Article

Cite This: Chem. Res. Toxicol. 2019, 32, 986−994 pubs.acs.org/crt

Effects of Silver Nanoparticle Exposure to the Testicular Antioxidant

System during the Prepubertal Rat Stage
Ingra Monique Duarte Lopes,† Isabela Medeiros de Oliveira,† Paula Bargi-Souza,‡,§
Mônica Degraf Cavallin,† Christiane Schineider Machado Kolc,§ Najeh Maissar Khalil,†
Sueli Peŕ cio Quinaí a,∥ Marco Aurelio Romano,† and Renata Marino Romano*,†
†
Laboratory of Reproductive Toxicology and Pharmaceutical Nanotechnology Laboratory, Department of Pharmacy and
∥
Laboratory of Trace and Instrumentation Analysis Group, Department of Chemistry, State University of Centro-Oeste
(UNICENTRO), Rua Simeão Camargo Varela de Sa, 03, 85040-080 Parana, Brazil
‡
See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Department of Physiology and Biophysics, Institute of Biomedical Sciences, University of São Paulo (USP), Av. Prof. Lineu Prestes,
1524, 05508-000 São Paulo, Brazil
Downloaded via UNIV FED DE SANTA MARIA on August 9, 2021 at 17:27:07 (UTC).

§
Department of Physiology and Biophysics, Institute of Biological Sciences, Federal University of Minas Gerais, Avenida Presidente
Antônio Carlos, 6627, 31270-901 Minas Gerais, Brazil

ABSTRACT: Humans and environments are constantly exposed to a wide range of commercial products containing silver
nanoparticles (AgNPs) in their composition. The hypothalamic-pituitary-testicular (HP-testicular) axis is sensitive to low doses
of AgNPs with repercussions in sperm functionality. The oxidative stress may be related to the pathogenesis of sperm alterations
because Ag+ ions are released from AgNPs in the corporal fluids. This study aimed to investigate the effects of AgNP exposure
in the antioxidant defense system. For this, the transcript expression and the activity of catalase (CAT), superoxide dismutase
(SOD), glutathione peroxidase (GPX), and glutathione reductase (GSR) enzymes were evaluated in the testis of rats exposed
during the prepubertal period to increasing doses of AgNPs (1.875, 3.75, 7.5, or 15 μg of AgNPs/kg). The higher dose of
AgNPs (15 μg/kg) investigated promoted increases in the activity of CAT, GPX, and GSR enzymes and in the expression of
Gpx4 var1 transcript. The exposure to 7.5 μg/kg of AgNP increased the Gpx4 var1 mRNA expression. In the group that
received 3.75 μg of AgNP/kg, the expression of Sod1, Gpx4 var2, and Gsr transcripts was decreased while the Gpx4 var1 mRNA
expression was augmented. The lower dose of AgNPs tested (1.875 μg/kg) increased the expression of Cat and Gpx4 var1
transcripts. Thus, AgNP alters the expression and activity of the antioxidant enzymes in a nonmonotonic dose−response curve
and directly or indirectly modulates the events related to spermatogenesis process.

■ INTRODUCTION
Among the nanomaterials, silver is commonly used in
food packaging to preserve it from fungal contamination in the
food industry.10
Thus, humans and the environment are constantly exposed
nanoenabled products in the commercial market as water
to a wide range of commercial products containing residues of
filters, paints, toys, cosmetics, deodorants, toothbrushes,
AgNPs. AgNP release was observed from the use of
clothes, plastics, detergents, disinfectants and biosensors.1,2 commercial AgNP-impregnated toothbrushes11 as well as
The silver nanoparticles (AgNPs) present a variable size (1 to from infant products (plush toys, baby blankets, and sippy
100 nm) and unique physical and chemical proprieties3 (shape, cups).12 Despite the potential risk being considered minimal
catalytic and antimicrobial activity,4 and high electrical and for infants,13 the relevance of human exposure to low doses of
thermal conductivity5) that are useful in several fields of AgNP is a controversial issue because it may be released from
science and technology.6,7 AgNPs are applied as coatings of several products.14−19 Therefore, it is relevant to study possible
surgical instruments, prostheses, catheters, and bandages to toxic effects of low doses of AgNPs after oral exposure.
prevent bacterial infection, 8 incorporated into clothes
manufacturing as antiodor, antimicrobial, and antihumidity Received: September 30, 2018
agents in the textile area,9 and used during the assembly of Published: April 1, 2019

© 2019 American Chemical Society 986 DOI: 10.1021/acs.chemrestox.8b00281

Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology Article

The lrepubertal period is highly sensitive to the action of an NADPH-dependent way, maintaining the balance in the
chemical substances, which is why this period is chosen to GSH/GSSG ratio.31,33,34
evaluate the action of endocrine-disrupting chemicals The ROS generation induced by AgNP may be an important
(EDC).20 Puberty is initiated by a differential modulation of mechanism of toxicity.35 Thus, the sperm alterations observed
GnRN neuron activity: before puberty, their activity is in prepubertal rats exposed to low doses of AgNPs could be
predominantly inhibitory, while after puberty, it is mainly related to an imbalance between the generation and removal of
excitatory.21 Prior to puberty, a pulsatile release of gonado- reactive oxygen species (ROS) in the testicular environment.30
tropin-releasing hormone (GnRH) is increased and stimula- In this sense, considering the possibility of oral ingestion of
tory events lead to the release of lutropin (LH) and follitropin AgNPs released from commercial products,14−19 the bio-
(FSH) from the pituitary.21,22 The pulse frequency of GnRH accumulation of AgNPs in the testis,36−38 and the higher
controls the differential expression of LH and FSH subunit susceptibility in the prepubertal period to the action of
genes by the gonadotrophs.23,24 In the testis, LH stimulates the EDCs,29 the present study aims to evaluate the consequences
synthesis of testosterone by binding to the luteinizing of AgNP exposure to the testicular antioxidant defense system
hormone/choriogonadotropin receptor (LHCGR) in the by the evaluation of CAT, SOD, GPX, and GSR mRNA
plasma membrane of Leydig cells.25 Spermatogenesis events expression and their enzymatic activity in animals exposed to
low doses of AgNPs during the prepubertal period.

