Accelerat ing t he world's research.

Ziziphus spina-christi fruit extract

suppresses oxidative stress and p38
MAPK expression in ulcerative colitis
i...
sahar mahmoud

Cite this paper Downloaded from Academia.edu 

Get the citation in MLA, APA, or Chicago styles

Related papers Download a PDF Pack of t he best relat ed papers 

T he Role of Diet ary Polyphenols in t he Management of Inflammat ory Bowel Disease

Mohammad Hosein Farzaei

Modulat ing effect of Biophyt um sensit ivum ext ract on rat s wit h acet ic acid-induced ulcerat ive colit is
Kunnat hur Murugesan Sakt hivel

Chronic administ rat ion of Abarema cochliacarpos at t enuat es colonic infl ammat ion in rat s
Maria Silene
 Food and Chemical Toxicology 115 (2018) 49–62

Contents lists available at ScienceDirect

Food and Chemical Toxicology

journal homepage: www.elsevier.com/locate/foodchemtox

T
Ziziphus spina-christi fruit extract suppresses oxidative stress and p38 MAPK
expression in ulcerative colitis in rats via induction of Nrf2 and HO-1
expression
Rafa S. Almeera, Sahar M. Mahmoudb, Hatem K. Aminc, Ahmed E. Abdel Moneimd,∗
a
Department of Zoology, College of Science, King Saud University, Riyadh, Saudi Arabia
b
Department of Zoology, Faculty of Science, Cairo University, Egypt
c
Department of Biochemistry and Molecular Biology, Faculty of Pharmacy, Helwan University, Cairo, Egypt
d
Department of Zoology and Entomology, Faculty of Science, Helwan University, Cairo, Egypt

A B S T R A C T

In this study, we aimed to evaluate the anti-inflammatory and protective effects of Ziziphus spina-christi fruit
extract (ZFE) against acetic acid (AcOH)-induced colitis in rats. Before a single AcOH instillation, ZFE (100, 200,
and 400 mg/kg/day) was administered for 5 days by oral gavage. Pretreatment with ZFE at different doses
suppressed the spread of inflammation and inhibited mucosal damage; in addition, it reduced ulcer size and
mitigated colitis markers. Administration of ZFE (400 mg/kg) resulted in a greater reduction of inflammatory
colonic injury than that after reference drug, mesalazine (MLZ), administration. In addition, ZFE not only his-
topathologically ameliorated AcOH-induced colitis but also restored the balance between the oxidants and an-
tioxidants. Furthermore, ZFE effectively modulated the mRNA expression of redox-sensitive transcription fac-
tors, such as nuclear factor (erythroid-derived 2)-like 2 and heme oxygenase-1, downregulated the expression of
p38 mitogen-activated protein kinase, and upregulated that of vascular endothelial growth factor A and inter-
leukin-1β in AcOH-induced colitis in rats. In conclusion, our results suggested that ZFE could prevent the de-
velopment of chronic experimental colitis in rats; therefore, it could be considered as an alternative and/or
additive therapeutic approach for the management of inflammatory bowel disease.

1. Introduction including 20293 IBD patients, revealed that most IBD patients die be-
cause of respiratory or circulatory problems (Chu et al., 2017). Al-
Ulcerative colitis (UC), a life-long recurrent relapsing-remitting though there is no permanent cure, FDA-approved drugs for UC treat-
disorder, is a type of debilitating chronic autoimmune inflammatory ment comprise different lines of drugs, including anti-inflammatory
bowel disease (IBD), which is associated with gastrointestinal symp- drugs, such as aminosalicylates and corticosteroids, and immune system
toms, such as bloody diarrhea and purulent stools, and extensive co- modulators, such as azathioprine and tumor necrosis factor-α (TNF-α)
lonic mucosal and submucosal damage (Hao et al., 2014; Malago and inhibitors. In addition, symptomatic treatments, such as antidiarrheals
Sangu, 2015; Podolsky, 2002). Millions of patients are diagnosed with and painkillers, are considered (Dubinsky, 2017).
UC worldwide, and the inpatient admission rate for UC patients from Unfortunately, the full etiology of UC is not completely understood.
1999 to 2007 was 50.6/100,000 (Al-Rejaie et al., 2013; Parmar et al., However, decreased antioxidant capacity, as well as enhanced genera-
2014). Untreated IBD has the potential to develop malignancy and life- tion of free radicals, such as reactive oxygen species (ROS) and reactive
threatening complications (Sturm et al., 2008). In England, a study, nitrogen species (RNS), is commonly associated with UC. Excessive free

Abbreviations: AcOH, acetic acid; ARE, antioxidant responsive element; Cas-3, caspase-3; CAT, catalase; CMIS, colonic mucosal injury score; COX, cyclooxygenase; GAPDH, glycer-
aldehyde 3-phosphate dehydrogenase; GRd, glutathione reductase; GPx, glutathione peroxidase; H&E, hematoxylin and eosin; HDI, histopathological damage index; HO-1, heme oxy-
genase-1; IBD, inflammatory bowel disease; IL-1β, interleukin-1β; iNOS, inducible nitric oxide synthase; LPO, lipid peroxidation; MAPK, mitogen-activated protein kinase; MDA, mal-
ondialdehyde; MLZ, mesalazine; MPO, myeloperoxidase; NADH, reduced nicotinamide adenine dinucleotide; NBT, nitroblue tetrazolium; NF-кB, nuclear factor kappa-B; Nrf2, nuclear
factor (erythroid-derived 2)-like 2; PAS/AB, periodic acid-Schiff/Alcian blue; PMS, phenazine methosulfate; SOD, superoxide dismutase; TBA, thiobarbituric acid; TNF-α, tumor necrosis
factor-α; UC, ulcerative colitis; VEGF, vascular endothelial growth factor; ZFE, Ziziphus spina-christi fruit extract
∗
Corresponding author.
E-mail addresses: [email protected] (R.S. Almeer), [email protected] (S.M. Mahmoud), [email protected] (H.K. Amin),
[email protected] (A.E. Abdel Moneim).

https://doi.org/10.1016/j.fct.2018.03.002

Available online 05 March 2018

Received 16 October 2017; Received in revised form 9 February 2018; Accepted 2 March 2018

0278-6915/ © 2018 Elsevier Ltd. All rights reserved.

