OUR PATRONS

Sh. Tajuddin Shaik

Deputy Commissioner
KVS Regional Office, Jabalpur

Mrs. Vandana Sekar

Assistant Commissioner
KVS Regional Office, Jabalpur

GUIDANCE
Sh. Manish Gupta
Principal
KV SECL NOWROZABAD

Content Team of Kendriya Vidyalaya Nowrozabad

1. Sh. Anuja Rai, PGT (Hindi)
2. Sh. Ravi Kumar, PGT (CS.)
3. Mrs. Nimisha Mishra, PGT (Chem)
4. Sh. Rajendra Kr. Barman, PGT (Maths)
5. Sh.D.K. Chaudhary, TGT (P&HE)
6. Sh Ganpat Chaurasia, PGT (Phy)- Cont.
7. Ms. Richa Verma, PGT (Bio)- Cont.
8. Sh. Prashant Jayaswal, PGT (Eng.) - Cont.
Compilation
Sh. Rajendra Kr. Barman, PGT (Maths)
Cover page Design
Sh. S.P.Soni,PRT (cont.)

CONTENT
SYLLABUS FOR TERM – II (as prescribed by CBSE)
ENGLISH, HINDI, MATHS, PHYSICS, CHEMISTRY, BIOLOGY,COMPUTER SCIENCE, PHYSICAL EDUCATION
Question Bank & Revision Notes for Term 2
ENGLISH, HINDI, MATHS, PHYSICS, CHEMISTRY, BIOLOGY,COMPUTER SCIENCE, PHYSICAL EDUCATION
SAMPLE PAPERS with Marking scheme for Term 2 (as issued by CBSE)
ENGLISH, HINDI, MATHS, PHYSICS, CHEMISTRY, BIOLOGY,COMPUTER SCIENCE, PHYSICAL EDUCATION
 English Core
Code No. 301

QUESTION BANK Class XII (2021-22) TERM 2

Que. 1 )Read the passage given below and answer the questions that follow:

1. Though more than a year has passed since the E-waste (Management and Handling) Rules came
into effect in May 2012, their implementation is still in a nascent stage, at least in Varanasi, one of
the major cities of Uttar Pradesh. In fact, the state ranks fourth among the 10 largest e-waste
generating states in the country.

2. The e-waste (Management and Handling) Rules 2011 mandate for safe disposal of electronic
and electrical wastes through private bodies. According to the UPSPCB official, it is mandatory for
the municipal corporation to provide a site to the private firm for proper disposal of e-waste. The
site for this purpose has been made available in Ram Nagar area, he said. The E-waste
(Management and Handling) Rules 2011 also suggest that it is the responsibility of the municipal
corporation to ensure that e-waste, if found to be mixed with municipal solid waste, is properly
segregated, collected and is channelized to either authorized collection centre or dismantler or
recycler.

3. The Research Unit of the Rajya Sabha has compiled a comprehensive report on e-waste in India.
According to the report, there are 10 states that contribute up to 70 per cent of the total e-waste
generated in the country, while 65 cities generate more than 60 per cent of the total e-waste in
India. Among the 10 largest e-waste generating states, Maharashtra ranks first followed by Tamil
Nadu, Andhra Pradesh, Uttar Pradesh, West Bengal, Delhi, Karnataka, Gujarat, Madhya Pradesh
and Punjab.

4. All over the world, the quantity of electrical and electronic waste generated each year,
especially by computers and televisions, has assumed alarming proportions.

5. Globally, about 20-50 MT (million tonnes) of e-wastes is disposed of each year, which accounts
for 5% of all municipal solid waste. A report of the United Nations predicted that by 2020, e-waste
from old computers would jump by 400 percent on 2007 levels in China and by 500 percent in
India. Additionally, e-waste from discarded mobile phones would be about seven tips higher than
2007 levels and, in India, 18 times higher by 2020. Such predictions highlight the urgent need to
address the problem of e-waste in developing countries like India where the collection and
management of e-waste and the recycling process is yet to be properly regulated.

6. E-waste releases many toxic substances that are serious health hazards. Unless suitable safety
measures are taken, these toxic substances can critically affect the health of employees and others
in the vicinity — who manually sort and treat the waste — by entering their body through
respiratory tracts, through the skin, or through the mucous membrane of the mouth and the
digestive tract. Therefore, the health impact of e-waste is evident. There is no doubt that it has
been linked to the growing incidence of several lethal or severely debilitating health conditions,
including cancer, neurological and respiratory disorders, and birth defects.

7. This impact is found to be worse in developing countries like India where people engaged in
recycling e-waste are mostly in the unorganized sector, living in close proximity to dumps or
landfills of untreated e-waste and working without any protection or safeguards. Many workers
engaged in these recycling operations are the urban poor and unaware of the hazards associated
with them. (Source: TNN)

On the basis of your understanding of the above passage, complete the statements given below
.with the help of options that follow:

(a) It is mandatory that the …………………………. should provide a proper e-disposal site to private
firms.
(i) municipal committee
(ii) municipal corporation
(iii) health ministry
(iv) area counselor

(b) After segregation, the e-waste should be …………………………. .

(i) reused
(ii) reduced
(iii) recycled
(iv) resold

(c) By 2020, e-waste from old computers would jump by …………………………. percent on 2007 level
in India.
(i) 300
(ii) 400
(iii) 500
(iv) 600

(d) The toxic substances enter the body through …………………………. .

(i) respiratory tracts
(ii) skin
(iii) digestive tract
(iv) all of these

(e) The implementation of e-waste rules is still in a nascent stage which means …………………………. .
(i) completely developed stage
(ii) not yet fully developed stage
(iii) in an unknown stage
(iv) both (i) and (iii)

Answer the following.

(a) The E-waste (Management and Handling) Rules came into effect in May 2012. (True/False)
(b) In Uttar Pradesh, Ram Nagar is the site for e-waste management. (True/False)
(c) The Rajya Sabha has compiled a report on e-waste in India. (True/False)
(d) There is an urgent need to address e-waste management …………………………. in countries.
(e) In India people engaged in recycling e-waste are mostly in the …………………………. sector.
Find words from the passage which mean the same as the following:
(i) compulsory (para 2)
(ii) surroundings (para 6)

Que. 2 )Read the following passage carefully.

1. South India is known for its music and for its arts and rich literature. Madras or Chennai can be
called the cultural capital and the soul of Mother India. The city is built low in pleasant contrast to
the ghoulish tall structures of Mumbai and Kolkata. It has vast open spaces and ample greenery.
The majestic spacious Mount Road looks like a river, wide and deep. A stroll on the Marina beach
in the evening with the sea glistening in your face is refreshing. The breeze soothes the body, it
refreshes the mind, sharpens the tongue and brightens the intellect.

2. One can never feel dull in Chennai. The intellectual and cultural life of the city is something of a
marvel. Every street corner of Chennai has a literary forum, a debating society and music, dance
and dramatic club. The intelligent arguments, the sparkling wit and dashing irony enliven both
the political and the literary meetings. There is a young men’s association which attracts brilliant
speakers and equally brilliant listeners to its meetings. It is a treat to watch the speakers use their
oratorical weapons. Chennai speakers are by and large sweet and urbane, though the
cantankerous, fire-eating variety is quite often witnessed in political campaigning. The urbane
speakers weave their arguments slowly like the unfolding of a leisurely Carnatic raga.

3. Music concerts and dance performances draw packed houses. There is hardly any cultural
family in Chennai that does not learn and patronise music and dance in its pristine purity.
Rukmani Devi Arundale’s ‘Kalakshetra’ is a renowned international centre. It has turned out
hundreds of celebrated maestros and dancers who have brought name and glory to our country.
Carnatic music has a peculiar charm of its own. It has the moon’s soft beauty and moon’s soft pace.
Thousands of people flock to the temple ‘maidans’ to get drunk with the mellifluous melodies of
their favourite singers. They sit out all night in the grueling heat, swaying to the rhythm of
‘nadaswaram’ and rollicking with the measured beats of ‘mridangam’. M.S. Subbulakshmi is
considered to be the nightingale of the South.

4. The Gods might descend from heaven to see a South Indian damsel dancing. There are several
varieties of South Indian dance – Bharatnatyam, Mohiniyattam, Kuchipudi, Kathakali, etc. Age
cannot wither nor custom stale its beautiful variety. Bharatnatyam is the most graceful and
enchanting dance form, whereas Kathakali is most masculine and virile. South Indian dances
combine voluptuousness with purity. Here, every muscle and fibre of the body vibrates into life,
and as the tempo increases, a divine flame-like passion bodies forth as if making an assault on
heaven.

5. South Indian dress, particularly of the males, is puritanically simple. There you cannot
distinguish a judge from an ‘ardali’ by their dress. South Indian ladies too look charming and
graceful in their colourful Kanjeevaram and Mysore silk sarees.

6. South Indian cuisine, especially ‘dosa’, ‘idli’ and ‘vada’ are so delicious that now we
can enjoy them almost everywhere in India as well as in some foreign countries. The Madras ‘idli’,
which was a favourite of Gandhiji, is served with ‘sambhar’ and ‘coconut chutney’.

A. On the basis of your understanding of the passage, answer the following questions by
choosing the most appropriate option. (1 x 5 = 5 marks)

Question (i)For what is South India mainly known?

(a) For tasty food
(b) For its traditional, music, art, literature
(c) For scenic beauty
(d) For its delicate and precise ways

Question (ii)Why is it a treat to watch the speakers?

(a) Because they use oratorical weapons

(b) Because they are witnessed in campaigning
(c) Because they weave their arguments fastly
(d) Because they argue and complain a lot.

Question (iii)What is M.S. Subbulakshmi considered to be?

(a) Graceful and enchanting
(b) Masculine and virile
(c) Nightingale of the South
(d) Moon’s soft beauty

Question (iv)Which is the South Indian dance form?

(a) Bharatnatyam
(b) Kuchipudi
(c) Kathakali
(d) All of these

Question (v)Why are South Indian dances special?

(a) Because Gods come from heaven to see them
(b) Because there aren’t many varieties of dance
(c) Because they are pure as well as sensuous
(d) Because they make an assault on heaven

B. Answer the following questions briefly. (1 × 7 = 7 marks)

Question (i)How does the breeze on Marina Beach affect the author?
Question (ii)How do we know that music is very important for the people of South India?
Question (iii)What is the common connection between language, music and dance of South India?
Question (iv)What makes Carnatic music charming?

Question (v)What is Kalakshetra renowned for?

Question (vi)Find a word from the passage (para-2) which means ‘confident, comfortable and
polite in social situations’.
Question (vii)Find a word from the passage (para-3) which means ‘having a pleasant and flowing
sound’.

Que. 3 ) M/s Shyam Lai & Sons are opening a new general store ‘Galaxy Novelties’ in Geetanjali
Enclave, Dwarika, Delhi. The inauguration ceremony is fixed for Sunday, the 19th of October 20XX
at 11 a.m. Prepare a draft of formal invitation letter for the purpose.

Que. 4 )You are Leena Sen. The wedding of your elder sister Reena Sen is going to be held on
the 15th May, 20XX at Hotel Lake View, Udaipur. Write out an informal invitation to your friend
Vinnie requesting her to attend the function.

Que. 5 )Draft an application for the post of an accountant in Pioneers (Pvt.) Ltd. Co. Hyderabad in
response to their advertisement that appeared in The Times of India dated 1st August, 20XX.
Prepare a biodata to be enclosed. You are Nipun/Aparna.

Que. 6 )MMD School, Nashik, recently organized a science symposium on the topic: ‘Effect of
pollution on quality of life’. You are Amit/AmitaRaazdan, editor of the school magazine. Write a
report on the event for your school magazine. (120 – 150 words)

Que. 7 )How did the ironmaster react on seeing the stranger lying close to the furnace? (All India
2012)
.

Que. 8 )Why did the peddler derive pleasure from his idea of the world as a rattrap?

Que. 9 )What were the terms of the indigo contract between the British landlords and the Indian
peasants? (All India 2015)

Que. 10 )How was the Champaran incident a turning point in Gandhiji’s life? (Comptt. All India
2010)

Que. 11 ) Read the extract given below and answer the questions that follow.
“Spite of despondence, of the inhuman dearth
Of noble natures, of the gloomy days,
Of all the unhealthy and o’er-darkened ways
Made for our searching: yes in spite of all,
Some shape of beauty moves away the pall
From our dark spirits.”

(a) Name the poem and the poet.

(b) Why are we despondent?
(c) What removes “the pall from our dark spirits”?
(d) Explain, “the inhuman dearth of noble natures.” ’
(d) What removes the pall from our dark spirits?

Que. 12 )Read the extract given below and answer the questions that follow: (Delhi 2000)
Therefore, on every morrow, are we wreathing
A flowery band to bind us to the earth,
Spite of despondence, of the inhuman dearth
Of noble natures, of the gloomy days,
Of all the unhealthy and o’er-darkened ways
Made for our searching:

1. What are the flowery bands that bind us to the earth?

2. What message do the above lines convey?

Que. 13 )Read the extract given below and answer the questions that follow: (Delhi 2010)
Aunt Jennifer’s tigers prance across a screen,
Bright topaz denizens of a world of green.
They do not fear the men beneath the tree;
They pace in sleek chivalric certainty.

1. How are aunt Jennifer’s tigers described?

2. Why are they described as denizens of a world of green?
3. Why are they not afraid of the men?

Que. 14 )Why did Roger Skunk go to visit the old owl? (Compartment 2014)

Que. 15 )Why is an adult’s perspective on life different from that of a child’s? (All India 2010)

Que. 16 )What qualities of Mr Lamb attracted Derry to him? (All India 2009)
Que. 17 ) In what sense is the friendship between Mr Lamb and Derry fruitful?
Que. 18 )What clues did the answer sheet of Evans provide to the Governor?
Que. 19 )What kind of person was Evans? Why did he want to sit for O-level German examination?

Que. 20 )What does Keats consider an endless fountain of immortal drink and why does he
call its drink immortal?
 केन्द्रीय विद्यालय एस॰ ई॰ सी॰ एल॰ नौरोजाबाद
प्रश्न बैंक
कक्षा – 12 विषय-विन्दी सत्र – 2
कायाा लयी विन्दी और रचनात्मक लेखन 20

प्रश्न-1 दिए गए नए और अप्रत्यादित दिषयदों में से दिसी एि दिषय पर लगभग 150 िब्दों
में रचनात्मि ले ख दलखखए |
ि)मे रा दप्रय टाइम पास
ख) झरदखे से बाहर
ग) एि िामिाजी औरत िी िाम
प्रश्न-2 अपने मदहल्ले में िषाा िे िारण उत्पन्न हुए जल भराि िी समस्या िी ओर ध्यान
आिृष्ट िरने िे दलए नगरपादलिा अदििारी िद पत्र दलखखए |
प्रश्न-3 चु नाि िे दिनदों में िायािताा घर, दिद्यालयदों और सािाजदनि जगहदों आदि पर
बेतहािा पदस्टर लगा जाते हैं | इससे लदगदों िद हदने िाली असुदििा पर अपने दिचार व्यक्त
िरते हुए दै वनक लोक िाणी समाचार पत्र िे जनमत िॉलम िे दलए पत्र दलखखए |
प्रश्न-4 िहानी िे प्रमु ख तत्त्व िौन-िौन से हैं ?
प्रश्न -5 िहानी िा नाट्य रूपान्तरण िरते समय दिन-दिन बातदों िा ध्यान रखना चादहए ?
प्रश्न-6 नाट्य रूपान्तरण िरते समय िौन-िौन सी समस्याएँ आती हैं ?
प्रश्न-7 सोंिाि िद नाटि िा सबसे जरूरी और सिक्त माध्यम क्दों माना जाता है ?
प्रश्न-8 नाटि सादहत्य िी अन्य दििाओों से िैसे अलग हदता है ?
प्रश्न-9 समाचार िे तत्दों पर प्रिाि डादलए |
प्रश्न-10 समाचार – ले खन िी िैली पर प्रिाि डादलए |
प्रश्न-11 समाचार िे छह ििारदों िा क्ा महत्त्व है ?
प्रश्न-12 मु द्रण माध्यमदों िी दिन्ीों 2 दििेषताओों और िमजदररयदों िा उल्लेख िीदजए |
प्रश्न-13 उल्टा दपरादमड िैली िे दितने अोंग- अियि हदते हैं ?
प्रश्न-14 फीचर और आले ख में अोंतर स्पष्ट िीदजए |
प्रश्न-15 पत्रिार दितने प्रिार िे हदते हैं ?
प्रश्न-16 पत्रिाररता िे प्रमु ख प्रिार बताइये |
प्रश्न-17 िॉचडॉग पत्रिाररता दिसे िहते हैं ?
प्रश्न-18 पेज थ्री पत्रिाररता दिसे िहते हैं ?
प्रश्न-19 दििेषीिृत पत्रिाररता िे प्रमु ख क्षे त्र िौन-िौन से हैं ?
प्रश्न -20 स्तम्भ ले खन से क्ा तात्पया है ?
प्रश्न-21 पत्रिाररता िी भाषा में बीट दिसे िहते हैं ?
प्रश्न-22 ‘इन डे फ़्थ ररपदटा ’’ क्ा है ?
प्रश्न-23 पत्रिारीय ले खन एिों सृजनात्मि ले खन में अोंतर बताइये |
प्रश्न-24 आले ख दलखते समय दिन-दिन बातदों िा ध्यान रखना चादहए ?
प्रश्न-25 सोंपािन िे प्रमु ख दसद्धान्त बताइये |
अथिा
सोंपािि िे प्रमु ख बैसाखखयाँ बताइये
पाठ्यपु स्तक आरोि भाग-2 15
प्रश्न-19 िदिता िे दिन उपमानदों िद िे खिर यह िहा जा सिता है दि “उषा” िदिता
गाँ ि दि सुबह िा गदतिील िब्-दचत्र है ?
प्रश्न-20 नई िदिता में िदष्ठि ,दिराम दचह्दों और पोंखक्तयदों िे बीच िा स्थान भी िदिता िद
अथा िे ता है | उषा िदिता में िदष्ठिदों से िदिता में दििेष अथा पैिा हुआ है –समझाइए
प्रश्न-21 िदितािाली िे आिार पर पुदष्ट िीदजए दि तुलसी िद अपने समय िी आदथा ि-
सामादजि समस्याओों िी जानिारी थी |
प्रश्न-22 िदिग्रस्त माहौल में हनुमान िे अितरण िद िरुण रस िे बीच िीर रस िा
आदिभाा ि क्दों िहा गया है ?
प्रश्न-23 लक्ष्मण मूछाा और राम िा दिलाप िदिता िे भादषि सौोंिया पर दटप्पणी िीदजए |
अथिा
प्रश्न-24 िदिता िे भाि-िैदिष्ट्ट्य िद स्पष्ट िीदजए |
प्रश्न-25 गजल पाठ िे आिार पर खुि िा पिाा खदलने िा क्ा आिय है ?
प्रश्न-26 रुबाईया छों ि िी दििेषता बताइये |
प्रश्न-27 पहलिान िी ढदलि िहानी में ले खि ने गाँ ि िी दिस दिभीदषिा िा िणान इस
िहानी में दिया है ?िैसे
प्रश्न-28 िहानी िे दिस दिस मदड़ पर लु ट्टन िे जीिन में क्ा क्ा पररिता न आए ?
प्रश्न-29 ‘लाहौर अभी भी उनिा ितन है और िे हली मेरा या मे रा ितन ढािा है ’ –जैसे
उद्गार दिस सामादजि उद्गार िा सोंिेत िरते हैं ?
प्रश्न-30 नमि िी पुदड़या ले जाने िे सोंबोंि में सदफया िे मन में क्ा द्वों द्व था ?
प्रश्न-31 जादतप्रथा िद श्रम-दिभाजन िा ही एि रूप न मानने िे पीछे अोंबेडिर िे क्ा
तिा हैं ?
प्रश्न-32 जादतप्रथा िे ले खि िे मत से ‘िासता” िी व्यापि पररभाषा क्ा है ?
प्रश्न-33 िारीररि िोंि परों परा और सामादजि उत्तरादििार िी दृदष्ट से मनुष्दों में
असमानता सोंभादित रहने िे बािजूि अोंबेडिर समता िद एि व्यिहाया दसद्धान्त मानने
िा आग्रह क्दों िरते हैं ? इसिे पीछे उनिे क्ा तिा हैं ?
अनुपूरक पाठ्यपु स्तक वितान भाग -2 5

प्रश्न-34 क्ा दसोंिु घाटी िी सभ्यता िद जल सोंस्कृदत िह सिते हैं ? तिा सदहत उत्तर
िीदजये |
प्रश्न- 35 दसोंिु सभ्यता सािन सम्पन्न थी पर उसमें भव्यता िा आडों बर नहीों था | िैसे ?
प्रश्न-36 दसोंिु सभ्यता िी खूबी उसिा सौन्दया बदि है , जद राज पददषत या िमा पददषत न
हदिर समाज पददषत था’’ ऐसा क्दों िहा गया हैं ?
प्रश्न-37 दसोंिु सभ्यता ताित से िादसत हदने िी अपेक्षा समझ से अनुिादसत सभ्यता थी
,दसद्ध िीदजए|
प्रसन्न-38 ऐन िी डायरी उसिी दनजी भािनात्मि उथल-पुथल िा िस्तािेज़ भी है | इस
िथन िी दििेचना िीदजए |
प्रश्न-39 डायरी िे पन्ने पाठ िे आिार पर ऐन िे व्यखक्तत् िी तीन दििेषताओों पर प्रिाि
डादलए |
प्रश्न-40 ऐन िी डायरी िद एि महत्त्वपूणा िस्तािेज़ क्दों माना जाता है ?
 Mathematics
Code No. 041

QUESTION BANK Class XII (2021-22) TERM 2

INTEGRALS
2 Marks
1. Evaluate : 2.Evaluate : 3.Evaluate : 4.Evaluate :
𝒅𝒙
∫ 𝒔𝒊𝒏𝟐 𝒙𝒄𝒐𝒔𝟐𝒙 𝒔𝒆𝒄𝟐 𝒙 𝒅𝒙 𝟏
𝟐𝒙 𝒅𝒙 𝟏
𝒅𝒙
∫ ∫ ∫
𝒄𝒐𝒔𝒆𝒄𝟐 𝒙 𝟎 𝟏+𝒙
𝟐
𝟎 √𝟏 − 𝒙𝟐

4 Marks
5. Find : 6.Evaluate : 7.Evaluate : 8.Evaluate :
∫ (√𝒕𝒂𝒏 𝒙 + √𝒄𝒐𝒕 𝒙 ) dx 𝟓𝒙+𝟑 (𝟑 𝒔𝒊𝒏 𝜽−𝟐)𝒄𝒐𝒔𝜽 𝒅𝜽 𝒔𝒊𝒏 (𝒙−𝒂)
∫ dx ∫
𝟐
√(𝒙 +𝟒𝒙+𝟔) 𝟓−𝒄𝒐𝒔𝟐𝜽−𝟒 𝒔𝒊𝒏𝜽 ∫ 𝒔𝒊𝒏 (𝒙+𝒂) dx

𝟗. 𝐄𝐯𝐚𝐥𝐮𝐚𝐭𝐞 𝟏𝟎. 𝐄𝐯𝐚𝐥𝐮𝐚𝐭𝐞 11.Evaluate :

𝒙𝟐 + 𝒙 + 𝟏 𝒙𝟐 𝒙 𝒔𝒊𝒏−𝟏𝒙 12.Evaluate :
∫ 𝟐 ∫ (𝒙𝟐 +𝟒)(𝒙𝟐 +𝟗) dx ∫ dx
(𝒙 + 𝟏)(𝒙𝟐 + 𝟐) √(𝟏− 𝒙𝟐 ) √𝒙𝟐 +𝟏[𝒍𝒐𝒈(𝒙𝟐 +𝟏)−𝟐 𝒍𝒐𝒈𝒙]
∫ dx
𝒙𝟒

13. Evalute 14. Evalute 15. .Evaluate : 16. .Evaluate :

𝟑 𝟑 𝝅/𝟑 𝝅/𝟐
∫𝟏 ( (𝒙𝟐 + 𝟑𝒙 + 𝒆𝒙 ) dx, ∫𝟏 ( (𝒙𝟐− 𝒙) dx, (𝒔𝒊𝒏𝒙 + 𝒄𝒐𝒔𝒙) 𝒅𝒙 (𝒙𝒔𝒊𝒏𝒙𝒄𝒐𝒔𝒙) 𝒅𝒙
∫ ∫
as the limlit of the as the limlit of 𝝅/𝟔 √𝒔𝒊𝒏𝟐𝒙 𝟎 𝒔𝒊𝒏𝟒 𝒙 + 𝒄𝒐𝒔𝟒 𝒙
sum. the sum.

APPLICATION OF INTEGRALS
4 Marks
1. Using integration, find the area of region in the first quadrant enclosed by the x –
axis, the line y = x and the circle (𝒙𝟐 + 𝒚𝟐 = 𝟑𝟐) .
2. Find the area enclosed by the parabola 4y = 3x2 and the straight line 3x– 12y + 12=
0..
3. Using integration, find the area bounded by the curvex2 = 4y, and the line x = 4y – 2 .
4. Using integration, find the area of region {(x,y) : x2≤ y ≤ IxI}
5. Using integration, find the area of region {(x,y) : x2 + 𝒚𝟐≤ 1 ≤ x + y}
 DIFFERENTIAL EQUATIONS
2 Marks
𝟒
𝒅𝟐 𝒚 𝒅𝒚 𝟐
1 . Find the order and degree of the diffrential equation x2 (𝒅𝒙𝟐 )
= {𝟏 + (𝒅𝒙) }
𝒅 𝒅𝒚 𝟑
2. Find the sum of order and degree of the diffrential equation 𝒅𝒙
{( ) } = 0
𝒅𝒙
𝒆−𝟐√𝒙 𝒚 𝒅𝒙
3. Find the integrating factor of the diffrential equation ( − ) =1
√𝒙 √𝒙 𝒅𝒙

3 Marks
𝒅𝒚 𝒙𝒚
1. Find the particular solution of the diffrential equation 𝒅𝒙
= 𝒙𝟐 +𝒚𝟐 , given that y = 1 when x = 0
𝒅𝒚
2. Find the particular solution of the diffrential equation 𝒅𝒙
+ 2y tan x = sin x , given that y = 0
𝝅
when x = 𝟑

4 Marks
𝒅𝒚 𝟐
1. Solve the differential equation 𝒙 𝒍𝒐𝒈 𝒙 𝒅𝒙
+ y = 𝒙 log x
𝒅𝒚 𝒚
2. Find the particular solution of the diffrential equation x – y + x cosec( )= 0, given that y =
𝒅𝒙 𝐱
0 when x = 1
𝒚 𝒅𝒚 𝒚
3. Solve the differential equation x cos( ) = y cos( )+ x ; x ≠ 0
𝐱 𝒅𝒙 𝐱
𝒅𝒚
4. Solve the differential equation x 𝒅𝒙 + y- x + xy cot x =0 ; x ≠ 0
5. Solve the differential equation ( 1 + x2) dy + 2xy dx = cot x dx ; x ≠ 0

VECTOR ALGEBRA
2 Marks
1. Write the position vector of the point which divides the join of points with position vectors 3𝒂⃗ -
⃗ and 2𝒂
2𝒃 ⃗ + 3𝒃⃗ in the ratio 2 : 1
̂ + 𝟐𝒌
2. Write a vector of magnitude 15 units in the direction of the vector𝒊̂ − 𝟐𝒋 ̂
𝝅 𝝅 ̂ , then find the
3. If a unit vector 𝒂 ⃗ makes angle with 𝒊̂, with 𝒋̂ and an acute angle 𝜽 with 𝒌
𝟑 𝟒
value of .

4 Marks
̂ ̂ ̂
1. The two vectors 𝒋̂ + 𝒌 and 𝟑𝒊 − 𝒋̂ + 𝟒𝒌 represent the two sides AB and AC, respectively of ∆ ABC.
Find the length of the median through A .
2. Write the value of 𝝀 so that the vectors 𝒊̂ + 𝟐𝝀𝒋̂ + 𝒌 ̂ and 𝟐𝒊̂ + 𝒋̂ - 𝟑𝒌̂ are perpendicular to each
other.
3. Vectors ⃗𝒂,⃗⃗⃗𝒃 and ⃗𝒄 are such that ⃗𝒂 + ⃗𝒃 +𝒄 ⃗ = ⃗𝟎 and I𝒂
⃗ I = 3, I𝒃I = 5 and I𝒄
⃗ I = 7. Find the angle
between 𝒂 ⃗ 𝐚𝐧𝐝 𝒃 ⃗.
⃗ = 2𝒊̂ − 𝟑𝒋̂+ 𝒌
4. If 𝒂 ̂, 𝒃
⃗ = -𝒊̂ + 𝒌̂ , 𝒄⃗ = 2𝒋 − 𝒌̂ are three vectors, find the area of parallelogram having
diagonals (𝒂 ⃗ +⃗⃗⃗𝒃) and (𝒃⃗ +𝒄⃗ ).
5. Find the vector 𝒑 ⃗ which is perpendicular to both 𝒂 ⃗ = 4𝒊̂ + 𝟓𝒋̂ -𝒌 ̂ and 𝒑.
̂ and ⃗𝒃 = 𝒊̂ − 𝟒𝒋̂ + 𝟓𝒌 ⃗⃗⃗ 𝒒
⃗ =
21, where 𝒒 ⃗ =3 𝒊̂ + 𝒋̂ -𝒌
̂
6. Using vectors, find the area of triangle ABC with vertices A(1, 2, 3) , B(2, -1, 4) and C(4, 5, -1).
⃗ ,⃗⃗⃗𝒃 and 𝒄
7. If 𝒂 ⃗ are three vectors such that each one is perpendicular to the vector obtained by the
sum of other two and I𝒂 ⃗ I = 3, I𝒃I = 4 and I𝒄
⃗ I = 5, then prove that I𝒂⃗ + ⃗𝒃 + 𝒄
⃗ I = 5√2

THREE DIMENTIONAL GEOMETRY

2 Marks
1. If a line makes angles 𝜶, 𝜷, 𝜸 with the positive direction of coordinate axes, then write the value
of sin2 𝜶 + sin2 𝜷 + sin2 𝜸 .

2. The x- coordinate of a point on the line joining the points P(2, 2, 1) and Q(5, 1, -2) is 4. Find its z-
coordinate.
3. Find the vector equation of a line passing through the point A(1, 2, -1) and parallel to the line 5x
– 25 = 14 -7y = 35z.
4. Find the length of intercept, cut off by the plane 2x + y- z = 5 on the x- axis.
5. Write the distance of plane from 2x – y + 2z + 1 = 0 from the origin.

4 Marks

1. Find the vector and Cartesian equations of the line through the (1, 2, -4) and perpendicular to the
two lines 𝐫 = 8 𝐢̂ − 𝟏𝟗𝐣̂ + 10 ̂𝐤 + 𝛌 ( 𝟑 ̂𝐢 − 𝟏𝟔 𝐣̂ + 𝟕𝐤̂ ) and 𝐫 = 15 𝐢̂ + 𝟐𝟗𝐣̂ + 5 𝐤
̂ + 𝛍 ( 𝟑 ̂𝐢 + 𝟖 𝐣̂ − 𝟓𝐤
̂)
2. By computing the shortest distance between the following pair of lines, determine whether they
̂ ); 𝐫 = (2 𝐢̂ − 𝐣̂) + 𝛍 ( 𝐢̂ − 𝐣̂ − 𝐤
intersect or not ? 𝐫 = ( 𝐢̂ − 𝐣̂) + 𝛌 ( 𝟐 ̂𝐢 − 𝐤 ̂)

3. Find the vector equation of the plane determined by the points A(3, -1, 2), B(5, 2, 4) and C(-1, -1,
6), Also find the distance of point P(6, 5, 9) from this plane.

𝒙 𝒚−𝟐 𝒛−𝟑
4. Find the equation of perpendicular from the point (3, -1, 11) to the line 𝟐 = 𝟑 = 𝟒 . Also find
the coordinates of the foot of the perpendicular and the length of the perpendicular.

PROBABILITY
2 Marks
1. Out of 8 outstanding students of a school, in which there are 3 boys and 5 girls, a team of 4
students is to be selected for a quiz completion. Find the probability that 2 boys and 2 girls are
selected.

2. The random variable X has a probability distribution P(X) of the following form, where ‘k’ is some
number.
𝒌, 𝒊𝒇 𝒙 = 𝟎
𝟐𝒌, 𝒊𝒇 𝒙 = 𝟏
P(X = x)= { Determine the value of ‘k’.
𝟑𝒌, 𝒊𝒇 𝒙 = 𝟐
𝟎, 𝒐𝒕𝒉𝒆𝒓𝒘𝒊𝒔𝒆

3. 12 cards numbered 1 to 12 (one number on one card), are placed in a box and mixed up
thoroughly. Then a card is drawn at random from the box. If it is known that the number on the
drawn card is greater than 5, find the probability that the card bears an odd numbers.
4. A black and a red die are rolled together. Find the conditional probability of obtaining the sum 8,
given that the red die resulted in a number less than 4.

