Flavins and Flavoproteins
Flavins and Flavoproteins
Stefan Weber
Erik Schleicher Editors
Flavins and
Flavoproteins
Methods and Protocols
METHODS IN M O L E C U L A R B I O LO G Y
Series Editor
John M. Walker
School of Life Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
Edited by
Stefan Weber
Institut für Physikalische Chemie, Albert-Ludwigs-Universität Freiburg, Germany
Erik Schleicher
Institut für Physikalische Chemie, Albert-Ludwigs-Universität Freiburg, Germany
Editors
Stefan Weber Erik Schleicher
Institut für Physikalische Chemie Institut für Physikalische Chemie
Albert-Ludwigs-Universität Freiburg Albert-Ludwigs-Universität Freiburg
Germany Germany
We would like to dedicate this volume to our long-term collaborator Kenichi Hitomi, who
died unexpectedly and much too young on December 30, 2013. Kenichi was a highly
enthusiastic flavin enzymologist who made seminal contributions, both at the Scripps
Research Institute and at Osaka University, to understanding various light-active flavoproteins
such as photolyases and cryptochromes. We mourn his untimely death and keep his
friendship and scientific expertise in our hearts.
Preface
After the first discovery of the flavin cofactor in the early 1930s, it was soon recognized that
riboflavin and its derivatives are essential and ubiquitously encountered organic cofactors in
biology. Since these pioneering years, a number of important protein classes harboring fla-
vin cofactors have been isolated and their specific functions elucidated based on the method
spectrum that was available at the respective time. In 1999, Chapman and Reid presented
a comprehensive volume in the “Methods in Molecular Biology” series devoted solely to
flavoproteins. The focus of this issue was on general characterizations of flavins and flavo-
proteins, using optical, vibrational, and magnetic-resonance spectroscopies, as well as on
computational methods. Moreover, protocols for cofactor reconstitution, the handling of
flavoproteins, and protein modification were provided. Since then, despite being only about
15 years later, tremendous progress was made on improving these techniques and methods.
Increased spectral and temporal resolutions, in combination with sensitivity enhancements
have been accomplished for most spectroscopic techniques. These are of course essential
and beneficial for in-depth investigations of flavoproteins, as well as of free flavins in isotro-
pic and anisotropic media. With methods for determining primary to quaternary protein
structures being nowadays more or less routinely available and extremely successful, precise
spectroscopic data can now be correlated to gain structure–function relationships at a
molecular level. This is aided by the continuously increasing computational power and
methodology. Moreover, novel roadmaps for cofactor synthesis have been developed with
the aim of incorporating stable isotopes at virtually any desired position in the flavin and/
or chemically altering the isoalloxazine moiety. On the other hand, completely new classes
of flavoproteins with yet-to-be-fully unraveled functions have been discovered in the last
one and a half decades, such as the light-activated flavoproteins that are involved in light
signaling and DNA repair, or the redox-sensing flavoprotein apoptosis-inducing factor, that
is involved in initiating a caspase-independent pathway of apoptosis.
With the present volume, we intend to encounter the above-mentioned developments
and are proud to present an update to “Flavoprotein Protocols.” Different from the other
issues of this series, we not only included “conventional” protocols but also invited distin-
guished scientists to provide protocols in a review style to exemplify the variety, the power,
and the success of modern techniques and methods in application to flavoproteins.
Part I of this volume covers general properties, syntheses, and applications of free fla-
vins as well as its analogs, and flavoproteins. Specifically, Chapter 1 by Ana Edwards opens
up the field of flavins and flavoproteins by introducing the structure and general properties
of flavins. In Chapter 2, the detailed biosynthesis of flavins and its derivatives is described
by Markus Fischer and coworkers. Matthias Mack and coworkers have provided an over-
view on the synthesis and the application of natural flavin analogs (Chapter 3). Many spec-
troscopic techniques rely on isotope-labeled flavins for assignment and/or resolution
enhancement. Therefore, a comprehensive strategy for isotope labeling of flavins is pre-
sented in Chapter 4 under the aegis of Adelbert Bacher and Markus Fischer. Two classes of
flavoproteins, namely flavin-containing electron-transfer dehydrogenases and oxygenases,
vii
viii Preface
are presented in Chapters 5 and 6 by the groups of Willem van Berkel and Miagros Medina,
respectively. This part closes with a contribution by Katja Becker and coworkers on applica-
tions of flavins to medicine (Chapter 7).
Part II covers characterizations of flavins and flavoproteins using modern experimental
techniques as well as theoretical methods. The reader should keep in mind that this volume
is designed as an upgrade with respect to the first volume of the “Flavoprotein Protocols.”
Therefore, a novice to flavoproteins is strongly encouraged to first study the book from
1999 to get introduced into the very basics of flavoprotein handling.
In the present volume, Chapter 8, written by the group of Nigel Scrutton, covers a
practical protocol for the use of kinetic isotope effects as probes to determine the enzymatic
activity of flavoproteins. Aleksandra Bury and Klaas Hellingwerf provided an article that
deals with the in vivo characterization of redox states exemplified by flavin-containing pho-
toreceptors, an upgrade to the general protocol for potentiometric measurement of oxida-
tion–reduction potentials of flavins. A global overview on recent progress in computational
spectroscopy with emphasis to the dynamics of photoactive flavoproteins was contributed
by Tatiana Domratcheva and coworkers (Chapter 10).
Chapters 11–17 focus on individual spectroscopic techniques. These chapters are
arranged in terms of their respective excitation energies. Hence, this part starts with three
chapters dealing with magnetic resonance spectroscopies: In Chapters 11 and 12, Franz
Müller and Anne-Francis Miller cover the field of modern NMR spectroscopy of flavins and
flavoproteins, both in liquids as well as in solids. Additionally, Chapter 11 provides a com-
prehensive database of chemical shifts of various nuclei in flavin derivatives, flavoproteins,
and chemically modified flavins. Chapter 13 by the group of Robert Bittl reviews a number
of timely electron paramagnetic resonance experiments that have been successfully used to
investigate and characterize flavoprotein radicals and flavin-based radical pairs. The adjacent
region of electromagnetic radiation is the infrared region, from which information on
molecular vibrations can be obtained. Two techniques, Fourier transform infrared spectros-
copy and resonance Raman spectroscopy are introduced in detail by Hideki Kandori and
Teizo Kitagawa with their coworkers, respectively.
Last but not least, two advanced optical methods and their applications to flavins
and flavoproteins are described in Chapters 16 and 17. First, Tilo Mathes, Ivo van
Stokkum, and John Kennis introduce the setup of ultrafast spectroscopy and the analysis
of spectra obtained from this method using global analyses. And second, Robert Stanley
and coworkers demonstrate how information on excited states of flavins can be obtained
via Stark spectroscopy.
The editors are indebted to all contributors for their efforts and persistent verve in
preparing and editing their chapters. We also wish to thank J and J Walker for giving us the
opportunity to coordinate this volume and for their endless patience. At last, we hope that
this volume will convince many readers that the field of flavoproteins is timeless and still
evolving, and that the modern protocols presented in this volume can help to tackle the
countless questions that need to be answered to more fully comprehend the vast diversity
and specificity of flavin-governed biological processes.
Dedication . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . vii
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
PART I
1 Structure and General Properties of Flavins . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
Ana Maria Edwards
2 Recent Advances in Riboflavin Biosynthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
Ilka Haase, Tobias Gräwert, Boris Illarionov, Adelbert Bacher,
and Markus Fischer
3 Natural Riboflavin Analogs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
Danielle Biscaro Pedrolli, Frank Jankowitsch, Julia Schwarz,
Simone Langer, Shinobu Nakanishi, and Matthias Mack
4 A Roadmap to the Isotopolog Space of Flavocoenzymes . . . . . . . . . . . . . . . . . 65
Adelbert Bacher, Boris Illarionov, Wolfgang Eisenreich,
and Markus Fischer
5 Electron Transferases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
Patricia Ferreira, Marta Martínez-Júlvez, and Milagros Medina
6 Aldonolactone Oxidoreductases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95
Nicole G.H. Leferink and Willem J.H. van Berkel
7 Flavins and Flavoproteins: Applications in Medicine . . . . . . . . . . . . . . . . . . . . 113
Esther Jortzik, Lihui Wang, Jipeng Ma, and Katja Becker
PART II
8 Practical Aspects on the Use of Kinetic Isotope Effects
as Probes of Flavoprotein Enzyme Mechanisms . . . . . . . . . . . . . . . . . . . . . . . . 161
Christopher R. Pudney, Sam Hay, and Nigel S. Scrutton
9 On the In Vivo Redox State of Flavin-Containing
Photosensory Receptor Proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 177
Aleksandra Bury and Klaas J. Hellingwerf
10 Computational Spectroscopy, Dynamics, and Photochemistry
of Photosensory Flavoproteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
Tatiana Domratcheva, Anikό Udvarhelyi,
and Abdul Rehaman Moughal Shahi
11 NMR Spectroscopy on Flavins and Flavoproteins . . . . . . . . . . . . . . . . . . . . . . 229
Franz Müller
12 Solid-State NMR of Flavins and Flavoproteins. . . . . . . . . . . . . . . . . . . . . . . . . 307
Anne-Frances Miller
ix
x Contents
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 467
Contributors
xi
xii Contributors
Abstract
Flavins are a family of yellow-colored compounds with the basic structure of 7,8-dimethyl-10-alkylisoalloxazine.
Riboflavin, commonly known as vitamin B2, is an essential component of living organisms and is the precur-
sor of all biologically important flavins. In this chapter, the redox properties of flavins are described, with
special emphasis in their ability to participate in both one-electron and two-electron transfer processes; hence,
flavins are indispensable mediators between two-electron and one-electron processes in biological systems.
The photophysical and photochemical properties of flavins are also discussed. All oxidized flavins exhibit
strong absorption in the ultraviolet and visible regions and an intense yellow-green fluorescence (in their
neutral oxidized form). Flavins are thermostable compounds; however, they are photosensitive. In the
absence of an external reductant, the isoalloxazine ring system undergoes intramolecular photoreduction.
Some flavins are efficient photosensitizers; they can induce photomodifications of compounds that are not
directly modified by visible light.
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_1, © Springer Science+Business Media New York 2014
3
4 Ana Maria Edwards
NH2
O O N N
OH O P O P
N N
O O O
HO HO
OH OH
OH OH
OH OH
N N O N N O
N N
N H N H
O O
RF FAD
O P O
O
HO
OH
OH
N N O
N
N H
FMN
Fig. 1 Chemical structures of riboflavin (RF), flavin mononucleotide (FMN), and flavin adenine dinucleotide (FAD)
R R R
+ H
N N O N N O N N O
pK ~ 0 pK ~ 10
NH NH N
N N N
O O O
FLH+ox FL ox FL ox (-H+)
e-
R R R
H
N N O pK ~ 2 N N O pK ~ 8 N N O
+ NH NH NH
N N N
H O OH O
H 2FL+ HFL FL
e-
R R R
H H
N N O N N O N N O
pK ~ 0 pK ~ 6
+
NH NH NH
N N N
H H
H H O O O
+ H2FL red HFL red
H 2FLH red
protein can stabilize the neutral radical species over the whole
range of pH values at which the enzyme is stable, the pKa is shifted
up significantly from 8.5. In other cases if the semiquinone anion
is stabilized, the pKa is decreased significantly. There are some
enzymes, of which glucose oxidase was the first example [14], that
show such a pKa that the identification of both forms is possible.
In addition to these redox/ionic forms (each of them with differ-
ent canonical forms), there are other electronic states, known as
charge-transfer states. These are electronic states that do not
belong to any of the three redox states, but in which partial charge
is transferred to or from one of the three redox states. All these
redox states, ionic and charge transfer ones, are the origin for the
different colors of flavins and flavoproteins [15]. The large spectral
differences between the various flavin redox–ionic–electronic states
make it possible to monitor the events occurring in catalysis using
flavin itself as a reporter.
Among the known redox coenzymes, flavins are unique in that
they can participate in both one-electron and two-electron transfer
processes. Other redox cofactors usually catalyze exclusively either
one- or two-electron transfer processes. Active redox metalloen-
zymes catalyze only the one-electron process, and nicotinamide
nucleotides, with wide distribution in biological systems, are involved
in only two-electron redox reactions. This is because the radical
forms of the pyridine ring are not stable enough to be involved in
enzymatic reactions. For these reasons, flavoenzymes are indispens-
able mediators between two-electron and one-electron processes,
as is the case of the well-known mitochondrial and chloroplast
electron-transport chains.
The reactions catalyzed by a flavoenzyme always involve two
separate half-reactions, reductive and oxidative half-reactions, both
of which are necessary for the turnover of the enzyme. In oxida-
tion reactions, the former is the process in which a substrate or an
electron donor is oxidized concomitant with flavin reduction.
In the latter process, the reduced flavin is oxidized by another sub-
strate or an electron acceptor (for reduction reactions the inverse
pathway occurs). This is required because the flavin is strongly
attached to the active site of the enzyme, where it must be recov-
ered in the catalytically active redox state. By comparison, this is
not the case for enzymes with nicotinamide nucleotides as redox
cofactors, where the cofactor leaves the enzyme when reduced
(or oxidized) and is replaced by a different cofactor molecule with
the required redox state. The leaving cofactor is recovered in a
different process, e.g., in complex 1 of the mitochondrial electron
transport chain, for NADH/NAD+ where the FMN cofactor of
NADH dehydrogenase acts as oxidant.
Flavins show an extremely high chemical versatility, which is
reflected to the flavoenzymes; however, each of the enzymes is also
characterized by a strict specificity. Flavoproteins have been
8 Ana Maria Edwards
Table 1
Structure of riboflavin and its photoproducts
riboflavin,2’,3’,4’,5’-tetrabutyrate ―CH2―(CHOR2)3―CH2OR2
R2 = ―CO―CH2CH2CH3
1
FL + hν FL* (1)
1 3
FL* FL* (2)
3
FL* FL’ (3)
3 1
FL* + O2 FL + O2 (4)
3 •– •+
FL* + S FL +S (5)
•– + •
FL +H FLH (6)
• +
2 FL + 2H FL + FLH2 (7)
• •
FLH2 + O2 FLH2 + + O2 – (8)
•+ •–
FLH2 + O2 FL + H2O2 (9)
Scheme 2 Major kinetic processes in the visible-light irradiation of an air-equilibrated solution of a flavin
molecule (FL) in the presence or absence of an external reductant (S)
4 Concluding Remarks
References
1. Wynter Blyth A (1879) The composition of semiquinones. A new method for the quantitative
cows’ milk in health and disease. J Chem Soc production of flavoprotein semiquinones.
Trans 35:530–538 Biochemistry 5:3181–3189
2. Kuhn R, Weygand F (1934) Synthetic vitamin 15. Miura R (2001) Versatility and specificity in
B2. Berichte der deutschen chemischen flavoenzymes: control mechanisms of flavin
Gesellschaft 67B:2084–2085 reactivity. Chem Rec 1:183–194
3. Karrer P, Schopp K, Benz F (1935) Synthesen 16. Massey V, Hemmerich P (1980) Active-site
von Flavinen IV. Helv Chim Acta 18:426–429 probes of flavoproteins. Biochem Soc Trans
4. COMA (1991) Committee on medical aspects 8:246–257
of food and nutrition policy: dietary reference 17. Fraaije MW, Mattevi A (2000) Flavoenzymes:
values for food energy and nutrients for the diverse catalysts with recurrent features. Trends
UK. HMSO, London Biochem Sci 25:126–132
5. Theorell H (1935) Purification of the active 18. Ahmad I, Vaid FHM (2006) Photochemistry
group of the yellow enzyme. Biochem Z 275: of flavins in aqueous and organic solvents.
344–346 In: Silva E, Edwards AM (eds) Flavins photo-
6. Krebs HA (1935) Metabolism of amino acids. chemistry and photobiology, Comprehensive
III. Deamination of amino acids. Biochem J series in photochemical and photobiological
29:1620–1644 sciences (Häder, D.P. and Jori, G. Series Eds).
7. Warburg O, Christian W (1933) The yellow RSC, Cambridge
enzyme and its functions. Biochem Z 266: 19. van der Berg PAW, Windengren J, Hink MA,
377–411 Rigler R, Visser AJWG (2001) Fluorescence
8. Massey V (2000) The chemical and biological correlation spectroscopy of flavins and flavoen-
versatility of riboflavin. Biochem Soc Trans 28: zymes: photochemical and photophysical
283–296 aspects. Spectrochim Acta A 57:2135–2144
9. Dym O, Eisenberg D (2001) Sequence– 20. Swartz TE, Corchnoy SB, Christie JM, Lewis
structure analysis of FAD-containing proteins. JW, Szundi I, Briggs WR, Bogomolni RA
Protein Sci 10:1712–1728 (2001) The photocycle of a flavin-binding
domain of the blue light photoreceptor pho-
10. Müller F (1991) Free flavins: synthesis, chemi- totropin. J Biol Chem 276:36493–36500
cal and physical properties. In: Müller F (ed)
Chemistry and biochemistry of flavoenzymes, 21. Briggs WR (2006) Flavin-based photorecep-
vol I. CRC Press, Boca Raton, FL, pp 1–71 tors in plants. In: Silva E, Edwards AM (eds)
Flavins photochemistry and photobiology,
11. Heelis PF (1982) The photophysical and Comprehensive series in photochemical and
photochemical properties of flavins (isoalloxa- photobiological sciences (Häder, D.P. and Jori,
zines). Chem Soc Rev 11:15–39 G. Series Eds). RSC, Cambridge
12. Walsh JD, Miller AF (2003) Flavin reduction 22. Cairns WL, Metzler DE (1971) Photochemical
potential tuning by substitution and bending. degradation of flavins. VI. A new photoproduct
J Mol Struct 623:185–195 and its use in studying the photolytic mechanism.
13. Fraaije MW, van den Heuvel RH, van Berkel WJ, J Am Chem Soc 13:2772–2777
Mattevi A (1999) Covalent flavinylation is essen- 23. Kay CWM, Bacher A, Fischer M, Richter G,
tial for efficient redox catalysis in vanillyl–alcohol Schleicher E, Weber S (2006) Flavins photo-
oxidase. J Biol Chem 274:35514–35520 chemistry and photobiology. In: Silva E,
14. Massey V, Palmer G (1966) On the existence Edwards AM (eds) Blue light-initiated DNA
of spectrally distinct classes of flavoprotein repair by photolyase, Comprehensive series in
Structure and General Properties of Flavins 13
Abstract
Riboflavin is biosynthesized from GTP and ribulose 5-phosphate. Whereas the early reactions conducing
to 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione 5′-phosphate show significant taxonomic
variation, the subsequent reaction steps are universal in all taxonomic kingdoms. With the exception of a
hitherto elusive phosphatase, all enzymes of the pathway have been characterized in some detail at the
structural and mechanistic level. Some of the pathway enzymes (GTP cycloyhdrolase II, 3,4-dihydroxy-
2-butanone 4-phosphate synthase, riboflavin synthase) have exceptionally complex reaction mechanisms.
The commercial production of the vitamin is now entirely based on highly productive fermentation
processes. Due to their absence in animals, the pathway enzymes are potential targets for the development
of novel anti-infective drugs.
Key words Biosynthesis of flavocoenzymes, Riboflavin synthase, Lumazine synthase, GTP cyclohy-
drolase II, Riboflavin biosynthesis
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_2, © Springer Science+Business Media New York 2014
15
16 Ilka Haase et al.
2 Biosynthesis of Riboflavin
Fig. 1 Biosynthesis of flavocoenzymes. Enzymes are designated by capital letters which are used throughout
the manuscript for reference to the Figure. Reprinted (adapted) with permission from (Römisch W., Eisenreich W.,
Richter G., Bacher A. (2002) Rapid one-pot synthesis of riboflavin isotopomers. J Org Chem. 67, 8890–8894).
Copyright (2002) American Chemical Society
2.1 GTP The conversion of GTP into 2 requires the hydrolytic cleavage of
Cyclohydrolase II two carbon nitrogen bonds (affording formic acid as second prod-
(Reaction B) uct) and the hydrolysis of a phosphoanhydride bond affording
inorganic pyrophosphate. In eubacteria and eukaryotes, these
reaction steps are all catalyzed by GTP cyclohydrolase II (Fig. 2)
[11, 12].
Besides the formation of the first committed intermediate of
riboflavin synthase, GTP cyclohydrolase II also produces GMP
(15) by release of pyrophosphate from GTP. The product ratio of
GMP and 2 is about 1:10 [13]. The action of GTP cyclohydrolase
II in H218O is conducive to the incorporation of 18O into the
reaction product 2 as well as into 15 produced as a side product
(see above). The first reaction step is therefore believed to involve
the covalent linkage of a GMP moiety to an amino acid side
chain, most likely Arg128 [14], under release of pyrophosphate.
The hydrolytic cleavage of the phosphoamide bond affords the minor
Recent Advances in Riboflavin Biosynthesis 19
Fig. 3 Crystal structure of E. coli GTP cyclohydrolase II in complex with a non-hydrolyzable GTP analog (orange)
and zinc (red ) [14]
2.2 GTP In archaea, GTP cyclohydrolase III (A in Fig. 4) cleaves only one
Cyclohydrolase III carbon nitrogen bond and thus yields the amide 3 as product
(Reaction A) and (Fig. 4) [17, 18]. Formate is then released by a second hydrolase
Formamidelyase (C) [19]. The product 3 of GTP cyclohydrolase III can also be
(Reaction C) obtained with certain mutants of GTP cyclohydrolase II of E. coli
[15, 20].
Fig. 9 Reaction mechanism of methylerythritol 4-phosphate synthase; right: substrate coupled to the active site
2.5 Lumazine Lumazine synthase catalyzes the penultimate step in the biosynthesis
Synthase (Reaction J) of riboflavin which involves the condensation of 5-amino-6-
ribitylamino-2,4(1H,3H)-pyrimidinedione (7) with 3,4-dihy-
droxy-2-butanone 4-phosphate (9) under release of inorganic
phosphate and two water molecules. The multistep reaction
mechanism appears mechanistically straightforward. The initial
formation of a Schiff base (35) is followed by elimination and ring
closure (Fig. 12).
The reaction can proceed without enzyme catalysis at room
temperature in dilute aqueous solution at neutral pH [33]. In fact,
Recent Advances in Riboflavin Biosynthesis 25
Fig. 13 Crystal structures of pentameric [56] and icosahedral lumazine synthases. See also [48–55, 57–64]
3 Deazaflavin Cofactors
4 Roseoflavin
Fig. 20 Inhibitors of lumazine synthase 66, 67, 69 [122, 125], and riboflavin
synthase 70 [123]
34 Ilka Haase et al.
Acknowledgements
References
1. Chaves I, Pokorny R, Byrdin M, Hoang N, Ashbya gossypii, Candida famata, or Bacillus
Ritz T, Brettel K, Essen LO, van der Horst subtilis compete with chemical riboflavin pro-
GT, Batschauer A, Ahmad M (2011) The duction. Appl Microbiol Biotechnol
cryptochromes: blue light photoreceptors in 53:509–516
plants and animals. Annu Rev Plant Biol 5. Bacher A, Eberhardt S, Eisenreich W, Fischer
62:335–364 M, Herz S, Illarionov B, Kis K, Richter G
2. Christie JM (2007) Phototropin blue-light (2001) Biosynthesis of riboflavin. Vitam
receptors. Annu Rev Plant Biol 58:21–45 Horm 61:1–49
3. Sancar A (2008) Structure and function of 6. Bacher A, Eberhardt S, Fischer M, Kis K,
photolyase and in vivo enzymology: 50th Richter G (2000) Biosynthesis of vitamin B2
anniversary. J Biol Chem 283:32153–32157 (riboflavin). Annu Rev Nutr 20:153–167
4. Stahmann KP, Revuelta JL, Seulberger H 7. Fischer M, Bacher A (2005) Biosynthesis of
(2000) Three biotechnical processes using flavocoenzymes. Nat Prod Rep 22:324–350
Recent Advances in Riboflavin Biosynthesis 35
8. Fischer M, Bacher A (2006) Biosynthesis of vitamin B2. An essential zinc ion at the catalytic
vitamin B2 in plants. Physiol Plant 126: site of GTP cyclohydrolase II. Eur J Biochem
304–318 269:5264–5270
9. Fischer M, Bacher A (2011) Biosynthesis of 21. Chatwell L, Krojer T, Fidler A, Romisch W,
vitamin B2 and flavocoenzymes in plants. Adv Eisenreich W, Bacher A, Huber R, Fischer M
Bot Res 58:93–152 (2006) Biosynthesis of riboflavin: structure
10. Fischer M, Bacher A (2011) Biosynthesis of and properties of 2,5-diamino-6-ribosylamino-
vitamin B2: a unique way to assemble a xylene 4(3H)-pyrimidinone 5′-phosphate reductase
ring. Chembiochem 12:670–680 of Methanocaldococcus jannaschii. J Mol Biol
11. Foor F, Brown GM (1975) Purification and 359:1334–1351
properties of guanosine triphosphate cyclohy- 22. Chen SC, Chang YC, Lin CH, Liaw SH
drolase II from Escherichia coli. J Biol Chem (2006) Crystal structure of a bifunctional
250:3545–3551 deaminase and reductase from Bacillus subtilis
12. Foor F, Brown GM (1980) GTP cyclohydro- involved in riboflavin biosynthesis. J Biol
lase II from Escherichia coli. Methods Chem 281:7605–7613
Enzymol 66:303–307 23. Stenmark P, Moche M, Gurmu D, Nordlund
13. Ritz H, Schramek N, Bracher A, Herz S, P (2007) The crystal structure of the bifunc-
Eisenreich W, Richter G, Bacher A (2001) tional deaminase/reductase RibD of the
Biosynthesis of riboflavin: studies on the riboflavin biosynthetic pathway in Escherichia
mechanism of GTP cyclohydrolase II. J Biol coli: implications for the reductive mechanism.
Chem 276:22273–22277 J Mol Biol 373:48–64
14. Ren J, Kotaka M, Lockyer M, Lamb HK, 24. Chen SC, Lin YH, Yu HC, Liaw SH (2009)
Hawkins AR, Stammers DK (2005) GTP Complex structure of Bacillus subtilis RibG:
cyclohydrolase II structure and mechanism. the reduction mechanism during riboflavin
J Biol Chem 280:36912–36919 biosynthesis. J Biol Chem 284:1725–1731
15. Bracher A, Fischer M, Eisenreich W, Ritz H, 25. Yuan D, Wang Q, Gao W, Sheng F, Zhang Z,
Schramek N, Boyle P, Gentili P, Huber R, Nar Lu Q, Cang H, Bi R (2007) Cloning, expres-
H, Auerbach G, Bacher A (1999) Histidine sion, purification, characterization, crystalliza-
179 mutants of GTP cyclohydrolase I catalyze tion and X-ray diffraction of bifunctional
the formation of 2-amino-5-formylamino- pyrimidine deaminase/reductase from Shigella
6-ribofuranosylamino-4(3H)-pyrimidinone tri- flexneri 2a. Protein Pept Lett 14:925–927
phosphate. J Biol Chem 274:16727–16735 26. Le Van Q, Keller PJ, Bown DH, Floss HG,
16. Lehmann M, Degen S, Hohmann HP, Wyss Bacher A (1985) Biosynthesis of riboflavin in
M, Bacher A, Schramek N (2009) Bacillus subtilis: origin of the four-carbon
Biosynthesis of riboflavin. Screening for an moiety. J Bacteriol 162:1280–1284
improved GTP cyclohydrolase II mutant. 27. Volk R, Bacher A (1990) Studies on the 4-car-
FEBS J 276:4119–4129 bon precursor in the biosynthesis of riboflavin.
17. Graham DE, Xu H, White RH (2002) A Purification and properties of L-3,4-dihydroxy-
member of a new class of GTP cyclohydro- 2-butanone-4-phosphate synthase. J Biol
lases produces formylaminopyrimidine nucle- Chem 265:19479–19485
otide monophosphates. Biochemistry 28. Volk R, Bacher A (1991) Biosynthesis of ribo-
41:15074–15084 flavin. Studies on the mechanism of L-3,4-
18. Morrison SD, Roberts SA, Zegeer AM, dihydroxy-2-butanone 4-phosphate synthase.
Montfort WR, Bandarian V (2008) A new use J Biol Chem 266:20610–20618
for a familiar fold: the X-ray crystal structure 29. Richter G, Volk R, Krieger C, Lahm HW,
of GTP-bound GTP cyclohydrolase III from Rothlisberger U, Bacher A (1992)
Methanocaldococcus jannaschii reveals a two Biosynthesis of riboflavin: cloning, sequenc-
metal ion catalytic mechanism. Biochemistry ing, and expression of the gene coding for
47:230–242 3,4-dihydroxy-2-butanone 4-phosphate syn-
19. Grochowski LL, Xu H, White RH (2009) thase of Escherichia coli. J Bacteriol 174:
An iron(II) dependent formamide hydrolase 4050–4056
catalyzes the second step in the archaeal bio- 30. Richter G, Krieger C, Volk R, Kis K, Ritz H,
synthetic pathway to riboflavin and 7,8-dide- Gotze E, Bacher A (1997) Biosynthesis of ribo-
methyl-8-hydroxy-5-deazariboflavin. flavin: 3,4-dihydroxy-2-butanone-4-phosphate
Biochemistry 48:4181–4188 synthase. Methods Enzymol 280:374–382
20. Kaiser J, Schramek N, Eberhardt S, Püttmer S, 31. Goetze E, Kis K, Eisenreich W, Yamauchi N,
Schuster M, Bacher A (2002) Biosynthesis of Kakinuma K, Bacher A (1998) Biosynthesis of
36 Ilka Haase et al.
52. Koch M, Breithaupt C, Gerhardt S, Haase I, subunit capsids with bound substrate analogue
Weber S, Cushman M, Huber R, Bacher A, inhibitor at 2.4 A resolution. J Mol Biol
Fischer M (2004) Structural basis of charge 253:151–167
transfer complex formation by riboflavin 61. Zhang X, Meining W, Cushman M, Haase I,
bound to 6,7-dimethyl-8-ribityllumazine Fischer M, Bacher A, Ladenstein R (2003)
synthase. Eur J Biochem 271:3208–3214 A structure-based model of the reaction cat-
53. Kumar P, Singh M, Karthikeyan S (2011) alyzed by lumazine synthase from Aquifex
Crystal structure analysis of icosahedral luma- aeolicus. J Mol Biol 328:167–182
zine synthase from Salmonella typhimurium, 62. Zhang X, Meining W, Fischer M, Bacher A,
an antibacterial drug target. Acta Crystallogr Ladenstein R (2001) X-ray structure analysis
D Biol Crystallogr 67:131–139 and crystallographic refinement of lumazine
54. Meining W, Moertl S, Fischer M, Cushman synthase from the hyperthermophile Aquifex
M, Bacher A, Ladenstein R (2000) The aeolicus at 1.6 A resolution: determinants of
atomic structure of pentameric lumazine syn- thermostability revealed from structural com-
thase from Saccharomyces cerevisiae at 1.85 A parisons. J Mol Biol 306:1099–1114
resolution reveals the binding mode of a 63. Zhang Y, Illarionov B, Morgunova E, Jin G,
phosphonate intermediate analogue. J Mol Bacher A, Fischer M, Ladenstein R, Cushman
Biol 299:181–197 M (2008) A new series of N-[2,4-dioxo-6-d-
55. Morgunova E, Illarionov B, Saller S, Popov ribitylamino- 1,2,3,4-tetrahydropyrimidin-
A, Sambaiah T, Bacher A, Cushman M, 5-yl]oxalamic acid derivatives as inhibitors of
Fischer M, Ladenstein R (2010) Structural lumazine synthase and riboflavin synthase:
study and thermodynamic characterization of design, synthesis, biochemical evaluation,
inhibitor binding to lumazine synthase from crystallography, and mechanistic implications.
Bacillus anthracis. Acta Crystallogr D Biol J Org Chem 73:2715–2724
Crystallogr 66:1001–1011 64. Ladenstein R, Ritsert K, Huber R, Richter G,
56. Morgunova E, Illarionov B, Sambaiah T, Bacher A (1994) The lumazine synthase/
Haase I, Bacher A, Cushman M, Fischer M, riboflavin synthase complex of Bacillus subtilis.
Ladenstein R (2006) Structural and thermo- X-ray structure analysis of hollow reconsti-
dynamic insights into the binding mode of tuted beta-subunit capsids. Eur J Biochem
five novel inhibitors of lumazine synthase 223:1007–1017
from Mycobacterium tuberculosis. FEBS J 65. Zhang X, Konarev PV, Petoukhov MV,
273:4790–4804 Svergun DI, Xing L, Cheng RH, Haase I,
57. Morgunova E, Meining W, Illarionov B, Fischer M, Bacher A, Ladenstein R, Meining
Haase I, Jin G, Bacher A, Cushman M, W (2006) Multiple assembly states of luma-
Fischer M, Ladenstein R (2005) Crystal zine synthase: a model relating catalytic func-
structure of lumazine synthase from tion and molecular assembly. J Mol Biol
Mycobacterium tuberculosis as a target for 362:753–770
rational drug design: binding mode of a new 66. Ladenstein R, Schneider M, Huber R,
class of purinetrione inhibitors. Biochemistry Bartunik HD, Wilson K, Schott K, Bacher A
44:2746–2758 (1988) Heavy riboflavin synthase from
58. Morgunova E, Saller S, Haase I, Cushman M, Bacillus subtilis. Crystal structure analysis of
Bacher A, Fischer M, Ladenstein R (2007) the icosahedral beta 60 capsid at 3.3 A resolu-
Lumazine synthase from Candida albicans as tion. J Mol Biol 203:1045–1070
an anti-fungal target enzyme: structural and 67. Schott K, Ladenstein R, Konig A, Bacher A
biochemical basis for drug design. J Biol (1990) The lumazine synthase-riboflavin
Chem 282:17231–17241 synthase complex of Bacillus subtilis.
59. Persson K, Schneider G, Jordan DB, Viitanen Crystallization of reconstituted icosahedral
PV, Sandalova T (1999) Crystal structure beta-subunit capsids. J Biol Chem 265:
analysis of a pentameric fungal and an icosa- 12686–12689
hedral plant lumazine synthase reveals the 68. Fischer M, Schott AK, Romisch W,
structural basis for differences in assembly. Ramsperger A, Augustin M, Fidler A, Bacher
Protein Sci 8:2355–2365 A, Richter G, Huber R, Eisenreich W (2004)
60. Ritsert K, Huber R, Turk D, Ladenstein R, Evolution of vitamin B2 biosynthesis. A novel
Schmidt-Base K, Bacher A (1995) Studies on class of riboflavin synthase in Archaea. J Mol
the lumazine synthase/riboflavin synthase Biol 343:267–278
complex of Bacillus subtilis: crystal structure 69. Milne JL, Shi D, Rosenthal PB, Sunshine JS,
analysis of reconstituted, icosahedral beta- Domingo GJ, Wu X, Brooks BR, Perham RN,
38 Ilka Haase et al.
the presence of two different flavin chromo- ria: localization of the single ligand binding
phores. Biochemistry 27:1758–1765 site to the N-terminal domain. Biol Chem
95. Glas AF, Maul MJ, Cryle M, Barends TR, 388:1313–1323
Schneider S, Kaya E, Schlichting I, Carell T 108. Illarionov B, Lee CY, Bacher A, Fischer M,
(2009) The archaeal cofactor F0 is a light- Eisenreich W (2005) Random isotopolog
harvesting antenna chromophore in libraries for protein perturbation studies. 13C
eukaryotes. Proc Natl Acad Sci U S A NMR studies on lumazine protein of
106:11540–11545 Photobacterium leiognathi. J Org Chem
96. Maul MJ, Barends TR, Glas AF, Cryle MJ, 70:9947–9954
Domratcheva T, Schneider S, Schlichting I, 109. Ainciart N, Zylberman V, Craig PO, Nygaard
Carell T (2008) Crystal structure and mecha- D, Bonomi HR, Cauerhff AA, Goldbaum FA
nism of a DNA (6-4) photolyase. Angew (2010) Sensing the dissociation of a poly-
Chem Int Ed Engl 47:10076–10080 meric enzyme by means of an engineered
97. Mueller M, Carell T (2009) Structural biol- intrinsic probe. Proteins 79:1079–1088
ogy of DNA photolyases and cryptochromes. 110. Lalli M, Facey SJ, Hauer B (2011) Protein
Curr Opin Struct Biol 19:277–285 containers—promising tools for the future.
98. Petersen JL, Ronan PJ (2010) Critical role of Chem Bio Chem 12:1519–1521
7,8-didemethyl-8-hydroxy-5-deazariboflavin 111. Sutter M, Boehringer D, Gutmann S,
for photoreactivation in Chlamydomonas rein- Gunther S, Prangishvili D, Loessner MJ,
hardtii. J Biol Chem 285:32467–33275 Stetter KO, Weber-Ban E, Ban N (2008)
99. Eisenreich W, Schwarzkopf B, Bacher A Structural basis of enzyme encapsulation into
(1991) Biosynthesis of nucleotides, flavins, a bacterial nanocompartment. Nat Struct Mol
and deazaflavins in Methanobacterium thermo- Biol 15:939–947
autotrophicum. J Biol Chem 266:9622–9631 112. Cushman M, Jin G, Sambaiah T, Illarionov B,
100. Reuke B, Korn S, Eisenreich W, Bacher A Fischer M, Ladenstein R, Bacher A (2005)
(1992) Biosynthetic precursors of deazafla- Design, synthesis, and biochemical evaluation
vins. J Bacteriol 174:4042–4049 of 1,5,6,7-tetrahydro-6,7-dioxo-9-D-ribityl-
aminolumazines bearing alkyl phosphate sub-
101. Graham DE, Xu H, White RH (2003)
stituents as inhibitors of lumazine synthase
Identification of the 7,8-didemethyl-8-
and riboflavin synthase. J Org Chem
hydroxy-5-deazariboflavin synthase required
70:8162–8170
for coenzyme F(420) biosynthesis. Arch
Microbiol 180:455–564 113. Cushman M, Mavandadi F, Kugelbrey K,
Bacher A (1998) Synthesis of 2,6-dioxo-
102. Otani S, Takatsu M, Nakano M, Kasai S,
(1H,3H)-9-N-ribitylpurine and 2,6-dioxo-
Miura R (1974) Letter: Roseoflavin, a new
(1H,3H)-8-aza-9-N-ribitylpurine as
antimicrobial pigment from Streptomyces .
inhibitors of lumazine synthase and riboflavin
J Antibiot (Tokyo) 27:86–87
synthase. Bioorg Med Chem 6:409–415
103. Matsui K, Juri N, Kubo Y, Kasai S (1979)
114. Cushman M, Mavandadi F, Yang D, Kugelbrey
Formation of roseoflavin from guanine
K, Kis K, Bacher A (1999) Synthesis and bio-
through riboflavin. J Biochem 86:167–175
chemical evaluation of bis(6,7-dimethyl-8-D-
104. Jankowitsch F, Kuhm C, Kellner R, Kalinowski ribityllumazines) as potential bisubstrate
J, Pelzer S, Macheroux P, Mack M (2011) A analogue inhibitors of riboflavin synthase.
novel N, N-8-amino-8-demethyl-D-riboflavin J Org Chem 64:4635–4642
Dimethyltransferase (RosA) catalyzing the
115. Cushman M, Yang D, Gerhardt S, Huber R,
two terminal steps of roseoflavin biosynthesis
Fischer M, Kis K, Bacher A (2002) Design,
in Streptomyces davawensis. J Biol Chem
synthesis, and evaluation of 6-carboxyalkyl
286:38275–38285
and 6-phosphonoxyalkyl derivatives of 7-oxo-
105. Chatwell L, Illarionova V, Illarionov B, 8-ribitylaminolumazines as inhibitors of ribo-
Eisenreich W, Huber R, Skerra A, Bacher A, flavin synthase and lumazine synthase. J Org
Fischer M (2008) Structure of lumazine pro- Chem 67:5807–5816
tein, an optical transponder of luminescent
116. Cushman M, Yang D, Mihalic JT, Chen J,
bacteria. J Mol Biol 382:44–55
Gerhardt S, Huber R, Fischer M, Kis K,
106. Lee J (1993) Lumazine protein and the exci- Bacher A (2002) Incorporation of an amide
tation mechanism in bacterial biolumines- into 5-phosphonoalkyl-6-D-ribitylaminopy-
cence. Biophys Chem 48:149–158 rimidinedione lumazine synthase inhibitors
107. Illarionov B, Eisenreich W, Wirth M, Yong results in an unexpected reversal of selectivity
Lee C, Eun Woo Y, Bacher A, Fischer M for riboflavin synthase vs lumazine synthase.
(2007) Lumazine proteins from photobacte- J Org Chem 67:6871–6877
40 Ilka Haase et al.
117. Chen J, Sambaiah T, Illarionov B, Fischer M, 123. Zhao Y, Bacher A, Illarionov B, Fischer M,
Bacher A, Cushman M (2004) Design, synthe- Georg G, Ye QZ, Fanwick PE, Franzblau SG,
sis, and evaluation of acyclic C-nucleoside and Wan B, Cushman M (2009) Discovery and
N-methylated derivatives of the ribitylaminopy- development of the covalent hydrates of
rimidine substrate of lumazine synthase as trifluoromethylated pyrazoles as riboflavin
potential enzyme inhibitors and mechanistic synthase inhibitors with antibiotic activity
probes. J Org Chem 69:6996–7003 against Mycobacterium tuberculosis. J Org
118. Cushman M, Sambaiah T, Jin G, Illarionov B, Chem 74:5297–5303
Fischer M, Bacher A (2004) Design, synthe- 124. Talukdar A, Morgunova E, Duan J, Meining
sis, and evaluation of 9-D-ribitylamino- W, Foloppe N, Nilsson L, Bacher A, Illarionov
1,3,7,9-tetrahydro-2,6,8-purinetriones B, Fischer M, Ladenstein R, Cushman M
bearing alkyl phosphate and alpha, alpha- (2010) Virtual screening, selection and devel-
difluorophosphonate substituents as inhibi- opment of a benzindolone structural scaffold
tors of tiboflavin synthase and lumazine for inhibition of lumazine synthase. Bioorg
synthase. J Org Chem 69:601–612 Med Chem 18:3518–3534
119. Chen J, Illarionov B, Bacher A, Fischer M, 125. Zhang Y, Illarionov B, Bacher A, Fischer M,
Haase I, Georg G, Ye QZ, Ma Z, Cushman M Georg GI, Ye QZ, Vander Velde D, Fanwick
(2005) A high-throughput screen utilizing PE, Song Y, Cushman M (2007) A novel
the fluorescence of riboflavin for identification lumazine synthase inhibitor derived from
of lumazine synthase inhibitors. Anal Biochem oxidation of 1,3,6,8-tetrahydroxy-2,7-
338:124–130 naphthyridine to a tetraazaperylenehexaone
120. Talukdar A, Illarionov B, Bacher A, Fischer derivative. J Org Chem 72:2769–2776
M, Cushman M (2007) Synthesis and enzyme 126. Park EY, Zhang JH, Tajima S, Dwiarti L
inhibitory activity of the s-nucleoside ana- (2007) Isolation of Ashbya gossypii mutant for
logue of the ribitylaminopyrimidine substrate an improved riboflavin production targeting
of lumazine synthase and product of ribofla- for biorefinery technology. J Appl Microbiol
vin synthase. J Org Chem 72:7167–7175 103:468–476
121. Zhang Y, Jin G, Illarionov B, Bacher A, 127. Yang Y, Wang L, Yin J, Wang X, Cheng S,
Fischer M, Cushman M (2007) A new series Lang X, Qu H, Sun C, Wang J, Zhang R
of 3-alkyl phosphate derivatives of (2011) Immunoproteomic analysis of
4,5,6,7-tetrahydro-1-D-ribityl-1H- Brucella melitensis and identification of a new
pyrazolo[3,4-d]pyrimidinedione as inhibitors immunogenic candidate protein for the devel-
of lumazine synthase: design, synthesis, and opment of brucellosis subunit vaccine. Mol
evaluation. J Org Chem 72:7176–7184 Immunol 49:175–184
122. Talukdar A, Breen M, Bacher A, Illarionov B, 128. Bellido D, Craig PO, Mozgovoj MV,
Fischer M, Georg G, Ye QZ, Cushman M Gonzalez DD, Wigdorovitz A, Goldbaum
(2009) Discovery and development of a small FA, Dus Santos MJ (2009) Brucella spp.
molecule library with lumazine synthase inhibi- lumazine synthase as a bovine rotavirus antigen
tory activity. J Org Chem 74:5123–5134 delivery system. Vaccine 27:136–145
Chapter 3
Abstract
Riboflavin analogs have a good potential to serve as basic structures for the development of novel
anti-infectives. Riboflavin analogs have multiple cellular targets, since riboflavin (as a precursor to flavin
cofactors) is active at more than one site in the cell. As a result, the frequency of developing resistance to
antimicrobials based on riboflavin analogs is expected to be significantly lower. The only known natural
riboflavin analog with antibiotic function is roseoflavin from the bacterium Streptomyces davawensis.
This antibiotic negatively affects flavoenzymes and FMN riboswitches. Another roseoflavin producer,
Streptomyces cinnabarinus, was recently identified. Possibly, flavin analogs with antibiotic activity are more
widespread than anticipated. The same could be true for flavin analogs yet to be discovered, which could
constitute tools for cellular chemistry, thus allowing a further extension of the catalytic spectrum of
flavoenzymes.
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_3, © Springer Science+Business Media New York 2014
41
O
42
O O
N
N N NH
NH
ATP ADP NH
ATP PPi
NH2
N N O
N N O N N O N
N
O OH
OH flavokinase OH FAD synthetase
OH -O
P O N N O O
EC 2.7.1.26 EC 2.7.7.2
O- O P O P O OH
OH OH O
H H - - OH
O O
OH OH H H
OH OH
O
O O
N
N ATP ADP N NH
NH NH
ATP PPi NH2
Danielle Biscaro Pedrolli et al.
N N N O
N N N O N N N O N
N OH
O
OH flavokinase OH FAD synthetase
BH OH -O
P O N N O O
-
EC 2.7.1.26 EC 2.7.7.2
B O- O P O P O OH
OH OH O
H H - - OH
H3C O O
+
N OH OH H H
H OH OH
CH3
O
O O
N
N ATP ADP N NH
NH NH ATP PPi NH2
H2N N N O
N N O N N O N
H2N H2N N
O OH
OH flavokinase OH FAD synthetase
OH -O
P O N N O O
EC 2.7.1.26 EC 2.7.7.2
O- O P O P O OH
OH OH O
H H - - OH
O O
OH OH H H
OH OH
Fig. 1 Cellular activation of different flavins. The conversion of riboflavin (top) into FMN/FAD, of roseoflavin (middle) into roseoflavin-5′-phosphate (roseoflavin mononucleotide;
RoFMN) and roseoflavin adenine dinucleotide (RoFAD), and of (8-demethyl)-8-amino-riboflavin (bottom) into 8-amino-riboflavin-5′-phosphate (8-amino-riboflavin mono-
nucleotide; AFMN) and (8-demethyl)-8-amino-riboflavin adenine dinucleotide (AFAD). In many bacteria the activation is carried out by a bifunctional flavokinase/FAD
synthetase (RibCF or RibFC). The possible protonation of the amino groups at C(8) of, e.g., RoF and AF is exemplarily shown for RoF, whereby B denotes a general base
Natural Riboflavin Analogs 43
Only very few natural RF analogs are known and have been
characterized with respect to their biosynthesis and biological
function. In addition to RF, FMN, FAD, and the biologically inac-
tive products of their photolysis (lumiflavin and lumichrome)
(see Figs. 1 and 2a for chemical structures), other biogenic flavins
(see Fig. 2) have been detected, mainly in microorganisms [8, 15].
F420 is structurally similar to flavins, the chromophore of this coen-
zyme being 5-deaza-7,8-didemethyl-8-hydroxy RF [5, 6]. F420
plays a central role in archaeal methanogenesis being the electron
donor in several steps of CO2 reduction [33, 34]. F420 is used by
Streptomyces species for lincomycin and tetracycline biosynthesis
[35, 36] and possibly is involved in mitomycin C biosynthesis [37].
Also, F420 has been found to serve as a second chromophore in
DNA photolyases of cyanobacteria [38]. In Mycobacterium and
Nocardia species, F420 is used by F420-dependent glucose-6-
phosphate dehydrogenase. Due to the absence of F420 in animals
(and presumably humans), it constitutes a reasonable target for
anti-infective drugs [39]. Notably, F420 was reported to be required
for activation of the antituberculosis lead compound PA-824 by
M. tuberculosis and Mycobacterium bovis strain BCG [40].
The basidiomycete Schizophillum commune produces two RF
derivatives, known as schizoflavins: 7,8-dimethyl-l0-(2,3,4-
trihydroxy-4-carboxybutyl)isoalloxazine and 7,8-dimethyl-l0-
(2,3,4-trihydroxy-4-formylbutyl)isoalloxazine. The function(s) of
the latter flavin compounds remains elusive [41].
Molybdopterin is an RF-related cofactor active within several
enzymatic redox reactions. Enzymes containing this cofactor catalyze
the transfer of an oxygen atom to or from a substrate in a two-electron
redox reaction [42]. Molybdopterin is found in bacteria, plants,
and animals. A relatively large number of enzymes are involved in
its biosynthesis. As it is the case for RF biosynthesis, the pyrimidine
ring of molybdopterin is derived from GTP [43].
Two interesting flavin modifications have been discovered
many years ago. First, the yellow (at pH 5) or green (at pH 9)
molecule 6-hydroxy-7,8-dimethyl-isoalloxazine was found to be
present in pure preparations of an electron-transferring flavopro-
tein from the strictly anaerobic bacterium Peptostreptococcus elsde-
nii and also in pig liver glycolate oxidase [44]. Second, the orange
compound 7-methyl-8-hydroxy-isoalloxazine was found to be
associated with a NADH dehydrogenase, purified again from
P. elsdenii [45, 46]. The modified flavins, however, were reported
to be not normal constituents in P. elsdenii and probably were
generated accidentally during isolation of the enzymes.
Nekoflavin, identified as 8α-hydroxyriboflavin, was isolated
from the choroid of cat eyes [47, 48]. The latter flavin, together
48 Danielle Biscaro Pedrolli et al.
Fig. 2 Natural flavins and structural riboflavin analogs. The chemical structures of some naturally occurring flavins
and riboflavin analogs are shown in addition to riboflavin and its photolysis products lumiflavin and lumichrome.
Notably, molybdopterin (A) consists of a pyranopterin, a complex heterocycle featuring a pyran fused to a pterin
ring. In addition, the pyran ring has two thiolates that serve as ligands in molybdo- and tungstoenzymes [83].
The riboflavin analog 8-demethyl-8-dimethylamino-riboflavin is also called roseoflavin (RoF) and naturally is
produced by Streptomyces davawensis
Natural Riboflavin Analogs 49
RoF are present in the culture supernatant (Fig. 3). The addition
of 100 μM RF to the growth medium shortly after inoculation
enhances RoF production to 40 μM RoF. In contrast, the addi-
tion of 200 μM RF reduces the RoF yield to about 10 μM
RoF. The aqueous solution of RoF is red. RoF was reported to be
not fluorescent. If apparent fluorescence was detected, it was
attributed to impure preparations containing fluorescent com-
pounds such as MAF [58]. In our hands RoF was found to be
fluorescent (Fig. 4). RoF can be reduced using Na2S2O4 to a
yellow reduced form, and the reduced form is autoxidizable; how-
ever, a semiquinone form is not recognizable. The redox potential
Em7 obtained by polarography was −0.466 V, and Eo obtained by
titration was −0.222 V and thus was lower than that of RF by as
much as 0.038 V [59]. Photolytic products of RoF were identi-
fied as 7-methyl-8-dimethylamino-alloxazine or 7-methyl-8-
methylamino-10-D-ribityl-isoalloxazine [60]. Diastereoisomers
of RoF show reduced antibiotic activity. 8-N-alkyl analogs of
RoF also have antiRF activity [59, 61].
RoF is easily detected by HPLC using, e.g., a REPROSIL-PUR
C18-AQ column (5 μm particle size, 250 mm × 4 mm; Dr. A. Maisch
Natural Riboflavin Analogs 51
Fig. 4 Roseoflavin is fluorescent. Pure preparations of riboflavin (top) and roseoflavin (bottom) were separated
by HPLC and analyzed using a fluorescence detector. Retention times, emission intensities, and emission
wavelengths are shown (excitation wavelength 485 nm)
5.2 Biosynthesis It was postulated that RoF is synthesized from GTP and ribulose-
of RoF 5-phosphate through RF, AF, and MAF [62, 63]. The major lines of
evidence were (1) incorporation of 14C of [2- and U-14C]guanine
and [2-14C]RF into RoF, (2) no incorporation of 14C of [8-14C]
guanine into RoF, and (3) formation of [2-14C]RoF upon the
addition of [2-14C]AF or [2-14C]MAF (11). Whether AF is directly
formed from RF or through any intermediate(s) is unknown.
The possible intermediates 8α-hydroxyRF, 8-demethylRF, and
8-demethyl-8-hydroxyRF (all 14C-labeled) were added to actively
growing cultures of S. davawensis; however, no 14C-RoF was
detected. It was concluded from these experiments that the latter
compounds are not intermediates of the RoF biosynthetic path-
way. Possibly, however, the labeled flavin intermediates were not
taken up by S. davawensis cells and thus were not metabolized.
In our laboratory 8-demethyl-8-hydroxyRF (synthesized by
Madina Mansurova and Wolfgang Gärtner, Germany) and
8-demethyl-8-carboxyRF (synthesized by Tadhg Begley, USA)
were tested as possible intermediates of RoF synthesis using
cell-free S. davawensis extracts; however, no enzymatic conversion
of the two flavins was observed. Thus, the only intermediates of
the RoF pathway that have been validated experimentally are AF
and MAF. Recently, a novel N,N-8-amino-8-demethyl-D-RF
dimethyltransferase from S. davawensis has been described,
which converts AF in two steps to RoF [56]. Both methylation
reactions depend on the methyl group donor S-adenoyslmethionine.
The corresponding gene has been identified in the genome of
S. davawensis, was named rosA, and was found to be located in a
cluster comprising a total of 10 genes. As already mentioned above,
the inactivation of rosA led to a MAF/RoF-deficient strain accu-
mulating about 14 μM AF, strongly suggesting that rosA is respon-
sible for the terminal two steps in RoF biosynthesis. The primary
structure of RosA is similar (up to 35 % at the amino acid level) to
several SAM-dependent N-methyl- and O-methyl-transferases.
RosA apparently is a new member of a small family of enzymes
that are capable of catalyzing a N,N-dimethylation reaction. RosA
shares low similarities to several characterized N,N-
dimethyltransferases [64]. RosA activity and rosA transcripts were
only detectable in the RoF production phase. AF apparently is a
good substrate for the enzyme (Km = 57.7 ± 9.2 μM; KD = 10.0 μM)
and thus most likely also is the natural substrate in S. davawensis.
The functions of the other putative genes of the rosA gene cluster
are unclear; no obvious candidate genes responsible for putative
reactions of the RoF biosynthetic pathway are present. Heterologous
Natural Riboflavin Analogs 53
0,028 0,069
0,026 0,065
0,024
0,022 0,060
0,020 0,055
0,018 0,050
0,016 0,045
0,014
0,012 0,040
A
0,010 0,035
0,008 0,030
0,006 0,025
0,004
0,002 0,020
0,000 0,015
-0,002 0,011
300 350 400 450 500 300 350 400 450 500
nm nm
Fig. 5 Azobenzol reductase as a model flavoenzyme. Azobenzol reductase (AzoR) from Escherichia coli was
purified to apparent homogeneity from a recombinant riboflavin-deficient E. coli strain. The preparation to the
left was purified from E. coli treated with riboflavin. The preparation to the right was purified from E. coli
treated with roseoflavin and, accordingly, the RoFMN form of AzoR was isolated. The spectra of the two different
enzyme preparations are shown (top). The purified AzoR holoenzymes were denatured and analyzed with
regard to their flavin content by HPLC (bottom). The retention times (min) are shown
O O
N N
NH NH
R1 N N N O R1 N N N O
R2 Rib W1 R2 Rib
O O
AA H H H AA′
R59 R59H+
Fig. 6 Resonance structure of RoF and stabilization of the zwitterion AA′ by a
hydroxyl ion generated by R59 in the active site of AzoR-RoFMN from Escherichia
coli
6.2 FMN It was hypothesized earlier that some antibacterial compounds may
Riboswitches are function by targeting riboswitches [79]. Recent work using
Targets for RoFMN RoF-sensitive B. subtilis as a model organism suggested that RoF
blocks FMN riboswitches rendering cells RF auxotrophic [80, 81].
In another study it was investigated how roseoflavin affected FMN
riboswitch-mediated gene expression, growth, and infectivity of
the human bacterial pathogen Listeria monocytogenes. The results
showed that roseoflavin had a profound inhibiting effect on the
growth of L. monocytogenes at very low concentrations [55].
Moreover, expression of the gene located downstream of the FMN
riboswitch, an RF transporter, was blocked by the addition of
roseoflavin. Disadvantageous for the development of flavin analogs
as anti-infective drugs is the finding that roseoflavin stimulated
L. monocytogenes virulence gene expression and infection abilities
in a mechanism independent of the FMN riboswitch [55].
An independent proof that RoF and other flavin analogs indeed
target FMN riboswitches now comes from our in vitro and in vivo
experiments with respect to RoF resistance of the producer strain
S. davawensis in direct comparison to the RoF-sensitive model acti-
nomycete S. coelicolor [82]. First of all, we found that S. davawensis
(in contrast to S. coelicolor) is RoF resistant to concentrations of
RoF (200 μM) exceeding the level synthesized by S. davawensis
under laboratory conditions (maximum of 40 μM). In addition,
we could show that RoFMN and RoFAD indeed are present in the
cytoplasm of S. davawensis and also of S. coelicolor cells treated with
RoF, supporting our previous finding that transport of RF occurs
and that flavokinases/FAD synthetases are responsible for the
phosphorylation/adenylylation of flavin analogs [68]. Analysis of
S. coelicolor cell-free extracts revealed the presence of both RoFMN
Natural Riboflavin Analogs 57
(1.2 μM ± 0.3 μM) and RoFAD (0.1 μM ± 0.05 μM). The same
experiment was carried out with S. davawensis and similar amounts
of RoFMN/RoFAD were detected in the corresponding cell-free
extracts (RoFMN, 1.4 μM ± 0.2 μM; RoFAD, 0.2 μM ± 0.06 μM).
For the in vitro testing of a variety of bacterial FMN ribo-
switches, a novel in vitro transcription/translation system based on
RNA polymerase from bacteriophage T7 was established. The cor-
responding data show that in S. davawensis and in S. coelicolor
(as in other FMN riboswitch-containing bacteria) expression of
the rib genes is controlled by the amount of FMN present in the
cytoplasm and that RoFMN (not RoF) triggers RoF-sensitive FMN
riboswitches. RoFMN blocks the S. coelicolor FMN riboswitch more
efficiently when compared to FMN, which explains why RoF is able
to inhibit growth and acts as an antibiotic. In contrast, the S. davaw-
ensis FMN riboswitch is not affected by RoFMN (see next section).
Even if the supply with essential RF/FMN/FAD would only be
slightly reduced in the presence of RoF, this may constitute a major
disadvantage for competing cells in a natural habitat.
The current knowledge with respect to RoF activity (and resis-
tance; see section below) is summarized in Fig. 7. Since RoF also
reduces growth of animals (not employing FMN riboswitches)
[58], the observed anti-FMN riboswitch activity cannot be the
only explanation for RoF toxicity (see above).
Notably, AFMN was found to block FMN riboswitches as
well (unpublished results), which explains the antibiotic effect of
AF (in addition to targeting flavoenzymes).
6.3 The Molecular The FMN riboswitches of S. davawensis and S. coelicolor were found
Mechanism of to respond very differently with respect to the addition of RoFMN
Resistance to Flavin to in vitro transcription/translation assays [82]: The S. coelicolor
Analogs FMN riboswitch was turned off by RoFMN; i.e., reporter gene
expression was repressed in the presence of this ligand. In contrast,
the S. davawensis FMN riboswitch was turned on in the presence of
RoFMN; i.e., reporter gene expression was stimulated in the pres-
ence of RoFMN. Both riboswitches, however, were turned off by
FMN. The in vitro transcription/translation results were strongly
supported by in vivo data, which showed that RibB activity (expression
of ribB is controlled by an FMN riboswitch) was strongly reduced in
S. coelicolor upon treatment with RoF but not in S. davawensis.
The critical residue responsible for RoF resistance of S. davawensis is
nucleotide A61 of a highly specialized FMN riboswitch still respond-
ing to FMN but not to RoFMN [82]. A specialized FMN ribo-
switch, however, cannot be the only reason for RoF resistance.
A relatively large number of flavoenzymes (2.6 % of all predicted
proteins) seem to be present in S. davawensis [57], which are of
course potential targets for RoFMN and RoFAD.
As mentioned above, S. davawensis is resistant to relatively
high concentrations of RoF (200 μM). In the time course of
58 Danielle Biscaro Pedrolli et al.
Riboflavin (RF)
Roseoflavin (RoF)
RibM/PnuX, RibU
FMN
Inactive flavoenzymes
RoF/RF RoFMN/RoFAD
Degradation/modification
Ro
FMN
FAD of flavin analogs?
FMN Ro
FAD
Ro
RoF/RF RoFMN/FMN RoFAD/FAD FMN
Flavokinase FAD-synthetase
(EC 2.7.1.26) (EC 2.7.7.2)
FMN riboswitch blocked:
RF auxotrophy
Fig. 7 Metabolization and mode of action of the antibiotic roseoflavin (RoF). The scheme shows the probable
mode of action of the RF analog roseoflavin (RoF). Uptake of flavins (RF and RoF) is catalyzed by, e.g., the RF
transporters RibM or RibU [17, 23]. RF and RoF are both substrates for flavokinases/FAD synthetases, which
produce the cofactors FMN/FAD and the cofactor analogs RoFMN/RoFAD within the cytoplasm of many bacteria.
The latter flavin derivatives combine with flavoenzymes. RoFMN and RoFAD are less active as cofactors
and their incorporation produces flavoenzymes with reduced activity (pink ). Expression of the rib genes is
controlled by the rib promoter P in combination with an FMN riboswitch. The latter is a target for FMN and also
RoFMN. Binding of FMN/RoFMN to the 5′-untranslated region of the corresponding mRNA results in reduced
expression of the rib genes and thus to reduced synthesis of RF. In the case of RoFMN, aptamer binding leads to RF
auxotrophy. Notably, the expression of many RF transporter genes is controlled by FMN riboswitches as well
Acknowledgments
References
1. Kurth R, Paust J, Hähnlein W (1996) Vitamins, 9. French GL (2010) The continuing crisis in
Chapter 7. In: Ullmann’s Encyclopedia of antibiotic resistance. Int J Antimicrob Agents
industrial chemistry. Wiley-VCH, Weinheim, 36(Suppl 3):S3–S7
pp 521–530 10. Fischer M, Bacher A (2005) Biosynthesis of
2. Bacher A (1991) Riboflavin kinase and FAD flavocoenzymes. Nat Prod Rep 22:324–350
synthetase. In: Müller F (ed) Chemistry and 11. Perkins J, Pero J (2002) Biosynthesis of
biochemistry of flavoenzymes. CRC press, riboflavin, biotin, folic acid, and cobalamin.
Boca Raton, FL, pp 349–370 In: Sonenshein A, Hoch J, Losick R (eds)
3. Ghisla S, Massey V (1986) New flavins for old: Bacillus subtilis and its closest relatives: from
artificial flavins as active site probes of flavopro- genes to cells. ASM Press, Washington DC,
teins. Biochem J 239:1–12 pp 271–286
4. Massey V, Hemmerich P (1980) Active-site 12. Perkins JB, Pero JG, Sloma A (1990) Riboflavin
probes of flavoproteins. Biochem Soc Trans overproducing strains of Bacillus subtilis.
8:246–257 European Patent Application 0 405 730 A1
5. Eirich LD, Vogels GD, Wolfe RS (1978) 13. Nudler E, Mironov AS (2004) The riboswitch
Proposed structure for coenzyme F420 control of bacterial metabolism. Trends
from Methanobacterium. Biochemistry Biochem Sci 29:11–17
17:4583–4593 14. Winkler WC, Breaker RR (2005) Regulation of
6. Eirich LD, Vogels GD, Wolfe RS (1979) bacterial gene expression by riboswitches.
Distribution of coenzyme F420 and properties of Annu Rev Microbiol 59:487–517
its hydrolytic fragments. J Bacteriol 140:20–27 15. Abbas CA, Sibirny AA (2011) Genetic control
7. Bardos TJ (1974) Antimetabolites: molecular of biosynthesis and transport of riboflavin and
design and mode of action. Top Curr Chem flavin nucleotides and construction of robust
52:63–98 biotechnological producers. Microbiol Mol
8. Mack M, Grill S (2006) Riboflavin analogs and Biol Rev 75:321–360
inhibitors of riboflavin biosynthesis. Appl 16. García Angulo VA, Bonomi HR, Posadas DM,
Microbiol Biotechnol 71:265–275 Serer MI, Torres AG, Zorreguieta Á, Goldbaum FA
Natural Riboflavin Analogs 61
40. Stover CK, Warrener P, VanDevanter DR, 53. Otani S, Takatsu M, Nakano M, Kasai S, Miura
Sherman DR, Arain TM, Langhorne MH, R (1974) Letter: roseoflavin, a new antimicro-
Anderson SW, Towell JA, Yuan Y, McMurray bial pigment from Streptomyces. J Antibiot
DN, Kreiswirth BN, Barry CE, Baker WR (Tokyo) 27:88–89
(2000) A small-molecule nitroimidazopyran drug 54. Grill S, Yamaguchi H, Wagner H, Zwahlen L,
candidate for the treatment of tuberculosis. Kusch U, Mack M (2007) Identification and
Nature 405:962–966 characterization of two Streptomyces davawensis
41. Tachibana S, Murakami T (1975) The isolation riboflavin biosynthesis gene clusters. Arch
and some properties of new flavins (“schizofla- Microbiol 188:377–387
vin”) formed by Schizophyllum commune. J Nutr 55. Mansjo M, Johansson J (2011) The riboflavin
Sci Vitaminol (Tokyo) 21:61–63 analog roseoflavin targets an FMN-riboswitch
42. Kisker C, Schindelin H, Rees DC (1997) and blocks Listeria monocytogenes growth, but
Molybdenum-cofactor-containing enzymes: also stimulates virulence gene-expression and
structure and mechanism. Annu Rev Biochem infection. RNA Biol 8:674–680
66:233–267 56. Jankowitsch F, Kuhm C, Kellner R, Kalinowski J,
43. Leimkuhler S, Wuebbens MM, Rajagopalan Pelzer S, Macheroux P, Mack M (2011) A
KV (2011) The history of the discovery of the novel N, N-8-amino-8-demethyl-D-riboflavin
molybdenum cofactor and novel aspects of its dimethyltransferase (RosA) catalyzing the two
biosynthesis in bacteria. Coord Chem Rev terminal steps of roseoflavin biosynthesis in
255:1129–1144 Streptomyces davawensis. J Biol Chem
44. Mayhew SG, Whitfield CD, Ghisla S, Jorns MS 286:38275–38285
(1974) Identification and properties of new 57. Jankowitsch F, Schwarz J, Ruckert C, Gust B,
flavins in electron-transferring flavoprotein Szczepanowski R, Blom J, Pelzer S, Kalinowski J,
from Peptostreptococcus elsdenii and pig-liver Mack M (2012) Genome sequence of the bac-
glycolate oxidase. Eur J Biochem 44:579–591 terium Streptomyces davawensis JCM 4913 and
45. Ghisla S, Mayhew SG (1973) Identification and heterologous production of the unique antibi-
structure of a novel flavin prosthetic group asso- otic roseoflavin. J Bacteriol 194:6818–6827
ciated with reduced nicotinamide adenine dinu- 58. Otani S, Matsui K, Kasai S (1997) Chemistry
cleotide dehydrogenase from Peptostreptococcus and biochemistry of 8-aminoflavins. Osaka
elsdenii. J Biol Chem 248:6568–6570 City Med J 43:107–137
46. Ghisla S, Mayhew SG (1976) Identification 59. Kasai S, Kubo Y, Yamanaka S, Hirota T, Sato H,
and properties of 8-hydroxyflavin–adenine Tsuzukida Y, Matusi K (1978) Anti-riboflavin
dinucleotide in electron-transferring flavopro- activity of 8N-alkyl analogues of roseoflavin in
tein from Peptostreptococcus elsdenii. Eur J some Gram-positive bacteria. J Nutr Sci
Biochem 63:373–390 Vitaminol (Tokyo) 24:339–350
47. Matsui K (1965) Nekoflavin, a new flavin com- 60. Matsui K, Kasai S (1976) Photolysis products
pound, in the choroid of cat’s eye. J Biochem of roseoflavin. In: Singer T (ed) Flavins and fla-
57:201–206 voproteins. Proc. Int. Symp. 5th, 1975. Elsevier,
48. Matsui K, Kasai S (1996) Identification of neko- Amsterdam, pp 328–333
flavin as 7 alpha-hydroxyriboflavin. J Biochem 61. Kasai S, Yamanaka S, Wang SC, Matsui K
119:441–447 (1979) Anti-riboflavin activity of 8-O-alkyl
49. Ohkawa H, Ohishi N, Yagi K (1983) New derivatives of riboflavin in some Gram-positive
metabolites of riboflavin appear in human bacteria. J Nutr Sci Vitaminol (Tokyo) 25:
urine. J Biol Chem 258:5623–5628 289–298
50. Ohkawa H, Ohishi N, Yagi K (1983) New 62. Juri N, Kubo Y, Kasai S, Otani S, Kusunose M,
metabolites of riboflavin appeared in rat urine. Matsui K (1987) Formation of roseoflavin from
Biochem Int 6:239–247 8-amino- and 8-methylamino-8-demethyl-D-
51. West DW, Owen EC (1969) The urinary excre- riboflavin. J Biochem (Tokyo) 101:705–711
tion of metabolites of riboflavine by man. Br J 63. Matsui K, Juri N, Kubo Y, Kasai S (1979)
Nutr 23:889–898 Formation of roseoflavin from guanine through
52. Susin S, Abian J, Sanchez-Baeza F, Peleato ML, riboflavin. J Biochem (Tokyo) 86:167–175
Abadia A, Gelpi E, Abadia J (1993) Riboflavin 64. Chen H, Yamase H, Murakami K, Chang CW,
3′- and 5′-sulfate, two novel flavins accumulating Zhao L, Zhao Z, Liu HW (2002) Expression,
in the roots of iron-deficient sugar beet (Beta purification, and characterization of two N,
vulgaris). J Biol Chem 268:20958–20965 N-dimethyltransferases, tylM1 and desVI,
Natural Riboflavin Analogs 63
involved in the biosynthesis of mycaminose and azobenzene reductase AzoR from Escherichia
desosamine. Biochemistry 41:9165–9183 coli binds roseoflavin mononucleotide (RoFMN)
65. Cooke G, Legrand YM, Rotello VM (2004) with high affinity and is less active in its RoFMN
Model systems for flavoenzyme activity: an form. Biochemistry 52:4288–4295
electrochemically tuneable model of roseoflavin. 75. Ito K, Nakanishi M, Lee WC, Sasaki H, Zenno
Chem Commun 1088–1089 S, Saigo K, Kitade Y, Tanokura M (2006)
66. Hasford J, Rizzo C (1998) Linear free energy Three-dimensional structure of AzoR from
substituent effect on flavin redox chemistry. Escherichia coli. An oxidereductase conserved
J Am Chem Soc 120:2251–2255 in microorganisms. J Biol Chem 281:
20567–20576
67. Pedrolli DB, Nakanishi S, Barile M, Mansurova
M, Carmona EC, Lux A, Gärtner W, Mack M 76. Caldwell ST, Farrugia LJ, Hewage SG,
(2011) The antibiotics roseoflavin and 8- Kryvokhyzha N, Rotello VM, Cooke G (2009)
demethyl-8-amino-riboflavin from Streptomyces Model systems for flavoenzyme activity: an
davawensis are metabolized by human flavoki- investigation of the role functionality attached
nase and human FAD synthetase. Biochem to the C(7) position of the flavin unit has on
Pharmacol 82:1853–1859 redox and molecular recognition properties.
Chem Commun 1350–1352
68. Grill S, Busenbender S, Pfeiffer M, Kohler U,
Mack M (2008) The bifunctional flavokinase/ 77. Reddick JJ, Saha S, Lee J, Melnick JS, Perkins
flavin adenine dinucleotide synthetase from J, Begley TP (2001) The mechanism of action
Streptomyces davawensis produces inactive fla- of bacimethrin, a naturally occurring thiamin
vin cofactors and is not involved in resistance to antimetabolite. Bioorg Med Chem Lett
the antibiotic roseoflavin. J Bacteriol 190: 11:2245–2248
1546–1553 78. Fiehe K, Arenz A, Drewke C, Hemscheidt T,
Williamson RT, Leistner E (2000) Biosynthesis
69. Yorita K, Misaki H, Palfey BA, Massey V
of 4′-O-methylpyridoxine (Ginkgotoxin)
(2000) On the interpretation of quantitative
from primary precursors. J Nat Prod 63:
structure-function activity relationship data for
185–189
lactate oxidase. Proc Natl Acad Sci U S A
97:2480–2485 79. Blount KF, Breaker RR (2006) Riboswitches as
antibacterial drug targets. Nat Biotechnol
70. Walsh C, Fisher J, Spencer R, Graham DW, 24:1558–1564
Ashton WT, Brown JE, Brown RD, Rogers EF
(1978) Chemical and enzymatic properties of 80. Ott E, Stolz J, Lehmann M, Mack M (2009)
riboflavin analogues. Biochemistry 17: The RFN riboswitch of Bacillus subtilis is a
1942–1951 target for the antibiotic roseoflavin produced
by Streptomyces davawensis. RNA Biol
71. Shinkai S, Kameoka K, Honda N, Ueda K, 6:276–280
Manabe O, Lindsey J (1986) Spectral and reac-
tivity studies of roseoflavin analogs: correlation 81. Lee ER, Blount KF, Breaker RR (2009)
between reactivity and spectral parameters. Roseoflavin is a natural antibacterial compound
Bioorg Chem 14:119–133 that binds to FMN riboswitches and regulates
gene expression. RNA Biol 6:187–194
72. Otani S, Kasai S, Matsui K (1980) Isolation,
82. Pedrolli DB, Matern A, Wang J, Ester M,
chemical synthesis, and properties of roseofla-
Siedler K, Breaker R, Mack M (2012) A
vin. Methods Enzymol 66:235–241
highly specialized flavin mononucleotide
73. Nakanishi M, Yatome C, Ishida N, Kitade Y riboswitch responds differently to similar
(2001) Putative ACP phosphodiesterase gene ligands and confers roseoflavin resistance to
(acpD) encodes an azoreductase. J Biol Chem Streptomyces davawensis. Nucleic Acids Res
276:46394–46399 40:8662–8673
74. Langer S, Nakanishi S, Mathes T, Knaus T, 83. Schwarz G, Mendel RR, Ribbe MW (2009)
Binter A, Macheroux P, Mase T, Miyakawa T, Molybdenum cofactors, enzymes and pathways.
Tanokura M, Mack M (2013) The flavoenzyme Nature 460:839–847
Chapter 4
Abstract
Flavocoenzymes with selective or universal stable isotope labeling are important tools for the investigation
of flavoproteins using a variety of spectroscopic methods. Numerous selectively labeled flavin isotopologs
can be generated by the combined application of chemical synthesis and in vitro biotransformation using
commercially available enzymes and/or recombinant riboflavin biosynthesis enzymes. Notably, the complex
reaction sequences can be rapidly carried out using enzyme-assisted one-pot reaction strategies.
Key words Biotransformation, 13C-labeled flavins, 15N-labeled flavins, Stable isotope-labeled flavins,
Enzyme-assisted synthesis
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_4, © Springer Science+Business Media New York 2014
65
66 Adelbert Bacher et al.
Table 1
Selected isotopologs of riboflavin and 6,7-dimethyl-8-lumazine obtained by introduction of 13C or 15N,
therein using different synthesis techniques
6,7-Dimethyl- Chapter
Riboflavin 8-ribityllumazine Synthone of this review
[5-15N1] Na15NO2 2, 3
[10-15N1] [8-15N1] 15
NH2OH 3
15 15
[1,3- N2] [ N2]urea 2
15 15 15
[U- N4] [U- N4] NH4Cl 4
[U-13C17,U-15N4] [U-13C13,U-15N4] [U-13C6]glucose, 15NH4Cl 4
[2-13C1] [13C]urea 2
13 13
[4a- C1] diethyl-[2- C1]malonate 2
[1′-13C1] [1′-13C1] [1-13C1]ribose 2, 3
[4,10a-13C2] Diethyl-[1,3-13C2]malonate 2
13 13 13 13
[6,8α- C2] [6α- C1] [2- C1]glucose or [1- C1]ribose 3
13 13 13 13
[5a,8- C2] [6- C1] [3- C1]glucose or [2- C1]ribose 3
[9a,7-13C2] [7-13C1] [4-13C1]glucose or [3-13C1]ribose 3
[7α,9-13C2] [7α-13C1] [6-13C1]glucose or [5-13C1]ribose 3
13 13 13 13
[4a,5,6,7,7α,8,8α,9,9a- C8] [6,6α,7,7α- C4] [U- C6]glucose or [U- C5]ribose 3
13 13
[U- C17] [U- C13] [U-13C6]glucose 4
Scheme 1
Scheme 2
Scheme 3
and/or 15N. Barbituric acid labeled with 13C and/or 15N is easily
prepared from malonic acid ester (8) and urea (9) which are
both commercially available in isotope-labeled form (Scheme 2)
[14, 15].