R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

radical production results in considerable colonic inflammation. guidelines of the Department of Zoology, Faculty of Science, Helwan
Clinically, patients with colitis exhibit overproduction of ROS that have University. All animals were housed in cages in a controlled environ-
pivotal roles in UC pathogenesis. Furthermore, granulocytes migrate to ment of temperature (24 ± 2 °C) with 12 h light/dark cycle. They had
the mucosal layer and induce robust inflammation by secreting dif- access to standard rodent pellets and tap water ad libitum. Prior to co-
ferent inflammatory mediators, which lead to progressive injury. These litis induction, animals were fasted overnight with free access to water,
inflammatory mediators, such as TNF-α, inducible nitric oxide synthase whereas after induction of colitis, water and food were available ad
(iNOS), and IL-1β, are activated through the nuclear factor-kappa B libitum.
(NF-κB) pathway (Jang et al., 2013). In addition, mitogen-activated Rats were randomly divided into seven groups (7 rats/group), as
protein kinase (MAPK) signaling pathways play an important role in the follows: group (1), control rats without colitis treated orally with saline
inflammatory process and induce the release of proinflammatory cy- (0.9% NaCl solution); group (2), rats without colitis treated with ZFE
tokines (Jang et al., 2013). Hence, medications that can inhibit the (400 mg/kg); group (3), rats with colitis treated orally with saline;
production of proinflammatory cytokines and free radicals were shown groups (4, 5, and 6), rats with colitis treated orally with ZFE (100, 200,
to be clinically effective, indicating the contribution of proin- and 400 mg/kg, respectively); and group (7), rats with colitis treated
flammatory cytokines and free radicals to the aggravation of IBD and orally with mesalazine MLZ (300 mg/kg). All treatments were ad-
other chronic inflammatory conditions. ministered daily for five consecutive days before induction of UC using
Ziziphus spina-christi (common Persian name, “Konar” or “Sedr”) is AcOH.
an armed tree with edible sweet drupe fruits, grown widely in the south
of Iran. The leaves have been widely used in folk medicine as emollient, 2.4. Induction of colitis in rats
disinfectant, antiulcer, anti-inflammatory, hypoglycemic, antifungal,
antimicrobial, antihypertensive, hepatoprotective, antioxidant, anti- After overnight fast, rats were anesthetized with light ether in-
tumor, and immune system modulatory agents (Dkhil et al., 2018; spiration. First, the colons of rats were lavaged with 2 mL of saline
Guizani et al., 2013; Jafarian et al., 2014). The active constituents of followed by palpation of the lower abdomen to expel any remaining
Ziziphus spina-christi include triterpenoid sapogenins, geranyl acetate, feces. AcOH (2 mL, 4% v/v in 0.9% saline) was intrarectally injected for
sterols (such as β-sitosterol), saponins, (such as betulinic acid), methyl 30 s using a polyurethane cannula (2 mm in diameter) inserted through
hexadecanoate, peptide and cyclopeptide alkaloids (such as spinanine- the anus up to a distance of 6 cm. The rats were held in a head-down
A), methyl octadecanoate, tanines, and flavonoids (such as rutin and position for 2 min to prevent intracolonic AcOH leakage. In the normal
quercetin derivatives) (Jafarian et al., 2014). control and ZFE alone-treated groups (groups 1 and 2), rats were
In this study, we aimed to investigate the possible effects of Ziziphus treated with saline (2 mL) instead of AcOH. After 9 h, animals were
spina-christi fruit extract (ZFE) in acetic acid (AcOH)-induced UC in rats. sacrificed, and colon samples (5–6 cm) were collected, washed with
saline, imaged using a Samsung camera (WB30F, Japan), and weighed.
2. Materials and methods Parts (1 cm) of the colon samples were immediately fixed with 10%
formalin in phosphate-buffered saline (PBS) and embedded in paraffin
2.1. Plant materials and extract preparation for histopathological examination and immunohistochemical analyses.
The remaining parts were stored at −80 °C until analysis.
Ziziphus spina-christi fruits were purchased from a local hypermarket
in Cairo, Egypt. The fruits were identified, confirmed by a specialized 2.5. Histopathological and immunohistochemical studies
taxonomist (Department of Botany, Faculty of Science, Helwan
University, Egypt), and recorded under herbarium number (HCH Paraffin blocks of colon tissue specimens were sectioned at 4–5-μm
No.763) in the herbarium of the Department of Botany, Faculty of thickness and stained with hematoxylin and eosin (H&E) or periodic
Science, Helwan University. Ziziphus spina-christi fruits were cleaned acid-Schiff/Alcian blue (PAS/AB) stain for morphological studies.
using fresh tap water to remove dust and then air shade-dried. The Specific antibodies against cyclooxygenase (COX) II, NF-κB, TNF-α,
pericarps of the fruits were collected, cut into small pieces, and then phosphorylated p38 MAPK, vascular endothelial growth factor (VEGF),
ground into a mash using an electrical blender. They were extracted Bcl-2, Bax, and caspase-3 (Cas-3) were used for immunohistochemical
three times with 70% (v/v) methanol using the percolation method at analyses. In brief, 4-μm-thick sections were incubated in 10% normal
4 °C with frequent mixing. The collected extract was subsequently serum containing 1% bovine serum albumin in Tris-buffered saline for
evaporated to semi-dryness using a rotary vacuum evaporator (IKA, 2 h at 25 °C, and then incubated with 1% H2O2 for 15 min. They were
Germany) at 45 °C. Then, the residue was dissolved in distilled water, incubated with primary antibodies against COX-II, NF-κB, TNF-α, and
and kept at −20 °C. The contents of polyphenols and flavonoids in ZFE VEGF (dilution, 1:50; Santa Cruz Biotechnology, Santa Cruz, CA, USA)
were determined using standard protocols (Abdel Moneim, 2013). We overnight at 4 °C. For detection, a biotin-labeled rabbit anti-mouse
found that the content of polyphenols and flavonoids in ZFE ranged secondary antibody (Dako system kit) was added, followed by avidin/
from 74.6 to 58.7 mg gallic acid equivalent/g extract and 64.2 to biotin-peroxidase detection solution (Dako system kit). Colon speci-
47.3 mg quercetin equivalent/g extract, respectively. mens were counterstained with hematoxylin, dehydrated, and mounted
using Aquatex fluid (Merck KGaA, Germany).
2.2. HPLC analysis
2.6. Determination of the effects of ZFE on colonic mucosal injury score
The polyphenolic and flavonoid compounds in ZFE were determined (CMIS) and histopathological damage index (HDI)
using high-pressure liquid chromatography (HPLC, Perkin Elmer Series
200 liquid chromatography, PerkinElmer, USA) with a photodiode The severity of colitis was scored by two independent blinded ob-
array (PDA) detector, as previously described by Kadioglu et al. (2016). servers in terms of colonic mucosal injury score (CMIS) and histo-
pathological damage index (HDI).
2.3. Experimental animals The CMIS was assigned based on the following morphological fea-
tures using a scale ranging from 0 to 5, as follows: 0, no damage; 1, mild
Forty-nine, adult, male Wistar rats, weighing 200–225 g were used hyperemia with small edema and no corrosion or ulcer seen in the
in this study. They were handled in accordance with the National mucosal layer; 2, moderate hyperemia and edema with one corrosion
Institutes of Health (NIH) Guidelines for the Care and Use of Laboratory site in the mucosal layer; 3, moderate hyperemia and edema with two
Animals, 8th edition (NIH Publication No. 85-23, revised 1985) and the corrosion sites in the mucosal layer; 4, severe hyperemia and edema

50
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

Table 1
Primer sequences of genes analyzed in real time PCR.

