Dissertation

Submitted to the
Combined Faculties for the Natural Sciences and for Mathematics
of the Ruperto-Carola University of Heidelberg, Germany

for the degree of

Doctor of Natural Sciences

Presented by

Md. Harun-or Rashid

born in Sherpur, Bangladesh

Date of oral examination:

Genetic diversity of rhizobia nodulating

lentils (Lens culinaris Medik.)

Referees: Prof. Dr. Michael Wink

Prof. Dr. Thomas Rausch

Acknowledgements

This thesis would not have been possible without the help of many people who
supported me and my work during my study period.

I express my deepest gratitude to my supervisors Prof. Michael Wink and Prof. Thomas
Rausch for accepting me as Ph.D. student and for providing all necessary support to
finish my research project. I owe my deepest gratitude to both of them for their critical
advice and enormous support during my study period.

I am grateful to Prof. Michael Wink for freedom in research, scientific guidance,

confidence and encouragement. It was a g reat pleasure for me to work on r hizobia
project in his laboratory.

I am grateful to Prof. Thomas Rausch for his inspirations, critical suggestions for
research and general administration, and for providing research facility at glasshouse
condition.

I am grateful to my wife, Afrid Akter for her limitless inspiration, understanding, sacrifice
and taking care of my children in Bangladesh during my study at Heidelberg University.

I am deeply indebted to the EMMA authority for providing a scholarship to me for doing
my Ph.D. at Heidelberg University. I appreciate the help from the Bangladesh
Agricultural Research Council, Bangladesh for providing partial funding for the field
work in Bangladesh and the DAAD-STIBET program authority for providing a t hesis
completion grant to me.

I would like to thank Prof. J.P.W. Young, University of York (UK) for providing
reference strains and critical suggestions to my work. I am grateful to Dr. Holger
Schäfer for his nice cooperations regarding collections of primers, chemicals, soil
samples and fruitfull discussions during my study period. I would like to thank Dr. Javier
Gonzalez for his critical comments and suggestions regarding phylogenetic
interpretations and software use. Special thanks to Markus Santhosh Braun for his nice
cooperation for solving many problems related to German language and g eneral
administration during laboratory work, summary writing and daily life.

I would like to show my gratitude to Prof. M. A. Hashem, Bangladesh Agricultural

University and D r. M. A. Satter, Director General, Bangladesh Institute of Nuclear

i
Agriculture for encouraging me to do my research project in Germany. I am grateful to
my friend Dr. Martin Krehenbrink, Chief technical officer, CYSAL, Germany, for
improving language and fruitful discussion while writing up my thesis.

I would like to show my gratitude to Polash Sarker, Agriculture Officer, Dhaka, Nazim
Uddin Shakh, Deputy Director, BADC, E arshad Ali, SSAE, Rajshahi, Golam Rasul,
ASO and Shahin Akther, ASO, BINA, for their help to collect field grown lentil nodules
from Bangladesh.

Several people have contributed to collect soil samples from Germany, Turkey and
Syria. I am grateful to all of you: Heidi Staudter, Annika Heinemann, Vanessa Erbe,
Johannes Reiner and Beate Waibel from Germany, Razan Hamoud, Shirin Hamoud
and R asha Abou Aleinein from Syria ,and Dr. Tamer Albayrak from Turkey for your
important contribution for making a good story about my research project. I am grateful
to Dr. Sabine Grube, Hoehenheim Unversity, Mr. Woldae Mammel, president
(Vorsitzender) of the Friends Association (Förderverein), Alblinsen and Mr. Markus
Santhosh Braun for their help to collect field grown lentil nodules from Germany.

I am grateful to Heidi Staudter and Hedwig Sauer-Gürth for their lot of help and
technical assistance to my laboratory work. Thank to Astrid Backhaus and Dieter
Holzmann for their general help to my laboratory work. Special thank to Michael
Schilbach at COS for his technical assistance during my work at glasshouse conditions.
I would like to thank Mr. Philipp Kremer for helping in the mapping of sampling
localities. I am indebted to my colleagues to support me during my study period. I would
like to thank our secretary Petra Fellhauer for her lots of help and nice cooperations
during my study period.

This work has been performed according to Bangladesh and German law.

Md. Harun-or Rashid

ii
Table of contents
Acknowledgements………………………………………………………………………. i
Summary…………………………………………………………………………………... v
Zusammenfassung………………………………………………………………………. vi
1. Introduction…………………………………………………………………………….. 1
1.2 Rhizobia………………………………………………………………………………. 1
1.2 Legume-Rhizobium symbiosis……………………………………………………… 1
1.3 Lentil cultivation status in different countries……………………………………… 2
1.4 Taxonomy of bacteria……………………………………………………………….. 5
1.5 Rhizobial taxonomy…………………………………………………………………. 6
1.6 Taxonomy of rhizobia (α-rhizobia)…………………………………………………. 7
1.7 Revisions in rhizobial taxonomy…………………………………………………… 8
1.8 Ambiguity in Agrobacterium-Allorhizobium-Rhizobium…………………………. 8
1.9 Taxonomy of β-rhizobia…………………………………………………………….. 9
1.10 Molecular Phylogeny……………………………………………………………… 9
1.10.1 Overview of molecular phylogenetics…………………………………………. 9
1.10.2 Advantages of molecular data………………………………………………….. 10
1.11 Phylogeny of bacteria and rhizobia………………………………………………. 10
1.12 Phylogenetic inference……………………………………………………………. 12
1.12.1 Steps in phylogenetic analyses………………………………………………… 13
1.12.2 Selection of phylogenetic markers……………………………………………… 13
1.12.3 Sequencing of molecules……………………………………………………….. 14
1.12.4 Multiple sequence alignment and software……………………………………. 14
1.12.5 Phylogenetic tree reconstruction methods…………………………………….. 15
1.12.6 Distance matrix method…………………………………………………………. 15
1.12.7 Maximum parsimony method…………………………………………………… 15
1.12.8 Maximum likelihood method……………………………………………………. 16
1.12.9 Bayesian inference……………………………………………………………… 17
1.13 Reliability of phylogenetic tree……………………………………………………. 17
1.13.1 Bootstrapping……………………………………………………………………... 17
1.13.2 Tree rooting……………………………………………………………………….. 18
1.13.3 Model selection…………………………………………………………………… 19
1.14 Bacterial speciation and recombination………………………………………….. 19
1.15 Multi locus sequence analyses…………………………………………………… 20
1.16 Symbiotic genes for phylogenetic analyses…………………………………….. 20
1.17 Nodulation mechanism……………………………………………………………. 21
1.18 Coevolution and dispersion of rhizobia…………………………………………. 22
1.19 Symbiosis between rhizobia and lentil………………………………………….. 23
1.20 Benefit of lentil-rhizobia symbiosis……………………………………………….. 23
1.21 Previous work on lentil nodulating rhizobia……………………………………… 25
1.22 Research strategy………………………………………………………………….. 25
1.23 Objectives…………………………………………………………………………… 25
2. Materials and Methods……………………………………………………………….. 27
2.1 Sources of nodule samples and their collection localities……………………….. 27
2.2 Isolation rhizobia from nodules and their preservation…………………………... 27
2.3 Phenotypic characterization……………………………………………………….. 28
2.4 Nodulation and cross-inoculation tests……………………………………………. 31
2.5 Symbiotic effectivity test……………………………………………………………. 32
2.6 DNA extraction, gene amplification and sequencing……………………………. 33
2.7 Genomic fingerprinting by ERIC-PCR…………………………………………….. 35
2.8 Processing of sequence data……………………………………………………… 36
iii
2.9 Phylogenetic analyses……………………………………………………………… 36
2.10 Population genetic analyses……………………………………………………… 37
2.11 Recombination and mutation analyses………………………………………….. 37
2.12 Apparatus, instruments, chemicals, solutions used in this study……………... 38
Research projects………………………………………………………………………... 41
3.1 Project 1: Genetic diversity of rhizobia nodulating lentil (Lens culinaris) in 41
Bangladesh…………………………………………………………………………..
3.1.1 Abstract…………………………………………………………………………….. 41
3.1.2 Introduction………………………………………………………………………… 42
3.1.3 Materials and methods……………………………………………………………. 44
3.1.4 Results……………………………………………………………………………… 45
3.1.5 Discussion…………………………………………………………………………. 60
3.2 Project 2: Rhizobium leguminosarum symbiovar viciae is the symbiont of 74
lentils in the Middle East and Europe but not in Bangladesh……………………
3.2.1 Abstract……………………………………………………………………............. 74
3.2.2 Introduction………………………………………………………………………… 75
3.2.3 Materials and methods……………………………………………………………. 77
3.2.4 Results……………………………………………………………………………… 79
3.2.5 Discussion…………………………………………………………………………. 97
4. Conclusions and general discussion………………………………………………... 105
4.1 Genetic diversity of rhizobia nodulating lentil in Bangladesh………………….. 105
4.2 Origin of rhizobia nodulating lentil in Bangladesh………………………………... 106
4.3 Genetic diversity of lentil-nodulating rhizobia from the Middle East and 106
Germany are greatly influenced by recombination……………………………….
4.4 Species delineation of lentil rhizobia………………………………………………. 107
4.5 Rhizobium leguminosarum is the original symbiont of lentils…………………… 107
4.6 Genetic diversity of nodulation genes……………………………………………... 108
4.7 Specific conclusion………………………………………………………………….. 109
5. References…………………………………………………………………………….. 110
6. Appendixes…………………………………………………………………………….. 129

iv
Summary

Lentil is not only the oldest legume crop but also the oldest of the crops that have been
domesticated in the Fertile Crescent and distributed to other regions during the Bronze
Age, making it an i deal model to study the evolution of rhizobia associated with crop
legumes. This study investigates lentil-nodulating rhizobia from the region where lentil
originated (Turkey and Syria) and from regions to which lentil was introduced later
(Germany and Bangladesh). There are few studies on lentil-nodulating rhizobia, and no
phylogenetic studies on lentil rhizobia using multi locus sequence analyses. Therefore,
rhizobia from lentil nodules were chosen to study 1) the genetic diversity 2) the
taxonomic position and 3) the transmissible nature of nodulation genes. I have
sequenced four housekeeping genes (16S rRNA, recA, atpD, glnII) and three
nodulation genes (nodA, nodC, nodD) and analyzed these using phylogenetic and
population genetic approaches to achieve these objectives. To supplement these
approaches I have also used DNA fingerprinting and p henotypic characterization.
Moreover, the symbiotic performance was assessed by nodulation and cross
inoculation tests. I identified four different lineages of rhizobia associated with lentil, of
which three are new and endemic to Bangladesh, and one lineage was found in the
Mediterranean region and C entral Europe. The new lineages from Bangladesh are
close to Rhizobium etli and correspond to new species in the genus Rhizobium. The
endemic lentil grex pilosae may have played a significant role in the origin of these new
lineages in Bangladesh. The single lineage from the Mediterranean and Central Europe
belongs to Rhizobium leguminosarum. The association of Rhizobium leguminosarum
with lentil at the centre of lentil origin and in countries where lentil was introduced later
suggests that Rhizobium leguminosarum is the original symbiont of lentil. Lentil seeds
might have played a significant role in the initial dispersal of Rhizobium leguminosarum
within the Middle East and on to other countries. Analysis of nodulation genes showed
that they are prone to horizontal transfer between different chromosomal lineages and
sub-lineages of rhizobia. Nodulation genes showed bias to their geographical origin,
evidencing that plasmid-borne characters in bacteria rapidly change according to their
adaptation to particular environment.
Key words: Rhizobium, Lens culinaris, nodulation, multilocus analysis, fingerprint,
phylogeny

v
Zusammenfassung

Die Linse ist die älteste Hülsenfrucht und zugleich die älteste der im Fruchtbaren
Halbmond domestizierten Kulturpflanzen. Im Bronzezeitalter wurde sie in andere
Regionen eingeführt, was sie zu einem idealen Studienobjekt der Evolution von mit
Kulturpflanzen assoziierten Rhizobien macht. Diese Arbeit untersucht knöllchenbildende
Rhizobien der Linse aus den Ursprungsländern (Türkei und Syrien) und aus Gebieten, in
die sie erst später eingeführt wurde (Deutschland und Bangladesch). Bislang gibt es nur
wenige Studien an K nöllchenbakterien von Linsen; Untersuchungen, phylogenetische
Analysen mit Hilfe des Multi Locus Sequencing existieren nicht. Aus diesem Grund
wurden aus Linsenknöllchen stammende Rhizobien gewählt, um 1) deren genetische
Vielfalt, 2) ihre taxonomische Position und 3) die Übertragbarkeit von Nodulationsgenen
zu untersuchen. Um diese Ziele zu erreichen, habe ich vier Haushaltsgene (16S rRNA,
recA, atpD, glnII) und drei Nodulationsgene (nodA, nodC, nodD) sequenziert und diese
mittels phylogenetischer und p opulationsgenetischer Methoden analysiert. Ergänzend
habe ich DNA-Fingerprints erstellt und die Rhizobien phänotypisch charakterisiert.
Zusätzlich wurde die symbiotische Effizienz durch Nodulationstests und
Kreuzbeimpfungen bestimmt. Ich habe vier unterschiedliche Abstammungslinien von
Linsen-Rhizobien identifiziert. Drei davon waren bislang unbekannt und sind in
Bangladesch endemisch. Die verbleibende kommt im Mittelmeergebiet und Mitteleuropa
vor. Die neuen A bstammungslinien aus Bangladesch sind nahe Verwandte von
Rhizobium etli und bilden innerhalb der Gattung Rhizobium drei neue Arten. Die
endemische Linsengrex pilosae könnte eine entscheidende Rolle hinsichtlich des
Ursprungs der neuen A bstammungslinien Bangladeschs gespielt haben. Die
Abstammungslinie der Mittelmeergebiete und Mitteleuropas gehört zu Rhizobium
leguminosarum. Das Vorkommen von Rhizobium leguminosarum an Linsen im Kern des
Ursprungsgebiets der Pflanze und in Ländern, in die die Linse später eingeführt wurde,
lässt vermuten, dass Rhizobium leguminosarum der ursprüngliche Symbiont dieser
Kulturpflanze ist. Linsensamen könnten für die Verbreitung von Rhizobium
leguminosarum in den N ahen Osten und andere Länder entscheidend gewesen sein.
Die Analyse der Nodulationsgene hat gezeigt, dass leicht ein horizontaler Gentransfer
zwischen unterschiedlichen chromosomalen- und Sub-Abstammungslinien von
Rhizobien stattfinden kann. Die Variabilität der Nodulationsgene wies eine Korrelation
mit deren geographischen Ursprung auf, was zeigt, dass sich durch Plasmide verliehene
Eigenschaften von Bakterien schnell an ihre spezielle Umgebung anpassen.

vi
This thesis is based on the following manuscripts:

1. Rashid MH, Schafer H, Gonzalez H & Wink M (2012) Genetic diversity of

rhizobia nodulating lentil (Lens culinaris) in Bangladesh. Syst Appl Microbiol
35: 98 – 109.

2. Rashid MH, Gonzalez H, Young JPW and Wink M (2013) Rhizobium leguminosarum
symbiovar viciae is the symbiont of lentils in the Middle East and Europe but not in
Bangladesh. Submitted to the “FEMS Microbiology Ecology” (under review).

vii
1. Introduction

1.1 Rhizobia
Nitrogen is an essential nutrient for all living organisms and necessary for the production
of high-yield and high-quality agricultural crops. Although molecular nitrogen (N2) is the
most abundant gas in the atmosphere, it is unavailable to plants in its elemental form.
Rhizobia are a group of bacteria that have the capacity to form nodules on legume roots
(and occasionally on stems) and can fix atmospheric nitrogen to partially or fully meet the
nitrogen requirements of the host plant. To describe bacteria from root nodules, Frank
(1889) proposed name “rhizobia”, and after this proposal all nodule-forming bacteria
have been k nown as rhizobia. Biological nitrogen fixation (BNF: atmospheric nitrogen
fixation through different members of prokaryotes, specifically by diazotrophs)
contributes approximately 16% of total nitrogen input in crop land (Ollivier et al., 2011).
Rhizobia are a major contributor to BNF, and the legume-rhizobium symbiosis can fix up
to 450 Kg N/ha/year (Unkovich & Pate, 2000). Rhizobia as a group are not monophyletic
and have been classifed as α and β rhizobia (Moulin et al., 2002). Already 163 species
from 12 genera (http://edzna.ccg.unam.mx/rhizobial-taxonomy) have been d escribed.
However, further study of the genetic diversity of rhizobia helps to understand the
evolutionary histories of the legume-rhizobium symbiosis and helps to devise effective
planning strategies to achieve the maximum benefit from legume-rhizobium symbiosis.

1.2 Legume-Rhizobium symbiosis

Legumes are the third largest flowering plant family, containing 700 genera and ab out
20,000 species. It is an extremely diverse plant family with a great number of different
characters, and a few characters are common to all species. Nodulation is an important
characteristic of majority legumes but it is absent in the earliest divergent lineages of this
family. Legume evolved about 65 MYA and nodulation have evolved in legumes after the
origin of this family approximately 30 MY (Lavin et al., 2005; Bruneau et al., 2008; Doyle,
2011) later.

Nodulation is a complex issue and there is no simple explanation for its origin (Doyle,
1998; 2003; Sprent, 2001). Nodulation takes place in the legume sub-family
Papilionoideae and Mimosoideae, and in the tribe Caesalpinieae and c ore Cassieae.
Most of the members of the Papilionoideae and about 90% of the Mimosoid members
are thought to be nodulated by rhizobia for nitrogen fixation (Doyle, 2011). Nodulating or

1
non-nodulating legumes have a high demand for nitrogen, largely in the leaf where
photosynthesis or the accumulation of nitrogen-rich defensive compounds occurrs.
Hence, it has been concluded that legumes owe their evolutionary success to nodulation
and subsequent access to atmospheric nitrogen (McKey, 1994).

Rhizobia produce nodulation (nod) factors after a specific interaction with their host plant,
and thus it has been assumed that rhizobia have coevolved with their host plants (Perret
et al., 2000). The strong correlation between host plant and nodulation genotypes
denotes the importance of the host on nodulation genotypes (Young & Wexler, 1988;
Laguerre et al., 1992; 1993; Black et al., 2012). However, from two model legumes,
Lotus japonicus and Medicago truncatula, 26 genes have been cloned which are
involved in recognition of rhizobia, the nodulation signal cascade, infection, the
nodulation process and the regulation of nitrogen fixation (Kouchi et al., 2010; and
reference therein). However, host association also is important for shaping the genetic
divergence of nodulation and h ousekeeping genes in rhizobia (Wernegreen & Riley,
1999).

1.3 Lentil cultivation status in different countries

Root-nodulating bacteria were first described from different members of the legume tribe
Vicieae. The tribe Vicieae is composed of several closely-related genera with many
intermediate forms. Therefore, this tribe contains several newly proposed genera.
However, there are four well-recognized genera such as Vicia, Lathyrus, Pisium and
Lens in the tribe Vicieae.

Lentil (Lens culinaris) is an i mportant and popular legume employed for human and
animal nutrition, and soil fertility management. Lens is a Latin word, which describes the
shape of cultivated lentil seeds. The word and seed are very distinct from other legumes,
and it is therefore easy to identify lentil from historical texts and archeological sites
(Cubero, 1981; and references therein). Lentil were domesticated in the Fertile Crescent
around 9,000 years ago (Toklu et al., 2009; and reference therein) and remains an
important seed legume crop cultivated worldwide (Sarker & Erskine, 2006). The region
for the domestication of lentl consists of Southeastern Turkey and N orthern Syria,
including the sources of the Tigris and t he Euphrates rivers (Lev-Yadun et al., 2000).
Lens culinaris is the putative ancestor of domesticated lentil (Barulina, 1930; Cubero,
1981).The taxonomy of cultivated lentil subspecies and grex is shown in table 1 (after
Cubero, 1981):
2
Table 1. Taxonomy of cultivated lentil

Species Subspecies Race Grex

nigricans
Lens culinaris macrosperma europeae

asiaticae
microsperma
intermediae
subspontaneae
orientalis
aethiopicae
pilosae
culinaris

After domestication in the cradle of agriculture, lentil spread to Cyprus in the Neolithic
(Erskine et al., 1994). Lentil disseminated from Southeastern Europe to Central Europe
around the 5,000 years BC via the Danube. From Europe, it dispersed to the Nile Valley
and from there to Ethiopia. However, in Georgia, lentil was propagated during the 5,000
and 4,000 years BC and in the Indian sub-continent around 2,500 – 2,000 years BC
(Sonnante et al., 2009; and r eferences therein). Lentil is now grown all over the world
(Indian sub-continent, Middle East, North Africa, South Europe, the North and South
America and Australia, Chahota et al., 2007).

Lentil cultivation in Bangladesh

Legumes play an important role in agriculture and daily diet in Bangladesh. Around 5.2%
of cultivable lands are subject to legume cultivation (Rahman et al., 2009). Because poor
people cannot afford expensive fish and meat, pulses have been known for a long time
as the “meat of the poor people” in Bangladesh. Although legumes have been grown in
Bangladesh for a long time, farmers have largely been cultivating pulse legumes without
applying major agricultural inputs like fertilizers, irrigation and plant protection. A number
of pulse crops like vetch (Lathyrus sativus L.), lentil (Lens culinaris, Medic), chickpea
(Cicer arietinum L.), black gram (Vigna mungo L.), mung bean (Vigna radiata L.), and
cowpea (Vigna unguiculata L.) are grown in Bangladesh. Among these crops, lentil is the
most popular and has been cultivated since ancient times. In 2010, lentil was grown on
9,199 hectares of land and the total production was 71,100 tonnes (FAOSTAT-
Agriculture, 2010). The grex pilosae in the race microsperma of Lens culinaris is the only
3
cultivated lentil in Bangladesh (Dr. A. Sarker, Dr. A. Rahman and Dr. M. A. Samad,
personal communication).

Lentil cultivation in Germany

Germany has a history of cultivation of different pulse crops like dry bean, horse bean,
lupin, pea and lentil. In 2010, about 103,800 hectares of land were used for different
pulse crop production in Germany. Of the area cultivated with legumes (0.3% of the total
cultivated area, http://www.aid.de) about 17,200 hectares were used for pea production
(FAOSTAT-Agriculture, 2010). In 2012 about 200 hectare of land was under lentil
cultivation in Germany (Dr. Sabine Gruber; Mr. Woldemar Mammel, personal
communication). For several decades, little attention was paid to lentil cultivation and
research in Germany. Nowadays, there is an increasing market for high-priced lentil in
Germany. Considering the various advantages like nitrogen fixation potential, high
nutritive values and essentiality for mix cropping, more and more farmers are beginning
to reintroduce lentil to German organic farming, and scientists are paying more attention
to lentil research (Wang et al., 2012).

Lentil cultivation in Syria

Different pulse legumes like bean, broad bean, chickpea, lentils, lupin, pea and vetch are
grown in Syria (FAOSTAT-Agriculture, 2010). Lentil is an important pulse crop in Syria. It
does not only provide cheap dietary protein but also plays significant role for farm land
and farmers. Moreover, lentil cultivation is an integral part of crop rotation to maintain soil
fertility and as sures that farmers are getting a higher more economic return from
cultivation. Among the different provinces, Aleppo, Idlib, Al Hasakah and Hama are the
main (80%) lentil producers in Syria, though Damascus and As Suwayda also contribute
(20%) to the national production (www.houseoflentils.com). In 2010, about 242,620
hectares were used for legume production and 131,100 hectares were used for lentil
cultivation (FAOSTAT-Agriculture, 2010).

Lentil cultivation in Turkey

Since ancient times, pulses have been cultivated and consumed in large quantities in
Turkey. Turkey is also the third largest lentil producing country in the world after India
and Canada (FAOSTAT-Agriculture, 2007). Major pulses like lentil, chickpea, white
bean, red bean, broad bean and vetch have been grown in Turkey

4
(www.economy.gov.tr; FAOSTAT-Agriculture, 2010), but pulse production is significantly
influenced by lentil production (http://www.invest.gov.tr/en). About 895,689 hectares of
land are used for the production of different pulses and 234,378 hectares were used for
lentil cultivation in 2010 (FAOSTAT-Agriculture, 2010). Although pulse cultivation is
distributed throughout Turkey, some regions are important for specific pulse crops. For
example, red lentil is grown in the Southeast Anatolia, green lentil, chickpea and dr y
bean are grown in central Anatolia, and broad bean and dry pea are cultivated in the
Aegean and Marmara regions (www.economy.gov.tr). Although macrosperma is the
dominating race in Turkey, the microsperma race is also available in some regions like
South Turkey (Toklu et al., 2009).

1.4 Taxonomy of bacteria

Systematics is the branch of biology which deals with the classification of living
organisms by describing their diversity and relationships to one another. Systematics has
three major divisions; taxonomy, classification and phylogenetics (Wink, 2007).

A group of organism which is specifically defined on t he basis of certain characters is

known as a taxon, and the description and naming of taxa is known as taxonomy.
Taxonomy organizes different taxa on t he basis of their similarity and is therefore
important for the identification of organisms at field level. However, taxa may not always
reflect the evolutionary relationship of organisms. As for eukaryotes there are different
levels in bacterial taxonomy, although kingdoms have not been proposed for bacteria. In
bacterial taxonomy the topmost level is the domain, which is followed by phylum, family,
genus, species and sub-species (Brenner et al., 2005). However, taxonomy is not fixed,
but rather always prone to change with the development of new ideas. To implement a
new idea it is necessary to change the taxonomy, and subsequently changes have
occurred in classification, nomenclature and identification.

There are three major concepts for defining species, such as the typological
/morphological concept, the biological species concept, and the phylogenetic
/evolutionary species concept. According to the morphological species concept, a
species combines a group of organisms based on s ufficiently close, shared and fixed
morphological or anatomical properties. In the biological species concept (Mayr, 1963), a
species is a group of populations whose members can potentially inbreed and are
reproductively isolated from others group.

5
The phylogenetic species is the most recent concept. In this concept, a species is a
group of organisms that share a common ancestor and can be separated from other
species by distinctive characters. The evolutionary species concept describes that
maintain integrity from other lineages through both time and space. During evolution,
members of the lineage can diverge and become an independent species (Wink, 2007 ;
and references therein).

Phylogenetics is the field of biology that deals with identifying and understanding the
evolutionary relationships between different kinds of life on Earth, and is the basis for
evolutionary systematics. Classification is the organization of information about diversity,
and arranges organisms into a c onvenient hierarchical system such as the Linnean
system.

1.5 Rhizobial taxonomy

From the very begening of bacterial taxonomy, rhizobial taxonomy was significantly
influenced by the nodulating host. In the initial classification of bacteria ( Bergey et al.,
1923 ), rhizobia were described as Gram-negative, aerobic, non-spore forming bacteria,
and the main criterion was their ability to nodulate.

Fig. 1. Distribution of root-nodulating bacterial genera (bold font) in different classes of Proteobacteria in
an unrooted phylogenetic tree based on 16S rDNA sequences (Masson-Boivin et al., 2009). Root
nodulating bacteria are distributed mainly in the classes’ α-proteobacteria and β-proteobacteria. A few γ-
proteobacteria have also been isolated from nodules. For example, bacteria belonging to γ-proteobacteria
have been isolated from the nodules of Arachis hypogea, but these failed Koch’s postulates under
laboratory conditions (Ibañez et al., 2009).

6
For a long time, it had been assumed that all nodulating bacteria came from the α-
proteobacteria, but recently a number of bacteria from the β-proteobacteria were found
to also show nodulation capacity, and recently rhizobia have been classified as α-
rhizobia and β-rhizobia (Moulin et al., 2002).

1.6 Taxonomy of rhizobia (α-rhizobia)

In Bergey’s original manual, bacteria were included in rhizobia if they showed nodulation
capacity, while bacteria with the same morphological characters that did not nodulate
were excluded. L ater, nodulation host range and behavior on growth media were also
considered (Baldwin & Fred, 1929; Fred et al., 1932) for rhizobial classification. Based
on growth behavior on media, Fred et al. (1932) classified rhizobia as either fast growing
and slow growing rhizobia (Young, 1996; and references therein).

Although the transferable nature of plasmids and plasmid-borne genes were well known
to scientists (Zurkowski & Lorkiewicz, 1976; and reference therein), plasmid-borne
character like nodulation capacity was dominant in rhizobial taxonomy for a long time.
For example, six rhizobial species were included in the genus Rhizobium by Jordan and
Allan (1974) in the first Bergey manual of determinative bacteriology based on t heir
nodulation host. In the first published valid list of bacterial species (Skerman et al., 1980)
four rhizobial species (Rhizobium leguminosarum, Rhizobium phaseoli, Rhizobium trifoli
and Rhizobium meliloti) were included, and their names were assigned based on the
nodulated host. I n 1975, the International Committee of Systematic Bacteriology
proposed a minimum standard for describing new taxa (species). Following the code of
nomenclature for bacteria, Jordan (1984) used the idea of numerical taxonomy, DNA GC
content, serological response, extracellular composition, carbohydrate utilization pattern,
metabolism type, bacteriophage and antibiotic susceptibility, protein composition and
bacteroid type to propose the new genus Bradyrhizobium in the family Rhizobiaceae and
rearrange previously described species. The previously described three species R.
leguminosarum, R. trifoli, and R. phaseoli were combined together into the single
species R. leguminosarum. Two other species, R. meliloti and R. loti, remained in the
genus Rhizobium but all slow-growing rhizobia were transferred to the genus
Bradyrhizobium (Jordan, 1984).

The international sub-committee on taxonomy of Rhizobium and Agrobacterium

(http://edzna.ccg.unam.mx/rhizobial-taxonomy/node/4) is curating information about root
nodulating rhizobia. According to this, 145 bacterial species that form nodules with
7
different legumes have been described in the genera Agrobacterium (Conn, 1942),
Allorhizobium (de Lajudie et al., 1998), Azorhizobium (Dreyfus et al., 1988),
Bradyrhizobium (Jordan, 1982; 1984), Ensifer (Chen et al., 1988; Scholla & Elkan, 1984)
and Rhizobium (Frank, 1889).

1.7 Revisions in rhizobial taxonomy

A valid list of bacterial species was first published in 1980 by Skerman et al. (1980), and
from this year it became a requirement to publish or validate all newly described bacterial
species in the IJSEM journal. The proposal of Jordan (1984) for the new genus
Bradyrhizobium and the rearrangement of the previously described species were
published in Bergey’s manual, but not validated in the IJSEM journal. Therefore, the
previously described species remained valid until 2008, when (Ramírez-Bahena et al.,
2008) revised the taxonomic status of R. trifoli, R. phaseoli and R. leguminosarum. They
merged R. trifoli into R. leguminosarum but retained R. phaseoli as a separate species
(Rivas et al., 2009; and references therein).

1.8 Ambiguity in Agrobacterium-Allorhizobium-Rhizobium

All described species in the genus Agrobacterium are named and included in this genus
on the basis of plasmid-borne characters like tumorigenesis, pathogenicity, and
rhizogenicity. Plasmids and plasmid-borne genes are not stable characters but are
exchangeable among closely-related and even distantly-related bacterial species or even
with plants (for example Agrobacterium tumafaciens is very useful for transferring DNA
to plants). There are several studies reporting ambiguity between Rhizobium and
Agrobacterium (Graham & Parker, 1964; White, 1972; Graham, 1976; Sawada et al.,
1993; Young & Haukka, 1996; Willems, 2006). Nowadays, taxonomists are trying to
establish a natural classification of microorganisms by describing stable characters that
avoid ambiguity. Therefore, it has been proposed to merge Agrobacterium and
Allorhizobium with Rhizobium (Young et al., 2001). After several proposals for the
revision of the three genera Rhizobium, Allorhizobium and Agrobacterium, the proposal
of Young et al. (2001) has been accepted and Agrobacterium and Allorhizobium have
now been included in the genus Rhizobium.

8
1.9 Taxonomy of β-rhizobia
Rhizobia as a group are not monophyletic but contain diverse species of phylogenetically
disparate bacteria. In total, eighteen published species have been validly described as
β-rhizobia so far under the genera: Aminobacter (Urakami et al., 1992), Burkholderia
(Yabuuchi et al., 1992), Cupriavialus (Makkar & Casida, 1987), Devosia (Nakagawa et
al., 1996), Herbaspirilum (Baldani et al., 1986) Mesorhizobium (Jarvis et al., 1997),
Methylobacterium (Patt et al., 1976), Microvigra (Kanso & Patel, 2003), Ochrobactrum
(Ngom et al., 2004), Phyllobacterium (Knösel et al., 1984) and Shinella (An et al., 2006).

Although β-rhizobia have only recently been described from different legumes, molecular
evidence showed that as legume symbionts they have existed for 50 m illion years
(Gyaneshwar et al., 2011; and references therein). Different species of rhizobia from β-
proteobacteria contain common nodulation genes (nodABC, nodD, nifH) that are very
similar to ‘traditional’ rhizobial (α-proteobacteria) symbiotic genes. Therefore, it has been
hypothesized that β-rhizobia recruited symbiotic genes (Rivas et al., 2009) by horizontal
gene transfer.

1.10 Molecular Phylogeny

1.10.1 Overview of molecular phylogenetics

The study of evolutionary relationships between organisms using molecular data (DNA,
RNA or protein sequences) is known as molecular phylogenetics. Zuckerkandl & Pauling
(1965) proposed the concept of theoretical phylogenetic reconstruction, which views
macromolecules as documents of evolutionary history that may therefore help to
reconstruct phylogenies. They also introduced the “molecular clock concept”, i.e. the
idea that random changes in nucleotide or amino acid sequences occur at more or less
constant rates, so that the number of differences between two molecules with conserved
function from two organisms should be approximately proportional to the evolutionary
time that has passed since divergence.

A phylogenetic tree is a diagram composed of nodes and branches, with the nodes
connecting any adjacent branches. Branches represent taxonomic units that could be
species, populations or individuals. Relationships between taxonomic units are defined
by branches in terms of descent and anc estry; this branching pattern is known as the
tree topology (Graur & Li, 2000). Following a cladistic approach only monophyletic
groups derived from a common ancestor, should form taxonomic units such as genera,
9
tribes, families, species or subspecies (Wink, 2007; and reference therein). Monophyly,
paraphyly or polyphyly may be inferred from phylogenetic analyses (Henning, 1966).
Monophyletic and paraphyletic groups have a single evolutionary origin. Polyphyletic
groups are the result of convergent evolution, and the main characteristic used to define
the group is absent in the most recent common ancestor and consist of a hodgepodge of
unrelated forms (Henning, 1966).

1.10.2 Advantages of molecular data

Molecular data, especially DNA, RNA and amino acid sequences, are much more
reliable for evolutionary studies than morphological and physiological data.
Morphological data can be convergent and is adaptive in nature (Wink, 2007), while
molecular data are strictly heritable and less prone to convergence. DNA sequence is
relatively resistant to change because of various repair and proofreading systems.
Description of molecular data is straightforward and defined, while morphological
descriptions always contain ambiguous modifiers such as ‘thin’, ‘reduced’, ‘slightly
elongated’, ‘partially enclosed’, or ‘somewhat flattened’. More importantly, molecular
traits evolve in a much more regular manner than morphological and physiological traits,
and hence a much clearer relationship can be inferred from DNA, RNA or amino acid
sequences. Nonetheless, sophisticated mathematical and statistical models have been
developed to analyze molecular data (Nei & Kumar, 2000). Finally, molecular data are
abundant in public databases and much more accessible than morphological data.
Prokaryotes have very little morphological and phy siological variation for use in
phylogenetic studies (Nei & Kumar, 2000). The aforementioned molecular characters are
thus particularly important for studying the phylogenetics of microorganisms such as
Bacteria and Archaea.

1.11 Phylogeny of bacteria and rhizobia

In 1930, many famous scientists (Albert Jan Kluyver, Cornelius Van Niel and Roger Yate
Stanier) initially reconstructed bacterial phylogenies on the basis of morphological
characters of the cells (Oren, 2010; and references therein), and during the 1940’s the
use of morphological and phy siological characteristics for bacterial phylogentic
reconstruction had become common place, scientists started to use. Soon after, many
prominent scientists [Stainer (1916 – 1989); Nile (1897 – 1985); Ernst Georg Pringsheim
(1881 – 1970); Sergei Winogradsky (1856 – 1953)] already realized that morphological

10
and physiological properties were insufficient to construct a natural taxonomy of bacteria,
but had not yet found a viable alternative (Oren, 2010; and reference therein). Because
of this difficulty, this period became known as “the Dark age” of bacterial phylogeny (
Woese et al., 1984).

The development of protein and nucleic acid sequencing technology in 1978

revolutionized all aspects of biological research. Woese and his colleagues obtained
surprising phylogenetic results using sequencing techniques, which became the ultimate
starting point for the comparison of 16S and 18S rRNA genes from prokaryotes and
eukaryotes (Fox et al., 1977). During the 1970’s, Carl Richard Woese (1928 – 2012)
proposed his famous three domain model of life based on nucleotide sequence of 16S
rRNA: Archaebacteria, Eubacteria and Eukaryotes (Woese & Fox, 1977). The concept of
“three domains of life” is now well accepted by the scientific community, with very few
exceptions.

Due to a lack of sufficient morphological and physiological variations, and availability of

sequencing facilities, microbiologists are now depending on m olecular data, especially
chromosomal DNA sequences, for taxonomic and systematic purposes. However,
phylogenetic analyses of different genes also help to understand the evolutionary history
of single genes or entire genomes of microorganisms, and hence microbiologists from
the fields of systematics, taxonomy and epi demiology are using DNA sequences
substantially. Nowadays, it is clear that any phylogenetic hypothesis has to be accepted
or rejected on the basis of molecular sequences.

Although rhizobial characterization, classification and identification began on the basis of

nodulation capacity and morphological characteristics, analyses of the 16S rRNA gene
sequences later helped to eliminate plasmid-borne characters (nodulation, pathogenicity
or hairy root formation) and significantly contributed to the identification of non-traditional
rhizobia. Therefore, after the proposal of Woese et al. (1984) 16S rRNA gene
sequencing became a main criterion for rhizobial taxonomy, and nodulation became
secondary (Rivas et al., 2009).

Bacterial taxonomists suggest different methods for identifying bacterial species.These

methods include sequencing of the 16S rRNA gene, restriction fragment length
polymorphism (RFLP) typing, multilocus sequence analyses of different protein-coding
housekeeping genes (MLSA), whole-genome sequence analysis, fourier transformed
infrared spectroscopy (FTIR) and pyrolysis mass spectrometry. However, the

11
sequencing of housekeeping genes, DNA profiling and the application of DNA arrays are
preferred (Brenner et al., 2005; and references therein). There are also some powerful
PCR-based techniques like REP- and ERIC-PCR available for bacterial taxonomy, and
their discriminatory power is higher than serological, RFLP and multi locus enzyme
electrophoresis (MLEE) techniques (Vinuesa et al., 2005). However, for the description
of root- and stem-nodulating bacteria, a minimum standard has been pr oposed by
(Graham et al., 1991) who suggested to use a combination of traditional morphological
and culture characteristics, symbiotic properties, DNA fingerprinting methods, 16S rRNA
gene sequencing and DNA hybridization.

1.12 Phylogenetic inference

Evolution in different lineages does not accumulate changes at a uniform rate. In other
words, different branches may evolve at different rates of change. In a realistic evolution
scenario, variations in divergence rates could arise due to random changes, differences
in mutation rate and selective pressure. Thus, similarity alone may not be a good
indicator of the degree of relatedness. Therefore, it is important that reconstruction
methods consider variation in rates of divergence between lineages (Barton et al., 2007).

Bifurcation is a major assumption in phylogenetic reconstructions, but is not true in many

cases and can lead misinterpretations. For example, recombination is essential in the
sexual reproduction process, and combines and matches genetic variation in different
lineages. Therefore, the evolutionary histories for such lineages are not perfectly vertical,
and these histories cannot be r epresented correctly by bifurcating trees. Moreover,
lineages that have experienced hybridization and lateral gene transfer have exchanged /
transfered DNA between distinct lineages, and thus a bifurcating tree may show an
incorrect interpretation. Furthermore, gene duplication, deletion, domain shuffling and
gene conversion can create complex evolutionary scenarios (Barton et al., 2007).

Convergent and parallel evolution can cause different lineages to become more similar
to each other, at least for some features. Convergent evolution implies an independent
origin of derived characters in two or more lineages and is critical for phylogenetic
interpretation. Similarities between lineages that are not due to a common ancestor are
known as homoplasy. A degree of similarity may also be an indication of a common
ancestry and helps to infer monophyletic groups. Although shared derived character
states (synapomorphy) accurately indicate common ancestry, derived character states
restricted to specific lineage (autapomorphies) do not provide evidence for a relationship
12
with other lineages. Homologus character states mean that the character states shared
by all taxa inherited from a common ancestor to its descendents without change,
reflecting the real phylogeny (Futuyma, 2009). Therefore, shared derived characters
states are valid evidence of monophyletic groups only are if they are uniquely derived
(Barton et al., 2007).