■
take place in the Sertoli cells and are mainly influenced by the
action of FSH, which binds to the follicle-stimulating hormone
receptor (FSHR) located at the plasma membrane of Sertoli EXPERIMENTAL PROCEDURES
cells to perform its action.25 Besides Leydig and Sertoli cells, Experimental Design. All procedures were performed in
the testis presents a large number of germ cells, and during accordance with the Conselho Nacional de Controle de Exper-
spermatogenesis the spermatogonial stem cells are differ- imentação Animal (CONCEA) and were approved by the
Universidade Estadual do Centro-Oeste Ethical Committee for
entiated to spermatozoa.26 Animal Research (protocol 013/2015). The experimental design
Our previous studies conducted on prepubertal male rats was based on the prepubertal protocol from the Endocrine Disrupting
showed that the hypothalamic-pituitary-testicular (HP-testicu- Screening and Testing Advisory Committee (EDSTAC) and includes
lar) axis is highly sensitive to AgNPs.27 The reduction of sperm the evaluation of endocrine-disrupting chemical (EDC) effects in
production and integrity, the impairment of plasma and prepubertal and puberty.20 Forty newly weaned male Wistar rats
acrosomal membranes, the decrease in mitochondrial activity, (Rattus norvegicus var. albinus) were obtained from 20 pregnant
and alterations on reproductive behavioral28 as well as the female rats that had been monitored from the 17th day of pregnancy
to determine the exact day of birth. On postnatal day 4 (PND4), the
deregulation of the HP-testicular axis were observed in rats
10 litters were culled to 8 pups (4 males/4 females) per female and
exposed to different doses of AgNPs during the prepubertal kept at this size until weaning (PND21). On PND23, the male
period.29 The sperm alterations observed in these studies27−29 offspring were divided into five groups containing eight animals each
may be related to an imbalance between the generation and and received either 0 (control), 1.875, 3.750, 7.500, or 15 μg of
removal of reactive oxygen species (ROS) in the testicular AgNP/kg of body weight (BW) from PND23 to PND60 every other
environment.30 day in a volume of 0.25 mL/100 g of BW by gavage in watery
The FSH modulates gene expression, activates several suspension. (The control group received only water.) The doses used
signaling pathways, and induces the secretion of many peptides in this study were the same as Cavallin et al.29 in which the lowest
observable adverse effect level (LOAEL) for sperm parameters was
in Sertoli cells involved in the development of the proper 1.875 μg/kg.
environment for the spermatozoa.31 For example, the cAMP During all experiments, the animals were kept in groups of four,
response element binding protein (CREB) is an important housed in polypropylene cages (43 × 43 × 20 cm3) with a 5 cm layer
transducer of FSH signals, and this family of transcription of wood shavings, fed commercial feed (Nuvilab CR- 1, Quimtia, PR,
factors is recognized to induce gene expression in response to a Brazil), and allowed water ad libitum, under a 12:12 h/h dark/light
number of signaling pathways induced by ROS over- cycle in a temperature-controlled room (23 ± 1 °C).
expression.31 Thus, the ROS formed during oxidative Characterization of AgNPs. A solution containing silver
nanoparticles in a dispersion (60 nm particle size, 0.02 mg/mL in
phosphorylation in the Sertoli cells can act by stimulating
aqueous buffer) was purchased from Sigma-Aldrich (catalog number
CREB, but its excess may also impair the functioning of the cell 730815, Sigma-Aldrich Co., Seelze, Germany), and the dilution in
and consequently and the efficiency of spermatogenesis.31 The water was performed just before its use. The nanoparticle stability in a
plasma membrane of spermatozoa has an elevated content of watery suspension was analyzed by the mean particle size and
polyunsaturated fatty acids (PUFA), making the spermatozoa polydispersity index (PDI) by dynamic light scattering (DSL) (BIC
highly susceptible to oxidative damage by lipid peroxidation 90 plus, Brookhaven Instruments Corp., USA) at a scattering angle of
(LPO).32 Besides, the high rates of cell division during the 90° and a temperature of 25 °C. The estimated particle diameter was
spermatogenesis process contribute to the overexpression of 79.5 ± 11 nm, and the PDI was 0.575 ± 118.29
Tissue Collection. The animals were subjected to deep anesthesia
reactive oxygen species (ROS),30 which may impair the with ketamine and xylazine and euthanized by decapitation.
functioning of the Sertoli cells and consequently the efficiency Afterward, the testis was immediately excised, frozen in liquid
of spermatogenesis.31 In contrast, the testes present a complex nitrogen, pulverized in liquid nitrogen, and maintained at −80 °C
antioxidant system that comprises vitamins, minerals, and until further analysis of RT-qPCR, enzyme activity, and electro-
nonenzymatic and enzymatic defenses. The catalase (CAT), thermal atomic absorption spectrometry.
superoxide dismutase (SOD), glutathione peroxidase (GPX), Reverse Transcription Followed by Real-Time Quantitative
PCR (RT-qPCR). Fifty milligrams of the pulverized testis was used for
and glutathione reductase (GSR) enzymes are associated with
total RNA extraction using Trizol reagent (Life Technologies,
the antioxidant process. SOD synthesizes H2O2 from O2− and Carlsbad, CA, USA). The total RNA concentration was measured
H+, and H2O2 is metabolized to H2O by CAT or in a greater with a nanospectrophotometer (Kasvi, Brazil), and 2.5 μg was
proportion by GPX. The GSR enzyme converts the reduced transcript reversed by the GoScript reverse transcription system
form of glutathione (GSH) in oxidized glutathione (GSSG) in (Promega, Madison, WI, USA) using oligo(dTs) according to the

987 DOI: 10.1021/acs.chemrestox.8b00281

Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology Article

Table 1. Primers Used for RT-qPCR Analyses

gene GenBank primer sequences (5′-3′)a
Sod1 NM_017050.1 F:GGGGACAATACACAAGGCTGT
(superoxide dismutase 1) R:CATGCCTCTCTTCATCCGCT
Cat NM_012520.2 F: TTCTTGTTCAGCGACCGAGG
(catalase) R:GATGCCCTGGTCAGTCTTGTA
Gpx4Var1 NM_017165.2 F:GCCGTCTGAGCCGCTTATT
(glutathione peroxidase 4, transcript variant 1) R: ACGCAACCCCTGTACTTATCCA
Gpx4Var2 NM_001039849.2 F: ACCTTCCCCAGACCAGCAAC
(glutathione peroxidase 4, transcript variant 2) R: ACGCAACCCCTGTACTTATCCA
Gsr NM_053906.2 F: ACTTCTCACCCCAGTTGCG
(glutathione-disulfide reductase) R: CCACGGTAGGGATGTTGTCA
Rpl19 NM_031103.1 F: AATGAAACCAACGAAATCG
(ribosomal protein L19) R: TCAGGCCATCTTTGATCAGCT
a
F, forward; R, reverse.

