Appl Microbiol Biotechnol (2017) 101:3811–3820

DOI 10.1007/s00253-017-8252-2

METHODS AND PROTOCOLS

An external substrate-free blue/white screening system

in Escherichia coli
Zhoujie Xie 1 & Zhao Zhang 1,2 & Zhenju Cao 1,2 & Meng Chen 1,2 & Pengwei Li 1 &
Weifeng Liu 3 & Hua Qin 1 & Xuejin Zhao 3 & Yong Tao 2,3 & Yihua Chen 1,2

Received: 19 December 2016 / Revised: 11 March 2017 / Accepted: 16 March 2017 / Published online: 28 March 2017
# Springer-Verlag Berlin Heidelberg 2017

Abstract Since the lacZα-based blue/white screening system Keywords Blue/white screening . Indigoidine synthetase .
was introduced to molecular biology, several different visual Sfp . External substrate-free
reporter systems were developed and used for various pur-
poses in Escherichia coli. A common limit to the existent
visual reporter systems is that an extracellular chromogenic Introduction
substrate has to be added for the visible pigment production.
In this study, we developed a new blue/white screening system Gene cloning is one of the most frequently used techniques in
based on a non-ribosomal peptide synthetase encoded by idgS molecular biology. The gene cloning process has become
from Streptomyces and a phosphopantetheinyl transferase more and more rapid and easy due to the various screening
encoded by sfp from Bacillus. When IdgS is activated from methods developed recently. Based on the screening strategy,
an apo-form to a holo-form via a posttranslational modifica- all the screening systems developed so far can be divided into
tion catalyzed by Sfp, it can synthesize a blue pigment two classes: visual and non-visual. The visual screening sys-
indigoidine using L-glutamine, the amino acid abundant in tem has been developed normally based on reporter genes for
cells, as a substrate. The new blue/white screening system visible pigment production, such as the α-fragment of β-ga-
contains a recipient E. coli strain with an optimized idgS gene lactosidase-encoding gene (lacZα) (Langley et al. 1975), β-
cassette and a cloning vector harboring an sfp gene with an in- glucuronidase enzyme-encoding gene (gusA) (Myronovskyi
frame insertion of a multiple cloning site close to its N-termi- et al. 2011), alkaline phosphatase gene (phoZ) (Chaffin and
nal. We demonstrated that the IdgS/Sfp-based blue/white Rubens 1998), etc. A common limit of these systems is that an
screening system is a powerful alternative to the lacZα-based extracellular chromogenic substrate for visible pigment pro-
screening system, which does not require any external sub- duction has to be added during the screening. Besides the
strate addition. chromogenic reporter genes, fluorescent protein-encoding
genes were also used in some visual screening system
Electronic supplementary material The online version of this article (Banerjee et al. 2010; Wong and Truong 2010). Although no
(doi:10.1007/s00253-017-8252-2) contains supplementary material, chromogenic substrate is required in this case, a UV emission
which is available to authorized users.
device is usually needed for screening.
The non-visual screening system is usually based on toxic
* Yihua Chen
[email protected]
or antibiotic resistance genes. The toxic genes are used as
counter-selection markers, and only the positive cells with a
1
State Key Laboratory of Microbial Resources, Institute of
disrupted toxic gene by insertion of a DNA fragment into the
Microbiology, Chinese Academy of Sciences, Beijing 100101, cloning site are able to grow on the selection medium. The
People’s Republic of China toxic gene ccdB, encoding a poisoning DNA gyrase, thereby
2
University of Chinese Academy of Sciences, Beijing 100049, China killing host cells when it is expressed functionally, has been
3
CAS Key Laboratory of Microbial Physiological and Metabolic
used in the construction of a variety of positive selection vec-
Engineering, Institute of Microbiology, Chinese Academy of tors (Bernard et al. 1994; Miyazaki 2010). Maintaining or
Sciences, Beijing 100101, China amplifying vectors harboring the intact ccdB gene requires
3812 Appl Microbiol Biotechnol (2017) 101:3811–3820

