MATLAB Programming Fundamentals - MathWorks
MATLAB Programming Fundamentals - MathWorks
Programming Fundamentals
R2021b
How to Contact MathWorks
Phone: 508-647-7000
Language
Syntax Basics
1
Continue Long Statements on Multiple Lines . . . . . . . . . . . . . . . . . . . 1-2
Program Components
2
MATLAB Operators and Special Characters . . . . . . . . . . . . . . . . . . . . 2-2
Arithmetic Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-2
Relational Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-2
Logical Operators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-2
Special Characters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-3
String and Character Formatting . . . . . . . . . . . . . . . . . . . . . . . . . . 2-16
v
Compatible Array Sizes for Basic Operations . . . . . . . . . . . . . . . . . . 2-25
Inputs with Compatible Sizes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-25
Inputs with Incompatible Sizes . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-27
Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-27
vi Contents
Fast Fourier Transform Example . . . . . . . . . . . . . . . . . . . . . . . . . . . 2-84
Numeric Classes
4
Integers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-2
Integer Classes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-2
Creating Integer Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-2
Arithmetic Operations on Integer Classes . . . . . . . . . . . . . . . . . . . . . 4-4
Largest and Smallest Values for Integer Classes . . . . . . . . . . . . . . . . 4-4
vii
Single Precision Math . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4-26
viii Contents
Why Does isempty("") Return 0? . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-61
Why Does Appending Strings Using Square Brackets Return Multiple
Strings? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6-62
ix
Line Plot with Durations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7-37
Scatter Plot with Dates and Durations . . . . . . . . . . . . . . . . . . . . . . 7-39
Plots that Support Dates and Durations . . . . . . . . . . . . . . . . . . . . . 7-40
Categorical Arrays
8
Create Categorical Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8-2
x Contents
Tables
9
Create Tables and Assign Data to Them . . . . . . . . . . . . . . . . . . . . . . . 9-2
Timetables
10
Create Timetables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10-2
xi
Retime and Synchronize Timetable Variables Using Different
Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10-14
Structures
11
Structure Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11-2
Create Scalar Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11-2
Access Values in Fields . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11-2
Index into Nonscalar Structure Array . . . . . . . . . . . . . . . . . . . . . . . 11-4
Cell Arrays
12
What Is a Cell Array? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12-2
xii Contents
Combine Cell Arrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12-10
Function Handles
13
Create Function Handle . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-2
What Is a Function Handle? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-2
Creating Function Handles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-2
Anonymous Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-3
Arrays of Function Handles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13-4
Saving and Loading Function Handles . . . . . . . . . . . . . . . . . . . . . . 13-4
Map Containers
14
Overview of Map Data Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-2
xiii
Modify Keys and Values in Map . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-13
Remove Keys and Values from Map . . . . . . . . . . . . . . . . . . . . . . . . 14-13
Modify Values . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-13
Modify Keys . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-14
Modify Copy of Map . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14-14
Using Objects
16
Object Behavior . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16-2
Two Copy Behaviors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16-2
Handle Object Copy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16-2
Value Object Copy Behavior . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16-2
Handle Object Copy Behavior . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16-3
Testing for Handle or Value Class . . . . . . . . . . . . . . . . . . . . . . . . . . 16-5
xiv Contents
Defining Your Own Classes
17
Scripts
18
Create Scripts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18-2
xv
Modify Figures in Live Scripts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-12
Explore Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-12
Update Code with Figure Changes . . . . . . . . . . . . . . . . . . . . . . . . 19-14
Add Formatting and Annotations . . . . . . . . . . . . . . . . . . . . . . . . . 19-14
Add and Modify Multiple Subplots . . . . . . . . . . . . . . . . . . . . . . . . 19-16
Save and Print Figure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-20
xvi Contents
Create Examples Using the Live Editor . . . . . . . . . . . . . . . . . . . . . . 19-84
Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19-89
Function Basics
20
Create Functions in Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-2
Syntax for Function Definition . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-2
Contents of Functions and Files . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-3
End Statements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-4
xvii
Sharing Variables Between Parent and Nested Functions . . . . . . . 20-28
Using Handles to Store Function Parameters . . . . . . . . . . . . . . . . 20-29
Visibility of Nested Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20-31
Function Arguments
21
Find Number of Function Arguments . . . . . . . . . . . . . . . . . . . . . . . . 21-2
xviii Contents
Parse Function Inputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21-13
xix
HTML Markup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-18
LaTeX Markup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23-19
Check Code for Errors and Warnings Using the Code Analyzer . . . 24-5
Enable Continuous Code Checking . . . . . . . . . . . . . . . . . . . . . . . . . 24-5
View Code Analyzer Status for File . . . . . . . . . . . . . . . . . . . . . . . . . 24-5
View Code Analyzer Messages . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-6
Fix Problems in Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24-7
Create a Code Analyzer Message Report . . . . . . . . . . . . . . . . . . . . . 24-8
Adjust Code Analyzer Message Indicators and Messages . . . . . . . . 24-9
Understand Code Containing Suppressed Messages . . . . . . . . . . . 24-11
Understand the Limitations of Code Analysis . . . . . . . . . . . . . . . . 24-12
Enable MATLAB Compiler Deployment Messages . . . . . . . . . . . . . 24-14
xx Contents
Change Code Based on Code Analyzer Messages . . . . . . . . . . . . . 24-30
Other Ways to Access Code Analyzer Messages . . . . . . . . . . . . . . 24-30
Programming Utilities
25
Identify Program Dependencies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-2
Simple Display of Program File Dependencies . . . . . . . . . . . . . . . . 25-2
Detailed Display of Program File Dependencies . . . . . . . . . . . . . . . 25-2
Dependencies Within a Folder . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25-2
xxi
Order of Argument Validation . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-16
Avoiding Class and Size Conversions . . . . . . . . . . . . . . . . . . . . . . 26-17
nargin in Argument Validation . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-19
Restrictions on Variable and Function Access . . . . . . . . . . . . . . . . 26-20
Debugging Arguments Blocks . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26-21
Software Development
Error Handling
27
Exception Handling in a MATLAB Application . . . . . . . . . . . . . . . . . 27-2
Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-2
Getting an Exception at the Command Line . . . . . . . . . . . . . . . . . . 27-2
Getting an Exception in Your Program Code . . . . . . . . . . . . . . . . . . 27-3
Generating a New Exception . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-3
xxii Contents
Issue Warnings and Errors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-13
Issue Warnings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-13
Throw Errors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27-13
Add Run-Time Parameters to Your Warnings and Errors . . . . . . . . 27-14
Add Identifiers to Warnings and Errors . . . . . . . . . . . . . . . . . . . . . 27-14
Program Scheduling
28
Schedule Command Execution Using Timer . . . . . . . . . . . . . . . . . . . 28-2
Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28-2
Example: Displaying a Message . . . . . . . . . . . . . . . . . . . . . . . . . . . 28-2
Performance
29
Measure the Performance of Your Code . . . . . . . . . . . . . . . . . . . . . . 29-2
Overview of Performance Timing Functions . . . . . . . . . . . . . . . . . . 29-2
Time Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-2
Time Portions of Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-2
The cputime Function vs. tic/toc and timeit . . . . . . . . . . . . . . . . . . . 29-2
Tips for Measuring Performance . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-3
xxiii
Profile Multiple Statements in Command Window . . . . . . . . . . . . . 29-10
Profile an App . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-11
Preallocation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-16
Preallocating a Nondouble Matrix . . . . . . . . . . . . . . . . . . . . . . . . 29-16
Vectorization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-18
Using Vectorization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-18
Array Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-19
Logical Array Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-20
Matrix Operations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29-21
Ordering, Setting, and Counting Operations . . . . . . . . . . . . . . . . . 29-22
Functions Commonly Used in Vectorization . . . . . . . . . . . . . . . . . 29-23
Background Processing
30
Asynchronous Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-2
Asynchronous Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-2
Background Workers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30-4
xxiv Contents
Memory Usage
31
Strategies for Efficient Use of Memory . . . . . . . . . . . . . . . . . . . . . . . 31-2
Use Appropriate Data Storage . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-2
Avoid Temporary Copies of Data . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-3
Reclaim Used Memory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31-4
xxv
Elements of the demos.xml File . . . . . . . . . . . . . . . . . . . . . . . . . . 32-30
Projects
33
Create Projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-2
What Are Projects? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-2
Create Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-2
Open Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-2
Set up Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-3
Add Files to Project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-5
Other Ways to Create Projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-6
xxvi Contents
Upgrade Projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-30
Run Upgrade Project Tool . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33-30
Examine Upgrade Project Report . . . . . . . . . . . . . . . . . . . . . . . . . 33-31
xxvii
Set Up SVN Source Control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-14
SVN Source Control Options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-14
Register Binary Files with SVN . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-14
Standard Repository Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-17
Tag Versions of Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-17
Enforce Locking Files Before Editing . . . . . . . . . . . . . . . . . . . . . . 34-17
Share a Subversion Repository . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-18
xxviii Contents
Integration with SVN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34-41
Integration with Other Source Control Tools . . . . . . . . . . . . . . . . . 34-42
Unit Testing
35
Write Test Using Live Script . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-3
xxix
Write Function-Based Unit Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-20
Create Test Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-20
Run the Tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-22
Analyze the Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-23
xxx Contents
Define Parameters at Suite Creation Time . . . . . . . . . . . . . . . . . . . 35-82
xxxi
Write Test for App . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-155
Write Test That Uses App Testing and Mocking Frameworks . . . 35-159
Create App . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-159
Test App With Manual Intervention . . . . . . . . . . . . . . . . . . . . . . . 35-160
Create Fully Automated Test . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-161
xxxii Contents
GitHub Actions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-213
Jenkins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-214
Travis CI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-214
Other Platforms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35-214
xxxiii
Hide Inactive Properties . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36-26
Specify Inactive Property . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36-26
Complete Class Definition File with Inactive Properties Method . . . . . . 36-26
xxxiv Contents
Analyze System Object Code . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36-58
View and Navigate System object Code . . . . . . . . . . . . . . . . . . . . . . . . 36-58
Example: Go to StepImpl Method Using Analyzer . . . . . . . . . . . . . . . . . 36-58
Create New System Objects for File Input and Output . . . . . . . . . . . . . 36-69
xxxv
Language
37
1
Syntax Basics
The start and end quotation marks for a character vector must appear on the same line. For example,
this code returns an error, because each line contains only one quotation mark:
x = [1.23...
4.56];
is the same as
x = [1.23 4.56];
1-2
Name=Value in Function Calls
Use the name=value syntax to help identify name-value arguments for functions and to clearly
distinguish names from values in lists of name-value arguments.
Most functions and methods support both syntaxes, but there are some limitations on where and how
the name=value syntax can be used:
• Mixing name,value and name=value syntaxes: The recommended practice is to use only one
syntax in any given function call. However, if you do mix name=value and name,value syntaxes
in a single call, all name=value arguments must appear after the name,value arguments. For
example, plot(x,y,"Color","red",LineWidth=2) is a valid combination, but
plot(x,y,Color="red","LineWidth",2) errors.
• Using positional arguments after name-value arguments: Some functions have positional
arguments that appear after name-value arguments. For example, this call to the verifyEqual
method uses the RelTol name-value argument, followed by a string input:
verifyEqual(testCase,1.5,2,"RelTol",0.1,...
"Difference exceeds relative tolerance.")
Using the name=value syntax (RelTol=0.1) causes the statement to error. In cases where a
positional argument follows name-value arguments, use the name,value syntax.
• Names that are invalid variable names: Name-value arguments with names that are invalid
MATLAB variable names cannot be used with the name=value syntax. See “Variable Names” on
page 1-5 for more info. For example, a name-value argument like "allow-empty",true errors
if passed as allow-empty=true. Use the name,value syntax in these cases.
Function authors do not need to code differently to support both the name,value and name=value
syntaxes. For information on authoring functions that accept name-value arguments, see “Name-Value
Arguments” on page 26-10.
1-3
1 Syntax Basics
helpFile = which('help');
[helpPath,name,ext] = fileparts(helpFile);
The current workspace now contains three variables from fileparts: helpPath, name, and ext. In
this case, the variables are small. However, some functions return results that use much more
memory. If you do not need those variables, they waste space on your system.
If you do not use the tilde operator, you can request only the first N outputs of a function (where N is
less than or equal to the number of possible outputs) and ignore any remaining outputs. For example,
request only the first output, ignoring the second and third.
helpPath = fileparts(helpFile);
If you request more than one output, enclose the variable names in square brackets, []. The
following code ignores the output argument ext.
[helpPath,name] = fileparts(helpFile);
To ignore function outputs in any position in the argument list, use the tilde operator. For example,
ignore the first output using a tilde.
[~,name,ext] = fileparts(helpFile);
You can ignore any number of function outputs using the tilde operator. Separate consecutive tildes
with a comma. For example, this code ignores the first two output arguments.
[~,~,ext] = fileparts(helpFile);
See Also
More About
• “Ignore Inputs in Function Definitions” on page 21-10
1-4
Variable Names
Variable Names
In this section...
“Valid Names” on page 1-5
“Conflicts with Function Names” on page 1-5
Valid Names
A valid variable name starts with a letter, followed by letters, digits, or underscores. MATLAB is case
sensitive, so A and a are not the same variable. The maximum length of a variable name is the value
that the namelengthmax command returns.
You cannot define variables with the same names as MATLAB keywords, such as if or end. For a
complete list, run the iskeyword command.
Check whether a proposed name is already in use with the exist or which function. exist returns
0 if there are no existing variables, functions, or other artifacts with the proposed name. For example:
exist checkname
ans =
0
If you inadvertently create a variable with a name conflict, remove the variable from memory with the
clear function.
Another potential source of name conflicts occurs when you define a function that calls load or eval
(or similar functions) to add variables to the workspace. In some cases, load or eval add variables
that have the same names as functions. Unless these variables are in the function workspace before
the call to load or eval, the MATLAB parser interprets the variable names as function names. For
more information, see:
See Also
clear | exist | iskeyword | namelengthmax | which | isvarname
1-5
1 Syntax Basics
In MATLAB code, use an exact match with regard to case for variables, files, and functions. For
example, if you have a variable, a, you cannot refer to that variable as A. It is a best practice to use
lowercase only when naming functions. This is especially useful when you use both Microsoft®
Windows® and UNIX®1 platforms because their file systems behave differently with regard to case.
When you use the help function, the help displays some function names in all uppercase, for
example, PLOT, solely to distinguish the function name from the rest of the text. Some functions for
interfacing to Oracle® Java® software do use mixed case and the command-line help and the
documentation accurately reflect that.
Spaces
Blank spaces around operators such as -, :, and ( ), are optional, but they can improve readability.
For example, MATLAB interprets the following statements the same way.
y = sin (3 * pi) / 2
y=sin(3*pi)/2
However, blank spaces act as delimiters in horizontal concatenation. When defining row vectors, you
can use spaces and commas interchangeably to separate elements:
A = [1, 0 2, 3 3]
A =
1 0 2 3 3
Because of this flexibility, check to ensure that MATLAB stores the correct values. For example, the
statement [1 sin (pi) 3] produces a much different result than [1 sin(pi) 3] does.
[1 sin (pi) 3]
[1 sin(pi) 3]
ans =
1. UNIX is a registered trademark of The Open Group in the United States and other countries.
1-6
Choose Command Syntax or Function Syntax
For introductory information on calling functions, see “Calling Functions”. For information related to
defining functions, see “Create Functions in Files” on page 20-2.
In function syntax, inputs can be data, variables, and even MATLAB expressions. If an input is data,
such as the numeric value 2 or the string array ["a" "b" "c"], MATLAB passes it to the function
as-is. If an input is a variable MATLAB will pass the value assigned to it. If an input is an expression,
like 2+2 or sin(2*pi), MATLAB evaluates it first, and passes the result to the function. If the
functions has outputs, you can assign them to variables as shown in the example syntax above.
Command syntax is simpler but more limited. To use it, separate inputs with spaces rather than
commas, and do not enclose them in parentheses.
functionName input1 ... inputN
With command syntax, MATLAB passes all inputs as character vectors (that is, as if they were
enclosed in single quotation marks) and does not assign outputs to variables. To pass a data type
other than a character vector, use the function syntax. To pass a value that contains a space, you have
two options. One is to use function syntax. The other is to put single quotes around the value.
Otherwise, MATLAB treats the space as splitting your value into multiple inputs.
If a value is assigned to a variable, you must use function syntax to pass the value to the function.
Command syntax always passes inputs as character vectors and cannot pass variable values. For
example, create a variable and call the disp function with function syntax to pass the value of the
variable:
A = 123;
disp(A)
You cannot use command syntax to pass the value of A, because this call
disp A
is equivalent to
1-7
1 Syntax Basics
disp('A')
and returns
filename = 'accounts.txt';
A = int8(1:8);
B = A;
or
Some functions expect character vectors for variable names, such as save, load, clear, and whos.
For example,
requests information about variable X in the example file durer.mat. This command is equivalent to
whos('-file','durer.mat','X')
ls ./d
This could be a call to the ls function with './d' as its argument. It also could represent element-
wise division on the array ls, using the variable d as the divisor.
1-8
Choose Command Syntax or Function Syntax
If you issue this statement at the command line, MATLAB can access the current workspace and path
to determine whether ls and d are functions or variables. However, some components, such as the
Code Analyzer and the Editor/Debugger, operate without reference to the path or workspace. When
you are using those components, MATLAB uses syntactic rules to determine whether an expression is
a function call using command syntax.
In general, when MATLAB recognizes an identifier (which might name a function or a variable), it
analyzes the characters that follow the identifier to determine the type of expression, as follows:
ls =d
• An open parenthesis after an identifier implies a function call. For example:
ls('./d')
• Space after an identifier, but not after a potential operator, implies a function call using command
syntax. For example:
ls ./d
• Spaces on both sides of a potential operator, or no spaces on either side of the operator, imply an
operation on variables. For example, these statements are equivalent:
ls ./ d
ls./d
Therefore, MATLAB treats the potentially ambiguous statement ls ./d as a call to the ls function
using command syntax.
The best practice is to avoid defining variable names that conflict with common functions, to prevent
any ambiguity.
See Also
“Calling Functions” | “Create Functions in Files” on page 20-2
1-9
1 Syntax Basics
Issue
You may encounter the following error message, or something similar, while working with functions
or variables in MATLAB:
These errors usually indicate that MATLAB cannot find a particular variable or MATLAB program file
in the current directory or on the search path.
Possible Solutions
Verify Spelling of Function or Variable Name
One of the most common causes is misspelling the function or variable name. Especially with longer
names or names containing similar characters (such as the letter l and numeral one), it is easy to
make mistakes and hard to detect them.
Often, when you misspell a MATLAB function, a suggested function name appears in the Command
Window. For example, this command fails because it includes an uppercase letter in the function
name:
accumArray
When this happens, press Enter to execute the suggested command or Esc to dismiss it.
Object methods are typically called using function syntax: for instance method(object,inputs).
Alternatively, they can be called using dot notation: for instance object.method(inputs). One
common error is to mix these syntaxes. For instance, you might call the method using function syntax,
but to provide inputs following dot notation syntax and leave out the object as an input: for instance,
method(inputs). To avoid this, when calling an object method, make sure you specify the object
first, either through the first input of function syntax or through the first identifier of dot notation.
When you write a function, you establish its name when you write its function definition line. This
name should always match the name of the file you save it to. For example, if you create a function
named curveplot,
then you should name the file containing that function curveplot.m. If you create a pcode file for
the function, then name that file curveplot.p. In the case of conflicting function and file names, the
file name overrides the name given to the function. In this example, if you save the curveplot
1-10
Resolve Error: Undefined Function or Variable
function to a file named curveplotfunction.m, then attempts to invoke the function using the
function name will fail:
curveplot
Undefined function or variable 'curveplot'.
If you encounter this problem, change either the function name or file name so that they are the
same.
To Locate the file that defines this function, use the MATLAB Find Files utility as follows:
1
On the Home tab, in the File section, click Find Files.
2 Under Find files named, enter *.m
3 Under Find files containing text, enter the function name.
4 Click the Find button
If you are unable to use a built-in function from MATLAB or its toolboxes, make sure that the function
is installed and is the correct version.
If you do not know which toolbox contains the function you need, search for the function
documentation at https://www.mathworks.com/help. The toolbox name appears at the top of the
function reference page. Alternatively, for steps to identify toolboxes that a function depends on, see
“Identify Program Dependencies” on page 25-2.
Once you know which toolbox the function belongs to, use the ver function to see which toolboxes
are installed on the system from which you run MATLAB. The ver function displays a list of all
currently installed MathWorks® products. If you can locate the toolbox you need in the output
displayed by ver, then the toolbox is installed. If you cannot, you need to install it in order to use it.
For help with installing MathWorks products, see “Install License Manager on License Server”.
1-11
1 Syntax Basics
Tip If you have a custom file path, this step will delete it.
The MATLAB search path is a subset of all the folders in the file system. MATLAB uses the search
path to locate files used with MathWorks products efficiently. For more information, see “What Is the
MATLAB Search Path?”.
If the function you are attempting to use is part of a toolbox, then verify that the toolbox is available
using ver.
Because MATLAB stores the toolbox information in a cache file, you need to first update this cache
and then reset the path.
1
On the Home tab, in the Environment section, click Preferences.
A small dialog box opens warning that you will lose your current path settings if you proceed.
Select Yes if you decide to proceed.
Run ver to see if the toolbox is installed. If not, you may need to reinstall this toolbox to use this
function. For more information about installing a toolbox, see How do I install additional toolboxes
into an existing installation of MATLAB.
Once ver shows your toolbox, run the following command to see if you can find the function:
replacing <functionname> with the name of the function. If MATLAB finds your function file, it
presents you with the path to it. You can add that file to the path using the addpath function. If it
does not, make sure the necessary toolbox is installed, and that it is the correct version.
If you are unable to use a built-in function from a MATLAB toolbox and have confirmed that the
toolbox is installed, make sure that you have an active license for that toolbox. Use license to
display currently active licenses. For additional support for managing licenses, see “Manage Your
Licenses”.
1-12
2
Program Components
Arithmetic Operators
Symbol Role More Information
+ Addition plus
+ Unary plus uplus
- Subtraction minus
- Unary minus uminus
.* Element-wise multiplication times
* Matrix multiplication mtimes
./ Element-wise right division rdivide
/ Matrix right division mrdivide
.\ Element-wise left division ldivide
\ Matrix left division mldivide
Relational Operators
Symbol Role More Information
== Equal to eq
~= Not equal to ne
> Greater than gt
>= Greater than or equal to ge
< Less than lt
<= Less than or equal to le
Logical Operators
Symbol Role More Information
& Find logical AND and
| Find logical OR or
&& Find logical AND (with short- Logical Operators: Short-
circuiting) Circuit && ||
2-2
MATLAB Operators and Special Characters
Special Characters
@ Name: At symbol
Uses:
Description: The @ symbol forms a handle to either the named function that follows the @
sign, or to the anonymous function that follows the @ sign. You can also use @ to call
superclass methods from subclasses.
Examples
fhandle = @myfun
disp@MySuper(obj)
Call the superclass constructor from a subclass using the object being constructed:
obj = obj@MySuper(arg1,arg2,...)
More Information:
2-3
2 Program Components
Uses:
• Decimal point
• Element-wise operations
• Structure field access
• Object property or method specifier
Description: The period character separates the integral and fractional parts of a
number, such as 3.1415. MATLAB operators that contain a period always work element-
wise. The period character also enables you to access the fields in a structure, as well as
the properties and methods of an object.
Examples
Decimal point:
102.5543
Element-wise operations:
A.*B
A.^2
myStruct.f1
myObj.PropertyName
More Information
2-4
MATLAB Operators and Special Characters
Description: Three or more periods at the end of a line continues the current command
on the next line. If three or more periods occur before the end of a line, then MATLAB
ignores the rest of the line and continues to the next line. This effectively makes a
comment out of anything on the current line that follows the three periods.
Examples
Break a character vector up on multiple lines and concatenate the lines together:
To comment out one line in a multiline command, use ... at the beginning of the line to
ensure that the command remains complete. If you use % to comment out a line it
produces an error:
y = 1 +...
2 +...
% 3 +...
4;
However, this code runs properly since the third line does not produce a gap in the
command:
y = 1 +...
2 +...
... 3 +...
4;
More Information
2-5
2 Program Components
, Name: Comma
Uses: Separator
Examples
A = [12,13; 14,15]
Separate subscripts:
A(1,2)
[Y,I] = max(A,[],2)
More Information
• horzcat
2-6
MATLAB Operators and Special Characters
: Name: Colon
Uses:
• Vector creation
• Indexing
• For-loop iteration
Description: Use the colon operator to create regularly spaced vectors, index into
arrays, and define the bounds of a for loop.
Examples
Create a vector:
x = 1:10
x = 1:3:19
A(:)
A = rand(3,4);
A(:) = 1:12;
A(2:5,3)
A(:,3)
x = 1;
for k = 1:25
x = x + x^2;
end
More Information
• colon
• “Creating, Concatenating, and Expanding Matrices”
2-7
2 Program Components
; Name: Semicolon
Uses:
Examples
A = [12,13; 14,15]
Y = max(A);
More Information
• vertcat
2-8
MATLAB Operators and Special Characters
( ) Name: Parentheses
Uses:
• Operator precedence
• Function argument enclosure
• Indexing
Examples
Precedence of operations:
(A.*(B./C)) - D
plot(X,Y,'r*')
C = union(A,B)
Indexing:
A(3,:)
A(1,2)
A(1:5,1)
More Information
2-9
2 Program Components
Uses:
• Array construction
• Array concatenation
• Empty matrix and array element deletion
• Multiple output argument assignment
Examples
X = [10 12 -3]
A = rand(3);
A = [A; 10 20 30]
A = []
A(:,1) = []
[C,iA,iB] = union(A,B)
More Information
2-10
MATLAB Operators and Special Characters
Description: Use curly braces to construct a cell array, or to access the contents of a
particular cell in a cell array.
Examples
To construct a cell array, enclose all elements of the array in curly braces:
Index to a specific cell array element by enclosing all indices in curly braces:
A = C{4,7,2}
More Information
• “Cell Arrays”
% Name: Percent
Uses:
• Comment
• Conversion specifier
Description: The percent sign is most commonly used to indicate nonexecutable text
within the body of a program. This text is normally used to include comments in your
code.
Two percent signs, %%, serve as a cell delimiter as described in “Create and Run Sections
in Code” on page 18-5.
Examples
More Information
2-11
2 Program Components
Description: The %{ and %} symbols enclose a block of comments that extend beyond
one line.
Note With the exception of whitespace characters, the %{ and %} operators must appear
alone on the lines that immediately precede and follow the block of help text. Do not
include any other text on these lines.
Examples
Enclose any multiline comments with percent followed by an opening or closing brace:
%{
The purpose of this routine is to compute
the value of ...
%}
More Information
Description: The exclamation point precedes operating system commands that you want
to execute from within MATLAB.
Examples
The exclamation point initiates a shell escape function. Such a function is to be performed
directly by the operating system:
!rmdir oldtests
More Information
2-12
MATLAB Operators and Special Characters
Description: The question mark retrieves the meta.class object for a particular class
name. The ? operator works only with a class name, not an object.
Examples
?inputParser
More Information
• metaclass
'' Name: Single quotes
Description: Use single quotes to create character vectors that have class char.
Examples
More Information
Description: Use double quotes to create string scalars that have class string.
Examples
S = "Hello, world"
More Information
2-13
2 Program Components
Uses: Separator
Description: Use the space character to separate row elements in an array constructor,
or the values returned by a function. In these contexts, the space character and comma
are equivalent.
Examples
Uses: Separator
Examples
2-14
MATLAB Operators and Special Characters
~ Name: Tilde
Uses:
• Logical NOT
• Argument placeholder
Description: Use the tilde symbol to represent logical NOT or to suppress specific input
or output arguments.
Examples
A = eye(3);
~A
A = [1 -1; 0 1]
B = [1 -2; 3 2]
A~=B
[~,~,iB] = union(A,B)
More Information
• not
• “Ignore Inputs in Function Definitions” on page 21-10
• “Ignore Function Outputs” on page 1-4
= Name: Equal sign
Uses: Assignment
Description: Use the equal sign to assign values to a variable. The syntax B = A stores
the elements of A in variable B.
Note The = character is for assignment, whereas the == character is for comparing the
elements in two arrays. See eq for more information.
Examples
Create a matrix A. Assign the values in A to a new variable, B. Lastly, assign a new value
to the first element in B.
A = [1 0; -1 0];
B = A;
B(1) = 200;
2-15
2 Program Components
Examples
More Information:
• “Subclass Syntax”
.? Name: Dot question mark
Description:
When using function argument validation, you can define the fields of the name-value
structure as the names of all writeable properties of the class.
Examples
Specify the field names of the propArgs structure as the writeable properties of the
matlab.graphics.primitive.Line class.
function f(propArgs)
arguments
propArgs.?matlab.graphics.primitive.Line
end
% Function code
...
end
More Information:
Use the special characters in this table to specify a folder path using a character vector or string.
2-16
MATLAB Operators and Special Characters
Description: In addition to their use as mathematical operators, the slash and backslash
characters separate the elements of a path or folder. On Microsoft Windows based
systems, both slash and backslash have the same effect. On The Open Group UNIX based
systems, you must use slash only.
Examples
dir([matlabroot '\toolbox\matlab\elmat\shiftdim.m'])
dir([matlabroot '/toolbox/matlab/elmat/shiftdim.m'])
dir([matlabroot '/toolbox/matlab/elmat/shiftdim.m'])
.. Name: Dot dot
Description: Two dots in succession refers to the parent of the current folder. Use this
character to specify folder paths relative to the current folder.
Examples
To go up two levels in the folder tree and down into the test folder, use:
cd ..\..\test
More Information
• cd
* Name: Asterisk
Description: In addition to being the symbol for matrix multiplication, the asterisk * is
used as a wildcard character.
Wildcards are generally used in file operations that act on multiple files or folders.
MATLAB matches all characters in the name exactly except for the wildcard character *,
which can match any one or more characters.
Examples
Locate all files with names that start with january_ and have a .mat file extension:
dir('january_*.mat')
2-17
2 Program Components
@ Name: At symbol
Examples
\@myClass\get.m
More Information
Examples
+mypack
+mypack/pkfcn.m % a package function
+mypack/@myClass % class folder in a package
More Information
There are certain special characters that you cannot enter as ordinary text. Instead, you must use
unique character sequences to represent them. Use the symbols in this table to format strings and
character vectors on their own or in conjunction with formatting functions like compose, sprintf,
and error. For more information, see “Formatting Text” on page 6-24.
2-18
MATLAB Operators and Special Characters
See Also
More About
• “Array vs. Matrix Operations” on page 2-20
• “Array Comparison with Relational Operators” on page 2-29
• “Compatible Array Sizes for Basic Operations” on page 2-25
• “Operator Precedence” on page 2-32
• “Find Array Elements That Meet a Condition” on page 5-2
• “Greek Letters and Special Characters in Chart Text”
2-19
2 Program Components
Introduction
MATLAB has two different types of arithmetic operations: array operations and matrix operations.
You can use these arithmetic operations to perform numeric computations, for example, adding two
numbers, raising the elements of an array to a given power, or multiplying two matrices.
Matrix operations follow the rules of linear algebra. By contrast, array operations execute element by
element operations and support multidimensional arrays. The period character (.) distinguishes the
array operations from the matrix operations. However, since the matrix and array operations are the
same for addition and subtraction, the character pairs .+ and .- are unnecessary.
Array Operations
Array operations execute element by element operations on corresponding elements of vectors,
matrices, and multidimensional arrays. If the operands have the same size, then each element in the
first operand gets matched up with the element in the same location in the second operand. If the
operands have compatible sizes, then each input is implicitly expanded as needed to match the size of
the other. For more information, see “Compatible Array Sizes for Basic Operations” on page 2-25.
As a simple example, you can add two vectors with the same size.
A = [1 1 1]
A =
1 1 1
B = [1 2 3]
B =
1 2 3
A+B
ans =
2 3 4
If one operand is a scalar and the other is not, then MATLAB implicitly expands the scalar to be the
same size as the other operand. For example, you can compute the element-wise product of a scalar
and a matrix.
A = [1 2 3; 1 2 3]
A =
2-20
Array vs. Matrix Operations
1 2 3
1 2 3
3.*A
ans =
3 6 9
3 6 9
Implicit expansion also works if you subtract a 1-by-3 vector from a 3-by-3 matrix because the two
sizes are compatible. When you perform the subtraction, the vector is implicitly expanded to become
a 3-by-3 matrix.
A = [1 1 1; 2 2 2; 3 3 3]
A =
1 1 1
2 2 2
3 3 3
m = [2 4 6]
m =
2 4 6
A - m
ans =
-1 -3 -5
0 -2 -4
1 -1 -3
A row vector and a column vector have compatible sizes. If you add a 1-by-3 vector to a 2-by-1 vector,
then each vector implicitly expands into a 2-by-3 matrix before MATLAB executes the element-wise
addition.
x = [1 2 3]
x =
1 2 3
y = [10; 15]
y =
10
15
x + y
ans =
11 12 13
16 17 18
2-21
2 Program Components
If the sizes of the two operands are incompatible, then you get an error.
A = [8 1 6; 3 5 7; 4 9 2]
A =
8 1 6
3 5 7
4 9 2
m = [2 4]
m =
2 4
A - m
The following table provides a summary of arithmetic array operators in MATLAB. For function-
specific information, click the link to the function reference page in the last column.
Matrix Operations
Matrix operations follow the rules of linear algebra and are not compatible with multidimensional
arrays. The required size and shape of the inputs in relation to one another depends on the operation.
For nonscalar inputs, the matrix operators generally calculate different answers than their array
operator counterparts.
For example, if you use the matrix right division operator, /, to divide two matrices, the matrices
must have the same number of columns. But if you use the matrix multiplication operator, *, to
multiply two matrices, then the matrices must have a common inner dimension. That is, the number
of columns in the first input must be equal to the number of rows in the second input. The matrix
multiplication operator calculates the product of two matrices with the formula,
2-22
Array vs. Matrix Operations
n
C(i, j) = ∑ A(i, k)B(k, j) .
k=1
A = [1 3;2 4]
A =
1 3
2 4
B = [3 0;1 5]
B =
3 0
1 5
A*B
ans =
6 15
10 20
The previous matrix product is not equal to the following element-wise product.
A.*B
ans =
3 0
2 20
The following table provides a summary of matrix arithmetic operators in MATLAB. For function-
specific information, click the link to the function reference page in the last column.
2-23
2 Program Components
See Also
More About
• “Compatible Array Sizes for Basic Operations” on page 2-25
• “MATLAB Operators and Special Characters” on page 2-2
• “Operator Precedence” on page 2-32
2-24
Compatible Array Sizes for Basic Operations
These are some combinations of scalars, vectors, and matrices that have compatible sizes:
• One input is a matrix, and the other is a column vector with the same number of rows.
2-25
2 Program Components
Multidimensional Arrays
Every array in MATLAB has trailing dimensions of size 1. For multidimensional arrays, this means
that a 3-by-4 matrix is the same as a matrix of size 3-by-4-by-1-by-1-by-1. Examples of
multidimensional arrays with compatible sizes are:
• One input is a matrix, and the other is a 3-D array with the same number of rows and columns.
• One input is a matrix, and the other is a 3-D array. The dimensions are all either the same or one
of them is 1.
Empty Arrays
The rules are the same for empty arrays or arrays that have a dimension size of zero. The size of the
dimension that is not equal to 1 determines the size of the output. This means that dimensions with a
2-26
Compatible Array Sizes for Basic Operations
size of zero must be paired with a dimension of size 1 or 0 in the other array, and that the output has
a dimension size of 0.
A: 1-by-0
B: 3-by-1
Result: 3-by-0
A: 3-by-2
B: 4-by-2
• Two nonscalar row vectors with lengths that are not the same.
A: 1-by-3
B: 1-by-4
Examples
Subtract Vector from Matrix
To simplify vector-matrix operations, use implicit expansion with dimensional functions such as sum,
mean, min, and others.
For example, calculate the mean value of each column in a matrix, then subtract the mean value from
each element.
A = magic(3)
A =
8 1 6
3 5 7
4 9 2
C = mean(A)
C =
5 5 5
A - C
ans =
3 -4 1
-2 0 2
-1 4 -3
Row and column vectors have compatible sizes, and when you perform an operation on them the
result is a matrix.
2-27
2 Program Components
For example, add a row and column vector. The result is the same as bsxfun(@plus,a,b).
a = [1 2 3 4]
ans =
1 2 3 4
b = [5; 6; 7]
ans =
5
6
7
a + b
ans =
6 7 8 9
7 8 9 10
8 9 10 11
See Also
bsxfun
More About
• “Array vs. Matrix Operations” on page 2-20
• “MATLAB Operators and Special Characters” on page 2-2
2-28
Array Comparison with Relational Operators
Relational operators compare operands quantitatively, using operators like “less than”, “greater
than”, and “not equal to.” The result of a relational comparison is a logical array indicating the
locations where the relation is true.
Array Comparison
Numeric Arrays
The relational operators perform element-wise comparisons between two arrays. The arrays must
have compatible sizes to facilitate the operation. Arrays with compatible sizes are implicitly expanded
to be the same size during execution of the calculation. In the simplest cases, the two operands are
arrays of the same size, or one is a scalar. For more information, see “Compatible Array Sizes for
Basic Operations” on page 2-25.
For example, if you compare two matrices of the same size, then the result is a logical matrix of the
same size with elements indicating where the relation is true.
A = [2 4 6; 8 10 12]
A =
2 4 6
8 10 12
B = [5 5 5; 9 9 9]
B =
5 5 5
9 9 9
A < B
ans =
2-29
2 Program Components
1 1 0
1 0 0
A > 7
ans =
0 0 0
1 1 1
If you compare a 1-by-N row vector to an M-by-1 column vector, then MATLAB expands each vector
into an M-by-N matrix before performing the comparison. The resulting matrix contains the
comparison result for each combination of elements in the vectors.
A = 1:3
A =
1 2 3
B = [2; 3]
B =
2
3
A >= B
ans =
0 1 1
0 0 1
Empty Arrays
The relational operators work with arrays for which any dimension has size zero, as long as both
arrays have compatible sizes. This means that if one array has a dimension size of zero, then the size
of the corresponding dimension in the other array must be 1 or zero, and the size of that dimension in
the output is zero.
A = ones(3,0);
B = ones(3,1);
A == B
ans =
A == []
return an error if A is not 0-by-0 or 1-by-1. This behavior is consistent with that of all other binary
operators, such as +, -, >, <, &, |, and so on.
2-30
Array Comparison with Relational Operators
Complex Numbers
• The operators >, <, >=, and <= use only the real part of the operands in performing comparisons.
• The operators == and ~= test both real and imaginary parts of the operands.
Logic Statements
Use relational operators in conjunction with the logical operators A & B (AND), A | B (OR),
xor(A,B) (XOR), and ~A (NOT), to string together more complex logical statements.
For example, you can locate where negative elements occur in two arrays.
A = [2 -1; -3 10]
A =
2 -1
-3 10
B = [0 -2; -3 -1]
B =
0 -2
-3 -1
ans =
0 1
1 0
For more examples, see “Find Array Elements That Meet a Condition” on page 5-2.
See Also
gt | lt | ge | le | eq | ne
More About
• “Array vs. Matrix Operations” on page 2-20
• “Compatible Array Sizes for Basic Operations” on page 2-25
• “MATLAB Operators and Special Characters” on page 2-2
2-31
2 Program Components
Operator Precedence
You can build expressions that use any combination of arithmetic, relational, and logical operators.
Precedence levels determine the order in which MATLAB evaluates an expression. Within each
precedence level, operators have equal precedence and are evaluated from left to right. The
precedence rules for MATLAB operators are shown in this list, ordered from highest precedence level
to lowest precedence level:
1 Parentheses ()
2 Transpose (.'), power (.^), complex conjugate transpose ('), matrix power (^)
3 Power with unary minus (.^-), unary plus (.^+), or logical negation (.^~) as well as matrix
power with unary minus (^-), unary plus (^+), or logical negation (^~).
Note Although most operators work from left to right, the operators (^-), (.^-), (^+), (.^+),
(^~), and (.^~) work from second from the right to left. It is recommended that you use
parentheses to explicitly specify the intended precedence of statements containing these
operator combinations.
4 Unary plus (+), unary minus (-), logical negation (~)
5 Multiplication (.*), right division (./), left division (.\), matrix multiplication (*), matrix
right division (/), matrix left division (\)
6 Addition (+), subtraction (-)
7 Colon operator (:)
8 Less than (<), less than or equal to (<=), greater than (>), greater than or equal to (>=),
equal to (==), not equal to (~=)
9 Element-wise AND (&)
10 Element-wise OR (|)
11 Short-circuit AND (&&)
12 Short-circuit OR (||)
The same precedence rule holds true for the && and || operators.
2-32
Operator Precedence
C = (A./B).^2
C =
2.2500 81.0000 1.0000
See Also
More About
• “Array vs. Matrix Operations” on page 2-20
• “Compatible Array Sizes for Basic Operations” on page 2-25
• “Array Comparison with Relational Operators” on page 2-29
• “MATLAB Operators and Special Characters” on page 2-2
2-33
2 Program Components
Use random points picked from the peaks function in the domain [ − 3, 3] × [ − 3, 3] as the data set.
Add a small amount of noise to the data.
xy = rand(10000,2)*6-3;
z = peaks(xy(:,1),xy(:,2)) + 0.5-rand(10000,1);
A = [xy z];
plot3(A(:,1), A(:,2), A(:,3), '.')
view(-28,32)
Find points that have similar x and y coordinates using uniquetol with these options:
• Specify ByRows as true, since the rows of A contain the point coordinates.
• Specify OutputAllIndices as true to return the indices for all points that are within tolerance
of each other.
• Specify DataScale as [1 1 Inf] to use an absolute tolerance for the x and y coordinates, while
ignoring the z-coordinate.
DS = [1 1 Inf];
[C,ia] = uniquetol(A, 0.3, 'ByRows', true, ...
'OutputAllIndices', true, 'DataScale', DS);
2-34
Average Similar Data Points Using a Tolerance
Average each group of points that are within tolerance (including the z-coordinates), producing a
reduced data set that still holds the general shape of the original data.
for k = 1:length(ia)
aveA(k,:) = mean(A(ia{k},:),1);
end
hold on
plot3(aveA(:,1), aveA(:,2), aveA(:,3), '.r', 'MarkerSize', 15)
See Also
uniquetol
More About
• “Group Scattered Data Using a Tolerance” on page 2-36
2-35
2 Program Components
Create a set of random 2-D points. Then create and plot a grid of equally spaced points on top of the
random data.
x = rand(10000,2);
[a,b] = meshgrid(0:0.1:1);
gridPoints = [a(:), b(:)];
plot(x(:,1), x(:,2), '.')
hold on
plot(gridPoints(:,1), gridPoints(:,2), 'xr', 'Markersize', 6)
Use ismembertol to locate the data points in x that are within tolerance of the grid points in
gridPoints. Use these options with ismembertol:
• Specify ByRows as true, since the point coordinates are in the rows of x.
• Specify OutputAllIndices as true to return all of the indices for rows in x that are within
tolerance of the corresponding row in gridPoints.
For each grid point, plot the points in x that are within tolerance of that grid point.
2-36
Group Scattered Data Using a Tolerance
figure
hold on
for k = 1:length(LocB)
plot(x(LocB{k},1), x(LocB{k},2), '.')
end
plot(gridPoints(:,1), gridPoints(:,2), 'xr', 'Markersize', 6)
See Also
ismembertol
More About
• “Average Similar Data Points Using a Tolerance” on page 2-34
2-37
2 Program Components
Bit-Wise Operations
This topic shows how to use bit-wise operations in MATLAB® to manipulate the bits of numbers.
Operating on bits is directly supported by most modern CPUs. In many cases, manipulating the bits of
a number in this way is quicker than performing arithmetic operations like division or multiplication.
Number Representations
Any number can be represented with bits (also known as binary digits). The binary, or base 2, form of
a number contains 1s and 0s to indicate which powers of 2 are present in the number. For example,
the 8-bit binary form of 7 is
00000111
A collection of 8 bits is also called 1 byte. In binary representations, the bits are counted from the
right to the left, so the first bit in this representation is a 1. This number represents 7 because
2 1 0
2 + 2 + 2 = 7.
When you type numbers into MATLAB, it assumes the numbers are double precision (a 64-bit binary
representation). However, you can also specify single-precision numbers (32-bit binary
representation) and integers (signed or unsigned, from 8 to 64 bits). For example, the most memory
efficient way to store the number 7 is with an 8-bit unsigned integer:
a = uint8(7)
a = uint8
7
You can even specify the binary form directly using the prefix 0b followed by the binary digits (for
more information, see “Hexadecimal and Binary Values” on page 6-55). MATLAB stores the number
in an integer format with the fewest number of bits. Instead of specifying all the bits, you need to
specify only the left-most 1 and all the digits to the right of it. The bits to the left of that bit are
trivially zero. So the number 7 is:
b = 0b111
b = uint8
7
MATLAB stores negative integers using two's complement. For example, consider the 8-bit signed
integer -8. To find the two's complement bit pattern for this number:
1 Start with the bit pattern of the positive version of the number, 8: 00001000.
2 Next, flip all of the bits: 11110111.
3 Finally, add 1 to the result: 11111000.
n = 0b11111000s8
n = int8
-8
2-38
Bit-Wise Operations
MATLAB does not natively display the binary format of numbers. For that, you can use the dec2bin
function, which returns a character vector of binary digits for positive integers. Again, this function
returns only the digits that are not trivially zero.
dec2bin(b)
ans =
'111'
You can use bin2dec to switch between the two formats. For example, you can convert the binary
digits 10110101 to decimal format with the commands
data = [1 0 1 1 0 1 0 1];
dec = bin2dec(num2str(data))
dec = 181
The cast and typecast functions are also useful to switch among different data types. These
functions are similar, but they differ in how they treat the underlying storage of the number:
Because MATLAB does not display the digits of a binary number directly, you must pay attention to
data types when you work with bit-wise operations. Some functions return binary digits as a
character vector (dec2bin), some return the decimal number (bitand), and others return a vector of
the bits themselves (bitget).
MATLAB has several functions that enable you to perform logical operations on the bits of two equal-
length binary representations of numbers, known as bit masking:
• bitand — If both digits are 1, then the resulting digit is also a 1. Otherwise, the resulting digit is
0.
• bitor — If either digit is 1, then the resulting digit is also a 1. Otherwise, the resulting digit is 0.
• bitxor — If the digits are different, then the resulting digit is a 1. Otherwise, the resulting digit
is 0.
In addition to these functions, the bit-wise complement is available with bitcmp, but this is a unary
operation that flips the bits in only one number at a time.
One use of bit masking is to query the status of a particular bit. For example, if you use a bit-wise
AND operation with the binary number 00001000, you can query the status of the fourth bit. You can
then shift that bit to the first position so that MATLAB returns a 0 or 1 (the next section describes bit
shifting in more detail).
n = 0b10111001;
n4 = bitand(n,0b1000);
n4 = bitshift(n4,-3)
n4 = uint8
1
Bit-wise operations can have surprising applications. For example, consider the 8-bit binary
representation of the number n = 8:
2-39
2 Program Components
00001000
8 is a power of 2, so its binary representation contains a single 1. Now consider the number
n − 1 = 7:
00000111
By subtracting 1, all of the bits starting at the right-most 1 are flipped. As a result, when n is a power
of 2, corresponding digits of n and n − 1 are always different, and the bit-wise AND returns zero.
n = 0b1000;
bitand(n,n-1)
ans = uint8
0
0
However, when n is not a power of 2, then the right-most 1 is for the 2 bit, so n and n − 1 have all
0
the same bits except for the 2 bit. For this case, the bit-wise AND returns a nonzero number.
n = 0b101;
bitand(n,n-1)
ans = uint8
4
This operation suggests a simple function that operates on the bits of a given input number to check
whether the number is a power of 2:
function tf = isPowerOfTwo(n)
tf = n && ~bitand(n,n-1);
end
The use of the short-circuit AND operator && checks to make sure that n is not zero. If it is, then the
function does not need to calculate bitand(n,n-1) to know that the correct answer is false.
Shifting Bits
Because bit-wise logical operations compare corresponding bits in two numbers, it is useful to be able
to move the bits around to change which bits are compared. You can use bitshift to perform this
operation:
• bitshift(A,N) shifts the bits of A to the left by N digits. This is equivalent to multiplying A by
N
2 .
• bitshift(A,-N) shifts the bits of A to the right by N digits. This is equivalent to dividing A by
N
2 .
These operations are sometimes written A<<N (left shift) and A>>N (right shift), but MATLAB does not
use << and >> operators for this purpose.
When the bits of a number are shifted, some bits fall off the end of the number, and 0s or 1s are
introduced to fill in the newly created space. When you shift bits to the left, the bits are filled in on
the right; when you shift bits to the right, the bits are filled in on the left.
For example, if you shift the bits of the number 8 (binary: 1000) to the right by one digit, you get 4
(binary: 100).
2-40
Bit-Wise Operations
n = 0b1000;
bitshift(n,-1)
ans = uint8
4
Similarly, if you shift the number 15 (binary: 1111) to the left by two digits, you get 60 (binary:
111100).
n = 0b1111;
bitshift(15,2)
ans = 60
When you shift the bits of a negative number, bitshift preserves the signed bit. For example, if you
shift the signed integer -3 (binary: 11111101) to the right by 2 digits, you get -1 (binary: 11111111).
In these cases, bitshift fills in on the left with 1s rather than 0s.
n = 0b11111101s8;
bitshift(n,-2)
ans = int8
-1
Writing Bits
You can use the bitset function to change the bits in a number. For example, change the first bit of
the number 8 to a 1 (which adds 1 to the number):
bitset(8,1)
ans = 9
By default, bitset flips bits to on or 1. You can optionally use the third input argument to specify the
bit value.
bitset does not change multiple bits at once, so you need to use a for loop to change multiple bits.
Therefore, the bits you change can be either consecutive or nonconsecutive. For example, change the
first two bits of the binary number 1000:
bits = [1 2];
c = 0b1000;
for k = 1:numel(bits)
c = bitset(c,bits(k));
end
dec2bin(c)
ans =
'1011'
Another common use of bitset is to convert a vector of binary digits into decimal format. For
example, use a loop to set the individual bits of the integer 11001101.
data = [1 1 0 0 1 1 0 1];
n = length(data);
dec = 0b0u8;
for k = 1:n
dec = bitset(dec,n+1-k,data(k));
2-41
2 Program Components
end
dec
dec = uint8
205
dec2bin(dec)
ans =
'11001101'
Another use of bit shifting is to isolate consecutive sections of bits. For example, read the last four
bits in the 16-bit number 0110000010100000. Recall that the last four bits are on the left of the
binary representation.
n = 0b0110000010100000;
dec2bin(bitshift(n,-12))
ans =
'110'
To isolate consecutive bits in the middle of the number, you can combine the use of bit shifting with
logical masking. For example, to extract the 13th and 14th bits, you can shift the bits to the right by
12 and then mask the resulting four bits with 0011. Because the inputs to bitand must be the same
integer data type, you can specify 0011 as an unsigned 16-bit integer with 0b11u16. Without the -
u16 suffix, MATLAB stores the number as an unsigned 8-bit integer.
m = 0b11u16;
dec2bin(bitand(bitshift(n,-12),m))
ans =
'10'
Another way to read consecutive bits is with bitget, which reads specified bits from a number. You
can use colon notation to specify several consecutive bits to read. For example, read the last 8 bits of
n.
bitget(n,16:-1:8)
0 1 1 0 0 0 0 0 1
You can also use bitget to read bits from a number when the bits are not next to each other. For
example, read the 5th, 8th, and 14th bits from n.
2-42
Bit-Wise Operations
1 1 0
See Also
bitand | bitor | bitxor | bitget | bitset | bitshift | bitcmp
More About
• “Integers” on page 4-2
• “Perform Cyclic Redundancy Check” on page 2-44
• “Hexadecimal and Binary Values” on page 6-55
2-43
2 Program Components
1101100111011010
To obtain the check value, divide this number by the polynomial x3 + x2 + x + 1. You can represent
this polynomial with its coefficients: 1111.
The division is performed in steps, and after each step the polynomial divisor is aligned with the left-
most 1 in the number. Because the result of dividing by the four term polynomial has three bits (in
general dividing by a polynomial of length n + 1 produces a check value of length n), append the
number with 000 to calculate the remainder. At each step, the result uses the bit-wise XOR of the four
bits being operated on, and all other bits are unchanged.
1101100111011010 000
1111
----------------
0010100111011010 000
Each successive division operates on the result of the previous step, so the second division is
0010100111011010 000
1111
----------------
0001010111011010 000
The division is completed once the dividend is all zeros. The complete division, including the above
two steps, is
1101100111011010 000
1111
0010100111011010 000
1111
0001010111011010 000
1111
0000101111011010 000
1111
0000010011011010 000
1111
0000001101011010 000
1111
0000000010011010 000
1111
0000000001101010 000
1111
2-44
Perform Cyclic Redundancy Check
0000000000010010 000
1111
0000000000001100 000
1111
0000000000000011 000
11 11
0000000000000000 110
The remainder bits, 110, are the check value for this message.
In MATLAB®, you can perform this same operation to obtain the check value using bit-wise
operations. First, define variables for the message and polynomial divisor. Use unsigned 32-bit
integers so that extra bits are available for the remainder.
message = 0b1101100111011010u32;
messageLength = 16;
divisor = 0b1111u32;
divisorDegree = 3;
Next, initialize the polynomial divisor. Use dec2bin to display the bits of the result.
divisor = bitshift(divisor,messageLength-divisorDegree-1);
dec2bin(divisor)
ans =
'1111000000000000'
Now, shift the divisor and message so that they have the correct number of bits (16 bits for the
message and 3 bits for the remainder).
divisor = bitshift(divisor,divisorDegree);
remainder = bitshift(message,divisorDegree);
dec2bin(divisor)
ans =
'1111000000000000000'
dec2bin(remainder)
ans =
'1101100111011010000'
Perform the division steps of the CRC using a for loop. The for loop always advances a single bit
each step, so include a check to see if the current digit is a 1. If the current digit is a 1, then the
division step is performed; otherwise, the loop advances a bit and continues.
for k = 1:messageLength
if bitget(remainder,messageLength+divisorDegree)
remainder = bitxor(remainder,divisor);
end
remainder = bitshift(remainder,1);
end
Shift the bits of the remainder to the right to get the check value for the operation.
CRC_check_value = bitshift(remainder,-messageLength);
dec2bin(CRC_check_value)
2-45
2 Program Components
ans =
'110'
You can use the check value to verify the integrity of a message by repeating the same division
operation. However, instead of using a remainder of 000 to start, use the check value 110. If the
message is error free, then the result of the division will be zero.
Reset the remainder variable, and add the CRC check value to the remainder bits using a bit-wise OR.
Introduce an error into the message by flipping one of the bit values with bitset.
remainder = bitshift(message,divisorDegree);
remainder = bitor(remainder,CRC_check_value);
remainder = bitset(remainder,6);
dec2bin(remainder)
ans =
'1101100111011110110'
Perform the CRC division operation and then check if the result is zero.
for k = 1:messageLength
if bitget(remainder,messageLength+divisorDegree)
remainder = bitxor(remainder,divisor);
end
remainder = bitshift(remainder,1);
end
if remainder == 0
disp('Message is error free.')
else
disp('Message contains errors.')
end
References
[1] Sklar, Bernard. Digital Communications: Fundamentals and Applications. Englewood Cliffs, NJ:
Prentice Hall, 1988.
[2] Wicker, Stephen B. Error Control Systems for Digital Communication and Storage. Upper Saddle
River, NJ: Prentice Hall, 1995.
See Also
bitshift | bitxor
More About
• “Bit-Wise Operations” on page 2-38
• “Hexadecimal and Binary Values” on page 6-55
2-46
Conditional Statements
Conditional Statements
Conditional statements enable you to select at run time which block of code to execute. The simplest
conditional statement is an if statement. For example:
% If it is even, divide by 2
if rem(a, 2) == 0
disp('a is even')
b = a/2;
end
if statements can include alternate choices, using the optional keywords elseif or else. For
example:
a = randi(100, 1);
if a < 30
disp('small')
elseif a < 80
disp('medium')
else
disp('large')
end
Alternatively, when you want to test for equality against a set of known values, use a switch
statement. For example:
switch dayString
case 'Monday'
disp('Start of the work week')
case 'Tuesday'
disp('Day 2')
case 'Wednesday'
disp('Day 3')
case 'Thursday'
disp('Day 4')
case 'Friday'
disp('Last day of the work week')
otherwise
disp('Weekend!')
end
For both if and switch, MATLAB executes the code corresponding to the first true condition, and
then exits the code block. Each conditional statement requires the end keyword.
In general, when you have many possible discrete, known values, switch statements are easier to
read than if statements. However, you cannot test for inequality between switch and case values.
For example, you cannot implement this type of condition with a switch:
if yourNumber < 0
2-47
2 Program Components
disp('Negative')
elseif yourNumber > 0
disp('Positive')
else
disp('Zero')
end
See Also
if | switch | end | return
2-48
Loop Control Statements
• for statements loop a specific number of times, and keep track of each iteration with an
incrementing index variable.
x = ones(1,10);
for n = 2:6
x(n) = 2 * x(n - 1);
end
• while statements loop as long as a condition remains true.
For example, find the first integer n for which factorial(n) is a 100-digit number:
n = 1;
nFactorial = 1;
while nFactorial < 1e100
n = n + 1;
nFactorial = nFactorial * n;
end
It is a good idea to indent the loops for readability, especially when they are nested (that is, when one
loop contains another loop):
A = zeros(5,100);
for m = 1:5
for n = 1:100
A(m, n) = 1/(m + n - 1);
end
end
You can programmatically exit a loop using a break statement, or skip to the next iteration of a loop
using a continue statement. For example, count the number of lines in the help for the magic
function (that is, all comment lines until a blank line):
fid = fopen('magic.m','r');
count = 0;
while ~feof(fid)
line = fgetl(fid);
if isempty(line)
break
elseif ~strncmp(line,'%',1)
continue
end
count = count + 1;
end
fprintf('%d lines in MAGIC help\n',count);
fclose(fid);
2-49
2 Program Components
Tip If you inadvertently create an infinite loop (a loop that never ends on its own), stop execution of
the loop by pressing Ctrl+C.
See Also
for | while | break | continue | end
2-50
Regular Expressions
Regular Expressions
In this section...
“What Is a Regular Expression?” on page 2-51
“Steps for Building Expressions” on page 2-52
“Operators and Characters” on page 2-55
This topic describes what regular expressions are and how to use them to search text. Regular
expressions are flexible and powerful, though they use complex syntax. An alternative to regular
expressions is a pattern (since R2020b), which is simpler to define and results in code that is easier
to read. For more information, see “Build Pattern Expressions” on page 6-40.
The character vector 'Joh?n\w*' is an example of a regular expression. It defines a pattern that
starts with the letters Jo, is optionally followed by the letter h (indicated by 'h?'), is then followed
by the letter n, and ends with any number of word characters, that is, characters that are alphabetic,
numeric, or underscore (indicated by '\w*'). This pattern matches any of the following:
Regular expressions provide a unique way to search a volume of text for a particular subset of
characters within that text. Instead of looking for an exact character match as you would do with a
function like strfind, regular expressions give you the ability to look for a particular pattern of
characters.
km/h
km/hr
km/hour
kilometers/hour
kilometers per hour
You could locate any of the above terms in your text by issuing five separate search commands:
strfind(text, 'km/h');
strfind(text, 'km/hour');
% etc.
To be more efficient, however, you can build a single phrase that applies to all of these search terms:
2-51
2 Program Components
Translate this phrase into a regular expression (to be explained later in this section) and you have:
pattern = 'k(ilo)?m(eters)?(/|\sper\s)h(r|our)?';
Now locate one or more of the terms using just a single command:
ans =
There are four MATLAB functions that support searching and replacing characters using regular
expressions. The first three are similar in the input values they accept and the output values they
return. For details, click the links to the function reference pages.
Function Description
regexp Match regular expression.
regexpi Match regular expression, ignoring case.
regexprep Replace part of text using regular expression.
regexptranslate Translate text into regular expression.
When calling any of the first three functions, pass the text to be parsed and the regular expression in
the first two input arguments. When calling regexprep, pass an additional input that is an
expression that specifies a pattern for the replacement.
This entails breaking up the text you want to search for into groups of like character types. These
character types could be a series of lowercase letters, a dollar sign followed by three numbers
and then a decimal point, etc.
2 Express each pattern as a regular expression on page 2-53
2-52
Regular Expressions
Use the metacharacters and operators described in this documentation to express each segment
of your search pattern as a regular expression. Then combine these expression segments into the
single expression to use in the search.
3 Call the appropriate search function on page 2-54
Pass the text you want to parse to one of the search functions, such as regexp or regexpi, or to
the text replacement function, regexprep.
The example shown in this section searches a record containing contact information belonging to a
group of five friends. This information includes each person's name, telephone number, place of
residence, and email address. The goal is to extract specific information from the text..
contacts = { ...
'Harry 287-625-7315 Columbus, OH [email protected]'; ...
'Janice 529-882-1759 Fresno, CA [email protected]'; ...
'Mike 793-136-0975 Richmond, VA [email protected]'; ...
'Nadine 648-427-9947 Tampa, FL [email protected]'; ...
'Jason 697-336-7728 Montrose, CO [email protected]'};
The first part of the example builds a regular expression that represents the format of a standard
email address. Using that expression, the example then searches the information for the email
address of one of the group of friends. Contact information for Janice is in row 2 of the contacts cell
array:
contacts{2}
ans =
A typical email address is made up of standard components: the user's account name, followed by an
@ sign, the name of the user's internet service provider (ISP), a dot (period), and the domain to which
the ISP belongs. The table below lists these components in the left column, and generalizes the
format of each component in the right column.
In this step, you translate the general formats derived in Step 1 into segments of a regular
expression. You then add these segments together to form the entire expression.
2-53
2 Program Components
The table below shows the generalized format descriptions of each character pattern in the left-most
column. (This was carried forward from the right column of the table in Step 1.) The second column
shows the operators or metacharacters that represent the character pattern.
Assembling these patterns into one character vector gives you the complete expression:
email = '[a-z_]+@[a-z]+\.(com|net)';
In this step, you use the regular expression derived in Step 2 to match an email address for one of the
friends in the group. Use the regexp function to perform the search.
Here is the list of contact information shown earlier in this section. Each person's record occupies a
row of the contacts cell array:
contacts = { ...
'Harry 287-625-7315 Columbus, OH [email protected]'; ...
'Janice 529-882-1759 Fresno, CA [email protected]'; ...
'Mike 793-136-0975 Richmond, VA [email protected]'; ...
'Nadine 648-427-9947 Tampa, FL [email protected]'; ...
'Jason 697-336-7728 Montrose, CO [email protected]'};
This is the regular expression that represents an email address, as derived in Step 2:
email = '[a-z_]+@[a-z]+\.(com|net)';
Call the regexp function, passing row 2 of the contacts cell array and the email regular
expression. This returns the email address for Janice.
ans =
MATLAB parses a character vector from left to right, “consuming” the vector as it goes. If matching
characters are found, regexp records the location and resumes parsing the character vector, starting
just after the end of the most recent match.
Make the same call, but this time for the fifth person in the list:
ans =
2-54
Regular Expressions
You can also search for the email address of everyone in the list by using the entire cell array for the
input argument:
Metacharacters
Metacharacters represent letters, letter ranges, digits, and space characters. Use them to construct a
generalized pattern of characters.
2-55
2 Program Components
Character Representation
Operator Description
\a Alarm (beep)
\b Backspace
\f Form feed
\n New line
\r Carriage return
\t Horizontal tab
\v Vertical tab
\char Any character with special meaning in regular expressions that you want to match literally
(for example, use \\ to match a single backslash)
Quantifiers
Quantifiers specify the number of times a pattern must occur in the matching text.
2-56
Regular Expressions
{0,1} is equivalent to ?.
expr{m,} At least m times consecutively. '<a href="\w{1,}\.html">' matches an
<a> HTML tag when the file name contains one
{0,} and {1,} are equivalent to * and +, or more characters.
respectively.
expr{n} Exactly n times consecutively. '\d{4}' matches four consecutive digits.
Equivalent to {n,n}.
Quantifiers can appear in three modes, described in the following table. q represents any of the
quantifiers in the previous table.
'<tr><td><p>text</p></td>'
exprq? Lazy expression: match as few characters as Given the text'<tr><td><p>text</p></
necessary. td>', the expression '</?t.*?>' ends each
match at the first occurrence of the closing
angle bracket (>):
Grouping Operators
Grouping operators allow you to capture tokens, apply one operator to multiple elements, or disable
backtracking in a specific group.
2-57
2 Program Components
Anchors
Anchors in the expression match the beginning or end of a character vector or word.
Lookaround Assertions
Lookaround assertions look for patterns that immediately precede or follow the intended match, but
are not part of the match.
The pointer remains at the current location, and characters that correspond to the test expression
are not captured or discarded. Therefore, lookahead assertions can match overlapping character
groups.
2-58
Regular Expressions
If you specify a lookahead assertion before an expression, the operation is equivalent to a logical AND.
For more information, see “Lookahead Assertions in Regular Expressions” on page 2-63.
Logical and conditional operators allow you to test the state of a given condition, and then use the
outcome to determine which pattern, if any, to match next. These operators support logical OR and if
or if/else conditions. (For AND conditions, see “Lookaround Assertions” on page 2-58.)
Conditions can be tokens on page 2-60, lookaround assertions on page 2-58, or dynamic expressions
on page 2-60 of the form (?@cmd). Dynamic expressions must return a logical or numeric value.
2-59
2 Program Components
Token Operators
Tokens are portions of the matched text that you define by enclosing part of the regular expression in
parentheses. You can refer to a token by its sequence in the text (an ordinal token), or assign names
to tokens for easier code maintenance and readable output.
Note If an expression has nested parentheses, MATLAB captures tokens that correspond to the
outermost set of parentheses. For example, given the search pattern '(and(y|rew))', MATLAB
creates a token for 'andrew' but not for 'y' or 'rew'.
Dynamic Expressions
Dynamic expressions allow you to execute a MATLAB command or a regular expression to determine
the text to match.
The parentheses that enclose dynamic expressions do not create a capturing group.
2-60
Regular Expressions
Within dynamic expressions, use the following operators to define replacement terms.
Comments
The comment operator enables you to insert comments into your code to make it more maintainable.
The text of the comment is ignored by MATLAB when matching against the input text.
Search Flags
Flag Description
(?-i) Match letter case (default for regexp and regexprep).
(?i) Do not match letter case (default for regexpi).
2-61
2 Program Components
Flag Description
(?s) Match dot (.) in the pattern with any character (default).
(?-s) Match dot in the pattern with any character that is not a newline character.
(?-m) Match the ^ and $ metacharacters at the beginning and end of text (default).
(?m) Match the ^ and $ metacharacters at the beginning and end of a line.
(?-x) Include space characters and comments when matching (default).
(?x) Ignore space characters and comments when matching. Use '\ ' and '\#' to
match space and # characters.
The expression that the flag modifies can appear either after the parentheses, such as
(?i)\w*
or inside the parentheses and separated from the flag with a colon (:), such as
(?i:\w*)
The latter syntax allows you to change the behavior for part of a larger expression.
See Also
regexp | regexpi | regexprep | regexptranslate | pattern
More About
• “Lookahead Assertions in Regular Expressions” on page 2-63
• “Tokens in Regular Expressions” on page 2-66
• “Dynamic Regular Expressions” on page 2-72
• “Search and Replace Text” on page 6-37
2-62
Lookahead Assertions in Regular Expressions
Lookahead Assertions
There are two types of lookaround assertions for regular expressions: lookahead and lookbehind. In
both cases, the assertion is a condition that must be satisfied to return a match to the expression.
A lookahead assertion has the form (?=test) and can appear anywhere in a regular expression.
MATLAB looks ahead of the current location in the text for the test condition. If MATLAB matches the
test condition, it continues processing the rest of the expression to find a match.
For example, look ahead in a character vector specifying a path to find the name of the folder that
contains a program file (in this case, fileread.m).
chr = which('fileread')
chr =
'matlabroot\toolbox\matlab\iofun\fileread.m'
regexp(chr,'\w+(?=\\\w+\.[mp])','match')
ans =
{'iofun'}
The match expression, \w+, searches for one or more alphanumeric or underscore characters. Each
time regexp finds a term that matches this condition, it looks ahead for a backslash (specified with
two backslashes, \\), followed by a file name (\w+) with an .m or .p extension (\.[mp]). The
regexp function returns the match that satisfies the lookahead condition, which is the folder name
iofun.
Overlapping Matches
Lookahead assertions do not consume any characters in the text. As a result, you can use them to find
overlapping character sequences.
For example, use lookahead to find every sequence of six nonwhitespace characters in a character
vector by matching initial characters that precede five additional characters:
startIndex =
1 8 9 16 17 24 25
2-63
2 Program Components
Without the lookahead operator, MATLAB parses a character vector from left to right, consuming the
vector as it goes. If matching characters are found, regexp records the location and resumes parsing
the character vector from the location of the most recent match. There is no overlapping of
characters in this process.
chr = 'Locate several 6-char. phrases';
startIndex = regexpi(chr,'\S{6}')
startIndex =
1 8 16 24
chr =
Merely searching for non-vowels ([^aeiou]) does not return the expected answer, as the output
includes capital letters, space characters, and punctuation:
c = regexp(chr,'[^aeiou]','match')
c =
Columns 1 through 14
{' '} {'N'} {'O'} {'R'} {'M'} {'E'} {'S'} {'T'} {' '} {'E'} {'s
Columns 15 through 28
{' '} {'t'} {'h'} {' '} {'m'} {'t'} {'r'} {'x'} {' '} {'2'} {'-
Columns 29 through 42
{'.'} {'↵'} {' '} {' '} {' '} {' '} {'N'} {'O'} {'R'} {'M'} {'E
Column 43
{'S'}
2-64
Lookahead Assertions in Regular Expressions
Try this again, using a lookahead operator to create the following AND condition:
c = regexp(chr,'(?=[a-z])[^aeiou]','match')
c =
{'s'} {'t'} {'m'} {'t'} {'t'} {'h'} {'m'} {'t'} {'r'} {'x'} {'n
Note that when using a lookahead operator to perform an AND, you need to place the match
expression expr after the test expression test:
(?=test)expr or (?!test)expr
See Also
regexp | regexpi | regexprep
More About
• “Regular Expressions” on page 2-51
2-65
2 Program Components
Introduction
Parentheses used in a regular expression not only group elements of that expression together, but
also designate any matches found for that group as tokens. You can use tokens to match other parts
of the same text. One advantage of using tokens is that they remember what they matched, so you
can recall and reuse matched text in the process of searching or replacing.
Each token in the expression is assigned a number, starting from 1, going from left to right. To make
a reference to a token later in the expression, refer to it using a backslash followed by the token
number. For example, when referencing a token generated by the third set of parentheses in the
expression, use \3.
As a simple example, if you wanted to search for identical sequential letters in a character array, you
could capture the first letter as a token and then search for a matching character immediately
afterwards. In the expression shown below, the (\S) phrase creates a token whenever regexp
matches any nonwhitespace character in the character array. The second part of the expression,
'\1', looks for a second instance of the same character immediately following the first.
poe = ['While I nodded, nearly napping, ' ...
'suddenly there came a tapping,'];
mat =
The cell array tok contains cell arrays that each contain a token.
tok{:}
ans =
{'d'}
ans =
2-66
Tokens in Regular Expressions
{'p'}
ans =
{'d'}
ans =
{'p'}
The cell array ext contains numeric arrays that each contain starting and ending indices for a token.
ext{:}
ans =
11 11
ans =
26 26
ans =
35 35
ans =
57 57
For another example, capture pairs of matching HTML tags (e.g., <a> and </a>) and the text
between them. The expression used for this example is
expr = '<(\w+).*?>.*?</\1>';
The first part of the expression, '<(\w+)', matches an opening angle bracket (<) followed by one or
more alphabetic, numeric, or underscore characters. The enclosing parentheses capture token
characters following the opening angle bracket.
The second part of the expression, '.*?>.*?', matches the remainder of this HTML tag (characters
up to the >), and any characters that may precede the next opening angle bracket.
The last part, '</\1>', matches all characters in the ending HTML tag. This tag is composed of the
sequence </tag>, where tag is whatever characters were captured as a token.
2-67
2 Program Components
ans =
'<a name="752507"></a>'
ans =
'<b>Default</b>'
tok{:}
ans =
{'a'}
ans =
{'b'}
Multiple Tokens
Here is an example of how tokens are assigned values. Suppose that you are going to search the
following text:
You choose to search the above text with the following search pattern:
and(y|rew)|(t)e(d)
This pattern has three parenthetical expressions that generate tokens. When you finally perform the
search, the following tokens are generated for each match.
Only the highest level parentheses are used. For example, if the search pattern and(y|rew) finds the
text andrew, token 1 is assigned the value rew. However, if the search pattern (and(y|rew)) is
used, token 1 is assigned the value andrew.
2-68
Tokens in Regular Expressions
Unmatched Tokens
For those tokens specified in the regular expression that have no match in the text being evaluated,
regexp and regexpi return an empty character vector ('') as the token output, and an extent that
marks the position in the string where the token was expected.
The example shown here executes regexp on a character vector specifying the path returned from
the MATLAB tempdir function. The regular expression expr includes six token specifiers, one for
each piece of the path. The third specifier [a-z]+ has no match in the character vector because this
part of the path, Profiles, begins with an uppercase letter:
chr = tempdir
chr =
'C:\WINNT\Profiles\bpascal\LOCALS~1\Temp\'
When a token is not found in the text, regexp returns an empty character vector ('') as the token
and a numeric array with the token extent. The first number of the extent is the string index that
marks where the token was expected, and the second number of the extent is equal to one less than
the first.
In the case of this example, the empty token is the third specified in the expression, so the third token
returned is empty:
tok{:}
ans =
The third token extent returned in the variable ext has the starting index set to 10, which is where
the nonmatching term, Profiles, begins in the path. The ending extent index is set to one less than
the starting index, or 9:
ext{:}
ans =
1 2
4 8
10 9
19 25
27 34
36 39
2-69
2 Program Components
second, $2, is 'Baker'. Note that regexprep returns the modified text, not a vector of starting
indices.
regexprep('Norma Jean Baker', '(\w+\s\w+)\s(\w+)', '$2, $1')
ans =
Named Capture
If you use a lot of tokens in your expressions, it may be helpful to assign them names rather than
having to keep track of which token number is assigned to which token.
When referencing a named token within the expression, use the syntax \k<name> instead of the
numeric \1, \2, etc.:
poe = ['While I nodded, nearly napping, ' ...
'suddenly there came a tapping,'];
ans =
Named tokens can also be useful in labeling the output from the MATLAB regular expression
functions. This is especially true when you are processing many pieces of text.
For example, parse different parts of street addresses from several character vectors. A short name is
assigned to each token in the expression:
chr1 = '134 Main Street, Boulder, CO, 14923';
chr2 = '26 Walnut Road, Topeka, KA, 25384';
chr3 = '847 Industrial Drive, Elizabeth, NJ, 73548';
p1 = '(?<adrs>\d+\s\S+\s(Road|Street|Avenue|Drive))';
p2 = '(?<city>[A-Z][a-z]+)';
p3 = '(?<state>[A-Z]{2})';
p4 = '(?<zip>\d{5})';
As the following results demonstrate, you can make your output easier to work with by using named
tokens:
loc1 = regexp(chr1, expr, 'names')
loc1 =
2-70
Tokens in Regular Expressions
loc2 =
loc3 =
See Also
regexp | regexpi | regexprep
More About
• “Regular Expressions” on page 2-51
2-71
2 Program Components
In this section...
“Introduction” on page 2-72
“Dynamic Match Expressions — (??expr)” on page 2-73
“Commands That Modify the Match Expression — (??@cmd)” on page 2-73
“Commands That Serve a Functional Purpose — (?@cmd)” on page 2-74
“Commands in Replacement Expressions — ${cmd}” on page 2-76
Introduction
In a dynamic expression, you can make the pattern that you want regexp to match dependent on the
content of the input text. In this way, you can more closely match varying input patterns in the text
being parsed. You can also use dynamic expressions in replacement terms for use with the
regexprep function. This gives you the ability to adapt the replacement text to the parsed input.
You can include any number of dynamic expressions in the match_expr or replace_expr
arguments of these commands:
regexp(text, match_expr)
regexpi(text, match_expr)
regexprep(text, match_expr, replace_expr)
As an example of a dynamic expression, the following regexprep command correctly replaces the
term internationalization with its abbreviated form, i18n. However, to use it on a different
term such as globalization, you have to use a different replacement expression:
match_expr = '(^\w)(\w*)(\w$)';
replace_expr1 = '$118$3';
regexprep('internationalization', match_expr, replace_expr1)
ans =
'i18n'
replace_expr2 = '$111$3';
regexprep('globalization', match_expr, replace_expr2)
ans =
'g11n'
match_expr = '(^\w)(\w*)(\w$)';
replace_expr = '$1${num2str(length($2))}$3';
2-72
Dynamic Regular Expressions
ans =
'i18n'
ans =
'g11n'
When parsed, a dynamic expression must correspond to a complete, valid regular expression. In
addition, dynamic match expressions that use the backslash escape character (\) require two
backslashes: one for the initial parsing of the expression, and one for the complete match. The
parentheses that enclose dynamic expressions do not create a capturing group.
There are three forms of dynamic expressions that you can use in match expressions, and one form
for replacement expressions, as described in the following sections
Here is an example of the type of expression that you can use with this operator:
chr = {'5XXXXX', '8XXXXXXXX', '1X'};
regexp(chr, '^(\d+)(??X{$1})$', 'match', 'once');
The purpose of this particular command is to locate a series of X characters in each of the character
vectors stored in the input cell array. Note however that the number of Xs varies in each character
vector. If the count did not vary, you could use the expression X{n} to indicate that you want to match
n of these characters. But, a constant value of n does not work in this case.
The solution used here is to capture the leading count number (e.g., the 5 in the first character vector
of the cell array) in a token, and then to use that count in a dynamic expression. The dynamic
expression in this example is (??X{$1}), where $1 is the value captured by the token \d+. The
operator {$1} makes a quantifier of that token value. Because the expression is dynamic, the same
pattern works on all three of the input vectors in the cell array. With the first input character vector,
regexp looks for five X characters; with the second, it looks for eight, and with the third, it looks for
just one:
regexp(chr, '^(\d+)(??X{$1})$', 'match', 'once')
ans =
For example, use the dynamic expression (??@flilplr($1)) to locate a palindrome, “Never Odd or
Even”, that has been embedded into a larger character vector.
2-73
2 Program Components
First, create the input string. Make sure that all letters are lowercase, and remove all nonword
characters.
chr = lower(...
'Find the palindrome Never Odd or Even in this string');
chr =
'findthepalindromeneveroddoreveninthisstring'
Locate the palindrome within the character vector using the dynamic expression:
palindrome =
{'neveroddoreven'}
The dynamic expression reverses the order of the letters that make up the character vector, and then
attempts to match as much of the reversed-order vector as possible. This requires a dynamic
expression because the value for $1 relies on the value of the token (.{3,}).
Dynamic expressions in MATLAB have access to the currently active workspace. This means that you
can change any of the functions or variables used in a dynamic expression just by changing variables
in the workspace. Repeat the last command of the example above, but this time define the function to
be called within the expression using a function handle stored in the base workspace:
fun = @fliplr;
palindrome =
{'neveroddoreven'}
The following example parses a word for zero or more characters followed by two identical
characters followed again by zero or more characters:
ans =
2-74
Dynamic Regular Expressions
{'mississippi'}
To track the exact steps that MATLAB takes in determining the match, the example inserts a short
script (?@disp($1)) in the expression to display the characters that finally constitute the match.
Because the example uses greedy quantifiers, MATLAB attempts to match as much of the character
vector as possible. So, even though MATLAB finds a match toward the beginning of the string, it
continues to look for more matches until it arrives at the very end of the string. From there, it backs
up through the letters i then p and the next p, stopping at that point because the match is finally
satisfied:
regexp('mississippi', '\w*(\w)(?@disp($1))\1\w*', 'match')
i
p
p
ans =
{'mississippi'}
Now try the same example again, this time making the first quantifier lazy (*?). Again, MATLAB
makes the same match:
regexp('mississippi', '\w*?(\w)\1\w*', 'match')
ans =
{'mississippi'}
But by inserting a dynamic script, you can see that this time, MATLAB has matched the text quite
differently. In this case, MATLAB uses the very first match it can find, and does not even consider the
rest of the text:
regexp('mississippi', '\w*?(\w)(?@disp($1))\1\w*', 'match')
m
i
s
ans =
{'mississippi'}
To demonstrate how versatile this type of dynamic expression can be, consider the next example that
progressively assembles a cell array as MATLAB iteratively parses the input text. The (?!) operator
found at the end of the expression is actually an empty lookahead operator, and forces a failure at
each iteration. This forced failure is necessary if you want to trace the steps that MATLAB is taking to
resolve the expression.
MATLAB makes a number of passes through the input text, each time trying another combination of
letters to see if a fit better than last match can be found. On any passes in which no matches are
2-75
2 Program Components
found, the test results in an empty character vector. The dynamic script (?@if(~isempty($&)))
serves to omit the empty character vectors from the matches cell array:
matches = {};
expr = ['(Euler\s)?(Cauchy\s)?(Boole)?(?@if(~isempty($&)),' ...
'matches{end+1}=$&;end)(?!)'];
matches
matches =
{'Euler Cauchy Bo…'} {'Euler Cauchy '} {'Euler '} {'Cauchy Boole'} {'Cauchy '}
The operators $& (or the equivalent $0), $`, and $' refer to that part of the input text that is
currently a match, all characters that precede the current match, and all characters to follow the
current match, respectively. These operators are sometimes useful when working with dynamic
expressions, particularly those that employ the (?@cmd) operator.
This example parses the input text looking for the letter g. At each iteration through the text, regexp
compares the current character with g, and not finding it, advances to the next character. The
example tracks the progress of scan through the text by marking the current location being parsed
with a ^ character.
(The $` and $´ operators capture that part of the text that precedes and follows the current parsing
location. You need two single-quotation marks ($'') to express the sequence $´ when it appears
within text.)
chr = 'abcdefghij';
expr = '(?@disp(sprintf(''starting match: [%s^%s]'',$`,$'')))g';
In the regexprep call shown here, the replacement pattern is '${convertMe($1,$2)}'. In this
case, the entire replacement pattern is a dynamic expression:
2-76
Dynamic Regular Expressions
The dynamic expression tells MATLAB to execute a function named convertMe using the two tokens
(\d+\.?\d*) and (\w+), derived from the text being matched, as input arguments in the call to
convertMe. The replacement pattern requires a dynamic expression because the values of $1 and $2
are generated at runtime.
The following example defines the file named convertMe that converts measurements from imperial
units to metric.
function valout = convertMe(valin, units)
switch(units)
case 'inches'
fun = @(in)in .* 2.54;
uout = 'centimeters';
case 'miles'
fun = @(mi)mi .* 1.6093;
uout = 'kilometers';
case 'pounds'
fun = @(lb)lb .* 0.4536;
uout = 'kilograms';
case 'pints'
fun = @(pt)pt .* 0.4731;
uout = 'litres';
case 'ounces'
fun = @(oz)oz .* 28.35;
uout = 'grams';
end
val = fun(str2num(valin));
valout = [num2str(val) ' ' uout];
end
At the command line, call the convertMe function from regexprep, passing in values for the
quantity to be converted and name of the imperial unit:
regexprep('This highway is 125 miles long', ...
'(\d+\.?\d*)\W(\w+)', '${convertMe($1,$2)}')
ans =
ans =
ans =
As with the (??@ ) operator discussed in an earlier section, the ${ } operator has access to
variables in the currently active workspace. The following regexprep command uses the array A
defined in the base workspace:
A = magic(3)
2-77
2 Program Components
A =
8 1 6
3 5 7
4 9 2
ans =
See Also
regexp | regexpi | regexprep
More About
• “Regular Expressions” on page 2-51
2-78
Comma-Separated Lists
Comma-Separated Lists
In this section...
“What Is a Comma-Separated List?” on page 2-79
“Generating a Comma-Separated List” on page 2-79
“Assigning Output from a Comma-Separated List” on page 2-81
“Assigning to a Comma-Separated List” on page 2-81
“How to Use the Comma-Separated Lists” on page 2-82
“Fast Fourier Transform Example” on page 2-84
ans =
ans =
ans =
Such a list, by itself, is not very useful. But when used with large and more complex data structures
like MATLAB structures and cell arrays, the comma-separated list can enable you to simplify your
MATLAB code.
Extracting multiple elements from a cell array yields a comma-separated list. Given a 4-by-6 cell array
as shown here
C = cell(4,6);
for k = 1:24
C{k} = k*2;
end
C
C =
2-79
2 Program Components
C{:,5}
ans =
34
ans =
36
ans =
38
ans =
40
C{1,5},C{2,5},C{3,5},C{4,5}
For structures, extracting a field of the structure that exists across one of its dimensions yields a
comma-separated list.
Start by converting the cell array used above into a 4-by-1 MATLAB structure with six fields: f1
through f6. Read field f5 for all rows and MATLAB returns a comma-separated list:
S = cell2struct(C,{'f1','f2','f3','f4','f5','f6'},2);
S.f5
ans =
34
ans =
36
ans =
38
2-80
Comma-Separated Lists
ans =
40
S(1).f5,S(2).f5,S(3).f5,S(4).f5
C = cell(4,6);
for k = 1:24
C{k} = k*2;
end
[c1,c2,c3,c4,c5,c6] = C{1,1:6};
c5
c5 =
34
If you specify fewer output variables than the number of outputs returned by the expression, MATLAB
assigns the first N outputs to those N variables, and then discards any remaining outputs. In this next
example, MATLAB assigns C{1,1:3} to the variables c1, c2, and c3, and then discards C{1,4:6}:
[c1,c2,c3] = C{1,1:6};
S = cell2struct(C,{'f1','f2','f3','f4','f5','f6'},2);
[sf1,sf2,sf3] = S.f5;
sf3
sf3 =
38
You also can use the deal function for this purpose.
This example uses deal to overwrite each element in a comma-separated list. First create a list.
ans =
31 7
2-81
2 Program Components
ans =
3 78
ans =
10 20
ans =
14 12
This example does the same as the one above, but with a comma-separated list of vectors in a
structure field:
ans =
31 7
ans =
3 78
ans =
10 20
ans =
14 12
2-82
Comma-Separated Lists
The following sections provide examples of using comma-separated lists with cell arrays. Each of
these examples applies to MATLAB structures as well.
Constructing Arrays
You can use a comma-separated list to enter a series of elements when constructing a matrix or array.
Note what happens when you insert a list of elements as opposed to adding the cell itself.
When you specify a list of elements with C{:, 5}, MATLAB inserts the four individual elements:
A = {'Hello',C{:,5},magic(4)}
A =
When you specify the C cell itself, MATLAB inserts the entire cell array:
A = {'Hello',C,magic(4)}
A =
Displaying Arrays
ans =
Hello
ans =
ans =
16 2 3 13
5 11 10 8
9 7 6 12
4 14 15 1
Concatenation
Putting a comma-separated list inside square brackets extracts the specified elements from the list
and concatenates them:
2-83
2 Program Components
A = [C{:,5:6}]
A =
34 36 38 40 42 44 46 48
When writing the code for a function call, you enter the input arguments as a list with each argument
separated by a comma. If you have these arguments stored in a structure or cell array, then you can
generate all or part of the argument list from the structure or cell array instead. This can be
especially useful when passing in variable numbers of arguments.
X = -pi:pi/10:pi;
Y = tan(sin(X)) - sin(tan(X));
C = cell(2,3);
C{1,1} = 'LineWidth';
C{2,1} = 2;
C{1,2} = 'MarkerEdgeColor';
C{2,2} = 'k';
C{1,3} = 'MarkerFaceColor';
C{2,3} = 'g';
figure
plot(X,Y,'--rs',C{:})
MATLAB functions can also return more than one value to the caller. These values are returned in a
list with each value separated by a comma. Instead of listing each return value, you can use a comma-
separated list with a structure or cell array. This becomes more useful for those functions that have
variable numbers of return values.
C = cell(1,3);
[C{:}] = fileparts('work/mytests/strArrays.mat')
C =
fftshift uses vectors of indices to perform the swap. For the vector shown above, the index [1 2
3 4 5 6] is rearranged to form a new index [4 5 6 1 2 3]. The function then uses this index
vector to reposition the elements. For a multidimensional array, fftshift must construct an index
vector for each dimension. A comma-separated list makes this task much simpler.
2-84
Comma-Separated Lists
function y = fftshift(x)
numDims = ndims(x);
idx = cell(1,numDims);
for k = 1:numDims
m = size(x,k);
p = ceil(m/2);
idx{k} = [p+1:m 1:p];
end
y = x(idx{:});
end
The function stores the index vectors in cell array idx. Building this cell array is relatively simple.
For each of the N dimensions, determine the size of that dimension and find the integer index nearest
the midpoint. Then, construct a vector that swaps the two halves of that dimension.
By using a cell array to store the index vectors and a comma-separated list for the indexing operation,
fftshift shifts arrays of any dimension using just a single operation: y = x(idx{:}). If you were
to use explicit indexing, you would need to write one if statement for each dimension you want the
function to handle:
if ndims(x) == 1
y = x(index1);
else if ndims(x) == 2
y = x(index1,index2);
end
end
Another way to handle this without a comma-separated list would be to loop over each dimension,
converting one dimension at a time and moving data each time. With a comma-separated list, you
move the data just once. A comma-separated list makes it very easy to generalize the swapping
operation to an arbitrary number of dimensions.
2-85
2 Program Components
• MATLAB compiles code the first time you run it to enhance performance for future runs. However,
because code in an eval statement can change at run time, it is not compiled.
• Code within an eval statement can unexpectedly create or assign to a variable already in the
current workspace, overwriting existing data.
• Concatenated character vectors within an eval statement are often difficult to read. Other
language constructs can simplify the syntax in your code.
For many common uses of eval, there are preferred alternate approaches, as shown in the following
examples.
For example, create a cell array that contains 10 elements, where each element is a numeric array:
numArrays = 10;
A = cell(numArrays,1);
for n = 1:numArrays
A{n} = magic(n);
end
Access the data in the cell array by indexing with curly braces. For example, display the fifth element
of A:
A{5}
ans =
17 24 1 8 15
23 5 7 14 16
4 6 13 20 22
2-86
Alternatives to the eval Function
10 12 19 21 3
11 18 25 2 9
The assignment statement A{n} = magic(n) is more elegant and efficient than this call to eval:
eval(['A', int2str(n),' = magic(n)']) % Not recommended
The best practice is to use function syntax, which allows you to pass variables as inputs. For example:
currentFile = 'myfile1.mat';
save(currentFile)
You can construct file names within a loop using the sprintf function (which is usually more
efficient than int2str), and then call the save function without eval. This code creates 10 files in
the current folder:
numFiles = 10;
for n = 1:numFiles
randomData = rand(n);
currentFile = sprintf('myfile%d.mat',n);
save(currentFile,'randomData')
end
• Create function handles with the @ symbol or with the str2func function. For example, run a
function from a list stored in a cell array:
examples = {@odedemo,@sunspots,@fitdemo};
n = input('Select an example (1, 2, or 3): ');
examples{n}()
• Use the feval function. For example, call a plot function (such as plot, bar, or pie) with data
that you specify at run time:
2-87
2 Program Components
If you enter weight at the input prompt, then you can find the minimum weight value with the
following command.
min(dataToUse)
ans =
90
For an additional example, see “Generate Field Names from Variables” on page 11-10.
Error Handling
The preferred method for error handling in MATLAB is to use a try, catch statement. For example:
try
B = A;
catch exception
disp('A is undefined')
end
If your workspace does not contain variable A, then this code returns:
A is undefined
Previous versions of the documentation for the eval function include the syntax
eval(expression,catch_expr). If evaluating the expression input returns an error, then eval
evaluates catch_expr. However, an explicit try/catch is significantly clearer than an implicit
catch in an eval statement. Using the implicit catch is not recommended.
2-88
Classes (Data Types)
89
3
There are 16 fundamental classes in MATLAB. Each of these classes is in the form of a matrix or
array. With the exception of function handles, this matrix or array is a minimum of 0-by-0 in size and
can grow to an n-dimensional array of any size. A function handle is always scalar (1-by-1).
All of the fundamental MATLAB classes are shown in the diagram below:
Numeric classes in the MATLAB software include signed and unsigned integers, and single- and
double-precision floating-point numbers. By default, MATLAB stores all numeric values as double-
precision floating point. (You cannot change the default type and precision.) You can choose to store
any number, or array of numbers, as integers or as single-precision. Integer and single-precision
arrays offer more memory-efficient storage than double-precision.
All numeric types support basic array operations, such as subscripting, reshaping, and mathematical
operations.
You can create two-dimensional double and logical matrices using one of two storage formats:
full or sparse. For matrices with mostly zero-valued elements, a sparse matrix requires a fraction
of the storage space required for an equivalent full matrix. Sparse matrices invoke methods
especially tailored to solve sparse problems.
These classes require different amounts of storage, the smallest being a logical value or 8-bit
integer which requires only 1 byte. It is important to keep this minimum size in mind if you work on
data in files that were written using a precision smaller than 8 bits.
3-2
Fundamental MATLAB Classes
3-3
3 Overview of MATLAB Classes
See Also
More About
• “Valid Combinations of Unlike Classes” on page 15-2
3-4
4
Numeric Classes
Integers
In this section...
“Integer Classes” on page 4-2
“Creating Integer Data” on page 4-2
“Arithmetic Operations on Integer Classes” on page 4-4
“Largest and Smallest Values for Integer Classes” on page 4-4
Integer Classes
MATLAB has four signed and four unsigned integer classes. Signed types enable you to work with
negative integers as well as positive, but cannot represent as wide a range of numbers as the
unsigned types because one bit is used to designate a positive or negative sign for the number.
Unsigned types give you a wider range of numbers, but these numbers can only be zero or positive.
MATLAB supports 1-, 2-, 4-, and 8-byte storage for integer data. You can save memory and execution
time for your programs if you use the smallest integer type that accommodates your data. For
example, you do not need a 32-bit integer to store the value 100.
Here are the eight integer classes, the range of values you can store with each type, and the MATLAB
conversion function required to create that type:
For example, to store 325 as a 16-bit signed integer assigned to variable x, type
x = int16(325);
If the number being converted to an integer has a fractional part, MATLAB rounds to the nearest
integer. If the fractional part is exactly 0.5, then from the two equally nearby integers, MATLAB
chooses the one for which the absolute value is larger in magnitude:
x = 325.499;
int16(x)
4-2
Integers
ans =
int16
325
x = x + .001;
int16(x)
ans =
int16
326
If you need to round a number using a rounding scheme other than the default, MATLAB provides
four rounding functions: round, fix, floor, and ceil. The fix function enables you to override the
default and round towards zero when there is a nonzero fractional part:
x = 325.9;
int16(fix(x))
ans =
int16
325
Arithmetic operations that involve both integers and floating-point always result in an integer data
type. MATLAB rounds the result, when necessary, according to the default rounding algorithm. The
example below yields an exact answer of 1426.75 which MATLAB then rounds to the next highest
integer:
int16(325) * 4.39
ans =
int16
1427
The integer conversion functions are also useful when converting other classes, such as strings, to
integers:
str = 'Hello World';
int8(str)
ans =
If you convert a NaN value into an integer class, the result is a value of 0 in that integer class. For
example,
int32(NaN)
ans =
int32
4-3
4 Numeric Classes
• Integers or integer arrays of the same integer data type. This yields a result that has the same
data type as the operands:
For all binary operations in which one operand is an array of integer data type (except 64-bit
integers) and the other is a scalar double, MATLAB computes the operation using element-wise
double-precision arithmetic, and then converts the result back to the original integer data type. For
binary operations involving a 64-bit integer array and a scalar double, MATLAB computes the
operation as if 80-bit extended-precision arithmetic were used, to prevent loss of precision.
You can also obtain these values with the intmax and intmin functions:
intmax('int8')
ans =
int8
127
intmin('int8')
ans =
int8
-128
If you convert a number that is larger than the maximum value of an integer data type to that type,
MATLAB sets it to the maximum value. Similarly, if you convert a number that is smaller than the
minimum value of the integer data type, MATLAB sets it to the minimum value. For example,
4-4
Integers
x = int8(300)
x =
int8
127
x = int8(-300)
x =
int8
-128
Also, when the result of an arithmetic operation involving integers exceeds the maximum (or
minimum) value of the data type, MATLAB sets it to the maximum (or minimum) value:
x = int8(100) * 3
x =
int8
127
x = int8(-100) * 3
x =
int8
-128
4-5
4 Numeric Classes
Floating-Point Numbers
In this section...
“Double-Precision Floating Point” on page 4-6
“Single-Precision Floating Point” on page 4-6
“Creating Floating-Point Data” on page 4-6
“Arithmetic Operations on Floating-Point Numbers” on page 4-8
“Largest and Smallest Values for Floating-Point Classes” on page 4-9
“Accuracy of Floating-Point Data” on page 4-10
“Avoiding Common Problems with Floating-Point Arithmetic” on page 4-11
Bits Usage
63 Sign (0 = positive, 1 = negative)
62 to 52 Exponent, biased by 1023
51 to 0 Fraction f of the number 1.f
Bits Usage
31 Sign (0 = positive, 1 = negative)
30 to 23 Exponent, biased by 127
22 to 0 Fraction f of the number 1.f
Because MATLAB stores numbers of type single using 32 bits, they require less memory than
numbers of type double, which use 64 bits. However, because they are stored with fewer bits,
numbers of type single are represented to less precision than numbers of type double.
4-6
Floating-Point Numbers
Because the default numeric type for MATLAB is double, you can create a double with a simple
assignment statement:
x = 25.783;
The whos function shows that MATLAB has created a 1-by-1 array of type double for the value you
just stored in x:
whos x
Name Size Bytes Class
x 1x1 8 double
Use isfloat if you just want to verify that x is a floating-point number. This function returns logical
1 (true) if the input is a floating-point number, and logical 0 (false) otherwise:
isfloat(x)
ans =
logical
You can convert other numeric data, characters or strings, and logical data to double precision using
the MATLAB function, double. This example converts a signed integer to double-precision floating
point:
y = int64(-589324077574); % Create a 64-bit integer
Because MATLAB stores numeric data as a double by default, you need to use the single
conversion function to create a single-precision number:
x = single(25.783);
The whos function returns the attributes of variable x in a structure. The bytes field of this structure
shows that when x is stored as a single, it requires just 4 bytes compared with the 8 bytes to store it
as a double:
xAttrib = whos('x');
xAttrib.bytes
ans =
4
You can convert other numeric data, characters or strings, and logical data to single precision using
the single function. This example converts a signed integer to single-precision floating point:
y = int64(-589324077574); % Create a 64-bit integer
4-7
4 Numeric Classes
single
-5.8932e+11
Double-Precision Operations
You can perform basic arithmetic operations with double and any of the following other classes.
When one or more operands is an integer (scalar or array), the double operand must be a scalar. The
result is of type double, except where noted otherwise:
This example performs arithmetic on data of types char and double. The result is of type double:
c = 'uppercase' - 32;
class(c)
ans =
double
char(c)
ans =
UPPERCASE
Single-Precision Operations
You can perform basic arithmetic operations with single and any of the following other classes. The
result is always single:
• single
• double
• char
• logical
In this example, 7.5 defaults to type double, and the result is of type single:
class(x)
ans =
single
4-8
Floating-Point Numbers
The MATLAB functions realmax and realmin return the maximum and minimum values that you
can represent with the double data type:
ans =
The range for double is:
-1.79769e+308 to -2.22507e-308 and
2.22507e-308 to 1.79769e+308
Numbers larger than realmax or smaller than -realmax are assigned the values of positive and
negative infinity, respectively:
realmax + .0001e+308
ans =
Inf
-realmax - .0001e+308
ans =
-Inf
The MATLAB functions realmax and realmin, when called with the argument 'single', return the
maximum and minimum values that you can represent with the single data type:
ans =
The range for single is:
-3.40282e+38 to -1.17549e-38 and
1.17549e-38 to 3.40282e+38
Numbers larger than realmax('single') or smaller than -realmax('single') are assigned the
values of positive and negative infinity, respectively:
realmax('single') + .0001e+038
ans =
single
Inf
-realmax('single') - .0001e+038
ans =
single
4-9
4 Numeric Classes
-Inf
Double-Precision Accuracy
Because there are only a finite number of double-precision numbers, you cannot represent all
numbers in double-precision storage. On any computer, there is a small gap between each double-
precision number and the next larger double-precision number. You can determine the size of this
gap, which limits the precision of your results, using the eps function. For example, to find the
distance between 5 and the next larger double-precision number, enter
format long
eps(5)
ans =
8.881784197001252e-16
This tells you that there are no double-precision numbers between 5 and 5 + eps(5). If a double-
precision computation returns the answer 5, the result is only accurate to within eps(5).
The value of eps(x) depends on x. This example shows that, as x gets larger, so does eps(x):
eps(50)
ans =
7.105427357601002e-15
If you enter eps with no input argument, MATLAB returns the value of eps(1), the distance from 1
to the next larger double-precision number.
Single-Precision Accuracy
Similarly, there are gaps between any two single-precision numbers. If x has type single, eps(x)
returns the distance between x and the next larger single-precision number. For example,
x = single(5);
eps(x)
returns
ans =
single
4.7684e-07
Note that this result is larger than eps(5). Because there are fewer single-precision numbers than
double-precision numbers, the gaps between the single-precision numbers are larger than the gaps
between double-precision numbers. This means that results in single-precision arithmetic are less
precise than in double-precision arithmetic.
4-10
Floating-Point Numbers
For a number x of type double, eps(single(x)) gives you an upper bound for the amount that x is
rounded when you convert it from double to single. For example, when you convert the double-
precision number 3.14 to single, it is rounded by
double(single(3.14) - 3.14)
ans =
1.0490e-07
single
2.3842e-07
The decimal number 4/3 is not exactly representable as a binary fraction. For this reason, the
following calculation does not give zero, but rather reveals the quantity eps.
e = 1 - 3*(4/3 - 1)
e =
2.2204e-16
Similarly, 0.1 is not exactly representable as a binary number. Thus, you get the following
nonintuitive behavior:
a = 0.0;
for i = 1:10
a = a + 0.1;
end
a == 1
ans =
logical
4-11
4 Numeric Classes
logical
There are gaps between floating-point numbers. As the numbers get larger, so do the gaps, as
evidenced by:
(2^53 + 1) - 2^53
ans =
0
Since pi is not really π, it is not surprising that sin(pi) is not exactly zero:
sin(pi)
ans =
1.224646799147353e-16
When subtractions are performed with nearly equal operands, sometimes cancellation can occur
unexpectedly. The following is an example of a cancellation caused by swamping (loss of precision
that makes the addition insignificant).
sqrt(1e-16 + 1) - 1
ans =
0
Some functions in MATLAB, such as expm1 and log1p, may be used to compensate for the effects of
catastrophic cancellation.
Round-off, cancellation, and other traits of floating-point arithmetic combine to produce startling
computations when solving the problems of linear algebra. MATLAB warns that the following matrix A
is ill-conditioned, and therefore the system Ax = b may be sensitive to small perturbations:
A = diag([2 eps]);
b = [2; eps];
y = A\b;
Warning: Matrix is close to singular or badly scaled.
Results may be inaccurate. RCOND = 1.110223e-16.
These are only a few of the examples showing how IEEE floating-point arithmetic affects
computations in MATLAB. Note that all computations performed in IEEE 754 arithmetic are affected,
this includes applications written in C or FORTRAN, as well as MATLAB.
References
[1] Moler, Cleve. “Floating Points.” MATLAB News and Notes. Fall, 1996.
[2] Moler, Cleve. Numerical Computing with MATLAB. Natick, MA: The MathWorks, Inc., 2004.
4-12
Create Complex Numbers
The following statement shows one way of creating a complex value in MATLAB. The variable x is
assigned a complex number with a real part of 2 and an imaginary part of 3:
x = 2 + 3i;
Another way to create a complex number is using the complex function. This function combines two
numeric inputs into a complex output, making the first input real and the second imaginary:
x = rand(3) * 5;
y = rand(3) * -8;
z = complex(x, y)
z =
4.7842 -1.0921i 0.8648 -1.5931i 1.2616 -2.2753i
2.6130 -0.0941i 4.8987 -2.3898i 4.3787 -3.7538i
4.4007 -7.1512i 1.3572 -5.2915i 3.6865 -0.5182i
You can separate a complex number into its real and imaginary parts using the real and imag
functions:
zr = real(z)
zr =
4.7842 0.8648 1.2616
2.6130 4.8987 4.3787
4.4007 1.3572 3.6865
zi = imag(z)
zi =
-1.0921 -1.5931 -2.2753
-0.0941 -2.3898 -3.7538
-7.1512 -5.2915 -0.5182
4-13
4 Numeric Classes
Infinity
MATLAB represents infinity by the special value Inf. Infinity results from operations like division by
zero and overflow, which lead to results too large to represent as conventional floating-point values.
MATLAB also provides a function called Inf that returns the IEEE arithmetic representation for
positive infinity as a double scalar value.
Several examples of statements that return positive or negative infinity in MATLAB are shown here.
x = 1/0 x = 1.e1000
x = x =
Inf Inf
x = exp(1000) x = log(0)
x = x =
Inf -Inf
x = log(0);
isinf(x)
ans =
1
NaN
MATLAB represents values that are not real or complex numbers with a special value called NaN,
which stands for “Not a Number”. Expressions like 0/0 and inf/inf result in NaN, as do any
arithmetic operations involving a NaN:
x = 0/0
x =
NaN
x = NaN;
whos x
Name Size Bytes Class
x 1x1 8 double
The NaN function returns one of the IEEE arithmetic representations for NaN as a double scalar
value. The exact bit-wise hexadecimal representation of this NaN value is,
4-14
Infinity and NaN
format hex
x = NaN
x =
fff8000000000000
Always use the isnan function to verify that the elements in an array are NaN:
isnan(x)
ans =
MATLAB preserves the “Not a Number” status of alternate NaN representations and treats all of the
different representations of NaN equivalently. However, in some special cases (perhaps due to
hardware limitations), MATLAB does not preserve the exact bit pattern of alternate NaN
representations throughout an entire calculation, and instead uses the canonical NaN bit pattern
defined above.
Because two NaNs are not equal to each other, logical operations involving NaN always return false,
except for a test for inequality, (NaN ~= NaN):
NaN ~= NaN
ans =
1
4-15
4 Numeric Classes
Command Operation
whos x Display the data type of x.
xType = class(x); Assign the data type of x to a variable.
isnumeric(x) Determine if x is a numeric type.
isa(x, 'integer') Determine if x is the specified numeric type. (Examples for any
isa(x, 'uint64') integer, unsigned 64-bit integer, any floating point, double precision,
isa(x, 'float') and single precision are shown here).
isa(x, 'double')
isa(x, 'single')
isreal(x) Determine if x is real or complex.
isnan(x) Determine if x is Not a Number (NaN).
isinf(x) Determine if x is infinite.
isfinite(x) Determine if x is finite.
4-16
Display Format for Numeric Values
x = 4/3
x =
1.3333
You can change the display in the Command Window or Editor using the format function.
format long
x
x =
1.333333333333333
Using the format function only sets the format for the current MATLAB session. To set the format for
subsequent sessions, click Preferences on the Home tab in the Environment section. Select
MATLAB > Command Window, and then choose a Numeric format option.
4-17
4 Numeric Classes
The display format only affects how numbers are displayed, not how they are stored in MATLAB.
See Also
format
Related Examples
• “Format Output”
4-18
Integer Arithmetic
Integer Arithmetic
This example shows how to perform arithmetic on integer data representing signals and images.
Load measurement datasets comprising signals from four instruments using 8 and 16-bit A-to-D's
resulting in data saved as int8, int16 and uint16. Time is stored as uint16.
load integersignal
% Look at variables
whos Signal1 Signal2 Signal3 Signal4 Time1
Plot Data
First we will plot two of the signals to see the signal ranges.
4-19
4 Numeric Classes
It is likely that these values would need to be scaled to calculate the actual physical value that the
signal represents e.g. Volts.
Process Data
We can perform standard arithmetic on integers such as +, -, *, and /. Let's say we wished to find the
sum of Signal1 and Signal2.
Now let's plot the sum signal and see where it saturates.
cla;
plot(Time1, SumSig);
hold on
Saturated = (SumSig == intmin('int8')) | (SumSig == intmax('int8')); % Find where it has saturate
plot(Time1(Saturated),SumSig(Saturated),'rd')
grid
hold off
4-20
Integer Arithmetic
Here we see the images are 24-bit color, stored as three planes of uint8 data.
Display Images
cla;
image(street1); % Display image
axis equal
axis off
4-21
4 Numeric Classes
4-22
Integer Arithmetic
Scale an Image
We can scale the image by a double precision constant but keep the image stored as integers. For
example,
duller = 0.5 * street2; % Scale image with a double constant but create an integer
whos duller
subplot(1,2,1);
image(street2);
axis off equal tight
title('Original'); % Display image
subplot(1,2,2);
image(duller);
axis off equal tight
title('Duller'); % Display image
4-23
4 Numeric Classes
We can add the two street images together and plot the ghostly result.
4-24
Integer Arithmetic
4-25
4 Numeric Classes
Ad = [1 2 0; 2 5 -1; 4 10 -1]
Ad = 3×3
1 2 0
2 5 -1
4 10 -1
A = single(Ad); % or A = cast(Ad,'single');
We can also create single precision zeros and ones with their respective functions.
n = 1000;
Z = zeros(n,1,'single');
O = ones(n,1,'single');
whos A Ad O Z n
A 3x3 36 single
Ad 3x3 72 double
O 1000x1 4000 single
Z 1000x1 4000 single
n 1x1 8 double
We can see that some of the variables are of type single and that the variable A (the single precision
version of Ad) takes half the number of bytes of memory to store because singles require just four
bytes (32-bits), whereas doubles require 8 bytes (64-bits).
1 2 4
4-26
Single Precision Math
2 5 10
0 -1 -1
whos B
B 3x3 36 single
5 12 24
12 30 59
24 59 117
C = A .* B % Elementwise arithmetic
1 4 0
4 25 -10
0 -10 1
5 2 -2
-2 -1 1
0 -2 1
1 0 0
0 1 0
0 0 1
1 0 0
0 1 0
0 0 1
E = eig(A) % Eigenvalues
4-27
4 Numeric Classes
3.7321
0.2679
1.0000
F = fft(A(:,1)) % FFT
7.0000 + 0.0000i
-2.0000 + 1.7321i
-2.0000 - 1.7321i
12.3171
0.5149
0.1577
1 -5 5 -1
3.7321
1.0000
0.2679
R = conv(P,Q)
4-28
Single Precision Math
Now let's look at a function to compute enough terms in the Fibonacci sequence so the ratio is less
than the correct machine epsilon (eps) for datatype single or double.
ans = 19
ans = 41
fcurrent = ones(dtype);
fnext = fcurrent;
4-29
4 Numeric Classes
goldenMean = (ones(dtype)+sqrt(5))/2;
tol = eps(goldenMean);
nterms = 2;
while abs(fnext/fcurrent - goldenMean) >= tol
nterms = nterms + 1;
temp = fnext;
fnext = fnext + fcurrent;
fcurrent = temp;
end
Notice that we initialize several of our variables, fcurrent, fnext, and goldenMean, with values
that are dependent on the input datatype, and the tolerance tol depends on that type as well. Single
precision requires that we calculate fewer terms than the equivalent double precision calculation.
4-30
5
To apply a single condition, start by creating a 5-by-5 matrix that contains random integers between 1
and 15. Reset the random number generator to the default state for reproducibility.
rng default
A = randi(15,5)
A = 5×5
13 2 3 3 10
14 5 15 7 1
2 9 15 14 13
14 15 8 12 15
10 15 13 15 11
Use the relational less than operator, <, to determine which elements of A are less than 9. Store the
result in B.
B = A < 9
0 1 1 1 0
0 1 0 1 1
1 0 0 0 0
0 0 1 0 0
0 0 0 0 0
The result is a logical matrix. Each value in B represents a logical 1 (true) or logical 0 (false) state
to indicate whether the corresponding element of A fulfills the condition A < 9. For example, A(1,1)
is 13, so B(1,1) is logical 0 (false). However, A(1,2) is 2, so B(1,2) is logical 1 (true).
Although B contains information about which elements in A are less than 9, it doesn’t tell you what
their values are. Rather than comparing the two matrices element by element, you can use B to index
into A.
A(B)
ans = 8×1
2
2
5
3
8
5-2
Find Array Elements That Meet a Condition
3
7
1
The result is a column vector of the elements in A that are less than 9. Since B is a logical matrix, this
operation is called logical indexing. In this case, the logical array being used as an index is the
same size as the other array, but this is not a requirement. For more information, see “Array
Indexing”.
Some problems require information about the locations of the array elements that meet a condition
rather than their actual values. In this example, you can use the find function to locate all of the
elements in A less than 9.
I = find(A < 9)
I = 8×1
3
6
7
11
14
16
17
22
The result is a column vector of linear indices. Each index describes the location of an element in A
that is less than 9, so in practice A(I) returns the same result as A(B). The difference is that A(B)
uses logical indexing, whereas A(I) uses linear indexing.
You can use the logical and, or, and not operators to apply any number of conditions to an array; the
number of conditions is not limited to one or two.
First, use the logical and operator, denoted &, to specify two conditions: the elements must be less
than 9 and greater than 2. Specify the conditions as a logical index to view the elements that
satisfy both conditions.
ans = 5×1
5
3
8
3
7
The result is a list of the elements in A that satisfy both conditions. Be sure to specify each condition
with a separate statement connected by a logical operator. For example, you cannot specify the
conditions above by A(2<A<9), since it evaluates to A(2<A | A<9).
Next, find the elements in A that are less than 9 and even numbered.
5-3
5 The Logical Class
ans = 3×1
2
2
8
The result is a list of all even elements in A that are less than 9. The use of the logical NOT operator,
~, converts the matrix mod(A,2) into a logical matrix, with a value of logical 1 (true) located where
an element is evenly divisible by 2.
Finally, find the elements in A that are less than 9 and even numbered and not equal to 2.
A(A<9 & ~mod(A,2) & A~=2)
ans = 8
The result, 8, is even, less than 9, and not equal to 2. It is the only element in A that satisfies all three
conditions.
Use the find function to get the index of the element equal to 8 that satisfies the conditions.
find(A<9 & ~mod(A,2) & A~=2)
ans = 14
Sometimes it is useful to simultaneously change the values of several existing array elements. Use
logical indexing with a simple assignment statement to replace the values in an array that meet a
condition.
Replace all values in A that are greater than 10 with the number 10.
A(A>10) = 10
A = 5×5
10 2 3 3 10
10 5 10 7 1
2 9 10 10 10
10 10 8 10 10
10 10 10 10 10
Next, replace all values in A that are not equal to 10 with a NaN value.
A(A~=10) = NaN
A = 5×5
5-4
Find Array Elements That Meet a Condition
10 10 10 10 10
Lastly, replace all of the NaN values in A with zeros and apply the logical NOT operator, ~A.
A(isnan(A)) = 0;
C = ~A
0 1 1 1 0
0 1 0 1 1
1 1 0 0 0
0 0 1 0 0
0 0 0 0 0
The resulting matrix has values of logical 1 (true) in place of the NaN values, and logical 0 (false)
in place of the 10s. The logical NOT operation, ~A, converts the numeric array into a logical array
such that A&C returns a matrix of logical 0 (false) values and A|C returns a matrix of logical 1
(true) values.
See Also
nan | Logical Operators: Short Circuit | isnan | find | and | or | xor | not
5-5
5 The Logical Class
The any and all functions are natural extensions of the logical | (OR) and & (AND) operators,
respectively. However, rather than comparing just two elements, the any and all functions compare
all of the elements in a particular dimension of an array. It is as if all of those elements are connected
by & or | operators and the any or all functions evaluate the resulting long logical expressions.
Therefore, unlike the core logical operators, the any and all functions reduce the size of the array
dimension that they operate on so that it has size 1. This enables the reduction of many logical values
into a single logical condition.
First, create a matrix A that contains random integers between 1 and 25. Reset the random number
generator to the default state for reproducibility.
rng default
A = randi(25,5)
A = 5×5
21 3 4 4 17
23 7 25 11 1
4 14 24 23 22
23 24 13 20 24
16 25 21 24 17
Next, use the mod function along with the logical NOT operator, ~, to determine which elements in A
are even.
A = ~mod(A,2)
0 0 1 1 0
0 0 0 0 0
1 1 1 0 1
0 1 0 1 1
1 0 0 1 0
The resulting matrices have values of logical 1 (true) where an element is even, and logical 0
(false) where an element is odd.
Since the any and all functions reduce the dimension that they operate on to size 1, it normally
takes two applications of one of the functions to reduce a 2–D matrix into a single logical condition,
such as any(any(A)). However, if you use the notation A(:) to regard all of the elements of A as a
single column vector, you can use any(A(:)) to get the same logical information without nesting the
function calls.
any(A(:))
5-6
Reduce Logical Arrays to Single Value
ans = logical
1
You can perform logical and relational comparisons within the function call to any or all. This makes
it easy to quickly test an array for a variety of properties.
all(~A(:))
ans = logical
0
Determine whether any main or super diagonal elements in A are even. Since the vectors returned by
diag(A) and diag(A,1) are not the same size, you first need to reduce each diagonal to a single
scalar logical condition before comparing them. You can use the short-circuit OR operator || to
perform the comparison, since if any elements in the first diagonal are even then the entire
expression evaluates to true regardless of what appears on the right-hand side of the operator.
any(diag(A)) || any(diag(A,1))
ans = logical
1
See Also
any | all | and | or | xor | Logical Operators: Short Circuit
5-7
6
You can store any 1-by-n sequence of characters as a string, using the string data type. Starting in
R2017a, enclose text in double quotes to create a string.
str =
"Hello, world"
Though the text "Hello, world" is 12 characters long, str itself is a 1-by-1 string, or string scalar.
You can use a string scalar to specify a file name, plot label, or any other piece of textual information.
n = strlength(str)
n = 12
If the text includes double quotes, use two double quotes within the definition.
str =
"They said, "Welcome!" and waved."
To add text to the end of a string, use the plus operator, +. If a variable can be converted to a string,
then plus converts it and appends it.
fahrenheit = 71;
celsius = (fahrenheit-32)/1.8;
tempText = "temperature is " + celsius + "C"
tempText =
"temperature is 21.6667C"
Starting in R2019a, you can also concatenate text using the append function.
tempText2 =
"Today's temperature is 21.6667C"
The string function can convert different types of inputs, such as numeric, datetime, duration, and
categorical values. For example, convert the output of pi to a string.
ps = string(pi)
ps =
"3.1416"
6-2
Text in String and Character Arrays
You can store multiple pieces of text in a string array. Each element of the array can contain a string
having a different number of characters, without padding.
str = ["Mercury","Gemini","Apollo";...
"Skylab","Skylab B","ISS"]
str is a 2-by-3 string array. You can find the lengths of the strings with the strlength function.
N = strlength(str)
N = 2×3
7 6 6
6 8 3
As of R2018b, string arrays are supported throughout MATLAB and MathWorks® products. Functions
that accept character arrays (and cell arrays of character vectors) as inputs also accept string arrays.
To store a 1-by-n sequence of characters as a character vector, using the char data type, enclose it in
single quotes.
chr =
'Hello, world'
The text 'Hello, world' is 12 characters long, and chr stores it as a 1-by-12 character vector.
whos chr
If the text includes single quotes, use two single quotes within the definition.
chr =
'They said, 'Welcome!' and waved.'
• To specify single pieces of text, such as file names and plot labels.
• To represent data that is encoded using characters. In such cases, you might need easy access to
individual characters.
seq = 'GCTAGAATCC';
6-3
6 Characters and Strings
You can access individual characters or subsets of characters by indexing, just as you would index
into a numeric array.
seq(4:6)
ans =
'AGA'
Concatenate character vector with square brackets, just as you concatenate other types of arrays.
seq2 =
'GCTAGAATCCATTAGAAACC'
Starting in R2019a, you also can concatenate text using append. The append function is
recommended because it treats string arrays, character vectors, and cell arrays of character vectors
consistently.
seq2 = append(seq,'ATTAGAAACC')
seq2 =
'GCTAGAATCCATTAGAAACC'
MATLAB functions that accept string arrays as inputs also accept character vectors and cell arrays of
character vectors.
See Also
string | char | cellstr | strlength | plus | horzcat | append
Related Examples
• “Create String Arrays” on page 6-5
• “Analyze Text Data with String Arrays” on page 6-15
• “Frequently Asked Questions About String Arrays” on page 6-59
• “Update Your Code to Accept Strings” on page 6-64
• “Cell Arrays of Character Vectors” on page 6-12
6-4
Create String Arrays
MATLAB® provides string arrays to store pieces of text. Each element of a string array contains a 1-
by-n sequence of characters.
str =
"Hello, world"
As an alternative, you can convert a character vector to a string using the string function. chr is a
1-by-17 character vector. str is a 1-by-1 string that has the same text as the character vector.
chr = 'Greetings, friend'
chr =
'Greetings, friend'
str = string(chr)
str =
"Greetings, friend"
Create a string array containing multiple strings using the [] operator. str is a 2-by-3 string array
that contains six strings.
str = ["Mercury","Gemini","Apollo";
"Skylab","Skylab B","ISS"]
Find the length of each string in str with the strlength function. Use strlength, not length, to
determine the number of characters in strings.
L = strlength(str)
L = 2×3
7 6 6
6 8 3
As an alternative, you can convert a cell array of character vectors to a string array using the string
function. MATLAB displays strings in string arrays with double quotes, and displays characters
vectors in cell arrays with single quotes.
6-5
6 Characters and Strings
C = {'Mercury','Venus','Earth'}
C = 1x3 cell
{'Mercury'} {'Venus'} {'Earth'}
str = string(C)
In addition to character vectors, you can convert numeric, datetime, duration, and categorical values
to strings using the string function.
ans =
"01-Sep-2021 16:04:06"
Also, you can read text from files into string arrays using the readtable, textscan, and fscanf
functions.
String arrays can contain both empty and missing values. An empty string contains zero characters.
When you display an empty string, the result is a pair of double quotes with nothing between them
(""). The missing string is the string equivalent to NaN for numeric arrays. It indicates where a string
array has missing values. When you display a missing string, the result is <missing>, with no
quotation marks.
Create an empty string array using the strings function. When you call strings with no
arguments, it returns an empty string. Note that the size of str is 1-by-1, not 0-by-0. However, str
contains zero characters.
str = strings
str =
""
Create an empty character vector using single quotes. Note that the size of chr is 0-by-0.
chr = ''
chr =
6-6
Create String Arrays
Create a string array where every element is an empty string. You can preallocate a string array with
the strings function.
str = strings(2,3)
To create a missing string, convert a missing value using the string function. The missing string
displays as <missing>.
str = string(missing)
str =
<missing>
You can create a string array with both empty and missing strings. Use the ismissing function to
determine which elements are strings with missing values. Note that the empty string is not a
missing string.
str(1) = "";
str(2) = "Gemini";
str(3) = string(missing)
ismissing(str)
0 0 1
Compare a missing string to another string. The result is always 0 (false), even when you compare a
missing string to another missing string.
str = string(missing);
str == "Gemini"
ans = logical
0
str == string(missing)
ans = logical
0
String arrays support array operations such as indexing and reshaping. Use array indexing to access
the first row of str and all the columns.
6-7
6 Characters and Strings
str = ["Mercury","Gemini","Apollo";
"Skylab","Skylab B","ISS"];
str(1,:)
str(2,2)
ans =
"Skylab B"
Assign a new string outside the bounds of str. MATLAB expands the array and fills unallocated
elements with missing values.
str(3,4) = "Mir"
You can index into a string array using curly braces, {}, to access characters directly. Use curly
braces when you need to access and modify characters within a string element. Indexing with curly
braces provides compatibility for code that could work with either string arrays or cell arrays of
character vectors. But whenever possible, use string functions to work with the characters in strings.
Access the second element in the second row with curly braces. chr is a character vector, not a
string.
str = ["Mercury","Gemini","Apollo";
"Skylab","Skylab B","ISS"];
chr = str{2,2}
chr =
'Skylab B'
Access the character vector and return the first three characters.
str{2,2}(1:3)
ans =
'Sky'
Find the space characters in a string and replace them with dashes. Use the isspace function to
inspect individual characters within the string. isspace returns a logical vector that contains a true
value wherever there is a space character. Finally, display the modified string element, str(2,2).
TF = isspace(str{2,2})
6-8
Create String Arrays
0 0 0 0 0 0 1 0
str{2,2}(TF) = "-";
str(2,2)
ans =
"Skylab-B"
Note that in this case, you can also replace spaces using the replace function, without resorting to
curly brace indexing.
replace(str(2,2)," ","-")
ans =
"Skylab-B"
Concatenate strings into a string array just as you would concatenate arrays of any other kind.
Transpose str1 and str2. Concatenate them and then vertically concatenate column headings onto
the string array. When you concatenate character vectors into a string array, the character vectors
are automatically converted to strings.
str1 = str1';
str2 = str2';
str = [str1 str2];
str = [["Mission:","Station:"] ; str]
To append text to strings, use the plus operator, +. The plus operator appends text to strings but
does not change the size of a string array.
Append a last name to an array of names. If you append a character vector to strings, then the
character vector is automatically converted to a string.
names = ["Mary";"John";"Elizabeth";"Paul";"Ann"];
names = names + ' Smith'
6-9
6 Characters and Strings
"John Smith"
"Elizabeth Smith"
"Paul Smith"
"Ann Smith"
Append different last names. You can append text to a string array from a string array or from a cell
array of character vectors. When you add nonscalar arrays, they must be the same size.
names = ["Mary";"John";"Elizabeth";"Paul";"Ann"];
lastnames = ["Jones";"Adams";"Young";"Burns";"Spencer"];
names = names + " " + lastnames
Append a missing string. When you append a missing string with the plus operator, the output is a
missing string.
str1 = "Jones";
str2 = string(missing);
str1 + str2
ans =
<missing>
MATLAB provides a rich set of functions to work with string arrays. For example, you can use the
split, join, and sort functions to rearrange the string array names so that the names are in
alphabetical order by last name.
Split names on the space characters. Splitting changes names from a 5-by-1 string array to a 5-by-2
array.
names = ["Mary Jones";"John Adams";"Elizabeth Young";"Paul Burns";"Ann Spencer"];
names = split(names)
Switch the columns of names so that the last names are in the first column. Add a comma after each
last name.
names = [names(:,2) names(:,1)];
names(:,1) = names(:,1) + ','
6-10
Create String Arrays
"Adams," "John"
"Young," "Elizabeth"
"Burns," "Paul"
"Spencer," "Ann"
Join the last and first names. The join function places a space character between the strings it joins.
After the join, names is a 5-by-1 string array.
names = join(names)
names = sort(names)
See Also
string | strings | strlength | ismissing | isspace | plus | split | join | sort
Related Examples
• “Analyze Text Data with String Arrays” on page 6-15
• “Search and Replace Text” on page 6-37
• “Compare Text” on page 6-32
• “Test for Empty Strings and Missing Values” on page 6-20
• “Frequently Asked Questions About String Arrays” on page 6-59
• “Update Your Code to Accept Strings” on page 6-64
6-11
6 Characters and Strings
Note
• As of R2018b, the recommended way to store text is to use string arrays. If you create variables
that have the string data type, store them in string arrays, not cell arrays. For more information,
see “Text in String and Character Arrays” on page 6-2 and “Update Your Code to Accept Strings”
on page 6-64.
• While the phrase cell array of strings frequently has been used to describe such cell arrays, the
phrase is no longer accurate because such a cell array holds character vectors, not strings.
C = 1x5 cell
{'Li'} {'Sanchez'} {'Jones'} {'Yang'} {'Larson'}
The character vectors in C can have different lengths because a cell array does not require that its
contents have the same size. To determine the lengths of the character vectors in C, use the
strlength function.
L = strlength(C)
L = 1×5
2 7 5 4 6
chr =
'Li'
6-12
Cell Arrays of Character Vectors
C = 1x5 cell
{'Yang'} {'Sanchez'} {'Jones'} {'Yang'} {'Larson'}
To refer to a subset of cells, instead of their contents, index using smooth parentheses.
C(1:3)
While you can access the contents of cells by indexing, most functions that accept cell arrays as
inputs operate on the entire cell array. For example, you can use the strcmp function to compare the
contents of C to a character vector. strcmp returns 1 where there is a match and 0 otherwise.
TF = strcmp(C,'Yang')
1 0 0 1 0
num = sum(TF)
num = 2
Use TF as logical indices to return the matches in C. If you index using smooth parentheses, then the
output is a cell array containing only the matches.
M = C(TF)
M = 1x2 cell
{'Yang'} {'Yang'}
You can convert cell arrays of character vectors to string arrays. To convert a cell array of character
vectors, use the string function.
C = {'Li','Sanchez','Jones','Yang','Larson'}
C = 1x5 cell
{'Li'} {'Sanchez'} {'Jones'} {'Yang'} {'Larson'}
str = string(C)
6-13
6 Characters and Strings
In fact, the string function converts any cell array, so long as all of the contents can be converted to
strings.
str2 = string(C2)
See Also
cellstr | char | iscellstr | strcmp | string
More About
• “Text in String and Character Arrays” on page 6-2
• “Access Data in Cell Array” on page 12-5
• “Create String Arrays” on page 6-5
• “Update Your Code to Accept Strings” on page 6-64
• “Frequently Asked Questions About String Arrays” on page 6-59
6-14
Analyze Text Data with String Arrays
Read text from Shakespeare's Sonnets with the fileread function. fileread returns the text as a
1-by-100266 character vector.
sonnets = fileread('sonnets.txt');
sonnets(1:35)
ans =
'THE SONNETS
by William Shakespeare'
Convert the text to a string using the string function. Then, split it on newline characters using the
splitlines function. sonnets becomes a 2625-by-1 string array, where each string contains one
line from the poems. Display the first five lines of sonnets.
sonnets = string(sonnets);
sonnets = splitlines(sonnets);
sonnets(1:5)
To calculate the frequency of the words in sonnets, first clean it by removing empty strings and
punctuation marks. Then reshape it into a string array that contains individual words as elements.
Remove the strings with zero characters ("") from the string array. Compare each element of
sonnets to "", the empty string. Starting in R2017a, you can create strings, including an empty
string, using double quotes. TF is a logical vector that contains a true value wherever sonnets
contains a string with zero characters. Index into sonnets with TF and delete all strings with zero
characters.
TF = (sonnets == "");
sonnets(TF) = [];
sonnets(1:10)
6-15
6 Characters and Strings
Replace some punctuation marks with space characters. For example, replace periods, commas, and
semi-colons. Keep apostrophes because they can be part of some words in the Sonnets, such as
light's.
p = [".","?","!",",",";",":"];
sonnets = replace(sonnets,p," ");
sonnets(1:10)
Strip leading and trailing space characters from each element of sonnets.
sonnets = strip(sonnets);
sonnets(1:10)
Split sonnets into a string array whose elements are individual words. You can use the split
function to split elements of a string array on whitespace characters, or on delimiters that you
specify. However, split requires that every element of a string array must be divisible into an equal
number of new strings. The elements of sonnets have different numbers of spaces, and therefore are
not divisible into equal numbers of strings. To use the split function on sonnets, write a for-loop
that calls split on one element at a time.
Create the empty string array sonnetWords using the strings function. Write a for-loop that splits
each element of sonnets using the split function. Concatenate the output from split onto
sonnetWords. Each element of sonnetWords is an individual word from sonnets.
sonnetWords = strings(0);
for i = 1:length(sonnets)
6-16
Analyze Text Data with String Arrays
Find the unique words in sonnetWords. Count them and sort them based on their frequency.
To count words that differ only by case as the same word, convert sonnetWords to lowercase. For
example, The and the count as the same word. Find the unique words using the unique function.
Then, count the number of times each unique word occurs using the histcounts function.
sonnetWords = lower(sonnetWords);
[words,~,idx] = unique(sonnetWords);
numOccurrences = histcounts(idx,numel(words));
Sort the words in sonnetWords by number of occurrences, from most to least common.
[rankOfOccurrences,rankIndex] = sort(numOccurrences,'descend');
wordsByFrequency = words(rankIndex);
Plot the occurrences of words in the Sonnets from the most to least common words. Zipf's Law states
that the distribution of occurrences of words in a large body text follows a power-law distribution.
loglog(rankOfOccurrences);
xlabel('Rank of word (most to least common)');
ylabel('Number of Occurrences');
6-17
6 Characters and Strings
Calculate the total number of occurrences of each word in sonnetWords. Calculate the number of
occurrences as a percentage of the total number of words, and calculate the cumulative percentage
from most to least common. Write the words and the basic statistics for them to a table.
numOccurrences = numOccurrences(rankIndex);
numOccurrences = numOccurrences';
numWords = length(sonnetWords);
T = table;
T.Words = wordsByFrequency;
6-18
Analyze Text Data with String Arrays
T.NumOccurrences = numOccurrences;
T.PercentOfText = numOccurrences / numWords * 100.0;
T.CumulativePercentOfText = cumsum(numOccurrences) / numWords * 100.0;
T(1:10,:)
ans=10×4 table
Words NumOccurrences PercentOfText CumulativePercentOfText
______ ______________ _____________ _______________________
The most common word in the Sonnets, and, occurs 490 times. Together, the ten most common words
account for 20.163% of the text.
See Also
string | split | join | unique | replace | lower | splitlines | histcounts | strip | sort |
table
Related Examples
• “Create String Arrays” on page 6-5
• “Search and Replace Text” on page 6-37
• “Compare Text” on page 6-32
• “Test for Empty Strings and Missing Values” on page 6-20
6-19
6 Characters and Strings
You can test a string array for empty strings using the == operator.
Starting in R2017a, you can create an empty string using double quotes with nothing between them
(""). Note that the size of str is 1-by-1, not 0-by-0. However, str contains zero characters.
str = ""
str =
""
Create an empty character vector using single quotes. Note that the size of chr is 0-by-0. The
character array chr actually is an empty array, and not just an array with zero characters.
chr = ''
chr =
Create an array of empty strings using the strings function. Each element of the array is a string
with no characters.
str2 = strings(1,3)
if (str == "")
disp 'str has zero characters'
end
Do not use the isempty function to test for empty strings. A string with zero characters still has a
size of 1-by-1. However, you can test if a string array has at least one dimension with a size of zero
using the isempty function.
Create an empty string array using the strings function. To be an empty array, at least one
dimension must have a size of zero.
str = strings(0,3)
6-20
Test for Empty Strings and Missing Values
str =
isempty(str)
ans = logical
1
Test a string array for empty strings. The == operator returns a logical array that is the same size as
the string array.
str = ["Mercury","","Apollo"]
str == ''
0 1 0
Strings always contain the empty string as a substring. In fact, the empty string is always at both the
start and the end of every string. Also, the empty string is always found between any two consecutive
characters in a string.
TF = logical
1
TF = startsWith(str,"")
TF = logical
1
Count the number of characters in str. Then count the number of empty strings in str. The count
function counts empty strings at the beginning and end of str, and between each pair of characters.
Therefore if str has N characters, it also has N+1 empty strings.
str
str =
"Hello, world"
6-21
6 Characters and Strings
strlength(str)
ans = 12
count(str,"")
ans = 13
Replace a substring with the empty string. When you call replace with an empty string, it removes
the substring and replaces it with a string that has zero characters.
replace(str,"world","")
ans =
"Hello, "
Insert a substring after empty strings using the insertAfter function. Because there are empty
strings between each pair of characters, insertAfter inserts substrings between each pair.
insertAfter(str,"","-")
ans =
"-H-e-l-l-o-,- -w-o-r-l-d-"
In general, string functions that replace, erase, extract, or insert substrings allow you to specify
empty strings as the starts and ends of the substrings to modify. When you do so, these functions
operate on the start and end of the string, and between every pair of characters.
You can test a string array for missing values using the ismissing function. The missing string is the
string equivalent to NaN for numeric arrays. It indicates where a string array has missing values. The
missing string displays as <missing>.
To create a missing string, convert a missing value using the string function.
str = string(missing)
str =
<missing>
You can create a string array with both empty and missing strings. Use the ismissing function to
determine which elements are strings with missing values. Note that the empty string is not a
missing string.
str(1) = "";
str(2) = "Gemini";
str(3) = string(missing)
ismissing(str)
0 0 1
6-22
Test for Empty Strings and Missing Values
Compare str to a missing string. The comparison is always 0 (false), even when you compare a
missing string to another missing string.
str == string(missing)
0 0 0
To find missing strings, use the ismissing function. Do not use the == operator.
See Also
string | strings | strlength | ismissing | contains | startsWith | endsWith | erase |
extractBetween | extractBefore | extractAfter | insertAfter | insertBefore | replace |
replaceBetween | eraseBetween | eq | all | any
Related Examples
• “Create String Arrays” on page 6-5
• “Analyze Text Data with String Arrays” on page 6-15
• “Search and Replace Text” on page 6-37
• “Compare Text” on page 6-32
6-23
6 Characters and Strings
Formatting Text
To convert data to text and control its format, you can use formatting operators with common
conversion functions, such as num2str and sprintf. These operators control notation, alignment,
significant digits, and so on. They are similar to those used by the printf function in the C
programming language. Typical uses for formatted text include text for display and output files.
For example, %f converts floating-point values to text using fixed-point notation. Adjust the format by
adding information to the operator, such as %.2f to represent two digits after the decimal mark, or
%12f to represent 12 characters in the output, padding with spaces as needed.
A = pi*ones(1,3);
txt = sprintf('%f | %.2f | %12f', A)
txt =
'3.141593 | 3.14 | 3.141593'
You can combine operators with ordinary text and special characters in a format specifier. For
instance, \n inserts a newline character.
txt =
'Displaying pi:
3.141593
3.14
3.141593'
Functions that support formatting operators are compose, num2str, sprintf, fprintf, and the
error handling functions assert, error, warning, and MException.
Conversion Character
The conversion character specifies the notation of the output. It consists of a single character and
appears last in the format specifier.
Specifier Description
c Single character.
6-24
Formatting Text
Specifier Description
d Decimal notation (signed).
e Exponential notation (using a lowercase e, as in 3.1415e+00).
E Exponential notation (using an uppercase E, as in 3.1415E+00).
f Fixed-point notation.
g The more compact of %e or %f. (Insignificant zeroes do not print.)
G Same as %g, but using an uppercase E.
o Octal notation (unsigned).
s Character vector or string array.
u Decimal notation (unsigned).
x Hexadecimal notation (unsigned, using lowercase letters a–f).
X Hexadecimal notation (unsigned, using uppercase letters A–F).
For example, format the number 46 using different conversion characters to display the number in
decimal, fixed-point, exponential, and hexadecimal formats.
A = 46*ones(1,4);
txt = sprintf('%d %f %e %X', A)
txt =
'46 46.000000 4.600000e+01 2E'
Subtype
The subtype field is a single alphabetic character that immediately precedes the conversion
character. Without the subtype field, the conversion characters %o, %x, %X, and %u treat input data as
integers. To treat input data as floating-point values instead and convert them to octal, decimal, or
hexadecimal representations, use one of following subtype specifiers.
b The input data are double-precision floating-point values rather than unsigned integers. For
example, to print a double-precision value in hexadecimal, use a format like %bx.
t The input data are single-precision floating-point values rather than unsigned integers.
Precision
The precision field in a formatting operator is a nonnegative integer that immediately follows a
period. For example, in the operator %7.3f, the precision is 3. For the %g operator, the precision
indicates the number of significant digits to display. For the %f, %e, and %E operators, the precision
indicates how many digits to display to the right of the decimal point.
txt =
'157.08 1.6e+02 157.079633 157.08'
While you can specify the precision in a formatting operator for input text (for example, in the %s
operator), there is usually no reason to do so. If you specify the precision as p, and p is less than the
number of characters in the input text, then the output contains only the first p characters.
6-25
6 Characters and Strings
Field Width
The field width in a formatting operator is a nonnegative integer that specifies the number of digits or
characters in the output when formatting input values. For example, in the operator %7.3f, the field
width is 7.
Specify different field widths. To show the width for each output, use the | character. By default, the
output text is padded with space characters when the field width is greater than the number of
characters.
txt = sprintf('|%e|%15e|%f|%15f|', pi*50*ones(1,4))
txt =
'|1.570796e+02| 1.570796e+02|157.079633| 157.079633|'
When used on text input, the field width can determine whether to pad the output text with spaces. If
the field width is less than or equal to the number of characters in the input text, then it has no effect.
txt = sprintf('%30s', 'Pad left with spaces')
txt =
' Pad left with spaces'
Flags
Optional flags control additional formatting of the output text. The table describes the characters you
can use as flags.
Right- and left-justify the output. The default behavior is to right-justify the output text.
txt = sprintf('right-justify: %12.2f\nleft-justify: %-12.2f',...
12.3, 12.3)
txt =
'right-justify: 12.30
6-26
Formatting Text
Display a + sign for positive numbers. The default behavior is to omit the leading + sign for positive
numbers.
txt =
'no sign: 12.30
sign: +12.30'
Pad to the left with spaces and zeroes. The default behavior is to pad with spaces.
txt =
'Pad with spaces: 5.20
Pad with zeroes: 000000005.20'
Note You can specify more than one flag in a formatting operator.
Value Identifiers
By default, functions such as sprintf insert values from input arguments into the output text in
sequential order. To process the input arguments in a nonsequential order, specify the order using
numeric identifiers in the format specifier. Specify nonsequential arguments with an integer
immediately following the % sign, followed by a $ sign.
ans = ans =
Special Characters
Special characters can be part of the output text. But because they cannot be entered as ordinary
text, they require specific character sequences to represent them. To insert special characters into
output text, use any of the character sequences in the table.
6-27
6 Characters and Strings
The figure illustrates how the field width and precision settings affect the output of the formatting
functions. In this figure, the zero following the % sign in the formatting operator means to add leading
zeroes to the output text rather than space characters.
6-28
Formatting Text
• If the field width w is greater than p+1+n, then the whole part of the output value is padded to the
left with w-(p+1+n) additional characters. The additional characters are space characters unless
the formatting operator includes the 0 flag. In that case, the additional characters are zeroes.
You can specify the field width and precision using values from a sequential argument list. Use an
asterisk (*) in place of the field width or precision fields of the formatting operator.
For example, format and display three numbers. In each case, use an asterisk to specify that the field
width or precision come from input arguments that follow the format specifier.
txt =
' 123.456780 16.428 3.1416'
The table describes the effects of each formatting operator in the example.
You can mix the two styles. For example, get the field width from the following input argument and
the precision from the format specifier.
txt =
'123.46'
You also can specify field width and precision as values from a nonsequential argument list, using an
alternate syntax shown in the figure. Within the formatting operator, specify the field width and
precision with asterisks that follow numbered identifiers and $ signs. Specify the values of the field
width and precision with input arguments that follow the format specifier.
For example, format and display three numbers. In each case, use a numbered identifier to specify
that the field width or precision come from input arguments that follow the format specifier.
6-29
6 Characters and Strings
txt =
' 123.456780 16.428 3.1416'
The table describes the effect of each formatting operator in the example.
ans = ans =
If your function call provides more input arguments than there are formatting operators in the format
specifier, then the operators are reused. However, only function calls that use sequential ordering
reuse formatting operators. You cannot reuse formatting operators when you use numbered
identifiers.
ans = ans =
'1234' '1'
6-30
Formatting Text
If you use numbered identifiers when the input data is a vector or array, then the output does not
contain formatted data.
ans = ans =
See Also
compose | sprintf | fprintf | num2str
Related Examples
• “Convert Text to Numeric Values” on page 6-49
• “Convert Numeric Values to Text” on page 6-45
6-31
6 Characters and Strings
Compare Text
Compare text in character arrays and string arrays in different ways. String arrays were introduced
in R2016b. You can compare string arrays and character vectors with relational operators and with
the strcmp function. You can sort string arrays using the sort function, just as you would sort
arrays of any other type. MATLAB® also provides functions to inspect characters in pieces of text.
For example, you can determine which characters in a character vector or string array are letters or
space characters.
You can compare string arrays for equality with the relational operators == and ~=. When you
compare string arrays, the output is a logical array that has 1 where the relation is true, and 0 where
it is not true.
Create two string scalars. Starting in R2017a, you can create strings using double quotes.
str1 = "Hello";
str2 = "World";
str1,str2
str1 =
"Hello"
str2 =
"World"
str1 == str2
ans = logical
0
str1 = ["Mercury","Gemini","Apollo";...
"Skylab","Skylab B","International Space Station"];
str2 = "Apollo";
str1 == str2
0 0 1
0 0 0
Compare a string array to a character vector. As long as one of the variables is a string array, you can
make the comparison.
chr = 'Gemini';
TF = (str1 == chr)
0 1 0
6-32
Compare Text
0 0 0
Index into str1 with TF to extract the string elements that matched Gemini. You can use logical
arrays to index into an array.
str1(TF)
ans =
"Gemini"
Compare for inequality using the ~= operator. Index into str1 to extract the elements that do not
match 'Gemini'.
TF = (str1 ~= chr)
1 0 1
1 1 1
str1(TF)
Compare two nonscalar string arrays. When you compare two nonscalar arrays, they must be the
same size.
str2 = ["Mercury","Mars","Apollo";...
"Jupiter","Saturn","Neptune"];
TF = (str1 == str2)
1 0 1
0 0 0
str1(TF)
You can also compare strings with the relational operators >, >=, <, and <=. Strings that start with
uppercase letters come before strings that start with lowercase letters. For example, the string
"ABC" is less than "abc". Digits and some punctuation marks also come before letters.
6-33
6 Characters and Strings
ans = logical
1
Compare a string array that contains names to another name with the > operator. The names
Sanchez, de Ponte, and Nash come after Matthews, because S, d, and N all are greater than M.
1 0 1 0 1
str(TF)
You can sort string arrays. MATLAB® stores characters as Unicode® using the UTF-16 character
encoding scheme. Character and string arrays are sorted according to the UTF-16 code point order.
For the characters that are also the ASCII characters, this order means that uppercase letters come
before lowercase letters. Digits and some punctuation also come before letters.
sort(str)
Sort a 2-by-3 string array. The sort function sorts the elements in each column separately.
sort(str2)
To sort the elements in each row, sort str2 along the second dimension.
sort(str2,2)
6-34
Compare Text
You can compare character vectors and cell arrays of character vectors to each other. Use the
strcmp function to compare two character vectors, or strncmp to compare the first N characters.
You also can use strcmpi and strncmpi for case-insensitive comparisons.
Compare two character vectors with the strcmp function. chr1 and chr2 are not equal.
chr1 = 'hello';
chr2 = 'help';
TF = strcmp(chr1,chr2)
TF = logical
0
Note that the MATLAB strcmp differs from the C version of strcmp. The C version of strcmp
returns 0 when two character arrays are the same, not when they are different.
Compare the first two characters with the strncmp function. TF is 1 because both character vectors
start with the characters he.