Antisense (5′–3′) Sense (5′–3′) Accession number Name

GATGGTGATGGGTTTCCCGT GCATCTTCTTGTGCAGTGCC NM_017008.4 GAPDH

TCCACCACCCTTAGGGCTCA AGCTGCACCACAGCAAGCAC NM_001270850.1 SOD2
TCGAGCACGGTAGGGACAGTTCAC TCCGGGATCTTTTTAACGCCATTG NM_012520.2 CAT
ACACCGGGGACCAAATGATG CGGTTTCCCGTGCAATCAGT NM_017006.2 GPx1
GATCGCAACTGGGGTGAGAA TGCACTTCCCGGTAGGAAAC NM_053906.2 GRd
GGCTGGGAATATCCAGGGC GGTTGCCCACATTCCCAAAC NM_031789.2 Nrf2
GCTCAGGATGAGTACCTCCCA GCGAAACAAGCAGAACCCA NM_012580.2 HO-1
TGGGGGAACACAGTAATGGC GTTCCTCAGGCTTGGGTCTT NM_012611.3 iNOS
GGAGACTGCCCATTCTCGAC GACTTCACCATGGAACCCGT NM_031512.2 IL-1β
GCTTGGTGGTTTGCTACGAC AGAACTCAGCGAGGACACCAA XM_008772775.2 TNF-α
GCTTTCTGCTCCCCTTCTGT TTCGTCCAACTTCTGGGCTC NM_001110333.2 VEGF A
GGGTCGTGGTACTGAGCAAA ATAATGCGTCTGACGGGGAC NM_031020.2 MAPK14
GGTCTGCTGACCTCACTTGTG CTGGTGGACAACATCGCTCTG NM_016993.1 Bcl-2
ATGGTTCTGATCAGCTCGGG GGCGAATTGGCGATGAACTG NM_017059.2 Bax
TAACCGGGTGCGGTAGAGTA GAGCTTGGAACGCGAAGAAA NM_012922.2 Caspase 3

The abbreviations of the genes; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; SOD2: Manganese-dependent superoxide dismutase (MnSOD); CAT: Catalase; GPx1: Glutathione
peroxidase 1; GRd: Glutathione reductase; Nrf2: nuclear factor erythroid 2-related factor 2; HO-1: Heme oxygenase 1; iNOS: Inducible nitric oxide synthase; IL-1β: Interleukin 1 beta;
TNF-α: Tumor necrosis factor; VEGF A: Vascular endothelial growth factor A; MAPK14: Mitogen-activated protein kinase 14; Bcl-2: B-cell lymphoma 2; Bax: Bcl-2-like protein 4.

Fig. 1. HPLC profile of Zizyphus spina-christi fruit extract analyzed at 280 nm. The most abundant polyphenols and flavonoids were catechin, gallic acid, ellagic acid, chlorogenic acid,
rutin, isoquercitrin, quercetin, and kaempferol.

and inflammation covering the mucosal layer and the size of the major 2.8. Determination of oxidative stress markers and antioxidant enzyme
inflammation does not exceed 1 cm; and 5, severe hyperemia and activities
edema with swelling, bleeding, and inflammation covering the mucosal
layer, and the size of the major inflammation covers ˃ 1 cm. For the Parts of the colon tissue were homogenized in 50 mmol of Tris–HCl
HDI, we used the method modified by Mei et al. (2005), as follows: (1) buffer (pH 7.4), and protein concentration in the supernatants was
inflammatory cell infiltration and aggregation (0 for none or slight, 1 determined according to the Lowry method (1951). The resulting su-
for moderate, and 2 for severe); (2) epithelial damage (0 for none, 1 for pernatants were used for estimation of lipid peroxidation (LPO), in
mucosal damage, and 2 for mucosal and submucosal damage); (3) terms of malondialdehyde (MDA) formed based on the thiobarbituric
submucosal edema (0 for none, 1 for moderate, and 2 for severe); (4) acid (TBA) reaction assay, as previously described by Ohkawa et al.
epithelial necrosis (0 for none, 1 for moderate, and 2 for severe); and (1979). MDA concentrations were expressed as nmol/mg protein. Ni-
(5) epithelial ulcer (0 for negative and 1 for positive). trite/nitrate (nitric oxide; NO) levels were determined by adding the
Griess reagent (a mixture of naphthylene diamine dihydrochloride
(0.1%) and sulfanilamide [1% in 5% H3PO4]) for 10 min in dark at
2.7. Estimation of adherent colonic mucus concentration room temperature (Green et al., 1982), and the absorbance of the
formed bright reddish purple azo dye was measured at 515 nm. More-
Alcian blue was used to measure the concentration of adherent over, the content of reduced glutathione (GSH) was assayed, according
colonic mucosal mucus, according to the method described by Al-Rejaie to the method described by Sedlak and Lindsay (1968). Briefly, Ellman's
et al. (2013). Briefly, a small part of the colon was cut, weighed, and reagent (5,5-dithio-bis-(2-nitrobenzoic acid); DTNB) was added after
added immediately to 1% AB solution for 24 h. Excess AB was removed deproteinization of the sample, and the absorbance of the formed
by rinsing with 0.16 M sucrose solution. AB bound to the colonic wall yellow chromogen was measured spectrophotometrically at 412 nm.
mucus was extracted using 10 mL of 0.5 M MgCl2 solution. The intensity The colonic total thiol content (total-SH) was determined in the su-
of blue color in the extract was measured at 580 nm using a spectro- pernatants using Ellman's reagent, and the absorbance of the yellow
photometer (Jasco, V-630, Japan). The adherent colonic mucosal chromogen was measured spectrophotometrically at 412 nm.
mucus concentration was expressed as the quantity of AB extracted per The supernatants were used for determination of superoxide dis-
gram colon tissue (μg/g tissue). mutase (SOD) activity, as described by Nishikimi et al. (1972). The
reaction mixture consisted of nitroblue tetrazolium (NBT; 0.5 M),

51
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

Fig. 2. Effects of Ziziphus spina-christi fruit extract (ZFE) on (A) colon weight/length, (B) mucin concentration, (C) colonic mucosal injury score (CMIS), and (D) macroscopic appearance
of rat colon in acetic acid (AcOH)-induced colitis.
Results in (A) and (B) are expressed as the means ± SEM (n = 6) and analyzed using one-way analysis of variance followed by Duncan's post hoc test. ap < 0.05 vs. the control rats;
b
p < 0.05 vs. AcOH-treated rats.

