Methods in

Molecular Biology 1343

Albert C. Shaw Editor

Immunose-
necence
Methods and Protocols
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes:

http://www.springer.com/series/7651
 Immunosenecence
Methods and Protocols

Edited by

Albert C. Shaw
Section of Infectious Diseases, Department of Internal Medicine, Yale School of Medicine,
New Haven, CT, USA
Editor
Albert C. Shaw
Section of Infectious Diseases
Department of Internal Medicine
Yale School of Medicine
New Haven, CT, USA

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-4939-2962-7 ISBN 978-1-4939-2963-4 (eBook)
DOI 10.1007/978-1-4939-2963-4

Library of Congress Control Number: 2015946748

Springer New York Heidelberg Dordrecht London

© Springer Science+Business Media New York 2015
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.

Printed on acid-free paper

Humana Press is a brand of Springer

Springer Science+Business Media LLC New York is part of Springer Science+Business Media (www.springer.com)
Preface

The United Nations estimates that, by 2050, the number of adults over age 60 will rise to
over two billion worldwide and will exceed the number of individuals under age 15 for the
first time in human history. This aging of the worldwide population has profound social
implications and will undoubtedly influence the distribution and delivery of healthcare;
notably, older adults are at increased risk for organ-specific dysfunction such as cardiovas-
cular and renal disease, as well as increased rates of neurodegeneration and epithelial
malignancies, to name a few examples. Older adults are also at risk for increased morbidity
and mortality from infectious diseases and poor responses to vaccinations. In some cases,
this increased risk is for specific infectious syndromes, such as sepsis, or reactivation of vari-
cella zoster virus infection or tuberculosis. At the same time, aging of adults with chronic
viral infections such as HIV disease will result in immunologic changes that reflect the
convergence of immune dysregulation of chronic infection and of aging. This burden of
acute and chronic disease in older adults in part results from age-associated changes in the
immune system, or immunosenescence. This volume contains protocols employed by
experts in the field to study the protean effects of immunosenescence on innate and adap-
tive immune responses and includes cell biology and biochemical methods for analyses of
telomere dysfunction, autophagy, and protein oxidation. Genomic approaches for the
analysis of antigen receptor repertoire, microRNAs, and DNA methylation are also dis-
cussed. While in no way comprehensive, this volume is intended to provide a mixture of
basic and advanced protocols that will be useful for immunologists in general and investi-
gators in aging biology in particular.
This edition of Methods in Molecular Biology would not have been possible without the
efforts of the chapter authors, and I am grateful to them for taking time from their busy
schedules to contribute. I would also like to thank Professor John Walker, the Editor-in-
Chief of this series, for inviting me to edit this volume and for his constant support, and
would also like to thank Patrick Marton, David Casey, and the team at Humana Press. We
all hope that this edition will facilitate cross-fertilization and future advances aimed at
improving the health of older adults.

New Haven, CT Albert C. Shaw

v
Contents

Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

1 Isolation of Lipid Rafts from Human Neutrophils

by Density Gradient Centrifugation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Carl Fortin and Tamas Fülöp
2 Flow Cytometry Analysis of NK Cell Phenotype and Function in Aging . . . . . 9
Raquel Tarazona, Carmen Campos, Alejandra Pera,
Beatriz Sanchez-Correa, and Rafael Solana
3 Flow Cytometric Identification of Fibrocytes in the Human Circulation . . . . . 19
Xinyuan Hu, Erin M. DeBiasi, and Erica L. Herzog
4 Experimental Approaches to Tissue Injury and Repair in Advanced Age . . . . . 35
Aleah L. Brubaker, Stewart R. Carter, and Elizabeth J. Kovacs
5 Multicolor Digital Flow Cytometry in Human Translational Immunology. . . . 53
Samit R. Joshi, Subhasis Mohanty, and Albert C. Shaw
6 Flow Cytometry-Based Methods to Characterize Immune Senescence
in Nonhuman Primates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
Christine Meyer, Kristen Haberthur, Mark Asquith,
and Ilhem Messaoudi
7 Multiparameter Phenotyping of Human PBMCs Using Mass Cytometry. . . . . 81
Michael D. Leipold, Evan W. Newell, and Holden T. Maecker
8 Imaging Immunosenescence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
Feng Qian and Ruth R. Montgomery
9 Activation-Induced Cytidine Deaminase and Switched
Memory B Cells as Predictors of Effective In Vivo Responses
to the Influenza Vaccine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107
Daniela Frasca, Alain Diaz, and Bonnie B. Blomberg
10 Analyzing the Effect of Aging on CD8+ T-Cell Phenotype
Using Flow Cytometry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 115
Min Sun Shin and Insoo Kang
11 Cell-Mediated Immune Response to Influenza Using Ex Vivo Stimulation
and Assays of Cytokine and Granzyme B Responses. . . . . . . . . . . . . . . . . . . . . 121
Janet E. McElhaney and Beth Gentleman
12 Assays for Monitoring Macroautophagy Activity in T cells . . . . . . . . . . . . . . . . 143
Yair Botbol and Fernando Macian
13 Fluorescence-Based Approaches for Quantitative Assessment
of Protein Carbonylation, Protein Disulfides, and Protein
Conformation in Biological Tissues . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 155
Asish R. Chaudhuri, Rochelle Wei, Arunabh Bhattacharya,
and Ryan Hamilton

vii
viii Contents

14 Monitoring the DNA Damage Response at Dysfunctional Telomeres . . . . . . . 175

Rekha Rai and Sandy Chang
15 Single-Cell Analysis of T-Cell Receptor Αβ Repertoire. . . . . . . . . . . . . . . . . . . 181
Pradyot Dash, George C. Wang, and Paul G. Thomas
16 Assessment of B Cell Repertoire in Humans . . . . . . . . . . . . . . . . . . . . . . . . . . 199
Yu-Chang Wu, David Kipling, and Deborah Dunn-Walters
17 Laboratory and Data Analysis Methods for Characterization
of Human B Cell Repertoires by High-Throughput DNA Sequencing . . . . . . 219
Chen Wang, Yi Liu, Krishna M. Roskin, Katherine J.L. Jackson,
and Scott D. Boyd
18 Discovery of Novel microRNAs in Aging Caenorhabditis elegans . . . . . . . . . . . 235
Alexandre de Lencastre and Frank Slack
19 Analysis of DNA Methylation by Pyrosequencing . . . . . . . . . . . . . . . . . . . . . . 249
Colin Delaney, Sanjay K. Garg, and Raymond Yung

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 265
Contributors

MARK ASQUITH • Division of Pathobiology and Immunology, Oregon National Primate

Research Center, Beaverton, OR, USA
ARUNABH BHATTACHARYA • Cellular and Structural Biology, University of Texas Health
Science Center at San Antonio, San Antonio, TX, USA; Barshop Institute for Longevity
and Aging Studies, University of Texas Health Science Center at San Antonio,
San Antonio, TX, USA
BONNIE B. BLOMBERG • Department of Microbiology and Immunology, University of Miami
Miller School of Medicine, Miami, FL, USA
YAIR BOTBOL • Department of Pathology, Albert Einstein College of Medicine, Bronx,
NY, USA
SCOTT D. BOYD • Department of Pathology, Stanford University, Stanford, CA, USA
ALEAH L. BRUBAKER • Integrative Cell Biology, Loyola University Chicago, Health Sciences
Division, Maywood, IL, USA; Burn and Shock Trauma Institute, Loyola University
Chicago, Health Sciences Division, Maywood, IL, USA; Immunology and Aging
Program, Loyola University Chicago, Health Sciences Division, Maywood, IL, USA;
Stritch School of Medicine, Loyola University Chicago, Health Sciences Division,
Maywood, IL, USA
CARMEN CAMPOS • Department of Immunology, IMIBIC, Reina Sofia University Hospital,
University of Cordoba, Cordoba, Spain
STEWART R. CARTER • Burn and Shock Trauma Institute, Loyola University Chicago,
Health Sciences Division, Maywood, IL, USA; Department of Surgery, Loyola University
Chicago, Health Sciences Division, Maywood, IL, USA; Stritch School of Medicine,
Loyola University Chicago, Health Sciences Division, Maywood, IL, USA
SANDY CHANG • Department of Laboratory Medicine, Yale School of Medicine, New Haven,
CT, USA; Department of Pathology, Yale School of Medicine, New Haven, CT, USA
ASISH R. CHAUDHURI • UT Southwestern Medical Center, Dallas, TX, USA; Barshop
Institute for Longevity and Aging Studies, University of Texas Health Science Center at
San Antonio, San Antonio, TX, USA; Departments of Biochemistry, University of Texas
Health Science Center at San Antonio, San Antonio, TX, USA; South Texas Veterans
Health Care System, San Antonio, TX, USA
PRADYOT DASH • Department of Immunology, St. Jude Children’s Research Hospital,
Memphis, TN, USA
ERIN M. DEBIASI • Department of Internal Medicine, Section of Pulmonary, Critical Care
and Sleep Medicine, Yale School of Medicine, New Haven, CT, USA
COLIN DELANEY • Department of Internal Medicine, University of Michigan Medical
School, Ann Arbor, MI, USA
ALEXANDRE DE LENCASTRE • Department of Biological Sciences, Quinnipiac University,
Hamden, CT, USA
ALAIN DIAZ • Department of Microbiology and Immunology, University of Miami Miller
School of Medicine, Miami, FL, USA
DEBORAH DUNN-WALTERS • Department of Immunobiology, King’s College London School
of Medicine, London, UK

ix
x Contributors

CARL FORTIN • Department of Medicine, Duke University Medical Center, Durham,

NC, USA
DANIELA FRASCA • Department of Microbiology and Immunology, University of Miami
Miller School of Medicine, Miami, FL, USA
TAMAS FÜLÖP • Research Center on Aging, Department of Medicine, Immunology
Postgraduate Programme, Faculty of Medicine and Health Sciences, Université
de Sherbrooke, Sherbrooke, QC, Canada
SANJAY K. GARG • Department of Internal Medicine, University of Michigan Medical
School, Ann Arbor, MI, USA
BETH GENTLEMAN • Advanced Medical Research Institute of Canada, Sudbury, ON, Canada
KRISTEN HABERTHUR • Department of Molecular Microbiology and Immunology,
Oregon Health and Science University, Portland, OR, USA
RYAN HAMILTON • Cellular and Structural Biology, University of Texas Health Science
Center at San Antonio, San Antonio, TX, USA; Barshop Institute for Longevity
and Aging Studies, University of Texas Health Science Center at San Antonio,
San Antonio, TX, USA
ERICA L. HERZOG • Department of Internal Medicine, Section of Pulmonary, Critical Care
and Sleep Medicine, Yale School of Medicine, New Haven, CT, USA
XINYUAN HU • Department of Internal Medicine, Section of Pulmonary, Critical Care and
Sleep Medicine, Yale School of Medicine, New Haven, CT, USA
KATHERINE J.L. JACKSON • Department of Pathology, Stanford University, Stanford, CA, USA
SAMIT R. JOSHI • Section of Infectious Diseases, Department of Internal Medicine,
Yale School of Medicine, New Haven, CT, USA; Bristol-Myers Squibb, Inc., Wallingford,
CT, USA
INSOO KANG • Section of Rheumatology, Department of Internal Medicine, Yale School
of Medicine, New Haven, CT, USA
DAVID KIPLING • Department of Pathology, Cardiff University, Cardiff, UK
ELIZABETH J. KOVACS • Integrative Cell Biology, Loyola University Chicago, Health Sciences
Division, Maywood, IL, USA; Burn and Shock Trauma Institute, Loyola University
Chicago, Health Sciences Division, Maywood, IL, USA; Immunology and Aging
Program, Loyola University Chicago, Health Sciences Division, Maywood, IL, USA;
Department of Surgery, Loyola University Chicago, Health Sciences Division,
Maywood, IL, USA; Stritch School of Medicine, Loyola University Chicago,
Health Sciences Division, Maywood, IL, USA
MICHAEL D. LEIPOLD • Institute for Immunity, Transplantation and Infection,
Stanford University, Stanford, CA, USA
YI LIU • Department of Pathology, Stanford University, Stanford, CA, USA; Biomedical
Informatics Training Program, Stanford University, Stanford, CA, USA
FERNANDO MACIAN • Department of Pathology, Albert Einstein College of Medicine, Bronx,
NY, USA
HOLDEN T. MAECKER • Institute for Immunity, Transplantation and Infection,
Department of Microbiology and Immunology, Stanford University, Stanford, CA, USA
JANET E. MCELHANEY • Advanced Medical Research Institute of Canada, Sudbury,
ON, Canada
ILHEM MESSAOUDI • Division of Biomedical Sciences, University of California, Riverside
School of Medicine, Riverside, CA, USA
 Contributors xi

CHRISTINE MEYER • Division of Pathobiology and Immunology, Oregon National Primate

Research Center, Beaverton, OR, USA
SUBHASIS MOHANTY • Division of Pathobiology and Immunology, Oregon National Primate
Research Center, Beaverton, OR, USA; Molecular Microbiology and Immunology, Oregon
Health and Science University, Portland, OR, USA; Division of Biomedical Sciences,
School of Medicine, University of California, Riverside, CA, USA
RUTH R. MONTGOMERY • Section of Rheumatology, Department of Internal Medicine,
Yale School of Medicine, New Haven, CT, USA
EVAN W. NEWELL • Singapore Immunology Network, Singapore, Singapore
ALEJANDRA PERA • Department of Immunology, IMIBIC, Reina Sofia University Hospital,
University of Cordoba, Cordoba, Spain
FENG QIAN • Section of Rheumatology, Department of Internal Medicine, Yale University School
of Medicine, New Haven, CT, USA; State Key Laboratory of Genetic Engineering and
Ministry of Education Key Laboratory of Contemporary Anthropology, School of Life
Sciences, Fudan University, Shanghai, China
REKHA RAI • Department of Laboratory Medicine, Yale School of Medicine, New Haven,
CT, USA
KRISHNA M. ROSKIN • Department of Pathology, Stanford University, Stanford, CA, USA
BEATRIZ SANCHEZ-CORREA • Immunology Unit, Department of Physiology, University
of Extremadura, Caceres, Spain
ALBERT C. SHAW • Section of Infectious Diseases, Department of Internal Medicine,
Yale School of Medicine, New Haven, CT, USA
MIN SUN SHIN • Section of Rheumatology, Department of Internal Medicine, Yale School
of Medicine, New Haven, CT, USA
FRANK SLACK • Cancer Center at BI-Deaconess Medical Center, Department of Pathology,
Harvard Medical School, Boston, MA, USA
RAFAEL SOLANA • Department of Immunology, IMIBIC, Reina Sofia University Hospital,
University of Cordoba, Cordoba, Spain
RAQUEL TARAZONA • Immunology Unit, Department of Physiology, University of Extremadura,
Caceres, Spain
PAUL G. THOMAS • Department of Immunology, St. Jude Children’s Research Hospital,
Memphis, TN, USA
CHEN WANG • Department of Pathology, Stanford University, Stanford, CA, USA
GEORGE C. WANG • Department of Immunology, St. Jude Children’s Research Hospital,
Memphis, TN, USA; Center of Excellence in Geriatric Medicine, Newton Medical Center,
Sparta, NJ, USA
ROCHELLE WEI • Barshop Institute for Longevity and Aging Studies, University of Texas
Health Science Center at San Antonio, San Antonio, TX, USA
YU-CHANG WU • Randall Division of Cell and Molecular Biophysics, King’s College
London School of Biomedical Science, London, UK
RAYMOND YUNG • Department of Internal Medicine, University of Michigan Medical
School, Ann Arbor, MI, USA
 Chapter 1

Isolation of Lipid Rafts from Human Neutrophils

by Density Gradient Centrifugation
Carl Fortin and Tamas Fülöp

Abstract
Neutrophils are present within minutes to the site of aggression in the body making them one of the first
cells of the immune system to be in contact with incoming threats. The cell functions of neutrophils are
elicited through the engagement of surface receptors, some of which are located in a specific region of the
membrane called lipid rafts, a functionally segregated region of the membrane enriched with cholesterol
and distinct species of sphingomyelin and glycerophospholipids. Lipid rafts are relatively resistant to
detergent extraction and this can be taken advantage of to isolate them from the rest of the cell membrane.
This chapter will describe a reliable method to obtain lipid rafts from detergent-resistant membrane
fractions of human neutrophils. Cells are lysed in an HEPES solution containing 0.5 % Triton X-100,
supernatants are mixed with a 42 % sucrose solution, which is then overlaid with a 35 % and 5 % sucrose
solution. The gradient is centrifuged for 16 h and the resulting fractions can be further analyzed by immu-
noblotting or subjected to immunoprecipitation.