special host strains carrying mutations in DNA gyrase

(gyrA462) (Bernard et al. 1994). Another toxic gene used in
non-visual screening system is p-fluorophenylalanine-sensi-
tive gene pheS, which encodes a phenylalanyl-tRNA synthe-
tase (Hennecke et al. 1982). Similarly, a special host strain
containing mutated pheS (phe12) and a special medium con-
taining p-fluorophenylalanine is required for the recombinant
plasmid screening (Hennecke et al. 1982). Antibiotic resis-
tance genes were also used for screening purpose in some
cloning vectors (Nakanishi et al. 1986). In these cases, replica
plating is usually required for screening the recombinant plas-
mid by identifying the insertion inactivation of antibiotic re-
sistance markers, which adds an extra laborious step in the
screening process.
Among all the aforementioned screening systems, the
lacZα-based system is still the most wildly used one. Cells
containing these empty vectors hydrolyze a chromogenic sub-
strate (5-bromo-4-chloro-3-indolyl-β-D-galactoside, X-Gal)
to give blue colonies. The DNA insertion into lacZα by re- Fig. 1 Indigoidine production by heterologous expression of indigoidine
combinant cloning results in an inactivated enzyme and the synthetase encoding gene. a Indigoidine production catalyzed by
cells harboring the recombinant plasmids generate white col- indigoidine synthetase. Schematic diagram shows that indigoidine
onies. Besides the extra labor and cost introduced by the ad- synthetase (IdgS) is modified by PPTase from apo-form to holo-form.
CoA is required for this modification. The holo-indigoidine synthetase
dition of X-Gal, another drawback of lacZα-based blue/white catalyzes the production of one molecule of indigoidine from two mole-
screening system comes from the instability of the chromo- cules of L-glutamine. b Requirement of co-expression of idgS and sfp in
genic substrate X-Gal, which is light-sensitive and heat- E. coli for the production of indigoidine. E. coli JM109 harboring plasmid
unstable and leads to false positive screening results some- pCIM2001, a plasmid with idgS insertion driven by the promoter ermEp*
(Li et al. 2015) (JM109 (idgS)); E. coli JM109 harboring plasmid
times (Heuermann and Cosgrove 2001). pCIM2002, a plasmid containing two gene operon (idgS-sfp) driven by
Thus, a screening system that meets the following require- the promoter ermEp* (Li et al. 2015) (JM109 (idgS-sfp))
ments is still desirable: (1) Cloning vector can be easily main-
tained and prepared in normal Escherichia coli host strain, (2)
normal medium without addition of extra substrate can be mechanism of indigoidine, a series of applications, such as
used in the screening process, and (3) discrimination between an in vivo reporter for bacterial and mammalian cells
positive and negative clones can be done visually without the (Muller et al. 2012) and a tool for analysis of PPTase enzymes
help of any extra equipment. For the purpose of developing (Owen et al. 2011), have been developed. We cloned the
such a system, we constructed a new system using the endog- encoding gene of indigoidine synthetase (idgS) from
enous production of pigment (indigoidine) as a selection Streptomyces lavendulae CGMCC 4.1386 and successfully
indicator. developed a screening system for gene inactivation in
Indigoidine is a water-insoluble blue pigment (Kuhn et al. Streptomyces species based on the gene pair of idgS and sfp
1965), which can be readily detected either in vivo or in vitro (a PPTase-encoding gene from Bacillus subtilis) (Li et al.
owing to its characteristic blue color and strong absorbance at 2015), demonstrating the feasibility of indigoidine production
590 nm. Its chemical properties give the producing strain a as a selection indicator in Streptomyces. In this report, we
dark blue colony phenotype. The enzymes and substrates re- describe the construction of the indigoidine-based blue/white
quired for the production of indigoidine have been well char- screening system and its use in recombinant DNA screening
acterized already (Reverchon et al. 2002; Takahashi et al. in E. coli.
2007). Indigoidine is synthesized from two molecules of L-
glutamine by indigoidine synthetase, a single module non-
ribosomal peptide synthase (NRPS). As the other NRPSs, Materials and methods
indigoidine synthetase’s activity is dependent on
phosphopantetheinyl transferase (PPTase) mediated posttrans- Bacterial strains and culture conditions
lational modification from an apo-form to a holo-form.
Therefore, co-expression of indigoidine synthetase and an ap- Bacterial strains used in this study are shown in Table 1.
propriate PPTase are necessary for the production of LB broth and agar were used for routine growth and
indigoidine (Fig. 1a). Based on the simple biosynthesis maintenance of all E. coli strains used in this study.
Appl Microbiol Biotechnol (2017) 101:3811–3820 3813

Table 1 Strains and plasmids

used in this study Strains and plasmids Characteristics References

E. coli strains
JM109 recA1, endA1, gyrA96, thi-1, hsdR17, e14-(mcrA-), Yanisch-Perron et al. (1985)
supE44, relA1, Δ (lac-proAB)
BW25113 rrnB3, ΔlacZ4787, hsdR514, Δ(araBAD)567, Datsenko and Wanner (2000)
Δ(rhaBAD)568, rph-1
IDG01 E. coli JM109, ompT::T5-idgS, KanR This study
TRI01 E. coli JM109, attB1::T5-RBSs-midgS, KanR This study
JRI01 E. coli JM109, attB1::J23100-RBSs-midgS, KanR This study
JRI02 E. coli JM109, attB1::J23100-RBSw-midgS, KanR This study
IDG02 E. coli JM109, attB1::T5-RBSs-midgS, markerless This study
Plasmids
pUKM-T5 pUC19 with T5-FRT-Kan-FRT cassette insertion, This study
KanR, AmpR
pUC19 Cloning vector, AmpR Yanisch-Perron et al. (1985)
pCIM001 pSET152::PermE-idgS, AprR Li et al. (2015)
R
pCIM002 pSET152::PermE-idgS-sfp, Apr Li et al. (2015)
pSFP01 pUC19-derived plasmid, lacZ−sfp+, with lac This study
repressor binding site deletion, AmpR
pSFP02 pSFP01-derived plasmid, with the deletion of This study
codons 1–7 of sfp, AmpR
pSFP03 pSFP01-derived plasmid, with MCS region This study
insertion after the 5th codon of sfp, AmpR
pSFP04 pSFP01-derived plasmid, containing MCS region This study
with orientation opposite to that of pSFP03,
AmpR
pOSIP-KO Plasmid used for clonetegration in E. coli, St-Pierre et al. (2013)
maintained and prepared in E. coli DB3.1, KanR
pJRI01 pPT02 with the insertion of J23100-RBSS-midgS This study
cassette, CmR
pJRI02 pPT02 with the insertion of J23100-RBSW-midgS This study
cassette, CmR
pIDG02 pPT02 with the insertion of midgS, CmR This study
pPT02 pSC101 ori, pSB4C5 derived cloning vector This study
containing sfGFP gene and two BsaI sites
upstream of sfGFP, CmR
pTGE33 pET28a::sfp, KanR Fang et al. (2008)
+ ts R R
pCP20 FLP , Rep , Amp , Cm Datsenko and Wanner (2000)