4 Marks

1. A couple has 2 children. Find the probability that both are boys, if it is known that
(i) One of them is a boy.
(ii) the older child is a boy.
2. Of the students in a college, it is known that 60% reside in hostel and 40% are day scholars (not
residing in hostel). Previous year results report that 30% of all students who reside in hostel attain
Á’ grade and 20% of day scholars attain Á’ grade in their annual examination. At the end of the
year, one student is chosen at random from the college and he has an Á’ grade, what is the
probability that the student is a hosteller?
3. From a lot of 15 bulbs which include 5 defectives, a sample of 2 bulbs is drawn at random
(without replacement). Find the probability distribution of the number of defective bulbs.
4. A random variable X has the following probability distribution :
X 0 1 2 3 4 5 6 7
2 2 2
P(X) 0 K 2K 2K 3K K 2K 7K + K
Determine :
(i) K (ii) P(X < 3) (iii) P(X > 6) (iv) P(0 < X < 3)
𝟏 𝟏
5. Probability of solving specific problem independently by A and B are 𝟐
and 𝟑 respectively. If both
try to solve the problem independently, find the probability that
(i) problem is solved
(ii) exactly one of them solved the problem.
 Biology
Code No. 044

QUESTION BANK Class XII (2021-22) TERM 2

UNIT: VII (14 Marks)

Chapter: 8 Human Health and Disease

1. What are the various public health measures which you would suggest as safeguard against infection
disease?
2. Write down comments on following disease.
(a) Typhoid , (b) pneumonia , (c) dysentery, (d) Plague, (e) diphtheria, (f) common cold,(g) Ascariasis, (h)
Elephantiasis (i) ringworm.
3. Describe life cycle of plasmodium in both type of host.
4. Difference between:
(I) Innate immunity and Acquired immunity
(II) Two type of tumor
(III) Primary and secondary immune response
(iv) B- lymphocytes and T- lymphocytes
(v) Vaccination and immunisations
(vi) Active and passive immunity
5. Define the following:
(A) Allergy , (B) Auto immunity, (C) Antibody, (D) LSD , (E) Interferon, (f) Metastasis, (g) Sadative drugs &
Psychotropic drugs , (h) Biopsy , (i) withdrawal syndrome
6.Draw a well labeled structure of an antibody molecule.
7. Expand each one to its full form:
1. MALT 2. CMI 3. AIDS 4. NACO 5. HIV, 6.NK 7. PMNL
8. What measures would you take to prevent water born disease?
9. What is AIDS ? Write down its causes, transmission and symptoms, & the mechanism by which the
AIDS virus cause deficiency in the immune system of the infected person?
10. What is cancer? Write the types of cancer, causes & treatment.
11. List the harmful effects caused by alcohol/ drug abuse & tobacco smoking.
12. Do you think that friends can influence one to take alcohol/ drug ? If yes, how many one protect
himself/herself from such an influence ?
13. In your view what motivates youngsters to take to alcohol or drug and how can this be avoided.

Chapter : 10 Microbes in Human Welfare

1.Write ten useful activity of bacteria, fungi.
2 Explain the uses and types of virus.
3. Find out the role of microorganism in the following and discuss it.
(a) SCP (Single cell protein) (b) Soil, (c) Sewage treatment plant, (d) Biogas production.
4. How do biofertilizers enrich the fertility of the soil?
5. What is sewage? What is key difference between primary and secondary sewage treatment plant?
6. Draw well labeled diagram of Biogas plant.
7. What is the utilization of bacteria in agriculture and vinegar industries?
8. Microbes can be used to decrease the use of chemical fertilizers and pesticides. Explain how this can
be accomplished.

UNIT: XI (11 Marks)

Chapter : 11 Biotechnology: principles and processes

1. What is gene manipulation or genetic engineering? Explain it.
2. Write application of genetic engineering in Human life
3. Name the scientist who discovered artificial DNA synthesizing method.
4. What do you understand by gene bank? What are it significances.
5. Describe briefly the following:
(I)Origin of replication, (II) PCR, (III) Gel electrophoresis, (IV) Restriction endonuclease enzyme, (V)
Bioreactor, (VI) downstream processing, (VII) gene cloning, (VIII) Biolistic or gene gun, (IX) Microinjection
(X) Selectable marker
6. Find out how to distinguish between:
(I) Plasmid DNA and Chromosomal DNA, (II) DNA and RNA
(III) Endonuclease and exonuclease
7. What is vector? Described its types and characters.
8. Explain the mechanism of recombinant DNA technology in genetic engineering by using plasmid as
carrier of genes.
9. What is clone ? Give its preparation, extraction and purification.
10. Can you list 10 recombinant proteins which are used in medical practice? Find out where they are
used as therapeutics.
11. Write comments on:
(a) C-DNA, (b) S-DNA, (c) R-DNA, (d) Ligase, (e) Chitinase, (f) Plasmid
12. Who discovered artificial DNA synthesis method?
13. Make a chart showing a restriction enzyme, the substrate DNA on which it acts, the site at which
cuts DNA and the products its produces.

Chapter : 12 Biotechnology and Its Application

1. Can you suggest a method to remove oil(hydrocarbon) from seed based on your understanding of r-
DNA technology and chemistry of oil?
2. What is genetically modified food? Give two example, compare and contrast the advantage and
disadvantage of production of genetically modified crop,
3. (a) What is Bt? Example of Bt crop.
(b) By which Bt toxin is coded.
(c) What is cry gene and cry protein?
4. what is RNAi method?
5. What is genetic engineering? Describe the application of genetic engineering in the field of medical
science.
6. What is gene therapy? Illustrate using the example of adenosine deaminase deficiency (ADA).
7. Explain the following in brief:
(I) Biopiracy, (II) Biopatent, (III)Humalin, (IV) gene library
8. What is forensic science? Explain DNA fingerprinting method of forensic science.
9. What is transgenic animal? Write its application.

UNIT: X (10 Marks)

Chapter : 13 Organism and population

1. Define the following:
(a) Diapause, (b) Birth rate, (c) Death rate, (d)Population, (e) Biotic potential, (f) Population density, (g)
Population equilibrium, (h) Phenotypic adaptation, (i)Camouflage (j) Interspecific competition, (k)Species
dominance

2. Differentiate the following:

(a) Parasitism and symbiosis, (b) Mutualism and Commensalism
6. Explain population dispersal in brief.

7. With the help of suitable diagram describe the logistic and exponential growth curve.

8. Write a short note on:

1. Adaptation of desert plant and animal
2. Adaptation of plant to water scarcity
3. Behavioral adaptation in animal
4. Importance of light to plant
5. Effects of temperature water scarcity and adaptation of animal
9. Explain different patterns of age pyramid.

Chapter : 15 Biodiversity
1. Explain biodiversity and its deferent level.
2. Describe different pattern of diversity and showing species area relationship with the help of
graph.
3. Write important points of causes of biodiversity loss.
4. Explain “How do we conserve biodiversity?”
5. What do you understand threatened species ? Explain its type.
6. Describe the national and international efforts prescribed for the conservation of the forest.
7. What are the main roles of India forest act?
8. Write notes on:
(a) Social forestry, (b) Sacred groove, (c)IUCN
9. Give three hypothesis for explaining why tropic shoe greatest level of species richness.
 Physics
Code No. 042

Class XII (2021-22) TERM 2

QUESTION BANK
UNIT –5. Electromagnetic Waves ( 3 marks)

SYLLABUS:
Electromagnetic waves and their characteristics(qualitative ideas only). Transverse nature of electromagnetic waves.
Electromagnetic spectrum (radio waves, microwaves, infrared, visible, ultraviolet, Xrays,gamma rays) including
elementary facts about their uses.
1. Mention properties of electromagnetic waves.
2. Name the phenomena which proves transverse nature of e.m .waves.
3. Describe properties ,uses ,application of E.m spectrum.
4. A capacitor , made of two parallel plates each of plate area A and separation d , is being charged by an
external ac source. Show that the displacement current inside the capacitor is the same as the current
charging the capacitor. ************

UNIT – 6. Optics (14 marks)

SYLLABUS:
Refraction of light, total internal reflection and its applications, optical fibres, refraction at spherical surfaces, lenses, thin lens formula,
lens-maker’s formula. Magnification, power of a lens, combination of thin lenses in contact . Refraction and dispersion of light through a
prism. Scattering of light - blue colour of the sky and reddish appearance of the sun at sunrise and sunset.

Optical instruments: Microscopes and astronomical telescopes (reflecting and refracting) and their magnifying powers.

Wave optics: wave front and Huygens’ principle, reflection and refraction of plane wave at a plane surface using wave fronts. Proof of laws
of reflection and refraction using Huygens’principle. Interference, Young’s double slit experiment and expression for fringe width,
coherent sources and sustained interference of light. Diffraction due to a single slit, width of central maximum.
1. What is total internal reflection and state two conditions required for it. Mention its applications.
2. Derive relation between µ u,v and R for a spherical surface and hence derive lens maker formula.
3. Derive thin lens formula. Explain Magnification and Power of a lens.
4. Derive expression for focal length for combination of thin lenses in contact.
5. Derive prism formula. Also show graphically variation of angle of deviation with angle of incidence.
6. Define angular dispersion and dispersive power .
7. Why (i) sky appears blue (ii) sun appears reddish at sunrise and at sun set (iii) dangers signals are red.
8. Draw ray diagram of compound microscope to show image formation in normal and far point
position. Derive expression for magnifying power also.
9.Draw ray diagram for normal adjustment of a astronomical telescope in and derive expression for
magnifying power also.
10. Draw ray diagram for image formation by reflecting telescope. Give two merits of reflecting telescope.
11. How the Resolving power of microscopes and astronomical telescopes changes with (i) aperture (ii) frequency of light.
12. State Huygens’ principle and prove laws of reflection and refraction of plane wave at a plane surface on its basis .
13. Draw the shape of wave front (i) converging to a point (ii) diverging from a point (iii) produced from a point
source (iv) at far distance (v) reflected from plane mirror (vi) refracted from convex lens
( for parallel incidence) .
14. Describe Young’s double slit experiment. Write conditions required for sustained interference of
light. What are coherent sources?
15. Derive expression for fringe width in double slit experiment.
16. What is diffraction of light? Write the condition required and derive expression for width of central
maximum in single slit diffraction.
17. Which phenomenon proves transverse nature of light?

**********************
 UNIT – 7. Dual Nature of Matter and Radiation(4 marks)

SYLLABUS:
Dual nature of radiation. Photoelectric effect, Hertz and Lenard’s observations; Einstein’sphotoelectric
equation-particle nature of light.
Matter waves-wave nature of particles, de Broglie relation. Davisson-Germer experiment.

1. What is Photo electric effect ? Write laws of photoelectric emission.

2. Explain the terms (i)stopping potential (ii) Threshold frequency (iii) threshold energy.
3. Show variation of photo current with frequency and intensity of incident light.
4. Derive the Einstein’s photoelectric equation.
5. Draw a labeled diagram of photo cell and explain its working. Mention its two applications.
6. What are matter waves? Derive expression for De broglie wavelength of an electron in electric field.
7. Briefly describe Davission andGermer experiment to show existence of matter waves.
8. Light of Wavelength 5000A0 falls on a metal surface of work function 1.9eV. Find (a) energy
of photons in eV (b) K.E of photoelectrons and (c) stopping potential.

**********************

UNIT – 8. Atoms and Nuclei (7 marks)

SYLLABUS:
Alpha-particle scattering experiment; Rutherford’s model of atom; Bohr model, energy levels, hydrogen spectrum.

Composition and size of nucleus, atomic masses, isotopes, isobars; isotones.. Mass-energy relation, mass
defect; nuclear fission and fusion.

1. Explain Alpha-particle scattering experiment and mention important inferences of it.

2. Give main postulates of Rutherford’s model of atom . Give its merits and demerits.
3. What is Bohr’s model of atom. Explain Hydrogen spectrum .
4. Derive relation between Atomic No. and radius of a nucleus.
5. Explain with examples – (i) isotopes, (ii) isobars (iii) isotones.
7. Write the radioactive decay laws and derive expression to show that radioactive decay is logarithmic.
8. State Mass energy relation and convert 1 eV into Joules.
9. What is mass defect and Binding energy? Show graphically variation in binding energy per nucleon
with mass number. State inferences from graph.
10. Distinguish between Nuclear fission and nuclear fusion.
40 40
Ca Ca
11. Calculate the binding energy per nucleon of 20 nucleus. Given : m( 20 ) =39.962589.u ,
mn = 1.008665u mp = 1.007825u
12. A neutron is absorbed by a 3Li6 nucleus with subsequent emission of an alpha particle. Write the
corresponding nuclear reaction and Calculate the energy released in this reaction in MeV.
Given M(3Li6) =6.015126a.m.u , M(2He4) = 4.0026044 a.m.u M(0n1) = 1.0086654 a.m.u ,
3
M(1H ) = 3.016049 a.m.u
13. Draw a plot of potential energy of a pair of nucleons as a function of their separations. Mark theregions
Where the nuclear force is (i) attractive and (ii) repulsive .
14. The ground state energy of hydrogen atom is -13.6eV. What are the KE and PE of electron in this state?

Numericals of alpha beta series decay , Hydrogen spectrum , energy.

******************
2
 UNIT – 9. Electronic Devices(7 marks)

SYLLABUS:
Energy bands in solids (Qualitative ideas only) conductor, insulator and semiconductor; semiconductor diode - I-V
characteristicsin forward and reverse bias, diode as a rectifier; special purpose p-n junction diodes: I-V
characteristics of LED, photodiode, solar cell,

1. Describe Energy bands in solids and differentiate between conductors ,insulators and
semiconductors on the basis of it. Define Fermi energy level.
2. Differentiate between pure and impure semiconductors . Derive expression for conductivity of
a pure semiconductor.
3. Differentiate between P type and N type semiconductors .
4. What is PN junction? Explain i) depletion layer ii) barrier potential
5. What is Forward and Reverse biasing of a diode. What is an ideal diode?
6. Draw characteristics curve of PN junction for forward and reverse biasing.
7. How does width of depletion layer changes with forward and reverse biasing.
8. What is rectification? Give principle, circuit diagram, construction, working and input output
waveforms for (i) half wave rectifier (ii) full wave rectifier
10. Describe briefly (i) LED (ii) photo diode (iii) solar cell

******************

3
 Chemistry
Code No. 043

QUESTION BANK Class XII (2021-22) TERM 2

Electrochemistry
1.Calculate the emf of the following cell at 298 K : Cr(s) / Cr3+ (0.1M) // Fe2+ (0.01M) / Fe(s) [Given : 0 ECell = +
0.30 V]
2.The conductivity of 10-3 mol /L acetic acid at 250 C is 4.1 x 10 -5 S cm-1 . Calculate its degree of dissociation,
if m0 for acetic acid at 250 C is 390.5 S cm2 mol-1 .
3. (a) A cell is prepared by dipping a zinc rod in 1M zinc sulphate solution and a silver electrode in 1M silver
nitrate solution. The standard electrode potential given: E 0 Zn2+ / Zn = - 0.76 V, E0 Ag+ / Ag = + 0.80 V What is
the effect of increase in concentration of Zn2+ on the Ecell?
(b) Write the products of electrolysis of aqueous solution of NaCl with platinum electrodes. (c) Calculate e.m.f.
of the following cell at 298 K: Ni(s) / Ni2+ (0.01 M) // Cu2+ (0.1M) / Cu (s) [ Given E0 Ni2+/ Ni = - 0.25 V , E0
Cu2+/Cu = + 0.34 V ) Write the overall cell reaction. 5
4. Apply Kohlrausch law of independent migration of ions, write the expression to determine the limiting molar
conductivity of calcium chloride.
5. 0.1 M KCl solution offered a resistance of 100 ohms in a conductivity cell at 298 K. If the cell constant of the
cell is 1.29 cm-1 , calculate the molar conductivity of KCl solution.
6. (a) Equivalent conductance of a 0.0128 N solution of acetic acid is 1.4 mho cm2 eq–1
and conductance at infinite dilution is 391 mho cm2 eq–1. Calculate degree of dissociation and dissociation
constant of acetic acid.
(b) The equivalent conductances of sodium acetate, sodium chloride and hydrochloric
acid are 83, 127 and 426 mho cm2 eq–1 at 250°C respectively. Calculate the equivalent
conductance of acetic acid solution.
7. Solutions of two electrolytes ‘A’ and ‘B’ are diluted. The Λm of ‘B’ increases 1.5 times
While that of A increases 25 times. Which of the two is a strong electrolyte? Justify your
answer. Graphically show the behavior of ‘A’ and ‘B’.
8. The resistivity of a 0.8M solution of electrolyte is 5 × 10–3 Ωcm. Calculate its molar conductivity.
9. Q. 7.In a galvanic cell, the following cell reaction occurs:
Zn(s) + 2Ag+(aq) ® Zn2+(aq) + 2Ag(s) Eo cell = +1.56 V
(i) Is the direction of flow of electrons from zinc to silver or silver to zinc?
(ii) How will concentration of Zn2+ ions and Ag+ ions be affected when the cell functions?
10. Calculate the emf of the following cell at 298 K
Cr(s)|Cr3+ (0.1M)||Fe2+ (0.01M)|Fe(s) [Given: E°cell = + 0.30 V]
11. X and Y are two electrolytes. On dilution molar conductivity of ‘X’ increases 2.5 times while
that Y increases 25 times. Which of the two is a weak electrolyte and why?
12. Calculate ΔrG 0 & value of equilibrium constant for the following :
a) Mg(s)/Mg2+//Cu2+/Cu(s); Eo Cu 2+ /Cu = +0.34V, Eo Mg 2+ /Mg = -2.36
b) Zn(s) + Cu2+  Zn2+ + Cu Eo Cu 2+ /Cu = +0.34V, Eo Zn 2+ /Zn = -0.76V
c) Cu (s) + 2Ag+  Cu +2+ 2Ag(s) Eo Cu 2+ /Cu = +0.34V, Eo Ag + /Ag = + 0.80V
d) 2Fe3+ + 2I- → 2Fe2+ + I2 has Eo cell =0.236 V
e) Fe2+(aq) + Ag+ → Fe3+(aq) + Ag(s),Eo Ag + /Ag = + 0.80V, Eo Fe 3+ / Fe 2+ = +0.77V
f) 2Cr(s) + 3Cd2+ → 2Cr3+ + 3Cd(s) Eo Cr 3+ /Cr= - 0.74V , Eo Cd 2+ /Cd= - 0.40V

CHEMICAL KINETICS
1. For a first order reaction, calculate the ratio between time taken to complete three fourth of the
reaction and time taken to complete half of the reaction.
1. A reaction is of second order with respect to a reactant. How is the rate of reaction affected, if the
concentration of the reactant is reduced to half? What is the unit of rate constant for such a reaction?
2. Define order of reaction. Write the condition under which a bimolecular reaction follows first
order kinetics.
3. In a reaction, if the concentration of the reactant R is quadrupled, the rate of reaction becomes
sixty four times. What is the order of reaction?
4. A first order reaction has a rate constant of 0.0051 min-1 If we begin with 0.10 M concentration of
reactant, whatconcentration of reactant will remain in solution after 3hours?
6. In a pseudo first order hydrolysis of an ester in water, the following results were obtained :
t/s 0 30 60 90
[Ester]/mol L-1 0.55 0.31 0.17 0.085
(i) Calculate the average rate of reaction between the time interval 30 to 60 s.
(ii) Calculate the pseudo first order rate constant for the hydrolysis of an ester.
7 The rate constant for a first order reaction is 60 s – 1 How much time will it take to reduce the initial
concentration of the reactant to its 1/16th value?
8.Give difference between molecularity and order of reaction.
9. For a reaction, the rate law expression is represented as follows Rate = k [A ] [B ]1/2
(i) Interpret whether the reaction is elementary or complex. Give reason to support your answer.
(ii) Write the units of rate constant for this reaction,if concentration of A and B is expressed in moles/L.
10. The conversion of molecules x to y follows second order kinetics. If concentration of x is increased
to three times, how will it affect the rate of formation of y ?
SURFACE CHEMISTRY
1. Distinguish between the meaning of the terms adsorption and absorption. Give one example of
each.
2. Why do physisorption and chemisorption behave differently with rise in temperature?
3. Explain what is observed,
(i) when a beam of light is passed through a colloidal solution?
(ii) when an electrolyte, NaCl, is added to hydrated ferric oxide solution?
(iii) electric current is passed through a colloidal solution?
4. How are colloids classified on the basis of
(i) physical state of components?
(ii) nature of dispersed phase?
(iii) interaction between dispersed phase and dispersion medium?
5. (i) What happens, when
(a) a freshly prepared precipitate of Fe(OH) 3 Is shaken with a small amount of FeCl 3 solution?
(b) persistent dialysis of a colloidal solution is carried out?
6. Distinguish between micelles and colloidal particles.
7. Write one difference in each of the following:
(i) Lyophobic sol and lyophilic sol.
(ii) Solution and colloid.
(iii) Multimolecular colloid and associated colloid
8. What are the three factors which influence the adsorption of the gas on a solid?
9. Explain the reason for following :
a) Powdered substances more effective adsorbents than their crystalline forms.
b) Finely divided substance is more effective as an adsorbent.
c) NH3 gas adsorbs more readily than N2 gas on the surface of Charcoal.
d) Adsorption is accompanied by decrease in entropy.
e) Enthalpy of chemisorption is high .
f) Adsorption is always exothermic.
g) Physical adsorption is reversible , while chemisorption is irreversible
h) Physisorption decrease with the increase of temperature.
i) Physical adsorption is multilayered, while chemisorption is monolayered.
j) It is important to have clean surface in surface studies.
k) We add alum to purify water.
l) Adsorption of a gas on the surface of solid is generally accompanied by a decrease in entropy. Still it is
spontaneous process.
D and F block elements
1. Name the two transition elements which have abnormal electronic configuration and explain why?
2. Explain, why density of transition elements increases from left to right in a period?
3. Why do transition elements show variable oxidation states?
(i) Name the element showing maximum number of oxidation states among the first series of
transition metals from Sc (Z = 21) to Zn ( ) Z = 30 .
(ii) Name the element which shows only +3 oxidation state.
4. Explain briefly how + 2state becomes more and more stable in the first half of the first row
transition elements with increasing atomic number?
5. Why E° values for Mn, Ni and Zn are more negative than expected?
6. Explain the following
(i) The second and third rows of transition elements resemble each other much more than they
resemble the first row.
(ii) Copper can not replace hydrogen from acids.
7. Explain the following observations.
(i) Copper atom has completely filled d-orbitals( 3) d10 in ground state, yet it is regarded as a
transition element.
(ii) Cr2+ is a stronger reducing agent than Fe2+in a queous solution .
9. Calculate the number of unpaired electrons in the following gaseous ions Mn 3+, Cr 3+, V3+ and Ti
3+.Which one of these is the most stable in aqueous solution?
10. Use Hund’s rule to derive the electronic configuration of Ce 3+ ion and calculate its magnetic
moment on the basis of ‘spin only’ formula.
11. Calculate the ‘spin only’ magnetic moment of M( aq) 2+ ion. Z = 27
12. (i) Calculate the magnetic moment of a divalent ion in
aqueous solution [Fe(H2 O)6 ] 2+, if atomic number of Fe is 26.
(ii) Although fluorine is more electronegative than oxygen, but the ability of oxygen to stabilise higher
oxidation states exceeds that of fluorine. Why?
(iii) Although Cr 3+ and Co2+ ions have same number of unpaired electrons but the magnetic moment
of Cr 3+ is 3.87 BM and that of Co2+ is 4.87 BM. Give reason.
13. Give reasons
(i) E° value for Mn 3 +/ Mn 2 + couple is much more positive than that for Fe3 +/ Fe2 +
(ii) Iron has higher enthalpy of atomisation than that of copper.
(iii) Sc3 +is colourless in aqueous solution where as Ti 3 + is coloured.
14 Account for the Following:
a) [Ni (CN)4] 2- ion with square planar structure is diamagnetic and the [NiCl4] 2- ion with tetrahedral structure
is paramagnetic .
b) [NiCl4] 2- is paramagnetic while [Ni (CO)4] is diamagnetic though both are tetrahedral.
c) [Fe (H2O) 6] 3+ is strongly paramagnetic while [Fe(CN)6] 3- is weakly paramagnetic.
d) [Fe (H2O) 6] 3+has a magnetic moment value of 5.92 BM whereas [Fe(CN)6] 3- has a value of only 1.74 BM.
e) [Co (NH3)6] +3 is an inner orbital complex whereas [Ni(NH3)6] +2 is an outer complex.
f) [Cr (NH3)6] +3 is paramagnetic while [Ni (CN)4] 2- is diamagnetic
. g) A solution of [Ni (H2O) 6] 2+ is green but a solution of [Ni (CN)4] 2- is colourless
h) [Fe (CN)6] 3- and [Fe(H2O) 6] 3+ are of different colours in dilute solutions
COORDINATION COMPOUNDS
1. Using IUPAC norms, write the formulae for the following
(i) Tetrahydroxozincate(II)
(ii) Potassium tetrachloridopalladate(II)
(iii) Diamminedichloridoplatinum(II)
(iv) Potassium tetracyanonickelate(II)
(v) Pentaamminenitrito-O-cobalt(III)
(vi) Hexaamminecobalt(III) sulphate
2. (i) Write the electronic configuration of iron ion in the following complex ion and predict its
magnetic behaviour : [Fe(H2 O) ] 2+
(ii) Write the IUPAC name of the coordination complex:
[CoCl2 (en)2]NO3 .
3. (i) On the basis of crystal field theory explain why Co (III) forms paramagnetic octahedral complex
with weak field ligands whereas it forms diamagnetic octahedral complex with strong field ligands.
(ii) Give the electronic configuration of the following complexes on the basis of crystal field splitting
theory
[CoF 6] 3-, [Fe(CN)6 ] 4- and [Cu(NH 3) 6] 2+
4 The hexaaquamanganese (II) ion contains five unpaired electrons, while the hexacyano ion
containsonly one paired electron. Explain using crystal field theory.
5. Using crystal field theory, draw energy level diagram,write electronic configuration of the central
metal atom or ion and determine the magnetic moment valuein the following.
(i) [CoF6 ] 3-, [Co(H2 O)6 ]2+ [Co(CN)6 ] 3-and
(ii) [FeF6 ]3- , [Fe(H2 O)6 ]2+ [Fe(CN) 6]4
6. (i) [Cr(NH 3) 6] 3+ is paramagnetic while [Ni(CN) 4] 2- is diamagnetic. Explain, why?
(ii) [Fe(CN)6 ]4- and [Fe(H 2O)6 ] 2+ are of different colours in dilute solutions. Why?
7. Using valence bond theory, explain the following in relation to the complexes given below
[Mn(CN)6 ] 3-, [Co(NH3 6) ] +3 [Cr(H2 O)6 ] 3+
(i) Type of hybridisation.
(ii) Inner or outer orbital complex.
(iii) Magnetic behaviour.
(iv) Spin only magnetic moment value.
8 Why do compounds having similar geometry have different magnetic moment?
9.Give postulates of werners theory.
10. What are the various factors affecting crystal field splitting?
ALDEHYDES KETONES AND CARBOXYLIC ACIDS
1 Name the electrophile produced in the reaction of benzene with benzoyl chloride in the presence
of anhydrous AlCl3
2 Write the equations involved in the following reactions
(i) Wolf-Kishner reduction
(ii) Etard reaction
3 How do you convert the following?
(i) Ethanal to propanone
(ii) Toluene to benzoic acid
4. An organic compound with molecular formula C 9H10 O 9 , forms 2,4-DNP derivative, reduces
Tollen’sreagent and undergoes Cannizzaro reaction.On vigorous oxidation, it gives 1,2-benzene
dicarboxylic acid. Identify the compound.
5 Arrange the following in the increasing order of their property indicated (any 2):
a. Benzoic acid, Phenol, Picric acid, Salicylic acid (pka values).
b. Acetaldehyde, Acetone, Methyl tert butyl ketone (reactivity towards NH2OH).
c. ethanol, ethanoic acid, benzoic acid (boiling point)
6 An alkene ‘A’ (Mol. formula C5H10) on ozonolysis gives a mixture of two compounds ‘B’and ‘C’.
Compound ‘B’ gives positive Fehling’s test and also forms iodoform on treatment with I2 and NaOH.
Compound ‘C’ does not give Fehling’s test but forms iodoform. Identify the compounds A, B and C.
Write the reaction for ozonolysis and formation of iodoform from B and C.
7 . (i) Give reasons :
(a) HCHO is more reactive than CH3 – CHO towards addition of HCN.
(b) pKa of O2N – CH2 – COOH is lower than that of CH3 – COOH.
(c) Alpha hydrogen of aldehydes and ketones is acidic in nature.
(ii) Give simple chemical tests to distinguish between the following pairs of compounds :
(a) Ethanal and Propanal
(b) Pentan-2-one and Pentan-3-one
8 . How will you bring the following conversions in not more than two steps :
(a) Propanone to propene
(b) Benzyl chloride to phenyl ethanoic acid
9 (ii) Give simple chemical tests to distinguish between the following pairs of compounds:
(a) Benzaldehyde and Benzoic acid
(b) Propanal and Propanone
10 . (i) How will you convert:
(a) Benzene to acetophenone
(b) Propanone to 2-Methylpropan-2-ol
(ii) Give reasons:
(a) Electrophilic substitution in benzoic acid takeplace at meta-position.
(b) Carboxylic acids are higher boiling liquids than aldehydes, ketones and alcohols of comparable
molecular masses.
(c) Propanal is more reactive than propanone in nucleophilic addition reactions.
11. Arrange the following compounds in the increasing order of their boiling points :
CH3CHO, CH3CH2OH, CH3OCH3, CH3COOH
12 Draw the structures of the following derivatives :
(a) The 2, 4-Dinitrophenylhydrazone of benzaldehyde,
(b) Acetaldehyde dimethyl acetal
(c) Cyclopropanone oxime.
13 (i) Give a plausible explanation for each one of thefollowing :
(a) Although phenoxide ion has more numberof resonating structures than carboxylate ion, carboxylic
acid is a stronger acid than
phenol.
(b) There are two -NH2groups in semicarbazide.However, only one is involved in the formation of
semicarbazones.
(ii) Carry out the following conversions in not more than two steps :
(a) Phenyl magnesium bromide to benzoicacid.
(b) Acetaldehyde to But-2-enal.
(c) Benzene to m-Nitroacetophenone. B.
14 ACCOUNT FOR THE FOLLOWING:
1. Aldehydes and Ketones have lower boiling point than alcohols.
2. Aldehydes are more reactive than Ketones towards Nucleophilic addition reaction
3. Cyclohexanone forms cyanohydrin in good yield but 2,2,6 – tri methylcyclohexanone does not.
4. There are two – NH2 group in semi carbazide however only one is involved in the formation of semi
carbazones.
5. During the preparation of esters from a carboxylic acid and an alcohol in the presence of an acid catalyst, the
water or the ester should be removed as fast as it is formed.
 6. Melting Point of an acid with even number of carbon atoms higher than those of its neighbours with odd
number of carbon atoms
7. It is necessary to control the pH during the reaction of aldehydes and ketones with ammonia derivatives.
8. Formaldehyde does not take part in Aldol condensation.
9. Benzaldehyde gives a positive test with Tollens reagent but not with Fehling and Benedict’s solution.
10.Carboxylic acids do not give the characteristic reactions of carbonyl group.
11.Chloroacetic acid is stronger than acetic acid.
12.The boiling points of aldehydes and ketones are higher than hydrocarbons and ethers of comparable
molecular masses.
13.The lower members of aldehydes and ketones such as methanal,ethanal and propanone are miscible with
water in all proportions.
14.Would you expect benzaldehyde to be more reactive or less reactive in nucleophilic addition reactions than
propanal.
15.Carboxylic acids are higher boiling liquids than aldehydes, ketones and even alcohols of comparable
molecular masses.
16.Aliphatic carboxylic acids having upto four carbon atoms are miscible in water.
17.Carboxylic acids are more acidic than phenols.
18.Although phenoxide ion has more number of resonating structures than carboxylate ion, carboxylic acid is a
stronger acid than phenol.
19.Electron withdrawing groups increase the acidity of carboxylic acids.
20.Electron donating groups decrease the acidity of carboxylic acids.
21.Arrange the following compounds in increasing order of acid strength.
(i)CH3CH2CH(Br)COOH, CH3CH(Br)CH2COOH, (CH3)2CHCOOH,CH3CH2CH2COOH
(ii) Benzoic acid, 4-Nitrobenzoic acid, 3,4- Dinitrobenzoic acid, 4-Methoxybenzoic acid (acid strength)
22.Which acid of each pair shown here would you expect to be stronger
?(i) CH3CO2H or CH2FCO2H (ii) CH2FCO2H or CH2ClCO2H(iii) CH2FCH2CH2CO2H or CH3CHFCH2CO2H.
15 . Write short notes on following :
1. Aldol Condensation
2. Cross Aldol Condensation
3. Cannizzaro Reaction
4. Clemmensen Reaction
5. Wolf Kishner Reaction
6. Rosenmund Reaction
7. Etard Reaction
8. Stephen Reaction
9. Gatterman-Koch reaction:
10.Ozonolysis
11. Esterification
12.Decarboxylation
13.Hell Volhard Zelinsky
14.Acetylation
 AMINES
1 (i) Write an isomer of C3H9N which gives foul smell of isocyanide when treated with chloroform and
ethanolic NaOH
(ii) Write an isomer of C3H9N which does not react with Hinsberg reagent.
2 (i) Arrange the following in increasing order of boiling points.
(CH3)3N, C2H5OH,C2H5NH2
(ii) Arrange the following in increasing order of base strength in gas phase:
(C2H5)3N, C2H5NH2, (C2H5)2NH
3(i) Arrange the following in decreasing order ofsolubility in water:
(CH3)3N,(CH3)2NH,CH3NH2
(ii) Arrange the following in decreasing order of thebasic character:
C6H5NH2, (CH3)3N, C2H5NH2
4 Write the chemical equations involved in the following reactions:
(i) Hoffmann-bromamide degradation reaction,
(ii) Carbylamine reaction.
5 Why does acetylation of —NH2 group of aniline reduce its activating effect ?
6 Give reasons:
(i) Aniline is a weaker base than cyclohexylamine.
(ii) It is difficult to prepare pure amines by ammonolysis of alkyl halides.
(ii) Aniline does not undergo Friedel Crafts reaction.
6. Give two chemical tests to identify primary, secondary and tertiary amines.
8. How do you convert the following :
(a) N-phenylethanamide to p-bromoaniline
(b) Benzoic acid to aniline
9 Account for the following:
a. Aniline cannot be prepared by the ammonolysis of chlorobenzene under normal conditions.
b. N-ethylethanamine boils at 329.3K and butanamine boils at 350.8K, although both are isomeric in
nature.
c. Acylation of aniline is carried out in the presence of pyridine.