The abovementioned problems and other complexities encouraged the development of

new methods for phylogenetic inference. However, none of the methods is perfect, and
each has its own strengths and weaknesses. Taking all challenges and caveats into
acconut, phylogenetic inference can be remarkably accurate, successful and useful
(Barton et al., 2007).

1.12.1 Steps in phylogenetic analyses

Four steps are necessary in phylogenetic analyses of molecular sequences. These are:
the selection of molecular markers, obtaining sequences from selected molecules, a
multiple sequence alignment and tree reconstruction.

1.12.2 Selection of phylogenetic markers

There are different mechanisms such as mutation, gene duplication, genome
reorganization, genetic exchange through recombination, reassortment and lateral gene
transfer contributing to molecular evolution in bacteria (Vandamme, 2009; and
references therein).

Information from substitutions, insertions, deletions is considered for phylogenetic

reconstructions. Single-copy orthologus genes are important molecular markers for
tracing phylogenetic relationships. Gene duplications, loss and acquired events occur
more frequently in multiple copy and non-essential genes. Hence, phylogenetic analyses
of multicopy and non-essential genes may give ambiguous relationships. Phylogenetic
markers with highly conserved regions also do not provide important information due to a
lack of variation, and highly-variable genes are subject to repeated mutations in the
same position. Hence, both are ignored for phylogenetic analyses (Chun & Hong, 2010;
and references therein).

13
1.12.3 Sequencing of molecules
Sequencing of selected genes, DNA fragments or whole genomes is important and
generally done by a Sequencer. DNA and RNA may be sequenced using targeted or
random approaches. In the targeted approach, specific genes or genetic elements are
selected from operational taxonomic units (OTUs) and amplified and sequenced using
specific primers to obtain nucleotide sequences. In a random approach, genome
sequencing methods are used to sequence random cDNA or genomic DNA regions, and
genes or elements of interest are identified from the obtained sequences using
computational search. For understanding genome evolution, whole genome sequencing
and metagenomic sequencing have recently introduced.

1.12.4 Multiple sequence alignment and software

The quality of the sequencing data and their alignment is very important for the
phylogenetic reconstruction and interpretation. Besides sequencing quality, the quality of
the alignment is also crucial, because phylogenetic reconstruction and c onclusions
depend heavily on correct sequence alignment (Ludwig, 2010). Direct correlations exist
between alignment errors and inaccurate phylogenetic interpretation (Kumar & Filipski,
2007).

In phylogenetic inference from sequence data, each position of the sequence can be
considered as independent character trait. Alignment is essential to identify homologus
positions in sequences by assigning each sequence is to a separate row and arranging
homologus positions in columns. An alignment therefore corresponds to a data matrix.
Each column in the alignment corresponds to homologus traits, and specific residues
(amino acid or nucleotide) represent the character states (Barton et al., 2007).

To obtain a good alignment of homologus protein-coding gene sequences from closely

related species is not difficult, as the presence of strong positive selective pressure on
homologus genes hardly permits their sequences to diverge from each other. It is much
more challenging to get a good alignment from distantly-related protein-coding genes
and from genes that have many insertions and deletions. Different software packages
are available to align sequences using different algorithms for inserting gaps. Although
gaps are introduced to increase sequence similarity, they do not guarantee perfect
matching. The manual and judicious insertion of gaps by a specialist is therefore
important for good alignment. Several algorithms are available for sequence alignment.

14
Among these, Clustal-X (Chenna et al., 2003) is widely used due to its ability to easily
produce high quality alignments.

1.12.5 Phylogenetic tree reconstruction methods

The main objective of phylogenetic analyses is to find the evolutionary relationships of
the studied organisms, which is generally represented as a phylogenetic tree. There are
four different methods for reconstructing phylogenetic trees: Distance matrix, Maximum
parsimony, Maximum likelihood, and Bayesian inference.

1.12.6 Distance matrix method

It is generally assumed that organisms having a recent common ancestor are more
similar than organisms that have a more distant common ancestor. Hence, it is possible
to deduce evolutionary relationships from the similarity of organisms. The distance
method uses this general principle for tree reconstruction. It consist of two steps:
calculation of genetic distances using appropriate substitution models (for example,
Jukes model (Jukes & Cantor, 1969); Kimura two parameter model (Kimura, 1980);
general time reversible model (Rodríguez et al., 1990) and tree reconstruction using
suitable clustering algorithms (UPGMA, Goodfelow, 1971); Neighbor-joining method (NJ,
Saito & Nei, 1987). Several modifications have been done in the NJ method to improve
the clustering performance (Gascuel, 1997; Bruno et al., 2000).

The distance method for tree reconstructions has some advantages, like being easy to
implement in computer programs and producing phylogenies within the shortest time
(Chun & Hong, 2010). The distance method always depends on pairwise distances,
which is not always favorable. The difference-based parameter D is not equivalent with
the evolutionary distance (d), because D does not consider all available information from
a sequence in the alignment. Moreover, most measures of D do not follow a linear scale
of time or number of generations. A true evolutionary distance is more linear, and allows
a clear phylogenetic inference (Barton et al., 2007).

1.12.7 Maximum parsimony method

The maximum parsimony method is also widely used. It uses character-based algorithms
rather than distances. According to this method, the best tree reconstruction method
uses the least number of changes to explain the information in an alignment (Hall, 2008).

15
In this method, uninformative sites (conserved sites, sites with apomorphic changes and
terminal changes) are not used for tree reconstruction.

To find the best tree, different algorithms, e.g. branch and bound algorithm (Land & Doig,
1960), are used. Several programs such as PAUP (Swofford et al., 1996); PHYLIP
(Felsenstein, 1985) or MEGA (Tamura et al., 2011), use the maximum parsimony
method for tree reconstruction. This method is however sensitive to long-branch
attraction (Bergsten, 2005), which is easily detectable by other methods.

1.12.8 Maximum likelihood method

To reconstruct a tree from DNA or RNA sequences, Felsenstein (1981) developed the
maximum likelihood (ML) method. This method depends on a purely statistical way of
constructing phylogenetic trees. It allocates probabilities for generating a particular tree
to all individual residues in a sequence alignment and hence utilizes information from all
nucleotides or amino acids. Maximum likelihood analyses depend on a substitution
model for the estimation of the probability of a given tree.

Swofford et al., (1996) mentioned that “Maximum likelihood methods of phylogenetic

inference evaluate a hypothesis about evolutionary history in terms of the probability that
a proposed model of the evolutionary process and the hypothesized history would give
rise to the observed data. It is conjectured that a history with a higher probability of giving
rise to the current state of affairs is a preferable hypothesis to one with a lower
probability of reaching the observed state. In addition to its consistency properties,
maximum likelihood is useful because it often yields estimates that have lower variance
than other methods (i.e., it is frequently the estimation method least affected by sampling
error). It also tends to be robust to many violations of the assumptions used in its
models”. Moreover, Harrison & Langdale (2006) noted that “ the analysis starts with a
specified tree derived from the input dataset (for example a NJ tree) and swaps the
branches on the starting tree until the tree with the highest likelihood score (i.e. the best
probability of fitting the data) is gained. This score is a function both of the tree topology
and the branch lengths (number of character state changes). Likelihood analysis
therefore allows an explicit examination of the assumptions made about sequence
evolution”. A maximum likelihood tree can be reconstructed using different software
packages like PAUP (Swofford et al., 1996); PHYLIP (Felsenstein, 1988) or MEGA
(Tamura et al., 2011).The ML is the most powerful tree reconstruction method, but it is

16
time consuming and is hence not used extensively in many laboratories (Chun & Hong,
2010).

1.12.9 Bayesian inference

The Bayesian inference method is interesting and p owerful for phylogenetic tree
reconstruction. Bayesian inference is based on the notion of posterior probabilities,
which means that probabilities are estimated based on some model (prior expectations)
after learning something about the data. It generates a posterior probability distribution
for a parameter based on prior expectations and the likelihood of the data generated by
a multiple alignment (Hall, 2008). Like the MP and ML methods, it deals with each
character, nucleotide or amino acid residue.

The MrBayes software package (Ronquist & Huelsenbeck, 2003) implements the
Bayesian method for phylogenetic inference. MrBayes uses the Metropolis-coupled
Monte Carlo Markov Chain (MCMC) process, which can be v isualized as a s et of
independent searches that occasionally exchange information. This program allows a
search across probability valleys that would otherwise trap the search on a suboptimal
hill. The final product is a s et of trees that the program has repeatedly visited, which
constitute the top of the hill. Although this method is also powerful, it takes long time for
tree reconstruction (Nei & Kumar, 2000).

Bayesian analysis is similar to the ML method in that the user has to postulate a model
of evolution (Rannala & Yang et al., 1996; Mau et al., 1999). However, ML analyses
obtain the tree that maximizes the probability of observing the data that given tree while
Bayesian analyses seeks the tree that maximize the probability of observing the data
and model that given the tree. Most importantly, Bayesian analyses rescale likelihoods to
true probabilities so that the probabilities over all trees is 1.0 (Nei & Kumar, 2000).
Moreover, ML analyses try to find the single best tree, while Bayesian analyses try to find
the best set of trees.

1.13 Reliability of phylogenetic tree

1.13.1 Bootstrapping
After the reconstruction of a phylogenetic tree, the reliability and quality of the tree has to
be assessed to ensure that the tree accurately represents the actual relationships among
OUTs (operational taxonomic units). Therefore, different methods have developed to
17
determine the reliability and r obustness of tree topologies, such as bootstrapping and
branch length estimation. The most common method is the bootstrap analysis, which can
be implemented in different tree reconstruction algorithms. This method was introduced
by Felsenstein (1985) and i s a w idely and s uccessfully applied procedure. The
bootstrapping algorithm resamples the columns of a sequence alignment and creates
many new alignments by random sampling, replacing the original data set. New sets are
similar to each other or the original alignment, but they are rarely absolutely identical.
Multiple trees are then generated from the new sets of alignments and t he statistical
confidence of each branch is calculated. This value is known as the bootstrap value.
Generally 200 – 2000 resamplings should be used for bootstrapping (Chun & Hong,
2010), but 1000 resamples are frequently used. A bootstrap support of 70% or higher is
often considered as indicative of a reliable grouping or clustering in a phylogenetic tree.
The bootstrapping method can be used in all available tree building methods (Van de
Peer, 2003; Chun & Hong, 2010).

1.13.2 Tree rooting

Relationships between organisms are visualized by phylogenetic studies. In the
absence of directly observable relationships between ancestors and descendents, the
direction of the changes must be inferred by rooting the tree (Nei & Kumar, 2000). From
an un-rooted tree, it is impossible to determine the directions of changes in traits of
organisms. Although rooting is not strictly necessary, in most of the cases knowledge of
the direction of changes is essential to reconstruct the evolutionary process (Graur & Li,
2000).There are two methods for molecular tree rooting: out-group rooting and duplicate
gene rooting. Out-group rooting compares character states of the group of interest (in-
group) with a c losely-related but sufficiently distant group (out-group). The differences
between in-group and out-group help to understand the direction of change in the final
tree (Maddison et al., 1984). Prior knowledge of the relatedness of the out-group to the
in-group is required to select the out-group.

In duplicated gene rooting, sequences from one g ene clade are used to root another
gene clade (Simmons et al., 2000). Duplicated gene rooting helps to unveil unexpected
relationships among species or genes in the main clade (Brown & Doolittle, 1995;
Mathews & Donoghue, 1999). However, a tree can also be rooted using evidence from
DNA sequences of fossil record (Smith, 1994).

18
1.13.3 Model selection
Selection of DNA substitution model is crucial for statistical phylogenetic inference. DNA
substitution model works like language interpreter. It translates the information in a set of
sequences into phylogenetic information that can be directly interpreted by a bi ologist.
Generally two types of error such as systematic error or bias and stochastic error or
inflated variance could be ar ised from the selection of wrong substitution model during
analysis. Very simplified model avoid / ignore naturally occurring evolutionary processes
and hence produce systematic error. On the other hand use of excessively complex
model in phylogenetic analysis produces stochastic effect. However, DNA substitution
models are designed to reduce the effect of multiple substitutions at highly variable side
in a D NA sequences. A proper model make a bal ance between these two challenging
error. Therefore, it is important to use a good model for phylogenetic inference (Brown &
Eidabaje, 2009).

1.14 Bacterial speciation and recombination

Speciation is a complex event and is the outcome of a variety of genetic and ecological
processes and historical contingencies. In other words, it is the result of an interaction
between forces such as recombination, migration and selective sweeps (Vinuesa et al.,
2005; and references therein). Recombination occurs frequently among bacteria and
plays an i mportant role in the evolution of most bacterial species, including rhizobia
(Silva et al., 2005; Vinuesa et al., 2005; Bailly et al., 2006; Maiden, 2006; den Bakker et
al., 2008; Tian et al., 2012). New genetic material can be rapidly introduced by
recombination, which can lead to faster evolution than mutation alone (Narra & Ochman,
2006; Redfield, 2001).

Bifurcation, a m ajor assumption for most phylogenetic algorithms, is violated by the

presence of recombination, and it is very hard to predict mutation rates and times to the
most recent common ancestor in organisms which have histories for recombination
events. Moreover, the presence of recombination events gives rise to phylogenetic
incongruence in reconstructed trees (Holmes et al., 1999; Didelot & Falush, 2007; den
Bakker et al., 2008). Alternatively, network analyses allow recombination for visualizing
phylogentic ambiguity, and therefore this method also be considered to study microbial
evolution (Didelot & Falush, 2007; den Bakker et al., 2008; Chun & Hong, 2010). Several
studies have been carried out on rhizobial population genetics, and the population-
species interface could be e xplored using both population genetics and phy logenetics

19
(Silva et al., 2005; Vinuesa et al., 2005; Bailly et al., 2006; Maiden, 2006; Tian et al.,
2012).

1.15 Multi locus sequence analyses

The 16S rRNA gene fulfills most of the requirements for a g ood phylogentic marker
molecule (Ludwig & Klenk, 2005). However, they have some limitations like being highly
functionally conserved, their pattern of sequence change, and branching pattern in the
periphery of the tree, and presence of more than one copy in some bacterial genomes.
Therefore, it has been suggested that 16S rRNA has a low phylogenetic resolving power
for separating closely-related organisms (> 97% similarity) and analyses of this gene are
not suitable for distinguishing prokaryotes at the species level (Ludwig, 2010).
Considering the limitations of the 16S rRNA gene in bacterial taxonomy, a m ulti locus
sequence analysis (MLSA) / multi locus sequence typing (MLST) using different protein
coding genes has been preferred for studying closely-related species of bacteria,
including rhizobia (Adekambi & Drancourt, 2004; Mutch & Young, 2004; Ludwig & Klenk,
2005; Naser et al., 2005; Konstantinidis et al., 2006; Martens et al., 2008). Nowadays,
MLSA is a w idely accepted approach for the characterization of bacteria. After its
introduction, it has been applied to the classification of a v ariety of bacteria and fungi,
and has helped to develop a uni versally portable and reproducible method. In brief,
MLST represents a universal approach for bacterial characterization (Maiden, 2006).

A small number of protein coding genes could be used as marker genes to evaluate the
rRNA based phylogenetic conclusions (Ludwig & Klenk, 2005). These are translation
elongation (IF2, EF-G, and EF-TU) and initiation factors, RNA polymerase sub-units,
DNA gyrase, recA, atpD, and hsp60 (Adekambi & Drancourt, 2004; Glazunova et al.,
2009).

1.16 Symbiotic genes for phylogenetic analyses

The rhizobial genes that are responsible for nodulation and ni trogen fixations are
commonly known as symbiotic genes. They are also known as auxiliary or accessory
genes because they are not essential for rhizobial survival and reproduction. In general,
all symbiotic genes, like nodulation gene clusters, have been found in close proximity to
nif and fix genes. Specifically, rhizobial plasmids often carry nodulation (nod, nol and
noe), nif and fix genes, as well as many secretion related genes. In plasmid-less strains

20
or species these genes are often located in laterally transferrable genomic islands, also
denominated as symbiotic islands (Black et al., 2012; and references therein).

The evolutionary history of chromosomal genes and symbiotic genes can be different
(Lane & Reeves, 2001) and different stories may be found from the phylogenetic
analyses of nodulation genes and the 16S rRNA gene (Mergaert et al., 1997; Haukka et
al., 1998). Among symbiotic genes, a few symbiotic genes like nodD, nodC, nodA and
nifH genes are commonly included for the proper description of rhizobial species by
phylogenetic analyses. Due to the horizontal transfer of symbiotic genes, they do not
provide useful information for taxonomy, but do pr ovide complementary information on
host nodulation and nitrogen fixation (Mergaert et al., 1997). The description of symbiotic
genes is also useful for the proper identification of β-rhizobia and for rhizobial
biogeography studies (Rivas et al., 2009). For symbiovar identification of α-
rhizobia/traditional rhizobia, descriptions of nodulation genes are essential. H owever,
recently some rhizobial strains have been described that lack common nodulation genes,
especially in Bradyrhizobium sp. (BTAi1, ORS278, Giraud et al., 2007).

1.17 Nodulation mechanism

Communication between the plant host and rhizobia starts when the plant secretes
flavonoids in the rhizosphere (Perret et al., 2000). Different plant species secrete
different flavonoids to select the appropriate rhizobia for effective symbiosis. The
specificity is determined by the flavonoid-binding transcriptional regulator nodD, which is
the master regulator of symbiosis (Fellay et al., 1995).

Induction of nodulation (nod) genes by NodD is essential for the production and
secretion of rhizobial signaling molecules known as Nod factors (NFs). Nod factors are
oligosaccharides consisting of four or five beta 1,4 linked N-acetyl glucosamine residues
with a f atty acid residue replacing the N-acetyl group at the non-reducing end. Nod
factors may also be further modified by different molecules (Perret et al., 2000; Cullimore
et al., 2001).The enzymes involved in the synthesis of the basic Nod factors structure are
encoded by the nodABC genes, which are conserved in all rhizobia except strains BTAi1
and ORS278 (Giraud et al., 2007). Nod factors are in turn recognized by the plant and
trigger root hair curling and induce the formation of nodule primordia.

21
1.18 Coevolution and dispersion of rhizobia
In coevolution, two species evolve in response to one another. Coevolution has been
described for plant-pathogenic and symbiotic bacteria. For pathogenic bacteria, it has
been proposed that any change in a single base, combined with different recombination
mechanisms like unequal crossing-over, gene conversion and transposition among R
genes clusters, may lead to the random generation of new sequences in the host and
pathogen developed new virulence against this new sequences. Consequently, different
sets of specificities are randomly generated in the host plant and the bacterium in each
center of diversity.

Fig. 2. Recognition of rhizobial Nod factors by plant Nod factor receptors for nodule formation. Nod factor
structure determines the strict specificity between rhizobium and h ost legume, which trigger rhizobial
infection process and initiation of nodule primordial in a compatible host. Five Nod factor receptors (NFR1,
NFR5, LYK3, NFP, SYM10 and SYM37) have been identified in different legumes and are essential for the
perception of rhizobial Nod factors for symbiosis (Kouchi et al., 2010; and references therein).

Following several cycles of generation of new resistance/virulence and frequency-

dependent selection, a different array of specific host-pathogen combinations appears,
leading to the observed geographic differences in resistance and virulence. Host-
microbe coevolution therefore occurred independently in different centres of
diversification (Geffroy et al., 1999; and references therein). From several experiments
22
(Lie et al., 1987) concluded that the strong co-adaptation between legumes and
indigenous rhizobial strains found in different geographical locations is a r esult of
coevolution. Rhizobial nod factor variants induce a response in specific legume plant nod
factor receptors, suggesting coevolution of legume and rhizobia (Perret et al., 2000; and
references therein). Moreover, Aguilar et al. (2004) found distinct nodC genotypes in
rhizobia in different centres of host origin and c oncluded that they are distinct
evolutionary lineages.

1.19 Symbiosis between rhizobia and lentil

To date, 65 valid species have been described in the genus Rhizobium. R.
leguminosarum symbiovar viciae usually nodulates different members of the legume
tribe Vicieae and this symbiosis may be very specific (Tian et al., 2010; and references
therein). In contrast, from the analysis of rhizobia from bean and pea, Santillana et al.,
(2008) concluded that R. leguminosarum symbiovar viciae could be s plit into more
species and proposed a t axonomic revision of this rhizobial species based on a
polyphasic approach (a consensus type of taxonomy utilizing all the available data to
describe consensus groups). However, most of the rhizobial strains isolated so far from
legumes of the tribe Vicieae clearly belong to the R. leguminosarum species complex (R.
leguminosarum, Rhizobium fabae and Rhizobium pisi) (Álvarez-Martinez et al., 2009). As
little work has been done on lentil symbionts, it is interesting to study the genetic
diversity of lentil nodulating rhizobia from different geographical locations.

1.20 Benefit of lentil-rhizobia symbiosis

The benefit of legume cultivation has been known since ancient times. The role of root
nodulating bacteria on legume growth was also observed by Hellriegel & Wilfarth (1888).
Based on their own studies, Nobbe & Hiltner (1896) commercialized the effect of rhizobia
on legume growth and made the first commercial rhizobial inoculum, “nitragin”, for
agricultural practices (Nautiyal et al., 2008; and references therein). Rhizobial inoculation
has the potential to increase plant dry matter production, nitrogen yields and r esidual
nitrogen levels of forage and grain legumes. However, the benefit of legume inoculation
depends on the legume species and soil nitrogen levels (Vessey, 2004).

Similar to other legumes, lentils require infective and effective rhizobia to fix atmospheric
nitrogen. Lentil showed a w ide range of response to rhizobial inoculation. From
FAOSTAT (2004) data and d ata from other sources it was concluded that the annual

23
fixation by lentil was about 73 kg N/ha/yr by the above-ground plant part or 110 kg
N/ha/yr including the below-ground parts. The average removal of nitrogen by lentil was
approximately 65 kg N/ha/yr in the harvested grain, and lentil stored 8 kg N/ha/yr in the
soil for the following crop (McNeil & Materne, 2007 and references therein).

Significant responses of inoculation can be expected if lentil is grown in virgin soil.

Slattery & Pearce (2002) found significant increases in nodule numbers (8-fold more),
50% more yield and 25% more dry matter yield after inoculation with acid tolerant R.
leguminosarum strains in acidic soil (4.5 – 5), and found positive correlations between
these three parameters. On the Indian subcontinent, where rhizobial populations are
high, yield responses were moderate to high (Khurana & Sharma, 1995; Dhingra et al.,
1988; Satter, 2001; Saha et al., 2008) under field conditions. Moreover, Vessey (2004)
observed a significant yield response to rhizobial inoculation with lentil using commercial
inoculants under field conditions. However, Moawad et al. (1998) investigated the
competitive ability and y ield response of inoculant strains in Egypt and found only 5%
more yield compared to the control.

Rhizobial inoculation can significantly increase yield, seed moisture, ash, crude fiber and
protein content of legumes. Regardless of whether the soil is virgin or contains endemic
rhizobial populations, legume producers should inoculate their legumes for a better yield
and soil nitrogen balance using low-cost rhizobial inoculum (Vessey, 2004). However,
legume inoculation with effective rhizobial strains is necessary to counterbalance and
reduce the use of chemical fertilizers. Therefore, it is worthwhile to manage lentil crops
by inoculation to achieve maximum nitrogen fixation rates and thereby maximize total
productivity and profitability (McNeil & Materne, 2007).

From the aforementioned experimental results it is clear that potential benefits from lentil
inoculation with rhizobia can be achieved by using highly infective and effective strains
with high survival capacity under field conditions. To find effective and infective rhizobial
strains for lentil inoculation we need to isolate rhizobia from a wide range of
environmental conditions. Subsequently, we need to evaluate their effect on growth
under growth chamber conditions, glass house conditions and finally under field
conditions to find strains suitable for use on farms.

24
1.21 Previous work on lentil nodulating rhizobia
Although several studies have been c arried out to assess the diversity and i dentity of
rhizobia that nodulate members of the tribe Vicieae, there are few reports that
investigated rhizobia isolated from lentil. The studies performed on lentil rhizobia so far
have mainly evaluated their symbiotic performance on plant growth and have described
their biochemical characteristics and s tress tolerance (salt and temperature). The
diversity of rhizobia from the tribe Vicieae, especially from pea, faba bean and grass pea,
has been studied by many scientists around the world (Laguerre et al., 1996; Mutch &
Young, 2004; Hou et al., 2009; Tian et al., 2010; Risal et al., 2012; and many others), but
very few studies on the diversity and t axonomy of lentil nodulating rhizobia have been
carried out (Hynes & O’Connell, 1990; Moawad & Beck, 1991; Laguerre et al., 1992;
Geniaux & Amargr, 1993; Keatinge et al., 1995). However, by analyzing rhizobia from
the tribe Vicieae from different countries it has been concluded that R. leguminosarum is
the main lentil-nodulating species (Tian et al., 2010; and reference therein).

1.22 Research strategy

In order to increase our knowledge of the genetic diversity of rhizobial populations
associated with members of the tribe Vicieae, specifically with lentil, and to determine the
taxonomic position and identity of lentil symbionts, we isolated rhizobia from field-grown
lentil nodules which were collected from different localities of Bangladesh and Germany.
Lentil-nodulating rhizobia were also isolated from the nodules of lentils grown in potted
soil samples under glass house conditions. These soils were collected from lentil-
growing countries where this crop originated (Turkey & Syria; Lev-Yadun et al., 2000;
Sonnante et al., 2009) and from Germany, where it introduced later. In this study, we aim
to (1) explore the genetic diversity and identity of lentil nodulationg rhizobia (2) evaluate
the levels of genetic diversity and the population structure of these bacteria from different
geographic locations (3) to know the transmissible nature of nodulation genes. Here,
concepts from prokaryotic evolutionary theories and population genetics have been used
to describe our result and interpretations.

1.23 Objectives
The diversity of lentil-nodulating rhizobia has been described on the basis of plasmid
profiles, RFLP and rep-PCR (repetitive element sequence-based PCR), but no sequence
information is currently available (Laguerre et al., 1992; Geniaux & Amargr, 1993;

25
Tegegn, 2006). To our knowledge, phylogenetic analyses have not yet been performed
on lentil rhizobia using a MLSA approach. Therefore, it is interesting to study the genetic
diversity of lentil nodulating rhizobia from different geographical locations using an MLSA
approach.

The main aim of this study was to investigate the genetic biodiversity of rhizobia
associated with lentil (Lens culinaris, Medik.) from different countries. There were several
questions, e.g. what are the symbionts of Lens culinaris? Are they native to particular
country/countries? Is same genotype present in different countries? Are they influenced
by lentil cultivars, greges, races, sub-species, and species?

To answer these questions, lentil-nodulating rhizobia were isolated from traditional lentil-
growing countries like Bangladesh, Turkey and Syria, and from Germany, where lentil is
now only grown in scattered localities. A total of 134 rhizobia from lentil nodules were
isolated from the four different countries. We have determined some morpho-
physiological characteristics of the collected rhizobia, like biochemical properties,
tolerance to acid or alkaline conditions, salt concentrations and temperature, and
resistance to different antibiotics. The symbiotic properties were evaluated by conducting
nodulation tests with lentil and cross-inoculation test with grass pea and pea. We have
sequenced four chromosomal genes and three plasmid-borne nodulation genes from 94
isolates, and 406 sequences have deposited in the GenBank from the isolates used in
this study. Nucleotide sequences have analyzed using phylogenetic and population
genetic approach.

26
2. Materials and Methods

2.1 Sources of nodule samples and their collection localities

All nodule samples were collected from field-grown and glasshouse-grown lentil roots. All
Bangladeshi isolates were collected from field grown lentil nodules and isolates from
Germany were collected from both field grown and glasshouse grown lentil nodules. To
grow lentil under glasshouse condition, soil samples were collected from different
localities of Germany, Turkey and Syria. Nodule collection and preservation, and
isolation of rhizobia were carried out following standard protocols (Somasegaran &
Hoben, 1994). Nodules from lentil roots were collected from 25 localities in Bangladesh,
10 localities in Germany, two localities in Syria and one locality in Turkey (table 2 and
table 3). Isolates numbers, localities and their respective geographical positions in
Bangladesh are listed in the table 2. Details of the isolates from Germany, Turkey and
Syria are shown in table 3.

2.2 Isolation rhizobia from nodules and their preservation

The collected nodulated roots were washed with water, dried with tissue paper and
preserved on silica gel dessicant until further processing. For the isolation of bacteria
from nodules, a s ingle nodule was crushed in 50 µL of sterile water using a
homogenizer. A loop-full of suspension was streaked on yeast-extract mannitol agar
(YEMA) plates (Vincent, 1970) and incubated at 28°C for 3 – 5 days. Isolated single
colonies were purified by repeated streaking on Y EMA and C RYEMA plates
(Somasegaran & Hoben, 1994). A total 134 rhizobial strains (36 from Bangladesh, 78
from Germany, 12 from Turkey and 8 from Syria) were isolated in this study. Single
colonies were preserved either on agar slants at 4°C, or frozen in broth with 50% glycerol
at −80 °C until further analysis. All collected bacterial isolates were preserved at the
Institute of Pharmacy and Molecular Biotechnology (IPMB, Germany) and at the
Bangladesh Institute of Nuclear Agriculture (BINA, Bangladesh) for further study. The
names of isolates and GenBank accession numbers for the different gene sequences
provided in the table 4 (Bangladeshi isolates) and table 5 (German, Turkish and Syrian
isolates).

27
Fig. 3. Isolated single colonies of lentil-nodulating rhizobia on CRYEMA plate

2.3 Phenotypic characterization

Different phenotypic characteristics of isolated bacteria such as tolerance to high
temperature, NaCl, pH, and antibiotics; size and morphology of colonies, acid production
and growth on LB media were determined following standard procedures (Amarger et al.,
1997; Wang et al., 1998; Valverde et al., 2006; Bromofeld et al., 2010). The tolerance to
temperature, NaCl, pH and ant ibiotics resistance was determined on T Y medium.
Overnight cultures (5 µL, circa 1 × 108 cell / mL) were used to inoculate different media.
The pH was adjusted with NaOH or HCl and media were buffered with 25 mM
HOMOPIPES (pH 4.5), 40 mM MES (pH 5.5), 30 mM HEPES (pH 6.8 – 8.2) (Moron et
al., 2005), or CHES (pH 10). Temperature tolerance was assayed by incubating
inoculated plates at different temperatures (4 – 45°C). Inoculated plates containing
media with different pH values, concentrations of antibiotics or NaCl, LB medium, or
YEMA with BTB (bromothymol blue) were incubated at 28°C for 3 – 5 days. However, in
this study, the strains R. leguminosarum symbiovar viciae 3841, Rhizobium etli CFN42
and Sinorhizobium meliloti 1021, kindly provided by Prof Dr. J.P.W. Young, University of
York, England, were used as references.

28
Table 2. Geographical coordinates of sample collection localities in Bangladesh
Locality Isolates Village/ Upazila/ District/ Geographical
number union subdivision division coordinates
1 9, 12 Jeopara Puthia Rajshahi 24°24′10″ N, 88°50′0″ E

2 27, 28 Bagatipara Bagatipara Natore 24°21′48″ N, 88°55′42″ E

3 26 Fatehpur Lalpur Natore 24°12′59″ N, 88°58′30″ E

4 45, 46 Mooladooli Ishwardi Pabna 24°10′0″ N, 89°4′0″ E

5 39, 41 Baromile Bheramara Kushtia 24°3′0″ N, 88°58′0″ E

6 29, 33 Mirpur Mirpur Kushtia 23°58′0″ N, 89°0′0″ E

7 100 Nangal Jara Kalaroa Satkhira 22°53′15″ N, 89°2′30″ E

8 99 Labsha Satkhira Sadar Satkhira 22°44′0.12″ N, 89°4′0″ E

9 105 Nagor Ghata Tala Satkhira 22°46′0″ N, 89°15′0″ E

10 160, 174 Ghurnia Dumuria Khulna 22°51″ N, 89°25′30″ E

11 175 Mohammadpur Khulna Sadar Khulna 22°50″ N, 89°33′0″ E

12 129 Gangni Mollahat Bagerhat 22°57′30″ N, 89°42′0″ E

Chandra
13 153,154 Gopalganj Sadar Gopalganj 23°2′0″ N, 89°49′0″ E
Dighalia
14 137,139 Patgati Tungipara Gopalganj 22°55′0″ N, 89°53′0″ E

15 122 Noapara Fakirhat Bagerhat 22°47′48″ N, 89°42′30″ E

15 127 Fakirhat Fakirhat Bagerhat 22°47′48″ N, 89°42′30″ E

16 87, 98 Kulia Debhata Satkhira 22°35′0.12″ N, 88°57′0″ E

17 235 Osmanpur Mirsharai Chittagong 22°48′0″ N, 91°34′50″ E

18 228 Mohori project Sonagazi Feni 22°53′0″ N, 91°23′12″ E

19 195 Sarishadi Feni Sadar Feni 23°3′0″ N, 91°23′45″ E

20 57, 58 Bhairab Bhairab Kishoregonj 24°4′0″ N, 91°0′ E

21 62 Morichar Chor Ishwarganj Mymensingh 24°42′0″ N, 90°37′30″ E

Mymensingh
22 59 Boyra Mymensingh 24°46′0″ N, 90°25′0″ E
Sadar
23 288 Shankarpur Sadar Dinajpur 25°39′45″ N, 88°35′45″ E

24 299 Bhandara Biral Dinajpur 25°37′59″ N, 88°31′59″ E

Kusha
25 281 Pirganj Thakurgaon 25°52′15″ N, 88°20′45″ E
Ranigonj

29
 25
24 23

22
21
1
2
3
4 20
5
6

12 13 19
10
7 9 11 14 18
8 15 17
16
8
15
8

75 Km

Fig. 4. Sampling localities in Bangladesh (red squares).

1: Jeopara, 2: Bagatipara, 3: Fatehpur, 4: Mooladooli, 5: Baromile, 6: Mirpur, 7: Nangal Jara, 8: Labsha,

9: Nagor Ghata, 10: Ghurnia, 11: Mohamadpur, 12: Gangni, 13: Chandra Dighalia, 14: Patgati,

15: Noapara and Fakirhat, 16: Kulia, 17: Osmanpur, 18: Mohori Project, 19: Sarishadi, 20: Bhairab,

21: Boyra, 22: Morichar Chor, 23: Shankarpur, 24: Bhandar, 25: Kusha Ranigonj.

30
Table 3. Name of country, isolate numbers, soil pH and rhizobial density in sample
collection areas

Country Locality Isolates Soil MPN of rhizobia

pH (cells × g−1 soil)
2
Bürstadt, HG GLR1, GLR2, GLR3, GLR5 7.14 1.14 × 10
2
Rittersheim, RLP GLR6, GLR7, GLR8, 6.92 1.14 × 10
GLR9, GLR10
Plankstadt, BW GLR11, GLR12, GLR13, 7.10 ND
GLR14
Germany Heidelberg, GLR16, GLR17, GLR19 7.27 ND
Wieblingen, BW
Ziegelhausen, GLR22 4.85 ND
Heidebuckelweg, BW
2
Babenhausen, HG GLR23, GLR25, GLR27, 6.81 5.65 × 10
GLR28, GLR29,
GLR30,GLR31
Hüfingen, BW GLR32, GLR33, GLR34 6.78 ND
3
Ostrach, BW GLR40, GLR43, GLR45 7.25 2.18 × 10
Heidelberg, GLR46, GLR49, GLR50 6.54 ND
Handschuhsheimer
Feld, BW
Lauterach, BW GLR54, GLR59, 6.5-7.0 ND
GLR67,GLR69, GLR71,
GLR74, GLR79
Turkey Burdur, TLR2, TLR3, T4, TLR5, ND ND
Southwestern Turkey TLR6, TLR7, TLR8, TLR9,
TLR10, TLR11, TLR12,
TLR14
Syria Al-Hannadi, Latakia SLR1, SLR2, SLR3, SLR4 7.58 ND
Tishreen Suburb, SLR5, SLR6, SLR7, SLR8 7.65 ND
Latakia
Bangladesh Rashid et al. (2012) BLR9, BLR27, BLR28, ND ND
BLR153, BLR175, BLR195,
BLR235
Abbreviations, ND = not determined; BW = Baden-Württemberg, RLP = Rheinland-Pfalz, HG = Hessen,
MPN = most probable numbers

2.4 Nodulation and cross-inoculation tests

All bacterial isolates were tested for nodule formation with lentil. Cross-inoculations were
performed with Lathyrus sativus and Pisum sativum, two related members of the legume
tribe Vicieae. Seeds from two lentil varieties [BINA-3 from Bangladesh and Teller Linsen
from Mullers and Muhle (commercial grade) from Germany], one variety of Lathyrus
sativa (BINA-1 from Bangladesh) and one of P. sativum (green pea, unshelled,
commercial grade from Mullers and Muhle, Germany) were surface-sterilized using 70%
ethanol (1 min) and 3% NaClO (3 – 5 min). After surface sterilization, the seeds were
washed at least six times with sterile distilled water in order to completely remove the
disinfectant. After imbibing (4 h in sterile water), seeds were transferred aseptically to 1%
water agar plates and allowed to germinate for 2 days at room temperature in the dark.

31
Seedlings were later transferred to glass tubes (32 mm × 170 mm) containing Fåhraeus
(1957) agar medium. Bacterial cultures (2 mL / plant) grown in YEM liquid medium (circa
1 × 108 cells / mL) were used to inoculate 5 days old seedlings (Somasegaran & Hoben,
1994). Plants were alternately irrigated with sterile de-ionized water and J enson’s
nitrogen-free seedling solutions. The same procedure was used for cross-inoculation
assays with 10 r andomly selected isolates that were able to form nodules under
laboratory conditions from Bangladeshi isolates and 30 isolates from Germany, Turkey
and Syria. Plants were grown for 3 – 5 weeks in a plant growth chamber set to 25°C with
14 h light / 10 h dark cycles. Three replicates were used for each bacterial isolate in the
nodulation tests. Un-inoculated plants served as negative controls.

A. B.
Fig. 5. Plant infection test sets under growth chamber conditions. A: Plants on agar
based medium, B: Plant roots with nodules in agar based medium in glass tubes

2.5 Symbiotic effectivity test

For the determination of symbiotic effectiveness, an experiment was conducted under
glasshouse conditions employing sterile sand. In this experiment, 17 i solates from
Bangladesh, R. leguminosarum symbiovar viciae 3841, and un-inoculated controls with
or without nitrogen fertilization were evaluated for lentil growth and nodul ation.
Commercially available lentil seeds (Linsen from Kiepenkerl, Germany) were surface-
sterilized, germinated and t ransferred to sterile sand as described above. Plant
inoculation was performed as described for plant infection and cross-inoculation assays.
Sterile water and nitrogen-free seedling solution were used for irrigation. In the nitrogen-
fertilized control, the plants were also irrigated with KNO3 solutions (0.5 g / L)
(Somasegaran & Hoben, 1994). After four weeks, all plants were harvested and nodules
were separated from the roots. The plants were dried at 70°C for 72 h, and nodules at
105°C for 48 h (Laguerre et al., 2007). The data were analyzed using SPSS version 17
and the means were compared using ANOVA statistical significance tests at the 5% level
and results are shown in table 10 (A – H).
32
A B.
Fig. 6. Plants with nodules from cross-inoculation test. A: Pea , B. Grass pea

A B.
Fig. 7. Symbiotic effectivity test at glasshouse, A: BINA-1, B: Linsen (commercial grade)

2.6 DNA extraction, gene amplification and sequencing

Bacterial cultures were grown at 28°C overnight or for 24 h in tryptone-yeast (TY extract)
medium (Beringer, 1974) and the DNA were isolated following the protocol of Chen and
Kuo (1993). Extracted DNA was dissolved in TE buffer and the concentration was
measured by UV spectrophotometry. PCR amplifications were performed with about 50
ng of template DNA. PCR conditions and primer sequences used for sequencing and
DNA fingerprinting are shown in table 6.

For sequencing, PCR products were precipitated following Gonzalez and Wink
(Gonzalez & Wink, 2010). Sequencing was performed using an ABI 3730 automated
capillary sequencer (Applied Biosystems) with the ABI Prism Big Dye Terminator Cycle
Sequencing Ready Reaction Kit version 3.1 by STARSEQ GmbH (Mainz, Germany). To
confirm the observed sequences quality, both strands were sequenced from most of the
isolates. In this study, a t otal of 159 sequences from 36 isolates from Bangladeshi
isolates and 270 sequences from 58 strains from German, Turkish and Syrian isolates
were generated and deposited in GenBank. Isolates names and accession numbers are
listed in table 4 and table 5.