Key words Human, Neutrophils, Sucrose, Lipid raft, Flotillin, Detergent-resistant membrane

1 Introduction

Neutrophils are present within minutes to the site of aggression in

the body making them one of the first cells of the immune system
to be in contact with incoming threats. Neutrophils are well known
for their phagocytic and antimicrobial capacities. But, their contri-
bution to the immune response goes well beyond clearance of
debris at the site of infection [1]. Indeed, neutrophils locally secrete
an impressive array of mediators such as regulatory proteases [2]
and cytokines/chemokines [3] that have a profound influence on
the shaping of the ensuing immune response.
As in any other cells of the immune system, the cellular func-
tions of neutrophils are elicited through the engagement of surface
receptors [4]. It was reported that some of these receptors [4–7]
are located in a specific region of the membrane called lipid rafts.
Lipid rafts are highly fluctuating, both in size and composition,

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_1, © Springer Science+Business Media New York 2015

1
2 Carl Fortin and Tamas Fülöp

domains of the membrane enriched in sphingolipids, cholesterol, and

proteins (including receptor and adapter proteins). The best-
known example of the physiological relevance of lipid rafts is T-cell
activation. Indeed, the interaction between the antigenic peptide
and the TCR occurs in the central part of the immunological syn-
apse, a functionally segregated region of the membrane enriched
with cholesterol and distinct species of sphingomyelin and glycero-
phospholipids [8]. More simply put, lipid rafts can aggregate
(a phenomenon called coalescence) upon cell stimulation and this
results in an increased physical proximity for all molecules involved
in ligand–receptor signaling. Lipid rafts are, however, not only rel-
evant for T-cell activation, but, as reviewed elsewhere [9], have
broad biological roles including virus budding and membrane
trafficking.
A crucial characteristic of lipid rafts is that they are relatively
resistant to detergent extraction. Taking advantage of this charac-
teristic, this chapter will describe a reliable method to obtain lipid
rafts from detergent-resistant membrane (DRM) fractions of
human neutrophils. To facilitate the detection of lipid raft-
associated proteins by immunoblotting, a small volume gradient
and 1 mL ultracentrifuge tubes are used.

2 Materials

Prepare all solutions using double-distilled water and molecular

biology grade reagents. The solutions are stored at 4 °C and not
filtered, unless indicated otherwise.

2.1 Stock Solutions 1. Phenylmethanesulfonyl fluoride (PMSF): For a 250 mg bottle,

for Inhibitors (See add 14.35 mL of DMSO. This is your 100 mM stock solution.
Note 1) Use at 1 mM final.
2. DL-Dithiothreitol (DTT): To prepare a 1 M stock solution,
add 1 mL of water to 154 mg of powder. Discard after use.
Use at 1 mM final.
3. Sodium Fluoride (NaF): To prepare a 1 M stock solution, add
1 mL of water to 42 mg of powder. Discard after use. Use at
10 mM final.
4. Sodium pyrophosphate dibasic (Na2H2PO7): To prepare a 1 M
stock solution, add 1 mL of water to 222 mg of powder.
Discard after use. Use at 2 mM final.
5. β-Glycerophosphate disodium salt hydrate: To prepare a 1 M
stock solution, add 1 mL of water to 216 mg of powder. Use
at 25 mM final.
6. Diisopropylfluorophosphate (DFP): Depending on your pro-
vider, DFP will be in powder or liquid form. Use at 1 mM
 Isolation of Lipid Rafts from Human Neutrophils by Density… 3

final. DFP is extremely toxic, open under a fume hood. Discard

the product upon the appearance of a yellow color.
7. Sodium orthovanadate (Na3VO4): Orthovanadate must be
activated (see Note 2). Use at 1 mM final. Because of its high
pH (pH 10), adding too much of the orthovanadate solution
will cause unwanted cell lysis.

2.2 Solutions 1. Solution A: PBS 1× pH 7.4 containing all the inhibitors men-
Required tioned in Subheading 2.1 (see Note 3).
for Neutrophil Lysis 2. Solution B: 25 mM HEPES, 100 mM NaCl, 2 mM EDTA,
pH 6.9. Add about 100 mL water to a glass beaker. Weight
1.49 g HEPES, 1.46 g NaCl, 0.146 g EDTA, and add to the
beaker. Mix until the solution is colorless and adjust the pH to
6.9. Put the solution into a 250-mL graduated cylinder and
complete to 250 mL with water. Filter the solution through a
250 mL 0.45 μm filter unit. Discard after 3 months.

2.3 Sucrose Gradient 1. 85 % sucrose solution (see Note 4): Weigh 42.5 g sucrose and
add to a glass beaker containing 10 mL of solution B. Mix
overnight with a small stir bar and, when the sucrose is dis-
solved, complete to 50 mL with solution B. Discard after 3
months.
2. 35 % sucrose solution (see Note 5): Weigh 17.5 g sucrose and
add to a glass beaker containing 25 mL of solution B. Mix with
a small stir bar until the sucrose is dissolved and complete to
50 mL with solution B. Discard after 3 months.
3. 5 % sucrose solution (see Note 5): Weigh 2.5 g sucrose and add
to a glass beaker containing 25 mL of solution B. Mix with a
small stir bar until the sucrose is dissolved and complete to
50 mL with solution B. Store the solution at 4 °C and discard
after 3 months.

2.4 Centrifugation Tubes: 1 mL polycarbonate thick wall centrifuge tubes (11 × 34 mm,
Beckman) were used with the TLA-120.2 rotor in a Beckman
Optima MAX centrifuge.

3 Methods

3.1 Neutrophil When working with primary cells, such as neutrophils, it is essential
Stimulation to follow some guidelines to prevent accidental cell activation and
reduce variability between donors. As neutrophils as extremely
sensitive to endotoxins, the entire cell isolation procedure must be
carried out under endotoxin-free conditions. Therefore, this means
using sterile, apyrogenic plasticware, sterilized and baked glassware
(LPS survives autoclaving), and low-endotoxin serum/FBS.
Equally important is to avoid heat shock, which can activate the cells.
4 Carl Fortin and Tamas Fülöp

To do so, always isolate cells at room temperature (no refrigeration

during centrifugation) and do not put human neutrophils on ice. It
is better to leave human neutrophils at room temperature if you
need a short break (15–30 min). Before stimulation, let the cells
equilibrate at 37 °C in a water bath for about 15 min. If pre-incu-
bating for 30 min or more with inhibitors, then no prior equilibra-
tion is necessary. Also, never exceed a final concentration of 0.3 %
DMSO or any other vehicle (some vehicles kill primary cells and
others activate them); it is best to aim for 0.1 % by preparing your
stock solutions at 1000× so as to use 1 μL in 1 mL, which makes
0.1 % final. In addition, a common mistake made when working
with neutrophils is to resuspend them at a high cell density. For
most of the readouts, this can result in unwanted activation, false
positives, and high backgrounds. Freshly isolated cells must be
immediately resuspended (avoid making bubbles) in RPMI + 5 %
serum (FBS or autologous) at a final concentration of no more than
3—10 × 106 cells/mL. Stimulation should be done at 37 °C in a
water bath with occasional (5–10 min) gentle shaking to avoid cell
sedimentation, especially when using a higher cell density. Finally,
do not ever use a vortexer to resuspend neutrophils. As a starting
point, we suggest that 1×107 neutrophils in 1 mL be used.

3.2 Stopping 1. If using 15 or 50 mL conicals, centrifuge for 5 min at 200 × g

the Stimulation to pellet the cells. If stimulation was done in microcentrifuge
tubes, quickspin (4–5 s at max speed) to pellet the cells.
Remove supernatant by aspiration.
2. Gently resuspend the cells in 200 μL of ice-cold solution A with
a tip and transfer, if needed, in microcentrifuge tubes.
3. Incubate 10 min on ice.

3.3 Cell Lysis 1. Pellet the cells by doing a quickspin (4–5 s at max speed).
2. Remove supernatant by aspiration (see Note 6).
3. Resuspend the cells in 150 μL solution B containing freshly
made inhibitors (Subheading 2.1) and 0.5 % Triton X-100.
4. Incubate 10 min on ice.
5. Centrifuge 5 min at max speed to pellet cell debris.
6. Proceed immediately to gradient preparation (Subheading 3.4).

3.4 Preparing 1. Add 150 μL of the 85 % sucrose solution in the bottom of

the Sucrose Gradient 1 mL polycarbonate thick wall centrifuge tubes (see Note 7).
2. Add the supernatant from cell lysis (Subheading 3.3, step 5)
and mix well. The goal is to dilute the 85 % sucrose solution to
a 42.5 % sucrose solution.
3. Gently overlay with 500 μL of 35 % sucrose solution (see Note 8).
4. Carefully add 300 μL of 5 % sucrose solution.
5. Load tubes into the rotor (see Note 9).
 Isolation of Lipid Rafts from Human Neutrophils by Density… 5

3.5 Centrifugation 1. Centrifuge at 78,288 × g overnight at 4 °C. This speed results

in an average rcf of 78,000 × g and a max rcf of 96,000 × g in a
TLA-120.2 rotor (see Note 10).

3.6 Harvest 1. Put a 96-well plate on ice.

2. Carefully remove the tubes from the rotor and put on ice
avoiding any disturbance of the gradient.
3. Collect nine 100 μL fractions, starting from the top of the
gradient, and put each fraction in a different well. Using the
rows of a 96-well plate as a means to separate samples and wells
to aliquot fractions greatly facilitates the handling of a large
number of samples.
4. Boil fractions in an equal volume of pre-heated 2× Laemmli
sample buffer and resolve by gel electrophoresis according to
standard protocols [10]. Alternatively, an immunoprecipita-
tion can be performed on fractions to enhance the detection of
low abundance proteins (see Note 11).

4 Notes

1. All inhibitor solutions should be made fresh except for PMSF,

β-Glycerophosphate, DFP, and Na3VO4. In addition, solution
A should have a yellow color when DTT is added; otherwise,
discard your DTT and make a fresh solution.
2. Orthovanadate should be activated for maximal phosphotyro-
syl phosphatase-blocking activity. The procedure outline below
actually depolymerizes the vanadate, which is most potent as a
monomer [11]. First, prepare a 200 mM solution of orthovan-
adate (3.68 g in 100 mL water). Then, adjust to pH 10 (the
solution will be yellow). Third, boil until the solution becomes
colorless (about 10 min) and let it cool to room temperature.
Fourth, readjust to pH 10 and repeat the previous step only if
there is still some yellow coloration. Most of the time, only one
boiling step is required. Aliquot in small volumes and store at
−20 °C. Discard aliquot after use.
3. PBS 1× is diluted from a 10× stock solution. PBS 10×: Add
about 800 mL water to a glass beaker. Weigh 80 g NaCl, 2 g
KCl, 11.5 g Na2HPO4, and 2 g KH2PO4 and add to the beaker.
Mix until the salts are dissolved and adjust the pH to 7.4. Put
the solution into a 1-L graduated cylinder and complete to 1 L
with water. Filter the solution through a 500 mL 0.45 μm filter
unit and store at room temperature. To make the 1× solution,
dilute with distilled water.
4. The 85 % sucrose solution takes a long time to prepare and
heating does not make all that sucrose dissolve faster. So, plan
accordingly.
6 Carl Fortin and Tamas Fülöp

5. The 35 and 5 % sucrose solution can easily be made in a 50 mL

conical: add the powder in 25 mL of solution B and vortex
until the sucrose is dissolved. Complete to 50 mL.
6. Freezing the cell pellets to continue the protocol later is not a
good idea.
7. Try to keep the ultracentrifuge tubes on ice, whenever possible,
during the gradient preparation.
8. All the sucrose solutions must be ice-cold before use.
9. The rotor as well as the centrifuge must be pre-chilled at
4 °C. Do not put the rotor on ice but in a cold room. Always
use the rotor’s support because if the diodes at the bottom of
the rotor get dirty, the centrifuge will not reach its speed.
10. This centrifugation speed only applies to a 0.950 mL gradient
centrifuged in 1 mL tubes in a TLA-120.2 rotor. The optimal
centrifugation speed will have to be experimentally determined
by each user. To do so, set-up a gradient as described in this
chapter and subject all nine fractions to immunoblotting against
Flotillin-1, a known lipid raft marker [12]. If the centrifugation
speed is adequate, Flotillin-1 distribution will be discontinuous,
as showed by us in figure 2A of Fortin et al. [13]. In addition,
larger tubes can be used but cell numbers and total volume of
the gradient must be scaled up accordingly [12, 14].
11. We have presented in this chapter a method to isolate lipid rafts
from 1 × 107 human neutrophils. The detection of a large number
of proteins by immunoblotting with this amount of cells should
be possible. If you are trying to detect a low-abundance protein,
you can try at first to increase cell numbers in solution B (with
inhibitors and Triton) to 4 × 107. A wiser alternative, however, is
to disrupt a large number of neutrophils (1 × 108 cells) by nitrogen
cavitation according to a standard protocol. Resulting cavitates
are then centrifuged at a maximum speed in a microcentrifuge for
10 min at 4 °C in order to get rid of nuclei and granules.
Supernatants, which contain cell membranes, are then centrifuged
for 1 h at 100,000 × g. After washing, cell membranes are dis-
solved directly in solution B containing inhibitors and 0.5 %
Triton X-100 (as in Subheading 3.3) for 10 min and the gradient
is made as described in Subheading 3.4. This enhances the detec-
tion of low-abundance proteins and ensures that no neutrophil-
derived proteases degrade your target, which is a genuine risk if
you simply increase cell numbers in solution B.

Acknowledgments

This work was supported by grants from the Canadian Institutes of

Health Research (CIHR) (No. 106634 and No. 106701), the
Université de Sherbrooke, and the Research Center on Aging.
 Isolation of Lipid Rafts from Human Neutrophils by Density… 7

References
1. Mantovani A, Cassatella MA, Costantini C, 8. Zech T, Ejsing CS, Gaus K, de Wet B,
Jaillon S (2011) Neutrophils in the activation Shevchenko A, Simons K, Harder T (2009)
and regulation of innate and adaptive immu- Accumulation of raft lipids in T-cell plasma
nity. Nat Rev Immunol 11:519–531 membrane domains engaged in TCR signal-
2. Borregaard N (2010) Neutrophils, from ling. EMBO J 28:466–476
Marrow to Microbes. Immunity 33:657–670 9. Simons K, Gerl MJ (2010) Revitalizing mem-
3. Scapini P, Lapinet-Vera JA, Gasperini S, brane rafts: new tools and insights. Nat Rev
Calzetti F, Bazzoni F, Cassatella MA (2000) Mol Cell Biol 11:688–699
The neutrophil as a cellular source of chemo- 10. Gallagher SR (2012) One-dimensional SDS
kines. Immunol Rev 177:195–203 gel electrophoresis of proteins. Curr Protoc
4. Fulop T, Larbi A, Douziech N, Fortin C, Protein Sci 10(1):1–44, Chapter 10, Unit 10 1
Guerard KP, Lesur O, Khalil A, Dupuis G 11. Gordon JA (1991) Use of vanadate as protein-
(2004) Signal transduction and functional phosphotyrsine phosphatase inhibitor.
changes in neutrophils with aging. Aging Cell Methods Enzymol 201:477–482
3:217–226 12. Sitrin RG, Emery SL, Sassanella TM, Blackwood
5. Fortin CF, Lesur O, Fulop T Jr (2007) Effects RA, Petty HR (2006) Selective localization of
of TREM-1 activation in human neutrophils: recognition complexes for leukotriene B4 and
activation of signaling pathways, recruitment Formyl-Met-Leu-Phe within lipid raft microdo-
into lipid rafts and association with TLR4. mains of human polymorphonuclear neutro-
Int Immunol 19:41–50 phils. J Immunol 177:8177–8184
6. David A, Fridlich R, Aviram I (2005) The 13. Fortin CF, Sohail A, Sun Q, McDonald PP,
presence of membrane proteinase 3 in neutro- Fridman R, Fulop T (2010) MT6-MMP is
phil lipid rafts and its colocalization with present in lipid rafts and faces inward in living
FcyRIIIb and cytochrome b558. Exp Cell Res human PMNs but translocates to the cell sur-
308:156–165 face during neutrophil apoptosis. Int Immunol
7. Bournazos S, Hart SP, Chamberlain LH, 22:637–649
Glennie MJ, Dransfield I (2009) Association of 14. Hill WG, An B, Johnson JP (2002)
FcyRIIa (CD32a) with lipid rafts regulates Endogenously expressed epithelial sodium
ligand binding activity. J Immunol 182: channel is present in lipid rafts in A6 cells.
8026–8036 J Biol Chem 277:33541–33544
 Chapter 2

Flow Cytometry Analysis of NK Cell

Phenotype and Function in Aging
Raquel Tarazona, Carmen Campos, Alejandra Pera,
Beatriz Sanchez-Correa, and Rafael Solana

Abstract
Natural killer (NK) cells represent a subpopulation of lymphocytes involved in innate immunity, defined
recently as group 1 of innate lymphoid cells (ILCs). NK cells are cytotoxic lymphocytes with a relevant role
in the destruction of transformed cells as virus-infected or tumor cells, as well as the regulation of the
immune response through cytokine and chemokine production that activates other cellular components of
innate and adaptive immunity. In humans, NK cell subsets have been defined according to the level of
expression of CD56. Aging differentially affects NK cell subsets and NK cell function. Here, we describe
protocols for the delineation of NK cell subsets and the analysis of their functional capacity using multipa-
rametric flow cytometry.