reduced nicotinamide adenine dinucleotide (NADH, 0.78 M), and phe- the absorbance at 460 nm was recorded, and MPO activity was ex-
nazine methosulfate (PMS). The change in the absorbance was mon- pressed as U/mg protein.
itored at 560 nm, and SOD activity was expressed as U/min/mg protein.
Catalase (CAT) activity was determined according to the method de-
2.10. IL-1β assay
scribed by Aebi (1984), based on estimation of the decomposition rate
of H2O2 at 240 nm. CAT activity was expressed as nmol of H2O2 con-
IL-1β levels were measured using a commercial enzyme-linked im-
sumed/min/mg protein. Glutathione peroxidase (GPx) activity was
munosorbent assay (ELISA) kit (R&D System, Minneapolis, MN, USA),
determined spectrophotometrically using H2O2 as a substrate, as pre-
in accordance with the manufacturer's instructions. Colon supernatants
viously described by Paglia and Valentine (1967). GPx activity was
with protease inhibitor cocktail were used. IL-1β levels were normal-
determined in terms of the decrease in NADH per min using a reaction
ized to the protein content in the supernatant and expressed as pg/mg
coupled with glutathione reductase (GRd). The decrease in absorbance
protein.
at 340 nm was monitored, and GPx activity was expressed as U/mg
protein. In addition, GRd activity was estimated by quantifying glu-
tathione-dependent oxidation of NADPH at 340 nm and expressed as U/ 2.11. Real-time quantitative PCR
mg protein.
Total RNA was extracted, and first strand cDNA was synthesized as
described by Abdel Moneim (2016). The expression of oxidative stress
2.9. Myeloperoxidase (MPO) activity assay enzyme-encoding genes (SOD2, CAT, GPx1, GRd, nuclear factor (ery-
throid-derived 2)-like 2 [Nrf2], and heme oxygenase-1 [HO-1]), in-
MPO activity was determined based on the modified method de- flammatory response-related genes (IL-1β, iNOS, and TNF-α), apop-
scribed by Bradley et al. (1982). After three freeze-thaw cycles of the tosis-related genes (Bcl-2, Bax, and Cas-3), p38 MAPK, and VEGF-A was
homogenate and centrifugation at 10,000×g for 10 min at 4 °C, MPO determined using real-time quantitative reverse transcription poly-
activity was determined by mixing 0.1 mL of the supernatant with merase chain reaction (qRT-PCR) technique using an Applied Biosys-
2.9 mL of 0.05 M phosphate buffer (pH 6) and 1 mL of 1.6 mM o-dia- tems 7500 Instrument. The thermal conditions for qRT-PCR were 95 °C
nisidine hydrochloride containing 0.0005% (v/v) H2O2. The change in for 4 min, followed by 40 cycles of 94 °C for 60 s and 55 °C for 60 s, and

52
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

Fig. 3. Effects of Ziziphus spina-christi fruit extract (ZFE) on histopathological injury in the colon of rats treated intrarectally with acetic acid (AcOH); adherent colonic mucus (A) and (B)
PAS-alcian blue reaction of the colon mucosa of rats. (A) The colon of control rats showed normal structure of the mucosa with intact epithelial cells, submucosa, and muscularis layers,
(B) colon of ZFE (400 mg/kg) alone-treated rats showed no histological changes in colon layers, (C) colon of rats damaged by acetic acid showed marked mucosal damage with severe
hemorrhage, (D) colon of rats treated with mesalazine (300 mg/kg) before intracolonic acetic acid administration preserved the normal architecture of the colonic layers with no distinct
damage, (E) colon of rats treated with ZFE (100 mg/kg) before intracolonic acetic administration revealed moderate pathological changes with some inflammatory cell infiltration and
less colonic layer preservation, (F) colon of rats treated with ZFE (200 mg/kg) before intracolonic acetic acid administration showed less pathological changes with reduced inflammatory
cell infiltration and good colonic layer preservation, and (H) colon of rats treated with ZFE (400 mg/kg) before intracolonic acetic acid administration showed less pathological changes
with diminished inflammatory cell infiltration and marked colonic layer preservation.

53
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

Fig. 4. Effects of Ziziphus spina-christi fruit extract (ZFE) on lipid peroxidation, nitric oxide, glutathione, and total-thiol levels and myeloperoxidase activity in the colon of rats treated
intrarectally with acetic acid (AcOH). Results are expressed as the means ± SEM of 7 rats. ap < 0.05 vs. the control rats; bp < 0.05 vs. the AcOH-treated rats using Duncan's post hoc test.

then a final extension at 72 °C for 10 min. After PCR amplification, the SPSS, version 17.0. A p-value ˂ 0.05 was considered statistically sig-
ΔCt from triplicate experiments was calculated by subtracting the value nificant.
of the reference gene, glyceraldehyde 3-phosphate dehydrogenase
(GAPDH; Ct) from that of each sample (Ct). The sequences of primers of 3. Results
different genes are provided in Table 1.
3.1. HPLC profile of ZFE
2.12. Statistical analysis
The HPLC fingerprint of ZFE revealed the presence of eleven peaks
All data are expressed as the means ± standard error of the mean with retention times ranging from 4.14 to 31.57 min (Fig. 1). Based on
(SEM). One-way analysis of variance (ANOVA) was used to compare the UV-Visible spectral data and retention times, ZFE showed the UV
between the control and treatment groups using the statistical package bands and λmax (280 nm) characteristic for catechin, gallic acid, ellagic

54
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

Fig. 5. Effects of Ziziphus spina-christi fruit extract (ZFE) on the activity and mRNA expression of superoxide dismutase, catalase, glutathione peroxidase, and glutathione reductase in the
colon of rats treated intrarectally with acetic acid (AcOH).
Results of antioxidant activities are expressed as the means ± SEM of 7 rats, whereas results of mRNA expression (means ± SEM of three assays) were normalized to the gapdh mRNA
level and expressed as fold induction (log2 scale), relative to the mRNA level in the control. Sod2, superoxide dismutase 2; Gpx1, glutathione peroxidase 1. ap < 0.05 vs. the control rats;
b
p < 0.05 vs. the AcOH-treated rats using Duncan's post hoc test.

55
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

Fig. 6. Effects of Ziziphus spina-christi fruit extract (ZFE) on

the gene expression of nuclear factor (erythroid-derived 2)-
like 2 (Nrf2) and heme oxygenase-1 (HO-1) in the colon of
rats treated intrarectally with acetic acid (AcOH).
Results (means ± SEM of three assays) were normalized to
the gapdh mRNA level and expressed as fold induction (log2
scale), relative to the mRNA level in the control. ap < 0.05
vs. the control rats; bp < 0.05 vs. the AcOH-treated rats
using Duncan's post hoc test.

Fig. 7. Effects of Ziziphus spina-christi fruit extract (ZFE) on the levels of interleukin-1β and gene expression of inflammatory markers in the colon of rats treated intrarectally with acetic
acid (AcOH).
Results of interleukin-1β levels are expressed as the means ± SEM of 7 rats, whereas results of mRNA expression (means ± SEM of three assays) were normalized to the gapdh mRNA
level and expressed as fold induction (log2 scale), relative to the mRNA level in the control. IL-1β, interleukin-1β; TNF-α, tumor necrosis factor-α; iNOS, inducible nitric oxide synthase.
a
p < 0.05 vs. the control rats; bp < 0.05 vs. the AcOH-treated rats using Duncan's post hoc test.

acid, chlorogenic acid, rutin, isoquercitrin, quercetin, and kaempferol. for 5 days significantly prevented the increase in weight/length com-
pared to that in the AcOH-treated group (P < 0.05; Fig. 2A). Mucin
concentration markedly decreased in the AcOH-injected group com-
3.2. Effects of ZFE on the macroscopic and microscopic features in rat colitis pared to that of the control rats (P < 0.01). Pre-administration of ZFE
at 100, 200, and 400 mg/kg significantly prevented the decrease in
Colonic instillation of AcOH resulted in a significant elevation of colonic mucin concentration compared to that in the AcOH-treated
colonic weight/length compared to that of the control group group (Fig. 2B). Interestingly, mucin concentration increased in the
(P < 0.01). Pre-administration of ZFE at three different doses or MLZ