Due to the molecular symmetry properties of barbituric
acid, only pairwise labeling of the pyrimidine nitrogen atoms
N(1) and N(3) of riboflavin is possible by this approach.
Specifically, [U-15N2]urea affords [1,3-15N2]riboflavin, and
[15N1]urea affords a mixture of [1-15N1]- and [3-15N1]riboflavin
(in fact, this type of isotopolog mixture can be useful for certain
biophysical experiments). The situation is analogous for the
preparation of riboflavin from diethyl-[1,3-13C2]malonate,
which results in the diversion of label to the C(4) as well as the
C(10a) position.
The Tishler method can also be used for labeling of N(5)
in the pyrazine ring of riboflavin (Scheme 3). Specifically, the
diazotization of aniline with Na15NO2, followed by diazo coupling
A Roadmap to the Isotopolog Space of Flavocoenzymes 69
Scheme 4
Scheme 5
Scheme 6
Scheme 7
Scheme 8
Fig. 3 Biosynthesis of riboflavin. The fate of glucose carbon atoms is indicated by
small letters (a–c). Partial scrambling in 13 is due to reactions of the pentose
phosphate pathway
76 Adelbert Bacher et al.
Scheme 9
Acknowledgements
References
Electron Transferases
Patricia Ferreira, Marta Martínez-Júlvez, and Milagros Medina
Abstract
The flavin isoalloxazine ring in electron transferases functions in a redox capacity, being able to take up
electrons from a donor to subsequently deliver them to an acceptor. The main characteristics of these fla-
voproteins, including their unique ability to mediate obligatory processes of two-electron transfers with
those involving single-electron transfer, are here described. To illustrate the versatility of these proteins,
the acquired knowledge of the function of the two electron transferases involved in the cyanobacterial
photosynthetic electron transfer from photosystem I to NADP+ is presented. Many aspects of their
biochemistry and biophysics have been extensively characterized using site-directed mutagenesis, steady-
state and transient kinetics, spectroscopy, calorimetry, X-ray crystallography, electron paramagnetic reso-
nance, and computational methods.
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_5, © Springer Science+Business Media New York 2014
79
80 Patricia Ferreira et al.
2 General Properties
2.1 Pure Electron Pure electron transferases include flavoproteins in which the flavin
Transferases is reduced and re-oxidized in single one-electron transfer steps
(class 1e−/1e−), stabilizing the flavin semiquinone intermediate
during the reaction. The best examples of this type are the flavo-
doxins (Fld), a group of low-potential flavoproteins that mediate
electron transfers between proteins [4–6]. Another example is
DNA photolyase (EC 4.1.99.3) that repairs one of the major
lesions in DNA induced by far-UV light, the formation of pyrimi-
dine dimers [7]. Photolyases contain photoantennas that absorb
near-UV light photons and then transfer the excitation energy to a
second cofactor, FAD. Formation of the FAD hydroquinone
(FADhq) induces specific binding of the photolyase to the damaged
DNA. Then, FADhq transfers an electron to the pyrimidine dimer,
yielding a dimeric anion radical and the neutral semiquinone,
FADsq. As a consequence, the bonds stabilizing the dimer radical
are believed to be spontaneously broken, the electron is transferred
back to the FAD, and the repaired DNA dissociates from the
enzyme [8].
2.2 Dehydrogenases Flavoproteins belonging to this group are also known as either
and Reductases dehydrogenases (class 2e−/1e−) or oxido-reductases (class 2e−/1e−
or 1e−/2e−), indicating that the isoalloxazine ring is able to take up
or release either two electrons or one electron at a time.
The isoalloxazine ring in dehydrogenases gets fully reduced in
a single two-electron transfer step from a reduced substrate, and
then it is re-oxidized in two sequential one-electron transfer steps to
one-electron acceptors, such as cytochromes or iron–sulfur proteins.
Electron Transferases 81
2.3 Key Properties Free flavins stabilize very little of their one-electron reduced semi-
quinone state, because the midpoint potential for reduction of the
oxidized state to the one-electron reduced semiquinone state, Eox/sq,
is more negative than that for the reduction of the semiquinone to
the two-electron reduced hydroquinone state, Esq/hq [15]. Binding
of FAD or FMN to an apoprotein usually displaces Eox/sq to a less
negative value, while Esq/hq shifts to a more negative one, thus sta-
bilizing the semiquinone state [2, 6, 16]. In electron transferases
the flavin functions in a redox capacity, being able to react with
one-electron acceptors or donors, an ability that allows them to
mediate at the interface between one-electron and two-electron
transfer processes [1, 5] and to participate in many key biological
processes [5, 6, 17]. They often react with molecular oxygen quite
rapidly producing substantial amounts of the superoxide anion
(O2−) and the neutral semiquinone radical, without detection of
any flavin-hydroperoxide intermediate [1, 2, 18]. Usually, the
reactivity of the semiquinone with oxygen is several orders of
magnitude lower. During electron exchange with one-electron
donors/acceptors they also thermodynamically stabilize its neutral
semiquinone over the entire range of pH stability [1]. In general,
in these flavoproteins the dimethyl moiety of the benzene ring is
the only portion of the isoalloxazine that is freely accessible to the
solvent [19, 20], and they do not stabilize the flavin-sulfite adduct
formed by oxidases [21].
Reactions mediated by electron transferases always involve a
reductive half reaction, where the flavin is reduced, and an
82 Patricia Ferreira et al.
2.5 Diflavin Diflavin reductases are enzymes, which emerged as a gene fusion of
Reductases an FNR-type flavoenzyme and an Fld [10]. They tightly bind two
flavin cofactors, FAD and FMN, and generally catalyze the transfer
of reducing equivalents from a two-electron donor, like NADPH,
to a variety of one-electron acceptors. Cytochrome-P450 reduc-
tase (P450R, EC 1.6.2.4) is their main exponent. It is a part of
the cytochrome-P450 mono-oxygenase multidomain system in the
mammalian endoplasmic reticulum. P450R catalyzes the ET via its
FAD and FMN cofactors to a variety of cytochromes involved in
oxidative detoxification of endogenous and exogenous com-
pounds. P450Rs also act as electron donors to the heme oxygen-
ase, the fatty acid elongation system, or the cytochrome b5 [10].
The diflavin-containing subunit of bacterial sulfite reductase (EC.
1.8.1.2) is homologous to the microsomal P450R. It is involved in
the transfer of six electrons from three molecules of NADPH to
the heme subunit that contains siroheme and an Fe4S4 cluster
responsible of sulfite reduction to sulfide [10]. Other diflavin
reductases are methionine synthase reductase, NR1, cytochrome-
P450 BM3, and the flavocytochromes nitric oxide synthases or the
fatty acid hydroxylase.
Electron Transferases 83
3.1 Flavodoxin Anabaena Fld (AnFld) is a pure electron transferase that folds in a
five-stranded parallel β-sheet sandwiched by five α-helices. The
FMN group is located at the edge of the globular protein, with its
two isoalloxazine methyl groups accessible to the solvent [20].
Upon reduction AnFld stabilizes a maximum of the neutral semi-
quinone of ~96 %. Since this species has a particularly intense
extinction coefficient in the 500–600-nm region, UV/vis spectros-
copy has been widely used to investigate the properties of Fld as
well as the processes of interaction and ET in which it is involved.
These properties also allowed independent determination of mid-
point reduction potentials of the ox/sq and sq/hq couples by step-
wise anaerobic photoreduction. In AnFld at pH 8.0 and 25 °C,
these values are Eox/sq = –266 mV and Esq/hq = –439 mV [26, 27].
Therefore, Fld is proposed to replace Fd (Eox/rd = –384 mV) by
exchanging electrons between its neutral semiquinone and its
anionic hydroquinone states [25, 28]. The high percentage of semi-
quinone stabilized and the ability to reconstitute the ApoFld with
FMN analogues made AnFld an excellent model system to study
the influence of the protein environment in modulating the elec-
tronic properties of the cofactor [29]. Thus, characterization of dif-
ferent Fldsq forms using electron paramagnetic resonance (EPR),
electron-nuclear double resonance (ENDOR), and one- and two-
dimensional electron-spin echo envelope modulation spectroscopies
(ESEEM and HYSCORE) has been very useful in providing experi-
mental information about the chemical environment of flavin semi-
quinone radicals within the protein, including interactions with
nearby nuclear and electronic spins (see Note 7) [30–32].
3.3 Flavodoxin as a The properties of FMN in Fld are a consequence of its isoalloxazine
Model to Understand ring being able to exist in three different redox states with a different
the Modulation of the number of electrons and protons and, therefore, offering differen-
Flavin Properties by tial possibilities for the interaction with ApoFld. X-ray and NMR
the Protein structures show two main regions involved in isoalloxazine bind-
Environment ing, which are highly conserved in different Fld species: the 50s
and the 90s loops [20]. The quenching produced in the FMN
fluorescence upon ApoFld titration has been experimentally used
to determine the binding affinity (ΔGox) for the ApoFld:FMNox
complex. The use of a thermodynamic cycle showing the relation-
ship between midpoint reduction potentials of free and bound
FMN with the free energy for the interaction of ApoFld with FMN
in the three redox states, additionally allowed determining ΔGsq
and ΔGhq for ApoFld:FMNsq and ApoFld:FMNhq, respectively.
These parameters indicated a high stabilization of the ApoFld:FMNsq
complex, while the ApoFld:FMNhq one was considerably destabi-
lized. Both facts explained the large amount of FMNsq stabilized
as well as the negative midpoint potentials exhibited by AnFld (see
Note 8) [26, 27, 36].
These methods have been widely used for a characterization of
site-directed mutants of AnFld, and their combination with
biochemical and structural studies permitted to better understand
the role of individual residues in modulating the flavin properties.
The stacking of Tyr94 against the FMN si-face particularly con-
tributes to stabilize more strongly the oxidized and semireduced
complexes than the reduced one, making the Esq/hq more negative.
Trp57, stacked at the re-inner face, slightly destabilizes the
Electron Transferases 85
semireduced state [27, 36, 37]. The carbonyl of the 58–59 peptide
bond in AnFld is proposed to flip from an “O-down” conformation
in the oxidized state to an “O-up” in the neutral semiquinone,
changing the H-bond network of the N(5) position of the flavin
with regard to the Asn58–Ile59 peptide bond. Even though a three-
dimensional structure for AnFldsq is not available, replacements at
T56, W57, N58, I59, and E61 have been shown to modulate the
N58–I59 peptide ability to H-bond with N(5) (ox state) or N(5)
H (sq state) and the energy of the proposed conformational change
[26, 27, 38, 39]. Therefore, the backbone rearrangements of
N58–I59 also provide a versatile device for modulating the strength
of FMN binding as well as Eox/sq and Esq/hq in AnFld [26, 27, 38, 39].
The importance of electrostatic repulsion in the control of Eox/sq
and, particularly, of Esq/hq has also been demonstrated using several
Fld variants that considerably alter the magnitude and/or orienta-
tion of the Fld strong molecular dipole moment that addresses its
negative end towards the isoalloxazine ring [25, 27, 38, 39].
Similar procedures have allowed identifying the low solvent accessi-
bility of the flavin cofactor as another factor contributing to set the
low Esq/hq in AnFld [27, 40].
Finally, the chemical nature of the substituents at the isoalloxa-
zine 7- and 8-methyl groups, the only portion of the flavin ring
exposed to solvent, were analyzed by replacing FMN in AnFld
with several high-potential analogues: 8-nor-Cl-FMN, 7,8-nor-
7,8-Cl-FMN, 7-nor-7-Cl, 8-nor-FMN, and 7-nor-8-nor-8-Cl-
FMN were chosen because they represent substitutions in the
positions of the isoalloxazine ring putatively involved in protein
interaction and ET, they considerably alter the charge density in
these positions, their midpoint-reduction potentials cover a narrow
range, and they have been widely used as mechanistic probes with
flavoproteins [41–43]. AnFld forms strong complexes with these
FMN analogues and stabilizes the intermediate semiquinone state.
However, upon protein binding the shift in Eox/sq was in general
slightly larger for the FMN analogues than for FMN, while the
shift in Esq/hq was smaller. These observations indicate that differ-
ences introduced by the replacements in the chemical distribution
of the isoalloxazine ring modulate the influence of the protein on
its properties [29]. These studies have additionally provided inter-
esting observations about the atoms for exchanging electrons
when the flavin ring is within this protein environment [44].
3.5 Interaction Once the FAD cofactor of FNR accepts two electrons, reduction
and Hydride Transfer of NADP+ occurs by a formal hydride transfer (HT) from the
Between FNR and the anionic FADhq to the nicotinamide. The ApoFNR portion has a
Pyridine Nucleotide dual role in this process: first, by modulating the FAD midpoint
potential to a value that allows a reversible HT, and second, by
providing the environment for an efficient encounter among
the N(5) of the isoalloxazine, the hydride to be transferred, and the
C(4) of the nicotinamide moiety of the coenzyme. Although the
main biological function of photosynthetic FNR is the HT to
NADP+, being highly specific for NADP+ versus NAD+, the process is
reversible in vivo. These facts allowed studying the FNR reactions
with the coenzyme in oxidative and reductive reactions, making
FNR a good model for the characterizing the catalytic mechanism
of enzymes belonging to this family and for determining the factors
involved in coenzyme specificity using biochemical and biophysical
experimental methods [52, 53]. Recently, computational methods
are also contributing to increase this knowledge using AnFNR as
model [54–56].
Characterization of chemically modified FNR samples and
site-directed mutants allowed identifying several FNR regions
involved in determining coenzyme binding, specificity, and enzy-
matic efficiency [53, 57–65]. X-ray crystal structures suggested a
88 Patricia Ferreira et al.
3.6 The Ternary In the Anabaena system, isothermal titration calorimetry has
Complex confirmed that NADP+ is able to occupy a site on FNR without
displacing Fld [70, 71]. Although the order of addition of sub-
strates might not be important during catalysis, calorimetric meth-
ods have recently demonstrated that Fld lowers the FNR affinity
for NADP+, while occupation of the NADP+-binding site weakens
the Fld:FNR interaction. This information further indicates that
the two binding sites are not completely independent, and the
overall reaction is proposed to work in an ordered two-substrate
process with the pyridine nucleotide binding first in the context of a
ternary transitory complex [25]. ET from Fldhq to the FNRox:NADP+
preformed complex has also been recently analyzed using stop-
flow methods with photodiode array detection. The process was
consistent with two ET steps at all the ionic strengths assayed, with
the presence of the pyridine nucleotide modulating the electronic
properties of both FMN and FAD. These observations revealed,
therefore, that the nicotinamide portion of NADP+ must contribute
to the catalytically competent complex by modulating the orientation
and/or distance between the reacting flavins [72].
4 Notes
Acknowledgments
References
1. Massey V (2000) The chemical and biological 3. Miura R (2001) Versatility and specificity in
versatility of riboflavin. Biochem Soc Trans flavoenzymes: control mechanisms of flavin
28:283–296 reactivity. Chem Rec 1:183–194
2. Müller F (1990) Chemistry and biochemistry 4. Zhou Z, Swenson RP (1995) Electrostatic
of flavoenzymes. CRC Press, Boca Raton, FL effects of surface acidic amino acid residues on
Electron Transferases 91
and hyperfine sublevel correlation spectroscopic potential for the flavodoxin from Desulfovibrio
studies of flavodoxin mutants from Anabaena vulgaris [Hildenborough]. Biochemistry
sp. PCC 7119. Biophys J 77:1712–1720 35:15980–15988
33. Serre L, Vellieux FM, Medina M, Gómez- 41. Schopfer LM, Wessiak A, Massey V (1991)
Moreno C, Fontecilla-Camps JC, Frey M Interpretation of the spectra observed during
(1996) X-ray structure of the ferredoxin:NADP+ oxidation of p-hydroxybenzoate hydroxylase
reductase from the cyanobacterium Anabaena reconstituted with modified flavins. J Biol
PCC 7119 at 1.8 Å resolution, and crystallo- Chem 266:13080–13085
graphic studies of NADP+ binding at 2.25 Å 42. Ghisla S, Massey V (1986) New flavins for old:
resolution. J Mol Biol 263:20–39 artificial flavins as active site probes of flavopro-
34. Faro M, Gómez-Moreno C, Stankovich M, teins. Biochem J 239:1–12
Medina M (2002) Role of critical charged resi- 43. Yorita K, Misaki H, Palfey BA, Massey V
dues in reduction potential modulation of (2000) On the interpretation of quantitative
ferredoxin-NADP+ reductase. Eur J Biochem structure–function activity relationship data for
269:2656–2661 lactate oxidase. Proc Natl Acad Sci USA
35. Martínez-Júlvez M, Nogués I, Faro M, Hurley 97:2480–2485
JK, Brodie TB, Mayoral T, Sanz-Aparicio J, 44. Lans I, Frago S, Medina M (2012)
Hermoso JA, Stankovich MT, Medina M, Understanding the FMN cofactor chemistry
Tollin G, Gómez-Moreno C (2001) Role of a within the Anabaena flavodoxin environment.
cluster of hydrophobic residues near the FAD Biochim Biophys Acta 1817:2118–2127
cofactor in Anabaena PCC 7119 ferredoxin- 45. Nogués I, Martínez-Júlvez M, Navarro JA,
NADP+ reductase for optimal complex forma- Hervás M, Armenteros L, de la Rosa MA,
tion and electron transfer to ferredoxin. J Biol Brodie TB, Hurley JK, Tollin G, Gómez-
Chem 276:27498–24510 Moreno C, Medina M (2003) Role of hydro-
36. Lostao A, Gómez-Moreno C, Mayhew SG, phobic interactions in the flavodoxin mediated
Sancho J (1997) Differential stabilization of electron transfer from photosystem I to
the three FMN redox forms by tyrosine 94 and ferredoxin-NADP+ reductase in Anabaena
tryptophan 57 in flavodoxin from Anabaena PCC 7119. Biochemistry 42:2036–2045
and its influence on the redox potentials. 46. Martínez-Júlvez M, Medina M, Gómez-Moreno
Biochemistry 36:14334–14344 C (1999) Ferredoxin-NADP+ reductase uses the
37. Swenson RP, Krey GD (1994) Site-directed same site for the interaction with ferredoxin and
mutagenesis of tyrosine-98 in the flavodoxin flavodoxin. J Biol Inorg Chem 4:568–578
from Desulfovibrio vulgaris (Hildenborough): 47. Martínez-Júlvez M, Medina M, Hurley JK,
regulation of oxidation–reduction properties of Hafezi R, Brodie TB, Tollin G, Gómez-Moreno
the bound FMN cofactor by aromatic, solvent, C (1998) Lys75 of Anabaena ferredoxin-
and electrostatic interactions. Biochemistry NADP+ reductase is a critical residue for binding
33:8505–8514 ferredoxin and flavodoxin during electron trans-
38. Goñi G, Herguedas B, Hervás M, Peregrina fer. Biochemistry 37:13604–13613
JR, De la Rosa MA, Gómez-Moreno C, 48. Faro M, Frago S, Mayoral T, Hermoso JA,
Navarro JA, Hermoso JA, Martínez-Júlvez M, Sanz-Aparicio J, Gómez-Moreno C, Medina
Medina M (2009) Flavodoxin: a compromise M (2002) Probing the role of glutamic acid
between efficiency and versatility in the elec- 139 of Anabaena ferredoxin-NADP+ reductase
tron transfer from photosystem I to ferredoxin- in the interaction with substrates. Eur J
NADP+ reductase. Biochim Biophys Acta Biochem 269:4938–4947
1787:144–154 49. Nogués I, Hervás M, Peregrina JR, Navarro
39. Goñi G, Serrano A, Frago S, Hervás M, JA, de la Rosa MA, Gómez-Moreno C, Medina
Peregrina JR, De la Rosa MA, Gómez-Moreno M (2005) Anabaena flavodoxin as an electron
C, Navarro JA, Medina M (2008) Flavodoxin- carrier from photosystem I to ferredoxin-
mediated electron transfer from photosystem I NADP+ reductase. Role of flavodoxin residues
to ferredoxin-NADP+ reductase in Anabaena: in protein-protein interaction and electron
role of flavodoxin hydrophobic residues in transfer. Biochemistry 44:97–104
protein-protein interactions. Biochemistry 50. Casaus JL, Navarro JA, Hervás M, Lostao A,
47:1207–1217 De la Rosa MA, Gómez-Moreno C, Sancho J,
40. Zhou Z, Swenson RP (1996) The cumulative Medina M (2002) Anabaena sp. PCC 7119 fla-
electrostatic effect of aromatic stacking inter- vodoxin as electron carrier from photosystem I
actions and the negative electrostatic environ- to ferredoxin-NADP+ reductase. Role of
ment of the flavin mononucleotide binding Trp(57) and Tyr(94). J Biol Chem 277:
site is a major determinant of the reduction 22338–22344
Electron Transferases 93
of cooperative ligand binding by isothermal 72. Serrano A, Medina M (2011) Fast kinetic
titration calorimetry. Biophys J 91:1887–1904 methods with photodiode array detection in
71. Martinez-Julvez M, Medina M, Velázquez- the study of the interaction and electron trans-
Campoy A (2009) Binding thermodynamics of fer between flavodoxin and ferredoxin NADP+-
ferredoxin:NADP+ reductase: two different reductase. Advances in Photosynthesis.
protein substrates and one energetics. Biophys Fundamental Aspects (Najafpour, M.M., Ed.),
J 96:4966–4975 Intech, Rijeka, Croatia
Chapter 6
Aldonolactone Oxidoreductases
Nicole G.H. Leferink and Willem J.H. van Berkel
Abstract
Vitamin C is a widely used vitamin. Here we review the occurrence and properties of aldonolactone
oxidoreductases, an important group of flavoenzymes responsible for the ultimate production of vitamin C
and its analogs in animals, plants, and single-cell organisms.
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_6, © Springer Science+Business Media New York 2014
95
96 Nicole G.H. Leferink and Willem J.H. van Berkel
2 Vitamin C Biosynthesis
3 Aldonolactone Oxidoreductases
Fig. 2 Reactions catalyzed by various aldonolactone oxidoreductases. (a) L-Gulono-1,4-lactone oxidase (GUO);
(b) D-Arabinono-1,4-lactone oxidase (ALO); (c) D-Gluconolactone oxidase (GLO); (d) L-Galactono-1,4-lactone
dehydrogenase (GALDH)
Table 1
Overview of characterized aldonolactone oxidoreductases
Subcellular Electron
Enzyme Source location Flavin Main substrate acceptor(s) References
GUO Animals Microsomes 8α-N1- L-Gulono-1, Oxygen [12, 30–35]
histidyl 4-lactone
FAD
GALDH Plants Mitochondria Non- L-Galactono-1, Cytochrome c [42–51]
covalent 4-lactone
FAD
ALO Yeast Mitochondria 8α-N1- D-Arabinono-1, Oxygen [27, 36–39]
histidyl 4-lactone
FAD
LdALO L. donovani Glycosomes Non- D-Arabinono-1, Cytochrome c [23]
covalent 4-lactone
FAD
TbALO T. brucei Glycosomes Non- D-Arabinono-1, Cytochrome c [21, 22]
covalent 4-lactone
FMNa
TcGAL T. cruzi Glycosomes Non- L-Galactono-1, Cytochrome c, [22, 81]
covalent 4-lactone oxygen
FAD
GLO Penicillium sp. Extracellular 8α-N3- D-Gluconolactone Oxygen [6, 24, 25]
histidyl
FADb
GUDH M. tuberculosis – Nonec L-Gulono-1, Cytochrome c [40]
4-lactone
a
Prediction from amino acid sequence gives non-covalent FAD [81]
b
Prediction from amino acid sequence gives 8-N1-histidyl FAD [29]
c
No flavin was detected, despite the presence of a conserved N-terminal FAD-binding domain [40]
Fig. 3 Comparison of putative active site residues of various aldonolactone oxidoreductases with related VAO
family members. (a) Crystal structure of the active site of alditol oxidase (AldO) with bound xylitol (PDB entry:
2VFS). (b) Crystal structure of the active site of cholesterol oxidase (CO) (PDB entry: 1I19). Active site residues
conserved in aldonolactone oxidoreductases are indicated. (c) Clustal W multiple sequence alignment of part
of the active site region of several aldonolactone oxidoreductases with related VAO family members. Identical
residues are shaded in black; similar residues are shaded in grey. The conserved Arg–Glu pair is indicated with
asterisks (asterisk). The number of residues present at the termini and in gaps in the sequence is indicated in
parentheses. Amino acid sequences used are GALDH, Q8GY19; GUO, P10867; ALO, P54783; TcGAL, Q4DPZ5;
AldO, Q9ZBU1; and CO, Q7SID9. This figure is modified from ref. 57
Fig. 4 Proposed mechanism for the irreversible oxidation and reversible glutathionylation of GALDH [58].
The green (white) state is active, the orange (light gray) state is reversibly inactive, and the red (dark grey)
state is irreversibly inactive
3.2 Refolding The trypanosomal parasites T. brucei and T. cruzi threat millions of
of TcGAL people around the world. Current treatments are unsatisfactory,
since the available drugs have a limited efficacy and exhibit toxic
side effects. During their life cycles, trypanosomatids are exposed
to reactive oxygen species generated by their own aerobic metabo-
lism and by the host’s immune response. The antioxidant response
in the parasites is distinct from their mammalian hosts and includes
targets that may be exploited therapeutically. Trypanosomes lack
catalases and glutathione peroxidases [77, 78] and detoxify hydro-
gen peroxide using a plant-like ascorbate peroxidase [79, 80].
Furthermore, they possess the unique dithiol trypanothione, which
is a conjugate of two glutathione molecules with one molecule of
spermidine. The flavoenzyme trypanothione reductase, which
keeps trypanothione in the reduced state, is an essential enzyme for
the parasite as it is the only enzyme that connects hydrogen perox-
ide detoxification to NAD(P)H redox biology in these parasites
[78]. Trypanosomes contain significant levels of L-ascorbate, which
is synthesized in the glycosome. Genome analysis has indicated
that ascorbate biosynthesis in trypanosomes is similar to that in
plants [21, 22]. The trypanosomal enzymes involved in ascorbate
biosynthesis are interesting targets for drug therapy, since the para-
sites lack the ability to scavenge ascorbate from the environment
and rely on de novo synthesis for their survival [22, 77].
The terminal step in ascorbate biosynthesis in T. cruzi is cata-
lyzed by L-galactonolactone oxidoreductase (TcGAL) [22].
Because recombinant expression of untagged TcGAL in E. coli
yields mostly inactive inclusion bodies, we designed an in vitro
refolding method using AOT–isooctane reverse micelles [81]:
1. For refolding of the TcGAL inclusion bodies, the insoluble
material collected after cell lysis is washed with a 6 % Triton
X-100 solution containing 60 mM EDTA and 1.5 M NaCl.
The washed inclusion bodies are dissolved in 6 M guanidin-
ium hydrochloride to a final protein concentration of 10 mg/mL.
Subsequently, the denaturant is removed by dialysis against
10 mM sodium phosphate, pH 8.0, containing 1 mM DTT to
reduce any oxidized cysteines. A final dialysis step against
10 mM sodium phosphate, pH 7.2, is employed to remove
excess DTT. The turbid suspension obtained after dialysis is
then added to the reverse micelles system consisting of 0.4 M
106 Nicole G.H. Leferink and Willem J.H. van Berkel
4 Outlook
References
1. Joosten V, van Berkel WJH (2007) Flavoenzymes. production of D-erythorbic acid in recombinant
Curr Opin Chem Biol 11:195–202 Pichia pastoris. Appl Environ Microbiol 70:
2. Macheroux P, Kappes B, Ealick SE (2011) 5503–5510
Flavogenomics – a genomic and structural 7. Hancock RD, Viola R (2002) Biotechnological
view on flavin-dependent proteins. FEBS J approaches for L ascorbic acid production.
278:2625–2634 Trends Biotechnol 20:299–305
3. Englard S, Seifter S (1986) The biochemical 8. Ishikawa T, Dowdle J, Smirnoff N (2006)
functions of ascorbic acid. Annu Rev Nutr Progress in manipulating ascorbic acid biosyn-
6:365–406 thesis and accumulation in plants. Physiol Plant
4. Chatterjee IB (1973) Evolution and the bio- 126:343–355
synthesis of ascorbic acid. Science 182: 9. Hancock RD, Viola R (2001) The use of
1271–1272 micro-organisms for L-ascorbic acid produc-
5. Smirnoff N, Wheeler GL (2000) Ascorbic acid tion: current status and future perspectives.
in plants: biosynthesis and function. Crit Rev Appl Microbiol Biotechnol 56:567
Biochem Mol Biol 35:291–314 10. Linster CL, van Schaftingen E (2007) Vitamin
6. Salusjärvi T, Kalkkinen N, Miasnikov AN C. Biosynthesis, recycling and degradation in
(2004) Cloning and characterization of gluco- mammals. FEBS J 274:1–22
nolactone oxidase of Penicillium cyaneo-fulvum 11. Smirnoff N (2001) L-Ascorbic acid biosynthesis.
ATCC 10431 and evaluation of its use for Vitam Horm 61:241–266
Aldonolactone Oxidoreductases 109
12. Burns JJ, Moltz A, Peyser P (1956) Missing properties of D glucono-γ-lactone dehydroge-
step in guinea pigs required for the biosynthesis nase: D erythorbic acid producing enzyme of
of L ascorbic acid. Science 124:1148–1149 Penicillium cyaneo-fulvum. Agr Biol Chem
13. Valpuesta V, Botella MA (2004) Biosynthesis of 40:121–129
L-ascorbic acid in plants: new pathways for an 25. Harada Y, Shimizu M, Murakawa S, Takahashi
old antioxidant. Trends Plant Sci 9:573–577 T (1979) Identification of FAD of D glucono-
14. Wheeler GL, Jones MA, Smirnoff N (1998) lactone dehydrogenase: D-erythorbic acid pro-
The biosynthetic pathway of vitamin C in ducing enzyme of Penicillium cyaneo-fulvum.
higher plants. Nature 393:365–369 Agr Biol Chem 43:2635–2636
15. Gatzek S, Wheeler GL, Smirnoff N (2002) 26. Amako K, Fujita K, Shimohata T-A, Hasegawa
Antisense suppression of L galactose dehydro- E, Kishimoto R, Goda K (2006) NAD+ spe-
genase in Arabidopsis thaliana provides evi- cific D arabinose dehydrogenase and its con-
dence for its role in ascorbate synthesis and tribution to erythroascorbic acid production
reveals light modulated L-galactose synthesis. in Saccharomyces cerevisiae. FEBS Lett 580:
Plant J 30:541–553 6428–6434
16. Mapson LW, Isherwood FA, Chen YT (1954) 27. Huh WK, Lee BH, Kim ST, Kim YR, Rhie GE,
Biological synthesis of L ascorbic acid: the con- Baek YW, Hwang CS, Lee JS, Kang SO (1998)
version of L galactono-γ-lactone into L ascor- D erythroascorbic acid is an important antioxi-
bic acid by plant mitochondria. Biochem J dant molecule in Saccharomyces cerevisiae. Mol
56:21–28 Microbiol 30:895–903
17. Agius F, González-Lamothe R, Caballero JL, 28. Fraaije MW, Benen JAE, Visser J, Mattevi A,
Muñoz-Blanco J, Botella MA, Valpuesta V van Berkel WJH (1998) A novel oxidoreduc-
(2003) Engineering increased vitamin C levels tase family sharing a conserved FAD-binding
in plants by overexpression of a D galacturonic domain. Trends Biochem Sci 23:206–207
acid reductase. Nat Biotechnol 21:177–181 29. Leferink NGH, Heuts DPHM, Fraaije MW,
18. Lorence A, Chevone BI, Mendes P, Nessler CL van Berkel WJH (2008) The growing VAO fla-
(2004) Myo-inositol oxygenase offers a possi- voprotein family. Arch Biochem Biophys 474:
ble entry point into plant ascorbate biosynthe- 292–301
sis. Plant Physiol 134:1200–1205 30. Nishikimi M (1979) L Gulono-γ-lactone oxi-
19. Maruta T, Ichikawa Y, Mieda T, Takeda T, dase (rat and goat liver). Methods Enzymol 62:
Tamoi M, Yabuta Y, Ishikawa T, Shigeoka S 24–30
(2010) The contribution of Arabidopsis homo- 31. Kiuchi K, Nishikimi M, Yagi K (1982)
logs of L gulono-1,4 lactone oxidase to the Purification and characterization of L gulono-
biosynthesis of ascorbic acid. Biosci Biotechnol lactone oxidase from chicken kidney micro-
Biochem 74:1494–1497 somes. Biochemistry 21:5076–5082
20. Ishikawa T, Nishikawa H, Gao Y, Sawa Y, 32. Puskas F, Braun L, Csala M, Kardon T,
Shibata H, Yabuta Y, Maruta T, Shigeoka S Marcolongo P, Benedetti A, Mandl J, Banhegyi
(2008) The pathway via D galacturonate/L G (1998) Gulonolactone oxidase activity-
galactonate is significant for ascorbate biosyn- dependent intravesicular glutathione oxidation
thesis in Euglena gracilis: Identification and in rat liver microsomes. FEBS Lett 430:
functional characterization of aldonolactonase. 293–296
J Biol Chem 283:31133–31141 33. Kenney WC, Edmondson DE, Singer TP
21. Wilkinson SR, Prathalingam SR, Taylor MC, (1976) Identification of the covalently bound
Horn D, Kelly JM (2005) Vitamin C biosyn- flavin of L-gulono-γ-lactone oxidase. Biochem
thesis in trypanosomes: a role for the glyco- Biophys Res Commun 71:1194–1200
some. Proc Natl Acad Sci U S A 102: 34. Nakagawa H, Asano A (1970) Ascorbate synthe-
11645–11650 sizing system in rat liver microsomes. I.
22. Logan FJ, Taylor MC, Wilkinson SR, Kaur H, Gulonolactone-reducible pigment as a prosthetic
Kelly JM (2007) The terminal step in vitamin group of gulonolactone oxidase. J Biochem
C biosynthesis in Trypanosoma cruzi is medi- 68:737–746
ated by a FMN dependent galactonolactone 35. Nishikimi M, Fukuyama R, Minoshima S,
oxidase. Biochem J 407:419–426 Shimizu N, Yagi K (1994) Cloning and chro-
23. Biyani N, Madhubala R (2011) Leishmania mosomal mapping of the human nonfunctional
donovani encodes a functional enzyme involved gene for L-gulono-γ-lactone oxidase, the
in vitamin C biosynthesis: arabino-1,4-lactone enzyme for L ascorbic acid biosynthesis missing
oxidase. Mol Biochem Parasitol 180:76–85 in man. J Biol Chem 269:13685–13688
24. Takahashi T, Yamashita H, Kato E, Mitsumoto 36. Nishikimi M, Noguchi E, Yagi K (1978)
M, Murakawa S (1976) Purification and some Occurrence in yeast of L galactonolactone
110 Nicole G.H. Leferink and Willem J.H. van Berkel
oxidase which is similar to a key enzyme for 48. Østergaard J, Persiau G, Davey MW, Bauw G,
ascorbic acid biosynthesis in animals, L gulono- van Montagu M (1997) Isolation of a cDNA
lactone oxidase. Arch Biochem Biophys 191: coding for L galactono-γ-lactone dehydroge-
479–486 nase, an enzyme involved in the biosynthesis of
37. Bleeg HS, Christensen F (1982) Biosynthesis ascorbic acid in plants. Purification, character-
of ascorbate in yeast. Purification of L ization, cDNA cloning, and expression in yeast.
galactono-1,4-lactone oxidase with properties J Biol Chem 272:30009–30016
different from mammalian L gulonolactone 49. Imai T, Karita S, Shiratori G, Hattori M,
oxidase. Eur J Biochem 127:391–396 Nunome T, Ôba K, Hirai M (1998)
38. Huh WK, Kim ST, Yang KS, Seok YJ, Hah YC, L-Galactono-γ-lactone dehydrogenase from
Kang SO (1994) Characterisation of D sweet potato: purification and cDNA sequence
arabinono-1,4-lactone oxidase from Candida analysis. Plant Cell Physiol 39:1350–1358
albicans ATCC 10231. Eur J Biochem 225: 50. Yabuta Y, Yoshimura K, Takeda T, Shigeoka S
1073–1079 (2000) Molecular characterization of tobacco
39. Kenney WC, Edmondson DE, Singer TP, mitochondrial L galactono-γ-lactone dehydro-
Nishikimi M, Noguchi E, Yagi K (1979) genase and its expression in Escherichia coli.
Identification of the covalently-bound flavin of Plant Cell Physiol 41:666–675
L galactonolactone oxidase from yeast. FEBS 51. Leferink NGH, van den Berg WAM, van Berkel
Lett 97:40–42 WJH (2008) L Galactono-γ-lactone dehydro-
40. Wolucka BA, Communi D (2006) genase from Arabidopsis thaliana, a flavopro-
Mycobacterium tuberculosis possesses a func- tein involved in vitamin C biosynthesis. FEBS J
tional enzyme for the synthesis of vitamin C, 275:713–726
L gulono-1,4-lactone dehydrogenase. FEBS J 52. Lederer F (1978) Sulfite binding to a flavode-
273:4435–4445 hydrogenase, cytochrome b2 from baker’s
41. Smith AG, Croft MT, Moulin M, Webb ME yeast. Eur J Biochem 88:425–431
(2007) Plants need their vitamins too. Curr 53. Fraaije MW, Mattevi A (2000) Flavoenzymes:
Opin Plant Biol 10:266–275 diverse catalysts with recurrent features. Trends
42. Heazlewood JL, Howell KA, Millar AH (2003) Biochem Sci 25:126–132
Mitochondrial complex I from Arabidopsis and 54. Mewies M, McIntire WS, Scrutton NS (1998)
rice: orthologs of mammalian and fungal com- Covalent attachment of flavin adenine dinucle-
ponents coupled with plant-specific subunits. otide (FAD) and flavin mononucleotide (FMN)
Biochim Biophys Acta 1604:159–169 to enzymes: the current state of affairs. Protein
43. Alhagdow M, Mounet F, Gilbert L, Nunes- Sci 7:7–20
Nesi A, Garcia V, Just D, Petit J, Beauvoit B, 55. Forneris F, Heuts DPHM, Delvecchio M,
Fernie AR, Rothan C, Baldet P (2007) Rovida S, Fraaije MW, Mattevi A (2008)
Silencing of the mitochondrial ascorbate syn- Structural analysis of the catalytic mechanism
thesizing enzyme L galactono-1,4-lactone and stereoselectivity in Streptomyces coelicolor
dehydrogenase (L-GalLDH) affects plant and alditol oxidase. Biochemistry 47:978–985
fruit development in tomato. Plant Physiol 56. Coulombe R, Yue KQ, Ghisla S, Vrielink A
145:1408–1422 (2001) Oxygen access to the active site of cho-
44. Pineau B, Layoune O, Danon A, De Paepe R lesterol oxidase through a narrow channel is
(2008) L-Galactono-1,4-lactone dehydrogenase gated by an Arg-Glu pair. J Biol Chem
is required for the accumulation of plant respira- 276:30435–30441
tory complex I. J Biol Chem 283:32500–32505 57. Leferink NGH, Jose MF, van den Berg WAM,
45. Mapson LW, Breslow E (1958) Biological syn- van Berkel WJH (2009) Functional assignment
thesis of ascorbic acid: L galactono-γ-lactone of Glu386 and Arg388 in the active site of
dehydrogenase. Biochem J 68:395–406 L-galactono-γ-lactone dehydrogenase. FEBS
46. Mutsuda M, Ishikawa T, Takeda T, Shigeoka S Lett 583:3199–3203
(1995) Subcellular localization and properties 58. Leferink NGH, van Duijn E, Barendregt A,
of L-galactono-γ-lactone dehydrogenase in Heck AJR, van Berkel WJH (2009)
spinach leaves. Biosci Biotechnol Biochem 59: Galactonolactone dehydrogenase requires a
1983–1984 redox-sensitive thiol for optimal production of
47. Ôba K, Ishikawa S, Nishikawa M, Mizuno H, vitamin C. Plant Physiol 150:596–605
Yamamoto T (1995) Purification and proper- 59. Dalle-Donne I, Rossi R, Giustarini D, Colombo R,
ties of L galactono-γ-lactone dehydrogenase, a Milzani A (2007) S glutathionylation in pro-
key enzyme for ascorbic acid biosynthesis, from tein redox regulation. Free Radic Biol Med
sweet potato roots. J Biochem 117:120–124 43:883–898
Aldonolactone Oxidoreductases 111
60. Giorgio M, Trinei M, Migliaccio E, Pelicci PG 72. Bruckner RC, Winans J, Jorns MS (2011)
(2007) Hydrogen peroxide: a metabolic by- Pleiotropic impact of a single lysine mutation on
product or a common mediator of ageing sig- biosynthesis of and catalysis by N methyltrypto-
nals? Nat Rev Mol Cell Biol 8:722–728 phan oxidase. Biochemistry 50:4949–4962
61. Navrot N, Rouhier N, Gelhaye E, Jacquot J-P 73. Kommoju P-R, Chen Z, Bruckner RC, Scott
(2007) Reactive oxygen species generation and Mathews F, Jorns MS (2011) Probing oxygen
antioxidant systems in plant mitochondria. activation sites in two flavoprotein oxidases
Physiol Plant 129:185–195 using chloride as an oxygen surrogate.
62. Ishikawa T, Shigeoka S (2008) Recent advances Biochemistry 50:5521–5534
in ascorbate biosynthesis and the physiological 74. Hernandez-Ortega A, Lucas F, Ferreira P,
significance of ascorbate peroxidase in photo- Medina M, Guallar V, Martínez AT (2011)
synthesizing organisms. Biosci Biotechnol Modulating oxygen reactivity in a fungal flavo-
Biochem 72:1143–1154 enzyme. J Biol Chem 286:41105–41114
63. Massey V (1994) Activation of molecular oxy- 75. Kuipers RK, Joosten HJ, Verwiel E, Paans S,
gen by flavins and flavoproteins. J Biol Chem Akerboom J, van der Oost J, Leferink NG, van
269:22459–22462 Berkel WJH, Vriend G, Schaap PJ (2009)
64. Mattevi A (2006) To be or not to be an oxi- Correlated mutation analyses on super-family
dase: challenging the oxygen reactivity of flavo- alignments reveal functionally important resi-
enzymes. Trends Biochem Sci 31:276–283 dues. Proteins 76:608–616
65. Baron R, Rileya C, Chenprakhon P, 76. Leferink NGH, Fraaije MW, Joosten HJ,
Thotsaporn K, Winter RT, Alfieri A, Forneris Schaap PJ, Mattevi A, van Berkel WJH (2009)
F, van Berkel WJH, Chaiyen P, Fraaije MW, Identification of a gatekeeper residue that pre-
Mattevi A, McCammon JA (2009) Multiple vents dehydrogenases from acting as oxidases.
pathways guide oxygen diffusion into flavoen- J Biol Chem 284:4392–4397
zyme active sites. Proc Natl Acad Sci U S A 77. Irigoín F, Cibils L, Comini MA, Wilkinson SR,
106:10603–10608 Flohé L, Radi R (2008) Insights into the redox
66. Vrielink A, Ghisla S (2009) Cholesterol oxi- biology of Trypanosoma cruzi: trypanothione
dase: biochemistry and structural features. metabolism and oxidant detoxification. Free
FEBS J 276:6826–6843 Radic Biol Med 45:733–742
67. Finnegan S, Agniswamy J, Weber IT, Gadda G 78. Krauth-Siegel RL, Comini MA (2008) Redox
(2010) Role of valine 464 in the flavin oxida- control in trypanosomatids, parasitic protozoa
tion reaction catalyzed by choline oxidase. with trypanothione-based thiol metabolism.
Biochemistry 49:2952–2961 Biochim Biophys Acta 1780:1236–1248
68. Jorns MS, Chen Z, Scott Mathews F (2010) 79. Wilkinson SR, Obado SO, Mauricio IL, Kelly
Structural characterization of mutations at the JM (2002) Trypanosoma cruzi expresses a
oxygen activation site in monomeric sarcosine plant-like ascorbate-dependent hemoperoxi-
oxidase. Biochemistry 49:3631–3639 dase localized to the endoplasmic reticulum.
69. Spadiut O, Tan T-C, Pisanelli I, Haltrich D, Proc Natl Acad Sci U S A 99:13453–13458
Divne C (2010) Importance of the gating seg- 80. Castro H, Tomás AM (2008) Peroxidases of
ment in the substrate-recognition loop of pyra- trypanosomatids. Antioxid Redox Signal 10:
nose 2 oxidase. FEBS J 277:2892–2909 1593–1606
70. Saam J, Rosini E, Molla G, Schulten K, 81. Kudryashova EV, Leferink NGH, Slot IGM,
Pollegioni L, Ghisla S (2010) Oxygen reac- van Berkel WJH (2011) Galactonolactone oxi-
tivity of flavoproteins. J Biol Chem 285: doreductase from Trypanosoma cruzi employs a
24439–24446 FAD cofactor for the synthesis of vitamin C.
71. Rosini E, Molla G, Ghisla S, Pollegioni L Biochim Biophys Acta 1814:545–552
(2011) On the reaction of D amino acid oxi- 82. Kashyap DR, Vohra PK, Chopra S, Tewari R
dase with dioxygen: oxygen diffusion pathways (2001) Applications of pectinases in the com-
and enhancement of reactivity. FEBS J 278: mercial sector: a review. Bioresour Technol 77:
482–492 215–227
Chapter 7
Abstract
The potential of flavoproteins as targets of pharmacological treatments is immense. In this review we present
an overview of the current research progress on medical interventions based on flavoproteins with a special
emphasis on cancer, infectious diseases, and neurological disorders.
List of abbreviations
5-HT Serotonin
ALS Amyotrophic lateral sclerosis
AR Androgen receptor
DA Dopamine
DAAO D-amino acid oxidase
DHODH Dihydroorotate dehydrogenase
ER Estrogen receptor
FAD Flavin adenine dinucleotide
FMN Flavin mononucleotide
GR Glutathione reductase
Grx Glutaredoxin
GSH Reduced glutathione
GSSG Oxidized glutathione
HDAC Histone deacetylase
LipDH Lipoamide dehydrogenase
LSD Lysine specific demethylase
MAO Monoamine oxidase
MGd Motexafin gadolinium
NQO1 NAD(P)H:quinone oxidoreductase 1
NE Norepinephrine
NMDAR N-methyl D-aspartate receptor
NOX NADPH oxidases
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_7, © Springer Science+Business Media New York 2014
113
114 Esther Jortzik et al.
1 Introduction
2.1 Lysine-Specific The phenotype of a cell is not only dependent up on its genetic
Demethylase 1 information encoded by DNA but also mediated by epigenetic
regulations of gene transcription, which includes DNA methyla-
tion, posttranslational histone modifications, nucleosome
remodeling, and noncoding RNAs [6]. Among epigenetic gene
regulations, histone lysine methylation plays an important role in
activating and suppressing gene transcription, depending on the
target site and the degree of methylation [7, 8]. In eukaryotes,
histone lysine methylation occurs at the N-terminal tail of histones,
and is catalyzed by lysine methyltransferases. Concurrently,
demethylation catalyzed by histone lysine demethylases is required
to balance the homeostasis of histone lysine methylation. So far,
two major classes of histone lysine demethylases have been identi-
fied, the lysine-specific demethylases (LSD1 and 2) and the Jumonji
C domain demethylases [8, 9].
The evolutionarily conserved flavoprotein LSD1, also known
as BHC110 or KIAA0601, is the first identified histone demethyl-
ase [10]. LSD1 specifically catalyzes the demethylation of mono-
and di-methylated lysine 4 of histone 3 (H3K4me1/2), but not of
tri-methylated H3K4 (H3K4me3) [10]. Later, it was shown that
LSD1 can also demethylate lysine 9 of histone 3 (H3K9me1/2)
when it associates with the androgen receptor (AR) [11]. The
demethylating activity of LSD1 on H3K4 can also be influenced by
concurrent post-translational modifications on the same peptide,
exemplified by the fact that acetylation of H3K9 reduces LSD1
activity, whereas phosphorylation of H3S10 completely abolishes
it [12]. Importantly, LSD1 is found to act as part of a multiprotein
complex, which further involves histone deacetylase (HDAC1/2),
CoREST (corepressor 1 of REST), and PHD-domain-containing
protein BHC80 [13, 14].
Genetic and structural analyses of LSD1 indicate that the pro-
tein is homologous to flavin-containing amine oxidases [10]. At its
C-terminus, LSD1 contains an amine oxidase-like domain, which
consists of two subdomains: an FAD-binding domain and a
substrate-binding domain. The catalytic mechanism of demethyl-
ation by LSD1 has been proposed to follow a way of amine oxida-
tion as characterized for flavin-containing amine oxidase: LSD1
catalyzes the oxidative cleavage of a C–N bond of the methylated
lysine via two-electron reduction of FAD forming an imine inter-
mediate, which is then non-enzymatically hydrolyzed to aldehyde
116 Esther Jortzik et al.
2.1.1 The Role of LSD1 Abnormal alterations of histone methylation marks have been cor-
in Cancer related with tumorigenesis [15–17]. Analyses of global histone
modifications in human cancer cells revealed that histone methyla-
tion patterns differ in different types of cancer and are associated
with progression, recurrence, and prognosis of cancer [9, 18–25].
For example, when compared to other gastrointestinal and hepato-
biliary carcinomas, strikingly low H3K4me2 levels have been
reported in hepatocellular carcinomas [19]. Reduced levels of
H3K4me2 are also correlated with an adverse prognosis in breast
cancer and non-small-cell lung carcinoma [23, 24]. However, lev-
els of all H3K4 methylation states are significantly increased in
hormone-refractory prostate cancer when compared to clinically
localized prostate cancer [21].
Aberrant regulation of histone methylation is undoubtedly
related to an imbalance of histone methyltransferases and demeth-
ylases, which cooperatively govern the dynamic homeostasis of his-
tone methylation [9]. Increasing evidence has pointed out that
LSD1 is implicated in tumorigenesis [15]. Overexpression of
LSD1 has been found in many high-risk tumors, predicting an
adverse clinical prognosis [20, 22, 26]. For example, LSD1 is
strongly expressed in poorly differentiated neuroblastoma and
seems to maintain undifferentiated and malignant phenotypes of
neuroblastoma cells [27]. LSD1 is also correlated with the adverse
outcome of neuroblastoma. Either knockdown of LSD1 by small
interfering RNA or inhibition of LSD1 by monoamine oxidase
Flavins and Flavoproteins: Applications in Medicine 117
2.1.2 LSD1 Inhibitors in Although our understanding of the role of histone demethylases in
the Treatment of Cancer cancer still requires a lot of research, emerging studies have shed
light on the therapeutic potential of LSD1 inhibitors against can-
cer [32]. Since LSD1 and monoamine oxidases (MAOs) share a
high similarity of their catalytic site, LSD1 was found to be inhib-
ited by various unspecific MAO inhibitors, of which tranylcypro-
mine showed the strongest inhibitory effect on LSD1 by forming
a covalent tranylcypromine-FAD adduct [33, 34]. Recently, a
number of tranylcypromine derivatives have been synthesized and
characterized with respect to their anticancer potentials [35, 36].
118 Esther Jortzik et al.
2.2.1 The Role of TrxR TrxR functions as an essential antioxidant enzyme to protect cells
in Cancer from oxidative stress [54]. TrxR is able to directly reduce some
oxidative species, including hydrogen peroxide and lipid hydroper-
oxides [51, 55]. Besides, many intracellular antioxidant proteins
and low-molecular-weight compounds are also substrates of TrxR,
such as glutaredoxin (Grx), protein disulfide isomerase, dehydro-
ascorbate, ubiquinone, and selenium compounds [56–60].
Moreover, TrxR-mediated reduction of Trx also exerts antioxidant
functions since Trx serves as an electron donor for peroxiredoxin
(Prx) and methionine sulfoxide reductase [61, 62] (see Fig. 2).
Since oxidative stress is a well-known trigger of cancer, elimination
of oxidative stress, either by TrxR alone or in association with Trx,
plays a pivotal role in stabilizing the intracellular redox balance,
thus preventing oxidative stress-induced carcinogenesis [54, 63].
Notably, it is known that TrxR also mediates chemopreventive
120 Esther Jortzik et al.
Fig. 2 Flow of electrons through the thioredoxin system with antioxidant and prooxidant functions. TrxR exhibits
the predominant electron transport pathway that starts from NADPH via FAD, the N-terminal active site disul-
fide and the C-terminal Cys-Sec active site to its main substrate Trx. TrxR can function as an intracellular
antioxidant, in redox regulation and in cell proliferation, which is either mediated directly by TrxR via reduction
of different substrates and/or indirectly via reduction of Trx, which in turn reduces disulfides of downstream
target proteins. When the electron transport to Trx is blocked by Sec-targeting inhibitors, the electrons tend to
flow from the intact N-terminal active site to oxygen in order to produce superoxide, thus leading to ROS-
mediated cancer cell death. DHA dehydroascorbate, Grx glutaredoxin, LOOHs lipid hydroperoxides, PDI protein
disulfide isomerase, Q10 ubiquinone-10, Trx thioredoxin, TrxR thioredoxin reductase
that the Trx system may facilitate the survival of cancer cells [67, 68].
Moreover, expression of the Trx system may be increased in cancer
cells in order to fulfill the large demand of DNA biosynthesis for
their rapid proliferation rate, since ribonucleotide reductase
(RNR), a key enzyme in DNA biosynthesis, acquires reducing
equivalents from Trx [44, 69]. In fact, overexpression of both
TrxR1 and Trx1 has been detected in many types of human cancer,
including melanomas, thyroid, prostate, breast, colon, lung, and
oral squamous cell carcinomas [70–74]. Consistently, the Trx sys-
tem is also overexpressed in solid tumors, lymphomas, and leuke-
mias [75, 76]. Overexpression of TrxR and Trx is usually related to
malignancy, high proliferation capacity, low apoptosis rate, and
drug-resistant tumors and predicts an adverse clinical prognosis in
tumor patients [68, 70, 77, 78]. Therefore, TrxR, the key player of
the Trx system, has been proposed as a potential anticancer target
[79] (see Fig. 2).
Indeed, knockdown of TrxR1 in mouse lung carcinoma
(LLC1) cells was reported to reverse malignant cancer phenotypes
and to inhibit tumorigenicity in mice [80]. Additionally, reduction
of TrxR1 levels leads to inhibition of self-sufficient growth and
DNA replication in cancer cells [81]. These in vivo studies suggest
that TrxR1 may be a prime target in cancer therapy. In fact, inhibi-
tion of TrxR has indeed been correlated to the anticancer mecha-
nism of many clinically used drugs and synthesized active
compounds [82–85]. Inhibition of TrxR usually results in suppres-
sion of proliferation in tumor and cancer cells, induction of cancer
apoptosis, attenuation of drug resistance, and sensibilization of
radiotherapy/chemotherapy [44, 67, 84, 86].
Recently, selenium-compromised thioredoxin reductase-
derived apoptotic proteins (SecTRAP), the Sec-deficient form of
TrxR generated by specifically targeting the Sec residue by inhibi-
tors, have been shown to produce pronounced amounts of ROS
and to rapidly induce ROS-mediated cancer cell death [87]. It was
found that the intact N-terminal active site is essential for this
ROS-generating function of SecTRAP. The underlying mecha-
nism has later been attributed to the Sec-independent inherent
pro-oxidant NADPH oxidase activity of TrxR [88]. It was shown
that upon blockage of the normal electron-transferring pathway
to Trx, TrxR1 tends to generate considerable amounts of super-
oxide via the N-terminal domain dithiols (Cys59/Cys64) [88].
This pro-oxidant role of TrxR is of particular importance, because
it may contribute to the cytotoxic effects related to enhanced oxi-
dative stress caused by some TrxR1 inhibitors targeting the
C-terminal active site of TrxR. Thus, by targeting the C-terminal
active site of TrxR to obstruct the electron flow toward Trx, TrxR
can switch from an antioxidant to a pro-oxidant protein (see Fig. 2).
This may offer a substantial advantage for developing anticancer
agents that induce oxidative stress-mediated cell death in cancer.
122 Esther Jortzik et al.
2.2.2 TrxR Inhibitors Sec in the C-terminal active site of TrxR is highly reactive toward
in Cancer Therapy electrophiles and provides an excellent target site for developing
TrxR inhibitors [52]. So far, numerous TrxR inhibitors with
Flavins and Flavoproteins: Applications in Medicine 123
3.2 Malaria With almost half of the world’s population living in malaria-endemic
regions and nearly 800,000 deaths per year, malaria is one of the
major threats to human health [147]. Its most severe form is
caused by the protozoan parasite Plasmodium falciparum. Due to
emerging resistance to nearly all previously and currently used
drugs, new pharmacologic approaches are urgently needed, with
the most promising strategies being based on combination thera-
pies with two drugs [147]. Components of the Plasmodium redox
network are considered highly attractive targets for antimalarial
drug development with a major focus on the FAD-dependent oxi-
doreductases GR and TrxR [148, 149].
4 Flavoproteins in Neurotransmission
4.1.1 Monoamine Monoamine oxidase (MAO, E.C. 1.4.3.4) catalyzes the oxidative
Oxidase deamination of a broad range of monoamines including serotonin
(5-HT), norepinephrine (NE), dopamine (DA), and phenylethyl-
amine (PEA), thus playing a critical role in the degradation of
monoamine neurotransmitters. The MAO-catalyzed reaction
yields the corresponding aldehyde, ammonia, and hydrogen per-
oxide. Due to its potential function in neuropsychiatric disorders,
the enzyme has been extensively investigated. These research activ-
ities have furthermore been stimulated by the discovery of the
MAO inhibitor iproniazid as an antidepressant agent in the 1950s
[227, 228]. MAO is a flavin-containing enzyme that is bound to
the outer mitochondrial membrane and has two isozymes (MAO-A
and MAO-B), which are distributed in most tissues of mammals.
MAO-A exhibits a high affinity to serotonin and is blocked by low
concentrations of clorgyline [229], while MAO-B favors
2-phenylethylamine and is inhibited by low concentrations of
deprenyl [230]. The cloning of two separate cDNAs encoding two
isoforms of MAO [231] provided the basis for a range of impor-
tant discoveries, thereby allowing the elucidation of their biologi-
cal roles and development of inhibitors.
The genes of MAO isozymes originated from evolutionary
duplication of the same ancestral gene [232]. The isoforms of
MAO share 70 % amino acid identity and have a conserved penta-
peptidic sequence (Ser-Gly-Gly-Cys-Tyr) that binds the cofactor
FAD [231]. A range of studies on transcription factors and gene
promoters explained differences of tissue and cell distribution of
the two MAO isozymes [233–237]. Immunohistochemical find-
ings demonstrate that MAO-A mostly exists in catecholaminergic
neurons, whereas MAO-B is the predominantly abundant form in
serotonergic and histaminergic neurons, as well as in astrocytes
[238–241]. However, pharmacological data show that serotonin is
mainly elevated by MAO-A inhibition [242, 243]. This conflict
may indicate a certain role of MAO-A in glial cells during sero-
tonin metabolism [244].
After successful heterologous overexpression and purification
of recombinant human MAO in yeast [245, 246], the three-
dimensional structures of human MAO-A and MAO-B have been
solved at a resolution of 2.2 Å and 1.65 Å, respectively [247–249].
The X-ray structures of both human MAOs showed that the trans-
membrane motif is an α-helix located at the C-terminus. When the
C-terminal residues 393–520 in MAO-B were replaced with resi-
dues 402–527 from MAO-A, the enzyme was shown to be inac-
tive, suggesting a unique function of the C-term from MAO-B for
the active-site structure [250]. Generally, the active-site cavities are
134 Esther Jortzik et al.
4.2.1 Monoamine The use of MAO-B inhibitors in the treatment of Parkinson’s dis-
Oxidase ease is based on the observation of insufficient dopamine levels and
elevated MAO-B levels primarily caused by the cell death of dopa-
mine-secreting cells in the substantia nigra. Therefore, adjusting
the DA level by inhibition of MAO-B was studied as an adjunct to
the treatment with L-DOPA, a DA precursor [269]. The therapeu-
tic actions of selegiline (l-deprenyl) in the treatment of Parkinson’s
disease may rely on its irreversible and selective inhibition of
MAO-B, leading to an increase of brain DA levels [270]. Chemically
inducible Parkinson’s-like disease was induced by MAO-B medi-
ated bioactivation of 1-methy-4-phenyl-1,2,3,6-tetrahydropyridine
leading to N-methyl-4-phenylpyridine [271]. Similarly, elevated
levels of MAO-B in astrocytes led to parkinsonian pathological
events in mice [272]. Although rasagiline, lazabemide, and L-
deprenyl are likely to slow disease progression with different syn-
drome improvement in the first year, no obvious evidence for
therapeutic success is found after that time [273–276].
Interestingly, a selective and reversible MAO-A inhibitor,
moclobemide, demonstrated its therapeutic function in
Parkinson’s disease [277]. The study also revealed that dopamine
availability was increased upon inhibition of human MAO-A [278].
136 Esther Jortzik et al.
Table 1
Summary of monoamino oxidase inhibitors for the treatment of neurological diseases (modified
after ref. 244)
Type of
Inhibitor compound Alias inhibition Selectivity Treatment
Iproniazid Marsilid, Euphozid, Irreversible A and B Depression
Iprazid, Ipronid,
Ipronin, Rivivol
Phenelzine Nardil, Nardelzine Irreversible A and B Depression, anxiety
Isocarboxazid Marplan, Enerzer, Irreversible A and B Depression, anxiety
Marplon
Caroxazone Surodil, Timostenil Reversible A and B Depression
Nialamide Niamid Irreversible A and B Depression, anxiety
Tranylcypromine Parnate, Jatrosom Irreversible A and B Depression
Iproclozide Sursum, Sinderesin Irreversible A and B Depression
Clorgyline – Irreversible A Depression
Metralindole Inkazan Reversible A Depression
Pirlindole Lifril, Pyrazidol Reversible A Depression
Brofaromine Consonar Reversible A Depression
Minaprine Brantur, Cantor Reversible A Depression
Cimoxatone MD 780515 Reversible A Depression
Tetrindole – Reversible A Depression
Befloxatone MD370503 Reversible A Depression
Toloxatone Humoryl Reversible A Depression
Moclobemide Aurorix, Manerix Reversible A Depression,
Parkinson’s
disease
Selegiline L-Deprenyl, Irreversible B Parkinson’s disease,
Eldepryl, depression
Emsam, Zelapar
Rasagiline Azilect, AGN 1135 Irreversible B Parkinson’s disease
Ladostigil TV3326 Irreversible A and B, Parkinson’s disease,
brain depression,
selective Alzheimer’s
disease
R-2HMP – Irreversible B Parkinson’s disease
Lazabemide Pakio, Tempium Reversible B Parkinson’s disease
(continued)
Flavins and Flavoproteins: Applications in Medicine 137
Table 1
(continued)
Type of
Inhibitor compound Alias inhibition Selectivity Treatment
M30 – Irreversible A and B, Parkinson’s disease,
brain depression,
selective Alzheimer’s
disease
PF 9601N – Irreversible B Parkinson’s disease
Safinamide EMD 1195686 Reversible B Parkinson’s disease
CX 157 Tyrima Reversible A Depression
N-[5-(3-(1-Benzylpiperidin- – Irreversible A and B Alzheimer’s disease
4-yl)propoxy)-1-methyl-
1H-indol-2-yl]
methyl-N-methylprop-2-
yn-1-amine
3-(1H-pyrrol-3-yl)-2- – Reversible A Depression
oxazolidinones
4.3 Alzheimer’s Alzheimer’s disease is one common form of dementia, and the
Disease progression of the disease is caused by irreversible loss of neurons
and the loss of cognitive abilities. Currently used drugs for the
treatment of Alzheimer’s disease are acetylcholinesterase inhibitors
and NMDA glutamate receptor antagonists, but drugs acting at
the onset of the disease are required [285].
138 Esther Jortzik et al.
4.4.1 D-Amino Acid The flavoenzyme D-amino acid oxidase (DAAO, EC 1.4.3.3) oxi-
Oxidase dizes D-amino acids in the presence of oxygen, forming hydrogen
peroxide and the corresponding imino acids, which are further
hydrolyzed non-enzymatically to ammonium and an α-keto acid via
oxidative deamination. Since DAAO was first discovered in pigs in
1935 [293], DAAO has been found in many eukaryotic organisms
including fish, insects, mammals, and bacteria [294]. The human
DAAO gene located on chromosome 12q24 consists of 11 exons
and is transcribed as one 1595-bp mRNA [295, 296]. A study char-
acterizing human DAAO revealed a weaker binding trait to the
cofactor FAD compared to DAAO from pig and yeast. Human
DAAO possesses a low kinetic efficiency, which was proposed as a
mechanism for inactivation of DAAO and for maintaining high lev-
els of D-serine in vivo [297, 298]. The activity of DAAO in the
brain was detected more than 40 years ago, and D-alanine, D-serine,
D-leucine, and D-proline as substrates of DAAO were also detected
in the brain [299–301]. Recent evidence has shown that an inter-
acting protein, pLG72, can inactivate newly synthesized DAAO in
glial cells. The discovery of racemase [302, 303] in the brain respon-
sible for D-serine synthesis from L-serine may illustrate the in vivo
function of DAAO in the metabolic pathway of D-serine in the
brain. The exchange Gly181Arg in DAAO resulted in inactivation
of the enzyme in ddY/DAAO-mice. It was demonstrated that sub-
strate amino acids of DAAO such as D-serine were elevated in mouse
brains [304, 305]. However, the studies revealed transport and
uptake mechanisms of D-serine between the brain and the periph-
ery, showing that D-serine synthesis is not the only source of D-ser-
ine in the brain [306–308]. The crystal structure of human DAAO
Flavins and Flavoproteins: Applications in Medicine 139
Fig. 4 The role of DAAO in serine metabolism. Glutamate as a neurotransmitter is released from presynaptic
neurons and binds to NMDAR leading to an activation of SRR for production of D-serine. D-Serine can activate
NMDAR as a co-agonist. D-Serine can be taken up into the neurons and astrocytes through D-serine transport-
ers, known as ASCT. Then, D-serine can be transported into peroxisomes, where it is degraded by DAAO or
directly by cytosolic DAAO. New data showed that pLG72 is an inhibiting factor of DAAO. DAAO D-amino acid
oxidase, NMDAR N-methyl D-aspartate receptor, SRR serine racemase
4.5 Other Huntington’s disease and amyotrophic lateral sclerosis (ALS) share
Flavoproteins in numerous similarities with Parkinson’s disease, such as oxidative stress,
Neurological or Mental inflammation, and the formation of toxic proteins. Rasagiline and
Disorders CGP 3466 appear to be promising compounds in an animal model
Flavins and Flavoproteins: Applications in Medicine 141
5.2 NADPH Oxidase The primary catalytic function of FAD-dependent NADPH oxi-
dases (NOX) is the production of ROS by reducing molecular oxy-
gen to generate superoxide and hydrogen peroxide in many cellular
compartments [357]. ROS generation has important physiological
functions in regulating redox-sensitive signaling pathways.
However, dysregulation of NOX can result in oxidative stress with
subsequent pathophysiological states such as cardiovascular and
neural damage [358]. The majority of ROS generated in vascular
142 Esther Jortzik et al.
Acknowledgements
References
1. Massey V (1994) Activation of molecular 11. Metzger E, Wissmann M, Yin N, Müller JM,
oxygen by flavins and flavoproteins. J Biol Schneider R, Peters AHFM, Günther T,
Chem 269:22459–22462 Buettner R, Schüle R (2005) LSD1 demeth-
2. Mansoorabadi SO, Thibodeaux CJ, Liu HW ylates repressive histone marks to promote
(2007) The diverse roles of flavin coenzymes: androgen-receptor-dependent transcription.
nature’s most versatile thespians. J Org Chem Nature 437:436–439
72:6329–6342 12. Forneris F, Binda C, Vanoni MA, Battaglioli
3. Miura R (2001) Versatility and specificity in E, Mattevi A (2005) Human histone demeth-
flavoenzymes: control mechanisms of flavin ylase LSD1 reads the histone code. J Biol
reactivity. Chem Rec 1:183–194 Chem 280:41360–41365
4. Mathews FS, Cunane L, Durley RC (2000) 13. Lan F, Collins RE, De Cegli R, Alpatov R,
Flavin electron transfer proteins. Subcell Horton JR, Shi X, Gozani O, Cheng X, Shi Y
Biochem 35:29–72 (2007) Recognition of unmethylated histone
5. Macheroux P, Kappes B, Ealick SE (2011) H3 lysine 4 links BHC80 to LSD1-mediated
Flavogenomics: a genomic and structural gene repression. Nature 448:718–722
view of flavin-dependent proteins. FEBS J 14. Lee MG, Wynder C, Bochar DA, Hakimi
278:2625–2634 MA, Cooch N, Shiekhattar R (2006)
6. Portela A, Esteller M (2010) Epigenetic Functional interplay between histone demeth-
modifications and human disease. Nat ylase and deacetylase enzymes. Mol Cell Biol
Biotechnol 28:1057–1068 26:6395–6402
7. Shi Y, Whetstine JR (2007) Dynamic regula- 15. Varier RA, Timmers HT (2011) Histone
tion of histone lysine methylation by demeth- lysine methylation and demethylation path-
ylases. Mol Cell 25:1–14 ways in cancer. Biochim Biophys Acta
8. Heightman TD (2011) Chemical biology of 1815:75–89
lysine demethylases. Curr Chem Genomics 16. Pedersen MT, Helin K (2010) Histone
5:62–71 demethylases in development and disease.
9. Chi P, Allis CD, Wang GG (2010) Covalent Trends Cell Biol 20:662–671
histone modifications: miswritten, misinter- 17. Shi Y (2007) Histone lysine demethylases:
preted and mis-erased in human cancers. Nat emerging roles in development, physiology
Rev Cancer 10:457–469 and disease. Nat Rev Genet 8:829–833
10. Shi Y, Lan F, Matson C, Mulligan P, Whetstine 18. Manuyakorn A, Paulus R, Farrell J, Dawson
JR, Cole PA, Casero RA, Shi Y (2004) Histone NA, Tze S, Cheung-Lau G, Hines OJ, Reber
demethylation mediated by the nuclear amine H, Seligson DB, Horvath S, Kurdistani SK,
oxidase homolog LSD1. Cell 119:941–953 Guha C, Dawson DW (2010) Cellular histone
Flavins and Flavoproteins: Applications in Medicine 143
polyamine analogues results in reexpression doxin reductase: the active site is a redox-active
of aberrantly silenced genes. Proc Natl Acad selenolthiol/selenenylsulfide formed from the
Sci USA 104:8023–8028 conserved cysteine-selenocysteine sequence.
41. Zhu Q, Huang Y, Marton LJ, Woster PM, Proc Natl Acad Sci USA 97:5854–5859
Davidson NE, Casero RA (2011) Polyamine 52. Gromer S, Johansson L, Bauer H, Arscott
analogs modulate gene expression by inhibit- LD, Rauch S et al (2003) Active sites of thio-
ing lysine-specific demethylase 1 (LSD1) and redoxin reductases: why selenoproteins? Proc
altering chromatin structure in human breast Natl Acad Sci USA 100:12618–12623
cancer cells. Amino Acids 42:887–898 53. Fritz-Wolf K, Kehr S, Stumpf M, Rahlfs S,
42. Sharma SK, Wu Y, Steinbergs N, Crowley Becker K (2011) Crystal structure of the
ML, Hanson AS et al (2010) (Bis)urea and human thioredoxin reductase-thioredoxin
(bis)thiourea inhibitors of lysine-specific complex. Nat Commun 2 Article-No. 383
demethylase 1 as epigenetic modulators. J Med 54. Nordberg J, Arner ES (2001) Reactive oxy-
Chem 53:5197–5212 gen species, antioxidants, and the mammalian
43. Wang J, Lu F, Ren Q, Sun H, Xu Z, Lan R, thioredoxin system. Free Radic Biol Med
Liu Y, Ward D, Quan J, Ye T, Zhang H 31:1287–1312
(2011) Novel histone demethylase LSD1 55. Bjornstedt M, Hamberg M, Kumar S, Xue J,
inhibitors selectively target cancer cells with Holmgren A (1995) Human thioredoxin
pluripotent stem cell properties. Cancer Res reductase directly reduces lipid hydroperoxides
71:7238–7249 by NADPH and selenocystine strongly stimu-
44. Arner ES (2009) Focus on mammalian thio- lates the reaction via catalytically generated
redoxin reductases: important selenoproteins selenols. J Biol Chem 270:11761–11764
with versatile functions. Biochim Biophys 56. Johansson C, Lillig CH, Holmgren A (2004)
Acta 1790:495–526 Human mitochondrial glutaredoxin reduces
45. Gromer S, Urig S, Becker K (2004) The thio- S-glutathionylated proteins with high affin-
redoxin system: from science to clinic. Med ity accepting electrons from either glutathi-
Res Rev 24:40–89 one or thioredoxin reductase. J Biol Chem
46. Lee SR, Kim JR, Kwon KS, Yoon HW, Levine 279:7537–7543
RL et al (1999) Molecular cloning and char- 57. Lundstrom-Ljung J, Birnbach U, Rupp K,
acterization of a mitochondrial selenocysteine- Soling HD, Holmgren A (1995) Two resi-
containing thioredoxin reductase from rat dent ER-proteins, CaBP1 and CaBP2, with
liver. J Biol Chem 274:4722–4734 thioredoxin domains, are substrates for thio-
47. Turanov AA, Su D, Gladyshev VN (2006) redoxin reductase: comparison with protein
Characterization of alternative cytosolic forms disulfide isomerase. FEBS Lett 357:305–308
and cellular targets of mouse mitochondrial 58. May JM, Mendiratta S, Hill KE, Burk RF
thioredoxin reductase. J Biol Chem 281: (1997) Reduction of dehydroascorbate to
22953–22963 ascorbate by the selenoenzyme thioredoxin
48. Sun QA, Kirnarsky L, Sherman S, Gladyshev reductase. J Biol Chem 272:22607–22610
VN (2001) Selenoprotein oxidoreductase 59. Xia L, Nordman T, Olsson JM,
with specificity for thioredoxin and glutathi- Damdimopoulos A, Bjorkhem-Bergman L
one systems. Proc Natl Acad Sci USA et al (2003) The mammalian cytosolic seleno-
98:3673–3678 enzyme thioredoxin reductase reduces ubi-
49. Zhong L, Arner ES, Ljung J, Aslund F, quinone. A novel mechanism for defense
Holmgren A (1998) Rat and calf thioredoxin against oxidative stress. J Biol Chem 278:
reductase are homologous to glutathione 2141–2146
reductase with a carboxyl-terminal elongation 60. Lu J, Berndt C, Holmgren A (2009)
containing a conserved catalytically active pen- Metabolism of selenium compounds catalyzed
ultimate selenocysteine residue. J Biol Chem by the mammalian selenoprotein thioredoxin
273:8581–8591 reductase. Biochim Biophys Acta 1790:
50. Sandalova T, Zhong L, Lindqvist Y, Holmgren 1513–1519
A, Schneider G (2001) Three-dimensional 61. Rhee SG, Chae HZ, Kim K (2005)
structure of a mammalian thioredoxin reduc- Peroxiredoxins: a historical overview and
tase: implications for mechanism and evolu- speculative preview of novel mechanisms and
tion of a selenocysteine-dependent enzyme. emerging concepts in cell signaling. Free
Proc Natl Acad Sci USA 98:9533–9538 Radic Biol Med 38:1543–1552
51. Zhong L, Arner ES, Holmgren A (2000) 62. Oien DB, Moskovitz J (2008) Substrates of
Structure and mechanism of mammalian thiore- the methionine sulfoxide reductase system
Flavins and Flavoproteins: Applications in Medicine 145
and their physiological relevance. Curr Top expression in human tumors and cell lines,
Dev Biol 80:93–133 and the effects of serum stimulation and
63. Klaunig JE, Kamendulis LM, Hocevar BA hypoxia. Anticancer Res 16:3459–3466
(2010) Oxidative stress and oxidative dam- 76. Shao L, Diccianni MB, Tanaka T, Gribi R, Yu
age in carcinogenesis. Toxicol Pathol 38: AL et al (2001) Thioredoxin expression in
96–109 primary T-cell acute lymphoblastic leukemia
64. Ganther HE (1999) Selenium metabolism, and its therapeutic implication. Cancer Res
selenoproteins and mechanisms of cancer pre- 61:7333–7338
vention: complexities with thioredoxin reduc- 77. Lincoln DT, Al-Yatama F, Mohammed FM,
tase. Carcinogenesis 20:1657–1666 Al-Banaw AG, Al-Bader M et al (2010)
65. Gallegos A, Berggren M, Gasdaska JR, Powis Thioredoxin and thioredoxin reductase expres-
G (1997) Mechanisms of the regulation of sion in thyroid cancer depends on tumour
thioredoxin reductase activity in cancer cells aggressiveness. Anticancer Res 30:767–775
by the chemopreventive agent selenium. 78. Cadenas C, Franckenstein D, Schmidt M,
Cancer Res 57:4965–4970 Gehrmann M, Hermes M et al (2010) Role of
66. Trachootham D, Zhou Y, Zhang H, Demizu Y, thioredoxin reductase 1 and thioredoxin
Chen Z et al (2006) Selective killing of onco- interacting protein in prognosis of breast can-
genically transformed cells through a ROS- cer. Breast Cancer Res 12 Article-No. R44
mediated mechanism by beta-phenylethyl 79. Smart DK, Ortiz KL, Mattson D, Bradbury
isothiocyanate. Cancer Cell 10:241–252 CM, Bisht KS et al (2004) Thioredoxin
67. Tonissen KF, Di Trapani G (2009) reductase as a potential molecular target for
Thioredoxin system inhibitors as mediators of anticancer agents that induce oxidative stress.
apoptosis for cancer therapy. Mol Nutr Food Cancer Res 64:6716–6724
Res 53:87–103 80. Yoo MH, Xu XM, Carlson BA, Gladyshev
68. Arner ES, Holmgren A (2006) The thiore- VN, Hatfield DL (2006) Thioredoxin reduc-
doxin system in cancer. Semin Cancer Biol tase 1 deficiency reverses tumor phenotype
16:420–426 and tumorigenicity of lung carcinoma cells. J
69. Nordlund P, Reichard P (2006) Ribonucleotide Biol Chem 281:13005–13008
reductases. Annu Rev Biochem 75:681–706 81. Yoo MH, Xu XM, Carlson BA, Patterson AD,
70. Lincoln DT, Ali Emadi EM, Tonissen KF, Gladyshev VN et al (2007) Targeting thiore-
Clarke FM (2003) The thioredoxin-thioredoxin doxin reductase 1 reduction in cancer cells
reductase system: over-expression in human inhibits self-sufficient growth and DNA repli-
cancer. Anticancer Res 23:2425–2433 cation. PLoS One 2:e1112
71. Singh SS, Li Y, Ford OH, Wrzosek CS, 82. Lu J, Chew EH, Holmgren A (2007)
Mehedint DC et al (2008) Thioredoxin Targeting thioredoxin reductase is a basis for
reductase 1 expression and castration- cancer therapy by arsenic trioxide. Proc Natl
recurrent growth of prostate cancer. Transl Acad Sci USA 104:12288–12293
Oncol 1:153–157 83. Gromer S, Arscott LD, Williams CH Jr,
72. Eriksson SE, Prast-Nielsen S, Flaberg E, Schirmer RH, Becker K (1998) Human pla-
Szekely L, Arner ES (2009) High levels of centa thioredoxin reductase. Isolation of the
thioredoxin reductase 1 modulate drug- selenoenzyme, steady state kinetics, and inhi-
specific cytotoxic efficacy. Free Radic Biol bition by therapeutic gold compounds. J Biol
Med 47:1661–1671 Chem 273:20096–20101
73. Iwasawa S, Yamano Y, Takiguchi Y, Tanzawa 84. Pennington JD, Jacobs KM, Sun L, Bar-Sela
H, Tatsumi K et al (2011) Upregulation of G, Mishra M et al (2007) Thioredoxin and
thioredoxin reductase 1 in human oral squa- thioredoxin reductase as redox-sensitive
mous cell carcinoma. Oncol Rep 25:637–644 molecular targets for cancer therapy. Curr
74. Soini Y, Kahlos K, Napankangas U, Pharm Des 13:3368–3377
Kaarteenaho-Wiik R, Saily M et al (2001) 85. Urig S, Becker K (2006) On the potential of
Widespread expression of thioredoxin and thioredoxin reductase inhibitors for cancer
thioredoxin reductase in non-small cell lung therapy. Semin Cancer Biol 16:452–465
carcinoma. Clin Cancer Res 7:1750–1757 86. Nguyen P, Awwad RT, Smart DD, Spitz DR,
75. Berggren M, Gallegos A, Gasdaska JR, Gius D (2006) Thioredoxin reductase as a
Gasdaska PY, Warneke J et al (1996) novel molecular target for cancer therapy.