Key words NK cell subsets, Density gradient separation, Flow cytometry, CD107a/b degranulation
assay, Cytotoxicity

1 Introduction

In peripheral blood, human natural killer (NK) cells represent

between 5 and 20 % of lymphocytes. They are classically defined by
the expression of CD56 and/or CD16 and the absence of T- and
B-cell receptors [1]. According to the level of expression of CD56
and CD16, NK cells can be divided into four subsets: CD56bright
CD16negative, CD56bright CD16+, CD56dim CD16+, and CD56negative
CD16+ cells. An additional CD56dim CD16negative subset has been also
defined [2]. Recently, CD56bright cells have been placed as a more
immature stage of NK cells than CD56dim cells; in addition, CD57 is
expressed in more mature and highly cytotoxic NK cells and CD57+
NK cells are less responsive to cytokine stimulation [3, 4].
Age can affect cell number, cell subset distribution, and NK
cell function as demonstrated previously [5–7]. It has been
described that per cell NK cell cytotoxicity is usually decreased
whereas CD16-mediated antibody-dependent cell cytotoxicity

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_2, © Springer Science+Business Media New York 2015

9
10 Raquel Tarazona et al.

(ADCC) is preserved in the elderly [6, 7]. Whereas the number of

NK cell is maintained or increased in the elderly, a decline in the
more immature CD56bright NK cell subset and an increase in
CD56dim cells and in CD57 expression have been reported. NK cell
differentiation has been proposed as a continuous process support-
ing a gradual shift from CD56bright to CD56dim CD57negative and
finally to CD56dim CD57+ NK cells [6, 8, 9]. Thus, the alterations
observed in NK cells in the elderly can be explained by a remodeling
of NK cell subsets, with a decrease in the immature CD56bright
subset and the accumulation of more differentiated CD56dim
CD57+ NK cells that may also explain many of the functional
features of NK cells observed in elderly individuals [6, 7]. The
inclusion of anti-CD57 antibody in panels designed to determine
NK cell subsets in elderly individuals therefore gives us additional
relevant information about NK cell differentiation status.
The mean fluorescence intensity of natural cytotoxicity receptors
(NCR) NKp30 and NKp46 has been used to classify NCRbright
(NKp30bright NKp46bright), NCRdiscordant (NKp30brightNKp46dull or
NKp30dullNKp46bright) or NCRdull (NKp30dull NKp46dull) pheno-
types [10]. We have observed that the majority of healthy young
individuals have a NCRbright phenotype, whereas elderly individuals
as well as young and elderly leukemia patients frequently display a
NCRdull or NCRdiscordant phenotype [11, 12].
DNAM-1 has been recently emerged as an important regula-
tor of NK cell function. DNAM-1 triggers NK cell-mediated cyto-
toxicity and IFN-γ production upon engagement with its ligands
CD155 and CD112. Recent evidence suggests that DNAM-1
ligands can be induced by cellular stress, strengthening the role of
this receptor on NK cell function. DNAM-1 expression has been
found to be reduced in the elderly [6, 11–13].
The analysis of the effect of aging and CMV seropositivity on
the expression of CD94, CD94/NKG2C, and CD94/NKG2A on
NK cell subsets has showed that CMV seropositivity is associated
with the expression of CD94/NKG2C dimers and CD57 on the
major CD56dimCD16+ and the dysfunctional CD56 − CD16+
NK cell subsets. A significant decrease on the expression of the
CD94/NKG2A inhibitory receptor is found in the CD56 − CD16+
NK cell subset from elderly CMV seropositive individuals com-
pared to young individuals (Campos et al. 2014, Experimental
Gerontology, in press). No significant changes have been reported
so far on the expression or function of NKG2D on elderly indi-
viduals [6]. In addition, in recent years, degranulation assays quan-
tifying CD107a surface expression have been applied to NK cells.
CD107a expression correlates with NK cell activity [14], enabling
the simultaneous analysis of NK cell markers and the functionality
of NK cells.
Technical advances in flow cytometry over the last decade have
allowed the analysis on a per cell basis of NK cell subsets and their
 Flow Cytometry of NK Cells in the Elderly 11

characteristic phenotypes along with the study of NK cell function

in the different subsets. Here, we present protocols and provide
advice regarding the analysis of age-associated changes in NK cell
phenotype and function.

2 Materials

2.1 Cells, Media, 1. Whole blood collected in sodium heparin vacutainer tubes
and Solutions (2–3 tubes by donor) (see Note 1).
2. Sterile Phosphate Buffered Saline (PBS) 1×.
3. NK cell-susceptible target cells (e.g. K562 or 721.221) are
required for functional experiments.
4. Density gradient cell separation medium for mononuclear cells
as Histopaque-1077 containing Ficoll and sodium diatrizoate
(Sigma-Aldrich).
5. Complete culture medium (RPMIc): RPMI-1640 supple-
mented with 10 % heat-inactivated fetal bovine serum (FBS)
and 2 mM L-glutamine or 1 % of Glutamax (GIBCO) and pen-
icillin (50 U/ml)-streptomycin (50 U/ml).
6. Materials for freezing cells: Cold Freezing Media (Heat inacti-
vated and filtered FBS with 20 % of Dimethylsulfoxide
(DMSO)). Cryovials, freezing container (e.g. Mr. Frosty,
Nalgene) and isopropyl alcohol.
7. Optional, for NK cell isolation: NK cell-negative isolation kit
(Miltenyi) or Rosette Sep human NK cell enrichment cocktail
(StemCell Technologies, Grenoble, France).
8. Materials for proliferation assays: CellTrace CFSE proliferation
kit, from Invitrogen. Prepare CFSE aliquots at a concentration
of 5 mM (10 μl). Store at −20 °C.
9. Human recombinant IL-2 [15] in vials containing 50,000 IU/ml.
Store at −20 °C.
10. Flow cytometry buffer.
11. Trypan Blue solution (0.4 %), Neubauer chamber and
coverslips.
12. Plasticware: 30 ml sterile universal tubes, sterile pipettes, 15 ml
sterile polypropylene conical tubes and 96-well plates, U
bottom.

2.2 Monoclonal 1. Analysis of NK cell subsets: monoclonal antibodies (mAb)

Antibodies against CD56 (B159 from BD Pharmingen), CD16 (3G8
from BD Pharmingen or VEP13 from Miltenyi Biotec) and
CD3 (BW264/56 from Miltenyi Biotec or SP34-2 or SK7
from BD Biosciences) labeled with the appropriate combination
of fluorochromes.
12 Raquel Tarazona et al.

2. Study of NK cell activating receptors: mAb against Natural

Cytotoxicity Receptors (NCRs) NKp30 (p30-15), NKp46
(9E2) and NKp44 (p44-8.1); NKG2D (1D11); DNAM-1
(CD226) (DX11); CD94 (HP-3D9) from BD Pharmingen
and NKG2C (134591) from R&D Systems.
3. Study of NK cell inhibitory receptors: mAb against KIR (e.g.
pan KIR2D, NKVFS1, Miltenyi Biotec), CD85j (ILT2)
(GHI/75, BD Pharmingen), CD94 and NKG2A (131411,
R&D Systems).
4. Antibodies against CD107a (H4A3, BD Pharmingen) for
degranulation assays.
5. Antibodies against NK cell effector molecules: perforin (δG9),
granzymes A (CB9) and B (GB11) from BD Pharmingen, and
cytokines as IFN-γ (45–15) and TNF-α (CA2) from Miltenyi
Biotec.
Other combinations of mAbs and fluorochromes from differ-
ent suppliers can also be used.

2.3 Equipment 1. Inverted microscope.

Required 2. Thermostated centrifuge.
3. Cell culture incubator at 37 °C and 5 % CO2.
4. Freezer (−80°) and a liquid nitrogen (N2) tank.
5. Flow Cytometer.

3 Methods

Carry out all procedures in sterile conditions unless otherwise

specified.

3.1 Peripheral Blood 1. Dilute whole blood from each vacutainer at least 2× with PBS.
Mononuclear Cell Carefully layer the diluted blood suspension over the
(PBMC) Isolation by Histopaque separation medium (7 ml, ~ 3:1 proportion) in a
Gradient Density 30 ml universal tube.
2. Centrifuge at 400 × g for 20 min at room temperature (RT) in
a swinging bucket rotor without brake.
3. Aspirate the mononuclear cell layer at the interphase and
deposit it in a new 30 ml tube. Fill with 1× PBS to the brim
and centrifuge at 300 × g for 5 min.
4. Discard supernatant and resuspend cell pellet in 10 ml of PBS.
Centrifuge at 300 × g for 5 min and then discard supernatant
and resuspend cell pellet again in 10 ml of PBS.
5. Count cells in a Neubauer chamber using Trypan blue for
assessment of viability.
 Flow Cytometry of NK Cells in the Elderly 13

3.2 Freeze–Thaw Cryopreservation of blood samples is frequently required for

Procedures lymphocyte storage for further analysis. Performing a high-quality
freezing procedure will improve cell viability and cell recovery after
thawing.
1. After counting the previously isolated cells, remove superna-
tant and resuspend cell pellet with FBS at a concentration of
5–6 × 106 cells/0.9 ml per cryovial and place them on ice. Then
add drop by drop 0.9 ml of cold freezing media (containing
20 % of DMSO) to each vial to be frozen, for a final concentra-
tion of 10 % DMSO in FBS solution. It is important to deposit
the freezing media slowly and do not pipette the cell suspen-
sion, instead invert the tube once carefully (see Note 2).
2. Freeze vials overnight in a −80 °C freezer using a freezing
container filled with isopropyl alcohol (some freezer containers
do not require alcohol) to ensure standardized cooling rate of
−1 °C/min required for successful cryopreservation of cells.
3. Transfer vials to liquid N2 tank for long-term storage (see Note 3).
4. Thaw procedure: Warm 8 ml of complete culture media.
Remove vial from liquid N2 tank and hold in 37 °C water bath
until sides are thawed but centre remains frozen. Add the
warm media to the partially frozen cells and gently pour cells
into a 30 ml tube. Do not shake the vial. It is important to
remove DMSO as soon as possible. Centrifuge at 250 × g for
5 min. Discard supernatant and resuspend pellet in 10 ml of
PBS if the cells are going to be marked for cytometry analysis
or in 10 ml of RPMIc if the cells are going to be used for func-
tionality assays. Count cells using Trypan blue to calculate cell
viability (see Note 4).

3.3 Flow Cytometry The protocol and antibody panels presented here are standardized
Analysis of NK Cell for the analysis on a 7-color MACSQuant flow cytometer (Miltenyi).
Phenotype Antibody incubation was performed for 20 min at 4 °C unless
otherwise specified. We recommend performing titration experi-
ments to obtain the optimal concentration for each antibody batch.
1. For the analysis of human NK cell subsets: CD56brightCD16negative,
CD56brightCD16+, CD56dimCD16+ and CD56negative CD16+
populations, PBMCs (0.3 × 106 to 106) obtained as indicated
in Subheading 3.1 were labeled with anti-CD3PerCP, anti-
CD56 PE-Cy7, and anti-CD16 APC-Cy7.
2. Further characterization of NK cell subsets is done by using
mAb against different surface markers such as CD57 (clone
TB03, Miltenyi Biotec), a marker of activated/senescent cells
that we include in all tubes, and antibodies against activating
and inhibitory receptors such as NKG2D, NKp46, NKp30,
DNAM-1 and CD94 together with NKG2A or NKG2C. Table 1
is a representative multicolor antibody panel used for seven-
color flow cytometry analysis of NK cells.
14 Raquel Tarazona et al.

Table 1
Example of an antibody panel for seven-color flow cytometry analysis of NK cells

APC-Vio770
VioBlue FITC PE PerCP PE-Cy7 APC or APC-Cy7
Isotope controls
Phenotype CD57 Biotin/ DNAM-1 NKp30 CD3 CD56 NKp46 CD16
antibiotin VB
CD57 Biotin/ CD94 NKG2C CD3 CD56 NKG2D CD16
antibiotin VB
CD57 Biotin/ CD85j Pan-KIR2D CD3 CD56 NKG2A CD16
antibiotin VB
Analysis of CD57 Biotin/ Granzyme B TNF-α CD3 CD56 INF-γ CD16
effector antibiotin VB
molecules and CD57 Biotin/ INF-γ TNF-α CD3 CD56 CD107a CD16
degranulation antibiotin VB
CD57 Biotin/ Perforin Granzyme A CD3 CD56 CD107a CD16
antibiotin VB

3. Once staining of surface molecules is accomplished, cells are

fixed and permeabilized using BD Cytofix/Cytoperm fixa-
tion/permeabilization kit (BD Biosciences) and then stained
with antibodies against the intracellular cytotoxic effector mol-
ecules perforin and granzymes A and B.
4. Cell acquisition is performed gating on the lymphocyte region
using forward scatter (FSC) vs. side scatter (SSC) and then
gating on CD3negative cells and finally a dot plot of CD56 vs.
CD16 will show the four NK cell subsets (Fig. 1). Acquire at
least 105 cells within the lymphocyte gate (see Note 5).

3.4 NK Cell As CD107a expression has been directly correlated with CD8+ T
Cytotoxicity cell and NK cell cytotoxicity, this marker is used for the degranula-
and Cytokine tion assays.
Production 1. Use either freshly isolated PBMCs or cryopreserved PBMCs
in Response to K562 (see Subheading 3.2).
and 721.221 Cell Lines
2. PBMCs are resuspended at 1 × 106 cells/ml in RPMIc and
rested overnight at 37 °C in a standard incubator (humidified
CO2 atmosphere).
3. The following day, PBMCs are placed in a 96-well plate at
1.5 × 106 cells/ml (200 μl final volume). First, anti-CD16
APC-Vio770 (Miltenyi Biotec) is added to all wells and the
plate is incubated for 15 min at RT. Next, Anti-CD107a-APC
(BD Biosciences) antibody is added. The recommended anti-
body dilution for CD107a conjugate is 1:10 for up to 107
cells/100 μl. For each individual a positive control containing
 Flow Cytometry of NK Cells in the Elderly 15

104
4000 4000

3000 3000 103

CD16 APC-Cy7
SSC-A

SSC-A
2000 2000
102

1000 1000
101

1000 2000 3000 4000 101 102 103 104 105

100
FSC-A CD3 PerCPVio700
100 101 102 103 104
CD56 PE-Cy7

100 100 100

80 R1 80 R2 80 R3
60 60 60
40 40 40
20 20 20
0 0 1 0
101 102 103 104 105 10 102 103 104 105 10
1
102 103 104 105

100 100
80 R4 80 R5
60 60
40 40
20 20
0 0
10
1
102 103 104 105 101 102 103 104 105

CD57 VioBlue

Fig. 1 Representative analysis of NK cell subsets by flow cytometry. Lymphocyte gating is performed according
to FSC and SSC parameters, then CD3-negative lymphocytes are selected and the analysis of CD56 and/or
CD16 expression is represented in a dot plot in order to select the different NK cell subsets. Regions R1 to R5
represent, total NK cells, CD56negative CD16+, CD56dim CD16+, CD56bright CD16+ and CD56bright CD16negative NK cells
respectively. Histograms represent CD57 expression for each subset

PMA and ionomycin at a final concentration of 50 ng/ml and

1 μg/ml (respectively) was included, as well as a negative con-
trol without stimuli, to measure spontaneous stimulation. For
stimulation with K562 and 721.221 cell lines the cell target:NK
cell ratio recommended is 1:1. This ratio is determined by esti-
mating the NK cell proportion in PBMCs by flow cytometry
or by using purified NK cells.
4. The plate is then placed in a standard incubator (37 °C,
humidified CO2 atmosphere) and, after 1 h, each well receives
the addition of monensin (Golgistop, 0.67 μl/ml; BD
Biosciences) and brefeldin A (Golgi Plug 1 μg/ml; BD
Biosciences) ( see Note 6). Cells are then incubated for an
additional 4 h. Following incubation, cells are washed twice
with PBS (4 °C) and stained with surface antibodies (anti-
CD56, anti-CD3). Cells are then fixed and permeabilized and
subsequently stained intracellularly with antibodies against
IFN-gamma and TNF-alpha for 30 min. For isotype controls
16 Raquel Tarazona et al.

follow the same protocol as samples. All antibodies used must

be titred before use. Stained cells can be analyzed by flow
cytometry the following day.