TF = strncmp(chr1,chr2,2)
TF = logical
1
Compare two cell arrays of character vectors. strcmp returns a logical array that is the same size as
the cell arrays.
1
0
0
You can inspect the characters in string arrays or character arrays with the isstrprop, isletter,
and isspace functions.
Determine which characters in a character vector are space characters. isspace returns a logical
vector that is the same size as chr.
6-35
6 Characters and Strings
0 0 0 0 1 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 1 0 0 0
The isstrprop function can query characters for many different traits. isstrprop can determine
whether characters in a string or character vector are letters, alphanumeric characters, decimal or
hexadecimal digits, or punctuation characters.
Determine which characters in a string are punctuation marks. isstrprop returns a logical vector
whose length is equal to the number of characters in str.
str =
"A horse! A horse! My kingdom for a horse!"
isstrprop(str,"punct")
0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
isstrprop(chr,"alpha")
1 1 1 1 0 1 1 1 1 1 0 1 1 1 0 1 1 1 1 1 0 1 1 1
See Also
strcmp | sort | isstrprop | isletter | isspace | eq | ne | gt | ge | le | lt
Related Examples
• “Text in String and Character Arrays” on page 6-2
• “Create String Arrays” on page 6-5
• “Analyze Text Data with String Arrays” on page 6-15
• “Search and Replace Text” on page 6-37
• “Test for Empty Strings and Missing Values” on page 6-20
6-36
Search and Replace Text
Processing text data often involves finding and replacing substrings. There are several functions that
find text and return different information: some functions confirm that the text exists, while others
count occurrences, find starting indices, or extract substrings. These functions work on character
vectors and string scalars, such as "yes", as well as character and string arrays, such as
["yes","no";"abc","xyz"]. In addition, you can use patterns to define rules for searching, such as
one or more letter or digit characters.
To determine if text is present, use a function that returns logical values, like contains,
startsWith, or endsWith. Logical values of 1 correspond to true, and 0 corresponds to false.
TF = logical
1
Calculate how many times the text occurs using the count function.
n = count(txt,"sea")
n = 2
To locate where the text occurs, use the strfind function, which returns starting indices.
idx = strfind(txt,"sea")
idx = 1×2
11 28
Find and extract text using extraction functions, such as extract, extractBetween,
extractBefore, or extractAfter.
mid = extractBetween(txt,"sea","shore")
mid =
"shells by the sea"
mid = extractBetween(txt,"sea","shore","Boundaries","inclusive")
mid =
"seashells by the seashore"
The search and replacement functions can also find text in multi-element arrays. For example, look
for color names in several song titles.
6-37
6 Characters and Strings
colors =["Red","Yellow","Blue","Black","White"];
TF = contains(songs,colors)
1
0
1
To list the songs that contain color names, use the logical TF array as indices into the original songs
array. This technique is called logical indexing.
colorful = songs(TF)
Use the function replace to replace text in songs that matches elements of colors with the string
"Orange".
replace(songs,colors,"Orange")
Match Patterns
Since R2020b
In addition to searching for literal text, like “sea” or “yellow”, you can search for text that matches a
pattern. There are many predefined patterns, such as digitsPattern to find numeric digits.
address = "123a Sesame Street, New York, NY 10128";
nums = extract(address,digitsPattern)
For additional precision in searches, you can combine patterns. For example, locate words that start
with the character “S”. Use a string to specify the “S” character, and lettersPattern to find
additional letters after that character.
pat = "S" + lettersPattern;
StartWithS = extract(address,pat)
6-38
Search and Replace Text
"Street"
See Also
contains | extract | count | pattern | replace | strfind
Related Examples
• “Text in String and Character Arrays” on page 6-2
• “Build Pattern Expressions” on page 6-40
• “Test for Empty Strings and Missing Values” on page 6-20
• “Regular Expressions” on page 2-51
6-39
6 Characters and Strings
Patterns are a tool to aid in searching for and modifying text. Similar to regular expressions, a
pattern defines rules for matching text. Patterns can be used with text-searching functions like
contains, matches, and extract to specify which portions of text these functions act on. You can
build a pattern expression in a way similar to how you would build a mathematical expression, using
pattern functions, operators, and literal text. Because building pattern expressions is open ended,
patterns can become quite complicated. Building patterns in steps and using functions like
maskedPattern and namedPattern can help organize complicated patterns.
The simplest pattern is built from a single pattern function. For example, lettersPattern matches
any letter characters. There are many pattern functions for matching different types of characters
and other features of text. A list of these functions can be found on the pattern reference page.
txt = "abc123def";
pat = lettersPattern;
extract(txt,pat)
Patterns combine with other patterns and literal text by using the plus(+) operator. This operator
appends patterns and text together in the order they are defined in the pattern expression. The
combined patterns only match text in the same order. In this example, "YYYY/MM/DD" is not a match
because a four-letter string must be at the end of the text.
Patterns used with the or(|) operator specify that only one of the two specified patterns needs to
match a section of text. If neither pattern is able to match then the pattern expression fails to match.
txt = "123abc";
pat = lettersPattern|digitsPattern;
extract(txt,pat)
Some pattern functions take patterns as their input and modify them in some way. For example,
optionalPattern makes a specified pattern match if possible, but the pattern is not required for a
successful match.
6-40
Build Pattern Expressions
Boundary Patterns
Boundary patterns are a special type of pattern that do not match characters but rather match the
boundaries between a designated character type and other characters or the start or end of that
piece of text. For example, digitBoundary matches the boundaries between digit characters and
nondigit characters and between digit characters and the start or end of the text. It does not match
digit characters themselves. Boundary patterns are useful as delimiters for functions like split.
txt = "123abc";
pat = digitBoundary;
split(txt,pat)
Boundary patterns are special amongst patterns because they can be negated using the not(~)
operator. When negated in this way, boundary patterns match before or after characters that did not
satisfy the requirements above. For example, ~digitBoundary matches the boundary between:
Use replace to mark the locations matched by ~digitBoundary with a "|" character.
txt = "123abc";
pat = ~digitBoundary;
replace(txt,pat,"|")
ans =
"1|2|3a|b|c|"
Sometimes a simple pattern is not sufficient to solve a problem and a more complicated pattern is
needed. As a pattern expression grows it can become difficult to understand what it is matching. One
way to simplify building a complicated pattern is building each part of the pattern separately and
then combining the parts together into a single pattern expression.
For instance, email addresses use the form [email protected]. Each of the three identifiers —
local_part, domain, and TLD — must be a combination of digits, letters and underscore characters. To
build the full pattern, start by defining a pattern for the identifiers. Build a pattern that matches one
letter or digit character or one underscore character.
6-41
6 Characters and Strings
identifier = asManyOfPattern(identCharacters,1);
Test the pattern by seeing how well it matches the following example emails.
exampleEmails = ["[email protected]"
"[email protected]"
"[email protected]"];
matches(exampleEmails,emailPattern)
1
0
0
The pattern fails to match several of the example emails even though all the emails are valid. Both the
local_part and domain can be made of a series of identifiers that are separated by periods. Use the
identifier pattern to build a pattern that is capable of matching a series of identifiers.
asManyOfPattern matches as many concurrent appearances of the specified pattern as possible,
but if there are none the rest of the pattern is still able to match successfully.
Use this pattern to build a new emailPattern that can match all of the example emails.
1
1
1
Complex patterns can sometimes be difficult to read and interpret, especially by those you share
them with who are unfamiliar with the pattern's structure. For example, when displayed,
emailPattern is long and difficult to read.
emailPattern
emailPattern = pattern
Matching:
Part of the issue with the display is that there are many repetitions of the identifier pattern. If the
exact details of this pattern are not important to users of the pattern, then the display of the
6-42
Build Pattern Expressions
identifier pattern can be concealed using maskedPattern. This function creates a new pattern
where the display of identifier is masked and the variable name, "identifier", is displayed
instead. Alternatively, you can specify a different name to be displayed. The details of patterns that
are masked in this way can be accessed by clicking "Show all details" in the displayed pattern.
identifier = maskedPattern(identifier);
identifierSeries = asManyOfPattern(identifier + ".") + identifier
identifierSeries = pattern
Matching:
Patterns can be further organized using the namedPattern function. namedPattern designates a
pattern as a named pattern that changes how the pattern is displayed when combined with other
patterns. Email addresses have several important portions, [email protected], which each have
their own matching rules. Create a named pattern for each section.
localPart = namedPattern(identifierSeries,"local_part");
Named patterns can be nested, to further delineate parts of a pattern. To nest a named pattern, build
a pattern using named patterns and then designate that pattern as a named pattern. For example,
Domain.TLD can be divided into the domain, subdomains, and the top level domain (TLD). Create
named patterns for each part of domain.TLD.
subdomain = namedPattern(identifierSeries,"subdomain");
domainName = namedPattern(identifier,"domainName");
tld = namedPattern(identifier,"TLD");
Nest the named patterns for the components of domain underneath a single named pattern domain.
domain = optionalPattern(subdomain + ".") + ...
domainName + "." + ...
tld;
domain = namedPattern(domain);
Combine the patterns together into a single named pattern, emailPattern. In the display of
emailPattern you can see each named pattern and what they match as well as the information on
any nested named patterns.
emailPattern = localPart + "@" + domain
emailPattern = pattern
Matching:
6-43
6 Characters and Strings
You can access named patterns and nested named patterns by dot-indexing into a pattern. For
example, you can access the nested named pattern subdomain by dot-indexing from emailPattern
into domain and then dot-indexing again into subdomain.
emailPattern.domain.subdomain
ans = pattern
Matching:
Dot-assignment can be used to change named patterns without needing to rewrite the rest of the
pattern expression.
emailPattern.domain = "mathworks.com"
emailPattern = pattern
Matching:
See Also
pattern | string | regexp | contains | replace | extract
More About
• “Search and Replace Text” on page 6-37
• “Regular Expressions” on page 2-51
6-44
Convert Numeric Values to Text
Convert to Strings
To convert a number to a string that represents it, use the string function.
str = string(pi)
str =
"3.1416"
The string function converts a numeric array to a string array having the same size.
A = [256 pi 8.9e-3];
str = string(A)
You can specify the format of the output text using the compose function, which accepts format
specifiers for precision, field width, and exponential notation.
str = compose("%9.7f",pi)
str =
"3.1415927"
If the input is a numeric array, then compose returns a string array. Return a string array that
represents numbers using exponential notation.
A = [256 pi 8.9e-3];
str = compose("%5.2e",A)
Before R2016b, convert numbers to character vectors and concatenate characters in brackets, [].
The simplest way to combine text and numbers is to use the plus operator (+). This operator
automatically converts numeric values to strings when the other operands are strings.
For example, plot a sine wave. Calculate the frequency of the wave and add a string representing that
value in the title of the plot.
X = linspace(0,2*pi);
Y = sin(X);
plot(X,Y)
6-45
6 Characters and Strings
freq = 1/(2*pi);
str = "Sine Wave, Frequency = " + freq + " Hz"
str =
"Sine Wave, Frequency = 0.15915 Hz"
title(str)
Sometimes existing text is stored in character vectors or cell arrays of character vectors. However,
the plus operator also automatically converts those types of data to strings when another operand is
a string. To combine numeric values with those types of data, first convert the numeric values to
strings, and then use plus to combine the text.
str =
"Sine Wave, Frequency = 0.15915 Hz"
Character Codes
If your data contains integers that represent Unicode® values, use the char function to convert the
values to the corresponding characters. The output is a character vector or array.
u = [77 65 84 76 65 66];
c = char(u)
c =
'MATLAB'
6-46
Convert Numeric Values to Text
Converting Unicode values also allows you to include special characters in text. For instance, the
Unicode value for the degree symbol is 176. To add char(176) to a string, use plus.
deg = char(176);
temp = 21;
str = "Temperature: " + temp + deg + "C"
str =
"Temperature: 21°C"
Before R2016b, use num2str to convert the numeric value to a character vector, and then
concatenate.
str =
'Temperature: 21°C'
Since R2019b
You can represent hexadecimal and binary values in your code either using text or using literals. The
recommended way to represent them is to write them as literals. You can write hexadecimal and
binary literals using the 0x and 0b prefixes respectively. However, it can sometimes be useful to
represent such values as text, using the dec2hex or dec2bin functions.
For example, set a bit in a binary value. If you specify the binary value using a literal, then it is stored
as an integer. After setting one of the bits, display the new binary value as text using the dec2bin
function.
register = 0b10010110
register = uint8
150
register = bitset(register,5,0)
register = uint8
134
binStr = dec2bin(register)
binStr =
'10000110'
See Also
dec2bin | dec2hex | char | string | compose | plus
More About
• “Convert Text to Numeric Values” on page 6-49
• “Hexadecimal and Binary Values” on page 6-55
• “Convert Between Datetime Arrays, Numbers, and Text” on page 7-42
• “Formatting Text” on page 6-24
6-47
6 Characters and Strings
6-48
Convert Text to Numeric Values
You can convert string arrays, character vectors, and cell arrays of character vectors to numeric
values. Text can represent hexadecimal or binary values, though when you convert them to numbers
they are stored as decimal values. You can also convert text representing dates and time to
datetime or duration values, which can be treated like numeric values.
Double-Precision Values
The recommended way to convert text to double-precision values is to use the str2double function.
It can convert character vectors, string arrays, and cell arrays of character vectors.
For example, create a character vector using single quotes and convert it to the number it represents.
X = str2double('3.1416')
X = 3.1416
If the input argument is a string array or cell array of character vectors, then str2double converts
it to a numeric array having the same size. You can create strings using double quotes. (Strings have
the string data type, while character vectors have the char data type.)
str = ["2.718","3.1416";
"137","0.015"]
X = str2double(str)
X = 2×2
2.7180 3.1416
137.0000 0.0150
The str2double function can convert text that includes commas (as thousands separators) and
decimal points. For example, you can use str2double to convert the Balance variable in the table
below. Balance represents numbers as strings, using a comma as the thousands separator.
load balances
balances
balances=3×2 table
Customer Balance
_________ ___________
"Diaz" "13,790.00"
"Johnson" "2,456.10"
6-49
6 Characters and Strings
"Wu" "923.71"
T.Balance = str2double(T.Balance)
T=3×2 table
Customer Balance
_________ _______
"Diaz" 13790
"Johnson" 2456.1
"Wu" 923.71
While the str2num function can also convert text to numbers, it is not recommended. str2num uses
the eval function, which can cause unintended side effects when the text input includes a function
name. To avoid these issues, use str2double.
As an alternative, you can convert strings to double-precision values using the double function. If the
input is a string array, then double returns a numeric array that has the same size, just as
str2double does. However, if the input is a character vector, then double converts the individual
characters to numbers representing their Unicode values.
X = double("3.1416")
X = 3.1416
X = double('3.1416')
X = 1×6
51 46 49 52 49 54
This list summarizes the best practices for converting text to numeric values.
• To convert text to numeric values, use the str2double function. It treats string arrays, character
vectors, and cell arrays of character vectors consistently.
• You can also use the double function for string arrays. However, it treats character vectors
differently.
• Avoid str2num. It calls the eval function which can have unintended consequences.
You can represent hexadecimal and binary numbers as text or as literals. When you write them as
literals, you must use the 0x and 0b prefixes. When you represent them as text and then convert
them, you can use the prefixes, but they are not required.
D = 0x3FF
D = uint16
1023
6-50
Convert Text to Numeric Values
Then convert text representing the same value by using the hex2dec function. It recognizes the
prefix but does not require it.
D = hex2dec('3FF')
D = 1023
D = hex2dec('0x3FF')
D = 1023
D = bin2dec('101010')
D = 42
D = bin2dec('0b101010')
D = 42
MATLAB provides the datetime and duration data types to store dates and times, and to treat
them as numeric values. To convert text representing dates and times, use the datetime and
duration functions.
Convert text representing a date to a datetime value. The datetime function recognizes many
common formats for dates and times.
C = '2019-09-20'
C =
'2019-09-20'
D = datetime(C)
D = datetime
20-Sep-2019
str = ["2019-01-31","2019-02-28","2019-03-31"]
D = datetime(str)
D = 1x3 datetime
31-Jan-2019 28-Feb-2019 31-Mar-2019
If you convert text to duration values, then use the hh:mm:ss or dd:hh:mm:ss formats.
D = duration('12:34:56')
6-51
6 Characters and Strings
D = duration
12:34:56
See Also
bin2dec | hex2dec | str2double | datetime | duration | double | table
More About
• “Convert Numeric Values to Text” on page 6-45
• “Convert Between Datetime Arrays, Numbers, and Text” on page 7-42
• “Hexadecimal and Binary Values” on page 6-55
• “Formatting Text” on page 6-24
• “Unicode and ASCII Values” on page 6-53
6-52
Unicode and ASCII Values
You can convert characters to integers that represent their Unicode code values. To convert a single
character or a character array, use any of these functions:
• double
• uint16, uint32, or uint64
The best practice is to use the double function. However, if you need to store the numeric values as
integers, use unsigned integers having at least 16 bits because MATLAB uses the UTF-16 encoding.
Convert a character vector to Unicode code values using the double function.
C = 'MATLAB'
C =
'MATLAB'
unicodeValues = double(C)
unicodeValues = 1×6
77 65 84 76 65 66
You cannot convert characters in a string array directly to Unicode code values. In particular, the
double function converts strings to the numbers they represent, just as the str2double function
does. If double cannot convert a string to a number, then it returns a NaN value.
str = "MATLAB";
double(str)
ans = NaN
To convert characters in a string, first convert the string to a character vector, or use curly braces to
extract the characters. Then convert the characters using a function such as double.
C = char(str);
unicodeValues = double(C)
unicodeValues = 1×6
77 65 84 76 65 66
You can convert Unicode values to characters using the char function.
6-53
6 Characters and Strings
D = [77 65 84 76 65 66]
D = 1×6
77 65 84 76 65 66
C = char(D)
C =
'MATLAB'
A typical use for char is to create characters you cannot type and append them to strings. For
example, create the character for the degree symbol and append it to a string. The Unicode code
value for the degree symbol is 176.
deg = char(176)
deg =
'°'
myLabel =
"Current temperature is 21°C"
For more information on Unicode, including mappings between characters and code values, see
Unicode.
See Also
char | double | single | string | int8 | int16 | int32 | int64 | uint8 | uint16 | uint32 |
uint64
More About
• “Convert Text to Numeric Values” on page 6-49
• “Convert Numeric Values to Text” on page 6-45
External Websites
• Unicode
6-54
Hexadecimal and Binary Values
• As literals. Starting in R2019b, you can write hexadecimal and binary values as literals using an
appropriate prefix as notation. For example, 0x2A is a literal that specifies 42—and MATLAB
stores it as a number, not as text.
• As strings or character vectors. For example, the character vector '2A' represents the number 42
as a hexadecimal value. When you represent a hexadecimal or binary value using text, enclose it
in quotation marks. MATLAB stores this representation as text, not a number.
MATLAB provides several functions for converting numbers to and from their hexadecimal and binary
representations.
Hexadecimal literals start with a 0x or 0X prefix, while binary literals start with a 0b or 0B prefix.
MATLAB stores the number written with this notation as an integer. For example, these two literals
both represent the integer 42.
A = 0x2A
A = uint8
42
B = 0b101010
B = uint8
42
Do not use quotation marks when you write a number using this notation. Use 0-9, A-F, and a-f to
represent hexadecimal digits. Use 0 and 1 to represent binary digits.
By default, MATLAB stores the number as the smallest unsigned integer type that can accommodate
it. However, you can use an optional suffix to specify the type of integer that stores the value.
• To specify unsigned 8-, 16-, 32-, and 64-bit integer types, use the suffixes u8, u16, u32, and u64.
• To specify signed 8-, 16-, 32-, and 64-bit integer types, use the suffixes s8, s16, s32, and s64.
A = 0x2As32
A = int32
42
When you specify signed integer types, you can write literals that represent negative numbers.
Represent negative numbers in two's complement form. For example, specify a negative number with
a literal using the s8 suffix.
A = 0xFFs8
A = int8
-1
6-55
6 Characters and Strings
Since MATLAB stores these literals as numbers, you can use them in any context or function where
you use numeric arrays.
You can also convert integers to character vectors that represent them as hexadecimal or binary
values using the dec2hex and dec2bin functions. Convert an integer to hexadecimal.
hexStr = dec2hex(255)
hexStr =
'FF'
binStr = dec2bin(16)
binStr =
'10000'
Since these functions produce text, use them when you need text that represents numeric values. For
example, you can append these values to a title or a plot label, or write them to a file that stores
numbers as their hexadecimal or binary representations.
The recommended way to convert an array of numbers to text is to use the compose function. This
function returns a string array having the same size as the input numeric array. To produce
hexadecimal format, use %X as the format specifier.
A = 1×5
hexStr = compose("%X",A)
The dec2hex and dec2bin functions also convert arrays of numbers to text representing them as
hexadecimal or binary values. However, these functions return character arrays, where each row
represents a number from the input numeric array, padded with zeros as necessary.
To convert a binary value to hexadecimal, start with a binary literal, and convert it to text
representing its hexadecimal value. Since a literal is interpreted as a number, you can specify it
directly as the input argument to dec2hex.
D = 0b1111;
hexStr = dec2hex(D)
hexStr =
'F'
6-56
Hexadecimal and Binary Values
If you start with a hexadecimal literal, then you can convert it to text representing its binary value
using dec2bin.
D = 0x8F;
binStr = dec2bin(D)
binStr =
'10001111'
One typical use of binary numbers is to represent bits. For example, many devices have registers that
provide access to a collection of bits representing data in memory or the status of the device. When
working with such hardware you can use numbers in MATLAB to represent the value in a register.
Use binary values and bitwise operations to represent and access particular bits.
Create a number that represents an 8-bit register. It is convenient to start with binary representation,
but the number is stored as an integer.
register = 0b10010110
register = uint8
150
To get or set the values of particular bits, use bitwise operations. For example, use the bitand and
bitshift functions to get the value of the fifth bit. (Shift that bit to the first position so that
MATLAB returns a 0 or 1. In this example, the fifth bit is a 1.)
b5 = bitand(register,0b10000);
b5 = bitshift(b5,-4)
b5 = uint8
1
register = bitset(register,5,0)
register = uint8
134
Since register is an integer, use the dec2bin function to display all the bits in binary format.
binStr is a character vector, and represents the binary value without a leading 0b prefix.
binStr = dec2bin(register)
binStr =
'10000110'
See Also
bin2dec | bitand | bitshift | bitset | dec2bin | dec2hex | hex2dec | sprintf | sscanf
More About
• “Convert Text to Numeric Values” on page 6-49
• “Convert Numeric Values to Text” on page 6-45
6-57
6 Characters and Strings
External Websites
• Two's Complement
6-58
Frequently Asked Questions About String Arrays
In most respects, strings arrays behave like character vectors and cell arrays of character vectors.
However, there are a few key differences between string arrays and character arrays that can lead to
results you might not expect. For each of these differences, there is a recommended way to use
strings that leads to the expected result.
With command syntax, you separate inputs with spaces rather than commas, and you do not enclose
input arguments in parentheses. For example, you can use the cd function with command syntax to
change folders.
cd C:\Temp
The text C:\Temp is a character vector. In command form, all arguments are always character
vectors. If you have an argument, such as a folder name, that contains spaces, then specify it as one
input argument by enclosing it in single quotes.
cd 'C:\Program Files'
But if you specify the argument using double quotes, then cd throws an error.
cd "C:\Program Files"
Error using cd
Too many input arguments.
The error message can vary depending on the function that you use and the arguments that you
specify. For example, if you use the load function with command syntax and specify the argument
using double quotes, then load throws a different error.
load "myVariables.mat"
In command form, double quotes are treated as part of the literal text rather than as the string
construction operator. If you wrote the equivalent of cd "C:\Program Files" in functional form,
then it would look like a call to cd with two arguments.
cd('"C:\Program','Files"')
When specifying arguments as strings, use function syntax. All functions that support command
syntax also support function syntax. For example, you can use cd with function syntax and input
arguments that are double quoted strings.
6-59
6 Characters and Strings
cd("C:\Program Files")
str = ["Venus","Earth","Mars"]
Avoid using cell arrays of strings. When you use cell arrays, you give up the performance advantages
that come from using string arrays. And in fact, most functions do not accept cell arrays of strings as
input arguments, options, or values of name-value pairs. For example, if you specify a cell array of
strings as an input argument, then the contains function throws an error.
C = {"Venus","Earth","Mars"}
TF = contains(C,"Earth")
str = ["Venus","Earth","Mars"];
TF = contains(str,"Earth");
Before R2016b, the term "cell array of strings" meant a cell array whose elements all contain
character vectors. But it is more precise to refer to such cell arrays as "cell arrays of character
vectors," to distinguish them from string arrays.
Cell arrays can contain variables having any data types, including strings. It is still possible to create
a cell array whose elements all contain strings. And if you already have specified cell arrays of
character vectors in your code, then replacing single quotes with double quotes might seem like a
simple update. However, it is not recommended that you create or use cell arrays of strings.
Create a character vector using single quotes. To determine its length, use the length function.
Because C is a vector, its length is equal to the number of characters. C is a 1-by-11 vector.
C = 'Hello world';
L = length(C)
L = 11
6-60
Frequently Asked Questions About String Arrays
Create a string with the same characters, using double quotes. Though it stores 11 characters, str is
a 1-by-1 string array, or string scalar. If you call length on a string scalar, then the output argument is
1, no matter how many characters it stores.
L = 1
To determine the number of characters in a string, use the strlength function, introduced in
R2016b. For compatibility, strlength operates on character vectors as well. In both cases
strlength returns the number of characters.
L = strlength(C)
L = 11
L = strlength(str)
L = 11
You also can use strlength on string arrays containing multiple strings and on cell arrays of
character vectors.
The length function returns the size of the longest dimension of an array. For a string array, length
returns the number of strings along the longest dimension of the array. It does not return the number
of characters within strings.
L = strlength("")
L = 0
However, an empty string is not an empty array. An empty string is a string scalar that happens to
have no characters.
sz = size("")
sz = 1×2
1 1
If you call isempty on an empty string, then it returns 0 (false) because the string is not an empty
array.
tf = isempty("")
tf = logical
0
However, if you call isempty on an empty character array, then it returns 1 (true). A character
array specified as a empty pair of single quotes, '', is a 0-by-0 character array.
tf = isempty('')
6-61
6 Characters and Strings
tf = logical
1
To test whether a piece of text has no characters, the best practice is to use the strlength function.
You can use the same call whether the input is a string scalar or a character vector.
str = "";
if strlength(str) == 0
disp('String has no text')
end
chr = '';
if strlength(chr) == 0
disp('Character vector has no text')
end
For example, if you concatenate two strings, then the result is a 1-by-2 string array.
However, if you concatenate two character vectors, then the result is a longer character vector.
chr = 'HelloWorld'
To append text to a string (or to the elements of a string array), use the plus operator instead of
square brackets.
str = "HelloWorld"
As an alternative, you can use the strcat function. strcat appends text whether the input
arguments are strings or character vectors.
str = strcat("Hello","World")
str = "HelloWorld"
Whether you use square brackets, plus, or strcat, you can specify an arbitrary number of
arguments. Append a space character between Hello and World.
6-62
Frequently Asked Questions About String Arrays
See Also
string | strlength | contains | plus | strcat | sprintf | dir | cd | copyfile | load | length
| size | isempty
Related Examples
• “Create String Arrays” on page 6-5
• “Test for Empty Strings and Missing Values” on page 6-20
• “Compare Text” on page 6-32
• “Update Your Code to Accept Strings” on page 6-64
6-63
6 Characters and Strings
If you write code for other MATLAB users, then it is to your advantage to update your API to accept
string arrays, while maintaining backward compatibility with other text data types. String adoption
makes your code consistent with MathWorks products.
If your code has few dependencies, or if you are developing new code, then consider using string
arrays as your primary text data type for better performance. In that case, best practice is to write or
update your API to accept input arguments that are character vectors, cell arrays of character
vectors, or string arrays.
For the definitions of string array and other terms, see “Terminology for Character and String Arrays”
on page 6-70.
Functions
• If an input argument can be either a character vector or a cell array of character vectors, then
update your code so that the argument also can be a string array. For example, consider a
function that has an input argument you can specify as a character vector (using single
quotes). Best practice is to update the function so that the argument can be specified as either
a character vector or a string scalar (using double quotes).
• Accept strings as both names and values in name-value pair arguments.
• A cell array of string arrays has a string array in each cell. For example, {"hello","world"}
is a cell array of string arrays. While you can create such a cell array, it is not recommended
for storing text. The elements of a string array have the same data type and are stored
6-64
Update Your Code to Accept Strings
efficiently. If you store strings in a cell array, then you lose the advantages of using a string
array.
However, if your code accepts heterogeneous cell arrays as inputs, then consider accepting cell
arrays that contain strings. You can convert any strings in such a cell array to character
vectors.
• In general, do not change the output type.
• If your function returns a character vector or cell array of character vectors, then do not
change the output type, even if the function accepts string arrays as inputs. For example, the
fileread function accepts an input file name specified as either a character vector or a
string, but the function returns the file contents as a character vector. By keeping the output
type the same, you can maintain backward compatibility.
• Return the same data type when the function modifies input text.
• If your function modifies input text and returns the modified text as the output argument, then
the input and output arguments should have the same data type. For example, the lower
function accepts text as the input argument, converts it to all lowercase letters, and returns it.
If the input argument is a character vector, then lower returns a character vector. If the input
is a string array, then lower returns a string array.
• Consider adding a 'TextType' argument to import functions.
• If your function imports data from files, and at least some of that data can be text, then
consider adding an input argument that specifies whether to return text as a character array or
a string array. For example, the readtable function provides the 'TextType' name-value
pair argument. This argument specifies whether readtable returns a table with text in cell
arrays of character vectors or string arrays.
Classes
• For string adoption, treat methods as though they are functions. Accept string arrays as input
arguments, and in general, do not change the data type of the output arguments, as described
in the previous section.
• Do not change the data types of properties.
• If a property is a character vector or a cell array of character vectors, then do not change its
type. When you access such a property, the value that is returned is still a character vector or a
cell array of character vectors.
As an alternative, you can add a new property that is a string, and make it dependent on the
old property to maintain compatibility.
• Set properties using string arrays.
• If you can set a property using a character vector or cell array of character vectors, then
update your class to set that property using a string array too. However, do not change the
data type of the property. Instead, convert the input string array to the data type of the
property, and then set the property.
• Add a string method.
6-65
6 Characters and Strings
• If your class already has a char and/or a cellstr method, then add a string method. If you
can represent an object of your class as a character vector or cell array of character vectors,
then represent it as a string array too.
The convertStringsToChars function provides a way to process all input arguments, converting
only those arguments that are string arrays. To enable your existing code to accept string arrays as
inputs, add a call to convertStringsToChars at the beginnings of your functions and methods.
For example, if you have defined a function myFunc that accepts three input arguments, process all
three inputs using convertStringsToChars. Leave the rest of your code unaltered.
function y = myFunc(a,b,c)
[a,b,c] = convertStringsToChars(a,b,c);
<line 1 of original code>
<line 2 of original code>
...
In this example, the arguments [a,b,c] overwrite the input arguments in place. If any input
argument is not a string array, then it is unaltered.
If myFunc accepts a variable number of input arguments, then process all the arguments specified by
varargin.
function y = myFunc(varargin)
[varargin{:}] = convertStringsToChars(varargin{:});
...
Performance Considerations
The convertStringsToChars function is more efficient when converting one input argument. If
your function is performance sensitive, then you can convert input arguments one at a time, while
still leaving the rest of your code unaltered.
function y = myFunc(a,b,c)
a = convertStringsToChars(a);
b = convertStringsToChars(b);
c = convertStringsToChars(c);
...
6-66
Update Your Code to Accept Strings
Functions
• If an input argument can be a string array, then also allow it to be a character vector or cell
array of character vectors.
• Accept character arrays as both names and values in name-value pair arguments.
• A cell array of string arrays has a string array in each cell. While you can create such a cell
array, it is not recommended for storing text. If your code uses strings as the primary text data
type, store multiple pieces of text in a string array, not a cell array of string arrays.
However, if your code accepts heterogeneous cell arrays as inputs, then consider accepting cell
arrays that contain strings.
• In general, return strings.
• If your function returns output arguments that are text, then return them as string arrays.
• Return the same data type when the function modifies input text.
• If your function modifies input text and returns the modified text as the output argument, then
the input and output arguments should have the same data type.
Classes
• Accept character vectors and cell arrays of character vectors as input arguments, as described
in the previous section. In general, return strings as outputs.
• Specify properties as string arrays.
• If a property contains text, then set the property using a string array. When you access the
property, return the value as a string array.
The convertCharsToStrings function provides a way to process all input arguments, converting
only those arguments that are character vectors or cell arrays of character vectors. To enable your
new code to accept these text data types as inputs, add a call to convertCharsToStrings at the
beginnings of your functions and methods.
For example, if you have defined a function myFunc that accepts three input arguments, process all
three inputs using convertCharsToStrings.
6-67
6 Characters and Strings
function y = myFunc(a,b,c)
[a,b,c] = convertCharsToStrings(a,b,c);
<line 1 of original code>
<line 2 of original code>
...
In this example, the arguments [a,b,c] overwrite the input arguments in place. If any input
argument is not a character vector or cell array of character vectors, then it is unaltered.
If myFunc accepts a variable number of input arguments, then process all the arguments specified by
varargin.
function y = myFunc(varargin)
[varargin{:}] = convertCharsToStrings(varargin{:});
...
Performance Considerations
The convertCharsToStrings function is more efficient when converting one input argument. If
your function is performance sensitive, then you can convert input arguments one at a time, while
still leaving the rest of your code unaltered.
function y = myFunc(a,b,c)
a = convertCharsToStrings(a);
b = convertCharsToStrings(b);
c = convertCharsToStrings(c);
...
If you must convert input arguments, then use the functions in this table.
Conversion Function
String scalar to character vector char
String array to cell array of character vectors cellstr
Character vector to string scalar string
Cell array of character vectors to string array string
6-68
Update Your Code to Accept Strings
An empty string is a string with no characters. MATLAB displays an empty string as a pair of double
quotes with nothing between them (""). However, an empty string is still a 1-by-1 string array. It is
not an empty array.
The recommended way to check whether a string is empty is to use the strlength function.
str = "";
tf = (strlength(str) ~= 0)
Note Do not use the isempty function to check for an empty string. An empty string has no
characters but is still a 1-by-1 string array.
The strlength function returns the length of each string in a string array. If the string must be a
string scalar, and also not empty, then check for both conditions.
If str could be either a character vector or string scalar, then you still can use strlength to
determine its length. strlength returns 0 if the input argument is an empty character vector ('').
An empty string array is, in fact, an empty array—that is, an array that has at least one dimension
whose length is 0.
6-69
6 Characters and Strings
The recommended way to create an empty string array is to use the strings function, specifying 0
as at least one of the input arguments. The isempty function returns 1 when the input is an empty
string array.
str = strings(0);
tf = isempty(str)
The strlength function returns a numeric array that is the same size as the input string array. If the
input is an empty string array, then strlength returns an empty array.
str = strings(0);
L = strlength(str)
String arrays also can contain missing strings. The missing string is the string equivalent to NaN for
numeric arrays. It indicates where a string array has missing values. The missing string displays as
<missing>, with no quotation marks.
You can create missing strings using the missing function. The recommended way to check for
missing strings is to use the ismissing function.
str = string(missing);
tf = ismissing(str)
Note Do not check for missing strings by comparing a string to the missing string.
The missing string is not equal to itself, just as NaN is not equal to itself.
str = string(missing);
f = (str == missing)
6-70
Update Your Code to Accept Strings
See Also
char | cellstr | string | strings | convertStringsToChars | convertCharsToStrings |
isstring | isStringScalar | ischar | iscellstr | strlength | validateattributes |
convertContainedStringsToChars
More About
• “Create String Arrays” on page 6-5
• “Test for Empty Strings and Missing Values” on page 6-20
• “Compare Text” on page 6-32
• “Search and Replace Text” on page 6-37
• “Frequently Asked Questions About String Arrays” on page 6-59
6-71
7
For example, create a MATLAB datetime array that represents two dates: June 28, 2014 at 6 a.m. and
June 28, 2014 at 7 a.m. Specify numeric values for the year, month, day, hour, minute, and second
components for the datetime.
t = datetime(2014,6,28,6:7,0,0)
t =
28-Jun-2014 06:00:00 28-Jun-2014 07:00:00
Change the value of a date or time component by assigning new values to the properties of the
datetime array. For example, change the day number of each datetime by assigning new values to the
Day property.
t.Day = 27:28
t =
Change the display format of the array by changing its Format property. The following format does
not display any time components. However, the values in the datetime array do not change.
t =
Jun 27, 2014 Jun 28, 2014
If you subtract one datetime array from another, the result is a duration array in units of fixed
length.
t2 = datetime(2014,6,29,6,30,45)
t2 =
29-Jun-2014 06:30:45
d = t2 - t
d =
48:30:45 23:30:45
By default, a duration array displays in the format, hours:minutes:seconds. Change the display
format of the duration by changing its Format property. You can display the duration value with a
single unit, such as hours.
d.Format = 'h'
d =
7-2
Represent Dates and Times in MATLAB
You can create a duration in a single unit using the seconds, minutes, hours, days, or years
functions. For example, create a duration of 2 days, where each day is exactly 24 hours.
d = days(2)
d =
2 days
You can create a calendar duration in a single unit of variable length. For example, one month can be
28, 29, 30, or 31 days long. Specify a calendar duration of 2 months.
L = calmonths(2)
L =
2mo
Use the caldays, calweeks, calquarters, and calyears functions to specify calendar durations
in other units.
Add a number of calendar months and calendar days. The number of days remains separate from the
number of months because the number of days in a month is not fixed, and cannot be determined
until you add the calendar duration to a specific datetime.
L = calmonths(2) + caldays(35)
L =
2mo 35d
t2 = t + calmonths(2) + caldays(35)
t2 =
whos t2
In summary, there are several ways to represent dates and times, and MATLAB has a data type for
each approach:
7-3
7 Dates and Time
The calendarDuration data type also accounts for daylight saving time changes and leap years,
so that 1 day might be more or less than 24 hours, and 1 year can have 365 or 366 days.
See Also
datetime | duration | calendarDuration
7-4
Specify Time Zones
You can specify a time zone when you create a datetime, using the 'TimeZone' name-value pair
argument. The time zone value 'local' specifies the system time zone. To display the time zone
offset for each datetime, include a time zone offset specifier such as 'Z' in the value for the
'Format' argument.
t = datetime(2014,3,8:9,6,0,0,'TimeZone','local',...
'Format','d-MMM-y HH:mm:ss Z')
t =
A different time zone offset is displayed depending on whether the datetime occurs during daylight
saving time.
You can modify the time zone of an existing datetime. For example, change the TimeZone property of
t using dot notation. You can specify the time zone value as the name of a time zone region in the
IANA Time Zone Database. A time zone region accounts for the current and historical rules for
standard and daylight offsets from UTC that are observed in that geographic region.
t.TimeZone = 'Asia/Shanghai'
t =
You also can specify the time zone value as a character vector of the form +HH:mm or -HH:mm, which
represents a time zone with a fixed offset from UTC that does not observe daylight saving time.
t.TimeZone = '+08:00'
t =
Operations on datetime arrays with time zones automatically account for time zone differences. For
example, create a datetime in a different time zone.
u = datetime(2014,3,9,6,0,0,'TimeZone','Europe/London',...
'Format','d-MMM-y HH:mm:ss Z')
u =
dt = t - u
7-5
7 Dates and Time
dt =
-19:00:00 04:00:00
When you perform operations involving datetime arrays, the arrays either must all have a time zone
associated with them, or they must all have no time zone.
See Also
datetime | timezones
Related Examples
• “Represent Dates and Times in MATLAB” on page 7-2
• “Convert Date and Time to Julian Date or POSIX Time” on page 7-7
7-6
Convert Date and Time to Julian Date or POSIX Time
While datetime arrays are not required to have a time zone, converting "unzoned" datetime values
to Julian dates or POSIX times can lead to unexpected results. To ensure the expected result, specify
the time zone before conversion.
You can specify a time zone for a datetime array, but you are not required to do so. In fact, by
default the datetime function creates an "unzoned" datetime array.
d = datetime('now')
d = datetime
01-Sep-2021 16:01:28
d is constructed from the local time on your machine and has no time zone associated with it. In many
contexts, you might assume that you can treat the times in an unzoned datetime array as local
times. However, the juliandate and posixtime functions treat the times in unzoned datetime
arrays as UTC times, not local times. To avoid any ambiguity, it is recommended that you avoid using
juliandate and posixtime on unzoned datetime arrays. For example, avoid using
posixtime(datetime('now')) in your code.
If your datetime array has values that do not represent UTC times, specify the time zone using the
TimeZone name-value pair argument so that juliandate and posixtime interpret the datetime
values correctly.
d = datetime('now','TimeZone','America/New_York')
d = datetime
01-Sep-2021 16:01:28
As an alternative, you can specify the TimeZone property after you create the array.
d.TimeZone = 'America/Los_Angeles'
d = datetime
01-Sep-2021 13:01:28
7-7
7 Dates and Time
A Julian date is the number of days (including fractional days) since noon on November 24, 4714
BCE, in the proleptic Gregorian calendar, or January 1, 4713 BCE, in the proleptic Julian calendar. To
convert datetime arrays to Julian dates, use the juliandate function.
DZ = 1x3 datetime
29-Aug-2016 10:05:24 29-Sep-2016 10:05:24 29-Oct-2016 10:05:24
format longG
JDZ = juliandate(DZ)
JDZ = 1×3
Create an unzoned copy of DZ. Convert D to the equivalent Julian dates. As D has no time zone,
juliandate treats the times as UTC times.
D = DZ;
D.TimeZone = '';
JD = juliandate(D)
JD = 1×3
Compare JDZ and JD. The differences are equal to the time zone offset between UTC and the
America/New_York time zone in fractional days.
JDZ - JD
ans = 1×3
The POSIX time is the number of seconds (including fractional seconds) elapsed since 00:00:00 1-
Jan-1970 UTC (Universal Coordinated Time), ignoring leap seconds. To convert datetime arrays to
POSIX times, use the posixtime function.
7-8
Convert Date and Time to Julian Date or POSIX Time
DZ = 1x3 datetime
29-Aug-2016 10:05:24 29-Sep-2016 10:05:24 29-Oct-2016 10:05:24
PTZ = posixtime(DZ)
PTZ = 1×3
Create an unzoned copy of DZ. Convert D to the equivalent POSIX times. As D has no time zone,
posixtime treats the times as UTC times.
D = DZ;
D.TimeZone = '';
PT = posixtime(D)
PT = 1×3
Compare PTZ and PT. The differences are equal to the time zone offset between UTC and the
America/New_York time zone in seconds.
PTZ - PT
ans = 1×3
See Also
datetime | timezones | posixtime | juliandate
Related Examples
• “Represent Dates and Times in MATLAB” on page 7-2
• “Specify Time Zones” on page 7-5
7-9
7 Dates and Time
t.Format = 'default'
Changing the Format property does not change the values in the array, only their display. For
example, the following can be representations of the same datetime value (the latter two do not
display any time components):
The Format property of the datetime, duration, and calendarDuration data types accepts
different formats as inputs.
To change the default formats, see “Default datetime Format” on page 7-12.
Alternatively, you can use the letters A-Z and a-z to specify a custom date format. You can include
nonletter characters such as a hyphen, space, or colon to separate the fields. This table shows several
common display formats and examples of the formatted output for the date, Saturday, April 19, 2014
at 9:41:06 PM in New York City.
7-10
Set Date and Time Display Format
For a complete list of valid symbolic identifiers, see the Format property for datetime arrays.
Note The letter identifiers that datetime accepts are different from those used by the datestr,
datenum, and datevec functions.
To specify the number of fractional digits displayed, use the format function.
To display a duration in the form of a digital timer, specify one of the following character vectors.
• 'dd:hh:mm:ss'
• 'hh:mm:ss'
• 'mm:ss'
• 'hh:mm'
You also can display up to nine fractional second digits by appending up to nine S characters. For
example, 'hh:mm:ss.SSS' displays the milliseconds of a duration value to 3 digits.
Changing the Format property does not change the values in the array, only their display.
7-11
7 Dates and Time
This table describes the date and time components that the characters represent.
To specify the number of digits displayed for fractional seconds, use the format function.
Changing the Format property does not change the values in the array, only their display.
where fmt is a character vector composed of the letters A-Z and a-z described for the Format
property of datetime arrays, above. For example,
datetime.setDefaultFormats('default','yyyy-MM-dd hh:mm:ss')
sets the default datetime format to include a 4-digit year, 2-digit month number, 2-digit day number,
and hour, minute, and second values.
In addition, you can specify a default format for datetimes created without time components. For
example,
datetime.setDefaultFormats('defaultdate','yyyy-MM-dd')
sets the default date format to include a 4-digit year, 2-digit month number, and 2-digit day number.
To reset the both the default format and the default date-only formats to the factory defaults, type
datetime.setDefaultFormats('reset')
You also can set the default formats in the Preferences dialog box. For more information, see “Set
Command Window Preferences”.
7-12
Set Date and Time Display Format
See Also
datetime | duration | calendarDuration | format
7-13
7 Dates and Time
Create a sequence of datetime values starting from November 1, 2013 and ending on November 5,
2013. The default step size is one calendar day.
t1 = datetime(2013,11,1,8,0,0);
t2 = datetime(2013,11,5,8,0,0);
t = t1:t2
t = 1x5 datetime
Columns 1 through 3
Columns 4 through 5
t = t1:caldays(2):t2
t = 1x3 datetime
01-Nov-2013 08:00:00 03-Nov-2013 08:00:00 05-Nov-2013 08:00:00
Specify a step size in units other than days. Create a sequence of datetime values spaced 18 hours
apart.
t = t1:hours(18):t2
t = 1x6 datetime
Columns 1 through 3
Columns 4 through 6
7-14
Generate Sequence of Dates and Time
Use the years, days, minutes, and seconds functions to create datetime and duration sequences
using other fixed-length date and time units. Create a sequence of duration values between 0 and 3
minutes, incremented by 30 seconds.
d = 0:seconds(30):minutes(3)
d = 1x7 duration
0 sec 30 sec 60 sec 90 sec 120 sec 150 sec 180 sec
Assign a time zone to t1 and t2. In the America/New_York time zone, t1 now occurs just before a
daylight saving time change.
t1.TimeZone = 'America/New_York';
t2.TimeZone = 'America/New_York';
If you create the sequence using a step size of one calendar day, then the difference between
successive datetime values is not always 24 hours.
t = t1:t2;
dt = diff(t)
dt = 1x4 duration
24:00:00 25:00:00 24:00:00 24:00:00
t = t1:days(1):t2
t = 1x5 datetime
Columns 1 through 3
Columns 4 through 5
dt = diff(t)
dt = 1x4 duration
24:00:00 24:00:00 24:00:00 24:00:00
If you specify a step size in terms of an integer, it is interpreted as a number of 24-hour days.
t = t1:1:t2
7-15
7 Dates and Time
t = 1x5 datetime
Columns 1 through 3
Columns 4 through 5
t1 = datetime(2013,11,1,8,0,0);
t = t1 + hours(0:2)
t = 1x3 datetime
01-Nov-2013 08:00:00 01-Nov-2013 09:00:00 01-Nov-2013 10:00:00
t = t1 + calmonths(1:5)
t = 1x5 datetime
Columns 1 through 3
Columns 4 through 5
dt = caldiff(t)
dt = 1x4 calendarDuration
1mo 1mo 1mo 1mo
dt = caldiff(t,'days')
dt = 1x4 calendarDuration
31d 31d 28d 31d
7-16
Generate Sequence of Dates and Time
Add a number of calendar months to the date, January 31, 2014, to create a sequence of dates that
fall on the last day of each month.
t = datetime(2014,1,31) + calmonths(0:11)
t = 1x12 datetime
Columns 1 through 5
Columns 6 through 10
Columns 11 through 12
30-Nov-2014 31-Dec-2014
Create a sequence of five equally spaced dates between April 14, 2014 and August 4, 2014. First,
define the endpoints.
A = datetime(2014,04,14);
B = datetime(2014,08,04);
The third input to linspace specifies the number of linearly spaced points to generate between the
endpoints.
C = linspace(A,B,5)
C = 1x5 datetime
14-Apr-2014 12-May-2014 09-Jun-2014 07-Jul-2014 04-Aug-2014
Create a sequence of six equally spaced durations between 1 and 5.5 hours.
A = duration(1,0,0);
B = duration(5,30,0);
C = linspace(A,B,6)
C = 1x6 duration
01:00:00 01:54:00 02:48:00 03:42:00 04:36:00 05:30:00
7-17
7 Dates and Time
Generate a sequence of dates consisting of the next three occurrences of Monday. First, define
today's date.
t1 = datetime('today','Format','dd-MMM-yyyy eee')
t1 = datetime
01-Sep-2021 Wed
The first input to dateshift is always the datetime array from which you want to generate a
sequence. Specify 'dayofweek' as the second input to indicate that the datetime values in the
output sequence must fall on a specific day of the week. You can specify the day of the week either by
number or by name. For example, you can specify Monday either as 2 or 'Monday'.
t = dateshift(t1,'dayofweek',2,1:3)
t = 1x3 datetime
06-Sep-2021 Mon 13-Sep-2021 Mon 20-Sep-2021 Mon
Generate a sequence of start-of-month dates beginning with April 1, 2014. Specify 'start' as the
second input to dateshift to indicate that all datetime values in the output sequence should fall at
the start of a particular unit of time. The third input argument defines the unit of time, in this case,
month. The last input to dateshift can be an array of integer values that specifies how t1 should be
shifted. In this case, 0 corresponds to the start of the current month, and 4 corresponds to the start
of the fourth month from t1.
t1 = datetime(2014,04,01);
t = dateshift(t1,'start','month',0:4)
t = 1x5 datetime
01-Apr-2014 01-May-2014 01-Jun-2014 01-Jul-2014 01-Aug-2014
t1 = datetime(2014,04,01);
t = dateshift(t1,'end','month',0:2)
t = 1x3 datetime
30-Apr-2014 31-May-2014 30-Jun-2014
dt = caldiff(t,'days')
dt = 1x2 calendarDuration
31d 30d
7-18
Generate Sequence of Dates and Time
You can specify other units of time such as week, day, and hour.
t1 = datetime('now')
t1 = datetime
01-Sep-2021 13:42:35
t = dateshift(t1,'start','hour',0:4)
t = 1x5 datetime
Columns 1 through 3
Columns 4 through 5
Generate a sequence of datetime values beginning with the previous hour. Negative integers in the
last input to dateshift correspond to datetime values earlier than t1.
t = dateshift(t1,'start','hour',-1:1)
t = 1x3 datetime
01-Sep-2021 12:00:00 01-Sep-2021 13:00:00 01-Sep-2021 14:00:00
See Also
dateshift | linspace
7-19
7 Dates and Time
Create language-independent datetime values. That is, create datetime values that use month
numbers rather than month names, such as 01 instead of January. Avoid using day of week names.
t = datetime
2021-09-01
instead of this:
t = datetime('today','Format','eeee, dd-MMM-yyyy')
t = datetime
Wednesday, 01-Sep-2021
Display the hour using 24-hour clock notation rather than 12-hour clock notation. Use the 'HH'
identifiers when specifying the display format for datetime values.
t = datetime
15:32
instead of this:
t = datetime('now','Format','hh:mm a')
t = datetime
03:32 PM
When specifying the display format for time zone information, use the Z or X identifiers instead of the
lowercase z to avoid the creation of time zone names that might not be recognized in other languages
or regions.
7-20
Share Code and Data Across Locales
t.TimeZone = 'America/New_York';
t = datetime
01-09-2021 -0400
If you share files but not code, you do not need to write locale-independent code while you work in
MATLAB. However, when you write to a file, ensure that any text representing dates and times is
language-independent. Then, other MATLAB users can read the files easily without having to specify
a locale in which to interpret date and time data.
t = [datetime('today');datetime('tomorrow')]
t = 2x1 datetime
01-Sep-2021
02-Sep-2021
S = 2x1 cell
{'01. September 2021'}
{'02. September 2021'}
S is a cell array of character vectors representing dates in German. You can export S to a text file to
use with systems in the de_DE locale.
• When reading text files using the textscan function, specify the file encoding when opening the
file with fopen. The encoding is the fourth input argument to fopen.
• When reading text files using the readtable function, use the FileEncoding name-value pair
argument to specify the character encoding associated with the file.
7-21
7 Dates and Time
See Also
datetime | char | cellstr | readtable | textscan
7-22
Extract or Assign Date and Time Components of Datetime Array
t = 1x3 datetime
02-Sep-2021 10:44:38 03-Oct-2022 06:44:38 04-Nov-2023 02:44:38
Get the year values of each datetime in the array. Use dot notation to access the Year property of t.
t_years = t.Year
t_years = 1×3
Get the month values of each datetime in t by accessing the Month property.
t_months = t.Month
t_months = 1×3
9 10 11
You can retrieve the day, hour, minute, and second components of each datetime in t by accessing the
Hour, Minute, and Second properties, respectively.
Use the month function to get the month number for each datetime in t. Using functions is an
alternate way to retrieve specific date or time components of t.
m = month(t)
m = 1×3
9 10 11
Use the month function rather than the Month property to get the full month names of each datetime
in t.
m = month(t,'name')
7-23
7 Dates and Time
m = 1x3 cell
{'September'} {'October'} {'November'}
You can retrieve the year, quarter, week, day, hour, minute, and second components of each datetime
in t using the year, quarter, week, hour, minute, and second functions, respectively.
w = week(t)
w = 1×3
36 41 44
Use the ymd function to get the year, month, and day values of t as three separate numeric arrays.
[y,m,d] = ymd(t)
y = 1×3
m = 1×3
9 10 11
d = 1×3
2 3 4
Use the hms function to get the hour, minute, and second values of t as three separate numeric
arrays.
[h,m,s] = hms(t)
h = 1×3
10 6 2
m = 1×3
44 44 44
s = 1×3
7-24
Extract or Assign Date and Time Components of Datetime Array
Assign new values to components in an existing datetime array by modifying the properties of the
array. Use dot notation to access a specific property.
Change the year number of all datetime values in t to 2014. Use dot notation to modify the Year
property.
t.Year = 2014
t = 1x3 datetime
02-Sep-2014 10:44:38 03-Oct-2014 06:44:38 04-Nov-2014 02:44:38
Change the months of the three datetime values in t to January, February, and March, respectively.
You must specify the new value as a numeric array.
t.Month = [1,2,3]
t = 1x3 datetime
02-Jan-2014 10:44:38 03-Feb-2014 06:44:38 04-Mar-2014 02:44:38
t.TimeZone = 'Europe/Berlin';
Change the display format of t to display only the date, and not the time information.
t.Format = 'dd-MMM-yyyy'
t = 1x3 datetime
02-Jan-2014 03-Feb-2014 04-Mar-2014
If you assign values to a datetime component that are outside the conventional range, MATLAB®
normalizes the components. The conventional range for day of month numbers is from 1 to 31. Assign
day values that exceed this range.
t = 1x3 datetime
30-Dec-2013 01-Feb-2014 01-Apr-2014
The month and year numbers adjust so that all values remain within the conventional range for each
date component. In this case, January -1, 2014 converts to December 30, 2013.
See Also
datetime | ymd | hms | week
7-25
7 Dates and Time
Create a space-delimited text file named schedule.txt that contains the following (to create the
file, use any text editor, and copy and paste):
Date Name Time
10.03.2015 Joe 14:31
10.03.2015 Bob 15:33
11.03.2015 Bob 11:29
12.03.2015 Kim 12:09
12.03.2015 Joe 13:05
Read the file using the readtable function. Use the %D conversion specifier to read the first and
third columns of data as datetime values.
T = readtable('schedule.txt','Format','%{dd.MM.uuuu}D %s %{HH:mm}D','Delimiter',' ')
T =
Date Name Time
__________ _____ _____
10.03.2015 'Joe' 14:31
10.03.2015 'Bob' 15:33
11.03.2015 'Bob' 11:29
12.03.2015 'Kim' 12:09
12.03.2015 'Joe' 13:05
Change the display format for the T.Date and T.Time variables to view both date and time
information. Since the data in the first column of the file ("Date") have no time information, the time
of the resulting datetime values in T.Date default to midnight. Since the data in the third column of
the file ("Time") have no associated date, the date of the datetime values in T.Time defaults to the
current date.
T.Date.Format = 'dd.MM.uuuu HH:mm';
T.Time.Format = 'dd.MM.uuuu HH:mm';
T
T =
Date Name Time
________________ _____ ________________
10.03.2015 00:00 'Joe' 12.12.2014 14:31
10.03.2015 00:00 'Bob' 12.12.2014 15:33
11.03.2015 00:00 'Bob' 12.12.2014 11:29
12.03.2015 00:00 'Kim' 12.12.2014 12:09
12.03.2015 00:00 'Joe' 12.12.2014 13:05
Combine the date and time information from two different table variables by adding T.Date and the
time values in T.Time. Extract the time information from T.Time using the timeofday function.
myDatetime = T.Date + timeofday(T.Time)
myDatetime =
10.03.2015 14:31
10.03.2015 15:33
7-26
Combine Date and Time from Separate Variables
11.03.2015 11:29
12.03.2015 12:09
12.03.2015 13:05
See Also
readtable | timeofday
7-27
7 Dates and Time
Create a datetime scalar. By default, datetime arrays are not associated with a time zone.
t1 = datetime('now')
t1 = datetime
01-Sep-2021 13:47:20
t2 = 1x3 datetime
01-Sep-2021 14:47:20 01-Sep-2021 15:47:20 01-Sep-2021 16:47:20
Verify that the difference between each pair of datetime values in t2 is 1 hour.
dt = diff(t2)
dt = 1x2 duration
01:00:00 01:00:00
diff returns durations in terms of exact numbers of hours, minutes, and seconds.
t2 = 1x3 datetime
01-Sep-2021 13:27:20 01-Sep-2021 13:17:20 01-Sep-2021 13:07:20
Add a numeric array to a datetime array. MATLAB® treats each value in the numeric array as a
number of exact, 24-hour days.
t2 = t1 + [1:3]
t2 = 1x3 datetime
02-Sep-2021 13:47:20 03-Sep-2021 13:47:20 04-Sep-2021 13:47:20
If you work with datetime values in different time zones, or if you want to account for daylight saving
time changes, work with datetime arrays that are associated with time zones. Create a datetime
scalar representing March 8, 2014 in New York.
t1 = datetime(2014,3,8,0,0,0,'TimeZone','America/New_York')
7-28
Date and Time Arithmetic
t1 = datetime
08-Mar-2014
t2 = t1 + days(0:2)
t2 = 1x3 datetime
08-Mar-2014 00:00:00 09-Mar-2014 00:00:00 10-Mar-2014 01:00:00
Because a daylight saving time shift occurred on March 9, 2014, the third datetime in t2 does not
occur at midnight.
Verify that the difference between each pair of datetime values in t2 is 24 hours.
dt = diff(t2)
dt = 1x2 duration
24:00:00 24:00:00
You can add fixed-length durations in other units such as years, hours, minutes, and seconds by
adding the outputs of the years, hours, minutes, and seconds functions, respectively.
To account for daylight saving time changes, you should work with calendar durations instead of
durations. Calendar durations account for daylight saving time shifts when they are added to or
subtracted from datetime values.
t3 = t1 + caldays(0:2)
t3 = 1x3 datetime
08-Mar-2014 09-Mar-2014 10-Mar-2014
View that the difference between each pair of datetime values in t3 is not always 24 hours due to the
daylight saving time shift that occurred on March 9.
dt = diff(t3)
dt = 1x2 duration
24:00:00 23:00:00
t1 = datetime(2014,1,31)
t1 = datetime
31-Jan-2014
t2 = t1 + calmonths(1:4)
7-29
7 Dates and Time
t2 = 1x4 datetime
28-Feb-2014 31-Mar-2014 30-Apr-2014 31-May-2014
Calculate the difference between each pair of datetime values in t2 in terms of a number of calendar
days using the caldiff function.
dt = caldiff(t2,'days')
dt = 1x3 calendarDuration
31d 30d 31d
The number of days between successive pairs of datetime values in dt is not always the same
because different months consist of a different number of days.
t2 = t1 + calyears(0:4)
t2 = 1x5 datetime
31-Jan-2014 31-Jan-2015 31-Jan-2016 31-Jan-2017 31-Jan-2018
Calculate the difference between each pair of datetime values in t2 in terms of a number of calendar
days using the caldiff function.
dt = caldiff(t2,'days')
dt = 1x4 calendarDuration
365d 365d 366d 365d
The number of days between successive pairs of datetime values in dt is not always the same
because 2016 is a leap year and has 366 days.
You can use the calquarters, calweeks, and caldays functions to create arrays of calendar
quarters, calendar weeks, or calendar days that you add to or subtract from datetime arrays.
Adding calendar durations is not commutative. When you add more than one calendarDuration
array to a datetime, MATLAB® adds them in the order in which they appear in the command.
t2 = datetime
30-May-2014
First add 30 calendar days to the same date, and then add 3 calendar months. The result is not the
same because when you add a calendar duration to a datetime, the number of days added depends on
the original date.
7-30
Date and Time Arithmetic
t2 = datetime
02-Jun-2014
d1 = calendarDuration
1y 2mo 20d
d2 = calmonths(11) + caldays(23)
d2 = calendarDuration
11mo 23d
d = d1 + d2
d = calendarDuration
2y 1mo 43d
When you sum two or more calendar durations, a number of months greater than 12 roll over to a
number of years. However, a large number of days does not roll over to a number of months, because
different months consist of different numbers of days.
Increase d by multiplying it by a factor of 2. Calendar duration values must be integers, so you can
multiply them only by integer values.
2*d
ans = calendarDuration
4y 2mo 86d
Subtract one datetime array from another to calculate elapsed time in terms of an exact number of
hours, minutes, and seconds.
Find the exact length of time between a sequence of datetime values and the start of the previous
day.
t2 = datetime('now') + caldays(1:3)
t2 = 1x3 datetime
02-Sep-2021 13:47:22 03-Sep-2021 13:47:22 04-Sep-2021 13:47:22
t1 = datetime('yesterday')
t1 = datetime
31-Aug-2021
dt = t2 - t1
7-31
7 Dates and Time
dt = 1x3 duration
61:47:22 85:47:22 109:47:22
whos dt
dt 1x3 40 duration
View the elapsed durations in units of days by changing the Format property of dt.
dt.Format = 'd'
dt = 1x3 duration
2.5746 days 3.5746 days 4.5746 days
Scale the duration values by multiplying dt by a factor of 1.2. Because durations have an exact
length, you can multiply and divide them by fractional values.
dt2 = 1.2*dt
Use the between function to find the number of calendar years, months, and days elapsed between
two dates.
t1 = datetime('today')
t1 = datetime
01-Sep-2021
t2 = t1 + calmonths(0:2) + caldays(4)
t2 = 1x3 datetime
05-Sep-2021 05-Oct-2021 05-Nov-2021
dt = between(t1,t2)
dt = 1x3 calendarDuration
4d 1mo 4d 2mo 4d
See Also
between | diff | caldiff
7-32
Compare Dates and Time
Compare two datetime arrays. The arrays must be the same size or one can be a scalar.
A = datetime(2013,07,26) + calyears(0:2:6)
A = 1x4 datetime
26-Jul-2013 26-Jul-2015 26-Jul-2017 26-Jul-2019
B = datetime(2014,06,01)
B = datetime
01-Jun-2014
A < B
1 0 0 0
The < operator returns logical 1 (true) where a datetime in A occurs before a datetime in B.
A >= '26-Sep-2014'
0 1 1 1
Comparisons of datetime arrays account for the time zone information of each array.
Compare September 1, 2014 at 4:00 p.m. in Los Angeles with 5:00 p.m. on the same day in New York.
A = datetime(2014,09,01,16,0,0,'TimeZone','America/Los_Angeles',...
'Format','dd-MMM-yyyy HH:mm:ss Z')
A = datetime
01-Sep-2014 16:00:00 -0700
B = datetime(2014,09,01,17,0,0,'TimeZone','America/New_York',...
'Format','dd-MMM-yyyy HH:mm:ss Z')
B = datetime
01-Sep-2014 17:00:00 -0400
A < B
7-33
7 Dates and Time
ans = logical
0
4:00 p.m. in Los Angeles occurs after 5:00 p.m. on the same day in New York.
Compare Durations
A = duration([2,30,30;3,15,0])
A = 2x1 duration
02:30:30
03:15:00
B = duration([2,40,0;2,50,0])
B = 2x1 duration
02:40:00
02:50:00
A >= B
0
1
Compare a duration array to a numeric array. Elements in the numeric array are treated as a number
of fixed-length (24-hour) days.
1
0
Use the isbetween function to determine whether values in a datetime array lie within a closed
interval.
tlower = datetime(2014,08,01)
tlower = datetime
01-Aug-2014
tupper = datetime(2014,09,01)
7-34
Compare Dates and Time
tupper = datetime
01-Sep-2014
Create a datetime array and determine whether the values lie within the interval bounded by t1
and t2.
A = datetime(2014,08,21) + calweeks(0:2)
A = 1x3 datetime
21-Aug-2014 28-Aug-2014 04-Sep-2014
tf = isbetween(A,tlower,tupper)
1 1 0
See Also
isbetween
More About
• “Array Comparison with Relational Operators” on page 2-29
7-35
7 Dates and Time
Create t as a sequence of dates and create y as random data. Plot the vectors using the plot
function.
t = datetime(2014,6,28) + calweeks(0:9);
y = rand(1,10);
plot(t,y);
By default, plot chooses tick mark locations based on the range of data. When you zoom in and out
of a plot, the tick labels automatically adjust to the new axis limits.
Change the x-axis limits. Also, change the format for the tick labels along the x-axis. For a list of
formatting options, see the xtickformat function.
7-36
Plot Dates and Durations
Create t as seven linearly spaced duration values between 0 and 3 minutes. Create y as a vector of
random data. Plot the data.
t = 0:seconds(30):minutes(3);
y = rand(1,7);
plot(t,y);
7-37
7 Dates and Time
View the x-axis limits. Since the duration tick labels are in terms of a single unit (minutes), the limits
are stored in terms of that unit.
xl = xlim
xl = 1x2 duration
-4.5 sec 184.5 sec
Change the format for the duration tick labels to display in the form of a digital timer that includes
more than one unit. For a list of formatting options, see the xtickformat function.
xtickformat('mm:ss')
7-38
Plot Dates and Durations
View the x-axis limits again. Since the duration tick labels are now in terms of multiple units, the
limits are stored in units of 24-hour days.
xl = xlim
xl = 1x2 duration
-00:04 03:04
t = datetime('today') + caldays(1:100);
y = linspace(10,40,100) + 10*rand(1,100);
scatter(t,y)
7-39
7 Dates and Time
bar barh
plot plot3
semilogx (x values must be numeric) semilogy (y values must be numeric)
stem stairs
scatter scatter3
area mesh
surf surface
fill fill3
line text
histogram
See Also
plot | datetime | xtickformat
7-40
Core Functions Supporting Date and Time Arrays
This table lists notable MATLAB functions that operate on datetime, duration, and
calendarDuration arrays in addition to other arrays.
7-41
7 Dates and Time
Overview
datetime is the best data type for representing points in time. datetime values have flexible
display formats and up to nanosecond precision, and can account for time zones, daylight saving
time, and leap seconds. However, if you work with code authored in MATLAB R2014a or earlier, or if
you share code with others who use such a version, you might need to work with dates and time
stored in one of these three formats:
Example: 7.3510e+005
Date strings, vectors, and numbers can be stored as arrays of values. Store multiple date strings in a
cell array of character vectors, multiple date vectors in an m-by-6 matrix, and multiple serial date
numbers in a matrix.
You can convert any of these formats to a datetime array using the datetime function. If your
existing MATLAB code expects a serial date number or date vector, use the datenum or datevec
functions, respectively, to convert a datetime array to the expected data format. To convert a
datetime array to character vectors, use the char or cellstr functions.
Starting in R2016b, you also can convert a datetime array to a string array with the string
function.
7-42
Convert Between Datetime Arrays, Numbers, and Text
A date string includes characters that separate the fields, such as the hyphen, space, and colon used
here:
d = '23-Aug-2010 16:35:42'
Convert one or more date strings to a datetime array using the datetime function. For best
performance, specify the format of the input date strings as an input to datetime.
Note The specifiers that datetime uses to describe date and time formats differ from the specifiers
that the datestr, datevec, and datenum functions accept.
For a complete list of date and time format specifiers, see the Format property of the datetime data
type.
t = datetime(d,'InputFormat','dd-MMM-yyyy HH:mm:ss')
t =
datetime
23-Aug-2010 16:35:42
Although the date string, d, and the datetime scalar, t, look similar, they are not equal. View the
size and data type of each variable.
whos d t
d 1x20 40 char
t 1x1 17 datetime
Convert a datetime array to a character vector using char or cellstr. For example, convert the
current date and time to a timestamp to append to a file name.
t = datetime('now','Format','yyyy-MM-dd''T''HHmmss')
t =
datetime
2017-01-03T151105
S = char(t);
filename = ['myTest_',S]
filename =
'myTest_2017-01-03T151105'
7-43
7 Dates and Time
Convert a string array. MATLAB displays strings in double quotes. For best performance, specify the
format of the input date strings as an input to datetime.
str =
"24-Oct-2016 11:58:17"
"19-Nov-2016 09:36:29"
"12-Dec-2016 10:09:06"
t = datetime(str,'InputFormat','dd-MMM-yyyy HH:mm:ss')
t =
24-Oct-2016 11:58:17
19-Nov-2016 09:36:29
12-Dec-2016 10:09:06
t = datetime('25-Dec-2016 06:12:34');
str = string(t)
str =
"25-Dec-2016 06:12:34"
[2012 10 24 10 45 07]
Convert one or more date vectors to a datetime array using the datetime function:
t = datetime([2012 10 24 10 45 07])
7-44
Convert Between Datetime Arrays, Numbers, and Text
t =
datetime
24-Oct-2012 10:45:07
Instead of using datevec to extract components of datetime values, use functions such as year,
month, and day instead:
y = year(t)
y =
2012
Alternatively, access the corresponding property, such as t.Year for year values:
y = t.Year
y =
2012
Serial time can represent fractions of days beginning at midnight; for example, 6 p.m. equals 0.75
serial days. So the character vector '31-Oct-2003, 6:00 PM' in MATLAB is date number
731885.75.
Convert one or more serial date numbers to a datetime array using the datetime function. Specify
the type of date number that is being converted:
t = datetime(731885.75,'ConvertFrom','datenum')
t =
datetime
31-Oct-2003 18:00:00
t = datetime(2014,6,18) + calmonths(1:4)
t =
7-45
7 Dates and Time
Subtract the origin value. For example, the origin value might be the starting day of an experiment.
dt = t - datetime(2014,7,1)
dt =
dt is a duration array. Convert dt to a double array of values in units of years, days, hours,
minutes, or seconds using the years, days, hours, minutes, or seconds function, respectively.
x = hours(dt)
x =
y = log(x)
y =
See Also
datetime | datenum | datevec | cellstr | char | string | duration
More About
• “Represent Dates and Times in MATLAB” on page 7-2
• “Extract or Assign Date and Time Components of Datetime Array” on page 7-23
• Proleptic Gregorian Calendar
7-46
Carryover in Date Vectors and Strings
In the following example, the month element has a value of 22. MATLAB increments the year value to
2010 and sets the month to October.
datestr([2009 22 03 00 00 00])
ans =
03-Oct-2010
The carrying forward of values also applies to time and day values in text representing dates and
times. For example, October 3, 2010 and September 33, 2010 are interpreted to be the same date,
and correspond to the same serial date number.
datenum('03-Oct-2010')
ans =
734414
datenum('33-Sep-2010')
ans =
734414
The following example takes the input month (07, or July), finds the last day of the previous month
(June 30), and subtracts the number of days in the field specifier (5 days) from that date to yield a
return date of June 25, 2010.
ans =
25-Jun-2010
7-47
7 Dates and Time
Note The best practice is to use datetime values to represent points in time rather than date
vectors. Unlike date vectors, datetime values display in a human-readable format, often avoiding
the need for conversion to text. If you need to convert a date vector to text, the best practice is to
first convert it to a datetime value, and then to convert the datetime value to text by using the
string or char functions. While you can convert date vectors to text directly by using the datestr
function, you might get unexpected results, as described in this section.
Because a date vector is a 1-by-6 row vector of numbers, the datestr function might interpret input
date vectors as vectors of serial date numbers and return unexpected output. Or it might interpret
vectors of serial date numbers as date vectors. This ambiguity exists because datestr has a
heuristic rule for interpreting a 1-by-6 row vector as either a date vector or a vector of six serial date
numbers. The same ambiguity applies to inputs that are m-by-6 numeric matrices, where each row
can be interpreted either as a date vector or as six serial date numbers.
For example, consider a date vector that includes the year 3000. This year is outside the range of
years that datestr interprets as elements of date vectors. Therefore, the input is interpreted as a 1-
by-6 vector of serial date numbers.
d = datestr([3000 11 05 10 32 56])
d =
'18-Mar-0008'
'11-Jan-0000'
'05-Jan-0000'
'10-Jan-0000'
'01-Feb-0000'
'25-Feb-0000'
Here datestr interprets 3000 as a serial date number, and converts it to the text '18-Mar-0008'
(the date that is 3000 days after 0-Jan-0000). Also, datestr converts the next five elements as
though they also were serial date numbers.
There are two methods for converting such a date vector to text.
• The recommended method is to convert the date vector to a datetime value. Then convert it
using the char, cellstr, or string function. The datetime function always treats 1-by-6
numeric vectors as date vectors.
dt = datetime([3000 11 05 10 32 56]);
ds = string(dt)
dt =
"05-Nov-3000 10:32:56"
• As an alternative, convert it to a serial date number using the datenum function. Then, convert
the date number to a character vector using datestr.
dn = datenum([3000 11 05 10 32 56]);
ds = datestr(dn)
7-48
Converting Date Vector Returns Unexpected Output
ds =
'05-Nov-3000 10:32:56'
When converting dates to text, datestr interprets input as either date vectors or serial date
numbers using a heuristic rule. Consider an m-by-6 matrix. The datestr function interprets the
matrix as m date vectors when:
If either condition is false, for any row, then datestr interprets the m-by-6 matrix as an m-by-6 matrix
of serial date numbers.
Usually, dates with years in the range 1700–2300 are interpreted as date vectors. However, datestr
might interpret rows with month, day, hour, minute, or second values outside their normal ranges as
serial date numbers. For example, datestr correctly interprets the following date vector for the year
2020:
d = datestr([2020 06 21 10 51 00])
d =
'21-Jun-2020 10:51:00'
But given a day value outside the typical range (1–31), datestr returns a date for each element of
the vector.
d = datestr([2020 06 2110 10 51 00])
d =
'12-Jul-0005'
'06-Jan-0000'
'10-Oct-0005'
'10-Jan-0000'
'20-Feb-0000'
'00-Jan-0000'
Again, the datetime function always treats numeric inputs as date vectors. In this case, it calculates
an appropriate date, interpreting 2110 as the 2110th day since the beginning of June 2020.
d = datetime([2020 06 2110 10 51 00])
d =
datetime
11-Mar-2026 10:51:00
• When you have a matrix of date vectors that datestr might interpret incorrectly as serial date
numbers, convert the matrix by using either the datetime or datenum functions. Then convert
those values to text.
• When you have a matrix of serial date numbers that datestr might interpret as date vectors, first
convert the matrix to a column vector. Then, use datestr to convert the column vector.
7-49
7 Dates and Time
See Also
datetime | datenum | datevec | char | string | datestr
More About
• “Represent Dates and Times in MATLAB” on page 7-2
• “Convert Between Datetime Arrays, Numbers, and Text” on page 7-42
7-50
8
Categorical Arrays
By default, categorical arrays contain categories that have no mathematical ordering. For example,
the discrete set of pet categories {'dog' 'cat' 'bird'} has no meaningful mathematical
ordering, so MATLAB® uses the alphabetical ordering {'bird' 'cat' 'dog'}. Ordinal categorical
arrays contain categories that have a meaningful mathematical ordering. For example, the discrete
set of size categories {'small', 'medium', 'large'} has the mathematical ordering small <
medium < large.
When you create categorical arrays from cell arrays of character vectors or string arrays, leading and
trailing spaces are removed. For example, if you specify the text {' cat' 'dog '} as categories, then
when you convert them to categories they become {'cat' 'dog'}.
You can use the categorical function to create a categorical array from a numeric array, logical
array, string array, cell array of character vectors, or an existing categorical array.
Create a 1-by-11 cell array of character vectors containing state names from New England.
state = ["MA","ME","CT","VT","ME","NH","VT","MA","NH","CT","RI"];
Convert the cell array, state, to a categorical array that has no mathematical order.
state = categorical(state)
MA ME CT VT ME NH VT MA NH
Columns 10 through 11
CT RI
class(state)
ans =
'categorical'
categories(state)
8-2
Create Categorical Arrays
{'RI'}
{'VT'}
Create a 1-by-8 cell array of character vectors containing the sizes of eight objects.
AllSizes = ["medium","large","small","small","medium",...
"large","medium","small"];
The cell array, AllSizes, has three distinct values: 'large', 'medium', and 'small'. With the cell
array of character vectors, there is no convenient way to indicate that small < medium < large.
Convert the cell array, AllSizes, to an ordinal categorical array. Use valueset to specify the values
small, medium, and large, which define the categories. For an ordinal categorical array, the first
category specified is the smallest and the last category is the largest.
valueset = ["small","medium","large"];
sizeOrd = categorical(AllSizes,valueset,'Ordinal',true)
Columns 7 through 8
medium small
class(sizeOrd)
ans =
'categorical'
The order of the values in the categorical array, sizeOrd, remains unchanged.
The categories are listed in the specified order to match the mathematical ordering small <
medium < large.
8-3
8 Categorical Arrays
Use the discretize function to create a categorical array by binning the values of x. Put all values
between zero and 15 in the first bin, all the values between 15 and 35 in the second bin, and all the
values between 35 and 50 in the third bin. Each bin includes the left endpoint, but does not include
the right endpoint.
catnames = ["small","medium","large"];
binnedData = discretize(x,[0 15 35 50],'categorical',catnames);
binnedData is a 100-by-1 ordinal categorical array with three categories, such that small <
medium < large.
Use the summary function to print the number of elements in each category.
summary(binnedData)
small 30
medium 35
large 35
Starting in R2016b, you can create string arrays with the string function and convert them to
categorical array.
str = ["Earth","Jupiter","Neptune","Jupiter","Mars","Earth"]
planets = categorical(str)
Add missing elements to str and convert it to a categorical array. Where str has missing values,
planets has undefined values.
str(8) = "Mars"
Columns 7 through 8
<missing> "Mars"
planets = categorical(str)
8-4
Create Categorical Arrays
Columns 7 through 8
<undefined> Mars
See Also
categorical | categories | summary | discretize
Related Examples
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Access Data Using Categorical Arrays” on page 8-24
• “Compare Categorical Array Elements” on page 8-16
More About
• “Advantages of Using Categorical Arrays” on page 8-34
• “Ordinal Categorical Arrays” on page 8-36
8-5
8 Categorical Arrays
load patients
whos
Store the patient data from Age, Gender, Height, Weight, SelfAssessedHealthStatus, and
Location in a table. Use the unique identifiers in the variable LastName as row names.
T = table(Age,Gender,Height,Weight,...
SelfAssessedHealthStatus,Location,...
'RowNames',LastName);
Convert Table Variables from Cell Arrays of Character Vectors to Categorical Arrays
The cell arrays of character vectors, Gender and Location, contain discrete sets of unique values.
T.Gender = categorical(T.Gender);
T.Location = categorical(T.Location);
The variable, SelfAssessedHealthStatus, contains four unique values: Excellent, Fair, Good,
and Poor.
Convert SelfAssessedHealthStatus to an ordinal categorical array, such that the categories have
the mathematical ordering Poor < Fair < Good < Excellent.
T.SelfAssessedHealthStatus = categorical(T.SelfAssessedHealthStatus,...
{'Poor','Fair','Good','Excellent'},'Ordinal',true);
Print a Summary
View the data type, description, units, and other descriptive statistics for each variable by using
summary to summarize the table.
8-6
Convert Text in Table Variables to Categorical
format compact
summary(T)
Variables:
Age: 100x1 double
Values:
Min 25
Median 39
Max 50
Gender: 100x1 categorical
Values:
Female 53
Male 47
Height: 100x1 double
Values:
Min 60
Median 67
Max 72
Weight: 100x1 double
Values:
Min 111
Median 142.5
Max 202
SelfAssessedHealthStatus: 100x1 ordinal categorical
Values:
Poor 11
Fair 15
Good 40
Excellent 34
Location: 100x1 categorical
Values:
County General Hospital 39
St. Mary s Medical Center 24
VA Hospital 37
The table variables Gender, SelfAssessedHealthStatus, and Location are categorical arrays.
The summary contains the counts of the number of elements in each category. For example, the
summary indicates that 53 of the 100 patients are female and 47 are male.
Create a subtable, T1, containing the age, height, and weight of all female patients who were
observed at County General Hospital. You can easily create a logical vector based on the values in the
categorical arrays Gender and Location.
rows is a 100-by-1 logical vector with logical true (1) for the table rows where the gender is female
and the location is County General Hospital.
vars = {'Age','Height','Weight'};
T1 = T(rows,vars)
8-7
8 Categorical Arrays
T1=19×3 table
Age Height Weight
___ ______ ______
Brown 49 64 119
Taylor 31 66 132
Anderson 45 68 128
Lee 44 66 146
Walker 28 65 123
Young 25 63 114
Campbell 37 65 135
Evans 39 62 121
Morris 43 64 135
Rivera 29 63 130
Richardson 30 67 141
Cox 28 66 111
Torres 45 70 137
Peterson 32 60 136
Ramirez 48 64 137
Bennett 35 64 131
⋮
A is a 19-by-3 table.
Since ordinal categorical arrays have a mathematical ordering for their categories, you can perform
element-wise comparisons of them with relational operations, such as greater than and less than.
Create a subtable, T2, of the gender, age, height, and weight of all patients who assessed their health
status as poor or fair.
rows = T.SelfAssessedHealthStatus<='Fair';
vars = {'Gender','Age','Height','Weight'};
T2 = T(rows,vars)
T2=26×4 table
Gender Age Height Weight
______ ___ ______ ______
Johnson Male 43 69 163
Jones Female 40 67 133
Thomas Female 42 66 137
Jackson Male 25 71 174
Garcia Female 27 69 131
Rodriguez Female 39 64 117
Lewis Female 41 62 137
Lee Female 44 66 146
Hall Male 25 70 189
Hernandez Male 36 68 166
Lopez Female 40 66 137
Gonzalez Female 35 66 118
Mitchell Male 39 71 164
8-8
Convert Text in Table Variables to Categorical
T2 is a 26-by-4 table.
See Also
Related Examples
• “Create Tables and Assign Data to Them” on page 9-2
• “Create Categorical Arrays” on page 8-2
• “Access Data in Tables” on page 9-32
• “Access Data Using Categorical Arrays” on page 8-24
More About
• “Advantages of Using Categorical Arrays” on page 8-34
• “Ordinal Categorical Arrays” on page 8-36
8-9
8 Categorical Arrays
load patients
whos
The workspace variable, Location, is a cell array of character vectors that contains the three unique
medical facilities where patients were observed.
To access and compare data more easily, convert Location to a categorical array.
Location = categorical(Location);
summary(Location)
39 patients were observed at County General Hospital, 24 at St. Mary's Medical Center, and 37 at the
VA Hospital.
Convert SelfAssessedHealthStatus to an ordinal categorical array, such that the categories have
the mathematical ordering Poor < Fair < Good < Excellent.
SelfAssessedHealthStatus = categorical(SelfAssessedHealthStatus,...
{'Poor' 'Fair' 'Good' 'Excellent'},'Ordinal',true);
summary(SelfAssessedHealthStatus)
8-10
Plot Categorical Data
Poor 11
Fair 15
Good 40
Excellent 34
Plot Histogram
figure
histogram(SelfAssessedHealthStatus)
title('Self Assessed Health Status From 100 Patients')
The function histogram accepts the categorical array, SelfAssessedHealthStatus, and plots the
category counts for each of the four categories.
Create a histogram of the hospital location for only the patients who assessed their health as Fair or
Poor.
figure
histogram(Location(SelfAssessedHealthStatus<='Fair'))
title('Location of Patients in Fair or Poor Health')
8-11
8 Categorical Arrays
figure
pie(SelfAssessedHealthStatus);
title('Self Assessed Health Status From 100 Patients')
8-12
Plot Categorical Data
The function pie accepts the categorical array, SelfAssessedHealthStatus, and plots a pie chart
of the four categories.
Create a Pareto chart from the category counts for each of the four categories of
SelfAssessedHealthStatus.
figure
A = countcats(SelfAssessedHealthStatus);
C = categories(SelfAssessedHealthStatus);
pareto(A,C);
title('Self Assessed Health Status From 100 Patients')
8-13
8 Categorical Arrays
The first input argument to pareto must be a vector. If a categorical array is a matrix or
multidimensional array, reshape it into a vector before calling countcats and pareto.
Gender = categorical(Gender);
summary(Gender)
Female 53
Male 47
Gender is a 100-by-1 categorical array with two categories, Female and Male.
Use the categorical array, Gender, to access Weight and Height data for each gender separately.
X1 = Weight(Gender=='Female');
Y1 = Height(Gender=='Female');
X2 = Weight(Gender=='Male');
Y2 = Height(Gender=='Male');
X1 and Y1 are 53-by-1 numeric arrays containing data from the female patients.
8-14
Plot Categorical Data
X2 and Y2 are 47-by-1 numeric arrays containing data from the male patients.
Create a scatter plot of height vs. weight. Indicate data from the female patients with a circle and
data from the male patients with a cross.
figure
h1 = scatter(X1,Y1,'o');
hold on
h2 = scatter(X2,Y2,'x');
See Also
categorical | summary | countcats | histogram | pie | bar | rose | scatter
Related Examples
• “Access Data Using Categorical Arrays” on page 8-24
8-15
8 Categorical Arrays
colors = categorical(C)
categories(colors)
Use the relational operator, eq (==), to compare the first and second rows of colors.
colors(1,:) == colors(2,:)
1 0 1 1
Only the values in the second column differ between the rows.
Compare the entire categorical array, colors, to the character vector 'blue' to find the location of
all blue values.
colors == 'blue'
1 0 0 1
1 0 0 1
There are four blue entries in colors, one in each corner of the array.
8-16
Compare Categorical Array Elements
Add a mathematical ordering to the categories in colors. Specify the category order that represents
the ordering of color spectrum, red < green < blue.
categories(colors)
Determine if elements in the first column of colors are greater than the elements in the second
column.
1
1
Both values in the first column, blue, are greater than the corresponding values in the second
column, red and green.
Find all the elements in colors that are less than 'blue'.
0 1 1 0
0 1 1 0
The function lt (<) indicates the location of all green and red values with 1.
See Also
categorical | categories
8-17
8 Categorical Arrays
Related Examples
• “Access Data Using Categorical Arrays” on page 8-24
More About
• “Relational Operations”
• “Advantages of Using Categorical Arrays” on page 8-34
• “Ordinal Categorical Arrays” on page 8-36
8-18
Combine Categorical Arrays
rng('default')
A = randi(3,[25,1]);
A = categorical(A,1:3,{'milk' 'water' 'juice'});
A is a 25-by-1 categorical array with three distinct categories: milk, water, and juice.
summary(A)
milk 6
water 5
juice 14
Six students in classroom A prefer milk, five prefer water, and fourteen prefer juice.
B = randi(3,[28,1]);
B = categorical(B,1:3,{'milk' 'water' 'juice'});
summary(B)
milk 9
water 8
juice 11
Nine students in classroom B prefer milk, eight prefer water, and eleven prefer juice.
Concatenate the data from classrooms A and B into a single categorical array, Group1.
Group1 = [A;B];
summary(Group1)
milk 15
water 13
juice 25
Group1 is a 53-by-1 categorical array with three categories: milk, water, and juice.
8-19
8 Categorical Arrays
Create a categorical array, Group2, containing data from 50 students who were given the additional
beverage option of soda.
Group2 = randi(4,[50,1]);
Group2 = categorical(Group2,1:4,{'juice' 'milk' 'soda' 'water'});
summary(Group2)
juice 12
milk 14
soda 10
water 14
Group2 is a 50-by-1 categorical array with four categories: juice, milk, soda, and water.
students = [Group1;Group2];
summary(students)
milk 29
water 27
juice 37
soda 10
Concatenation appends the categories exclusive to the second input, soda, to the end of the list of
categories from the first input, milk, water, juice, soda.
Use reordercats to change the order of the categories in the categorical array, students.
students = reordercats(students,{'juice','milk','water','soda'});
categories(students)
Use the function union to find the unique responses from Group1 and Group2.
C = union(Group1,Group2)
C = 4x1 categorical
milk
water
8-20
Combine Categorical Arrays
juice
soda
union returns the combined values from Group1 and Group2 with no repetitions. In this case, C is
equivalent to the categories of the concatenation, students.
All of the categorical arrays in this example were nonordinal. To combine ordinal categorical arrays,
they must have the same sets of categories including their order.
See Also
categorical | categories | summary | union | cat | horzcat | vertcat
Related Examples
• “Create Categorical Arrays” on page 8-2
• “Combine Categorical Arrays Using Multiplication” on page 8-22
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Access Data Using Categorical Arrays” on page 8-24
More About
• “Ordinal Categorical Arrays” on page 8-36
8-21
8 Categorical Arrays
Combine two categorical arrays using times. The input arrays must have the same number of
elements, but can have different numbers of categories.
A = categorical({'blue','red','green'});
B = categorical({'+','-','+'});
C = A.*B
C = 1x3 categorical
blue + red - green +
Show the categories of C. The categories are all the ordered pairs that can be created from the
categories of A and B, also known as the Cartesian product.
categories(C)
D = B.*A
D = 1x3 categorical
+ blue - red + green
categories(D)
8-22
Combine Categorical Arrays Using Multiplication
Combine two categorical arrays. If either A or B have an undefined element, the corresponding
element of C is undefined.
A = categorical({'blue','red','green','black'});
B = categorical({'+','-','+','-'});
A = removecats(A,{'black'});
C = A.*B
C = 1x4 categorical
blue + red - green + <undefined>
Combine two ordinal categorical arrays. C is an ordinal categorical array only if A and B are both
ordinal. The ordering of the categories of C follows from the orderings of the input categorical arrays.
A = categorical({'blue','red','green'},{'green','red','blue'},'Ordinal',true);
B = categorical({'+','-','+'},'Ordinal',true);
C = A.*B;
categories(C)
See Also
categorical | categories | summary | times
Related Examples
• “Create Categorical Arrays” on page 8-2
• “Combine Categorical Arrays” on page 8-19
• “Access Data Using Categorical Arrays” on page 8-24
More About
• “Ordinal Categorical Arrays” on page 8-36
8-23
8 Categorical Arrays
In this section...
“Select Data By Category” on page 8-24
“Common Ways to Access Data Using Categorical Arrays” on page 8-24
• Select elements from particular categories. For categorical arrays, use the logical operators
== or ~= to select data that is in, or not in, a particular category. To select data in a particular
group of categories, use the ismember function.
For ordinal categorical arrays, use inequalities >, >=, <, or <= to find data in categories above or
below a particular category.
• Delete data that is in a particular category. Use logical operators to include or exclude data
from particular categories.
• Find elements that are not in a defined category. Categorical arrays indicate which elements
do not belong to a defined category by <undefined>. Use the isundefined function to find
observations without a defined value.
load patients
whos
8-24
Access Data Using Categorical Arrays
Gender and Location contain data that belong in categories. Each cell array contains character
vectors taken from a small set of unique values (indicating two genders and three locations
respectively). Convert Gender and Location to categorical arrays.
Gender = categorical(Gender);
Location = categorical(Location);
For categorical arrays, you can use the logical operators == and ~= to find the data that is in, or not
in, a particular category.
Determine if there are any patients observed at the location, 'Rampart General Hospital'.
ans = logical
0
You can use ismember to find data in a particular group of categories. Create a logical vector for the
patients observed at County General Hospital or VA Hospital.
VA_CountyGenIndex = ...
ismember(Location,{'County General Hospital','VA Hospital'});
VA_CountyGenIndex is a 100-by-1 logical array containing logical true (1) for each element in the
categorical array Location that is a member of the category County General Hospital or VA
Hospital. The output, VA_CountyGenIndex contains 76 nonzero elements.
Use the logical vector, VA_CountyGenIndex to select the LastName of the patients observed at
either County General Hospital or VA Hospital.
VA_CountyGenPatients = LastName(VA_CountyGenIndex);
Use the summary function to print a summary containing the category names and the number of
elements in each category.
summary(Location)
Location is a 100-by-1 categorical array with three categories. County General Hospital
occurs in 39 elements, St. Mary s Medical Center in 24 elements, and VA Hospital in 37
elements.
8-25
8 Categorical Arrays
Female 53
Male 47
Gender is a 100-by-1 categorical array with two categories. Female occurs in 53 elements and Male
occurs in 47 elements.
Use logical operator == to access the age of only the female patients. Then plot a histogram of this
data.
figure()
histogram(Age(Gender=='Female'))
title('Age of Female Patients')
You can use logical operators to include or exclude data from particular categories. Delete all patients
observed at VA Hospital from the workspace variables, Age and Location.
Age = Age(Location~='VA Hospital');
Location = Location(Location~='VA Hospital');
Now, Age is a 63-by-1 numeric array, and Location is a 63-by-1 categorical array.
8-26
Access Data Using Categorical Arrays
List the categories of Location, as well as the number of elements in each category.
summary(Location)
The patients observed at VA Hospital are deleted from Location, but VA Hospital is still a
category.
Use the removecats function to remove VA Hospital from the categories of Location.
categories(Location)
Delete Element
You can delete elements by indexing. For example, you can remove the first element of Location by
selecting the rest of the elements with Location(2:end). However, an easier way to delete
elements is to use [].
Location(1) = [];
summary(Location)
Location is a 62-by-1 categorical array that has two categories. Deleting the first element has no
effect on other elements from the same category and does not delete the category itself.
Location(1:8)
8-27
8 Categorical Arrays
After removing the category, County General Hospital, elements that previously belonged to
that category no longer belong to any category defined for Location. Categorical arrays denote
these elements as undefined.
Use the function isundefined to find observations that do not belong to any category.
undefinedIndex = isundefined(Location);
undefinedIndex is a 62-by-1 categorical array containing logical true (1) for all undefined
elements in Location.
Use the summary function to print the number of undefined elements in Location.
summary(Location)
The first element of Location belongs to the category, St. Mary's Medical Center. Set the first
element to be undefined so that it no longer belongs to any category.
Location(1) = '<undefined>';
summary(Location)
You can make selected elements undefined without removing a category or changing the categories
of other elements. Set elements to be undefined to indicate elements with values that are unknown.
You can use undefined elements to preallocate the size of a categorical array for better performance.
Create a categorical array that has elements with known locations only.
definedIndex = ~isundefined(Location);
newLocation = Location(definedIndex);
summary(newLocation)
Expand the size of newLocation so that it is a 200-by-1 categorical array. Set the last new element
to be undefined. All of the other new elements also are set to be undefined. The 23 original
elements keep the values they had.
newLocation(200) = '<undefined>';
summary(newLocation)
8-28
Access Data Using Categorical Arrays
newLocation has room for values you plan to store in the array later.
See Also
categorical | categories | summary | any | histogram | removecats | isundefined
Related Examples
• “Create Categorical Arrays” on page 8-2
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Plot Categorical Data” on page 8-10
• “Compare Categorical Array Elements” on page 8-16
• “Work with Protected Categorical Arrays” on page 8-30
More About
• “Advantages of Using Categorical Arrays” on page 8-34
• “Ordinal Categorical Arrays” on page 8-36
8-29
8 Categorical Arrays
When you create a categorical array with the categorical function, you have the option of
specifying whether or not the categories are protected. Ordinal categorical arrays always have
protected categories, but you also can create a nonordinal categorical array that is protected using
the 'Protected',true name-value pair argument.
When you assign values that are not in the array's list of categories, the array updates automatically
so that its list of categories includes the new values. Similarly, you can combine (nonordinal)
categorical arrays that have different categories. The categories in the result include the categories
from both arrays.
When you assign new values to a protected categorical array, the values must belong to one of the
existing categories. Similarly, you can only combine protected arrays that have the same categories.
• If you want to combine two nonordinal categorical arrays that have protected categories, they
must have the same categories, but the order does not matter. The resulting categorical array
uses the category order from the first array.
• If you want to combine two ordinal categorical array (that always have protected categories), they
must have the same categories, including their order.
To add new categories to the array, you must use the function addcats.
Create a categorical array containing the sizes of 10 objects. Use the names small, medium, and
large for the values 'S', 'M', and 'L'.
A = categorical({'M';'L';'S';'S';'M';'L';'M';'L';'M';'S'},...
{'S','M','L'},{'small','medium','large'},'Ordinal',true)
A = 10x1 categorical
medium
large
small
small
medium
large
medium
large
medium
small
8-30
Work with Protected Categorical Arrays
When you create an ordinal categorical array, the categories are always protected.
Use the isprotected function to verify that the categories of A are protected.
tf = isprotected(A)
tf = logical
1
If you try to assign a new value that does not belong to one of the existing categories, then MATLAB®
returns an error. For example, you cannot assign the value 'xlarge' to the categorical array, as in
the expression A(2) = 'xlarge', because xlarge is not a category of A. Instead, MATLAB®
returns the error:
To add a new category for xlarge, use the addcats function. Since A is ordinal you must specify the
order for the new category.
A = addcats(A,'xlarge','After','large');
A(2) = 'xlarge'
A = 10x1 categorical
medium
xlarge
small
small
medium
large
medium
large
medium
small
A is now a 10-by-1 categorical array with four categories, such that small < medium < large <
xlarge.
Create another ordinal categorical array, B, containing the sizes of five items.
8-31
8 Categorical Arrays
B = categorical([2;1;1;2;2],1:2,{'xsmall','small'},'Ordinal',true)
B = 5x1 categorical
small
xsmall
xsmall
small
small
B is a 5-by-1 categorical array with two categories such that xsmall < small.
To combine two ordinal categorical arrays (which always have protected categories), they must have
the same categories and the categories must be in the same order.
A = addcats(A,'xsmall','Before','small');
categories(A)
B = addcats(B,{'medium','large','xlarge'},'After','small');
categories(B)
The categories of A and B are now the same including their order.
C = [A;B]
C = 15x1 categorical
medium
xlarge
small
small
medium
large
medium
large
medium
8-32
Work with Protected Categorical Arrays
small
small
xsmall
xsmall
small
small
categories(C)
C is a 16-by-1 ordinal categorical array with five categories, such that xsmall < small < medium
< large < xlarge.
See Also
categorical | categories | summary | isprotected | isordinal | addcats
Related Examples
• “Create Categorical Arrays” on page 8-2
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Access Data Using Categorical Arrays” on page 8-24
• “Combine Categorical Arrays” on page 8-19
• “Combine Categorical Arrays Using Multiplication” on page 8-22
More About
• “Ordinal Categorical Arrays” on page 8-36
8-33
8 Categorical Arrays
In this section...
“Natural Representation of Categorical Data” on page 8-34
“Mathematical Ordering for Character Vectors” on page 8-34
“Reduce Memory Requirements” on page 8-34
An ordering other than alphabetical order is not possible with character arrays or cell arrays of
character vectors. Thus, inequality comparisons, such as greater and less than, are not possible. With
categorical arrays, you can use relational operations to test for equality and perform element-wise
comparisons that have a meaningful mathematical ordering.
state = [repmat({'MA'},25,1);repmat({'NY'},25,1);...
repmat({'CA'},50,1);...
repmat({'MA'},25,1);repmat({'NY'},25,1)];
whos state
8-34
Advantages of Using Categorical Arrays
The variable state is a cell array of character vectors requiring 17,400 bytes of memory.
state = categorical(state);
categories(state)
whos state
See Also
categorical | categories
Related Examples
• “Create Categorical Arrays” on page 8-2
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Compare Categorical Array Elements” on page 8-16
• “Access Data Using Categorical Arrays” on page 8-24
More About
• “Ordinal Categorical Arrays” on page 8-36
8-35
8 Categorical Arrays
Order of Categories
categorical is a data type to store data with values from a finite set of discrete categories, which
can have a natural order. You can specify and rearrange the order of categories in all categorical
arrays. However, you only can treat ordinal categorical arrays as having a mathematical ordering to
their categories. Use an ordinal categorical array if you want to use the functions min, max, or
relational operations, such as greater than and less than.
The discrete set of pet categories {'dog' 'cat' 'bird'} has no meaningful mathematical
ordering. You are free to use any category order and the meaning of the associated data does not
change. For example, pets = categorical({'bird','cat','dog','dog','cat'}) creates a
categorical array and the categories are listed in alphabetical order, {'bird' 'cat' 'dog'}. You
can choose to specify or change the order of the categories to {'dog' 'cat' 'bird'} and the
meaning of the data does not change.
ordinal categorical arrays contain categories that have a meaningful mathematical ordering. For
example, the discrete set of size categories {'small', 'medium', 'large'} has the
mathematical ordering small < medium < large. The first category listed is the smallest and the
last category is the largest. The order of the categories in an ordinal categorical array affects the
result from relational comparisons of ordinal categorical arrays.
Create an ordinal categorical array, sizes, from a cell array of character vectors, A. Use valueset,
specified as a vector of unique values, to define the categories for sizes.
sizes = categorical(A,valueset,'Ordinal',true)
sizes is 3-by-2 ordinal categorical array with three categories such that small < medium <
large. The order of the values in valueset becomes the order of the categories of sizes.
8-36
Ordinal Categorical Arrays
Create an equivalent categorical array from an array of integers. Use the values 1, 2, and 3 to define
the categories small, medium, and large, respectively.
A2 = [2 3; 1 2; 3 1];
valueset = 1:3;
catnames = {'small','medium','large'};
sizes2 = categorical(A2,valueset,catnames,'Ordinal',true)
isequal(sizes,sizes2)
ans = logical
1
sizes and sizes2 are equivalent categorical arrays with the same ordering of categories.
Create a nonordinal categorical array from the cell array of character vectors, A.
sizes3 = categorical(A)
isordinal(sizes3)
ans = logical
0
Convert sizes3 to an ordinal categorical array, such that small < medium < large.
sizes3 = categorical(sizes3,{'small','medium','large'},'Ordinal',true);
8-37
8 Categorical Arrays
sizes3 is now a 3-by-2 ordinal categorical array equivalent to sizes and sizes2.
See Also
categorical | categories | isordinal | isequal
Related Examples
• “Create Categorical Arrays” on page 8-2
• “Convert Text in Table Variables to Categorical” on page 8-6
• “Compare Categorical Array Elements” on page 8-16
• “Access Data Using Categorical Arrays” on page 8-24
More About
• “Advantages of Using Categorical Arrays” on page 8-34
8-38
Core Functions Supporting Categorical Arrays
The following table lists notable MATLAB functions that operate on categorical arrays in addition to
other arrays.
8-39
9
Tables
In MATLAB®, you can create tables and assign data to them in several ways.
The way you choose depends on the nature of your data and how you plan to use tables in your code.
You can create a table from arrays by using the table function. For example, create a small table
with data for five patients.
First, create six column-oriented arrays of data. These arrays have five rows because there are five
patients. (Most of these arrays are 5-by-1 column vectors, while BloodPressure is a 5-by-2 matrix.)
LastName = ["Sanchez";"Johnson";"Zhang";"Diaz";"Brown"];
Age = [38;43;38;40;49];
Smoker = [true;false;true;false;true];
Height = [71;69;64;67;64];
Weight = [176;163;131;133;119];
BloodPressure = [124 93; 109 77; 125 83; 117 75; 122 80];
Now create a table, patients, as a container for the data. In this call to the table function, the
input arguments use the workspace variable names for the names of the variables in patients.
patients = table(LastName,Age,Smoker,Height,Weight,BloodPressure)
patients=5×6 table
LastName Age Smoker Height Weight BloodPressure
_________ ___ ______ ______ ______ _____________
9-2
Create Tables and Assign Data to Them
The table is a 5-by-6 table because it has six variables. As the BloodPressure variable shows, a
table variable itself can have multiple columns. This example shows why tables have rows and
variables, not rows and columns.
Once you have created a table, you can add a new variable at any time by using dot notation. Dot
notation refers to table variables by name, T.varname, where T is the table and varname is the
variable name. This notation is similar to the notation you use to access and assign data to the fields
of a structure.
For example, add a BMI variable to patients. Calculate body mass index, or BMI, using the values in
patients.Weight and patients.Height. Assign the BMI values to a new table variable.
patients.BMI = (patients.Weight*0.453592)./(patients.Height*0.0254).^2
patients=5×7 table
LastName Age Smoker Height Weight BloodPressure BMI
_________ ___ ______ ______ ______ _____________ ______
Another way to create a table is to start with an empty table and assign variables to it. For example,
re-create the table of patient data, but this time assign variables using dot notation.
patients2 = table
patients2 =
Next, create a copy of the patient data by assigning variables. Table variable names do not have to
match array names, as shown by the Name and BP table variables.
patients2.Name = LastName;
patients2.Age = Age;
patients2.Smoker = Smoker;
patients2.Height = Height;
patients2.Weight = Weight;
patients2.BP = BloodPressure
patients2=5×6 table
Name Age Smoker Height Weight BP
_________ ___ ______ ______ ______ __________
9-3
9 Tables
Sometimes you know the sizes and data types of the data that you want to store in a table, but you
plan to assign the data later. Perhaps you plan to add only a few rows at a time. In that case,
preallocating space in the table and then assigning values to empty rows can be more efficient.
For example, to preallocate space for a table to contain time and temperature readings at different
stations, use the table function. Instead of supplying input arrays, specify the sizes and data types of
the table variables. To give them names, specify the 'VariableNames' argument. Preallocation fills
table variables with default values that are appropriate for their data types.
sz = [4 3];
varTypes = ["double","datetime","string"];
varNames = ["Temperature","Time","Station"];
temps = table('Size',sz,'VariableTypes',varTypes,'VariableNames',varNames)
temps=4×3 table
Temperature Time Station
___________ ____ _________
0 NaT <missing>
0 NaT <missing>
0 NaT <missing>
0 NaT <missing>
One way to assign or add a row to a table is to assign a cell array to a row. If the cell array is a row
vector and its elements match the data types of their respective variables, then the assignment
converts the cell array to a table row. However, you can assign only one row at a time using cell
arrays. Assign values to the first two rows.
temps(1,:) = {75,datetime('now'),"S1"};
temps(2,:) = {68,datetime('now')+1,"S2"}
temps=4×3 table
Temperature Time Station
___________ ____________________ _________
As an alternative, you can assign rows from a smaller table into a larger table. With this method, you
can assign one or more rows at a time.
temps(3:4,:) = table([63;72],[datetime('now')+2;datetime('now')+3],["S3";"S4"])
temps=4×3 table
Temperature Time Station
___________ ____________________ _______
9-4
Create Tables and Assign Data to Them
You can use either syntax to increase the size of a table by assigning rows beyond the end of the
table. If necessary, missing rows are filled in with default values.
temps(6,:) = {62,datetime('now')+6,"S6"}
temps=6×3 table
Temperature Time Station
___________ ____________________ _________
You can convert variables that have other data types to tables. Cell arrays and structures are other
types of containers that can store arrays that have different data types. So you can convert cell arrays
and structures to tables. You can also convert an array to a table where the table variables contain
columns of values from the array. To convert these kinds of variables, use the array2table,
cell2table, or struct2table functions.
For example, convert an array to a table by using array2table. Arrays do not have column names,
so the table has default variable names.
A = randi(3,3)
A = 3×3
3 3 1
3 2 2
1 1 3
a2t = array2table(A)
a2t=3×3 table
A1 A2 A3
__ __ __
3 3 1
3 2 2
1 1 3
You can provide your own table variable names by using the "VariableNames" name-value
argument.
a2t = array2table(A,"VariableNames",["First","Second","Third"])
a2t=3×3 table
First Second Third
9-5
9 Tables
3 3 1
3 2 2
1 1 3
It is common to have a large quantity of tabular data in a file such as a CSV (comma-separated value)
file or an Excel® spreadsheet. To read such data into a table, use the readtable function.
For example, the CSV file outages.csv is a sample file that is distributed with MATLAB. The file
contains data for a set of electrical power outages. The first line of outages.csv has column names.
The rest of the file has comma-separated data values for each outage. The first few lines are shown
here.
Region,OutageTime,Loss,Customers,RestorationTime,Cause
SouthWest,2002-02-01 12:18,458.9772218,1820159.482,2002-02-07 16:50,winter storm
SouthEast,2003-01-23 00:49,530.1399497,212035.3001,,winter storm
SouthEast,2003-02-07 21:15,289.4035493,142938.6282,2003-02-17 08:14,winter storm
West,2004-04-06 05:44,434.8053524,340371.0338,2004-04-06 06:10,equipment fault
MidWest,2002-03-16 06:18,186.4367788,212754.055,2002-03-18 23:23,severe storm
...
To read outages.csv and store the data in a table, you can use readtable. It reads numeric
values, dates and times, and strings into table variables that have appropriate data types. Here, Loss
and Customers are numeric arrays. The OutageTime and RestorationTime variables are
datetime arrays because readtable recognizes the date and time formats of the text in those
columns of the input file. To read the rest of the text data into string arrays, specify the "TextType"
name-value argument.
outages = readtable("outages.csv","TextType","string")
outages=1468×6 table
Region OutageTime Loss Customers RestorationTime Cause
___________ ________________ ______ __________ ________________ ______________
9-6
Create Tables and Assign Data to Them
Finally, you can interactively preview and import data from spreadsheets or delimited text files by
using the Import Tool. There are two ways to open the Import Tool.
• MATLAB Toolstrip: On the Home tab, in the Variable section, click Import Data.
• MATLAB command prompt: Enter uiimport(filename), where filename is the name of a text
or spreadsheet file.
For example, open the outages.csv sample file by using uiimport and which to get the path to
the file.
uiimport(which("outages.csv"))
The Import Tool shows you a preview of the six columns from outages.csv. To import the data as a
table, follow these steps.
See Also
readtable | table | array2table | cell2table | struct2table | Import Tool
Related Examples
• “Access Data in Tables” on page 9-32
• “Add and Delete Table Rows” on page 9-9
9-7
9 Tables
9-8
Add and Delete Table Rows
load patients
T = table(LastName,Gender,Age,Height,Weight,Smoker,Systolic,Diastolic);
size(T)
ans = 1×2
100 8
Read data on more patients from a comma-delimited file, morePatients.csv, into a table, T2. Then,
append the rows from T2 to the end of the table, T.
T2 = readtable('morePatients.csv');
Tnew = [T;T2];
size(Tnew)
ans = 1×2
104 8
The table Tnew has 104 rows. In order to vertically concatenate two tables, both tables must have the
same number of variables, with the same variable names. If the variable names are different, you can
directly assign new rows in a table to rows from another table. For example, T(end+1:end+4,:) =
T2.
To append new rows stored in a cell array, vertically concatenate the cell array onto the end of the
table. You can concatenate directly from a cell array when it has the right number of columns and the
contents of its cells can be concatenated onto the corresponding table variables.
cellPatients = {'Edwards','Male',42,70,158,0,116,83;
'Falk','Female',28,62,125,1,120,71};
Tnew = [Tnew;cellPatients];
size(Tnew)
ans = 1×2
106 8
You also can convert a cell array to a table using the cell2table function.
9-9
9 Tables
You also can append new rows stored in a structure. Convert the structure to a table, and then
concatenate the tables.
structPatients(1,1).LastName = 'George';
structPatients(1,1).Gender = 'Male';
structPatients(1,1).Age = 45;
structPatients(1,1).Height = 76;
structPatients(1,1).Weight = 182;
structPatients(1,1).Smoker = 1;
structPatients(1,1).Systolic = 132;
structPatients(1,1).Diastolic = 85;
structPatients(2,1).LastName = 'Hadley';
structPatients(2,1).Gender = 'Female';
structPatients(2,1).Age = 29;
structPatients(2,1).Height = 58;
structPatients(2,1).Weight = 120;
structPatients(2,1).Smoker = 0;
structPatients(2,1).Systolic = 112;
structPatients(2,1).Diastolic = 70;
Tnew = [Tnew;struct2table(structPatients)];
size(Tnew)
ans = 1×2
108 8
To omit any rows in a table that are duplicated, use the unique function.
Tnew = unique(Tnew);
size(Tnew)
ans = 1×2
106 8
Tnew([18,20,21],:) = [];
size(Tnew)
ans = 1×2
103 8
9-10
Add and Delete Table Rows
First, specify the variable of identifiers, LastName, as row names. Then, delete the variable,
LastName, from Tnew. Finally, use the row name to index and delete rows.
Tnew.Properties.RowNames = Tnew.LastName;
Tnew.LastName = [];
Tnew('Smith',:) = [];
size(Tnew)
ans = 1×2
102 7
The table now has one less row and one less variable.
You also can search for observations in the table. For example, delete rows for any patients under the
age of 30.
ans = 1×2
85 7
See Also
table | readtable | array2table | cell2table | struct2table
Related Examples
• “Add, Delete, and Rearrange Table Variables” on page 9-12
• “Clean Messy and Missing Data in Tables” on page 9-19
9-11
9 Tables
You also can modify table variables using the Variables Editor.
Load arrays of sample data from the patients MAT-file. Display the names and sizes of the variables
loaded into the workspace.
load patients
whos -file patients
Create two tables. Create one table, T, with information collected from a patient questionnaire and
create another table, T2, with data measured from patients. Each table has 100 rows.
T = table(Age,Gender,Smoker);
T2 = table(Height,Weight,Systolic,Diastolic);
head(T,5)
ans=5×3 table
Age Gender Smoker
___ __________ ______
38 {'Male' } true
43 {'Male' } false
38 {'Female'} false
40 {'Female'} false
49 {'Female'} false
head(T2,5)
ans=5×4 table
Height Weight Systolic Diastolic
9-12
Add, Delete, and Rearrange Table Variables
71 176 124 93
69 163 109 77
64 131 125 83
67 133 117 75
64 119 122 80
ans=5×7 table
Age Gender Smoker Height Weight Systolic Diastolic
___ __________ ______ ______ ______ ________ _________
If the tables that you are horizontally concatenating have row names, horzcat concatenates the
tables by matching the row names. Therefore, the tables must use the same row names, but the row
order does not matter.
Add the names of patients from the workspace variable LastName before the first table variable in T.
You can specify any location in the table using the name of a variable near the new location. Use
quotation marks to refer to the names of table variables. However, do not use quotation marks for
input arguments that are workspace variables.
T = addvars(T,LastName,'Before','Age');
head(T,5)
ans=5×8 table
LastName Age Gender Smoker Height Weight Systolic Diastolic
____________ ___ __________ ______ ______ ______ ________ _________
You also can specify locations in a table using numbers. For example, the equivalent syntax using a
number to specify location is T = addvars(T,LastName,'Before',1).
9-13
9 Tables
An alternative way to add new table variables is to use dot syntax. When you use dot syntax, you
always add the new variable as the last table variable. You can add a variable that has any data type,
as long as it has the same number of rows as the table.
Create a new variable for blood pressure as a horizontal concatenation of the two variables
Systolic and Diastolic. Add it to T.
ans=5×9 table
LastName Age Gender Smoker Height Weight Systolic Diastolic B
____________ ___ __________ ______ ______ ______ ________ _________ _
T now has 9 variables and 100 rows. A table variable can have multiple columns. So although
BloodPressure has two columns, it is one table variable.
Add a new variable, BMI, in the table T, that contains the body mass index for each patient. BMI is a
function of height and weight. When you calculate BMI, you can refer to the Weight and Height
variables that are in T.
T.BMI = (T.Weight*0.453592)./(T.Height*0.0254).^2;
The operators ./ and .^ in the calculation of BMI indicate element-wise division and exponentiation,
respectively.
head(T,5)
ans=5×10 table
LastName Age Gender Smoker Height Weight Systolic Diastolic B
____________ ___ __________ ______ ______ ______ ________ _________ _
Move the table variable BMI using the movevars function, so that it is after the variable Weight.
When you specify table variables by name, use quotation marks.
T = movevars(T,'BMI','After','Weight');
head(T,5)
9-14
Add, Delete, and Rearrange Table Variables
ans=5×10 table
LastName Age Gender Smoker Height Weight BMI Systolic Dias
____________ ___ __________ ______ ______ ______ ______ ________ ____
You also can specify locations in a table using numbers. For example, the equivalent syntax using a
number to specify location is T = movevars(T,'BMI,'After',6). It is often more convenient to
refer to variables by name.
As an alternative, you can move table variables by indexing. You can index into a table using the same
syntax you use for indexing into a matrix.
T = T(:,[1:7 10 8 9]);
head(T,5)
ans=5×10 table
LastName Age Gender Smoker Height Weight BMI BloodPressure
____________ ___ __________ ______ ______ ______ ______ _____________
In a table with many variables, it is often more convenient to use the movevars function.
Delete Variables
To delete table variables, use the removevars function. Delete the Systolic and Diastolic table
variables.
T = removevars(T,{'Systolic','Diastolic'});
head(T,5)
ans=5×8 table
LastName Age Gender Smoker Height Weight BMI BloodPressure
____________ ___ __________ ______ ______ ______ ______ _____________
9-15
9 Tables
As an alternative, you can delete variables using dot syntax and the empty matrix, []. Remove the
Age variable from the table.
T.Age = [];
head(T,5)
ans=5×7 table
LastName Gender Smoker Height Weight BMI BloodPressure
____________ __________ ______ ______ ______ ______ _____________
You also can delete variables using indexing and the empty matrix, []. Remove the Gender variable
from the table.
T(:,'Gender') = [];
head(T,5)
ans=5×6 table
LastName Smoker Height Weight BMI BloodPressure
____________ ______ ______ ______ ______ _____________
To split multicolumn table variables into variables that each have one column, use the splitvars
functions. Split the variable BloodPressure into two variables.
T = splitvars(T,'BloodPressure','NewVariableNames',{'Systolic','Diastolic'});
head(T,5)
ans=5×7 table
LastName Smoker Height Weight BMI Systolic Diastolic
____________ ______ ______ ______ ______ ________ _________
Similarly, you can group related table variables together in one variable, using the mergevars
function. Combine Systolic and Diastolic back into one variable, and name it BP.
9-16
Add, Delete, and Rearrange Table Variables
T = mergevars(T,{'Systolic','Diastolic'},'NewVariableName','BP');
head(T,5)
ans=5×6 table
LastName Smoker Height Weight BMI BP
____________ ______ ______ ______ ______ __________
You can reorient the rows of a table or timetable, so that they become the variables in the output
table, using the rows2vars function. However, if the table has multicolumn variables, then you must
split them before you can call rows2vars.
Reorient the rows of T. Specify that the names of the patients in T are the names of table variables in
the output table. The first variable of T3 contains the names of the variables of T. Each remaining
variable of T3 contains the data from the corresponding row of T.
T = splitvars(T,'BP','NewVariableNames',{'Systolic','Diastolic'});
T3 = rows2vars(T,'VariableNamesSource','LastName');
T3(:,1:5)
ans=6×5 table
OriginalVariableNames Smith Johnson Williams Jones
_____________________ ______ _______ ________ ______
{'Smoker' } 1 0 0 0
{'Height' } 71 69 64 67
{'Weight' } 176 163 131 133
{'BMI' } 24.547 24.071 22.486 20.831
{'Systolic' } 124 109 125 117
{'Diastolic'} 93 77 83 75
You can use dot syntax with T3 to access patient data as an array. However, if the row values of an
input table cannot be concatenated, then the variables of the output table are cell arrays.
T3.Smith
ans = 6×1
1.0000
71.0000
176.0000
24.5467
124.0000
93.0000
See Also
table | addvars | movevars | removevars | splitvars | mergevars | inner2outer |
rows2vars
9-17
9 Tables
Related Examples
• “Add and Delete Table Rows” on page 9-9
• “Clean Messy and Missing Data in Tables” on page 9-19
• “Modify Units, Descriptions, and Table Variable Names” on page 9-24
9-18
Clean Messy and Missing Data in Tables
Load sample data from a comma-separated text file, messy.csv. The file contains many different
missing data indicators:
To specify the character vectors to treat as empty values, use the 'TreatAsEmpty' name-value pair
argument with the readtable function. (Use the disp function to display all 21 rows, even when
running this example as a live script.)
T = readtable('messy.csv','TreatAsEmpty',{'.','NA'});
disp(T)
A B C D E
________ ____ __________ ____ ____
{'afe1'} 3 {'yes' } 3 3
{'egh3'} NaN {'no' } 7 7
{'wth4'} 3 {'yes' } 3 3
{'atn2'} 23 {'no' } 23 23
{'arg1'} 5 {'yes' } 5 5
{'jre3'} 34.6 {'yes' } 34.6 34.6
{'wen9'} 234 {'yes' } 234 234
{'ple2'} 2 {'no' } 2 2
{'dbo8'} 5 {'no' } 5 5
{'oii4'} 5 {'yes' } 5 5
{'wnk3'} 245 {'yes' } 245 245
{'abk6'} 563 {0x0 char} 563 563
{'pnj5'} 463 {'no' } 463 463
{'wnn3'} 6 {'no' } 6 6
{'oks9'} 23 {'yes' } 23 23
{'wba3'} NaN {'yes' } NaN 14
{'pkn4'} 2 {'no' } 2 2
{'adw3'} 22 {'no' } 22 22
{'poj2'} -99 {'yes' } -99 -99
{'bas8'} 23 {'no' } 23 23
{'gry5'} NaN {'yes' } NaN 21
T is a table with 21 rows and five variables. 'TreatAsEmpty' only applies to numeric columns in the
file and cannot handle numeric values specified as text, such as '-99'.
Summarize Table
View the data type, description, units, and other descriptive statistics for each variable by creating a
table summary using the summary function.
summary(T)
9-19
9 Tables
Variables:
B: 21x1 double
Values:
Min -99
Median 14
Max 563
NumMissing 3
D: 21x1 double
Values:
Min -99
Median 7
Max 563
NumMissing 2
E: 21x1 double
Values:
Min -99
Median 14
Max 563
When you import data from a file, the default is for readtable to read any variables with
nonnumeric elements as a cell array of character vectors.
Display the subset of rows from the table, T, that have at least one missing value.
A B C D E
________ ___ __________ ___ ___
readtable replaced '.' and 'NA' with NaN in the numeric variables, B, D, and E.
Clean the data so that the missing values indicated by code -99 have the standard MATLAB®
numeric missing value indicator, NaN.
9-20
Clean Messy and Missing Data in Tables
T = standardizeMissing(T,-99);
disp(T)
A B C D E
________ ____ __________ ____ ____
{'afe1'} 3 {'yes' } 3 3
{'egh3'} NaN {'no' } 7 7
{'wth4'} 3 {'yes' } 3 3
{'atn2'} 23 {'no' } 23 23
{'arg1'} 5 {'yes' } 5 5
{'jre3'} 34.6 {'yes' } 34.6 34.6
{'wen9'} 234 {'yes' } 234 234
{'ple2'} 2 {'no' } 2 2
{'dbo8'} 5 {'no' } 5 5
{'oii4'} 5 {'yes' } 5 5
{'wnk3'} 245 {'yes' } 245 245
{'abk6'} 563 {0x0 char} 563 563
{'pnj5'} 463 {'no' } 463 463
{'wnn3'} 6 {'no' } 6 6
{'oks9'} 23 {'yes' } 23 23
{'wba3'} NaN {'yes' } NaN 14
{'pkn4'} 2 {'no' } 2 2
{'adw3'} 22 {'no' } 22 22
{'poj2'} NaN {'yes' } NaN NaN
{'bas8'} 23 {'no' } 23 23
{'gry5'} NaN {'yes' } NaN 21
Create a new table, T2, and replace missing values with values from previous rows of the table.
fillmissing provides a number of ways to fill in missing values.
T2 = fillmissing(T,'previous');
disp(T2)
A B C D E
________ ____ _______ ____ ____
{'afe1'} 3 {'yes'} 3 3
{'egh3'} 3 {'no' } 7 7
{'wth4'} 3 {'yes'} 3 3
{'atn2'} 23 {'no' } 23 23
{'arg1'} 5 {'yes'} 5 5
{'jre3'} 34.6 {'yes'} 34.6 34.6
{'wen9'} 234 {'yes'} 234 234
{'ple2'} 2 {'no' } 2 2
{'dbo8'} 5 {'no' } 5 5
{'oii4'} 5 {'yes'} 5 5
{'wnk3'} 245 {'yes'} 245 245
{'abk6'} 563 {'yes'} 563 563
{'pnj5'} 463 {'no' } 463 463
{'wnn3'} 6 {'no' } 6 6
{'oks9'} 23 {'yes'} 23 23
{'wba3'} 23 {'yes'} 23 14
{'pkn4'} 2 {'no' } 2 2
{'adw3'} 22 {'no' } 22 22
{'poj2'} 22 {'yes'} 22 22
9-21
9 Tables
{'bas8'} 23 {'no' } 23 23
{'gry5'} 23 {'yes'} 23 21
Create a new table, T3, that contains only the rows from T without missing values. T3 has only 16
rows.
T3 = rmmissing(T);
disp(T3)
A B C D E
________ ____ _______ ____ ____
{'afe1'} 3 {'yes'} 3 3
{'wth4'} 3 {'yes'} 3 3
{'atn2'} 23 {'no' } 23 23
{'arg1'} 5 {'yes'} 5 5
{'jre3'} 34.6 {'yes'} 34.6 34.6
{'wen9'} 234 {'yes'} 234 234
{'ple2'} 2 {'no' } 2 2
{'dbo8'} 5 {'no' } 5 5
{'oii4'} 5 {'yes'} 5 5
{'wnk3'} 245 {'yes'} 245 245
{'pnj5'} 463 {'no' } 463 463
{'wnn3'} 6 {'no' } 6 6
{'oks9'} 23 {'yes'} 23 23
{'pkn4'} 2 {'no' } 2 2
{'adw3'} 22 {'no' } 22 22
{'bas8'} 23 {'no' } 23 23
Organize Data
Sort the rows of T3 in descending order by C, and then sort in ascending order by A.
T3 = sortrows(T2,{'C','A'},{'descend','ascend'});
disp(T3)
A B C D E
________ ____ _______ ____ ____
9-22
Clean Messy and Missing Data in Tables
{'egh3'} 3 {'no' } 7 7
{'pkn4'} 2 {'no' } 2 2
{'ple2'} 2 {'no' } 2 2
{'pnj5'} 463 {'no' } 463 463
{'wnn3'} 6 {'no' } 6 6
In C, the rows are grouped first by 'yes', followed by 'no'. Then in A, the rows are listed
alphabetically.
T3 = T3(:,{'A','C','B','D','E'});
disp(T3)
A C B D E
________ _______ ____ ____ ____
See Also
readtable | summary | ismissing | sortrows | standardizeMissing | rmmissing |
fillmissing
Related Examples
• “Add and Delete Table Rows” on page 9-9
• “Add, Delete, and Rearrange Table Variables” on page 9-12
• “Modify Units, Descriptions, and Table Variable Names” on page 9-24
• “Access Data in Tables” on page 9-32
• “Missing Data in MATLAB”
• “Data Cleaning and Calculations in Tables” on page 9-66
• “Grouped Calculations in Tables and Timetables” on page 9-86
9-23
9 Tables
load patients
BloodPressure = [Systolic Diastolic];
T = table(Gender,Age,Height,Weight,Smoker,BloodPressure);
T(1:5,:)
ans=5×6 table
Gender Age Height Weight Smoker BloodPressure
__________ ___ ______ ______ ______ _____________
Specify units for each variable in the table by modifying the table property, VariableUnits. Specify
the variable units as a cell array of character vectors.
An individual empty character vector within the cell array indicates that the corresponding variable
does not have units.
Add a variable description for the variable, BloodPressure. Assign a single character vector to the
element of the cell array containing the description for BloodPressure.
T.Properties.VariableDescriptions{'BloodPressure'} = 'Systolic/Diastolic';
You can use the variable name, 'BloodPressure', or the numeric index of the variable, 6, to index
into the cell array of character vectors containing the variable descriptions.
View the data type, description, units, and other descriptive statistics for each variable by using
summary to summarize the table.
summary(T)
9-24
Modify Units, Descriptions, and Table Variable Names
Variables:
Properties:
Units: Yrs
Values:
Min 25
Median 39
Max 50
Properties:
Units: In
Values:
Min 60
Median 67
Max 72
Properties:
Units: Lbs
Values:
Min 111
Median 142.5
Max 202
Values:
True 34
False 66
Properties:
Description: Systolic/Diastolic
Values:
Column 1 Column 2
________ ________
Min 109 68
Median 122 81.5
Max 138 99
The BloodPressure variable has a description and the Age, Height, Weight, and BloodPressure
variables have units.
9-25
9 Tables
Change the variable name for the first variable from Gender to Sex.
T.Properties.VariableNames{'Gender'} = 'Sex';
T(1:5,:)
ans=5×6 table
Sex Age Height Weight Smoker BloodPressure
__________ ___ ______ ______ ______ _____________
In addition to properties for variable units, descriptions and names, there are table properties for row
and dimension names, a table description, and user data.
See Also
readtable | table | array2table | cell2table | struct2table | summary
Related Examples
• “Add, Delete, and Rearrange Table Variables” on page 9-12
• “Access Data in Tables” on page 9-32
9-26
Add Custom Properties to Tables and Timetables
All tables and timetables have properties that contain metadata about them or their variables. You
can access these properties through the T.Properties object, where T is the name of the table or
timetable. For example, T.Properties.VariableNames returns a cell array containing the names
of the variables of T.
The properties you access through T.Properties are part of the definitions of the table and
timetable data types. You cannot add or remove these predefined properties. But starting in
R2018b, you can add and remove your own custom properties, by modifying the
T.Properties.CustomProperties object of a table or timetable.
Add Properties
Read power outage data into a table. Sort it using the first variable that contains dates and times,
OutageTime. Then display the first three rows.
T = readtable('outages.csv');
T = sortrows(T,'OutageTime');
head(T,3)
ans=3×6 table
Region OutageTime Loss Customers RestorationTime Cause
_____________ ________________ ______ __________ ________________ ____________
Display its properties. These are the properties that all tables have in common. Note that there is also
a CustomProperties object, but that by default it has no properties.
T.Properties
ans =
TableProperties with properties:
Description: ''
UserData: []
DimensionNames: {'Row' 'Variables'}
VariableNames: {1x6 cell}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowNames: {}
CustomProperties: No custom properties are set.
Use addprop and rmprop to modify CustomProperties.
To add custom properties, use the addprop function. Specify the names of the properties. For each
property, also specify whether it has metadata for the whole table (similar to the Description
property) or for its variables (similar to the VariableNames property). If the property has variable
metadata, then its value must be a vector whose length is equal to the number of variables.
9-27
9 Tables
Add custom properties that contain an output file name, file type, and indicators of which variables to
plot. Best practice is to assign the input table as the output argument of addprop, so that the custom
properties are part of the same table. Specify that the output file name and file type are table
metadata using the 'table' option. Specify that the plot indicators are variable metadata using the
'variable' option.
T = addprop(T,{'OutputFileName','OutputFileType','ToPlot'}, ...
{'table','table','variable'});
T.Properties
ans =
TableProperties with properties:
Description: ''
UserData: []
DimensionNames: {'Row' 'Variables'}
VariableNames: {1x6 cell}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowNames: {}
When you add custom properties using addprop, their values are empty arrays by default. You can
set and access the values of the custom properties using dot syntax.
Set the output file name and type. These properties contain metadata for the table. Then assign a
logical array to the ToPlot property. This property contains metadata for the variables. In this
example, the elements of the value of the ToPlot property are true for each variable to be included
in a plot, and false for each variable to be excluded.
T.Properties.CustomProperties.OutputFileName = 'outageResults';
T.Properties.CustomProperties.OutputFileType = '.mat';
T.Properties.CustomProperties.ToPlot = [false false true true true false];
T.Properties
ans =
TableProperties with properties:
Description: ''
UserData: []
DimensionNames: {'Row' 'Variables'}
VariableNames: {1x6 cell}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowNames: {}
9-28
Add Custom Properties to Tables and Timetables
ToPlot: [0 0 1 1 1 0]
Plot variables from T in a stacked plot using the stackedplot function. To plot only the Loss,
Customers, and RestorationTime values, use the ToPlot custom property as the second input
argument.
stackedplot(T,T.Properties.CustomProperties.ToPlot);
When you move or delete table variables, both the predefined and custom properties are reordered so
that their values correspond to the same variables. In this example, the values of the ToPlot custom
property stay aligned with the variables marked for plotting, just as the values of the
VariableNames predefined property stay aligned.
T.Customers = [];
T.Properties
ans =
TableProperties with properties:
Description: ''
UserData: []
DimensionNames: {'Row' 'Variables'}
VariableNames: {1x5 cell}
VariableDescriptions: {}
9-29
9 Tables
VariableUnits: {}
VariableContinuity: []
RowNames: {}
Convert the table to a timetable, using the outage times as row times. Move Region to the end of the
table, and RestorationTime before the first variable, using the movevars function. Note that the
properties are reordered appropriately. The RestorationTime and Loss variables still have
indicators for inclusion in a plot.
T = table2timetable(T);
T = movevars(T,'Region','After','Cause');
T = movevars(T,'RestorationTime','Before',1);
T.Properties
ans =
TimetableProperties with properties:
Description: ''
UserData: []
DimensionNames: {'OutageTime' 'Variables'}
VariableNames: {'RestorationTime' 'Loss' 'Cause' 'Region'}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowTimes: [1468x1 datetime]
StartTime: 2002-02-01 12:18
SampleRate: NaN
TimeStep: NaN
Remove Properties
You can remove any or all of the custom properties of a table using the rmprop function. However,
you cannot use it to remove predefined properties from T.Properties, because those properties are
part of the definition of the table data type.
Remove the OutputFileName and OutputFileType custom properties. Display the remaining table
properties.
T = rmprop(T,{'OutputFileName','OutputFileType'});
T.Properties
ans =
TimetableProperties with properties:
Description: ''
UserData: []
9-30
Add Custom Properties to Tables and Timetables
See Also
readtable | table | head | addprop | table2timetable | movevars | rmprop | sortrows |
stackedplot
Related Examples
• “Modify Units, Descriptions, and Table Variable Names” on page 9-24
• “Access Data in Tables” on page 9-32
• “Add, Delete, and Rearrange Table Variables” on page 9-12
9-31
9 Tables
A table is a container that stores column-oriented data in variables. Table variables can have different
data types and sizes as long as all variables have the same number of rows. Table variables have
names, just as the fields of a structure have names. The rows of a table can have names, but row
names are not required. To access table data, index into the rows and variables using either their
names or numeric indices.
• Smooth parentheses, (), returns a table that has selected rows and variables.
• Dot notation returns the contents of a variable as an array.
• Curly braces, {}, returns an array concatenated from the contents of selected rows and
variables.
You can specify rows and variables by name, numeric index, or data type. Starting in R2019b,
variable names and row names can include any characters, including spaces and non-ASCII
characters. Also, they can start with any characters, not just letters. Variable and row names do not
have to be valid MATLAB identifiers (as determined by the isvarname function).
9-32
Access Data in Tables
Array extracted
from the first
table variable
9-33
9 Tables
9-34
Access Data in Tables
load patients
whos
Create a table and populate it with the Age, Gender, Height, Weight, and Smoker workspace
variables. Use the unique identifiers in LastName as row names. T is a 100-by-5 table. (When you
specify row names, they do not count as a table variable).
T = table(Age,Gender,Height,Weight,Smoker,...
'RowNames',LastName)
T=100×5 table
Age Gender Height Weight Smoker
___ __________ ______ ______ ______
9-35
9 Tables
Create a subtable containing the first five rows and all the variables from T. To specify the desired
rows and variables, use numeric indices within parentheses. This type of indexing is similar to
indexing into numeric arrays.
T1 = T(1:5,:)
T1=5×5 table
Age Gender Height Weight Smoker
___ __________ ______ ______ ______
T1 is a 5-by-5 table.
In addition to numeric indices, you can use row or variable names inside the parentheses. (In this
case, using row indices and a colon is more compact than using row or variable names.)
Select all the data for the patients with the last names 'Williams' and 'Brown'. Since T has row
names that are the last names of patients, index into T using row names.
T2 = T({'Williams','Brown'},:)
T2=2×5 table
Age Gender Height Weight Smoker
___ __________ ______ ______ ______
T2 is a 2-by-5 table.
You also can select variables by name. Create a table that has only the first five rows of T and the
Height and Weight variables. Display it.
9-36
Access Data in Tables
T3 = T(1:5,{'Height','Weight'})
T3=5×2 table
Height Weight
______ ______
Smith 71 176
Johnson 69 163
Williams 64 131
Jones 67 133
Brown 64 119
Table variable names do not have to be valid MATLAB identifiers. They can include spaces and non-
ASCII characters, and can start with any character.
Add a variable name with spaces and a dash to T. Then index into T using variable names.
T = addvars(T,SelfAssessedHealthStatus,'NewVariableNames','Self-Assessed Health Status');
T(1:5,{'Age','Smoker','Self-Assessed Health Status'})
ans=5×3 table
Age Smoker Self-Assessed Health Status
___ ______ ___________________________
Instead of specifying variables using names or numbers, you can create a data type subscript that
matches all variables having the same data type.
S =
table vartype subscript:
Create a table that has only the numeric variables, and only the first five rows, from T.
T4 = T(1:5,S)
T4=5×3 table
Age Height Weight
___ ______ ______
Smith 38 71 176
Johnson 43 69 163
9-37
9 Tables
Williams 38 64 131
Jones 40 67 133
Brown 49 64 119
load patients
T = table(Age,Gender,Height,Weight,Smoker,...
'RowNames',LastName);
To extract data from one variable, use dot notation. Extract numeric values from the variable Weight.
Then plot a histogram of those values.
histogram(T.Weight)
title('Patient Weight')
9-38
Access Data in Tables
You can index into an array or a table using an array of logical indices. Typically, you use a logical
expression that determines which values in a table variable meet a condition. The result of the
expression is an array of logical indices.
For example, create logical indices matching patients whose age is less than 40.
1
0
1
0
0
0
1
0
1
1
⋮
To extract heights for patients whose age is less than 40, index into the Height variable using rows.
There are 56 patients younger than 40.
T.Height(rows)
ans = 56×1
71
64
64
68
66
71
72
65
69
69
⋮
You can index into a table with logical indices. Display the rows of T for the patients who are younger
than 40.
T(rows,:)
ans=56×5 table
Age Gender Height Weight Smoker
___ __________ ______ ______ ______
9-39
9 Tables
You can match multiple conditions with one logical expression. Display the rows for smoking patients
younger than 40.
ans=18×5 table
Age Gender Height Weight Smoker
___ __________ ______ ______ ______
• By name, without quotation marks. For example, T.Date specifies a variable named 'Date'.
• By an expression, where the expression is enclosed by parentheses after the dot. For example, T.
('Start Date') specifies a variable named 'Start Date'.
Use the first syntax when a table variable name also happens to be a valid MATLAB® identifier. (A
valid identifier starts with a letter and includes only letters, digits, and underscores.)
9-40
Access Data in Tables
For example, create a table from the patients MAT-file. Then use dot notation to access the
contents of table variables.
load patients
T = table(Age,Gender,Height,Weight,Smoker,...
'RowNames',LastName);
To specify a variable by position in the table, use a number. Age is the first variable in T, so use the
number 1 to specify its position.
T.(1)
ans = 100×1
38
43
38
40
49
46
33
40
28
31
⋮
To specify a variable by name, you can enclose it in quotation marks. Since 'Age' is a valid identifier,
you can specify it using either T.Age or T.('Age').
T.('Age')
ans = 100×1
38
43
38
40
49
46
33
40
28
31
⋮
You can specify table variable names that are not valid MATLAB identifiers. Variable names can
include spaces and non-ASCII characters, and can start with any character. However, when you use
dot notation to access a table variable with such a name, you must specify it using parentheses.
9-41
9 Tables
ans=5×6 table
Age Gender Height Weight Smoker Self-Assessed Health Status
___ __________ ______ ______ ______ ___________________________
Access the new table variable using dot notation. Display the first five elements.
You also can use the output of a function as a variable name. Delete the T.('Self-Assessed
Health Status') variable. Then replace it with a variable whose name includes today's date.
ans=5×6 table
Age Gender Height Weight Smoker 01-Sep-2021 Self Report
___ __________ ______ ______ ______ _______________________
9-42
Access Data in Tables
Create a table from numeric and logical arrays from the patients file.
load patients
T = table(Age,Height,Weight,Smoker,...
'RowNames',LastName);
Extract data from multiple variables in T. Unlike dot notation, indexing with curly braces can extract
values from multiple table variables and concatenate them into one array.
Extract the height and weight for the first five patients. Use numeric indices to select the first five
rows, and variable names to select the variables Height and Weight.
A = T{1:5,{'Height','Weight'}}
A = 5×2
71 176
69 163
64 131
67 133
64 119
If you specify one variable name, then curly brace indexing results in the same array you can get with
dot notation. However, you must specify both rows and variables when you use curly brace indexing.
For example, this syntaxes T.Height and T{:,'Height'} return the same array.
If all the table variables have data types that allow them to be concatenated together, then you can
use the T.Variables syntax to put all the table data into an array. This syntax is equivalent to
T{:,:} where the colons indicate all rows and all variables.
A2 = T.Variables
A2 = 100×4
38 71 176 1
43 69 163 0
38 64 131 0
40 67 133 0
49 64 119 0
46 68 142 0
33 64 142 1
40 68 180 0
28 68 183 0
31 66 132 0
⋮
See Also
table | histogram | addvars | vartype
9-43
9 Tables
Related Examples
• “Advantages of Using Tables” on page 9-56
• “Create Tables and Assign Data to Them” on page 9-2
• “Modify Units, Descriptions, and Table Variable Names” on page 9-24
• “Calculations on Tables” on page 9-45
• “Data Cleaning and Calculations in Tables” on page 9-66
• “Grouped Calculations in Tables and Timetables” on page 9-86
• “Find Array Elements That Meet a Condition” on page 5-2
9-44
Calculations on Tables
Calculations on Tables
This example shows how to perform calculations on tables.
The functions rowfun and varfun each apply a specified function to a table, yet many other
functions require numeric or homogeneous arrays as input arguments. You can extract data from
individual variables using dot indexing or from one or more variables using curly braces. The
extracted data is then an array that you can use as input to other functions. Starting in R2018a, you
also can use the groupsummary function for calculations on groups of data in a table.
Read data from a comma-separated text file, testScores.csv, into a table using the readtable
function. testScores.csv contains test scores for several students. Use the student names in the
first column of the text file as row names in the table.
T = readtable('testScores.csv','ReadRowNames',true)
T=10×4 table
Gender Test1 Test2 Test3
__________ _____ _____ _____
HOWARD {'male' } 90 87 93
WARD {'male' } 87 85 83
TORRES {'male' } 86 85 88
PETERSON {'female'} 75 80 72
GRAY {'female'} 89 86 87
RAMIREZ {'female'} 96 92 98
JAMES {'male' } 78 75 77
WATSON {'female'} 91 94 92
BROOKS {'female'} 86 83 85
KELLY {'male' } 79 76 82
View the data type, description, units, and other descriptive statistics for each variable by using the
summary function to summarize the table.
summary(T)
Variables:
Values:
Min 75
Median 86.5
Max 96
9-45
9 Tables
Values:
Min 75
Median 85
Max 94
Values:
Min 72
Median 86
Max 98
The summary contains the minimum, median, and maximum score for each test.
Extract the data from the second, third, and fourth variables using curly braces, {}, find the average
of each row, and store it in a new variable, TestAvg.
T.TestAvg = mean(T{:,2:end},2)
T=10×5 table
Gender Test1 Test2 Test3 TestAvg
__________ _____ _____ _____ _______
HOWARD {'male' } 90 87 93 90
WARD {'male' } 87 85 83 85
TORRES {'male' } 86 85 88 86.333
PETERSON {'female'} 75 80 72 75.667
GRAY {'female'} 89 86 87 87.333
RAMIREZ {'female'} 96 92 98 95.333
JAMES {'male' } 78 75 77 76.667
WATSON {'female'} 91 94 92 92.333
BROOKS {'female'} 86 83 85 84.667
KELLY {'male' } 79 76 82 79
Alternatively, you can use the variable names, T{:,{'Test1','Test2','Test3'}} or the variable
indices, T{:,2:4} to select the subset of data.
Compute the mean and maximum of TestAvg by gender of the students. First, compute the means by
using the varfun function.
varfun(@mean,T,'InputVariables','TestAvg',...
'GroupingVariables','Gender')
ans=2×3 table
Gender GroupCount mean_TestAvg
__________ __________ ____________
{'female'} 5 87.067
{'male' } 5 83.4
9-46
Calculations on Tables
Starting in R2018a, you also can use the groupsummary function to perform computations on groups
of data in a table. Compute the maximum values of TestAvg for each group of students using
groupsummary.
groupsummary(T,'Gender','max','TestAvg')
ans=2×3 table
Gender GroupCount max_TestAvg
__________ __________ ___________
{'female'} 5 95.333
{'male' } 5 90
The maximum score for each test is 100. Use curly braces to extract the data from the table and
convert the test scores to a 25 point scale.
T{:,2:end} = T{:,2:end}*25/100
T=10×5 table
Gender Test1 Test2 Test3 TestAvg
__________ _____ _____ _____ _______
T.Properties.VariableNames{end} = 'Final'
T=10×5 table
Gender Test1 Test2 Test3 Final
__________ _____ _____ _____ ______
9-47
9 Tables
See Also
table | summary | rowfun | varfun | findgroups | splitapply | groupsummary
Related Examples
• “Access Data in Tables” on page 9-32
• “Split Table Data Variables and Apply Functions” on page 9-52
• “Data Cleaning and Calculations in Tables” on page 9-66
• “Grouped Calculations in Tables and Timetables” on page 9-86
9-48
Split Data into Groups and Calculate Statistics
Split the patients into nonsmokers and smokers using the Smoker variable. Calculate the mean
weight for each group.
[G,smoker] = findgroups(Smoker);
meanWeight = splitapply(@mean,Weight,G)
meanWeight = 2×1
149.9091
161.9412
The findgroups function returns G, a vector of group numbers created from Smoker. The
splitapply function uses G to split Weight into two groups. splitapply applies the mean function
to each group and concatenates the mean weights into a vector.
findgroups returns a vector of group identifiers as the second output argument. The group
identifiers are logical values because Smoker contains logical values. The patients in the first group
are nonsmokers, and the patients in the second group are smokers.
smoker
9-49
9 Tables
Split the patient weights by both gender and status as a smoker and calculate the mean weights.
G = findgroups(Gender,Smoker);
meanWeight = splitapply(@mean,Weight,G)
meanWeight = 4×1
130.3250
130.9231
180.0385
181.1429
The unique combinations across Gender and Smoker identify four groups of patients: female
nonsmokers, female smokers, male nonsmokers, and male smokers. Summarize the four groups and
their mean weights in a table.