Thioredoxin and thioredoxin reductase gene Cancer Lett 236:164–174
146 Esther Jortzik et al.
87. Anestal K, Prast-Nielsen S, Cenas N, Arner Gold complexes inhibit mitochondrial thio-
ES (2008) Cell death by SecTRAPs: thiore- redoxin reductase: consequences on mito-
doxin reductase as a prooxidant killer of cells. chondrial functions. J Inorg Biochem 98:
PLoS One 3 Article-No. e1846 1634–1641
88. Cheng Q, Antholine WE, Myers JM, 99. Rackham O, Shearwood AM, Thyer R,
Kalyanaraman B, Arner ES et al (2010) The McNamara E, Davies SM et al (2011)
selenium-independent inherent pro-oxidant Substrate and inhibitor specificities differ
NADPH oxidase activity of mammalian thio- between human cytosolic and mitochondrial
redoxin reductase and its selenium-dependent thioredoxin reductases: implications for
direct peroxidase activities. J Biol Chem development of specific inhibitors. Free Radic
285:21708–21723 Biol Med 50:689–699
89. Liu Z, Huang SL, Li MM, Huang ZS, Lee KS 100. Cox AG, Brown KK, Arner ES, Hampton
et al (2009) Inhibition of thioredoxin reduc- MB (2008) The thioredoxin reductase inhibi-
tase by mansonone F analogues: Implications tor auranofin triggers apoptosis through a
for anticancer activity. Chem Biol Interact Bax/Bak-dependent process that involves
177:48–57 peroxiredoxin 3 oxidation. Biochem
90. Javvadi P, Hertan L, Kosoff R, Datta T, Kolev Pharmacol 76:1097–1109
J et al (2010) Thioredoxin reductase-1 medi- 101. Marzano C, Gandin V, Folda A, Scutari G,
ates curcumin-induced radiosensitization of Bindoli A et al (2007) Inhibition of thiore-
squamous carcinoma cells. Cancer Res doxin reductase by auranofin induces apopto-
70:1941–1950 sis in cisplatin-resistant human ovarian cancer
91. Fang J, Lu J, Holmgren A (2005) Thioredoxin cells. Free Radic Biol Med 42:872–881
reductase is irreversibly modified by curcumin: 102. Liu JJ, Liu Q, Wei HL, Yi J, Zhao HS et al
a novel molecular mechanism for its anticancer (2011) Inhibition of thioredoxin reductase by
activity. J Biol Chem 280:25284–25290 auranofin induces apoptosis in adriamycin-
92. Wang L, Yang Z, Fu J, Yin H, Xiong K, Tan Q, resistant human K562 chronic myeloid leuke-
Jin H, Li J, Wang T, Tang W, Yin J, Cai G, mia cells. Pharmazie 66:440–444
Liu M, Kehr S, Becker K, Zeng H (2011) 103. Hashemy SI, Ungerstedt JS, Zahedi Avval F,
Ethaselen: a potent mammalian thioredoxin Holmgren A (2006) Motexafin gadolinium, a
reductase 1 inhibitor and novel organoselenium tumor-selective drug targeting thioredoxin
anticancer agent. Free Radic Biol Med 52: reductase and ribonucleotide reductase. J Biol
898–908 Chem 281:10691–10697
93. Watson WH, Heilman JM, Hughes LL, 104. Francis D, Richards GM, Forouzannia A,
Spielberger JC (2008) Thioredoxin reduc- Mehta MP, Khuntia D (2009) Motexafin
tase-1 knock down does not result in thiore- gadolinium: a novel radiosensitizer for brain
doxin-1 oxidation. Biochem Biophys Res tumors. Expert Opin Pharmacother 10:
Commun 368:832–836 2171–2180
94. Mandal PK, Schneider M, Kolle P, 105. Zahedi Avval F, Berndt C, Pramanik A,
Kuhlencordt P, Forster H et al (2010) Loss of Holmgren A (2009) Mechanism of inhibition
thioredoxin reductase 1 renders tumors of ribonucleotide reductase with motexafin
highly susceptible to pharmacologic glutathi- gadolinium (MGd). Biochem Biophys Res
one deprivation. Cancer Res 70:9505–9514 Commun 379:775–779
95. Rollins MF, van der Heide DM, Weisend CM, 106. Dhillon N, Aggarwal BB, Newman RA, Wolff
Kundert JA, Comstock KM et al (2010) RA, Kunnumakkara AB et al (2008) Phase II
Hepatocytes lacking thioredoxin reductase 1 trial of curcumin in patients with advanced
have normal replicative potential during pancreatic cancer. Clin Cancer Res 14:
development and regeneration. J Cell Sci 4491–4499
123:2402–2412 107. Shi C, Yu L, Yang F, Yan J, Zeng H (2003) A
96. Zeng HH, Wang LH (2010) Targeting novel organoselenium compound induces cell
thioredoxin reductase: anticancer agents and cycle arrest and apoptosis in prostate cancer
chemopreventive compounds. Med Chem cell lines. Biochem Biophys Res Commun
6:286–297 309:578–583
97. Kean WF, Kean IR (2008) Clinical pharma- 108. Zhao F, Yan J, Deng S, Lan L, He F et al
cology of gold. Inflammopharmacology 16: (2006) A thioredoxin reductase inhibitor
112–125 induces growth inhibition and apoptosis in
98. Pia Rigobello M, Messori L, Marcon G, five cultured human carcinoma cell lines.
Agostina Cinellu M, Bragadin M et al (2004) Cancer Lett 236:46–53
Flavins and Flavoproteins: Applications in Medicine 147
109. Peng ZF, Lan LX, Zhao F, Li J, Tan Q, Yin 120. Hoey BM, Butler J, Swallow AJ (1988)
HW, Zeng HH (2008) A novel thioredoxin Reductive activation of mitomycin C.
reductase inhibitor inhibits cell growth and Biochemistry 27:2608–2614
induces apoptosis in HL-60 and K562 cells. 121. Siegel D, Ross D (2000) Immunodetection
J Zhejiang Univ Sci B 9:16–21 of NAD(P)H:quinone oxidoreductase 1
110. Xing F, Li S, Ge X, Wang C, Zeng H et al (NQO1) in human tissues. Free Radic Biol
(2008) The inhibitory effect of a novel Med 29:246–253
organoselenium compound BBSKE on the 122. Siegel D, Franklin WA, Ross D (1998)
tongue cancer Tca8113 in vitro and in vivo. Immunohistochemical detection of NAD(P)
Oral Oncol 44:963–969 H:quinone oxidoreductase in human lung and
111. Fu JN, Li J, Tan Q, Yin HW, Xiong K et al lung tumors. Clin Cancer Res 4:2065–2070
(2011) Thioredoxin reductase inhibitor ethase- 123. Reinicke KE, Bey EA, Bentle MS, Pink JJ,
len increases the drug sensitivity of the colon Ingalls ST, Hoppel CL, Misico RI, Arzac
cancer cell line LoVo towards cisplatin via regu- GM, Burton G, Bornmann WG, Sutton D,
lation of G1 phase and reversal of G2/M phase Gao J, Boothman DA (2005) Development
arrest. Invest New Drugs 29:627–636 of β-lapachone prodrugs for therapy against
112. Tan Q, Li J, Yin HW, Wang LH, Tang WC human cancer cells with elevated NAD(P)
et al (2010) Augmented antitumor effects of H:quinone oxidoreductase 1 levels. Clin
combination therapy of cisplatin with ethase- Cancer Res 11:3055–3064
len as a novel thioredoxin reductase inhibitor 124. Volpato M, Abou-Zeid N, Tanner RW,
on human A549 cell in vivo. Invest New Glassbrook LT, Taylor J et al (2007) Chemical
Drugs 28:205–215 synthesis and biological evaluation of a
113. Wang L, Fu JN, Wang JY, Jin CJ, Ren XY NAD(P)H:quinone oxidoreductase-1 tar-
et al (2011) Selenium-containing thioredoxin geted tripartite quinone drug delivery system.
reductase inhibitor ethaselen sensitizes non- Mol Cancer Ther 6:3122–3130
small cell lung cancer to radiotherapy. 125. Kelsey KT, Ross D, Traver RD, Christiani
Anticancer Drugs 22:732–740 DC, Zuo ZF et al (1997) Ethnic variation in
114. Li R, Bianchet MA, Talalay P, Amzel LM the prevalence of a common NAD(P)H qui-
(1995) The three-dimensional structure of none oxidoreductase polymorphism and its
NAD(P)H:quinone reductase, a flavoprotein implications for anti-cancer chemotherapy. Br
involved in cancer chemoprotection and che- J Cancer 76:852–854
motherapy: mechanism of the two-electron 126. Fagerholm R, Hofstetter B, Tommiska J,
reduction. Proc Natl Acad Sci USA 92: Aaltonen K, Vrtel R et al (2008) NAD(P)
8846–8850 H:quinone oxidoreductase 1 NQO1*2 geno-
115. Ross D (2004) Quinone reductases multi- type (P187S) is a strong prognostic and pre-
tasking in the metabolic world. Drug Metab dictive factor in breast cancer. Nat Genet 40:
Rev 36:639–654 844–853
116. Anwar A, Dehn D, Siegel D, Kepa JK, Tang LJ 127. Traver RD, Horikoshi T, Danenberg KD,
et al (2003) Interaction of human NAD(P) Stadlbauer TH, Danenberg PV et al (1992)
H:quinone oxidoreductase 1 (NQO1) with the NAD(P)H:quinone oxidoreductase gene
tumor suppressor protein p53 in cells and cell- expression in human colon carcinoma cells:
free systems. J Biol Chem 278:10368–10373 characterization of a mutation which modu-
117. Asher G, Lotem J, Cohen B, Sachs L, Shaul Y lates DT-diaphorase activity and mitomycin
(2001) Regulation of p53 stability and sensitivity. Cancer Res 52:797–802
p53-dependent apoptosis by NADH quinone 128. Fleming RA, Drees J, Loggie BW, Russell GB,
oxidoreductase 1. Proc Natl Acad Sci USA Geisinger KR et al (2002) Clinical significance
98:1188–1193 of a NAD(P)H: quinone oxidoreductase 1
118. Colucci MA, Moody CJ, Couch GD (2008) polymorphism in patients with disseminated
Natural and synthetic quinones and their peritoneal cancer receiving intraperitoneal
reduction by the quinone reductase enzyme hyperthermic chemotherapy with mitomycin
NQO1: from synthetic organic chemistry to C. Pharmacogenetics 12:31–37
compounds with anticancer potential. Org 129. Begleiter A, Hewitt D, Maksymiuk AW, Ross
Biomol Chem 6:637–656 DA, Bird RP (2006) A NAD(P)H:quinone
119. Alcain FJ, Villalba JM (2007) NQO1-directed oxidoreductase 1 polymorphism is a risk fac-
antitumour quinones. Expert Opin Ther tor for human colon cancer. Cancer Epidemiol
Patents 17:649–665 Biomarkers Prev 15:2422–2426
148 Esther Jortzik et al.
130. Chao C, Zhang ZF, Berthiller J, Boffetta P, Paramecium bursaria chlorella virus-1. J Biol
Hashibe M (2006) NAD(P)H:quinone oxi- Chem 279:54340–54347
doreductase 1 (NQO1) Pro187Ser polymor- 143. Kogler M, Vanderhoydonck B, De Jonghe S,
phism and the risk of lung, bladder, and Rozenski J, Van Belle K et al (2011) Synthesis
colorectal cancers: a meta-analysis. Cancer and evaluation of 5-substituted 2′-deoxyuri-
Epidemiol Biomarkers Prev 15:979–987 dine monophosphate analogues as inhibitors
131. Haydel SE (2010) Extensively drug-resistant of flavin-dependent thymidylate synthase in
tuberculosis: a sign of the times and an impetus Mycobacterium tuberculosis. J Med Chem 54:
for antimicrobial discovery. Pharmaceuticals 4847–4862
3:2268–2290 144. Tian J, Bryk R, Shi S, Erdjument-Bromage
132. Johnson R, Streicher EM, Louw GE, Warren H, Tempst P et al (2005) Mycobacterium
RM, van Helden PD et al (2006) Drug resis- tuberculosis appears to lack alpha-ketogluta-
tance in Mycobacterium tuberculosis. Curr rate dehydrogenase and encodes pyruvate
Issues Mol Biol 8:97–111 dehydrogenase in widely separated genes.
133. Dondorp AM, Nosten F, Yi P, Das D, Phyo AP Mol Microbiol 57:859–868
et al (2009) Artemisinin resistance in 145. Venugopal A, Bryk R, Shi S, Rhee K, Rath P
Plasmodium falciparum malaria. N Engl J Med et al (2011) Virulence of Mycobacterium
361:455–467 tuberculosis depends on lipoamide dehydroge-
134. WHO (2010) Gobal tuberculosis control nase, a member of three multienzyme com-
135. Myllykallio H, Lipowski G, Leduc D, Filee J, plexes. Cell Host Microbe 9:21–31
Forterre P et al (2002) An alternative flavin- 146. Bryk R, Arango N, Venugopal A, Warren JD,
dependent mechanism for thymidylate syn- Park YH et al (2010) Triazaspirodimeth-
thesis. Science 297:105–107 oxybenzoyls as selective inhibitors of mycobac-
136. Koehn EM, Fleischmann T, Conrad JA, terial lipoamide dehydrogenase. Biochemistry
Palfey BA, Lesley SA et al (2009) An unusual 49:1616–1627
mechanism of thymidylate biosynthesis in 147. WHO (2010) World Malaria Report 2010
organisms containing the thyX gene. Nature 148. Becker K, Tilley L, Vennerstrom JL, Roberts
458:919–923 D, Rogerson S et al (2004) Oxidative stress in
137. Myllykallio H, Leduc D, Filee J, Liebl U malaria parasite-infected erythrocytes: host-
(2003) Life without dihydrofolate reductase parasite interactions. Int J Parasitol 34:
FolA. Trends Microbiol 11:220–223 163–189
138. Chernyshev A, Fleischmann T, Kohen A 149. Krauth-Siegel RL, Bauer H, Schirmer RH
(2007) Thymidyl biosynthesis enzymes as (2005) Dithiol proteins as guardians of the
antibiotic targets. Appl Microbiol Biotechnol intracellular redox milieu in parasites: old and
74:282–289 new drug targets in trypanosomes and
139. Ulmer JE, Boum Y, Thouvenel CD, malaria-causing plasmodia. Angew Chem Int
Myllykallio H, Sibley CH (2008) Functional Ed 44:690–715
analysis of the Mycobacterium tuberculosis 150. Böhme CC, Arscott LD, Becker K, Schirmer
FAD-dependent thymidylate synthase, ThyX, RH, Williams CH Jr (2000) Kinetic charac-
reveals new amino acid residues contributing terization of glutathione reductase from the
to an extended ThyX motif. J Bacteriol 190: malarial parasite Plasmodium falciparum.
2056–2064 Comparison with the human enzyme. J Biol
140. Sampathkumar P, Turley S, Ulmer JE, Rhie Chem 275:37317–37323
HG, Sibley CH et al (2005) Structure of the 151. Buchholz K, Putrianti ED, Rahlfs S, Schirmer
Mycobacterium tuberculosis flavin dependent RH, Becker K, Matuschewski K (2010)
thymidylate synthase (MtbThyX) at 2.0 Å Molecular genetics evidence for the in vivo
resolution. J Mol Biol 352:1091–1104 roles of the two major NADPH-dependent
141. Fivian-Hughes A, Houghton J, Davis E disulfide reductases in the malaria parasite.
(2011) Mycobacterium tuberculosis thymi- J Biol Chem 285:37388–37395
dylate synthase gene thyX is essential and 152. Pastrana-Mena R, Dinglasan RR, Franke-
potentially bifunctional, while thyA deletion Fayard B, Vega-Rodriguez J, Fuentes-
confers resistance to para-aminosalicylic acid. Caraballo M, Baerga-Ortiz A, Coppens I,
Microbiology 158:308–318 Jacobs-Lorena M, Janse CJ, Serrano AE
142. Graziani S, Xia Y, Gurnon JR, Van Etten JL, (2010) Glutathione reductase-null malaria
Leduc D, Skouloubris S, Myllykallio H, Liebl parasites have normal blood stage growth but
U (2004) Functional analysis of FAD- arrest during development in the mosquito.
dependent thymidylate synthase ThyX from J Biol Chem 285:27045–27056
Flavins and Flavoproteins: Applications in Medicine 149
153. Gilberger TW, Schirmer RH, Walter RD, 163. Becker K, Christopherson RI, Cowden WB,
Müller S (2000) Deletion of the parasite- Hunt NH, Schirmer RH (1990) Flavin ana-
specific insertions and mutation of the cata- logs with antimalarial activity as glutathione
lytic triad in glutathione reductase from reductase inhibitors. Biochem Pharmacol 39:
chloroquine-sensitive Plasmodium falciparum 59–65
3D7. Mol Biochem Parasitol 107:169–179 164. Schonleben-Janas A, Kirsch P, Mittl PR,
154. Sarma GN, Savvides SN, Becker K, Schirmer Schirmer RH, Krauth-Siegel RL (1996)
M, Schirmer RH, Karplus PA (2003) Inhibition of human glutathione reductase by
Glutathione reductase of the malarial parasite 10-arylisoalloxazines: crystalline, kinetic, and
Plasmodium falciparum: crystal structure electrochemical studies. J Med Chem 39:
and inhibitor development. J Mol Biol 328: 1549–1554
893–907 165. Biot C, Bauer H, Schirmer RH, Davioud-
155. Kanzok SM, Schirmer RH, Turbachova I, Charvet E (2004) 5-substituted tetrazoles as
Iozef R, Becker K (2000) The thioredoxin bioisosteres of carboxylic acids. Bioisosterism
system of the malaria parasite Plasmodium fal- and mechanistic studies on glutathione reduc-
ciparum. Glutathione reduction revisited. tase inhibitors as antimalarials. J Med Chem
J Biol Chem 275:40180–40186 47:5972–5983
156. Buchholz K, Schirmer RH, Eubel JK, 166. Müller T, Johann L, Jannack B, Brückner M,
Akoachere MB, Dandekar T et al (2008) Lanfranchi DA, Bauer H, Sanchez C, Yardley
Interactions of methylene blue with human V, Deregnaucourt C, Schrével J, Lanzer M,
disulfide reductases and their orthologues Schirmer RH, Davioud-Charvet E (2011)
from Plasmodium falciparum. Antimicrob Glutathione reductase-catalyzed cascade of
Agents Chemother 52:183–191 redox reactions to bioactivate potent antima-
157. Kasozi DM, Gromer S, Adler H, Zocher K, larial 1,4-naphthoquinones. A new strategy to
Rahlfs S et al (2011) The bacterial redox sig- combat malarial parasites. J Am Chem Soc
naller pyocyanin as an antiplasmodial agent: 133:11557–11571
comparisons with its thioanalog methylene 167. Morin C, Besset T, Moutet JC, Fayolle M,
blue. Redox Rep 16:154–165 Bruckner M et al (2008) The aza-analogues
158. Akoachere M, Buchholz K, Fischer E, of 1,4-naphthoquinones are potent substrates
Burhenne J, Haefeli WE et al (2005) In vitro and inhibitors of plasmodial thioredoxin and
assessment of methylene blue on chloroquine- glutathione reductases and of human erythro-
sensitive and -resistant Plasmodium falci- cyte glutathione reductase. Org Biomol
parum strains reveals synergistic action with Chem 6:2731–2742
artemisinins. Antimicrob Agents Chemother 168. Chandra R, Tripathi LM, Saxena JK, Puri SK
49:4592–4597 (2011) Implication of intracellular glutathi-
159. Meissner PE, Mandi G, Coulibaly B, Witte S, one and its related enzymes on resistance of
Tapsoba T et al (2006) Methylene blue for malaria parasites to the antimalarial drug
malaria in Africa: results from a dose-finding arteether. Parasitol Int 60:97–100
study in combination with chloroquine. 169. Davioud-Charvet E, Delarue S, Biot C,
Malar J 5:84 Schwobel B, Boehme CC et al (2001) A pro-
160. Becker K, Schirmer RH (1995) 1,3-Bis drug form of a Plasmodium falciparum glu-
(2-chloroethyl)-1-nitrosourea as thiol- tathione reductase inhibitor conjugated with
carbamoylating agent in biological systems. a 4-anilinoquinoline. J Med Chem 44:
Methods Enzymol 251:173–188 4268–4276
161. Karplus PA, Krauth-Siegel RL, Schirmer 170. Chavain N, Davioud-Charvet E, Trivelli X,
RH, Schulz GE (1988) Inhibition of human Mbeki L, Rottmann M et al (2009) Anti-
glutathione reductase by the nitrosourea malarial activities of ferroquine conjugates
drugs 1,3-bis(2-chloroethyl)-1-nitrosourea and with either glutathione reductase inhibitors or
1-(2-chloroethyl)-3-(2-hydroxyethyl)-1- glutathione depletors via a hydrolyzable amide
nitrosourea. A crystallographic analysis. Eur linker. Bioorg Med Chem 17:8048–8059
J Biochem 171:193–198 171. Ginsburg H, Famin O, Zhang J, Krugliak M
162. Savvides SN, Scheiwein M, Bohme CC, Arteel (1998) Inhibition of glutathione-dependent
GE, Karplus PA et al (2002) Crystal structure degradation of heme by chloroquine and
of the antioxidant enzyme glutathione reduc- amodiaquine as a possible basis for their anti-
tase inactivated by peroxynitrite. J Biol Chem malarial mode of action. Biochem Pharmacol
277:2779–2784 56:1305–1313
150 Esther Jortzik et al.
172. Gallo V, Schwarzer E, Rahlfs S, Schirmer RH, terization of small molecule inhibitors of
van Zwieten R, et al (2009) Inherited gluta- Plasmodium falciparum dihydroorotate dehy-
thione reductase deficiency and Plasmodium drogenase. J Biol Chem 283:35078–35085
falciparum malaria. A case study. PLoS One 4 184. Booker ML, Bastos CM, Kramer ML, Barker
Article-No. e7303 RH Jr, Skerlj R et al (2010) Novel inhibitors
173. Nickel C, Rahlfs S, Deponte M, Koncarevic S, of Plasmodium falciparum dihydroorotate
Becker K (2006) Thioredoxin networks in the dehydrogenase with anti-malarial activity in
malarial parasite Plasmodium falciparum. the mouse model. J Biol Chem 285:
Antioxid Redox Signal 8:1227–1239 33054–33064
174. Müller S (2004) Redox and antioxidant sys- 185. Phillips MA, Gujjar R, Malmquist NA,
tems of the malaria parasite Plasmodium falci- White J, El Mazouni F et al (2008)
parum. Mol Microbiol 53:1291–1305 Triazolopyrimidine-based dihydroorotate
175. Krnajski Z, Gilberger TW, Walter RD, dehydrogenase inhibitors with potent and
Cowman AF, Müller S (2002) Thioredoxin selective activity against the malaria parasite
reductase is essential for the survival of Plasmodium falciparum. J Med Chem 51:
Plasmodium falciparum erythrocytic stages. 3649–3653
J Biol Chem 277:25970–25975 186. Deng X, Gujjar R, El Mazouni F, Kaminsky W,
176. Davioud-Charvet E, McLeish MJ, Veine DM, Malmquist NA et al (2009) Structural plastic-
Giegel D, Arscott LD et al (2003) Mechanism- ity of malaria dihydroorotate dehydrogenase
based inactivation of thioredoxin reductase allows selective binding of diverse chemical
from Plasmodium falciparum by Mannich scaffolds. J Biol Chem 284:26999–27009
bases. Implication for cytotoxicity. 187. Gujjar R, Marwaha A, El Mazouni F, White J,
Biochemistry 42:13319–13330 White KL et al (2009) Identification of a met-
177. Andricopulo AD, Akoachere MB, Krogh abolically stable triazolopyrimidine-based
R, Nickel C, McLeish MJ et al (2006) dihydroorotate dehydrogenase inhibitor with
Specific inhibitors of Plasmodium falci- antimalarial activity in mice. J Med Chem
parum thioredoxin reductase as potential 52:1864–1872
antimalarial agents. Bioorg Med Chem 188. Coteron JM, Marco M, Esquivias J, Deng X,
Lett 16:2283–2292 White KL et al (2011) Structure-guided
178. Sturm N, Hu Y, Zimmermann H, Fritz-Wolf lead optimization of triazolopyrimidine-ring
K, Wittlin S et al (2009) Compounds struc- substituents identifies potent Plasmodium
turally related to ellagic acid show improved falciparum dihydroorotate dehydrogenase
antiplasmodial activity. Antimicrob Agents inhibitors with clinical candidate potential. J
Chemother 53:622–630 Med Chem 54:5540–5561
179. Sannella AR, Casini A, Gabbiani C, Messori 189. Malvy D, Chappuis F (2011) Sleeping sick-
L, Bilia AR et al (2008) New uses for old ness. Clin Microbiol Infect 17:986–995
drugs. Auranofin, a clinically established anti- 190. Burri C (2010) Chemotherapy against human
arthritic metallodrug, exhibits potent antima- African trypanosomiasis: is there a road to
larial effects in vitro: Mechanistic and success? Parasitology 137:1987–1994
pharmacological implications. FEBS Lett 191. Astelbauer F, Walochnik J (2011)
582:844–847 Antiprotozoal compounds: state of the art
180. Reyes P, Rathod PK, Sanchez DJ, Mrema JE, and new developments. Int J Antimicrob
Rieckmann KH et al (1982) Enzymes of Agents 38:118–124
purine and pyrimidine metabolism from the 192. Müller S, Liebau E, Walter RD, Krauth-Siegel
human malaria parasite, Plasmodium falci- RL (2003) Thiol-based redox metabolism of
parum. Mol Biochem Parasitol 5:275–290 protozoan parasites. Trends Parasitol 19:
181. Subbayya IN, Ray SS, Balaram P, Balaram H 320–328
(1997) Metabolic enzymes as potential drug 193. Krauth-Siegel RL, Comini MA (2008) Redox
targets in Plasmodium falciparum. Indian J control in trypanosomatids, parasitic protozoa
Med Res 106:79–94 with trypanothione-based thiol metabolism.
182. Baldwin J, Michnoff CH, Malmquist NA, Biochim Biophys Acta 1780:1236–1248
White J, Roth MG et al (2005) High- 194. Frearson JA, Wyatt PG, Gilbert IH, Fairlamb
throughput screening for potent and selec- AH (2007) Target assessment for antiparasitic
tive inhibitors of Plasmodium falciparum drug discovery. Trends Parasitol 23:589–595
dihydroorotate dehydrogenase. J Biol Chem 195. Olin-Sandoval V, Moreno-Sanchez R,
280:21847–21853 Saavedra E (2010) Targeting trypanothione
183. Patel V, Booker M, Kramer M, Ross L, Celatka metabolism in trypanosomatid human parasites.
CA et al (2008) Identification and charac- Curr Drug Targets 11:1614–1630
Flavins and Flavoproteins: Applications in Medicine 151
196. Krauth-Siegel RL, Inhoff O (2003) Parasite- 208. Bonse S, Richards JM, Ross SA, Lowe G,
specific trypanothione reductase as a drug tar- Krauth-Siegel RL (2000) (2,2′:6′,2″-
get molecule. Parasitol Res 90:S77–S85 Terpyridine)platinum(II) complexes are irre-
197. Eberle C, Lauber BS, Fankhauser D, Kaiser versible inhibitors of Trypanosoma cruzi try-
M, Brun R et al (2011) Improved inhibitors panothione reductase but not of human
of trypanothione reductase by combination of glutathione reductase. J Med Chem 43:
motifs: synthesis, inhibitory potency, binding 4812–4821
mode, and antiprotozoal activities. 209. Salmon-Chemin L, Buisine E, Yardley V,
ChemMedChem 6:292–301 Kohler S, Debreu M-A, Landry V, Sergheraert
198. Hunter WN (2007) Picking pockets to fuel C, Croft SL, Krauth-Siegel RL, Davioud-
antimicrobial drug discovery. Biochem Soc Charvet E (2001) 2- and 3-substituted
Trans 35:980–984 1,4-naphthoquinone derivatives as subversive
199. Chibale K, Haupt H, Kendrick H, Yardley V, substrates of trypanothione reductase and
Saravanamuthu A et al (2001) Antiprotozoal lipoamide dehydrogenase from Trypanosoma
and cytotoxicity evaluation of sulfonamide cruzi: synthesis and correlation between
and urea analogues of quinacrine. Bioorg redox cycling activities and in vitro cytotoxic-
Med Chem Lett 11:2655–2657 ity. J Med Chem 44:548–565
200. Hammond DJ, Croft SL, Hogg J, Gutteridge 210. Holloway GA, Charman WN, Fairlamb AH,
WE (1986) A strategy for the prevention of Brun R, Kaiser M et al (2009) Trypanothione
the transmission of Chagas’ disease during reductase high-throughput screening cam-
blood transfusion. Acta Trop 43:367–378 paign identifies novel classes of inhibitors with
antiparasitic activity. Antimicrob Agents
201. Benson TJ, McKie JH, Garforth J, Borges A,
Chemother 53:2824–2833
Fairlamb AH et al (1992) Rationally designed
selective inhibitors of trypanothione reduc- 211. Chan C, Yin H, Garforth J, McKie JH,
tase. Phenothiazines and related tricyclics as Jaouhari R et al (1998) Phenothiazine inhibi-
lead structures. Biochem J 286:9–11 tors of trypanothione reductase as potential
antitrypanosomal and antileishmanial drugs. J
202. Khan MO (2007) Trypanothione reductase: a
Med Chem 41:148–156
viable chemotherapeutic target for antitry-
panosomal and antileishmanial drug design. 212. Bonnet B, Soullez D, Davioud-Charvet E,
Drug Target Insights 2:129–146 Landry V, Horvath D et al (1997) New sperm-
203. Li Z, Fennie MW, Ganem B, Hancock MT, ine and spermidine derivatives as potent inhibi-
Kobaslija M et al (2001) Polyamines with tors of Trypanosoma cruzi trypanothione
N-(3-phenylpropyl) substituents are effective reductase. Bioorg Med Chem 5:1249–1256
competitive inhibitors of trypanothione 213. Khan MO, Austin SE, Chan C, Yin H, Marks
reductase and trypanocidal agents. Bioorg D et al (2000) Use of an additional hydro-
Med Chem Lett 11:251–254 phobic binding site, the Z site, in the rational
204. Ponasik JA, Strickland C, Faerman C, Savvides drug design of a new class of stronger try-
S, Karplus PA et al (1995) Kukoamine A and panothione reductase inhibitor, quaternary
other hydrophobic acylpolyamines: potent and alkylammonium phenothiazines. J Med Chem
selective inhibitors of Crithidia fasciculata try- 43:3148–3156
panothione reductase. Biochem J 311:371–375 214. Lee B, Bauer H, Melchers J, Ruppert T,
205. Bond CS, Zhang Y, Berriman M, Cunningham Rattray L et al (2005) Irreversible inactivation
ML, Fairlamb AH et al (1999) Crystal struc- of trypanothione reductase by unsaturated
ture of Trypanosoma cruzi trypanothione Mannich bases: a divinyl ketone as key inter-
reductase in complex with trypanothione, and mediate. J Med Chem 48:7400–7410
the structure-based discovery of new natural 215. Schmidt A, Krauth-Siegel RL (2002)
product inhibitors. Structure 7:81–89 Enzymes of the trypanothione metabolism as
206. Cota BB, Rosa LH, Fagundes EM, Martins- targets for antitrypanosomal drug develop-
Filho OA, Correa-Oliveira R et al (2008) A ment. Curr Top Med Chem 2:1239–1259
potent trypanocidal component from the fun- 216. Soeiro MN, de Castro SL (2009) Trypanosoma
gus Lentinus strigosus inhibits trypanothione cruzi targets for new chemotherapeutic
reductase and modulates PBMC prolifera- approaches. Expert Opin Ther Targets
tion. Mem Inst Oswaldo Cruz 103:263–270 13:105–121
207. Schirmer RH, Müller JG, Krauth-Siegel RL 217. Roldan A, Comini MA, Crispo M, Krauth-
(1995) Disulfide-reductase inhibitors as che- Siegel RL (2011) Lipoamide dehydrogenase
motherapeutic agents: the design of drugs for is essential for both bloodstream and procy-
trypanosomiasis and malaria. Angew Chem clic Trypanosoma brucei. Mol Microbiol
Int Ed 34:141–154 81:623–639
152 Esther Jortzik et al.
218. Sreider CM, Grinblat L, Stoppani AO (1992) inhibitors. Adv Biochem Psychopharmacol
Reduction of nitrofuran compounds by heart 5:393–408
lipoamide dehydrogenase: role of flavin and 231. Bach AW, Lan NC, Johnson DL, Abell
the reactive disulfide groups. Biochem Int CW, Bembenek ME et al (1988) cDNA
28:323–334 cloning of human liver monoamine oxidase
219. Blumenstiel K, Schoneck R, Yardley V, Croft A and B: molecular basis of differences in
SL, Krauth-Siegel RL (1999) Nitrofuran enzymatic properties. Proc Natl Acad Sci
drugs as common subversive substrates of USA 85:4934–4938
Trypanosoma cruzi lipoamide dehydroge- 232. Lan NC, Heinzmann C, Gal A, Klisak I, Orth
nase and trypanothione reductase. Biochem U et al (1989) Human monoamine oxidase A
Pharmacol 58:1791–1799 and B genes map to Xp 11.23 and are deleted
220. Petrat F, Paluch S, Dogruoz E, Dorfler P, in a patient with Norrie disease. Genomics
Kirsch M et al (2003) Reduction of Fe(III) 4:552–559
ions complexed to physiological ligands by 233. Wong WK, Ou XM, Chen K, Shih JC (2002)
lipoyl dehydrogenase and other flavoenzymes Activation of human monoamine oxidase B
in vitro: implications for an enzymatic reduc- gene expression by a protein kinase C MAPK
tion of Fe(III) ions of the labile iron pool. signal transduction pathway involves c-Jun
J Biol Chem 278:46403–46413 and Egr-1. J Biol Chem 277:22222–22230
221. Ramos EI, Garza KM, Krauth-Siegel RL, 234. Wong WK, Chen K, Shih JC (2003)
Bader J, Martinez LE et al (2009) 2,3-diphenyl- Decreased methylation and transcription
1,4-naphthoquinone: a potential chemo- repressor Sp3 up-regulated human mono-
therapeutic agent against Trypanosoma cruzi. amine oxidase (MAO) B expression during
J Parasitol 95:461–466 Caco-2 differentiation. J Biol Chem 278:
222. Lohrer H, Krauth-Siegel RL (1990) 36227–36235
Purification and characterization of lipoamide 235. Ou XM, Chen K, Shih JC (2004) Dual func-
dehydrogenase from Trypanosoma cruzi. Eur tions of transcription factors, transforming
J Biochem 194:863–869 growth factor-beta-inducible early gene
223. Gutierrez-Correa J, Krauth-Siegel RL, (TIEG)2 and Sp3, are mediated by CACCC
Stoppani AO (2003) Phenothiazine radicals element and Sp1 sites of human monoamine
inactivate Trypanosoma cruzi dihydroli- oxidase (MAO) B gene. J Biol Chem 279:
poamide dehydrogenase: enzyme protection 21021–21028
by radical scavengers. Free Radic Res 37: 236. Ou XM, Chen K, Shih JC (2006)
281–291 Glucocorticoid and androgen activation of
224. Gutierrez-Correa J (2006) Trypanosoma cruzi monoamine oxidase A is regulated differ-
dihydrolipoamide dehydrogenase as target for ently by R1 and Sp1. J Biol Chem 281:
phenothiazine cationic radicals. Effect of anti- 21512–21525
oxidants. Curr Drug Targets 7:1155–1179 237. Ou XM, Chen K, Shih JC (2006) Monoamine
225. Logan FJ, Taylor MC, Wilkinson SR, Kaur H, oxidase A and repressor R1 are involved in
Kelly JM (2007) The terminal step in vitamin apoptotic signaling pathway. Proc Natl Acad
C biosynthesis in Trypanosoma cruzi is medi- Sci USA 103:10923–10928
ated by a FMN-dependent galactonolactone 238. Westlund KN, Denney RM, Rose RM, Abell
oxidase. Biochem J 407:419–426 CW (1988) Localization of distinct mono-
226. Kulkarni SK, Dhir A (2009) Current investi- amine oxidase A and monoamine oxidase B
gational drugs for major depression. Expert cell populations in human brainstem.
Opin Investig Drugs 18:767–788 Neuroscience 25:439–456
227. West ED, Dally PJ (1959) Effects of ipronia- 239. Saura J, Luque JM, Cesura AM, Da Prada M,
zid in depressive syndromes. Br Med J Chan-Palay V et al (1994) Increased mono-
1:1491–1494 amine oxidase B activity in plaque-associated
228. Crane GE (1957) Iproniazid (marsilid) phos- astrocytes of Alzheimer brains revealed by
phate, a therapeutic agent for mental disor- quantitative enzyme radioautography.
ders and debilitating diseases. Psychiatr Res Neuroscience 62:15–30
Rep Am Psychiatr Assoc 8:142–152 240. Jahng JW, Houpt TA, Joh TH, Son JH (1998)
229. Johnston JP (1968) Some observations upon Differential expression of monoamine oxidase
a new inhibitor of monoamine oxidase in brain A, serotonin transporter, tyrosine hydroxylase
tissue. Biochem Pharmacol 17:1285–1297 and norepinephrine transporter mRNA by
230. Knoll J, Magyar K (1972) Some puzzling anorexia mutation and food deprivation. Brain
pharmacological effects of monoamine oxidase Res Dev Brain Res 107:241–246
Flavins and Flavoproteins: Applications in Medicine 153
241. Westlund KN, Denney RM, Kochersperger nistic properties of the membrane-bound
LM, Rose RM, Abell CW (1985) Distinct mitochondrial monoamine oxidases.
monoamine oxidase A and B populations in Biochemistry 48:4220–4230
primate brain. Science 230:181–183 253. Milczek EM, Binda C, Rovida S, Mattevi A,
242. Blier P, De Montigny C, Azzaro AJ (1986) Edmondson DE (2011) The ‘gating’ residues
Modification of serotonergic and noradrener- Ile199 and Tyr326 in human monoamine
gic neurotransmissions by repeated adminis- oxidase B function in substrate and inhibitor
tration of monoamine oxidase inhibitors: recognition. FEBS J 278:4860–4869
electrophysiological studies in the rat central 254. Binda C, Wang J, Li M, Hubalek F, Mattevi A
nervous system. J Pharmacol Exp Ther 237: et al (2008) Structural and mechanistic stud-
987–994 ies of arylalkylhydrazine inhibition of human
243. Twist EC, Mitchell S, Brazell C, Stahl SM, monoamine oxidases A and B. Biochemistry
Campbell IC (1990) 5HT2 receptor changes 47:5616–5625
in rat cortex and platelets following chronic 255. Milczek EM, Bonivento D, Binda C, Mattevi
ritanserin and clorgyline administration. A, McDonald IA et al (2008) Structural and
Biochem Pharmacol 39:161–166 mechanistic studies of mofegiline inhibition
244. Youdim MB, Edmondson D, Tipton KF of recombinant human monoamine oxidase
(2006) The therapeutic potential of mono- B. J Med Chem 51:8019–8026
amine oxidase inhibitors. Nat Rev Neurosci 256. Binda C, Li M, Hubalek F, Restelli N,
7:295–309 Edmondson DE et al (2003) Insights into the
245. Li M, Hubalek F, Newton-Vinson P, mode of inhibition of human mitochondrial
Edmondson DE (2002) High-level expres- monoamine oxidase B from high-resolution
sion of human liver monoamine oxidase A in crystal structures. Proc Natl Acad Sci USA
Pichia pastoris: comparison with the enzyme 100:9750–9755
expressed in Saccharomyces cerevisiae. Protein 257. Upadhyay AK, Wang J, Edmondson DE
Expr Purif 24:152–162 (2008) Comparison of the structural proper-
246. Newton-Vinson P, Hubalek F, Edmondson ties of the active site cavities of human and rat
DE (2000) High-level expression of human monoamine oxidase A and B in their soluble
liver monoamine oxidase B in Pichia pastoris. and membrane-bound forms. Biochemistry
Protein Expr Purif 20:334–345 47:526–536
247. Binda C, Newton-Vinson P, Hubalek F, 258. Cases O, Seif I, Grimsby J, Gaspar P, Chen K
Edmondson DE, Mattevi A (2002) Structure et al (1995) Aggressive behavior and altered
of human monoamine oxidase B, a drug tar- amounts of brain serotonin and norepineph-
get for the treatment of neurological disor- rine in mice lacking MAOA. Science 268:
ders. Nat Struct Biol 9:22–26 1763–1766
248. De Colibus L, Li M, Binda C, Lustig A, 259. Grimsby J, Toth M, Chen K, Kumazawa T,
Edmondson DE et al (2005) Three- Klaidman L et al (1997) Increased stress
dimensional structure of human monoamine response and beta-phenylethylamine in MAOB-
oxidase A (MAO A): relation to the structures deficient mice. Nat Genet 17:206–210
of rat MAO A and human MAO B. Proc Natl 260. Meyer JH, Ginovart N, Boovariwala A,
Acad Sci USA 102:12684–12689 Sagrati S, Hussey D et al (2006) Elevated
249. Son SY, Ma J, Kondou Y, Yoshimura M, monoamine oxidase a levels in the brain: an
Yamashita E et al (2008) Structure of human explanation for the monoamine imbalance of
monoamine oxidase A at 2.2-Å resolution: major depression. Arch Gen Psychiatry 63:
the control of opening the entry for sub- 1209–1216
strates/inhibitors. Proc Natl Acad Sci USA 261. Zeller EA, Barsky J (1952) In vivo inhibition
105:5739–5744 of liver and brain monoamine oxidase by
250. Chen K, Wu HF, Shih JC (1996) Influence of 1-isonicotinyl-2-isopropyl hydrazine. Proc
C terminus on monoamine oxidase A and B Soc Exp Biol Med 81:459–461
catalytic activity. J Neurochem 66:797–803 262. Youdim MB, Weinstock M (2004)
251. Hubalek F, Binda C, Khalil A, Li M, Mattevi Therapeutic applications of selective and non-
A et al (2005) Demonstration of isoleucine selective inhibitors of monoamine oxidase A
199 as a structural determinant for the selec- and B that do not cause significant tyramine
tive inhibition of human monoamine oxidase potentiation. Neurotoxicology 25:243–250
B by specific reversible inhibitors. J Biol 263. Da Prada M, Kettler R, Keller HH, Cesura
Chem 280:15761–15766 AM, Richards JG et al (1990) From
252. Edmondson DE, Binda C, Wang J, Upadhyay moclobemide to Ro 19-6327 and Ro
AK, Mattevi A (2009) Molecular and mecha- 41-1049: the development of a new class of
154 Esther Jortzik et al.
reversible, selective MAO-A and MAO-B 276. Parkinson study group (1996) Effect of laz-
inhibitors. J Neural Transm Suppl 29: abemide on the progression of disability in
279–292 early Parkinson’s disease. The Parkinson
264. Amsterdam JD, Shults J (2005) MAOI effi- Study Group. Ann Neurol 40:99–107
cacy and safety in advanced stage treatment- 277. Sieradzan K, Channon S, Ramponi C, Stern
resistant depression. A retrospective study. J GM, Lees AJ et al (1995) The therapeutic
Affect Disord 89:183–188 potential of moclobemide, a reversible selec-
265. Vallejo J, Gasto C, Catalan R, Salamero M tive monoamine oxidase A inhibitor in
(1987) Double-blind study of imipramine Parkinson’s disease. J Clin Psychopharmacol
versus phenelzine in melancholias and dysthy- 15:51S–59S
mic disorders. Br J Psychiatry 151:639–642 278. Haefely W, Burkard WP, Cesura AM, Kettler R,
266. Nierenberg AA, Alpert JE, Pava J, Rosenbaum Lorez HP et al (1992) Biochemistry and
JF, Fava M (1998) Course and treatment of Pharmacology of Moclobemide, a Prototype
atypical depression. J Clin Psychiatry Rima. Psychopharmacology 106:S6–S14
59(Suppl 18):5–9 279. Moore DJ, West AB, Dawson VL, Dawson
267. Dauer W, Przedborski S (2003) Parkinson’s TM (2005) Molecular pathophysiology of
disease: mechanisms and models. Neuron Parkinson’s disease. Annu Rev Neurosci
39:889–909 28:57–87
268. Martin I, Dawson VL, Dawson TM (2011) 280. Bortolato M, Chen K, Shih JC (2008)
Recent advances in the genetics of Parkinson’s Monoamine oxidase inactivation: from patho-
disease. Annu Rev Genomics Hum Genet physiology to therapeutics. Adv Drug Deliv
12:301–325 Rev 60:1527–1533
269. Birkmayer W, Riederer P, Ambrozi L, Youdim 281. Inaba-Hasegawa K, Akao Y, Maruyama W,
MB (1977) Implications of combined treat- Naoi M (2012) Type A monoamine oxidase is
ment with ‘Madopar’ and L-deprenil in associated with induction of neuroprotective
Parkinson’s disease. A long-term study. Lancet Bcl-2 by rasagiline, an inhibitor of type B
1:439–443 monoamine oxidase. J Neural Transm 119:
270. Riederer P, Youdim MBH (1986) 405–414
Monoamine-oxidase activity and monoamine 282. Boyer EW, Shannon M (2005) The serotonin
metabolism in brains of Parkinsonian-patients syndrome. Reply. N Engl J Med 352:
treated with L-deprenyl. J Neurochem 2455–2456
46:1359–1365 283. Petzer JP, Castagnoli N, Schwarzschild MA,
271. Chiba K, Trevor A, Castagnoli N Jr (1984) Chen JF, van der Schyf CJ (2009) Dual-target-
Metabolism of the neurotoxic tertiary amine, directed drugs that block monoamine oxidase B
MPTP, by brain monoamine oxidase. Biochem and adenosine A(2A) receptors for Parkinson’s
Biophys Res Commun 120:574–578 disease. Neurotherapeutics 6:141–151
272. Mallajosyula JK, Kaur D, Chinta SJ, 284. Youdim MB (2006) The path from anti
Rajagopalan S, Rane A, et al (2008) MAO-B Parkinson drug selegiline and rasagiline to
elevation in mouse brain astrocytes results in multifunctional neuroprotective anti
Parkinson’s pathology. PLoS One 3 Article-No. Alzheimer drugs ladostigil and m30. Curr
e1616 Alzheimer Res 3:541–550
273. Parkinson study group (1996) Impact of 285. Mancuso C, Siciliano R, Barone E, Butterfield
deprenyl and tocopherol treatment on DA, Preziosi P (2011) Pharmacologists and
Parkinson’s disease in DATATOP patients Alzheimer disease therapy: to boldly go where
requiring levodopa. Ann Neurol 39:37–45 no scientist has gone before. Expert Opin
274. Parkinson study group (2005) A randomized Investig Drugs 20:1243–1261
placebo-controlled trial of rasagiline in 286. Jossan SS, Gillberg PG, Gottfries CG,
levodopa-treated patients with Parkinson dis- Karlsson I, Oreland L (1991) Monoamine
ease and motor fluctuations: the PRESTO oxidase B in brains from patients with
study. Arch Neurol 62:241–248 Alzheimer’s disease: a biochemical and auto-
275. Rascol O, Brooks DJ, Melamed E, Oertel W, radiographical study. Neuroscience 45:1–12
Poewe W et al (2005) Rasagiline as an adjunct 287. Birks J, Flicker L (2003) Selegiline for
to levodopa in patients with Parkinson’s dis- Alzheimer’s disease. Cochrane Database Syst
ease and motor fluctuations (LARGO, Rev CD000442
Lasting effect in Adjunct therapy with 288. Marin DB, Bierer LM, Lawlor BA, Ryan TM,
Rasagiline Given Once daily, study): a ran- Jacobson R et al (1995) L-deprenyl and phy-
domised, double-blind, parallel-group trial. sostigmine for the treatment of Alzheimer’s
Lancet 365:947–954 disease. Psychiatry Res 58:181–189
Flavins and Flavoproteins: Applications in Medicine 155
289. Saha S, Chant D, McGrath J (2007) A system- aspartate neurotransmission. Proc Natl Acad
atic review of mortality in schizophrenia: is the Sci USA 96:13409–13414
differential mortality gap worsening over 304. Hamase K, Inoue T, Morikawa A, Konno R,
time? Arch Gen Psychiatry 64:1123–1131 Zaitsu K (2001) Determination of free
290. van Os J, Kapur S (2009) Schizophrenia. D-proline and D-leucine in the brains of
Lancet 374:635–645 mutant mice lacking D-amino acid oxidase
291. Kane JM (1996) Schizophrenia. N Engl J activity. Anal Biochem 298:253–258
Med 334:34–41 305. Morikawa A, Hamase K, Inoue T, Konno R,
292. Seto K, Dumontet J, Ensom MH (2011) Niwa A et al (2001) Determination of free
Risperidone in schizophrenia: is there a role D-aspartic acid, D-serine and D-alanine in the
for therapeutic drug monitoring? Ther Drug brain of mutant mice lacking D-amino acid oxi-
Monit 33:275–283 dase activity. J Chromatogr B 757:119–125
293. Krebs HA (1935) Metabolism of amino- 306. Dunlop DS, Neidle A (1997) The origin and
acids: Deamination of amino-acids. Biochem turnover of D-serine in brain. Biochem
J 29:1620–1644 Biophys Res Commun 235:26–30
294. Tishkov VI, Khoronenkova SV (2005) 307. Bauer D, Hamacher K, Broer S, Pauleit D,
D-Amino acid oxidase: structure, catalytic Palm C et al (2005) Preferred stereoselective
mechanism, and practical application. brain uptake of d-serine. A modulator of
Biochem-Moscow 70:40–54 glutamatergic neurotransmission. Nucl Med
295. Fukui K, Miyake Y (1992) Molecular cloning Biol 32:793–797
and chromosomal localization of a human 308. Langen KJ, Hamacher K, Bauer D, Broer S,
gene encoding D-amino-acid oxidase. J Biol Pauleit D et al (2005) Preferred stereoselec-
Chem 267:18631–18638 tive transport of the D-isomer of cis-4-[18F]
296. Momoi K, Fukui K, Watanabe F, Miyake Y fluoro-proline at the blood-brain barrier.
(1988) Molecular cloning and sequence J Cereb Blood Flow Metab 25:607–616
analysis of cDNA encoding human kidney 309. Kawazoe T, Tsuge H, Pilone MS, Fukui K
D-amino acid oxidase. FEBS Lett 238: (2006) Crystal structure of human D-amino
180–184 acid oxidase: context-dependent variability of
297. Molla G, Sacchi S, Bernasconi M, Pilone MS, the backbone conformation of the VAAGL
Fukui K et al (2006) Characterization of hydrophobic stretch located at the si-face of
human D-amino acid oxidase. FEBS Lett the flavin ring. Protein Sci 15:2708–2717
580:2358–2364 310. Verrall L, Walker M, Rawlings N, Benzel I,
298. Caldinelli L, Molla G, Sacchi S, Pilone MS, Kew JNC et al (2007) D-Amino acid oxidase
Pollegioni L (2009) Relevance of weak flavin and serine racemase in human brain: normal
binding in human D-amino acid oxidase. distribution and altered expression in schizo-
Protein Sci 18:801–810 phrenia. Eur J Neurosci 26:1657–1669
299. Nagata Y, Yamamoto K, Shimojo T, Konno 311. Kitano R, Morimoto S (1975) Isolation of
R, Yasumura Y et al (1992) The presence of peroxisomes from the dog kidney cortex.
free D-alanine, D-proline and D-serine in Biochim Biophys Acta 411:113–120
mice. Biochim Biophys Acta 1115:208–211 312. Perotti ME, Gavazzi E, Trussardo L,
300. Neims AH, Zieverink WD, Smilack JD Malgaretti N, Curti B (1987) Immunoelectron
(1966) Distribution of D-amino acid oxidase microscopic localization of D-amino acid oxi-
in bovine and human nervous tissues. J dase in rat kidney and liver. Histochem J
Neurochem 13:163–168 19:157–169
301. Inoue T, Hamase K, Morikawa A, Zaitsu K 313. Tarelli GT, Vanoni MA, Negri A, Curti B
(2000) Determination of minute amounts of (1990) Characterization of a fully active
D-leucine in various brain regions of rat and N-terminal 37-kDa polypeptide obtained by
mouse using column-switching high- limited tryptic cleavage of pig kidney D-amino
performance liquid chromatography. J acid oxidase. J Biol Chem 265:21242–21246
Chromatogr B 744:213–219 314. Sacchi S, Bernasconi M, Martineau M,
302. Wolosker H, Sheth KN, Takahashi M, Mothet Mothet JP, Ruzzene M et al (2008) pLG72
JP, Brady RO Jr et al (1999) Purification of modulates intracellular D-serine levels
serine racemase: biosynthesis of the neuro- through its interaction with D-amino acid
modulator D-serine. Proc Natl Acad Sci USA oxidase: effect on schizophrenia susceptibility.
96:721–725 J Biol Chem 283:22244–22256
303. Wolosker H, Blackshaw S, Snyder SH (1999) 315. Gaunt GL, de Duve C (1976) Subcellular dis-
Serine racemase: a glial enzyme synthesizing tribution of D-amino acid oxidase and cata-
D-serine to regulate glutamate-N-methyl-D- lase in rat brain. J Neurochem 26:749–759
156 Esther Jortzik et al.
316. Robinson JM, Briggs RT, Karnovsky MJ perceptual, cognitive, and neuroendocrine
(1978) Localization of D-amino acid oxidase responses. Arch Gen Psychiat 51:199–214
on the cell surface of human polymorphonu- 328. Coyle JT (2006) Glutamate and schizophre-
clear leukocytes. J Cell Biol 77:59–71 nia: beyond the dopamine hypothesis. Cell
317. Sakata K, Fukushima T, Minje L, Ogurusu T, Mol Neurobiol 26:365–384
Taira H et al (1999) Modulation by L- and 329. Ross CA, Margolis RL, Reading SA, Pletnikov
D-isoforms of amino acids of the L-glutamate M, Coyle JT (2006) Neurobiology of schizo-
response of N-methyl-D-aspartate receptors. phrenia. Neuron 52:139–153
Biochemistry 38:10099–10106 330. Morita Y, Ujike H, Tanaka Y, Otani K,
318. Schell MJ, Molliver ME, Snyder SH (1995) Kishimoto M et al (2007) A genetic variant of
D-serine, an endogenous synaptic modulator: the serine racemase gene is associated with
localization to astrocytes and glutamate- schizophrenia. Biol Psychiatry 61:1200–1203
stimulated release. Proc Natl Acad Sci USA 331. Chumakov I, Blumenfeld M, Guerassimenko
92:3948–3952 O, Cavarec L, Palicio M et al (2002) Genetic
319. Schell MJ, Brady RO Jr, Molliver ME, Snyder and physiological data implicating the new
SH (1997) D-serine as a neuromodulator: human gene G72 and the gene for D-amino
regional and developmental localizations in acid oxidase in schizophrenia. Proc Natl Acad
rat brain glia resemble NMDA receptors. J Sci USA 99:13675–13680
Neurosci 17:1604–1615 332. Hashimoto K, Fukushima T, Shimizu E,
320. Almond SL, Fradley RL, Armstrong EJ, Komatsu N, Watanabe H et al (2003)
Heavens RB, Rutter AR et al (2006) Behavioral Decreased serum levels of D-serine in patients
and biochemical characterization of a mutant with schizophrenia: evidence in support of
mouse strain lacking D-amino acid oxidase the N-methyl-D-aspartate receptor hypofunc-
activity and its implications for schizophrenia. tion hypothesis of schizophrenia. Arch Gen
Mol Cell Neurosci 32:324–334 Psychiat 60:572–576
321. Katsuki H, Nonaka M, Shirakawa H, Kume 333. Liu YL, Fann CSJ, Liu CM, Chang CC, Wu
T, Akaike A (2004) Endogenous D-serine is JY et al (2006) No association of G72 and
involved in induction of neuronal death by D-amino acid oxidase genes with schizophre-
N-methyl-D-aspartate and simulated isch- nia. Schizophr Res 87:15–20
emia in rat cerebrocortical slices. J Pharmacol 334. Liu X, He G, Wang X, Chen Q, Qian X et al
Exp Ther 311:836–844 (2004) Association of DAAO with schizo-
322. Wood PL, Emmett MR, Rao TS, Mick S, Cler phrenia in the Chinese population. Neurosci
J et al (1989) In vivo modulation of the Lett 369:228–233
N-methyl-D-aspartate receptor complex by 335. Wood LS, Pickering EH, Dechairo BM
D-serine: potentiation of ongoing neuronal (2007) Significant support for DAO as a
activity as evidenced by increased cerebellar schizophrenia susceptibility locus: examina-
cyclic GMP. J Neurochem 53:979–981 tion of five genes putatively associated with
323. Oliet SH, Mothet JP (2009) Regulation of schizophrenia. Biol Psychiatry 61:1195–1199
N-methyl-D-aspartate receptors by astrocytic 336. Shinkai T, De Luca V, Hwang R, Müller DJ,
D-serine. Neuroscience 158:275–283 Lanktree M et al (2007) Association analyses
324. Junjaud G, Rouaud E, Turpin F, Mothet JP, of the DAOA/G30 and D-amino-acid oxi-
Billard JM (2006) Age-related effects of the dase genes in schizophrenia: Further evidence
neuromodulator D-serine on neurotransmis- for a role in schizophrenia. Neuromol Med
sion and synaptic potentiation in the CA1 9:169–177
hippocampal area of the rat. J Neurochem 337. Burnet PWJ, Eastwood SL, Bristow GC,
98:1159–1166 Godlewska BR, Sikka P et al (2008) D-amino
325. Panatier A, Theodosis DT, Mothet JP, Touquet acid oxidase activity and expression are
B, Pollegioni L et al (2006) Glia-derived increased in schizophrenia. Mol Psychiatr 13:
D-serine controls NMDA receptor activity and 658–660
synaptic memory. Cell 125:775–784 338. Madeira C, Freitas ME, Vargas-Lopes C,
326. Javitt DC, Zukin SR (1991) Recent advances Wolosker H, Panizzutti R (2008) Increased
in the phencyclidine model of schizophrenia. brain D-amino acid oxidase (DAAO) activity
Am J Psychiat 148:1301–1308 in schizophrenia. Schizophr Res 101:76–83
327. Krystal JH, Karper LP, Seibyl JP, Freeman 339. Labrie V, Wang W, Barger SW, Baker GB,
GK, Delaney R et al (1994) Subanesthetic Roder JC (2010) Genetic loss of D-amino acid
effects of the noncompetitive NMDA antago- oxidase activity reverses schizophrenia-like phe-
nist, ketamine, in humans. Psychotomimetic, notypes in mice. Genes Brain Behav 9:11–25
Flavins and Flavoproteins: Applications in Medicine 157
340. Iwana S, Kawazoe T, Park HK, Tsuchiya K, 349. Feigin A, Kurlan R, McDermott MP, Beach J,
Ono K et al (2008) Chlorpromazine oligo- Dimitsopulos T et al (1996) A controlled trial
mer is a potentially active substance that of deprenyl in children with Tourette’s syn-
inhibits human D-amino acid oxidase, prod- drome and attention deficit hyperactivity dis-
uct of a susceptibility gene for schizophrenia. order. Neurology 46:965–968
J Enzym Inhib Med Chem 23:901–911 350. Rubinstein S, Malone MA, Roberts W, Logan
341. Abou El-Magd RM, Park HK, Kawazoe T, WJ (2006) Placebo-controlled study examin-
Iwana S, Ono K et al (2010) The effect of ing effects of selegiline in children with
risperidone on D-amino acid oxidase activity attention-deficit/hyperactivity disorder. J
as a hypothesis for a novel mechanism of Child Adolesc Psychopharmacol 16:404–415
action in the treatment of schizophrenia. 351. Akhondzadeh S, Tavakolian R, Davari-Ashtiani
J Psychopharmacol 24:1055–1067 R, Arabgol F, Amini H (2003) Selegiline in the
342. Adage T, Trillat AC, Quattropani A, Perrin treatment of attention deficit hyperactivity dis-
D, Cavare L et al (2008) In vitro and in vivo order in children: a double blind and random-
pharmacological profile of AS057278, a selec- ized trial. Prog Neuropsychopharmacol Biol
tive D-amino acid oxidase inhibitor with Psychiatry 27:841–845
potential anti-psychotic properties. Eur 352. Yanik M, Erel O, Kati M (2004) The relation-
Neuropsychopharmacol 18:200–214 ship between potency of oxidative stress and
343. Smith SM, Uslaner JM, Yao LH, Mullins CM, severity of depression. Acta Neuropsychiatr
Surles NO et al (2009) The behavioral and 16:200–203
neurochemical effects of a novel D-amino acid 353. Berry CE, Hare JM (2004) Xanthine oxido-
oxidase inhibitor compound 8 [4H-thieno reductase and cardiovascular disease: molecu-
[3,2-b]pyrrole-5-carboxylic acid] and D-serine. lar mechanisms and pathophysiological
J Pharmacol Exp Ther 328:921–930 implications. J Physiol 555:589–606
344. Hashimoto K, Fujita Y, Horio M, Kunitachi S, 354. George J, Struthers AD (2008) The role of
Iyo M et al (2009) Co-administration of a urate and xanthine oxidase inhibitors in
D-amino acid oxidase inhibitor potentiates the cardiovascular disease. Cardiovasc Ther 26:
efficacy of D-serine in attenuating prepulse 59–64
inhibition deficits after administration of dizo-
cilpine. Biol Psychiatry 65:1103–1106 355. Pacher P, Nivorozhkin A, Szabo C (2006)
Therapeutic effects of xanthine oxidase inhibi-
345. Horio M, Fujita Y, Ishima T, Iyo M, Ferraris tors: renaissance half a century after the discov-
D, Tsukamoto T et al (2009) Effects of ery of allopurinol. Pharmacol Rev 58:87–114
D-amino acid oxidase inhibitor on the extra-
cellular Dalanine levels and the efficacy of 356. Kelkar A, Kuo A, Frishman WH (2011)
D-alanine on dizocilpineinduced prepulse Allopurinol as a cardiovascular drug. Cardiol
inhibition deficits in mice. Open Clin Chem J Rev 19:265–271
2:16–21 357. Lambeth JD (2004) NOX enzymes and the
346. Ferraris D, Duvall B, Ko YS, Thomas AG, biology of reactive oxygen. Nat Rev Immunol
Rojas C et al (2008) Synthesis and biological 4:181–189
evaluation of D-amino acid oxidase inhibi- 358. Touyz RM, Briones AM, Sedeek M, Burger D,
tors. J Med Chem 51:3357–3359 Montezano AC (2011) NOX isoforms and
347. Sagot Y, Toni N, Perrelet D, Lurot S, King B reactive oxygen species in vascular health.
et al (2000) An orally active anti-apoptotic Mol Interv 11:27–35
molecule (CGP 3466B) preserves mitochon- 359. Drummond GR, Selemidis S, Griendling KK,
dria and enhances survival in an animal model Sobey CG (2011) Combating oxidative stress
of motoneuron disease. Br J Pharmacol 131: in vascular disease: NADPH oxidases as thera-
721–728 peutic targets. Nat Rev Drug Discov 10:
348. Waibel S, Reuter A, Malessa S, Blaugrund 453–471
E, Ludolph AC (2004) Rasagiline alone and 360. Aldieri E, Riganti C, Polimeni M, Gazzano E,
in combination with riluzole prolongs sur- Lussiana C et al (2008) Classical inhibitors of
vival in an ALS mouse model. J Neurol 251: NOX NAD(P)H oxidases are not specific.
1080–1084 Curr Drug Metab 9:686–696
Part II
Chapter 8
Abstract
The measurement of kinetic isotope effects (KIEs) has proved useful in many mechanistic studies of
enzyme activity, most notably in enzyme-catalyzed hydrogen-transfer reactions. Primary KIEs (1° KIE)
greater than unity indicate that transfer of the hydrogen species of interest is partially or fully rate limiting,
and studies of the magnitude of the temperature and pressure dependence of these KIEs can inform on the
mechanism of transfer. For example, KIE measurements have proved crucial in understanding the role of
quantum mechanical tunneling in enzyme systems. The measurement of secondary KIEs (2° KIEs) is also
informative and can be used to infer a significant tunneling contribution and details of transition state
geometry. Here the deuterium label is introduced next to that of the transferred hydrogen. Measurements
of 1° and 2° KIEs are being used increasingly in studies of H-transfer in flavoprotein enzymes and this
requires the preparation of high purity and stereospecific labeled isotopologues. Strategies for the synthesis
of labeled substrates are dependent on the enzyme system being studied. However, the nicotinamide
coenzymes are often used in studies of flavoprotein enzyme mechanisms. Here, we provide practical details
for the enzymatic synthesis of high purity deuterated isotopologues of the common biological coenzymes
NADH and NADPH as well as the corresponding nonreactive mimics, tetrahydroNAD(P)H. Both forms
of the coenzyme have proven useful in the study of mechanisms, particularly in relation to the involvement
of quantum mechanical tunneling and dynamics in enzymatic H-transfer chemistry. The focus here is on
practical considerations in the synthesis of these compounds. We also provide an abbreviated description
of how measurements of KIEs can inform on flavoprotein mechanisms. The aim of this contribution is
not to give a detailed description of the underlying theory (which has been reviewed extensively in the
literature), but to provide a basic introduction and practical considerations for nonexpert readers who wish
to incorporate such measurements in studies of enzyme mechanisms.
1 Introduction
Kinetic isotope effects (KIEs) are major tools for dissecting and
interpreting enzyme mechanisms. The reaction rate can be greatly
modified if isotopic substitution is made in the reacting bond
[a primary (1°) KIE], i.e., a bond broken or made during the reaction
[1]. A secondary KIE (2° KIE) is observed when the substituted
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_8, © Springer Science+Business Media New York 2014
161
162 Christopher R. Pudney et al.
2 Materials
3 Methods
0.6
Absorbance
0.4
0.2
0.0
Fig. 2 Example absorbance spectra for purified coenzymes. The black line shows
example spectra for NADH and NADPH isotopologues, appearing essentially
identical to that obtained for the corresponding protiated coenzyme. The blue line
shows absorbance spectra arising from NAD(P)H4
Fig. 3 1H NMR spectra of purified NADH (a) and NADPH (b) coenzymes expanded
around the R and S protons. The isotopic purity for the single deuterated coen-
zymes is determined from the ratio of the peak integral of the R and S protons.
For (R,S)-[4,4-2H2]-NADH, the ratio of the R and S proton peaks to the peak at
5.65 ppm (not shown) was used. The spectra for (R)-[4-2H]-NADH (a, red line)
exemplify contamination with the protiated coenzyme, observable as peaks cen-
tered around ~2.6 ppm
3.6 Accounting for The syntheses reported here yield isotopologues with a purity
Isotopic Impurity >95 %. However, it is not always possible to prepare such high-
purity isotopologues. We have found that even small amounts of
isotopic impurity give rise to kinetic isotope fractionation [34],
essentially a special case of competitive inhibition. Specifically, this
effect leads to the formation of more protiated than deuterated
product and as such the observed rate for deuterium transfer may
be overestimated. The consequence is that the magnitude of the
KIE may be significantly underestimated. This is a major issue,
particularly where the absolute magnitude of the KIE is important
to mechanistic interpretation. Where high-purity isotopologues
cannot be used, correcting the observed rate constant for isotopic
impurity can ameliorate this effect. For steady-state reactions, the
correction is given by the linear relationship
V obs = V H c + V D ( 1 – c ) , (1)
168 Christopher R. Pudney et al.
where VH and VD are the observed rates of the reaction for the
protiated and (isotopically pure) deuterated substrate, respectively.
χ is the fraction of isotopic impurity to the total substrate
concentration. The parameter χ can usually be determined accu-
rately using NMR or mass spectrometry. Under pre-steady state
conditions, isotope fractionation occurs where there is a reversible
chemical step preceding H-transfer and the reverse rate of this step
is comparable with the rate of H-transfer. We have provided a rigor-
ous method for the correction of this kind of isotopic fractionation
[34]. It is, however, possible to correct for incomplete deuteration
using a simple linear relationship (Eq. 2) in a way similar to that used
in the correction of steady-state data [34]:
kobs = kH c + kD ( 1 – c ) , (2)
kH and kD are the observed rates of the reaction for the protiated
and isotopically pure deuterated substrate under pre-steady state
conditions, respectively. This simple relationship may not always
hold and as such we would suggest the more complex correction
method in ref. 34 be also tested.
4 Notes
5.2 Secondary KIEs It is often difficult to accurately measure α-2° KIEs as they typically
fall in the range ~1–1.3. Traditional methods use competitive mea-
surements to obtain the desired level of accuracy in measuring these
small isotope effects. Again, the reader is directed to reviews and
primary papers in which the competitive method of measurement is
described in detail [2, 3, 44]. We have shown recently, however,
that α-2° KIEs can also be measured accurately non-competitively
using stopped-flow methods, an approach which is particularly
suited to flavoprotein enzymes. The interpretation of the physical
basis of α-2° KIEs is usually described as a change in force constant
at the position of isotopic substitution [45, 46]. Experimentally,
particularly in enzyme systems, it is then difficult to relate such a
Practical Aspects on the Use of Kinetic Isotope Effects as Probes of Flavoprotein… 171
6 Concluding Remarks
References
1. Romesberg FE, Schowen RL (2004) Isotope 10. Hay S, Sutcliffe MJ, Scrutton NS (2007)
effects and quantum tunneling in enzyme- Promoting motions in enzyme catalysis
catalyzed hydrogen transfer. Part I. The experi- probed by pressure studies of kinetic isotope
mental basis. Adv Phys Org Chem 39:27–77 effects. Proc Natl Acad Sci U S A 104:
2. Northrop DB (1975) Steady-state analysis of 507–512
kinetic isotope effects in enzymic reactions. 11. Hay S, Pudney CR, Sutcliffe MJ, Scrutton NS
Biochemistry 14:2644–2651 (2008) Solvent as a probe of active site motion
3. Cha Y, Murray CJ, Klinman JP (1989) and chemistry during the hydrogen tunnelling
Hydrogen tunneling in enzyme reactions. reaction in morphinone reductase.
Science 243:1325–1330 ChemPhysChem 9:1875–1881
4. Pudney CR, Hay S, Scrutton NS (2009) 12. Heyes DJ, Sakuma M, Scrutton NS (2009)
Bipartite recognition and conformational sam- Solvent-slaved protein motions accompany
pling mechanisms for hydride transfer from proton but not hydride tunneling in light-
nicotinamide coenzyme to FMN in pentae- activated protochlorophyllide oxidoreductase.
rythritol tetranitrate reductase. FEBS J 276: Angew Chem Int Ed 48:3850–3853
4780–4789 13. Kohen A, Jonsson T, Klinman JP (1997)
5. Pudney CR, Hay S, Pang J, Costello C, Leys Effects of protein glycosylation on catalysis:
D, Sutcliffe MJ, Scrutton NS (2007) changes in hydrogen tunneling and enthalpy of
Mutagenesis of morphinone reductase induces activation in the glucose oxidase reaction.
multiple reactive configurations and identifies Biochemistry 36:2603–2611
potential ambiguity in kinetic analysis of 14. Seymour SL, Klinman JP (2002) Comparison
enzyme tunneling mechanisms. J Am Chem of rates and kinetic isotope effects using PEG-
Soc 129:13949–13956 modified variants and glycoforms of glucose
6. Pudney CR, McGrory T, Lafite P, Pang J, Hay oxidase: the relationship of modification of the
S, Leys D, Sutcliffe MJ, Scrutton NS (2009) protein envelope to C–H activation and tunnel-
Parallel pathways and free-energy landscapes ing. Biochemistry 41:8747–8758
for enzymatic hydride transfer probed by 15. Nagel ZD, Klinman JP (2009) A 21st century
hydrostatic pressure. ChemBioChem 10: revisionist’s view at a turning point in enzy-
1379–1384 mology. Nat Chem Biol 5:543–550
7. Pudney CR, Johannissen LO, Sutcliffe MJ, 16. Hay S, Pudney CR, Scrutton NS (2009)
Hay S, Scrutton NS (2010) Direct analysis of Structural and mechanistic aspects of flavopro-
donor–acceptor distance and relationship to teins: probes of hydrogen tunnelling. FEBS J
isotope effects and the force constant for bar- 276:3930–3941
rier compression in enzymatic H-tunneling 17. Warshel A, Sharma PK, Kato M, Xiang Y, Liu
reactions. J Am Chem Soc 132:11329–11335 H, Olsson MHM (2006) Electrostatic basis
8. Meyer MP, Tomchick DR, Klinman JP (2008) for enzyme catalysis. Chem Rev 106:
Enzyme structure and dynamics affect hydro- 3210–3235
gen tunneling: the impact of a remote side 18. Hammes-Schiffer S (2006) Hydrogen tunnel-
chain (I553) in soybean lipoxygenase-1. Proc ing and protein motion in enzyme reactions.