3.5 Analysis of Cell 1. Separate and isolate PBMCs from blood samples as described
Proliferation by CFSE in Subheading 3.1 (see Note 7).
Staining 2. Count the cells with a Neubauer chamber and calculate viability
with Trypan blue solution.
3. Take a few cells (~200,000 cells) to perform a pre-purification
analysis (using surface markers CD3 and CD56 and their
corresponding isotype controls).
4. Purify cells using a purification kit and count purified cells
obtained (see Subheading 2.1.7).
5. Take a few cells to make a post-purification cytometry
(~100,000 cells) using anti-CD3 and anti-CD56 mAb and
quantify its efficiency (see Note 8).
6. Centrifuge the remaining volume at 300 × g, 5 min (to remove
any residual separation solution after purification). Decant and
resuspend the pellet.
7. Add to the pellet 1 ml of PBS + CFSE (1 μM final concentra-
tion) and incubate for 3 min at RT in the dark and shake the
sample (manually mixing).
8. Stop reaction by adding 10 ml of cold medium and centrifuge
at 200 × g for 10 min at 20 °C. Decant and resuspend in 10 ml
of RPMIc, wash twice.
9. Resuspend the pellet in RPMIc to a final concentration of
250,000 cell/200 μl per well (just over 106/ml). Usually we
use four wells per donor: two for isotype control (stimulated
and unstimulated) and two for sample (stimulated and
unstimulated).
10. Add 2 μl of rhIL-2 (so that the final concentration of rhIL-2 is
500 IU/ml) to the corresponding wells and incubate at 37 °C
and 5 % CO2 during 24 h.
11. The next day, take 50 μl from one of the unstimulated wells
(best use cells from the isotype control well), acquire the cells
in the cytometer and set the setting (value) for FL1 (CFSE
fluoresces on this channel). Thus, we establish the beginning
of proliferation. To do this, we set the voltage for FL1 between
103 and 104. If we have sufficient cells also set the voltages for
the rest of the channels (since unlabeled cells may also emit
auto-fluorescence).
12. Incubate for 5 days.
13. At the end of 5 days, centrifuge the plate at 300 × g for 5 min
at 20 °C. Decant the supernatant and wash twice with 200 μl
of cold sterile 1× PBS. Label the cells with mAb against CD56,
 Flow Cytometry of NK Cells in the Elderly 17

CD3 and CD16 (in any color except FITC, which corresponds
to CFSE) and other surface markers of interest, like CD57.
14. Wash with 200 μl of cold sterile 1× PBS. Centrifuge at 300 × g
for 5 min at 10 °C, decant and resuspend with 200 μl of 1×
PBS or cytometry buffer. Acquire the cells the same day.
15. Analyze the data using the FlowJo software (Tree Star Inc
V.7.2.1, Ashland, OR. USA). With this program you can cal-
culate the “proliferation index” which represents the number
of cell divisions, not counting the cells that have not entered
into division.

4 Notes

1. It has been observed that for flow cytometry analysis, sodium

heparin performs better than citrated-based anticoagulants
maintaining cell viability.
2. Do not freeze more than five vials at the same time to ensure
that cell processing is performed quickly.
3. Using this technique we have increased cell viability after thaw-
ing (>90 %) compared with the use of 10 % DMSO freezing
media directly deposited on cell pellet.
4. For analysis of NK cell function viability of cell suspension
should be greater than 90 %.
5. APC and PE labeled antibodies against NKG2A and NKG2C
respectively cannot be used simultaneously due to fluorescence
quenching.
6. Monensin is required for the CD107a assay and brefeldin A or
monensin for intracellular cytokine detection. Check which
transport inhibitor is recommended for the detection of a
given cytokine.
7. For proliferation assays freshly isolated PBMCs perform better
than cryopreserved PBMCs.
8. Perform the cytometry purification control on the same day of
purification.

Acknowledgement

This work was supported by grants PS09/00723 and PI13/02691

(to R.S.) from the Spanish Ministry of Health, SAF2009-09711
and SAF2013-46161-R (to R.T.) from the Ministry of Science and
Innovation of Spain and, PRI09A029 and grants to INPATT
research group from the Junta de Extremadura (GRU10104) and
from the University of Extremadura (to R.T.) and grants from the
18 Raquel Tarazona et al.

Junta de Andalucia (to R.S.) cofinanced by the European Regional

Development Fund (FEDER). The following reagent was obtained
through the AIDS Reagent Program, Division of AIDS, NIAID,
NIH: (human rIL-2) from Dr. Maurice Gately, Hoffmann–La
Roche Inc.

References

1. Cooper MA, Fehniger TA, Caligiuri MA (2001) uncoupled from NK-cell education. Blood
The biology of human natural killer-cell subsets. 116:3853–3864
Trends Immunol 22:633–640 9. Lopez-Verges S, Milush JM, Pandey S, York
2. Poli A, Michel T, Theresine M, Andres E, VA, Arakawa-Hoyt J, Pircher H, Norris PJ,
Hentges F, Zimmer J (2009) CD56bright Nixon DF, Lanier LL (2010) CD57 defines a
natural killer (NK) cells: an important NK cell functionally distinct population of mature NK
subset. Immunology 126:458–465 cells in the human CD56dimCD16+ NK-cell
3. Romagnani C, Juelke K, Falco M, Morandi B, subset. Blood 116:3865–3874
D’Agostino A, Costa R, Ratto G, Forte G, 10. Fauriat C, Just-Landi S, Mallet F, Arnoulet C,
Carrega P, Lui G, Conte R, Strowig T, Moretta Sainty D, Olive D, Costello RT (2007)
A, Munz C, Thiel A, Moretta L, Ferlazzo G Deficient expression of NCR in NK cells from
(2007) CD56bright. J Immunol 178: acute myeloid leukemia: evolution during
4947–4955 leukemia treatment and impact of leukemia
4. Chan A, Hong DL, Atzberger A, Kollnberger cells in NCRdull phenotype induction. Blood
S, Filer AD, Buckley CD, McMichael A, Enver 109:323–330
T, Bowness P (2007) CD56bright human NK 11. Sanchez-Correa B, Gayoso I, Bergua JM,
cells differentiate into CD56dim cells: role of Casado JG, Morgado S, Solana R, Tarazona R
contact with peripheral fibroblasts. J Immunol (2012) Decreased expression of DNAM-1 on
179:89–94 NK cells from acute myeloid leukemia patients.
5. Gayoso I, Sanchez-Correa B, Campos C, Immunol Cell Biol 90:109–115
Alonso C, Pera A, Casado JG, Morgado S, 12. Sanchez-Correa B, Morgado S, Gayoso I,
Tarazona R, Solana R (2011) Immunosenescence Bergua JM, Casado JG, Arcos MJ, Bengochea
of human natural killer cells. J Innate Immun ML, Duran E, Solana R, Tarazona R (2011)
3:337–343 Human NK cells in acute myeloid leukaemia
6. Solana R, Tarazona R, Gayoso I, Lesur O, patients: analysis of NK cell-activating recep-
Dupuis G, Fulop T (2012) Innate immunose- tors and their ligands. Cancer Immunol
nescence: effect of aging on cells and receptors Immunother 60:1195–1205
of the innate immune system in humans. Semin 13. de Andrade LF, Smyth MJ, Martinet L (2014)
Immunol 24:331–341 DNAM-1 control of natural killer cells func-
7. Solana R, Pawelec G, Tarazona R (2006) Aging tions through nectin and nectin-like proteins.
and innate immunity. Immunity 24:491–494 Immunol Cell Biol 92:237–244
8. Bjorkstrom NK, Riese P, Heuts F, Andersson 14. Alter G, Malenfant JM, Altfeld M (2004)
S, Fauriat C, Ivarsson MA, Bjorklund AT, CD107a as a functional marker for the identifi-
Flodstrom-Tullberg M, Michaelsson J, cation of natural killer cell activity. J Immunol
Rottenberg ME, Guzman CA, Ljunggren Methods 294:15–22
HG, Malmberg KJ (2010) Expression pat- 15. Lahm HW, Stein S (1985) Characterization of
terns of NKG2A, KIR, and CD57 define a recombinant human interleukin-2 with micro-
process of CD56dim NK-cell differentiation methods. J Chromatogr 326:357–361
 Chapter 3

Flow Cytometric Identification of Fibrocytes

in the Human Circulation
Xinyuan Hu, Erin M. DeBiasi, and Erica L. Herzog

Abstract
Because the incidence of organ fibrosis increases with age, various fibrosing disorders are projected to
account for significant increases in morbidity, mortality, and healthcare costs in the years to come.
Treatments for these diseases are scarce and better understanding of the immunopathogenesis of fibrosis
and its relationship to aging are sorely needed. One area of interest in this field is the role that fibrocytes
might play in the development of tissue remodeling and fibrosis. Fibrocytes are mesenchymal progenitor
cells presumed to be of monocyte origin that possess the tissue remodeling properties of tissue resident
fibroblasts such as extracellular matrix production and α-SMA-related contractile properties, as well as the
immunologic functions typically attributed to macrophages including production of cytokines and chemo-
kines, antigen presentation, regulation of leukocyte trafficking, and modulation of angiogenesis. Fibrocytes
could participate in the development of age-related fibrosing disorders through any or all of these functions.
This chapter presents methods that have been developed for the study of circulating human fibrocytes.
Protocols for the quantification of fibrocytes in the human circulation will be presented along with discus-
sion of the technical challenges that are frequently encountered in this field. It is hoped that this informa-
tion will facilitate further investigation of the relationship between fibrocytes, aging, and fibrosis, and
perhaps uncover new areas of study in these difficult-to-treat and deadly diseases.

Key words Aging, Collagen, Extracellular matrix, Fibrocyte, Fibrosis, Flow cytometry

1 Introduction

The incidence of many diseases characterized by chronic inflammation

and fibrosis increases with age. Because these ailments are difficult
to treat, the combined toll of end-organ fibrosis accounts for
substantial morbidity, mortality, and healthcare costs [1]. Despite
many years of research, precise identification of the cells and medi-
ators driving these responses remain undefined [2, 3]. Current
paradigms of fibrogenesis feature damage to structural cells
followed by a chronic macrophage-rich inflammatory infiltrate and
an aberrant fibroblast-driven wound repair response [2, 4]. Given
the age-related nature of these diseases, it is possible that various
forms of immunosenescence are involved. Identification of

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_3, © Springer Science+Business Media New York 2015

19
20 Xinyuan Hu et al.

age-related profibrotic immune responses has the potential to

advance our understanding of the pathogenic mechanism(s) driving
these diseases. Fibrocytes are a monocyte-derived population of
mesenchymal progenitor cells possessing a remarkable array of pro-
inflammatory and reparative functions [5]. Strong experimental
evidence obtained in murine models and in primary human cells
reveals enhanced concentrations of peripheral blood fibrocytes in
many forms of solid organ fibrosis, as well as in normal aging,
thereby suggesting that fibrocyte abnormalities might reflect a
novel form of age-related immune dysregulation [6]. Therefore,
the development of methods to accurately quantify fibrocytes in the
human circulation has the potential to significantly advance the
study of immunosenescence. This chapter will present the data link-
ing fibrocytes with fibrosis and aging and will describe the factors
regulating their function and trafficking. Methods for the accurate
detection of fibrocytes in the circulation will be described, along
with common technical challenges encountered in these studies.
It is hoped that this information will facilitate novel investigation of
the role that fibrocytes might play in age-related fibrosing disorders
and perhaps uncover new areas of study related to immunosenes-
cence in these difficult-to-treat and deadly diseases.

1.1 Fibrocytes: Fibrocytes are an important area of interest in the immunopatho-

Disease Associations genesis of many diseases characterized by fibrosis and remodeling
[6]. Identified by the co-expression of leukocyte markers such as
CD45, extracellular matrix proteins such as Collagen-1α, and pluri-
potency markers such as CD34 [5], fibrocytes display an increas-
ingly recognized association with a wide variety of diseases
characterized by autoimmunity such as rheumatoid arthritis [7],
autoimmune thyroiditis [8], amyopathic antisynthetase syndrome
[9], and scleroderma [10, 11]. Quantitative and phenotypic abnor-
malities in circulating and parenchymal fibrocytes are also seen in
chronic inflammatory disorders that are not classically thought of
as autoimmune including idiopathic pulmonary fibrosis [12–14],
asthma [15–17], nephrogenic systemic fibrosis [18], cardiovascu-
lar disease [19], and pulmonary hypertension [20]. In support of
these studies, animal modeling implicates fibrocytes in the devel-
opment of several forms of tissue fibrosis including those affecting
the lungs [13, 14, 21, 22], liver [23], kidney [24, 25], heart [26–28],
and vasculature [29]. When viewed in this light, it is particularly
relevant that elevations in circulating fibrocytes are seen in the
blood of aged but otherwise healthy individuals, and in several
animal models of aging [30, 31], leading to speculation that fibro-
cytes might represent a form of abnormal immune activation related
to aging. Additionally, fibrocytes are emerging as mediators of
tumor metastasis [32–34]. For all of these reasons, the study of
fibrocytes as it relates to immunosenescence has become both
important and timely.
 FACS-Based Detection of Circulating Human Fibrocytes 21

Fig. 1 Representative imaging of fibrocytes from an aged subject. Panel (a) shows an image of a fibrocyte
obtained from the peripheral blood monocytes of a healthy but aged individual. This image was generated
using Amnis image stream technology in which flow cytometry is combined with real-time confocal micros-
copy. Top left: brightfield; top right: FITC-detected Pro-Collagen Iα1 (Pro-Col Iα1, pseudocolored yellow here).
Bottom left: PE-detected CD45, bottom right: merged image of CD45 and Pro-Col Iα1. (b) Brightfield image of
cultured fibrocytes. The spindle-shaped cells demonstrate the typical morphology of fibrocytes

1.2 Identification Flow cytometric identification of fibrocytes in the circulation

of Fibrocytes employs the co-detection of characteristic cell surface markers and
in the Circulation intracellular staining for collagens and/or other extracellular matrix
components. Human fibrocytes express nonspecific hematopoietic
markers such as CD45 [5] and leukocyte-specific protein-1 (LSP-
1) [35] along with more specific markers of monocyte lineage and
function (CD11b, CD11c, CD11d) [36], chemokine receptors
(CXCR4) [13], host defense proteins and scavenger receptors
(CD16/32, CD163) [36], antigen presentation (Major
Histocompatibility Complex (MHC) I and II, CD80, and CD86)
[37], and cell surface enzymes such as CD10 and CD13 [36].
Most sources agree that fibrocytes lack markers of lymphocyte ori-
gin [36, 38] though this may not be true in all cases. Circulating
fibrocytes also express CD34 [5], a motility protein also found on
certain populations of stem cell that is often used to distinguish
fibrocytes from related cells such as macrophages and tissue resident
fibroblasts [6]. In addition to these cell surface markers, fibrocytes
also produce many extracellular matrix components including
structural proteins and glycosaminoglycans (GAGs) [36, 38, 39].
Representative imaging of fibrocytes is shown in Fig. 1 and a com-
plete listing of fibrocyte markers is compiled in Table 1.

1.3 Fibrocytes: Because human and murine fibrocyte precursors copurify with
Differentiation peripheral blood monocytes that express CD14 [40], fibrocytes are
and Homing considered to be of monocytic origin, though lineage tracing stud-
ies will be required to definitively address this question. Enrichment
for CD11b(+) CD115(+) Gr1(+) expression enhances fibrocyte
outgrowth from cultured murine monocytes; these effects require
direct contact with activated CD4+ lymphocytes and occur via an
mTOR-PI3 kinase-dependent pathway [24]. Human and rodent
fibrocyte precursors also express the Fcγ receptor [41], which
responds to aggregated IgG by inducing fibrocyte outgrowth.
22 Xinyuan Hu et al.