10 Give a CHEMICAL TEST to distinguish between following pair of organic compounds

a.Methylamine and dimethylamine
b. Ethylamine and aniline
c Aniline and benzylamine
d.Aniline and N-methylaniline
e.N-methyl Propane -2-amine and N-ethyl N-methyl ethanamine
f. Secondary and tertiary amines
g. 1 0 ,20 ,& 30 Amines
h. C6H5NH2 & C6H5NHCH3
11. Write chemical equations for the following conversions:
a. CH3–CH2–Cl into CH3–CH2–CH2–NH2
b. C6H5–CH2–Cl into C6H5–CH2–CH2–NH2
c. Benzene into aniline
d. Benzene into N, N-dimethylaniline
e. Cl–(CH2)4–Cl into hexan-1,6-diamine
f. Ethanoic acid into methanamine
g. Hexanenitrile into 1-aminopentane
h. Methanol to ethanoic acid
i. Ethanamine into methanamine
j. Ethanoic acid into propanoic acid
j. Methanamine into ethanamine
k. Nitromethane into dimethylamine
l. Propanoic acid into ethanoic acid
m..Nitrobenzene to benzoic acid
n. Benzene to m-bromophenol
o. Benzoic acid to aniline
p. Aniline to 2,4,6-tribromofluorobenzene
q. Benzyl chloride to 2-phenylethanamine
r. Chlorobenzene to p-chloroaniline
s..Aniline to p-bromoaniline
t. Benzamide to toluene
u . Aniline to benzyl alcohol.
11 WRITE FOLLOWING NAME REACTIONS :
1. Hofmann’s bromamide reaction
2. Ammonolysis
3. Gabriel phthalimide synthesis.
4. Carbylamine reaction
5. Diazotisation
6. Coupling reaction
7. Acetylation
8. Benzoylation
 Computer Science
Code No. 083

QUESTION BANK Class XII (2021-22) TERM 2

UNIT-1 : Data Structure – 02 Marks Questions with Answers

1 Give any two characteristics of stacks.
Ans Characteristics of Stacks:
It is a LIFO data structure, The insertion and deletion happens at one end i.e. from the top
of the stack
2 Expand the following: LIFO, FIFO
Ans LIFO: Last-In First-Out FIFO: First-In First-Out
3 Give few applications areas of stack.
Ans Expression evaluation
Backtracking (game playing, finding paths, exhaustive searching).
Memory management, run-time environment for nested language features.
4 Evaluate the following postfix notation of expression, Show status of stack after every
operation. 12,2,7,34,20,-, +,5, +
Ans Input Symbol Statch Content
12 12
2 12, 2
/ 6
34 6, 34
20 6,34,20
- 6,14
+ 20
5 20, 5
+ 25
5 Evaluate The Following Postfix Notation Of Expression. Show status of stack after every
operation. 12,2, *, 24,20, -, +, 8, –

Ans
Scanned Stack Expression

1
 Element Status
12 12 ---
2 12, 2
* 24 12*2
24 24,24
20 24, 24, 20
- 24, 4 24 - 20
+ 28 24 + 4
8 28 , 8
- 20 28 - 8
Result- 80

Stack, operations on stack (push & pop), implementation of stack using list-
03 Marks Questions with Answers
1 Nivedita has started a new year’s resolution to read 12 non fiction books by the end of 2022.
For this purpose she has bought 20 such books. She stores the data in a dictionary as
book_name,rating as key, value pair. Help her out a bit to organize her collection with help of
Stack Data Structure.
Write a program, with separate user defined functions to perform the following operations:
● Push the keys (book_name) of the dictionary into a stack, where the corresponding value
(rating) are more than 8 .
● Pop and display the content of the stack. For example: If the sample content of the
dictionary is as follows:
B={"AI 2041: Ten Visions for Our Future":7.9, "Beginners: The Transformative Joy of
Lifelong Learning":8.5, "Bravey: Chasing Dreams, Befriending Pain, and Other Big Ideas":9,
"Chatter: The Voice in Our Head, Why It Matters, and How to Harness It":8.2, "The Code
Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race":7.5}
The output from the program should be:
Beginners: The Transformative Joy of Lifelong Learning,
Bravey: Chasing Dreams, Befriending Pain, and Other Big Ideas,
Chatter: The Voice in Our Head, Why It Matters, and How to Harness It
OR
Raghav has created a vocabulary list. You need to help him create a program with separate
user defined functions to perform the following operations based on this list.
● Traverse the content of the list and push the entries having less than 7 charecters into
astack.
● Pop and display the content of the stack.
For Example:
If the sample Content of the list is as follows:
W=[‘Elucidate’, ‘Haughty’, ‘Pacify’, ‘Quip’, ‘Rapport’, ‘Urbane’, ‘Young’,‘Zenith’]

2
 Sample Output of the code should be:
Pacify,Quip,Urbane,Young,Zenith
Ans
B={"AI 2041":7.9, "Beginners":8.5, OR
"Bravey":9, "Chatter":8.2, "The Code W=['Elucidate', 'Haughty', 'Pacify', 'Quip',
Breaker":7.5} 'Rapport', 'Urbane', 'Young','Zenith']
def PUSH(S,N): def PUSH(S,W):
S.append(N) S.append(W)
def POP(S): def POP(S):
if S!=[]: if S!=[]:
return S.pop() return S.pop()
else: else:
return None return None
BList=[] WList=[]
for i in B: for i in W:
if B[i]>8: if len(i)<7:
PUSH(BList,i) PUSH(WList,i)
while True: while True:
if BList!=[]: if WList!=[]:
print(POP(BList),end=" ") print(POP(WList),end=" ")
else: else:
break break

2 BCCI has created a dictionary containing top players and their runs as key value pairs of
cricket team. Write a program, with separate user defined functions to perform the following
operations:
● Push the keys (name of the players) of the dictionary into a stack, where the corresponding
value (runs) is greater than 49.
● Pop and display the content of the stack.
For example:
If the sample content of the dictionary is as follows:
SCORE={"KAPIL":40, "SACHIN":55, "SAURAV":80, "RAHUL":35, "YUVRAJ":110, }
The output from the program should be:
SACHIN SAURAV YUVRAJ
OR
Vikram has a list containing 10 integers. You need to help him create a program with separate
user defined functions to perform the following operations based on this list.
● Traverse the content of the list and push the ODD numbers into a stack.
● Pop and display the content of the stack.
For Example:
If the sample Content of the list is as follows:
N=[12, 13, 34, 56, 21, 79, 98, 22, 35, 38]
Sample Output of the code should be:
13,21,89,35
Ans
SCORE={"KAPIL":40, "SACHIN":55, OR
"SAURAV":80, "RAHUL":35, "YUVRAJ":110, } N=[12, 13, 34, 56, 21, 79, 98, 22,35, 38]

3
 def PUSH(S,R): def PUSH(S,N):
S.append(R) S.append(N)
def POP(S): def POP(S):
if S!=[]: if S!=[]:
return S.pop() return S.pop()
else: else:
return None #Message return None
ST=[] ST=[]
for k in SCORE: for k in N:
if SCORE[k]>49: if k%2!=0:
PUSH(ST,k) PUSH(ST,k)
while True: while True:
if ST!=[]: if ST!=[]:
print(POP(ST),end=" ") print(POP(ST),end=" ")
else: else:
break break
3 Write Push (contents) and Pop (contents) methods in Python to add numbers and remove
numbers
considering them to act as Push and Pop operations of stack.
Ans def Push (contents) :
if(len(stack) >= limit) :
print(“Stack Overflow!”)
else :
stack . append (contents)
print (“Stack after Push”, stack)
def Pop ( ) :
if (len (stack) <= 0 ) :
print(“Stack Underflow!”)
return 0
else :
return stack. Pop( )
UNIT 2 TOPIC: Evolution of networking: introduction to computer networks, evolution of networking
(ARPANET,NSFNET, INTERNET)
1 List any 4 services provided by the Internet. 1
Ans Email, Instant-Messaging, Sharing of Devices and Directory Sharing etc.
2 What is interspace and how is it different from the Internet? 1
Ans InterSpace is a client-server software program, allows multiple users to communicate online
with real-time audio, video or text chat in dynamic 3D environments. It provides the most
advanced form of communication available on the Internet today.
InterSpace is a vision of what the Internet will become in the future.
3 While transferring data on the internet, the message is divided into small units called 1
as____________________________

Ans Packets

4
4 Name the device responsible for converting the digital signal to continuous (analog) signal 1
for
transmission over telephone lines.
Ans Modem
5 What is the name given to the unique address assigned to each NIC? 1
Ans MAC (Media Access Control) Address also called as the physical address of a device.
6 Explain the 80:20 rule. 1
Ans The 80:20 rule states that 80% of the traffic in any network segment should be local and only
20% of the traffic should leave that segment for efficient traffic management.
It simply means that we should install the server at the site/building containing the
maximum
number of computers.
TOPIC: Data communication terminologies: concept of communication, components of data
communication(sender, receiver, message, communication media, protocols), measuring capacity of
communication media(bandwidth, data transfer rate), IP address, switching techniques (Circuit
switching, Packet switching)
1 What are the components used in communication? 1
Ans Sender, receiver, message, protocol and transmission media
2 What do you mean by a Protocol? 1
Ans It is a set of rules or procedures for transmitting data between electronic devices.
3 What is the full form of IP? 1
Ans Internet Protocol
4 How many bits are used in an IPv4 address and IPv6 address? 1
Ans 32 bits and 128 bits
5 Differentiate circuit switching and packet switching (mention any 2). 2
Ans S.no Circuit Switching Packet Switching
1 Connection-oriented Connectionless
2 The bandwidth used is fixed The bandwidth used is dependent on
actual data transmitted
3 Preferred when the It's beneficial for transferring data that
communication doesn't require real-time responsiveness
is long and continuous

6 List the types of communication media with examples of each. 2

Ans 1. Wired Communication Media - Twisted Pair Cable, Coaxial Cable, Optical Fibre Cable
2.Wireless Communication Media - Microwave, Radio Waves, Infrared, Satellite
Communication
7 What is an IP (logical) address? 1
Ans An IP address is a unique address assigned to each device connected to a computer network.
8 Give an example of an IPv4 address. 1
Ans An IPv4 address is a 32-bit address expressed in decimal notation as x.x.x.x where each x is

5
 an
integer between 0 and 255.
Example: 192.0.2.188
9 Which of the following communication media require(s) line-of-sight for communication? 1
Microwave, Radio waves, Infrared
Ans Microwaves, Infrared
10 Which of the following communication media can penetrate solid objects?
Microwave, Radio waves, Infrared
Ans Radio waves
TOPIC: Transmission media: Wired communication media (Twisted pair cable, Co-axial cable, Fiber-optic
cable), Wireless media (Radio waves, Micro waves, Infrared waves
1 Write name of guided and unguided media. 1
Ans Guided Media : Twisted pair, coaxial cable , Fiber Optic Cable
Unguided Media : Radio waves, Micro waves, Infrared waves
2 Why fiber optic transmission media is faster as compared to other wired transmission 1
media?
Ans Fiber optic transmits data as light, while other wired media transfer data as electricity. Light
travels exponentially faster than electricity so fiber optic transmission media is faster.
3 Out of the following, identified the unguided communication media ? 1
Infrared, Coaxial Cable, Optical Fibre, Microwave, Radio waves
Ans Infrared, Microwave, Radio waves
4 Write the two characteristics of Wi-fi 1
Ans Convenient and anywhere technology.
Support Secure wireless communication
5 Arrange the following communication media in the ascending order of their transmission 1
speed.
Twisted Pair Cable ,Telephone Cable , Optical Fibre Cable
Ans Telephone Cable , Twisted Pair Cable , Optical Fibre Cable
6 Rearrange the following terms in increasing order of data transfer rates 1
Gbps ,Mbps, Tbps, Kbps,Bps
Ans Bps, Kbps, Mbps, Gbps, Tbps

TOPIC:Network devices (Modem, Ethernet card, RJ45, Repeater, Hub, Switch, Router, Gateway, WIFI card)

1 What is a network device? Give some examples of network devices. 2

Ans Hardware devices that are used to connect computers, printers, fax machines and other
electronic devices to a network are called network devices.
E.g. Modem, Ethernet card, RJ45, Repeater, Hub, Switch, Router, Gateway, WIFI card.
2 What is Ethernet card? How Ethernet Differs from Wi-Fi Card? 2
Ans An Ethernet card is a kind of network adapter. These adapters support the ethernet standard
for high-speed network connections via cables.
Wi-Fi Card Ethernet Card
Speed Slow data transfer speed Faster data transfer speed
Reliability Suffers from signal interferencedue Delivers a consistent speed

6
 to many environmental factors
Data doesn’t required to be
Security Data flow needs to be encrypted
encrypted
Cable installation infrastructure is
Deployment Easy to installand deploy
required
3 What is RJ45 connector? where it is used? 2
Ans RJ45 stands for Registered Jack-45. It is aneight wire connector.RJ45 connector is used to
connect computersonto a Ethernet cable/Local Area Network(LAN).
4 Define repeaters with its two types 2
Ans Repeaters are used to amplify the signals, when they are transported over a long distance.
Repeaters are of two types
(i) Amplifier It amplifies or boosts the incoming signals. So, it amplifies both the signal and
any
concurrent noise.
(ii) Signal repeater It only amplifies the signal and filters out the noise signals. So, we get
onlythe clear signal at the receiver end.Repeaters may be included after every 100 mtrs
(approx) distance.
5 Expand the following i. MODEM ii. RJ45 2
Ans i. MODEM - MOdulator DEModulator ii. RJ45 - Registered Jack-45
6 Mention the appropriate networking device for following conditions. 2
(i) It is a hardware device which is used to amplify the signals when they are transported
over
a long distance.
(ii) It is a device that converts digital signal to analog signal and vice versa
Ans i. Repeater ii. MODEM
7 How are active hubs different from passive hubs? 2
Ans Active Hub Passive Hub
Active Hubs electrically amplify the signal as Passive Hubs does not amplify the
it moves from one connected device to another signals
Active hubs are used like repeater to extend Passive hubs can not used as a
the length of a network repeater
Transmission rate is high Transmission rate is slow
8 What is a Switch?
Ans A switch is called a smart hub. Providesmultiple connections 2
A device that filters and forwards packetsbetween LAN segments.
Switch passes the frame to a specific portbecause it keep a record of MAC address
9 What is Gateway ? 2
Ans A gateway is a network point that acts as an entrance to another network. It is used to
connect two dissimilar networks
10 What is a Bridge ? 2
Ans A device that connects two local-areanetworks (LANs), or two segments of thesame LAN that
use the same protocol, suchas Ethernet.
11 What is the Router ? 2
7
Ans A router is a device thatforwards data packets along networks.A router is connected to at
least two
networks, commonly two LANs orWANs. Routers are located atgateways, the places where
two or morenetworks connect.A router acts as a dispatcher, choosingthe best path for
information to travelso it’s received quickly.
12 Which of the following (i) is not a broadcast device (ii) offers a dedicated bandwidth ? 2
(a) Repeater (b) Bridge (c) Hub (d) Switch
Ans (i) Bridge is not a broadcast device as it filters traffic depend upon the receivers MAC address
(ii) Switch Offer dedicated bandwidth
13 What out of the following, will you use to have an audio visual chat with an expert sitting in a 1
faraway place to fix-up a technical issue
(i) Email (ii) VoIP (iii) FTP
Ans (ii) VoIP
TOPIC: Network topologies and Network types: types of networks (PAN, LAN, MAN, WAN), networking
topologies(Bus, Star, Tree)
1 TPU University is setting up its academic blocks at Udaipur and is planning to set up a 4
network. The
University has 3 academic blocks and one Human Resource Centre as shown in the diagram
below:

Center to Center distances between No of computers in various blocks/center

various blocks/center is as follows is as follows:
Law Block to Business Block 40m Law Block 15

Law Block to Technology Block 80m Technology Block 40

Law Block to HR Centre 105m HR Centre 115
Business Block to HR Centre 30m Business Block 25
Technology Block to HR Centre 15m
a) Suggest an ideal layout for connecting these blocks/centers for wired connectivity.
b) Which device will you suggest to be placed/installed in each of these blocks/centers to
efficiently
connect all the computers within these blocks/centers.
c) Suggest the placement of a Repeater in the network with justification.
d) The university is planning to connect its admission office in Delhi, which is more than 780
km
from the university. Which type of network out of LAN, MAN, or WAN will be formed? Justify
your
answer

8
Ans a) b). Hub / Switch

c). Repeater may be placed when the

distance between 2 buildings is more
than 100 meters.

d). WAN, as the given distance is more

than the range of LAN and MAN.

2 Unicorp Tech Training Ltd. is a Delhi based organization which is expanding its office set-up 4
to
Jaipur. At Jaipur office , they are planning to have 3 different blocks for Admin, Training and
Accounts related activities. Each block has a number of computers, which are required to be
connected in a network for communication, data and resource sharing.
As a network consultant, you have to suggest the best network related solutions for them for
issues/problems raised by them in (i) to (iv), as per the distances between various
blocks/locations
and other given parameters.

ACCOUNT ADMIN
BLOCK BLOCK HEAD OFFICE
DELHI
TRAINING BLOCK
JAIPUR OFFICE

Shortest distances between various Number of computers installed at various

blocks/locations blocks are as follows :
Admin Block to Accounts Block 310M Admin Block 50

Accounts Block to Training 160M Accounts Block 40

Block
Admin Block to Training Block 190M Training Block 130
Delhi Head Office to Jaipur 700KM
Office

(i) Suggest the most appropriate block/location to house the SERVER in the JAIPUR office (out
of
the 3blocks) to get the best and effective connectivity. Justify your answer.
(ii) Suggest the best wired medium and draw the cable layout (Block to Block) to efficiently
connect
various blocks within the JAIPUR office compound.
(iii) Suggest a device/software and its placement that would provide data security for the
entire
network of the JAIPUR office.
(iv) Suggest a device and the protocol that shall be needed to provide wireless Internet access
to all
9
 smartphone/laptop users in the JAIPUR office.
Ans (i) Training Block – Because it has maximum number of computers.
(ii) Best wired medium: Optical Fibre OR CAT5 OR CAT6 OR CAT7 OR CAT8 OR Ethernet Cable

ACCOUNT BLOCK ADMIN BLOCK

TRAINING BLOCK
(iii) Firewall – Placed with the server at the Training Block
OR
Any other valid device/software name
(iv) Device Name: WiFi Router OR WiMax OR RF Router OR Wireless Modem OR RF
Transmitter
Protocol: WAP OR 802.16 OR TCP/IP OR VOIP OR MACP OR 802.11
3 Identify the type of topology from the following ?: 2
(i) Each node is connected with the help of a single cable
(ii) Each node is connected with the help of independent cable with central switching.
Ans (i) Bus Topology
(ii) Star Topology
4 Mahesh wants to transfer data within a city at very high speed. Write the wired transmission 2
medium and type of network ?.
Ans Wired communication media is Optical Fibre Cable and type of network is MAN (Metropolitan
Area
Network)
5 (i) Which type of network (out of LAN, PAN and MAN) is formed when you connect two 2
mobiles using
Bluetooth to transfer a video?
(ii) Which type of network frame when we connect with our relative in a foreign country?
Ans (i) PAN (Personal Area Network)
(ii) WAN ( Wide Area Network)
TOPIC: Network protocol: HTTP, FTP, PPP, SMTP, TCP/IP, POP3, HTTPS, TELNET, VoIP
1 Which is the most recent version of HTTP protocol? 1
Ans HTTP/2 (originally named HTTP/2.0)
2 HTTP (HyperText Transfer Protocol) is a _______ Protocol. (Connection Oriented 1
/Connectionless)
Ans Connectionless (also called stateless)
3 You want to open the KVS HQ website on a web-browser, which Protocol do you need to 1
access the
same?
Ans HTTP (HyperText Transfer Protocol)
4 Which protocol is generally used to upload web pages to a web server for hosting? 1
Ans FTP (File Transfer Protocol)
5 Explain Point to Point Protocol (PPP) protocol. 2
Ans It is Windows’ default Remote Access Service (RAS) protocol and mainly used to encapsulate
data
to pass through synchronous and asynchronous lines of communication over serial point-to–
point
10
 connections. It is also known as RFC 1661.
6 List the two sub-protocol of PPP. 1
Ans Link Control Protocol (LCP) and Network Control Protocol (NCP).
7 A Manager of an IT company sends an email to one of his colleagues, requesting him to 1
prepare the
balance sheet. Which network protocol is involved during this email communication?
Ans Simple Mail Transfer Protocol (SMTP)
8 Explain the two models of SMTP Protocols. 1
Ans The end-to-end model is used to communicate between different organisations .
The store and forward model is used within an organisation.
9 What is the Post Office Protocol v3 (POP3)? 1
Ans It is used to retrieve emails from a remote mailserver to a local email client which can be
read
later even when the system is offline. Thisprotocol also removes the mail copy from themail
server once downloaded locally.
10 Write the full form of HTTP, FTP. 1
Ans HTTP - HyperText Transfer Protocol FTP - File Transfer Protocol
11 Write the full form of PPP, SMTP. 1
Ans ANS PPP - Point to Point Protocol SMTP - Simple Mail Transfer Protocol

12 Write the full form of TCP/IP, POP3. 1

Ans TCP/IP - Transmission Control Protocol/Internet Protocol POP3 - Post Office Protocol
Version 3
13 Write the full form of HTTPS, VoIP. 1
Ans HTTPS - HyperText Transfer Protocol Secure VoIP - Voice Over Internet Protocol
14 Write the full form of XML and HTML 1
Ans XML - Extensible Markup Language HTML - HyperText Markup Language
15 Write the full form of WLL and IMAP 1
Ans WLL - Wireless local loop IMAP - Internet Message Access Protocol
16 Write the full form of CDMA and GSM 1
Ans CDMA - Code Division Multiple Access GSM - Global System for Mobile Communication
17 Write the full form of LTE and GPRS 1
Ans LTE - Long Term Evolution GPRS - General Packet Radio Service
18 Name the softwares that uses the TELNET protocol? 1
Ans TELNET, AnyDesk, Team Viewer
19 What type of content can be transferred using the HTTP protocol? 1
Ans Text, images, audio, video and other multimedia files can be transferred over the web using
the
HTTP protocol
20 Explain the 3-way handshake process of TCP protocol. 2
Ans TCP protocol uses three-way handshake in which the sender first sends the RTS (Request to

11
 send)
frame After receipt of RTS, the receiver sends the CTS (Clear to send) frame On receipt of CTS,
the sender again sends the ACK (Acknowledgement) which signifies the successful receipt of
the CTS frame.
21 Distinguish between HTTP and FTP protocol. (any two) 2
Ans HTTP FTP
It stands for HyperText Transfer Protocol It stands for File Transfer Protocol
It is a set of rules that define how web pages It is a set of rules that govern the uploading
are transferred between computers over and
the downloading of files over the internet
internet
It uses the Transmission Control Protocol It uses the Transmission Control Protocol
and and
runs on TCP port 80 runs on TCP port 20(for commands) and 21
(for data)
It is efficient in transferring small files It is efficient in transferring large files
It is a stateless (Connectionless) protocol It is a stateful(connection-oriented)
protocol
It is faster as compared to FTP It is slower as compared to HTTP
22 Which out of the following is/are connection-oriented protocol(s)? 1
TCP, IP, HTTP
Ans TCP
23 Write the port numbers used by the following protocols: 2
HTTP, FTP, SMTP, POP3, HTTPS, TELNET, VoIP
Ans HTTP - Port No. 80 FTP - Port No. 20 for commands and Port no. 21 for data
SMTP - Port No. 25 POP3 - Port No. 110 ,HTTPS - Port No. 443 TELNET - Port No. 23
VoIP -Port No. 5060
24 Ram wants to have a meeting with his team-mates where they can see each other and discuss 1
the
new project they have been assigned by the management. Which protocol would be used in
this
communication?
Ans H.323 and session initiation protocol (SIP)
25 Tejas wants to download all his emails on his ipad and read them whenever he is free. Which 1
protocol would be used?
Ans POP3
26 Rani needs to download all the study material regarding her favourite subject from a remote 1
server. Which protocol would she use?
Ans FTP (File Transfer Protocol)
27 Aman works for an IT company which provides custom-application softwares. One of his 1
clients
does not know how to install one such software on his computer. Which protocol would
Aman use
to assist the client for remote installation of a particular application software?
Ans TELNET (for remote access)
28 Write the name of the protocol used when- 1
You send an email to another user You read your email

12
Ans SMTP (Simple Mail transfer protocol) POP3 (Post Office Protocol Version 3)
29 Dev wants to search for information about esteemed engineering colleges in India. He opens 1
his
web browser and types the phrase “Best engineering colleges in India” into the Google Search
box.
He gets a list of search results in his web browser. Which protocol was used in this task?
Ans HTTPS (HyperText Transfer Protocol Secure)
TOPIC: Introduction to web services: WWW, Hyper Text Markup Language (HTML), Extensible Markup
Language(XML), domain names, URL, website, web browser, web servers, web hosting
1 What is a Cookie? 1
Ans Cookies are text files with small pieces of data like a username and password that are used to
identify your computer as you use a computer network.
2 What is the Domain Name Server (DNS)? 1
Ans Domain Name Server, translates human readable domain names (for example,
www.amazon.com) to its corresponding machine readable IP addresses (for example,
192.0.2.44).
3 What is Web Hosting? List any two Web Hosts Service providers. 2
Ans Web hosting is an online service that allows customers to publish their website onto the
internet.
Web host is responsible for making sure that the website is up and running 24x7. It is also a
host's
job to prevent any security breaches and store all website related files, assets and databases
onto
the server.
Example, IBM, Amazon Web Services (AWS), Bluehost, HostGator and Hostinger etc.
4 What is the difference between WWW and W3C? 2
Ans The World Wide Web Consortium (W3C) is the main international standards organisation
which
develops standards and protocols/guidelines to ensure long-term growth for the World Wide
Web;
Led by Web inventor and Director Tim Berners-Lee and CEO Jeffrey Jaffe.
The World Wide Web, also called the Web, is an information space where documents and
other
web resources are identified by Uniform Resource Locator, interlinked by hypertext links,
and
accessible via the Internet.
5 Write the full form of URL. 1

13
Ans Uniform Resource Locator
6 Identify the following from the URL : https://www.sample.com/cs_books.html 2
Type of protocol being used
Name of the server on the Internet
Domain Indicator
Name of the resource being accessed
Ans HTTPS
Server Name - www.sample.com
Domain Indicator - com
Name of resource being accessed - cs_books.html
7 What is a web server? 1
Ans It is a computer that serves web pages as and when they are requested by clients.
8 Give examples of web servers. (Any two) 1
Ans Apache HTTP Server, Microsoft IIS (Internet Information Services) Server, Apache Tomcat,
NGINX
9 Give examples of search engines 1
Ans Google, Bing, Yahoo. DuckDuckGo
10 Give examples of DNS servers. (Any two) 1
Ans Google, Quad9, OpenDNS, Cloudflare, Alternate DNS
11 What is the difference between HTML and XML?(any two) 2
Ans XML HTML
New tags can be created, Tags are pre-fixed new tags cannot be created
It is case sensitive It is case insensitive
Ordering of tags matters (nesting of tags must Ordering of tags is immaterial
be in correct order)
It focuses on structure of data It focuses on presentation of data
Matching opening tags and closing tags must be Closing tags are optional
there

UNIT-3
TOPIC: Structured Query Language: introduction, Data Definition Language and Data Manipulation
Language,data type (char(n), varchar(n), int, float, date), constraints (not null, unique, primary key),
create database, usedatabase, show databases, drop database, show tables, create table, describe table,
1 Define DDL & DML commands of SQL with example. 2
Ans DDL: - Data Definition Language (DDL) provides commands for defining relation schemas,
deleting relations, creating indexes, and modifying relation schemas. For example: CREATE,
ALTER, DROP etc…
DML: - Data Manipulation Language (DML) includes commands for manipulating tuples in
databases. For example: Insert, Delete, Update commands etc…
14
2 A table TEACHER has attributes CODE, NAME, POST, CATEGORY. Write down the command to 1
delete the attribute CATEGORY from this table.
Ans ALTER TABLE Teacher DROP Category;
3 Consider the following SQL statement. 2
S1: CREATE TABLE employee (eno CHAR(3), name VARCHAR(20));
S2: INSERT INTO employee VALUES (‘E01’,RAHUL DRAVID’);
From S1 and S2, which one is DDL and which one is DML?
Ans S1: DDL
S2: DML
4 In SQL, write the query to display the list of tables stored in a database. 2
Ans SHOW TABLES
5 In SQL, what is the use of the IS NULL operator? 2
Ans To check if the column has null value/no value/blank
6 In SQL, name the clause that is used to display the tuples in ascending/ descending order of 1
an
attribute.
Ans ORDER BY
7 A table ACCOUNTS in the database has 14 columns and 4 records. What is its degree if 2 more 1
rows are added into the table?
Ans 14
8 Write the queries to Create a database named as ‘Company’ and then Create a Table with use 2
of
NOT NULL and Primary Key constraints for following relation definition:
Staff (StaffID, FirstName, LastName, IsQualified) where
StaffID Char type data with length 5 PRIMARY KEY
FirstName varchar type data with length 20 NOT NULL
LastName varchar type data with length 15
IsQualified Char type data with length 4
Ans CREATE DATABASE COMPANY;
CREATE TABLE Staff
( StaffID CHAR (5) PRIMARY KEY, FirstName VARCHAR (20) NOT NULL,
LastName VARCHAR (15), IsQualified CHAR(4) ) );
9 Write a SQL statement to create a table named Country including columns 3
country_id,country_name and region_id and make sure that no duplicate data against column
country_id will be allowed at the time of insertion.
Attribute Name Data type Constraint
country_id char data type of length 4 Should not be empty and should be unique
country_name variable length ( 40) Should not be empty
region_id decimal with length (10,0) Should not be empty
Write a query to describe the structure of this table after creation?
Ans CREATE TABLE Country
( COUNTRY_ID char(4) NOT NULL, COUNTRY_NAME varchar(40) NOT NULL,
REGION_ID decimal(10,0) NOT NULL, UNIQUE (COUNTRY_ID) );
Desc Country; Or Describe Country;
10 Write a Query to Create a database named as “COMPANY” and after creating write a query to 3
open
it?
15
 Write a SQL statement to create a table named Job under this database company, the table
includes columns JOB_ID, JOB_TITLE, MIN_SAL and MAX_SAL, BONUS and make sure that the
job_id column should be primary key and job_title should not be empty.
FIELD NAME DATA TYPE REMARKS
JOB_ID VARCHAR(10) PRIMARY KEY
JOB_TITLE VARCHAR(35) NOT EMPTY
MIN_SAL INTEGER
MAX_SAL INTEGER
BONUS INTEGER
Ans CREATE DATABASE COMPANY;
USE COMPANY;
CREATE TABLE JOB ( JOB_ID varchar(10) PRIMARY KEY, JOB_TITLE varchar(35) NOT NULL,
MIN_SAL int , MAX_SAL int, BONUS int );
11 Which SQL command is used to display existing databases. 1
Ans SHOW DATABASES;
12 An organisation named PRIDE wants to put all the data in the form of records. The records 1
are
stored in a table and tables are stored in a database. Which DDL command is used to create a
database name PRIDE.
Ans CREATE DATABASE PRIDE;
13 How to use an existing database name PRIDE ? Give an example. 1
Ans USE PRIDE;
14 What is the difference between CHAR and VARCHAR in SQL? 1 1
Ans VARCHAR is variable length, while CHAR is fixed length
15 How to delete the whole database named Student_Data? 1
Ans DROP DATABASE Student_Data;
16 How to see the existing table structure in the database? 1
Ans DESCRIBE table_name; OR DESC table_name;
17 What is the maximum value that can be stored in NUMERIC(6,2) ? 1
Ans 9999.99
18 What should be the data type for the column Rate storing values less than Rs. 1000, e.g., 1
400.40 ?
Ans NUMBER(5,2)
19 What should be the data type for the column IFSC_Code storing alphanumeric bank code 1
having 11
characters, e.g. SBIN0066200 ?
Ans CHAR(11)
20 What should be the data type for the column PINCode storing 6-digit numeric PIN code for 1
any
address in India, e.g. 324100 ? Also, it should be calculation-proof.
Ans NUMBER(6)