33
Table 4. Amplified genes and their accession number from Bangladeshi isolates

Isolates 16S rRNA atpD recA glnII nodC nodA nodD

BLR9 JN648902 JN648938 JN649028 JN648974 JN648993 JN648983 JN649014
BLR12 JN648903 JN648939 JN649029 JN648975
BLR26 JN648904 JN648940 JN649030 JN648994
BLR27 JN648905 JN648941 JN649031 JN648976
BLR28 JN648906 JN648942 JN649032 JN648977 JN648984 JN649015
BLR29 JN648907 JN648943 JN649033 JN648995
BLR33 JN648908 JN648944 JN649034 JN648996 JN648985 JN649016
BLR39 JN648909 JN648945 JN649035
BLR41 JN648910 JN648946 JN649036 JN648997 JN649017
BLR45 JN648911 JN648947 JN649037 JN648998 JN649018
BLR46 JN648912 JN648948 JN649038
BLR57 JN648913 JN648949 JN649039 JN648999 JN648986 JN649019
BLR58 JN648914 JN648950 JN649040
BLR59 JN648915 JN648951 JN649041
BLR62 JN648916 JN648952 JN649042 JN649000
BLR87 JN648917 JN648953 JN649043
BLR98 JN648918 JN648954 JN649044 JN649001 JN649020
BLR99 JN648919 JN648955 JN649045 JN649002 JN648987 JN649021
BLR100 JN648920 JN648956 JN649046 JN649003
BLR105 JN648921 JN648957 JN649047 JN649004
BLR122 JN648922 JN648958 JN649048
BLR127 JN648923 JN648959 JN649049 JN649005 JN649022
BLR129 JN648924 JN648960 JN649050 JN649006 JN648988
BLR137 JN648925 JN648961 JN649051 JN649023
BLR139 JN648926 JN648962 JN649052 JN649007
BLR153 JN648927 JN648963 JN649053 JN648978 JN649008 JN648989
BLR154 JN648928 JN648964 JN649054
BLR160 JN648929 JN648965 JN649055 JN649009
BLR174 JN648930 JN648966 JN649056 JN649010 JN648990 JN649024
BLR175 JN648931 JN648967 JN649057 JN648979 JN649011 JN648991 JN649025
BLR195 JN648932 JN648968 JN649058 JN648980 JN649012
BLR228 JN648933 JN648969 JN649059 JN648992 JN649026
BLR235 JN648934 JN648970 JN649060 JN648981 JN649013 JN649027
BLR281 JN648935 JN648971
BLR288 JN648936 JN648972
BLR299 JN648937 JN648973 JN648982

34
Table 5. Genes and their accession number from German, Turkish and Syrian isolates

Isolates 16S rRNA recA atpD gln II nodC nodD

GLR1 KC679411 KC679449 KC679507 KC679562 KC679619 KC679657
GLR2 KC679412 KC679450 KC679508 KC679563 KC679620 KC679658
GLR3 KC679413 KC679451 KC679509 KC679564
GLR5 KC679414 KC679452 KC679510 KC679565 KC679621
GLR6 KC679415 KC679453 KC679511 KC679566
GLR7 KC679416 KC679454 KC679512 KC679567 KC679622 KC679659
GLR8 KC679417 KC679455 KC679513 KC679568 KC679623
GLR9 KC679418 KC679514 KC679569
GLR10 KC679419 KC679456 KC679515 KC679570 KC679624
GLR11 KC679420 KC679457 KC679516 KC679571 KC679625 KC679660
GLR12 KC679421 KC679458 KC679517
GLR13 KC679422 KC679459 KC679518 KC679572 KC679626
GLR14 KC679423 KC679460 KC679627
GLR16 KC679424 KC679461 KC679519 KC679573 KC679628
GLR17 KC679425 KC679462 KC679520 KC679574 KC679629 KC679661
GLR19 KC679426 KC679463 KC679521 KC679575
GLR22 KC679427 KC679464 KC679522 KC679576 KC679630
GLR23 KC679428 KC679465 KC679523 KC679577 KC679631 KC679662
GLR25 KC679429 KC679466 KC679524 KC679578 KC679632
GLR27 KC679430 KC679467 KC679525 KC679579 KC679633 KC679663
GLR28 KC679431 KC679468 KC679526 KC679580
GLR29 KC679432 KC679469 KC679527 KC679581
GLR30 KC679433 KC679470 KC679582
GLR31 KC679434 KC679471 KC679528 KC679583
GLR32 KC679435 KC679472 KC679529 KC679584
GLR33 KC679436 KC679473 KC679530 KC679585 KC679634 KC679664
GLR34 KC679437 KC679474 KC679531 KC679586 KC679635
GLR40 KC679438 KC679475 KC679532 KC679587 KC679636
GLR43 KC679476 KC679533 KC679588
GLR45 KC679439 KC679477 KC679534 KC679589 KC679637 KC679665
GLR46 KC679440 KC679478 KC679535 KC679590 KC679638 KC679666
GLR49 KC679441 KC679479 KC679536 KC679591 KC679639
GLR50 KC679442 KC679480 KC679537 KC679592 KC679640 KC679667
GLR54 KC679481 KC679538 KC679593
GLR59 KC679482 KC679539 KC679594
GLR67 KC679483 KC679540 KC679595
GLR69 KC679484 KC679541 KC679596
GLR71 KC679485 KC679542 KC679597
GLR74 KC679486 KC679543 KC679598
GLR79 KC679487 KC679544 KC679599
TLR2 KC679443 KC679488 KC679545 KC679600 KC679641 KC679668
TLR3 KC679489 KC679546 KC679601 KC679642
TLR4 KC679490
TLR5 KC679491 KC679602 KC679643
TLR6 KC679444 KC679492 KC679547 KC679603
TLR7 KC679445 KC679493 KC679548 KC679604 KC679644 KC679669
TLR8 KC679605 KC679645
TLR9 KC679494 KC679549 KC679606 KC679646 KC679670
TLR10 KC679495 KC679550 KC679607 KC679647 KC679671
TLR11 KC679496 KC679551 KC679608 KC679648 KC679672
TLR12 KC679497 KC679552 KC679609 KC679649 KC679673
TLR14 KC679498 KC679553 KC679610 KC679650
SLR1 KC679446 KC679499 KC679554 KC679611 KC679674
SLR2 KC679500 KC679555 KC679612 KC679651
SLR3 KC679501 KC679556 KC679613 KC679652 KC679675
SLR4 KC679447 KC679502 KC679557 KC679614 KC679653 KC679676
SLR5 KC679503 KC679558 KC679615 KC679654
SLR6 KC679504 KC679559 KC679616 KC679677
SLR7 KC679448 KC679505 KC679560 KC679617 KC679655 KC679678
SLR8 KC679506 KC679560 KC679618 KC679656 KC679679
BLR195 KC679680

2.7 Genomic fingerprinting by ERIC-PCR

For high resolution PCR, we used the primers and PCR conditions following (De Bruijn,
1992) and (Gonzalez & Wink, 2010), respectively (table 6). The 25 µL reaction mixture
contained 2.5 µL of 10X PCR buffer, 2.5 µL DMSO, 2 µL 45%-dATP nucleotide mixture,
35
40 pmol of each primer, 2 units of Taq polymerase (Pharmacia Biotech), 1 µCi (α-33P)-
dATP (Amersham Biosciences) and approximately 80 ng of genomic DNA. DNA
fragments were separated by vertical PAGE (polyacrylamide gel electrophoresis) using a
Base Acer Sequencer (Stratagene, La Jolla, San Diego, CA, USA) at 65 W for 2 h. The
denaturing gels (45 × 30 × 0.025 cm) were prepared with 50 m L of Long Ranger ®
solution, 35 µ L tetramethylethylenediamine (TEMED) and 2 50 µL o f ammonium
persulfate (APS). After drying, the gel was exposed to X-ray film for 48 h.

Table 6. Primers used for amplification of different genes

Gene
Primer Sequence (5´ – 3´ ) /sequence PCR conditions Reference
fD1 AGAGTTTGATCCTGGCTCAG 5 min 95°C, 30 × (1 min 95°C, 1 min 55°C, Weisburg et al., (1991)
rD1 AAGGAGGTGATCCAGC 16S rRNA 1.5 min 72°C), 10 min 72°C
63F ATCGAGCGGTCGTTCGGCAAGGG 5 min 95°C, 30 × (1 min 94°C, 1 min 65°C *, Gaunt et al.,( 2001)
504R TTGCGCAGCGCCTGGCTCAT *recA 1 min 72°C), 10 min 72°C
273F SCTGGGSCGYATCMTGAACGT 5 min 95°C, 30 × (1 min 94°C, 1 min 65°C *, Gaunt et al.,( 2001)
771R GCCGACACTTCCGAACCNGCCTG *atpD 1 min 72°C), 10 min 72°C
TsglnIIf AAGCTCGAGTACATCTGGCTCGACGG 5 min 95°C, 30 × (45 s 95°C, 30 s 58°C, 1.5 min Stepkowski et al.,( 2005)
TsglnIIr SGAGCCGTTCCAGTCGGTGTCG glnII 72°C), 7 min 72°C
nodCF AYGTHGTYGAYGACGGTTC 5 min 95°C, 30 × (1 min 95°C, 1 min 55°C, Laguerre et al., (2001)
nodCI CGYGACAGCCANTCKCTATTG nodC 1.5 min 72°C), 10 min 72°C
NBA12 GGATSGCAATCATCTAYRGMRTGG 5 min 95°C, 30 × (1 min 95°C, 1 min 55°C, Laguerre et al., (1996)
NBF12_ GGATCRAAAGCATCCRCASTATGG nodD 1.5 min 72°C), 10 min 72°C
nod-A1 TGCRGTGGAARNTRNNCTGGGAAA 5 min 95°C, 30 × (1 min 95°C, 1 min 60°C, Haukka et al., (1998)
nod-A2 GGNCCGTCRTCRAAWGTCARGTA nodA 1 min 72°C), 10 min 72°C
ERIC 1R ATGTAAGCTCCTGGGGAT 5 min 95°C, 30 × (30 s 94°C, 1 min 52°C, 8 min De Bruijn, (1992)
ERIC 2 AAGTAAGTGACTGGGGGTGAGC ERIC-sequence 65°C), 16 min 65°C

* Annealing temperature for recA and atpD genes for German, Turkish and Syrian isolates was 60°C

The bands were scored as 1 (present) or 0 (absent). Similarity matrices, neighbor-joining

(NJ) bootstrap consensus phylogenetic trees and principal coordinate analysis (PCoA)
plots were generated using FAMD version 1.25 (Schlüter & Harris, 2006).

2.8 Processing of sequence data

Obtained sequences were aligned using Bio-Edit with careful manual curation and
following the recommended precautions.

2.9 Phylogenetic Analyses

The sequences were aligned with BioEdit (Hall, 1999). Phylogenetic trees were
reconstructed using the neighbor-joining (NJ) algorithm (Saito & Nei, 1987) and
maximum likelihood methods (ML) in MEGA version 5 ( Tamura et al., 2011) using the
36
Kimura two-parameter model K2P (K2P, Kimura, 1980) and GTR model (Tavaré, 1986),
and Bayesian Inference (BI) in MrBayes version 3.1.2 (Ronquist & Huelsenbeck, 2003).
Bootstrap support for each node was evaluated with 1000 replicates. In BI analyses, two
inde-pendent runs of 10,000,000 generations each were performed along with four
Markov chains. Trees were sampled every 500 generations and the first 5000 samples
were discarded as ‘burn-in’. Phylogenetic trees were reconstructed based on single as
well as combined gene data sets. Trees were rooted using Bradyrhizobium japonicum
and Rhizobium yanglingense as out group except for the nodC (Fig. 27) and nodD (Fig.
28) trees. Uncorrected genetic distances (p, Nei, 1987) within and between lineages and
sub-lineages were calculated using MEGA 5 (Tamura et al., 2011). Tree topologies were
compared using the S-H test (Shimodaira & Hasegawa, 1999).

2.10 Population genetic analyses

Parameters such as recombination events were measured with DNASP version 5.10.01
(Rozas et al., 2010). The population structure was evaluated with STRUCTURE version
2.3.3 (Pritchard et al., 2000; Falush et al., 2003). The most likely number of clusters (K =
1 – 10) was determined under an ‘ admixture’ model, 20,000 ‘burn-in’ and 40,000
sampling iterations and the corresponding (highest) posterior probability value
associated to the data set for STRUCTURE analyses. With an estimated K = 9, five extra
long runs of 20,000 ‘burn-in’ and 100, 000 sampling iterations were performed.
Hierarchical Analysis of Molecular Variance (AMOVA, Excoffier et al., 1992) was
conducted in ARLEQUIN version 3.5 (Excoffier et al., 2005).

2.11 Recombination and mutation analyses

Levels of recombination, mutation rates and 50% majority rule consensus trees (with and
without recombination) were estimated based on the combined data set using
CLONALFRAME version 1.1 (Didelot & Falush, 2007). Three independent runs were
performed with a 100,000 ‘burn-in’ and 300,000 sampling iterations. Satisfactory MCMC
convergence was judged following the criterion of Gelman & Rubin (1992). We made use
of three approaches in order to estimate the level of recombination in the isolates from
Germany, Turkey and Syria: (1) minimal intragenic recombination events (Rm) were
detected and compared with expected values of coalescence simulations based on
10,000 genealogy replications at 95% confidence level (Hudson et al., 1992; Rozas et
al., 2010) analyzing single genes and the combined data set in DNASP version 5.10.1

37
(Rozas et al., 2010; (2) the Shimodaira-Hasegawa (S-H) test (Shimodaira & Hasegawa,
1999) was performed to compare ML tree topologies for phylogenetic congruence as
implemented in TREE-PUZZLE version 5.2 (Schmidt et al., 2003); and (3) recombination
rates were determined by the relative impact of recombination as compared with point
mutation in the genetic diversification of the lineages (r/m proportion; (Guttman &
Dykhuizen, 1994) and the relative frequency of the occurrence of recombination as
compared with point mutation in the history of the lineage (ρ/θ proportion; Milkman &
Bridges, 1990); these analyses were carried out in CLONALFRAME version 1.1 as
described before.

2.12 Apparatus, instruments, chemicals, solutions used in this study

Table 7. List of instruments and apparatuses used for this study

Instruments Company
Automated sequencer ABI 3100, Applied Biosystems
Autoclave, large Webeco, Germany
Autoclave, small Vienna, Austria
DU 640 Photometer Beckman ,USA
Centrifuge, 1-15K Sigma, Germany
Electrophoresis power supply unit-E452 Fröbel , Germany
Falcon tube (25, 50 mL) Sarstedt, Germany
Freezers (-20°C, -70°C) AEG, Santo, Liebherr Revco
Gel casting chamber/tray Heidelberg University, Germany
Gloves VWR international, USA
Incubator with shaking New Brunswick Scientific, USA
Incubators (28°C, 37°C, 65°C) Heraeus, Germany
Laminar flow: LF1800 Fröbel labortechnik, Germany
Microcentrifuge-biofuge 13R Heraeus, Germany
Microcentrifuge: Biofuge Fresco Heraeus, Germany
PCR machines: Tgradient thermo cycler Senso Quest,Biometra, Germany
pH meter: Pipetman Gilson, France
Plant growth chamber Rubarth, Germany
Reaction tubes (0.2, 0.5, 1.5, 2 mL) Eppendorf, Germany
Shaker: schuettler-MT4 IKA, Germany
Sterile filter ( 0.22, 0.45 μm ) Sartorius, Germany
SW22 shaking water bath Julabo, Germany
UVP,Benchtop variable transilluminator NY, USA
UV-Photometer WPA, Hong Kong
Vertical gel rig for PA glass Stratagene, La Jolla, San Diego, USA
Vortex mixer, genie-2 Bender & Hobein AG, Switzerland
X-ray film Fuji , Japan

38
Table 8. Chemicals, enzymes, and other materials used in this study

Chemicals, enzymes and other materials Company / Country

Acetic acid Merck, Germany
Agarose HYBAID-AGS, Germany
Ammonium sulfate Gerbu, Germany
Ammonium acetate Merck, Germany
Antibiotics (ampicillin, kanamycin, tetracyclin, Sigma-Aldrich, Serva, AppliChem,
nalidixic acid, chloramphenicol, streptomycin) Germany
Agar Sigma-Aldrich, Germany
Big Dye Terminator kit Applied Biosystems
Bovine serum albumin Sigma-Aldrich, Germany
Bromo thymol blue Serva, Germany
Chloroform Fluka, Switzerland
DMSO Sigma-Aldrich, Germany
Ethanol, absolute Merck and Becker , Germany
EDTA Roth, Germany
Ethidium bromide Serva, Germany
Formamide Applied Biosystems
Glycerol Sigma-Aldrich, Germany
Gram staining kit Sigma-Aldrich, Germany
Isopropanol Applichem, Germany
ß-mercaptoethanol Merck, Germany
Mannitol Becton, USA
Mineral oil Sigma-Aldrich, Germany
Nucleotides Eurofins, Germany
Phenol Merck, Germany
Potassium nitrate Merck, Germany
Proteinase K Merck , Germany
Sodium dodecyl sulfate (SDS) Applichem, Germany
Sodium acetate Merck , Germany
TM
Taq DNA polymerase (red taq) Sigma-Aldrich, Germany
Taq DNA polymerase Sigma-Aldrich, Bioron
Taq DNA polymerase Bioron, Germany
Tris-HCl Roth, Germany
Ultra pure water Merck, Germany
Yeast extract Becton, USA

39
Table 9. Buffers, medium and solutions used in this study

Buffers and stock solutions Components / Company

Agarose gel solution- 1-1.5% Agarose in water, contains 1 μg/mL ethidium bromide
Ammonium acetate- 4M Amonium acetate (C2H3O2NH4 ) in water
Ammonium persulfate-10% Amonium sulphate (NH4)2S2O8 in water
BTB solution Bromothymol blue (stock; 0.5 g /100 EtOH); 10 mL per litre
YEMA medium (concentration: 25 ppm BTB in YEMA)
Chloroform: isoamyl alcohol CHCl3/C5H12O in ratio 24:1
CHES (pH 10) Sigma-Aldrich, Germany
CAPS (pH 10) Sigma-Aldrich, Germany
Congo Red solution Congo Red (stock:0.25 g/100 mL water): 10 mL per litre
YEMA medium (concentration: 25ppm BTB in YEMA)
CRYEMA medium Mannitol (C6H8(OH)6) -10 g, yeast extract-1.0 g, KH2PO4-0.5
g, MgSO4.7H2O - 0.2 g, NaCl - 0.2 g, agar-18 g, congo red-10
mL, in 1000mL water, pH-7.0
DNA size marker (100 bp ) Fermentas-Thermo Fisher Scientific, USA
DNA size marker (50 bp) Fermentas-Thermo Fisher Scientific, USA
EDTA buffer 10% EDTA, 0.5% NaF, 0.5% thymol, 1% Tris (pH 7.5)
Ethidium bromide 0.00001% in 1% agarose
Fahraeus N-free medium CaCl2- 0.1 g, MgSO4.7H2O- 0.12 g, NaCl- 0.2 g KH2PO4- 0.1
g, Na2HPO4- 0.15 g, C6H5+4yFexNyO7 - 0.005 g and trace
element solution-1mL in 1000 mL water.
HOMOPIPES (pH 4.5) Sigma-Aldrich, Germany
HEPES (pH 6.8–8.2) Sigma-Aldrich, Germany
Jensen N-free solution CaHPO4- 1.0, K2HpO4- 0.2g, MgSO4.7H2O- 0.2 g, NaCl- 0.2 g,
FeCl3- 0.1 g, trace element solution-1 mL in 1000 mL water
Lysis buffer 40 mM Tris-acetate, pH 7.8, 20 mM sodium acetate, 1 mM
EDTA, 75 mM NaCl, 1% SDS
Lysogeny broth Tryptone- 10 g, Yeast extract- 5g, NaCL- 10g per litre water
MES (pH 5.5) Sigma-Aldrich, Germany
Nucleotide mix 2.5 mM dATP, 2.5 mM dCTP, 2.5 mM dGTP, 2.5 mM dTTP
PCR buffer (10X) 100 mM Tris-HCl, 500 mM KCl, 5% TritonX-100, 15 mM MgCl2
(pH 8.5)
Phenol/chloroform/isoamyl alcohol C6H5OH/ CHCl3/C5H12O in ratio 25:24:1
SDS solution- 10% C12H25NaO4S in water
Sodium chloride solution- 5M NaCl in water (saturated)
Sodium hypochloride solution-3% NaOCl in water
TAE buffer 40 mM Tris, 1 mM EDTA, acetic acid (pH 8.0)
TBA buffer 1 M Tris, 89 mM boric acid, 10 mM EDTA, pH 8.6
TE buffer 10 mM Tris-HCl, 1 mM EDTA (pH 8.0)
Trace element solution Bo- 0.05%,Mn- 0.05%, Zn- 0.005%,Cu- 0.002%,pH- 6.5-7.0
Tryptone agar medium Tryptone- 5 g, yeast extract- 3.0 g, CaCl2- 0.66 g, agar- 18 g,
pH-7.0 in 1000 mL water
λ-PSTI size standard Fermentas-Thermo Fisher Scientific, USA
Yeast extract mannitol agar medium Mannitol (C6H8(OH)6)-10 g, yeast extract-1.0 g, K2HPO4-0.5 g,
MgSO4,7H2O- 0.2 g, NaCl- 0.2 g, agar- 18 g, in 1000 mL
water, pH-7.0

40
Research projects

3.1 Project 1: Genetic diversity of rhizobia nodulating lentil (Lens

culinaris) in Bangladesh

3.1.1 Abstract
In order to determine the bacterial diversity and the identity of rhizobia nodulating lentil in
Bangladesh, we performed a phylogenetic analysis of housekeeping genes (16S rRNA,
recA, atpD and glnII) and nodulation genes (nodC, nodD and nodA) of 36 bac terial
isolates from 25 localities across the country. Maximum likelihood (ML) and Bayesian
analyses based on 16S rRNA sequences showed that most of the isolates (30 out of 36)
were related to Rhizobium etli and Rhizobium leguminosarum. Only these thirty isolates
were able to re-nodulate lentil under laboratory conditions. The protein-coding
housekeeping genes of the lentil nodulating isolates showed 89.1 – 94.8% genetic
similarity to the corresponding genes of Rhizobium etli and Rhizobium leguminosarum.
The same analyses showed that they split into three distinct phylogenetic clades. The
distinctness of these clades from closely related species was also supported by high
resolution ERIC-PCR fingerprinting and phenotypic characteristics such as temperature
tolerance, growth on acid-alkaline media (pH 5.5 – 10.0) and a ntibiotic sensitivity. Our
phylogenetic analyses based on three nodulation genes (nodA, nodC and nodD) and
cross-inoculation assays confirmed that the nodulation genes are related to those of
Rhizobium leguminosarum symbiovar viciae, but clustered in a distinct group supported
by high bootstrap values. Thus, our multi-locus phylogenetic analysis, DNA fingerprinting
and phenotypic characterizations suggest that at least three different clades are
responsible for lentil nodulation in Bangladesh. These clades differ from the Rhizobium
etli–Rhizobium leguminosarum group and may correspond to novel species in the genus
Rhizobium.

Key words: Rhizobium; Lens culinaris; Nodulation; Multi locus analysis; Fingerprinting;
Phylogeny

41
3.1.2 Introduction
Rhizobia are a group of bacteria that have the capacity to form nodules on legume roots
(and occasionally on stems) and can fix atmospheric nitrogen to partially or fully meet the
nitrogen requirements of the plant. An effective symbiotic relationship between the
bacteria and the plant hosts is crucial for the legume to achieve maximum growth
efficiency. Lentil (Lens culinaris) is an important and popular legume in many countries
for human and animal nutrition as well as for soil fertility management. Lentil can meet its
full or partial nitrogen requirement for growth and development from its symbiotic partner.
The lentil is indigenous to the Near East and Central Asia, and its history in agriculture is
probably as old as that of agriculture itself. The putative progenitor of modern cultivated
lentils has been distributed from this region to the other continents (Shandu & Singh,
2007; and references therein). It is believed that the cultivated lentil originated in the
Turkey-Cyprus region, and that the centre for diversification is South Asia. The lentil was
introduced to India by 2,500 years BC and it is commonly known as “Measure” in all
Indian states (Nene, 2006; Sonnante et al., 2009) including Bangladesh and Pakistan.

Bangladesh also possesses a long history of lentil cultivation. To our knowledge, there is
no historical record of the introduction of the lentil to Bangladesh, but it has been
cultivated in this region for a l ong time. Bangladesh is a s mall South Asian country
surrounded by various Indian states. These surrounding states share cultural sim-ilarities
with Bangladesh, including linguistic similarities and a n agricultural history. Linguistic
comparisons for example show that the Hindi word ‘Masur’ is found to have the same
meaning (‘lentil’) in India, Bangladesh and Pakistan. These three countries make up the
Indian subcontinent, and we can assume an early beginning for the cultivation of lentils
in Bangladesh from around 2,500 years BC.

R. leguminosarum symbiovar viciae usually nodulates legumes of the tribe Vicieae

(Laguerre et al., 2003; Santillana et al., 2008; Hou et al., 2009), and this symbiosis may
be very specific (Tian et al., 2010). From the analysis of several isolates, Santillana et al.
(2008) concluded that the taxonomic status of R. leguminosarum is not clear, and
proposed a taxonomic revision of this rhizobial species based on a polyphasic approach
(a consensus type of taxonomy utilizing all the available data to describe consensus
groups). However, most of the rhizobial strains isolated so far from legumes of the tribe
Vicieae belong to the R. leguminosarum species complex (R. leguminosarum, R. fabae
and R. pisi) (Álvarez-Martinez et al., 2009). It has also been shown that certain rhizobial
species can only nodulate a single species of legume and that certain legumes can only
42
be nodulated by a s ingle rhizobial species. There are currently six recognized species
within the genus Rhizobium that form nodules with the common bean (Valverde et al.,
2006; and references therein).

Nodulation and cross-inoculation assays are necessary to determine the host range of
rhizobial species, and nucleotide sequences from nodulation genes may be us ed to
provide complementary information. Gene transfer and rearrangement of symbiotic plas-
mids can occur under natural conditions, depending on t he donor and r ecipient strains
(Geniaux & Amargr, 1993; Zhang et al., 2001) and therefore different strains of the same
rhizobial species may carry similar or different nod genes. This incongruence is generally
explained by lateral gene transfer in rhizobia (Han et al., 2010; and references therein). To
take account of differences among strains within the same species, different symbiovars
have been described for same bacterial species. Three symbiovar (viciae, phaseoli, trifolii)
have been described in R. leguminosarum, and these biovars were later also described in
other species of rhizobia. The same symbiovar can also occur in different species of
rhizobia (Perret et al., 2000). Moreover, based on t he description of pathovars in
pathogenic bacteria, symbiotic variants or symsymbiovars have recently been pr oposed
for describing the adaptive behavior of rhizobia with regard to their legume host, and
different symsymbiovars should be distinguished by host ranges as well as by gene
sequences (Rogel et al., 2011; and references therein).

In prokaryotic identification and systematics, the analysis of genes coding for the SSU
rRNA is one of the most widely used classification techniques. However, for the
description of new species or higher taxonomic levels of bacteria, phylogenetic analyses
based on 16S rRNA sequences should be integrated into a p olyphasic approach like
multilocus sequence analysis (MLSA) with phenotypic characterization and DNA
fingerprinting (Mutch & Young, 2004; Ludwig & Klenk, 2005; Konstantinidis et al., 2006).
DNA fingerprints can be useful in determining the stability of dominant members of a
community in large sampling projects (Hamady & Knight, 2009).

Although several studies have been c arried out to assess the diversity and identity of
rhizobia that nodulate members of the tribe Vicieae, there are few reports investigating
rhizobia isolated from lentil. The studies performed on lentil rhizobia so far have mainly
evaluated their symbiotic performance on plant growth and h ave described their
biochemical characteristics and stress (salt and temperature) tolerance (Tegegn, 2006).
The diversity of lentil-nodulating rhizobia has also been described on the basis of
plasmid profiles, RFLP and rep-PCR (repetitive element sequence-based PCR), but no
43
sequence information is currently available (Laguerre et al., 1992; Geniaux & Amargr,
1993; Tegegn, 2006). To our knowledge no phylogenetic analyses have yet been
performed on lentil rhizobia using a MLSA approach.

In order to increase our knowledge of the genetic diversity of rhizobial populations

associated with members of the Vicieae, specifically with lentil, and to determine the
taxonomic position and identity of lentil symbionts, we collected field-grown lentil nodules
from different localities in Bangladesh and performed polyphasic analyses on the
isolated bacteria.

3.1.3 Materials and methods

Nodule collection, isolation of bacteria

Detail descriptions of the methods are available in chapter 2 (materials and methods).

Plant infection and nodule effectiveness assays

Methods are available in chapter 2.

Phenotypic characterization of isolates

Methods used for phenotypic characterization are available in chapter 2.

DNA isolation, PCR amplifications, gene sequencing and ERIC

fingerprinting
Detail descriptions of the methods are available in chapter 2.

Phylogenetic analyses
Detail descriptions for phylogenetic analyses are available in chapter 2.

44
3.1.4 Results

Isolation and purification of rhizobia

Single colony from isolated rhizobia were purified by repeated streaking on C RYEMA
medium as described earlier and, colony morphology and cell shape have shown in the
Fig. 3 and Fig. 8 respectively.

A (40X) B (100X)
Fig. 8. Shape of lentil-nodulating rhizobia

Nodulation and cross-inoculation

The nodulation efficiency of all isolates was tested on lentil; out of 36 isolates, 30 were
able to induce the formation of nodules within 2 – 3 weeks after inoculation (Fig. 5). In
cross-inoculation tests, all 10 i solates out of a r andomly selected set (BLR9, BLR28,
BLR45, BLR58, BLR100, BLR105, BLR154, BLR175, BLR195, and BLR235) were able
to form nodules with both L. sativus and P. sativum (Fig. 6).

Symbiotic effectiveness assays

Symbiotic effectivity test were performed using sterile sand under glasshouse conditions
(Fig. 7) using selected Bangladeshi isolates. Under glasshouse conditions all tested
isolates [(BLR9, BLR26, BLR28, BLR41, BLR58, BLR87, BLR98, BLR99, BLR100,
BLR105, BLR122, BLR129, BLR137, BLR139, BLR175, BLR228, BLR235, split into
three clades (I – III), according to phylogenetic analyses, see below)], R. leguminosarum
symbiovar viciae 3841 and the un-inoculated nitrogen-fertilized control treatment showed
a significant effect (ANOVA, P < 0.05) on lentil dry matter weight production compared to
the un-inoculated, un-fertilized control (table 10B). Moreover, significant differences in
nodulation and plant growth were observed (ANOVA, P < 0.05) when comparing only the
three clades (table 10D). When comparing all BLR isolates as one g roup with R.
leguminosarum symbiovar viciae 3841, significant differences (ANOVA, P < 0.05) were
45
observed in lentil nodulation, but we did not find significant differences for plant dry
matter weight production (ANOVA, P < 0.071) (table 10F).

Table 10 (A – H). Symbiotic effectivity of lentil rhizobia on growth of lentil

A. Effect of Bangladeshi isolates, R. leguminosarum (Rlv3841) and nitrogen on lentil

growth (descriptive statistics)

Treatments Number of Plant weight (mg) Nodule weight (mg)

observations mean std. std. mean std. mean
deviation error deviation
Clade- I 55 473.96 112.45 15.16 24.49 7.92 1.06

Clade-II 20 539.50 98.45 22.01 26.68 8.92 1.99

Clade-III 10 643.90 47.02 14.87 44.86 6.35 2.00

Rlv 5 413.20 17.76 7.94 16.06 .58 0.26

nitrogen 5 615.00 9.24 4.13 0.00 0.00 0.00

control 5 365.80 37.53 16.78 0.00 0.00 0.00

Total 100 502.67 117.33 11.73 24.09 12.65 1.26

B. Effect of Bangladeshi isolates, R. leguminosarum (Rlv3841) and nitrogen on lentil

growth (ANOVA)

Source of Plant weight (mg) Nodule weight (mg) df sig.

variation sum of mean F sum of mean F stat.
square square stat. square square
Between group 468692.68 93738.53 9.85 10583.21 2116.64 37.72 5 0.00

Within group 894185.42 9512.61 5273.77 56.10 94

Total 1362878.11 15856.98 99

C. Effect of Bangladeshi isolates on lentil growth (clades-wise, descriptive statistics)

Treatments Number of Plant weight Nodule weight (mg)

observations mean std. std. error mean std. std.
deviation deviation error
Clade- I 55 473.96 112.45 15.16 24.49 7.92 1.06

Clade-II 20 539.50 98.45 22.01 26.68 8.92 1.99

Clade-III 10 643.90 47.02 14.87 44.86 6.35 2.00

Total 85 509.38 117.26 12.71 27.40 10.23 1.11

46
Table 10 (A – H). Symbiotic effectivity of lentil rhizobia on growth of lentil (cont.)

D. Effect of Bangladeshi isolates on lentil growth (clades-wise, ANOVA)

Source of variation Plant weight (mg) Nodule weight (mg) df sig.

sum of mean F stat. sum of mean F
square square square square stat.
Between group 268088.12 134044.06 12.39 3523.61 1761.80 27.40 2 0.00

Within group 886945.82 10816.41 5272.42 64.29 82

Total 1155033.95 8796.03 84

E. Effect of Bangladeshi isolates and R. leguminosarum (descriptive statistics)

Treatments Number of Plant weight (mg) Nodule weight (mg)

observations mean Std. Std. mean std. std.
deviation error deviation error
Bangladeshi 85 509.38 117.26 12.71 27.40 10.23 1.11
isolates
Rlv3841 5 413.20 17.76 7.94 16.06 0.58 0.26

Total 90 504.03 116.11 12.24 26.77 10.28 1.08

F. Effect of Bangladeshi isolates and R. leguminosarum ( ANOVA)

Source of Plant weight (mg) Nodule weight (mg) df Sig.

variation sum of square mean F sum of mean F plant nodule
square stat. square square stat.
Between 43680.14 43680.14 3.32 607.76 607.76 6.07 1 0.07 0.01
group
Within 1156296.75 13139.73 8797.39 99.97 88
group
Total 1199976.90 9405.15

47
Table 10 (A – H). Symbiotic effectivity of lentil rhizobia on growth of lentil (cont.)

G. Effect of rhizobial inoculation over control on lentil growth (descriptive statistics)

Isolates/ Replication Plant weight (mg) Nodule weight (mg)

nitrogen mean std. std. mean std. std.
deviation error deviation error
BLR-9 5 377.20 38.38 17.16 26.14 2.96 1.32
BLR-26 5 425.60 25.96 11.61 41.26 4.82 2.15
BLR-41 5 415.40 34.23 15.30 14.28 1.29 0.58
BLR-58 5 480.60 54.56 24.40 22.50 3.04 1.36
BLR-87 5 602.60 24.31 10.87 27.80 3.11 1.39
BLR-98 5 389.00 11.81 5.28 33.52 3.18 1.42
BLR-100 5 585.00 47.89 21.41 18.32 2.78 1.24
BLR-105 5 318.00 21.09 9.43 17.12 2.94 1.31
BLR-122 5 380.80 35.78 16.00 21.98 2.90 1.30
BLR-137 5 624.40 25.62 11.46 22.52 2.46 1.10
BLR-139 5 615.00 22.77 10.18 23.98 4.52 2.02
BLR-62 5 521.20 47.79 21.37 18.32 4.36 1.95
BLR-99 5 545.80 57.84 25.86 24.42 4.31 1.93
BLR-129 5 421.60 25.18 11.26 39.74 2.41 1.08
BLR-175 5 669.40 28.99 12.96 24.26 4.57 2.04
BLR-228 5 645.00 645.00 15.70 40.56 4.50 2.01
BLR-235 5 642.80 642.80 27.34 49.16 4.91 2.20
Rlv3841 5 413.20 413.20 7.94 16.06 0.58 0.26
Nitrogen 5 615.00 615.00 4.13 0.00 0.00 0.00
control 5 365.80 365.80 16.78 0.00 0.00 0.00
Total 100 502.67 502.60 11.73 24.09 12.65 1.26

H. Effect of rhizobial inoculation over control treatment on lentil growth (ANOVA)

Source of Plant weight (mg) Nodule weight (mg) df sig.

variance sum of mean F stat. sum of mean F stat.
square square square square
between group 1258438.11 66233.58 50.73 14962.61 787.50 70.44 19 0.00
within group 104440.00 1305.50 894.37 11.18 80
Total 1362878.11 15856.98 99

16S rRNA gene

From 36 isolates, 1040 – 1400 base pairs (bp) were obtained from the 16S rRNA gene.
The maximum likelihood (ML) phylogenetic tree based on 16S rRNA reveals that most of
the isolates (approximately 83%) cluster together with, among others, R. etli CFN42, R.
leguminosarum, R. fabae and R. pisi (Fig. 9). A BLAST search with these sequences
shows a hi gh similarity (99 – 100%) to R. etli (30 isolates). The genetic similarity (p-
distance) inferred from the 16S rRNA sequences of lentil-nodulating bacteria was 99.8%
to R. etli CFN 42 and 98.9% to R. leguminosarum USDA 2370 ( table 11). The non-
nodulating isolates were closely related to Ensifer sp., R. huautlense, R. giardinii, R.
tumefaciens and R. radiobacter.
48
 BLR26 (JN648904)
BLR27(JN648923)
BLR160(JN648929)
BLR27(JN648905)
BLR33(JN648908)
BLR100(JN648920)
BLR122(JN648922)
BLR139(JN648926)
BLR174 (JN648930)
BLR9(JN648902)
BLR28(JN648906)
BLR45(JN648911)
BLR29(JN648907)
BLR105 (JN648921)
BLR87(JN648917)
BLR57(JN648913)
BLR58(JN648914)
BLR137(JN648925)
BLR41(JN648910)
BLR59(JN648915)
BLR98(JN648918)
R. etli CIAT613 (AF313905)
R. etli SCAU46 (FJ785220)
R. etli SCAU18 (FJ785221)
R. etli symbiovar mimosae Mim7 (DQ648575)
R. etli CFN42T (U28916)
R. etli 12a3 (FN433083)
BLR175(JN648931)
BLR228(JN648933)
BLR99 (JN648919)
R. etli CCBAU65830 (EU618034)
BLR129 (JN648924)
BLR153(JN648927)
BLR195 (JN648932)
BLR154 (JN648928)
BLR235(JN648934)
R. etli PEPSM15 (DQ196417)
BLR62(JN648916)
R. etli RP368 (DQ406706)
R. pisi DSM30132T (AY509899)
93
R. etli CIAT 652 (CP 001074)
R. fabae CCBAU33202 (DQ835306)
98 R. hainanense I66T (U71078)
99 R. miluonense CCBAU41251T (EF061096)
R. rhizoagenesIFO13257T (D14501)
71 R. leguminosarum CCNWXJ0177 (FJ449680)
R. leguminosarum symbiovar viciae ATCC 1004T (U29386)
R. leguminosarum symbiovar trifolii Len4 (FJ593639)
R. leguminosarum CCBAU65761 (EU618030)
75 R. leguminosarum ICMP14642 (AY491062)
R. leguminosarum RPVF18 (GQ863496)
R. leguminosarum V6 (GU306144)
R. mesosinicum CCBAU41044 (AY395697)
R. mesosinicum CCBAU25010T (DQ100063)
91 Ensifer sp T173 (EU928871)
BLR39 (JN648909)
87 E. fredii LMG6217T (X67231)
E. meliloti LMG6133T (X67222)
R. giardinii H152T (U86344)
99 R. giardinii CCBAU45226 (GU565533)
R. herbae CCBAU01209 (GU565531)
BLR12 (JN648903)
99 R. rubi IFO13261T (D14503)
R. radiobacter LMG 196 (X67223)
87 BLR46(JN648912)
99 96 R. galegae LMG6214T (X67226)
R. vignae CCBAU05176T (GU128881)
80 R. cellulosilyticum ALA10B2T (DQ855276)
BLR288(JN648936)
84 BLR281(JN648935)
BLR299(JN648937)
R. huautlense SO2T (AF025852)
99 M. huakuii IAM14158T (D12797)
99 M. loti LMG6125T (X67229)
M. ciceri UPM-Ca7T (U07934)
B. japonicum ATCC 10324T (U69638)
B. yuanmingense B071 (AF193818)

0.02

Fig. 9. ML tree based on 16S rRNA gene partial sequences. Bootstrap values indicated
when ≥ 70% (1000 replicates). Abbreviations used: BLR: Bangladeshi lentil rhizobia,
R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium.

49
Protein-coding housekeeping genes
We were able to amplify approximately 500 bp of the partial recA gene from 33 isolates
with the primers described previously (Gaunt et al., 2001) but were unable to amplify a
fragment from the three remaining isolates (BLR281, BLR288 and BLR299). Con-
sidering the recA gene, lentil rhizobia showed 91.7 and 92.1% similarity to R.
leguminosarum and R. etli, respectively. The partial atpD gene (approximately 550 b p)
showed 89.1% similarity to R. leguminosarum and 94.4% to R. etli CFN42. The partial
glnII gene sequences (approximately 750 bp) showed 92.8% similarity to R.
leguminosarum USDA2370 and 9 4.8% to R. etli CFN42 (table 10). In the ML trees,
based on the partial recA, atpD and glnII gene sequences, lentil-nodulating Isolates form
three separate clades (I, II and III, see Figs. 10 – 12). These isolates form monophyletic
groups that differ from R. etli, R. leguminosarum, R. fabae and R. pisi. The ML trees
based on concatenated sequences (16S rRNA + recA + atpD and 16S rRNA + recA +
atpD + glnII) revealed congruent topologies (Fig. 16 and Fig. 17).