Table 1
Markers used to identify fibrocytes

Marker Expression
Adhesion and motility
CD9, CD11a, CD11b, CD11c, CD43 Intermediate to high
CD164, Mac2, LSP-1, CD29, CD44, CD81 Intermediate to high
ICAM-1, CD49 complex, CD34 Intermediate to high
Cell surface enzymes
CD10, CD172a, FAP Intermediate to high
CD13, Prolyl-4-hydroxylase Intermediate to high
Scavenging receptors and host defense
CD14, CD68, CD163, CD206, CD209, Conflicting reports
CD35, CD36
Fcγ receptors
CD16, CD32a, CD32b, CD32c Intermediate to high
Chemokine receptors
CCR2, CCR5, CCR4, CCR7, CCR9 Intermediate to high
CXCR1, CXCR4, CXC3R1 Intermediate to high
Antigen presentation
CD45, CD80, CD86, MHCI, MCHII Low to intermediate
Extracellular matrix
Collagen-I/III/IV, vimentin, tenascin Low to intermediate
Fibronectin, α-SMA Conflicting reports
Collagen V High
Glycosaminoglycans
Perlecan, Versican, Hyaluronan Intermediate to high
Decorin Low to intermediate
Miscellaneous
Semaphorin 7a, CD115, Thy 1.1, CD105 Low to intermediate

These effects are opposed by exposure to the short pentraxin

protein serum Amyloid P [21] via an ITIM-dependent mechanism
[42]. In vitro studies of primary human cells also reveal that the
monocyte to fibrocyte transition is inhibited by Th1 cytokines such
as IFNγ, TNF, and IL-12, and by Th17 cytokines such as IL-17A
[43]; this transition is augmented by Th2 cytokines including IL-4
and IL-13 [43, 44], as well as exposure to TGF-β1, and engage-
ment of the β1 integrin subunit [11, 20]. The β1 integrin effects
require Erk phosphorylation [20], though other signaling path-
ways might also be involved.
Recruitment of murine fibrocytes to injured tissue occurs via
the chemokine receptors CCR2, CCR7, and CXCR4 [22, 45, 46].
Human fibrocytes express the chemokine receptors CCR3 (eotaxin
receptor) and CCR5 (MCP-1 receptor) as well as CD29 and
 FACS-Based Detection of Circulating Human Fibrocytes 23

Semaphorin 7a [47], and it is assumed that these receptors regu-

late in vivo trafficking though this assumption has not been con-
firmed. Despite the paucity of direct data regarding the mediators
that affect fibrocyte recruitment in humans, our own work demon-
strates an association between concentrations of soluble factors
such as IL-4, IL-10, IL-13, MCP-1, and CCL18 in the blood of
aged but otherwise healthy subjects, suggesting that fibrocytes
might enter the circulation in response to one or more of these
cytokines. In studies involving the bleomycin model of murine
lung fibrosis, elevations in circulating and intrapulmonary fibro-
cytes and the soluble mediators TGF-β1 and Stromal-derived
factor-1 (SDF-1) were seen in unchallenged mice with null muta-
tions of the Senescence-Associated Mutation Prone gene which
confers an enhanced fibrotic phenotype [30]. Similarly, in studies
employing in vivo imaging of transgenic mice in which the lucifer-
ase gene is placed under control of the Col-Iα promoter, enhanced
bone marrow egress of circulating fibrocytes is detected [31]. In
humans, high levels of CXCL12, which binds to CXCR4, have
been found in the lungs and blood of patients with idiopathic pul-
monary fibrosis (IPF), and these levels correlate with circulating
fibrocyte concentrations [13]. The blood of patients with sclero-
derma-associated lung fibrosis also demonstrates high level expres-
sion of Plexin C1, the cognate inhibitory receptor for Sema 7a
[48]. Interestingly, in vitro knockdown of this receptor markedly
promotes fibrocyte outgrowth, suggesting that Plexin C1 might
serve as a counter-regulatory response. To date, these pathways
have not been specifically assessed in fibrocytes obtained from aged
but otherwise healthy individuals.

1.4 Fibrocytes: Fibrocytes possess an array of functions implicating them in the

Functions pathogenesis of chronic inflammatory conditions and fibrosis.
For example, human fibrocytes respond to stimulation with inter-
leukin-1 beta (IL-1β) by increasing secretion of the cytokines
interleukin-6 (IL-6) and interleukin-8 (IL-8), the chemokines
CCL2 and CCL3, and by upregulating expression of intercellular
adhesion molecule-1 (ICAM-1) [49]. In the setting of Toll-Like
Receptor stimulation and viral infections, porcine fibrocytes par-
ticipate in antigen presentation and activation of cytotoxic CD8+
cells by increasing expression of Major Histocompatibility Complex
I and II, and the costimulatory proteins CD80 and CD86 [50].
In addition to these proinflammatory activities, in some settings
fibrocytes can also respond to IL-1β by increasing interleukin-10
(IL-10) production [49] which would be expected to reduce
inflammation in part through recruitment of regulatory T cells.
Fibrocytes might also participate in repair and remodeling through
their ability to adopt the alpha-Smooth Muscle Actin (α-SMA)-
expressing, contractile phenotype of activated myofibroblasts, and
their participation in wound contraction has been demonstrated
24 Xinyuan Hu et al.

ex vivo in studies using wound chambers [5]. Normal human

fibrocytes exhibit a pattern of ECM production that would be
expected to recruit inflammatory cells and enact repair; this pattern
includes robust expression of Collagen V, hyaluronan, and versican,
and decorin [39].
In addition to direct production of ECM, fibrocytes might also
participate in remodeling and fibrosis via secretion of soluble medi-
ators such as platelet-derived growth factor (PDGF) and TGF-β1.
These growth factors regulate transformation of cultured myofi-
broblasts. Fibrocytes are also involved in the regulation of angio-
genesis via secretion of matrix metalloproteinases (MMPs), vascular
endothelial growth factor (VEGF), PDGF-A, hepatocyte growth
factor (HGF), granulocyte–macrophage colony stimulating factor
(GM-CSF), basic fibroblast growth factor (b-FGF), IL-8 and
IL-1β [51]. Additional immunoregulatory properties are sug-
gested by fibrocyte expression of Semaphorin 7a (“Sema 7a” or
CD108W) [11], a GPI-anchored membrane protein that can acti-
vate macrophages and dendritic cells, control T-cell activation and
induce secretion of TGF-β1 [52].
Fibrocytes are also identified in certain human malignancies
[32, 53, 54] and have in animal models been shown to facilitate
tumor metastasis through several mechanisms. Fibrocytes can aug-
ment tumor growth by mediating immunosuppression via both
active suppression of interferon-gamma (IFNγ) and tumor necro-
sis factor (TNF) [55] and production of indoleamine oxidase [32].
Fibrocytes recruit immunosuppressive monocytes via CCL2 to
metastatic sites [34]. Additionally, murine fibrocytes contribute to
the development of a premetastatic niche through regulation of
cell migration via CCR5 and induction of MMP9 [33]. This array
of functions frames fibrocytes as a pluripotent cell population that
responds to the local inflammatory milieu by adopting diverse phe-
notypic characteristics involving varying degrees of inflammation
and ECM production (Fig. 2). Any or all of these properties might
participate in the immunopathogenesis and tissue remodeling
responses seen in age-related pathologies.
The following protocol has been developed for the accurate
detection of fibrocytes in the human circulation. The stepwise pro-
tocol is included along with detailed notes regarding the assiduous
use of blocking agents and controls and commonly encountered
technical challenges.

2 Materials

1. Kendall Monoject Blood Collection Tubes (Tyco/Healthcare,

Mansfield, MA).
2. Histopaque (Sigma-Aldrich, St. Louis, MO).
 FACS-Based Detection of Circulating Human Fibrocytes 25

Fig. 2 Potential contributions of fibrocytes to the pathogenesis of age-related fibrosis. Fibrocyte precursors
copurify with CD14+ monocytes and possess immunomodulatory functions including production of chemo-
kines and cytokines, antigen presentation, extracellular matrix production, wound contraction, paracrine regu-
lation of angiogenesis, and regulation of leukocyte trafficking. Any or all of these functions might contribute to
the age-related immune abnormalities

3. PE-conjugated Anti-human CD45 (HI30, BD Biosciences,

San Jose, CA).
4. IsoPE Mouse IgG1 (MOPC-21), Isointracellular Purified Rat
IgG1 (R3-34) (BD Biosciences Pharmingen).
5. Alexa Fluor 488 conjugated Goat Anti-rat IgG (Invitrogen,
Eugene, Oregon).
6. FCR Blocking Reagent Human (MACS Miltenyi Biotec).
7. Rat anti Human Pro-Collagen Iα1 (M-58, Millipore, Temecula,
CA).
8. 10× Phosphate-buffered saline (PBS) pH 7.4: 1.4 M NaCl,
0.1 M phosphate, pH 7.4, 0.03 M KCl. Mixed with dH2O to
get 1× PBS (American Bioanalytical, Natick, MA).
9. Ethylenediaminetetraacetate (EDTA) pH 8.0 (American
Bioanalytical, Natick, MA).
10. Fetal Bovine Serum (FBS).
11. FACS Buffer: PBS with 2 % FBS, 0.01 % NaN3 and 1 mM
EDTA/500 mL.
12. Paraformaldehyde (PFA) (JT Baker, Phillipsburg, NJ).
13. FACS Calibur (Becton Dickinson).
14. CellQuest (BD Biosciences).
15. FlowJo software.
16. 4 % Paraformaldehyde (see recipe).
26 Xinyuan Hu et al.

3 Methods

The methods described here outline (a) human peripheral

mononuclear cell collection and staining for identification of fibro-
cytes; (b) flow cytometry of stained samples; and (c) accurate
analysis of flow cytometry data.

3.1 Human 1. Collect peripheral blood in sterile sodium heparin tubes

Peripheral Blood (10 mL draw).
Mononuclear Cell 2. Dilute blood with Phosphate-buffered Saline (PBS) 1:2 blood
Collection to PBS.
and Staining 3. Layer diluted blood over histopaque: 1:3 histopaque to blood/
3.1.1 Separation PBS (typically 10 mL of histopaque to 30 mL blood/PBS)
of Peripheral Blood (see Note 1).
Mononuclear Cells 4. Centrifuge at 1240 × g for 22 min at 12 °C with acceleration,
from Plasma deceleration curves at (1,1) (most gradual).
5. Remove peripheral blood mononuclear cells (PBMCs) in the
buffy coat layer (layer between plasma and histopaque) with
pipettor (see Note 2).
6. Wash with PBS twice, centrifuge at 500 × g for 8 min at 4 °C
with acceleration, deceleration curves at (9,9).
7. Count cells with hemocytometer and tryphan blue and
re-suspend at one million cells/mL (see Note 3).
8. If needed, separate cells for RNA and DNA analysis prior to
FACS staining.
9. One million cells/Eppendorf tube (Individual Eppendorfs for
RNA and DNA).
10. One million cells/tube (For FACS).
11. RNA and DNA storage (non-sterile).
12. Centrifuge cells at 900 × g for 3 min.
13. Pipette off supernatant.
14. Store DNA pellet at −80 °C.
15. Re-suspend RNA pellet in 350 μL of RLT + βME buffer
(RNeasy kit, Qiagen) and store at −80 °C.

3.1.2 Staining of Cells 1. Place approximately 1 × 106 cells/tube. Prepare the following
for CD45 and Pro- tubes for CD45 and Pro-Collagen Iα1 staining (see Note 4):
Collagen-Iα1 Expression (a) No Stain.
(b) CD45 PE (2 μL) + Intracellular isotype control + FITC
labeled secondary antibody.
(c) CD45 PE (2 μL), Rat Anti-human Procol-I and FITC
labeled secondary antibody (1 μL).
 FACS-Based Detection of Circulating Human Fibrocytes 27

2. Centrifuge cells at 250 × g for 5 min at 4 °C with acceleration,

deceleration curves at (9,9).
3. Re-suspend cells in 100 μL of 10 % normal goat serum (NGS)
FACS Buffer and 5 μL/sample of FCR blocker (see Note 5).
4. Add appropriate antibodies (amount noted above) for extra-
cellular staining.
5. Incubate at 4 °C for 30 min.
6. Wash with FACS Buffer twice, centrifuge at 250 × g for 5 min
at 4 °C with acceleration, deceleration curves at (9,9).
7. Add 100–200 μL of cytofix/cytoperm buffer (BD
Biosciences) to remaining samples and incubate at 4 °C for
15 min (see Note 6).
8. Wash with PermWash buffer (P/W; BD Biosciences), centri-
fuge at 250 × g for 5 min at 4 °C with acceleration, deceleration
curves at (9,9).
9. Wash extracellular stains with FACS Buffer and intracellular
stains with P/W, centrifuge at 250 × g for 5 min at 4 °C with
acceleration, deceleration curves at (9,9) (see Note 7).
10. Re-suspend intracellular samples in 100 μL of P/W and add
1 μL of Pro-collagen Iα1 antibody to all applicable samples
and one 1 μL of isotype intracellular to all applicable samples
(see Note 8).
11. Incubate covered at 4 °C for 30 min.
12. Wash all with P/W, centrifuge at 250 × g for 5 min at 4 °C with
acceleration, deceleration curves at (9,9).
13. Add 100 μL of Alexa Fluor 488 dilution (1:500 Alexa Fluor
488 to P/W) to all intracellular samples.
14. Incubate at 4 °C for 30 min.
15. Wash with P/W then wash with FACS Buffer, centrifuge at
250 × g for 5 min at 4 °C with acceleration, deceleration curves
at (9,9).
16. Fix all intracellular samples with 100–200 μL of 4 % PFA and
store at 4 °C until flow cytometric analysis (see Note 9).

3.1.3 Flow Cytometry 1. Open Cell Quest, connect to the cytometer and make sure the
of Stained Samples setup box is checked.
2. Voltages for the FACS Calibur are set using the non-stain
control.
(a) Adjust the Forward Scatter (FSC) (controls lateral move-
ment of events on graph if FSC is x-axis) and Side Scatter
(SSC) (controls vertical tilt if SSC is y-axis) to record as
many of the cells of interest as possible.
28 Xinyuan Hu et al.

(b) Using histograms of each of the channels (FL1, FL3) or a

dot plot, adjust voltages so that the majority of events
occur between 0 and 101.
3. Compensations for the FACS Calibur are set using the single
color controls.
(a) Using the FITC control, adjust the compensation so that
the majority of events occur in the FITC channel (it will
bleed into PE).
(b) Using the PE control, adjust the compensations so that
the majority of events occur in the PE channel (it will bleed
into FITC and APC).
4. Uncheck the setup box, set the location to record all samples
to, and acquire all samples (including controls).

3.2 Analysis of Flow 1. Open the flow cytometry analysis software (in this case,
Cytometry Data FlowJo).
3.2.1 FACS Analysis 2. First a gate is set for all of the live cells based on the FSC and
for Fibrocytes SSC and applied to all samples (Fig 3a, see Note 10).

a 1k
FSC-Height. SSC-Height subset
b 104
73.6%
800 03
CD45-PE

600
SSC

02
400
01
200 FL1-FITC.FL2-CD45-PE subset
98.7%
0 100
0 200 400 600 800 1k 100 101 102 103 104
FSC-H::FSC-Height
FSC Intracellular Isotype-FITC
c 104 Q1 Q2
d 10 4
Q1 Q2
e 4 Q1 Q2
10 86.4%
99.4% 0.637% 99.5% 0.506% 13.6%

103 03 103
CD45-PE
CD45-PE
CD45-PE

102 02 102

101 01 101
Q4 Q3 Q4 Q3 Q4 Q3
0.00% 0.00% 0.00% 0.00% 0.00% 0.00%
100 100 100
100 101 102 103 104 100 101 102 103 104 100 101 102 103 104
Intracellular Isotype-FSC Pro-Coll α1-FITC Pro-Coll α1-FITC

Fig. 3 FACS-based identification of fibrocytes in human PBMCs. (a) The live cell gate is set based on forward
(FSC) vs. side scatter (SSC). (b, c) FITC-detected intracellular isotype control (X Axis) vs. Anti-CD45-PE (Y axis).
The negative gate for PE is set (b). PE-stained CD45+ve cells are selected and the negative gate for intracel-
lular FITC staining is chosen (c). (d) This gate is then applied to the sample stained with FITC-detected Pro-
Collagen- Iα1 (X Axis) vs. Anti-CD45-PE. The dual positive cells in the right upper quadrant represent fibrocytes.
The proportion of dual positive cells in the right upper quadrant in the negative control (c) is subtracted from
the proportion of dual positive cells in the sample stained with Pro-Collagen-Iα1 in a young (d) or aged (e)
subject to determine the overall percentage of double positive cells
 FACS-Based Detection of Circulating Human Fibrocytes 29

3. The negative gate for fibrocyte analysis is determined by stain-

ing a CD45-stained sample with intracellular isotype control
and secondary antibody (Fig. 3b).
4. Once the negative gate for Col-I staining of CD45+ cells is
established, this gating strategy should be applied to the
sample(s) of interest (Fig. 3c) (see Note 11).

