0% found this document useful (0 votes)

652 views163 pages

Genetics Learning Material (Midterm)

This document provides an overview and outline of the course EDUC SCI 323A Genetics. The course is divided into two parts: genetics lecture and genetics laboratory. The lecture portion covers the history of genetics, DNA and chromosomes, meiosis, Mendelian genetics, extending Mendelian genetics, gene function, and genetic engineering. It is a 4-unit course that will be assessed through exams, assignments, and a journal notebook. The outline provides learning objectives, topics, assignments, schedules, and policies for the course.

Uploaded by

Megan Alde

We take content rights seriously. If you suspect this is your content, claim it here.

Available Formats

Download as PDF, TXT or read online on Scribd

0% found this document useful (0 votes)

652 views163 pages

Genetics Learning Material (Midterm)

Uploaded by

Megan Alde

We take content rights seriously. If you suspect this is your content, claim it here.

Available Formats

Download as PDF, TXT or read online on Scribd

You are on page 1/ 163

EDUC SCI 323A GENETICS

The content of this handout is based from the books of the following authors who are
being acknowledged:

Alberts B., Bray D., Hopkin K., Johnson A., Lewis J., Raff M., Roberts K., Walter
P. 2013. Essential Cell Biology, 4th Edition. London: Garland Science.
Clark, M., Choi, J., Douglas, M., 2018. Biology 2e. 2nd edition. OpenStax. Houston
Texas 7705. Rice University.
Griffiths AJ., Miller JH., Suzuki DT., Lewontin RC., Gelbart, eds. 2000. An
Introduction to Genetic Analysis. 7th ed. New York: W. H. Freeman.
King RC., Mulligan PK., Stansfield WD. 2013. A Dictionary of Genetics. 8th ed.
New York: Oxford University Press.
Smith, J. 2012. General, organic, and biological chemistry (2nd ed.). Boston:
McGraw-Hill Companies.
Urry, LA., Cain, ML., Wasserman, SA., Minorsky, PV., Reece, JB. 2017.
Campbell Biology. 11th edition. United States of America. Pearson
Higher Education.

This material is intended for instructional purposes only. It is not intended for sale.
Should it be distributed to persons other those enrolled in this subject or be dispended for
commercial purposes, the university and the faculty member will not be responsible for any
claims of the original authors.

ii
Preface

Genetics is a discipline which includes the transmission and variation of inherited

characteristics, in particular genes in the DNA. With studying on how one’s physical,
ii
biochemical and physiological attributes are influenced by heritable factors (or genes),
studying Genetics finds it interesting and noteworthy. However, some concepts in genetics
and solving genetics problems find it overwhelming to some students. Hence, to deliver the
lessons effectively is a challenge.

With the present COVID crisis, achieving the goal to deliver the lessons effectively is
even a greater challenge. In this online learning scheme, this instructional material was made
simplified but comprehensive for students’ use. This is a student-centered instructional
material which aims to promote an independent learning approach to develop students’ critical
thinking, hone their skills in decision-making and solving problems, and instill to them the
positive attitudes and values.

---oOo---

iii
OVERVIEW
iv

Educ Sci 323A Genetics is a 4-unit course which is divided into two parts: (I)
Genetics (Lecture), a 3-unit course; and (II) Genetics (Laboratory), a 1-unit course.

Part I. Genetics (Lecture)

Course Description

This course deals with the principles of heredity and variation; its application in
plant and animal breeding, and problems involved in it. It also includes biometrical
treatment of qualitative and quantitative characters of both plants and animals.

Course Outline

This instructional material covers the following topics:

Midterm Coverage:
Unit 1: Introduction to Genetics
Unit 2: Meiosis and Sexual Life Cycles
Unit 3: Mendelian Genetics
Final Coverage
Unit 4: Extending Mendelian Genetics
Unit 6: Gene Function
Unit 7: Genetic Engineering and Biotechnology

Each unit has subtopics. For more details, please see Contents.

Course Outcomes

After going through each unit, you will be able to:

1. Outline the history and development of Genetics.
2. Connect the structure of DNA and RNA to its functions as a molecular basis of
heredity.
3. Illustrate the behavior of chromosomes during meiosis in germ cells.
4. Illustrate qualitatively and quantitatively the concepts of heredity and variation in
Mendelian and Non-Mendelian Inheritance.
5. Describe the process on how the gene is expressed and regulated from DNA to
protein.
6. Explain the benefits and disadvantages of genetic manipulation towards the society.
v
Course Requirements

Major Examinations (Mid-term and Final term examinations)

Assessments (answered activities in each module)
Journal Notebook

Grading System: 40% Major exam; 60 % Class Standing

Time Frame

The suggested allotted time to finish all the lessons is 54 hours (12 weeks)—that
includes the readings and answering of all the activities and assessments. There are 6
units for the subject: three (3) units for the mid-term and three (3) units for the final
term. The first three units (for midterm) has a suggested time allotment of 6 weeks.
The next three (3) units (Final term) has a time allotment of 6 weeks. Each unit (e.g.,
Unit 1) is expected to be finished within 2 weeks. Please see the number of hours
allotted per lesson in the Contents. These are just suggested time frames. You are free
to use on what day you are going to answer all activities.

NOTE: If you use your time wisely, it is possible for you to finish all the lessons within
the suggested time allotment.

vi
Course Policies

1. Take care of the hand outs for the interests of the next users.
2. Return handouts during or after midterm examination.
3. Do not write on the handouts. Use the separate sheets for all exercises. Consider
further instructions from each from each of your professors/instructors from each of
your professor/instructors as to how will you accomplish the exercises whether
printed or be sent online.
4. Read and/or refer to other sources or references on related topics for additional
learning contents.
5. Optimize your time and effort to complete this hand out to achieve desired learning
outcomes for the semester.
6. Arrange with your course professor/instructor the schedule of submission of
exercises and/or requirements.
7. For this semester, there are only three face-to-face sessions. All students must attend
the schedules of Onboarding or Orientation day, Midterm Examination day and
Final Examination day. Further information will be given as to the dates and venues
of these face-to-face sessions.
8. All exercises in the handout will also serve as your attendance. Hence, schedule of
submissions must be agreed upon between the professor/instructor and students to
secure attendance.
9. For smooth and fast communication, maintain your active contact number. Do not
be changing your mobile numbers if not necessary.
10. Username of your social media accounts like Facebook and Messenger must be
your real complete name. No pseudonyms, no aliases, no codenames.
11. Secure contact details of all your course professors. Feel free to contact or confer
with your course instructor/professor for any concern, clarification about the
handout content.
12. Above all, your safety and health are our concern. Always maintain a minimum
health guideline provided by DOH and IATF. Wear facemask, bring your own
sanitizers, and maintain a 2-meter physical distancing.

PLEASE DO NOT LEAVE ANY QUESTIONS UNANSWERED!

vii
CONTENTS
Title Page Time
Frame
UNIT 1. INTRODUCTION TO GENETICS
2 weeks
Lesson 1.1 The History and Development of Genetics................... 1 1 week.
Lesson 1.2 Genes, DNA, and Chromosomes: An Intro to 24 1 week
Heredity.........................................................................

UNIT 2. MEIOSIS AND SEXUAL LIFEYCLES 2 weeks

Lesson 2.1 The Process of Meisois…………………………......... 56 1 week
Lesson 2.2 Sexual Life Cycle………………………………......... 75 1 week

UNIT 3. MENDELIAN GENETICS 2 weeks

Lesson 1 Mendel’s Laws of Inheritance……………………........ 102 1 week

Lesson 2 Punnett Square: Monohybrid Cross and Dihybrid Cross. 1 week.
111
Midterm 5 hours

UNIT 4. EXTENDING MENDELIAN GENETICS 3 weeks

Lesson 1 The Degree of Dominance 1 week

Lesson 2 Pedigree Chart 1 week

Lesson 3 The Chromosomal Basis of Inheritance 1 week

UNIT 5. GENE FUNCTION 2 weeks

Lesson 1 The Genetic Code........................................................... 1 week

Lesson 2 The Central Dogma of Molecular Biology....................
Lesson 3 Gene Regulation and Gene Mutation............................ 1 week

UNIT 6. GENETIC ENGINEEERING AND BIOTECHNOLOGY 1 week

Lesson 1 Biotechnology and Genetic Engineering........................ 1 week

Finals 5 hours

viii
RUBRIC FOR CHECKING ESSAY TYPE OF QUIZ IN SCIENCE

Weig Poi
3-
5-STELLAR 4-WELL 2-LIMITED 1-I NEED hted nts
CRITERIA MODERATE
(wow!) DONE (aaah.) (huh?) HELP! (huhu!) Value Ear
(hmm.)
ned
IDEAS The essay is The essay is The essay is The essay is The essay shows
 -Controlling idea fully focused consistently sufficiently minimally little or no focus
 -Supporting ideas and contains a focused and focused and focused. The and the ideas are
 -Use of details wealth of ideas contains ample contains some provided unclear,
 -Awareness of and examples. ideas and ideas and examples are irrelevant, or
purpose The writer uses examples. The examples. The vague or general repetitive. The X2
 -Sense of scientific writer may use response is and the response response is
completeness reasoning to scientific generally demonstrates incomplete or too
addresses ideas reasoning to appropriate to minimal brief.
and arguments. addresses ideas the purpose. awareness.
and arguments.
ORGANIZATION The organization The organization The The organization The essay shows
 -Introduction/body/ of ideas supports is appropriate organization is is formulaic or little evidence of
 conclusion the writer’s and the generally inappropriate. organization or
 -Sequence of ideas focus. Ideas are sequencing of appropriate and The response sequencing.
 -Grouping of ideas grouped in a ideas is logical. the ideas are may lack a clear Transitions are
 -Effective transitions logical manner. Varied clearly introduction or not used. The X1
 -Awareness of purpose Effective and transitions are sequenced, but conclusion. response is
varied used. may be Transitions are incomplete or too
transitions are repetitive. rare. brief.
used. Transitions are
used

ix ix
STYLE The writer The language The language The language The language and
 -Sentence variety utilizes carefully and tone of the and tone are and tone are tone are
 -Word choice crafted phrases essay enhance appropriate. uneven. Word inappropriate.
 -Audience to create a the persuasive Word choice is choice is simple, Word choice is
awareness sustained tone purpose. Word adequate, but ordinary, or incorrect or
 -Personal voice and an choice is may be simple repetitive. confusing. The X1
authoritative appropriate. or ordinary. There is response is
voice. Word Sentences are Some sentence minimal incomplete or too
choice reflects varied. variety is variation in brief.
an advanced evident. sentence length
vocabulary. and structure.
CONVENTIONS The writer The writer The writer The writer The writer lacks
 -Sentence formation demonstrates demonstrates demonstrates demonstrates understanding of
 -Subject-verb full command of knowledge of sufficient minimal control the conventions
agreement the conventions the conventions control of the of the of written
 -Standard word of written of written conventions of conventions of English. Errors
forms English English. Errors written written English. are pervasive. X1
 -Punctuation, language. No are minor and do English. Errors Errors are The response is
spelling, and errors are not interfere may interfere frequent and incomplete or too
capitalization evident. with meaning. with meaning, interfere with brief.
but are not meaning.
distracting.
TOTAL 25

x
EducSci 323A Genetics

Part II. Genetics (Laboratory)

About i Lab Home

i Lab Home includes wet, hands-on laboratory experiments in Genetics to be done

at home. The materials that you will use in the experiments are those
commonly found at home. Therefore, the materials are safe for use.
However, laboratory rules and regulations should still be observed.
Since you will be doing experiments at home, these rules and
regulations are modified.

i Lab Home Rules and Regulations

1. Work in a clean environment.
2. Do not eat nor drink while you are doing the experiment.
3. Even if some materials you will be using are found in the kitchen and
are safe to use, still, do not taste them.
4. Do not smoke while you are doing the experiment.
5. Tie long hair back.
6. Wash your hands after conducting the experiment.
7. Wastes are to be poured into the appropriately labeled waste
container. DO NOT mix wastes from different categories.
8. Clean up broken glass immediately. DISPOSE OF IN SPECIFIED
"BROKEN GLASS" CONTAINER ONLY.
9. Clean up solid and liquid spills immediately.
10. If you will be using containers or anything where you put your
samples, label them.
11. Use special care when handling things at home such as plastic cups
and spoons.
12. Follow any other housekeeping, safety, or disposal rules in your
house.
13. Show sensitivity and respect to family members while doing the
experiment.
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
xi
NOT FOR SALE.
EducSci 323A Genetics

Educ Sci 323A Genetics (Laboratory) is divided into two parts: The
first part is a laboratory activity on DNA. This is the coverage for midterm.
The second part is a laboratory activity on the Mendelian Genetics on fruit
flies. This is the coverage for the final term.

Course Description

This 1-unit course deals with wet laboratory activities on the nature of
genetic materials, and variation and pattern of inheritance using model
oraganisms.

Course Outline

Activity
No. Title of the Page
Experivment Number
Midterm
(Part I) The DNA
1 DNA Extraction on Fruits
Finals
(Part II) Mendelian Genetics in Fruitflies
2 Culturing D. melanogaster
3 Setting Up the Cross for D.
melanogaster
4 Genetic Crosses in D.
melanogaster

Course Requirement

1. Laboratory report (with documentation such as pictures or videos)

2. Laboratory notebook

-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
xii
NOT FOR SALE.
EducSci 323A Genetics

Good Day! I’m Teacher Smiley! I am the

IM’s teacher in Genetics. I will be the one to
give you instructions, activities and tests. Here
are some reminders:

 Read all directions carefully.

 Do not leave any questions unanswered.
 Manage your time well.
 Smile always 😊

Let’s start! 😊

Unit 1
INTRODUCTION TO
GENETICS
2 WEEKS

Lesson 1.1
(1 week)

Lesson 1.2
(1 week)

Photo Credit: Pinterest.com

Lesson 1.1 The

Overview of the Unit
History and
Development of Living organisms are different from one another. For example,
Genetics humans may have similarities in structural organization of
Lesson 1.2 Genes, internal and external body organs, but they differ in various ways
DNA, and
such as skin color, type of hair, shape of the nose, language, and
Chromosomes: An
Intro to Heredity skills. These variations are inherited from parents. The study of
inherited characteristics which are passed on from parents to
offspring is called Genetics.
Let us start studying Genetics by looking back on its history and how it developed
as a Science. Indeed, as Science students, it is important for you to look back to appreciate
the work of scientists, learn from them, and gain knowledge and wisdom. These will guide
you and give you insights on what should be done in the present and what to prepare for
the future. In this lesson, be inspired as you encounter scientists who greatly contributed
on the study of Genetics, starting from how it was first discovered until the development
of DNA sequencing and genetic engineering.
Also, let us start studying Genetics with the important molecules of heredity. In the
second lesson, we will tackle about the structural and chemical components of your genes,
DNA, and chromosomes. Let’s unravel the molecules that make you unique. Let’s unravel
the molecules that make you who you are.
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 1 EducSci 323A Genetics

The History and Development

Lesson 1.1 of Genetics
1 week

Topic Learning Outcomes

After going through the lesson, you will be able to:

1. Name global and local scientists who have great achievements in Genetics.
2. Sequence some major events in the past and present of Genetics.
3. Conclude the present and future impacts of a significant event in Genetics to
the scientific community and the society.
4. Create an essay as a response to the selected scientist (or group of
scientists).

Introduction
In Modern Genetics, one
important breakthrough is the
development of DNA sequencing.
With this, several molecular
genetic researches were published.
Some of its applications include
gene therapy, plant and animal
breeding, and the diagnosis of
infectious diseases.

Gregor Mendel
(The Father of Genetics)

T he observation on the similarities

and inheritance among organisms had been Photo Credit: up.edu.ph

observed a long time ago. It is Gregor Mendel Filipino-made PCR Kit

who turned the observation of heredity into
Polymerase Chain Raction (PCR) is a
science when he started his work with pea in his molecular biology technique that can
garden. This opens for several breakthroughs in be used to diagnose infectious disease
Science including the discovery of DNA. such as the COVID-19.
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 2 EducSci 323A Genetics

LESSON PRE-TEST
What Do You Already Know?

What do you already know about the history of Genetics?

Before going through the lesson, please check your background
by answering the following activity. Do not sneak for an answer
yet. You may check the correct answers only after you have
answered all questions. Correct answers can be found at the last
page of the lesson. Don’t forget to read the direction.

A. Name the Scientist in the History

Direction: In each box, there is a picture of a scientist and his
contribution on the field of Genetics. Name the Scientist. Get the name in
the Word Bank.

1. 2. 3.

_Gregor Mendel_ _ _

He is the father of Genetics. He He isolates DNA for He is the first to describe

describes his experiments with the first time chromosome behavior during
peas showing that heridity is cell division
transmitted in discrete units.
Word Bank
4. 5.
 Wilhelm Johannsen
 Thomas Hunt
Morgan
 Joe Hin Tjio
 Gregor Mendel
 Beadle and Tatum
_______________________ _________________________  Sanger
 Friedrich Miescher
He used fruit flies as a  Barbara McClintock
He coined the word model organism and show
 Walther Flemming
gene that genes are the units of
 Crick and Watson
heredity
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 3 EducSci 323A Genetics

7.
6.

__________ _ _ _________

_____ ______ ______ ______
They affirm the “one gene, one They described the double helix
enzyme” hypothesis structure of DNA

8. 9. 10.

_______ _ _____________

______
She discovered the He defined 46 as the He developed the
“Jumping genes”. exact number human first rapid DNA
chromosomes. sequencing method
B. Sequence the Event
Direction: Put a number in the circle to label the sequence of the event.
Write the sequence of the event on the next page.

PCR was inveneted Genetic Code cracked Launched of

Human Genome
Project
DNA first isolated First recombinant DNA
DNA double helix
The word gene coined Mendel’s Pea Experiment
“One gene, one enzyme”
The first rapid DNA
Free access to Flavr Savr. tomato- the first
sequencing method
genomic genetically modified food
information was developed

GenBank database
Human DNA sequncing begins First animal gene cloned formed

1. ___ 11. _

2. _________________________________ 12. _______________________________
3. _________________________________ 13. _______________________________
4. _________________________________ 14. _______________________________
5. _________________________________ 15. _______________________________
6. _________________________________
7. _________________________________
8. _________________________________
9. _________________________________
10. _________________________________

C. Write a short essay as your response to a selected scientist who have

contributions in the field of Genetics.
____________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
____________________________________________________________

Check the correct answers found at the last page of the lesson.

Thank you for answering! 😊

Self-Rating Competency Checklist

. After answering the lesson pre-test, please rate

yourself by checking the following Learning Comptency
cheklist. 😊

I I can do I can I can do

Learning Competencies cann this but do this very
(Knowledge, Skills, Values) ot do I need to this well and
this learn confi- can teach
yet more dently other
Name global and local scientists who have
great achievements in Genetics.
Sequence some major events in the past and
present of Genetics.
Conclude the present and future impacts of a
significant event in Genetics to the scientific
community and the society.
Create an essay as a response to the selected
scientist (or group of scientists).

Self-Rating Journal

Based from the lesson pre-test, please write a short

self-rating reflection. Highlight on what you know already,
what you don’t know yet, and what to improve. Use the self-
rating competency checklist above as your guide. 😊
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________

LESSON PROPER
Let’s start our lesson. You have a suggested time allotment of 3 hours to
finish all the readings, activities, and assessments. That is only a
suggested time frame. You may answer all the activities at your most
convenient time. Do not forget to read all instructions. Happy reading! 😊

LET’S GET STARTED!

1. Read the headline on the newly sequenced genome of COVID-19 virus.

Chinese Scientists Sequence Genome of COVID-19

AsianScientist (Feb.25, 2020)-
Scientists in China have sequenced the genome
of the COVID-19 virus demonstrating that it is
a completely new virus, albeit closely related to
A the coronavirus (CoV) responsible for severe
C acute respiratory syndrome (SARS). Their
findings are published in the journal Chinese
T Medical Journal.
I In the present study, reserachers led by
Dr. Wang Jienwei used next generation
V sequencing (NGS) to identify the pathogen
I causing illness in Wuhan... Photo credit: Asian Scientist Newsroom

T
[Optional: To read more about the news, you A research group in China has
Y may check the URL link given in E-visit corner sequenced the genome of the COVID-
below (Science News). 19 virus and reported that the virus
most likely originated from bats.
Optional: To read the research article, you
may check the URL link given in E-visit corner Source: Asian Scientist Newsroom
(Research Article)]

E-Visit Corner: Science News E-Visit Corner : Research Article

Title of the Headline: Chinese Scientists Title of the Research article: Identification of a
Sequence Genome of COVID-19 novel coronavirus causing severe pneumonia in
GO TO: human: a descriptive study
https://www.asianscientist.com/2020/02/topn GO TO:
ews/china-coronavirus-covid-19-study/ https://journals.lww.com/cmj/FullText/2020/05050/Ide
ntification_of_a_novel_coronavirus_causing.3.aspx

LET’S THINK AND REFLECT!

After reading the Science news, please answer the following questions:

1. What is the recent discovery or achievement of Genetics posed on the

headline?

A
N
A 2. Who are the group of scientists who sequenced the genome of the COVID-
L 19?
Y
S
I
S

3. What do you think are the roles of the past events or history of Genetics to the
recent achievement on the sequencing of the COVID-19 corona virus
genome?

4. What do you think are the present impacts of the said achievement or
discovery to the Scientific community and the society? How about the future
impacts?

A
N
A
L
Y
S
I
S
Getting There...
The Science of Genetics has developed overtime—from the discovery of
genes and DNA to a more advanced sequencing of DNA. Major events from the
past such as the discovery of genes, DNA, and chromosomes had opened to a
flourishing advancement and promises of genetic engineering and DNA
sequencing.
Scientific discoveries and breakthroughs are influenced by the demand of
the society. An expamle is DNA sequencing. Then and now, many genomes of
important unicellular and multicelluar organisms were sequenced such as
humans, pathogenic bacteria like E. coli, and model organsims like fruit flies
and rats. These breakthroughs have helped the advancement in Medicine,
agriculture, environment, and other global demands.
The promise of DNA sequencing fed the society’s demand during the
COVID-19 pandemic. One of which is when the genome of the COVID-19
coronavirus was sequenced. This paves the way to undertanding the identity of
the virus and its source. In turn, this may serve as a baseline information to
studying its characteristics, diagnosis of the disease, and even the discovery of
vaccine and treatment.
Behind all achievements of Genetics are the great scientists of the past
and today. In this lesson, let us know some of these important people and their
achievements.