KanR kanamycin resistance, AmpR ampicillin resistance, CmR chloramphenicol resistance, AprR apramycin
resistance

Where it is necessary, media were supplemented with Primers and plasmids

100 μg/ml apramycin, 25 μg/ml chloramphenicol,
100 μg/ml ampicillin, or 50 μg/ml kanamycin. Unless The plasmids and strains used in this study are shown in
stated otherwise, strains expressing idgS and sfp were Table 1. The primers used in this study are shown in Table S1.
plated on LB agar and incubated for 12–14 h at 37 °C
to facilitate colony formation. After that, the plates were Preparation for the E. coli recipient strain construction
placed at room temperature (around 25 °C) and incubated
for another 3–4 h to facilitate indigoidine production. All For the construction of E. coli strains with a higher ex-
the images were captured using a digital camera with a pression level of IdgS, a DNA cassette (T5-RBSs-midgS)
12-megapixel resolution and F2.2 aperture in this work. containing a codon-optimized idgS gene (midgs) with a
To show the blue and white colonies clearly, the images strong ribosomal binding site (RBSs) driven by T5 pro-
of plates with blue colonies were captured on a white moter was synthesized by TsingKe Co., Beijing, China
background, while the images of plates with white colo- (see supplementary materials for full sequence of modi-
nies were captured on a black background. fied idgS). T5 promoter is a strong promoter from
3814 Appl Microbiol Biotechnol (2017) 101:3811–3820

bacteriophage T5 (Gentz and Bujard 1985). DNA cassette

of T5-RBSs-midgS was used for the construction of TRI01
(see following). Combined with midgS, promoter J23100
and two RBS region (RBSs and RBSw) were selected for
the constructions of the strains of JRI01 and JRI02 (see
following). RBS s (AGTTAGAAATTCAACAAAGC
ATAAGGAGGTATTTT) and RBS w (TCCCGTAG
TCTAAAAAGTTTAAAGGCAAGT) are two RBS mod-
ules designed using the RBS calculators (Salis et al.
2009). Strengths of RBSs and RBSw indicated by transla-
tion initiation rate (TIR) are 333,796 and 4844, respec-
tively. Promoter J23100 is a strong promoter from a com-
binatorial library of constitutive promoters (Registry for
Standard Biological Parts, http://parts.igem.com).
Promoter J23100 has been shown to be weaker than
promoter T5 (unpublished data).

Construction of E. coli strain IDG01 Fig. 2 Construction and evaluation of the E. coli recipient strains TRI01,
JRI01, and JRI02. a Illustration of the constructions of the midgS
integration strains (TRI01, JRI01, JRI02) by an integration strategy. The
E. coli strain IDG01 (the E. coli strain harboring an idgS midgS cassette was cloned into pOSIP-KO and integrated into the chro-
gene driven by T5 promoter) was constructed by λ Red- mosome of E. coli JM109. After integration, the integration cassette (con-
mediated recombination (Datsenko and Wanner 2000). taining kanR and integrase genes) could be removed by expressing FLP
recombinase. b Blue pigment production phenotypes of the three E. coli
Briefly, a 3.9-kb DNA fragment containing the idgS gene
recipient strains harboring plasmid pSFP01. Strain TRI01 containing
and its intact RBS region was amplified from genomic pSFP01 (TRI01 (pSFP01)); strain JRI01 containing pSFP01 (JRI01
DNA of S. lavendulae CGMCC 4.1386 using the primer (pSFP01)); strain JRI02 containing pSFP01 (JRI02 (pSFP01)). This ex-
pair idgSF-kanT/idgSR, while a 1.6-kb fragment contain- periment was performed multiple times and got similar results
ing the KanR cassette and T5 promoter was amplified with
the primer pair kanF/kanT5-idgSF from pUKM-T5. The
Construction of E. coli strain JRI01
overlapping regions between the two amplicons allow a
subsequent overlapping PCR using primer pair kanF-
Plasmid pJRI01 carring a 4.0-kb DNA insertion containing
ompTup and idgSR-ompTdn, two primers with 39-nt ho-
midgS with RBSs driven by J23100 promoter (J23100-RBSs-
mology extensions corresponding to the ompT gene in
midgS) was used for the construction of E. coli strain JRI01.
E. coli. The resulting 5.5-kb amplicon was electroporated
Plasmid pJRI01 is derived from pIDG02, which was generat-
into E. coli BW25113 carrying plasmid pIJ790 as the
ed as described below. A 3.8-kb fragment was amplified with
protocol described before (Datsenko and Wanner 2000).
primer pair pTPF-idgsR and pTPR-SidgS-St using pPT02 as a
The transformant, losing plasmid pIJ790 and carrying the
template, while a 4.0-kb fragment containing midgS was am-
correct insertion of idgS gene driven by T5 promoter in
plified from the synthesized DNA cassette of T5-RBSs-midgS
the ompT locus, was named as IDG01.
with primer pair SigdS-ST and IdgSmR-BamHI. The overlap-
ping regions between the two amplicons facilitated the con-
Construction of E. coli strain TRI01 struction of plasmid pIDG02 by assembling the two fragments
with ClonExpress II One-Step Cloning Kit (Vazyme Biotech
As illustrated in Fig. 2a, strain TRI01 was constructed using Co., Ltd., Nanjing, China). During the construction of
the one-step cloning and chromosomal integration method pIDG02, two BsaI recognition sites were introduced upstream
(St-Pierre et al. 2013). Briefly, using the synthesized DNA of the open reading frame of midgS. For pJRI01construction, a
cassette (T5-RBSs-midgS Fragment) as a template, a 4.0-kb DNA fragment containing PJ2300 promoter and RBSs was
DNA fragment was PCR amplified with the primer pair PCR amplified with primer pair PRsF and PRsR and inserted
T5F-SpeI and idgsmR-BamHI. The PCR products were dou- into the BsaI sites of pIDG02 by Golden Gate Cloning strat-
ble digested with BamHI and SpeI and inserted into the same egy (Engler and Marillonnet 2014). A 4.0-kb fragment was
sites of pOSIP-KO. The ligation products were transformed then amplified from plasmid pJRI01 with primer pair PJF-
into the competent cells of JM109 directly, and the integrants SpeI and idgsmR-BamHI. The PCR products were digested
were selected on LB plate containing kanamycin to obtain with SpeI and BamHI and inserted into the corresponding sites
strain TRI01. of pOSIP-KO. Ligation products were transformed into
Appl Microbiol Biotechnol (2017) 101:3811–3820 3815