56
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

Fig. 8. Effects of Ziziphus spina-christi fruit extract (ZFE) on the protein expression of cyclooxygenase-2 (COX-II), nuclear factor kappa-B (NF-κB), tumor necrosis factor-α (TNF-α) and
vascular endothelial growth factor (VEGF) in the colon of rats treated intrarectally with acetic acid (AcOH). (magnification, 100×).

saline- and ZFE alone-treated rats. Images of the control and ZFE alone- Interestingly, the effects of ZFE at 400 mg/kg were stronger than those
treated rats showed normal colonic structure; however, AcOH injection of MLZ, a standard drug used for the treatment of colitis (Fig. 2D).
resulted in induction of ulceration, as evident from necrosis, corrosion, Treatment of the rats with AcOH induced acute colitis. Six hours
and ulceration. Rats pretreated with ZFE at the high doses (200 and post intracolonic injection of AcOH, rats experienced hemorrhagic
400 mg/kg) or MLZ showed less severe necrosis, corrosion, and ul- diarrhea and general weakness. AcOH caused severe microscopic
ceration compared to those observed in the AcOH-treated rats (Fig. 2D). changes, including severe necrosis, edema, focal infiltration of in-
Consistent with the morphological findings, colitis-related damage was flammatory cells, and erosion of the mucosal layer resulting in des-
evident in the AcOH-treated rats. Pre-administration of ZFE (100, 200, quamation and loss of the colonic epithelium. Some crypts lost their
and 400 mg/kg) suppressed the spread of inflammation and mucosal architecture with surface epithelial loss, whereas the remaining crypts
damage; in addition, it reduced ulcer size and colitis marker levels. lost the lamina propria that characterizes the normal crypts (Fig. 3C, top

57
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

Fig. 9. Effects of Ziziphus spina-christi fruit extract

(ZFE) on the gene expression of p38 mitogen-ac-
tivated protein kinase (p38 MAPK) and vascular
endothelial growth factor A (VEGF-A) in the
colon of rats treated intrarectally with acetic acid
(AcOH).
Results (means ± SEM of three assays) were
normalized to the gapdh mRNA level and ex-
pressed as fold induction (log2 scale), relative to
the mRNA level in the control. ap < 0.05 vs. the
control rats; bp < 0.05 vs. the AcOH-treated rats
using Duncan's post hoc test.

panel). The AcOH-treated group exhibited the highest HDI among the whereas the antioxidant capacity of ZFE is more likely to contribute to
other groups (Fig. 3, middle panel). Oral administration of ZFE (100 its effects.
and 200 mg/kg) failed to prevent the damage, where both groups had qRT-PCR analysis was also performed to evaluate the involvement
higher HDI than that of the control group. However, both doses (100 of the Nrf2/HO-1 signaling pathway in the colon-protective activity of
and 200 mg/kg) could decrease the infiltration of inflammatory cells. ZFE. Nrf2 expression was significantly diminished in AcOH-induced
Interestingly, pretreatment of the rats with ZFE at 400 mg/kg com- colitis in rats, whereas the decrease in HO-1 expression did not reach
pletely prevented AcOH-induced colitis, as evident from the intact statistical significance (Fig. 6). However, ZFE pretreatment prevented
structure of the colonic mucosa, tidy arrangement of the epithelium, the decrease in HO-1 expression in the colon at all doses tested. qRT-
and normal shape of the crypts (Fig. 3E, top panel). Although MLZ PCR analysis also revealed that MLZ pretreatment had no effect on the
(300 mg/kg) administration offered marked protection to the colonic Nrf2/HO-1 signaling pathway.
structure, ZFE at 400 mg/kg was more potent than MLZ, which did not
prevent some inflammatory responses in the mucosa (Fig. 3F, top
panel). 3.4. Effects of ZFE on the markers of inflammation and apoptosis in rat
Furthermore, PAS/AB staining of mucus confirmed the protective colitis
effects of ZFE. PAS/AB staining was observed in the mucosa and within
the cecal lumen of the control and ZFE alone-treated rats (Fig. 3A and B, The mRNA expression of IL-1β, iNOS, and TNF-α was measured
respectively, bottom panel). However, the intensity of PAS/AB staining using qRT-PCR to evaluate the anti-inflammatory activity of ZFE
markedly decreased in the AcOH-treated rats, suggesting the loss of (Fig. 7). A striking elevation in IL-1β levels was observed in AcOH-
Goblet cells (Fig. 3C, bottom panel). In contrast, the intensity of PAS/ induced UC; in addition, the mRNA expression of IL-1β, iNOS, and TNF-
AB staining increased in all the treated groups, particularly in the ZFE α was markedly elevated in the AcOH-induced colitis group compared
(400 mg/kg)-treated rats, indicating amelioration of colitis in rats. to that of the control group. However, ZFE pretreatment prevented the
increase in proinflammatory cytokine levels and dose-dependently in-
hibited the elevation of inflammatory marker mRNA expression, sug-
3.3. Effects of ZFE on oxidant/antioxidant status in rat colitis gesting that ZFE could prevent colonic inflammation and mucosal in-
jury.
Moreover, AcOH-induced colitis was characterized by induction of Immunohistochemical examination revealed that intracolonic in-
oxidative stress, as evidenced by the increase in LPO, NO levels, and jection of AcOH in rats induced a robust inflammatory response, as
MPO activity, compared to the observations in the control group. ZFE evidenced by the strong and widespread immunoreactivity against TNF-
pretreatment resulted in a significant decrease in LPO, NO levels, and α, COX-2, and NF-κB in the colon (Fig. 8). Rats pretreated with ZFE or
MPO activity in a dose-dependent manner compared to those in the MLZ displayed lower expression of TNF-α, COX-2, and NF-κB, than that
colitis model group. In addition, AcOH administration decreased colon in the AcOH-treated rats.
total-SH and GSH contents; however, pretreatment with ZFE at 100, To elucidate the mechanism(s) underlying the anti-inflammatory
200, and 400 mg/kg daily for 5 days effectively suppressed the colon activity of ZFE, p38 MAPK and VEGF-A expression was determined.
mucosal oxidative damage, as evident from the increase in GSH and Pretreatment with ZFE could downregulate p38 MAPK and VEGF-A
total-SH levels (Fig. 4). Interestingly, ZFE at the highest dose was more expression. However, the decrease in p38 MAPK expression does not
effective than MLZ. necessarily reflect inhibition of inflammation since inhibition of its
Deficiency in mucosal antioxidant defenses is a leading factor that phosphorylation is also essential. Hence, we measured the phosphor-
contributes to the severity of UC since oxidative stress in the mucosa is ylation of p38 MAPK. As shown in Fig. 10, compared to the AcOH-
associated with inflammation and colitis progression. Herein, AcOH treated group, ZFE pre-administration markedly blocked AcOH-induced
caused a significant decrease in SOD, CAT, GRd, and GPx activities, as phosphorylation of p38 MAPK. Suppression of p38 MAPK expression in
shown by both the biochemical and molecular analyses (Fig. 5). In AcOH-treated rats could block the overexpression of one or more
contrast, ZFE-pretreated rats exhibited higher activities of the anti- proinflammatory cytokines (Fig. 9).
oxidant enzymes, SOD, CAT, GPx, and GRd, than those in the AcOH- Furthermore, Bcl-2, Bax, and Cas-3 expression was evaluated using
treated rats. Importantly, there were no significant differences in anti- immunohistochemistry and qRT-PCR to investigate whether ZFE ex-
oxidant enzyme activities between the AcOH- and MLZ-treated groups, hibited antiapoptotic effects. Pretreatment with ZFE downregulated Bax
suggesting that the standard drug did not have antioxidant activity, and Cas-3 expression and upregulated Bcl-2 expression (Figs. 10 and