LET’S GET TO KNOW MORE!

The History of Genetics

The Quest to Turning the Study of The first DNA isolated
Inheritance and Heridity into Science
Variation
A
B
S
T
R
A
C Gregor Johann Mendel Friedrich Miescher
T Charles Darwin (Father of Genetics) (1869)
I (1859) (1865)
O Miescher is a
N The study of Influencing the
inheritance and variation ideas from the previous Swiss scientist who
among organisms had quests, Gregor Johann first isolated the DNA.
been observed before the Mendel turned the While studying the
time of Gregor Mendel. study of heredity into biochemistry of white
Many have tried to Science. He was a blood cell, he was able
answer the quest. One Monk interested in to isolate a material
norable person is a Botany and a Science rich in phosphorus. He
Naturalist named Teacher. In 1857, he called it nuclein
Charles Darwin. He started his work on (eventually became
worked for years to studying of peas in his known as DNA)
develop the idea about garden. He carefully because it was isolated
evolution by Natural pollinated the plants from nucleus.
Selection since his five- and analyzed the
year journey in the 1830s succeeding generations.
Extended Reading Corner
to the South American He concluded that traits
Coast, the Galapagos are inherited from the TOPIC: The History of Genetics
Islands. The first parents trhough a YOU MAY VISIT:
printing of his book was discrete unit he called a https://www.britannica.com/
titled, “On the Orgin of heritable factor. Now, science/genetics
Species by Means of this heritable factor is
Natural Selection”. called gene.

After Mendel. ..

A fter Mendel
and after the first
isolation of DNA,
many great
achievements in Walther Flemming
Wilhelm Johannsen Thomas Hunt Morgan
Genetics (1879)
(1909) (1911)
followed. Some He is the first to
He coined the word He used fruit flies as a
of these are the describe the
gene to describe the model organism and
discovery of chromosome
Mendelian units of show that genes are the
gene, the behavior during units of heredity
heredity
structure of DNA, animal cell division
and DNA
A sequencing. Let’s
B recognize some
S notable scientists
T behind these great
R achievements.
[Photo start from
A
the upperleft; George Beadle and
C
clockwise (oldest Edward Tatum (1941)
T They affirm the “one
to latest)
I gene, one enzyme
O hypothesis”
N

DNA STRUCTURE
UNRAVELLED!
In 1953, Francis Crick and James
Frederick Sanger Watson unravelled the double helix
(1975-1977) structure of DNA.
Sanger and his Barbara McClintock
colleagues developed (1944)
the rapid DNA She discovered that genes
Joe Hin Tjio
sequencing methods. can jump around on
(1955)
This great achievement chromosomes showing
He defined 46 as
open up for the many that genome is more
the exact number
sequencing of human dynamic. These genes are
opportunities on the called “jumping genes.
chromosomes
genome of organisms.
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 11 EducSci 323A Genetics

Our Filipino Scientists

Philippine’s National Scientists

M any of our
Specialization: Genetics and Plant Breeding
Year Proclaimed as National Scientist: 1986
Filipino
He developed and improved varieties of rice
scientists and and corn, food legumes, fruits and ornamental
academicians plants. His research output and writings paved
are getting into the way for the launching of programs rainfed
the Dioscoro L. Umali
and upland agriculture, social forestry,
advancement of environmental conservation, and rural poverty
“Father of Philippine
Genetics. They alleviation. (source: Directory of NAST, 2006)
Plant Breeding”
are involved in
A the publication Specialization: Genetics and Plant Breeding
of scientific Year Proclaimed as National Scientist: 1994
B
researches,
S Provided leadership in the development,
promoting their isolation, and release of many rice cultivars in
T
goals and the Philippines. The classic rice cultivar C4.63
R advocacies to is high yielding, resistant to many diseases and
A the society, and insect pests and has become the standard for
C utilizing the Pedro B. Escuro high quality rice in the Philippines as well as in
T Science of many other rice growing countries. (source:
I Directory of NAST, 2006)
Genetics in
O solving some of Specialization: Biochemical Genetics
N our country’s Year Proclaimed as National Scientist: 1998
problems.
Let us recognize She pioneered cytogenetics of various Philippine
some of our crops and the biochemical genetics of macapuno.
She initiated researches in genome analysis and
remarkable molecular/biochemical markers in important
scholars who agricultural crops. (source: Directory of NAST,
Dolores A. Ramirez
have been 2006)
awarded as
National Specialization: Plant Breeding
Scientists! Year Proclaimed as National
Scientist: 2005

Noted for his comprehensive researches

Extended Reading Corner on varietal breeding especially in the
development of varietal resistance and
TOPIC: The National Scientists the improvement of plant structure and
Ricardo M. Lantican morphology which paved for the
YOU MAY VISIT:
http://www.nast.ph/images/pdf%20file production of outstanding plant varieties.
s/Publications/Other%20Publications These varieties are now commercially
%20of%20NAST/First%20Decade/Th
e%20National%20Scientists%20Deca grown in the Philippines and Asia.
de.pdf (source: Directory of NAST, 2006)
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 12 EducSci 323A Genetics

The Quest After Cracking the Code

1966 The Genetic Code was cracked

E stablishing
1968
1972
First restriction enzyme was described
First recombinant DNA
the genetic code 1973 First animal gene cloned
leds to many 1975 The rapid DNA sequencing was developed
remarkable
breakthroughs in 1976 First engineering company was founded
the development 1977 Introns were discovered
of Genetics. These 1981 First transgenic mice and fruit flies
include gene 1982 GenBank database formed
cloning and DNA 1983 First disease gene mapped. It’s Huntington’s
A sequencing. After disease
B DNA sequencing 1983 PCR was invented.
S fluorished, the
1990 Launched of Human Genome Project
T genome sequences
R of important 1994 Flavr Savr. tomato—the first GMO was
A prokaryotic and approved by FDA
C eukaryotic model 1994 First two microbial genomes were sequenced:
organisms were Haemophilus influenzae and Myoplasma
T
unraveled. DNA genitali
I
sequencing 1996 First genetic map was completed
O
N influences the 1996 Yeast genome was sequenced
launching of 1996 First archaea genome was sequenced and
Human Genome confirmed that there is a third main branch of
Project and life.
introduces the 1996 Human DNA sequencing begins
advancement of
DNA technology 1997 E. Coli genome was sequenced
and genetic 1998 M. tuberculosis bacterium
engineering. sequenced
2000 free access to genomic information
In 2020, the 2000 Fruit fly genome sequenced
complete
Extended Reading Corner
genome of a
2019 novel TOPIC: Development of Genetics
YOU MAY VISIT:
coronavirus https://www.britannica.com/science/
genetics
was sequenced.
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 13 EducSci 323A Genetics

LET’S DO AND DISCOVER!

Was everything clear to you? You may go back to the last

section if there are some concepts that are not yet clear. Take note
of some important facts and ideas. You may visit the E-reading
corners for supplemental readings. If you’re ready, please do the
the following activity.

Look for Your Scientists and their Achievements

Activity 1
Directions:
A 1. Read headlines from science news about a great discovery, an
P achievement, or breakthrough of great geneticists in the history. Pick at
P least two (2) which you think have great impacts in the world. (For
L example, a headline/Sience news about the discovery of Jumping genes by
I Barbara McClintock)
C 2. After you have read the news, answer the following table:
A
Your Scientists Present Impact Future Impact
T
(Write your Their (State its present (State its future
I Scientist, the title of Contributions impact to Science impact to Science
O the headline, and the community, and to community, and to
N source) the society) the society)
1.

Look for Your Modern Scientists and their Achievements

Activity 2

1. Read 2 headlines about any recent discovery, breakthrough, or achievements

of Genetics or Molecular Biology on the issues on COVID-19. One headline
is global, the other is local. Of those headlines, identify the scientist or group
of scientists who are behind those dicoveries, breakthroughs, or achievements.
2. After reading, satisfy what is asked below:

Headline 1:

a. Title of the Headline:

A
P Source:
P b. Summary:
L
I
C
A
T
I
O
N

c. Scientist or group of Scientists:

d. What do you think are the present impacts?

e. What do you think are the future impacts?

Headline 2:

a. Title of the Headline:

Source:
b. Summary:

A
P
P
L c. Scientist or group of Scientists:
I
C
A d. What do you think is the present impact?
T
I
O
N

e. What do you think is the future impact?

Look for Your Filipino Scientists and their Achievements

Activity 3

1. Read the headlines from newspapers or Science news about the achievements of
some Filipino scientists or academicians on the following subjects:

 Filipino-made PCR diagnostic kit for COVID-19 (Dr. Raul Destura)

 DNA forensics application during Paco Orphanage Fire (Dr. Ma. Corazon
de Ungria)
 Fisheries and Aquatic Resources (Dr. Mudjeekeewis D. Santos)
 2 Filipino scientists or academicians who specializes Genetics or
Molecular Biology
2. Answer the table below.
A
‘
P Your Filipino Their Present Impact Future Impact
P Scientists Contributions (State the present (State the future
L (Write your impact to Science impact to Science
I Scientist, the community, and to the community, and to
C title of the society) the society)
A headline, and
T the source)
I 1.
O
N

A
P
4.
P
L
I
C
A
T
I
O
N

Thank you for answering! 😊

Sum It Up!
1. Notable geneticists in the history. Gregor Mendel, the Father of Genetics turn
employ scientific approach to study the variation and inheritance in organisms.
Friedrich Meischer isolated the DNA for the first time. Joe Hin Tjio defined 46
as the exact number of human chromosomes. Walther Flemming was the first to
describe the chromosome behavior during animal cell division. Wilhelm
Johannsen coined the word gene to describe the Mendelian units of heredity.
Watson and Crick described the double helix DNA Barbara McClintock
discovered jumping genes. Thomas Hunt Morgan used fruit flies as a model
organism and show that genes are the units of heredity. George Beadle and
Edward Tatum affirm the “one gene, one enzyme hypothesis”. Sanger and his
colleagues developed the rapid DNA sequencing methods.

2. Local Filipino Scientists. Among our National Scientists are: Dioscoro L. Umali
(Father of Philippine Plant Breeding), Pedro B. Escuro, Dolores A. Ramirez, and
Ricardo M. Lantican. These National Scientists have greatly contributed on plant
breeding and enhancement of the quality and yield of important agricultural crops.
3. Timeline on the development of Genetics. The Science of Genetics started when
Mendel worked with pea in his garden. Many significant events followed: DNA
was isolated, the behavior and features of chromosomes were identified, DNA
sequencing was developed, and many important model and non-model organisms
were sequenced.

LESSON POST-TEST
How Much Have You Learned?

How much have you learned from the previous readings and
activities? This time, we will have our evaluation. Read the directions
carefully. Good luck! 😊

Name: _________________________________ Date: _

Course, Year, and Section: ___________________________ Rating: __________

Worksheet 1.1. The History and Development of Genetics

Part I. True or False

Direction: Write TRUE if the statement is correct. If the stament is not correct,
write FALSE and change the underined word with the correct answer. Write your
answer after the statement.

1. Wilhelm Johannsen suggested that the Mendelian factors of inheritance be

called genes. _______________
2. Pedro Escuro provided leadership in the development, isolation, and release of
many rice cultivars in the Philippines. _______________
3. Friedrich Miescher was the first to isolate a phosporous-rich material isolated in
the nucleus of the white blood cell which he call nuclein. Later, this nuclein was
known to be the DNA. _______________
4. Frederick Sanger and his colleagues developed a protocol for squencing DNA,
where a marker attaches to the growing ends of DNA chains. His protocols in
DNA sequencing is used most commonly in labs now. _______________
5. Ricardo M. Lantican is noted for his research on plant breeding, development of
varietal resistance, and improvement of structure and morphology of plants
which produces high plant varieties. _______________
6. In 1879, Walther Flemming was the first to detail on how the chromosomes
move during mitosis or animal cell division. _______________
7. Dioscoro Umali, noted for his research biochemical genetics of Macapuno and
other plants. She initiated the research in genome analysis and molecular and
biochemical markers in important crops. _______________

8. Thomas Hunt Morgan and his group studied the fruitfly Drosophila melanogaster
and showed that chromososmes carry genes. _______________
9. Francis Crick and James Watson describe the double helix model of DNA. ______
10. George Beadle and Edward Tatum, throug experiments on the red bread mold
Nerospora crassa, they showed that genes act by regulating distinct chemical
events- affirming the “one gene, one enzyme” hypothesis. _______________

2. In your own words, list in order at least 5 major significant events in the history of
Genetics. Then, add a recent trend in Genetics in the global or local scenes. You may
use examples from our previous activities based on what you have learned.)

Events Present Impact Future Impact

Local Scene

Global scene

Self-Reflect
 Create an essay as a response to the selected scientist (or group of Scientists)
who have great achievements in Genetics. Write at least 3 to 5 paragraphs. Your
essay should cover but not limited on the following:
a. Name of the scientist and their significant achievements
b. Present and future impacts of the achievement to the scientific
community and the society
c. Your personal response as a Science student and future Science
educator

Essay:

Self-Rating Competency Checklist

I hope you have learned a lot from the lesson. Please rate yourself
. by checking the following Learning Comptency cheklist. 😊

I I can do this I can I can do this

Learning Competencies cannot but I need do this very well
(Knowledge, Skills, Values) do this to learn confide and can
yet more ntly teach other
1. Name global and local
scientists who have great
achievements in Genetics.
2. Sequence some major
events in the past and
present of Genetics.
3. Conclude the present and
future impacts of a
significant event in
Genetics to the scientific
community and the society.
4. Create an essay as a
response to the selected
scientist (or group of
scientists).

Self-Rating Journal

Based from the previous readings and assessments, please

write a short self-rating reflection. Highlight on what you know
already, what you don’t know yet, and what to improve. Compare
your self-rating checklist during the lesson pre-test and post-test.
Use the self-rating competency checklist above as your guide. 😊
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________
___________________________________________________________________________________

Answer Key

LESSON PRE-TEST

Name the Scientist in the History

1. Gregor Mendel
2. Friedrich Miescher
3. Wlather Flemming
4. Wilhelm Johannsen
5. Thomas Hunt Morgan
6. George Beadle and Edward Tatum
7. James Watson and Francis Crick
8. Barbara McClintock
9. Joe Hin Tjio
10. Frederick Sanger

Sequence the Event

1. Mendel’s Pea Experiment
2. DNA first isolated
3. The word gene coined
4. “One gene, one enzyme”
5. DNA double helix
6. Genetic code was cracked
7. First recombinant DNA
8. First animal gene cloned
9. The firts DNA rapid sequencing method was developed
10. GenBank database formed
11. PCR was invented
12. Launched of Human Genome Project
13. Flavr Savr. tomato – the first genetically modified food
14. Human DNA sequencing begins
15. Free access to genomic information

GENES, DNA, AND

Lesson 1.2 CHROMOSOMES: AN INTRO
TO HEREDITY
1 week
Topic Learning Outcomes

After going through the lesson, you will be able to:

1. Describe the function of genes.

2. Illustrate the structure of a nucleic acid DNA.
3. Compare and contrast the structure and functions of DNA and RNA.
4. Write the complementary base-pairing in DNA and RNA.
5. Illustrate the structure of chromosomes.
6. Connect the relationships between genes, DNA, and chromosomes based on
their location and function.
7. Write an appreciation letter to the molecules of heredity.

Introduction

Living organisms may have similarity

in the structural oraganizations of body
cells, tissues, organs, and systems, still,
they differ from each other in many
ways. Let’s consider the Asian people.
Although they have all the same
structural body organs, but they differ
from each other-- from the types of eyes,
the shape of the nose, the color of the
Photo credit:
skin, and other physical features. They https://pubsapp.acs.org/cen/news/88/i44/8844notw7.html
even differ from their language and
skills. These variation of character traits diversity is your DNA or deoxyribonucleic
are passed on from parents to offspring. acid.
What makes the Asian people In this lesson, we will study about the
unique from each other? What makes molecules of heredity—your genes in your
you unique? It’s the same question at the DNA—the blue print of life which strungs in
cellular level. What enables cells to have the chromosome. We will also tackle their
different forms and functions? structures and functions.
Ultimately , the answer for these
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 25 EducSci 323A Genetics

LESSON PRE-TEST
What Do You Already Know?

What do you already know about the molecules of heredity? What

do you already know about genes, DNA, and chromosomes? Before
going through the lesson, please check your background by answering
the following activity. Please do not sneak for an answer yet. You may
check the correct answers only after you have answered all questions.
Correct answers can be found at the last page of the lesson. Don’t forget
to read the direction. Good luck! 😊

Direction. Answer the following questions:

1. What do you already know about genes?

2. Label the following structures below. Get your answers from the word box.

1.
2. 3.

Word Box:
Nucleus Chromosomes RNA Histone Proteins
Mitochondria DNA Nucleosomes Endosome

3. Compare and contrast the sturcture of DNA and RNA based on their structure and
function.

4. Try this one:

Write the complementary base of the following DNA sequence:

3’ A T G G C A C T 5’
5’ 3’

Check the correct answers found at the last page of the lesson

Thank you for answering! 😊

Self-Rating Competency Checklist

After answering the lesson pre-test, please rate yourself by

checking the following Learning Comptency cheklist. 😊

I cannot I can do this I can do I can do this

Learning Competencies do this but I need to this very well
(Knowledge, Skills, Values) yet learn more confidently and can
teach other
Describe the function of genes.
Illustrate the structure of nucleic acid
DNA.
Compare and contrast the structure of
nucleic acids DNA and RNA.

Write the complementary base-pairing in

DNA and RNA
Illustrate the structure of chromosomes

Connect the relationships between genes,

nucleic acid DNA, and chromosomes
based on their location and function.
Write an appreciation letter to the
molecules of heredity.

Self-Rating Journal

Based from the previous activity, please write a short self-

rating reflection. Highlight on what you know already, what
you don’t know yet, and what to improve. Use the self-
rating competency checklist above as your guide. 😊
____________________________________________________________
_________________________________________________________________
_________________________________________________________________
_________________________________________________________________
_________________________________________________________________
_________________________________________________________________
________________________________________________________________

LESSON PROPER
Let’s start our lesson. You have a suggested time allotment of 5 hours to
finish all the readings, activities, and assessments. That is only a suggested
time frame. You may answer all the activities at your most convenient
time. Do not forget to read all instructions. Happy reading! 😊

LET’S PRACTICE YOUR VOCABULARY!

Direction: I have here key words for our lesson. Fill the missing letters to complete
the correct word.

1. CNTOM__RE  It is the central region of a eukaryotic chromosome where

the kinetochore is located.

2. CHOOSOE  A structure in the cell nucleus that contains DNA,

histone protein, and other structural proteins.
V
O 3. D__O__YRIB__NU__LE__C A__ID  a nucleic acid found in all living things.
C It consists of a polymer of nucleotides which are shaped into a double helix. It is
A associated with the transmission of genetic information.
B 4. DE__X__RI__O__E  It is the sugar constituent of deoxyribonucleic acid. It is
U a derivative of the pentose sugar ribose in which the 2’ hydroxyl (-OH) is reduced
L to a hydrogen (H).
A
R 5. GE__E__  a unit of heredity of living organisms

6. OMOLOOU CROOSOES  a pair of chromosomes with the

same gene sequence, loci, chromosome length, and centromere location

7. NCEIC A__IDS  A biomolecule consisting of multiply repeat units of

phosphoric acid, sugar, and nitrogenous bases. It can be a DNA or RNA.

8. RIOUCEIC ACD  a derivative of DNA having ribose in place of

deoxyribose , and uracil in place of thymine; its primary funtion is in the
transcription of genetic mateerial and subsequent synthesis of protein.

9. RBOE  It is a naturally occuring petose sugar of Ribonucleic acid (RNA).

10. ITR CHOMTD__  Either of the two chromatids of a

chromosome

Check the correct answers found at the last page of the lesson
😊
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 29 EducSci 323A Genetics

LET’S GET STARTED!

A
Things to do:
C
T 1. Choose a photo of a famous family. Paste your photo on the frame above.
I Optional: Take a family photo. Include your biological parents and your
V siblings.
I
T 2. Observe the picture keenly. Spot the similarities and differences (e.g., in
Y physical appearance and talents) among the family members—from parents to
the children, and between siblings.
Optional: You may talk with your parents and siblings about your similarities
and differences.

3. Write the results on the boxes below:

Child With the mother With the father With the siblings

Similarities

Differences

LET’S THINK AND REFLECT!

1. Based from your observation, what physical characteristics does the child have
in common with her/his parents? With the siblings? What makes her/him
unique from the rest of the family?

Optional: (What do you have in common with your parents? With your
siblings? What makes you unique from the rest of the family members? )

A
N
2. What do you think, accounts for family resemblance? Write words or
A
phrases as many as you can the probable reasons for family resemblance. Write
L
on the oval below. Also, write the probable reasons for the differences on the
Y
rectangle below.
S
I
S

Getting There...

You have just listed words or phrases the probable reasons on the
resemblance and differences of physical appearance among family
members.What you just did earlier is the quest in Genetics. Genetics is the
scientific study of heredity and variation in living organisms, including humans.
Heredity is the transmission of traits from one generation to the next. Variation
is demonstrated by the differences in appearance that offspring show from parents
and siblings. In a literal sense, children do not inherit particular physical traits
from their parents. It is genes that are actually inherited.
Genes are the units of heredity, and are made up of segments of DNA. Genes
are passed to the next generation through reproductive cells called gametes
(sperm and eggs). Each gene has a specific location called a locus on a certain
chromosome. Most DNA is packaged into chromosomes. One set of
chromosomes is inherited from each parent. These molecules of heredity-- the
genes, DNA, and chromosomes, are what we are going to tackle in this lesson.