manufacturer’s instructions. The catalase (Cat), superoxide dismutase RED, Randox Laboratories Limited, Crumlin, Northern Ireland).
1 (Sod1), glutathione-disulfide reductase (Gsr), glutathione perox- GSR catalyzes the GSSG reduction and the NADPH oxidation to
idase 4 variants 1 (Gpx4var1), and 2 (Gpx4var2) mRNA contents NADP+.43 The absorbance was measured at 340 nm. For each sample,
were evaluated in testis, and the results obtained for each target gene the absorbance value was divided by the protein concentration. The
per sample were normalized with the mRNA expression of ribosomal results were expressed as units of GSR per liter per microgram of
protein L19 (Rpl19), a housekeeping gene. The primer sequences and protein (U of GSR × L−1 × μg of Ptn−1).
the GenBank access number of target genes are shown in Table 1. The catalase activity was measured by the H2O2 decay at 30 °C via
The product of reverse transcription (RT) was diluted according to spectrophotometry at 240 nm, according to the method described.44
the efficiency curve for each gene investigated. Real-time PCR (RT- Briefly, 10 μL of protein lysate was added to 500 μL of H2O2 (20 mM,
qPCR) was performed in a 10 μL mix reaction volume containing the pH 7.0) at 30 °C, and the absorbance was measured at 60 s in quartz
product of RT, 2 μM primers [except for Gpx4var1 (1.6 μM) and Gsr cuvetttes using a V-630 Bio UV−vis spectrophotometer (JASCO,
(1 μM)], 0.5 μM ROX dye, and 5 μL of Platinum SYBR Green qPCR USA). The results were expressed by the change in absorbance (initial
SuperMix-UDG (Life Technologies, Carlsbad, CA, USA). Amplifica- minus final) per second per microgram of protein (ΔAbs × s−1× μg of
tion was performed with the resources of an Applied Biosystems Ptn−1).
StepOnePlus Real-Time PCR System (Applied Biosystems, Singa- Electrothermal Atomic Absorption Spectrometry. The rat
pore) and consisted of the following cycle conditions: 50 °C (2 min), testicle samples were prepared from acid digestion using concentrated
95 °C (2 min), and 40 cycles of 95 °C (15 s) and 60 °C (30 s). At the HNO3 as previously described.45 The determination of AgNP was
end of the reaction, a melting curve was generated and analyzed to carried out with electrothermal atomic absorption equipment (model
confirm the specificity of the amplification. The average cycle AA 240Z) from Varian (Agilent) with Zeeman background correction
threshold (Ct) was automatically determined using StepOne and a graphite tube atomizer (GT 120) linked to an autosampler
Software, v2.3 (Applied Biosystems), and quantification was (PSD 120). The analysis was performed using one hollow cathode
performed by the 2−ΔΔCt method, as described previously.39 lamp operating at 328.1 nm with a current of 4 mA and a slit width of
Antioxidant Enzyme Activity in the Testis. Twenty-five 0.5 nm. Argon as an inert gas and pyrolytic graphite-coated graphite
milligrams of pulverized testis was homogenized in 250 μL of 0.5 tubes with longitudinal heating were used.
mM Tris-HCl at pH 7.4 and centrifuged at 590g for 10 min at 4 °C. Statistical Analysis. The variables in question were first
The supernatant was collected, and the total protein content was submitted to Kolmogorov−Smirnov tests for normality and the
estimated by the Bradford method.40 The supernatant was then used Bartlett test for homoscedasticity. The parameters were analyzed by
in the enzymatic assays to determine the activities of superoxide an ANOVA test followed by the post hoc Tukey HSD (honest
dismutase (SOD), glutathione peroxidase (GPX), glutathione significance difference) test. The Pearson correlation coefficient (r)
reductase (GSR), and catalase (CAT). These assays were performed was used to measure the linear correlation between the two variables:
using the SpectraMax 190 Microplate Reader (Molecular Devices, mRNA expression and enzymatic activity. The linear correlation
USA). ranges from −1 to 1 and was classified as strong (|r > 0.7|), moderate
The SOD activity was estimated according to the degree of (|0.5 < r < 0.7|), or weak (|0.3 < r < 0.5|). When |0 < r < 0.3|, there is
formazan inhibition in the presence of xanthine and xanthine oxidase no linear correlation between the variables. All analysis was performed
and detected by spectrophotometry.41 Analyses were performed with Statistica 7.0 (Statsoft Inc., Tulsa, OK, USA). Statistical
following the manufacturing instructions for the RANSOD Kit differences were considered to be significant when the value of P
(Randox Laboratories Limited, Crumlin, Northern Ireland), and the was lower than 0.05. The values were expressed as means and the
standard error of the mean (±SEM).

■
absorbance at 505 nm was measured. The SOD activity data was
obtained for each sample by the absorbance/protein concentration
ratio, and the results were expressed as units of SOD per microgram RESULTS
of protein (U of SOD × μg of Ptn−1). Superoxide Dismutase. The expression of the Sod1
The GPX activity was measured using the RANSEL Kit as transcript was reduced in the animals that received 3.750 μg of
previously described42 (Randox Laboratories Limited, Crumlin, AgNP/kg of BW compared to the control and 1.875 μg of
Northern Ireland). GPX catalyzes the GSH oxidation to GSSG in AgNP/kg of BW groups. The SOD activity was not statically
the presence of cumene hydroperoxide. Reductions in absorbance
were measured at 340 nm. The GPX activity data was obtained for
altered by AgNP exposure. A weak linear correlation between
each sample by the absorbance/protein concentration ratio, and the SOD transcript expression and activity according to the
results were expressed as units of GPX per liter per microgram of Pearson correlation coefficient analysis (r = 0.36; P = 0.025)
protein (U of GPX × L−1 × μg of Ptn−1). was observed (Figure 1A−C).
The GSR activity was measured following the manufacturer’s Glutathione Peroxidase. The Gpx4 var1 mRNA content
instructions for the GLUTATHIONE REDUCTASE Kit (GLUT was increased in all groups treated with AgNP compared to
988 DOI: 10.1021/acs.chemrestox.8b00281
Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology Article

Figure 1. Superoxide dismutase (A) mRNA relative expression, (B) Figure 2. Glutathione peroxidase 4 mRNA relative expression (A)
enzyme activity, and (C) correlation between mRNA and enzyme transcript variant 1, (B) transcript variant e, and (C) enzyme activity
activity in male Wistar rats exposed to 0, 1.875, 3.750, 7.500, or 15 μg in male Wistar rats exposed to 0, 1.875, 3.750, 7.500, or 15 μg of
of AgNPs/kg of BW during the prepubertal period. Data are expressed AgNPs/kg of BW during the prepubertal period. Data are expressed as
as the mean ± SEM. ANOVA was followed by Tukey HSD; n = 8/ mean ± SEM. ANOVA was followed by Tukey HSD; n = 8/group; a
group; a and b differ, P < 0.05. Pearson correlation coefficient (r) = and b differ, P < 0.05. Gpx4var1, Glutathione peroxidase 4 transcript
0.36; P = 0.025. Sod1, Superoxide dismutase 1; SOD, superoxide variant 1; Gpx4var2, glutathione peroxidase 4 transcript variant 2;
dismutase; Ptn, protein. GPX, glutathione peroxidase; Ptn, protein.