[G,gender,smoker] = findgroups(Gender,Smoker);
T = table(gender,smoker,meanWeight)
T=4×3 table
gender smoker meanWeight
______ ______ __________
T.gender contains categorical values, and T.smoker contains logical values. The data types of these
table variables match the data types of Gender and Smoker respectively.
Calculate body mass index (BMI) for the four groups of patients. Define a function that takes Height
and Weight as its two input arguments, and that calculates BMI.
BMI = 4×1
21.6721
21.6686
26.5775
26.4584
Calculate the fraction of patients who report their health as either Poor or Fair. First, use
splitapply to count the number of patients in each group: female nonsmokers, female smokers,
male nonsmokers, and male smokers. Then, count only those patients who report their health as
either Poor or Fair, using logical indexing on S and G. From these two sets of counts, calculate the
fraction for each group.
9-50
Split Data into Groups and Calculate Statistics
[G,gender,smoker] = findgroups(Gender,Smoker);
S = SelfAssessedHealthStatus;
I = ismember(S,{'Poor','Fair'});
numPatients = splitapply(@numel,S,G);
numPF = splitapply(@numel,S(I),G(I));
numPF./numPatients
ans = 4×1
0.2500
0.3846
0.3077
0.1429
Compare the standard deviation in Diastolic readings of those patients who report Poor or Fair
health, and those patients who report Good or Excellent health.
stdDiastolicPF = splitapply(@std,Diastolic(I),G(I));
stdDiastolicGE = splitapply(@std,Diastolic(~I),G(~I));
Collect results in a table. For these patients, the female nonsmokers who report Poor or Fair health
show the widest variation in blood pressure readings.
T = table(gender,smoker,numPatients,numPF,stdDiastolicPF,stdDiastolicGE,BMI)
T=4×7 table
gender smoker numPatients numPF stdDiastolicPF stdDiastolicGE BMI
______ ______ ___________ _____ ______________ ______________ ______
See Also
findgroups | splitapply
Related Examples
• “Grouping Variables To Split Data” on page 9-61
• “Split Table Data Variables and Apply Functions” on page 9-52
• “Data Cleaning and Calculations in Tables” on page 9-66
9-51
9 Tables
The sample file, outages.csv, contains data representing electric utility outages in the United
States. The file contains six columns: Region, OutageTime, Loss, Customers, RestorationTime,
and Cause. Read outages.csv into a table.
T = readtable('outages.csv');
Convert Region and Cause to categorical arrays, and OutageTime and RestorationTime to
datetime arrays. Display the first five rows.
T.Region = categorical(T.Region);
T.Cause = categorical(T.Cause);
T.OutageTime = datetime(T.OutageTime);
T.RestorationTime = datetime(T.RestorationTime);
T(1:5,:)
ans=5×6 table
Region OutageTime Loss Customers RestorationTime Cause
_________ ________________ ______ __________ ________________ _______________
Determine the greatest power loss due to a power outage in each region. The findgroups function
returns G, a vector of group numbers created from T.Region. The splitapply function uses G to
split T.Loss into five groups, corresponding to the five regions. splitapply applies the max
function to each group and concatenates the maximum power losses into a vector.
G = findgroups(T.Region);
maxLoss = splitapply(@max,T.Loss,G)
maxLoss = 5×1
104 ×
2.3141
2.3418
0.8767
0.2796
1.6659
Calculate the maximum power loss due to a power outage by cause. To specify that Cause is the
grouping variable, use table indexing. Create a table that contains the maximum power losses and
their causes.
9-52
Split Table Data Variables and Apply Functions
T1 = T(:,'Cause');
[G,powerLosses] = findgroups(T1);
powerLosses.maxLoss = splitapply(@max,T.Loss,G)
powerLosses=10×2 table
Cause maxLoss
________________ _______
attack 582.63
earthquake 258.18
energy emergency 11638
equipment fault 16659
fire 872.96
severe storm 8767.3
thunder storm 23418
unknown 23141
wind 2796
winter storm 2883.7
powerLosses is a table because T1 is a table. You can append the maximum losses as another table
variable.
Calculate the maximum power loss by cause in each region. To specify that Region and Cause are
the grouping variables, use table indexing. Create a table that contains the maximum power losses
and display the first 15 rows.
T1 = T(:,{'Region','Cause'});
[G,powerLosses] = findgroups(T1);
powerLosses.maxLoss = splitapply(@max,T.Loss,G);
powerLosses(1:15,:)
ans=15×3 table
Region Cause maxLoss
_________ ________________ _______
MidWest attack 0
MidWest energy emergency 2378.7
MidWest equipment fault 903.28
MidWest severe storm 6808.7
MidWest thunder storm 15128
MidWest unknown 23141
MidWest wind 2053.8
MidWest winter storm 669.25
NorthEast attack 405.62
NorthEast earthquake 0
NorthEast energy emergency 11638
NorthEast equipment fault 794.36
NorthEast fire 872.96
NorthEast severe storm 6002.4
NorthEast thunder storm 23418
Determine power-outage impact on customers by cause and region. Because T.Loss contains NaN
values, wrap sum in an anonymous function to use the 'omitnan' input argument.
9-53
9 Tables
osumFcn = @(x)(sum(x,'omitnan'));
powerLosses.totalCustomers = splitapply(osumFcn,T.Customers,G);
powerLosses(1:15,:)
ans=15×4 table
Region Cause maxLoss totalCustomers
_________ ________________ _______ ______________
MidWest attack 0 0
MidWest energy emergency 2378.7 6.3363e+05
MidWest equipment fault 903.28 1.7822e+05
MidWest severe storm 6808.7 1.3511e+07
MidWest thunder storm 15128 4.2563e+06
MidWest unknown 23141 3.9505e+06
MidWest wind 2053.8 1.8796e+06
MidWest winter storm 669.25 4.8887e+06
NorthEast attack 405.62 2181.8
NorthEast earthquake 0 0
NorthEast energy emergency 11638 1.4391e+05
NorthEast equipment fault 794.36 3.9961e+05
NorthEast fire 872.96 6.1292e+05
NorthEast severe storm 6002.4 2.7905e+07
NorthEast thunder storm 23418 2.1885e+07
Determine the mean durations of all U.S. power outages in hours. Add the mean durations of power
outages to powerLosses. Because T.RestorationTime has NaT values, omit the resulting NaN
values when calculating the mean durations.
D = T.RestorationTime - T.OutageTime;
H = hours(D);
omeanFcn = @(x)(mean(x,'omitnan'));
powerLosses.meanOutage = splitapply(omeanFcn,H,G);
powerLosses(1:15,:)
ans=15×5 table
Region Cause maxLoss totalCustomers meanOutage
_________ ________________ _______ ______________ __________
9-54
Split Table Data Variables and Apply Functions
See Also
findgroups | splitapply | rowfun | varfun
Related Examples
• “Access Data in Tables” on page 9-32
• “Calculations on Tables” on page 9-45
• “Grouping Variables To Split Data” on page 9-61
• “Split Data into Groups and Calculate Statistics” on page 9-49
• “Data Cleaning and Calculations in Tables” on page 9-66
• “Grouped Calculations in Tables and Timetables” on page 9-86
9-55
9 Tables
You can use the table data type to collect mixed-type data and metadata properties, such as variable
name, row names, descriptions, and variable units, in a single container. Tables are suitable for
column-oriented or tabular data that is often stored as columns in a text file or in a spreadsheet. For
example, you can use a table to store experimental data, with rows representing different
observations and columns representing different measured variables.
Tables consist of rows and column-oriented variables. Each variable in a table can have a different
data type and a different size, but each variable must have the same number of rows.
Then, combine the workspace variables, Systolic and Diastolic into a single BloodPressure
variable and convert the workspace variable, Gender, from a cell array of character vectors to a
categorical array.
BloodPressure = [Systolic Diastolic];
Gender = categorical(Gender);
whos('Gender','Age','Smoker','BloodPressure')
The variables Age, BloodPressure, Gender, and Smoker have varying data types and are
candidates to store in a table since they all have the same number of rows, 100.
Now, create a table from the variables and display the first five rows.
T = table(Gender,Age,Smoker,BloodPressure);
T(1:5,:)
ans=5×4 table
Gender Age Smoker BloodPressure
______ ___ ______ _____________
The table displays in a tabular format with the variable names at the top.
Each variable in a table is a single data type. If you add a new row to the table, MATLAB® forces
consistency of the data type between the new data and the corresponding table variables. For
example, if you try to add information for a new patient where the first column contains the patient's
9-56
Advantages of Using Tables
The error occurs because MATLAB® cannot assign numeric data, 37, to the categorical array,
Gender.
For comparison of tables with structures, consider the structure array, StructArray, that is
equivalent to the table, T.
StructArray = table2struct(T)
Structure arrays organize records using named fields. Each field's value can have a different data
type or size. Now, display the named fields for the first element of StructArray.
StructArray(1)
Fields in a structure array are analogous to variables in a table. However, unlike with tables, you
cannot enforce homogeneity within a field. For example, you can have some values of S.Gender that
are categorical array elements, Male or Female, others that are character vectors, 'Male' or
'Female', and others that are integers, 0 or 1.
Now consider the same data stored in a scalar structure, with four fields each containing one variable
from the table.
ScalarStruct = struct(...
'Gender',{Gender},...
'Age',Age,...
'Smoker',Smoker,...
'BloodPressure',BloodPressure)
Unlike with tables, you cannot enforce that the data is rectangular. For example, the field
ScalarStruct.Age can be a different length than the other fields.
A table allows you to maintain the rectangular structure (like a structure array) and enforce
homogeneity of variables (like fields in a scalar structure). Although cell arrays do not have named
9-57
9 Tables
fields, they have many of the same disadvantages as structure arrays and scalar structures. If you
have rectangular data that is homogeneous in each variable, consider using a table. Then you can use
numeric or named indexing, and you can use table properties to store metadata.
You can index into a table using parentheses, curly braces, or dot indexing. Parentheses allow you to
select a subset of the data in a table and preserve the table container. Curly braces and dot indexing
allow you to extract data from a table. Within each table indexing method, you can specify the rows
or variables to access by name or by numeric index.
Consider the sample table from above. Each row in the table, T, represents a different patient. The
workspace variable, LastName, contains unique identifiers for the 100 rows. Add row names to the
table by setting the RowNames property to LastName and display the first five rows of the updated
table.
T.Properties.RowNames = LastName;
T(1:5,:)
ans=5×4 table
Gender Age Smoker BloodPressure
______ ___ ______ _____________
In addition to labeling the data, you can use row and variable names to access data in the table. For
example, use named indexing to display the age and blood pressure of the patients Williams and
Brown.
T({'Williams','Brown'},{'Age','BloodPressure'})
ans=2×2 table
Age BloodPressure
___ _____________
Williams 38 125 83
Brown 49 122 80
Now, use numeric indexing to return an equivalent subtable. Return the third and fifth row from the
second and fourth variables.
T(3:2:5,2:2:4)
ans=2×2 table
Age BloodPressure
___ _____________
Williams 38 125 83
Brown 49 122 80
With cell arrays or structures, you do not have the same flexibility to use named or numeric indexing.
9-58
Advantages of Using Tables
• With a cell array, you must use strcmp to find desired named data, and then you can index into
the array.
• With a scalar structure or structure array, it is not possible to refer to a field by number.
Furthermore, with a scalar structure, you cannot easily select a subset of variables or a subset of
observations. With a structure array, you can select a subset of observations, but you cannot select
a subset of variables.
• With a table, you can access data by named index or by numeric index. Furthermore, you can
easily select a subset of variables and a subset of rows.
For more information on table indexing, see “Access Data in Tables” on page 9-32.
In addition to storing data, tables have properties to store metadata, such as variable names, row
names, descriptions, and variable units. You can access a property using T.Properties.PropName,
where T is the name of the table and PropName is one of the table properties.
For example, add a table description, variable descriptions, and variable units for Age.
T.Properties.VariableDescriptions = ...
{'Male or Female' ...
'' ...
'true or false' ...
'Systolic/Diastolic'};
T.Properties.VariableUnits{'Age'} = 'Yrs';
Individual empty character vectors within the cell array for VariableDescriptions indicate that
the corresponding variable does not have a description. For more information, see the Properties
section of table.
summary(T)
Variables:
Properties:
Description: Male or Female
Values:
Female 53
Male 47
Properties:
Units: Yrs
Values:
9-59
9 Tables
Min 25
Median 39
Max 50
Properties:
Description: true or false
Values:
True 34
False 66
Properties:
Description: Systolic/Diastolic
Values:
Column 1 Column 2
________ ________
Min 109 68
Median 122 81.5
Max 138 99
Structures and cell arrays do not have properties for storing metadata.
See Also
table | summary
Related Examples
• “Create Tables and Assign Data to Them” on page 9-2
• “Modify Units, Descriptions, and Table Variable Names” on page 9-24
• “Access Data in Tables” on page 9-32
• “Data Cleaning and Calculations in Tables” on page 9-66
• “Grouped Calculations in Tables and Timetables” on page 9-86
9-60
Grouping Variables To Split Data
Grouping Variables
Grouping variables are variables used to group, or categorize, observations—that is, data values in
other variables. A grouping variable can be any of these data types:
Data variables are the variables that contain observations. A grouping variable must have a value
corresponding to each value in the data variables. Data values belong to the same group when the
corresponding values in the grouping variable are the same.
This table shows examples of data variables, grouping variables, and the groups that you can create
when you split the data variables using the grouping variables.
You can give groups of data meaningful names when you use cell arrays of character vectors or
categorical arrays as grouping variables. A categorical array is an efficient and flexible choice of
grouping variable.
Group Definition
Typically, there are as many groups as there are unique values in the grouping variable. (A
categorical array also can include categories that are not represented in the data.) The groups and
the order of the groups depend on the data type of the grouping variable.
• For numeric, logical, datetime, or duration vectors, or cell arrays of character vectors, the
groups correspond to the unique values sorted in ascending order.
• For categorical arrays, the groups correspond to the unique values observed in the array, sorted in
the order returned by the categories function.
The findgroups function can accept multiple grouping variables, for example G =
findgroups(A1,A2). You also can include multiple grouping variables in a table, for example T =
table(A1,A2); G = findgroups(T). The findgroups function defines groups by the unique
combinations of values across corresponding elements of the grouping variables. findgroups
decides the order by the order of the first grouping variable, and then by the order of the second
grouping variable, and so on. For example, if A1 = {'a','a','b','b'} and A2 = [0 1 0 0],
9-61
9 Tables
then the unique values across the grouping variables are 'a' 0, 'a' 1, and 'b' 0, defining three
groups.
The findgroups function returns a vector of group numbers that define groups based on the unique
values in the grouping variables. splitapply uses the group numbers to split the data into groups
efficiently before applying a function.
See Also
findgroups | splitapply | rowfun | varfun
9-62
Grouping Variables To Split Data
Related Examples
• “Access Data in Tables” on page 9-32
• “Split Table Data Variables and Apply Functions” on page 9-52
• “Split Data into Groups and Calculate Statistics” on page 9-49
• “Data Cleaning and Calculations in Tables” on page 9-66
• “Grouped Calculations in Tables and Timetables” on page 9-86
9-63
9 Tables
T =
Number Party
______ __________
Display its properties, including the dimension names. The default values of the dimension names are
'Row' and 'Variables'.
T.Properties
ans =
Description: ''
UserData: []
DimensionNames: {'Row' 'Variables'}
VariableNames: {'Number' 'Party'}
VariableDescriptions: {}
VariableUnits: {}
RowNames: {5×1 cell}
Starting in R2016b, you can assign new names to the dimension names, and use them to access table
data. Dimension names must be valid MATLAB identifiers, and must not be one of the reserved
names, 'Properties', 'RowNames', or 'VariableNames'.
Assign a new name to the first dimension name, and use it to access the row names of the table.
T.Properties.DimensionNames{1} = 'Name';
T.Name
ans =
'Van Buren'
'Arthur'
9-64
Changes to DimensionNames Property in R2016b
'Fillmore'
'Garfield'
'Polk'
Create a new table variable called Name. When you create the variable, the table modifies its first
dimension name to prevent a conflict. The updated dimension name becomes Name_1.
T =
T.Properties.DimensionNames
ans =
'Name_1' 'Data'
Similarly, if you assign a dimension name that is not a valid MATLAB identifier, the name is modified.
ans =
'LastName' 'Data'
In R2016b, tables raise warnings when dimension names are not valid identifiers, or conflict with
variable names or reserved names, so that you can continue to work with code and tables created
with previous releases. If you encounter these warnings, it is recommended that you update your
code to avoid them.
9-65
9 Tables
Because tables and timetables are containers, working with them is somewhat different than working
with ordinary numeric arrays. The example shows how to use different tabular subscripting modes,
how these modes differ, and the advantages and disadvantages of each mode for different situations.
It also shows how to access and assign data, apply transformation and summary functions, convert
table variables to different data types, and plot results.
The Ames Housing Data used in this example comes from residential real estate data for the town of
Ames, Iowa, in the United States. You can download the original data from an XLS (Excel®
Workbook) spreadsheet. The data description is available as a text file. (Used with permission of the
copyright holder. Please contact the copyright holder if you wish to publish or redistribute this data.)
The best way to import a spreadsheet into MATLAB is to use the readtable function, or for data that
include timestamps, the readtimetable function. While the Ames Housing Data includes the sale
month and year for each house, the month and year are stored in separate columns. In this case, it is
simpler to use readtable.
Read the housing data. With readtable you can read data directly from a URL. Store all text data
from the spreadsheet as string arrays in the output table. Also, when readtable reads column
headers from a file, it uses them as table variable names and transforms them into valid MATLAB
identifiers. To preserve the original names, use the 'VariableNamingRule' name-value argument.
housing = readtable("http://jse.amstat.org/v19n3/decock/AmesHousing.xls","TextType","string");
Warning: Column headers from the file were modified to make them valid MATLAB identifiers before
Set 'VariableNamingRule' to 'preserve' to use the original column headers as table variable names
Display housing. The table has one variable for each of the 82 columns in the spreadsheet.
housing
housing=2930×82 table
Order PID MSSubClass MSZoning LotFrontage LotArea Street Alley
_____ ____________ __________ ________ ___________ _______ ______ _____
9-66
Data Cleaning and Calculations in Tables
The spreadsheet has some column headers with spaces and other column headers that start with
numbers. Column headers become variable names in the output table. By default, readtable
standardizes names with spaces by using camel case, and standardizes names beginning with
numbers by prepending them with 'x'. Although a table can have variable names with spaces and
other non-alphanumeric characters in them, the standardization makes working with table variable
names more natural. Before standardizing names, readtable saves the original column headers in
housing.Properties.VariableDescriptions.
housing.Properties.VariableDescriptions
In this example, the original variable names are not needed. To delete them, assign an empty cell
array to the VariableDescriptions property.
housing.Properties.VariableDescriptions = {};
You can remove the Order variable because it is a row index and not needed. To remove one variable
from the table, assign an empty array, [], to the variable, just as you delete rows or columns from a
matrix.
housing.Order = [];
There are 81 variables left in the table. For a complete analysis of the housing prices, most of the
variables are probably important. But for this example, only a much smaller subset is needed. To
delete the unwanted variables one-by-one is tedious. The removevars function can delete them all at
once, but in this case there is an easier way. First list the variables that you want to keep. Then use
subscripting to select them and delete the others. Selecting variables by name is often much easier
than figuring out their numeric indices.
housing=2930×25 table
PID MSSubClass LotFrontage LotArea Neighborhood BldgType OverallCo
____________ __________ ___________ _______ ____________ ________ _________
9-67
9 Tables
Two of the variable names are not very clear. Rename those variables with better names by using the
VariableNames property.
housing.Properties.VariableNames(["GrLivArea" "LowQualFinSF"]) = ["TotalAboveGroundLivingArea" "L
There are two other variable names, starting with 'x', that look odd. Another way to rename them is
to use the renamevars function. If you use renamevars, assign the output to the original table.
Otherwise the update is lost.
housing = renamevars(housing,["x1stFlrSF" "x2ndFlrSF"],["FirstFlrArea" "SecondFlrArea"]);
Six of the variables are string arrays. Conceptually they all contain categorical data: discrete,
nonnumeric values drawn from a small fixed set of possible values or categories. It is almost always a
good idea to convert that kind of data to categorical arrays. You can use the
detectImportOptions function to control the data types of the data you read with readtable. But
instead of starting over, you can convert these table variables to have the categorical data type.
For example, convert the Neighborhood variable to a categorical array.
housing.Neighborhood = categorical(housing.Neighborhood);
This assignment overwrites, or replaces, the existing text variable Neighborhood in the table with a
new categorical variable. Replacement is what enables the assignment to change the data type. In
contrast, this assignment, using indexing:
housing.Neighborhood(:) = categorical(housing.Neighborhood)
assigns values into the existing text variable, element by element, rather than replacing the variable.
In that case housing.Neighborhood remains a string array. This behavior is consistent with the
behavior of ordinary workspace variables. Assignment by indexing into an array does not change the
type of the array. For example, if you index into an array of integers and assign a floating-point value
to an element, the value is truncated and stored as an integer.
x = uint32([1 2 3]);
x(2) = 2.2 % converted to 2, as a uint32
1 2 3
Assignment with dot notation is one way to convert the type of a variable in a table. The
convertvars function is another way and has two benefits. First, it avoids any confusion about
overwriting as opposed to assignment into a variable. The convertvars function always overwrites
existing variables and converts their type. Second, convertvars can operate on more than one
9-68
Data Cleaning and Calculations in Tables
variable at a time. There are several more text variables in housing to be converted to the
categorical data type. Changing them one at a time would get tedious, but convertvars can
convert more than one variable in one command.
housing = convertvars(housing,["BldgType" "Foundation"],"categorical");
It is not necessary to explicitly list the variables by name or position in the table. You can find all the
table variables that are string arrays and convert them to categorical variables. To specify table
variables that are string arrays, use the function handle @isstring when calling convertvars.
housing = convertvars(housing,@isstring,"categorical");
In both cases, assign the output of convertvars back to the original table. Otherwise, the update is
lost.
Sometimes, converting all text variables to categorical is too much. For example, if the current
homeowners' names were present in the data, then it would not make sense to store them in a
categorical variable. Homeowners' names do not define housing categories. You might keep their
names in a string array instead.
As another example, the CentralAir variable is one of the variables that was converted to
categorical. But because its categories are just Y and N, it might make more sense to consider it a
logical variable.
summary(housing.CentralAir)
N 196
Y 2734
The logical data type (like all the integer types) does not allow missing values (analogous to NaN),
while categorical does. The CentralAir variable happens to have no missing data values. You
can use either logical or categorical as the data type for CentralAir.
any(ismissing(housing.CentralAir))
ans = logical
0
Convert the data type to logical, with true corresponding to Y, using dot notation to overwrite the
existing categorical variable with the new logical one.
housing.CentralAir = (housing.CentralAir == "Y");
housing=2930×25 table
PID MSSubClass LotFrontage LotArea Neighborhood BldgType OverallCond
__________ __________ ___________ _______ ____________ ________ ___________
9-69
9 Tables
All the text data has been converted to categorical variables. But there are still a few things to
clean up.
The OverallCond variable was read in as a numeric array, but its values are all drawn from the
integers 1-10. You can leave these values as numeric data, but you can think of it as ordinal
categorical data. When a categorical array is ordinal, its categories have a specified order. For
example, the categories 10 and 5 can be compared (10 > 5, because a house whose condition is
rated as a 10 is theoretically nicer than one rated 5), but for these comparisons, there is no numeric
meaning to 10 - 5. To avoid unintentionally treating OverallCond as numeric data, convert it to an
ordinal categorical array, which still enables relational comparisons but prevents arithmetic
operations. The category names 1, 2, and so on are easy to interpret and are acceptable.
housing.OverallCond = categorical(housing.OverallCond,1:10,"Ordinal",true);
Similarly, the MSSubClass variable consisted of numeric codes in the original spreadsheet. You can
think of those values as being categorical data. Because there is no mathematical order to these
particular codes, the categories are nonordinal (or nominal). In this case, readtable read those
values in as text to preserve leading zeroes in the codes. MSSubClass was then converted to
categorical data.
While MSSubClass has the data type that you want, you might find it difficult to interpret the codes
as categories of houses. The file that describes the Ames Housing Data contains the definitions of the
numeric codes. Giving these categories readable names can help you understand the data. To make it
clear which names go with which numbers, specify both the categories (code) and their names
(subclass) in another call to the categorical function.
code = ["020" "030" "040" "045" "050" "060" "070" "075" "080" "085" "090" "120" "150" "160" "180"
subclass = ["1-STORY 1946 & NEWER ALL STYLES" ...
"1-STORY 1945 & OLDER" ...
"1-STORY W/FINISHED ATTIC ALL AGES" ...
"1-1/2 STORY - UNFINISHED ALL AGES" ...
"1-1/2 STORY FINISHED ALL AGES" ...
"2-STORY 1946 & NEWER" ...
"2-STORY 1945 & OLDER" ...
"2-1/2 STORY ALL AGES" ...
"SPLIT OR MULTI-LEVEL" ...
"SPLIT FOYER" ...
"DUPLEX - ALL STYLES AND AGES" ...
"1-STORY PUD (Planned Unit Development) - 1946 & NEWER" ...
"1-1/2 STORY PUD - ALL AGES" ...
"2-STORY PUD - 1946 & NEWER" ...
"PUD - MULTILEVEL - INCL SPLIT LEV/FOYER" ...
"2 FAMILY CONVERSION - ALL STYLES AND AGES"];
housing.MSSubClass = categorical(housing.MSSubClass,code,subclass);
9-70
Data Cleaning and Calculations in Tables
The category names for the BldgType variable are not obvious. As with MSSubClass, more
descriptive names can help you understand the building categories. To display the number of houses
in each building category, use the summary function.
summary(housing.BldgType)
1Fam 2425
2fmCon 62
Duplex 109
Twnhs 101
TwnhsE 233
With only five categories, you can safely list the new category names in the right order without
specifying the old names. To rename categories, use the renamecats function.
types = ["Single-family Detached" "Two-family Conversion" "Duplex" "Townhouse End Unit" "Townhous
housing.BldgType = renamecats(housing.BldgType,types);
The GarageType variable includes the category NA, standing for Not Applicable. In GarageType, NA
means that the house does not have a garage. But it is too easy to confuse NA with a missing value. A
true missing value means it cannot be determined if a house has a garage. But in this housing data, it
is always known if a house has a garage. Change that one category name to make its meaning clearer.
housing.GarageType = renamecats(housing.GarageType,"NA","None");
Finally, the PID variable was read in as a string array. While its values were numeric, some of them
had leading zeroes. The readtable function preserved this information by storing the values as
strings. Then the call to convertvars converted the PID variable to a categorical array. PID
stores identification numbers that are unique. Identification numbers are assigned as needed and do
not come from a fixed set of values. There is no particular advantage in storing them in a
categorical variable. If every identification number is a category, then adding a new identification
number means adding a new category to PID. It might be more convenient to convert PID back to a
string array. To convert values to strings, use the string function.
housing.PID = string(housing.PID);
housing
housing=2930×25 table
PID MSSubClass LotFrontage LotAr
____________ _____________________________________________________ ___________ _____
9-71
9 Tables
The table has separate variables for the month and year of sale. It is more convenient if those
variables are combined in one datetime variable. Assignment by using dot notation is a good way to
add a new variable at the right edge of a table. Add the date of sale as a new variable.
Now delete the two original variables. It is easier to list the variables by name and use removevars.
housing=2930×24 table
PID MSSubClass LotFrontage LotAr
____________ _____________________________________________________ ___________ _____
Explore the data by making some simple plots. Many basic plotting commands do not accept tables as
input arguments. But you can use dot notation to pass one or more table variables into a plotting
function. You are taking arrays out of the table and passing them as input arguments to a plotting
function.
For example, make a scatter plot of the sale prices of houses in the table as a function of the years in
which they were built.
scatter(housing.YearBuilt,housing.SalePrice,20,"filled");
9-72
Data Cleaning and Calculations in Tables
A log transformation of the prices might show a simpler relationship between year and price. Also,
you can show more information in the scatter plot by using the living area of the houses to color the
markers. The living areas have a long right tail, so it is also useful to show a log transformation of the
areas. To transform the two table variables, wrap them in calls to the log function. Then make
another scatter plot.
logSalePrice = log(housing.SalePrice);
logLivingArea = log(housing.TotalAboveGroundLivingArea);
scatter(housing.YearBuilt,logSalePrice,20,logLivingArea,"filled");
9-73
9 Tables
Any large, complex data set collected over a long period of time might contain some errors. Check for
errors in the housing data. Dates in the data are a good place to start. First compare YearBuilt to
YearRemod_Add.
checkRows = housing.YearBuilt > housing.YearRemod_Add;
housing(checkRows,:)
ans=1×24 table
PID MSSubClass LotFrontage LotArea Neighborhood
____________ _______________________________ ___________ _______ ____________
It is not possible for remodeling to have been done in 2001 if the house itself was built in 2002. If you
assume that the YearBuilt value is known to be the error (an assumption that needs to be
confirmed), you can use dot notation to assign 2001 as the year in which this house was built.
housing.YearBuilt(checkRows) = 2001;
ans=2×24 table
PID MSSubClass LotFrontage LotArea Neighborhood
9-74
Data Cleaning and Calculations in Tables
There is another issue. These two houses were sold in late 2007, as shown in the LastSoldDate
variable. But the corresponding value in YearBuilt is 2008. It might be that for these houses, the
years in YearBuilt were recorded in early 2008 (another assumption needing confirmation). Update
the YearBuilt variable, this time by using dot notation to assign to two rows.
housing.YearBuilt(checkRows) = 2007;
The next step in cleaning the data is to check for missing data in the numeric and categorical
variables. The one logical variable in housing does not support missing values. The ismissing
function indicates which elements of the table have missing values.
missingElements = ismissing(housing)
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
⋮
The ismissing function returns a logical matrix that is the same size as the table. Summing the
columns of that matrix gives the number of missing values in each of the variables of the table.
numMissing = sum(missingElements,1)
numMissing = 1×24
0 0 490 0 0 0 0 0 0 0 0 0 0 0 0 0
Only three of the variables have missing data, but without the variable names it is not easy to tell
which variables they are. One way to tell is to index into the VariableNames property of the table to
find the names that correspond to the variables with missing values.
housing.Properties.VariableNames(numMissing > 0)
Deciding what to do about missing data is a challenge. If the data is missing at random, and there are
only a few missing values, one strategy is to remove those rows from the table. The four missing
9-75
9 Tables
basement bath values (NaNs, in this case) occur in only two rows. You can remove those two rows by
using the rmmissing function.
ans=2×24 table
PID MSSubClass LotFrontage LotArea Neighborhood
____________ _______________________________ ___________ _______ ____________
This call to rmmissing removes only the rows that have missing values in BsmtFullBath and
BsmtHalfBath. The 490 rows with missing LotFrontage values are still in the table. You can
remove these 490 rows but doing so deletes more than 16% of the data. You also can fill these
missing values with the mean frontage value by using the fillmissing function, but that is not
practical for this data. For variables that form a time series, fillmissing also supports filling
variables with interpolated values or moving-window smoothed values. LotFrontage is not a time
series. The data in this variable is a cross-sectional data set.
One commonly used strategy for filling in missing values in cross-sectional data is to create a
regression model to predict the missing values in a row from the non-missing data in that row. A
simple scatter plot indicates that there is a log-log relationship between the area of a lot and its
frontage. That relationship suggests a model.
loglog(housing.LotArea,housing.LotFrontage,'o')
9-76
Data Cleaning and Calculations in Tables
You can use that log-log relationship to fill in the missing LotFrontage values by regressing the
values on LotArea.
missingValues = ismissing(housing.LotFrontage);
beta = polyfit(log(housing.LotArea(~missingValues)),log(housing.LotFrontage(~missingValues)),1);
housing.LotFrontage(missingValues) = exp(polyval(beta,log(housing.LotArea(missingValues))));
You can use dot notation to work on data in a table when you use functions such as polyfit and
polyval that accept numeric vectors but not tables. You can think of a table as a container that is
designed to hold data having different types. Functions such as polyfit that are specifically for
numeric inputs do not work on a table because a table often contains nonnumeric data. Even when a
table contains only numeric data, it is still a container. The functions must be applied to the contents
of the table. Use dot notation to access table variables.
Add the imputed missing values that you calculated with polyfit and polyval to the scatter plot. A
simple imputation scheme might not be sufficient in a real analysis of this data, but it illustrates how
to visualize and make computations on numeric data in a table.
hold on
loglog(housing.LotArea(missingValues),housing.LotFrontage(missingValues),'rx')
hold off
9-77
9 Tables
Dot notation has been convenient for operations such as converting an existing table variable, adding
a new variable, assigning values, plotting, and applying functions like polyval to a table variable.
Dot notation is also convenient for arithmetic operations on table variables. For example, convert the
LotFrontage variable from feet to meters.
housing=2928×24 table
PID MSSubClass LotFrontage LotAr
____________ _____________________________________________________ ___________ _____
9-78
Data Cleaning and Calculations in Tables
Using dot notation means that the multiplication is applied not to the housing table, which cannot
be done because tables are containers, but rather to its LotFrontage variable, which is a numeric
vector. With dot notation, you extracted LotFrontage from the table and put the modified version
back in.
Another way to access the contents of a table is to subscript into it by using curly braces, just as you
use curly braces to extract the contents of a cell array. You can use curly brace subscripting to refer
to and operate on data in a table by extracting and reinserting contents. For example, convert
LotFrontage back to feet by using curly brace subscripting.
Dot notation and brace subscripting are different syntaxes for the same kinds of operations. They
both work on the contents of a table. Also, they both enable you to specify a table variable and a
subset of its rows.
housing.LotArea(1:2)
ans = 2×1
31770
11622
housing{1:2,"LotArea"}
ans = 2×1
31770
11622
While both syntaxes work on the contents of table, there are two subtle differences to consider.
First, a limitation of curly brace subscripting is that it assigns into the contents of a table rather than
replacing a variable. For example, this assignment does not change the data type of the
LotFrontage variable in the way that an assignment using dot notation does. The call to the single
function on the right side of the assignment creates an array having the single data type. But by
subscripting into housing with curly braces, you assign values from that array into the existing table
variable. And the data type of LotFrontage is double. The values from the right side are converted
back to double by this assignment.
housing{:,"LotFrontage"} = single(housing{:,"LotFrontage"});
Second, a benefit of curly brace subscripting is that, unlike dot notation, it uses the familiar two-
dimensional subscripting syntax. This syntax enables you to refer to more than one variable at a time
and also to a subset of rows. For example, there are five variables whose units are square feet.
Converting these variables to square meters one at a time is tedious. To apply the multiplication to all
five variables at once, use curly brace subscripting.
9-79
9 Tables
A common mistake is to use parenthesis subscripting instead of braces to operate on the contents of a
table. While some functions, such as ismissing or varfun, do accept a table as their input, many
numeric operations, including arithmetic, do not. For example, this assignment using parentheses
results in an error. The try-catch block catches the error and displays it.
try
housing(:,areaVars) = 0.3048^2 * housing(:,areaVars);
catch ME
disp(ME.message)
end
A third way to do calculations on numeric variables in a table is to use the varfun function. Like
curly brace subscripting, varfun can operate on all or only some of the variables in a table. Unlike
curly braces, varfun operates on each table variable separately. By default, varfun returns another
table containing a variable for each separate result.
Sometimes the operation that you want to apply is an existing function. To pass the function as an
argument to varfun, use a function handle. For example, use the round function to round data in the
variables specified by areaVars.
roundedAreaTable = varfun(@round,housing,"InputVariables",areaVars)
roundedAreaTable=2928×5 table
round_LotArea round_FirstFlrArea round_SecondFlrArea round_LowQualFinishedArea ro
_____________ __________________ ___________________ _________________________ __
2952 154 0 0
1080 83 0 0
1325 123 0 0
1037 196 0 0
1285 86 65 0
927 86 63 0
457 124 0 0
465 119 0 0
501 150 0 0
697 96 72 0
929 71 83 0
741 110 0 0
781 73 63 0
945 125 0 0
634 140 0 0
4971 157 148 0
⋮
9-80
Data Cleaning and Calculations in Tables
If there is no function that does exactly what you want, you can also write an anonymous function to
do it.
sqMeters2sqFeet = @(x) x / 0.3048^2;
areaTable = varfun(sqMeters2sqFeet,housing,"InputVariables",areaVars)
areaTable=2928×5 table
Fun_LotArea Fun_FirstFlrArea Fun_SecondFlrArea Fun_LowQualFinishedArea Fun_TotalA
___________ ________________ _________________ _______________________ __________
31770 1656 0 0
11622 896 0 0
14267 1329 0 0
11160 2110 0 0
13830 928 701 0
9978 926 678 0
4920 1338 0 0
5005 1280 0 0
5389 1616 0 0
7500 1028 776 0
10000 763 892 0
7980 1187 0 0
8402 789 676 0
10176 1341 0 0
6820 1502 0 0
53504 1690 1589 0
⋮
Because that result is a table, it can be assigned back into the original table with parenthesis
subscripting.
housing(:,areaVars) = areaTable;
housing.Properties.VariableUnits(areaVars) = "ft^2";
housing(:,areaVars) = areaTable;
The two assignments have the same effect. The assignment with parentheses assigns one table to
another. The assignment with curly braces explicitly assigns values to the content of the table. The
left and right sides of that assignment are numeric matrices. Because curly brace subscripting
extracts and reinserts data, it is a convenient way to modify data in place. Contents-to-contents
assignment can operate on only one data type at a time, while table-to-table assignment can move
data of different types. For example, this assignment results in an error because it involves mixed
numeric and categorical data in brace subscripting.
try
housing{:,["LotFrontage" "OverallCond"]} = normalize(housing{:,["LotFrontage" "OverallCond"]}
catch ME
disp(ME.message)
end
9-81
9 Tables
Because varfun returns a table, assignment using parenthesis subscripting cannot change the type
of any table variables. For example, this assignment does not convert any variables from the double
to single data type.
housing(:,areaVars) = varfun(@single,housing,"InputVariables",areaVars);
To convert the data types of table variables, use convertvars, as previously shown.
Because curly brace subscripting extracts the variables from a table as one matrix having one data
type, you can use it to perform row operations across numeric variables in a table. For example, a
check on the data is to compare the individual square footage variables against
TotalAboveGroundLivingArea. Extract the former by using curly braces. Then compare their row
sums to TotalAboveGroundLivingArea, extracted by using dot notation.
area = housing{:,["FirstFlrArea" "SecondFlrArea" "LowQualFinishedArea"]}
area = 2928×3
1656 0 0
896 0 0
1329 0 0
2110 0 0
928 701 0
926 678 0
1338 0 0
1280 0 0
1616 0 0
1028 776 0
⋮
isequal(sum(area,2), housing.TotalAboveGroundLivingArea)
ans = logical
1
The square footage data is consistent. Another example is to compute the total number of bathrooms
in each house by extracting the four different bathroom counts and adding them up across each row.
bathCountVars = ["BsmtHalfBath" "HalfBath" "BsmtFullBath" "FullBath"];
bathCounts = housing{:,bathCountVars}
bathCounts = 2928×4
0 0 1 1
0 0 0 1
0 1 0 1
0 1 1 2
0 1 0 2
0 1 0 2
0 0 1 2
0 0 0 2
0 0 1 2
0 1 0 2
⋮
9-82
Data Cleaning and Calculations in Tables
sum(housing{:,bathCountVars},2);
but that sum is not correct. Half-baths count only half as much as full bathrooms. A trend in real
estate listings is to account for multiple half-baths by counting them after the decimal point. Matrix
multiplication makes that operation one line.
Replace those four variables with TotalBaths, rather than adding a new variable at the end of the
table. Begin this replacement by using addvars to add TotalBaths next to the existing variables.
There is a mistake in one row of the data. A townhouse built in 2007 probably does not have four half
baths and no full baths.
groupcounts(housing,"TotalBaths")
ans=17×3 table
TotalBaths GroupCount Percent
__________ __________ ________
0.4 1 0.034153
1 442 15.096
1.1 293 10.007
1.2 20 0.68306
1.3 2 0.068306
2 890 30.396
2.1 558 19.057
2.2 29 0.99044
3 349 11.919
3.1 288 9.8361
3.2 6 0.20492
3.3 1 0.034153
4 25 0.85383
4.1 16 0.54645
4.2 3 0.10246
6 2 0.068306
⋮
ans=1×25 table
PID MSSubClass LotFrontage LotAr
____________ _____________________________________________________ ___________ _____
"0528228275" 1-STORY PUD (Planned Unit Development) - 1946 & NEWER 53 3922
The BsmtHalfBath count should be two full bathrooms. The bathroom counts are all numeric. The
assignment with braces updates all three values across that row.
9-83
9 Tables
housing = removevars(housing,bathCountVars)
housing=2928×21 table
PID MSSubClass LotFrontage LotAr
____________ _____________________________________________________ ___________ _____
Unlike curly braces, varfun operates on each variable in a table separately. For that reason, varfun
cannot do row operations. The related function rowfun can do row operations. It is often simpler and
faster to use curly brace subscripting for row operations.
In previous sections, the operations on numeric data in the table were transformations that replace
the original values. Many other important operations are reductions whose results are scalars. For
example, calculate the median price of the values in SalePrice.
median(housing.SalePrice)
ans = 160000
The median function works column-wise on matrices. You can use curly brace subscripting to extract
those four variables as a numeric matrix. Then you can calculate the medians of the columns of the
matrix.
median(housing{:,["LotFrontage", "LotArea" "TotalAboveGroundLivingArea" "SalePrice"]})
ans = 1×4
105 ×
This operation does not attach variable names or any other table metadata to the result. As an
alternative, you can use varfun to apply median to each variable in the table. With varfun, the
result is another table that contains separate numeric results and preserves the names.
varfun(@median,housing,"InputVariables",["LotFrontage", "LotArea" "TotalAboveGroundLivingArea" "S
ans=1×4 table
median_LotFrontage median_LotArea median_TotalAboveGroundLivingArea median_SalePrice
9-84
Data Cleaning and Calculations in Tables
These two ways to get the medians are equivalent. There is a trade-off between having the variable
names preserved in another table and having the results in one numeric row vector. The way you pick
depends on what you plan to do with the result.
Using curly braces when calculating the medians has another drawback. Curly braces require
compatible data type for all the variables. That is, the data you extract from the variables must have
data types that allow them to be concatenated into one matrix. Ordinal categorical data can also
have median values. Because categorical and numeric arrays cannot be concatenated, this
operation results in an error.
But because varfun operates on each variable in the table separately, there is no requirement that
the variables have the same data type or compatible types allowing concatenation. The only
requirement is that all the variables must support the function that is applied. To calculate the
medians of ordinal categorical variables and numeric variables in one function call use varfun.
ans=1×5 table
median_LotFrontage median_LotArea median_OverallCond median_TotalAboveGroundLivingAr
__________________ ______________ __________________ _______________________________
See Also
categorical | table | readtable | varfun | renamevars | convertvars | summary |
ismissing | rmmissing | datetime | removevars | addvars | groupcounts
Related Examples
• “Access Data in Tables” on page 9-32
• “Clean Messy and Missing Data in Tables” on page 9-19
• “Add and Delete Table Rows” on page 9-9
• “Add, Delete, and Rearrange Table Variables” on page 9-12
• “Modify Units, Descriptions, and Table Variable Names” on page 9-24
• “Create Timetables” on page 10-2
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Grouped Calculations in Tables and Timetables” on page 9-86
9-85
9 Tables
This example shows how to import nitrogen dioxide (NO2) data from the US Environmental
Protection Agency (EPA) into a table and do grouped calculations on this data. NO2 is one of the
Criteria Air Pollutants regulated under the US Clean Air Act. It is toxic by itself and is also a key
component of photochemical smog that results in ground-level ozone production. NO2 is produced
through high-temperature processes that can split nitrogen and oxygen gases and enable them to
recombine. Natural processes contribute NO2 to the atmosphere, but so do human activities such as
combustion in automobile engines and power plants, lightning, and biomass burning. The
concentration of NO2 in the atmosphere is also influenced by the photochemical cycling between NO
and NO2, atmospheric transport, and ultimately oxidation to nitric acid, causing acid rain. Different
processes contribute NO2 to the atmosphere on different timescales, leading to daily (diurnal),
weekly, and annual cycles in its atmospheric concentration. Time-series analysis of such data relies
heavily on grouped calculations to examine different periodic behavior or to average the data over
time to smooth out high-frequency variability and reveal long-term trends.
The example first shows how to do preliminary data cleaning, including conversion of the table to a
timetable. Then it shows simple ways to group the data by one grouping variable and calculate annual
mean NO2 concentrations. It also shows how to group the NO2 data by two grouping variables
together, time and location, enabling calculations that find locations exceeding EPA standards at
various times. You can also group the NO2 data by time period to look for daily or yearly cycles.
Finally it shows how to apply a function that requires inputs from multiple table variables to find the
times at which the maximum NO2 concentrations occurred at each site.
First, import NO2 data from the Air Quality System (AQS) database maintained by the EPA. This data
consists of hourly measurements of NO2 concentrations from outdoor monitors across the United
States, Puerto Rico, and the U.S. Virgin Islands. It is stored as a set of zipped spreadsheets, one for
each year starting with 1980.
Download hourly NO2 measurements for the years 1985–1989. You can download and unzip the
compressed spreadsheets by using the unzip function. The result is set of files in your current folder
with names such as hourly_42602_1985.csv. Here, 42602 is an EPA code for NO2. (Data from the
US Environmental Protection Agency. Air Quality System Data Mart available via https://
www.epa.gov/airdata. Accessed July 15, 2021.)
yrs = string(1985:1989);
urls = "https://aqs.epa.gov/aqsweb/airdata/hourly_42602_" + yrs + ".zip";
fnames = strings(numel(yrs),1);
for ii = 1:numel(yrs)
fnames(ii) = unzip(urls(ii));
end
fnames
9-86
Grouped Calculations in Tables and Timetables
"hourly_42602_1986.csv"
"hourly_42602_1987.csv"
"hourly_42602_1988.csv"
"hourly_42602_1989.csv"
Import data from the spreadsheets into a table. Start by creating an empty table. Then import data
from the spreadsheets, one by one, by using the readtable function and adding it to the table.
Create import options that help specify how readtable imports tabular data. To create import
options based on the contents of the spreadsheets, use the detectImportOptions function. Read
all the text data into table variables that store strings. You can also specify that only specified table
variables have certain data types. To specify that only the TimeGMT and TimeLocal table variables
store times as duration arrays, use the setvaropts function.
NO2data = table;
opts = detectImportOptions(fnames(1),"TextType","string");
opts = setvaropts(opts,["TimeGMT","TimeLocal"],"Type","duration","InputFormat","hh:mm");
Import data from the spreadsheets by using the readtable function. You can vertically concatenate
the tables you read in so that all the data is in one large table.
The spreadsheets have column names, such as "Time GMT", that you cannot use as MATLAB
identifiers. As the warning messages indicate, readtable converts these names into table variable
names that are valid MATLAB identifiers, such as TimeGMT. When a table variable name is also a
valid MATLAB identifier, it is easier to access the variable by using dot notation, as in
NO2data.TimeGMT.
for ii = 1:numel(yrs)
NO2data = [NO2data; readtable(fnames(ii),opts)];
end
Warning: Column headers from the file were modified to make them valid MATLAB identifiers before
Set 'VariableNamingRule' to 'preserve' to use the original column headers as table variable names
Warning: Column headers from the file were modified to make them valid MATLAB identifiers before
Set 'VariableNamingRule' to 'preserve' to use the original column headers as table variable names
Warning: Column headers from the file were modified to make them valid MATLAB identifiers before
Set 'VariableNamingRule' to 'preserve' to use the original column headers as table variable names
Warning: Column headers from the file were modified to make them valid MATLAB identifiers before
Set 'VariableNamingRule' to 'preserve' to use the original column headers as table variable names
Warning: Column headers from the file were modified to make them valid MATLAB identifiers before
Set 'VariableNamingRule' to 'preserve' to use the original column headers as table variable names
Display NO2data. It has 24 variables storing NO2 sample measurements, site locations, state names,
times, and many other pieces of information.
NO2data
NO2data=11294497×24 table
StateCode CountyCode SiteNum ParameterCode POC Latitude Longitude Datum
_________ __________ _______ _____________ ___ ________ _________ ______
9-87
9 Tables
Next, prepare NO2data for analysis by cleaning the data. Data cleaning is the process of detecting
and correcting (or removing) parts of the data set that are either corrupt, inaccurate, or irrelevant.
You can also convert table variables so that they have data types that can be more convenient for
analysis, such as categorical or datetime arrays.
For example, the table variable SampleMeasurement has measurements of NO2 concentration.
Concentrations below the method detection limit (MDL) are unreliable. To exclude them from
analysis, find the rows where SampleMeasurement is below the MDL. Set those elements to NaN.
NO2data.SampleMeasurement(NO2data.SampleMeasurement < NO2data.MDL) = NaN;
Create a table that contains only the subset of variables that are relevant to this example. You can use
table subscripting to create a table that has all rows (specified by a colon) and only those variables
that you name.
NO2data = NO2data(:,["DateLocal","TimeLocal","SampleMeasurement","StateName","CountyName","SiteNu
NO2data=11294497×8 table
DateLocal TimeLocal SampleMeasurement StateName CountyName SiteNum Latitud
__________ _________ _________________ _________ __________ _______ _______
9-88
Grouped Calculations in Tables and Timetables
Combine the local date and time into a single timestamp. The new Timestamp table variable is a
datetime array. Delete the DateLocal and TimeLocal variables because they are now redundant.
To categorize the data later, convert the StateName and CountyName variables to categorical
arrays, first erasing space characters from the names. There are fixed sets of state and county names
in the data, which makes it convenient to create categories based on them.
Rename the SampleMeasurement variable to MeasuredNO2. One way to rename table variables is
by using the VariableNames property of the table.
NO2data.Properties.VariableNames("SampleMeasurement") = "MeasuredNO2";
Convert NO2data to a timetable. The datetime values in Timestamp are now row times that label
the rows of the timetable. The dates and times of the original table were in separate variables. To put
data like this data into a timetable, it is more convenient to import the data as a table, and then
combine the separate date and time variables into one datetime variable. Then convert the modified
table by using the table2timetable function.
NO2data = table2timetable(NO2data)
NO2data=11294497×6 timetable
Timestamp MeasuredNO2 StateName CountyName SiteNum Latitude Long
____________________ ___________ _________ __________ _______ ________ ____
Given the size of the timetable, it is obvious that there are many thousands of hourly measurements
in every state. One way to calculate the number of measurements for each state is to sum the number
of rows that have a particular state as a category. For example, calculate the number of
measurements for Alaska, and then for Arizona.
9-89
9 Tables
numAlaska = sum(NO2data.StateName=="Alaska")
numAlaska = 7071
numArizona = sum(NO2data.StateName=="Arizona")
numArizona = 142793
It is tedious to perform this calculation multiple times or to store intermediate results in many
variables or subtables. Instead, MATLAB provides functions that group data in tables and apply
functions to each group in-place. For example, use the groupcounts function to group the data in
NO2data by the states in StateName and count the rows in each group. Instead of calling sum many
times, call groupcounts once.
NO2counts = groupcounts(NO2data,"StateName")
NO2counts=42×3 table
StateName GroupCount Percent
__________________ __________ ________
To sort the results in a table or timetable, use the sortrows function. Sort gc on its GroupCount
variable from highest to lowest value.
sortedNO2counts = sortrows(NO2counts,"GroupCount","descend")
sortedNO2counts=42×3 table
StateName GroupCount Percent
_____________ __________ _______
9-90
Grouped Calculations in Tables and Timetables
To calculate other statistics, use the groupsummary function. For example, find the maximum NO2
concentration measured in each state.
NO2max = groupsummary(NO2data,"StateName","max","MeasuredNO2");
sortedNO2max = sortrows(NO2max,"max_MeasuredNO2","descend")
sortedNO2max=42×3 table
StateName GroupCount max_MeasuredNO2
____________ __________ _______________
As an alternative, you can use the varfun function with the "GroupingVariables" name-value
argument for grouped calculations. But the groupsummary function is simpler and performs most of
the same grouped calculations as varfun.
Functions such as groupcounts, groupsummary, and varfun work equally well on tables and
timetables. But timetables also provide the retime and synchronize functions, which can perform
time-based calculations by using their row times. You can group timetable data by time and perform
calculations on data within the time periods. The retime function is the best option for such cases.
For example, group the data in NO2data into yearly time periods. Find the maximum NO2
concentration for each year.
yearlyMaxNO2 = retime(NO2data(:,"MeasuredNO2"),"yearly","max")
yearlyMaxNO2=5×1 timetable
Timestamp MeasuredNO2
___________ ___________
01-Jan-1985 407.3
9-91
9 Tables
01-Jan-1986 500
01-Jan-1987 497
01-Jan-1988 743.5
01-Jan-1989 462
This calculation is useful if you have one time series. In this case, the data in the MeasuredNO2
variable come from multiple sites. A more useful analysis is to group by both year and site.
The US EPA has two National Ambient Air Quality Standards (NAAQS) for NO2. A location is not in
compliance with the NAAQS if either:
Analyze data in NO2data to find locations that are not in compliance with the first standard, where
the annual mean exceeded 53 ppb. There are three different ways to approach this analysis. What the
three approaches have in common is that you can group the data by both time and site to calculate
annual means by site.
To find sites that do not comply with the NAAQS, calculate the mean value for each site for each year.
While NO2data does not include unique identifiers for the sites, you can use state names, county
names, and site numbers together to uniquely identify air quality sites.
The row times of NO2data are datetime values. Extract their year components and add a new
variable to NO2data named Year. Calculate the annual means for each site by using groupsummary
with StateName, CountyName, SiteNum, and Year as grouping variables.
NO2data.Year = year(NO2data.Timestamp);
meanNO2bySite = groupsummary(NO2data,["StateName","CountyName","SiteNum","Year"],"mean","Measured
meanNO2bySite=1585×6 table
StateName CountyName SiteNum Year GroupCount mean_MeasuredNO2
_________ ______________ _______ ____ __________ ________________
9-92
Grouped Calculations in Tables and Timetables
To find the sites that have the highest mean NO2, sort the timetable.
sortedMeanNO2bySite = sortrows(meanNO2bySite,"mean_MeasuredNO2","descend")
sortedMeanNO2bySite=1585×6 table
StateName CountyName SiteNum Year GroupCount mean_MeasuredNO2
__________ __________ _______ ____ __________ ________________
You can create a table that includes only those sites exceeding 53 ppb by using logical indexing.
Create a logical vector that indicates the rows where mean_MeasuredNO2 is greater than 53. Use
that vector as a subscript to get matching rows from meanNO2bySite.
exceeded53ppb = meanNO2bySite.mean_MeasuredNO2 > 53;
sitesExceed53ppb = meanNO2bySite(exceeded53ppb,:)
sitesExceed53ppb=19×6 table
StateName CountyName SiteNum Year GroupCount mean_MeasuredNO2
__________ __________ _______ ____ __________ ________________
9-93
9 Tables
Sometimes pivoting, or rearranging statistics calculated from tabular data, makes it easier to see and
analyze results, particularly when you look at the relationship between two grouping variables. For
example, you can create a pivot table for the annual mean NO2 by site. By pivoting, you can create a
table where every site lists annual mean NO2 in its own table variable, showing the relationship
between year and site. In MATLAB, you can create pivot tables by using the stack and unstack
functions, which stack and unstack table variables into taller or wider formats.
A complication in this case is that NO2data has three grouping variables that together uniquely
identify sites: state name, county name, and site number. To create a pivot table, first combine these
three table variables into one variable. Convert StateName, CountyName, and SiteNum into strings
and add them together. Replace spaces and dashes with underscores, and erase periods and
parentheses. The names in SiteID are unique site identifiers.
Add SiteID to NO2data as a new table variable. Calculate annual means by using groupsummary,
but this time use SiteID as a grouping variable.
NO2data.SiteID = categorical(siteID);
meanNO2bySiteID = groupsummary(NO2data,["SiteID","Year"],"mean","MeasuredNO2")
meanNO2bySiteID=1585×4 table
SiteID Year GroupCount mean_MeasuredNO2
__________________________ ____ __________ ________________
To create a pivot table, use the unstack function. Each unique site in the SiteID variable of
meanNO2bySiteID becomes the name of a separate table variable in the output,
pivotedMeanNO2bySiteID, and has the annual means associated with that site. This unstacking
operation is how you can create a pivot table in MATLAB.
pivotedMeanNO2bySiteID = unstack(meanNO2bySiteID,"mean_MeasuredNO2","SiteID","GroupingVariable","
pivotedMeanNO2bySiteID=5×443 table
Year Alaska_KenaiPeninsula_1004 Arizona_Apache_10 Arizona_Apache_11 Arizona_Apach
9-94
Grouped Calculations in Tables and Timetables
This representation of the annual means by site has an advantage and a disadvantage.
• It is easier to look at the short five-year time series for each site. After unstacking, each site has
its own variable in pivotedMeanNO2bySiteID. You can easily compare sites to each other.
• It is harder to sort and pick out the largest values across the whole pivoted table. After
unstacking, pivotedMeanNO2bySiteID has 443 variables. The stacked version,
meanNO2bySite, has only seven variables.
To group data in NO2data by year and another grouping variable, it was necessary to add Year as an
additional variable. Also, the output from groupsummary is a table even when the input is a
timetable. But suppose you want to keep the results in a timetable instead. The retime function can
also produce annual summaries. But it can group data only by time. To group data by site and by year,
rearrange NO2data so that you can call retime on a timetable where the NO2 concentrations are
already grouped by site.
Group the raw data in NO2data by site by using the unstack function. The output timetable has a
separate variable for each site. This timetable looks similar to a pivot table. But instead of having
means or some other statistic, NO2bySite has all the raw data. It is just reorganized. For further
convenience, sort the rows of the timetable by their row times so that the earliest timestamps come
first.
NO2bySite = unstack(NO2data,"MeasuredNO2","SiteID","GroupingVariable","Timestamp");
NO2bySite = sortrows(NO2bySite)
NO2bySite=43824×442 timetable
Timestamp Alaska_KenaiPeninsula_1004 Arizona_Apache_10 Arizona_Apache_11
____________________ __________________________ _________________ _________________
In this format you can easily plot the raw data by using the stackedplot function. This plot shows
NO2 concentrations for each site as a function of time.
stackedplot(NO2bySite)
9-95
9 Tables
To create a timetable that is also a pivot table, use retime to calculate annual means.
meanNO2bySiteTT = retime(NO2bySite,"yearly","mean")
meanNO2bySiteTT=5×442 timetable
Timestamp Alaska_KenaiPeninsula_1004 Arizona_Apache_10 Arizona_Apache_11 Arizon
___________ __________________________ _________________ _________________ ______
stackedplot(meanNO2bySiteTT)
9-96
Grouped Calculations in Tables and Timetables
You might want to preserve information from the original timetable NO2data in this timetable of
results. For example, you might want to add the latitudes and longitudes of the sites to NO2bySite.
They were stored for each timestamp in NO2data. But to store them more compactly in this
timetable, add them as per-variable custom properties to NO2bySite.
LatLon = groupsummary(NO2data,"SiteID","mode",["Latitude","Longitude"]);
NO2bySite = addprop(NO2bySite,["Latitude","Longitude"],["variable","variable"]);
NO2bySite.Properties.CustomProperties.Latitude(string(LatLon.SiteID)) = LatLon.mode_Latitude';
NO2bySite.Properties.CustomProperties.Longitude(string(LatLon.SiteID)) = LatLon.mode_Longitude';
To calculate compliance with the second NAAQS standard for NO2 requires a sequence of grouped
calculations. By the second standard, a location is out of compliance if the 98th percentile of the 1-
hour daily maximum concentrations of NO2, averaged over 3 years, exceeds 100 ppb.
Start with the hourly concentrations of NO2 by site. To find the daily maximum for each site, use the
retime function, specifying "max" as the method to find the maximum concentration for each day's
worth of data. Then find the 98th percentiles of the daily maximums in each year's worth of data,
calling retime a second time. To calculate percentiles, use the findPrctile supporting function
referred to in this example.
dailyMax = retime(NO2bySite,"daily","max");
yearlyP98 = retime(dailyMax,"yearly",@(x)findPrctile(x,98))
yearlyP98=5×442 timetable
Timestamp Alaska_KenaiPeninsula_1004 Arizona_Apache_10 Arizona_Apache_11 Arizon
9-97
9 Tables
01-Jan-1985 NaN 27 29
01-Jan-1986 NaN 13 14
Next calculate a moving mean for each site, specifying a three-year window for the moving mean. The
smoothdata enables you to apply the movmean function to each variable in yearlyP98.
moving3yearAvg = smoothdata(yearlyP98,"movmean",[years(3) 0])
moving3yearAvg=5×442 timetable
Timestamp Alaska_KenaiPeninsula_1004 Arizona_Apache_10 Arizona_Apache_11 Arizon
___________ __________________________ _________________ _________________ ______
01-Jan-1985 NaN 27 29
01-Jan-1986 NaN 20 21.5
Display sites that are out of compliance. First specify a time range starting in 1987, the first year for
which the moving three-year window has three full years of data.
full3years = timerange("1987-01-01","1989-01-01","closed")
full3years =
timetable timerange subscript:
Next find sites that exceeded the standard during any year in the 1987–1989 time period. The vector
exceed is a vector of logical values whose values are 1 (true) where the corresponding variables of
moving3yearAvg have values that exceed the standard. You can use logical arrays to index into
tables. In this case, index into moving3yearAvg by using exceed to display only the variables for
the sites that exceed the standard.
exceed = any(moving3yearAvg{full3years,:}>100,1);
moving3yearAvg(full3years,exceed)
ans=3×85 timetable
Timestamp California_Alameda_1001 California_ContraCosta_3001 California_Fresno_5
___________ _______________________ ___________________________ ___________________
The NO2bySite timetable has latitudes and longitudes for the sites, saved as custom properties. The
latitudes and longitudes are associated with the variables of the timetable. You can mark the sites
that exceeded the standard on a map by using the geoscatter function. The sites that exceeded the
standard in 1987 are marked in yellow. (Here, moving3yearAvg{1,:} accesses the first row of the
timetable, corresponding to the year 1987.) The sites out of compliance in 1987 were typically large
cities such as Los Angeles. Due to the Clean Air Act, a similar analysis using the latest data for the
years 2015–2019 would show no sites out of compliance with the NO2 standard.
9-98
Grouped Calculations in Tables and Timetables
geoscatter(moving3yearAvg.Properties.CustomProperties.Latitude,...
moving3yearAvg.Properties.CustomProperties.Longitude,...
moving3yearAvg{1,:},moving3yearAvg{1,:}>100,'filled')
Another way to group by time is by using periodic time units to look for things like seasonality or
daily cycles. For example, consider the average daily pattern of NO2 concentrations at each site. It is
likely that fossil fuel combustion emissions from human activity and atmospheric photochemistry
driven by the sun contribute to a daily cycle in NO2 concentrations. You cannot calculate the mean
daily cycle using retime. One approach is to use the varfun function by adding a grouping variable
based on the time of day of each timestamp. The timeofday function returns the time of day, or
length of time since midnight, as a duration. This code sample shows the approach by using varfun.
NO2bySite.Hour = timeofday(NO2bySite.Timestamp);
NO2bySite.Hour.Format = "hh:mm";
meanDailyCycleNO2 = varfun(@mean,NO2bySite,"GroupingVariable","Hour")
For common calendar periods such as hour of day or month of year, there is a simpler method. These
common calendar periods are options of the groupsummary function. Call groupsummary with the
"hourofday" option.
meanDailyCycleNO2 = groupsummary(NO2bySite,"Timestamp","hourofday","mean")
meanDailyCycleNO2=24×444 table
hourofday_Timestamp GroupCount mean_Alaska_KenaiPeninsula_1004 mean_Arizona_Apache_1
___________________ __________ _______________________________ _____________________
9-99
9 Tables
0 1826 11.067 5
⋮
To visualize the daily cycle for the first few sites, use stackedplot. Compare the pattern of a single
peak in remote sites in Alaska and Arizona to the morning and evening peaks during rush hour at
urban sites in Arizona and California.
meanDailyCycleNO2.GroupCount = [];
meanDailyCycleNO2.hourofday_Timestamp = hours(double(meanDailyCycleNO2.hourofday_Timestamp));
stackedplot(meanDailyCycleNO2,'XVariable','hourofday_Timestamp')
The retime, groupsummary, and varfun functions all apply functions separately to each table
variable. But sometimes you have functions that use more than one table variable as inputs. For
example, you might want to find the time or index at which some condition occurred within each
group of data values. In such cases, use the rowfun function. It enables you to apply functions that
require multiple inputs.
For example, determine when the maximum NO2 concentration occurred at each site. This
determination requires a function such as the findMax supporting function referred to in this
example. The findMax function requires both timestamps and data values as input arguments. It
returns the maximum value with the time at which the maximum value occurred.
9-100
Grouped Calculations in Tables and Timetables
To group the data in NO2data by SiteID and find the times when the maximum NO2 concentration
occurred at each site, use rowfun. Specify that the inputs to findMax are Timestamp and
MeasuredNO2 from NO2data. Convert NO2data to a table so that rowfun returns a table.
NO2data = timetable2table(NO2data);
rowfun(@findMax,NO2data,"GroupingVariable","SiteID","InputVariables",["Timestamp","MeasuredNO2"],
"OutputVariableNames",["MaxMeasuredNO2","MaxOccurrenceTime"])
ans=442×4 table
SiteID GroupCount MaxMeasuredNO2 MaxOccurrenceTime
___________________________ __________ ______________ ____________________
With these results you could extend your analysis to find out why the NO2 concentrations were
particularly high on those dates.
Supporting Functions
See Also
categorical | table | timetable | readtable | detectImportOptions | varfun | datetime |
groupcounts | groupsummary | rowfun | retime | stackedplot
9-101
9 Tables
Related Examples
• “Access Data in Tables” on page 9-32
• “Clean Messy and Missing Data in Tables” on page 9-19
• “Add, Delete, and Rearrange Table Variables” on page 9-12
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-27
• “Data Cleaning and Calculations in Tables” on page 9-66
9-102
10
Timetables
Create Timetables
This example shows how to create a timetable, combine timetables, and adjust the data from multiple
timetables to a common time vector. The common time vector can contain the times from either or
both timetables, or it can be an entirely new time vector that you specify. The example shows how to
compute and display a daily mean for weather measurements contained in different timetables.
A timetable is a type of table that associates a time with each row. A timetable can store column-
oriented data variables that have different data types and sizes, so long as each variable has the same
number of rows. In addition, timetables provide time-specific functions to combine, subscript into,
and adjust their data.
Load air quality data and weather measurements into two different timetables. The dates of the
measurements range from November 15, 2015, to November 19, 2015. The air quality data come
from a sensor inside a building, while the weather measurements come from sensors outside.
Read the air quality data from a table with the readtimetable function. The output is a timetable.
indoors = readtimetable('indoors.csv');
You also can create a timetable from an M-by-N array with the array2timetable function, or from
workspace variables with the timetable function.
Display the first five rows of indoors. Each row of the timetable has a time that labels that row of
data.
indoors(1:5,:)
ans=5×2 timetable
Time Humidity AirQuality
___________________ ________ __________
2015-11-15 00:00:24 36 80
2015-11-15 01:13:35 36 80
2015-11-15 02:26:47 37 79
2015-11-15 03:39:59 37 82
2015-11-15 04:53:11 36 80
Load the timetable with weather measurements. Display the first five rows of outdoors.
load outdoors
outdoors(1:5,:)
ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________
10-2
Create Timetables
Synchronize Timetables
The timetables, indoors and outdoors, contain different measurements taken inside and outside a
building at different times. Combine all the data into one timetable with the synchronize function.
tt = synchronize(indoors,outdoors);
tt(1:5,:)
ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________
The output timetable, tt contains all the times from both timetables. synchronize puts a missing
data indicator where there are no data values to place in tt. When both input timetables have a
variable with the same name, such as Humidity, synchronize renames both variables and adds
both to the output timetable.
Synchronize the timetables again, and this time fill in missing data values with linear interpolation.
ttLinear = synchronize(indoors,outdoors,'union','linear');
ttLinear(1:5,:)
ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________
You also can adjust the data in a single timetable to a new time vector. Calculate the means of the
variables in ttLinear over six-hour intervals with the retime function. If any rows have NaN values
after you adjust the data, remove them with the rmmissing function.
tv = [datetime(2015,11,15):hours(6):datetime(2015,11,18)];
ttHourly = retime(ttLinear,tv,'mean');
ttHourly = rmmissing(ttHourly);
Normalize the data in ttHourly to the mean for each variable in the timetable. Plot the mean daily
values of these measurements. You can use the Variables property of a timetable to access the
variables. ttHourly.Variables returns the same variables as ttHourly{:,:}.
ttMeanVars = ttHourly.Variables./mean(ttHourly.Variables);
plot(ttHourly.Time,ttMeanVars);
10-3
10 Timetables
legend(ttHourly.Properties.VariableNames,'Interpreter','none');
xlabel('Time');
ylabel('Normalized Weather Measurements');
title('Mean Daily Weather Trends');
See Also
timetable | table2timetable | synchronize | retime | timerange | rmmissing
Related Examples
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Combine Timetables and Synchronize Their Data” on page 10-8
• “Retime and Synchronize Timetable Variables Using Different Methods” on page 10-14
• “Select Times in Timetable” on page 10-19
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-27
10-4
Resample and Aggregate Data in Timetable
Import Timetable
Load a timetable containing weather measurements taken from November 15, 2015, to November 19,
2015. The timetable contains humidity, temperature, and pressure readings taken over this time
period.
load outdoors
outdoors(1:5,:)
ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________
Determine if the timetable is regular. A regular timetable is one in which the differences between all
consecutive row times are the same. outdoors is not a regular timetable.
TF = isregular(outdoors)
TF = logical
0
Find the differences in the time steps. They vary between half a minute and an hour and a half.
dt = unique(diff(outdoors.Time))
dt = 3x1 duration
00:00:24
01:29:36
01:30:00
Adjust the data in the timetable with the retime function. Specify an hourly time vector. Interpolate
the timetable data to the new row times.
TT = retime(outdoors,'hourly','spline');
TT(1:5,:)
ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________
10-5
10 Timetables
Specify an hourly time vector for TT. For each row in TT, copy values from the corresponding row in
outdoors whose row time is nearest.
TT = retime(outdoors,'hourly','nearest');
TT(1:5,:)
ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________
The retime function provides aggregation methods, such as mean. Calculate the daily means for the
data in outdoors.
TT = retime(outdoors,'daily','mean');
TT
TT=4×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________
Calculate the means over six-hour time intervals. Specify a regular time step using the 'regular'
input argument and the 'TimeStep' name-value pair argument.
TT = retime(outdoors,'regular','mean','TimeStep',hours(6));
TT(1:5,:)
ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________
10-6
Resample and Aggregate Data in Timetable
As an alternative, you can specify a time vector that has the same six-hour time intervals. Specify a
format for the time vector to display both date and time when you display the timetable.
tv = datetime(2015,11,15):hours(6):datetime(2015,11,18);
tv.Format = 'dd-MMM-yyyy HH:mm:ss';
TT = retime(outdoors,tv,'mean');
TT(1:5,:)
ans=5×3 timetable
Time Humidity TemperatureF PressureHg
____________________ ________ ____________ __________
See Also
timetable | table2timetable | synchronize | retime
Related Examples
• “Create Timetables” on page 10-2
• “Combine Timetables and Synchronize Their Data” on page 10-8
• “Retime and Synchronize Timetable Variables Using Different Methods” on page 10-14
• “Select Times in Timetable” on page 10-19
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-27
10-7
10 Timetables
Load timetables from openPricesSmall and concatenate them vertically. The timetables are
opWeek1 and opWeek2. They contain opening prices for some stocks during the first and second
weeks of January 2016.
load openPricesSmall
opWeek1
opWeek1=5×2 timetable
Time AAPL FB
____________________ ______ ______
opWeek2
opWeek2=5×2 timetable
Time AAPL FB
____________________ ______ ______
Concatenate the timetables. You can concatenate timetables vertically when they have the same
variables. The row times label the rows and are not contained in a timetable variable. Note that the
row times of a timetable can be out of order and do not need to be regularly spaced. For example, op
does not include days that fall on weekends. A timetable also can contain duplicate times. op contains
two rows for 08-Jan-2016 09:00:00.
op = [opWeek2;opWeek1]
op=10×2 timetable
Time AAPL FB
10-8
Combine Timetables and Synchronize Their Data
You also can concatenate timetables horizontally. The timetables must have the same row times and
different variables.
Display the timetable opOtherStocks. The timetable has the same row times as opWeek1, but
variables for different stocks.
opOtherStocks
opOtherStocks=5×2 timetable
Time MSFT TWTR
____________________ _____ _____
Concatenate opWeek1 and opOtherStock. The output timetable has one set of row times and the
variables from both timetables.
op = [opWeek1 opOtherStocks]
op=5×4 timetable
Time AAPL FB MSFT TWTR
____________________ ______ ______ _____ _____
Load air quality data and weather measurements from two different timetables and synchronize
them. The dates of the measurements range from November 15, 2015, to November 19, 2015. The air
quality data come from a sensor inside a building, while the weather measurements come from
sensors outside.
10-9
10 Timetables
load indoors
load outdoors
Display the first five lines of each timetable. They contain measurements of different quantities taken
at different times.
indoors(1:5,:)
ans=5×2 timetable
Time Humidity AirQuality
___________________ ________ __________
2015-11-15 00:00:24 36 80
2015-11-15 01:13:35 36 80
2015-11-15 02:26:47 37 79
2015-11-15 03:39:59 37 82
2015-11-15 04:53:11 36 80
outdoors(1:5,:)
ans=5×3 timetable
Time Humidity TemperatureF PressureHg
___________________ ________ ____________ __________
Synchronize the timetables. The output timetable tt contains all the times from both timetables.
synchronize puts a missing data indicator where there are no data values to place in tt. When both
input timetables have a variable with the same name, such as Humidity, synchronize renames
both variables and adds both to the output timetable.
tt = synchronize(indoors,outdoors);
tt(1:5,:)
ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________
Synchronize the timetables, and fill in missing timetable elements with linear interpolation. To
synchronize on a time vector that includes all times from both timetables, specify 'union' for the
output times.
ttLinear = synchronize(indoors,outdoors,'union','linear');
ttLinear(1:5,:)
10-10
Combine Timetables and Synchronize Their Data
ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________
Synchronize the timetables to an hourly time vector. The input timetables had irregular row times.
The output timetable has regular row times with one hour as the time step.
ttHourly = synchronize(indoors,outdoors,'hourly','linear');
ttHourly(1:5,:)
ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________
Synchronize the timetables to a 30-minute time step. Specify a regular time step using the
'regular' input argument and the 'TimeStep' name-value pair argument.
ttHalfHour = synchronize(indoors,outdoors,'regular','linear','TimeStep',minutes(30));
ttHalfHour(1:5,:)
ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________
As an alternative, you can synchronize the timetables to a time vector that specifies half-hour
intervals.
tv = [datetime(2015,11,15):minutes(30):datetime(2015,11,18)];
tv.Format = indoors.Time.Format;
ttHalfHour = synchronize(indoors,outdoors,tv,'linear');
ttHalfHour(1:5,:)
ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________
10-11
10 Timetables
Synchronize the timetables and calculate the daily means for all variables in the output timetable.
ttDaily = synchronize(indoors,outdoors,'daily','mean');
ttDaily
ttDaily=4×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________
Synchronize the timetables to six-hour time intervals and calculate a mean for each interval.
tt6Hours = synchronize(indoors,outdoors,'regular','mean','TimeStep',hours(6));
tt6Hours(1:5,:)
ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________
As an alternative, specify a time vector that has the same six-hour time intervals.
tv = [datetime(2015,11,15):hours(6):datetime(2015,11,18)];
tv.Format = indoors.Time.Format;
tt6Hours = synchronize(indoors,outdoors,tv,'mean');
tt6Hours(1:5,:)
ans=5×5 timetable
Time Humidity_indoors AirQuality Humidity_outdoors TemperatureF
___________________ ________________ __________ _________________ ____________
10-12
Combine Timetables and Synchronize Their Data
See Also
timetable | table2timetable | synchronize | retime
Related Examples
• “Create Timetables” on page 10-2
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Retime and Synchronize Timetable Variables Using Different Methods” on page 10-14
• “Select Times in Timetable” on page 10-19
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-27
10-13
10 Timetables
Create Timetable
Create a timetable that has simulated weather measurements for several days in May 2017. The
timetable variables Tmax and Tmin contain maximum and minimum temperature readings for each
day, and PrecipTotal contains total precipitation for the day. WXEvent is a categorical array,
recording whether certain kinds of weather events, such as thunder or hail, happened on any given
day. The timetable has simulated data from May 4 to May 10, 2017, but is missing data for two days,
May 6th and May 7th.
Date = [datetime(2017,5,4) datetime(2017,5,5) datetime(2017,5,8:10)]';
Tmax = [60 62 56 59 60]';
Tmin = [44 45 40 42 45]';
PrecipTotal = [0.2 0 0 0.15 0]';
WXEvent = [2 0 0 1 0]';
WXEvent = categorical(WXEvent,[0 1 2 3 4],{'None','Thunder','Hail','Fog','Tornado'});
Station1 = timetable(Date,Tmax,Tmin,PrecipTotal,WXEvent)
Station1=5×4 timetable
Date Tmax Tmin PrecipTotal WXEvent
___________ ____ ____ ___________ _______
One way to fill in data for the two missing days is to use the retime function. If you call retime
without specifying a method, then retime fills in gaps with missing data indicators. For instance,
retime fills gaps in numeric variables with NaN values, and gaps in the categorical variable with
undefined elements.
Station1Daily = retime(Station1,'daily')
Station1Daily=7×4 timetable
Date Tmax Tmin PrecipTotal WXEvent
___________ ____ ____ ___________ ___________
10-14
Retime and Synchronize Timetable Variables Using Different Methods
08-May-2017 56 40 0 None
09-May-2017 59 42 0.15 Thunder
10-May-2017 60 45 0 None
If you specify a method when you call retime, it uses the same method to fill gaps in every variable.
To apply different methods to different variables, you can call retime multiple times, each time
indexing into the timetable to access a different subset of variables.
However, you also can apply different methods by specifying the VariableContinuity property of
the timetable. You can specify whether each variable contains continuous or discrete data. Then the
retime function applies a different method to each timetable variable, depending on the
corresponding VariableContinuity value.
If you specify VariableContinuity, then the retime function fills in the output timetable variables
using the following methods:
• 'unset' — Fill in values using the missing data indicator for that type (such as NaN for numeric
variables).
• 'continuous' — Fill in values using linear interpolation.
• 'step' — Fill in values using previous value.
• 'event' — Fill in values using the missing data indicator for that type.
Specify that the temperature data in Station1 is continuous, that PrecipTotal is step data, and
that WXEvent is event data.
Station1.Properties.VariableContinuity = {'continuous','continuous','step','event'};
Station1.Properties
ans =
TimetableProperties with properties:
Description: ''
UserData: []
DimensionNames: {'Date' 'Variables'}
VariableNames: {'Tmax' 'Tmin' 'PrecipTotal' 'WXEvent'}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: [continuous continuous step event]
RowTimes: [5x1 datetime]
StartTime: 04-May-2017
SampleRate: NaN
TimeStep: NaN
CustomProperties: No custom properties are set.
Use addprop and rmprop to modify CustomProperties.
Resample the data in Station1. Given the values assigned to VariableContinuity, the retime
function interpolates the temperature data, fills in the previous day's values in PrecipTotal, and
fills in WXEvent with undefined elements.
Station1Daily = retime(Station1,'daily')
Station1Daily=7×4 timetable
Date Tmax Tmin PrecipTotal WXEvent
___________ ____ ______ ___________ ___________
10-15
10 Timetables
If you specify a method, then retime applies that method to all variables, overriding the values in
VariableContinuity.
Station1Missing = retime(Station1,'daily','fillwithmissing')
Station1Missing=7×4 timetable
Date Tmax Tmin PrecipTotal WXEvent
___________ ____ ____ ___________ ___________
The synchronize function also fills in output timetable variables using different methods, depending
on the values specified in the VariableContinuity property of each input timetable.
Create a second timetable that contains pressure readings in millibars from a second weather station.
The timetable has simulated readings from May 4 to May 8, 2017.
Date = datetime(2017,5,4:8)';
Pressure = [995 1003 1013 1018 1006]';
Station2 = timetable(Date,Pressure)
Station2=5×1 timetable
Date Pressure
___________ ________
04-May-2017 995
05-May-2017 1003
06-May-2017 1013
07-May-2017 1018
08-May-2017 1006
Synchronize the data from the two stations using the synchronize function. synchronize fills in
values for variables from Station1 according to the values in the VariableContinuity property
of Station1. However, since the VariableContinuity property of Station2 is empty,
synchronize fills in Pressure with NaN values.
BothStations = synchronize(Station1,Station2)
10-16
Retime and Synchronize Timetable Variables Using Different Methods
BothStations=7×5 timetable
Date Tmax Tmin PrecipTotal WXEvent Pressure
___________ ____ ______ ___________ ___________ ________
Station2.Properties.VariableContinuity = {'continuous'};
Station2.Properties
ans =
TimetableProperties with properties:
Description: ''
UserData: []
DimensionNames: {'Date' 'Variables'}
VariableNames: {'Pressure'}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: continuous
RowTimes: [5x1 datetime]
StartTime: 04-May-2017
SampleRate: NaN
TimeStep: 1d
CustomProperties: No custom properties are set.
Use addprop and rmprop to modify CustomProperties.
Synchronize the data from the two stations. synchronize fills in values in
BothStations.Pressure because Station2.Pressure has continuous data.
BothStations = synchronize(Station1,Station2)
BothStations=7×5 timetable
Date Tmax Tmin PrecipTotal WXEvent Pressure
___________ ____ ______ ___________ ___________ ________
10-17
10 Timetables
If you specify a method as an input argument to synchronize, then synchronize applies that
method to all variables, just as the retime function does.
See Also
timetable | synchronize | retime
Related Examples
• “Create Timetables” on page 10-2
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Combine Timetables and Synchronize Their Data” on page 10-8
• “Select Times in Timetable” on page 10-19
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-27
10-18
Select Times in Timetable
• Find times within a certain range using the timerange or withtol functions.
• Match recurring units of time, such as days or months, using the components of datetime arrays.
• Resample or group data with the retime function.
For example, read a sample file outages.csv, containing data representing electric utility outages
in the United States from 2002–2014. The vector of row times, OutageTime, indicates when the
outages occurred. The readtimetable function imports it as a datetime array. Display the first five
rows.
TT = readtimetable('outages.csv');
head(TT,5)
ans=5×5 timetable
OutageTime Region Loss Customers RestorationTime Cause
________________ _____________ ______ __________ ________________ ____________
Before R2019a, read tabular data with readtable and convert it to a timetable using
table2timetable.
To find data in a specific range, you can use the timerange function, which defines time-based
subscripts for indexing. For instance, define a range for the summer of 2008, which started on June
20 and ended on September 21. By default, timerange defines a half-open interval that is closed on
the left and open on the right, so specify the end date as September 22.
TR = timerange("2008-06-20","2008-09-22")
TR =
timetable timerange subscript:
Find the outages that occurred in that range, and then plot the number of customers affected over
time.
summer08 = TT(TR,:);
stem(summer08.OutageTime,summer08.Customers)
ylabel("Customers")
10-19
10 Timetables
Several outages during that time range had high customer impact. Expand the range to a time period
that spans the entire year of 2008 and look for similarly high numbers.
TR = timerange("2008","years");
all08 = TT(TR,:);
high08 = all08(all08.Customers > 500000,:);
stem(high08.OutageTime,high08.Customers)
ylabel('Customers')
10-20
Select Times in Timetable
The timerange function is also helpful for selecting specific dates. Selecting times by comparing
datetime values can give misleading results because all datetime values include both date and
time components. However, when you specify only the date component of a datetime value, the time
component is set to midnight. Therefore, although there is data from June 26, a comparison like this
one returns no results.
any(summer08.OutageTime == datetime("2008-06-26"))
ans = logical
0
TR = timerange("2008-06-26","days");
june26 = summer08(TR,:)
june26=1×5 timetable
OutageTime Region Loss Customers RestorationTime Cause
________________ _____________ ______ _________ ________________ _____________
Another way to define a range is to specify a tolerance around a time using withtol. For example,
find rows from the summer of 2008 where OutageTime is within three days of Labor Day, September
1.
10-21
10 Timetables
WT = withtol("2008-09-01",days(3));
nearSep1 = summer08(WT,:)
nearSep1=4×5 timetable
OutageTime Region Loss Customers RestorationTime Cause
________________ _____________ ______ _________ ________________ _____________
You also can use units of datetime values, such as hours or days, to identify rows for logical
indexing. This method can be useful for specifying periodic intervals.
For example, find the values of OutageTime whose month components have values of 3 or less,
corresponding to January, February, and March of each year. Use the resulting logical array to index
into TT.
head(winterTT,5)
ans=5×5 timetable
OutageTime Region Loss Customers RestorationTime Cause
________________ _____________ ______ __________ ________________ ____________
Create a pie chart of the wintertime causes. The pie function accepts only numeric or categorical
inputs, so first convert Cause to categorical.
winterTT.Cause = categorical(winterTT.Cause);
pie(winterTT.Cause)
title("Causes of Outages, January to March");
10-22
Select Times in Timetable
The retime function adjusts row times to create specified intervals, either by resampling or grouping
values. Its pre-defined intervals range from seconds to years, and you can specify how to handle
missing or multiple values for the intervals. For instance, you can select the first observation from
each week, or count observations in a quarter.
For the outage data, you can use retime to find totals for each year. First, create a timetable with
only numeric variables. Then, call retime and specify a yearly interval, combining multiple values
using a sum. The output has one row for each year, containing the total losses and total customers
affected during that year.
numTT = TT(:,vartype("numeric"));
numTT = retime(numTT,"yearly","sum");
head(numTT,5)
ans=5×2 timetable
OutageTime Loss Customers
________________ _____ __________
10-23
10 Timetables
bar(numTT.OutageTime,numTT.Customers)
xlabel("Year")
ylabel("Customers")
You can use the row times of a timetable with other datetime or duration values to perform
calculations. For example, calculate the durations of the power outages listed in the outage data.
Then calculate the monthly medians of the outage durations and plot them.
First add the outage durations to TT by subtracting the row times (which are the starts of power
outages) from RestorationTime (which are the ends of the power outages). Change the format of
OutageDuration to display the durations of the outages in days. Display the first five rows of TT.
TT.OutageDuration = TT.RestorationTime - TT.OutageTime;
TT.OutageDuration.Format = 'd';
head(TT,5)
ans=5×6 timetable
OutageTime Region Loss Customers RestorationTime Cause
________________ _____________ ______ __________ ________________ ____________
10-24
Select Times in Timetable
Create a timetable that has only the outage durations. Some rows of TT have missing values, NaT, for
the restoration times, leading to NaN values in OutageDuration. To remove the NaN values from
medianTT, use the rmmissing function. Then use retime to calculate the monthly median outage
duration. Display the first five rows of medianTT.
medianTT = TT(:,"OutageDuration");
medianTT = rmmissing(medianTT);
medianTT = retime(medianTT,'monthly',@median);
head(medianTT,5)
ans=5×1 timetable
OutageTime OutageDuration
________________ ______________
stairs(medianTT.OutageTime,medianTT.OutageDuration)
xlabel("Year")
ylabel("Median Duration (days)")
10-25
10 Timetables
See Also
categorical | timetable | retime | timerange | readtimetable | month | withtol |
rmmissing | vartype | datetime | duration | NaT
Related Examples
• “Create Timetables” on page 10-2
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-27
• “Access Data in Tables” on page 9-32
• “Calculations on Tables” on page 9-45
• “Compare Dates and Time” on page 7-33
• “Date and Time Arithmetic” on page 7-28
10-26
Clean Timetable with Missing, Duplicate, or Nonuniform Times
Also, some toolboxes have functions that work on regularly spaced time series data in the form of
numeric arrays. So the example also shows how to export the data from a timetable for use with other
functions.
There are a number of issues with row times that can make timetables irregular. The row times can
be missing. They can be out of order. They can be duplicates, creating multiple rows with the same
time that might have the same or different data. And even when they are present, sorted, and unique,
they can differ by time steps of different sizes.
Timetables provide a number of different ways to resolve missing, duplicate, or nonuniform times,
and to resample or aggregate data to create regular row times.
10-27
10 Timetables
Load Timetable
Load a sample timetable from the MAT-file badTimes that contains weather measurements taken
over several hours on June 9, 2016. The timetable TT includes temperature, rainfall, and wind speed
measurements taken at irregular times during that day.
load badTimes
TT
TT=12×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________
One way to begin is by finding and removing rows that have a NaT, or missing value, as the row time.
To find missing values in the vector of row times, use ismissing. The ismissing function returns a
logical vector that contains 1 wherever TT.Time has a missing value.
natRowTimes = ismissing(TT.Time)
0
0
0
0
1
0
0
0
0
0
⋮
To keep only those rows that do not have missing values as row times, index into TT using
~natRowTimes as row indices. Assign those rows to a new timetable, goodRowTimesTT.
goodRowTimesTT = TT(~natRowTimes,:)
goodRowTimesTT=11×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________
10-28
Clean Timetable with Missing, Duplicate, or Nonuniform Times
This method removes only the rows that have missing row times. The timetable variables still might
have missing data values. For example, the last row of goodRowTimesTT has NaN values for the Rain
and Windspeed variables.
As an alternative, you can remove both missing row times and missing data values at the same time
by using the rmmissing function. rmmissing removes any timetable rows that have missing row
times, missing data values, or both.
Display the missing row time and missing data values of TT.
TT
TT=12×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________
Remove all rows that have missing row times or data values. Assign the remaining rows to the
timetable goodValuesTT.
goodValuesTT = rmmissing(TT)
goodValuesTT=10×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________
10-29
10 Timetables
After dealing with missing values, you can go on to sort your timetable and then determine if the
sorted timetable is regular.
tf = issorted(goodValuesTT)
tf = logical
0
Since it is not, sort the timetable on its row times by using the sortrows function.
sortedTT = sortrows(goodValuesTT)
sortedTT=10×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________
Determine whether sortedTT is regular. A regular timetable has the same time interval between
consecutive row times. Even a sorted timetable can have time steps that are not uniform.
tf = isregular(sortedTT)
tf = logical
0
diff(sortedTT.Time)
10-30
Clean Timetable with Missing, Duplicate, or Nonuniform Times
00:00:00
00:00:00
00:00:00
01:04:47
00:00:00
00:00:00
Since the row times are sorted, this result shows that some row times are unique and some are
duplicates.
Timetables can have duplicate rows. Timetable rows are duplicates if they have the same row times
and the same data values. In this example, the last two rows of sortedTT are duplicate rows. (There
are other rows in sortedTT that have duplicate row times but differing data values.)
To remove the duplicate rows from sortedTT, use unique. The unique function returns the unique
rows and sorts them by their row times.
uniqueRowsTT = unique(sortedTT)
uniqueRowsTT=9×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________
Timetables can have rows with duplicate row times but different data values. In this example,
uniqueRowsTT has several rows with the same row times but different values.
Find the rows that have duplicate row times. First, sort the row times and find consecutive times that
have no difference between them. Times with no difference between them are the duplicates. Index
back into the vector of row times and return a unique set of times that identify the duplicate row
times in uniqueRowsTT.
dupTimes = sort(uniqueRowsTT.Time);
tf = (diff(dupTimes) == 0);
dupTimes = dupTimes(tf);
dupTimes = unique(dupTimes)
10-31
10 Timetables
To display the rows with duplicate row times, index into uniqueRowsTT using dupTimes. When you
index on times, the output timetable contains all rows with matching row times.
uniqueRowsTT(dupTimes,:)
ans=6×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________
When a timetable has rows with duplicate times, you might want to select particular rows and discard
the other rows having duplicate times. For example, you can select either the first or the last of the
rows with duplicate row times by using the unique and retime functions.
Select the first row from each set of rows that have duplicate times. To copy data from the first rows,
specify the 'firstvalue' method.
firstUniqueRowsTT = retime(uniqueRowsTT,uniqueTimes,'firstvalue')
firstUniqueRowsTT=5×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________
Select the last rows from each set of rows that have duplicate times. To copy data from the last rows,
specify the 'lastvalue' method.
lastUniqueRowsTT = retime(uniqueRowsTT,uniqueTimes,'lastvalue')
lastUniqueRowsTT=5×3 timetable
Time Temp Rain WindSpeed
____________________ ____ ____ _________
10-32
Clean Timetable with Missing, Duplicate, or Nonuniform Times
As a result, the last two rows of firstUniqueRowsTT and lastUniqueRowsTT have different values
in the Temp variable.
Another way to deal with data in the rows having duplicate times is to aggregate or combine the data
values in some way. For example, you can calculate the means of several measurements of the same
quantity taken at the same time.
Calculate the mean temperature, rainfall, and wind speed for rows with duplicate row times using the
retime function.
meanTT = retime(uniqueRowsTT,uniqueTimes,'mean')
meanTT=5×3 timetable
Time Temp Rain WindSpeed
____________________ _____ ____ _________
As a result, the last two rows of meanTT have mean temperatures in the Temp variable for the rows
with duplicate row times.
Finally, you can resample data from an irregular timetable to make it regular by using the retime
function. For example, you can interpolate the data from meanTT onto a regular hourly time vector.
To use linear interpolation, specify 'linear'. Each row time in hourlyTT begins on the hour, and
there is a one-hour interval between consecutive row times.
hourlyTT = retime(meanTT,'hourly','linear')
hourlyTT=6×3 timetable
Time Temp Rain WindSpeed
____________________ ______ ________ _________
10-33
10 Timetables
Instead of using a predefined time step such as 'hourly', you can specify a time step of your own.
To specify a time step of 30 minutes, use the 'regular' input argument and the 'TimeStep' name-
value argument. You can specify a time step of any size as a duration or calendarDuration value.
regularTT = retime(meanTT,'regular','linear','TimeStep',minutes(30))
regularTT=11×3 timetable
Time Temp Rain WindSpeed
____________________ ______ ________ _________
You can export the timetable data for use with functions to analyze data that is regularly spaced in
time. For example, the Econometrics Toolbox™ and the Signal Processing Toolbox™ have functions
you can use for further analysis on regularly spaced data.
Extract the timetable data as an array. You can use the Variables property to return the data as an
array, as long as the table variables have data types that allow them to be concatenated.
A = regularTT.Variables
A = 11×3
A2 = regularTT{:,:}
A2 = 11×3
10-34
Clean Timetable with Missing, Duplicate, or Nonuniform Times
See Also
timetable | table2timetable | retime | issorted | sortrows | unique | diff | isregular |
rmmissing | fillmissing
Related Examples
• “Create Timetables” on page 10-2
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Combine Timetables and Synchronize Their Data” on page 10-8
• “Retime and Synchronize Timetable Variables Using Different Methods” on page 10-14
• “Select Times in Timetable” on page 10-19
10-35
10 Timetables
For example, you can sort a timetable on its row times, on one or more of its data variables, or on row
times and data variables together.
Create a timetable using the timetable function. A timetable has row times along its first
dimension, labeling the rows. The row times are a property of the timetable, not a timetable variable.
Date = datetime(2016,7,[10;10;11;11;10;10;11;11]);
X = [1;1;1;1;2;2;2;2];
Y = {'a';'b';'a';'b';'a';'b';'a';'b'};
Z = [1;2;3;4;5;6;7;8];
TT = timetable(X,Y,Z,'RowTimes',Date)
TT=8×3 timetable
Time X Y Z
___________ _ _____ _
10-Jul-2016 1 {'a'} 1
10-Jul-2016 1 {'b'} 2
11-Jul-2016 1 {'a'} 3
11-Jul-2016 1 {'b'} 4
10-Jul-2016 2 {'a'} 5
10-Jul-2016 2 {'b'} 6
11-Jul-2016 2 {'a'} 7
11-Jul-2016 2 {'b'} 8
Rename the first dimension. By default, the name of the first dimension of a timetable is Time. You
can access the Properties.DimensionNames property to rename a dimension.
TT.Properties.DimensionNames{1} = 'Date';
TT.Properties.DimensionNames
As an alternative, you can specify the row times as the first input argument to timetable, without
specifying 'RowTimes'. The timetable function names the row times, or the first dimension, after
the first input argument, just as it names the timetable variables after the other input arguments.
TT = timetable(Date,X,Y,Z)
TT=8×3 timetable
Date X Y Z
___________ _ _____ _
10-36
Using Row Labels in Table and Timetable Operations
10-Jul-2016 1 {'a'} 1
10-Jul-2016 1 {'b'} 2
11-Jul-2016 1 {'a'} 3
11-Jul-2016 1 {'b'} 4
10-Jul-2016 2 {'a'} 5
10-Jul-2016 2 {'b'} 6
11-Jul-2016 2 {'a'} 7
11-Jul-2016 2 {'b'} 8
Sort the timetable by row times. To sort on row times, refer to the first dimension of the timetable by
name.
sortrows(TT,'Date')
ans=8×3 timetable
Date X Y Z
___________ _ _____ _
10-Jul-2016 1 {'a'} 1
10-Jul-2016 1 {'b'} 2
10-Jul-2016 2 {'a'} 5
10-Jul-2016 2 {'b'} 6
11-Jul-2016 1 {'a'} 3
11-Jul-2016 1 {'b'} 4
11-Jul-2016 2 {'a'} 7
11-Jul-2016 2 {'b'} 8
ans=8×3 timetable
Date X Y Z
___________ _ _____ _
10-Jul-2016 1 {'a'} 1
11-Jul-2016 1 {'a'} 3
10-Jul-2016 1 {'b'} 2
11-Jul-2016 1 {'b'} 4
10-Jul-2016 2 {'a'} 5
11-Jul-2016 2 {'a'} 7
10-Jul-2016 2 {'b'} 6
11-Jul-2016 2 {'b'} 8
ans=8×3 timetable
Date X Y Z
___________ _ _____ _
10-Jul-2016 1 {'a'} 1
10-Jul-2016 1 {'b'} 2
10-Jul-2016 2 {'a'} 5
10-37
10 Timetables
10-Jul-2016 2 {'b'} 6
11-Jul-2016 1 {'a'} 3
11-Jul-2016 1 {'b'} 4
11-Jul-2016 2 {'a'} 7
11-Jul-2016 2 {'b'} 8
When you group rows together using the rowfun, varfun, stack, and unstack functions, you can
specify row labels as grouping variables. When you join tables or timetable together using the join,
innerjoin, and outerjoin functions, you can specify row labels as key variables.
For example, you can perform an inner join two tables together, using row names and a table variable
together as key variables. An inner join keeps only those table rows that match with respect to the
key variables.
Create two tables of patient data. A table can have row names along its first dimension, labeling the
rows, but is not required to have them. Specify the last names of patients as the row names of the
tables. Add the first names of the patients as table variables.
A = table({'Michael';'Louis';'Alice';'Rosemary';'Julie'},[38;43;45;40;49],...
'VariableNames',{'FirstName' 'Age'},...
'RowNames',{'Garcia' 'Johnson' 'Wu' 'Jones' 'Picard'})
A=5×2 table
FirstName Age
____________ ___
Garcia {'Michael' } 38
Johnson {'Louis' } 43
Wu {'Alice' } 45
Jones {'Rosemary'} 40
Picard {'Julie' } 49
B = table({'Michael';'Beverly';'Alice'},...
[64;69;67],...
[119;163;133],...
[122 80; 109 77; 117 75],...
'VariableNames',{'FirstName' 'Height' 'Weight' 'BloodPressure'},...
'RowNames',{'Garcia' 'Johnson' 'Wu'})
B=3×4 table
FirstName Height Weight BloodPressure
___________ ______ ______ _____________
If a table has row names, then you can index into it by row name. Indexing by row names is a
convenient way to select rows of a table. Index into B by a patient's last name to retrieve information
about the patient.
B('Garcia',:)
10-38
Using Row Labels in Table and Timetable Operations
ans=1×4 table
FirstName Height Weight BloodPressure
___________ ______ ______ _____________
Perform an inner join on the two tables. Both tables use the last names of patients as row names, and
contain the first names as a table variable. Some patients in the two tables have matching last names
but different first names. To ensure that both last and first names match, use the row names and
FirstName as key variables. To specify the row names as a key or grouping variable, use the name of
the first dimension of the table. By default, the name of the first dimension is 'Row'.
C = innerjoin(A,B,'Keys',{'Row','FirstName'})
C=2×5 table
FirstName Age Height Weight BloodPressure
___________ ___ ______ ______ _____________
If you rename the first dimension of a table, then you can refer to the row names by that name
instead of using 'Row'. Perform the same inner join as above but use a different name to refer to the
row names.
A.Properties.DimensionNames
Change the name of the first dimension of the table by using its Properties.DimensionNames
property. Then use the new name as a key variable.
A.Properties.DimensionNames{1} = 'LastName';
A.Properties.DimensionNames
Perform an inner join on A and B using LastName and FirstName as key variables.
B.Properties.DimensionNames{1} = 'LastName';
D = innerjoin(A,B,'Keys',{'LastName','FirstName'})
D=2×5 table
FirstName Age Height Weight BloodPressure
___________ ___ ______ ______ _____________
10-39
10 Timetables
• You cannot stack or unstack row labels using the stack and unstack functions. However, you can
use row labels as grouping variables.
• You cannot perform a join using the join, innerjoin, or outerjoin functions when the first
argument is a table and the second argument is a timetable. However, you can perform a join
when both arguments are tables, both are timetables, or the first argument is a timetable and the
second is a table.
• The output of a join operation can have row labels if you specify row labels as key variables. For
more details on row labels from a join operation, see the documentation on the 'Keys',
'LeftKeys', and 'RightKeys' arguments of the join, innerjoin, and outerjoin functions.
See Also
sortrows | join | innerjoin | outerjoin | varfun | rowfun | stack | unstack
10-40
Loma Prieta Earthquake Analysis
The file quake.mat contains 200Hz data from the October 17, 1989 Loma Prieta earthquake in the
Santa Cruz Mountains. The data are courtesy of Joel Yellin at the Charles F. Richter Seismological
Laboratory, University of California, Santa Cruz.
In the workspace there are three variables, containing time traces from an accelerometer located in
the Natural Sciences building at UC Santa Cruz. The accelerometer recorded the main shock
amplitude of the earthquake wave. The variables n, e, v refer to the three directional components
measured by the instrument, which was aligned parallel to the fault, with its N direction pointing in
the direction of Sacramento. The data are uncorrected for the response of the instrument.
Create a variable, Time, containing the timestamps sampled at 200Hz with the same length as the
other vectors. Represent the correct units with the seconds function and multiplication to achieve
the Hz (s−1) sampling rate. This results in a duration variable which is useful for representing
elapsed time.
Time = (1/200)*seconds(1:length(e))';
whos Time
Separate variables can be organized in a table or timetable for more convenience. A timetable
provides flexibility and functionality for working with time-stamped data. Create a timetable with
the time and three acceleration variables and supply more meaningful variable names. Display the
first eight rows using the head function.
varNames = {'EastWest', 'NorthSouth', 'Vertical'};
quakeData = timetable(Time, e, n, v, 'VariableNames', varNames);
head(quakeData)
ans=8×3 timetable
Time EastWest NorthSouth Vertical
_________ ________ __________ ________
0.005 sec 5 3 0
0.01 sec 5 3 0
0.015 sec 5 2 0
10-41
10 Timetables
0.02 sec 5 2 0
0.025 sec 5 2 0
0.03 sec 5 2 0
0.035 sec 5 1 0
0.04 sec 5 1 0
Explore the data by accessing the variables in the timetable with dot subscripting. (For more
information on dot subscripting, see Access Data in a Table.) We chose "East-West" amplitude and
plot it as function of the duration.
plot(quakeData.Time,quakeData.EastWest)
title('East-West Acceleration')
Scale Data
Scale the data by the gravitational acceleration, or multiply each variable in the table by the constant.
Since the variables are all of the same type (double), you can access all variables using the
dimension name, Variables. Note that quakeData.Variables provides a direct way to modify the
numerical values within the timetable.
quakeData.Variables = 0.098*quakeData.Variables;
We are interested in the time region where the amplitude of the shockwave starts to increase from
near zero to maximum levels. Visual inspection of the above plot shows that the time interval from 8
10-42
Loma Prieta Earthquake Analysis
to 15 seconds is of interest. For better visualization we draw black lines at the selected time spots to
draw attention to that interval. All subsequent calculations will involve this interval.
t1 = seconds(8)*[1;1];
t2 = seconds(15)*[1;1];
hold on
plot([t1 t2],ylim,'k','LineWidth',2)
hold off
Create another timetable with data in this interval. Use timerange to select the rows of interest.
tr = timerange(seconds(8),seconds(15));
dataOfInterest = quakeData(tr,:);
head(dataOfInterest)
ans=8×3 timetable
Time EastWest NorthSouth Vertical
_________ ________ __________ ________
10-43
10 Timetables
figure
subplot(3,1,1)
plot(dataOfInterest.Time,dataOfInterest.EastWest)
ylabel('East-West')
title('Acceleration')
subplot(3,1,2)
plot(dataOfInterest.Time,dataOfInterest.NorthSouth)
ylabel('North-South')
subplot(3,1,3)
plot(dataOfInterest.Time,dataOfInterest.Vertical)
ylabel('Vertical')
To display statistical information about the data we use the summary function.
summary(dataOfInterest)
RowTimes:
10-44
Loma Prieta Earthquake Analysis
Variables:
Values:
Min -255.09
Median -0.098
Max 244.51
Values:
Min -198.55
Median 1.078
Max 204.33
Values:
Min -157.88
Median 0.98
Max 134.46
Additional statistical information about the data can be calculated using varfun.This is useful for
applying functions to each variable in a table or timetable. The function to apply is passed to varfun
as a function handle. Below we apply the mean function to all three variables and output the result in
format of a table, since the time is not meaningful after computing the temporal means.
mn = varfun(@mean,dataOfInterest,'OutputFormat','table')
mn=1×3 table
mean_EastWest mean_NorthSouth mean_Vertical
_____________ _______________ _____________
To identify the speed of propagation of the shockwave, we integrate the accelerations once. We use
cumulative sums along the time variable to get the velocity of the wave front.
edot = (1/200)*cumsum(dataOfInterest.EastWest);
edot = edot - mean(edot);
Below we perform the integration on all three variables to calculate the velocity. It is convenient to
create a function and apply it to the variables in the timetable with varfun. In this example, we
included the function at the end of this file and named it velFun.
vel = varfun(@velFun,dataOfInterest);
head(vel)
10-45
10 Timetables
ans=8×3 timetable
Time velFun_EastWest velFun_NorthSouth velFun_Vertical
_________ _______________ _________________ _______________
Apply the same function velFun to the velocities to determine the position.
pos = varfun(@velFun,vel);
head(pos)
ans=8×3 timetable
Time velFun_velFun_EastWest velFun_velFun_NorthSouth velFun_velFun_Vertical
_________ ______________________ ________________________ ______________________
Notice how the variable names in the timetable created by varfun include the name of the function
used. It is useful to track the operations that have been performed on the original data. Adjust the
variable names back to their original values using dot notation.
pos.Properties.VariableNames = varNames;
Below we plot the 3 components of the velocity and position for the time interval of interest.
figure
subplot(2,1,1)
plot(vel.Time,vel.Variables)
legend(quakeData.Properties.VariableNames,'Location','NorthWest')
title('Velocity')
subplot(2,1,2)
plot(vel.Time,pos.Variables)
legend(quakeData.Properties.VariableNames,'Location','NorthWest')
title('Position')
10-46
Loma Prieta Earthquake Analysis
Visualize Trajectories
The trajectories can be plotted in 2D or 3D by using the component value. In the following we will
show different ways of visualizing this data.
Begin with 2-dimensional projections. Here is the first with a few values of time annotated.
figure
plot(pos.NorthSouth,pos.Vertical)
xlabel('North-South')
ylabel('Vertical')
% Select locations and label
nt = ceil((max(pos.Time) - min(pos.Time))/6);
idx = find(fix(pos.Time/nt) == (pos.Time/nt))';
text(pos.NorthSouth(idx),pos.Vertical(idx),char(pos.Time(idx)))
10-47
10 Timetables
Use plotmatrix to visualize a grid of scatter plots of all variables against one another and
histograms of each variable on the diagonal. The output variable Ax, represents each axes in the grid
and can be used to identify which axes to label using xlabel and ylabel.
figure
[S,Ax] = plotmatrix(pos.Variables);
for ii = 1:length(varNames)
xlabel(Ax(end,ii),varNames{ii})
ylabel(Ax(ii,1),varNames{ii})
end
10-48
Loma Prieta Earthquake Analysis
Plot a 3-D view of the trajectory and plot a dot at every tenth position point. The spacing between
dots indicates the velocity.
step = 10;
figure
plot3(pos.NorthSouth,pos.EastWest,pos.Vertical,'r')
hold on
plot3(pos.NorthSouth(1:step:end),pos.EastWest(1:step:end),pos.Vertical(1:step:end),'.')
hold off
box on
axis tight
xlabel('North-South')
ylabel('East-West')
zlabel('Vertical')
title('Position')
10-49
10 Timetables
Supporting Functions
function y = velFun(x)
y = (1/200)*cumsum(x);
y = y - mean(y);
end
See Also
timetable | head | summary | varfun | duration | seconds | timerange
Related Examples
• “Represent Dates and Times in MATLAB” on page 7-2
• “Create Timetables” on page 10-2
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-27
• “Select Times in Timetable” on page 10-19
• “Access Data in Tables” on page 9-32
10-50
Preprocess and Explore Time-stamped Data Using timetable
This example shows how to perform a variety of data cleaning, munging, and preprocessing tasks
such as removing missing values and synchronizing time-stamped data with different timesteps. In
addition, data exploration is highlighted including visualizations and grouped calculations using the
timetable data container to:
Import a sample of the bicycle traffic data from a comma-separated text file. The readtable function
returns the data in a table. Display the first eight rows using the head function.
bikeTbl = readtable('BicycleCounts.csv');
head(bikeTbl)
ans=8×5 table
Timestamp Day Total Westbound Eastbound
___________________ _____________ _____ _________ _________
The data have timestamps, so it is convenient to use a timetable to store and analyze the data. A
timetable is similar to a table, but includes timestamps that are associated with the rows of data. The
timestamps, or row times, are represented by datetime or duration values. datetime and
duration are the recommended data types for representing points in time or elapsed times,
respectively.
Convert bikeTbl into a timetable using the table2timetable function. You must use a conversion
function because readtable returns a table. table2timetable converts the first datetime or
duration variable in the table into the row times of a timetable. The row times are metadata that
label the rows. However, when you display a timetable, the row times and timetable variables are
displayed in a similar fashion. Note that the table has five variables whereas the timetable has four.
bikeData = table2timetable(bikeTbl);
head(bikeData)
ans=8×4 timetable
Timestamp Day Total Westbound Eastbound
10-51
10 Timetables
Convert the Day variable to categorical. The categorical data type is designed for data that consists
of a finite set of discrete values, such as the names of the days of the week. List the categories so
they display in day order. Use dot subscripting to access variables by name.
bikeData.Day = categorical(bikeData.Day,{'Sunday','Monday','Tuesday',...
'Wednesday','Thursday','Friday','Saturday'});
In a timetable, the times are treated separately from the data variables. Access the Properties of
the timetable to show that the row times are the first dimension of the timetable, and the variables
are the second dimension. The DimensionNames property shows the names of the two dimensions,
while the VariableNames property shows the names of the variables along the second dimension.
bikeData.Properties
ans =
TimetableProperties with properties:
Description: ''
UserData: []
DimensionNames: {'Timestamp' 'Variables'}
VariableNames: {'Day' 'Total' 'Westbound' 'Eastbound'}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowTimes: [9387x1 datetime]
StartTime: 2015-06-24 00:00:00
SampleRate: NaN
TimeStep: NaN
CustomProperties: No custom properties are set.
Use addprop and rmprop to modify CustomProperties.
By default, table2timetable assigned Timestamp as the first dimension name when it converted
the table to a timetable, since this was the variable name from the original table. You can change the
names of the dimensions, and other timetable metadata, through the Properties.
10-52
Preprocess and Explore Time-stamped Data Using timetable
ans =
TimetableProperties with properties:
Description: ''
UserData: []
DimensionNames: {'Time' 'Data'}
VariableNames: {'Day' 'Total' 'Westbound' 'Eastbound'}
VariableDescriptions: {}
VariableUnits: {}
VariableContinuity: []
RowTimes: [9387x1 datetime]
StartTime: 2015-06-24 00:00:00
SampleRate: NaN
TimeStep: NaN
CustomProperties: No custom properties are set.
Use addprop and rmprop to modify CustomProperties.
ans=8×4 timetable
Time Day Total Westbound Eastbound
___________________ _________ _____ _________ _________
Determine the number of days that elapsed between the latest and earliest row times. The variables
can be accessed by dot notation when referencing variables one at a time.
elapsedTime = max(bikeData.Time) - min(bikeData.Time)
elapsedTime = duration
9383:30:00
elapsedTime.Format = 'd'
elapsedTime = duration
390.98 days
To examine the typical bicycle counts on a given day, calculate the means for the total number of
bikes, and the numbers travelling westbound and eastbound.
Return the numeric data as a matrix by indexing into the contents of bikeData using curly braces.
Display the first eight rows. Use standard table subscripting to access multiple variables.
10-53
10 Timetables
counts = bikeData{:,2:end};
counts(1:8,:)
ans = 8×3
13 9 4
3 3 0
1 1 0
1 1 0
1 1 0
7 3 4
36 6 30
141 13 128
Since the mean is appropriate for only the numeric data, you can use the vartype function to select
the numeric variables. vartype can be more convenient than manually indexing into a table or
timetable to select variables. Calculate the means and omit NaN values.
counts = bikeData{:,vartype('numeric')};
mean(counts,'omitnan')
ans = 1×3
To determine how many people bicycle during a holiday, examine the data on the 4th of July holiday.
Index into the timetable by row times for July 4, 2015. When you index on row times, you must match
times exactly. You can specify the time indices as datetime or duration values, or as character
vectors that can be converted to dates and times. You can specify multiple times as an array.
Index into bikeData with specific dates and times to extract data for July 4, 2015. If you specify the
date only, then the time is assumed to be midnight, or 00:00:00.
bikeData('2015-07-04',:)
ans=1×4 timetable
Time Day Total Westbound Eastbound
___________________ ________ _____ _________ _________
ans=2×4 timetable
Time Day Total Westbound Eastbound
___________________ ________ _____ _________ _________
10-54
Preprocess and Explore Time-stamped Data Using timetable
It would be tedious to use this strategy to extract the entire day. You can also specify ranges of time
without indexing on specific times. To create a time range subscript as a helper, use the timerange
function.
Subscript into the timetable using a time range for the entire day of July 4, 2015. Specify the start
time as midnight on July 4, and the end time as midnight on July 5. By default, timerange covers all
times starting with the start time and up to, but not including, the end time. Plot the bicycle counts
over the course of the day.
tr = timerange('2015-07-04','2015-07-05');
jul4 = bikeData(tr,'Total');
head(jul4)
ans=8×1 timetable
Time Total
___________________ _____
2015-07-04 00:00:00 8
2015-07-04 01:00:00 13
2015-07-04 02:00:00 4
2015-07-04 03:00:00 1
2015-07-04 04:00:00 0
2015-07-04 05:00:00 1
2015-07-04 06:00:00 8
2015-07-04 07:00:00 16
bar(jul4.Time,jul4.Total)
ylabel('Bicycle Counts')
title('Bicycle Counts on July 4, 2015')
10-55
10 Timetables
From the plot, there is more volume throughout the day, leveling off in the afternoon. Because many
businesses are closed, the plot does not show typical traffic during commute hours. Spikes later in
the evening can be attributed to celebrations with fireworks, which occur after dark. To examine
these trends more closely, the data should be compared to data for typical days.
Compare the data for July 4 to data for the rest of the month of July.
jul = bikeData(timerange('2015-07-01','2015-08-01'),:);
plot(jul.Time,jul.Total)
hold on
plot(jul4.Time,jul4.Total)
ylabel('Total Count')
title('Bicycle Counts in July')
hold off
legend('Bicycle Count','July 4 Bicycle Count')
10-56
Preprocess and Explore Time-stamped Data Using timetable
The plot shows variations that can be attributed to traffic differences between weekdays and
weekends. The traffic patterns for July 4 and 5 are consistent with the pattern for weekend traffic.
July 5 is a Monday but is often observed as a holiday. These trends can be examined more closely with
further preprocessing and analysis.
Time-stamped data sets are often messy and may contain anomalies or errors. Timetables are well
suited for resolving anomalies and errors.
A timetable does not have to have its row times in any particular order. It can contain rows that are
not sorted by their row times. A timetable can also contain multiple rows with the same row time,
though the rows can have different data values. Even when row times are sorted and unique, they can
differ by time steps of different sizes. A timetable can even contain NaT or NaN values to indicate
missing row times.
The timetable data type provides a number of different ways to resolve missing, duplicate, or
nonuniform times. You can also resample or aggregate data to create a regular timetable. When a
timetable is regular, it has row times that are sorted and unique, and have a uniform or evenly spaced
time step between them.
10-57
10 Timetables
• To make a timetable with unique and sorted row times, use unique and retime.
• To make a regular timetable, specify a uniformly spaced time vector and use retime.
Determine if the timetable is sorted. A timetable is sorted if its row times are listed in ascending
order.
issorted(bikeData)
ans = logical
0
Sort the timetable. The sortrows function sorts the rows by their row times, from earliest to latest
time. If there are rows with duplicate row times, then sortrows copies all the duplicates to the
output.
bikeData = sortrows(bikeData);
issorted(bikeData)
ans = logical
1
A timetable can have missing data indicators in its variables or its row times. For example, you can
indicate missing numeric values as NaNs, and missing datetime values as NaTs. You can assign, find,
10-58
Preprocess and Explore Time-stamped Data Using timetable
remove, and fill missing values with the standardizeMissing, ismissing, rmmissing, and
fillmissing functions, respectively.
Find and count the missing values in the timetable variables. In this example, missing values indicate
circumstances when no data were collected.
missData = ismissing(bikeData);
sum(missData)
ans = 1×4
1 3 3 3
The output from ismissing is a logical matrix, the same size as the table, identifying missing data
values as true. Display any rows which have missing data indicators.
idx = any(missData,2);
bikeData(idx,:)
ans=3×4 timetable
Time Day Total Westbound Eastbound
___________________ ___________ _____ _________ _________
ismissing(bikeData) finds missing data in the timetable variables only, not the times. To find
missing row times, call ismissing on the row times.
missTimes = ismissing(bikeData.Time);
bikeData(missTimes,:)
ans=2×4 timetable
Time Day Total Westbound Eastbound
____ ___________ _____ _________ _________
In this example, missing times or data values indicate measurement errors and can be excluded.
Remove rows of the table containing missing data values and missing row times using rmmissing.
bikeData = rmmissing(bikeData);
sum(ismissing(bikeData))
ans = 1×4
0 0 0 0
sum(ismissing(bikeData.Time))
ans = 0
10-59
10 Timetables
Determine if there are duplicate times and/or duplicate rows of data. You might want to exclude exact
duplicates, as these can also be considered measurement errors. Identify duplicate times by finding
where the difference between the sorted times is exactly zero.
idx = diff(bikeData.Time) == 0;
dup = bikeData.Time(idx)
Three times are repeated and November 19, 2015 is repeated twice. Examine the data associated
with the repeated times.
bikeData(dup(1),:)
ans=2×4 timetable
Time Day Total Westbound Eastbound
___________________ ______ _____ _________ _________
bikeData(dup(2),:)
ans=3×4 timetable
Time Day Total Westbound Eastbound
___________________ ________ _____ _________ _________
The first has duplicated times but non-duplicate data, whereas the others are entirely duplicated.
Timetable rows are considered duplicates when they contain identical row times and identical data
values across the rows. You can use unique to remove duplicate rows in the timetable. The unique
function also sorts the rows by their row times.
bikeData = unique(bikeData);
The rows with duplicate times but non-duplicate data require some interpretation. Examine the data
around those times.
d = dup(1) + hours(-2:2);
bikeData(d,:)
ans=5×4 timetable
Time Day Total Westbound Eastbound
___________________ ________ _____ _________ _________
10-60
Preprocess and Explore Time-stamped Data Using timetable
In this case, the duplicate time may have been mistaken since the data and surrounding times are
consistent. Though it appears to represent 01:00:00, it is uncertain what time this should have been.
The data can be accumulated to account for the data at both time points.
sum(bikeData{dup(1),2:end})
ans = 1×3
25 16 9
This is only one case which can be done manually. However, for many rows, the retime function can
perform this calculation. Accumulate the data for the unique times using the sum function to
aggregate. The sum is appropriate for numeric data but not the categorical data in the timetable. Use
vartype to identify the numeric variables.
vt = vartype('numeric');
t = unique(bikeData.Time);
numData = retime(bikeData(:,vt),t,'sum');
head(numData)
ans=8×3 timetable
Time Total Westbound Eastbound
___________________ _____ _________ _________
2015-06-24 00:00:00 13 9 4
2015-06-24 01:00:00 3 3 0
2015-06-24 02:00:00 1 1 0
2015-06-24 03:00:00 1 1 0
2015-06-24 04:00:00 1 1 0
2015-06-24 05:00:00 7 3 4
2015-06-24 06:00:00 36 6 30
2015-06-24 07:00:00 141 13 128
You cannot sum the categorical data, but since one label represents the whole day, take the first value
on each day. You can perform the retime operation again with the same time vector and concatenate
the timetables together.
vc = vartype('categorical');
catData = retime(bikeData(:,vc),t,'firstvalue');
bikeData = [catData,numData];
bikeData(d,:)
ans=4×4 timetable
Time Day Total Westbound Eastbound
___________________ ________ _____ _________ _________
10-61
10 Timetables
The data appear to have a uniform time step of one hour. To determine if this is true for all the row
times in the timetable, use the isregular function. isregular returns true for sorted, evenly-
spaced times (monotonically increasing), with no duplicate or missing times (NaT or NaN).
isregular(bikeData)
ans = logical
0
The output of 0, or false, indicates that the times in the timetable are not evenly spaced. Explore
the time interval in more detail.
dt = diff(bikeData.Time);
[min(dt); max(dt)]
To put the timetable on a regular time interval, use retime or synchronize and specify the time
interval of interest.
Determine the counts per day using the retime function. Accumulate the count data for each day
using the sum method. This is appropriate for numeric data but not the categorical data in the
timetable. Use vartype to identify the variables by data type.
dayCountNum = retime(bikeData(:,vt),'daily','sum');
head(dayCountNum)
ans=8×3 timetable
Time Total Westbound Eastbound
___________________ _____ _________ _________
As above, you can perform the retime operation again to represent the categorical data using an
appropriate method and concatenate the timetables together.
dayCountCat = retime(bikeData(:,vc),'daily','firstvalue');
dayCount = [dayCountCat,dayCountNum];
head(dayCount)
ans=8×4 timetable
Time Day Total Westbound Eastbound
10-62
Preprocess and Explore Time-stamped Data Using timetable
Examine the effect of weather on cycling behavior by comparing the bicycle count with weather data.
Load the weather timetable which includes historical weather data from Boston, MA including storm
events.
load BostonWeatherData
head(weatherData)
ans=8×3 timetable
Time TemperatureF Humidity Events
___________ ____________ ________ ____________
01-Jul-2015 72 78 Thunderstorm
02-Jul-2015 72 60 None
03-Jul-2015 70 56 None
04-Jul-2015 67 75 None
05-Jul-2015 72 67 None
06-Jul-2015 74 69 None
07-Jul-2015 75 77 Rain
08-Jul-2015 79 68 Rain
To summarize the times and variables in the timetable, use the summary function.
summary(weatherData)
RowTimes:
Variables:
Values:
Min 2
Median 55
Max 85
10-63
10 Timetables
Values:
Min 29
Median 64
Max 97
Values:
Fog 7
Hail 1
Rain 108
Rain-Snow 4
Snow 18
Thunderstorm 12
None 233
Combine the bicycle data with the weather data to a common time vector using synchronize. You
can resample or aggregate timetable data using any of the methods documented on the reference
page for the synchronize function.
Synchronize the data from both timetables to a common time vector, constructed from the
intersection of their individual daily time vectors.
data = synchronize(dayCount,weatherData,'intersection');
head(data)
ans=8×7 timetable
Time Day Total Westbound Eastbound TemperatureF Humidi
___________________ _________ _____ _________ _________ ____________ ______
Compare bicycle traffic counts and outdoor temperature on separate y axes to examine the trends.
Remove the weekends from the data for visualization.
idx = ~isweekend(data.Time);
weekdayData = data(idx,{'TemperatureF','Total'});
figure
yyaxis left
plot(weekdayData.Time, weekdayData.Total)
ylabel('Bicycle Count')
yyaxis right
plot(weekdayData.Time,weekdayData.TemperatureF)
ylabel('Temperature (\circ F)')
title('Bicycle Counts and Temperature Over Time')
xlim([min(data.Time) max(data.Time)])
10-64
Preprocess and Explore Time-stamped Data Using timetable
The plot shows that the traffic and weather data might follow similar trends. Zoom in on the plot.
xlim([datetime('2015-11-01'),datetime('2016-05-01')])
10-65
10 Timetables
The trends are similar, indicating that fewer people cycle on colder days.
Examine the data based on different intervals such as day of the week and time of day. Determine the
total counts per day using varfun to perform grouped calculations on variables. Specify the sum
function with a function handle and the grouping variable and preferred output type using name-
value pairs.
byDay = varfun(@sum,bikeData,'GroupingVariables','Day',...
'OutputFormat','table')
byDay=7×5 table
Day GroupCount sum_Total sum_Westbound sum_Eastbound
_________ __________ _________ _____________ _____________
figure
bar(byDay{:,{'sum_Westbound','sum_Eastbound'}})
legend({'Westbound','Eastbound'},'Location','eastoutside')
10-66
Preprocess and Explore Time-stamped Data Using timetable
xticklabels({'Sun','Mon','Tue','Wed','Thu','Fri','Sat'})
title('Bicycle Count by Day of Week')
The bar plot indicates that traffic is heavier on weekdays. Also, there is a difference in the Eastbound
and Westbound directions. This might indicate that people tend to take different routes when
entering and leaving the city. Another possibility is that some people enter on one day and return on
another day.
Determine the hour of day and use varfun for calculations by group.
bikeData.HrOfDay = hour(bikeData.Time);
byHr = varfun(@mean,bikeData(:,{'Westbound','Eastbound','HrOfDay'}),...
'GroupingVariables','HrOfDay','OutputFormat','table');
head(byHr)
ans=8×4 table
HrOfDay GroupCount mean_Westbound mean_Eastbound
_______ __________ ______________ ______________
10-67
10 Timetables
bar(byHr{:,{'mean_Westbound','mean_Eastbound'}})
legend('Westbound','Eastbound','Location','eastoutside')
xlabel('Hour of Day')
ylabel('Bicycle Count')
title('Mean Bicycle Count by Hour of Day')
There are traffic spikes at the typical commute hours, around 9:00 a.m. and 5:00 p.m. Also, the trends
between the Eastbound and Westbound directions are different. In general, the Westbound direction
is toward residential areas surrounding the Cambridge area and toward the Universities. The
Eastbound direction is toward Boston.
The traffic is heavier later in the day in the Westbound direction compared to the Eastbound
direction. This might indicate university schedules and traffic due to restaurants in the area. Examine
the trend by day of week as well as hour of day.
byHrDay = varfun(@sum,bikeData,'GroupingVariables',{'HrOfDay','Day'},...
'OutputFormat','table');
head(byHrDay)
ans=8×6 table
HrOfDay Day GroupCount sum_Total sum_Westbound sum_Eastbound
_______ _________ __________ _________ _____________ _____________
10-68
Preprocess and Explore Time-stamped Data Using timetable
To arrange the timetable so that the days of the week are the variables, use the unstack function.
hrAndDayWeek = unstack(byHrDay(:,{'HrOfDay','Day','sum_Total'}),'sum_Total','Day');
head(hrAndDayWeek)
ans=8×8 table
HrOfDay Sunday Monday Tuesday Wednesday Thursday Friday Saturday
_______ ______ ______ _______ _________ ________ ______ ________
ribbon(hrAndDayWeek.HrOfDay,hrAndDayWeek{:,2:end})
ylim([0 24])
xlim([0 8])
xticks(1:7)
xticklabels({'Sun','Mon','Tue','Wed','Thu','Fri','Sat'})
ylabel('Hour')
title('Bicycle Count by Hour and Day of Week')
10-69
10 Timetables
There are similar trends for the regular work days of Monday through Friday, with peaks at rush hour
and traffic tapering off in the evening. Friday has less volume, though the overall trend is similar to
the other work days. The trends for Saturday and Sunday are similar to each other, without rush hour
peaks and with more volume later in the day. The late evening trends are also similar for Monday
through Friday, with less volume on Friday.
To examine the overall time of day trends, split up the data by rush hour times. It is possible to use
different times of day or units of time using the discretize function. For example, separate the data
into groups for AM, AMRush, Day, PMRush, PM. Then use varfun to calculate the mean by group.
bikeData.HrLabel = discretize(bikeData.HrOfDay,[0,6,10,15,19,24],'categorical',...
{'AM','RushAM','Day','RushPM','PM'});
byHrBin = varfun(@mean,bikeData(:,{'Total','HrLabel'}),'GroupingVariables','HrLabel',...
'OutputFormat','table')
byHrBin=5×3 table
HrLabel GroupCount mean_Total
_______ __________ __________
AM 2342 3.5508
RushAM 1564 94.893
Day 1955 45.612
RushPM 1564 98.066
PM 1955 35.198
10-70
Preprocess and Explore Time-stamped Data Using timetable
bar(byHrBin.mean_Total)
cats = categories(byHrBin.HrLabel);
xticklabels(cats)
title('Mean Bicycle Count During Rush Hours')
In general, there is about twice as much traffic in this area during the evening and morning rush
hours compared to other times of the day. There is very little traffic in this area in the early morning,
but there is still significant traffic in the evening and late evening, comparable to the day outside of
the morning and evening rush hours.
See Also
timetable | table2timetable | head | summary | varfun | timerange | sortrows | rmmissing
| retime | datetime | unstack
Related Examples
• “Represent Dates and Times in MATLAB” on page 7-2
• “Create Timetables” on page 10-2
• “Resample and Aggregate Data in Timetable” on page 10-5
• “Clean Timetable with Missing, Duplicate, or Nonuniform Times” on page 10-27
• “Select Times in Timetable” on page 10-19
10-71
11
Structures
Structure Arrays
When you have data that you want to organize by name, you can use structures to store it. Structures
store data in containers called fields, which you can then access by the names you specify. Use dot
notation to create, assign, and access data in structure fields. If the value stored in a field is an array,
then you can use array indexing to access elements of the array. When you store multiple structures
as a structure array, you can use array indexing and dot notation to access individual structures and
their fields.
Use dot notation to add the fields name, billing, and test, assigning data to each field. In this
example, the syntax patient.name creates both the structure and its first field. The commands that
follow add more fields.
patient.name = 'John Doe';
patient.billing = 127;
patient.test = [79 75 73; 180 178 177.5; 220 210 205]
11-2
Structure Arrays
billing: 512
test: [3x3 double]
With dot notation, you also can access the value of any field. For example, make a bar chart of the
values in patient.test. Add a title with the text in patient.name. If a field stores an array, then
this syntax returns the whole array.
bar(patient.test)
title("Test Results for " + patient.name)
To access part of an array stored in a field, add indices that are appropriate for the size and type of
the array. For example, create a bar chart of the data in one column of patient.test.
bar(patient.test(:,1))
11-3
11 Structures
For example, add a second structure to patients having data about a second patient. Also, assign
the original value of 127 to the billing field of the first structure. Since the array now has two
structures, you must access the first structure by indexing, as in patient(1).billing = 127.
As a result, patient is a 1-by-2 structure array with contents shown in the diagram.
11-4
Structure Arrays
Each patient record in the array is a structure of class struct. An array of structures is sometimes
referred to as a struct array. However, the terms struct array and structure array mean the same
thing. Like other MATLAB® arrays, a structure array can have any dimensions.
If you add a new structure to the array without specifying all of its fields, then the unspecified fields
contain empty arrays.
patient(3).name = 'New Name';
patient(3)
To index into a structure array, use array indexing. For example, patient(2) returns the second
structure.
patient(2)
To access a field, use array indexing and dot notation. For example, return the value of the billing
field for the second patient.
11-5
11 Structures
patient(2).billing
ans = 28.5000
You also can index into an array stored by a field. Create a bar chart displaying only the first two
columns of patient(2).test.
bar(patient(2).test(:,[1 2]))
Note You can index into part of a field only when you refer to a single element of a structure array.
MATLAB does not support statements such as patient(1:2).test(1:2,2:3), which attempt to
index into a field for multiple elements of the structure array. Instead, use the arrayfun function.
See Also
struct | fieldnames | isfield
Related Examples
• “Access Elements of a Nonscalar Structure Array” on page 11-13
• “Generate Field Names from Variables” on page 11-10
• “Create Cell Array” on page 12-3
• “Cell vs. Structure Arrays” on page 12-16
11-6
Structure Arrays
11-7
11 Structures
Concatenate Structures
This example shows how to concatenate structure arrays using the [] operator. To concatenate
structures, they must have the same set of fields, but the fields do not need to contain the same sizes
or types of data.
Create scalar (1-by-1) structure arrays struct1 and struct2, each with fields a and b:
struct1.a = 'first';
struct1.b = [1,2,3];
struct2.a = 'second';
struct2.b = rand(5);
struct1,struct2
Just as concatenating two scalar values such as [1,2] creates a 1-by-2 numeric array, concatenating
struct1 and struct2 creates a 1-by-2 structure array.
combined = [struct1,struct2]
When you want to access the contents of a particular field, specify the index of the structure in the
array. For example, access field a of the first structure.
combined(1).a
ans =
'first'
Concatenation also applies to nonscalar structure arrays. For example, create a 2-by-2 structure
array named new. Because the 1-by-2 structure combined and the 2-by-2 structure new both have
two columns, you can concatenate them vertically with a semicolon separator.
new(1,1).a = 1;
new(1,1).b = 10;
new(1,2).a = 2;
new(1,2).b = 20;
new(2,1).a = 3;
new(2,1).b = 30;
new(2,2).a = 4;
new(2,2).b = 40;
11-8
Concatenate Structures
Access field a of the structure larger(2,1). It contains the same value as new(1,1).a.
larger(2,1).a
ans = 1
See Also
Related Examples
• “Creating, Concatenating, and Expanding Matrices”
• “Structure Arrays” on page 11-2
• “Access Elements of a Nonscalar Structure Array” on page 11-13
11-9
11 Structures
structName.(dynamicExpression)
currentDate = datestr(now,'mmmdd');
myStruct.(currentDate) = [1,2,3]
If the current date reported by your system is February 29, then this code assigns data to a field
named Feb29:
myStruct =
Feb29: [1 2 3]
The dynamic fieldname can return either a character vector or a string scalar. For example, you can
specify the field Feb29 using either single or, starting in R2017b, double quotes.
myStruct.('Feb29')
ans =
1 2 3
myStruct.("Feb29")
ans =
1 2 3
Field names, like variable names, must begin with a letter, can contain letters, digits, or underscore
characters, and are case sensitive. To avoid potential conflicts, do not use the names of existing
variables or functions as field names.
See Also
struct | fieldnames | getfield | setfield
Related Examples
• “Variable Names” on page 1-5
• “Structure Arrays” on page 11-2
11-10
Access Data in Nested Structures
structName(index).nestedStructName(index).fieldName(indices)
When a structure is scalar (1-by-1), you do not need to include the indices to refer to the single
element. For example, create a scalar structure s, where field n is a nested scalar structure with
fields a, b, and c:
s.n.a = ones(3);
s.n.b = eye(4);
s.n.c = magic(5);
third_row_b = s.n.b(3,:)
third_row_b =
0 0 1 0
s(1).n(2).a = 2*ones(3);
s(1).n(2).b = 2*eye(4);
s(1).n(2).c = 2*magic(5);
s(2).n(1).a = '1a';
s(2).n(2).a = '2a';
s(2).n(1).b = '1b';
s(2).n(2).b = '2b';
s(2).n(1).c = '1c';
s(2).n(2).c = '2c';
Access part of the array in field b of the second element in n within the first element of s:
part_two_eye = s(1).n(2).b(1:2,1:2)
part_two_eye =
2 0
0 2
See Also
struct | setfield | getfield
11-11
11 Structures
Related Examples
• “Structure Arrays” on page 11-2
• “Ways to Organize Data in Structure Arrays” on page 11-15
11-12
Access Elements of a Nonscalar Structure Array
Although each structure in the array must have the same number of fields and the same field names,
the contents of the fields can be different types and sizes. When you refer to field f for multiple
elements of the structure array, such as
s(1:3).f
or
s.f
MATLAB returns the data from the elements in a comma-separated list, which displays as follows:
ans =
1
ans =
two
ans =
3 3 3
3 3 3
3 3 3
You cannot assign the list to a single variable with the syntax v = s.f because the fields can contain
different types of data. However, you can assign the list items to the same number of variables, such
as
[v1, v2, v3] = s.f;
If all of the fields contain the same type of data and can form a hyperrectangle, you can concatenate
the list items. For example, create a structure nums with scalar numeric values in field f, and
concatenate the data from the fields:
nums(1).f = 1;
nums(2).f = 2;
nums(3).f = 3;
allNums = [nums.f]
11-13
11 Structures
If you want to process each element of an array with the same operation, use the arrayfun function.
For example, count the number of elements in field f of each structure in array s:
The syntax @(x) creates an anonymous function. This code calls the numel function for each element
of array s, such as numel(s(1).f), and returns
numElements =
1 3 9
11-14
Ways to Organize Data in Structure Arrays
Plane organization allows easier access to all values within a field. Element-by-element organization
allows easier access to all information related to a single element or record. The following sections
include an example of each type of organization:
When you create a structure array, MATLAB stores information about each element and field in the
array header. As a result, structures with more elements and fields require more memory than
simpler structures that contain the same data.
Plane Organization
Consider an RGB image with three arrays corresponding to color intensity values.
If you have arrays RED, GREEN, and BLUE in your workspace, then these commands create a scalar
structure named img that uses plane organization:
img.red = RED;
img.green = GREEN;
img.blue = BLUE;
Plane organization allows you to easily extract entire image planes for display, filtering, or other
processing. For example, multiply the red intensity values by 0.9:
11-15
11 Structures
adjustedRed = .9 * img.red;
If you have multiple images, you can add them to the img structure, so that each element
img(1),...,img(n) contains an entire image. For an example that adds elements to a structure,
see the following section.
Element-by-Element Organization
Consider a database with patient information. Each record contains data for the patient’s name, test
results, and billing amount.
Additional patients correspond to new elements in the structure. For example, add an element for a
second patient:
patient(2).name = 'Ann Lane';
patient(2).billing = 28.50;
patient(2).test = [68, 70, 68; 118, 118, 119; 172, 170, 169];
Element-by-element organization supports simple indexing to access data for a particular patient. For
example, find the average of the first patient’s test results, calculating by rows (dimension 2) rather
than by columns:
aveResultsDoe = mean(patient(1).test,2)
See Also
struct
11-16
Ways to Organize Data in Structure Arrays
More About
• “Structure Arrays” on page 11-2
• “Access Elements of a Nonscalar Structure Array” on page 11-13
• “Memory Requirements for Structure Array” on page 11-18
11-17
11 Structures
Preallocate memory for the contents by assigning initial values with the struct function, such as
newStruct(1:25,1:50) = struct('a',ones(20),'b',zeros(30),'c',rand(40));
This code creates and populates a 25-by-50 structure array S with fields a, b, and c.
If you prefer not to assign initial values, you can initialize a structure array by assigning empty arrays
to each field of the last element in the structure array, such as
newStruct(25,50).a = [];
newStruct(25,50).b = [];
newStruct(25,50).c = [];
or, equivalently,
newStruct(25,50) = struct('a',[],'b',[],'c',[]);
However, in this case, MATLAB only allocates memory for the header, and not for the contents of the
array.
11-18
12
Cell Arrays
There are two ways to refer to the elements of a cell array. Enclose indices in smooth parentheses,
(), to refer to sets of cells — for example, to define a subset of the array. Enclose indices in curly
braces, {}, to refer to the text, numbers, or other data within individual cells.
12-2
Create Cell Array
When you have data to put into a cell array, create the array using the cell array construction
operator, {}.
myCell = {1, 2, 3;
'text', rand(5,10,2), {11; 22; 33}}
Like all MATLAB® arrays, cell arrays are rectangular, with the same number of cells in each row.
myCell is a 2-by-3 cell array.
You also can use the {} operator to create an empty 0-by-0 cell array.
C = {}
C =
To add values to a cell array over time or in a loop, create an empty N-dimensional array using the
cell function.
emptyCell = cell(3,4,2)
emptyCell(:,:,2) =
emptyCell is a 3-by-4-by-2 cell array, where each cell contains an empty array, [].
See Also
cell
Related Examples
• “Access Data in Cell Array” on page 12-5
12-3
12 Cell Arrays
12-4
Access Data in Cell Array
There are two ways to refer to the elements of a cell array. Enclose indices in smooth parentheses,
(), to refer to sets of cells--for example, to define a subset of the array. Enclose indices in curly
braces, {}, to refer to the text, numbers, or other data within individual cells.
Cell array indices in smooth parentheses refer to sets of cells. For example, to create a 2-by-2 cell
array that is a subset of C, use smooth parentheses.
upperLeft = C(1:2,1:2)
Update sets of cells by replacing them with the same number of cells. For example, replace cells in
the first row of C with an equivalent-sized (1-by-3) cell array.
C(1,1:3) = {'first','second','third'}
If cells in your array contain numeric data, you can convert the cells to a numeric array using the
cell2mat function.
numericCells = C(2,1:3)
numericVector = cell2mat(numericCells)
numericVector = 1×3
1 2 3
numericCells is a 1-by-3 cell array, but numericVector is a 1-by-3 array of type double.
12-5
12 Cell Arrays
Access the contents of cells--the numbers, text, or other data within the cells--by indexing with curly
braces. For example, to access the contents of the last cell of C, use curly braces.
last = C{2,3}
last = 3
last is a numeric variable of type double, because the cell contains a double value.
Similarly, you can index with curly braces to replace the contents of a cell.
C{2,3} = 300
You can access the contents of multiple cells by indexing with curly braces. MATLAB® returns the
contents of the cells as a comma-separated list. Because each cell can contain a different type of data,
you cannot assign this list to a single variable. However, you can assign the list to the same number of
variables as cells. MATLAB® assigns to the variables in column order.
r1c1 =
'first'
r2c1 = 1
r1c2 =
'second'
r2c2 = 2
If each cell contains the same type of data, you can create a single variable by applying the array
concatenation operator, [], to the comma-separated list.
nums = [C{2,:}]
nums = 1×3
1 2 300
See Also
cell | cell2mat
Related Examples
• “Create Cell Array” on page 12-3
12-6
Access Data in Cell Array
12-7
12 Cell Arrays
C = {1, 2, 3}
Assign data to a cell outside the current dimensions. MATLAB® expands the cell array to a rectangle
that includes the specified subscripts. Any intervening cells contain empty arrays.
C{4,4} = 44
Add cells without specifying a value by assigning an empty array as the contents of a cell. C is now a
5-by-5 cell array.
C{5,5} = []
Column 5
{0x0 double}
{0x0 double}
{0x0 double}
{0x0 double}
{0x0 double}
See Also
Related Examples
• “Access Data in Cell Array” on page 12-5
• “Combine Cell Arrays” on page 12-10
• “Delete Data from Cell Array” on page 12-9
12-8
Delete Data from Cell Array
C = {1, 2, 3; 4, 5, 6; 7, 8, 9}
Delete the contents of a particular cell by assigning an empty array to the cell, using curly braces for
content indexing, {}.
C{2,2} = []
Delete sets of cells using standard array indexing with smooth parentheses, (). For example, remove
the second row of C.
C(2,:) = []
See Also
Related Examples
• “Add Cells to Cell Array” on page 12-8
• “Access Data in Cell Array” on page 12-5
12-9
12 Cell Arrays
C1 = {1, 2, 3};
C2 = {'A', 'B', 'C'};
C3 = {10, 20, 30};
Concatenate cell arrays with the array concatenation operator, []. In this example, vertically
concatenate the cell arrays by separating them with semicolons:
C4 =
[ 1] [ 2] [ 3]
'A' 'B' 'C'
[10] [20] [30]
Create a nested cell array with the cell array construction operator, {}:
C5 =
{1x3 cell}
{1x3 cell}
{1x3 cell}
To combine cell arrays of character vectors into one character vector, use the strjoin function.
See Also
strjoin
Related Examples
• “Creating, Concatenating, and Expanding Matrices”
12-10
Pass Contents of Cell Arrays to Functions
This example creates a cell array that contains text and a 20-by-2 array of random numbers.
Plot only the first column of data by indexing further into the content (multilevel indexing).
figure
plot(randCell{1,2}(:,1))
title('First Column of Data')
12-11
12 Cell Arrays
This example creates a 5-by-2 cell array that stores temperature data for three cities, and plots the
temperatures for each city by date.
allTemps = cell2mat(temperature(:,2));
dates = datetime(temperature(:,1));
plot(dates, allTemps)
12-12
Pass Contents of Cell Arrays to Functions
This example plots X against Y , and applies line styles from a 2-by-3 cell array C.
X = -pi:pi/10:pi;
Y = tan(sin(X)) - sin(tan(X));
12-13
12 Cell Arrays
See Also
More About
• “Access Data in Cell Array” on page 12-5
• “Multilevel Indexing to Access Parts of Cells” on page 12-20
• “Comma-Separated Lists” on page 2-79
12-14
Preallocate Memory for Cell Array
Cell arrays do not require completely contiguous memory. However, each cell requires contiguous
memory, as does the cell array header that MATLAB creates to describe the array. For very large
arrays, incrementally increasing the number of cells or the number of elements in a cell results in
Out of Memory errors.
Initialize a cell array by calling the cell function, or by assigning to the last element. For example,
these statements are equivalent:
C = cell(25,50);
C{25,50} = [];
MATLAB creates the header for a 25-by-50 cell array. However, MATLAB does not allocate any
memory for the contents of each cell.
See Also
cell
Related Examples
• “Reshaping and Rearranging Arrays”
• “How MATLAB Allocates Memory” on page 31-12
12-15
12 Cell Arrays
Structure Arrays
patient
numPatients = numel(patient);
for p = 1:numPatients
figure
bar(patient(p).test)
title(patient(p).name)
xlabel('Test')
ylabel('Result')
end
12-16
Cell vs. Structure Arrays
12-17
12 Cell Arrays
Cell Arrays
Cell arrays contain data in cells that you access by numeric indexing. Common applications of cell
arrays include storing separate pieces of text and storing heterogeneous data from spreadsheets.