LET’S GET TO KNOW MORE!

GENES, DNA, AND CHROMOSOMES

O rganisms reproduce offspring like

themselves— like how humans reproduce same
species of humans or the plants reproduce the
same species of plants. During reproduction,
character traits are passed on from parents to
A offspring. The transmission of character traits
B from parents to offspring is called heredity.
S During reproduction, the hereditary information
T of a single trait (e.g., skin color, types of eyes) is
R passed on from parents to offspring. This unit of Figure 1.1 Genes for character traits
are passed on from parent to offspring.
A hereditary information is called genes.
C
T Genes are segments of deoxyribonucleic acid (DNA) or ribonucleic acid
I (RNA) from a cell or an organism’s genome which codes many biomolecules, thus
O influencing the physical, biochemical, or physiological aspects of organisms. DNA
is a type of nucleic acid (one of the biomolecules) necessary for the storage and
N
transmission of hereditary information. DNA are found and packaged in the
chromosomes. Chromosomes are one of the prominent structures of the cell’s
nucleus. (Figure 1.2).

Figure 1.2. The level of structural organization of gene, DNA, and Chromosomes based
on their locations.

Lesson 1.2.1 NUCLEIC ACIDS: DNA and RNA

At the end of the topic, you will be able to:

 Draw the structure of DNA.

 Differentitiate the structure of DNA and RNA.
 Write the complementary base-pairing of DNA and RNA.

Nucleic acids are one of the types of biomolecules or biopolymers that have
roles in the transmission of hereditary information. Two kinds of nucleic acids are
found in cells: ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). As a
biopolymer, nucleic acid is made up of a repetitive subunit of monomers called
nucleotide. The nucleotide is composed of different subunits: the nitrogenous base
[Adenine, Thymine in (or Uracil in RNA), Cytosine, Guanine], the sugar, and the
A phosphate.
B
S DNA
T
R Deoxyribonucleic acid, or DNA is a type of
A nucleic acid which is a double helix chain of
C molecules. It has a segment of heritable
T factors called genes that determines the
I unique external and internal characteristics
O of an organism. Hence its popular identity
N phrase, “the blueprint of life”. DNA is
present in the chromosomes of the nuclei of
eukaryotic cells (Figure 1.3). DNA is also
present in prokaryotic cells and virus. James Figure 1.3 Location of DNA in
eukaryotic cells. DNA is strung and
Watson and Francis Crick co-originated the packaged in the chromosomes of the
double helix molecule of DNA. nucleus in eukaryotic cells.

E-Visit Corner

TOPIC: Nucleic Acids

YOU MAY VISIT:
https://youtu.be/0IZRAShqft0

Figure 1.4 Structure of a double helix DNA

Photo Credit: Openstax book: biology-2e

HOW DNA IS DIFFERENT FROM RNA?

RNA is a type of nucleic acid that plays a

major role in the synthesis of protein. It is
not found in the chromosomes, but rather is
located elsewhere in the nucleus and even
outside the nucleus, in the cytoplasm.
Similar with DNA, its “building block” is
called nucleotides which is composed of
sugar, nitrogenous bases, and, phosphate
group.
However, RNA is structurally different from
DNA in some parts. RNA is single stranded.
A It has a five-membered sugar called ribose.
B Also, in nitrogenous bases, it consists of
S Adenine, Uracil, Cytosine and Guanine. Figure 1.5 Structure of DNA and RNA.
T Take note that Uracil replaced the Thymine. DNA is double-stranded double helix while
R RNA is single-stranded
A
C Difference Between DNA and RNA
T
BASIS OF DNA RNA
I
COMPARISON
O Number of strands 1 2
N Deoxyribose Ribose
Type of sugar Full name: Full name:
ẞ -2-deoxy-D-ribofuranose ẞ -D-ribofuranose
Type of base Adenine, Thymine, Cytosine, Guanine Adenine, Thymine, Cytosine,
Guanine
present in the chromosomes of the elsewhere in the nucleus and
Location in the nuclei of eukaryotic cells. even outside the nucleus, in the
cell cytoplasm

Major Types of RNA and their Functions

RNA TYPE FUNCTION
Transfer RNA Transports amino acids to site of protein synthesis
Ribosomal RNA Combines with proteins to form ribosomes, the site of protein synthesis
Messenger RNA Directs amino acid sequence of proteins
Small nuclear RNA Processes initial mRNA to its mature form in eukaryotes
Micro RNA Affects gene expression; important in growth and development
Small interfering Affects gene expression; used by scientists to knock out a gene being
RNA studied

Nucleotides

Both DNA and RNA are made up of

building blocks called nucleotides.

Nucleotides are the repititve units of

monomers that form a long polymer chain
of DNA or RNA. Nucleotides are
composed of three simpler units: a base, a
sugar (which is a monosaccharide), and
a phosphate.
Figure 1.6 Molecular structure of a nucleotide
A. A Base
A A base, oftentimes called a nitrogenous base, is a heterocyclic aromatic
B amines. There are two classification of nitrogenous base: (1) purine and (2)
S pyrimidine. Adenine, Guanine and Cytosine are found in both DNA and RNA, but
T uracil (U) is found only in RNA, and thymine (T) is found only in DNA. Note that
thymine differs from uracil only in the methyl group in the 5 position. For DNA, the
R
bases are A, G, C, and T; for RNA, the bases are A, G, C, and U.
A
C
T Purines are heterocyclic aromatic
I amines that have double rings—
O one is a six-membered ring and the
N other is a 5-membered ring. The
types of purines are Adenine (A)
and Guanine (G).

Figure 1.7 Double-ringed structure of purines.

Pyrimidines have a single 6-

membered ring. The types of
pyrimidines are Cytosine and
Thymine (for DNA) and Uracil (for
RNA)

Figure 1.8 Single-ringed structure of purines.

In base-pairing rule, in DNA, Adenine pairs with Thymine linked by two

hydrogen bonds; while Cytosine pairs with Guanine linked by three hydrogen
bonds. The hydrogen bonding follows the same in RNA but, Adenine pairs with
Uracil, instead of Thymine.

A-T pairs linked with 2 hydrogen bonds C-G pairs linked with 3 hydrogen bonds
A
B
S Sample complementary base-pairing:
T DNA RNA
R
5’ AATTTGCGTATGCGTGACGTG 3’ 5’ AGCGAUAGCUAGCUGGCAGC 3’
A 3’ UCGCUAUCGAUCGACCGUCG 5’
3’ TTAAACGCATACGCACTGCAC 5’
C
T
I B. Sugars
O
N Both types of sugar of each nucleic acid is a A
pentose. The sugar component of RNA is D-ribose.
In DNA, it is 2-deoxy-D-ribose. The full name of
ẞ-D-ribose is ẞ -D-ribofuranose and that of ẞ -2-
deoxy-D-ribose is ẞ -2-deoxy-D-ribofuranose.
B

C. Phosphates
Phosphate is an anion, salt, functional group or
ester derived from a phosphoric acid. The third
component of nucleic acids is phosphoric acid. When
this group forms a phosphate ester bond with a
nucleoside (base-sugar), the result is a compound Figure 1.9 Sugars of
(A) DNA; and (B)
known as a nucleotide.
RNA

Figure 1. Structure of
phosphate group in a
nucleic acid

Enabling Task: Nucleic Acids

Let’s do the following task. Please do not sneak for an answer

yet. You may check the correct answers only after you have
answered all questions. Correct answers are found at the last page
of the lesson. Don’t forget to read the direction. Good luck! 😊

Direction: Answer all questions and instructions below.

1. Draw a simplified structure of DNA showing the base, sugar, and phosphate
group. Color your nitrogenous bases: (Adenine= blue, Thymine= red;
A Cytosine= orange, Guanine= green
B
S
T
R
A
C
T
I 2. Make a venn diagram to compare and contrast the structure and function of
O DNA and RNA.
N
DNA RNA

Function:
Function:

Structure:

Sugar: Sugar:
Base: Base:

Function:

No. Of strand: No. Of strand:

Location:
Location:

3. Write the complementary base-pairs of the following DNA and RNA

sequences.

a. DNA sequence

3’ A C G T C G G C C T A C G 5’
5’ 3’

b. RNA sequence

A 3’ C G C G A U A C G U C A G 5’
B 5’ 3’
S
T
R
A
C Check the correct answers found at the last page of the lesson
T
I
O Thank you for answering! 😊
N

Lesson 1.2.2 CHROMOSOMES

At the end of the topic, you will be able to:

 Describe the function of chromosomes

 Classify the diffferent types of chromosomes
 Illustrate the structure of chromosomes.

Chromosomes are present in all living A

organsims. It is one of the prominent
structures found in the nucleus. It
contains proteins and DNA. It holds the
A DNA which contains genetic materials
B containing the hereditary information.
S The DNA and proteins are packaged to
T make the chromosomes condensed. It is B
R like a condensed thick thread structure. If
A you loosen the thick thread (or the
C chromosome), you will have the tinier
T thread-- in this case, the DNA (Figure
I 1.10).
O
N Figure 1.10 The Chromosomes. A)
Location of chromosomes. B) The
Transmission Electron (TEM) image of an
x-chromosome

Figure 1.11 Parts of a chromosome

Photo Credit: National Human Genome Research Institute

Figure 1.12 Parts of a homologous chromosome

A
Photo Credit: Openstax book: biology-2e
B
S
Parts of the Chromosomes
T
R  Chromatid- One of the two identical parts of chromosomes
A  Centromere- the region at the cell’s constriction point, which may or may not
C be the center of the chromosome. It divides the chromosomes into two section:
T the p arm and the q arm.
I  Kinetochores- part of the centromere where the spindlle fibers attach during
O the anaphase stage of cell division.
N  p arm- the upper arm of the chromosome; or the short arm
 q arm- the lower arm of the chromosome; the long arm
 Synaptonemal complex- a protein complex that forms during meiosis
 Telomere- a repetitive nucleotide sequence cap located at the end end of each
chromosome

E-Visit Corner

TOPIC: Chromosomes
YOU MAY VISIT:
https://www.youtube.co
Figure 1.13 End part of the chromosome. m/watch?v=IePMXxQ-
Telomeres are in color red. KWY
Photo Credit: NCI Center for Cancer Research

Each Kind of Organism has a Different Number of Chromosomes

Table 1. The Chromosome Number of Some Organisms

Common Name Genus and Species Chromosome

Number
Buffalo Bison bison 60
Cat Felis catus 38
Cattle Bos taurus, 60
B. indicus
Dog Canis familiaris 78
Donkey E. asinus 62
Goat Capra hircus 60
A Horse Equus caballus 64
B Human Homo sapiens 46
S Pig Sus scrofa 38
T Sheep Ovis aries 54
R
A Karyotype
C
T Karyotype is a record of the observed characteristics (number, type, shape,
I etc.) of the chromosomes of an individual; or species. In humans, there are 46
chromosomes, which usually occurs in pairs (homologues). Hence, there are 23 pairs.
O
The 23rd pair of chromosomes determine the sex of a person. There are two types of
N
chromosomes based on the shape: The X and Y chromosomes. In the 23rd pair, if the
chromosomes are XX, the sex of a person is female; if XY, the sex is male.

A B

Male Karyotyope Female Karyotyope

Figure 1.14 The Karyotype of Humans: A) Male karyotype B) Female Karyotype
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 40 EducSci 323A Genetics

Chromosome Organization

A
B
Figure 1.15 Organization in chromosomes. A) Loosening the condensed
S chromosomes displays proteins like histones and nucleosomes. Some proteins like
T histones wrap the DNA. B) Chromosome proteins are further coiled. C-D)
R Supercoiled proteins results to a thread-like fiber chromatin: Extended chromatin
A (C); and a more condensed chromatin (D) A compacted condensed chromosome
C resulted after many replications of DNA.
T
I Chromosome Carries a lot of
O genetic information
N

Short length of DNA

Controls inherited
character of the
organism
Figure 1. Chromosomes carrying genes.

A chromosome displays the location of genes, called gene locus (Figure

1). This carries genetic information like the gene for the skin color or the structure
and functions of proteins to be made. A gene is being known as the segment unit of
the DNA carrying traits. Also, the usage of the term “gene” is sometimes denoted
as the “gene locus” of the chromosomes.

Types of Chromososmes

X- X-shaped
Chromosome chromosome

Based on Shapes

Y- Y-shaped
Chromosome chromosome;
Photo credit:
determine the male https://www.pinterest.ph/
sex on the 23rd
chromosome (XY)

Having a single set of Example: One copy

Haploid
A unpaired chromosomes of chromosome
B
Based on Number
S
Diploid Having a pair of each
T type of chromosome, Example: Two
R one of the pair from
copies of
chromosomes
A the ovum and the
C other from
T spermatozoon.
I
O
Sister Each of the two chromatids of
N Chromatid a chromosome
Based on the s
Pairing
Homologous Two chromosomes
Chromosome having the same size,
shape, and gene locus.

centromere approximately in
Metacentric
the middle, such that the two
Based on arms are of similar length
Centromere
Position Submetacentric centromere between one end
and the middle, thus having a
long arm, and a short arm

Centromere very near to one

Acrocentric
end, thus has a long arm, and a
very short arm

Enabling Task: Chromosomes

Let’s do the following task. Please do not sneak for an answer

yet. You may check the correct answers only after you have
answered all questions. Correct answers are found at the last page
of the lesson. Don’t forget to read the direction. Good luck! 😊
Direction: Answer the the following questions and instructions.

1. What is (are) the function(s) of chromosomes?

A
2. Draw the structure of the following types of chromosomes:
B
S
a. Sister Chromatids b. Homologous chromosomes c. Acrocentric
T Chromosome
R
A
C
T
I
O
N

3. Label the parts of a chromosome.

Check the correct answers found at the last page of the lesson

Thank you for answering! 😊

LET’S DO AND DISCOVER!

Was everything clear to you? You may go back to the last

section if there are some concepts that are not yet clear. Read it
again thoroughly. You may visit the E-reading corners for
supplemental readings. If you’re ready, please do the the
following activity.

MODELING THE MOLECULES OF HEREDITY

1. At home, pick two different species of the same family. Capture images of both
species (e.g., dogs). Put the images on the boxes below.
A
P
P
L
I
C
A
T
I Species A: ______________________ Species B: ____________________
O
N 2. List at least three (3) physical characteristics that make these two different
species different from each other (e.g., eye color)

Physical trait 1: _______________________

Physical trait 2: _______________________
Physical trait 3: _______________________

3. Pick at least one (1) physical trait (e.g., eye color). Assign a gene name of the
physical trait on each species—for example, Gene A for Species A; Gene B for
Species B.

Physical Trait 1 for Species A:_________________________

Gene Name: _________________________

Physical Trait 1 for Species B: _________________________

Gene Name: __________________________

4. Draw a chromosome structure of each species where your hypothetical gene is

located. Label the hypothetical gene on your chromosome of each species (e.g.,
gene A for the hair color of Species A)

A
P
P
L
I Chromosome of Species A Chromosome of Species B
C
A
5. Loosen your chromosome. Draw the DNA on your chromosome showing the
T
complementary nitrogenous bases
I
O
N

6. Encircle a segment in the DNA as your hypothetical gene. Write the sequence
of the nitrogenous bases of DNA on the box below. Do not forget to write the
complementary bases.

Analysis:

1. Based on the activity, what is your own definition of gene?

A
P
P 2. What do you think is the relationship between the gene, DNA, and
L chromosomes?
I
C
A
T
I
O
N

3. In your own words, compare and contrast the gene, DNA, and chromosomes.

Sum It Up!
 Genes are the segment of DNA which is the unit of heredity.
 Deoxyribonucleic acid or DNA is a type of nucleic acid which stores genetic
information. It consists of a repetitive unit of monomers called nucleotides.
Nucleotides are the building blocks of DNA which are composed of sugar,
nitrogenous base (Adenine, Thymine, Cytosine, Guanine), and phosphate group.
 Ribonucleic acid or RNA is another type of nucleic acid consist of repetitive units
of nucleotides. It plays a major role in the synthesis of proteins
 DNA and RNA differ in structure and function. DNA is a double helix molecule,
while RNA is a single stranded molecule. DNA has a deoxyribose sugar while RNA
has a ribose sugar. DNA has nitrogenous bases of Adenine (A), Thymine (T),
Cytosine (C), and Guanine (G), while in RNA, although it also has the A, C, G, the
thymine is replaced by Uracil. In terms of their function, DNA plays a major role
in storing genetic information. it is where the gene, the unit of heredity, are found;
while RNA plays a major role in the synthesis of proteins.
 Both DNA and RNA nitrogenous bases has rules in complementary base pairing:
Adenine always pairs with Thymine (or Uracil in RNA), and Cytosine always pairs
with Guanine. Pyrimidine (C, T) always pairs with purine (A, G).
 Chromosomes are structures found in the cell’s nucleus. It is a condensed form of
a thread-like structure which houses DNA and proteins like histones and
nucleosomes.
 Genes, DNA, and RNA are important molecules of heredity. Genes, the unit of
heredity, are segments of DNA. DNA stores genetic information which can be
found in the chromosomes.

LESSON POST- TEST

How Much Have You Learned?
How much have you learned from the previous readings and
activities? This time, we will have our evaluation. Read the directions
carefully. Good luck! 😊

Name: ______________________________ Date: _

Course, Year, and Section: ________________________ Rating: __________

Worksheet 1.2 Genes, DNA, and Chromosomes: Intro to Heredity

Direction: Write the letter of the correct answer. If you want to change your
answer, please mark X the previous answer and change it with the final answer.
Then, write your explanation for your answer. Points will not be valid if there is no
explanation. (2 points in each item number)
1. Which of the follwing best defines deoxyribonucleic acid (DNA)?
A. DNA is a segment of gene.
B. All segments of DNA contains expressed genes.
C. DNA is a type of nucleic acid containing nucleotides arranged in a wavy,
single strand
D. DNA molecule is composed of two long chains of nucleotides arranged in a
double helix.
Answer:
Explanation:

2. What do you call the “building blocks” of both DNA and RNA?
A. nitrogenous bases
B. nucleotides
C. genes
D. amino acids
Answer:
Explanation:

3. What is the appearance of struture of DNA in eukaryotic cells?

A. wavy single strand.
B. double helix
C. letter U
D. letter S

Answer:
Explanation:

4. Which of the following is correct about the pairing of nitrogenous bases in

nucleic acids?
A. Adenine always pairs to Uracil
B. Cytosine and Guanine has a covalent double bond.
C. The type of bond between all types of nitrogenous bases are hydrogen bonds.
D. Adenine always pairs to Thymine

Answer:
Explanation:

5. Which of the following is true about the major function of RNA?

A. synthesis of protein.
B. convey genetic information to offspring
C. transport amino acids to other cells
D. mediate cell recognition

Answer:
Explanation:

6. All of the following nitrogenous bases are found in DNA EXCEPT ________.
A. thymine
B. adenine
C. guanine
D. uracil
Answer:
Explanation:

7. What is the difference of sugar in DNA to that of sugar in RNA?

A. The sugar of DNA contains one less oxygen atom than RNA.
B. The sugar of DNA is five-membered ring while RNA is six-membered ring
C. Only the sugar of DNA can bond to phosphate group
D. The sugar of DNA is ribose while RNA is deoxyribose

Answer:
Explanation:

8. Of the following statements, which best summarizes the structural differences

between DNA and RNA?
A. The structure of sugar in DNA is different in RNA.
B. RNA is a double helix, but DNA is single-stranded.
C. DNA has a different phosphate group than RNA
D. NA is a protein, whereas RNA is a nucleic acid.

Answer:
Explanation:

9. Which of the following best define the homologous chromosomes?

A. A pair of chromosomes with same size but different centromere position
B. A pair of chromosomes with same shape but different size and different
centromere position
C. A pair of chromosomes with the same shape, size, and centromere position
but with different staining pattern
D. A pair of chromosomes with the same shape, size, centromere position, and
staining pattern

Answer:
Explanation:

10. Which of the following is true about the base-pairing in RNA?

A. Cytosine always bonds to Adenine
B. Cytosine always bonds to Uracil
C. Guanine always bonds to Adenine
D. Adenine always bonds to Uracil

Answer:
Explanation:

11. What would be the complementary strand if the sequence of bases in one strand
of DNA molecule is 3'TAACGT5'?
A. 3'UAACGU5'
B. 5'UAACGU3'

C. 5'ATTGCA3'
D. 3'ATTGCA5”

Answer:
Explanation:

12. Which of the following statements about genes is NOT correct?

A. Genes contain the information needed to synthesize proteins
B. During fertilization, both the sperm and the ovum contribute genes to the
resulting fertilized egg.
C. Under normal circumstances, each chromosome contains precisely one gene.
D. Genes correspond to segments of DNA.

Answer:
Explanation:

13. How do the two members of a pair of homologous chromosomes differ from
each other?
A. the precise sequence of the DNA within each of the chromosomes
B. the centromere position of each chromosome
C. the relative position of the genes present on each of the chromosomes
D. the staining patterns of each chromosome

Answer:
Explanation:

14. Which of the following bests define a chromatid?

A. a replicated chromosome
B. a synonym of centromere
C. a chromosome in the cytoplasm rather than in nucleus
D. It doesn’t contain genetic information

Answer:
Explanation:

15. How many chromosomes are their in humans?

A. 42 chromosomes
B. 44 chromosomes
C. 21 pars of chromosomes
D. 23 pairs of chromosomes

Answer:
Explanation:

Part II. Answer the following questions.

1. How are genes important to heredity?

2. In your own words, illustrate and explain the relationship between the gene,
DNA, and chromosomes.

3. Compare and contrast DNA and RNA in terms of:

a. Function
b. Location in the cell
c. Structure:
 Number of strands
 Type of sugar
 Type of base

Self-Reflect
1. Recall and reflect on the structure and fuction of the molecules of heredity—the
genes, DNA, and chromosomes. Then, write an appreciation letter to your DNA.
Relate it to the structure and function of the genes, and chromosomes. Write 3 to
5 paragraphs.