58
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

Fig. 10. Effects of Ziziphus spina-christi fruit extract (ZFE) on the protein expression of phosphorylated p38 mitogen-activated protein kinase (p-p38), B-cell lymphoma 2 (Bcl-2), Bcl-2-
associated X (Bax), and caspases-3 (Cas-3) in the colon of rats treated intrarectally with acetic acid (AcOH). (magnification, 100×).

11). In particular, the 400 mg/kg dose of ZFE was the most effective in immunosuppressants. However, these drugs are associated with serious
inhibiting apoptosis. adverse effects (Dugani et al., 2016).
MLZ is the first-line therapy for UC; it acts via inhibition of the
4. Discussion production of inflammatory mediators, such as TNF, plasma cell anti-
body, and IL-1, as well as scavenging of free oxygen radicals. Its long-
Ulcerative colitis is a chronic IBD with relapsing intestinal disorders, term administration might lead to worsening of colitis and other serious
resulting from colonic mucosal damage. Oxidative stress and in- side effects, such as nausea, vomiting, nephrotoxicity, hepatotoxicity,
flammatory responses play major roles in the disease progression. pericarditis, and pancreatitis. These side effects raised the demand for
Currently, the clinical management of IBD is based on using anti-in- alternative and/or supportive therapeutic agents (Williams et al.,
flammatory drugs, such as corticosteroids, aminosalicylates, and 2011).

59
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

Fig. 11. Effects of Ziziphus spina-christi fruit extract (ZFE) on the gene expression of caspase 3, Bax, and Bcl2 in the colon of rats treated intrarectally with acetic acid (AcOH).
Results (means ± SEM of three assays) were normalized to the gapdh mRNA level and expressed as fold induction (log2 scale), relative to the mRNA level in the control. ap < 0.05 vs. the
control rats; bp < 0.05 vs. the AcOH-treated rats using Duncan's post hoc test.

Fig. 12. A summary schematic demonstrating the major signaling pathways that participate in ZFE protects against acetic acid (AcOH)-induced ulcerative colitis in rats. Signaling
pathways involved are suppression of oxidative stress (MDA), apoptosis (Bax, Cas-3) and inflammation (NO, iNOS, MPO, NF-κB, IL-1β, TNF-α, MAPK, VEGF-A) and activation of
antioxidants (GSH, Total-SH SOD, CAT, GRd, GPx, HO-1, Nrf2) and anti-apoptosis (Bcl-2).

Morphological examination of colon damage markers revealed that hypothesis is supported by the histopathological results showing epi-
intracolonic AcOH injection induced edema (increased colonic weight), thelial cell necrosis, edema, and leukocyte infiltration in the colon. The
congestion, erosion, and ulceration because of activation of in- overproduction of inflammatory mediators might be attributed to ac-
flammatory responses, which reflect the disease severity and extent tivation of the MAPK pathway. p38 MAPK mediates inflammation by
(Dugani et al., 2016). In the current study, AcOH significantly reduced activating neutrophils; moreover, the secreted proinflammatory cyto-
mucin concentration. Mucin is well known to protect the epithelium kines by the stimulated neutrophils, in turn, activate p38 MAPK.
from chemical-induced damage. ZFE at 400 mg/kg effectively inhibited Therefore, phosphorylation of p38 MAPK plays an important role in
mucin depletion, suggesting that ZFE exhibited anti-inflammatory ac- amplifying and sustaining the inflammatory reaction, leading to con-
tivity. tinuous inflammation and tissue damage. The p38 MAPK pathway is
Intracolonic AcOH instillation significantly induced histopatholo- activated in IBD, and p38 MAPK inhibitors have been shown to be ef-
gical changes associated with infiltration of inflammatory cells. fective in inhibiting the production of proinflammatory cytokines, such
Mobilization of granulocytes and macrophages to the inflamed epithe- as ILs and NF-κB. Atreya et al. (2008) showed that NF-κB is a central
lial layer results in overproduction of proinflammatory mediators, such effector of gastrointestinal inflammation via induction of transcription
as MPO, IL-1β, and TNF-α, which suggest the role of these in- of not only many proinflammatory cytokines, including TNF-α and ILs,
flammatory mediators in the pathogenesis of UC. Furthermore, this but also proinflammatory proteins, such as COX-2 and iNOS. Herein,