For example, store temperature data for three cities over time in a cell array.
temperature(1,:) = {'2009-12-31', [45, 49, 0]};
temperature(2,:) = {'2010-04-03', [54, 68, 21]};
temperature(3,:) = {'2010-06-20', [72, 85, 53]};
temperature(4,:) = {'2010-09-15', [63, 81, 56]};
temperature(5,:) = {'2010-12-09', [38, 54, 18]};
temperature
12-18
Cell vs. Structure Arrays
plot(dates,allTemps)
title('Temperature Trends for Different Locations')
xlabel('Date')
ylabel('Degrees (Fahrenheit)')
Struct and cell arrays are the most commonly used containers for storing heterogeneous data. Tables
are convenient for storing heterogeneous column-oriented or tabular data. Alternatively, use map
containers, or create your own class.
See Also
cell | cell2mat | containers.Map | table | struct | datetime | plot
Related Examples
• “Access Data in Cell Array” on page 12-5
• “Structure Arrays” on page 11-2
• “Access Data in Tables” on page 9-32
More About
• “Advantages of Using Tables” on page 9-56
12-19
12 Cell Arrays
C = {myNum, 100*myNum;
myCell, myStruct}
Access the complete contents of a particular cell using curly braces, {}. For example, return a
numeric vector from the cell that contains it.
C{1,2}
ans = 1×3
Access part of the contents of a cell by appending indices, using syntax that matches the data type of
the contents.
Enclose numeric indices in smooth parentheses. For example, C{1,1} returns the 1-by-3 numeric
vector, [1 2 3]. Access the second element of that vector using smooth parentheses.
C{1,1}(1,2)
ans = 2
Enclose cell array indices in curly braces. For example, C{2,1} returns the cell array,
{'one','two'}. Access the contents of the second cell within that cell array using curly braces.
C{2,1}{1,2}
ans =
'two'
Refer to fields of a struct array with dot notation, and index into the array as described for numeric
and cell arrays. For example, C{2,2} returns a structure array, where Field2 contains a 5-by-5
numeric array of fives. Access the element in the fifth row and first column of that field using dot
notation and smooth parentheses.
C{2,2}.Field2(5,1)
ans = 5
You can nest any number of cell and structure arrays. For example, add nested cells and structures to
C.
12-20
Multilevel Indexing to Access Parts of Cells
Access parts of the new data using curly braces, smooth parentheses, or dot notation.
copy_pi = C{2,1}{2,2}{1,1}
copy_pi = 3.1416
part_magic = C{2,2}.Field3.NestedField2(1:2,1:2)
part_magic = 2×2
16 2
5 11
nested_cell = C{2,2}.Field3.NestedField3{2,1}
nested_cell =
'more text'
See Also
Related Examples
• “Access Data in Cell Array” on page 12-5
12-21
13
Function Handles
You can create function handles to named and anonymous functions. You can store multiple function
handles in an array, and save and load them, as you would any other variable.
• Passing a function to another function (often called function functions). For example, passing a
function to integration and optimization functions, such as integral and fzero.
• Specifying callback functions (for example, a callback that responds to a UI event or interacts with
data acquisition hardware).
• Constructing handles to functions defined inline instead of stored in a program file (anonymous
functions).
• Calling local functions from outside the main function.
You call a function using a handle the same way you call the function directly. For example, suppose
that you have a function named computeSquare, defined as:
function y = computeSquare(x)
y = x.^2;
end
Create a handle and call the function to compute the square of four.
f = @computeSquare;
a = 4;
b = f(a)
b =
16
13-2
Create Function Handle
If the function does not require any inputs, then you can call the function with empty parentheses,
such as
h = @ones;
a = h()
a =
a =
@ones
Function handles are variables that you can pass to other functions. For example, calculate the
integral of x2 on the range [0,1].
q = integral(f,0,1);
Function handles store their absolute path, so when you have a valid handle, you can invoke the
function from any location. You do not have to specify the path to the function when creating the
handle, only the function name.
• Name length — Each part of the function name (including package and class names) must be less
than the number specified by namelengthmax. Otherwise, MATLAB truncates the latter part of
the name.
• Scope — The function must be in scope at the time you create the handle. Therefore, the function
must be on the MATLAB path or in the current folder. Or, for handles to local or nested functions,
the function must be in the current file.
• Precedence — When there are multiple functions with the same name, MATLAB uses the same
precedence rules to define function handles as it does to call functions. For more information, see
“Function Precedence Order” on page 20-37.
• Overloading — When a function handle is invoked with one or more arguments, MATLAB
determines the dominant argument. If the dominant argument is an object, MATLAB determines if
the object’s class has a method which overloads the same name as the function handle’s
associated function. If it does, then the object’s method is invoked instead of the associated
function.
Anonymous Functions
You can create handles to anonymous functions. An anonymous function is a one-line expression-
based MATLAB function that does not require a program file. Construct a handle to an anonymous
function by defining the body of the function, anonymous_function, and a comma-separated list of
input arguments to the anonymous function, arglist. The syntax is:
h = @(arglist)anonymous_function
For example, create a handle, sqr, to an anonymous function that computes the square of a number,
and call the anonymous function using its handle.
13-3
13 Function Handles
x =
ans =
-1
ans =
See Also
str2func | func2str | functions | isa | function_handle
Related Examples
• “Pass Function to Another Function” on page 13-5
More About
• “Anonymous Functions” on page 20-20
13-4
Pass Function to Another Function
For example, to find the integral of the natural log from 0 through 5, pass a handle to the log
function to integral.
a = 0;
b = 5;
q1 = integral(@log,a,b)
q1 = 3.0472
Similarly, to find the integral of the sin function and the exp function, pass handles to those
functions to integral.
q2 = integral(@sin,a,b)
q2 = 0.7163
q3 = integral(@exp,a,b)
q3 = 147.4132
Also, you can pass a handle to an anonymous function to function functions. An anonymous function is
a one-line expression-based MATLAB® function that does not require a program file. For example,
evaluate the integral of x/(ex − 1) on the range [0,Inf]:
fun = @(x)x./(exp(x)-1);
q4 = integral(fun,0,Inf)
q4 = 1.6449
Functions that take a function as an input (called function functions) expect that the function
associated with the function handle has a certain number of input variables. For example, if you call
integral or fzero, the function associated with the function handle must have exactly one input
variable. If you call integral3, the function associated with the function handle must have three
input variables. For information on calling function functions with more variables, see
“Parameterizing Functions”.
See Also
Related Examples
• “Create Function Handle” on page 13-2
• “Parameterizing Functions”
More About
• “Anonymous Functions” on page 20-20
13-5
13 Function Handles
Create the following function in a file, ellipseVals.m, in your working folder. The function returns
a struct with handles to the local functions.
function fh = ellipseVals
fh.focus = @computeFocus;
fh.eccentricity = @computeEccentricity;
fh.area = @computeArea;
end
function f = computeFocus(a,b)
f = sqrt(a^2-b^2);
end
function e = computeEccentricity(a,b)
f = computeFocus(a,b);
e = f/a;
end
function ae = computeArea(a,b)
ae = pi*a*b;
end
h = ellipseVals
h =
focus: @computeFocus
eccentricity: @computeEccentricity
area: @computeArea
Call a local function using its handle to compute the area of an ellipse.
h.area(3,1)
ans =
9.4248
13-6
Call Local Functions Using Function Handles
Alternatively, you can use the localfunctions function to create a cell array of function handles
from all local functions automatically. This approach is convenient if you expect to add, remove, or
modify names of the local functions.
See Also
localfunctions
Related Examples
• “Create Function Handle” on page 13-2
More About
• “Local Functions” on page 20-25
13-7
13 Function Handles
MATLAB® considers function handles that you construct from the same named function to be equal.
The isequal function returns a value of true when comparing these types of handles.
fun1 = @sin;
fun2 = @sin;
isequal(fun1,fun2)
ans =
logical
If you save these handles to a MAT-file, and then load them back into the workspace, they are still
equal.
Unlike handles to named functions, function handles that represent the same anonymous function are
not equal. They are considered unequal because MATLAB cannot guarantee that the frozen values of
nonargument variables are the same. For example, in this case, A is a nonargument variable.
A = 5;
h1 = @(x)A * x.^2;
h2 = @(x)A * x.^2;
isequal(h1,h2)
ans =
logical
If you make a copy of an anonymous function handle, the copy and the original are equal.
h1 = @(x)A * x.^2;
h2 = h1;
isequal(h1,h2)
ans =
logical
13-8
Compare Function Handles
MATLAB considers function handles to the same nested function to be equal only if your code
constructs these handles on the same call to the function containing the nested function. This
function constructs two handles to the same nested function.
function z = findZ
z = a.^3 + b.^2 + c';
end
end
Function handles constructed from the same nested function and on the same call to the parent
function are considered equal.
[h1,h2] = test_eq(4,19,-7);
isequal(h1,h2)
ans =
logical
Function handles constructed from different calls are not considered equal.
[q1,q2] = test_eq(4,19,-7);
isequal(h1,q1)
ans =
logical
See Also
isequal
Related Examples
• “Create Function Handle” on page 13-2
13-9
14
Map Containers
Indices into the elements of a Map are called keys. These keys, along with the data values associated
with them, are stored within the Map. Each entry of a Map contains exactly one unique key and its
corresponding value. Indexing into the Map of rainfall statistics shown below with a character vector
representing the month of August yields the value internally associated with that month, 37.3.
Keys are not restricted to integers as they are with other arrays. Specifically, a key may be any of the
following types:
The values stored in a Map can be of any type. This includes arrays of numeric values, structures,
cells, character arrays, objects, or other Maps.
Note A Map is most memory efficient when the data stored in it is a scalar number or a character
array.
See Also
keys | values | containers.Map
14-2
Overview of Map Data Structure
Related Examples
• “Description of Map Class” on page 14-4
• “Create Map Object” on page 14-6
• “Examine Contents of Map” on page 14-8
14-3
14 Map Containers
To examine one of these properties, follow the name of the Map object with a dot and then the
property name. For example, to see what type of keys are used in Map mapObj, use
mapObj.KeyType
A Map is a handle object. As such, if you make a copy of the object, MATLAB does not create a new
Map; it creates a new handle for the existing Map that you specify. If you alter the Map's contents in
reference to this new handle, MATLAB applies the changes you make to the original Map as well. You
can, however, delete the new handle without affecting the original Map.
Method Description
isKey Check if Map contains specified key
keys Names of all keys in Map
length Length of Map
remove Remove key and its value from Map
size Dimensions of Map
values Values contained in Map
14-4
Description of Map Class
See Also
keys | isKey | values | containers.Map | remove | length | size
Related Examples
• “Overview of Map Data Structure” on page 14-2
• “Create Map Object” on page 14-6
• “Examine Contents of Map” on page 14-8
14-5
14 Map Containers
newMap = containers.Map(optional_keys_and_values)
newMap = containers.Map
newMap =
Count: 0
KeyType: char
ValueType: any
The properties of an empty Map object are set to their default values:
• Count = 0
• KeyType = 'char'
• ValueType = 'any'
Once you construct the empty Map object, you can use the keys and values methods to populate it.
For a summary of MATLAB functions you can use with a Map object, see “Methods of Map Class” on
page 14-4
For those keys and values that are character vectors, be sure that you specify them enclosed within
single quotation marks. For example, when constructing a Map that has character vectors as keys,
use
mapObj = containers.Map(...
{'keystr1', 'keystr2', ...}, {val1, val2, ...});
As an example of constructing an initialized Map object, create a new Map for the following key/value
pairs taken from the monthly rainfall map shown earlier in this section.
14-6
Create Map Object
rainfallMap = containers.Map(k, v)
rainfallMap =
Count: 13
KeyType: char
ValueType: double
The Count property is now set to the number of key/value pairs in the Map, 13, the KeyType is
char, and the ValueType is double.
See Also
keys | values | containers.Map
Related Examples
• “Overview of Map Data Structure” on page 14-2
• “Description of Map Class” on page 14-4
• “Examine Contents of Map” on page 14-8
14-7
14 Map Containers
Create a new Map called ticketMap that maps airline ticket numbers to the holders of those tickets.
Construct the Map with four key/value pairs:
ticketMap = containers.Map(...
{'2R175', 'B7398', 'A479GY', 'NZ1452'}, ...
{'James Enright', 'Carl Haynes', 'Sarah Latham', ...
'Bradley Reid'});
Use the keys method to display all keys in the Map. MATLAB lists keys of type char in alphabetical
order, and keys of any numeric type in numerical order:
keys(ticketMap)
ans =
Next, display the values that are associated with those keys in the Map. The order of the values is
determined by the order of the keys associated with them.
keys values
2R175 James Enright
A479GY Sarah Latham
B7398 Carl Haynes
NZ1452 Bradley Reid
values(ticketMap)
ans =
See Also
keys | isKey | values | containers.Map | remove | length | size
Related Examples
• “Create Map Object” on page 14-6
• “Read and Write Using Key Index” on page 14-9
• “Modify Keys and Values in Map” on page 14-13
• “Map to Different Value Types” on page 14-15
14-8
Read and Write Using Key Index
Note For a large Map, the keys and value methods use a lot of memory as their outputs are cell
arrays.
valueN = mapObj(keyN);
ticketMap = containers.Map(...
{'2R175', 'B7398', 'A479GY', 'NZ1452'}, ...
{'James Enright', 'Carl Haynes', 'Sarah Latham', ...
'Bradley Reid'});
You can find any single value by indexing into the Map with the appropriate key:
passenger = ticketMap('2R175')
passenger =
James Enright
ans =
To access the values of multiple keys, use the values method, specifying the keys in a cell array:
ans =
Map containers support scalar indexing only. You cannot use the colon operator to access a range of
keys as you can with other MATLAB classes. For example, the following statements throw an error:
ticketMap('2R175':'B7398')
ticketMap(:)
14-9
14 Map Containers
Add two more entries to the ticketMap Map. Verify that ticketMap now has six key/value pairs:
ticketMap('947F4') = 'Susan Spera';
ticketMap('417R93') = 'Patricia Hughes';
ticketMap.Count
ans =
ans =
ans =
'James Enright' 'Patricia Hughes' 'Susan Spera' 'Sarah Latham' 'Carl Haynes' 'Bradley Reid'
• Only vertical vectors of Map objects are allowed. You cannot create an m-by-n array or a
horizontal vector of Map objects. For this reason, vertcat is supported for Map objects, but not
horzcat.
• All keys in each Map being concatenated must be of the same class.
• You can combine Maps with different numbers of key/value pairs. The result is a single Map object
containing key/value pairs from each of the contributing Map objects:
tMap1 = containers.Map({'2R175', 'B7398', 'A479GY'}, ...
{'James Enright', 'Carl Haynes', 'Sarah Latham'});
14-10
Read and Write Using Key Index
The result of this concatenation is the same 6-element Map that was constructed in the previous
section:
ticketMap.Count
ans =
keys(ticketMap), values(ticketMap)
ans =
ans =
'James Enright' 'Patricia Hughes' 'Susan Spera' 'Sarah Latham' 'Carl Haynes' 'Bradley Reid'
• Concatenation does not include duplicate keys or their values in the resulting Map object.
In the following example, both objects m1 and m2 use a key of 8. In Map m1, 8 is a key to value C;
in m2, it is a key to value X:
m = [m1; m2];
The resulting Map object m has only five key/value pairs. The value C was dropped from the
concatenation because its key was not unique:
keys(m), values(m)
ans =
ans =
See Also
keys | isKey | values | containers.Map
Related Examples
• “Create Map Object” on page 14-6
• “Examine Contents of Map” on page 14-8
• “Modify Keys and Values in Map” on page 14-13
14-11
14 Map Containers
14-12
Modify Keys and Values in Map
Note Keep in mind that if you have more than one handle to a Map, modifying the handle also makes
changes to the original Map. See “Modify Copy of Map” on page 14-14, below.
remove(mapName, 'keyname');
ticketMap = containers.Map(...
{'2R175', 'B7398', 'A479GY', 'NZ1452'}, ...
{'James Enright', 'Carl Haynes', 'Sarah Latham', ...
'Bradley Reid'});
Remove one entry (the specified key and its value) from the Map object:
remove(ticketMap, 'NZ1452');
values(ticketMap)
ans =
Modify Values
You can modify any value in a Map simply by overwriting the current value. The passenger holding
ticket A479GY is identified as Sarah Latham:
ticketMap('A479GY')
ans =
Sarah Latham
Change the passenger's first name to Anna Latham by overwriting the original value for the A479GY
key:
ticketMap('A479GY')
ans =
Anna Latham
14-13
14 Map Containers
Modify Keys
To modify an existing key while keeping the value the same, first remove both the key and its value
from the Map. Then create a new entry, this time with the corrected key name.
remove(ticketMap, '2R175');
ticketMap('2S185') = 'James Enright';
k = keys(ticketMap); v = values(ticketMap);
str1 = ' ''%s'' has been assigned a new\n';
str2 = ' ticket number: %s.\n';
fprintf(str1, v{1})
fprintf(str2, k{1})
Make a copy of the ticketMap Map. Write to this copy, and notice that the change is applied to the
original Map object itself:
copiedMap = ticketMap;
ans =
unidentified person
Clean up:
remove(ticketMap, 'AZ12345');
clear copiedMap;
See Also
keys | isKey | values | containers.Map | remove | length | size
Related Examples
• “Create Map Object” on page 14-6
• “Examine Contents of Map” on page 14-8
• “Read and Write Using Key Index” on page 14-9
• “Map to Different Value Types” on page 14-15
14-14
Map to Different Value Types
ticketMap = containers.Map(...
{'2R175', 'B7398', 'A479GY', 'NZ1452'}, ...
{'James Enright', 'Carl Haynes', 'Sarah Latham', ...
'Bradley Reid'});
Then create the following structure array, containing ticket numbers and destinations:
Using this Map object, find information about the passenger who has reserved seat 09C:
seatingMap('09C')
ans =
ticketNum: 'B7398'
destination: 'Granada'
reserved: '30-Apr-2008'
origin: 'JFK'
Using ticketMap and seatingMap together, you can find the name of the person who has reserved
seat 15B:
ticket = seatingMap('15B').ticketNum;
passenger = ticketMap(ticket)
passenger =
Sarah Latham
14-15
14 Map Containers
See Also
keys | isKey | values | containers.Map | struct | cell
Related Examples
• “Create Map Object” on page 14-6
• “Structure Arrays” on page 11-2
• “Create Cell Array” on page 12-3
• “Examine Contents of Map” on page 14-8
• “Read and Write Using Key Index” on page 14-9
• “Modify Keys and Values in Map” on page 14-13
14-16
15
Data type conversion is done with respect to a preset precedence of classes. The following table
shows the five classes you can concatenate with an unlike type without generating an error (that is,
with the exception of character and logical).
For example, concatenating a double and single matrix always yields a matrix of type single.
MATLAB converts the double element to single to accomplish this.
See Also
More About
• “Combining Unlike Integer Types” on page 15-3
• “Combining Integer and Noninteger Data” on page 15-5
• “Combining Cell Arrays with Non-Cell Arrays” on page 15-6
• “Concatenation Examples” on page 15-8
• “Concatenating Objects of Different Classes”
15-2
Combining Unlike Integer Types
Overview
If you combine different integer types in a matrix (e.g., signed with unsigned, or 8-bit integers with
16-bit integers), MATLAB returns a matrix in which all elements are of one common type. MATLAB
sets all elements of the resulting matrix to the data type of the leftmost element in the input matrix.
For example, the result of the following concatenation is a vector of three 16-bit signed integers:
A =
A = [int16(5000) int8(50)]
A =
5000 50
B = [int8(50) int16(5000)]
B =
50 127
The first operation returns a vector of 16-bit integers. The second returns a vector of 8-bit integers.
The element int16(5000) is set to 127, the maximum value for an 8-bit signed integer.
C = [int8(50); int16(5000)]
C =
15-3
15 Combining Unlike Classes
50
127
Note You can find the maximum or minimum values for any MATLAB integer type using the intmax
and intmin functions. For floating-point types, use realmax and realmin.
A = [int8(-100) uint8(100)]
A =
-100 100
B = [uint8(100) int8(-100)]
B =
100 0
MATLAB evaluates each element prior to concatenating them into a combined array. In other words,
the following statement evaluates to an 8-bit signed integer (equal to 50) and an 8-bit unsigned
integer (unsigned -50 is set to zero) before the two elements are combined. Following the
concatenation, the second element retains its zero value but takes on the unsigned int8 type:
A = [int8(50), uint8(-50)]
A =
50 0
See Also
More About
• “Integers” on page 4-2
• “Integer Arithmetic” on page 4-19
15-4
Combining Integer and Noninteger Data
15-5
15 Combining Unlike Classes
fprintf('Classes: %s %s %s %s\n',...
class(A{1}),class(A{2}),class(A{3}),class(A{4}))
15-6
Empty Matrices
Empty Matrices
If you construct a matrix using empty matrix elements, the empty matrices are ignored in the
resulting matrix:
15-7
15 Combining Unlike Classes
Concatenation Examples
In this section...
“Combining Single and Double Types” on page 15-8
“Combining Integer and Double Types” on page 15-8
“Combining Character and Double Types” on page 15-8
“Combining Logical and Double Types” on page 15-8
class(x)
ans =
char
15-8
Concatenation Examples
class(x)
ans =
double
15-9
16
Using Objects
16 Using Objects
Object Behavior
In this section...
“Two Copy Behaviors” on page 16-2
“Handle Object Copy” on page 16-2
“Value Object Copy Behavior” on page 16-2
“Handle Object Copy Behavior” on page 16-3
“Testing for Handle or Value Class” on page 16-5
Value objects behave like MATLAB fundamental types with respect to copy operations. Copies are
independent values. Operations that you perform on one object do not affect copies of that object.
Handle objects are referenced by their handle variable. Copies of the handle variable refer to the
same object. Operations that you perform on a handle object are visible from all handle variables that
reference that object.
a = 8;
b = a;
a = 6;
b
b =
8
clear a
b
b =
8
16-2
Object Behavior
The copy behavior of values stored as properties in value objects is the same as numeric variables.
For example, suppose vobj1 is a value object with property a:
vobj1.a = 8;
If you copy vobj1 to vobj2, and then change the value of vobj1 property a, the value of the copied
object's property, vobj2.a, is unaffected:
vobj2 =vobj1;
vobj1.a = 5;
vobj2.a
ans =
8
hobj1 = HdClass(8)
Because this statement is not terminated with a semicolon, MATLAB displays information about the
object:
hobj1 =
Data: 8
The variable hobj1 is a handle that references the object created. Copying hobj1 to hobj2 results in
another handle referring to the same object:
hobj2 = hobj1
hobj2 =
Data: 8
16-3
16 Using Objects
Because handles reference the object, copying a handle copies the handle to a new variable name,
but the handle still refers to the same object. For example, given that hobj1 is a handle object with
property Data:
hobj1.Data
ans =
Change the value of hobj1's Data property and the value of the copied object's Data property also
changes:
hobj1.Data = 5;
hobj2.Data
ans =
Because hobj2 and hobj1 are handles to the same object, changing the copy, hobj2, also changes
the data you access through handle hobj1:
hobj2.Data = 17;
hobj1.Data
ans =
17
Reassigning a handle variable produces the same result as reassigning any MATLAB variable. When
you create an object and assign it to hobj1:
hobj1 = HdClass(3.14);
hobj1 references the new object, not the same object referenced previously (and still referenced by
hobj2).
When you clear a handle from the workspace, MATLAB removes the variable, but does not remove
the object referenced by the other handle. However, if there are no references to an object, MATLAB
destroys the object.
Given hobj1 and hobj2, which both reference the same object, you can clear either handle without
affecting the object:
hobj1.Data = 2^8;
clear hobj1
hobj2
hobj2 =
Data: 256
16-4
Object Behavior
If you clear both hobj1 and hobj2, then there are no references to the object. MATLAB destroys the
object and frees the memory used by that object.
To remove an object referenced by any number of handles, use delete. Given hobj1 and hobj2,
which both refer to the same object, delete either handle. MATLAB deletes the object:
hobj1 = HdClass(8);
hobj2 = hobj1;
delete(hobj1)
hobj2
hobj2 =
Modifying Objects
When you pass an object to a function, MATLAB passes a copy of the object into the function
workspace. If the function modifies the object, MATLAB modifies only the copy of the object that is in
the function workspace. The differences in copy behavior between handle and value classes are
important in such cases:
• Value object — The function must return the modified copy of the object. To modify the object in
the caller’s workspace, assign the function output to a variable of the same name
• Handle object — The copy in the function workspace refers to the same object. Therefore, the
function does not have to return the modified copy.
ans =
ans =
16-5
16 Using Objects
ans =
containers.Map
See Also
Related Examples
• “Implement Copy for Handle Classes”
16-6
17
All MATLAB data types are implemented as object-oriented classes. You can add data types of your
own to your MATLAB environment by creating additional classes. These user-defined classes define
the structure of your new data type, and the functions, or methods, that you write for each class
define the behavior for that data type.
These methods can also define the way various MATLAB operators, including arithmetic operations,
subscript referencing, and concatenation, apply to the new data types. For example, a class called
polynomial might redefine the addition operator (+) so that it correctly performs the operation of
addition on polynomials.
3
18
Scripts
Create Scripts
Scripts are the simplest kind of code file because they have no input or output arguments. They are
useful for automating series of MATLAB commands, such as computations that you have to perform
repeatedly from the command line or series of commands you have to reference.
• Highlight commands from the Command History, right-click, and select Create Script.
•
On the Home tab, click the New Script button.
• Use the edit function. For example, edit new_file_name creates (if the file does not exist) and
opens the file new_file_name. If new_file_name is unspecified, MATLAB opens a new file
called Untitled.
After you create a script, you can add code to the script and save it. For example, you can save this
code that generates random numbers from 0 through 100 as a script called numGenerator.m.
columns = 10000;
rows = 1;
bins = columns/100;
rng(now);
list = 100*rand(rows,columns);
histogram(list,bins)
Save your script and run the code using either of these methods:
• Type the script name on the command line and press Enter. For example, to run the
numGenerator.m script, type numGenerator.
•
On the Editor tab, click the Run button.
You also can run the code from a second code file. To do this, add a line of code with the script name
to the second code file. For example, to run the numGenerator.m script from a second code file, add
the line numGenerator; to the file. MATLAB runs the code in numGenerator.m when you run the
second file.
When execution of the script completes, the variables remain in the MATLAB workspace. In the
numGenerator.m example, the variables columns, rows, bins, and list remain in the workspace.
To see a list of variables, type whos at the command prompt. Scripts share the base workspace with
your interactive MATLAB session and with other scripts.
See Also
More About
• “Create and Run Sections in Code” on page 18-5
• “Scripts vs. Functions” on page 18-10
• “Base and Function Workspaces” on page 20-9
• “Create Live Scripts in the Live Editor” on page 19-6
18-2
Add Comments to Code
In the Live Editor, you can insert lines of text before and after code to describe a process or code.
Text lines provide additional flexibility such as standard formatting options, and the insertion of
images, hyperlinks, and equations. For more information, see “Create Live Scripts in the Live Editor”
on page 19-6.
Note When you have a MATLAB code file (.m) containing text that has characters in a different
encoding than that of your platform, when you save or publish your file, MATLAB displays those
characters as garbled text. Live scripts and functions (.mlx) support storing and displaying
characters across all locales.
To add comments to MATLAB code, use the percent (%) symbol. Comment lines can appear anywhere
in a code file, and you can append comments to the end of a line of code.
For example:
To comment out multiple lines of code, use the block comment operators, %{ and %}. The %{ and %}
operators must appear alone on the lines that immediately precede and follow the block of help text.
Do not include any other text on these lines.
For example:
a = magic(3);
%{
sum(a)
diag(a)
sum(diag(a))
%}
sum(diag(fliplr(a)))
To comment out a selection, select the lines of code, go to the Editor or Live Editor tab, and in the
Code section, click the button. You also can type Ctrl+R. To uncomment the selected lines code,
click the button or type Ctrl+Shift+R. On macOS systems, use Command+/ to comment and
Command+Option+/ to uncomment. On Linux® systems, use Ctrl+/ to comment and Ctrl+Shift+/
to uncomment.
To comment out part of a statement that spans multiple lines, use an ellipsis (...) instead of a
percent sign. For example:
18-3
18 Scripts
The Editor and Live Editor include tools and context menu items to help you add, remove, or change
the format of comments for MATLAB, Java, and C/C++ code. For example, suppose that you have this
lengthy text into a commented line.
% This is a code file that has a comment that is a little more than 75 columns wide.
disp('Hello, world')
With the cursor on the line, go to Editor or Live Editor tab, and in the Code section, click the
button. The comment wraps to the next line:
% This is a code file that has a comment that is a little more than 75
% columns wide.
disp('Hello, world')
By default, as you type comments in the Editor and Live Editor, the text wraps when it reaches a
column width of 75. To change the column where the comment text wraps or to disable automatic
comment wrapping, go to the Home tab and in the Environment section, click Preferences.
Select MATLAB > Editor/Debugger > Language, and adjust the Comment formatting
preferences. To adjust Comment formatting preferences in MATLAB Online, select Editor/
Debugger > MATLAB Language.
See Also
Related Examples
• “Add Help for Your Program” on page 20-5
• “Create Scripts” on page 18-2
• “Create Live Scripts in the Live Editor” on page 19-6
• “Editor/Debugger Preferences”
18-4
Create and Run Sections in Code
MATLAB code files often contain many commands and lines of text. You typically focus your efforts on
a single part of your code at a time, working with the code and related text in pieces. For easier
document management and navigation, divide your file into sections. Then, you can run the code in
an individual section and navigate between sections, as needed.
In the Editor, a section begins with two percent signs (%%). The text on the same line as %% is called
the section title. Including section titles is optional, however, it improves the readability of the file
and appears as a heading if you publish your code.
In the Live Editor, a section can consist of code, text, and output. When you create a section or modify
an existing section, the bar on the left side of the section is displayed with vertical striping. The
striping indicates that the section is stale. A stale section is a section that has not yet been run, or
that has been modified since it was last run.
18-5
18 Scripts
Delete Sections
To delete a section break in the Editor, delete the two percent signs (%%) at the beginning of the
section. To delete a section break in the Live Editor, place your cursor at the beginning of the line
directly after the section break and press Backspace. Alternatively, you can place your cursor at the
end of the line directly before the section break and press the Delete key.
Note You cannot remove sections breaks added by MATLAB. For more information about when
MATLAB might add a section break, see “Behavior of Sections in Functions” on page 18-8 and
“Behavior of Sections in Loops and Conditional Statements” on page 18-8.
Run Sections
You can run your code file by either running each section individually or by running all of the code in
the file at once. To run a section individually, it must contain all the values it requires, or the values
must exist in the MATLAB workspace. When running individual sections, MATLAB does not save your
file and the file does not have to be on your search path.
Operation Instructions
Run all the code in the file.
On the Editor or Live Editor tab, in the Run section, click Run.
Run the code in the selected
section. On the Editor or Live Editor tab, in the Section section, click
Run Section.
In the Live Editor, you also can click the blue bar to the left of the
section.
18-6
Create and Run Sections in Code
Operation Instructions
Run to a specific line of code Click the Run to Here button to the left of the line. If the selected
and pause. line cannot be reached, MATLAB continues running until the end of
the file is reached or a breakpoint is encountered.
In the Editor, the Run to Here button is available only for code
that has been saved. In the Live Editor, the Run to Here button is
available for all code, whether it is saved or not. In functions and
classes, the Run to Here button is available only when evaluation
is paused.
For more information, see “Debug MATLAB Code Files” on page 22-
2.
You can increment numeric values within a section, rerunning that section after every change. This
helps you fine-tune and experiment with your code.
To increment a numeric value within a section, use controls in the Live Editor. For example, this code
calculates the factorial of the variable x.
x = 5;
y = factorial(x)
y =
120
To interactively change the value of x, in a live script, replace the value 5 with a numeric slider. By
default, MATLAB reruns the current section when the value of the slider changes.
For more information, see “Add Interactive Controls to a Live Script” on page 19-36.
18-7
18 Scripts
Operation Instructions
Move to specific section.
On the Editor or Live Editor tab, in the Navigate section, click
Go To . Then, in the Sections section, select from the available
options.
Move to previous section.
On the Editor or Live Editor tab, in the Navigate section, click
Go To , and then click Previous Section. Alternatively, you can use
the Ctrl+Up keyboard shortcut.
Move to next section
On the Editor or Live Editor tab, in the Navigate section, click
Go To , and then click Next Section. Alternatively, you can use the
Ctrl+Down keyboard shortcut.
In the Live Editor, you cannot add section breaks inside a function. Sections inside local functions are
not supported. If you add local functions to a live script, MATLAB adds a section break before the first
local function definition and removes all section breaks after it. When running individual sections in a
live script, you can run only the sections that are before the local function definitions.
For example, this code preallocates a 10-element vector, and then calculates nine values. If a
calculated value is even, MATLAB adds one to it.
x = ones(1,10);
for n = 2:10
x(n) = x(n) + 1;
end
end
If you add a section break at line 3, inside the for loop, MATLAB adds a section break at line 9, the
end statement for the for loop. If you add a section break at line 6, inside the if statement, MATLAB
adds a section break at line 8, the end statement for the if statement, leading to three levels of
nested sections.
18-8
Create and Run Sections in Code
• At the outermost level of nesting, one section spans the entire file.
• At the second level of nesting, a section exists within the for loop.
• At the third level of nesting, one section exists within the if statement.
See Also
More About
• “Create Scripts” on page 18-2
• “Create Live Scripts in the Live Editor” on page 19-6
• “Scripts vs. Functions” on page 18-10
18-9
18 Scripts
Both scripts and functions allow you to reuse sequences of commands by storing them in code files.
Scripts are the simplest type of code file, since they store commands exactly as you would type them
at the command line. However, functions are more flexible and more easily extensible.
Create a script in a file named triarea.m that computes the area of a triangle:
b = 5;
h = 3;
a = 0.5*(b.*h)
After you save the file, you can call the script from the command line:
triarea
a =
7.5000
To calculate the area of another triangle using the same script, you could update the values of b and
h in the script and rerun it. Each time you run it, the script stores the result in a variable named a
that is in the base workspace.
However, instead of manually updating the script each time, you can make your code more flexible by
converting it to a function. Replace the statements that assign values to b and h with a function
declaration statement. The declaration includes the function keyword, the names of input and
output arguments, and the name of the function.
function a = triarea(b,h)
a = 0.5*(b.*h);
end
After you save the file, you can call the function with different base and height values from the
command line without modifying the script:
a1 = triarea(1,5)
a2 = triarea(2,10)
a3 = triarea(3,6)
a1 =
2.5000
a2 =
10
a3 =
9
Functions have their own workspace, separate from the base workspace. Therefore, none of the calls
to the function triarea overwrite the value of a in the base workspace. Instead, the function assigns
the results to variables a1, a2, and a3.
18-10
Scripts vs. Functions
See Also
More About
• “Create Scripts” on page 18-2
• “Create Functions in Files” on page 20-2
• “Add Functions to Scripts” on page 18-12
• “Base and Function Workspaces” on page 20-9
18-11
18 Scripts
In the file, include two local functions, mymean and mymedian. The script mystats declares an array,
determines the length of the array, and then uses the local functions mymean and mymedian to
calculate the average and median of the array.
x = 1:10;
n = length(x);
avg = mymean(x,n);
med = mymedian(x,n);
function a = mymean(v,n)
% MYMEAN Local function that calculates mean of array.
a = sum(v)/n;
end
function m = mymedian(v,n)
% MYMEDIAN Local function that calculates median of array.
w = sort(v);
if rem(n,2) == 1
m = w((n + 1)/2);
else
m = (w(n/2) + w(n/2 + 1))/2;
end
end
When you add local functions to a live script, MATLAB automatically adds a section break before the
first local function definition and removes all section breaks after it. This is because the Live Editor
does not support individual sections within local functions.
Run button. You also can type the saved script name in the Command Window.
18-12
Add Functions to Scripts
To run an individual section inside a script or live script, place the cursor inside the section and use
the Run Section button (requires R2017b or later for .m files). In live scripts or functions (.mlx
files), you only can run sections that are before the local function definitions.
Local functions in the current file have precedence over functions in other files. That is, when you call
a function within a script, MATLAB checks whether the function is a local function before looking for
the function in other locations. This allows you to create an alternate version of a particular function
while retaining the original in another file.
Scripts create and access variables in the base workspace. Local functions, like all other functions,
have their own workspaces that are separate from the base workspace. Local functions cannot access
variables in the workspace of other functions or in the base workspace, unless you pass them as
arguments.
For example:
help mystats>mymean
See Also
More About
• “Create Functions in Files” on page 20-2
• “Function Precedence Order” on page 20-37
• “Base and Function Workspaces” on page 20-9
18-13
19
• Add titles, headings, and formatted text to describe a process and include equations, images, and
hyperlinks as supporting material.
• Save your narratives as richly formatted, executable documents and share them with colleagues
or the MATLAB community, or convert them to HTML, PDF, Microsoft Word, or LaTeX documents
for publication.
19-2
What Is a Live Script or Function?
• Combine code and results with formatted text and mathematical equations.
• Create step-by-step lectures and evaluate them incrementally to illustrate a topic.
• Modify code on the fly to answer questions or explore related topics.
• Share lectures with students as interactive documents or in hard copy format, and distribute
partially completed files as assignments.
19-3
19 Live Scripts and Functions
Requirements
• MATLAB R2016a — MATLAB supports live scripts in versions R2016a and above, and live
functions in versions R2018a and above.
• Operating System — Starting in R2019b, MATLAB supports the Live Editor in all operating
systems supported by MATLAB. For more information, see System Requirements.
For MATLAB versions R2016a through R2019a, the Live Editor is not supported in several
operating systems supported by MATLAB.
In addition, some operating systems require additional configuration to run the Live Editor in
MATLAB versions R2016a through R2019a. If you are unable to run the Live Editor on your
system, Contact Technical Support for information on how to configure your system.
19-4
What Is a Live Script or Function?
Unsupported Features
Some MATLAB features are unsupported in the Live Editor:
• Classes — Classes are not supported in the Live Editor. Create classes as plain code files (.m)
instead. You then can use the classes in your live scripts or functions.
• MATLAB preferences — The Live Editor ignores some MATLAB preferences, including custom
keyboard shortcuts and Emacs-style keyboard shortcuts.
See Also
Related Examples
• “Create Live Scripts in the Live Editor” on page 19-6
• “Live Code File Format (.mlx)” on page 19-59
• MATLAB Live Script Gallery
19-5
19 Live Scripts and Functions
To create a live script in the Live Editor, go to the Home tab and click New Live Script . You also
can use the edit function in the Command Window. For example, type edit penny.mlx to open or
create the file penny.mlx. To ensure that a live script is created, specify a .mlx extension. If an
extension is not specified, MATLAB defaults to a file with .m extension, which only supports plain
code.
If you have an existing script, you can open it as a live script in the Live Editor. Opening a script as a
live script creates a copy of the file and leaves the original file untouched. MATLAB converts
publishing markup from the original script to formatted content in the new live script.
To open an existing script (.m) as a live script (.mlx) from the Editor, right-click the document tab,
and select Open scriptName as Live Script from the context menu. Alternatively, go to the Editor
tab, click Save , and select Save As. Then, set the Save as type: to MATLAB Live Code Files
(*.mlx) and click Save.
Note You must use one of the described conversion methods to convert your script to a live script.
Simply renaming the script with a .mlx extension does not work and can corrupt the file.
Add Code
After you create a live script, you can add code and run it. For example, add this code that plots a
vector of random data and draws a horizontal line on the plot at the mean.
n = 50;
r = rand(n,1);
plot(r)
m = mean(r);
19-6
Create Live Scripts in the Live Editor
hold on
plot([0,n],[m,m])
hold off
title('Mean of Random Uniform Data')
Run Code
To run the code, click the vertical striped bar to the left of the code. Alternatively, go to the Live
Editor tab and click Run. While your program is running, a status indicator appears at the top
left of the Editor window. A gray blinking bar to the left of a line of code indicates the line that
MATLAB is evaluating. To navigate to the line MATLAB is evaluating, click the status indicator.
If an error occurs while MATLAB is running your program or if MATLAB detects a significant issue in
your code, the status indicator becomes an error icon . To navigate to the error, click the icon. An
error icon to the right of the line of code indicates the error. The corresponding error message is
displayed as an output.
You do not need to save your live script to run it. When you do save your live script, MATLAB
automatically saves it with a .mlx extension. For example, go the Live Editor tab, click Save,
and enter the name plotRand. MATLAB saves the live script as plotRand.mlx.
Display Output
By default, MATLAB displays output to the right of the code. Each output is displayed with the line
that creates it.
When scrolling, MATLAB aligns the output to the code that generates it. To disable the alignment of
output to code, right-click the output section and select Disable Synchronous Scrolling. To change
the size of the output display panel, drag the resizer bar between the code and output to the left or to
the right.
19-7
19 Live Scripts and Functions
To clear an output, right-click the output or the code line that created it, and select Clear Output. To
clear all output, right-click anywhere in the script and select Clear All Output. Alternatively, go to
the View tab and in the Output section, click the Clear all Output button.
To open individual outputs, such as variables and figures, in a separate window, click the button in
the upper right corner of the output. Variables open in the Variables editor, and figures open in a new
figure window. Changes made to variables or figures outside of a live script do not apply to the output
displayed in the live script.
To modify figures in the output, use the tools in the upper-right corner of the figure axes or in the
Figure toolstrip. You can use the tools to explore the data in a figure and add formatting and
annotations. For more information, see “Modify Figures in Live Scripts” on page 19-12.
Change View
To optimize your live script for your current flow, you can change where to display output and
whether to display code in the live script.
By default, output displays to the right of the code. Each output displays with the line that creates it.
This option is ideal when writing code.
19-8
Create Live Scripts in the Live Editor
To display output in line with the code, select the output inline button to the right of the live
script. You also can go to the View tab and in the View section, select the Output inline button.
MATLAB displays each output underneath the line that creates it. This view is ideal for sharing.
To display only output, controls, and formatted text, and hide the code, select the hide code button
to the right of the live script or in the View tab. This view is ideal for sharing when you want others
to only change the value of the controls in your live script, or when you do not want others to see
your code.
To change the default location of the output when creating a new live script, on the Home tab, in the
Environment section, click Preferences. Select MATLAB > Editor / Debugger > Display, and
then select a different option for the Live Editor default view.
19-9
19 Live Scripts and Functions
Format Text
You can add formatted text, hyperlinks, images, and equations to your live scripts to create a
presentable document to share with others. For example, add a title and some introductory text to
plotRand.mlx:
1
Place your cursor at the top of the live script and, in the Live Editor tab, select Text. A new
text line appears above the code.
2
Click and select Title.
3 Add the text Plot Random Data.
4
With your cursor still in the line, click the button to center the text.
5 Press Enter to move to the next line.
6 Type the text This script plots a vector of random data and draws a
horizontal line on the plot at the mean.
For more information including a list of all available formatting options, see “Format Text in the Live
Editor” on page 19-21.
To adjust the displayed font size in the Live Editor, use the Ctrl + Plus (+) and Ctrl + Minus (-)
keyboard shortcuts or the Ctrl + Mouse Scroll keyboard shortcut. On macOS systems, use the
Command key instead of the Ctrl key.
The change in the displayed font size is not honored when exporting the live script to PDF, Microsoft
Word, HTML, or LaTeX.
19-10
Create Live Scripts in the Live Editor
1 On the Live Editor tab, in the File section, select Save > Save As....
2 In the dialog box that appears, select MATLAB Code files (UTF-8) (*.m) as the Save as
type.
3 Click Save.
See Also
More About
• “Format Text in the Live Editor” on page 19-21
• “Create and Run Sections in Code” on page 18-5
• “Modify Figures in Live Scripts” on page 19-12
• MATLAB Live Script Gallery
19-11
19 Live Scripts and Functions
Explore Data
You can pan, zoom, and rotate a figure in your script using the tools that appear in the upper-right
corner of the figure axes when you hover over the figure.
To undo or redo an action, click or at the upper right corner of the toolstrip.
Note When you open a saved live script, appears next to each output figure, indicating that the
interactive tools are not available yet. To make these tools available, run the live script.
Suppose that you want to explore the health information for 100 different patients. Create a live
script called patients.mlx and add code that loads the data and adds a scatter plot that shows the
height versus weight of two groups of patients, female and male. Run the code by going to the Live
Editor tab and clicking Run.
load patients
figure
Gender = categorical(Gender);
scatter(Height(Gender=='Female'),Weight(Gender=='Female'));
hold on
scatter(Height(Gender=='Male'),Weight(Gender=='Male'));
hold off
19-12
Modify Figures in Live Scripts
Explore the points where the patient height is 64 inches. Select the button and click one of the data
points where height is 64. MATLAB zooms into the figure.
19-13
19 Live Scripts and Functions
For example, in the live script patients.mlx, after zooming in on patients with a height of 64, click
the Update Code button. MATLAB adds the generated code after the line containing the code for
creating the plot.
xlim([61.31 69.31])
ylim([116.7 183.3])
If MATLAB is unable to determine where to place the generated code, the Update Code button is
disabled. This occurs, for example, if you modify the code without running the script again. In this
case, use the Copy button to copy the generated code into the clipboard. You then can paste the code
into your script at the appropriate location.
annotation button. To undo or redo a formatting or annotation action, click or at the upper
right corner of the toolstrip.
•
Title — Add a title to the axes. To modify an existing title, click the existing title and enter
the modified text.
•
X-Label, Y-Label — Add a label to the axes. To modify an existing label, click the
existing label and enter the modified text.
•
Legend — Add a legend to the figure. To modify the existing legend descriptions, click the
existing descriptions and enter the modified text. Select Remove Legend from the Annotations
section to remove the legend from the axes.
•
Colorbar — Add a color bar legend to the figure. Select Remove Colorbar from the
Annotations section to remove the color bar legend from the axes.
•
Grid, X-Grid, Y-Grid — Add grid lines to the figure. Select Remove Grid from
the Annotations section to remove all the grid lines from the axes.
•
Line, Arrow, Text Arrow, Double Arrow — Add a line or arrow
annotation to the figure. Draw the arrow from tail to head. To move an existing annotation, click
19-14
Modify Figures in Live Scripts
the annotation to select it and drag it to the desired location. Press the Delete key to delete the
selected annotation.
For example, suppose that you want to add formatting and annotations to the figure in
patients.mlx.
1
Add a title — In the Annotations section, select Title. A blue rectangle appears
prompting you to enter text. Type the text Weight vs. Height and press Enter.
2
Add X and Y Labels — In the Annotations section, select X-Label. A blue rectangle
appears prompting you to enter text. Type the text Height and press Enter. Select Y-
Label. A blue rectangle appears prompting you to enter text. Type the text Weight and press
Enter.
3
Add a legend — In the Annotations section, select Legend. A legend appears at the top
right corner of the axes. Click the data1 description in the legend and replace the text with
Female. Click the data2 description in the legend and replace the text with Male. Press Enter.
4
Add grid lines — In the Annotations section, select Grid. Grid lines appear in the axes.
5
Add an arrow annotation — In the Annotations section, select Text Arrow. Drawing
the arrow from tail to head, position the arrow on the scatter plot pointing to the lightest patient.
Enter the text Lightest Patient and press Enter
6 Update the code — In the selected figure, click the Update Code button. The live script now
contains the code needed to reproduce the figure changes.
grid on
legend({'Female','Male'})
title('Weight vs Height')
xlabel('Height')
ylabel('Weight')
annotation('textarrow',[0.455 0.3979],[0.3393 0.13],'String','Lightest Patient');
19-15
19 Live Scripts and Functions
For example, suppose that you want to compare the blood pressure of smoking and non-smoking
patients. Create a live script called patients_smoking.mlx and add code that loads the health
information for 100 different patients.
load patients
Run the code by going to the Live Editor tab and clicking Run.
Add a scatter plot that shows the systolic blood pressure of patients that smoke versus the systolic
blood pressure of patients that do not smoke. Run the code.
figure
scatter(Age(Smoker==1),Systolic(Smoker==1));
hold on
19-16
Modify Figures in Live Scripts
scatter(Age(Smoker==0),Systolic(Smoker==0));
hold off
In the Figure tab, select Subplot and choose the layout for two horizontal graphs.
In the newly created figure, click the Update Code button. The live script now contains the code
needed to reproduce the two subplots.
subplot(2,1,1,gca)
subplot(2,1,2)
Add a scatter plot that shows the diastolic blood pressure of patients that smoke versus the diastolic
blood pressure of patients that do not smoke. Run the code.
scatter(Age(Smoker==1),Diastolic(Smoker==1));
hold on
scatter(Age(Smoker==0),Diastolic(Smoker==0));
hold off
Add formatting:
1
Add titles to each subplot — In the Annotations section, select Title. A blue rectangle
appears in each subplot prompting you to enter text. Type the text Systolic Blood Pressure
of Smokers vs Non-Smokers in the first subplot and Diastolic Blood Pressure of
Smokers vs Non-Smokers in the second subplot and press Enter.
19-17
19 Live Scripts and Functions
2
Add grid lines to each subplot — In the Annotations section, select Grid. An Add Grid
button appears on each subplot. Click the Add Grid button on each subplot. Grid lines appear in
both subplots.
19-18
Modify Figures in Live Scripts
3 Update the code — In the selected figure, click the Update Code button. The live script now
contains the code needed to reproduce the figure changes.
subplot(2,1,1)
grid on
title('Systolic Blood Pressure of Smokers vs Non-Smokers')
subplot(2,1,2)
grid on
title('Diastolic Blood Pressure of Smokers vs Non-Smokers')
19-19
19 Live Scripts and Functions
1
Click the button in the upper-right corner of the output. This opens the figure in a separate
figure window.
2 a To save the figure — Select File > Save As. For more information on saving figures, see
“Save Plot as Image or Vector Graphics File” or “Save Figure to Reopen in MATLAB Later”.
b To print the figure — Select File > Print. For more information on printing figures, see
“Print Figure from File Menu”.
Note Any changes made to the figure in the separate figure window are not reflected in the live
script. Similarly, any changes made to the figure in the live script are not reflected in the open figure
window.
See Also
Related Examples
• “Format Text in the Live Editor” on page 19-21
• “Create and Run Sections in Code” on page 18-5
19-20
Format Text in the Live Editor
To insert a new item, go to the Insert tab and select from the available options:
19-21
19 Live Scripts and Functions
• Alt Text — Add text to the edit field to specify alternative text
for the image.
• Alignment — Select from the available options to specify how
the image aligns with the other items in the row.
• Size — To specify a size relative to the original image size,
select Relative (%) and specify the width and height of the
image as a percentage of the original image. To specify an
absolute size, select Absolute (px) and specify the width and
height of the image in pixels. Select Keep Aspect Ratio to
maintain the aspect ratio while resizing.
Hyperlink Insert a You can insert hyperlinks only in text lines. If you insert a
hyperlink. hyperlink into a code line, MATLAB places the hyperlink in a new
text line directly under the selected code line.
To format existing text, use any of the options included in the Live Editor tab Text section:
19-22
Format Text in the Live Editor
Heading 1
Heading 2
Heading 3
Title
Text Alignment Left
Center
Right
Lists Numbered list
Bulleted list
Standard
Bold
Formatting
Italic
Underline
Monospace
To change the case of selected text or code from all uppercase to lowercase, or vice versa, select the
text, right-click, and select Change Case. You also can press Ctrl+Shift+A. If the text contains both
uppercase and lowercase text, MATLAB changes the case to all uppercase.
Change Fonts
You can adjust the displayed font size in the Live Editor, or use settings to change the font name,
style, size, and color of code and text.
To increase or decrease the displayed font size in the Live Editor, zoom in or out using the Ctrl +
Plus (+) and Ctrl + Minus (-) keyboard shortcuts or by holding Ctrl and scrolling with the mouse.
On macOS systems, use the Command key instead of the Ctrl key. The change in the displayed font
size is not honored when exporting the live script to PDF, Microsoft Word, HTML, or LaTeX.
To change the font name, style, size, and color of code and text, using settings. For example, this code
changes the color and style of titles in the Live Editor:
19-23
19 Live Scripts and Functions
s = settings;
s.matlab.fonts.editor.title.Style.PersonalValue = {'bold'};
s.matlab.fonts.editor.title.Color.PersonalValue = [0 0 255 1];
This code increases the size and changes the font name of normal text in the Live Editor:
s = settings;
s.matlab.fonts.editor.normal.Size.PersonalValue = 20;
s.matlab.fonts.editor.normal.Name.PersonalValue = 'Calibri';
The Live Editor updates all open live scripts and live functions to show the selected fonts. When you
create new live scripts or functions, the selected fonts are applied as well.
Autoformatting
For quick formatting in live scripts and functions, you can use a combination of keyboard shortcuts
and character sequences. Formatting appears after you enter the final character in a sequence.
This table shows a list of formatting styles and their available keyboard shortcuts and autoformatting
sequences.
19-24
Format Text in the Live Editor
--- + Enter
*** + Enter
Bulleted list * text Ctrl + Alt + U
- text
+ text
Numbered list number. text Ctrl + Alt + O
Italic *text* Ctrl + I
_text_
Bold **text** Ctrl + B
__text__
Bold and italic ***text*** Ctrl + B, then Ctrl + I
___text___
Monospace `text` Ctrl + M
|text|
Underline None Ctrl + U
LaTeX equation $LaTeX$ Ctrl + Shift + L
Hyperlink URL + Space or Ctrl + K
Enter
<URL>
[Label](URL)
Trademark, (TM) None
service mark,
and copyright (SM)
symbols (™, ℠,
®, and ©) (R)
(C)
Note Title, heading, section break, and list sequences must be entered at the beginning of a line.
Sometimes you want an autoformatting sequence such as *** to appear literally. To display the
characters in the sequence, escape out of the autoformatting by pressing the Backspace key or by
19-25
19 Live Scripts and Functions
clicking Undo . For example, if you type ## text + Enter, a heading in the Heading 1 style with
the word text appears. To undo the formatting style and simply display ## text, press the
Backspace key. You only can escape out of a sequence directly after completing it. After you enter
another character or move the cursor, escaping is no longer possible.
To revert the autoformatting for LaTeX equations and hyperlinks, use the Backspace key at any
point.
To force formatting to reappear after escaping out of a sequence, click the Redo button. You only
can redo an action directly after escaping it. After you enter another character or move the cursor,
the redo action is no longer possible. In this case, to force the formatting to reappear, delete the last
character in the sequence and type it again.
To disable all or certain autoformatting sequences, you can adjust the “Editor/Debugger
Autoformatting Preferences”.
See Also
More About
• “Insert Equations into the Live Editor” on page 19-27
• “Share Live Scripts and Functions” on page 19-57
19-26
Insert Equations into the Live Editor
There are two ways to insert an equation into a live script or function.
• Insert an equation interactively — You can build an equation interactively by selecting from a
graphical display of symbols and structures.
• Insert a LaTeX equation — You can enter LaTeX commands and the Live Editor inserts the
corresponding equation.
2 Build your equation by selecting symbols, structures, and matrices from the options displayed in
the Equation tab. View additional options by clicking the to the right of each section.
When adding or editing a matrix, a context menu appears, which you can use to delete and insert
rows and columns. You also can use the context menu to change or remove matrix delimiters.
19-27
19 Live Scripts and Functions
3 Format your equation using the options available in the Text section. Formatting is only available
for text within the equation. Numbers and symbols cannot be formatted. The formatting option is
disabled unless the cursor is placed within text that can be formatted.
The equation editor provides a few shortcuts for adding elements to your equation:
• To insert symbols, structures, and matrices, type a backslash followed by the name of the symbol.
For example, type \pi to insert a π symbol into the equation. To discover the name of a symbol or
structure, hover over the corresponding button in the Equation tab. You can also type backslash
in the equation editor to bring up a completion menu of all supported names.
Note Although the \name syntax closely resembles LaTeX command syntax, entering full LaTeX
expressions is not supported when inserting equations interactively.
• To insert subscripts, superscripts, and fractions, use the symbols ‘_’, ‘^’ or ‘/’. For example:
19-28
Insert Equations into the Live Editor
The preview pane shows a preview of equation as it would appear in the live script.
3 To include a description of the LaTeX equation when exporting the live script to HTML, add text
to the Alt Text field. For example, you can enter the text Maclaurin series for sin(x).
The description specifies alternative text for the equation and is saved as an alt attribute in the
HTML document. It is used to provide additional information for the equation if, for example, a
user is using a screen reader.
4 Press OK to insert the equation into your live script.
LaTeX expressions describe a wide range of equations. This table shows several examples of LaTeX
expressions and their appearance when inserted into a live script.
\int_{0}^{2} x^2\sin(x) dx
∫ x sin(x)dx
2
2
0
19-29
19 Live Scripts and Functions
MATLAB supports most standard LaTeX math mode commands. These tables show a list of supported
LaTeX commands.
Non-ASCII Letters
Greek/Hebrew Letters
19-30
Insert Equations into the Live Editor
Operator Symbols
Relation Symbols
Note The leq, geq, equiv, approx, cong, sim, simeq, models, ni, succ, succeq, prec, preceq,
parallel, subset, supset, subseteq, and supseteq commands can be combined with the not
command to create the negated version of the symbol. For example, \not\leq creates the symbol ≰.
19-31
19 Live Scripts and Functions
Arrows
Brackets
Bigg, Biggl,
Biggr, Biggm
Misc Symbols
19-32
Insert Equations into the Live Editor
ℜ Re j ′ prim
Note The exists command can be combined with the not command to create the negated version
of the symbol. For example, \not\exists creates the symbol ∄.
Accents
Functions
Math Constructs
19-33
19 Live Scripts and Functions
∫
a
c d
Note To create a matrix using the matrix and pmatrix commands, use the & symbol to separate
columns, and \cr to separate rows. For example, to create a 2–by–2 matrix, use the expression
\matrix{a & b \cr c & d}.
White Space
Text Styling
19-34
Insert Equations into the Live Editor
See Also
Related Examples
• “Share Live Scripts and Functions” on page 19-57
External Websites
• https://www.latex-project.org/
19-35
19 Live Scripts and Functions
Insert Controls
To insert a control into a live script, go to the Live Editor tab, and in the Code section, click
Control. Then, select from the available options. To replace an existing value with a control, select
the value and then insert the control. The Control menu only shows options available for the selected
value.
The value to the left of the slider is its For more information about specifying
current value. the slider values using variables, see
“Link Variables to Controls” on page
19-37.
Drop-Down List Use drop-down lists to interactively In the Items > Item Labels field,
change the value of a variable by specify the text that you want to
selecting from a list of values. display for each item in the drop-down
list.
Hover over the text displayed in the
drop-down list to see its current value. In the Items > Item Values field,
specify the values for each item in the
drop-down line. Make sure to enclose
text values in quotes or double quotes,
because the Live Editor interprets each
item in the list as code.
19-36
Add Interactive Controls to a Live Script
click Hide Code. To show the code again, click the output inline button or the output on
right button.
When the code is hidden, labels display next to the control. To modify the label for a control, right-
click the control and select Configure Control. Then, in the Label section, enter a label name. This
is also the text that displays on button controls in all views. Press Tab or Enter, or click outside of
the control configuration menu to return to the live script.
To specify the minimum, maximum, and step values for a slider using variables, right-click the control
and select Configure Control. Then, in the Values section, select a workspace variable for Min,
Max, and Step. Only variables with numeric values appear in the drop-down list. If the variables that
you want to select are not listed, try running the live script first to create the variables and add them
to the workspace. Changes to the variables are automatically reflected in the numeric slider.
19-37
19 Live Scripts and Functions
To populate the items in a drop-down list using the values stored in a variable, right-click the control
and select Configure Control. Then, in the Items section, select a workspace variable from the
Variable list. The variable must be a string array to appear in the list. If the variable that you want to
select is not listed, try running the live script first to create the variable and add it to the workspace.
Changes to the variable are automatically reflected in the drop-down list.
For example, create a live script and define the variable lastnames containing a list of last names.
lastnames = ["Houston","Vega","Obrien","Potter","Rivera","Hanson","Fowler","Tran","Briggs"];
Run the live script to create lastnames and add it to the workspace. Then, go to the Live Editor
tab, and in the Code section, select Control > Drop Down. In the Items section of the control
configuration menu, select lastnames as the Variable.
Close the configuration menu to return to the live script. The drop-down list now contains the last
names defined in lastnames.
If you add, remove, or edit the values in lastnames, MATLAB updates the items in the drop-down list
accordingly.
Note If the items in a drop-down list are linked to a variable, and one or more of the values in the
variable are deleted while MATLAB is running, an error can occur if one of the deleted values was the
19-38
Add Interactive Controls to a Live Script
selected list item. To prevent the error from occurring, avoid deleting values from a linked variable
while the live script is running.
To set the default value for a control, right-click the control and select Configure Control. Then, in
the Defaults section, specify a default value by entering the value or by selecting a workspace
variable from the list. The list shows only valid variables for the control. For drop-down lists, select
the default value from the list of items.
To restore the default value for a control, right-click the control and select Restore Default Value.
Tip To link the value of a control to a workspace variable, set the default value for the control to that
variable. The control value is set to the default value and changes as the default value changes. The
control value stays linked to the default value until the control value is changed manually, for
example, by moving the slider thumb of a numeric slider.
Field Options
Run On (slider control only) Select one of these options to specify when the
code runs:
19-39
19 Live Scripts and Functions
Field Options
Run Select one of these options to specify what code
runs when the value of the control changes:
To specify the gender of the patients to plot, insert a drop-down list and select the genderStrings
variable to populate the items in the list. To specify a threshold height and weight, insert two numeric
sliders and select the minHeight, maxHeight, minWeight, and maxWeight variables as the Min
and Max values.
19-40
Add Interactive Controls to a Live Script
To view and interact with the controls, open this example in your browser or in MATLAB.
load patients
genderStrings = ["Female","Male"];
selectedGender = ;
minHeight = min(Height);
maxHeight = max(Height);
minWeight = min(Weight);
maxWeight = max(Weight);
thresholdHeight = ;
thresholdWeight = ;
sp1 = scatter(Height(Gender==selectedGender),Weight(Gender==selectedGender),'blue');
hold on
19-41
19 Live Scripts and Functions
If you share the live script itself as an interactive document, consider hiding the code in the live
script before sharing it. When the code is hidden, the Live Editor only displays labeled controls,
output, and formatted text. To hide the code, click the hide code button to the right of the live
script. You also can go to the View tab, and in the View section, click Hide Code.
If you share the live script as a static PDF, Microsoft Word, HTML, or LaTeX document, the Live
Editor saves the control as code. For example, in the live script shown here, the Live Editor replaces
the slider controls with their current value (68 and 132) and replaces the drop-down control with the
current value of the drop-down ("Female").
19-42
Add Interactive Controls to a Live Script
See Also
More About
• “Add Interactive Tasks to a Live Script” on page 19-44
• “Share Live Scripts and Functions” on page 19-57
19-43
19 Live Scripts and Functions
Tasks represent a series of MATLAB commands. You can display their output either inline or on the
right. To see the MATLAB commands that the task runs, show the generated code.
Insert Tasks
To add a task to a live script, go to the Live Editor tab, click Task , and select from the
available tasks. You also can type the name of the task in a live script code block. As you type, the
Live Editor displays possible matches, and you can select and insert the desired task. For example,
create a live script that creates a vector of data containing an outlier.
Add the Create Plot task to your live script to plot the vector of data.
19-44
Add Interactive Tasks to a Live Script
Add the Clean Outlier Data task to your live script to smooth the noisy data and avoid skewed
results. To add the task, start typing the word clean in the live script and select Clean Outlier
Data from the suggested command completions. In the task, set Input data to A. The task identifies
and fills two outliers in the data and creates the variable cleanedData in the MATLAB workspace
with the stored results. You also can see the results in the output plot for the task. Continue
modifying additional parameters until you are satisfied with the results.
19-45
19 Live Scripts and Functions
To restore all parameter values back to their defaults, click the options button ( ) at the top-right of
the task and select Restore Default Values.
When you are done modifying parameters, you can collapse the task to help with readability. To
collapse the task, click the arrow at the top-left of the task.
19-46
Add Interactive Tasks to a Live Script
Delete Tasks
To delete a task, click the options button ( ) at the top-right of the task and select Remove Task.
Alternatively, select the task and then press the Delete or Backspace key.
A green circular icon at the top-right of the task indicates that the task runs automatically when you
modify the task parameters.
To disable running the section automatically, click the autorun icon. The icon updates to display the
disabled state. To run the task and current section, on the Live Editor tab, click the Run
Section button.
19-47
19 Live Scripts and Functions
Some tasks do not run automatically by default. This default setting ensures optimal performance for
those tasks.
You can use the resulting output argument in subsequent code, including as inputs to additional Live
Editor tasks.
To edit the generated code, click the options button ( ) and select Convert Task to Editable Code.
This option removes the task and replaces it with the generated code, which you then can edit.
19-48
Add Interactive Tasks to a Live Script
See Also
More About
• “Add Interactive Controls to a Live Script” on page 19-36
• “Clean Messy Data and Locate Extrema Using Live Editor Tasks”
• MATLAB Live Script Gallery
19-49
19 Live Scripts and Functions
If you have an existing function, you can open it as a live function in the Live Editor. Opening a
function as a live function creates a copy of the file and leaves the original file untouched. MATLAB
converts publishing markup from the original script to formatted content in the new live function.
To open an existing function (.m) as a live function (.mlx) from the Editor, right-click the document
tab and select Open functionName as Live Function from the context menu.
Alternatively, go to the Editor tab, click Save , and select Save As. Then, set the Save as type: to
MATLAB Live Code Files (*.mlx) and click Save.
Note You must use one of the described conversion methods to convert your function to a live
function. Simply renaming the function with a .mlx extension does not work and can corrupt the file.
If you have an existing large live script or function, you can break it into smaller pieces by
automatically converting selected areas of code into functions or local functions. This is called code
refactoring.
To refactor a selected area of code, select one or more lines of code and on the Live Editor tab, in
the Code section, click Refactor. Then, select from the available options. MATLAB creates a
function with the selected code and replaces the original code with a call to the newly created
function.
Add Code
After you create the live function, add code to the function and save it. For example, add this code
and save it as a function called mymean.mlx. The mymean function calculates the average of the
input list and returns the results.
function a = mymean(v,n)
a = sum(v)/n;
end
19-50
Create Live Functions
Add Help
To document the function, add formatted help text above the function definition. For example, add a
title and some text to describe the functionality. For more information about adding help text to
functions, see “Add Help for Live Functions” on page 19-53.
To run a live function from the Command Window, enter the name of the function in the Command
Window. For example, use mymean.mlx to calculate the mean of 10 sequential numbers from 1 to 10.
mymean(1:10, 10)
ans =
5.5000
You also can call the live function from a live script. For example, create a live script called
mystats.mlx. Add this code that declares an array, determines the length of the array, and passes
both values to the function mymean.
x = 1:10;
n = length(x);
avg = mymean(x,n);
disp(['Average = ', num2str(avg)])
Run the live script. The Live Editor displays the output.
If a live function displays text or returns values, the Live Editor displays the output in the calling live
script, in line with the call to the live function. For example, add a line to mymean that displays the
calculated mean before returning the value:
function a = mymean(v,n)
a = sum(v)/n;
19-51
19 Live Scripts and Functions
When you run mystats, the Live Editor displays the output for mymean with the output from
mystats.
In MATLAB Online, you can use the Run button to run live functions interactively. When you run a
live function using the Run button, the output displays in the Command Window. To run live
functions that require input argument values or any other additional setup, configure the Run
button by clicking Run and adding one or more commands. For more information about configuring
the Run button, see “Configure the Run Button for Functions” on page 20-7.
1 On the Live Editor tab, in the File section, select Save > Save As....
2 In the dialog box that appears, select MATLAB Code files (UTF-8) (*.m) as the Save as
type.
3 Click Save.
See Also
More About
• “Add Help for Live Functions” on page 19-53
19-52
Add Help for Live Functions
Create help text by inserting text at the beginning of the file, immediately before the function
definition line (the line with the function keyword).
For example, create a live function called addme.mlx with this code:
function c = addme(a,b)
switch nargin
case 2
c = a + b;
case 1
c = a + a;
otherwise
c = 0;
end
When you type help addme in the Command Window, the help text displays.
19-53
19 Live Scripts and Functions
The first line of help text, often called the H1 line, typically contains a brief description of the
function. When displaying help for a function, MATLAB first displays the name of the function
followed by the H1 line. Then, MATLAB displays the syntax of the function. Finally, MATLAB displays
any remaining help text.
To add "See also" links, add a text line at the end of the help text that begins with the words See
also followed by a list of function names. If the functions exist on the search path or in the current
folder, the help command displays each of these function names as a hyperlink to its help. Otherwise,
help prints the function names as they appear in the help text.
Note When multiple programs have the same name, the help command determines which help text
to display by applying the rules described in “Function Precedence Order” on page 20-37. However,
if a program has the same name as a built-in function, the Help on Selection option in context
menus always displays documentation for the built-in function.
To enhance the documentation displayed in the Help browser further, you can format the text and add
hyperlinks, images, equations, and example code. For example, in the addme function, select the H1
line and in the Live Editor tab, change the Normal text style to Title. Then, position your cursor at
the end of the second syntax description, go to the Insert tab, and select Equation. Enter the
equation c = a + b and press Esc. Finally, in the Insert tab, select Code Example > MATLAB and
add two examples. For more information about formatting files in the Live Editor, see “Format Text in
the Live Editor” on page 19-21.
19-54
Add Help for Live Functions
Use the doc command to display the help text in a separate browser.
You also can add help to live functions by inserting comments at the beginning of the file. Comments
at the beginning of the file display as help text when you use the help and doc commands, similar to
how text at the beginning of the file displays. For more information about adding help using
comments, see “Add Help for Your Program” on page 20-5.
19-55
19 Live Scripts and Functions
See Also
More About
• “Create Live Functions” on page 19-50
• “Format Text in the Live Editor” on page 19-21
• “Share Live Scripts and Functions” on page 19-57
19-56
Share Live Scripts and Functions
This table shows the different ways to share live scripts and functions.
19-57
19 Live Scripts and Functions
To hide the code, click the hide code button to the right of the live script. You also can go to the
View tab, and in the View section, click Hide Code. To show the code again, click the output
inline button or the output on right button.
See Also
Related Examples
• “Create Live Scripts in the Live Editor” on page 19-6
• “Format Text in the Live Editor” on page 19-21
• MATLAB Live Script Gallery
19-58
Live Code File Format (.mlx)
Source Control
To determine and display code differences between live scripts or functions, use the MATLAB
Comparison Tool.
If you use source control, register the .mlx extension as binary. For more information, see “Register
Binary Files with SVN” on page 34-14 or “Register Binary Files with Git” on page 34-25.
See Also
More About
• “What Is a Live Script or Function?” on page 19-2
• “Create Live Scripts in the Live Editor” on page 19-6
External Websites
• Open Packaging Conventions Fundamentals
• Office Open XML File Formats (ECMA-376)
19-59
19 Live Scripts and Functions
Create a live script in the Live Editor. To create a live script, on the Home tab, click New Live
Script.
Divide your live script into sections. Sections can contain text, code, and output. MATLAB code
appears with a gray background and output appears with a white background. To create a new
section, go to the Live Editor tab and click the Section Break button.
pop = 1×11
75.9950 91.9720 105.7110 123.2030 131.6690 150.6970 179.3230 213.2120 228.5050 250.6
Sections can be run independently. To run the code in a section, go to the Live Editor tab and click
the Run Section button. You can also click the blue bar that appears when you move the mouse to
the left of the section. When you run a section, output and figures appear together with the code that
produced them.
19-60
Introduction to the Live Editor
Add supporting information to the text, including equations, images, and hyperlinks.
Let's try fitting the data with polynomials. We'll use the MATLAB polyfit function to get the
coefficients.
y = ax + b linear
y= ax2 + bx + c quadratic
y = ax3 + bx2 + cx + d . cubic
x = (years-1900)/50;
coef1 = polyfit(x,pop,1)
coef1 = 1×2
98.9924 66.1296
coef2 = polyfit(x,pop,2)
coef2 = 1×3
19-61
19 Live Scripts and Functions
coef3 = polyfit(x,pop,3)
coef3 = 1×4
We can plot the linear, quadratic, and cubic curves fitted to the data. We'll use the polyval function
to evaluate the fitted polynomials at the points in x.
pred1 = polyval(coef1,x);
pred2 = polyval(coef2,x);
pred3 = polyval(coef3,x);
[pred1; pred2; pred3]
ans = 3×11
66.1296 85.9281 105.7266 125.5250 145.3235 165.1220 184.9205 204.7190 224.5174 244.3
75.1904 89.5524 105.1225 121.9007 139.8870 159.0814 179.4840 201.0946 223.9134 247.9
80.1414 88.5622 101.4918 118.1050 137.5766 159.0814 181.7944 204.8904 227.5441 248.9
hold on
plot(years,pred1)
plot(years,pred2)
plot(years,pred3)
ylim([50 300])
legend({'Data' 'Linear' 'Quadratic' 'Cubic'},'Location', 'NorthWest')
hold off
19-62
Introduction to the Live Editor
You can share your live script with other MATLAB users so that they can reproduce your results. You
also can publish your results as PDF, Microsoft® Word, or HTML documents. Add controls to your
live scripts to show users how important parameters affect the analysis. To add controls, go to the
Live Editor tab, click the Control button, and select from the available options.
We can now calculate the predicted population of a given year using our three equations.
year = ;
xyear = (year-1900)/50;
pred1 = polyval(coef1,xyear);
pred2 = polyval(coef2,xyear);
pred3 = polyval(coef3,xyear);
[pred1 pred2 pred3]
ans = 1×3
19-63
19 Live Scripts and Functions
For the year 2010 for example, the linear and cubic fits predict similar values of about 284 million
people, while the quadratic fit predicts a much higher value of about 300 million people.
See Also
More About
• “Create Live Scripts in the Live Editor” on page 19-6
• MATLAB Live Script Gallery
19-64
Accelerate Exploratory Programming Using the Live Editor
The Live Editor displays output together with the code that produced it. To run a section, go to the
Live Editor tab and select the Run Section button. You can also click the blue bar that appears
when you move your mouse to the left edge of a section.
In this example, we explore some highway fatality data. Start by loading the data. The variables are
shown as the column headers of the table.
load fatalities
fatalities(1:10,:)
ans=10×8 table
longitude latitude deaths drivers vehicles vehicleMile
_________ ________ ______ _______ ________ ___________
The Live Editor allows you to divide your program into sections containing text, code, and output. To
create a new section, go to the Live Editor tab and click the Section Break button. The code in a
section can be run independently, which makes it easy to explore ideas as you write your program.
Calculate the fatality rate per one million vehicle miles. From these values we can find the states with
the lowest and highest fatality rates.
states = fatalities.Properties.RowNames;
rate = fatalities.deaths./fatalities.vehicleMiles;
[~, minIdx] = min(rate); % Minimum accident rate
[~, maxIdx] = max(rate); % Maximum accident rate
disp([states{minIdx} ' has the lowest fatality rate at ' num2str(rate(minIdx))])
19-65
19 Live Scripts and Functions
Distribution of Fatalities
You can include visualizations in your program. Like output, plots and figures appear together with
the code that produced them.
We can use a bar chart to see the distribution of fatality rates among the states. There are 11 states
that have a fatality rate greater than 0.02 per million vehicle miles.
histogram(rate,10)
xlabel('Fatalities per Million Vehicle Miles')
ylabel('Number of States')
You can explore your data quickly in the Live Editor by experimenting with parameter values to see
how your results will change. Add controls to change parameter values interactively. To add controls,
go to the Live Editor tab, click the Control button, and select from the available options.
19-66
Accelerate Exploratory Programming Using the Live Editor
We can experiment with the data to see if any of the variables in the table are correlated with
highway fatalities. For example, it appears that highway fatality rates are lower in states with a
higher percentage urban population.
dataToPlot = ;
close % Close any open figures
scatter(fatalities.(dataToPlot),rate) % Plot fatalities vs. selected variable
xlabel(dataToPlot)
ylabel('Percent Fatalities per Million Vehicle Miles')
hold on
xmin = min(fatalities.(dataToPlot));
xmax = max(fatalities.(dataToPlot));
p = polyfit(fatalities.(dataToPlot),rate,1); % Calculate & plot least squares line
plot([xmin xmax], polyval(p,[xmin xmax]))
19-67
19 Live Scripts and Functions
Summarize your results and share your live script with your colleagues. Using your live script, they
can recreate and extend your analysis. You can also save your analysis as HTML, Microsoft® Word, or
PDF documents for publication.
Based on this analysis, we can summarize our findings using a plot of fatality rates and urban
population on a map of the continental United States.
load usastates.mat
figure
geoplot([usastates.Lat], [usastates.Lon], 'black')
geobasemap darkwater
hold on
geoscatter(fatalities.latitude,fatalities.longitude,2000*rate,fatalities.urbanPopulation,'filled'
c = colorbar;
title(c,'Percent Urban')
19-68
Accelerate Exploratory Programming Using the Live Editor
See Also
More About
• “Create Live Scripts in the Live Editor” on page 19-6
• MATLAB Live Script Gallery
19-69
19 Live Scripts and Functions
Overall Approach
Include formatted text as part of the interactive narrative. Use bold, italic, and underlined text to
highlight important words. Use bullets or numbers to format lists.
Estimate the power output from a typical solar panel installation on a specific date, time, and location
by calculating the following:
• Solar time
• Solar declination and solar elevation
• Air mass and the solar radiation reaching the earth's surface
• Radiation on a solar panel given its position, tilt, and efficiency
• Power generated in a day and over the entire year
Use the results of these calculations to plot solar and panel radiation for the example day and
location. Then, plot the expected panel power generation over the course of a year. To streamline the
analysis, use two MATLAB functions created for this example: solarCorrection and
panelRadiation.
Solar Time
Show output together with the code that produced it. To run a section of code, go to the Live Editor
tab and click the Run Section button.
Power generation in a solar panel depends on how much solar radiation reaches the panel. This in
turn depends on the sun's position relative to the panel as the sun moves across the sky. For example,
suppose that you want to calculate power output for a solar panel on June 1st at 12 noon in Boston,
Massachusetts.
lambda = ; % longitude
phi = ; % latitude
19-70
Create an Interactive Narrative with the Live Editor
localTime = datetime
01-Jun-2019 12:00:00
To calculate the sun's position for a given date and time, use solar time. Twelve noon solar time is the
time when the sun is highest in the sky. To calculate solar time, apply a correction to local time. That
correction has two parts:
• A term which corrects for the difference between the observer's location and the local meridian.
• An orbital term related to the earth's orbital eccentricity and axial tilt.
solarTime = datetime
01-Jun-2019 12:18:15
Include equations to describe the underlying mathematics. Create equations using LaTeX commands.
To add a new equation, go to the Insert tab and click the Equation button. Double-click an equation
to edit it in the Equation Editor.
The solar declination (δ) is the angle of the sun relative to the earth's equatorial plane. The solar
∘ ∘
declination is 0 at the vernal and autumnal equinoxes, and rises to a maximum of 23 . 45 at the
summer solstice. Calculate the solar declination for a given day of the year (d) using the equation
−1 360
δ = sin sin(23 . 45)sin (d − 81)
365
Then, use the declination (δ), the latitude (ϕ), and the hour angle (ω) to calculate the sun's elevation
(α) at the current time. The hour angle is the number of degrees of rotation of the earth between the
current solar time and solar noon.
−1
α = sin sinδsinϕ + cosδcosϕcosω
Calculate the time of sunrise and sunset in Standard Time using the sun's declination and the local
latitude.
midnight = dateshift(localTime,'start','day');
sr = 12 - acosd(-tand(phi)*tand(delta))/15 - solarCorr/60;
19-71
19 Live Scripts and Functions
sunrise.Format = 'hh:mm:ss';
sunset.Format = 'hh:mm:ss';
disp('Sunrise = ' + string(sunrise) + ' Sunset = ' + string(sunset))
Include images to illustrate important points in your story. To include an image, copy and paste an
image from another source or go to the Insert tab and click the Image button.
As light from the sun passes through the earth's atmosphere, some of the solar radiation is absorbed.
Air mass is the length of the path of light through the atmosphere (Y) relative to the shortest possible
path (X) when the sun's elevation is 90∘, as shown in the diagram below. It is a function of solar
elevation (α).
The larger the air mass, the less radiation reaches the ground. Calculate the air mass using the
equation
1
AM = −1 . 6364
cos(90 − α) + 0 . 5057(6 . 0799 + α) .
Then, calculate the solar radiation reaching the ground (in kilowatts per square meter) using the
empirical equation
0 . 678
sRad = 1 . 353 * 0 . 7 AM .
AM = 1/(cosd(90-alpha) + 0.50572*(6.07955+alpha)^-1.6354);
solarRad = 1.353*0.7^(AM^0.678); % kW/m^2
disp(['Air Mass = ' num2str(AM) ' Solar Radiation = ' num2str(solarRad) ' kW/m^2'])
19-72
Create an Interactive Narrative with the Live Editor
Use hyperlinks to reference supporting information from other sources. To add a hyperlink, go to the
Insert tab and click the Hyperlink button.
Panels installed with a solar tracker can move with the sun and receive 100% of the sun's radiation as
the sun moves across the sky. However, most solar cell installations have panels set at a fixed azimuth
and tilt. Therefore, the actual radiation reaching the panel also depends on the solar azimuth. The
solar azimuth (γ) is the compass direction of the sun's position in the sky. At solar noon in the
∘
Northern hemisphere the solar azimuth is180 corresponding to the direction south. Calculate the
solar azimuth using the equation
sinδcosϕ − cosδsinϕcosω
cos−1 for solar time ≤ 12
cosα
γ=
∘ sinδcosϕ − cosδsinϕcosω
360 − cos−1 for solar time > 12
cosα
In the northern hemisphere, a typical solar panel installation has panels oriented toward the south
∘ ∘
with a panel azimuth (β) of 180 . At northern latitudes, a typical tilt angle (τ) is 35 . Calculate the
panel radiation for fixed panels from the total solar radiation using the equation
Modify parameters using interactive controls. Display plots together with the code that produced
them.
Panel Radiation
For a given day of the year, calculate the total solar radiation and the radiation on the panel. To
simplify the analysis, use the panelRadiation function. Try different dates to see how the solar and
panel radiation change depending on the time of year.
selectedMonth = ;
selectedDay = ;
selectedDate = datetime(2019,selectedMonth,selectedDay);
[times,solarRad,panelRad] = panelRadiation(selectedDate,lambda,phi,UTCoff,tau,beta) ;
19-73
19 Live Scripts and Functions
plot(times,solarRad,times,panelRad)
Power Generation
So far, the calculations assume that all of the radiation reaching the panel is available to generate
power. However, solar panels do not convert 100% of available solar radiation into electricity. The
efficiency of a solar panel is the fraction of the available radiation that is converted. The efficiency of
a solar panel depends on the design and materials of the cell.
Typically, a residential installation includes 20m2 of solar panels with an efficiency of 25%. Modify the
parameters below to see how efficiency and size affect panel power generation.
selectedDate.Format = 'dd-MMM-yyyy';
disp('Expected daily electical output for ' + string(selectedDate) + ' = ' + num2str(dayPower) +
19-74
Create an Interactive Narrative with the Live Editor
Hover over a plot to interact with it. Interacting with a plot in the Live Editor will generate code that
you can then add to your script.
Repeat the calculation to estimate power generation for each day of the year.
plot(yearDates,dailyPower)
title('Yearly Power Generation')
xlabel('Date');
ylabel('Power Generation, kW-hrs')
yearlyPower = sum(dailyPower);
disp(['Expected annual power output = ' num2str(yearlyPower) ' kW-hrs'])
19-75
19 Live Scripts and Functions
Use a heatmap to determine how panel tilt affects power generation. The heatmap below shows that
the optimal panel tilt for any location is about 5∘ less than the latitude.
load LatitudeVsTilt.mat
heatmap(powerTbl,'Tilt','Latitude',...
'ColorVariable','Power');
xlabel('Panel Tilt')
ylabel('Latitude')
title('Normalized Power Output')
Share your analysis with colleagues. Invite them to reproduce or extend your analysis. Work
collaboratively using the Live Editor.
In reality, true power output from a solar installation is significantly affected by local weather
conditions. An interesting extension of this analysis would be to see how cloud cover affects the
results. In the US, you can use data from these government websites.
• Use historical local weather data from the National Weather Service website.
19-76
Create an Interactive Narrative with the Live Editor
• Use measured solar radiation data from the National Solar Radiation Database.
See Also
More About
• “Create Live Scripts in the Live Editor” on page 19-6
• “Format Text in the Live Editor” on page 19-21
• MATLAB Live Script Gallery
19-77
19 Live Scripts and Functions
Add equations to explain the underlying mathematics for concepts that you want to teach. To add an
equation, go to the Insert tab and click the Equation button. Then, select from the symbols and
structures in the Equation tab.
Today we're going to talk about finding the roots of 1. What does it mean to find the nth root of 1?
The nth roots of 1 are the solutions to the equation xn − 1 = 0.
For square roots, this is easy. The values are x = ± 1 = ± 1. For higher-order roots, it gets a bit
more difficult. To find the cube roots of 1 we need to solve the equation x3 − 1 = 0. We can factor this
equation to get
x − 1 x2 + x + 1 = 0 .
So the first cube root is 1. Now we can use the quadratic formula to get the second and third cube
roots.
2
−b ± b − 4ac
x=
2a
To execute individual sections of MATLAB code, go to the Live Editor tab and click the Run Section
button. Output appears together with the code that created it. Create sections using the Section
Break button.
In our case a, b, and c are all equal to 1. The other two roots are calculated from these formulas:
a = 1 ; b = 1 ; c = 1;
roots = [];
roots(1) = 1;
roots(2) = (-b + sqrt(b^2 - 4*a*c))/(2*a); % Use the quadratic formula
roots(3) = (-b - sqrt(b^2 - 4*a*c))/(2*a);
disp(roots')
19-78
Create Interactive Course Materials Using the Live Editor
1.0000 + 0.0000i
-0.5000 - 0.8660i
-0.5000 + 0.8660i
Include plots in the Live Editor so students can visualize important concepts.
We can visualize the roots in the complex plane to see their location.
range = 0:0.01:2*pi;
plot(cos(range),sin(range),'k') % Plot the unit circle
axis square; box off
ax = gca;
ax.XAxisLocation = 'origin';
ax.YAxisLocation = 'origin';
hold on
plot(real(roots), imag(roots), 'ro') % Plot the roots
To add supporting information, go to the Insert tab and click the Hyperlink and Image buttons.
Students can use supporting information to explore lecture topics outside of the classroom.
Once you get past n = 3, things get even trickier. For 4th roots we could use the quartic formula
discovered by Lodovico Ferrari in 1540. But this formula is long and unwieldy, and doesn't help us
find roots higher than 4. Luckily, there is a better way, thanks to a 17th century French
mathematician named Abraham de Moivre.
19-79
19 Live Scripts and Functions
Abraham de Moivre was born in Vitry in Champagne on May 26, 1667. He was a contemporary and
friend of Isaac Newton, Edmund Halley, and James Stirling. https://en.wikipedia.org/wiki/
Abraham_de_Moivre
He is best known for de Moivre's theorem that links complex numbers and trigonometry, and for his
work on the normal distribution and probability theory. De Moivre wrote a book on probability theory,
The Doctrine of Chances, said to have been prized by gamblers. De Moivre first discovered Binet's
formula, the closed-form expression for Fibonacci numbers linking the nth power of the golden ratio
φ to the nth Fibonacci number. He was also the first to postulate the Central Limit Theorem, a
cornerstone of probability theory.
de Moivre's theorem states that for any real x and any integer n,
n
cos x + i sin x = cos nx + i sin nx .
How does that help us solve our problem? We also know that for any integer k,
Use the Live Editor to experiment with MATLAB code interactively. Add controls to show students
how important parameters affect the analysis. To add controls, go to the Live Editor tab, click the
Control button, and select from the available options.
We can use this last equation to find the nth roots of 1. For example, for any value of n, we can use
the formula above with values of k = 0…n − 1. We can use this MATLAB code to experiment with
different values of n:
n = ;
roots = zeros(1, n);
for k = 0:n-1
roots(k+1) = cos(2*k*pi/n) + 1i*sin(2*k*pi/n); % Calculate the roots
19-80
Create Interactive Course Materials Using the Live Editor
end
disp(roots')
1.0000 + 0.0000i
0.5000 - 0.8660i
-0.5000 - 0.8660i
-1.0000 - 0.0000i
-0.5000 + 0.8660i
0.5000 + 0.8660i
Plotting the roots in the complex plane shows that the roots are equally spaced around the unit circle
at intervals of 2π/n.
cla
plot(cos(range),sin(range),'k') % Plot the unit circle
hold on
plot(real(roots),imag(roots),'ro') % Plot the roots
Use additional examples to reinforce important concepts. Modify code during the lecture to answer
questions or explore ideas in more depth.
We can find the roots of -1, i, and -i just by using extensions of the approach described above. If we
look at the unit circle we see that the values of 1, i, -1, -i appear at angles 0, π/2, π, and 3π/2
respectively.
19-81
19 Live Scripts and Functions
r = ones(1,4);
theta = [0 pi/2 pi 3*pi/2];
[x,y] = pol2cart(theta,r);
cla
plot(cos(range),sin(range),'k') % Plot the unit circle
hold on
plot(x, y, 'ro') % Plot the values of 1, i, -1, and -i
text(x(1)+0.05,y(1),'1') % Add text labels
text(x(2),y(2)+0.1,'i')
text(x(3)-0.1,y(3),'-1')
text(x(4)-0.02,y(4)-0.1,'-i')
1/n 1/n
i = cos 2k + 1/2 π + i sin 2k + 1/2 π
19-82
Create Interactive Course Materials Using the Live Editor
Homework
Use live scripts as the basis for assignments. Give students the live script used in the lecture and
have them complete exercises that test their understanding of the material.
Exercise 3: Describe the mathematical approach you would use to calculate the nth roots of an
arbitrary complex number. Include the equations you used in your approach.
See Also
More About
• “Create Live Scripts in the Live Editor” on page 19-6
• MATLAB Live Script Gallery
19-83
19 Live Scripts and Functions
To view and interact with the controls, open this example in MATLAB®.
See Also
More About
• “Create Live Scripts in the Live Editor” on page 19-6
• “Add Help for Live Functions” on page 19-53
• “Display Custom Documentation” on page 32-21
• MATLAB Live Script Gallery
19-84
Create an Interactive Form Using the Live Editor
To view and interact with the example, open it in MATLAB®. To view the code for this example in
MATLAB, go to the View tab and click Output Inline or Output on Right.
19-85
19 Live Scripts and Functions
See Also
More About
• “Create Live Scripts in the Live Editor” on page 19-6
19-86
Create an Interactive Form Using the Live Editor
19-87
19 Live Scripts and Functions
To view and interact with the example, open it in MATLAB®. To view the code for this example in
MATLAB, go to the View tab and click Output Inline or Output on Right.
See Also
More About
• “Create Live Scripts in the Live Editor” on page 19-6
• MATLAB Live Script Gallery
19-88
Acknowledgments
Acknowledgments
MATLAB Live Editor uses Antenna House® XSL Formatter. Antenna House is a trademark of Antenna
House, Inc.
19-89
20
Function Basics
function f = fact(n)
f = prod(1:n);
end
This type of function must be defined within a file, not at the command line. Often, you store a
function in its own file. In that case, the best practice is to use the same name for the function and
the file (in this example, fact.m), since MATLAB associates the program with the file name. Save the
file either in the current folder or in a folder on the MATLAB search path.
You can call the function from the command line, using the same syntax rules that apply to functions
installed with MATLAB. For instances, calculate the factorial of 5.
x = 5;
y = fact(5)
y =
120
Starting in R2016b, another option for storing functions is to include them at the end of a script file.
For instance, create a file named mystats.m with a few commands and two functions, fact and
perm. The script calculates the permutation of (3,2).
x = 3;
y = 2;
z = perm(x,y)
function p = perm(n,r)
p = fact(n)/fact(n-r);
end
function f = fact(n)
f = prod(1:n);
end
mystats
z =
20-2
Create Functions in Files
If your function returns more than one output, enclose the output
names in square brackets.
function myFunction(x)
function [] = myFunction(x)
Function name (required) Valid function names follow the same rules as variable names. They
must start with a letter, and can contain letters, digits, or
underscores.
Note To avoid confusion, use the same name for both the function file
and the first function within the file. MATLAB associates your
program with the file name, not the function name. Script files cannot
have the same name as a function in the file.
Input arguments (optional) If your function accepts any inputs, enclose their names in
parentheses after the function name. Separate inputs with commas.
function y = myFunction(one,two,three)
Tip When you define a function with multiple input or output arguments, list any required arguments
first. This ordering allows you to call your function without specifying optional arguments.
Program files can contain multiple functions. If the file contains only function definitions, the first
function is the main function, and is the function that MATLAB associates with the file name.
Functions that follow the main function or script code are called local functions. Local functions are
only available within the file.
20-3
20 Function Basics
End Statements
Functions end with either an end statement, the end of the file, or the definition line for a local
function, whichever comes first. The end statement is required if:
• Any function in the file contains a nested function (a function completely contained within its
parent).
• The function is a local function within a function file, and any local function in the file uses the end
keyword.
• The function is a local function within a script file.
See Also
function
More About
• “Files and Folders that MATLAB Accesses”
• “Base and Function Workspaces” on page 20-9
• “Types of Functions” on page 20-17
• “Add Functions to Scripts” on page 18-12
20-4
Add Help for Your Program
Create help text by inserting comments at the beginning of your program. If your program includes a
function, position the help text immediately below the function definition line (the line with the
function keyword). If the function contains an arguments block, you also can position the help text
immediately below the arguments block.
For example, create a function in a file named addme.m that includes help text:
function c = addme(a,b)
% ADDME Add two values together.
% C = ADDME(A) adds A to itself.
%
% C = ADDME(A,B) adds A and B together.
%
% See also SUM, PLUS.
switch nargin
case 2
c = a + b;
case 1
c = a + a;
otherwise
c = 0;
end
When you type help addme at the command line, the help text displays in the Command Window:
The first help text line, often called the H1 line, typically includes the program name and a brief
description. The Current Folder browser and the help and lookfor functions use the H1 line to
display information about the program.
Create See also links by including function names at the end of your help text on a line that begins
with % See also. If the function exists on the search path or in the current folder, the help
command displays each of these function names as a hyperlink to its help. Otherwise, help prints the
function names as they appear in the help text.
You can include hyperlinks (in the form of URLs) to Web sites in your help text. Create hyperlinks by
including an HTML <a></a> anchor element. Within the anchor, use a matlab: statement to
execute a web command. For example:
End your help text with a blank line (without a %). The help system ignores any comment lines that
appear after the help text block.
20-5
20 Function Basics
Note When multiple programs have the same name, the help command determines which help text
to display by applying the rules described in “Function Precedence Order” on page 20-37. However,
if a program has the same name as a MathWorks function, the Help on Selection option in context
menus always displays documentation for the MathWorks function.
See Also
help | lookfor
Related Examples
• “Add Comments to Code” on page 18-3
• “Create Help for Classes” on page 32-2
• “Create Help Summary Files — Contents.m” on page 32-10
• “Check Which Programs Have Help” on page 32-8
• “Display Custom Documentation” on page 32-21
• “Use Help Files with MEX Functions”
20-6
Configure the Run Button for Functions
To configure the Run button in the Editor, click Run and add one or more run commands.
For example:
1 Create the function myfunction.m that performs a calculation using the inputs x and y and
stores the results in z.
function z = myfunction(x,y)
z = x.^2 + y;
2 Go to the Editor tab and click Run . MATLAB displays the list of commands available for
running the function.
3 Click the last item in the list and replace the text type code to run with a call to the function
including the required input arguments. For example, enter the text result =
myfunction(1:10,5) to run myfunction with the input arguments 1:10 and 5, and store the
results in the variable result. MATLAB replaces the default command with the newly added
command.
To run multiple commands at once, enter the commands on the same line. For example, enter the
text a = 1:10; b = 5; result = myfunction(a,b) to create the variables a and b and
then call myfunction with a and b as the input arguments.
Note If you define a run command that creates a variable with the same name as a variable in
the base workspace, the run command variable overwrites the base workspace variable when you
run that run command.
4
Click the Run button. MATLAB runs the function using the first run command in the list. For
example, click Run to run myfunction using the command result =
myfunction(1:10,5). MATLAB displays the result in the Command Window.
20-7
20 Function Basics
result =
6 9 14 21 30 41 54 69 86
To run the function using a different run command from the list, click Run and select the
desired command. When you select a run command from the list, it becomes the default for the
Run button.
To edit or delete an existing run command, click Run , right-click the command, and then select
Edit or Delete.
Note Running live functions in the Live Editor using the Run button is only supported in MATLAB
Online. When you run a live function using the Run button, the output displays in the Command
Window. To run a live function in an installed version of MATLAB, call the function from the Command
Window or from a script or live script.
See Also
More About
• “Calling Functions”
• “Create Functions in Files” on page 20-2
• “Create Live Functions” on page 19-50
20-8
Base and Function Workspaces
The base workspace stores variables that you create at the command line. This includes any variables
that scripts create, assuming that you run the script from the command line or from the Editor.
Variables in the base workspace exist until you clear them or end your MATLAB session.
Functions do not use the base workspace. Every function has its own function workspace. Each
function workspace is separate from the base workspace and all other workspaces to protect the
integrity of the data. Even local functions in a common file have their own workspaces. Variables
specific to a function workspace are called local variables. Typically, local variables do not remain in
memory from one function call to the next.
When you call a script from a function, the script uses the function workspace.
Like local functions, nested functions have their own workspaces. However, these workspaces are
unique in two significant ways:
• Nested functions can access and modify variables in the workspaces of the functions that contain
them.
• All of the variables in nested functions or the functions that contain them must be explicitly
defined. That is, you cannot call a function or script that assigns values to variables unless those
variables already exist in the function workspace.
See Also
Related Examples
• “Share Data Between Workspaces” on page 20-10
More About
• “Nested Functions” on page 20-27
20-9
20 Function Basics
Introduction
This topic shows how to share variables between workspaces or allow them to persist between
function executions.
In most cases, variables created within a function are local variables known only within that function.
Local variables are not available at the command line or to any other function. However, there are
several ways to share data between functions or workspaces.
For example, create two functions, update1 and update2, that share and modify an input value.
update2 can be a local function in the file update1.m, or can be a function in its own file,
update2.m.
function y1 = update1(x1)
y1 = 1 + update2(x1);
function y2 = update2(x2)
y2 = 2 * x2;
Call the update1 function from the command line and assign to variable Y in the base workspace:
X = [1,2,3];
Y = update1(X)
Y =
3 5 7
Nested Functions
A nested function has access to the workspaces of all functions in which it is nested. So, for example,
a nested function can use a variable (in this case, x) that is defined in its parent function:
function primaryFx
x = 1;
nestedFx
20-10
Share Data Between Workspaces
function nestedFx
x = x + 1;
end
end
When parent functions do not use a given variable, the variable remains local to the nested function.
For example, in this version of primaryFx, the two nested functions have their own versions of x that
cannot interact with each other.
function primaryFx
nestedFx1
nestedFx2
function nestedFx1
x = 1;
end
function nestedFx2
x = 2;
end
end
Persistent Variables
When you declare a variable within a function as persistent, the variable retains its value from one
function call to the next. Other local variables retain their value only during the current execution of
a function. Persistent variables are equivalent to static variables in other programming languages.
Declare variables using the persistent keyword before you use them. MATLAB initializes persistent
variables to an empty matrix, [].
For example, define a function in a file named findSum.m that initializes a sum to 0, and then adds to
the value on each iteration.
function findSum(inputvalue)
persistent SUM_X
if isempty(SUM_X)
SUM_X = 0;
end
SUM_X = SUM_X + inputvalue;
When you call the function, the value of SUM_X persists between subsequent executions.
• clear all
• clear functionname
• Editing the function file
To prevent clearing persistent variables, lock the function file using mlock.
20-11
20 Function Basics
Global Variables
Global variables are variables that you can access from functions or from the command line. They
have their own workspace, which is separate from the base and function workspaces.
• Any function can access and update a global variable. Other functions that use the variable might
return unexpected results.
• If you unintentionally give a “new” global variable the same name as an existing global variable,
one function can overwrite the values expected by another. This error is difficult to diagnose.
If you use global variables, declare them using the global keyword before you access them within
any particular location (function or command line). For example, create a function in a file called
falling.m:
function h = falling(t)
global GRAVITY
h = 1/2*GRAVITY*t.^2;
The two global statements make the value assigned to GRAVITY at the command prompt available
inside the function. However, as a more robust alternative, redefine the function to accept the value
as an input:
function h = falling(t,gravity)
h = 1/2*gravity*t.^2;
Like global variables, these functions carry risks of overwriting existing data. Use them sparingly.
evalin and assignin are sometimes useful for callback functions in graphical user interfaces to
evaluate against the base workspace. For example, create a list box of variable names from the base
workspace:
function listBox
figure
lb = uicontrol('Style','listbox','Position',[10 10 100 100],...
'Callback',@update_listBox);
update_listBox(lb)
20-12
Share Data Between Workspaces
function update_listBox(src,~)
vars = evalin('base','who');
src.String = vars;
For other programming applications, consider argument passing and the techniques described in
“Alternatives to the eval Function” on page 2-86.
See Also
More About
• “Base and Function Workspaces” on page 20-9
20-13
20 Function Basics
Scoping issues can be the source of some coding problems. For instance, if you are unaware that
nested functions share a particular variable, the results of running your code might not be as you
expect. Similarly, mistakes in usage of local, global, and persistent variables can cause unexpected
results.
The Code Analyzer does not always indicate scoping issues because sharing a variable across
functions is not an error—it may be your intent. Use MATLAB function and variable highlighting
features to identify when and where your code uses functions and variables. If you have an active
Internet connection, you can watch the Variable and Function Highlighting video for an overview of
the major features.
For conceptual information on nested functions and the various types of MATLAB variables, see
“Sharing Variables Between Parent and Nested Functions” on page 20-28 and “Share Data Between
Workspaces” on page 20-10.
To enable and disable highlighting or to change the colors, click Preferences and select
MATLAB > Colors > Programming tools. In MATLAB Online, highlighting is enabled by default
and changing the preferences for highlighting is not available.
• Highlights all instances of a given function or local variable in sky blue when you place the cursor
within a function or variable name. For instance:
• Displays a variable with shared scope in teal blue, regardless of the cursor location. For instance:
x = ones(2,10);
20-14
Check Variable Scope in Editor
[n, m] = size(x);
rowTotals = zeros(1,n);
for i = 1:n
rowTotals(i) = addToSum;
end
end
When you run this code, instead of returning the sum of the values in each row and displaying:
ans =
10 10
MATLAB displays:
ans =
0 0 0 0 0 0 0 0 0 10
1
On the Home tab in the Environment section, click Preferences and select MATLAB >
Colors > Programming tools. Ensure that Automatically highlight and Variables with
shared scope are selected.
2 Copy the rowsum code into the Editor.
Notice the variable appears in teal blue, which indicates i is not a local variable. Both the
rowTotals function and the addToSum functions set and use the variable i.
The variable n, at line 6 appears in black, indicating that it does not span multiple functions.
20-15
20 Function Basics
Every reference to i highlights in sky blue and markers appear in the indicator bar on the right
side of the Editor.
A tooltip appears and displays the name of the function or variable and the line of code
represented by the marker.
7 Click a marker to navigate to the line indicated in tooltip for that marker.
This is particularly useful when your file contains more code than you can view at one time in the
Editor.
You can see similar highlighting effects when you click on a function reference. For instance, click on
addToSum.
20-16
Types of Functions
Types of Functions
In this section...
“Local and Nested Functions in a File” on page 20-17
“Private Functions in a Subfolder” on page 20-18
“Anonymous Functions Without a File” on page 20-18
Local functions are subroutines that are available within the same file. Local functions are the most
common way to break up programmatic tasks. In a function file, which contains only function
definitions, local functions can appear in the file in any order after the main function in the file. In a
script file, which contains commands and function definitions, local function must be at the end of the
file. (Functions in scripts are supported in R2016b or later.)
For example, create a function file named myfunction.m that contains a main function,
myfunction, and two local functions, squareMe and doubleMe:
function b = myfunction(a)
b = squareMe(a)+doubleMe(a);
end
function y = squareMe(x)
y = x.^2;
end
function y = doubleMe(x)
y = x.*2;
end
You can call the main function from the command line or another program file, although the local
functions are only available to myfunction:
myfunction(pi)
ans =
16.1528
Nested functions are completely contained within another function. The primary difference between
nested functions and local functions is that nested functions can use variables defined in parent
functions without explicitly passing those variables as arguments.
Nested functions are useful when subroutines share data, such as applications that pass data
between components. For example, create a function that allows you to set a value between 0 and 1
using either a slider or an editable text box. If you use nested functions for the callbacks, the slider
and text box can share the value and each other’s handles without explicitly passing them:
function myslider
value = 0;
f = figure;
s = uicontrol(f,'Style','slider','Callback',@slider);
e = uicontrol(f,'Style','edit','Callback',@edittext,...
20-17
20 Function Basics
'Position',[100,20,100,20]);
function slider(obj,~)
value = obj.Value;
e.String = num2str(value);
end
function edittext(obj,~)
value = str2double(obj.String);
s.Value = value;
end
end
For example, this statement creates a function handle named s for an anonymous function:
s = @(x) sin(1./x);
This function has a single input, x. The @ operator creates the function handle.
You can use the function handle to evaluate the function for particular values, such as
y = s(pi)
y = 0.3130
Or, you can pass the function handle to a function that evaluates over a range of values, such as
fplot:
range = [0.01,0.1];
fplot(s,range)
20-18
Types of Functions
See Also
More About
• “Local Functions” on page 20-25
• “Nested Functions” on page 20-27
• “Private Functions” on page 20-36
• “Anonymous Functions” on page 20-20
20-19
20 Function Basics
Anonymous Functions
In this section...
“What Are Anonymous Functions?” on page 20-20
“Variables in the Expression” on page 20-21
“Multiple Anonymous Functions” on page 20-21
“Functions with No Inputs” on page 20-22
“Functions with Multiple Inputs or Outputs” on page 20-22
“Arrays of Anonymous Functions” on page 20-23
For example, create a handle to an anonymous function that finds the square of a number:
Variable sqr is a function handle. The @ operator creates the handle, and the parentheses ()
immediately after the @ operator include the function input arguments. This anonymous function
accepts a single input x, and implicitly returns a single output, an array the same size as x that
contains the squared values.
Find the square of a particular value (5) by passing the value to the function handle, just as you
would pass an input argument to a standard function.
a = sqr(5)
a =
25
Many MATLAB functions accept function handles as inputs so that you can evaluate functions over a
range of values. You can create handles either for anonymous functions or for functions in program
files. The benefit of using anonymous functions is that you do not have to edit and maintain a file for a
function that requires only a brief definition.
For example, find the integral of the sqr function from 0 to 1 by passing the function handle to the
integral function:
q = integral(sqr,0,1);
You do not need to create a variable in the workspace to store an anonymous function. Instead, you
can create a temporary function handle within an expression, such as this call to the integral
function:
q = integral(@(x) x.^2,0,1);
20-20
Anonymous Functions
For example, create a handle to an anonymous function that requires coefficients a, b, and c.
a = 1.3;
b = .2;
c = 30;
parabola = @(x) a*x.^2 + b*x + c;
Because a, b, and c are available at the time you create parabola, the function handle includes
those values. The values persist within the function handle even if you clear the variables:
clear a b c
x = 1;
y = parabola(x)
y =
31.5000
To supply different values for the coefficients, you must create a new function handle:
a = -3.9;
b = 52;
c = 0;
parabola = @(x) a*x.^2 + b*x + c;
x = 1;
y = parabola(1)
y =
48.1000
You can save function handles and their associated values in a MAT-file and load them in a subsequent
MATLAB session using the save and load functions, such as
Use only explicit variables when constructing anonymous functions. If an anonymous function
accesses any variable or nested function that is not explicitly referenced in the argument list or body,
MATLAB throws an error when you invoke the function. Implicit variables and function calls are often
encountered in the functions such as eval, evalin, assignin, and load. Avoid using these
functions in the body of anonymous functions.
20-21
20 Function Basics
The final function allows you to solve the equation for any value of c. For example:
g(2)
ans =
2.3333
t = @() datestr(now);
d = t()
d =
26-Jan-2012 15:11:47
Omitting the parentheses in the assignment statement creates another function handle, and does not
execute the function:
d = t
d =
@() datestr(now)
x = 1;
y = 10;
z = myfunction(x,y)
z = 111
20-22
Anonymous Functions
However, an anonymous function returns only one output. If the expression in the function returns
multiple outputs, then you can request them when you invoke the function handle.
For example, the ndgrid function can return as many outputs as the number of input vectors. This
anonymous function that calls ndgrid returns only one output (mygrid). Invoke mygrid to access
the outputs returned by the ndgrid function.
c = 10;
mygrid = @(x,y) ndgrid((-x:x/c:x),(-y:y/c:y));
[x,y] = mygrid(pi,2*pi);
You can use the output from mygrid to create a mesh or surface plot:
z = sin(x) + cos(y);
mesh(x,y,z)
f = {@(x)x.^2;
@(y)y+10;
@(x,y)x.^2+y+10};
20-23
20 Function Basics
When you create the cell array, keep in mind that MATLAB interprets spaces as column separators.
Either omit spaces from expressions, as shown in the previous code, or enclose expressions in
parentheses, such as
f = {@(x) (x.^2);
@(y) (y + 10);
@(x,y) (x.^2 + y + 10)};
Access the contents of a cell using curly braces. For example, f{1} returns the first function handle.
To execute the function, pass input values in parentheses after the curly braces:
x = 1;
y = 10;
f{1}(x)
f{2}(y)
f{3}(x,y)
ans =
1
ans =
20
ans =
21
See Also
More About
• “Create Function Handle” on page 13-2
• “Types of Functions” on page 20-17
20-24
Local Functions
Local Functions
This topic explains the term local function, and shows how to create and use local functions.
MATLAB program files can contain code for more than one function. In a function file, the first
function in the file is called the main function. This function is visible to functions in other files, or
you can call it from the command line. Additional functions within the file are called local functions,
and they can occur in any order after the main function. Local functions are only visible to other
functions in the same file. They are equivalent to subroutines in other programming languages, and
are sometimes called subfunctions.
As of R2016b, you can also create local functions in a script file, as long as they all appear after the
last line of script code. For more information, see “Add Functions to Scripts” on page 18-12.
For example, create a function file named mystats.m that contains a main function, mystats, and
two local functions, mymean and mymedian.
function a = mymean(v,n)
% MYMEAN Example of a local function.
a = sum(v)/n;
end
function m = mymedian(v,n)
% MYMEDIAN Another example of a local function.
w = sort(v);
if rem(n,2) == 1
m = w((n + 1)/2);
else
m = (w(n/2) + w(n/2 + 1))/2;
end
end
The local functions mymean and mymedian calculate the average and median of the input list. The
main function mystats determines the length of the list n and passes it to the local functions.
Although you cannot call a local function from the command line or from functions in other files, you
can access its help using the help function. Specify names of both the file and the local function,
separating them with a > character:
help mystats>mymean
Local functions in the current file have precedence over functions in other files. That is, when you call
a function within a program file, MATLAB checks whether the function is a local function before
looking for other main functions. Therefore, you can create an alternate version of a particular
function while retaining the original in another file.
20-25
20 Function Basics
All functions, including local functions, have their own workspaces that are separate from the base
workspace. Local functions cannot access variables used by other functions unless you pass them as
arguments. In contrast, nested functions (functions completely contained within another function)
can access variables used by the functions that contain them.
See Also
localfunctions
More About
• “Nested Functions” on page 20-27
• “Function Precedence Order” on page 20-37
• “Types of Functions” on page 20-17
20-26
Nested Functions
Nested Functions
In this section...
“What Are Nested Functions?” on page 20-27
“Requirements for Nested Functions” on page 20-27
“Sharing Variables Between Parent and Nested Functions” on page 20-28
“Using Handles to Store Function Parameters” on page 20-29
“Visibility of Nested Functions” on page 20-31
For example, this function named parent contains a nested function named nestedfx:
function parent
disp('This is the parent function')
nestedfx
function nestedfx
disp('This is the nested function')
end
end
The primary difference between nested functions and other types of functions is that they can access
and modify variables that are defined in their parent functions. As a result:
• Nested functions can use variables that are not explicitly passed as input arguments.
• In a parent function, you can create a handle to a nested function that contains the data necessary
to run the nested function.
20-27
20 Function Basics
This means that both a nested function and a function that contains it can modify the same variable
without passing that variable as an argument. For example, in each of these functions, main1 and
main2, both the main function and the nested function can access variable x:
When parent functions do not use a given variable, the variable remains local to the nested function.
For example, in this function named main, the two nested functions have their own versions of x that
cannot interact with each other:
function main
nestedfun1
nestedfun2
function nestedfun1
x = 1;
end
function nestedfun2
x = 2;
end
end
Functions that return output arguments have variables for the outputs in their workspace. However,
parent functions only have variables for the output of nested functions if they explicitly request them.
For example, this function parentfun does not have variable y in its workspace:
function parentfun
x = 5;
nestfun;
function y = nestfun
y = x + 1;
end
end
function parentfun
x = 5;
z = nestfun;
function y = nestfun
20-28
Nested Functions
y = x + 1;
end
end
• Input arguments
• Variables defined within the nested function
• Variables defined in a parent function, also called externally scoped variables
When you create a function handle for a nested function, that handle stores not only the name of the
function, but also the values of externally scoped variables.
For example, create a function in a file named makeParabola.m. This function accepts several
polynomial coefficients, and returns a handle to a nested function that calculates the value of that
polynomial.
function p = makeParabola(a,b,c)
p = @parabola;
function y = parabola(x)
y = a*x.^2 + b*x + c;
end
end
The makeParabola function returns a handle to the parabola function that includes values for
coefficients a, b, and c.
At the command line, call the makeParabola function with coefficient values of 1.3, .2, and 30. Use
the returned function handle p to evaluate the polynomial at a particular point:
p = makeParabola(1.3,.2,30);
X = 25;
Y = p(X)
Y =
847.5000
Many MATLAB functions accept function handle inputs to evaluate functions over a range of values.
For example, plot the parabolic equation from -25 to +25:
fplot(p,[-25,25])
20-29
20 Function Basics
You can create multiple handles to the parabola function that each use different polynomial
coefficients:
firstp = makeParabola(0.8,1.6,32);
secondp = makeParabola(3,4,50);
range = [-25,25];
figure
hold on
fplot(firstp,range)
fplot(secondp,range,'r:')
hold off
20-30
Nested Functions
• From the level immediately above it. (In the following code, function A can call B or D, but not C or
E.)
• From a function nested at the same level within the same parent function. (Function B can call D,
and D can call B.)
• From a function at any lower level. (Function C can call B or D, but not E.)
function A(x, y) % Main function
B(x,y)
D(y)
20-31
20 Function Basics
The easiest way to extend the scope of a nested function is to create a function handle and return it
as an output argument, as shown in “Using Handles to Store Function Parameters” on page 20-29.
Only functions that can call a nested function can create a handle to it.
See Also
More About
• “Resolve Error: Attempt to Add Variable to a Static Workspace.” on page 20-33
• “Create Function Handle” on page 13-2
• “Checking Number of Arguments in Nested Functions” on page 21-8
• “Types of Functions” on page 20-17
20-32
Resolve Error: Attempt to Add Variable to a Static Workspace.
Issue
The workspaces for nested and anonymous functions are static. This means that all variables used
within the function must be present in the text of the code.
If you attempt to dynamically add a variable to the static workspace of an anonymous function, a
nested function, or a function that contains a nested function, then MATLAB issues an error of the
form
For more information about the differences between the base and function workspaces, see “Base
and Function Workspaces” on page 20-9. For more information about nested functions, see “Nested
Functions” on page 20-27.
Possible Solutions
Declare Variable in Advance
One way to avoid dynamically adding a variable to static workspaces is to explicitly declare the
variable in the code before dynamically assigning a value to that variable. Doing so will cause the
variable name to be visible to MATLAB, so the name will be included in the fixed set of variables that
make up the static workspace.
For example, suppose a script named makeX.m dynamically assigns a value to variable X. A function
that calls makeX and explicitly declares X avoids the dynamic adding error because X is in the
function workspace.
function noerror
nestedfx
function nestedfx
X = [];
makeX
end
end
Using eval, evalin, or assignin to assign new variables inside of a nested functions will generate
an error.
function staticWorkspaceErrors
function nest
% This will error since x is not declared outside of the eval
eval("x=2");
end
end
20-33
20 Function Basics
If possible, avoid these functions altogether. See “Alternatives to the eval Function” on page 2-86. If it
is not possible to avoid them, then explicitly declare the variable within the parent function:
function noStaticWorkspaceErrors
x = [];
function nest
% This will not error since 'x' is declared outside of the eval
eval("x=2");
end
end
Calling a MATLAB script that creates a variable inside of a nested function will generate an error. In
the example below, the script, scriptThatIntroducesZ, contains code that assigns a value to the
variable z. Since the code does not explicitly declare that z is being assigned an error will be thrown.
function staticWorkspaceErrors
function nest
% This will error since 'z' is not declared outside of this script
scriptThatIntroducesZ
end
end
To avoid an error, declare the variable within the function before calling the script that assigns a
value to it.
function noStaticWorkspaceErrors
function nest
% This will not error since 'z' is declared outside of the script
z = [];
scriptThatIntroducesZ
end
end
Alternatively, convert the script to a function and make z it's output argument. This approach also
makes the code clearer.
Using load to assign variables inside of a nested function, without explicitly specifying the variable
name will generate an error. In the example below, load is used to load a MAT-file containing the
variable Y. Since the code does not explicitly declare that Y is being assigned an error will be thrown.
function staticWorkspaceErrors
function nest
% This will error since var Y is not explicitly specified
load MatFileWithVarY
end
end
To avoid an error, instead specify the variable name as an input to the load function.
function noStaticWorkspaceErrors
function nest
% This will not error since variables 'x' and 'y' are specified
load MatFileWithVarX x
y = load('MatFileWithVarY','y');
20-34
Resolve Error: Attempt to Add Variable to a Static Workspace.
end
end
Alternatively, assign the output from the load function to a structure array.
While debugging, you cannot add a variable using the debug command prompt if you are stopped in a
nested function. Assign the variable into the base workspace, which is not static.
K>> assignin('base','X',myvalue)
Anonymous functions cannot contain variable assignments. When the anonymous function is called an
error will be thrown.
Rewrite the function in such a way that variable assignments are not required.
xEquals2 = @()2;
x = xEquals2()
x =
See Also
More About
• “Base and Function Workspaces” on page 20-9
• “Nested Functions” on page 20-27
20-35
20 Function Basics
Private Functions
This topic explains the term private function, and shows how to create and use private functions.
Private functions are useful when you want to limit the scope of a function. You designate a function
as private by storing it in a subfolder with the name private. Then, the function is available only to
functions and scripts in the folder immediately above the private subfolder.
For example, within a folder that is on the MATLAB search path, create a subfolder named private.
Do not add private to the path. Within the private folder, create a function in a file named
findme.m:
function findme
% FINDME An example of a private function.
Change to the folder that contains the private folder and create a file named visible.m.
function visible
findme
Change your current folder to any location and call the visible function.
visible
Although you cannot call the private function from the command line or from functions outside the
parent of the private folder, you can access its help:
help private/findme
Private functions have precedence over standard functions, so MATLAB finds a private function
named test.m before a nonprivate program file named test.m. This allows you to create an
alternate version of a particular function while retaining the original in another folder.
See Also
More About
• “Function Precedence Order” on page 20-37
• “Types of Functions” on page 20-17
20-36
Function Precedence Order
Before assuming that a name matches a function, MATLAB checks for a variable with that name
in the current workspace.
Note If you create a variable with the same name as a function, MATLAB cannot run that
function until you clear the variable from memory.
2 Function or class whose name matches an explicitly imported name
The import function allows functions with compound names (names comprised of several parts
joined by dots) to be called using only the final part of the compound name. When a function
name matches an explicit (non-wildcard) imported function, MATLAB uses the imported
compound name and gives it precedence over all other functions with the same name.
3 Nested functions within the current function
4 Local functions within the current file
5 Function or class whose name matches a wildcard-based imported name
When a function name matches a wildcard-based imported function, MATLAB uses the imported
compound name and gives it precedence over all other functions with the same name, except for
nested and local functions.
6 Private functions
Private functions are functions in a subfolder named private that is immediately below the
folder of the currently running file.
7 Object functions
An object function accepts a particular class of object in its input argument list. When there are
multiple object functions with the same name, MATLAB checks the classes of the input
arguments to determine which function to use.
8 Class constructors in @ folders
When determining the precedence of functions within the same folder, MATLAB considers the file
type, in this order:
20-37
20 Function Basics
1 Built-in function
2 MEX-function
3 Simulink model files that are not loaded, with file types in this order:
a SLX file
b MDL file
4 Stateflow® chart with a .sfx extension
5 App file (.mlapp) created using MATLAB App Designer
6 Program file with a .mlx extension
7 P-file (that is, an encoded program file with a .p extension)
8 Program file with a .m extension
For example, if MATLAB finds a .m file and a P-file with the same name in the same folder, it uses the
P-file. Because P-files are not automatically regenerated, make sure that you regenerate the P-file
whenever you edit the program file.
To determine the function MATLAB calls for a particular input, include the function name and the
input in a call to the which function.
See Also
import
More About
• “What Is the MATLAB Search Path?”
20-38
Function Precedence Order
20-39
20 Function Basics
These changes impact the behavior of the import function. You should analyze and possibly update
your code. To start, search your code for import statements. For example, use “Find Files and
Folders” to search for .m and .mlx files containing text import. Refer to these search results when
evaluating the effects of the following changes.
If this behavior change impacts your code, rename either the variable or the function so that they
have different names.
Consider the following code. MATLAB used to treat x as a variable because of colon-indexing.
Starting in R2019b, if a function of the same name exists on the path, MATLAB treats x as a function.
function myfunc
load data.mat; % data.mat contains variable x
disp(x(:))
end
20-40
Update Code for R2019b Changes to Function Precedence Order
If you intend to use x as a variable from data.mat instead of a function, explicitly declare it.
Similarly, to use an identifier x as a variable obtained from a script, declare it before invoking the
script. This new behavior also applies if the variable is implicitly introduced by the functions sim,
eval, evalc, and assignin.
This table shows some examples of how you can update your code.
Before After
function myfunc function myfunc
load data.mat; load data.mat x;
disp(x(:)) disp(x(:))
end end
function myfunc2 function myfunc2
myscript; % Contains variable x x = [];
disp(x(:)) myscript;
end disp(x(:))
end
For example, in the following code, identifier x in myfunc is different from variable x in the nested
function. If x is a function on the path, MATLAB treats x in myfunc as a function and the code runs.
Otherwise, MATLAB throws an error.
function myfunc
nested;
x(3) % x is not a shared variable
function nested
x = [1 2 3];
end
end
In previous releases, if x was a function on the path, MATLAB treated it as a function in myfunc and
as a variable in nested. If x was not a function on the path, MATLAB treated it as a variable shared
between myfunc and nested. This resulted in code whose output was dependent on the state of the
path.
To use an identifier as a variable shared between parent and nested functions, you might need to
update your code. For example, you can initialize the identifier to an empty array in the parent
function.
20-41
20 Function Basics
Before After
function myfunc function myfunc
nested; x = [];
x(3) nested;
function nested x(3)
x = [1 2 3]; function nested
end x = [1 2 3];
end end
end
For example, in this code, the statement local() calls myfunc/local instead of pkg1.local in the
wildcard-based import. The statement nest() calls myfunc/nest instead of pkg1.nest.
In the search results for import, look for statements that include the wildcard character (*).
Fully qualified import functions cannot have the same name as nested
functions
Starting in R2019b, fully qualified imports that share a name with a nested function in the same
scope throw an error.
20-42
Update Code for R2019b Changes to Function Precedence Order
20-43
20 Function Basics
if ~usejava('jvm') if ~usejava('jvm')
% Statement never executes % Display message
disp('This function requires Java'); disp('This function requires Java')
else else
% Do something with Java String class % Do something with Java String cla
end end
end end
% Package p1 has functions plot and bar % Package p1 has functions plot and bar
import p1.plot import p1.plot
import p1.* import p1.*
nest nest
For example, suppose a package pkg contains a class foo with a static method bar and also a
subpackage foo with a function bar.
In R2019b, a call to which pkg.foo.bar returns the path to the package function.
which pkg.foo.bar
+pkg/+foo/bar.m
Previously, a static method took precedence over a package function in cases where a package and a
class had the same name.
20-44
Update Code for R2019b Changes to Function Precedence Order
See Also
import
More About
• “Import Classes”
20-45
20 Function Basics
Example
Consider the function:
function y = myStruct(x)
y = struct("Afield",x);
end
This function creates a structure with one field, named Afield, and assigns a value to the field. You
can invoke the function and create a structure with a field containing the value 1 with the command:
myStruct(1)
ans =
Afield: 1
However, if you want to return the field value directly, you can index into the function call result with
the command:
myStruct(1).Afield
ans =
After this command executes, the temporary structure created by the command myStruct(1) no
longer exists, and MATLAB returns only the field value. Conceptually, this usage is the same as
creating the structure, indexing into it, and then deleting it:
S = struct("Afield",1);
S.Afield
clear S
Supported Syntaxes
MATLAB supports dot indexing into function call results, as in foo(arg).prop. Other forms of
indexing into function call results (with parentheses such as foo(arg)(2) or with curly braces such
as foo(arg){2}) are not supported. Successful commands must meet the criteria:
20-46
Indexing into Function Call Results
MATLAB always attempts to apply the dot indexing operation to the temporary variable, even if the
function returns a variable for which dot indexing is not defined. For example, if you try to index into
the matrix created by magic(3), then you get an error.
magic(3).field
You can add more indexing commands onto the end of an expression as long as the temporary
variables can continue to be indexed. For example, consider the expression:
table(rand(10,2)).Var1(3,:)
In this expression, you index into a table to get the matrix it contains, and then index into the matrix
to get the third row:
• table(rand(10,2)) creates a table with one variable named Var1. The variable contains a 10-
by-2 matrix.
• table(rand(10,2)).Var1 returns the 10-by-2 matrix contained in Var1.
• table(rand(10,2)).Var1(3,:) returns the third row in the matrix contained in Var1.
See Also
function | subsref
More About
• “Types of Functions” on page 20-17
• “Array Indexing”
• “Access Data in Tables” on page 9-32
20-47
21
Function Arguments
Input Arguments
Create a function in a file named addme.m that accepts up to two inputs. Identify the number of
inputs with nargin.
function c = addme(a,b)
switch nargin
case 2
c = a + b;
case 1
c = a + a;
otherwise
c = 0;
end
ans =
84
addme(2,4000)
ans =
4002
addme
ans =
0
Output Arguments
Create a new function in a file named addme2.m that can return one or two outputs (a result and its
absolute value). Identify the number of requested outputs with nargout.
function [result,absResult] = addme2(a,b)
switch nargin
case 2
result = a + b;
case 1
result = a + a;
otherwise
result = 0;
end
if nargout > 1
absResult = abs(result);
end
21-2
Find Number of Function Arguments
value = addme2(11,-22)
value =
-11
[value,absValue] = addme2(11,-22)
value =
-11
absValue =
11
Functions return outputs in the order they are declared in the function definition.
See Also
nargin | narginchk | nargout | nargoutchk
21-3
21 Function Arguments
Create a function in a file named plotWithTitle.m that accepts a variable number of paired (x,y)
inputs for the plot function and an optional title. If the function receives an odd number of inputs, it
assumes that the last input is a title.
function plotWithTitle(varargin)
if rem(nargin,2) ~= 0
myTitle = varargin{nargin};
numPlotInputs = nargin - 1;
else
myTitle = 'Default Title';
numPlotInputs = nargin;
end
plot(varargin{1:numPlotInputs})
title(myTitle)
Because varargin is a cell array, you access the contents of each cell using curly braces, {}. The
syntax varargin{1:numPlotInputs} creates a comma-separated list of inputs to the plot
function.
x = [1:.1:10];
y1 = sin(x);
y2 = cos(x);
plotWithTitle(x,y1,x,y2,'Sine and Cosine')
You can use varargin alone in an input argument list, or at the end of the list of inputs, such as
function myfunction(a,b,varargin)
In this case, varargin{1} corresponds to the third input passed to the function, and nargin returns
length(varargin) + 2.
See Also
nargin | varargin
Related Examples
• “Access Data in Cell Array” on page 12-5
More About
• “Checking Number of Arguments in Nested Functions” on page 21-8
• “Comma-Separated Lists” on page 2-79
21-4
Support Variable Number of Outputs
Create a function in a file named magicfill.m that assigns a magic square to each requested
output.
for k = 1:nOutputs
varargout{k} = magic(k);
end
[first,second,third] = magicfill
first =
1
second =
1 3
4 2
third =
8 1 6
3 5 7
4 9 2
MATLAB assigns values to the outputs according to their order in the varargout array. For example,
first == varargout{1}.
You can use varargout alone in an output argument list, or at the end of the list of outputs, such as
In this case, varargout{1} corresponds to the third output that the function returns, and nargout
returns length(varargout) + 2.
See Also
nargout | varargout
Related Examples
• “Access Data in Cell Array” on page 12-5
More About
• “Checking Number of Arguments in Nested Functions” on page 21-8
21-5
21 Function Arguments
MATLAB checks whether your function receives more arguments than expected when it can
determine the number from the function definition. For example, this function accepts up to two
outputs and three inputs:
If you pass too many inputs to myFunction, MATLAB issues an error. You do not need to call
narginchk to check for this case.
[X,Y] = myFunction(1,2,3,4)
Use the narginchk and nargoutchk functions to verify that your function receives:
Define a function in a file named testValues.m that requires at least two inputs. The first input is a
threshold value to compare against the other inputs.
function testValues(threshold,varargin)
minInputs = 2;
maxInputs = Inf;
narginchk(minInputs,maxInputs)
for k = 1:(nargin-1)
if (varargin{k} > threshold)
fprintf('Test value %d exceeds %d\n',k,threshold);
end
end
testValues(10)
testValues(10,1,11,111)
21-6
Validate Number of Function Arguments
Define a function in a file named mysize.m that returns the dimensions of the input array in a vector
(from the size function), and optionally returns scalar values corresponding to the sizes of each
dimension. Use nargoutchk to verify that the number of requested individual sizes does not exceed
the number of available dimensions.
sizeVector = size(x);
varargout = cell(1,nargout-1);
for k = 1:length(varargout)
varargout{k} = sizeVector(k);
end
A = rand(3,4,2);
[fullsize,nrows,ncols,npages] = mysize(A)
fullsize =
3 4 2
nrows =
3
ncols =
4
npages =
2
A = 1;
[fullsize,nrows,ncols,npages] = mysize(A)
See Also
narginchk | nargoutchk
Related Examples
• “Support Variable Number of Inputs” on page 21-4
• “Support Variable Number of Outputs” on page 21-5
21-7
21 Function Arguments
varargin and varargout allow you to create functions that accept variable numbers of input or
output arguments. Although varargin and varargout look like function names, they refer to
variables, not functions. This is significant because nested functions share the workspaces of the
functions that contain them.
If you do not use varargin or varargout in the declaration of a nested function, then varargin or
varargout within the nested function refers to the arguments of an outer function.
For example, create a function in a file named showArgs.m that uses varargin and has two nested
functions, one that uses varargin and one that does not.
function showArgs(varargin)
nested1(3,4)
nested2(5,6,7)
function nested1(a,b)
disp('nested1: Contents of varargin{1}')
disp(varargin{1})
end
function nested2(varargin)
disp('nested2: Contents of varargin{1}')
disp(varargin{1})
end
end
Call the function and compare the contents of varargin{1} in the two nested functions.
showArgs(0,1,2)
On the other hand, nargin and nargout are functions. Within any function, including nested
functions, calls to nargin or nargout return the number of arguments for that function. If a nested
function requires the value of nargin or nargout from an outer function, pass the value to the
nested function.
For example, create a function in a file named showNumArgs.m that passes the number of input
arguments from the primary (parent) function to a nested function.
function showNumArgs(varargin)
function nestedFx(n,varargin)
disp(['Number of inputs to nestedFx: ',int2str(nargin)]);
21-8
Checking Number of Arguments in Nested Functions
end
Call showNumArgs and compare the output of nargin in the parent and nested functions.
showNumArgs(0,1)
See Also
nargin | nargout | varargin | varargout
21-9
21 Function Arguments
In a file named colorButton.m, define a callback for a push button that does not use the
eventdata input. Add a tilde to the input argument list so that the function ignores eventdata.
function colorButton
figure;
uicontrol('Style','pushbutton','String','Click me','Callback',@btnCallback)
function btnCallback(h,~)
set(h,'BackgroundColor',rand(3,1))
The function declaration for btnCallback is effectively the same as the following:
function btnCallback(h,eventdata)
However, using the tilde prevents the addition of eventdata to the function workspace and makes it
clearer that the function does not use eventdata.
You can ignore any number of inputs in your function definition, in any position in the argument list.
Separate consecutive tildes with a comma. For example:
function myFunction(myInput,~,~)
See Also
More About
• “Ignore Function Outputs” on page 1-4
21-10
Check Function Inputs with validateattributes
validateattributes requires that you pass the variable to check and the supported data types for
that variable. Optionally, pass a set of attributes that describe the valid dimensions or values.
Define a function in a file named checkme.m that accepts up to three inputs: a, b, and c. Check
whether:
function checkme(a,b,c)
validateattributes(a,{'double'},{'positive','2d'})
validateattributes(b,{'numeric'},{'numel',100,'ncols',10})
validateattributes(c,{'char','cell'},{'nonempty'})
The curly braces {} indicate that the set of data types and the set of additional attributes are in cell
arrays. Cell arrays allow you to store combinations of text and numeric data, or character vectors of
different lengths, in a single variable.
checkme(pi,rand(5,10,2),'text')
Call checkme with invalid inputs. The validateattributes function issues an error for the first
input that fails validation, and checkme stops processing.
checkme(-4)
checkme(pi,rand(3,4,2))
checkme(pi,rand(5,10,2),struct)
char, cell
21-11
21 Function Arguments
The default error messages use the generic term input to refer to the argument that failed
validation. When you use the default error message, the only way to determine which input failed is
to view the specified line of code in checkme.
Define a function in a file named checkdetails.m that performs the same validation as checkme,
but adds details about the input name and position to the error messages.
function checkdetails(a,b,c)
validateattributes(a,{'double'},{'positive','2d'},'','First',1)
validateattributes(b,{'numeric'},{'numel',100,'ncols',10},'','Second',2)
validateattributes(c,{'char'},{'nonempty'},'','Third',3)
The empty character vector '' for the fourth input to validateattributes is a placeholder for an
optional function name. You do not need to specify a function name because it already appears in the
error message. Specify the function name when you want to include it in the error identifier for
additional error handling.
checkdetails(-4)
checkdetails(pi,rand(3,4,2))
See Also
validateattributes | validatestring
21-12
Parse Function Inputs
The Input Parser provides a consistent way to validate and assign defaults to inputs, improving the
robustness and maintainability of your code. To validate the inputs, you can take advantage of
existing MATLAB functions or write your own validation routines.
Create a function in a file named printPhoto.m. The printPhoto function has one required input
for the file name, and optional inputs for the finish (glossy or matte), color space (RGB or CMYK),
width, and height.
function printPhoto(filename,varargin)
In your function declaration statement, specify required inputs first. Use varargin to support
optional inputs.
p = inputParser;
Add inputs to the parsing scheme in your function using addRequired, addOptional, or
addParameter. For optional inputs, specify default values.
For each input, you can specify a handle to a validation function that checks the input and returns a
scalar logical (true or false) or errors. The validation function can be an existing MATLAB function
(such as ischar or isnumeric) or a function that you create (such as an anonymous function or a
local function).
In the printPhoto function, filename is a required input. Define finish and color as optional
inputs, and width and height as optional parameter value pairs.
defaultFinish = 'glossy';
validFinishes = {'glossy','matte'};
checkFinish = @(x) any(validatestring(x,validFinishes));
defaultColor = 'RGB';
validColors = {'RGB','CMYK'};
checkColor = @(x) any(validatestring(x,validColors));
defaultWidth = 6;
defaultHeight = 4;
addRequired(p,'filename',@ischar);
addOptional(p,'finish',defaultFinish,checkFinish)
addOptional(p,'color',defaultColor,checkColor)
addParameter(p,'width',defaultWidth,@isnumeric)
addParameter(p,'height',defaultHeight,@isnumeric)
21-13
21 Function Arguments
Inputs that you add with addRequired or addOptional are positional arguments. When you call a
function with positional inputs, specify those values in the order they are added to the parsing
scheme.
Inputs added with addParameter are not positional, so you can pass values for height before or
after values for width. However, parameter value inputs require that you pass the input name
(height or width) along with the value of the input.
If your function accepts optional input strings or character vectors and name-value arguments,
specify validation functions for the optional inputs. Otherwise, the Input Parser interprets the
optional strings or character vectors as parameter names. For example, the checkFinish validation
function ensures that printPhoto interprets 'glossy' as a value for finish and not as an invalid
parameter name.
By default, the Input Parser makes assumptions about case sensitivity, function names, structure
array inputs, and whether to allow additional parameter names and values that are not in the scheme.
Properties allow you to explicitly define the behavior. Set properties using dot notation, similar to
assigning values to a structure array.
Allow printPhoto to accept additional parameter value inputs that do not match the input scheme
by setting the KeepUnmatched property of the Input Parser.
p.KeepUnmatched = true;
If KeepUnmatched is false (default), the Input Parser issues an error when inputs do not match the
scheme.
Within your function, call the parse method. Pass the values of all of the function inputs.
parse(p,filename,varargin{:})
• Results — Structure array with names and values of all inputs in the scheme.
• Unmatched — Structure array with parameter names and values that are passed to the function,
but are not in the scheme (when KeepUnmatched is true).
• UsingDefaults — Cell array with names of optional inputs that are assigned their default values
because they are not passed to the function.
Within the printPhoto function, display the values for some of the inputs:
disp(['File name: ',p.Results.filename])
disp(['Finish: ', p.Results.finish])
if ~isempty(fieldnames(p.Unmatched))
disp('Extra inputs:')
disp(p.Unmatched)
end
if ~isempty(p.UsingDefaults)
disp('Using defaults: ')
21-14
Parse Function Inputs
disp(p.UsingDefaults)
end
• Required inputs first, in the order they are added to the parsing scheme with addRequired.
• Optional positional inputs in the order they are added to the scheme with addOptional.
• Positional inputs before parameter name and value pair inputs.
• Parameter names and values in the form Name1,Value1,...,NameN,ValueN.
Pass several combinations of inputs to printPhoto, some valid and some invalid:
printPhoto('myfile.jpg')
printPhoto(100)
printPhoto('myfile.jpg','satin')
'glossy', 'matte'
The input, 'satin', did not match any of the valid strings.
printPhoto('myfile.jpg',height=10,width=8)
When using name-value arguments before R2021a, pass names as strings or character vectors, and
separate names and values with commas. For example:
printPhoto('myfile.jpg','height',10,'width',8)
To pass a value for the nth positional input, either specify values for the previous (n – 1) inputs or
pass the input as a parameter name and value pair. For example, these function calls assign the same
values to finish (default 'glossy') and color:
printPhoto('myfile.gif','glossy','CMYK') % positional
See Also
inputParser | varargin
21-15
21 Function Arguments
More About
• “Input Parser Validation Functions” on page 21-17
21-16
Input Parser Validation Functions
The Input Parser methods addRequired, addOptional, and addParameter each accept an
optional handle to a validation function. Designate function handles with an at (@) symbol.
Validation functions must accept a single input argument, and they must either return a scalar logical
value (true or false) or error. If the validation function returns false, the Input Parser issues an
error and your function stops processing.
• Use an existing MATLAB function such as ischar or isnumeric. For example, check that a
required input named num is numeric:
p = inputParser;
checknum = @isnumeric;
addRequired(p,'num',checknum)
parse(p,'text')
• Create an anonymous function. For example, check that input num is a numeric scalar greater
than zero:
p = inputParser;
checknum = @(x) isnumeric(x) && isscalar(x) && (x > 0);
addRequired(p,'num',checknum)
parse(p,rand(3))
The value of 'num' is invalid. It must satisfy the function: @(x) isnumeric(x) && isscalar(x)
&& (x>0).
• Define your own function, typically a local function in the same file as your primary function. For
example, in a file named usenum.m, define a local function named checknum that issues custom
error messages when the input num to usenum is not a numeric scalar greater than zero:
function usenum(num)
p = inputParser;
addRequired(p,'num',@checknum);
parse(p,num);
function TF = checknum(x)
TF = false;
if ~isscalar(x)
error('Input is not scalar');
elseif ~isnumeric(x)
error('Input is not numeric');
elseif (x <= 0)
error('Input must be > 0');
else
TF = true;
end
21-17
21 Function Arguments
usenum(-1)
See Also
inputParser | is* | validateattributes
Related Examples
• “Parse Function Inputs” on page 21-13
• “Create Function Handle” on page 13-2
More About
• “Anonymous Functions” on page 20-20
21-18
22
You can diagnose problems in your MATLAB code files by debugging your code interactively in the
Editor and Live Editor or programmatically by using debugging functions in the Command Window.
Before you begin debugging, to avoid unexpected results, save your code files and make sure that the
code files and any files they call exist on the search path or in the current folder. MATLAB handles
unsaved changes differently depending on where you are debugging from:
• Editor — If a file contains unsaved changes, MATLAB saves the file before running it.
• Live Editor — MATLAB runs all changes in a file, whether they are saved or not.
• Command Window — If a file contains unsaved changes, MATLAB runs the saved version of the
file. You do not see the results of your changes.
Display Output
One way to determine where a problem occurs in your MATLAB code file is to display the output. To
display the output for a line, remove the semicolon from the end of that line. In the Editor, MATLAB
displays the output in the Command Window. In the Live Editor, MATLAB displays the output with the
line of code that creates it.
For example, suppose that you have a script called plotRand.m that plots a vector of random data
and draws a horizontal line on the plot at the mean.
n = 50;
r = rand(n,1);
plot(r)
m = mean(r);
hold on
plot([0,n],[m,m])
hold off
title('Mean of Random Uniform Data')
To display the output of the rand function at line two, remove the semicolon at the end of the line.
MATLAB displays the value of r in the Command Window.
22-2
Debug MATLAB Code Files
In the Live Editor, MATLAB displays the value of r with line two.
To run code to a specified line, and then pause, click the Run to Here button to the left of the line.
If the selected line cannot be reached, MATLAB continues running until the end of the file is reached
or a breakpoint is encountered.
Note In functions and classes, the Run to Here button is available only when debugging.
22-3
22 Debugging MATLAB Code
For example, click the Run to Here button to the left of line two in plotRand.m. MATLAB runs
plotRand.m starting at line one and pauses before running line two.
•
The Run button in the Editor or Live Editor tab changes to a Continue button.
• The prompt in the Command Window changes to K>> indicating that MATLAB is in debug mode
and that the keyboard is in control.
• MATLAB indicates the line at which it is paused by using a green arrow and green highlighting.
Tip It is a good practice to avoid modifying a file while MATLAB is paused. Changes that are made
while MATLAB is paused do not run until after MATLAB finishes running the code and the code is
rerun.
The line at which MATLAB is paused does not run until after you continue running the code. To
continue running the code, click the Continue button. MATLAB continues running the file until it
reaches the end of the file or a breakpoint. You also can click the button to the left of the line of
code that you want to continue running to.
To continue running the code line-by-line, on the Editor or Live Editor tab, click Step. MATLAB
executes the current line at which it is paused and the pauses at the next line.
22-4
Debug MATLAB Code Files
You also can view the value of a variable by typing the variable name in the Command Window. For
example, to see the value of the variable n, type n and press Enter. The Command Window displays
the variable name and its value. To view all the variables in the current workspace, use the
Workspace browser.
For more information, see “Examine Values While Debugging” on page 22-14.
Note Clicking the Pause button can cause MATLAB to pause in a file outside your own code.
22-5
22 Debugging MATLAB Code
click the Step Out button at the top of the file to run the rest of the called function, leave the
called function, and then pause.
By default, the Step In button is available only for user-defined functions and scripts. To make the
button active for MathWorks functions, on the Home tab, in the Environment section, click
Preferences. Then, select MATLAB > Editor/Debugger, and in the Debugging section, clear the
Only show contextual Step in button for user-defined functions option.
Alternatively, you can step in and out of functions while debugging by using the Step In or
Step Out buttons on the Editor or Live Editor tab. These buttons do not honor the Only show
contextual Step in button for user-defined functions preference and always step in and out of
user-defined and MathWorks functions.
When you step into a called function or file, MATLAB displays the list of the functions it executed
before pausing at the current line. The list, also called the function call stack, is shown at the top of
the file and displays the functions in order, starting on the left with the first called script or function,
and ending on the right with the current script or function in which MATLAB is paused.
For each function in the function call stack, there is a corresponding workspace. Workspaces contain
variables that you create within MATLAB or import from data files or other programs. Variables that
you assign through the Command Window or create by using scripts belong to the base workspace.
Variables that you create in a function belong to their own function workspace.
You can examine the values of variables outside of the current workspace by selecting a different
workspace. For more information, see “Examine Values While Debugging” on page 22-14.
There are three types of breakpoints: standard, conditional, and error. To add a standard breakpoint
in the Editor or Live Editor, click the gray area to the left of the executable line where you want to set
the breakpoint. For example, click the area next to line three in plotRand.m to add a breakpoint at
that line.
22-6
Debug MATLAB Code Files
When you run the file, MATLAB pauses at the line of code indicated by the breakpoint. The line at
which MATLAB is paused does not run until after you continue running your code.
For example, with the plotRand.m file open in the Editor, click the Run button in the Editor tab.
MATLAB runs plotRand.m starting at line one and pauses before running line three.
•
The Run button in the Editor or Live Editor tab changes to a Continue button.
• The prompt in the Command Window changes to K>> indicating that MATLAB is in debug mode
and that the keyboard is in control.
• MATLAB indicates the line at which it is paused by using a green arrow and green highlighting.
Tip It is a good practice to avoid modifying a file while MATLAB is paused. Changes that are made
while MATLAB is paused do not run until after MATLAB finished running the code and the code is
rerun.
To continue running the code, click the Continue button. MATLAB continues running the file until
it reaches the end of the file or a breakpoint. To continue running the code line-by-line, on the Editor
or Live Editor tab, click Step. MATLAB executes the current line at which it is paused, and then
pauses at the next line.
For more information about the different types of breakpoints and how to set, clear, and disabled
them, see “Set Breakpoints” on page 22-9.
click Stop. After you end debugging, the normal >> prompt in the Command Window reappears
in place of the K>> prompt. You no longer can access the function call stack.
To avoid confusion, make sure to end your debugging session every time you are done debugging. If
you make changes to a file and save it while debugging, MATLAB ends the debugging session. If
MATLAB becomes unresponsive when it pauses, press Ctrl+C to end debugging.