Appreciation Letter:
Date: _________________
Dear DNA,
_____________________________________________________________
____________________________________________________________________
____________________________________________________________________
____________________________________________________________________
____________________________________________________________________
____________________________________________________________________
____________________________________________________________________
____________________________________________________________________
____________________________________________________________________
____________________________________________________________________
____________________________________________________________________

Sincerely Yours,
___________________________________

Self-Rating Competency Checklist

.
Please rate yourself by checking the following Learning
Comptency cheklist. 😊

I I can do I can do I can do

Learning Competencies cannot this but this this very
(Knowledge, Skills, Values) do this I need to confidently well and
yet learn can teach
more other
Describe the function of genes.
Illustrate the structure of nucleic acid
DNA.
Compare and contrast the structure of
nucleic acids DNA and RNA.
Write the complementary base-pairing in
DNA and RNA
Illustrate the structure of chromosomes
Connect the relationships between genes,
nucleic acid DNA, and chromosomes
based on their location and function.
Write an appreciation letter to the
molecules of heredity.

Self-Rating Journal

Based from the previous readings and assessments, please

write a short self-rating reflection. Highlight on what you know
already, what you don’t know yet, and what to improve. Compare
_ your self-rating checklist during the lesson pre-test and post-test.
Use the self-rating competency checklist above as your guide. 😊
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
______________________________________________________________________________________

Answer Key
LESSON PRE-TEST
1) Genes are the segment of DNA in an organism. It is the unit of heredity.
It predetermines the character traits of the offspring.

2) Labelling:
1. Nucleus 2. Chromosomes 3. DNA 4. Histone proteins 5. Nucleosomes

3) 5’ T A C C G T G A 3’
LET’S PRACTICE YOUR VOCABULARY
1. CENTROMERE 6. HOMOLOGOUS CHROMOSOMES
2. CHROMOSOME 7. NUCLEIC ACIDS
3. DEOXYRIBONUCLEIC ACID 8. RIBONUCLEIC ACIDS
4. DEOXYRIBOSE 9. RIBOSE
5. GENES 10. SISTER CHROMATID

ENABLING TASK 1: NUCLEIC ACIDS

1.
Adenine p
Phosphate
group
Nitrogenous
base Deoxyribose
sugar
A nucleotide

2. RNA
DNA

Function: stores Function: major player in

genetic information the transcription and
Structure: translation process of
*Both have protein synthesis
nucleotides Sugar: Ribose
Sugar: Deoxyribose (phosphate, sugar,
Base: Thymine is only base) with few Base: Uracil is only
found in DNA differences found in RNA
*Bases contain
Adenine, Cytosine,
No. Of strand: two No. Of strand: single
Guanine
strands strand
Function: both
are players in Location: cytoplasm
Location: nucleus’
protein and ribosomes; some
chromosome; few in
synthesis in nucleus
mitochondria

3.
a 5’ T G C A G C C G G A T G C 3’

b. 5’ G C G C U A U G C A G U C 3’

ENABLING TASK 2: CHROMOSOMES

1. Chromosomes holds the DNA, histone, nucleosome and other proteins. It holds
molecules that stores genetic information.
2.

Sister chromatids Homologous Acrocentric

chromosome chromosome
3.
1. Telomere 3. Centromere 5. Telomere
2. P-arm 4. q arm

2
MEOSIS AND SEXUAL
Unit
LIFECYCLES

Lesson 2.1 The

Process of Meiosis
Lesson 2.2 Sexual
Lifecycles

Photo credit: pinterest.com

O ne of the characteristics of an organism is its ability to

reproduce. There are two modes of reproduction: The asexual
reproduction and sexual reproduction. The asexual reproducion is a form
of reproduction that does not involve the fusion of gametes (or egg and
sperm cells). An example is the binary fission of an E. coli bacteria. On
the contrary, the sexual reproduction involves the union of sex cells (or
2 WEEKS gametes) — for example, the mode of reproduction in humans. It is the
1st session process in which a new organism with the combination of genetic
Lesson 2.1 materials of two organisms. In this unit, we will focus more on organisms
(1 week) that reproduce sexually.
The sexual life cycle of an organism starts when there is the union
2nd session
of sex cells. The union of these cells produce a diploid organism. In
Lesson 2.2
humans, for example, it contains 23 pairs of chromosomes (a total of 46
(1 week) chromosomes). To maintain this number of chromosomes, the number of
chromosomes for sex cells should be half (or haploid). This is achieved
through the process of a special type of cell division called meiosis. In
this unit, we will tackle how organisms produce haploid sex cells or
gametes; how the chromosomes of gametes, which carry genetic
materials, behave during meiosis; and how the exact number of
chromosomes is maintained in a newly produced unique organism.
Also, we will tackle abuout the sexual lifecyles of the different
types of sexually reproducing organisms.
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 56 EducSci 323A Genetics

Lesson 2.1 The Process of Meiosis

1 week

Topic Learning Outcomes

After going through the lesson, you will be able to:

1. Describe the behavior of chromosomes during meiosis.

2. Explain the mechanisms within the meiotic process that produce genetic
variation among the haploid gametes.
3. Create an instructional video to execute the stages of Meiosis.
4. Write a reflective essay on the role of meiosis in genetics diseases.

Introduction

T he exact number of
chromosomes in an organism is crucial to
maintain and continue its existence. In
humans, the number of chromosomes is 46
(that is, 23 pairs). The first 22 pairs are body
chromosomes (also called autosomes) from
body cells (also called somatic cells) except
sex cells. The 23rd chromosomes are the sex
chromosomes from sex cells-- the egg and
sperm cells (also called gametes). The
excess or lacking number of chromosomes
results in a genetic disease; an example is
Figure 2.1 Couple with downsyndrome
Down Syndrome in humans having an extra
celebrate 22 years of Happy marriage
number of chromosomes (Figure 2.1)
The union of the sperm and egg cell Source: People.com
results to a diploid zygote having 46
chromosomes carrying genes from the chromosomes before the union—a term
mother and father. This zygote undergoes called haploid. There is a special type of
several body cell divisions to grow, cell division which produces haploid sex
differentiate, and develop into a full-grown cells. This process is called meiosis.
human in a process called mitosis. Since the How these sex cells become haploid to
human zygote is diploid, both sperm cells maintain the number of the exact
and egg cells should have half of its chromosomes in an offspring is the
number or having a single set of pair of subject in this lesson.
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 57 EducSci 323A Genetics

LESSON PRE-TEST
What Do You Already Know?
What do you already know about Meiosis? Before going
through the lesson, please check your background by answering the
following activity. Do not sneak for an answer yet. You may check
the correct answers only after you have answered all questions.
Correct answers can be found at the last page of the lesson. Don’t
forget to read the direction. 😊

A. True or False. Write TRUE if the statement is correct, and write FALSE if the
statement is incorrect then write the correct answer.
1. After the complete process of meiosis, this results to four diploid daughter cells.
2. One of the uniqueness of meiosis that is not in mitosis, is that meiosis produces
gametes.
3. Meiosis and mitosis both undego cytokinesis.
4. Crossing over occurs during the Prophase II stage of Meiosis.
5. Crossing over is the exchange of chromosome segments between non-sister
chromatids.

B. Label the stages of Meiosis. Describe each stage briefly.

Describe each stage briefly.

Meiosis I:
1.
2.
3.
4.

MEIOSIS II

Explanation
Meiosis II:
1.
2.
3.
4.

Check the correct answers found at the last page of the chapter

Thank you for answering! 😊

Self-Rating Competency Checklist

After answering the lesson pre-test, please rate yourself by

checking the following Learning Comptency cheklist. 😊

I I can do I can do I can do

Learning Competencies cannot this but this this very
(Knowledge, Skills, Values) do this I need to confidently well and
yet learn can teach
more other
Describe the behavior of
chromosomes during meiosis.
Explain the mechanisms within
the meiotic process that produce
genetic variation among the
haploid gametes.
Create an instructional video to
execute the stages of Meiosis.
Write a reflective essay on the
role of meiosis in genetics
diseases.

Self-Rating Journal

Based from the lesson pre-test, please write a short self-

rating reflection. Highlight on what you know already, what you
don’t know yet, and what to improve. Use the self-rating
competency checklist above as your guide. 😊

I cannot I can do I can do I can do this

_______________________________________________________________________________________
Learning Competencies do this this but I this very well and
_______________________________________________________________________________________
(Knowledge, Skills, Values) yet need to confidently can teach
learn more
_______________________________________________________________________________________ other
Describe the behavior of
_______________________________________________________________________________________
chromosomes during meiosis.
_______________________________________________________________________________________
Explain the mechanisms within
_______________________________________________________________________________________
the meiotic process that produce
_______________________________________________________________________________________
genetic variation among the
______________________________________________________________________________________
haploid gametes.
Create an instructional video to
execute the stages of Meiosis.
-----------------------------------------------------------------------------------------------------------------------------------------
Write aThis
reflective
handoutessay on the only for the use of students who take Genetics course.
is intended
role of meiosis in genetics NOT FOR SALE.
diseases.
Page 60 EducSci 323A Genetics

LESSON PROPER

Let’s start our lesson. You have a suggested time allotment of 3

LESSON PROPER
hours to finish all the readings, activities, and assessments. That is
only a suggested time frame. You may answer all the activities at
your most convenient time. Do not forget to read all instructions.
Happy reading! 😊

Let’s start our lesson. You have a suggested time allotment of 2 1/2
hours
LET’StoPRACTICE
finish all the readings,
YOUR activities, and assessments. That is
VOCABULARY!
only a suggested time frame. You may answer all the activities at
your most convenient
Direction: time.
I have here keyDo not forget
words for ourtolesson.
read all instructions.
Fill the missing letters to complete
the correct word. Happy reading! 😊

1. ATOSME  any chromosomes other than sex chromosomes

2. CEL DVISO  a process in which a cell divides into two cells

3. C__RO__OS__ME  a structure in the cell nucleus that contains DNA, histone
V proteins and other structural proteins
O
4. DI__LOI__  of a cell, having a pair of each type of chromosome, one of the pair
C
being derived from the ovum, the other form spermatozoon
A
B 5. GAME__E  a reproductive cell (sperm in males or eggs in females), having only
U half of a complete set of chromosomes
L
6. H__PL__I__  having a set of unpaired chromosomes
A
R 7. ME__O__IS  cell division of a diploid cell into four haploid cells, which
Y develop to produce gametes
8. MI__OS__S  a type of cell division in most body cells except sex cells. It is the
division of the cell nucleus in which the genome is copied and
separated into two identical halves. It is normally followed by
ell division
9. __EX __E__L  reproductive cells (sperm in male and eggs in female; also called
gametes
10. SO__AT__C CE__L  any type of body cells except sex cells

Check the correct answers found at the last page of the lesson

-----------------------------------------------------------------------------------------------------------------------------------------
This handout
Check the is intended
correctonly for the
answers use ofatstudents
found the last who
pagetake Genetics
of the lessoncourse.
NOT FOR SALE.
Page 61 EducSci 323A Genetics

L
LET’S GET STARTED!

A
C 1. Paste the family photo of the previous activity from the last lesson (in Lesson
T 1.2)
I 2. List at least 1 obvious physical trait the child inherits from the Mother and 1
V obvious physical trait the child inherits from the father.
I
Physical trait inherited from Mother: ________________________
T
Y Physical trait inherited from Father: __________________________

3. There are two homologous chromosomes (long and short) in the circle below.
Color one of the chromosomes in a homologous chromosome pair as red
(from Mother) the other chromosome, blue (from father). Do the same in the
short homologous chromosomes.
In a blue long chromosome, put a stain or segment for the gene of a physical
trait inherited from Father. Label it. In a red short chromosome, put a stain or
mark for the gene of a physical trait inherited from Mother. Label it.

4. Consider the circle (where the chromosomes are located) as a sex cell. (Put your
gene mark in the chromosome in each division).
On your own, conclude the results after some divisions of the sex cell by asnwering
the following:
a. Separate all homologous chromosomes into sister chromatids. In one cell, draw
and color the long short sister chromatids. Do the same on the other cell.

A
C
T
I
V
I b. Paste the result above on the circles below. Separate the sister chromatids
T into individual chromatids. Each cell should compose one long chromatid
Y and one short chromatid.

LET’S THINK AND REFLECT!

Based from the previous activity:

1. During the process of the cell division, what happened to your gene
segments in the chromosome?

2. During the process of the cell division, what happened to the homologous
A chromosomes? the sister chromatids?
N
A
L
Y
S
I
S
3. How does the diploid cell reduced into haploid?

Getting There...
Sex cells (or gametes) such as sperm cell and egg cell should be in
haploid form, so that after the union of these cells, the exact number of dipliod
chromsome of the offspring will be maintained. To reduce the sex cells into
haploid form, it should undergo a series of special type of cell division. This
special type of cell division that reduces the sex cell into haploid cell is called
Meiosis.
What you have just did in the previous activity is an overview on how
the sex cells divide and how the chromosomes behave during Meiosis. In the
next section, let’s dig deeper the process of Meiosis.

LET’S GET TO KNOW MORE!

Overview of Meiosis
LET’S GET TO KNOW MORE!
Meiosis is a type of cell division
wherein the number of chromosome
sets is reduced from diploid to haploid.
It has two stages of cell division: (1)
Meiosis I and Meiosis (II). In the first
A cell division (meiosis I), homologous
B chromosomes separate. It results in two
S haploid daughter cells with replicated
T chromosomes; it is called the
R reductional division. In the second
A cell division (meiosis II), sister
C chromatids separate. It results in four
T haploid daughter cells with
I unreplicated chromosomes; it is called
O the equational division. (Figure 2.1)
N
Meiosis I is preceded by interphase, in
which chromosomes are replicated to
Overview
form sister of chromatids.
Meiosis The sister
chromatids are genetically identical and
joined atMeiosis is a type (Figure
the centromere. of cell division
2.1) Photo Credit: 2008 Pearson Education, Inc., publishing
wherein the number of chromosome sets is
as Pearson Benjamin Cummings
reduced from diploid to haploid. It has two
Figure 2.1. General Overview of the
stages of cell division: (1) Meiosis I and
behavior of chromosomes during Meiosis
Meiosis (II). In the first cell division (meiosis
Photo Credit: 2008 Pearson Education, Inc., publishing
Overview of Stages
I), homologous of Meiosis:separate.ToItremember
chromosomes Figure 2.1.
the stages
as Pearson ofGeneral
Benjaminmeiosis Overview
easily,
Cummings of the
use an acronym.
results in two haploid daughter cells with (e.g., PMAT)
behavior of chromosomes during Meiosis
replicatedI chromosomes;
Meiosis it is II
Meiosis called the
reductional division. In the second cell
Prophase
division I
(meiosis Prophase
II), sister II
chromatids E-Visit Corner
separate. It results in four haploid daughter To remember the stages of meiosis easily, use an acronym.
Metaphase I Metaphase (e.g.,
II TOPIC: Meiosis
cells with unreplicated chromosomes; it is PMAT)
Anaphase
called I
the equational Anaphase
division. (Figure 1)II GO TO:
https://www.youtube.c
Telophase I Telophase II om/watch?v=qCLmR9-
YY7o

Stages of Meiosis
Meiosis I
In the first cell division (meiosis I), homologous chromosomes
separate. It results in two haploid daughter cells with replicated
chromosomes; it is called the reductional division.

A
B
S
T
R
A
C Photo Credit: 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings
Figure 2.2. The stages of Meiosis I.
T
I Prophase I Prophase I typically occupy more than 90% of the time required for
meiosis. In this stage, chromosomes begin to condense. Other important
O
events during Prophase I includes synapsis and crossing over. In
N
synapsis, homologous chromosomes loosely pair up, aligned gene by
gene. In crossing over, nonsister chromatids exchange DNA segments.
Each pair of chromosomes forms a tetrad, a group of four chromatids.
Each tetrad usually has one or more chiasmata, X-shaped regions where
crossing over occurred.
Metaphase Tetrads line up at the metaphase plate, with one chromosome facing
I each pole. Microtubules from one pole are attached to the kinetochore
of one chromosome of each tetrad. Microtubules from the other pole are
attached to the kinetochore of the other chromosome
Anaphase Pairs of homologous chromosomes separate. One chromosome moves
I toward each pole, guided by the spindle apparatus. Sister chromatids
remain attached at the centromere and move as one unit toward the pole
Telophase In the beginning of telophase I, each half of the cell has a haploid set of
I chromosomes; each chromosome still consists of two sister chromatids
Cytokinesis Cytokinesis usually occurs simultaneously, forming two haploid
daughter cells. In animal cells, a cleavage furrow forms; in plant cells, a
cell plate forms.

In the second cell division (meiosis II), sister chromatids separate. It

Meiosis II results in four haploid daughter cells with unreplicated
chromosomes; it is called the equational division.

A
B
S
T
R
A
C
T
I
O
Photo Credit: 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings
N
Figure 2.3 Stages of Meiosis II

Prophase II In prophase II, a spindle apparatus forms. In late prophase II,

chromosomes (each still composed of two chromatids) move
toward the metaphase plate
Metaphase II In metaphase II, the sister chromatids are arranged at the metaphase
plate. Because of crossing over in meiosis I, the two sister
chromatids of each chromosome are no longer genetically
identical. The kinetochores of sister chromatids attach to
microtubules extending from opposite poles
Anaphase II In anaphase II, the sister chromatids separate. The sister chromatids
of each chromosome now move as two newly individual
chromosomes toward opposite poles
Telophase II In telophase II, the chromosomes arrive at opposite poles. Nuclei
form, and the chromosomes begin decondensing
Cytokinesis Cytokinesis separates the cytoplasm. At the end of meiosis, there
are four daughter cells, each with a haploid set of unreplicated
chromosomes. Each daughter cell is genetically distinct from the
others and from the parent cell
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 67 EducSci 323A Genetics

Comparing Meiosis and Mitosis

Meiosis and mitosis are types of cell division. Meiosis occurs in sex cells (or
gametes). The process is important to maintain the number of chromosomes in
offsprings, necessary for the continuity of life. Mitosis occurs in all types of body cells
(or somatic cells). The process is improtant for growth, development, and repair.

A
B
S
T
R
A
C
T
I
O
N Photo Credit: 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings
Figure 2.4 Difference between Meisosis and Mitosis
Table 1. Differences between meiosis and mitosis.
Property Mitosis Meiosis
DNA replication Occurs during interphase Occurs during interphase before
before mitosis begins meiosis I begins
Number of divisions One Two
Occurs during prophase I along with
Synapsis of Does not occur crossing over between nonsister
homologous chromatids; resulting chiasmata hold
chromosomes pairs together due to sister chromatid
cohesion
Number of Two, each diploid (2n) and Four, each haploid (n), containing half
daughter cells genetically identical to the as many chromosomes as the parent
and genetic parent cell cell; genetically different from the
composition parent cell and from each other
Enables multicellular adult to Produces gametes; reduces number of
Role in the arise from zygote; produces chromosomes by half and introduces
animal body cells for growth, repair, and, genetic variability among the gametes
in some species, asexual
reproduction

LET’S DO AND DISCOVER!

Was everything clear to you? You may go back to the last section
if there are some concepts that are not yet clear. Take note of some
important facts and ideas. You may visit the E-reading corners for
supplemental readings. If you’re ready, please do the the following
activity.

Create a 15-minute instructional Tiktok song-and-dance video to illustrate the

process of meiosis. Highlight on the following: behavior of chromosomes during
each stage of Meiosis.
 Describe the behavior of chromosomes during meiosis.
 Describe the cellular events that take place during meiosis.
A  Explain the mechanisms within the meiotic process that produce genetic
P variation among the haploid gametes.
P  Apply the importance of meiosis to sexual lifecycle in humans (or other
L organisms)
I
C Please check the rubrics for rating
A
T
I
O
N

Sum It Up

 Meiosis is a special type of cell division the produces sex cells (or
gametes) with a haploid set of chromosomes.
 There are two stages of Meiosis: Meiosis I and Meiosis II.
 Meiosis I has 4 stages:
o PROPHASE I- Chromosome begins to condense; synapsis and
crossing over occurs; Each pair of chromosomes form a tetrad
o METAPHASE I- tetrad line up at the metaphase plate
o ANAPHASE I- Pairs of homologous chromosomes separate toward
each pole
o TELOPHASE I- sister chromatids are in the opposite poles; each
chromosome still consists of sister chromatids
 MEIOSIS II has 4 stages:
o PROPHASE II- spindle apparatus form; sister chromatids move
towards the metaphase plate
o METAPHASE II- sister chromatids are arranged at the metaphase
plate
o ANAPHASE II- Sister chromatids separate
o TELOPHASE II- Chromosome are at opposite poles. Cells contain
haploid sets of chromosomes.
 In terms of function, mitosis and meiosis have differences. Mitosis is
involved in the growth and renewal of cells. It occurs in somatic cells (or
body cells). It produces identical cells. In humans, it produces cells with a
diploid sets of chromosomes. Meiosis is a special type of cell division that
produces sex cells. It produces cells with a haploid set of chromosomes.