4 Notes

1. Red blood cell lysis is also sometimes performed using brief

exposure to a hypotonic solution such as deionized water.
This approach has not been validated for detection of fibrocytes
and as such is not recommended.
2. The buffy coat will appear as a pale yellow layer of cells at the
interface between the plasma and blood layers. It is important
to avoid pipetting red blood cells into this layer as the presence
of red blood cells will make flow cytometry difficult.
3. If starting material is limited and there are not enough cells,
scale down all reagents as needed.
4. The combination of hematopoietic cell surface marker expression
such as CD45, LSP-1, or CXCR4 combined with intracellular
staining detecting production of ECM components such as
collagen, vimentin, or prolyl-4 hydroxylase is considered suffi-
cient for the detection of circulating fibrocytes. While CD45
and Procollagen co-expression has been classically used to
define fibrocytes, these other markers are acceptable as well
and the protocols described in this unit can be easily modified
for these markers.
5. The goat serum helps block nonspecific staining and is a critical
aspect of performing this protocol properly.
6. The initial permeabilization is an absolute necessity due to the
intracellular nature of the collagen staining. If permeabiliza-
tion is not achieved the protocol will not work and fibrocytes
will not be detected.
7. From here on, all antibodies should be diluted in perm/wash
solution to maintain a permeabilized membrane.
8. It is critical that an intracellular isotype antibody be included as
a control. The permeabilization step causes a pronounced
increase in autofluorescence that may be incorrectly interpreted
as collagen staining if the correct control is not included.
9. If flow cytometry is not performed immediately, cells should
be maintained in fixation solution such as paraformaldehyde,
at 4 ° C in the dark. The fluorescence of cells increases when
samples are stored in this manner so in order to avoid detection
30 Xinyuan Hu et al.

artifact, all controls and experimental tubes should be fixed

and stored identically.
10. Selection of live cells based on FSC vs. SSC is critical. Dead or
dying cells demonstrate increased autofluorescence and inclu-
sion of these cells in the gating strategy will cause increased
overall brightness that might be erroneously captured as actual
staining.
11. It is crucial that consistent populations be analyzed for each
sample. Thus it is recommended that rather than manually
applying the CD45/Pro-ColIα1 gate to each sample, that the
gate be established on the CD45/isotype intracellular control
and automatically applied to the subsequent sample.
12. The most commonly encountered challenge is the inherent
autofluorescence of unstained cells in subjects with undiag-
nosed inflammatory disease. While in normal individuals the
inherent autofluorescence of the unstained cells will be low,
some subjects may exhibit increased baseline autofluorescence,
which is likely due to alterations in the phenotypes of circulat-
ing leukocytes. When this challenge is encountered, use of an
isotype control stain prepared from the diseased individual can
be helpful. Otherwise this shift in autofluorescence may be
incorrectly interpreted as intracellular staining.
13. Fibrocyte quantities are reported as the percentage of total
PBMCs or as concentrations (fibrocytes per mL of blood). The
former is calculated by using the gating strategy shown in Fig. 3
and subtracting CD45/intracellular isotype from CD45/
Pro-Col Iα1 staining. The latter is calculated by dividing the
Post-Ficoll cell count by the input mLs of blood to derive cells per
mL. Then this value is multiplied by the percentage of cells in the
live cell gate based on FSC vs SSC, and then by the CD45/
Pro-Col Iα1 subtracted CD45/intracellular isotype staining.
14. The extracellular matrix proteins used to identify fibrocytes are
intracellular stains requiring fixation and permeabilization.
Therefore, in vitro functional studies are impossible to perform
on fibrocytes detected in this manner. For detailed methods
allowing the isolation and characterization of live human fibro-
cytes, the reader is referred to reference [56].
15. Most reagents are prepared as stock solutions, stored at 4 or at
−80 °C, and used in aliquots. Reagents stored in a −20 °C frost
free freezer may be damaged due to recurrent freeze–thaw cycles.

Acknowledgements

This work was supported in part by grants R01 HL109033, U01

HL112702-01 (both to E.L.H) from the National Institutes of
Health.
 FACS-Based Detection of Circulating Human Fibrocytes 31

References

1. Murray PJ, Wynn TA (2011) Protective and 15. Schmidt M, Sun G, Stacey MA et al (2003)
pathogenic functions of macrophage subsets. Identification of circulating fibrocytes as pre-
Nat Rev Immunol 11:723–737 cursors of bronchial myofibroblasts in asthma.
2. Murray LA, Rubinowitz A, Herzog EL (2012) J Immunol 171:380–389
Interstitial lung disease: is interstitial lung dis- 16. Wang CH, Huang CD, Lin HC et al (2008)
ease the same as scleroderma lung disease? Increased circulating fibrocytes in asthma with
Curr Opin Rheumatol 24:656–662 chronic airflow obstruction. Am J Respir Crit
3. Homer RJ, Elias JA, Lee CG et al (2011) Care Med 178:583–591
Modern concepts on the role of inflammation 17. Nihlberg K, Larsen K, Hultgardh-Nilsson A
in pulmonary fibrosis. Arch Pathol Lab Med et al (2006) Tissue fibrocytes in patients with
135:780–788 mild asthma: A possible link to thickness of
4. Gross TJ, Hunninghake GW (2001) Idiopathic reticular basement membrane? Respir Res
pulmonary fibrosis. N Engl J Med 345: 7:50
517–525 18. Vakil V, Sung JJ, Piecychna M et al (2009)
5. Bucala R, Spiegel LA, Chesney J et al (1994) Gadolinium-containing magnetic resonance
Circulating fibrocytes define a new leukocyte image contrast agent promotes fibrocyte differ-
subpopulation that mediates tissue repair. Mol entiation. J Magn Reson Imaging 30:
Med 1:71–81 1284–1288
6. Reilkoff RA, Bucala R, Herzog EL (2011) 19. Falk E (2006) Pathogenesis of atherosclerosis.
Fibrocytes: emerging effector cells in chronic J Am Coll Cardiol 47:C7–C12
inflammation. Nat Rev Immunol 11:427–435 20. Nikam VS, Wecker G, Schermuly R et al
7. Galligan CL, Siminovitch KA, Keystone EC (2011) Treprostinil inhibits adhesion and dif-
et al (2009) Fibrocyte activation in rheumatoid ferentiation of fibrocytes via camp and rap
arthritis. Rheumatology (Oxford) 49: dependent erk inactivation. Am J Respir Cell
640–651 Mol Biol 45:692–703
8. Douglas RS, Afifiyan NF, Hwang CJ et al 21. Murray LA, Chen Q, Kramer MS et al (2010)
(2009) Increased generation of fibrocytes in Tgf-beta driven lung fibrosis is macrophage
thyroid-associated ophthalmopathy. J Clin dependent and blocked by serum amyloid p.
Endocrinol Metab 95:430–438 Int J Biochem Cell Biol 43:154–162
9. Peng X, Mathai SK, Murray LA et al (2011) 22. Phillips RJ, Burdick MD, Hong K et al (2004)
Local apoptosis promotes collagen production Circulating fibrocytes traffic to the lungs in
by monocyte-driven cells in transforming response to cxcl12 and mediate fibrosis. J Clin
growth factor β1-induced lung fibrosis. Invest 114:438–446
Fibrogenesis Tissue Repair 4:12–25 23. Kisseleva T, Uchinami H, Feirt N et al (2006)
10. Mathai SK, Gulati M, Peng X et al (2010) Bone marrow-derived fibrocytes participate in
Circulating monocytes from systemic sclerosis pathogenesis of liver fibrosis. J Hepatol 45:
patients with interstitial lung disease show an 429–438
enhanced profibrotic phenotype. Lab Invest 24. Niedermeier M, Reich B, Gomez RM et al
90:812–823 (2009) Cd4+ t cells control the differentiation
11. Gan Y, Reilkoff RA, Peng X et al (2011) Role of gr1+ monocytes into fibrocytes. Proc Natl
of semaphorin 7a signaling in transforming Acad Sci U S A 106:17892–17897
growth factor β1-induced lung fibrosis and 25. Katebi M, Fernandez P, Chan ES et al (2008)
scleroderma-related interstitial lung disease. Adenosine a2a receptor blockade or deletion
Arthritis Rheum 63:2484–2494 diminishes fibrocyte accumulation in the skin
12. Moeller A, Gilpin SE, Ask K et al (2009) in a murine model of scleroderma, bleomycin-
Circulating fibrocytes are an indicator for poor induced fibrosis. Inflammation 31:299–303
prognosis in idiopathic pulmonary fibrosis. Am 26. Haudek SB, Cheng J, Du J et al (2010)
J Respir Crit Care Med 179:588–594 Monocytic fibroblast precursors mediate fibro-
13. Mehrad B, Burdick MD, Zisman DA et al sis in angiotensin-ii-induced cardiac hypertro-
(2006) Circulating peripheral blood fibrocytes phy. J Mol Cell Cardiol 49:499–507
in human fibrotic interstitial lung disease. 27. Haudek SB, Xia Y, Huebener P et al (2006)
Biochem Biophys Res Commun 353:104–108 Bone marrow-derived fibroblast precursors
14. Mehrad B, Burdick MD, Strieter RM (2009) mediate ischemic cardiomyopathy in mice.
Fibrocyte cxcr4 regulation as a therapeutic tar- Proc Natl Acad Sci U S A 103:18284–18289
get in pulmonary fibrosis. Int J Biochem Cell 28. Haudek SB, Trial J, Xia Y et al (2008) Fc recep-
Biol 41:1708–1718 tor engagement mediates differentiation of
32 Xinyuan Hu et al.

cardiac fibroblast precursor cells. Proc Natl 39. Bianchetti L, Barczyk M, Cardoso J et al
Acad Sci U S A 105:10179–10184 (2012) Extracellular matrix remodeling prop-
29. Buday A, Orsy P, Godo M et al (2010) erties of human fibrocytes. J Cell Mol Med
Elevated systemic tgf-beta impairs aortic vaso- 3:483–495
motor function through activation of nadph 40. Abe R, Donnelly SC, Peng T et al (2001)
oxidase-driven superoxide production and Peripheral blood fibrocytes: differentiation path-
leads to hypertension, myocardial remodel- way and migration to wound sites. J Immunol
ing, and increased plaque formation in 166:7556–7562
apoe(−/−) mice. Am J Physiol Heart Circ 41. Pilling D, Buckley CD, Salmon M et al (2003)
Physiol 299:H386–H395 Inhibition of fibrocyte differentiation by serum
30. Xu J, Gonzalez ET, Iyer SS et al (2009) Use of amyloid p. J Immunol 171:5537–5546
senescence-accelerated mouse model in 42. Castano AP, Lin SL, Surowy T, Nowlin BT
bleomycin-induced lung injury suggests that et al (2009) Serum amyloid p inhibits fibrosis
bone marrow-derived cells can alter the out- through fc gamma r-dependent monocyte-
come of lung injury in aged mice. J Gerontol A macrophage regulation in vivo. Sci Transl Med
Biol Sci Med Sci 64:731–739 1:5ra13
31. Scholten D, Reichart D, Paik YH et al (2011) 43. Bellini A, Marini MA, Bianchetti L et al (2011)
Migration of fibrocytes in fibrogenic liver Interleukin (il)-4, il-13, and il-17a differen-
injury. Am J Pathol 179:189–198 tially affect the profibrotic and proinflamma-
32. Zhang H, Maric I, DiPrima MJ, Khan J, tory functions of fibrocytes from asthmatic
Orentas RJ, Kaplan RN, Mackall CL (2013) patients. Mucosal Immunol 5:140–149
Fibrocytes represent a novel MDSC subset cir- 44. Shao DD, Suresh R, Vakil V et al (2008)
culating inn patients with metastatic cancer. Pivotal advance: Th-1 cytokines inhibit, and
Blood 122:1105–1113 th-2 cytokines promote fibrocyte differentia-
33. Van Deventer HW, Wu PQ, Bergsstralh DT, tion. J Leukoc Biol 83:1323–1333
Davis BD, O’Connor BP, Ting J, Serody JS 45. Moore BB, Murray L, Das A et al (2006)
(2008) C-C chemokine receptor 5 on pulmo- The role of ccl12 in the recruitment of fibro-
nary fibrocytes facilitates migration and pro- cytes and lung fibrosis. Am J Respir Cell Mol
motes metastasis via matrix metalloproteinase Biol 35:175–181
9. Am J Pathol 173:253–264 46. Sakai N, Wada T, Yokoyama H et al (2006)
34. Van Deventer HW, Palmieri DA, Ping Q, Secondary lymphoid tissue chemokine (slc/
McCook EC, Serody JS (2013) Circulating ccl21)/ccr7 signaling regulates fibrocytes in
fibrocytes prepare the lung for cancer metasta- renal fibrosis. Proc Natl Acad Sci U S A
sis by recruiting Ly-6C+ monocytes via CCL2. 103:14098–14103
J Immunol 190:4861–4867 47. Quan TE, Cowper S, Wu SP et al (2004)
35. Yang L, Scott PG, Giuffre J et al (2002) Circulating fibrocytes: Collagen-secreting cells
Peripheral blood fibrocytes from burn patients: of the peripheral blood. Int J Biochem Cell
identification and quantification of fibrocytes Biol 36:598–606
in adherent cells cultured from peripheral 48. Lazova R, Gould Rothberg BE, Rimm D et al
blood mononuclear cells. Lab Invest 82: (2009) The semaphorin 7a receptor plexin c1
1183–1192 is lost during melanoma metastasis. Am J
36. Pilling D, Fan T, Huang D et al (2009) Dermatopathol 31:177–181
Identification of markers that distinguish 49. Chesney J, Metz C, Stavitsky AB et al (1998)
monocyte-derived fibrocytes from mono- Regulated production of type i collagen and
cytes, macrophages, and fibroblasts. PLoS inflammatory cytokines by peripheral blood
One 4:e7475 fibrocytes. J Immunol 160:419–425
37. Chesney J, Bacher M, Bender A et al (1997) 50. Balmelli C, Alves MP, Steiner E et al (2007)
The peripheral blood fibrocyte is a potent Responsiveness of fibrocytes to toll-like
antigen-presenting cell capable of priming receptor danger signals. Immunobiology 212:
naive t cells in situ. Proc Natl Acad Sci U S A 693–699
94:6307–6312 51. Hartlapp I, Abe R, Saeed RW et al (2001)
38. Bellini A, Mattoli S (2007) The role of the Fibrocytes induce an angiogenic phenotype
fibrocyte, a bone marrow-derived mesenchy- in cultured endothelial cells and promote
mal progenitor, in reactive and reparative fibro- angiogenesis in vivo. FASEB J 15:
ses. Lab Invest 87:858–870 2215–2224
 FACS-Based Detection of Circulating Human Fibrocytes 33

52. Sultana H, Neelakanta G, Foellmer HG et al myxomatous mitral valve degeneration. Pathol

(2012) Semaphorin 7a contributes to west nile Res Pract 201:301–304
virus pathogenesis through tgf-beta1/smad6 55. Kraman M, Bambrough PJ, Arnold JN et al
signaling. J Immunol 189:3150–3158 (2010) Suppression of antitumor immunity by
53. Barth PJ, Ebrahimsade S, Hellinger A et al (2002) stromal cells expressing fibroblast activation
Cd34+ fibrocytes in neoplastic and inflammatory protein-alpha. Science 330:827–830
pancreatic lesions. Virchows Arch 440:128–133 56. Quan TE, Bucala R (2007) Culture and analy-
54. Barth PJ, Koster H, Moosdorf R (2005) sis of circulating fibrocytes. Methods Mol Med
Cd34+ fibrocytes in normal mitral valves and 135:423–434
 Chapter 4

Experimental Approaches to Tissue Injury

and Repair in Advanced Age
Aleah L. Brubaker, Stewart R. Carter, and Elizabeth J. Kovacs

Abstract
Cutaneous wound healing is a complex physiological process. This process can be altered by multiple
physiological and pathological factors. Multiple pathophysiological disturbances act to impair resolution of
cutaneous wound injury, including obesity, diabetes, peripheral vascular disease, and advanced age. As our
longevity increases without a concomitant increase in healthy living years, it is plausible to assume that
problematic wound closure will continue to consume a large portion of our health care resources.
Furthermore, advanced age is associated with numerous alterations in the innate and adaptive immune
responses that complicate outcomes following cutaneous injury, trauma, or infection. Thus, models that
examine the impact of advanced age on cutaneous wound repair will be of great benefit to the develop-
ment of potential therapeutics that target age-related aberrancies in tissue repair. Herein, we detail two
animal models of tissue injury, excisional wound injury and burn injury, that can be used to evaluate
wound healing in the context of advanced age. We also describe modifications of these methods to exam-
ine wound infection following either excisional or burn injury. Lastly, we discuss methods of subsequent
tissue analysis following injury. Models described below can be further adapted to genetically engineered
murine strains to study the effects of aging and other co-morbidities on wound healing.