22-7
22 Debugging MATLAB Code
See Also
Related Examples
• “Set Breakpoints” on page 22-9
• “Examine Values While Debugging” on page 22-14
• “Edit and Format Code” on page 24-16
22-8
Set Breakpoints
Set Breakpoints
Since R2021b. Replaces Set Breakpoints (R2021a) and Debug Code in the Live Editor (R2021a).
Setting breakpoints pauses the execution of your MATLAB program so that you can examine values
where you think an issue might have occurred. You can set breakpoints interactively in the Editor or
Live Editor, or by using functions in the Command Window.
• Standard
• Conditional
• Error
You can set breakpoints only at executable lines in saved files that are in the current folder or in
folders on the search path. You can set breakpoints at any time, whether MATLAB is idle or busy
running a file.
By default, when MATLAB reaches a breakpoint, it opens the file containing the breakpoint. To
disable this option:
1
From the Home tab, in the Environment section, click Preferences.
2 In the Preferences window, select MATLAB > Editor/Debugger.
3 Clear the Automatically open file when MATLAB reaches a breakpoint option and click OK.
Standard Breakpoints
A standard breakpoint pauses at a specific line in a file. To set a standard breakpoint, click the gray
area to the left of the executable line where you want to set the breakpoint. Alternatively, you can
press the F12 key to set a breakpoint at the current line. If you attempt to set a breakpoint at a line
that is not executable, such as a comment or a blank line, MATLAB sets it at the next executable line.
To set a standard breakpoint programmatically, use the dbstop function. For example, to add a
breakpoint at line three in a file named plotRand.m, type:
dbstop in plotRand at 3
When debugging a file that contains a loop, set the breakpoint inside the loop to examine the values
at each increment of the loop. Otherwise, if you set the breakpoint at the start of the loop, MATLAB
pauses at the loop statement only once. For example, this code creates an array of ten ones and uses
a for loop to perform a calculation on items two through six of the array:
22-9
22 Debugging MATLAB Code
x = ones(1:10);
for n = 2:6
x(n) = 2 * x(n-1);
end
For MATLAB to pause at each increment of the for loop (a total of five times), set a breakpoint at line
four.
Conditional Breakpoints
A conditional breakpoint causes MATLAB to pause at a specific line in a file only when the specified
condition is met. For example, you can use conditional breakpoints when you want to examine results
after some iterations in a loop.
To set a conditional breakpoint, right-click the gray area to the left of the executable line where you
want to set the breakpoint and select Set Conditional Breakpoint. If a breakpoint already exists on
that line, select Set/Modify Condition. In the dialog box that opens, enter a condition and click OK.
A condition is any valid MATLAB expression that returns a logical scalar value.
When you run the code, MATLAB evaluates the condition before running the line. If the condition is
met, MATLAB enters debug mode and pauses at the line. For example, this code creates an array of
ten ones and uses a for loop to perform a calculation on items two through six of the array:
x = one(1:10)
for n = 2:6
x(n) = 2 * x(n-1);
end
Set a conditional breakpoint at line four with the condition n >= 4. When you run the code, MATLAB
runs through the for loop twice and pauses on the third iteration at line four when n is 4. If you
continue running the code, MATLAB pauses again at line four on the fourth iteration when n is 5, and
then once more, when n is 6.
You also can set a conditional breakpoint programmatically using the dbstop function. For example,
to add a conditional breakpoint in myprogram.m at line six, type:
22-10
Set Breakpoints
Error Breakpoints
In the Editor, you can set an error breakpoint to have MATLAB pause and enter debug mode if
MATLAB encounters an issue. Setting error breakpoints is not supported in the Live Editor.
Unlike standard and conditional breakpoints, you do not set error breakpoints at a specific line or in a
specific file. When you set an error breakpoint, MATLAB pauses at any line in any file if the error
condition specified occurs. MATLAB then enters debug mode and opens the file containing the error,
with the execution arrow at the line containing the error.
To set an error breakpoint, on the Editor tab, click Run and select from these options:
Alternatively, you can set an error breakpoint programmatically by using the dbstop function with a
specified condition. For example, to pause execution on all errors, type:
dbstop if error
To pause execution at the first run-time error within the try portion of a try/catch block that has a
message ID of MATLAB:ls:InputsMustBeStrings, type:
To set a breakpoint on a line containing an anonymous function, click the gray area to the left of the
line. MATLAB adds a breakpoint for the line, and a disabled breakpoint for each anonymous function
in the line. To enable a breakpoint for an anonymous function, click the disabled breakpoint for that
function.
To view information about all the breakpoints on a line, place your cursor on the breakpoint icon. A
tooltip appears with available information. For example, in this code, line seven contains two
anonymous functions, with a breakpoint at each one.
When you set a breakpoint in an anonymous function, MATLAB pauses when the anonymous function
is called. The line highlighted in green is where the code defines the anonymous function. The line
highlighted in gray is where the code calls the anonymous functions. For example, in this code,
MATLAB pauses the program at a breakpoint set for the anonymous function g, defined at line seven,
and called at line eight.
22-11
22 Debugging MATLAB Code
Invalid Breakpoints
A dark gray breakpoint indicates an invalid breakpoint.
• Unsaved changes in the file. To make breakpoints valid, save the file. The gray breakpoints
become red, indicating that they are now valid.
• A syntax error in the file. When you set a breakpoint, an error message appears indicating where
the syntax error is. To make the breakpoint valid, fix the syntax error and save the file.
Disable Breakpoints
You can disable selected breakpoints so that your program temporarily ignores them and runs
uninterrupted. For example, you might disable a breakpoint after you think you identified and
corrected an issue or if you are using conditional breakpoints.
To disable a breakpoint, right-click the breakpoint icon, and select Disable Breakpoint from the
context menu.
To reenable a breakpoint, right-click the breakpoint icon and select Enable Breakpoint from the
context menu.
The gray breakpoints become red, and program execution pauses at that line.
To enable or disable all breakpoints in the file, right-click the gray area to the left of an executable
line and select Enable All Breakpoints in File or Disable All Breakpoints in File. These options
are available only if there is at least one breakpoint to enable or disable.
Clear Breakpoints
All breakpoints remain in a file until you clear (remove) them or until they are cleared automatically
at the end of your MATLAB session.
22-12
Set Breakpoints
To clear a breakpoint, right-click the breakpoint icon and select Clear Breakpoint from the context
menu. Alternatively, you can press the F12 key to clear the breakpoint.
To clear a breakpoint programmatically, use the dbclear function. For example, to clear the
breakpoint at line six in a file called myprogram.m, type:
dbclear in myprogram at 6
To clear all breakpoints in the file, right-click the breakpoint alley and select Clear All Breakpoints
in File. You can also use the dbclear all command. For example, to clear all the breakpoints in a
file called myprogram.m, type:
To clear all breakpoints in all files, including error breakpoints, right-click the breakpoint alley and
select Clear All Breakpoints. You also can use the dbclear all command.
Breakpoints clear automatically when you end a MATLAB session. To save your breakpoints for future
sessions, use the dbstatus function.
See Also
Related Examples
• “Debug MATLAB Code Files” on page 22-2
• “Examine Values While Debugging” on page 22-14
22-13
22 Debugging MATLAB Code
When debugging a code file, you can view the value of any variable currently in the workspace while
MATLAB is paused. If you want to determine whether a line of code produces the expected result or
not, examining values is useful. If the result is as expected, you can continue running the code or step
to the next line. If the result is not as you expect, then that line, or a previous line, might contain an
error.
• Workspace browser — The Workspace browser displays all variables in the current workspace.
The Value column of the Workspace browser shows the current value of the variable.
To view more details, double-click the variable. The Variables Editor opens, displaying the content
for that variable. You also can use the openvar function to open a variable in the Variables Editor.
• Editor and Live Editor — To view the value of a variable in the Editor and Live Editor, place your
cursor over the variable. The current value of the variable appears in a data tip. The data tip stays
in view until you move the cursor. If you have trouble getting the data tip to appear, click the line
containing the variable, and then move the pointer next to the variable.
Data tips are always enabled when debugging in the Editor. To disable data tips in the Live Editor
or when editing a file in the Editor, go to the View tab and click the Datatips button off.
You also can view the value of a variable or equation by selecting it in the Editor and Live Editor,
right-clicking, and selecting Evaluate Selection in Command Window. MATLAB displays the
value of the variable or equation in the Command Window.
Note You cannot evaluate a selection while MATLAB is busy, for example, running a file.
22-14
Examine Values While Debugging
• Command Window — To view the value of a variable in the Command Window, type the variable
name. For the example, to see the value of a variable n, type n and press Enter. The Command
Window displays the variable name and its value. To view all the variables in the current
workspace, call the who function.
You also can use the dbstack function to view the current workspace in the Command Window:
dbstack
For each function in the function call stack, there is a corresponding workspace. Workspaces contain
variables that you create within MATLAB or import from data files or other programs. Variables that
you assign through the Command Window or create by using scripts belong to the base workspace.
Variables that you create in a function belong to their own function workspace.
To examine the values of variables outside of the current workspace, select a different workspace. In
the Editor or Live Editor, select a workspace from the drop-down list to the right of the function call
stack at the top of the file.
You also can use the dbup and dbdown functions in the Command Window to select the previous or
next workspace in the function call stack. To list the variables in the current workspace, use who or
whos.
If you attempt to view the value of a variable in a different workspace while MATLAB is in the process
of overwriting it, MATLAB displays an error in the Command Window.
K>> x
Variable "x" is inaccessible. When a variable appears on both sides of an assignment
statement, the variable may become temporarily unavailable during processing.
The error occurs whether you select the workspace by using the drop-down list to the right of the
function call stack or the dbup command.
22-15
22 Debugging MATLAB Code
See Also
Related Examples
• “Debug MATLAB Code Files” on page 22-2
• “Set Breakpoints” on page 22-9
22-16
23
MATLAB software enables you to present your MATLAB code in various ways. You can share your
code and results with others, even if they do not have MATLAB software. You can save MATLAB
output in various formats, including HTML, XML, and LaTeX. If Microsoft Word or Microsoft
PowerPoint applications are on your Microsoft Windows system, you can publish to their formats as
well.
23-2
Publish and Share MATLAB Code
This code demonstrates the Fourier series expansion for a square wave.
1 Create a MATLAB script or function. Divide the code into steps or sections by inserting two
percent signs (%%) at the beginning of each section.
23-3
23 Presenting MATLAB Code
2 Document the code by adding explanatory comments at the beginning of the file and within each
section.
Within the comments at the top of each section, you can add markup that enhances the
readability of the output. For example, the code in the preceding table includes the following
markup.
Note When you have a file containing text that has characters in a different encoding than that
of your platform, when you save or publish your file, MATLAB displays those characters as
garbled text.
3 Publish the code. On the Publish tab, click Publish.
By default, MATLAB creates a subfolder named html, which contains an HTML file and files for
each graphic that your code creates. The HTML file includes the code, formatted comments, and
output. Alternatively, you can publish to other formats, such as PDF files or Microsoft PowerPoint
presentations. For more information on publishing to other formats, see “Specify Output File” on
page 23-22.
In MATLAB Online, to allow MATLAB to open output windows automatically when publishing,
enable pop-up windows in your Web browser.
After publishing the code, you can share the folder containing the published files. For more
information, see “Share Folders in MATLAB”. In MATLAB Online, you also can make the results
publicly available by copying the published files from the html folder to the Published folder. Then,
you can use a URL of the form https://matlab.mathworks.com/users/userid/Published/
filename/index.html (for HTML) or https://matlab.mathworks.com/users/userid/
Published/foldername/filename.pdf (for PDF) to share the files.
The sample code that appears in the previous figure is part of the installed documentation. You can
view the code in the Editor by running this command:
edit(fullfile(matlabroot,'help','techdoc','matlab_env', ...
'examples','fourier_demo2.m'))
You also can create your own MATLAB documentation topics for viewing from the MATLAB Help
browser or the web. For more information, see “Display Custom Documentation” on page 32-21
23-4
Publish and Share MATLAB Code
See Also
publish
More About
• “Create Live Scripts in the Live Editor” on page 19-6
• “Publishing Markup” on page 23-6
• “Output Preferences for Publishing” on page 23-21
External Websites
• Publishing MATLAB Code from the Editor video
23-5
23 Presenting MATLAB Code
Publishing Markup
When publishing your MATLAB code files (.m), you can enhance the readability of the published
documents by adding markup to the comments within the files. Adding markup allows you to format
the published documents and display external files and graphics.
Markup Overview
To insert markup, you can:
• Use the formatting buttons and drop-down menus on the Publish tab to format the file. This
method automatically inserts the text markup for you.
• Select markup from the Insert Text Markup list in the right click menu.
• Type the markup directly in the comments.
The following table provides a summary of the text markup options. Refer to this table if you are not
using the MATLAB Editor, or if you do not want to use the Publish tab to apply the markup.
• Spaces following the comment symbols (%) often determine the format of the text that follows.
• Starting new markup often requires preceding blank comment lines, as shown in examples.
• Markup only works in comments that immediately follow a section break.
% *BOLD TEXT*
% |MONOSPACED TEXT|
% Trademarks:
% TEXT(TM)
% TEXT(R)
23-6
Publishing Markup
%% Numbered List
%
% # NUMBERED ITEM 1
% # NUMBERED ITEM 2
%
“Text and Code Blocks” on page 23-10 %%
%
% PREFORMATTED
% TEXT
%
%% MATLAB(R) Code
%
% for i = 1:10
% disp x
% end
%
“External File Content” on page 23-11 %
% <include>filename.m</include>
%
“External Graphics” on page 23-12 %
% <<FILENAME.PNG>>
%
“Image Snapshot” on page 23-14 snapnow;
“LaTeX Equations” on page 23-14 %% Inline Expression
% $x^2+e^{\pi i}$
%% Block Equation
%
% $$e^{\pi i} + 1 = 0$$
%
“Hyperlinks” on page 23-16 % <https://www.mathworks.com MathWorks>
% <matlab:FUNCTION DISPLAYED_TEXT>
“HTML Markup” on page 23-18 %
% <html>
% <table border=1><tr>
% <td>one</td>
% <td>two</td></tr></table>
% </html>
%
23-7
23 Presenting MATLAB Code
Note You can add comments in the lines immediately following the title. However, if you want an
overall document title, you cannot add any MATLAB code before the start of the next section (a line
starting with %%).
%% Vector Operations
% You can perform a number of binary operations on vectors.
%%
A = 1:3;
B = 4:6;
%% Dot Product
% A dot product of two vectors yields a scalar.
% MATLAB has a simple command for dot products.
s = dot(A,B);
%% Cross Product
% A cross product of two vectors yields a third
% vector perpendicular to both original vectors.
% Again, MATLAB has a simple command for cross products.
v = cross(A,B);
By saving the code in an Editor and clicking the Publish button on the Publish tab, MATLAB
produces the output as shown in this figure. Notice that MATLAB automatically inserts a Contents
menu from the section titles in the MATLAB file.
23-8
Publishing Markup
Text Formatting
You can mark selected text in the MATLAB comments so that they display in italic, bold, or
monospaced text when you publish the file. Simply surround the text with _, *, or | for italic, bold, or
monospaced text, respectively.
For instance, these lines display each of the text formatting syntaxes if published.
Trademark Symbols
If the comments in your MATLAB file include trademarked terms, you can include text to produce a
trademark symbol (™) or registered trademark symbol (®) in the output. Simply add (R) or (TM)
directly after the term in question, without any space in between.
If you publish the file to HTML, it appears in the MATLAB web browser.
23-9
23 Presenting MATLAB Code
%% Two Lists
%
% * ITEM1
% * ITEM2
%
% # ITEM1
% # ITEM2
%
Preformatted text appears in monospace font, maintains white space, and does not wrap long lines.
Two spaces must appear between the comment symbol and the text of the first line of the
preformatted text.
%%
% Many people find monospaced texts easier to read:
%
% A dot product of two vectors yields a scalar.
% MATLAB has a simple command for dot products.
23-10
Publishing Markup
Executable code appears with syntax highlighting in published documents. You also can highlight
sample code. Sample code is code that appears within comments.
To indicate sample code, you must put three spaces between the comment symbol and the start of the
first line of code. For example, clicking the Code button on the Publish tab inserts the following
sample code in your Editor.
%%
%
% for i = 1:10
% disp(x)
% end
%
Publishing this code to HTML produces output in the MATLAB web browser.
For example, this code inserts the contents of sine_wave.m into your published output:
23-11
23 Presenting MATLAB Code
External Graphics
To publish an image that the MATLAB code does not generate, use text markup. By default, MATLAB
already includes code-generated graphics.
This code inserts a generic image called FILENAME.PNG into your published output.
%%
%
% <<FILENAME.PNG>>
%
MATLAB requires that FILENAME.PNG be a relative path from the output location to your external
image or a fully qualified URL. Good practice is to save your image in the same folder that MATLAB
publishes its output. For example, MATLAB publishes HTML documents to a subfolder html. Save
your image file in the same subfolder. You can change the output folder by changing the publish
configuration settings. In MATLAB Online, save your image file to your Published folder, which is
located in your root folder.
This example shows how to insert surfpeaks.jpg into a MATLAB file for publishing.
saveas(surf(peaks),'surfpeaks.jpg');
saveas(surf(peaks),'html/surfpeaks.jpg');
3 Publish this MATLAB code to HTML.
%% Image Example
% This is a graphic:
%
% <<surfpeaks.jpg>>
%
23-12
Publishing Markup
The type of images you can include when you publish depends on the output type of that document as
indicated in this table. For greatest compatibility, best practice is to use the default image format for
each output type.
Output File Format Default Image Format Types of Images You Can Include
doc png Any format that your installed version of
Microsoft Office supports.
html png All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.
latex png or epsc2 All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.
pdf bmp bmp and jpg.
ppt png Any format that your installed version of
Microsoft Office supports.
xml png All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.
23-13
23 Presenting MATLAB Code
Image Snapshot
You can insert code that captures a snapshot of your MATLAB output. This is useful, for example, if
you have a for loop that modifies a figure that you want to capture after each iteration.
The following code runs a for loop three times and produces output after every iteration. The
snapnow command captures all three images produced by the code.
for i=1:3
imagesc(magic(i))
snapnow;
end
If you publish the file to HTML, it resembles the following output. By default, the images in the HTML
are larger than shown in the figure. To resize images generated by MATLAB code, use the Max
image width and Max image height fields in the Publish settings pane, as described in “Output
Preferences for Publishing” on page 23-21.
LaTeX Equations
Inline LaTeX Expression
MATLAB enables you to include an inline LaTeX expression in any code that you intend to publish. To
insert an inline expression, surround your LaTeX markup with dollar sign characters ($). The $ must
immediately precede the first word of the inline expression, and immediately follow the last word of
the inline expression, without any space in between.
Note
• All publishing output types support LaTeX expressions, except Microsoft PowerPoint.
23-14
Publishing Markup
• MATLAB publishing supports standard LaTeX math mode directives. Text mode directives or
directives that require additional packages are not supported.
If you publish the sample text markup to HTML, this is the resulting output.
MATLAB enables you to insert LaTeX symbols in blocks that are offset from the main comment text.
Two dollar sign characters ($$) on each side of an equation denote a block LaTeX equation.
Publishing equations in separate blocks requires a blank line in between blocks.
23-15
23 Presenting MATLAB Code
Hyperlinks
Static Hyperlinks
You can insert static hyperlinks within a MATLAB comment, and then publish the file to HTML, XML,
or Microsoft Word. When specifying a static hyperlink to a web location, include a complete URL
within the code. This is useful when you want to point the reader to a web location. You can display or
hide the URL in the published text. Consider excluding the URL, when you are confident that readers
are viewing your output online and can click the hyperlink.
%%
% For more information, see our web site:
% <https://www.mathworks.com MathWorks>
Eliminating the text MathWorks after the URL produces this modified output.
Note If your code produces hyperlinked text in the MATLAB Command Window, the output shows the
HTML code rather than the hyperlink.
Dynamic Hyperlinks
You can insert dynamic hyperlinks, which MATLAB evaluates at the time a reader clicks that link.
Dynamic hyperlinks enable you to point the reader to MATLAB code or documentation, or enable the
reader to run code. You implement these links using matlab: syntax. If the code that follows the
matlab: declaration has spaces in it, replace them with %20.
Note Dynamic links only work when viewing HTML in the MATLAB web browser.
23-16
Publishing Markup
You can specify a dynamic hyperlink to run code when a user clicks the hyperlink. For example, this
matlab: syntax creates hyperlinks in the output, which when clicked either enable or disable
recycling:
%% Recycling Preference
% Click the preference you want:
%
% <matlab:recycle('off') Disable recycling>
%
% <matlab:recycle('on') Enable recycling>
When you click one of the hyperlinks, MATLAB sets the recycle command accordingly. After clicking
a hyperlink, run recycle in the Command Window to confirm that the setting is as you expect.
Dynamic Link to a File
You can specify a link to a file that you know is in the matlabroot of your reader. You do not need to
know where each reader installed MATLAB. For example, link to the function code for publish.
%%
% See the
% <matlab:edit(fullfile(matlabroot,'toolbox','matlab','codetools','publish.m')) code>
% for the publish function.
When you click the code link, the MATLAB Editor opens and displays the code for the publish
function. On the reader's system, MATLAB issues the command (although the command does not
appear in the reader's Command Window).
Dynamic Link to a MATLAB Function Reference Page
You can specify a link to a MATLAB function reference page using matlab: syntax. For example,
suppose that your reader has MATLAB installed and running. Provide a link to the publish reference
page.
23-17
23 Presenting MATLAB Code
%%
% See the help for the <matlab:doc('publish') publish> function.
When you click the publish hyperlink, the MATLAB Help browser opens and displays the reference
page for the publish function. On the reader's system, MATLAB issues the command, although the
command does not appear in the Command Window.
HTML Markup
You can insert HTML markup into your MATLAB file. You must type the HTML markup since no
button on the Publish tab generates it.
Note When you insert text markup for HTML code, the HTML code publishes only when the
specified output file format is HTML.
If you publish the code to HTML, MATLAB creates a single-row table with two columns. The table
contains the values one, two, three, and four.
If a section produces command-window output that starts with <html> and ends with </html>,
MATLAB includes the source HTML in the published output. For example, MATLAB displays the disp
command and makes a table from the HTML code if you publish this code:
23-18
Publishing Markup
disp('<html><table><tr><td>1</td><td>2</td></tr></table></html>')
LaTeX Markup
You can insert LaTeX markup into your MATLAB file. You must type all LaTeX markup since no button
on the Publish tab generates it.
Note When you insert text markup for LaTeX code, that code publishes only when the specified
output file format is LaTeX.
If you publish the file to LaTeX, then the Editor opens a new .tex file containing the LaTeX markup.
\documentclass{article}
\usepackage{graphicx}
\usepackage{color}
\sloppy
\definecolor{lightgray}{gray}{0.5}
\setlength{\parindent}{0pt}
\begin{document}
23-19
23 Presenting MATLAB Code
\begin{par}
This is a table:
\end{par} \vspace{1em}
\begin{par}
\begin{tabular}{|c|c|} \hline
$n$ & $n!$ \\ \hline
1 & 1 \\
2 & 2 \\
3 & 6 \\ \hline
\end{tabular}
\end{par} \vspace{1em}
\end{document}
MATLAB includes any additional markup necessary to compile this file with a LaTeX program.
See Also
More About
• “Publish and Share MATLAB Code” on page 23-2
• “Output Preferences for Publishing” on page 23-21
23-20
Output Preferences for Publishing
1 Locate the Publish tab and click the Publish button arrow .
23-21
23 Presenting MATLAB Code
The MATLAB expression pane specifies the code that executes during publishing. The Publish
settings pane contains output, figure, and code execution options. Together, they make what
MATLAB refers to as a publish configuration. MATLAB associates each publish configuration with
an .m file. The name of the publish configuration appears in the top left pane.
Format Notes
html Publishes to an HTML document. You can use an Extensible Stylesheet
Language (XSL) file.
xml Publishes to XML document. You can use an Extensible Stylesheet Language
(XSL) file.
latex Publishes to LaTeX document. Does not preserve syntax highlighting. You can
use an Extensible Stylesheet Language (XSL) file.
doc Publishes to a Microsoft Word document. Does not preserve syntax
highlighting. This format is only available on Windows platforms.
ppt Publishes to a Microsoft PowerPoint document. Does not preserve syntax
highlighting. This format is only available on Windows platforms.
pdf Publishes to a PDF document.
Note XSL files allow you more control over the appearance of the output document. For more
details, see http://docbook.sourceforge.net/release/xsl/current/doc/.
Specifying Code
By default, MATLAB executes the .m file that you are publishing. However, you can specify any valid
MATLAB code in the MATLAB expression pane. For example, if you want to publish a function that
requires input, then run the command function(input). Additional code, whose output you want
to publish, appears after the functions call. If you clear the MATLAB expression area, then MATLAB
publishes the file without evaluating any code.
Note Publish configurations use the base MATLAB workspace. Therefore, a variable in the MATLAB
expression pane overwrites the value for an existing variable in the base workspace.
23-22
Output Preferences for Publishing
Evaluating Code
Another way to affect what MATLAB executes during publishing is to set the Evaluate code option in
the Publish setting pane. This option indicates whether MATLAB evaluates the code in the .m file
that is publishing. If set to true, MATLAB executes the code and includes the results in the output
document.
Because MATLAB does not evaluate the code nor include code results when you set the Evaluate
code option to false, there can be invalid code in the file. Therefore, consider first running the file
with this option set to true.
For example, suppose that you include comment text, Label the plot, in a file, but forget to
preface it with the comment character. If you publish the document to HTML, and set the Evaluate
code option to true, the output includes an error.
Use the false option to publish the file that contains the publish function. Otherwise, MATLAB
attempts to publish the file recursively.
Including Code
You can specify whether to display MATLAB code in the final output. If you set the Include code
option to true, then MATLAB includes the code in the published output document. If set to false,
MATLAB excludes the code from all output file formats, except HTML.
If the output file format is HTML, MATLAB inserts the code as an HTML comment that is not visible
in the web browser. If you want to extract the code from the output HTML file, use the MATLAB
grabcode function.
Catching Errors
You can catch and publish any errors that occur during publishing. Setting the Catch error option to
true includes any error messages in the output document. If you set Catch error to false, MATLAB
23-23
23 Presenting MATLAB Code
terminates the publish operation if an error occurs during code evaluation. However, this option has
no effect if you set the Evaluate code property to false.
You can limit the number of lines of code output that is included in the output document by specifying
the Max # of output lines option in the Publish settings pane. Setting this option is useful if a
smaller, representative sample of the code output suffices.
For example, the following loop generates 100 lines in a published output unless Max # of output
lines is set to a lower value.
for n = 1:100
disp(x)
end;
When publishing, you can choose the image format that MATLAB uses to store any graphics
generated during code execution. The available image formats in the drop-down list depend on the
setting of the Figure capture method option. For greatest compatibility, select the default as
specified in this table.
Output File Format Default Image Format Types of Images You Can Include
doc png Any format that your installed version of
Microsoft Office supports.
html png All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.
latex png or epsc2 All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.
pdf bmp bmp and jpg.
ppt png Any format that your installed version of
Microsoft Office supports.
xml png All formats publish successfully. Ensure that the
tools you use to view and process the output
files can display the output format you specify.
You set the size of MATLAB generated images in the Publish settings pane on the Edit
Configurations dialog window. You specify the image size in pixels to restrict the width and height of
23-24
Output Preferences for Publishing
images in the output. The pixel values act as a maximum size value because MATLAB maintains an
image’s aspect ratio. MATLAB ignores the size setting for the following cases:
• When working with external graphics as described in “External Graphics” on page 23-12
• When using vector formats, such as .eps
• When publishing to .pdf
Capturing Figures
You can capture different aspects of the Figure window by setting the Figure capture method
option. This option determines the window decorations (title bar, toolbar, menu bar, and window
border) and plot backgrounds for the Figure window.
This table summarizes the effects of the various Figure capture methods.
Use This Figure Capture To Get Figure Captures with These Appearance Details
Method
Window Decorations Plot Backgrounds
entireGUIWindow Included for dialog boxes; Excluded for Set to white for figures; matches the
figures screen for dialog boxes
print Excluded for dialog boxes and figures Set to white
getframe Excluded for dialog boxes and figures Matches the screen plot background
entireFigureWindow Included for dialog boxes and figures Matches the screen plot background
Note Typically, MATLAB figures have the HandleVisibility property set to on. Dialog boxes are
figures with the HandleVisibility property set to off or callback. If your results are different
from the results listed in the preceding table, the HandleVisibility property of your figures or
dialog boxes might be atypical. For more information, see HandleVisibility.
MATLAB allows you to specify custom appearance for figures it creates. If the Use new figure option
in the Publish settings pane is set to true, then in the published output, MATLAB uses a Figure
window at the default size and with a white background. If the Use new figure option is set to
false, then MATLAB uses the properties from an open Figure window to determine the appearance
of code-generated figures. This preference does not apply to figures included using the syntax in
“External Graphics” on page 23-12.
Use the following code as a template to produce Figure windows that meet your needs.
% Create figure
figure1 = figure('Name','purple_background',...
'Color',[0.4784 0.06275 0.8941]);
colormap('hsv');
% Create subplot
subplot(1,1,1,'Parent',figure1);
box('on');
23-25
23 Presenting MATLAB Code
ylabel({'y-axis'})
% Create title
title({'Title'});
By publishing your file with this window open and the Use new figure option set to false, any code-
generated figure takes the properties of the open Figure window.
Note You must set the Figure capture method option to entireFigureWindow for the final
published figure to display all the properties of the open Figure window.
Creating a Thumbnail
You can save the first code-generated graphic as a thumbnail image. You can use this thumbnail to
represent your file on HTML pages. To create a thumbnail, follow these steps:
1 On the Publish tab, click the Publish button drop-down arrow and select Edit Publishing
Options. The Edit Configurations dialog box opens.
2 Set the Image Format option to a bitmap format, such as .png or .jpg. MATLAB creates
thumbnail images in bitmap formats.
3 Set the Create thumbnail option to true.
23-26
Output Preferences for Publishing
MATLAB saves the thumbnail image in the folder specified by the Output folder option in the
Publish settings pane.
When the Publish settings options are set, you can follow these steps to save the settings:
1 Click Save As when the options are set in the manner you want.
The Save Publish Settings As dialog box opens and displays the names of all the currently
defined publish settings. By default the following publish settings install with MATLAB:
• Factory Default
You cannot overwrite the Factory Default and can restore them by selecting Factory
Default from the Publish settings list.
• User Default
Initially, User Default settings are identical to the Factory Default settings. You can
overwrite the User Default settings.
2 In the Settings Name field, enter a meaningful name for the settings. Then click Save.
You can now use the publish settings with other MATLAB files.
You also can overwrite the publishing properties saved under an existing name. Select the name
from the Publish settings list, and then click Overwrite.
23-27
23 Presenting MATLAB Code
Together, the code in the MATLAB expression pane and the settings in the Publish settings pane
make a publish configuration that is associated with one file. These configurations provide a simple
way to refer to publish preferences for individual files.
To create a publish configuration, click the Publish button drop-down arrow on the Publish tab,
and select Edit Publishing Options. The Edit Configurations dialog box opens, containing the
default publish preferences. In the Publish configuration name field, type a name for the publish
configuration, or accept the default name. The publish configuration saves automatically.
After saving a publish configuration, you can run it without opening the Edit Configurations dialog
box:
1 Click the Publish button drop-down arrow If you position your mouse pointer on a publish
configuration name, MATLAB displays a tooltip showing the MATLAB expression associated with
the specific configuration.
2 Select a configuration name to use for the publish configuration. MATLAB publishes the file using
the code and publish settings associated with the configuration.
You can create multiple publish configurations for a given file. You might do this to publish the file
with different values for input arguments, with different publish setting property values, or both.
Create a named configuration for each purpose, all associated with the same file. Later you can run
whichever particular publish configuration you want.
A new name appears on the configurations list, filename_n, where the value of n depends on
the existing configuration names.
23-28
Output Preferences for Publishing
4 If you modify settings in the MATLAB expression or Publish setting pane, MATLAB
automatically saves the changes.
Each publish configuration is associated with a specific file. If you move or rename a file, redefine its
association. If you delete a file, consider deleting the associated configurations, or associating them
with a different file.
When MATLAB cannot associate a configuration with a file, the Edit Configurations dialog box
displays the file name in red and a File Not Found message. To reassociate a configuration with
another file, perform the following steps.
1
Click the Clear search button on the left pane of the Edit Configurations dialog box.
2 Select the file for which you want to reassociate publish configurations.
3 In the right pane of the Edit Configurations dialog box, click Choose.... In the Open dialog box,
navigate to and select the file with which you want to reassociate the configurations.
You can rename the configurations at any time by selecting a configuration from the list in the left
pane. In the right pane, edit the value for the Publish configuration name.
Note To run correctly after a file name change, you might need to change the code statements in the
MATLAB expression pane. For example, change a function call to reflect the new file name for that
function.
Each time you create or save a publish configuration using the Edit Configurations dialog box, the
Editor updates the publish_configurations.m file in your preferences folder. (This is the folder
that MATLAB returns when you run the MATLAB prefdir function.)
Although you can port this file from the preferences folder on one system to another, only one
publish_configurations.m file can exist on a system. Therefore, only move the file to another
system if you have not created any publish configurations on the second system. In addition, because
23-29
23 Presenting MATLAB Code
the publish_configurations.m file might contain references to file paths, be sure that the
specified files and paths exist on the second system.
MathWorks recommends that you not update publish_configurations.m in the MATLAB Editor
or a text editor. Changes that you make using tools other than the Edit Configurations dialog box
might be overwritten later.
See Also
More About
• “Publish and Share MATLAB Code” on page 23-2
• “Publishing Markup” on page 23-6
23-30
24
You can save your files in the Editor and Live Editor using several methods. In the Editor, you also can
create backup copies of your files. Creating backup copies of your files ensures that you have a
known working version of the files before making changes to them, and can also be useful for
recovering lost changes after a system problem.
Depending on your needs, you can also control how the files you save are encoded and cached.
Save Code
When you modify a file in the Editor or the Live Editor, MATLAB indicates that there are unsaved
changes in the file by displaying an asterisk (*) next to the file name in the document tab.
To save the file, go to the Editor or Live Editor tab, and in the File section, click Save.
To change the name, location, or type of a file, select Save > Save As. For example, to save a live
script as a plain code file (.m), on the Live Editor tab, in the File section, select Save > Save As. In
the dialog box that appears, select MATLAB Code files (UTF-8) (*.m) as the Save as type and
click Save.
Back Up Code
You can create backup copies of your files in the Editor. Creating a backup copy of a file ensures that
you have a known working version of the file before making changes to it. To create a backup copy of
a file, on the Editor tab, in the File section, select Save > Save Copy As. This option is not available
in the Live Editor or in MATLAB Online.
In addition, when you modify files in the Editor, MATLAB automatically creates backup copies of the
files. If you lose changes to your files due to system problems, you can use the automatically created
backup copies of the files to recover the changes.
By default, MATLAB saves a backup copy of a modified file every five minutes using the same file
name but with an .asv extension. For example, filename.m would have a backup file name of
filename.asv. If you lose changes to your file, you can recover the unsaved changes by opening the
backup copy of the file, filename.asv, and saving it as filename.m.
24-2
Save and Back Up Code
To change how and when MATLAB saves backup copies of files, on the Home tab, in the
Environment section, click Preferences. Then, select MATLAB > Editor/Debugger > Backup
Files. You can specify:
• How often to save backup copies of the files you are editing.
• What file extension to use when creating backup copies of files.
• Where to save backup copies of files.
• Whether to automatically delete backup copies of files when you close the corresponding source
file in the Editor.
For more information about the available options, see the Backup Files preferences in “Editor/
Debugger Preferences”.
In MATLAB Online, every time you save a code file in the Editor, MATLAB stores the contents of your
code file in the version history. For more information about recovering a previous version of a file in
MATLAB Online, see “Restore Files in MATLAB Online”.
MATLAB does not automatically create backups of files modified in the Live Editor.
If you do save files in the matlabroot folder tree, you may need to take extra steps for your changes
to take effect. At the beginning of each MATLAB session, MATLAB loads and caches in memory the
locations of files in the matlabroot folder tree. Therefore, if you add, remove, or make changes to
files in the matlabroot folder tree using an external editor or file system operations, you must
update the cache so that MATLAB recognizes the changes you made. For more information, see
“Toolbox Path Caching in MATLAB”.
File Encoding
As of R2020a, when the Editor saves a new MATLAB code file that has a .m extension, such as a
script or a function, it uses UTF-8 without a byte-order-mark (BOM). The Editor saves existing files
with their current encoding unless a different one is selected from the Save As dialog. For example, to
save a file using a legacy locale-specific encoding for compatibility with an earlier release of MATLAB,
on the Editor tab, in the File section, select Save > Save as. In the dialog box that appears, select
the desired encoding from the Save as type options.
The current encoding is displayed next to the file name in the Editor status bar or, if the Editor
Window is docked, the Desktop status bar.
24-3
24 Coding and Productivity Tips
See Also
More About
• “Editor/Debugger Preferences”
• “Manage Files and Folders”
24-4
Check Code for Errors and Warnings Using the Code Analyzer
Check Code for Errors and Warnings Using the Code Analyzer
The MATLAB Code Analyzer can automatically check your code for coding problems. You can view
warning and error messages about your code, and modify your file based on the messages. The
messages are updated automatically and continuously so you can see if your changes address the
issues noted in the messages. Some messages offer additional information, automatic code
correction, or both.
To enable continuous code checking, on the Home tab, in the Environment section, click
Preferences. Select MATLAB > Code Analyzer, and then select the Enable integrated warning
and error messages check box. Set the Underlining option to Underline warnings and
errors.
When continuous code checking is enabled, MATLAB displays warning and error messages about
your code in the Editor and Live Editor. For example, the sample file lengthofline.m contains
several errors and warnings. Copy the file into your current folder and then open it in the Editor.
copyfile(fullfile(matlabroot,'help','techdoc','matlab_env','examples','lengthofline.m'))
fileattrib('lengthofline.m','+w');
edit('lengthofline.m')
For example, in lengthofline.m, the message indicator is , meaning that the file contains at
least one error.
24-5
24 Coding and Productivity Tips
For example, in lengthofline.m, when you click the message indicator, the cursor moves to line 47,
where the first error occurs. MATLAB displays the errors for that line next to the error marker in the
indicator bar. Multiple messages can represent a single problem or multiple problems. Addressing
one message might address all of them. Or, after you address one, the other messages might change
or what you need to do can become clearer.
24-6
Check Code for Errors and Warnings Using the Code Analyzer
To go to the next code fragment containing a message, click the message indicator. You also can click
a marker in the indicator bar to go to the line that the marker represents. For example, click the first
marker in the indicator bar in lengthofline.m. The cursor moves to the beginning of line 21.
To view the message for a code fragment, move the mouse pointer within the underlined code
fragment. Alternatively, you can position your cursor within the underlined code fragment and press
Ctrl+M. If additional information is available for the message, the message includes a Details
button. Click the button to display the additional information and any suggested user actions..
For example, on line 47 in lengthofline.m, the message suggests a delimiter imbalance. When you
move the arrow keys over each delimiter, MATLAB does not appear to indicate a mismatch. However,
code analysis detects the semicolon in data{3}(;) and interprets it as the end of a statement.
To fix the problem in line 47, change data{3}(;) to data{3}(:). The single change addresses all
of the messages on line 47, and the underline no longer appears for the line. Because the change
removes the only error in the file, the message indicator at the top of the bar changes from to
For some messages, MATLAB suggests an automatic fix that you can apply to fix the problem. If an
automatic fix is available for a problem, the code fragment is highlighted and the message includes a
Fix button.
24-7
24 Coding and Productivity Tips
For example, on line 27 in lengthofline.m, place the mouse over the underlined and highlighted
code fragment prod. The displayed messaged includes a Fix button.
If you know how to fix the problem, perhaps from prior experience, click the Fix button. If you are
unfamiliar with the problem, right-click the highlighted code. The first item in the context menu
shows the suggested fix. Select the item to apply the fix.
If multiple instances of a problem exist, MATLAB might offer to apply the suggested fix for all
instances of the problem. To apply the fix for all instances of a problem, right-click the highlighted
code and select Fix All (n) Instances of This Issue. This option is not available for all suggested
fixes.
After you modify the code to address all the messages or disable designated messages, the message
indicator becomes green. The example file with all messages addressed has been saved as
lengthofline2.m. For example, to open the corrected version of the sample file lengthofline.m,
use this command:
open(fullfile(matlabroot,'help','techdoc',...
'matlab_env', 'examples','lengthofline2.m'))
24-8
Check Code for Errors and Warnings Using the Code Analyzer
To create a report for an individual MATLAB code file, use the mlintrpt function. For example, to
create a report for the sample file lengthofline.m, enter mlintrpt('lengthofline.m') in the
Command Window.
For more information, see “MATLAB Code Analyzer Report” on page 24-29.
section, click Preferences. Select MATLAB > Code Analyzer, and then select an Underlining
option.
You also can adjust what messages you see when analyzing your code. Code analysis does not provide
perfect information about every situation. Sometimes, you might not want to change the code based
on a message. If you do not want to change the code, and you do not want to see the indicator and
message for a specific line, you can suppress them. For example, the first message on line 48 of the
sample file lengthofline.m is Terminate statement with semicolon to suppress
output (in functions). Adding a semicolon to the end of a statement suppresses output and is a
common practice. Code analysis alerts you to lines that produce output, but lack the terminating
semicolon. If you want to view output from line 48, do not add the semicolon as the message
suggests.
You can suppress (turn off) the indicators for warning and error messages in these ways:
You can suppress a specific instance of a Code Analyzer message in the current file. For example, to
suppress the message on line 48 in the sample file lengthofline.m, right-click the first underline
on line 48 and select Suppress 'Terminate statement with semicolon...' > On This Line.
The comment %#ok<NOPRT> appears at the end of the line, which instructs MATLAB to suppress the
Terminate statement with semicolon to suppress output (in functions) Code
Analyzer message for that line. The underline and mark in the indicator bar for the message
disappear.
If a line contains two message that you do not want to display, right-click each underline separately
and select the appropriate entry from the context menu. The %#ok syntax expands. For example,
suppressing both messages for line 48 in the sample file lengthofline.m adds the comment
%#ok<NBRAK,NOPRT> at the end of the line.
Even if Code Analyzer preferences are set to enable this message, the specific instance of the
suppressed message does not appear because the %#ok takes precedence over the preference
setting. If you later decide you want to show the Terminate statement with semicolon to
suppress output (in functions) Code Analyzer message for that line, delete %#ok<NOPRT>
from the line.
24-9
24 Coding and Productivity Tips
You can suppress all instances of a specific Code Analyzer message in the current file. For example, to
suppress all instances of the message on line 48 in the sample file lengthofline.m, right-click the
first underline on line 48 and select Suppress 'Terminate statement with semicolon...' > In This
File.
The comment %#ok<*NOPRT> appears at the end of the line, which instructs MATLAB to suppress all
instances of the Terminate statement with semicolon to suppress output (in
functions) Code Analyzer message in the current file. All underlines and marks in the message
indicator bar that correspond to this message disappear.
If a line contains two messages that you do not want to display anywhere in the current file, right-
click each underline separately and select the appropriate entry from the context menu. The %#ok
syntax expands. For the example, suppressing both messages for line 48 in the sample file
lengthofline.m adds the comment %#ok<*NBRAK,*NOPRT>.
Even if Code Analyzer preferences are set to enable this message, the message does not appear
because the %#ok takes precedence over the preference setting. If you later decide you want to show
all instances of the Terminate statement with semicolon to suppress output (in
functions) Code Analyzer message in the current file, delete %#ok<*NOPRT> from the line.
You can disable all instances of a Code Analyzer message in all files. For example, to suppress all
instances in all files of the message on line 48 in the sample file lengthofline.m, right-click the
first underline on line 48 and select Suppress 'Terminate statement with semicolon...' > In All
Files. This option modifies the Code Analyzer preferences.
If you know which messages you want to suppress, you can disable them directly using Code Analyzer
preferences:
1
On the Home tab, in the Environment section, click Preferences.
2 Select MATLAB > Code Analyzer.
3 Search the messages to find the ones you want to suppress.
4 Clear the check box associated with each message you want to suppress in all files.
5 Click OK.
You can set options to enable or disable certain Code Analyzer messages, and then save those
settings to a file. When you want to use a settings file with a particular file, you select it from the
Code Analyzer preferences. The settings file remains in effect until you select another settings file.
Typically, you change the settings file when you have a subset of files for which you want to use a
particular settings file.
1
On the Home tab, in the Environment section, click Preferences.
2 Select MATLAB > Code Analyzer.
3 Enable or disable specific messages or categories of messages.
24-10
Check Code for Errors and Warnings Using the Code Analyzer
4 Click the Actions button , select Save As, and then save the settings to a txt file.
5 Click OK.
You can reuse these settings for any MATLAB file, or provide the settings file to another user. To use
the saved settings:
1
On the Home tab, in the Environment section, click Preferences.
2 Select MATLAB > Code Analyzer.
3 Open the Active settings list and select Browse.
4 Choose from any of your settings files.
The settings you choose remain in effect for all MATLAB files until you select another set of Code
Analyzer settings.
• One or more %#ok<message-ID> directives are on a line of code that elicits a message specified
by <message-ID>.
• One or more %#ok<*message-ID> directives are in a file that elicits a message specified by
<message-ID>.
• The messages are cleared in the Code Analyzer preferences pane.
• The messages are disabled by default.
1 Search the file for the %#ok directive and create a list of all the message IDs associated with that
directive.
2
On the Home tab, in the Environment section, click Preferences.
3 Select MATLAB > Code Analyzer.
4 In the search field, type msgid: followed by one of the message IDs from step 1. The message
list now contains only the message that corresponds to that ID. If the message is a hyperlink,
click it to see an explanation and suggested action for the message. The results can provide
insight into why the message is suppressed or disabled.
24-11
24 Coding and Productivity Tips
5
Click the Clear search button to clear the search field, and then repeat step 4 for each
message ID from step 1.
6 To display messages that are disabled by default and disabled in the Preferences window, click
the down arrow to the right of the search field. Then, select Show Disabled Messages.
7 Review the message associated with each message ID to understand why it is suppressed in the
code or disabled in Preferences.
• Code analysis sometimes fails to produce Code Analyzer messages where you expect them.
By design, code analysis attempts to minimize the number of incorrect messages it returns, even if
this behavior allows some issues to go undetected.
• Code analysis sometimes produces messages that do not apply to your situation.
Clicking the Details button to display additional information for a message can help you
determine if the message applies to your situation. Error messages are almost always problems.
However, many warnings are suggestions to look at something in the code that is unusual, but
might be correct in your case.
Suppress a warning message if you are certain that the message does not apply to your situation.
If your reason for suppressing a message is subtle or obscure, include a comment giving the
rationale. That way, those who read your code are aware of the situation.
For more information, see “Adjust Code Analyzer Message Indicators and Messages” on page 24-9.
Code analysis cannot always distinguish function names from variable names. For the following code,
if the Code Analyzer message is enabled, code analysis returns the message, Code Analyzer
cannot determine whether xyz is a variable or a function, and assumes it is a
24-12
Check Code for Errors and Warnings Using the Code Analyzer
function. Code analysis cannot make a determination because xyz has no obvious value assigned to
it. However, the code might have placed the value in the workspace in a way that code analysis
cannot detect.
function y=foo(x)
.
.
.
y = xyz(x);
end
For example, in the following code, xyz can be a function or a variable loaded from the MAT-file.
Code analysis has no way of making a determination.
function y=foo(x)
load abc.mat
y = xyz(x);
end
Variables might also be undetected by code analysis when you use the eval, evalc, evalin, or
assignin functions.
• Initialize the variable so that code analysis does not treat it as a function.
• For the load function, specify the variable name explicitly in the load command line. For
example:
function y=foo(x)
load abc.mat xyz
y = xyz(x);
end
Code analysis cannot always distinguish structures from handle objects. In the following code, if x is
a structure, you might expect a Code Analyzer message indicating that the code never uses the
updated value of the structure. If x is a handle object, however, then this code can be correct.
function foo(x)
x.a = 3;
end
Code analysis cannot determine whether x is a structure or a handle object. To minimize the number
of incorrect messages, code analysis returns no message for the previous code, even though it might
contain a subtle and serious bug.
If some built-in functions are overloaded in a class or on the path, Code Analyzer messages might
apply to the built-in function, but not to the overloaded function you are calling. In this case, suppress
the message on the line where it appears or suppress it for the entire file.
For information on suppressing messages, see “Adjust Code Analyzer Message Indicators and
Messages” on page 24-9.
24-13
24 Coding and Productivity Tips
Code analysis has a limited ability to determine the type of variables and the shape of matrices. Code
analysis might produce messages that are appropriate for the most common case, such as for vectors.
However, these messages might be inappropriate for less common cases, such as for matrices.
Code Analyzer has limited capabilities to check class definitions with superclasses. For example, Code
Analyzer cannot always determine if the class is a handle class, but it can sometimes validate custom
attributes used in a class if the attributes are inherited from a superclass. When analyzing class
definitions, Code Analyzer tries to use information from the superclasses, but often cannot get
enough information to make a certain determination.
Most class methods must contain at least one argument that is an object of the same class as the
method. But this argument does not always have to be the first argument. When it is, code analysis
can determine that an argument is an object of the class you are defining, and can do various checks.
For example, code analysis can check that the property and method names exist and are spelled
correctly. However, when code analysis cannot determine that an object is an argument of the class
you are defining, then it cannot provide these checks.
1
On the Home tab, in the Environment section, click Preferences.
2 Select MATLAB > Code Analyzer.
3 Click the down arrow next to the search field, and then select Show Messages in Category >
MATLAB Compiler (Deployment) Messages.
4 Click the Enable Category button to the right of the MATLAB Compiler (Deployment)
Messages category title.
5 Clear individual messages that you do not want to display for your code.
6 Decide if you want to save these settings, so you can reuse them the next time you work on a file
to be deployed.
The settings txt file, which you can create as described in “Save and Reuse Code Analyzer Message
Settings” on page 24-10, includes the status of this setting.
See Also
mlintrpt | checkcode
24-14
Check Code for Errors and Warnings Using the Code Analyzer
Related Examples
• “MATLAB Code Analyzer Report” on page 24-29
• “Code Analyzer Preferences”
24-15
24 Coding and Productivity Tips
Column Selection
When adding or editing code in the Editor and Live Editor, you can select and edit a rectangular area
of code (also known as column selection or block edit). If you want to copy or delete several columns
of data (as opposed to rows) or if you want to edit multiple lines at one time, selecting and editing
code is useful. To select a rectangular area, press the Alt key while making a selection with the
mouse. On macOS systems, use the Option key instead.
Before R2021b, column selection is available only in the Live Editor, not in the Editor.
Change Case
You can change the case of selected text or code from all uppercase to lowercase, or vice versa, in the
Editor and Live Editor. Select the text, right-click, and select Change Case. Alternatively, you can
press Ctrl+Shift+A. If the text contains uppercase and lowercase text, MATLAB changes the case to
all uppercase.
Before R2021b, the Change Case option is available only in the Live Editor, not in the Editor.
24-16
Edit and Format Code
MATLAB can also complete block endings. On the Home tab, in the Environment section, click
Preferences. Select Editor/Debugger > Automatic Completions and in the Autocoding options
section, select one or more of the Autocomplete block endings options.
To undo an automatic code completion, press Ctrl+Z or the Undo button. To disable automatic
code completions, in the Editor/Debugger > Automatic Completions preferences, clear one or
more of the options in the Autocoding options section.
Before R2021b, MATLAB completes code only in the Live Editor, not in the Editor.
Refactor Code
You can break large scripts or functions into smaller pieces by converting selected areas of code into
functions or local functions, known as code refactoring.
Before R2021b, refactoring options are available only in the Live Editor, not in the Editor.
Indent Code
Indenting code makes functions and statements such as while loops easier to read. By default,
MATLAB indents code such as functions and the body of loops in the Editor and Live Editor as you
type. When you indent lines by using tabs or spaces, MATLAB also aligns subsequent lines with those
lines.
You can enable or disable automatic indenting depending on how you prefer to write code. On the
Home tab, in the Environment section, click Preferences. Select MATLAB > Editor/
Debugger > Language and in the Language drop-down list, select a programming language. Then,
in the Indenting section of the selected language, select or clear the Apply smart indenting while
typing option.
Note Indenting preferences are not supported for TLC, VHDL, or Verilog.
In MATLAB Online, indenting preferences are located under MATLAB > Editor/Debugger >
MATLAB Language and MATLAB > Editor/Debugger > Other Languages.
To indent selected lines of code if automatic indenting is disabled, go to the Editor or Live Editor
To manually increase the indent of selected lines further to the left or right, on the Editor or Live
Editor tab, click , or . Manually increasing the indent works whether automatic indenting is
24-17
24 Coding and Productivity Tips
enabled or disabled. Alternatively, you can use the Tab key or the Shift+Tab key, respectively. If you
select the Emacs-style Tab key smart indenting option in the MATLAB > Editor/Debugger >
Tab preferences, the selected lines indent according to indenting practices.
Before R2018a, indenting preferences are supported only in the Editor, not in the Live Editor.
You can specify how functions indent in MATLAB code files. On the Home tab, in the Environment
section, click Preferences. Select MATLAB > Editor/Debugger > Language and in the
Language drop-down list, select MATLAB. Then, select from the Function indenting format
options:
• Classic — The Editor and Live Editor align the function code with the function declaration.
• Indent nested functions — The Editor and Live Editor indent the function code within a
nested function.
• Indent all functions — The Editor and Live Editor indent the function code for main and
nested functions.
In MATLAB Online, MATLAB indenting preferences are located under MATLAB > Editor/Debugger
> MATLAB Language.
Fold Code
Code folding expands and collapses blocks of MATLAB code in the Editor. You can use code folding to
hide code that you are not currently working on. Code folding improves the readability of a file that
contains numerous functions or other blocks of code. Code folding is not supported in the Live Editor.
24-18
Edit and Format Code
• Code sections
• for and parfor blocks
• Function code
• Class code
• Multiline comments
To expand or collapse a block of code, click the plus or minus sign that appears to the left of the
construct in the Editor. Alternatively, you can use the Ctrl+Shift+. (period) and Ctrl+. (period)
keyboard shortcuts or use the code folding buttons in the View tab.
To expand or collapse all of the code in a file, place your cursor anywhere within the file, go to the
View tab, and select Expand All or Collapse All. Alternatively, you can use the Ctrl+Shift
+, (comma) and Ctrl+, (comma) keyboard shortcuts.
Note If you print a file with one or more collapsed constructs, those constructs are expanded in the
printed version of the file.
You can change which programming constructs can be folded and whether a programming construct
is collapsed the first time that you open a MATLAB file. On the Home tab, in the Environment
section, click Preferences. Select Editor/Debugger > Code Folding, and then adjust the
preference options.
1
On the Home tab, in the Environment section, click Preferences.
2 In the Preferences window, select MATLAB > Editor/Debugger > Display.
3 Adjust the settings in the Right-hand text limit section.
The right-side text limit indicator is a visual cue only and does not prevent text from exceeding the
limit. To wrap comment text at a specified column number automatically, go to the Home tab and in
the Environment section, click Preferences. Select MATLAB > Editor/Debugger > Language,
and adjust the Comment formatting preferences. To adjust Comment formatting preferences in
MATLAB Online, select Editor/Debugger > MATLAB Language.
See Also
Related Examples
• “Create Scripts” on page 18-2
24-19
24 Coding and Productivity Tips
24-20
Find and Replace Text in Files and Go to Location
search for text in a file, on the Editor or Live Editor tab, in the Navigate section, click Find. You
also can use the Ctrl+F keyboard shortcut.
In the find and replace dialog box, enter the text that you want to search for and then use the and
buttons to search forward or backward through the file. You also can use the F3 and Shift+F3
keyboard shortcuts.
To find text that matches the case of the search text, select the button. To find an exact full-word
match, select the button.
To replace text in the file, click the expand button to the left of the search field to open the replace
options. Then, enter the text that you want to replace the search text with and use the and
buttons to replace the text.
To programmatically search for text in the first comment line of help in all MATLAB code files found
on the search path, use the lookfor function.
Note If the indicator bar contains a code analyzer marker and a variable marker for the same line,
the variable marker takes precedence.
Finding functions and variables using automatic highlighting is more efficient than using text finding
tools because when using automatic highlighting, MATLAB only finds references to that particular
function or variable, not other occurrences. For example, it does not find instances of the function or
variable name in comments. Furthermore, MATLAB only finds references to the same variable. That
is, if two variables use the same name, but are in different scopes on page 20-10, highlighting one
does not cause the other to highlight.
For example, if you select the first instance of the variable i in the rowTotals function, MATLAB
highlights that instance and the two other instances of i. In addition, MATLAB displays three
variables markers in the indicator bar.
24-21
24 Coding and Productivity Tips
To disable automatic highlighting of functions and variables, go to the Home tab and in the
Environment section, click Preferences. In MATLAB > Colors > Programming Tools, clear
the Automatically highlight option.
function foo(m)
Input or output variable name in a function Rename y or m in:
declaration
function y = foo(m)
(Except varargin and varargout)
Variable name on the left side of assignment Rename y in:
statement
y = 1
(Except global variable names)
When you rename a variable or function, if there is more than one reference to that variable or
function in the file, MATLAB prompts you to rename all instances by pressing Shift + Enter.
(Typically, multiple references to a function in a file only occur when you use nested functions or local
functions.)
24-22
Find and Replace Text in Files and Go to Location
Automatic variable and function renaming is enabled by default. To disable it, on the Home tab, in
the Environment section, click Preferences. Select MATLAB > Editor/Debugger >
Language and in the Language field, select MATLAB. Then, clear the Enable automatic variable
and function renaming preference.
In MATLAB Online, the Enable automatic variable and function renaming preference is located
in MATLAB > Editor/Debugger > MATLAB Language.
tab, in the Navigate section, click Find and select Find Files. For more information, see “Find
Files and Folders”.
Go To Location in File
You can go to a specific location in a file, set bookmarks, navigate backward and forward within the
file, and open a file or variable from within a file.
This table show how to navigate to a specific location in a file open in the Editor and Live Editor.
24-23
24 Coding and Productivity Tips
Go To Instructions Notes
Line Number On the Editor or Live Editor tab, in the None
24-24
Find and Replace Text in Files and Go to Location
Go To Instructions Notes
Method In the Current Folder browser, select the For more information, see “Methods in
file that you want to navigate through and Class Design”.
click the up arrow at the bottom of
Current Folder browser to open the Details
panel. Then, in the Details panel, double-
Note The Details panel does not display details for live scripts or live functions and is not available in
MATLAB Online.
Set Bookmarks
You can set a bookmark at any line in a file in the Editor and Live Editor so that you can quickly
navigate to the bookmarked line. This is particularly useful in long files. For example, suppose that
while working on a line, you want to look at another part of the file, and then return. Set a bookmark
at the current line, go to the other part of the file, and then use the bookmark to return.
To set a bookmark in the Editor and Live Editor, position the cursor on the line that you want to add
the bookmark to. Then, go to the Editor or Live Editor tab, and in the Navigate section, click
Bookmark. To clear the bookmark, click Bookmark , and select Set/Clear. You also can click the
bookmark icon to the left of the line.
In the Editor and Live Editor, you can access lines in a file in the same sequence that you previously
navigated or edited them. To navigate backward and forward in sequence, on the Editor or Live
Editing a line or navigating to another line using the list of features described in “Navigate to a
Specific Location” on page 24-23 interrupts the backward and forward sequence. Once the sequence
is interrupted, you can still go to the lines preceding the interruption point in the sequence, but you
cannot go to any lines after that point. Any lines that you edit or navigate to after interrupting the
sequence are added to the sequence after the interruption point.
For example, open a file containing more than 6 lines and edit lines 2, 4, and 6. Click the button
to return to line 4, and then again to return to line 2. Click the button to return to line 4. Edit line
3. This interrupts the sequence. You can no longer use the button to return to line 6. You can,
24-25
24 Coding and Productivity Tips
You can open a function, file, variable, or Simulink model from within a file in the Editor or Live
Editor. Position the cursor on the name, right-click, and select Open selection. The Editor or Live
Editor performs a action based on the selection, as described in this table.
Item Action
Local function Navigates to the local function within the current file, if that file is a
MATLAB code file. If no function by that name exists in the current file,
the Editor or Live Editor runs the open function on the selection,
which opens the selection in the appropriate tool.
Text file Opens in the Editor.
Figure file (.fig) Opens in a figure window.
MATLAB variable that is in Opens in the Variables Editor.
the current workspace
Model Opens in Simulink.
Other If the selection is some other type, Open selection looks for a
matching file in a private folder in the current folder and performs the
appropriate action.
See Also
lookfor
Related Examples
• “Find Files and Folders”
24-26
Add Reminders to Files
This sample TODO/FIXME Report shows a file containing the text TODO, FIXME, and NOTE. The
search is case insensitive.
Note You cannot run reports when the path is a UNC (Universal Naming Convention) path; that
is, a path that starts with \\. Instead, use an actual hard drive on your system, or a mapped
network drive.
2 On the Current Folder browser, click , and then select Reports > TODO/FIXME Report.
• TODO
• FIXME
• The text field check box
You can then enter any text in this field, including a regular expression on page 2-51. For
example, you can enter NOTE, tbd, or re.*check.
Specifying custom text or which lines to search for is not supported in MATLAB Online.
4 Run the report on the files in the current folder, by clicking Rerun This Report.
The window refreshes and lists all lines in the MATLAB files within the specified folder that
contain the text you selected in step 1. Matches are not case sensitive.
If you want to run the report on a folder other than the one currently specified in the report
window, change the current folder. Then, click Run Report on Current Folder.
To open a file in the Editor at a specific line, click the line number in the report. Then you can change
the file, as needed.
24-27
24 Coding and Productivity Tips
Suppose you have a file, area.m, in the current folder. The code for area.m appears in the image
that follows.
When you run the TODO/FIXME report on the folder containing area.m, with the text TODO and
FIXME selected and the text NOTE specified and selected, the report lists:
9 and rectangle. (todo)
14 Fixme: Is the area of hemisphere as below?
17 fIXME
21 NOTE: Find out from the manager if we need to include
• Line 9 as a match for the text TODO. The report includes lines that have the selected text
regardless of its placement within a comment.
• Lines 14 and 17 as a match for the text FIXME. The report matches selected text in the file
regardless of their casing.
• Line 21 as a match for the text NOTE. The report includes lines that have text as specified in the
text field, assuming that you select the text field.
24-28
MATLAB Code Analyzer Report
1 In the Current Folder browser, navigate to the folder that contains the files you want to check.
2 Click , and then select Reports > Code Analyzer Report.
The report displays in the MATLAB Web Browser, showing those files identified as having
potential problems or opportunities for improvement.
3 For each message in the report, review the suggestion and your code. Click the line number to
open the file in the Editor at that line, and change the file based on the message. Use the
following general advice:
• If you are unsure what a message means or what to change in the code, click the link in the
message if one appears. If the message does not contain a link, and you are unsure what a
message means or what to do, search for related topics in the Help browser. For more
information, see “Check Code for Errors and Warnings Using the Code Analyzer” on page 24-
5.
• The messages do not provide perfect information about every situation and in some cases, you
might not want to change anything based on the message. For more information, see
“Understand the Limitations of Code Analysis” on page 24-12.
• If there are certain messages or types of messages you do not want to see, you can suppress
them. For more information, see “Adjust Code Analyzer Message Indicators and Messages” on
page 24-9.
4 After modifying the file, save it. Consider saving the file to a different name if you made
significant changes that might introduce errors. Then you can refer to the original file, if needed,
24-29
24 Coding and Productivity Tips
to resolve problems with the updated file. Use the Compare button on the Editor or Live
Editor tab to help you identify the changes you made to the file. For more information, see
“Compare Files and Folders and Merge Files”.
5 Run and debug the file or files again to be sure that you have not introduced any inadvertent
errors.
6 If the report is displaying, click Rerun This Report to update the report based on the changes
you made to the file. Ensure that the messages are gone, based on the changes you made to the
files. To rerun the report in MATLAB Online, in the Current Folder browser, click , and then
select Reports > Code Analyzer Report.
• Open the file in the Editor and click the Details button in the tooltip, as shown in the image
following this list. An extended message opens. However, not all messages have extended
messages.
• Use the Help browser Search pane to find documentation about terms presented in the messages.
The following image shows a tooltip with a Details button. The orange line under the equals (=) sign
indicates a tooltip displays if you hover over the equals sign. The orange highlighting indicates that
an automatic fix is available.
• Access the Code Analyzer Report for a file from the Profiler detail report.
• Run the checkcode function, which analyzes the specified file and displays messages in the
Command Window.
• Run the mlintrpt function, which runs checkcode and displays the messages in the Web
Browser.
• Use automatic code checking while you work on a file in the Editor. For more information, see
“Check Code for Errors and Warnings Using the Code Analyzer” on page 24-5.
See Also
mlintrpt | checkcode
24-30
MATLAB Code Analyzer Report
Related Examples
• “Check Code for Errors and Warnings Using the Code Analyzer” on page 24-5
• “Code Analyzer Preferences”
24-31
24 Coding and Productivity Tips
• Identify the compatibility issues that you must address for your code to run properly in the current
MATLAB release.
• Estimate the effort required to update your code when you upgrade to a newer MATLAB release.
• Improve your code by replacing functionality that is not recommended.
The Code Compatibility Report displays the locations in your code that are affected by compatibility
issues and provides links to the documentation for more information on how to make the necessary
changes at each location.
1 In the Current Folder browser, navigate to and open the folder that contains the code files you
want to analyze.
2 In the Current Folder browser that lists the files you want to analyze, either click or right-click
in the white space of the browser. Both options open a menu. Select Reports > Code
Compatibility Report. Alternatively, you can run codeCompatibilityReport at the command
prompt to generate the report.
The report displays in the MATLAB Web Browser, showing potential compatibility issues. For
example:
24-32
MATLAB Code Compatibility Report
3 Update your code to resolve the syntax errors for each file listed in the Syntax Errors section.
Syntax errors result in code that does not run. While most likely the code did not run properly in
previous releases, syntax errors impact compatibility analysis. For example, Parse error at '}':
usage might be invalid MATLAB syntax.
4 For each functionality listed in the report, review the issue description and your code. Messages
include the line numbers to help locate the issue in your code. To open the file in the Editor at
that line, click the line number. Then change the file based on the message. If you are unsure
what a message means or what to change in the code, click the Documentation link associated
with the message.
Each functionality listed in the report displays a recommended action. You also can use the
following general advice:
• Functionality that has been removed — Update your code to avoid compatibility errors in
the current release.
• Functionality that has changed behavior — Confirm that the change in behavior is
acceptable, and if not, update your code for the current release.
• Unsupported functionality that might cause errors — Files listed here use functionality
that is unsupported, undocumented, and not intended for customer use. Update your code to
use documented functionality to avoid errors and unexpected behavior changes.
• Functionality that will be removed — Update your code now or in a later release. Updating
your code now makes future upgrades easier.
• Functionality that will change behavior — Investigate these changes now to make future
upgrades easier.
• New functionality that might improve code — Consider updating your code. Current code
is expected to continue working in future releases but newer functionality is recommended.
24-33
24 Coding and Productivity Tips
The Code Compatibility Report also includes information about the checks performed on your
code and the list of files that MATLAB analyzed for code compatibility.
Programmatic Use
When you generate a Code Compatibility Report through the current folder browser, MATLAB
analyzes code in the current working folder and subfolders. However, if you generate a report
programmatically, you can specify particular files to analyze or to exclude subfolders from analysis.
To generate a report programmatically, use one of the following methods.
• To generate a report that opens in the MATLAB® Web Browser programmatically, use the
codeCompatibilityReport function.
• To return a CodeCompatibilityAnalysis object that contains the report information, use the
analyzeCodeCompatibility function. You can then display a report for the stored object using
the codeCompatibilityReport function.
Unsupported Functionality
The Code Compatibility Report checks for functionality that is unsupported, undocumented, and not
intended for use. Such features are subject to change or removal without notice and can cause future
errors. In some cases there is documented replacement functionality, but there might be no simple
replacement. Contact MathWorks Support to describe your usage and request supported
replacement.
See Also
analyzeCodeCompatibility | codeCompatibilityReport | CodeCompatibilityAnalysis
24-34
25
Programming Utilities
1 Type clear functions to clear all functions from memory (see Note below).
Note clear functions does not clear functions locked by mlock. If you have locked functions
(which you can check using inmem) unlock them with munlock, and then repeat step 1.
2 Execute the function you want to check. Note that the function arguments you choose to use in
this step are important, because you can get different results when calling the same function
with different arguments.
3 Type inmem to display all program files that were used when the function ran. If you want to see
what MEX-files were used as well, specify an additional output:
[fList,pList] = matlab.codetools.requiredFilesAndProducts('myFun.m');
fList
fList =
'C:\work\myFun.m'
The only required program file, is the function file itself, myFun.
{pList.Name}'
ans =
'MATLAB'
'Image Processing Toolbox'
The file, myFun.m, requires both MATLAB and the Image Processing Toolbox.
25-2
Identify Program Dependencies
• Which files in the folder are required by other files in the folder
• If any files in the current folder will fail if you delete a file
• If any called files are missing from the current folder
• Files in the toolbox/matlab folder because every MATLAB user has those files.
Therefore, if you use a function file that shadows a built-in function file, MATLAB excludes both
files from the list.
• Files called from anonymous functions.
• The superclass for a class file.
• Files called from eval, evalc, run, load, function handles, and callbacks.
MATLAB does not resolve these files until run time, and therefore the Dependency Report cannot
discover them.
• Some method files.
The Dependency Report finds class constructors that you call in a MATLAB file. However, any
methods you execute on the resulting object are unknown to the report. These methods can exist
in the classdef file, as separate method files, or files belonging to superclass or superclasses of
a method file.
• The search path when you run the report is the same as when you run the files in the folder. (That
is, the current folder is at the top of the search path.)
• The files in the folder for which you are running the report do not change the search path or
otherwise manipulate it.
• The files in the folder do not load variables, or otherwise create name clashes that result in
different program elements with the same name.
Note Do not use the Dependency Report to determine which MATLAB code files someone else needs
to run a particular file. Instead use the matlab.codetools.requiredFilesAndProducts
function.
1 Use the Current Folder pane to navigate to the folder containing the files for which you want to
produce a Dependency Report.
Note You cannot run reports when the path is a UNC (Universal Naming Convention) path; that
is, a path that starts with \\. Instead, use an actual hard drive on your system, or a mapped
network drive.
2 On the Current Folder pane, click , and then select Reports > Dependency Report.
25-3
25 Programming Utilities
• To see a list of all MATLAB code files (children) called by each file in the folder (parent), select
Show child functions.
The report indicates where each child function resides, for example, in a specified toolbox. If
the report specifies that the location of a child function is unknown, it can be because:
The report limits the parent (calling) functions to functions in the current folder.
• To include local functions in the report, select Show subfunctions. The report lists local
functions directly after the main function and highlights them in gray.
4 Click Run Report on Current Folder.
The following image shows a Dependency Report. It indicates that chirpy.m calls two files in Signal
Processing Toolbox™ and one in Image Processing Toolbox. It also shows that go.m calls mobius.m,
which is in the current folder.
The list of files in the folder on which you ran the Dependency Report. Click a link in this column
to open the file in the Editor.
• Children
25-4
Identify Program Dependencies
Click a link in this column to open the MATLAB file listed in the same row, and go to the first
reference to the called function. For instance, suppose your Dependency Report appears as shown
in the previous image. Clicking \images\images\erode.m opens chirpy.m and places the cursor
at the first line that references erode. In other words, it does not open erode.m.
• Multiple class methods
Because the report is a static analysis, it cannot determine run-time data types and, therefore,
cannot identify the particular class methods required by a file. If multiple class methods match a
referenced method, the Dependency Report inserts a question mark link next to the file name. The
question mark appears in the following image.
Click the question mark link to list the class methods with the specified name that MATLAB might
use. MATLAB lists almost all the method files on the search path that match the specified method
file (in this case, freqresp.m). Do not be concerned if the list includes methods of classes and
MATLAB built-in functions that are unfamiliar to you.
It is not necessary for you to determine which file MATLAB will use. MATLAB determines which
method to use depending on the object that the program calls at run time.
25-5
25 Programming Utilities
• Deploy as P-code on page 25-6 — Convert some or all of your source code files to a content-
obscured form called a P-code file (from its .p file extension), and distribute your application code
in this format. When MATLAB P-codes a file, the file is obfuscated not encrypted. While the
content in a .p file is difficult to understand, it should not be considered secure. It is not
recommended that you P-code files to protect your intellectual property.
MATLAB does not support converting live scripts or live functions to P-code files.
• Compile into binary format on page 25-7 — Compile your source code files using the MATLAB
Compiler to produce a standalone application. Distribute the latter to end users of your
application.
Note Because users of P-code files cannot view the MATLAB code, consider providing diagnostics to
enable a user to proceed in the event of an error.
To generate a P-code file, enter the following command in the MATLAB Command Window:
The command produces the files, file1.p, file2.p, and so on. To convert all .m source files
residing in your current folder to P-code files, use the command:
pcode *.m
See the pcode function reference page for a description of all syntaxes for generating P-code files.
You invoke the resulting P-code file in the same way you invoke the MATLAB .m source file from
which it was derived. For example, to invoke file myfun.p, type
myscript;
25-6
Protect Your Source Code
When you call a P-code file, MATLAB gives it execution precedence over its corresponding .m source
file. This is true even if you happen to change the source code at some point after generating the P-
code file. Remember to remove the .m source file before distributing your code.
P-code files are designed to be independent of the release under which they were created and the
release in which they are used (backward and forward compatibility). New and deprecated MATLAB
features can be a problem, but it is the same problem that would exist if you used the original
MATLAB input file. To fix errors of this kind in a P-code file, fix the corresponding MATLAB input file
and create a new P-code file.
P-code files built using MATLAB Version 7.4 and earlier have a different format than those built with
more recent versions of MATLAB. These older P-code files do not run in MATLAB 8.6 (R2015b) or
later. Rebuild any P-code files that were built with MATLAB 7.4 or earlier using a more recent version
of MATLAB, and then redistribute them as necessary.
To build a standalone application for your MATLAB application, develop and debug your application
following the usual procedure for MATLAB program files. Then, generate the executable file or files
following the instructions in “Create Standalone Application from MATLAB” (MATLAB Compiler).
25-7
25 Programming Utilities
Use matlab: syntax to create a hyperlink in the Command Window that runs one or more functions.
For example, you can use disp to display the word Hypotenuse as an executable hyperlink as follows:
Clicking the hyperlink executes the three commands following matlab:, resulting in
c =
5
Executing the link creates or redefines the variables a, b, and c in the base workspace.
The argument to disp is an <a href> HTML hyperlink. Include the full hypertext text, from '<a
href= to </a>' within a single line, that is, do not continue long text on a new line. No spaces are
allowed after the opening < and before the closing >. A single space is required between a and href.
You cannot directly execute matlab: syntax. That is, if you type
matlab:a=3; b=4;c=hypot(a,b)
you receive an error, because MATLAB interprets the colon as an array operator in an illegal context:
You do not need to use matlab: to display a live hyperlink to the Web. For example, if you want to
link to an external Web page, you can use disp, as follows:
disp('<a href="http://en.wikipedia.org/wiki/Hypotenuse">Hypotenuse</a>')
The result in the Command Window looks the same as the previous example, but instead opens a
page at en.wikipedia.org:
Hypotenuse
25-8
Create Hyperlinks that Run Functions
x = 0:1:8;
y = sin(x);
plot(x,y)
x = -2*pi:pi/16:2*pi;
Click the hyperlink, Plot x,y again and it changes the current value of x back to 0:1:8. The code
that matlab: runs when you click the Plot x,y defines x in the base workspace.
The Command Window displays the links that follow. Depending on which link you click, MATLAB sets
state to 0 or 1.
25-9
25 Programming Utilities
Some symbols might not be interpreted correctly and you might need to use the ASCII value for the
symbol. For example, an alternative way to run the previous statement is to use ASCII 62 instead of
the greater than symbol:
disp('<a href="matlab:str=[''Value '' char(62) '' 0'']">Positive</a>')
25-10
Create and Share Toolboxes
You can package MATLAB files to create a toolbox to share with others. These files can include
MATLAB code, data, apps, examples, and documentation. When you create a toolbox, MATLAB
generates a single installation file (.mltbx) that enables you or others to install your toolbox.
Create Toolbox
To create a toolbox installation file:
1
In the Environment section of the Home tab, select Package Toolbox from the Add-Ons
menu.
2
In the Package a Toolbox dialog box, click the button and select your toolbox folder. It is good
practice to create the toolbox package from the folder level above your toolbox folder.
The .mltbx toolbox file contains information about the path settings for your toolbox files and
folders. By default, any of the included folders and files that are on your path when you create
the toolbox appear on their paths after the end users install the toolbox.
3 In the dialog box, add the following information about your toolbox.
Toolbox Description
Information
Field
Toolbox Enter the toolbox name, if necessary. By default, the toolbox name is the
Name name of the toolbox folder. The Toolbox Name becomes the .mltbx file
name.
Version Enter the toolbox version number in the Major.Minor.Bug.Build format.
Bug and Build are optional.
Author Enter contact information for the toolbox author. To save the contact
Name, Email, information, click Set as default contact.
and Company
Toolbox To select an image that represents your toolbox, click Select toolbox
Image image.
Summary and Enter the toolbox summary and description. It is good practice to keep the
Description Summary text brief and to add detail to the Description text.
4 To ensure MATLAB detects the expected components, review the toolbox contents. The following
sections of the Package a Toolbox dialog box appear after you select a toolbox folder.
25-11
25 Programming Utilities
Package a Description
Toolbox
Dialog Box
Section
Toolbox List of the folders and files contained in your toolbox. The listed files and
Files and folders are only those files that are located in the top level of the toolbox
Folders folder. You cannot navigate through the folders in the Toolbox Packaging
dialog box.
By default, if your toolbox contains a P-code file and a MATLAB code file (.m)
with the same name in the same folder, MATLAB excludes the .m file from the
toolbox. To include both the .p and .m files, clear the Exclude MATLAB
script or function files with matching P-files option.
To exclude other files or folders from the toolbox, register them in the text file
that is displayed when you click Exclude files and folders. It is good
practice to exclude any source control files related to your toolbox.
Requiremen Add-ons — List of add-ons required for your toolbox. Selected add-ons are
ts downloaded and installed when the toolbox is installed. MATLAB auto-
populates this list with the add-ons it thinks the toolbox requires and selects
them all by default. You can choose to omit any add-ons you do not want to
install with your toolbox.
25-12
Create and Share Toolboxes
Package a Description
Toolbox
Dialog Box
Section
Installation of Additional Software — List of additional software ZIP files that
are installed on the user's system when they install a toolbox.
• Display Name — The name to display to the user when they install a
toolbox.
• License URL — The URL of the additional software license agreement to
display to the user when they install a toolbox. The user is prompted to
review and agree to the license agreement during installation. You must
specify a valid URL to the license agreement.
• Download URL — The URL to the ZIP file that contains the additional
software. To specify different download URLs for different platforms,
select a platform name from the drop-down menu to the left of the
download URL. Then, click Add Platform to add a download URL for
additional platforms.
When the user installs a toolbox, MATLAB installs all additional software in
the addons\Toolboxes\AdditionalSoftware folder, where addons is the
add-ons default installation folder. For more information about the location of
the add-ons default installation folder, see “Get and Manage Add-Ons”.
If your toolbox contains code that refers to the installation folder of the
specified additional software, make these references portable to other
computers. Replace the references with calls to the generated function
toolboxname\getInstallationLocation.mlx, where toolboxname is
the name of your toolbox. For example, if you are creating a toolbox called
mytoolbox and want to reference the install location for additional software
called mysoftware, replace this code
mysoftwarelocation = 'C:\InstalledSoftware\mysoftware\'
mysoftwarelocation = mytoolbox.getInstallationLocation('mysoftware')
25-13
25 Programming Utilities
Package a Description
Toolbox
Dialog Box
Section
Platform Compatibility—List of platforms that support the toolbox. Consider if
your toolbox has third-party software or hardware requirements that are
platform specific. MATLAB Online cannot interact with hardware, including
devices used for image acquisition and instrument control.
Release Compatibility—List of MATLAB releases that support the toolbox.
Products—List of MathWorks products required by your toolbox. Create this
list manually.
Examples, Examples—Published MATLAB examples associated with your toolbox. To
Apps, and include .m and .mlx files as examples, click the Add examples button, select
Documentat your code file, and click Publish HTML. MATLAB publishes the code to
ion HTML and places the output files in the html folder.
Alternatively, you can manually publish code files to HTML in MATLAB and
then include the code files and the HTML files in your toolbox folder.
• For a live script (.mlx) example, export it to HTML. On the Live Editor
tab, select Save > Export to HTML and save it in a folder named html.
• For a script (.m) example, publish it to HTML with the publish function.
Do not specify an output folder when publishing your examples. For the
Package a Toolbox tool to recognize the examples, the output folder must
be the default folder (html).
• To specify which apps (.mlapp files) are also installed and registered in
the user's MATLAB Apps Gallery, select the apps.
• All .mlappinstall files in your toolbox folder are installed and
registered in the user's MATLAB Apps Gallery.
25-14
Create and Share Toolboxes
Package a Description
Toolbox
Dialog Box
Section
Getting Started Guide—Quick start guide for your toolbox. For the Package a
Toolbox tool to recognize a Getting Started Guide, include the guide as a live
script named GettingStarted.mlx in a doc subfolder within your toolbox
folder.
Users of your toolbox can view the Getting Started Guide through the Options
menu for the toolbox in the Add-On Manager. For more information, see “Get
and Manage Add-Ons”.
Help Browser Integration—Custom documentation associated with your
toolbox. For the Package a Toolbox tool to recognize custom documentation,
include an info.xml file to identify your documentation files. If you use the
builddocsearchdb function to build the documentation database before
packaging your toolbox, you can include the generated helpsearch
subfolder in your toolbox. The info.xml file and the helpsearch folder
allow recipients to access your documentation through the Supplemental
Software link at the bottom of the Help browser home page. For more
information, see “Display Custom Documentation” on page 32-21.
• To save your toolbox, click Package at the top of the Package a Toolbox dialog box. Packaging
your toolbox generates a .mltbx file in your current MATLAB folder.
• To save your toolbox and share it on MATLAB Central File Exchange, select Package and
Share from the Package menu at the top of the Package a Toolbox dialog box. This option
generates a .mltbx file in your current MATLAB folder and opens a web page for your
toolbox submission to File Exchange. MATLAB populates the File Exchange submission form
with information about the toolbox. Review and submit the form to share your toolbox on File
Exchange.
When you create a toolbox, MATLAB generates a .prj file that contains information about the
toolbox and saves it frequently. It is good practice to save this associated .prj file so that you
can quickly create future revisions of your toolbox.
Share Toolbox
To share your toolbox with others, give them the .mltbx file. All files you added when you packaged
the toolbox are included in the .mltbx file. When the end users install your toolbox, they do not need
to be concerned with the MATLAB path or other installation details. The .mltbx file manages these
details for end users.
25-15
25 Programming Utilities
For information on installing, uninstalling, and viewing information about toolboxes, see “Get and
Manage Add-Ons”.
You can share your toolbox with others by attaching the .mltbx file to an email message, or using
any other method you typically use to share files—such as uploading to MATLAB Central File
Exchange. If you upload your toolbox to File Exchange, your users can download the toolbox from
within MATLAB. For more information, see “Get and Manage Add-Ons”.
Alternatively, you can upload your toolbox to File Exchange when you package it. Select Package
and Share from the Package menu at the top of the Package a Toolbox dialog box.
Note While .mltbx files can contain any files you specify, MATLAB Central File Exchange places
additional limitations on submissions. If your toolbox contains any of the following, it cannot be
submitted to File Exchange:
• MEX-files.
• Other binary executable files, such as DLLs or ActiveX® controls. (Data and image files are
typically acceptable.)
See Also
publish | matlab.addons.toolbox.packageToolbox |
matlab.addons.toolbox.toolboxVersion | matlab.addons.toolbox.installToolbox |
matlab.addons.toolbox.uninstallToolbox |
matlab.addons.toolbox.installedToolboxes
Related Examples
• “Get and Manage Add-Ons”
• “Display Custom Examples” on page 32-29
• “Package Apps From the MATLAB Toolstrip”
• “Display Custom Documentation” on page 32-21
25-16
Run Parallel Language in MATLAB
• parfor
• parfeval and parfevalOnAll
• DataQueue and PollableDataQueue
• afterEach and afterAll
• Constant
You do not need Parallel Computing Toolbox to run code using this functionality.
• parfor
• parfeval and parfevalOnAll
To run functions in the background, use parallel language syntaxes with backgroundPool instead.
Code that you write using backgroundPool can automatically scale to use more parallel resources if
you have Parallel Computing Toolbox. For more information, see backgroundPool.
Serial parfor
The following syntaxes run in parallel when you have Parallel Computing Toolbox, and otherwise run
in serial:
When a parfor-loop runs in serial, the iterations run in reverse order. For more information, see
parfor and parfor.
The following syntaxes run in parallel when you use Parallel Computing Toolbox, and otherwise run in
serial:
• parfeval(fcn,n,X1,...Xm)
• parfevalOnAll(fcn,n,X1,...Xm)
When a Future object runs in serial, MATLAB runs the function fcn associated with it using
deferred execution. The function runs when MATLAB becomes idle, blocking MATLAB until the
function finishes running. Examples of functionality that causes MATLAB to be temporarily idle
include:
25-17
25 Programming Utilities
• Using pause
• Using fetchOutputs or fetchNext to get results from a Future object
• Using wait to wait for a Future object to finish
• Using afterEach or afterAll to run a function after a Future object finishes
When you create a DataQueue or PollableDataQueue object, the object is not directly associated
with the background pool or a parallel pool. You can therefore use a DataQueue or
PollableDataQueue object without any pool.
The following code updates a plot on each iteration of a parfor-loop. If you have Parallel Computing
Toolbox, the parfor-loop runs using a parallel pool. If you do not have Parallel Computing Toolbox,
the code runs in serial.
x = 1:1000
line = plot(x,NaN(size(x)));
q = parallel.pool.DataQueue;
afterEach(q,@(data)updatePlot(line,data));
parfor i = 1:numel(x)
% Simulate some work
pause(rand)
y(i) = x(i)^2;
send(q,[i y(i)])
end
function updatePlot(line,data)
line.XData(data(1)) = data(1);
line.YData(data(1)) = data(2);
drawnow
end
Constant
When you create a Constant object, the object is not directly associated with the background pool or
a parallel pool. You can therefore use a Constant object without any pool.
The following code creates a Constant object in your current MATLAB session. You can write to a
temporary file using c.Value and fprintf.
If you have Parallel Computing Toolbox, the parfor-loop runs using a parallel pool. If you use a
parallel pool, the Constant is available on each worker in the parallel pool. Otherwise, the
Constant object is created only in your current MATLAB session.
c = parallel.pool.Constant(@() fopen(tempfile(pwd),'wt'),@fclose);
parfor i = 1:10
y(i) = i^2;
fprintf(c.Value,"%03d %f\n",i,y(i));
end
25-18
Run Parallel Language in MATLAB
You can use the following syntaxes without Parallel Computing Toolbox:
• parallel.pool.Constant(X)
• parallel.pool.Constant(fcn)
• parallel.pool.Constant(fcn,cleanupFcn)
25-19
26
Function argument validation is declarative, which enables MATLAB desktop tools to extract
information about a function by inspection of specific code blocks. By declaring requirements for
input arguments, you can eliminate cumbersome argument-checking code and improve the
readability, robustness, and maintainability of your code.
The function argument validation syntax simplifies the process of defining optional, repeating, and
name-value arguments. The syntax also enables you to define default values in a consistent way.
In local and private functions, and in private or protected methods, the caller is aware of input
requirements, so these types of functions can be called with valid arguments.
You cannot use argument validation syntax in nested functions, abstract methods, or handle class
destructor methods. For more information on argument validation in methods, see “Argument
Validation in Class Methods” on page 26-16.
You can use multiple arguments blocks in a function, but all blocks must occur before any code that
is not part of an arguments block.
The highlighted area in the following code shows the syntax for argument validation.
26-2
Function Argument Validation
The function argument declaration can include any of these kinds of restrictions:
You can also define a default value for the input argument in the function validation declaration for
that argument. The default value must satisfy the declared restrictions for that argument.
Size
Validation size is the dimensions of the input argument, specified with nonnegative integer numbers
or colons (:). A colon indicates that any length is allowed in that dimension. You cannot use
expressions for dimensions. The value assigned to the argument in the function call must be
compatible with the specified size, or MATLAB throws an error.
MATLAB indexed assignment rules apply to size specifications. For example, a 1-by-1 value is
compatible with the size specified as (5,3) because MATLAB applies scalar expansion. Also,
MATLAB row-column conversion applies so that a size specified as (1,:) can accept a size of 1-by-n
and n-by-1.
If you do not specify a size, then any size is allowed unless restricted by validation functions.
Class
Validation class is the name of a single class. The value assigned to the function input must be of the
specified class or convertible to the specified class. Use any MATLAB class or externally defined class
that is supported by MATLAB, except Java, COM classes, and MATLAB class definitions that do not
use the classdef keyword (classes defined before MATLAB software Version 7.6).
• char — Input must be of class char, or a value that MATLAB can convert to a char, such as
string.
26-3
26 Function Argument Validation
If you do not specify a class, then any class is allowed unless restricted by validation functions.
Validation Functions
A validation function is a MATLAB function that throws an error if certain requirements are not
satisfied by the argument value. Validation functions do not return values and, unlike class and size,
cannot change the value of the arguments they are validating.
During the validation process, MATLAB passes the argument value to each validation function listed
for that argument. The value passed to the validation functions is the result of any conversion made
by the class and size specifications. MATLAB calls each function from left to right and throws the first
error encountered.
For a table of predefined validation functions, see “Argument Validation Functions” on page 26-22.
Default Value
An argument default value can be any constant or expression that satisfies the size, class, and
validation function requirements. Specifying a default value in an argument declaration makes the
argument optional. MATLAB uses the default value when the argument is not included in the function
call. Default value expressions are evaluated each time the default is used.
Note Because MATLAB validates the default value only when the function is called without a value
for the argument, an invalid default value causes an error only when the function is called without
that argument.
Optional arguments must be positioned after required arguments in the function signature and in the
arguments block. For more information on optional arguments, see “Required and Optional
Positional Arguments” on page 26-6.
Validation Sequence
Arguments are validated from top to bottom in the arguments block. MATLAB validates each part of
an argument declaration in a specific order. First the class is validated, then the size. The result of
the class and size validations is passed to the validation functions. Each step is optional depending on
whether class, size, and validation functions are in the argument declaration.
Both class validation and size validation can change the value of an input argument because of
standard MATLAB conversion rules. Therefore, the validated value in the function body can be
different from the value passed when calling the function. The conversion rules are derived from the
rules that MATLAB applies for indexed assignment of the form:
A(indices) = value
26-4
Function Argument Validation
MATLAB can determine that the left side value has requirements for class and size and, in certain
cases, can convert the right side value to be of the required class and size.
For related information, see “Avoiding Class and Size Conversions” on page 26-17.
% Function code
...
end
• A is a string scalar.
• B is a 1-by-any length vector of doubles.
• C is a 2-by-2 cell array.
Value Conversion
The following function illustrates how inputs can be converted to match the classes specified in the
arguments block. The SpeedEnum class is an enumeration class created to define the values allowed
for the third input argument.
function forwardSpeed(a,b,c)
arguments
a double
b char
c SpeedEnum
end
% Function code
disp(class(a))
disp(class(b))
disp(class(c))
end
This call to the function uses input values that MATLAB can convert to the declared types. The actual
argument types within the function are displayed as output.
26-5
26 Function Argument Validation
forwardSpeed(int8(4),"A string",'full')
double
char
SpeedEnum
Validation functions can restrict input arguments in more specific ways. You can use predefined
validation functions for many common kinds of validation, and you can define your own validation
function to satisfy specific requirements.
For example, this function specifies the following validations using mustBeNumeric, mustBeReal,
mustBeMember, and the local function mustBeEqualSize.
Avoid using function argument validation within custom validation functions. For more information
about defining validation functions and a list of predefined validation functions, see “Argument
Validation Functions” on page 26-22.
Kinds of Arguments
Function argument validation can declare four kinds of arguments. Functions can define any of these
kinds of arguments, but the arguments must be defined in the following order:
1 Required positional arguments
2 Optional positional arguments
3 Repeating positional arguments
4 Optional name-value arguments
26-6
Function Argument Validation
Positional arguments in the arguments block are required when calling the function, unless the
argument defines a default value. Specifying a default value in the argument declaration makes a
positional argument optional because MATLAB can use the default value when no value is passed in
the function call.
The default value can be a constant or an expression that produces a result that satisfies the
argument declaration. The expression can refer to the arguments that are declared before it in the
arguments block, but not arguments that are declared after it.
MATLAB evaluates the default value expression only when the argument is not included in the
function call.
All optional arguments must be positioned after all required arguments in the arguments block. For
example, in this argument block, maxval and minval have default values and are therefore optional.
function myFunction(x,y,maxval,minval)
arguments
x (1,:) double
y (1,:) double
maxval (1,1) double = max(max(x),max(y))
minval (1,1) double = min(min(x),min(y))
end
% Function code
....
end
An optional positional argument becomes required when its position must be filled in the function call
to identify arguments that come after it. That is, if you want to specify a value for minval, you must
specify a value for maxval.
MATLAB lets you ignore input arguments by passing a tilde character (~) in place of the argument.
You can define a function that ignores unused positional arguments by adding a tilde character (~) in
the arguments block corresponding to the position of the argument in the function signature. Add a
tilde character (~) for each ignored argument in the function signature.
Ignored arguments cannot have default values or specify class, size, or validation functions.
The tilde character (~) is treated as an optional input argument unless it is followed by a required
positional argument. For example, in this function the tilde character (~) represents an optional
argument.
function c = f(~)
arguments
~
end
% Function code
end
26-7
26 Function Argument Validation
In the following function, the tilde character (~) represents a required argument.
function c = f(~,x)
arguments
~
x
end
% Function code
...
end
For more information on calling functions with ignored inputs, see “Ignore Inputs in Function
Definitions” on page 21-10.
Repeating Arguments
Repeating arguments are positional arguments that can be specified repeatedly as input arguments.
Declare repeating arguments in an arguments block that includes the Repeating attribute.
arguments (Repeating)
arg1
arg2
...
end
Functions can have only one Repeating arguments block, which can contain one or more repeating
arguments.
A function that defines a Repeating arguments block can be called with zero or more occurrences
of all the arguments in the block. If a call to a function includes repeating arguments, then all
arguments in the Repeating arguments block must be included for each repetition.
For example, if a Repeating arguments block defines arguments x and y, then each repetition must
contain both x and y.
Repeating arguments cannot specify default values and therefore cannot be optional. However, you
can call the function without including any repeating arguments.
Functions must declare repeating arguments after positional arguments and before name-value
arguments. You cannot specify name-value arguments within a Repeating block. For information on
name-value arguments, see “Name-Value Arguments” on page 26-10.
In the function, each repeating argument becomes a cell array with the number of elements equal to
the number of repeats passed in the function call. The validation is applied to each element of the cell
26-8
Function Argument Validation
array. If the function is called with zero occurrences of this argument, the cell array has a size of 1-
by-0. That is, it is empty.
For example, this function declares a block of three repeating arguments, x, y, and option.
function [xCell,yCell,optionCell] = fRepeat(x,y,option)
arguments (Repeating)
x double
y double
option {mustBeMember(option,["linear","cubic"])}
end
% Function code
% Return cell arrays
xCell = x;
yCell = y;
optionCell = option;
end
You can call the function with no inputs or multiples of three inputs. MATLAB creates a cell array for
each argument containing all the values passes for that argument. This call to fRepeat passes two
sets of the three repeating arguments.
[xCell,yCell,optionCell] = fRepeat(1,2,"linear",3,4,"cubic")
xCell =
{[1]} {[3]}
yCell =
{[2]} {[4]}
optionCell =
{["linear"]} {["cubic"]}
The following function accepts repeating arguments for x and y inputs in a Repeating arguments
block. In the body of the function, the values specified as repeating arguments are available in the
cell arrays x and y. This example interleaves the values of x and y to match the required input to the
plot function: plot(x1,y1,…).
function myPlotRepeating(x,y)
arguments (Repeating)
x (1,:) double
y (1,:) double
end
% Function code
% Interleave x and y
26-9
26 Function Argument Validation
z = reshape([x;y],1,[]);
x1 = 1:10;
y1 = sin(x1);
x2 = 0:5;
y2 = sin(x2);
myPlotRepeating(x1,y1,x2,y2)
Using varargin with functions that use argument validation is not recommended. If varargin is
restricted in size or class in the repeating arguments block, then the restrictions apply to all values in
varargin.
If you use varargin to support legacy code, it must be the only argument in a Repeating
arguments block.
For example, this function defines two required positional arguments and varargin as the repeating
argument.
% Function code
...
end
Name-Value Arguments
Name-value arguments associate a name with a value that is passed to the function. Name-value
arguments:
26-10
Function Argument Validation
Declare name-value arguments in an arguments block using dot notation to define the fields of a
structure. For example, the structure named NameValueArgs defines two name-value arguments,
Name1 and Name2. You can use any valid MATLAB identifier as the structure name.
arguments
NameValueArgs.Name1
NameValueArgs.Name2
end
Call the function using the field names in the name-value structure.
myFunction(Name1=value1,Name2=value2)
Before R2021a, pass names as strings or character vectors, and separate names and values with
commas. Both syntaxes are valid in later releases.
The name of the structure used in the function signature is the name of the structure in the function
workspace that contains the names and values passed to the function.
function result = myFunction(NameValueArgs)
arguments
NameValueArgs.Name1
NameValueArgs.Name2
end
% Function code
result = NameValueArgs.Name1 * NameValueArgs.Name2;
end
r = myFunction(Name1=3,Name2=7)
r =
21
Name-value arguments support partial name matching when there is no ambiguity. For example, a
function that defines LineWidth and LineStyle as its two name-value arguments accepts LineW
and LineS, but using Line results in an error. In general, using full names is the recommended
practice to improve code readability and avoid unexpected behavior.
You can specify a default value for each name. If you do not specify a default value and the function is
called without that name-value argument, then that field is not present in the name-value structure. If
no name-value arguments are passed to the function, MATLAB creates the structure, but it has no
fields.
To determine what name-value arguments have been passed in the function call, use the isfield
function.
For example, the following function defines two required positional arguments (width and height)
and two name-value arguments (LineStyle and LineWidth). In this example, the options
structure has two fields (LineStyle and LineWidth) containing either the default values or values
specified as name-value arguments when the function is called.
26-11
26 Function Argument Validation
function myRectangle(width,height,options)
arguments
width double
height double
options.LineStyle (1,1) string = "-"
options.LineWidth (1,1) {mustBeNumeric} = 1
end
% Function code
...
end
myRectangle(4,5)
myRectangle(4,5,LineStyle=":",LineWidth=2)
myRectangle(4,5,LineWidth=2,LineStyle=":")
myRectangle(4,5,LineStyle=":")
myRectangle(4,5,LineWidth=2)
Before R2021a, pass names as strings or character vectors, and separate names and values with
commas. For example:
myRectangle(4,5,"LineStyle",":","LineWidth",2)
myRectangle(4,5,"LineWidth",2,"LineStyle",":")
If the function defines repeating arguments, then you must declare the name-value arguments in a
separate arguments block that follows the repeating arguments block. For example, this function
accepts two repeating arguments, x and y. After specifying all repeats of x and y, you can specify a
name-value argument that assigns the value lin or log to the PlotType name.
To determine if the function call includes the PlotType argument, use the isfield function to
check for the PlotType field in the scale structure.
function myLinLog(x,y,scale)
arguments(Repeating)
x (1,:) double
y (1,:) double
end
arguments
scale.PlotType (1,1) string
end
z = reshape([x;y],1,[]);
if isfield(scale,"PlotType")
if scale.PlotType == "lin"
plot(z{:})
elseif scale.PlotType =="log"
loglog(z{:})
end
end
end
26-12
Function Argument Validation
myLinLog(1:5,1:5)
myLinLog(1:5,1:5,1:10,1:100:1000)
myLinLog(1:5,1:5,1:10,1:100:1000,PlotType="log")
Before R2021a, pass names as strings or character vectors, and separate names and values with
commas. For example:
myLinLog(1:5,1:5,1:10,1:100:1000,"PlotType","log")
Function argument blocks can contain multiple name-value structures. However, the field names
must be unique among all structures. This function has two name-value structures: lineOptions
and fillOptions. These structures cannot have the same field names.
function myRectangle(width,height,lineOptions,fillOptions)
arguments
width double
height double
lineOptions.LineStyle (1,1) string = "-"
lineOptions.LineWidth (1,1) {mustBeNumeric} = 1
fillOptions.Color string
fillOptions.Pattern
end
% Function Code
...
end
Defining a name-value argument in an arguments block ensures that the name is a valid identifier. In
turn, this helps ensure that your arguments work with both "name",value and name=value
syntaxes. For example, a name-value argument that uses an invalid identifier can work with the
comma-separated syntax:
myFunction(data,"allow-empty",true)
26-13
26 Function Argument Validation
However, the same call using allow-empty=true throws an error. Defining the name-value
argument in an arguments block ensures that the names you define are valid MATLAB variable names
and compatible with the name=value syntax.
Functions that include both optional text inputs and name-value arguments run the risk of MATLAB
interpreting text inputs as the names of the name-value arguments. This function includes two
optional text inputs and a name-value argument.
function mySignal(tag,unit,opts)
arguments
tag = "0"
unit = "ampere"
opts.Magnifier {mustBeMember{opts.Magnifier,["small","medium","big"]}}
end
end
A user enters this function call intending to set the values of tag to "Mag" and unit to "coulomb":
mySignal("Mag","coulomb")
However, MATLAB, through partial matching, parses "Mag" as the name-value argument Magnifer.
"coulomb" is not a valid value for that name, so the function errors.
One way to avoid this is to make tag a required argument by removing its default value:
function mySignal(tag,unit,opts)
arguments
tag
unit = "ampere"
opts.Magnifier {mustBeMember{opts.Magnifier,["small","medium","big"]}}
end
end
Because MATLAB does not parse required inputs as name-value arguments, the same function call
now sets the value tag to "Mag" and does not error.
Another option is to make all three inputs name-value arguments. This helps users avoid mistakes
when specifying inputs because each value is associated with a name, and the order the user
specifies the inputs does not affect the end results.
structName.?ClassName
A function can use the "structName.? ClassName" syntax only once. Therefore, a function can
define only one name-value structure that gets its field names from a class, even if using different
classes and structure names.
If the class places restrictions on values that you can assign to the property by using property
validation, then the function applies the validation to the individual name-value arguments. For
information on property validation, see “Validate Property Values”.
For example, this function has two required arguments, x and y and accepts any public property
name and value for the matlab.graphics.chart.primitive.Bar class.
26-14
Function Argument Validation
function myBar(x,y,propArgs)
arguments
x (:,:) double
y (:,:) double
propArgs.?matlab.graphics.chart.primitive.Bar
end
propertyCell = namedargs2cell(propArgs);
bar(x,y,propertyCell{:})
end
Call the function with the required inputs and any settable property name-value pairs.
x = [1,2,3;4,5,6];
y = x.^2;
myBar(x,y)
myBar(x,y,FaceColor="magenta",BarLayout="grouped")
Before R2021a, pass names as strings or character vectors, and separate names and values with
commas. For example:
myBar(x,y,"FaceColor","magenta","BarLayout","grouped")
You can override the class property validation by redefining the property name with a specific name-
value argument in the arguments block.
structName.?ClassName
structName.PropertyName (dim1,dim2,...) ClassName {fcn1,fcn2,...}
The specific name-value argument validation overrides the validation defined by class for the
individually specified property name.
For example, the following function defines name-value arguments as the properties of the
matlab.graphics.chart.primitive.Bar class. The function also overrides the property name
FaceColor to allow only these specific values: red or blue.
The matlab.graphics.chart.primitive.Bar class has a default value for FaceColor that is not
one of the restricted values (red or blue). Therefore, the overriding declaration must assign a
default value that satisfies the restriction placed by the mustBeMember validation function. That is,
the default value must be red or blue.
This function converts the name-value structure to a cell array containing interleaved names and
values using the namedargs2cell function.
function myBar(x,y,propArgs)
arguments
x (:,:) double
y (:,:) double
propArgs.?matlab.graphics.chart.primitive.Bar
propArgs.FaceColor {mustBeMember(propArgs.FaceColor,{'red','blue'})} = "blue"
end
propertyCell = namedargs2cell(propArgs);
bar(x,y,propertyCell{:})
end
Call the function using the two required arguments, x and y. Optionally pass any name-value pairs
supported by the bar function and a value for FaceColor that can be either red or blue. Other
values for FaceColor are not allowed.
x = [1,2,3;4,5,6];
y = x.^2;
myBar(x,y)
myBar(x,y,FaceColor="red",BarLayout="grouped")
26-15
26 Function Argument Validation
If a classdef file includes method prototypes for methods defined in separate files, include the
arguments blocks in the separate files defining the method. For more information on defining
methods in separate files, see “Methods in Separate Files”.
Subclass methods do not inherit function argument validation. In subclass methods that override
superclass methods, you can add the same argument validation to the subclass method as is used in
the superclass method.
Handle class destructor methods cannot use argument validation. A method named delete in a
handle subclass that includes an arguments block is not treated as a destructor. (In other words, it is
not called by MATLAB when the object is destroyed). For more information on class destructor
methods, see “Handle Class Destructor”.
Validated values can be different from the original values passed as inputs when the function is
called. For example, this function declares the inputs as class uint32 values. The third input
declaration assigns a default value equal to the product of the first two inputs.
function c = f(a, b,c)
arguments
a uint32
b uint32
c uint32 = a .* b
end
% Function code
...
end
Calling the function with inputs that are a different numeric class (for example, double) results in a
conversion to uint32.
c = f(1.8,1.5)
Because the optional input argument c is not specified in the function call, MATLAB evaluates the
default value and assigns it to c after converting a and b to uint32 values. In this case, the
conversion results in a value of 2 for both inputs. Therefore, the product of a times b is four.
c =
26-16
Function Argument Validation
uint32
If you specify a value for the third input, then the function assigns a value to c and does not evaluate
the default value expression.
c = f(1.8,1.5,25)
c =
uint32
25
When an argument value that is passed to a function does not match the class and size required by
the validation, MATLAB converts the value to the declared class and size when conversion is possible.
However, conversion might not be the desired behavior.
To eliminate the standard conversions performed by MATLAB from input argument validation, use
validation functions instead of class and size restrictions. Calls to validation functions do not return
values and cannot change the value of the input argument.
For example, this function restricts the first input to a two-dimensional array of any size that is of
class double. The second input must be a 5-by-3 array of any class.
function f(a, b)
arguments
a (:,:) double
b (5,3)
end
% Function code
...
end
26-17
26 Function Argument Validation
Because of standard MATLAB type conversion and scalar expansion, you can call this function with
the following inputs and not receive a validation error.
f('character vector',144)
By default, MATLAB converts the elements of the character vector to their equivalent numeric value
and applies scalar expansion to create a 5-by-3 array from the scalar value 144.
Using specialized validation functions can provide more specific input argument validation. For
example, this function defines specialized validation functions that it uses in place of the class and
size specifications for the first and second arguments. These local functions enable you to avoid input
value conversions.
• mustBeOfClass restricts the input to a specific class without allowing conversion or subclasses.
For a related function, see mustBeA.
• mustBeEqualSize restricts two inputs to be of equal size without allowing scalar expansion. For
a related function, see mustBeScalarOrEmpty.
• mustBeDims restricts the input to be of a specified dimension without allowing transposing or
scalar expansion. For a related function, see mustBeVector.
function fCustomValidators(a,b)
arguments
a {mustBeOfClass(a,'double'), mustBeDims(a,2)}
b {mustBeEqualSize(b,a)}
end
% Function code
...
end
function mustBeEqualSize(a,b)
% Test for equal size
if ~isequal(size(a),size(b))
eid = 'Size:notEqual';
msg = 'Inputs must have equal size.';
throwAsCaller(MException(eid,msg))
end
end
function mustBeDims(input,numDims)
% Test for number of dimensions
if ~isequal(length(size(input)),numDims)
eid = 'Size:wrongDimensions';
msg = ['Input must have dimensions: ',num2str(numDims)];
throwAsCaller(MException(eid,msg))
26-18
Function Argument Validation
end
end
The mustBeOfClass function enforces strict class matching by requiring a match with the name of
the class. A more general approach could use the isa function to also match subclasses of the
specified class.
The mustBeEqualSize and mustBeDims functions enforce the strict declarations for the input
arguments.
fCustomValidators('character vector',144)
In this call, the number of dimensions of the first input is wrong, so the validation function returns a
custom error message.
fCustomValidators(ones(2,2,4),144)
The mustBeEqualSize validator function restricts the second input to a specific dimension, which is
provided in the error message.
fCustomValidators(ones(2,2),144)
For related predefined validation functions, see mustBeA, mustBeFloat, and mustBeVector.
Repeating arguments are positional arguments and therefore the number of repeating arguments
passed to the function when called is included in the value returned by nargin.
The value that nargin returns does not include optional arguments that are not included in the
function call. Also, nargin does not count any name-value arguments.
Use nargin to determine if optional positional arguments are passed to the function when called. For
example, this function declares three positional arguments and a name-value argument. Here is how
the function determines what arguments are passed when it is called.
• nargin determines if the optional positional argument c is passed to the function with a switch
block.
• isfield determines if the name-value argument for Format is passed to the function.
26-19
26 Function Argument Validation
end
% Function code
switch nargin
case 2
result = a + b;
case 3
result = a^c + b^c;
end
if isfield(namedargs,"Format")
format(namedargs.Format);
end
end
result = fNargin(3,4)
result =
result = fNargin(3,4,7.62)
result =
4.3021e+04
result = fNargin(3,4,7.62,Format="bank")
result =
43020.56
The only variables visible to validator functions and default value expressions are the input variables
already declared. In this function, the default value of c is derived from a and b.
function c = f(a,b,c)
arguments
a uint32
b uint32
c uint32 = a * b
end
% Function code
...
end
26-20
Function Argument Validation
However, you cannot refer to input variables not yet declared in an arguments block. For example,
using this declaration for argument a in the previous function is not valid because b and c have not
been declared yet.
arguments
a uint32 = b * c
b uint32
c uint32
end
Argument validation expressions can reference only previously declared, and therefore validated,
arguments. Validation functions and default values for name-value arguments cannot access other
name-value arguments.
Any references to previously declared arguments must be visible in the text of validation functions
and default values. To ensure code transparency, do not use functions that interact with the function
workspace. Specifically, do not use nested functions or any of the functions listed in the following
table in the arguments block.
These restrictions apply only within the arguments block and do not apply to variables or functions
in the body of the function.
See Also
namedargs2cell | arguments
Related Examples
• “Argument Definitions”
• “Argument Validation Functions” on page 26-22
• “Validate Property Values”
26-21
26 Function Argument Validation
26-22
Argument Validation Functions
Data Types
Name Meaning Functions Called
on Inputs
mustBeA(value,classnam value must be of Uses class
es) specific class. definition
relationships
mustBeNumeric(value) value must be isnumeric
numeric.
mustBeNumericOrLogical value must be isnumeric,
(value) numeric or logical. islogical
mustBeFloat(value) value must be isfloat
floating-point array.
mustBeUnderlyingType(v value must have isUnderlyingTyp
alue,typename) specified underlying e
type.
Size
Name Meaning Functions Called
on Inputs
mustBeNonempty(value) value is not empty. isempty
mustBeScalarOrEmpty(va value must be a isscalar,
lue) scalar or be empty. isempty
mustBeVector(value) value must be a isvector
vector.
26-23
26 Function Argument Validation
Text
Name Meaning Functions Called
on Inputs
mustBeFile(path) path must refer to a isfile
file.
mustBeFolder(folder) path must refer to a isfolder
folder.
mustBeNonzeroLengthTex value must be a piece Not applicable
t(value) of text with nonzero
length.
mustBeText(value) value must be a Not applicable
string array, character
vector, or cell array of
character vectors.
mustBeTextScalar(value value must be a Not applicable
) single piece of text.
mustBeValidVariableNam varname must be a isvarname
e(varname) valid variable name.
• Validation functions do not return outputs or modify program state. The only purpose is to check
the validity of the input value.
• Validation functions must accept the value being validated as an input argument. If the function
accepts more than one input argument, the first input is the value to be validated.
• Validation functions rely only on the inputs. No other values are available to the function.
• Validation functions throw an error if the validation fails. Using throwAsCaller to throw
exceptions avoids showing the validation function itself in the displayed error message.
Creating your own validation function is useful when you want to provide specific validation that is
not available using the MATLAB validation functions. You can create a validation function as a local
26-24
Argument Validation Functions
function within the function file or place it on the MATLAB path. To avoid a confluence of error
messages, do not use function argument validation within user-defined validation functions.
For example, the mustBeRealUpperTriangular function restricts the input to real-valued, upper
triangular matrices. The validation function uses the istriu and isreal functions.
function mustBeRealUpperTriangular(a)
if ~(istriu(a) && isreal(a))
eidType = 'mustBeRealUpperTriangular:notRealUpperTriangular';
msgType = 'Input must be a real-valued, upper triangular matrix.';
throwAsCaller(MException(eidType,msgType))
end
end
If the input argument is not of the correct type, the function throws an error.
a = [1 2 3+2i; 0 2 3; 0 0 1];
mustBeRealUpperTriangular(a)
Input must be a real-valued, upper triangular matrix.
See Also
More About
• “Function Argument Validation” on page 26-2
26-25
26 Function Argument Validation
Function input arguments are variables in the function workspace whose values come from the
calling code or command-line users. When a function is widely used by others, it should determine if
the input values match the values expected by the code in the function.
Argument checking allows the function to provide more useful information when input values are
unexpected and the function is unable to perform as intended. MATLAB provides several ways to
simplify the process of checking and processing function inputs.
An effective way to implement these common patterns is to declare the arguments using a function
arguments block, as described in “Function Argument Validation” on page 26-2. This syntax is new
for release R2019b and does not work in earlier releases.
Function argument validation is a way to declare specific restrictions on function input arguments. It
enables you to constrain the class, size, and other aspects of function input values without writing
code in the body of the function to perform these tests.
validateattributes
The validateattributes function enables you to verify that the inputs to a function conform to a
set of requirements. Call validateattributes for each input argument with parameters specifying
argument requirements.
inputParser
For complex function signatures, use an inputParser object to express input argument
requirements programmatically. An inputParser object parses and validates a set of inputs.
See Also
validateattributes | inputParser | arguments
More About
• “Function Argument Validation” on page 26-2
• “Check Function Inputs with validateattributes” on page 21-11
• “Parse Function Inputs” on page 21-13
26-26
Transparency in MATLAB Code
• Function argument validation blocks. For more information, see “Restrictions on Variable and
Function Access” on page 26-20
• The body of a parfor loop or spmd block. For more information, see “Ensure Transparency in
parfor-Loops or spmd Statements” (Parallel Computing Toolbox).
However, in the following call to the eval function, MATLAB cannot recognize the variables in the
statement that is passed to eval because the input is a character string.
X = zeros(1,10);
for ii = 1:10
eval('X(ii) = randi(9,1);')
end
Before executing this code, MATLAB sees a call to the eval function with one argument, which is the
character vector 'X(ii) = randi(9,1);'.
To be transparent, code must refer to variable names explicitly so that MATLAB can identify the
variables by inspection or static analysis. Using the eval function with the character vector 'X(ii)
= randi(9,1);' means that MATLAB must execute the code to identify X and ii as variables.
Here is a partial list of functions and coding that you cannot use with transparent variable access:
Passing a variable to a function using the command form is not transparent because it is equivalent to
passing the argument as a character string. For example, these calls to the clear function are both
nontransparent.
26-27
26 Function Argument Validation
clear X
clear('X')
If code creates workspace variables, but MATLAB can identify these new variables only after
executing the code, then this code does not have transparent variable access. For example, MATLAB
cannot determine what variables are loaded from a MAT file, so this statement is nontransparent.
load foo.mat
However, code that explicitly assigns the loaded variable to a name is transparent because MATLAB
can recognize that the name on the left-hand side refers to a workspace variable. For example, this
statement loads the variable X from the MAT file into the workspace in a variable named X.
X = load('foo.mat','X');
Access to variables must be transparent within the workspace. For example, code cannot use the
evalin or assignin functions in a workspace that requires transparency to create variables in
another workspace.
See Also
More About
• “Function Argument Validation” on page 26-2
• “Scope Variables and Generate Names”
26-28
Software Development
29
27
Error Handling
Overview
No matter how carefully you plan and test the programs you write, they may not always run as
smoothly as expected when executed under different conditions. It is always a good idea to include
error checking in programs to ensure reliable operation under all conditions.
In the MATLAB software, you can decide how your programs respond to different types of errors. You
may want to prompt the user for more input, display extended error or warning information, or
perhaps repeat a calculation using default values. The error-handling capabilities in MATLAB help
your programs check for particular error conditions and execute the appropriate code depending on
the situation.
When MATLAB detects a severe fault in the command or program it is running, it collects information
about what was happening at the time of the error, displays a message to help the user understand
what went wrong, and terminates the command or program. This is called throwing an exception. You
can get an exception while entering commands at the MATLAB command prompt or while executing
your program code.
Evaluate the error message MATLAB has displayed. Most error messages attempt to explain at least
the immediate cause of the program failure. There is often sufficient information to determine the
cause and what you need to do to remedy the situation.
If the function in which the error occurred is implemented as a MATLAB program file, the error
message should include a line that looks something like this:
surf
The text includes the name of the function that threw the error (surf, in this case) and shows the
failing line number within that function's program file. Click the line number; MATLAB opens the file
and positions the cursor at the location in the file where the error originated. You may be able to
determine the cause of the error by examining this line and the code that precedes it.
27-2
Exception Handling in a MATLAB Application
You can use the MATLAB Debugger to step through the failing code. Click the underlined error text to
open the file in the MATLAB Editor at or near the point of the error. Next, click the hyphen at the
beginning of that line to set a breakpoint at that location. When you rerun your program, MATLAB
pauses execution at the breakpoint and enables you to step through the program code. The command
dbstop on error is also helpful in finding the point of error.
See the documentation on “Debug MATLAB Code Files” on page 22-2 for more information.
Some of the things you might want to do in the catch block are:
When you reach the end of the catch block, you can either continue executing the program, if
possible, or terminate it.
Use an MException object to access information about the exception in your program. For more
information, see “Respond to an Exception” on page 27-6.
• Saves information about what went wrong and what code was executing at the time of the error.
• Gathers any other pertinent information about the error.
• Instructs MATLAB to throw the exception.
Use an MException object to capture information about the error. For more information, see “Throw
an Exception” on page 27-4.
27-3
27 Error Handling
Throw an Exception
When your program detects a fault that will keep it from completing as expected or will generate
erroneous results, you should halt further execution and report the error by throwing an exception.
The basic steps to take are:
1 Detect the error. This is often done with some type of conditional statement, such as an if or
try/catch statement that checks the output of the current operation.
2 Construct an MException object to represent the error. Add an error identifier and error
message to the object when calling the constructor.
3 If there are other exceptions that may have contributed to the current error, you can store the
MException object for each in the cause field of a single MException that you intend to throw.
Use the addCause function for this.
4 If there is fix that can be suggested for the current error, you can add it to the Correction field
of the MException that you intend to throw. Use the addCorrection function for this.
5 Use the throw or throwAsCaller function to have MATLAB issue the exception. At this point,
MATLAB stores call stack information in the stack field of the MException, exits the currently
running function, and returns control to either the keyboard or an enclosing catch block in a
calling function.
Create a function, indexIntoArray, that indexes into a specified array using a specified index. The
function catches any errors that MATLAB throws and creates an exception that provides general
information about the error. When it catches an error, it detects whether the error involves the
number of inputs or the specified index. If it does, the function adds additional exceptions with more
detailed information about the source of the failure, and suggests corrections when possible.
function indexIntoArray(A,idx)
throw(baseException);
end
try
assert(isnumeric(idx),'MYFUN:notNumeric', ...
'Indexing array is not numeric.')
catch causeException
baseException = addCause(baseException,causeException);
end
27-4
Throw an Exception
If you call the function without specifying an index, the function throws a detailed error and suggests
a correction:
Caused by:
Not enough input arguments.
If you call the function with a nonnumeric index array that is too large, the function throws a detailed
error.
Caused by:
Error using indexIntoArray (line 25)
Indexing array is not numeric.
Indexing array is too large.
27-5
27 Error Handling
Respond to an Exception
In this section...
“Overview” on page 27-6
“The try/catch Statement” on page 27-6
“Suggestions on How to Handle an Exception” on page 27-7
Overview
The MATLAB software, by default, terminates the currently running program when an exception is
thrown. If you catch the exception in your program, however, you can capture information about what
went wrong and deal with the situation in a way that is appropriate for the particular condition. This
requires a try/catch statement.
A try/catch statement looks something like the following pseudocode. It consists of two parts:
• A try block that includes all lines between the try and catch statements.
• A catch block that includes all lines of code between the catch and end statements.
try
Perform one ...
or more operations
A catch ME
Examine error info in exception object ME
Attempt to figure out what went wrong
Either attempt to recover, or clean up and abort
end
B Program continues
The program executes the statements in the try block. If it encounters an error, it skips any
remaining statements in the try block and jumps to the start of the catch block (shown here as
point A). If all operations in the try block succeed, then execution skips the catch block entirely and
goes to the first line following the end statement (point B).
Specifying the try, catch, and end commands and also the code of the try and catch blocks on
separate lines is recommended. If you combine any of these components on the same line, separate
them with commas:
Note You cannot define nested functions within a try or catch block.
27-6
Respond to an Exception
On execution, your code enters the try block and executes each statement as if it were part of the
regular program. If no errors are encountered, MATLAB skips the catch block entirely and continues
execution following the end statement. If any of the try statements fail, MATLAB immediately exits
the try block, leaving any remaining statements in that block unexecuted, and enters the catch
block.
The catch command marks the start of a catch block and provides access to a data structure that
contains information about what caused the exception. This is shown as the variable ME in the
preceding pseudocode. ME is an MException object. When an exception occurs, MATLAB creates an
MException object and returns it in the catch statement that handles that error.
You are not required to specify any argument with the catch statement. If you do not need any of the
information or methods provided by the MException object, just specify the catch keyword alone.
The MException object is constructed by internal code in the program that fails. The object has
properties that contain information about the error that can be useful in determining what happened
and how to proceed. The MException object also provides access to methods that enable you to
respond to the exception.
Having entered the catch block, MATLAB executes the statements in sequence. These statements
can attempt to
The catch block often ends with a rethrow command. The rethrow causes MATLAB to exit the
current function, keeping the call stack information as it was when the exception was first thrown. If
this function is at the highest level, that is, it was not called by another function, the program
terminates. If the failing function was called by another function, it returns to that function. Program
execution continues to return to higher level functions, unless any of these calls were made within a
higher-level try block, in which case the program executes the respective catch block.
• The first if statement checks whether the function is called with an input argument. If no input
argument is specified, the program throws an error and suggests an input argument to correct the
error.
• The try block attempts to open and read the file. If either the open or the read fails, the program
catches the resulting exception and saves the MException object in the variable ME1.
• The catch block checks to see if the specified file could not be found. If so, the program allows for
the possibility that a common variation of the filename extension (e.g., jpeg instead of jpg) was
27-7
27 Error Handling
used, by retrying the operation with a modified extension. This is done using a try/catch
statement nested within the original try/catch.
function d_in = read_image(filename)
% Did the read fail because the file could not be found?
if strcmp(idSegLast,'InvalidFid') && ...
~exist(filename,'file')
This example illustrates some of the actions that you can take in response to an exception.
• Compare the identifier field of the MException object to possible causes of the error. In this
case, the function checks whether the identifier ends in 'InvalidFid', indicating a file could not
be found.
• Use a nested try/catch statement to retry the operation with improved input. In this case, the
function retries the open and read operations using a known variation of the filename extension.
• Display an appropriate message.
• Add the first MException object to the cause field of the second.
• Add a suggested correction to an MException object.
• Rethrow the exception. This stops program execution and displays the error message.
Cleaning up any unwanted results of the error is also advisable. For example, close figures that
remained open after the error occurred.
27-8
Clean Up When Functions Complete
Overview
A good programming practice is to make sure that you leave your program environment in a clean
state that does not interfere with any other program code. For example, you might want to
MATLAB provides the onCleanup function for this purpose. This function, when used within any
program, establishes a cleanup routine for that function. When the function terminates, whether
normally or in the event of an error or Ctrl+C, MATLAB automatically executes the cleanup routine.
The following statement establishes a cleanup routine cleanupFun for the currently running
program:
cleanupObj = onCleanup(@cleanupFun);
When your program exits, MATLAB finds any instances of the onCleanup class and executes the
associated function handles. The process of generating and activating function cleanup involves the
following steps:
1 Write one or more cleanup routines for the program under development. Assume for now that it
takes only one such routine.
2 Create a function handle for the cleanup routine.
3 At some point, generally early in your program code, insert a call to the onCleanup function,
passing the function handle.
4 When the program is run, the call to onCleanup constructs a cleanup object that contains a
handle to the cleanup routine created in step 1.
5 When the program ends, MATLAB implicitly clears all objects that are local variables. This
invokes the destructor method for each local object in your program, including the cleanup
object constructed in step 4.
6 The destructor method for this object invokes this routine if it exists. This perform the tasks
needed to restore your programming environment.
You can declare any number of cleanup routines for a program file. Each call to onCleanup
establishes a separate cleanup routine for each cleanup object returned.
27-9
27 Error Handling
If, for some reason, the object returned by onCleanup persists beyond the life of your program, then
the cleanup routine associated with that object is not run when your function terminates. Instead, it
will run whenever the object is destroyed (e.g., by clearing the object variable).
Your cleanup routine should never rely on variables that are defined outside of that routine. For
example, the nested function shown here on the left executes with no error, whereas the very similar
one on the right fails with the error, Undefined function or variable 'k'. This results from
the cleanup routine's reliance on variable k which is defined outside of the nested cleanup routine:
function testCleanup function testCleanup
k = 3; k = 3;
myFun obj = onCleanup(@myFun);
function myFun function myFun
fprintf('k is %d\n', k) fprintf('k is %d\n', k)
end end
end end
MATLAB closes the file with identifier fid when function openFileSafely terminates:
function openFileSafely(fileName)
fid = fopen(fileName, 'r');
c = onCleanup(@()fclose(fid));
s = fread(fid);
.
.
.
end
This example preserves the current folder whether functionThatMayError returns an error or not:
function changeFolderSafely(fileName)
currentFolder = pwd;
c = onCleanup(@()cd(currentFolder));
functionThatMayError;
end % c executes cd(currentFolder) here.
This example extends the MATLAB path to include files in the toolbox\images folders, and then
displays a figure from one of these folders. After the figure displays, the cleanup routine
restore_env closes the figure and restores the path to its original state.
function showImageOutsidePath(imageFile)
fig1 = figure;
imgpath = genpath([matlabroot '\toolbox\images']);
27-10
Clean Up When Functions Complete
Run the function as shown here. You can verify that the path has been restored by comparing the
length of the path before and after running the function:
origLen = length(path);
showImageOutsidePath('greens.jpg')
Opening the figure greens.jpg
Closing the figure
Restoring the path
currLen = length(path);
currLen == origLen
ans =
1
The details of that handle are then contained within the object returned by the onCleanup function:
cleanupObj = onCleanup(@()restore_env(fig1, imgpath));
You can access these details using the task property of the cleanup object as shown here. (Modify
the showImageOutsidePath function by adding the following code just before the comment line
that says, “% This is the cleanup routine.”)
disp ' Displaying information from the function handle:'
task = cleanupObj.task;
fun = functions(task)
wsp = fun.workspace{2,1}
fprintf('\n');
pause(2);
Run the modified function to see the output of the functions command and the contents of one of
the workspace cells:
27-11
27 Error Handling
showImageOutsidePath('greens.jpg')
The following program cleans up if an error occurs, but not in response to Ctrl+C:
function cleanupByCatch
try
pause(10);
catch
disp(' Collecting information about the error')
disp(' Executing cleanup tasks')
end
Unlike the try/catch statement, the onCleanup function responds not only to a normal exit from
your program and any error that might be thrown, but also to Ctrl+C. This next example replaces the
try/catch with onCleanup:
function cleanupByFunc
obj = onCleanup(@()...
disp(' Executing cleanup tasks'));
pause(10);
onCleanup in Scripts
onCleanup does not work in scripts as it does in functions. In functions, the cleanup object is stored
in the function workspace. When the function exits, this workspace is cleared thus executing the
associated cleanup routine. In scripts, the cleanup object is stored in the base workspace (that is, the
workspace used in interactive work done at the command prompt). Because exiting a script has no
effect on the base workspace, the cleanup object is not cleared and the routine associated with that
object does not execute. To use this type of cleanup mechanism in a script, you would have to
explicitly clear the object from the command line or another script when the first script terminates.
27-12
Issue Warnings and Errors
Issue Warnings
You can issue a warning to flag unexpected conditions detected when running a program. The
warning function prints a warning message to the command line. Warnings differ from errors in two
significant ways:
Use the warning function in your code to generate a warning message during execution. Specify the
message as the input argument to the warning function:
For example, you can insert a warning in your code to verify the software version:
function warningExample1
if ~strncmp(version, '7', 1)
warning('You are using a version other than v7')
end
Throw Errors
You can throw an error to flag fatal problems within the program. Use the error function to print
error messages to the command line. After displaying the message, MATLAB stops the execution of
the current program.
For example, suppose you construct a function that returns the number of combinations of k elements
from n elements. Such a function is nonsensical if k > n; you cannot choose 8 elements if you start
with just 4. You must incorporate this fact into the function to let anyone using combinations know
of the problem:
If the combinations function receives invalid input, MATLAB stops execution immediately after
throwing the error message:
combinations(4,8)
27-13
27 Error Handling
For example, this warning uses %s and %d to mark where to insert the values of variables arrayname
and arraydims:
If you execute this command with arrayname = 'A' and arraydims = 3, MATLAB responds:
Adding run-time parameters to your warnings and errors can clarify the problems within a program.
Consider the function combinations from “Throw Errors” on page 27-13. You can throw a much
more informative error using run-time parameters:
If this function receives invalid arguments, MATLAB throws an error message and stops the program:
combinations(6,9)
Enable or disable warnings with identifiers. Use an identifying text argument with the warning
function to attach a unique tag to a message:
warning(identifier_text,message_text)
For example, you can add an identifier tag to the previous MATLAB warning about which version of
software is running:
minver = '7';
if ~strncmp(version,minver,1)
warning('MYTEST:VERCHK','Running a version other than v%s',minver)
end
Adding an identifier to an error message allows for negative testing. However, adding and recovering
more information from errors often requires working with MException objects.
27-14
Issue Warnings and Errors
See Also
warning | lastwarn | warndlg | MException
Related Examples
• “Suppress Warnings” on page 27-16
• “Restore Warnings” on page 27-18
• “Exception Handling in a MATLAB Application” on page 27-2
27-15
27 Error Handling
Suppress Warnings
Your program might issue warnings that do not always adversely affect execution. To avoid confusion,
you can hide warning messages during execution by changing their states from 'on' to 'off'.
To suppress specific warning messages, you must first find the warning identifier. Each warning
message has a unique identifier. To find the identifier associated with a MATLAB warning, reproduce
the warning. For example, this code reproduces a warning thrown if MATLAB attempts to remove a
nonexistent folder:
rmpath('folderthatisnotonpath')
Note If this statement does not produce a warning message, use the following code to temporarily
enable the display of all warnings, and then restore the original warning state:
w = warning ('on','all');
rmpath('folderthatisnotonpath')
warning(w)
To obtain information about the most recently issued warning, use the warning or lastwarn
functions. This code uses the query state to return a data structure containing the identifier and the
current state of the last warning:
w = warning('query','last')
w =
identifier: 'MATLAB:rmpath:DirNotFound'
state: 'on'
Note warning('query','last') returns the last displayed warning. MATLAB only displays
warning messages that have state: 'on' and a warning identifier.
Using the lastwarn function, you can retrieve the last warning message, regardless of its display
state:
lastwarn
ans =
27-16
Suppress Warnings
Continuing the example from the previous section, turn the warning
'MATLAB:rmpath:DirNotFound' off, and repeat the operation.
warning('off',id)
rmpath('folderthatisnotonpath')
warning('on',id)
rmpath('folderthatisnotonpath')
Tip Turn off the most recently invoked warning with warning('off','last').
The term all refers only to those warnings that have been issued or modified during your current
MATLAB session. Modified warning states persist only through the current session. Starting a new
session restores the default settings.
Use the identifier 'all' to represent the group of all warnings. View the state of all warnings with
either syntax:
warning('query','all')
warning
warning('on','all')
warning('query','all')
To disable all warnings and verify the state, use this syntax:
warning('off','all')
warning
See Also
Related Examples
• “Restore Warnings” on page 27-18
• “Change How Warnings Display” on page 27-20
27-17
27 Error Handling
Restore Warnings
MATLAB allows you to save the on-off warning states, modify warning states, and restore the
original warning states. This is useful if you need to temporarily turn off some warnings and later
reinstate the original settings.
The following statement saves the current state of all warnings in the structure array called
orig_state:
orig_state = warning;
To restore the original state after any warning modifications, use this syntax:
warning(orig_state);
You also can save the current state and toggle warnings in a single command. For example, the
statement, orig_state = warning('off','all'); is equivalent to the commands:
orig_state = warning;
warning('off','all')
orig_state =
identifier: 'Control:parameterNotSymmetric'
state: 'on'
The default warning state is 'on'. Warnings not set to the default are
off Control:parameterNotSymmetric
27-18
Restore Warnings
w(1) = warning('off','MATLAB:rmpath:DirNotFound');
w(2) = warning('off','MATLAB:singularMatrix');
w(3) = warning('off','Control:parameterNotSymmetric');
warning
The default warning state is 'on'. Warnings not set to the default are
off Control:parameterNotSymmetric
off MATLAB:rmpath:DirNotFound
off MATLAB:singularMatrix
2 Restore the three warnings to their the original state, and query all warnings:
warning(w)
warning
You do not need to store information about the previous warning states in an array, but doing so
allows you to restore warnings with one command.
Note When temporarily disabling multiple warnings, using methods related to onCleanup might be
advantageous.
orig_state = warning('on','all');
2 Restore your warnings to the previous state:
warning(orig_state)
See Also
warning | onCleanup
Related Examples
• “Suppress Warnings” on page 27-16
• “Clean Up When Functions Complete” on page 27-9
27-19
27 Error Handling
• prev_state does not contain information about the backtrace or verbose modes in the
statement, prev_state = warning('query','all').
• A mode change affects all enabled warnings.
For example, you can turn on all warnings, disable backtrace, and enable verbose warnings:
warning on all
warning off backtrace
warning on verbose
rmpath('folderthatisnotonpath')
warning on backtrace
warning off verbose
Running a command that produces an error displays a hyperlink with a line number:
27-20
Use try/catch to Handle Errors
If an error occurs within the try block, MATLAB skips any remaining commands in the try block
and executes the commands in the catch block. If no error occurs within try block, MATLAB
skips the entire catch block.
For example, a try/catch statement can prevent the need to throw errors. Consider the
combinations function that returns the number of combinations of k elements from n elements:
function com = combinations(n,k)
com = factorial(n)/(factorial(k)*factorial(n-k));
end
MATLAB throws an error whenever k > n. You cannot construct a set with more elements, k, than
elements you possess, n. Using a try/catch statement, you can avoid the error and execute this
function regardless of the order of inputs:
function com = robust_combine(n,k)
try
com = factorial(n)/(factorial(k)*factorial(n-k));
catch
com = factorial(k)/(factorial(n)*factorial(k-n));
end
end
C1 =
70
C2 =
70
Optionally, you can capture more information about errors if a variable follows your catch statement:
catch MExc
27-21
27 Error Handling
MExc is an MException class object that contains more information about the thrown error. To learn
more about accessing information from MException objects, see “Exception Handling in a MATLAB
Application” on page 27-2.
See Also
MException | onCleanup | try, catch
27-22
28
Program Scheduling
In this section...
“Overview” on page 28-2
“Example: Displaying a Message” on page 28-2
Overview
The MATLAB software includes a timer object that you can use to schedule the execution of MATLAB
commands. This section describes how you can create timer objects, start a timer running, and
specify the processing that you want performed when a timer fires. A timer is said to fire when the
amount of time specified by the timer object elapses and the timer object executes the commands you
specify.
You use timer object properties to specify this information. To learn about all the properties
supported by the timer object, see timer. You can also set timer object properties when you
create them, in step 1.
3 Start the timer object.
After you create the timer object, you must start it, using either the start or startat function.
4 Delete the timer object when you are done with it.
After you are finished using a timer object, you should delete it from memory. See delete for
more information.
Note The specified execution time and the actual execution of a timer can vary because timer objects
work in the MATLAB single-threaded execution environment. The length of this time lag is dependent
on what other processing MATLAB is performing. To force the execution of the callback functions in
the event queue, include a call to the drawnow function in your code. The drawnow function flushes
the event queue.
28-2
Schedule Command Execution Using Timer
After creating the timer object, the example uses the start function to start the timer object. (The
additional commands in this example are included to illustrate the timer but are not required for
timer operation.)
stat=true;
while(stat==true)
disp('.')
pause(1)
end
.
.
.
.
.
.
.
.
.
Timer!
See Also
timer
More About
• “Timer Callback Functions” on page 28-4
• “Handling Timer Queuing Conflicts” on page 28-8
28-3
28 Program Scheduling
In this section...
“Associating Commands with Timer Object Events” on page 28-4
“Creating Callback Functions” on page 28-5
“Specifying the Value of Callback Function Properties” on page 28-6
Note Callback function execution might be delayed if the callback involves a CPU-intensive task such
as updating a figure.
The following diagram shows when the events occur during execution of a timer object and give the
names of the timer object properties associated with each event. For example, to associate MATLAB
commands with a start event, assign a value to the StartFcn callback property. Error callbacks can
occur at any time.
28-4
Timer Callback Functions
This example creates a timer object that displays a greeting after 5 seconds. The example specifies
the value of the TimerFcn callback property directly, putting the commands in a character vector.
t = timer('TimerFcn',@(x,y)disp('Hello World!'),'StartDelay',5);
Note When you specify the callback commands directly as the value of the callback function
property, the commands are evaluated in the MATLAB workspace.
Instead of specifying MATLAB commands directly as the value of a callback property, you can put the
commands in a MATLAB program file and specify the file as the value of the callback property.
When you create a callback function, the first two arguments must be a handle to the timer object
and an event structure. An event structure contains two fields: Type and Data. The Type field
contains a character vector that identifies the type of event that caused the callback. The value of this
field can be any of the following: 'StartFcn', 'StopFcn', 'TimerFcn', or 'ErrorFcn'. The Data
field contains the time the event occurred.
In addition to these two required input arguments, your callback function can accept application-
specific arguments. To receive these input arguments, you must use a cell array when specifying the
name of the function as the value of a callback property. For more information, see “Specifying the
Value of Callback Function Properties” on page 28-6.
This example implements a simple callback function that displays the type of event that triggered the
callback and the time the callback occurred. To illustrate passing application-specific arguments, the
example callback function accepts as an additional argument a character vector and includes this text
in the display output. To see this function used with a callback property, see “Specifying the Value of
Callback Function Properties” on page 28-6.
event_type = event.Type;
event_time = datestr(event.Data.time);
28-5
28 Program Scheduling
The following table shows the syntax for several sample callback functions and describes how you call
them.
This example illustrates several ways you can specify the value of timer object callback function
properties, some with arguments and some without. To see the code of the callback function,
my_callback_fcn, see “Example: Writing a Callback Function” on page 28-5:
start(t)
delete(t)
See Also
timer
28-6
Timer Callback Functions
More About
• “Handling Timer Queuing Conflicts” on page 28-8
28-7
28 Program Scheduling
You can determine how the timer object handles this scenario by setting the BusyMode property to
use one of these modes:
For example, suppose you create a timer with a period of 1 second, but a callback that requires at
least 1.6 seconds, as shown here for mytimer.m.
function mytimer()
t = timer;
t.Period = 1;
t.ExecutionMode = 'fixedRate';
t.TimerFcn = @mytimer_cb;
t.BusyMode = 'drop';
t.TasksToExecute = 5;
t.UserData = tic;
start(t)
end
function mytimer_cb(h,~)
timeStart = toc(h.UserData)
pause(1.6);
timeEnd = toc(h.UserData)
end
This table describes how the timer manages the execution queue.
28-8
Handling Timer Queuing Conflicts
Error Mode
The 'error' mode for the BusyMode property is similar to the 'drop' mode: In both modes, the
timer allows only one instance of the callback in the execution queue. In 'error' mode, when the
queue is nonempty, the timer calls the function that you specify by using the ErrorFcn property, and
then stops processing. The currently running callback function completes, but the callback in the
queue does not execute.
For example, modify mytimer.m (described in the previous section) so that it includes an error
handling function and sets BusyMode to 'error'.
function mytimer()
t = timer;
t.Period = 1;
t.ExecutionMode = 'fixedRate';
t.TimerFcn = @mytimer_cb;
t.ErrorFcn = @myerror;
t.BusyMode = 'error';
t.TasksToExecute = 5;
t.UserData = tic;
start(t)
28-9
28 Program Scheduling
end
function mytimer_cb(h,~)
timeStart = toc(h.UserData)
pause(1.6);
timeEnd = toc(h.UserData)
end
function myerror(h,~)
disp('Reached the error function')
end
This table describes how the timer manages the execution queue.
Queue Mode
If you specify 'queue', the timer object waits until the currently executing callback function finishes
before queuing the next execution of the timer callback function.
In 'queue' mode, the timer object tries to make the average time between executions equal the
amount of time specified in the Period property. If the timer object has to wait longer than the time
specified in the Period property between executions of the timer function callback, it shortens the
time period for subsequent executions to make up the time.
For example, modify mytimer.m (described in the previous section) so that BusyMode is set to
'queue'.
function mytimer()
t = timer;
t.Period = 1;
t.ExecutionMode = 'fixedRate';
t.TimerFcn = @mytimer_cb;
t.ErrorFcn = @myerror;
t.BusyMode = 'queue';
t.TasksToExecute = 5;
t.UserData = tic;
start(t)
28-10
Handling Timer Queuing Conflicts
end
function mytimer_cb(h,~)
timeStart = toc(h.UserData)
pause(1.6);
timeEnd = toc(h.UserData)
end
function myerror(h,~)
disp('Reached the error function')
end
This table describes how the timer manages the execution queue.
28-11
28 Program Scheduling
See Also
timer
More About
• “Timer Callback Functions” on page 28-4
28-12
29
Performance
For additional details about the performance of your code, such as function call information and
execution time of individual lines of code, use the MATLAB Profiler. For more information, see “Profile
Your Code to Improve Performance” on page 29-4.
Time Functions
To measure the time required to run a function, use the timeit function. The timeit function calls
the specified function multiple times, and returns the median of the measurements. It takes a handle
to the function to be measured and returns the typical execution time, in seconds. Suppose that you
have defined a function, computeFunction, that takes two inputs, x and y, that are defined in your
workspace. You can compute the time to execute the function using timeit.
tic
% The program section to time.
toc
Sometimes programs run too fast for tic and toc to provide useful data. If your code is faster than
1/10 second, consider measuring it running in a loop, and then average to find the time for a single
run.
29-2
Measure the Performance of Your Code
The cputime function measures the total CPU time and sums across all threads. This measurement is
different from the wall-clock time that timeit or tic/toc return, and could be misleading. For
example:
• The CPU time for the pause function is typically small, but the wall-clock time accounts for the
actual time that MATLAB execution is paused. Therefore, the wall-clock time might be longer.
• If your function uses four processing cores equally, the CPU time could be approximately four
times higher than the wall-clock time.
• Time a significant enough portion of code. Ideally, the code you are timing should take more than
1/10 second to run.
• Put the code you are trying to time into a function instead of timing it at the command line or
inside a script.
• Unless you are trying to measure first-time cost, run your code multiple times. Use the timeit
function.
• Avoid clear all when measuring performance. For more information, see the clear function.
• Assign your output to a variable instead of letting it default to ans.
See Also
timeit | tic | toc | profile
Related Examples
• “Profile Your Code to Improve Performance” on page 29-4
• “Techniques to Improve Performance” on page 29-14
• MATLAB Performance Measurement White Paper on MATLAB Central File Exchange
29-3
29 Performance
What Is Profiling?
Profiling is a way to measure the time it takes to run your code and identify where MATLAB spends
the most time. After you identify which functions are consuming the most time, you can evaluate
them for possible performance improvements. You also can profile your code to determine which lines
of code do not run. Determining which lines of code do not run is useful when developing tests for
your code, or as a debugging tool to help isolate a problem in your code.
You can profile your code interactively using the MATLAB Profiler or programmatically using the
profile function. For more information about profiling your code programmatically, see profile. If
you are profiling code that runs in parallel, for best results use the Parallel Computing Toolbox
parallel profiler. For details, see “Profiling Parallel Code” (Parallel Computing Toolbox).
Tip Code that is prematurely optimized can be unnecessarily complex without providing a significant
gain in performance. Make your first implementation as simple as possible. Then, if speed is an issue,
use profiling to identify bottlenecks.
For example, you may want to investigate functions and lines of code that use a significant
amount of time or that are called most frequently.
4 Save the profiling results.
5 Implement potential performance improvements in your code.
For example, if you have a load statement within a loop, you might be able to move the load
statement outside the loop so that it is called only once.
6 Save the files, and run clear all. Run the Profiler again and compare the results to the original
results.
7 Repeat the above steps to continue improving the performance of your code. When your code
spends most of its time on calls to a few built-in functions, you have probably optimized the code
as much as possible.
1
On the Home tab, in the Code section, click Run and Time to open the Profiler. You also
can type profile viewer in the Command Window.
2 Go to the Profiler tab, and in the Profile section, enter the code that you want to profile in the
edit box.
29-4
Profile Your Code to Improve Performance
For example, create a function solvelotka.m that finds the prey and predator population peaks
for the Lotka-Volterra example provided with MATLAB:
preypeaks = calculatepeaks(y(:,1));
predatorpeaks = calculatepeaks(y(:,2));
end
Enter this statement in the edit box to profile the solvelotka function:
[preypeaks,predatorpeaks] = solvelotka(0,15,[20;20])
If you previously profiled the statement in the current MATLAB session, you also can select it
from the edit box drop down list.
3
Click Run and Time.
When profiling is complete, the Profiler displays the results in Profile Summary. The statements
you profiled also display as having been run in the Command Window.
To profile a code file open in the Editor, on the Editor tab, in the Run section, select Run > Run and
Time. The Profiler profiles the code file open in the current Editor tab and displays the results in the
Profile Summary.
After running the Profiler on your code, the Profile Summary presents statistics about the overall
execution of your code and provides summary statistics for each function called. For example, the
image below shows the Profile Summary for the solvelotka function.