LESSON POST-TEST
How Much Have You Learned?
How much have you learned from the previous readings
and activities? This time, we will have our evaluation. Read the
directions carefully. Good luck! 😊

Name: _____________________________________ Date:

Course, Year, and Section: _____________________________ Rating: _______

Worksheet 2.1. The Process of Meiosis

I. Multiple Choice
Direction: Write the letter of the correct answer. Provide an explanation. Point
are not valid without an explanation. (2 points)

1. Which of the following is true about meiosis?

A. The complete process results to four haploid daughter cells
B. There is a production of identical daughter cells
C. It enables multicellular adult arise from zygote
D. It results to four genetically identical daughter cells to its parents

Answer:
Explanation:

2. The following differentiates the the functions of meiosis with mitosis,

EXCEPT
A. Meiosis produces gametes
B. Meiosis reduces number of chromosomes by half
C. Meisos introduces genetic variability among the gametes
D. Meiosis promotes asexual reproduction

Answer:
Explanation:

3. Which of the following best states wherein Mitosis and Meiosis share in
common?
A. Number of divisions
B. Synapsis of homologous chromosomes
C. Number of daughter cells
D. Both undergo cytokinesis
Answer:
Explanation:

4. Which stage in Meiosis where the exchange of DNA segements of non-sister

chromatids occurs?
A. Prophase I
B. Prophase II
C. Metaphase I
D. Anaphase II
Answer:
Explanation:

5. You view a meitoc cell in a light microscope. You saw tetrads lined up at the
center of the cell. What stage of meiosis it is?
A. Propahase I
B. Metaphase I
C. Metaphase II
D. Anapahase I
Answer:
Explanation:

II. Direction: Refer to the drawings in the figure below of a single pair of
homologous chromosomes as they might appear during various stages of either
mitosis or meiosis. Answer the following questions. Provide an explanation. (2
points)
A B C
.

D E F

1. Which of the drawing represents metaphase II of Meiosis?_____

Explanation:

2. Which of the drawing represents Prophase I of Meiosis? _____

Explanation:

3. Which of the drawing represents the separation of homologous

chromosomes in Meiosis? Name the stage. ______
Explanation:

4. Which of the drawing represents the exchange of DNA segements? Name

the stage.
Explanation:

5. Figures B and E represents what stage of Meiosis? _______

Explanation:

Self-Reflect
1. Read a Science news on Down Syndrome. Explain on your own what might have
caused the extra chromosomes. Reflect on yourself the importance of Meiosis in
your life. Write 2 to 3 paragraphs.

Self-Rating Competency Checklist

I hope you learned a lot from the lesson. Please rate yourself by
checking the following Learning Comptency cheklist. 😊

I I can do I can do I can do

Learning Competencies cannot this but this this very
(Knowledge, Skills, Values) do this I need to confidently well and
yet learn can teach
more other
Describe the behavior of chromosomes
during meiosis.
Explain the mechanisms within the
meiotic process that produce genetic
variation among the haploid gametes.
Create an instructional video to execute
the stages of Meiosis.
Write a reflective essay on the role of
meiosis in genetics diseases.

Self-Rating Journal

Based from the previous readings and assessments, please write

a short self-rating reflection. Highlight on what you know already, what
you don’t know yet, and what to improve. Compare your self-rating
checklist during the lesson pre-test and post-test. Use the self-rating
competency checklist above as your guide. 😊

______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________

Answer Key
LESSON PRE-TEST
A. TRUE OR FALSE
1. FALSE. Four haploid cells
2. TRUE
3. TRUE
4. FALSE- Prophase I
5. TRUE

B.
MEIOSIS I

1. PROPHASE I- Chromosome begins to condense; synapsis and crossing over

occurs; Each pair of chromosomes form a tetrad
2. METAPHASE I- tetrad line up at the metaphase plate
3. ANAPHASE I- Pairs of homologous chromosomes separate toward each pole
4. TELOPHASE I- sister chromatids are in the opposite poles; each chromosome
still consists of sister chromatids.

MEIOSIS II

1. PROPHASE II- spindle apparatus form; sister chromatids move towards the
metaphase plate
2. METAPHASE II- sister chromatids are arranged at the metaphase plate
3. ANAPHASE II- Sister chromatids separate
4. TELOPHASE II- Chromosome are at opposite poles. Cells contain haploid sets
of chromosomes.

LET’S PRACTICE YOUR VOCABULARY

1. AUTOSOME 6. HAPLOID
2. CELL DIVISION 7. MEOSIS
3. CHROMOSOME 8. MITOSIS
4. DIPLOID 9. SEX CELL
5. GAMETE 10. SOMATIC CELL

Lesson 2.2 Sexual Lifecycles

1 week
1.
Topic Learning Outcomes

At the end of the lesson, you will be able to:

1. Distinguish haplontic life cycle, diplontic life cycle, and alternation of

generations.
2. Determine the haploid and diploid generations in the lifecycle among
sexually reproducing organisms.
3. Sketch the lifecycle among sexually reproducing organisms.
4. Explain the life cycle among sexually reproducing organisms.
5. Write a reflective essay on your own biological life cycle.

Introduction

Sexually-reproducing organisms like

animals and some plants have sexual life cycle.
Two important stages important to this lifecycle
are meiosis and fertilization. Fertilization
involves the union of sperm cell and egg cell. To
recall, the process of meiosis produces sex cells
or gametes and reduces its number of
chromosomes by half.
In human sexual lifecycle, the gametes or
sex cells from each parent unites to form a zygote
through fertilization. These unified cells
undergo a series of mitosis to form a mast of cells,
and eventually differentiates, develop, and grow Photo credit: MyPinterest.com
into a baby. This baby further grows and develop
into a child, a teenager, and an adult human being.
Each type of organism, whether an animal The life cycle of sexually
or a plant, has a different timing of haploid and reproducing organisms, the
diploid generations. In humans, most of its entire difference in timing of meiosis and
life have diploid generations. Only during fertilization, and the haploid and
meiosis or the production of gametes is its diploid stages among these
haploid generation. In plants, it has an alternate organisms are the focus in this lesson.
of diploid and haploid generations.
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 76 EducSci 323A Genetics

LESSON PRE-TEST
What Do You Already Know?

What do you already know about sexual life cycles? Before

going through the lesson, please check your background by
answering the following activity. Please do not sneak for an answer
yet. You may check the correct answers only after you have answered
all questions. Correct answers can be found at the last page of the
lesson. Don’t forget to read the direction. Good luck! 😊

A. Direction: I have herethe lists of sexually reproducing organisms. Deremine

their type of life cycle as to: haplontic, diplontic, and alternation of
generations.

6.
1. Humans Rats
______________ _______________
2. 7.
Fungi Fern
______________ _______________
8.
3. Protists Monkey
______________ _______________

Most Plants 9.
4. Hippopotam
______________ us _______________

5. , Seed- 10. Tiger

bearing ______________ ________________
plants

B. Sketch the life cycle of the following sexually reproducing orgasmisms: (Drawing
of organism is not necessary). Explain briefly.

a. Animals

Description

b. Fungi

Description

c. Plants

Description

Check the correct answers found at the last page of the chapter

Thank you for answering! 😊

Self-Rating Competency Checklist

After answering the lesson pre-test, I want you to rate yourself by

checking the following Learning Comptency cheklist. 😊

I cannot I can do I can do I can do

Learning Competencies do this this but this this very
(Knowledge, Skills, Values) yet I need to confidently well and
learn can teach
more other
Distinguish haplontic and diplontic
lifecycles.
Determine the haploid and diploid
generations in the lifecycle among
sexually reproducing organisms.
Sketch the lifecycle among sexually
reproducing organisms.
Explain the life-cycle among sexually
reproducing organisms.
Write a reflective essay on your own
biological life cycle.

Self-Rating Competency Checklist

Based from the previous activity, please write a short self-rating

reflection. Highlight on what you know already, what you don’t know
yet, and what to improve. Use the self-rating competency checklist
above as your guide. 😊
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
______________________________

LESSON PROPER
Let’s start our lesson. You have 2 hours to finish all the readings,
actitivities, and assessments of the lesson. Please read all
directions carefully.

LET’S PRACTICE YOUR VOCABULARY!

1. AL__ER__ATI__N OF G__NERA__ION  life-cycle type in which the diploid and
haploid stages alternate

2. __IP__OID having a pair of each type of chromosome, one of the pair being
derived from the ovum and the other from the spermatozoon.

3. D__PLONT__C  having a life cycle in which the main form, except for the
gametes, is diploid.
V
O 4. __ER__IL__ZA__ION  a union or joining of two haploid gametes.
C
A 5. G__ME__E__  a reproductive cell having only half of a complete set of
B chromosomes
U
6. __AME__OP__YTE  a plant (or the haploid phase in its lifecycle) which
L
produces gametes by mitosis in order to produce a zygote
A
R 7. HA__LOI__  having a single set of unpaired chromosomes
Y
8. HA__LON__IC  having a life cycle in which the main form is haploid, with a
diploid zygote being formed only briefly.

9. LFCY__LE  the sequence of events in the development of an organism and

the production of cells that produce offspring

10. SOR  a reproductive particle, usually a single cell, released by a fungus,

alga, or plant that may germinate into another

11. SP__R__P__YT__  A plant (or the diploid phase in its life cycle) which
produces spores by meiosis in order to produce gametophytes

12. YGTE  a fertilized egg cell

Check the correct answers found at the last page of the chapter

LET’S GET STARTED!

1. At home, find and capture a photo of the following:

 a young animal and an adult animal. It should be the same kind of
animal (e,g., kitten and cat). Paste your picture in your journal
notebook.
 a seedling or a young plant, and an adult plant. It should be the same
type of plant.

a. Young and adult animals:

A Adult
Young
C
T
I
V
I
T
Y

b. Young and adult plants:

LET’S THINK AND REFLECT!

From the previous activity,

1. What do you think is the young plant or seedling you’ve collected, a haploid
or a diploid organism? Why did you say so? How about the adult plant?

A
N
A
L
Y
S 2. What do you think is the young animal you have choosen, a haploid
I organism or a diploid organism? Why did you say so? How about the adult
animal?
S

Getting There...
Sexually reproducing organisms like plants and animals have have haploid
and diploid stages in its life cycle. The seedling or young plant and the adult plant
you’ve chosen are in diploid stages in its lifecycle; so they are diploid organisms.
The young and adult animals you’ve chosen are in diploid stages in its lifecycle;
so they are diploid organisms too.
To continue life, the diploid type of chromosomes in these organsisms
should be reduced by half through meisosis to produce gametes—which is the
haploid stage of the lifecycle of an organasism. Gametes should be in haploid form
so that during fertilization (or union of gametes), the exact number of
chromosomes will be maintained.
However, each type of sexually reproducing organism has a different
timing of haploid and diploid stages as well as the timing of alteration of meiosis
and fertilization. Let’s get to know more!

LET’S GET TO KNOW MORE!

Overview of Sexual Lifecycles

A lifecycle includes a series of stages that occurs in organisms. In sexually
reproducing organisms, (or the organisms that undergo sexual reproduction) such as
animals, plants, and fungi, they undergo the alternation of two important stages:
A meiosis and fertilization. Meiosis is a process that reduces the chromosome number
B by half. Fertilization restores the chromosome number (or become diploid) when
S the gametes or sex cells (which are both haploid) unite. The union of these gametes
T results to a zygote, which has already a diploid chromosome number. This zygote
R rapidly divides, differentiate and develop from a mass of cells to a complete human
A with whole body parts through a process of mitosis.
C
T
I
O
N

Figure 2.2.1. General stages of a life cycle in sexually reproducing organisms.

The Variety of Sexual Life

Cycles
The alternation of meiosis and fertilization is common to all organisms
that reproduce sexually. These organisms differ on the timing of meiosis and
fertilization. Some sexually reproducing organisms have multicellular diplod stage
that is most obvious, some have multicellular haploid stage that is most obvious.
Let’s take a look at the timing of meiosis and fertilization, and the most obvious
haploid or diploid stages of the sexually reproducing organisms: (a) animals; (b)
plants and some algae; and (c) fungi and other protists.

Sexual Life Cycle Based on Ploidy

Ploidy refers to the number of homologous sets of chromosomes. It can be

diploid or haploid. To recall, diploid have a pair of each type of c hromosome, one
from the mother, and one from the father. Haploid has a single set of chromosome.
The type of lifecyces in sexually reproducing organisms depend on the the ploidy stage
their life mostly spend--either haploid or diploid. They can be diplontic, haplontic, or
alternation of generation.

a. Diplontic Life Cycle

In a diplontic life cycle, the majority of the organism's life is spent with most
A of the cells in the body being diploid. The only cells that have half the number of
B chromosomes, or are haploid, are the gametes (sex cells). Most organisms that have
S a diplontic life cycle start from the fusion of two haploid gametes. One of the
T gametes comes from a female and the other from the male. This coming together of
R the sex cells creates a diploid cell called a zygote.
A Since the diplontic life cycle keeps most of the body cells as diploid, mitosis
C can happen to split the zygote and continue splitting future generations of cells.
T Before mitosis can happen, the cell's DNA is duplicated to make sure the daughter
I cells have two full sets of chromosomes that are identical to each other.
The only haploid cells that happen during a diplontic life cycle are gametes.
O
Therefore, mitosis cannot be used to make the gametes. Instead, the process of
N
meiosis is what creates the haploid gametes from the diploid cells in the body. This
ensures that the gametes will have only one set of chromosomes, so when they fuse
again during sexual reproduction, the resulting zygote will have the two sets of
chromosomes of a normal diploid cell.

Example: Most animals, including humans, have a diplontic sexual life cycle.

b. Haplontic Life Cycle

Cells that spend the majority of their lives in a haploid phase are considered to
have a haplontic sexual life cycle. In fact, organisms that have a haplontic life cycle
are only composed of a diploid cell when they are zygotes. Just like in the diplontic
life cycle, a haploid gamete from a female and a haploid gamete from a male will fuse
to make a diploid zygote. However, that is the only diploid cell in the entire haplontic
life cycle.

The zygote undergoes meiosis at its first division to create daughter cells that
have half the number of chromosomes compared to the zygote. After that division,
all of the now haploid cells in the organism undergo mitosis in future cell divisions
to create more haploid cells. This continues on for the organism's entire life cycle.
When it is time to sexually reproduce, the gametes are already haploid and can just
fuse with another organism's haploid gamete to form the zygote of the offspring.

Example: Fungi, some protists, and some plants

C. Alternation of Generation
A
B The final type of sexual life cycle is a kind of mix of the two previous
S types. Called alternation of generations, the organism spends about half of its
T life in a haplontic life cycle and the other half of its life in a diplontic life cycle.
R Like the haplontic and diplontic life cycles, organisms that have an alternation
A of generations sexual life cycle begin life as a diploid zygote formed from the
C fusion of haploid gametes from a male and a female.
T
The zygote can then either undergo mitosis and enter its diploid phase,
I
or perform meiosis and become haploid cells. The resulting diploid cells are
O
called sporophytes and the haploid cells are called gametophytes. The cells
N
will continue to do mitosis and split in whichever phase they enter and create
more cells for growth and repair. Gametophytes can then once again fuse to
become a diploid zygote of the offspring.

Example: Most plants

Sexual Life Cycle in Animals

A
B
S
T
R
A
C
T
I
O
N Figure 2.1. Sexual Life Cycle in Animals.
Photo credit: 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings

Explanation In sexually reproducing animals, the most

obvious stage is diploid (2n). The male or female
adult have body cells that are diploid, except sex cells.
Male and female adults undergo a process of meiosis
to reduce the number of chromosomes of gametes (or
E-Visit Corner
sex cells) by half; these sex cells are now in haploid
TOPIC: Diplontic Life Cycle form (n). When these haploid gametes join, a process
YOU MAY VISIT: called fertilization, these will result to a diploid
https://bio.libretexts.org/Book zygote. The diploid zygote multiplies and grow
shelves/Botany/Book%3A_Bot through a series of cell division. These will
any_Lab_Manual_(Morrow)/14
%3A_Meiosis%2C_Fertilizatio differentiate and develop into a multicellular diploid
n%2C_and_Life_Cycles/14.5% adult organism. The lifecycle continues.
3A_Life_Cycles

A
B
S
T
R
A
C
T
I
O
N

Figure 2.2. The life cycle of Human

Photo credit: 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings

In human lifecycle, the haploid egg cell

Explanation
(n) from the mother and the haploid sperm cell
(n) from the father unites to form a diploid
E-Visit Corner
zygote (2n) through fertilization. This diploid
zygote undergoes mitosis and development to
TOPIC: Human Life Cycle form a multicellular diploid adult. Both diploid
YOU MAY VISIT: multicellular female and male adults reduce the
https://bio.libretexts.org/Bookshelv diploid chromosomes into half or haploid (n) by
es/Botany/Book%3A_Botany_Lab_
Manual_(Morrow)/14%3A_Meiosis% meiosis. These haploid sex cells or gametes
2C_Fertilization%2C_and_Life_Cycl unite again to form diploid zygote and the
es/14.5%3A_Life_Cycles
human life cycle continues (figure 2.2).

Sexual Life Cycle in Plants and Some Algae

A
B
S
T
R
A
C
T
I
O
N

Figure 2.3. Sexual Life Cycle in Plants and some algae

Photo credit: 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings

Explanation Plants and some algae exhibit an alternation of

generations. This inicludes both a diploid and
haploid multicellular stages. In some plants
like ferns, the diploid organism, called the
E-Visit Corner sporophyte, makes haploid spores by meiosis.
Each spore grows by mitosis into a haploid
TOPIC: Alternation of Generation organism called a gametophyte. A
GO TO: gametophyte makes haploid gametes by
https://bio.libretexts.org/Bookshelves/
Botany/Book%3A_Botany_Lab_Manua mitosis. Fertilization of gametes results in a
l_(Morrow)/14%3A_Meiosis%2C_Fertili diploid sporophytes.
zation%2C_and_Life_Cycles/14.5%3A_
Life_Cycles

Sexual Life Cycle in Most Fungi and Some Protists

A
B
S
T
R
A
C
T
I
O
N

Figure 2.4. Sexual Life Cycle in Most Fungi and Some Protists
Photo credit: 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings

In most fungi and somem protists, the

Explanation
only diploid stage is the single-celled
zygote; there is no multicellular diploid
stage. The zygote produces haploid cells
by meiosis. Each haploid cell grows by
E-Visit Corner mitosis into a haploid multicellualr
organsism. The haploid adult produces
TOPIC: Haplontic Life Cycle gametes by mitosis.
GO TO:
https://bio.libretexts.org/Bookshelves
/Botany/Book%3A_Botany_Lab_Man
ual_(Morrow)/14%3A_Meiosis%2C_F
ertilization%2C_and_Life_Cycles/14.5
%3A_Life_Cycles

LET’S DO AND DISCOVER!

Direction: At home (or in your backyard), collect samples of mature organisms:

the first must have a haplontic lifecycle; the second, diplontic life cycle; and the
third, with alternation of generation.
For bigger samples such as animals, you may take photos. For plants and other
smaller organisms, you may take the sample. Determine whether your samples
are at diploid or haploid stage. Sketch the lifecycle of the organisms you have
collected.
A
P Sample
P Collected
L 1
I
C
A
T
I
O
Scientific Name:
N
Common Name:

Sketch of a Life Cycle (Diplontic):

Explanation:

Sample
Collected
2

Scientific Name:
Common Name:

A
P
P Sketch of a Life Cycle (haplontic):
L
I
C
A
T
I
O
N

Explanation

Sample
Collected
3

Scientific Name:
Common Name:

Sketch of a Life Cycle (Alternation of Generation):

Explanation:

Sum It Up!
 Sexually reproducing organisms like animals, some plants, and fungi,
have different types of sexual lifecycle.
 The type of sexual life cycle depends on the timing of haploid and
diploid generations
 The types of sexual life cycles are: diplontic, haplontic, and alternation
of generation
 Diplontic lifecycle occurs in organisms that spend most of its life’s
phase as diploid. For example, in animals such as humans.
 Haplontic life cycle occurs in organisms that spend most of its life’s
phase as haploid. For example, in fungi and most protists
 Alternation of generations occur in organisms that have life’s phase
alternation of being diploid and haploid. For example, in most plants.

LESSON POST- TEST

How much have you learned?
How much have you learned from the previous readings and
activities? This time, we will have our evaluation. Read the
directions carefully. Good luck! 😊

Name: ___________________________ Date: _

Course, Year, and Section: ______________________ Rating: __________

Worksheet 2.2. Sexual Life Cycles

Part I. Multiple Choice

Direction: Write he letter of the best answer. Provide an explanation. Without an
explanation, points are not valid. (2 points each).

1. Eukaryotic sexual life cycles show tremendous variation. Of the following

elements, which do all sexual life cycles have in common?
I. alternation of generations III. fertilization V. spores
II. meiosis IV. gametes

A. I, IV, and V
B. I, II, and IV
C. II, III, and IV
D. II, IV, and V
Answer: _____
Explanation:

2. Referring to a plant sexual life cycle, which of the following terms describes
the process that leads directly to the formation of gametes?
A. sporophyte meiosis
B. gametophyte mitosis
C. gametophyte meiosis
D. sporophyte mitosis

Answer: _____
Explanation:

3. Which of the following is an example of alternation of generations?

A. A grandparent and grandchild each have dark hair, but the parent has blond
hair.
B. A diploid plant (sporophyte) produces, by meiosis, a spore that gives rise to a
multicellular, haploid pollen grain (gametophyte).
C. A diploid animal produces gametes by meiosis, and the gametes undergo
fertilization to produce a diploid zygote.
D. A haploid mushroom produces gametes by mitosis, and the gametes undergo
fertilization, which is immediately followed by meiosis

Answer: _____ Explanation:

4. How does the sexual life cycle increase the genetic variation in a species?
A. by mitosis
B. by alternation of generation
C. by allowing crossing over
D. Both B and C

Answer: _____ Explanation:

5. The immediate product of meiosis in a plant is a

A. spore.
B. gamete.
C. sporophyte.
D. gametophyte.

Answer: _____ Explanation:

6. Multicellular haploid organisms

A. are typically called sporophytes.
B. produce new cells for growth by meiosis
C. produce gametes by mitosis.
D. are found only in aquatic environments.