16
21 What should be the data type for the column DOB, e.g., 30/06/2002 1
What format does the SQL follow to store the DOB?
Ans DATE ‘YYYY-MM-DD’
22 What do you understand by Degree and Cardinality of a table ? Give a suitable example. 2
Ans Degree - Number of columns or attributes or fields in a table are called table’s degree.
Cardinality - Number of rows/tuples/records in a table are called table’s cardinality.
Example:
TABLE - EMPLOYEE
ID Name DEPT EXPERIENCE
101 Siddharath Sales 12
104 Raghav Finance 6
107 Naman Research 10
114 Nupur Sales 3
Its degree is 4 (4 columns) and cardinality is 4 (4 rows)
23 Give a suitable example of a table with sample data and illustrate Primary ,Candidate and 2
Alternate Keys in it. (any two keys)
Ans Primary Key. It is the set of one or more attributes that can uniquely identify tuples within a
relation.
Candidate Key. A candidate key is the one that is capable of becoming the primary key.
Alternate Key. It is a candidate key which is not the primary key.
Example :
TABLE - EMPLOYEE
ID Name DEPT EXPERIENCE PANNO
101 Siddharath Sales 12 SF63564
104 Raghav Finance 6 DGH645
107 Naman Research 10 HHD563
114 Nupur Sales 3 5634YH
Candidate keys : ID,PANNO
Primary Key : ID
Alternate Key : PANNO
24 Consider the following tables GAME and PLAYER and answer the parts(i) and (ii) accordingly. 2
Table : GAMES
GCODE GAMENAME NUMBER PRZMONEY SCHDATE
101 Chess 5 25000 23 Jan 2010
102 Badminton 3 38000 12 Nov 2008
103 Carrom 6 18000 18 Mar 2010
105 Table Tennis 3 30000 09 Jan 2009
108 Basketball 5 40000 29 Apr 2009
Table : PLAYER
PCODE NAME GCODE
1 Rakesh Srivastava 101

17
 2 Nilesh Mishra 102
3 Vandana 108
4 Ravi Jindal 105
(i) Identify the candidate key(s) from the table GAMES .
(ii) Which field will be considered as the foreign key if the tables GAMES and PLAYER are
related in a database?
Ans (i) Candidate Key: GCODE , GAMENAME
(ii) GCODE is the Foreign Key in PLAYER table and it is related to Primary Key GCODE of
GAMES
table.
TOPIC: Alter table (add and remove an attribute, add and remove primary key), drop table, insert, delete,
select,operators (mathematical, relational and logical), aliasing, distinct clause, where clause, in,
between, order by,meaning of null, is null, is not null, like, update command, delete command
1 Which command of SQL is used to change/modify the structure of a table? 1
Ans ALTER TABLE
2 Ms. Shruti has created a table GAMES having attributes ID, GAME, NO_OF_PLAYERS. Later she 1
wants to add a new attribute DURATION of integer type in this table. How can she do this?
Write down a full command.
Ans ALTER TABLE Games ADD Duration int(3);
3 A table TEACHER has attributes CODE, NAME, POST, CATEGORY. Write down command to 1
delete the attribute CATEGORY from this table.
Ans ALTER TABLE Teacher DROP Category;
4 A table TEACHER has no primary key. Which command will be used to make one if its 1
attribute named CODE its primary key?
Ans ALTER TABLE TEACHER ADD PRIMARY KEY(CODE);
5 What will happen if following command is executed : - 1
ALTER TABLE EMPLOYEE DROP PRIMARY KEY;
Ans After executing the above command the primary key of the EMPLOYEE table will be removed
from the primary key and there will be no primary key in this table.
6 What is the purpose of IS NULL and IS NOT NULL operators? 1
Ans IS NULL and IS NOT NULL operators are used for filtering tuples from the table having or not
having NULL values in a specific attribute. E.g.
SELECT * FROM STUDENT WHERE DOB IS NULL;
SELECT * FROM STUDENT WHERE CLASS IS NOT NULL;
7 What is the use of LIKE operator in SQL? 1
Ans Like operator is used for matching patterns of character values on specific attributes and
filter
out the tuples on the basis of the given patterns. It uses two wildcard characters % and _
(Underscore) for specifying patterns.
8 Write the output of the queries (a) to (d) based on the table PLAYER given below:

18
 a. SELECT PNAME, GAME FROM PLAYER WHERE GENDER=”F”;
b. SELECT DISTINCT GAME FROM PLAYER;
c. SELECT PID,PNAME,RANK FROM PLAYER WHERE GAME=”CRICKET” ORDER BY RANK;
d. SELECT * FROM PLAYER WHERE GENDER<>”M” AND RANK<10;
Ans a. PNAME GAME
C.
SAYNA BADMINTON
PI PNAME RANK
SANIYA TENNIS
P04 VIRAT 1
b. GAME P01 JASPRIT 5
CRICKET
BADMINTON
TENNIS
PID PNAME GENDER GAME RANK
d.
P02 SAYNA F BADMINTON 9
9 Write the queries (a) to (d) based on the table BOOK given below: 4

a. Display details of the books whose price not mentioned

b. Display title and date of purchase of the books having “IP”in their title.
c. Display all the details of books by NCERT in the descending order of their price.
d. Add Rs. 50 in the price of all the books by CBSE.
Ans a. SELECT * FROM BOOK WHERE PRICE IS NULL;
b. SELECT TITLE,DATE_PURCHASED FROM BOOK WHERE TITLE LIKE “%IP%”;
c. SELECT * FROM BOOK WHERE AUTHOR=”NCERT” ORDER BY PRICE DESC
d. UPDATE BOOK SET PRICE=PRICE+50 WHERE AUTHOR =”CBSE”;
10 Write the queries (a) to (d) based on the table BOOK given below: 4

19
 a. Display details of the books which have been purchased before 01-01-2022
b. Display BNO, TITLE and PRICE of books which book no is P01, P03 or P05.
c. Delete all the books whose price is not given.
d. Increase the price of all the books by 10% whose price is below 300.
Ans a. SELECT * FROM BOOK WHERE DATE_PURCHASED<’2022-01-01’;
b. SELECT BNO,TITLE, PRICE FROM BOOK WHERE TITLE IN (“P01”,”P02”,”P03”);
c. DELETE FROM BOOKS WHERE PRICE IS NULL;
d. UPDATE BOOK SET PRICE=PRICE+PRICE*.10 WHERE PRICE<300;
11 What is the difference between where clause and having clause? 2
Ans WHERE CLAUSE HAVING CLAUSE
It is used to apply conditions on It is used to apply conditions on a group
individual of
rows. rows.
Example:
Select * from customer where Select city,sum(salary) from customer
salary>2000; group by city having city=”Jaipur”;
Example:
12 What is equi join?Explain with suitable example. 2
Ans It joins two tables on equality of values in matching column (s) of the specified tables.
CUSTOMER(ID,NAME,CITY)
ORDER(ORDERID,ID,AMOUNT)
Select * from CUSTOMER,ORDER where CUSTOMER.ID=ORDER.ID;
TOPIC: Aggregate functions (max, min, avg, sum, count), group by, having clause, joins : Cartesian product
ontwo tables, equi-join and natural join
1 What are the different categories of functions in SQL? 1
Ans Types of functions in SQL
Single Row Functions - LEN(), UPPER(), LOWER() ETC.
Aggregate Functions - SUM(), MAX() ETC
2 What do you understand by Aggregate functions in SQL? 1
Ans An aggregate function in SQL performs a calculation on multiple values and returns a single
value. SQL provides following aggregate functions: -
Sum(), Avg(), Count(), Max(), MIN()
3 A table CLIENT has an attribute AGE. What will be the output of the following query based on 1
the data of AGE column given below: - SELECT COUNT(AGE) FROM CLIENT;
TABLE - CLIENT
AGE
40
NULL
50

20
 30
Ans COUNT(AGE)
3
4 Consider table given in Question 6 and write down the output of the following query: - 1
SELECT AVG(AGE) FROM CLIENT;
Ans AVG(AGE)
40
5 What is join? What are different types of joins in SQL? 2
Ans join is used to combine rows from two or more tables, based on a related column between
them.
Type of Joins: -Cross Join/Cartesian Product , Equi Join ,Natural Join
6 Consider following table and write query for question (i) to (iv): - 4

(i) Display total balance of account table.

(ii) Display average balance at JAIPUR branch.
(iii) DIsplay maximum balance and minimum balance of each branch.
(iv) Display number of accounts of each type
Ans i) SELECT SUM(BALANCE) FROM ACCOUNT;
ii) SELECT AVG(BALANCE) FROM ACCOUNT WHERE BRANCH=”JAIPUR”;
iii) SELECT BRANCH, MAX(BALANCE), MIN(BALANCE) FROM ACCOUNT
GROUP BY BRANCH;
iv) SELECT TYPE,COUNT(*) FROM ACCOUNT GROUP BY TYPE;
7 Consider following table and write query for question (i) to (iv): - 4

A. Display total no. of contacts from TAMILNADU state.

B. Display number of contacts from each city.
C. Display details of contacts whose city is either starting from M or K
D. Display name of state and total number of contacts where at least 2 contacts are
there.

21
Ans A. SELECT COUNT(*) FROM CONTACTS WHERE STATE=”TAMILNADU”;
B. SELECT CITY COUNT(*) FROM CONTACTS GROUP BY CITY;
C. SELECT * FROM CONTACTS WHERE CITY LIKE “M%” or CITY LIKE “K%”;
D. SELECT STATE,COUNT(*) FROM CONTACTS
GROUP BY STATE HAVING COUNT(*)>2;
8 Answer the following questions based on table CUSTOMER and ORDER. 3

A. Identify foreign key in above tables with suitable explanation.

B. What will be the degree and cardinality of the resultant table after the cartesian
product of the table customer and order .
C. What will be the cardinality of table customer after removal of column salary.
Ans A. CUSTOMER:NO FOREIGN KEY , ORDER:CUSTOMER_ID
Explanation:
(i)values of column CUSTOMER_ID are from the domain of primary key ID from CUSTOMER
table. , (ii)Its a non-key attribute.
B. Degree=9 , Cardinality=6
C. Cardinality=3
TOPIC:Interface of python with an SQL database: connecting SQL with Python, performing insert, update,
delete queries using cursor, display data by using fetchone(), fetchall(), rowcount, creating database
connectivity applications
1 What is the Database Connector? 1
Ans A database connector is a software that connects an application to any database.
2 Write the command to install the mysql-connectors module for python. 1
Ans pip install mysql-connector
3 Which function is used to check the successful connection? 1
Ans is_connected() method
4 Write python code to connect with the database named “XIICS”. 2
Ans import mysql.connector
myconn = mysql.connector.connect (host='localhost', user='root', password='root',
database='XIICS')
myconn.close()
5 What is a cursor? Explain how to initiate the same. 2
Ans A cursor is an object which helps to execute the query and fetch the records from the database.
import mysql.connector
myconn = mysql.connector.connect (host='localhost', user='root', password='root',
database='XIICS')
22
 mycursor = myconn.cursor()
mycursor.execute("MySQL Command")
myconn.close()
6 What are the multiple ways to retrieve data? 2
Ans Data can be fetched from MYSQL using the fetch() method provided by the mysqlconnector-
python. The cursor provides three methods namely fetchall(), fetchmany() and fetchone().
● The fetchone() method fetches the next row in the result of a query and returns it as a
tuple.
● The fetchall() method retrieves all the rows in the result set of a query and returns them as
a list of tuples. (If we execute this after retrieving a few rows it returns the remaining ones).
● The fetchmany() method is similar to the fetchone() but it retrieves the next set of rows in
the result set of a query, instead of a single row.
7 Which method is used to insert multiple records into a table? 1
Ans executemany() method
8 What is the result set? 1
Ans A ResultSet is a table of data returned by the .execute() method, containing a list of
tuples of query results, which is usually generated by executing a statement that queries
the database. The object of ResultSet maintains a cursor pointing to a row of a table.
9 Write a python database connectivity script to create a Database named “XIICS” and a 2
Table named “Student”.
Ans import mysql.connector
try:
myconn = mysql.connector.connect ( host='localhost', user='root',
password='root' )
mycursor = myconn.cursor()
mycursor.execute('CREATE DATABASE IF NOT EXISTS XIICS')
mycursor.execute('USE XIICS')
mycursor.execute("""
CREATE TABLE IF NOT EXISTS Student (
rollNo INT PRIMARY KEY,
firstName VARCHAR(15) NOT NULL, lastName VARCHAR(15) NOT
NULL,
class INT NOT NULL, city VARCHAR(20) );
""")
myconn.close()
print("Database and Table created successfully")
except:
print("Error! Unable to create database and table. Please try again later.")
10 Write python commands to display data by using fetchone() and fetchall()
Ans #fetchone()
import mysql.connector
myconn = mysql.connector.connect (host='localhost',user='root', password='root',
database='XIICS')
rollNo = 101
mycursor = myconn.cursor()
mycursor.execute('SELECT rollNo, firstName, lastName FROM Student WHERE rollNo =
%s', (rollNo, ))
record = list(mycursor.fetchone())
print(str(record[0]) + " " + str(record[1]) + " " + str(record[2]))
23
 myconn.close()
#fetchall()
import mysql.connector
myconn = mysql.connector.connect (host='localhost',user='root', password='root',
database='XIICS')
rollNo = 101
mycursor = myconn.cursor()
mycursor.execute('SELECT rollNo, firstName, lastName FROM Student WHERE rollNo =
%s', (rollNo, ))
records = list(mycursor.fetchall())
for record in records:
print(str(record[0]) + " " + str(record[1]) + " " + str(record[2]))
myconn.close()
11 Write a python database connectivity script to insert a student record in the “Student” table. 2
Data should be read from the user at run time.
Ans import mysql.connector
stuList = []
stuList.append(input('Enter Student Roll No.: '))
stuList.append(input('Enter First Name: '))
stuList.append(input('Enter Last Name: '))
stuList.append(input('Enter Class: '))
stuList.append(input('Enter City: '))
try:
myconn = mysql.connector.connect (host='localhost',user='root', password='root',
database='XIICS')
mycursor = myconn.cursor()
mycursor.execute('INSERT INTO Student (rollNo, firstName, lastName, class, city)
VALUES (%s, %s, %s, %s, %s)', stuList)
myconn.commit()
myconn.close()
print("Student with student roll no. "+stuList[0]+" added successfully")
except Exception:
print("Error! Unable to add the student. Please try again")

12 Write a python database connectivity script to update the first name of the student 2
having roll no. as 101 in the “Student” table.
Ans import mysql.connector
myconn = mysql.connector.connect (host='localhost',user='root', password='root',
database='XIICS')
rollNo = 101
mycursor = myconn.cursor()
mycursor.execute('UPDATE Student SET firstName = "Bhagat" WHERE rollNo = %s', (rollNo,
))
print("No. of rows affected:", mycursor.rowcount)
myconn.commit()
myconn.close()
13 Write a python database connectivity script that deletes records from “Student” table 2
having second character of Surname as ”u”
Ans import mysql.connector
myconn = mysql.connector.connect (host='localhost',user='root', password='root',

24
 database='XIICS')
mycursor = myconn.cursor()
mycursor.execute('DELETE FROM Student WHERE Surname LIKE %s', ("_u%, ))
myconn.commit()
myconn.close()
14 A resultset is extracted from the database using a cursor object by giving the following 2
statement:
data = cursor.fetchmany(5)
a. How many records will be returned by the fetchmany( ) function/method?
b. What is the datatype of ‘data’ after the execution of the above statement?
Ans a. Five records (Please note that the fetchmany() function fetches all the records if the
number of records fetched from the database are less than the number of records specified
by the argument of fetchmany() function).
b. List
15 A resultset is extracted from the database using a cursor object by giving the following 2
statement:
data = cursor.fetchmany(5)
a. How many records will be returned by the fetchmany( ) function/method if 10 records
were returned from the database?
b. What is the datatype of ‘data’ after the execution of the above statement?
Ans a. 5 records
b. List containing 5 tuples

25
 PHYSICAL EDUCATION
TERM-2 CLASS 12 SESSION 2021-22

Shorts Answer Questions-

1- What is obesity? How can we know if we are obese?
2- Explain Bhujangasana and its procedure.
3- Discuss the procedure of Gomukhasana.
4- Explain Pawanmuktasana.
5- What is the role of Sukhasana in modern life?
6- Explain the types of disabilities.
7- Explain Sensory Processing Disorder.
8- Discuss the causes of ODD.
9- Discuss the role of genetics in ADHD.
10- Define in brief a disorder and its symptoms.
11- Write a short note on vital capacity.
12- Elaborate the effect of aging on bone density.
13- Discuss any three physiological factors determining flexibility.
14- What changes take place in cardiovascular system by doing regular exercise?
15- Explain the management of fracture?
16- Classify sports injuries with their causes.
17- What is laceration and how do you treat it?
18- What is greenstick fracture? How do you manage it?
19- What measures are taken for first aid on the sports field?
20- What is the big five theory? Explain in brief.
21- What are the dimensions of personality?
22- What is emotional stability?
23- How does regular exercise improve mood?
24- What are the typical characteristics of introvert?
25- Discuss the types of strength.
26- State any one method to develop speed.
27- Explain short-term and long-term endurance.
28- What is circuit training? Mention its advantages.
29- Discuss the dynamic flexibility. How can develop flexibility.
30- What is isometric exercise and what is its focus?

Long Answer Questions-

1- What is lifestyle disease? How can we prevent them?
2- What do you mean by asthma? Explain the procedure, benefits and contradictions of Chakrasana.
3- What is hypertension? Discuss the benefits and contradictions of Vajrasana and Ardhchakrasana.
4- Discuss the health benefits of yoga for obesity and explain any one asana in detail.
5- Back pain is an impediment. Explain how yoga can help and describe any one asana in detail to
get rid of backache.
6- How can we make physical activities accessible to special need children?
7- What is obsessive compulsive disorder? Explain its causes in detail.
8- Discuss in detail the causes of disabilities and their prevention.
9- What is the advantage of physical activities for special needs children?
10- Disability etiquette is necessary in modern world. Explain.
11- What is the effect of regular exercise on the respiratory system?
12- Elucidate any five physiological changes due to aging/
13- Enumerate any five effects of exercise on muscular system.
14- Define sports injuries. Classify and write about prevention of sports injuries.
15- Define and discuss the management of transverse, oblique and impacted fracture.
16- What are joint injuries? Discuss the measures we can take to prevent them.
17- What is the RICE concept in sports medicine?
18- Explain the term “stress”. How can it be managed?
19- Define personality. Explain its type in detail.
20- Explain the structure of personality. Describe the role of sports in developing personality.
21- Define motivation. Elucidate any five techniques of motivation.
22- How many types of aggression in sports exist? Describe any one of them.
23- Describe the personality division by Carl Jung and briefly explain any two.
24- Define endurance and discuss any two methods to increase endurance.
25- Discuss coordinative abilities in detail.
26- Describe pace races. Why they are important?
27- How can improve coordinative abilities?
28- What is fartlek training and what are its disadvantages?
29- What is explosive strength? In what sports is it important and why?
30- How is muscles strength measured? Explain in detail with specific mention of its units.
 TERM II
SAMPLE QUESTION PAPER (2021-22)
ENGLISH – CORE
CLASS-XII
Time allowed: 2 Hrs. Maximum Marks: 40
General Instructions:
1. The Question Paper contains THREE sections-READING, WRITING and LITERATURE.
2. Attempt questions based on specific instructions for each part.

SECTION A – READING (14 marks) Marks

1. Read the passage given below.

I saw ‘Jaws’, the popular shark movie, the summer it came out, in 1975 and
became paranoid about sharks. Though I kept swimming after Jaws, it was
always with the vague fear that a shark’s teeth could tug on my leg at
any moment. Never mind that there’d been only two shark bites since 1900
5 on the Connecticut coast, where I lived.

So, when I got this assignment for the National Geographic magazine, I
decided to accept and do what I’d never wanted to do: swim with the
sharks. I had to go to a place in the Bahamas known as Tiger Beach and dive
with tiger sharks, the species responsible for more recorded attacks on
10 humans than any shark except the great white. It was to be my first dive
after getting certified—which meant it would be my first dive anywhere
other than a swimming pool or a quarry—and without a diver’s cage. Most
people who got wind of this plan thought I was either very brave or very
stupid.

15 But I just wanted to puncture an illusion. The people who know sharks
intimately tend to be the least afraid of them, and no one gets closer to
sharks than divers. The divers who run operations at Tiger Beach speak
lovingly of the tiger sharks the way people talk about their children or their
pets. In their eyes, these sharks aren’t man-eaters any more than dogs are.

20 The business of puncturing illusions is never just black and white. My fellow
divers had hundreds of dives under their belt and on the two-hour boat ride
to the site in the morning of our first dive, they kept saying things like,
“Seriously, I really can’t believe this is your first dive.” All this was okay with
me until I reached the bottom and immediately had to fend off the first tiger
25 shark, I had ever laid eyes on. However, when I watched the other divers
feeding them fish and steering them gently, it became easy to see the sharks
in a very benign light.

I think it would be unfair not to mention that though tiger sharks are apex
predators. They act as a crucial balancing force in ocean
30 ecosystems, constraining the numbers of animals like sea turtles and limit

Page 1 of 6
 their behaviour by preventing them from overgrazing the sea grass beds.
Furthermore, tiger sharks love warm water, they eat almost anything, have
a huge litter and are the hardiest shark species. If the planet and its oceans
continue to warm, some species will be winners and others will be losers,
and tiger sharks are likely to be winners.

Based on your understanding of the passage, answer ANY EIGHT questions from the 1*8
nine given below.

i. Cite a point in evidence, from the text, to suggest that the writer's post-Jaws fear was 1
not justified.

ii. State any one trait of the writer that is evident from lines 5-10 and provide a reason
for your choice. 1

iii. People thought the writer was ‘either brave or very stupid’. Why did some people 1
think that he was ‘very stupid’?

iv. Why does the writer say that people who know sharks intimately tend to be least
afraid of them? 1

v. Rewrite the given sentence by replacing the underlined phrase with another one,
1
from lines 10 – 20.
Some academicians think that reward, as a form of discipline, is a simple right or
wrong issue.

vi. What does the use of the phrase ‘benign light’ suggest in the context of the writer’s
1
viewpoint about the tiger sharks?

Select a suitable phrase from lines 15-25 to complete the following sentence
vii.
appropriately. 1
I agree the team will find this experience tough, but competing will be easier next
time after they get this tournament __________________________.

viii. Apex predators serve to keep prey numbers in check. How can we say that tiger 1
sharks are apex predators?

Analyse why having a large litter is one of the features that empowers tiger sharks to
ix. emerge winners if global warming persists. 1

2. Read the passage given below. 6

Changing food preferences have brought about rapid changes in the

structure of the Indian diet. The rapid proliferation of multinational fast-
food companies and the influence of Western culture have replaced
traditional home-cooked meals with ready-to-eat, processed foods thus
5 increasing the risk of chronic diseases in urban Indians. Therefore, nurturing

Page 2 of 6
 healthy eating habits among Indians from an early age would help to reduce
health risks.

To date, little is known about the quality and quantity of foods and
beverages consumed by urban Indian adolescents. This lack of evidence is
10 a significant barrier to the development of effective nutrition promotion
and disease prevention measures.

Therefore, a self-administered, semi-quantitative, 59-item meal-based food

frequency questionnaire (FFQ) was developed to assess the dietary intake
of adolescents. A total of 1026 students (aged 14–16 years) attending
15 private, English-speaking schools in Kolkata completed the survey.

A sample percentage of the food consumption pattern is displayed (Fig. 1)

The survey results report poor food consumption patterns and highlights
the need to design healthy eating initiatives. Interestingly, while there
were no gender differences in the consumption of legumes and fried
snacks, the survey found more females consumed cereals, vegetables and
20 fruits than their male counterparts.

In conclusion, the report suggested that schools ought to incorporate food

literacy concepts into their curriculum as they have the potential of
increasing the fruit and vegetable intake in teenagers. Additionally,
healthy school canteen policies with improved availability, accessibility,
25 variety and affordability of healthy food choices would support the
consumption of nutritious food in students.

Page 3 of 6
 Adapted from: https://nutritionj.biomedcentral.com/articles/10.1186/s12937-017-0272-3

Based on your understanding of the passage, answer ANY SIX out of the seven 1*6
questions given below.

i. What does the researcher mean by ‘changing food preferences’? 1

ii. Why was this survey on the food consumption of adolescents undertaken? 1

iii. With reference to fig.1, write one conclusion about students' consumption of 1
energy-dense drinks.
FOR THE VISUALLY IMPAIRED CANDIDATES
What do you understand by the term food frequency, as stated in lines 12-13?

iv. What can be concluded by the ‘no intake’ data of fruit consumption versus 1
energy dense snacks, with reference to fig.1?
FOR THE VISUALLY IMPAIRED CANDIDATES
Comment on the significance of incorporating food literacy concepts into
student curriculum.

v. There were no gender differences observed in the consumption of healthy 1

foods, according to the survey. Substantiate.

vi. Why is ‘affordability’ recommended as a significant feature of a school 1

canteen policy?

vii. Identify a word from lines 9 - 18 indicating that the questionnaire was 1
specifically designed to be completed by a respondent without the intervention
of the researcher collecting the data.

SECTION B – WRITING 8

3. You are Natasha, residing in Pune. Your cousin, from the same city is hosting your
grandmother’s eightieth birth anniversary and has extended an invite to you. He has 3
also requested your assistance for arrangements needed. Draft a reply of acceptance,
in not more than 50 words.

4. Attempt ANY ONE from A and B given below. 5

You are Shantanu, residing at Ghar B-94, Balimela Road, Malkangiri. You come across
A.
the following classified advertisement in a local daily. Write a letter, in about 120-150
words, applying for the position of a volunteer for the Each One Teach One campaign.

Page 4 of 6
 SITUATION VACANT

WANTED committed volunteers, aged 18 years and above, to teach underprivileged

children, for one hour a week, in the district of Malkangiri. Ability to speak, read
and write Odiya fluently, important. Experience not necessary. All volunteers to
receive training. Contact Nethra N, Coordinator (Each One Teach One), 4Literacy,
Ambaguda, Malkangiri, Odisha -764045

OR

The efforts of 400 volunteers working with the NGO, 4Literacy, in the district of
B.
Malkangiri, Odisha, was lauded by the District Collector, Shri V. Singh (IAS). As a staff
reporter of ‘The Odisha Bhaskar’, write a report about this in 120-150 words covering
all the details of the event, such as training, teaching and infrastructure involved in the
‘Each One Teach One’ campaign, initiated by the district administration in association
with the NGO.
SECTION C - LITERATURE 18

5. Attempt ANY FIVE of the six questions given below, within 40 words each. 2x5=10

i. A mistaken identity led to a discovery of a new one for the rattrap peddler.
How did this impact him? 2

ii. As the host of a talk show, introduce Rajkumar Shukla to the audience by
stating any two of his defining qualities.
You may begin your answer like this: 2
Meet Rajkumar Shukla, the man who played a pivotal role in the Champaran
Movement. He ……

iii. Adrienne Rich chose to express her silent revolt through her poem, Aunt 2
Jennifer’s Tigers, just as Aunt Jennifer did with her embroidery. Explain.

iv. Rationalize why Keats uses the metaphor ‘an endless fountain of immortal 2
drink’ in his poem, A Thing of Beauty.

v. How do you think Derry’s mother contributes to his sense of alienation and 2
isolation? (On the Face of It)

vi. Validate John Updike’s open-ended title, ‘Should Wizard Hit Mommy?’. 2

6. Answer ANY TWO of the following in about 120-150 words each. 4*2
i. How does Keats’ poem, A Thing of Beauty appeal richly to the senses, stimulating the
reader’s inner sight as well as the sense of touch and smell? Write your answer in about 4
120-150 words.

Page 5 of 6
 Colin Dexter, the author of Evans Tries an O-level employs the red herring technique
ii. of intentionally misleading readers by placing false clues to keep the plot enigmatic. 4
Substantiate with reference to text, in about 120-150 words.

iii. Biographies include features of non-fiction texts – factual information and different
text structures such as description, sequence, comparison, cause and effect, or 4
problem and solution. Examine Indigo in the light of this statement, in about 120-150
words.

Page 6 of 6
 TERM II-MARKING SCHEME (2021-22)
SAMPLE QUESTION PAPER (2021-22)
ENGLISH – CORE
CLASS-XII

SECTION A – READING (14 marks)

Note:
(i) The Reading Section focuses on testing a candidate’s ability to comprehend.
(ii) Marks should be awarded only if the answer reveals formation of a response to the question.
(iii) No marks to be awarded if a chunk/exact line/s is/are transcribed from the passage without evidence of
structure or semblance of coherent thought, in an attempt to pass off as a response.

1. Based on your understanding of the passage, answer ANY EIGHT questions from the nine given below.

i. Cite a point in evidence, from the text, to suggest that the writer's post Jaws fear was not justified.
(1 mark)
Value Points Guidance
Not justified as stated in the text that there were only 2 The learner is required to look for evidence in
shark attacks reported in 75 years i.e., from 1900 – 1975, so the passage supporting/proving that the
it was highly unlikely that he had anything to fear. writer’s fear of sharks (after the movie) was a
bit irrational.

▪ Award maximum 1 mark for the complete

correct answer.
▪ There is no partial credit

ii. State any one trait of the writer that is evident from lines 5-10 and provide a reason for your choice.
(1 mark)
Value Points Guidance
Adventurous/ Courageous/ Bold/ Experimental The learner is required to infer the writer’s trait
from lines 5-10. The reason/ evidence for the
Because he feared the tiger sharks/ was aware of the fact choice of trait is to be stated too.
that they were dangerous, yet accepted, as his very first
assignment, that required him to face them. ▪ Award maximum 1 mark for the trait and
reason.
▪ Partial credit for either trait or reason
▪ No credit for just quoting from text
without an impression of an answer.

iii. People thought the writer was ‘either brave or very stupid’. Why did some people think that he was ‘very
stupid’? (1 mark)
Value Points Guidance
because he was risking his life and could be bitten by the The learner is required to answer to just the
sharks as other people were/ side-lined the popular notion ‘very stupid’ part. The ‘brave’ part hasn’t been
that tiger sharks are dangerous/ did not pay due attention asked, and there is no credit for explanation of
to the fact that he was walking into obvious danger without that.
the required expertise
 ▪Accept any 1 point.
▪Award 1 mark for the complete correct
answer
▪ Accept a relevant complete response along
the same lines.
▪ There is no partial credit

iv. Why does the writer say that people who know sharks intimately tend to be least afraid of them?
(1 mark)
Value Points Guidance
because they find the sharks to be harmless/ as docile as The learner is required to answer to why
pets—the sharks feed on the food they offer and seem as familiarity with the sharks makes the people
docile as pets less/least afraid of them.

▪ Award maximum 1 mark for the complete

correct answer
▪ Award partial credit of ½ mark if just
‘harmless’/ ‘as docile as pets’ is the
response, without substantiation.

v. Rewrite the given sentence by replacing the underlined phrase with another one, from lines 10 – 20.
Some academicians think that reward, as a form of discipline, is a simple right or wrong issue. (1 mark)

Value Points Guidance

Some academicians think that reward, as a form of
discipline, is a simple black and white issue. ▪ Award 1 mark for the correct answer
▪ No partial credit

Learners are expected to write the full

sentence with the answer, however, no
marks to be deducted if they just write the
phrase only.

vi. What does the use of the phrase ‘benign light’ suggest in the context of the writer’s viewpoint about the
tiger sharks? (1 mark)
Value Points Guidance
▪ Benign light – viewed as benevolent/ gentle/ friendly ▪ Award maximum 1 mark for the complete
▪ Tiger sharks did not seem to be that harmful/dangerous/ correct answer.
They seemed fairly docile/less dangerous than the other ▪ Award partial credit of ½ mark if just the
sharks meaning of ‘benign light’ is explained,
without the context of tiger sharks and vice
versa. Accept any other similar
interpretations that are complete, with
reference to the given passage.

vii. Select a suitable phrase from lines 15-25 to complete the following sentence appropriately. (1 mark)
I agree the team will find this experience tough, but competing will be easier next time after they get this
tournament __________________________.

Value Points Guidance

I agree the team will find this experience tough, but
competing will be easier next time after they get this ▪ Award 1 mark for the correct answer
tournament under their belt. ▪ No partial credit
(line 21) Learners are expected to write the full
sentence with the answer filled in, however,
no marks to be deducted if they just write the
phrase only.

viii. Apex predators serve to keep prey numbers in check. How can we say that tiger sharks are apex
predators? (1 mark)
Value Points Guidance
Because tiger sharks restrict the number of sea turtles (by The learner is required to answer how tiger
feeding on them), and act as a balancing force in the sharks serve to keep prey numbers in check.
ecosystem. If the numbers weren’t constrained, it would Here, sea turtles are stated as the prey. There
result in the depletion of sea-grass which supports other is also a suggestion that there are other
marine life forms. marine creatures like the sea turtles.

▪ Award maximum 1 mark for the complete

correct answer
▪ Award partial credit of ½ mark if just
‘balancing force’/constraining number of
sea turtles/ ‘overgrazing the sea grass
beds’ / ‘anchoring the ecosystem’ is the
response, without substantiation.

ix. Analyse why having a large litter is one of the features that empowers tiger sharks to emerge winners if
global warming persists. (1 mark)
Value Points Guidance
Reduces possibility of extinction or destruction due to The learner is required to examine how the
harsh conditions, as large numbers would ensure that tiger sharks would continue to survive despite
some definitely survive. warming of oceans if they have a large litter.