29-5
29 Performance
At the top of the Profile Summary results, a flame graph shows a visual representation of the time
MATLAB spent running the code. Each function that was run is represented by a bar in the flame
graph. User-defined functions display in blue, and MathWorks functions display in gray.
The functions in the graph display in hierarchical order, with parent functions appearing lower on the
graph, and child functions appearing higher on the graph. The bar that spans the entire bottom of the
graph labeled Profile Summary represents all of the code that ran. The width of a bar on the graph
represents the amount of time it took for the function to run as a percentage of the total run time.
To see the actual percentage and time values as well as the full function name, hover over the bar in
the graph. To display detailed information about a function including information about individual
code lines, click the bar representing that function.
29-6
Profile Your Code to Improve Performance
The function table below the flame frame displays similar information to the flame graph. Initially the
functions appear in order of time they took to process. This table describes the information in each
column.
Column Description
Function Name Name of the function called by the profiled code.
Calls Number of times the profiled code called the function.
Total Time Total time spent in the function, in seconds. The time for the function includes time
spent in child functions. The Profiler itself takes some time, which is included in
the results. The total time can be zero for files whose run time is inconsequential.
Self Time Total time in seconds spent in a function, excluding time spent in any child
functions. Self time also includes some overhead resulting from the process of
profiling.
Total Time Plot Graphic display showing self time compared to total time.
To sort the function table by a specific column, click the arrow in the column header. For example,
click the arrow in the Function Name column to sort the functions alphabetically. Initially the results
appear in order by Total Time. To display detailed information about a function including information
about individual code lines, click the function name.
To find potential improvements in your code, look for functions in the flame graph or function table
that use a significant amount of time or that are called most frequently. Click a function name to
display detailed information about the function, including information about individual code lines. For
example, click the solvelotka>calculatepeaks function. The Profiler displays detailed
information for the function.
29-7
29 Performance
At the top of the page, next to the name of the current function, the Profiler displays the number of
times the function was called by a parent function and the total time spent in the function. Use the
displayed links underneath the flame graph to open the function in your default editor or copy the
displayed results to a separate window.
To return to the Profile Summary, in the Profiler tab, click the Profile Summary button. You also
can click the Profile Summary bar at the bottom of the flame graph.
Once you have clicked an individual function, the Profiler displays additional information in these
sections:
29-8
Profile Your Code to Improve Performance
Section Details
Flame Graph Flame graph showing visual representation of the time MATLAB spent
running the profiled function. The graph shows the hierarchy of the
profiled function, including child functions (displayed above the
current function) and parent functions (displayed below the current
function). User-defined functions display in blue ( ), and MathWorks
functions display in gray ( ).
Hover over the bar in the graph to see the actual percentage and time
values as well as the full function name. Click a bar representing a
function to display detailed information about the function.
Parents List of functions that call the profiled function, including the number
of times the parent function called the profiled function.
Click a code line to see it in the Function Listing section, within the
context of the rest of the function code.
Children List of all the functions called by the profiled function.
29-9
29 Performance
Section Details
Function listing Source code for the function, if it is a MATLAB code file.
For each line of code, the Function listing includes these columns:
To compare the impact of changes after you have made improvements to your code, save your
profiling results. To save your results, use the displayed link underneath the flame graph to copy the
displayed results to a separate window.
You also can print your results from the Profiler by going to the Profiler tab and clicking the Print
button.
29-10
Profile Your Code to Improve Performance
Profile an App
You can profile apps that you create in App Designer. You also can profile apps that ship with
MathWorks products, such as the Filter Design and Analysis tool included with Signal Processing
Toolbox.
To profile an app:
1
Open the Profiler by going to the Home tab, and in the Code section, click Run and Time.
You also can type profile viewer in the Command Window.
2
In the Profile section of the Profiler toolstrip, click Start Profiling. Make sure that there is
no code in the edit box to the right of the button.
3 Start the app.
4 Use the app.
5 When you are finished, click Stop Profiling in the Profiler toolstrip.
6 Review the Profile Summary results.
Note To exclude the app startup process in the profile, reverse steps 2 and 3. In other words, start
See Also
profile | profsave
More About
• “Measure the Performance of Your Code” on page 29-2
• “Techniques to Improve Performance” on page 29-14
• “Determine Code Coverage Using the Profiler” on page 29-12
29-11
29 Performance
To determine how much of a file MATLAB executed when you profiled it, run the Coverage Report.
1 Profile your MATLAB code file. For more information, see “Profile Your Code to Improve
Performance” on page 29-4 or the profile function.
2 Ensure that the Profiler is not currently profiling.
• In the Profiler, a Stop Profiling button displays if the Profiler is running. If the Profiler is
running, click the Stop Profiling button.
• At the command prompt, check the Profiler status using profile status. If the
ProfilerStatus is 'on', stop the Profiler by typing profile off.
3 Use the Current Folder browser to navigate to the folder containing the profiled code file.
Note You cannot run reports when the path is a UNC (Universal Naming Convention) path; that
is, a path that starts with \\. Instead, use an actual hard drive on your system, or a mapped
network drive.
4 On the Current Folder browser, click , and then select Reports > Coverage Report.
The Profiler Coverage Report opens, providing a summary of coverage for the profiled file. In the
following image, the profiled file is lengthofline2.m.
5 Click the Coverage link to see the Profile Detail Report for the file.
See Also
profile
29-12
Determine Code Coverage Using the Profiler
More About
• “Profile Your Code to Improve Performance” on page 29-4
• “Measure the Performance of Your Code” on page 29-2
• “Techniques to Improve Performance” on page 29-14
29-13
29 Performance
Environment
Be aware of background processes that share computational resources and decrease the performance
of your MATLAB code.
Code Structure
While organizing your code:
29-14
Techniques to Improve Performance
• Avoid using “data as code” — If you have large portions of code (for example, over 500 lines) that
generate variables with constant values, consider constructing the variables and saving them, for
example, in a MAT-file or .csv file. Then you can load the variables instead of executing code to
generate them.
• Avoid clearing more code than necessary. Do not use clear all programmatically. For more
information, see clear.
• Avoid functions that query the state of MATLAB such as inputname, which, whos, exist(var),
and dbstack. Run-time introspection is computationally expensive.
• Avoid functions such as eval, evalc, evalin, and feval(fname). Use the function handle input
to feval whenever possible. Indirectly evaluating a MATLAB expression from text is
computationally expensive.
• Avoid programmatic use of cd, addpath, and rmpath, when possible. Changing the MATLAB path
during run time results in code recompilation.
See Also
More About
• “Measure the Performance of Your Code” on page 29-2
• “Profile Your Code to Improve Performance” on page 29-4
• “Preallocation” on page 29-16
• “Vectorization” on page 29-18
• “Graphics Performance”
29-15
29 Performance
Preallocation
for and while loops that incrementally increase the size of a data structure each time through the
loop can adversely affect performance and memory use. Repeatedly resizing arrays often requires
MATLAB to spend extra time looking for larger contiguous blocks of memory, and then moving the
array into those blocks. Often, you can improve code execution time by preallocating the maximum
amount of space required for the array.
The following code displays the amount of time needed to create a scalar variable, x, and then to
gradually increase the size of x in a for loop.
tic
x = 0;
for k = 2:1000000
x(k) = x(k-1) + 5;
end
toc
If you preallocate a 1-by-1,000,000 block of memory for x and initialize it to zero, then the code runs
much faster because there is no need to repeatedly reallocate memory for the growing data
structure.
tic
x = zeros(1,1000000);
for k = 2:1000000
x(k) = x(k-1) + 5;
end
toc
Use the appropriate preallocation function for the kind of array you want to initialize:
A = int8(zeros(100));
This statement preallocates a 100-by-100 matrix of int8, first by creating a full matrix of double
values, and then by converting each element to int8. Creating the array as int8 values saves time
and memory. For example:
A = zeros(100,'int8');
29-16
Preallocation
See Also
Related Examples
• “Reshaping and Rearranging Arrays”
• “Preallocate Memory for Cell Array” on page 12-15
• “Access Data Using Categorical Arrays” on page 8-24
• “Preallocate Arrays of Graphics Objects”
• “Construct Object Arrays”
More About
• “Techniques to Improve Performance” on page 29-14
29-17
29 Performance
Vectorization
In this section...
“Using Vectorization” on page 29-18
“Array Operations” on page 29-19
“Logical Array Operations” on page 29-20
“Matrix Operations” on page 29-21
“Ordering, Setting, and Counting Operations” on page 29-22
“Functions Commonly Used in Vectorization” on page 29-23
Using Vectorization
MATLAB is optimized for operations involving matrices and vectors. The process of revising loop-
based, scalar-oriented code to use MATLAB matrix and vector operations is called vectorization.
Vectorizing your code is worthwhile for several reasons:
• Appearance: Vectorized mathematical code appears more like the mathematical expressions found
in textbooks, making the code easier to understand.
• Less Error Prone: Without loops, vectorized code is often shorter. Fewer lines of code mean fewer
opportunities to introduce programming errors.
• Performance: Vectorized code often runs much faster than the corresponding code containing
loops.
This code computes the sine of 1,001 values ranging from 0 to 10:
i = 0;
for t = 0:.01:10
i = i + 1;
y(i) = sin(t);
end
The second code sample usually executes faster than the first and is a more efficient use of MATLAB.
Test execution speed on your system by creating scripts that contain the code shown, and then use
the tic and toc functions to measure their execution time.
This code computes the cumulative sum of a vector at every fifth element:
x = 1:10000;
ylength = (length(x) - mod(length(x),5))/5;
y(1:ylength) = 0;
for n= 5:5:length(x)
y(n/5) = sum(x(1:n));
end
29-18
Vectorization
Using vectorization, you can write a much more concise MATLAB process. This code shows one way
to accomplish the task:
x = 1:10000;
xsums = cumsum(x);
y = xsums(5:5:length(x));
Array Operations
Array operators perform the same operation for all elements in the data set. These types of
operations are useful for repetitive calculations. For example, suppose you collect the volume (V) of
various cones by recording their diameter (D) and height (H). If you collect the information for just
one cone, you can calculate the volume for that single cone:
V = 1/12*pi*(D^2)*H;
Now, collect information on 10,000 cones. The vectors D and H each contain 10,000 elements, and you
want to calculate 10,000 volumes. In most programming languages, you need to set up a loop similar
to this MATLAB code:
for n = 1:10000
V(n) = 1/12*pi*(D(n)^2)*H(n);
end
With MATLAB, you can perform the calculation for each element of a vector with similar syntax as the
scalar case:
% Vectorized Calculation
V = 1/12*pi*(D.^2).*H;
Note Placing a period (.) before the operators *, /, and ^, transforms them into array operators.
Array operators also enable you to combine matrices of different dimensions. This automatic
expansion of size-1 dimensions is useful for vectorizing grid creation, matrix and vector operations,
and more.
Suppose that matrix A represents test scores, the rows of which denote different classes. You want to
calculate the difference between the average score and individual scores for each class. Using a loop,
the operation looks like:
mA = mean(A);
B = zeros(size(A));
for n = 1:size(A,2)
B(:,n) = A(:,n) - mA(n);
end
A more direct way to do this is with A - mean(A), which avoids the need of a loop and is
significantly faster.
devA = A - mean(A)
29-19
29 Performance
devA =
18 11 0
16 4 8
-15 2 15
-3 -1 -17
9 -19 -10
-1 -12 3
-24 15 1
Even though A is a 7-by-3 matrix and mean(A) is a 1-by-3 vector, MATLAB implicitly expands the
vector as if it had the same size as the matrix, and the operation executes as a normal element-wise
minus operation.
The size requirement for the operands is that for each dimension, the arrays must either have the
same size or one of them is 1. If this requirement is met, then dimensions where one of the arrays has
size 1 are expanded to be the same size as the corresponding dimension in the other array. For more
information, see “Compatible Array Sizes for Basic Operations” on page 2-25.
Another area where implicit expansion is useful for vectorization is if you are working with
multidimensional data. Suppose you want to evaluate a function, F, of two variables, x and y.
To evaluate this function at every combination of points in the x and y vectors, you need to define a
grid of values. For this task you should avoid using loops to iterate through the point combinations.
Instead, if one of the vectors is a column and the other is a row, then MATLAB automatically
constructs the grid when the vectors are used with an array operator, such as x+y or x-y. In this
example, x is a 21-by-1 vector and y is a 1-by-16 vector, so the operation produces a 21-by-16 matrix
by expanding the second dimension of x and the first dimension of y.
x = (-2:0.2:2)'; % 21-by-1
y = -1.5:0.2:1.5; % 1-by-16
F = x.*exp(-x.^2-y.^2); % 21-by-16
In cases where you want to explicitly create the grids, you can use the meshgrid and ndgrid
functions.
For example, suppose while collecting data from 10,000 cones, you record several negative values for
the diameter. You can determine which values in a vector are valid with the >= operator:
ans =
0 1 1 1 0 1 1
You can directly exploit the logical indexing power of MATLAB to select the valid cone volumes,
Vgood, for which the corresponding elements of D are nonnegative:
29-20
Vectorization
MATLAB allows you to perform a logical AND or OR on the elements of an entire vector with the
functions all and any, respectively. You can throw a warning if all values of D are below zero:
if all(D < 0)
warning('All values of diameter are negative.')
return
end
MATLAB can also compare two vectors with compatible sizes, allowing you to impose further
restrictions. This code finds all the values where V is nonnegative and D is greater than H:
To aid comparison, MATLAB contains special values to denote overflow, underflow, and undefined
operators, such as Inf and NaN. Logical operators isinf and isnan exist to help perform logical
tests for these special values. For example, it is often useful to exclude NaN values from
computations:
xvalid =
2 -1 0 3 2 11 4 Inf
Note Inf == Inf returns true; however, NaN == NaN always returns false.
Matrix Operations
When vectorizing code, you often need to construct a matrix with a particular size or structure.
Techniques exist for creating uniform matrices. For instance, you might need a 5-by-5 matrix of equal
elements:
A = ones(5,5)*10;
v = 1:5;
A = repmat(v,3,1)
A =
1 2 3 4 5
1 2 3 4 5
1 2 3 4 5
The function repmat possesses flexibility in building matrices from smaller matrices or vectors.
repmat creates matrices by repeating an input matrix:
A = repmat(1:3,5,2)
B = repmat([1 2; 3 4],2,2)
29-21
29 Performance
A =
1 2 3 1 2 3
1 2 3 1 2 3
1 2 3 1 2 3
1 2 3 1 2 3
1 2 3 1 2 3
B =
1 2 1 2
3 4 3 4
1 2 1 2
3 4 3 4
A number of different ways exist for finding the redundant elements of a vector. One way involves the
function diff. After sorting the vector elements, equal adjacent elements produce a zero entry when
you use the diff function on that vector. Because diff(x) produces a vector that has one fewer
element than x, you must add an element that is not equal to any other element in the set. NaN
always satisfies this condition. Finally, you can use logical indexing to choose the unique elements in
the set:
x = [2 1 2 2 3 1 3 2 1 3];
x = sort(x);
difference = diff([x,NaN]);
y = x(difference~=0)
y =
1 2 3
Alternatively, you could accomplish the same operation by using the unique function:
y=unique(x);
However, the unique function might provide more functionality than is needed and slow down the
execution of your code. Use the tic and toc functions if you want to measure the performance of
each code snippet.
Rather than merely returning the set, or subset, of x, you can count the occurrences of an element in
a vector. After the vector sorts, you can use the find function to determine the indices of zero values
in diff(x) and to show where the elements change value. The difference between subsequent
indices from the find function indicates the number of occurrences for a particular element:
29-22
Vectorization
x = [2 1 2 2 3 1 3 2 1 3];
x = sort(x);
difference = diff([x,max(x)+1]);
count = diff(find([1,difference]))
y = x(find(difference))
count =
3 4 3
y =
1 2 3
The find function does not return indices for NaN elements. You can count the number of NaN and
Inf values using the isnan and isinf functions.
count_nans = sum(isnan(x(:)));
count_infs = sum(isinf(x(:)));
29-23
29 Performance
See Also
More About
• “Array Indexing”
• “Techniques to Improve Performance” on page 29-14
• “Array vs. Matrix Operations” on page 2-20
External Websites
• MathWorks Newsletter: Matrix Indexing in MATLAB
29-24
30
Background Processing
Asynchronous Functions
MATLAB either runs code synchronously or asynchronously. You can use the following functions to
run code asynchronously:
Calculate the maximum of two random matrices. MATLAB runs each line consecutively.
tic
A = rand(10000);
B = ones(10000);
C = max(A,B);
toc
Asynchronous Code
When you run a function asynchronously, MATLAB can run other code in the foreground at the same
time.
Use parfeval or parfevalOnAll to run functions asynchronously. Use afterEach and afterAll
to run functions asynchronously after a previous function completes.
• When you run a function asynchronously, MATLAB immediately returns a Future object. MATLAB
schedules the function to run in the background or on a parallel pool.
30-2
Asynchronous Functions
Calculate the maximum of two random matrices: one created in the background, and one created in
the foreground. Matrix A is created in the background, and matrix B is calculated in the foreground at
the same time.
Note Generally, you do not need to use wait. fetchOutputs will implicitly wait for MATLAB to
finish running the function in the background before collecting results. The function wait is used
here to explicitly show waiting for results before collecting them.
tic
fA = parfeval(backgroundPool,@rand,1,10000);
B = ones(10000);
wait(fA)
C = max(fetchOutputs(fA),B);
toc
a Use parfeval to schedule the function rand to run in the background, with 1 output and a
single input 10000. Return a future fA in the foreground.
b Run the function rand in the background.
30-3
30 Background Processing
a Use wait to explicitly wait for the future fA to finish running in the background.
b Use fetchOutputs to get rand(10000) from the future fA.
c Calculate the final result C from matrices fetchOutputs(fA) and B.
Background Workers
When you use parfeval or parfevalOnAll to run a function asynchronously, MATLAB runs the
function on a pool.
When you use backgroundPool to run code in the background, MATLAB uses the background pool
to run that code.
The background pool has a fixed number of workers. MATLAB uses these workers to run functions.
Each worker can only run one function at a time. Therefore when you run multiple functions in the
background, you must wait for a worker to be available to run each function.
Use the NumWorkers property of a BackgroundPool to find out how many workers you have.
• If you do not have Parallel Computing Toolbox, the background pool has 1 worker.
• If you have Parallel Computing Toolbox, the background pool has multiple workers. The number of
workers in the background pool is min(8,N) where N is the number of physical cores on your
machine. For example if your machine has 4 cores, the background pool has 4 workers. If your
machine has 16 cores, the background pool has 8 workers.
See Also
30-4
Run MATLAB Functions in Thread-Based Environment
Use the rand function to generate a 100-by-100 matrix of random numbers in the background.
f = parfeval(backgroundPool,@rand,1,100);
For more information about running code in the background, see backgroundPool.
parpool("threads");
parfor i = 1:100
A{i} = rand(100);
end
Automatically Scale Up
If you have Parallel Computing Toolbox, your code that uses backgroundPool automatically scales
up to use more available cores.
For information about the number of cores that you can use, see the NumWorkers property of
BackgroundPool.
By running multiple functions in the background at the same time when you use Parallel Computing
Toolbox, you can speed up the following code.
for i = 1:100
f(i) = parfeval(backgroundPool,@rand,1,100);
end
30-5
30 Background Processing
Tip For a filtered list of MATLAB functions that have thread support, see Function List (Thread-Based
Environment).
In general, functionality in “Graphics”, “App Building”, “External Language Interfaces”, “Files and
Folders”, and “Environment and Settings” is not supported.
MATLAB and several toolboxes include functions with built-in thread support. To view lists of all
functions in MATLAB and these toolboxes that have thread support, use the links in the following
table. Functions in the lists with warning indicators have limitations or usage notes specific to
running the function on threads. You can check the usage notes and limitations in the Extended
Capabilities section of the function reference page. For information about updates to individual
thread-supported functions, see the release notes.
See Also
parfeval | backgroundPool
More About
• “Run MATLAB Functions on a GPU” (Parallel Computing Toolbox)
30-6
Use the Background to Make Your Apps More Responsive
If you want to modify an existing app that runs code in the background, see “Responsive App That
Calculates and Plots Simple Curves” on page 30-10.
• Open an existing app that does not run any code in the background.
• Modify a function to allow the app to run code in the background.
• Write a function to automatically update a plot after code finishes running in the background.
• Modify existing callbacks to allow your app to immediately respond to user interface interactions
and interrupt calculations.
Use this app as a starting point as you modify and reorganize the app code. The app has five
functions:
• getFunction — Use the value from the drop-down fcnDropDown to select a function fcn. The
custom functions available as supporting files use pause(rand) to simulate a nontrivial
calculation.
• createData — Use getFunction to get a function fcn, then use that function to compute y =
fcn(x) in iterations of a for-loop. The for-loop suspends MATLAB execution until it is finished.
• updatePlot — Update the plot represented by app.UIAxes with each y-axis data point after it is
calculated.
• clearPlot — Clear the plot.
• toggleButtons — Switch between enabling the Start button or Stop button.
To make your app responsive, you need to store all of the Future objects the app creates. Then, you
can use cancel to stop the calculations running in the background when the user of the app clicks
the Stop button or uses the drop down fcnDropDown.
30-7
30 Background Processing
To store the Future objects the app creates, you must add a private property to your app. In the App
Designer toolstrip, click Property > Private Property, then name the property F.
1 Use parfeval and backgroundPool to run the function fcn in the background. In each
iteration of the for-loop, store each Future in an array f.
2 Store the future array as the F property of the app.
3 Use afterEach to run a function onFutureDone that updates a plot after each element of
app.F completes. Specify PassFuture as true to run the function using each Future element.
4 Use afterAll to toggle between the Start and Stop buttons after MATLAB finishes calculating
all of the y-axis data.
function createData(app)
% Create data for the x-axis and y-axis.
% Update a plot while the data is being created.
% Get function
fcn = app.getFunction;
% x-axis data
app.X = 5 * 1:100;
% y-axis data
for i = 1:numel(app.X)
% Run fcn(x) in the background
f(i) = parfeval(backgroundPool,fcn,1,app.X(i));
end
1 In the App Designer toolstrip, click Function > Private Function, then name the function
onFutureDone.
30-8
Use the Background to Make Your Apps More Responsive
2 If the Future object finished with an error, immediately return from the function.
3 If the Future object did not finish with an error, use the ID property of f to find the index of the
element f in the array app.F. The index of the Future object f must match the index of the x-
axis data point.
4 Update the plot with the result from f and the matching x-axis data point by, using the index
idx.
function onFutureDone(app,f)
% Do not update the plot if there was an error
if ~isempty(f.Error)
return
end
app.clearPlot
if app.StartButton.Enable == false
app.createData
end
end
• Push the Stop button.
app.toggleButtons
end
• Request the app to close.
30-9
30 Background Processing
delete(app)
end
Run the PlotCurveBackground app by clicking the Run button in App Designer.
30-10
Run Functions in Background
Use parfeval to run the function magic(3) and retrieve one output. Specify backgroundPool as
the first argument to run the function in the background. When you use parfeval, you create a
Future object.
f = parfeval(backgroundPool,@magic,1,3);
To retrieve the output from the background, use fetchOutputs. MATLAB returns the output once
the execution of magic is complete.
fetchOutputs(f)
ans = 3×3
8 1 6
3 5 7
4 9 2
30-11
30 Background Processing
Set the number of iterations for your for-loop, N. Store the current number of completed iterations,
0, and the total number of iterations, N, in the UserData property of the wait bar.
N = ;
w.UserData = [0 N];
Run a for-loop with N iterations. In each iteration, use parfeval and backgroundPool to run
pause in the background for a random number of seconds. Store each Future object in an array.
for i = 1:N
delay = rand;
f(i) = parfeval(backgroundPool,@pause,0,delay);
end
Use the helper function updateWaitbar to update the waitbar after each Future finishes.
afterEach(f,@(~)updateWaitbar(w),0);
Use delete to close the wait bar after all the Future objects finish.
afterAll(f,@(~)delete(w),0);
Define the helper function updateWaitbar. The function increments the first element of the
UserData property, then uses the vector to calculate the progress.
function updateWaitbar(w)
% Update a waitbar using the UserData property.
30-12
Update Wait Bar While Functions Run in the Background
waitbar(progress,w);
end
end
30-13
31
Memory Usage
The numeric class you should use in MATLAB depends on your intended actions. The default class
double gives the best precision, but requires 8 bytes per element of memory to store. If you intend
to perform complicated math such as linear algebra, you must use a floating-point class such as a
double or single. The single class requires only 4 bytes. There are some limitations on what you
can do with the single class, but most MATLAB Math operations are supported.
If you just need to carry out simple arithmetic and you represent the original data as integers, you
can use the integer classes in MATLAB. The following is a list of numeric classes, memory
requirements (in bytes), and the supported operations.
MATLAB arrays (implemented internally as mxArrays) require room to store meta information about
the data in memory, such as type, dimensions, and attributes. This takes about 104 bytes per array.
This overhead only becomes an issue when you have a large number (e.g., hundreds or thousands) of
small mxArrays (e.g., scalars). The whos command lists the memory used by variables, but does not
include this overhead.
Because simple numeric arrays (comprising one mxArray) have the least overhead, you should use
them wherever possible. When data is too complex to store in a simple array (or matrix), you can use
other data structures.
Cell arrays are comprised of separate mxArrays for each element. As a result, cell arrays with many
small elements have a large overhead.
Structures require a similar amount of overhead per field. Structures with many fields and small
contents have a large overhead and should be avoided. A large array of structures with numeric
31-2
Strategies for Efficient Use of Memory
scalar fields requires much more memory than a structure with fields containing large numeric
arrays.
Also note that while MATLAB stores numeric arrays in contiguous memory, this is not the case for
structures and cell arrays. For more information, see “How MATLAB Allocates Memory” on page 31-
12.
When reading data from a binary file with fread, it is a common error to specify only the class of the
data in the file, and not the class of the data MATLAB uses once it is in the workspace. As a result, the
default double is used even if you are reading only 8-bit values. For example,
If your data contains many zeros, consider using sparse arrays, which store only nonzero elements.
The following example compares sparse and full storage requirements:
You can see that this array requires only about 24 KB to be stored as sparse, but approximately 8 MB
as a full matrix. In general, for a sparse double array with nnz nonzero elements and ncol columns,
the memory required is:
Note that MATLAB supports most, but not all, mathematical operations on sparse arrays.
31-3
31 Memory Usage
Avoid creating large temporary variables, and also make it a practice to clear temporary variables
when they are no longer needed. For example, this code creates an array of zeros stored as a
temporary variable A, and then converts A to single-precision:
A = zeros(1e6,1);
As = single(A);
A = zeros(1e6,1,'single');
Using the repmat function, array preallocation, and for loops are other ways to work on non-double
data without requiring temporary storage in memory.
When working with large data sets, be aware that MATLAB makes a temporary copy of an input
variable if the called function modifies its value. This temporarily doubles the memory required to
store the array, which causes MATLAB to generate an error if sufficient memory is not available.
One way to use less memory in this situation is to use nested functions. A nested function shares the
workspace of all outer functions, giving the nested function access to data outside of its usual scope.
In the example shown here, nested function setrowval has direct access to the workspace of the
outer function myfun, making it unnecessary to pass a copy of the variable in the function call. When
setrowval modifies the value of A, it modifies it in the workspace of the calling function. There is no
need to use additional memory to hold a separate array for the function being called, and there also is
no need to return the modified value of A:
function myfun
A = magic(500);
setrowval(400,0)
disp('The new value of A(399:401,1:10) is')
A(399:401,1:10)
function setrowval(row,value)
A(row,:) = value;
end
end
If your program generates very large amounts of data, consider writing the data to disk periodically.
After saving that portion of the data, use the clear function to remove the variable from memory and
continue with the data generation.
31-4
Strategies for Efficient Use of Memory
When you are working with a very large data set repeatedly or interactively, clear the old variable
first to make space for the new variable. Otherwise, MATLAB requires temporary storage of equal
size before overriding the variable. For example,
a = rand(1e5);
b = rand(1e5);
Out of memory.
More information
clear a
a = rand(1e5); % New array
See Also
More About
• “Resolve “Out of Memory” Errors” on page 31-6
31-5
31 Memory Usage
Issue
When your code operates on large amounts of data or does not use memory efficiently, MATLAB
might produce an error in response to an unreasonable array size, or it might run out of memory.
MATLAB has built-in protection against creating arrays that are too large. For example, this code
results in an error, because MATLAB cannot create an array with the requested number of elements.
A = rand(1e9);
By default, MATLAB can use up to 100% of the RAM (not including virtual memory) of your computer
to allocate memory for arrays, and if an array size would exceed that threshold, then MATLAB
produces an error. For example, this code attempts to create an array whose size exceeds the
maximum array size limit.
B = rand(1e6);
Requested 1000000x1000000 (7450.6GB) array exceeds maximum array size preference (63.7GB). This might cause MATLAB to bec
unresponsive.
If you turn off the array size limit in MATLAB Workspace Preferences, attempting to create an
unreasonably large array might cause MATLAB to run out of memory, or it might make MATLAB or
even your computer unresponsive due to excessive memory paging (that is, moving memory pages
between RAM and disk).
B = rand(1e6);
Out of memory.
Possible Solutions
No matter how you run into memory limits, MATLAB provides several solutions depending on your
situation and goals. For example, you can improve the way your code uses memory, leverage
specialized data structures such as datastores and tall arrays, take advantage of pooled resources
within a computing cluster, or make adjustments to your settings and preferences.
Note The solutions presented here are specific to MATLAB. To optimize system-wide memory
performance, consider adding more physical memory (RAM) to your computer or making adjustments
at the operating system level.
Make it a practice to clear variables when they are no longer needed. To clear items from memory,
use the clear function.
31-6
Resolve “Out of Memory” Errors
Before After
A = rand(1e4); A = rand(1e4);
disp(max(A,[],"all")) disp(max(A,[],"all"))
B = rand(1e4); clear A
B = rand(1e4);
For more information, see “Strategies for Efficient Use of Memory” on page 31-2.
Memory requirements differ for MATLAB data types. You might be able to reduce the amount of
memory used by your code by using the appropriate data type and storage. For more information
about the solutions in this section, see “Strategies for Efficient Use of Memory” on page 31-2.
Use the Appropriate Numeric Class
The numeric class you should use depends on your intended actions. In MATLAB, double is the
default numeric data type and provides sufficient precision for most computational tasks:
• If you want to perform complicated math such as linear algebra, use floating-point numbers in
either double-precision (double) or single-precision (single) format. Numbers of type single
require less memory than numbers of type double, but are also represented to less precision.
• If you just need to carry out simple arithmetic and you represent the original data as integers, use
the integer classes in MATLAB.
When you create a numeric or character array, MATLAB allocates a block of memory to store the
array data. MATLAB also stores information about the array data, such as its class and dimensions, in
a small, separate block of memory called a header. Because simple numeric and character arrays
have the least overhead, use them whenever possible. Use other data structures only for data that is
too complex to store in a simple array.
For structures and cell arrays, MATLAB creates a header not only for the array, but also for each field
of the structure or each cell of the cell array. Therefore, the amount of memory required to store a
structure or cell array depends not only on how much data it holds, but also on how it is constructed.
As a result, cell arrays with many small elements or structures with many fields containing little
content have large overhead and should be avoided.
31-7
31 Memory Usage
Before After
% S has 15,000 fields (3 fields per array element)
% S has 3 fields
for i = 1:100 S.R = zeros(100,50); % Each field contains a numeric
for j = 1:50 S.G = zeros(100,50);
S(i,j).R = 0; % Each field containsS.B
a numeric
= zeros(100,50);
scalar
S(i,j).G = 0;
S(i,j).B = 0;
end
end
A good practice is to store matrices with few nonzero elements using sparse storage. When a full
matrix has a small number of nonzero elements, converting the matrix to sparse storage typically
improves memory usage and code execution time. MATLAB has several functions that support sparse
storage. For example, you can use the speye function to create a sparse identity matrix.
Before After
I = eye(1000); I = speye(1000);
When reading data from a binary file with fread, a common mistake is to specify only the class of the
data in the file and not the class of the data MATLAB uses once it is in the workspace. If you do not
specify the class of the data in memory, MATLAB uses double even if you read 8-bit values.
Before After
fileID = fopen("large_file_of_uint8s.bin","r");
fileID = fopen("large_file_of_uint8s.bin","r");
A = fread(fileID,1e3,"uint8"); A = fread(fileID,1e3,"uint8=>uint8");
To improve memory usage and execution speed, make sure your code does not result in unnecessary
copies of data. For more information about the solutions in this section, see “Avoid Unnecessary
Copies of Data” on page 31-16 and “Strategies for Efficient Use of Memory” on page 31-2.
Avoid Creating Temporary Arrays
Avoid creating temporary arrays when they are not necessary. For example, instead of creating an
array of zeros as a temporary variable and then passing that variable to a function, use one command
to do both operations.
Before After
A = zeros(1e6,1); As = zeros(1e6,1,"single");
As = single(A);
Preallocate Memory
When you work with large data sets, repeatedly resizing arrays might cause your program to run out
of memory. If you expand an array beyond the available contiguous memory of its original location,
MATLAB must make a copy of the array and move the copy into a memory block with sufficient space.
During this process, two copies of the original array exist in memory. You can improve the memory
usage and code execution time by preallocating the maximum amount of space required for the array.
For more information, see “Preallocation” on page 29-16.
31-8
Resolve “Out of Memory” Errors
Before After
x = 0; x = zeros(1,1000000);
for k = 2:1000000 for k = 2:1000000
x(k) = x(k-1) + 5; x(k) = x(k-1) + 5;
end end
When calling a function, MATLAB typically makes a temporary copy of the variable in the caller's
workspace if the function modifies its value. MATLAB applies various techniques to avoid making
unnecessary copies, but avoiding a temporary copy of an input variable is not always possible.
One way to avoid temporary copies in function calls is to use nested functions. A nested function
shares the workspace of all outer functions, so you do not need to pass a copy of variables in the
function call. For more information, see “Nested Functions” on page 20-10.
One way to fix memory issues is to import into MATLAB only as much of a large data set as you need
for the problem you are trying to solve. Data set size is not usually a problem when importing from
sources such as a database, where you can explicitly search for elements matching a query. But it is a
common problem with loading large flat text or binary files.
The datastore function lets you work with large data sets incrementally. Datastores are useful any
time you want to load only some portions of a data set into memory at a time.
To create a datastore, provide the name of a file or a directory containing a collection of files with
similar formatting. For example, with a single file, use the following.
ds = datastore("path/to/file.csv");
ds = datastore("path/to/folder/");
You also can use the wildcard character * to select all files of a specific type.
ds = datastore("path/to/*.csv");
Datastores support a wide variety of file formats (tabular data, images, spreadsheets, and so on). For
more information, see “Select Datastore for File Format or Application”.
Aside from datastores, MATLAB also has several other functions to load parts of files. This table
summarizes the functions by the type of files they operate on.
31-9
31 Memory Usage
Tall arrays help you work with data sets that are too large to fit in memory. MATLAB works with small
blocks of the data at a time, automatically handling all of the data chunking and processing in the
background. You can use tall arrays in two primary ways:
• If you have a large array that fits in memory, but you run out of memory when you try to perform
calculations, you can cast the array to a tall array.
t = tall(A);
This approach lets you work with large arrays that can fit in memory, but that consume too much
memory to allow for copies of the data during calculations. For example, if you have 8 GB of RAM
and a 5 GB matrix, casting the matrix to a tall array enables you to perform calculations on the
matrix without running out of memory. For an example of this usage, see tall.
• If you have file- or folder-based data, you can create a datastore and then create a tall array on top
of the datastore.
ds = datastore("path/to/file.csv");
t = tall(ds);
This approach gives you the full power of tall arrays in MATLAB. The data can have any number of
rows and MATLAB does not run out of memory. And because datastore works with both local
and remote data locations, the data you work with does not need to be on the computer you use to
analyze it. See “Work with Remote Data” for more information.
To learn more about tall arrays, see “Tall Arrays for Out-of-Memory Data”.
If you have a cluster of computers, you can use distributed arrays (requires Parallel Computing
Toolbox) to perform calculations using the combined memory of all the machines in the cluster.
Depending on how your data fits in memory, different ways to partition data among workers of a
parallel pool exist. For more information, see “Distributing Arrays to Parallel Workers” (Parallel
Computing Toolbox).
31-10
Resolve “Out of Memory” Errors
Generally, rewriting code is the most effective way to improve memory performance. However, if you
cannot make changes to your code, these solutions might provide it with the required amount of
memory.
Start MATLAB Without Java Virtual Machine or Decrease the Java Heap Size
If you either start MATLAB without the Java Virtual Machine (JVM™) software or decrease the Java
heap size, you can increase the available workspace memory. To start MATLAB without JVM, use the
command-line option -nojvm. For information on how to decrease the Java heap size, see “Java Heap
Memory Preferences”.
Using -nojvm comes with a penalty in that you lose several features that rely on JVM, such as the
desktop tools and graphics. Starting MATLAB with the -nodesktop option does not save any
substantial amount of memory.
Adjust the Array Size Limit
If you face an error stating that the array size exceeds the maximum array size preference, you can
adjust this array size limit in MATLAB. For information on adjusting the array size limit, see
“Workspace and Variable Preferences”. This solution is helpful only if the array you want to create
exceeds the current maximum array size limit but is not too large to fit in memory. Even if you turn
off the array size limit, attempting to create an unreasonably large array might cause MATLAB to run
out of memory, or it might make MATLAB or even your computer unresponsive due to excessive
memory paging.
See Also
memory | whos | datastore | tall
Related Examples
• “How MATLAB Allocates Memory” on page 31-12
• “Strategies for Efficient Use of Memory” on page 31-2
• “Avoid Unnecessary Copies of Data” on page 31-16
• “Large Files and Big Data”
31-11
31 Memory Usage
When you assign a numeric or character array to a variable, MATLAB allocates a contiguous block of
memory and stores the array data in that block. MATLAB also stores information about the array
data, such as its class and dimensions, in a small, separate block of memory called a header. For most
arrays, the memory required to store the header is insignificant. However, there could be some
advantage to storing large data sets in a small number of large arrays as opposed to a large number
of small arrays. This is because fewer arrays require fewer array headers.
If you add new elements to an existing array, MATLAB expands the array in memory in a way that
keeps its storage contiguous. This usually requires finding a new block of memory large enough to
hold the expanded array. MATLAB then copies the contents of the array from its original location to
this new block in memory, adds the new elements to the array in this block, and frees up the original
array location in memory.
If you remove elements from an existing array, MATLAB keeps the memory storage contiguous by
removing the deleted elements, and then compacting its storage in the original memory location.
Copying Arrays
When you assign an array to a second variable (for instance, when you execute B = A), MATLAB
does not allocate new memory right away. Instead, it creates a copy of the array reference. As long as
you do not modify the contents of the memory block being referenced by A and B, there is no need to
store more than one copy of data. However, if you modify any elements of the memory block using
either A or B, MATLAB allocates new memory, copies the data into it, and then modifies the created
copy.
On Windows® systems, the memory function enables you to inspect the memory details. To see how
copying arrays affects memory usage on your Windows system, create the function memUsed in a file
in your current folder. The function calls memory to return the amount of memory used by your
MATLAB process in megabytes.
function y = memUsed
usr = memory;
y = usr.MemUsedMATLAB/1e6;
ans =
3966.1
Create a 2000-by-2000 numeric array and observe the change in memory usage. The array uses about
32 MB of memory.
A = magic(2000);
memUsed
31-12
How MATLAB Allocates Memory
ans =
3998.1
Make a copy of A in B. Because there is no need to have two copies of the array data, MATLAB only
makes a copy of the array reference. This requires no significant additional memory.
B = A;
memUsed
ans =
3998.1
Now modify B by removing half of its rows. Because A and B no longer point to the same data,
MATLAB must allocate a separate memory block to B. As a result, the amount of memory used by the
MATLAB process increases by the size of B, which is about 16 MB (one half of the 32 MB required for
A).
B(1001:2000,:) = [];
memUsed
ans =
4014.1
Function Arguments
MATLAB handles arguments passed in function calls in the same way that it handles arrays being
copied. When you pass a variable to a function, you actually pass a reference to the data that the
variable represents. As long as the data is not modified by the called function, the variable in the
calling function or script and the variable in the called function point to the same location in memory.
If the called function modifies the value of the input data, then MATLAB makes a copy of the original
variable in a new location in memory, updates that copy with the modified value, and points the input
argument in the called function to this new location.
For example, consider the function myfun, which modifies the value of the array passed to it.
MATLAB makes a copy of A in a new location in memory, sets the variable X as a reference to this
copy, and then sets one row of X to zero. The array referenced by A remains unchanged.
A = magic(5);
myfun(A)
function myfun(X)
X(4,:) = 0;
disp(X)
end
If the calling function or script needs the modified value of the array it passed to myfun, you need to
return the updated array as an output of the called function.
Memory requirements differ for MATLAB data types. You might be able to reduce the amount of
memory used by your code by learning how MATLAB treats various data types.
31-13
31 Memory Usage
Numeric Arrays
MATLAB allocates 1, 2, 4, or 8 bytes to 8-bit, 16-bit, 32-bit, and 64-bit signed and unsigned integers,
respectively. It represents floating-point numbers in either double-precision (double) or single-
precision (single) format. Because MATLAB stores numbers of type single using 4 bytes, they
require less memory than numbers of type double, which use 8 bytes. However, because they are
stored with fewer bits, numbers of type single are represented to less precision than numbers of
type double. In MATLAB, double is the default numeric data type and provides sufficient precision
for most computational tasks. For more information, see “Floating-Point Numbers” on page 4-6.
While numeric arrays must be stored in a contiguous block of memory, structures and cell arrays can
be stored in noncontiguous blocks. For structures and cell arrays, MATLAB creates a header not only
for the array, but also for each field of the structure or each cell of the cell array. Therefore, the
amount of memory required to store a structure or cell array depends not only on how much data it
holds, but also on how it is constructed.
For example, consider a scalar structure S1 with fields R, G, and B, where each field contains a 100-
by-50 array. S1 requires one header to describe the overall structure, one header for each unique
field name, and one header for each field. This makes a total of seven headers for the entire
structure.
S1.R = zeros(100,50);
S1.G = zeros(100,50);
S1.B = zeros(100,50);
On the other hand, consider a 100-by-50 structure array S2 in which each element has scalar fields R,
G, and B. In this case, S2 needs one header to describe the overall structure, one header for each
unique field name, and one header for each field of the 5,000 elements, making a total of 15,004
array headers for the entire structure array.
for i = 1:100
for j=1:50
S2(i,j).R = 0;
S2(i,j).G = 0;
S2(i,j).B = 0;
end
end
Use the whos function to compare the amount of memory allocated to S1 and S2 on a 64-bit system.
Even though S1 and S2 hold the same data, S1 uses significantly less memory.
whos S1 S2
Complex Arrays
MATLAB uses an interleaved storage representation of complex numbers, where the real and
imaginary parts are stored together in a contiguous block of memory. If you make a copy of a complex
array, and then modify only the real or imaginary part of the array, MATLAB creates an array
containing both real and imaginary parts. For more information about the representation of complex
numbers in memory, see “MATLAB Support for Interleaved Complex API in MEX Functions”.
31-14
How MATLAB Allocates Memory
Sparse Matrices
It is a good practice to store matrices with few nonzero elements using sparse storage. When a full
matrix has a small number of nonzero elements, converting the matrix to sparse storage typically
improves memory usage and code execution time. You can convert a full matrix to sparse storage
using the sparse function.
For example, let matrix A be a 1,000-by-1,000 full storage identity matrix. Create B as a sparse copy
of A. In sparse storage, the same data uses a significantly smaller amount of memory.
A = eye(1000);
B = sparse(A);
whos A B
When you work with large data sets, repeatedly resizing arrays might cause your program to run out
of memory. If you expand an array beyond the available contiguous memory of its original location,
MATLAB must make a copy of the array and move the copy into a memory block with sufficient space.
During this process, there are two copies of the original array in memory. This temporarily doubles
the amount of memory required for the array and increases the risk of your program running out of
memory. You can improve the memory usage and code execution time by preallocating the maximum
amount of space required for the array. For more information, see “Preallocation” on page 29-16.
See Also
memory | whos
Related Examples
• “Strategies for Efficient Use of Memory” on page 31-2
• “Resolve “Out of Memory” Errors” on page 31-6
• “Avoid Unnecessary Copies of Data” on page 31-16
31-15
31 Memory Usage
In this section...
“Passing Values to Functions” on page 31-16
“Why Pass-by-Value Semantics” on page 31-19
“Handle Objects” on page 31-19
MATLAB does not provide a way to define a reference to a value, as in languages like C++. Instead,
MATLAB allows multiple output as well as multiple input parameters so that you know what values
are going into a function and what values are coming out of the function.
Copy-on-Write
If a function does not modify an input argument, MATLAB does not make a copy of the values
contained in the input variable.
A = rand(1e7,1);
B = f1(A);
The function f1 multiplies each element in the input array X by 1.1 and assigns the result to the
variable Y.
function Y = f1(X)
Y = X.*1.1; % X is a shared copy of A
end
Because the function does not modify the input values, the local variable X and the variable A in the
caller's workspace share the data. After f1 executes, the values assigned to A have not changed. The
variable B in the caller's workspace contains the result of the element-wise multiplication. The input
is passed by value. However, no copy is made when calling f1.
The function f2 does modify its local copy of the input variable, causing the local copy to be unshared
with input A. The value of X in the function is now an independent copy of the input variable A in the
caller's workspace. When f2 returns the result to the caller's workspace, the local variable X is
destroyed.
A = rand(1e7,1);
B = f2(A);
function Y = f2(X)
X = X.*1.1; % X is an independent copy of A
Y = X; % Y is a shared copy of X
end
31-16
Avoid Unnecessary Copies of Data
You can use the value returned from a function as an input argument to another function. For
example, use the rand function to create the input for the function f2 directly.
B = f2(rand(1e7,1));
The only variable holding the value returned by rand is the temporary variable X in the workspace of
the function f2. There is no shared or independent copy of these values in the caller's workspace.
Directly passing function outputs saves the time and memory required to create a copy of the input
values in the called function. This approach makes sense when the input values are not used again.
Assigning In-Place
When you do not need to preserve the original input values, you can assign the output of a function to
the same variable that you provided as input.
A = f2(A);
In-place assignment follows the copy-on-write behavior described previously: modifying the input
variable values results in a temporary copy of those values.
MATLAB can apply memory optimizations under certain conditions. Consider the following example.
The canBeOptimized function creates a large array of random numbers in the variable A. Then it
calls the local function fLocal, passing A as the input, and assigning the output of the local function
to the same variable name.
function canBeOptimized
A = rand(1e7,1);
A = fLocal(A);
end
function X = fLocal(X)
X = X.*1.1;
end
Because the call to the local function, A = fLocal(A), assigns the output to the variable A, MATLAB
does not need to preserve the original value of A during execution of the function. Modifications made
to X inside fLocal do not result in a copy of the data. The assignment X = X.*1.1 modifies X in
place, without allocating a new array for the result of the multiplication. Eliminating the copy in the
local function saves memory and improves execution speed for large arrays.
However, MATLAB cannot apply this optimization if the assignment in the local function requires
array indexing. For example, modifying the cell array created in updateCells requires indexing into
the array X in the local function gLocal. The looped assignment in the form X{i} = X{i}*1.1
creates a copy of the data in X{i}. For each element of the cell array, there are two copies in the
workspace of gLocal.
function updateCells
C = num2cell(rand(1e7,1));
C = gLocal(C);
end
function X = gLocal(X)
for i = 1:length(X)
X{i} = X{i}*1.1;
end
end
31-17
31 Memory Usage
Several additional restrictions apply. MATLAB cannot apply memory optimization when it is possible
to use the variable after the function throws an error. Therefore, this optimization is not applied in
scripts, on the command line, in calls to eval, or to code inside try/catch blocks. Also, MATLAB
does not apply memory optimization when the original variable is directly accessible during execution
of the called function. For example, if fLocal was a nested function, MATLAB could not apply the
optimization because variables can be shared with the parent function. Finally, MATLAB does not
apply memory optimization when the assigned variable is declared as global or persistent.
When MATLAB applies in-place optimization to an assignment statement, the variable on the left side
of the assignment is set to a temporary state that makes it inaccessible before MATLAB executes the
right side of the assignment statement. If MATLAB stops in the debugger before the result of
executing the right-side of the statement has been assigned to the variable, examining the left-side
variable can produce an error indicating that the variable is unavailable.
For example, this function has a mismatch in the dimensions of variables A and B.
function A = inPlace
A = rand(100);
B = rand(99);
dbstop if error
A = A.*B;
end
5 A = A.*B;
Attempting to see the value of the variable A while in debug mode results in an error because the
variable is temporarily unavailable.
K>> A
To gain more flexibility when debugging, refactor your code to remove the in-place assignment. For
example, assign the result to another variable.
function A = inPlace
A = rand(100);
B = rand(99);
dbstop if error
% Assign result to C indtead of A
C = A.*B;
A = C;
end
31-18
Avoid Unnecessary Copies of Data
When calling functions, you know that the input variables are not modified in the caller's workspace.
Therefore, you do not need to make copies of inputs inside a function or at a call site just to guard
against the possibility that these values might be modified. Only the variables assigned to returned
values are modified.
Also, you avoid the possibility of corrupting workspace variables if an error occurs within a function
that has been passed a variable by reference.
Handle Objects
There are special kinds of objects called handles. All variables that hold copies of the same handle
can access and modify the same underlying object. Handle objects are useful in specialized
circumstances where an object represents a physical object such as a window, plot, device, or person
rather than a mathematical object like a number or matrix.
Handle objects derive from the handle class, which provides functionality such as events and
listeners, destructor methods, and support for dynamic properties.
For more information about values and handles, see “Comparison of Handle and Value Classes” and
“Which Kind of Class to Use”.
See Also
handle
Related Examples
• “Handle Object Behavior”
• “Avoid Copies of Arrays in MEX Functions”
• “Strategies for Efficient Use of Memory” on page 31-2
31-19
32
For example, create a class definition file named someClass.m with several properties and methods,
as shown.
classdef someClass
% someClass Summary of this class goes here
% Detailed explanation goes here
properties
One % First public property
Two % Second public property
end
properties (Access=private)
Three % Do not show this property
end
methods
function obj = someClass
% Summary of constructor
end
function myMethod(obj)
% Summary of myMethod
disp(obj)
end
end
methods (Static)
function myStaticMethod
% Summary of myStaticMethod
end
end
end
View the help text and the details from the class definition using the doc command.
doc someClass
32-2
Create Help for Classes
Classes
Create help text for classes by including comments on lines immediately after the classdef
statement in a file. For example, create a file named myClass.m, as shown.
classdef myClass
% myClass Summary of myClass
% This is the first line of the description of myClass.
% Descriptions can include multiple lines of text.
%
% myClass Properties:
% a - Description of a
% b - Description of b
%
% myClass Methods:
32-3
32 Custom Help and Documentation
properties
a
b
end
methods
function obj = myClass
end
function doThis(obj)
end
function doThat(obj)
end
end
end
Lists and descriptions of the properties and methods in the initial comment block are optional. If you
include comment lines containing the class name followed by Properties or Methods and a colon
(:), then MATLAB creates hyperlinks to the help for the properties or methods.
View the help text for the class in the Command Window using the help command.
help myClass
myClass Properties:
a - Description of a
b - Description of b
myClass Methods:
doThis - Description of doThis
doThat - Description of doThat
Methods
Create help for a method by inserting comments immediately after the function definition statement.
For example, modify the class definition file myClass.m to include help for the doThis method.
function doThis(obj)
% doThis Do this thing
% Here is some help text for the doThis method.
%
% See also DOTHAT.
disp(obj)
end
View the help text for the method in the Command Window using the help command. Specify both
the class name and method name, separated by a dot.
help myClass.doThis
32-4
Create Help for Classes
Properties
• Insert comment lines above the property definition. Use this approach for multiline help text.
• Add a single-line comment next to the property definition.
Comments above the definition have precedence over a comment next to the definition.
For example, modify the property definitions in the class definition file myClass.m.
properties
a % First property of myClass
View the help for properties in the Command Window using the help command. Specify both the
class name and property name, separated by a dot.
help myClass.a
help myClass.b
Enumerations
Like properties, there are two ways to create help for enumerations:
• Insert comment lines above the enumeration definition. Use this approach for multiline help text.
• Add a single-line comment next to the enumeration definition.
Comments above the definition have precedence over a comment next to the definition.
classdef myEnumeration
enumeration
uno, % First enumeration
32-5
32 Custom Help and Documentation
end
end
View the help in the Command Window using the help command. Specify both the class name and
enumeration member, separated by a dot.
help myEnumeration.uno
help myEnumeration.dos
Events
Like properties and enumerations, there are two ways to create help for events:
• Insert comment lines above the event definition. Use this approach for multiline help text.
• Add a single-line comment next to the event definition.
Comments above the definition have precedence over a comment next to the definition.
methods
function fireEventAlpha(h)
notify(h,'Alpha')
end
function fireEventBeta(h)
notify(h,'Beta')
end
end
end
View the help in the Command Window using the help command. Specify both the class name and
event, separated by a dot.
help hasEvents.Alpha
help hasEvents.Beta
32-6
Create Help for Classes
See Also
help | doc
More About
• “Role of Classes in MATLAB”
• “User-Defined Classes”
32-7
32 Custom Help and Documentation
In the Help Report, you specify a set of help components for which you want to search, such as
examples or See Also lines. For each file searched, MATLAB displays the help text for the
components it finds. Otherwise, MATLAB displays a highlighted message to indicate that the
component is missing.
To generate a Help Report, in the Current Folder browser, navigate to the folder you want to check,
click , and then select Reports > Help Report. The Help Report displays in the MATLAB web
browser.
Note You cannot run reports when the path is a UNC (Universal Naming Convention) path; that is, a
path that starts with \\. Instead, use an actual hard drive on your system, or a mapped network
drive.
32-8
Check Which Programs Have Help
If your program has the same name as other programs on the MATLAB
search path, then the help command generates a list of those overloaded
items. MATLAB automatically adds links to the help for those items.
Description Check for an initial, nonempty comment line in the file. This line is
sometimes called the H1 line.
Examples Check for examples in the help text. The Help Report performs a case-
insensitive search for a help line with a single-word variant of example.
The report displays that line and subsequent nonblank comment lines,
along with the initial line number.
See Also Check for a line in the help that begins with the words See also. The
report displays the text and the initial line number.
If the programs listed after See also are on the search path, then the
help command generates hyperlinks to the help for those programs. The
Help Report indicates when a program in the See also line is not on the
path.
Copyright Check for a comment line in the file that begins with the word
Copyright. When there is a copyright line, the report also checks
whether the end year is current. The date check requires that the
copyright line includes either a single year (such as 2012) or a range of
years with no spaces (such as 2001-2012).
See Also
Related Examples
• “Add Help for Your Program” on page 20-5
• “Create Help Summary Files — Contents.m” on page 32-10
32-9
32 Custom Help and Documentation
Contents.m files contain only comment lines. The first two lines are headers that describe the folder.
Subsequent lines list the program files in the folder, along with their descriptions. Optionally, you can
group files and include category descriptions. For example, view the functions available in the
codetools folder:
help codetools
Commands for creating and debugging code
MATLAB Version 9.3 (R2017b) 24-Jul-2017
Directory tools
mlintrpt - Run mlint for file or folder, reporting results in browser
visdiff - Compare two files (text, MAT, or binary) or folders
...
If you do not want others to see a summary of your program files, place an empty Contents.m file in
the folder. An empty Contents.m file causes help foldername to report No help found for
foldername. Without a Contents.m file, the help and doc commands display a generated list of all
program files in the folder.
32-10
Create Help Summary Files — Contents.m
Do not include any spaces in the date. This comment line enables the ver function to detect the
version information.
Note MATLAB does not include live scripts or functions when creating a Contents Report.
1 In the Current Folder browser, navigate to the folder that contains the Contents.m file.
2 Click , and then select Reports > Contents Report.
Note You cannot run reports when the path is a UNC (Universal Naming Convention) path; that is, a
path that starts with \\. Instead, use an actual hard drive on your system, or a mapped network
drive.
You can make all the suggested changes by clicking fix all, or open the file in the Editor by clicking
edit Contents.m.
See Also
doc | help | ver
32-11
32 Custom Help and Documentation
For MATLAB to detect the function signature information, you must place
functionSignatures.json in the folder that contains the function code. If you define information
for a class method or package function, you must place functionSignatures.json in the parent
folder of the outermost class or package folder. For example, to define information for a method of
myClass, place functionSignatures.json in the folder myFolder for these class and package
structures:
myFolder/+myPackage/@myClass
myFolder/+myPackage/+mySubpackage/@myClass
For classes located outside of class or package folders, place functionSignatures.json in the
folder that contains the class code. You can define signatures for multiple functions in the same file.
The functionSignatures.json file contains a single JSON object. JSON uses braces to define
objects, and refers to objects as collections of name and value pairs. Since these terms are
overloaded in context of function signatures, "property" is used instead of "name." The JSON object in
functionSignatures.json contains an optional schema version and a list of function objects.
Each function object contains a list of signature objects, and each signature object contains an array
of argument objects. JSON uses brackets to define arrays.
To specify the optional schema version use _schemaVersion as the first property and the version
number as its value. Specify the version number as a JSON string in the format
major#.minor#.patch#, with each number specified as a nonnegative integer. The current schema
version is 1.0.0. If the file does not specify a schema version, MATLAB assumes version 1.0.0.
32-12
Customize Code Suggestions and Completions
Function Objects
To define information for a function, create a property that is the same as the function name. Its value
is a signature object on page 32-13.
{
"functionName1": { signatureObj1 },
"functionName2": { signatureObj2 }
}
To define information for a class constructor, class method, or package function, use the full name of
the function or method. For example, define a class constructor, class method myMethod, and a
package function myFunction.
{
"myClass.myClass": { signatureObj },
"myClass.myMethod": { signatureObj },
"myPackage.myFunction": { signatureObj }
}
You can define multiple function signatures for the same function or method by defining multiple
function objects with the same property (function or method name). For more information, see
“Multiple Signatures” on page 32-19.
Signature Objects
A signature object defines the input and output arguments and supported platforms for the function.
The value of each property, except for the platforms property, is an array of argument objects on
page 32-14.
{
"functionName1":
{
"inputs": [ argumentObj1, argumentObj2 ]
}
}
If you specify an instance method such as myClass.myMethod in the JSON file, one of the elements
in inputs must be an object of myClass. Typically, this object is the first element. MATLAB supports
code suggestions and completions for a specified method when you call it using either dot notation (b
= myObj.myMethod(a)) or function notation (b = myMethod(myObj,a)) syntax.
Each signature in the JSON file can include the following properties.
32-13
32 Custom Help and Documentation
Argument Objects
Argument objects define the information for each of the input and output arguments.
{
"functionName1":
{
"inputs":
[
{"name":"in1", "kind":"required", "type":["numeric"]},
{"name":"in2", "kind":"required", "type":["numeric","integer","scalar"]}
]
}
}
The order that the inputs appear in the JSON file is significant. For example, in a call to the
functionName1 function, in1 must appear before in2.
The name of the input or output argument, specified as a JSON string. This property and value is
required. The name property does not need to match the argument name in the source code, but it is
a best practice for it to match any help or documentation.
Example: "name":"myArgumentName"
The kind of argument, specified as a JSON string with one of the following values. MATLAB uses the
value of the kind property to determine if and when to display the arguments within the function
signature.
Value Description
required Argument is required, and its location is relative to other required arguments in
the signature object.
ordered Argument is optional, and its location is relative to the required and preceding
optional arguments in the signature object.
namevalue Argument is an optional name-value pair. Name-value pair arguments occur at
the end of a function signature, but the pairs can be specified in any order.
32-14
Customize Code Suggestions and Completions
Arguments that are required and ordered appear first in the function signature, and are followed
by any namevalue arguments.
required, ordered, and namevalue arguments are most common. You can also specify the
following values for kind.
• positional – Argument is optional if it occurs at the end of the argument list, but becomes
required to specify a subsequent positional argument. Any positional arguments must appear
with the required and ordered arguments, before any namevalue arguments.
• flag – Argument is an optional, constant string, typically used as a switch. For example,
'ascend' or 'descend'. Flags occur at the end of a function signature. All flag arguments
must appear before any namevalue arguments.
• properties – Argument is optional and is used to specify public, settable properties of a different
MATLAB class. Indicate the class using the argument object type property. In code suggestions,
these properties appear as name-value pairs. Any properties arguments must be the last
argument in the signature.
Class or attributes of the argument, specified as a JSON string, list, or list of lists.
The type property can define what class the argument is and what attributes the argument must
have.
• To match one class or attribute, use a single JSON string. For example, if an argument must be
numeric, then specify "type":"numeric".
• To match all classes or attributes, use a list of JSON strings. For example, if an argument must be
both numeric and positive, then specify "type":["numeric", ">=0"].
• To match any of multiple classes or attributes, use a list of lists of JSON strings. For the inner lists,
MATLAB uses a logical AND of the values. For the outer list, MATLAB uses a logical OR of the
values. For example, if an argument must be either a positive number or a containers.Map
object, then specify "type":[["numeric", ">=0"],["containers.Map"]].
expression can refer by name to other input arguments that appear in the
argument list. Since expression is evaluated at run time, allowable choices
can vary dynamically with the value of other input arguments.
"file=*.ext,..." Must be a string or character vector that names an existing file with the
specified extension. File names are relative to the current working folder.
For example, to allow all .m and .mlx files in the current folder, use
"file=*.m,*.mlx". To match all files in the current folder, use "file".
32-15
32 Custom Help and Documentation
"<expression"
"<=expression"
@(args) expression Must satisfy the function handle. For a value to satisfy the function handle,
the handle must evaluate to true.
Indicator that an argument can be specified multiple times, specified as a JSON true or false
(without quotes). The default is false. If specified as true, the argument or set of arguments (tuple)
32-16
Customize Code Suggestions and Completions
can be specified multiple times. A required repeating argument must appear one or more times, and
an optional repeating argument can appear zero or more times.
Example: "repeating":true
Description of argument, specified as a JSON string. Use this property to communicate the purpose of
the argument.
For more complicated function signatures, the following properties are available for each argument
object.
List of platforms that support the argument, specified as a JSON string. The default is all platforms.
Elements of the list must match an archstr returned from the computer function. The list can be
inclusive or exclusive, but not both.
Definition of a set of arguments that must always appear together, specified as a list of argument
objects. This property is only used to define sets of multiple repeating arguments. For these function
signatures, define tuples and set the repeating property to true.
Definition of a set of sets of arguments that cannot be used together, specified as a list of argument
objects. This property is used to provide information about functions with multiple function
signatures. However, typically it is easier to define multiple function signatures using multiple
function objects. For more information, see “Multiple Signatures” on page 32-19.
Create a function whose signature you will describe in a JSON file in later steps. The following
function accepts:
myFunc is presented to demonstrate code suggestions and does not include argument checking.
% myFunc Example function
% This function is called with any of these syntaxes:
%
% myFunc(in1, in2) accepts 2 required arguments.
% myFunc(in1, in2, in3) also accepts an optional 3rd argument.
% myFunc(___, NAME, VALUE) accepts one or more of the following name-value pair
% arguments. This syntax can be used in any of the previous syntaxes.
% * 'NAME1' with logical value
32-17
32 Custom Help and Documentation
if nargin > 3
if rem(nargin,2)
posA = varargin{1};
V = varargin(2:end);
else
V = varargin;
end
for n = 1:2:size(V,2)
switch V{n}
case 'Name1'
NV1 = V{n+1};
case 'Name2'
NV2 = V{n+1}
otherwise
error('Error.')
end
end
end
end
In the same folder as myFunc, create the following function signature description in a file called
functionSignatures.json. The input names do not match the names in the body of myFunc, but
are consistent with the help text.
{
"_schemaVersion": "1.0.0",
"myFunc":
{
"inputs":
[
{"name":"in1", "kind":"required", "type":["numeric"], "purpose":"ID of item"},
{"name":"in2", "kind":"required", "type":["numeric"], "purpose":"# Items"},
{"name":"in3", "kind":"ordered", "type":["numeric"], "purpose":"Input Value"},
{"name":"Name1", "kind":"namevalue", "type":["logical","scalar"],"purpose":"Option"},
{"name":"Name2", "kind":"namevalue", "type":["char", "choices={'Default','Choice1','Choice2'}"]}
]
}
}
MATLAB uses this function signature description to inform code suggestions and completion.
To experiment with code suggestions, start to call myFunc from a script or live script. The names and
purposes from the JSON file appear. MATLAB indicates when arguments are optional and if there are
multiple suggestions available (such as the third positional argument or a name-value pair). Name-
value pairs options are listed.
32-18
Customize Code Suggestions and Completions
When adding a name-value pair argument to the function call, MATLAB presents the choices from the
JSON file. Since 'Name1' is defined as a logical scalar, MATLAB populates the choices automatically
(true or false). MATLAB takes the three values for the 'Name2' argument from the JSON file.
Multiple Signatures
If a function has many syntaxes, it can be helpful for code suggestions to group syntaxes as multiple
function signatures (regardless of the implementation of the function). To provide code suggestions
and completions for multiple signatures, create multiple function objects with the same property in
the JSON file.
Consider the following function that follows different code paths depending on the class of the second
input. This function is presented as an example for code suggestions, and, therefore, does not
perform any computations or error checking.
function anotherFunc(arg1,arg2,arg3)
switch class(arg2)
case 'double'
% Follow code path 1
case {'char','string'}
% Follow code path 2
otherwise
error('Invalid syntax.')
end
end
From a code suggestions perspective, consider the function as having two function signatures. The
first signature accepts two required numeric values. The second signature accepts a required
numeric, followed by a character or string, and finally a required numeric. To define multiple function
signatures, define multiple function objects in the JSON file with the same property (function name).
{
"_schemaVersion": "1.0.0",
"anotherFunc":
{
"inputs":
[
{"name":"input1", "kind":"required", "type":["numeric"]},
{"name":"input2", "kind":"required", "type":["numeric"]}
]
},
"anotherFunc":
{
"inputs":
[
{"name":"input1", "kind":"required", "type":["numeric"]},
{"name":"input2", "kind":"required", "type":[["char"],["string"]]},
{"name":"input3", "kind":"required", "type":["numeric"]}
]
}
}
32-19
32 Custom Help and Documentation
Alternatively, you can define multiple function signatures using the mutuallyExclusiveGroup
property of the argument object. Typically, it is easier and more readable to implement multiple
function objects, but using mutually exclusive groups enables reuse of common argument objects,
such as input1.
{
"_schemaVersion": "1.0.0",
"anotherFunc":
{
"inputs":
[
{"name":"input1", "kind":"required", "type":["numeric"]},
{"mutuallyExclusiveGroup":
[
[
{"name":"input2", "kind":"required", "type":["numeric"]}
],
[
{"name":"input2", "kind":"required", "type":[["char"],["string"]]},
{"name":"input3", "kind":"required", "type":["numeric"]}
]
]
}
]
}
}
See Also
validateFunctionSignaturesJSON
More About
• “Check Syntax as You Type”
External Websites
• https://www.json.org/
32-20
Display Custom Documentation
Overview
If you create a toolbox that works with MathWorks products, even if it only contains a few functions,
you can include custom documentation in the form of HTML help files. Custom documentation for
your toolbox can include figures, diagrams, screen captures, equations, and formatting to make your
toolbox help more usable.
• HTML help files — These files contain your custom documentation information.
• info.xml file — This file enables MATLAB to find and identify your HTML help files.
• helptoc.xml file — This file contain the Table of Contents for your documentation that displays
in the Contents pane of the Help browser. This file must be stored in the folder that contains your
HTML help files.
• Search database (optional) — These files enable searching in your HTML help files.
To view your custom documentation, open the Help browser and navigate to the home page. At the
bottom of the home page, under Supplemental Software, click the name of your toolbox. Your help
opens in the current window.
32-21
32 Custom Help and Documentation
• Create a live script (*.mlx) and export it to HTML. For more information, see “Share Live Scripts
and Functions” on page 19-57.
• Create a script (*.m), and publish it to HTML. For more information, see “Publish and Share
MATLAB Code” on page 23-2.
Store all your HTML help files and any additional custom documentation files (such as PNG and CSS
files) for your toolbox in one folder, such as an html subfolder in your toolbox folder. This folder must
be:
32-22
Display Custom Documentation
• A roadmap page (that is, an initial landing page for the documentation)
• Examples and topics that explain how to use the toolbox
• Function or block reference pages
To create info.xml to describe your toolbox, you can adapt this template:
<productinfo xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
xsi:noNamespaceSchemaLocation="optional">
<?xml-stylesheet type="text/xsl"href="optional"?>
<matlabrelease>R2016b</matlabrelease>
<name>MyToolbox</name>
<type>toolbox</type>
<icon></icon>
<help_location>html</help_location>
</productinfo>
You can also create info.xml by using the template info_template.xml included with the
MATLAB documentation. To create and edit a copy of the template file in your current folder, run this
code in the command window:
copyfile(fullfile(matlabroot,'help','techdoc','matlab_env',...
'examples','templates','info_template.xml'),pwd)
fileattrib('info_template.xml','+w')
edit('info_template.xml')
The following table describes the required elements of the info.xml file.
32-23
32 Custom Help and Documentation
You also can include comments in your info.xml file, such as copyright and contact information.
Create comments by enclosing the text on a line between <!-- and -->.
Note MATLAB parses the info.xml file and displays your documentation when you add the
folder that contains info.xml to the path. If you created an info.xml file in a folder already on
the path, remove the folder from the path. Then add the folder again, so that MATLAB parses the
file. Make sure that the folder you are adding is not your current folder.
You can create a helptoc.xml file by using the template included with the MATLAB documentation.
To create and edit a copy of the template file helptoc_template.xml in your current folder, run
this code in the Command Window:
copyfile(fullfile(matlabroot,'help','techdoc','matlab_env',...
'examples','templates','helptoc_template.xml'),pwd)
fileattrib('helptoc_template.xml','+w')
edit('helptoc_template.xml')
Place the helptoc.xml file in the folder that contains your HTML documentation files. This folder
must be referenced as the <help_location> in your info.xml file.
32-24
Display Custom Documentation
Each <tocitem> entry in the helptoc.xml file references one of your HTML help files. The first
<tocitem> entry in the helptoc.xml file serves as the initial landing page for your documentation.
Within the top-level <toc> element, the nested <tocitem> elements define the structure of your
table of contents. Each <tocitem> element has a target attribute that provides the file name. File
and path names are case-sensitive.
• The location of the helptoc.xml files is listed as the <help_location> in your info.xml file.
• All file and path names exactly match the names of the files and folders, including capitalization.
• All path names use URL file path separators (/). Windows style file path separators (\) can cause
the table of contents to display incorrectly. For example, if you have an HTML help page
firstfx.html located in a subfolder called refpages within the main documentation folder, the
<tocitem> target attribute value for that page would be refpages/firstfx.html.
</toc>
This helptoc.xml file, paired with a properly formulated info.xml file, produced this display in the
Help browser.
32-25
32 Custom Help and Documentation
For example, suppose that your HTML files are in C:\MATLAB\MyToolbox\html. This command
creates a searchable database for those files:
builddocsearchdb('C:\MATLAB\MyToolbox\html')
To search for terms in your toolbox, open the Help browser, and in the Search Documentation field,
enter the term you want to search for. Then, on the left side of the page, under Refine by Source,
select Supplemental Software to view the results for your toolbox.
Beginning with MATLAB R2014b, you can maintain search indexes side by side. For instance, if you
already have a search index for MATLAB R2014a or earlier, run builddocsearchdb against your
32-26
Display Custom Documentation
help files using MATLAB R2014b. Then, when you run any MATLAB release, the help browser
automatically uses the appropriate index for searching your documentation database.
When MATLAB finds an info.xml file on the search path or in the current folder, it automatically
validates the file against the supported schema. If there is an invalid construct in the info.xml file,
MATLAB displays an error in the Command Window. The error is typically of the form:
An info.xml validation error can occur when you start MATLAB or add folders to the search path.
If you do not list required XML elements in the prescribed order, you receive an XML validation error:
Often, errors result from incorrect ordering of XML tags. Correct the error by updating
the info.xml file contents to follow the guidelines in the MATLAB help documentation.
For a description of the elements you need in an info.xml file and their required ordering, see
“Create info.xml File” on page 32-23.
Suppose that you have a file named info.xml that has nothing to do with custom documentation.
Because this info.xml file is an unrelated file, if it causes an error, you can safely ignore it. To
prevent the error message from reoccurring, rename the unrelated info.xml file. Alternatively,
ensure that the file is not on the search path or in the current folder.
Use the error message to isolate the problem or use any XML schema validator. For more information
about the structure of the info.xml file, consult its schema at matlabroot/sys/namespace/
info/v1/info.xsd.
If you have an info.xml file from a different version of MATLAB, that file could contain constructs
that are not valid with your version. To identify an info.xml file from another version, look at the
full path names reported in the error message. The path usually includes a version number, for
example, ...\MATLAB\R14\.... In this situation, the error is not actually causing any problems, so
you can safely ignore the error message. To ensure that the error does not reoccur, remove the
offending info.xml file. Alternatively, remove the outdated info.xml file from the search path and
out of the current folder.
32-27
32 Custom Help and Documentation
See Also
Related Examples
• “Display Custom Examples” on page 32-29
• “Create and Share Toolboxes” on page 25-11
• “Add Help for Your Program” on page 20-5
32-28
Display Custom Examples
• Create a live script (*.mlx) and export it to HTML. For more information, see “Share Live
Scripts and Functions” on page 19-57.
• Create a script (*.m), and publish it to HTML. For more information, see “Publish and Share
MATLAB Code” on page 23-2.
Store all your example files and any supporting files (such as PNG and CSS files) for your toolbox
in the folder (of a subfolder of the folder) that contains your demos.xml file. This folder must be:
For example, suppose that you have a toolbox named My Sample, which contains a script named
my_example that you published to HTML. This demos.xml file allows you to display
my_example:
<?xml version="1.0" encoding="utf-8"?>
<demos>
<name>My Sample</name>
<type>toolbox</type>
<icon>HelpIcon.DEMOS</icon>
<description>This text appears on the main page for your examples.</description>
<website><a href="https://www.mathworks.com">Link to your Web site</a></website>
<demosection>
<label>First Section</label>
<demoitem>
<label>My Example Title</label>
<type>M-file</type>
<source>my_example</source>
</demoitem>
</demosection>
</demos>
3 View your examples.
In the Help browser, navigate to the home page. At the bottom of the page, under Supplemental
Software click the link for your example. Your example opens in the main help window.
32-29
32 Custom Help and Documentation
If your examples do not display under Supplemental Software, the demos.xml file might
contain an invalid construct.
Within the demos.xml file, the root tag is <demos>. This tag includes elements that determine the
contents of the main page for your examples.
In previous releases, this icon was the icon for your example. In
those releases, you can use a standard icon, HelpIcon.DEMOS. Or,
you can provide a custom icon by specifying a path to the icon
relative to the location of the demos.xml file.
<description> The description that appears on the main page for your examples.
32-30
Display Custom Examples
Optionally, define categories for your examples by including a <demosection> for each category. If
you include any categories, then all examples must be in categories.
Each <demosection> element contains a <label> that provides the category name, and the
associated <demoitem> elements.
See Also
patchdemoxmlfile
Related Examples
• “Display Custom Documentation” on page 32-21
32-31
33
Projects
Create Projects
Projects can help you organize your work and collaborate. Projects promote productivity and
teamwork by helping you with common tasks.
Create Project
To create a blank project, on the Home tab, click New > Project > Blank Project. To create a
project from an existing folder, on the Home tab, click New > Project > From Folder.
The New Project dialog box opens. Enter a project name, select a project folder, and click Create.
Open Project
To open an existing project, on the Home tab, click Open and browse to an existing project .prj file.
Alternatively, in the Current Folder browser, double-click the project .prj file.
Note To avoid conflicts, you can have only one project open at a time. If you open another project,
any currently open project closes.
To open a recent project, on the Home tab, click the Open arrow and select your project under the
Recent Projects list.
33-2
Create Projects
Set up Project
After you create a project, the Welcome to your project dialog box opens and prompts you to set up
the project.
2 In the Set Up Project (Step 1 of 2) dialog box, you can choose folders to add to the project path.
Adding project folders to the project path ensures that all users of the project can access the files
within them. MATLAB adds these folders to the search path when you open the project, and
removes them when you close the project.
To add all the folders in project folder to the project path, click Add with Subfolders and then
select the root project folder containing all your subfolders.
For more information about adding folders to the project path, including how to add them after
completing the project setup, see “Specify Project Path” on page 33-8.
33-3
33 Projects
3 After specifying the project path, click the Next button to continue.
4 In the Set Up Project (Step 2 of 2) dialog box, you can specify startup and shutdown files. Startup
files help you set up the environment for your project. Shutdown files help you clean up the
environment when you are done. Use shutdown files to undo the setup that occurs in startup
files.
Use the Add and Remove buttons to manage the startup and shutdown file lists. The files run
from the top down. If the order in which the files are run is important, use the arrow buttons to
move files up or down in the list.
For more information about specifying startup and shutdown files, including how to specify them
after completing the project setup, see “Specify Startup and Shutdown Files” on page 33-8.
33-4
Create Projects
5 Click Finish to complete the project setup and open your new project.
To create a new file or folder in the project, in the Files view, right-click in white space and select
New Folder or New File. The new file or folder is created and added to the project.
To add existing files to a project, on the Project tab, click the down arrow to expand the Tools
gallery. Under Project Files, click Add Files. Then, select from the list of files in the project folder
that are not yet added to the project. To add existing files from the Files view, click All. Then, right-
click one or more files and folders, and select Add to Project or Add Folder to Project (Including
Child Files). To add existing files from a file browser or the Current Folder browser, cut and paste or
drag and drop the files into the project Files view. If you drag a file from outside the project root
folder, this moves the file and adds it to your project. Drag files within the project root to move them.
To add and remove project files programmatically, use the addFile function.
You might not want to include all files in your project. For example, you might want to exclude some
files in the project root folder, such as SVN or CVS source control folders. To determine which files
need to be included in your project, see “Analyze Project Dependencies” on page 33-33.
33-5
33 Projects
Some projects are shared as archived projects. An archived project is useful for sharing with users
who do not have access to a connected source control tool. To view and edit the contents of an
archived project, create a new project from the archived project.
To create a new project from an archived project, in the Current Folder browser, double-click the
archived project file which has an .mlproj extension. The Extract Project dialog box opens. Specify
the location for the new project and click Select Folder. For example, C:\myNewProject.
The new project opens. The current folder (for example, C:\myNewProject) contains the imported
project folders. If the archived project contains referenced projects, MATLAB imports files into two
subfolders, mains and refs. The mains project folder (for example, C:\myNewProject\mains)
contains the project folders. The refs folder (for example C:\myNewProject\refs) contains the
referenced project folders.
If you have Simulink, you can use a Simulink template to create and reuse a standard project
structure.
1 On the Home or Project tab, click New > Project > From Simulink Template. The Simulink
Start Page opens.
2 The start page shows all project templates (*.sltx) on the MATLAB path. Select a template in
the list to read the template description.
If your templates do not appear, locate them by clicking Open. In the Open dialog box, make
*.sltx files visible by setting the file type to All MATLAB files, and browse to your template.
3 Select a template and click Create Project. The Create Project dialog box opens.
Templates created in R2017b or later warn you if required products are missing. Click the links
to open Add-On Explorer and install required products.
4 Specify the root project folder, edit the project name, and click Create Project.
To use project templates created in R2014a or earlier (.zip files), upgrade them to .sltx files using
Simulink.exportToTemplate.
33-6
Create Projects
See Also
More About
• “Manage Project Files” on page 33-13
• “Analyze Project Dependencies” on page 33-33
• “Share Projects” on page 33-26
• “Use Source Control with Projects” on page 33-48
• “Create and Edit Projects Programmatically” on page 33-59
33-7
33 Projects
More specifically, when you open a project, MATLAB changes the current folder to the project startup
folder, and runs (.m and .p files) or loads (.mat files) any specified startup file. For more information
about configuring the startup folder, see “Set Startup Folder” on page 33-8.
To add a folder to the project path, on the Project tab, in the Environment section, click Project
Path. Click Add Folder and select the folder that you want to add. To add a folder and all of its
subfolders, click Add with Subfolders.
To remove a folder from the project path, select the folder from the displayed list and click Remove.
You also can add or remove a folder from the project Files view. Right-click the folder, select Project
Path, and select from the available options.
Folders on the project path appear with the project path icon in the Status column of the Files
view.
To edit the project startup folder, on the Project tab, in the Environment section, click Details.
Then, in the Start up section, enter a path for the project startup folder.
To stop a file from running at startup or shutdown, right-click the file and select Remove from
Startup or Remove from Shutdown.
Alternatively, go to the Project tab and click Startup Shutdown. Then, in the Manage Project
Startup and Shutdown dialog box, use the Add and Remove buttons to manage the startup and
shutdown file lists. The files run from the top down. If the order in which the files are run is
important, use the arrow buttons to move files up or down in the list.
33-8
Automate Startup and Shutdown Tasks
Note Startup and shutdown files are included when you commit modified files to source control.
When you configure startup and shutdown files, they run for all other project users.
Startup files can have any name except startup.m. A file named startup.m on the MATLAB path
runs when you start MATLAB. If your startup.m file calls the project, an error occurs because the
project is not yet loaded. For more information about using startup.m files, see “Startup Options in
MATLAB Startup File”.
To create new startup and shutdown files programmatically, see addStartupFile and
addShutdownFile.
In Simulink, you can specify additional project startup options. For more information, see “Automate
Startup Tasks” (Simulink).
See Also
addStartupFile
More About
• “Manage Project Files” on page 33-13
• “Create and Edit Projects Programmatically” on page 33-59
• “What Is the MATLAB Search Path?”
33-9
33 Projects
On the Home tab, in the Environment section, click Preferences. Select MATLAB > Project.
Then, adjust preference options as described in this table. Not all project preferences are available in
MATLAB Online.
Preference Usage
New Projects To specify where to create new projects, in Default folder, browse to a
folder on your system.
To specify the Project definition files type for new projects, select an
option based on your use case:
For details, see “Manage Shadowed and Dirty Models and Other Project
Files” (Simulink).
Project Shutdown To receive a warning about files with unsaved changes when closing a
project, select Interrupt project close if there are dirty project files.
To automatically close project models when closing a project unless the
project models contain unsaved changes, select Check for open project
models and close them, unless they are dirty.
File Management To disable the message that lists which files have changed after calling
update to get the latest revisions from your SVN repository, clear Show
changes on source control updates.
To disable automatic updates when renaming, deleting, or removing files
in a project, clear Detect project-wide references when renaming,
removing and deleting files.
33-10
Set MATLAB Projects Preferences
Preference Usage
To disable the project prompt and analysis when renaming buses or bus
elements while keeping automatic updates enabled for other files, clear
Detect project-wide references when renaming Simulink buses and
bus elements.
To choose what files a project should check for conflict markers, specify
Conflict marker detection when loading project files. Select one of
the available options:
33-11
33 Projects
See Also
More About
• “Create Projects” on page 33-2
• “Manage Project Files” on page 33-13
• “Project Definition Files” on page 33-53
• “Manage Shadowed and Dirty Models and Other Project Files” (Simulink)
33-12
Manage Project Files
Action Procedure
View project files. In the Files view, click Project to display only the files and
folders that are included in the project.
View all files in a project folder. To display all files and folders in the project folder, in the Files
view, click All.
You might not want to include all files in your project. For
example, you might want to exclude SVN or CVS source control
folders. For more information, see “Work with Derived Files in
Projects” on page 33-57.
Create a new project folder. In the Files view, right-click in white space, and then click New
> Folder.
Add files to a project. On the Project tab, click the down arrow to expand the Tools
gallery. Under Project Files, click Add Files. Select from the
list of unmanaged files in the project folder.
You also can paste or drag files and folders from your operating
system file browser or the Current Folder browser to the
project Files view. When you drag a file to the Files view,
MATLAB adds the file to the project.
33-13
33 Projects
Action Procedure
Undo or redo an action
Click or at the upper right corner of the toolstrip.
When renaming files, the project offers to automatically update references to the file. Automatically
updating references to a file when renaming prevents errors that result from changing names or
paths manually and overlooking or mistyping the name.
For example:
• When renaming a class, the project offers to automatically update all classes that inherit from it.
• When renaming a .m or .mlx file, the project offers to automatically update any files and
callbacks that call it.
• When renaming a C file, the project prompts you to update the S-function that uses it.
You can disable the automatic updates when renaming, deleting, or removing files in a project. On the
MATLAB Home tab, in the Environment section, click Preferences. Select MATLAB > Project and
clear the Detect project-wide references when renaming, removing, and deleting files option.
For more information about automatic updates when renaming, deleting, or removing Simulink files
such as library links, model references, and model callbacks, see “Automatic Updates When
Renaming, Deleting, or Removing Files” (Simulink).
See Also
More About
• “Find Project Files” on page 33-15
• “Add Labels to Project Files” on page 33-19
• “Create Custom Tasks” on page 33-21
33-14
Find Project Files
For example, to group files by type, in the Layout field, select List. Then, click the Actions button
and select Group By > Type. To sort the grouped files by size, click the actions button and select
Sort By > Size.
To search for a file or folder, in the search field at the top of the view, begin typing the file or folder
name. The asterisk character (*) is a wildcard. For example, to show only file names that begin with
coll and have a .m extension, type coll*.m.
To filter the files and folders in the current view, click the Filter button next to the search field. In
the Filter Builder dialog box, select the names, file types, project statuses, and labels to filter by.
Click Apply to filter the files and folders in the current view. The search field displays the applied
filter.
To clear a search or filter, click the Clear button to the right of the search field.
33-15
33 Projects
1 On the Project tab, click the down arrow to expand the Tools gallery. Under Project Files, click
Search. The Search Inside Project Files dialog box opens.
2 Enter the text to search. MATLAB searches the project files for the exact text in the search field
and displays the results.
See Also
More About
• “Manage Project Files” on page 33-13
• “Create Shortcuts to Frequent Tasks” on page 33-17
• “Add Labels to Project Files” on page 33-19
33-16
Create Shortcuts to Frequent Tasks
Run Shortcuts
To run a shortcut, in the Project Shortcuts tab, click the shortcut. Clicking a shortcut in the Project
Shortcuts tab performs the default action for the file type. For example, MATLAB runs .m shortcut
files and loads .mat shortcut files. If the shortcut file is not on the path, MATLAB changes the current
folder to the parent folder of the shortcut file, runs the shortcut, and then changes the current folder
back to the original folder.
Alternatively, in the Files view, you can right-click the shortcut file and select Run. If the script is not
on the path, then MATLAB asks if you want to change folder or add the folder to the path.
Create Shortcuts
To create a shortcut from an existing project file:
1 In the Files view, right-click the file and select Create Shortcut. Alternatively, on the Project
Shortcuts tab, click New Shortcut and browse to select a file.
The shortcut appears with the selected name and icon on the Project Shortcuts tab. In the Files
view, the Status column displays an icon indicating that the file is a shortcut.
Note Shortcuts are included when you commit your modified files to source control, so you can share
shortcuts with other project users.
Organize Shortcuts
You can organize shortcuts by categorizing them into groups. For example, you might create one
group of shortcuts for loading data, another for opening files, another for generating code, and
another for running tests.
33-17
33 Projects
1 On the Project Shortcuts tab, right-click a shortcut and select Edit Shortcut. Alternatively, in
the Files view, right-click a file and select Edit Shortcut.
See Also
More About
• “Manage Project Files” on page 33-13
• “Find Project Files” on page 33-15
• “Add Labels to Project Files” on page 33-19
33-18
Add Labels to Project Files
Add Labels
To add a label to a project file, in the Files view, select the file. Then, drag the desired label from the
Labels panel at the bottom left of the project into the Label Editor panel for the selected file. The
Label Editor panel is located at the bottom right of the Files view. To restore the panel if it is
minimized, click the icon.
To add a label to multiple project files, in the Files view or in the Dependency Analyzer graph, select
the files, right-click, and select Add Label. Choose a label from the list and click OK.
Note After you add a label to a file, the label persists across file revisions.
To add labels programmatically (for example, in custom task functions) see addLabel.
To change a label that belongs to a single-valued category, select the new value from the label list.
You can add additional annotations to labels from categories that you create. In the Label Editor
panel, click a label and insert or modify text. Then, click Apply.
33-19
33 Projects
Create Labels
Labels exist in two types of categories:
• Single-valued — You can attach only one label from the category to a file.
• Multi-valued — You can attach multiple labels from the category to a file.
All projects contain a built-in label category called Classification with several built-in labels. These
built-in labels are read-only.
1 In the Labels panel at the bottom left of the project, right-click and select Create New
Category. The Create Category dialog box opens.
2 Enter a name for the new category.
3 To create a single-valued label category, select the Single Valued check box. Otherwise,
MATLAB creates a multi-valued label category.
4 To specify a label data type other than the default String data type, from the Type list, select
from the available options.
5 Click Create.
1 In the Labels panel at the bottom left of the project, right-click the label category and select
Create New Label. The Create Label dialog box opens.
2 Enter a name for the new label and click OK.
See Also
More About
• “Manage Project Files” on page 33-13
• “Find Project Files” on page 33-15
33-20
Create Custom Tasks
1 On the Project tab, click the down arrow to expand the Tools gallery. Under Project Checks,
click Custom Tasks. In the Custom Task dialog box, click Manage.
2 Click Add and then select Add Using New Function. If you want to add an existing script as a
custom task, select Add Using Existing Function.
3 Specify a file name for the script and save the new file on the MATLAB path. The MATLAB Editor
opens the new file containing an example custom task function.
4 Edit the function to perform the desired action on each file. Use the instructions at the top of the
file to guide you to create a custom task with the correct function signature. Your custom tasks
must accept a full path to a file as the single input argument and return a single output
argument.
For example, this custom task function extracts Code Analyzer information for each file using the
checkcode function.
[~,~,ext] = fileparts(file);
switch ext
case {'.m', '.mlx', '.mlapp'}
result = checkcode(file, '-string');
otherwise
result = [];
end
5 Save the file.
You can use the MATLAB editor to set breakpoints and debug a custom task function, just as with any
other MATLAB function.
1 On the Project tab, click the down arrow to expand the Tools gallery. Under Project Checks,
click Custom Tasks.
2 In the Include column of the table, select which project files you want to run the custom task on.
To include or exclude multiple files in the table at once, press the Shift or Ctrl key, select the
files, and then right-click and select Include or Exclude. If the custom task function can identify
the files to operate on, include all files.
3 In the Custom task field, select from the available custom task functions. You also can enter the
name of a task directly in the field, or click Browse.
33-21
33 Projects
4 Click Run Task to run the task. The Custom Task Report window displays the results.
5 Examine the Results column in the table to ensure that the custom task ran correctly on all files.
To view detailed result information for a file, select the file in the table. The results pane at the
bottom of the Custom Task Report displays the details.
To save the Custom Task Report, click the Publish Report button at the bottom of the Custom Task
Report. You can either save the report as an HTML file or a Microsoft Word file. If you have MATLAB
Report Generator™, you also can save the report as a PDF file.
To see the report file and add it to your project, switch to the All files view.
See Also
More About
• “Create Shortcuts to Frequent Tasks” on page 33-17
• “Manage Project Files” on page 33-13
33-22
Componentize Large Projects
Projects can reference multiple other projects in a hierarchical manner. The project reference
hierarchy appears as a tree in the References view.
• Access the project paths, entry-point shortcuts, and source control information for all referenced
projects.
• View, edit, and run files that belong to a referenced project.
• Detect changes in referenced projects using checkpoints.
1
On the Project tab, in the Environment section, click References. The Add Reference
dialog box opens.
2 Browse to select the required project (.prj) file.
3 In the Reference type field, select either Relative or Absolute. Select Relative if your project
hierarchy has a well-defined root relative to your project root. For example, your project root
might be a folder under source control. Select Absolute if the project you want to reference is in
a location accessible to your computer, for example, a network drive.
4 To create a checkpoint when you add the project, select Set a checkpoint to detect future
changes. For more information about checkpoints, see “Manage Changes in Referenced Project
Using Checkpoints” on page 33-24.
5 Click Add.
When the referenced project loads, MATLAB adds the referenced project path to the MATLAB search
path and then runs or loads specified startup files. Similarly, when the referenced project closes,
MATLAB removes the project path from the search path and runs specified shutdown files. MATLAB
loads referenced projects before their parent projects. This allows the parent project to access the
referenced project in startup and shutdown files.
To remove a referenced project from your project hierarchy, in the References tree, right-click the
referenced project and select Remove Reference.
33-23
33 Projects
To view a referenced project, in the parent project, select the References view. In the References
tree, select a referenced project.
To display the referenced project files, at the top right of the References view, click Show Files.
To modify or run a file, right-click the file and select from the list of available options.
To extract a folder from a project and convert the folder into a referenced project:
1 In the Files view, right-click the folder and select Extract to Referenced Project. The Extract
Folder to New Project dialog box opens.
2 Specify a project name and location
3 In the Reference type field, select either Relative or Absolute. Select Relative if you specify
the new project location with reference to the current project root. Select Absolute if you specify
the full path for the new location, which is, for example, on a network drive
4 To disable any of the default content migration actions, click More Options and clear the
corresponding check boxes.
5 Click Extract.
6 In the two Warning dialog boxes that open, click OK.
The selected folder and its contents are removed from the project. On the Project Shortcuts tab, the
Referenced Projects section shows a new shortcut for the referenced project.
By default, MATLAB creates a checkpoint when you add a reference to a project. To create additional
checkpoints:
To detect changes in a referenced project, go to the References tab, and in the Checkpoint section,
click Checkpoint Report. The Difference to Checkpoint dialog box displays the files that have
changed on disk since you created the checkpoint.
To remove the checkpoint, in the Checkpoint section of the References tab, click Clear.
33-24
Componentize Large Projects
See Also
More About
• How to Organize Large Projects into Components (3 min, 32 sec)
• “Create Projects” on page 33-2
• “Share Projects” on page 33-26
33-25
33 Projects
Share Projects
You can collaborate with others by packaging and sharing projects. You can also control which files
are included in a shared project by using labels and an export profile. (For more information, see
“Create an Export Profile” on page 33-29.)
To archive a project:
1 With the project loaded, on the Project tab, click Share >
Archive.
2 If you want to export only a set of specified files, choose an
Export profile. For more information, see “Create an Export
Profile” on page 33-29.
3 If you have referenced projects and want to export the
referenced project files, select Include referenced projects.
4 Click Save As and specify a file path.
5 In the Save as type field, select the archived project file type.
By default, MATLAB archives the project as an .mlproj file.
You can choose to archive the project as a ZIP file.
6 Click Save to create the project archive.
You can now share the archive file the way you would any other
file.
33-26
Share Projects
1 With the project loaded, on the Project tab, select Share >
Email.
2 If you want to export only a set of specified files, choose an
Export profile. For more information, see “Create an Export
Profile” on page 33-29.
3 If you have referenced projects and want to export the
referenced project files, select the Include referenced
projects check box.
4 Click Attach to Email. MATLAB opens a new email in your
default email client with the project attached as an .mlproj
file.
5 Edit and send the email.
Create a toolbox to share. You can create a toolbox from your project and share the toolbox
with collaborators.
The packager adds all project files to the toolbox and opens
the Package a Toolbox dialog box.
2 The Toolbox Information fields are populated with the
project name, author, and description. Edit the information as
needed.
3 To include files not already included in the project files, edit
the excluded files and folders.
4 Click Package.
You can now share the toolbox file the way you would any other
file.
33-27
33 Projects
To view the URL for the remote repository, on the Project tab, in
the Source Control section, click the Git Details button.
Before sharing a project with others, it can be useful to examine the required add-ons for your project
by performing a dependency analysis. For more information, see “Find Required Products and Add-
Ons” on page 33-42.
33-28
Share Projects
Note Export profiles do not apply changes to referenced projects. When you share your project,
MATLAB exports the entire referenced projects.
See Also
More About
• “Add Labels to Project Files” on page 33-19
• “Create Projects” on page 33-2
• “Analyze Project Dependencies” on page 33-33
33-29
33 Projects
Upgrade Projects
The Upgrade Project tool helps you check for compatibility issues or upgrade your project to the
current MATLAB release. The tool applies fixes automatically when possible and produces a report.
Tip To perform an upgrade that you can later revert if necessary, add source control to your project
before upgrading. For more information, see “Use Source Control with Projects” on page 33-48.
If you want to run the Project Upgrade tool without applying fixes automatically, clear Apply
upgrades automatically.
If you want to specify which files to upgrade and which checks to run, click Change Options. In
the Upgrade Options dialog box, clear the check box for any file or check that you want to exclude
33-30
Upgrade Projects
from the upgrade. For example, you might want to exclude checks that require performing an
update diagram, as this can be time consuming.
The Upgrade Project tool displays the results of the compatibility check or upgrade in the Upgrade
Project Report.
The summary shows how many files passed all of the upgrade checks and how many files require
attention. To view the upgrade results for a file, select the file in the left file list. By default, the file
list shows any files that need attention. To change which files are shown, select from the options in
the Show drop-down.
For each file in the Project Upgrade Report, examine the checks marked as needing attention. These
files are marked with an orange circle icon in the Result column. Select a check in the Check Name
column to display the check results and any automatically applied fixes in the lower panel.
To see the differences before and after the upgrade, in the Upgrade Project Report, click View
Changes. If your project is under source control, you also can see the differences by comparing the
before and after versions of the file.
33-31
33 Projects
MATLAB saves an HTML report of the upgrade results in the project root folder. To open the saved
report, click the Report link at the top of the Upgrade Project Report.
See Also
More About
• “Use Source Control with Projects” on page 33-48
• “Analyze Project Dependencies” on page 33-33
33-32
Analyze Project Dependencies
To explore a project and visualize its structure using different views, see “Explore the Dependency
Graph, Views, and Filters” on page 33-35.
To find and fix problems in your project, see “Investigate and Resolve Problems” on page 33-40.
To assess how a change will affect other project files, see “Find File Dependencies” on page 33-43.
To find add-ons and products required by your project to run properly, see “Find Required Products
and Add-Ons” on page 33-42.
To start analyzing your project, on the Project tab, in the Tools gallery, click Dependency Analyzer.
Alternatively, in the project Views pane, select Dependency Analyzer and click Analyze.
To analyze the dependencies of specific files, in the dependency graph, select the files. In the Impact
Analysis section, click All Dependencies or use the context menu and select Find All
Dependencies.
To analyze the dependencies inside add-ons, select Analyze > Add-Ons. For more details about
available options, see “Analysis Scope” (Simulink).
You can also check dependencies directly in Project. In the Project Files view, right-click the project
files you want to analyze and select Find Dependencies.
33-33
33 Projects
• Your project structure and its file dependencies, including how files such as models, libraries,
functions, data files, source files, and derived files relate to each other.
• Required products and add-ons.
• Relationships between source and derived files (such as .m and .p files, .slx and .slxp, .ssc
and .sscp, or .c and .mex files), and between C/C++ source and header files. You can see what
code is generated by each model, and find what code needs to be regenerated if you modify a
model.
• Warnings about problem files, such as missing files, files not in the project, files with unsaved
changes, and out-of-date derived files.
You can examine project dependencies and problem files using the File List. In the toolstrip, click
File List.
After you run the first dependency analysis of your project, subsequent analyses incrementally update
the results. The Dependency Analyzer determines which files changed since the last analysis and
updates the dependency data for those files. However, if you update add-ons or installed products and
want to discover dependency changes in them, you must perform a complete analysis. To perform a
complete analysis, in the Dependency Analyzer, click Analyze > Reanalyze All.
For more information about running a dependency analysis on Simulink models and libraries, see
“Perform an Impact Analysis” (Simulink).
33-34
Analyze Project Dependencies
By default, the dependency graph shows all files required by your project. To help you investigate
dependencies or a specific problem, you can simplify the graph using one of the following filters:
• Use the filtered Views to color the files in the graph by type, class, source control status, and
label. See “Color Files by Type, Status, or Label” on page 33-36.
• Use the check boxes in the Legend pane to filter out a group of files.
• Use the Impact Analysis tools to simplify the graph. See “Find File Dependencies” on page 33-
43.
To select all files of a certain type, hover the pointer over the corresponding item in the Legend
pane and click the Add to selection icon.
To remove all files of a certain type from the current selection, hover the pointer over the
corresponding item in the Legend pane and click the Remove from selection icon.
• To open a file, double-click it.
• To pan the dependency graph, hold the Space key, click and drag the mouse. Alternatively, press
and hold the mouse wheel and drag.
To see more information about how two files are related, select their dependency arrow. In the
Properties pane, in the Details section, you can see the full paths of the files you are examining, the
dependency type (such as function call, inheritance, and property type), and where the dependency is
introduced.
33-35
33 Projects
To open the file and highlight where the dependency is introduced, in the Details section, click the
link under Impacted.
Explore the different views in the Views section of the Dependency Analyzer toolstrip to explore your
project files dependencies.
• The MATLAB Files view shows only MATLAB files (such as .m, .mlx, .p, .mlapp, .fig, .mat,
and .mex) in the view and colors them by type.
• The Class Hierarchy view shows the class inheritance graph and colors the files by type (class,
enumeration class, or abstract class). If the class is not on the search path, the Dependency
Analyzer cannot determine the class type.
33-36
Analyze Project Dependencies
• The Classification view shows all files in the graph and colors them by file label (such as test,
design, and artifact).
Use the classification view to identify which tests you need to run to validate the changes in your
design. For more information, see “Identify Tests to Run” on page 33-44.
33-37
33 Projects
• The Source Control view shows all files in the graph and colors them by source control status.
This view is only enabled if your project is under source control.
Use the source control view to find modified files in your project and to examine the impact of
these changes on the rest of the project files. For more information, see “Investigate Impact of
Modified Files” on page 33-44.
33-38
Analyze Project Dependencies
This is equivalent to manually removing all of the filters. Filters appear at the top of the graph. For
example, if you have the Source Control view selected, you can remove it by clicking
In large projects, when investigating problems or dependencies, use the different filters to show only
the files you want to investigate:
• To filter out a subgroup of files from the graph, such as files labeled test or modified files, use the
check boxes in the Legend pane. To remove the legend filter, click the Legend Filter
.
• To color the files in the graph by type, class, label, or source control status, use the Views. To
remove the view filter, click View: viewName at the top of the graph . For example, if you have the
.
• To clear all filters and restore the graph to show all analyzed dependencies in the project, click
Restore to Default. Alternatively, manually remove all filters at the top of the graph.
33-39
33 Projects
1 In the Properties pane, in the Problems section, point to a problem, such as File not in
project, and click the magnifying glass icon . The graph highlights the files with this specific
problem.
To go through these files, use the arrows in the search box (e.g., Problem: File not in
project).
2 To see more information about a specific problem file, select the file in the graph. In the
Properties pane, in the Problems section, you can see details including the path, type, and the
problems for this file.
For example, if a file is File not in project, right-click the problem file in the graph and
select Add to Project.
33-40
Analyze Project Dependencies
3 Investigate the next problem listed in the Problems section. Repeat the steps until you resolve
all problems. For more details on how to fix problems, see “Resolve Problems” on page 33-41.
Tip For large projects, viewing the results in a list can make navigation easier.
For large projects, use the File List to investigate your project problem files.
The File List shows only files with the specific problem. Select all the files in the list and use the
context menu to Add to Project.
3 Investigate the next problem listed in the Problems section, for example Missing file. Repeat
the steps until you resolve all problems.
Resolve Problems
For each problem file, take actions to resolve the problem. This table lists common problems and
describes how to fix them.
33-41
33 Projects
In the Dependency Analyzer, in the Properties pane, the Product section displays the required
products for the whole project. To view products required by a specific file, select a file by clicking
the graph.
To find which file is introducing a product dependency, point to the product name and click the
magnifying glass icon . The graph highlights the files that use the selected product.
33-42
Analyze Project Dependencies
To go through these files, use the arrows in the search box (e.g., Files using "productName").
To investigate further, you can list the files that use a product and examine where in these files the
dependency is introduced. In the Products section, in the Properties pane, point to product and
If a required product is missing, the products list labels it as missing. The product is also listed in the
Problems section as productName not installed. To resolve a missing product, install the product
and rerun the dependency analysis.
• In the Impact Analysis section, click All Dependencies. The graph shows the selected file and
all its dependencies.
• To show only files needed by the selected file to run properly, click Required.
• To show only files impacted by a potential change to the selected file, click Impacted.
Finding these dependencies can help you identify the impact of a change and identify the tests you
need to run to validate your design before committing the changes.
To investigate the dependencies of multiple files, click files while holding the Shift key. The Impact
Analysis section displays how many files are selected.
33-43
33 Projects
To reset the graph, click the filter at the top of the graph. For example, if you had filtered by files
To examine the impact of the changes you made on the rest of the project files, perform an impact
analysis on the modified files in your project.
1 In the Views section, select the Source Control view. The graph colors the files by their source
control status. The modified files are in light blue.
2 Select all the modified files in the graph.
Alternatively, add all modified files to selection by clicking the Add to selection icon of an item
in the Legend pane.
Tip If you changed a large number of files, you can also use the file list.
In the Dependency Analyzer toolstrip, click File List. Point to Status and click the arrow to sort
the list by the source control status. Select all the modified files.
3 In the Impact Analysis section, click Impacted. Alternatively, use the context menu and select
Find Impacted.
To identify the tests you need to run to validate your design before committing the changes, use the
Classification view when you perform an impact analysis on the file you changed.
33-44
Analyze Project Dependencies
1 In the Views section, select the Classification view. The graph colors the files by their project
label.
2 Select the file you changed, for example timesTableGame.m.
3 In the Impact Analysis section, click Impacted. Alternatively, use the context menu and select
Find Impacted.
The example graph shows three tests you need to run to qualify the change made to
timesTableGame.m.
Tip You can compare different analysis results without having to repeat the analysis. To compare
previously saved graphs, in MATLAB, in the Current Folder, right-click two GraphML files and
select Compare Selected Files/Folders.
To export a subset of files in the graph, select the files, then click Export.
• Use the Legend check boxes, the filtered Views, or the Impact Analysis tools to simplify the
graph.
33-45
33 Projects
The menu displays how many files are selected. The Dependency Analyzer exports only the selected
files.
Note When you use Package As Archive, the Dependency Analyzer includes the selected files and
all their dependencies in the archive.
You can send files to other Project tools using the Project menu. The Dependency Analyzer exports
only the selected files in the current filtered view.
Select the desired files. In the Dependency Analyzer toolstrip, in the Export section, click Project.
Select from the available options:
• Show in Project — Switch to the project Files view with the files selected.
• Send to Custom Task — Run a project custom task on the selected files.
See Also
More About
• “Share Projects” on page 33-26
• “Use Source Control with Projects” on page 33-48
33-46
Clone from Git Repository
1 On the Home tab, click New > Project > From Git. The New Project From Source Control
dialog box opens.
2 Enter your HTTPS repository path into the Repository path field.
3 In the Sandbox field, select the working folder where you want to put the retrieved files for your
new project.
4 Click Retrieve.
If an authentication dialog box for your repository appears, enter the login information for your
Git repository account -- for instance, your GitHub user name and personal access token.
If your repository already contains a project, the project is ready when the tool finishes retrieving
files to your selected sandbox folder.
If your sandbox does not yet contain a project, then a dialog box asks whether you want to create
a project in the folder. To create a project, specify a project name and click OK. The Welcome
screen appears to help you set up your new project. For more information about setting up a
project, see “Set up Project” on page 33-3.
You can now add, delete, and modify your project files. For details on how to commit and push the
modified project files, see “Commit Modified Project Files” on page 33-54.
Tip Alternatively, to prevent frequent login prompts when you interact with your remote repository,
you can clone a remote repository using SSH instead of HTTPS. To avoid problems connecting using
SSH, set the HOME environment variable and use it to store your SSH keys. For more information, see
“Use SSH Authentication with MATLAB” on page 34-23.
If you encounter errors like OutOfMemoryError: Java heap space when cloning large Git
repositories, edit your MATLAB preferences to increase the heap size.
See Also
Related Examples
• “Use SSH Authentication with MATLAB” on page 34-23
• “Commit Modified Project Files” on page 33-54
33-47
33 Projects
Projects integrate with two source control systems, Git and Subversion (SVN).
Then, when your project is under source control, you can perform operations from within MATLAB
such as checking files in and out, running checks, and committing and reverting changes.
Create a new local copy of a project from an existing repository by retrieving files from source
control. You can clone a Git repository, or check out files from an SVN repository, or use another
source control integration.
1 On the Home tab, click New > Project > From Git or New > Project > From SVN. The New
Project From Source Control dialog box opens.
2 If you know your repository location, paste it into the Repository path field.
Otherwise, to browse for and validate the repository path to retrieve files from, click Change.
a In the dialog box, specify the repository URL by entering or pasting a URL into the field, by
33-48
Use Source Control with Projects
3 In the Sandbox field, select the working folder where you want to put the retrieved files for your
new project. With SVN, use a local folder for best results, because using a network folder is slow.
4 Click Retrieve.
If your repository already contains a project, the project is ready when the tool finishes retrieving
files to your selected sandbox folder.
If your sandbox does not yet contain a project, then a dialog box asks whether you want to create
a project in the folder. To create a project, specify a project name and click OK. The Welcome
screen appears to help you set up your new project. For more information about setting up a
project, see “Set up Project” on page 33-3.
If you encounter errors like OutOfMemoryError: Java heap space when cloning large Git
repositories, edit your MATLAB preferences to increase the heap size.
1 On the Home tab, in the Environment section, click Preferences.
2 Select MATLAB > General > Java Heap Memory.
3 Move the slider to increase the heap size, and then click OK.
4 Restart MATLAB.
If you have an existing project, you can add it to Git or SVN source control.
Click Validate to check the path to the selected repository, and then click OK.
5 Click Convert to finish adding the project to source control.
The project displays details of the current source control tool and the repository location.
7 If you created a new repository, select the Files > Modified view and click Commit to commit
the first version of your files to the new repository. In the dialog box, enter a comment if you
want, and click Submit.
If you want to merge branches with Git, you need to follow additional setup steps. For more
information, see “Set Up Git Source Control” on page 34-23.
If you want to use a version of SVN other than the built-in version, see “Set Up SVN Source Control”
on page 34-14.
33-49
33 Projects
If you create a new project from a folder that is already under source control, MATLAB can
automatically add the new project to source control. After creating the project, click the Detect
button. For more information about creating a project from a folder, see “Create Projects” on page
33-2.
Creating a GitHub repository adds Git source control to your new or existing project. The GitHub
repository you create becomes the project remote repository. To create a GitHub repository, you must
have a GitHub account.
1 On the Home tab, click New > Project > From Git.
2 Select New > GitHub Repository. In the GitHub dialog box, enter your User name and
Personal access token. Fill the Repository name and Description fields and click Create.
MATLAB creates a new public GitHub repository and populates the Repository path field with
information in the https://github.com/myusername/mynewrepository format.
3 In the Sandbox field, specify the location for your sandbox. The selected folder must be empty.
Click Retrieve to create the sandbox.
After creating the GitHub repository and sandbox, add your files to the sandbox. See “Mark Files for
Addition to Source Control” on page 34-8. Commit the first version of your files to your local
repository, then push all modifications to your remote GitHub repository.
Tip If you want to create a remote GitHub repository for an existing project, share your project to
GitHub instead.
With your project loaded, on the Project tab, select Share > GitHub. For detailed instructions, see
Publish on GitHub in “Share Projects” on page 33-26.
This table shows how to check for modified project files, update revisions, get and manage file locks,
and tag project files.
33-50
Use Source Control with Projects
Action Procedure
Refresh status of project files. To check for locally modified files, on the Project tab, in the
Source Control section, click Refresh. Refreshing queries the
local sandbox state and checks for changes made with another tool
outside of MATLAB.
For more information, see “Update SVN File Status and Revision”
on page 34-21 or “Update Git File Status and Revision” on page
34-30.
Check for modifications in To find out if there is a new version of the project in the repository,
project files. in the Files view, right-click the file and select Source Control >
Check for Modifications.
With SVN, this option contacts the repository to check for external
modifications. The project compares the revision numbers of the
local file and the repository version. If the revision number in the
repository is larger than that in the local sandbox folder, then the
project displays (not latest) next to the revision number of the local
file.
Update all project files. Using SVN, to get the latest changes of all project files, go to the
Project tab, and in the Source Control section, click Update. The
project displays a dialog box listing all the files that have changed
on disk. You can control this behavior using the project preference
Show changes on source control update. For more information,
see “Update SVN File Status and Revision” on page 34-21.
Using Git, to get the latest changes for all project files from a
source control repository and merge them into your current
branch, go to the Project tab, and in the Source Control section,
click Pull. To get changes and merge manually, on the Project tab,
in the Source Control section, click Fetch. This updates all of the
origin branches in the local repository. When you click Fetch, your
sandbox files are not changed. To see the changes from others,
merge in the origin changes to your local branches. For more
information, see “Pull, Push and Fetch Files with Git” on page 34-
35.
Update revision for selected To update a selected set of files, in the Files view, right-click the
project files. files, and select the Source Control > Update command for the
source control system you are using. For example, if you are using
SVN, select Source Control > Update from SVN to get fresh
local copies of the selected files from the repository.
Clear SVN login information. To clear any stored login credentials, on the Project tab, in the
Source Control section, click Clear Login.
33-51
33 Projects
Action Procedure
Get SVN file locks. To get SVN file locks, in the Files view, select the files that you
want to check out. Right-click the selected files and select Source
Control > Get File Lock. A lock symbol appears in the SVN
source control column. Other users do not see the lock symbol in
their sandboxes, but they cannot get a file lock or check in a
change when you have the lock. To view or break locks, on the
Project tab, click Locks.
Get File Lock is only for SVN. Git does not have locks.
Manage SVN repository locks. To manage global SVN locks for a repository, on the Project tab, in
the Source Control section, click Locks. For more information,
see “Get SVN File Locks” on page 34-22.
Tag versions of project files. To identify specific revisions of all project files, on the Project tab,
in the Source Control section, click Tag. Specify the tag text and
click OK. The tag is added to every project file. Errors appear if
you do not have a tags folder in your repository. For more
information, see “Set Up SVN Source Control” on page 34-14.
You can review changes in project files using the Files > Modified view. This table shows how to
view the list of modified project files, review the history of a file, and compare two files' revisions.
Action Procedure
View modified project files. In the Files view, select the Modified (number of files) tab. The
Files > Modified view is visible only if you are using source
control with your project.
Tip Use the List layout to view files without needing to expand
folders.
33-52
Use Source Control with Projects
Action Procedure
View revision history. In the Files view, right-click a file and select Source Control >
Show Revisions.
The files in the resources/project folder are project definition files generated when you first
create or make changes to your project. The project definition files enable you to add project
metadata to files without checking them out. Some examples of metadata you can change this way
are shortcuts, labels, and project descriptions. Project definition files also specify the files added to
your project. These files are not part of the project.
Any changes you make to your project generate changes in the resources/project folder. These
files store the definition of your project in XML files whose format is subject to change.
You do not need to view project definition files directly, except when the source control tool requires a
merge. The files are shown so that you know about all the files being committed to the source control
system.
Starting in R2020b, the default project definition file type is Use multiple project files (fixed-path
length). To change the project definition file management from the type selected when the project
was created, use matlab.project.convertDefinitionFiles.
matlab.project.convertDefinitionFiles preserves the source control history of your project.
Warning To avoid merge issues, do not convert the definition file type more than once for a project.
For releases before R2020b, if you want to change the project definition file management from the
type selected when the project was created:
1 On the Home tab, in the Environment section, click Preferences. Select MATLAB > Project
and in the New Projects section, select one of the options under Project definition files:
• Use multiple project files - Helps to avoid merging issues on shared projects
33-53
33 Projects
• Use multiple project files (fixed-path length) - Is better if you need to work with long
paths
• Use a single project file (not recommended for source control) - Is faster but is likely to
cause merge issues when two users submit changes in the same project to a source control
tool
2 Create a project archive file (.mlproj). For more information, see “Share Projects” on page 33-
26 or export.
3 Create a new project from the archived project. For more information, see “Create Projects” on
page 33-2.
To stop managing your folder with a project and delete the resources/project folder, see
matlab.project.deleteProject.
To run checks for a project, on the Project tab, click the down arrow to expand the Tools gallery.
Under Project Checks, click Check Project. The project checks for problems with project integrity
such as missing files, unsaved files, or files not under source control. A dialog box reports the results.
You can click for details and follow prompts to fix problems.
If you want to check for required files, click Dependency Analyzer to analyze the dependencies of
the modified files. Use the dependency tools to analyze the structure of your project.
For details on problems the checks can fix, see “Work with Derived Files in Projects” on page 33-57,
and “Analyze Project Dependencies” on page 33-33.
After reviewing changes and running project checks, you are ready to commit your modified project
files to source control. This table shows how to commit modified project files.
Action Procedure
Commit all modified files to In the Files view, select the Modified (number of files) tab. On
source control. the Project tab, in the Source Control section, click Commit.
Enter comments in the dialog box, and click Submit. If you are
using Git source control, this commits to your local repository. If
you are using SVN source control, this commits changes to your
repository.
If you commit individual files, you risk not committing the related
project definition files that keep track of your files. To avoid this,
commit all modified files.
33-54
Use Source Control with Projects
Action Procedure
Push project files with Git. To send local commits to the remote repository, on the Project tab,
in the Source Control section, click Push. A message appears if
you cannot push your changes directly because the repository has
moved on. Click Fetch to fetch all changes from the remote
repository. Merge branches and resolve conflicts, and then you can
push your changes. For more information, see “Pull, Push and
Fetch Files with Git” on page 34-35.
Push empty project folders with You cannot add empty folders to Git source control, so you cannot
Git. click Push and then clone an empty folder. You can create an
empty folder in a project, but if you push changes and then sync a
new sandbox, the empty folder does not appear in the new
sandbox. Instead, run Check Project, which creates the empty
folder for you.
Select a source for the new branch. Click a node in the Branch
Browser diagram, or enter a unique identifier in the Source text
box. You can enter a tag, branch name, or a unique prefix of the
SHA1 hash (for example, 73c637) to identify a specific commit.
Leave the default values to create a branch from the head of the
current branch. Enter a name in the Branch name text box and
click Create.
Switch, compare, save, and To switch, compare, save, and merge branches, on the Project tab,
merge branches with Git. in the Source Control section, click Branches. The Branches
dialog box appears, where you can view, switch, create, and merge
branches. For more information, see “Branch and Merge with Git”
on page 34-31.
33-55
33 Projects
Action Procedure
Resolve conflicts. If you and another user change the same file in different sandboxes
or on different branches, a conflict message appears when you try
to commit your modified files. Extract conflict markers if
necessary, compare the differences causing the conflict, and
resolve the conflict.
Look for conflicted files in the Files > Modified view. Identify
conflicted folder contents using the source control summary
status. Folders display the rolled-up source control status. This
makes it easier to locate changes in files, particularly conflicted
files. You can hover over the source control status for a folder to
view a tooltip displaying how many files inside are modified,
conflicted, added, and deleted.
Tip Use the List layout to view files without needing to expand
folders.
Check the source control status column (Git or SVN) for files with
a red warning symbol, which indicates a conflict. Right-click the
conflicted file and select View Conflicts to compare versions. A
comparison report opens showing the differences between the
conflicted files.
When you have resolved the changes and want to commit the
version in your sandbox, right-click the file and select Source
Control > Mark Conflict Resolved.
For Git, the Branch status in the Git pane changes from
MERGING to SAFE.
Revert Changes
This table shows how to revert changes in project files. For more information about reverting
changes, see “Revert Changes in Source Control” on page 34-13.
Action Procedure
Revert local changes. To release locks and revert to the version in the last sandbox
update (that is, the last version you synchronized or retrieved from
the repository), in the Files view, right-click the files to revert and
select Source Control > Discard Local Changes and Release
Locks.
33-56
Use Source Control with Projects
Action Procedure
Revert a file to a specified To revert a file to a specified revision, right-click a file and select
revision Source Control > Revert using SVN or Source Control >
Revert using Git.
In the Revert Files dialog box, choose a revision to revert to. Select
a revision to view information about the change, such as the
author, date, log message. Click Revert.
Once you have chosen a revision and are satisfied that the
information is correct, click Revert.
It is also a best practice to exclude derived files such as .mex*, the contents of the slprj folder,
sccprj folder, or other code generation folders from source control, because they can cause
problems. For example:
• With a source control system that can do file locking, you can encounter conflicts. If slprj is
under source control and you generate code, most of the files under slprj change and become
locked. Other users cannot generate code because of file permission errors. The slprj folder is
also used for simulation via code generation, so locking these files can have an impact on a team.
The same problems arise with binaries, such as .mex*.
• Deleting slprj is often required. However, deleting slprj causes problems such as “not a
working copy“ errors if the folder is under some source control tools (for example, SVN).
• If you want to check in the generated code as an artifact of the process, it is common to copy some
of the files out of the slprj cache folder and into a separate location that is part of the project.
That way, you can delete the temporary cache folder when you need to. Use the packNGo function
to list the generated code files, and use the project API to add them to the project with
appropriate metadata.
• The slprj folder can contain many small files. This can affect performance with some source
control tools when each of those files is checked to see if it is up-to-date.
33-57
33 Projects
In the Unsaved Changes dialog box, you can see the project files with unsaved changes. Project only
detects unsaved changes edited in the MATLAB and Simulink editors. Manually examine changes
edited in other tools. If you have referenced projects, files are grouped by project. You can save or
discard all detected changes.
To control this behavior, on the Home tab, in the Environment section, click Preferences. Go to
MATLAB > Project and in the Project Shutdown section, select or clear the check box labeled
Check for open project models and close them, unless they are dirty.
See Also
More About
• “About MathWorks Source Control Integration” on page 34-2
• “Set Up Git Source Control” on page 34-23
• “Set Up SVN Source Control” on page 34-14
33-58
Create and Edit Projects Programmatically
Create a working copy of the Times Table App example project files and open the project. MATLAB®
copies the files to an examples folder so that you can edit them. The project puts the files under Git™
source control. Use currentProject to create a project object from the currently loaded project.
matlab.project.example.timesTable
mainProject = currentProject;
files=1×14 object
1×14 ProjectFile array with properties:
Path
Labels
Revision
SourceControlStatus
Use indexing to access files in this list. For example, get file number 10. Each file has properties
describing its path and attached labels.
mainProject.Files(10)
ans =
ProjectFile with properties:
Path: "C:\workSpace\examples\TimesTableApp1\tests\tNewTimesTable.m"
Labels: [1×1 matlab.project.Label]
Revision: "51316c67b968d45a17e127003a25143577ec011a"
SourceControlStatus: Unmodified
ans =
"51316c67b968d45a17e127003a25143577ec011a"
ans =
Label with properties:
33-59
33 Projects
File: "C:\workSpace\examples\TimesTableApp1\tests\tNewTimesTable.m"
DataType: 'none'
Data: []
Name: "Test"
CategoryName: "Classification"
myfile = findFile(mainProject,"source/timestable.mlapp")
myfile =
ProjectFile with properties:
Path: "C:\workSpace\examples\TimesTableApp1\source\timestable.mlapp"
Labels: [1×1 matlab.project.Label]
Revision: "51316c67b968d45a17e127003a25143577ec011a"
SourceControlStatus: Unmodified
Create the Times Table Game project. This project will store the game logic behind the Times Table
App. The Times Table Game project will be used by the Times Table App project through a project
reference.
timesTableGameFolder = fullfile(mainProject.RootFolder,"refs","TimesTableGame");
timesTableGame = matlab.project.createProject(timesTableGameFolder);
timesTableGame.Name = "Times Table Game";
Move the Times Table App game logic from the main project folder to the new project folder, and add
it to the Times Table Game project. Then, remove the file from the Times Table App project.
movefile("..\..\source\timesTableGame.m");
addFile(timesTableGame,"timesTableGame.m");
reload(mainProject);
removeFile(mainProject,"source\timesTableGame.m");
Add the Times Table Game project root folder to the Times Table Game project path. This makes the
timesTableGame.m file available when the Times Table App project or any project that references
the Times Table App project is loaded.
reload(timesTableGame);
addPath(timesTableGame,timesTableGame.RootFolder);
Add the new Times Table Game project to the Times Table App project as a project reference. This
allows the Time Table App project to view, edit, and run files in the Times Table Game project.
reload(mainProject);
addReference(mainProject,timesTableGame);
33-60
Create and Edit Projects Programmatically
Get all the modified files in the Times Table App project. Compare this list with the Files > Modified
view in the project. You can see the files for the new Times Table Game project, as well as the
removed and modified files in the Times Table App project.
modifiedfiles = listModifiedFiles(mainProject)
modifiedfiles=1×8 object
1×8 ProjectFile array with properties:
Path
Labels
Revision
SourceControlStatus
Get the second modified file in the list. Observe that the SourceControlStatus property is Added.
The listModifiedFiles function returns any files that are added, modified, conflicted, deleted,
and so on.
modifiedfiles(2)
ans =
ProjectFile with properties:
Path: "C:\workSpace\examples\TimesTableApp1\refs\TimesTableGame\resources\proj
Revision: ""
SourceControlStatus: Added
Refresh the source control status before querying individual files. You do not need to do this before
calling listModifiedFiles.
refreshSourceControl(mainProject)
Get all the project files that are Unmodified. Use the ismember function to get an array of logicals
stating which files in the Times Table App project are unmodified. Use the array to get the list of
unmodified files.
unmodifiedStatus = ismember([mainProject.Files.SourceControlStatus],matlab.sourcecontrol.Status.U
mainProject.Files(unmodifiedStatus)
ans=1×9 object
1×9 ProjectFile array with properties:
Path
Labels
Revision
SourceControlStatus
Run a dependency analysis to update the known dependencies between project files.
updateDependencies(mainProject)
33-61
33 Projects
Get the list of dependencies in the Times Table App project. The Dependencies property contains
the graph of dependencies between project files, stored as a MATLAB digraph object.
g = mainProject.Dependencies
g =
digraph with properties:
Get the top-level files of all types in the graph. The indegree function finds all the files that are not
depended on by any other file.
top = g.Nodes.Name(indegree(g)==0)
Get the top-level files that have dependencies. The indegree function finds all the files that are not
depended on by any other file, and the outdegree function finds all the files that have dependencies.
Find impacted (or "upstream") files by creating a transposed graph. Use the flipedge function to
reverse the direction of the edges in the graph.
transposed = flipedge(g)
transposed =
digraph with properties:
33-62
Create and Edit Projects Programmatically
impacted = bfsearch(transposed,which('source/timestable.mlapp'))
Get information on the project files, such as the number of dependencies and orphans.
averageNumDependencies = mean(outdegree(g));
numberOfOrphans = sum(indegree(g)+outdegree(g)==0);
Change the sort order of the dependency graph to show project changes from the bottom up.
ordered = g.Nodes.Name(flip(toposort(g)));
Query Shortcuts
You can use shortcuts to save frequent tasks and frequently accessed files, or to automate startup and
shutdown tasks.
shortcuts=1×4 object
1×4 Shortcut array with properties:
Name
Group
File
ans =
Shortcut with properties:
ans =
"C:\workSpace\examples\TimesTableApp1\utilities\openRequirementsDocument.m"
33-63
33 Projects
{["C:\workSpace\examples\TimesTableApp1\utilities\runTheseTests.m" ]}
Label files
Create a new category of labels of type char. In the Times Table App project, the new Engineers
category appears in the Labels pane.
createCategory(mainProject,'Engineers','char')
ans =
Category with properties:
Name: "Engineers"
SingleValued: 0
DataType: "char"
LabelDefinitions: [1×0 matlab.project.LabelDefinition]
category = findCategory(mainProject,'Engineers');
createLabel(category,'Bob');
ld = findLabel(category,'Bob')
ld =
LabelDefinition with properties:
Name: "Bob"
CategoryName: "Engineers"
Attach a label to a project file. If you select the file in the Times Table App project, you can see this
label in the Label Editor pane.
myfile = findFile(mainProject,"source/timestable.mlapp");
addLabel(myfile,'Engineers','Bob');
label = findLabel(myfile,'Engineers','Bob');
label.Data = 'Email: [email protected]'
label =
Label with properties:
File: "C:\workSpace\examples\TimesTableApp1\source\timestable.mlapp"
DataType: 'char'
Data: 'Email: [email protected]'
Name: "Bob"
CategoryName: "Engineers"
mydata = label.Data
33-64
Create and Edit Projects Programmatically
mydata =
'Email: [email protected]'
Create a new label category with data type double, the type MATLAB commonly uses for numeric
data.
createCategory(mainProject,'Assessors','double');
category = findCategory(mainProject,'Assessors');
createLabel(category,'Sam');
Attach the new label to a specified file and assign data value 2 to the label.
myfile = mainProject.Files(10);
addLabel(myfile, 'Assessors', 'Sam', 2)
ans =
Label with properties:
File: "C:\workSpace\examples\TimesTableApp1\utilities"
DataType: 'double'
Data: 2
Name: "Sam"
CategoryName: "Assessors"
Close Project
Close the project to run shutdown scripts and check for unsaved files.
close(mainProject)
See Also
currentProject
More About
• “Create Projects” on page 33-2
• “Manage Project Files” on page 33-13
• “Analyze Project Dependencies” on page 33-33
33-65
33 Projects
Using the Times Table App example, we will explore how to:
1 Set up and browse some example project files under source control.
2 Examine project shortcuts to access frequently used files and tasks.
3 Analyze dependencies in the project and locate required files that are not yet in the project.
4 Modify some project files, find and review modified files, compare them to an earlier version, and
commit modified files to source control.
5 Explore views of project files only, modified files, and all files under the project root folder.
Create a working copy of the Times Table App example project files and open the project. MATLAB®
copies the files to an examples folder so that you can edit them. The project puts the files under Git™
source control.
matlab.project.example.timesTable
You can view, search, and sort project files by using the Files view.
To view the files in the project, in the Files view, click Project (number of files). When the view
is selected, only the files in your project are shown.
To see all the files in your project folder, click All. This view shows all the files that are under the
project root, not just the files that are in the project. As a result, this view is useful for adding files to
the project.
To view files as a list instead of a tree, in the Layout field at the top right of the Files view, select
List.
• To search for particular files or file types by name, in any file view, type in the search box or click
the Filter button. For example, in the search field, enter the text timestable. The project
returns all files and folders that contain the word timestable. Click the to clear the search.
• To search the content of files, go to the Project tab and click the Search button. Enter a value in
the search field and click Enter. For example, enter the word tests. The project displays all files
and folders that contain the word tests. Click the to clear the search.
•
To change how files are grouped or sorted, and to customize the columns, click the actions
button and select from the available options.
You can use shortcuts to make files easier to find in a large project. View and run shortcuts on the
Project Shortcuts tab. You can organize the shortcuts into groups.
33-66
Explore an Example Project
The Times Table App project contains several shortcuts, including a shortcut to open the project
requirements, and another to run all the tests in the project. The shortcuts make these tasks easier
for users of the project.
To perform an action, on the Project Shortcuts tab, click the associated shortcut. For example, to
open project requirements, click Documentation > Requirements. To run tests, click Test > Run
All Tests.
To create a new shortcut, select the Files view, right-click a file, and select Create Shortcut.
Create a new folder and add it to the project path. Adding a project folder to the project path ensures
that all users of the project can access the files within it.
1 Select the Files view. View folders using the tree layout, and then expand the utilities folder.
2 Right-click source/timesTableGame.m and select Open.
3 Make a change in the Editor, such as adding a comment, and save the file.
4 In the Files view, select the Modified (number of files) tab. After editing the file, you see
Modified (2). The file you changed appears in the list.
5 To review changes, right-click source/timesTableGame.m in the Modified files view and
select Compare > Compare to Ancestor. The MATLAB Comparison Tool opens a report
comparing the modified version of the file in your sandbox to its ancestor stored in version
control. The comparison report type can differ depending on the file you select. If you select a
Simulink® model to compare, this command runs a Simulink model comparison.
* Note - When you open the Times Table App example project, the project shows a modified file in the
resources folder. This is a side effect of opening the example project. When editing files in your own
projects, only changes that affect file metadata, such as adding a label to a file, create modified files
in the resources folder.
Analyze Dependencies
To check that all required files are in the project, run a file dependency analysis on the modified files.
1 On the Project tab, click the down arrow to expand the Tools gallery. Under Apps, click
Dependency Analyzer.
2 The dependency graph displays the structure of all analyzed dependencies in the project. The
right pane lists required add-ons and any problem files. Observe that there are no problems files
listed.
33-67
33 Projects
Now, remove one of the required files. Select the project Files view, right click the source/
timesTableGame.m file, and select Remove from Project. Click Remove in the Remove from
Project dialog box.
The Dependency Analyzer automatically updates the graph and the Problems section in the
Properties pane.
1 In the Dependency Analyzer, in the Properties pane, point to the problem message, Not in
project, under Problems and click the magnifying glass . The graph updates to highlight the
problem file, timesTableGame.m.
2 To view the dependencies of the problem file, in the Impact Analysis section, click All
Dependencies.
Now that you have seen the problem, fix it by returning the missing file to the project. Right-click the
file and select Add to Project. The next time you run a dependency analysis, the file does not appear
as a problem file.
After running a dependency analysis, to investigate the dependencies of modified files, perform an
impact analysis.
1 In the Views section, click Source Control. The graph colors the files by source control status.
2 Select the modified files in the graph or in the File List.
3 To view the dependencies of the modified files, in the Impact Analysis section, click All
Dependencies.
To make sure that your changes are ready to commit, check your project. To run the project integrity
checks, on the Project tab, click the down arrow to expand the Tools gallery. Under Project Checks,
click Check Project. The checks look for missing files, files to add to source control or retrieve from
source control, and other issues. The Checks dialog box offers automatic fixes to problems found,
when possible. When you click a Details button in the Checks dialog box, you can view recommended
actions and decide whether to make the changes.
After you modify files and you are satisfied with the results of the checks, you can commit your
changes to the source control repository.
1 In the Files view, select the Modified (number of files) tab. The files you changed appear in
the list.
2 To commit your changes to source control, on the Project tab, in the Source Control section,
click Commit.
3 Enter a comment for your submission, and click Submit. Watch the messages in the status bar as
the source control commits your changes. In Git, you can have both local and remote
repositories. These instructions commit to the local repository. To commit to the remote
repository, in the Source Control section, click Push.
33-68
Explore an Example Project
To view and edit project details, on the Project tab, in the Environment section, click Details. View
and edit project details such as the name, description, project root, startup folder, and location of
folders containing generated files.
To view details about the source control integration and repository location, on the Project tab, in
the Source Control section, click Git Details. The Times Table App example project uses Git source
control.
Click the at the top right corner of the project window to close the project.
proj = currentProject;
close(proj);
See Also
More About
• “Create Projects” on page 33-2
• “Manage Project Files” on page 33-13
• “Analyze Project Dependencies” on page 33-33
33-69
34
The source control interface provides access to your source control system from MATLAB.
• Subversion (SVN)
• Git
• Retrieve files from an existing repository. See “Check Out from SVN Repository” on page 34-19
or “Retrieve Files from Git Repository” on page 34-29.
• Add source control to a folder. See “Create Git Repository” on page 34-5.
• Add new files in a folder already under source control. See “Mark Files for Addition to Source
Control” on page 34-8.
Additional source control integrations, such as Microsoft Source-Code Control Interface (MSSCCI),
are available for download from the Add-On Explorer. For more information, see “Get and Manage
Add-Ons”.
• Locking and user permissions on a per-file basis (e.g., you can enforce locking of model files)
• Central server, reducing local storage needs
• Simple and easy to learn
This diagram represents the distributed source control workflow (for example, using Git).
34-2
About MathWorks Source Control Integration
• Offline working
• Local repository, which provides full history
• Branching
• Multiple remote repositories, enabling large-scale hierarchical access control
• You need to work offline, commit regularly, and need access to the full repository history.
• You need to branch locally.
34-3
34 Source Control Interface
34-4
Create Git Repository
Note Before using source control, you must register binary files with your source control tools to
avoid corruption. For more information, see “Register Binary Files with Git” on page 34-25.
1 Right-click in the white space (any blank area) of the MATLAB Current Folder browser and select
Source Control > Manage Files. MATLAB opens the Manage Files Using Source Control dialog
box.
2 In the Source control integration list, select Git.
3 Click the Change button. MATLAB opens the Select a Repository dialog box.
4
Click the Create a Git repository on disk ( ) button.
5 Select an empty folder or create a new folder in which you want to create the repository and then
click Select Folder. MATLAB creates the repository, closes the dialog box and returns to the
Select a Repository dialog box.
6 Click Validate to check the path to the new repository, and then click OK. MATLAB closes the
dialog box and returns to the Manage Files Using Source Control dialog box.
7 In the Sandbox field, specify the location for your sandbox. The selected folder must be empty.
8 Click Retrieve to create the sandbox.
After creating the Git repository and sandbox, add your files to the sandbox. Then, commit the first
version of your files to the new repository. For more information, see “Mark Files for Addition to
Source Control” on page 34-8.
You also can change the repository URL after the repository is created. In the Current Folder
browser, in a folder under source control, right-click, and select Source Control > Remote and
specify a new URL.
To use a Git server for the repository on your local system, you can use a Git server hosting solution
or set up your own Apache™ Git server. If you cannot set up a server and must use a remote
repository via the file system using the file:/// protocol, make sure that it is a bare repository with
no checked out working copy.
See Also
Related Examples
• “Set Up Git Source Control” on page 34-23
• “Set Up SVN Source Control” on page 34-14
• “Retrieve Files from Git Repository” on page 34-29
• “Check Out from SVN Repository” on page 34-19
34-5
34 Source Control Interface
34-6
Review Changes in Source Control
• Show Revisions to open the File Revisions dialog box and browse the history of a file. You can
view information about who previously committed the file, when they committed it, the log
messages, and the list of files in each change set. You can select multiple files and view revision
history for each file.
With SVN, you can select a revision and browse the lower list of files in the change set. Right-click
files to view changes or save revisions.
• Compare to Revision to open a dialog box where you can select the revisions you want to
compare and view a comparison report. You can either:
With SVN, you can select a revision and browse the lower list of files in the change set. Right-click
files to view changes or save revisions.
• Compare to Ancestor to run a comparison with the last checked-out version in the sandbox
(SVN) or against the local repository (Git). The Comparison Tool displays a report.
If you need to update the status of the modified files, see “Update SVN File Status and Revision” on
page 34-21 or “Update Git File Status and Revision” on page 34-30.
See Also
Related Examples
• “Resolve Source Control Conflicts” on page 34-9
• “Commit Modified Files to Source Control” on page 34-12
• “Revert Changes in Source Control” on page 34-13
34-7
34 Source Control Interface
When the file is marked for addition to source control, the symbol changes to Added .
34-8
Resolve Source Control Conflicts
For details on using the Comparison Tool to merge changes, see “Merge Text Files” on page 34-10.
After you are satisfied with the file that is marked conflicted, you can mark the conflict resolved and
commit the file.
Resolve Conflicts
1 Look for conflicted files in the Current Folder browser.
2
Check the source control status column (SVN or Git) for files with a red warning symbol ,
which indicates a conflict.
3 Right-click the conflicted file and select Source Control > View Conflicts to compare versions.
4 Examine the conflict. A comparison report opens that shows the differences between the
conflicted files.
With SVN, the comparison shows the differences between the file and the version of the file in
conflict.
With Git, the comparison shows the differences between the file on your branch and the branch
you want to merge into.
5 Use the Comparison Tool report to determine how to resolve the conflict.
You can use the Comparison Tool to merge changes between revisions, as described in “Merge
Text Files” on page 34-10.
6 When you have resolved the changes and want to commit the version in your sandbox, in the
Current Folder browser, right-click the file and select Source Control > Mark Conflict
Resolved.
With Git, the Branch status in the Source Control Details dialog box changes from MERGING to
SAFE.
7 Commit the modified files.
34-9
34 Source Control Interface
then extract the conflict markers before merging, as described in “Extract Conflict Markers” on page
34-10.
Tip When comparing a file to another version in source control, by default the right file is the version
in your sandbox and the left file is either a temporary copy of the previous version or another version
causing a conflict (e.g., filename_theirs). You can swap the position of the files, so be sure to
observe the file paths of the left and right file at the top of the comparison report. Merge differences
from the temporary copy to the version in your sandbox to resolve conflicts.
1 In the Comparison Tool report, select a difference in the report and click Merge. The selected
difference is copied from the left file to the right file.
Merged differences display gray row highlighting and a green merge arrow.
The merged file name at the top of the report displays with an asterisk (filename.m*) to show
you that the file contains unsaved changes.
2 Click Save Merged File to save the file in your sandbox. To resolve conflicts, save the merged
file over the conflicted file.
3 If you want to inspect the files in the editor, click the line number links in the report.
Note If you make any further changes in the editor, the comparison report does not update to
reflect changes and report links can become incorrect.
4 When you have resolved the changes mark them as conflict resolved. Right-click the file in the
Current Folder browser and select Source Control > Mark Conflict Resolved.
Source control tools can insert conflict markers in files that you have not registered as binary (e.g.,
text files). You can use MATLAB to extract the conflict markers and compare the files causing the
conflict. This process helps you to decide how to resolve the conflict.
Caution Register files with source control tools to prevent them from inserting conflict markers and
corrupting files. See “Register Binary Files with SVN” on page 34-14 or “Register Binary Files with
34-10
Resolve Source Control Conflicts
Git” on page 34-25. If your files already contains conflict markers, the MATLAB tools can help you to
resolve the conflict.
If you try to open a file containing conflict markers, the Conflict Markers Found dialog box opens.
Follow the prompts to fix the file by extracting the conflict markers. After you extract the conflict
markers, resolve the conflicts as described in “Examining and Resolving Conflicts” on page 34-9.
To view the conflict markers, in the Conflict Markers Found dialog box, click Load File. Do not try to
load files, because MATLAB does not recognize conflict markers. Instead, click Fix File to extract the
conflict markers.
When you open a conflicted file or select View Conflicts, MATLAB checks files for conflict markers
and offers to extract the conflict markers. MATLAB checks only conflicted files for conflict markers.
However, some files that are not marked as conflicted can still contain conflict markers. This can
happen if you or another user marked a conflict resolved without removing the conflict markers and
then committed the file. If you see conflict markers in a file that is not marked conflicted, you can
extract the conflict markers.
1 In the Current Folder browser, right-click the file, and select Source Control > Extract Conflict
Markers to File.
2 In the Extract Conflict Markers to File dialog box, leave the default option to copy “mine” file
version over the conflicted file. Leave the Compare extracted files check box selected. Click
Extract.
3 Use the Comparison Tool report as usual to continue to resolve the conflict.
34-11
34 Source Control Interface
1 Right-click in the Current Folder browser and select Source Control > View and Commit
Changes. In the View and Commit Changes dialog box, select the files to commit to the
repository.
2 Enter comments in the dialog box, and click Commit.
3 A message appears if you cannot commit because the repository has moved ahead. Before you
can commit the file, you must update the revision up to the current HEAD revision.
• If you are using SVN source control, right-click in the Current Folder browser. Select Source
Control > Update All from SVN.
• If you are using Git source control, right-click in the Current Folder browser. Select Source
Control > Pull.
See Also
Related Examples
• “Mark Files for Addition to Source Control” on page 34-8
• “Review Changes in Source Control” on page 34-7
• “Resolve Source Control Conflicts” on page 34-9
• “Update SVN File Status and Revision” on page 34-21
• “Update Git File Status and Revision” on page 34-30
• “Pull, Push and Fetch Files with Git” on page 34-35
34-12
Revert Changes in Source Control
With Git, right-click a file and select Source Control > Revert Local Changes. Git does not have
locks. To remove all local changes, right-click a blank space in the Current Folder browser and select
Source Control > Branches. In the Branches dialog box, click Revert to Head.
If you revert a file to an earlier revision and then make changes, you cannot commit the file until you
resolve the conflict with the repository history.
See Also
Related Examples
• “Resolve Source Control Conflicts” on page 34-9
34-13
34 Source Control Interface
Caution Before using source control, you must register binary files with the source control tools to
avoid corruption. See “Register Binary Files with SVN” on page 34-14.
If you need to use a version of SVN other than the built-in version, you can create a repository using
the Command-Line SVN Integration (compatibility mode) Source control integration
option, but you must also install a command-line SVN client.
Command-line SVN integration communicates with any Subversion (SVN) client that supports the
command-line interface. With Command-Line SVN Integration (compatibility mode), if you
try to rename a file or folder to a name that contains an @ character, an error occurs because
command-line SVN treats all characters after the @ symbol as a peg revision value.
Also check that other file extensions are registered as binary to avoid corruption at check-in. Check
and register files such as MEX-files, .xlsx, .jpg, .pdf, .docx, etc.
You must register binary files if you use any version of SVN, including the built-in SVN integration
provided by MATLAB. If you do not register your extensions as binary, SVN might add annotations to
conflicted MATLAB files and attempt automerge. To avoid this problem when using SVN, register file
extensions.
1 Locate your SVN config file. Look for the file in these locations:
34-14
Set Up SVN Source Control
1 If you do not find an SVN config file, create a text file containing these lines:
[miscellany]
enable-auto-props = yes
[auto-props]
*.mlx = svn:mime-type=application/octet-stream
*.mat = svn:mime-type=application/octet-stream
*.fig = svn:mime-type=application/octet-stream
*.mdl = svn:mime-type=application/octet-stream
*.slx = svn:mime-type= application/octet-stream
*.mlapp = svn:mime-type= application/octet-stream
*.p = svn:mime-type=application/octet-stream
*.mdlp = svn:mime-type=application/octet-stream
*.slxp = svn:mime-type=application/octet-stream
*.sldd = svn:mime-type=application/octet-stream
*.slxc = svn:mime-type=application/octet-stream
*.mlproj = svn:mime-type=application/octet-stream
*.mldatx = svn:mime-type=application/octet-stream
*.slreqx = svn:mime-type=application/octet-stream
*.sfx = svn:mime-type=application/octet-stream
*.sltx = svn:mime-type=application/octet-stream
2 Check for other file types you use that you also need to register as binary to avoid corruption at
check-in. Check for files such as MEX-files
(.mexa64, .mexmaci64, .mexw64), .xlsx, .jpg, .pdf, .docx, etc. Add a line to the config
file for each file type you need. Examples:
*.mexa64 = svn:mime-type=application/octet-stream
*.mexw64 = svn:mime-type=application/octet-stream
*.mexmaci64 = svn:mime-type=application/octet-stream
*.xlsx = svn:mime-type=application/octet-stream
*.docx = svn:mime-type=application/octet-stream
*.pdf = svn:mime-type=application/octet-stream
*.jpg = svn:mime-type=application/octet-stream
*.png = svn:mime-type=application/octet-stream
3 Name the file config and save it in the appropriate location:
After you create the SVN config file, SVN treats new files with these extensions as binary. If you
already have binary files in repositories, see “Register Files Already in Repositories” on page 34-16.
If you find an existing config file, you have previously installed SVN. Edit the config file to register
files as binary.
enable-auto-props = yes
34-15
34 Source Control Interface
Ensure that this line is not commented (that is, that it does not start with #). Config files can
contain example lines that are commented out. If there is a # character at the beginning of the
line, delete it.