Answer: _____ Explanation:

7. In comparing the typical life cycles of plants and animals, a stage found in plants but
not in animals is a
A. gamete.
B. zygote.
C. multicellular diploid.
D. multicellular haploid

Answer: _____ Explanation:

Refer to the life cycles illustrated in the figure below to answer the following questions:

8. Which of the life cycles is typical for animals?

A) I only
B) II only
C) III only
D) I and II

Answer: _____
Explanation:

9. Which of the life cycles is typical for plants and some algae?
A. I only
B. II only
C. III only
D. I and II

Answer: _____
Explanation:

10. Which of the life cycles is typical for most fungi and some protists?
A. I only
B. II only
C. III only
D. I and II

Answer: _____
Explanation:

Self-Reflect
Create a reflective essay on your own biologial life cycle. Your essay should
cover, but not limited, to the following:

1. Fertilization
2. You as a zygote at diploid stage
3. You as an adult at diploid stage
4. How you produced haploid sex cells
5. The type of your biological life cycle

Self-Rating Competency Checklist

I hope you learned a lot from the lesson. Please rate yourself
by checking the following Learning Comptency cheklist. 😊

I I can do I can do I can do

Learning Competencies cannot this but I this this very
(Knowledge, Skills, Values) do this need to confidently well and
yet learn can teach
more other
1. Distinguish haplontic life cycle,
diplontic life cycle, and alternation of
generations.
2. Determine the haploid and diploid
generations in the lifecycle among
sexually reproducing organisms.
3. Sketch the lifecycle among sexually
reproducing organisms.

4. Explain the life cycle among sexually

reproducing organisms.
5. Write a reflective essay on your own
biological life cycle.

Self-Rating Journal

Based from the previous readings and assessments, please

_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________

Answer Key
LESSON PRE-TEST

A.
1. Diplontic
2. Haplontic
3. Haplontic
4. Alternation of Generations
5. Diplontic
6. Diplontic
7. Alternation of Generation
8. Diplontic
9. Diplontic
10. Diplontic

B.
1. Lifecycle of Animals

Description
Animals have diplontic life cycle, of which, majority of its life (or adult
phase) is spent in diploid stage. Meoisis occurs during the diploid stage.

2. Lifecycle of Fungi

Description
Most fungi have haplontic stage. Majority of its life is in haploid stage.
The adult (called gametophyte) are in haploid form. Meiosis occurs in
zygote which is a diploid.

3. Lifecycle of Plants

Description
Most plants undergo alternation of generation. Most of its phase are in diploid and
haploid form.

LET’S PRACTICE YOUR VOCABULARY

1. ALTERNATION OF GENERATION
2. DIPLOID
3. DIPLONTIC
4. FERTILIZATION
5. GAMETES
6. GAMETOPHYTE
7. HAPLOID
8. HAPLONTIC
9. LIFECYCLE
10. SPORE
11. SPOROPHYTE
12. ZYGOTE

Unit 3
MENDELIAN GENETICS

Lesson 3.1
Mendel’s Law of
Inheritance
Lesson 3.2
Punnett Square:
Monohybrid and
Dihybrid Cross

Overview of the Unit

2 WEEKS
1st session
Lesson 3.1
(1 week) G regor Mendel, the Father of Genetics, did an
experiment with peas in his garden to unlock the questions
2nd session
on the variations and inheritance among organisms. Mendel
Lesson 3.2
did a test cross of pea plants using a diagram called a punnett
(1 week) square. He used the chart to predict the possible character
traits inherited by the offspring from its parents. Punnett
suare is still widely used in Modern Genetics to solve
genetics problems. With Mendel’s experiment in pea plants,
he was able to deduce the Laws of Inheritance.
The experiment of Mendel and the use of Punnett
square are the focus of this unit.

Lesson 3.1 Mendel’s Laws of Inheritance

1 week

Topic Learning Outcomes

After going through the lesson, you will be able to:

1. Describe how Mendel used the scientific approach to identify the laws of
inheritance.
2. Define the following terms: true breeding, hybridization, monohybrid
cross, P generation, F1 generation, F2 generation
3. Distinguish between the following pairs of terms: dominant and recessive;
heterozygous and homozygous; genotype and phenotype
4. Explain Mendel’s law of seggragation and law of independent assortment

Introduction

How does this

garden pea turn
Genetics into a
scientific
Photo credit: discipline?
www.ebay.com

Figure 3.1.1 Pisum sativum (Garden

pea)

T he differences among organisms (variation) and how the character traits are
passed on from parents to offspring (inheriatance) had long been observed and discussed
before Genetics was established as a science. It is Gregor Mendel, the father of Genetics,
who turn the quest of inheritance and variation into science when he worked with pea
plants in his garden.
In this lesson, we will describe how Mendel did a scientific approach to identify
the laws of ineritance and how he was able to identify an important heritable factor that
is passed on from parents to offspring. This heritable factor is what we call now gene—
the unit of heredity.
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 103 EducSci 323A Genetics

LESSON PRE-TEST

What Do You Already Know?

Please check your background on the lesson by answering

the following lesson pre-test. Do not sneak for an answer yet. You
may check the correct answers only after you have answered all
questions. Read all directions carefully.

Part I. Multiple Choice

Direction: Write he letter of the best answer. Provide an explanation.
1. A plant with purple flowers is allowed to self-pollinate. Generation after
generation, it produces purple flowers. This is an example of
A. hybridization.
B. incomplete dominance.
C. true-breeding.
D. the law of segregation

2. Which of the following statements about Mendel's breeding experiments is correct?

A. None of the parental (P) plants were true-breeding.
B. All of the F2 progeny showed a phenotype that was intermediate between the
two parental (P) phenotypes.
C. Half of the F1 progeny had the same phenotype as one of the parental (P)
plants, and the other half had the same phenotype as the other parent.
D. All of the F1 progeny resembled one of the parental (P) plants, but only some
of the F2 progeny did.

3. A cross between homozygous purple-flowered and homozygous white-flowered

pea plants results in offspring with purple flowers. This demonstrates
A. the blending model of genetics.
B. true-breeding.
C. dominance.
D. a dihybrid cross.

4. What was the most significant conclusion that Gregor Mendel drew from his
experiments with pea plants?
A. There is considerable genetic variation in garden peas.
B. Traits are inherited in discrete units, and are not the results of "blending."
C. Recessive genes occur more frequently in the F1 than do dominant ones.
D. Genes are composed of DNA.

5. Which of the following is NOT true about the law of segregation?

A. It states that each of two alleles for a given trait segregate into different gametes.
B. It can be explained by the segregation of homologous chromosomes during
meiosis.
C. It can account for the 3:1 ratio seen in the F2 generation of Mendel's crosses.
D. It is a method that can be used to determine the number of chromosomes in a
plant.
6. The fact that all seven of the pea plant traits studied by Mendel obeyed the principle of
independent assortment means that
A. none of the traits obeyed the law of segregation.
B. the diploid number of chromosomes in the pea plants was 7.
C. all of the genes controlling the traits were located on the same chromosome.
D. all of the genes controlling the traits behaved as if they were on different
chromosomes.
7. Pea plants were particularly well suited for use in Mendel's breeding experiments for all
of the following reasons EXCEPT that
A. peas show easily observed variations in a number of characters, such as pea
shape and flower color.
B. it is possible to completely control matings between different pea plants.
C. it is possible to obtain large numbers of progeny from any given cross.
D. peas have an unusually long generation time
8. Which of the following is the result of Mendel’s experiment when he allowed to cross
the true-breeding plant?
A. All flowers white in color
B. All flowers are purple in color
C. Half of the flowers are purple and half are white
D. ¾ are purple flowers and ½ are white flowers
9. Which of the following is true about homozygous dominant?
A. It is denoted by one capital letter and one small letter
B. It is denoted by all small letters
C. It is denoted by all capital letters
D. It is denoted by either all small letters or all capital letters
10. Which of the following results in the second generation (F2) when Mendel self pollinate
purple flowers of the first generation (F1)?
A. All flowers white in color
B. All flowers are purple in color
C. Half of the flowers are purple and half are white
D. ¾ are purple flowers and ½ are white flowers

Check the correct answers found at the last page of the lesson

Self-Rating Competency Checklist

After answering the lesson pre-test, please rate yourself by

checking the following Learning Comptency cheklist. 😊

I I can do I can do I can do

Learning Competencies cannot this but this this very
(Knowledge, Skills, Values) do this I need confidently well and
yet to learn can teach
more other
1. Describe how Mendel used the
scientific approach to identify the
laws of inheritance.
2. Define the following terms: true
breeding, hybridization, P
generation, F1 generation, F2
generation
3. Distinguish between the
following pairs of terms:
dominant and recessive;
heterozygous and homozygous;
genotype and phenotype
4. Explain Mendel’s law of
seggragation and law of
independent assortment

Based from the pre-test, please write a short self-rating

LESSON PROPER
Let’s start our lesson. You have a suggested time allotment of 3 hours
to finish all the readings and assessments. That is only a suggested
time frame. You may answer all the activities at your most convenient
time. Do not forget to read all instructions. Happy reading! 😊

LET’S PRACTICE YOUR VOCABULARY!

Direction: I have here key terms for our lesson. Fill the missing letters to complete
the
correct word.

1. DMNANT AL__ELE  It is a variation of gene in the chromosome

masking the effect of the other variation. It produces a certain phenotype even
in the prescence of the other allele
V
O 2. F1 G__NER__TI__N  Refers to the first filial generation; the off spring of
C the true breeds in the Parent generation
A
B 3. __2 G__N__R__T__ON  It refers to the second filial generation; the
U offspring of the first filial generation
L
4. __ __NOTY__E  The part (DNA sequence) of the genetic make-up of an
A
organism which determines a characteristic (phenotype) of an organism
R
Y 5. H__ ER__ __Y__OUS  two different alleles of a given gene

6. H__M__ __YG__US  both copies of a given gene have the same allele

7. YRII TON  a process of breeding a mixed offspring from two

different strains or species of plants

8. A OF IDP DET ASO__TMENT  describes how

different genes independently separate from one another when reproductive
cells develolop

9. W F EGEATO__  states that the two alleles for a

heritable character separate (segregate) during gamete formation and end up in
different gametes

10. ONHBRD ROS  a cross happening in F1 generation offspring

of parents differring in one trait only
11. P-G__NE__AT__O__  the-true breeding generation

12. PENOY__E  Any observable characteristics of an organism such as

physical characteristics, developmental, biochemical, or physiological
properties or its behavior

13. ECESIVE A_ _LE  A variation of gene in the chromosome that

does not express characterstics (phenotype) when the dominant allele is present
V
O 14. T__U__ BRE__DI__G  a purebreed organism
C
A
B
U Check the correct answers found at the last page of the lesson
L
A
R
Y

LET’S GET TO KNOW MORE!

Mendel’s Experiment
Gregor Mendel, an Austrian monk
and a Botany teacher, did an experiment
with his pea in his garden that made a great
breakthrough in the history of Science.
The fundamental question on the variation
among organisms and how the traits are
A
B passed on from parents to its offspring was
S answered through Mendel’s experiment on Figure 3.1.2. Gregor Johan
the pea plant in his garden. This was the Mendel
Photo Credit: Britannica.com
T
R fundamental science of Genetics.
A
C
T Mendel’s Technique
I
O Mendel used the garden pea
N plant in his experiment because of the
following advantages: there are many
varieties with distinguishable features,
mating of plants can be controlled, each
pea plant has both sperm-producing
(stamen) and ovary-producing (carpel)
organs and pea plants can be cross-
polliated from each other.
Mendel cross-pollinate one
variety of pea to another by brushing
off the stamen of one variety of pea Figure 3.1.3. Mendel’s
plant (e.g., white folwer) and put in the Technique
Photo Credit: 2008 Pearson Education, Inc.,
publishing as Pearson Benjamin Cummings
carpel of another variety of pea plant
(purple flower of a pea plant).

A
B
S
T
R
A
C
T
I
O Figure 3.1.4. Cross-pollination and self-pollination of pea plant by Mendel
N Photo Credit: 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings

Mendel cross pollinated the true breed varieties of white and purple flowers
in a process called hybridization. The true breeding plants are the parental
generation or P generation. When the true breed white pea variety allows to cross-
pollinate to a true breed purple white pea variety, the offsprings have all purple
flowers. These flowers are already hybrids. This generation of offspring is called
the first filial generation or F1 generation. When these purple flowers were self-
pollinated, the offsprings have a ratio of 75% of purple flowers and 25% of white
flowers. This generation of offspsring is the second filial generation or F2
generation. Mendel called the purple flower dominant because they are the
majority of varities that are produced. The white purple flower are recessive
because they are produced lesser than the purple flowers.

Mendel’s experiment showed that the character traits, in this case the flower
color, are passed on from parents to offspring. Mendel concluded that there is a
heritable factor for a particuar trait that is passed on. This “heritable factor” of
Gregor Mendel is what we now call a gene.

Mendel Used other Character Traits

A
B
S
T
R
A
C
T
I
O
N

Figure 3.1.5. Seven character traits of pea plant used by Mendel in his experiment
Photo Credit: 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings

Aside from the pea’s flower color, Mendel also used other character traits of
pea plants in his experiment. The result of his experiment showed that, after cross
pollinating contrasting true-breeds of pea plant in P generation, it always produces
plants of the same character trait (e.g., all are tall plants) in the F1 generation. When
these F1 pea plants were allowed to self-pollinate, it results to pea plants with
character traits of 3:1 ratio (e.g., ¾ are tall plants, and ¼ of short plants. As he
repeated the experiment with the other character traits, it still produced the same
result. Mendel developed a hypothesis to explain the 3:1 inheritance pattern he
observed in F2 offspring.

Mendel’s Model

In Mendel’s experiment, four important concepts are related to it which

are applicable to what we know today about genes and chromosomes.

Concept Alternative versions of genes account for variations in inherited

1: characters.

For example, the gene for flower color in pea plants exists in two
versions, one for purple flowers and the other for white flowers
These alternative versions of a gene are now called alleles

Each gene resides at a specific locus on a specific chromosome

A
B
S
T
R
A
C
T
I
O
N
Figure 3.1.6. Location of genes or allele for purple flower in
the chromosome
Photo Credit: 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings

Concept For each character an organism inherits two alleles, one from each
2: parent
Concept If the two alleles at a locus differ, then one (the dominant allele)
3: determines the organism’s appearance, and the other (the recessive
allele) has no noticeable effect on appearance

In the flower-color example, the F1 plants had purple flowers because

the allele for that trait is dominant
Concept The fourth concept, now known as the law of segregation, states that
4: the two alleles for a heritable character separate (segregate) during
gamete formation and end up in different gametes

Homozygous vs Heterozygous
 Homozygous-- two identical alleles for a character.
 Heterozygous-- two different alleles for a gene.

Phenotype vs Genotype
Phenotype refers to the physical appearance of an organism. It refers to any
observable traits in an organism such as its morpological, developmental,
biochemical, pysiological properties, or its behavior. The appearance of an
organism are determined either by genetic make-up or environmental factors.
Genotype refers to the genetic make-up of an organism. The genetic make-
up determines the physical traits (or phenotype of an organsim. Genotypes can be
homozygous dominant or homozygous recessive, and heterozygous. Homozygous
A
dominant are genotypes for dominant traits (e.g., purple color of flower in peas).
B
Homozygous recessive are genotypes for recessive traits. (e.g., white color of
S
flower in peas). Heterozygous consists of both dominant and recessive alleles.
T
R
A Writing of genotypes are
C denoted in letters. For
T homozygous dominant, letters
I are in uppercase; for example,
O PP—a genotype that determines
N the phenotype purple flower. A
purple color of flower in pea
plant is a dominant trait. For
homozygous recessive , letters
are in lower case; for example,
pp— a genotype that determines
the phenotype white flower as
white. A white color of flower
in pea plant is the recessive
trait. For heterozygous, letters
are both uppercase and
lowercase (Pp). Altough, in this
case, there is a recesssive allele, Figure 3.1.7 The phenotype (flower color) and
the heterozygous genotype Pp genotype (homozygous or heterozygous) of the
determines the purple fower pea flower
color of the pea. This is because
Photo Credit: 2008 Pearson Education, Inc., publishing as
the dominant allele masks the Pearson Benjamin Cummings
recessive allelle.

The Law of Seggregation and the Law of Independent Assortment

a. The Law of Seggregation The law of segregation states that the two
alleles for a heritable character separate
(segregate) during gamete formation and end up
in different gametes

For example, an egg or a sperm gets only one of the two alleles that are
present in the somatic cells of an organism. This segregation of alleles
corresponds to the distribution of homologous chromosomes to different
gametes in meiosis

A Key Points:
B
S  Mendel identified the law of
seggregation, by using a single
T
character (e.g., flower color).
R
These organisms that are
A
heterozygous for one
C character are called
T monohybrids. A cross
I between such hybrids are
O called monohybrid cross.
N  Mendel’s segregation model
accounts for the 3:1 ratio he
observed in the F2 generation
of his numerous crosses
 The possible combinations of
sperm and egg can be shown
using a Punnett square, a
diagram for predicting the
results of a genetic cross
between individuals of known
genetic makeup
 A capital letter represents a
dominant allele, and a Figure 3.1.8. Test Cross of flowers with a
lowercase letter represents a single trait
recessive allele
Photo Credit: 2008 Pearson Education, Inc., publishing as
Pearson Benjamin Cummings

b. The Law of Independent Assortment

The law of independent assortment
states that each pair of alleles
segregates independently of each
other pair of alleles during gamete
formation

A
B
S
T
R
A
C
T
I
O
N

Figure 3.1.9. Test cross of seeds with two traits

Photo Credit: 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings

Key Points:
 Mendel identified the law of independent assortment, by using two character
traits of an organism which are dihybrids. Crossing two true breeding traits
of an orgaims results to dihybrids—both heterozygous. A cross between
such heterozygotes are called dihybrid cross.
 Mendel’s model he identified in the second law accounts for the 9:3:3:1 ratio
he observed in the F2 generation of his numerous crosses.

Sum It Up

 Mendel conducted a scientific investigation on the inheritance and variation in

organisms using pea plants.
 Mendel cross true breeds of pea plant with certain traits, for example, flower
color. One true breed is a white color flower, the other is a true breed purple
flower. The crossing of these true breeds resulted to all purple flowers. These
types of offspring are in the First filial generation (F1 generation)
 When Mendel allowed to self-pollinate with single character trait (e.g., purple
flower) in the first generation, it resulted to a 3:1 ratio—that is, 75% are purple
flower, and 25% are white flowers. These offspring are in the second generation.
 True breeding are pure breed organisms
 Hybridization is a process of breeding two contrasting pure breed organisms.
 Monohybrid cross involves the crossing of the two organisms using a single
character trait.
 There are series if generation in Mendelian’s pattern of inheritance. In his
experiment, the P generation includes the pure breed parent organisms with
contrasting character traits. F1 generation are the resulting offspring of the P
generation; all organisms have the same character traits (e.g., all are purple
flowers). F2 generation are the resulting offspring of the fF1 generation. In
crossing of a single trait, it resulted to q 3:1 ratio (e.g., 75% purple flower, 25%
white flower).
 If the two alleles at a locus differ, then one (the dominant allele) determines the
organism’s appearance, and the other (the recessive allele) has no noticeable
effect on appearance
 Homozygous refers to two identical alleles for a character while heterozygous
refers to an organism that has two different alleles for a gene.
 Genotype refers to the type of genetic make-up of an organism. The phenotype
are the observable characteristics such as physical characteristic, developmental,
biochemical, and physiological observed in an organism.
 The Law of Segregation states that states that the two alleles for a heritable
character separate (segregate) during gamete formation and end up in different
gametes
 The law of independent assortment states that each pair of alleles segregates
independently of each other pair of alleles during gamete formation

LESSON POST-TEST
How Much Have You Learned?
How much have you learned from the previous readings and
activities? This time, we will have our evaluation. Read the directions
carefully. Good luck! 😊

Name: ___________________________________ Date: _

Course, Year, and Section: ____________________________ Rating: __________

Worksheet 2.1. Mendel’s Law of Inheritance

II. Multiple Choice

Direction: Write the letter of the correct answer. Provide an explanation. Your points
are not valid if there are no explanations. (2 points)

1. In Mendel’s experiment, crossing of true-breeding pea plant with contrasting color

flowers (purple and white flower) resulted to:
A. All pea’s flowers are purple in color
B. All pea’s flowers are white in color
C. 75% are purple flowers and 50% are white flowers
D. 50% of the flowers are purple and 50% are white
Ans. _______ Explanation:

2. In an experiment, a plant with purple flowers is allowed to self-pollinate and

produced all purple flowers. The applied concept is an example of ____________
A. the law of segregation
B. incomplete dominance.
C. C. true-breeding.
D. hybridization.
Ans. _______ Explanation:

3. Which of the following is the most significant conclusion that Gregor Mendel
drew from his experiments with pea plants?
A. Recessive genes mask the dominant genes in the F2 generation
B. Traits are inherited in discrete units, and are not the results of
"blending."