JM109 and selected on LB plate containing kanamycin to and Wanner 2000). When the transformants were selected
obtain JRI01. on LB plate with ampicillin at 30 °C, site-specfic recombina-
tion occurred between the two FRT sites which flank the kana-
Construction of E. coli strain JRI02 mycin resistance gene and the integrase genes. After culture at
37 °C, a large majority of transformants lost the FRT flanked
Plasmid pJRI02 carries a 4.0-kb DNA cassette containing kanamycin resistance gene and the integrase genes and also
midgS with RBSw driven by J23100 promoter (J23100- the FLP helper plasmid pCP20. The final construction losing
RBSw-midgS). A DNA fragment containing PJ2300 pro- all antibiotic resistances was selected as strain IDG02.
moter and an artificial RBS (RBSw) was PCR amplified
with primer pair PRwF and PRwR and inserted into the Construction of plasmid pSFP01-04
BsaI sites of pIDG02 with the golden gate cloning way to
generate pJRI02. E. coli strain JRI02 was constructed Using pTGE33 as a template, a 750-bp DNA fragment
using a similar strategy as that of TRI01 and JRI01 con- (containing sfp gene) was PCR amplified with the primer
structions (Fig. 2a) (St-Pierre et al. 2013). Briefly, a 4.0- pair sfpF-pUC18r and sfpR-pUC18f, while a 2.7-kb frag-
kb fragment was amplified from plasmid pJRI02 with ment was amplified from the plasmid pUC19 with the
primer pair PJF-SpeI and idgsmR-BamHI. The PCR prod- primer pair pUC18F-sfp and pUC18R-sfp. The overlap-
ucts were digested with SpeI and BamHI and inserted into ping regions between the two amplicons allow them to be
the same sites of pOSIP-KO. Ligation products were assembled into a plasmid using the One-Step Cloning Kit
transformed into JM109 and selected on LB plate contain- (Vazyme Biotech Co., Ltd., Nanjing, China) to obtain
ing kanamycin to obtain strain JRI02. pSFP01. A 3.0-kb fragment was then PCR amplified
using pSFP01 as a template with the primer pair
Verification of E. coli strains TRI01, JRI01, and JRI02 sfp2ndATGF and sfp2ndATGR. The amplicon was treated
with T4 polynucleotide kinase (New England Biolabs
All three strains were verified by a PCR strategy for test- (Beijing) Ltd., China) and self-ligated to obtain pSFP02.
ing the presence of new locus-specific fragments of pre- For the construction of pSFP03, a 3.1-kb fragment was
dicted sizes as described before (St-Pierre et al. 2013). amplified from pSFP01 using primer pair pUCsfpF-
There are two putative integration sites (attB1and attB2) HindIII and pUCsfpR-EcoRI, while the two oligos
on the chromosome of E. coli JM109 for pOSIP-KO vec- (MCSF and MCSR) were annealed to obtain the multi-
tor (St-Pierre et al. 2013). The integration sites of the cloning site (MCS) fragment with the overhangs compli-
three constructions were determined by two separate ment with the overhangs generated by EcoRI and HindIII
PCR reactions using the genomic DNA of TRI01, digestion. The annealed oligos and 3.1-kb fragment
JRI01, or JRI02 as a template with the primer mix of digested with EcoRI and HindIII were linked together to
OP1, P2, P3, and OP4 and primer mix of P1, P2, P3, get plasmid pSFP03. The same way was used in the con-
and P4, respectively. Primers P1 and P4 flank the attB1 struction of pSFP04, except that the 3.1-kb plasmid back-
site, primers OP1 and OP4 flank the attB2 site, and the bone was amplified with primer pair pUCsfpF-EcoRI and
binding sites of primers P2 and P3 locate on the vector pUCsfpR-HindIII.
and flank the midgS cassette. The PCR program was set
as initial denaturation at 98 °C for 60 s followed by 30 cy-
cles of amplification (denaturation at 98 °C for 10 s, an- sfGFP cloning using pSFP03 as a vector in the host
nealing at 50 °C for 15 s, extension at 72 °C for 1 min), of E. coli IDG02
and a final extension at 72 °C for 10 min. As depicted in
Fig. S2, successful integration into attB1 will give two The sfGFP-encoding gene was PCR amplified from pPT02
fragments of 389 and 328 bp from primer pairs P1/P2 using the primer pair GFPF-EcoRI and GFPR-HindIII. The
and P3/P4, respectively, and the absence of integration PCR products were double digested with EcoRI and HindIII
into attB2 will produce one fragment of 601 bp from and inserted into the corresponding sites of pSFP03. The liga-
primer pair OP1/OP2. tion products were transformed into the competent cells of
IDG02 and selected on LB plate containing ampicillin. The
Construction of E. coli strain IDG02 plate was inoculated at 30 °C for 16 h for blue/white
screening.
The markerless strain IDG02 was obtained by excision of the
kanamycin resistance and integration module from E. coli Nucleotide sequence accession number The T5-RBSs-midgS
TRI01 (Fig. 2a). Briefly, E. coli TRI01 was transformed with gene cassette was deposited in GenBank under an accession
the FLP recombinase expression plasmid pCP20 (Datsenko number KY381898.
3816 Appl Microbiol Biotechnol (2017) 101:3811–3820