▪ Award maximum 1 mark for the

complete correct answer
▪ No partial credit

2. Based on your understanding of the passage, answer ANY SIX out of the seven questions given below.

i. What do the researchers mean by ‘changing food preferences? (1 mark)

Value Points Guidance
Urban population’s transition from healthy home-cooked The learner is required to include the change
meals to ready-to-eat-processed foods in food habits/preferences as indicated in the
text

▪ Award 1 mark for the complete

answer.
▪ No partial credit

ii. Why was this survey on the food consumption of adolescents undertaken? (1 mark)
Value Points Guidance
 ▪ understand the food consumption pattern of urban The learner needs to draw on the objectives
adolescents and listed.
▪ make recommendations based on the data.
▪ Award ½ mark for each point, to a
maximum of 1 mark
▪ ½ mark partial credit if one point is
stated

iii. With reference to fig.1, write one conclusion about students' consumption of energy-dense drinks.
(1 mark)
Value Points Guidance
The learner needs to analyse the energy
Close to 47% drink three or more servings of energy dense dense drinks’ graph and compare
beverages while a mere 5% said ‘no’ to more than one consumption trend, to analyse.
serving of the beverage.
▪ Award ½ mark each, for a maximum of
1 mark, for both aspects.
▪ ½ mark as partial credit for only one
aspect

FOR THE VISUALLY IMPAIRED CANDIDATES

What do you understand by the term food frequency, as stated in lines 12-13?

Refers to the rate of intake of food and beverages (drinks) The learner needs to explain, from context,
consumed over a specified period of time. It could even the meaning of the term ‘food frequency’.
refer to portion size.
▪ Award ½ mark each, for ‘rate of intake’
and ‘over a period of time’.
▪ ½ mark as partial credit if only ‘rate of
intake’ or ‘over a period of time’ is
alluded to.
The vocabulary used to explain the term may
vary and the explanation is to be accepted if
the two main aspects of the term have been
addressed.

iv. What can be concluded by the ‘no intake’ data of fruit consumption versus energy dense snacks, with
reference to fig.1? (1 mark)
Value Points Guidance
The learner needs to analyse the fruit
Nearly half the respondents (45%) did not consume any consumption graph for ‘no intake’ with energy
servings of fruit in contrast to 95% that had some form of dense snacks’ graph for ‘no intake’ and
energy dense snack. compare to analyse.

▪ Award ½ mark for each to a maximum

of 1 mark
▪ ½ mark as partial credit for only one
aspect
FOR THE VISUALLY IMPAIRED CANDIDATES
Comment on the significance of incorporating food literacy concepts into student curriculum.
It is important because reading about the advantages of a The learner needs to explain the importance
healthy diet would assist an increased intake of fruits and of this recommendation, based on the study.
vegetables in teenagers
▪ Award ½ mark for each to a maximum
of 1 mark
▪ ½ mark as partial credit for only one
aspect
▪ Quoting the textual line in response,
without explaining how it works,
carries no credit.

v. There were gender differences observed in the consumption of healthy foods, according to the survey.
Substantiate. (1 mark)
Value Points Guidance
The learner needs correctly substantiate the
Females had more nutritious dietary intake as they statement with reference to the graph.
consumed more cereals, vegetables and fruits compared to
their male counterparts. ▪ Award 1 mark for complete answer
▪ No partial credit

vi. Why is ‘affordability’ recommended as a significant feature of a school canteen policy? (1 mark)
Value Points Guidance
The learner needs to infer the reason why
The consumers are school children and therefore food school canteen fare needs to be affordable.
should be affordable
▪ Award 1 mark for a valid reason.
▪ No partial credit

vii. Identify a word from lines 9 - 17 indicating that the questionnaire was specifically designed to be
completed by a respondent without the intervention of the researcher collecting the data. (1 mark)
Value Points Guidance
Self-administered ▪ Award 1 mark for the correct answer
▪ No partial credit

SECTION B – WRITING
This questions in this section address the following writing LOs:

1. convey ideas convincingly using appropriate layout as relevant

2) organize the content and structure the ideas logically, sequentially, cohesively
3) use a range of vocabulary and sentence structure appropriate to the content and the context
4) make accurate use of spelling, punctuation and grammar

3. You are Natasha, residing in Pune. Your cousin, from the same city is hosting your grandmother’s
eightieth birth anniversary and has extended an invite to you. He has also requested your assistance for
arrangements needed. Draft a reply of acceptance, in not more than 50 words.
(3 marks)

Content -2 Expression-1 Accuracy *

Value Points

• Reference to invitation
• Acceptance of invitation
 • Confirmation of date, time and venue
• Comment on extending assistance

▪ Content (as listed in value points) –

½ mark *4=2 marks

▪ Expression- 1 mark
use of appropriate functional language to show
(i) acknowledgement/ gratitude for invite- thank you
(ii) acceptance- would love to / delighted to/nothing can stop me from attending etc.
(iii) confirming assistance- gladly/ goes without saying/ just let me know how I can help/ goes
without saying etc.

✓ full credit of 1 mark to be allotted if the functional language/ expressions has/ have been used
consistently, throughout.
✓ Partial credit of ½ mark to be allotted if the functional language/ expressions has/have been used
generally, in most places.
✓ No credit of marks if the functional language/ expressions has/ have been used sporadically/ not at
all.

▪ Accuracy* - Deductions up to 1 mark from overall score

✓ Deduct ½ mark from total marks if all or either one of the following apply:
• the reply is not formatted correctly as an informal letter/ largely in informal letter format
• has a few inaccurate spellings and grammatical structures

✓ Deduct 1 mark from total marks if all or either one of the following apply:
• the reply is not in informal letter format/ has a fair number of format inaccuracies
• has a total of 3 or more spelling/ grammatical errors

4. Attempt ANY ONE from A and B given below. (5 marks)

A. You are Shantanu, residing at Ghar B-94, Balimela Road, Malkangiri. You come across the following
classified advertisement in a local daily. Write a letter, in 120–150 words, applying for the position of a
volunteer for the Each One Teach One campaign.
SITUATION VACANT

WANTED committed volunteers, aged 18 years and above, to teach

underprivileged children, for one hour a week, in the district of Malkangiri.
Ability to speak, read and write Odiya fluently, important. Experience not
required. All volunteers to receive training. Contact Nethra N, Coordinator
(Each One Teach One), 4Literacy, Ambaguda, Malkangiri, Odisha -764045

Content -2 Expression-2 Accuracy -1

Value points- Content
• Covering Letter
• Reference to the advertisement
• Conveying suitability for the position
• Submission of application
• Resume / Bio data as separate enclosure
• Profile of self
• Educational Qualifications
• Any other relevant information
 Descriptors for Content
NOTE-Dedicated marks at a level are to be awarded only if ALL descriptors match. If one or more descriptors do not
match, the marks are awarded at a level lower.
2 marks
✓ All points included
✓ Well-developed with sustained clarity
1½ marks
✓ Almost all points incorporated
✓ Reasonably well-developed
1 mark
✓ Some points incorporated
✓ Fair attempt at developing ideas with some impact on clarity of response
½ mark
✓ Most of the points of the given task not incorporated
✓ Limited awareness of task development
Expression -2 marks
Marks Descriptors for Expression
NOTE-Dedicated marks at a level are to be awarded only if ALL descriptors match. If one or more descriptors do
not match, the marks are awarded at a level lower.
2 • Highly effective style capable of conveying the ideas convincingly with appropriate layout of
a formal letter viz. addresses, salutation,subscription, and ending.
• Carefully structured content with organised paragraphing presented cohesively.
• Highly effective register (formal tone and vocabulary), relevant and appropriate
sentences for conveying the ideas precisely and effectively.
1½ • Frequent clarity of expression most of the times, layout of a formal letter largely accurate.
• Ideas generally well sequenced and related to the given topic maintaining overall
cohesion of ideas.
• Range of vocabulary is mostly relevant and conveys the overall meaning and the purpose of
the writing.
1 • Inconsistent style, expression sometimes awkward, layout of a formal letter basically
accurate.
• Sequencing of ideas is somewhat clear and related to the given topic attempting to
maintain a general overall cohesion.
• Range of vocabulary is limited but manages to convey the overall meaning and the purpose
of the writing.
½ • Expression unclear, layout partially followed affecting the format of the letter.
• Poor sequencing of ideas but ideas are related to the given topic in a disjointed manner
exhibiting a lack of coherence of ideas.
• Very limited vocabulary or copying from the question.
Accuracy -1 mark
Descriptors for Accuracy
1 mark
✓ Spelling, punctuation and grammar consistently/largely accurate, with occasional minor errors,
that do not impede communication.
½ mark
✓ Spelling, punctuation and grammar display some errors spread across, causing minor impediments
to the message communicated.
 No credit
✓ Frequent errors in spelling, punctuation and grammar, impeding communication.
B. The efforts of 400 volunteers working with the NGO, 4Literacy, in the district of Malkangiri, Odisha, was
lauded by the District Collector, Shri V. Singh (IAS). As the staff reporter of ‘The Odisha Bhaskar’, write a
report in 120-150 words covering all details of the event, such as the training, teaching and infrastructure
involved in the ‘Each One Teach One’ campaign, initiated by the district administration in association with
the NGO.
Value Points

• what - the efforts of 400 volunteers in the Each One Teach One campaign lauded by the District
Collector
• who were taught and what was taught
• when & where
• details of the volunteer work
• training received by the volunteers by the NGO and district administration
• the infrastructure – classrooms, blackboard etc.
• Any other valid relevant information

Descriptors for Content

NOTE-Dedicated marks at a level are to be awarded only if ALL descriptors match. If one or more descriptors do not
match, the marks are awarded at a level lower.
2 marks
✓ All points included
✓ Well-developed with sustained clarity
1½ marks
✓ Almost all points incorporated
✓ Reasonably well-developed
1 mark
✓ Some points incorporated
✓ Fair attempt at developing ideas with some impact on clarity of response
½ mark
✓ Most of the points of the given task not incorporated
✓ Limited awareness of task development

Expression -2 marks
 Marks Descriptors for Expression
NOTE-Dedicated marks at a level are to be awarded only if ALL descriptors match. If one or more descriptors do
not match, the marks are awarded at a level lower.
2 • Highly effective style capable of conveying the ideas convincingly with appropriate layout of
a newspaper report viz. headline and by-line, place, date.
• Carefully structured content with organised paragraphing presented cohesively.
• Highly effective register (formal tone, tense, and vocabulary), relevant and appropriate
sentences for conveying the ideas precisely and effectively.
1½ • Frequent clarity of expression most of the times, layout of a newspaper report largely
accurate.
• Ideas generally well sequenced and related to the given topic maintaining overall
cohesion of ideas.
• Range of vocabulary is mostly relevant and conveys the overall meaning and the purpose of
the writing.
1 • Inconsistent style, expression sometimes awkward, layout of a newspaper report basically
accurate.
• Sequencing of ideas is somewhat clear and related to the given topic attempting to
maintain a general overall cohesion.
• Range of vocabulary is limited but manages to convey the overall meaning and the purpose
of the writing.
½ • Expression unclear, layout partially followed affecting the format of the newspaper
report.
• Poor sequencing of ideas but ideas are related to the given topic in a disjointed manner
exhibiting a lack of coherence of ideas.
• Very limited vocabulary or copying from the question.

Accuracy -1 mark
Descriptors for Accuracy
1 mark
✓ Spelling, punctuation and grammar consistently/largely accurate, with occasional minor
errors, that do not impede communication.
½ mark
✓ Spelling, punctuation and grammar display some errors spread across, causing minor
impediments to the message communicated.
No credit
• Frequent errors in spelling, punctuation and grammar, impeding communication.

SECTION C - LITERATURE
5. Attempt ANY FIVE of the six questions given below, within 40 words each. (2 marks each) x 5= 10 marks

i. A mistaken identity led to a discovery of a new one for the rattrap peddler. How did this impact him?
Value Points Guidance
The examiner knows about the mistaken
• Gave him the power to clear his conscience identity, hence that requires no elaboration
• Brought out his latent goodness here.
 • Lent him conviction to become a better human/ a The response needs to address how the
chance at elevating himself from being a thief mistaken identity effected/ influenced him.
• Allowed him the opportunity to behave in a
dignified manner befitting that of a Captain Content -
Award 1 mark for inclusion of any one impact
with explanation.
Award ½ mark if the impact is listed without
explanation.

Expression –
1 mark when both given aspects are included.
✓ Answer organised effectively
✓ usage of words for effect-cause (due to, as
a result, owing to, therefore etc.)
½ mark when either aspect is missing

Deduct ½ mark from the overall score if the

error density is high (more than a total of 2
spellings and/or grammatical errors).
ii. As the host of a talk show, introduce Rajkumar Shukla to the audience by stating any two of his defining
qualities. You may begin your answer like this:
Meet Rajkumar Shukla, the man who played a pivotal role in the Champaran Movement. He ……

Value Points Guidance

• Determined/ Resolute The examiner knows the sequence of

• Persevering incidents that transpired, and the role of
• Dedicated Gandhi, hence that requires no elaboration
• Any other valid quality here.
The question requires characteristics of
Rajkumar Shukla, as inferred from the text
written as introductory lines to be spoken.

Content -
Award 1 mark for 2 valid qualities.
Award ½ mark for one valid.

Expression –
1 mark when both given aspects are included
✓ Answer organised effectively
✓ The language usage needs to display a
semi-formal tone + language for
introduction
½ mark when either aspect is missing

Deduct ½ mark from the overall score if the

error density is high (more than a total of 2
spellings and/or grammatical errors).
iii. Adrienne Rich chose to express her silent revolt through her poem, Aunt Jennifer’s Tigers, just as Aunt
Jennifer did with her embroidery. Explain.

Value Points Guidance

Adrienne Rich, through her poem, criticizes the traditional Both the poet’s and Aunt Jennifer’s point of
institution of marriage, in her times, suggesting that it view to be expressed.
oppresses women. Similarly, Aunt Jennifer, a victim of an
unhappy marriage, under a domineering husband, chooses Content -
embroidery to vent her angst. Award 1 mark for both aspects compared.
Both use their creative outlet as a form of protest against Award ½ mark for elaboration on only one
societal expectations. aspect.

Expression –
1 mark when both given aspects are included
✓ Answer organised effectively
✓ The language usage needs to display
comparison (similarly/ just like etc.)
½ mark when either aspect is missing

Deduct ½ mark from the overall score if the

error density is high (more than a total of 2
spellings and/or grammatical errors).
iv. Rationalize why Keats uses the metaphor ‘an endless fountain of immortal drink’ in his poem, A Thing of
Beauty.
Value Points Guidance
• Things of beauty are just like the immortal drink of the The question requires an answer to how
gods that flow continuously and never die beauty is perennial.
• Just as the endless fountain of immortality is an elixir
of life, similarly things of beauty are constant/ Content -
perennial in providing everlasting joy/ motivation/bliss Award 1 mark for stating the reason with valid
explanation.
Award ½ mark for just stating minus
explanation.

Expression –
1 mark when both given aspects are included
✓ Answer organised effectively
✓ The language usage needs to display
rationalisation via comparison (just as/
similarly/ like)
½ mark when either aspect is missing

Deduct ½ mark from the overall score if the

error density is high (more than a total of 2
spellings and/or grammatical errors).

v. How do you think Derry’s mother contributes to his sense of alienation and isolation? (On the Face of It)
Value Points Guidance
• Mother is overprotective and doesn’t understand her The question requires inferring how the
son’s longing for companionship. actions of Derry’s mother led to the
• She treats him with a sense of pity and robs him of his development of feelings of alienation and
dignity by perpetually treating him like a helpless isolation in her son.
victim The learner would be required to draw upon
textual evidence to infer.

Content -
 Award 1 mark for 2 valid points.
Award ½ mark for 1 valid point.

Expression –
1 mark when both given aspects are included
✓ Answer organised effectively
✓ The language usage needs to display
stating of inference (based on…I
believe that/…. reveals that…. etc.)
½ mark when either aspect is missing

Deduct ½ mark from the overall score if the

error density is high (more than a total of 2
spellings and grammatical errors).

vi. Validate John Updike’s open-ended title, ‘Should Wizard Hit Mommy?’.
Value Points
The story title is a question that suggests agreeing with The question requires an opinion from the
Jo, who believes in justice for the skunk, or the father, who learner in favour of leaving the title open-
believes that mothers cannot err. ended (‘validate’)
Both seem right.
Content -
The author leaves it open-ended for the reader to Award 1 mark for identification of the title as
allow flexibility and creative insight a question that could have varying answers +
(any other valid purpose) likely purpose of writer.
Award ½ mark for either aspect.

Expression –
1 mark when both given aspects are included
✓ Answer organised effectively
✓ The language usage needs to display
justification
½ mark when either aspect is missing

Deduct ½ mark from the overall score if the

error density is high (more than a total of 2
spellings and grammatical errors).
LONG QUESTIONS No. 6 (i-iii) (ANY TWO - 4 marks each)

Content 2 Expression & Accuracy 2

Note-
✓ Use the given descriptors to mark the LQs. For CONTENT (refer to Value points) and EXPRESSION
✓ If the response does not justify all points of a level, the response is marked down.

DESCRIPTORS FOR CONTENT (with reference to value points) MARK

• Sustained, clear, well-developed personal response to the task 2
• Well-developed and justified arguments/evidence for the
characters
• Largely, a reasonably well-developed personal response to the 1½
task
• Clear justification with arguments/evidence for the characters
• Fairly competent personal response to the task 1
 • Clear justification with restricted arguments/evidence for the
characters
• Limited awareness of the task ½
• Limited justification or relevant arguments/evidence for the
characters
DESCRIPTORS FOR EXPRESSION (Coherence & Cohesion + Accuracy) MARKS

• Carefully structured content with a beginning, middle and end 2

with highly relevant ideas presented cohesively.
• Highly effective vocabulary usage, relevant and appropriate
sentences for conveying the ideas precisely and effectively.
• Spelling, punctuation and grammar are almost always accurate
• Ideas generally well sequenced and related to the given topic 1½
maintaining overall cohesion of ideas.
• Range of vocabulary suffices in large parts to convey the overall
idea and meaning
• Spelling, punctuation and grammar mostly accurate, with
occasional minor errors but does not impede communication
• Ideas sequenced fairly well and related to the given topic, 1
sometimes maintaining cohesion of ideas.
• Range of vocabulary is limited and conveys a basic idea of the
overall meaning
• Spelling, punctuation and grammar fairly accurate, with
occasional minor errors but does not impede communication
• Poor sequencing of ideas; though related to the given topic, ½
expressed in a disjointed manner exhibiting a lack of coherence
of ideas.
• Very limited expected/ topical vocabulary as per question asked
• A lot of errors in spelling, punctuation and grammar that impede
communication.
6 (i). How does Keats’ poem, A Thing of Beauty appeal richly to the senses, stimulating the reader’s inner
sight as well as the sense of touch and smell? Write your answer in about 120-150 words.

Value Points
Introduction
Keats’ descriptions allow for a deeper perception of the imaginary, converting it into a life-like experience stimulating
the reader’s inner sight as well as the sense of touch and smell.

Justification (any 2-3)

• Keats establishes this with powerful imagery and word play
• The cooling comfort of the bower, dancing daffodils in its green environs, the babbling stream and the mid-
forest brake with the musk rose blooms evoke our imagination, sense of hearing, touch and smell.
• The stories of mighty and the doom that befalls them appeals to our intellect
• The endless fountain may be an allusion of the fountain of youth however it has a sublimating effect on the
reader.
• Keats poetic descriptions presents beauty that appeals to our senses and gives delight.

(Accept associated relevant points)

6. (ii). Colin Dexter, the author of Evans Tries an O-level employs the red herring technique of intentionally
misleading readers by placing false clues to keep the plot enigmatic. Substantiate with reference to text, in
about 120-150 words.
Value Points
Introduction
The stage is set - a maximum security prison and a kleptomaniac with a record of breaking out of prison

Analysis (any 3-4)

• Evans’ grubby appearance, jovial manner and friendly banter distracts from sharp intelligence and
extraordinary talent for deception
• The silly but filthy looking bobble hat (a knit beanie with a pom-pom on top) distracts, giving readers the
appearance of a comical character
• ‘Number two Handkerchief’ neatly placed on the bed, where’s number one?
• The first mention of Reverend Stuart McLeery exiting his bachelor flat in Broad Street.
• Mention of the nail file and then reference to McLeery’s meticulously manicured fingers
• Illusion of Mc Leery having grown thinner and then ‘Mc Leery’ slumped in a chair
• Clues in the question paper, a chase all over town
(Accept similar relevant points)

Conclusion
Colin Dexter’s Evan’s Tries an O-level – a creative and highly complicated prison break interspersed with twists in the
plot.

6. (iii). Biographies include features of non-fiction texts – factual information and different text structures
such as description, sequence, comparison, cause and effect, or problem and solution. Examine Indigo in the
light of this statement, in about 120-150 words.
Value Points
Introduction
Focus on Indigo being an excerpt of a biography and thus having features of fiction as well as non-fiction texts.

Examination
Substantiation to support the point that it includes—
• Factual information (any 2)
• Text structures (examples of any 2 different features)
✓ explanation;
✓ content recorded in order of occurrence;
✓ points of comparison between people;
✓ action and impact;
✓ problem-solution/ conflIct resolution
(The learner is expected to elaborate on both aspects—factual information + text structure)

Conclusion
Reiterating that Indigo does include features of a non-fiction text.
 ितदश प 2021-22

िवषय - िहं दी (आधार)

(िवषय कोड - 302)

क ा - बारहवी ं

िनधा रत समय : 90
2 घंिमनट
टे  अिधकतम अं क : 40
अं क

सामा िनदश :-
 िन िल खत िनदशों को ब त सावधानी से पिढ़ए और उनका पालन कीिजए :-
 इस प म वणना क पू छे गए ह।

 इस प म कुल 07 पू छे गए ह। आपको 07 ों के उ र दे ने ह।

 ों म आं त रक िवक भी िदए गए ह। िनदशानु सार उ र दीिजए।

सं ा कायालयी िहंदी और रचना क लेखन अं क

(20)

1. िन िल खत िदए गए 03 शीषकों म से िकसी 01 शीषक का चयन कर 5x1=5

लगभग 200 श ों का एक रचना क लेख िल खए :-
 ातः काल योग करते लोग
 दु घटना से दे र भली
 िज ज ी थी, वे चले गए

2. अपने े के मु िचिक ा अिधकारी, उनके िचिक कों और सहायक 5x1=5

कमचा रयों को कोरोना काल म उनके ारा िकये गए काय की शंसा और
सरहाना करते ए एक प िल खए।
अथवा
 बस चालकों की असावधानी से हो रही दु घटनाओं पर िचंता करते ए
िकसी समाचार प के संपादक को प िल खए।

3. (i) कहानी की प रभाषा बताते ए इसके त ों के नाम िलख। 3x1=3

अथवा
नाटक म अिभनय और संवाद योजना के मह को रे खां िकत कीिजए।

3. (ii) रे िडयो नाटक की अविध छोटी ों रखी जाती है? 2x1=2

अथवा
कहानी म ाइमे का ा मह है ?

4. (i) समाचार ले खन की रचना ि या को कीिजए। 3x1=3

अथवा
फ़ीचर कैसे िलखा जाता है ?

4. (ii) समाचार और फ़ीचर म मु अंतर ा होता है? 2x1=2

अथवा
समाचार ले खन के छः ककार कौन से ह?

सं ा पा पु
क आरोह भाग - 2 तथा अनुपूरक पा पु क िवतान भाग अं क
–2 (20)
5. िन िल खत 03 ों म से िक ी ं 02 ों के उ र दीिजए। 3x2=6
(i) शमशेर की किवता ‘उषा’ गाँ व के जीवन का जीवंत िच ण है। पुि कीिजए। 3

(ii) 'किवतावली' के आधार पर िस कीिजए िक तुलसीदास को अपने समय की 3

आिथक-सामािजक सम ाओं की समझ थी।

(iii) िफ़राक की गज़ल म अपना परदा खोलने से ा आशय है? 3

6. िन िल खत 04 ों म से िक ी ं 03 ों के उ र दीिजए। 3x3=9

(i) जाित था को म िवभाजन का ही एक अं ग न मानने के पीछे डॉ. 3

आं बेडकर के ा तक थे ?
(ii) नमक कहानी म नमक की पु िड़या इतनी मह पूण ों हो गई थी? क म 3

अिधकारी उसे लौटाते ए भावुक ों हो उठा था?

(iii) बाबा भीमराव आं बेडकर के अनु सार उनकी क ना का आदश समाज 3
 कैसा होना चािहए? अपने श ों म अिभ कर।
(iv) 'ढोल म तो जैसे पहलवान की जान बसी थी।' 'पहलवान की ढोलक' पाठ के 3

आधार पर तक सिहत पं को िस कीिजए।

7. िन िल खत ों के उ र दीिजए। 3+2=5

(i) एन क की डायरी िक ी को संबोिधत कर ही ों िलखी गई है ? यह 3x1=3

डायरी वह िकसी अपने को भी सं बोिधत कर सकती थी? तक सिहत उ र

दीिजए।
अथवा
मोहनजोदाड़ो की स ता को लो - ोफाइल स ता ों माना गया है ?
(ii) "काश, कोई तो होता जो मेरी भावनाओं को गंभीरता से समझ पाता। 2x1=2

अफ़सोस, ऐसा मुझे अब तक नही ं िमला।" एन क की इस पं

का आशय कर।
अथवा
िसं धु स ता के क म समाज था, राजा या धम नही!ं िस कीिजए।
 ितदश प 2021-22

िवषय - िहं दी (आधार)

(िवषय कोड - 302)

क ा – बारहवी ं

अंक योजना

िनधा रत समय : 90
2 घंिमनट
टे  अिधकतम अंक : 40 अंक

सामा िनदश :-

 अं क योजना का उ े मू ां कन को अिधकािधक व ुिन बनाना है|

 वणना क ों के अंक योजना म िदए गए उ र-िबंदु अं ितम नही ं ह| ये सुझावा क एवं सां केितक ह|
 यिद परी ाथ इन सां केितक िबंदुओं से िभ , िकंतु उपयु उ र दे तो उसे अंक िदए जाएँ |
 मू ां कन काय िनजी ा ा के अनुसार नही,ं ब अं क-योजना म िनिद िनदशानुसार ही िकया
जाए|

सं ा कायालयी िहंदी और रचना क लेखन अं क

(20)

1. िकसी एक िवषय पर लगभग 150 श ों म रचना क लेख िल खए:- 5x1=5

भूिमका - 1 अं क
िवषयव ु - 3 अंक
भाषा - 1 अंक

2. 2 म से िकसी 1 िवषय पर प (लगभग 80-100 श -सीमा) 5x1=5

आरं भ और अं त की औपचा रकताएँ - 1 अंक

 िवषयव ु - 3 अंक

भाषा - 1 अंक
3. (i) कहानी ग सािह की वह सबसे अिधक रोचक एवं लोकि य िवधा है , जो जीवन 3x1=3
के िकसी िवशे ष प का मािमक, भावना क और कला क वणन करती है।
“िह ी ग की वह िवधा है िजसमे ले खक िकसी घटना, पा अथवा सम ा का
मब ौरा दे ता है , िजसे पढ़कर एक सम त भाव उ होता है,
उसे कहानी कहते ह”।
o कथाव ु
o च र -िच ण
o कथोपकथन
o दे शकाल
o भाषा-शैली
o उ े
अथवा
अिभनय िकसी अिभने ता या अिभने ी के ारा िकया जाने वाला वह काय है
िजसके ारा वे िकसी कथा को दशाते ह, साधारणतया िकसी पा के मा म से।
अिभनय का उ े होता है िकसी पद या श के भाव को मु अथ तक प ँचा
दे ना; अथात् दशकों या सामािजकों के दय म भाव या अथ से अिभभूत करना"।
संवाद – नाटक म नाटकार के पास अपनी और से कहने का अवकाश नहीं
रहता। वह संवादों ारा ही व ु का उद् घाटन तथा पा ों के च र का िवकास
करता है । अतः इसके संवाद सरल , सुबोध , भािवक तथा पा अनुकूल होने
चािहए।

3. (ii) मा म म मनु की एका ता सीिमत होती है । 2x1=2

अथवा
चरम उ ष या ाइमे कहानी का अंितम त होता है । इसम कहानी के
उ े की अिभ होती है । कहानी का उ े मनोरं जन के साथ साथ जीवन-
संबंधी अनु भूितयों से मानव-मन का िनकट प रचय कराना है ।

4. (i) o उ ा िपरािमड शैली 3x1=3

o इं टो , बॉडी और समापन
 अथवा
फीचर ले खन िकसी कहानी , उप ास की तरह ही कुछ िबंदुओं पर आधा रत होता
है – आरं भ, म , चरम, समापन, भाषा – शैली, ने ता तथा िन ष। फीचर ले खन का
आरं भ िकसी घटना, या ा आिद पर आधा रत होता है। आरं भ म पाठक को कुछ
ऐसी घटना का िज करना चािहए िजससे पूरा ले ख पढ़ने की उ ुकता पाठक के
मन म बरकरार रहे ।

4. (ii) समाचार और फीचर म मु ख अं तर ुतीकरण की शैली और िवषयव ु की 2x1=2

मा ा का होता है। जहाँ उ ा िपरािमड शै ली म िलखा गया समाचार िकसी िवषय
अथवा घटना को संि प म ुत करता है , वही ं फीचर उस समाचार को
िव ार से ु त करता है ।
अथवा
चार ककार ( ा, कब, कौन, कहाँ ) सूचना क व अ म दो ककार ( ों, कैसे)
िववरणा क होते ह।

सं ा पा पु
क आरोह भाग - 2 तथा अनुपूरक पा पु क िवतान भाग अं क
-2 (20)
5. िन िल खत 03 ों म से िक ी ं 02 ों के उ र दीिजए। 3x2=6
(i) राख से लीपा आ चौका 3
ब त काली िसल
ेट पर या लाल खिड़या चाक मलना
िकसी की गौर िझलिमल दे ह का िहलना

(ii) ‘किवतावली’ म उद् धृत छं दों के अ यन से पता चलता है िक तुलसीदास को अपने 3

युग की आिथक िवषमता की अ ी समझ है। उ ोंने समकालीन समाज का
यथाथपरक िच ण िकया है। वे समाज के िविभ वगों का वणन करते ह जो कई
तरह के काय करके अपना िनवाह करते ह। तुलसी दास तो यहाँ तक बताते ह िक
पेट भरने के िलए लोग गलत-सही सभी काय करते ह। उनके समय म भयंकर
गरीबी व बेरोजगारी थी। गरीबी के कारण लोग अपनी संतानों तक को बेच दे ते थे ।
बेरोजगारी इतनी अिधक थी िक लोगों को भीख तक नही ं िमलती थी। द र ता पी
रावण ने हर तरफ हाहाकार मचा रखा था।

(iii) परदा खोलने से आशय है – अपने बारे म बताना। यिद कोई िकसी दू सरे 3
 की िनंदा करता है या बुराई करता है। तो वह यं की बुराई कर रहा है। इसीिलए
शायर ने कहा िक मेरा परदा खोलने वाले अपना परदा खोल रहे ह।

6. िन िल खत 04 ों म से िक ी ं 03 ों के उ र दीिजए। 3x3=9

(i) 1. जाित था म का ही िवभाजन नही ं करती ब यह िमक को भी बाँ ट 3

दे ती है

2. जाित था म म का जो िवभाजन िकया गया है , वह की िच को

ान म रखकर नही ं िकया गया है ।

3. जाित था म पेशे का िनधारण एक मनु को जीवनभर के िलए दे िदया

जाता है ।
(ii) इस कहानी म नमक की पु िड़या के मह पू ण बनने का यह कारण है िक 3

भारत-पाक के बीच नमक का ापार गैरकानूनी था। दू सरे , यह िवभाजन

की यादों से जु ड़ी है । क म अिधकारी नमक की पु िड़या लौटाते

ए भावुक हो उठा ोंिक हर को ज भूिम से लगाव होता है । उस

े म की अनु भूित से वह भावु क हो उठा।
(iii) उनका यह आदश समाज तं ता, समता व ातृ ता पर आधा रत होगा। 3

(iv) पहलवान का सारा जीवन ही ढोल की आवाज़ से उठता - िगरता है , 3

पहलवान की ढोलक पूरे गाँ व म सं जीवनी बूटी का काय करती है , ढोल की

थाप से पहलवान की कु ी के दाँ व-पच िनि त होते थे ।
7. िन िल खत ों के उ र दीिजए। 3+2=5

(i) अपनी डायरी म अपनी गुिड़या को वह प िलखती है । गुिड़या को प 3x1=3

िलखते ए अपरो प से वह खु द से ही बात करती है । वह जानती है िक

िजन बातों को वह िलख रही है , शायद उ दू सरे ठीक ढं ग से न

समझ पाय। इसीिलए उसे अपनी गुिड़या को संबोिधत करते ए प

िलखना पड़ा।
अथवा
ले खक ने िसंधु स ता को 'लो ोफाइल' स ता कहा है। संसार के अ थानों
पर खुदाई करने से राजतं को दिशत करने वाले महल, धम की ताकत िदखाने
 वाले पूजा थल, मू ितयाँ तथा िपरािमड िमले ह। मोहनजोदड़ो म ऐसी कोई चीज
नही ं िमली है जो राजस ा या धम के भाव को दशाती है।

(ii) अकेलापन ही ऐन क के डायरी लेखन का कारण बना। य िप वह अपने 2x1=2

प रवार और वॉन दं पि के साथ अ ातवास म दो वष तक रही लेिकन इस

दौरान िकसी ने उसकी भावनाओं को समझने का यास नही ं िकया। पीटर

य िप उससे ार करता है लेिकन केवल दो की तरह। जबिक हर िकसी

की शारी रक ज रत होती ह लेिकन पीटर उसकी इस ज़ रत को नही ं

समझ सका। माता-िपता और बहन ने भी कभी उसकी भावनाओं को

गंभीरता से नही ं। समझी शायद इसी कारण वह डायरी िलखने लगी।
अथवा
इस स ता को लेखक ने साधन-सं प माना है । इस स ता ने भ ता को
मह नही ं िदया है । यह कला कता को मह दे ती है । अतः हम कह

सकते ह िक यहाँ के लोग बोध कला म िच रखते थे । यहाँ की नगर

व था, प र तथा धातु से बनी मूितयाँ , पशु-पि यों की आकृितयाँ , सुं दर

मुहर, खलौने, बालों को सवारने का कंघा, गहने इ ािद इसके सौंदय बोध
का माण दे ते ह। यहाँ पर आपको राजिच या धम से सं बंिधत िच नही ं

िमलते ह। यिद िमलते होते तो इसकी थित िबलकुल अलग होती। यहाँ
आम जनता से जु ड़े िच अिधक िबखरे ए ह। िजनका सौंदय बोध इसी

कारण िव मान है । यह स ता हर तरह से समाज-पोिषत स ता को

दशाती है । यहाँ पर ताकत के िच नही ं िमलते । यह स ता आपसी समझ

के कारण लंबे समय तक चली। यह आडं बर रिहत है ।

 Sample Question Paper
CLASS: XII
Session: 2021-22
Mathematics (Code-041)
Term - 2
Time Allowed: 2 hours Maximum Marks: 40
General Instructions:
1. This question paper contains three sections – A, B and C. Each part is compulsory.
2. Section - A has 6 short answer type (SA1) questions of 2 marks each.
3. Section – B has 4 short answer type (SA2) questions of 3 marks each.
4. Section - C has 4 long answer type questions (LA) of 4 marks each.
5. There is an internal choice in some of the questions.
6. Q14 is a case-based problem having 2 sub parts of 2 marks each.