C. Recessive genes mask the dominant genes in the F1 generation

D. Traits and variation are inherited throgh blending.
Ans. _______ Explanation:

4. Of all the pea plants with 7 traits used by Mendel, he observed that it follows the
Law of Independent Assortment. Which of the folowing best accounts for this
result?
A. The ploidy type of chromosome do not determine the phenotype of the
offspring.
B. none of the traits obeyed the law of segregation.
C. all of the genes controlling the traits were located on the same
chromosome.
D. all of the genes controlling the traits behaved as if they were on different
chromosomes.
Ans. _______ Explanation:

5. In the Philippines, the dominant trait for the type of hair is straight. The recessive
trait is curly hair. Let’s assign letter S to denote the type of allele for the type of
hair. Which of the following denotes the homozygous dominant allele for the
trait?
A. Ss
B. SS
C. ss
D. SSS
Ans. _______ Explanation:

6. Which of the following statements about Mendel's breeding experiments is

true?
A. All of the F1 offspring resembled one of the parental (P) plants, but only
some of the F2 offspring did
B. All of the F2 offspring showed a phenotype that was intermediate
between the two parental (P) phenotypes.
C. None of the parental (P) plants were true-breeding.
D. Half of the F1 offspring had the same phenotype as one of the parental
(P) plants, and the other half had the same phenotype as the other
parent.
Ans. _______ Explanation:

7. It was important that Mendel examined not just the F1 generation in his breeding
experiments, but the F2 generation as well, because
A. he obtained very few F1 progeny, making statistical analysis difficult.
B. parental traits that were not observed in the F1 reappeared in the F2,
suggesting that the traits did not truly disappear in the F1.
C. analysis of the F1 progeny would have allowed him to discover the law of
segregation, but not the law of independent assortment.
D. the dominant phenotypes were visible in the F2 generation, but not in the
F1.
Ans. _______ Explanation:

8. Which of the following best describes the law of segregation?

A. It states that each of two alleles for a given trait segregate into different
gametes.
B. It describes the behavior of cell division of gametes
C. It is a method that can be used to determine the number of chromosomes in
a plant.
D. It describes the 3:1 ratio of the offspring after breeding of all heterozygous
chromosomes.
Ans. _______ Explanation:

9. Mendel accounted for the observation that traits which had disappeared in the F1
generation reappeared in the F2 generation by proposing that
A. new mutations were frequently generated in the F2 progeny, "reinventing"
traits that had been lost in the F1.
B. the mechanism controlling the appearance of traits was different between
the F1 and the F2 plants.
C. traits can be dominant or recessive, and the recessive traits were obscured
by the dominant ones in the F1.
D. the traits were lost in the F1 due to blending of the parental traits.
Ans. _______ Explanation:

10. A homozygous purple-flowered were crossed with homozygous white-flowered

pea plants which results in offspring with purple flowers. This is an example of
____________.
A. true-breeding.
B. a dihybrid cross.
C. the blending model of genetics.
D. dominance
Ans. _______ Explanation:

Self-Rating Competency Checklist

Please rate yourself by checking the following Learning

Comptency cheklist. 😊

I I can do I can do I can do

Learning Competencies cannot this but this this very
(Knowledge, Skills, Values) do this I need confidently well and
yet to learn can
more teach
other
Describe how Mendel used the scientific
approach to identify the laws of
inheritance.
Define the following terms: true
breeding, hybridization, P generation, F1
generation, F2 generation
Distinguish between the following pairs
of terms: dominant and recessive;
heterozygous and homozygous; genotype
and phenotype
Explain Mendel’s law of seggragation
and law of independent assortment

Self-Rating Journal

Based from the previous readings and assessments, please

write a short self-rating reflection. Highlight on what you know
already, what you don’t know yet, and what to improve. Compare
your self-rating checklist during the lesson pre-test and post-test.
Use the self-rating competency checklist above as your guide. 😊
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________
_______________________________________________________________________________________

Answer Key
LESSON PRE-TEST
1. C
2. D
3. C
4. B
5. D
6. D
7. D
8. B
9. C
10. D

LET’S PRACTICE YOUR VOCABULARY!

1. DOMINANT ALLELE
2. F1 GENERATION
3. F2 GENERATION
4. GENOTYPE
5. HETEROZYGOUS
6. HOMOZYGOUS
7. HYBRIDIZATION
8. LAW OF INDEPENDENT ASSORTMENT
9. LAW OF SEGGREGATION
10. MONOHYBRID CROSS
11. P- GENERATION
12. PHENOTYPE
13. RECESSIVE ALLELE
14. TRUE BREEDING

Lesson 3.2 Punnett Square: Monohybrid

Cross and Dihybrid Cross
1 week

Topic Learning Outcomes

After going through the lesson, you will be able to:

1. Differentiate monohybrid cross and dihybrid cross.
2. Analyze genetics problems involving monohybrid traits using Punnett square.
3. Analyze genetics problems involving dihybrid trait using Punnett square.
4. Predict your own phenotype and genotype for a particular trait.
5. Write a reflective essay about your future self, predicting your selected
phenotype of your offspring.

Introduction

How can you

predict and tell
the hair color of
your child?
Photo credit: https://www.healthline.com/health/pregnancy/what-color-hair-
will-baby-have

C ould you predict the physical characteristics of an offspring? In Genetics, it

is possible for you to predict and tell the phenotype (e.g., physical characteristics) of an
offspring if you know the genotype (or the type of genetic make-up) of its parents.
Solving genetics problems like this using a single trait (monohybrid) and two traits
(dihybrid) can be done using a Punnett square—a graphical representation used to
determine the probability of the character traits and genetic make-up of the offspring. A
test cross involving a single trait is a monohybrid cross. A test cross involving two
different traits is a dihybrid cross. These will be our focus in this lesson.
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 112 EducSci 323A Genetics

LESSON PRE-TEST
What Do You Already Know?
Please check your background on the lesson by answering the
following pre-test. Do not sneak for an answer yet. You may check the
correct answers only after you have answered all questions. Read all
directions carefully.

Part I. Multiple Choice. Write the letter of the best answer. Then, explain your
answer.

1. Which of the following best differentiates a monohybrid cross and a dihybrid

cross?
A. A monohybrid cross involves a single parent, whereas a dihybrid cross
involves two parents.
B. A monohybrid cross produces a single progeny, whereas a dihybrid cross
produces two progeny
C. A monohybrid cross involves organisms that are heterozygous for a single
character, whereas a dihybrid cross involves organisms that are
heterozygous for two characters.
D. A monohybrid cross is performed only once, whereas a dihybrid cross is
performed twice

Ans. _______ Explanation:

2. Two plants are crossed, resulting in offspring with a 3:1 ratio for a particular trait.
This suggests
A. that the parents were true-breeding for contrasting traits.
B. incomplete dominance.
C. that a blending of traits has occurred.
D. that the parents were both heterozygous.

Ans. _______
Explanation:

3. A 9:3:3:1 phenotypic ratio is characteristic of which of the following?

A. a monohybrid cross
B. a dihybrid cross
C. a trihybrid cross
D. linked genes
Ans. _______
Explanation:

4. When crossing a homozygous recessive with a heterozygote, what is the chance

of getting an offspring with the homozygous recessive phenotype?
A. 0%
B. 25%
C. 50%
D. 75%

Ans. _______
Explanation:

5. What are Punnett squares used for?

A. predicting the result of genetic crosses between organisms of known
genotypes
B. determining the DNA sequence of a given gene
C. identifying the gene locus where allelic variations are possible
D. testing for the presence of the recessive allele

Ans. _______
Explanation:

6. Black fur in mice (B) is dominant to brown fur (b). Short tails (T) are dominant
to long tails (t). What fraction of
A. the progeny of the cross BbTt × BBtt will have black fur and long tails?
1/16
B. 3/16
C. 3/8
D. ½

Ans. _______
Explanation:

7. In certain plants, tall is dominant to short. If a heterozygous plant is crossed with

a homozygous tall plant, what is the probability that the offspring will be short?
A. ½
B. ¼
C. 0
D. 1
Ans. _______
Explanation:
8. A couple has three children, all of whom have brown eyes and blond hair. Both
parents are homozygous for brown eyes (BB), but one is a blond (rr) and the
other is a redhead (Rr). What is the probability that their next child will be a
brown-eyed redhead?
A. 1/16
B. B) 1/8
C. C) ¼
D. 1/2
Ans. _______
Explanation:
9. P = purple, pp = white. The offspring of a cross between two heterozygous purple-
flowering plants (Pp × Pp) results in
A. all purple-flowered plants.
B. purple-flowered plants and white-flowered plants.
C. two types of white-flowered plants: PP and Pp.
D. all white-flowered plants.
Ans. _______
Explanation:

10. What is genetic cross between an individual showing a dominant phenotype (but
of unknown genotype) and a homozygous recessive individual called?
A. a self-cross
B. a testcross
C. a hybrid cross
D. an F1 cross
Ans. _______
Explanation:

Check the correct answers found at the last page of the lesson

Thank you for answering! 😊

Self-Rating Competency Checklist

After answering the lesson pre-test, please rate yourself by

checking the following Learning Comptency cheklist. 😊

I I can do I can do I can do this

Learning Competencies cannot this but I this very well and
(Knowledge, Skills, Values) do this need to confidently can teach
yet learn more other
1. Differentiate monohybrid
cross and dihybrid cross.
2. Analyze genetics problems
involving monohybrid traits
using Punnett square.
3. Analyze genetics problems
involving dihybrid trait using
Punnett square.
4. Predict your own phenotype
and genotype for a particular
trait.
5. Write a reflective essay about
your future self, predicting
your selected phenotype of
your offspring.

Self-Rating Journal

Based from the pre-test, please write a short self-rating

LESSON PROPER
Let’s start our lesson. You have a suggested time allotment of 3 hours to
finish all the readings, activities, and assessments. That is only a suggested
time frame. You may answer all the activities at your most convenient
time. Do not forget to read all instructions. Happy reading! 😊

LET’S PRACTICE YOUR VOCABULARY!

Direction: I have here key terms for our lesson. Fill the missing letters to complete the
correct word.

1. LEL__  an alternative form or variation of a gene.

2. OMNANT TAT  an inherited characteristics that appears in an offspring from a

parent through a domina nt allele. It is the trait that occurs frequently in an organism

3. __ENO__Y__E  It is an individual’s collecion of genes. It can also refer to the two alleles
inherited for a partcular gene
V
O 4. HO__OZ__G__US DO__INA__T A__LE__E a genotype in which both alleles are
C dominant
A
B 5. __OM__ZY__O__S __ECE__SIVE __L__ELE  a genotype in which booth alleles are
recessive
U
L 6. __ET__ROZ__GO__S A__LELE  a genotype in which oe allele is dominant, the other
A allele is recessive.
R
Y 7. __H__NO__YPE  any observable characteristics of an organsim such as the physical,
biochemical, and physiological characteristics

8. ECESIVE T__AIT an inherited characteristics that appears in an offspring from a

parent through a recessive allele. It is the trait that does not occur frequently.

9. UNETT SUAE a graphical representation used to determine the probability of

an offspring expressing a particular genotype

10. TST COS__  the breeding of an individual with a phenotypically recessive

individual, to deter mine the zygosity of the former by analyzing proportions of offspring
phenotype.

Check the correct answers found at the last page of the chapter

LET’S GET STARTED!

A
C
T
I
V
I
T Attached Earlobe Free earlobe
Y

1. Get a mirror. Touch your earlobe found at the bottom of your ear.
Using your mirror, observe if it is attached to the side of the head or
not.

2. Then, write the folllowing:

 If you have earlobes attached to the side of your head, write ee
 If you have unattached earlobe or free earlobe, write EE and Ee.

3. Review: Determine whether the following are homozygous dominant,

homozygous recessive, or heterozygous. Then, write whether it is
attached earlobe or unattached earlobe.
 EE=
 Ee=
 ee=

LET’S THINK AND REFLECT!

1. What type of earlobe do you have?

2. By knowing the type of your earlobe (phenotype), could you determine

your genotype for the earlobe already? How?

3. If you know the type of earlobe of your parents, could you determine your
genotype for the earlobe already? How?
A
N
A
L
Y
S
I
S

Getting There...
What type of earlobes do you have? In humans, there are two types of
earlobes: the attached earlobe and the free earlobe. Some people have their
earlobes attached to the side of the head. This is the attached earlobe. Some
have unattached earlobes or free earlobes.
The free earlobe is due to a gene that is dominant for the trait. The
attached earlobe is due to a gene that is recessive for the trait. It is possible for
you to predict the type of gene for your earlobe if you know the genotype of
your parents. You could also predict a certain trait of your future offspring if
you know your genotype, and the genotype of your future life partner. It can
be illustrated through the use of punnet square. Let’s get to know more on
how to do it.

LET’S GET TO KNOW MORE!

A Punnett square is a graphical representations used to predict the outcome of

the offspring. A Punnett square can be applied when solving genetic problems
involving the mating of organisms using different traits.

Let’s try an example!

Juan has a free earlobe (phenotype). His genotype is heterozygous alllele (Ee).
He married Maria with an attached earlobe (phenotype) having a genotype of
homozygous recessive allele (ee). What would be the phenotype and the
A genotype of their offspring?
B
S To solve genetic problems, take these steps:
T
R 1. Determine the Keys
A
e.g., male: EE
C
female: ee
T
I 2. Draw a punnet square. Write the allele of female at the top. One letter to the top
O of each box. For example : e, e. Write the allele of male at the sides. One letter
N on each side of the box. For example, E, E.

e e

3. Cross each allele. First is in the first box (e x E). Then, in the second box (e x
e)

eE eE
ee
ee ee

4. Determine the genotype and phenotype of the of the offspring:

Genotype of the offspring: Phenotype of the offspring:

eE = heterozygous  free earlobe (dominant trait)

eE= heterozygous  free earlobe (dominant trait)
ee= homozygous recessive  attached earlobe (recessive trait)
ee= homozygous recessive  attached earlobe (recessive trait)
A
B 5. Determine the genotypic ratio and phenotypic ration of the offspring
S
T Genotypic ratio of the offspring
R
A 50% (e.g., 2 out of 4 or 2/4) of the offspring are eE (heterozygous)
C 50% (e.g., 2 out of four or 2/4) of the offspring are eE (heterozygous)
T
I Phenotypic ratio of the offspring
O
50% (e.g., 2 out of 4 or 2/4) of the offspring have free earlobes
N 50% (e.g., 2 out of 4 or 2/4) of the offspring have attached earlobes

Juan and Maria will have children that have free earlobes and attached
earlobes. Half of their children will have free earlobes. Half of their children
will have attached earlobes. For example, if they will have 8 children, 50%
of them (or 4/8) will have free earlobes, and 50 % of them (or 4/8) will have
attached earlobes.

Enabling Task 1A: Punnett Sqaure

Let’s do the following task. Please do not sneak for an

answer yet. You may check the correct answers only after you
have answered all questions. Correct answers are found at the
last page of the lesson. Don’t forget to read the direction.
Good luck! 😊

Sample Problem 1

In dragons, wings are a dominant trait, but some dragons are born wingless.
1. If a wingless dragon is crossed with one that is heterozygous, how many of
its offspring will also be wingless?
2. What are the chances that two heterozygous dragons have a whelp that is
wingless?

Key: F= winged dragon; f= wingless

Your Answer:

Sample Problem 2

If a wingless dragon is crossed with one that have wings, How many of
the offspring are wingless? How many have wings? How can you
determine the genotype of the parent winged dragon?

I can help you. Let’s

Help! Help! I don’t have offspring!
know my genotype!
Am I Ff or FF?

Your Answer:

Thank you for doing the activity 😊

Check the correct answers found at the last page of the chapter

Monohybrid Cross and Dihybrid Cross

One of the characteristics of an organism is its ablility to reproduce. During

fertilization, when there is the mating of sperm and egg cell, there is a combination
of genes or crossing of genes from both the Mother and the father. These types of
genes (or genotypes) determine the character traits of its offpring (phenotype). One
way to determine the genotype of an organism is through a test cross.
A test cross is a a test used to mate organisms of different contrasting traits to
determine the type of allele present in the genotype. Two types of test cross can be
applied based on the number of character traits: the monohybrid cross and dihybrid
cross. Monohybrid cross involves a mating of one (mono) character and different
(hybrid) traits. In dihybrid cross involves a mating of two (di-) character traits of
either homozygotes or heterozygotes.

The Punnett Square Approach for a Monohybrid Cross

A
B The punnett square is a graphical representations used to predict the
S outcome of the offspring. A punnet square can be applied when solving
genetic problems involving the mating of organisms using one character trait
T
R
A In Mendel’s experiment, the the law of seggregation is illustrated by monohybrid cross.
C
T To solve genetic problems, take these steps:
I
1. Determine the Keys
O
2. Draw a punnet square
N
3. Cross the alleles
4. Determine the genotype and phenotype of the of the offspring.
5. Determine the genotypic ratio and phenotypic ration of the offspring

For example,

Cross heterozygous green pea (Gg) with heterozygous green pea plant
(Gg). Yellow is recessive.

Keys: GG gg -- yellow
Gg Green
G g
Parent cross: Gg x Gg G GG Gg
g Gg gg

Enabling Task 1A: Monohybrid Cross

Let’s do the following task. Please do not sneak for an

answer yet. You may check the correct answers only after you have
answered all questions. Correct answers are found at the last page
of the lesson. Don’t forget to read the direction. Good luck! 😊

Sample Problem 1:

Two heterozygous purple flowered pea plants are crossed.

What are the phenotypes of their offspring and in what
proportion?

Your Answer:

The Punnett Square Approach for a Dihybrid Cross

A test cross using a Punnet sqaure can be applied to two character traits that are
hybrids. This test cross is known as dihybrid cross. In In Mendel’s experiment, the
law of independent assortment can be illustrated by the dihybrid cross. To solve genetics
problems using dihybrid cross, take the following steps:

1. Determine the Keys

2. Draw a punnet square
3. Cross the alleles
4. Determine the genotype and phenotype of the of the offspring.
5. Determine the genotypic ratio and phenotypic ration of the offspring
A A dihybrid is an individual that is a double heterozygote (e.g., with the genotype
B RrYy - round seed, yellow seed).
S
T
Dihybrid Cross: RrYy x RrYy cross two traits at same time: remember
R
independent assortment
A
C
T
I
O
N

For example,
Test cross heterozygous with a genotype of TtTt (Tall
plant, short plant) and GgGg (Green pod, yellow pod)

Keys: T = tall plant G = green pod

t = short plant g= yellow pod

Parent cross: TTGG x ttgg

Gametes : TG x tg

Punnett Square:
Genotype Phenotype
9/16 tall plant, green
pod
3/16 tall plant, yellow
pod
3/16 short plant,
green pod
1/16 short plant,
yellow pod
A
B Phenotypic ratio= 9:3:3:1
S All of these type of crosses will follow the same ratio:
T
R AaBb x AaBb both heterozygous for both traits
A
C 9 - (two dominant traits)
T 3 - (one dominant, one recessive)
I 3 - (one recessive, one dominant)
O 1- (two recessive traits)
N

Enabling Task 1 B: Dihybrid Cross

Let’s do the following task. Please do not sneak for an answer

yet. You may check the correct answers only after you have
answered all questions. Correct answers are found at the last page
of the lesson. Don’t forget to read the direction. Good luck! 😊

Sample Problem 1: Cross heterozygous with a genotype of RrRr

(round seed, yellow seed) and TtTt (Tall plant
short plant)
Your Answer:

LET’S DO AND DISCOVER

Let’s go back to our activity with your earlobe. Now that you were
able to determine your type of earlobe (phenotype), let’s predict your
genotype.
1. Applying the learings you gained in this lesson, use a punnett
square to predict your hypothetical genotype for your earlobe.

A
P
P
L
I
C
A
T
I
O
N

Sum It Up!

 Punnett square is a diagram used to predict the phenotype and genotype of the
offspring.
 A test cross is a way to determine whether an organism that is expressed a dominant
trait was a aheterozygote or a homozygote.
 Monohybrid cross is the mating of two parents that are heterozygotes or hybrids that
involves a single trait .
 Dihybrid cross is the mating of two parents that are heterozygotes or hybrids that
involves two traits.

LESSON POST-TEST
How Much Have You Learned?

How much have you learned from the previous readings and
activities? This time, we will have our evaluation. Read the directions
carefully. Good luck! 😊

Name: ___________________________________ Date: _

Course, Year, and Section: _____________________________ Rating: __________

Worksheet 3. Punnett Square: Monohybrid Cross and Dihybrid Cross

I. Multiple Choice
Direction: Write the letter of the correct answer. Use a punnett square if it is
necessary and provide an explanation. Without an explanation and a punnett square,
points will not be valid. (2 points)

1. A sexually reproducing animal has two unlinked genes, one for head shape (H)
and one for tail length (T). Its genotype is HhTt. Which of the following genotypes
is possible in a gamete from this organism?
A. HT
B. Hh
C. HhTt
D. D) T
Ans. _______Explanation:
2. Two true-breeding stocks of pea plants are crossed. One parent has red, axial
flowers and the other has white, terminal flowers; all F1 individuals have red,
axial flowers. If 1,000 F2 offspring resulted from the cross, approximately how
many of them would you expect to have red, terminal flowers? (Assume
independent assortment.)
A. 65
B. 190
C. 250
D. 565
Ans. ______Explanation:
-----------------------------------------------------------------------------------------------------------------------------------------
This handout is intended only for the use of students who take Genetics course.
NOT FOR SALE.
Page 130 EducSci 323A Genetics

3. Given the parents AABBCc × AabbCc, assume simple dominance and independent
assortment. What proportion of the progeny will be expected to phenotypically
resemble the first parent?
A. ¼
B. 1/8
C. ¾
D. 3/8
Ans.
Explanation:

4. Skin color in a fish is inherited via a single gene with four different alleles. How
many different types of gametes would be possible in this system?
A. 1
B. 2
C. 4
D. 8
Ans.
Explanation:

Use the following diagram and description to answer the questions below.

In a particular plant, leaf color is controlled by gene D. Plants with the dominant
allele D have dark green leaves, and plants with the homozygous recessive dd
genotype have light green leaves. A true-breeding dark-leaved plant is crossed with a
light-leaved one, and the F1 offspring is allowed to self-pollinate. The predicted
outcome of this cross is diagrammed in the Punnett square shown below, where 1, 2,
3, and 4 represent the genotypes corresponding to each box within the square

5. Which of the boxes marked 1-4 correspond to plants with dark leaves?
A. 1 only
B. 1 and 2
C. 2 and 3
D. 1, 2, and 3
Ans.
Explanation:

6. Which of the boxes correspond to plants with a heterozygous genotype?

A. 1
B. 1 and 2
C. 1, 2, and 3
D. 2 and 3
Ans.____Explanation:
7. Which of the plants will be true-breeding?
A. 1 and 4
B. 2 and 3
C. 1-4
D. 1 only
Ans.___Explanation:
8. Gene S controls the sharpness of spines in a type of cactus. Cactuses with the
dominant allele, S, have sharp spines, whereas homozygous recessive ss cactuses
have dull spines. At the same time, a second gene, N, determines whether cactuses
have spines. Homozygous recessive nn cactuses have no spines at all. A cross
between a true-breeding sharp-spined cactus and a spineless cactus would produce
A. all sharp-spined progeny.
B. 50% sharp-spined, 50% dull-spined progeny.
C. 25% sharp-spined, 50% dull-spined, 25% spineless progeny
D. all spineless progeny
Ans. ____Explanation:
9. What is the chance of getting an offspring with the homozygous recessive
phenotype if you cross a homozygous recessive with a heterozygote,?
A. 50%
B. 75%
C. 0%
D. 25%
Ans.
Explanation:
10. How many unique gametes could be produced through independent assortment by
an individual with the genotype AaBbCCDdEE?
A. 4
B. 8
C. 16
D. 32
Ans.
Explanation:

Part B. Using Punnett Square

1. A round seeded plant (RR) is crossed with a wrinkle seeded plant (rr). What are
the phenotypes of the offspring?
2. Two heterozygous purple flowered pea plants are crossed. What are the
phenotypes of their offspring and in what proportion?
3. A plant with green seeds (yy) is crossed with a heterozygous plant. What
percentage of their offspring have yellow seeds?
4. In tomatoes, tall vines (T) are dominant to dwarf vines (t), and red fruit (R) is
dominant to yellow fruit (r). A farmer mates a homozygous tall, red tomato
plant (TTRR) with a heterozygous tall, red tomato plant (TtRr). What is the
percent chance that the offspring will be dwarf plants with yellow fruit?
5. In a flowering plant, tall (T) is dominant to short (t), and blue flowers (B) is
dominant to white flowers (b). A tall plant with white flowers (Ttbb) is crossed
with a short plant with blue flowers (ttBb). What is the chance that the
offspring will be short with white flowers?