control animals, while the expression of the Gpx4 var2

transcript was reduced in the group that received 3.750 μg of group that received 15 μg of AgNP/kg of BW in comparison to
AgNP/kg of BW in comparison to all others groups (Figure the control and 3.750 and 7.500 μg of AgNP/kg of BW (Figure
2A,B). The GPX activity was increased only in the group that 3B). The Pearson correlation coefficient (r) between GSR
received 15 μg of AgNP/kg of BW compared to all other transcript expression and activity was 0.49 (P = 0.002) (Figure
groups (Figure 2C). There was no statistical significance (P > 3C).
0.05) in the Pearson correlation coefficient analysis for the Catalase. The expression of the Cat transcript was
comparisons between Gpx4 var. 1 or Gpx4 var. 2 and GPX increased in the group that received 1.875 μg of AgNP/kg of
activity (data not shown). BW compared to the control and 15 μg of AgNP/kg of BW
Glutathione Reductase. The Gsr mRNA content was groups (Figure 4A). The CAT activity was increased in the
reduced in the group that received 3.750 μg of AgNP/kg of group that received 15 μg of AgNP/kg of BW in comparison to
BW in comparison to the control and 1.875 μg of AgNP/kg of control and 3.750 μg of AgNP/kg of BW groups (Figure 4B).
BW (Figure 3A). The GSR activity was reduced in the group The Pearson correlation coefficient (r) between CAT
that received 3.750 μg of AgNP/kg of BW compared to 1.875 transcript expression and activity was 0.37 (P = 0.02) (Figure
and 15 μg of AgNP/kg of BW groups and increased in the 4C).
989 DOI: 10.1021/acs.chemrestox.8b00281
Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology Article

Figure 3. Glutathione reductase (A) mRNA relative expression, (B)

enzyme activity, and (C) correlation between mRNA and enzyme
activity in male Wistar rats exposed to 0, 1.875, 3.750, 7.500, or 15 μg Figure 4. Catalase (A) mRNA relative expression, (B) enzyme
of AgNPs/kg of BW during the prepubertal period. Data are expressed activity, and (C) correlation between mRNA and enzyme activity in
as the mean ± SEM. ANOVA was followed by Tukey HSD; n = 8/ male Wistar rats exposed to 0, 0, 1.875, 3.750, 7.500, or 15 μg of
group; a, b and g, h differ, P < 0.05. Pearson correlation coefficient (r) AgNPs/kg of BW during the prepubertal period. Data are expressed as
= 0.39; P = 0.002. Gsr, Glutathione reductase; GSR, glutathione the mean ± SEM. ANOVA was followed by Tukey HSD; n = 8/
reductase; Ptn, protein. group; a and b differ, P < 0.05. Pearson correlation coefficient (r) =
0.37; P = 0.02. Cat, Catalase; CAT, catalase; Abs, absorbance; Ptn,
protein.
Quantification of AgNP in the Testis. AgNP was
detected in the testis of rats treated with doses higher than
3.750 μg/kg of BW. The amount of AgNP (ng/g of testis) Table 2. Quantification of AgNP in the Testis
detected is shown in Table 2.

■
dose AgNP (μg/kg BW) detected AgNP (ng/g testis)
0.000 <detection limit
DISCUSSION 1.875 <detection limit
The puberty period is marked by changes in hypothalamic 3.750 2.110 ± 1.30
function. Before puberty, the tonus controlling the GnRH 7.500 3.288 ± 0.80
neuron activity is predominantly inhibitory, and during 15.000 5.450 ± 0.07
puberty, the change to excitatory tonus is associated with the
increase in the pulsatile GnRH release and secretion of
pituitary gonadotrophins, LH and FSH, which in turn trigger The puberty period is sensitive to the action of AgNPs,27−29
their actions in testicular cells and initiate the process of and the induction of oxidative stress is also a factor related to
spermatogenesis.21,22 The spermatogenesis process involves the toxicity of AgNPs.48−50 Indeed, it has been shown that the
the intense production of ROS,31,46 and several fertility levels of AgNPs remain elevated in the testis several weeks
problems are associated with failures in ROS removal.30,32,47 after the end of exposure,36−38 demonstrating a particular
990 DOI: 10.1021/acs.chemrestox.8b00281
Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology Article