Natl Acad Sci U S A 105:1146–1151 Acc Chem Res 39:93–100
9. Nagel ZD, Dong M, Bahnson BJ, Klinman JP 19. Hay S, Johannissen LO, Sutcliffe MJ, Scrutton
(2011) Impaired protein conformational NS (2010) Barrier compression and its contri-
landscapes as revealed in anomalous Arrhenius bution to both classical and quantum mechani-
prefactors. Proc Natl Acad Sci U S A cal aspects of enzyme catalysis. Biophys J 98:
108:10520–10525 121–128
174 Christopher R. Pudney et al.
20. Nagel ZD, Klinman JP (2010) Update 1 of: β-nicotinamide adenine dinucleotide 2 ' phos-
Tunneling and dynamics in enzymatic hydride phate. Anal Biochem 324:131–136
transfer. Chem Rev 110:R41–PR67 33. Ottolina G, Riva S, Carrea G, Danieli B,
21. Hay S, Scrutton NS (2012) Good vibrations in Buckmann AF (1989) Enzymatic synthesis of
enzyme-catalysed reactions. Nat Chem [4R-2H]NAD(P)H and [4S-2H]NAD(P)H
4:161–168 and determination of the stereospecificity of
22. Kamerlin SCL, Warshel A (2010) An analysis 7α- and 12α-hydroxysteroid dehydrogenase.
of all the relevant facts and arguments indicates Biochim Biophys Acta 998:173–178
that enzyme catalysis does not involve large 34. Hay S, Pudney CR, Hothi P, Scrutton NS
contributions from nuclear tunneling. J Phys (2008) Correction of pre-steady-state KIEs for
Org Chem 23:677–684 isotopic impurities and the consequences of
23. Kamerlin SCL, Warshel A (2010) At the dawn kinetic isotope fractionation. J Phys Chem A
of the 21st century: is dynamics the missing 112:13109–13115
link for understanding enzyme catalysis? 35. Branlant G, Eiler B, Biellmann JF (1982) A
Proteins 78:1339–1375 word of caution: 1,4,5,6-tetrahydronicotinamide
24. Nashine VC, Hammes-Schiffer S, Benkovic SJ adenine dinucleotide (phosphate) should be
(2010) Coupled motions in enzyme catalysis. used with care in acidic and neutral media. Anal
Curr Opin Chem Biol 14:644–651 Biochem 125:264–268
25. Basran J, Harris RJ, Sutcliffe MJ, Scrutton NS 36. French CE, Nicklin S, Bruce NC (1996)
(2003) H-tunneling in the multiple H-transfers Sequence and properties of pentaerythritol tet-
of the catalytic cycle of morphinone reductase ranitrate reductase from Enterobacter cloacae
and in the reductive half-reaction of the homol- PB2. J Bacteriol 178:6623–6627
ogous pentaerythritol tetranitrate reductase. 37. French CE, Bruce NC (1994) Purification and
J Biol Chem 278:43973–43982 characterization of morphinone reductase
26. Pudney CR, Hay S, Sutcliffe MJ, Scrutton NS from Pseudomonas putida M10. Biochem J
(2006) α-secondary isotope effects as probes of 301:97–103
“tunneling-ready” configurations in enzymatic 38. Knapp MJ, Rickert K, Klinman JP (2002)
H-tunneling: Insight from environmentally Temperature-dependent isotope effects in soy-
coupled tunneling models. J Am Chem Soc bean lipoxygenase-1: correlating hydrogen
128:14053–14058 tunneling with protein dynamics. J Am Chem
27. Masgrau L, Roujeinikova A, Johannissen LO, Soc 124:3865–3874
Hothi P, Basran J, Ranaghan KE, Mulholland AJ, 39. Nesheim JC, Lipscomb JD (1996) Large kinetic
Sutcliffe MJ, Scrutton NS, Leys D (2006) Atomic isotope effects in methane oxidation catalyzed by
description of an enzyme reaction dominated by methane monooxygenase: evidence for C–H
proton tunneling. Science 312:237–241 bond cleavage in a reaction cycle intermediate.
28. Hay S, Pang J, Monaghan PJ, Wang X, Evans Biochemistry 35:10240–10247
RM, Sutcliffe MJ, Allemann RK, Scrutton NS 40. Hay S, Scrutton NS (2008) Incorporation of
(2008) Secondary kinetic isotope effects as hydrostatic pressure into models of hydrogen
probes of environmentally-coupled enzymatic tunneling highlights a role for pressure-
hydrogen tunneling reactions. ChemPhysChem modulated promoting vibrations. Biochemistry
9:1536–1539 47:9880–9887
29. Pudney CR, Hay S, Levy C, Pang J, Sutcliffe MJ, 41. Johannissen LO, Scrutton NS, Sutcliffe MJ
Leys D, Scrutton NS (2009) Evidence to support (2011) How does pressure affect barrier com-
the hypothesis that promoting vibrations enhance pression and isotope effects in an enzymatic
the rate of an enzyme catalyzed H-tunneling hydrogen tunneling reaction? Angew Chem
reaction. J Am Chem Soc 131:17072–17073 Int Ed 50:2129–2132
30. Markham KA, Kohen A (2006) Analytical pro- 42. Hay S, Pudney CR, McGory TA, Pang J, Sutcliffe
cedures for the preparation, isolation, analysis MJ, Scrutton NS (2009) Barrier compression
and preservation of reduced nicotinamides. enhances an enzymatic hydrogen-transfer reac-
Curr Anal Chem 2:379–388 tion. Angew Chem Int Ed 48:1452–1554
31. Viola RE, Cook PF, Cleland WW (1979) 43. Hay S, Pudney CR, Sutcliffe MJ, Scrutton NS
Stereoselective preparation of deuterated (2010) Probing active site geometry using
reduced nicotinamide adenine nucleotides and high pressure and secondary isotope effects in
substrates by enzymatic synthesis. Anal Biochem an enzyme-catalysed ‘deep’ H-tunnelling
96:334–340 reaction. J Phys Org Chem 23:696–701
32. McCracken JA, Wang L, Kohen A (2004) 44. Kohen A, Cannio R, Bartolucci S, Klinman JP
Synthesis of R and S tritiated reduced (1999) Enzyme dynamics and hydrogen
Practical Aspects on the Use of Kinetic Isotope Effects as Probes of Flavoprotein… 175
Abstract
Measured values of the redox midpoint potential of flavin-containing photoreceptor proteins range from
physiologically very negative values, i.e., < –300 mV (compared to the calomel electrode) for some LOV
domains, to slightly positive values for some cryptochromes. The actual intracellular redox potential of
several key physiological electron-transfer intermediates, like the nicotinamide dinucleotides, particularly
in chemoheterotrophic bacteria, may be varying beyond these two values, and are subject to physiological-
and environmental regulation. The photochemical activity of photoreceptor proteins containing their
flavin chromophore in the reduced, and in the fully oxidized form, is very different. We therefore have
addressed the question whether or not the functioning of these flavin-containing photosensory receptors
in vivo is subject to redox regulation.
Here we (1) provide further evidence for the overlap of the ranges of the redox midpoint potential of
the flavin in a specific photoreceptor protein and the redox potential of key intracellular redox-active
metabolites, and (2) demonstrate that the redox state and photochemical activity of LOV domains can be
recorded in vivo in Escherichia coli. Significantly, so far in vivo reduction of LOV domains under physio-
logical conditions could not be detected. The implications of these observations are discussed.
Key words Redox midpoint potential, LOV domains, Nicotinamide nucleotides, Cryptochromes,
Escherichia coli
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_9, © Springer Science+Business Media New York 2014
177
178 Aleksandra Bury and Klaas J. Hellingwerf
2.1.1 Bacterial Strains The bacterial strains, plasmids, and primers that were used in this
and Construction investigation have been listed in Table 1. E. coli Xl1-blue was used
of Plasmids as the intermediate cloning host for plasmids prior to transforma-
tion of E. coli M15/pREP4. Transformants were selected on LB
agar plates, containing 100 μg/mL ampicillin or 100 μg/mL
ampicillin plus 25 μg/mL kanamycin, after their overnight incuba-
tion at 37 °C.
The lovK gene was amplified by using chromosomal DNA
from Caulobacter crescentus FC19 as the template and part of
the primers shown in Table 1. Truncated derivatives of this gene
(i.e., 1–138 and 1–156; numbers refer to amino acids of the
Table 1
Strains, plasmids, and primers used in this investigation
Reference,
Strain, plasmid, source, or
or primer Relevant genotype, characterization, or primer sequences construction
Strains:
E.coli M15/pREP4
E.coli Xl1-blue
Plasmids:
pQE30
Primers:
LovK_R_A 5′ GCTTGGT CACGTCCACCTGCGAGC 3′ This study
LovK_R_B 5′ GTTGAAAGCTGCTGCAGACCGTCGC 3′ This study
YtvA_F_A 5′ GGACGTG ACCAAGCAAAAAGAATATG This study
AAAAGCTTCTCG3′
YtvA_F_B 5′ GCAGCAGCTTTCAACTCCTATTGTCCCG3′ This study
pQE30LovKbamHiFW 5′ CCCGGATCCATGGAAGACTATTCGGATCGC 3′ This study
pQE30YtvARV 5′GGGGTCGACTTACATAATCGGAAGCACTTTAACG 3′ [15]
pQE30LovKRV 5′ CCCAAGCTTCTATTGCGTCCCATTGATGGGCA 3′ This study
pQE30LovK138RV 5′CCCAAGCTTGTCGGTCACGTCCACCT 3′ This study
pQE30LovK156RV 5′ CCCAAGCTTCATCTGCTGCAGACCGT 3′ This study
pQE30YtvAFW 5′CCCGGATCCATGGCTTTTCAATCATTTGGG 3′ [15]
180 Aleksandra Bury and Klaas J. Hellingwerf
2.2 Measurement Redox midpoint potentials were determined with the procedure
of Redox Midpoint based on the use of xanthine/xanthine oxidase as the electron
Potentials donor developed by Massey [13], as described in Arents et al. [5].
The midpoint potential of all proteins included in this study was
measured with both safranin O and with phenosafranin as the indi-
cation dye. Complete reduction of a protein sample typically took
between 2 and 3 h.
2.3 Spectroscopy UV–Vis spectra were recorded using an HP8453 UV–Vis diode
array spectrophotometer (Hewlett-Packard Nederland BV,
Amstelveen, NL) for purified protein (domains), or a SPECORD
210PLUS double beam UV–Vis spectrometer (Analytik Jena,
On the In Vivo Redox State of Flavin-Containing Photosensory Receptor Proteins 181
3 Results
3.1 Choice of Protein Because Crosson and colleagues reported quite some variation in
Domains and Design the redox midpoint potential between full-length LovK and several
of Fusion Proteins truncated LOV-domain fragments [7], we decided to first look
into the effect of variation of the linker to the LOV domain on the
flavin midpoint potential. For this purpose we purified (via heter-
ologous overexpression in E. coli; see Subheading 2) full-length
LovK, as well as its truncated derivatives LovK1–138 and LovK1–156.
In addition, we generated two fusion proteins, LovK–STAS A and
LovK–STAS B. The STAS domain (for: sulfate transport anti-sigma
factor antagonist) is the C-terminal effector domain of YtvA, a
photo-sensory stress protein from B. subtilis, which contains an
N-terminal LOV domain that mediates light perception [11, 14, 15].
Significantly, in both YtvA and in LovK, the N-terminal LOV
domain is linked to the respective effector domain through a helical
linker structure (often referred to as Jα helix [16]) that presumably
forms a coiled/coil structure in the functionally active dimers of
both proteins [15, 17]. These fusion proteins were designed via
sequence alignment of the two full-length proteins in the linker
region (Fig. 1a). In LovK–STAS A, the LOV domain from LovK1–138
is connected to the STAS domain (128–256) from YtvA, such that
the Jα linker from YtvA is retained. LovK–STAS B comprises 156
residues from LovK which are connected to the 146th residue of
182 Aleksandra Bury and Klaas J. Hellingwerf
Fig. 1 Characterization of LOV/STAS fusion proteins. (a) Schematic drawing of the LovK-STAS A/B domains
used in this study; (b) In vitro difference spectra of LovK-STAS A and LovK-STAS B; (c) Absolute spectra of the
LovK-STAS A and LovK-STAS B proteins in vivo; (d) Dark-minus-light absorption difference spectra of the LovK-
STAS A and LovK STAS B proteins in vivo
3.2 Redox All redox midpoint potential measurements were carried out under
Midpoint Potential exactly the same conditions as described in Arents et al. [5]. Full
Measurements UV–Vis absorption spectra of the visible color changes in the reac-
tion mixture during the reducing titration were recorded. For all
measurements just two indicator dyes, safranin and phenosafranin
were used (Fig. 2a–d). The midpoint potentials of these dyes are
–252 and –289 mV, respectively. Figure 2e, f show plots of the
ratio of the oxidized/reduced form of the flavin and the indicator
dye used in the reaction. Based on such plots it is possible to calcu-
late the redox midpoint potential of the flavoproteins, based on the
known redox midpoint potential of the respective dye. During
the reductive titrations with purified proteins, no formation of the
semiquinone intermediate was observed.
Surprisingly, close inspection of the midpoint potential values
obtained showed small, but significant, differences in the values of
the midpoint potentials measured with the two indicator dyes for
all constructs (see Table 2). Nearly all actual values for the midpoint
184 Aleksandra Bury and Klaas J. Hellingwerf
Fig. 2 Spectral recording and data evaluation of the color changes in the reaction mixture during the reducing
titration with xanthine/xanthine oxidase. Spectra were taken at 60 s intervals, but only every 20th spectrum is
shown. (a) Full-length LovK titrated with phenosafranin; (b) LovK-STAS A with phenosafranin, (c) Full-length
LovK with safranin, (d) LovK-STAS A with safranin. (e and f) Plot of the redox potential of the LovK-STAS A
(solid line) and full-length LovK (dashed line) versus: (e) safranin and: (f) phenosafranin. Such plots allow a
straightforward calculation of the respective midpoint potentials [5, 13]
On the In Vivo Redox State of Flavin-Containing Photosensory Receptor Proteins 185
Table 2
Overview of the redox midpoint potentials of the LOV domains studied in this investigation. Values
are given in mV relative to the calomel electrode
Standard deviation
Em in pH 8 with Em in pH 8 with ∆Em
Flavoprotein safranin (S) phenosafranin (PS) Em(PS) − Em(S) Safranin Phenosafranin
LovK-STAS A −295 −272 23 7 6
Av: −274 −283 −268 15
−284 −261 23
LovK-STAS B −305 −257 48 8 6
Av: −287 −295 −266 29
−311
LovK (1–368) −291 −285 6 9 11
Av: −287 −304 −270 34
LovK (1–156) −293 −276 17 2 7
Av: −284 −295 −276 19
−292 −276 16
−297 −263 34
LovK (1–138) −270 −272 −2 7 11
Av: −272 −285 −248 37
−285 −268 17
−283 −263 20
FMN −209 −213 −4
YtvA −313 −296 17
Av: −305
Average 18 7 8
3.3 On the Redox To better understand the factors that determine the in vivo redox
State of LovK In Vivo: state of the LOV domain(s) we first studied the specificity of their
(a) Specificity of the In reduction in vitro. To this end, LOV-domain containing protein
Vitro Reduction of the solutions were incubated with sodium dithionite, NADH, or
LOV Domain of LovK methylviologen. All solutions were flushed with argon before
mixing. Of these three compounds only sodium dithionite
(Em′ = –660 mV) did reduce the LOV domain of LovK under
anaerobic conditions (Fig. 3). Glucose and glucose oxidase were
added to the reaction mixtures to remove remaining traces of
oxygen. It is clear from these data (i.e., the broad peak in the
range between 550 and 700 nm) that dithionite in this case does
give rise to very pronounced flavin semiquinone formation.
Addition of equimolar amounts of NADH did not reduce this
LOV domain, as was also observed by Crosson and coworkers [7].
A 25-fold increase of the NADH concentration in the reaction
mixture did not lead to reduction of the LOV domain either.
Also addition of 10 μM methyl viologen (Em′ = –449 mV) did not
reduce the LOV domain in vitro, despite the reduction seen in
vivo (see further below). When all these different reductants,
including the (pheno)safranin dyes, are combined, this—as
expected—does lead to the observation that the LOV domain is
reduced first, followed by the NAD+.
3.4 On the Redox As the LovK1–138 construct has the highest midpoint potential of
State of LovK In Vivo: the ones we have studied in this investigation (see Table 2), this
(b) In Vivo Reduction latter construct was the prime target for further in vivo studies.
of the LOV Domain We first tested the effect of addition of a range of reducing agents
of LovK to cells that overexpress this LOV domain: methyl viologen, benzyl
On the In Vivo Redox State of Flavin-Containing Photosensory Receptor Proteins 187
Fig. 4 Difference spectra of the chemical reduction of the LOV domain of LovK in vivo with: (a) 10 μM methyl
viologen, (b) 10 μM sodium dithionite
4 Discussion
The data reported here for the redox midpoint potential of LovK
and some of its truncated fragments differs slightly from the values
reported by Crosson and coworkers [7]. Most notable are the
differences for the midpoint potential of the full-length LovK
protein and the truncated LovK1–138, i.e., –287 and –272 mV, as
reported here, and –258 and –303 mV as reported in the study of
Purcell et al. [7]. However, as the latter study does neither indicate
which specific indicator dye was used for which protein nor what
the typical standard deviation was in their assays, it is difficult to
pinpoint the reason(s) for these differences.
Although not observed in our previous study [5], here we did
observe a slight but significant difference in the apparent redox
midpoint potential of the set of analyzed proteins, as a function
of the specific indicator dye that was used. We attribute this to a
difference in reactivity of the two indicator dyes with the respective
proteins, rather than to a kinetic disequilibrium caused by too high
rates of electron input via the xanthine/xanthine oxidase system
[5]. Because of the relatively small differences in the values reported
by the two indicator dyes used here, we nevertheless think that it is
relevant to calculate the averaged midpoint potential for the various
On the In Vivo Redox State of Flavin-Containing Photosensory Receptor Proteins 189
Acknowledgments
We would like to thank Jos Arents for his expert technical assis-
tance. This work is part of the research program of the Foundation
for Fundamental Research on Matter (FOM), which is part of the
Netherlands Organization for Scientific Research (NWO).
190 Aleksandra Bury and Klaas J. Hellingwerf
References
1. van der Horst MA, Hellingwerf KJ (2004) 13. Massey V (1990) A simple method for the
Photoreceptor proteins, “Star Actors of determination of redox potentials. In: Curti B,
Modern Times”: a review of the functional Ronchi S, Zanetti G (eds) Flavins and flavo-
dynamics in the structure of representative proteins 1990. Walter de Gruyter, Berlin,
members of six different photoreceptor families. pp 59–66
Acc Chem Res 37:13–20 14. Gaidenko TA, Kim TJ, Weigel AL, Brody MS,
2. Möglich A, Yang X, Ayers RA, Moffat K (2010) Price CW (2006) The blue-light receptor YtvA
Structure and function of plant photoreceptors. acts in the environmental stress signaling
Annu Rev Plant Biol 61:21–47 pathway of Bacillus subtilis. J Bacteriol 188:
3. Losi A, Gärtner W (2011) The evolution of 6387–6395
flavin-binding photoreceptors: an ancient 15. Avila-Perez M, Vreede J, Tang Y, Bende O,
chromophore serving trendy blue-light sensors. Losi A, Gärtner W, Hellingwerf K (2009) In
Annu Rev Plant Biol 63:49–72 vivo mutational analysis of YtvA from Bacillus
4. Sancar A (2004) Photolyase and cryptochrome subtilis: mechanism of light activation of the
blue-light photoreceptors. Adv Protein Chem general stress response. J Biol Chem 284:
69:73–100 24958–24964
5. Arents JC, Perez MA, Hendriks J, Hellingwerf 16. Harper SM, Neil LC, Gardner KH (2003)
KJ (2011) On the midpoint potential of the Structural basis of a phototropin light switch.
FAD chromophore in a BLUF-domain con- Science 301:1541–1544
taining photoreceptor protein. FEBS Lett 17. Jurk M, Dorn M, Schmieder P (2011) Blue
585:167–172 flickers of hope: secondary structure, dynamics,
6. Balland V, Byrdin M, Eker AP, Ahmad M, and putative dimerization interface of the blue-
Brettel K (2009) What makes the difference light receptor YtvA from Bacillus subtilis.
between a cryptochrome and DNA photolyase? Biochemistry 50:8163–8171
A spectroelectrochemical comparison of the 18. Möglich A, Ayers RA, Moffat K (2009) Design
flavin redox transitions. J Am Chem Soc 131: and signaling mechanism of light-regulated
426–427 histidine kinases. J Mol Biol 385:1433–1444
7. Purcell EB, McDonald CA, Palfey BA, Crosson 19. van der Steen JB, Ávila-Pérez M, Knippert D,
S (2010) An analysis of the solution structure Vreugdenhil A, van Alphen P, Hellingwerf KJ
and signaling mechanism of LovK, a sensor (2012) Differentiation of function among the
histidine kinase integrating light and redox RsbR paralogs in the general stress response of
signals. Biochemistry 49:6761–6770 Bacillus subtilis with regard to light perception.
8. Canovas M, Sevilla A, Bernal V, Leal R, Iborra J Bacteriol 194:1708–1716
JL (2006) Role of energetic coenzyme pools in 20. Alexandre MTA, Arents JC, van Grondelle R,
the production of L-carnitine by Escherichia Hellingwerf KJ, Kennis JTM (2007) A base-
coli. Metab Eng 8:603–618 catalyzed mechanism for dark state recovery in
9. Alexeeva S, Hellingwerf KJ, Teixeira de Mattos the Avena sativa phototropin-1 LOV2 domain.
MJ (2003) Requirement of ArcA for redox Biochemistry 46:3129–3137
regulation in Escherichia coli under microaerobic 21. Gindt YM, Schelvis JPM, Thoren KL, Huang
but not anaerobic or aerobic conditions. TH (2005) Substrate binding modulates the
J Bacteriol 185:204–209 reduction potential of DNA photolyase. J Am
10. Jackson JB (1991) The proton-translocating Chem Soc 127:10472–10473
nicotinamide adenine dinucleotide transhy- 22. Sokolowsky K, Newton M, Lucero C,
drogenase. J Bioenerg Biomembr 23:715–741 Wertheim B, Freedman J, Cortazar F,
11. Ávila-Pérez M, Hellingwerf KJ, Kort R (2006) Czochor J, Schelvis JPM, Gindt YM (2010)
Blue light activates the σB-dependent stress Spectroscopic and thermodynamic compari-
response of Bacillus subtilis via YtvA. J Bacteriol sons of Escherichia coli DNA photolyase and
188:6411–6414 Vibrio cholerae cryptochrome 1. J Phys Chem B
12. Horton RM, Hunt HD, Ho SN, Pullen JK, 114:7121–7130
Pease LR (1989) Engineering hybrid genes 23. Brettel K, Byrdin M (2010) Reaction mecha-
without the use of restriction enzymes: gene nisms of DNA photolyase. Curr Opin Struct
splicing by overlap extension. Gene 77:61–68 Biol 20:693–701
Chapter 10
Abstract
Extensive interest in photosensory proteins stimulated computational studies of flavins and flavoproteins
in the past decade. This review is dedicated to the three central topics of these studies: calculations of flavin
UV–visible and IR spectra, simulated dynamics of photoreceptor proteins, and flavin photochemistry.
Accordingly, this chapter is divided into three parts; each part describes corresponding computational
protocols, summarizes computational results, and discusses the emerging mechanistic picture.
Key words Excited state calculations, Triplet formation, Flavin vibrations, Photoinduced dynamics,
Photoinduced electron transfer, Proton-coupled electron transfer, Radical pairs, Molecular dynamics
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_10, © Springer Science+Business Media New York 2014
191
192 Tatiana Domratcheva et al.
2.1 Computational To compute the UV–visible absorption and emission spectra, first
Protocols the geometry of the chromophore is optimized in the electronic
ground state and in the excited state. At the optimized geometries,
the vertical energy differences—the excitation and emission energy
(Fig. 1)—give a first estimation for the absorption and emission
band maxima. The band intensity is characterized by the oscillator
strength, the square of the transition dipole moment integral
between the initial and final electronic states. Vertical excitation
energies and oscillator strengths provide a line spectrum. To aid the
comparison with the experimental spectrum and to account for the
band overlap, the line spectrum is widened by Gaussian functions
of a certain half-width. The actual absorption/emission spectra
are more complex because of the non-vertical transitions from the
lowest vibrational level of the ground state into several vibrational
levels of the excited state. To simulate the vibronic structure,
calculations of molecular vibrations have to be carried out. The
excitation energy computed as the energy difference between the
ground-state and excited-state minima is referred to as the adia-
batic transition energy (Fig. 1). The adiabatic transition energy
corrected for the zero-point vibrational energy, the so-called 0–0
transition, serves as a good estimate for the lowest-energy component
of the experimental absorption band.
A wide range of computational methods is employed to study
flavins. Nowadays, molecular density functional theory (DFT) [1, 2]
is the most popular choice for ground-state calculations because of
its computational efficiency and reasonable accuracy. An alternative
is to use the Møller–Plesset perturbation theory of second order
(MP2) method [3] or the approximate coupled-cluster singles and
Computational Spectroscopy, Dynamics, and Photochemistry of Photosensory… 193
S1 min
Eexc Eem
Ead E0-0
S0 min
1 2
9 9a
8 N 10a N 2 O N O N N O N N N O
10
4a 3
6 4 NH NH NH NH
7 5a N N N
5 4
O O O O
Lumiflavin N1-deazaflavin N5-deazaflavin Roseoflavin
Fig. 2 The chemical structure of flavin chromophores and conventional atom numbering
2.2 Spectral The experimental UV–Vis absorption spectra of the oxidized flavin
Signatures of the show three absorption bands centered at 450 nm (2.76 eV), 330–
Oxidized Flavin 370 nm (3.76–3.35 eV), and 275 nm (4.5 eV). In the following,
we refer to these bands and the respective electronic states as S1, S2,
and S3. In the low-temperature flavin solution spectrum, the S1
band has three vibronic peaks. The vibronic structure can also be
distinguished in flavoproteins. The UV–Vis flavin spectrum origi-
nates from the isoalloxazine ring, therefore the smallest flavin
homolog—lumiflavin—is often considered (Fig. 2).
Computational Spectroscopy, Dynamics, and Photochemistry of Photosensory… 197
Fig. 3 Electronic structure and energies of the excited states of the oxidized flavin.
Electronic excitations from occupied to unoccupied MOs predominantly contrib-
uting to an excited state are indicated by the vertical arrows. Solid and dashed
arrows indicate singlet and triplet states, respectively
larger than 0.01 has an energy of 1.8 eV (690 nm), in good agreement
with the experiment [13]. Solvatochromic shifts of the triplet states
are similar to the shifts of their singlet counterparts [15].
The flavin mid-IR spectrum consists of several bands assigned
to the double-bond C=O, C=C and C=N stretches. The harmonic
normal vibrations of the oxidized flavin were computed by several
groups [32, 34, 43, 47]. In contrast to the C=C and C=N double
bonds, the carbonyl C=O frequencies are sensitive to the flavin
environment. A computational study of Rieff et al. revealed several
factors determining the position of the C=O(2) and C=O(4)
stretches [43] (see atom numbering in Fig. 2). In a polar solvent,
the C=O(2) frequency downshifts more than the C=O(4) fre-
quency because the more polar C=O(2) group interacts stronger
with the polar environment. This property is experimentally
observed as an increased separation of the C=O(2) and C=O(4)
bands upon increasing the polarity of the solvent, for example,
upon going from chloroform to DMSO and to water. Rieff et al.
reproduced this trend by employing the TIP3P and TIP4P water
models with different polarity. In combined experimental and
computational studies of Wolf et al. [33] and Haigney et al. [47],
the computed and measured isotopic shifts of the carbonyl stretches
are in excellent agreement, supporting the assignment of the
higher frequency to the C=O(4) group and the lower frequency to
the C=O(2) group. The C=O stretches are coupled with the
N(3)–H deformation, which is observed as a downshift of the
respective bands in D2O. As expected, in calculations the substitu-
tion of the N(3)–H hydrogen by deuterium reproduces the D2O
downshifts [47].
The difference IR spectrum characterizing flavin photoexcita-
tion or photoreduction originates from the population of the flavin
LUMO and thus the loss of the double-bonding character is
reflected in the spectrum. The downshift of the double-bond
stretching frequencies is specific to the transiently formed flavin
states—the excited singlet, triplet or flavin radical. In the case of
the C=O stretches, there are two factors determining the down-
shift: the decrease of the force constants that is more pronounced
for the C=O(4) group, and the decrease of the difference polarity
of the two carbonyl groups [32]. These two factors reduce the
C=O frequency gap: in the triplet state, the carbonyl frequencies
merge in one band [35]; in the excited singlet state they are only
10 cm−1 apart [32, 35], whereas in the ground-state spectrum the
gap is about 40 cm−1. Wolf et al. reported the band assignments of
the excited singlet flavin mid-IR spectrum supported by the mea-
sured and computed isotope shifts [32, 33]. In the excited singlet
state, despite their close frequencies, the C=O(2) and C=O(4)
stretches are not coupled as demonstrated by their specific
13
C-isotope shifts [33].
200 Tatiana Domratcheva et al.
2.4 Spectral Flavin adapts neutral and anionic one- and two-electron reduced
Signatures of the forms—semiquinone and hydroquinone. The hydroquinone
Reduced Flavin spectrum in ethanol at liquid-nitrogen temperature shows three
absorption bands: the neutral form at 404, 340, and 297 nm (3.07,
3.65, and 4.17 eV) and the anionic form at 415, 356, and 296 nm
(2.99, 3.48, and 4.19 eV). The highest energy band is the most
intense in both forms [50]. Fluorescence is observed at 495 and
510 nm (2.50 and 2.43 eV) for the neutral and anionic hydroqui-
none, respectively [50]. The one-electron reduced semiquinone
radical has a significantly red-shifted absorption spectrum as
compared to the oxidized and reduced flavin.
Computational Spectroscopy, Dynamics, and Photochemistry of Photosensory… 201
Fig. 4 Electronic structure and energies of the excited states of the neutral hydro-
quinone. Electronic excitations from occupied to unoccupied MOs predominantly
contributing to an excited state are indicated by the vertical arrows
Fig. 5 The structure of the dark and light state of the LOV protein. The residue numbing of LOV2 and LOV1
(in brackets) is indicated. (a) Domain organization in phototropins; (b) Chemical structure of the flavin–
cysteinyl covalent adduct; (c) Cartoon representation of the LOV protein structure with important residues
shown as balls and sticks (the green colored Jα-helix is only present in the LOV2 structure); and (d) Superposed
dark (gray) and light (orange) state structures of the LOV1 domain (PDB models 1N9L and 1N9O, respectively).
Note the different rotamers of Gln61 and Gln120 in the two structures. In the methylmercaptan adduct the
Cβ–Cα covalent bond is not present
hydrogen bonds around flavin are stable and the Jα-helix does not
unfold thus confirming the critical role of Gln1029 in signal prop-
agation [65].
MD simulations provide a versatile tool for predicting effects
of protein-residue mutations. Using MD simulations, Song et al.
[73] predicted mutations in the A. sativa phototropin-1 AsLOV2
domain. In particular, they searched for mutations, which may
stabilize the rotated conformation of the conserved Gln513 (the
AsLOV2 construct has a different residue numbering and Gln513
is an analog of Gln1029 in the previously described LOV2). In one
of the mutants, residue Phe434, forming a van-der-Waals contact
with Gln513, was replaced by a tyrosine. The solution-NMR
studies of this mutant indicated local structural changes close to
the mutation site. In addition, time-resolved spectroscopy studies
revealed that the mutation affects the life times of the excited flavin
and covalent adduct [73]. The MD simulations of Song et al.
showed formation of a water binding site next to the Tyr434 side
chain that changes the rotameric distribution of the photoactive
Cys450: In the mutant, the Cys450 rotamer, which is oriented
away from the C(4a) atom of flavin, is stabilized by 1 kcal/mol as
compared to the wild type. By including the dynamics of the
Cys450 rotamers in a global kinetic model, the observed life times
of the excited flavin were reproduced. The combined experimental
and theoretical study of Song et al. [73] demonstrated a significant
coupling between the photoreaction center and its protein envi-
ronment in AsLOV2 that apparently influences light sensing
(the excited-state life time) as well as signaling (the photoproduct
life time).
3.3 Dynamics of the BLUF-protein domains mediate response to blue light in various
Flavin-Binding Pocket bacterial species. Similar to the LOV domain, the BLUF light sen-
and Computational sor controls the activity of the enzymatic domains in multi-domain
Spectroscopy of the proteins using the photochemistry of the oxidized flavin adenine
BLUF Protein nucleotide (FAD) chromophore. The BLUF domain has a peculiar
photoreaction, which does not result in any chemical change of the
flavin: The UV–Vis absorption spectrum of the BLUF light state
contains the oxidized flavin with the 10–15-nm red-shifted absorp-
tion spectrum as compared to the dark state. Concomitantly, a
downshift of the flavin C=O(4) stretching frequency is observed.
The red-shifts can be explained by the formation or strengthening
of a hydrogen bond involving the C=O(4) group.
X-ray crystal structures and NMR solution structures of several
BLUF homologs are known. The BLUF domain has a ferredoxin-
like fold comprising a five-stranded β-sheet and two α-helices that
sandwich the FAD chromophore. There are two protein
conformations in the crystal structures (Fig. 6a, b) that vary in the
fold of the β5-strand and in the position of the conserved Trp104
residue that is either solvent-exposed (Trp-out structure) [74]
208 Tatiana Domratcheva et al.
Fig. 6 Protein structure and flavin binding in the BLUF protein. The AppA-BLUF residue numbering is indicated.
(a) and (b): Cartoon representation of the Trp-in (PDB entry: 1YRX) and Trp-out (PDB entry: 2IYG) structures,
respectively. Important residues are shown as balls and sticks. The α2-helix is transparent for better visualiza-
tion of the flavin-binding pocket. (c): Structure of the hydrogen-bonding network around flavin according to the
experimentally determined BLUF structures. Selected distances were averaged over all polypeptide chains
present in the respective PDB files; the PDB subscript indicates the number of chains. In the 2HFN structure
nine chains correspond to the Trp-out conformation and one to the Trp-in conformation. PDB models 3KB2 and
2BUN are solution-NMR structures, whereas the remaining six are X-ray crystal structures. The color-coding
for the distances is explained in a cartoon on the right-hand side. The error bars represent the standard deviation
of the averaging. The gray-shaded background indicates the distances typical for hydrogen bonding
1730
Trp-out N N O
Trp-out Sadeghian et al.
Trp-out
1720 NH
N
Trp-in O4
DARK Trp-out
w C=O4 [cm−1]
1710 OH O NH2
Rieff et al.
Obanayama et al. S
Trp-in
1700
Trp-in
Trp-out
experiment Trp-in
1690 Rieff et al. O
N N
LIGHT
NH
1680 N
Khrenova et al. O4
Trp-in
OH H2N O HN
1670
425 430 435 440 445 450 455
S1 maximum [nm]
NH NH NH
N N N
O4 O4 O4
HN HO
OH O NH2 OH OH HN OH NH HN
HN
Fig. 7 Correlation between the S1 excitation energy and the C=O(4) stretching frequency in the two structural
forms of the BLUF protein together with the hydrogen-bond network structures proposed for the Trp-in and
Trp-out conformations
Fig. 8 Excited states and formation of a radical pair. (a) Excited states of the BLUF protein in the Trp-out
conformation computed by Udvarhelyi et al. [25]. (b) Formation and recombination of the radical pair between
flavin and tyrosine in the BLUF protein
RP min
RP min
CS CS CS
S0 min S0 min S0 min
Fig. 9 Computational characterization of flavin photoreaction pathways. The thick lines represent states in
which geometry optimization is performed. The vertical gray lines indicate the minima at which the excitation
spectrum is computed. The dashed lines connect the energies from the single-point calculations. (a) Salzmann
et al. [15] optimized the geometries in the S0 and S1 states with (TD)-DFT methods. Along a linear-interpolated
path between the S0 and S1 minima, they computed the MRCI energies of the S1, T1, and Tn states. At the cross-
ing between the S1 and Tn states they evaluated the spin-orbit coupling and determined the ISC rate.
( b) Udvarhelyi et al. [25] optimized the geometries with the CASSCF method in all electronic states of interest.
From the S0 min geometry, following the ET-RP state energy gradient, they found the S1 and ET-RP state
crossing (CI). At each optimized minimum and crossing geometry, the XMCQDPT2 correction yields the final
energies. (c) Sadeghian et al. [29] performed geometry optimization in the ET-RP state with the TD-DFT
method. The ET-RP state is the lowest excited state when computed with TD-DFT. Along the optimization path,
they recomputed the excitation energies with the CC2 method which gives the correct state ordering indicated
by the dot-dashed lines. From the single point CC2-energies they inferred the crossing of the S1 and ET-RP
states
PCET
S1 T1 ET-RP S0
N N O N N O N N O N N O
NH NH NH NH
N N N N
H H
O O O O
S
SH SH S
T2/Tn
70
S1
ISC-1
60 T1
energy [kcal/mol]
10 ET-RP
50
T1 min PCET
40
hν
30
ISC-2
20
22-25
C4a-Cys
10 CS
S0min C4a-S dissociation
4.2 Photoreaction In LOV proteins, the oxidized flavin forms a covalent adduct with
of the LOV the side chain of a cysteine (Fig. 10). In spectroscopy studies, the
Photoreceptor reaction is observed as a bleach of the flavin absorption at 450 nm.
The formed excited flavin S1 state is converted to the flavin triplet
T1 state within nanoseconds [35]. The T1 state is observed through
the transient absorbance at 600–700 nm that has a life time of
microseconds [90–92]. The long life times of the flavin S1 and T1
states in LOV allow for the characterization of their vibrational
spectra [35]. The triplet flavin reacts with the cysteine residue,
Computational Spectroscopy, Dynamics, and Photochemistry of Photosensory… 219
which gives rise to the absorption at 390 nm. The covalent adduct
thermally dissociates, recovering the dark state within minutes to
hours.
Several computational studies considered the photochemical
mechanism of LOV photoactivation. Salzmann et al. [14, 15]
demonstrated that formation of the triplet state follows different
mechanisms in the LOV protein and in solution. Instead of the
S1/Tn crossing (described in Subheading 4.1), the S1/T2 crossing
takes place in LOV. The computed S1/T2 ISC rate increases signifi-
cantly if vibronic spin-orbit coupling is taken into account. In addi-
tion, the S1/T2 spin-orbit coupling is enhanced if the cysteine
residue is included in the quantum part of the LOV QM/MM
model. Thus, Salzmann et al. concluded that in LOV, formation of
the flavin triplet state is facilitated by vibronic coupling and by the
sulfur heavy-atom effect [14].
Dittrich et al. computed the formation of the flavin–cysteinyl
covalent adduct for the first time [93] and found that the LOV
photoreaction corresponds to a concerted proton-coupled elec-
tron transfer (PCET). However, they reported rather high energy
barriers along this pathway. Later, Domratcheva et al. demon-
strated that formation and dissociation of the covalent adduct
requires a multi-reference description [24], and with the PT2//
CASSCF method, they obtained reaction barriers in good agree-
ment with the experimentally observed life times. The proposed
LOV photoreaction mechanism (Fig. 10) consists of the following
steps: The triplet flavin abstracts a hydrogen atom from the cyste-
ine, which requires an activation energy of 10 kcal/mol. Initial
photoexcitation of flavin in the S1 state with 450-nm light provides
enough energy for the hydrogen abstraction, as the initial S1
excitation energy is still about 10 kcal/mol higher than the com-
puted energy barrier. The PCET barrier determines the life time of
the triplet flavin in LOV [24]. After the hydrogen abstraction, the
semiquinone and cysteinyl triplet radical pair is formed with an
energy 17 kcal/mol lower than the flavin triplet minimum [24, 93].
In the radical pair, the triplet and singlet energies are close, indicat-
ing a possible ISC [24]. Zenichovski et al. found that the spin-
orbit coupling in the radical pair is rather large, which is favorable
for the efficient formation of the singlet state [46]. The singlet
radical pair is unstable, as there is no radical-pair minimum on the
singlet potential energy surface. Instead there is a barrierless path
corresponding to the formation of the covalent bond in the flavin–
cysteinyl covalent adduct, the LOV photoproduct.
Domratcheva et al. reported the computed S1 excitation energy
of the LOV covalent adduct of 370 nm in agreement with the
experimental absorption maximum [24]. They also considered
the dissociation of the covalent adduct along a reaction coordinate,
which is the reverse of the photoreaction pathway—the disso-
ciation of the C(4a)–S bond followed by hydrogen transfer.
220 Tatiana Domratcheva et al.
They found that the energy of the isolated covalent adduct is rather
low compared to the energy of the covalent adduct within the
LOV protein reported by Dittrich et al. [93]. On the basis of the
energy comparison, Domratcheva et al. proposed that the dissocia-
tion is facilitated not chemically, but rather mechanically by the
protein forces destabilizing the C(4a)–S bond [24]. An alternative
dissociation mechanism was considered by Lanzl et al. who found
that either protonation of the sulfur atom or deprotonation of the
N(5)H group results in spontaneous dissociation of the C(4a)–S
covalent bond [72].
4.3 Photoreaction In BLUF photoreceptors, the decay of the flavin S1 state is described
of BLUF Photoreceptor by a multiexponential kinetic model [94]. The vibrational spectra
of the S1 flavin are reported for both the dark and light states of the
protein [76, 95, 96]. The yield of the flavin T1 state is insignificant
and plays no role in BLUF photochemistry [97]. Fluorescence
quenching by electron transfer from the nearby Tyr21 or Trp104
residues is observed [78, 94, 98]. The experiments in D2O demon-
strated that the photoinduced electron transfer is accompanied by
proton transfer [94]. The BLUF light state is formed on the nano-
second time scale. The spontaneous thermal recovery of the dark
state takes several seconds or minutes.
Sadeghian et al. [27] and Udvarhelyi et al. [25] computed the
BLUF photoreaction starting from the Trp-out conformation as
the dark state (Fig. 11). Upon blue-light absorption, the flavin S1
state is populated. The ET-RP state, corresponding to electron
transfer from Tyr21 to the flavin, has a higher energy than the
excited flavin S1 state at the Franck–Condon S0 geometry. The
ET-RP state that lies higher in energy than the S1 state is a com-
mon feature of photoactive flavoproteins including BLUF, LOV,
cryptochromes and photolyases [25, 27, 28, 79, 99, 100].
Udvarhelyi et al. found a pathway along which the S1 and ET-RP
states cross [25]. This pathway corresponds to the photoinduced
electron transfer (PET) reaction yielding a radical pair. The respec-
tive reaction coordinate includes the changes of flavin and Tyr21
bond lengths from the closed-shell to the radical geometries as well
as the shortening of the hydrogen bonds according to the charge
redistribution. After electron transfer, proton transfer from Tyr21
to flavin mediated by Gln63 decreases the energy of the radical pair
but increases the energy of the closed-shell ground state [25, 27].
The minimum, corresponding to the neutral radical pair, is found
in the ground state as the system goes through the ET-RP/CS
state crossing. The neutral radical pair includes the semiquinone
and tyrosyl radicals and notably the tautomeric Gln63. The energy
of the neutral radical pair minumum is 16 kcal/mol lower than the
energy of the singlet excited flavin (S1 minimum) and about
40 kcal/mol higher than the energy of the dark state (S0 mini-
mum). Similar to the LOV domain, formation of the radical pair in
Computational Spectroscopy, Dynamics, and Photochemistry of Photosensory… 221
PCET1 PCET2
S1 ET-RP ET-RP S0
N N O N N O N N O N N O
NH NH N NH NH
N N N
O H O
O O
OH O NH2 OH O NH2 O HO NH OHHN OH
Tyr21 Gln63
100
ET-RP
90
80
S1
70
energy [kcal/mol]
S1
60 min
PET
50
RP min
40
PCET1 PCET2
hν
30 tautomeric
Gln
20 CS
S0
10 min
5 Conclusions
Acknowledgments
References
25. Udvarhelyi A, Domratcheva T (2011) 37. Martin CB, Tsao ML, Hadad CM, Platz MS
Photoreaction in BLUF receptors: proton- (2002) The reaction of triplet flavin with
coupled electron transfer in the flavin-Gln-Tyr indole. A study of the cascade of reactive
system. Photochem Photobiol 87:554–563 intermediates using density functional theory
26. Solov’yov IA, Domratcheva T, Shahi ARM, and time resolved infrared spectroscopy. J Am
Schulten K (2012) Decrypting cryptochrome: Chem Soc 124:7226–7234
revealing the molecular identity of the photo- 38. Rieff B, Bauer S, Mathias G, Tavan P (2011)
activation reaction. J Am Chem Soc 134: IR spectra of flavins in solution: DFT/MM
18046–18052 description of redox effects. J Phys Chem B
27. Sadeghian K, Bocola M, Schütz M (2008) A 115:2117–2123
conclusive mechanism of the photoinduced 39. Unno M, Sano R, Masuda S, Ono TA,
reaction cascade in blue light using flavin Yamauchi S (2005) Light-induced structural
photoreceptors. J Am Chem Soc 130: changes in the active site of the BLUF domain
12501–12513 in AppA by Raman spectroscopy. J Phys
28. Sadeghian K, Bocola M, Schütz M (2010) A Chem B 109:12620–12626
QM/MM study on the fast photocycle of 40. Tomasi J, Mennucci B, Cammi R (2005)
blue light using flavin photoreceptors in their Quantum mechanical continuum solvation
light-adapted/active form. Phys Chem Chem models. Chem Rev 105:2999–3094
Phys 12:8840–8846 41. Klamt A, Schüürmann G (1993) COSMO: a
29. Sadeghian K, Schütz M (2007) On the pho- new approach to dielectric screening in sol-
tophysics of artificial blue-light photorecep- vents with explicit expressions for the screen-
tors: an ab initio study on a flavin-based dye ing energy and its gradient. J Chem Soc Perkin
dyad at the level of coupled-cluster response Trans 2:799–805
theory. J Am Chem Soc 129:4068–4074 42. Warshel A, Levitt M (1976) Theoretical stud-
30. Taylor WJ (1954) Distribution of kinetic and ies of enzymic reactions: dielectric, electro-
potential energy in vibrating molecules. J Chem static and steric stabilization of the carbonium
Phys 22:1780 ion in the reaction of lysozyme. J Mol Biol
31. Pulay P, Fogarasi G (1992) Geometry optimi- 103:227–249
zation in redundant internal coordinates. 43. Rieff B, Bauer S, Mathias G, Tavan P (2011)
J Chem Phys 96:2856–2860 DFT/MM description of flavin IR spectra in
32. Wolf MMN, Schumann C, Gross R, BLUF domains. J Phys Chem B 115:
Domratcheva T, Diller R (2008) Ultrafast 11239–11253
infrared spectroscopy of riboflavin: dynamics, 44. Rieff B, Mathias G, Bauer S, Tavan P (2011)
electronic structure, and vibrational mode Density functional theory combined with
analysis. J Phys Chem B 112:13424–13432 molecular mechanics: the infrared spectra of
33. Wolf MMN, Zimmermann H, Diller R, flavin in solution. Photochem Photobiol
Domratcheva T (2011) Vibrational mode 87:511–523
analysis of isotope-labeled electronically 45. Sikorska E, Khmelinskii I, Komasa A, Koput
excited riboflavin. J Phys Chem B 115: J, Ferreira LFV, Herance JR, Bourdelande JL,
7621–7628 Williams SL, Worrall DR, Insinska-Rak M,
34. Klaumünzer B, Kröner D, Saalfrank P (2010) Sikorski M (2005) Spectroscopy and photo-
(TD-)DFT calculation of vibrational and physics of flavin related compounds: ribofla-
vibronic spectra of riboflavin in solution. J Phys vin and iso-(6,7)-riboflavin. Chem Phys
Chem B 114:10826–10834 314:239–247
35. Alexandre MTA, Domratcheva T, Bonetti C, 46. Zenichowski K, Gothe M, Saalfrank P (2007)
van Wilderen LJGW, van Grondell R, Groot Exciting flavins: absorption spectra and spin-
ML, Hellingwerf KJ, Kennis JTM (2009) orbit coupling in light-oxygen-voltage (LOV)
Primary reactions of the LOV2 domain of domains. J Photochem Photobiol A Chem
phototropin studied with ultrafast mid- 190:290–300
infrared spectroscopy and quantum chemis- 47. Haigney A, Lukacs A, Zhao RK, Stelling AL,
try. Biophys J 97:227–237 Brust R, Kim RR, Kondo M, Clark I, Towrie
36. Martin CB, Shi XF, Tsao ML, Karweik D, M, Greetham GM, Illarionov B, Bacher A,
Brooke J, Hadad CM, Platz MS (2002) The Römisch-Margl W, Fischer M, Meech SR,
photochemistry of riboflavin tetraacetate and Tonge PJ (2011) Ultrafast infrared spectros-
nucleosides. A study using density functional copy of an isotope-labeled photoactivatable
theory, laser flash photolysis, fluorescence, flavoprotein. Biochemistry 50:1321–1328
UV-vis, and time resolved infrared spectros- 48. Merz T, Sadeghian K, Schütz M (2011)
copy. J Phys Chem B 106:10263–10271 Why BLUF photoreceptors with roseoflavin
226 Tatiana Domratcheva et al.
cofactors lose their biological functionality. 62. Zoltowski BD, Schwerdtfeger C, Widom J,
Phys Chem Chem Phys 13:14775–14783 Loros JJ, Bilwes AM, Dunlap JC, Crane BR
49. Choe YK, Nagase S, Nishimoto K (2007) (2007) Conformational switching in the
Theoretical study of the electronic spectra of fungal light sensor vivid. Science
oxidized and reduced states of lumiflavin and 316:1054–1057
its derivative. J Comput Chem 28:727–739 63. Salomon M, Lempert U, Rüdiger W (2004)
50. Ghisla S, Massey V, Lhoste JM, Mayhew SG Dimerization of the plant photoreceptor pho-
(1974) Fluorescence and optical characteris- totropin is probably mediated by the LOV1
tics of reduced flavins and flavoproteins. domain. FEBS Lett 572:8–10
Biochemistry 13:589–597 64. Harper SM, Neil LC, Gardner KH (2003)
51. Walsh JD, Miller AF (2003) Flavin reduction Structural basis of a phototropin light switch.
potential tuning by substitution and bending. Science 301:1541–1544
J Mol Struct Theochem 623:185–195 65. Peter E, Dick B, Baeurle SA (2010)
52. Harbach PHP, Borowka J, Bohnwagner MV, Mechanism of signal transduction of the
Dreuw A (2010) DNA (6-4) photolesion LOV2-Jalpha photosensor from Avena sativa.
repair occurs in the electronic ground state of Nat Commun 1:122
the TT dinucleotide dimer radical anion. J Phys 66. Peter E, Dick B, Baeurle SA (2011) Effect of
Chem Lett 1:2556–2560 computational methodology on the confor-
53. Sadeghian K, Bocola M, Merz T, Schütz M mational dynamics of the protein photosensor
(2010) Theoretical study on the repair mecha- LOV1 from Chlamydomonas reinhardtii. J
nism of the (6-4) photolesion by the (6-4) pho- Chem Biol 4:167–184
tolyase. J Am Chem Soc 132:16285–16295 67. Peter E, Dick B, Baeurle SA (2012)
54. Freddolino PL, Dittrich M, Schulten K Illuminating the early signaling pathway of a
(2006) Dynamic switching mechanisms in fungal light-oxygen-voltage photoreceptor.
LOV1 and LOV2 domains of plant phototro- Proteins 80:471–481
pins. Biophys J 91:3630–3639 68. Peter E, Dick B, Baeurle SA (2012) Signals of
55. Neiss C, Saalfrank P (2004) Molecular LOV1: a computer simulation study on the
dynamics simulation of the LOV2 domain wildtype LOV1-domain of Chlamydomonas
from Adiantum capillus-veneris. J Chem Inf reinhardtii and its mutants. J Mol Model
Comput Sci 44:1788–1793 18:1375–1388
56. Masson F, Laino T, Rothlisberger U, Hutter J 69. Peter E, Dick B, Baeurle SA (2012) Signaling
(2009) A QM/MM investigation of thymine pathway of a photoactivable Rac1-GTPase in
dimer radical anion splitting catalyzed by DNA the early stages. Proteins 80:1350–1362
photolyase. ChemPhysChem 10:400–410 70. Lingenheil M, Denschlag R, Reichold R,
57. Condic-Jurkic K, Smith AS, Zipse H, Smith Tavan P (2008) The “hot-solvent/cold-
DM (2012) The protonation states of the solute” problem revisited. J Chem Theory
active-site histidines in (6-4) photolyase. Comput 4:1293–1306
J Chem Theory Comput 8:1078–1091 71. Lanzl K, Noll G, Dick B (2008) LOV1 pro-
58. Humphrey W, Dalke A, Schulten K (1996) tein from Chlamydomonas reinhardtii is a
VMD: visual molecular dynamics. J Mol template for the photoadduct formation of
Graph 14:33–38 FMN and methylmercaptane. ChemBioChem
59. Fedorov R, Schlichting I, Hartmann E, 9:861–864
Domratcheva T, Fuhrmann M, Hegemann P 72. Lanzl K, von Sanden-Flohe M, Kutta RJ,
(2003) Crystal structures and molecular mech- Dick B (2010) Photoreaction of mutated
anism of a light-induced signaling switch: the LOV photoreceptor domains from
Phot-LOV1 domain from Chlamydomonas Chlamydomonas reinhardtii with aliphatic
reinhardtii. Biophys J 84:2474–2482 mercaptans: implications for the mechanism
60. Halavaty AS, Moffat K (2007) N- and of wild type LOV. Phys Chem Chem Phys
C-terminal flanking regions modulate light- 12:6594–6604
induced signal transduction in the LOV2 73. Song SH, Freddolino PL, Nash AI, Carroll
domain of the blue light sensor phototropin 1 EC, Schulten K, Gardner KH, Larsen DS
from Avena sativa. Biochemistry (2011) Modulating LOV domain photody-
46:14001–14009 namics with a residue alteration outside the
61. Crosson S, Moffat K (2002) Photoexcited chromophore binding site. Biochemistry
structure of a plant photoreceptor domain 50:2411–2423
reveals a light-driven molecular switch. Plant 74. Jung A, Reinstein J, Domratcheva T,
Cell 14:1067–1075 Schoeman RL, Schlichting I (2006) Crystal
Computational Spectroscopy, Dynamics, and Photochemistry of Photosensory… 227
structures of the AppA BLUF domain protein light sensors. J Phys Chem B 117:
photoreceptor provide insights into blue 2369–2377
light-mediated signal transduction. J Mol 85. Iwata T, Watanabe A, Iseki M, Watanabe M,
Biol 362:717–732 Kandori H (2011) Strong donation of the
75. Anderson S, Dragnea V, Masuda S, Ybe J, hydrogen bond of tyrosine during photoacti-
Moffat K, Bauer C (2005) Structure of a vation of the BLUF domain. J Phys Chem
novel photoreceptor, the BLUF domain of Lett 2:1015–1019
AppA from Rhodobacter sphaeroides. 86. Udvarhelyi A, Domratcheva T (2013)
Biochemistry 44:7998–8005 Glutamine rotamers in BLUF photorecep-
76. Lukacs A, Haigney A, Brust R, Zhao RK, tors: a mechanistic reappraisal. J Phys Chem B
Stelling AL, Clark IP, Towrie M, Greetham 117:2888–2897
DM, Meech SR, Tonge PJ (2011) 87. Grinstead JS, Hsu S-TD, Laan W, Bonvin
Photoexcitation of the blue light using FAD AMJJ, Hellingwerf KJ, Boelens R, Kaptein R
photoreceptor AppA results in ultrafast (2006) The solution structure of the AppA
changes to the protein matrix. J Am Chem BLUF domain: insight into the mechanism of
Soc 133:16893–16900 light-induced signaling. ChemBioChem
77. Unno M, Masuda S, Ono TA, Yamauchi S 7:187–193
(2006) Orientation of a key glutamine resi- 88. Jung A, Domratcheva T, Tarutina M, Wu Q,
due in the BLUF domain from AppA revealed Ko WH, Shoeman RL, Gomelsky M, Gardner
by mutagenesis, spectroscopy, and quantum KH, Schlichting I (2005) Structure of a bac-
chemical calculations. J Am Chem Soc terial BLUF photoreceptor: insights into blue
128:5638–5639 light-mediated signal transduction. Proc Natl
78. Unno M, Kikuchi S, Masuda S (2010) Acad Sci U S A 102:12350–12355
Structural refinement of a key tryptophan 89. El-Sayed MA (1968) Triplet state. Its radia-
residue in the BLUF photoreceptor AppA by tive and nonradiative properties. Acc Chem
ultraviolet resonance Raman spectroscopy. Res 1:8–16
Biophys J 98:1949–1956 90. Kottke T, Heberle J, Hehn D, Dick B,
79. Domratcheva T, Grigorenko BL, Schlichting Hegemann P (2003) Phot-LOV1: photocycle
I, Nemukhin AV (2008) Molecular models of a blue-light receptor domain from the
predict light-induced glutamine tautomeriza- green alga Chlamydomonas reinhardtii.
tion in BLUF photoreceptors. Biophys J Biophys J 84:1192–1201
94:3872–3879 91. Kennis JTM, Crosson S, Gauden M, van
80. Götze J, Saalfrank P (2009) Serine in BLUF Stokkum IHM, Moffat K, van Grondelle R
domains displays spectral importance in com- (2003) Primary reactions of the LOV2
putational models. J Photochem Photobiol B domain of phototropin, a plant blue-light
94:87–95 photoreceptor. Biochemistry 42:3385–3392
81. Khrenova MG, Domratcheva T, Schlichting I, 92. Swartz TE, Corchnoy SB, Christie JM, Lewis
Grigorenko BL, Nemukhin AV (2011) JW, Szundi I, Briggs WR, Bogomolni RA
Computational characterization of reaction (2001) The photocycle of a flavin-binding
intermediates in the photocycle of the sensory domain of the blue light photoreceptor pho-
domain of the AppA blue light photorecep- totropin. J Biol Chem 276:36493–36500
tor. Photochem Photobiol 87:564–573 93. Dittrich M, Freddolino PL, Schulten K
82. Meier K, Thiel W, van Gunsteren WF (2012) (2005) When light falls in LOV: a quantum
On the effect of a variation of the force field, mechanical/molecular mechanical study of
spatial boundary condition and size of the photoexcitation in Phot-LOV1 of
QM region in QM/MM MD simulations. Chlamydomonas reinhardtii. J Phys Chem B
J Comput Chem 33:363–378 109:13006–13013
83. Obanayama K, Kobayashi H, Fukushima K, 94. Gauden M, van Stokkum IHM, Key JM,
Sakurai M (2008) Structures of the chromo- Lührs DC, van Grondelle R, Hegemann P,
phore binding sites in BLUF domains as stud- Kennis JTM (2006) Hydrogen-bond switch-
ied by molecular dynamics and quantum ing through a radical pair mechanism in a
chemical calculations. Photochem Photobiol flavin-binding photoreceptor. Proc Natl Acad
84:1003–1010 Sci U S A 103:10895–10900
84. Khrenova MG, Nemukhin AV, Domratcheva 95. Bonetti C, Mathes T, van Stokkum IHM,
T (2013) Photoinduced electron transfer Mullen KM, Groot ML, van Grondelle R,
facilitates tautomerization of the conserved Hegemann P, Kennis JTM (2008) Hydrogen
signaling glutamine side chain in BLUF bond switching among flavin and amino
228 Tatiana Domratcheva et al.
acid side chains in the BLUF photoreceptor 99. Izmaylov AF, Tully JC, Frisch MJ (2009)
observed by ultrafast infrared spectroscopy. Relativistic interactions in the radical pair
Biophys J 95:4790–4802 model of magnetic field sense in CRY-1 pro-
96. Stelling AL, Ronayne KL, Nappa J, Tonge PJ, tein of Arabidopsis thaliana. J Phys Chem A
Meech SR (2007) Ultrafast structural dynam- 113:12276–12284
ics in BLUF domains: transient infrared spec- 100. Domratcheva T (2011) Neutral histidine
troscopy of AppA and its mutants. J Am Chem and photoinduced electron transfer in DNA
Soc 129:15556–15564 photolyases. J Am Chem Soc 133:
97. Bonetti C, Stierl M, Mathes T, van Stokkum 18172–18182
IHM, Mullen KM, Cohen-Stuart TA, van 101. Toh KC, van Stokkum IHM, Hendriks J,
Grondelle R, Hegemann P, Kennis JTM Alexandre MTA, Arenths JC, Perez MA, van
(2009) The role of key amino acids in the Grondelle R, Hellingwerf KJ, Kennis JTM
photoactivation pathway of the Synechocystis (2008) On the signaling mechanism and the
Slr1694 BLUF domain. Biochemistry 48: absence of photoreversibility in the AppA
11458–11469 BLUF domain. Biophys J 95:312–321
98. Dragnea V, Arunkumar AI, Yuan H, Giedroc 102. Mathes T, van Stokkum IHM, Stierl M,
DP, Bauer CE (2009) Spectroscopic studies Kennis JTM (2012) Redox modulation of fla-
of the AppA BLUF domain from Rhodobacter vin and tyrosine determines photoinduced
sphaeroides: addressing movement of trypto- proton-coupled electron transfer and photo-
phan 104 in the signaling state. Biochemistry activation of BLUF photoreceptors. J Biol
48:9969–9979 Chem 287:31725–31738
Chapter 11
Abstract
1
H-, 11B-, 13C-, 15N-, 17O-, 19F-, and 31P-NMR chemical shifts of flavocoenzymes and derivatives of it, as
well as of alloxazines and isoalloxazinium salts, from NMR experiments performed under various experi-
mental conditions (e.g., dependence of the chemical shifts on temperature, concentration, solvent polarity,
and pH) are reported. Also solid-state 13C- and 15N-NMR experiments are described revealing the aniso-
tropic values of corresponding chemical shifts. These data, in combination with a number of coupling
constants, led to a detailed description of the electronic structure of oxidized and reduced flavins. The data
also demonstrate that the structure of oxidized flavin can assume a configuration deviating from coplanar-
ity, depending on substitutions in the isoalloxazine ring, while that of reduced flavin exhibits several con-
figurations, from almost planar to quite bended. The complexes formed between oxidized flavin and metal
ions or organic molecules revealed three coordination sites with metal ions (depending on the chemical
nature of the ion), and specific interactions between the pyrimidine moiety of flavin and organic molecules,
mimicking specific interactions between apoflavoproteins and their coenzymes.
Most NMR studies on flavoproteins were performed using 13C- and 15N-substituted coenzymes,
either specifically enriched in the pterin moiety of flavin or uniformly labeled flavins. The chemical shifts of
free flavins are used as a guide in the interpretation of the chemical shifts observed in flavoproteins.
Although the hydrogen-bonding pattern in oxidized and reduced flavoproteins varies considerably, no
correlation is obvious between these patterns and the corresponding redox potentials. In all reduced flavo-
proteins the N(1)H group of the flavocoenzyme is deprotonated, an exception is thioredoxin reductase.
Three-dimensional structures of only a few flavoproteins, mostly belonging to the family of flavodoxins,
have been solved. Also the kinetics of unfolding and refolding of flavodoxins has been investigated by
NMR techniques. In addition, 31P-NMR data of all so far studied flavoproteins and some 19F-NMR spectra
are discussed.
Key words NMR, Chemical shift, Electronic structure, Electron transfer, Flavodoxin
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_11, © Springer Science+Business Media New York 2014
229
230 Franz Müller
2.1 General Remarks Table 1 summarizes some useful properties of nuclides, which are
part of this presentation. The reference compounds shown for
each nuclide are those recommended or preferred by the IUPAC
[34, 35]. All chemical shifts listed in this chapter are referenced to
these compounds (1H, 13C, 15N, 17O, 31P). 15N chemical shifts are
232 Franz Müller
Table 1
Some properties of nuclides discussed in this chapter
Property Nuclide
Name and Hydrogen Carbon-13 Nitrogen-15 Phosphorus-31 Fluorine-19 Oxygen-17 Boron-11
symbol 1 13 15 31 19 17 11
H C N P F O B
a
Tetramethylsilane
b
Sodium 2,2-dimethyl-2-silapentane-5-sulfonate [3-(trimethylsilyl)propane-1-sulfonate]
R' H
9a N 10a N O N N O
9 10 1 2
8
7 3N
6
5a
5
4a 4 H N H
N N R'
O O
2 N N O
1 R' = CH3 = Lumiflavin
3 R' = Ribityl = Riboflavin N H
4 R' = Ribityl-5'-phosphate = FMN
O
5 R' = Riboflavin 5'-adenosine diphosphate = FAD
6 R' = Ribityl
Scheme 1 Chemical structures of various isoalloxazines and alloxazines in the neutral and cationic oxidized
states
2.2 1H-NMR Studies The first detailed 1H-NMR studies on flavins were those on FAD
on Oxidized Flavins and FMN. Although only limited information can be obtained on
the isoalloxazine moiety of flavins by 1H-NMR, FAD and FMN
were investigated because of their biological relevance [46–50].
Bullock and Jardetzky unambiguously assigned the methyl groups
at positions 7 and 8 in FMN [46]. Also the two resonances at low
field of the FMN spectrum were assigned, namely to C(6)H and
C(9)H. However, the latter assignments were later questioned
[47, 50] when FAD was investigated by 1H-NMR. Thus it has
been shown that dilution of FAD samples leads to downfield shifts
of both resonances of the aromatic protons, the chemical shift dif-
ference becoming very small. Increasing the concentration or tem-
perature affects the two resonances, merging almost into one single
peak [48, 50]. Also the C(7,8)-methyl groups are affected by tem-
perature and concentration, but to a lesser extent than the aromatic
protons, and the order of the two resonances remains unchanged
[47–50].
From the NMR data on FAD it was concluded that the mole-
cule forms intramolecular as well as intermolecular complexes.
While stacking of FAD (intramolecular complex) was favored by all
groups, the data interpretation with regard to the intermolecular
complex formation differed: Kotowycz et al. proposed a vertical
interaction between two FAD molecules [48]; Kainosho and
Kyogoku proposed a model differing slightly in the overlap
between the adenine and the flavin moieties [49]. Raszka and
Kaplan, on the other hand, favored an intermolecular complex
where the adenine part of flavin formed hydrogen bonds with the
N(3)H and C(4)O atoms [50]. It should also be mentioned that
the NMR study of Kainosho and Kyogoku furthermore provided
information and assignments of protons in the ribityl side chain
and of the adenine protons of the molecule [49]. These data were
supplemented with the corresponding coupling constants. The lat-
ter study also revealed the magnetic nonequivalence of the methy-
lene protons at C(1′) [49].
1
H-NMR chemical shifts of FAD, FMN, Rfl, and some flavin
derivatives are presented in Table 2. We have undertaken a study
using three classes of compounds: isoalloxazines, alloxazines, and
flavinium salts (for structures see Scheme 1) [51]. In all three
classes, a number of derivatives have been synthesized and studied
by NMR in order to gain more basic insights into the electronic
properties of flavins. Tetraacetylriboflavin (TARF) was used because
Table 2
1
H-NMR chemical shifts (δ in ppm) of various flavins in the oxidized state
Atom
Compound (Nr.,
Scheme 1) C(6)H C(9)H CH3(7) CH3(8) N(10)CH3/CH2 N(1)CH3 N(3)CH3/H C(5)H/C(1)H Solvent Ref.
1 7.91 7.64 2.43 2.53 4.00 – 3.35 – CD3CN-d3 [51]
2 7.94 7.77 2.50 2.53 – 3.69 3.44 – CD3CN-d3 [51]
3 7.84 7.78 2.36a 2.45a 3.64/4.25 – 11.32 – DMSO-d6 [52]
4 7.62 7.43 2.30 2.44 4.54/4.94 – – – D2O, pH 8 [36, 49]
5 7.11 7.34 2.05 2.17 4.20/4.73 – – – D2O, pH 7 [49]
TARF 8.04 7.57 2.45 2.57 4.90/5.15 – 8.43, 11.38 – CDCl3, [53, 54]
DMSO
6 7.94 7.86 2.34 2.45 n.a.b – 11.05 8.84 DMSO-d6 [55]
7 7.77 7.06 2.27 2.37 3.84 – 8.27 5.31 CDCl3-d1 [56]
8 8.33 7.90 2.59 2.68 5.22 4.73 3.46 – CD3CN-d3 [51]
9 8.23 8.07 2.58 2.69 4.37 3.77 3.46 – CD3CN-d3 [51]
10 8.28 8.14 2.59 2.71 4.50 – 3.55 4.38 C(2)OCH3 CD3CN-d3 [51]
11 8.31 8.23 2.63 2.76 4.62 – – 4.39 C(2)OCH3 CD3CN-d3 [51]
4.33 C(4)OCH3
(continued)
NMR Spectroscopy on Flavins and Flavoproteins
235
Table 2
236
(continued)
Atom
Compound (Nr.,
Scheme 1) C(6)H C(9)H CH3(7) CH3(8) N(10)CH3/CH2 N(1)CH3 N(3)CH3/H C(5)H/C(1)H Solvent Ref.
Franz Müller
12 8.25 7.98 2.59 2.65 3.42 – 4.20 1.81 N(5)CH3, CD3CN-d3 [57]
5.00/6.10
N(5)CH2
Side chain of C(2′)H C(3′)H C(4′)H C(5′)H C(2′)COCH3 C(3′)COCH3 C(4′)COCH3 C(5′)COCH3
3 4.78 4.48 4.58 5.11/4.85 DMSO-d6 [52, 58]
4 4.30 3.85 3.98 3.95/4.00 D2O, pH 7 [49]
c
5 4.36 3.99 4.08 4.18/4.30 D2O [59]
TARF 5.69 5.45 5.42 4.24/4.44 1.72 2.21 2.30 2.05 CDCl3-d1 [53, 60]
a
Published values interchanged
b
Not available
c
The chemical shifts of the ribose-adenine moiety are: AC(8)H = 8.16; AC(2)H = 7.71; AC(1′)H = 5.81; AC(2′)H = 4.55; AC(3′)H = 4.51; AC(4′)H = 4.34;
AC(5′)H = 4.27 [49]
NMR Spectroscopy on Flavins and Flavoproteins 237
also involved in binding to the metal ion [60]. Similar results were
obtained with Gd(III) and Mo(IV), thus supporting the notion
that flavin–metal chelation involves possibly three sites of which
two are stated: the primary site at the flavin N(5)–O(4α) and the
ribityl side chain. The complex was also investigated by X-ray tech-
niques [93]; the structure deduced from NMR spectra was con-
firmed. In addition, an alternative structure was proposed wherein
a negative charge is placed on N(5). A Mo(V) riboflavin complex
has been investigated by 1H-NMR and other methods [93]. As
seen in Table 3, the most affected proton resonances are those of
C(2′)H and C(5′)H exhibiting downfield shifts of up to 2.5 ppm;
all other resonances are much less affected (<0.35 ppm). The crys-
tallographic investigation indicated interaction of Mo(V) with fla-
vin at the N(5) position only. Despite this fact, the resonance lines
due to protons located close to the coordination site are, in con-
trast to what has been observed with other flavin–metal complexes,
very little affected. The most affected protons are those belonging
to the side chain indicating either preferable interaction at these
sites or a combination of primary complexation site with the side
chain as already mentioned above [60]. In the paper by Malele
et al., 1H-NMR spectra of oxidized and reduced riboflavin in
DMSO-d6 were presented [93]. The low-field peaks in the spec-
trum of the reduced flavin can be assigned to N(3)H and N(5)H.
Unexpectedly, the chemical shifts of the other atoms are usually
upfield shifted in reduced flavin as compared to those of oxidized
one. This is not very obvious in the spectra.
Of the metal complexes discussed above, X-ray data are avail-
able for Ag(I) [94–96], Cu(II) [97], and Cu(I) [98]. The crystals
obtained with Ag(I) and lumiflavin (1) demonstrate the interac-
tion of Ag(I) with flavin at the primary chelation site binding two
flavin molecules; the secondary sites (O(2α), N(1)) are occupied
by nitrate/nitrite ions and/or a water molecule. Using riboflavin
(3), the primary site is occupied by one Ag(I) ion, another Ag(I)
ion interacts with the ribityl side chain via O(2α), N(1), and
OC(2′). In the Cu(II)–riboflavin complex [97] there are two inde-
pendent Cu(II) ions: one occupies the primary and secondary
sites, and in the other only the primary site is occupied by the fla-
vin, at the secondary site one water molecule is located. In the
Cu(I) complex [98] there are also two flavin molecules coordi-
nated with one metal ion.
Table 4
1
H NMR chemical shifts (δ in ppm) of two-electron reduced flavins
Atom
Franz Müller
N R’ N CH3 N CH3
N N N
R O O CH3 O
13 14 15
R = benzoyl
R' = benzyl
CH3 H CH3
N N O N N
– O N N O
N CH3 + N CH3 N H
N N F3C N
16 O 17 O 18 Ac O Ac = Acetyl
R
N N O N N O X N N O
N H N H N CH3
F3C N N N
19 H O 20 O ClO4– O
21
+P(C6H5)3
Scheme 2 Chemical structures of some alloxazines and isoalloxazines in the 1,5- and 4a,5-dihydro states
was not, or to a much lesser degree, seen for the other protons of
the propane group. The results have been interpreted to be prob-
ably a consequence of the hindered inversion at the N(5) center
[105].
13
2.4 13C and 15N-NMR C-NMR chemical shifts are providing much more detailed infor-
Studies on Oxidized mation on the electronic structure of a molecule than 1H-NMR
Flavins chemical shifts. This is related to the observation, and is supported
by theoretical calculations (see, e.g., [106]), that the 13C chemical
shifts reflect the electron distribution in a molecule quite reliably as
compared to the 1H chemical shifts. This observation is based on
the fact that 13C chemical shifts are dominated by paramagnetic
effects, which are proportional to the π-electron charge densities in
the carbon 2pz orbitals. The 13C chemical shifts of FMN (4) and
Rfl (3) reported in this chapter have been ascertained by isotopic
substitution, and therefore, can be used as reference for the assign-
ments in other flavins (see ref. 107 and references therein). This
has led to the reassignment of some chemical shifts published by
other groups. If so they are marked by a footnote or mentioned in
the text.
To understand the chemical and electronic properties of flavins
in detail, 15N-NMR chemical shift data is required. To lay a basic
fundament for investigations with proteins, we have studied flavins
depending on concentration, solvent polarity, substitution of the
molecule, and redox state.
15
N chemical shifts are good reporters on structural variations
related to environmental changes. Flavin contains four nitrogen
atoms, which have been characterized as pyridine- or β-type nitro-
gen (N(1), N(5)) in the oxidized state and pyrrole- or α-type
nitrogen (N(10), N(3)) in the oxidized state, and all four nitro-
gens in the two-electron reduced state. This characterization of the
15
N chemical shifts of flavin is supported by the fact that the shifts
fall in the range of the two molecules. The 15N chemical shifts are
excellent reporters for hydrogen-bonding interaction (pyridine-
type, upfield shift) and in the reduced state yield information on
the degree of sp2 or sp3 hybridization, state of protonation/depro-
tonation, but are less sensitive to hydrogen-bonding interaction.
In Table 5, 13C and 15N chemical shifts of compounds of differ-
ent structures are presented. The combination of 13C- and 15N-
NMR spectroscopy should be useful in obtaining rather detailed
insight into the electronic structure of these compounds and con-
sequently on their chemistry. The assignment of resonance lines in
a complex spectrum, like that of flavin, can be difficult, especially
the assignments of lines arising from quaternary carbon atoms. To
ascertain a correct assignment, we have made use of selectively
enriched 13C atoms [40, 107, 108] or replacement of protons by
deuterons [40]. It should however be recognized that the reso-
nance line of C(4a) is not always easily detected, even when it is
Table 5
13
C and 15N NMR chemical shifts (in ppm) of (iso)alloxazines in the oxidized state (all values in ppm)
Compound
Compound
R R
∗ N ∗ N O N N O
∗ ∗ ∗
∗
∗
∗ ∗ N R
∗ ∗ N R
N N
1a O 2a O
N N O
H O
N
N
N H
N
1b O
H
N
which are about two orders of magnitude more acidic than that of
N(3)H in isoalloxazine [115]. The chemical shifts of the C(4a)
and C(10a) atoms are much more alike in alloxazine than in isoal-
loxazine, whereas those of C(2) and C(4) are more alike in isoal-
loxazine than in alloxazine. This proves that both carbonyl groups
of isoalloxazine and only the C(4)O of alloxazine are participating
in the conjugation of the ring systems. The addition of a methyl
group, e.g., in 1 at C(9), leads to strong perturbation of the C(9a)
resonance, not observed in an analog substitution in alloxazine
[40]. This is in support of the 1H-NMR data where it has been
concluded that such substitutions have an influence on the planar-
ity of the benzene subnucleus owing to overcrowding effects in the
N(10)–C(9) region of the molecule, becoming somewhat tilted.
The dependence of the chemical shifts of flavins on solvent
polarity is best demonstrated by comparison of the data of TARF
in chloroform with those of FMN in aqueous solution (see Table 5).
Although chloroform is weakly hydrogen-bond donating, it has
been used because it allows the preparation of highly concentrated
solutions. Nevertheless, conclusions have been drawn from these
data regarding specific hydrogen-bonding interactions with the fla-
vin. This concept has been applied to NMR studies on flavoproteins
to characterize qualitatively the interaction between apoflavoprotein
and its coenzyme. Despite some objections to this approach, we
believe it to be still a useful guide for this particular purpose; a quan-
titative description of the hydrogen-bonding interaction would
however require further data. Anyhow, from Table 5 (last column) it
can be seen that all chemical shifts, except that due to C(6), are
downfield shifted in going from chloroform to aqueous solution.