Table 11. Average genetic similarity among clades and to R etli, R. leguminosarum

Isolates / clades 16S atpD recA glnII

R. etli / nodulating isolates 99.8 94.4 92.1 94.8

R. leguminosarum / nodulating isolates 98.9 89.1 91.7 92.8

R. etli / Clade I 99.8 94.5 91.4 94.8

R. etli / Clade II 99.7 94.4 96.4 94.7

R. etli / Clade III 99.8 93.8 88.8 94.8

R. leguminosarum / Clade I 98.9 89.3 92.1 92.0

R. leguminosarum / Clade II 98.8 88.6 90.4 93.1

R. leguminosarum / Clade III 99.0 88.7 91.1 93.7

Clade I / Clade II 99.7 93.8 90.8 95.1

Clade I / Clade III 99.8 94.0 91.7 96.2

Clade II / Clade III 99.8 93.6 89.1 94.3

50
 BLR139 (JN649052)
BLR160 (JN649055)
BLR137 (JN649051)
BLR127 (JN649049)
BLR105 (JN649047)
BLR100 (JN649046)
BLR98 (JN649044)
BLR87(JN649043)
BLR59 (JN649041)
BLR58 (JN649040)
BLR57 (JN649039) Clade I
BLR45 (JN649037)
BLR41(JN649036)
BLR33 (JN649034)
100 BLR29 (JN649033)
BLR28 (JN649032)
BLR27 (JN649031)
BLR26 (JN649030)
71 BLR9 (JN649028)
BLR174 (JN649056)
97 BLR122 (JN649048)
R. etli CIAT652 (NC010994)
98 Rhizobum sp PEPSM14 (EF113131)
R. leguminosarum PEPSM13 (EF113130)
R. etli symbiovar phaseoli IE950 (AY907460)
99 R. etli symbiovar phaseoli KIM5 (AY907360)
R. etli symbiovar phaseoli IE2755 (AY907465)
R. etli symbiovar phaseoli GR12 (AY907361)
100
BLR 228 (JN649059)
BLR 195 (JN649058) Clade III
BLR 235 (JN649060)
82
99 R. fabae CCBAU23123 (EF579937)
94 R. pisi DSM30132T (EF113134)
R. leguminosarum USDA 2370 T (AJ294376)
86
R. leguminosarum symbiovar viciae 3841 (NC008380)
Rhizobium sp PEVF08 (EF113126)
R. etli PEPSM15 (EF113132)
90 R. etli USDA9032T (AJ294375)
BLR 62 (JN649042)
86 91 BLR 153 (JN649053)
100 BLR 175 (JN649057) Clade II
BLR 99 (JN649045)
98 BLR 129 (JN649050)
BLR 154 (JN649054)
93 R. tropici USDA9039 (AJ294372)
R. rhizogenes NCPPB2991 (AJ294374)
R. multihospitium CCBAU83401T (EF490029)
R. miluonense CCBAU41251T (HM047131)
R. hainanense CCBAU57015 (HM047132)
99 R. galegae USDA4128 (AJ294378)
R. vignae CCBAU05176T (GU128902)
91 R. huautlense LMG18254T (AM182128)
R. cellulosilyticum LMG 23642T (AM286427)
R. rubi LMG140T (AM182122)
96 R. radiobacter NCPPB2437T (AJ294377)
BLR 46 (JN649038)
72 R. giardinii H152T (EU488819)
BLR 12 (JN649029)
R. herbae CCBAU85050T (GU565545)
BLR 39 (JN649035)
72 E. fredii USDA205T (AJ294379)
E. meliloti USDA1002T (AJ294382)
86 M. loti USDA3471T (AJ294371)
79 M. ciceri USDA3383T (AJ294367)
M. huakuii USDA4779T (AJ294370)
B. elkanii USDA76T (AY591568)
99
B. yuanmingense (AM168343)
Bradyrhizobium sp SEMIA6077 (FJ391163)
100 B. japonicum SEMIA511 (FJ391142)
T
98 B. japonicum USDA6 (AM168341)
B. japonicum LMG6138 (AM182158)

0.05

Fig. 10. ML tree based on recA gene partial sequences. Bootstrap values indicated
when ≥ 70% (1000 replicates). Abbreviations: BLR: Bangladeshi lentil rhizobia,
R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium.

51
 BLR57 (JN648949)
BLR59 (JN648951)
BLR45 (JN648947)
BLR41 (JN648946)
BLR29 (JN648943)
85 BLR28 (JN648942)
BLR27 (JN648941)
BLR26 (JN648940)
BLR9 (JN648938)
88 BLR33 (JN648944) Clade I
BLR98 (JN648954)
BLR105 (JN648957)
BLR122 (JN648958)
72 BLR160 (JN648965)
BLR58 (JN648950)
BLR100 (JN648956)
BLR174 (JN648966)
BLR127 (JN648959)
BLR137 (JN648961)
BLR139 (JN648962)
R. mesosinicum CCBAU 25010 (NR043548)
BLR62 (JN648952)
R. tropici USDA9039 (AJ294396)
83 R. rhizogenes NCPB2991T (AJ294398)
R. miluonense CCBAU41251T (HM047116)
R. multihospitium CCBAU83401T (EF490019)
R. hainanense CCBAU5701T (GU726293)
R. radiobacter NCPB2437T (AJ294407)
BLR46 (JN648948)
R. cellulosilyticum LMG23642T (AM286426)
BLR12 (JN648939)
BLR39 (JN648945)
96 R. vignae CCBAU05176T (GU128888)
72 R. galegae USDA4128 (AJ294406)
T
100 R. huautlense S02 (AY688589)
BLR 281 (JN648971)
99 BLR 288 (JN648972)
BLR 299 (JN648973)
R. etli CCBAU65708 (EU617991)
100
BLR195 (JN648968)
96 BLR228 (JN648969) Clade III
BLR235 (JN648970)
R. etli USDA9032 T (AJ294404)
BLR99 (JN648955)
99 BLR129 (JN648960)
BLR154 (JN648964) Clade II
BLR153 (JN648963)
BLR175 (JN648967)
99 R. etli CIAT652 (CP001074)
R. etli symbiovar Mim2 (AY929507)
R. etli PEPSM15 (EF113147)
95 R. leguminosarum symbiovar viciae 3841 (EF113141)
91 86 R. leguminosarum CCBAU85025 (EU288659)
R. leguminosarum USDA2370T (AJ294405)
99 R. fabae CCBAU23123 (EF579925)
R. pisi DSM30132T (EF113149)
R. herbae CCBAU85050 (GU565538)
R. giardinii CCBAU45226 (GU565541)
E. fredii USDA205 T (AJ294402)
E. meliloti USDA1002T (AJ294400)
100 M. ciceri USDA3383T (AJ294395)
M. huakuii USDA4779T (AJ294394)
M. loti USDA3471T (AJ294393)
100 B. elkanii USDA76T (AY386758)
B. japonicum USDA6T (AM168320)
B. yuanmingense CCBAU10071 (AY386760)

0.02

Fig. 11. ML tree based on atpD gene partial sequences. Bootstrap values
indicated when ≥ 70% (1000 replicates). Abbreviations: BLR: Bangladeshi lentil
rhizobia, R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium.

52
 99 BLR195 (JN648980)
Clade III
BLR235 (JN648981)
100 R. etli symbiovar phaseoli IE954 (AY907409)
R. etli symbiovar phaseoli KIM5S (AY929463)
99 R. etli SCAU46 (FJ799727)
R. etli symbiovar phaseoli GR12 (AY929464)
R. etli CIAT652 (CP001074)
BLR28 (JN648977)
99 Clade I
BLR27 (JN648976)
BLR9 (JN648974)
R. etli (AF169585)
99 BLR153 (JN648978)
Clade II
BLR175 (JN648979)
R. leguminosarum symbiovar viciae USDA2500 (GQ323651)
98 R. leguminosarum symbiovar viciae Nvf1 (GQ323655)
70
R. leguminosarum symbiovar viciae USDA2498 (GQ323649)
R. leguminosarum symbiovar viciae J1 (GQ323654)
100 R. fabae CCBAU23127 (EF579932)
R. girdinii CCBAU33202 (EF579935)
98 R. leguminosarum symbiovar viciae CCBAU33204 (GQ323622)
92 R. leguminosarum symbiovar viciae CCBAU43240 (GQ323623)
95 R. leguminosarum USDA2671 (EU488784)
R. leguminosarum symbiovar viciae USDA2370 T (AF169586 )
R. vignae CCBAU05176T (GU128895)
R. herbae CCBAU85050 (GU565552)
100 R. tropici USDA9030 (AF169584)
95
R. tropici CIAT899T (EU488791)
R. multihospitium CCBAU83401T (EF490040)
R. yanglingense SH22623T (AY9294620)
97 R. girdinii CCBAU41230 (GU565554)
100 R. girdinii CCBAU45226 (GU565555)
BLR12 (JN648975)
R. girdinii CCBAU45157 (HM070216)
100 BLR299 (JN648982)
R. huautlense SCAU12 FJ799723 (FJ799723)
Rhizobium sp CCBAU45157 (HM070216)
100 E. meliloti USDA1002T (AF169593)
99 E. medicae A321 (AF169592)
E. saheli ORS609 (AF169589)
E. mexicanus HAMBI 2910T (GU994064)
98 M. huakuii USDA 4779 (AF169588)
M. ciceri USDA3383T (AF169580)
M. tianshanense USDA3592T (AF169579)
M. loti LMG6125 T (AF169581 )
B. elkanii ICMP3638 (AY494804)
B. japonicum USDA6 T (AF169582)

0.02

Fig. 12. ML tree based on glnII gene partial sequences. Bootstrap values
indicated when ≥ 70% (1000 replicates). Abbreviations: BLR: Bangladeshi lentil
rhizobia, R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium.

53
Nodulation genes
We amplified three nodulation genes from lentil isolates that were able to form nodules
under laboratory conditions, namely nodA, nodC and nodD (table 6). The nodulation
gene sequences showed high similarity to R. leguminosarum symbiovar viciae. Our
phylogenetic analyses based on nod ulation genes (nodA, nodC and nodD) revealed a
close relationship to R. leguminosarum symbiovar viciae, but most of the isolates form
distinct clade supported by high bootstrap values (99%, see Figs. 13 – 14 and Fig. 19).

In general, the phylogenetic analyses based on single gene and concatenated

sequences of housekeeping genes, resulted in congruent topologies that supported the
relationship to R. etli but formed three distinct monophyletic groups (Figs. 10 – 12 and
Figs. 16 – 17). However, the phylogenetic analyses based on the sequences of the three
nodulation genes showed that these three new clades harbor almost identical nodulation
genes (Figs. 13 – 14 and Fig. 19) and congruence was absent between chromosomal
gene and nodulation gene phylogeny.

DNA fingerprinting
The DNA fingerprints showed three (I – III) different, well-defined banding patterns (see
Fig. 15). The NJ analyses based on hi gh resolution ERIC-PCR fingerprints revealed
three different clusters. These clusters can be distinguished from each other as well as
from R. etli and R. leguminosarum (Fig. 18a). The principal coordinate analysis (PCoA)
showed three non-overlapping clusters and also demonstrated the distinctness of R. etli
and R. leguminosarum with high bootstrap values (Fig. 18b).

54
 BLR175 (JN648991)

BLR153 (JN648989)

BLR129 (JN648988)

BLR99 (JN648987)
100
genotype I
BLR33 (JN648985)

BLR28 (JN648984)

BLR9 (JN648983)

94 BLR57 (JN648986)

BLR174 (JN648990) genotype II

100
R. leguminosarum symbiovar viciae 201ZG (DQ286900)
symbiovar
viciae
BLR228 (JN648992)
91 99
R. leguminosarum VT608 (FJ715818)

R. trifolii (X03721)
99 100

R. leguminosarum symbiovar trifolii (AY904443)

R. galegae HAMBI1207 (AJ300240)

76 100

R. galegae HAMBI174 (X87578)

E. fredii NGR234 NC (000914)

94
R. etli CFN42 T (U80928)
100

R. leguminosarum symbiovar phaseoli ICMP2672 (DQ100403)

M. loti NZP2213 (L06241)

R. tropici CFN299 (X98514)

99

R. giardinii bv.giardinii H152 T (AJ300238)

Bradyrhizobium sp CH2310 CH2310 (AM117514)

99
B. japonicum USDA110 (NC004463)
99

98 Bradyrhizobium sp ORS1812 (AJ430723)

B. elkanii USDA94 (U04609)

0.05

Fig. 13. ML tree based on nodA gene partial sequences. Bootstrap values indicated
when ≥ 70% (1000 replicates). Abbreviations: BLR: Bangladeshi lentil rhizobia,
R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium.

55
 BLR100 (JN649003)
BLR105 (JN649004)
BLR62 (JN649000)
BLR57 (JN648999)
BLR45 (JN648998)
BLR41 (JN648997)
BLR33 (JN648996)
BLR29 (JN648995) genotype I
77
BLR175 (JN649001)
BLR129 (JN649006)
BLR235 (JN649013)
BLR153 (JN649008)
99
BLR99 (JN649002)
BLR26 (JN648994)
BLR9 (JN648993)
BLR127 (JN649005)
100 R. multihospitium CCBAU83401T(EF050781)
R. leguminosarum symbiovar viciae (DQ413004)
98
Rhizobium sp. CVIII14 (FJ596021)
Rhizobium sp. MVP07 (FJ596024)
R. leguminosarum VF25 (AY664622)
BLR160 (JN649009)
R. leguminosarum PEVF05 (FJ596028)
91 BLR98 (JN649001) genotype II
91 (symbiovar viciae)
BLR174 (JN649010)
BLR139 (JN649007)
79 R. leguminosarum CCBAU71205 (EU177612)
99
R. leguminosarum PEVF01 (FJ596025)
97
BLR195 (JN649012)
78
R. leguminosarum RVS03 (FJ596018)
R. leguminosarum ATCC14480T(FJ895269)
100
R. leguminosarum symbiovar trifolii (AF217271)
Ensifer sp. NGR234 (U00090)

100 M. tianshanense RCAN03 (DQ407285)

80 M. ciceri UPMCa7 (DQ407292)
Rhizobium sp. N33 (U53327)
R. giardinii symbiovar giardiniiT(AF217267)
79 R. etli symbiovar phaseoli CFN42T (AF217268)
100
R. gallicum symbiovar phaseoli (AF217265)
99
R. giardinii symbiovar phaseoli (AF217264)
98
R. etli symbiovar phaseoli VikingI (AF217262)
M. gobiense CCBAU83346 (EF549524)
B. japonicum CPAC7 (DQ485695)
100
B. elkanii IFO14791T(AB354631)

0.05

Fig. 14. ML tree based on nodC gene partial sequences. Bootstrap values indicated
when ≥ 70% (1000 replicates). Abbreviations used: BLR: Bangladeshi lentil rhizobia,
R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium.

56
 Cluster I Cluster II Cluster III

R.leg

R.etli
R.leg
Retli
R.leg
Retli

129
175

195
228
235
100
105
122
134
174

99
26
27
28
29
33
41
45
57
58
87
98

Fig. 15. High resolution ERIC-PCR fingerprint for rhizobial isolates and closely related
species including Rhizobium etli CFN 42 and R. leguminosarum 3841. Abbreviations
used: R.etli = Rhizobium etli, R.leg = Rhizobium leguminosarum.

57
Phenotypic characterization
The brief phenotypic characteristics of the lentil isolates are listed briefly in table 12.
Cells were aerobic, Gram-negative, and r od-shaped. After 48 h o f inoculation on YMA
media, the diameter of the creamy-white colonies ranged between 1.5 and 2.0 mm, and
most of the isolates produced mucilage after 5 days of incubation (table 13). The majority
of the isolates grew well on alkaline media (pH 10.0) and showed acidic reactions by
producing a yellow coloration on BTB plates. All isolates grew well at 37°C, at pH values
of 5.5 – 10, and on media containing both ampicillin (50 g / mL), and kanamycin (10 g /
mL), while closely related species like R. etli CFN 42 and R. leguminosarum 3841 were
unable to grow under the same conditions. Like R. etli, all isolates (except two) showed
resistance to nalidixic acid (up to 40 g / mL) (see table 13).

However, lentil isolates could not grow on LB medium and were sensitive to NaCl; few
isolates grew even at 1% NaCl. Out of the different tested antibiotics, tetracycline was
the most toxic to lentil isolates; none of the isolates grew on media containing 5 g/mL of
tetracycline. The clade III (phylogenetic clade) was more sensitive to ampicillin than
clades I and I I. None of the isolatess in clade III was able to grow on T Y medium
containing 100 g / mL ampicillin, while 50% of the mem-bers of clade II and 90% of the
members of clade I grew well under the same conditions. Compared to the members of
clades I and II, the members of clade III were also more sensitive to kanamycin. In
contrast to antibiotic sensitivity, clade III was more resistant to NaCl (1%) and g rew
better at pH 10.0 than the members of the other two clades (table 13).

58
Table 12. Brief morpho-physiological characteristics of lentil isolates and their closest
relatives (clade wise)

Characteristics Clade Clade Clade R. etli R.

I II III (CFN42) leguminosarum
( conditions at /
(3841)
in)

Temperature 32 + + + + +
(°C)
37 + + + ─ ─
40 ─ ─ ─ ─ ─
45 ─ ─ ─ ─ ─
pH 4.5 ─ ─ ─ ─ ─
5.5 + + + ± ±
8.2 + + + ─ ─
9.0 + + + ─ ─
10.0 +(76%) + (90%) + ─ ─
NaCl (%) 0.5 + + + ─ ─
1.0 ─ ─ + ─ ─
1.5 ─ ─ ─ ─ ─
Resistance to antibiotics
Ampicillin 50 + + + ─ +
(µg / mL)
75 +(95%) + (50%) ─ ─ ±
100 +(90%) + (50%) ─ ─ ─
125 +(73%) + (16%) ─ ─ ─
150 +(33%) + (16%) ─ ─ ─
Kanamycin 10 + + + ─ +
(µg / mL)
20 +(90%) + (83%) +(66%) ─ ±
10 +(100%) +(100%) +(100%) + ±

Nalidixic 20 +(85%) +(100%) +(100%) + ─

acid (µg / 30 +(85%) +(100%) +(100%) + ─
mL)
40 +(85%) +(100%) +(100%) + ─

59
3.1.5 Discussion

Rhizobia nodulating lentil are closely related to Rhizobium

leguminosarum and Rhizobium etli
The 16S rRNA gene fulfils all of the requirements for a good phylogenetic marker, such
as functional conservation, ubiquitous distribution, conserved size and i nformation
content, and the presence of evolutionary conserved regions alongside highly variable
structural elements (Ludwig & Klenk, 2005). To date, rhizobial strains isolated from the
legume tribe Vicieae were all found to be closely related to R. leguminosarum (Laguerre
et al., 2003; Mutch & Young, 2004; Moschetti et al., 2005; Santillana et al., 2008; Hou et
al., 2009; Tian et al., 2010).

In our study, the 16S rRNA gene analyses showed that out of 36 isolates, 30 isolates
were closely related to R. etli, R. leguminosarum, R. pisi and R. fabae, and only these 30
isolates were able to nodulate lentil under laboratory conditions. The phylogenetic
analyses based on 16S rRNA gene sequences indicated that the main rhizobial isoltes
nodulating lentil in Bangladesh may be related to R. etli. Other isolates that were not able
to form nodules under laboratory conditions showed phylogenetic relationships to
different rhizobial species such as R. huautlense, R. giardini and Ensifer (Sinorhizobium)
sp. These rhizobia do not form nodules with host plant species within the tribe Vicieae,
but have the capacity to form nodules with other legumes (Willems, 2006).

Moreover, we also obtained other bacteria that failed to form nodules under laboratory
conditions, and these were closely related to R. radiobacter (Agrobacterium sp.). There
are numerous reports (Anyango et al., 1995; Zakhia et al., 2006; Li et al., 2008;
Cummings et al., 2009; Ibañez et al., 2009) that this bacterial species is very often
recovered from nodules of naturally growing legumes from around the world. Thus,
although bacteria may lose their nodulation genes during storage (Ibañez et al., 2009),
these results suggest that these non-nodulating isolates may be oppor-tunistic bacteria
capable of lentil nodulation under field conditions, or bacteria that coexist within the
nodule alongside nodulating rhizobia.

60
 BLR29
BLR105
BLR45
BLR9
BLR28
BLR41
77 BLR59
BLR98
BLR27
100
BLR57 Clade I
BLR26
BLR33
BLR122
BLR58
BLR160
BLR100
BLR127
72 BLR139
BLR137
BLR174
99 R. etli CIAT613
89 R. etli CIAT 652
BLR228
100
BLR195 Clade III
BLR235
BLR62
R. etli CFN42T
BLR99
100
BLR129
BLR154 Clade II
BLR153
BLR175
R. etli PEPSM15
99 R. leguminosarum symbiovar viciaeT
100 R. pisi DSM30132T
97 R. fabae CCBAU33202
100 R. rhizogenesT
98 R. hainanenseT
R. miluonense CCBAU41251T
R. mesosinicum CCBAU25010T
100 R. radiobacter LMG 196T
BLR46
R. cellulosilyticum ALA10B2T
89 100 R. galegae LMG6214T
R. vignae CCBAU05176T
77
R. huautlense SO2 T
100 99
BLR281
BLR288
BLR299
99 E. fredii LMG6217T
89 E. meliloti LMG6133T
100
BLR39
BLR12
99
92 R. giardinii CCBAU45226
R. herbae CCBAU01209
M. huakuii IAM14158T
100
95 M. loti LMG6125T
M. ciceri UPM-Ca7T
B. japonicum ATCC10324 T
B. yuanmingense B071

0.02

Fig. 16. ML tree based on concatenated partial sequences of 16S, atpD and recA genes.
Bootstrap values indicated when ≥ 70% (1000 replicates). Abbreviations: BLR: Bangladeshi
lentil rhizobia, R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium.

61
At least three different rhizobial clades are involved in lentil nodulation
Multilocus sequence analysis (MLSA) is considered to be a better approach for
describing the relatedness of different bacterial species by phylogenetic analysis than
the analysis of a single locus (Konstantinidis et al., 2006; Martens et al., 2008). Although
in a t ypical MLSA sequences from six to eight genes are used for strain analysis, an
accurate phylogenetic reconstruction was obtained by using just three of the best-
performing genes (Konstantinidis et al., 2006). MLSA may also uncover horizontal gene
transfer or recombination events occurring in one or more lineages showing incongruent
phylogenetic signals (Konstantinidis et al., 2006). The housekeeping genes recA, atpD
and glnII play vital roles in homologous recombination, ATP synthesis and nitrogen
assimilation, respectively. For closely related species, these three protein-coding genes
are more informative for phylogenetic analysis than 16S rRNA. Although they are under
more stringent functional constraints, they show higher substitution rates than 16S rRNA
and have been proven to be phylogenetically informative (Bromofeld et al., 2010 and
references therein).

In our study, all ML phylogenetic trees based on individual protein-coding housekeeping

genes (recA, atpD, glnII), a tree based on the concatenated sequences of the 16S rRNA,
recA and atpD genes, and a tree based on the concatenated 16S rRNA, recA, atpD and
glnII gene sequences showed similar and congruent topologies (Figs.16 – 17). In
Bayesian Inference analysis, all housekeeping genes, including 16S rRNA, showed
similar congruent results (Figs. Appendix: 1 – 9). By analyzing 16S rRNA, recA, atpD
and ITS nucleotide sequences from several strains isolated from Vicia faba and P.
sativum, Santillana et al. (2008) suggested that several species may be described within
the R. leguminosarum–R. etli group. Our analyses of three protein-coding housekeeping
genes (recA, atpD and glnII) supported three distinct clades separate from R. etli and R.
leguminosarum (Figs. 10 – 12), which suggests that lentil-nodulating rhizobia are related
to R. etli and R. leguminosarum, but correspond to species that are genetically distinct
from the aforementioned species.

62
 R. etli CIAT613
100

R. etli CIAT 652

97

BLR 195
100
Clade III
73 BLR 235

BLR 9

100
93
BLR 27 Clade I

BLR 28

R. etli CFN42T
98
100
BLR 153
100
Clade II
BLR 175

80 R. leguminosarum symbiovar viciaeT

98

R. fabae CCBAU33202

R. vignae CCBAU05176T
100
78 R. huautlense SO2T
100
BLR 299

100 R. herbae CCBAU01209T

99
R. giardinii CCBAU45226
100

BLR 12

E. meliloti LMG6133T

M. huakuii IAM14158T
100
M. loti LMG6125T
96

M. ciceri T

B. japonicum USDA6T

0.02

Fig. 17. ML tree based on the concatenated partial sequences of 16S, atpD, recA and
glnII genes. Bootstrap values indicated when ≥ 70% (1000 replicates). Abbreviations:
BLR: Bangladeshi lentil rhizobia, R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M:
Mesorhizobium.

63
Out of the three clades, clades I and II were found to be distributed throughout
Bangladesh, while clade III was confined to the southeast region of the country (see
localities 1 – 25 in Fig. 4).

The uncorrected genetic distances (similarity levels) based on nucleotide sequences

correspond to an important parameter in the description of rhizobial species. Different
genes are not under the same selection pressures; hence they show different mutation
rates. For example, along with other bacterial genes, the atpD and recA gene sequences
have been us ed (Valverde et al., 2006) to describe a new rhizobial species (R.
lusitanum), and higher similarity values between atpD gene sequences than between
recA gene sequences have been found within the same strain. Moreover, considering
both the recA and the atpD genes, similarity values of 94% or less may point to separate
species status, taking into account homology levels from DNA–DNA hybridization
experiments (Valverde et al., 2006; Santillana et al., 2008). In our study three protein-
coding genes from lentil rhizobia showed 89.1 – 92.8% of similarity to R. leguminosarum
and 92.1 – 94.8% similarity to R. etli. Although topological incongruence has been
detected in some phylogenetic studies carried out on r hizobial species (Eardly et al.,
2005), we did in not detect any topological incongruence in our phylogenetic
reconstructions when analyzing three protein-coding housekeeping genes and the 16S
rRNA gene using both ML and Bayesian analyses. Our phylogenetic reconstruction
based on different protein-coding genes supports three distinct sub-lineages (clades I, II
and III) in single gene tree and tree from concatenated sequences with high bootstrap
values (see Figs. 10 – 12 and Figs. 16 – 17).

Moreover, the genetic similarity values among these clusters, based on t hree different
protein-coding genes, range between 91 and 92% for recA, 92 and 94% for glnII and 89
and 94% for the atpD gene (table 11). These genetic similarity levels are comparable to
those found between R. etli and R. leguminosarum, suggesting species status for these
clades nodulating lentil in Bangladesh.

DNA fingerprinting distinguishes the new clusters from closely related

species
Repetitive Extragenic Palindromic (REP) elements and Enterobacterial Repetitive
Intergenic Consensus (ERIC) sequences are widespread in the genome of Gram-
negative soil bacteria. In ERIC-PCR, the amplified ERIC-like elements are useful for
fingerprinting genera, species, and strains of bacteria. These techniques are con-sidered
64
powerful tools in bacterial taxonomy and may help in the determination of phylogenetic
relationships (Versalobic et al., 1991; De Bruijn, 1992).

In our study, the fingerprint patterns distinguish our Bangladeshi isolates from R. etli and
R. leguminosarum. The NJ bootstrap phylogenetic trees and principal coordinate
analyses based on high-resolution ERIC-PCR also strongly support the differentiation of
three clusters among the isolatesfrom Bangladesh (Fig. 18a and 18b). Consequently,
based on r epetitive intergenic sequences which are distributed across the whole
genome, these new clusters differ from R. etli and R. leguminosarum. These results are
congruent with the phylogenetic analyses based on housekeeping gene sequences and
provide further evidence for the presence of three new clades of rhizobia capable of
nodulating lentil.

Collectively, the evidence obtained from phylogenetic trees based on 16S rRNA genes,
three protein-coding housekeeping genes, concatenated sequences, levels of genetic
similarity and DNA fingerprinting showed that the new clades described in this study are
very close to R. etli and R. leguminosarum, but may correspond to new bacterial species
within the genus Rhizobium.

Nucleotide sequences of nodulation genes support a symbiovar

similar to viciae
The nodulation (Nod) factors determine the legume-rhizobium symbiosis (Laguerre et al.,
2001). These genes are essential for nodulation and nitrogen fixation and are either
localized on transmissible symbiosis plasmids, e.g. in Rhizobium and Sinorhizobium, or
on the chromo-some, e.g. in most species of Mesorhizobium and all Bradyrhizobium
species (Herrera-Cervera et al., 1998; Laguerre et al., 2003). Because of its regulatory
function on the expression of other nodulation genes, the nodD gene has been used as a
symbiotic marker in the analyses of specificity between rhizobia and host plants such

65
 Cluster II

Cluster III
etli1 99
etli
etli2

195 129

235
87
100

58 100
98
175
228
53

100 leg2

29

26 leg1
105
57 leg
55
134
33 54 98
88
72
122
87 174

41

27 100 Cluster I

28
58
45

Fig. 18a.The NJ bootstrap trees based on high resolution ERIC-PCR

fingerprint.

66
 175
Cluster II
129
99

R. etli

195
235228
57

33 134
105
Cluster III 98
28
58

174
122
26
29 87
100
27
45

41

Cluster I

R. leguminosarum

Fig. 18b. PCoA analysis of high resolution ERIC-PCR.

67
as faba bean (Tian et al., 2010; and references therein). Similarly, the nodC gene from
rhizobia has been widely used to determine the host range of isolates and the degree of
host promiscuity (Perret et al., 2000; Laguerre et al., 2001; Iglesias et al., 2007). In this
study, three nodulation genes (nodA, nodC and nodD) were analyzed in order to
determine the nature of the symbiotic interaction and the diversity of lentil isolates. Phy-
logenetic analyses based on three nodulation genes from the lentil isolates revealed high
similarities to those of R. leguminosarum symbiovar viciae, but they still formed a
separate clade supported by high bootstrap values (99 – 100%). The symbiovar term
has been proposed for rhizobia to describe the adaptive behavior of Rhizobium in
legumes, and it should be distinguishable by host ranges as well as by gene sequences
(Rogel et al., 2011).

Symbiotic host range and nitrogen fixation ability with various host plants are two
important parameters for describing symbiovars (Rogel et al., 2011). However,
symbiovars reflect a c omplex phenomenon in rhizobia. For instance, strains of R.
leguminosarum symbiovar viciae may show different host ranges (Rogel et al., 2011 and
references therein), and rhizobial strains differ significantly regarding symbiotic
effectiveness (Wielbo et al., 2011). R. leguminosarum symbiovar viciae nodulates lentil
effectively (Moawad & Beck, 1991; Tegegn, 2006) and produced effective nodules (pink
color) with lentil in our nodulation test. In symbiotic effectiveness test, isolates from three
clades (phylogenetic clades) and R. leguminosarum symbiovar viciae 3841 produced
effective nodules and showed higher symbiotic effectiveness than the control treatment.
When comparing all BLR isolates versus R. leguminosarum symbiovar viciae 3841 we
found significantly higher nodule dry weights with BLR isolates than with R.
leguminosarum symbiovar viciae 3841, but we did not find the same effect on plant dry
weight. We employed only one strain of R. leguminosarum symbiovar viciae; therefore
we can only speculate that the symbiotic performance of the BLR isolates lies within the
variability of R. leguminosarum symbiovar viciae. However, these data should be
considered with caution and further research is needed. For example, many more strains
of R. leguminosarum symbiovar viciae and more lentil varieties should be included in
order to better understand the symbiovar status of lentil rhizobia.

68
 BLR9 (JN649014)

BLR33 (JN649016)

BLR28 (JN649015)

BLR41 (JN649017)

100
BLR45 (JN649018)
genotype I
BLR57 (JN649019)

BLR99 (JN649021)

BLR235 (JN649027)

BLR127 (JN649022)

BLR175 (JN649025)

BLR174 (JN649024)

BLR98 (JN649020)
genotype II
BLR137 (JN649023)
100
BLR228 (JN649026)
symbiovar
R. fabae CCBAU23123 (EU430079)
viciae
R. leguminosarum symbiovar viciae Lp 3 (AY226889)
72 99
R. leguminosarum (J03671)

R. fabae CCBAU 33202 (EU430078)

100

95 R. leguminosarum symbiovar viciae Vf10 (AY226878)

R. leguminosarum symbiovar trifoli (X03721)

81 E. meliloti D2 (M29367)
100

E. meliloti Rm1021 (AE006469)

R. leguminosarum symbiovar phaseoli D2 (X54215)

R. leguminosarum symbiovar phaseoli D1 (X54214)

98
R. tropici D1 (L01273)
86
Rhizobium sp BR816 D2(U26451)
73
Rhizobium sp (U16154)

79 B. japonicum nodD1 (M81825)

B. japonicum nodD2 (M81825)

0.05

Fig. 19. ML tree based on nodD gene partial sequences. Bootstrap values indicated when
≥ 70% (1000 replicates). Abbreviations: BLR: Bangladeshi lentil rhizobia, R: Rhizobium,
E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium.

69
In bacteria, the chromosomal genetic background and t he plasmid-borne genetic
background are often not correlated due to horizontal transfer of plasmid-borne genes
(Ochman et al., 2000). Moreover, different rhizobial species can share similar symbiotic
genes, and different symbiosis genes can be harbored by similar genomic backgrounds
(Laguerre et al., 1996; 2001; Han et al., 2010; Degefu et al., 2011). Thus, discordance
may exist between genealogies based on nod an d housekeeping genes, and t his
phenomenon may determine the levels of diversification and structure of natural
populations of rhizobia (Young, 1996; Laguerre et al., 2001; Vinuesa et al., 2005).
Because of the phylogenetic incongruence between housekeeping genes and symbiotic
genes, our results indicate that the symbiotic genes in lentil rhizobial isolates may have
evolved independently (Zhang et al., 2001) or evolved from other lineages, probably from
R. leguminosarum symbiovar viciae. Our nodulation and cross-inoculation assays also
showed that all isolates behaved similarly to R. leguminosarum and were able to
nodulate different cultivars of lentil as well as L. sativus and P. sativum. However, our
bacterial isolates related to R. huautlense, R. giardini and Ensifer sp. were unable to
form nodules under laboratory conditions, and w e were not able to amplify the
corresponding nodulation genes using the same primers.

Lentil symbionts are phenotypically different from closely related

species
Phenotypic characteristics such as growth at different temperatures, pH values, and
sensitivity to different antibiotics allow the distinction between different species of
rhizobia. For instance, R. etli and R. leguminosarum are closely related species, but they
differ in terms of phenotypic characteristics (Eardly et al., 2005). Similarly, species of
bean-nodulating rhizobia (R. giardinii and R. gallicum) are phenotypically different from
previously described Rhizobium species (Eardly et al., 2005). We performed several
phenotypic analyses on lentil isolates that showed that lentil isolates were different from
closely related species (R. etli and R. leguminosarum). The isolates grew well on YEMA
and TY media at temperatures up to 37°C, at pH 5.5 – 10.0, and at 0.5% NaCl, and
hence are more stress-tolerant than closely related species. The colonies showed acidic
reactions by producing a y ellow coloration on YEMA medium containing BTB, which
identified them as fast-growing rhizobia. All isolates showed resistance to ampicillin (50 g
/ mL), kanamycin (10 g / mL), nalidixic acid (up to 40 g / mL) and sensitivity to
tetracycline (5 g / mL). Like R. etli, all BLR isolates are nalidixic acid resistant (Segovia et
al., 1993). Among the three clades (phylogenetic clades), clade III is more salt tolerant
70
(1%), but less resistant to ampicillin and kanamycin than the other two clades. Although
lentil-nodulating rhizobia could be di stinguished from the closely related R. etli and R.
leguminosarum by various phenotypic characteristics, we did not detect clear phenotypic
differences between the three clades, except for salt tolerance.

Origin of rhizobia nodulating lentil in Bangladesh

The members of the legume tribe Vicieae (Vicia, Pisum, Lens and Lathyrus) are
commonly nodulated by R. leguminosarum symbiovar viciae, and t his symbiosis has
been found in different geographical areas (Laguerre et al., 2003; Santillana et al., 2008;
Hou et al., 2009; Tian et al., 2010). The dissemination of nodulating bacteria may be
enhanced by the export of plants and seeds (Aguilar et al., 2004). Phylogenetic evidence
shows a common origin of R. leguminosarum strains that nodulate Vicia sp., which might
have been dispersed from Europe to several other continents (Álvarez-Martinez et al.,
2009).

R. etli symbiovar phaseoli was originally described as exclusively nodulating and fixing
nitrogen with Phaseolus vulgaris (Segovia et al., 1993). In Europe, other species such as
R. gallicum and R. giardinii have been also reported to nodulate P. vulgaris (Amarger et
al., 1997). Based on the high similarity between symbiotic genes and their co-existence
in Europe, R. etli symbiovar phaseoli strains probably donated symbiotic plasmids to R.
leguminosarum symbiovar phaseoli, and these strains may also have transferred
symbiotic plasmids to R. gallicum and R. giardinii (Laguerre et al., 2001; and references
therein).

71
Table 13. Phenotypic characteristics of lentil-nodulating rhizobial isolates from Bangladesh

Isolates pH Tolerance NaCl Tolerance Temperature Antibiotic sensitivity (µg/mL) Colony

O
(%) Tolerance ( C) Ampicillin Kanam. Nalidixic acid (mm)
4.5 5.5 8.2 10 0.5 1.0 1.5 32 37 40 50 75 100 125 150 10 20 10 20 30 40
BLR9 ̶ + + ̶ ± ̶ ̶ + + ̶ + ̶ ̶ ̶ ̶ + + + ̶ ̶ ̶ 2.0
BLR26 ̶ + + + ̶ ̶ ̶ + + ̶ + + + + + + ̶ + + + + 1.5 ̶ 2.0
BLR27 ̶ + + ̶ ± ̶ ̶ + + ̶ + + + + + + + + + + + 2.0
BLR28 ̶ + + + ̶ ̶ ̶ + + ̶ + + + + + + + + + + + 2.0
BLR29 ̶ + + + ̶ ± ̶ + ± ± + + + ̶ + + ̶ + + + + 1.5 ̶ 2.0
BLR33 ̶ + + ̶ ̶ ̶ ̶ + + ̶ + + + + ̶ + + + + + + 1.5 ̶ 2.0
BLR41 ̶ + + ̶ ̶ ̶ ̶ + + ̶ + + + + ̶ + + + ̶ ̶ ̶ 1.5 ̶ 2.0
BLR45 ̶ + + ̶ ̶ ̶ ̶ + + ̶ + + + ̶ ̶ + + + + + + 1.5 ̶ 2.0
BLR57 ̶ + + + ̶ ̶ ̶ + + ̶ + + + + ± + + + + + + 2.0
BLR58 ̶ + + + ± ̶ ̶ + + ̶ + + + + ̶ + + + + + + 2.0
BLR59 ̶ + + ̶ ̶ ̶ ̶ + + ̶ + + + + + + + + + + + 1.5 ̶ 2.0
BLR62 ̶ + + + ± ̶ ̶ + + ̶ + + + + + + + + + + + 2.0
BLR87 ̶ + + ̶ ̶ ̶ ̶ + + ̶ + + + + + + + + + + + 1.5 ̶ 2.0
BLR98 ̶ + + ̶ ̶ ̶ ̶ + + ̶ + + + ̶ ̶ + + + + + + 1.5 ̶ 2.0
BLR99 ̶ + + ̶ ̶ ̶ ̶ + + ̶ + + ± ̶ ̶ + ̶ + + ̶ ̶ 2.0
BLR100 ̶ + + ̶ ̶ ̶ ̶ + + ̶ + + + + ± + + + + + + 1.5 ̶ 2.0
BLR105 ̶ + + ̶ ± ̶ ̶ + + ̶ + + ̶ ̶ ̶ + + + + + + 1.5 ̶ 2.0
BLR122 ̶ + + + + ̶ ̶ + + ̶ + + + + + + + + + + + 2.0
BLR127 ̶ + + ̶ ̶ ̶ ̶ + + ̶ + + + + + + + + + + + 1.5 ̶ 2.0
BLR129 ̶ + + + + ̶ ̶ + + ± + + + ̶ ̶ + + + + + + 2.0
BLR137 ̶ + + ̶ ̶ ̶ ̶ + + ̶ + + + ̶ ± + + + + + + 1.5 ̶ 2.0
BLR139 ̶ + + + ̶ ̶ ̶ + + ̶ + + + + ± + + + + + + 1.5 ̶ 2.0
BLR153 ̶ + + + + ̶ ̶ + + ̶ + ̶ ̶ ̶ ̶ + + + + + + 2.0
BLR154 ̶ + + + + ̶ ̶ + + ̶ + ̶ ̶ ̶ ̶ + + + + + + 2.0
BLR160 ̶ + + ̶ ̶ ̶ ̶ + + ̶ + + + + ± + + + ̶ ̶ ̶ 1.5 ̶ 2.0
BLR174 ̶ + + + ̶ ̶ ̶ + + ̶ + + + + ± + + + + + + 1.5 ̶ 2.0
BLR175 ̶ + + ̶ + ̶ ̶ + + ̶ + ̶ ̶ ̶ ̶ + + + + + + 2.0
BLR195 ̶ + + + + ̶ ̶ + + ̶ + ̶ ̶ ̶ ̶ + ̶ + + + + 1.5 ̶ 2.0
BLR228 ̶ + + ± + + ̶ + + ̶ + ̶ ̶ ̶ ̶ + + + + + + 1.5 ̶ 2.0
BLR235 ̶ + + + + + ̶ + + ̶ + ̶ ̶ ̶ ̶ + + + + ± ± 1.5 ̶ 2.0
R.etli ̶ ± ̶ ̶ ̶ ̶ ̶ + ̶ ̶ ̶ ̶ ̶ ̶ ̶ ̶ ̶ + + ± ± 2.0
Rlv3841 ̶ ± ̶ ̶ ̶ ̶ ̶ + ̶ ̶ + ± ̶ ̶ ̶ + + ± ̶ ̶ ̶ 1.5 ̶ 2.0
+ = growth positive, – = no growth, ± = growth was not clear, NB = non nodulating isolates were not considered for phenotypic characterization, at kanamycin 200 µg / mL
and neomycin 100 µg / mL, LB medium : no isolates and type strains showed growth, at 4OC and 32 OC all isolates and type strains were positive

72
Seeds are known carriers of bacteria. For example, the testa of the seeds of P. vulgaris
has been shown to carry rhizobia and play an important role in the dispersal of R. etli in
different geographical regions (Perez-Ramírez et al., 1998). The host plant of R. etli is
P. vulgaris. The P. vulgaris is neither a w ell-known crop nor widely cultivated in
Bangladesh, leaving a l ow probability of transferring R. etli or close relatives from
Europe to Bangladesh via P. vulgaris. In contrast, the lentil has been cultivated in
Bangladesh since antiquity, and t he isolates collected in this study were from field-
grown lentil plants from all over the country. The center of origin for lentil is located in
the Near East and Central Asia (Shandu & Singh, 2007; and reference therein) and this
crop is not being cultivated on a v ery large scale in Europe. Among rhizobia, parallel
and independent evolution may occur in different locations (Wolde-Meskel et al., 2005)
leaving these new lineages as potential endemic species in Bangladesh soil.