Results even it is driven by the strong T5 promoter. We speculated that

a possible reason is that the idgS gene (G+C content 73%) is
Co-expression of idgS and sfp in E. coli leads to a blue not efficiently expressed in E. coli due to the codon bias. To
pigment production circumvent this problem, a codon-optimized idgS (midgS),
which has the same amino acid sequence as idgS but using
BpsA from S. lavendulae ATCC 11924 is the first in vitro- codons preferred by E. coli, was synthesized. The new midgS
characterized indigoidine synthetase (Takahashi et al. 2007). It gene was then used in place of idgS in the construction of the
was reported that the endogenous PPTases of E. coli are not following recipient strains.
able to activate BpsA and that co-expression of an appropriate Given that the appropriate expression level of IdgS in the
PPTase is necessary for the production of the blue pigment recipient strain is unknown, three strains (named as TRI01,
indigoidine in E. coli. Our previous study identified another JRI01, and JRI02), designed to exhibit different expression
indigoidine synthetase-encoding gene (designated as idgS) levels of IdgS, were made based on midgS. As shown in
from S. lavendulae CGMCC 4.1386, which shows high sim- Fig. 2a, the three recombinant E. coli strains were constructed
ilarity with bpsA (Li et al. 2015). The plasmids of pCIM2001 using the cloning and integration strategy developed by St-
(pUC replicon with the insertion of idgS driven by a constitu- Pierre and his colleagues (St-Pierre et al. 2013). The new
tive promoter) and pCIM2002 (pUC replicon with the inser- midgS cassette combined with different promoters (a relative-
tion of a two-gene operon idgS-sfp driven by a constitutive ly strong promoter T5 and a weaker one J23100) and ribosom-
promoter) are two constructions made during our efforts to al binding sites (a relatively strong one RBSs and a weaker one
develop a gene inactivation system in Streptomyces (Li et al. RBSw) was used in the construction of the three recombinant
2015). In order to know whether the formation of holo-IdgS strains. As illustrated in Fig. S1, E. coli TRI01 carries a DNA
needs an exogenous PPTase in E. coli, the two plasmids were insertion containing midgS with RBSs driven by T5 promoter
transformed into E. coli JM109, respectively. It was observed (T5-RBSs-midgS); E. coli JRI01 carries a DNA insertion con-
that E. coli strain carrying pCIM2002 produced blue pigment taining midgS with RBSs driven by J23100 promoter (J23100-
indigoidine effectively, while E. coil carrying pCIM2001 RBSs-midgS), and E. coli JRI01 carries a DNA insertion con-
could not (Fig. 1b), indicating that the endogenous PPTases taining midgS with RBS w driven by J23100 promoter
of E. coli cannot, but Sfp can activate IdgS. (J23100-RBSw-midgS). Among them, TRI01 is expected to
The observation that co-expression of idgS and sfp in have the highest expression level of IdgS, while JRI02 is ex-
E. coli is required for the production of indigoidine promoted pected to have the lowest expression level. To determine
us to make a new blue/white screening system in E. coli, which one is the best recipient strain in our cloning system,
which will use the endogenous substrates (L-glutamine and plasmid pSFP01 was transformed into them, respectively. It is
ATP) to make blue pigment. We envisaged that the novel clear that the pSFP01/TRI01 transformants displayed the
blue/white screening system will have two parts: an idgS strongest blue phenotype, while the pSFP01/JRI02
containing E. coli strain (recipient strain) and an sfp containing transformants showed the weakest blue color (Fig. 2b).
vector (cloning vector). The recipient strain containing empty Finally, a markerless strain IDG02 was constructed by remov-
cloning vector would display blue phenotype, and the strains ing the kanamycin resistance and integration cassette from
containing recombinant plasmids would show white pheno- TRI01 through FLP-mediated site-specific recombination
type due to the inactivation of sfp by the inserted foreign and was used as the recipient strain in our following studies.
DNA.
Construction and evaluation of the cloning vectors
Construction and evaluation of the recipient E. coli strains
The cloning vectors with an MCS region inserted inside sfp
A prerequisite for such a screening system is to construct an were constructed based on plasmid pSFP01. In order to ex-
appropriate recipient strain. At first, strain IDG01 derived plore the potential locations for inserting an MCS region in
from E. coli BW25113 with idgS gene and its intact RBS sfp, the short N-terminal encoding region between the start
driven by the strong T5 promoter (T5-RBSidgS-idgS) was con- codon and the second ATG codon of sfp (the eighth codon,
structed. To evaluate IGD01, plasmid pSFP01 was generated Fig. 3a) was checked. Plasmid pSFP02 was constructed from
by replacing the lacZ gene in pUC19 with the sfp gene. The pSFP01 by deleting the first seven codons of the sfp gene and
lac repressor binding site was also deleted during the con- transformed into IDG02. All transformants displayed white
struction. Therefore, the sfp gene in pSFP01 can be expressed phenotype as shown in Fig. 3b, indicating that the truncated
constitutively. When pSFP01 was transformed into E. coli Sfp translated from the second ATG completely loses activity.
IDG01, the transformants displayed a light brown phenotype Thereafter, the tolerance of inserting an MCS region at the
instead of the anticipated dark blue, indicating that a single short N-terminal encoding region was investigated. We chose
copy of the native idgS gene cannot produce enough enzyme the polylinker sequence corresponding to the MCS region of
Appl Microbiol Biotechnol (2017) 101:3811–3820 3817