susceptibly of gonadal tissue to AgNP actions. Corroborating damage in the midpiece of spermatozoa and the loss of
these findings, a range from 2.11 to 5.45 ng of AgNPs was capacity to produces energy needed for flagellum movement29
detected per gram of testis of animals treated with 3.750− impairing the movement of the sperm through the female
15.000 μg of AgNP/kg of BW. The objective of this study was genital tract.64
to evaluate whether the exposure to low doses of AgNPs It is possible to assume that 15 μg of AgNP/kg directly
during the prepubertal phase alters the expression and activity triggers a toxic effect on sperm mitochondria and the plasma
of the enzymes catalase (CAT), superoxide dismutase (SOD), membrane, as observed in cultured neuronal cells.65 In these
glutathione peroxidase (GPX), and glutathione reductase cells, AgNPs alters the electron transport chain in the
(GSR) in the testes of rats, which could explain the mitochondrial membrane and its permeability and protein
impairment previously observed in the spermatogenesis composition, reducing the mitochondrial function.65 In this
induced by AgNPs. study, treatment with 15 μg of AgNP/kg also increased the
AgNP altered the expression and activity of enzymes related Gpx4 var1 transcript expression. The translation of variant 1 of
to the testicular antioxidant system without following a classic Gpx4 results in the long form of GPX, also known as
dose−response pattern. The catalase transcript showed the phospholipid hydroperoxide glutathione peroxidase (phGPx),
maximum alteration in the group treated with the lower dose which has an affinity for mitochondria.66 Thus, in addition to
of AgNP (1.875 μg/kg), while the GSR activity was reduced in the positive effect on GPX enzyme activity, AgNP also
animals treated with 3.750 μg of AgNP/kg and increased in the increases the transcription of the gene that codifies the
group that received 15 μg of AgNP/kg. In a dose−response glutathione peroxidase enzyme. All of these data together
curve, the effects observed at the point where the signal of the indicate that the physiological mechanisms triggered in the
slopes are inverted (negative to positive and vice versa) are testicular cells are not sufficient to prevent the oxidative
classified as a nonmonotonic dose−response curve and are damage induced by AgNP (at 15 μg/kg).
related to the occupation kinetics and receptor saturation.51 The group treated with 7.500 μg of AgNP/kg presented only
This pattern of response for certain chemical compounds an increase in the Gpx4 var1 expression, without alterations in
observed in the experimental model hinders the establishment the GPX activity, despite the reduced mitochondrial activity of
of important toxicological parameters such as LOAEL (lowest the sperm.29 Previously, we showed that AgNP, in this
observed adverse effect level) and NOAEL (no observed intermediate dose, increases the serum estradiol concentra-
adverse effect level, a higher dose that does not result in a toxic tion.29 The exogenous administration of estradiol stimulates
effect).51−55 the testicular LPO and reduces the SOD and CAT activities,67
The testes are highly dependent on oxygen for the which in turn could alter the generation and removal of ROS.
spermatogenesis process and very susceptible to the ROS
Thus, AgNP (at 7.500 μg/kg) would be exerting an indirect
toxic effects.56 The plasma membrane of spermatozoa has an
effect on the testicular antioxidant system. Interestingly, GPX
elevated content of polyunsaturated fatty acids (PUFA) that
was the only enzyme that did not present a correlation
are involved with the events associated with the fertilization
between the transcript content and enzymatic activity. In fact,
process. However, the high levels of PUFA cause the
Gpx4 var1 encodes the gene for phGPx, and besides its action
spermatozoa to be highly susceptible to oxidative damage by
lipid peroxidation (LPO).32 In human spermatozoa, the as an antioxidant enzyme during spermatogenesis, phGPx was
superoxide radical (O2−.) is the predominant ROS57 and described as a structural protein in the mature spermatozoa,
comes mainly from the mitochondrial electron transport constituting about 50% of the midpiece and being enzymati-
chain.56 O2−. is a potent initiator of the LPO cascade which cally inactive under this condition.68 This functional change is
can lead to membrane rupture and loss of sperm function.58 In synchronized with the relocation of phGPx from the matrix to
this study, all groups showed alterations in the expression and/ the intermembrane space of mitochondria during spermato-
or activity of antioxidant enzymes investigated; however, genesis.69
considering that lower doses of AgNP (3.750 and 1.875 μg/ The groups that received the lowest doses of AgNP did not
kg) do not alter the sperm functionality,29 we assume that the show spermatic functional changes,29 indicating that the fine
generation and removal dynamics of ROS is modulated only by modulation of the antioxidant system was sufficient to
the higher doses of AgNPs. maintain the integrity of the spermatozoa membrane. The
The excess in testicular ROS is one of the main factors in the treatment with 3.750 μg of AgNP/kg reduced the Sod1, Gpx4
induction of germ cell apoptosis.46 The testes present an var2, and Gsr expression and the GSR activity, while the
efficient antioxidant enzyme system and also high concen- expression of Gpx4 var1 was increased. The group that
trations of antioxidants such as reduced glutathione (GSH), received 1.875 μg of AgNP/kg showed an increase in the
ascorbic acid, and vitamin E,31,57,59 which protect the germ mRNA content of Cat and Gpx4 var1. Gpx4 var1, as previously
cells from DNA damage.60,61 The first enzyme involved in the mentioned, has two important roles: (a) acting as an
protection against oxidative damage is SOD, which catalyzes antioxidant enzyme and (b) being a structural protein of the
the reaction between O2−. and H+ to produce O2 and H2O2.62 mitochondria in the midpiece of sperm. Thus, the increase in
SOD activity is stimulated by the increase in the oxygen Gpx4 var1 mRNA expression may influence the antioxidant
pressure62 and inhibited by elevated H2O2 concentra- defense system as well as the mitochondrial composition in the
tion.63H2O2 is then metabolized by CAT or, to a greater midpiece of the sperm. Gpx4 var2 encodes specific sperm
extent, by GPX. GSR is a NADPH-dependent enzyme nuclei glutathione peroxidase (snGPx), which is related to the
responsible for reducing GSH to oxidized glutathione chromatin condensation in the final stages of spermatogenesis
(GSSG) while maintaining the GSH/GSSG ratio.31,33,34 by cross-linked protamine thiols.70 In this sense, the reduction
Although the activity of CAT, GPX, and GSR enzymes was of Gpx4 var2 transcription could impair the DNA integrity in
increased in the group treated with 15 μg of AgNP/kg, these the chromatin, which in turn could increase the vulnerability of
alterations were not sufficient to prevent mitochondrial the offspring to xenobiotic agents, thus affecting its health.71
991 DOI: 10.1021/acs.chemrestox.8b00281
Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology Article

The methods applied in these studies were not able to evaluate (8) Shenava, A., Sharma, S., Shetty, V., and Shenoy, S. (2015) Silver
whether the AgNPs induced changes in the chromatin. nanoparticles: A boon in clinical medicine. Journal of Oral Research
In this study, we have used low doses of AgNP in an attempt and Review 7, 35−38.
to compare to the unintentional ingestion of AgNPs residues (9) Velmurugan, P., Lee, S. M., Cho, M., Park, J. H., Seo, S. K.,
Myung, H., Bang, K. S., and Oh, B. T. (2014) Antibacterial activity of
released from commercial products. Recent studies have used
silver nanoparticle-coated fabric and leather against odor and skin
very high doses of AgNPs to assess the possible effects on the infection causing bacteria. Appl. Microbiol. Biotechnol. 98, 8179−8189.
antioxidant system, and the results were variable. A single (10) Kumari, A., and Yadav, S. K. (2014) Nanotechnology in agri-
intraperitoneal dose of 5000 μg of AgNP/kg (2666-fold > food sector. Crit. Rev. Food Sci. Nutr. 54, 975−984.
1875) administered to rats reduced the SOD, CAT, and GPX (11) Mackevica, A., Olsson, M. E., and Hansen, S. F. (2017) The
activities in testis72 and liver,73 while higher doses (100 000 release of silver nanoparticles from commercial toothbrushes. J.
and 200 000 μg of AgNP/kg/90 days, 53 333- and 106 666- Hazard. Mater. 322 (Part A), 270−275.
fold > 1875, respectively) increased the SOD and CAT (12) Quadros, M. E., Pierson, R., Tulve, N. S., Willis, R., Rogers, K.,
activities in the liver of rats.74 However, the SOD, CAT, and Thomas, T. A., and Marr, L. C. (2013) Release of Silver from
GPX activities were not altered in the serum of male Wistar Nanotechnology-Based Consumer Products for Children. Environ. Sci.
rats exposed to 5000 or 10 000 μg of AgNP/kg/28 days.75 Technol. 47, 8894−8901.