We have characterized 30 rhizobial isolates, isolated from lentil grown in Bangladesh,

using a p olyphasic approach. Our analyses revealed that these lentil isolates are
related to R. etli and R. leguminosarum but differs considerably from the
aforementioned species in terms of genetic and phenotypic characteristics. This
conclusion is underpinned by phenotypic characterization, DNA fingerprinting using
high resolution ERIC-PCR, and multilocus sequence analyses (MLSA). Therefore, there
are tentatively three clades involved in lentil nodulation in Bangladesh, and they may
correspond to novel species within the genus Rhizobium.

73
3.2 Project 2: Rhizobium leguminosarum symbiovar viciae is the
symbiont of lentils in the Middle East and Europe but not in
Bangladesh

3.2.1 Abstract
Lentil is the oldest of the crops that have been domesticated in the Fertile Crescent and
distributed to other regions during the Bronze Age, making it an i deal model to study
the evolution of rhizobia associated with crop legumes. Housekeeping and nodulation
genes of lentil nodulating rhizobia from the region where lentil originated (Turkey and
Syria) and regions to which lentil was introduced later (Germany and Bangladesh) were
analyzed to determine their genetic diversity, population structure and t axonomic
position. There are four different lineages of rhizobia associated with lentil nodulation,
of which three are new and endemic to Bangladesh, and one lineage is found to be in
Mediterranean and Central Europe that belongs to Rhizobium leguminosarum. The
endemic lentil grex pilosae may have played a significant role in the origin of these new
lineages in Bangladesh. The availability of Rhizobium leguminosarum with lentil at the
centre of origin and at countries where lentil was introduced later suggests that
Rhizobium leguminosarum is the original symbiont of lentil. Lentil seeds might have
played a significant role in the initial dispersal of this species within middle-East and on
to other countries. Nodulation gene sequences revealed a high similarity to those of
symbiovar viciae.
Keywords: Rhizobia; legume; lentil greges; speciation; recombination

74
3.2.2 Introduction
Nitrogen is an es sential nutrient for all living organisms and necessary for high crop
yield and pl ant quality in agriculture, but only prokaryotes can convert atmospheric
molecular nitrogen into forms that are available to plants. Rhizobia are nitrogen-fixing
soil bacteria that are able to enter a mutual symbiosis with leguminous plants in the
form of root nodules that fully or partially satisfy the nitrogen demand of the plant. So
far, over 90 rhizobial species from 12 genera of α- and β-proteobacteria have been
described that can form nitrogen-fixing nodules with legumes (Masson-Boivin et al.,
2009; and references therein). The legume-rhizobium symbiosis is a hi ghly specific
mutual interrelationship between the two partners. During the infection process,
rhizobia produce a number of host-specific factors, and thus it has been assumed that
rhizobia have coevolved with their host plants (Perret et al., 2000) and that host
association is important for shaping the genetic divergence of nodulation and
housekeeping genes in rhizobia (Wernegreen et al., 1997 ).

R. leguminosarum is a cosmopolitan and well-studied species in the genus Rhizobium.

The name R. leguminosarum was first proposed by Frank (1889) for all nodule-forming
bacteria infecting legumes, but many other species were later described. The current
species R. leguminosarum has three symbiovars that differ in the selectively plant hosts
(Jordan, 1984). The host specificity is conferred by a c luster of Nod genes that is
usually plasmid-encoded (Perret et al., 2000). Commonly, strains in the symbiovar
viciae nodulate Lathyrus, Pisum, Vicia, and Lens in the legume tribe Vicieae. Probably
due to its saprophytic nature, R. leguminosarum symbiovar viciae (Rlv) can maintain
high population densities (104–105) in soil, even if the host plant has been absent for a
long time (Hirsch, 1996). Like other species of rhizobia, R. leguminosarum can be
carried on the testa of seeds (Perez-Ramírez et al., 1998), allowing it to disperse to
different geographical regions along with the seeds.

Lentil (Lens culinaris) is the oldest crop that was domesticated in the Fertile Crescent
around 9,000 years ago (Zohary & Hopf, 2000; Toklu et al., 2009; and references
therein) and remains an important and popular legume employed worldwide for human
and animal nutrition and for soil fertility management (Sonnante et al., 2009; and
references therein; Sarker & Erskine, 2006). The region of origin encompasses
Southeastern Turkey and Northern Syria, including the sources of the rivers Tigris and
Euphratec (Lev-Yadun et al., 2000). After domestication, lentil spread to Cyprus in the
Neolithic period (Erskine et al., 1994) and disseminated from Southeastern Europe to
75
Central Europe around the 5,000 years BC via the Danube. From Europe, it was
transported to the Nile Valley and from there to Ethiopia. In Georgia, lentil was
propagated during the 5,000 to 4,000 years BC and transported to the Indian sub-
continent around 2,500 – 2,000 years BC (Sonnante et al., 2009; and references
therein).

Nucleotide sequences of the 16S rRNA genes are w idely used genetic markers for
bacterial identification and c lassification (Martens et al., 2008), but suffer from a
number of known drawbacks. For a m ore precise identification and des cription of
closely related bacterial species, including rhizobia, multi-locus sequence analysis
(MLSA) using different protein-coding genes has become the preferred method (Ludwig
& Klenk, 2005; Konstantinidis et al., 2006; Martens et al., 2008). Furthermore,
phylogenies inferred from chromosomal and plasmid-encoded symbiotic genes of
rhizobia are frequently found to be incongruent due to the existence of horizontal /
lateral transfer of plasmids and plasmid-borne genes (Sprent, 1994; Laguerre et al.,
1996; Young & Haukka, 1996). Recombination occurs frequently in bacteria and plays
an important role in the evolution of most bacterial species, including rhizobia (Silva et
al., 2005; Vinuesa et al., 2005; Maiden, 2006; Bailly et al., 2006; den Bakker et al.,
2008; Tian et al., 2012). New genetic material can be rapidly introduced by
recombination, allowing faster evolution than simple point mutations (Narra & Ochman,
2006; Redfield, 2001).

The diversity of rhizobia from the tribe Vicieae, especially from pea, faba bean and
grass pea has been studied previously (Laguerre et al., 1996; Mutch & Young, 2004;
Hou et al., 2009; Tian et al., 2010; Risal et al., 2012; and many others). In contrast,
there have been r elatively few studies on rhizobia that nodulate lentil (Hynes &
O’Connell, 1990; Moawad & Beck, 1991; Laguerre et al., 1992; Geniaux & Amargr,
1993; Keatinge et al., 1995; Rashid et al., 2009; 2012). By analyzing the nodulating
rhizobia of Vicieae from different countries it has been concluded that R.
leguminosarum is the main nodulating species (Tian et al., 2010; and references
therein), although a distinct but related species has also been described and named R.
pisi (Ramírez-Bahena et al., 2008) and, almost simultaneously, R. fabae (Tian, et al.,
2008). Although, found more than once R. pisi has not been seen as the sole or main
symbiont in wild peas. By contrast, we found that lentils in Bangladesh were nodulated
by three distinct species-level lineages related to R. etli, while R. leguminosarum was
absent (Rashid et al., 2012). It is therefore important to examine lentil symbionts from

76
other geographic regions in order to establish whether lentils are exceptional in having
different symbionts from other legumes of the tribe Vicieae.

In this study, lentil-nodulating rhizobia were collected from traditional lentil-growing

countries Turkey and Syria, representing the region of original domestication, and from
Germany, where lentil have been grown sporadically. We compared DNA sequences of
rhizobial isolated from three countries where g rex pilosae is absent (Barulina, 1930;
Sarker & Erskine, 2006) with those of isolated previously (Rashid et al., 2012) from
field-grown pilosae (Dr. A. R. Sarker; Dr. M. Rahman and Dr. M. A. Samad, personal
communication) lentils in Bangladesh. The aim of this study was (1) to explore the
genetic diversity and identity of lentil-nodulating rhizobia, (2) to evaluate the levels of
genetic diversity and population structure of these bacteria from different geographical
locations.

3.2.3 Materials and methods

Soil samples, plant growth and nodule separation

Rhizobia were isolated from nodules of lentils (variety BINA-3, grex pilosae) grown in
potted soil under glasshouse conditions and from field-grown lentils [variety Anicia,
small green lentil, originally imported from France, Mr. Woldemar Mammel, president
(Vorsitzender) of the Friends Association (Förderverein), Alblinsen- Förderverein für
alte Kulturpflanzen auf der Schwäbischen Alb, personal communication]. Nodules from
foeld-grown lentils were collected from Lauterach, Baden-Württemberg, Germany. Soil
samples were collected from nine locations in Germany, one in Turkey and t wo
locations in Syria (table 3). All soil samples were collected from cultivated soils, except
for one that had collected from a forest in Germany. S oil samples were kept well
separated and processed for growing plants under glass house conditions within 3 – 12
days of collection. About 2.5 – 3.0 kg of soil was transferred to a s urface-sterilized
plastic pot in order to grow lentils. One pot per locality was used to grow 2 – 3 lentil
plants for five weeks.

Surface-sterilized (one min in 70% ethanol and 3 – 5 min in 3% NaOCl) and pre-
germinated (48 h on 1% water agar) lentil seeds were then placed on potted soil. After
germination, a maximum of three plants were grown for five weeks. Plants were
irrigated alternately (i.e., water, then N-free seedlings solutions, then water, then N-free
seedlings solutions, etc) with sterile water and ni trogen-free seedling solutions when

77
needed. After five weeks, plants were uprooted carefully, the roots washed with water,
dried with tissue paper and then preserved on s ilica gel desicent until further
processing.

Bacteria isolation
Methods are available in chapter 2 (materials and methods).

Determination of rhizobial population from collected soil

The number of rhizobial cells in one g of collected soil sample was determined following
standard protocols described by Brockwell (1963). Five-fold serial dilution with three
replicates for each soil sample and four replicates for each dilution were used for plant
inoculation. Seeds were surface-sterilized and germinated on agar plates, and the
seedlings were transferred to growth medium as described in chapter 2. Harvested
plants were scored for the presence or absence of nodules. The population density of
soil samples was determined following the MPN table (Brockwell, 1963; and references
therein).

Determination of soil pH
Air-dried samples (200 g soil) were first ground and then sieved (2 mm) to remove large
particles. From the sieved sample, 10 g were used to determine the pH. From each
locality, the soil pH was measured using 0.01 mM CaCl2 following the protocol ISO
2006 (International standard organization, www.iso.org) with a HANNA pH meter (HI
98150).

Nodulation and cross-inoculation tests

Methods are available in chapter 2 (materials and methods).

DNA isolation, PCR and nucleotide sequencing

Standard methods were followed and descriptions are available in chapter 2.

78
Phylogenetic analyses
Methods are available in chapter 2.

Population genetic analyses

Details of the methods are available in chapter 2.

Recombination and mutation analyses

Methods are available in chapter 2.

3.2.4 Results

Bacterial isolation, soil pH and rhizobial population density

A total of 98 rhizobial colonies were isolated from lentil nodules representing 12
localities in three countries: Germany (N = 78), Turkey (N = 12) and Syria (N = 8), and
different genes were sequenced from 58 isolates (table 1). A single colony was isolated
from each of the selected nodules. Each colony was purified by repeated streaking on
CRYEMA medium and preserved at −80ºC with 25% glycerol and at 4ºC on agar slants
for further study. In addition, we included seven isolates from Bangladesh (Rashid et
al., 2012) in the analyses for species delineation and comparison. Isolates numbers
and the corresponding localities are documented in table 3.

Soil pH ranged between neutral values of pH 6.5 – 7.4, with the exception of one forest
soil sample from Heidebuckelweg, Heidelberg that presented an acidic pH of 4.8 (table
3. Rhizobial population density varied across different localities in Germany, from 114
cells/g soil in Bürstadt (Hessen) to 2.18× 103 cells / g soil in Ostrach (Baden-
Württemberg, table 3).

Nodulation, cross-inoculation and symbiotic effectivity test

The nodulation efficiency test showed that all 98 isolates were able to form nodules with
lentil within 3 – 4 weeks after inoculation under growth chamber conditions. In a cross-
inoculation test, a set of 30 randomly-selected isolates were able to form nodules with
both Lathyrus sativus and Pisum sativum under the same growth conditions. All isolates
produced dark pink nodules and plant leaves were darker green compared to the
uninoculated controls, demonstrating that all isolates were symbiotically effective.

79
Phylogenetic analyses based on nucleotide sequences
We amplified the 16S rRNA gene (about 1.5 kbp length) and obtained sequences of
about 1,100 – 1,350 bp from 38 rhizobial isolates originating from three different
countries. BLAST searches indicated high similarities (99 – 100%) to R. leguminosarum
symbiobar viciae. Phylogenetic analyses based on 16S rRNA sequences revealed that
all isolates from the three different geographical origins were closely related to R.
leguminosarum and separate from the Bangladeshi isolates (Fig. 20).

Phylogenetic analyses based on concatenated sequence of three housekeeping genes

(Fig. 21) and individual housekeeping genes, recA (415 bp from 58 isolates), atpD (472
bp from 55 isolates) and glnII (598 bp from 57 isolates) (Fig. 22 – 24) recovered six
sub-lineages (IVa – IVf) with high bootstrap support (70 – 90%). However, the
recovered tree topologies differed in phylogenetic analyses, i.e. some isolates changed
their positions between different sub-lineages depending on the analyzed gene,
revealing phylogenetic incongruence among the loci (table 14 and table 15). Defined by
high bootstrap support, two new sub-lineages (IVb and IVd) differ from sub-lineages of
R. leguminosarum described previously from various hosts and geographic regions
(Tian et al., 2010). Phylogenetic analyses and genetic distances of three protein-coding
genes (Valverde et al., 2006) with respect to the type strain of R. leguminosarum (Fig.
21, Fig. S22 – 24 and table 16) suggest that all isolates belong to R. leguminosarum.
However, we recovered very similar topologies using different tree reconstruction
methods, i.e. NJ, ML and BI (appendix 9 – 16).

Table 14. Phylogenetic incongruence using Shimodaira-Hasegawa (S-H) test

Input data set Inferred tree topology data set

recA atpD glnII
recA NS + +

atpD + NS +

glnII + + NS

NS= not significant

80
 Rl RPVF18 (GQ863496)
GLR45 (KC679439)
GLR23 (KC679428)
GLR22 (KC679427)
GLR13 (KC679422)
GLR12 (KC679421)
GLR10 (KC679418)
GLR9 (KC679418)
GLR8 (KC679417)
GLR7 (KC679416)
GLR6 (KC679415)
GLR5 (KC679414)
GLR1 (KC679411)
R. etli CIAT 652 (NC 010994)
R. fabae CCBAU33202 (DQ835306)
R. pisi DSM30132 (AY509899)
Rl ICMP14642 (AY491062)
Rl CCBAU65761 (EU618030)
Rl symbiovar viciae BIHB1194 (JF759699)
Rl 2A (JN105997)
Rhizobium sp H111 (AB529851)
Rl symbiovar trifolii Len-4 (FJ593639)
Rl symbiovar trifolii WSM1325(CP012850)
Rl symbiovar trifolii WSM2304 (CP001191)
GLR46 (KC679440)
GLR27 (KC679430)
GLR40 (KC679438)
GLR14 (KC679423) Germany, Turkey, Syria
GLR3 (KC679413)
Rl CCNWXJ0177 (FJ449680)
Rl symbiovar viciae BIHB1160 (EU730590)
Rl symbiovar viciae BIHB1157 (EU730602)
Rhizobium sp CCBAU83268 (EF549382)
GLR50 (KC679442)
Rlv 3841 (NC008380)
GLR16 (KC679424)
GLR19 (KC679426)
GLR25 (KC679429)
GLR28 (KC679430)
GLR29 (KC679432)
GLR30 (KC679433)
GLR31 (KC679434)
GLR32 (KC679435)
GLR33 (KC679436)
Rl V6 (GU306144)
GLR34 (KC679437)
TLR6 (KC679444)
GLR2 (KC679412)
86 TLR7 (KC679445)
TLR2 (KC679443)
SLR7 (KC679448)
SLR4 (KC679447)
SLR1 (KC679446)
Rhizobium sp FB2504 (HM194627)
GLR11 (KC679420)
GLR17 (KC679425)
R. etli PEPSM15 (DQ196417)
Rhizobium sp BLR27 (JN648905)
Rhizobium sp BLR9 (JN648902) Bangladesh
93 Rhizobium sp BLR28 (JN648906)
R. etli CFN42 (U28916)
Rhizobium sp BLR195 (JN648932)
Rhizobium sp BLR235 (JN648934) Bangladesh
Rhizobium sp BLR175 JN648931
Rhizobium sp BLR153 (JN648927)
GLR 49
88 99 R. rhizogenes (D14501)
R. hainanense (U71078)
R. miluonense CCBAU41251 (EF061096)
100 R. cellulosilyticum ALA10B2 (DQ855276)
R. huautlense SO2T (AF025852)
R. galegae LMG6214 (X67226)
97 R. vignae CCBAU05176 (GU128881)
81 R. radiobacter LMG196 (X67223)
98 R. giardinii CCBAU45226 (GU565533)
90 R. herbae CCBAU01209 (GU565531)
E. meliloti LMG6133 (X67222)
E. fredii LMG6217T (X67231)
100 M. huakuii IAM14158 (D12797)
100 M. ciceri (U07934)
M. loti LMG6125 (X67229)
0.01

Fig. 20. ML tree from 16S rRNA gene partail sequences. Bootstrap values indicated
when ≥ 70% (1000 replicates). Abbreviations: GLR = German lentil rhizobia, TLR =
Turkish lentil rhizobia, SLR = Syrian lentil rhizobia, R = Rhizobium, Rl = R.
leguminosarum, E = Ensifer, M = Mesorhizobium .

81
Table 15. Isolates under different lineages and sub-lineages in different analyses

Isolates Phylogenetic analyses Split Structure Recombination Nodulation

analyses (concatenated) genes
(concaten
(concaten ated) nodC nodD
ated)
recA atpD gln II concatenat with no
ed (recA- recombin- recombin-
atpD-glnII) ation ation
TLR2 a a a a a a a a A C
TLR3 a* a* a a a a a a C
TLR4 a - - - - - - - -
TLR5 a - e a - - - - C
TLR6 a* a a a a a a a -
TLR7 a a a a a a** a a A C
TLR8 - f a* - - - - - C
TLR9 a* a a a a a a a C C
TLR10 a a e a unique e** unique unique C C
TLR11 a a a a a a a a C C
TLR12 a a a a a a a a A C
TLR14 a* a a* unique unique e** unique unique C
SLR1 d d* d d d d d d - B
SLR2 a* a a a a a a a unique -
SLR3 a* a a a a a a a E E
SLR4 a* a* a a a a a a E E
SLR5 a* a* a a a a a a E -
SLR6 a a* a a a a a a - E
SLR7 a* a* a a a a a a E E
SLR8 d d* d d d d d d A A
GLR1 a* a* a a a a a a B B
GLR2 d d d d d d d d unique
GLR3 a* a* a a a a a a -
GLR5 a* a* a a a a a a B
GLR6 unique f f f f f f f -
GLR7 f f a* f unique a,f** unique b A A
GLR8 f f f f f f f f D
GLR9 - f f - - - - - -
GLR10 f f f f f f f f unique
GLR11 d unique d d d d d d A A
GLR12 unique e - - - - - - -
GLR13 a* a a a a a a a A
GLR14 a - - - - - - - B
GLR16 e a e* e e e e e D
GLR17 d d d d d d d d B unique
GLR19 e e e e e e e e -
GLR22 f f f f f f f f D
GLR23 b b b b b f** b b D D
GLR25 e e e e e e e e A
GLR27 a a* a a a a a a B B
GLR28 e e e e e e e e -
GLR29 e e e* e e e e e -
GLR30 e - e* - - - - - -
GLR31 e e unique unique b e** b e -
GLR32 e unique e e e e e e -
GLR33 e e b b b b b e A A
GLR34 d d* unique d d d d d A
GLR40 b unique b b b b** b e D
GLR43 f f f f f f f f -
GLR45 b b a unique unique a** b b D D
GLR46 a* a* a a a a a a B B
GLR49 unique a* a a a f** a a A
GLR50 a a* a a a a a a A A
GLR54 f f f f f f f f -
GLR59 f f f f f f f f -
GLR67 f f e f f f** unique unique -
GLR69 a e e e c e c c -
GLR71 c c e c c e c c -
GLR74 c c f c c e** c c -
GLR79 f f f f f f f f -
BLR9 I I I I I I I I I
BLR27 I I I I I I I I -
BLR28 I I I I I I I I -
BLR153 II II II II II II II II I I
BLR175 II II II II II II II II I I
BLR195 III III III III III III III III A A
BLR235 III III III III III III III III -
Abbreviations: I–III = lineages, a–f = sub-lineages of lineage IV, * = split sub-lineage, **= mixed isolates, - = not sequenced

82
Species delineation and recombination visualization using neighbor-
network analyses
Neighbor-network analyses based on t he concatenated data set (recA-atpD-glnII)
showed a r eticulate structure, in which we identified six sub-lineages (Fig. 25a). Two
sub-lineages (IVb and IVd) are distinguishable from other described R. leguminosarum
sub-lineages and strains (Tian et al., 2010), and the sub-lineage IVc was not
consistently recovered in all analyses. For example, IVc was recovered in phylogenetic
analyses including recA and atpD genes (Figs: 21 – 22, 23) and TMRCA analyses
(Figs. 29a, 29b), but it was not identified in network and STRUCTURE analyses (Figs.
25a, 25b, 26A, 26B). In neighbor-network analysis, by a long edge, lentil isolates from
Bangladesh (lineages I, II and III) differed significantly from German, Turkish and Syrian
isolates and they did not form any reticulate structure among themselves (Fig. 25a and
25b). The isolates GLR7, GLR45, TLR14 and TLR10, which lay outside the main
phylogenetic clusters (Fig. 21), had unique positions in the network with a high level of
reticulation, indicating that they are potentially recombinant for one or more genes.

Table 16. Genetic distances among different sub-lineages

Sub-lineages* Genes and similarity (%)

recA atpD gln II Concatenated (recA-
atpD-glnII)
**Rlv type vs IVa 97 93 94 95

Rlv type vs IVb 98 93 94 95

Rlv type vs IVc 97 93 - 96

Rlv type vs IVd 97 93 94 95

Rlv type vs IVe 98 93 98 96

Rlv type vs IVf 99 99 99 99

*All sub-lineages were selected from phylogenetic analyses,

**Rlv = Rhizobium leguminosarum symbiovar viciae USDA2370T

83
 77 TLR 3
GLR 27
GLR 50
SLR 6
TLR 2
88
TLR 11
Rlv USDA2499
Rlv Nvf1
TLR 12
99 Rlv Nvf3
TLR 7
Rlv J1
78 SLR 2 a
83 SLR 3
SLR 4
96 SLR 5
SLR 7
TLR 6
TLR 9
85 GLR 13
GLR 46
GLR 49
GLR 1
GLR 3
GLR 5
GLR 45
Rlv USDA2489
GLR 31
GLR 23
b
73 77 86 Rlv USDA2500
GLR 33
GLR 40
Rlv CCBAU03317
Rl symbiovar trifolii WSM1325
GLR71 c
GLR74 IV (Germany, Turkey, Syria)
95 Rlv CCBAU23125
98 Rlv CCBAU23131
Rlv CCBAU85004
75 Rlv CCBAU03322
TLR 10
97 GLR 2
GLR 17
GLR 34 d
SLR 1
76 SLR 8
77
GLR 11
Rlv USDA2502
TLR 14
75 Rlv USDA2503
Rlv CCBAU81107
GLR69
GLR 16
GLR 32
GLR 28
77 GLR 19 e
GLR 29
GLR 25
Rlv CCBAU81100
Rlv VF39 AY929419
Rlv 3841
GLR 7
GLR67
90 GLR 6
GLR 10
74 Rlv USDA2370T
GLR 43
GLR 22 f
72 GLR79
GLR54
71 GLR 8
GLR59
Rlv CCBAU43229
98 R. pisi DSM30132
R. fabae CCBAU33202
99Rlv trifolii WSM2304
99 Rhizobium sp BLR153 II (Bangladesh)
Rhizobium sp BLR175
R. etli CFN42
79 99 Rhizobium sp BLR235 III (Bangladesh)
Rhizobium sp BLR195
R. etli CIAT652
99 Rhizobium sp BLR27
Rhizobium sp BLR28 I (Bangladesh)
Rhizobium sp BLR9
R. yanglingense SH22623
0.05
Fig. 21. ML tree from concatenated partial sequences of recA-atpD-glnII genes. Bootstrap
values indicated when ≥ 70% (1000 replicates). Abbreviations: GLR = German lentil
rhizobia, TLR = Turkish lentil rhizobia, SLR = Syrian lentil rhizobia, R = Rhizobium, Rl=
Rhizobium leguminosarum, Rlv = R. leguminosarum symbiovar viciae, I, II, III, IV =
lineages , a – f = sub-lineages within lineage IV.

84
 99
GLR71 (KC679485)
GLR74 (KC679486)
c
Rl symbiovar trifolii WSM1325 (CP001191)
98 TLR 6 (KC679492)
TLR 9 (KC679494)
TLR 14 (KC679498)
GLR69 (KC679484)
GLR 13 (KC679422) a
76 GLR 46 (KC679440)
GLR 1 (KC679449)
GLR 3 (KC679451)
GLR 5 (KC679452)
86
GLR 40 (KC679475)
GLR 23 (KC679465)
b
GLR 45 (KC679477)
Rlv USDA2503 (GQ323690)
GLR 49 (KC679479)
Rlv CCBAU03317 (GQ323670)
99 Rlv CCBAU23125 (GQ323657)
Rlv CCBAU23131 (GQ323661)
SLR 4 (KC679402)
88 SLR 7 (KC679405)
Rlv J1 (GQ323691)
SLR 2 (KC679400) a
91 SLR 3 (KC679401)
SLR 5 (KC679403)
Rlv CCBAU81107 (GQ323675)
GLR 33 (KC679473)
GLR 32 (KC679472)
GLR 28 (KC679468)
GLR 25 (KC679466)
GLR 16 (KC679461)
83 GLR 19 (KC679463)
GLR 31 (KC679471)
Rlv CCBAU81100 (GQ323680) e
Rlv USDA2489 (GQ323684)
Rlv VF39 (AY929419)
Rlv 3841 (NC008380)
Rhizobium sp PEVF03 (EF113124)
GLR 29 (KC679469)
GLR 30 (KC679470)
GLR 12 (KC679458) IV (Germany,
99 Rlv USDA2500 (GQ323688)
Rhizobium sp MVP07 (FJ596037) Turkey
Rlv CCBAU85004 (GQ323669) Syria)
Rhizobium sp CVIII14 (FJ596034)
Rlv CCBAU03322 (GQ323672)
GLR 14 (KC679460)
GLR 50 (KC679480)
GLR 27 (KC679467)
Rhizobium sp FB2504 (JN558687)
99 Rlv USDA2499 (GQ323687)
Rlv Nvf1 (GQ323692)
TLR 2 (KC679488) a
TLR 3 (KC679489)
TLR 4 (KC679490)
TLR 5 (KC679491)
TLR 10 (KC679495)
TLR 11 (KC679496)
TLR 12 (KC679497)
SLR 6 (KC679504)
Rlv BIHB1160 (JF759780)
71 GLR 6 (KC679453)
95 Rlv Nvf3 (GQ323694)
TLR 7 (KC679493)
80 Rlv USDA2502 (GQ323689)
SLR 1 (KC679499)
SLR 8 (KC679560)
GLR 2 (KC679450) d
GLR 11 (KC679457)
GLR 17 (KC679462)
GLR 34 (KC679474)
GLR 10 (KC679456)
GLR 7 (KC679454)
GLR 8 (KC679455)
Rhizobium sp H111SPAIN (AB529832)
Rlv USDA2370T (AJ294376)
Rlv BIHB1194 (JF759788) f
Rl RVS11 (FJ596032)
75 GLR 22 (KC679464)
GLR 43 (KC679476)
GLR54 (KC679481)
GLR59 (KC679482)
GLR67 (KC679483)
GLR79 (KC679487)
99 R. pisi DSM30132 (AY509899)
R. fabae CCBAU33202 (DQ835306)
Rlv trifolii WSM2304 (CP001191)
100 Rhizobium sp BLR153 (JN649053)
95 95 Rhizobium sp BLR175 (JN649057) II (Bangladesh)
R. etli CFN42 (CP000133)
R. etli PEPSM15 (DQ196417)
100 Rhizobium sp BLR27 (JN649031)
Rhizobium sp BLR9 (JN649028) I (Bangladesh)
Rhizobium sp BLR28 (JN649032)
87 Rl PEPSM13 EF113130
82 R. etli CIAT652 (NC010994)
100 Rhizobium sp BLR235 (JN649060) III ( Bangladesh)
Rhizobium sp BLR195 (JN649058)
Rlv CCBAU43229 (GQ323665)
R. yanglingense SH22623 (AY907359)
0.02
Fig. 22. ML tree from recA gene partail sequences. Bootstrap values indicated when ≥
70% (1000 replicates). Abbreviations: GLR = German lentil rhizobia, TLR = Turkish lentil
rhizobia, SLR = Syrian lentil rhizobia, R = Rhizobium, Rl= Rhizobium leguminosarum,
Rlv = R. leguminosarum symbiovar viciae, I – IV = lineages, a – f = sub-lineages within
the lineage IV.

85
 95
70 Rlv CCBAU85004 (GQ323593)
Rlv CCBAU23131 (GQ323585)
72 Rlv CCBAU23125 (GQ323581)
Rlv CCBAU 83268 (GQ323598)
Rl CCBAU03322 (GQ323596)
Rlv BIHB1157 (JF759809)
72GLR49 (KC679536)
GLR27 (KC679525)
GLR46 (KC679535)
GLR 3 (KC679509) a
TLR3 (KC679546)
GLR1 (KC679507)
GLR5 (KC679510)
GLR69 (KC679541)
94 Rl CCBAU81107 (GQ323599)
GLR11 (KC679516)
SLR1 (KC679554)
86 Rlv USDA2502 (GQ323613) d
85 SLR8 (KC679560)
GLR34 (KC679531)
83 Rhizobium sp CVIII14 (FJ596007)
SLR5 (KC679558)
SLR7 (KC679560)
GLR13 (KC679518)
Rl CCBAU83267 (EF549434)
GLR50 (KC679537)
SLR6 (KC679559)
SLR4 (KC679557)
Rlv J1 (GQ323615)
GLR16 (KC679519)
TLR2 (KC679545)
GLR32 (KC679529)
SLR2 (KC679555)
SLR3 (KC679556) a
TLR7 (KC679548)
TLR9 (KC679549)
TLR6 (KC679547)
Rlv Nvf1 (GQ323616)
Rlv Nvf3 (GQ323618)
Rlv USDA2499 (GQ323611)
TLR10 (KC679550)
TLR11 (KC679551)
TLR12 (KC679552)
TLR14 (KC679553)
81 Rhizobium sp FB2504 (JN558667)
Rhizobium sp PEVF08 (EF113141)
GLR2 (KC679508) d IV (Germany, Turkey, Syria)
73 GLR17 (KC679520)
72 Rl symbiovar trifolii WSM1325 (CP001622)
Rl CCBAU03317 (GQ323594)
GLR71 (KC679542) c
83 GLR74 (KC679543)
Rlv CCBAU43229 (GQ323589)
GLR40 (KC679532)
Rhizobium sp MVP07 (FJ596010)
99 Rlv USDA2500 (GQ323612)
Rlv BIHB1160 (JF759810)
GLR28 (KC679526)
72 Rlv VF39 (AY907376)
Rlv USDA2489 (GQ323608)
71 Rlv CCBAU81100 (GQ323604)
GLR12 (KC679517)
GLR31 (KC679528) e
GLR33 (KC679530)
90 Rhizobium sp PEVF03 (EF113139)
Rlv 3841 (NC008380)
GLR19 (KC679521)
GLR25 (KC679524)
GLR29 (KC679527)
99 GLR45 (KC679534) b
Rlv USDA2503 GQ323614
GLR23 (KC679523)
Rl symbiovar trifolii WSM2304 (CP001191)
GLR22 (KC679522)
GLR6 (KC679511)
GLR7 (KC679512)
99 GLR10 (KC679515)
Rl RVS11 (FJ596005)
GLR79 (KC679544)
GLR54 (KC679538) f
GLR59 (KC679539)
Rlv USDA2370 (AJ294405)
Rlv BIHB1194 (F759818)
GLR8 (KC679513)
GLR9 (KC679514)
GLR43 (KC679533)
GLR67 (KC679540)
R. etli CIAT652
R. etli PEPSM15 (EF113147)
99 Rhizobium sp BLR175 (JN648967) II (Bangladesh)
Rhizobium sp BLR153 (JN648963)
R. etliCFN42 (CP000133)
99 Rhizobium sp BLR28 (JN648942)
Rhizobium sp BLR27 (JN648941) I (Bangladesh)
Rhizobium sp BLR9 (JN648938)
99 R. etli CCBAU65708 (EU617991)
R. etli CCBAU65830 (EU617992)
99 Rhizobium sp BLR235 (JN648970)
Rhizobium sp BLR195 (JN648968)
III (Bangladesh)
98 R. pisi DSM30132 (AY509899)
R. fabae CCBAU33202 (DQ835306)
R. yanglingense SH22623 (AY907373)
0.02
Fig. 23. ML tree from atpD gene partial sequences. Bootstrap values indicated when ≥ 70%
(1000 replicates). Abbreviations : GLR = Germany lentil rhizobia, TLR = Turkish lentil rhizobia,
SLR = Syrian lentil rhizobia, R = Rhizobium, Rl = Rhizobium leguminosarum,Rlv = R.
leguminosarum symbiovar viciae, I – IV = lineage, a – f = sub-lineages within lineage IV.

86
 Rlv CCBAU81100 (GQ323643)
GLR25 (KC679524)
Rlv 3841 (NC008380)
Rlv VF39 AY929468
GLR19 (KC679575)
TLR5 (KC679602)
GLR71 (KC679597) e
TLR 10 (KC679607)
GLR67 (KC679595)
81 GLR69 (KC679596)
77 GLR28 (KC679580)
GLR32 (KC679529)
Rlv CCBAU03322 (GQ323635)
Rl bv trifolii WSM1325 (CP001622)
Rlv CCBAU43229 (GQ323628)
Rlv USDA2502 (GQ323652)
Rlv USDA2671 (EU488784)
GLR10 (KC679570)
GLR6 (KC679566)
81 GLR8 (KC679568)
Rlv USDA2370T (AF169586)
GLR9 (KC679569)
80 GLR22 (KC679576) f
GLR43 (KC679588)
GLR54 (KC679593)
GLR59 (KC679594)
GLR74 (KC679598)
GLR79 (KC679599)
96 Rlv CCBAU81107 (GQ323638)
Rlv USDA2503 (GQ323653)
GLR29 (KC679581)
86 GLR16 (KC679573)
GLR30 (KC679582)
e
96 TLR8 (KC679605)
TLR14 (KC679610)
Rlv CCBAU03317 (GQ323633)
SLR8 (KC679618)
99 GLR2 (KC679563)
SLR1 (KC679611)
GLR11 (KC679571) d IV (Germany
GLR17 (KC679574)
GLR34 (KC679586) Turkey
90 Rlv CCBAU33204 (GQ323622) Syria)
Rlv CCBAU43240 (GQ323623)
75 Rlv CCBAU85004 (GQ323632)
81 Rlv CCBAU23125 (GQ323620)
Rlv CCBAU23131 (GQ323624)
GLR33 (KC679585)
88
73 GLR40 (KC679587) b
Rlv USDA2500 (GQ323651)
GLR23 (KC679577)
GLR31 (KC679583)
TLR7 (KC679604)
GLR1 (KC679562)
GLR46 (KC679590)
GLR49 (KC679591)
76 GLR13 (KC679572)
GLR5 (KC679565)
GLR3 (KC679564)
GLR50 (KC679592)
SLR5 (KC679615)
GLR45 (KC679589)
SLR4 (KC679614)
TLR9 (KC679606)
TLR3 (KC679601)
RlvUSDA2499 (GQ323650) a
RlvJ1 (GQ323654)
GLR7 (KC679567)
GLR27 (KC679579)
Rlv USDA2498 (GQ323649)
TLR2 (KC679600)
SLR6 ((KC679616)
TLR11 (KC679608)
SLR2 (KC679612)
SLR3 (KC679613)
SLR7 (KC679617)
Rlv Nvf1 (GQ323655)
Rlv Nvf3 (GQ323656)
TLR6 (KC679603)
TLR12 (KC679609)
Rl symbiovar trifolii WSM2304 (CP001191)
99 Rhizobium sp BLR153 (JN648978)
Rhizobium sp BLR175 (JN648979) II (Bangladesh)
R. etli CFN42 (CP000133)
R. etli CIAT652 (CP001074)
96 R. etli SCAU46 (FJ799727)
R. etli bv phaseoli GR12 (AY929464)
99 Rhizobium sp BLR9 (JN648974)
Rhizobium sp BLR27 (JN648976) I (Bangladesh)
Rhizobium sp BLR28 (JN648977)
84 Rhizobium sp BLR195 (JN648980)
Rhizobium sp BLR235 (JN648981) III (Bangladesh)
98 R. etli bv phaseoli IE954 (AY907409)
R. etli bv phaseoli KIM5S (AY929463)
R. fabae CCBAU23127 (EF579932)
R. pisi DSM30132 (JN580715)
R. yanglingense SH22623 (AY929462)
0.02

Fig. 24. ML tree from gln II gene partial sequences. Bootstrap values indicated when ≥
70% (1000 replicates). Abbreviations : GLR = German lentil rhizobia, TLR = Turkish
lentil rhizobia, SLR = Syrian lentil rhizobia, R = Rhizobium, Rl = Rhizobium
leguminosarum, Rlv = R. leguminosarum symbiovar viciae, I – IV = lineages, a – f =
sub-lineages within lineage IV.

87
Genetic diversity analyses using STRUCTURE
With five long runs in STRUCTURE, we determined the optimal number of clusters K to
be 9 and found admixture among populations (Fig. 26A and Fig. 26B). However, we
obtained admixed structures in Isolates GLR7, GLR23, GLR31, GLR33, GLR40,
GLR45, GLR67, GLR74, TLR7, TLR10 and TLR14. In contrast, the new lineages from
Bangladesh did not show any admixture (Fig. 26A and Fig. 26B).

Detection of minimum recombination events and gene flow using

DnaSP
Minimum recombination events found in single gene sequences and concatenated
sequences of three genes are shown in table 17. Among three housekeeping genes,
recA, atpD and glnII reveal 12, 14 and 16 recombination events, respectively, and
concatenated data showed 43 recombination events.