Key words Wounding healing, Animal model, Aging, Excisional biopsy, Burn injury, Infection

1 Introduction: Aging and Cutaneous Wound Healing

Cutaneous wound healing is a complex physiological process

comprised of three primary phases: the inflammatory, proliferative,
and remodeling phases [1, 2]. The inflammatory phase begins
immediately following tissue injury. Platelets at the wound site act
to aid in hemostasis and degranulate to release a host of pro-
inflammatory mediators. Simultaneously, antimicrobial peptides
released from cutaneous keratinocytes help to provide direct bacte-
ricidal activity following tissue injury. These mediators, alongside the
cytokines and chemokines released from damaged keratinocytes
and resident tissue leukocytes, aid in recruitment of innate immune
cells to help prevent microorganism contamination and infection [3].
Early in the inflammatory phase, neutrophils predominate, helping

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_4, © Springer Science+Business Media New York 2015

35
36 Aleah L. Brubaker et al.

phagocytose pathogens and debris [4]. Macrophages then enter

the wound bed to aid in phagocytosis, eventually undergoing a
phenotypic shift in order to facilitate the transition to the prolifera-
tive phase [5]. During the proliferative phase, keratinocytes aid in
re-epithelialization by migrating over the open wound bed to
restore the epidermis. Concurrent deposition of immature colla-
gen by fibroblasts and angiogenesis help to restore the dermal
architecture and vascularity of the injured tissue, creating a provi-
sional extracellular matrix [6, 7]. Over time, the proliferative phase
gives way to the remodeling phase, where the initial type III col-
lagen is replaced with type I collagen, which improves the tensile
strength of the wound [2]. Additionally, the developing vascula-
ture is pruned to form an efficient vascular network. Timely pro-
gression through these phases is required for efficient wound
healing. Alterations in any of these phases of wound healing can
impair wound closure, resulting in a range of clinical complications
from infection to chronic wounds to excessive scar formation.
Currently, it is estimated the U.S. health care system spends
25 billion dollars treating chronic wounds and related complica-
tions [8]. Multiple pathophysiological disturbances act to impair
resolution of cutaneous wound injury, including obesity, diabe-
tes, peripheral vascular disease, and advanced age [8–10]. Of
note, the average human lifespan continues to lengthen, with a
growing number of individuals greater than 65. Moreover, the
aforementioned co-morbidities are on the rise, compromising
healthy living years in this aging population [11]. As our longev-
ity increases without a concomitant increase in healthy living
years, it is plausible to assume that problematic wound closure
will continue to consume a large portion of our health care
resources. Furthermore, advanced age is associated with numer-
ous alterations in the innate and adaptive immune responses that
complicate outcomes following cutaneous injury, trauma or
infection [12, 13]. Thus, models that examine the impact of
advanced age on cutaneous wound repair will be of great benefit
to the development of potential therapeutics that target age-
related aberrancies in tissue repair.
Herein, we detail two animal models of tissue injury, exci-
sional wound injury and burn injury, that can be used to evaluate
wound healing in the context of advanced age. These models were
selected based on clinical reports of impaired wound healing,
increased wound dehiscence and worse outcomes following burn
trauma in elderly patients [8, 9, 14, 15]. We also describe modifi-
cations of these methods to examine wound infection following
either excisional or burn injury. Lastly, we discuss methods of sub-
sequent tissue analysis following injury. Models described below
can be further adapted to genetically engineered murine strains to
study the effects of aging and other co-morbidities on wound
healing.
 Experimental Approaches to Tissue Injury and Repair in Advanced Age 37

Fig. 1 Excisional wound by punch biopsy. Lift the skin in the mid-dorsal line and fold over a hockey puck (a). Push
the punch biopsy tool through the folded skin, such that the puck is visible on the other side. This will create a
wound on each side of the dorsal midline (b). Repeat this procedure for the desired number of wounds (c)

1.1 Excisional Excisional wound injury models allow for evaluation of the phases
Wound Healing of wound healing outlined above. In these models, a full thickness,
cutaneous injury results in removal of the murine epidermis,
dermis, hypodermis and the smooth muscle layer known as the
panniculus carnosus. Depending on the interest of the researchers,
the number and size of wounds can be varied using a standard
dermal punch biopsy. Briefly, young and aged mice of the desired
strains and age ranges are anesthetized and the fur is removed
either by shaving with an electric animal clipper, hair removal
cream or plucking. The skin is then lightly cleansed with ethanol,
and the wounds are induced by lifting the murine skin in the dorsal
midline and folding it over a hockey puck. Then 2–6 wounds, from
3 to 8 mm in diameter, can be created using dermal punch biop-
sies, allowing for symmetrical and identical sized wounds on either
side of the dorsal midline (Fig. 1). This method also allows for full
excision of the epidermis, dermis, hypodermis, and panniculus car-
nosus as mentioned above. Mice can then be sacrificed at early
(3 h–3 days), mid (5–10 days), or late (14 days onward) time
points to evaluate the different phases of wound repair described
above [1, 2]. At sacrifice, wounds are removed with a larger punch
biopsy than used to injure the animal to allow for consistent
removal of intact skin around the wound margin (Fig. 2). During
dissection of the pelt of the mouse, it is important to carefully
remove the tissue around the wound site to ensure removal of the
entire wound matrix. This requires special attention during the
early phases of wound repair when the granulation tissue is easily
disrupted. After removal of the tissue, the wounds can be analyzed
as detailed later in the chapter.

1.2 Burn Wound Similar to perturbations in excisional or incisional cutaneous injury

Healing with aging, advanced age is also associated with worse outcomes
following burn trauma. Though improvements in clinical manage-
ment over the past few decades have improved the mortality
38 Aleah L. Brubaker et al.

Fig. 2 Wound harvesting. Carefully dissect the dorsal pelt from the mouse using scissors and forceps (a). Using
scissors, cut around the wound site to ensure inclusion of all granulation tissue. Using forceps, provide counter
traction while cutting directly on top of the muscular layer to include epidermis, dermis, hypodermis, and
panniculus carnosa (b). Place the excised specimen on a hockey puck (c). Using a punch biopsy 2 mm larger
than the size used to inflict the wounds, remove the wound tissue and surrounding wound margins (d–e)

following burn injury in elderly patients over 65, clinical outcomes

are still mediocre compared to young counterparts [14, 16].
In addition to direct cutaneous insult, burn injury also results in
significant systemic inflammation and subsequent pulmonary com-
plications, such as pneumonia and acute respiratory distress syn-
drome, which are particularly devastating in the elderly patient
[17–19]. Thus, the model described within not only allows for
direct comparison of burn wound healing with age, but also allows
for evaluation of the systemic complications associated with burn
trauma and aging. Briefly, young and aged mice of the age ranges
delineated previously are anesthetized and the fur is removed as
mentioned above. The mice are weighed and then placed in a burn
template (Fig. 3) that represents ~12–15 % of their total body
Experimental Approaches to Tissue Injury and Repair in Advanced Age 39

Fig. 3 Scald burn apparatus and burn template. The apparatus consists of a metal
container for water, heating plate, templates, and paper towels for drying mice
after burn injury. The template is selected based on mouse weight in order to
achieve a 12–15 % total body surface area burn. The inferior surface of the
template has a portion removed that corresponds to the needed size. Hardware
cloth is used to reinforce the bottom of the template

Fig. 4 Scald burn administration. Immerse the dorsum, template lined area of
the mouse in the water bath for 8 s. Push gently on the abdomen to ensure the
dorsum of the animal is flush with the burn template. The tail should remain out
of the template and above the water

surface area (TBSA). The mice are then immersed in a 90–92 °C

water bath to produce a ~12–15 % TBSA full thickness, scald injury
(Fig. 4). Using this method, the damage encompasses the epi-
dermis, dermis, hypodermis, and the murine panniculus carnosa.
Mice can be sacrificed at similar time points as those used for exci-
sional wound healing to evaluate the wound closure, as well as
systemic inflammation and complications associated with burn
trauma. It is important to note that in the absence of excisional
debridement and grafting, the wound will heal significantly by con-
tracture and fibrosis. At sacrifice, wounds are removed with an 8 mm
punch biopsy which encompasses half of the burn wound tissue and
half of the uninjured tissue just proximal to the burn site.
40 Aleah L. Brubaker et al.

2 Materials

2.1 Prototypical 1. BALB/c: Young 10–16 weeks, Aged 18–22 months [20, 21].
Animal Strains 2. C57BL/6: Young 8–14 weeks, Aged 25–32 months [22].
in Aging Studies
3. CBA: Young 8–14 weeks, Aged 25–27 months [23].

2.2 Excisional 1. Anesthesia solution: Ketamine (100 mg/mL solution), xylazine

Wound Injury (100 mg/mL) and sterile saline. Prior to injury, combine 1 mL
and Isolation of stock ketamine, 0.2 mL of stock xylazine and 3.8 mL of
of Wound Tissue sterile, 0.9 % normal saline in a sterile 15 mL polypropylene
conical tube. Mix by inverting the tube.
2. Sterile, 0.9 % normal saline, warmed to 37 °C.
3. Sterile alcohol prep pads.
4. Electric animal hair clippers with #40 blade.
5. Single-use, sterile, 25 G, 1 mL tuberculin syringes.
6. 3 mm punch biopsy for wounding (Acuderm Inc., Fort
Lauderdale, FL).
7. Hockey puck.
8. Scissors and forceps.
9. 5 mm punch biopsy for removal of wounds and adjacent tissue
from dorsal skin pelt (Acuderm Inc., Fort Lauderdale, FL).
10. Analytical balance and weigh boats.
11. Single use, straight edge razors (Personna America Safety
Razor Co., Verona, VA).
12. Paper towels.
13. Examination gloves.
14. Heating pads.

2.3 Burn Wound 1. Anesthesia solution: Ketamine (100 mg/mL solution), xylazine
Injury and Isolation (100 mg/mL) and sterile saline. Prior to injury, combine 1 mL
of Wound Tissue of stock ketamine, 0.2 mL of stock xylazine and 3.8 mL of
sterile, 0.9 % normal saline in a 15 mL polypropylene conical
tube. Mix by inverting the tube.
2. Sterile 0.9 % normal saline, warmed to 37 °C (Hospira Inc.,
Lake Forest, IL).
3. Electric animal hair clippers (see Subheading 2.2).
4. Hot plate.
5. Thermometer.
6. Two Metal pans with lid (1 quart, ~21.5 × 11.5 cm pans, Fisher
Scientific, Pittsburgh, PA).
7. Deionized water.
 Experimental Approaches to Tissue Injury and Repair in Advanced Age 41

8. Single-use, sterile, 1 mL tuberculin syringes with 25 G needles

Burn injury template (Fig. 3).
9. 8 mm punch biopsy for removal of burn tissue and adjacent
tissue from dorsal skin pelt (Acuderm Inc., Fort Lauderdale,
FL).
10. Analytical balance and weigh boats.
11. Single use straight edge razors (Personna America Safety Razor
Co., Verona, VA).
12. Paper towels.
13. Examination gloves.
14. Stop watch or timer.
15. Heating pads.
16. Blunt dissecting scissors.
17. Forceps.

2.4 Subsequent Bacterial colonization

Tissue Analysis:
1. 5 mL polypropylene, round bottom tubes.
Excisional Wounds
and Burn Wounds 2. Sterile PBS.
3. Rotor-stator homogenizer.
4. Agar plates for desired bacteria (i.e., MSA for S. aureus and
centrimide for P. aeruginosa).
5. Sterile plate spreaders.
6. Incubator.

2.5 Preparation 1. Digital Canon EOS SLR Camera.

for Measurement 2. Camera stand.
of Wound Closure by
3. Metric ruler.
Pixels
4. Hockey puck.
5. Adobe Photoshop Version 7.0 (Adobe Systems Inc., San Jose, CA).

2.6 Preparation 1. 24-well tissue culture dishes.

for Wound Cell 2. Dispase Solution: 5 mL of RPMI 1640 culture media contain-
Isolation for Flow ing 10 % fetal bovine serum (FBS), 2 mM L-glutamine, 1 %
Cytometry penicillin/streptomycin, 3 mL of dispase II at 1 mg/mL
(Roche Diagnostics, Indianapolis, IN), 2 mL of gentamicin
sulfate at 10 mg/mL.
3. Plate shaker at 4 °C.

2.7 RNA Isolation 1. Liquid nitrogen.

from Wound Tissue 2. 1.7 mL Eppendorf tubes.
3. RNA Easy Kit (Qiagen, Valencia, CA).
42 Aleah L. Brubaker et al.

2.8 Protein Isolation 1. Liquid nitrogen.

from Wound Tissue 2. 1.7 mL Eppendorf tubes.
3. 5 mL polypropylene tubes (BD Falcon, Bedford, MA).
4. Acrodisc filter, 1.2 mm, 32 mm (Utech Products,
Schenectady, NY).
5. 1 mL sterile tuberculin syringes with 25 G needle.
6. BioRad Lysis Buffer (Lysis Buffer, Factor 1 and Factor 2;
BioRad, Hercules, CA).
7. Ice and dry ice.

2.9 OCT Embedding 1. Tissue-Tek O.C.T compound (Sakura Finetek, Torrance, CA).
of Wound Tissue 2. Straight edge razor (Personna America Safety Razor Co.,
Verona, VA).
3. Disposable base molds, 15 mm × 15 mm × 5 mm (Fischer
HealthCare, Houston, TX).

2.10 Formalin 1. 10 % formalin.

Fixation 2. Tissue-Tek Uni-cassette (Sakura Finetek, Torrance, CA).
of Wound Tissue
3. Straight Edge Razor (Personna America Safety Razor Co.,
Verona, VA).

2.11 Immunofluo- 1. Superfrosted PLUS slides (Fischer Scientific, Pittsburgh, PA).

rescent Staining 2. PAP pen (Sigma-Aldrich, St. Louis, MO).
of Wound Tissue
3. 4 % paraformaldehyde (PFA) in sterile PBS, filtered, 37 °C
Sterile PBS, filtered.
4. Normal Goat Serum (NGS, Jackson ImmunoResearch, West
Grove, PA), or serum that is appropriate given the speciation
of the secondary antibody in use.
5. Bovine Serum Albumin (BSA, Sigma-Aldrich, St. Louis, MO).
6. Primary and secondary antibodies of interest.
7. VectaShield Hard Set Mounting Media with DAPI (Vector Labs,
Burlingame, CA).
8. Coverslips.

3 Methods

All animal procedures and protocols must be reviewed and

approved by the Institutional Animal Care and Use Committee
(IACUC) in the investigator’s home institution and researchers
must be appropriately trained and qualified to carry out the proce-
dures below.
 Experimental Approaches to Tissue Injury and Repair in Advanced Age 43

3.1 Excisional 1. Prepare anesthesia mixture fresh prior to use as described

Wound Injury (see Subheading 2.2 above) and load into a single use syringe.
and Isolation Weigh the mice. For a 20–25 g mouse, 100 μL of solution will
of Wound Tissue result in 100 mg/kg ketamine/10 mg/kg xylazine as desired.
2. Grasp the mouse at the nape of the neck and tail. Tilt the head
of the mouse downwards. Inject desired volume of anesthetic
intraperitoneally (i.p.) in the left lower quadrant based on the
weight of the animals to achieve 100 mg ketamine/10 mg
xylazine as desired.
3. Following injection of the anesthesia, inject 1 mL of warmed,
sterile saline i.p. in the left lower quadrant. This promotes
distribution of the anesthetic and prevents dehydration as
the full effects of anesthesia can last upwards of 3 h. Return the
mouse to a clean cage and allow for the anesthesia to take
effect, ~5 min.
4. Once the mouse no longer responds to firm pressure applied
to the hind limb, shave the dorsum with animal clippers.
Alternate methods of hair removal mentioned above can be
used but will not be discussed here.
5. Cleanse the shaved area with an alcohol prep pad. Be sure to
cleanse the entire area but do not douse the mouse in ethanol
as excessive ethanol can perturb the epidermal barrier. Allow
the ethanol to evaporate.
6. Lift the skin in the mid-dorsal line and fold over a hockey puck
(Fig. 1a). Using a 3 mm (or size desired) dermal punch biopsy,
push punch biopsy tool through the folded skin, such that a
wound on each side of the dorsal midline is created (Fig. 1b).
Repeat this procedure for the desired number of wounds
(Fig. 1c). With 3–5 mm dorsal punch biopsies, we suggest creat-
ing 4–6 wounds per mouse. We recommend limiting larger
wounds, 6 mm or greater, to two wounds per mouse dorsum.
7. Return the mice to clean cages on heating pads and allow for
recovery from anesthesia (~3–4 h). Given that these studies
involve the evaluation of the inflammatory stages of wound
healing, no analgesics are given as they can interfere with the
inflammatory immune process.
8. Sacrifice mice by CO2 inhalation at desired time point to evaluate
the various phases of wound healing: Inflammatory (3 h to 3
days), Proliferative (3–14 days), Remodeling (14 days and
onwards). These time delineations will be variable to a certain
degree depending on the initial size of the wound.
9. To harvest the wounds, carefully dissect the dorsal pelt from
the mouse using scissors and forceps (Fig. 2a, b). Ensure that
when removing tissue around the wound site to include all
granulation tissue. This requires patience particularly at early
44 Aleah L. Brubaker et al.

time points when the granulation tissue and wound matrix is

still delicate.
10. Place the pelt on a hockey puck (Fig. 2c). Then, use a punch
biopsy 2 mm larger than the size used to inflict the wounds to
remove the wound tissue and surrounding wound margins
(Fig. 2d, e). If evaluating wound size, photograph the pelt at a
fixed distance with a metric ruler in the plane of the photo.
Process the tissue as described below.