60
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

ZFE effectively downregulated p38 MAPK mRNA expression. The MAPK stimulating the cellular antioxidant mechanisms; in addition, it sig-
signaling pathway is very closely related to inflammatory responses and nificantly decreased iNOS expression (Fig. 12). The second pathway
involved in modifying inflammatory mediator expression. Our results was the anti-inflammatory activity, where ZFE significantly increased
suggested that ZFE could suppress proinflammatory cytokine produc- HO-1 expression and decreased inflammatory mediator (TNF-α and IL-
tion via blocking of the activation of the MAPK signaling pathway (Shi 1β) levels. Finally, the third pathway involved inhibition of apoptosis,
et al., 2016). as evidenced by the significant decrease in Bax and Cas-3 expression
In the present study, VEGF-A protein expression was upregulated in and increase in Bcl-2 expression.
AcOH-treated rats. VEGF-A, a key mediator of angiogenesis in UC, has In conclusion, ZFE showed pronounced protective effects against
been found to be upregulated in the sera of patients with UC and in AcOH-induced UC in rats. It prevented the histopathological changes
experimental animals with UC (Bousvaros et al., 1999; Cromer et al., through its antioxidant, anti-inflammatory, and anti-apoptotic effects.
2013). Angiogenesis during UC results in inflamed blood vessels that However, further studies on human subjects are required to evaluate
increase disease activity and progression through recruitment of im- the effects of ZFE as an alternative and/or additive therapy for the
mune cells, secretion of proinflammatory mediators, and increase in management of UC.
microvascular and epithelial permeability (Deban et al., 2008). The
increase in blood vessel density that accompanies UC is predictive of Conflicts of interest
the disease severity, and inhibition of intestinal microvasculature ex-
pansion in UC has been shown to protect against experimental UC The authors declare that they have no conflicts of interest.
(Scaldaferri et al., 2009). Studies using animal models of UC have
shown that attenuation of VEGF-A signaling inhibits disease activity, Acknowledgments
whereas increased levels of VEGF-A exacerbate disease severity. In this
study, we found that pretreatment with ZFE markedly downregulated This research project was supported by a grant from the “Research
VEGF-A expression in a dose-dependent manner. Center of the Center of Female Scientific and Medical Colleges”,
Oxidative stress and imbalance between oxidants and antioxidants Deanship of Scientific Research, King Saud University, Riyadh, Saudi
is well known to play a crucial role in the pathophysiology of UC (Aleisa Arabia.
et al., 2014). AcOH administration in rats caused oxidative damage. In
animal models and patients with UC, the levels of free radicals in- Appendix A. Supplementary data
creased in colon tissue specimens. Overproduction of free radicals in the
colon adversely affects the proteins and nucleic acids (Bitiren et al., Supplementary data related to this article can be found at http://dx.
2010; Pavlick et al., 2002). Antioxidant enzymes (SOD, CAT, GPx, and doi.org/10.1016/j.fct.2018.03.002.
GRd), as well as the non-enzymatic antioxidant sulfhydryl groups play a
major role in the defense against the excess free radicals produced in References
disease conditions (Aleisa et al., 2014). In the current study, the ac-
tivities of the antioxidant enzymes, as well as the levels of GSH and Abdel Moneim, A.E., 2013. The neuroprotective effects of purslane (Portulaca oleracea)
total-SH were markedly diminished in the colon following AcOH in- on rotenone-induced biochemical changes and apoptosis in brain of rat. CNS Neurol.
Disord. - Drug Targets 12, 830–841.
jection, which clearly suggested the role of oxidative stress in colon Abdel Moneim, A.E., 2016. Indigofera oblongifolia prevents lead acetate-induced hepa-
tissue damage. totoxicity, oxidative stress, fibrosis and apoptosis in rats. PLoS One 11 e0158965.
Furthermore, UC was associated with downregulation of Nrf2 and Aebi, H., 1984. Catalase in vitro. Methods Enzymol. 105, 121–126.
Al-Rejaie, S.S., Abuohashish, H.M., Al-Enazi, M.M., Al-Assaf, A.H., Parmar, M.Y., Ahmed,
HO-1 expression. Nrf2 is a basic leucine zipper redox-sensitive tran- M.M., 2013. Protective effect of naringenin on acetic acid-induced ulcerative colitis
scription factor, and the Nrf2/antioxidant responsive element (ARE) in rats. World J. Gastroenterol. 19, 5633–5644.
pathway is an important protective mechanism against oxidative stress Aleisa, A.M., Al-Rejaie, S.S., Abuohashish, H.M., Ola, M.S., Parmar, M.Y., Ahmed, M.M.,
2014. Pretreatment of Gymnema sylvestre revealed the protection against acetic acid-
(Khodir et al., 2017). Lu et al. (2016) found that activation of the Nrf2 induced ulcerative colitis in rats. BMC Compl. Alternative Med. 14, 49.
pathway might be beneficial in attenuating or treating UC. HO-1 is one Araki, Y., Mukaisyo, K., Sugihara, H., Fujiyama, Y., Hattori, T., 2010. Increased apoptosis
of the ARE genes, which has a pivotal role in the defense against cel- and decreased proliferation of colonic epithelium in dextran sulfate sodium-induced
colitis in mice. Oncol. Rep. 24, 869–874.
lular oxidative stress and inflammation. Zhang et al. (2014) showed
Atreya, I., Atreya, R., Neurath, M.F., 2008. NF-kappaB in inflammatory bowel disease. J.
that HO-1 might be a novel therapeutic target in IBD. Intern. Med. 263, 591–596.
In the present study, AcOH intrarectal injection induced apoptosis, Bitiren, M., Karakilcik, A.Z., Zerin, M., Ozardali, I., Selek, S., Nazligul, Y., Ozgonul, A.,
one form of programmed cell death. Increased apoptosis has been found Musa, D., Uzunkoy, A., 2010. Protective effects of selenium and vitamin E combi-
nation on experimental colitis in blood plasma and colon of rats. Biol. Trace Elem.
in the intestinal epithelium of patients with IBD (Nunes et al., 2014). Res. 136, 87–95.
Iwamoto et al. (1996) showed that apoptotic features were found in the Bousvaros, A., Leichtner, A., Zurakowski, D., Kwon, J., Law, T., Keough, K., Fishman, S.,
crypts of active UC, suggesting that loss of the epithelial cells occurred 1999. Elevated serum vascular endothelial growth factor in children and young
adults with Crohn's disease. Dig. Dis. Sci. 44, 424–430.
mainly by apoptosis in the involved areas, such as the intestine, as well Bradley, P.P., Priebat, D.A., Christensen, R.D., Rothstein, G., 1982. Measurement of cu-
as in the adjacent uninvolved areas. Araki et al. (2010) also reported taneous inflammation: estimation of neutrophil content with an enzyme marker. J.
that the increase in apoptosis and decrease in proliferation might lead Invest. Dermatol. 78, 206–209.
Chu, T.P.C., Moran, G.W., Card, T.R., 2017. The pattern of underlying cause of death in
to breakdown of the epithelial barrier function, and thus might accel- patients with inflammatory bowel disease in england: a record linkage study. J
erate mucosal damage in experimental colitis. Results of the current Crohns Colitis 11, 578–585.
study showed that ZFE pretreatment resulted in a significant decrease in Cromer, W.E., Ganta, C.V., Patel, M., Traylor, J., Kevil, C.G., Alexander, J.S., Mathis, J.M.,
2013. VEGF-A isoform modulation in an preclinical TNBS model of ulcerative colitis:
the mRNA expression of Bax and Cas-3 and increase in that of Bcl-2,
protective effects of a VEGF164b therapy. J. Transl. Med. 11, 207.
revealing that ZFE might suppress colonic ulceration via inhibition of Deban, L., Correale, C., Vetrano, S., Malesci, A., Danese, S., 2008. Multiple pathogenic
apoptosis. roles of microvasculature in inflammatory bowel disease: a Jack of all trades. Am. J.
Pathol. 172, 1457–1466.
This study showed that ZFE (400 mg/kg) exhibited stronger ther-
Dkhil, M.A., Al-Quraishy, S., Moneim, A.E.A., 2018. Ziziphus spina-christileaf extract
apeutic effects in rats with AcOH-induced UC than in those treated with pretreatment inhibits liver and spleen injury in a mouse model of sepsis via anti-
MLZ (300 mg/kg). The effects of ZFE might be attributed to interference oxidant and anti-inflammatory effects. Inflammopharmacology. http://dx.doi.org/
with three different processes (oxidative stress, inflammation, and 10.1007/s10787-017-0439-8.
Dubinsky, M.C., 2017. Reviewing treatments and outcomes in the evolving landscape of
apoptosis). The first pathway involved the antioxidant and free radical- ulcerative colitis. Postgrad. Med. 1–16.
scavenging effects, supported by the findings that ZFE significantly Dugani, A., Dakhil, B., Treesh, S., 2016. Protective effect of the methanolic extract of
increased SOD, CAT, GPx1, GRd, and Nrf2 levels/expression, thus malva parviflora l. leaves on acetic acid-induced ulcerative colitis in rats. Saudi J.