Self-Reflect
Write a reflective essay about your future self. Your essay should cover, but
not limited to the following:
1. Your favorite phenotype of yourself
2. Your offspring inheriting your favorite phenotype
3. Application of punnett square for predicting the phenotype of your
offspring.

Answer Key
LESSON PRE-TEST
1. C
2. D
3. B
4. C
5. A
6. D
7. C
8. D
9. B
10. B

LET’S PRACTICE YOUR VOCABLARY

1. ALLELE
2. DOMINANT ALLELE
3. GENOTYPE
4. HOMOZYGOUS DOMINANT ALLELE
5. HEMOZYGOUS RECESSIVE ALLELE
6. HETEROYGOUS ALLELE
7. PHENOTYPE
8. RECESSIVE TRAIT
9. PUNNETT SQUARE
10. TEST CROSS

ENABLING TASK: PUNNET SQUARE

Sample Problem 1

1.) ff x Ff

f f
F Ff Ff

f ff ff 50% of its offspring will be wingless.

2.) Ff x Ff

F f
Ff Ff
F
Ff ff 25% of its offspring will be wingless.
f

Sample Problem 2

If the genotype of a winged dragon is FF,

ff x FF

f f

F Ff Ff

All of their offspring will have wings

If the genotype of a winged dragon is Ff,

ff x Ff

f f

F Ff Ff

f ff ff

50% of their offspring will have wings

We can determine the genotype of the parent winged dragon if we know

the phenotype and genotype of the offspring after mating with the wingless
dragon with a known genotype (ff). If all of their offspring have wings, the
genotype of the parent winged dragon is FF. If 50% of their offspring have
wings, and 50% do not have wings, the genotype of the parent winged dragon
is Ff.

ENABLING TASK: MONOHYBRID CROSS

Pp x Pp

P p

P PP Pp

p Pp Pp

All of their offspring have purple flowers (100%)

ENABLING TASK: DIHYBRID CROSS

PART I. THE DNA

Name: _______________________ Rating:

Program, Year, Section: ____________________ Date:______________

Lab 1. Extracting DNA from Banana

Title

Introduction

All living things pass on information from one generation to the next using the
same basic material, DNA. Within every living organism, most cells contain a
complete set of DNA instructions. The information in DNA tells our bodies how to
develop, grow, and work. It also controls many of the features that make an organism
unique.
Every cell contains DNA. Cells contain water, proteins, and Nucleic Acids
(DNA and RNA) contained in a membrane made of lipids (fat). In the following
activity, when you add soap to the cells of banana, it breaks the membranes open and
the contents of the cell, including the DNA, spill out. The salt changes the ionic
concentration of the water and makes it easier for the DNA and RNA to separate.
DNA will not dissolve in alcohol, so when you add alcohol to the solution, the DNA
collects where the two layers meet. In this activity, we will use common household
materials to break apart the cells in a banana and extract out its DNA.

Objectives
In this activity, you will:
1. Extract DNA from a riped banana.
2. Examine the nature of the extracted DNA from banana.
3. Explain the role of materials used in banana DNA extraction based on scientific
concepts and principles.

Materials  Coffee filter (or any filter

paper)
 1 banana (you may use other fruits)  Thick plastic bag (an ice water
 Water bag will do)
 Rubbing alcohol (70% or higher) that is ice cold  Tooth pick, paper clip (or
 Table salt anything that can be used to
collect your DNA)

Procedure

1. Mash a banana in a sealed thick clear plastic bag (e.g., ice-water bag). Add
about 1/3 cup of banana to the bag, remove the air, seal and then start squishing
it up. That’s about 1/3 a banana. Once it’s turned into a paste, set the bag aside.
2. Fill a clear glass with 1/2 cup of water. Slowly add in 2 teaspoons of dish soap
and 1/2 teaspoon of table salt. Gently mix this solution without making bubbles
until the salt dissolves. The salt will latter help the DNA stick together. Add this
solution to your sealed bag of squished up banana. Don’t add too much liquid.
Add enough so that you have a nice mixture that you cannot see through. That’s
probably about 1/4 of a cup of soap solution. Flatten out your baggie to remove
most of the air and then seal it up. Gently squish the liquid around. If you have
the time, let this mixture sit for 10-20 minutes to give the detergent time to
release a lot of DNA.
3. Place a coffee filter (or any clean filter paper) on top of a glass and carefully pour
your banana mixture into the filter. You can gently squeeze the filter to get more
liquid out, just don’t break it! This is the solution that contains the DNA.
4. Pour the cold rubbing alcohol (or ethyl alcohol will do) down the side of the
glass very carefully. You are trying to create a layer of alcohol that floats on the
top of the water solution. The DNA will come out of solution at the boundary
layer between the water and alcohol. You should see some white string almost
cotton like strands begin to appear in the glass. That is the DNA!
5. Let the solution sit for a few minutes and you should see more DNA come out
of the solution. You can collect the DNA using a toothpick, chopstick or
paperclip. You have extracted DNA at home!

For the procedure, watch this video: https://youtu.be/sxd1IKNBnfQ

 Plastic bag
 Coffee filter (or any
clean filter paper)
 toothpick or paperclip
 Clear glasses

Guide Questions:
 What does the banana DNA look like?
 Why was the banana used in this activity? Can you use other fruits? If yes, why?
 Why is it necessary to add a cold alcohol to the fruit mixture?
 Why is it necessary to add salt to the fruit mixture?
 Why is it necessary to add a liquid detergent to the fruit mixture?

Prepare a laboratory report for this activity

People and The Earths Ecosystem Lesson 1 4
No ratings yet
People and The Earths Ecosystem Lesson 1 4
12 pages
Earth Science Syllabus
No ratings yet
Earth Science Syllabus
7 pages
Introduction To Biology
No ratings yet
Introduction To Biology
25 pages
Appointment
50% (2)
Appointment
2 pages
Division of Bachelor in Elementary Education: West Visayas State University
100% (3)
Division of Bachelor in Elementary Education: West Visayas State University
6 pages
Module 1
100% (1)
Module 1
16 pages
Chromosomal Theory of Inheritance
100% (1)
Chromosomal Theory of Inheritance
3 pages
Syllabus in Biological Science
No ratings yet
Syllabus in Biological Science
8 pages
Laboratory Manual in Genetics
No ratings yet
Laboratory Manual in Genetics
118 pages
Genetics Midterm
No ratings yet
Genetics Midterm
30 pages
Lesson 1: SC - Sci 1 - Teaching Science in The Elementary Grades
No ratings yet
Lesson 1: SC - Sci 1 - Teaching Science in The Elementary Grades
44 pages
Nature Environmental Science
No ratings yet
Nature Environmental Science
32 pages
Tos For Biological Science
No ratings yet
Tos For Biological Science
5 pages
Chapter 2 - Components of Ecosystem
No ratings yet
Chapter 2 - Components of Ecosystem
28 pages
Earth Science MODULE 1 Intro
100% (1)
Earth Science MODULE 1 Intro
43 pages
Unit 5 Lesson A ICT Tools For Collaboration and Sharing Resources
No ratings yet
Unit 5 Lesson A ICT Tools For Collaboration and Sharing Resources
5 pages
Syllabus For Science, Technology, and Society (STS)
No ratings yet
Syllabus For Science, Technology, and Society (STS)
2 pages
Evolution, Species, Interactions and Biological Communities
No ratings yet
Evolution, Species, Interactions and Biological Communities
21 pages
Introduction To Science, Technology, and Society: Study Guide For Module No. 1
No ratings yet
Introduction To Science, Technology, and Society: Study Guide For Module No. 1
5 pages
1 ZOOLOGY Defined
100% (1)
1 ZOOLOGY Defined
6 pages
MODULE 1-Genetics
No ratings yet
MODULE 1-Genetics
13 pages
STS Reviewer
No ratings yet
STS Reviewer
52 pages
Systematics Lec Notes CH1
100% (1)
Systematics Lec Notes CH1
5 pages
Syllabus STS New Normal
No ratings yet
Syllabus STS New Normal
11 pages
SED 3269 Module 1 - History of Astronomy
No ratings yet
SED 3269 Module 1 - History of Astronomy
24 pages
Teacher in Society
No ratings yet
Teacher in Society
7 pages
Chapter 1 - Genetics-An Introduction PDF
100% (1)
Chapter 1 - Genetics-An Introduction PDF
31 pages
Chapter 1 - Nature of Environmental Science
No ratings yet
Chapter 1 - Nature of Environmental Science
40 pages
MST Module 3
100% (3)
MST Module 3
83 pages
UNIT III. Taxonomy and Systematics-1
No ratings yet
UNIT III. Taxonomy and Systematics-1
41 pages
DLP Protein Synthesis
No ratings yet
DLP Protein Synthesis
11 pages
Frog Lab
100% (1)
Frog Lab
4 pages
BIOLOGY 2 (Pedigree Analysis) A4
No ratings yet
BIOLOGY 2 (Pedigree Analysis) A4
7 pages
Environmental Science - (Biodiversity)
No ratings yet
Environmental Science - (Biodiversity)
83 pages
Chromosomes Powerpoint
No ratings yet
Chromosomes Powerpoint
14 pages
Davao Oriental State College of Science and Technology: Syllabus
No ratings yet
Davao Oriental State College of Science and Technology: Syllabus
10 pages
Bse III-3 Sci117 Module 1
No ratings yet
Bse III-3 Sci117 Module 1
15 pages
GMRC Teacher As God's Masterpiece
No ratings yet
GMRC Teacher As God's Masterpiece
15 pages
Genetics - The Science of Heredity and Variation Module 1
100% (1)
Genetics - The Science of Heredity and Variation Module 1
6 pages
Earth Science
No ratings yet
Earth Science
70 pages
2nd Sem Q1 Week 3 Lesson 1 Patterns of Descent With Modification
No ratings yet
2nd Sem Q1 Week 3 Lesson 1 Patterns of Descent With Modification
32 pages
General Biology Reviewer:: - Synthesis of Biological Macromolecules
No ratings yet
General Biology Reviewer:: - Synthesis of Biological Macromolecules
4 pages
Iucn
No ratings yet
Iucn
34 pages
ES-LECTURE 1 - The Multidisciplinary Nature On Environmental Science
No ratings yet
ES-LECTURE 1 - The Multidisciplinary Nature On Environmental Science
52 pages
4 Pic 1 Word: General Biology Edition
100% (1)
4 Pic 1 Word: General Biology Edition
6 pages
General Biology 2
No ratings yet
General Biology 2
4 pages
Development of Evolutionary Thought
No ratings yet
Development of Evolutionary Thought
20 pages
Learning/Thinking Styles and Multiple Intelligences
No ratings yet
Learning/Thinking Styles and Multiple Intelligences
12 pages
Chapter 1 Research in Teaching Science 1
No ratings yet
Chapter 1 Research in Teaching Science 1
4 pages
2 Roles and Products of Sytematics On Modern Biology
No ratings yet
2 Roles and Products of Sytematics On Modern Biology
12 pages
STS 8-Biodiversity
No ratings yet
STS 8-Biodiversity
27 pages
Midterm Exam The Teaching Profession
No ratings yet
Midterm Exam The Teaching Profession
5 pages
Lesson-exemplar-Q2week 4
No ratings yet
Lesson-exemplar-Q2week 4
24 pages
AQUATIC BIOME in Earth Science (3rd Year College)
No ratings yet
AQUATIC BIOME in Earth Science (3rd Year College)
23 pages
Science Technology Society Learning Approach: by Group 1
No ratings yet
Science Technology Society Learning Approach: by Group 1
23 pages
Species Concepts and Intraspecific Variation
No ratings yet
Species Concepts and Intraspecific Variation
46 pages
Sci 313.313L - Genetics-Learning Material - Vol. I
No ratings yet
Sci 313.313L - Genetics-Learning Material - Vol. I
55 pages
BIO 320 - Syllabus - Summer 2023 - 05-19-2023
100% (1)
BIO 320 - Syllabus - Summer 2023 - 05-19-2023
9 pages
BIOL2301 001 U2024W Syllabus
No ratings yet
BIOL2301 001 U2024W Syllabus
9 pages
Biol220 Su 2022 Syllabus PDF
No ratings yet
Biol220 Su 2022 Syllabus PDF
4 pages
BIOS2003-Fall 2008-Genetics
No ratings yet
BIOS2003-Fall 2008-Genetics
5 pages
Topic Outline:: Salcedo, Eastern Samar 6807 Eastern Samar, Philippines
No ratings yet
Topic Outline:: Salcedo, Eastern Samar 6807 Eastern Samar, Philippines
3 pages
Document
No ratings yet
Document
2 pages
Application Lettter
No ratings yet
Application Lettter
2 pages
Detailed Lesson Plan in Science - Measure
100% (1)
Detailed Lesson Plan in Science - Measure
6 pages
WRO 2022 Future Innovators General Rules
No ratings yet
WRO 2022 Future Innovators General Rules
16 pages
Giant Steps Tutorial
100% (1)
Giant Steps Tutorial
8 pages
Template RPH CEFR
No ratings yet
Template RPH CEFR
2 pages
DLL WEEK 4 Q3 Mapeh8 Health
No ratings yet
DLL WEEK 4 Q3 Mapeh8 Health
2 pages
Suppose Vehicles Arrive at A Signalized Road Inter...
No ratings yet
Suppose Vehicles Arrive at A Signalized Road Inter...
2 pages
Short Advt. of Junior Lecturer Adv No 02 of 2009-10
No ratings yet
Short Advt. of Junior Lecturer Adv No 02 of 2009-10
3 pages
Worksheet Essay Practice - Julius Caesar
100% (2)
Worksheet Essay Practice - Julius Caesar
3 pages
Psychiatry Nursing Journal (Jurnal Keperawatan Jiwa)
No ratings yet
Psychiatry Nursing Journal (Jurnal Keperawatan Jiwa)
5 pages
Job Description: Head of Development, Royal Irish Academy of Music
No ratings yet
Job Description: Head of Development, Royal Irish Academy of Music
5 pages
9 Month Day Wise Study Plan Lyst1731926853840
No ratings yet
9 Month Day Wise Study Plan Lyst1731926853840
29 pages
CTFC Qualification Specification-Specification PDF
No ratings yet
CTFC Qualification Specification-Specification PDF
14 pages
Unit 07 Culture, Language and Communication VAN Anthropology Optional
No ratings yet
Unit 07 Culture, Language and Communication VAN Anthropology Optional
18 pages
IIPH Hyderabad - Health Informatics, Brochure, 2018
No ratings yet
IIPH Hyderabad - Health Informatics, Brochure, 2018
4 pages
BPEd LPE FormatFINAL
No ratings yet
BPEd LPE FormatFINAL
1 page
Maths Lesson Plan
No ratings yet
Maths Lesson Plan
2 pages
Yenepoya University: Course Fee
No ratings yet
Yenepoya University: Course Fee
1 page
Detailed Lesson Plan Mathematics Grade L
No ratings yet
Detailed Lesson Plan Mathematics Grade L
4 pages
21 Batch All Details 21-476 To 21-4A0
No ratings yet
21 Batch All Details 21-476 To 21-4A0
4 pages
Notice of Meeting-1st MDC Ldip Alignment Meeting & Ws
100% (1)
Notice of Meeting-1st MDC Ldip Alignment Meeting & Ws
5 pages
Professional Engineer Summary Statement Paragraph Number in The Career Episode(s) Where The Element Is Addressed
No ratings yet
Professional Engineer Summary Statement Paragraph Number in The Career Episode(s) Where The Element Is Addressed
6 pages
CV
No ratings yet
CV
1 page
Exorcising The Popular Seriously Luhmann S Concept of Semantics
No ratings yet
Exorcising The Popular Seriously Luhmann S Concept of Semantics
20 pages
Outline
No ratings yet
Outline
8 pages
Universitas Mathla'Ul Anwar Banten: Transkrip Akademik Sementara
No ratings yet
Universitas Mathla'Ul Anwar Banten: Transkrip Akademik Sementara
2 pages
Neuroeconomics 1
No ratings yet
Neuroeconomics 1
3 pages
2.1-6 Task Sheet (Training Activity Matrix)
100% (1)
2.1-6 Task Sheet (Training Activity Matrix)
4 pages
Modified Basic Education Enrollment Form: Student Information
No ratings yet
Modified Basic Education Enrollment Form: Student Information
1 page
Tle January
67% (3)
Tle January
10 pages
FPC Syllabus
No ratings yet
FPC Syllabus
3 pages

Genetics Learning Material (Midterm)

Uploaded by

Genetics Learning Material (Midterm)

Uploaded by

EDUC SCI 323A GENETICS

Genetics is a discipline which includes the transmission and variation of inherited

Part I. Genetics (Lecture)

This instructional material covers the following topics:

After going through each unit, you will be able to:

Major Examinations (Mid-term and Final term examinations)

Grading System: 40% Major exam; 60 % Class Standing

PLEASE DO NOT LEAVE ANY QUESTIONS UNANSWERED!

UNIT 2. MEIOSIS AND SEXUAL LIFEYCLES 2 weeks

UNIT 3. MENDELIAN GENETICS 2 weeks

Lesson 1 Mendel’s Laws of Inheritance……………………........ 102 1 week

UNIT 4. EXTENDING MENDELIAN GENETICS 3 weeks

Lesson 1 The Degree of Dominance 1 week

Lesson 2 Pedigree Chart 1 week

Lesson 3 The Chromosomal Basis of Inheritance 1 week

UNIT 5. GENE FUNCTION 2 weeks

Lesson 1 The Genetic Code........................................................... 1 week

UNIT 6. GENETIC ENGINEEERING AND BIOTECHNOLOGY 1 week

Lesson 1 Biotechnology and Genetic Engineering........................ 1 week

Part II. Genetics (Laboratory)

About i Lab Home

i Lab Home includes wet, hands-on laboratory experiments in Genetics to be done

i Lab Home Rules and Regulations

1. Laboratory report (with documentation such as pictures or videos)

Good Day! I’m Teacher Smiley! I am the

 Read all directions carefully.

Photo Credit: Pinterest.com

Lesson 1.1 The

The History and Development

Topic Learning Outcomes

After going through the lesson, you will be able to:

T he observation on the similarities

observed a long time ago. It is Gregor Mendel Filipino-made PCR Kit

What do you already know about the history of Genetics?

A. Name the Scientist in the History

___Gregor Mendel_____ _________________________ _______________________

He is the father of Genetics. He He isolates DNA for He is the first to describe

____________________ ___________________ ___________________ ___________________

___________________ _________________________ _________________________

PCR was inveneted Genetic Code cracked Launched of

1. _________________________________ 11. _______________________________

C. Write a short essay as your response to a selected scientist who have

Thank you for answering! 😊

Self-Rating Competency Checklist

. After answering the lesson pre-test, please rate

I I can do I can I can do

Based from the lesson pre-test, please write a short

LET’S GET STARTED!

1. Read the headline on the newly sequenced genome of COVID-19 virus.

Chinese Scientists Sequence Genome of COVID-19

E-Visit Corner: Science News E-Visit Corner : Research Article

LET’S THINK AND REFLECT!

1. What is the recent discovery or achievement of Genetics posed on the

LET’S GET TO KNOW MORE!

The History of Genetics

Our Filipino Scientists

Noted for his comprehensive researches

The Quest After Cracking the Code

1966 The Genetic Code was cracked

LET’S DO AND DISCOVER!

Was everything clear to you? You may go back to the last

Look for Your Scientists and their Achievements

Look for Your Modern Scientists and their Achievements

1. Read 2 headlines about any recent discovery, breakthrough, or achievements

a. Title of the Headline:

c. Scientist or group of Scientists:

d. What do you think are the present impacts?

e. What do you think are the future impacts?

a. Title of the Headline:

e. What do you think is the future impact?

Look for Your Filipino Scientists and their Achievements

 Filipino-made PCR diagnostic kit for COVID-19 (Dr. Raul Destura)

Thank you for answering! 😊

Name: ___________________________________________ Date: ___________

Worksheet 1.1. The History and Development of Genetics

Part I. True or False

_Gregor Mendel_ _ _

__________ _ _ _________

_______ _ _____________

1. ___ 11. _

Name: _________________________________ Date: _

1. CNTOM__RE  It is the central region of a eukaryotic chromosome where

2. CHOOSOE  A structure in the cell nucleus that contains DNA,

6. OMOLOOU CROOSOES  a pair of chromosomes with the

7. NCEIC A__IDS  A biomolecule consisting of multiply repeat units of

8. RIOUCEIC ACD  a derivative of DNA having ribose in place of

9. RBOE  It is a naturally occuring petose sugar of Ribonucleic acid (RNA).

10. ITR CHOMTD__  Either of the two chromatids of a