The sequence of the downfield shifts is, in decreasing order, C(2) ~
C(4) > C(7) ~ C(8) > C(9) ~ C(9a) > C(5a) ~ C(4a) ~ C(10a). The 15N
chemical shifts most affected are those due to N(1) and N(5), both
shifted upfield by about 10 ppm. The large changes of the chemical
shifts of C(2), C(4), N(1), and N(5) provide strong support for
hydrogen-bonding interactions at these specific sites of the flavin
molecule. A detailed interpretation of the chemical shifts and their
relation to the derived electronic (mesomeric) structures of the
flavin has been published [111]. Exceptionally, the 13C-NMR spec-
trum of a biologically relevant modified coenzyme, 8α-N-
imidazolyl-TARF, is available [68]. A comparison of these chemical
shifts with those of TARF reveals only minor differences between
the two sets of data: the chemical shifts due to C(6), C(7), and
C(10a) are shifted downfield by ~1.5 ppm, and that of C(8) upfield
by 3.7 ppm. The methylene group at C(8α) resonates at 48.8 ppm.
The data indicate that this substitution exerts little influence on the
π-electron distribution in the flavin molecule.
Lhoste et al. have presented, for the first time, 13C-NMR data
on the cationic flavin [112]. These data coincide with chemical
shifts obtained by us from Rfl in 6 N HCl (see Table 5). We have
NMR Spectroscopy on Flavins and Flavoproteins 253
Table 6
Some spin–lattice coupling constants of free flavins
Solvent
Aprotic Aqueous
2.5 13C- and 15N-NMR The 13C-NMR chemical shifts of structurally different two-electron
Studies on Reduced reduced flavins are given in Table 7 and their structures are shown
Flavins in Scheme 4 [129]. Upon two-electron reduction of FMN, all reso-
nance lines shift upfield, except that of C(1′). The largest upfield
shift experiences C(4a), shifted by 33.4 ppm, followed by, in
decreasing order, C(8) > C(6) > C(2) ~ C(10a) > C(7) ~ C(4) > C(9a)
~ C(5a) > C(9). The higher magnetic equivalence of the pairs C(6)
and C(9), and C(7) and C(8), in the reduced molecule indicates a
reduced conjugation via C(8)–C(6)–N(5)–C(10a)–C(2) as com-
pared to oxidized flavin.
The chemical shifts of the nitrogen atoms undergo large upfield
shifts. The most affected atom is N(5), shifting 276.7 ppm upfield.
The least affected atom is N(3), shifting only by 10.8 ppm, while
N(1) and N(10) undergo about the same upfield shifts of 62.8 ppm
and 76.3 ppm, respectively. Of the side-chain carbon atoms, only
the methylene group at C(1′) moves significantly, 2.3 ppm to low
field. This effect may be related to the fact that stacking is dimin-
ished in reduced flavin.
Deprotonation of N(1)H (FMNH–, see Table 7) does not per-
turb most chemical shifts of the carbon atoms, except those of
C(2) and C(10a), which are downfield shifted by 7.1 ppm and
11.5 ppm, respectively, an effect related to the negative charge on
N(1). A slight upfield shift is also observed for C(4a) and C(7)
(~1.4 ppm). Upon deprotonation, the chemical shift of the N(1)
atom moves to lower field by 53.3 ppm, and that due to N(10) by
9.3 ppm. The downfield shifts of the two carbon atoms (C(2) and
C(10a)) are caused by the negative charge on N(1). The data dem-
onstrate that the charge on N(1) is rather localized on this atom.
The pH dependence of the chemical shifts of the carbon and
nitrogen atoms has been investigated. From the shifts of the most
affected atoms, C(10a), C(2), and N(1), a pKa value of 6.7 was
derived [40, 108, 118].
Table 7
13
C- and 15N-NMR chemical shifts (δ, in ppm) of 1,5-dihydroflavins
Compound
R’ H R’’ H
N N O N N O
N R N R
N N
Ac O Ac O
22 23
R R R H
N N O N N O
N R N R
N N
H O R O
24 25
R R
N N O N N O
N R N R
N N
Ac O Ac O
26 27
R = CH3
R' = Ribityltetraacetate
R'’ = Undecanyl
Ac = Acetyl
much lesser extent. Upfield shifts are observed for the resonances
of C(4a) and C(5a), the carbon atoms under the direct influence of
the acyl group. The chemical shift pattern indicates that electron
density is withdrawn from the atoms shifted downfield and reallo-
cated probably to N(5), thus acquiring a higher degree of sp3
hybridization. This notion is supported by light absorption spectra
showing that N(5)-acetylated flavins exhibit spectra that are more
similar to those of substituted xylidines and quite dissimilar to
those of N(5)-unsubstituted flavins [102].
Comparing 22 with 23 (see Scheme 4), differing only by the
presence or absence of acetyl groups in the side chain of the flavins,
it is evident that the chemical shifts of both compounds are identi-
cal except those due to C(4a) and C(9a), where C(9a) is more
affected (5 ppm) on removal of the acetyl groups. The shielding in
22 is therefore related to one of the carbonyl functions of acetyl,
folding over the flavin moiety, an observation already reported
above for some flavin—metal complexes.
Comparison of 26 and 27 with 23 (see Scheme 4 and Table 7)
reveals opposite behavior of some atoms, i.e., the chemical shifts of
the most affected atoms, C(4a), C(5a), C(9), C(9a), and C(10a),
are either downfield or upfield of those of the reference compound
23. In 26, the pairs C(4a) and C(5a) on the one hand, and C(9a)
and C(10a) on the other, are downfield shifted. In 27, the pair
C(4a)/C(5a) is shifted upfield, whereas the pair C(10a)/C(9a)
remains practically unaffected. The shielding in 27 originates from
electron-density transfer more probably from N(10) than N(1),
and is a consequence of the fixation of the two nitrogen atoms in a
certain position by the ethylene bridge. Another situation is
encountered with 26 where both pairs of carbon atoms are shifted
downfield. These observations will be briefly discussed below. The
compounds 24 and 25 are best compared with TARF. Here again
the chemical shifts of the pairs C(4a)/C(5a) and C(9a)/C(10a) of
24 shift both downfield as compared to TARFH2. In 25 the chem-
ical shifts of the pair C(4a)/C(5a) are shielded and those of the
C(9a)/C(10a) pair are deshielded compared to TARFH2. The
two-electron reduced 5-deazaflavin (6-H2, Table 7) shows a simi-
lar pattern as TARFH2 on reduction. The resonance line of C(4a)
is most affected, shifting upfield by 27.5 ppm. Downfield shifts are
observed for the resonances from C(4) and C(5a), and upfield
shifts for C(7), C(8), and C(10a), based on the observation that in
reduced models the chemical shifts of the pairs C(4a)/C(5a)
(para-position to N(10)) and C(9a)/C(10a) (para to N(5)) are
influenced, depending on the structure, in a parallel manner. We
used this correlation for the calculation of the endocyclic angles of
the two nitrogen atoms. It could be shown, although only qualita-
tively, that a reasonable correlation was obtained between calcu-
lated endocyclic angles based on 13C chemical shifts and X-ray
derived data [111].
NMR Spectroscopy on Flavins and Flavoproteins 261
Table 8
13
C NMR chemical shifts (δ in ppm) of some less common dihydroflavins, free and bound to proteins
Compound
11
2.6 B-NMR Studies During the course of the study investigating the exchange reaction
of N(5)H [130], it was observed that the resonance lines due to
NMR Spectroscopy on Flavins and Flavoproteins 265
CH3 R R
N N O N N O N N O
N CH3 N H N H
N N N
31 O 32 H O 33 H O
OH SR OOH
R R R
N N O N N H N N OCH3
H OCH3
N H N CH3 N CH3
N N N
H OH O O
34 35 36
OCH3 HO NH2
N N O N N O N N O
Table 9
13
C-NMR chemical shifts (δ in ppm) of the ribityl side chain atoms of oxidized and two-electron
reduced FMN in phosphate and borate buffers at pH 11
2.7 17
O-NMR Studies Two decades ago it was assumed that 17O-NMR could hardly be
applied to proteins, because of severe line broadening due to quad-
rupole relaxation processes. Most of the associated problems have
been solved, and nowadays this technique can be successfully
applied to proteins [28, 148].
Two flavin models isotopically substituted with 17O have been
synthesized [149]. The compounds were obtained by synthesis
of the tetraacetylribityl analogues of 10 und 11 (see Scheme 1).
NMR Spectroscopy on Flavins and Flavoproteins 267
These were hydrolyzed with 17OH2, and acidified with gaseous HCl
to the corresponding [17O(2)]TARF-N(3)-methyl and [17O2(2,4)]
TARF, which, for future work, could be transformed to Rfl, FMN,
and FAD. Using 10 and 11 directly would yield the corresponding
lumiflavin derivatives. Nishina et al. have prepared 18O-labeled Rfl by
treatment with 1 M Na18OH [150]. Using instead 1 M Na17OH
should make the correspondingly labeled flavin available, i.e., the
[17O2(2,4)]Rfl. This procedure could, however, not be used to syn-
thesize directly a N(3)-alkylated derivative because such flavins
would be destroyed under these experimental conditions.
The 17O-NMR spectra were obtained using H2O as a reference
[114]. The spectrum of oxidized [17O(2)]TARF in chloroform
showed a line at about 300 ppm with a line width of 2.5 kHz (for
the spectra, see ref. 37). The corresponding quadrupole-coupling
constant was calculated to be about 9.1 MHz. The chemical shift is
in the range of amides and esters, but about 200 ppm upfield from
those of aldehydes and ketones. Considering the interpretation of
17
O chemical shifts by Delseth et al. [151], it is proposed that the
C(2) carbonyl group in flavin possesses a reduced π-bond order,
and hence, a polarity different from those of carbonyl groups in
ketones and aldehydes. A very similar spectrum was obtained from
the doubly labeled TARF, with a line width of 3 kHz. The virtually
identical spectra of both compounds indicate that they have about
the same order of hybridization. In methanol, the chemical shifts
are upfield shifted by 10 ppm, and in water a further upfield shift of
about 40 ppm is observed. These data are in accord with the inter-
pretation given above for the 13C and 15N chemical shifts in polar
media, i.e., polarization of the flavin molecule through hydrogen-
bonding interaction with the two carbonyl groups [111].
On two-electron reduction of the [17O(2)]TARF in CHCl3,
two peaks appear in the NMR spectrum at 229 and 288 ppm.
Although it is difficult to interpret the spectrum in the absence of
any further data, it was tentatively suggested that the low-field
peak represents the carbonyl group and the high-field peak the
corresponding iminol tautomer. If correct, this interpretation
would imply that the interconversion of the two species is slow on
the NMR time scale and their lifetime would exceed 20 ms. Direct
support for the presence of the iminol form comes from synthetic
work by Dudley and Hemmerich, who obtained 10 and 11 (see
Scheme 1) by alkylation of N(5)acetyl-1,5-dihydroflavin [152].
3.1 General Remarks To investigate proteins by NMR techniques, special attention has
to be paid to certain experimental issues. Usually rather large quan-
tities of proteins are required depending on the nuclide under
268 Franz Müller
3.2 19
F-NMR Studies The 19F nuclide possesses all the advantages needed to obtain high-
quality spectra in a short acquisition time and without disturbing
background signals (see Table 1). Despite these advantages, 19F-NMR
was only sporadically applied to flavins and flavoproteins. It was
used in a few cases indirectly in the structural elucidation of prod-
ucts obtained by enzymatic transformations of fluorinated com-
pounds [162, 163].
Two fluorine-containing flavocoenzymes, 8-fluoro- and
2′F-2′-deoxyflavins (replacement of H by F and OH by H), have
been synthesized and used as replacements of the natural coenzymes
in different flavoproteins. It was assumed that the 8-fluoro-
compound would be a good reporter group to explore the acces-
sibility of this position of flavoproteins to bulk solvent [164, 165].
From the other derivative it was expected to obtain some informa-
tion on the interaction of the original hydroxyl group with the
protein at that site [164]. Some of the published data are pre-
sented in Table 10. There are no significant differences to the 19F
chemical shifts of FAD and Rfl in the oxidized state in aqueous
solution, both located at ~100 ppm. This value is close to that of
dinitrofluorobenzene, 104.6 ppm. On reduction, the chemical
shifts of both compounds are downfield shifted by ~30 ppm. The
pH dependence showed a pKa of 9.6, which is close to that of Rfl
(~10) and, in analogy, has been ascribed to the deprotonation of
the N(3)H group [165]. In methanol, a similar downfield shift is
observed as in alkaline pH values. This downfield shift is probably
not due to hydrogen bonding, but more probably due to the
change of polarity of the solvent.
Incorporation of 8-fluoro-flavin into Megasphaera elsdenii
flavodoxin, old yellow enzyme (OYE), p-hydroxybenzoate hydrox-
ylase, or Rfl-binding protein does not much affect the chemical
shifts in the oxidized state as compared to free flavin. Upon two-
electron reduction, significant differences in the chemical shifts are
observed among the four proteins (see Table 10). The chemical
shifts of M. elsdenii flavodoxin, p-hydroxybenzoate hydroxylase,
and OYE are further downfield shifted than those of free flavin,
NMR Spectroscopy on Flavins and Flavoproteins 269
Table 10
19
F-NMR chemical shifts (δ in ppm) of free flavins, and flavoproteins containing modified coenzymes
or amino acids (all referenced to trichloro-fluoro-methane)
Chemical shifts
Table 10
(continued)
Chemical shifts
3.3 31
P-NMR Studies In Table 11, the 31P chemical shifts of free and protein-bound fla-
vocoenzymes are collected. The NMR spectrum of free FMN con-
sists of one single resonance line located at 5.1 ppm if proton
decoupling is applied, and is independent on the redox state of the
flavin. Under non-decoupling conditions, the spectrum shows, at
any pH value, a triplet structure with a vicinal coupling of 3J [31P–
1
H] = 7.2 Hz [54, 173]. The NMR spectrum of FMN shows a pH
dependence: at low pH values the resonance line appears at
0.92 ppm and moves to lower field (5.1 ppm) at pH 9.3, with a
titration curve revealing a pKa of 6.05 [54, 173]. This pKa is on the
transition from the mono- to the di-ionic phosphate. In Table 11,
two numbers are stated for FMN and some flavoproteins. The
number in parenthesis refers to older data, which could not be
confirmed using more advanced instrumentation. The cause of this
difference could not be clarified [174].
Commercially available FMN contains several phosphate esters
as by-products. The 31P-NMR spectrum of the mixture is best
resolved at pH 7. Under these conditions, seven resonance lines
are observed in the spectrum. Four of these lines could be assigned
(see below) and were verified by the use of different techniques
including the determination of the pKa of the individual com-
pounds and, using the flavin radical as an intramolecular paramag-
netic label, to FMN (main product, ~78 %), 4′-phosphate (~9 %),
3′-phoshate (~5 %), and 2′-phosphate (~4 %) [173]. The chemical
shift of FMN does not show any dependence on ionic strength.
The property of flavins to form intermolecular complexes in aque-
ous solution has been studied in the past by 1H-NMR [47] and
now also by 31P-NMR, measuring 31P T1 (and T2) relaxation times
in dependence on the concentration of FMN. From these data it
was concluded that stacking of flavin molecules occurs even at
lower concentrations than previously believed [47], namely as low
as 0.3 mM [173], and that the mobility of the ribityl phosphate
side chain decreases with increasing concentration [173].
The 31P-NMR spectrum of free FAD reveals two rather broad
peaks at about 9 and 11 ppm (see Table 11). The chemical shifts are
independent of pH in the tested range from pH 1.7 to 10.5. The
two phosphorus atoms are magnetically nonequivalent. The spec-
trum obtained under non-decoupling conditions exhibits an AB
quartet with 2J [31P–O–31P] = 22 Hz [173, 174], similar to that of
2′-ADP (22.0 Hz) [49]. Kainosho and Kyogoku [49] assigned,
based on a detailed 1H-NMR study, the low-field resonance to
FMN and the upfield resonance to 5′-AMP. Although this approach
seems reasonable based on the available data, it should be used
with caution, because it is well established that 31P chemical shifts
NMR Spectroscopy on Flavins and Flavoproteins 273
Table 11
31
P-NMR chemical shifts (δ in ppm) of free and protein-bound flavocoenzymes
Chemical shifts
Redox states
FlH2
Molecule pH Flox (1,5H2) Radical Othersa Ref.
FMN 8.0 5.1 (4.7) 5.1 – – [54, 173,
174]
FAD 1.7–10.5 −9.87, −10.5 – – – [175]
9.3 −10.4, −11.1 – – – [49]
8.5 −10.8, −11.3 – – – [176]
FMN-proteins:
Flavodoxins:
Clostridium MPb 8.0 5.7 5.8 – – [174]
c
Megasphaera elsdenii 8.0 5.3 (4.8) 5.4 (4.9) (4.9) – [173, 174]
Desulfovibrio vulgaris 8.0 5.4 (5.0) 5.5 (5.0) (5.0) – [54, 174]
Desulfovibrio gigas 7.8 (5.0) (4.9) (5.0) – [54]
Azotobacter vinelandii:
OP (ATCC, Berkeley) 8.0 6.3 (5.6) 6.4 (5.4) ~5.6 0.9, (0.8) [174, 177]
ATCC 478: Form I 7.5 5.3 – – – [178]
Form II 7.5 6.1 – – – [178]
Form III 7.5 5.5 – – – [178]
UW 136: Form I 8.0 4.7 – – −1.1 [179]
Form II 8.0 5.5 – – 2.4 [179]
Anabaena 7120 8.0 5.4 5.9 – – [180]
Klebsiella pneumoniae 7.4 5.6 – – 3.6, −11.2 [181]
Rfl-binding protein:
Holo, egg white 7.9 4.63–4.35 – – – [182]
Apo, egg white 7.9 4.64–4.36 – – – [182]
Holo, egg yolk 7.9 4.43–3.99 – – – [182]
Apo, egg yolk 7.9 4.43–3.98 – – – [182]
LOV2, A. 7.0 4.8 (dark) – – – [136]
capillus-veneris 7.0 4.1 (light) – – – [107]
(continued)
274 Franz Müller
Table 11
(continued)
Chemical shifts
Redox states
FlH2
Molecule pH Flox (1,5H2) Radical Othersa Ref.
Bacterial luciferase 7.5 5.2 5.6 – – [42]
Flavocytochrome b2 7.0 8.8 – – – [183]
Old yellow enzyme 9.0 8.6, 8.8 8.6 [184, 185]
FAD-proteins:
Glucose oxidase 5.0–8.0 −10.8, −10.8, – 2.0 [176]
~−13.3 −13.3
ETF’sd: –
Human ETF 7.8 −7.35, −9.33 −7.19, – 6.12(6.06) [186]
−9.74
P. denitrificans 7.8 −7.34, −9.60 −7.50, – 6.06(6.00) [186]
ETF(wt) −10.2
P. denitrificans ETF 7.8 −7.42, −9.52 −7.40, – 6.00(5.90) [186]
(mutant aT244M) −10.1
Hydroxy-L-nicotine 7.5 −12.2 Very – 1.3, 0.7, −0.3, [187]
oxidase (Arthrobacter broad −0.6
oxidans)
Thioredoxin reductase: – –
wt 7.8 −9.2, −11.5 – – [188]
wt reconstituted 7.8 −9.4, −11.4 −9.8 – – [188]
Native E159Y mutant 7.8 −9.4, −11.4 – [188]
p-OH-benzoate 7.0 −9.0, −9.6 −9.0, – [189]
hydroxylase −9.6
Glutathione reductase 7.0 −9.7, −10.5 – – [37]
Mercuric ion reductase 7.0 −12.1, −12.9 – – 10.5 [37]
Lipoamide 7.0 −8.4, −12.4 – – – [37]
dehydrogenase
D-Amino acid oxidase 7.0 −11.2, −13.5 – – – [37]
Oxynitrilase 7.0 −11.2, −12.3 – – [37]
Ferredoxin-NADP+- 8.0 −7, −12 – – – [190]
oxidoreductase
Milk xanthine oxidase 8.0 −8.8, −13.5 – – −1, 3 [191]
(continued)
NMR Spectroscopy on Flavins and Flavoproteins 275
Table 11
(continued)
Chemical shifts
Redox states
FlH2
Molecule pH Flox (1,5H2) Radical Othersa Ref.
E. coli sulfite reductase 7.5 −10.8, −12.1 −10.8, – 4.9e [192]
−12.1
Adrenodoxin reductase 7.0 −10.1, −14.3 – [193]
Medium-chain acyl CoA 8.5 −6.3, −8.1 – – 4.65 [194]
dehydrogenase
NADPH- 7.7 −7.4, −11.3 – 4.1d,1.8f [195]
cytochrome-P450 7.7 −7.3, −11.3 4.6e [175]
reductase
FMN-depleted 7.7 −9.6, −10.4 [195]
a
Covalently bound phosphorus
b
Now called Clostridium beijerinckii MP
c
Broadened line
d
Electron transfer flavoproteins
e
FMN
f
2′-AMP
3.4 13C- and 15N-NMR As shown above, the combination of 13C- and 15N-NMR investiga-
Studies tions should yield valuable information on the interaction of flavo-
coenzymes with their respective apoproteins. In these studies,
besides the determination of the chemical shifts of both nuclides,
coupling constants, NOEs, and some T1 and T2 values were deter-
mined. The 1J [15N(1,3,5)–1H] are of special interest and related to
the discussion about the conformation of reduced flavin, free and
protein-bound. Since these coupling constants are almost com-
pletely under the influence of the Fermi contact term, a semiem-
pirical relationship exists, in a first approximation, between the
coupling constant and the degree of sp2 and sp3 hybridization of
the corresponding nitrogen atom. A coupling constant of 93 Hz
represents a fully sp2- and 72 Hz a fully sp3- hybridized nitrogen
atom. However, it must be kept in mind that the magnitude of a
particular coupling constant can be strongly influenced when the
N–H group is involved in hydrogen bonding, leading to a decrease
in the coupling constant. Also single one-bond 13C–13C coupling
constants can yield valuable information on the s-character of the
atoms making up the bond. Since these coupling constants may be
influenced by neighboring polar atoms, only qualitative informa-
tion can be extracted from such data [111].
NOEs measured for a particular atom of the flavin molecule
can yield some insight into the mobility of protein-bound flavin,
because the NOE depends, among other factors, on the rotational
correlation time of the molecule under investigation.
Table 12 presents some 13C and 15N chemical shifts of flavopro-
teins in the oxidized state. Initially, M. elsdenii flavodoxin was inves-
tigated by 3C- and 15N-NMR techniques because of its easy
availability and low molecular mass of 15 kDa [108]. For these rea-
sons, several other flavodoxins, with a molecular mass ranging up to
23 kDa and similar biological functions, were later also studied by
NMR. Following the interpretation of the chemical shifts of 13C
and 15N, as outlined above for free flavins [111], it was concluded
from the data in Table 12 that all five flavodoxins in the oxidized
state form hydrogen bonds with C(2)O, C(4)O, N(1), and N(3).
280 Franz Müller
Table 12
13
C and 15N NMR chemical shifts (δ in ppm) of apoflavoproteins reconstituted with flavocoenzymes
enriched with C-13 and N-15 atoms, in the oxidized state
Flavodoxins Flavoenzymes
Atom M.e.a D.v.b Anab.c A.v.d C.MPe OYEf TrxRg NOXh LOV-2i B. luc.j DAAOk
C(2) 159.8 159.7 158.6 159.6 159.8 160.6 159.1 159.9 159.4 158.5 160.7
C(4) 162.4 162.4 161.6 161.7 162.3 164.2 165.2 164.9 161.3 162.6 165.0
C(4a) 135.6 134.3 135.3 135.7 135.5 137.1 136.1 136.9 134.2 137.4 137.3
C(5a) 138.4 137.4 135.7 136.9 138.5 135.2 135.4 136.9 136.2 135.7 –
C(6) 133.0 132.5 129.8 132.6 133.1 – 130.4 131.6 133.1 130.8 –
C(7) 141.4 142.0 141.9 141.2 141.4 141.2 140.3 137.7 138.9 139.0 –
C(8) 153.0 154.0 152.8 152.2 153.0 151.8 151.2 148.3 150.2 148.6 –
C(9) 117.5 117.2 117.8 117.9 117.4 117.7 119.4 120.3 118.9 119.5 –
C(9a) 132.9 131.9 130.8 131.5 132.9 131.7 130.4 135.5 134.4 134.6 –
C(10a) 151.5 152.3 152.2 153.5 151.4 152.9 151.2 151.5 150.8 151.3 152.5
C(7α) 20.6 20.5 20.3 20.4 20.5 19.3 19.0 20.7 21.9 20.2 –
C(8α) 22.1 23.3 23.0 21.9 22.0 21.9 21.6 21.6 23.2 21.9 –
N(1) 185.0 188.0 188.0 186.4 184.5 194.3 183.0 192.2 188.5 187.1 –
N(3) 160.9 159.9 162.5 160.2 161.1 164.2 156.6 160.6 157.5 162.3 –
N(5) 349.3 341.1 335.0 341.4 351.5 319.4 326.8 335.3 349.5 325.8 –
N(10) 165.6 165.6 163.5 161.5 164.8 161.5 161.5 162.2 155.5 160.8 –
pH 7.0 7.5 7.5 8.0 8.0 8.5 7.8 7.0 7.0 7.0 8.0
Ref. [129, [208] [180, [108, [174] [184, [188] [187] [107, [42, [211]
174] 209] 174] 185, 136] 137]
210]
Other flavoproteins
Riboflavin-
binding
protein
Flavocy- p-Hydroxybenzoate (egg
Atom ETFl tochrome b2m hydroxylasen yolk) GOXo
C(2) 161.0 161.5 159.5 159.6 159.8
C(4) 162.3 166.1 163.2 162.0 162.5
C(4a) 137.3 138.5 136.4 135.9 137.8
(continued)
NMR Spectroscopy on Flavins and Flavoproteins 281
Table 12
(continued)
Other flavoproteins
Riboflavin-
binding
protein
Flavocy- p-Hydroxybenzoate (egg
Atom ETFl tochrome b2m hydroxylasen yolk) GOXo
C(10a) 150.2 154.1 151.6 152.4 152.5
N(1) 181.3 188 191.6 191.6 195.0
N(3) 159.1 159 159.6 159.4 161.8
N(5) 306.8 336 328.5 338.2 336.2
N(10) 154.7 162 165.6 165.3 164.3
pH 7.5 7.0 7.0 6.2 5.8, 8.0
Ref. [186] [183] [189] [212, [214]
213]
a
M. elsdenii
b
D. vulgaris
c
Anabaena 7120
d
A. vinelandii
e
C. MP
f
Old yellow enzyme
g
Thioredoxin reductase
h
6-hydroxy-l-nicotine oxidase
i
Adiantum capillus-veneris LOV2 domain
j
Bacterial luciferase
k
D-amino acid oxidase
l
Human electron transfer flavoprotein
m
From Saccharomyces cerevisiae
n
From Pseudomonas fluorescens
o
Glucose oxidase
Flavodoxins Flavoenzymes
Atom M.e.a D.v.b A.v.d C.MPe OYEf TrxRg NOXh LOV-2i B. luc.j GThionk
C(2) 156.9 157.5 158.3 156.6 159.4 158.2 158.7 159.2 157.9 161.0
C(4) 154.8 154.0 155.2 154.8 163.0 158.8 160.0 165.9 157.2 162.0
C(4a) 3.5 102.7 102.6 103.7 95.3 105.6 98.1 65.7 103.5 99.7
C(5a) 136.3 134.6 135.5 136.5 133.9 143.3 135.2 130.1 135.0 –
C(6) 112.4 114.5 113.8 112.4 – 116.1 120.8 119.1 116.8 –
C(7) 131.1 130.7 130.4 131.3 131.8 130.6 134.5 130.3 132.7 –
C(8) 125.9 126.7 125.5 125.6 128.5 130.6 129.7 136.2 126.2 –
C(9) 115.3 114.7 115.2 114.8 117.0 117.2 117.9 119.6 115.6 –
C(9a) 131.8 129.1 131.2 132.1 131.8 136.0 130.11 127.7 130.7 –
C(10a) 154.5 155.0 155.2 154.1 157.7 153.3 160.0 156.7 156.2 159.1
C(7α) 19.6 19.4 19.8 19.6 18.3 19.5 19.9 21.8 19.4 –
C(8α) 16.2 20.3 19.3 19.1 19.5 19.1 21.4 22.2 19.7 –
N(1) 183.4 186.6 182.0 182.8 187.4 118.3 192.7 188.5 176.8 –
N(3) 149.7 148.3 150.0 150.1 153.2 146.0 149.2 164.5 150.0 –
N(5) 61.3 62.1 61.7 61.9 48.6 14.4 52.7 66.3 59.9 –
N(10) 98.3 98.4 96.7 97.7 97.6 52.1 100.6 164.5 94.6 –
pH 7.0 7.5 8.0 8.0 8.5 7.8 7.0 7.0 7.0 7.0
Ref. [129, [208] [108, [174] [184, [188] [187] [107, [42, [37]
174] 174] 185, 136] 137]
210]
Other flavoproteins
Flavocy-
tochrome p-Hydroxybenzoate Riboflavin-binding
Atom ETFl b2m hydroxylasen protein (egg yolk) GOXo
C(2) 158.4 160.0 156.9 151.1 158.7
C(4) 157.3 161.5 157.6 156.6 158.6
C(4a) 103.5 100.3 99.9 102.8 97.3
C(10a) 153.2 156.0 155.6 144.2 157.7
N(1) 176.6 183 183.9 129.8 186.2
N(3) 147.4 145 148.2 148.9 153.8
(continued)
286 Franz Müller
Table 13
(continued)
Other flavoproteins
Flavocy-
tochrome p-Hydroxybenzoate Riboflavin-binding
Atom ETFl b2m hydroxylasen protein (egg yolk) GOXo
N(5) 50 53 60.9 59.9 57.3
N(10) 85.0 95 98.4 90.3 96.3
pH 7.5 7.0 7.0 6.2 7.4
Ref. [186] [183] [189] [212, 213] [214]
i
After exposure to light leading to the C(4a) adduct with Cys966, for all other footnotes, see Table 12
1 1
3.5 H-NMR Studies H-NMR was only sporadically applied to flavoproteins in the past.
McDonalds and Phillips investigated apo- and native flavodoxin
3.5.1 Brief Historical
from Clostridium pasteurianum and found that the conforma-
Overview and
tion of the two species differed drastically [224]. Crespi et al.
One-Dimensional Spectra
prepared a uniformly deuterium-labeled flavodoxin from
Synechococcus lividus, removed the coenzyme from the protein,
and replaced it by natural FMN to study the 1H-NMR properties
NMR Spectroscopy on Flavins and Flavoproteins 289
3.5.2 Two- and In the last two decades, NMR techniques have undergone an
Multidimensional NMR unprecedented progress with respect to hardware as well as soft-
ware. This made it possible to apply the technique to much larger
proteins than previously thought. In addition, advanced tech-
niques of introducing selective mutations and the isotope substitu-
tion (13C and 15N) into proteins are very helpful tools in the
elucidation of secondary and tertiary structures of proteins and
their dynamic properties. In the following, some work achieved
using these techniques will be reviewed without the description of
the experimental details (see ref. 22–33).
To elucidate the structure of the active center of M. elsdenii
flavodoxin, two-dimensional NMR techniques were used and
complemented with two-dimensional difference spectra [235].
Varying the concentration of the semiquinone of the protein-
bound FMN in a solution of hydroquinone allowed to “map” the
active center. The difference spectra of the two species generated
simplified spectra in an otherwise complex spectrum. This procedure
NMR Spectroscopy on Flavins and Flavoproteins 291
also part of the ribityl side chain of FMN. The pyrimidine moiety
of FMN is buried in the protein. In addition, water molecules asso-
ciated with the protein have been localized by NOE experiments
[243]. The comparison of the structures between the oxidized and
the reduced molecule revealed significant differences [244]. The
reduced state of the protein exhibits more flexibility than the oxi-
dized molecule, an unexpected finding. In addition the mobility
around the N(3)H group is increased, supporting the above given
interpretation of the data obtained from the mutant G61A.
Flavodoxin from D. vulgaris was also studied by Peelen and
Vervoort [251] using two-dimensional NMR techniques. Although
both sets of data have been claimed to be in agreement with the
crystallographic data, some differences exist between the two data
sets. Whereas Rüterjans et al. suppose a weak hydrogen bond at
C(2)O of FMN [243], Peelen and Vervoort postulated a strong
one. The other difference concerns the mobility of a part of
reduced FMN. The solution structure of A. chroococcum flavo-
doxin, containing a short extra loop as compared to other flavo-
doxins, was elucidated [250]. It was found that negatively charged
amino acid residues are mainly located in the flavin-binding region,
whereas positively charged groups are clustered on one of the
α-helices. Residues responsible for binding interactions with iron-
proteins were also identified.
The folding and unfolding of proteins is still a poorly under-
stood and a more complex process than usually assumed. To shed
some light on this biologically important process, van Mierlo and
his group have devoted an NMR program to this issue [251–253].
Flavodoxin from A. vinelandii was chosen as a model protein
because of its easy availability and high stability. Its secondary
structure was elucidated by multidimensional NMR techniques
[253]. It possesses a five-stranded parallel β-sheet and five α-helices,
structural elements common in many (flavo)proteins. Hydrogen-
exchange rates for many amide protons were determined and
found to vary from ~10−3 to 10−7 s−1 [251]. The exchange rate for
the N(3)H group of the protein-bound flavin was found to be
~10−6 s−1 [251]. The flavin-binding region of the holoprotein is
relatively rigid, as has also been observed in the study on oxidized
flavodoxin from Cyanobacterium anabaena [254], contrasting its
increased flexibility in the apo-form. The formation of native apo-
flavodoxin occurs cooperatively whereas the off-pathway molten
globule forms noncooperatively [253]. This intermediate could be
trapped and investigated. It turned out that it is helical and con-
tains no β-sheet [255]. The studies have been reviewed in ref. 256.
Very unexpected but important data regarding the reconstitu-
tion of holoflavodoxin from the apoprotein and FMN were very
recently published by van Mierlo’s group [257]. The first and well-
known step of the reconstitution yields a holoprotein with a Kd in
the nanomolar range. However the holoprotein relaxes thereafter
NMR Spectroscopy on Flavins and Flavoproteins 293
References
1. Fagan RL, Palfey BA (2010) Flavin-dependent 10. Unno H, Yamashita S, Ikeda Y, Sekiguchi S,
enzymes. In: Begley TP (ed) Comprehensive Yoshida N, Yashimura T, Kusunoki M,
natural products II, vol 7. Elsevier Ltd., New Nakayama T, Nishino T, Hemmi H (2009)
York, NY, pp 37–114 New role of flavin as a general acid–base cata-
2. Losi A, Gärtner W (2011) Old chromo- lyst with no redox function in type 2
phores, new photoactivation paradigms, isopentenyl-diphosphate isomerase. J Biol
trendy applications: flavins in LOV and BLUF Chem 284:9160–9167
photoreceptors. Photochem Photobiol 11. Müller F (1991) Free flavins: synthesis, chem-
87:491–510 ical and physical properties. In: Müller F (ed)
3. van Peé K-H, Patallo EP (2006) Flavin- Chemistry and biochemistry of flavoenzymes,
dependent halogenases involved in secondary vol I. CRC, Boca Raton, FL, pp 1–71
metabolism in bacteria. Appl Microbiol 12. Macheroux P, Kappes B, Ealick SE (2011)
Biotechnol 70:631–641 Flavogenomics – a genomic and structural
4. Fischer M, Bacher A (2008) Biosynthesis of view of flavin-dependent proteins. FEBS J
vitamin B2: structure and mechanism of ribo- 278:2625–2634
flavin synthase. Arch Biochem Biophys 13. Fraaije MW, Mattevi A (2000) Flavoenzymes:
474:252–265 diverse catalysts with recurrent features.
5. Chaves I, Pokorny R, Byrdin M, Hoang N, Trends Biochem Sci 25:126–132
Ritz T, Brettel K, Essen L-O, van der Horst 14. Mewies M, McIntire WS, Scrutton NS (1998)
GTJ, Batschauer A, Ahmad M (2011) The Covalent attachment of flavin adenine dinu-
cryptochromes: blue light photoreceptors in cleotide (FAD) and flavin mononucleotide
plants and animals. Annu Rev Plant Biol (FMN) to enzymes: the current state of
62:335–364 affairs. Protein Sci 7:7–20
6. Abbas CA, Sibirny AA (2011) Genetic control 15. Mansoorabadi SO, Thibodeaux CJ, Liu H-W
of biosynthesis and transport of riboflavin and (2007) The diverse roles of flavin coenzymes
flavin nucleotides and construction of robust – nature’s most versatile thespians. J Org
biotechnological producers. Microbiol Mol Chem 72:6329–6342
Biol Rev 75:321–360 16. Heuts DPHM, Scrutton NS, McIntire WS,
7. Ghisla S, Massey V (1989) Mechanisms of Fraaije MW (2009) What’s in a covalent
flavoprotein-catalyzed reactions. Eur J bond? On the role and formation of cova-
Biochem 181:1–17 lently bound flavin cofactors. FEBS J
8. van Berkel WJH, Kamerbeek NM, Fraaije 276:3405–3427
MW (2006) Flavoprotein monooxygenases, a 17. Senda T, Senda M, Kimura S, Ishida T (2009)
diverse class of oxidative biocatalysts. J Redox control of protein conformation in flavo-
Biotechnol 124:670–689 proteins. Antioxid Redox Signal 11:1741–1766
9. Bornemann S (2002) Flavoenzymes that 18. Becker DF, Zhu W, Moxley MA (2011)
catalyse reactions with no net redox change. Flavin redox switching of protein functions.
Nat Prod Rep 19:761–772 Antioxid Redox Signal 14:1079–1091
296 Franz Müller
19. Ghisla S, Massey V (1986) New flavins for 34. Harris RK, Becker ED, Cabral de Menezes
old: artificial flavins as active site probes of fla- SM, Goodfellow R, Granger P (2001) NMR
voproteins. Biochem J 239:1–12 nomenclature. Nuclear spin properties and
20. Edmondson D, Ghisla S (1999) Flavoenzyme conventions for chemical shifts. Pure Appl
structure and function – approaches using fla- Chem 73:1795–1818
vin analogues. Meth Mol Biol 131:157–179 35. Harris RK, Becker ED, Cabral de Menezes
21. Vervoort J, Hefti M (1999) NMR of flavo- SM, Granger P, Hoffmann RE, Zilm KW
proteins. Meth Mol Biol 131:131–147 (2008) Further conventions for NMR shield-
22. Kitevski-LeBlanc JL, Prosser RS (2012) ing and chemical shifts. Pure Appl Chem
Current application of 19F NMR to studies of 80:59–84
protein structure and dynamics. Prog Nucl 36. Müller F, Ghisla S, Bacher A (1988) Vitamin
Magn Reson Spectrosc 62:1–33 B2 und natürliche flavine. In: Isler O,
23. Skrisovska L, Schubert M, Allain FH-T Brubacher G, Ghisla S, Kräutler R (eds)
(2010) Recent advances in segmental isotope Vitamine II, wasserlösliche vitamine. Thieme
labeling of proteins: NMR applications to Verlag Stuttgart, New York, NY, pp 50–159
large proteins and glycoproteins. J Biomol 37. Müller F (1992) Nuclear magnetic resonance
NMR 46:51–65 studies on flavoproteins. In: Müller F (ed)
24. Zhao X (2012) Protein structure determina- Chemistry and biochemistry of flavoenzymes.
tion by solid-state NMR. Top Curr Chem CRC, Boca Raton, FL, pp 557–595
326:187–213 38. Yagi K, Ohishi N, Takai A, Kawano K,
25. Lu GJ, Son WS, Opella SJ (2011) A general Kyogoku Y (1976) 15N nuclear magnetic
assignment method for oriented sample (OS) resonance of flavins. Biochemistry 15:
solid-state NMR of proteins based on the cor- 2877–2780
relation of resonances through heteronuclear 39. Kawano K, Ohishi N, Suzuki AT, Kyogoku Y,
dipolar couplings in samples aligned parallel Yagi K (1978) Nitrogen-15 and carbon-13
and perpendicular to the magnetic field. J nuclear magnetic resonance of reduced fla-
Magn Reson 209:195–206 vins. Comparative study with oxidized flavins.
26. Thamarath SS, Heberle J, Hore PJ, Kottke T, Biochemistry 17:3854–3859
Matysik J (2010) Solid-state photo-CIDNP 40. Grande HJ, Gast R, van Schagen CG, van
effect observed in phototropin LOV1-C575 Berkel WJH, Müller F (1977) 13C-NMR.
by 13C magic-angle spinning NMR spectros- Study on isoalloxazine and alloxazine deriva-
copy. J Am Chem Soc 132:15542–15543 tives. Helv Chim Acta 60:367–379
27. Tal A, Frydman L (2010) Single-scan multidi- 41. Müller F, Vervoort J, Lee J, Horowitz M,
mensional magnetic resonance. Prog Nucl Carreira LA (1983) Coherent anti-stokes
Magn Reson Spectrosc 57:241–292 Raman spectra of isoalloxazines. J Raman
28. Zhu J, Ye E, Terskikh V, Wu G (2011) Spectrosc 14:106–117
Experimental verification of the theory of 42. Vervoort J, Müller F, O’Kane DJ, Lee J,
nuclear quadrupole relaxation in liquids over Bacher A (1986) Bacterial luciferase: a car-
the entire range of molecular tumbling bon-13, nitrogen-15, and phosphorus-31
motion. J Phys Chem Lett 2:1020–1023 nuclear magnetic resonance investigation.
29. Baldwin AJ, Kay LE (2009) NMR spectros- Biochemistry 25:8067–8075
copy brings invisible protein states into focus. 43. Chang F-C, Swenson RP (1999) The mid-
Nat Chem Biol 5:808–814 point potentials for the oxidized–semiqui-
30. Kanamori E, Igarashi S, Osawa M, Fukunishi none couple for Gly57 mutants of the
Y, Shimada I, Nakamura H (2011) Structure Clostridium beijerinckii flavodoxin correlate
determination of a protein assembly by amino with changes in the hydrogen-bonding inter-
acid selective cross-saturation. Proteins action with the proton on N(5) of the reduced
79:179–190 mononucleotide cofactor as measured by
31. Joo C-G, Casey A, Turner CJ, Griffin RG NMR chemical shift temperature dependen-
(2009) In situ temperature-jump dynamic cies. Biochemistry 38:7168–7176
nuclear polarization: enhanced sensitivity in 44. Grininger M, Zeth K, Oesterhelt D (2006)
two dimensional 13C–13C correlation spec- Dodecins: a family of lumichrome binding
troscopy in solution. J Am Chem Soc proteins. J Mol Biol 357:842–857
131:12–13 45. Grininger M, Staudt H, Johansson P,
32. Lee JH, Sekhar A, Cavagnero S (2011) Wachtveitl J, Oesterhelt D (2009) Dodecin is
1
H-detected 13C photo-CIDNP as a sensitiv- the key player in flavin homeostasis of Archaea.
ity enhancement tool in solution NMR. J Am J Biol Chem 284:13068–13076
Chem Soc 133:8062–8065 46. Bullock FJ, Jardetzky O (1965) An experimental
33. Jameson CJ, De Dios AC (2010) Theoretical demonstration of the nuclear magnetic resonance
and physical aspects of nuclear shielding. Nucl assignments in the 6,7-dimethyl-isoalloxazine
Magn Reson 39:42–69 nucleus. J Org Chem 30:2056–2057
NMR Spectroscopy on Flavins and Flavoproteins 297
47. Sarma RH, Dannies P, Kaplan NO (1968) 60. Roberie T, Bhacca NS, Selbin J (1977) High
Investigations of inter- and intramolecular resolution 1H nuclear magnetic resonance
interactions in flavin-adenine dinucleotide by studies of a flavine and its product with
proton magnetic resonance. Biochemistry MoCl4. Can J Chem 55:575–582
7:4359–4367 61. Isobe M, Uyakul D, Goto T (1988)
48. Kotowycz G, Teng N, Klein MP, Calvin M Lampteromyces bioluminescence – 2.
(1969) The 220 MHz nuclear magnetic reso- Lampteroflavin, a light emitter in the lumi-
nance study of a solvent-induced conforma- nous mushroom, L. japonicus. Tetrahedron
tional change in flavin adenine dinucleotide. J Lett 29:1169–1172
Biol Chem 244:5656–5662 62. Uyakul D, Isobe M, Goto T (1989)
49. Kainosho M, Kyogoku Y (1972) High- Lampteromyces bioluminescence. 3. Structure
resolution proton and phosphorus nuclear of lampteroflavin, the light emitter in the
magnetic resonance spectra of flavin-adenine luminous mushroom, L. japonicus. Bioorg
dinucleotide and its conformation in aqueous Chem 17:454–460
solution. Biochemistry 11:741–752 63. Kellogg RM, Kruizinga W, Bystrykh LV,
50. Raszka M, Kaplan NO (1974) Intramolecular Dijkhuizen L, Harder W (1992) Structural
hydrogen bonding in flavin adenine dinucleo- analysis of a stereochemical modification of
tide. Proc Natl Acad Sci U S A 71: flavin adenine dinucleotide in alcohol oxidase
4546–4550 from methylotrophic yeasts. Tetrahedron
51. Grande HJ, van Schagen CG, Jarbandhan T, 48:4147–4162
Müller F (1977) An 1H-NMR spectroscopic 64. Fraiz FJ, Pinto RM, Costas MJ, Ávalos M,
study of alloxazines and isoalloxazines. Helv Canales J, Cabezas A (1998) Enzymic forma-
Chim Acta 60:348–366 tion of riboflavin 4′,5′-cyclic phosphate from
52. Malele CN, Ray J, Jones WE Jr (2010) FAD: evidence for a specific low-Km FMN in
Synthesis, characterization and spectroscopic rat liver. Biochem J 330:881–888
study of riboflavin–molybdenum complex. 65. Williamson G, Edmondson DE (1985)
Polyhedron 29:749–756 Proton nuclear magnetic resonance studies of
53. Edwards AM, Saldaño A, Bueno C, Silva E, 8α-N-imidazolylriboflavin in its oxidized and
Alegría S (2000) Spectroscopic properties of reduced forms. Biochemistry 24:7918–7926
hydrophobic flavin esters. A one and two- 66. Edmondson DE (1977) 2′,5′-Anhydro-8α-
dimensional 1H-NMR and 13C-NMR study. histidylflavins: their formation and structural
Bol Soc Chil Quim 45:423–431 elucidation. Biochemistry 16:4308–4311
54. Favaudon V, Le Gall J, Lhoste J-M (1980) 67. Otani S, Matsui K, Kasai S (1997) Chemistry
Nuclear magnetic resonance of flavodoxin and biochemistry of 8-aminoflavins. Osaka
from sulfite-reducing bacteria. In: Yagi K, City Med J 43:107–137
Yamano T (eds) Flavins and flavoproteins. 68. Edmondson DE, De Francesco R (1991)
Japan Scientific Societies Press, Tokyo, pp Structure, synthesis, and physical properties
373–386 of covalently bound flavins and 6- and
55. Insinska-Rak M, Sokorska E, Bourdelande JL, 8-hydroxyflavins. In: Müller F (ed) Chemistry
Khmelinskii IV, Prukala W, Dobek K, and biochemistry of flavoenzymes. CRC,
Karolczak J, Machado IF, Ferreira LFV, Boca Raton, FL, pp 73–103
Komasa A, Worrall DR, Sikorski M (2006) 69. Andrew ER, Glowinkowski S (2000)
Spectroscopy and photophysics of flavin- Molecular dynamics in solid riboflavin as
related compounds: 5-deaza-riboflavin. J Mol studied by 1H NMR. Solid State Nucl Magn
Struct 783:184–190 Reson 18:89–96
56. Kennedy AA (2009) Biomimetic models for 70. Seward EM, Hopkins RB, Sauerer W, Tam
redox enzyme systems. Ph.D. Thesis, S-W, Diederich F (1990) Redox-dependent
University of Glasgow binding of a flavin cyclophane in aqueous
57. Ménová P, Eigner V, Cejka J, Dvoráková H, solution: hydrophobic stacking versus cavity-
Sanda M, Cibulka R (2011) Synthesis and inclusion complexation. J Am Chem Soc
structural studies of flavin and alloxazine 112:1783–1790
adducts. J Mol Struct 1004:178–187 71. Takeda J, Ota S, Hirobe M (1987) Synthesis
58. Williamson G, Edmondson DE (1986) 1H and characterization of novel flavin-linked
NMR spectral analysis of the ribityl side chain porphyrins. Mechanism for flavin-catalyzed
of riboflavin and its ring-substituted analogs. inter- and intramolecular 2e/1e electron-
Methods Enzymol 122:240–248 transfer reactions. J Am Chem Soc
59. Ulrich EL, Westler WM, Markley JL (1983) 109:7677–7688
Reassignments in the 1H NMR spectrum of 72. Niemz A, Rotello VM (1996) Model systems
flavin adenine dinucleotide by two- for flavoenzyme activity. The effects of specific
dimensional homonuclear chemical shift hydrogen bonds on the 13C and 1H NMR of
correlation. Tetrahedron Lett 24:473–476 flavins. J Mol Recognit 9:158–162
298 Franz Müller
73. Caldwell ST, Cooke G, Hewage SG, Mabruk 84. Lauterwein J, Hemmerich P, Lhoste J-M
S, Rabani G, Rotello V, Smith BO, Subramani (1972) Proton magnetic-resonance studies of
C, Woisel P (2008) Model systems for flavo- flavoquinone–metal complexes. Z Naturforsch
enzyme activity: intramolecular self-assembly 27B:1047–1049
of a flavin derivative via hydrogen bonding 85. Lauterwein J, Hemmerich P, Lhoste J-M
and aromatic interactions. Chem Commun (1975) Flavoquinone–metal complexes. II.
(Camb) 35:4126–4128 Paramagnetic interactions. Inorg Chem
74. Deans R, Rotello VM (1996) Model systems 14:2161–2168
for flavoenzyme activity. 2-Aminopyridines as 86. Kierkegaard P, Leijonmarck M, Werner P-E
spectroscopic models for flavoenzyme active (1972) Studies on flavin derivatives. X-ray
sites. Tetrahedron Lett 37:4435–4438 structure investigation of 1′,2′,3′,4′-tetraacetyl-
75. Chattopadhyay P, Nagpal R, Pandey PS 3-ethyl-riboflavin zinc-chelate perchlorate.
(2008) Recognition properties of flavin Acta Chem Scand 26:2980–2982
analogues with bile acid-based receptors: 87. Heilmann O, Hornung FM, Fiedler J, Kaim
role of steric effects in hydrogen bond based W (1999) Organometallic iridium(III) and
molecular recognition. Aust J Chem 61: rhenium(I) complexes with lumazine, alloxa-
216–222 zine and pterin derivatives. J Organomet
76. Rai R, Pandey PS (2005) Comparative bind- Chem 589:2–10
ing study of steroidal adenine with flavin and 88. Kaim W, Schwederski B, Heilmann O,
uracil derivatives. Bioorg Med Chem Lett Hornung FM (1999) Coordination com-
15:2923–2925 pounds of pteridine, alloxazine and flavin
77. Manesiotis P, Hall AJ, Courtois J, Irgum K, ligands: structures and properties. Coord
Sellergren B (2005) An artificial riboflavin Chem Rev 182:323–342
receptor prepared by a template analogue 89. Clarke MJ, Dowling MG, Garafalo AR,
imprinting strategy. Angew Chem Int Ed Brennan TF (1980) Structural and electronic
44:3902–3906 effects resulting from metal-flavin ligation. J
78. Evstigneev MP, Rozvadovskaya AO, Biol Chem 255:3472–3481
Chubarov AS, Hernandez Santiago AA, 90. Miyazaki S, Kojima T, Fukuzumi S (2008)
Davies DB, Veselkov AN (2005) Structural Photochemical and thermal isomerization of a
and thermodynamic analysis of heteroassocia- ruthenium(II)–alloxazine complex involving
tion of daunomycin and flavin mononucleo- an unusual coordination mode. J Am Chem
tide molecules in water by 1H NMR Soc 130:1556–1557
spectroscopy. J Struct Chem 46:67–74 91. Miyazaki S, Ohkubo K, Kojima T, Fukuzumi
79. Evstigneev MP, Rozvadovskaya AO, S (2007) Modulation of characteristics of a
Hernandez Santiago AA, Mukhina YV, ruthenium-coordinated flavin analogue that
Veslekov KA, Rogova OV, Davies DB, shows an unusual coordination mode. Angew
Veselkov AN (2005) A 1H NMR study of the Chem Int Ed 46:905–908
association of caffeine with flavin mononucle- 92. Hornung FM, Heilmann O, Kaim W, Zalis S,
otide in aqueous solution. Russ J Phys Chem Fiedler J (2000) Metal vs ligand reduction in
79:573–578 complexes of 1,3-diemthylalloxazine (DMA)
80. Evstigneev MP, Mukhina YV, Davies DB with copper(I), ruthenium(II), and
(2006) 1H NMR study of the hetero- tungsten(VI). Crystal structures of (DMA)
association of flavin-mononucleotide with WO2Cl2 and (bis(1-methylimidazol-2-yl)
mutagenic dyes: ethidium bromide and pro- ketone)WO2Cl2. Inorg Chem 39:4052–4058
flavine. Mol Phys 104:647–654 93. Kaufmann HL, Carroll PJ, Burgmayer SJN
81. Andrejuk DD, Hernandez Santiago AA, (1999) Molybdenum–pterin chemistry. 2.
Khomich VV, Voronov VK, Davies DB, Reinvestigation of molybdenum (IV) coor-
Estigneev MP (2008) Structural and thermo- dination by flavin gives evidence for partial
dynamic analysis of the hetero-association of pteridine reduction. Inorg Chem 38:
theophylline with aromatic drug molecules. J 2600–2606
Mol Struct 889:229–236 94. Benno RH, Fritchie CJ Jr (1973) Metal–fla-
82. Evstigneev MP, Mykhina YV, Davies DB vin interactions: the crystal structure of bis-
(2005) Complexation of daunomycin with a (10-methylisoalloxazine) silver nitrite
DNA oligomer in the presence of an aromatic tetrahydrate and similar disordered nitrate–
vitamin (B2) determined by NMR spectros- nitrite. Acta Cryst B 29:2493–2502
copy. Biophys Chem 118:118–127 95. Fritchie CJ Jr (1972) The structure of a
83. Lauterwein J, Hemmerich P, Lhoste J-M metal-flavin complex. 10-Methylisoalloxazine
(1975) Flavoquinone–metal complexes. I. silver nitrate. J Biol Chem 247:7459–7464
Structure and properties. Inorg Chem 14: 96. Wade TD, Fritchie CJ Jr (1973) The crystal
2152–2161 structure of a riboflavin-metal complex.
NMR Spectroscopy on Flavins and Flavoproteins 299
124. Reibenspies JH, Guo F, Rizzo CJ (2000) in bacterial luciferase. Biochemistry 25:
X-ray crystal structures of conformationally 8062–8067
biased flavin models. Org Lett 2:903–906 138. Žurek J, Cibulka R, Dvořáková H, Svoboda J
125. Wouters J, Evrard G, Durant F (1995) (2010) N1, N10-ethylen-bridged flavinium
Lumiflavinium (7,8,10-trimethyl-isoalloxazinium) salts derived from l-valinol: synthesis and cata-
nitrate. Acta Cryst C51:1223–1227 lytic activity in H2O2 oxidations. Tetrahedron
126. Zheng Y-J, Ornstein RL (1996) A theoretical Lett 51:1083–1086
study of structures of flavin in different oxida- 139. Müller F, Lee J (2001) A convenient method
tion and protonation states. J Am Chem Soc to prepare labile FMN derivatives. Molecules
118:9402–9408 6:825–830
127. Hall LH, Orchard BJ, Tripathy SK (1987) 140. Müller F (1971) On the reaction of flavins
The structure and properties of flavins: molec- with alcohols. In: Kamin H (ed) Flavins and
ular orbital study based on totally optimized flavoproteins. University Park Press, London,
geometries. I. Molecular geometry investiga- pp 363–373
tions. Int J Quantum Chem 31:195–216 141. Müller F, Grande HJ, Jarbandhan T (1976)
128. Hall LH, Orchard BJ, Tripathy SK (1987) On the interaction of flavins with oxygen ions
The structure and properties of flavins: molec- and molecular oxygen. In: Singer TP (ed)
ular orbital study based on totally optimized Flavins and flavoproteins. Elsevier Scientific
geometries. II. Molecular orbital structure Publishing Co., Amsterdam, pp 38–50
and electron distribution. Int J Quantum 142. Szczesna V, Müller F, Vervoort J (1990)
Chem 31:217–242 Synthesis and properties of a new dihydrofla-
129. van Schagen CG, Müller F (1980) A com- vin: reduction of a flavinium salt by borocya-
parative 13C-NMR. study on various reduced nohydride. Helv Chim Acta 73:1669–1678
flavins. Helv Chim Acta 63:2187–2201 143. van Schagen CG, Grande HJ, Müller F
130. Macheroux P, Ghisla S, Sanner C, Rüterjans (1978) The structure of σ-complexes between
H, Müller F (2005) Reduced flavin: NMR flavinium salts and methoxide as revealed by
13
investigation of N(5)-H exchange mecha- C nuclear magnetic resonance. Recl Trav
nism, estimation of ionization constants and Chim Pays-Bas 97:179–180
assessment of properties as biological catalyst. 144. Bolognesi M, Ghisla S, Incoccia L (1978)
BMC Biochem 6:26–36 The crystal and molecular structure of two
131. Moonen CTW, Vervoort J, Müller F (1984) models of catalytic flavo(co)enzyme interme-
Carbon-13 nuclear magnetic resonance study diates. Acta Cryst B34:821–828
on the dynamics of the conformation of 145. Sanner C, Rüterjans H, Müller F, unpub-
reduced flavin. Biochemistry 23:4868–4872 lished work
132. Tauscher L, Ghisla S, Hemmerich P (1973) 146. van Duin M, Peters JA, Kieboom APG, van
NMR.-study of nitrogen inversion and con- Bekkum H (1984) Studies on borate esters I.
formation of 1,5-dihydro-isoalloxazones The pH dependence of the stability of esters
('reduced flavin'). Helv Chim Acta 56: of boric acid and borate in aqueous medium
630–644 as studied by 11B-NMR. Tetrahedron
133. Hall LH, Bowers ML, Durfor CN (1987) 40:2901–2911
Further consideration of flavin coenzyme bio- 147. van Duin M, Peters JA, Kieboom APG, van
chemistry afforded by geometry-optimized Bekkum H (1985) Studies on borate esters II.
molecular orbital calculations. Biochemistry Structure and stability of borate esters of
26:7401–7409 polyhydroxycarboxylates and related polyols
134. Rodríguez-Otero J, Martínez-Núñez E, in aqueous alkaline media as studied by 11B-
NMR
Peña-Gallego A, Vázquez SA (2002) The role . Tetrahedron 41:3411–3421
of aromaticity in the planarity of lumiflavin. J 148. Zhu J, Wu G (2010) Quadrupole central
Org Chem 67:6347–6352 transition 17O NMR spectroscopy of biologi-
135. Rizzo CJ (2001) Further computational studies cal macromolecules in aqueous solution. J Am
on the conformation of 1,5-dihydrolumiflavin. Chem Soc 133:920–932
Antioxid Redox Signal 3:737–746 149. Müller F, unpublished data
136. Salomon M, Eisenreich W, Dürr H, Schleicher 150. Nishina Y, Sato K, Miura R, Matsui K, Shiga
E, Knieb E, Massey V, Rüdiger W, Müller F, K (1998) Resonance Raman study on reduced
Bacher A, Richter G (2001) An optomechani- flavin in purple intermediate of flavoenzyme:
cal transducer in the blue light receptor pho- use of [4-carbonyl-18O]-enriched flavin. J
totropin from Avena sativa. Proc Natl Acad Biochem 124:200–208
Sci U S A 98:12357–12361 151. Delseth C, Nguyen TT-T, Kitzinger J-P
137. Vervoort J, Müller F, Lee J, van den Berg (1980) Oxygen-17 and carbon-13 nuclear
WAM, Moonen CTW (1986) Identification magnetic resonance. Chemical shifts of unsat-
of the true carbon-13 nuclear magnetic reso- urated carbonyl compounds and acyl deriva-
nance spectrum of the stable intermediate II tives. Helv Chim Acta 63:498–503
NMR Spectroscopy on Flavins and Flavoproteins 301
152. Dudley KH, Hemmerich P (1967) Stabile 164. Macheroux P, Kojiro CL, Schopfer LM,
dihydroflavine und quartäre flaviniumsalze. Chakraborty S, Massey V (1990) 19F NMR
Studien in der flavinreihe. 12. Mitteilung. studies on 8-fluoroflavins and 8-fluoro flavo-
Helv Chim Acta 50:355–363 proteins. Biochemistry 29:2670–2679
153. Müller F, van Berkel WJH (1982) A study on 165. Miura R, Kasai S, Horiike K, Sugimoto K,
p-hydroxybenzoate hydroxylase from Matsui K, Yamano T, Miyake Y (1983)
Pseudomonas fluorescens. A convenient 8-fluoro-8-demethylriboflavin as a 19F-probe
method of preparation and some properties of for flavin-protein interaction. A 19F NMR
the apoenzyme. Eur J Biochem 128:21–27 study with egg white riboflavin binding pro-
154. van Berkel WJH, van den Berg WAM, Müller tein. Biochem Biophys Res Commun 110:
F (1988) Large-scale preparation and recon- 406–411
stitution of apo-flavoproteins with special ref- 166. Monaco HL (1997) Crystal structure of
erence to butyryl-CoA dehydrogenase from chicken riboflavin-binding protein. EMBO J
Megasphaera elsdenii. Hydrophobic interac- 16:1475–1483
tion chromatography. Eur J Biochem 167. Murthy YVSN, Massey V (1995) Chemical
178:197–207 modification of the N-10 ribityl side chain of
155. Gostimskaya IS, Grivennikova VG, Cecchini flavins. Effects on properties of flavoprotein
G, Vinogradov AD (2007) Reversible disso- disulfide oxidoreductases. J Biol Chem
ciation of flavin mononucleotide from mam- 270:28586–28594
malian membrane-bound NADH:ubiquinone 168. Murthy YVSN, Massey V (1996) 19F NMR
oxidoreductase (complex I). FEBS Lett studies with 2′-F-2′-deoxyarabinoflavoproteins.
581:5803–5806 J Biol Chem 271:19915–19921
156. Fruk L, Kuo C-H, Torres E, Niemeyer CM 169. Miller SM (1993) 2′-Fluoro-2′-deoxy-
(2009) Apoenzyme reconstitution as a chemi- arabino-FAD: effects on the formation and
cal tool for structural enzymology and bio- stability of 2-electron reduced mercuric ion
technology. Angew Chem Int Ed reductase. In: Yagi K (ed) Flavins and flavo-
48:1550–1574 proteins. De Gruyter, Berlin, pp 575–582
157. Husain M, Massey V (1978) Reversible reso- 170. Visser NV, Westphal AH, Nabuurs SM, van
lution of flavoproteins into apoproteins and Hoek A, van Mierlo CPM, Visser AJWG,
free flavins. Methods Enzymol 53:429–437 Broos J, van Amerongen H (2009)
158. Hefti MH, Milder FJ, Boeren S, Vervoort J, 5-Fluorotryptophan as dual probe for ground-
van Berkel WJH (2003) A His-tag based state heterogeneity and excited-state dynam-
immobilization method for the preparation ics in apoflavodoxin. FEBS Lett
and reconstitution of apoflavoproteins. 583:2785–2788
Biochim Biophys Acta 1619:139–143 171. Miura R (1989) 19F-NMR study on the inter-
159. Mathes T, Vogel C, Stolz J, Hegemann P action of fluorobenzoate with porcine kidney
(2009) In vivo generation of flavoproteins D-amino acid oxidase. J Biochem
with modified cofactors. J Mol Biol 385: 105:318–322
1511–1518 172. Sun Z-Y, Truong H-TN, Pratt EA, Sutherland
160. van Müller F, Berkel WJH (1991) Methods DC, Kulig CE, Homer RJ, Groetsch SM,
used to reversibly resolve flavoproteins into Hsue PY, Ho C (1993) A 19F-NMR study of
the constituents apoflavoprotein and pros- the membrane-binding region of D-lactate
thetic group. In: Müller F (ed) Flavins and dehydrogenase of Escherichia coli. Protein Sci
flavoproteins. CRC, Boca Raton, FL, pp 2:1938–1947
261–274 173. Moonen CTW, Müller F (1982) Structural
161. Hefti MH, Vervoort J, van Berkel WJH and dynamic information on the complex of
(2003) Deflavination and reconstitution of Megasphaera elsdenii apoflavodoxin and ribo-
flavoproteins. Tackling fold and function. Eur flavin 5′-phosphate. A phosphorus-31 nuclear
J Biochem 270:4227–4242 magnetic resonance study. Biochemistry
162. van der Bolt FJT, van den Heuvel RHH, 21:408–414
Vervoort J, van Berkel WJH (1997) 19F NMR 174. Vervoort J, Müller F, Mayhew SG, van den
study on the regiospecificity of hydroxylation Berg WAM, Moonen CTW, Bacher A (1986)
of tetrafluoro-4-hydroxybenzoate by wild- A comparative carbon-13, nitrogen-15, and
type and Y385F p-hydroxybenzoate hydrox- phosphorus-31 nuclear magnetic resonance
lase: evidence for a consecutive oxygenolytic study on the flavodoxins from Clostridium
dahalogenation mechanism. Biochemistry MP, Megasphaera elsdenii, and Azotobacter
36:14192–14201 vinelandii. Biochemistry 25:6789–6799
163. Moonen MJH, Rietjens IMCM, van Berkel 175. Otvos JD, Krum DP, Masters BSS (1986)
WJH (2001) 19F NMR study on the biologi- Localization of the free radical on the flavin
cal Baeyer–Villiger oxidation of acetophe- mononucleotide of the air-stable semiqui-
nones. J Ind Microbiol Biotechnol 26:35–42 none state of NADPH–cytochrome P-450
302 Franz Müller
reductase using 31P NMR spectroscopy. yeast old yellow enzyme. J Biochem
Biochemistry 25:7220–7228 99:907–914
176. James TL, Edmondson DE, Husain M (1981) 186. Griffin KJ, Degala GD, Eisenreich W, Müller
Glucose oxidase contains a disubstituted F, Bacher A, Frerman FE (1998) 13P-NMR
phosphorus residue. Phosphorus-31 nuclear spectroscopy of human and Paracoccus denit-
magnetic resonance studies of the flavin and rificans electron transfer flavoproteins, and
13
nonflavin phosphate residues. Biochemistry C- and 15N-NMR spectroscopy of human
20:617–621 electron transfer flavoprotein in the oxidised
177. Edmondson DE, James TL (1979) Covalently and reduced states. Eur J Biochem
bound non-coenzyme phosphorus residues in 255:125–132
flavoproteins: 31P nuclear magnetic resonance 187. Pust S, Vervoort J, Decker K, Bacher A, Müller
studies of Azotobacter vinelandii. Proc Natl F (1989) 13C, 15N, and 31P NMR studies on
Acad Sci U S A 76:3786–3789 6-hydroxy-l-nicotine oxidase from Arthrobacter
178. Klugkist J, Voorberg J, Haaker H, Veeger C oxidans. Biochemistry 28:516–521
(1986) Characterization of three different fla- 188. Eisenreich W, Kemter K, Bacher A, Mulrooney
vodoxins from Azotobacter vinelandii. Eur J SB, Williams CH, Müller F (2004) 13C-, 15N-
Biochem 155:33–40 and 31P-NMR studies of oxidized and reduced
179. Gangeswaran R, Eady RR (1996) Flavodoxin low molecular mass thioredoxin reductase
1 of Azotobacter vinelandii: characterization and some mutant proteins. Eur J Biochem
and role in electron donation to purified 271:1437–1452
assimilatory nitrate reductase. Biochem J 189. Vervoort J, van Berkel WJH, Müller F,
317:103–108 Moonen CTW (1991) NMR studies on
180. Stockman BJ, Westler WM, Mooberry ES, p-hydroxybenzoate hydroxylase from
Markley JL (1988) Flavodoxin from Anabena Pseudomonas fluorescens and salicylate hydrox-
7120: uniform nitrogen-15 enrichment and ylase from Pseudomonas putida. Eur J
hydrogen-1, nitrogen-15 and phosphorus-31 Biochem 200:731–738
NMR investigations of the flavin mononucle- 190. Gomez-Moreno C, Sancho J, Fillat M, Pueyo
otide binding site in the reduced and oxidized JJ, Edmondson DE (1987) Complex forma-
states. Biochemistry 27:136–142 tion between ferredoxin-NADP+-oxidoreduc-
181. Thorneley RNF, Abell C, Ashby GA, tase and flavodoxin. In: Edmondson DE,
Drummond MH, Eady RR, Huff S, McCormick DB (eds) Flavins and flavopro-
Macdonald CJ, Shneier A (1992) teins. de Gruyter, Berlin, pp 335–339
Posttranslational modification of Klebsiella 191. Davis MD, Edmondson DE, Müller F (1984)
31
pneumoniae flavodoxin by covalent attach- P Nuclear magnetic resonance and chemical
ment to coenzyme A, shown by 31P NMR and studies of the phosphorus residues in bovine
electrospray mass spectrometry, prevents elec- milk xanthine oxidase. Eur J Biochem
tron transfer from the nifJ protein to nitroge- 145:237–243
nase. A possible new regulatory mechanism 192. Evrard A, Zeghouf M, Fontecave M, Roby C,
for biological nitrogen fixation. Biochemistry Covès J (1999) 31P nuclear magnetic reso-
31:1216–1224 nance study of the flavoprotein component of
182. Miller MS, Mas MT, White HB (1984) the Escherichia coli sulfite reductase. Eur J
Highly phosphorylated region of chicken Biochem 261:430–437
riboflavin-binding protein: chemical charac- 193. Nonaka Y, Fujii S, Yamano T (1985)
terization and 31P NMR studies. Biochemistry Phosphorus-31 nuclear magnetic resonance
23:569–576 and electronic spectroscopic studies of adren-
183. Fleischmann G, Lederer F, Müller F, Bacher odoxin reductase and its binary complex with
A, Rüterjans H (2000) Flavin–protein inter- NADP+. J Biochem 97:1263–1271
actions in flavocytochrome b2 as studied by 194. Macheroux P, Sanner C, Büttner H, Kieweg
NMR after reconstitution of the enzyme with V, Rüterjans H, Ghisla S (1997) Medium-
13
C- and 15N-labelled flavin. Eur J Biochem chain acyl CoA dehydrogenase: evidence for
267:5156–5167 phosphorylation. Biol Chem
184. Beinert W-D, Rüterjans H, Müller F, Bacher 378:1381–1385
A (1985) Nuclear magnetic resonance studies 195. Bonants PJM, Müller F, Vervoort J, Edmondson
of the old yellow enzyme. 2. 13C NMR of the DE (1990) A 31P-nuclear-magnetic-resonance study of
enzyme recombined with 13C-labeled flavin NADPH-cytochrome-P-450 reductase and of the
mononucleotides. Eur J Biochem Azotobacter flavodoxin/ferredoxin-NADP+ reduc-
152:581–587 tase complex. Eur J Biochem 190:531–537
185. Miura R, Yamano T, Miyake Y (1986) 31P- 196. Gorenstein DG, Debojyoti K (1975) 31P
and 13C-NMR studies on the flavin-protein chemical shifts in phosphate diester monoan-
and flavin-ligand interactions in Brewer’s ions. Bond angle and torsional angle effects.
NMR Spectroscopy on Flavins and Flavoproteins 303
Biochem Biophys Res Commun 65: tochrome P450 from Bacillus megaterium.