Fig. 3 Properties of plasmids pSFP01, pSFP02, pSFP03, and pSFP04. a (having an opposite orientation to that in pSFP03) inserted after the fifth
A pUC replicon containing a full size sfp (pSFP01); a pUC replicon codon (pSFP04). b Phenotypes of IDG02 strains transformed with
containing an sfp lacking the first seven codons (pSFP02); a pUC plasmid pSFP01, pSFP02, pSFP03, and PSFP04. This experiment was
replicon containing an sfp with a MCS region inserted after the fifth performed multiple times and got similar results
codon (pSFP03); a pUC replicon containing an sfp with a MCS region

pUC19 and made in-frame fusion to sfp gene after its fifth temperature, which makes our attempt possible (Owen
codon. Corresponding to two orientations for the same MCS et al. 2011). To determine the best incubation temperature
region, two vectors pSFP03 and pSFP04 were constructed for our system, the strain IDG02 containing plasmid
from pSFP01. As illustrated in Fig. 3a, the MCS region inser- pSFP01 was constantly cultivated at a serial of tempera-
tion will result in an in-fusion Sfp protein with 18 extra amino ture (from 24 to 34 °C). When cultivated at 30 °C, the
acid insertions in both cases. The two vectors, pSFP03 and E. coli strain displayed a reasonable colony size and clear
pSFP04, were transformed into E. coli IDG02, respectively, blue phenotype after 16-h incubation (Fig. S3). The result
and assessed rapidly by visual inspection of blue pigment suggested that cultivation constantly at 30 °C is appropri-
production. As shown in Fig. 3b, transformants containing ate for the indigoidine-based blue/white screening system.
pSFP03 showed a similar blue phenotype with transformants The effect of pH on the production of indigoidine in E. coli
containing pSFP01, while pSFP04 transformants displayed a was also investigated by growing strain IDG02 containing
slight weaker blue phenotype. plasmid pSFP03 on LB agar plates with an initial pH range
from 5.0 to 9.0. As shown in Fig. S5, when the E. coli strain
was spread on LB agar plate with pH of 6.0, 7.0, and 8.0, a
Optimization of the cultivation conditions whole plate of blue colonies was observed; when it was spread
on LB agar plate with pH of 5.0 and 9.0, very few tiny colo-
The recipient strain E. coli IDG02 and the cloning vector nies, which were also blue, could grow up. These results re-
pSFP03 constitute the new blue/white screening system. It vealed that production of indigoidine in E. coli is insensitive to
should be mentioned that IdgS and Sfp, the two enzymes medium pH. Therefore, LB medium without special pH ad-
recruited by the new screening system, have different op- justment (pH around 7.2) was used in the indigoidine-based
timum temperatures for their functionality. Accordingly, screening system.
we had to cultivate the transformants at two different tem-
peratures successively for the blue phenotype observation
(12–14 h at 37 °C for holo-IdgS accumulation and then 3– Cloning the sfGFP gene with the new blue/white screening
4 h at room temperature for indigoidine synthesis). In system
order to simplify the cultivation procedure, we sought to
find a constant temperature to incubate the transformants. To demonstrate the convenience of the new screening
It has been reported that Sfp functions in a wide range of system, we cloned the sfGFP gene into the EcoRI and
3818 Appl Microbiol Biotechnol (2017) 101:3811–3820