61
R.S. Almeer et al. Food and Chemical Toxicology 115 (2018) 49–62

Gastroenterol. 22, 226–233. in experimental colitis and its inhibition by melatonin in vivo and in vitro. Postgrad.
Green, L.C., Wagner, D.A., Glogowski, J., Skipper, P.L., Wishnok, J.S., Tannenbaum, S.R., Med. J. 81, 667–672.
1982. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal. Nishikimi, M., Appaji, N., Yagi, K., 1972. The occurrence of superoxide anion in the re-
Biochem. 126, 131–138. action of reduced phenazine methosulfate and molecular oxygen. Biochem. Biophys.
Guizani, N., Waly, M.I., Singh, V., Rahman, M.S., 2013. Nabag (Zizyphus spina-christi) Res. Commun. 46, 849–854.
extract prevents aberrant crypt foci development in colons of azoxymethane-treated Nunes, T., Bernardazzi, C., de Souza, H.S., 2014. Cell death and inflammatory bowel
rats by abrogating oxidative stress and inducing apoptosis. Asian Pac. J. Cancer Prev. diseases: apoptosis, necrosis, and autophagy in the intestinal epithelium. BioMed Res.
14, 5031–5035. Int. 2014, 218493.
Hao, Y., Nagase, K., Hori, K., Wang, S., Kogure, Y., Fukunaga, K., Kashiwamura, S., Ohkawa, H., Ohishi, N., Yagi, K., 1979. Assay for lipid peroxides in animal tissues by
Yamamoto, S., Nakamura, S., Li, J., Miwa, H., Noguchi, K., Dai, Y., 2014. Xilei san thiobarbituric acid reaction. Anal. Biochem. 95, 351–358.
ameliorates experimental colitis in rats by selectively degrading proinflammatory Paglia, D.E., Valentine, W.N., 1967. Studies on the quantitative and qualitative char-
mediators and promoting mucosal repair. Evid. Base. Compl. Alternative Med. 2014, acterization of erythrocyte glutathione peroxidase. J. Lab. Clin. Med. 70, 158–169.
569587. Parmar, A.R., Trivedi, P.P., Jena, G.B., 2014. Dextran sulfate sodium-induced ulcerative
Iwamoto, M., Koji, T., Makiyama, K., Kobayashi, N., Nakane, P.K., 1996. Apoptosis of colitis leads to testicular toxicity in mice: role of inflammation, oxidative stress and
crypt epithelial cells in ulcerative colitis. J. Pathol. 180, 152–159. DNA damage. Reprod. Toxicol. 49, 171–184.
Jafarian, A., Zolfaghari, B., Shirani, K., 2014. Cytotoxicity of different extracts of arial Pavlick, K.P., Laroux, F.S., Fuseler, J., Wolf, R.E., Gray, L., Hoffman, J., Grisham, M.B.,
parts of Ziziphus spina-christi on Hela and MDA-MB-468 tumor cells. Adv. Biomed. 2002. Role of reactive metabolites of oxygen and nitrogen in inflammatory bowel
Res. 3, 38. disease. Free Radic. Biol. Med. 33, 311–322.
Jang, S.E., Hyam, S.R., Han, M.J., Kim, S.Y., Lee, B.G., Kim, D.H., 2013. Lactobacillus Podolsky, D.K., 2002. Inflammatory bowel disease. N. Engl. J. Med. 347, 417–429.
brevis G-101 ameliorates colitis in mice by inhibiting NF-κB, MAPK and AKT path- Scaldaferri, F., Vetrano, S., Sans, M., Arena, V., Straface, G., Stigliano, E., Repici, A.,
ways and by polarizing M1 macrophages to M2-like macrophages. J. Appl. Microbiol. Sturm, A., Malesci, A., Panes, J., Yla-Herttuala, S., Fiocchi, C., Danese, S., 2009.
115, 888–896. VEGF-A links angiogenesis and inflammation in inflammatory bowel disease patho-
Kadioglu, O., Jacob, S., Bohnert, S., Nass, J., Saeed, M.E., Khalid, H., Merfort, I., Thines, genesis. Gastroenterology 136, 585–595 e585.
E., Pommerening, T., Efferth, T., 2016. Evaluating ancient Egyptian prescriptions Sedlak, J., Lindsay, R.H., 1968. Estimation of total, protein-bound, and nonprotein sulf-
today: anti-inflammatory activity of Ziziphus spina-christi. Phytomedicine 23, hydryl groups in tissue with Ellman's reagent. Anal. Biochem. 25, 192–205.
293–306. Shi, L., Lin, Q., Yang, T., Nie, Y., Li, X., Liu, B., Shen, J., Liang, Y., Tang, Y., Luo, F., 2016.
Khodir, A.E., Atef, H., Said, E., ElKashef, H.A., Salem, H.A., 2017. Implication of Nrf2/ Oral administration of Lentinus edodes beta-glucans ameliorates DSS-induced ul-
HO-1 pathway in the coloprotective effect of coenzyme Q10 against experimentally cerative colitis in mice via MAPK-Elk-1 and MAPK-PPARgamma pathways. Food
induced ulcerative colitis. Inflammopharmacology 25, 119–135. Funct. 7, 4614–4627.
Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with Sturm, A., de Souza, H.S., Fiocchi, C., 2008. Mucosal T cell proliferation and apoptosis in
the Folin phenol reagent. J. Biol. Chem. 193, 265–275. inflammatory bowel disease. Curr. Drug Targets 9, 381–387.
Lu, M.C., Ji, J.A., Jiang, Y.L., Chen, Z.Y., Yuan, Z.W., You, Q.D., Jiang, Z.Y., 2016. An Williams, C., Panaccione, R., Ghosh, S., Rioux, K., 2011. Optimizing clinical use of me-
inhibitor of the Keap1-Nrf2 protein-protein interaction protects NCM460 colonic cells salazine (5-aminosalicylic acid) in inflammatory bowel disease. Ther. Adv.
and alleviates experimental colitis. Sci. Rep. 6, 26585. Gastroenterol. 4, 237–248.
Malago, J.J., Sangu, C.L., 2015. Intraperitoneal administration of butyrate prevents the Zhang, L., Zhang, Y., Zhong, W., Di, C., Lin, X., Xia, Z., 2014. Heme oxygenase-1 ame-
severity of acetic acid colitis in rats. J. Zhejiang Univ. - Sci. B 16, 224–234. liorates dextran sulfate sodium-induced acute murine colitis by regulating Th17/Treg
Mei, Q., Xu, J.-M., Xiang, L., Hu, Y.-M., Hu, X.-P., Xu, Z.-W., 2005. Change of nitric oxide cell balance. J. Biol. Chem. 289, 26847–26858.

62