3 Locate the [auto-props] section. Ensure that [auto-props] is not commented. If there is a #
character at the beginning, delete it.
4 Add the following lines at the end of the [auto-props] section:
*.mlx = svn:mime-type=application/octet-stream
*.mat = svn:mime-type=application/octet-stream
*.fig = svn:mime-type=application/octet-stream
*.mdl = svn:mime-type=application/octet-stream
*.slx = svn:mime-type= application/octet-stream
*.mlapp = svn:mime-type= application/octet-stream
*.p = svn:mime-type=application/octet-stream
*.mdlp = svn:mime-type=application/octet-stream
*.slxp = svn:mime-type=application/octet-stream
*.sldd = svn:mime-type=application/octet-stream
*.slxc = svn:mime-type=application/octet-stream
*.mlproj = svn:mime-type=application/octet-stream
*.mldatx = svn:mime-type=application/octet-stream
*.slreqx = svn:mime-type=application/octet-stream
*.sfx = svn:mime-type=application/octet-stream
*.sltx = svn:mime-type=application/octet-stream
These lines prevent SVN from adding annotations to MATLAB and Simulink files on conflict and
from automerging.
5 Check for other file types you use that you also need to register as binary to avoid corruption at
check-in. Check for files such as MEX-files
(.mexa64, .mexmaci64, .mexw64), .xlsx, .jpg, .pdf, .docx, etc. Add a line to the config
file for each file type you use. Examples:
*.mexa64 = svn:mime-type=application/octet-stream
*.mexw64 = svn:mime-type=application/octet-stream
*.mexmaci64 = svn:mime-type=application/octet-stream
*.xlsx = svn:mime-type=application/octet-stream
*.docx = svn:mime-type=application/octet-stream
*.pdf = svn:mime-type=application/octet-stream
*.jpg = svn:mime-type=application/octet-stream
*.png = svn:mime-type=application/octet-stream
6 Save the config file.
After you create or update the SVN config file, SVN treats new files as binary. If you already have
files in repositories, register them as described in “Register Files Already in Repositories” on page
34-16.
Caution Changing your SVN config file does not affect files already committed to an SVN
repository. If a file is not registered as binary, use svn propset to manually register the files as
binary.
To manually register a file in a repository as binary, use the following command with command-line
SVN:
34-16
Set Up SVN Source Control
After you create a repository with this structure, you can click Tag in the Source Control context
menu to add tags to all of your files. For more information, see “Tag Versions of Files” on page 34-
17.
1 Right-click in the Current Folder browser, and select Source Control > Tag.
2 Specify the tag text and click Submit. The tag is added to every file in the folder. Errors appear if
you do not have a tags folder in your repository.
Note You can retrieve a tagged version of your files from source control, but you cannot tag them
again with a new tag. You must check out from trunk to create new tags.
To enforce locking files, modify entries in the SVN config file. To locate your SVN config file, see
“Register Binary Files with SVN” on page 34-14.
1 To make files with a .m extension read only, add a property to your SVN config file in the
[auto-props] section. If there is no entry for files with a .m extension, add one with the
needs-lock property.
*.m = svn:needs-lock=yes
If an entry exists, you can combine properties in any order, but multiple entries must be on a
single line separated by semicolons.
2 To make files with a .mlx extension read only, add a property to your SVN config file in the
[auto-props] section. Since you must register files with a .mlx extension as binary, there is an
entry for the file type. Add the needs-lock property to the entry in any order, but on the same
line and separated by a semicolon.
*.mlx = svn:mime-type=application/octet-stream;svn:needs-lock=yes
34-17
34 Source Control Interface
With this setting, you need to select Get File Lock before you can edit files with a .m extension. See
“Get SVN File Locks” on page 34-22.
See Also
Related Examples
• “Check Out from SVN Repository” on page 34-19
34-18
Check Out from SVN Repository
1 Right-click in the white space (any blank area) in the Current Folder browser and select Source
Control > Manage Files.
2 In the Manage Files Using Source Control dialog box, select the source control interface from the
Source control integration list. To use SVN, leave the default SVN.
3 If you know your repository location, paste it into the Repository path field.
Otherwise, to browse for and validate the repository path to retrieve files from, click Change.
a In the Specify SVN Repository URL dialog box, specify the repository URL by entering a URL
in the box, using the list of recent repositories.
b Click Validate to check the repository path.
If you see an authentication dialog box for your repository, enter the login information to
continue.
c If the path is invalid, check the URL against your source control repository browser.
If necessary, select a deeper folder in the repository tree. You might want to check out from
trunk or from a branch folder under tags, if your repository contains tagged versions of
files. You can check out from a branch, but the built-in SVN integration does not support
branch merging. Use an external tool such as TortoiseSVN to perform branch merging.
d When you have finished specifying the URL path you want to retrieve, click OK. The dialog
box closes and you return to the Manage Files Using Source Control dialog box.
4 In the Manage Files Using Source Control dialog box, select the sandbox folder to store the
retrieved files and click Retrieve.
If you see an authentication dialog box for your repository, enter the login information to
continue.
Caution Use local sandbox folders. Using a network folder with SVN slows source control
operations.
The Manage Files Using Source Control dialog box displays messages as it retrieves the files
from source control.
Note To update an existing sandbox from source control, see “Update SVN File Status and Revision”
on page 34-21.
1 Right-click in the white space in the Current Folder browser, and select Source Control >
Manage Files.
34-19
34 Source Control Interface
2 In the Manage Files Using Source Control dialog box, select the source control interface from the
Source control integration list. To use SVN, leave the default SVN.
3 Click Change to select the repository path that you want to retrieve files from.
4 In the Specify SVN Repository URL dialog box:
a
Select a recent repository from the Repository list, or click the Repository button to
browse for the repository location.
b Click Validate to show the repository browser.
c Expand the tags folder in the repository tree, and select the tag version you want. Navigate
up a level in the repository if the URL contains the trunk.
d Click OK to continue and return to the Manage Files Using Source Control dialog box.
5 Select the sandbox folder to receive the tagged files. You must use an empty sandbox folder or
specify a new folder.
6 Click Retrieve.
See Also
Related Examples
• “Set Up SVN Source Control” on page 34-14
• “Update SVN File Status and Revision” on page 34-21
34-20
Update SVN File Status and Revision
To refresh the status of all files in a folder, right-click the white space of the Current Folder browser
and select Source Control > Refresh SVN status.
Note For SVN, refreshing the source control status does not contact the repository. To get the latest
revisions, see “Update Revisions of Files” on page 34-21.
To update all files in a folder, right-click the Current Folder browser and select Source Control >
Update All from SVN.
See Also
Related Examples
• “Check Out from SVN Repository” on page 34-19
• “Review Changes in Source Control” on page 34-7
34-21
34 Source Control Interface
In the Current Folder browser, select the files you want to check out. Right-click the selected files and
select Source Control > Get File Lock. A lock symbol appears in the source control status
column. Other users cannot see the lock symbol in their sandboxes, but they cannot get a file lock or
check in a change when you have the lock. To view or break locks, right-click in the Current Folder
browser and select Source Control > Locks.
If you see an SVN message reporting a working copy locked error, remove stale locks. In the
Current Folder browser, right-click and select Source Control > SVN Cleanup. SVN uses working
copy locks internally and they are not the file locks you control using Source Control > Get File
Lock.
Note Starting in R2020a Update 5, SVN cleanup only removes stale locks and unfinished
transactions. It does not remove unversioned or ignored files.
1 In the Current Folder browser, click the SVN header to sort files by their SVN status.
2 Select the Not Under Source Control files.
3 Right-click and select Delete.
See Also
Related Examples
• “Enforce Locking Files Before Editing” on page 34-17
34-22
Set Up Git Source Control
Add the Cygwin bin folder location to the end of librarypath.txt, for example,
C:\cygwin64\bin.
If you do not have permission to edit the librarypath.txt file, see “Locate Native Method
Libraries”.
3 Restart MATLAB for the changes to take effect.
To use Git LFS or a credential helper, you must also install command-line Git. For more information,
see “Use Git LFS with MATLAB” on page 34-26 and “Configure Git Credential Helper” on page 34-
25.
You can clone a remote repository like GitHub and GitLab using HTTPS or SSH. To prevent frequent
login prompts when you interact with your remote repository using HTTPS, configure a Git credential
manager to remember credentials or add a new public key and clone the repository using SSH
instead. For more information, see “Configure Git Credential Helper” on page 34-25 and “Use SSH
Authentication with MATLAB” on page 34-23.
For new projects under Git source control, MATLAB automatically registers your binary files to
prevent corruption when merging. For existing projects, register the binary files before using Git to
merge branches. For more information, see “Register Binary Files with Git” on page 34-25.
If you are working with long path files, run this command in MATLAB:
!git config --global core.longpaths true
34-23
34 Source Control Interface
1 Use ssh-keygen to generate valid SSH keys. In the Command Prompt, enter:
ssh-keygen
ssh-keygen confirms where to save the key (for example, .ssh/id_rsa) and asks for a
passphrase. If you do not want to type a password when you use the key, leave the passphrase
empty. If you already have keys in the specified folder, ssh-keygen asks if you want to override
them.
Note It is not possible to generate SSH keys directly in MATLAB. Generate SSH keys using the
ssh-keygen provided with a command-line Git install.
2 Place your keys in the appropriate folder.
getenv('USERPROFILE')
To use multiple keys, use Pageant as the SSH agent. If Pageant is running, MATLAB looks for
keys in Pageant before looking in USERPROFILE/.ssh.
• On Linux and Mac, place your keys in the HOME/.ssh folder. To verify which HOME directory
the MATLAB Git integration is working with, in the MATLAB Command Window, enter:
getenv('HOME')
To use multiple keys, use an SSH agent. If an SSH agent is running, MATLAB looks for keys in
the agent before looking in HOME/.ssh.
To enable the use of a pass-phrase and receive a prompt once per session, choose one of the
following options:
git = settings().matlab.sourcecontrol.git;
git.KeyHasPassphrase.PersonalValue = true;
3 Configure your GitHub or GitLab account to use the SSH keys:
34-24
Set Up Git Source Control
Also check that other file extensions are registered as binary to avoid corruption at check-in. Check
and register files such as MEX-files, .xlsx, .jpg, .pdf, .docx, etc.
You can prevent Git from corrupting your files by registering binary files in your .gitattributes
file.
• For new projects and projects that switched from another source control system, MATLAB
automatically creates a .gitattributes file and populates it with a list of binary files to register.
This specifies that Git should not make automatic line feed, diff, and merge attempts for registered
files.
• For existing projects, create a .gitattributes file and populate it with the list of binary files to
register.
edit .gitattributes
2 Add a line to the attributes file for each file type you need. For example, *.mlapp binary.
Tip You can copy a .gitattributes file that contains the list of common binary files to
register.
copyfile(fullfile(matlabroot,'toolbox','shared','cmlink','git','auxiliary_files','mwgitatt
Tip You can reduce your Git repository size by saving Simulink models without compression. Turning
off compression results in larger SLX files on disk but reduces repository size.
To use this setting with new SLX files, create your models using a model template with SLX
Compression set to none. For existing SLX files, set compression and then save the model. For more
information, see “Set SLX Compression Level” (Simulink).
34-25
34 Source Control Interface
LFS uses Git Hooks. Make sure you have Cygwin installed. For more details, see “Configure MATLAB
on Windows” on page 34-23.
MATLAB does not support Git LFS locking. MATLAB has no integration with LFS commands such as
git lfs track. Use !git lfs track instead.
See Also
Related Examples
• “Clone from Git Repository” on page 33-47
34-26
Add Git Submodules
1 Right-click in the MATLAB Current Folder browser, and select Source Control > Submodules.
2 In the Submodules dialog box, click the + button.
3 In the Add Submodule dialog box, in the Remote box, specify a repository location. Optionally,
click Validate.
4 In the Path box, specify a location for the submodule and click OK. The Submodules dialog box
displays the status and details of the submodule.
5 Check the status message, and click Close.
Update Submodules
After using Pull to get the latest changes from a remote repository, check that submodules are up to
date by clicking Submodules and then click Update. If any submodule definition have changed, then
the update ensures that the submodule folder contains the correct files. Update applies to all child
submodules in the submodule hierarchy.
1 To get the latest version of a submodule, in the Submodules dialog box, click Fetch.
2 After fetching, you must merge. Check the Status message in the Submodules dialog box for
information about your current branch relative to the remote tracking branch in the repository.
When you see the message Behind, you need to merge in changes from the repository to your
local branch.
3 Click Branches and merge in the origin changes to your local branch using the Branches dialog
box. See “Fetch and Merge” on page 34-36.
If you want other users to obtain your changes in the submodule when they clone the parent folder,
make sure the index and head match.
1 In the Submodules dialog box, check the index and head values. The index points to the head
commit at the time you first cloned the submodule, or when you last committed the parent folder.
If the index and head do not match, you must update the index.
2 To update the index, commit your changes in the parent folder, and then click Push in the
Submodules dialog box. This action makes the index and head the same.
34-27
34 Source Control Interface
See Also
Related Examples
• “Retrieve Files from Git Repository” on page 34-29
34-28
Retrieve Files from Git Repository
1 Right-click in the white space (any blank area) in the Current Folder browser, and select Source
Control > Manage Files.
2 In the Manage Files Using Source Control dialog box, select Git from the Source control
integration list.
3 If you know your repository location, paste it into the Repository path field.
Otherwise, to browse for and validate the repository path to retrieve files from, click Change.
a In the Select a Repository dialog box, browse to your repository using the Remote button
.
b Click Validate to check the repository path.
If you see an authentication dialog box for your repository, enter the login information to
continue.
c If the path is valid, click OK. The dialog box closes and you return to the Manage Files Using
Source Control dialog box.
4 In the Manage Files Using Source Control dialog box, select the sandbox folder to store the
retrieved files and click Retrieve.
If you see an authentication dialog box for your repository, enter the login information to
continue.
See Also
Related Examples
• “Set Up Git Source Control” on page 34-23
• “Update Git File Status and Revision” on page 34-30
• “Branch and Merge with Git” on page 34-31
34-29
34 Source Control Interface
To refresh the status of all files in the repository, right-click the white space of the Current Folder
browser and select Source Control > Refresh Git status.
Caution Ensure you have registered binary files with Git before using Pull. If you do not, conflict
markers can corrupt your files. For more information, see “Register Binary Files with Git” on page 34-
25.
Pull fetches the latest changes and merges them into your current branch. If you are not sure what is
going to come in from the repository, use fetch to examine the changes first and then merge the
changes manually. For more information, see “Pull, Push and Fetch Files with Git” on page 34-35.
Pull might fail if you have conflicts. With a complicated change you might want to create a branch
from the origin, make some compatibility changes, then merge that branch into the main tracking
branch.
See Also
Related Examples
• “Retrieve Files from Git Repository” on page 34-29
• “Review Changes in Source Control” on page 34-7
34-30
Branch and Merge with Git
Create Branch
1 From within your Git repository folder, right-click the white space of the Current Folder browser
and select Source Control > Branches. In the Branches dialog box, you can view, switch,
create, and merge branches.
Tip You can inspect information about each commit node. Select a node in the Branch Browser
diagram to view the author, date, commit message, and changed files.
34-31
34 Source Control Interface
2 Select a source for the new branch. Click a node in the Branch Browser diagram, or enter a
unique identifier in the Source text box. You can enter a tag, branch name, or a unique prefix of
the SHA1 hash (for example, 73c637 to identify a specific commit). Leave the default to create a
branch from the head of the current branch.
3 Enter a name in the Branch name text box and click Create.
4 To work on the files on your new branch, switch your project to the branch.
In the Branches drop-down list, select the branch you want to switch to and click Switch.
5 Close the Branches dialog box and work on the files on your branch.
For next steps, see “Pull, Push and Fetch Files with Git” on page 34-35.
Switch Branch
1 From within your Git repository folder, right-click the white space of the Current Folder browser
and select Source Control > Branches.
2 In the Branches dialog box, in the Branches drop-down list, select the branch you want to and
click Switch.
34-32
Branch and Merge with Git
3 Close the Branches dialog box and work on the files on your branch.
Compare Branches
From within your Git repository folder, right-click the white space of the Current Folder browser and
select Source Control > Branches.
• To examine differences in a file between the current revision and its parent, right-click a file in the
tree under Differences from parent and select Show Difference.
• To examine differences in a file between any two revisions including revisions on two different
development branches, hold the Ctrl key and select the two different revisions. Right-click a file in
the tree under Differences from selection and select Show Difference.
MATLAB opens a comparison report. You can save a copy of the selected file on either revision. Right-
click a file and select Save As to save a copy of the file on the selected revision. Select Save Original
As to save a copy of the file on the prior revision. This is useful if you want to test how the code ran in
previous revisions or on other branches.
Merge Branches
Before you can merge branches, you must register binary files to prevent Git from inserting conflict
markers. See “Register Binary Files with Git” on page 34-25.
Tip After you fetch changes, you must merge. For more information, see “Fetch and Merge” on page
34-36.
1 From within your Git repository folder, right-click the white space of the Current Folder browser
and select Source Control and Branches.
2 In the Branches dialog box, from the Branches drop-down list, select a branch you want to
merge into the current branch, and click Merge.
3 Close the Branches dialog box and work on the files on your branch.
If the branch merge causes a conflict that Git cannot resolve automatically, an error dialog box
reports that automatic merge failed. Resolve the conflicts before proceeding.
Caution Do not move or delete files outside of MATLAB because this can cause errors on merge.
1 To keep your version of the file, right-click the file and select Mark Conflict Resolved.
2 Click Commit Modified Files to commit your change that marks the conflict resolved.
If you merge a branch and there is a conflict in a file, Git marks the file as conflicted and does not
modify the contents. Right-click the file and select Source Control > View Conflicts. A comparison
34-33
34 Source Control Interface
report opens that shows the differences between the file on your branch and the branch you want to
merge into. Decide how to resolve the conflict. See “Resolve Source Control Conflicts” on page 34-9.
Revert to Head
1 From within your Git repository folder, right-click the white space of the Current Folder browser
and select Source Control > Branches.
2 In the Branches dialog box, click Revert to Head to remove all local changes.
Delete Branches
1 In the Branches dialog box under Branch Browser, expand the Branches drop-down list, and
select the branch you want to delete.
2 On the far right, click the down arrow and select Delete Branch.
See Also
Related Examples
• “Set Up Git Source Control” on page 34-23
• “Pull, Push and Fetch Files with Git” on page 34-35
• “Resolve Source Control Conflicts” on page 34-9
34-34
Pull, Push and Fetch Files with Git
Note Before you can merge, you must register binary files to prevent Git from inserting conflict
markers. See “Register Binary Files with Git” on page 34-25.
Pull might fail if you have conflicts. With a complicated change you might want to create a branch
from the origin, make some compatibility changes, then merge that branch into the main tracking
branch.
To commit changes to the local repository, right-click the Current Folder browser and select Source
Control > View and Commit Changes.
To see if your local changes have moved ahead of the remote tracking branch, right-click the file or
white space of the Current Folder browser and select Source Control > View Details. The Git
information field indicates whether your committed local changes are ahead of, behind, or
coincident with the remote tracking branch.
To send local commits to the remote repository, right-click in the Current Folder browser and select
Source Control > Push. A message appears if you cannot push your changes directly because the
repository has moved on. Right-click in the Current Folder browser and select Source Control >
34-35
34 Source Control Interface
Fetch to fetch all changes from the remote repository. Merge branches and resolve conflicts, and
then you can push your changes.
Using Git, you cannot add empty folders to source control, so you cannot select Push and then clone
an empty folder. You can create an empty folder in MATLAB, but if you push changes and then sync a
new sandbox, then the empty folder does not appear in the new sandbox. To push empty folders to
the repository for other users to sync, create a gitignore file in the folder and then push your
changes.
Note After fetching, you must merge. Before you can merge branches, you must register binary files
to prevent Git from inserting conflict markers. See “Register Binary Files with Git” on page 34-25.
To fetch changes from the remote repository, right-click in the Current Folder browser and select
Source Control > Fetch. Fetch updates all of the origin branches in the local repository. Your
sandbox files do not change. To see others’ changes, you need to merge in the origin changes to your
local branches.
For information about your current branch relative to the remote tracking branch in the repository,
right-click the file or white space of the Current Folder browser and select Source Control > View
Details. The Git information field indicates whether your committed local changes are ahead of,
behind, or coincident with the remote tracking branch. When you see the message Behind, you need
to merge in changes from the repository to your local branch.
For example, if you are on the main branch, get all changes from the main branch in the remote
repository.
1 Right-click in the Current Folder browser and select Source Control > Fetch
2 Right-click in the Current Folder browser and select Source Control > Branches.
3 In the Branches dialog box, select origin/main in the Branches list.
4 Click Merge. The origin branch changes merge into the main branch in your sandbox.
If you right-click the Current Folder browser and select Source Control > View Details, the Git
information field indicates Coincident with /origin/main. You can now view the changes that
you fetched and merged from the remote repository in your local sandbox.
To create and manage stashes, in the Current Folder browser, right-click the white space in a folder
managed by Git and select Source Control > Stashes.
34-36
Pull, Push and Fetch Files with Git
• To create a stash containing your currently modified files, click New Stash.
• To view modified files in a stash, select the stash under Available Stashes. Right-click modified
files to view changes or save a copy.
• To apply the stash to your current branch and then delete the stash, click Pop.
• To apply the stash and keep it, click Apply.
• To delete the stash, click Drop.
See Also
Related Examples
• “Branch and Merge with Git” on page 34-31
• “Resolve Source Control Conflicts” on page 34-9
34-37
34 Source Control Interface
To move a file under source control, right-click the file in the Current Folder browser, select Source
Control > Move, and enter a new file location.
To rename a file under source control, right-click the file in the Current Folder browser, select
Source Control > Rename, and enter a new file name.
To delete a file from the repository, mark the file for deletion.
• To mark a file for deletion from the repository and retain a local copy, right-click the file in the
Current Folder browser. Select Source Control and then Delete from SVN or Delete from Git.
When the file is marked for deletion from source control, the symbol changes to Deleted . The
file is removed from the repository at the next commit.
• To mark a file for deletion from the repository and from your disk, right-click the file in the
Current Folder browser. Select Source Control and then Delete from SVN and disk or Delete
from Git and disk. The file disappears from the Current Folder browser and is immediately
deleted from your disk. The file is removed from the repository at the next commit.
See Also
Related Examples
• “Mark Files for Addition to Source Control” on page 34-8
• “Commit Modified Files to Source Control” on page 34-12
34-38
Customize External Source Control to Use MATLAB for Diff and Merge
You can customize external source control tools to use the MATLAB Comparison Tool for diff and
merge. If you want to compare MATLAB files such as live scripts, MAT, SLX, or MDL files from your
source control tool, then you can configure your source control tool to open the MATLAB Comparison
Tool. The MATLAB Comparison Tool provides tools for merging MathWorks files and is compatible
with popular software configuration management and version control systems. You can use the
automerge tool with Git to automatically merge branches that contain changes in different
subsystems in the same SLX file.
To set up your source control tool to use MATLAB as the application for diff and merge, you must first
determine the full paths of the mlDiff, mlMerge, and mlAutoMerge executable files, and then
follow the recommended steps for the source control tool you are using.
Finding the Full Paths for MATLAB Diff, Merge, and AutoMerge
To get the required file paths and enable external source control tools to reuse open MATLAB
sessions, run this command in MATLAB:
comparisons.ExternalSCMLink.setup()
This command sets the MATLAB preference, under Comparison, called Allow external source
control tools to use open MATLAB sessions for diffs and merges.
This command also displays the file paths to copy and paste into your source control tool setup:
• On Windows:
Diff: matlabroot\bin\win64\mlDiff.exe
Merge: matlabroot\bin\win64\mlMerge.exe
AutoMerge: matlabroot\bin\win64\mlAutoMerge.bat
• On Linux:
Diff: matlabroot/bin/glnxa64/mlDiff
Merge: matlabroot/bin/glnxa64/mlMerge
AutoMerge: matlabroot/bin/glnxa64/mlAutoMerge
• On Mac:
Diff: matlabroot/bin/maci64/mlDiff
Merge: matlabroot/bin/maci64/mlMerge
34-39
34 Source Control Interface
AutoMerge: matlabroot/bin/maci64/mlAutoMerge
where matlabroot is replaced with the full path to your installation, for example, C:\Program
Files\MATLAB\R2020b.
Note Your diff and merge operations use open MATLAB sessions when available, and only open
MATLAB when necessary. The operations only use the specified MATLAB installation.
comparisons.ExternalSCMLink.setupGitConfig()
This command displays the full paths of the mlDiff, mlMerge, and mlAutoMerge executable
files. It also automatically populates the global .gitconfig file. For example:
[difftool "mlDiff"]
cmd = \"C:/Program Files/MATLAB/R2020b/bin/win64/mlDiff.exe\" $LOCAL $REMOTE
[mergetool "mlMerge"]
cmd = \"C:/Program Files/MATLAB/R2020b/bin/win64/mlMerge.exe\" $BASE $LOCAL $REMOTE $MERGED
[merge "mlAutoMerge"]
driver = \"C:/Program Files/MATLAB/R2020b/bin/win64/mlAutoMerge.bat\" %O %A %B %A
Note You need to do step 1 only once for your Git setup.
2 Configure your repository to use the mlAutoMerge executable file. Open the .gitattributes
file in your repository and add:
Now, when you merge branches that contain changes in different subsystems in the same SLX
file, MATLAB handles the merge automatically.
To run the MATLAB diff and merge tools from command-line Git, use git difftool and git
mergetool:
• To compare two revisions of a model using the MATLAB diff tool, type:
git difftool -t mlDiff <revisonID1> <revisionID2> myModel.slx
If you do not provide revision IDs, git difftool compares the working copy to the repository
copy.
If you do not specify which model you want to compare, command-line Git will go through all
modified files and ask you if you want to compare them one by one.
• To resolve a merge conflict in a model using the MATLAB merge tool, type:
git mergetool -t mlMerge myModel.slx
If you do not specify which model you want to merge, command-line Git will go through all files
and ask you if you want to merge them one by one.
34-40
Customize External Source Control to Use MATLAB for Diff and Merge
SourceTree
SourceTree is an interactive GUI tool that visualizes and manages Git repositories for Windows and
Mac.
1 Configure the MATLAB diff and merge tools as SourceTree external tools:
Tip Customize the full path of the mlDiff, mlMerge, and mlAutoMerge executables to match both
the MATLAB installation and the operating system you are using. For more information, see “Finding
the Full Paths for MATLAB Diff, Merge, and AutoMerge” on page 34-39.
To use the MATLAB diff tool from within SourceTree, right-click a modified file under Unstaged files
and select External Diff.
To use the MATLAB merge tool when SourceTree detects a merge conflict, select the Uncommitted
changes branch, right-click a modified file, and select Resolve Conflicts > Launch External
Merge Tool.
With TortoiseSVN, you can customize your diff and merge tools based on the file extension. For
example, to use MATLAB diff and merge tools for SLX files:
1 Right-click in any file explorer window and select TortoiseSVN > Settings to open TortoiseSVN
settings.
2 In the Settings sidebar, select Diff Viewer. Click Advanced to specify the diff application based
on file extensions.
3 Click Add and fill the fields with the extension and the mlDiff executable path:
Filename, extension or mime-type: .slx
External Program: "C:\Program Files\MATLAB\R2020b\bin\win64\mlDiff.exe" %base %mine
4 Click OK and repeat the same steps to add another file extension.
34-41
34 Source Control Interface
5 In the Settings sidebar, select Diff ViewerMerge Tool. Click Advanced to specify the merge
application based on file extensions.
6 Click Add and fill the fields with the extension and mlMerge executable path:
Filename, extension or mime-type: .slx
External Program: "C:\Program Files\MATLAB\R2020b\bin\win64\mlMerge.exe" %base %mine %theirs %merged
7 Click OK and repeat the same steps to add another file extension.
You can now use the MATLAB tools for diff and merge the same way you would use the TortoiseSVN
default diff and merge applications.
Note Automerging binary files with SVN , such as SLX files, is not supported.
With Perforce® P4V, you can customize your diff and merge tools based on the file extension. To use
MATLAB diff and merge tools for SLX files, for example:
Tip Customize the full path of the mlDiff and mlMerge executables to match both the MATLAB
installation and the operating system you are using. For more information, see “Finding the Full
Paths for MATLAB Diff, Merge, and AutoMerge” on page 34-39.
You can now use the MATLAB tools for diff and merge the same way you would use the Perforce
default diff and merge applications.
See Also
Related Examples
• “Compare Files and Folders and Merge Files”
34-42
Customize External Source Control to Use MATLAB for Diff and Merge
34-43
34 Source Control Interface
Note MSSCCI support has been removed. Replace this functionality with one of the following
options.
• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.
If you use source control systems to manage your files, you can interface with the systems to perform
source control actions from within the MATLAB, Simulink, and Stateflow products. Use menu items in
the MATLAB, Simulink, or Stateflow products, or run functions in the MATLAB Command Window to
interface with your source control systems.
The source control interface on Windows works with any source control system that conforms to the
Microsoft Common Source Control standard, Version 1.1. If your source control system does not
conform to the standard, use a Microsoft Source Code Control API wrapper product for your source
control system so that you can interface with it from the MATLAB, Simulink, and Stateflow products.
This documentation uses the Microsoft Visual SourceSafe® software as an example. Your source
control system might use different terminology and not support the same options or might use them
in a different way. Regardless, you should be able to perform similar actions with your source control
system based on this documentation.
Perform most source control interface actions from the Current Folder browser. You can also perform
many of these actions for a single file from the MATLAB Editor, a Simulink model window, or a
Stateflow chart window—for more information, see “Access MSSCCI Source Control from Editors” on
page 34-58.
34-44
Set Up MSSCCI Source Control
Note MSSCCI support has been removed. Replace this functionality with one of the following
options.
• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.
In this section...
“Create Projects in Source Control System” on page 34-45
“Specify Source Control System with MATLAB Software” on page 34-46
“Register Source Control Project with MATLAB Software” on page 34-47
“Add Files to Source Control” on page 34-49
All files in a folder must belong to the same source control project. Be sure the working folder for the
project in the source control system specifies the correct path to the folder on disk.
This example uses the project my_thesis_files in Microsoft Visual SourceSafe. This illustration of
the Current Folder browser shows the path to the folder on disk, D:\my_thesis_files.
34-45
34 Source Control Interface
The following illustration shows the example project in the source control system.
To set the working folder in Microsoft Visual SourceSafe for this example, select my_thesis_files,
right-click, select Set Working Folder from the context menu, and specify D:\my_thesis_files in
the resulting dialog box.
The currently selected system is shown in the Preferences dialog box. The list includes all installed
source control systems that support the Microsoft Common Source Control standard.
Select the source control system you want to interface with and click OK.
34-46
Set Up MSSCCI Source Control
MATLAB remembers preferences between sessions, so you only need to perform this action again
when you want to access a different source control system.
If you run a 64-bit version of MATLAB and want MATLAB to interface with your source control
system, your source control system must be 64-bit compliant. If you have a 32-bit source control
system, or if you have a 64-bit source control system running in 32-bit compatibility mode, MATLAB
cannot use it. In that event, MATLAB displays a warning about the problem in the Source Control
preference pane.
1 In the MATLAB Current Folder browser, select a file that is in the folder you want to associate
with a project in your source control system. For example, select D:\my_thesis_files
\wind.m. This will associate all files in the my_thesis_files folder.
2 Right-click, and from the context menu, select Source Control > Register
Name_of_Source_Control_System Project with MATLAB. The
Name_of_Source_Control_System is the source control system you selected using preferences
as described in “Specify Source Control System with MATLAB Software” on page 34-46.
34-47
34 Source Control Interface
3 In the resulting Name_of_Source_Control_System Login dialog box, provide the user name
and password you use to access your source control system, and click OK.
4 In the resulting Choose project from Name_of_Source_Control_System dialog box, select the
source control system project to associate with the folder and click OK. This example shows
my_thesis_files.
34-48
Set Up MSSCCI Source Control
The selected file, its folder, and all files in the folder, are associated with the source control
system project you selected. For the example, MATLAB associates all files in
D:\my_thesis_files with the source control project my_thesis_files.
1 In the Current Folder browser, select files you want to add to the source control system.
2 Right-click, and from the context menu, select Source Control > Add to Source Control.
3 The resulting Add to source control dialog box lists files you selected to add. You can add text
in the Comments field. If you expect to use the files soon, select the Keep checked out check
box (which is selected by default). Click OK.
If you try to add an unsaved file, the file is automatically saved upon adding.
34-49
34 Source Control Interface
Note MSSCCI support has been removed. Replace this functionality with one of the following
options.
• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.
In this section...
“Check Files Into Source Control” on page 34-50
“Check Files Out of Source Control” on page 34-50
“Undoing the Checkout” on page 34-51
Before checking files into and out of your source control system from the MATLAB desktop, be sure to
set up your system for use with MATLAB as described in “Set Up MSSCCI Source Control” on page
34-45.
1 In the Current Folder browser, select the files to check in. A file can be open or closed when you
check it in, but it must be saved, that is, it cannot contain unsaved changes.
2 Right-click, and from the context menu, select Source Control > Check In.
3 In the resulting Check in file(s) dialog box, you can add text in the Comments field. If you want
to continue working on the files, select the check box Keep checked out. Click OK.
If a file contains unsaved changes when you try to check it in, you will be prompted to save the
changes to complete the checkin. If you did not keep the file checked out and you keep the file open,
note that it is a read-only version.
34-50
Check Files In and Out from MSSCCI Source Control
After checking out a file, make changes to it in MATLAB or another product, and save the file. For
example, edit a file in the Editor.
If you try to change a file without first having checked it out, the file is read-only, as seen in the title
bar, and you will not be able to save any changes. This protects you from accidentally overwriting the
source control version of the file.
If you end the MATLAB session, the file remains checked out. You can check in the file from within
MATLAB during a later session, or folder from your source control system.
1 In the MATLAB Current Folder browser, select the files for which you want to undo the checkout.
2 Right-click, and from the context menu, select Source Control > Undo Checkout.
The MATLAB Undo checkout dialog box opens, listing the files you selected.
3 Click OK.
34-51
34 Source Control Interface
Note MSSCCI support has been removed. Replace this functionality with one of the following
options.
• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.
In this section...
“Getting the Latest Version of Files for Viewing or Compiling” on page 34-52
“Removing Files from the Source Control System” on page 34-53
“Showing File History” on page 34-53
“Comparing the Working Copy of a File to the Latest Version in Source Control” on page 34-54
“Viewing Source Control Properties of a File” on page 34-55
“Starting the Source Control System” on page 34-56
1 In the MATLAB Current Folder browser, select the folders or files that you want to get. If you
select files, you cannot select folders too.
2 Right-click, and from the context menu, select Source Control > Get Latest Version.
The MATLAB Get latest version dialog box opens, listing the files or folders you selected.
3 Click OK.
You can now open the file to view it, run the file, or check out the file for editing.
34-52
Additional MSSCCI Source Control Actions
1 In the MATLAB Current Folder browser, select the files you want to remove.
2 Right-click, and from the context menu, select Source Control > Remove from Source
Control.
The MATLAB Remove from source control dialog box opens, listing the files you selected.
3 Click OK.
1 In the MATLAB Current Folder browser, select the file for which you want to view the history.
2 Right-click, and from the context menu, select Source Control > History.
A dialog box, which is specific to your source control system, opens. For Microsoft Visual
SourceSafe, the History Options dialog box opens, as shown in the following example
illustration.
3 Complete the dialog box to specify the range of history you want for the selected file and click
OK. For example, enter my_name for User.
The history presented depends on your source control system. For Microsoft Visual SourceSafe,
the History dialog box opens for that file, showing the file's history in the source control system.
34-53
34 Source Control Interface
1 In the MATLAB Current Folder browser, select the file for which you want to view differences.
This is a file that has been checked out and edited.
2 Right-click, and from the context menu, select Source Control > Differences.
A dialog box, which is specific to your source control system, opens. For Microsoft Visual
SourceSafe, the Difference Options dialog box opens.
3 Review the default entries in the dialog box, make any needed changes, and click OK. The
following example is for Microsoft Visual SourceSafe.
34-54
Additional MSSCCI Source Control Actions
The method of presenting differences depends on your source control system. For Microsoft
Visual SourceSafe, the Differences for dialog box opens. This highlights the differences between
the working copy of the file and the latest checked-in version of the file.
1 In the MATLAB Current Folder browser, select the file for which you want to view properties.
2 Right-click, and from the context menu, select Source Control > Properties.
A dialog box, which is specific to your source control system, opens. The following example shows the
Microsoft Visual SourceSafe properties dialog box.
34-55
34 Source Control Interface
The interface to your source control system opens, showing the source control project associated
with the current folder in MATLAB. The following example shows the Microsoft Visual SourceSafe
Explorer interface.
34-56
Additional MSSCCI Source Control Actions
34-57
34 Source Control Interface
Note MSSCCI support has been removed. Replace this functionality with one of the following
options.
• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.
You can create or open a file in the Editor, the Simulink or Stateflow products and perform most
source control actions from their File > Source Control menus, rather than from the Current Folder
browser. Following are some differences in the source control interface process when you use the
Editor, Simulink, or Stateflow:
34-58
Troubleshoot MSSCCI Source Control Problems
Note MSSCCI support has been removed. Replace this functionality with one of the following
options.
• Use a source control system that is part of the MathWorks “Source Control Integration” with the
Current Folder browser.
• Use the Source Control Software Development Kit to create a plug-in for your source control.
• Use the MATLAB system function to access the command-line API for your source control tool.
This option does not provide integration with the MATLAB Current Folder browser menus or
source control status column.
In this section...
“Source Control Error: Provider Not Present or Not Installed Properly” on page 34-59
“Restriction Against @ Character” on page 34-60
“Add to Source Control Is the Only Action Available” on page 34-60
“More Solutions for Source Control Problems” on page 34-60
Often, this error occurs because a registry key that MATLAB requires from the source control
application is not present. Make sure this registry key is present:
HKEY_LOCAL_MACHINE\SOFTWARE\SourceCodeControlProvider\
InstalledSCCProviders
HKEY_LOCAL_MACHINE\SOFTWARE\Microsoft\SourceSafe\SccServerPath
This registry key has a path to a DLL-file in the file system. Make sure the DLL-file exists in that
location. If you are not familiar with registry keys, ask your system administrator for help.
If this does not solve the problem and you use Microsoft Visual SourceSafe, try running a client setup
for your source control application. When SourceSafe is installed on a server for a group to use, each
machine client can run a setup but is not required to do so. However, some applications that interface
with SourceSafe, including MATLAB, require you to run the client setup. Run the client setup, which
should resolve the problem.
34-59
34 Source Control Interface
You might be able to work around this restriction by quoting nonstandard characters in file names,
such as with an escape sequence, which some source control systems allow. Consult your source
control system documentation or technical support resources for a workaround.
34-60
35
Unit Testing
35-2
Write Test Using Live Script
• The name of the test file must start or end with the word 'test', which is case-insensitive. If the file
name does not start or end with the word 'test', the tests in the file might be ignored in certain
cases.
• Place each unit test into a separate section of the live-script file. If a section has a heading in the
Heading 1 style, the heading becomes the name of the test element. Otherwise, MATLAB assigns a
name to the test.
• Consider how you are running your live-script-based test. If you run the test using the Run
buttons in the Live Editor and MATLAB encounters a test failure, then it stops execution of the
script and does not run any remaining tests. If you run the live script using the unit testing
framework, such as with the runtests function, then if MATLAB encounters a test failure, it still
runs remaining tests.
• When a live script runs as a test, variables defined in one test are not accessible within other
tests. Similarly, variables defined in other workspaces are not accessible to the tests.
Outside of this example, in your current MATLAB folder, create a function in a file, rightTri.m. This
function takes lengths of two sides of a triangle as input and returns the three angles of the
corresponding right triangle. The input sides are the two shorter edges of the triangle, not the
hypotenuse.
type rightTri.m
A = atand(sides(1)/sides(2));
B = atand(sides(2)/sides(1));
hypotenuse = sides(1)/sind(A);
C = asind(hypotenuse*sind(A)/sides(1));
angles = [A B C];
end
You can include equations and images in your live script to help document the test. Create the
following test for the small angle approximation. Typically, when you compare floating-point values,
you specify a tolerance for the comparison.
The rightTri function should return values consistent with the small angle approximation, such that
sin(θ) ≈ θ.
35-3
35 Unit Testing
∑ ak = 180∘
k
You can have multiple assert statements in the same test. However, if the first assertion fails, the
MATLAB does not evaluate the remaining statements.
The sum of all angles of the resulting right triangle should always be 180 degrees.
∘ ∘ ∘
Test that the sides of the triangle reduce to 1 and 3. In which case, the angles are 30 , 60 , and 90 .
tol = 1e-10;
angles = rightTri([2 2*sqrt(3)]);
assert(abs(angles(1)-30) <= tol)
assert(abs(angles(2)-60) <= tol)
assert(abs(angles(3)-90) <= tol)
For isosceles triangles, both of the non-right angles must be 45 degrees; otherwise assert throws an
error.
Test that two sides of the triangle are equal. In which case, the corresponding angles are equal.
To run your tests, best practice is to use the testing framework via the runtests function instead of
the Run button in the Live Editor. The testing framework provides additional diagnostic information.
In the event of a test failure, the framework runs subsequent tests but the Run button in the Live
35-4
Write Test Using Live Script
Editor does not. For example, to run this test at the MATLAB command prompt, type result =
runtests('TestRightTriLiveScriptExample'). For more information, see runtests.
See Also
runtests | assert
Related Examples
• “Write Script-Based Unit Tests” on page 35-6
• “Write Function-Based Unit Tests” on page 35-20
35-5
35 Unit Testing
Create this function in a file, rightTri.m, in your current MATLAB® folder. This function takes
lengths of two sides of a triangle as input and returns the three angles of the corresponding right
triangle. The input sides are the two shorter edges of the triangle, not the hypotenuse.
A = atand(sides(1)/sides(2));
B = atand(sides(2)/sides(1));
hypotenuse = sides(1)/sind(A);
C = asind(hypotenuse*sind(A)/sides(1));
angles = [A B C];
end
In your working folder, create a new script, rightTriTest.m. Each unit test checks a different
output of the rightTri function. A test script must adhere to the following conventions:
• The name of the test file must start or end with the word 'test', which is case-insensitive. If the file
name does not start or end with the word 'test', the tests in the file might be ignored in certain
cases.
• Place each unit test into a separate section of the script file. Each section begins with two percent
signs (%%), and the text that follows on the same line becomes the name of the test element. If no
text follows the %%, MATLAB assigns a name to the test. If MATLAB encounters a test failure, it
still runs remaining tests.
• In a test script, the shared variable section consists of any code that appears before the first
explicit code section (the first line beginning with %%). Tests share the variables that you define in
this section. Within a test, you can modify the values of these variables. However, in subsequent
tests, the value is reset to the value defined in the shared variables section.
• In the shared variables section (first code section), define any preconditions necessary for your
tests. If the inputs or outputs do not meet this precondition, MATLAB does not run any of the
tests. MATLAB marks the tests as failed and incomplete.
• When a script is run as a test, variables defined in one test are not accessible within other tests
unless they are defined in the shared variables section (first code section). Similarly, variables
defined in other workspaces are not accessible to the tests.
• If the script file does not include any code sections, MATLAB generates a single test element from
the full contents of the script file. The name of the test element is the same as the script file name.
In this case, if MATLAB encounters a failed test, it halts execution of the entire script.
In rightTriTest.m, write four tests to test the output of rightTri. Use the assert function to
test the different conditions. In the shared variables section, define four triangle geometries and
define a precondition that the rightTri function returns a right triangle.
35-6
Write Script-Based Unit Tests
% test triangles
tri = [7 9];
triIso = [4 4];
tri306090 = [2 2*sqrt(3)];
triSkewed = [1 1500];
% preconditions
angles = rightTri(tri);
assert(angles(3) == 90,'Fundamental problem: rightTri not producing right triangle')
angles = rightTri(triIso);
assert(sum(angles) == 180)
angles = rightTri(tri306090);
assert(sum(angles) == 180)
angles = rightTri(triSkewed);
assert(sum(angles) == 180)
Test 1 tests the summation of the triangle angles. If the summation is not equal to 180 degrees,
assert throws an error.
Test 2 tests that if two sides are equal, the corresponding angles are equal. If the non-right angles are
not both equal to 45 degrees, the assert function throws an error.
Test 3 tests that if the triangle sides are 1 and sqrt(3), the angles are 30, 60, and 90 degrees. If this
condition is not true, assert throws an error.
Test 4 tests the small-angle approximation. The small-angle approximation states that for small angles
the sine of the angle in radians is approximately equal to the angle. If it is not true, assert throws an
error.
35-7
35 Unit Testing
Run Tests
Execute the runtests function to run the four tests in rightTriTest.m. The runtests function
executes each test in each code section individually. If Test 1 fails, MATLAB still runs the remaining
tests. If you execute rightTriTest as a script instead of by using runtests, MATLAB halts
execution of the entire script if it encounters a failed assertion. Additionally, when you run tests using
the runtests function, MATLAB provides informative test diagnostics.
result = runtests('rightTriTest');
Running rightTriTest
..
================================================================================
Error occurred in rightTriTest/Test3_30_60_90Triangle and it did not run to completion.
---------
Error ID:
---------
'MATLAB:assertion:failed'
--------------
Error Details:
--------------
Error using rightTriTest (line 31)
Assertion failed.
================================================================================
.
================================================================================
Error occurred in rightTriTest/Test4_SmallAngleApproximation and it did not run to completion.
---------
Error ID:
---------
''
--------------
Error Details:
--------------
Error using rightTriTest (line 39)
Problem with small angle approximation
================================================================================
.
Done rightTriTest
__________
Failure Summary:
The test for the 30-60-90 triangle and the test for the small-angle approximation fail in the
comparison of floating-point numbers. Typically, when you compare floating-point values, you specify
a tolerance for the comparison. In Test 3 and Test 4, MATLAB throws an error at the failed assertion
and does not complete the test. Therefore, the test is marked as both Failed and Incomplete.
To provide diagnostic information (Error Details) that is more informative than 'Assertion
failed' (Test 3), consider passing a message to the assert function (as in Test 4). Or you can also
consider using function-based unit tests.
35-8
Write Script-Based Unit Tests
Save rightTriTest.m as rightTriTolTest.m, and revise Test 3 and Test 4 to use a tolerance. In
Test 3 and Test 4, instead of asserting that the angles are equal to an expected value, assert that the
difference between the actual and expected values is less than or equal to a specified tolerance.
Define the tolerance in the shared variables section of the test script so it is accessible to both tests.
For script-based unit tests, manually verify that the difference between two values is less than a
specified tolerance. If instead you write a function-based unit test, you can access built-in constraints
to specify a tolerance when comparing floating-point values.
% test triangles
tri = [7 9];
triIso = [4 4];
tri306090 = [2 2*sqrt(3)];
triSkewed = [1 1500];
% preconditions
angles = rightTri(tri);
assert(angles(3) == 90,'Fundamental problem: rightTri not producing right triangle')
angles = rightTri(triIso);
assert(sum(angles) == 180)
angles = rightTri(tri306090);
assert(sum(angles) == 180)
angles = rightTri(triSkewed);
assert(sum(angles) == 180)
35-9
35 Unit Testing
result = runtests('rightTriTolTest');
Running rightTriTolTest
....
Done rightTriTolTest
__________
rt = table(result)
rt =
4×6 table
See Also
runtests | assert
Related Examples
• “Write Script-Based Test Using Local Functions” on page 35-11
• “Write Function-Based Unit Tests” on page 35-20
35-10
Write Script-Based Test Using Local Functions
Create this function in a file, approxSinCos.m, in your current MATLAB folder. This function takes
an angle in radians and approximates the sine and cosine of the angle using Taylor series.
%% Test 0rad
% Test expected values of 0
[sinApprox,cosApprox] = approxSinCos(0);
assertWithAbsTol(sinApprox,0)
assertWithRelTol(cosApprox,1)
%% Test 2pi
% Test expected values of 2pi
[sinApprox,cosApprox] = approxSinCos(2*pi);
assertWithAbsTol(sinApprox,0)
assertWithRelTol(cosApprox,1)
function assertWithAbsTol(actVal,expVal,varargin)
35-11
35 Unit Testing
function assertWithRelTol(actVal,expVal,varargin)
% Helper function to assert equality within a relative tolerance.
% Takes two values and an optional message and compares
% them within a relative tolerance of 0.1%.
relTol = 0.001;
tf = abs(expVal - actVal) <= relTol.*abs(expVal);
assert(tf, varargin{:});
end
Each unit test uses assert to check different output of the approxSinCos function. Typically, when
you compare floating-point values, you specify a tolerance for the comparison. The local functions
assertWithAbsTol and assertWithRelTol are helper functions to compute whether the actual
and expected values are equal within the specified absolute or relative tolerance.
• Test 0rad tests whether the computed and expected values for an angle of 0 radians are within
an absolute tolerance of 1e-6 or a relative tolerance 0.1%. Typically, you use absolute tolerance to
compare values close to 0.
• Test 2pi tests whether the computed and expected values for an angle of radians are equal
within an absolute tolerance of 1e-6 or a relative tolerance 0.1%.
• Test pi over 4 equality tests whether the sine and cosine of are equal within a relative
tolerance of 0.1%.
• Test matches MATLAB fcn tests whether the computed sine and cosine of are equal to
the values from the sin and cos functions within a relative tolerance of 0.1%.
Run Tests
Execute the runtests function to run the four tests in approxSinCosTest.m. The runtests
function executes each test individually. If one test fails, MATLAB still runs the remaining tests. If you
execute approxSinCosTest as a script instead of using runtests, MATLAB halts execution of the
entire script if it encounters a failed assertion. Additionally, when you run tests using the runtests
function, MATLAB provides informative test diagnostics.
results = runtests('approxSinCosTest');
Running approxSinCosTest
....
Done approxSinCosTest
__________
rt = table(results)
35-12
Write Script-Based Test Using Local Functions
rt =
4x6 table
See Also
runtests | assert
Related Examples
• “Write Script-Based Unit Tests” on page 35-6
More About
• “Add Functions to Scripts” on page 18-12
35-13
35 Unit Testing
Typically, with script-based tests, you create a test file, and pass the file name to the runtests
function without explicitly creating a suite of Test objects. If you create an explicit test suite, there
are additional features available in script-based testing. These features include selecting tests and
using plugins to customize the test runner. For additional functionality, consider using “Function-
Based Unit Tests” or “Class-Based Unit Tests”.
Also, you can create a test suite from all the test files in a specified folder using the
matlab.unittest.TestSuite.fromFolder method. If you know the name of a particular test in
your script-based test file, you can create a test suite from that test using
matlab.unittest.TestSuite.fromName.
Test Selection
With an explicit test suite, use selectors to refine your suite. Several of the selectors are applicable
only for class-based tests, but you can select tests for your suite based on the test name:
• Use the 'Name' name-value pair argument in a suite generation method, such as
matlab.unittest.TestSuite.fromFile.
• Use a selectors instance and optional constraints instance.
35-14
Extend Script-Based Tests
import matlab.unittest.selectors.HasName
import matlab.unittest.constraints.ContainsSubstring
import matlab.unittest.TestSuite.fromFile
f = 'rightTriTolTest.m';
selector = HasName(ContainsSubstring('Triangle'));
% fromFile, selector
suite = TestSuite.fromFile(f,selector)
% selectIf, selector
fullSuite = TestSuite.fromFile(f);
suite = selectIf(fullSuite,selector)
If you use one of the suite creation methods with a selector or name-value pair, the testing framework
creates the filtered suite. If you use the selectIf method, the testing framework creates a full test
suite and then filters it. For large test suites, this approach can have performance implications.
After you run tests, you can access recorded diagnostics using the DiagnosticRecord field in the
Details property on the TestResult object. For example, if your test results are stored in the
variable results, then result(2).Details.DiagnosticRecord contains the recorded
diagnostics for the second test in the suite.
The recorded diagnostics are DiagnosticRecord objects. To access particular types of test
diagnostics for a test, use the selectFailed, selectPassed, selectIncomplete, and
selectLogged methods of the DiagnosticRecord class.
35-15
35 Unit Testing
For example,use test suite, suite, to create a silent test runner and run the tests with the run
method of TestRunner.
runner = matlab.unittest.TestRunner.withNoPlugins;
results = runner.run(suite);
Use plugins to customize the test runner further. For example, you can redirect output, determine
code coverage, or change how the test runner responds to warnings. For more information, see “Add
Plugin to Test Runner” on page 35-95 and the plugins classes.
See Also
plugins | selectors | matlab.unittest.constraints | TestRunner | TestSuite
Related Examples
• “Add Plugin to Test Runner” on page 35-95
35-16
Run Tests in Editor
function testA(testCase)
verifyEqual(testCase,5,5)
end
function testB(testCase)
verifyGreaterThan(testCase,42,13)
end
function testC(testCase)
verifySubstring(testCase,'hello, world','llo')
end
When you save the test, the Run section in the Editor tab changes to Run Tests.
Click the Run Tests icon. MATLAB displays the command it uses to run the tests in the Command
Window, and the test output follows. MATLAB runs all three tests from sampleTest.m.
runtests('sampleTest')
Running sampleTest
...
Done sampleTest
__________
ans =
Name
Passed
Failed
Incomplete
Duration
Details
Totals:
35-17
35 Unit Testing
In the Editor, place your cursor in the testB function and click Run Current Test. MATLAB runs
testB only.
runtests('sampleTest','ProcedureName','testB')
Running sampleTest
.
Done sampleTest
__________
ans =
Name: 'sampleTest/testB'
Passed: 1
Failed: 0
Incomplete: 0
Duration: 9.9411e-04
Details: [1×1 struct]
Totals:
1 Passed, 0 Failed, 0 Incomplete.
0.00099411 seconds testing time.
In addition to running tests, you can customize the test run using the test options under Run Tests.
(Click the down arrow under Run Tests to access the full option list.) MATLAB uses test options
whether you run all the tests in a file or just the test at your cursor location. When you select a test
option, the selection persists for the duration of your current MATLAB session.
35-18
Run Tests in Editor
You can also run the tests of this example in the Live Editor by saving them in a file with a .mlx
extension and using the Run section in the Live Editor tab.
See Also
runtests
35-19
35 Unit Testing
The main function collects all of the local test functions into a test array. The name of the main
function corresponds to the name of your test file and should start or end with the word 'test', which
is case-insensitive. If the file name does not start or end with the word 'test', the tests in the file
might be ignored in certain cases. In this sample case, the MATLAB file is exampleTest.m. The main
function needs to make a call to functiontests to generate a test array, tests. Use
localfunctions as the input to functiontests to automatically generate a cell array of function
handles to all the local functions in your file. This is a typical main function.
Individual test functions are included as local functions in the same MATLAB file as the main (test-
generating) function. These test function names must begin or end with the case-insensitive word,
‘test’. Each of the local test functions must accept a single input, which is a function test case object,
testCase. The testing framework automatically generates this object. For more information on
creating test functions, see “Write Simple Test Case Using Functions” on page 35-24 and “Table of
Verifications, Assertions, and Other Qualifications” on page 35-44. This is a typical example of
skeletal local-test functions.
function testFunctionOne(testCase)
% Test specific code
end
function testFunctionTwo(testCase)
% Test specific code
end
Setup and teardown code, also referred to as test fixture functions, set up the pretest state of the
system and return it to the original state after running the test. There are two types of these
functions: file fixture functions that run once per test file, and fresh fixture functions that run before
35-20
Write Function-Based Unit Tests
and after each local test function. These functions are not required to generate tests. In general, it is
preferable to use fresh fixtures over file fixtures to increase unit test encapsulation.
A function test case object, testCase, must be the only input to file fixture and fresh fixture
functions. The testing framework automatically generates this object. The TestCase object is a
means to pass information between setup functions, test functions, and teardown functions. Its
TestData property is, by default, a struct, which allows easy addition of fields and data. Typical
uses for this test data include paths and graphics handles. For an example using the TestData
property, see “Write Test Using Setup and Teardown Functions” on page 35-27.
File Fixture Functions
Use file fixture functions to share setup and teardown functions across all the tests in a file. The
names for the file fixture functions must be setupOnce and teardownOnce, respectively. These
functions execute a single time for each file. You can use file fixtures to set a path before testing, and
then reset it to the original path after testing. This is a typical example of skeletal file fixture setup
and teardown code.
Use fresh fixture functions to set up and tear down states for each local test function. The names for
these fresh fixture functions must be setup and teardown, respectively. You can use fresh fixtures to
obtain a new figure before testing and to close the figure after testing. This is typical example of
skeletal test function level setup and teardown code.
%% Test Functions
function testFunctionOne(testCase)
% Test specific code
end
function testFunctionTwo(testCase)
% Test specific code
end
35-21
35 Unit Testing
To run tests from the command prompt, use the runtests function with your MATLAB test file as
input. For example:
results = runtests('exampleTest.m')
results = run(exampleTest)
For more information on running tests see runtests and “Run Tests for Various Workflows” on page
35-91.
35-22
Write Function-Based Unit Tests
See Also
runtests | functiontests | localfunctions
Related Examples
• “Write Simple Test Case Using Functions” on page 35-24
• “Write Test Using Setup and Teardown Functions” on page 35-27
35-23
35 Unit Testing
This example shows how to write a function-based test to qualify the correctness of a function defined
in a file in your current folder. The quadraticSolver function takes as inputs the coefficients of a
quadratic polynomial and returns the roots of that polynomial. If the coefficients are specified as
nonnumeric values, the function throws an error.
function roots = quadraticSolver(a,b,c)
% quadraticSolver returns solutions to the
% quadratic equation a*x^2 + b*x + c = 0.
end
Create Tests
To test the quadraticSolver function, create the test file quadraticSolverTest.m in your
current folder. Then, define a main function and two local functions in the file to test
quadraticSolver against real and imaginary solutions. The name of the main and local functions
must start or end with the word "test", which is case-insensitive. Additionally, the name of the main
function must correspond to the name of your test file.
To run function-based unit tests, you must define a main function that collects all of the local test
functions into a test array. Define the main function quadraticSolverTest in your test file. The
main function calls functiontests to generate the test array tests. Pass localfunctions to
functiontests to automatically generate a cell array of function handles to the local functions in
your file.
function tests = quadraticSolverTest
tests = functiontests(localfunctions);
end
Add local functions to the test file to test the quadraticSolver function against real and imaginary
solutions. The order of the tests within the file does not matter. Each local function must accept a
single input testCase, which is a matlab.unittest.FunctionTestCase object. The testing
framework automatically generates this object. The function uses the object to perform qualifications
for testing values and responding to failures.
Define a local function testRealSolution to verify that quadraticSolver returns the correct real
solutions for specific coefficients. For example, the equation x2 − 3x + 2 = 0 has real solutions x = 1
35-24
Write Simple Test Case Using Functions
and x = 2. The function calls quadraticSolver with the coefficients of this equation. Then, it uses
the verifyEqual qualification function to compare the actual output actSolution to the expected
output expSolution.
function tests = solverTest
tests = functiontests(localfunctions);
end
function testRealSolution(testCase)
actSolution = quadraticSolver(1,-3,2);
expSolution = [2 1];
verifyEqual(testCase,actSolution,expSolution)
end
function testRealSolution(testCase)
actSolution = quadraticSolver(1,-3,2);
expSolution = [2 1];
verifyEqual(testCase,actSolution,expSolution)
end
function testImaginarySolution(testCase)
actSolution = quadraticSolver(1,2,10);
expSolution = [-1+3i -1-3i];
verifyEqual(testCase,actSolution,expSolution)
end
Use the runtests function to run the tests defined in the quadraticSolverTest.m file. In this
example, both of the tests pass.
results = runtests('quadraticSolverTest.m')
Running quadraticSolverTest
..
Done quadraticSolverTest
__________
results =
1×2 TestResult array with properties:
Name
Passed
Failed
Incomplete
Duration
Details
35-25
35 Unit Testing
Totals:
2 Passed, 0 Failed, 0 Incomplete.
0.89529 seconds testing time.
results = run(quadraticSolverTest)
Running quadraticSolverTest
..
Done quadraticSolverTest
__________
results =
1×2 TestResult array with properties:
Name
Passed
Failed
Incomplete
Duration
Details
Totals:
2 Passed, 0 Failed, 0 Incomplete.
0.017825 seconds testing time.
See Also
runtests | functiontests | localfunctions
More About
• “Write Function-Based Unit Tests” on page 35-20
• “Table of Verifications, Assertions, and Other Qualifications” on page 35-44
• “Analyze Test Case Results” on page 35-125
• “Create Simple Test Suites” on page 35-89
35-26
Write Test Using Setup and Teardown Functions
Create a file containing the main function that tests figure properties and include two test functions.
One function verifies that the x-axis limits are correct, and the other one verifies that the face color of
a surface is correct.
In a folder on your MATLAB path, create axesPropertiesTest.m. In the main function of this file,
have functiontests create an array of tests from each local function in axesPropertiesTest.m
with a call to the localfunctions function.
function tests = axesPropertiesTest
tests = functiontests(localfunctions);
end
File fixture functions are setup and teardown code that runs a single time in your test file. These
fixtures are shared across the test file. In this example, the file fixture functions create a temporary
folder and set it as the current working folder. They also create and save a new figure for testing.
After tests are complete, the framework reinstates the original working folder and deletes the
temporary folder and saved figure.
In this example, a helper function creates a simple figure — a red cylinder. In a more realistic
scenario, this code is part of the product under test and is computationally expensive, thus motivating
the intent to create the figure only once and to load independent copies of the result for each test
function. For this example, however, you want to create this helper function as a local function to
axesPropertiesTest. Note that the test array does not include the function because its name does
not start or end with ‘test’.
Write a helper function that creates a simple red cylinder and add it as a local function to
axesPropertiesTest.
function f = createFigure
f = figure;
ax = axes('Parent',f);
cylinder(ax,10)
h = findobj(ax,'Type','surface');
h.FaceColor = [1 0 0];
end
You must name the setup and teardown functions of a file test fixture setupOnce and
teardownOnce, respectively. These functions take a single input argument testCase into which the
testing framework automatically passes a function test case object. This test case object contains a
TestData structure that allows data to pass between setup, test, and teardown functions. In this
example, the TestData structure uses assigned fields to store the original path, the temporary folder
name, and the figure file name.
35-27
35 Unit Testing
testCase.TestData.origPath = pwd;
testCase.TestData.tmpFolder = "tmpFolder" + ...
string(datetime('now','Format',"yyyyMMdd'T'HHmmss"));
mkdir(testCase.TestData.tmpFolder)
cd(testCase.TestData.tmpFolder)
% Create and save a figure
testCase.TestData.figName = 'tmpFig.fig';
aFig = createFigure;
saveas(aFig,testCase.TestData.figName)
close(aFig)
end
function teardownOnce(testCase)
delete(testCase.TestData.figName)
cd(testCase.TestData.origPath)
rmdir(testCase.TestData.tmpFolder)
end
Fresh fixtures are function-level setup and teardown code that runs before and after each test
function in your file. In this example, the functions open the saved figure and find the handles. After
testing, the framework closes the figure.
You must name fresh fixture functions setup and teardown, respectively. Similar to the file fixture
functions, these functions take a single input argument testCase. In this example, these functions
create a new field in the TestData structure that includes handles to the figure and to the axes. This
allows information to pass between setup, test, and teardown functions.
Create the setup and teardown functions as local functions to axesPropertiesTest. Open the
saved figure for each test to ensure test independence.
function setup(testCase)
testCase.TestData.Figure = openfig(testCase.TestData.figName);
testCase.TestData.Axes = findobj(testCase.TestData.Figure, ...
'Type','Axes');
end
function teardown(testCase)
close(testCase.TestData.Figure)
end
In addition to custom setup and teardown code, the testing framework provides some classes for
creating fixtures. For more information, see matlab.unittest.fixtures.
Each test is a local function that follows the naming convention of having ‘test’ at the beginning or
end of the function name. The test array does not include local functions that do not follow this
convention. Similar to setup and teardown functions, individual test functions must accept a single
input argument testCase. Use this test case object for verifications, assertions, assumptions, and
fatal assertions.
The testDefaultXLim function verifies that the x-axis limits are large enough to display the
cylinder. The lower limit needs to be less than -10, and the upper limit needs to be greater than 10.
These values come from the figure generated in the helper function — a cylinder with a 10 unit radius
centered on the origin. This test function opens the figure created and saved in the setupOnce
35-28
Write Test Using Setup and Teardown Functions
function, queries the axes limit, and verifies the limits are correct. The qualification functions
verifyLessThanOrEqual and verifyGreaterThanOrEqual take as inputs the test case, the
actual value, the expected value, and optional diagnostic information to display in the case of failure.
function testDefaultXLim(testCase)
xlim = testCase.TestData.Axes.XLim;
verifyLessThanOrEqual(testCase,xlim(1),-10, ...
'Minimum x-limit was not small enough')
verifyGreaterThanOrEqual(testCase,xlim(2),10, ...
'Maximum x-limit was not large enough')
end
The surfaceColorTest function accesses the figure that you created and saved in the setupOnce
function. surfaceColorTest queries the face color of the cylinder and verifies that it is red. The
color red has an RGB value of [1 0 0]. The qualification function verifyEqual takes as inputs the
test case, the actual value, the expected value, and optional diagnostic information to display in the
case of failure. Typically when using verifyEqual on floating-point values, you specify a tolerance
for the comparison. For more information, see matlab.unittest.constraints.
function surfaceColorTest(testCase)
h = findobj(testCase.TestData.Axes,'Type','surface');
co = h.FaceColor;
verifyEqual(testCase,co,[1 0 0],'Face color is incorrect')
end
Now the axesPropertiesTest.m file is complete with a main function, a helper function, file fixture
functions, fresh fixture functions, and two test functions. You are ready to run the tests.
Run Tests
The next step is to run the tests using the runtests function. In this example, the call to runtests
results in the following steps:
results = runtests('axesPropertiesTest.m')
35-29
35 Unit Testing
Running axesPropertiesTest
..
Done axesPropertiesTest
__________
results =
1×2 TestResult array with properties:
Name
Passed
Failed
Incomplete
Duration
Details
Totals:
2 Passed, 0 Failed, 0 Incomplete.
0.5124 seconds testing time.
To access functionality available to tables, create one from the TestResult objects.
rt = table(results)
rt=2×6 table
Name Passed Failed Incomplete Duration De
_______________________________________ ______ ______ __________ ________ ____
sortrows(rt,'Duration')
ans=2×6 table
Name Passed Failed Incomplete Duration De
_______________________________________ ______ ______ __________ ________ ____
writetable(rt,'myTestResults.xls')
See Also
matlab.unittest.fixtures | matlab.unittest.constraints
More About
• “Write Function-Based Unit Tests” on page 35-20
• “Table of Verifications, Assertions, and Other Qualifications” on page 35-44
35-30
Extend Function-Based Tests
Typically, with function-based tests, you create a test file and pass the file name to the runtests
function without explicitly creating a suite of Test objects. However, if you create an explicit test
suite, additional features are available in function-based testing. These features include:
These fixtures take the place of manually coding the actions in the setupOnce, teardownOnce,
setup, and teardown functions of your function-based test.
For example, if you manually write setup and teardown code to set up a temporary folder for each
test, and then you make that folder your current working folder, your setup and teardown functions
could look like this.
function setup(testCase)
% store current folder
testCase.TestData.origPath = pwd;
35-31
35 Unit Testing
function teardown(testCase)
% change to original folder
cd(testCase.TestData.origPath)
However, you also can use a fixture to replace both of those functions with just a modified setup
function. The fixture stores the information necessary to restore the initial state and performs the
teardown actions.
function setup(testCase)
% create temporary folder
f = testCase.applyFixture(matlab.unittest.fixtures.TemporaryFolderFixture);
Test Selection
With an explicit test suite, use selectors to refine your suite. Several of the selectors are applicable
only for class-based tests, but you can select tests for your suite based on the test name:
• Use the 'Name' name-value pair argument in a suite generation method, such as
matlab.unittest.TestSuite.fromFile.
• Use a selectors instance and optional constraints instance.
import matlab.unittest.selectors.HasName
import matlab.unittest.constraints.ContainsSubstring
import matlab.unittest.TestSuite.fromFile
f = 'rightTriTolTest.m';
selector = HasName(ContainsSubstring('Triangle'));
35-32
Extend Function-Based Tests
% fromFile, selector
suite = TestSuite.fromFile(f,selector)
% selectIf, selector
fullSuite = TestSuite.fromFile(f);
suite = selectIf(fullSuite,selector)
If you use one of the suite creation methods with a selector or name-value pair, the testing framework
creates the filtered suite. If you use the selectIf method, the testing framework creates a full test
suite and then filters it. For large test suites, this approach can have performance implications.
Test Running
There are several ways to run a function-based test.
For more information, see “Run Tests for Various Workflows” on page 35-91.
After you run tests, you can access recorded diagnostics using the DiagnosticRecord field in the
Details property on the TestResult object. For example, if your test results are stored in the
variable results, then result(2).Details.DiagnosticRecord contains the recorded
diagnostics for the second test in the suite.
The recorded diagnostics are DiagnosticRecord objects. To access particular types of test
diagnostics for a test, use the selectFailed, selectPassed, selectIncomplete, and
selectLogged methods of the DiagnosticRecord class.
35-33
35 Unit Testing
For example,use test suite, suite, to create a silent test runner and run the tests with the run
method of TestRunner.
runner = matlab.unittest.TestRunner.withNoPlugins;
results = runner.run(suite);
Use plugins to customize the test runner further. For example, you can redirect output, determine
code coverage, or change how the test runner responds to warnings. For more information, see “Add
Plugin to Test Runner” on page 35-95 and the plugins classes.
See Also
matlab.unittest.TestCase | matlab.unittest.TestSuite |
matlab.unittest.qualifications | matlab.unittest.constraints |
matlab.unittest.diagnostics | matlab.unittest.selectors
Related Examples
• “Run Tests for Various Workflows” on page 35-91
• “Add Plugin to Test Runner” on page 35-95
35-34
Author Class-Based Unit Tests in MATLAB
%% Test Function
function testASolution(testCase)
%% Exercise function under test
% act = the value from the function under test
Qualifications are methods for testing values and responding to failures. This table lists the types of
qualifications.
35-35
35 Unit Testing
The MATLAB unit testing framework provides approximately 25 qualification methods for each type
of qualification. For example, use verifyClass or assertClass to test that a value is of an
expected class, and use assumeTrue or fatalAssertTrue to test if the actual value is true. For a
summary of qualification methods, see “Table of Verifications, Assertions, and Other Qualifications”
on page 35-44.
Often, each unit test function obtains an actual value by exercising the code that you are testing and
defines the associated expected value. For example, if you are testing the plus function, the actual
value might be plus(2,3) and the expected value 5. Within the test function, you pass the actual
and expected values to a qualification method. For example:
testCase.verifyEqual(plus(2,3),5)
For an example of a basic unit test, see “Write Simple Test Case Using Classes” on page 35-38.
• Setup and teardown methods blocks to implicitly set up the pretest state of the system and return
it to the original state after running the tests. For an example of a test class with setup and
teardown code, see “Write Setup and Teardown Code Using Classes” on page 35-41.
• Advanced qualification features, including actual value proxies, test diagnostics, and a constraint
interface. For more information, see matlab.unittest.constraints and
matlab.unittest.diagnostics.
• Parameterized tests to combine and execute tests on the specified lists of parameters. For more
information, see “Create Basic Parameterized Test” on page 35-66 and “Create Advanced
Parameterized Test” on page 35-71.
• Ready-to-use fixtures for handling the setup and teardown of frequently used testing actions and
for sharing fixtures between classes. For more information, see matlab.unittest.fixtures
and “Write Tests Using Shared Fixtures” on page 35-51.
35-36
Author Class-Based Unit Tests in MATLAB
• Ability to create custom test fixtures. For more information see “Create Basic Custom Fixture” on
page 35-54 and “Create Advanced Custom Fixture” on page 35-56.
See Also
Related Examples
• “Write Simple Test Case Using Classes” on page 35-38
• “Write Setup and Teardown Code Using Classes” on page 35-41
• “Create Simple Test Suites” on page 35-89
• “Run Tests for Various Workflows” on page 35-91
• “Analyze Test Case Results” on page 35-125
• “Analyze Failed Test Results” on page 35-128
35-37
35 Unit Testing
This example shows how to write class-based unit tests to qualify the correctness of a function
defined in a file in your current folder. The quadraticSolver function takes as inputs the
coefficients of a quadratic polynomial and returns the roots of that polynomial. If the coefficients are
specified as nonnumeric values, the function throws an error.
end
In a file in your current folder, create the SolverTest class by subclassing the
matlab.unittest.TestCase class. This class provides a place for tests for the quadraticSolver
function. Add three unit tests inside a methods block with the Test attribute. These test the
quadraticSolver function against real solutions, imaginary solutions, and error conditions. Each
Test method must accept a TestCase instance as an input. The order of the tests within the block
does not matter.
First, create a Test method realSolution to verify that quadraticSolver returns the correct
real solutions for specific coefficients. For example, the equation x2 − 3x + 2 = 0 has real solutions
x = 1 and x = 2. The method calls quadraticSolver with the coefficients of this equation. Then, it
uses the verifyEqual method of matlab.unittest.TestCase to compare the actual output
actSolution to the expected output expSolution.
Create a second Test method imaginarySolution to verify that quadraticSolver returns the
correct imaginary solutions for specific coefficients. For example, the equation x2 + 2x + 10 = 0 has
imaginary solutions x = − 1 + 3i and x = − 1 − 3i. Just like the previous method, this method calls
35-38
Write Simple Test Case Using Classes
quadraticSolver with the coefficients of this equation, and then uses the verifyEqual method to
compare the actual output actSolution to the expected output expSolution.
Finally, add a Test method nonnumericInput to verify that quadraticSolver produces an error
for nonnumeric coefficients. Use the verifyError method of matlab.unittest.TestCase to test
that the function throws the error specified by 'quadraticSolver:InputMustBeNumeric' when
it is called with inputs 1, '-3', and 2.
To run all of the tests in the SolverTest class, create a TestCase object from the class and then
call the run method on the object. In this example, all three tests pass.
testCase = SolverTest;
results = testCase.run
Running SolverTest
...
Done SolverTest
__________
results =
1×3 TestResult array with properties:
35-39
35 Unit Testing
Name
Passed
Failed
Incomplete
Duration
Details
Totals:
3 Passed, 0 Failed, 0 Incomplete.
1.2373 seconds testing time.
You also can run a single test specified by one of the Test methods. To run a specific Test method,
pass the name of the method to run. For example, run the realSolution method.
result = run(testCase,'realSolution')
Running SolverTest
.
Done SolverTest
__________
result =
TestResult with properties:
Name: 'SolverTest/realSolution'
Passed: 1
Failed: 0
Incomplete: 0
Duration: 0.0082
Details: [1×1 struct]
Totals:
1 Passed, 0 Failed, 0 Incomplete.
0.0081829 seconds testing time.
See Also
matlab.unittest.TestCase
Related Examples
• “Author Class-Based Unit Tests in MATLAB” on page 35-35
• “Table of Verifications, Assertions, and Other Qualifications” on page 35-44
• “Analyze Test Case Results” on page 35-125
• “Create Simple Test Suites” on page 35-89
35-40
Write Setup and Teardown Code Using Classes
Test Fixtures
Test fixtures are setup and teardown code that sets up the pretest state of the system and returns it
to the original state after running the test. Setup and teardown methods are defined in the TestCase
class by the following method attributes:
• TestMethodSetup and TestMethodTeardown methods run before and after each test method.
• TestClassSetup and TestClassTeardown methods run before and after all test methods in the
test case.
It is good practice for test authors to perform all teardown activities from within the
TestMethodSetup and TestClassSetup blocks using the addTeardown method instead of
implementing corresponding teardown methods in the TestMethodTeardown and
TestClassTeardown blocks. This guarantees the teardown is executed in the reverse order of the
setup and also ensures that the test content is exception safe.
properties
TestFigure
end
methods(TestMethodSetup)
function createFigure(testCase)
testCase.TestFigure = figure;
end
end
methods(TestMethodTeardown)
function closeFigure(testCase)
close(testCase.TestFigure)
end
end
35-41
35 Unit Testing
methods(Test)
function defaultCurrentPoint(testCase)
cp = testCase.TestFigure.CurrentPoint;
testCase.verifyEqual(cp,[0 0], ...
'Default current point is incorrect')
end
function defaultCurrentObject(testCase)
import matlab.unittest.constraints.IsEmpty
co = testCase.TestFigure.CurrentObject;
testCase.verifyThat(co,IsEmpty, ...
'Default current object should be empty')
end
end
end
To setup the BankAccountTest, which tests the BankAccount class example described in
“Developing Classes That Work Together”, add a TestClassSetup method,
addBankAccountClassToPath. This method adds the path to the BankAccount example file.
Typically, you set up the path using a PathFixture. This example performs the setup and teardown
activities manually for illustrative purposes.
classdef BankAccountTest < matlab.unittest.TestCase
% Tests the BankAccount class
methods(TestClassSetup)
function addBankAccountClassToPath(testCase)
p = path;
testCase.addTeardown(@path,p)
addpath(fullfile(matlabroot,'help','techdoc','matlab_oop', ...
'examples'))
end
end
methods(Test)
function testConstructor(testCase)
b = BankAccount(1234,100);
testCase.verifyEqual(b.AccountNumber,1234, ...
'Constructor failed to correctly set account number')
testCase.verifyEqual(b.AccountBalance,100, ...
'Constructor failed to correctly set account balance')
end
function testConstructorNotEnoughInputs(testCase)
import matlab.unittest.constraints.Throws
testCase.verifyThat(@()BankAccount, ...
Throws('MATLAB:minrhs'))
end
function testDesposit(testCase)
b = BankAccount(1234,100);
b.deposit(25)
testCase.verifyEqual(b.AccountBalance,125)
end
function testWithdraw(testCase)
b = BankAccount(1234,100);
b.withdraw(25)
testCase.verifyEqual(b.AccountBalance,75)
end
function testNotifyInsufficientFunds(testCase)
callbackExecuted = false;
function testCallback(~,~)
35-42
Write Setup and Teardown Code Using Classes
callbackExecuted = true;
end
b = BankAccount(1234,100);
b.addlistener('InsufficientFunds',@testCallback);
b.withdraw(50)
testCase.assertFalse(callbackExecuted, ...
'The callback should not have executed yet')
b.withdraw(60)
testCase.verifyTrue(callbackExecuted, ...
'The listener callback should have fired')
end
end
end
See Also
matlab.unittest.TestCase | addTeardown
Related Examples
• “Author Class-Based Unit Tests in MATLAB” on page 35-35
• “Write Simple Test Case Using Classes” on page 35-38
35-43
35 Unit Testing
• Verifications — Produce and record failures without throwing an exception. When a verification
failure occurs, the remaining tests run to completion.
• Assumptions — Ensure that the test environment meets preconditions that otherwise do not result
in a test failure. When an assumption failure occurs, the testing framework marks the test as
filtered.
• Assertions — Ensure that the preconditions of the current test are met. When an assertion failure
occurs, the framework marks the current test as failed and incomplete. However, the failure does
not prevent proper execution of subsequent tests.
• Fatal assertions — Ensure that the remainder of the current test session is valid and the state is
recoverable. When a fatal assertion failure occurs, the testing framework aborts the test session.
These qualification types have parallel methods for the same types of tests. The methods use a
common naming convention. For instance, the methods that test for a true value use the form
<qualify>True, where <qualify> can be verify, assume, assert, or fatalAssert. That is:
General Purpose
35-44
Table of Verifications, Assertions, and Other Qualifications
Inequalities
Array Size
Type
Strings
35-45
35 Unit Testing
See Also
matlab.unittest.qualifications.Verifiable |
matlab.unittest.qualifications.Assumable |
matlab.unittest.qualifications.Assertable |
matlab.unittest.qualifications.FatalAssertable | matlab.unittest.qualifications
35-46
Tag Unit Tests
Tag Tests
To define test tags, use a cell array of meaningful character vectors or a string array. For example,
TestTags = {'Unit'} or TestTags = ["Unit","FeatureA"].
This sample test class, ExampleTagTest, uses the TestTags method attribute to tag individual
tests.
Several of the tests in class ExampleTagTest are tagged. For example, testD is tagged with
'Unit' and 'FeatureA'. One test, testA, is not tagged.
This sample test class, ExampleTagClassTest, uses a TestTags class attribute to tag all the tests
within the class, and a TestTags method attribute to add tags to individual tests.
35-47
35 Unit Testing
end
methods (Test, TestTags = {'FeatureC','System'})
function testG (testCase)
% test code
end
end
methods (Test, TestTags = {'System','FeatureA'})
function testH (testCase)
% test code
end
end
end
Each test in class ExampleTagClassTest is tagged with 'FeatureB'. Additionally, individual tests
are tagged with various tags including 'FeatureA', 'FeatureC', and 'System'.
Use the runtests function to select and run tests without explicitly creating a test suite. Select and
run all the tests from ExampleTagTest and ExampleTagClassTest that include the 'FeatureA'
tag.
results = runtests({'ExampleTagTest','ExampleTagClassTest'},'Tag','FeatureA');
Running ExampleTagTest
..
Done ExampleTagTest
__________
Running ExampleTagClassTest
.
Done ExampleTagClassTest
__________
table(results)
ans =
3×6 table
35-48
Tag Unit Tests
The selected tests are testE and testD from ExampleTagTest, and testH from
ExampleTagClassTest.
Create a suite of tests from the ExampleTagTest class that are tagged with 'FeatureA'.
import matlab.unittest.TestSuite
sA = TestSuite.fromClass(?ExampleTagTest,'Tag','FeatureA');
Create a suite of tests from the ExampleTagClassTest class that are tagged with 'FeatureC'.
sB = TestSuite.fromFile('ExampleTagClassTest.m','Tag','FeatureC');
ans =
'ExampleTagTest/testE'
'ExampleTagTest/testD'
'ExampleTagClassTest/testG'
Create a suite of all the tests from the ExampleTagTest and ExampleTagClassTest classes.
import matlab.unittest.selectors.HasTag
sA = TestSuite.fromClass(?ExampleTagTest);
sB = TestSuite.fromFile('ExampleTagClassTest.m');
suite = [sA sB];
s1 =
Name: 'ExampleTagTest/testA'
ProcedureName: 'testA'
TestClass: "ExampleTagTest"
BaseFolder: 'C:\work'
Parameterization: [0×0 matlab.unittest.parameters.EmptyParameter]
SharedTestFixtures: [0×0 matlab.unittest.fixtures.EmptyFixture]
Tags: {1×0 cell}
Tests Include:
0 Parameterizations, 0 Shared Test Fixture Classes, 0 Tags.
Select all the tests with the 'Unit' tag and display their names.
35-49
35 Unit Testing
s2 = suite.selectIf(HasTag('Unit'));
{s2.Name}'
ans =
'ExampleTagTest/testD'
'ExampleTagTest/testB'
'ExampleTagTest/testC'
Select all the tests with the 'FeatureB' or 'System' tag using a constraint.
import matlab.unittest.constraints.IsEqualTo
constraint = IsEqualTo('FeatureB') | IsEqualTo('System');
s3 = suite.selectIf(HasTag(constraint));
{s3.Name}'
ans =
'ExampleTagTest/testE'
'ExampleTagClassTest/testH'
'ExampleTagClassTest/testG'
'ExampleTagClassTest/testF'
See Also
matlab.unittest.constraints | matlab.unittest.selectors.HasTag |
matlab.unittest.TestSuite | runtests | matlab.unittest.TestCase
35-50
Write Tests Using Shared Fixtures
The two test classes used in this example test the DocPolynom class and the BankAccount class.
You can access both classes in MATLAB, but you must add them to the MATLAB path. A path fixture
adds the directory to the current path, runs the tests, and removes the directory from the path. Since
both classes require the same addition to the path, the tests use a shared fixture.
Create a test file for the DocPolynom class. Create the shared fixture by specifying the
SharedTestFixtures attribute for the TestCase and passing in a PathFixture.
properties
msgEqn = 'Equation under test: ';
end
methods (Test)
function testConstructor(testCase)
p = DocPolynom([1, 0, 1]);
testCase.verifyClass(p, ?DocPolynom)
end
function testAddition(testCase)
p1 = DocPolynom([1, 0, 1]);
p2 = DocPolynom([5, 2]);
actual = p1 + p2;
expected = DocPolynom([1, 5, 3]);
msg = [testCase.msgEqn,...
'(x^2 + 1) + (5*x + 2) = x^2 + 5*x + 3'];
testCase.verifyEqual(actual, expected, msg)
end
function testMultiplication(testCase)
p1 = DocPolynom([1, 0, 3]);
p2 = DocPolynom([5, 2]);
actual = p1 * p2;
expected = DocPolynom([5, 2, 15, 6]);
msg = [testCase.msgEqn,...
'(x^2 + 3) * (5*x + 2) = 5*x^3 + 2*x^2 + 15*x + 6'];
testCase.verifyEqual(actual, expected, msg)
end
35-51
35 Unit Testing
end
end
Create a test file for the BankAccount class. Create the shared fixture by specifying the
SharedTestFixtures attribute for the TestCase and passing in a PathFixture.
methods (Test)
function testConstructor(testCase)
b = BankAccount(1234, 100);
testCase.verifyEqual(b.AccountNumber, 1234, ...
'Constructor failed to correctly set account number')
testCase.verifyEqual(b.AccountBalance, 100, ...
'Constructor failed to correctly set account balance')
end
function testConstructorNotEnoughInputs(testCase)
import matlab.unittest.constraints.Throws
testCase.verifyThat(@()BankAccount, ...
Throws('MATLAB:minrhs'))
end
function testDesposit(testCase)
b = BankAccount(1234, 100);
b.deposit(25)
testCase.verifyEqual(b.AccountBalance, 125)
end
function testWithdraw(testCase)
b = BankAccount(1234, 100);
b.withdraw(25)
testCase.verifyEqual(b.AccountBalance, 75)
end
function testNotifyInsufficientFunds(testCase)
callbackExecuted = false;
function testCallback(~,~)
callbackExecuted = true;
end
b = BankAccount(1234, 100);
b.addlistener('InsufficientFunds', @testCallback);
b.withdraw(50)
testCase.assertFalse(callbackExecuted, ...
'The callback should not have executed yet')
b.withdraw(60)
testCase.verifyTrue(callbackExecuted, ...
'The listener callback should have fired')
35-52
Write Tests Using Shared Fixtures
end
end
end
The classes DocPolynomTest.m and BankAccountTest.m are in your working directory. Create a
test suite from your current working directory. If you have additional tests, they are included in the
suite when you use the TestSuite.fromFolder method. Create the test suite at the command
prompt.
import matlab.unittest.TestSuite;
suiteFolder = TestSuite.fromFolder(pwd);
result = run(suiteFolder);
Setting up PathFixture.
Description: Adds 'C:\Program Files\MATLAB\R2013b\help\techdoc\matlab_oop\examples' to the path.
__________
Running BankAccountTest
.....
Done BankAccountTest
__________
Running DocPolynomTest
...
Done DocPolynomTest
__________
The testing framework sets up the test fixture, runs all the tests in each file, and then tears the
fixture down. If the path fixture was set up and torn down using TestClassSetup methods, the
fixture is set up and torn down twice—once for each test file.
See Also
matlab.unittest.TestCase | matlab.unittest.fixtures |
matlab.unittest.fixtures.PathFixture
35-53
35 Unit Testing
In a file in your working folder, create a new class, FormatHexFixture that inherits from the
matlab.unittest.fixtures.Fixture class. Since we want the fixture to restore the pretest state
of the MATLAB display format, create an OriginalFormat property to keep track of the original
display format.
classdef FormatHexFixture < matlab.unittest.fixtures.Fixture
properties (Access = private)
OriginalFormat
end
end
Subclasses of the Fixture class must implement the setup method. Use this method to record the
pretest display format, and set the format to 'hex'. Use the teardown method to restore the
original display format. Define the setup and teardown methods in the methods block of the
FormatHexFixture class.
classdef FormatHexFixture < matlab.unittest.fixtures.Fixture
properties (Access = private)
OriginalFormat
end
methods
function setup(fixture)
fixture.OriginalFormat = get(0,'Format');
set(0,'Format','hex')
end
function teardown(fixture)
set(0,'Format',fixture.OriginalFormat)
end
end
end
In a file in your working folder, create the following test class, SampleTest.m.
classdef SampleTest < matlab.unittest.TestCase
methods (Test)
function test1(testCase)
testCase.applyFixture(FormatHexFixture)
actStr = getColumnForDisplay([1;2;3],'Small Integers');
expStr = ['Small Integers '
'3ff0000000000000'
'4000000000000000'
'4008000000000000'];
testCase.verifyEqual(actStr,expStr)
end
35-54
Create Basic Custom Fixture
end
end
This test applies the custom fixture and verifies that the displayed column of hexadecimal
representation is as expected.
run(SampleTest);
Running SampleTest
.
Done SampleTest
__________
See Also
matlab.unittest.fixtures.Fixture
Related Examples
• “Create Advanced Custom Fixture” on page 35-56
• “Write Tests Using Shared Fixtures” on page 35-51
35-55
35 Unit Testing
properties (SetAccess=private)
UserName
end
Subclasses of the Fixture class must implement the setup method. Use this method to save the
original UserName variable. This method also defines the TeardownDescription and registers the
teardown task of setting the UserName to the original state after testing.
Classes that derive from Fixture must implement the isCompatible method if the constructor is
configurable. Since you can configure the UserName property through the constructor,
UserNameEnvironmentVariableFixture must implement isCompatible.
35-56
Create Advanced Custom Fixture
The isCompatible method is called with two instances of the same class. In this case, it is called
with two instances of UserNameEnvironmentVariableFixture. The testing framework considers
the two instances compatible if their UserName properties are equal.
properties (SetAccess=private)
UserName
end
methods
function fixture = UserNameEnvironmentVariableFixture(name)
validateattributes(name, {'char'}, {'row'}, '','UserName')
fixture.UserName = name;
fixture.SetupDescription = sprintf( ...
'Set the UserName environment variable to "%s".',...
fixture.UserName);
end
function setup(fixture)
originalUserName = getenv('UserName');
fixture.assertNotEmpty(originalUserName, ...
'An existing UserName environment variable must be defined.')
fixture.addTeardown(@setenv, 'UserName', originalUserName)
fixture.TeardownDescription = sprintf(...
'Restored the UserName environment variable to "%s".',...
originalUserName);
setenv('UserName', fixture.UserName)
end
end
methods (Access=protected)
function bool = isCompatible(fixture, other)
bool = strcmp(fixture.UserName, other.UserName);
end
end
end
In a file in your working folder, create the following test class, ExampleTest.m.
methods (Test)
function t1(~)
35-57
35 Unit Testing
This test uses the UserNameEnvironmentVariableFixture for each test in the ExampleTest
class.
Running ExampleTest
Current UserName: "David".
Done ExampleTest
__________
In your working folder, create three test classes using a shared fixture. Using a shared fixture allows
the UserNameEnvironmentVariableFixture to be shared across classes.
35-58
Create Advanced Custom Fixture
runtests({'testA','testB','testC'});
Setting up UserNameEnvironmentVariableFixture
Done setting up UserNameEnvironmentVariableFixture: Set the UserName environment variable to "Dav
__________
Running testA
Current UserName: "David".
Done testA
__________
Setting up UserNameEnvironmentVariableFixture
Done setting up UserNameEnvironmentVariableFixture: Set the UserName environment variable to "And
__________
Running testB
Current UserName: "Andy".
Done testB
__________
Running testC
Current UserName: "Andy".
Done testC
__________
Recall that the fixtures are compatible if their UserName properties match. The tests in testA and
testB use incompatible shared fixtures, since 'David' is not equal to 'Andy'. Therefore, the
framework invokes the fixture teardown and setup methods between calls to testA and testB.
However, the shared test fixture in testC is compatible with the fixture in testB, so the framework
does not repeat fixture teardown and setup before testC.
An alternate approach to using the addTeardown method within the setup method is to implement a
separate teardown method . Instead of the setup method described above, implement the following
setup and teardown methods within UserNameEnvironmentVariableFixture.m.
properties (Access=private)
OriginalUser
end
properties (SetAccess=private)
UserName
end
methods
function fixture = UserNameEnvironmentVariableFixture(name)
validateattributes(name, {'char'}, {'row'}, '','UserName')
35-59
35 Unit Testing
fixture.UserName = name;
fixture.SetupDescription = sprintf( ...
'Set the UserName environment variable to "%s".',...
fixture.UserName);
end
function setup(fixture)
fixture.OriginalUser = getenv('UserName');
fixture.assertNotEmpty(fixture.OriginalUser, ...
'An existing UserName environment variable must be defined.')
setenv('UserName', fixture.UserName)
end
function teardown(fixture)
fixture.TeardownDescription = sprintf(...
'Restored the UserName environment variable to "%s".',...
fixture.OriginalUser);
setenv('UserName', fixture.OriginalUser)
end
end
methods (Access=protected)
function bool = isCompatible(fixture, other)
bool = strcmp(fixture.UserName, other.UserName);
end
end
end
The setup method does not contain a call to addTeardown or a definition for
TeardownDescription. These tasks are relegated to the teardown method. The alternative class
definition contains an additional property, OriginalUser, which allows the information to be passed
between methods.
See Also
matlab.unittest.fixtures.Fixture
Related Examples
• “Create Basic Custom Fixture” on page 35-54
• “Write Tests Using Shared Fixtures” on page 35-51
35-60
Use Parameters in Class-Based Tests
The testing framework enables you to parameterize your test class at different levels. Additionally,
when you call a test class method with multiple parameters, you can specify how the method should
be invoked for different combinations of the parameters.
For example, consider the SampleTest class. The class defines a parameterized test, because it
specifies a property within a properties block with the TestParameter attribute. The property is
passed to the Test method and is used to perform qualification.
Because Number is a cell array with five elements, the test class results in a parameterized test suite
with five elements.
suite = testsuite('SampleTest');
{suite.Name}'
ans =
{'SampleTest/testDouble(Number=value1)'}
{'SampleTest/testDouble(Number=value2)'}
{'SampleTest/testDouble(Number=value3)'}
{'SampleTest/testDouble(Number=value4)'}
{'SampleTest/testDouble(Number=value5)'}
35-61
35 Unit Testing
The value assigned to a parameterization property must be either a nonempty cell array or a scalar
structure with at least one field. MATLAB uses the property value to specify parameter names and
values in the test suite:
• If the property value is a cell array of character vectors, MATLAB generates parameter names
from the values in the cell array. Otherwise, MATLAB specifies parameter names as value1,
value2, …, valueN.
• If the property value is a structure, structure fields represent the parameter names and structure
values represent the parameter values. To include descriptive parameter names in the suite,
define the parameters using a structure instead of a cell array.
• Class load time: If the property value can be determined at the time MATLAB loads the test class
definition, initialize the property using a default value. You can specify the default value in the
properties block or using a local function in the classdef file. For more information about
assigning values in a class definition, see “Evaluation of Expressions in Class Definitions”.
When you initialize a parameterization property at class load time, the parameters associated with
the property remain fixed for different test runs. Each time you create a suite from the
parameterized test class, the framework uses the same parameter names and values to run the
tests. See “Create Basic Parameterized Test” on page 35-66 for an example using
parameterization properties with default values.
• Suite creation time: If you cannot or do not want to determine the parameters at class load
time, initialize the property at suite creation time using a static method with the
TestParameterDefinition attribute. When you initialize a parameterization property with a
TestParameterDefinition method, the parameters associated with the property can vary for
different test runs. Each time you create a suite from the parameterized test class, the framework
generates fresh parameter names and values to run the tests. For more information, see “Define
Parameters at Suite Creation Time” on page 35-82.
Once you assign a value to a parameterization property, do not modify it. For example, when you
initialize a parameterization property using a default value, you cannot use a
TestParameterDefinition method to overwrite the default value.
A parameter might be used by several unit tests. Tests using the same parameter must run
independently, without accidentally affecting one another. In addition, a running test must not affect
subsequent reruns of the same test. To ensure test run independence, initialize your parameterization
properties with value objects. Using handle objects (such as MATLAB graphics objects) as parameter
values is not recommended. For more information about the behavior of value and handle objects, see
“Comparison of Handle and Value Classes”.
If you need to test handle objects in your parameterized test, consider constructing them indirectly
by using function handles as parameter values and invoking those function handles in tests. For
example, write a parameterized test to test the default current point of figures created with the
figure and uifigure functions.
classdef FigureTest < matlab.unittest.TestCase
properties (TestParameter)
35-62
Use Parameters in Class-Based Tests
This table shows different parameterization levels and the required method and property attributes
for each level.
A parameterized method can access parameterization properties depending on the level at which the
method is defined:
• A parameterized TestClassSetup method can access parameterization properties only with the
ClassSetupParameter attribute.
• A parameterized TestMethodSetup method can access parameterization properties only with the
MethodSetupParameter or ClassSetupParameter attributes.
• A parameterized Test method can access any parameterization properties.
For an example of how to parameterize a test class at different levels, see “Create Advanced
Parameterized Test” on page 35-71.
35-63
35 Unit Testing
You can combine parameters at class-setup, method-setup, and test levels. For example, use the
combined method attributes TestMethodSetup, ParameterCombination = 'sequential' to
specify sequential combination of the method-setup-level parameters defined in the properties
block with the MethodSetupParameter attribute.
For examples of how to combine test parameters, see “Create Basic Parameterized Test” on page 35-
66 and “Create Advanced Parameterized Test” on page 35-71.
See Also
matlab.unittest.parameters | matlab.unittest.parameters.Parameter |
matlab.unittest.TestCase
35-64
Use Parameters in Class-Based Tests
More About
• “Create Basic Parameterized Test” on page 35-66
• “Create Advanced Parameterized Test” on page 35-71
• “Define Parameters at Suite Creation Time” on page 35-82
• “Use External Parameters in Parameterized Test” on page 35-78
35-65
35 Unit Testing
In your current folder, create a function in the file sierpinski.m. This function returns a matrix
representing an image of a Sierpinski carpet fractal. It takes as input the fractal level and an optional
data type.
function carpet = sierpinski(levels,classname)
if nargin == 1
classname = 'single';
end
msize = 3^levels;
carpet = ones(msize,classname);
function cutCarpet(x,y,s,cl)
if cl
ss = s/3; % Define subsize
for lx = 0:2
for ly = 0:2
if lx == 1 && ly == 1
% Remove center square
carpet(x+ss:x+2*ss-1,y+ss:y+2*ss-1) = 0;
else
% Recurse
cutCarpet(x+lx*ss,y+ly*ss,ss,cl-1)
end
end
end
end
end
end
In a file in your current folder, create the TestCarpet class to test the sierpinski function. Define
the properties used for parameterized testing in a properties block with the TestParameter
attribute.
classdef TestCarpet < matlab.unittest.TestCase
properties (TestParameter)
type = {'single','double','uint16'};
level = struct('small',2,'medium',4,'large',6);
side = struct('small',9,'medium',81,'large',729);
end
end
The type property contains the different data types you want to test. The level property contains
the different fractal levels you want to test. The side property contains the number of rows and
columns in the Sierpinski carpet matrix and corresponds to the level property. To provide
meaningful names for each parameter, level and side are defined as structures.
35-66
Create Basic Parameterized Test
In a methods block with the Test attribute, define three test methods:
• The testRemainPixels method tests the output of the sierpinski function by verifying that
the number of nonzero pixels is the same as expected for a particular level. This method uses the
level property and, therefore, results in three test elements—one for each value in level.
• The testClass method tests the class of the output from the sierpinski function with each
combination of the type and level parameter values (that is, exhaustive parameter
combination). The method results in nine test elements.
• The testDefaultL1Output method does not use a TestParameter property and, therefore, is
not parameterized. The method verifies that the level 1 matrix contains the expected values.
Because the test method is not parameterized, it results in one test element.
methods (Test)
function testRemainPixels(testCase,level)
expPixelCount = 8^level;
actPixels = find(sierpinski(level));
testCase.verifyNumElements(actPixels,expPixelCount)
end
function testClass(testCase,type,level)
testCase.verifyClass( ...
sierpinski(level,type),type)
end
function testDefaultL1Output(testCase)
exp = single([1 1 1; 1 0 1; 1 1 1]);
testCase.verifyEqual(sierpinski(1),exp)
end
end
end
Define the testNumel method to ensure that the matrix returned by the sierpinski function has
the correct number of elements. Set the ParameterCombination attribute for the method to
'sequential'. Because the level and side properties each specify three parameter values, the
testNumel method is invoked three times — one time for each of the 'small', 'medium', and
'large' values.
methods (Test)
35-67
35 Unit Testing
function testRemainPixels(testCase,level)
expPixelCount = 8^level;
actPixels = find(sierpinski(level));
testCase.verifyNumElements(actPixels,expPixelCount)
end
function testClass(testCase,type,level)
testCase.verifyClass( ...
sierpinski(level,type),type)
end
function testDefaultL1Output(testCase)
exp = single([1 1 1; 1 0 1; 1 1 1]);
testCase.verifyEqual(sierpinski(1),exp)
end
end
At the command prompt, create a suite from TestCarpet.m. The suite has 16 test elements.
MATLAB includes parameterization information in the names of the suite elements.
suite = matlab.unittest.TestSuite.fromFile('TestCarpet.m');
{suite.Name}'
ans =
{'TestCarpet/testNumel(level=small,side=small)' }
{'TestCarpet/testNumel(level=medium,side=medium)'}
{'TestCarpet/testNumel(level=large,side=large)' }
{'TestCarpet/testRemainPixels(level=small)' }
{'TestCarpet/testRemainPixels(level=medium)' }
{'TestCarpet/testRemainPixels(level=large)' }
{'TestCarpet/testClass(type=single,level=small)' }
{'TestCarpet/testClass(type=single,level=medium)'}
{'TestCarpet/testClass(type=single,level=large)' }
{'TestCarpet/testClass(type=double,level=small)' }
{'TestCarpet/testClass(type=double,level=medium)'}
{'TestCarpet/testClass(type=double,level=large)' }
{'TestCarpet/testClass(type=uint16,level=small)' }
{'TestCarpet/testClass(type=uint16,level=medium)'}
{'TestCarpet/testClass(type=uint16,level=large)' }
{'TestCarpet/testDefaultL1Output' }
suite.run
35-68
Create Basic Parameterized Test
Running TestCarpet
.......... ......
Done TestCarpet
__________
ans =
Name
Passed
Failed
Incomplete
Duration
Details
Totals:
16 Passed, 0 Failed, 0 Incomplete.
2.459 seconds testing time.
Use the selectIf method of TestSuite to select test elements that use a particular
parameterization. Select all test elements that use the parameter name 'small' in the level
parameterization property list. The filtered suite has five elements.
s1 = suite.selectIf('ParameterName','small');
{s1.Name}'
ans =
{'TestCarpet/testNumel(level=small,side=small)' }
{'TestCarpet/testRemainPixels(level=small)' }
{'TestCarpet/testClass(type=single,level=small)'}
{'TestCarpet/testClass(type=double,level=small)'}
{'TestCarpet/testClass(type=uint16,level=small)'}
Running TestCarpet
.....
Done TestCarpet
__________
Alternatively, you can create the same test suite directly using the fromFile method of TestSuite.
import matlab.unittest.selectors.HasParameter
s1 = matlab.unittest.TestSuite.fromFile('TestCarpet.m', ...
HasParameter('Name','small'));
See Also
matlab.unittest.TestCase | matlab.unittest.selectors.HasParameter |
matlab.unittest.TestSuite
35-69
35 Unit Testing
Related Examples
• “Use Parameters in Class-Based Tests” on page 35-61
• “Create Advanced Parameterized Test” on page 35-71
• “Define Parameters at Suite Creation Time” on page 35-82
• “Use External Parameters in Parameterized Test” on page 35-78
35-70
Create Advanced Parameterized Test
In a file in your current folder, create the TestRand class to test various aspects of random number
generation. Define the properties used for parameterized testing.
classdef TestRand < matlab.unittest.TestCase
properties (ClassSetupParameter)
generator = {'twister','combRecursive','multFibonacci'};
end
properties (MethodSetupParameter)
seed = {0,123,4294967295};
end
properties (TestParameter)
dim1 = struct('small',1,'medium',2,'large',3);
dim2 = struct('small',2,'medium',3,'large',4);
dim3 = struct('small',3,'medium',4,'large',5);
type = {'single','double'};
end
end
Define the setup methods at the test class and test method levels. These methods register the initial
random number generator state. After the framework runs the tests, the methods restore the original
state. The classSetup method defines the type of random number generator, and the methodSetup
method seeds the generator.
classdef TestRand < matlab.unittest.TestCase
properties (ClassSetupParameter)
generator = {'twister','combRecursive','multFibonacci'};
end
properties (MethodSetupParameter)
seed = {0,123,4294967295};
end
properties (TestParameter)
dim1 = struct('small',1,'medium',2,'large',3);
dim2 = struct('small',2,'medium',3,'large',4);
dim3 = struct('small',3,'medium',4,'large',5);
type = {'single','double'};
end
methods (TestClassSetup)
35-71
35 Unit Testing
function classSetup(testCase,generator)
orig = rng;
testCase.addTeardown(@rng,orig)
rng(0,generator)
end
end
methods (TestMethodSetup)
function methodSetup(testCase,seed)
orig = rng;
testCase.addTeardown(@rng,orig)
rng(seed)
end
end
end
Define the testSize method in a methods block with the Test and ParameterCombination =
'sequential' attributes.
properties (MethodSetupParameter)
seed = {0,123,4294967295};
end
properties (TestParameter)
dim1 = struct('small',1,'medium',2,'large',3);
dim2 = struct('small',2,'medium',3,'large',4);
dim3 = struct('small',3,'medium',4,'large',5);
type = {'single','double'};
end
methods (TestClassSetup)
function classSetup(testCase,generator)
orig = rng;
testCase.addTeardown(@rng,orig)
rng(0,generator)
end
end
methods (TestMethodSetup)
function methodSetup(testCase,seed)
orig = rng;
testCase.addTeardown(@rng,orig)
rng(seed)
end
end
35-72
Create Advanced Parameterized Test
end
end
The method tests the size of the output for each corresponding parameter value in dim1, dim2, and
dim3. For a given TestClassSetup and TestMethodSetup parameterization, the framework calls
the testSize method three times — one time for each of the 'small', 'medium', and 'large'
values. For example, to test with all of the 'medium' values, the framework uses
testCase.verifySize(rand(2,3,4),[2 3 4]).
Define the testRepeatable method in a methods block with the Test and
ParameterCombination = 'pairwise' attributes.
classdef TestRand < matlab.unittest.TestCase
properties (ClassSetupParameter)
generator = {'twister','combRecursive','multFibonacci'};
end
properties (MethodSetupParameter)
seed = {0,123,4294967295};
end
properties (TestParameter)
dim1 = struct('small',1,'medium',2,'large',3);
dim2 = struct('small',2,'medium',3,'large',4);
dim3 = struct('small',3,'medium',4,'large',5);
type = {'single','double'};
end
methods (TestClassSetup)
function classSetup(testCase,generator)
orig = rng;
testCase.addTeardown(@rng,orig)
rng(0,generator)
end
end
methods (TestMethodSetup)
function methodSetup(testCase,seed)
orig = rng;
testCase.addTeardown(@rng,orig)
rng(seed)
end
end
35-73
35 Unit Testing
testCase.verifyEqual(firstRun,secondRun)
end
end
end
The method verifies that the random number generator results are repeatable. For a given
TestClassSetup and TestMethodSetup parameterization, the framework calls the
testRepeatable method 10 times to ensure testing with each pair of parameter values specified by
dim1, dim2, and dim3. If the parameter combination were exhaustive, the framework would call the
method 3³ = 27 times.
Define the testClass method in a methods block with the Test attribute. Because the
ParameterCombination attribute is not specified, the parameter combination is exhaustive by
default.
properties (MethodSetupParameter)
seed = {0,123,4294967295};
end
properties (TestParameter)
dim1 = struct('small',1,'medium',2,'large',3);
dim2 = struct('small',2,'medium',3,'large',4);
dim3 = struct('small',3,'medium',4,'large',5);
type = {'single','double'};
end
methods (TestClassSetup)
function classSetup(testCase,generator)
orig = rng;
testCase.addTeardown(@rng,orig)
rng(0,generator)
end
end
methods (TestMethodSetup)
function methodSetup(testCase,seed)
orig = rng;
testCase.addTeardown(@rng,orig)
rng(seed)
end
end
35-74
Create Advanced Parameterized Test
state = rng;
firstRun = rand(dim1,dim2,dim3);
rng(state)
secondRun = rand(dim1,dim2,dim3);
testCase.verifyEqual(firstRun,secondRun)
end
end
methods (Test)
function testClass(testCase,dim1,dim2,type)
testCase.verifyClass(rand(dim1,dim2,type),type)
end
end
end
The method verifies that the class of the output from rand is the same as the expected class. For a
given TestClassSetup and TestMethodSetup parameterization, the framework calls the
testClass method 3×3×2 = 18 times to ensure testing with each combination of dim1, dim2, and
type parameter values.
suite = matlab.unittest.TestSuite.fromClass(?TestRand)
suite =
Name
ProcedureName
TestClass
BaseFolder
Parameterization
SharedTestFixtures
Tags
Tests Include:
17 Unique Parameterizations, 0 Shared Test Fixture Classes, 0 Tags.
suite(1).Name
ans =
'TestRand[generator=twister]/[seed=value1]testClass(dim1=small,dim2=small,type=single)'
35-75
35 Unit Testing
The parameter name for the seed property is not particularly meaningful (value1). The testing
framework provided this name because the seed property is specified as a cell array. For a more
meaningful name, define the seed property as a structure with descriptive field names.
At the command prompt, create a selector to select test elements that test the 'twister' generator
for 'single' precision. Create a suite by omitting test elements that use properties with the
'large' parameter name.
import matlab.unittest.selectors.HasParameter
s = HasParameter('Property','generator','Name','twister') & ...
HasParameter('Property','type','Name','single') & ...
~HasParameter('Name','large');
suite2 = matlab.unittest.TestSuite.fromClass(?TestRand,s)
suite2 =
Name
ProcedureName
TestClass
BaseFolder
Parameterization
SharedTestFixtures
Tags
Tests Include:
9 Unique Parameterizations, 0 Shared Test Fixture Classes, 0 Tags.
If you first generate the full suite from the TestRand class, you can construct the same filtered suite
using the selectIf method.
suite = matlab.unittest.TestSuite.fromClass(?TestRand);
suite2 = selectIf(suite,s);
suite2.run;
Running TestRand
.......... ..
Done TestRand
__________
Create a selector that omits test elements that use properties with the 'large' or 'medium'
parameter names. Limit results to test elements from the testRepeatable method.
35-76
Create Advanced Parameterized Test
import matlab.unittest.selectors.HasParameter
s = ~(HasParameter('Name','large') | HasParameter('Name','medium'));
suite3 = matlab.unittest.TestSuite.fromMethod(?TestRand,'testRepeatable',s);
{suite3.Name}'
ans =
{'TestRand[generator=twister]/[seed=value1]testRepeatable(dim1=small,dim2=small,dim3=small)' }
{'TestRand[generator=twister]/[seed=value2]testRepeatable(dim1=small,dim2=small,dim3=small)' }
{'TestRand[generator=twister]/[seed=value3]testRepeatable(dim1=small,dim2=small,dim3=small)' }
{'TestRand[generator=combRecursive]/[seed=value1]testRepeatable(dim1=small,dim2=small,dim3=small)'}
{'TestRand[generator=combRecursive]/[seed=value2]testRepeatable(dim1=small,dim2=small,dim3=small)'}
{'TestRand[generator=combRecursive]/[seed=value3]testRepeatable(dim1=small,dim2=small,dim3=small)'}
{'TestRand[generator=multFibonacci]/[seed=value1]testRepeatable(dim1=small,dim2=small,dim3=small)'}
{'TestRand[generator=multFibonacci]/[seed=value2]testRepeatable(dim1=small,dim2=small,dim3=small)'}
{'TestRand[generator=multFibonacci]/[seed=value3]testRepeatable(dim1=small,dim2=small,dim3=small)'}
suite3.run;
Running TestRand
.........
Done TestRand
__________
At the command prompt, run all of the test elements from the TestRand class that use the 'double'
parameter name.
runtests('TestRand','ParameterName','double');
Running TestRand
.......... .......... .......... .......... ..........
.......... .......... .......... .
Done TestRand
__________
See Also
matlab.unittest.TestSuite | matlab.unittest.TestCase |
matlab.unittest.selectors.HasParameter
Related Examples
• “Use Parameters in Class-Based Tests” on page 35-61
• “Create Basic Parameterized Test” on page 35-66
• “Define Parameters at Suite Creation Time” on page 35-82
• “Use External Parameters in Parameterized Test” on page 35-78
35-77
35 Unit Testing
Create the following function to test. The function accepts an array, vectorizes the array, removes 0,
Nan, and Inf, and then sorts the array.
function Y = cleanData(X)
Y = X(:); % Vectorize array
Y = rmmissing(Y); % Remove NaN
% Remove 0 and Inf
idx = (Y==0 | Y==Inf);
Y = Y(~idx);
% If array is empty, set to eps
if isempty(Y)
Y = eps;
end
Y = sort(Y); % Sort vector
end
Create the following parameterized test for the cleanData function. The test repeats each of the
four test methods for the two data sets that are defined in the properties block.
35-78
Use External Parameters in Parameterized Test
Create and run a parameterized test suite. View the results. The framework runs the eight
parameterized tests using the data defined in the test file.
import matlab.unittest.TestSuite
suite1 = TestSuite.fromClass(?TestClean);
results = suite1.run;
table(results)
Running TestClean
........
Done TestClean
__________
ans =
8×6 table
Create a parameter with the external data set. The fromData method accepts the name of the
parameterized property from the properties block in TestClean and the new data as a cell array
(or struct).
import matlab.unittest.parameters.Parameter
newData = {A};
param = Parameter.fromData('Data',newData);
Create a new test suite and view the suite element names. The fromClass method accepts the new
parameter.
suite2 = TestSuite.fromClass(?TestClean,'ExternalParameters',param);
{suite2.Name}'
ans =
{'TestClean/classCheck(Data=value1#ext)' }
{'TestClean/sortCheck(Data=value1#ext)' }
{'TestClean/finiteCheck(Data=value1#ext)'}
{'TestClean/noZeroCheck(Data=value1#ext)'}
35-79
35 Unit Testing
Using the external parameter, the framework creates four suite elements. Since the parameters are
defined as a cell array, MATLAB generates the parameter name (value1). Also, it appends the
characters #ext to the end of the parameter name, indicating the parameter is defined externally.
To assign meaningful parameter names (instead of valueN), define the parameter using a struct.
View the suite element names and run the tests.
newData = struct('commandLineData',A);
param = Parameter.fromData('Data',newData);
suite2 = TestSuite.fromClass(?TestClean,'ExternalParameters',param);
{suite2.Name}'
results = suite2.run;
ans =
{'TestClean/classCheck(Data=commandLineData#ext)' }
{'TestClean/sortCheck(Data=commandLineData#ext)' }
{'TestClean/finiteCheck(Data=commandLineData#ext)'}
{'TestClean/noZeroCheck(Data=commandLineData#ext)'}
Running TestClean
....
Done TestClean
__________
B = rand(3);
B(2,4) = 0;
dlmwrite('myFile.dat',B)
clear B
newData = struct('commandLineData',A,'storedData',dlmread('myFile.dat'));
param2 = Parameter.fromData('Data',newData);
suite3 = TestSuite.fromClass(?TestClean,'ExternalParameters',param2);
To run the tests using parameters defined in the test file and externally, concatenate test suites. View
the suite element names and run the tests.
ans =
{'TestClean/classCheck(Data=clean)' }
{'TestClean/classCheck(Data=needsCleaning)' }
{'TestClean/sortCheck(Data=clean)' }
{'TestClean/sortCheck(Data=needsCleaning)' }
35-80
Use External Parameters in Parameterized Test
{'TestClean/finiteCheck(Data=clean)' }
{'TestClean/finiteCheck(Data=needsCleaning)' }
{'TestClean/noZeroCheck(Data=clean)' }
{'TestClean/noZeroCheck(Data=needsCleaning)' }
{'TestClean/classCheck(Data=commandLineData#ext)' }
{'TestClean/classCheck(Data=storedData#ext)' }
{'TestClean/sortCheck(Data=commandLineData#ext)' }
{'TestClean/sortCheck(Data=storedData#ext)' }
{'TestClean/finiteCheck(Data=commandLineData#ext)'}
{'TestClean/finiteCheck(Data=storedData#ext)' }
{'TestClean/noZeroCheck(Data=commandLineData#ext)'}
{'TestClean/noZeroCheck(Data=storedData#ext)' }
Running TestClean
........
Done TestClean
__________
Running TestClean
........
Done TestClean
__________
See Also
matlab.unittest.TestSuite | matlab.unittest.parameters.Parameter.fromData
Related Examples
• “Use Parameters in Class-Based Tests” on page 35-61
• “Create Basic Parameterized Test” on page 35-66
• “Create Advanced Parameterized Test” on page 35-71
• “Define Parameters at Suite Creation Time” on page 35-82
35-81
35 Unit Testing
In most cases, MATLAB can determine the value of a parameterization property when it loads the test
class definition. Therefore, you can initialize the property using a default value. When you initialize a
parameterization property with a default value, the parameters associated with the property remain
fixed for different test runs. Each time you create a suite from the parameterized test class, the
testing framework uses the same parameter names and values to run the tests.
In some cases, MATLAB cannot determine the value of a parameterization property when it loads the
test class definition. For example, sometimes a parameterization property depends on another
property defined at a higher parameterization level. Or you might not want the parameters to be
determined at class load time. For instance, if parameters represent files in a folder, you might want
to refresh the parameters each time you create a suite to test the files. When you cannot or do not
want to initialize a parameterization property at class load time, initialize it at suite creation time
using a static method with the TestParameterDefinition attribute. When you initialize a
parameterization property using a TestParameterDefinition method, the parameters associated
with the property can vary for different test runs. In other words, each time you create a test suite
from the parameterized test class, the framework generates fresh parameter names and values to run
the tests.
This example shows how to use parameterization properties with default and nondefault values to
verify that the public properties of a group of classes in your current folder are nonempty. In it, you
define a parameterized test class named PropertiesTest in the test subfolder of your current
folder. You define three classes to test, named ClassA, ClassB, and ClassC, in the source
subfolder of your current folder. For a summary of these three classes, see Classes in source
Subfolder on page 35-0 .
To test the public properties of classes defined in the source subfolder, create the PropertiesTest
class in the test subfolder. This class takes three specified classes, retrieves all properties of each
class, and verifies that they are nonempty. To iterate over the classes to test, parameterize
PropertiesTest at the class-setup level. To iterate over the properties of each class specified by a
given class-setup-level parameterization, parameterize PropertiesTest at the test level.
• List the classes for the framework to iterate over in a property named ClassToTest. Because this
example assumes that the classes in the source subfolder are fixed and known at the time
MATLAB loads the test class definition, initialize the property using a default value. In order to
specify the class to test before running any Test methods, make ClassToTest a
ClassSetupParameter property.
• Define a TestParameter property named PropertyToTest that you can use to iterate over the
properties of whatever class the framework is currently testing. Because its value depends on the
class being tested, do not assign it a default value. Instead, initialize it at suite creation time using
a TestParameterDefinition method.
• To store the value of different properties on an instance of the class being tested, define a
property named ObjectToTest.
35-82
Define Parameters at Suite Creation Time
properties (TestParameter)
PropertyToTest
end
properties
ObjectToTest
end
end
In the PropertiesTest class, PropertyToTest has a different value for each class being tested.
Therefore, you cannot assign a default value to it. Instead, you must initialize it at suite creation time.
To implement this requirement, add a TestParameterDefinition method named
initializeProperty. Because a TestParameterDefinition method must be static, use the
combined method attributes TestParameterDefinition, Static to define the method.
properties (TestParameter)
PropertyToTest
end
properties
ObjectToTest
end
In the initializeProperty method, both the input argument ClassToTest and the output
argument PropertyToTest are parameterization properties defined in the PropertiesTest class.
Any time you define a TestParameterDefinition method, all inputs to the method match
parameterization properties defined in the same class or one of its superclasses. Also, all outputs of
the method must match parameterization properties defined in the same class.
In the initializeProperty method, the input argument ClassToTest is defined at the highest
parameterization level. This puts it higher than the output argument PropertyToTest, which is
defined at the lowest parameterization level. Any time you define a TestParameterDefinition
method that accepts inputs, the inputs must be at a higher parameterization level relative to the
35-83
35 Unit Testing
outputs of the method. For more information about parameterization levels, see “Use Parameters in
Class-Based Tests” on page 35-61.
To test for nonempty property values, you must first create an object of the class being tested so that
you can retrieve the property values. To implement this requirement, add the parameterized
classSetup method to the PropertiesTest class. In order to have the object ready before running
any Test methods, make classSetup a TestClassSetup method.
The classSetup method creates an instance of the class being tested and stores it in the
ObjectToTest property. Tests can later retrieve the property values from ObjectToTest. In this
example, the framework runs the tests by calling the classSetup method three times—one time for
each of ClassA, ClassB, and ClassC.
classdef PropertiesTest < matlab.unittest.TestCase
properties (ClassSetupParameter)
ClassToTest = {'ClassA', 'ClassB', 'ClassC'};
end
properties (TestParameter)
PropertyToTest
end
properties
ObjectToTest
end
methods (TestClassSetup)
function classSetup(testCase,ClassToTest)
constructor = str2func(ClassToTest);
testCase.ObjectToTest = constructor();
end
end
end
To test that the properties on ObjectToTest are nonempty, add a Test method named
testProperty. In order for the method to iterate over the properties of ObjectToTest, make the
method parameterized, and pass it PropertyToTest.
During each test, the testProperty method retrieves the value of a property on ObjectToTest.
Then, it uses a call to the verifyNotEmpty qualification method to verify that the value is not empty.
For a given class-setup-level parameterization, the framework calls testProperty once for each
property on the class being tested.
classdef PropertiesTest < matlab.unittest.TestCase
properties (ClassSetupParameter)
ClassToTest = {'ClassA', 'ClassB', 'ClassC'};
end
35-84
Define Parameters at Suite Creation Time
properties (TestParameter)
PropertyToTest
end
properties
ObjectToTest
end
methods (TestClassSetup)
function classSetup(testCase,ClassToTest)
constructor = str2func(ClassToTest);
testCase.ObjectToTest = constructor();
end
end
methods (Test)
function testProperty(testCase,PropertyToTest)
value = testCase.ObjectToTest.(PropertyToTest);
testCase.verifyNotEmpty(value)
end
end
end
Now that the PropertiesTest class definition is complete, you can create a parameterized test
suite and run the tests. To do this, make sure that the source and test subfolders are on the path.
addpath('source','test')
suite = testsuite('PropertiesTest');
The test suite includes eight elements. Each element corresponds to a property defined within the
source subfolder. Return the name of the first suite element.
suite(1).Name
ans =
'PropertiesTest[ClassToTest=ClassA]/testProperty(PropertyToTest=PropA1)'
Run the tests. Because two properties in the source subfolder are empty, two of the tests fail.
35-85
35 Unit Testing
suite.run
Running PropertiesTest
..
================================================================================
Verification failed in PropertiesTest[ClassToTest=ClassA]/testProperty(PropertyToTest=PropA3).
---------------------
Framework Diagnostic:
---------------------
verifyNotEmpty failed.
--> The value must not be empty.
--> The value has a size of [0 0].
Actual Value:
[]
------------------
Stack Information:
------------------
In C:\TEMP\Examples\matlab-ex41465327\test\PropertiesTest.m (PropertiesTest.testProperty) at
================================================================================
....
================================================================================
Verification failed in PropertiesTest[ClassToTest=ClassC]/testProperty(PropertyToTest=PropC1).
---------------------
Framework Diagnostic:
---------------------
verifyNotEmpty failed.
--> The value must not be empty.
--> The value has a size of [0 0].
Actual Value:
[]
------------------
Stack Information:
------------------
In C:\TEMP\Examples\matlab-ex41465327\test\PropertiesTest.m (PropertiesTest.testProperty) at
================================================================================
..
Done PropertiesTest
__________
Failure Summary:
ans =
1×8 TestResult array with properties:
Name
Passed
Failed
Incomplete
Duration
Details
35-86
Define Parameters at Suite Creation Time
Totals:
6 Passed, 2 Failed (rerun), 0 Incomplete.
2.9493 seconds testing time.
Run only the tests for ClassB. To do this, use the selectIf method of the
matlab.unittest.TestSuite class to select test suite elements that use a particular
parameterization. The resulting test suite is a filtered suite and has only three elements.
suite2 = suite.selectIf('ParameterName','PropB*');
{suite2.Name}'
Running PropertiesTest
...
Done PropertiesTest
__________
Alternatively, you can run the same tests by creating a selector that filters the test suite by
parameterization.
import matlab.unittest.selectors.HasParameter
import matlab.unittest.constraints.StartsWithSubstring
suite3 = matlab.unittest.TestSuite.fromClass(?PropertiesTest, ...
HasParameter('Name',StartsWithSubstring('PropB')));
suite3.run;
Running PropertiesTest
...
Done PropertiesTest
__________
This section provides the contents of the classes in the source subfolder.
ClassA has three properties. Two of its properties have nonempty values.
classdef ClassA
properties
PropA1 = 1;
PropA2 = 2;
PropA3
end
end
ClassB has three properties. All of its properties have nonempty values.
35-87
35 Unit Testing
classdef ClassB
properties
PropB1 = 1;
PropB2 = 2;
PropB3 = 'a';
end
end
ClassC has two properties. One of its properties has a nonempty value.
classdef ClassC
properties
PropC1
PropC2 = [1 2 3];
end
end
See Also
matlab.unittest.TestSuite | matlab.unittest.selectors.HasParameter |
matlab.unittest.TestCase
Related Examples
• “Use Parameters in Class-Based Tests” on page 35-61
• “Create Basic Parameterized Test” on page 35-66
• “Create Advanced Parameterized Test” on page 35-71
• “Use External Parameters in Parameterized Test” on page 35-78
35-88
Create Simple Test Suites
Create the following function that solves roots of the quadratic equation in a file,
quadraticSolver.m, in your working folder.
end
Create the following test class in a file, SolverTest.m, in your working folder.
methods (Test)
function testRealSolution(testCase)
actSolution = quadraticSolver(1,-3,2);
expSolution = [2,1];
testCase.verifyEqual(actSolution,expSolution);
end
function testImaginarySolution(testCase)
actSolution = quadraticSolver(1,2,10);
expSolution = [-1+3i, -1-3i];
testCase.verifyEqual(actSolution,expSolution);
end
end
end
At the command prompt, add the matlab.unittest.TestSuite class to the current import list.
import matlab.unittest.TestSuite
Make sure the SolverTest class definition file is on your MATLAB path.
35-89
35 Unit Testing
The fromClass method creates a suite from all Test methods in the SolverTest class.
suiteClass = TestSuite.fromClass(?SolverTest);
result = run(suiteClass);
The fromFile method creates a suite using the name of the file to identify the class.
suiteFile = TestSuite.fromFile('SolverTest.m');
result = run(suiteFile);
The fromFolder method creates a suite from all test case files in the specified folder. For example,
the following files are in the current folder:
• BankAccountTest.m
• DocPolynomTest.m
• FigurePropertiesTest.m
• IsSupportedTest.m
• SolverTest.m
suiteFolder = TestSuite.fromFolder(pwd);
result = run(suiteFolder);
suiteMethod = TestSuite.fromMethod(?SolverTest,'testRealSolution')'
result = run(suiteMethod);
See Also
matlab.unittest.TestSuite
Related Examples
• “Write Simple Test Case Using Classes” on page 35-38
35-90
Run Tests for Various Workflows
You can also assign the test file output to a variable and run the tests using the functional form or dot
notation.
% Create Test or TestCase objects
t1 = DocPolynomTest; % TestCase object from class-based test
t2 = axesPropertiesTest; % Test object from function-based test
Alternatively, you can run tests contained in a single file by using runtests or from the Editor.
35-91
35 Unit Testing
results1 = run(DocPolynomTest,'testMultiplication');
Function-based test files return an array of Test objects instead of a single TestCase object. You
can run a particular test by indexing into the array. However, you must examine the Name field in the
test array to ensure you run the correct test. For example, only run the test, surfaceColorTest,
from the axesPropertiesTest file.
ans =
axesPropertiesTest/testDefaultXLim
ans =
axesPropertiesTest/surfaceColorTest
suite = {'axesPropertiesTest','DocPolynomTest'};
runtests(suite);
Run all tests in the current folder using the pwd as input to the runtests function.
runtests(pwd);
Alternatively, you can explicitly create Test arrays and use the run method to run them.
import matlab.unittest.TestSuite
s1 = TestSuite.fromClass(?DocPolynomTest);
s2 = TestSuite.fromFile('axesPropertiesTest.m');
35-92
Run Tests for Various Workflows
Since the suite is explicitly defined, it is easy for you to perform further analysis on the suite, such as
rerunning failed tests.
failedTests = fullSuite([result.Failed]);
result2 = run(failedTests);
import matlab.unittest.TestRunner
import matlab.unittest.TestSuite
import matlab.unittest.plugins.TestRunProgressPlugin
% Generate TestSuite.
s1 = TestSuite.fromClass(?DocPolynomTest);
s2 = TestSuite.fromFile('axesPropertiesTest.m');
suite = [s1 s2];
See Also
runtests | run (TestCase) | run (TestSuite) | run (TestRunner)
More About
• “Run Tests in Editor” on page 35-17
35-93
35 Unit Testing
After you run tests, you can access recorded diagnostics using the DiagnosticRecord field in the
Details property on the TestResult object. For example, if your test results are stored in the
variable results, then result(2).Details.DiagnosticRecord contains the recorded
diagnostics for the second test in the suite.
The recorded diagnostics are DiagnosticRecord objects. To access particular types of test
diagnostics for a test, use the selectFailed, selectPassed, selectIncomplete, and
selectLogged methods of the DiagnosticRecord class.
See Also
matlab.unittest.plugins.DiagnosticsRecordingPlugin |
matlab.unittest.plugins.diagnosticrecord.DiagnosticRecord |
matlab.unittest.TestResult
Related Examples
• “Add Plugin to Test Runner” on page 35-95
35-94
Add Plugin to Test Runner
In a file in your working folder, create a test file for the BankAccount class.
type BankAccountTest.m
methods (TestClassSetup)
function addBankAccountClassToPath(testCase)
p = path;
testCase.addTeardown(@path,p);
addpath(fullfile(matlabroot,'help','techdoc','matlab_oop',...
'examples'));
end
end
methods (Test)
function testConstructor(testCase)
b = BankAccount(1234, 100);
testCase.verifyEqual(b.AccountNumber, 1234, ...
'Constructor failed to correctly set account number');
testCase.verifyEqual(b.AccountBalance, 100, ...
'Constructor failed to correctly set account balance');
end
function testConstructorNotEnoughInputs(testCase)
import matlab.unittest.constraints.Throws;
testCase.verifyThat(@()BankAccount, ...
Throws('MATLAB:minrhs'));
end
function testDesposit(testCase)
b = BankAccount(1234, 100);
b.deposit(25);
testCase.verifyEqual(b.AccountBalance, 125);
end
function testWithdraw(testCase)
b = BankAccount(1234, 100);
b.withdraw(25);
testCase.verifyEqual(b.AccountBalance, 75);
end
function testNotifyInsufficientFunds(testCase)
callbackExecuted = false;
function testCallback(~,~)
callbackExecuted = true;
end
35-95
35 Unit Testing
b = BankAccount(1234, 100);
b.addlistener('InsufficientFunds', @testCallback);
b.withdraw(50);
testCase.assertFalse(callbackExecuted, ...
'The callback should not have executed yet');
b.withdraw(60);
testCase.verifyTrue(callbackExecuted, ...
'The listener callback should have fired');
end
end
end
At the command prompt, create a test suite, ts, from the BankAccountTest test case.
ts = matlab.unittest.TestSuite.fromClass(?BankAccountTest);
runner = matlab.unittest.TestRunner.withNoPlugins;
res = runner.run(ts);
No output displayed.
import matlab.unittest.plugins.TestRunProgressPlugin
runner.addPlugin(TestRunProgressPlugin.withVerbosity(2))
res = runner.run(ts);
Running BankAccountTest
.....
Done BankAccountTest
__________
See Also
matlab.unittest.plugins
35-96
Write Plugins to Extend TestRunner
At the test suite, test class, and test levels, the reportFinalizedResult method enables the
TestRunner to report finalized test results. A test result is finalized when no remaining test content
can modify it. The TestRunner determines if it invokes the reportFinalizedResult method at
each level. At the test session level, the reportFinalizedSuite method enables the TestRunner
to report test results once the test suite is finalized.
The creation methods are the only set of TestRunnerPlugin methods with an output argument.
Typically, you extend the creation methods to listen for various events originating from the test
content at the corresponding level. Since both TestCase and Fixture instances inherit from the
handle class, you add listeners using the addlistener method. The methods that set up, run, and
tear down test content extend the way the TestRunner evaluates the test content.
35-97
35 Unit Testing
The run method at this level, runTestSuite, extends the running of a portion of the entire
TestSuite array that the testing framework passes to the TestRunner. The
reportFinalizedSuite method extends the reporting of a test suite that has been finalized by
runTestSuite.
At this level, the createSharedTestFixture method is the only plugin method with an output
argument. It returns the Fixture instances for each shared fixture required by a test class. These
fixture instances are available to the test through the getSharedTestFixtures method of
TestCase.
The run method at this level, runTestClass, extends the running of tests that belong to the same
test class or the same function-based test, and incorporates the functionality described for the test
class level plugin methods.
At this level, the createTestClassInstance method is the only plugin method with an output
argument. It returns the TestCase instances created at the class level. For each class, the testing
framework passes the instance into any methods with the TestClassSetup or
TestClassTeardown attribute.
The run method at this level, runTest, extends the running of a single TestSuite element, and
incorporates the functionality described for the test level plugin methods.
35-98
Write Plugins to Extend TestRunner
The testing framework evaluates methods at the test class level within the scope of the
runTestClass method. If the TestClassSetup code completes successfully, it invokes the
runTest method one time for each element in the TestSuite array. Each TestClassSetup
parameterization invokes the creation, setup, and teardown methods a single time.
At this level, the createTestMethodInstance method is the only plugin method with an output
argument. It returns the TestCase instances created for each Test element. The testing framework
passes each of these instances into the corresponding Test methods, and into any methods with the
TestMethodSetup or TestMethodTeardown attribute.
The testing framework evaluates methods at the test level within the scope of the runTest method.
Provided the framework completes all TestMethodSetup work, it invokes the plugin methods at this
level a single time per Test element.
See Also
matlab.unittest.plugins.TestRunnerPlugin | matlab.unittest.plugins.OutputStream
| matlab.unittest.TestCase | matlab.unittest.TestRunner |
matlab.unittest.fixtures.Fixture | addlistener | matlab.unittest.TestSuite |
matlab.unittest.plugins.Parallelizable
Related Examples
• “Create Custom Plugin” on page 35-100
• “Run Tests in Parallel with Custom Plugin” on page 35-105
• “Plugin to Generate Custom Test Output Format” on page 35-122
• “Write Plugin to Save Diagnostic Details” on page 35-118
35-99
35 Unit Testing
In a file in your current folder, create the custom plugin class AssertionCountingPlugin, which
inherits from the TestRunnerPlugin class. For the complete code for
AssertionCountingPlugin, see AssertionCountingPlugin Class Definition Summary on page 35-
0 .
To keep track of the number of passing and failing assertions, define two read-only properties,
NumPassingAssertions and NumFailingAssertions, within a properties block.
plugin.NumPassingAssertions = 0;
plugin.NumFailingAssertions = 0;
[email protected](...
plugin, pluginData);
The testing framework evaluates this method one time. It displays information about the total number
of tests, initializes the properties used by the plugin to generate text output, and invokes the
superclass method. After the framework completes evaluating the superclass method, the
runTestSuite method displays the assertion count summary by calling the helper method
printAssertionSummary (see Define Helper Methods on page 35-0 ).
Add listeners to AssertionPassed and AssertionFailed events to count the assertions. To add
these listeners, extend the methods used by the testing framework to create the test content. The test
content includes TestCase instances for each Test element, class-level TestCase instances for the
TestClassSetup and TestClassTeardown methods, and Fixture instances used when a
TestCase class has the SharedTestFixtures attribute.
35-100
Create Custom Plugin
Invoke the corresponding superclass method when you override the creation methods. The creation
methods return the content that the testing framework creates for each of their respective contexts.
When implementing one of these methods using the incrementPassingAssertionsCount and
incrementFailingAssertionsCount helper methods on page 35-0 , add the listeners required
by the plugin to the returned Fixture or TestCase instance.
fixture.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
fixture.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
testCase.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
testCase.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
testCase.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
testCase.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
end
Extend runTest to display the name of each test at run time. Include this method in a methods
block with protected access. Like all plugin methods, the runTest method requires you to invoke
the corresponding superclass method.
[email protected](...
plugin, pluginData);
end
end
35-101
35 Unit Testing
In a methods block with private access, define three helper methods. These methods increment the
number of passing or failing assertions, and print the assertion count summary.
function incrementFailingAssertionsCount(plugin)
plugin.NumFailingAssertions = plugin.NumFailingAssertions + 1;
end
function printAssertionSummary(plugin)
fprintf('%s\n', repmat('_', 1, 30))
fprintf('Total Assertions: %d\n', ...
plugin.NumPassingAssertions + plugin.NumFailingAssertions)
fprintf('\t%d Passed, %d Failed\n', ...
plugin.NumPassingAssertions, plugin.NumFailingAssertions)
end
end
plugin.NumPassingAssertions = 0;
plugin.NumFailingAssertions = 0;
[email protected](...
plugin, pluginData);
fixture.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
fixture.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
testCase.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
35-102
Create Custom Plugin
testCase.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
testCase.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
testCase.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
[email protected](...
plugin, pluginData);
end
end
function incrementFailingAssertionsCount(plugin)
plugin.NumFailingAssertions = plugin.NumFailingAssertions + 1;
end
function printAssertionSummary(plugin)
fprintf('%s\n', repmat('_', 1, 30))
fprintf('Total Assertions: %d\n', ...
plugin.NumPassingAssertions + plugin.NumFailingAssertions)
fprintf('\t%d Passed, %d Failed\n', ...
plugin.NumPassingAssertions, plugin.NumFailingAssertions)
end
end
end
In your current folder, create a file named ExampleTest.m containing the following test class.
classdef ExampleTest < matlab.unittest.TestCase
methods(Test)
function testOne(testCase) % Test fails
testCase.assertEqual(5, 4)
end
function testTwo(testCase) % Test passes
testCase.verifyEqual(5, 5)
end
function testThree(testCase) % Test passes
testCase.assertEqual(7*2, 14)
end
end
end
At the command prompt, create a test suite from the ExampleTest class.
import matlab.unittest.TestSuite
import matlab.unittest.TestRunner
suite = TestSuite.fromClass(?ExampleTest);
35-103
35 Unit Testing
Create a TestRunner instance with no plugins. This code creates a silent runner and gives you
control over the installed plugins.
runner = TestRunner.withNoPlugins;
result = runner.run(suite);
runner.addPlugin(AssertionCountingPlugin)
result = runner.run(suite);
See Also
matlab.unittest.plugins.TestRunnerPlugin | matlab.unittest.plugins.OutputStream
| matlab.unittest.TestCase | matlab.unittest.TestRunner |
matlab.unittest.fixtures.Fixture | addlistener
Related Examples
• “Write Plugins to Extend TestRunner” on page 35-97
• “Run Tests in Parallel with Custom Plugin” on page 35-105
• “Write Plugin to Save Diagnostic Details” on page 35-118
35-104
Run Tests in Parallel with Custom Plugin
In a file in your current folder, create the parallelizable plugin class AssertionCountingPlugin,
which inherits from both the TestRunnerPlugin and Parallelizable classes. For the complete
code for AssertionCountingPlugin, see Plugin Class Definition Summary on page 35-0 .
To keep track of the number of passing and failing assertions, define four read-only properties within
a properties block. Each MATLAB worker on the current parallel pool uses
NumPassingAssertions and NumFailingAssertions to track the number of passing and failing
assertions when running a portion of the TestSuite array. The MATLAB client uses
FinalizedNumPassingAssertions and FinalizedNumFailingAssertions to aggregate the
results from different workers and to report the total number of passing and failing assertions at the
end of the test session.
To extend the running of the entire TestSuite array, override the runSession method of
TestRunnerPlugin in a methods block with protected access. The testing framework evaluates
this method one time on the client.
[email protected](plugin, pluginData);
runSession displays information about the total number of Test elements, initializes the properties
used by the plugin to generate text output, and invokes the superclass method to trigger the entire
test run. After the framework completes evaluating the superclass method, runSession displays the
assertion count summary by calling the helper method printAssertionSummary (see Define Helper
Methods on page 35-0 ).
35-105
35 Unit Testing
Add listeners to AssertionPassed and AssertionFailed events to count the assertions. To add
these listeners, extend the methods used by the testing framework to create the test content. The test
content includes TestCase instances for each Test element, class-level TestCase instances for the
TestClassSetup and TestClassTeardown method blocks, and Fixture instances used when a
TestCase class has the SharedTestFixtures attribute.
Invoke the corresponding superclass method when you override the creation methods. The creation
methods return the content that the testing framework creates for each of their respective contexts.
When implementing one of these methods using the incrementPassingAssertionsCount and
incrementFailingAssertionsCount helper methods on page 35-0 , add the listeners required
by the plugin to the returned Fixture or TestCase instance.
fixture.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
fixture.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
testCase.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
testCase.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
testCase.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
testCase.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
end
The testing framework divides the entire TestSuite array into different groups and assigns them to
workers for processing. Each worker can run one or more test suite portions. To customize the
behavior of workers, override the runTestSuite method of TestRunnerPlugin in a methods
block with protected access.
Extend the TestRunner to display the identifier of each test group that a worker runs along with the
number of Test elements within the group. Additionally, store the number of passing and failing
35-106
Run Tests in Parallel with Custom Plugin
assertions in a buffer so that the client can retrieve these values to produce the finalized results. Like
all plugin methods, the runTestSuite method requires you to invoke the corresponding superclass
method at an appropriate point. In this case, invoke the superclass method after initializing the
properties and before storing the worker data. The testing framework evaluates runTestSuite on
the workers as many times as the number of test suite portions.
methods (Access = protected)
function runTestSuite(plugin, pluginData)
suiteSize = numel(pluginData.TestSuite);
groupNumber = pluginData.Group;
fprintf('### Running a total of %d tests in group %d\n', ...
suiteSize, groupNumber);
plugin.NumPassingAssertions = 0;
plugin.NumFailingAssertions = 0;
[email protected](...
plugin, pluginData);
To store test-specific data, the implementation of runTestSuite contains a call to the storeIn
method of the Parallelizable interface. Use storeIn along with retrieveFrom when workers
must report to the client. In this example, after returning from the superclass method,
NumPassingAssertions and NumFailingAssertions contain the number of passing and failing
assertions corresponding to a group of tests. Because storeIn accepts the worker data as only one
input argument, assertionStruct groups the assertion counts using two fields.
Extend reportFinalizedSuite to aggregate the assertion counts by retrieving test data for each
finalized test suite portion. To retrieve the stored assertionStruct for a test suite portion, invoke
the retrieveFrom method within the scope of reportFinalizedSuite. Add the field values to the
corresponding class properties, and invoke the superclass method. The testing framework evaluates
this method on the client as many times as the number of test suite portions.
methods (Access = protected)
function reportFinalizedSuite(plugin, pluginData)
assertionStruct = plugin.retrieveFrom(pluginData.CommunicationBuffer);
plugin.FinalizedNumPassingAssertions = ...
plugin.FinalizedNumPassingAssertions + assertionStruct.Passing;
plugin.FinalizedNumFailingAssertions = ...
plugin.FinalizedNumFailingAssertions + assertionStruct.Failing;
[email protected](...
plugin, pluginData);
end
end
In a methods block with private access, define three helper methods. These methods increment the
number of passing or failing assertions within each running test suite portion, and print the assertion
count summary.
35-107
35 Unit Testing
function incrementFailingAssertionsCount(plugin)
plugin.NumFailingAssertions = plugin.NumFailingAssertions + 1;
end
function printAssertionSummary(plugin)
fprintf('%s\n', repmat('_', 1, 30))
fprintf('Total Assertions: %d\n', plugin.FinalizedNumPassingAssertions + ...
plugin.FinalizedNumFailingAssertions)
fprintf('\t%d Passed, %d Failed\n', plugin.FinalizedNumPassingAssertions, ...
plugin.FinalizedNumFailingAssertions)
end
end
[email protected](plugin, pluginData);
fixture.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
fixture.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
testCase.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
testCase.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
35-108
Run Tests in Parallel with Custom Plugin
testCase = createTestMethodInstance@...
matlab.unittest.plugins.TestRunnerPlugin(plugin, pluginData);
testCase.addlistener('AssertionPassed', ...
@(~,~)plugin.incrementPassingAssertionsCount);
testCase.addlistener('AssertionFailed', ...