SECTION – A
1. 𝑙𝑜𝑔𝑥
Find ∫ (1+𝑙𝑜𝑔𝑥)2 𝑑𝑥 2
OR
𝑠𝑖𝑛2𝑥
Find ∫ √9−𝑐𝑜𝑠4 𝑑𝑥
𝑥
2. Write the sum of the order and the degree of the following differential 2
equation:
𝑑 𝑑𝑦
( )=5
𝑑𝑥 𝑑𝑥

3. If 𝑎̂ and 𝑏̂ are unit vectors, then prove that 2

𝜃
|𝑎̂ + 𝑏̂| = 2𝑐𝑜𝑠 , where 𝜃 is the angle between them.
2

4. Find the direction cosines of the following line: 2

3 − 𝑥 2𝑦 − 1 𝑧
= =
−1 2 4
5. A bag contains 1 red and 3 white balls. Find the probability distribution of 2
the number of red balls if 2 balls are drawn at random from the bag one-by-
one without replacement.
6. Two cards are drawn at random from a pack of 52 cards one-by-one without 2
replacement. What is the probability of getting first card red and second
card Jack?
SECTION – B
7. 𝑥+1
Find: ∫ (𝑥 2+1)𝑥 𝑑𝑥 3
8. Find the general solution of the following differential equation: 3
𝑑𝑦 𝑦
𝑥 = 𝑦 − 𝑥𝑠𝑖𝑛( )
𝑑𝑥 𝑥
OR
Find the particular solution of the following differential equation, given that
𝜋
y = 0 when x = 4 :
𝑑𝑦 2
+ 𝑦𝑐𝑜𝑡𝑥 =
𝑑𝑥 1 + 𝑠𝑖𝑛𝑥
9. ⃗⃗⃗ 𝑎⃗. 𝑏⃗⃗ = 𝑎⃗. 𝑐⃗, 𝑎⃗ × 𝑏⃗⃗ = 𝑎⃗ × 𝑐⃗, then show that 𝑏⃗⃗ = 𝑐⃗.
If 𝑎⃗ ≠ 0, 3
10. Find the shortest distance between the following lines: 3
𝑟⃗ = (𝑖̂ + 𝑗̂ − 𝑘̂) + 𝑠(2𝑖̂ + 𝑗̂ + 𝑘̂ )
𝑟⃗ = (𝑖̂ + 𝑗̂ + 2𝑘̂) + 𝑡(4𝑖̂ + 2𝑗̂ + 2𝑘̂)
OR
Find the vector and the cartesian equations of the plane containing the point
𝑖̂ + 2𝑗̂ − 𝑘̂ and parallel to the lines 𝑟⃗ = (𝑖̂ + 2𝑗̂ + 2𝑘̂) + 𝑠(2𝑖̂ − 3𝑗̂ + 2𝑘̂) and
𝑟⃗ = (3𝑖̂ + 𝑗̂ − 2𝑘̂) + 𝑡(𝑖̂ − 3𝑗̂ + 𝑘̂)
SECTION – C
11. Evaluate:
2
∫−1|𝑥 3 2
− 3𝑥 + 2𝑥|𝑑𝑥 4

12. Using integration, find the area of the region in the first quadrant enclosed 4
by the line x + y = 2, the parabola y 2 = x and the x-axis.
OR
Using integration, find the area of the region
{(𝑥, 𝑦): 0 ≤ 𝑦 ≤ √3𝑥, 𝑥 2 + 𝑦 2 ≤ 4}

13. Find the foot of the perpendicular from the point (1, 2, 0) upon the plane 4
x – 3y + 2z = 9. Hence, find the distance of the point (1, 2, 0) from the given
plane.

14. CASE-BASED/DATA-BASED

Fig 1
An insurance company believes that people can be divided into two classes: those who
are accident prone and those who are not. The company’s statistics show that an
accident-prone person will have an accident at sometime within a fixed one-year period
with probability 0.6, whereas this probability is 0.2 for a person who is not accident
prone. The company knows that 20 percent of the population is accident prone.
Based on the given information, answer the following questions.
(i)what is the probability that a new policyholder will have an accident 2
within a year of purchasing a policy?
(ii) Suppose that a new policyholder has an accident within a year of 2
purchasing a policy. What is the probability that he or she is accident prone?

---------------------------
 Marking Scheme
CLASS: XII
Session: 2021-22
Mathematics (Code-041)
Term - 2

SECTION – A

1. 𝑙𝑜𝑔𝑥
Find: ∫ (1+𝑙𝑜𝑔𝑥)2 𝑑𝑥
𝑙𝑜𝑔𝑥 𝑙𝑜𝑔𝑥+1−1 1 1
Solution:∫ (1+𝑙𝑜𝑔𝑥)2 𝑑𝑥 = ∫ (1+𝑙𝑜𝑔𝑥)2 𝑑𝑥 = ∫ 1+𝑙𝑜𝑔𝑥 𝑑𝑥 − ∫ (1+𝑙𝑜𝑔𝑥)2 𝑑𝑥 1/2
1 −1 1 1 𝑥
= ×𝑥− ∫ (1+𝑙𝑜𝑔𝑥)2 × × 𝑥𝑑𝑥 − ∫ (1+𝑙𝑜𝑔𝑥)2 𝑑𝑥 = +𝑐 1+1/2
1+𝑙𝑜𝑔𝑥 𝑥 1+𝑙𝑜𝑔𝑥
OR
𝑠𝑖𝑛2𝑥
Find: ∫ √9−𝑐𝑜𝑠4 𝑑𝑥
𝑥
Solution: Put 𝑐𝑜𝑠 2 𝑥 = 𝑡 ⇒ −2𝑐𝑜𝑠𝑥𝑠𝑖𝑛𝑥𝑑𝑥 = 𝑑𝑡 ⇒ 𝑠𝑖𝑛2𝑥𝑑𝑥 = −𝑑𝑡 1
𝑑𝑡 𝑡 𝑐𝑜𝑠2 𝑥
The given integral = − ∫ √32 = −sin−1 3 + 𝑐 = −sin−1 +𝑐 1
−𝑡 2 3
2. Write the sum of the order and the degree of the following differential
𝑑 𝑑𝑦
equation: 𝑑𝑥 (𝑑𝑥 ) = 5

Solution: Order = 2
1
Degree = 1
1/2
Sum = 3
½

3. If 𝑎̂ and 𝑏̂ are unit vectors, then prove that

𝜃
|𝑎̂ + 𝑏̂| = 2𝑐𝑜𝑠 , where 𝜃 is the angle between them.
2
2
Solution: (𝑎̂ + 𝑏̂). (𝑎̂ + 𝑏̂) = |𝑎̂|2 + |𝑏̂| + 2(𝑎̂. 𝑏̂ ) 1
2
|𝑎̂ + 𝑏̂| = 1 + 1 + 2𝑐𝑜𝑠𝜃
𝜃
= 2(1 + 𝑐𝑜𝑠𝜃) = 4𝑐𝑜𝑠 2 1/2
2
𝜃
∴ |𝑎̂ + 𝑏̂| = 2𝑐𝑜𝑠 , ½
2

4. Find the direction cosines of the following line:

3 − 𝑥 2𝑦 − 1 𝑧
= =
−1 2 4
Solution: The given line is
1
𝑥−3 𝑦−2 𝑧
= = 1
1 1 4
Its direction ratios are <1, 1, 4> 1/2
Its direction cosines are
1 1 4
〈 , , 〉 ½
3√2 3√2 3√2
5. A bag contains 1 red and 3 white balls. Find the probability distribution of the
number of red balls if 2 balls are drawn at random from the bag one-by-one
without replacement.
Solution: Let X be the random variable defined as the number of red balls.
Then X = 0, 1 1/2
3 2 6 1 1/2
P(X=0) = 4 × 3 = 12 = 2
1 3 3 1 6 1
P(X=1) =4 × 3 + 4 × 3 = 12 = 2 1/2
Probability Distribution Table:
X 0 1
P(X) 1 1 ½
2 2

6. Two cards are drawn at random from a pack of 52 cards one-by-one without
replacement. What is the probability of getting first card red and second card
Jack?
Solution: The required probability = P((The first is a red jack card and The
second is a jack card) or (The first is a red non-jack card and The second is 1
a jack card))
2 3 24 4 1 1
=52 × 51 + 52 × 51 = 26
SECTION – B
𝑥+1
7. Find: ∫ (𝑥 2 +1)𝑥 𝑑𝑥
𝑥+1 𝐴𝑥+𝐵 𝐶 (𝐴𝑥+𝐵)𝑥+𝐶(𝑥 2 +1)
Solution: Let (𝑥 2 +1)𝑥 = +𝑥 = 1/2
𝑥 2 +1 (𝑥 2 +1)𝑥
2
⇒ 𝑥 + 1 = (𝐴𝑥 + 𝐵)𝑥 + 𝐶(𝑥 + 1) (An identity)
Equating the coefficients, we get
B = 1, C = 1, A + C = 0
Hence, A = -1, B = 1, C = 1 ½
−𝑥+1 1
The given integral = ∫ 𝑥 2 +1 𝑑𝑥 + ∫ 𝑥 𝑑𝑥
−1 2𝑥 − 2 1 1/2
= ∫ 2 𝑑𝑥 + ∫ 𝑑𝑥
2 𝑥 +1 𝑥
−1 2𝑥 1 1
= ∫ 2 𝑑𝑥 + ∫ 2 𝑑𝑥 + ∫ 𝑑𝑥
2 𝑥 +1 𝑥 +1 𝑥
−1 1+1/2
= log(𝑥 2 + 1) + tan−1 𝑥 + 𝑙𝑜𝑔|𝑥| + 𝑐
2

8. Find the general solution of the following differential equation:

𝑑𝑦 𝑦
𝑥 = 𝑦 − 𝑥𝑠𝑖𝑛( )
𝑑𝑥 𝑥
Solution: We have the differential equation:
𝑑𝑦 𝑦 𝑦
= − 𝑠𝑖𝑛( )
𝑑𝑥 𝑥 𝑥
The equation is a homogeneous differential equation.
𝑑𝑦 𝑑𝑣 1
Putting 𝑦 = 𝑣𝑥 ⇒ 𝑑𝑥 = 𝑣 + 𝑥 𝑑𝑥
The differential equation becomes
𝑑𝑣
𝑣+𝑥 = 𝑣 − 𝑠𝑖𝑛𝑣
𝑑𝑥
𝑑𝑣 𝑑𝑥 𝑑𝑥
⇒ =− ⇒ 𝑐𝑜𝑠𝑒𝑐𝑣𝑑𝑣 = − ½
𝑠𝑖𝑛𝑣 𝑥 𝑥
Integrating both sides, we get
 𝑙𝑜𝑔|𝑐𝑜𝑠𝑒𝑐𝑣 − 𝑐𝑜𝑡𝑣| = −𝑙𝑜𝑔|𝑥| + 𝑙𝑜𝑔𝐾, 𝐾 > 0 (Here, 𝑙𝑜𝑔𝐾 is an arbitrary
constant.) 1
⇒ 𝑙𝑜𝑔|(𝑐𝑜𝑠𝑒𝑐𝑣 − 𝑐𝑜𝑡𝑣)𝑥| = 𝑙𝑜𝑔𝐾
⇒ |(𝑐𝑜𝑠𝑒𝑐𝑣 − 𝑐𝑜𝑡𝑣)𝑥| = 𝐾
⇒ (𝑐𝑜𝑠𝑒𝑐𝑣 − 𝑐𝑜𝑡𝑣)𝑥 = ±𝐾
𝑦 𝑦 ½
⇒ (𝑐𝑜𝑠𝑒𝑐 𝑥 − 𝑐𝑜𝑡 𝑥 ) 𝑥 = 𝐶, which is the required general solution.

OR
Find the particular solution of the following differential equation, given that y
𝜋
= 0 when x = 4 :
𝑑𝑦 2
+ 𝑦𝑐𝑜𝑡𝑥 =
𝑑𝑥 1 + 𝑠𝑖𝑛𝑥
Solution:
The differential equation is a linear differential equation
I F = 𝑒 ∫ 𝑐𝑜𝑡𝑥𝑑𝑥 = 𝑒 𝑙𝑜𝑔𝑠𝑖𝑛𝑥 = 𝑠𝑖𝑛𝑥 1
The general solution is given by
𝑠𝑖𝑛𝑥
𝑦𝑠𝑖𝑛𝑥 = ∫ 2 𝑑𝑥 ½
1 + 𝑠𝑖𝑛𝑥
𝑠𝑖𝑛𝑥 + 1 − 1 1
⇒ 𝑦𝑠𝑖𝑛𝑥 = 2 ∫ 𝑑𝑥 = 2 ∫[1 − ]𝑑𝑥
1 + 𝑠𝑖𝑛𝑥 1 + 𝑠𝑖𝑛𝑥
1
⇒ 𝑦𝑠𝑖𝑛𝑥 = 2 ∫[1 − 𝜋 ]𝑑𝑥
1 + cos (2 − 𝑥)
1
⇒ 𝑦𝑠𝑖𝑛𝑥 = 2 ∫[1 − 𝜋 𝑥 ]𝑑𝑥
2𝑐𝑜𝑠 2 ( 4 − 2)
1 𝜋 𝑥
⇒ 𝑦𝑠𝑖𝑛𝑥 = 2 ∫[1 − 𝑠𝑒𝑐 2 ( − )]𝑑𝑥
2 4 2
𝜋 𝑥
⇒ 𝑦𝑠𝑖𝑛𝑥 = 2[𝑥 + tan ( − )] + 𝑐
4 2𝜋 1
Given that y = 0, when x = 4 ,
𝜋 𝜋
Hence, 0 = 2[ 4 + 𝑡𝑎𝑛 8 ] + 𝑐
𝜋 𝜋
⇒ 𝑐 = − − 2𝑡𝑎𝑛
2 8
Hence, the particular solution is
𝜋 𝑥 𝜋 𝜋
𝑦 = 𝑐𝑜𝑠𝑒𝑐𝑥[2 {𝑥 + tan ( − )} − ( + 2𝑡𝑎𝑛 )] ½
4 2 2 8

9. 0, 𝑎⃗. 𝑏⃗⃗ = 𝑎⃗. 𝑐⃗, 𝑎⃗ × 𝑏⃗⃗ = 𝑎⃗ × 𝑐⃗, then show that 𝑏⃗⃗ = 𝑐⃗.
If 𝑎⃗ ≠ ⃗⃗⃗
Solution: We have 𝑎⃗. (𝑏⃗⃗ − 𝑐⃗) = 0
⇒ (𝑏⃗⃗ − 𝑐⃗) = ⃗0⃗ or 𝑎⃗ ⊥ (𝑏⃗⃗ − 𝑐⃗)
⇒ 𝑏⃗⃗ = 𝑐⃗ or 𝑎⃗ ⊥ (𝑏⃗⃗ − 𝑐⃗) 1
Also, 𝑎⃗ × (𝑏⃗⃗ − 𝑐⃗) = ⃗0⃗
⇒ (𝑏⃗⃗ − 𝑐⃗) = ⃗0⃗ or 𝑎⃗ ∥ (𝑏⃗⃗ − 𝑐⃗)
⇒ 𝑏⃗⃗ = 𝑐⃗ or 𝑎⃗ ∥ (𝑏⃗⃗ − 𝑐⃗) 1
𝑎⃗ 𝑐𝑎𝑛 𝑛𝑜𝑡 𝑏𝑒 𝑏𝑜𝑡ℎ 𝑝𝑒𝑟𝑝𝑒𝑛𝑑𝑖𝑐𝑢𝑙𝑎𝑟 𝑡𝑜 (𝑏⃗⃗ − 𝑐⃗) 𝑎𝑛𝑑 𝑝𝑎𝑟𝑎𝑙𝑙𝑒𝑙 𝑡𝑜 (𝑏⃗⃗ − 𝑐⃗)
Hence, 𝑏⃗⃗ = 𝑐⃗. 1
10. Find the shortest distance between the following lines:
𝑟⃗ = (𝑖̂ + 𝑗̂ − 𝑘̂) + 𝑠(2𝑖̂ + 𝑗̂ + 𝑘̂ )
𝑟⃗ = (𝑖̂ + 𝑗̂ + 2𝑘̂) + 𝑡(4𝑖̂ + 2𝑗̂ + 2𝑘̂)
 |(𝑎
⃗⃗⃗⃗⃗⃗−𝑎 ⃗⃗|
2 ⃗⃗⃗⃗⃗⃗)×𝑏
1
Solution: Here, the lines are parallel. The shortest distance = ⃗⃗|
|𝑏
|(3𝑘̂) × (2𝑖̂ + 𝑗̂ + 𝑘̂)| 1+1/2
=
√4 + 1 + 1
𝑖̂ 𝑗̂ 𝑘̂
̂ ̂
(3𝑘) × (2𝑖̂ + 𝑗̂ + 𝑘 ) = |0 0 3| = −3𝑖̂ + 6𝑗̂ 1
2 1 1
3√5 ½
Hence, the required shortest distance = units
√6
OR

Find the vector and the cartesian equations of the plane containing the point
𝑖̂ + 2𝑗̂ − 𝑘̂ and parallel to the lines 𝑟⃗ = (𝑖̂ + 2𝑗̂ + 2𝑘̂) + 𝑠(2𝑖̂ − 3𝑗̂ + 2𝑘̂) and
𝑟⃗ = (3𝑖̂ + 𝑗̂ − 2𝑘̂) + 𝑡(𝑖̂ − 3𝑗̂ + 𝑘̂)
Solution: Since, the plane is parallel to the given lines, the cross product of
the vectors 2𝑖̂ − 3𝑗̂ + 2𝑘̂ and 𝑖̂ − 3𝑗̂ + 𝑘̂ will be a normal to the plane
𝑖̂ 𝑗̂ 𝑘̂
(2𝑖̂ − 3𝑗̂ + 2𝑘̂ ) × (𝑖̂ − 3𝑗̂ + 𝑘̂) = |2 −3 2| = 3𝑖̂ − 3𝑘̂ 1
1 −3 1
The vector equation of the plane is 𝑟⃗. (3𝑖̂ − 3𝑘̂) =(𝑖̂ + 2𝑗̂ − 𝑘̂). (3𝑖̂ − 3𝑘) ̂
1
or, 𝑟⃗. (𝑖̂ − 𝑘̂) = 2
and the cartesian equation of the plane is x – z – 2 = 0 1

SECTION – C

11. 2
Evaluate: ∫−1|𝑥 3 − 3𝑥 2 + 2𝑥|𝑑𝑥
2
Solution: The given definite integral = ∫−1|𝑥(𝑥 − 1)(𝑥 − 2)|𝑑𝑥
0 1 2
= ∫ |𝑥(𝑥 − 1)(𝑥 − 2)|𝑑𝑥 + ∫ |𝑥(𝑥 − 1)(𝑥 − 2)|𝑑𝑥 + ∫ |𝑥(𝑥 − 1)(𝑥 − 2)|𝑑𝑥 1+1/2
−1 0 1
0 1 2
= − ∫ (𝑥 3 − 3𝑥 2 + 2𝑥)𝑑𝑥 + ∫ (𝑥 3 − 3𝑥 2 + 2𝑥)𝑑𝑥 − ∫ (𝑥 3 − 3𝑥 2 + 2𝑥)𝑑𝑥 1/2
−1 0 1
4
𝑥 2 0
𝑥4 𝑥4
= −[ − 𝑥 + 𝑥 ]−1 + [ − 𝑥 + 𝑥 ]0 − [ − 𝑥 3 + 𝑥 2 ]12
3 3 2 1
4 4 4
9 1 1 11 2
= + + =
4 4 4 4
12. Using integration, find the area of the region in the first quadrant enclosed by
the line x + y = 2, the parabola y 2 = x and the x-axis.
Solution: Solving x + y = 2 and y 2 = x simultaneously, we get the points of
intersection as (1, 1) and (4, -2). 1

1
Fig 1

1 2
The required area = the shaded area = ∫0 √𝑥 𝑑𝑥 + ∫1 (2 − 𝑥)𝑑𝑥 1
3
2 𝑥2 2
= 3 [𝑥 ]10 + [2𝑥 −
2 ]
2 1
2 1 7
= 3 + 2 = 6 square units 1

OR
Using integration, find the area of the region: {(𝑥, 𝑦): 0 ≤ 𝑦 ≤ √3𝑥, 𝑥 2 + 𝑦 2 ≤
4}
Solution: Solving 𝑦 = √3𝑥 𝑎𝑛𝑑 𝑥 2 + 𝑦 2 = 4 , we get the points of intersection
as (1, √3) and (-1, −√3)
1

Fig 2
1
 1 2
The required area = the shaded area = ∫0 √3𝑥 𝑑𝑥 + ∫1 √4 − 𝑥 2 𝑑𝑥
1
√3 2 1 1 𝑥2
= [𝑥 ]0 + [𝑥 √4 − 𝑥 2 + 4 sin−1 ]
2 2 21
√3 1 𝜋
= + [2𝜋 − √3 − 2 ]
2 2 3
2𝜋
= 3 square units 1

13. Find the foot of the perpendicular from the point (1, 2, 0) upon the plane
x – 3y + 2z = 9. Hence, find the distance of the point (1, 2, 0) from the given
plane.
Solution: The equation of the line perpendicular to the plane and passing
through the point (1, 2, 0) is
𝑥−1 𝑦−2 𝑧 1
= =
1 −3 2
The coordinates of the foot of the perpendicular are (𝜇 + 1, −3𝜇 + 2,2𝜇) for ½
some 𝜇
These coordinates will satisfy the equation of the plane. Hence, we have
𝜇 + 1 − 3(−3𝜇 + 2) + 2(2𝜇) = 9
⇒𝜇=1 1
The foot of the perpendicular is (2, -1, 2). ½
Hence, the required distance = √(1 − 2)2 + (2 + 1)2 + (0 − 2)2 = √14 𝑢𝑛𝑖𝑡𝑠 1
14. CASE-BASED/DATA-BASED

Fig 3
An insurance company believes that people can be divided into two classes: those who are
accident prone and those who are not. The company’s statistics show that an accident-prone
person will have an accident at sometime within a fixed one-year period with probability 0.6,
whereas this probability is 0.2 for a person who is not accident prone. The company knows that
20 percent of the population is accident prone.
Based on the given information, answer the following questions.
(i)what is the probability that a new policyholder will have an accident within a
year of purchasing a policy?
(ii) Suppose that a new policyholder has an accident within a year of purchasing a
policy. What is the probability that he or she is accident prone?
Solution: Let E1 = The policy holder is accident prone.
E2 = The policy holder is not accident prone.
E = The new policy holder has an accident within a year of purchasing a
policy.
(i) P(E)= P(E1)× P(E∕E1) + P(E2)× P(E∕E2) 1
20 6 80 2 7 1
=100 × 10 + 100 × 10 = 25

𝑃(𝐸1 )×𝑃(𝐸/𝐸1 )
(ii) By Bayes’ Theorem, 𝑃(𝐸1⁄𝐸) = 1
𝑃(𝐸)
20 6
× 3
100 10
= 280 =7 1
1000

---------------------------
 SAMPLE QUESTION PAPER
CLASS XII
PHYSICS THEORY
TERM II
SESSION 2021 - 22
MM : 35 TIME : 2 Hours
General Instructions:

(i) There are 12 questions in all. All questions are compulsory.

(ii) This question paper has three sections: Section A, Section B and Section C.
(iii) Section A contains three questions of two marks each, Section B contains eight questions
of three marks each, Section C contains one case study-based question of five marks.
(iv) There is no overall choice. However, an internal choice has been provided in one question
of two marks and two questions of three marks. You have to attempt only one of the
choices in such questions.
(v) You may use log tables if necessary but use of calculator is not allowed.

SECTION A

Q1. In a pure semiconductor crystal of Si, if antimony is added then what type of extrinsic semiconductor
is obtained. Draw the energy band diagram of this extrinsic semiconductor so formed.
Q2. Consider two different hydrogen atoms. The electron in each atom is in an excited state. Is it
possible for the electrons to have different energies but same orbital angular momentum according
to the Bohr model? Justify your answer.
OR
Explain how does (i) photoelectric current and (ii) kinetic energy of the photoelectrons emitted in a
photocell vary if the frequency of incident radiation is doubled, but keeping the intensity same?
Show the graphical variation in the above two cases.
Q3. Name the device which converts the change in intensity of illumination to change in electric current
flowing through it. Plot I-V characteristics of this device for different intensities. State any two
applications of this device.
SECTION B
Q4. Derive an expression for the frequency of radiation emitted when a hydrogen atom de-excites
from level n to level (n – 1). Also show that for large values of n, this frequency equals to classical
frequency of revolution of an electron.
Q5. Explain with a proper diagram how an ac signal can be converted into dc ( pulsating)signal with
output frequency as double than the input frequency using pn junction diode. Give its input and
output waveforms.
Q6. How long can an electric lamp of 100 W be kept glowing by fusion of 2 kg of deuterium?
Take the fusion reaction as

H + H → He + n + 3.27 MeV
Q7. Define wavefront. Draw the shape of refracted wavefront when the plane incident wave undergoes
refraction from optically denser medium to rarer medium. Hence prove Snell’s law of refraction.
Q8. (a) Draw a ray diagram of compound microscope for the final image formed at least distance of
distinct vision?
(b) An angular magnification of 30X is desired using an objective of focal length 1.25 cm and an
eye piece of focal length 5 cm. How will you set up the compound microscope for the final
image formed at least distance of distinct vision?
OR
(a) Draw a ray diagram of Astronomical Telescope for the final image formed at infinity.
(b) A small telescope has an objective lens of focal length 140 cm and an eyepiece of focal
length 5.0 cm. Find the magnifying power of the telescope for viewing distant objects when
(i) the telescope is in normal adjustment,
(ii) the final image is formed at the least distance of distinct vision.
Q9. Light of wavelength 2000 Å falls on a metal surface of work function 4.2 eV.
(a) What is the kinetic energy (in eV) of the fastest electrons emitted from the surface?
(b) What will be the change in the energy of the emitted electrons if the intensity of light with
same wavelength is doubled?
(c) If the same light falls on another surface of work function 6.5 eV, what will be the energy of
emitted electrons?
Q10. The focal length of a convex lens made of glass of refractive index (1.5) is 20 cm.
What will be its new focal length when placed in a medium of refractive index 1.25 ?
Is focal length positive or negative? What does it signify?
Q11. (a) Name the e.m. waves which are suitable for radar systems used in aircraft navigation. Write
the range of frequency of these waves.
(b) If the Earth did not have atmosphere, would its average surface temperature be higher or
lower than what it is now? Explain.
(c) An e.m. wave exerts pressure on the surface on which it is incident. Justify.
OR

(a) "If the slits in Young's double slit experiment are identical, then intensity at any point on the
screen may vary between zero and four times to the intensity due to single slit".
Justify the above statement through a relevant mathematical expression.
(b) Draw the intensity distribution as function of phase angle when diffraction of light takes
place through coherently illuminated single slit.

Q12. CASE STUDY: MIRAGE IN DESERTS

To a distant observer, the light appears to be coming from somewhere below the ground. The observer
naturally assumes that light is being reflected from the ground, say, by a pool of water near the tall
object.
Such inverted images of distant tall objects cause an optical illusion to the observer. This phenomenon
is called mirage. This type of mirage is especially common in hot deserts.
Based on the above facts, answer the following questions:

(a) Which of the following phenomena is prominently involved in the formation of mirage in 1
deserts?
(i) Refraction, Total internal Reflection (ii) Dispersion and Refraction
(iii) Dispersion and scattering of light (iv) Total internal Reflection and diffraction.
(b) A diver at a depth 12 m inside water aμω = sees the sky in a cone of semi- vertical angle 1

(i) sin (ii) tan

(iii) sin (iv) 90°
(c) In an optical fibre, if n1 and n2 are the refractive indices of the core and cladding, then which 1
among the following, would be a correct equation?
(i) n1 < n2 (ii) n1 = n2
(iii) n1 << n2 (iv) n1 > n2

(d) A diamond is immersed in such a liquid which has its refractive index with respect to air as 1
greater than the refractive index of water with respect to air. Then the critical angle of
diamond-liquid interface as compared to critical angle of diamond -water interface will
(i) depend on the nature of the liquid only (ii) decrease
(iii) remain the same (iv) increase.

(e) The following figure shows a cross-section of a ‘light pipe’ made of a glass fiber of refractive 1
index 1.68. The outer covering of the pipe is made of a material of refractive index 1.44. What
is the range of the angles of the incident rays with the axis of the pipe for the following
phenomena to occur.
(i) 0 < 𝑖 < 90° (ii) 0 < 𝑖 < 60°
(iii) 0 < 𝑖 < 45° (iv) 0 < 𝑖 < 30°
 MARKING SCHEME
CLASS XII
PHYSICS THEORY
TERM II
SESSION 2021 - 22
MM:35 TIME: 2 Hours

ANS 1
As given in the statement antimony is added to pure Si crystal,
then a n -type extrinsic semiconductor would be so obtained, 1
Since antimony(Sb) is a pentavalent impurity. Mark

Energy level diagram of n-type semiconductor

Donar Energy level

1
Mark

ANS 2 No 1/2
mark
Because according to Bohr's model,
. 1/2
En = − and electrons having different energies belong to
mark
different levels having different values of n.

So, their angular momenta will be different, as 1

mark
L = mvr =
OR
(i) The increase in the frequency of incident radiation has no effect on
photoelectric current. This is because of incident photon of 1/2
 increased energy cannot eject more than one electron from the mark
metal surface.

1/2
mark

(ii) The kinetic energy of the photoelectron becomes more than the
double of its original energy. As the work function of the metal is 1/2
fixed, so incident photon of higher frequency and hence higher mark
energy will impart more energy to the photoelectrons.

1/2
mark

ANS 3 Photodiodes are used to detect optical signals of different 1/2 mark
intensities by changing current flowing through them.

1/2 mark

I-V Characteristics of a photodiode

 Applications of photodiodes:
1. In detection of optical signals.
2. In demodulation of optical signals.
3. In light operated switches.
4. In speed reading of computer punched cards. (1/2) X 2= 1
5. In electronic counters mark

(any two out of these or any other relevant application)

SECTION B
ANS 4 From Bohr’s theory, the frequency f of the radiation emitted when
an electron de – excites from level n to level n is given as
2π mk z e 1 1
f= −
h n n
2 marks
Given n = n − 1 , n = n , derivation of it
2π mk z e (2n − 1)
f=
h (n − 1) n
For large n, 2n − 1 = 2n , n − 1 = n and z = 1
1 mark
Thus, f =
which is same as orbital frequency of electron in n orbit.
v 4π mk e
f= =
2πr n h
ANS 5
A junction diode allows current to pass only when it is forward
biased. So, if an alternating voltage is applied across a diode the 1 mark
current flows only in that part of the cycle when the diode is
forward biased. This property is used to rectify alternating voltages
and the circuit used for this purpose is called a rectifier.