Table 17. Minimum recombination events on different genes

Gene N Gene Rm Coalescence simulation

size (bp) Rm Confidence P< observed
average interval Rm
recA 58 415 12 8.65 [5 – 13] 0.945
atpD 55 472 14 3.65 [1 – 6] 1.00
glnII 57 598 16 5.83 [2 – 10] 1.00
concatenated 53 1485 43 17.02 [10 – 24] 1.00

Abbreviations, Rm = minimal intragenic recombination events, N = number of isolates, bp = base pair

High values (Nm = 4.34) of gene flow were found between Turkish and Syrian isolates,
along with non-significant KST values (0.039), while low values (Nm = 1.91) for the
same parameters were found between Germany versus Turkey and Syria (table 18).

Differentiation between geographical groups

AMOVA analyses of the concatenated sequence of protein coding genes from isolates
from Germany, Turkey and S yria indicated the existence of significant differences
between geographical regions (table 18), although the percentage of variation

88
 a

b b

III

II
f d
c e

B = Bangladeshi lentil rhizobia

G = German lentil rhizobia
T = Turkish lentil rhizobia
S = Syrian lentil rhizobia
I – III = lineages
a – f = sub-lineages within lineage IV

Fig. 25a. Split graph from neighbor-network analyses based on concatenated

sequences of recA-atpD-glnII genes. Three lineages and six different sub-lineages
within the lineage IV were recovered like in ML phylogenetic analyses. Six sub-
lineages under the lineages IV are showing clear reticulate structure among
themselves indicating the effect of recombination on their genetic structure. Three
lineages (I – III) are clearly distinct from the lineage IV recovered from Bangladesh.

89
 a b
f

III

d II

c e

17 = Rlv CCBAU03322
B = Bangladeshi lentil rhizobia 1 = Rlv USDA2370 9 = Rlv J1 18 = Rlv CCBAU43229
G = German lentil rhizobia 2 = Rlv USDA2489 10 = Rlv WSM1325 19 = Rlv CCBAU81100
T = Turkish lentil rhizobia 3 = Rlv USDA2499 11 = Rlv WSM2304 20 = Rlv CCBAU81107
S = Syrian lentil rhizobia 4 = Rlv USDA2500 12 = Rlv 3841 21 = Rlv CCBAU85004
Rlv = Rhizobium leguminosarum 5 = Rlv USDA2502 13 = Rlv VF39 22 = R. pisi DSM30132
symbiovr viciae 6 = Rlv USDA2503 14 = Rlv CCBAU23125 23 = R. fabae CCBAU33202
I – III = lineages 7 = Rlv Nvf1 15 = Rlv CCBAU23131 24 = R. etli CFN42
a – f = sub-lineages within lineage IV 8 = Rlv Nvf3 16 = Rlv CCBAU03317 25 = R. etli CIAT652
26 = R. yanglingense SH22623

Fig. 25b. Split graph from neighbor-network analyses based on concatenated

sequences of recA-atpD-glnII genes of the studied rhizobial isolates and sequences
available in GenBank. Three lineages and six sub-lineages under the lineage IV were
recovered like ML phylogenetic analyses. The figure shows relationship of recovered
lineages and sub-lineages with previously described R. leguminosarum, R. etli and
other related species. The existence of three new lineages in Bangladesh and two new
sub-lineages in Germany, Turkey and Syria are clear in this picture.

90
Table 18. Hierarchical AMOVA of the genetic structure and gene flow of sub-lineages
AMOVA Gene flow
Average Nm KST*
Source of Sum of Variance Variance
Groups FST
variance d.f. squares component (%)
(Syria+ among 1 156.22 5.70 18.82 0.18*** 1.87 0.04
Turkey) populations **
vs.
Germany
within 51 1253.85 24.58 81.18
populations
total 52 1410.07 30.28

Turkey vs. among 1 116.31 6.30 19.86 0.19*** 1.50 0.03

Germany populations **

within 43 991.44 25.46 80.14

populations 44 1107.76
total 30.77

Syria vs. among 1 96.43 5.36 17.01 0.17*** 1.91 0.02

Germany populations **

within 42 1099.65 26.18 82.99

populations
total 43 1196.09 29.85

Syria vs. among 1 33.18 1.95 10.50 0.10 ns 4.14 0.04

Turkey populations *
within 15 249.63 16.65 89.50
populations
total 16 282.82 18.59
Abbreviations: Nm = gene flow, ns = not significant; *, 0.01<P<0.05; **, 0.001<P<0.01; ***, P<0.001

remained low among populations (11 – 20%) compared to the variation found within
populations (80 – 90%). However, there were no s ignificant differences between
Turkish and Syrian isolates (P > 0.05; table 18). Overall, AMOVA analyses showed that
German isolates significantly differed from Turkish and Syrian isolates, with Turkish
samples differ most (table 18).

91
 B
A
BLR9 BLR9
BLR27 BLR27
BLR28 BLR28
BLR153 BLR153
BLR175 BLR175
BLR195 BLR195
B.desh

BLR235 BLR235

I II III
GLR1 GLR1
GLR3 GLR2
GLR5 GLR3
GLR13 GLR5
GLR27 GLR6
GLR45 GLR7

Fig. 26. Ancestry of

GLR46 GLR8
GLR49 GLR10
GLR5 GLR11
TLR2 GLR13
TLR3 GLR16
TLR6

a
GLR17
TLR7 GLR19
TLR9 GLR22
TLR11 GLR23

different
TLR12 GLR25
SLR2 GLR27
SLR3 GLR28
SLR4 GLR29

92
SLR5 GLR31
SLR6
Germany

GLR32
SLR7 GLR33
GLR23 GLR34
GLR33 GLR40
GLR40 GLR43
GLR71 GLR45
GLR74
GLR2
bc GLR46
GLR49
GLR11 GLR50
GLR17 GLR54
GLR34 GLR59
d

SLR1 GLR67
SLR8 GLR69
GLR16 GLR71
GLR19 GLR74
GLR25 GLR79
GLR28 TLR2
e

GLR29 TLR3
GLR32 TLR6
GLR69 TLR7
GLR69 TLR9
GLR6 TLR10
GLR8 TLR11
Turkey

GLR10 TLR12
f

GLR22 TLR14
GLR43 SLR1

clustering of different group arranged by different lineages and sub-lineages.

GLR54 SLR2
GLR59 SLR3
GLR79 SLR4
GLR7 SLR5
Syria

GLR31 SLR6
GLR67

STRUCTURE assuming K = 9 ancestral populations. Individual isolate is marked at

clustering of different group ordered by different countries and bar plot (B) showing
horizontal axis and their corresponding column is filled with color according to the
inferred proportion which was inferred from one of the ancestry. Bar plot (A) showing
lineages and sub-lineages as inferred by
SLR7
TLR10
unique

SLR8
TLR14
Relative impact of recombination and point mutation
Using concatenated sequences, we determined the relative effect of recombination
versus point mutations. The r/m was 1.52 and the ρ/θ was 0.269, suggesting a greater
importance of recombination over mutation for explaining the observed genetic diversity
(table 19). Reconstructed phylograms from CLONALFRAME analyses revealed much
shorter times to the most recent common ancestor (TMRCA) when considering
recombination [TMRCA = 0.220 (0.130 – 0.352), Fig. 29a, table 19] than when
assuming no recombination [TMRCA = 1.110 (0.342 – 3.073) Fig. 29b]. Tree topologies
also differed between these phylograms.

Table 19. Recombination effect inferred by CLONALFRAME (confidence intervals are

shown in parentheses)

Run R r/m ρ/θ θ

1 26 (12 – 47) 1.479 (0.833 – 2.330) 0.252 (0.112 – 0.471) 109 (71 – 160)

2 31 (14 – 57) 1.611 (0.908 – 2.544) 0.294 (0.125 – 0.550) 109 (72 – 160)

3 26 (12 – 46) 1.490 (0.855 – 2.408) 0.262 (0.121 – 0.502) 101 (67 – 146)

Average 28 (13 – 50) 1.520 (0.865 – 2.428) 0.269 (0.119 – 0.507) 106 (70 – 155)

Abbreviations, R = recombination rate, r/m = relative impact of recombination as compared with point
mutation, ρ/ θ = relative frequency of the occurrence of recombination as compared with point mutation, θ
= mutational rate

For example, the position of the sub-lineages e and f, and the polytomy including sub-
lineages a and f is well resolved assuming no recombination (Fig. 29b). However, we
obtained more polytomies in the dendrogram when considering recombination (Fig.
29a).

Symbiotic gene analyses

ML analyses based on nodulation gene sequences recovered five groups (nodC from
38 isolates and nodD from 24 isolates) from Germany, Turkey and Syria (Fig. 27 and
Fig. 28). In nodC gene analysis, group A contained isolates from Germany, Turkey and
Syria. This group clusters with previously described strains isolated from Peru, Spain,
and United Kingdom from different members of the legume tribe Vicieae. This group
includes the isolate BLR195, which was isolated from lentils in Bangladesh and belongs
to lineage III, suggesting a c lear case of horizontal transfer of nodulation genes
between lineage III and IV. In same tree (nodC) group B and G contained isolates from
Germany only, while groups C and E contained isolates from Turkey and Syria,
93
respectively. Among seven groups (A – E from Germany, Turkey and Syria, and groups
I – II from Bangladesh), the group C from Turkey and t he group II from Bangladesh
differed considerably from existing nodC sequences of R. leguminosarum symbiovar
viciae strains. Moreover, two isolates GLR2 and S LR2 showed significant differences
from existing strains. In terms of congruence, the nodulation gene trees differed from
trees based on chromosomal genes, suggesting horizontal / lateral gene transfer of
nodulation genes.

We sequenced nodD gene from 24 isolates (11 from Germany, 6 from Turkey, 6 from
Syria and one from Bangladesh) to compare with the nodC gene analyses to determine
whether they were congruent or not. The reconstructed ML tree from the nodD gene
sequences showed similar tree topologies (except for the isolates GLR17 and SLR 4) to
the one based on nodC gene sequences (Fig. 28). The exception of GLR17 and SLR4
isolates may arise from internal rearrangement of nod region by recombination. Group
A corresponds to the previously described nodD type II / nodD type g (Laguerre et al.,
2003; Mutch & Young, 2004; Tian et al., 2010; and reference therein) from faba bean
rhizobia from different geographical locations (Jordan, Spain, Canada and UK). Group
B showed similarity with previously described nodD type III from faba bean rhizobia and
from Europe (France and UK) and China (Tian et al., 2010).

Although Turkish isolates form a separate group (group C) in the nodC gene tree, this
group showed similarity with a previously described nodD type I from the Middle East
and China, suggesting rearrangement within the nod region by recombination. Although
the nodC group from Syria (E) was close to previously described strains, in the nodD
gene tree this group formed a strong separate group from existing nodD groups. The
isolate GLR17 had an identical sequence to a distinct strain previously found in France
from pea rhizobia. However, Bangladeshi isolates formed a di stinct group from the
isolates from Germany, Turkey and Syria or previously described nodC gene
sequences from different geographical regions. Although Bangladeshi isolates formed a
strongly separate group in nodC gene, it was close to previously described nodD type
IV (Tian et al., 2010) from China and the Middle East in nodD gene.

94
 GLR34 (KC679635)
GLR49 (KC679639)
GLR33 (KC679634)
GLR25 (KC679632)
GLR11 (KC679625)
GLR7 (KC679622)
72 Rhizobium sp PEVF10 (FJ596030)
Rl RVS03 (FJ596018)
Rlv 3841 (NC 008381)
GLR50 (KC679640) A (Germany, Turkey, Syria)
SLR8 (KC679656)
Rhizobium sp BLR195 (JN649012)
(Bangladesh)
75 94 Rl CCBAU71205 (EU177612)
Rhizobium sp PEVF08 (FJ596029)
Rl PEVF01 (FJ596025)
Rl LEN4 (GU014314)
GLR13 (KC679626)
75
TLR2 (KC679641
TLR7 (KC679644)
TLR12 (KC679649)
SLR2 (KC679651) unique
80 Rhizobium sp BLR98 (JN649001)
Rhizobium sp BLR174 (JN649010) II (Bangladesh)
Rhizobium sp BLR139 (JN649007)
GLR 5
GLR 1
GLR 14 B (Germany)
GLR 17
GLR 27
GLR 46
Rl PEVF05 (FJ596028)
Rl (DQ413004)
94
Rhizobium sp CVIII14 (FJ596021)
96 GLR2 (KC679620) unique
GLR10 (KC679624) unique
92 TLR3 (KC679642)
TLR5 (KC679602)
TLR8 (KC679645)
100
TLR9 (KC679646) C (Turkey)
TLR10 (KC679647)
TLR11 (KC679648)
TLR14 (KC679649)
99 GLR23 (KC679631)
GLR45 (KC679637)
Rl VF25-3 (AY664624)
Rhizobium sp PEVF03 (FJ596027)
80 GLR22 (KC679630) D ( Germany)
GLR40 (KC679636)
GLR8 (KC679623)
90
Rlv BIHB1164 (JF759752)
GLR16 (KC679628)
80 Rlv BIHB1160 (JF759750)
98 Rlv BIHB1157 (JF759749)
Rl CCBAU71124 (EU177611)
SLR4 (KC679653)
99
99 SLR7 (KC679655)
70 SLR3 (KC679652)
E ( Syria)
SLR5 (KC679654)
Rhizobium sp MVP07 (FJ596024)
R. multihospitium CCBAU83401 (EF050781)
100 Rhizobium sp BLR26 (JN648994)
Rhizobium sp BLR9 (JN648993)
Rhizobium sp BLR153 (JN649008)
Rhizobium sp BLR62 (JN649000) I ( Bangladesh)
Rhizobium sp BLR175 (JN649011)
Rhizobium sp BLR127 (JN649005)
Rhizobium sp BLR235 (JN649013)

0.01

Fig. 27. ML tree from nodC gene partial sequences. Bootstrap values indicated when
≥ 70% (1000 replicates). Abbreviation: GLR = German lentil rhizobia, TLR = Turkish
lentil rhizobia, SLR = Syrian lentil rhizobia, BLR = Bangladeshi lentil rhizobia, Rlv = R.
leguminosarum symbiovar viciae, Rl = R. leguminosarum, A – E = nodulation gene
group from German, Turkish and Syrian strains, I – II = nodulation gene group from
previous study.

95
 Rhizobium sp. BLR28 (JN649015)
Rhizobium sp. BLR9 (JN649014)
Rhizobium sp. BLR235 (JN649027)
Rhizobium sp. BLR33 (JN649016)
100 Rhizobium sp. BLR41 (JN649017)
I (Bangladesh)
Rhizobium sp. BLR45 (JN649018)
Rhizobium sp. BLR57 (JN649019)
Rhizobium sp. BLR127 (JN649022)
Rlv CCBAU83268 (GQ323703)
73
Rhizobium sp. BLR175 (JN649025)
Rlv CCBAU11080 (GQ323701)
96 Rlv Nvf1 (GQ323718)
Rlv J1 (GQ323717)
99 SLR4 (KC679676)
75
SLR3 (KC679675) E
SLR6 (KC679677)
SLR7 (KC679678)
Rhizobium sp. BLR174 (JN649024) II (Bangladesh)
GLR 2 unique
90 GLR27 (KC679663)
GLR46 (KC679666)
GLR1 (KC679657)
B ( type III )
SLR1 (KC679674)
96
R. fabae CCBAU23123 (EU430079)
Rlv CCBAU03058 (GQ323708)
Rlv CCBAU65264 (GQ323706)
Rlv IIAUa3 (EU232114)
88 Rlv IIFa10 EU232108)
75
Rlv PINP3C (EU232116)
84 GLR23 (KC679662) D
Rlv Lp 3 (AY226889)
Rlv Vc2 (AY226887)
GLR45 (KC679637)
Rlv Ln7 (AY245528)
99 GLR17 (KC679661)
Unique
Rlv PC2-9 (EU232113)
GLR7 (KC679659)
Rlv Nvf3 (GQ323720)
SLR8 (KC679679)
Rlv 3841 (NC008381)
95 GLR33 (KC679664)
70 GLR50 (KC679667)
A ( type II / g )
Rlv Vf10 (AY226878)
GLR11 (KC679660)
Rlv USDA2499 (GQ323713)
Rlv USDA2502 (GQ323715)
BLR195 (KC679679) Bangladesh
99
TLR9 (KC679670)
99 TLR10 (KC679671)
TLR11 (KC679672)
Rlv Nvf2 (GQ323719)
Rlv CCBAU23125 (GQ323696)
Rlv Nvf4 (GQ323721) C ( type I)
TLR7 (KC679669)
TLR12 (KC679673)
R. fabae CCBAU33202 (EU430078)
73
TLR2 (KC679668)
Rlv CCBAU33202 (EU430078)

0.01

Fig. 28. ML tree from nodD gene partial sequences. Bootstrap values indicated when ≥
70% (1000 replicates). Abbreviations: GLR = German lentil rhizobia, TLR = Turkish lentil
rhizobia, SLR = Syrian lentil rhizobia, BLR = Bangladeshi lentil rhizobia, Rlv =R.
leguminosarum symbiovar viciae, Rl = R. leguminosarum, A – E = nodulation gene
group from present study, I – II = nodulation group from previous study.

96
3.2.5 Discussion

Rhizobial populations in collected soil and their symbiotic effectivity

Low to moderate lentil-nodulating rhizobial population densities (MPN / g of soil) were
found in different localities of Germany (table 3). Although there is no detailed
information on the cultivation of lentil in Germany, in 2009 about 0.7% (83,000 ha) of
the cultivable land was used for the cultivation of other legumes like pea
(http://www.aid.de). In addition to their saprophytic nature (Hirsch, 1996; and reference
therein), cultivation of alternative hosts like pea can certainly assist the survival of lentil
rhizobia in these soils. This fact may explain our findings regarding moderate density of
lentil-nodulating rhizobia in German soil (102 – 103, cells / g of soil, approximately).
Moreover, the v ariations in terms of rhizobial density found across German localities
may be du e to differences in soil fertility and l and use strategies employed in these
collection areas (Mwangi et al., 2011). In nodulation tests, all isolates produced pink
nodules with lentil, indicating that they are effective symbionts of this crop. However, in
cross inoculation tests all selected isolates formed nodules with others members of the
legume tribe Vicieae.

Genetic diversity of chromosomal genes and species delineation of

lentil rhizobia
We sequenced three protein-coding housekeeping genes (recA, atpD and glnII) that
contain valuable information for determining biogeographic processes (Palys et al.,
1997; Lan & Reeves, 2001; Vinuesa et al., 2005) and identified six sub-lineages (IVa –
IVf) among the 58 isolates from three countries (Turkey, Syria and Germany). All sub-
lineages belong to R. leguminosarum symbiovr viciae and two sub-lineages (IVb and
IVd) did not show any great similarity to the sub-lineages that were described earlier
within R. leguminosarum symbiovr viciae (Tian et al., 2012), evidencing that they are
new sub-lineages within R. leguminosarum symbiovr viciae. We found phylogenetic
incongruence in reconstructed trees from chromosomal genes. Consequently, result
from different analyses (S-H test, recombination analyses, estimation of TMRCA )
showed substantial level of recombination among sub-lineages (Fitch, 1997;
Shimodaira & Hasegawa, 1999; Bryant & Moulton, 2004; Tian et al., 2010).

97
Network analyses allow conflicting or alternative phylogenetic histories to account for
ambiguities caused by recombination, hybridization, gene conversion and gene transfer
(Fitch, 1997). From this analysis we obtained a c lear reticulate structure among
different sub-lineages from three different countries, but a long edge between
Bangladeshi isolates, and isolates from other three countries. In other words, network
analyses showed a clear difference between lineage IV and the rest by a long edge,
suggesting that lineage IV belongs to separate species (Aguilar et al., 2004; Bailly et
al., 2006). Lentil-nodulating rhizobia from Bangladesh were well-separated by long
edges from R. leguminosarum (those nodulating lentils in different countries of the
Mediterranean region) and always formed three distinct lineages without any
incongruence in phylogenetic analyses; evidencing that Bangladeshi isolates belong to
separate species. Based on pr otein coding genes (recA and glnII), lineage IV is
genetically similar to the R. leguminosarum type strain (> 94%) and form a r eticulate
structure with R. leguminosarum in network analysis suggesting that these sub-
lineages belong to this species (Bailly et al., 2006; Valverde et al., 2006; Santillana et
al., 2008).

Recombination history in lentil-nodulating rhizobia

The interpretation of population structure for a particular species of bacteria collected
from diverse ecological niches heavily depends on the proper interpretation of different
evolutionary processes acting on c hromosomal and plasmid-borne genes (Lan &
Reeves, 2001; Vinuesa et al., 2005). Hence, we used phylogenetic and population
genetic approaches to explore the the evolutionary history of lentil rhizobia.

In this study, we found phylogenetic incongruence in reconstructed trees from

chromosomal genes, and their topology showed significant differences in S-H tests.
Using concatenated sequences, a clear reticulate structure was found in network
analyses, coupled with high values of r/m statistics (r/m = 1.52) in recombination
analyses. Supporting this pattern, a high number of recombination events (43) was
found in three loci. Moreover, relative rates of recombination (ρ/θ) were high (0.269).
Furthermore, the estimation of TMRCA with and w ithout recombination differs
significantly and reveals different consensus tree topologies. These results indicate the
presence of recombination (Fitch, 1997; Shimodaira & Hasegawa, 1999;

98
 b

e
c

a
b
f

Time (coalescent units)

Fig. 29a. Dendogram, a majority rule consensus tree (50%) inferred from concatenated
partial sequence of recA-atpD-glnII genes using CLONALFRAME allowing recombination.
The scale indicate the time in coalescent units. Abbreviations: GLR = German lentil
rhizobia, TLR = Turkish lentil rhizobia, SLR = Syrian lentil rhizobia, a – f = sub-lineages
within lineage IV.

99
 e
c

a
a
b

Time (coalescent units)

Fig. 29b. Dendogram, a majority role consensus tree (50%), inferred from
concatenated partial sequence of recA-atpD-glnII genes using CLONALFRAME
without recombination. The scale indicates the time in coalescent units.
Abbreviations: GLR = German lentil rhizobia, TLR = Turkish lentil rhizobia, SLR =
Syrian lentil rhizobia, a – f = sub-lineages within lineage IV.

100
Bryant & Moulton, 2004; Tian et al., 2010) among the different sub-lineages. The
influence of recombination might explain why we did not recover same sub-lineages
with equal resolution from phylogenetic and network analyses (Holmes et al., 1999;
Didelot & Falush, 2007; den Bakker et al., 2008). Moreover, in the presence of
recombination, phylogenetic approaches used for bacterial taxa and species
delineation may not shown correct interpretations (Rosselló-Mora & Amann, 2001).
Alternatively, by allowing conflicting or alternative phylogenetic histories, network
analyses represent valuable tools for resolving ambiguities caused by recombination,
hybridization, gene conversion and gene transfer (Fitch, 1997).

Successful horizontal gene transfer in bacteria is assume to provide a s elective

advantage to either the host or the gene itself (Gogarten & Townsend, 2005).
Therefore, it could be assumed that to cope with diverse conditions, R. leguminosarum
from the Europe and the Middle East may allow recombination at loci. In contrast, we
did not see any phylogenetic incongruence in single gene and concatenated sequence
analyses in Bangladeshi isolates under present study and in our previous study (Rashid
et al., 2012) which may be due to soil conditions or crop cultivations histories.

Geographic structure of lentil-nodulating rhizobia

Both gene flow and founder effect act differentially at small or large scales to shape the
genetic structure of bacteria (Strain et al., 1995; Hagen & Hamrick, 1996; Silva et al.,
2005; Vinuesa et al., 2005). The estimation of these parameters in the three different
countries reveals high levels of migration within the center of origin of lentil (Turkey-
Syria), but low gene flow between this center of origin and Europe (Germany). This
result is in contrast to previous study (Silva et al., 2005) where large distances (more
than 10,000 km) represented an important barrier for gene flow, while populations
separated by 1,000 – 2,000 km did not show geographical sub-division. About 3,500
and 4,000 km separate Germany from Turkey and from Syria, respectively. These
distances represent almost one third of the distance proposed by Silva et al. (2005).

Direct dispersal (inoculation of legumes) or indirect dispersal (with seed) of rhizobia

may occur in legumes (Perez-Ramírez et al., 1998). Moreover, geographical distance
and environmental conditions may have a minor effect on bacterial diversity when high
levels of recombination are present (Fraser et al., 2009), which may be t he case for
lentil-nodulating rhizobia.

101
Origin and distribution of new lineages in Bangladesh are influenced
by symbiosis with lentil grex pilosae
For cultivated lentils, Barulina (1930) proposed six geographical groups, or greges, viz.
europeae, asiaticae, intermediae, subspontanea, aethiopicae and pilosae (Cubero,
1981; 2009; and references therein). Interestingly, among the six greges of cultivated
lentil, three groups are restricted to very specific areas. For instance, pilosae is
endemic to the Indian sub-continent, aethiopicae to Ethiopia and Yemen, and
subspontanea to Afghanistan. This study and others on lentil rhizobia show clearly that
R. leguminosarum is the main symbiont of all lentil greges except pilosae in the Indian
sub-continent.

Although Eastern Turkey and N orthern Syria are the area of lentil domestication
(Ladizinsky, 1979; Lev-Yadun et al., 2000; Zohary & Hopf, 2000; Cubero et al., 2009),
Barulina (1930) stated that the Himalaya-Hindu Kush corresponds to the centre of
origin for small seeded microsperma lentils because of the presence of a higher
proportion of endemic varieties. Pilosae has a s trong pubescence which is absent in
other lentils (Cubero et al., 2009) and a flowering asynchrony, and has not overlapped
with any other greges of lentil during the history of domestication and cultivation
(Barulina, 1930). This grex may also have specific genetic characteristics like nod factor
receptors that allow for a s uccessful symbiosis with the new Rhizobium species or
lineages found in Bangladesh. Thus, pilosae and their symbionts may have coevolved
in the Indian sub-continent (Perret et al., 2000; Aguilar et al., 2004). It is therefore
possible that we found new lineages (Rashid et al., 2012) of rhizobia from Bangladesh
due to the significant influence of the pilosae grex on their symbiotic partners.

Rhizobium leguminosarum is the original symbiont of lentils

In agreements with other studies (Moawad & Beck, 1991; 1998; Laguerre et al., 1992;
Geniaux & Amargr, 1993; Tegegn, 2006), we found R. leguminosarum in the centre of
origin of lentil and in countries where lentil had been introduced (e.g. Germany). We not
only found the same R. leguminosarum species but also the same chromosomal
genotype (e.g. sub-lineage IVa) in three different countries.

Hence, it could be assumed that R. leguminosarum is the original symbiont of lentils.

The dispersal of rhizobia with legume seeds is a w ell-accepted hypothesis (Perez-
Ramírez et al., 1998; Aguilar et al., 2004; Álvarez-Martinez et al., 2009). This mode is
considered to be the most important among the indirect ways of rhizobium dispersal
102
(Hirsch 1996; and references therein). L entil is the oldest crop and h as remained
popular from ancient times until to date, and found all over the world. Thus it could be
assumed that lentils seed might played a significant role for initial dispersion of R.
leguminosarum symbiovar viciae in different countries.

Phylogenetic incongruence between chromosomal and nodulation

genes
Rhizobial species diversity should be described not only based on genetic markers
located on chromosomes but also on plasmid-borne nodulation genes (Graham et al.,
1991; Amarger et al., 1997; Wang et al., 1999; Laguerre et al., 2001; Silva et al., 2005).
The nodC and nodD genes determine host range, host promiscuity and the
relationships between host plants and rhizobia (Laguerre et al., 2001; Zeze et al., 2001;
Iglesias et al., 2007). In our study, phylogenetic analyses based on nodulation genes
confirm that these isolates belong to symbiovar viciae and they have nodC and nodD
genotypes which have previously been described from Europe, Middle East and China.
We also detected new groups within this symbiovar.

There was no c ongruence between chromosomal and nodulation genotypes, which

may be due t o frequent lateral transfer of nodulation genes between different rhizobial
chromosomal genotypes (Sprent, 1994; Young & Haukka, 1996). However,
phylogenetic analyses based on nodulation genes (nodC and nodD) revealed similar
tree topologies correlated mostly with ecological regions. Probably as a consequence of
both host and soil microhabitats (Sprent, 1994), we detected new nodulation genotypes
(or groups) that were supported by both nodulation genes. These results support the
hypothesis that plasmid-borne characters in bacteria change rapidly according to their
adaptation to particular environments. Nonetheless, nodulation genes from Europe and
the Middle East did not show great similarities to the isolates from Bangladesh,
suggesting that the latter have an independent origin on t he Indian subcontinent. A
similar hypothesis has been proposed for the origin of R. etli (Aguilar et al., 2004). Out
of the three distinct lineages, one lineage (lineage I) is found all over Bangladesh
(Rashid et al., 2012), suggesting that it may have been distributed with pilosae seeds.

103
Conclusions
By analyzing lentil-nodulating rhizobia from four countries in two different continents we
found four different lineages of rhizobia, of which three are new. These three new
lineages of rhizobia are endemic to Bangladesh and have been coevolved with grex
pilosae of lentil. The presence of common genotypes of R. leguminosarum with lentil in
different countries, suggest that R. leguminosarum is the original symbiont of lentil.
Further research is needed in order to further examine the genetic diversity and
population structure of lentil-nodulating rhizobia in different geographical regions.

104
4. Conclusions and general discussion
In this study lentil-nodulating rhizobia were isolated from countries at the centre of the
origin of lentil (Turkey and Syria) and from countries where lentil was introduced later
(Germany and B angladesh). The collected rhizobial isolates were analyzed based on
multilocus sequence analyses, DNA fingerprinting, and phenotypic characteristics.
Phylogenetic and population genetic approaches have been used to interpret the data
in terms of rhizobial diversity and taxonomic status of rhizobia associated with lentil. To
our knowledge this is the first detailed study of lentil-nodulating rhizobia. This study
found four different lineages, three of which are novel. Moreover, the study also found
that evolutionary forces such as recombination played a greater role in the
diversification of R. leguminosarum than mutation. The results presented in this
dissertation highlight two major findings: the presence of three new endemic lineages in
Bangladesh (Indian sub-continent) that are close to R. etli but distinct from the R.
leguminosarum-R etli complex, and the origin and distribution of a cosmopolitan lineage
of lentil symbiont (R. leguminosarum) to different countries.

4.1 Genetic diversity of rhizobia nodulating lentil in Bangladesh

Multilocus sequence analysis (MLSA) is considered to be an effective approach for
describing bacterial species diversity and s peciation events. It is also a key approach
for describing closely-related bacterial species (Konstantinidis et al., 2006; and
references therein; Martens et al., 2008; and r eferences therein). Besides their
functional importance, some housekeeping genes like recA, atpD and glnII also provide
useful information for describing closely-related bacterial species that cannot be
resolved using 16S rRNA gene sequences (Bromofeld et al., 2010; and references
therein). Using a M LSA approach, our study revealed that three distinct lineages are
associated with lentil nodulation in Bangladesh. Lineages I and II were distributed
throughout Bangladesh, whereas lineage III was confined to the South East part of the
country. Three protein-coding genes from the isolates taken from Bangladesh showed
similarity values of 89.1 – 92.8% and 92.1 – 94.8% to R. leguminosarum and R.etli,
respectively. Moreover, the genetic similarity values between these new lineages were
91 – 92% for recA, 92 – 94% for glnII and 89 – 94% for atpD. The genetic similarity
levels between the new lineages are comparable to those found between R. etli and R.
leguminosarum, suggesting species status for these lineages from Bangladesh. These
lineages are close to R. etli but significantly different from this species based on DNA

105
sequence information from the four housekeeping genes. This conclusion is also highly
supported by DNA fingerprinting and phenotypic data. Different phylogenetic analyses
like neighbor-joining, maximum likelihood and Bayesian inference methods showed
similar tree topologies. Therefore, from this study it is clear that at least three different
rhizobial lineages are involved in lentil nodulation in Bangladesh that belong to new
species within the genus Rhizobium.

4.2 Origin of rhizobia nodulating lentil in Bangladesh

The host has a s ignificant effect on its symbiont, and the dispersion of legume-
nodulating bacteria may have been facilitated by the export of plants and seeds (Perez-
Ramírez et al., 1998; Aguilar et al., 2004). It is assumed that R. etli originated in the
Americas with its host Phaseolus vulgaris and was distributed with its seed to other
countries around the world (Aguilar et al., 2004). Although the lineages from
Bangladesh were close to R. etli, its host Phaseolus vulgaris is neither widely known
nor cultivated in Bangladesh, suggesting a l ow probability for the distribution of these
new lineages to Bangladesh with Phaseolus vulgaris seeds. However, Bangladesh has
a long history for lentil cultivation. Among the six cultivated greges of lentil, pilosae is
the only cultivated grex widely available throughout Bangladesh and other parts of the
Indian sub-continent. We obtained new lineages of rhizobia from endemic pilosae lentils
that were absent from other parts of the world. Parallel and independent evolution may
occur in different locations in strains of pathogenic and symbiotic bacteria, (Schuster &
Coyne, 1974; Geffroy et al., 1999; Aguilar et al., 2004; Wolde-Meskel et al., 2005)
suggesting that these new lineages may potentially be endemic to Bangladeshi soil and
may have coevolved with locally grown pilosae lentils.

4.3 Genetic diversity of lentil-nodulating rhizobia from the Middle East

and Germany are greatly influenced by recombination
Although the 16S rRNA gene sequences from the 58 i solates from Germany, Turkey
and Syria were 99 – 100% similar to R. leguminosarum, we identified six sub-lineages
(Iva – IVf) by analyzing three housekeeping genes. Out of these, two sub-lineages (IVb
and IVd) showed substantial differences to other sub-lineages and s trains of R.
leguminosarum that had been described earlier (Tian et al., 2010). Hence, they might
represent new sub-lineages within R. leguminosarum. However, all sub-lineages were
not equally well-resolved in phylogenetic and population analyses. Therefore, our study

106
further supports the view that the interface between populations and species should be
explored using both population genetics and phylogenetic approaches (Lan & Reeves,
2001; Vinuesa et al., 2005).

Different analyses (recombination, mutation, tree topologies, structure) of three protein-

coding genes showed phylogenetic incongruence among the reconstructed trees and
significant differences in their topologies, and a substantial influence of recombination
(Fitch, 1997; Shimodaira & Hasegawa, 1999; Bryant & Moulton, 2004; Tian et al., 2010)
in different sub-lineages. We identified a maximum of six sub-lineages in ML analyses
that were not found in other analyses; this might be due to a v iolation of the
phylogenetic assumption of bifurcation by the presence of recombination (Holmes et al.,
1999; Didelot & Falush, 2007; den Bakker et al., 2008) in the different sub-lineages. By
allowing conflicting or alternative phylogenetic histories, like recombination, network
analyses represent valuable tools for resolving ambiguities (Fitch, 1997; Vinuesa et al.,
2005; and references therein). This analysis produced a reticulate structure among sub-
lineages; suggesting a great influence of recombination on R. leguminosarum. In
contrast, recombination was apparently absent in three new lineages found in
Bangladesh, and we did not see any phylogenetic incongruence and reticulate structure
in single-gene and c oncatenated sequence analyses. This might be due t o the
influence of soil conditions or crop cultivation histories in Bangladesh.

4.4 Species delineation of lentil rhizobia

The ML analysis and genetic similarity showed that lentil rhizobia from Bangladesh
belong to three new lineages, and found a cosmopolitan lineage in the Middle East and
central Europe. Similar result were also observed in network analysis, which showed a
long edge between the German-Turkish-Syrian isolatesand Bangladeshi isolates and a
reticulate structure among six sub-lineages within R. leguminosarum, suggesting that
the Bangladeshi isolates belong to separate species (Aguilar et al., 2004; Bailly et al.,
2006). Although ML analysis found six sub-lineages in the Middle Eastern and German
isolates, they form a reticulate structure with R. leguminosarum; evidencing that all sub-
lineages belong to this species.

4.5 Rhizobium leguminosarum is the original symbiont of lentils

Most studies on the origin and distribution of cultivated lentil indicated that the center of
origin of lentil is located in the Near East and Central Asia (Shandu & Singh, 2007; and
107
references therein). We found R. leguminosarum in the center of origin (Syria and
Turkey) and i n a country where lentil had been introduced later (Germany). Previous
studies also found R. leguminosarum in the Mediterranean region, European countries,
different African countries and in the Americas (Moawad & Beck, 1991; Laguerre et al.,
1992; Geniaux & Amargr, 1993; Moawad et al., 1998; Tegegn, 2006). Moreover, both
macrosperma and microsperma lentils, with the exception of the grex pilosae, are
present in Turkey (www.economy.gov.tr), but we did not find any rhizobial strains that
are similar to the ones isolated from Bangladesh. In contrast, we not only found R.
leguminosarum in the center of origin but also in central Europe, including common
chromosomal genotypes such as sub-lineage IVa. Hence, it could be assumed that R.
leguminosarum is the original symbiont of lentil.

Legume seed is a major carrier of rhizobia (Perez-Ramírez et al., 1998; Aguilar et al.,
2004), and lentils seed therefore might also carry rhizobia on their testa. Lentil is one of
the oldest cultivated crops and has remained popular until now. Due to its popularity
and ancient origin, it can be assumed that after its domestication in the cradle of
agriculture lentil symbionts quickly dispersed to Europe and Africa with its host (Zohary
& Hopf, 1993; Shandu & Singh, 2007; Sonnante et al., 2009). The presence of common
chromosomal genotypes in both the center of lentil origin and in countries to which lentil
was introduced later suggest a c ommon phylogenetic origin of R. leguminosarum.
Therefore, the spread of lentils may have helped the initial dispersion of R.
leguminosarum from the cradle of agriculture to other countries.

4.6 Genetic diversity of nodulation genes

Nodulation factors (Nod) help to establish legume-rhizobium symbiosis (Laguerre et al.,
2001), and Nod factor synthesis depends on di fferent nodulation genes. Nodulation
genes like nodA, nodC and nodD are widely used as symbiotic marker for describing
rhizobial diversity (Perret et al., 2000; Laguerre et al., 2001; Iglesias et al., 2007; Tian et
al., 2010; and references therein). Although an analysis of chromosomal genes found
three distinct lineages in Bangladesh, phylogenetic analyses of three nodulation genes
(nodA, nodC and nodD) detected two genotypes / groups among these three lineages.
Nodulation gene sequences showed high similarities to those of R. leguminosarum
symbiovar viciae, but they still formed a separate genotypes supported by high
bootstrap values (79 – 99%). Phylogenetic analyses of nodulation genes from the
Middle Eastern and the central European isolates also support a similarity between the

108
isolates and R. leguminosarum symbiovar viciae. We also detected new groups within
this symbiovar that were biased to their geographical origin. There was no congruence
between nodulation gene and chromosomal gene phylogeny, which may be du e to
horizontal / lateral nodulation gene transfer between different chromosomal lineages
and sub-lineages (Ochman et al., 2000; Laguerre et al., 2001; Han et al., 2010; Degefu
et al., 2011). In most of the cases, the phylogeny of nodulation genes showed a positive
correlation with their ecological origin, which may be a c onsequence of both the host
and the soil microhabitats (Sprent, 1994).

Like the lentil-nodulating rhizobia from different countries (Bangladesh, Germany,

Turkey and Syria), R. leguminosarum symbiovar viciae 3841 also nodulates lentil
effectively and produces effective nodules with lentil in our nodulation test. Therefore,
we can predict that the symbiotic performance of lentil isolates lies within the variability
of R. leguminosarum symbiovar viciae.

4.7 Specific conclusion

Our present study found four different lineages of rhizobia associated with lentil
nodulation in different countries, of which three are new. These three new lineages are
closely related to R. etli but phylogentically distinct enough to warrant new species
status within the genus Rhizobium. Phylogenetic conclusions are highly supported by
DNA fingerprinting data and phenotypic data. Therefore, our study found three species-
level new lineages in Bangladesh. The pilosae lentil is endemic to Bangladesh and the
Indian sub-continent, and we isolated new lineages of rhizobia from pilosae root
nodules. Both the new rhizobial lineages and the lentil grex are absent from other parts
of the world, suggesting that these new rhizobial lineages are endemic to Bangladesh
or the Indian sub-continent and co-evolved with pilosae lentil. This study showed a
common R. leguminosarum genotype present in Turkey and Syria, which are at the
origin of all macrosperma and microsperma lentil greges with the exception of pilosae,
and in central Europe (Germany), suggesting that R. leguminosarum is the original
symbiont of lentil. The presence of a common lineage and sub-lineage at centre of
origin and in other countries suggested that lentil seed might have played a major role
in the initial distribution of this symbiont to different countries from the Middle East on to
other countries. Further research with more isolates from more geographical locations
and analyses of genetic markers from different lentil greges are needed to examine the
genetic diversity and population structure of lentil-nodulating rhizobia.