@(~,~)plugin.incrementFailingAssertionsCount);
end
[email protected](...
plugin, pluginData);
[email protected](...
plugin, pluginData);
end
end
function incrementFailingAssertionsCount(plugin)
plugin.NumFailingAssertions = plugin.NumFailingAssertions + 1;
end
function printAssertionSummary(plugin)
fprintf('%s\n', repmat('_', 1, 30))
fprintf('Total Assertions: %d\n', plugin.FinalizedNumPassingAssertions + ...
plugin.FinalizedNumFailingAssertions)
fprintf('\t%d Passed, %d Failed\n', plugin.FinalizedNumPassingAssertions, ...
plugin.FinalizedNumFailingAssertions)
end
end
end
In your current folder, create a file named ExampleTest.m containing the following parameterized
test class. This class results in 300 Test elements, 100 of which are assertion tests that compare
pseudorandom integers between 1 and 10.
properties (TestParameter)
num1 = repmat({@()randi(10)}, 1, 10);
num2 = repmat({@()randi(10)}, 1, 10);
end
35-109
35 Unit Testing
methods(Test)
function testAssert(testCase, num1, num2)
testCase.assertNotEqual(num1(), num2())
end
function testVerify(testCase, num1, num2)
testCase.verifyNotEqual(num1(), num2())
end
function testAssume(testCase, num1, num2)
testCase.assumeNotEqual(num1(), num2())
end
end
end
At the command prompt, create a test suite from the ExampleTest class.
import matlab.unittest.TestSuite
import matlab.unittest.TestRunner
suite = TestSuite.fromClass(?ExampleTest);
Create a TestRunner instance with no plugins. This code creates a silent runner and gives you
control over the installed plugins.
runner = TestRunner.withNoPlugins;
Add AssertionCountingPlugin to the runner and run the tests in parallel. You can also run the
same tests in serial mode if you invoke the run method on the runner.
runner.addPlugin(AssertionCountingPlugin)
result = runner.runInParallel(suite);
----------------
Finished Group 1
----------------
### Running a total of 20 tests in group 1
----------------
Finished Group 2
----------------
### Running a total of 20 tests in group 2
----------------
Finished Group 3
----------------
### Running a total of 19 tests in group 3
35-110
Run Tests in Parallel with Custom Plugin
----------------
Finished Group 4
----------------
### Running a total of 19 tests in group 4
----------------
Finished Group 5
----------------
### Running a total of 18 tests in group 5
----------------
Finished Group 7
----------------
### Running a total of 18 tests in group 7
----------------
Finished Group 8
----------------
### Running a total of 17 tests in group 8
----------------
Finished Group 9
----------------
### Running a total of 17 tests in group 9
-----------------
Finished Group 10
-----------------
### Running a total of 17 tests in group 10
-----------------
Finished Group 11
-----------------
### Running a total of 16 tests in group 11
-----------------
Finished Group 12
-----------------
### Running a total of 16 tests in group 12
-----------------
Finished Group 15
-----------------
### Running a total of 15 tests in group 15
-----------------
Finished Group 14
-----------------
### Running a total of 15 tests in group 14
-----------------
Finished Group 17
-----------------
### Running a total of 14 tests in group 17
-----------------
Finished Group 16
35-111
35 Unit Testing
-----------------
### Running a total of 14 tests in group 16
-----------------
Finished Group 13
-----------------
### Running a total of 15 tests in group 13
-----------------
Finished Group 18
-----------------
### Running a total of 12 tests in group 18
See Also
matlab.unittest.plugins.TestRunnerPlugin | matlab.unittest.TestCase |
matlab.unittest.TestRunner | matlab.unittest.fixtures.Fixture |
matlab.unittest.plugins.Parallelizable | matlab.unittest.TestSuite | addlistener
| runInParallel | matlab.unittest.TestResult
Related Examples
• “Write Plugins to Extend TestRunner” on page 35-97
• “Create Custom Plugin” on page 35-100
35-112
Write Plugin to Add Data to Test Results
In a file in your current folder, create the custom plugin class DetailsRecordingPlugin, which
inherits from the TestRunnerPlugin class. For the complete code for DetailsRecordingPlugin,
see DetailsRecordingPlugin Class Definition Summary on page 35-0 .
To store the actual and expected values in TestResult objects, define two constant properties,
ActField and ExpField, within a properties block. Set the value of ActField to the name of the
field of the Details structure that contains the actual value. Set the value of ExpField to the name
of the field that contains the expected value.
properties (Constant,Access = private)
ActField = 'ActualValue';
ExpField = 'ExpectedValue';
end
To add new fields to the Details property of all TestResult objects belonging to the test session,
override the runSession method of TestRunnerPlugin in a methods block with protected
access. runSession adds two empty fields to the Details structure of TestResult objects and
invokes the superclass method to trigger the entire test run.
methods (Access = protected)
function runSession(plugin,pluginData)
resultDetails = pluginData.ResultDetails;
resultDetails.append(plugin.ActField,{})
resultDetails.append(plugin.ExpField,{})
[email protected](plugin,pluginData);
end
end
To add the fields, the implementation of runSession contains calls to the append method of the
matlab.unittest.plugins.plugindata.ResultDetails class. Each call adds an empty field to
the Details structure.
Add listeners for the AssertionPassed and AssertionFailed events by extending the methods
used by the testing framework to create the test content. The test content includes TestCase
instances for each Test element, class-level TestCase instances for the TestClassSetup and
TestClassTeardown method blocks, and Fixture instances used when a TestCase class has the
SharedTestFixtures attribute.
Invoke the corresponding superclass method when you override the creation methods. The listeners
that you add to the returned Fixture or TestCase instances cause the reactToAssertion helper
method on page 35-0 to execute whenever an assertion is performed. To add assertion data to test
results, pass the result modifier instance along with the assertion event listener data to the helper
method.
35-113
35 Unit Testing
In a methods block with private access, define the helper method reactToAssertion. This
method uses the QualificationEventData instance to extract the actual and expected values in
assertions based on the IsEqualTo constraint, converts the extracted values to cell arrays, and
appends the cell arrays to the fields of the corresponding TestResult object.
35-114
Write Plugin to Add Data to Test Results
end
In your current folder, create a file named ExampleTest.m containing the following parameterized
test class. The class results in a test suite with 25 elements, each corresponding to an experiment
performed using a different seed for the random number generator. In each experiment, the testing
framework creates a 1-by-100 vector of normally distributed random numbers and asserts that the
magnitude of the difference between the actual and expected sample means is within 0.1.
classdef ExampleTest < matlab.unittest.TestCase
properties
SampleSize = 100;
end
properties (TestParameter)
seed = num2cell(randi(10^6,1,25));
end
35-115
35 Unit Testing
methods(Test)
function testMean(testCase,seed)
import matlab.unittest.constraints.IsEqualTo
import matlab.unittest.constraints.AbsoluteTolerance
rng(seed)
testCase.assertThat(mean(randn(1,testCase.SampleSize)),...
IsEqualTo(0,'Within',AbsoluteTolerance(0.1)));
end
end
end
At the command prompt, create a test suite from the ExampleTest class.
import matlab.unittest.TestSuite
import matlab.unittest.TestRunner
suite = TestSuite.fromClass(?ExampleTest);
Create a TestRunner instance with no plugins. This code creates a silent runner and gives you
control over the installed plugins.
runner = TestRunner.withNoPlugins;
runner.addPlugin(DetailsRecordingPlugin)
result = runner.run(suite)
result =
Name
Passed
Failed
Incomplete
Duration
Details
Totals:
18 Passed, 7 Failed (rerun), 7 Incomplete.
0.12529 seconds testing time.
To retrieve more information about the behavior of random number generation, create a structure
array from the Details structures of the test results.
details = [result.Details]
details =
ActualValue
ExpectedValue
35-116
Write Plugin to Add Data to Test Results
Create an array containing the difference between the actual and expected values in each test and
then display the error values in a bar graph. The seven bars with a length greater than 0.1
correspond to the failed tests.
errorInMean = cell2mat([details.ExpectedValue]) - cell2mat([details.ActualValue]);
bar(errorInMean)
xlabel('Experiment')
ylabel('Error')
See Also
matlab.unittest.plugins.TestRunnerPlugin | matlab.unittest.TestRunner |
matlab.unittest.fixtures.Fixture | matlab.unittest.TestSuite | addlistener |
matlab.unittest.TestResult | matlab.unittest.plugins.plugindata.ResultDetails
Related Examples
• “Write Plugins to Extend TestRunner” on page 35-97
• “Create Custom Plugin” on page 35-100
35-117
35 Unit Testing
Create Plugin
In a file in your working folder, create a class, myPlugin, that inherits from the
matlab.unittest.plugins.TestRunnerPlugin class. In the plugin class:
• Define a FailedTestData property on the plugin that stores information from failed tests.
• Override the default createTestMethodInstance method of TestRunnerPlugin to listen for
assertion, fatal assertion, and verification failures, and to record relevant information.
• Override the default runTestSuite method of TestRunnerPlugin to initialize the
FailedTestData property value. If you do not initialize value of the property, each time you run
the tests using the same test runner, failed test information is appended to the FailedTestData
property.
• Define a helper function, recordData, to save information about the test failure as a table.
The plugin saves information contained in the PluginData and QualificationEventData objects.
It also saves the type of failure and timestamp.
properties
FailedTestData
end
testName = pluginData.Name;
testCase.addlistener('AssertionFailed', ...
@(~,event)plugin.recordData(event,testName, 'Assertion'));
testCase.addlistener('FatalAssertionFailed', ...
@(~,event)plugin.recordData(event,testName, 'Fatal Assertion'));
testCase.addlistener('VerificationFailed', ...
@(~,event)plugin.recordData(event,testName, 'Verification'));
end
end
35-118
Write Plugin to Save Diagnostic Details
In your working folder, create the file ExampleTest.m containing the following test class.
classdef ExampleTest < matlab.unittest.TestCase
methods(Test)
function testOne(testCase)
testCase.assertGreaterThan(5,10)
end
function testTwo(testCase)
wrongAnswer = 'wrong';
testCase.verifyEmpty(wrongAnswer,'Not Empty')
testCase.verifyClass(wrongAnswer,'double','Not double')
end
function testThree(testCase)
testCase.assertEqual(7*2,13,'Values not equal')
end
function testFour(testCase)
testCase.fatalAssertEqual(3+2,6);
end
end
end
The fatal assertion failure in testFour causes the framework to halt and throw an error. In this
example, there are no subsequent tests. If there was a subsequent test, the framework would not run
it.
At the command prompt, create a test suite from the ExampleTest class, and create a test runner.
import matlab.unittest.TestSuite
import matlab.unittest.TestRunner
suite = TestSuite.fromClass(?ExampleTest);
runner = TestRunner.withNoPlugins;
Create an instance of myPlugin and add it to the test runner. Run the tests.
p = DiagnosticRecorderPlugin;
runner.addPlugin(p)
result = runner.run(suite);
35-119
35 Unit Testing
With the failed fatal assertion, the framework throws an error, and the test runner does not return a
TestResult object. However, the DiagnosticRecorderPlugin stores information about the tests
preceding and including the test with the failed assertion.
At the command prompt, view information about the failed tests. The information is saved in the
FailedTestData property of the plugin.
T = p.FailedTestData
T =
5×6 table
There are many options to archive or post-process this information. For example, you can save the
variable as a MAT-file or use writetable to write the table to various file types, such as .txt, .csv,
or .xls.
T.Stack(3)
ans =
file: 'C:\Work\ExampleTest.m'
name: 'ExampleTest.testTwo'
line: 9
Display the diagnostics that the framework displayed for the fifth test failure.
celldisp(T.FrameworkDiagnostics(5))
ans{1} =
fatalAssertEqual failed.
--> The values are not equal using "isequaln".
--> Failure table:
Actual Expected Error RelativeError
______ ________ _____ __________________
5 6 -1 -0.166666666666667
Actual Value:
5
35-120
Write Plugin to Save Diagnostic Details
Expected Value:
6
See Also
matlab.unittest.plugins.TestRunnerPlugin | matlab.unittest.TestCase |
matlab.unittest.TestRunner | addlistener
Related Examples
• “Write Plugins to Extend TestRunner” on page 35-97
• “Create Custom Plugin” on page 35-100
• “Plugin to Generate Custom Test Output Format” on page 35-122
35-121
35 Unit Testing
Create Plugin
In a file in your working folder, create a class, ExampleCustomPlugin, that inherits from the
matlab.unittest.plugins.TestRunnerPlugin class. In the plugin class:
• Define a Stream property on the plugin that stores the OutputStream instance. By default, the
plugin writes to standard output.
• Override the default runTestSuite method of TestRunnerPlugin to output text that indicates
the test runner is running a new test session. This information is especially useful if you are
writing to a single log file, as it allows you to differentiate the test runs.
• Override the default reportFinalizedResult method of TestRunnerPlugin to write finalized
test results to the output stream. You can modify the print method to output the test results in a
format that works for your test logs or continuous integration system.
classdef ExampleCustomPlugin < matlab.unittest.plugins.TestRunnerPlugin
properties (Access=private)
Stream
end
methods
function p = ExampleCustomPlugin(stream)
if ~nargin
stream = matlab.unittest.plugins.ToStandardOutput;
end
validateattributes(stream,...
{'matlab.unittest.plugins.OutputStream'},{})
p.Stream = stream;
end
end
methods (Access=protected)
function runTestSuite(plugin,pluginData)
plugin.Stream.print('\n--- NEW TEST SESSION at %s ---\n',...
char(datetime))
runTestSuite@...
matlab.unittest.plugins.TestRunnerPlugin(plugin,pluginData);
end
function reportFinalizedResult(plugin,pluginData)
thisResult = pluginData.TestResult;
if thisResult.Passed
status = 'PASSED';
elseif thisResult.Failed
status = 'FAILED';
elseif thisResult.Incomplete
status = 'SKIPPED';
end
plugin.Stream.print(...
'### YPS Company - Test %s ### - %s in %f seconds.\n',...
status,thisResult.Name,thisResult.Duration)
35-122
Plugin to Generate Custom Test Output Format
reportFinalizedResult@...
matlab.unittest.plugins.TestRunnerPlugin(plugin,pluginData)
end
end
end
In your working folder, create the file ExampleTest.m containing the following test class. In this test
class, two of the tests pass and the others result in a verification or assumption failure.
classdef ExampleTest < matlab.unittest.TestCase
methods(Test)
function testOne(testCase)
testCase.assertGreaterThan(5,1)
end
function testTwo(testCase)
wrongAnswer = 'wrong';
testCase.verifyEmpty(wrongAnswer,'Not Empty')
testCase.verifyClass(wrongAnswer,'double','Not double')
end
function testThree(testCase)
testCase.assumeEqual(7*2,13,'Values not equal')
end
function testFour(testCase)
testCase.verifyEqual(3+2,5);
end
end
end
At the command prompt, create a test suite from the ExampleTest class, and create a test runner.
import matlab.unittest.TestSuite
import matlab.unittest.TestRunner
suite = TestSuite.fromClass(?ExampleTest);
runner = TestRunner.withNoPlugins;
Create an instance of ExampleCustomPlugin and add it to the test runner. Run the tests.
import matlab.unittest.plugins.ToFile
fname = 'YPS_test_results.txt';
p = ExampleCustomPlugin(ToFile(fname));
runner.addPlugin(p)
result = runner.run(suite);
35-123
35 Unit Testing
Rerun the Incomplete tests using the same test runner. View the contents of the output file.
suiteFiltered = suite([result.Incomplete]);
result2 = runner.run(suiteFiltered);
type(fname)
See Also
matlab.unittest.plugins.TestRunnerPlugin | matlab.unittest.plugins.OutputStream
| ToFile | ToStandardOutput
Related Examples
• “Write Plugins to Extend TestRunner” on page 35-97
• “Write Plugin to Save Diagnostic Details” on page 35-118
35-124
Analyze Test Case Results
Create the following function that solves roots of the quadratic equation in a file,
quadraticSolver.m, in your working folder.
type quadraticSolver.m
end
Create the following test class in a file, SolverTest.m, in your working folder.
type SolverTest.m
quadTests = matlab.unittest.TestSuite.fromClass(?SolverTest);
result = run(quadTests);
35-125
35 Unit Testing
Running SolverTest
...
Done SolverTest
__________
ans =
TestResult with properties:
Name: 'SolverTest/realSolution'
Passed: 1
Failed: 0
Incomplete: 0
Duration: 0.0065
Details: [1×1 struct]
Totals:
1 Passed, 0 Failed, 0 Incomplete.
0.0065241 seconds testing time.
To access functionality available to tables, create one from the TestResult object.
rt = table(result)
rt=3×6 table
Name Passed Failed Incomplete Duration Details
________________________________ ______ ______ __________ _________ __________
ans=3×6 table
Name Passed Failed Incomplete Duration Details
35-126
Analyze Test Case Results
writetable(rt,'myTestResults.csv','QuoteStrings',true)
See Also
Related Examples
• “Write Simple Test Case Using Classes” on page 35-38
35-127
35 Unit Testing
Using the SolverTest test case, add a method, testBadRealSolution. This test, based on
testRealSolution, calls the quadraticSolver function with inputs 1,3,2, but tests the results
against an incorrect solution, [2,1].
function testBadRealSolution(testCase)
actSolution = quadraticSolver(1,3,2);
expSolution = [2,1];
testCase.verifyEqual(actSolution,expSolution)
end
Save the updated SolverTest class definition and rerun the tests.
quadTests = matlab.unittest.TestSuite.fromClass(?SolverTest);
result1 = run(quadTests);
Running SolverTest
..
================================================================================
Verification failed in SolverTest/testBadRealSolution.
---------------------
Framework Diagnostic:
---------------------
verifyEqual failed.
--> The values are not equal using "isequaln".
--> Failure table:
Index Actual Expected Error RelativeError
_____ ______ ________ _____ _____________
1 -1 2 -3 -1.5
2 -2 1 -3 -3
Actual Value:
-1 -2
Expected Value:
2 1
------------------
Stack Information:
------------------
In C:\work\SolverTest.m (SolverTest.testBadRealSolution) at 19
================================================================================
.
Done SolverTest
__________
Failure Summary:
Analyze Results
Actual Value:
-1 -2
35-128
Analyze Failed Test Results
Expected Value:
2 1
At this point, you must decide if the error is in quadraticSolver or in your value for expSolution.
Correct Error
Rerun Tests
failedTests = quadTests([result1.Failed]);
result2 = run(failedTests)
Running SolverTest
.
Done SolverTest
__________
result2 =
Name: 'SolverTest/testBadRealSolution'
Passed: 1
Failed: 0
Incomplete: 0
Duration: 0.0108
Details: [1x1 struct]
Totals:
1 Passed, 0 Failed, 0 Incomplete.
0.010813 seconds testing time.
Alternatively, you can rerun failed tests using the (rerun) link in the test results.
See Also
More About
• “Rerun Failed Tests” on page 35-130
35-129
35 Unit Testing
This link allows you to modify your test code or your code under test and quickly rerun failed tests.
However, if you make structural changes to your test class, using the rerun link does not pick up the
changes. Structural changes include adding, deleting, or renaming a test method, and modifying a
test parameter property and its value. In this case, recreate the entire test suite to pick up the
changes.
Create the following function in your current working folder. The function is meant to compute the
square and square root. However, in this example, the function computes the cube of the value
instead of the square.
function [x,y] = exampleFunction(n)
validateattributes(n,{'numeric'},{'scalar'})
function testSquare(testCase)
[sqrVal,sqrRootVal] = exampleFunction(3);
verifyEqual(testCase,sqrVal,9);
end
function testSquareRoot(testCase)
[sqrVal,sqrRootVal] = exampleFunction(100);
verifyEqual(testCase,sqrRootVal,10);
end
Create a test suite and run the tests. The testSquare test fails because the implementation of
exampleFunction is incorrect.
suite = testsuite('ExampleTest.m');
results = run(suite)
Running exampleTest
================================================================================
Verification failed in exampleTest/testSquare.
---------------------
Framework Diagnostic:
---------------------
verifyEqual failed.
--> The values are not equal using "isequaln".
35-130
Rerun Failed Tests
27 9 18 2
Actual Value:
27
Expected Value:
9
------------------
Stack Information:
------------------
In C:\Work\exampleTest.m (testSquare) at 7
================================================================================
..
Done exampleTest
__________
Failure Summary:
results =
Name
Passed
Failed
Incomplete
Duration
Details
Totals:
1 Passed, 1 Failed (rerun), 0 Incomplete.
0.24851 seconds testing time.
x = n^2; % square
y = sqrt(n); % square root
end
Click the (rerun) link in the command window to rerun the failed test. You cannot rerun failed tests
if the variable that stores the test results is overwritten. If the link is no longer in the Command
Window, you can type results at the prompt to view it.
Running exampleTest
.
Done exampleTest
__________
ans =
Name: 'exampleTest/testSquare'
Passed: 1
Failed: 0
Incomplete: 0
Duration: 0.0034
35-131
35 Unit Testing
Totals:
1 Passed, 0 Failed, 0 Incomplete.
0.0033903 seconds testing time.
MATLAB stores the TestResult array associated with tests that you rerun in the ans variable.
results is a 1x2 array that contains all the tests in exampleTest.m, and ans is a 1x1 array that
contains the rerun results from the one failed test.
whos
Name Size Bytes Class Attributes
To programmatically rerun failed tests, use the Failed property on the TestResult object to create
and run a filtered test suite.
failedTests = suite([results.Failed]);
result2 = run(failedTests);
Running exampleTest
.
Done exampleTest
__________
To ensure that all passing tests continue to pass, rerun the full test suite.
See Also
More About
• “Analyze Failed Test Results” on page 35-128
35-132
Dynamically Filtered Tests
Assumption failures produce filtered tests. In the matlab.unittest.TestResult class, such a test
is marked Incomplete.
Since filtering test content through the use of assumptions does not produce test failures, it has the
possibility of creating dead test code. Avoiding this requires monitoring of filtered tests.
Test Methods
If an assumption failure is encountered inside of a TestCase method with the Test attribute, the
entire method is marked as filtered, but MATLAB runs the subsequent Test methods.
The following class contains an assumption failure in one of the methods in the Test block.
Since the testB method contains an assumption failure, when you run the test, the testing
framework filters that test and marks it as incomplete. After the assumption failure in testB, the
testing framework proceeds and executes testC, which contains a verification failure.
ts = matlab.unittest.TestSuite.fromClass(?ExampleTest);
res = ts.run;
Running ExampleTest
.
================================================================================
ExampleTest/testB was filtered.
Details
================================================================================
.
================================================================================
Verification failed in ExampleTest/testC.
---------------------
Framework Diagnostic:
---------------------
verifyFalse failed.
--> The value must evaluate to "false".
35-133
35 Unit Testing
Actual logical:
1
------------------
Stack Information:
------------------
In C:\work\ExampleTest.m (ExampleTest.testC) at 11
================================================================================
.
Done ExampleTest
__________
Failure Summary:
If you examine the TestResult, you notice that there is a passed test, a failed test, and a test that
did not complete due to an assumption failure.
res
res =
Name
Passed
Failed
Incomplete
Duration
Details
Totals:
1 Passed, 1 Failed, 1 Incomplete.
2.4807 seconds testing time.
The testing framework keeps track of incomplete tests so that you can monitor filtered tests for
nonexercised test code. You can see information about these tests within the TestResult object.
res([res.Incomplete])
ans =
Name: 'ExampleTest/testB'
Passed: 0
Failed: 0
Incomplete: 1
Duration: 2.2578
Details: [1×1 struct]
Totals:
0 Passed, 0 Failed, 1 Incomplete.
2.2578 seconds testing time.
To create a modified test suite from only the filtered tests, select incomplete tests from the original
test suite.
35-134
Dynamically Filtered Tests
tsFiltered = ts([res.Incomplete])
tsFiltered =
Tests Include:
0 Parameterizations, 0 Shared Test Fixture Classes, 0 Tags.
One of the methods in the following TestMethodSetup block within ExampleTest.m contains an
assumption failure.
methods(TestMethodSetup)
function setupMethod1(testCase)
testCase.assumeEqual(1,0)
% remaining test code is not exercised
end
function setupMethod2(testCase)
disp('* Running setupMethod2 *')
testCase.assertEqual(1,1)
end
end
methods(Test)
function testA(testCase)
testCase.verifyTrue(true)
end
function testB(testCase)
35-135
35 Unit Testing
testCase.assumeEqual(0,1)
% remaining test code is not exercised
end
function testC(testCase)
testCase.verifyFalse(true)
end
end
end
When you run the test, you see that the framework completes executes all the methods in the
TestMethodSetup block that do not contain the assumption failure, and it marks as incomplete all
methods in the Test block.
ts = matlab.unittest.TestSuite.fromClass(?ExampleTest);
res = ts.run;
Running ExampleTest
================================================================================
ExampleTest/testA was filtered.
Details
================================================================================
* Running setupMethod2 *
.
================================================================================
ExampleTest/testB was filtered.
Details
================================================================================
* Running setupMethod2 *
.
================================================================================
ExampleTest/testC was filtered.
Details
================================================================================
* Running setupMethod2 *
.
Done ExampleTest
__________
Failure Summary:
The Test methods did not change but all 3 are filtered due to an assumption failure in the
TestMethodSetup block. The testing framework executes methods in the TestMethodSetup block
without assumption failures, such as setupMethod2. As expected, the testing framework executes
setupMethod2 3 times, once before each Test method.
methods(TestClassSetup)
function setupClass(testCase)
testCase.assumeEqual(1,0)
% remaining test code is not exercised
35-136
Dynamically Filtered Tests
end
end
methods(TestMethodSetup)
function setupMethod1(testCase)
testCase.assumeEqual(1,0)
% remaining test code is not exercised
end
function setupMethod2(testCase)
disp('* Running setupMethod2 *')
testCase.assertEqual(1,1)
end
end
methods(Test)
function testA(testCase)
testCase.verifyTrue(true)
end
function testB(testCase)
testCase.assumeEqual(0,1)
% remaining test code is not exercised
end
function testC(testCase)
testCase.verifyFalse(true)
end
end
end
When you run the test, you see that the framework does not execute any of the methods in the
TestMethodSetup or Test.
ts = matlab.unittest.TestSuite.fromClass(?ExampleTest);
res = ts.run;
Running ExampleTest
================================================================================
All tests in ExampleTest were filtered.
Details
================================================================================
Done ExampleTest
__________
Failure Summary:
35-137
35 Unit Testing
----------------------------------------------------------------
ExampleTest/testC X Filtered by assumption.
The Test and TestMethodSetup methods did not change but everything is filtered due to an
assumption failure in the TestClassSetup block.
See Also
matlab.unittest.qualifications.Assumable | matlab.unittest.TestCase |
matlab.unittest.TestResult
35-138
Create Custom Constraint
In a file in your current folder, create a class named HasSameSizeAs that derives from the
matlab.unittest.constraints.Constraint class. The class constructor accepts an expected
value whose size is compared to the size of an actual value. The expected value is stored in the
ValueWithExpectedSize property. The recommended practice is to make Constraint
implementations immutable, so set the property SetAccess attribute to immutable.
properties(SetAccess = immutable)
ValueWithExpectedSize
end
methods
function constraint = HasSameSizeAs(value)
constraint.ValueWithExpectedSize = value;
end
end
end
In a methods block with private access, define a helper method sizeMatchesExpected that
determines if the actual and expected values have the same size. This method is invoked by other
constraint methods.
methods(Access = private)
function bool = sizeMatchesExpected(constraint,actual)
bool = isequal(size(actual),size(constraint.ValueWithExpectedSize));
end
end
methods
function bool = satisfiedBy(constraint,actual)
bool = constraint.sizeMatchesExpected(actual);
end
end
methods
function diag = getDiagnosticFor(constraint,actual)
import matlab.unittest.diagnostics.StringDiagnostic
if constraint.sizeMatchesExpected(actual)
diag = StringDiagnostic('HasSameSizeAs passed.');
35-139
35 Unit Testing
else
diag = StringDiagnostic(sprintf(...
'HasSameSizeAs failed.\nActual Size: [%s]\nExpectedSize: [%s]',...
int2str(size(actual)),...
int2str(size(constraint.ValueWithExpectedSize))));
end
end
end
properties(SetAccess = immutable)
ValueWithExpectedSize
end
methods
function constraint = HasSameSizeAs(value)
constraint.ValueWithExpectedSize = value;
end
methods(Access = private)
function bool = sizeMatchesExpected(constraint,actual)
bool = isequal(size(actual),size(constraint.ValueWithExpectedSize));
end
end
end
import matlab.unittest.TestCase
testCase = TestCase.forInteractiveUse;
testCase.verifyThat(zeros(5),HasSameSizeAs(repmat(1,5)))
Verification passed.
testCase.verifyThat(zeros(5),HasSameSizeAs(ones(1,5)))
35-140
Create Custom Constraint
Verification failed.
---------------------
Framework Diagnostic:
---------------------
HasSameSizeAs failed.
Actual Size: [5 5]
ExpectedSize: [1 5]
See Also
matlab.unittest.constraints.Constraint | satisfiedBy | getDiagnosticFor |
matlab.unittest.diagnostics.StringDiagnostic |
matlab.unittest.diagnostics.Diagnostic
Related Examples
• “Create Custom Boolean Constraint” on page 35-142
35-141
35 Unit Testing
In a file in your current folder, create a class named HasSameSizeAs that derives from the
matlab.unittest.constraints.BooleanConstraint class. The class constructor accepts an
expected value whose size is compared to the size of an actual value. The expected value is stored in
the ValueWithExpectedSize property. The recommended practice is to make
BooleanConstraint implementations immutable, so set the property SetAccess attribute to
immutable.
classdef HasSameSizeAs < matlab.unittest.constraints.BooleanConstraint
properties(SetAccess = immutable)
ValueWithExpectedSize
end
methods
function constraint = HasSameSizeAs(value)
constraint.ValueWithExpectedSize = value;
end
end
end
In a methods block with private access, define a helper method sizeMatchesExpected that
determines if the actual and expected values have the same size. This method is invoked by other
constraint methods.
methods(Access = private)
function bool = sizeMatchesExpected(constraint,actual)
bool = isequal(size(actual),size(constraint.ValueWithExpectedSize));
end
end
35-142
Create Custom Boolean Constraint
end
end
In exchange for implementing the required methods, the constraint inherits the appropriate and, or,
and not overloads, so it can be combined with other BooleanConstraint objects or negated.
properties(SetAccess = immutable)
ValueWithExpectedSize
end
methods
function constraint = HasSameSizeAs(value)
constraint.ValueWithExpectedSize = value;
end
if constraint.sizeMatchesExpected(actual)
diag = StringDiagnostic('HasSameSizeAs passed.');
else
diag = StringDiagnostic(sprintf(...
'HasSameSizeAs failed.\nActual Size: [%s]\nExpectedSize: [%s]',...
int2str(size(actual)),...
int2str(size(constraint.ValueWithExpectedSize))));
end
end
end
methods(Access = protected)
function diag = getNegativeDiagnosticFor(constraint,actual)
import matlab.unittest.diagnostics.StringDiagnostic
if constraint.sizeMatchesExpected(actual)
diag = StringDiagnostic(sprintf(...
['Negated HasSameSizeAs failed.\nSize [%s] of '...
'Actual Value and Expected Value were the same '...
'but should not have been.'],int2str(size(actual))));
else
diag = StringDiagnostic('Negated HasSameSizeAs passed.');
end
end
35-143
35 Unit Testing
end
methods(Access = private)
function bool = sizeMatchesExpected(constraint,actual)
bool = isequal(size(actual),size(constraint.ValueWithExpectedSize));
end
end
end
import matlab.unittest.TestCase
import matlab.unittest.constraints.HasLength
testCase = TestCase.forInteractiveUse;
Test a passing case. The test passes because one of the or conditions, HasLength(5), is true.
testCase.verifyThat(zeros(5),HasLength(5) | ~HasSameSizeAs(repmat(1,5)))
Verification passed.
Test a failing case. The test fails because one of the and conditions,
~HasSameSizeAs(repmat(1,5)), is false.
Verification failed.
---------------------
Framework Diagnostic:
---------------------
AndConstraint failed.
--> + [First Condition]:
| HasLength passed.
|
| Actual Value:
| 0 0 0 0 0
| 0 0 0 0 0
| 0 0 0 0 0
| 0 0 0 0 0
| 0 0 0 0 0
| Expected Length:
| 5
--> AND
+ [Second Condition]:
| Negated HasSameSizeAs failed.
| Size [5 5] of Actual Value and Expected Value were the same but should not have bee
-+---------------------
See Also
matlab.unittest.constraints.BooleanConstraint |
matlab.unittest.constraints.Constraint | satisfiedBy | getDiagnosticFor |
getNegativeDiagnosticFor | matlab.unittest.diagnostics.StringDiagnostic |
matlab.unittest.diagnostics.Diagnostic
35-144
Create Custom Boolean Constraint
Related Examples
• “Create Custom Constraint” on page 35-139
35-145
35 Unit Testing
In a file, DNA.m, in your working folder, create a simple class for a DNA sequence.
classdef DNA
properties(SetAccess=immutable)
Sequence
end
methods
function dna = DNA(sequence)
validLetters = ...
sequence == 'A' | ...
sequence == 'C' | ...
sequence == 'T' | ...
sequence == 'G';
if ~all(validLetters(:))
error('Sequence contained a letter not found in DNA.')
end
dna.Sequence = sequence;
end
end
end
In a file in your working folder, create a tolerance class so that you can test that DNA sequences are
within a specified Hamming distance. The constructor requires a Value property that defines the
maximum Hamming distance.
methods
function tolerance = HammingDistance(value)
tolerance.Value = value;
end
end
end
In a methods block with the HammingDistance class definition, include the following method so
that the tolerance supports DNA objects. Tolerance classes must implement a supports method.
methods
function tf = supports(~, value)
tf = isa(value, 'DNA');
end
end
35-146
Create Custom Tolerance
In a methods block with the HammingDistance class definition, include the following method that
returns true or false. Tolerance classes must implement a satisfiedBy method. The testing
framework uses this method to determine if two values are within the tolerance.
methods
function tf = satisfiedBy(tolerance, actual, expected)
if ~isSameSize(actual.Sequence, expected.Sequence)
tf = false;
return
end
tf = hammingDistance(actual.Sequence,expected.Sequence) <= tolerance.Value;
end
end
In the HammingDistance.m file, define the following helper functions outside of the classdef
block. The isSameSize function returns true if two DNA sequences are the same size, and the
hammingDistance function returns the Hamming distance between two sequences.
function tf = isSameSize(str1, str2)
tf = isequal(size(str1), size(str2));
end
The function returns a Diagnostic object with information about the comparison. In a methods
block with the HammingDistance class definition, include the following method that returns a
StringDiagnostic. Tolerance classes must implement a getDiagosticFor method.
methods
function diag = getDiagnosticFor(tolerance, actual, expected)
import matlab.unittest.diagnostics.StringDiagnostic
if ~isSameSize(actual.Sequence, expected.Sequence)
str = 'The DNA sequences must be the same length.';
else
str = sprintf('%s%d.\n%s%d.', ...
'The DNA sequences have a Hamming distance of ', ...
hammingDistance(actual.Sequence, expected.Sequence), ...
'The allowable distance is ', ...
tolerance.Value);
end
diag = StringDiagnostic(str);
end
end
methods
function tolerance = HammingDistance(value)
tolerance.Value = value;
end
35-147
35 Unit Testing
if ~isSameSize(actual.Sequence, expected.Sequence)
str = 'The DNA sequences must be the same length.';
else
str = sprintf('%s%d.\n%s%d.', ...
'The DNA sequences have a Hamming distance of ', ...
hammingDistance(actual.Sequence, expected.Sequence), ...
'The allowable distance is ', ...
tolerance.Value);
end
diag = StringDiagnostic(str);
end
end
end
testCase = TestCase.forInteractiveUse;
---------------------
Framework Diagnostic:
---------------------
35-148
Create Custom Tolerance
IsEqualTo failed.
--> ObjectComparator failed.
--> The objects are not equal using "isequal".
Actual Object:
DNA with properties:
Sequence: 'ACCTGAGTA'
Expected Object:
DNA with properties:
Sequence: 'ACCACAGTA'
Verify that the DNA sequences are equal to each other within a Hamming distance of 1.
testCase.verifyThat(sampleA, IsEqualTo(sampleB,...
'Within', HammingDistance(1)))
---------------------
Framework Diagnostic:
---------------------
IsEqualTo failed.
--> ObjectComparator failed.
--> The objects are not equal using "isequal".
--> The DNA sequences have a Hamming distance of 2.
The allowable distance is 1.
Actual Object:
DNA with properties:
Sequence: 'ACCTGAGTA'
Expected Object:
DNA with properties:
Sequence: 'ACCACAGTA'
The sequences are not equal to each other within a tolerance of 1. The testing framework displays
additional diagnostics from the getDiagnosticFor method.
Verify that the DNA sequences are equal to each other within a Hamming distance of 2.
testCase.verifyThat(sampleA, IsEqualTo(sampleB,...
'Within', HammingDistance(2)))
See Also
matlab.unittest.constraints.Tolerance
35-149
35 Unit Testing
App Testing
Test Creation – Class-based tests can use the app testing framework by subclassing
matlab.uitest.TestCase. Because matlab.uitest.TestCase is a subclass of
matlab.unittest.TestCase, your test has access to the features of the unit testing framework,
such as qualifications, fixtures, and plugins. To experiment with the app testing framework at the
command prompt, create a test case instance using
matlab.uitest.TestCase.forInteractiveUse.
Test Content – Typically, a test of an app programmatically interacts with app components using a
gesture method of matlab.uitest.TestCase, such as press or type, and then performs a
qualification on the result. For example, a test might press one check box and verify that the other
check boxes are disabled. Or it might type a number into a text box and verify the app correctly
computes a result. These types of tests require understanding of the properties of the app being
tested. To verify a button press, you must know where in the app object MATLAB stores the status of
a button. To verify the result of a computation, you must know how to access the result within the
app.
Test Clean Up – It is a best practice to include a teardown action to delete the app after the test.
Typically, the test method adds this action using the addTeardown method of
matlab.unittest.TestCase.
App Locking – When an app test creates a figure, the framework locks the figure immediately to
prevent external interactions with the components. The app testing framework does not lock UI
components if you create an instance of matlab.uitest.TestCase.forInteractiveUse for
experimentation at the command prompt.
Dismissing Alerts – In some cases, an app displays modal alert dialog boxes, which make it
impossible to interact with app components. Accessing the figure behind a dialog box might require
you to close the dialog box. To programmatically close an alert dialog box in the figure window, use
the dismissAlertDialog method.
35-150
Overview of App Testing Framework
Button uibuttong ✔
Group roup
Check Box uicheckbo ✔ ✔ ✔
x
Date Picker uidatepic ✔ ✔
ker
Discrete uiknob ✔ ✔
Knob
Drop Down uidropdow ✔ ✔ ✔
n
Edit Field uieditfie ✔ ✔
(Numeric, ld
Text)
Image uiimage ✔ ✔
Knob uiknob ✔ ✔ ✔
List Box uilistbox ✔ ✔
Menu uimenu ✔
Panel uipanel ✔ ✔ ✔
Polar Axes polaraxes ✔ ✔ ✔
Push Tool uipushtoo ✔
l
Radio uiradiobu ✔ ✔ ✔
Button tton
Slider uislider ✔ ✔ ✔
Spinner uispinner ✔ ✔ ✔
State uibutton ✔ ✔ ✔
Button
Switch uiswitch ✔ ✔ ✔
(Rocker,
Slider,
Toggle)
Tab uitab ✔
Tab Group uitabgrou ✔
p
Table uitable ✔ ✔ ✔
Text Area uitextare ✔ ✔
a
Toggle uitoggleb ✔ ✔ ✔
Button utton
Toggle Tool uitogglet ✔ ✔
ool
35-151
35 Unit Testing
At the command prompt, make the app accessible by adding the folder that includes the app to the
MATLAB search path.
addpath(fullfile(matlabroot,'examples','matlab','main'))
To explore the properties of the app prior to testing, create an instance of the app at the command
prompt.
app = ConfigurePlotAppExample;
This step is not necessary for the tests, but it is helpful to explore the properties used by the app
tests. For example, use app.UpdatePlotButton to access the Update Plot button within the app
object.
methods (Test)
end
end
Create a test method test_SampleSize to test the sample size. The test method modifies the
sample size, updates the plot, and verifies that the surface uses the specified sample size. The call to
addTeardown deletes the app after the test is complete.
methods (Test)
function test_SampleSize(testCase)
app = ConfigurePlotAppExample;
testCase.addTeardown(@delete,app);
testCase.type(app.SampleSizeEditField,12);
testCase.press(app.UpdatePlotButton);
ax = app.UIAxes;
surfaceObj = ax.Children;
testCase.verifySize(surfaceObj.ZData,[12 12]);
end
end
35-152
Overview of App Testing Framework
end
Create a second test method test_Colormap to test the colormap. The test method selects a
colormap, updates the plot, and verifies that the plot uses the specified colormap. The full code is
now as follows.
methods (Test)
function test_SampleSize(testCase)
app = ConfigurePlotAppExample;
testCase.addTeardown(@delete,app);
testCase.type(app.SampleSizeEditField,12);
testCase.press(app.UpdatePlotButton);
ax = app.UIAxes;
surfaceObj = ax.Children;
testCase.verifySize(surfaceObj.ZData,[12 12]);
end
function test_Colormap(testCase)
app = ConfigurePlotAppExample;
testCase.addTeardown(@delete,app);
testCase.choose(app.ColormapDropDown,'Winter');
testCase.press(app.UpdatePlotButton);
expectedMap = winter;
ax = app.UIAxes;
testCase.verifyEqual(ax.Colormap,expectedMap);
end
end
end
results = runtests('testConfigurePlotAppExample')
Running testConfigurePlotAppExample
..
Done testConfigurePlotAppExample
__________
results =
Name
Passed
Failed
Incomplete
Duration
Details
35-153
35 Unit Testing
Totals:
2 Passed, 0 Failed, 0 Incomplete.
5.0835 seconds testing time.
See Also
matlab.uitest.TestCase
More About
• “Write Test for App” on page 35-155
• “Write Test That Uses App Testing and Mocking Frameworks” on page 35-159
• “App Building Components”
35-154
Write Test for App
At the command prompt, make the app accessible by adding the folder that includes the app to the
MATLAB search path.
addpath(fullfile(matlabroot,'examples','matlab','main'))
To explore the properties of this app prior to testing, create an instance of the app at the command
prompt.
app = PatientsDisplay;
This step is not necessary for the tests, but it is helpful to explore the properties used by the app
tests. For example, use app.BloodPressureSwitch to access the Blood Pressure switch within
the app object.
Create a test class that inherits from matlab.uitest.TestCase. To test the tab switching
functionality, create a test method test_tab. The test method chooses the Data tab and then verifies
that the selected tab has the correct title. The TestMethodSetup method creates an app for each
test and deletes it after the test is complete.
classdef TestPatientsDisplay < matlab.uitest.TestCase
properties
App
end
methods (TestMethodSetup)
function launchApp(testCase)
testCase.App = PatientsDisplay;
testCase.addTeardown(@delete,testCase.App);
end
end
methods (Test)
function test_tab(testCase)
% Choose Data Tab
dataTab = testCase.App.DataTab;
testCase.choose(dataTab)
end
end
Create a test_plottingOptions method that tests various plotting options. The test method
presses the Histogram radio button and verifies that the x-label changed. Then, it changes the Bin
Width slider and verifies the number of bins.
classdef TestPatientsDisplay < matlab.uitest.TestCase
properties
App
end
methods (TestMethodSetup)
function launchApp(testCase)
testCase.App = PatientsDisplay;
testCase.addTeardown(@delete,testCase.App);
end
end
methods (Test)
function test_plottingOptions(testCase)
35-155
35 Unit Testing
end
end
Create a test_bloodPressure method that tests blood pressure data and display. The test method
verifies the y-axis label and the values of the scatter points. Then it changes to Diastolic readings,
and verifies the label and data again.
classdef TestPatientsDisplay < matlab.uitest.TestCase
properties
App
end
methods (TestMethodSetup)
function launchApp(testCase)
testCase.App = PatientsDisplay;
testCase.addTeardown(@delete,testCase.App);
end
end
methods (Test)
function test_bloodPressure(testCase)
% Extract blood pressure data from app
t = testCase.App.DataTab.Children.Data;
t.Gender = categorical(t.Gender);
allMales = t(t.Gender == 'Male',:);
maleDiastolicData = allMales.Diastolic';
maleSystolicData = allMales.Systolic';
end
end
Create a test_gender method that tests gender data and display. The test method verifies the
number of male scatter points and then presses the check box to include female data. It verifies that
two data sets are plotted and the color of the female data is red. Finally, it clears the male data check
box and verifies the number of plotted data sets and scatter points. This test fails because there are
53 female scatter points instead of 50. To take a screenshot when the test fails, use a
ScreenshotDiagnostic with the onFailure method.
classdef TestPatientsDisplay < matlab.uitest.TestCase
properties
App
end
methods (TestMethodSetup)
35-156
Write Test for App
function launchApp(testCase)
testCase.App = PatientsDisplay;
testCase.addTeardown(@delete,testCase.App);
end
end
methods (Test)
function test_gender(testCase)
import matlab.unittest.diagnostics.ScreenshotDiagnostic
testCase.onFailure(ScreenshotDiagnostic);
% Verify two data sets display and the female data is red
testCase.assertNumElements(ax.Children,2);
testCase.verifyEqual(ax.Children(1).CData,[1 0 0]);
function test_bloodPressure(testCase)
% Extract blood pressure data from app
t = testCase.App.DataTab.Children.Data;
t.Gender = categorical(t.Gender);
allMales = t(t.Gender == 'Male',:);
maleDiastolicData = allMales.Diastolic';
maleSystolicData = allMales.Systolic';
function test_plottingOptions(testCase)
% Press the histogram radio button
testCase.press(testCase.App.HistogramButton)
function test_tab(testCase)
% Choose Data Tab
dataTab = testCase.App.DataTab;
testCase.choose(dataTab)
end
end
results = runtests('TestPatientsDisplay');
35-157
35 Unit Testing
Running TestPatientsDisplay
================================================================================
Verification failed in TestPatientsDisplay/test_gender.
---------------------
Framework Diagnostic:
---------------------
verifyNumElements failed.
--> The value did not have the correct number of elements.
Actual Value:
Columns 1 through 49
131 133 119 142 142 132 128 137 129 131 133 117 137 146 123 143 114 126 137 138 137 118
Columns 50 through 53
Failure Summary:
See Also
matlab.uitest.TestCase
More About
• “Overview of App Testing Framework” on page 35-150
• “Write Test That Uses App Testing and Mocking Frameworks” on page 35-159
35-158
Write Test That Uses App Testing and Mocking Frameworks
Create App
Create the launchApp app in your current working folder. The app allows a user to select an input
file and displays the name of the file in the app. The file selection dialog box is a blocking modal
dialog box that waits for user input.
To explore the properties of this app prior to testing, create an instance of the app at the command
prompt. This step is not necessary for the tests, but it is helpful to explore the properties used by the
app tests. For example, use app.Button to access the Input file button within the app object.
app = launchApp;
35-159
35 Unit Testing
tc.press(app.Button);
35-160
Write Test That Uses App Testing and Mocking Frameworks
tc.verifyEqual(app.Label.Text,tc.TestFile)
end
end
end
Run the test. When the file selection dialog box appears, select input2.txt to allow MATLAB to
proceed with the test. Selecting any other file results in a test failure.
results = runtests('LaunchAppTest');
Running LaunchAppTest
.
Done LaunchAppTest
__________
Create a FileChooser service with an Abstract method that implements the file selection
functionality.
classdef FileChooser
% Interface to choose a file
methods (Abstract)
[file,folder,status] = chooseFile(chooser,varargin)
end
end
Create a default FileChooser that uses the uigetfile function for file selection.
Change the app to accept an optional FileChooser object. When called with no inputs, the app uses
an instance of DefaultFileChooser.
35-161
35 Unit Testing
app.Label = label;
[mockChooser,behavior] = tc.createMock(?FileChooser);
when(behavior.chooseFile('*.*'),AssignOutputs(fname,pwd,1))
app = launchApp(mockChooser);
tc.addTeardown(@close,app.UIFigure);
tc.press(app.Button);
tc.verifyEqual(app.Label.Text,fname);
end
function testInputButton_Cancel(tc)
import matlab.mock.actions.AssignOutputs
app = launchApp(mockChooser);
tc.addTeardown(@close,app.UIFigure);
35-162
Write Test That Uses App Testing and Mocking Frameworks
tc.press(app.Button);
tc.verifyCalled(behavior.chooseFile('*.*'));
tc.verifyEqual(app.Label.Text,'No file selected');
end
end
end
Run the tests. The tests run to completion without manual file selection.
results = runtests('LaunchAppTest');
Running LaunchAppTest
..
Done LaunchAppTest
__________
See Also
matlab.mock.TestCase | matlab.uitest.TestCase
More About
• “Overview of App Testing Framework” on page 35-150
• “Write Test for App” on page 35-155
• “Create Mock Object” on page 35-181
35-163
35 Unit Testing
In this section...
“Determine Bounds of Measured Code” on page 35-164
“Types of Time Experiments” on page 35-165
“Write Performance Tests with Measurement Boundaries” on page 35-165
“Run Performance Tests” on page 35-166
“Understand Invalid Test Results” on page 35-166
The performance test interface leverages the script, function, and class-based unit testing interfaces.
You can perform qualifications within your performance tests to ensure correct functional behavior
while measuring code performance. Also, you can run your performance tests as standard regression
tests to ensure that code changes do not break performance tests.
35-164
Overview of Performance Testing Framework
This table summarizes the differences between the frequentist and fixed time experiments.
35-165
35 Unit Testing
The performance testing framework does not support nested measurement boundaries. If you use
these methods incorrectly in a Test method and run the test as a TimeExperiment, then the
framework marks the measurement as invalid. Also, you still can run these performance tests as unit
tests. For more information, see “Test Performance Using Classes” on page 35-172.
• Use the runperf function to run the tests. This function uses a variable number of measurements
to reach a sample mean with a 0.05 relative margin of error within a 0.95 confidence level. It runs
the tests four times to warm up the code and between 4 and 256 times to collect measurements
that meet the statistical objectives.
• Generate an explicit test suite using the testsuite function or the methods in the TestSuite
class, and then create and run a time experiment.
You can run your performance tests as regression tests. For more information, see “Test Performance
Using Classes” on page 35-172.
When the performance testing framework encounters an invalid test result, it behaves differently
depending on the type of time experiment:
• If you create a frequentist time experiment, then the framework stops measuring for that test and
moves to the next test.
• If you create a fixed time experiment, then the framework continues collecting the specified
number of samples.
See Also
runperf | testsuite | matlab.perftest.TimeExperiment |
matlab.unittest.measurement.MeasurementResult
Related Examples
• “Test Performance Using Scripts or Functions” on page 35-168
35-166
Overview of Performance Testing Framework
35-167
35 Unit Testing
Create a performance test in a file, preallocationTest.m, in your current working folder. In this
example, you can choose to use either the following script-based test or the function-based test. The
output in this example is for the function-based test. If you use the script-based test, then your test
names will be different.
function testForLoop(testCase)
vectorSize = getSize();
for i=1:vectorSize
x(i) = 1;
end
end
results = runperf('preallocationTest.m')
Running preallocationTest
.......... .......... .......... ..
Done preallocationTest
__________
35-168
Test Performance Using Scripts or Functions
results =
Name
Valid
Samples
TestActivity
Totals:
4 Valid, 0 Invalid.
10.2561 seconds testing time.
The results variable is a 1-by-4 TimeResult array. Each element in the array corresponds to one of
the tests defined in the code section in preallocationTest.m.
Display the measurement results for the second test. Your results might vary.
results(2)
ans =
Name: 'preallocationTest/testIndexingWithVariable'
Valid: 1
Samples: [4×7 table]
TestActivity: [8×12 table]
Totals:
1 Valid, 0 Invalid.
1.2274 seconds testing time.
As indicated by the size of the TestActivity property, the performance testing framework collected
8 measurements. This number of measurements includes four measurements to warm up the code.
The Samples property excludes warm-up measurements.
results(2).Samples
>> results(2).Samples
ans =
4×7 table
35-169
35 Unit Testing
Display the mean measured time for the second test. To exclude data collected in the warm-up runs,
use the values in the Samples field.
sampleTimes = results(2).Samples.MeasuredTime;
meanTest2 = mean(sampleTimes)
meanTest2 =
0.1534
The performance testing framework collected four sample measurements for the second test. The test
took an average of 0.1534 second.
Determine the average time for all the test elements. The preallocationTest test includes four
different methods for allocating a vector of ones. Compare the time for each method (test element).
Since the performance testing framework returns a Samples table for each test element,
concatenate all these tables into one table. Then group the rows by test element Name, and compute
the mean MeasuredTime for each group.
fullTable = vertcat(results.Samples);
summaryStats = varfun(@mean,fullTable,...
'InputVariables','MeasuredTime','GroupingVariables','Name')
summaryStats =
4×3 table
preallocationTest/testOnes 4 0.041072
preallocationTest/testIndexingWithVariable 4 0.1534
preallocationTest/testIndexingOnLHS 4 0.04677
preallocationTest/testForLoop 4 1.0343
Change the statistical objectives defined by the runperf function by constructing and running a time
experiment. Construct a time experiment with measurements that reach a sample mean with an 8%
relative margin of error within a 97% confidence level.
Construct a time experiment with a variable number of sample measurements, and run the tests.
import matlab.perftest.TimeExperiment
experiment = TimeExperiment.limitingSamplingError('NumWarmups',2,...
'RelativeMarginOfError',0.08, 'ConfidenceLevel', 0.97);
resultsTE = run(experiment,suite);
Running preallocationTest
.......... .......... ....
35-170
Test Performance Using Scripts or Functions
Done preallocationTest
__________
fullTableTE = vertcat(resultsTE.Samples);
summaryStatsTE = varfun(@mean,fullTableTE,...
'InputVariables','MeasuredTime','GroupingVariables','Name')
summaryStatsTE =
4×3 table
preallocationTest/testOnes 4 0.040484
preallocationTest/testIndexingWithVariable 4 0.15187
preallocationTest/testIndexingOnLHS 4 0.046224
preallocationTest/testForLoop 4 1.0262
See Also
runperf | testsuite | matlab.perftest.TimeExperiment | matlab.perftest.TimeResult |
matlab.unittest.measurement.DefaultMeasurementResult
35-171
35 Unit Testing
Consider the following unit (regression) test. You can run this test as a performance test using
runperf('fprintfTest') instead of runtests('fprintfTest').
testCase.addTeardown(@delete,testCase.file);
testCase.addTeardown(@fclose,testCase.fid);
end
end
methods(Test)
function testPrintingToFile(testCase)
textToWrite = repmat('abcdef',1,5000000);
fprintf(testCase.fid,'%s',textToWrite);
testCase.verifyEqual(fileread(testCase.file),textToWrite)
end
function testBytesToFile(testCase)
textToWrite = repmat('tests_',1,5000000);
nbytes = fprintf(testCase.fid,'%s',textToWrite);
testCase.verifyEqual(nbytes,length(textToWrite))
end
end
end
The measured time does not include the time to open and close the file or the assertion because these
activities take place inside a TestMethodSetup block, and not inside a Test block. However, the
measured time includes the time to perform the verifications. Best practice is to measure a more
accurate performance boundary.
Create a performance test in a file, fprintfTest.m, in your current working folder. This test is
similar to the regression test with the following modifications:
35-172
Test Performance Using Classes
end
methods(TestMethodSetup)
function openFile(testCase)
testCase.file = tempname;
testCase.fid = fopen(testCase.file,'w');
testCase.assertNotEqual(testCase.fid,-1,'IO Problem')
testCase.addTeardown(@delete,testCase.file);
testCase.addTeardown(@fclose,testCase.fid);
end
end
methods(Test)
function testPrintingToFile(testCase)
textToWrite = repmat('abcdef',1,5000000);
testCase.startMeasuring();
fprintf(testCase.fid,'%s',textToWrite);
testCase.stopMeasuring();
testCase.verifyEqual(fileread(testCase.file),textToWrite)
end
function testBytesToFile(testCase)
textToWrite = repmat('tests_',1,5000000);
testCase.startMeasuring();
nbytes = fprintf(testCase.fid,'%s',textToWrite);
testCase.stopMeasuring();
testCase.verifyEqual(nbytes,length(textToWrite))
end
end
end
The measured time for this performance test includes only the call to fprintf, and the testing
framework still evaluates the qualifications.
Run the performance test. Depending on your system, you might see warnings that the performance
testing framework ran the test the maximum number of times, but did not achieve a 0.05 relative
margin of error with a 0.95 confidence level.
results = runperf('fprintfTest')
Running fprintfTest
.......... .......... .
Done fprintfTest
__________
results =
Name
Valid
35-173
35 Unit Testing
Samples
TestActivity
Totals:
2 Valid, 0 Invalid.
4.1417 seconds testing time.
The results variable is a 1-by-2 TimeResultarray. Each element in the array corresponds to one of
the tests defined in the test file.
Display the measurement results for the first test. Your results might vary.
results(1)
ans =
Name: 'fprintfTest/testPrintingToFile'
Valid: 1
Samples: [4×7 table]
TestActivity: [8×12 table]
Totals:
1 Valid, 0 Invalid.
2.7124 seconds testing time.
As indicated by the size of the TestActivity property, the performance testing framework collected
8 measurements. This number includes 4 measurements to warm up the code. The Samples property
excludes warm-up measurements.
results(1).Samples
ans =
4×7 table
Display the mean measured time for the first test. To exclude data collected in the warm-up runs, use
the values in the Samples field.
sampleTimes = results(1).Samples.MeasuredTime;
meanTest = mean(sampleTimes)
35-174
Test Performance Using Classes
meanTest =
0.0681
Determine the average time for all the test elements. The fprintfTest test includes two different
methods. Compare the time for each method (test element).
Since the performance testing framework returns a Samples table for each test element,
concatenate all these tables into one table. Then group the rows by test element Name, and compute
the mean MeasuredTime for each group.
fullTable = vertcat(results.Samples);
summaryStats = varfun(@mean,fullTable,...
'InputVariables','MeasuredTime','GroupingVariables','Name')
summaryStats =
2×3 table
fprintfTest/testPrintingToFile 4 0.068139
fprintfTest/testBytesToFile 9 0.071595
Both test methods write the same amount of data to a file. Therefore, some of the difference between
the mean values is attributed to calling the fprintf function with an output argument.
Change the statistical objectives defined by the runperf function by constructing and running a time
experiment. Construct a time experiment with measurements that reach a sample mean with a 3%
relative margin of error within a 97% confidence level. Collect 4 warm-up measurements and up to 16
sample measurements.
suite = testsuite('fprintfTest');
Construct a time experiment with a variable number of sample measurements, and run the tests.
import matlab.perftest.TimeExperiment
experiment = TimeExperiment.limitingSamplingError('NumWarmups',4,...
'MaxSamples',16,'RelativeMarginOfError',0.03,'ConfidenceLevel',0.97);
resultsTE = run(experiment,suite);
Running fprintfTest
.......... ..........Warning: Target Relative Margin of Error not met after running the MaxSample
........
Done fprintfTest
__________
In this example output, the performance testing framework is not able to meet the stricter statistical
objectives with the specified number of maximum samples. Your results might vary.
35-175
35 Unit Testing
fullTableTE = vertcat(resultsTE.Samples);
summaryStatsTE = varfun(@mean,fullTableTE,...
'InputVariables','MeasuredTime','GroupingVariables','Name')
summaryStatsTE =
2×3 table
fprintfTest/testPrintingToFile 16 0.069482
fprintfTest/testBytesToFile 4 0.067902
Increase the maximum number of samples to 32 and rerun the time experiment.
experiment = TimeExperiment.limitingSamplingError('NumWarmups',4,...
'MaxSamples',32,'RelativeMarginOfError',0.03,'ConfidenceLevel',0.97);
resultsTE = run(experiment,suite);
Running fprintfTest
.......... ......
Done fprintfTest
__________
fullTableTE = vertcat(resultsTE.Samples);
summaryStatsTE = varfun(@mean,fullTableTE,...
'InputVariables','MeasuredTime','GroupingVariables','Name')
summaryStatsTE =
2×3 table
fprintfTest/testPrintingToFile 4 0.067228
fprintfTest/testBytesToFile 4 0.067766
The testing framework achieves the statistical objectives for both tests with 4 samples.
Start a new MATLAB session. A new session ensures that MATLAB has not run the code contained in
your tests.
Measure the first-time cost of your code by creating and running a fixed time experiment with zero
warm-up measurements and one sample measurement.
Construct an explicit test suite. Since you are measuring the first-time cost of the function, run a
single test. To run multiple tests, save the results and start a new MATLAB session between tests.
suite = testsuite('fprintfTest/testPrintingToFile');
35-176
Test Performance Using Classes
import matlab.perftest.TimeExperiment
experiment = TimeExperiment.withFixedSampleSize(1);
results = run(experiment,suite);
Running fprintfTest
.
Done fprintfTest
__________
Display the results. Observe the TestActivity table to ensure there are no warm-up samples.
fullTable = results.TestActivity
fullTable =
1×12 table
The performance testing framework collects one sample for each test.
See Also
runperf | testsuite | matlab.perftest.TimeExperiment | matlab.perftest.TestCase |
matlab.unittest.measurement.DefaultMeasurementResult |
matlab.perftest.TimeResult
35-177
35 Unit Testing
In your current working folder, create a class-based test, PreallocationTest.m, that compares
different methods of preallocation. Since the test methods include qualifications, use the
startMeasuring and stopMeasuring methods to define boundaries for the code you want to
measure.
classdef PreallocationTest < matlab.perftest.TestCase
methods(Test)
function testOnes(testCase)
testCase.startMeasuring
x = ones(1,1e5);
testCase.stopMeasuring
testCase.verifyEqual(size(x),[1 1e5])
end
function testIndexingWithVariable(testCase)
import matlab.unittest.constraints.IsSameSetAs
testCase.startMeasuring
id = 1:1e5;
x(id) = 1;
testCase.stopMeasuring
testCase.verifyThat(x,IsSameSetAs(1))
end
function testIndexingOnLHS(testCase)
import matlab.unittest.constraints.EveryElementOf
import matlab.unittest.constraints.IsEqualTo
testCase.startMeasuring
x(1:1e5) = 1;
testCase.stopMeasuring
testCase.verifyThat(EveryElementOf(x),IsEqualTo(1))
end
function testForLoop(testCase)
testCase.startMeasuring
for i=1:1e5
x(i) = 1;
end
testCase.stopMeasuring
testCase.verifyNumElements(x,1e5)
end
end
end
Run PreallocationTest as a performance test. Two tests are filtered because the measurements
are too close to the precision of the framework.
results = runperf('PreallocationTest');
Running PreallocationTest
........
================================================================================
35-178
Measure Fast Executing Test Code
Failure Summary:
To instruct the framework to automatically loop through the measured code and average the
measurement results, modify PreallocationTest to use a keepMeasuring-while loop instead of
startMeasuring and stopMeasuring.
function testIndexingWithVariable(testCase)
import matlab.unittest.constraints.IsSameSetAs
while(testCase.keepMeasuring)
id = 1:1e5;
x(id) = 1;
end
testCase.verifyThat(x,IsSameSetAs(1))
end
function testIndexingOnLHS(testCase)
import matlab.unittest.constraints.EveryElementOf
import matlab.unittest.constraints.IsEqualTo
while(testCase.keepMeasuring)
x(1:1e5) = 1;
end
testCase.verifyThat(EveryElementOf(x),IsEqualTo(1))
end
function testForLoop(testCase)
while(testCase.keepMeasuring)
for i=1:1e5
x(i) = 1;
end
end
testCase.verifyNumElements(x,1e5)
end
end
end
35-179
35 Unit Testing
results = runperf('PreallocationTest');
Running PreallocationTest
.......... .......... .......... ..
Done PreallocationTest
__________
sampleSummary(results)
ans =
4×7 table
See Also
runperf | keepMeasuring
Related Examples
• “Overview of Performance Testing Framework” on page 35-164
• “Test Performance Using Classes” on page 35-172
35-180
Create Mock Object
For example, suppose you want to test an algorithm for buying stock, but you do not want to test the
entire system. You could use a mock object to replace the functionality of looking up the stock price,
and another mock object to verify that the trader purchased the stock. The algorithm you are testing
does not know that it is operating on mock objects, and you can test the algorithm isolated from the
rest of the system.
Using a mock object, you can define behavior (a process known as stubbing). For example, you can
specify that an object produces predefined responses to queries. You can also intercept and
remember messages sent from the component under test to the mock object (a process known as
spying). For example, you can verify that a particular method was called or a property was set.
35-181
35 Unit Testing
4 Qualify interactions between the component of interest and the mocked components. For
example, verify that a mocked method was called with particular inputs, or that a property was
set.
Depended on Components
In this example, the component under test is a simple day-trading algorithm. It is the part of the
system you want to test independent of other components. The day-trading algorithm has two
dependencies: a data service to retrieve the stock price data and a broker to purchase the stock.
In a file DataService.m in your current working folder, create an abstract class that includes a
lookupPrice method.
classdef DataService
methods (Abstract,Static)
price = lookupPrice(ticker,date)
end
end
In production code, there could be several concrete implementations of the DataService class, such
as a BloombergDataService class. This class uses the Datafeed Toolbox™. However, since we
create a mock of the DataService class, you do not need to have the toolbox installed to run the
tests for the trading algorithm.
classdef BloombergDataService < DataService
methods (Static)
function price = lookupPrice(ticker,date)
% This method assumes you have installed and configured the
% Bloomberg software.
conn = blp;
data = history(conn,ticker,'LAST_PRICE',date-1,date);
price = data(end);
close(conn)
end
end
end
In this example, assume that the broker component has not been developed yet. Once it is
implemented, it will have a buy method that accepts a ticker symbol and a specified number of shares
to buy, and returns a status code. The mock for the broker component uses an implicit interface, and
does not derive from a superclass.
In a file trader.m in your current working folder, create a simple day trading algorithm. The trader
function accepts as inputs a data service object that looks up the price of the stock, a broker object
that defines how the stock is bought, a ticker symbol, and a number of shares to purchase. If the
price from yesterday is less than the price two days ago, instruct the broker to buy the specified
number of shares.
function trader(dataService,broker,ticker,numShares)
yesterday = datetime('yesterday');
priceYesterday = dataService.lookupPrice(ticker,yesterday);
price2DaysAgo = dataService.lookupPrice(ticker,yesterday-days(1));
35-182
Create Mock Object
end
end
The mock object is an implementation of the abstract methods and properties of the interface
specified by a superclass. You can also construct a mock without a superclass, in which case the mock
has an implicit interface. The component under test interacts with the mock object, for example, by
calling a mock object method or accessing a mock object property. The mock object carries out
predefined actions in response to these interactions.
When you create a mock, you also create an associated behavior object. The behavior object defines
the same methods as the mock object and controls mock behavior. Use the behavior object to define
mock actions and qualify interactions. For example, use it to define values a mocked method returns,
or verify that a property was accessed.
At the command prompt, create a mock test case for interactive use. Using the mock in a test class
instead of at the command prompt is presented later in this example.
import matlab.mock.TestCase
testCase = TestCase.forInteractiveUse;
Create a mock for the data service dependency and examine the methods on it. The data service
mock returns predefined values, replacing the implementation of the service that provides actual
stock prices. Therefore, it exhibits stubbing behavior.
[stubDataService,dataServiceBehavior] = createMock(testCase,?DataService);
methods(stubDataService)
Static methods:
lookupPrice
In the DataService class, the lookupPrice method is abstract and static. The mocking framework
implements this method as concrete and static.
Define behavior for the data service mock. For ticker symbol "FOO", it returns the price yesterday as
$123 and anything before yesterday is $234. Therefore, according to the trader function, the broker
always buys stock "FOO". For the ticker symbol "BAR", it returns the price yesterday as $765 and
anything before yesterday is $543. Therefore, the broker never buys stock "BAR".
import matlab.unittest.constraints.IsLessThan
yesterday = datetime('yesterday');
testCase.assignOutputsWhen(dataServiceBehavior.lookupPrice(...
"FOO",yesterday),123);
testCase.assignOutputsWhen(dataServiceBehavior.lookupPrice(...
"FOO",IsLessThan(yesterday)),234);
35-183
35 Unit Testing
testCase.assignOutputsWhen(dataServiceBehavior.lookupPrice(...
"BAR",yesterday),765);
testCase.assignOutputsWhen(dataServiceBehavior.lookupPrice(...
"BAR",IsLessThan(yesterday)),543);
p1 = stubDataService.lookupPrice("FOO",yesterday)
p2 = stubDataService.lookupPrice("BAR",yesterday-days(5))
p1 =
123
p2 =
543
Create a mock for the broker dependency and examine the methods on it. Since the broker mock is
used to verify interactions with the component under test (the trader function), it exhibits spying
behavior. The broker mock has an implicit interface. While the buy method is not currently
implemented, you can create a mock with it.
[spyBroker,brokerBehavior] = createMock(testCase,'AddedMethods',{'buy'});
methods(spyBroker)
buy
s1 = spyBroker.buy
s2 = spyBroker.buy("inputs",[13 42])
s1 =
[]
s2 =
[]
35-184
Create Mock Object
Since the trader function does not use the status return code, the default mock behavior of
returning empty is acceptable. The broker mock is a pure spy, and does not need to implement any
stubbing behavior.
Call the trader function. In addition to the ticker symbol and the number of shares to buy, the
trader function takes as inputs the data service and the broker. Instead of passing in actual data
service and broker objects, pass in the spyBroker and stubDataService mocks.
trader(stubDataService,spyBroker,"FOO",100)
trader(stubDataService,spyBroker,"FOO",75)
trader(stubDataService,spyBroker,"BAR",100)
Use the broker behavior object (the spy) to verify that the trader function calls the buy method, as
expected.
Use the TestCase.verifyCalled method to verify that the trader function instructed the buy
method to buy 100 shares of the FOO stock.
import matlab.mock.constraints.WasCalled;
testCase.verifyCalled(brokerBehavior.buy("FOO",100))
Verification passed.
Verify that FOO stock was purchased two times, regardless of the specified number of shares. While
the verifyCalled method is convenient to specify behavior, there is more functionality if you use
the WasCalled constraint. For example, you can verify that a mocked method was called a specified
number of times.
import matlab.unittest.constraints.IsAnything
testCase.verifyThat(brokerBehavior.buy("FOO",IsAnything), ...
WasCalled('WithCount',2))
Verification passed.
Verify that the buy method was not called requesting 100 shares of the BAR stock.
testCase.verifyNotCalled(brokerBehavior.buy("BAR",100))
Verification passed.
Although the trader function was called requesting 100 shares of BAR stock, the stub defined
yesterday's price for BAR to return a higher value than all days prior to yesterday. Therefore, the
broker never buys stock "BAR".
The interactive test case is convenient to experiment with at the command prompt. However, it is
typical to create and use mocks within a test class. In a file in your current working folder, create the
following test class that incorporates the interactive testing from this example.
classdef TraderTest < matlab.mock.TestCase
methods(Test)
function buysStockWhenDrops(testCase)
import matlab.unittest.constraints.IsLessThan
35-185
35 Unit Testing
import matlab.unittest.constraints.IsAnything
import matlab.mock.constraints.WasCalled
yesterday = datetime('yesterday');
% Create mocks
[stubDataService,dataServiceBehavior] = createMock(testCase,...
?DataService);
[spyBroker,brokerBehavior] = createMock(testCase,...
'AddedMethods',{'buy'});
% Set up behavior
testCase.assignOutputsWhen(dataServiceBehavior.lookupPrice(...
"FOO",yesterday),123);
testCase.assignOutputsWhen(dataServiceBehavior.lookupPrice(...
"FOO",IsLessThan(yesterday)),234);
% Verify interactions
testCase.verifyCalled(brokerBehavior.buy("FOO",100))
testCase.verifyThat(brokerBehavior.buy("FOO",IsAnything),...
WasCalled('WithCount',2))
end
function doesNotBuyStockWhenIncreases(testCase)
import matlab.unittest.constraints.IsLessThan
yesterday = datetime('yesterday');
% Create mocks
[stubDataService,dataServiceBehavior] = createMock(testCase,...
?DataService);
[spyBroker,brokerBehavior] = createMock(testCase, ...
'AddedMethods',{'buy'});
% Set up behavior
testCase.assignOutputsWhen(dataServiceBehavior.lookupPrice(...
"BAR",yesterday),765);
testCase.assignOutputsWhen(dataServiceBehavior.lookupPrice(...
"BAR",IsLessThan(yesterday)),543);
% Verify interactions
testCase.verifyNotCalled(brokerBehavior.buy("BAR",100))
end
end
end
results = runtests('TraderTest');
table(results)
Running TraderTest
..
Done TraderTest
35-186
Create Mock Object
__________
ans =
2×6 table
See Also
35-187
35 Unit Testing
When you create a mock, you create an associated behavior object that controls mock behavior. Use
this object to define mock method and property behavior (stub). For more information on creating a
mock, see “Create Mock Object” on page 35-181.
The mock object is an implementation of the abstract methods and properties of the interface
specified by a superclass. You can also construct a mock without a superclass, in which case the mock
has an implicit interface.
Create a mock with an implicit interface. The interface includes Name and ID properties and a
findUser method that accepts an identifier and returns a name. While the interface is not currently
implemented, you can create a mock with it.
testCase = matlab.mock.TestCase.forInteractiveUse;
[mock,behaviorObj] = testCase.createMock('AddedProperties', ...
{'Name','ID'},'AddedMethods',{'findUser'});
Specify that when the findUser method is called with any inputs, it returns "Unknown". By default,
MATLAB returns an empty array when you call the findUser method.
• The assignOutputsWhen method defines return values for the method call.
• The mocked method call (behaviorObj.findUser) implicitly creates a MethodCallBehavior
object.
• The withAnyInputs method of the MethodCallBehavior object specifies that the behavior
applies to a method call with any number of inputs with any value.
testCase.assignOutputsWhen(withAnyInputs(behaviorObj.findUser),"Unknown")
n = mock.findUser(1)
n =
"Unknown"
Specify that when the input value is 1701, the mock method returns "Jim". This behavior supersedes
the return of "Unknown" for the input value of 1701 only because it was defined after that
specification.
testCase.assignOutputsWhen(behaviorObj.findUser(1701),"Jim")
n = mock.findUser(1701)
35-188
Specify Mock Object Behavior
n =
"Jim"
Specify that when the findUser method is called with only the object as input, the mock method
returns "Unspecified ID". The withExactInputs method of the MethodCallBehavior object
specifies that the behavior applies to a method call with the object as the only input value.
testCase.assignOutputsWhen(withExactInputs(behaviorObj.findUser), ...
"Unspecified ID")
n = mock.findUser % equivalent to n = findUser(mock)
n =
"Unspecified ID"
You can use classes in the matlab.unittest.constraints package to help define behavior.
Specify that findUser throws an exception when it is called with an ID greater than 5000.
import matlab.unittest.constraints.IsGreaterThan
testCase.throwExceptionWhen(behaviorObj.findUser(IsGreaterThan(5000)));
n = mock.findUser(5001)
Error using
matlab.mock.internal.MockContext/createMockObject/mockMethodCallback (line 323)
The following method call was specified to throw an exception:
findUser([1×1 matlab.mock.classes.Mock], 5001)
You can define behavior based on the number of outputs requested in a method call. If the method
call requests two output values, return "??" for the name and -1 for the ID.
testCase.assignOutputsWhen(withNargout(2, ...
withAnyInputs(behaviorObj.findUser)),"??",-1)
[n,id] = mock.findUser(13)
n =
"??"
id =
-1
When defining mock property behavior, keep in mind that displaying a property value in the command
window is a property access (get) operation.
Similar to defining mock method behavior, defining mock property behavior requires an instance of
the PropertyBehavior class. The framework returns an instance of this class when you access a
mock property. To define access behavior, use an instance of PropertyGetBehavior by calling the
get method of the PropertyBehavior class. To define set behavior, use an instance of the
35-189
35 Unit Testing
Specify that when the Name property is set to any value, the testing framework throws an exception.
• The throwExceptionWhen method instructs the framework to throw an exception for a specified
behavior.
• Accessing a property on the behavior object PropertyBehavior class (behaviorObj.Name)
creates a PropertyBehavior class instance.
• The call to the set method of the PropertyBehavior class creates a PropertySetBehavior.
testCase.throwExceptionWhen(set(behaviorObj.Name))
mock.Name = "Sue";
Allow the mock to store the value when the property is set to "David".
testCase.storeValueWhen(setToValue(behaviorObj.Name,"David"));
mock.Name = "David"
mock =
Name: "David"
ID: []
Assign the value of 1138 to the ID property and then throw an exception for property access.
import matlab.mock.actions.AssignOutputs
import matlab.mock.actions.ThrowException
when(get(behaviorObj.ID),then(AssignOutputs(1138),ThrowException))
id = mock.ID
id = mock.ID
id =
1138
Assign the value of 1138 and then 237 to the ID property. Then, throw an exception for property
access. Each call to the then method accepts up to two actions. To specify more subsequent actions,
use multiple calls to then.
35-190
Specify Mock Object Behavior
when(get(behaviorObj.ID),then(AssignOutputs(1138), ...
then(AssignOutputs(237),ThrowException)))
id = mock.ID
id = mock.ID
id = mock.ID
id =
1138
id =
237
If the object is the only input value, specify the findUser function return the value of "Phil" twice.
when(withExactInputs(behaviorObj.findUser),repeat(2,AssignOutputs("Phil")))
n = mock.findUser
n = mock.findUser
n =
"Phil"
n =
"Phil"
Call the function a third time. If you repeat an action, and do not follow it with a call to the then
method, the mock continues to return the repeated value.
n = mock.findUser
n =
"Phil"
Define behavior for setting the value of Name. Throw an exception the first two times and then store
the value.
import matlab.mock.actions.StoreValue
when(set(behaviorObj.Name),then(repeat(2,ThrowException),StoreValue))
mock.Name = "John"
mock.Name = "Penny"
35-191
35 Unit Testing
mock.Name = "Tommy"
mock =
Name: "Tommy"
Summary of Behaviors
Behavior TestCase Method matlab.mock.Actions Class
(Allows for Definition of
Repeat and Subsequent
Behavior)
Return specified values for assignOutputsWhen AssignOutputs
method call and property
access.
Return stored value when returnStoredValueWhen ReturnStoredValue
property is accessed.
Store value when property is storeValueWhen StoreValue
set.
Throw exception when method throwExceptionWhen ThrowException
is called or when property is set
or accessed.
See Also
matlab.mock.TestCase | matlab.mock.actions.AssignOutputs |
matlab.mock.actions.ReturnStoredValue | matlab.mock.actions.StoreValue |
matlab.mock.actions.ThrowException
Related Examples
• “Create Mock Object” on page 35-181
35-192
Qualify Mock Object Interaction
In the mocking framework, qualifications are functions used to test interactions with the object.
There are four types of qualifications:
• Verifications — Produce and record failures without throwing an exception. Since verifications do
not throw exceptions, all test content runs to completion even when verification failures occur.
Typically verifications are the primary qualifications for a unit test since they typically do not
require an early exit from the test. Use other qualification types to test for violation of
preconditions or incorrect test setup.
• Assumptions — Ensure that the test environment meets preconditions that otherwise do not result
in a test failure. Assumption failures result in filtered tests, and the testing framework marks the
tests as Incomplete.
• Assertions — Ensure that a failure condition invalidates the remainder of the current test content,
but does not prevent proper execution of subsequent test methods. A failure at the assertion point
marks the current test method as failed and incomplete.
• Fatal Assertions — Abort the test session upon failure. These qualifications are useful when the
failure mode is so fundamental that there is no point in continuing testing. These qualifications are
also useful when fixture teardown does not restore the MATLAB state correctly and it is preferable
to abort testing and start a fresh session.
The mock object is an implementation of the abstract methods and properties of the interface
specified by a superclass. You can also construct a mock without a superclass, in which case the mock
has an implicit interface. Create a mock with an implicit interface for a dice class. The interface
includes Color and NumSides properties and a roll method that accepts a number of dice and
returns a value. While the interface is not currently implemented, you can create a mock with it.
testCase = matlab.mock.TestCase.forInteractiveUse;
[mock,behaviorObj] = testCase.createMock('AddedProperties', ...
{'NumSides','Color'},'AddedMethods',{'roll'});
val = mock.roll(1);
testCase.verifyCalled(behaviorObj.roll(1))
Verify that the roll method was called with 3 dice. This test fails.
testCase.verifyCalled(behaviorObj.roll(3), ...
'roll method should have been called with input 3.')
35-193
35 Unit Testing
----------------
Test Diagnostic:
----------------
roll method should have been called with input 3.
---------------------
Framework Diagnostic:
---------------------
verifyCalled failed.
--> Method 'roll' was not called with the specified signature.
--> Observed method call(s) with any signature:
out = roll([1×1 matlab.mock.classes.Mock], 1)
Verify that the roll method was not called with 2 dice.
testCase.verifyNotCalled(behaviorObj.roll(2))
testCase.verifyCalled(withAnyInputs(behaviorObj.roll))
Verify that the roll method was not called with 2 outputs and any inputs.
testCase.verifyNotCalled(withNargout(2,withAnyInputs(behaviorObj.roll)))
mock.Color = "red"
mock =
NumSides: []
Color: "red"
testCase.verifySet(behaviorObj.Color)
35-194
Qualify Mock Object Interaction
Verify the color was accessed. This test passes because there is an implicit property access when
MATLAB displays the object.
testCase.verifyAccessed(behaviorObj.Color)
testCase.assertNotSet(behaviorObj.NumSides)
testCase = matlab.mock.TestCase.forInteractiveUse;
[mock,behaviorObj] = testCase.createMock('AddedProperties', ...
{'NumSides','Color'},'AddedMethods',{'roll'});
Roll 2 dice. Then use a constraint to verify that the roll method was called at least once with two
dice.
val = mock.roll(2);
import matlab.mock.constraints.WasCalled
testCase.verifyThat(behaviorObj.roll(2),WasCalled)
Roll one die. Then verify that the roll method was called at least twice with any inputs.
val = mock.roll(1);
testCase.verifyThat(withAnyInputs(behaviorObj.roll), ...
WasCalled('WithCount',2))
import matlab.mock.constraints.WasAccessed
testCase.verifyThat(behaviorObj.NumSides,~WasAccessed)
Set the color of the dice. Then verify the property was set once.
mock.Color = "blue";
import matlab.mock.constraints.WasSet
testCase.verifyThat(behaviorObj.Color,WasSet('WithCount',1))
35-195
35 Unit Testing
Access the Color property. Then verify that it was not accessed exactly once. This test fails.
c = mock.Color
testCase.verifyThat(behaviorObj.Color,~WasAccessed('WithCount',1))
c =
"blue"
---------------------
Framework Diagnostic:
---------------------
Negated WasAccessed failed.
--> Property 'Color' was accessed the prohibited number of times.
Set the number of sides. Then, verify that the number of sides was set to 22.
mock.NumSides = 22;
testCase.verifyThat(behaviorObj.NumSides,WasSet('ToValue',22))
Use a constraint from the matlab.unittest.constraints package to assert that the number of
dice sides isn't set to more than 20. This test fails.
import matlab.unittest.constraints.IsLessThanOrEqualTo
testCase.verifyThat(behaviorObj.NumSides, ...
WasSet('ToValue',IsLessThanOrEqualTo(20)))
---------------------
Framework Diagnostic:
---------------------
WasSet failed.
--> Property 'NumSides' was not set to the specified value.
--> Observed property set(s) to any value:
<Mock>.NumSides = 22
35-196
Qualify Mock Object Interaction
PropertySetBehavior
<Mock>.NumSides = <IsLessThanOrEqualTo constraint>
Summary of Qualifications
Type of TestCase Method matlab.mock.constraints Class
Qualification Use With
matlab.unittest.TestCas matlab.mock.constra
e Method ints Class
Method was verifyCalled or verifyThat WasCalled or
called verifyNotCalled Occurred
assumeCalled or assumeThat
assumeNotCalled
assertCalled or assertThat
assertNotCalled
fatalAssertCalled fatalAssertThat
or
fatalAssertNotCal
led
Method was Not applicable verifyThat, assumeThat, WasCalled
called a certain assertThat, or
number of times fatalAssertThat
Property was verifyAccessed or verifyThat WasAccessed or
accessed verifyNotAccessed Occurred
assumeAccessed or assumeThat
assumeNotAccessed
assertAccessed or assertThat
assertNotAccessed
fatalAssertAccess fatalAssertThat
ed or
fatalAssertNotAcc
essed
Property was Not applicable verifyThat, assumeThat, WasAccessed
accessed a assertThat, or
certain number fatalAssertThat
of times
Property was set verifySet or verifyThat WasSet or Occurred
verifyNotSet
assumeSet or assumeThat
assumeNotSet
assertSet or assertThat
assertNotSet
fatalAssertSet or fatalAssertThat
fatalAssertNotSet
35-197
35 Unit Testing
See Also
35-198
Ways to Write Unit Tests
• Script-based unit tests: Write each unit test as a separate section of a test script file. You can
perform basic qualifications, access the diagnostics that the framework records on test results,
refine the test suite by selecting the tests you want to run, and customize the test run by creating
and configuring a TestRunner object.
• Function-based unit tests: Write each unit test as a local function within a test function file.
Function-based tests subscribe to the xUnit testing philosophy. In addition to supporting the
functionality provided by script-based tests, function-based tests give you access to a rich set of
test authoring features. For example, you can use advanced qualification features, including
constraints, tolerances, and test diagnostics.
• Class-based unit tests: Write each unit test as a Test method within a class definition file. In
addition to supporting the functionality provided by script-based and function-based tests, class-
based tests provide you with several advanced test authoring features and give you access to the
full framework functionality. For example, you can use shared test fixtures, parameterize tests,
and reuse test content.
Typically, with script-based tests, you create a test file, and pass the file name to the runtests
function without explicitly creating a suite of Test elements. If you create an explicit test suite (using
the testsuite function or a method of the matlab.unittest.TestSuite class), there are
additional features available in script-based testing. With an explicit test suite, you can:
35-199
35 Unit Testing
• Refine your suite, for example, using the classes in the matlab.unittest.selectors package.
(Several of the selectors are applicable only for class-based tests.)
• Create a TestRunner object and customize it to run your tests. You can add the plugin classes in
the matlab.unittest.plugins package to the test runner.
For more information about script-based tests, see “Write Script-Based Unit Tests” on page 35-6 and
“Extend Script-Based Tests” on page 35-14.
• Set up the pretest state of the system and return it to the original state after running the test. You
can perform these tasks once per test file or once per unit test. For more information, see “Write
Test Using Setup and Teardown Functions” on page 35-27.
• Use the fixture classes in the matlab.unittest.fixtures package (with the applyFixture
method) to handle the setup and teardown of frequently used testing actions.
• Record diagnostic information at a certain verbosity level by using the log method.
• Use the full library of qualifications in the matlab.unittest.qualifications package. To
determine which qualification to use, see “Table of Verifications, Assertions, and Other
Qualifications” on page 35-44.
• Use advanced qualification features, including constraints, actual value proxies, tolerances, and
test diagnostics. You can use the classes in the matlab.unittest.constraints and
matlab.unittest.diagnostics packages in your qualifications.
For more information about function-based tests, see “Write Function-Based Unit Tests” on page 35-
20 and “Extend Function-Based Tests” on page 35-31.
• Use setup and teardown method blocks to implicitly set up the pretest environment state and
return it to the original state after running the tests. For more information, see “Write Setup and
Teardown Code Using Classes” on page 35-41.
• Share fixtures among classes. For more information, see “Write Tests Using Shared Fixtures” on
page 35-51.
• Group tests into categories and then run the tests with specified tags. For more information, see
“Tag Unit Tests” on page 35-47.
• Write parameterized tests to combine and execute tests on specified lists of parameters. For more
information, see “Use Parameters in Class-Based Tests” on page 35-61.
• Use subclassing and inheritance to share and reuse test content. For example, you can reuse the
parameters and methods defined in a test class by deriving subclasses. For more information, see
“Hierarchies of Classes — Concepts”.
For more information about class-based tests, see “Author Class-Based Unit Tests in MATLAB” on
page 35-35.
35-200
Ways to Write Unit Tests
See Also
More About
• “Write Script-Based Unit Tests” on page 35-6
• “Write Function-Based Unit Tests” on page 35-20
• “Author Class-Based Unit Tests in MATLAB” on page 35-35
35-201
35 Unit Testing
MATLAB Compiler supports only class-based unit tests. (You cannot compile script-based or function-
based unit tests.) In addition, MATLAB Compiler currently does not support tests authored using the
performance testing framework.
In a file named TestRand.m in your current folder, create a parameterized test class that tests the
MATLAB random number generator (see “TestRand Class Definition Summary” on page 35-203).
In your current folder, create the runMyTests function. This function creates a test suite from the
TestRand class, runs the tests, and displays the test results.
function runMyTests
suite = matlab.unittest.TestSuite.fromClass(?TestRand);
runner = matlab.unittest.TestRunner.withNoPlugins;
results = runner.run(suite);
disp(results)
end
Compile the runMyTests function into a standalone application by running the mcc command in the
Command Window. MATLAB Compiler generates an application in your current folder.
mcc -m runMyTests
Open a terminal window, navigate to the folder into which you packaged your standalone application,
and run the application.
C:\work>runMyTests
1x1200 TestResult array with properties:
Name
Passed
Failed
Incomplete
Duration
Details
Totals:
35-202
Compile MATLAB Unit Tests
For more information on how to create and run standalone applications, see “Create Standalone
Application from MATLAB” (MATLAB Compiler).
For example, consider the tests in the file TestRand.m. You can create a standalone application to
run these tests in parallel by compiling this function.
function runMyTestsInParallel
%#function parallel.Pool
results = runtests('TestRand.m','UseParallel',true);
disp(results)
end
Compile the function into a standalone application using the mcc command. To instruct MATLAB
Compiler to include the test file in the application, specify the file name using the -a option.
mcc -m runMyTestsInParallel -a TestRand.m
methods (Test)
function testRepeatable(testCase,dim1,dim2,dim3)
state = rng;
firstRun = rand(dim1,dim2,dim3);
rng(state)
secondRun = rand(dim1,dim2,dim3);
testCase.verifyEqual(firstRun,secondRun);
end
function testClass(testCase,dim1,dim2,type)
testCase.verifyClass(rand(dim1,dim2,type),type)
end
end
end
35-203
35 Unit Testing
sizes = num2cell(round(logspace(0,2,10)));
end
See Also
mcc | run (TestRunner) | run (TestSuite) | runtests | runInParallel |
compiler.build.standaloneApplication
More About
• “Ways to Write Unit Tests” on page 35-199
• “Create Standalone Application from MATLAB” (MATLAB Compiler)
35-204
Develop and Integrate Software with Continuous Integration
• Finding problems in software and fixing them soon after they are introduced.
• Adding more features while reducing the resources required for debugging code.
• Minimizing integration and deployment overheads by performing integration on a continuous
basis.
• Clearly communicating the state of software and the changes that have been made to it.
This figure shows an example of the development cycle using the Jenkins™ CI server and open-source
source code management tools such as Git and GitHub. For information on how to interface MATLAB
with Jenkins, see Run MATLAB Tests on Jenkins Server.
35-205
35 Unit Testing
Run an automated pipeline of tasks (including testing) when you push your changes to the remote
repository or when you make a pull request:
1 Trigger an automated pipeline of tasks on Jenkins by pushing the committed changes to GitHub
or by making a pull request to merge the remote feature branch into the main branch.
2 Jenkins runs the automated pipeline, including MATLAB and Simulink tests, and generates
artifacts as specified in the project configuration.
35-206
Develop and Integrate Software with Continuous Integration
If you do not succeed in pushing your changes or making a pull request, follow these steps:
1 Inspect the automated pipeline results and the generated test artifacts. Make appropriate
changes to your code.
2 Trigger a new pipeline on Jenkins by pushing your changes to GitHub or by making a pull
request.
Integration engineers can use Jenkins test artifacts to decide when to merge the feature branch into
the main branch.
In addition to MATLAB, different toolboxes support continuous integration workflows. This table lists
common continuous integration use cases for models and code.
35-207
35 Unit Testing
See Also
matlab.unittest.plugins Package
More About
• “Set Up Git Source Control” on page 34-23
• “Use Source Control with Projects” on page 33-48
• “Explore an Example Project” on page 33-66
• “Continuous Integration with MATLAB on CI Platforms” on page 35-213
External Websites
• MathWorks Blogs: Developer Zone – Continuous Integration
35-208
Generate Artifacts Using MATLAB Unit Test Plugins
You also can generate CI-compatible artifacts when you run Simulink® Test™ test cases. For more
information, see “Output Results for Continuous Integration Systems” (Simulink Test).
This example shows how to create a test suite and customize the test runner to report on test run
progress and produce CI-compatible artifacts.
In a file in your current folder, create the function quadraticSolver, which returns the roots of
quadratic polynomials.
end
To test quadraticSolver, create the test class SolverTest in your current folder.
35-209
35 Unit Testing
testCase.verifyError(@()quadraticSolver(1,'-3',2), ...
'quadraticSolver:InputMustBeNumeric')
end
end
end
At the command prompt, create a test suite from the SolverTest class.
suite = testsuite('SolverTest');
import matlab.unittest.TestRunner
runner = TestRunner.withTextOutput('OutputDetail',3);
Create a TestReportPlugin instance that sends output to the file testreport.pdf and add the
plugin to the test runner.
import matlab.unittest.plugins.TestReportPlugin
pdfFile = 'testreport.pdf';
p1 = TestReportPlugin.producingPDF(pdfFile);
runner.addPlugin(p1)
Create an XMLPlugin instance that writes JUnit-style XML output to the file
junittestresults.xml. Then, add the plugin to the test runner.
import matlab.unittest.plugins.XMLPlugin
xmlFile = 'junittestresults.xml';
p2 = XMLPlugin.producingJUnitFormat(xmlFile);
runner.addPlugin(p2)
Create a plugin that outputs a Cobertura code coverage report for the source code in the file
quadraticSolver.m. Instruct the plugin to write its output to the file cobertura.xml and add the
plugin to the test runner.
import matlab.unittest.plugins.CodeCoveragePlugin
import matlab.unittest.plugins.codecoverage.CoberturaFormat
sourceCodeFile = 'quadraticSolver.m';
reportFile = 'cobertura.xml';
reportFormat = CoberturaFormat(reportFile);
p3 = CodeCoveragePlugin.forFile(sourceCodeFile,'Producing',reportFormat);
runner.addPlugin(p3)
results = runner.run(suite)
Running SolverTest
Setting up SolverTest
Done setting up SolverTest in 0 seconds
Running SolverTest/realSolution
Done SolverTest/realSolution in 1.0394 seconds
Running SolverTest/imaginarySolution
Done SolverTest/imaginarySolution in 0.019198 seconds
35-210
Generate Artifacts Using MATLAB Unit Test Plugins
Running SolverTest/nonnumericInput
Done SolverTest/nonnumericInput in 0.82551 seconds
Tearing down SolverTest
Done tearing down SolverTest in 0 seconds
Done SolverTest in 1.8841 seconds
__________
results =
1x3 TestResult array with properties:
Name
Passed
Failed
Incomplete
Duration
Details
Totals:
3 Passed, 0 Failed, 0 Incomplete.
1.8841 seconds testing time.
List the files in your current folder. The three specified artifacts are stored in your current folder.
dir
.
..
GenerateArtifactsUsingMATLABUnitTestPluginsExample.mlx
SolverTest.m
cobertura.xml
junittestresults.xml
quadraticSolver.m
testreport.pdf
You can process the generated artifacts on CI platforms. You also can view the contents of the
generated artifacts. For example, open the PDF test report.
open('testreport.pdf')
See Also
matlab.unittest.TestRunner | matlab.unittest.plugins Package |
matlab.unittest.plugins.TAPPlugin | matlab.unittest.plugins.XMLPlugin |
matlab.unittest.plugins.CodeCoveragePlugin |
matlab.unittest.plugins.TestReportPlugin
35-211
35 Unit Testing
More About
• “Develop and Integrate Software with Continuous Integration” on page 35-205
• “Continuous Integration with MATLAB on CI Platforms” on page 35-213
• “Output Results for Continuous Integration Systems” (Simulink Test)
35-212
Continuous Integration with MATLAB on CI Platforms
To facilitate running and testing software with continuous integration, MATLAB seamlessly integrates
with several CI platforms, such as Azure® DevOps, CircleCI®, and Jenkins. You can use these
platforms to:
Azure DevOps
To perform continuous integration with MATLAB on Azure DevOps, install an extension to your Azure
DevOps organization. To run MATLAB in your pipeline, use the extension to author your pipeline
YAML in a file named azure-pipelines.yml in the root of your repository. You can run your
pipeline using a Linux agent in the cloud or a self-hosted agent. For more information, see the
extension on Visual Studio Marketplace.
Bamboo
To perform continuous Integration with MATLAB on Bamboo®, install a plugin on your Bamboo CI
server. The plugin provides you with tasks to run MATLAB scripts, functions, statements, and tests as
part of your build. For more information, see Continuous Integration with MATLAB on Bamboo.
CircleCI
To perform continuous Integration with MATLAB on CircleCI, opt-in to using third-party orbs in your
organization security settings. To run MATLAB in your pipeline, import the appropriate orb to author
your pipeline YAML in a file named .circleci/config.yml in the root of your repository. You can
run your pipeline using a Linux machine executor in the cloud. For more information, see the orb on
CircleCI Orb Registry.
GitHub Actions
To perform continuous integration with MATLAB on GitHub Actions, make sure GitHub Actions is
enabled for your repository. To run MATLAB in your workflow, use the appropriate actions when you
define your workflow in the .github/workflows directory of your repository. You can run your
workflow using a Linux runner in the cloud or a self-hosted runner. For more information, see Use
MATLAB with GitHub Actions.
35-213
35 Unit Testing
Jenkins
To perform continuous integration with MATLAB on Jenkins, install a plugin on your Jenkins agent.
Then, you can use an interface to run MATLAB in freestyle and multi-configuration (matrix) projects.
You also can configure your pipeline as code checked into source control. For more information, see
the plugin on Jenkins Plugins Index.
Travis CI
To perform continuous integration with MATLAB on Travis CI, specify the MATLAB language when
you author your pipeline YAML in a file named .travis.yml in the root of your repository. You can
run your pipeline using a Linux agent in the cloud. For more information, see the language in Travis
CI Documentation.
Other Platforms
To perform continuous integration with MATLAB on other CI platforms, use the matlab command
with the -batch option in your pipeline. You can use matlab -batch to run MATLAB scripts,
functions, and statements noninteractively. For example, matlab -batch "myscript" starts
MATLAB noninteractively and runs the commands in a file named myscript.m. MATLAB terminates
automatically with exit code 0 if the specified script, function, or statement executes successfully
without error. Otherwise, MATLAB terminates with a nonzero exit code.
See Also
matlab.unittest.plugins Package
More About
• “Develop and Integrate Software with Continuous Integration” on page 35-205
• “Generate Artifacts Using MATLAB Unit Test Plugins” on page 35-209
35-214
36
A System object is a specialized MATLAB object. Many toolboxes include System objects. System
objects are designed specifically for implementing and simulating dynamic systems with inputs that
change over time. Many signal processing, communications, and controls systems are dynamic. In a
dynamic system, the values of the output signals depend on both the instantaneous values of the
input signals and on the past behavior of the system. System objects use internal states to store that
past behavior, which is used in the next computational step. As a result, System objects are optimized
for iterative computations that process large streams of data in segments, such as video and audio
processing systems. This ability to process streaming data provides the advantage of not having to
hold large amounts of data in memory. Use of streaming data also allows you to use simplified
programs that use loops efficiently.
For example, you could use System objects in a system that reads data from a file, filters that data
and then writes the filtered output to another file. Typically, a specified amount of data is passed to
the filter in each loop iteration. The file reader object uses a state to track where in the file to begin
the next data read. Likewise, the file writer object tracks where it last wrote data to the output file so
that data is not overwritten. The filter object maintains its own internal states to ensure that the
filtering is performed correctly. This diagram represents a single loop of the system.
These advantages make System objects well suited for processing streaming data.
Note Check the product documentation to confirm fixed-point, code generation, and MATLAB
Compiler support for the specific System objects you want to use.
This separation of creation from execution lets you create multiple, persistent, reusable objects, each
with different settings. Using this approach avoids repeated input validation and verification, allows
36-2
What Are System Objects?
for easy use within a programming loop, and improves overall performance. In contrast, MATLAB
functions must validate parameters every time you call the function.
In addition to the System objects provided with System Toolboxes, you can create your own System
objects. See “Create System Objects”.
dft = dsp.FFT('FFTLengthSource','Property','FFTLength',1024);
dft(x);
If you run a System object without any input arguments, you must include empty parentheses. For
example, asysobj().
When you run a System object, it also performs other important tasks related to data processing,
such as initialization and handling object states.
Note An alternative way to run a System object is to use the step function. For example, for an
object created using dft = dsp.FFT, you can run it using step(dft,x).
All System objects support the following object functions. In cases where a function is not applicable
to a particular object, calling that function has no effect on the object.
36-3
36 System object Usage and Authoring
Function Description
Run the object function, or Runs the object to process data using the algorithm defined by that
step object.
Example: For the object dft = dsp.FFT;, run the object via:
• y = dft(x)
• y = step(dft,x)
See Also
matlab.System
Related Examples
• “System Objects vs MATLAB Functions” on page 36-5
• “System Design in MATLAB Using System Objects” on page 36-7
• “System Design in Simulink Using System Objects” (Simulink)
36-4
System Objects vs MATLAB Functions
Building a dynamic system with different execution phases and internal states using only MATLAB
functions would require complex programming. You would need code to initialize the system, validate
data, manage internal states, and reset and terminate the system. System objects perform many of
these managerial operations automatically during execution. By combining System objects in a
program with other MATLAB functions, you can streamline your code and improve efficiency.
The code reads audio data from a file, filters it, and plays the filtered audio data. The audio data is
read in frames. This code produces the same result as the System objects code in the next example,
allowing you to compare approaches.
fname = 'speech_dft_8kHz.wav';
Obtain the total number of samples and the sampling rate from the source file.
audioInfo = audioinfo(fname);
maxSamples = audioInfo.TotalSamples;
fs = audioInfo.SampleRate;
b = fir1(160,.15);
z = zeros(1,numel(b)-1);
Define the amount of audio data to process at one time, and initialize the while loop index.
frameSize = 1024;
nIdx = 1;
36-5
36 System object Usage and Authoring
The loop uses explicit indexing and state management, which can be a tedious and error-prone
approach. You must have detailed knowledge of the states, such as, sizes and data types. Another
issue with this MATLAB-only code is that the sound function is not designed to run in real time. The
resulting audio is choppy and barely audible.
The code uses System objects from the DSP System Toolbox™ software to read audio data from a file,
filter it, and then play the filtered audio data. This code produces the same result as the MATLAB
code shown previously, allowing you to compare approaches.
fname = "speech_dft_8kHz.wav";
audioIn = dsp.AudioFileReader(fname,'OutputDataType','single');
filtLP = dsp.FIRFilter('Numerator',fir1(160,.15));
audioOut = audioDeviceWriter('SampleRate',audioIn.SampleRate);
while ~isDone(audioIn)
audio = audioIn(); % Read audio source file
y = filtLP(audio); % Filter the data
audioOut(y); % Play the filtered data
end
This System objects code avoids the issues present in the MATLAB-only code. Without requiring
explicit indexing, the file reader object manages the data frame sizes while the filter manages the
states. The audio device writer object plays each audio frame as it is processed.
36-6
System Design in MATLAB Using System Objects
1 “Create Individual Components” on page 36-7 — Create the System objects to use in your
system. “Create Individual Components” on page 36-7. In addition to the System objects
provided with System Toolboxes, you can also create your own System objects. See “Create
System Objects”.
2 “Configure Components” on page 36-8 — If necessary, change the objects’ property values to
model your particular system. All System object properties have default values that you may be
able to use without changing them. See “Configure Components” on page 36-8.
3 “Assemble Components Into System” on page 36-9 — Write a MATLAB program that includes
those System objects, connecting them using MATLAB variables as inputs and outputs to
simulate your system. See “Connecting System Objects” on page 36-9.
4 “Run Your System” on page 36-9 — Run your program. You can change tunable properties
while your system is running. See “Run Your System” on page 36-9 and “Reconfiguring
Objects” on page 36-10.
This section shows how to set up your system using predefined components from DSP System Toolbox
and Audio Toolbox™:
36-7
36 System object Usage and Authoring
audioIn = dsp.AudioFileReader;
filtLP = dsp.FIRFilter;
audioOut = audioDeviceWriter;
Configure Components
When to Configure Components
If you did not set an object's properties when you created it and do not want to use default values,
you must explicitly set those properties. Some properties allow you to change their values while your
system is running. See “Reconfiguring Objects” on page 36-10 for information.
Most properties are independent of each other. However, some System object properties enable or
disable another property or limit the values of another property. To avoid errors or warnings, you
should set the controlling property before setting the dependent property.
To display the current property values for an object, type that object’s handle name at the command
line (such as audioIn). To display the value of a specific property, type
objecthandle.propertyname (such as audioIn.FileName).
This section shows how to configure the components for your system by setting the component
objects’ properties.
Use this procedure if you have created your components separately from configuring them. You can
also create and configure your components at the same time, as described in a later example.
For the file reader object, specify the file to read and set the output data type.
For the filter object, specify the filter numerator coefficients using the fir1 function, which specifies
the low pass filter order and the cutoff frequency.
For the audio device writer object, specify the sample rate. In this case, use the same sample rate as
the input data.
audioIn.Filename = "speech_dft_8kHz.wav";
audioIn.OutputDataType = "single";
filtLP.Numerator = fir1(160,.15);
audioOut.SampleRate = audioIn.SampleRate;
36-8
System Design in MATLAB Using System Objects
Create the file reader object, specify the file to read, and set the output data type.
audioIn = dsp.AudioFileReader("speech_dft_8kHz.wav",...
'OutputDataType',"single");
Create the filter object and specify the filter numerator using the fir1 function. Specify the low pass
filter order and the cutoff frequency of the fir1 function.
filtLP = dsp.FIRFilter('Numerator',fir1(160,.15));
Create the audio player object and set the sample rate to the same rate as the input data.
audioOut = audioDeviceWriter('SampleRate',audioIn.SampleRate);
After you have determined the components you need and have created and configured your System
objects, assemble your system. You use the System objects like other MATLAB variables and include
them in MATLAB code. You can pass MATLAB variables into and out of System objects.
The main difference between using System objects and using functions is that System objects use a
two-step process. First you create the object and set its parameters and then, you run the object.
Running the object initializes it and controls the data flow and state management of your system. You
typically call a System object within a code loop.
You use the output from an object as the input to another object. For some System objects, you can
use properties of those objects to change the inputs or outputs. To verify that the appropriate number
of inputs and outputs are being used, you can use nargin and nargout on any System object. For
information on all available System object functions, see “System Object Functions” on page 36-3.
This section shows how to connect the components together to read, filter, and play a file of audio
data. The while loop uses the isDone function to read through the entire file.
while ~isDone(audioIn)
audio = audioIn(); % Read audio source file
y = filtLP(audio); % Filter the data
audioOut(y); % Play the filtered data
end
The first call to a System object initializes and runs the object. When a System object has started
processing data, you cannot change nontunable properties.
36-9
36 System object Usage and Authoring
• Input size
• Input complexity
• Input data type
• Tunable property data types
• Discrete state data types
If the System object author has restricted these specifications, you get an error if you try to change
them while the System object is in use.
Reconfiguring Objects
Change Properties
When a System object has started processing data, you cannot change nontunable properties. You
can use isLocked on any System object to verify whether the object is processing data. When
processing is complete, you can use the release function to release resources and allow changes to
nontunable properties.
Some object properties are tunable, which enables you to change them even if the object is in use.
Most System object properties are nontunable. Refer to the object’s reference page to determine
whether an individual property is tunable.
During object usage, after you have called the algorithm, some System objects do not allow changes
in input complexity, size, or data type. If the System object restricts these specifications, you can call
release to change these specifications. Calling release also resets other aspects of the System
object, such as states and Discrete states.
This example shows how to change the filter type to a high-pass filter as the code is running by
modifying the Numerator property of the filter object. The change takes effect the next time the
object is called.
36-10
Define Basic System Objects
System objects are composed of a base class, matlab.System and may include one or more
mixin classes. You specify the base class and mixin classes on the first line of your class definition
file.
3 Save the file and name it AddOne.m.
Define Algorithm
The stepImpl method contains the algorithm to execute when you run your object. Define this
method so that it contains the actions you want the System object to perform.
1 In the basic System object you created, inspect the stepImpl method template.
methods (Access = protected)
function y = stepImpl(obj,u)
% Implement algorithm. Calculate y as a function of input u and
% discrete states.
y = u;
end
end
The stepImpl method access is always set to protected because it is an internal method that
users do not directly call or run.
All methods, except static methods, require the System object handle as the first input argument.
The default value, inserted by MATLAB Editor, is obj. You can use any name for your System
object handle.
By default, the number of inputs and outputs are both one. Inputs and outputs can be added
using Inputs/Outputs. You can also use a variable number of inputs or outputs, see “Change the
Number of Inputs” on page 36-13.
Alternatively, if you create your System object by editing a MAT-file, you can add the stepImpl
method using Insert Method > Implement algorithm.
2 Change the computation in the stepImpl method to add 1 to the value of u.
methods (Access = protected)
36-11
36 System object Usage and Authoring
function y = stepImpl(~,u)
y = u + 1;
end
Tip Instead of passing in the object handle, you can use the tilde (~) to indicate that the object
handle is not used in the function. Using the tilde instead of an object handle prevents warnings
about unused variables.
3 Remove unused methods that are included by default in the basic template.
You can modify these methods to add more System object actions and properties. You can also
make no changes, and the System object still operates as intended.
The class definition file now has all the code necessary for this System object.
function y = stepImpl(~,u)
y = u + 1;
end
end
end
See Also
stepImpl | getNumInputsImpl | getNumOutputsImpl | matlab.System
Related Examples
• “Change the Number of Inputs” on page 36-13
• “System Design and Simulation in MATLAB” on page 36-7
36-12
Change the Number of Inputs
If you have a variable number of inputs or outputs and you intend to use the System object in
Simulink®, you must include the getNumInputsImpl or getNumOutputsImpl method in your class
definition.
These examples show modifications for the number of inputs. If you want to change the number of
outputs, the same principles apply.
As with all System object Impl methods, you always set the getNumInputsImpl and
getNumOutputsImpl method's access to protected because they are internal methods that are
never called directly.
This example shows how to write a System object that allows the number of inputs to vary.
Update the stepImpl method to accept up to three inputs by adding code to handle one, two, or
three inputs. If you are only using this System object in MATLAB, getNumInputsImpl and
getNumOutputsImpl are not required.
Run this System object with one, two, and three inputs.
addObj = AddTogether;
addObj(2)
ans =
36-13
36 System object Usage and Authoring
addObj(2,3)
ans =
addObj(2,3,4)
ans =
This example shows how to write a System object that allows changes to the number of inputs and
outputs before running the object. Use this method when your System object will be included in
Simulink:
properties (Nontunable)
NumInputs = 3; % Default value
end
methods (Access = protected)
function y = stepImpl(obj,x1,x2,x3)
switch obj.NumInputs
case 1
y = x1;
case 2
y = x1 + x2;
case 3
y = x1 + x2 + x3;
otherwise
y = [];
end
end
function validatePropertiesImpl(obj)
if ((obj.NumInputs < 1) ||...
(obj.NumInputs > 3))
error("Only 1, 2, or 3 inputs allowed.");
end
end
36-14
Change the Number of Inputs
end
end
Run this System object with one, two, and three inputs.
addObj = AddTogether2;
addObj.NumInputs = 1;
addObj(2)
ans =
release(addObj);
addObj.NumInputs = 2;
addObj(2,3)
ans =
release(addObj);
addObj.NumInputs = 3;
addObj(2,3,4)
ans =
See Also
getNumInputsImpl | getNumOutputsImpl
Related Examples
• “Validate Property and Input Values” on page 36-16
• “Define Basic System Objects” on page 36-11
• “Using ~ as an Input Argument in Method Definitions” on page 36-50
36-15
36 System object Usage and Authoring
Validate Inputs
To validate input values, use the validateInputsImpl method. This example shows how to validate
that the first input is a numeric value.
36-16
Validate Property and Input Values
See Also
validateInputsImpl | validatePropertiesImpl
Related Examples
• “Define Basic System Objects” on page 36-11
• “Change Input Complexity, Dimensions, or Data Type” on page 36-10
• “Summary of Call Sequence” on page 36-45
• “Property Set Methods”
• “Using ~ as an Input Argument in Method Definitions” on page 36-50
36-17
36 System object Usage and Authoring
In this example, you allocate file resources by opening the file so the System object can write to that
file. You do these initialization tasks one time during setup, rather than every time you run the object.
In this example, you define the public Filename property and specify the value of that property as
the nontunable character vector, default.bin. Users cannot change nontunable properties after the
setup method has been called.
properties (Nontunable)
Filename = "default.bin"
end
Users cannot access private properties directly, but only through methods of the System object. In
this example, you define the pFileID property as a private property. You also define this property as
hidden to indicate it is an internal property that never displays to the user.
Define Setup
You use the setupImpl method to perform setup and initialization tasks. You should include code in
the setupImpl method that you want to execute one time only. The setupImpl method is called
once the first time you run the object. In this example, you allocate file resources by opening the file
for writing binary data.
methods
function setupImpl(obj)
obj.pFileID = fopen(obj.Filename,"wb");
if obj.pFileID < 0
error("Opening the file failed");
end
end
end
Although not part of setup, you should close files when your code is done using them. You use the
releaseImpl method to release resources.
36-18
Initialize Properties and Setup One-Time Calculations
See Also
setupImpl | releaseImpl | stepImpl | matlab.System Constructor
Related Examples
• “Release System Object Resources” on page 36-22
• “Define Property Attributes” on page 36-24
• “Summary of Call Sequence” on page 36-45
36-19
36 System object Usage and Authoring
Define the System object constructor, which is a method that has the same name as the class (MyFile
in this example). Within that method, you use the setProperties method to make all public
properties available for input when the user constructs the object. nargin is a MATLAB function that
determines the number of input arguments. varargin indicates all of the object’s public properties.
methods
function obj = MyFile(varargin)
setProperties(obj,nargin,varargin{:});
end
end
methods
% You call setProperties in the constructor to let
% a user specify public properties of object as
% name-value pairs.
function obj = MyFile(varargin)
setProperties(obj,nargin,varargin{:});
end
end
36-20
Set Property Values at Construction Time
function stepImpl(obj,data)
fwrite(obj.pFileID,data);
end
See Also
nargin | setProperties
Related Examples
• “Define Property Attributes” on page 36-24
• “Release System Object Resources” on page 36-22
36-21
36 System object Usage and Authoring
In this section...
“Reset Algorithm State” on page 36-22
“Release System Object Resources” on page 36-22
This method allows you to clear the axes on the Whiteboard figure window while keeping the figure
open.
function releaseImpl(obj)
cla(Whiteboard.getWhiteboard());
hold on
end
For a complete definition of the Whiteboard System object, see “Create a Whiteboard System
object” on page 36-29.
36-22
Reset Algorithm and Release Resources
See Also
resetImpl | releaseImpl
More About
• “Summary of Call Sequence” on page 36-45
• “Initialize Properties and Setup One-Time Calculations” on page 36-18
36-23
36 System object Usage and Authoring
Use the Nontunable attribute for a property when the algorithm depends on the value being
constant once data processing starts. Defining a property as nontunable may improve the efficiency
of your algorithm by removing the need to check for or react to values that change. For code
generation, defining a property as nontunable allows the memory associated with that property to be
optimized. You should define all properties that affect the number of input or output ports as
nontunable.
When you use the System object, you can only change nontunable properties before calling the object
or after calling the release function. For example, you define the InitialValue property as
nontunable and set its value to 0.
properties (Nontunable)
InitialValue = 0;
end
properties (DiscreteState)
Count;
end
36-24
Define Property Attributes
properties
% Whether to increment the counter, must be a logical scalar
Increment (1, 1) logical = true
end
properties (DiscreteState)
% Count state variable
Count
end
function c = stepImpl(obj)
if obj.Increment && (obj.Count < obj.MaxValue)
obj.Count = obj.Count + 1;
else
disp(['Max count, ' num2str(obj.MaxValue) ' ,reached'])
end
c = obj.Count;
end
See Also
More About
• “Class Attributes”
• “Property Attributes”
• “What You Cannot Change While Your System Is Running” on page 36-9
• “Summary of Call Sequence” on page 36-45
36-25
36 System object Usage and Authoring
36-26
Hide Inactive Properties
if obj.UseRandomInitialValue
obj.pCount = rand();
else
obj.pCount = obj.InitialValue;
end
end
See Also
isInactivePropertyImpl
36-27
36 System object Usage and Authoring
For a System object that is used in a MATLAB System block in Simulink you can use enumerations or
property validation. If you use enumerations, enumerations can also derive from
Simulink.IntEnumType. You use this type of enumeration to add attributes (such as custom
headers) to the input or output of the MATLAB System block. See “Use Enumerated Data in Simulink
Models” (Simulink).
This example defines a Style property that can have the values solid, dash, or dot. The default
value is solid and the (1,1) defines the property as a scalar.
properties
Style (1,1) string {mustBeMember(Style, ["solid","dash","dot"])} = "solid";
end
Enumeration Property
To use enumerated data in a System object, you refer to the enumerations as properties in your
System object class definition and define your enumerated class in a separate class definition file.
This example defines a color enumeration property for a System object. The definition of the
enumeration class ColorValues is:
The ColorValues class inherits from int32 for code generation compatibility. Enumeration values
must be valid MATLAB identifiers on page 1-5.
In the System object, the Color property is defined as a ColorValues object with blue as the
default. The (1,1) defines the Color property as a scalar:
36-28
Limit Property Values to Finite List
properties
Color (1, 1) ColorValues = ColorValues.blue
end
properties(Nontunable)
Color (1, 1) ColorValues = ColorValues.blue
Style (1,1) string {mustBeMember(Style, ["solid","dash","dot"])} = "solid";
end
function releaseImpl(~)
cla(Whiteboard.getWhiteboard());
hold on
end
end
methods (Static)
function a = getWhiteboard()
h = findobj('tag','whiteboard');
if isempty(h)
h = figure('tag','whiteboard');
hold on
end
a = gca;
end
end
end
36-29
36 System object Usage and Authoring
greenInk = Whiteboard;
blueInk = Whiteboard;
greenInk.Color = "green";
blueInk.Color = "blue";
blueInk.Style = "dot";
for i=1:3
greenInk();
blueInk();
end
release(greenInk);
release(blueInk);
36-30
Limit Property Values to Finite List
See Also
Related Examples
• “Validate Property Values”
• “Enumerations”
• “Code Generation for Enumerations” (MATLAB Coder)
36-31
36 System object Usage and Authoring
properties
MiddleC = 440
NumNotes = 12
end
function hz = stepImpl(obj,noteShift)
% A noteShift value of 1 corresponds to obj.MiddleC
hz = obj.pLookupTable(noteShift);
end
function processTunedPropertiesImpl(obj)
propChange = isChangedProperty(obj,'NumNotes')||...
isChangedProperty(obj,'MiddleC')
if propChange
obj.pLookupTable = obj.MiddleC *...
36-32
Process Tuned Properties
(1+log(1:obj.NumNotes)/log(12));
end
end
end
See Also
processTunedPropertiesImpl
36-33
36 System object Usage and Authoring
To define a System object from other System objects, store those other objects in your class definition
file as properties. In this example, the highpass and lowpass filters are the separate System objects
defined in their own class-definition files.
function resetImpl(obj)
reset(obj.pLowpass);
reset(obj.pHighpass);
end
end
end
properties (Nontunable)
% Filter coefficients
Numerator = [0.006,-0.0133,-0.05,0.26,0.6,0.26,-0.05,-0.0133,0.006];
end
36-34
Define Composite System Objects
properties (DiscreteState)
State
end
function y = stepImpl(obj,u)
[y,obj.State] = filter(obj.Numerator,1,u,obj.State);
end
function resetImpl(obj)
obj.State = zeros(length(obj.Numerator)-1,1);
end
end
end
properties (Nontunable)
% Filter coefficients
Numerator = [0.006,0.0133,-0.05,-0.26,0.6,-0.26,-0.05,0.0133,0.006];
end
properties (DiscreteState)
State
end
function y = stepImpl(obj,u)
[y,obj.State] = filter(obj.Numerator,1,u,obj.State);
end
function resetImpl(obj)
obj.State = zeros(length(obj.Numerator)-1,1);
end
end
end
See Also
nargin
36-35
36 System object Usage and Authoring
In this section...
“Use the FiniteSource Class and Specify End of the Source” on page 36-36
“Complete Class Definition File with Finite Source” on page 36-36
function y = stepImpl(obj)
if ~obj.isDone()
obj.NumSteps = obj.NumSteps + 1;
y = obj.NumSteps;
else
y = 0;
end
end
36-36
Define Finite Source Objects
See Also
matlab.system.mixin.FiniteSource
More About
• “Subclassing Multiple Classes”
• “Using ~ as an Input Argument in Method Definitions” on page 36-50
36-37
36 System object Usage and Authoring
obj.protectedprop = s.protectedprop;
obj.pdependentprop = s.pdependentprop;
if isInUse
obj.state = s.state;
end
[email protected](obj,s,isInUse);
end
end
36-38
Save and Load System Object
end
methods (Access=protected)
function setupImpl(obj, ~)
obj.Count = 0;
end
function y = stepImpl(obj, u)
if u > 0
obj.Count = obj.Count + 1;
end
y = obj.Count;
end
end
end
properties (Dependent)
dependentprop
end
methods
function obj = MySaveLoader(varargin)
[email protected]();
setProperties(obj,nargin,varargin{:});
end
36-39
36 System object Usage and Authoring
end
% Serialization
methods (Access = protected)
function s = saveObjectImpl(obj)
% Call the base class method
s = [email protected](obj);
function loadObjectImpl(obj,s,isInUse)
% Load child System objects
obj.child = matlab.System.loadObject(s.child);
See Also
saveObjectImpl | loadObjectImpl
36-40
Define System Object Information
You can define your own info method to display specific information for your System object. The
default infoImpl method returns an empty struct. This infoImpl method returns detailed
information when info is called using info(x,'details') or only count information if it is called
using info(x).
properties
Threshold = 1
end
properties (DiscreteState)
Count
end
function resetImpl(obj)
obj.Count = 0;
end
function y = stepImpl(obj,u)
if (u > obj.Threshold)
obj.Count = obj.Count + 1;
end
y = obj.Count;
end
function s = infoImpl(obj,varargin)
if nargin>1 && strcmp('details',varargin(1))
s = struct('Name','Counter',...
'Properties', struct('CurrentCount', ...
obj.Count,'Threshold',obj.Threshold));
36-41
36 System object Usage and Authoring
else
s = struct('Count',obj.Count);
end
end
end
end
See Also
infoImpl
36-42
Handle Input Specification Changes
You can also restrict whether the input complexity, data type, or size can change while the object is in
use. Whichever aspects you restrict cannot change until after the user calls release.
This Counter System object restricts all three aspects of the input specification.
classdef Counter < matlab.System
%Counter Count values above a threshold
36-43
36 System object Usage and Authoring
properties
Threshold = 1
end
properties (DiscreteState)
Count
end
methods
function obj = Counter(varargin)
setProperties(obj,nargin,varargin{:});
end
end
methods (Access=protected)
function resetImpl(obj)
obj.Count = 0;
end
See Also
isInputSizeMutableImpl
Related Examples
• “What You Cannot Change While Your System Is Running” on page 36-9
36-44
Summary of Call Sequence
In this section...
“Setup Call Sequence” on page 36-45
“Running the Object or Step Call Sequence” on page 36-45
“Reset Method Call Sequence” on page 36-46
“Release Method Call Sequence” on page 36-47
The diagrams show an abstract view of which actions are performed when you call a System object.
The background color or each action indicates the type of call.
If you want a more detailed call sequence, see “Detailed Call Sequence” on page 36-48.
36-45
36 System object Usage and Authoring
36-46
Summary of Call Sequence
See Also
setupImpl | stepImpl | releaseImpl | resetImpl
Related Examples
• “Release System Object Resources” on page 36-22
• “Reset Algorithm State” on page 36-22
• “Set Property Values at Construction Time” on page 36-20
• “Define Basic System Objects” on page 36-11
36-47
36 System object Usage and Authoring
The call sequence diagrams show the order in which internal methods are called when you run the
specified method. If your System object does not overwrite a specified method, the default
implementation of that method is used.
If you want a more abstract view of the method calls, see “Summary of Call Sequence” on page 36-45.
1 If the System object is not in use (object was just created or was released),
Else, if the object is in use (object was called and release was not called)
i validatePropertiesImpl
36-48
Detailed Call Sequence
ii processTunedPropertiesImpl
b If the input size, data type, or complexity has changed
i validateInputsImpl
ii processInputSpecificationChangeImpl
1 If the object is in use (object was called and not released), call resetImpl
1 If the object is in use (object was called and not released), call releaseImpl
See Also
setupImpl | stepImpl | releaseImpl | resetImpl
Related Examples
• “Release System Object Resources” on page 36-22
• “Reset Algorithm State” on page 36-22
• “Set Property Values at Construction Time” on page 36-20
• “Define Basic System Objects” on page 36-11
36-49
36 System object Usage and Authoring
General
• Define all one-time calculations in the setupImpl method and cache the results in a private
property. Use the stepImpl method for repeated calculations.
• Specify Boolean values using true or false instead of 1 or 0, respectively.
• If the variables in a method do not need to retain their values between calls, use local scope for
those variables in that method.
In many examples, instead of passing in the object handle, ~ is used to indicate that the object handle
is not used in the function. Using ~ instead of an object handle prevents warnings about unused
variables.
Properties
• For properties that do not change, define them in as Nontunable properties. Tunable properties
have slower access times than Nontunable properties
• Whenever possible, use the protected or private attribute instead of the public attribute for
a property. Some public properties have slower access times than protected and private
properties.
• If properties are accessed more than once in the stepImpl method, cache those properties as
local variables inside the method. A typical example of multiple property access is a loop. Iterative
calculations using cached local variables run faster than calculations that must access the
properties of an object. When the calculations for the method complete, you can save the local
cached results back to the properties of that System object. Copy frequently used tunable
properties into private properties. This best practice also applies to the updateImpl and
outputImpl methods.
36-50
Tips for Defining System Objects
For example, in this code k is accessed multiple times in each loop iteration, but is saved to the
object property only once.
function y = stepImpl(obj,x)
k = obj.MyProp;
for p=1:100
y = k * x;
k = k + 0.1;
end
obj.MyProp = k;
end
• Default values of properties are shared across all instances of an object. Two instances of a class
can access the same default value if that property has not been overwritten by either instance.
Text Comparisons
Do not use character vector comparisons or character vector-based switch statements in the
stepImpl method. Instead, create a method handle in setupImpl. This handle points to a method in
the same class definition file. Use that handle in a loop in stepImpl.
This example shows how to use method handles and cached local variables in a loop to implement an
efficient object. In setupImpl, choose myMethod1 or myMethod2 based on a character vector
comparison and assign the method handle to the pMethodHandle property. Because there is a loop
in stepImpl, assign the pMethodHandle property to a local method handle, myFun, and then use
myFun inside the loop.
Simulink
For System objects being included in Simulink, add the StrictDefaults attribute. This attribute
sets all the MutableImpl methods to return false by default.
36-51
36 System object Usage and Authoring
Code Generation
For information about System objects and code generation, see “System Objects in MATLAB Code
Generation” (MATLAB Coder).
36-52
Insert System Object Code Using MATLAB Editor
To access the System object editing options, create a new System object, or open an existing one.
To add predefined code to your System object, select the code from the appropriate menu. For
example, when you click Insert Property > Numeric, the MATLAB Editor adds the following code:
properties(Nontunable)
Property
end
The MATLAB Editor inserts the new property with the default name Property, which you can
rename. If you have an existing properties group with the Nontunable attribute, the MATLAB Editor
inserts the new property into that group. If you do not have a property group, the MATLAB Editor
creates one with the correct attribute.
36-53
36 System object Usage and Authoring
Insert Options
Properties Properties of the System object: Numeric, Logical, Enumeration, Positive Integer, Tunable
Numeric, Private, Protected, and Custom. When you select Enumeration or Custom Properties, a
separate dialog box opens to guide you in creating these properties.
Methods Methods commonly used in System object definitions. The MATLAB Editor creates only the
method structure. You specify the actions of that method.
The Insert Method menu organizes methods by categories, such as Algorithm, Inputs and
Outputs, and Properties and States. When you select a method from the menu, the MATLAB
Editor inserts the method template in your System object code. In this example, selecting Insert
Method > Release resources inserts the following code:
function releaseImpl(obj)
% Release resources, such as file handles
end
If a method from the Insert Method menu is present in the System object code, that method is
shown shaded on the Insert Method menu:
36-54
Insert System Object Code Using MATLAB Editor
Inputs / Inputs, outputs, and related methods, such as Validate inputs and Disallow input size
Outputs changes.
When you select an input or output, the MATLAB Editor inserts the specified code in the
stepImpl method. In this example, selecting Insert > Input causes the MATLAB Editor to
insert the required input variable u2. The MATLAB Editor determines the variable name, but
you can change it after it is inserted.
function y = stepImpl(obj,u,u2)
% Implement algorithm. Calculate y as a function of
% input u and discrete states.
y = u;
end
• Fahrenheit
• Celsius
• Kelvin
7 Select Fahrenheit as the default value by clicking Default.
36-55
36 System object Usage and Authoring
In the System object class definition, the following code was added:
properties(Nontunable)
TemperatureUnit (1, 1) TemperatureUnitValues = TemperatureUnitValues.Fahrenheit
end
For more information on enumerations, see “Limit Property Values to Finite List” on page 36-28.
36-56
Insert System Object Code Using MATLAB Editor
4 Click Insert and the following code is inserted into the System object definition:
properties(Nontunable, Constant)
Property
end
5 Replace Property with your property.
properties(Nontunable, Constant)
FreezingPointFahrenheit = 32;
end
The MATLAB Editor inserts this code into the System object:
function validateInputsImpl(obj,u)
% Validate inputs to the step method at initialization
end
See Also
Related Examples
• “Analyze System Object Code” on page 36-58
36-57
36 System object Usage and Authoring
• Navigate to a specific input, output, property, state, or method by clicking the name of that
element.
• Expand or collapse element sections with the arrow buttons.
• Identify access levels for properties and custom methods with the + (public), # (protected), and –
(private) symbols.
36-58
Analyze System Object Code
The cursor in the MATLAB Editor window jumps to the resetImpl method.
See Also
Related Examples
• “Insert System Object Code Using MATLAB Editor” on page 36-53
36-59
36 System object Usage and Authoring
You set up and use global variables for the MATLAB System block in the same way as you do for the
MATLAB Function block (see “Data Stores” (Simulink) and “Share Data Globally” (Simulink)). Like
the MATLAB Function block, you must also use variable name matching with a Data Store Memory
block to use global variables in Simulink.
For example, this class definition file defines a System object that increments the first row of a matrix
by 1 at each time step. You must include getGlobalNamesImpl if the class file is P-coded.
This model includes the GlobalSysObjMatrix object in a MATLAB System block and the associated
Data Store Memory block.
36-60
Use Global Variables in System Objects
36-61
36 System object Usage and Authoring
36-62
Use Global Variables in System Objects
See Also
36-63
36 System object Usage and Authoring
Introduction
System objects are MATLAB classes that derive from matlab.System. As a result, System objects all
inherit a common public interface, which includes standard methods:
When you create new kinds of System objects, you provide specific implementations for all the
preceding methods to determine its behavior.
In this example, you create and use the movingAverageFilter System object.
movingAverageFilter is a System object that computes the unweighted mean of the previous
WindowLength input samples. WindowLength is the length of the moving average window.
movingAverageFilter accepts single-precision and double-precision 2-D input matrices. Each
column of the input matrix is treated as an independent (1-D) channel. The first dimension of the
input defines the length of the channel (or the input frame size). movingAverageFilter
independently computes the moving average of each input channel over time.
In the MATLAB Home tab, create a new System object class by selecting New > System Object >
Basic. The basic template for a System object opens in the MATLAB editor to guide you as you create
the movingAverageFilter System object.
Rename the class movingAverageFilter and save the file as movingAverageFilter.m. To ensure
you can use the System object, make sure you save the System object in a folder that is on the
MATLAB path.
For your convenience, a complete movingAverageFilter System object file is available with this
example. To open the completed class, enter:
edit movingAverageFilter.m
Add Properties
This System object needs four properties. First, add a public property WindowLength to control the
length of the moving average window. Because the algorithm depends on this value being constant
once data processing begins, the property is defined as nontunable. Additionally, the property only
accepts real, positive integers. To ensure input satisfies these conditions, add property validators (see
“Validate Property Values”). Set the default value of this property to 5.
properties(Nontunable)
WindowLength (1,1){mustBeInteger,mustBePositive} = 5
end
Second, add two properties called State and pNumChannels. Users should not access either
property, so use the Access = private attribute. State saves the state of the moving average
36-64
Create Moving Average System object
filter. pNumChannels stores the number of channels in your input. The value of this property is
determined from the number of columns in the input.
properties(Access = private)
State;
pNumChannels = -1;
end
Finally, you need a property to store the FIR numerator coefficients. Add a property called
pCoefficients. Because the coefficients do not change during data processing and you do not want
users of the System object to access the coefficients, set the property attributes as Nontunable,
Access = private.
The System object constructor is a method that has the same name as the class
(movingAverageFilter in this example). You implement a System object constructor to allow
name-value pair inputs to the System object with the setProperties method. For example, with the
constructor, users can use this syntax to create an instance of the System object: filter =
movingAverageFilter('WindowLength',10). Do not use the constructor for anything else. All
other setup tasks should be written in the setupImpl method.
methods
function obj = movingAverageFilter(varargin)
% Support name-value pair arguments when constructing object
setProperties(obj,nargin,varargin{:})
end
end
The setupImpl method sets up the object and implements one-time initialization tasks. For this
System object, modify the default setupImpl method to calculate the filter coefficients, the state,
and the number of channels. The filter coefficients are computed based on the specified
WindowLength. The filter state is initialized to zero. (Note that there are WindowLength-1 states
per input channel.) Finally, the number of channels is determined from the number of columns in the
input.
For setupImpl and all Impl methods, you must set the method attribute Access = protected
because users of the System object do not call these methods directly. Instead the back-end of the
System object calls these methods through other user-facing functions.
function setupImpl(obj,x)
% Perform one-time calculations, such as computing constants
obj.pNumChannels = size(x,2);
obj.pCoefficients = ones(1,obj.WindowLength)/obj.WindowLength;
obj.State = zeros(obj.WindowLength-1,obj.pNumChannels,'like',x);
end
36-65
36 System object Usage and Authoring
The object's algorithm is defined in the stepImpl method. The algorithm in stepImpl is executed
when the user of the System object calls the object at the command line. In this example, modify
stepImpl to calculate the output and update the object's state values using the filter function.
function y = stepImpl(obj,u)
[y,obj.State] = filter(obj.pCoefficients,1,u,obj.State);
end
The state reset equations are defined in the resetImpl method. In this example, reset states to zero.
Additionally, you need to add a releaseImpl method. From the Editor toolstrip, select Insert
Method > Release resources. The releaseImpl method is added to your System object. Modify
releaseImpl to set the number of channels to -1, which allows new input to be used with the filter.
function resetImpl(obj)
% Initialize / reset discrete-state properties
obj.State(:) = 0;
end
function releaseImpl(obj)
obj.pNumChannels = -1;
end
Validate Input
To validate inputs to your System object, you must implement a validateInputsImpl method. This
method validates inputs at initialization and at each subsequent call where the input attributes (such
as dimensions, data type, or complexity) change. From the toolstrip, select Insert Method >
Validate inputs. In the newly inserted validateInputsImpl method, call validateattributes
to ensure that the input is a 2-D matrix with floating-point data.
function validateInputsImpl(~, u)
validateattributes(u,{'double','single'}, {'2d',...
'nonsparse'},'','input');
end
When you save an instance of a System object, saveObjectImpl defines what property and state
values are saved in a MAT-file. If you do not define a saveObjectImpl method for your System
object class, only public properties and properties with the DiscreteState attribute are saved.
Select Insert Method > Save in MAT-file. Modify saveObjectImpl so that if the object is locked,
the coefficients and number of channels is saved.
function s = saveObjectImpl(obj)
s = [email protected](obj);
if isLocked(obj)
s.pCoefficients = obj.pCoefficients;
s.pNumChannels = obj.pNumChannels;
end
end
36-66
Create Moving Average System object
Method > Load from MAT-file. Modify loadObjectImpl so that if the object is locked, the
coefficients and number of channels are loaded.
function loadObjectImpl(obj,s,wasLocked)
if wasLocked
obj.pCoefficients = s.pCoefficients;
obj.pNumChannels = s.pNumChannels;
end
[email protected](obj,s,wasLocked);
end
Now that you have defined the System object, you can use the object in MATLAB. For example, use
movingAverageFilter to remove noise from a noisy pulse sequence.
movingAverageFilter = movingAverageFilter('WindowLength',10);
t = (1:250)';
signal = randn(250,1);
smoothedSignal = movingAverageFilter(signal);
plot(t,signal,t,smoothedSignal);
legend(["Input","Smoothed input"])
36-67
36 System object Usage and Authoring
To use your System object in Simulink, see “Create Moving Average Filter Block with System Object”
(Simulink).
36-68
Create New System Objects for File Input and Output
The objects discussed in this example address a number of realistic use cases, and they can be
customized to achieve more advanced and specialized tasks.
Introduction
System objects are MATLAB classes that derive from matlab.System. As a result, System objects all
inherit a common public interface, which includes standard methods:
When you create new kinds of System objects, you provide specific implementations for all the
preceding methods to determine its behavior.
In this example we discuss the internal structure and the use of the following two System objects:
• TextFileReader
• TextFileWriter
To create these System objects for streaming data in and out of MATLAB, this example uses standard
low-level file I/O functions available in MATLAB (like fscanf, fread, fprintf, and fwrite). By
abstracting away most usage details of those functions, they aim to make the task of reading and
writing streamed data simpler and more efficient.
This example includes the use of a number of advanced constructs to author System objects. For a
more basic introduction to authoring System objects, see “Create System Objects”.
The TextFileReader class includes a class definition, public and private properties, a constructor,
protected methods overridden from the matlab.System base class, and private methods. The
TextFileWriter class is similarly structured.
Class Definition
The class definition states that the TextFileReader class is derived from both matlab.System and
matlab.system.mixin.FiniteSource.
• matlab.System is required and is the base class for all System objects
• matlab.system.mixin.FiniteSource indicates this class is a signal source with a finite
number of data samples. For this type of class, in addition to the usual interface, the System
object will also expose the isDone function. When isDone returns true, the object reached the
end of the available data.
36-69
36 System object Usage and Authoring
Public Properties
Public properties can be changed by the user to adjust the behavior of the object to his or her
particular application. TextFileReader has two nontunable public properties (they can only be
changed before the first call to the object) and four tunable public properties. All the public
properties have a default value. Default values are assigned to the corresponding properties when
nothing else is specified by the user.
properties (Nontunable)
Filename = 'tempfile.txt'
HeaderLines = 4
end
properties
DataFormat = '%g'
Delimiter = ','
SamplesPerFrame = 1024
PlayCount = 1
end
Private Properties
Private properties are not visible to the user and can serve a number of purposes, including
• To hold values computed only occasionally, then used with subsequent calls to the algorithm. For
example, values used at initialization time, when setup is called or the object is called for the first
time. This can save recomputing them at runtime and improve the performance of the core
functionality
• To define the internal state of the object. For example, pNumEofReached stores the number of
times that the end-of-file indicator was reached:
properties(Access = private)
pFID = -1
pNumChannels
pLineFormat
pNumEofReached = 0
end
Constructor
The constructor is defined so that you can construct a TextFileReader object using name-value
pairs. The constructor is called when a new instance of TextDataReader is created. The call to
setProperties within the constructor allows setting properties with name-value pairs at
construction. No other initialization tasks should be specified in the constructor. Instead, use the
setupImpl method.
methods
function obj = TextFileReader(varargin)
setProperties(obj, nargin, varargin{:});
end
end
The public methods common to all System objects each have corresponding protected methods that
they call internally. The names of these protected methods all include an Impl postfix. They can be
implemented when defining the class to program the behavior of your System object.
36-70
Create New System Objects for File Input and Output
For more information on the correspondence between the standard public methods and their internal
implementations, please refer to “Summary of Call Sequence” on page 36-45.
• setupImpl
• resetImpl
• stepImpl
• releaseImpl
• isDoneImpl
• processTunedPropertiesImpl
• loadObjectImpl
• saveObjectImpl
Private Methods
Private methods are only accessible from within other methods of the same class. They can be used to
make the rest of the code more readable. They can also improve code reusability, by grouping under
separate routines code that is used multiple times in different parts of the class. For
TextFileReader, private methods are created for:
• getWorkingFID
• goToStartOfData
• peekCurrentLine
• lockNumberOfChannelsUsingCurrentLine
• readNDataRows
This example shows how you can use TextFileReader and TextFileWriter by:
• Creating a text file containing the samples of two different sinusoidal signals using
TextFileWriter
• Read from the text file using TextFileReader.
Create a new file to store two sinusoidal signals with frequencies of 50 Hz and 60 Hz. For each signal,
the data stored is composed of 800 samples at a sampling rate of 8 kHz.
fs = 8000;
tmax = 0.1;
t = (0:1/fs:tmax-1/fs)';
N = length(t);
f = [50,60];
data = sin(2*pi*t*f);
Form a header string to describe the data in a readable way for future use (optional step):
36-71
36 System object Usage and Authoring
To store the signal to a text file, create a TextFileWriter object. The constructor of
TextFileWriter needs the name of the target file and some optional parameters, which can be
passed in as name-value pairs.
TxtWriter = TextFileWriter('Filename','sinewaves.txt','Header',fileheader)
TxtWriter =
TextFileWriter with properties:
Filename: 'sinewaves.txt'
Header: 'The following contains 800 samples of two sinusoids,...'
DataFormat: '%.18g'
Delimiter: ','
TextFileWriter writes data to delimiter-separated ASCII files. Its public properties include:
• Filename — Name of the file to be written. If a file with this name already exists, it is
overwritten. When operations start, the object begins writing to the file immediately following the
header. The object then appends new data at each subsequent call to the object, until it is
released. Calling reset resumes writing from the beginning of the file.
• Header — Character string, often composed of multiple lines and terminated by a newline
character (\n). This is specified by the user and can be modified to embed human-readable
information that describes the actual data.
• DataFormat — Format used to store each data sample. This can take any value assignable as
Conversion Specifier within the formatSpec string used by the built-in MATLAB function
fprintf. DataFormat applies to all channels written to the file. The default value for this
property is '%.18g', which allows saving double precision floating point data in full precision.
• Delimiter — Character used to separate samples from different channels at the same time
instant. Every line of the written file maps to a time instant, and it includes as many samples as
the number of channels provided as input (in other words, the number of columns in the matrix
input passed to the object).
To write all the available data to the file, a single call to can be used.
TxtWriter(data)
The data is now stored in the new file. To visually inspect the file, type:
edit('sinewaves.txt')
Because the header takes up three lines, the data starts on line 4.
In this simple case, the length of the whole signal is small, and it fits comfortably on system memory.
Therefore, the data can be created all at once and written to a file in a single step.
There are cases when this approach is not possible or practical. For example, the data might be too
large to fit into a single MATLAB variable (too large to fit on system memory). Alternatively, the data
36-72
Create New System Objects for File Input and Output
might be created cyclically in a loop or streamed into MATLAB from an external source. In all these
cases, streaming the data into the file can be done with an approach similar to the following example.
Use a streamed sine wave generator to create a frame of data per loop. Run the desired number of
iterations to create the data and store it into the file:
frameLength = 32;
tmax = 10;
t = (0:1/fs:tmax-1/fs)';
N = length(t);
data = sin(2*pi*t*f);
numCycles = N/frameLength;
for k = 1:10 % Long running loop when you replace 10 with numCycles.
dataFrame = sin(2*pi*t*f);
TxtWriter(dataFrame)
end
release(TxtWriter)
TxtReader =
TextFileReader with properties:
Filename: 'sinewaves.txt'
HeaderLines: 3
DataFormat: '%g'
Delimiter: ','
SamplesPerFrame: 32
PlayCount: 1
TextFileReader reads numeric data from delimiter-separated ASCII files. Its properties are similar
to those of TextFileWriter. Some differences follow
• HeaderLines — Number of lines used by the header within the file specified in Filename. The
first call to the object starts reading from line number HeaderLines+1. Subsequent calls to the
object keep reading from the line immediately following the previously read line. Calling reset
will resume reading from line HeaderLines+1.
• Delimiter — Character used to separate samples from different channels at the same time
instant. In this case, the delimiter is also used to determine the number of data channels stored in
the file. When the object is first run, the object counts the number of Delimiter characters at
line HeaderLines+1, say numDel. Then for every time instant, the object reads numChan =
numDel+1 numeric values with format DataFormat. The matrix returned by the algorithm has
size SamplesPerFrame-by-numChan.
• SamplesPerFrame — Number of lines read by each call to the object. This value is also the
number of rows of the matrix returned as output. When the last available data rows are reached,
there might be fewer than the required SamplesPerFrame. In that case, the available data are
padded with zeros to obtain a matrix of size SamplesPerFrame-by-numChan. Once all the data
are read, the algorithm simply returns zeros(SamplesPerFrame,numChan) until reset or
release is called.
36-73
36 System object Usage and Authoring
• PlayCount — Number of times the data in the file is read cyclically. If the object reaches the end
of the file, and the file has not yet been read a number of times equal to PlayCount, reading
resumes from the beginning of the data (line HeaderLines+1). If the last lines of the file do not
provide enough samples to form a complete output matrix of size SamplesPerFrame-by-numChan,
then the frame is completed using the initial data. Once the file is read PlayCount times, the
output matrix returned by the algorithm is filled with zeros, and all calls to isDone return true
unless reset or release is called. To loop through the available data indefinitely, PlayCount
can be set to Inf.
To read the data from the text file, the more general streamed approach is used. This method of
reading data is also relevant to dealing with very large data files. Preallocate a data frame with
frameLength rows and 2 columns.
dataFrame = zeros(frameLength,2,'single');
Read from the text file and write to the binary file while data is present in the source text file. Notice
how the method isDone is used to control the execution of the while loop.
while(~isDone(TxtReader))
dataFrame(:) = TxtReader();
end
release(TxtReader)
Summary
This example illustrated how to author and use System objects to read from and write to numeric
data files. TextFileReader and TextFileWriter can be edited to perform special-purpose file
reading and writing operations. You can also combine these custom System objects with built-in
System objects such as dsp.BinaryFileWriter and dsp.BinaryFileReader.
For more information on authoring System objects for custom algorithms, see “Create System
Objects”.
See Also
More About
• “Create Moving Average System object” on page 36-64
• “Tips for Defining System Objects” on page 36-50
• “Define Basic System Objects” on page 36-11
36-74
Create Composite System object
The ability to create more than one instance of a System object and having each instance manage its
own state is one of the biggest advantages of using System objects over functions. The private
properties MovingAverageFilter1 and MovingAverageFilter2 are used to store the two moving
average filter objects.
properties (Access=private)
% This example class contains two moving average filters (more can be added
% in the same way)
MovingAverageFilter1
MovingAverageFilter2
end
In the setupImpl method, create the two moving average System objects and initialize their public
properties.
function setupImpl(obj,~)
% Set up moving average objects with default values
obj.MovingAverageFilter1 = movingAverageFilter('WindowLength',obj.WindowLength1);
obj.MovingAverageFilter2 = movingAverageFilter('WindowLength',obj.WindowLength2);
end
The WindowLength public property from the movingAverageFilter System object is implemented
as a dependent property in this example.
properties(Nontunable,Dependent)
% WindowLength Moving window length
WindowLength1;
WindowLength2;
end
Whenever you assign a value to one of the dependent properties, the value is set in the corresponding
moving average filter. When you read one of the dependent properties, the value is read from the
corresponding moving average filter.
function set.WindowLength1(obj,WindowLength1)
% Set the window length of one moving average filter
obj.MovingAverageFilter1.WindowLength = WindowLength1;
end
function WindowLength = get.WindowLength1(obj)
% Read window length from one of the moving average filters
WindowLength = obj.MovingAverageFilter1.WindowLength;
end
function set.WindowLength2(obj,WindowLength2)
36-75
36 System object Usage and Authoring
Create random variables to calculate the cross-correlation of their moving averages, then view the
results in a stem plot.
x = rand(20,1);
y = rand(20,1);
crossCorr = crossCorrelationMovingAverages('WindowLength1',1,'WindowLength2',5);
More About
• “Create Moving Average System object” on page 36-64
36-76
Create Composite System object
36-77