HindIII sites of plasmid pSFP03 as a DNA cloning exam- with a MCS region). The substrates for indigoidine bio-
ple. E. coli IDG02 was used as the recipient strain, and synthesis, L-glutamine and ATP, are available inside the
the transformants were cultivated at 30 °C for 16 h. bacterial cells, so no exogenous substrate is required for
Almost all transformants show white phenotype (no blue this system. So far as we know, it is the first visual DNA
pigment production); meanwhile, these white colonies cloning system that utilizes only the endogenous sub-
display green fluorescence under UV condition, indicating strates to produce a pigment as the screening indicator.
that all the white colonies are bacteria containing the cor- Indigoidine has a strong absorbance at 560 nm, which
rect recombinant plasmids (Fig. 4). Ten colonies were endows a dark blue color to its producer. To avoid any
randomly selected for plasmid extraction. Using the plas- external substance addition during the screening process,
mid as a template, PCR with the sfGFP-specific primers the midgS gene in the recipient strain is driven by a con-
was performed. The PCR results showed that all ten plas- stitutive promoter and the sfp gene in the cloning vector is
mids have the correct sfGFP insertions (Fig. 4). driven by lac promoter without the lac repressor binding
site; therefore, no inducing compound such as IPTG is
required.
Discussion For the indigoidine-based system, we found that
transformant incubation constantly at 30 °C could give a
In this study, we report the development of a novel blue/white better screening result compared with the other tempera-
screening system in E. coli based on an indigoidine tures tested. This observation is consistent with the previ-
synthetase-encoding gene (idgS) from Streptomyces and a ous finding that the optimal temperature of indigoidine
phosphopantetheinyl transferase-encoding gene (sfp) from synthetase is around 30 °C and Sfp functions at a wide
Bacillus. The new screening system consists of a recipient range of temperature (Owen et al. 2011; Quadri et al.
strain E. coli IDG02 (containing a T5-RBSs-midgS cassette) 1998; Takahashi et al. 2007). The pigment production
and a cloning vector pSFP03 (pUC replicon containing sfp on LB plate is accompanying with the colony formation,
which could give us increased sensitivity and earlier de-
tection of unstained colonies. It has been reported that
indigoidine exhibits low-level toxicity to E. coli (Owen
et al. 2011). We did have a similar observation by com-
paring the growth pattern of IDG02 strain carrying plas-
mid pSFP03, which is capable of producing indigiodine,
with that of IDG02 strain carrying plasmid pUC19 as a
control (Fig. S4). Therefore, it is not surprising that the
blue colonies are relatively smaller than the white colo-
nies on the same plate under our screening conditions.
However, white colonies are the targeting ones which
might contain the correct recombinant plasmids, so the
slower growth of the blue colonies does not affect the
screening process.
As mentioned above, there are some drawbacks for
lacZα-based screening system. Our studies have shown
that our indigoidine-based screening system provides a
powerful alternative to lacZα-based screening system.
There are two components for lacZα-based screening sys-
tem: a vector containing lacZα with MCS and an E. coli
strain harboring the lacZΔM15 mutation (Sambrook et al.
2001). Similarly, there are two components for the
indigoidine-based screening system: a vector containing
Fig. 4 sfGFP gene cloning using pSFP03 as a cloning vector and IDG02
sfp with MCS and an E. coli strain harboring the midgS
as a recipient strain. a The transformants were incubated at 30 °C for 18 h, gene. Theoretically, all lacZα-based screening system can
and pictures were taken under the conditions of visible (Vis) light and be replaced by the indigoidine-based screening system,
ultraviolet visible (UV) light, respectively. b Ten white colonies from the just by substituting the lacZα in the vector with sfp, at
transformation plate were randomly picked up for plasmid preparation
and then checked for the expected sfGFP inserts by PCR using the sfGFP-
the same time using the idgS containing strain instead of
specific primers. The sample denoted with a plus sign indicates a positive the lacZΔM15 containing strain. A detailed comparison
control of the two screening systems was made in Table S2, and
Appl Microbiol Biotechnol (2017) 101:3811–3820 3819