1 mark

Circuit Diagram
 1 mark

Working with input and output waveforms

ANS 6 Number of atoms present in 2 g of deuterium = 6 × 10
Number of atoms present in 2.0 Kg of deuterium = 6 × 10 1 mark
Energy released in fusion of 2 deuterium atoms
= 3.27 MeV
Energy released in fusion of 2.0 Kg of deuterium atoms
.
= × 6 × 10 MeV
= 9.81 × 10 MeV 1 mark
= 15.696 × 10 J
Energy consumed by bulb per sec = 100 J
. ×
Time for which bulb will glow = s = 4.97 × 10 𝑦𝑒𝑎𝑟
1 mark
ANS 7 A locus of points, which oscillate in phase is called a wavefront.
OR
A wavefront is defined as a surface of constant phase. 1 mark

1 mark
 Diagram
Proof n sin i = n sin r (Derivation) 1 mark
This is the Snell’s law of refraction.
ANS 8 Diagram of Compound Microscope for the final image formed at D:
(a)

𝟏
𝟏
𝟐
marks

(b) m = 30, f = 1.25 cm, f = 5 cm

when image is formed at least distance of distinct vision,
D = 25cm
Angular magnification of eyepiece
D 25 1/2 mark
m = 1+ = 1+ =6
f 5
Total Angular magnification, m = m m ⇒ m = = =5
As the objective lens forms the real image,
m = = −5 ⇒ v = −5u
1/2 mark
using lens equation, u = −1.5 cm, v = −5 × (−1.5)cm = +7.5 cm
Given v = −D = −25 cm, f = +5 cm, u = ?
using again lens equation u =
Thus, object is to be placed at 1.5 cm from the objective and
separation between the two lenses should be 1/2 mark
L = v + Iu l = 11.67 cm

OR
ANS 8
(a) Ray diagram of astronomical telescope when image is formed at 𝟏
𝟏 marks
𝟐
infinity.
 (b) (i) In normal adjustment :
Magnifying power. ½ mark
m = f /f = (140/5) = 28

(ii) When the final image is formed at the least distance of 1 mark
distinct vision (25 cm) :

m= 1+ = (28 x 1.2) = 33.6

ANS 9
λ = 2000 Å = (2000 × 10 )m
W = 4.2eV
h = 6.63 × 10 JS
(a) Using Einstein's photoelectric equation 1 mark
K. E. = (6.2 – 4.2) eV = 2.0 eV

The energy of the emitted electrons does not depend upon 1 mark
(b)
intensity of incident light; hence the energy remains unchanged.

(c) For this surface, electrons will not be emitted as the energy of 1 mark
incident light (6.2 eV) is less than the work function (6.5 eV) of the
surface.

ANS 10 Given a = 1.5

Focal length of the given convex lens when it is placed in air is
f = + 20 cm
Refractive index of the given medium with respect to air is
a = 1.25
New focal length of the given convex lens when placed in a
medium is f
= a −1 + ------(A) 1/2 mark
1/2 mark
= m −1 + ------(B)
Dividing (A) by (B), we get
f a −1 (1.5 − 1) 0.5 5
= = = = = 2.5
f m −1 (1.2 − 1) 0.2 2
. 1 mark
f = 2.5f = (2.5 × 20)cm = +50cm as m = = = 1.2
.
New focal length is positive.
The significance of the positive sign of the focal length is that given 1/2 mark
convex lens is still converging in the given medium.
1/2 mark
ANS 11.
(a) Microwaves are suitable for the radar system used in aircraft
 navigation. 1 mark
Range of frequency of microwaves is 108 Hz to 1011 Hz.
(b)
If the Earth did not have atmosphere, then there would be absence
of greenhouse effect of the atmosphere. Due to this reason, the 1 mark
temperature of the earth would be lower than what it is now.
(c)
An e.m. wave carries momentum with itself and given by
P = Energy of wave(U)/ Speed of the wave(c) 1 mark
= U/c
when it is incident upon a surface it exerts pressure on it.
OR
ANS. 11 The total intensity at a point where the phase difference is ∅, is
(a)
given by 𝐼 = 𝐼 + 𝐼 + 2 𝐼 𝐼 𝐶𝑂𝑆 ∅. Here 𝐼 and 𝐼 are the
intensities of two individual sources which are equal. 2 marks
When ∅ is 0, I = 4𝐼 .
When ∅ is 90o, I = 0
Thus intensity on the screen varies between 4𝐼 and 0.

Intensity distribution as function of phase angle, when diffraction of

ANS. 11
(b)
light takes place through coherently illuminated single slit

1 mark

ANS 12.
(a) Ans (i) Refraction, Total internal reflection 1 mark

(b) Ans iii) sin-1( )

1 mark
a =
⇒ sin C = ⇒ C = sin
(c) Ans (iv) n1 > n2 1 mark

The refractive index of the core should be greater than the

refractive index of the cladding.

(d)
1 mark
Ans (iv) increases
l = = ,ω = =

μ >μ
(e) Thus C > C
1 mark

Ans (ii) 0 < i < 60° , 1 =

.
Sin C = = 0.8571
.
⇒ C = 59°
Total internal reflection will occur if the angle 𝑖 > 𝑖 ,
i.e., if 𝑖 > 59o or when r < rmax’ where rmax = 90o – 59o = 31o.
Using Snell’s law,
= 1.68
or 𝑆𝑖𝑛 𝑖 = 1.68 × 𝑆𝑖𝑛 𝑟
= 1.68 x sin 31o = 1.68 x 0.5150 = 0.8662

∴ 𝑖 = 60o
Thus all incident rays which make angles in the range 0 < 𝑖 <
60 with the axis of the pipe will suffer total internal
reflections in the pipe.
 SAMPLE PAPER QUESTION (2021-22)
TERM – II
CHEMISTRY THEORY (043)

MM:35 Time: 2 Hours

GENERAL INSTRUCTIONS:
Read the following instructions carefully.
1. There are 12 questions in this question paper with internal choice.
2. SECTION A - Q. No. 1 to 3 are very short answer questions carrying 2 marks each.
3. SECTION B - Q. No. 4 to 11 are short answer questions carrying 3 marks each.
4. SECTION C- Q. No. 12 is case based question carrying 5 marks.
5. All questions are compulsory.
6. Use of log tables and calculators is not allowed

SECTION A
1. Arrange the following in the increasing order of their property indicated (any 2):
a. Benzoic acid, Phenol, Picric acid, Salicylic acid (pka values).
b. Acetaldehyde, Acetone, Methyl tert butyl ketone (reactivity towards NH 2OH).
c. ethanol, ethanoic acid, benzoic acid (boiling point) (1x2=2)

2. Solutions of two electrolytes ‘A’ and ‘B’ are diluted. The Λm of ‘B’ increases 1.5 times
while that of A increases 25 times. Which of the two is a strong electrolyte? Justify your
answer. Graphically show the behavior of ‘A’ and ‘B’. (2)

3. Give reasons to support the answer:

a. Presence of Alpha hydrogen in aldehydes and ketones is essential for aldol condensation.
b. 3 –Hydroxy pentan-2-one shows positive Tollen’s test. (1x2=2)

SECTION B
4. Account for the following:
a. Aniline cannot be prepared by the ammonolysis of chlorobenzene under normal
conditions.
b. N-ethylethanamine boils at 329.3K and butanamine boils at 350.8K, although both are
isomeric in nature.
c. Acylation of aniline is carried out in the presence of pyridine. (1x3=3)

OR
4. Convert the following:
a. Phenol to N-phenylethanamide.
b. Chloroethane to methanamine.
c. Propanenitrile to ethanol. (1x3=3)
5. Answer the following questions:
a. [Ni(H2O)6 ] 2+ (aq) is green in colour whereas [Ni(H2O)4 (en)]2+(aq)is blue in colour , give
reason in support of your answer .
b. Write the formula and hybridization of the following compound:
tris(ethane-1,2–diamine) cobalt(III) sulphate (1+2)

OR

5. In a coordination entity, the electronic configuration of the central metal ion is t 2g3 eg1
a. Is the coordination compound a high spin or low spin complex?
b. Draw the crystal field splitting diagram for the above complex. (1+2)

6. Account for the following:

a. Ti(IV) is more stable than the Ti (II) or Ti(III).
b. In case of transition elements, ions of the same charge in a given series show progressive
decrease in radius with increasing atomic number.
c. Zinc is a comparatively a soft metal, iron and chromium are typically hard. (1x3=3)

7. An alkene ‘A’ (Mol. formula C5H10) on ozonolysis gives a mixture of two compounds ‘B’
and ‘C’. Compound ‘B’ gives positive Fehling’s test and also forms iodoform on treatment
with I2 and NaOH. Compound ‘C’ does not give Fehling’s test but forms iodoform. Identify
the compounds A, B and C. Write the reaction for ozonolysis and formation of iodoform
from B and C. (3)

8. Observe the figure given below and answer the questions that follow:

a. Which process is represented in the figure?

 b. What is the application of this process?
c. Can the same process occur without applying electric field? Why is the electric field
applied?

9. What happens when reactions:

a. N-ethylethanamine reacts with benzenesulphonyl chloride.
b. Benzylchloride is treated with ammonia followed by the reaction with Chloromethane.
c. Aniline reacts with chloroform in the presence of alcoholic potassium hydroxide. (1x3=3)
OR

9. a. Write the IUPAC name for the following organic compound:

CH3 – N—CH2CH3

b.Complete the following:

Sn/HCl Br2/H2O NaNO2/HCl HBF4

C6H5NO2 A B C D
273-278K
(1x3=3)
10. Represent the cell in which the following reaction takes place.The value of E˚ for the cell is
1.260 V. What is the value of Ecell ?

2Al(s) + 3Cd2+ (0.1M)  3Cd (s) + 2Al3+ (0.01M) (3)

11. a. Why are fluorides of transition metals more stable in their higher oxidation state as
compared to the lower oxidation state?
b. Which one of the following would feel attraction when placed in magnetic field: Co 2+ ,
Ag+ ,Ti4+ , Zn2+
c. It has been observed that first ionization energy of 5 d series of transition elements are
higher than that of 3d and 4d series, explain why? (1x3=3)

OR

11. On the basis of the figure given below, answer the following questions:
 (source: NCERT)

a. Why Manganese has lower melting point

than Chromium?
b. Why do transition metals of 3d series have lower melting points as compared to 4d
series?
c. In the third transition series, identify and name the metal with the highest melting point.
(1x3=3)
SECTION C

12. Read the passage given below and answer the questions that follow.
Are there nuclear reactions going on in our bodies?

There are nuclear reactions constantly occurring in our bodies, but there are very few of them
compared to the chemical reactions, and they do not affect our bodies much. All of the physical
processes that take place to keep a human body running are chemical processes. Nuclear
reactions can lead to chemical damage, which the body may notice and try to fix.
The nuclear reaction occurring in our bodies is radioactive decay. This is the change of a less
stable nucleus to a more stable nucleus. Every atom has either a stable nucleus or an unstable
nucleus, depending on how big it is and on the ratio of protons to neutrons. The ratio of neutrons
to protons in a stable nucleus is thus around 1:1 for small nuclei (Z < 20). Nuclei with too many
neutrons, too few neutrons, or that are simply too big are unstable. They eventually transform to
a stable form through radioactive decay. Wherever there are atoms with unstable nuclei
(radioactive atoms), there are nuclear reactions occurring naturally. The interesting thing is that
there are small amounts of radioactive atoms everywhere: in your chair, in the ground, in the
food you eat, and yes, in your body.

The most common natural radioactive isotopes in humans are carbon-14 and potassium-40.
Chemically, these isotopes behave exactly like stable carbon and potassium. For this reason, the
body uses carbon-14 and potassium-40 just like it does normal carbon and potassium; building
them into the different parts of the cells, without knowing that they are radioactive. In time,
carbon-14 atoms decay to stable nitrogen atoms and potassium-40 atoms decay to stable calcium
atoms. Chemicals in the body that relied on having a carbon-14 atom or potassium-40 atom in a
certain spot will suddenly have a nitrogen or calcium atom. Such a change damages the
chemical. Normally, such changes are so rare, that the body can repair the damage or filter away
the damaged chemicals.

The natural occurrence of carbon-14 decay in the body is the core principle behind carbon
dating. As long as a person is alive and still eating, every carbon-14 atom that decays into a
nitrogen atom is replaced on average with a new carbon-14 atom. But once a person dies, he
stops replacing the decaying carbon-14 atoms. Slowly the carbon-14 atoms decay to nitrogen
without being replaced, so that there is less and less carbon-14 in a dead body. The rate at which
carbon-14 decays is constant and follows first order kinetics. It has a half - life of nearly 6000
years, so by measuring the relative amount of carbon-14 in a bone, archeologists can calculate
when the person died. All living organisms consume carbon, so carbon dating can be used to date
any living organism, and any object made from a living organism. Bones, wood, leather, and
even paper can be accurately dated, as long as they first existed within the last 60,000 years. This
is all because of the fact that nuclear reactions naturally occur in living organisms.

(source: The textbook Chemistry: The Practical Science by Paul B. Kelter, Michael D. Mosher
and Andrew Scott states)

a. Why is Carbon -14 radioactive while Carbon -12 not? (Atomic number of Carbon: 6)
b. Researchers have uncovered the youngest known dinosaur bone, dating around 65 million
years ago. How was the age of this fossil estimated?
c. Which are the two most common radioactive decays happening in human body?
d. Suppose an organism has 20 g of Carbon -14 at its time of death. Approximately how much
Carbon -14 remains after 10,320 years? (Given antilog 0.517 = 3.289)
OR
d. Approximately how old is a fossil with 12 g of Carbon -14 if it initially possessed 32 g of
Carbon -14? (Given log 2.667 = 0.4260)
(1+1+1+2)
 MARKING SCHEME (2021-22)
TERM – II
CHEMISTRY THEORY (043)
MM:35 Time: 2 Hours

1. (a)Picric acid < salicylic acid < benzoic acid <phenol 1

(b)Methyl tert – butyl ketone < acetone< Acetaldehyde 1

(c)ethanol <ethanoic acid < benzoic acid (boiling point of carboxylic acids is higher 1
than alcohols due to extensive hydrogen bonding , boiling point increases with
increase in molar mass)

2. B is a strong electrolyte. The molar conductivity increases slowly with dilution as ½+½
there is no increase in number of ions on dilution as strong electrolytes are
completely dissociated.

3. (a) The alpha hydrogen atoms are acidic in nature due to presence of electron 1
withdrawing carbonyl group. These can be easily removed by a base and the
carbanion formed is resonance stabilized.
(b) Tollen’s reagent is a weak oxidizing agent not capable of breaking the C-C bond 1
in ketones . Thus ketones cannot be oxidized using Tollen’s reagent itself gets
reduced to Ag.

4 a) In case of chlorobenzene, the C—Cl bond is quite difficult to break as it acquires 1

a partial double bond character due to conjugation.
So Under the normal conditions, ammonolysis of chlorobenzene does not yield
aniline.
b) Primary and secondary amines are engaged in intermolecular association due to
hydrogen bonding between nitrogen of one and hydrogen of another molecule. Due 1
to the presence of three hydrogen atoms, the intermolecular association is more in
 primary amines than in secondary amines as there are two hydrogen atoms available
for hydrogen bond formation in it.
c) During the acylation of aniline, stronger base pyridine is added. This done in order
to remove the HCl so formed during the reaction and to shift the equilibrium to the 1
right hand side.

OR

5 (a) The colour of coordination compound depends upon the type of ligand and d- 1
d transition taking place .
H2O is weak field ligand , which causes small splitting , leading to the d-d
transition corresponding green colour , however due to the presence of ( en )
which ia strong field ligand , the splitting is increased . Due to the change in
t2g -eg splitting the colouration of the compound changes from green to blue.
(b)Formula of the compound is [Co(H2NCH2CH2NH2 )3 ]2 (SO4 )3
The hybridisation of the compound is: d2sp3 1
 OR 1

a)As the fourth electron enters one of the eg orbitals giving the configuration t2g3 eg1
,which indicates ∆o < P hence forms high spin complex.
1
b)
2

6 (a) Ti is having electronic configuration [Ar] 3d2 4s2. Ti (IV) is more stable as 1
Ti4+ acquires nearest noble gas configuration on loss of 4 e-.
(b)In case of transition elements, ions of the same charge in a given series show 1
progressive decrease in radius with increasing atomic number.
As the new electron enters a d orbital each time the nuclear charge increases by
unity. The shielding effect of a d electron is not that effective, hence the net
electrostatic attraction between the nuclear charge and the outermost electron
increases and the ionic radius decreases.
(c)Iron and Chromium are having high enthalpy of atomization due to the presence
of unpaired electrons, which accounts for their hardness. However, Zinc has low 1
enthalpy of atomization as it has no unpaired electron. Hence zinc is comparatively
a soft metal.

7 Compound A is an alkene, on ozonolysis it will give carbonyl compounds. As both

B and C have >C=O group,
B gives positive Fehling’s test so it is an aldehyde and it gives iodoform test so it is
so it has CH3C=O group. This means the aldehyde is acetaldehyde
C does not give Fehling’s test, so it is a ketone. It gives positive iodoform test so it is
a methyl ketone means it has CH3C=O group

Compound A (C5H10) on ozonlysis gives B (CH3CHO) + C (CH3COR)

So “C” is CH3COCH3 ½
CH3CH=C(CH3)2 (i)O3 (ii) Zn/H3O+ CH3CHO + CH3COCH3
 CH3CHO + 2Cu2+ + 5OH- CH3COO- + Cu2O (red ppt) + 3H2O
CH3COCH3 + 2Cu2+ + 5OH- No reaction ½

CH3CHO + 3I2 + 3 NaOH CHI3 (yellow ppt) + 3HI + HCOONa

CH3COCH3 + 3I2 + 3 NaOH CHI3 (yellow ppt) + 3HI + CH3COONa ½

A = CH3CH=C(CH3)2 ½
B = CH3CHO ½
C = CH3COCH3 ½

8 (a)electrodialysis 1
(b)purification of colloidal solution 1
(c)Yes. Dialysis is a very slow process to increase its speed electric field is applied ½+½

9 (a)When N-ethylethanamine reacts with benzenesulphonyl chloride , 1

N,N-diethylbenzenesulphonamide is formed.
b)When benzylchloride is treated with ammonia , Benzylamine is formed which on ½+½
reation with Chloromethane yields a secondary amine ,
N-methylbenzylamine .
c)When aniline reacts with chloroform in the presence of alcoholic potassium 1
hydroxide ,
phenyl isocyanides or phenyl isonitrile is formed .
OR
(i)
N-Ethyl-N-methylbenzenamine or N-Ethyl-N-ethylaniline 1

(ii) ½
each

10 Al(s) /Cd2+ (0.1M) // Al3+ (0.01M) /Cd(s) ½

2Al(s) + 3Cd2+ (0.1M)  3Cd (s) + 2Al3+ (0.01M)
Ecell = Eocell -0.059 log [Al3+]2 ½
n [Cd2+]3
Ecell= 1.26 – 0.059 log (0.01)2
6 (0.1)3 ½
 = 1.26 – 0.059 (-1) 1
6
= 1.26+0.009 ½
= 1.269 V ans
unit
11
(a) The ability of fluorine to stabilize the highest oxidation state is attributed to 1
the higher lattice energy or high bond enthalpy.
1

(b) Co2+ has three unpaired electrons so it would be paramagnetic in nature, hence
Co2+ ion would be attracted to magnetic field.
(c) The transition elements of 5d series have intervening 4f orbitals. There is greater 1
effective nuclear charge acting on outer valence electrons due to the weak shielding
by 4f electrons. Hence first ionisation energy of 5 d series of transition elements are
higher than that of 3d and 4d series.
OR 1
a)Manganese is having lower melting point as compared to chromium , as it has
highest number of unpaired electrons , strong interatomic metal bonding , hence no
delocalisation of electrons .
b) There is much more frequent metal – metal bonding in compounds of the heavy 1
transition metals i.e 4d and 5d series , whixh accounts for lower melting point of 3d
series. 1
c) Tungsten

12 (a) Ratio of neutrons to protons is 2.3: 1 which is not the stable ratio of 1:1 1
(b)Age of fossils can be estimated by C-14 decay. All living organisms have C-14 1
which decays without being replaced back once the organism dies.
(c) carbon-14 atoms decay to stable nitrogen atoms and potassium-40 atoms decay to 1
stable calcium
(d)t = 2.303/ k log (Co/Ct) ½
Co = 20 g Ct = ?
t = 10320 years k = 0.693/6000 (half-life given in passage)
substituting in equation:
10320 = 2.303 / (0.693/6000) log 20/ Ct ½
0.517 = log 20 / Ct anlilog (0.517) = 20/Ct
3.289 = 20/Ct ½
Ct = 6.17 g ½
OR
t = 2.303/ k log (Co/Ct) ½
Co = 32 g Ct = 12
t = ? k = 0.693/6000 (half life given in passage)
substituting in equation:
t = 2.303 / (0.693/6000) log 32/ 12 ½

t = 2.303 x 60000 /0.693 log 2.667 ½

t = 2.303x6000x0.4260 /0.693
= 8494 years ½
 SAMPLE QUESTION PAPER
CLASS XII
BIOLOGY (044)
TERM II (2021-22)
Max. Marks 35 Time allowed: 2 hours
General Instructions:
i) All questions are compulsory.
ii) The question paper has three sections and 13 questions. All questions are
compulsory.
iii) Section–A has 6 questions of 2 marks each; Section–B has 6 questions of 3 marks
each; and Section–C has a case-based question of 5 marks.
iv) There is no overall choice. However, internal choices have been provided in
some questions. A student has to attempt only one of the alternatives in such
questions.
v) Wherever necessary, neat and properly labeled diagrams should be drawn.

Q. No. Marks

Section A

1 Humans have innate immunity for protection against pathogens that may 2
enter the gut along with food. What are the two barriers that protect the
body from such pathogens?

2 A patient admitted in ICU was diagnosed to have suffered from 2

myocardial infarction. The condition of coronary artery is depicted in the
image below.
Name two bioactive agents and their mode of action that can improve this
condition.

OR
Substantiate by giving two reasons as to why a holistic understanding of
the flora and fauna the cropland is required before introducing an
appropriate biocontrol method.
1
3 Identify the compound chemical structure is shown below. State any three 2
of its physical properties.

4 Water samples were collected at points A, B and C in a segment of a river 2

near a sugar factory and tested for BOD level. The BOD levels of samples
A, B and C were 400 mg/L, 480 mg/L and 8 mg/L respectively.
What is this indicative of? Explain why the BOD level gets reduced
considerably at the collection point C?

5 An ecologist study an area with population A, thriving on unlimited 2

resources and showing exponential growth, introduced population B and
C to the same area.
What will be the effect on the growth pattern of the population A, B and C
when living together in the same habitat?

6 With the decline in the population of fig species it was noticed that the 2
population of wasp species also started to decline. What is the
relationship between the two and what could be the possible reason for
decline of wasps?
OR
With the increase in the global temperature, the inhabitants of Antarctica
are facing fluctuations in the temperature. Out of the regulators and the
conformers, which of the two will have better chances of survival?
Give two adaptations that support them to survive in the ambient
environment? Give one suitable example.

2
 SECTION B

7 How do normal cells get transformed into cancerous neoplastic cells? 3

Elaborate giving three examples of inducing agent.
OR
A person is suffering from a high-grade fever. Which symptoms will help
to identify if he/she is suffering from Typhoid, Pneumonia or Malaria?

8 Recognition of an antigenic protein of a pathogen or exposure to a 3

pathogen occurs during many types of immune responses, including
active immunity and induced active immunity.
Specify the types of responses elicited when human beings get
encountered by a pathogen.

9 In a pathological lab, a series of steps were undertaken for finding the 3

gene of interest. Describe the steps, or make a flow chart showing the
process of amplification of this gene of interest.

10 a. ‘The Evil Quartet’ describes the rates of species extinction due to 3

human activities. Explain how the population of organisms is affected
by fragmentation the habitats.
b. Introduction of alien species has led to environmental damage and
decline of indigenous species. Give any one example of how it has
affected the indigenous species?
c. Could the extinction of Steller’s sea cow and passenger pigeon be
saved by man? Give reasons to support your answer.

11 a. The image shown below is of a sacred grove found in India. Explain 3

how has human involvement helped in the preservation of these
biodiversity rich regions.

b. Value of Z (regression coefficient) is considered for measuring the

species richness of an area. If the value of Z is 0.7 for area A ,and
0.15 for area B, which area has higher species richness and a steeper
slope?

3
12 The image below depicts the result of gel electrophoresis 3

If the ladder represents sequence length upto 3000 base pairs (bp),
a. Which of the bands (I - IV) correspond to 2500 bp and 100 bp
respectively?
b. Explain the basis of this kind of separation and also mention the
significance of this process.

SECTION C

13 Some restriction enzymes break a phosphodiester bond on both the DNA 5

strands, such that only one end of each molecule is cut and these ends
have regions of single stranded DNA. BamH1is one such restriction
enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and
cleaves these sequences just after the 5’- guanine on each strand.
a. What is the objective of this action?
b. Explain how the gene of interest is introduced into a vector.
c. You are given the DNA shown below.
5’ ATTTTGAGGATCCGTAATGTCCT 3’
3’ TAAAACTCCTAGGCATTACAGGA 5’
If this DNA was cut with BamHI, how many DNA fragments would
you expect? Write the sequence of these double-stranded DNA
fragments with their respective polarity.
d. A gene M was introduced into E.coli cloning vector PBR322 at
BamH1 site. What will be its impact on the recombinant plamids?
Give a possible way by which you could differentiate non
recombinant to recombinant plasmids.

4
OR
GM crops especially Bt crops are known to have higher resistance to pest
attacks. To substantiate this an experimental study was conducted in 4
different farmlands growing Bt and non Bt-Cotton crops. The farm lands
had the same dimensions, fertility and were under similar climatic
conditions. The histogram below shows the usage of pesticides on Bt
crops and non-Bt crops in these farm lands.

a. Which of the above 4 farm lands has successfully applied the concepts
of Biotechnology to show better management practices and use of
agrochemicals? If you had to cultivate, which crop would you prefer (Bt
or Non- Bt) and why?
b. Cotton Bollworms were introduced in another experimental study on
the above farm lands wherein no pesticide was used. Explain what
effect would a Bt and Non Bt crop have on the pest.

***

5
 MARKING SCHEME (SQP)
CLASS XII
BIOLOGY (044)
TERM II (2021-22)

Q. Section A Marks
No.

1 Microbial pathogens enter the gut of humans along with food: 2

 Physical barriers: Mucus coating of the epithelium lining the
gastrointestinal tract helps in trapping microbes entering our body.
(1 Mark)
 Physiological barriers: Acid in the stomach, saliva in the mouth
prevent microbial growth. (½+½ Mark)

2 Streptokinase (produced by the bacterium Streptococcus) is used as a 2

‘clot buster’ for removing clots from the blood vessels of patients who
have undergone myocardial infarction. (1 mark)
Statins (produced by the yeast Monascus purpureus) act as blood-
cholesterol lowering agents. (1 mark)
OR
Eradication of pests will disrupt predator-prey relationships, where
beneficial predatory and parasitic insects which depend upon flora and
fauna as food or hosts, may not be able to survive. (1 mark)
Holistic approach ensures that various life forms that inhabit the field,
their life cycles, patterns of feeding and the habitats that they prefer
are extensively studied and considered. (1 mark)

3 It is Morphine. (1/2 mark) 2

Physically it appears as a white, odourless, crystalline compound.
(1½ mark)

4 At collection points A and B, the BOD level is high due to high organic 2
pollution caused by sugar factory and sewage discharge. (1 mark)
At the collection point C, the water was released after secondary
treatment/ biological treatment (where vigorous growth of useful
aerobic microbes into flocs consume the major part of the organic
matter present in the river water or effluent due to sugar factory and
sewage discharge). (1 mark)

1
5 This interaction will lead to competition between the individuals of 2
population A,B and C for resources. Eventually the ‘fittest’ individuals
will survive and reproduce. (1 mark)
The resources for growth will become finite and limiting, and
population growth will become realistic. (1 mark)

6 The relationship between the plant and pollinator is called mutualism. 2

Fig depends on wasp for pollination, and wasp depends on fig for
food and shelter. (1 mark)
With the decline in population of figs, wasp loses its source of food
and shelter. (1 mark)
OR
Regulators;
Thermoregulation, Osmoregulation
Birds/mammals (any one) (½ x 4 Marks)

SECTION B

7 Transformation of normal cells into cancerous neoplastic cells may be 3

induced by following physical, chemical or biological agents causing
DNA damage:
● Ionising radiations like X-rays and gamma rays
● Non-ionizing radiations like UV.
● Chemical carcinogens present in tobacco smoke
● Cellular oncogenes (c-onc) or proto-oncogenes, when
activated under certain conditions cause cancer. Viruses with
oncogenes can transform normal cells to cancerous cells.
(any 3; 1 x 3 marks)
OR
If the person has sustained high fever (39° to 40°C), weakness,
stomach pain, constipation, headache and loss of appetite, it is
Typhoid. (1 mark)
If the person has fever, chills, cough and headache; and the lips and
fingernails turn gray to bluish, it is Pneumonia. (1 mark)
If the person has chills and high fever recurring every three to four
days then, it is Malaria. (1 mark)

8 ● When our body encounters an antigenic protein or a pathogen for 3

the first time it produces a response which is of low intensity and
our body retains memory of the first encounter. (1 mark)
● The subsequent encounter with the same pathogen elicits a
highly intensified response carried out with the help of two
special types of lymphocytes present in our blood, B-

2
 lymphocytes, and T-lymphocytes. (1 mark)
● The B-lymphocytes produce an army of proteins in response to
these pathogens into our blood to fight with them. These proteins
are called antibodies. The T-cells themselves do not secrete
antibodies but help B-cells produce them. (1 mark)

9 The flow chart shows the three steps involved in the process of PCR
showing the following 3
- Denaturation The DNA strands are treated with a temperature of
940C (Heat) and the strands are separated.
- Annealing The primers anneal to the complementary strands
- Extension The DNA polymerase facilitates the extension of the
strands. (1x3=3 marks)
OR

Diagram : Polymerase Chain Reaction

10 a. When a large habitat is broken into small fragments due to various 3

activities, mammals and birds requiring large territories and certain
animals with migratory habitats are badly affected, leading to
population decline. (1 mark)
b.
● Nile perch introduced in Lake Victoria eventually led to the
extinction of an ecologically unique assemblage of more than
200 species of cichild fish.

3
 ● Parthenium/Lantana/water hyacinth caused environmental
damage and threat to our native species
● African catfish-Clarias gariepinus introduced for aquaculture
purposes is posing a threat to the indigenous catfishes in our
rivers. (Any one) (1 mark)
c. Yes; Humans have overexploited natural resources for their ‘greed’
rather than ‘need’ leading to extinction of these animals.
Sustainable harvesting could have prevented extinction of these
species. (1 mark)

11 a. India’s history of religious and cultural traditions emphasized the 3

protection of nature. In many cultures, tracts of forest are set
aside, all the trees and wildlife within are venerated and given total
protection. Sacred groves in many states are the last refuges for a
large number of rare and threatened plants. (2 marks)
b. Area A will have more species richness and a steeper slope.
(1 mark)

12 a. Band III corresponds to 2500 base pairs, and Band IV corresponds 3

to 100bp. (½ + ½ mark)
b. The fragments will resolve according to their size. The shorter
sequence fragments would move farthest from well as seen in
Band IV (100 bp) which is lighter as compared to Band III which is
heavier being 2500 base pairs. (1 mark)
The significance of electrophoresis is to purify the DNA fragments
for use in constructing recombinant DNA by joining them with
cloning vectors. (1 mark)

SECTION C

13 a. The two different DNA molecules will have compatible ends to 5

recombine. (½ mark)
b. Restriction enzyme cuts the DNA of the vector and then ligates the
gene of interest into the DNA of the vector. (1 mark)
c. 2 fragments (½ mark)
5’ ATTTTGAG 3’5’GATCCGTAATGTCCT 3’
3’ TAAAACTCCTAG 5’.3’GCATTACAGGA 5’ (1 mark)
d. BamH1 site will affect tetracycline antibiotic resistance gene,
hence the recombinant plasmids will lose tetracycline resistance
due to inactivation of the resistance gene. (1 mark)
Recombinants can be selected from non recombinants by plating
into a medium containing tetracycline, as the recombinants will not
grow in the medium because the tetracycline resistance gene is
cut. (1 mark)

4
OR
a. Farm Land II. (½ mark)
Bt crop. (½ mark)
Because the use of pesticides is highly reduced for Bt crop
// Decrease of pesticide used is also more significant for
Bt crop. (1 mark)
b. In Bt cotton a cry gene has been introduce from bacterium
Bacillus thuringiensis (Bt) which causes synthesis of a toxic
protein. This protein becomes active in the alkaline gut of
bollworm feeding on cotton, punching holes in the lining
causing death of the insect. (2 marks)
However; a Non Bt crop will have no effect on the cotton
bollworm/ the yield of cotton will decrease / non Bt will
succumb to pest attack. (1 mark)

***

5
 Sample Question Paper
COMPUTER SCIENCE (Code: 083)
Maximum Marks: 35 Time: 2 hours

General Instructions

 The question paper is divided into 3 sections – A, B and C

 Section A, consists of 7 questions (1-7). Each question carries 2 marks.
 Section B, consists of 3 questions (8-10). Each question carries 3 marks.
 Section C, consists of 3 questions (11-13). Each question carries 4 marks.
 Internal choices have been given for question numbers 7, 8 and 12.