109
5. References

Adekambi T & Drancourt M (2004) Dissection of phylogenetic relationships among

rapidly growing Mycobacterium species by 16S rRNA, hsp65, sodA, recA and
fpoB gene sequencing. Int J Syst Evol Micr 54: 2095 – 2105.
Aguilar OM, Riva O & Peltzer E (2004) Analysis of Rhizobium etli and of its symbiosis
with wild Phaseolus vulgaris supports coevolution in centers of host diversification.
P Natl Acad Sci USA 101: 13548 – 13553.
Álvarez-Martinez ER, Valverde A, Ramírez-Bahena MH, García-Fraile P, Tejedor C,
Mateos PF, Santillana N, Zúñiga D, Peix A & Velázquez E (2009) The analysis of
core and symbiotic genes of rhizobia nodulating Vicia from different continents
reveals their common phylogenetic origin and s uggests the distribution of
Rhizobium leguminosarum strains together with Vicia seeds. Arch Microbiol 191:
659 – 668.
Amarger N, Macheret V & Laguerre G (1997) Rhizobium gallicum sp. nov. and
Rhizobium giardinii sp. nov. from Phaseolus vulgaris nodules. Int J Syst Bacteriol
47: 996 – 1006.
An DS, Im WT, Yang HC & Lee ST (2006) Shinella granuli gen. nov., sp. nov., and
proposal of the reclassification of Zoogloea ramigera ATCC 19623 as Shinella
zoogloeoides sp. nov. Int J Syst Evol Micr 56: 443 – 448.
Anyango B, Wilson KJ, Beynon JL & Giller KE (1995) Diversity of rhizobia nodulating
Phaseolus vulgaris in two Kenyan soils of contrasting pHs. Appl Environ Microb
61: 4016 – 4021.
Bailly X, Olivieri I, de Mitas S, Cleyet-Marel J & Béna G (2006) Recombination and
selection shape the molecular diversity pattern of nitrogen-fixing Sinorhizobium sp.
associated to Medicago. Mol Ecol 15: 2719 – 2734.
Baldani JI, Baldani VLD, Seldin L & Döbereiner J (1986) Characterization of
Herbaspirillum seropedicae gen. nov., sp. nov., a r oot-associated nitrogen-fixing
bacterium. Int J Syst Bacteriol 36: 86 – 93.
Baldwin IL & Fred EB (1929) Root-nodulating bacteria of leguminosae. J Bacteriol 17:
141 – 150.
Barton NH, Briggs DEG, Eisen JA, Goldstein DB & Patel NH (2007) Evolution. (eds.),
Cold spring harbor laboratory press, Europe.
Barulina H (1930) Lentil of the U.S.S.R. and of other countries. Vsesoi︠u︡znai︠a︡ akademii︠a︡
selʹsko khozi︠ a︡ǐ stvennyk, Lenina, Russia.
110
Bergey DH, Harrison FC, Breed RS, Hammer BW & Huntoon FM (1923) Bergey’s
Manual of Determinative Bacteriology. The Williams & Wilkins, Baltimore.
Beringer J (1974) R factor transfer in Rhizobium leguminosarum. J Gen Microbiol 84:
88 – 198.
Black M, Moolhuijzen P, Chapman B, Barrero R, Howieson J, Hungria M & Bellgard M
(2012) The Genetics of symbiotic nitrogen fixation: comparative genomics of 14
rhizobia strains by resolution of protein clusters. Genes 3: 138 – 166.
Brenner DJ, Staley JT & Krieg NR (2005) Classification of prokaryotic organism and
concept of bacterial speciation. Bergey’s manual of systematic bacteriology Vol. 2
(Brenner DJ, Krieg NR & Staley JT, eds), pp. 27 – 32. Springer, New York.
Brockwell J (1963) Accuracy of a plant-Infection technique for counting populations of
Rhizobium trifolii. Appl Microbiol 11: 377 – 383.
Bromofeld ESP, Tambong JT, Cloutier S, Prevost D, Laguerre G, van Berkum P, Thi
PV, Assabgui R & B arran LR (2010) Ensifer, Phyllobacterium and Rhizobium
species occupy nodules of Medicago sativa (alfalfa) and Medicago alba (sweet
clover) grown at a Canadian site without a history of cultivation. Microbiology 156:
505 – 520.
Brown JR & Doolittle WF (1995) Root of the universal tree of life based on ancient
amino-acyl-tRNA synthesize gene duplications. P Natl Acad Sci USA 92: 2441 –
2445.
Brown JM & ElDabaje R (2009) PuMA: Bayesian analysis of partitioned (and
unpartitioned) model adequacy. Bioinformatics 25: 537 – 538.

Bruneau A, Mercure M, Lewis GP & Herendeen PS (2008) Phylogenetic patterns and

diversification in the Caesalpinioid legumes. Botany 86: 697 – 718.
Bruno WJ, Socci ND & Halpern AL (2000) Weighted neighbor joining: a l ikelihood-
based approach to distance-based phylogeny reconstruction. Mol Biol Evol 17:
189 – 197.
Bryant D & Moulton V (2004) Neighbor-net: an ag glomerative method for the
construction of phylogenetic networks. Mol Biol Evol 21: 255 – 265.
Chahota RK, Kishore N, Dhiman KC, Sharma TR & Sharma SK (2007) Predicting
transgressive segregants in early generation using single seed descent method-
derived micromacrosperma genepool of lentil (Lens culinaris Medikus). Euphytica
156: 305-310.
Chen WP & Kuo TT (1993) A simple and rapid method for the preparation of gram
negative bacterial genomic DNA. Nucleic Acids Res 21: 2260.
111
Chen WX, Yan GH & Li JL (1988) Numerical taxonomic study of fast-growing soybean
rhizobia and a pr oposal that Rhizobium fredii be assigned to Sinorhizobium gen.
nov. Int J Syst Evol Micr 38: 392 – 397.
Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG & Thompson JD
(2003) Multiple sequence alignment with the Clustal series of programs Nucl Acids
Res 31: 3497 – 3500.
Chun J & Hong SG (2010) Methods and programs for calculation of phylogenetic
relationships from molecular sequences. Molecular Phylogeny of Microorganisms
(Oren A & Papke RT, eds.), Caister Academic Press, Norfolk, UK.
Conn HJ (1942) Validity of the genus Alcaligenes. J Bacteriol 44: 353 – 360.
Cubero JI (1981) Taxonomy, distribution and evolution of the lentil and its wild relatives.
Lentils (Witcombe J & Erskine W, eds), pp. 15 – 38. Nijhoff and Junk Publishers,
Boston.
Cubero JI, de la Vega MP & Fratini R (2009) Origin, taxonomy and domestication. The
lentil: Botany, production and uses (Erskine W, Muehlbauer F, Sarker A & Sharma
B, eds.), pp. 13 – 33. CAB International, Oxfordshire.
Cullimore JV, Ranjeva R & Bono JJ (2001) Perception of lipo-chitooligosaccharidic Nod
factors in legumes. Trends Plant Sci 6: 24 – 30
Cummings SP, Gyaneshwar P, Vinuesa P et al., (2009) Nodulation of Sesbania species
by Rhizobium (Agrobacterium) strain IRBG74 and other rhizobia. Environ
Microbiol 11: 2510 – 2525.
De Bruijn FJ (1992) Use of repetitive (repetitive extragenic palindromic and
enterobacterial repetitive intergeneric consensus) sequences and the polymerase
chain reaction to fingerprint the genomes of Rhizobium meliloti isolates and other
soil bacteria. Appl Environ Microb 58: 2180 – 2187.
de Lajudie P, Laurent-Fulele E, Willems A, Torck U, Coopman R, Collins MD, Kersters
K, Dreyfus B & Gillis M (1998) Allorhizobium undicola gen. nov., sp. nov., nitrogen-
fixing bacteria that efficiently nodulate Neptunia natans in Senegal. Int J Syst
Bacteriol 48: 1277 – 1290.
Degefu T, Wolde-Meskel E & Frostegård A (2011) Multilocus sequence analyses reveal
several un nam ed Mesorhizobium genospecies nodulating Acacia species and
Sesbania sesban trees in Southern regions of Ethiopia. Syst Appl Microbiol 34:
216 – 226.

112
den Bakker HC, Didelot X, Fortes ED, Nightingale KK & Wiedmann M (2008) Lineage
specific recombination rates and microevolution in Listeria monocytogenes. BMC
Evol Biol 8: 277 – 289.
Dhingra KK, Sekhon HS, Sandhu PS & Bhandari SC (1988) Phosphorus-Rhizobium
interaction studies on biological nitrogen fixation and yield of lentil. J Agr Sci 110:
141 – 144.
Didelot X & Falush D (2007) Inference of bacterial microevolution using multilocus
sequence data. Genetics 175: 1251 – 1266.
Doyle JJ (1998) Phylogenetic perspectives on no dulation: an evolving view of plants
and symbiotic bacteria. Trends Plant Sci 3: 473 – 478.
Doyle JJ (2011) Phylogenetic perspectives on t he origins of nodulation. Mol Plant
Microbe Interact 24: 1289 – 1295.
Doyle JJ & Luckow MA (2003) The rest of the iceberg: legume diversity and evolution in
a phylogenetic context. Plant Physiology 131: 900 – 910.
Dreyfus B, Garcia JL & Gillis M (1988) Characterization of Azorhizobium caulinodans
gen. nov., sp. nov., a s tem-nodulating nitrogen-fixing bacterium isolated from
Sesbania rostrata. Int J Syst Bacteriol 38: 89 – 98.
Eardly BD, Nour SM, van Berkum P & Selander RK (2005) Rhizobial 16S rRNA and
dnaK mosaicism and the uncertain phylogenetic placement of Rhizobium galegae.
Appl Environ Microb 71: 1328 – 1335.
Erskine W (1997) Lessons for breeders from land races of lentil. Euphytica 93: 107 –
112.
Erskine W, Smartt J & Muehlbauer FJ (1994) Mimicry of lentil and the domestication of
common vetch and grass pea. Econ Bot 48: 326 – 332.
Excoffier L, Laval G & Schneider S (2005) Arlequin ver. 3.5: an integrated software
package for population genetics data analysis. Evol Bioinform 1: 47 – 50.
Excoffier L, Somouse P & Quattro J (1992) Analysis of molecular variance inferred from
metric distances among DNA haplotypes: application to human mitochondrial DNA
restriction data. Genetics 131: 479 – 491.
Falush D, Stephens M & Pritchard J (2003) Inference of population structure using
multilocus genotype data: linked loci and correlated allele frequencies. Genetics
164: 1567 – 1587.
Fåhreus G (1957) The infection of clover root hairs by nodule bacteria studied by a
simple glass slide technique J Gen Microbiol 16: 374 – 381.

113
FAOSTAT-Agriculture (2004) Food and agricultural commodities production. Food and
agricultural organization. Rome.
FAOSTAT-Agriculture (2007) Food and agricultural commodities production. Food and
agricultural organization. Rome.
FAOSTAT-Agriculture (2010) Food and agricultural commodities production. Food and
agriculture organization. Rome.
Fellay R, Perret X, Viprey V, Broughton WJ & Brenner S (1995) Organization of host-
inducible transcripts on the symbiotic plasmid of Rhizobium sp. NGR234. Mol
Microbiol 16: 657 – 667.
Felsenstein J (1981) Evolutionary trees from DNA sequences: a maximum likelihood
approach. J Mol Evol 17: 368 – 376.
Felsenstein J (1985) Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39: 783 – 791.
Felsenstein J (1988) Phylogenies and q uantitative characters. Ann Rev Ecol Syst 19:
445 – 471.
Fitch W (1997) Networks and viral evolution. J Mol Evol 44: 65 – 75.
Fox GE, Magrum LJ, Balch WE, Wolfe RS & Woese CR (1977) Classification of
methanogenic bacteria by 16s ribosomal RNA characterization. Proc Natl Acad
Sci USA 74: 4537 – 4541.
Frank B (1889) Über die Pilzsymbiose der Leguminosen.Vol.19, Verlog von Paul Parey
Berlin.
Fraser C, Alm EJ, Polz MF, Spratt BJ & Hanage WP (2009) The bacterial species
challenge: making sense of genetic and ecological diversity. Science 323: 741 –
746.
Fred EB, Baldani JI & McCoy E (1932) Root nodule bacteria and legume plants
University of Wisconsin, USA.
Futuyma DJ (2009) Evolution. Sinauer Associates Sunderland, Massachusetts.
Gascuel O (1997) Concerning the NJ algorithm and its unweighted version, UNJ.
Mathematical hierarchies and biology (Mirkin B, McMorris FR, Roberts FS &
Rzhetsky A, eds), pp. 149 – 170. American Mathematical Society, Washington,
DC.
Gaunt MW, Turner SL, Rigottier-Gois L, Lloyd-Macgilp SA & Young JPW (2001)
Phylogenies of atpD and recA support the small subunit rRNA-based classification
of rhizobia. Int J Syst Evol Micr 51: 2037 – 2048.

114
Geffroy V, Sicard D, de Oliveira JCF, Sévignac M, Cohen S, Gepts P, Neema C, Langin
T & Dron M (1999) Identification of an ancestral resistance gene cluster involved
in the coevolution process between Phaseolus vulgaris and its fungal pathogen
Colletotrichum lindemuthianum. Mol Plant Microbe Interact 12: 774 – 784.
Gelman A & Rubin DB (1992) Inference from iterative simulation using multiple
sequences. Stat Sci 7: 457 – 511.
Geniaux E & Amarger N (1993) Diversity and stability of plasmid transfer in isolates
from a s ingle field population of Rhizobium leguminosarum bv. viciae. FEMS
Microbiol Ecol 102: 251 – 260.
Giraud E, Moulin L, Vallenet D et al., (2007) Legumes symbioses: Absence of Nod
genes in photosynthetic bradyrhizobia. Science 316: 1307 – 1312.
Glazunova, Raoult D & Roux V (2009) Partial sequence comparison of the rpoB, sodA,
groEL and gyrB genes within the genus Streptococcus. Int J Syst Evol Micr 59:
2317 – 2322.
Goodfelow M (1971) Numerical taxonomy of some noncardioform bacteria. J Gen
Microbiol 69: 33 – 80
Gogarten JP & Townsend JP (2005) Horizontal gene transfer, genome innovation and
evolution. Nat Rev Microbiol 3: 679 – 687.
Gonzalez J & Wink M (2010) Genetic differentiation of the Thorn-tailed Rayadito
(Aphrastura spinicauda) revealed by ISSR profiles suggest multiple paleorefugia
and high recurrent gene flow. IBIS 152: 761 – 774.
Graham PH (1976) Identifcation and classifcation of root nodule bacteria. Symbiotic
Nitrogen Fixation in Plants (Nutman PS, ed), Cambridge University Press, London.
Graham PH & Parker CA (1964) Diagnostic features in the characterization of the root-
nodule bacteria of legumes. Plant Soil 20: 383 – 396.
Graham PH, Sadowsky MJ & Keyser HH (1991) Proposed minimal standards for the
description of new genera and species of root- and stem-nodulating bacteria. Int J
Syst Evol Micr 41: 582 – 587.
Graur D & Li WH (2000) Fundamentals of molecular evolution. Massachusetts, Sinauer
Associates, Sunderland.
Guttman DS & Dykhuizen DE (1994) Clonal divergence in Escherichia coli as a result of
recombination, not mutation Science 266: 1380 – 1383.
Gyaneshwar P, Hirsch, AM, Moulin L. et al., (2011) Legume-nodulating
Betaproteobacteria: diversity, host range and future prospects. Mol Plant Microbe
Interact 24: 1276 – 1288.

115
Hagen MJ & Hamrick JL (1996) A hierarchical analysis of population genetic structure
in Rhizobium leguminosarum bv. trifolii. Mol ecol 5: 177 – 186.
Hall BG (2008) Phylogenetic Trees Made Easy: A how to manual. Sinauer Associates.
Hall TA (1999) BioEdit: a us er friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41: 95 – 98.
Hamady M & Knight R (2009) Microbial community profiling for human microbiome
projects: tools, techniques, and challenges. Genome Res 19: 1141 – 1152.
Han TX, Tian CF, Wang ET & Chen WX (2010) Associations among rhizobial
chromosomal background, nod genes and host plants based on the analysis of
symbiosis of indigenous rhizobia and w ild legumes native to Xinjiang. Microbial
Ecol 59: 311 – 323.
Harrison, CJ & Langdale JA (2006) A step by step guide to phylogeny reconstruction.
Plant J 45: 561 – 572
Haukka K, Lindstrom K & Young JP (1998) Three phylogenetic groups of nodA and nifH
genes in Sinorhizobium and Mesorhizobium isolates from leguminous trees
growing in Africa and Latin America. Appl Environ Microb 64: 419 – 426.
Hellriegel H & Wilfarth H (1888) Untersuchungen über die Stickstoffnahrung der
Gramineon und Leguminosen. Beilageheft zu der Ztschr. Ver. Rübenzucker-
Industrie Deutschen Reichs.
Hennig W (1966); Davis D & Zangerl R (translator) Phylogenetic Systematics ( Reissue
I, ed.), pp. 72 – 77, Board of Trustees of the University of Illinois, USA.

Herrera-Cervera JA, Sanjuan-Pinilla JM, Oliveres J & Sanjuan J (1998) Cloning and
identification of conjugative transfer origins in the Rhizobium meliloti genome. J
Bacteriol 180: 4583 – 4590.
Hirsch PR (1996) Population dynamics of indigenous and genetically modified rhizobia
in the field. New Phytol 133: 159 – 171.
Holmes EC, Urwin R & Maiden MC (1999) The influence of recombination on the
population structure and evolution of the human pathogen Neisseria meningitidis.
Mol Biol Evol 16: 741 – 749.
Hou BC, Wang ET, Li Y, Jia RZ, Chen WF, Man CX, Sui XH & Chen WX (2009)
Rhizobial resource associated with epidemic legumes in Tibet. Microbial Ecol 57:
69 – 81.
Hudson RR, Slatkin M & Maddison WP (1992) Estimation of levels of gene flow from
DNA sequence data. Genetics 132: 583 – 589.

116
Hynes MF & O’Connell MP (1990) Host plant effect on c ompetition among strains of
Rhizobium leguminosarum. Can J Microbiol 36: 864 – 869.
Ibañez F, Angelini J, Taurian T, Tonelli ML & Fabra A (2009) Endophytic occupation of
peanut root nodules by opportunistic Gammaproteobacteria. Syst Appl Microbiol
32: 49 – 55.
Iglesias O, Rivas R, García-Fraile P, Abril A, Mateos PF, Martinez-Molina E &
Velázquez E (2007) Genetic characterization of fast growing rhizobia able to
nodulate Prosopis alba in North Spain. FEMS Microbiol Lett 277: 210 – 216.
Jarvis BDW, van Berkum P, Chen WX, Nour SM, Fernandez MP, Cleyet-Marel JC &
Gillis M (1997) Transfer of Rhizobium loti, Rhizobium huakuii, Rhizobium ciceri,
Rhizobium mediterraneum, and Rhizobium tianshanense to Mesorhizobium gen.
nov. Int J Syst Bacteriol 47: 895 – 898.
Jordan DC & Allen ON (1974) Family III. Rhizobiaceae (Conn, 1938), Bergey’s manual
of determinative bacteriology (8th edn) (Buchanan RE & Gibbons NE, eds), pp.
261-264. The Williams & Wilkins, Baltimore.
Jordan DC (1982) Transfer of Rhizobium japonicum (Buchanan 1980) to
Bradyrhizobium gen. nov., a g enus of slow-growing, root nodule bacteria from
leguminous plants. Int J Syst Bacteriol 32: 136 – 139.
Jordan DC (1984) Family III. Rhizobiaceae. Bergey's manual of systematic
bacteriology, Vol. 1 (Krieg NR & Holt JG, eds), pp. 234 – 242. The Williams and
Wilkins, Baltimore.
Jukes TH & Cantor CR (1969) Evolution of protein molecules. (Munro HN, ed),
Academic Press, New York.
Kanso S & Patel BKC (2003) Microvirga subterranea gen. nov., sp. nov., a moderate
thermophile from a d eep subsurface Australian thermal aquifer. Int J Syst Evol
Micr 53: 401 – 406.
Keatinge JDH, Materon LA, Beck DP, Yurtsever N, Karuc K & Altuntas S (1995) The
role of rhizobial biodiversity in legume crop productivity in the West Asian
highlands. Exp Agr 31: 485 – 491.

Khurana AS & Sharma P (1995) Variety and Rhizobium strain interactions in lentil. Lens
Newsletter 22: 34 – 36.
Kimura M (1980) A simple method for estimating evolutionary rates of base
substitutions through comparative studies of nucleotide sequences. Mol Biol Evol
16: 111 – 120.

117
Kitching IJ, Forey PL, Humphries CJ & Williams DM (1998) Cladistics (2nd edn): The
theory and practice of parsimony analysis. Oxford University Press.
Knösel DH (1984) Genus: Phyllobacterium. (Krieg NR & Holt, JG, eds) Bergey's manual
of systematic bacteriology, Vol. 1, pp. 254 – 256. The Williams & Wilkins,
Baltimore.
Konstantinidis KT, Ramette A & Tiedje JM (2006) Toward a more robust assessment of
intraspecies diversity, using fewer genetic markers. Appl Environ Microb 72: 7286
– 7293.
Kouchi H, Imaizumi-Anraku H, Hayashi M, Hakoyama T, Nakagawa T, Umehara Y,
Suganuma N & Kawaguchi M (2010) How many peas in a pod? legume genes
responsible for mutualistic symbioses underground. Plant Cell Physiol 51: 1381 –
1397.
Kumar S & Filipski A (2007) Multiple sequence alignment: in pursuit of homologous
DNA positions. Genome Res 17: 127 – 132.
Ladizinsky G (1979) The origin of lentil and its wild genepool. Euphytica 28: 179 – 187.
Laguerre G, Bardin M & Amarger N (1993) Isolation from soil of symbiotic and
nonsymbiotic Rhizobium leguminosarum by DNA hybridization. Can J Microbiol
39: 1142 – 1149.
Laguerre G, Depret G, Bourion V & Duc G (2007) Rhizobium leguminosarum bv. viciae
genotypes interact with pea plants in developmental responses of nodules, roots
and shoots. New Phytol 176: 680 – 690.
Laguerre G, Geniaux E, Marzurier S, Casartelii R & Amarger N (1992) Conformity and
diversity among field isolates of R. leguminosarum bv. viceae, bv. trifolii, and bv.
phaseoli revealed by DNA hybridization using chromosome and plasmid probes
Can J Microbiol 39: 412 – 419.
Laguerre G, Louvrier P, Allard MR & Amarger N (2003) Compatibility of rhizobial
genotypes within natural populations of Rhizobium leguminosarum biovar viciae
for nodulation of host legumes. Appl Environ Microb 69: 2276 – 2283.
Laguerre G, Mavingui P, Allard MR, Charnay MP, Louvrier P, Mazurier SI, Ligottier-
Gois L & Amarger N (1996) Typing of rhizobia by PCR DNA fingerprinting and
PCR-restriction fragment length polymorphism analysis of chromosomal and
symbiotic gene regions: application to Rhizobium leguminosarum and its different
biovars. Appl Environ Microb 62: 2029 – 2036.

118
Laguerre G, Mazurier SI & Amarger N (1992) Plasmid profiles and restriction fragment
length polymorphism of Rhizobium leguminosarum bv. viciae in field populations.
FEMS Microbiol Ecol 101: 17 – 26.
Laguerre G, Nour SM, Macheret V, Sanjuan J, Drouin P & Amarger N (2001)
Classification of rhizobia based on nodC and nifH gene analysis reveals a c lose
phylogenetic relationship among Phaseolus vulgaris symbionts. Microbiology 147:
981 – 993.
Lan R & Reeves P (2001) When does a clone deserve a n ame? A perspective on
bacterial species based on population genetics. Trends Microbiol 9: 419 – 424.
Land AH & Doig AG (1960). An automatic method of solving discrete programming
problems". Econometrica 28: 497 – 520
Lavin M, Herendeen PS & Wojciechowski MF (2005) Evolutionary rates analysis of
Leguminosae implicates a rapid diversification of lineages during the tertiary. Syst
Biol 54: 575 – 594.
Lev-Yadun S, Gopher A & Abbo S (2000) The cradle of agriculture. Science 288: 1602
– 1603.
Li JH, Wang ET, Chen WF & Chen WX (2008) Genetic diversity and pot ential for
promotion of plant growth detected in nodule endophytic bacteria of soybean
grown in Heilongjiang province of China. Soil Biol Biochem 40: 238 – 246.
Lie TA, Goktan M, Engin M, Pijnenborg J & Anlarsal E (1987) Co-evolution of the
legume – rhizobium association. Plant Soil 100: 171 – 181.
Ludwig W (2010) Molecular phylogeny of microorganisms: Is rRNA still a us eful
marker? Molecular phylogeny of microorganisms (Oren A & Papke RT, eds), pp.
65 – 83. Caister Academic Press, Norfolk.
Ludwig W & Klenk HP (2005) Overview: a phylogenetic backbone and taxonomic
framework for prokaryotic systematic. Bergey’s manual of systematic bacteriology
Vol. 2 (Brenner DJ, Krieg NR & Staley JT, eds), pp. 49 – 65. Springer, New York.
Maddison WP, Donoghue MJ & Maddison DR (1984) Outgroup analyses and
parsimony. Syst Zool 33: 83 – 103.
Maiden MC (2006) Multilocus sequence typing of bacteria. Ann Rev Microbiol 60: 561 –
588.
Makkar NS & Casida LE (1987) Cupriavidus necator gen. nov., sp. nov.: a non obligate
bacterial predator of bacteria in soil. Int J Syst Bacteriol 37: 323 – 326.
Martens M, Dawyndt P, Coopman R, Gillis M, Vos PD & Willems A (2008) Advantages
of multilocus sequence analysis for taxonomic studies: a case study using

119
 housekeeping genes in the genus Ensifer (including former Sinorhizobium). Int J
Syst Evol Micr 58: 200 – 214.
Masson-Boivin C, Giraud E, Perret X & Batut J (2009) Establishing nitrogen-fixing
symbiosis with legumes: how many rhizobium recipes? Trends Microbiol 17: 458 –
466.
Mathews S & Donoghue MJ (1999) The root of angiosperm phylogeny inferred from
duplicate phytochrome genes. Science 286: 947 – 950.
Mau B, Newton M & Larget B (1999) Bayesian phylogenetic inference via Markov chain
Mont Carlo methods. Biometrics 55: 1 – 12
Mayr E (1963) Animal species and evolution. Harvard University Press; London: Oxford
University Press.
McKey D (1994) Legumes and nitrogen: The evolutionary ecology of a nitrogen-
demanding lifestyle. Advances in legume systematics (Sprent JI & McKey D, eds),
Royal Botanic Gardens, Kew, UK.
McNeil DL & Materne M (2007) Rhizobium management and nitrogen fixation Lentil: an
ancient crop for Modern times (Yadav SS, McNeil DL & Stevenson PC, eds), pp.
127 – 143. Springer, Dordrecht, The Netherlands.
Mergaert P, Van Montagu M & Holsters M (1997) Molecular mechanisms of Nod factor
diversity. Mol Microbiol 25: 811 – 817.
Milkman R & Bridges MM (1990) Molecular evolution of the E. coli chromosome III
Clonal frames. Genetics 126: 505 – 517.
Moawad H, Badr El-Din SMS & Abdel-Aziz RA (1998) Improvement of biological
nitrogen fixation in Egyptian winter legumes through better management of
Rhizobium. Plant Soil 204: 95 – 106.
Moawad H & Beck DP (1991) Some characteristics of Rhizobium leguminosarum
isolates from un-inoculated field-grown lentil. Soil Biol Biochem 23: 933 – 937.
Moron B, Soria-Diaz ME, Ault J, Verrios G, Noreen S, Rodriguez-Navarro D, Gil-
Serrano A, Thomas-Oates J, Megias M & Sousa C (2005) Low pH changes the
profile of nodulation factors produced by Rhizobium tropici CIAT899. Chem Biol
12: 1029 – 1040.
Moschetti G, Peluso A, Protopapa A, Anastasio M, Pepe O & Defez R (2005) Use of
nodulation pattern, stress tolerance, nodC gene amplification, RAPD-PCR and
RFLP-16S rDNA to discriminate genotypes of Rhizobium leguminosarum biovar
viciae. Syst Appl Microbiol 28: 619 – 631.

120
Moulin L, Chen W-M, Béna G, Dreyfus B & Boivin-Masson C (2002) Rhizobia: The
family is expanding. Nitrogen fixation: global perspectives (Finan T, O’Brian M,
Layzell D, Vessey K & Newton W, eds), pp. 61 – 65. CAB International,
Wallingford .
Mutch LA & Young JPW (2004) Diversity and specificity of Rhizobium leguminosarum
biovar viciae on wild and cultivated legumes. Mol Ecol 13: 2435 – 2444.
Mwangi SN, Karanja NK, B oga H, Kahindi JHP, Muigai A, Odee D & Mwenda GM
(2011) Genetic diversity and s ymbiotic efficiency of legume nodulating bacteria
from different land use system in Taita Taveta, Kenya. Trop subtrop Agro-
ecosystems 13: 109 – 118.
Nakagawa Y, Sakane T & Yokota A (1996) Transfer of "Pseudomonas riboflavina"
(Foster 1944), a gram-negative, motile rod with long-chain 3-hydroxy fatty acids, to
Devosia riboflavina gen. nov., sp. nov., nom. rev. Int J Syst Bacteriol 46: 16 – 22.
Naser SM, Thompson FL, Hoste B, Gevers, D, Dawyndt P, Vancanneyt M & Swings J
(2005) Application of multilocus sequence analysis (MLSA) for rapid identification
of Enterococcus species based on rpoA and pheS genes. Microbiology 151: 2141
– 2150.
Narra H & Ochman H (2006) Of what use is sex to bacteria? Curr Biol 16: 705 – 710.
Nautiyal CS, Srivastava S & Chauhan PS (2008) Rhizosphere colonization: molecular
determinant from plant-microbe coexistence perspective. Molecular mechanisms
of plant and microbe coexistence (Nautiyal CS & Dion P, eds), pp. 99 – 123 .
Springer-Verlag, Heidelberg.
Nei M (1987) Molecular evolutionary genetics. Columbia University Press, New York.
Nei M & Kumar S (2000) Molecular evolution and phylogenetics Oxford University
Press, New York.
Nene YL (2006) Indian pulse through the millennia. Asian Agri-History 10: 179 – 202
Ngom A, Nakagawa, Y, Sawada, H, et al. (2004). A novel symbiotic nitrogen-fixing
member of the Ochrobactrum clade isolated from root nodules of Acacia mangium.
J Gen Appl Microbiol 50:17 – 27.
Nobbe F & Hiltner L (1896) Inoculation of the soil for cultivating leguminous plants. US
Patent 570813.
Ochman H, Lawrence JG & Groisman EA (2000) Lateral gene transfer and the nature
of bacterial innovation. Nature 405: 299 – 304.

121
Ollivier J, We ST, Bannert A, Hai B, Kastl EM, Meyer A, Su MX, Kleineidam K &
Schloter M (2011) Nitrogen turnover in soil and g lobal change. FEMS Microbiol
Ecol 78: 3 – 16.
Oren A (2010) Concepts about phylogeny of microorganisms - an historical overview
Molecular Phylogeny of Microorganisms (Oren A & Papke RT, eds), pp. 1 – 21.
Caister Academic Press, Norfolk.
Palys T, Nakamura LK & Cohan FM (1997) Discovery and c lassification of ecological
diversity in the bacterial world: the role of DNA sequence data. Int J Syst Bacteriol
47: 1145 – 1156.
Patt TE, Cole GC & Hanson RS (1976) Methylobacterium, a new genus of facultatively
methylotrophic bacteria. Int J Syst Bacteriol 26: 226 – 229.
Perez-Ramírez ON, Rogel MA, Wang E, Castellanos ZJ & Martínez-Romero E (1998)
Seeds of Phaseolus vulgaris bean carry Rhizobium etli. FEMS Microbiol Ecol 26:
289 – 296.
Perret X, Staehelin C & Broughton WJ (2000) Molecular basis of symbiotic promiscuity.
Microbiol Mol Biol R 64: 180 – 201.
Pritchard J, Stephens M & Donnelly P (2000) Inference of population structure using
multilocus genotype data Genetics 155: 945 – 959.
Rahman MM, Bakr MA, Mia MF, Idris KM, Gowda CLL, Kumar J, Deb UK, Malek MA &
Sobhan A (2009) Legumes in Bangladesh. ICARDA, Patancheru, Andhra
Pradesh, India.
Ramírez-Bahena M, García-Fraile P, Peix A, Valverde A, Rivas R, Igual, J.M. , Mateos
PF, Martínez-Molina E & Velázquez E (2008) Revision of the taxonomic status of
the species Rhizobium leguminosarum (Frank 1879) Frank 1889AL, Rhizobium
phaseoli Dangeard 1926AL and Rhizobium trifolii Dangeard 1926AL. R. trifolii is a
later synonym of R. leguminosarum. Reclassification of the strain R.
leguminosarum DSM 30132 (=NCIMB 11478) as Rhizobium pisi sp. nov. Int J Syst
Evol Microbiol 58: 2484-2490.
Rannala B & Yang ZH (1996) Probability distribution of molecular evolutionary trees: a
new method of phylogenetic inference. J Mol Evol 43: 304 – 311

Rashid MH, Satter MA, Uddin MI & Young JPW (2009) Molecular characterization of
symbiotic root nodulating rhizobia isolated from lentil (Lens culinaris). EJEAFChe
8: 602 – 612.

122
Rashid MH, Schäfer H, Gonzalez J & Wink M (2012) Genetic diversity of rhizobia
nodulating lentil (Lens culinaris) in Bangladesh. Syst Appl Microbiol 35: 98 – 109.
Redfield R (2001) Do bacteria have sex? Nat Rev Genet 2: 634 – 639.
Risal CP, Djedidi S, Dhaka D, Ohkama-Ohtsu N, Sekimoto H & Yokoyama T (2012)
Phylogenetic diversity and s ymbiotic functioning in mungbean (Vigna radiata)
bradyrhizobia from contrast argo-ecological region of Nepal. Syst Appl Microbiol
35: 45 – 53.
Rivas R, García-Fraile P & Velázquez E (2009) Taxonomy of bacteria nodulating
legumes. Microbiol Insights 2: 51 – 69.
Rodríguez F, Oliver JF, Marín A & Medina JR (1990) The general stochastic model of
nucleotide substitution. J Theor Biol 142: 485 – 501.
Rogel MA, Ormeno-Orrillo E & Martinez Romero E (2011) Symbiovars in rhizobia
reflect bacterial adaptation to legumes. Syst Appl Microbiol 34: 96 – 104.
Ronquist F & Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference
under mixed models. Bioinformatics 19: 1572 – 1574.
Rosselló-Mora R & Amann R (2001) The species concept for prokaryotes. FEMS
Microbiol Rev 25: 39 – 67.
Rozas J, Sanchez-DelBarrio JC, Messeguer X & Rozas R (2010) DnaSP: DNA
polymorphism analyses by the coalescent and other methods. Bioinformatics 19:
2496 – 2497.
Saha BK, Chowdhury MAH & Rashid MH (2008) Effect of rhizobia and host cultivar on
some biochemical constituents and yield of lentil. Int J Biores 4: 100 – 107.
Saito N & Nei M (1987) The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol Biol Evol 4: 406 – 425.
Santillana N, Ramírez-Bahena MH, García-Fraile P, Velázquez E & Zuniga D (2008)
Phylogenetic diversity based on rrs, atpD, recA genes and 16S – 23S intergenic
sequence analyses of rhizobial strains isolated from Vicia faba and Pisum sativum
in Peru. Arch Microbiol 189: 239 – 247.
Sarker A & Erskine W (2006) Recent progress in the ancient lentil. J Agr Sci 144: 19 –
29.
Satter MA (2001) Soil Microbiology. Agricultural research in Bangladesh in the 20th
centtury (Mian MAW, Maniruzzaman FM, Satter MA, Miah MAA, Paul SK & Haque
KR, eds), pp. 117 – 123. Bangladeh agricultural research council & Bangladesh
academy of agriculture, Dhaka.

123
Sawada H, Ieki H, Oyaizu H & Matsumoto S (1993) Proposal for rejection of
Agrobacterium tumefaciens and revised descriptions for the genus Agrobacterium
and for Agrobacterium radiobacter and Agrobacterium rhizogenes. Int J Syst
Bacteriol 43: 694 – 702.
Schlüter PM & Harris SA (2006) Analysis of multilocus fingerprinting data sets
containing missing data. Mol Ecol notes 6: 569 – 572.
Schmidt HA, Petzold E, Vingron M & von Haeseler A (2003) Molecular phylogenetics:
parallelized parameter estimation and quartet puzzling. J Parallel Distr Com 63:
719 – 727.
Scholla MH & Elkan GH (1984) Rhizobium fredii sp.nov., a f ast-growing species that
effectively nodulates soybeans. Int J Syst Bacteriol 34: 484 – 486.
Schuster ML & Coyne DP (1974) Survival mechanisms of phytopathogenic bacteria
Ann Rev phytopathol 12: 199 – 221.
Segovia L, Young JPW & Martínez-Romero E (1993) Reclassification of American
Rhizobium leguminosarum biovar phaseoli type I strains as Rhizobium etli sp. nov.
Int J Syst Bacteriol 43: 374 – 377.
Shandu JS & Singh S (2007) History and origin. Lentil: an ancient crop for modern
times. ( Shyam SY, David MN & Stevenson PC, eds), pp. 1 – 9. Springer,
Dordrecht.
Shimodaira H & Hasegawa M (1999) Multiple comparisons of log-likelihoods with
applications to phylogenetic inference. Mol Biol Evol 16: 1114 – 1116.
Silva C, Vinuesa P, Eguiarte L, Souza V & Martínez-Romero E (2005) Evolutionary
genetics and biogeographic structure of Rhizobium gallicum sensu lato, a widely
distributed bacterial symbiont of diverse legumes. Mol Ecol 14: 4033 – 4050.
Simmons MP, Bailey DC & Nixon KC (2000) Phylogeny reconstruction using duplicate
genes. Mol Biol Evol 17: 469 – 473.
Skerman VBD, Mcgowan V & Sneath PHA (1980) Approved lists of bacterial names.
Int J Syst Bacteriol 30: 225 – 420.
Slattery JF & Pearce D (2002) Development of elite inoculant Rhizobium strains in
southeastern Australia. (Herridge D, ed), pp. 86 – 94. ACIAR, Australia.
Smith AB (1994) Rooting molecular trees: problem and strategies. Biol J Linn Soc 51:
279 – 292.
Somasegaran P & Hoben HJ (1994) Handbook for rhizobia: methods in legume-
rhizobium technology. Springer, Heidelberg.

124
Sonnante G, Hammer K & Pignone D (2009) From the cradle of agriculture a handful of
lentils:history of domestication. Rendiconti Lincei 20: 21 – 37.
Sprent JI (1994) Evolution and diversity in the legume-rhizobium symbiosis: chaos
theory? Plant Soil 161: 1 – 10.
Sprent JI (2001) Nodulation in Legumes. Royal Botanic Gardens, UK.
Stepkowski T, Moulin L, Krzyzanska A, McInnes A, Law IJ & Howieson J (2005)
European origin of Bradyrhizobium populations infecting lupins and s erradella in
soils of Western Australia and South Africa. Appl Environ Microb 71: 7041 – 7052.
Strain SR, Whittam TS & Bottomley PJ (1995) Analysis of genetic structure in soil
populations of Rhizobium leguminosarum recovered from the USA and t he UK.
Mol Ecol 4: 105 – 114.
Swofford DL, Olsen GJ, Waddell P & HilliS DM (1996) Phylogenetic inference. (Hillis
DM, Moritz C & Mable BK, eds), pp. 407 – 514. Sinauer Associates, Sunderland,
Massachusetts.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M & Kumar S (2011) MEGA5:
molecular evolutionary genetics analysis using maximum likelihood, evolutionary
distance, and maximum parsimony methods. Mol Biol Evol 28: 2731 – 2739.
Tavaré S (1986) Some probabilistic and statistical problems in the analysis of DNA
sequences. Lectures on Mathematics in the Life Sciences (American
Mathematical Society) 17: 57 – 86.

Tegegn ND (2006) Genetic diversity and c haracterization of indigenous Rhizobium

leguminosarum biovar viciae isolates of cool-season food legumes growth in the
highlands of Ethiopia. Thesis University of Putra, Malaysia.