■
(13) Pang, C., Hristozov, D., Zabeo, A., Pizzol, L., Tsang, M. P.,
Sayre, P., and Marcomini, A. (2017) Probabilistic approach for
CONCLUSIONS assessing infants’ health risks due to ingestion of nanoscale silver
Exposure to low doses of AgNPs during the prepubertal phase released from consumer products. Environ. Int. 99, 199−207.
alters the expression and the activity of catalase, superoxide (14) Benn, T., Cavanagh, B., Hristovski, K., Posner, J. D., and
dismutase, glutathione peroxidase, and glutathione reductase Westerhoff, P. (2010) The release of nanosilver from consumer
enzymes in the testes of rats, directly or indirectly affecting the products used in the home. J. Environ. Qual. 39, 1875−1882.
(15) Benn, T. M., and Westerhoff, P. (2008) Nanoparticle silver
events related to the spermatogenesis process. The response to
released into water from commercially available sock fabrics. Environ.
different AgNP doses did not fit a classic dose−response Sci. Technol. 42, 4133−4139.
pattern, characterizing a nonmonotonic dose−response curve.

■
(16) Echegoyen, Y., and Nerin, C. (2013) Nanoparticle release from
nano-silver antimicrobial food containers. Food Chem. Toxicol. 62,
AUTHOR INFORMATION 16−22.
Corresponding Author (17) Farkas, J., Peter, H., Christian, P., Gallego Urrea, J. A.,
Hassellov, M., Tuoriniemi, J., Gustafsson, S., Olsson, E., Hylland, K.,
*Phone: 55 42 36298184. E-mail: renataromano20@gmail.
and Thomas, K. V. (2011) Characterization of the effluent from a
com. nanosilver producing washing machine. Environ. Int. 37, 1057−1062.
ORCID (18) Rigo, C., Roman, M., Munivrana, I., Vindigni, V., Azzena, B.,
Paula Bargi-Souza: 0000-0001-7746-0636 Barbante, C., and Cairns, W. R. (2012) Characterization and
evaluation of silver release from four different dressings used in
Funding burns care. Burns: journal of the International Society for Burn Injuries
This study was supported by Capes (Coordenação de 38, 1131−1142.
Aperfeiç o amento de Pessoal de Nivel Superior, (19) Tulve, N. S., Stefaniak, A. B., Vance, M. E., Rogers, K., Mwilu,
23038.009865/2013-32). I.M.D.L. was the recipient of a S., LeBouf, R. F., Schwegler-Berry, D., Willis, R., Thomas, T. A., and
scholarship from Fundaçaõ Araucária. Marr, L. C. (2015) Characterization of silver nanoparticles in selected
Notes consumer products and its relevance for predicting children’s
potential exposures. Int. J. Hyg. Environ. Health 218, 345−357.
The authors declare no competing financial interest.

■
(20) Stoker, T. E., Parks, L. G., Gray, L. E., and Cooper, R. L. (2000)
Endocrine-disrupting chemicals: prepubertal exposures and effects on
REFERENCES sexual maturation and thyroid function in the male rat. A focus on the
(1) Vance, M. E., Kuiken, T., Vejerano, E. P., McGinnis, S. P., EDSTAC recommendations. Endocrine Disrupter Screening and
Hochella, M. F., Jr., Rejeski, D., and Hull, M. S. (2015) Testing Advisory Committee. Crit. Rev. Toxicol. 30, 197−252.
Nanotechnology in the real world: Redeveloping the nanomaterial (21) Abreu, A. P., and Kaiser, U. B. (2016) Pubertal development
consumer products inventory. Beilstein J. Nanotechnol. 6, 1769−1780. and regulation. Lancet Diabetes Endocrinol. 4, 254−264.
(2) WWICS, W. W. I. C. f. S. Project on Emerging Nanotechnologies: (22) Prevot, V. (2015) Chapter 30 - Puberty in Mice and Rats. In
Nanotechnology, 2018, https://www.wilsoncenter.org/publication- Knobil and Neill’s Physiology of Reproduction (Plant, T. M., and
series/project-emerging-nanotechnologies. Zeleznik, A. J., Eds.) , 4th ed., pp 1395−1439, Academic Press, San
(3) Wei, L., Lu, J., Xu, H., Patel, A., Chen, Z.-S., and Chen, G. Diego.
(2015) Silver nanoparticles: synthesis, properties, and therapeutic (23) Kaiser, U. B., Jakubowiak, A., Steinberger, A., and Chin, W. W.
applications. Drug Discovery Today 20, 595−601. (1997) Differential Effects of Gonadotropin-Releasing Hormone
(4) Xu, R., Wang, D., Zhang, J., and Li, Y. (2006) Shape-dependent (GnRH) Pulse Frequency on Gonadotropin Subunit and GnRH
catalytic activity of silver nanoparticles for the oxidation of styrene. Receptor Messenger Ribonucleic Acid Levels in Vitro 1. Endocrinology
Chem. - Asian J. 1, 888−893. 138, 1224−1231.
(5) Alshehri, A. H., Jakubowska, M., Mlozniak, A., Horaczek, M., (24) Nagirnaja, L., Rull, K., Uusküla, L., Hallast, P., Grigorova, M.,
Rudka, D., Free, C., and Carey, J. D. (2012) Enhanced electrical and Laan, M. (2010) Genomics and genetics of gonadotropin beta-
conductivity of silver nanoparticles for high frequency electronic subunit genes: unique FSHB and duplicated LHB/CGB loci. Mol.
applications. ACS Appl. Mater. Interfaces 4, 7007−7010. Cell. Endocrinol. 329, 4−16.
(6) Tran, Q. H., et al. (2013) Silver nanoparticles: synthesis, (25) O’Donnell, L., Meachem, S. J., Stanton, P. G., and McLachlan,
properties, toxicology, applications and perspectives. Adv. Nat. Sci.: R. I. (2006) Chapter 21 - Endocrine Regulation of Spermatogenesis.
Nanosci. Nanotechnol. 4, 033001. In Knobil and Neill’s Physiology of Reproduction (Neill, J. D., Plant, T.
(7) Keat, C. L., Aziz, A., Eid, A. M., and Elmarzugi, N. A. (2015) M., Pfaff, D. W., Challis, J. R. G., de Kretser, D. M., Richards, J. S., and
Biosynthesis of nanoparticles and silver nanoparticles. Bioresources and Wassarman, P. M., Eds.) 3rd ed., pp 1017−1069, Academic Press, St.
Bioprocessing 2, 47. Louis.