1073–1080 Biochemistry 48:5131–5141
197. Gorenstein DG (1975) Dependence of 31P 208. Vervoort J, Müller F, LeGall J, Bacher A,
chemical shifts on oxygen–phosphorus–oxy- Sedlmaier H (1985) Carbon-13 and nitogen-
gen bond angles in phosphate esters. J Am 15 nuclear-magnetic-resonance investigation
Chem Soc 97:898–900 on Desulfovibrio vulgaris flavodoxin. Eur J
198. James TL, Ludwig ML, Cohn M (1973) Biochem 151:49–57
Dependence of the proton magnetic reso- 209. Beinert W-D, Rüterjans H, Müller F (1985)
nance spectra on the oxidation state of flavo- Nuclear magnetic resonance studies of the old
doxin from Clostridium MP and from yellow enzyme. 1. 15N NMR of the enzyme
Peptostreptococcus elsdenii. Proc Natl Acad Sci recombined with 15N-labeled flavin mononu-
U S A 70:3292–3295 cleotides. Eur J Biochem 152:573–579
199. Moonen CTW, Müller F, unpublished data 210. Stockman BJ, Krezel AM, Markley JL (1990)
200. Burnett RM, Darling GD, Kendall DS, Hydrogen-1, carbon-13 and nitrogen-15
LeQuesne ME, Mayhew SG, Smith WW, NMR spectroscopy of Anabaena 7120 flavo-
Ludwig ML (1974) The structure of the oxi- doxin: assignment of β-sheet and flavin bind-
dized form of clostridial flavodoxin at 1.9-Å ing site resonances and analysis of protein–flavin
resolution. Description of the flavin mono- interactions. Biochemistry 29:9600–9609
nucleotide binding site. J Biol Chem 211. Miura R, Miyake Y (1987) 13C-NMR studies
249:4383–4392 of procine kidney D-amino acid oxidase recon-
201. Moonen CTW, Vervoort J, Müller F (1984) stituted with 13C-enriched flavin adenine
Some new ideas about the possible regulation dinucleotide. Effects of competitive inhibi-
of redox potentials in flavoproteins, with spe- tors. J Biochem 101:581–589
cial reference to flavodoxins. In: Bray RC, 212. Moonen CTW, van den Berg WAM, Boerjan
Engel PC, Mayhew SG (eds) Flavins and fla- M, Müller F (1984) Carbon-13 and nitrogen-
voproteins. de Gruyter, Berlin, pp 493–496 15 nuclear magnetic resonance study on the
202. Live DH, Edmondson DE (1988) Studies of interaction between riboflavin and riboflavin-
phosphorylated sites in proteins using 1H–31P binding apoprotein. Biochemistry
two-dimensional NMR: further evidence for a 23:4873–4878
phosphodiester link between a seryl and a 213. Miura R, Tojo H, Fujii S, Yamano T, Miyake
threonyl residue in Azotobacter flavodoxin. J Y (1984) A 13C-NMR study on the interac-
Am Chem Soc 110:4468–4470 tion of riboflavin with egg white riboflavin
203. Vervoort J, van Berkel WJH, Mayhew SG, binding protein. J Biochem 96:197–206
Müller F, Bacher A, Nielsen P, LeGall J 214. Sanner C, Macheroux P, Rüterjans H, Müller
(1986) Properties of the complexes of ribofla- F, Bacher A (1991) 15N- and 13C-NMR inves-
vin 3′,5′-bisphosphate and the apoflavodoxins tigations of glucose oxidase from Aspergillus
from Megasphaera elsdenii and Desulfovibrio niger. Eur J Biochem 196:663–672
vulgaris. Eur J Biochem 161:749–756 215. Doherty GM, Mayhew SG, Malthouse JPG
204. Ueda T, Kato A, Kuramitsu S, Terasawa H, (1993) 13C-n.m.r. of the cyanalated apoflavo-
Shimada I (2005) Identification and charac- doxin and flavodoxin from Clostridium pas-
terization of a second chromophore of DNA teurianum. Biochem J 294:215–218
photolyase from Thermus thermophilus HB27. 216. Doherty GM, Motherway R, Mayhew SG,
J Biol Chem 280:36237–36243 Malthouse JPG (1992) 13C NMR of cyanyl-
205. Chang F-C, Bradley LH, Swenson RP (2001) ated flavodoxin from Megasphaera elsdenii
Evaluation of the hydrogen bonding interac- and of thiocyanate model compounds.
tions and their effects on the oxidation- Biochemistry 31:7922–7930
reduction potentials for the riboflavin complex 217. Miura R, Yamano T, Miyake Y (1986) The
of the Desulfovibrio vulgaris flavodoxin. heterogeneity of Brewer’s yeast old yellow
Biochim Biophys Acta 1504:319–328 enzyme. J Biochem 99:901–906
206. Bradley LH, Swenson RP (2001) Role of 218. Miura R, Nishina Y, Sato K, Fujii S, Kuroda
hydrogen bonding interactions to N(3)H of K, Shiga K (1993) 13C- and 15N-NMR studies
the flavin mononucleotide cofactor in the on medium-chain acyl-CoA dehydrogenase
modulation of the redox potential of the reconstituted with 13C- and 15N-enriched fla-
Clostridium beijerinckii flavodoxin. vin adenine dinucleotide. J Biochem
Biochemistry 40:8686–8695 112:106–113
207. Kasim M, Chen H-C, Swenson RP (2009) 219. Miura R, Miyake Y (1987) 13C-NMR studies
Functional characterization of the re-face loop on the reaction intermediates of porcine kid-
spanning residues 526–541 and its interac- ney D-amino acid oxidase reconstituted with
13
tions with the cofactor in the flavin C-enriched flavin adenine dinucleotide. J
mononucleotide-binding domain of flavocy- Biochem 102:1345–1354
304 Franz Müller
220. Ponstingl H, Otting G (1997) NMR assign- redox states of flavodoxin from Megasphaera
ments, secondary structure and hydration of elsdenii. A 500-MHz 1H NMR study. Eur J
oxidized Escherichia coli flavodoxin. Eur J Biochem 140:303–309
Biochem 244:384–399 233. Moonen CTW, Müller F (1984) A proton-
221. Moonen CTW, Müller F (1983) On the nuclear-magnetic-resonance study at 500
mobility of riboflavin 5′-phosphate in MHz on Megasphaera elsdenii flavodoxin. A
Megasphaera elsdenii favodoxin as studied by study on the stability, proton exchange and
13
C-nuclear-magnetic-resonance relaxation. the assignment of some resonance lines. Eur J
Eur J Biochem 133:463–470 Biochem 140:311–318
222. Ludwig ML, Schopfer LM, Metzger AL, 234. Langdon GM, Jiménez MA, Genzor CG,
Pattrige KA, Massey V (1990) Structure and Maldonado S, Sancho J, Rico M (2001)
oxidation-reduction behavior of 1-deaza- Anabaena apoflavodoxin hydrogen exchange:
FMN flavodoxins: modulation of redox on the stable exchange core of the α/β(21345)
potentials in flavodoxins. Biochemistry flavodoxin-like family. Proteins 43:476–488
29:10364–10375 235. Moonen CTW, Scheek RM, Boelens R,
223. Yalloway GN, Mayhew SG, Malthouse JPG, Müller F (1984) The use of two-dimensional
Gallagher ME, Curley GP (1999) pH- nuclear-magnetic-resonance spectroscopy and
dependent spectroscopic changes associated two-dimensional difference spectra in the elu-
with the hydroquinone of FMN in flavodox- cidation of the active center of Megasphaera
ins. Biochemistry 38:3753–3762 elsdenii flavodoxin. Eur J Biochem
224. McDonald CC, Phillips WD (1969) Proton 141:323–330
magnetic resonance spectra of proteins in 236. van Mierlo CPM, Vervoort J, Müller F,
random-coil configurations. J Am Chem Soc Bacher A (1990) A two-dimensional 1H
91:1513–1521 NMR study on Megasphaera elsdenii flavo-
225. Crespi HL, Norris JR, Katz JJ (1972) doxin in the reduced state. Sequential assign-
Magnetic resonance of isotope hybrid flavo- ments. Eur J Biochem 187:521–541
protein 2H-flavoprotein (1H-flavin mononu- 237. van Mierlo CPM, Müller F, Vervoort J (1990)
cleotide). Nat New Biol 236:178–180 Secondary and tertiary structure characteris-
226. Crespi HL, Norris JR, Rays JP, Katz JJ (1973) tics of Megasphaera elsdenii flavodoxin in the
ESR and NMR studies with deuterated flavo- reduced state as determined by two-
doxin. Ann New York Acad Sci 222:800–815 dimensional 1H NMR. Eur J Biochem
227. Pluta PL, Crespi HL, Klein M, Blake MI, 189:589–600
Studier MH, Katz JJ (1976) Biosynthesis of 238. van Mierlo CPM, Lijnzaad P, Vervoort J,
deuterated riboflavin: structure determination Müller F, Berendsen HJC, de Vlieg J (1990)
by NMR and mass spectrometry. J Pharm Sci Tertiary structure of two-electron reduced
65:362–366 Megasphaera elsdenii flavodoxin and some
228. Lubas B, Soltysik M, Steczko J, Ostrowski W implications, as determined by two-
(1977) Proton NMR study of the interaction dimensional 1H-NMR and restrained molecu-
of riboflavin with the egg-yolk apoprotein. lar dynamics. Eur J Biochem 194:185–198
FEBS Lett 79:179–182 239. van Mierlo CPM, van der Sanden BPJ, van
229. Blicharska B, Sagnowski S, Steczko J, Woensel P, Müller F, Vervoort J (1990) A
1
Ostrowski W (1977) Relaxation and line- two-dimensional H-NMR study on
width nuclear magnetic resonance of egg-yolk Megasphaera elsdenii flavodoxin in the oxi-
flavoproteins. In: Ostrowski W (ed) Flavins dized state and some comparisons with the
and flavoproteins: physicochemical properties two-electron reduced state. Eur J Biochem
and function. Polish Scientific Publishers, 194:199–216
Warsaw, Cracow, pp 51–61 240. Wijmenga SS, van Mierlo CPM (1991)
230. Favaudon V, LeGall J, Lhoste J-M (1976) Three-dimensional correlated NMR study of
Proton magnetic resonance of Desulfovibrio Megasphaera elsdenii flavodoxin in the oxi-
vulgaris and Desulfovibrio gigas flavodoxins. dized state. Eur J Biochem 195:807–822
In: Singer TP (ed) Flavins and flavoproteins. 241. Watt W, Tulinsky A, Swenson RP, Watenpaugh
Elsevier Scientific Publishing Co., Amsterdam, KD (1991) Comparison of the crystal struc-
pp 434–438 tures of a flavodoxin in its three oxidation
231. van Schagen CG, Müller F (1981) High reso- states at cryogenic temperatures. J Mol Biol
lution 1H NMR study at 360 MHz on the 218:195–208
flavodoxin from Megasphaera elsdenii. FEBS 242. Knauf MA, Löhr F, Curley GP, O’Farrell P,
Lett 136:75–79 Mayhew SG, Müller F, Rüterjans H (1993)
232. Moonen CTW, Müller F (1984) On the inter- Homonuclear and heteronuclear NMR
molecular electron transfer between different studies of oxidized Desulfovibrio vulgaris
NMR Spectroscopy on Flavins and Flavoproteins 305
tions for redox potential modulation. polarization study on flavin adenine dinucleo-
Biochemistry 33:15298–15308 tide and flavoproteins. Biochemistry
264. Clubb RT, Thanabal V, Osborne C, Wagner 21:402–407
G (1991) 1H and 15N resonance assignments 271. Richter G, Weber S, Römisch W, Bacher A,
of oxidized flavodoxin from Anacystis nidu- Fischer M, Eisenreich W (2005) Photochemically
lans with 3D NMR. Biochemistry 30: induced dynamic nuclear polarization in a
7718–7730 C450A mutant of the LOV2 domain of Avena
265. Champier L, Sibille N, Bersch B, Brutscher B, sativa blue-light receptor phototropin. J Am
Blackledge M, Coves J (2002) Reactivity, sec- Chem Soc 127:17245–17252
ondary structure, and molecular topology of 272. Eisenreich W, Joshi M, Weber S, Bacher A,
the Escherichia coli sulfite reductase flavodoxin- Fischer M (2009) Natural abundance solu-
like domain. Biochemistry 41:3770–3780 tion 13C NMR studies of a phototropin with
266. Chatwood LL, Müller J, Gross JD, Wagner G, photoinduced polarization. J Am Chem Soc
Lippard SJ (2004) NMR structure of the flavin 130:13544–13545
domain from soluble methane monooxygenase 273. Eisenreich W, Fischer M, Joshi M, Richter G,
reductase from Methylococcus capsulatus (Bath). Bacher A, Weber S (2009) Tryptophan 13C
Biochemistry 43:11983–11991 nuclear-spin polarization generated by intra-
267. Barsukov I, Modi S, Lian L-Y, Sze KH, Paine protein electron transfer in a LOV2 domain
JI, Wolf CR, Roberts CK (1997) 1H, 15N and of the blue-light receptor phototropin.
13
C NMR resonance assignment, secondary Biochem Soc Trans 37:382–386
structure and global fold of the FMN-binding 274. Keizers PHJ, Mersinli B, Reinle W, Donauer
domain of human cytochrome P450 reduc- J, Hiruma Y, Hannemann F, Overhand M,
tase. J Biomol NMR 10:63–75 Bernhardt R, Ubbink M (2010) A solution
268. Ellis J, Gutierrez A, Barsukov IL, Huang model of the complex formed by adrenodoxin
W-C, Grossmann JG, Roberts GC (2009) and adrenodoxin reductase determined by
Domain motion in cytochrome P450 reduc- paramagnetic NMR spectroscopy.
tase: conformational equilibria revealed by Biochemistry 49:6846–6855
NMR and small-angle x-ray scattering. J Biol 275. Ueda T, Kato A, Ogawa Y, Torizawa T,
Chem 284:36628–36637 Kuramitsui S, Iwai S, Terasawa H, Shimada I
269. Fantuzzi A, Meharenna YT, Briscoe PB, (2004) NMR study of repair mechanism of
Guerlesquin F, Sadeghi SJ, Gilardi G (2009) DNA photolyase by FAD-induced paramag-
Characterisation of the electron transfer and netic relaxation enhancement. J Biol Chem
complex formation between flavodoxin from 279:52574–52579
D. vulgaris and the haem domain of cyto- 276. Nabuurs SM, de Kort BJ, Westphal AH, van
chrome P450 BN3 from B. megaterium. Mierlo CPM (2010) Non-native hydrophobic
Biochim Biophys Acta 1787:234–241 interactions detected in unfolded apoflavo-
270. van Schagen CG, Müller F, Kaptein R (1982) doxin by paramagnetic relaxation enhance-
Photochemically induced dynamic nuclear ment. Eur Biophys J 39:689–698
Chapter 12
Abstract
Why apply solid-state NMR (SSNMR) to flavins and flavoproteins? NMR provides information on an
atom-specific basis about chemical functionality, structure, proximity to other groups, and dynamics of the
system. Thus, it has become indispensable to the study of chemicals, materials, catalysts, and biomolecules.
It is no surprise then that NMR has a great deal to offer in the study of flavins and flavoenzymes. In general,
their catalytic or electron-transfer activity resides essentially in the flavin, a molecule eminently accessible
by NMR. However, the specific reactivity displayed depends on a host of subtle interactions whereby the
protein biases and reshapes the flavin’s propensities to activate it for one reaction while suppressing other
aspects of this cofactor’s prodigious repertoire (Massey et al., J Biol Chem 244:3999–4006, 1969; Müller,
Z Naturforsch 27B:1023–1026, 1972; Joosten and van Berkel, Curr Opin Struct Biol 11:195–202, 2007).
Thus, we are fascinated to learn about how the flavin cofactor of one enzyme is, and is not, like the flavin
cofactor of another. In what follows, we describe how the capabilities of SSNMR can help and are begin-
ning to bear fruit in this exciting endeavor.
Key words Electronic structure of flavins, Solid-state NMR, Chemical shift, Chemical-shift anisotropy,
Dipolar coupling, Magic-angle spinning, Binding motifs
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_12, © Springer Science+Business Media New York 2014
307
308 Anne-Frances Miller
Fig. 1 Left: Structure of the oxidized flavin ring system showing the range of isotropic chemical shifts for the
oxidized state in flavoproteins via the width of the oval associated with a position and the value beside it
(quoted in ppm), based on Müller’s 1991 tabulation [28]. For the most chemically reactive and variable sites of
the reduced state, C(4a) and N(1), the range of isotropic chemical shifts is also reported in numeric form only
(red). The latter ranges are for the anionic reduced state and consider only the EH4 forms of the disulfide
reductases [28]. Right: Numbering used here for the different positions in the flavin ring
Solid-State NMR of Flavins and Flavoproteins 309
flavin have been isotopically labeled, the NMR spectra have been
fully assigned by conventional methods, and NMR has been used to
study both the protein’s and the flavin’s roles in activity [44–47].
Thus, although solution NMR requires some 10–20 mg of pure
protein per sample, the experiments are generally non-destructive
and the information content has been found to more than justify the
costs in protein preparation and 13C and 15N isotope incorporation.
The ability of NMR to discern distinctions between the elec-
tronics and conformations of flavins in different proteins is illus-
trated by Fig. 1, which shows that for individual positions of the
oxidized flavin ring the isotropic chemical shift δiso varies greatly
from protein to protein [28]. Not surprisingly, the positions that
play critical roles in reactivity are precisely those that are most
affected by the protein environment. The δiso of N(5) is found to
range over 42 ppm in the proteins surveyed by Müller [28], an
amount larger than the difference of 11.3 ppm between the δisos of
tetraacetyl riboflavin (TARF) in chloroform (dielectric of εr = 8)
and FMN in water (εr = 78). As discussed below, the shift range of
N(5) represents another unique spectroscopic opportunity offered
by oxidized flavins, which is related to the electronics that underlie
reactivity. Similarly in the reduced state, the C(4a) position plays a
particularly important role in reactivity and displays a 9.1 ppm
range of δiso values across proteins surveyed [28], again indicating
that distinctions between protein sites are larger than the differ-
ence between chloroform versus water (3.8 ppm).
Many flavins occur in large multicomponent assemblies that
tumble too slowly in solution to be amenable to solution NMR
[48]. Extreme examples include flavins in integral membrane com-
plexes such as complex I [49, 50]. Membrane proteins not only
comprise a very significant fraction of all biological proteins, but
there are also some types of enzymes, such as electron-transfer
complexes involved in energy transduction, that are almost always
associated with membranes or superstructures. Thus, a growing
effort has been focused on developing solid-state NMR (SSNMR)
instrumentation and methodology that can be applied to biological
systems [51–53]. SSNMR offers the exciting possibility of observ-
ing reaction intermediates or other transient species trapped by
rapid freezing [54–58]. SSNMR has been used to learn about con-
formational changes associated with energy transduction in bacte-
riorhodopsin [59], the protonation and tautomerization states of
an enzyme-bound thiamine cofactor [30, 60, 61] and other aspects
of enzymatic turnover [62]. We have initiated efforts to execute
similar experiments on flavins in flavoproteins [63]. Equally impor-
tant, however, we argue here that SSNMR can add additional
insight that goes beyond that available from solution NMR via its
ability to measure all three principal values of the chemical-shift
tensor [64], and to exploit the much larger dipolar couplings in
effect in the solid state that are almost averaged out of solution
310 Anne-Frances Miller
2.1 First NMR lines obtained for compounds in solution are very sharp, in
Impressions: the absence of chemical exchange. This conceals a wealth of infor-
The Significance mation, which is averaged to zero by rapid reorientation of the
of Chemical-Shift molecules as they tumble in solution. However, if the molecules
Anisotropy and Dipolar are immobilized in a solid, one acquires the possibility of recover-
Coupling ing these effects of dipolar coupling and chemical-shift anisotropy
(CSA). Figure 2 compares the 13C spectra of 3-methyl glutaric acid
(MGA) obtained in solution and as a powder. While four sharp
lines are observed in solution, and the lines are well separated in
the spectrum with no risk of overlap, they are very broad in the
solid state. The aliphatic lines are broadened by dipolar coupling to
the attached 1H’s and the resonance of the carboxyl carbons are
broadened by chemical-shift anisotropy. The sample used con-
tained only natural-abundance 13C (1.1 %) but had the carbon
positions been enriched in 13C one might also have observed dipo-
lar coupling between 13C atoms.
2.1.1 Chemical Shift If the signal from one molecule could be observed, it would be
found to depend on the molecule’s orientation in the magnetic
field. This orientation dependence, or anisotropy, is averaged to
zero for molecules free in solution because (in most cases) they
tumble and reorient faster than the frequency difference (in Hz)
between the signals for the different orientations, thus averaging
the differences to zero. The average position of a resonance in
solution is reported as the chemical shift δ (=δiso, the isotropic
chemical shift), which is the difference from the frequency of a
reference signal (commonly 4,4-dimethyl-4-silapentane-1-sulfonic
acid, DSS [67]), scaled by the reference frequency (to factor out
effects due to the magnetic field being used and to permit com-
parison of results by researchers with different spectrometers):
δ obs = (ν obs − ν ref ) / ν ref (1)
1
It is anticipated that advanced methods will be undertaken with assistance from experts who will be
thoroughly familiar with all material provided here, but the current presentation is intended to provide
sufficient background to motivate a collaboration by enabling biochemists to appreciate the opportunities,
participate in experimental design, and discuss the results.
Solid-State NMR of Flavins and Flavoproteins 311
Fig. 2 Comparison of the 13C NMR spectrum of 3-methyl glutaric acid (MGA) collected in solution (bottom) and
in the solid state (top). The solution-NMR spectrum was collected at 100 MHz for 13C with the benefit of the 1H
nuclear Overhauser effect enhancement (see ref. 65) and 1H decoupling during 2.6 s acquisition with 1 s
between scans, and the SSNMR spectrum was similarly collected based on cross-polarization from 1H (3 ms
at 60 kHz) and 60 kHz decoupling during 28 ms acquisition (SPINAL-64) with 5-s delays between scans at
75 MHz for 13C. Both spectra were collected at room temperature. The resonances are assigned to the carboxyl
groups near 180 ppm, the methylene carbons near 40 ppm the methyne carbon near 30 ppm and the methyl
carbon near 20 ppm [66]
2
This relationship between shielding and chemical shift is an approximation that is exact only when the
reference signal occurs at a frequency νref approaching that of the Larmor frequency, ν0. When νref is far from
the Larmor frequency, then δ = 106 × (σref − σobs)/(1 − σref) in ppm.
312 Anne-Frances Miller
3
The chemical-shift tensor looks like a 3 × 3 matrix whose content depends on what coordinate frame is
chosen. However, if we choose a Cartesian frame using the principal axes of the molecule’s shielding as X,
Y, and Z axes, the chemical shift tensor will have diagonal elements only and these will be δ11, δ22, and δ33.
For further information, see refs. 68, 69.
Solid-State NMR of Flavins and Flavoproteins 313
Fig. 3 Three chemical shift principal values for N(5) or N(1) of oxidized flavin and
three orientations of its tensor in a magnetic field. Orange arrows indicate the
rotation of the tensor in (a) to get that in (b) and the rotation of the tensor in (c)
to get that in (b). Chemical-shift principal values used are approximately those of
N(1) with adjustments to facilitate illustration. Inspired by Laws et al. [71]
∧ 1 ∧
e 2 0 ∑L x ,q n n∑
q r
3
L x ,q 0
σ xx , p = ∑n
q
(5b)
2m02c 2 En − E 0
4
Similar logic applies for aromatic carbons. For the examples of the C(6) and C(9) positions of the flavin
xylene ring, coupling of σCH and π* orbitals produces de-shielding tangential to the ring, and coupling of
σCC and π* orbitals produces de-shielding radial to the ring, both in the plane of the ring.
Solid-State NMR of Flavins and Flavoproteins 315
Fig. 4 Cartoon of flavin ring system showing the directions and magnitudes of the
principal components of the chemical-shift tensors calculated for each of the fla-
vin’s nitrogen positions. Geometry optimizations and GIAO (gauge-including atomic
orbital) calculations of chemical-shift tensors were performed using Gaussian 03,
the B3PW91 functional and the 6-311 (d,p) basis set [64]. Components of the
tensors pointing perpendicular to the ring system are not shown. Adapted with
permission from reference [64], copyright 2006 American Chemical Society
5
Müller et al. have popularized the designation of the N(5) and N(1) sites of oxidized flavins as “pyridine-
type” nitrogens, consistent with their aromaticity and possession of a non-bonded lone pair in the aromatic
plane as in pyridine. The N(3) and N(10) sites, and all four nitrogens of fully reduced flavin have three σ
bonds (versus two) and a lone pair roughly perpendicular to the plane of the three bonding partners, as in
pyrrole rings so they have been dubbed “pyrrole-type” nitrogens [28]. Because pyrroles are only 5-membered
rings and less aromatic, this notation should not be taken too literally [73].
316 Anne-Frances Miller
Fig. 5 Overlapping SSNMR signals of N(1), N(3), N(5) in [15N3-N(1),N(3),N(5)]-TARF powder. The experimental
spectrum (top, black) is compared with the simulated spectrum (burgundy) that is the sum of the simulated
signals of N(5) (simulated using the parameters δ11 = 675 ppm, δ22 = 380 ppm, and δ33 = −40 ppm), N(1)
(simulated using δ11 = 325 ppm, δ22 = 235 ppm, δ33 = 20 ppm), and N(3) (simulated using δ11 = 225 ppm,
δ22 = 130 ppm, δ33 = 90 ppm). Gaussian broadening of 800 Hz was used for all signals. Data were collected at
room temperature at 40 MHz for 15N using 16 ms ramped CP from 1H with a CP field of 46 kHz and 1H
decoupling during the 20 ms acquisition at 51 kHz. Simulations were performed using the Wsolids package
generously provided by K. Eichele [80] (Color figure online)
3.1 Concentrating The 15N signal of N(5) is extreme, but in fact most signals are much
the Signal broader in the solid state than in solution. Sensitivity is an issue not
only because the inherently broad signals are therefore shorter than
they would be if the same total intensity were concentrated in a line
that is 10 Hz wide, but also because the T1 relaxation times required
for recovery of magnetization between scans are generally longer in
solids than in solution, because mechanisms of relaxation that are
mediated by molecular reorientation are not operative.
To increase the signal-to-noise ratio, we observe the signal
while spinning the sample about an axis tipped by the magic angle
relative to the direction of the magnetic field (we use MAS, magic
angle spinning). The “magic angle” is θ = 54.74° relative to the
magnetic field and corresponds to the direction that is the body-
diagonal of a cube with the field along its Z edge (see Fig. 6). As the
sample rotates, those molecules that had their Z axes parallel to the
field get reoriented so that their Y axis is parallel to the field, and
then their X axis, etc.6 Thus, for each molecule the chemical shield-
ing in effect is continuously and rapidly varied. Because the “magic
angle” has the property that it interconverts the direction parallel
to the field (and thus the shielding that applies) with two mutually
perpendicular directions, and three perpendicular directions pro-
vide a complete description of the chemical shift that is possible
(there are only three principal values), rotation about the magic
angle averages the three principal chemical-shift values giving equal
weight to each. If the rotation occurs faster than the largest differ-
ence between principal values (the span of the static signal, in Hz)
then all molecules’ signals will be observed at the isotropic average
chemical shift. Thus, MAS suppresses the effects of chemical-shift
anisotropy [71] and concentrates signals broadened by chemical-
shift anisotropy into a single line with greatly improved
signal-to-noise.
When the span of the signal (in Hz) is greater than the spinning
speed, then we observe a signal at the isotropic shift and additional
“spinning side bands” spaced on either side at intervals equal to the
spinning speed, which extend over the span of the signal. Thus, for
broad signals such as that of N(5) in oxidized flavins, the signal
6
For molecules at arbitrary angles, a linear combination of the three principal axes is parallel to the field at
one moment, to be replaced with the same linear combination in which the three axes have been permuted
in the next. In the end, all three directions will have acquired equal weight regardless of the particular
linear combination.
Solid-State NMR of Flavins and Flavoproteins 319
intensity may be distributed among several lines but these are still
much stronger than the single broad static signal obtained without
MAS. Figure 7 compares the powder (static) spectrum of TARF
labeled with 15N at N(1), N(3), and N(5) (top) with the spectrum
obtained upon MAS at 5 kHz (middle), with the two spectra pre-
sented at the same vertical scale. Even the farthest-flung side bands
of N(5) can be discerned from the baseline in the spinning spec-
trum, whereas it is difficult to locate the edges of the static signal.
Furthermore, MAS makes it much easier to deconvolute contribu-
tions from different overlapping signals, as each signal produces a
separate set of side bands spaced about its own δiso by the MAS
speed (red, purple and blue combs on the middle spectrum).
Pulse sequences such as TOSS (total suppression of spinning
side bands [83]) additionally suppress any spinning side bands that
persist, thus providing simplified spectra with only one signal per
chemically distinct atom, even when the spinning speed does not
exceed the span of the signals (see below).
Figure 8 shows photographs of two representative sample contain-
ers used for MAS, called rotors. The larger rotor (5 mm outer diame-
ter) can contain some 120 mg of sample and can spin as fast as 13 kHz,
whereas the smaller (3.2 mm outer diameter) contains only some
10–20 mg. However, the closer proximity of the probe pickup coils in
the latter rotor results in greater signal per mg of sample, and the
smaller rotors spin at even higher speeds, up to 30 kHz in conven-
tional instrumentation and higher in higher-end probes. 120 mg
was once a great deal of sample, but given that NMR is non-destructive
and modern molecular biological methods permit production of this
much purified protein from 2 L of culture, it is not impossible.
Most biological samples are examined using smaller rotors and
probes that produce less heating, and thus protect sample integrity.
320 Anne-Frances Miller
Fig. 8 SSNMR rotors in comparison to a 1.8-cm coin. Rotors are 5 and 3.2 mm in
outer diameter. Between the two rotors are inserts used to contain the powder
sample within the central region of the rotor that is in the most sensitive volume
of the probe coils. The drive tips are at the lower ends of the rotors and can be
seen to be machined with channels that cause the rotor to spin when a stream
of gas is directed at them from the side
Solid-State NMR of Flavins and Flavoproteins 321
3.2 Recovering Modern NMR spectrometers and small rotors make it possible to
Information on the completely average the chemical-shift anisotropy for relatively nar-
Chemical-Shift Tensor row signals, concentrating the signal intensity in a single line at δiso
that is strong and more easily resolved from other signals. However,
this would lack the information content of the three separate prin-
cipal values (see above). A compromise allows much-improved sig-
nal-to-noise with significant resolution of signals, in conjunction
with the possibility of extracting all three chemical-shift principal
values: Samples are spun at speeds smaller than the total chemical-
shift anisotropy. Usually a series of spectra is collected with each
spectrum recorded at a different spinning speed (Fig. 9). For each
signal, side bands occur on either side of the isotropic chemical shift
spaced by the spinning speed and extending over the full CSA
range. In each set of lines, the one whose position is independent of
MAS speed represents δiso. When spinning at higher speeds there
will be fewer side bands and the individual bands will be observed
with higher signal-to-noise ratio. However, good reconstruction of
the underlying chemical-shift principal values requires that one
measure some 6–10 spinning-side-band intensities, so slower spin-
ning offers the complementary benefit of more bands. It is com-
mon to begin with rapid spinning for initial detection and
optimization of a signal that may be weak. Thereafter, spectra are
collected with different MAS speeds, and the intensities of all the
Fig. 9 15N-N(5) signal of oxidized TPARF in benzene at −60 °C showing the separation between spinning side
bands as a function of MAS speed (TPARF, tetraphenylacetylriboflavin [35]). The δiso is indicated by the orange
dotted line, and is seen to not move as the MAS speed is changed. The chemical shift is reported relative to liquid
ammonia. Spectra were obtained at 40 MHz for 15N with signal enhancement via 8 ms ramped CP at 50 kHz,
50 kHz decoupling during 20 ms acquisition and 5 s relaxation delay between scans [63]
322 Anne-Frances Miller
3.3 Overcoming Although the flavin ring has only four nitrogens, permitting their
Signal Overlap with resolution in one-dimensional MAS spectra despite their overlap-
a Second Dimension ping spectral ranges, there are too many carbons to permit separate
measurement of all the spinning side bands of all the overlapping
signals. In situations such as this, two-dimensional methods are the
better way to resolve overlapping signals. Figure 10 shows the
2D-PASS (phase-adjusted spinning side bands) experiment [86,
87] applied to 15N3-[N(1),N(3),N(5)] TARF [64]. In this spec-
trum the central trace displays the isotropic shift of each signal in
the spectrum; the trace below it displays the first down-field
spinning side band and subsequent traces display higher-order side
bands. Up-field spinning side bands are displayed in successive
traces above the central one (negative-order side bands). This
experiment separates the different spinning side bands from one
another via phase encoding and presents the side bands in different
rows in the indirect dimension according to the order of the side
band.7 For each signal, the Herzfeld-Berger analysis can be applied
to the spinning side bands [87] to obtain chemical-shift principal
values, as for one-dimensional spectra (above). The side-band pat-
terns of each of N(1), N(3), and N(5) are indicated by diagonal
dashed lines in the PASS spectrum shown in Fig. 10. The δiso values
are indicated by vertical lines that correlate them with a one-
dimensional MAS spectrum shown above. Other approaches use
7
The order of the side band is the frequency offset from the isotropic frequency, in units of MAS speed.
Higher frequency (down-field) side bands are positive-order bands.
Solid-State NMR of Flavins and Flavoproteins 323
4.1 The Dipolar SSNMR spectra can reveal the presence, proximity, and natures of
Interaction Between other nearby NMR-active nuclei via dipole–dipole interactions
Spins that are much larger in the solid state than in solution, with 1H–1H
couplings on the order of 40 kHz, and 1H–13C couplings on the
324 Anne-Frances Miller
Hˆ IS = −d (3 cos 2 θ − 1) I z S z
∧ ∧
(6a)
The dipolar coupling constant d is
µ γ γ
d = 0 I3 S (6b)
4π rIS
with μ0 being the permeability of vacuum.
Because of their larger γ, coupling between 1H’s can be very
large, to the point that the signal of one 1H can be 50 kHz wide.
At 500 MHz this corresponds to 100 ppm, much broader than the
1
H chemical shift dispersion [71]. This is the reason that
1
H-observed SSNMR is rarely used unless 1H is dilute. Lower-γ
Solid-State NMR of Flavins and Flavoproteins 325
nuclei such as 13C and 15N have more modest dipolar couplings
(γH ≈ γF > γP > γC > |γN|).8 Thus, even when 15N is present at 100 %
enrichment, dipolar coupling between pairs of 15N’s separated by
the inter-N distances of ≈2.4–4.2 Å applicable in flavins produces
coupling constants of only ≈80 Hz. Thus, the most important
couplings in practice are couplings between 1H and the observed
13
C or 15N. For a 13C, the dipolar-coupling constant for one
attached 1H is approximately 30 kHz [71]. Although a single dipo-
lar coupling would produce a distinctive lineshape with diagnostic
features that would permit calculation of the internuclear distance,
the most common situation corresponds to observation of 13C
present at natural abundance so that the significance of dipolar
coupling between pairs of 13C nuclei is negligible but each 13C sig-
nal is broadened by numerous strong couplings to different 1H
nuclei at a range of distances and orientations relative to the field,
producing a broad signal with few discernable features (see Fig. 2).
Spins need not correspond to atoms in the same molecule to influ-
ence one another via dipolar coupling; however, dipolar broaden-
ing is dominated by spins within ≈10 Å of those being observed
[71]. Thus, 1H belonging to an active-site residue that binds a
flavin could affect the 13C and 15N signals of the flavin.
4.2 Removing A number of techniques have been developed that can average the
Dipolar Line 1
H–13C or 1H–15N couplings to close to zero and permit acquisi-
Broadening via tion of spectra containing well-resolved lines (see Fig. 12). MAS is
Magic Angle Spinning particularly effective for modest couplings. Thus, Andrew and
Lowe exploited the (3 cos2θ − 1) dependence of dipolar coupling
noting that when 3 cos2θ − 1 = 0 then the dipolar coupling is zero.
By rotating samples about an axis tipped relative to the magnetic
field at the angle that makes this true, any component of rIS per-
pendicular to the rotation axis is averaged to zero and all that
remains is the component of rIS for which 3 cos2θ − 1 = 0 [89, 90]
(Fig. 6). It is no coincidence that the angle for which 3 cos2θ − 1 = 0
is θ = 54.74°, the magic angle. MAS can in principle eliminate line
broadening due to dipolar coupling if the spinning can be con-
ducted at a frequency higher than the dipolar linewidth. For 1H–
1
H coupling that is very challenging, but it can be accomplished by
modern instrumentation for the more modest couplings of 1H to
13
C or 15N [71] (see Fig. 12). Spinning speeds lower than the dipolar
coupling result in a series of spinning side bands separated from
one another by the spinning speed as for CSA.
4.3 Removing Dipolar In flavins we normally observe 13C, 15N, and 31P, which are not
Line Broadening via strongly coupled by dipolar coupling among themselves, with the
Decoupling result that their homonuclear dipolar coupling can be averaged to
8
For 1H, γH/(2π) = 42.58 MHz/T, for 19F, γF/(2π) = 40.05 MHz/T, for 31P, γP/(2π) = 17.24 MHz/T, for
C, γC/(2π) = 10.71 MHz/T, and for 15N, γN/(2π) = –4.32 MHz/T.
13
326 Anne-Frances Miller
Fig. 12 13C static powder spectrum (top, burgundy) compared with the effect of
MAS (purple) and then the further effect of decoupling (blue, note effect on the
methylene carbons near 40 ppm) and finally the use of TOSS to suppress spin-
ning side bands (black) [83]. Vertical scales are adjusted to produce comparable
final heights. The sample was spun at 3.25 kHz, 1H was excited, magnetization
was transferred to 13C by CP at a field strength of 60 kHz for 3 ms, and data were
acquired for 28 ms (in the absence of decoupling) or 110 ms (with 1H decoupling
using SPINAL-64 at 60 kHz). Data were acquired at 75 MHz for 13C at room
temperature by S. Pyszczynski
9
Typical dipolar couplings among 13C, 15N, or 31P do not exceed the 13-kHz MAS speeds accessible with
routine instrumentation.
Solid-State NMR of Flavins and Flavoproteins 327
Fig. 13 (a) CP pulse sequence wherein I nuclei are allowed to relax to recover polarization for a few seconds,
then excited via a 90° pulse lasting a few microseconds. Then I nuclei are allowed to cross-relax with S nuclei
via dipolar coupling between the two for an interval typically lasting 0.5–5 ms (longer times are needed for the
flavin N(5)), before S nuclei are observed over a data acquisition time on the order of 20–100 ms (FID, free
induction decay). (b) The Hartmann–Hahn matching condition is ωI = ωS but this cannot be achieved in the
laboratory frame where one is restricted to one choice of static field, however, in the rotating frame one can
irradiate I and S nuclei simultaneously with different intensities of radiation and thus subject them to different
transient CP field strengths producing ωI,1 = γI BI,1 = ωS,1 = γS BS,1
Fig. 14 Optimization of CP. (a) Height of glycine’s 15N signal produced by CP from
1
H as a function of increasing the field strength applied to 15N while the 1H CP
field is held constant. As the strength of the 15N cross-polarizing field increases,
15
N comes into double resonance with 1H (trial peaks 7–8) and then at higher
fields the rotating frame precession frequency of 15N exceeds that of 1H, and CP
efficiency drops again. Because this experiment was performed with MAS at
3 kHz, CP double resonance occurs twice, at ωN = ωH + ωMAS and ωN = ωH − ωMAS.
To minimize sample heating and probe instability, the lower-power optimum cor-
responding to ωN = ωH − ωMAS is generally chosen. Data were acquired at 40 MHz
for 15N at −60 °C, 0.25 ms CP time and 50 ms 1H decoupling (TPPM2) during
20 ms data acquisition time. (b) The duration of CP is varied and the amplitudes of
resonances of interest are monitored in order to identify the CP duration (“con-
tact time”) that achieves the best compromise in ability to observe all signals of
interest. In this instance, N(3) is polarized within the 3 ms interval of the first
spectrum, and is seen to decay when longer contact times are employed.
However, N(1), which lacks an attached H, builds up more slowly being best
observed with a contact time on the order of 12 ms. The lines shown are the δiso
lines but depending on the importance of being able to measure intensities of
weaker spinning side bands, a contact time may be chosen that favors the signal
with weaker side bands (such as N(5), see Fig. 7). Data were acquired at 40 MHz
for 15N based on CP from 1H at 50 kHz and 1H decoupling at 50 kHz (TPPM2) dur-
ing the 20 ms of acquisition. A recovery time of 10 s was allowed between scans
Hartman–Hahn match with 15N spins at one end of the N(5) signal
is not a very good match for spins at the other end of the signal.
In these cases the CP field strength is varied over the duration of
the CP interval so that all 15N spins are in match for a portion of the
time. Thus, spectra of 15N in flavins are collected using compromise
conditions that seek to observe different types of signal at once.
Analogous compromises apply to detection of the 13C spectrum,
which includes both methyl carbons that cross-polarize fast, and
330 Anne-Frances Miller
quaternary carbons that do not. The consequence is, that the signal
strengths cannot be related directly to the quantities of the sites
they represent. In the case of isolated flavins this is not a problem
since the different nitrogen sites (or carbon sites) are present in fixed
stoichiometries, but in samples containing more than one species,
CPMAS spectra cannot be used to d etermine relative abundance of
different components in a mixture unless careful calibrations of the
efficiencies of CP have been established for each type of site.
Rotating-frame longitudinal relaxation including magnetiza-
tion transfer to other spins also erodes the CP that is possible at
longer times (see Fig. 14b). The relaxation times are longer for
isolated spins, compensating somewhat for their slower buildups.
Thus, Fig. 14b shows that the signal of N(3) in oxidized flavin is
cross-polarized in the first 3 ms and then decays during longer CP
intervals while the signal of N(1) grows based on a slower CP from
more distant H’s. Some nuclei are too distant from the high-γ
nuclei to be detected efficiently in CP spectra. Alternately, rapid
internal dynamics may average out the dipolar couplings and elimi-
nate the benefits of CP.11 In the former case, direct detection (also
called direct polarization) is the most reliable, however, for sites
that do not cross-polarize efficiently due to rapid motions that
average away the dipolar coupling, INEPT transfer via J-coupling
(insensitive nuclei enhanced by polarization transfer [96]) can be
successful [97].
11
Due to the several factors that affect the efficiency and maximum amplitude of cross-polarization, the
amplitudes of signals observed by this means cannot be related simply to the concentration of corresponding
nuclei [71].
Solid-State NMR of Flavins and Flavoproteins 331
5.1 Sample In the past, the quantity of protein needed for SSNMR was higher
Quantities than that needed for solution NMR because much more efficient
and Temperature spin–spin relaxation pathways in the solid state result in shorter
of Observation windows of time for collection of data. Moreover despite the
shorter T2’s, long T1’s are common especially for low-γ nuclei, and
this can necessitate long relaxation delays between scans, further
diminishing the signal obtained per hour. However, new probe
designs optimize the efficiency with which high-power pulses are
coupled to the samples, as well as the efficiency of signal collection,
332 Anne-Frances Miller
5.2 More Than Worth Our studies on flavins in model systems demonstrate the informa-
It: Insights into Tuning tion content of SSNMR and its unique power to inform us on
of Flavin Reactivity by tuning of flavin electronic structure by the protein environment.
Hydrogen Bonds We have demonstrated that the SSNMR signal of N(5) (and N(1))
is uniquely sensitive to hydrogen bonding, as predicted by theory
and experiments on simpler molecules [72, 73, 81]. We have mea-
sured 10 ppm changes concentrated in individual chemical-shift
principal values produced by H-bonds to distant locations of the
flavin [63]. This demonstrates the ability of the flavin cofactor
to transmit effects of interactions with the uracil ring to reactive
positions elsewhere in the molecule. This ability is crucial to fla-
vin reactivity as it permits the reactive positions to remain available
to substrates, while nonetheless being amenable to tuning by inter-
actions with the protein at distant sites on the flavin ring system.
We have also shown that the chemical-shift principal values
measured by SSNMR respond differently to different types of
hydrogen bonding [63]. Therefore, it will be interesting to exam-
ine the spectroscopic signatures of other interactions reported to
tune flavin reactivity such as bending, local electrostatics and π
stacking. Moreover, we demonstrated that quantum chemical cal-
culations are able to replicate the observed effects of hydrogen
bonding, despite the extreme sensitivity of chemical shift to the
electronic structure of the flavin [63, 64, 118]. Thus, the SSNMR
measurements provide very stringent tests of the computations,
and computations that pass this test allow interpretation of the
SSNMR results in terms of the electronic structure of the flavins.
Indeed, SSNMR-validated computations of electron-density
Solid-State NMR of Flavins and Flavoproteins 333
5.3 NMR Signal A major drawback of NMR spectroscopy is the large amount of
Enhancement via sample needed, due to the very weak signal produced by NMR.
Dynamic Nuclear Dynamic nuclear polarization (DNP) has been used to enhance
Polarization Based NMR signal intensity by as much as 200-fold [122]. This game-
on Flavin Radicals changing approach has a strong history of exploiting the unique
properties of flavins. In brief, the weakness of signals obtained by
NMR stems from the fact that the energy quantum observed is very
small. This has the benefit of making NMR a non-destructive
method, however, it also causes the excited state to be so highly
populated that the excess ground state population as a fraction
of the total population (the polarization) is only 5 parts in 105
(at room temperature for 1H in a 500-MHz NMR magnet). The
signal strength is proportional to the polarization, which in turn is
proportional to magnetic field strength, nuclear magnetic moment
and inverse of temperature. Thus, the essence of DNP is to draw on
the large magnetic moment of an unpaired electron and transfer its
polarization to NMR nuclei for observation [123]. In theory
334 Anne-Frances Miller
Fig. 15 1H NMR enhancement by DNP based on the neutral flavin semiquinone of flavodoxin. Solid symbols plot
NMR enhancement as a function of duration of polarization transfer from the unpaired electron spin. Open
symbols plot NMR signal recovery based on simple longitudinal relaxation as a function of duration of interval
allowed, for comparison. Thus, DNP is seen to yield more intense NMR. The results are contrasted for the case
of 85 % uniformly deuterated flavodoxin (blue squares) versus proteated flavodoxin (red circles), showing that
DNP produces sevenfold signal enhancement in proteated flavodoxin but 15-fold signal enhancement in deu-
terated flavodoxin, at the cost of slower DNP (and T1 recovery). In both cases flavodoxin was suspended in
deuterated medium consisting of 30 % v/v 200 mM potassium phosphate buffer (pH 7.50) and 70 % v/v
deuterated glycerol, reduced to the semiquinone state using deuterated dithionite solution and frozen to 90 K.
Data were collected at 140 GHz for electrons and 211 MHz for the NMR frequency using a pulse sequence
including initial saturation of 1H spins to establish a common starting point, relaxation or polarization transfer
for a defined interval, excitation of 1H with a 90° pulse and then digitization of the 1H free induction decay.
Polarization transfer was accomplished by microwave irradiation at 2.5 W, whereas relaxation occurred in the
absence of microwave irradiation but in otherwise identical conditions. The larger NMR signal enhancement
obtained using deuterated flavodoxin can be understood in terms of the much slower rate of longitudinal
relaxation and thus dissipation of polarization [128]
Acknowledgements
References
of nitrogen inversion and conformation of 39. Van Schagen CG, Müller F (1980) A com-
1,5-dihydro-isoalloxaziones (‘reduced flavin’). parative 13C-NMR study on various reduced
Helv Chim Acta 56:630–644 flavins. Helv Chim Acta 63:2187–2201
27. Grande HJ, Gast R, van Schagen CG, van 40. Moonen CTW, Vervoort J, Müller F (1984)
Berkel WJH, Müller F (1977) 13C-NMR. Reinvestigation of the structure of oxidized
study on isoalloxazine and alloxazine deriva- and reduced flavin: carbon-13 and nitrogen-
tives. Helv Chim Acta 60:367–379 15 nuclear magnetic resonance study.
28. Müller F (1992) Nuclear magnetic resonance Biochemistry 23:4859–4867
studies on flavoproteins. In: Müller F (ed) 41. Löhr F, Mayhew SG, Rüterjans H (2000)
Chemistry and biochemistry of flavoenzymes. Detection of scalar couplings across NH⋅⋅⋅OP
CRC Press, Boca Raton, FL, pp 558–595 and OH⋅⋅⋅OP hydrogen bonds in a flavopro-
29. Eisenreich W, Kemter K, Bacher A, Mulrooney tein. J Am Chem Soc 122:9289–9295
SB, Williams CH Jr, Müller F (2004) 13C-, 15N- 42. Chang F-C, Swenson RP (1999) The mid-
and 31P-NMR studies of oxidized and reduced point potentials for the oxidized–semiqui-
low molecular mass thioredoxin reductase none couple for Gly57 mutants of the
and some mutant proteins. Eur J Biochem Clostridium beijerinckii flavodoxin correlate
271:1437–1452 with changes in the hydrogen-bonding inter-
30. Zhu J, Lau JYC, Wu G (2010) A solid-state action with the proton on N(5) of the reduced
17
O NMR study of L-tyrosine in different flavin mononucleotide cofactor as measured
ionization states: implications for probing by NMR chemical shift temperature depen-
tyrosine side chains in proteins. J Phys Chem dencies. Biochemistry 38:7168–7176
B 114:11681–11688 43. Bradley LH, Swenson RP (2001) Role of
hydrogen bonding interactions to N(3)H of
31. Gerothanassis IP (2010) Oxygen-17 NMR
the flavin mononucleotide cofactor in the
spectroscopy: basic principles and applications
modulation of the redox potentials of the
(part II). Prog Nucl Magn Reson Spectrosc
Clostridium beijerinckii flavodoxin.
57:1–110
Biochemistry 40:8686–8695
32. Wu G (2008) Solid-state 17O NMR studies of
44. Nash AI, McNulty R, Shillito ME, Swartz
organic and biological molecules. Prog Nucl
TE, Bogomolni RA, Luecke H, Gardner KH
Magn Reson Spectrosc 52:118–169
(2011) Structural basis of photosensitivity in
33. Niemz A, Rotello VM (1999) From enzyme a bacterial light-oxygen-voltage/helix-
to molecular device. Exploring the interde- turn-helix (LOV-HTH) DNA-binding pro-
pendence of redox and molecular recogni- tein. Proc Natl Acad Sci U S A 108:
tion. Acc Chem Res 32:44–52 9449–9454
34. Kainosho M, Kyogoku Y (1972) High-resolution 45. Yalloway GN, Löhr F, Wienk HL, Mayhew
proton and phosphorus nuclear magnetic SG, Hrovat A, Knauf MA, Rüterjans H
resonance spectra of flavin–adenine dinucleotide (2003) 1H, 13C and 15N assignment of the
and its conformation in aqueous solution. hydroquinone form of flavodoxin from
Biochemistry 11:741–752 Desulfovibrio vulgaris (Hildenborough) and
35. Koder RL, Lichtenstein BR, Cerda JF, Miller comparison of the chemical shift differences
A-F, Dutton PL (2007) A flavin analogue with respect to the oxidized state. J Biomol
with improved solubility in organic solvents. NMR 25:257–258
Tetrahedron Lett 48:5517–5520 46. Stockman BJ, Richardson TE, Swenson RP
36. Sedlmaier H, Müller F, Keller PJ, Bacher A (1994) Structural changes caused by site-
(1987) Enzymatic synthesis of riboflavin and directed mutagenesis of tyrosine-98 in
FMN specifically labeled with 13C in the Desulfovibrio vulgaris flavodoxin delineated by
xylene ring. Z Naturforsch 42C:425–429 1
H and 15N NMR spectroscopy: implications
37. Vervoort J, Müller F, Mayhew SG, van den for redox potential modulation. Biochemistry
Berg WAM, Moonen CTW, Bacher A (1986) 33:15298–15308
A comparative carbon-13, nitrogen-15 and 47. Peelen S, Vervoort J (1994) Two-dimensional
phosphorus-31 nuclear magnetic resonance NMR studies of the flavin binding site of
study on the flavodoxins from Clostridium Desulfovibrio vulgaris flavodoxin in its three
MP, Megasphaera elsdenii and Azotobacter redox states. Arch Biochem Biophys 314:
vinelandii. Biochemistry 25:6789–6799 291–300
38. Rüterjans H, Fleischmann G, Knauf M, Löhr 48. Daff S (2012) NO synthase: structures and
F, Blümel M, Lederer F, Mayhew SG, Müller mechanisms. Nitric Oxide 23:1–11
F (1996) NMR studies of flavoproteins. 49. Birrell JA, King MS, Hirst J (2011) A ternary
Biochem Soc Trans 24:116–121 mechanism for NADH oxidation by positively
338 Anne-Frances Miller
charged electron acceptors, catalyzed at the 62. McDermott A, Polenova T (2007) Solid state
flavin site in respiratory complex I. FEBS Lett NMR: new tools for insight into enzyme
585:2318–2322 function. Curr Opin Struct Biol 17:617–622
50. Araki K, Inaba K (2012) Structure, mecha- 63. Cui D, Koder RL Jr, Dutton PL, Miller A-F
nism, and evolution of Ero1 family enzymes. (2011) 15N solid-state NMR as a probe of fla-
Antioxid Redox Signal 16:790–799 vin H-bonding. J Phys Chem B
51. Hong M, Su Y (2011) Structure and dynam- 115:7788–7798
ics of cationic membrane peptides and pro- 64. Koder RL Jr, Walsh JD, Pometun MS, Dutton
teins: insights from solid-state NMR. Protein PL, Wittebort RJ, Miller A-F (2006) 15N
Sci 20:641–655 solid-state NMR provides a sensitive probe of
52. McDermott AE, Polenova T (eds) (2010) oxidized flavin reactive sites. J Am Chem Soc
Solid-state NMR Studies of Biopolymers. 128:15200–15208
John Wiley & Sons, Chichester UK 65. Claridge TDW (2009) High-Resolution
53. Paasch S, Brunner E (2010) Trends in solid- NMR Techniques in Organic Chemistry, 2nd
state NMR spectroscopy and their relevance edn. Elsevier Science, Oxford
for bioanalytics. Anal Bioanal Chem 66. Barich DH, Gorman EM, Zell MT, Munson
398:2351–2362 EJ (2006) 3-Methylglutaric acid as a 13C
54. Appleyard RJ, Shuttleworth WA, Evans JNS solid-state NMR standard. Solid State Nucl
(1994) Time-resolved solid-state NMR spec- Magn Reson 30:125–129
troscopy of 5-enolpyruvylshikimate-3-phosphate 67. Wishart DS, Bigam CG, Yao J, Abildgaard F,
synthase. Biochemistry 33:6812–6821 Dyson HJ, Oldfield E, Markley JL, Sykes BD
55. Moffat K, Henderson R (1995) Freeze trap- (1995) 1H, 13C and 15N chemical shift refer-
ping of reaction intermediates. Curr Opin encing in biomolecular NMR. J Biomol NMR
Struct Biol 5:656–663 6:135–140
56. Krebs C, Edmondson DE, Huynh BH (2002) 68. Widdifield CM, Schurko RW (2009)
Demonstration of peroxodiferric intermedi- Understanding chemical shielding tensors
ate in M-ferritin ferroxidase reaction using using group theory, MO analysis, and mod-
rapid freeze-quench Mössbauer, resonance ern density-functional theory. Concepts
Raman, and XAS spectroscopies. Methods Magn Reson Part A 34:91–123
Enzymol 354:436–454 69. Grant DM (2010) Chemical Shift Tensors.
57. Li Y, Krekel F, Ramilo CA, Amrhein N, Evans In: McDermott AE, Polenova T (eds) Solid-
JNS (1995) Time-resolved solid-state state NMR studies of biopolymers. John
REDOR NMR studies of UDP Wiley & Sons, Chichester
N-acetylglucosamine enolpyruvyl transferase. 70. Herzfeld J, Berger AE (1980) Sideband
FEBS Lett 377: 208–212 intensities in NMR spectra of samples spin-
58. Stoll S, Nejaty-Jahromy Y, Woodward JJ, ning at the magic angle. J Chem Phys 73:
Ozarowski A, Marletta MA, Britt RD (2010) 6021–6030
Nitric oxide synthase stabilizes the tetrahy- 71. Laws DD, Bitter H-ML, Jerschow A (2002)
drobiopterin cofactor radical by controlling Solid-state NMR spectroscopic methods in
its protonation state. J Am Chem Soc chemistry. Angew Chem Int Ed 41:
132:11812–11823 3096–3129
59. Bajaj VS, Mak-Jurkauskas ML, Belenky M, 72. Ramsey NF (1950) Magnetic shielding of
Herzfeld J, Griffin RG (2009) Functional and nuclei in molecules. Phys Rev 78:699–703
shunt states of bacteriorhodopsin resolved by 73. Solum MS, Altmann KL, Strohmeier M,
250 GHz dynamic nuclear polarization- Berges DA, Zhang Y, Facelli JC, Pugmire RJ,
enhanced solid-state NMR. Proc Natl Acad Grant DM (1997) 15N chemical shift principal
Sci U S A 106:9244–9249 values in nitrogen heterocycles. J Am Chem
60. Harbison GS, Herzfeld J, Griffin RG (1983) Soc 119:9804–9809
Solid-state nitrogen-15 nuclear magnetic res- 74. Wei Y, de Dios AC, McDermott AE (1999)
onance study of the Schiff base in bacteri- Solid-state 15N NMR chemical shift anisotropy
orhodopsin. Biochemistry 22:1–5 of histidines: experimental and theoretical
61. Lai J, Niks D, Wang Y, Domratcheva T, studies of hydrogen bonding. J Am Chem Soc
Barends TRM, Schwarz F, Olsen RA, Elliott 121:10389–10394
DW, Fatmi MQ, Chang CA, Schlichting I, 75. de Dios AC, Oldfield E (1994) Chemical
Dunn MF, Mueller LJ (2011) X-ray and NMR shifts of carbonyl carbons in peptides and pro-
crystallography in an enzyme active site: the teins. J Am Chem Soc 116:11485–11488
indoline quinonoid intermediate in tryptophan 76. Hertzfeld J, Gupta SKD, Farrar MR, Harbison
synthase. J Am Chem Soc 133:4–7 GS, McDermott AE, Pelletier SL, Raleigh DP,
Solid-State NMR of Flavins and Flavoproteins 339
Smith SO, Winkel C, Lugtenburg J, Griffin 91. Pines A, Gibby MG, Waugh JS (1973)
RG (1990) Solid-state 13C NMR study of tyro- Proton-enhanced NMR of dilute spins in
sine protonation in dark-adapted bacteriorho- solids. J Chem Phys 59:569–590
dopsin. Biochemistry 29:5567–5574 92. Bennett AE, Rienstra CM, Auger M, Lakshmi
77. deGroot HJM, Harbison GS, Herzfeld J, KV, Griffin RG (1995) Heteronuclear decou-
Griffin RG (1989) Nuclear magnetic reso- pling in rotating solids. J Chem Phys 103:
nance study of the Schiff base in bacteriorho- 6951–6958
dopsin: counterion effects on the 15N shift 93. Comellas G, Lopez JJ, Nieuwkoop AJ, Lemkau
anisotropy. Biochemistry 28:3346–3353 LR, Rienstra CM (2011) Straightforward,
78. de Dios AC (1996) Ab initio calculations of effective calibration of SPINAL-64 decoupling
the NMR chemical shift. Prog Nucl Magn results in the enhancement of sensitivity and
Reson Spectrosc 29:229–278 resolution of biomolecular solid-state NMR.
79. Veeman WS (1981) 13C chemical-shift tensors J Magn Reson 209:131–135
in organic single-crystals. Phil Trans R Soc A 94. Nelson BN, Schieber LJ, Barich DH, Lubach
Math Phys Eng Sci 299:629–641 JW, Offerdahl TJ, Lewis DH, Heinrich JP,
80. Eichele K, Wasylishen RE, Maitra K, Nelson Munson EJ (2006) Multiple-sample probe for
JH, Britten JF (1997) Single-crystal 31P and solid-state NMR studies of pharmaceuticals.
X-ray diffraction study of a molybdenum Solid State Nucl Magn Reson 29:204–213
phosphine complex: (5-methyl-
95. Hartmann SR, Hahn EL (1962) Nuclear
dibenzophosphole) pentacarbonylmolybde- double resonance in the rotating frame. Phys
num(0). Inorg Chem 36:3539–3544 Rev 128:2042–2053
81. Witanowski M, Sicinska W, Biernat S, Webb 96. Morris GA, Freeman R (1979) Enhancement
GA (1991) Solvent effects on nitrogen shield- of nuclear magnetic resonance signals by
ings in azines. J Magn Reson 91:289–300 polarization transfer. J Am Chem Soc 101:
82. Witanowski M, Stefaniak L, Webb GA (1981) 760–762
Nitrogen NMR Spectroscopy, vol 11B. Press, 97. Helmus JJ, Surewicz K, Surewicz WK,
New York, Acad Jaroniec CP (2010) Conformational flexibil-
83. Dixon WT, Schaefer J, Sefcik MD, Stejskal ity of Y145Stop human prion protein amyloid
EO, McKay RA (1982) Total suppression of fibrils probed by solid-state nuclear magnetic
sidebands in CPMAS C-13 NMR. J Magn resonance spectroscopy. J Am Chem Soc
Reson 49:341–345 132:2393–2403
84. Eichele K, Wasylishen RE (2012) HBA: 98. Gullion T, Schaefer J (1989) Rotational-echo
Herzfeld-Berger analysis program, Version double-resonance NMR. J Magn Reson
1.7.3. http://anorganik.uni-tuebingen.de/ 81:196–200
klaus/soft/index.php?p=hba/hba 99. Kovacs FA, Fowler DJ, Gallagher GJ,
85. Mason J (1996) Nitrogen NMR. In: Grant Thompson LK (2007) A practical guide for
DM, Harris RK (eds) Encyclopedia of NMR. solid-state NMR distance measurements in
Wiley, Sussex UK, pp 3222–3251 proteins. Concepts Magn Reson Part A
86. Antzutkin ON (1999) Sideband manipula- 30:21–39
tion in magic-angle-spinning nuclear mag- 100. Römisch W, Eisenreich W, Richter G, Bacher
netic resonance. Prog Nucl Magn Reson A (2002) Rapid one-pot synthesis of ribofla-
Spectrosc 35:203–266 vin isotopomers. J Org Chem 67:8890–8894
87. Antzutkin ON, Lee YK, Levitt MH (1998) 101. Kim HW, Perez JA, Ferguson SJ, Campbell
13
C and 15N-chemical shift anisotropy of ID (1990) The specific incorporation of
ampicillin and penicillin-V studied by labeled aromatic amino acids into proteins
2D-PASS and CP/MAS NMR. J Magn Reson through growth of bacteria in the presence of
135:144–155 glyphosate. Application to fluorotryptophan
88. Alderman DW, McGeorge G, Hu JZ, Pugmire labeling to the H+ATPase of Escherichia coli
RJ, Grant DM (1998) A sensitive, high reso- and NMR studies. FEBS Lett 272:34–36
lution magic angle turning experiment for 102. Tugarinov V, Kanelis V, Kay LE (2006)
measuring chemical shift tensor principal val- Isotope labeling strategies for the study of
ues. Mol Phys 95:1113–1126 high-molecular-weight proteins by solution
89. Andrew ER, Bradbury A, Eades RG (1958) NMR spectroscopy. Nat Protoc 1:749–754
Nuclear magnetic resonance spectra from a 103. Anderson LL, Marshall GR, Crocker E, Smith
crystal rotated at high speed. Nature 182:1659 SO, Baranski TJ (2005) Motion of carboxyl
90. Lowe IJ (1959) Free induction decays of terminus of Gα is restricted upon G protein
rotating solids. Phys Rev Lett 2:285–287 activation. A solution NMR study using
340 Anne-Frances Miller
EPR on Flavoproteins
Richard Brosi, Robert Bittl, and Christopher Engelhard
Abstract
Flavoproteins often employ radical mechanisms in their enzymatic reactions. This involves paramagnetic
species, which can ideally be investigated with electron paramagnetic resonance (EPR) spectroscopy.
In this chapter we focus on the example of flavin-based photoreceptors and discuss, how different EPR
methods have been used to extract information about the flavin radical’s electronic state, its binding
pocket, electron-transfer pathways, and about the protein’s tertiary and quaternary structure.
Key words ENDOR spectroscopy, Radical mechanisms, Photoreceptors, Transient EPR, Protein
structure
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_13, © Springer Science+Business Media New York 2014
341
342 Richard Brosi et al.
gx gy gz gx gy gz
Fig. 1 Continuous wave EPR spectra recorded at 360 GHz and high magnetic field. Left: Anionic FAD radical of
Aspergillus niger glucose oxidase at pH 10, 140 K. Right: Neutral FAD radical of Escherichia coli CPD pho-
tolyase, 200 K. The respective flavin structure diagrams are shown below. Adapted from [20, 30]
Fig. 2 Structure of the neutral flavin radical. Red arrows indicate positions which
are positively identifiable by ENDOR spectroscopy, shaded red for protons with
weaker couplings, which will show up in the matrix region of the ENDOR spec-
trum (<2 MHz coupling). The positions indicated by blue arrows can unequivo-
cally be identified by 2D-ESEEM spectroscopy [20, 55]
His354 His354
pH 6 pH 9.5
wild type wild type
His354Ala His354Ala
His358Ala His358Ala
A 1 A2 A1 A 2 A 3 A3 A1A2 A1 A2 A3 A3
6 8 10 12 6 8 10 12
hyperfine coupling / MHz hyperfine coupling / MHz
Fig. 4 Top: Cutout from the crystal structure of Drosophila melanogaster (6-4)
photolyase (pdb entry: “3CVU”), highlighting the active histidines in their proton-
ation state as well as the flavin cofactor. Bottom: X-Band ENDOR spectra of this
protein’s wild type with His354Ala and His358Ala mutations below. Red H(8α)
and blue H(1′) curves show these proton’s contributions to the overall signal.
Adapted from [22, 59]
Fig. 5 X-band ENDOR spectra of the neutral flavin radical in C(4a)-inhibited Avena sativa phototropin 1 LOV2
domain C450A. Below, several additional mutations in the vicinity of H8α. Left: Spectra recorded at 120 K
(dashed lines), 80 K (black lines) and 10 K (shaded gray). Right: Detail of the 10 K-spectra (dotted line) with
simulations of the spectral contributions of both H(1′) protons (green), H(6) (blue) and H(8α) (red), including a
residual isotropic coupling (orange) where necessary. Superpositions of all simulated tensors are shown in
solid black. Adapted from [21]
Cys450Ala Asn425Cys
Cys450Ala Asn425Ser
Cys450Ala Phe509Val
Cys450Ala Phe509Ala
Cys450Ala Leu496Val
Cys450Ala Leu496Ala
H8α coupling / MHz
Cys450Ala Leu496Val
Cys450Ala Phe509Val Cys450Ala
Cys250Ser
Cys450Ala
Cys450Ala Phe509Ala Cys450Ala Asn425Ser
Cys450Ala Asn425Cys Cys450Ala Leu496Ala
10
0
0 80K
–40 –20 0 +20 +40
freezing angle / ° 10K
5 10 15 20 25
radio frequency / MHz
Fig. 6 Left: DFT calculations of H(8α) hyperfine couplings as a function of the rotation angle of the 8α methyl
group (gray lines). The dots mark the isotropic hyperfine couplings of both methyl protons possible to obtain
from the measurements (see Fig. 5). Set in is a schematic side view of the isoalloxazine plane and the deter-
mined rotation angles in case of Cys450Ala and Cys450Ala/Asn425Cys. Right, top: Temperature behavior of
the isotropic H(8α) coupling peak amplitude for all examined mutations of A. sativa LOV2 as well as for inhib-
ited C. reinhardtii phototropin LOV2 Cys250Ser. Right, bottom: Direct comparison of X-band ENDOR spectra of
A. sativa LOV2 Cys450Ala/Asn425Cys and C. reinhardtii LOV2 Cys250Ser at 80 K and 10 K. Adapted from [21]
H1’a H8α
ENDOR signal / a.u.
H6
H1’b
4 Long-Range Interactions
4.1 Transient EPR To examine fast reactions like electron transfer involving radical
in the Investigation pairs or short-lived spin-polarized triplet states in the time domain,
of Radical Pairs transient EPR is employed [60, 61]. It is usually implemented as a
cw EPR technique where a laser flash triggers the light-dependent
formation of the spin system. By avoiding the lock-in detection of
standard cw-EPR, the time resolution for acquisition of the radical
species’ evolution can be pushed into the few nanosecond range
[62–64].
Interesting examples of short-lived radical pairs occur in DNA
photolyases and Cry proteins upon illumination with blue light.
These two protein classes show high homology, in sequence as well
as in structure [6, 65]. Both Cry and photolyases can undergo a
light-induced process, the so-called “light activation,” whereupon
the fully oxidized flavin abstracts an electron from either a nearby
tryptophan or tyrosine residue leading to the formation of a radical
pair [66, 67]. While the DNA repair mechanism discussed above is
uncommon in Cry [5, 6], they were shown to be essential media-
tors of the circadian clock [68–70] as well as light sensors for plant
sprouting [71, 72].
Point-mutation studies in E. coli CPD photolyase that replaced
each individual tryptophan showed that only the W306F mutant
prevented photoreduction [73], proving that Trp306 is the termi-
nus of the electron-transfer chain. As the distance between the fla-
vin isoalloxazine moiety and Trp306 is too large for a fast direct
electron transfer on the order of 30 ps [74], the electron transfer
has to be mediated through a chain of electron donors. In E. coli
CPD photolyase two tryptophans, Trp359 and Trp382, connect
the isoalloxazine moiety of FAD with Trp306 [40]. This amino-
acid chain is completely conserved throughout all structurally
characterized photolyases and is also found in cryptochromes.
These tryptophans have early on been postulated to be the main
electron transfer pathway [75]. For Arabidopsis Cry1 it has been
demonstrated that substitution of the chain’s first and third trypto-
phan impairs both light-induced electron transfer in vitro as well as
the photoreceptor function in vivo [76], demonstrating the bio-
logical relevance of this mechanism.
Transient EPR (trEPR) was applied to detect the short-lived
radical pair formed by the flavin and the terminal tryptophan [10].
The shape of this radical-pair signal drastically depends on the initial
EPR on Flavoproteins 353
spin state before separation of the two electrons. If the initial state is
a pure singlet, the number of spins with spin up and spin down pro-
jections are equal, i.e., the net spin polarization is zero. Therefore,
the integrated trEPR signal amplitude over the field range also
amounts to zero, i.e., emissive and absorptive components cancel.
If in contrast to that the initial state has (a least partial) triplet
character, a net spin polarization is expected depending on the dif-
ferent occupation of the high and low energy triplet-state sublevels
T+ and T− in an external magnetic field. Specifically, if the radical
pair is formed rapidly while the system remains in a spin state with
strong T+ or T− character, a net polarization that decreases with
higher magnetic field is expected. If, however, the initial state’s
spin relaxation is fast enough for thermalization, the net polariza-
tion is expected to increase with higher magnetic field. For a
detailed explanation of this effect, see refs. 10, 11. In case of
X. laevis cryptochrome-DASH, spectra measured at both X- and
Q-band frequencies show no net absorption or emission, whereas
simulations of a thermalized and fully polarized triplet precursor
predict a net absorptive spectrum at Q-band or a net emissive spec-
trum at X-band, respectively, thus leaving the singlet precursor as
the only possible origin state of the precursor (Fig. 8) [10].
Even though the Trp chain is conserved throughout photoly-
ases and cryptochromes, the electron transfer does not necessarily
have to follow this route. Mutation studies on Synechocystis Cry-
DASH have shown that in this cryptochrome the distal tryptophan
Trp320 (structurally equivalent to Trp306 in DNA photolyase) is
not the terminal electron donor [12] (Fig. 9). Instead of a transfer
via Trp396-Trp373-Trp320, as expected from X. laevis Cry-DASH,
the actual transfer chain is Trp396-Trp373-Trp375. Even though
the distance from Trp375 to Trp373 is 8.2 Å compared to 3.7 Å
between Trp320 and Trp373, their aromatic ring systems are more
suitably oriented to transfer the electron. Furthermore, Trp375 is
likely more accessible to solvent molecules and thus more easily
stabilized by deprotonation and solvent–radical interaction.
Obviously, subtle differences between species can have dra-
matic effects on the protein function that are not readily deducible
from the amino-acid sequence or even the crystal structure alone.
Here trEPR was shown to be a valuable tool to investigate these
dynamic processes.
X-band Q-band
340 350 1212 1216 1220
EPR signal / a.u.
E SCry WT
thermalized
A triplet precursor
spin polarized
A triplet precursor
E singlet precursor
Fig. 8 Transient EPR spectra at X-band (left) and Q-band frequencies (right) of Synechocystis cryptochrome-
DASH at 274 and 272 K, respectively. Below, simulations of radical pair spectra for a polarized triplet, a ther-
malized triplet and a singulet precursor are shown. Adapted from [10]
5 Conclusion
Acknowledgements
References
1. Frey PA, Hegemann AD, Reed GH (2006) 4. Losi A, Gärtner W (2011) Old chromophores,
Free radical mechanisms in enzymology. Chem new photoactivation paradigms, trendy
Rev 106:3302–3316 applications: flavins in blue light-sensing
2. Losi A (2007) Flavin-based blue-light photo- photoreceptors. Photochem Photobiol 87:
sensors: a photobiophysics update. Photochem 491–510
Photobiol 83:1283–1300 5. Weber S (2005) Light-driven enzymatic catal-
3. Demarsy E, Fankhauser C (2009) Higher ysis of DNA repair: a review of recent biophys-
plants use LOV to perceive blue light. Curr ical studies on photolyase. Biochim Biophys
Opin Plant Biol 12:69–74 Acta 1707:1–23
EPR on Flavoproteins 357
6. Sancar A (2003) Structure and function of NADH: quinone oxidoreductase from Vibrio
DNA photolyase and cryptochrome blue-light cholerae. J Am Chem Soc 125:265–275
photoreceptors. Chem Rev 103:2203–2237 20. Okafuji A, Schnegg A, Schleicher E, Möbius K,
7. Müller M, Carell T (2009) Structural biology Weber S (2008) G-tensors of the flavin adenine
of DNA photolyases and cryptochromes. Curr dinucleotide radicals in glucose oxidase: a com-
Opin Struct Biol 19:277–285 parative multifrequency electron paramagnetic
8. Massey V (1994) Activation of molecular oxy- resonance and electron-nuclear double reso-
gen by flavins and flavoproteins. J Biol Chem nance study. J Phys Chem B 112:3568–3574
269:22459–22462 21. Brosi R, Illarionov B, Mathes T, Fischer M,
9. Massey V, Palmer G (1966) On the existence Joshi M, Bacher A, Hegemann P, Bittl R,
of spectrally distinct classes of flavoprotein Weber S, Schleicher E (2010) Hindered rota-
semiquinones. A new method for quantitative tion of a cofactor methyl group as a probe for
production of flavoprotein semiquinones. protein-cofactor interaction. J Am Chem Soc
Biochemistry 5:3181 132:8935–8944
10. Weber S, Biskup T, Okafuji A, Marino AR, 22. Schleicher E, Hitomi K, Kay CWM, Getzoff
Berthold T, Link G, Hitomi K, Getzoff ED, ED, Todo T, Weber S (2007) Electron nuclear
Schleicher E, Norris JR (2010) Origin of light- double resonance differentiates complemen-
induced spin-correlated radical pairs in crypto- tary roles for active site histidines in (6-4) pho-
chrome. J Phys Chem B 114:14745–14754 tolyase. J Biol Chem 282:4738–4747
11. Mi QX, Ratner MA, Wasielewski MR (2010) 23. Kurreck H, Bock M, Bretz N, Elsner M, Kraus
Time-resolved EPR spectra of spin-correlated H, Lubitz W, Müller F, Geissler J, Kroneck
radical pairs: spectral and kinetic modulation PMH (1984) Fluid solutions and solid-state
resulting from electron-nuclear hyperfine electron nuclear double resonance studies of
interactions. J Phys Chem A 114:162–171 flavin model compounds and flavoenzymes.
J Am Chem Soc 106:737–746
12. Biskup T, Hitomi K, Getzoff ED, Krapf S,
Koslowski T, Schleicher E, Weber S (2011) 24. Cinkaya I, Buckel W, Medina M, Gomez-
Unexpected electron transfer in cryptochrome Moreno C, Cammack R (1997) Electron-
identified by time-resolved EPR spectroscopy. nuclear double resonance spectroscopy
Angew Chem Int Ed 50:12647–12651 investigation of 4-hydroxybutyryl-CoA dehy-
dratase from Clostridium aminobutyricum:
13. Schleicher E, Wenzel R, Ahmad M, Batschauer comparison with other flavin radical enzymes.
A, Essen LO, Hitomi K, Getzoff ED, Bittl R, Biol Chem 378:843–849
Weber S, Okafuji A (2010) The electronic
state of flavoproteins: investigations with pro- 25. Medina M, Lostao A, Sancho J, Gomez-
ton electron-nuclear double resonance. Appl Moreno C, Cammack R, Alonso PJ, Martinez
Magn Reson 37:339–352 JI (1999) Electron-nuclear double resonance
and hyperfine sublevel correlation spectro-
14. Murataliev MB (1999) Applications of elec- scopic studies of flavodoxin mutants from
tron spin resonance (ESR) for detection and Anabaena sp PCC 7119. Biophys J 77:
characterization of flavoprotein semiquinones. 1712–1720
Methods Mol Biol 131:97–110
26. Kay CWM, Feicht R, Schulz K, Sadewater P,
15. Müller F (1981) Spectroscopy and photo- Sancar A, Bacher A, Mobius K, Richter G,
chemistry of flavins and flavoproteins. Weber S (1999) EPR, ENDOR, and TRIPLE
Photochem Photobiol 34:753–758 resonance spectroscopy on the neutral flavin
16. Heelis PF (1982) The photophysical and pho- radical in Escherichia coli DNA photolyase.
tochemical properties of flavins (isoalloxa- Biochemistry 38:16740–16748
zines). Chem Soc Rev 11:15–39 27. Kay CWM, El Mkami H, Molla G, Pollegioni
17. Weber S, Kay CWM, Bacher A, Richter G, L, Ramsay RR (2007) Characterization of the
Bittl R (2005) Probing the N(5)-H bond of covalently bound anionic flavin radical in
the isoalloxazine moiety of flavin radicals by X- monoamine oxidase a by electron paramag-
and W-band pulsed electron-nuclear double netic resonance. J Am Chem Soc 129:
resonance. Chemphyschem 6:292–299 16091–16097
18. Acocella A, Jones GA, Zerbetto F (2010) 28. Weber S, Möbius K, Richter G, Kay CWM
What is adenine doing in photolyase? J Phys (2001) The electronic structure of the flavin
Chem B 114:4101–4106 cofactor in DNA photolyase. J Am Chem Soc
19. Barquera B, Morgan JE, Lukoyanov D, 123:3790–3798
Scholes CP, Gennis RB, Nilges MJ (2003) X- 29. Garcia JI, Medina M, Sancho J, Alonso PJ,
and W-band EPR and Q-band ENDOR stud- Gomez-Moreno C, Mayoral JA, Martinez JI
ies of the flavin radical in the Na+-translocating (2002) Theoretical analysis of the electron
358 Richard Brosi et al.
spin density distribution of the flavin semi- 42. Hitomi K, Nakamura H, Kim ST, Mizukoshi
quinone isoalloxazine ring within model T, Ishikawa T, Iwai S, Todo T (2001) Role of
protein environments. J Phys Chem B 106: two histidines in the (6-4) photolyase reaction.