Tian CF, Young JPW, Wang ET, Tamimi SM & Chen WX (2010) Population mixing of
Rhizobium leguminosarum bv. viciae nodulating Vicia faba: the role of
recombination and lateral gene transfer. FEMS Microbiol Ecol 73: 563 – 576.
Tian CF, Zhoub YJ, Zhanga YM et al., (2012) Comparative genomics of rhizobia
nodulating soybean suggests extensive recruitment of lineage-specific genes in
adaptations. P Natl Acad Sci USA.
Toklu F, Karakoy T, Hakli E, Bicer T, Brandolini A, Kilian B & Özkan H (2009) Genetic
variation among lentil (Lens culinaris Medik) land races from Southeast Turkey.
Plant Breeding 128: 178 – 186.
Unkovich MJ & Pate JS (2000) An appraisal of recent field measurements of symbiotic
N2 fixation by annual legumes. Field Crops Res 65: 211 – 228.
125
Urakami T, Araki H, Oyanagi H, Suzuki KI & Komagata K (1992) Transfer of
Pseudomonas aminovorans (den Dooren de Jong 1926) to Aminobacter gen. nov.
as Aminobacter aminovorans comb. nov. and description of Aminobacter
aganoensis sp. nov. and Aminobacter niigataensis sp. nov. Int J Syst Bacteriol 42:
84 – 92.
Valverde A, Igual JM, Peix A, Cervantes E & Velazquez E (2006) Rhizobium lusitanum
sp. nov. a bacterium that nodulates Phaseolus vulgaris. Int J Syst Evol Micr 56:
2631 – 2637.
Van de Peer Y (2003) Phylogeny inference based on distance methods. (Salemi M &
Vandamme AM, eds), pp. 101 – 119. Cambridge University Press, Cambridge.
Vandamme AM (2009) Basic concept of molecular evolution. The phylogenetic
handbook: A practical approach to the analysis and hypothesis testing (Lamey P,
Salemi M & Vandamme AM, eds), pp. 3 – 29. Cambridge University press,
Cambridge.
Versalobic J, Koeuth T & Lupski JR (1991) Distribution of repetitive DNA sequences in
eubacteria and application to fingerprinting of bacterial genome. Nucleic Acids
Research 19: 6823 – 6831.
Vessey JK (2004) Benefits of inoculating legume crops with rhizobia in the Northern
Great Plains. Crop Management, doi: 10.1094 / CM-2004-0301-04-RV.
Vincent JM (1970) A Manual for the Practical Study of Root-Nodule Bacteria, Blackwell,
Oxford.
Vinuesa P, Silvaa C, Wernerb D & Martı´nez-Romero E (2005) Population genetics and
phylogenetic inference in bacterial molecular systematics: the roles of migration
and recombination in Bradyrhizobium species cohesion and delineation. Mol Phylo
Evol 34: 29 – 54.
Wang ET, Rogel MA & García-de los Santos A (1999) Rhizobium etli bv. mimosae, a
novel biovar isolated from Mimosa affinis. Int J Syst Evol Micr 49: 1479 – 1491.
Wang ET, van Berkum P, Beyene D, Sui XH, Dorado O, Chen WX & Martinez-Romero
E (1998) Rhizobium huautlense sp. nov., a symbiont of Sesbania herbacea that
has a close phylogenetic relationship with Rhizobium galegae. Int J Syst Evol
Micr 48: 687 – 699.
Wang L, Gruber S & Claupein W (2012) Effect of sowing date and variety on yield and
weed populations in a lentil-barley mixture. J Agril Sci In press: 1 – 10.
Weisburg WG, Barns SM, Pelletier DA & Lane D J (1991) 16S ribosomal DNA
amplification for phylogenetic study. J Bacteriol 173: 697 – 703.

126
Wernegreen JJ, Harding EE & Riley MA (1997) Rhizobium gone native: unexpected
plasmid stability of indigenous R. leguminosarum. P Natl Acad Sci USA 94:
5483 – 5488.
Wernegreen JJ & Riley MA (1999) Comparison of the evolutionary dynamics of
symbiotic and housekeeping loci: a c ase for the genetic coherence of rhizobial
lineages. Mol Biol Evol. 16: 98 – 113.
White LO (1972) The taxonomy of the crown-gall organism Agrobacterium tumefaciens
and its relationship to rhizobia and other agrobacteria. J Gen Microbiol 72: 565 –
574.
Wielbo J, Marek-Kozaczuk M, Kidaj D & Skorupska A (2011) Competitiveness of
Rhizobium leguminosarum bv. trifolii Strains in mixed inoculation of clover
(Trifolium pratense). Pol J Microbiol 60: 43 – 49.
Willems A (2006) The taxonomy of rhizobia: an overview. Plant Soil 287: 3 – 14.
Wink M (2007) Systematics. Raptor Research and Management Technique (Bird DM &
Bildstein KL, eds), pp. 57 – 72. Hancock House Publishers, Surrey.
Woese CR & Fox GE (1977) Phylogenetic structure of the prokaryotic domain: the
primary kingdoms. Proc Natl Acad Sci USA 74: 5088 – 5090.
Woese CR, Stackebrandt E, Weisburg WG et al., (1984) The phylogeny of purple
bacteria: The alpha subdivision. System Appl Microbiol 5: 315 – 326.
Wolde-Meskel E, Terefework Z, Frostegård A & Lindstrom K (2005) Genetic diversity
and phylogeny of rhizobia isolated from agro-forestry legume species in southern
Ethiopia Int J Syst Evol Micr 55: 1439 – 1452.
Yabuuchi E, Kosako Y, Oyaizu H, Yana I, Hotta H, Hashimoto Y, Ezaki T & Arakawa M
(1992) Proposal of Burkholderia gen. nov. and transfer of seven species of the
genus Pseudomonas homology group II to the new genus, with the type species
Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov. Microbiol.
Immunology 36: 1251 – 1275.
Young JM, Kuykendall LD, Martinenez-Romero E, Kerr A & Sawada H (2001) A
revission of Rhizobium (Frank 1889), with an emended description of the genus ,
and the inclussion of all species of Agrobacterium (Conn 1942) and Allorhizobium
undicola (de Lajudie et al.1998) as new combinations: Rhizobium radiobacter, R.
rhizogenes, R. rubi, R. undicola and R. vitis. Int J Syst Evol Micr 51: 89 – 103.
Young JPW (1996) Phylogeny and taxonomy of rhizobia. Plant Soil 186: 45 – 52.
Young JPW & Haukka K (1996) Diversity and phylogeny of rhizobia. New Phytol 133:
87 – 94.

127
Young JPW & Wexler M (1988) Sym plasmid and chromosomal genotypes are
correlated in field populations of Rhizobium leguminosarum. J Gen Microbiol 134:
2731 – 2739.
Zakhia F, Jeers H, Willems A, Gillis M, Dreyfus B & de Laj udie P (2006) Diverse
bacteria associated with root nodules of spontaneous legumes in Tunisia and first
report for nifH-like gene within the genera Microbacterium and Starkeya. Microbial
Ecol 51: 375 – 393.
Zeze A, Mutch LA & Young JPW (2001) Direct amplification of nodD from community
DNA reveals the genetic diversity of Rhizobium leguminosarum in soil. Environ
Microbiol 3: 363 – 370.
Zhang XX, Kosier B & Priefer UB (2001) Genetic diversity of indigenous Rhizobium
leguminosarum bv. viciae isolates nodulating two different host plant during soil
restoration with alfalfa. Mol Ecol 10: 2297 – 2305.
Zohary D & Hopf M (1993) Domestications of plants in the Old World: the origin and
spread of cultivated plants in West Africa, Europe and the Nile Valley. Clarendon
Press, Oxford.
Zohary D & Hopf M (2000) The domestication of plants in the Old World. Oxford
University Press.
Zuckerkandl E & Pauling L (1965) Molecules as documents of evolutionary history. J
Theor Biol 8: 357-366.
Zurkowski W & Lorkiewicz Z (1976) Plasmid deoxyribonucleic acid in Rhizobium trifolii.
J Bacteriol 128: 481 – 484.

128
6. Appendixes

129
 BLR 105
0.93 BLR 29
BLR 45
BLR 122
BLR 160
BLR 33
BLR 127
0.97 BLR 26
BLR 139
BLR 100
BLR 174
BLR 27
BLR 59
BLR 87
BLR 28
BLR 41
BLR 137
BLR 9
R. etli 12a3 (FN433083)
R. etli SCAU18 (FJ785221)
R. etli SCAU46 (FJ785220)
BLR 98
Rhizobium etli CFN42T (U28916)
R. etli symbiovar mimosae Mim7 (DQ648575)
BLR 57
BLR 58
R. etli CIAT613 (AF313905)
BLR 153
BLR 154
BLR 99
BLR 175
0.90 BLR 228
BLR 129
BLR 195
0.94 BLR 235
R. etli CCBAU65830 (EU618034)
BLR 62
R. etli PEPSM15 (DQ196417)
R. etli RP368 DQ406706
R. leguminosarum ICMP14642 (AY491062)
R. leguminosarum symbiovar viciae ATCC1004T(U29386)
R. leguminosarum RPVF18 (GQ863496)
R. leguminosarum symbiovar trifolii Len 4 (FJ593639)
R. leguminosarum CCBAU65761 EU618030
0.90 R. leguminosarum CCNWXJ0177 (FJ449680)
1 R. leguminosarum V6 (GU306144)
1 R. hainanense I66T (U71078)
1 1 R. miluonense CCBAU41251T (EF061096)
R. Rhizogenes IFO13257T(D14501)
R. etli CIAT 652 (NC 010994)
R. pisi DSM30132T(AY509899)
R. fabae CCBAU33202 (DQ835306)
BLR 281
R. huautlense SO2T(AF025852)
BLR 288
0.94 BLR 299
R. cellulosilyticum ALA10B2T(DQ855276)
R. galegae LMG6214 T (X67226)
1 R. vignae CCBAU05176T(GU128881)
1 1 M. loti LMG6125 (X67229)
1 R. ciceri (U07934)
0.93 M. huakuii IAM14158 (D12797)
R. giardinii H152T (U86344)
R. herbae CCBAU01209 (GU565531)
1 R. giardinii CCBAU45226 (GU565533)
BLR 12
0.93 BLR 46
0.99 R. radiobacter LMG 196 (X67223)
1 R. Rubi IFO13261T (D14503)
1 E. fredii LMG6217T(X67231)
1 E. meliloti LMG6133T(X67222)
BLR 39
Ensifer sp T173T (EU928871)
R. mesosinicum CCBAU25010T(DQ100063)
R. mesosinicum CCBAU41044 (AY395697)
T
B. japonicum ATCC10324 (U69638)
B. yuanmingense B071 (AF193818)

0.1

Appendix 1. Bayesian tree based on 16S rRNA gene partial sequences. Posterior
probability values shown when ≥ 0.90. Abbreviations used: BLR: Bangladeshi lentil
rhizobia., R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium

130
 BLR 105
BLR 9
BLR 33
BLR 98
BLR 127
BLR 29
BLR 57
BLR 87
BLR 174
BLR 59
BLR 26 Clade I
BLR 27
BLR 100
BLR 28
BLR 41
BLR 45
BLR 160
1 BLR 58
BLR 137
BLR 139
BLR 122
R. etli symbiovar phaseoli IE2755 (AY907465)
1 R. etli symbiovar phaseoli IE950 (AY907460)
0.97
R. etli symbiovar phaseoli KIM5 (AY907360)
R. etli symbiovar phaseoli GR12 (AY907361)
BLR 195
1 BLR 235
BLR 228
Clade III
0.98 1 R. leguminosarum PEPSM13 (EF113130)
1 Rhizobium sp PEPSM14 (EF113131)
R. etli CIAT652()
R. leguminosarum USDA 2370 (AJ294376)
0.99 R. leguminosarum symbiovar viciae 3841 (NC008380)
0.99 Rhizobium sp PEVF08 (EF113126)
1 R. fabae CCBAU23123 (F579937l)
1 R. pisi DSM30132T (EF113134)
BLR 129
0.99 BLR 99
1 BLR 154 Clade II
BLR 153
0.96
0.99 BLR 175
0.99 R. etli USDA9032 (AJ294375)
BLR 62
R. etli PEPSM15 (EF113132)
1 R. hainanense CCBAU57015 (HM047132)
R. miluonense CCBAU41251T (HM047131)
R. multihospitium CCBAU83401T (EF490029)
0.95
R. rhizogenes NCPPB2991 (AJ294374)
R. tropici USDA9039 (AJ294372)
1 BLR 46
R. radiobacter NCPPB2437T (AJ294377)
R. cellulosilyticum LMG 23642T (AM286427)
1 R. galegae USDA4128 (AJ294378)
1 R. vignae CCBAU05176T (GU128902)
0.96 R. rubi LMG17935 (AM182122)
R. huautlense LMG18254T (AM182128)
1 BLR 12
R. giardinii H152T (EU488819)
1
R. herbae CCBAU85050 (GU565545)
0.98 E. fredii USDA205T (AJ294379)
1 E. meliloti USDA1002T (AJ294382)
BLR 39
0.97 M. ciceri USDA3383T (AJ294367)
0.97 M. huakuii USDA4779T (AJ294370)
M. loti USDA3471T (AJ294371)
0.91 B. japonicum USDA6T (AM168341)
1 B. japonicum LMG6138 (AM182158)
0.93 B. japonicum SEMIA511 (FJ391142)
B. elkanii USDA76T (AY591568)
Bradyrhizobium sp SEMIA6077 (FJ391163)
B. yuanmingense (AM168343)
0.1

Appendix 2. Bayesian tree based on recA gene partial sequences. Posterior

probability values shown when ≥ 0.90. Abbreviations used: BLR: Bangladeshi lentil
rhizobia., R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium

131
 BLR 281
0.98 BLR 299
1
1 BLR 288
R. huautlense S02T (AY688589)
R. galegae USDA4128 (AJ294406)
0.93 R. vignae CCBAU05176T (GU128888)
0.98 BLR 39
BLR 12
R. cellulosilyticum LMG23642T (AM286426)
1 E. fredii USDA205T (AJ294402)
E. meliloti USDA1002T (AJ294400)
R. herbae CCBAU85050 (GU565538)
R giardinii CCBAU45226 (GU565541)
1 BLR 46
R. radiobacter NCPB2437T (AJ294407)
0.94 R. rhizogenes NCPB2991T (AJ294398)
R. tropici USDA9039 (AJ294396)
R. multihospitium CCBAU83401T (EF490019)
1
R. miluonense CCBAU41251T (HM047116)
R. hainanense CCBAU57015T (GU726293)
R. mesosinicum CCBAU 25010(NR_43548)
BLR 129
BLR 99
0.97 BLR 154 Clade II
BLR 153
BLR 175
R. leguminosarum CCBAU85025 (EU288659)
1
R. leguminosarum symbiovar viciae 3841 (EF113141)
1 R. leguminosarum USDA2370T (AJ294405)
0.95
1 R. fabae CCBAU23123 (EF579925)
R. pisi DSM30132T (EF113149)
0.95 R. etli PEPSM15 (EF113147)
R. etli CIAT652 (CP001074)
R. etli symbiovar Mim2 (AY929507)
0.99
BLR 195
BLR 235 Clade III
1 1
BLR 228
R. etli CCBAU65708 (EU617991)
R. etli USDA9032T (AJ294404)
BLR 62
BLR 100
BLR 127
BLR 137
BLR 174
BLR 139
BLR 160
BLR 58
BLR 105
1 BLR 98
BLR 33 Clade I
BLR 41
BLR 28
BLR 29
BLR 45
BLR 59
1 BLR 122
BLR 26
BLR 134
BLR 9
BLR 27
0.95
BLR 57
0.94 M. huakuii USDA4779T (AJ294394)
1 M. loti USDA3471T (AJ294393)
M. ciceri USDA3383 (AJ294395)
B. japonicum USDA6T (AM168320)
B. yuanmingense CCBAU10071 (AY386760)
B. elkanii USDA76T (AY386758)
0.1

Appendix 3. Bayesian tree based on atpD gene partial sequences. Posterior

probability values shown when ≥ 0.90. Abbreviations used: BLR: Bangladeshi lentil
rhizobia., R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium

132
 BLR 28
1 BLR 9 Clade I
BLR 27
BLR 153
1 Clade II
BLR 175
R. etli (AF169585)
1 BLR 195
0.96
BLR 235 Clade III
1 R. etli symbiovar phaseoli IE954 (AY907409)
0.99
R. etli symbiovar phaseoli KIM5S (AY929463)
R. etli CIAT652 (CP001074)

1 R. etli SCAU46 (FJ799727)

R. etli symbiovar phaseoli GR12 (AY929464)
R. leguminosarum symbiovar viciae J1 (GQ323654)
1
R. leguminosarum symbiovar viciae USDA2498 (GQ323649)
R. leguminosarum symbiovar viciae Nvf1 (GQ323655)
R. leguminosarum symbiovar viciae USDA2500 (GQ323651)
0.97
1 R. leguminosarum USDA2671 (EU488784)
1 R. leguminosarum symbiovar viciae USDA2370T (AF169586)
R. leguminosarum symbiovar viciae CCBAU33204 (GQ323622)
0.93 0.92
0.99 R. leguminosarum symbiovar viciae CCBAU43240 (GQ323623)
1 R. fabae CCBAU23127 (EF579932)
R. girdinii CCBAU33202 (EF579935)
R. herbae CCBAU85050 (GU565552)
R. vignae CCBAU05176T (GU128895)
R. girdinii CCBAU45157 (HM070216)
0.97
Rhizobium sp CCBAU45157 (HM070216)
1
BLR 299
R. huautlense SCAU12 (FJ799723)
R. girdinii CCBAU41230 (GU565554)
1 1 Rhizobium girdinii CCBAU45226 (GU565555)
BLR 12
0.99 R. yanglingense SH22623 (AY9294620)
1 R. tropici CIAT899T (EU488791)
1 R. tropici USDA9030 (AF169584)
1
R. multihospitium CCBAU83401T (EF490040)
M. huakuii USDA4779 (AF169588)
1 E. medicae (AF169592)
1 1 E. meliloti (AF169593)
E. mexicanus HAMBI2910T (GU994064)
0.97
E. saheli (AF169589)
1 M. ciceri (AF169580)
M. tianshanense (AF169579)
M. loti LMG6125T (AF169581)
B. japonicum USDA6T (AF169582)
B. elkanii ICMP13638 (AY494804)
0.1

Appendix 4. Bayesian tree based on glnII gene partial sequences. Posterior

probability values shown when ≥ 0.90. Abbreviations used: BLR: Bangladeshi lentil
rhizobia., R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium

133
 BLR 27
0.99 BLR 57
BLR 98
BLR 59
BLR 9
BLR 41
BLR 122
BLR 28
BLR 105
0.98 BLR 29
1 BLR 45 Clade I
BLR 33
BLR 26
1 BLR 127
BLR 174
BLR 137
0.97 BLR 139
1 BLR 100
BLR 160
BLR 58
BLR 195
1 BLR 235
Clade III
1 BLR 228
R. etli CIAT613
1 R. etli CIAT 652
1 R. fabae CCBAU33202
1 R. pisi DSM30132
R. leguminosarum symbiovar viciae
R. etli PEPSM15
BLR 153
1 BLR 175

1
1 BLR 154
BLR 129 Clade II
1 BLR 99
BLR 62
1 R. etli CFN42
1 R. hainanense
1 R. miluonense CCBAU41251
R. Rhizogenes
R. mesosinicum CCBAU25010
1 R. giardinii CCBAU45226
1 R. herbae CCBAU01209
BLR 12
0.99
1 E. fredii LMG6217
1 E. meliloti LMG6133
BLR 39
1
1 BLR 46
R. radiobacter LMG 196
BLR 288
0.99 BLR 299
1
BLR 281
1 R. huautlense
1 R. galegae LMG6214
R. vignae CCBAU05176 )
R. cellulosilyticum ALA10B2
1 M. loti LMG6125
1 R. ciceri
M. huakuii IAM14158
B. japonicum
B. yuanmingense B071
0.1

Appendix 5. Bayesian tree based on the concatenated partial sequences of 16S-atpD-

recA genes. Posterior probability values shown when ≥ 0.90. Abbreviations used: BLR:
Bangladeshi lentil rhizobia, R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M:
Mesorhizobium

134
 BLR 195
1 Clade III
BLR 235
1
R. etli CIAT613
1
R. etli CIAT 652
1
BLR 28

1 BLR 9 Clade I
1
BLR 27

BLR 153
1
Clade II
1 BLR 175
1
R. etli CFN42

R. fabae CCBAU33202
0.99 1
R. leguminosarum symbiovar viciae

BLR 299
1
1 R. huautlense
R. vignae CCBAU05176

BLR 12
1 1
1 R. giardinii CCBAU45226

R. herbae CCBAU01209

E. meliloti LMG6133

M. loti LMG6125
1
1 R. ciceri

M. huakuii IAM14158

B. japonicum

0.1

Appendix 6. Bayesian tree based on the concatenated partial sequences of

16S-atpD-recA-glnII genes. Posterior probability values shown when ≥ 0.90.
Abbreviations used: BLR: Bangladeshi lentil rhizobia., R: Rhizobium, E: Ensifer,
B: Bradyrhizobium, M: Mesorhizobium

135
 BLR 57

BLR 99

BLR 175

BLR 28

BLR 33

BLR 129
1 symbiovar viciae
BLR 9

BLR 153
0.99
BLR 174

1 R. leguminosarum symbiovar viciae 201ZG (DQ286900)

BLR 228
1
0.99
R. leguminosarum VT608 (FJ715818)

R. leguminosarum symbiovar trifolii (AY904443)

1 1
R. trifolii (X03721)

R. galegae HAMBI1207 (AJ300240)

1
0.95
R. galegae HAMBI174 (X87578)

R. etli CFN42T (U80928)

1
1
1 R. leguminosarum symbiovar phaseoli ICMP2672 (DQ100403)

E. fredii NGR234 (NC000914)

1
M. loti NZP2213 (L06241)

R. giardinii symbiovar giardinii H152T (AJ300238)

1
R. tropici CFN299 (X98514)

B. japonicum USDA110 (BA000040)

1
B. japonicum USDA110 (NC004463)
1
B.elkanii USDA94 (U04609)
0.98
Bradyrhizobium sp. ORS1812 (AJ430723)

Bradyrhizobium sp CH2310 CH2310 (AM117514)

0.1

Appendix 7. Bayesian tree based on nodA gene partial sequences. Posterior

probability values shown when ≥ 0.90. Abbreviations used: BLR: Bangladeshi lentil
rhizobia., R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium

136
 BLR 26
BLR 45
BLR 29
BLR 57
BLR 105
BLR 41
BLR 100
BLR 99
BLR 153
BLR 33
BLR 129
BLR 62
0.90
BLR 175
BLR 235
1
BLR 127
BLR 9
R. multihospitium CCBAU83401T (EF050781)
BLR 195
0.96
R. leguminosarum RVS03 (FJ596018)
0.99 1
R. leguminosarum CCBAU71205 (EU177612)
1
1 R. leguminosarum PEVF01 (FJ596025)
BLR 139
BLR 174
1 symbiovar
BLR 98
viciae
R. leguminosarum PEVF05 (FJ596028)
1 BLR 160
R. leguminosarum VF25 (AY664622)
Rhizobium sp MVP07 (FJ596024)
1
0.93 R. leguminosarum symbiovar viciae (DQ413004)
Rhizobium sp CVIII14 (FJ596021)
T
1 R. leguminosarum ATCC14480 (FJ895269)
R. leguminosarum symbiovar trifolii (AF217271)
Ensifer sp NGR234 U00090
M. gobiense CCBAU83346 (EF549524)
1 R. etli phaseoli VikingI (AF217262)
1
R. giardinii symbiovar phaseoli AF217264
1
1 R. gallicum symbiovar phaseoli (AF217265)
1 R. etli symbiovar phaseoli CFN42T (AF217268)
R. giardinii giardinii T (AF217267)
1 M. ciceri UPMCa7 (DQ407292)
0.98 M. tianshanense RCAN03 (DQ407285)
Rhizobium sp N33 (U53327)
B. elkanii IFO14791T (AB354631)
B. japonicum CPAC7 (DQ485695)
0.1

Appendix 8. Bayesian tree based on nodC gene partial sequences. Posterior

probability values shown when ≥ 0.90. Abbreviations used: BLR: Bangladeshi lentil
rhizobia., R: Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium

137
 BLR 9

BLR 33

BLR 28

BLR 41

100 BLR 45
BLR 57

BLR 99

BLR 235

BLR 127

BLR 175 symbiovar

viciae
BLR 174

BLR 98

BLR 137
100
BLR 228

R. fabae CCBAU23123 (EU430079)

R. leguminosarum bv viciae Lp 3 (AY226889)

72
99 R. leguminosarum (J03671)

100 R. fabae CCBAU 33202 (EU430078)

95 R. leguminosarum bv viciae Vf10 (AY226878)

R. leguminosarum bv trifoli (X03721)

81
100 E. meliloti D2 (M29367)
E. meliloti Rm1021 (AE006469)

R. leguminosarum bv phaseoli D2 (X54215)

R. leguminosarum bv phaseoli D1 (X54214)

98
R. tropici D1 (L01273)
86
73 Rhizobium sp BR816 D2(U26451)

Rhizobium sp (U16154)

B. japonicum nodD1 (M81825)

79
B. japonicum nodD2 (M81825)

0.05

Appendix 9. Bayesian tree based on nodD gene partial sequences. Posterior

probability values shown when ≥ 0.90. Abbreviations used: BLR: Bangladeshi
lentil rhizobia., Rhizobium, E: Ensifer, B: Bradyrhizobium, M: Mesorhizobium

138
 0.95 Rhizobium sp BLR28
RhizobiumspBLR27
RhizobiumspBLR9
Rhizobium sp BLR195 Bangladesh
Rhizobium sp BLR235
RhizobiumspBLR175
Rhizobium sp BLR153
R. etli CFN42
0.97 Rhainanense
0.94Rmiluonense CCBAU41251
R. rhizogenes D14501
Rl. symbiover trifolii WSM2304
Rl. symbiovar trifolii WSM1325
Rlv symbiovar 3841
Rl. Symbiovar trifolii Len4
Rhizobium spH111
R. leguminosarum 2A
Rhizobium sp FB2504
Rl. symbiovar viciae BIHB1157
Rl. Symbiovar viciae BIHB1160
Rl. Symbiovar viciae BIHB1194
R. leguminosarum RPVF18
R. leguminosarum CCBAU65761
R. leguminosarum ICMP14642
R. leguminosarum V6
R. leguminosarum CCNW
R. pisi DSM30132
R. fabae CCBAU33202
R. etli CIAT652
R. etli PEPSM15
SLR1
SLR4
SLR7
TLR2
TLR6
TLR7
GLR1
GLR2
1 GLR3
GLR5 Germany, Turkey , Syria
GLR6
GLR7
GLR8
GLR9
GLR10
GLR11
GLR12
GLR13
GLR14
GLR16
GLR17
GLR19
GLR22
GLR23
GLR25
GLR27
GLR28
GLR29
GLR30
1 GLR31
GLR32
GLR33
GLR34
GLR40
GLR45
GLR46
GLR49
GLR50
Rhizobium sp CCBAU83268 1 M. ciceri
1
M. loti LMG6125
1 M. huakuii IAM14158
1 E. meliloti LMG6133
E. fredii LMG6217T
1 R. giardinii CCBAU45226
1 R. herbae CCBAU01209
0.9 R. radiobacter LMG196
1 R. galegae LMG6214
0.99 R. vignae CCBAU05176
R. huautlense SO2T
R. cellulosilyticum ALA10B2
R. mesosinicum CCBAU25010
1 B. japonicum ATCC10324T
B. yanmingense B071

0.7

Appendix 10. Bayesian tree from partial sequences of 16S rRNA genes. Posterior
probability values shown when ≥ 0.90. Abbreviations: GLR = German lentil
rhizobia, TLR = Turkish lentil rhizobia, SLR = Syrian lentil rhizobia, R = Rhizobium,
Rlv = R. leguminosarum symbiovar viciae.

139
 Rlv USDA2499
Rlv Nvf1
Rhizobium sp FB2504
TLR2
0.97 TLR3
TLR4
TLR5
TLR10 a
TLR11
TLR12
1 SLR6
Rlv CCBAU03322
GLR14
GLR27
GLR50
1 Rlv USDA2500G
Rhizobium sp MVP07
Rhizobium sp CVIII14
1 Rl. PEPSM13
R. etli CIAT652
0.95 1 Rhizobium sp BLR235
Rhizobium sp BLR195 III
1 Rhizobium sp BLR28
Rhizobium sp BLR27 I
Rhizobium sp BLR9 1
1 Rhizobium sp BLR153
1 Rhizobium sp BLR175
R. etli CFN42
1 R. etli PEPSM15
R. pisi DSM30132
R. fabae CCBAU33202 II
Rlv symbiovar trifolii WSM2304
Rlv CCBAU43229
Rlv USDA2489
Rlv VF39
Rlv CCBAU81100
Rlv 3841
Rhizobium sp PEVF03
GLR29
GLR30 e
GLR31
0.99 GLR16
GLR19
GLR25
GLR28
GLR33
GLR32
GLR12
5USDA2502G
SLR1
0.99 SLR8
GLR2
1 GLR11 d
GLR17
GLR34
Nvf3
1TLR7
0.99 GLR71
GLR74 c
0.95 SLR3 Rlv symbiovar trifolii WSM1325
SLR5
SLR2
1 Rlv J1
SLR4
SLR7
0.91 GLR1
GLR3
GLR5
a
GLR13
GLR46
1 TLR6
TLR9
TLR14
1 GLR23
GLR45 b
GLR40 1
CCBAU23125
1 Rlv CCBAU23131
Rlv CCBAU03317
Rlv USDA2370
Rlv USDA2503G
Rlv BIHB1160
Rlv BIHB1194
Rlv CCBAU85004
Rlv CCBAU81107
R. leguminosarum RVS11
Rhizobium sp H111
GLR6
GLR7 f
GLR8
GLR10
GLR22
GLR43
GLR49
GLR54
GLR59
GLR67
GLR69
GLR79
R. yanglingense SH22623

0.2

Appendix 11. Bayesian tree from partial sequences of recA gene. Posterior
probability values shown when ≥ 0.90. Abbreviations: GLR = German lentil
rhizobia, TLR = Turkish lentil rhizobia, SLR = Syrian lentil rhizobia, R = Rhizobium,
Rlv = R. leguminosarum symbiovar viciae, I, II, III, IV = lineages , a – f = sub-
lineages within lineage IV.

140
 1 Rlv CCBAU85004
1 Rlv CCBAU23131
1 Rlv CCBAU23125
Rlv BIHB1157
0.90 Rlv CCBAU03322
Rlv CCBAU83268
TLR3
0.99 GLR5
GLR3
GLR1 a
0.95 GLR27
GLR49
GLR46
Rlv UDA2502
1 SLR8
SLR1 d
Rlv CCBAU81107
GLR11
GLR69
GLR34
Rlv CCBAU83267
0.99 GLR50
GLR13
1. SLR5
SLR7
Rhizobiumsp CVIII14
SLR6
SLR4
SLR2
SLR3
Rlv UDA2499
Rhizobium sp PEVF08 a
0.92 Rhizobium sp FB2504
TLR14
TLR12
TLR11
TLR10
TLR9
TLR7
TLR6
Rlv J1
Rlv Nvf1
Rlv Nvf3
TLR2
GLR32 e
GLR16
0.99 GLR2
GLR17 d
Rlv 3841
GLR33
0.90 GLR12
0.99 GLR31
Rhizobium sp PEVF03
GLR29 e
GLR25
GLR19
1 Rlv CCBAU81100
Rlv USDA2489
VF39AY907376
GLR28
1 1 Rlv symbiovar trifolii WSM1325
Rlv symbiovar CCBAU03317
GLR71
GLR74
c
Rlv BIHB1160J
0.90 Rlv
1 GLR45 UDA2503
GLR23
Rlv UDA2500
b
1
Rhizobium sp MVP07
GLR40
Rlv CCBAU43229
0.95 GLR6
1 1 GLR7
Rlv RVS11
GLR10
GLR43
GLR79
GLR67 f
1 GLR59
GLR54
GLR22
GLR9
1 GLR8
Rlv BIHB1194
Rlv USDA2370
1 1 R. pisi DSM30132
R. fabae CCBAU33202
Rlv symbiovar trifolii WSM2304
R. etli PEPSM15
1 Rhizobium sp BLR235
0.98 1 Rhizobium sp BLR195 III
R. etli CCBAU65708
R. etli CCBAU65830
R etli CIAT652
R. etli CFN42
1 RhizobiumspBLR175
RhizobiumspBLR153 II
0.98 1 Rhizobium sp BLR9
RhizobiumspBLR27
Rhizobium sp BLR28 I
R. yanglingense SH22623
0.1

Appendix 12. Bayesian tree from partial sequences of atpD gene. Posterior
probability values shown when ≥ 0.90. Abbreviations: GLR = German lentil rhizobia,
TLR = Turkish lentil rhizobia, SLR = Syrian lentil rhizobia, R = Rhizobium, Rlv = R.
leguminosarum symbiovar viciae, I, II, III, IV = lineages , a – f = sub-lineages within
lineage IV.

141
 0.94 SLR2
SLR3
Rlv Nvf1
SLR7
TLR12
TLR7
TLR6
Rlv Nvf3
TLR2
0.96 SLR6
TLR11
Rlv J1
GLR45
SLR5
SLR4 a
TLR9
TLR3
Rlv USDA2498
Rlv USDA2499
GLR7
GLR27
GLR1
GLR50
GLR49
GLR46
GLR13
GLR5
GLR3
Rhizobium sp BLR28
1 Rhizobium sp BLR9 I
Rhizobium sp BLR27
1 Rhizobium sp BLR153
Rhizobium sp B175
II
1 Rhizobium sp BLR195 III
Rhizobium sp BLR235
0.93 1 R. etli symbiovar phaseoi IE954
R. Eti symbiovar phaseoli KIM5
1 R. eti SCAU46
R. eti symbiovar phaseoli
Rlv symbiovar trifolii WSM2304
R. etli CFN42
R. etli CIAT652
1 G33
0.96 GLR40
0.99 Rlv USDA2500 b
GLR23
GLR31
0.93 SLR1
GLR11
1 SLR8 d
GLR2
GLR17
GLR34
0.92GLR28
GLR32
GLR67
GLR69
Rlv 3841
GLR71
GLR25
GLR19
TLR10
e
TLR5
Rlv CCBAU81100
Rlv VF39
GLR16
GLR30
1 Rlv CCBAU81107
Rlv USDA2503
GLR29
0.90 Rlv USDA2370
GLR79
GLR74
0.99 GLR59
0.99 GLR54
GLR43
1 GLR22 f
GLR9
GLR8
Rlv USDA2671
GLR10
GLR6
1 Rlv CCBAU23125
Rlv CCBAU23131
0.98 Rlv CCBAU85004
Rlv CCBAU33204
Rlv CCBAU43240
1 T8
T14
Rlv symbiovar trifolii WSM1325
Rlv CCBAU03322
Rlv CCBAU03317
Rlv USDA2502
Rlv CCBAU43229
R. pisi DSM30132
R. fabae CCBAU23127
R. yangingense SH22623
0.1

Appendix 13. Bayesian tree from partial sequences of glnII gene. Posterior
probability values shown when ≥ 0.90. Abbreviations: GLR = German lentil rhizobia,
TLR = Turkish lentil rhizobia, SLR = Syrian lentil rhizobia, R = Rhizobium, Rlv = R.
leguminosarum symbiovar viciae, I, II, III, IV = lineages , a – f = sub-lineages within
lineage IV.

142
 1 SLR2
SLR3
SLR5
SLR7
1 SLR4
Rlv J1
1 Rlv Nvf3
TLR7
1 TLR6
LR9
Rlv Nvf1
TLR12
Rlv USDA2499 a
TLR11
0.96 TLR2
SLR6
1 TLR3
GLR27
GLR50
GLR1
1 GLR5
GLR3
GLR13
GLR49
GLR46
1 GLR33
GLR40 b
1 Rlv USDA2500
GLR23
Rlv USDA2489
0.99 GLR45
GLR7
GLR31
1 GLR29
Rlv VF39
Rlv 3841
1 Rlv CCBAU81100
GLR25 e
GLR19
GLR28
GLR16
GLR32
1 Rlv CCBAU03322
TLR10
1 GLR6
GLR10
GLR79
GLR59
GLR54 f
GLR43
1 GLR22
GLR8
Rlv USDA2370
GLR67
Rlv WSM1325
1 GLR74 c
GLR71
Rlv CCBAU03317
1 GLR2
GLR17
GLR34 d
1 SLR1
1 SLR8
GLR11
1 Rlv USDA2502
1 Rlv CCBAU23125
1 Rlv CCBAU23131
Rlv CCBAU85004
1 Rlv USDA2503
Rlv CCBAU81107
TLR14
GLR69
Rlv CCBAU43229
1 R. pisi DSM30132
R. fabae CCBAU33202
R. trifolii WSM2304
0.99 1 Rhizobium sp BLR235 III
Rhizobium sp BLR195
R. etli CIAT652
Rhizobium sp BLR28
0.92 1 Rhizobium sp BLR9 I
Rhizobium sp BLR27
1 1 Rhizobium sp BLR153 II
Rhizobium sp BLR175
R. etli CFN42
R. yanglingense SH22623
0.1

Appendix 14. Bayesian tree from concatenated partial sequences of recA-atpD-glnII

genes. Posterior probability values shown when ≥ 0.90. Abbreviations: GLR = German
lentil rhizobia, TLR = Turkish lentil rhizobia, SLR = Syrian lentil rhizobia, R =
Rhizobium, Rlv = R. leguminosarum symbiovar viciae, I, II, III, IV = lineages , a – f =
sub-lineages within lineage IV.

143
 1 Rlv CCBAU71205
Rlv PEVF01
Rlv PEVF08
1 Rlv LEN4
GLR13
TLR2
TLR7
TLR12
Rhizobium sp BLR195
Rlv 3841
R. leguminosarum RVS03
R. leguminosarum PEVF10 A
0.99 GLR7
GLR11
GLR25
GLR33
0.98 GLR34
GLR49
GLR50
SLR8
SLR2
0.99 Rlv CCBAU71124
1
Rlv BIHB1160
0.99 Rlv BIHB1157
Rhizobium sp BLR98
0.98
Rhizobium sp BLR139 II
0.99 Rhizobium sp BLR174
GLR1
GLR5
1 GLR14
GLR17 B
GLR27
0.98 GLR46
Rlv PEVF05
Rlv BIHB1164
0.98 GLR8
0.96
GLR16 D
GLR40
PEVF03
GLR22
Rhizobium sp BLR9
Rhizobium sp BLR153
0.98 Rhizobium sp BLR26
Rhizobium sp BLR62 I
1 Rhizobium sp BLR127
Rhizobium sp BLR175
Rhizobium sp BLR235
0.91 Rlv CCBAU83401
0.99 SLR3
1 SLR5 E
SLR7
SLR4
TLR5
TLR8
0.95 0.98 TLR9
0.97 TLR10 C
TLR11
0.96 TLR14
1 TLR3
1 GLR10
1 Rlv viciae
0.99 0.98
Rlv CVIII14
GLR2
1 Rlv RMVP07
GLR23
GLR45 D
Rlv VF253

0.2

Appendix 15. Bayesian tree from partial nodC gene sequences. Posterior
probability values shown when ≥ 0.90. Abbreviation: GLR = German lentil
rhizobia, TLR = Turkish lentil rhizobia, SLR = Syrian lentil rhizobia, BLR =
Bangladeshi lentil rhizobia, Rlv = R. leguminosarum symbiovar viciae, Rl = R.
leguminosarum, A – E = nodulation gene group from German, Turkish and
Syrian isolates, I – II = nodulation gene group from Bangladeshi isolates.

144
 GLR7
GLR33
GLR50
SLR8
BLR195
Rlv Nvf3 A
Rlv 3841
0.98
GLR11
Rlv Vf10
Rlv USDA2499
Rlv USDA2502
0.99 TLR2
R. fabae CCBAU33202
Rlv CCBAU33202
1 Rlv Nvf2
1 Rlv Nvf4
Rlv CCBAU23125 C
0.99 TLR7
TLR12
1
1 TLR10
TLR11
TLR9
1 GLR17
Rlv PC29
Rhizobium sp BLR235
Rhizobium sp BLR175
Rhizobium sp BLR127
Rhizobium sp BLR57
Rhizobium sp BLR45 I
Rhizobium sp BLR41
1 Rhizobium sp BLR33
Rhizobium sp BLR28
1 Rhizobium sp BLR9
Rlv CCBAU83268
Rlv CCBAU11080
1 SLR3
0.99
SLR4
1 SLR6
E
0.98 SLR7
Rlv J1
Rlv Nvf1
Rhizobium sp BLR174
II
GLR2
GLR23
GLR45
RlvVc2 D
1 Rlv Lp3
0.99 Rlv Ln7
1 Rlv PINP3C
Rlv IIFa10
Rlv IIAUa3
0.97
Rlv CCBAU03058
0.99 Rlv CCBAU65264
SLR1
1 R. fabae CCBAU23123
GLR1
GLR27 B
GLR46

0.3

Appendix 16. Bayesian tree from partial nodD gene sequences. Posterior
probability values shown when ≥ 0.90. Abbreviation: GLR = German lentil
rhizobia, TLR = Turkish lentil rhizobia, SLR = Syrian lentil rhizobia, BLR =
Bangladeshi lentil rhizobia, Rlv = R. leguminosarum symbiovar viciae, Rl = R.
leguminosarum, A – E = nodulation gene group from German, Turkish and
Syrian isolates, I – II = nodulation gene group from Bangladeshi isolates.

145