992 DOI: 10.1021/acs.chemrestox.8b00281

Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology Article

(26) Valli, H., Phillips, B. T., Orwig, K. E., Gassei, K., and Nagano, (44) Aebi, H. (1984) Catalase in vitro. In Methods in Enzymology,
M. C. (2015) Chapter 15 - Spermatogonial Stem Cells and Vol. 13, pp 121−126, Academic Press.
Spermatogenesis, Knobil and Neill’s Physiology of Reproduction 4th (45) Butik, M., Kelte Filho, I., Peres, J. A., and Quinaia, S. P. (2018)
ed., pp 595−635, Academic Press, San Diego. Comparison between Alkaline Solubilization Methods and Acid
(27) Sleiman, H. K., Romano, R. M., Oliveira, C. A., and Romano, Digestion of Animal Tissue for Determination of Metals by Flame
M. A. (2013) Effects of prepubertal exposure to silver nanoparticles Atomic Absorption Spectrometry. Revista Virtual Quim. 10, 1039−
on reproductive parameters in adult male Wistar rats. J. Toxicol. 1055.
Environ. Health, Part A 76, 1023−1032. (46) Xu, Y.-R., Dong, H.-S., and Yang, W.-X. (2016) Regulators in
(28) Mathias, F. T., Romano, R. M., Kizys, M. M., Kasamatsu, T., the apoptotic pathway during spermatogenesis: Killers or guards?
Giannocco, G., Chiamolera, M. I., Dias-da-Silva, M. R., and Romano, Gene 582, 97−111.
M. A. (2015) Daily exposure to silver nanoparticles during (47) Aitken, R. J., Smith, T. B., Jobling, M. S., Baker, M. A., and De
prepubertal development decreases adult sperm and reproductive Iuliis, G. N. (2014) Oxidative stress and male reproductive health.
parameters. Nanotoxicology 9, 64−70. Asian J. Androl. 16, 31−38.
(29) Cavallin, M. D., Wilk, R., Oliveira, I. M., Cardoso, N. C. S., (48) Foldbjerg, R., Jiang, X., Miclaus, T., Chen, C., Autrup, H., and
Khalil, N. M., Oliveira, C. A., Romano, M. A., and Romano, R. M. Beer, C. (2015) Silver nanoparticles − wolves in sheep’s clothing?
(2018) The hypothalamic-pituitary-testicular axis and the testicular Toxicol. Res. 4, 563−575.
function are modulated after silver nanoparticle exposure. Toxicol. Res. (49) Kim, S., Choi, J. E., Choi, J., Chung, K. H., Park, K., Yi, J., and
7, 102−116. Ryu, D. Y. (2009) Oxidative stress-dependent toxicity of silver
(30) Aitken, R. J., Gibb, Z., Baker, M. A., Drevet, J., and nanoparticles in human hepatoma cells. Toxicol. In Vitro 23, 1076−
Gharagozloo, P. (2016) Causes and consequences of oxidative stress 1084.
in spermatozoa. Reprod., Fertil. Dev. 28, 1−10. (50) Zhang, W., Xiao, B., and Fang, T. (2018) Chemical
(31) Guerriero, G., Trocchia, S., Abdel-Gawad, F. K., and Ciarcia, G. transformation of silver nanoparticles in aquatic environments:
(2014) Roles of reactive oxygen species in the spermatogenesis Mechanism, morphology and toxicity. Chemosphere 191, 324−334.
regulation. Front Endocrinol. 5, 56. (51) Vandenberg, L. N. Non-Monotonic Dose Responses in Studies
(32) Aitken, R. J. (2017) Reactive oxygen species as mediators of of Endocrine Disrupting Chemicals: Bisphenol a as a Case Study.
sperm capacitation and pathological damage. Mol. Reprod. Dev. 84, Dose-Response 2014, 12, DOI: 10.2203/dose-response.13-020.Van-
1039−1052. denberg.
(33) Bauche, F., Fouchard, M. H., and Jegou, B. (1994) Antioxidant (52) Diamanti-Kandarakis, E., Bourguignon, J. P., Giudice, L. C.,
system in rat testicular cells. FEBS Lett. 349, 392−396. Hauser, R., Prins, G. S., Soto, A. M., Zoeller, R. T., and Gore, A. C.
(34) Wong, W. Y., Thomas, C. M., Merkus, J. M., Zielhuis, G. A., (2009) Endocrine-disrupting chemicals: an Endocrine Society
and Steegers-Theunissen, R. P. (2000) Male factor subfertility: scientific statement. Endocr. Rev. 30, 293−342.
possible causes and the impact of nutritional factors. Fertil. Steril. 73, (53) Welshons, W. V., Thayer, K. A., Judy, B. M., Taylor, J. A.,
435−442. Curran, E. M., and Vom Saal, F. S. (2003) Large effects from small
(35) McShan, D., Ray, P. C., and Yu, H. (2014) Molecular toxicity exposures. I. Mechanisms for endocrine-disrupting chemicals with
mechanism of nanosilver. Journal of food and drug analysis 22, 116− estrogenic activity. Environ. Health Perspect. 111, 994−1006.
127. (54) Schug, T. T., Janesick, A., Blumberg, B., and Heindel, J. J.
(36) van der Zande, M., Vandebriel, R. J., Van Doren, E., Kramer, E., (2011) Endocrine disrupting chemicals and disease susceptibility. J.
Herrera Rivera, Z., Serrano-Rojero, C. S., Gremmer, E. R., Mast, J., Steroid Biochem. Mol. Biol. 127, 204−215.
Peters, R. J. B., Hollman, P. C. H., Hendriksen, P. J. M., Marvin, H. J. (55) Weiss, B. (2011) ENDOCRINE DISRUPTORS AS A
P., Peijnenburg, A. A. C. M., and Bouwmeester, H. (2012) THREAT TO NEUROLOGICAL FUNCTION. J. Neurol. Sci. 305,
Distribution, Elimination, and Toxicity of Silver Nanoparticles and 11−21.
Silver Ions in Rats after 28-Day Oral Exposure. ACS Nano 6, 7427− (56) Aitken, R. J., and Roman, S. D. (2008) Antioxidant systems and
7442. oxidative stress in the testes. Oxid. Med. Cell. Longevity 1, 15−24.
(37) Bachler, G., von Goetz, N., and Hungerbühler, K. (2013) A (57) Henkel, R. R. (2011) Leukocytes and oxidative stress: dilemma
physiologically based pharmacokinetic model for ionic silver and silver for sperm function and male fertility. Asian J. Androl. 13, 43−52.
nanoparticles. Int. J. Nanomed. 8, 3365−3382. (58) Agarwal, A., Virk, G., Ong, C., and du Plessis, S. S. (2014)
(38) Kim, Y. S., Kim, J. S., Cho, H. S., Rha, D. S., Kim, J. M., Park, J. Effect of oxidative stress on male reproduction. World J. Men’s Health
D., Choi, B. S., Lim, R., Chang, H. K., Chung, Y. H., Kwon, I. H., 32, 1−17.
Jeong, J., Han, B. S., and Yu, I. J. (2008) Twenty-eight-day oral (59) Saalu, L. C. (2010) The incriminating role of reactive oxygen
toxicity, genotoxicity, and gender-related tissue distribution of silver species in idiopathic male infertility: an evidence based evaluation.
nanoparticles in Sprague-Dawley rats. Inhalation Toxicol. 20, 575− Pak. J. Biol. Sci. 13, 413−422.
583. (60) Kasahara, E., Sato, E. F., Miyoshi, M., Konaka, R., Hiramoto, K.,
(39) Livak, K. J., and Schmittgen, T. D. (2001) Analysis of relative Sasaki, J., Tokuda, M., Nakano, Y., and Inoue, M. (2002) Role of
gene expression data using real-time quantitative PCR and the 2(- oxidative stress in germ cell apoptosis induced by di(2-ethylhexyl)-
Delta Delta C(T)) Method. Methods 25, 402−408. phthalate. Biochem. J. 365, 849−856.
(40) Bradford, M. M. (1976) A rapid and sensitive method for the (61) Sanocka, D., and Kurpisz, M. (2004) Reactive oxygen species
quantitation of microgram quantities of protein utilizing the principle and sperm cells. Reprod. Biol. Endocrinol. 2, 12.
of protein-dye binding. Anal. Biochem. 72, 248−254. (62) Fridovich, I. (1978) The biology of oxygen radicals. Science 201,
(41) Beauchamp, C., and Fridovich, I. (1971) Superoxide dismutase: 875.
Improved assays and an assay applicable to acrylamide gels. Anal. (63) Bray, R. C., Cockle, S. A., Fielden, E. M., Roberts, P. B., Rotilio,
Biochem. 44, 276−287. G., and Calabrese, L. (1974) Reduction and inactivation of superoxide
(42) Paglia, D. E., and Valentine, W. N. (1967) Studies on the dismutase by hydrogen peroxide. Biochem. J. 139, 43−48.
quantitative and qualitative characterization of erythrocyte glutathione (64) Amaral, A., Lourenco, B., Marques, M., and Ramalho-Santos, J.
peroxidase. J. Lab. Clin. Med. 70, 158−169. (2013) Mitochondria functionality and sperm quality. Reproduction
(43) Kaneko, T., Iuchi, Y., Kobayashi, T., Fujii, T., Saito, H., (Bristol, U. K.) 146, R163−174.
Kurachi, H., and Fujii, J. (2002) The expression of glutathione (65) Ma, W., Jing, L., Valladares, A., Mehta, S. L., Wang, Z., Li, P. A.,
reductase in the male reproductive system of rats supports the and Bang, J. J. (2015) Silver nanoparticle exposure induced
enzymatic basis of glutathione function in spermatogenesis. Eur. J. mitochondrial stress, caspase-3 activation and cell death: amelioration
Biochem. 269, 1570−1578. by sodium selenite. Int. J. Biol. Sci. 11, 860−867.