4729–4735 J Biol Chem 276:10103–10109
30. Fuchs MR, Schleicher E, Schnegg A, Kay 43. Lv XY, Qiao DR, Xiong Y, Xu H, You FF, Cao
CWM, Törring JT, Bittl R, Bacher A, Richter Y, He X, Cao Y (2008) Photoreactivation of
G, Mobius K, Weber S (2002) g-Tensor of the (6-4) photolyase in Dunaliella salina. FEMS
neutral flavin radical cofactor of DNA photoly- Microbiol Lett 283:42–46
ase revealed by 360-GHz electron paramag- 44. Christie JM (2007) Phototropin blue-light
netic resonance spectroscopy. J Phys Chem B receptors. Annu Rev Plant Biol 58:21–45
106:8885–8890 45. Briggs WR (2007) The LOV domain: a chro-
31. Schnegg A, Okafuji A, Bacher A, Bittl R, mophore module servicing multiple photore-
Fischer M, Fuchs MR, Hegemann P, Joshi M, ceptors. J Biomed Sci 14:499–504
Kay CWM, Richter G, Schleicher E, Weber S 46. Swartz TE, Corchnoy SB, Christie JM, Lewis
(2007) Towards an identification of chemically JW, Szundi I, Briggs WR, Bogomolni RA
different flavin radicals by means of their (2001) The photocycle of a flavin-binding
g-tensor. Appl Magn Reson 30:345–358 domain of the blue light photoreceptor pho-
32. Kay CWM, Schleicher E, Hitomi K, Todo T, totropin. J Biol Chem 276:36493–36500
Bittl R, Weber S (2005) Determination of the 47. Salomon M, Christie JM, Knieb E, Lempert
g-matrix orientation in flavin radicals by high- U, Briggs WR (2000) Photochemical and
field/high-frequency electron-nuclear double mutational analysis of the FMN-binding
resonance. Magn Reson Chem 43:S96–S102 domains of the plant blue light receptor, pho-
33. Kay CWM, Bittl R, Bacher A, Richter G, totropin. Biochemistry 31:9401–9410
Weber S (2005) Unambiguous determination 48. Salomon M, Eisenreich W, Durr H, Schleicher
of the g-matrix orientation in a neutral flavin E, Knieb E, Massey V, Rudiger W, Müller F,
radical by pulsed electron-nuclear double reso- Bacher A, Richter G (2001) An optomechani-
nance at 94 GHz. J Am Chem Soc cal transducer in the blue light receptor pho-
127:10780–10781 totropin from Avena sativa. Proc Natl Acad Sci
34. Murphy DM, Farley RD (2006) Principles and U S A 98:12357–12361
applications of ENDOR spectroscopy for 49. Crosson S, Moffat K (2001) Structure of a
structure determination in solution and disor- flavin-binding plant photoreceptor domain:
dered matrices. Chem Soc Rev 35:249–268 insights into light-mediated signal trans-
35. Van Doorslaer S, Vinck E (2007) The strength duction. Proc Natl Acad Sci U S A 98:
of EPR and ENDOR techniques in revealing 2995–3000
structure-function relationships in metallopro- 50. Crosson S, Moffat K (2002) Photoexcited
tein. Phys Chem Chem Phys 9:4620–4638 structure of a plant photoreceptor domain
36. Kulik L, Lubitz W (2009) Electron-nuclear reveals a light-driven molecular switch. Plant
double resonance. Photosynth Res 102: Cell 14:1067–1075
391–401 51. Fedorov R, Schlichting I, Hartmann E,
37. Kim ST, Malhotra K, Smith CA, Taylor JS, Domratcheva T, Fuhrmann M, Hegemann P
Sancar A (1994) Characterization of (2003) Crystal structures and molecular
(6-4)-photoproduct DNA photolyase. J Biol mechanism of a light-induced signaling switch:
Chem 269:8535–8540 the Phot-LOV1 domain from Chlamydomonas
38. Zhao XD, Liu JQ, Hsu DS, Zhao SY, Taylor reinhardtii. Biophys J 84:2474–2482
JS, Sancar A (1997) Reaction mechanism of 52. Kasahara M, Swartz TE, Olney MA, Onodera
(6-4) photolyase. J Biol Chem A, Mochizuki N, Fukuzawa H, Asamizu E,
272:32580–32590 Tabata S, Kanegae H, Takano M, Christie JM,
39. Hitomi K, Kim ST, Iwai S, Harima N, Otoshi Nagatani A, Briggs WR (2002) Photochemical
E, Ikenaga M, Todo T (1997) Binding and properties of the flavin mononucleotide-
catalytic properties of Xenopus (6-4) photoly- binding domains of the phototropins from
ase. J Biol Chem 272:32591–32598 Arabidopsis, rice, and Chlamydomonas rein-
40. Park HW, Kim ST, Sancar A, Deisenhofer J hardtii. Plant Physiol 129:762–773
(1995) Crystal-structure of DNA photolyase 53. Swartz TE, Tseng TS, Frederickson MA, Paris
from Escherichia coli. Science 268:1866–1872 G, Comerci DJ, Rajashekara G, Kim JG,
41. Jordan SP, Jorns MS (1988) Evidence for a Mudgett MB, Splitter GA, Ugalde RA,
singlet intermediate in catalysis by Escherichia Goldbaum FA, Briggs WR, Bogomolni RA
coli DNA photolyase and evaluation of sub- (2007) Blue-light-activated histidine kinases:
strate binding determinants. Biochemistry two-component sensors in bacteria. Science
27:8915–8923 317:1090–1093
EPR on Flavoproteins 359
54. Bittl R, Kay CWM, Weber S, Hegemann P observation of a photoinduced radical pair in a
(2003) Characterization of a flavin radical cryptochrome blue-light photoreceptor.
product in a C57M mutant of a LOV1 domain Angew Chem Int Ed 48:404–407
by electron paramagnetic resonance. 68. Cashmore AR (2003) Cryptochromes:
Biochemistry 42:8506–8512 enabling plants and animals to determine cir-
55. Martínez JI, Alonso PJ, Gómez-Moreno C, cadian time. Cell 114:537–543
Medina M (1997) One- and two-dimensional 69. Brudler R, Hitomi K, Daiyasu H, Toh H,
ESEEM spectroscopy of flavoproteins. Kucho K, Ishiura M, Kanehisa M, Roberts VA,
Biochemistry 36:15526–15537 Todo T, Tainer JA, Getzoff ED (2003)
56. Weber S, Richter G, Schleicher E, Bacher A, Identification of a new cryptochrome class:
Mobius K, Kay CWM (2001) Substrate bind- structure, function, and evolution. Mol Cell
ing to DNA photolyase studied by electron 11:59–67
paramagnetic resonance spectroscopy. Biophys 70. Devlin PF, Kay SA (2001) Circadian pho-
J 81:1195–1204 toperception. Annu Rev Physiol 63:677–694
57. Eriksson LE, Ehrenberg A, Hyde JS (1970) 71. Canamero RC, Bakrim N, Bouly JP, Garay A,
Comparative electron-nuclear double reso- Dudkin EE, Habricot Y, Ahmad M (2006)
nance study of two flavoproteins. Eur J Cryptochrome photoreceptors cry1 and cry2
Biochem 17:539–543 antagonistically regulate primary root elongation
58. Hyde JS, Rist GH, Eriksson LE (1968) Endor in Arabidopsis thaliana. Planta 224:995–1003
of methyl matrix and alpha protons in amor- 72. Ahmad M, Jarillo JA, Smirnova O, Cashmore
phous and polycrystalline matrices. J Phys AR (1998) Cryptochrome blue-light photore-
Chem 72:4269 ceptors of Arabidopsis implicated in phototro-
59. Mees A, Klar T, Gnau P, Hennecke U, Eker pism. Nature 392:720–723
APM, Carell T, Essen LO (2004) Crystal 73. Li YF, Heelis PF, Sancar A (1991) Active-site
structure of a photolyase bound to a CPD-like of DNA photolyase—tryptophan-306 is the
DNA lesion after in situ repair. Science intrinsic hydrogen-atom donor essential for
306:1789–1793 flavin radical photoreduction and DNA-repair
60. Stehlik D, Möbius K (1997) New EPR meth- in vitro. Biochemistry 30:6322–6329
ods for investigating photoprocesses with para- 74. Lukacs A, Eker APM, Byrdin M, Brettel K,
magnetic intermediates. Annu Rev Phys Chem Vos MH (2008) Electron hopping through
48:745–784 the 15 angstrom triple tryptophan molecular
61. Bittl R, Weber S (2005) Transient radical pairs wire in DNA photolyase occurs within 30 ps.
studied by time-resolved EPR. Biochim J Am Chem Soc 130:14394
Biophys Acta 1707:117–126 75. Byrdin M, Sartor V, Eker APM, Vos MH,
62. Furrer R, Thurnauer MC (1981) Nanosecond Aubert C, Brettel K, Mathis P (2004)
time resolution in electron-electron Intraprotein electron transfer and proton
paramagnetic-res transient nutation spectros- dynamics during photoactivation of DNA
copy of triplet-states. Chem Phys Lett photolyase from E. coli: review and new
79:28–33 insights from an “inverse” deuterium isotope
63. van Tol J, Brunel LC, Angerhofer A (2001) effect. Biochim Biophys Acta 1655:64–70
Transient EPR at 240 GHz of the excited trip- 76. Zeugner A, Byrdin M, Bouly JP, Bakrim N,
let state of free-base tetra-phenyl porphyrin. Giovani B, Brettel K, Ahmad M (2005) Light-
Appl Magn Reson 21:335–340 induced electron transfer in Arabidopsis cryp-
64. van Tol J, Brunel LC, Wylde RJ (2005) A qua- tochrome-1 correlates with in vivo function.
sioptical transient electron spin resonance J Biol Chem 280:19437–19440
spectrometer operating at 120 and 240 GHz. 77. Milov AD, Salikhov KM, Shirov MD (1981)
Rev Sci Instrum 76:074101 Application of ENDOR in electron-spin echo
65. Lin CT, Todo T (2005) The cryptochromes. for paramagnetic center space distribution in
Genome Biol 6:220 solids. Fiz Tverd Tela 23:975–982
66. Weber S, Kay CWM, Mogling H, Mobius K, 78. Jeschke G (2002) Distance measurements in
Hitomi K, Todo T (2002) Photoactivation of the nanometer range by pulse EPR.
the flavin cofactor in Xenopus laevis (6-4) pho- Chemphyschem 3:927–932
tolyase: observation of a transient tyrosyl radi- 79. Martin RE, Pannier M, Diederich F (1998)
cal by time-resolved electron paramagnetic Determination of end-to-end distances in a
resonance. Proc Natl Acad Sci U S A 99: series of TEMPO diradicals of up to 2.8 nm
1319–1322 length with a new four-pulse double electron
67. Biskup T, Schleicher E, Okafuji A, Link G, electron resonance experiment. Angew Chem
Hitomi K, Getzoff ED, Weber S (2009) Direct Int Ed 37:2834–2837
360 Richard Brosi et al.
80. Millhauser GL (1992) Selective placement of tance distributions. Appl Magn Reson 26:
electron-spin-resonance spin labels—new 223–244
structural methods for peptides and proteins. 83. Swanson MA, Kathirvelu V, Majtan T, Frerman
Trends Biochem Sci 17:448–452 FE, Eaton GR, Eaton SS (2009) DEER
81. Hubbell WL, Altenbach C, Hubbell CM, distance measurement between a spin label
Khorana HG (2003) Rhodopsin structure, and a native FAD semiquinone in electron
dynamics, and activation: a perspective from transfer flavoprotein. J Am Chem Soc 131:
crystallography, site-directed spin labeling, 15978–15979
sulfhydryl reactivity, and disulfide cross- 84. Kay CWM, Elsässer C, Bittl R, Farrell SR,
linking. Adv Protein Chem 63:243–290 Thorpe C (2006) Determination of the dis-
82. Jeschke G, Panek G, Godt A, Bender A, tance between the two neutral flavin radicals in
Paulsen H (2004) Data analysis procedures augmenter of liver regeneration by pulsed
for pulse ELDOR measurements of broad dis- ELDOR. J Am Chem Soc 128:76–77
Chapter 14
Abstract
Light-induced difference Fourier transform infrared (FTIR) spectroscopy is a powerful, sensitive, and
informative method to study structure–function relationships in photoreceptive proteins. Strong absorp-
tion of water in the IR region is always problematic in this method, but if water content in the sample is
controlled during measurements, this method can provide useful information on a single protein-bound
water molecule. We established three kinds of sample preparations: hydrated film, redissolved sample, and
concentrated solution. Hydrated films were used for the measurements of LOV and BLUF domains,
where accurate difference FTIR spectra were obtained in the whole mid-IR region (4,000–800 cm−1).
Vibrations of S–H stretch of cysteine, O–H stretch of water, and O–H stretch of tyrosine provide impor-
tant information on hydrogen bonds in these proteins. Redissolved samples were used for the measure-
ments of (6-4) photolyase, in which enzymatic turnover takes place. From the illumination time-dependence
of excess amount of substrate, it is possible to isolate the signal originating from the binding of enzyme to
substrate. If proteins are less tolerant to drying, as for example cryptochromes of the DASH type, concen-
trated solution is used. Detailed methodological aspects in light-induced difference FTIR spectroscopy are
reviewed by mainly focusing on our results.
Key words FTIR, Difference spectroscopy, Double difference spectroscopy, BLUF domain, LOV
domain, Cryptochrome, Photolyase, Hydrated film, Redissolved sample, Concentrated solution
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_14, © Springer Science+Business Media New York 2014
361
362 Daichi Yamada and Hideki Kandori
2 Materials
2.1 Hydrated Films The purified LOV domain was concentrated to give a final concen-
tration of 2.1 mg/mL as determined with a Microcon YM-10
2.1.1 LOV Domains
instrument (Millipore), and then dialyzed against 1 mM potassium
phosphate buffer (pH 7). 50–90 μL of the solution was placed on
a BaF2 window, and then dried to a film under reduced pressure
with an aspirator. The films were hydrated as follows. A drop of
either H2O or its stable isotopologues (D2O, H218O, or D218O)
was put next to the film on the window, which was then sealed with
a second window and a rubber ring. Detailed hydration conditions
are described in ref. 24.
2.1.2 BLUF Domain Purified BLUF domains were reconstituted with polypeptide of
inclusion bodies expressed in E. coli and exogenous FAD as
described previously. Briefly, collected inclusion bodies were solu-
bilized and denatured by 6 M guanidine–HCl. Proteins were then
FTIR Spectroscopy of Flavin-Binding Photoreceptors 365
Water Amide I
Amide II
2.2 Redissolved We aimed at a (6-4) PHR sample with higher water content to
Samples facilitate enzyme turnover, so that we established the preparation
conditions of redissolved sample as follows [61]: First, we put 2 μL
2.2.1 (6-4) PHR
of the sample solution containing 1 mM (6-4) PHR, estimated
from the absorbance at 450 nm (ε450 = 11,200 M−1 cm−1) before
concentration, in 50 mM Tris–HCl buffer (pH 8.0) and 200 mM
NaCl on an IR window (BaF2), and dry. For measurements of
(6-4) PHR in complex with the (6-4) photoproduct, 2 μL or 1 μL
of 2 mM (6-4) photoproduct in aqueous solution was gently mixed
with the sample solution of (6-4) PHR on the IR window, and
then dried. We then put 0.4 μL of the 50 mM Tris–HCl buffer
(pH 8.0) containing 200 mM NaCl directly onto the dried film,
which is subsequently sandwiched by another IR window.
(6-4) PHR in D2O was prepared by diluting the (6-4) PHR
with the same buffer prepared in D2O, and concentrated using
Amicon YM-30 devices (Millipore) for three times. (6-4) photo-
product was dissolved in D2O. The same procedure was carried out
except for using D2O buffer for the preparation of redissolved sam-
ples. Note that the oxidized form of (6-4) PHR can bind (6-4)
photoproduct, where >99 % of (6-4) PHR binds (6-4) photoprod-
uct from the values Ka = 2.1 × 108 (M−1), 5 mM (6-4) PHR, and 10
(or 5) mM (6-4) photoproduct.
In PHRs, the reduced form of FAD has been proposed to be
the active form for DNA repair, whereas isolated PHRs in the
“resting” state have undergone FAD oxidation. PHRs inactivated
by FAD oxidation can be reactivated by light-dependent reduc-
tion (photoactivation). Under the redissolved sample conditions,
the oxidized FAD of the resting state (6-4) PHR was reduced by
continuous illumination with light above 390 nm. Under these
photoactivation conditions we did not detect significant absorp-
tion near 600 nm, which is characteristic of the semiquinone form
FTIR Spectroscopy of Flavin-Binding Photoreceptors 367
3 Methods
Fig. 2 (a) Typical experimental setup to measure light-induced difference FTIR spectra. We use a Bio-Rad FTS-
7000 spectrophotometer, which is equipped with a cryostat (Oxford DN, Oxford) and a temperature controller
(ITC 4, Oxford) with liquid nitrogen as coolant. For protein illumination we use a tungsten-halogen lamp (1 kW)
or a xenon lamp (300 mW) together with appropriate optical filters. A switch box controls the opening or closing
of shutters. (b) Optical alignment of the FTIR spectrophotometer. Illumination light is introduced either parallel
or perpendicular to the IR beam. For the latter setup, in addition to light-minus-dark spectra the difference of
(during illumination)-minus-dark can be measured, which is advantageous to capture short-lived intermediate
states
Before Irradiation
After Irradiation
a
Absorbsnce
Difference Absorbsnce
4.1 X–H Stretching By conventional FTIR spectroscopy, spectral changes are detected
Region in a region 1,800–1,000 cm−1. Although X–H stretches are direct
probes of hydrogen bonds, strong absorption of water in the sam-
ple may easily obscure such information. However, measurements
using hydrated films provide difference spectra not only in the con-
ventional region, but also >1,800 cm−1.
In case of LOV domains, the protonation state of the reactive
Cys is important to understand the adduct formation mechanism
with the C(4a) carbon of FMN. The stretching frequency of a cys-
teine’s S–H bond is in the 2,580–2,525 cm−1 region, where other
vibrations are absent [64, 65]. In neo1-LOV2 we identified the
S–H vibration at ~2,570 cm−1 [14]. Since this is the only cysteine
in the domain, this observation clearly indicates that Cys966 is
protonated. While transfer reactions of a proton, a hydrogen, or an
electron from Cys to the FMN in the triplet state have been pro-
posed, we also detected FTIR data after photoexcitation. Under
these conditions, the S–H stretch is shifted to 2,537 cm−1 [20].
This excludes proton-transfer and hydrogen-transfer reactions.
The S–H frequencies imply that the S–H group is not hydrogen-
bonded in the dark state, while it forms a strong hydrogen bond in
the light state. We infer the hydrogen-bonding acceptor to be the
N(5) atom of FMN, and such strong interaction presumably drives
adduct formation on a microsecond time scale.
Protein-bound water molecules possibly play important roles
in the structure and function of proteins. In fact, an important role
of the water-mediated hydrogen-bonding network has been
revealed for bacteriorhodopsin, a light-driven proton-pump pro-
tein, which can be monitored by light-induced difference FTIR
spectroscopy [10]. Comprehensive studies of microbial and visual
rhodopsins have revealed that strongly hydrogen-bonded water
molecules are only found in proteins exhibiting proton-pump
activities, and thus a strongly hydrogen-bonded water molecule is
the functional determinant of a light-driven proton pump [4].
While the functional role of protein-bound water molecules is not
well understood, they are experimentally observable for flavin-
binding photoreceptors [19].
In the case of BLUF domains, a conserved Tyr/Gln motive
close to the FAD chromophore plays a crucial role for the forma-
tion of a red-shifted intermediate. The intermediate appears
accompanying hydrogen-bonding alteration of the Tyr/Gln,
because FAD is in the oxidized form for both dark and intermedi-
ate states. The X-ray structures of dark and light state in their
current spatial resolution do not reveal the positions of hydrogen
atoms. Previous light-induced difference FTIR spectra are
FTIR Spectroscopy of Flavin-Binding Photoreceptors 371
Fig. 4 (a–c) Schematic drawing illustrating the specific information obtained by time-dependent illumination
measurements with enzyme-substrate mixtures of different molar ratio for X. laevis (6-4) PHR. (a) For a 1:1
molar ratio of PHR (yellow ellipse) to (6-4) photoproduct (bent blue line), all (6-4) photoproducts are bound to
PHR in the dark. Upon illumination, the double difference FTIR spectra always reflect differences between
bound and unbound PHR, and between damaged and repaired (straight blue lines) DNA. The spectral shape is
invariant with illumination time, although the overall intensity varies. (b, c) For a 1:2 molar ratio of PHR to (6-4)
photoproduct, one half of the (6-4) photoproducts is initially bound to PHR, but the remaining half is unbound.
(b) At an early stage of illumination, as repaired DNA is released from the enzyme into solution, remaining
unrepaired (6-4) photoproduct binds to the “empty” PHR. The double difference FTIR spectra correspond to the
structural differences between unbound damaged and repaired DNA only, because the enzyme-substrate
complex remains in steady state. (c) At a late stage of illumination, after all (6-4) photoproducts are repaired
and released from the enzyme into solution, “empty” (6-4) PHR accumulates. The difference FTIR spectra cor-
respond to the structural changes of PHR as well as those of DNA. (d–f) FTIR spectral comparisons of early
(black line) and late (red line) stages of illumination for the 1:1 (d) and the 1:2 (e) enzyme-substrate mixture.
In (f), double difference spectra (red-minus-black) from (d) and (e) are shown by green and pink lines, respec-
tively. One division of the vertical axis corresponds to 0.0015 (d, e) and 0.0005 (f) absorbance units. These
figures are reproduced from ref. 61. These figures are adapted with permission from ref. 61. Copyright (2011)
American Chemical Society
5 Concluding Remarks
Acknowledgments
We thank Drs. Tatsuya Iwata and Yu Zhang for their efforts to
establish the FTIR study of flavin-binding photoreceptors. We also
thank our many collaborators that contributed to our publications
(see "References").
References
1. Kandori H (2006) Retinal binding proteins. and protein structural changes in the LOV2
In: Dugave C (ed) cis-trans Isomerization in domain of the plant blue-light receptor pho-
biochemistry. Wiley-VCH, Weinheim, pp totropin 1. Biochemistry 41:7183–7189
53–75 14. Iwata T, Tokutomi S, Kandori H (2002)
2. Rockwell NC, Su Y-S, Lagarias JC (2006) Photoreaction of the cysteine S–H group in the
Phytochrome structure and signaling mecha- LOV2 domain of Adiantum phytochrome3.
nisms. Annu Rev Plant Biol 57:837–858 J Am Chem Soc 124:11840–11841
3. Imamoto Y, Kataoka M (2007) Structure and 15. Ataka K, Hegemann P, Heberle J (2003)
photoreaction of photoactive yellow protein, a Vibrational spectroscopy of an algal Phot-
structural prototype of the PAS domain super- LOV1 domain probes the molecular changes
family. Photochem Photobiol 83:40–49 associated with blue-light reception. Biophys J
4. Kandori H (2010) Hydrogen bonds of protein- 84:466–474
bound water molecules in rhodopsins. In: Han 16. Iwata T, Nozaki D, Tokutomi S, Kagawa T,
K-L, Zhao G-J (eds) Hydrogen bonding and Wada M, Kandori H (2003) Light-induced
transfer in the excited state. Wiley, Chichester, structural changes in the LOV2 domain of
pp 377–391 Adiantum phytochrome3 studied by low-
5. van der Horst MA, Hellingwerf KJ (2004) temperature FTIR and UV–visible spectros-
Photoreceptor proteins, "star actors of modern copy. Biochemistry 42:8183–8191
times": a review of the functional dynamics in 17. Nozaki D, Iwata T, Ishikawa T, Todo T,
the structure of representative members of six Tokutomi S, Kandori H (2004) Role of
different photoreceptor families. Acc Chem Gln1029 in the photoactivation processes of
Res 37:13–20 the LOV2 domain in Adiantum phyto-
6. Edmondson D, Ghisla S (1999) Flavoenzyme chrome3. Biochemistry 43:8373–8379
structure and function. In: Chapman SK, Reid 18. Bednarz T, Losi A, Gärtner W, Hegemann P,
GA (eds) Methods in molecular biology, vol Heberle J (2004) Functional variations among
131, Flavoprotein protocols. Humana Press, LOV domains as revealed by FT-IR difference
Clifton, UK, pp 157–179 spectroscopy. Photochem Photobiol Sci
7. Christie JM (2007) Phototropin blue-light 3:575–579
receptors. Annu Rev Plant Biol 58:21–45 19. Nozaki D, Iwata T, Tokutomi S, Kandori H
8. Kennis JT, Groot M-L (2007) Ultrafast spec- (2005) Water structural changes in the activa-
troscopy of biological photoreceptors. Curr tion process of the LOV2 domains of Adiantum
Opin Struct Biol 17:623–630 phytochrome3. J Mol Struct 735–736:
9. Sancar A (2003) Structure and function of 259–265
DNA photolyase and cryptochrome blue-light 20. Sato Y, Iwata T, Tokutomi S, Kandori H
photoreceptors. Chem Rev 103:2203–2237 (2005) Reactive cysteine is protonated in the
10. Kandori H (2000) Role of internal water mol- triplet excited state of the LOV2 domain in
ecules in bacteriorhodopsin. Biochim Biophys Adiantum phytochrome3. J Am Chem Soc
Acta 1460:177–191 127:1088–1089
11. Kötting C, Gerwert K (2005) Proteins in 21. Iwata T, Nozaki D, Tokutomi S, Kandori H
action monitored by time-resolved FTIR spec- (2005) Comparative investigation of the LOV1
troscopy. Chemphyschem 6:881–888 and LOV2 domains in Adiantum phyto-
12. Kottke T, Hegemann P, Dick B, Heberle J chrome3. Biochemistry 44:7427–7434
(2006) The photochemistry of the light-, 22. Nozaki D, Iwata T, Tokutomi S, Kandori H
oxygen-, and voltage-sensitive domains in the (2005) Unique temperature dependence in the
algal blue light receptor phot. Biopolymers adduct formation between FMN and cysteine
82:373–378 S–H group in the LOV2 domain of Adiantum
13. Swartz TE, Wenzel PJ, Corchnoy SB, Briggs phytochrome3. Chem Phys Lett 410:59–63
WR, Bogomolni RA (2002) Vibration spec- 23. Iwata T, Nozaki D, Sato Y, Sato K, Nishina Y,
troscopy reveals light-induced chromophore Shiga K, Tokutomi S, Kandori H (2006)
FTIR Spectroscopy of Flavin-Binding Photoreceptors 375
Identification of the C=O stretching vibrations implications for photosensory LOV domains.
of FMN and peptide backbone by 13C-labeling Phys Chem Chem Phys 15:5916–5926
of the LOV2 domain of Adiantum phyto- 35. Herman E, Sachse M, Kroth PG, Kottke T
chrome3. Biochemistry 45:15384–15391 (2013) Blue-light-induced unfolding of the Jα
24. Iwata T, Yamamoto A, Tokutomi S, Kandori H helix allows for the dimerization of Aureo-
(2007) Hydration and temperature similarly chrome-LOV from the diatom Phaeodactylum
affect light-induced protein structural changes tricornutum. Biochemistry 52:3094–3101
in the chromophoric domain of phototropin. 36. Laan W, van der Horst MA, van Stokkum IH,
Biochemistry 46:7016–7021 Hellingwerf KJ (2003) Initial characterization
25. Majerus T, Kottke T, Laan W, Hellingwerf K, of the primary photochemistry of AppA, a
Heberle J (2007) Time-resolved FT-IR spec- blue-light–using flavin adenine dinucleotide–
troscopy traces signal relay within the blue- domain containing transcriptional antirepres-
light receptor AppA. Chemphyschem sor protein from Rhodobacter sphaeroides: a key
8:1787–1789 role for reversible intramolecular proton trans-
26. Sato Y, Nabeno M, Iwata T, Tokutomi S, fer from the flavin adenine dinucleotide chro-
Sakurai M, Kandori H (2007) Heterogeneous mophore to a conserved tyrosine? Photochem
environment of the S–H group of Cys966 near Photobiol 78:290–297
the flavin chromophore in the LOV2 domain 37. Masuda S, Hasegawa K, Ishii A, Ono T (2004)
of Adiantum neochrome1. Biochemistry Light-induced structural changes in a putative
46:10258–10265 blue-light receptor with a novel FAD binding
27. Yamamoto A, Iwata T, Tokutomi S, Kandori H fold sensor of blue-light using FAD (BLUF);
(2008) Role of Phe1010 in light-induced Slr1694 of Synechocystis sp. PCC6803.
structural changes of the neo1-LOV2 domain Biochemistry 43:5304–5313
of Adiantum. Biochemistry 47:922–928 38. Hasegawa K, Masuda S, Ono T (2004)
28. Pfeifer A, Majerus T, Zikihara K, Matsuoka D, Structural intermediate in the photocycle of a
Tokutomi S, Heberle J, Kottke T (2009) Time- BLUF (sensor of blue light using FAD) protein
resolved Fourier transform infrared study on Slr1694 in a cyanobacterium Synechocystis sp.
photoadduct formation and secondary struc- PCC6803. Biochemistry 43:14979–14986
tural changes within the phototropin LOV 39. Laan W, Bednarz T, Heberle J, Hellingwerf KJ
domain. Biophys J 96:1462–1470 (2004) Chromophore composition of a heter-
29. Yamamoto A, Iwata T, Sato Y, Matsuoka D, ologously expressed BLUF-domain.
Tokutomi S, Kandori H (2009) Light signal Photochem Photobiol Sci 3:1011–1016
transduction pathway from flavin chromophore 40. Hasegawa K, Masuda S, Ono T (2005)
to the Jα helix of Arabidopsis phototropin1. Spectroscopic analysis of the dark relaxation
Biophys J 96:2771–2778 process of a photocycle in a sensor of blue light
30. Alexandre MTA, van Grondelle R, Hellingwerf using FAD (BLUF) protein Slr1694 of the cya-
KJ, Kennis JTM (2009) Conformational het- nobacterium Synechocystis sp. PCC6803. Plant
erogeneity and propagation of structural Cell Physiol 46:136–146
changes in the LOV2/Jα domain from Avena 41. Masuda S, Hasegawa K, Ono T (2005) Light-
sativa phototropin 1 as recorded by induced structural changes of apoprotein and
temperature-dependent FTIR spectroscopy. chromophore in the sensor of blue light using
Biophys J 97:238–247 FAD (BLUF) domain of AppA for a signaling
31. Koyama T, Iwata T, Yamamoto A, Sato Y, state. Biochemistry 44:1215–1224
Matsuoka D, Tokutomi S, Kandori H (2009) 42. Masuda S, Hasegawa K, Ono T (2005)
Different role of the Jα helix in the light- Adenosine diphosphate moiety does not par-
induced activation of the LOV2 domains in ticipate in structural changes for the signaling
various phototropins. Biochemistry state in the sensor of blue-light using FAD
48:7621–7628 domain of AppA. FEBS Lett 579:4329–4332
32. Pfeifer A, Mathes T, Lu Y, Hegemann P, 43. Masuda S, Hasegawa K, Ono T (2005)
Kottke T (2010) Blue light induces global and Tryptophan at position 104 is involved in
localized conformational changes in the kinase transforming light signal into changes of
domain of full-length phototropin. β-sheet structure for the signaling state in the
Biochemistry 49:1024–1032 BLUF domain of AppA. Plant Cell Physiol
33. Alexandre MTA, Purcell EB, van Grondelle R, 46:1894–1901
Robert B, Kennis JTM, Crosson S (2010) 44. Hasegawa K, Masuda S, Ono T (2006) Light
Biochemistry 49:4752–4759 induced structural changes of a full-length pro-
34. Thöing C, Pfeifer A, Kakorin S, Kottke T tein and its BLUF domain in YcgF(Blrp), a
(2013) Protonated triplet-excited flavin blue-light sensing protein that uses FAD
resolved by step-scan FTIR spectroscopy: (BLUF). Biochemistry 45:3785–3793
376 Daichi Yamada and Hideki Kandori
45. Okajima K, Fukushima Y, Suzuki H, Kita A, 55. Iwata T, Watanabe A, Iseki M, Watanabe M,
Ochiai Y, Katayama M, Shibata Y, Miki K, Kandori H (2011) Strong donation of the
Noguchi T, Itoh S, Ikeuchi M (2006) Fate hydrogen bond of tyrosine during photoactiva-
determination of the flavin photoreceptions in tion of the BLUF domain. J Phys Chem Lett
the cyanobacterial blue light receptor TePixD 2:1015–1019
(Tll0078). J Mol Biol 363:10–18 56. Kottke T, Batschauer A, Ahmad M, Heberle J
46. Takahashi R, Okajima K, Suzuki H, Nakamura (2006) Blue-light-induced changes in
H, Ikeuchi M, Noguchi T (2007) FTIR study Arabidopsis cryptochrome 1 probed by FTIR
on the hydrogen bond structure of a key tyro- difference spectroscopy. Biochemistry
sine residue in the flavin-binding blue light 45:2472–2479
sensor TePixD from Thermosynechococcus elon- 57. Schleicher E, Hessling B, Illarionova V, Bacher
gatus. Biochemistry 46:6459–6467 A, Weber S, Richter G, Gerwert K (2005)
47. Masuda S, Hasegawa K, Ohta H, Ono T (2008) Light-induced reactions of Escherichia coli
Crucial role in light signal transduction for the DNA photolyase monitored by Fourier trans-
conserved Met93 of the BLUF protein PixD/ form infrared spectroscopy. FEBS J 272:
Slr1694. Plant Cell Physiol 49:1600–1606 1855–1866
48. Suzuki H, Okajima K, Ikeuchi M, Noguchi T 58. Iwata T, Zhang Y, Hitomi K, Getzoff ED,
(2008) LOV-like flavin-cys adduct formation Kandori H (2010) Key dynamics of conserved
by introducing a cys residue in the BLUF asparagine in a cryptochrome/photolyase fam-
domain of TePixD. J Am Chem Soc 130: ily protein by Fourier transform infrared spec-
12884–12885 troscopy. Biochemistry 49:8882–8891
49. Stelling AL, Ronayne KL, Nappa J, Tonge PJ, 59. Immeln D, Pokorny R, Herman E, Moldt J,
Meech SR (2007) Ultrafast structural dynam- Batschauer A, Kottke T (2010) Photoreaction
ics in BLUF domains: transient infrared spec- of plant and DASH cryptochromes probed by
troscopy of AppA and its mutants. J Am Chem infrared spectroscopy: the neutral radical state
Soc 129:15556–15564 of flavoproteins. J Phys Chem B 114:
50. Ren S, Sawada M, Hasegawa K, Hayakawa Y, 17155–17161
Ohta H, Masuda S (2012) A PixD–PapB chi- 60. Wijaya IMM, Zhang Y, Iwata T, Yamamoto J,
meric protein reveals the function of the BLUF Hitomi K, Iwai S, Getzoff ED, Kandori H
domain C-terminal α-helices for light signal (2013) Detection of distinct α-helical rear-
transduction. Plant Cell Physiol 53: rangements of cyclobutane pyrimidine dimer
1638–1647 photolyase upon substrate binding by Fourier
51. Haigney A, Lukacs A, Brust R, Zhao R-K, transform infrared spectroscopy. Biochemistry
Towrie M, Greetham GM, Clark I, Illarionov 52:1019–1027
B, Bacher A, Kim R-R, Fischer M, Meech SR, 61. Zhang Y, Iwata T, Yamamoto J, Hitomi K,
Tonge PJ (2012) Vibrational assignment of the Iwai S, Todo T, Getzoff ED, Kandori H (2011)
ultrafast infrared spectrum of the photoactivat- FTIR study of light-dependent activation and
able flavoprotein AppA. J Phys Chem B DNA repair processes of (6-4) photolyase.
116:10722–10729 Biochemistry 50:3591–3598
52. Haigney A, Lukacs A, Zhao R-K, Stelling AL, 62. Zhang Y, Yamamoto J, Yamada D, Iwata T,
Brust R, Kim R-R, Kondo M, Clark I, Towrie Hitomi K, Todo T, Getzoff ED, Iwai S,
M, Greetham GM, Illarionov B, Bacher A, Kandori H (2011) Substrate assignment of the
Römisch-Margl W, Fischer M, Meech SR, (6-4) photolyase reaction by FTIR spectros-
Tonge PJ (2011) Ultrafast infrared spectros- copy. J Phys Chem Lett 2:2774–2777
copy of an isotope-labeled photoactivatable fla- 63. Yamada D, Zhang Y, Iwata T, Hitomi K,
voprotein. Biochemistry 50:1321–1328 Getzoff ED, Kandori H (2012) Fourier-
53. Lukacs A, Haigney A, Brust R, Zhao R-K, transform infrared study of the photoactivation
Stelling AL, Clark IP, Towrie M, Greetham process of Xenopus (6-4) photolyase.
GM, Meech SR, Tonge PJ (2011) Biochemistry 51:5774–5783
Photoexcitation of the blue light using FAD 64. Li H, Thomas GJ Jr (1991) Cysteine confor-
photoreceptor AppA results in ultrafast changes mation and sulfhydryl interactions in proteins
to the protein matrix. J Am Chem Soc and viruses. 1. Correlation of the Raman S–H
133:16893–16900 band with hydrogen bonding and intramolecu-
54. Mathes T, Zhu J, van Stokkum IHM, Groot lar geometry in model compounds. J Am
ML, Hegemann P, Kennis JTM (2012) Chem Soc 113:456–462
Hydrogen bond switching among flavin and 65. Kandori H, Kinoshita N, Shichida Y, Maeda A,
amino acids determines the nature of proton- Needleman R, Lanyi JK (1998) Cysteine S–H
coupled electron transfer in BLUF photorecep- as a hydrogen-bonding probe in proteins. J Am
tors. J Phys Chem Lett 3:203–208 Chem Soc 120:5828–5829
Chapter 15
Abstract
Flavin is a general name given to molecules having the heteroaromatic ring system of
7,8-dimethylisoalloxazine but practically means riboflavin (Rfl), flavin adenine dinucleotide (FAD), and
flavin mononucleotide (FMN) in biological systems, whose structures are illustrated in Fig. 1, together
with the atomic numbering scheme and ring numbering of the isoalloxazine moiety. As the isoalloxazine
skeleton cannot be synthesized in human cells, it is obtained from diet as Rfl (vitamin B2). FAD and FMN
can act as cofactors in flavoenzymes but Rfl does not. Most flavoenzymes catalyze redox reactions of
substrates (Miura, Chem Rec 1:183–194, 2001). When O2 serves as the oxidant in the oxidation half cycle
of an enzymic reaction, the enzyme is called “flavo-oxidase” but when others do, the enzyme is called
“flavo-dehydrogenase.” The difference between the two types of oxidative catalysis arises from delicate
differences in the π-electron distributions in the isoalloxazine ring, which can be revealed by Raman
spectroscopy (Miura, Chem Rec 1:183–194, 2001). Since a flavin is an extremely versatile molecule,
the scientific field including chemistry, biochemistry, and enzymology is collectively called “flavonology.”
It was found recently, however, that the flavin also acts as a chromophore to initiate light-induced DNA
repair and signal transductions (Sancar, Chem Rev 103:2203–2237, 2003).
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_15, © Springer Science+Business Media New York 2014
377
378 Jiang Li and Teizo Kitagawa
Fig. 1 Structure of flavin derivatives (Rfl, FMN, FAD) and the atomic numbering and ring numbering scheme for
isoalloxazine
Fig. 2 Neutral and anionic forms of oxidized, one-electron-reduced, and two-electron-reduced flavins
Fig. 3 Absorption spectra of (6-4) photolyase. The solid line shows the spectrum
of the enzyme immediately after purification, which is a mixture of the neutral
semiquinoid form and the oxidized form, while the dotted line shows that of the
oxidized form. The arrows indicate the excitation wavelengths used to obtain
Figs. 6 and 7
Fig. 4 Schematic diagram for the relation between an absorption spectrum of a molecule and the Raman
excitation wavelength (left) and the arrangement of a spinning cell and light at the scattering point (right), in
which ν0 and ν0 ± ν denote the excitation light and scattered light in Raman experiments, respectively
2.1.2 Photoreduction Depending on the redox potential, the oxidation state of the flavin
cofactor after purification may not be homogeneous. For example,
(6-4) photolyase as purified is composed of semiquinoid FAD and
oxidized FAD. All the semiquinoid enzymes in this mixture were
completely oxidized by air oxygen within 2 days. To prepare the
pure semiquinoid form, we sealed the oxidized enzyme in a cell,
replaced the inside air by N2 using Schlenk lines, and photore-
duced the enzyme by laser irradiation at 442 nm. To avoid heating
from the laser illumination, the cell was cooled by flushing with
cold N2 gas passed through liquid N2 [4]. The hydroquinoid (6-4)
photolyase can be obtained by argon purging at 4 °C in a buffer
containing 5 mM dithiothreitol [6].
382 Jiang Li and Teizo Kitagawa
2.2 Resonance Since light scattered from the sample goes in all directions, the
Raman Spectroscopy detector for Raman spectra may be placed at any angle with respect
to the sample cell. However, Raman-scattered light is so weak, so
that the scattered light should be first collected within a certain
range of scattering angles by a lens, then collimated, and finally
focused onto the entrance slit of the spectrometer. Rayleigh scat-
tering is removed with an appropriate holographic notch filter
(e.g., from Kaiser Optical Systems). In our laboratory, the scat-
tered light at a 90° angle is collected and focused at the entrance
slit of a single monochromator (e.g., from Jobin Yvon) equipped
with a liquid N2-cooled charge-coupled device (CCD) detector
(e.g., from Roper Scientific). The sample concentration is typically
80–150 μM, and all samples are cooled with cold N2 gas. A 100-μL
protein sample is put into a custom-designed cylindrical spinning
cell and irradiated by a focused continuous-wave laser beam from
the cell bottom as illustrated in Fig. 4 (right). The irradiation
wavelengths used are 568.2 and 488.0 nm from a krypton–argon
mixed gas ion laser (e.g., from Spectra Physics) for the semiquinoid
and oxidized flavin, respectively. The laser power at the sample
point is typically less than 5 mW. The sample cell is spun at a rate
of 2,000 rpm to avoid repeated excitation of an identical molecule.
The structureless fluorescence background in the final spectrum is
removed by assuming a polynomial function. Raman shifts are cali-
brated by using indene as a standard, and the accuracy of the peak
positions of the well-defined Raman bands is ±1 cm−1.
3.1 Oxidized Flavin Experimental assignments of Raman bands were first obtained
from isotope-labeled isoalloxazine (2H, 13C, and 15N) or chemical
modification at specific positions [7–10]. Then, normal-mode cal-
culations were performed to predict the isotope shifts, which were
used to assign the calculated normal modes of the Raman bands
[11, 12]. Recently, more detailed normal modes were provided by
quantum-chemical calculations using density functional theory
(DFT) [13–15]. The latest assignments of oxidized flavins reported
by Eisenberg et al. are shown in Table 1.
Resonance Raman Spectroscopy 383
Table 1
Assignments of the vibrational modes for the oxidized isoalloxazine moiety of FMN
3.2.1 Neutral Form Raman spectra of neutral semiquinoid flavin were first observed in
1980 independently by Dutta et al. [23] and Nishina et al. [24].
The spectra differ markedly from those of oxidized flavin. In par-
ticular, the intense line at ~1,611 cm−1 is absent for oxidized flavin
and was suggested as a marker band in the determination of neu-
tral semiquinoid form [25].
In principle, both protons at N(3) and N(5) in neutral semi-
quinoid flavin are exchangeable with deuterons in deuteriated buffer.
Unexpectedly, however, it was found that the H/D exchange at
N(5) was much more difficult as compared to that at N(3) in pho-
tolyase. On the basis of this observation, assignments of Raman
bands were developed for neutral semiquinoid flavin [4]. The rR
spectrum of the neutral semiquinoid form of (6-4) photolyase was
equally obtained from photoreduced enzyme (dominant neutral
semiquinoid form) or purified enzyme (a mixture of oxidized and
neutral semiquinoid flavin) in H2O as shown in Fig. 5a, b, respec-
tively. Thus, the photoreduction method does not perturb the
protein environment of the flavin cofactor and the bands are solely
Resonance Raman Spectroscopy 385
3.2.2 Anionic Form The vibrational modes of anionic semiquinoid flavin were inves-
tigated by Nishina et al. based on isotope-labeled flavin [30].
Table 2
Assignments of the vibrational modes for the neutral semiquinoid isoalloxazinea
Table 3
Assignments of the vibrational modes for the anionic semiquinoid
isoalloxazine moietya
3.3 Hydroquinoid Compared with the vibrational modes of oxidized and semiquin-
Flavin oid flavins, the understanding of hydroquinoid flavin is still ele-
mentary. Zheng et al. reported the assignments of neutral
semiquinoid flavin [31] as shown in Table 4. However, the anionic
hydroquinoid flavin, which is deprotonated at N(1) and may be
more planar [32], is often present in flavoproteins and its assign-
ments need to be clarified.
4 Case Studies
Table 4
Assignments of the vibrational modes for the neutral hydroquinoid
isoalloxazine moietya
4.1 Photoreceptors Recently, flavin was found to play an important role as chromophore
in photoreceptor proteins. So far, three classes of photoactive fla-
voproteins have been recognized: the photolyase/cryptochrome
protein family with a photolyase homology region (PHR) domain,
phototropin with light, oxygen, and voltage (LOV) domains, and
blue-light sensory proteins with a BLUF (blue light sensing using
flavin adenine dinucleotide) domain. The photochemistry of flavin
is key to unravel the reaction mechanisms of photoactive flavopro-
teins in their biological functions, such as DNA repair or signal
transduction.
Among the photoactive flavoproteins, FAD was first identified
in 1987 as a catalytic cofactor of photolyase, a repair enzyme of
photodamaged DNA [33]. Successively in 1995, FAD was discov-
ered in cryptochrome (CRY), which has a sequence homologous to
photolyase [34]. CRY serves as a blue-light receptor that regulates
the light-induced responses of plants and also controls the circadian
rhythm of animals. Recently, it was noted that CRY works as an
important player in rapid light perception like rhodopsin [35].
In both photolyase and CRY, FAD is buried in the PHR domain.
Phototropin, which regulates the phototropism responses in plants,
390 Jiang Li and Teizo Kitagawa
came into the scene in 1997 [36]. Phototropin binds two flavin
mononucleotide (FMN) molecules within a pair of LOV domains.
At almost the same time, the third type of photoactive flavoproteins
was found in blue-light sensory proteins with BLUF domains in
1997 [37]. So far, the DNA repair mechanism of FAD in the PHR
domain and the signal transduction mechanisms of FMN in LOV
domain and of FAD in BLUF domain have been well explained.
However, the photochemistry of FAD in the PHR domain of CRY
is still elusive. In the past decade, these photoreceptor proteins
were actively investigated by vibrational spectroscopy [38].
4.1.1 FAD in PHR Domain Photolyase is a blue-light-activated enzyme that repairs ultraviolet
(UV)-damaged DNA. There are two major UV-induced DNA
lesions, cyclobutane pyrimidine dimer (CPD) and (6-4) photo-
product (64PP), which are repaired by CPD photolyase and (6-4)
photolyase, respectively. The photoexcited FAD in photolyase
adopts the anionic two-electron-reduced state (see Fig. 2) and splits
the UV-damaged DNA dimer through a cyclic electron transfer
between FAD and DNA. Schelvis et al. were the first to examine
CPD photolyase combined with DNA substrate by rR spectros-
copy and discussed the vibrational modes of one-electron-reduced
neutral FAD and their perturbations by substrate binding [26, 39].
These studies provided the basis for understanding the structure
and environment of FAD when placed in a PHR domain. For
example, frequencies of bands between 1,615 and 1,150 cm−1
observed for one-electron-reduced neutral FAD are all lower in
photolyase compared with those in neutral semiquinoid flavin in
other flavoproteins, which suggests a stronger hydrogen bonding
environment in photolyase. Indeed, the crystal structure of CPD
photolyase has shown a very special U-shaped conformation of
FAD, in which the adenine ring of FAD approaches the N(10)–
C(10a) of the isoalloxazine moiety (see Fig. 1), and in addition, an
intramolecular hydrogen bond is formed between the 2′-OH of
the ribityl chain and the N(1) of isoalloxazine [40]. Such a bent
FAD is characteristic of this protein family, in which the adenine
has been demonstrated to bridge over the isoalloxazine and DNA
substrate to facilitate the electron transfer between them [41].
Little was known about (6-4) photolyase when this enzyme
was investigated by rR spectroscopy [3, 4]. The Raman spectra of
neutral semiquinoid forms of both (6-4) and CPD photolyases
with and without DNA substrate were systematically measured
with 568.2 nm excitation and are shown in Fig. 6. The marker
band of the neutral semiquinoid flavin appears at 1,606–1,607 cm−1
in both proteins. The behaviors of this band upon binding of sub-
strate are shown in the difference spectra. This band of CPD pho-
tolyase is not shifted upon binding of normal DNA (Fig. 6B-d) but
is downshifted upon binding of photodamaged DNA (Fig. 6B-e).
In contrast, the corresponding band in (6-4) photolyase is unal-
tered at all (Fig. 6A-d, e). This band is thought to be composed of
Resonance Raman Spectroscopy 391
1606
1607
l=568.2 nm
1398
1298
1374 1391
1391
1302
1338
1528
1331
1522
1377
1331
(a) photolyase
(b) +DNA
(d) [(b)-(a)]x3
1394
1401
1603
1530
1305
(e) [(c)-(a)]x3
1329
1391
1298
1331
1523
1610
1299
Fig. 6 Resonance Raman spectra of 150 μM neutral semiquinoid (6-4) photolyase (A) and CPD photolyase (B).
In both (A) and (B) panels, (a) shows the spectrum of the enzyme alone, (b) the spectrum in the presence of
300 μM poly(dT)10, (c) the spectrum in the presence of 300 μM UV-irradiated poly(dT)10, (d) the difference spec-
trum [(b) − (a)] × 3, and (e) the difference spectrum [(c) − (a)] × 3. The Raman excitation wavelength was 568.2 nm
1345
l
1350
1465
1228
1340
Xll
1577
1250
1398
1575
1222
1400
Xll
1622
V lV lll lV lll
1621
1178
X
1494
1509
-1180
1541
1544
1459
1321
1254
(b) +DNA
(d) [(b)-(a)]x3
1223
1346
1581
1183
1356
1582
1550
1403
1625
1250 1260
(e) [(c)-(a)]x3
1247
1335
1573
1402
1352
1571
1221
1200 1300 1400 1500 1600 1200 1300 1400 1500 1600
Raman Shift (cm-1)
Fig. 7 Resonance Raman spectra of 75 μM oxidized (6-4) photolyase (A) and CPD photolyase (B). In both (A)
and (B) panels, (a) shows the spectrum of the enzyme alone, (b) the spectrum in the presence of 150 μM
poly(dT)10, (c) the presence of 150 μM UV-irradiated poly (dT)10, (d) the difference spectrum [(b) − (a)] × 3, and
(e) the difference spectrum [(c) − (a)] × 3. The Raman excitation wavelength was 488.0 nm. Band numbering is
the same as used in Table 1 [12]. “G” Raman band of glycerol. Inset: Band X of (6-4) photolyase in the absence
(solid line) and presence (dotted line) of UV-irradiated poly (dT)10
4.1.2 FMN in LOV The FMN-bound LOV domain placed in the dark absorbs maxi-
Domain mally around 450 nm. Blue-light illumination triggers a photocy-
cle involving the formation of the excited triplet state of FMN
followed by a reversible formation of a blue-shifted signaling state
(LOV 370, absorbing maximally around 370 nm), and then the
394 Jiang Li and Teizo Kitagawa
original state is slowly restored in the dark. The signaling state was
demonstrated to involve a light-induced formation of a covalent
bond between C(4a) of FMN and a nearby cysteine [44]. Alexandre
et al. observed that the C(4a)-thiol adduct of flavin exhibited small
but significant downshifts of ring I vibrations and upshifts of ring
II and ring III vibrations. These trends are similar to those observed
for FMN derivatives substituted with an electron-donating group
at ring I [45]. Thus, the intersystem-crossing rate is increased in
LOV through appreciable donation of electrons by the cysteine
residue through mixing of π-orbitals of isoalloxazine with a p
orbital of sulfur. The proximity of the cysteine to FMN not only
enables the formation of a covalent adduct between FMN and cys-
teine but also facilitates the rapid formation of the reactive triplet
state of FMN [46]. More recently, a vibrational assignment of the
flavin-thiol adduct was proposed by Kikuchi et al., who provided a
framework for future investigations of the photocycle mechanism
of LOV domains by vibrational spectroscopy [47].
4.1.3 FAD in BLUF The BLUF domain exhibits typical features of an oxidized FAD in
Domain the dark. Upon blue-light illumination, the FAD forms an inter-
mediate signaling state with an ~10 nm red-shifted absorbance
without apparent variations in the redox state of the flavin. The
red-shifted state of FAD returns to the original form in the dark. It
has been identified that the signaling state is formed when the
hydrogen bonding between flavin and glutamine is switched from
N(5) to C(4)=O of flavin. Raman spectroscopy played an impor-
tant role in clarifying this mechanism [14, 48, 49].
A large downshift of ~15 cm−1 was observed for the C(4)=O
stretching of isoalloxazine upon blue-light illumination [14]. The
downshift indicates the formation of a strong hydrogen bond at
C(4)=O when FAD is brought into the signaling state yielding the
red-shifted absorption. Unno et al. carried out Raman spectro-
scopic studies on wild-type and mutated BLUF domains and clari-
fied that the hydrogen bonding switch from the Gln63-NH2···N(5)
to Gln63-NH2···O=C(4) of flavin is the key step [48]. The confor-
mational and environmental changes of a tryptophan residue
induced by hydrogen bonding switch were also observed [49].
4.2 Charge Transfer It has been long known that semiquinoid flavins have a broad
Complexes absorption band at longer wavelengths. However, during the reac-
tion of various flavoproteins with substrates, non-semiquinoid
intermediates often show a similar broad absorption. These reac-
tion intermediates are usually assigned to CT complexes of oxi-
dized or reduced flavin with a substrate or a product. Unlike in real
electron transfer, which occurs through migration of electron(s)
from the highest occupied molecular orbital (HOMO) of a donor
to the lowest unoccupied molecular orbital (LUMO) of an accep-
tor, an electron is partly shared between a donor and an acceptor
in CT complexes, and thus a new level of electrons is generated.
Resonance Raman Spectroscopy 395
Electronic excitation from the ground state to the new level yields
the red-shifted broad absorption called a CT band. Accordingly,
Raman excitation in resonance with a CT band gives some of the
vibrations associated with the CT phenomenon. Although Raman
intensity is obtained from the CT-excited state, the observed
Raman spectra reflect the vibrations in the ground state of the CT
complex. Therefore, it is often seen that the formation of a CT
complex affects the frequencies of Raman bands only a little,
because they are mainly determined by the electronic ground state
[42]. Since rR spectra excited in resonance with a CT band can
reveal details of donor–acceptor interactions that often occur in
reaction intermediates of flavoenzymes, CT complexes were exten-
sively investigated by rR spectroscopy [42, 50–69].
Old yellow enzyme (OYE, NADPH oxidoreductase) contains
an FMN. It had been known that phenol derivatives were bound
to OYE when the flavin was in the oxidized state, giving rise to a
long-wavelength absorption. Kitagawa et al. first applied the rR
technique to the OYE–pentafluorophenol complex by exciting
Raman scattering in resonance with the long-wavelength band and
observed a Raman spectrum characteristic of the CT complex [51].
It was found that the relative intensities of Raman bands were sig-
nificantly different between the CT complex and free OYE and
phenol molecules. As for the flavin moiety, the intensity enhance-
ment of the 1,588-cm−1 band (Band II) was conspicuous. This
band of oxidized flavin is known to mostly involve the vibrational
displacements of the C(4a) and N(5) atoms of isoalloxazine. The
invariance of Raman frequencies of Band X indicates that ring III
involving the N(3)–H was not involved in the CT interaction and,
therefore, ring III vibrations were not resonance enhanced by the
CT band. These results suggest that the CT interaction occurs at
the C(4a)–N(5) region in the parallel-plane arrangement of isoal-
loxazine and phenol [50, 51], which was later confirmed by the
crystal structure.
The most unique results from CT-rR spectra were reported
from the “purple intermediate” of D-amino acid oxidase (DAAO).
This enzyme contains FAD and catalyzes the oxidative deamina-
tion of D-amino acids. The “purple intermediate,” which yields
broad absorption beyond 700 nm, is practically a CT complex of
reduced FAD anion with a product, 2-keto-imino acid, and is oxi-
dized by O2 to restore the oxidized enzyme. This process is the
oxidative half cycle of the enzyme. Miura et al. had found from
13
C-NMR experiments that the reactivity of the “purple intermedi-
ate” becomes higher as the electron density at C(4a) increases and
interpreted this observation with the note that the reaction is initi-
ated by nucleophilic attack of C(4a) to O2 [70]. The rR spectra in
resonance with the CT band were reported by the same group
[58–60], which proved that the intermediate is indeed a CT com-
plex between the zwitterionic form of the imino acid product and
an anionic reduced FAD illustrated in Fig. 8(I).
396 Jiang Li and Teizo Kitagawa
Fig. 8 Three limiting structures involved in resonance hybridization of two-electron-reduced anionic flavin. I is
dominant in flavo-oxidases, and II is dominant in flavo-dehydrogenases [69]
5 Notes
References
1. Miura R (2001) Versatility and specificity in 7. Dutta PK, Nestor JR, Spiro TG (1977)
flavoenzymes: control mechanisms of flavin Resonance coherent anti-stokes Raman-
reactivity. Chem Rec 1:183–194 scattering spectra of fluorescent biological
2. Sancar A (2003) Structure and function of chromophores. Vibrational evidence for
DNA photolyase and cryptochrome blue-light hydrogen-bonding of flavin to glucose oxidase
photoreceptors. Chem Rev 103:2203–2237 and for rapid solvent exchange. Proc Natl Acad
3. Li J, Uchida T, Todo T, Kitagawa T (2006) Sci U S A 74:4146–4149
Similarities and differences between cyclobu- 8. Nishina Y, Kitagawa T, Shiga K, Horiike K,
tane pyrimidine dimer photolyase and (6-4) Matsumura Y, Watari H, Yamano T (1978)
photolyase as revealed by resonance Raman Resonance Raman spectra of riboflavin and its
spectroscopy: electron transfer from the FAD derivatives in the bound state with egg ribofla-
cofactor to ultraviolet-damaged DNA. J Biol vin binding proteins. J Biochem 84:925–932
Chem 281:25551–25559 9. Kitagawa T, Nishina Y, Kyogoku Y, Yamano T,
4. Li J, Uchida T, Ohta T, Todo T, Kitagawa T Ohishi N, Takai-Suzuki A, Yagi K (1979)
(2006) Characteristic structure and environ- Resonance Raman spectra of carbon-13- and
ment in FAD cofactor of (6-4) photolyase nitrogen-15-labeled riboflavin bound to egg-
along function revealed by resonance Raman white flavoprotein. Biochemistry 18:1804–1808
spectroscopy. J Phys Chem B 110: 10. Nishina Y, Shiga K, Horiike K, Tojo H, Kasai S,
16724–16732 Yanase K, Matsui K, Watari H, Yamano T (1980)
5. Mataga N, Chosrowjan H, Shibata Y, Tanaka Vibrational-modes of flavin bound to riboflavin
F (1998) Ultrafast fluorescence quenching binding-protein from egg-white. Resonance
dynamics of flavin chromophores in protein Raman-spectra of lumiflavin and 8-substituted
nanospace. J Phys Chem B 102:7081–7084 riboflavin. J Biochem 88:403–409
6. Li J, Liu Z, Tan C, Guo X, Wang L, Sancar A, 11. Abe M, Kyogoku Y (1987) Vibrational analysis
Zhong D (2010) Dynamics and mechanism of of flavin derivatives: normal coordinate treat-
repair of ultraviolet-induced (6-4) photoprod- ments of lumiflavin. Spectrochim Acta A Mol
uct by photolyase. Nature 466:887–890 Spectrosc 43:1027–1037
398 Jiang Li and Teizo Kitagawa
12. Bowman WD, Spiro TG (1981) Normal mode Clostridium MP flavodoxin. Biochemistry
analysis of lumiflavin and interpretation of res- 19:1590–1593
onance Raman-spectra of flavoproteins. 24. Nishina Y, Shiga K, Horiike K, Tojo H, Kasai
Biochemistry 20:3313–3318 S, Matsui K, Watari H, Yamano T (1980)
13. Eisenberg AS, Schelvis JP (2008) Contributions Resonance Raman spectra of semiquinone
of the 8-methyl group to the vibrational nor- forms of flavins bound to riboflavin binding
mal modes of flavin mononucleotide and its protein. J Biochem 88:411–416
5-methyl semiquinone radical. J Phys Chem A 25. Kitagawa T, Sakamoto H, Sugiyama T, Yamano
112:6179–6189 T (1982) Formation of the semiquinone form
14. Unno M, Sano R, Masuda S, Ono TA, in the anaerobic reduction of adrenodoxin
Yamauchi S (2005) Light-induced structural reductase by NADPH. Resonance Raman,
changes in the active site of the BLUF domain EPR, and optical spectroscopic evidence.
in AppA by Raman spectroscopy. J Phys Chem J Biol Chem 257:12075–12080
B 109:12620–12626 26. Schelvis JPM, Ramsey M, Sokolova O, Tavares
15. Zheng YG, Dong J, Palfey BA, Carey PR C, Cecala C, Connell K, Wagner S, Gindt YM
(1999) Using Raman spectroscopy to monitor (2003) Resonance Raman and UV-Vis spec-
the solvent-exposed and “buried” forms troscopic characterization of FADH• in the
of flavin in p-hydroxybenzoate hydroxylase. complex of photolyase with UV-damaged
Biochemistry 38:16727–16732 DNA. J Phys Chem B 107:12352–12362
16. Lively CR, McFarland JT (1990) Assignment 27. Sugiyama T, Nisimoto Y, Mason HS, Loehr
and the effect of hydrogen bonding on the TM (1985) Flavins of NADPH-
vibrational normal modes of flavins and flavo- cytochrome-P-450 reductase: evidence for
proteins. J Phys Chem 94:3980–3994 structural alteration of flavins in their one-
17. Tegoni M, Gervais M, Desbois A (1997) electron-reduced semiquinone states from
Resonance Raman study on the oxidized and resonance Raman spectroscopy. Biochemistry
anionic semiquinone forms of flavocytochrome 24:3012–3019
b2 and L-lactate monooxygenase. Influence of 28. Park HW, Kim ST, Sancar A, Deisenhofer J
the structure and environment of the isoallox- (1995) Crystal structure of DNA photoly-
azine ring on the flavin function. Biochemistry ase from Escherichia coli. Science 268:
36:8932–8946 1866–1872
18. Yang K-Y, Swenson RP (2007) Modulation of 29. Maul MJ, Barends TR, Glas AF, Cryle MJ,
the redox properties of the flavin cofactor Domratcheva T, Schneider S, Schlichting I,
through hydrogen-bonding interactions with Carell T (2008) Crystal structure and mecha-
the N(5) atom: role of αSer254 in the electron- nism of a DNA (6-4) photolyase. Angew
transfer flavoprotein from the methylotrophic Chem Int Ed 47:10076–10080
bacterium W3A1. Biochemistry 46:2289–2297 30. Nishina Y, Tojo H, Shiga K (1988) Resonance
19. Yang K-Y, Swenson RP (2007) Nonresonance Raman-spectra of anionic semiquinoid form of
Raman study of the flavin cofactor and its inter- a flavoenzyme, D-amino-acid oxidase.
actions in the methylotrophic bacterium W3A1 J Biochem 104:227–231
electron-transfer flavoprotein. Biochemistry 31. Zheng YG, Carey PR, Palfey BA (2004)
46:2298–2305 Raman spectrum of fully reduced flavin.
20. Hazekawa I, Nishina Y, Sato K, Shichiri M, J Raman Spectrosc 35:521–524
Miura R, Shiga K (1997) A Raman study on 32. Zheng YJ, Ornstein RL (1996) A theoretical
the C(4)=O stretching mode of flavins in fla- study of the structures of flavin in different
voenzymes: hydrogen bonding at the C(4)=O oxidation and protonation states. J Am Chem
moiety. J Biochem 121:1147–1154 Soc 118:9402–9408
21. Su Y, Tripathi GNR (1994) Time-resolved 33. Jorns MS, Baldwin ET, Sancar GB, Sancar A
resonance Raman observation of protein-free (1987) Action mechanism of Escherichia coli
riboflavin semiquinone radicals. J Am Chem DNA photolyase. II. Role of the chromo-
Soc 116:4405–4407 phores in catalysis. J Biol Chem 262:486–491
22. Schelvis JPM, Pun D, Goyal N, Sokolova O 34. Lin C, Robertson DE, Ahmad M, Raibekas
(2006) Resonance Raman spectra of the neu- AA, Jorns MS, Dutton PL, Cashmore AR
tral and anionic radical semiquinones of flavin (1995) Association of flavin adenine dinucleo-
adenine dinucleotide in glucose oxidase revis- tide with the Arabidopsis blue light receptor
ited. J Raman Spectrosc 37:822–829 CRY1. Science 269:968–970
23. Dutta PK, Spiro TG (1980) Resonance 35. Fogle KJ, Parson KG, Dahm NA, Holmes TC
coherent anti-Stokes Raman scattering spectra (2011) Cryptochrome is a blue-light sensor
of oxidized and semiquinone forms of
Resonance Raman Spectroscopy 399
that regulates neuronal firing rate. Science 47. Kikuchi S, Unno M, Zikihara K, Tokutomi S,
331:1409–1413 Yamauchi S (2009) Vibrational assignment of
36. Huala E, Oeller PW, Liscum E, Han IS, Larsen the flavin-cysteinyl adduct in a signaling state
E, Briggs WR (1997) Arabidopsis NPH1: a of the LOV domain in FKF1. J Phys Chem B
protein kinase with a putative redox-sensing 113:2913–2921
domain. Science 278:2120–2123 48. Unno M, Masuda S, Ono TA, Yamauchi S
37. Iseki M, Matsunaga S, Murakami A, Ohno K, (2006) Orientation of a key glutamine residue in
Shiga K, Yoshida K, Sugai M, Takahashi T, the BLUF domain from AppA revealed by muta-
Hori T, Watanabe M (2002) A blue-light- genesis, spectroscopy, and quantum chemical
activated adenylyl cyclase mediates pho- calculations. J Am Chem Soc 128:5638–5639
toavoidance in Euglena gracilis. Nature 49. Unno M, Kikuchi S, Masuda S (2010)
415:1047–1051 Structural refinement of a key tryptophan resi-
38. Li J, Kitagawa T (2011) Applications of vibra- due in the BLUF photoreceptor AppA by
tional spectroscopy in the study of flavin-based ultraviolet resonance Raman spectroscopy.
photoactive proteins. Spectroscopy Biophys J 98:1949–1956
25:261–269 50. Nishina Y, Kitagawa T, Shiga K, Watari H,
39. Murphy AK, Tammaro M, Cortazar F, Gindt Yamano T (1980) Resonance Raman study of
YM, Schelvis JPM (2008) Effect of the flavoenzyme-inhibitor charge-transfer interac-
cyclobutane cytidine dimer on the properties tions. Old yellow enzyme-phenol complexes.
of Escherichia coli DNA photolyase. J Phys J Biochem 87:831–839
Chem B 112:15217–15226 51. Kitagawa T, Nishina Y, Shiga K, Watari H,
40. Mees A, Klar T, Gnau P, Hennecke U, Eker Matsumura Y, Yamano T (1979) Resonance
AP, Carell T, Essen L-O (2004) Crystal struc- Raman evidence for charge-transfer interac-
ture of a photolyase bound to a CPD-like tions of phenols with the flavin mono-
DNA lesion after in situ repair. Science nucleotide of old yellow enzyme. J Am Chem
306:1789–1793 Soc 101:3376–3378
41. Liu Z, Tan C, Guo X, Kao YT, Li J, Wang L, 52. Nishina Y, Sato K, Shi R, Setoyama C, Miura
Sancar A, Zhong D (2011) Dynamics and R, Shiga K (2001) On the ligands in charge-
mechanism of cyclobutane pyrimidine dimer transfer complexes of porcine kidney flavoen-
repair by DNA photolyase. Proc Natl Acad Sci zyme D-amino acid oxidase in three redox
U S A 108:14831–14836 states: a resonance Raman study. J Biochem
42. Benecky M, Li TY, Schmidt J, Frerman F, 130:637–647
Watters KL, McFarland J (1979) Resonance 53. Tamaoki H, Setoyama C, Miura R, Hazekawa
Raman study of flavins and the flavoprotein I, Nishina Y, Shiga K (1997) Spectroscopic
fatty acyl coenzyme A dehydrogenase. studies of rat liver acyl-CoA oxidase with refer-
Biochemistry 18:3471–3476 ence to recognition and activation of substrate.
43. Sokolowsky K, Newton M, Lucero C, J Biochem 121:1139–1146
Wertheim B, Freedman J, Cortazar F, Czochor 54. Nishina Y, Sato K, Miura R, Shiga K (1995)
J, Schelvis JPM, Gindt YM (2010) Structures of charge-transfer complexes of fla-
Spectroscopic and thermodynamic compari- voenzyme D-amino-acid oxidase. A study by
sons of Escherichia coli DNA photolyase and resonance Raman-spectroscopy and extended
Vibrio cholerae cryptochrome 1. J Phys Chem Hückel molecular-orbital method. J Biochem
B 114:7121–7130 118:614–620
44. Salomon M, Christie JM, Knieb E, Lempert 55. Suzuki H, Koyama H, Nishina Y, Sato K, Shiga
U, Briggs WR (2000) Photochemical and K (1991) A resonance Raman study on a
mutational analysis of the FMN-binding reaction intermediate of Pseudomonas
domains of the plant blue light receptor, pho- L-phenylalanine oxidase (deaminating and
totropin. Biochemistry 39:9401–9410 decarboxylating). J Biochem 110:169–172
45. Schopfer LM, Haushalter JP, Smith M, Milad 56. Nishina Y, Sato K, Shiga K (1991)
M, Morris MD (1981) Resonance Raman Isomerization of Δ1-piperideine-2-carboxylate
spectra for flavin derivatives modified in the 8 to Δ2-piperideine-2-carboxylate on complex-
position. Biochemistry 20:6734–6739 ation with flavoprotein D-amino-acid oxidase.
46. Alexandre MT, van Grondelle R, Hellingwerf J Biochem 109:705–710
KJ, Robert B, Kennis JT (2008) Perturbation 57. Nishina Y, Miura R, Tojo H, Miyake Y, Watari
of the ground-state electronic structure of H, Shiga K (1986) A resonance Raman-study
FMN by the conserved cysteine in phototro- on the structures of complexes of flavoprotein
pin LOV2 domains. Phys Chem Chem Phys D-amino-acid oxidase. J Biochem 99:329–337
10:6693–6702
400 Jiang Li and Teizo Kitagawa
58. Nishina Y, Shiga K, Miura R, Tojo H, Ohta M, nance Raman study of a catalytic intermediate.
Miyake Y, Yamano T, Watari H (1983) On the J Biochem 117:800–808
structures of flavoprotein D-amino-acid oxi- 65. Hazekawa I, Nishina Y, Sato K, Shichiri M,
dase purple intermediates. A resonance Shiga K (1995) Substrate activating mecha-
Raman-study. J Biochem 94:1979–1990 nism of short-chain acyl-CoA, medium-chain
59. Miura R, Nishina Y, Ohta M, Tojo H, Shiga K, acyl-CoA, long-chain acyl-CoA, and isovaleryl-
Watari H, Yamano T, Miyake Y (1983) CoA dehydrogenases from bovine liver: a reso-
Resonance Raman study on the flavin in the nance Raman study on the 3-ketoacyl-CoA
purple intermediates of D-amino acid oxidase. complexes. J Biochem 118:900–910
Biochem Biophys Res Commun 111:588–594 66. Nishina Y, Sato K, Shiga K, Fujii S, Kuroda K,
60. Nishina Y, Shiga K, Watari H, Miura R, Miyake Miura R (1992) Resonance Raman study on
Y, Tojo H, Yamano T (1982) Resonance complexes of medium-chain acyl-CoA dehy-
Raman on the purple intermediates of the fla- drogenase. J Biochem 111:699–706
voenzyme D-amino acid oxidase. Biochem 67. Williamson G, Engel PC, Nishina Y, Shiga K
Biophys Res Commun 106:818–822 (1982) A resonance Raman study on the
61. Miura R, Nishina Y, Shiga K, Tojo H, Watari nature of charge-transfer interactions in butyryl
H, Miyake Y, Yamano T (1982) A resonance CoA dehydrogenase. FEBS Lett 138:29–32
Raman study on the reaction intermediates of 68. Schmidt J, Reinsch J, McFarland JT (1981)
D-amino acid oxidase. J Biochem 91:837–843 Mechanistic studies on fatty acyl-CoA dehy-
62. Nishina Y, Shiga K, Tojo H, Miura R, Watari drogenase. J Biol Chem 256:11667–11670
H, Yamano T (1981) Resonance Raman study 69. Nishina Y, Sato K, Miura R, Matsui K, Shiga K
of D-amino acid oxidase-inhibitor complexes. (1998) Resonance Raman study on reduced
J Biochem 90:1515–1520 flavin in purple intermediate of flavoenzyme:
63. Tamaoki H, Nishina Y, Shiga K, Miura R use of [4-carbonyl-18O]-enriched flavin.
(1999) Mechanism for the recognition and J Biochem 124:200–208
activation of substrate in medium-chain acyl- 70. Miura R, Nishina Y, Sato K, Fujii S, Kuroda K,
CoA dehydrogenase. J Biochem 125:285–296 Shiga K (1993) 13C- and 15N-NMR studies on
64. Nishina Y, Sato K, Hazekawa I, Shiga K (1995) medium-chain acyl-CoA dehydrogenase recon-
Structural modulation of 2-enoyl-CoA bound stituted with 13C- and 15N-enriched flavin ade-
to reduced acyl-CoA dehydrogenases: a reso- nine dinucleotide. J Biochem 113:106–113
Chapter 16
Abstract
Flavin-binding photoreceptor proteins use the isoalloxazine moiety of flavin cofactors to absorb light in the
blue/UV-A wavelength region and subsequently translate it into biological information. The underlying
photochemical reactions and protein structural dynamics are delicately tuned by the protein environment
and represent fundamental reactions in biology and chemistry. Due to their photo-switchable nature, these
proteins can be studied efficiently with laser-flash induced transient absorption and emission spectroscopy
with temporal precision down to the femtosecond time domain. Here, we describe the application of both
visible and mid-IR ultrafast transient absorption and time-resolved fluorescence methods in combination
with sophisticated global analysis procedures to elucidate the photochemistry and signal transduction of
BLUF (Blue light receptors using FAD) and LOV (Light oxygen voltage) photoreceptor domains.
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_16, © Springer Science+Business Media New York 2014
401
402 Tilo Mathes et al.
a
1.5
∆Absorbance
c
0.0
S2
-1.5
ESA
residuals
0.05 S1
0.00
-0.05
450 500 550 600 650 700 T
Energy
wavelength [nm]
SE
b GSB
1.5
∆Absorbance
S0 Photo-
0.0 products
-1.5
0.2
residuals
0.0
-0.2
450 500 550 600 650 700
wavelength [nm]
Fig. 1 (a) ΔA spectrum of the flavin singlet excited state minus the flavin ground state. Characteristic features
include the ground-state bleach (GSB, green) of the S0–S1 transition, excited-state absorption (ESA, blue, cyan,
magenta) and stimulated emission (SE, red ). The difference spectrum of the photoproduct (b) was derived
from transient-absorption experiments of the Slr1694 BLUF photoreceptor and modeled using steady-state
absorption spectra of light- and dark-adapted states; (c) simplified Jablonski scheme showing the corre-
sponding transitions. Photoproducts may be formed from the excited singlet (S1) or triplet ( T ) state
sample M6
Spectrograph La
La M4
Detector M5
mp2 Legend:
PDA
La - achromatic lens
beam m3 M - mirror pump path
Homebuilt 1kHz block m - mirror probe path
camera system mp - parabolic mirror
consisting of a photodiode mp1
White light # - shutter
array with 256 elements m1 generation R - rotator
# stage RR - retro reflector
m2
(80 Mhz seed)
R
Delay line Probe pulse #
oscillator
RR
kHz pump M3
laser M2
Fig. 2 Schematic representation of an ultrafast transient absorption spectroscopy setup (adapted from ref. 17)
IRF ( t ) =
1
D 2p
(
exp - log ( 2 )( 2 ( t - m ) / D )
2
)
( )
where D = D / 2 2 log ( 2 ) . Typically the FWHM is 120–160 fs
under our experimental conditions. The convolution of this
IRF with an exponential decay (with rate k) yields an analytical
expression, which facilitates the estimation of the IRF parameters
μ and Δ:
cl ( t , k , m , D ) = exp ( -kt ) × IRF(t )
1 é æ k D2 öù é é t - ( m + k D2 ) ù ù
= exp ( -kt ) × exp ê k ç m + ÷ ú ê1 + erf ê úú
2 ë è 2 øû ê
ë ê
ë 2D úû úû
j =1
Typically, with visible difference absorption measurements
over a large wavelength range, the order of this polynomial (jmax) is
3. The reference wavelength λc is usually at the center of the
spectrograph.
2.6 Global and The foundation of global analysis is the superposition principle,
Target Analysis which states that the measured data ΔA(t,λ) result from a superpo-
sition of the spectral properties εl(λ) of the components present in
the system of interest weighted by their concentration cl(t):
ncomp
DA ( t ,l ) = åc ( t )e ( l )
l l
l =1
The cl(t) of all ncomp components are described by a c ompartmental
model, that consists of first-order differential equations, with sums of
exponential decays as solution. We consider three types of compartmental
410 Tilo Mathes et al.
DA ( t ,l ) = åc ( k ) DADS ( l )
I
l l
l =1
The DADS thus represent the estimated amplitudes of the
above-defined exponential decays cI(kl). When the system consists
of parallely decaying components, the DADS are true species dif-
ference spectra. In all other cases, they are interpreted as a weighted
sum (with both positive and negative contributions) of true species
difference spectra.
In addition to exponentially decaying components, a coherent
artifact may be present. It can often be modeled as an extra com-
ponent with as concentration the IRF. Such spectra are typical in
nonlinear optics and may also contain Raman scattering from the
aqueous medium [17].
A sequential model consists of components decaying sequen-
tially 1 → 2 → ⋯ → ncomp where the decay rates kl are decreasing, and
the lifetimes 1/kl are increasing. It is a convenient way to describe
the spectral evolution, and each component possesses an EADS.
The model for the data now reads
ncomp
DA ( t ,l ) = åc ( k ) EADS ( l )
l
II
l l
l =1
where each concentration is a linear combination of the exponen-
tial decays,
l
clII = åb jl c I ( kl )
j =1
and the amplitudes [27] bjl are given by b11 = 1 and for:
l -1 l
b jl = Õkm / Õ (k n - kj )
m =1 n =1, n ¹ j
When the system truly consists of sequentially decaying
components, the EADS are true species difference spectra. In all
Photoactivation Mechanisms of Flavin-Binding Photoreceptors Revealed… 411
other cases they are interpreted as a weighted sum (with only posi-
tive contributions) of true species difference spectra.
In a more general target analysis a compartmental scheme is
used to describe the concentrations of the compartments (states).