the major advantage of the indigoidine-based screening Chaffin DO, Rubens CE (1998) Blue/white screening of recombinant
plasmids in gram-positive bacteria by interruption of alkaline phos-
system is that it does not need any external substrate or
phatase gene (phoZ) expression. Gene 219(1–2):91–99
inducer, which simplifies the screening process. Although Datsenko KA, Wanner BL (2000) One-step inactivation of chromo-
the indigoidine-based screening system developed in this somal genes in Escherichia coli K-12 using PCR products.
study was particularly focused on E. coli, given the al- Proc Natl Acad Sci U S A 97(12):6640–6645. doi:10.1073/
ready successful application of indigoidine-based reporter pnas.120163297
Engler C, Marillonnet S (2014) Golden gate cloning. Methods Mol Biol
in different hosts, the concept can easily be developed for 1116:119–131. doi:10.1007/978-1-62703-764-8_9
a wide range of species. However, the indigoidine-based Fang J, Zhang Y, Huang L, Jia X, Zhang Q, Zhang X, Tang G, Liu W
screening system might not be fit for bacteria containing (2008) Cloning and characterization of the tetrocarcin A gene cluster
endogenous homologs of idgS or sfp due to the possible from Micromonospora chalcea NRRL 11289 reveals a highly con-
served strategy for tetronate biosynthesis in spirotetronate antibi-
interfere caused by their endogenous homologs. otics. J Bacteriol 190(17):6014–6025. doi:10.1128/JB.00533-08
As a proof of concept, we demonstrated the utility of the Gentz R, Bujard H (1985) Promoters recognized by Escherichia coli
new blue/white screening system by cloning the sfGFP RNA polymerase selected by function: highly efficient promoters
gene. Upon selection, transformants harboring inserts from bacteriophage T5. J Bacteriol 164(1):70–77
displayed white phenotype and transformants containing Hennecke H, Gunther I, Binder F (1982) A novel cloning vector for the
direct selection of recombinant DNA in E. coli. Gene 19(2):231–234
the empty or self-ligation vectors show blue phenotype. Heuermann K, Cosgrove J (2001) S-Gal: an autoclavable dye for color
Besides its usefulness as a part of the cloning system, the selection of cloned DNA inserts. BioTechniques 30(5):1142–1147
recipient strain constructed in this study may also be Kuhn R, Starr MP, Kuhn DA, Bauer H, Knackmuss HJ (1965)
employed for other application. For example, it can be Indigoidine and other bacterial pigments related to 3,3′-bipyridyl.
Arch Mikrobiol 51:71–84
used in the screening of PPTase-encoding genes and the
Langley KE, Villarejo MR, Fowler AV, Zamenhof PJ, Zabin I (1975)
associated natural product clusters from metagenome li- Molecular basis of beta-galactosidase alpha-complementation.
braries. Previously, such screening has been carried out Proc Natl Acad Sci U S A 72(4):1254–1257
using reporter strain with BpsA expressed in trans on a Li P, Li J, Guo Z, Tang W, Han J, Meng X, Hao T, Zhu Y, Zhang L, Chen
plasmid (Owen et al. 2012). When doing such screening, Y (2015) An efficient blue/white screening based gene inactivation
system for Streptomyces. Appl Microbiol Biotechnol 99(4):1923–
the plasmid-free, markerless strain IDG02 provides not on- 1933. doi:10.1007/s00253-014-6369-0
ly a more stable genetic background but also a better Miyazaki K (2010) Lethal ccdB gene-based zero-background vector for
choice without the concerns of replicon incompatibility construction of shotgun libraries. J Biosci Bioeng 110(3):372–373.
and selection marker confliction. doi:10.1016/j.jbiosc.2010.02.016
Muller M, Auslander S, Auslander D, Kemmer C, Fussenegger M (2012)
A novel reporter system for bacterial and mammalian cells based on
the non-ribosomal peptide indigoidine. Metab Eng 14(4):325–335.
Acknowledgements The study was funded in part by the Ministry of doi:10.1016/j.ymben.2012.04.002
Science and Technology of China (2015CB150600 and 2013CB734000) Myronovskyi M, Welle E, Fedorenko V, Luzhetskyy A (2011) Beta-
and the National Natural Science Foundation of China (31400048 and glucuronidase as a sensitive and versatile reporter in actinomycetes.
31522001). Y.C. is an awardee for the BHundred Talents Program^ of the Appl Environ Microbiol 77(15):5370–5383. doi:10.1128/AEM.
Chinese Academy of Sciences. 00434-11
Nakanishi N, Oshida T, Yano S, Takeda K, Yamaguchi T, Ito Y
(1986) Construction and characterization of new cloning vec-
Compliance with ethical standards tors derived from Streptomyces griseobrunneus plasmid pBT1
and containing amikacin and sulfomycin resistance genes.
Conflict of interest Yihua Chen and Zhoujie Xie have filed a patent Plasmid 15(3):217–229
application related to this work. Owen JG, Copp JN, Ackerley DF (2011) Rapid and flexible biochemical
assays for evaluating 4′-phosphopantetheinyl transferase activity.
Biochem J 436(3):709–717. doi:10.1042/BJ20110321
Ethical approval This article does not contain any studies with human
Owen JG, Robins KJ, Parachin NS, Ackerley DF (2012) A functional
participants or animals performed by any of the authors.
screen for recovery of 4′-phosphopantetheinyl transferase and asso-
ciated natural product biosynthesis genes from metagenome librar-
ies. Environ Microbiol 14(5):1198–1209. doi:10.1111/j.1462-2920.
2012.02699.x
References Quadri LE, Weinreb PH, Lei M, Nakano MM, Zuber P, Walsh CT (1998)
Characterization of Sfp, a Bacillus subtilis phosphopantetheinyl
Banerjee S, Kumar J, Apte-Deshpande A, Padmanabhan S (2010) A transferase for peptidyl carrier protein domains in peptide synthe-
novel prokaryotic vector for identification and selection of tases. Biochemistry 37(6):1585–1595. doi:10.1021/bi9719861
recombinants: direct use of the vector for expression studies Reverchon S, Rouanet C, Expert D, Nasser W (2002) Characterization of
in E. coli. Microb Cell Factories 9:30. doi:10.1186/1475- indigoidine biosynthetic genes in Erwinia chrysanthemi and role of
2859-9-30 this blue pigment in pathogenicity. J Bacteriol 184(3):654–665
Bernard P, Gabant P, Bahassi EM, Couturier M (1994) Positive- Salis HM, Mirsky EA, Voigt CA (2009) Automated design of synthetic
selection vectors using the F plasmid ccdB killer gene. Gene ribosome binding sites to control protein expression. Nat Biotechnol
148(1):71–74 27(10):946–950. doi:10.1038/nbt.1568
3820 Appl Microbiol Biotechnol (2017) 101:3811–3820

Sambrook J, MacCallum P, Russell D (2001) Molecular cloning—a lab- blue pigment synthesis. J Biol Chem 282(12):9073–9081. doi:
oratory manual (3rd ed.) Cold Spring Harbor Laboratory Press, Cold 10.1074/jbc.M611319200
Spring Harbor, NY Wong SS, Truong K (2010) Fluorescent protein-based methods for on-
St-Pierre F, Cui L, Priest DG, Endy D, Dodd IB, Shearwin KE (2013) plate screening of gene insertion. PLoS One 5(12):e14274. doi:10.
One-step cloning and chromosomal integration of DNA. ACS Synth 1371/journal.pone.0014274
Biol 2(9):537–541. doi:10.1021/sb400021j Yanisch-Perron C, Vieira J, Messing J (1985) Improved M13 phage clon-
Takahashi H, Kumagai T, Kitani K, Mori M, Matoba Y, Sugiyama ing vectors and host strains: nucleotide sequences of the M13mp18
M (2007) Cloning and characterization of a Streptomyces sin- and pUC19 vectors. Gene 33(1):103-119
gle module type non-ribosomal peptide synthetase catalyzing a