Section -A
Each question carries 2 marks
Q. Part Question Marks
No No.
1. Give any two characteristics of stacks. (2)

2. (i) Expand the following: (1)

SMTP , XML

(ii) Out of the following, which is the fastest wired and wireless medium (1)
of transmission?

Infrared, coaxial cable, optical fibre,

microwave, Ethernet cable

3. Differentiate between char(n) and varchar(n) data types with respect (2)
to databases.

4. A resultset is extracted from the database using the cursor object (2)
(that has been already created) by giving the following statement.

Mydata=cursor.fetchone()

(a) How many records will be returned by fetchone()

method?
(b) What will be the datatype of Mydata object after the
given command is executed?

[1]
5. Write the output of the queries (a) to (d) based on the table, (2)
Furniture given below:

Table: FURNITURE
FID NAME DATEOFPURCHASE COST DISCOUNT
B001 Double 03-Jan-2018 45000 10
Bed
T010 Dining 10-Mar-2020 51000 5
Table
B004 Single 19-Jul-2021 22000 0
Bed
C003 Long 30-Dec-2016 12000 3
Back
Chair
T006 Console 17-Nov-2019 15000 12
Table
B006 Bunk 01-Jan-2021 28000 14
Bed

(a) SELECT SUM(DISCOUNT)

FROM FURNITURE
WHERE COST>15000;

(b) SELECT MAX(DATEOFPURCHASE)

FROM FURNITURE;

(c) SELECT * FROM FURNITURE

WHERE DISCOUNT>5 AND FID LIKE "T%";

(d) SELECT DATEOFPURCHASE FROM FURNITURE

WHERE NAME IN ("Dining Table", "Console
Table");

6. (i) Which command is used to view the list of tables in a database? (1)

(ii) Give one point of difference between an equi-join and a natural join. (1)

7. Consider the table, MOVIEDETAILS given below: (2)

Table: MOVIEDETAILS
MOVIEID TITLE LANGUAGE RATING PLATFORM
M001 Minari Korean 5 Netflix
M004 MGR Magan Tamil 4 Hotstar
[2]
 M010 Kaagaz Hindi 3 Zee5
M011 Harry English 4 Prime
Potter Video
and the
Chamber
of
Secrets
M015 Uri Hindi 5 Zee5
M020 Avengers: English 4 Hotstar
Endgame

(a) Identify the degree and cardinality of the table.

(b) Which field should be made the primary key? Justify your
answer.

OR

(a) Identify the candidate key(s) from the table MOVIEDETAILS.

(b) Consider the table SCHEDULE given below:

Table: SCHEDULE
SLOTID MOVIEID TIMESLOT
S001 M010 10 AM to 12 PM
S002 M020 2 PM to 5 PM
S003 M010 6 PM to 8 PM
S004 M011 9 PM to 11 PM

Which field will be considered as the foreign key if the tables

MOVIEDETAILS and SCHEDULE are related in a database?

SECTION – B
Each question carries 3 marks

8. Julie has created a dictionary containing names and marks as key (3)
value pairs of 6 students. Write a program, with separate user
defined functions to perform the following operations:

● Push the keys (name of the student) of the dictionary into a

stack, where the corresponding value (marks) is greater than
75.
● Pop and display the content of the stack.
For example:
If the sample content of the dictionary is as follows:

[3]
 R={"OM":76, "JAI":45, "BOB":89, "ALI":65, "ANU":90,
"TOM":82}

The output from the program should be:

TOM ANU BOB OM

OR

Alam has a list containing 10 integers. You need to help him create
a program with separate user defined functions to perform the
following operations based on this list.
● Traverse the content of the list and push the even numbers
into a stack.
● Pop and display the content of the stack.

For Example:
If the sample Content of the list is as follows:
N=[12, 13, 34, 56, 21, 79, 98, 22, 35, 38]

Sample Output of the code should be:

38 22 98 56 34 12

9. (i) A table, ITEM has been created in a database with the following (1)
fields:
ITEMCODE, ITEMNAME, QTY, PRICE

Give the SQL command to add a new field, DISCOUNT (of type
Integer) to the ITEM table.
(ii) Categorize following commands into DDL and DML commands? (2)

INSERT INTO, DROP TABLE, ALTER TABLE,

UPDATE...SET

10. Charu has to create a database named MYEARTH in MYSQL. (3)

She now needs to create a table named CITY in the database to store
the records of various cities across the globe. The table CITY has the
following structure:

Table: CITY
FIELD NAME DATA TYPE REMARKS

CITYCODE CHAR(5) Primary

Key
CITYNAME CHAR(30)
SIZE INTEGER

[4]
 AVGTEMP INTEGER
POLLUTIONRATE INTEGER
POPULATION INTEGER

Help her to complete the task by suggesting appropriate SQL

commands.
Section C
Each question carries 4 marks

11. Write queries (a) to (d) based on the tables EMPLOYEE and (4)
DEPARTMENT given below:

Table: EMPLOYEE
EMPID NAME DOB DEPTID DESIG SALARY
120 Alisha 23- D001 Manager 75000
Jan-
1978
123 Nitin 10- D002 AO 59000
Oct-
1977
129 Navjot 12- D003 Supervisor 40000
Jul-
1971
130 Jimmy 30- D004 Sales Rep
Dec-
1980
131 Faiz 06- D001 Dep 65000
Apr- Manager
1984

Table: DEPARTMENT

DEPTID DEPTNAME FLOORNO

D001 Personal 4
D002 Admin 10
D003 Production 1
D004 Sales 3

(a) To display the average salary of all employees, department wise.

(b) To display name and respective department name of each

employee whose salary is more than 50000.
[5]
 (c) To display the names of employees whose salary is not known, in
alphabetical order.

(d) To display DEPTID from the table EMPLOYEE without repetition.

12. (i) Give two advantages and two disadvantages of star topology (2)

OR

Define the following terms:

www , web hosting

(ii) How is packet switching different from circuit switching? (2)

13. BeHappy Corporation has set up its new centre at Noida, Uttar (4)
Pradesh for its office and web-based activities. It has 4 blocks of
buildings.

BeHappy Corporation
Block B
Block A

Block D
Block C

Distance between the various blocks is as follows:

A to B 40 m
B to C 120m
C to D 100m
A to D 170m
B to D 150m
A to C 70m

Numbers of computers in each block

Block A - 25
[6]
 Block B - 50
Block C - 125
Block D - 10

(a) Suggest and draw the cable layout to efficiently connect

various blocks of buildings within the Noida centre for
connecting the digital devices.

(b) Suggest the placement of the following device with

justification
i. Repeater
ii. Hub/Switch

(c) Which kind of network (PAN/LAN/WAN) will be formed if the

Noida office is connected to its head office in Mumbai?

(d) Which fast and very effective wireless transmission medium

should preferably be used to connect the head office at
Mumbai with the centre at Noida?

[7]
 Marking Scheme
COMPUTER SCIENCE (Code : 083)
Maximum Marks: 35 Time: 2 hours

General Instructions

 The question paper is divided into 3 sections – A, B and C

 Section A, consists of 7 questions (1-7). Each question carries 2 marks.
 Section B, consists of 3 questions (8-10). Each question carries 3 marks.
 Section C, consists of 3 questions( 11-13). Each question carries 4 marks.
 Internal choices have been given for question numbers – 7, 8 and 12

Section -A
Each question carries 2 marks
Q. Part Question Marking Marks
No No. Instructions
1. Characteristics of Stacks: 1 mark for
 It is a LIFO data structure each point (2)
 The insertion and deletion happens at one
end i.e. from the top of the stack

2. (i) SMTP : Simple Mail Transfer Protocol ½ mark for

XML: Extensible Mark Up Language each correct (1)
expansion
(ii) Wired- optical fibre ½ mark for
Wireless – microwave each correct (1)
answer
3. char(n): 1 mark for
 stores a fixed length string between 1 and each correct
255 characters difference
 if the value is of smaller length, adds blank ( minimum 2
spaces differences (2)
 some space is wasted to be given)
varchar(n) :
 stores a variable length string
 no blanks are added even if value is of
smaller length
 no wastage of space
[1]
4. (a) One record 1 mark for
(b) tuple each correct (2)
answer
5.
(a) 29

(b) 19-Jul-2021
½ mark for (2)
(c) each correct
output
T006 Console 17-Nov- 15000 12
Table 2019

(d)
10-Mar- 2020
17-Nov-2019

6. (i) SHOW TABLES; 1 mark for

correct (1)
answer
(ii) Equi- join: 1 mark for
 The join in which columns from two tables correct
are compared for equality difference
 Duplicate columns are shown (Any one (1)
Natural Join point may be
 The join in which only one of the identical given)
columns existing in both tables is present
 No duplication of columns

7. (a) Degree: 5 ½ mark each

Cardinality: 6 for correct
degree and
cardinality

(b) MOVIEID should be made the primary key as it ½ mark for

uniquely identifies each record of the table. correct field
and ½ mark (2)
for
justification

[2]
 OR

(a) MOVIEID and TITLE ½ mark for

each correct
field name

(b) MOVIEID 1 mark for

correct
answer
SECTION – B
Each question carries 3 marks

8. # Question No 8 (first option)

R={"OM":76, "JAI":45, "BOB":89, 1 mark for
"ALI":65, "ANU":90, "TOM":82} correct PUSH
def PUSH(S,N): operation
S.append(N)
def POP(S):
1 mark for
if S!=[]:
return S.pop() correct POP
else: operation
return None
ST=[] 1 mark for
for k in R: correct
if R[k]>=75: function calls
PUSH(ST,k) and (3)
while True: displaying
if ST!=[]: the output
print(POP(ST),end=" ")
else:
break

OR

# Question No 8 (second option) 1 mark for

correct PUSH
N=[12, 13, 34, 56, 21, 79, 98, 22, operation
35, 38]
def PUSH(S,N):

[3]
 S.append(N) 1 mark for
def POP(S): correct POP
if S!=[]: operation
return S.pop()
else: 1 mark for
return None
correct
ST=[]
for k in N: function calls
if k%2==0: and
PUSH(ST,k) displaying
while True: the output
if ST!=[]:
print(POP(ST),end=" ")
else:
break

Note: Marks
to be
awarded for
any other
correct logic
given by the
student
9. (i) ALTER TABLE Item 1 mark for
ADD (Discount INT); correct (1)
command
(ii) DDL: DROP TABLE, ALTER TABLE ½ mark for (2)
DML: INSERT INTO, UPDATE...SET each correct
command
identified
10. CREATE DATABASE MYEARTH; 1 mark for
correctly
CREATE TABLE CITY creating
( database.
CITYCODE CHAR(5)PRIMARY KEY, (3)
CITYNAME CHAR(30),
2 marks for
SIZE INT,
AVGTEMP INT, correctly
POPULATIONRATE INT, creating the
POPULATION INT, table.
);

Section C
Each question carries 4 marks
11. (a) SELECT AVG(SALARY)

[4]
 FROM EMPLOYEE
GROUP BY DEPTID;

(b) SELECT NAME, DEPTNAME

1 mark for
FROM EMPLOYEE, DEPARTMENT each correct
WHERE query
EMPLOYEE.DEPTID= (4)
DEPARTMENT.DEPTID
AND SALARY>50000;

(c) SELECT NAME FROM EMPLOYEE

WHERE SALARY IS NULL
ORDER BY NAME;

(d) SELECT DISTINCT DEPTID

FROM EMPLOYEE;
12. (i) Advantages
 Ease of service
 Centralized control
 Easy to diagnose faults
 One device per connection ½ mark for
each correct
Disadvantages advantage / (2)
 long cable length disadvantage
 difficult to expand
 central node dependency

OR

www: a set of protocols that allow you to access any

document on the internet through the naming 1 mark for
systems based on URLs each correct
Web hosting: Web hosting is a service that definition
allows organizations and individuals to post a
website or web page onto the server, which can be
viewed by everyone on the Internet.
(ii) Packet switching: 1 mark for
 uses store and forward concept to send each correct
messages difference
 no physical path is actually establishes
 message is divided into smaller parts, known (minimum
as packets and then sent forward two points (2)
 tight upper limit on block size should be
 Each data unit knows only the final given)
receiver’s address
[5]
 Circuit switching
 physical connection is established between
sender and receiver
 Each data unit knows the entire path from
sender to receiver
 It does not follow store and forward
concept

13.

(a)

BeHappy Corporation (4)

Block B
Block A

Block C Block D

1 mark for
each correct
answer
(b)
Repeater : between C and D as the distance
between them is 100 mts.

Hub/ Switch : in each block as they help to share

data packets within the devices of the network in
each block

(c) WAN.

(d) Satellite

[6]
 SAMPLE QUESTION PAPER
PHYSICAL EDUCATION (048)
SESSION 2021-22(CLASS XII)
TERM II
Max Marks: 35 Time: 2 hrs
General instructions:
1. There are three sections in the Question paper namely Section A, Section B and
Section C.
2. Section A consists of 9 questions amongst which 7 questions have to be attempted
each question carries 2 marks and should have 30-50 words.
3. Section B consists of 5 questions amongst which 3 questions have to be attempted
each question carries 3 marks and should have 80-100 words.
4. Section C consists of 4 questions amongst which 3 questions have to be attempted
each question carries 4 marks and should have 100-150 words.
(SECTION A)
Q1. Explain any two benefits of ardha matsyendrasana. (1+1)
Q2. Define explosive strength with help of example. (1+1)
Q3. Define personality and motivation. (1+1)
Q4. Write the full form of SPD and ASD. (1+1)
Q5.List any four changes happening in the muscular system due to exercising. (0.5*4)
Q6.What is the meaning of the Isotonic method and it is used for developing which ability.
(1+1)
Q7.Mention any two symptoms and causes of ADHD. (1+1)
Q8.What is Laceration and how can it be managed? (1+1)
Q9.List down any two strategies to make physical activities accessible for CWSN. (1+1)

(SECTION B)
Q10. List down and briefly explain any four techniques of motivation. {1+(0.5*4)}
Q11.Explain cognitive disability along with its symptoms. (1+2)
Q12.Create a flowchart to explain classification of sports injuries.(1+1+1)
For visually impaired candidates
Explain classification of sports injuries.(1+1+1)

Q13.List down any three asanas used for preventing Asthma and write two benefits of
each.(1+2)
Q14.What are the salient features of the Fartlek training method? (1*3)

(SECTION C)
Q15. Explain any three personality types of Big five theory.(1+3)
Q16. Discuss physiological factors determining speed. (1*4)
Q17. Define flexibility and explain methods to develop flexibility.(1+3)
Q18. Briefly explain the administration of Pawanmuktasana long with its contraindications
and draw stick diagram.(2+1+1)
For visually impaired candidates
Briefly explain the administration of Pawanmuktasana long with its contraindications
(2+2)
 PHYSICAL EDUCATION
CLASS - XII
MARKING SCHEME
TERM 2
(2021-2022)
Q.NO ANSWER MARKS
1. Benefits of Ardha Matsyendrasana
(Any two)
(i) It loses extra fat and makes the body beautiful and strong. (1+1=2)

(ii) It stimulates the liver, spleen and pancreas.

(iii) It is beneficial for the respiratory system.

(iv) It strengthens the spinal column and back muscles.

(v) It glorifies the face and keeps the menstrual cycle in women in
control.

(vi) It rejuvenates the nerves around.

(vii) It heals back pain, stress, and headache.

(viii) It is helpful for people suffering from diabetes.

2. Explosive Strength: It is the ability to overcome resistance with high speed.

It is used in take-off jumping events like long jump, high jump, triple jump, (1+1=2)
jumping in volleyball for smashing or spiking, jumping for rebound in
basketball.
3. PERSONALITY
According to Begge and Hunt, “Personality refers to the whole behavioral
pattern of an individual to the totality of its characteristics.”
According to Velentine, “Personality is the sum-total of inherited and acquired
abilities.”
According to Guild Ford, “Personality is an individual’s unique pattern of
traits.”
According to Sigmund Freud, “Personality is an individual’s unique thought, feeling and (1+1=2)
behavior that persist over time and different situations.”
According to Young, “Personality is the totality of behavior of an individual with a
given tendency system interacting with a sequence of situations.”
According to R.B. Cattel, “Personality is that which permits a prediction of
what a person will do in a given situation.”
On the basis of these definitions, a brief definition would be that,
“Personality is the sum total of inner and outer capabilities of an individual.”
MOTIVATION
According to Sage, “The drive to strive is called motivation.”
 According to Crooks and Stein, “Any condition that might energize and direct
our actions” is called motivation.
According to Morgan and King, “Motivation refers to a state within a person or
animal that drives behavior towards some goal.”
According to P.T. Yong, “Motivation is the process of arousing , action, sustaining the
activities in progress, and regulating the patterns of activity.”
According to Johnson, “Motivation is the influence of a general pattern of
activities indicating and directing the behavior of the organism.”

4. Autism SPECTRUM Disorder (ASD) (1+1=2)

Sensory PROCESSING Disorder (SPD)
5.
Changes happening in the muscular system due to exercising.
(Any four)
1. Change in size and shape of Muscle: Regular exercise helps in enlarging
cells of muscles which in turn helps in changing size and shape of muscles.

2. Increase in the Strength of Muscles: A person who does exercise daily has
stronger muscles and such muscles work more. These become stronger by (0.5*4=2
getting more nutritious food in the form of oxygen. )

3. Increase in Coordination: Regular exercise increases coordination in the

muscles. These become stronger by doing exercise. As a result a person
does not feel fatigue even by working for a long time. If the muscles do not
have co-ordination or have incomplete co-ordination then the working
becomes impossible.

4. Entrance of Greater Quantity of Oxygen in the Body: Muscles have to do

more work during exercise. The consumption of oxygen increases in the
person who exercises. Thus blood reaches quickly in the muscles.

5. Increase in Supply of Blood: Muscles get chemical substances like

glycogenephoscoratine, potassium etc. by doing regular exercise. These
chemical substances increase the speed of blood.

6. Proper Blood Circulation: During rest, the blood completes a round of the
body in 21 seconds, but it completes the round in just 15, 10 or 8 seconds
while exercising. The heart muscles work faster during exercise.

7. Effects on Bones and Joints: By doing exercise our bones become hard and
they can work for more time. It also has effects on our joints. Thus the
bones and muscles become strong by doing exercise. Children’s bones
happen to be very soft and fragile. Activities of muscles affect these a lot.
By the lack of these the bones remain soft and deformity takes place in
them.

8. Effective Respiration: Regular exercise increases the capacity of chest

 muscles. As a result, the respiratory system gets effective.

9. Increase in the Resistance Power of Body: Regular exercise develops the

lungs in an equal way. By this the volume of lungs starts increasing. Thus
develops the chest Skeleton and by doing exercise the condition of
breathing improves. Thus, as a result of this improved breathing capacity
the resistance capacity of the body increases.

6. Isotonic method
Isotonic exercises were introduced by De Lorene in 1954. This term comes from
the Greek word ‘iso’ which means ‘same or equal’ maintaining equal (muscle)
tone or tension’. In this one muscle group contracts the opposite relaxes during (1+1=2)
which the muscle changes its length. These are those exercises in which direct
movements are visible to the 3rd person. In this case, personal muscular efforts
are evidenced by visible movements. In isotonic exercises rapid movements are
accomplished by reflex alteration of contraction and relaxation of antagonistic
flexors and extensors of the joints concerned. Type of contraction where we
notice the movements of objects is called isotonic contraction e.g. doing exercise
with light weight or dumbbells etc. Most of the exercises fall under this category
Used to develop Strength.
7. Symptoms of ADHD in Children
l. They could not perform daily life activities.
1. They tend to forget routine work.

2. They indulge in daydreaming.

3. They do not like performing activities that require sitting still.

4. They get easily distracted.

5. They are weak in sports activities.

6. They do not take rest and usually roam around. (1+1=2)

7. They could not have any control on their emotions.

8. They lack concentration and work carelessly.

Symptoms in Adu1ts
l. They always remain worried.
2. They remain impulsive.

3. They have an inferiority complex.

4. They are always disorganized.

5. They easily get irritated.

6. They find difficulty in remembering things.

 7. Mood swings and depression are common in such adults.

8. They cannot control their anger.

9. They have problems with concentration.

Causes of ADHD
1. Heredity : If any parent is suffering from ADHD, there remains a high
probability of occurrence of this disorder in their children.

2. Pre-Nature Birth : If a child is delivered prematurely the nervous

system is not fully developed which increases chances of occurrence of
ADHD.

3. Less Efficiency of Brain and Deformity : If there is deformity of brain

shape that causes neural-imbalance which can cause ADHD.

4. Less Birth Body Weight : If a child on birth has less body weight,
ADHD, disorder remains a possibility.

5. Consumption of Alcohol and Drugs : Consumption of alcohol and

drugs always adversely affects our brain cells and nervous system.

6. Exposure to Toxic Substance: Exposure to some toxic substance like

lead can cause ADHD.

7. Diet : Few researches have proved that a particular type of food

substance plays a role in causing ADHD.

8. (a) Laceration: A laceration is an injury that results in an irregular break in the

skin, more commonly referred to as a cut, but defined as a torn and ragged
wound. Lacerations are caused when an object strikes the skin and causes
a wound to open. Depending on a variety of characteristics (angle, force,
depth, object), some lacerations can be more serious than others, reaching
as far as deep tissue and leading to serious bleeding. The predominant (1+1=2)
symptoms of lacerations are mild to serious breaking of the epidermis, tears
in the first layer of skin that can range from small slices to deep gashes.
Depending on the depth of the laceration, there can be bleeding of different
levels of severity. Mild lacerations may experience brief bleeding
accompanied by mild pain. Deeper lacerations will experience greater
bleeding and more intense pain.
Treatment of laceration (Treatment Steps)
i. Stop bleeding at the earliest by compression or by pressing.

ii. Clean the surface of the affected part using water and soap.

iii. Cover the affected part with medicinal cotton bandage or apply band aid.

iv. Repeat dressing or padding over the wound. If bleeding continues then applyy
 further pads or dressing.

v. Apply ice/cold for compression.

vi. If injury is deep go for stitches at the earliest.

9. Strategies to make physical activities accessible for CWSN

1. Interest: Physical activities must be based on interest, ability and limitation of

children with special needs to ensure maximum participation. (1+1=2)
2. Ability: The physical and mental state of children with special needs shall be
considered.

3. Medical Check-up : First, it is mandatory to have a medical check-up of all

children with special needs. Because without that we cannot know about the
disability the child is having.

4. Pre-experiences: Before deciding physical strategies, we shall know the

children with their past experiences and convince them.

5. Equipment: The equipment used should be according to capability and level of

children. It may vary in size, shape, colour and weight.

6. Specific Environment : A healthy and democratic environment shall be created

so that CWSN can perform freely.

7. Modified Rules : According to CWSN, the rules shall be diluted and modified
according to their nature of disability.

8. Easy to Difficult : The exercise shall be in progression from easily to difficult.

9. Use of All Body Parts : Physical strategies shall involve. Whole body parts and
ensure whole body movement.

10. Extra Care of Concern : While deciding upon physical strategies for CWSN,
extra care and concern shall be given like extra time, to avoid stress light music.

10. Any four techniques of motivation

1. Goal Setting: Goal setting is one of the most powerful techniques of
motivation. The athlete should be very specific and clear about his goal. In
other words, an athlete should be very clear what he has to do, how, and
why. If these three things are clear in the mind of the athlete then there will
be no problem in motivation and one will do the things accordingly. One
should be prepared mentally to do the activity and work to achieve the goal.
The goal should not be

impossible to achieve, it should be in the reach of the individual. One should {1+(0.5*
know the advantages of attaining the goal. 4)}=3
2. Reinforcement: Reinforcement is the use of rewards and punishments that
will work to either encourage a certain action or decrease it in the future.
There are two ways of using reinforcement - a positive and a negative
approach. The positive approach focuses on reward appropriate behaviour
this increases the likelihood of this behaviour happening again. The negative
approach focuses on punishing undesirable behaviors and should lead to
decrease of these behaviours in the future. Most coaches and instructors
combine positive and negative approaches.

3. Knowledge of Progress: The athlete should know fully about himself, his
capacity, quality, behavior, etc. Periodic positive results act as a strong
motivational force. One should be made aware about his progress from time
to time. Knowledge of progress is must because progress is also a reward in
itself.

4. Rewards: They can be effective for further progress and to achieve goal. This
can be very effective to motivate the players. Various rewards and cash
prizes act as a strong motivational force to perform.

5. Jobs: Outstanding sports persons can be offered good jobs according to their
achievement and educational qualifications. There are various departments
which provide jobs to good sports persons i.e. Police departments in various
states, Indian railways, Banks, Air India, etc.

6. Social Awards: The Government of India every year announces awards for
outstanding sports persons who bring laurels for the country in various
games and sports. They are honored with Arjuna Awards, Padama Shri, Rajiv
Gandhi Khel Ratna Award, Dronacharya Award, Major Dhyan Chand Award,
Padma Bhushan etc. Some special awards are also given for international
achievements.

7. Positive talks: Positive talk by the teachers or coaches is one of the best
methods to motivate an individual. It can help the athlete to change his
thinking and behaviour. It is most important even for players and athletes at
international level. At lower stages it works as a most successful tool for
motivation.

8. To provide best quality equipment The players and athletes should be

provided the best possible equipment, which will help the athlete to avoid
sports injuries, best and easy practice without any tension in mind. Good
quality equipment urges the participants to participate in the activity
whereas old and sub-standard equipment may turn off the interest of the
individual.

9. Positive attitude and environment: It is most important to have a positive

attitude and environment for a successful training programme. The coach
and the trainee should have a positive attitude towards each other and
towards the activity. The cordial environment plays a vital role to motivate
 an athlete.

10. Role of Mass Media: Television and Newspapers play an important role in
motivating the players. When the media gives coverage and recognition to
the performance of the sports persons it gives a boost to their self
confidence.

11. Role of Spectators: Crowd plays an important role in motivating the

players. Good and positive responses of spectators encourage the sports
persons to give their maximum.

11. 1. Cognitive Disability

This disorder comes in the mental disorder category. Due to
cognitive disorder, a person’s ability to learn, speak, memorize, and 1+2=3
problem solving skills are disrupted. Due to cognitive disorder, the
person suffers from dementia, and delirium disease. In addition, it
adversely affects the memorizing power and reasoning power.
Normally, these are various symptoms of these :
(i) Memory Disorder: The person who has a problem in listening and then
recalling things.

(ii) Hyper Activity: The person tends to hyper during sitting, standing phase,
The person remains in undue hurry.

(iii) Dyslexia: The person who faces problems in reading, writing and
memorizing.
Cause of Cognitive Disability
Cognitive disability normally occurs due to problems of the brain
like tumor, head injury, shock, infection, harmful brain neurotoxins,
heredity or any other brain related disease. It affects a person's
memorizing power, learning skills and ability to do routine activities
like, in case of tumor or head injury on part of the brain which
controls speech control, can affect the speaking skills of that person.
In same way, if brain tumor or head injury on that part of the brain
which can hamper the physical movement or delving other physical
activities.
12.

1+1+1=3

13. ASTHMA :SUKHASANA, CHAKRASANA, GOMUKHASANA, PARVATASANA,

BHUJANGASANA, PASCHIMOTTA- SANA, MATSYASANA

{1+(0.5*
4)}=3

14.
10.2 Fartlek Training Method:
 The Fartlek method of training was introduced and practiced in Sweden.
‘Fartlek’ is a Swedish term which means ‘speed play’ (playing with speed).
1*3=3
This training method was first introduced by Gosta Holmer. It is a type of
cross country running. Fartlek is usually conducted over a hilly region track,
and it allows variation in pace. It is one of the best methods of conditioning
for most of the sports in which endurance is the basic requirement. This
training can be performed at hilly path, river bed, forest, muddy road or
sandy path etc. Self-discipline is most important and vital in this type of
training. In Fartlek, the change of pace or speed is not pre planned so some
exercises can also be included in this method. These exercises may be
performed by stopping and running temporarily at different intervals. The
type of exercises that can be included along with running are hopping,
jumping, squat jump, double hop jump etc.
ADVANTAGES OF FARTLEK Training
1. It is an off season training method but is very useful in developing
endurance in athletes.

2. It has a psychological advantage over the other training methods

because the changing scenes help in delaying fatigue.

3. It is the best method to improve endurance in sports where

endurance is a basic requirement e.g. cross-country running.

4. Balancing adjustments of ankles, knees and thighs improves due to the

uneven surface.
15.

1+3=4

16.
Fast Twitch Muscle Fibre: The muscle composition is genetically determined
and cannot be changed by training. There are three main types of muscle
fibers. These are slow-twitch (type I), fast- twitch(type lla) and fast-
twitch(type llb). Fast twitch fibres are much better at generating short bursts
of strength or speed than slow twitch fibre muscles. Thus, the greater the 1*4=4
percentage of fast twitch muscle fibre one has, the faster he is.
Body Fat: Fat acts as excess baggage when trying to run. Body fat of 6 to
10 percent of body weight for men and 12 to 17 percent of body weight for
women is desirable for sprinting short distances. Lower range of body fat is
unhealthy whereas higher range of body fat negatively affects speed.
Anaerobic Capacity: Speed is dependent on the anaerobic energy
systems. Anaerobic capacity is the ability to produce energy without the use
of oxygen. Short bursts of speed are anaerobic and are very intensive. Our
body can only perform a certain number of quick bursts of speed before we
experience the physiological response of pain and fatigue. Thus, an athlete
having a better anaerobic capacity will have a better speed.
Neuromuscular Responses: Neuromuscular responses affect speed.
Faster responses lead to faster muscle contraction thus leading to faster
speed.
Flexibility: Another important factor contributing to optimum speed is
joint flexibility. Good flexibility will help an athlete in maximum range of
movement without much effort and resistance. Proper flexibility of the
 involved joints contributes to movements that are more fluid and
coordinated, resulting in longer and faster strides and greater speed. Thus,
flexibility plays an important role in determining speed.
17.
Flexibility can be defined as the maximum range of motion at a joint that is
the extent of movement possible about a joint without undue strain.
Flexibility is not a general quality; it is specific to a particular joint, such as
the knee or to a series of joints. This means that an individual can have a 1+3=4
better range of motion in some joints than in others.
10.4 ) Methods to Improve Flexibility
I. Ballistic Stretching: The individual performs these stretching exercises while
in motion. This dynamic method uses the momentum generated from
repeated bouncing movements to stretch the muscles. Although it is very
effective, most experts do not recommend this method because it may
overstretch the muscles and can cause muscle soreness or injury. This
method includes various exercises like swinging the trunk sidewards,
forward, backward, swinging the legs etc.

II. Static Stretching: It is an extremely popular and effective technique. Static

stretching involves gently and slowly moving into the stretch position and
holding it for a certain period of time. Movement should take place through
the full range of motion until a little tension or tightness is felt in the muscles
or group of muscles. As the muscle relaxes, the stretch should be extended
and held again. Stretching should not be painful. Care must be taken not to
force the joint to move too far, which may cause an injury. Stretching should
be held from 10 to 30 seconds and a maximum of five repetitions for each
exercise.

III. Passive stretching: Passive stretching techniques are usually performed

with a partner who applies a stretch to a relaxed joint. Partner stretching
requires closer communication between partners, and the slow
application of the stretch in order to 4 prevent injuries due to forceful
manipulation of the body segment.

IV. Proprioceptive Neuromuscular Facilitation (PNF) or Contract: PNF

technique is the most appropriate method for increasing or developing
flexibility in the shortest possible time. This method is used by sportsmen
for gaining flexibility. It involves use of muscle contraction before
stretching to achieve maximum muscle relaxation. The following
procedure is used for PNF technique :

1. Move into the stretch position so that the stretch sensation can be felt.

2. The partner holds the limb in this stretched position.

3. Push against your partner for 6 to 10 seconds by contracting the

antagonistic muscles and then relax. During contraction, the partner
 tries to resist any movement of the limb.

4. The partner then moves the limb further into the stretch until the stretch
sensation is felt.

5. Repeat the whole procedure for 4 to 5 times.

18.
PAWANMUKTASANA

Procedure

1. Lie on your back with your feet together and arms besides your body and 2+1+1=4
relax, breathing deeply.
2. With a deep inhalation raise your legs to 90° and completely exhale.

3. Now with another inhalation bring both the knees close to your chest and
press on the lower abdomen, holding the knees with your hands. Exhale
completely.
4. Remain with bent knees for a few breaths. With every exhalation press
the thighs and knees on the abdomen and hold them with your hands.
5. With a deep breath raise your head, neck and chest and bring them close
to your knees. If possible, bring your chin in between your knees. Ensure the
head moves less and the knees come closer to the face. That way the
pressure on the abdominal muscles will help in releasing the unwanted
gas/wind around the abdominal organs.
6. Remain in this posture for a few breaths focusing on maintaining the
position of the head and neck in place. With every exhalation press the
thighs closer and deeper into the chest and face deeper into the knees.
7. Try to maintain the balance while breathing slowly and keeping the body
relaxed.
8. Now with an inhalation, release the neck and head and exhale completely.
With another inhalation straighten the legs and bring them back to 90° and
as you exhale release the leg from 90° to the relaxed posture. With complete
exhalation, bring the legs stretched out on the floor and relax the neck.
9. Take a few breaths, and then continue with the next round. The longer
you hold in this posture the faster the muscles around the abdomen loosen.
Contraindications

To be avoided or performed under guidance by those suffering from

1. severe migraine
2. High or Low Blood Pressure
3. Asthma

4. slip disc

5. advanced stages of spondylitis

6. Girls/Women should avoid this asana or take the guidance of the teacher
while practicing it during the menstrual cycle.