993 DOI: 10.1021/acs.chemrestox.8b00281

Chem. Res. Toxicol. 2019, 32, 986−994
Chemical Research in Toxicology Article

(66) Arai, M., Imai, H., Koumura, T., Yoshida, M., Emoto, K.,
Umeda, M., Chiba, N., and Nakagawa, Y. (1999) Mitochondrial
phospholipid hydroperoxide glutathione peroxidase plays a major role
in preventing oxidative injury to cells. J. Biol. Chem. 274, 4924−4933.
(67) Chaki, S. P., Misro, M. M., Gautam, D. K., Kaushik, M., Ghosh,
D., and Chainy, G. B. (2006) Estradiol treatment induces testicular
oxidative stress and germ cell apoptosis in rats. Apoptosis 11, 1427−
1437.
(68) Ursini, F., Heim, S., Kiess, M., Maiorino, M., Roveri, A.,
Wissing, J., and Flohe, L. (1999) Dual function of the selenoprotein
PHGPx during sperm maturation. Science 285, 1393−1396.
(69) Haraguchi, C. M., Mabuchi, T., Hirata, S., Shoda, T., Yamada,
A. T., Hoshi, K., and Yokota, S. (2003) Spatiotemporal changes of
levels of a moonlighting protein, phospholipid hydroperoxide
glutathione peroxidase, in subcellular compartments during spermato-
genesis in the rat testis. Biol. Reprod. 69, 885−895.
(70) Pfeifer, H., Conrad, M., Roethlein, D., Kyriakopoulos, A.,
Brielmeier, M., Bornkamm, G. W., and Behne, D. (2001)
Identification of a specific sperm nuclei selenoenzyme necessary for
protamine thiol cross-linking during sperm maturation. FASEB J. 15,
1236−1238.
(71) Aitken, R. J. (2018) Not every sperm is sacred; a perspective on
male infertility. Mol. Hum. Reprod. 24, 287−298.
(72) Ansar, S., Abudawood, M., Hamed, S. S., and Aleem, M. M.
(2017) Sodium Selenite Protects Against Silver Nanoparticle-Induced
Testicular Toxicity and Inflammation. Biol. Trace Elem. Res. 175,
161−168.
(73) Ansar, S., Alshehri, S. M., Abudawood, M., Hamed, S. S., and
Ahamad, T. (2017) Antioxidant and hepatoprotective role of
selenium against silver nanoparticles. Int. J. Nanomed. 12, 7789−7797.
(74) Blanco, J., Tomas-Hernandez, S., Garcia, T., Mulero, M.,
Gomez, M., Domingo, J. L., and Sanchez, D. J. (2018) Oral exposure
to silver nanoparticles increases oxidative stress markers in the liver of
male rats and deregulates the insulin signalling pathway and p53 and
cleaved caspase 3 protein expression. Food Chem. Toxicol. 115, 398−
404.
(75) Nakkala, J. R., Mata, R., Raja, K., Khub Chandra, V., and Sadras,
S. R. (2018) Green synthesized silver nanoparticles: Catalytic dye
degradation, in vitro anticancer activity and in vivo toxicity in rats.
Mater. Sci. Eng., C 91, 372−381.

994 DOI: 10.1021/acs.chemrestox.8b00281

Chem. Res. Toxicol. 2019, 32, 986−994