Transitions to and from compartments are described by microscopic
rate constants. The model that is fitted to the data now reads:
ncomp
DA ( l ,t ) = åc ( t )SADS ( l )
i i
i =1
where ci(t) now corresponds to the concentration of the i-th com-
partment. SADSi(λ) is the i-th SADS. The concentrations of all
compartments are collated in a vector
T
c ( t ) = éëc1 ( t ) c2 ( t ) cncomp ( t ) ùû
T
= éë FAD * ( t ) Intermediate ( t ) Product ( t ) ùû
which obeys the differential equation
d
c ( t ) = Kc ( t ) + j ( t )
dt
where the transfer matrix K contains off-diagonal elements kpq,
representing the microscopic rate constant from compartment q to
compartment p. The diagonal elements contain the total decay
rates of each compartment. The input to the compartments is
j ( t ) = IRF ( t ) [1 0 0] . In most cases, spectral constraints are
T
BLUF domains are about ~130 amino acid large proteins that bind
FAD non-covalently through a number of hydrogen bonds and
hydrophobic interactions. Although the cofactor in vivo most
likely is FAD, the photochemistry of the flavin in BLUF domains
does not discriminate between riboflavin, FMN, and FAD. When
heterologously expressed, BLUF domains are not very specific for
FAD and bind FAD, FMN, and riboflavin in about equal amounts
[31]. In both eukaryotic and prokaryotic microorganisms, these
photosensitive domains regulate various photoprotective responses
and lifestyle decisions from photosynthesis gene expression, biofilm
formation to virulence [3, 4, 32, 33]. In many cases the BLUF
domain is fused to an enzyme effector domain involved in second
messenger synthesis or breakdown. Photoactivated adenylyl cyclase
412 Tilo Mathes et al.
a b c 9
R
1
H3C 9a N 10a N O
8 10 2
4 NH
H3C 7 5a N 4a 3
6
5
FAD d O
1.5
Absorbance
1.0
Q50
Y8 0.5 dark-adapted
light-adapted
Fig. 3 (a) Structure of the Slr1694 BLUF domain in the dark-adapted state; (b) BLUF conformation in the light-
adapted state. The proposed hydrogen-bond switch takes place between the conserved tyrosine, glutamine
and the flavin cofactor; (c) molecular structure and atom numbering of the isoalloxazine moiety of flavin (d)
Absorption spectra of the dark state (black) and the light-adapted state (red). The latter is red-shifted by ~15
nm relative to the dark state
3.1 Time-Resolved Due to the exceedingly high speed of the hydrogen-bond switch
Fluorescence reaction in BLUF domains, only ultrafast spectroscopy is capable
of addressing its mechanistic details. Time-resolved fluorescence
spectroscopy is a straightforward method to address the light-
driven reactions in BLUF domains, since it monitors solely the
emissive excited states. The experiments were performed using a
synchro-scan streak camera, which records time-resolved fluores-
cence spectra with a time resolution down to a few picoseconds.
A concise review on this method was provided by van Stokkum
et al. [24, 65]. Figure 4 shows the DAS that result from global
analysis of synchro-scan streak camera experiments on the Slr1694
(panel a) and AppA (panel b) BLUF domains [45, 58, 59]. The
experiments revealed a highly multiexponential excited-state decay,
with 4–5 decay components ranging from 6 ps to 4.5 ns in Slr1694,
and from 25 ps to 3.8 ns in AppA. Overall, the excited-state decay
in Slr1694 was significantly faster than in AppA, with a dominant
component of 26 ps in the former, and 670 ps in the latter. The
multiexponential excited-state decay most likely follows from side-
chain mobility in the flavin-binding pocket [66], which results in
subpopulations having variations in the distance between FAD and
the aromatic residues, with an ensuing distribution of light-induced
electron transfer rates as a result.
The time-resolved fluorescence experiments also enabled
the separation of non-covalently bound and unbound flavin in the
excited-state evolution. The fluorescence emission of free flavin is sig-
nificantly shifted to the red compared to when bound to the BLUF
domain (~25 nm) and has a characteristic lifetime of about 4.5–5 ns
414 Tilo Mathes et al.
a b
8 5
6 ps 25 ps
26 ps 4 150 ps
6
92 ps 670 ps
3
Intensity
Intensity
335 ps 3.8 ns
4
4.5 ns
2
2
1
0 0
Fig. 4 (a) Decay associated spectra (DAS) from time-resolved fluorescence experiments on Slr1694 with their
associated lifetimes; (b) same as panel (a) for the AppA BLUF domain
a
τ1 τ2 τ3 τ4 τ5
1 2 3 4 5 ...
b 4
c
5
2
∆Absorbance [10-3]
∆Absorbance [10-3]
0
0
0.9 ps 250 fs
-2 -5
7 ps 1.2 ps
22 ps 90 ps
-4 -10 590 ps
123 ps
inf 2.7 ns
-6
-15 inf
450 500 550 600 650 700 450 500 550 600 650
wavelength [nm] wavelength [nm]
Fig. 5 (a) Sequential kinetic scheme with increasing lifetimes (τ1 < τ2 < τ3 < τ4 < τ5) used for global analysis of
transient absorption data on the Slr1694 and AppA BLUF domains; (b) Evolution-Associated Difference Spectra
(EADS) that follow from global analysis of transient absorption data of Slr1694; (c) same as (b) for the AppA
BLUF domain
a b c
0 1
∆Absorbance@488nm
∆Absorbance@441nm
∆Absorbance@550nm
0
0
-1 -1
0 10 20 100 1000 10 20 100 1000 0 10 20 100 1000
t [ps] t [ps] t [ps]
d e
1 1
∆Absorbance@610nm
∆Absorbance@710nm
0 0
Fig. 6 Transient absorption kinetic traces recorded in the Slr1694 BLUF domain in H2O (black) and D2O (grey )
and the AppA BLUF domain in H2O (red ) at the wavelengths indicated at the vertical axes. The time axis is linear
up to 20 ps and logarithmic hence after, indicated by the skewed lines. The kinetics derive from the same
datasets as shown in Fig. 5. Circles represent transient absorption data, lines denote the result of a global fit
at 710 nm (Fig. 6e) did not show any kinetic isotope effect, this
strongly suggested that FAD* decay and the first intermediate
formation does not involve proton transfer. This finding was further
corroborated by time-resolved fluorescence spectroscopy, which
showed an H/D isotope-independent excited-state decay [45].
3.3 Target Analysis On the basis of these observations and primary analyses, a target
model was established for Slr1694 to determine the spectra of the
pure intermediate species, and hence, to arrive at a molecular mech-
anism for BLUF photoactivation. In a target analysis, a specific
kinetic model for the photoreaction is proposed. For instance,
branching can be introduced and inverted kinetics, where a species
that decays faster than its formation can be modeled. The spectra of
these compartments should then reflect the pure species and are
therefore referred to as SADS. Key features of the spectral evolution
include multiexponential decay of FAD*, the involvement of one
or more reaction intermediates, and finally, formation of the red-
shifted signaling state BLUFRED. The heterogeneity of excited-state
decay is taken into account by multiple FAD* compartments that
each have their own lifetime and population fraction, which feed
418 Tilo Mathes et al.
a b
0.2
0.2
u1res
u1res
0.0 0.0
-0.2
-0.2
Fig. 7 Singular-value decomposition (SVD) of the matrix of residuals using different models. The respective
first left singular vector, u1res(t), H2O in black and D2O in red, for a model with only one intermediate (Q1) preced-
ing the product state SlrRED (a) and with the inclusion of a second intermediate Q2 (b) are displayed (reproduced
from ref. 51)
a
FAD1* FAD2* FAD3* FAD4*
b
k1 F2 k2 F3 0.5
F1 k3 F4 k4
0.4
Q1
concentration
0.3
= 0.5 k5
0.2
Q2 0.1
k6
0.0
0 5 10 15 100 1000
SlrRED time (ps)
Fig. 8 Kinetic scheme and concentration profile that apply to the target analysis of the Slr1694 BLUF domain,
reproduced from ref. 51. (a) Kinetic scheme used to describe the spectral evolution of Slr1694 by means of a
target analysis. Here ki is a rate constant, Fi denotes the fractional contribution of the FAD*i state. Φ is the yield
by which Q1 interconverts to Q2 and is set at 50 %. (b) Concentration profiles for FAD*1–4 (blue), Q1 (black), Q2
(magenta), and SlrRED (orange) from the target analysis of time-resolved data on Slr1694 in H2O (solid lines) and
D2O (dotted lines)
Slr1694
blue
light
5
∆Absorbance [10-3]
FAD
5s
0 7 ps
FAD 40 ps
FAD 180 ps
-5 FADH Slrred FAD
65 ps
SlrRED 6 ps
(160 ps)
(18 ps)
450 500 550 600 650 700
wavelength [nm] FADH
Fig. 9 Simultaneous target analysis of Slr1694 absorbance changes in H2O (solid) and D2O (dashed) according
to the kinetic model shown in Fig. 8, schematically reproduced in the right panel. The SADS (left) resemble the
difference spectra of flavin excited state FAD*, anionic FAD•− and neutral semiquinone FADH• as well as the
final signaling state. The lifetimes are displayed in the model (right) with the deuterium-affected lifetimes in
parentheses (reproduced from ref. 51)
3.4 Ultrafast Mid-IR The transient absorption experiments in the visible range provided
Transient Absorption detailed information on the sequence of reactions involving the
Spectroscopy flavin in the photoactivation mechanism of BLUF domains. Yet,
the dynamic events that involve structural dynamics of the
chromophore and the protein, which include electron and proton
transfer and hydrogen-bond dynamics are often spectrally silent in
the UV–Vis, or otherwise give nonspecific signals. A powerful
approach to visualize the dynamics of the protein in this process is
to probe in the mid-IR spectral region, where the vibrational
modes of molecular groups of interest absorb [45].
Femtosecond probe pulses in the mid-IR were generated in an
OPG (TOPAS) pumped by an amplifier Ti:sapphire laser system,
equipped with a difference-frequency generation module utilizing
a AgGaS2 crystal. The spectral width of the mid-IR output beam
was ~150 to 180 cm−1 and the MCT array consisted of 32 elements,
Photoactivation Mechanisms of Flavin-Binding Photoreceptors Revealed… 421
a 0
b -10 -5 0 10 100 1000
-1 0.2
FAD FAD FAD
FAD (C=N)
(C=O) (C=C) 0.0
-2
-0.2
1750 1700 1650 1600 1550 1500 1450 -0.4
1692 cm-1
-0.6
0
∆Absorbance [10-3]
∆Absorbance [10-3]
-1 Q1 0.6
Tyr
(C=C) 0.4
-2 1617 cm-1
0.2
1750 1700 1650 1600 1550 1500 1450
0.0
0
-0.2
Q2
-0.4
Tyr
(C=C)
0.4
-1
Fig. 10 (a) Species-Associated Difference Spectra (SADS) that follow from a target analysis of the time-
resolved mid-IR data of the Synechocystis Slr1694 BLUF domain in D2O upon excitation at 475 nm; (b) Kinetic
traces at indicated mid-IR vibrational frequencies
FAD* SADS (blue line) is only due to the FAD chromophore and
shows ground-state bleach of the C(4)═O and C(2)═O stretch at
1,700 cm−1, ring-I C═C stretch bleach at 1,635 cm−1, and C═N
stretch bleach at 1,580 and 1,545 cm−1. The ground-state bleaches
were accompanied by induced absorptions at lower wave numbers,
which is consistent with the notion of an overall bond-order
decrease upon a π–π* transition [71, 73]. The Q1 SADS (red line)
shows the same bleaches as the FAD* SADS and an induced
absorption pattern that is consistent with that of a FAD•− species,
in particular the broad induced absorption at 1,500–1,530 cm−1
[74]. Importantly, it shows an additional bleach at 1,617 cm−1 that
was not present in the FAD* SADS and is therefore not due to the
FAD chromophore. Such a vibrational frequency is characteristic
for aromatic ring vibrations [75, 76], and it was therefore assigned
to Tyr8. The kinetics at 1,617 cm−1 in Fig. 10b clearly show the
evolution from an induced absorption (of FAD*) into a ground-
state bleach assignable to Tyr8. We conclude that electron transfer
from Tyr8 to FAD constitutes the primary reaction that photoac-
tivates the BLUF domain. The Q2 SADS (green line) exhibits the
same bleaches as the previous SADS, including that of Tyr8 at
1,617 cm−1. The induced absorption at 1,530 cm−1 has narrowed
significantly with respect to that of Q1, and is consistent with the
presence of a FADH• radical [74]. In addition, this SADS shows
an induced absorption at 1,210 cm−1 (not shown), which can be
assigned to the N(5)–H in-plane bend [45], which indicates that
protonation of the FADH• indeed takes place at N(5). Finally, the
BLUFRED SADS (magenta line) shows a downshift of the C(4)═O
stretch around 1,700 cm−1, along with a downshift of the C═N
stretches around 1,550 cm−1. Such downshifts are also illustrated
in Fig 10b with the kinetics at 1,692 and 1,540 cm−1. These obser-
vations indicate increased hydrogen-bond strength at the C(4)═O
and N(5) sites, and therefore, provides evidence for the hydrogen-
bond switch among FAD and nearby amino acids.
3.5 The BLUF On the basis of the ultrafast UV–Vis and mid-IR transient
Hydrogen-Bond absorptions, the time-resolved fluorescence experiments and the
Switch Reaction: advanced global-analysis and target-analysis techniques, an explicit
An Explicit Reaction reaction mechanism was proposed for the light-induced hydrogen-
Model bond switch in BLUF domains, indicated in Fig. 11 [45, 51, 61].
We believe that the model most accurately explains the t ime-resolved
and other experimental data, but we note that alternative reaction
models have been discussed in the literature [52, 53, 77].
In the dark state, the mutual orientation of Gln and FAD is
arranged as indicated in Fig. 11 (black), with hydrogen bonds
from the amino group of Gln50 to Tyr8 and the N(5) atom of
FAD. Blue-light excitation induces electron transfer from Tyr8 to
FAD, causing formation of the FAD anionic semiquinone FAD•−
and Tyr•+, as indicated in Fig. 11 (magenta). This event breaks the
Photoactivation Mechanisms of Flavin-Binding Photoreceptors Revealed… 423
R R
N N O N N O
NH NH
N N
O O
H H
H H
O O
H N H N
O O
FAD h
FAD
S
FAD
350 ps
R R
N N O FADH N N O
FADred
NH NH
N N
H
O O
H
H
O H O
N H
O H N O
R R
H 3C N N O H3C N N O
FAD NH C NH
H 3C N H3C N
e- O H
H+ O
Slr-Y8
O H H O H
O N O N
H H
Slr-Q50
Fig. 12 Light-induced concerted proton-coupled electron transfer (PCET) between flavin and tyrosine in the
light-adapted state of the Slr1694 BLUF domain, taking place with a time constant of 1 ps
3.6 Light-State BLUF The light-induced dynamics of the light-adapted state in BLUF
Photochemistry domains provides detailed information on the molecular nature of
the BLUF photoreaction (it is important to note here that the
light-adapted state corresponds to a molecular ground state).
A first study was carried out by Toh et al., who investigated the
ultrafast transient absorbance changes in the visible wavelength
region on the AppA BLUF domain in the light-adapted state [69].
The photoinduced absorbance changes showed a very fast forma-
tion of a neutral flavin semiquinone radical (FADH•) from FAD*
with a time constant 7 ps, which decayed in 60 ps back to the light-
adapted state, thus indicating that the BLUF domains cannot be
reversed to the dark-adapted state by light, nor does it form any
side product [69].
The light-state photochemistry was studied in further detail on
the Slr1694 BLUF domain by visible and IR absorption spectros-
copy [46]. Because the dark recovery of Slr1694 is fast at ~6 s, the
study was performed on the W91F mutant, which shows the same
primary photochemistry but is significantly slowed down in its
dark recovery (~200 s), which enables light-adapted state accumu-
lation through background illumination [60]. Upon excitation of
the light-adapted state, formation of FADH• occurred very fast
within 1 ps (see Fig. 12), without the involvement of an FAD•−
intermediate. Hence, in the light-adapted state, proton-coupled
Photoactivation Mechanisms of Flavin-Binding Photoreceptors Revealed… 425
3.7 The Role of It was established by a number of groups that the conserved Tyr
Particular Amino Acid and Gln that constitute the hydrogen-bonding partners with flavin
Side Chains in BLUF at the N(5) and C(4)═O positions are essential for signaling-state
Photoactivation formation [80–82]. In addition, several amino acid side chains of
the flavin-binding pocket have been identified to significantly
influence the nature of the BLUF photochemistry and the amount
of photoproduct formation without abolishing the photocycle. The
quantum yield of the photoproduct formation in BLUF domains
has been determined to be between 20 and 40 % [51, 58, 83–86].
In the AppA BLUF domain, the semi-conserved Trp104 is located
in close vicinity to the flavin’s C(4)═O group (Fig. 13) [36]. If the
conserved tyrosine (Tyr21) is replaced by non-aromatic side chains,
the primary electron-transfer process that initiates the BLUF pho-
tocycle is inhibited, and instead a FADH•-Trp• radical pair is
426 Tilo Mathes et al.
a 20
b Y21I
blue
light
10
Absorbance [10-3]
µs
2.0 ns
0
FAD*
FAD (hot) FADT 5 ns
FAD
-10 15 ps
FAD 69 ps
3.5 ns
FAD W
-20 FAD
T
FAD•- FADH• Trp•
450 500 550 600 650 700
290 ps
wavelength [nm]
c d AppA
blue
light
FADT ISC
Y21 FAD*
W104
FADH • Trp •
e-, H+
transfer
Q63
AppAred FADH•Tyr•
Fig. 13 (a) Species-associated difference spectra (SADS) of various molecular species that were estimated
from the application of a target analysis to the transient absorption data on the Y21I AppA mutant. The flavin–
tryptophan radical pair is indicated by the prominent absorbance of the tryptophan radical at around 510 nm;
(b) Simplified kinetic reaction scheme for the data obtained with the Y21I AppA mutant; (c) Crystal structure of
the AppA BLUF domain [36] with FAD, Tyr21 and Trp104 highlighted; (d) Photoactivation scheme of the AppA
BLUF domains, with a productive reaction pathway through electron/proton transfer from Tyr21 to FAD that
results in the signaling state AppARED, and a nonproductive pathway via electron/proton transfer from Trp104
to FAD that leads to radical-pair recombination to the original ground state on an ultrafast timescale. Intersystem
crossing from FAD* to the FAD triplet state is included
FAD* lifetime increases and the quantum yield of the signaling state is
accordingly increased from about 24 % to about 38 % (Fig. 13) [68].
In the Y21F/W104F double mutant, all light-driven electron-transfer
processes are abolished, and FAD* evolves by intersystem crossing
(ISC) to the triplet state. Thus, two competing light-driven electron-
transfer pathways are available in BLUF domains, as summarized in
Fig. 13d: one productive pathway that involves electron transfer from
the tyrosine and leads to signaling-state formation, and one nonpro-
ductive electron-transfer pathway from the tryptophan, which leads
to deactivation and the effective lowering of the signaling-state quan-
tum yield. These results were consistent with a conformation of the
AppA BLUF domain with Trp104 located in close vicinity to FAD
(the “Trp-in” conformation), as observed in the X-ray structure by
Anderson et al. [36] and the NMR structure of Grinstead et al. [54,
66], as opposed to the “Trp-out” conformation observed in a num-
ber of other BLUF domain X-ray structures [47–49]. In further
support, Trp fluorescence experiments on the W64F mutant of AppA
(which binds Trp104 as its only tryptophan) clearly indicated a bur-
ied conformation for Trp104 [69]. The corresponding W91F muta-
tion in Slr1694, however, does not influence the signaling- state
quantum yield [60]. This may either be due to the in general faster
electron transfer from the tyrosine to the flavin or the larger flavin–
tryptophan distance in Slr1694, which leaves little time for a compet-
ing electron transfer reaction.
In a recent study, modulation of the redox potential of the
flavin–tyrosine redox pair by site-directed mutagenesis close to the
flavin’s C(2) carbonyl and fluorination of the tyrosine, respectively,
was shown to significantly affect the photoinduced PCET rate
[87]. Because of the altered electron-transfer reaction rates an
excited-state charge-transfer intermediate was revealed, presumably
between Tyr and FAD, prior to full Tyr-FAD electron transfer in
the BLUF photocycle. It was additionally shown that the electron-
transfer rate directly correlates with the quantum yield of signaling-
state formation.
a b
Absorbance/fluorescence
300 350 400 450 500 550 600 650
wavelength (nm)
Fig. 14 (a) X-Ray structure of the AsLOV2 domain; (b) Absorption spectrum of the dark state D447 of AsLOV2
LOV2 (black line) and of its photoactivated S390 adduct state (red line). The blue line indicates the fluores-
cence spectrum
4.1 Time-Resolved The LOV domain has been studied quite extensively with time-
Emission resolved spectroscopic methods. Figure 15 shows a time-resolved
Spectroscopy of LOV emission experiment on AsLOV2 with a synchro-scan streak cam-
Domains era upon excitation at 400 nm [111]. Panel a shows a kinetic trace
taken at 524 nm along with the result of a global fit; panel b shows
the resulting DAS. The analysis revealed a single exponential
fluorescence lifetime of 2.2 ns and a DAS with peaks at 495 and
525 nm, at spectral positions similar to those observed in the
BLUF domain. In contrast to the observation in BLUF domains,
where a strong multiexponential decay of the FAD singlet excited
state was observed with lifetimes down to the picosecond timescale,
LOV domains show a relatively long-lived, homogeneous decay in
the nanosecond time range. Interestingly, a very weak long-lived
component with emission intensity from 600 to 650 nm was
observed (dashed line, expanded 50,000 times), following from
430 Tilo Mathes et al.
a 12285 b
1
524 nm
DAS
0
0
-500 0 500 1000 1500 450 500 550 600 650
Time [ps] Wavelength [nm]
Fig. 15 (a) Decay Associated Spectra (DAS) of AsLOV2 that result from a synchro-scan streak camera experi-
ment. The solid line denotes the 2.2 ns DAS, the dashed line the 2 μs DAS. The dashed phosphorescence DAS
has been multiplied by 5 × 104; (b) Kinetic traces of AsLOV2 emission (solid ) and fit (dashed ) at 524 nm
a 10
b 1495
1475 1375
1657
1520 1491
1415
1438
DA (mOD)
0 1390
DA (a.u.)
1620 1570
1637
1714
1395 1348 1320
1582 R
-10 9 1
2 ps H3C 9a N
10
10a N O
8 2
1694
2.2 ns I II III
4 NH
nondecaying H3C 7
6
5a N 4a 3
1678 1550 5
O
450 500 550 600 650 700 1700 1600 1500 1400 1300
wavelength (nm)
frequency (cm)-1
Fig. 16 (a) Evolution-associated difference spectra (EADS) that follow from a global analysis of ultrafast UV–Vis
transient absorption experiments on AsLOV2. The excitation wavelength was 400 nm, with associated lifetimes
indicated in the legend; (b) EADS that follow from a global analysis of ultrafast mid-infrared transient absorp-
tion experiments on AsLOV2 domain in H2O. The excitation wavelength was 475 nm. The first EADS (black)
evolves in 1.5 ns to the second EADS (red line), which does not decay on the time scale of the experiment
4.3 Microsecond Upon formation of the FMN triplet state on the nanosecond
Dynamics of LOV timescale, covalent adduct formation proceeds without apparent
Domains and the intermediates on the microsecond timescale [40, 114, 126, 127].
Mechanism of Contrary to the consensus that exists on the spectroscopically dis-
Covalent Adduct tinguishable intermediates in the LOV photocycle, the mechanism
Formation by which covalent adduct formation proceeds has been a subject of
considerable debate. Broadly speaking, two reaction mechanisms
have been put forward: (i) an ionic mechanism and (ii) a radical-
pair mechanism. According to the ionic model [40], the sharply
increased basicity of N(5) in the FMN triplet state triggers its pro-
tonation. This event would change the double bond of N(5)═C(4a)
to a single bond, leaving a very reactive carbo-cation at the C(4a)
position. This carbon has sp3 hybridization, which would decrease
the distance to the cysteine. Subsequently, a nucleophilic attack
by the cysteine thiolate on the C(4a) carbo-cation would occur,
leading to formation of the covalent FMN-C(4a)–thiol adduct.
Alternatively, a radical-pair mechanism for covalent adduct formation
was put forward [128, 129]. Upon promotion of the FMN
chromophore to the triplet state, a hydrogen atom would be trans-
ferred from the conserved cysteine to the N(5) of the flavin, result-
ing in an FMNH•⋯H2C-S• radical pair (Fig. 18c). Such a radical
pair would be formed in a triplet configuration; however, the close
proximity of the heavy sulfur radical to the isoalloxazine ring causes
a strong spin-orbit coupling, inducing a rapid triplet-to-singlet
interconversion. Once the radical pair obtains an appreciable sin-
glet character, radical-pair recombination between the H2C-S• and
the unpaired electron at C(4a) may take place, so as to result in the
FMN-C(4a)–thiol adduct (Fig. 18c).
The triplet spectrum on the nanosecond timescale that resulted
from ultrafast UV–Vis experiments was interpreted to consist of
partially protonated FMN triplet states, which seemed to support
the ionic mechanism [113]. However, the ultrafast mid-IR experi-
ments shown in Fig. 16b firmly demonstrated that no protonation
of the FMN triplet state takes place on the nanosecond timescale:
the IR signature was practically identical to that observed in
a flavin model compound dissolved in aprotic solvent [74].
Furthermore, quantum-chemical calculations indicated that the
experimentally observed triplet IR signature agreed well with an
unprotonated flavin triplet, and not at all with a triplet cation [78].
Time-resolved step-scan FTIR experiments on the microsecond
timescale yielded a FMN triplet signature similar to those shown in
Fig. 16b, indicating that no protonation occurs on that timescale
either [130]. Importantly, ab initio quantum-chemical calculations
434 Tilo Mathes et al.
a 500 fs b
9 ps
100 ps blue Blue/near-UV
nondecaying light light
20
∆A x 103
D447- S390
R 1 µs H3C
R
H3C N N O
N N C
N NH
NH H3C
H3C N H
O S O
0
N
SH 100 ps N
O
O
450 500 550 600 650
wavelength (nm)
Fig. 17 (a) Evolution-Associated Difference Spectra (EADS) and their associated lifetimes that follow from a
global analysis of time-resolved experiments on the photo-accumulated S390 state of Adiantum LOV2, with
excitation at 400 nm. The first EADS was scaled down by a factor of 2. The orange line denotes the D447-
minus-S390 difference spectrum; (b) key features of the light-driven reactions in LOV2 highlighting its photo-
chromic behavior
4.4 Photoreversi The lifetime of the covalent adduct in various LOV domains ranges
bility of LOV Domains: from minutes to hours [134, 135], which implies that under physi-
Covalent Adduct ological illumination there is a significant probability for absorp-
Rupture by Near-UV tion of a second, near-UV photon. The resulting photochemistry
Light in the LOV domain may have important consequences for its
signaling function. Indeed, it was shown that near-UV light is
capable of breaking the covalent cysteinyl-FMN adduct, as shown
by femtosecond transient absorption spectroscopy on the photo-
accumulated adduct state on the Adiantum phy3 LOV2 domain
[135], shown in Fig. 17.
Upon 400-nm excitation, four lifetimes were required to
describe the dynamics, with time constants of 500 fs, 9 ps, 100 ps,
and a nondecaying component. The nondecaying EADS (which
corresponds to the long-lived photoproduct that is formed upon
photolysis of the adduct state) agrees well with the dark-minus-light
(D447-S390) difference spectrum of LOV2, demonstrating that
within 100 ps, the dark ground state D447 is regenerated from the
photo-excited adduct state S390. The 500-fs component was
assigned to very rapid excited-state decay of the photoexcited
adduct state. The 9-ps and 100-ps EADS resembled those associated
with a charge-transfer complex between an oxidized flavin and a cys-
teine thiolate anion [137]. A reaction mechanism was proposed, in
Photoactivation Mechanisms of Flavin-Binding Photoreceptors Revealed… 435
a c R
H 3C N N O
NH
H 3C N
SH O
1 *
R
blue light H 3C N N O
AsLOV2
D447
Jα H 3C N
NH
1
FMN* SH O
dark
ISC
3
base ~ 2 ns *
R
catalyzed
b C-S 3
FMN* H3C N N O
cleavage near UV
NH
H 3C N
~s ~ 2 µs
SH O
FMNH· /Cys-S·
R
AsLOV2 H 3C N N O
D390
R C NH
H 3C N
H 3C N N O H
O
light NH
S
H 3C N
H
S O
Fig. 18 AsLOV2 structures with the FMN—conserved cysteine interaction highlighted in (a) the dark state and
(b) the light state; (c) Photocycle scheme of the AsLOV2 domain with associated time constants and transient
molecular structures
Acknowledgments
References
1. Briggs WR (2007) The LOV domain: a chro- 5. Losi A, Gärtner W (2008) Bacterial bilin- and
mophore module servicing multiple photore- flavin-binding photoreceptors. Photochem
ceptors. J Biomed Sci 14:499–504 Photobiol Sci 7:1168–1178
2. Christie JM, Briggs WR (2005) Blue-light 6. Herrou J, Crosson S (2011) Function, struc-
sensing and signaling by the phototropins. In: ture and mechanism of bacterial photo
Briggs WR, Spudich JL (eds) Handbook of sensory LOV proteins. Nat Rev Microbiol
photosensory receptors. Wiley-VCH, Weinheim, 9:713–723
pp 277–304 7. Hegemann P (2008) Algal sensory photore-
3. Iseki M, Matsunaga S, Murakami A, Ohno K, ceptors. Annu Rev Plant Biol 59:167–189
Shiga K, Yoshida K, Sugai M, Takahashi T, Hori 8. Ulijasz AT, Vierstra RD (2011) Phytochrome
T, Watanabe M (2002) A blue-light-activated structure and photochemistry: recent advances
adenylyl cyclase mediates photoavoidance in toward a complete molecular picture. Curr
Euglena gracilis. Nature 415:1047–1051 Opin Plant Biol 14:498–506
4. Gomelsky M, Klug G (2002) BLUF: a novel 9. van der Horst MA, Hellingwerf KJ (2004)
FAD-binding domain involved in sensory trans- Photoreceptor proteins, “star actors of mod-
duction in microorganisms. Trends Biochem ern times”: a review of the functional dynam-
Sci 27:497–500 ics in the structure of representative members
Photoactivation Mechanisms of Flavin-Binding Photoreceptors Revealed… 437
of six different photoreceptor families. Acc resolved spectra. Biochim Biophys Acta 1657:
Chem Res 37:13–20 82–104
10. Lee IR, Lee W, Zewail AH (2006) Primary 23. Holzwarth AR (1996) Data analysis of time-
steps of the photoactive yellow protein: iso- resolved measurements. In: Amesz J, Hoff AJ
lated chromophore dynamics and protein (eds) Biophysical techniques in photosynthe-
directed function. Proc Natl Acad Sci U S A sis. Kluwer, Dordrecht, The Netherlands,
103:258–262 pp 75–92
11. Schroeder-Lang S, Schwaerzel M, Seifert R, 24. van Stokkum IHM, van Oort B, van Mourik
Struenker T, Kateriya S, Looser J, Watanabe F, Gobets B, van Amerongen H (2008)
M, Kaupp UB, Hegemann P, Nagel G (2007) (Sub)-picosecond spectral evolution of fluo-
Fast manipulation of cellular cAMP level by rescence studied with a synchroscan streak-
light in vivo. Nat Methods 4:39–42 camera system and target analysis. In: Aartsma
12. Strickland D, Moffat K, Sosnick TR (2008) TJ, Matysik J (eds) Biophysical techniques in
Light-activated DNA binding in a designed photosynthesis, vol II. Springer, Dordrecht,
allosteric protein. Proc Natl Acad Sci U S A The Netherlands, pp 223–240
105:10709–10714 25. van Stokkum IHM (2005) Global and target
13. Wu YI, Frey D, Lungu OI, Jaehrig A, analysis of time-resolved spectra. In: Lecture
Schlichting I, Kuhlman B, Hahn KM (2009) notes for the Troisième Cycle de la Physique
A genetically encoded photoactivatable Rac en Suisse Romande, Department of Physics
controls the motility of living cells. Nature and Astronomy, Faculty of Sciences, Vrije
461:104–108 Universiteit, Amsterdam, The Netherlands
14. Stierl M, Stumpf P, Udwari D, Gueta R, 26. van Stokkum IHM, Bal HE (2006) A prob-
Hagedorn R, Losi A, Gärtner W, Petereit L, lem solving environment for interactive mod-
Efetova M, Schwarzel M, Oertner TG, Nagel G, elling of multiway data. Concurrency Comput
Hegemann P (2011) Light modulation of cel- Pract Ex 18:263–269
lular cAMP by a small bacterial photoactivated 27. Nagle JF, Parodi LA, Lozier RH (1982)
adenylyl cyclase, bPAC, of the soil bacterium Procedure for testing kinetic-models of the
Beggiatoa. J Biol Chem 286:1181–1188 photocycle of bacteriorhodopsin. Biophys J 38:
15. Ryu MH, Moskvin OV, Siltberg-Liberles J, 161–174
Gomelsky M (2010) Natural and engineered 28. Mullen KM, van Stokkum IHM (2007) TIMP:
photoactivated nucleotidyl cyclases for opto- an R package for modeling multi-way spectro-
genetic applications. J Biol Chem 285: scopic measurements. J Stat Softw 18: 1–46
41501–41508 29. R Development Core Team (2010) R: a lan-
16. Strickland D, Lin Y, Wagner E, Hope CM, guage and environment for statistical comput-
Zayner J, Antoniou C, Sosnick TR, Weiss EL, ing. R Foundation for Statistical Computing,
Glotzer M (2012) TULIPs: tunable, light- Vienna, Austria
controlled interacting protein tags for cell 30. Snellenburg JJ, Laptenok SP, Seger R, Mullen
biology. Nat Methods 9:379–384 KM, van Stokkum IHM (2012) Glotaran: a
17. Berera R, van Grondelle R, Kennis JTM Java-based graphical user interface for the
(2009) Ultrafast transient absorption spectros- R-package TIMP. J Stat Softw 49:1–22
copy: principles and application to photosyn- 31. Laan W, Bednarz T, Heberle J, Hellingwerf
thetic systems. Photosynth Res 101:105–118 KJ (2004) Chromophore composition of a
18. Andel F, Hasson KC, Gai F, Anfinrud PA, heterologously expressed BLUF-domain.
Mathies RA (1997) Femtosecond time-resolved Photochem Photobiol Sci 3:1011–1016
spectroscopy of the primary photochemistry of 32. Gomelsky M, Hoff WD (2011) Light helps
phytochrome. Biospectroscopy 3:421–433 bacteria make important lifestyle decisions.
19. Miura R (2001) Versatility and specificity in Trends Microbiol 19:441–448
flavoenzymes: control mechanisms of flavin 33. Masuda S, Bauer CE (2002) AppA is a blue
reactivity. Chem Rec 1:183–194 light photoreceptor that antirepresses photo-
20. Lacowicz J (2006) Principles of fluorescence synthesis gene expression in Rhodobacter
spectroscopy, 3rd edn. Springer, New York sphaeroides. Cell 110:613–623
21. Groot ML, van Wilderen LJGW, Di Donato M 34. Masuda S, Hasegawa K, Ohta H, Ono TA
(2007) Time-resolved methods in biophysics. (2008) Crucial role in light signal transduc-
5. Femtosecond time-resolved and dispersed tion for the conserved Met93 of the BLUF
infrared spectroscopy on proteins. Photochem protein PixD/Slr1694. Plant Cell Physiol
Photobiol Sci 6:501–507 49:1600–1606
22. van Stokkum IHM, Larsen DS, van Grondelle 35. Fiedler B, Börner T, Wilde A (2005)
R (2004) Global and target analysis of time- Phototaxis in the cyanobacterium Synechocystis
438 Tilo Mathes et al.
sp. PCC 6803: role of different photorecep- the AppA BLUF domain photoreceptor pro-
tors. Photochem Photobiol 81:1481–1488 vide insights into blue light-mediated signal
36. Anderson S, Dragnea V, Masuda S, Ybe J, transduction. J Mol Biol 362:717–732
Moffat K, Bauer C (2005) Structure of a 48. Jung A, Domratcheva T, Tarutina M, Wu Q,
novel photoreceptor, the BLUF domain of Ko W-H, Shoeman RL, Gomelsky M, Gardner
AppA from Rhodobacter sphaeroides. Bio KH, Schlichting I (2005) Structure of a bac-
chemistry 44:7998–8005 terial BLUF photoreceptor: insights into blue
37. Yuan H, Anderson S, Masuda S, Dragnea V, light-mediated signal transduction. Proc Natl
Moffat K, Bauer C (2006) Crystal structures Acad Sci U S A 102: 12350–12355
of the Synechocystis photoreceptor Slr1694 49. Kita A, Okajima K, Morimoto Y, Ikeuchi M,
reveal distinct structural states related to sig- Miki K (2005) Structure of a cyanobacterial
naling. Biochemistry 45:12687–12694 BLUF protein, Tll0078, containing a novel
38. Neiss C, Saalfrank P (2003) Ab initio quan- FAD-binding blue light sensor domain. J Mol
tum chemical investigation of the first steps of Biol 349:1–9
the photocycle of phototropin: a model study. 50. Stelling AL, Ronayne KL, Nappa J, Tonge PJ,
Photochem Photobiol 77:101–109 Meech SR (2007) Ultrafast structural dynam-
39. Neiss C, Saalfrank P, Parac M, Grimme S ics in BLUF domains: transient infrared spec-
(2003) Quantum chemical calculation of troscopy of AppA and its mutants. J Am
excited states of flavin-related molecules. J Phys Chem Soc 129:15556–15564
Chem A 107:140–147 51. Gauden M, van Stokkum IHM, Key JM,
40. Swartz TE, Corchnoy SB, Christie JM, Lewis Lührs DC, van Grondelle R, Hegemann P,
JW, Szundi I, Briggs WR, Bogomolni RA Kennis JTM (2006) Hydrogen-bond switch-
(2001) The photocycle of a flavin-binding ing through a radical pair mechanism in a
domain of the blue light photoreceptor pho- flavin-binding photoreceptor. Proc Natl Acad
totropin. J Biol Chem 276:36493–36500 Sci U S A 103:10895–10900
41. Salomon M, Christie JM, Knieb E, Lempert 52. Sadeghian K, Bocola M, Schütz M (2008) A
U, Briggs WR (2000) Photochemical and conclusive mechanism of the photoinduced reac-
mutational analysis of the FMN-binding tion cascade in blue light using flavin
domains of the plant blue light receptor, pho- photoreceptors. J Am Chem Soc 130:
totropin. Biochemistry 39:9401–9410 12501–12513
42. Holzer W, Penzkofer A, Fuhrmann M, 53. Domratcheva T, Grigorenko BL, Schlichting
Hegemann P (2002) Spectroscopic character- I, Nemukhin AV (2008) Molecular models
ization of flavin mononucleotide bound to the predict light-induced glutamine tautomeriza-
LOV1 domain of Phot1 from Chlamydomonas tion in BLUF photoreceptors. Biophys J 94:
reinhardtii. Photochem Photobiol 75:479–487 3872–3879
43. Losi A, Polverini E, Quest B, Gärtner W 54. Grinstead JS, Avila-Perez M, Hellingwerf KJ,
(2002) First evidence for phototropin-related Boelens R, Kaptein R (2006) Light-induced
blue-light receptors in prokaryotes. Biophys J flipping of a conserved glutamine sidechain
82:2627–2634 and its orientation in the AppA BLUF
44. Hasegawa K, Masuda S, Ono T-A (2004) domain. J Am Chem Soc 128: 15066–15067
Structural intermediate in the photocycle of a 55. Unno M, Masuda S, Ono T-A, Yamauchi S
BLUF (sensor of blue light using FAD) protein (2006) Orientation of a key glutamine residue
Slr1694 in a cyanobacterium Synechocystis sp. in the BLUF domain from AppA revealed by
PCC6803. Biochemistry 43:14979–14986 mutagenesis, spectroscopy, and quantum
45. Bonetti C, Mathes T, van Stokkum IHM, chemical calculations. J Am Chem Soc 128:
Mullen KM, Groot M-L, van Grondelle R, 5638–5639
Hegemann P, Kennis JTM (2008) Hydrogen 56. Ishikita H (2008) Light-induced hydrogen
bond switching among flavin and amino acid bonding pattern and driving force of electron
side chains in the BLUF photoreceptor transfer in AppA BLUF domain photorecep-
observed by ultrafast infrared spectroscopy. tor. J Biol Chem 283:30618–30623
Biophys J 95:4790–4802 57. Hsiao YW, Gotze JP, Thiel W (2012) The
46. Mathes T, Zhu J, van Stokkum IHM, Groot central role of Gln63 for the hydrogen bond-
ML, Hegemann P, Kennis JTM (2012) ing network and UV-visible spectrum of the
Hydrogen bond switching among flavin AppA BLUF domain. J Phys Chem B 116:
and amino acids determines the nature of 8064–8073
proton-coupled electron transfer in BLUF 58. Gauden M, Yeremenko S, Laan W, van
photoreceptors. J Phys Chem Lett 3:203–208 Stokkum IHM, Ihalainen JA, van Grondelle
47. Jung A, Reinstein J, Domratcheva T, Shoeman R, Hellingwerf KJ, Kennis JTM (2005)
RL, Schlichting I (2006) Crystal structures of Photocycle of the flavin-binding photorecep-
Photoactivation Mechanisms of Flavin-Binding Photoreceptors Revealed… 439
tor AppA, a bacterial transcriptional antire- Grondelle R, Hellingwerf KJ, Kennis JTM
pressor of photosynthesis genes. Biochemistry (2008) On the signaling mechanism and the
44:3653–3662 absence of photoreversibility in the AppA
59. Mathes T, van Stokkum IHM, Bonetti C, BLUF domain. Biophys J 95:312–321
Hegemann P, Kennis JTM (2011) The 70. Dragnea V, Waegele M, Balascuta S, Bauer C,
hydrogen- bond switch reaction of the Blrb Dragnea B (2005) Time-resolved spectro-
BLUF domain of Rhodobacter sphaeroides. scopic studies of the AppA blue-light receptor
J Phys Chem B 115:7963–7971 BLUF domain from Rhodobacter sphaeroides.
60. Bonetti C, Stierl M, Mathes T, van Stokkum Biochemistry 44:15978–15985
IHM, Mullen KM, Cohen-Stuart TA, van 71. Wolf MMN, Schumann C, Gross R,
Grondelle R, Hegemann P, Kennis JTM Domratcheva T, Diller R (2008) Ultrafast
(2009) The role of key amino acids in the infrared spectroscopy of riboflavin: dynamics,
photoactivation pathway of the Synechocystis electronic structure, and vibrational mode
Slr1694 BLUF domain. Biochemistry 48: analysis. J Phys Chem B 112:13424–13432
11458–11469 72. Laan W, Gauden M, Yeremenko S, van
61. Kennis JTM, Groot M-L (2007) Ultrafast Grondelle R, Kennis JTM, Hellingwerf KJ
spectroscopy of biological photoreceptors. (2006) On the mechanism of activation of the
Curr Opin Struct Biol 17:623–630 BLUF domain of AppA. Biochemistry 45:
62. Tanaka K, Nakasone Y, Okajima K, Ikeuchi 51–60
M, Tokutomi S, Terazima M (2011) Light- 73. Alexandre MTA, Domratcheva T, Bonetti C,
induced conformational change and transient van Wilderen LJGW, van Grondelle R, Groot
dissociation reaction of the BLUF photore- M-L, Hellingwerf KJ, Kennis JTM (2009)
ceptor Synechocystis PixD (Slr1694). J Mol Primary reactions of the LOV2 domain of
Biol 409:773–785 phototropin studied with ultrafast mid-infrared
63. Tanaka K, Nakasone Y, Okajima K, Ikeuchi spectroscopy and quantum chemistry. Biophys
M, Tokutomi S, Terazima M (2009) J 97:227–237
Oligomeric-state-dependent conformational 74. Martin CB, Tsao ML, Hadad CM, Platz MS
change of the BLUF protein TePixD (2002) The reaction of triplet flavin with
(Tll0078). J Mol Biol 386:1290–1300 indole. A study of the cascade of reactive
64. Majerus T, Kottke T, Laan W, Hellingwerf K, intermediates using density functional theory
Heberle J (2007) Time-resolved FT-IR spec- and time resolved infrared spectroscopy. J Am
troscopy traces signal relay within the blue- Chem Soc 124:7226–7234
light receptor AppA. ChemPhysChem 8: 75. Barth A (2000) The infrared absorption of
1787–1789 amino acid side chains. Prog Biophys Mol
65. van Stokkum IH, Gobets B, Gensch T, Biol 74:141–173
Mourik F, Hellingwerf KJ, Grondelle R, 76. Wolpert M, Hellwig P (2006) Infrared spec-
Kennis JT (2006) (Sub)-picosecond spectral tra and molar absorption coefficients of the 20
evolution of fluorescence in photoactive pro- alpha amino acids in aqueous solutions in the
teins studied with a synchroscan streak camera spectral range from 1800 to 500 cm−1.
system. Photochem Photobiol 82:380–388 Spectrochim Acta A Mol Biomol Spectrosc
66. Grinstead JS, Hsu ST, Laan W, Bonvin AM, 64:987–1001
Hellingwerf KJ, Boelens R, Kaptein R (2006) 77. Udvarhelyi A, Domratcheva T (2011)
The solution structure of the AppA BLUF Photoreaction in BLUF receptors: proton-
domain: insight into the mechanism of light- coupled electron transfer in the flavin-Gln-Tyr
induced signaling. ChemBioChem 7:187–193 system. Photochem Photobiol 87:554–563
67. van den Berg PAW, Feenstra KA, Mark AE, 78. Müller F, Hemmerich P, Ehrenberg A, Palmer
Berendsen HJC, Visser AJWG (2002) G, Massey V (1970) Chemical and electronic
Dynamic conformations of flavin adenine structure of neutral flavin radical as revealed
dinucleotide: simulated molecular dynamics by electron spin resonance spectroscopy of
of the flavin cofactor related to the time- chemically and isotopically substituted deriva-
resolved fluorescence characteristics. J Phys tives. Eur J Biochem 14:185–196
Chem B 106:8858–8869 79. Kandori H, Iwata T, Watanabe A, Iseki M,
68. Gauden M, Grinstead JS, Laan W, van Stokkum Watanabe M (2011) Strong donation of the
IHM, Avila-Pérez M, Toh KC, Boelens R, hydrogen bond of tyrosine during photoacti-
Kaptein R, van Grondelle R, Hellingwerf KJ, vation of the BLUF domain. J Phys Chem
Kennis JTM (2007) On the role of aromatic Lett 2:1015–1019
side chains in the photoactivation of BLUF 80. Kraft BJ, Masuda S, Kikuchi J, Dragnea V,
domains. Biochemistry 46:7405–7415 Tollin G, Zaleski JM, Bauer CE (2003)
69. Toh KC, van Stokkum IHM, Hendriks J, Spectroscopic and mutational analysis of the
Alexandre MTA, Arents JC, Perez MA, van blue-light photoreceptor AppA: a novel
440 Tilo Mathes et al.
126. Corchnoy SB, Swartz TE, Lewis JW, Szundi 136. Kennis JTM, van Stokkum IHM, Crosson S,
I, Briggs WR, Bogomolni RA (2003) Gauden M, Moffat K, van Grondelle R
Intramolecular proton transfers and structural (2004) The LOV2 domain of phototropin: a
changes during the photocycle of the LOV2 reversible photochromic switch. J Am Chem
domain of phototropin 1. J Biol Chem 278: Soc 126:4512–4513
724–731 137. Miller SM, Massey V, Ballou D, Williams CH,
127. Guo HM, Kottke T, Hegemann P, Dick B Distefano MD, Moore MJ, Walsh CT (1990)
(2005) The Phot LOV2 domain and its inter- Use of a site-directed triple mutant to trap
action with LOV1. Biophys J 89:402–412 intermediates. Demonstration that the flavin-
128. Kay CWM, Schleicher E, Kuppig A, Hofner C(4a)-thiol adduct and reduced flavin are
H, Rüdiger W, Schleicher M, Fischer M, kinetically competent intermediates in mercuric
Bacher A, Weber S, Richter G (2003) Blue ion reductase. Biochemistry 29:2831–2841
light perception in plants. Detection and 138. Kawaguchi Y, Nakasone Y, Zikihara K,
characterization of a light-induced neutral fla- Tokutomi S, Terazima M (2010) When is the
vin radical in a C450A mutant of phototro- helix conformation restored after the reverse
pin. J Biol Chem 278:10973–10982 reaction of phototropin? J Am Chem Soc
129. Schleicher E, Kowalczyk RM, Kay CWM, 132:8838–8839
Hegemann P, Bacher A, Fischer M, Bittl R, 139. Bouly JP, Schleicher E, Dionisio-Sese M,
Richter G, Weber S (2004) On the reaction Vandenbussche F, van der Straeten D, Bakrim
mechanism of adduct formation in LOV N, Meier S, Batschauer A, Galland P, Bittl R,
domains of the plant blue-light receptor pho- Ahmad M (2007) Cryptochrome blue light
totropin. J Am Chem Soc 126:11067–11076 photoreceptors are activated through inter-
130. Pfeifer A, Majerus T, Zikihara K, Matsuoka D, conversion of flavin redox states. J Biol Chem
Tokutomi S, Heberle J Kottke T (2009) Time- 282:9383–9391
Resolved Fourier Transform Infrared Study on 140. Yamamoto A, Iwata T, Sato Y, Matsuoka D,
Photoadduct Formation and Secondary Tokutomi S, Kandori H (2009) Light signal
Structural Changes within the Phototropin transduction pathway from flavin chromo-
LOV Domain Biophys. J 96:1462–1470 phore to the J alpha helix of Arabidopsis pho-
131. Dittrich M, Freddolino PL, Schulten K
totropin1. Biophys J 96:2771–2778
(2005) When light falls in LOV: a quantum 141.
Alexandre MTA, van Grondelle R,
mechanical/molecular mechanical study Hellingwerf KJ, Kennis JTM (2009)
of photo excitation in Phot-LOV1 of Conformational heterogeneity and propaga-
Chlamydomonas reinhardtii. J Phys Chem B tion of structural changes in the LOV2/Jα
109:13006–13013 domain from Avena sativa phototropin 1 as
132. Domratcheva T, Fedorov R, Schlichting I
recorded by temperature-dependent FTIR
(2006) Analysis of the primary photocycle spectroscopy. Biophys J 97:238–247
reactions occurring in the light, oxygen, and 142. Iwata T, Nozaki D, Tokutomi S, Kagawa T,
voltage blue-light receptor by multiconfigura- Wada M, Kandori H (2003) Light-induced
tional quantum-chemical methods. J Chem structural changes in the LOV2 domain of
Theory Comput 2:1565–1574 Adiantum phytochrome3 studied by low-
133. Zenichowski K, Gothe M, Saalfrank P (2007) temperature FTIR and UV-visible spectros-
Exciting flavins: absorption spectra and spin- copy. Biochemistry 42:8183–8191
orbit coupling in light-oxygen-voltage (LOV) 143. Nozaki D, Iwata T, Ishikawa T, Todo T,
domains. J Photochem Photobiol Chem Tokutomi S, Kandori H (2004) Role of
190:290–300 Gln1029 in the photoactivation processes
134. Kasahara M, Swartz TE, Olney MA, Onodera of the LOV2 domain in Adiantum phyto-
A, Mochizuki N, Fukuzawa H, Asamizu E, chrome3. Biochemistry 43:8373–8379
Tabata S, Kanegae H, Takano M, Christie JM, 144. Yamamoto A, Iwata T, Tokutomi S, Kandori
Nagatani A, Briggs WR (2002) Photochemical H (2008) Role of Phe1010 in light-induced
properties of the flavin mononucleotide- structural changes of the neol-LOV2
binding domains of the phototropins from domain of Adiantum. Biochemistry 47:
Arabidopsis, rice, and Chlamydomonas rein- 922–928
hardtii. Plant Physiol 129:762–773 145. Zayner JP, Antoniou C, Sosnick TR (2012)
135. Losi A (2004) The bacterial counterparts of The amino-rerminal helix modulates light-
plant phototropins. Photochem Photobiol Sci activated conformational changes in AsLOV2.
3:566–574 J Mol Biol 419:61–74
Chapter 17
Abstract
Flavins and flavoproteins have been studied by a plethora of spectroscopic techniques. Beginning with the
characterization of DNA photolyases and the discovery of the diversity of roles played by excited-state
flavins in photobiology, the characterization of the electronic excited state of flavins has become increas-
ingly important. In this protocol, we provide a guide to using Stark spectroscopy in obtaining the degree
of electronic charge redistribution in simple flavins and in flavoproteins. Stark spectroscopy is technically
simpler than more common approaches used to explore the structure of the excited state, considerably
cheaper to implement, and yet very powerful in its scope. At the end of this guide, we present data taken
on non-photobiological flavoproteins, glutathione reductase and lipoamide dehydrogenase, that suggest
that Stark spectroscopy is a unique way to elucidate the electrostatic environment that the flavin cofactor
experiences bound inside the protein.
1 Introduction
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5_17, © Springer Science+Business Media New York 2014
443
444 Raymond F. Pauszek and Robert J. Stanley
me (0) me (Feff)
Feff
mg (0) mg (Feff)
Fig. 1 The effect of an externally applied electric field F on the energy levels of
a dipolar molecule
Wavelength (nm)
550 500 450 400 350
15000
5000
S0 S1 S0 S2
0
500
d2ε(ν) / dν 2
-500
4
χ ≈ 54°
∆ε(ν) (M−1 cm−1)
2
χ = 90°
-2
Fig. 2 Comparison of the low-temperature absorption spectrum (top) and second derivative (middle) to the Stark
spectra at two angles of χ (bottom). The sample is 3 mM N(3)-methyltetraphenylacetylriboflavin in toluene
3 Sample Preparation
3.1 Cuvette Stark cuvettes are quite different from those used in normal absorp-
tion experiments (Fig. 4, inset). They are composed of a sandwich
of slides made of an optically transparent substrate which have
been coated with a transparent conductive coating. The slides
(ca. 2.5 × 2.5 × 0.7 cm) are arranged in a staggered fashion and
separated by Kapton spacers such that an area of conductive
448 Raymond F. Pauszek and Robert J. Stanley
3.1.1 Cuvette Substrates The type of substrate used to build the cuvette is selected based
upon the required wavelength range. For measurements made in
the visible region of the spectrum, simple float glass is suitable.
This material is generally the cheapest choice; however, it does not
transmit light below about 320 nm. Other types of glasses, such as
Corning 1737 or Eagle2000 boro-aluminosilicate glass, can extend
the accessible range further into the UV region and are comparable
in price.
For transitions in the UV region, fused silica or quartz slides
must be utilized. These substrates are considerably more expensive
but allow measurements down to about 200 nm. One must also
consider the transmission profile of the conductive coating used,
which is discussed in the next section.
For any substrate, thickness is an important consideration.
Thinner substrates have higher transmission, but are more suscep-
tible to breaking when clips are attached in order to supply the
electric field. We have successfully used slides as thin as 0.5 mm.
We have also found that thicker substrates are often difficult to cut
to the correct size.
3.1.2 Conductive Application of an electric field requires the interior of the cuvette
Coatings be coated with a conductive coating which is transparent through-
out the spectral region of interest. By far the most common coat-
ing is indium tin oxide (ITO). This coating is useful for
measurements in the visible region but absorbs strongly below
260 nm. The thicker the ITO coating the higher its conductivity.
We have had good success using a coating thickness of 150–300 Å,
which gives a conductivity of ~100 Ω/cm2. The higher the con-
ductivity the lower the resistance, and this plays a role in the maxi-
mum frequency response attainable for the external electric field.
However, thick ITO becomes less transmissive, and for all practical
purposes, becomes opaque below about 300 nm. Most ITO is
available on float glass or similar substrates, which compounds the
transmission issue. ITO-coated fused silica is available but very
expensive. Even so, ITO cuts off in the UV around 260 nm for any
useful coating thickness.
For measurements in the UV region, we and others have found
that Inconel coated neutral density filters provide the best compro-
mise between substrate and coating transmission. Standard
Inconel-coated fused silica neutral density filters (OD = 0.3, 2″ × 2″)
are commercially available (ESCO Products #S502000). While the
Inconel coating blocks approximately 50 % of incident light per
A “How-To” Guide to the Stark Spectroscopy of Flavins and Flavoproteins 449
100
80
Transmittance (%)
60
40
3.2.1 Organic Solvents Nonpolar, aprotic solvents provide some of the most non-
perturbing environments for condensed-phase spectroscopy.
Because of the low viscosity and high vapor pressure of most organic
450 Raymond F. Pauszek and Robert J. Stanley
3.2.2 Aqueous Solvents Many chromophores, for example biologically active flavins, flavo-
proteins, and DNA require aqueous solvents. Pure water forms an
opaque, highly fractured glass when flash-frozen in liquid nitro-
gen. An aqueous glassy matrix can be achieved using additives. The
most common solvents used for such experiments are 8 M LiCl or
a mixture of aqueous buffer and glycerol, or other polyalcohols,
depending on the sample to be studied [37].
8 M LiCl has long been used as a solvent for low-temperature
spectroscopy of various biological molecules such as double
stranded DNA [38–40]. This solvent is easy to work with, in that
it readily forms clear glasses relatively free of fractures and is able to
hold moderate electric fields [41–43]. Experiments carried out in
our laboratory have suggested that the high ionic strength of the
solution may have a disruptive effect on base stacking or other
unexpected structural effects on DNA which must be carefully
considered when analyzing biological macromolecules.
High-salt solutions are usually not suitable for use with pro-
teins, in which case the best choice is a 35:65 (v:v) mixture of
aqueous buffer and glycerol. This solvent forms a clear glass; how-
ever, it tends to fracture more than glasses made with LiCl solu-
tions. In addition, we have found that glycerol disrupts the base
stacking of DNA duplexes (data not shown), possibly to a larger
extend than LiCl solutions, and thus is not suitable for experiments
on these types of systems.
Both of these solvents are very viscous and necessitate a differ-
ent preparation of the cuvette. The bottom slide is placed with the
452 Raymond F. Pauszek and Robert J. Stanley
conductive coating face up, and the spacers are arranged appropriately.
A drop of sample (~30 μL for a 2.5 × 2.5 cm cuvette with 50 μm
spacers) is pipetted onto the center of the slide. The second slide,
coating face down, is then gently placed on top to complete the
cuvette. Unlike cuvettes prepared with samples in organic solvents,
these can be prepared in advance (upwards of an hour before freez-
ing) without formation of bubbles.
4 Instrumentation
4.1 Light Source The two lowest-lying transitions of oxidized flavins are between
and Monochromator 300 and 500 nm. A Xe arc lamp source is a natural choice for this
wavelength range. Our light source is a 300 W Xe arc lamp (Oriel
#69911) equipped with a light intensity controller (Oriel #68945)
which is used to minimize intensity fluctuations of the lamp
throughout the day. The beam is focused onto the entrance slit of
a 1/8 m monochromator (CV instruments CM110).
The Liptay analysis requires the spectrum to be a function of
wave number rather than wavelength. We have therefore chosen to
record spectra in steps of equal wave number rather than wave-
length. The grating and slit width is selected depending on the
system to be analyzed. The width of the narrowest spectral feature
must be taken into account. We have found that the widths of spec-
tral features measured at wave number steps lower than the resolu-
tion provided by the slit are identical to those measured at larger
step sizes; thus the line shape is limited by the nature of the transi-
tion, not the resolution of the monochromator. Therefore, larger
slits can be utilized, which provide more light and thus higher sig-
nal to noise, even at small step sizes. However, it is advisable to
check this spectral response for narrow bands in which the line
shape of the transition approaches the spectral resolution of the
monochromator slit. The higher energy transitions, and those of
reduced flavins are blue-shifted and require monochromators suit-
able for use in the ultraviolet region. The beam from the exit slit of
the monochromator is then collimated with a simple plano-convex
lens, passed through a depolarizer followed by a Glan-Taylor polar-
izer, and focused onto the frozen sample. Since the monochroma-
tor slit is much larger than the wavelength of light used for our
experiments, the polarization of the light is preserved.
4.3 Detectors Light passed through the sample is focused by a double convex
fused silica lens onto a photodiode in photocurrent mode. For
measurements made in the near-UV and visible regions, a Si pho-
todiode is used. Measurements below 300 nm are facilitated by the
use of a SiC photodiode, which has negligible response above
~400 nm (solar-blind response). A photomultiplier tube may be
substituted for the photodiode in order to provide a flatter response
along the measured spectral range but we have found PMTs to be
noisier for analog detection.
The photocurrent is then amplified by a current amplifier oper-
ating in either DC or low-pass mode (SRS SR570 or Keithley 162).
Care must be taken when setting the low-pass filters and sensitivity
of the amplifier such that the signal at the frequency of the applied
field is not filtered out. In general all filtering is done by the lock-in
detector.
The change in transmission at an externally applied electric
field of ca. 3 × 105 V/cm is ΔT/T(0) ~ 10−6, and thus special detec-
tion methods must be employed. A lock-in amplifier (SRS SR830)
is used to isolate the signal with respect to the frequency of the
applied electric field and is theoretically capable of measuring sig-
nal differences in the parts-per-billion range. The lock-in amplifier
is essentially a phase-sensitive detector that converts periodic sig-
nals which match a reference frequency to a proportional DC sig-
nal. Since ΔT/T(0) is so small, the intensity T(0) can be obtained
by digitizing using a 16-bit analog-to-digital converter by averag-
ing the photocurrent during the (lock-in) acquisition of ΔT. This
information is needed to calculate ΔT/T(0).
4.4 Signal Detection The external field is supplied by a high voltage (HV) amplifier with
by Lock-in voltage amplitude and frequency controlled by the sine wave refer-
Amplification ence from the lock-in amplifier. This HV amplifier is critical to
obtaining high S/N ratio, as discussed below. An essential require-
ment for the amplifier is its slew rate and current output as it must
be capable of supplying a large current in a short time period to
avoid frequency roll-off. We have used both a Rolfe HV amplifier
and a TREK 609E-6 amplifier. As will be shown below, the S/N
depends on reducing noise in the experiment by operating at as
high a frequency as possible.
From the Liptay analysis, the field-dependent change in extinc-
tion, Δε, is directly proportional to F 2 where F(t) ∝ F0sin(ωt + ϕ).
Using the identity sin2(ωt) = (1 − cos(2ωt))/2, Δε is recorded at the
second harmonic of the electric field frequency (2ω) [33]. The sign
and magnitude of the field effect on the transmittance is a sensitive
function of the phase shift, ϕ, between the reference frequency and
the applied field (there is often a phase shift due to the finite slew
rate of any HV amplifier). Correct measurement of the signal
requires that the phase offset between the applied field and the
measured signal be determined. This can be accomplished in a
A “How-To” Guide to the Stark Spectroscopy of Flavins and Flavoproteins 455
4.5 Low- The analysis of Stark spectra requires complementary high S/N
Temperature absorption spectra taken under the same conditions as that of the
Absorption Spectra Stark spectrum. The instrument is easily adapted to this need by
removing the polarizer and placing an optical chopper at an
456 Raymond F. Pauszek and Robert J. Stanley
Wavelength (nm)
550 500 450 400 350
2
1 500 Hz
0
-1
2
1 1000 Hz
0
∆ε(ν) (M−1 cm−1)
-1
2
1 2000 Hz
0
-1
2
3500 Hz
1
0
-1
Fig. 5 Stark spectra as a function of applied field frequency. The sample is 3 mM flavin mononucleotide in
water/glycerol (1:1, v:v)
5 Data Analysis
2 2 2
where χ is the angle formed between⇒the applied field F and the
polarization of incident light ê , Tr∆α is ⇒related
to the magnitude
of the difference polarizability and m ⋅ ∆ α ⋅ m is the projection
of
the difference polarizability onto the transition dipole moment m.
The third term is a second-derivative line shape caused by a
broadening of bands due to the isotropic orientation of permanent
dipoles with respect to the field. Cχ is related to the difference
dipole moment, and in most cases dominates the Stark spectrum.
The form is
2
{
C χ = ∆µ 5 + (3 cos 2 χ − 1 ) (3 cos 2
}
ζ A − 1) (5)
A “How-To” Guide to the Stark Spectroscopy of Flavins and Flavoproteins 459
where ∆µ is the difference dipole moment and ζA is the angle
between the transition dipole moment and the difference dipole
moment.
5.2 Calculation of The fitting procedure described above determines the best Aχ, Bχ,
Electronic Properties and Cχ coefficients of a given data set. The equations for the Bχ and
and Error Estimation Cχ coefficients, given in Eqs. 4 and 5, are nonlinear with respect to
the angle χ with two variables. Therefore, if spectra are taken for at
least two independent values of χ, the corresponding coefficients
⇒
can be used to calculate the values of Tr∆ α , ∆µ , and ζA.
A “How-To” Guide to the Stark Spectroscopy of Flavins and Flavoproteins 461
5.3 Assumptions The Liptay formalism is developed with multiple inherent assump-
and Limitations tions. The applied field is treated as a perturbation to the system and
thus, as in any perturbative treatment, the effect of the field must be
relatively small. This implies that fields of low to moderate strength
are used such that the external field does not alter the electronic
states of the molecule drastically. It is assumed that the applied field
perturbs the transition dipole moment and the position of the maxi-
mum absorption, but not the population or the line shape. For
example, mixing of electronic states by F to form a completely new
system would result in a breakdown of the Liptay formalism.
Secondly, absorption spectra of polyatomic molecules gener-
ally have vibronic structure and are inhomogeneously broadened.
It is not necessarily the case that all bands across a particular transi-
tion have the same electro-optic properties, in which case the above
fitting procedure will fail.
Third, the lack of a physical model to fit the absorption spec-
trum leads to uncertainty when trying to fit spectra with overlap-
ping electronic transitions. Since the difference electroabsorption
spectrum can be either positive or negative, overlapping features of
different electro-optic parameters can cancel each other out, lead-
ing to inaccurate determination of excited-state properties. This
problem can be remedied by using a physical model, such as vibronic
progressions, rather than free floating Gaussians to fit the data. This
approach is currently under investigation in our laboratory.
Another limitation on the accuracy of determined electronic
properties is the uncertainty in the magnitude of the field actually
felt by the molecule within the sample matrix, known as the local
field effect [19]. The dielectric and refractive index of the solvent
in which the solute molecule resides is not the same as that of the
bulk solvent and may not even be constant within this cavity [46].
Any dielectric cavity will attenuate the applied electric field, and
the shape of the cavity is important in the degree of attenuation.
There are various approximations to the local field correction (fc)
which can be used. One may also choose to report parameters
determined from analysis of Stark spectra as simply divided by fc.
There also exist physical limitations to measuring high-quality
Stark spectra. As mentioned before, working at low temperature
462 Raymond F. Pauszek and Robert J. Stanley
6 Future Directions
1.0 77K
298K
0.8
A (norm.)
0.6
0.4
0.2
0.006
χ ≈ 54°
0.004 χ = 90°
0.002
0.000
∆A
-0.002
-0.004
-0.006
-0.008
20000 22500 25000 27500 30000 20000 22500 25000 27500 30000
Wavenumber (cm−1) Wavenumber (cm−1)
Fig. 6 Comparison of splitting patterns of Stark features in two flavoproteins (~200 uM) in buffer:glycerol, 1:1
(v:v)
Acknowledgements
References
dimensional infrared Spectroscopy of proteins. molecules. II. Polyenes, polyynes and cumu-
Acc Chem Res 41:432–441 lenes. Chem Phys 120:439–448
17. Cheng YC, Fleming GR (2009) Dynamics of 31. Bublitz GU, Ortiz R, Marder SR, Boxer SG
light harvesting in photosynthesis. Annu Rev (1997) Stark spectroscopy of donor/acceptor
Phys Chem 60:241–262 substituted polyenes. J Am Chem Soc
18. Jonas DM (2003) Two-dimensional femtosec- 119:3365–3376
ond spectroscopy. Annu Rev Phys Chem 32. Locknar SA, Peteanu LA (1998) Investigation
54:425–463 of the relationship between dipolar properties
19. Boxer SG (2009) Stark realities. J Phys Chem and cis-trans configuration in retinal polyenes:
B 113:2972–2983 a comparative study using Stark spectroscopy
and semiempirical calculations. J Phys Chem B
20. Liptay W (1974) Dipole moments and polariz-
102:4240–4246
abilities of molecules in excited electronic
states. In: Lim EC (ed) Excited states. 33. Mathies R, Stryer L (1976) Retinal has a
Academic, New York, pp 129–229 highly dipolar vertically excited singlet state:
implications for vision. Proc Natl Acad Sci
21. Stanley RJ (2001) Advances in flavin and flavo- U S A 73:2169–2173
protein optical spectroscopy. Antioxid Redox
Signal 3:847–866 34. Karki L, Vance FW, Hupp JT, LeCours SM,
Therien MJ (1998) Electronic Stark effect
22. Stanley RJ, Jang H (1999) Electronic struc- studies of a porphyrin-based push-pull chro-
ture measurements of oxidized flavins and fla- mophore displaying a large first hyperpolariz-
vin complexes using Stark-effect spectroscopy. ability: state-specific contributions to beta.
J Phys Chem A 103:8976–8984 J Am Chem Soc 120:2606–2611
23. Stanley RJ, Siddiqui MS (2001) A Stark spec- 35. Eaton WA, Hofrichter J, Makinen MW,
troscopic study of N(3)-methyl, N(10)- Andersen RD, Ludwig ML (1975) Optical
isobutyl-7,8-dimethylisoalloxazine in nonpolar spectra and electronic structure of flavine
low-temperature glasses: experiment and com- mononucleotide in flavodoxin crystals.
parison with calculations. J Phys Chem A Biochemistry 14:2146–2151
105:11001–11008
36. Siddiqui MSU, Kodali G, Stanley RJ (2008)
24. MacFarlane AW IV, Stanley RJ (2001) The electronic transition dipole moment direc-
Evidence of powerful substrate electric fields in tions of reduced flavin in stretched poly(vinyl
DNA photolyase: implications for thymidine alcohol) films. J Phys Chem B 112:119–126
dimer repair. Biochemistry 40:15203–15214
37. Chowdhury A, Wachsmann-Hogiu S, Bangal
25. Hopkins N, Stanley RJ (2003) Measurement PR, Raheem I, Peteanu LA (2001)
of the electronic properties of the flavoprotein Characterization of chiral H and J aggregates
old yellow enzyme (OYE) and the OYE:p-Cl of cyanine dyes formed by DNA templating
phenol charge-transfer complex using Stark using Stark and fluorescence spectroscopies.
spectroscopy. Biochemistry 42:991–999 J Phys Chem B 105:12196–12201
26. Kodali G, Siddiqui SU, Stanley RJ (2009) 38. Barnes J, Bernhard WA (1993) The proton-
Charge redistribution in oxidized and semiqui- ation state of one-electron-reduced cytosine
none E. coli DNA photolyase upon photoexci- and adenine. 1. Initial protonation sites at low-
tation: Stark spectroscopy reveals a rationale temperatures in glassy solids. J Phys Chem
for the position of Trp382. J Am Chem Soc 97:3401–3408
131:4795–4807 39. Cai ZL, Sevilla MD (2004) Studies of excess
27. Hochstrasser RM (1973) Electric field effects electron and hole transfer in DNA at low tem-
on oriented molecules and molecular crystals. peratures. Topics in Current Chemistry, Long-
Acc Chem Res 6:263–269 range charge transfer in DNA II 237:103–127
28. Lao K, Moore LJ, Zhou H, Boxer SG (1995) 40. Eisinger J, Gueron M, Schulman RG, Yamane
Higher-order Stark spectroscopy: polarizabil- T (1966) Excimer fluorescence of dinucleo-
ity of photosynthetic pigments. J Phys Chem tides, polynucleotides, and DNA. Proc Natl
99:496–500 Acad Sci U S A 55:1015–1020
29. Bublitz GU, Boxer SG (1997) Stark spectros- 41. Kodali G, Kistler KA, Matsika S, Stanley RJ
copy: applications in chemistry, biology, and (2008) 2-Aminopurine excited state electronic
materials science. Annu Rev Phys Chem structure measured by Stark spectroscopy.
48:213–242 J Phys Chem B 112:1789–1795
30. Liptay W, Wortmann R, Boehm R, Detzer N 42. Kodali G, Kistler KA, Narayanan M, Matsika S,
(1988) Excited state dipole moments and Stanley RJ (2010) Change in electronic struc-
polarizabilities of centrosymmetric and dimeric ture upon optical excitation of 8-vinyladenosine:
466 Raymond F. Pauszek and Robert J. Stanley
an experimental and theoretical study. J Phys 51. Hopkins N, Williams CH Jr (1995) Lipoamide
Chem A 114:256–267 dehydrogenase from Escherichia coli lacking
43. Kodali G, Narayanan M, Stanley RJ (2012) The the redox active disulfide: C44S and C49S.
excited state electronic properties of 6-methyl- Redox properties of the FAD and interactions
isoxanthopterin (6-MI): an experimental and with pyridine nucleotides. Biochemistry 34:
theoretical study. J Phys Chem B 116:2981 11766–11776
44. Andrews SS, Boxer SG (2000) A liquid nitro- 52. Hopkins N, Williams CH Jr (1995)
gen immersion cryostat for optical measure- Characterization of lipoamide dehydrogenase
ments. Rev Sci Instrum 71:3567–3569 from Escherichia coli lacking the redox active
45. Press WH, Flannery BP, Teukolsky SA, disulfide: C44S and C49S. Biochemistry 34:
Vetterling WT (1988) Numerical recipes in C: 11757–11765
the art of scientific computing. Cambridge 53. Krauth-Siegel RL, Lohrer H, Hungerer KD,
University Press, New York Schoellhammer T (1991) Lipoamide dehydro-
46. Böttcher CJF (1952) Theory of electric polar- genase and trypanothione reductase from
ization. Elsevier, Houston Trypanosoma cruzi, the causative agent of
Chagas’ disease. In: Flavins Flavoproteins
47. Luchowski R, Krawczyk S (2003) Stark effect
Proc. Int. Symp., 10th, pp 843–846
spectroscopy of exciton states in the dimer of
acridine orange. Chem Phys 293:155–166 54. Williams CH Jr (1992) Lipoamide dehydroge-
48. Gibson QH, Massey V, Atherton NM (1962) nase, glutathione reductase, thioredoxin
The nature of compounds present in mixtures reductase, and mercuric ion reductase. A fam-
of oxidized and reduced flavin mononucleo- ily of flavoenzyme transhydrogenases. Chem
tides. Biochem J 85:369–383 Biochem Flavoenzymes 3:121–211
49. Silverman LN, Spry DB, Boxer SG, Fayer MD 55. Karplus PA, Schulz GE (1987) Refined structure
(2008) Charge transfer in photoacids observed of glutathione-reductase at 1.54 A resolution.
by Stark spectroscopy. J Phys Chem A J Mol Biol 195:701–729
112:10244–10249 56. Kodali G (2009) Excited state electronic prop-
50. Andrews SS, Boxer SG (2000) Vibrational erties of DNA photolyase and fluorescent
Stark effects of nitriles I. Methods and nucleobase analogues (FBA): An experimental
experimental results. J Phys Chem A 104:
and theoretical study. UMI Dissertation
11853–11863 Publishing 1–266
INDEX
Stefan Weber and Erik Schleicher (eds.), Flavins and Flavoproteins: Methods and Protocols, Methods in Molecular Biology,
vol. 1146, DOI 10.1007/978-1-4939-0452-5, © Springer Science+Business Media New York 2014
467
FLAVINS AND FLAVOPROTEINS: METHODS AND PROTOCOLS
468 Index
K Photosensitizers ..................................................................10
Protein structure .......................................202, 203, 205, 208,
Kinetic isotope effect ................................................161–173 210, 223, 231, 396
Proton-coupled electron transfer ............................. 215, 219,
L
362, 419, 424
Light, oxygen, and voltage (LOV) Pyridine nucleotide................................. 81, 87–89, 118, 230
domains ................................178, 181, 183, 186–189,
207, 220, 293, 348, 362–365, 370, 373, 390, R
393–394, 428, 429, 432, 434, 435 Radical mechanisms .........................................................341
Liptay analysis ..........................................................453, 454 Radical pairs ..................................... 223, 352–353, 356, 425
Lumazine synthase .......................................... 17, 21, 24–26, Redissolved sample ...................................................363–367
29–30, 32–34, 45, 69, 71, 74 Redox-coenzymes .............................................................163
Lysine-specific demethylase 1 ..................................114–116 Redox midpoint potential ................................ 178, 180–181,
183–186, 188, 189
M
Reductases ................................................. 20, 21, 80–82, 88,
Magic-angle spinning ....................................... 255, 318–323 95–108, 114, 118, 126, 127, 308, 463
Molecular dynamics.......................88, 89, 171, 196, 223, 432 Resonance-Raman spectroscopy................................ 66, 196,
Monoamine oxidase (MAO) ........................... 114, 116–118, 377–397, 432, 444
133–135, 137, 138, 141 Riboflavin .............................................3, 15, 41, 65, 79, 114,
187, 198, 233, 309, 411, 450
N analogs ....................................................................41–60
NADH ...................................................7, 47, 124, 126, 163, biosynthesis .......................................... 15–34, 44–45, 66
165–168, 178, 186, 187, 189 synthase .......................18, 25–30, 32, 33, 66, 69, 71, 72, 74
NAD(P)H:quinone oxidoreductase Roseoflavin ...........................................31–32, 42, 43, 48, 51,
(NQO1)................................................ 114, 124–125 54, 56, 58, 200
NADPH...............................................22, 81, 82, 88, 89, 90,
118–121, 123, 124, 127, 128, 132, 141, 163, 165, 167,
S
168, 178, 275, 279, 395 Solid-state NMR.............................................. 231, 307–335
NADPH oxidase ...................................... 121, 123, 141–142 Spectroscopy ................................................ 66, 83, 167, 180,
Nicotinamide nucleotides .....................................................7 191, 229, 333, 343, 361, 377, 401, 443
15
N-labeled flavins ............................................................232 Stable isotope labeled flavins ......................................66, 196
NQO1. See NAD(P)H:quinone oxidoreductase (NQO1) Stark spectroscopy ....................................................443–464
Nuclear magnetic resonance (NMR) ........................... 23, 65,
83, 167, 202, 229, 307, 395, 425 T