3.2 Burn Wound 1. Prepare anesthesia mixture prior to use on day of injury as
Injury and Isolation described in Subheading 3.1 and load into single use syringe.
of Wound Tissue Weigh the mice. For a 20–25 g mouse, 100 μL of solution will
result in 100 mg/kg ketamine/10 mg/kg xylazine as desired.
2. Grasp the mouse at the nape of the neck and tail. Tilt the head
of the mouse downwards. Inject desired volume of anesthetic
i.p. in the left lower quadrant based on the weight of the animals
to achieve 100 mg ketamine/10 mg xylazine as desired.
3. Prepare the water bath by filling two metal containers with
deionized water. Heat one container to 90–92 °C for scald
burn injury. Keep the thermometer in the water bath at all times
to ensure the temperature remains tightly controlled from
mouse to mouse. The second container will be maintained at
ambient temperature for sham injury (Fig. 3).
4. Once the mouse no longer responds to firm pressure applied
to the hind limb, shave the dorsum with an electric clipper.
Be sure to shave over the entire area of anticipated injury, from
the nape of the neck to the tail. Shave beyond where the injury
itself will be placed, as skin will contract after burn. Alternate
methods of hair removal mentioned above can be used but will
not be discussed here.
5. Based on the animal’s weight, select the appropriate burn tem-
plate to give a 12–15 % total body surface area (TBSA) burn
(Fig. 3). When placing the mouse in the burn template, ensure
that the dorsum of the animal is flush with the burn template
by gently pushing on the abdomen. Ensure the tail remains out
of the template and above the water.
6. Immerse the dorsum, template lined area of the mouse in the
water bath for 8 s (Fig. 4). Watch the timer carefully to
ensure the time in the water is a constant 8 s for each mouse.
We recommend this temperature and timing to ensure a full
thickness burn.
7. Immediately remove the mouse and blot the dorsal scald area
with a paper towel to prevent continued scald injury.
8. Resuscitate the mouse by injecting 1 mL of warmed, sterile
saline i.p. in the left lower quadrant.
 Experimental Approaches to Tissue Injury and Repair in Advanced Age 45

9. Return the mouse to a clean cage and place the cages on heat-
ing pads for 3–4 h, or until the mice are aroused from anesthe-
sia. Given that these studies involve evaluation the inflammatory
stages of wound healing, no analgesics are given as they can
interfere with the inflammatory immune process.
10. Sacrifice mice by CO2 inhalation at desired time point to evalu-
ate the various phases of wound healing as delineated above.
11. To harvest the wounds, carefully dissect the dorsal pelt from
the mouse. Remove an extra 4 mm of tissue from the margin
of the burn wound to include all granulation tissue.
12. Place the pelt on a hockey puck. Use a 5–8 mm punch biopsy
to remove the burn tissue at the wound margin, such that half
of the punch biopsy contained burn wound and the remaining
half contains intact skin from the wound margin.
13. Process the tissue as described below.

3.3 Models 1. Follow the steps above under Subheading 3.1 through step 6.
of Combined Wound 2. Immediately after injury, pipette desired CFU/mL in 10 μL
Injury and Infection: directly into each open wound bed. Be sure to change pipette
Excisional Wound tips between each wound on a given mouse.
Injury (a) S. aureus growth and inoculation: S. aureus of the desired
and Staphylococcus strain can be grown overnight in tryptic soy broth (TSB) at
aureus Infection 37 °C under constant agitation. The next day, 1 mL of S.
aureus in TSB is resuspended in 2 mL fresh TSB and incu-
bated at 37 °C for 2 h under constant agitation to ensure
mid-logarithmic growth at the time of application to cuta-
neous wounds. Bacterial concentration (CFU/mL) is then
determined by absorbance at 600 nm and the final inocu-
lum confirmed by back-plating on mannitol salt agar (MSA;
BD Diagnostics, Sparks, MD).
3. Resume the protocol under Subheading 3.1 at step 7.
Evaluation of bacterial colonization at the time of sacrifice is
described below.

3.4 Burn Wound 1. Follow the steps above under Subheading 3.2 through step 8.
Injury and Topical (a) P. aeruginosa growth and inoculation: P. aeruginosa of the
Pseudomonas desired strain can be grown overnight on centrimide agar
aeruginosa Infection plates (BD Diagnostics, Sparks, MD) at 37 °C. The next day,
inoculate sterile saline with one loop of P. aeruginosa from
centrimide agar plate. Bacterial concentration (CFU/mL)
is then determined by absorbance at 600 nm and the final
inoculum confirmed by back-plating on centrimide agar
plates (BD Diagnostics, Sparks, MD).
2. After towel drying the mouse to prevent further scald injury,
slowly pipette desired bacteria concentration in CFU/mL in
46 Aleah L. Brubaker et al.

100 μL directly onto the burn wound surface. (Note: A larger

volume is used in the burn injury protocol secondary to the
larger surface are of injury as compared to the individual
wounds in the cutaneous punch biopsy model). Be sure to
change pipette tips between each wound on a given mouse.
3. Resume the protocol under Subheading 3.2 at step 9.
Evaluation of bacterial colonization at the time of sacrifice is
described below.

3.5 Subsequent 1. Prior to euthanizing animals, place 1 mL of sterile PBS in each

Tissue Analysis: tube, with one tube per animal. Place tube on ice.
Excisional Wounds 2. After harvesting the wounds from individual animals, place
and Burn Wounds one wound in a 1 mL saline-filled tube. Maintain the tube on
Bacterial Colonization ice until all harvesting is complete.
(a) Note: You may choose to weigh each wound as to express
your final data as CFU/gm of tissue. If you do not weigh
your tissue, you will express your data as CFU/mL or
CFU/wound.
3. Using the rotor-stator homogenizer, homogenize the wound
in saline. Maintain the tube on ice during homogenization.
4. Directly plate 20 μL of homogenate onto agar plates in duplicate.
Spread with sterile plate spreaders.
5. Next create 1:10 serial dilutions of the homogenate. The number
of serial dilutions created will depend on the initial bacterial
inoculum and expected growth. We recommend creating 8
serial dilutions of 1:10 for your initial experiments.
6. Plate each serial dilution in duplicate.
7. Incubate plates for 24–48 h depending on the bacterial species
utilized.
8. Following incubation, count the colonies on each agar plate.
Be sure to multiply the colony count on a given plate by the
dilution factor. Average these colony counts to obtain the
CFU/20 μL and then multiply this by a factor of 50 to obtain
the CFU/mL (or per wound). If expressing the data as per
gram of tissue, multiply by the gram weight of the wound mea-
sured (see Note 1).

3.6 Measurement 1. Attach the digital camera onto the camera stand at a fixed
of Wound Closure by distance above the height of the hockey puck. We recommend
Digital Photography a fixed distance of 20 cm.
and Image Analysis 2. Remove the dorsal pelt as described above in Subheading 3.2.
3. Place the pelt flat on the hockey puck. Align a metric ruler with
the wounds in the frame of the photograph.
 Experimental Approaches to Tissue Injury and Repair in Advanced Age 47

4. Photograph the pelt including all wounds in a single image.

5. Using Adobo Photoshop 7.0 (Adobe Systems Inc., San Jose, CA)
determine the number of pixels in the open wound area using
the magic wand tool, with zoom at 100 % and a tolerance set-
ting of 60.
6. As controls, a separate set of animals should be sacrificed
immediately following wound injury and wound size deter-
mined to represent day 0.
7. Each wound area at each time point is then compared with
average pixels of day 0 wounds such that: [(individual wound
pixels at day greater than day 0)/(averaged pixels of day 0
wounds) × 100] is used to determine the percent open wound
area at each time point.
8. The individual wounds of each animal are then averaged to
give one value for the open wound area for the animal.
Example: If an animal has six wound sites, the % open area of
each wound would be calculated as above, and then the wounds
from that animal would be calculated as the average of the %
open area of all six wounds (sum of % open wound are of
six wounds divided by 6). Thus, the average of six wounds is
an N of one individual animal.

3.7 Wound Cell A detailed procedure for isolation and staining of wound cells can be
Isolation for Flow found in our previously published manuscript [24]. The procedure
Cytometry below only details the initial processing for tissue for flow cytom-
etry following wound excision. Details of subsequent processing
and staining can be carried out as described [24].
1. Prepare “Dispase Solution.”
2. Remove dorsal pelt and excise wounds from mice at desired
time-points following excisional cutaneous injury as described
above. Be sure to not use any ethanol in washing of the pelt as
ethanol may disrupt the cell membrane and promote lysis. If
you wish to wash the pelt, do so in sterile PBS.
3. Collect 2–3 wounds per animal and determine weight of sam-
ples in grams.
4. Mince wounds into small pieces (<2 mm × 2 mm) with a
straight razor.
5. Place wound pieces into a 24-well culture plate (1 well/
animal) filled with 15.4 mL “Dispase Solution”/gram of tissue
(see Note 2).
6. Incubate plate overnight at 4 °C on a rotating shaker at a gentle
setting.
7. Follow remaining step as outlined [24].
48 Aleah L. Brubaker et al.

3.8 RNA Isolation 1. Immediately following removal of the wound tissue, add 1–2
from Wound Tissue wounds to a 1.7 mL Eppendorf tube and snap freeze in liquid
nitrogen.
2. Store at −80 °C until ready to process tissue for RNA.
3. Using the RNA Easy Kit (Qiagen), isolate RNA as per the
manufacturer’s instructions (see Note 3).

3.9 Protein Isolation 1. Prepare Lysis Buffer: 9.9 mL BioRad Lysis Buffer, 40 μL
from Wound Tissue BioRad Factor I, 20 μL BioRad Factor 2, and 40 μL PMSF.
2. Place frozen tissue samples on dry ice.
3. Add 1 mL of Lysis Buffer to each polypropylene tube and keep
on wet ice.
4. Using forceps, remove tissue and place in polypropylene tube
and homogenize for 30 s until no tissue bits are left. Return to
ice bucket.
5. Spin the polypropylene tubes at 300 × g at 4 °C for 5 min.
6. Transfer the supernatant to 1.7 mL Eppendorf tubes.
7. Sonicate samples at a 30 % setting for 10 s.
8. Centrifuge at 4 °C for 10 min at 2655 × g (5000 rpm using
an Eppendorf centrifuge 5417 R, Eppendorf, Hamburg,
Germany).
9. Remove the supernatant, avoiding the pellet, with a 1 mL
single-use syringe.
10. Filter the supernatant through a 25 μM single use syringe filter
into a clean 1.7 mL Eppendorf tube. Maintain tube on ice.
11. Aliquot sample into fresh 1.7 mL Eppendorf tubes.
12. Snap freeze in liquid nitrogen and store at −80 °C until use.

3.10 OCT Embedding 1. Place a small amount of OCT compound into the Tissue Tray.
of Wound Tissue Allow to lightly cover the bottom of the cassette.
2. Using the straight razor, cut the outer 1/3 of wound.
3. Place the wound so the straight edge is flush with edge of tis-
sue cassette.
4. Cover the tissue with OCT, avoiding bubbles.
5. Freeze immediately by placing cassette on dry ice.
6. Store at −80 °C until use.

3.11 Formalin 1. Fill a plastic container with 10 % formalin.

Fixation 2. Using the straight razor, cut the outer 1/3 of the wound.
of Wound Tissue
3. Place the wound in the tissue cassette.
4. Place the tissue cassette in the formalin bath.
5. Store at room temperature until use.
 Experimental Approaches to Tissue Injury and Repair in Advanced Age 49

3.12 Immunofluo- 1. Remove stored frozen tissue in OCT.

rescent Staining 2. Section wound tissue at 3–8 μm onto Superfrosted Plus slides.
of Wound Tissue We recommend sectioning tissue at 5 μm.
3. Place sections in a humidified chamber at room temperature
for 2 h.
4. Encircle sections with PAP pen.
5. Fix tissue sections in 4 % PFA (filtered, 37 °C) for 15 min. Tap
off PFA.
6. Wash with sterile PBS three times for 5 min, tapping off PBS
between washes (see Note 4).
7. Block with 10 % BSA and 3 % Normal Goat Serum (or normal
serum of the species of the secondary antibody) in sterile PBS
for 1 h at room temperature.
8. Tip slides to remove blocking solution. Do not wash the tissue
sections after removal of the blocking solution.
9. Gently add ~100 μL of the primary antibody diluted in PBS to
each tissue section. Note it will be important to titrate the pri-
mary antibody to an appropriate concentration (see Note 5).
Incubate the slide in the primary antibody overnight at
4 °C. Be sure to include appropriate positive and negative
controls.
10. Tap off the primary antibody. Wash the tissue sections three
times with sterile PBS for 5 min each, tapping of PBS between
each wash.
11. Incubate with secondary antibody diluted in PBS (titrated to
the desired concentration) for 1 h at room temperature (see
Note 6). Protect the slides from direct light.
12. Tap off the secondary antibody. Wash the slides three times for
5 min each in sterile PBS, tapping off PBS between washes.
13. Let slides air dry and then place 2–4 drops of VectaShield
Mounting Media with DAPI nuclear stain on the slide and
cover slip. Avoid air bubbles. Seal cover slip to slide with clear
nail polish. Once completely dried, store samples at 4 °C.
14. Visualize tissue with fluorescent microscope of choice.

4 Notes

1. This calculation can be confusing without additional explanation.

The wound is homogenized in 1 mL of sterile saline. 20 μL of this
solution is then plated following 1:10 serial dilutions. As an
example, say 40 colonies grew on the 103 serial dilution—thus,
40 × 1000 would be 4 × 104 CFU/20 μL. Multiplying this value
by 50 will transform this in CFU/mL or 2 × 106 CFU/mL.
50 Aleah L. Brubaker et al.

2. Again this calculation can be confusing without further

explanation. The average 3 mm wound with a 5 mm excision
perimeter weight from 0.015 to 0.025 g per wound. As an
example, assume all wounds weigh 0.02 g and multiple this
value by the number of wounds that are used per isolation, for
example three wounds, and this yields 0.06 g of tissue.
Extending the calculation, if using the concentrations given
above, then 15.4 mL of the dispase solution per gram of tissue
is 15.4 × 0.06 results in 924 μL.
3. We recommend using two wounds for RNA analysis to ensure
enough RNA is isolated for subsequent PCR analysis. We also
recommend homogenizing the tissue with a rotor-stator
homogenizer, taking care to rinse the homogenizer between
each sample with ethanol.
4. We recommend performing all the washes with PBS with the
slides horizontal position, such that you gentle pipette the PBS
on and gently tap it off, rather than in a vertical position as you
would if they were to wash the slides in Coplin jars. We found
that this results in better retention of tissue on the Superfrosted
plus slides.
5. Antibody titration will be dependent of the antibody and
manufacturer. However, in our experience, the recommended
concentration by the manufacturer tends to result in significant
non-specific binding and high background. We recommend
starting at half the concentration recommended by the manu-
facturer and then performing a 1:2 serial dilution.
6. Of note, it is important to have three control slide: (a) tissue
that was blocked but received no antibody, (b) tissue that was
blocked and stained with the primary antibody only, and (c)
tissue that was blocked and stained with the secondary antibody
only. The first two serve as negative controls as no fluorescent
signal should be detected, the third allows you to determine the
specificity of the secondary antibody for the primary antibody
and the amount of background staining that is not specific.
Significant signal on the third slide suggests: (a) poor blocking
by the blocking solution, (b) poor affinity of the secondary
antibody for the primary antibody, or (c) too high of a concen-
tration of the secondary antibody.

Acknowledgements

The authors thank Jessica Palmer for her critical review and discussion
of this manuscript. This work was supported by NIH R21
AI073987 (E.J.K.), R01 AG018859 (E.J.K.), T32 AG031780
(P.L.W.), T32 GM008750 (R.L.G.) and by the Dr. Ralph and
Marian C. Falk Medical Research Trust (E.J.K.).
 Experimental Approaches to Tissue Injury and Repair in Advanced Age 51

References
1. Singer AJ, Clark RA (1999) Cutaneous wound 14. Slater H, Gaisford JC (1981) Burns in older
healing. N Engl J Med 341:738–746 patients. J Am Geriatr Soc 29:74–76
2. Reinke JM, Sorg H (2012) Wound repair and 15. Linn BS (1980) Age differences in the severity
regeneration. Eur Surg Res 49:35–43 and outcome of burns. J Am Geriatr Soc 28:
3. Gillitzer R, Goebeler M (2001) Chemokines in 118–123
cutaneous wound healing. J Leukoc Biol 16. Clayton MC, Solem LD, Ahrenholz DH
69:513–521 (1995) Pulmonary failure in geriatric patients
4. Kim MH, Liu W, Borjesson DL et al (2008) with burns: the need for a diagnosis-related
Dynamics of neutrophil infiltration during group modifier. J Burn Care Rehabil 16:
cutaneous wound healing and infection using 451–454
fluorescence imaging. J Invest Dermatol 17. Ely EW, Wheeler AP, Thompson BT et al
128:1812–1820 (2002) Recovery rate and prognosis in older
5. Daley JM, Brancato SK, Thomay AA et al persons who develop acute lung injury and the
(2010) The phenotype of murine wound mac- acute respiratory distress syndrome. Ann Intern
rophages. J Leukoc Biol 87:59–67 Med 136:25–36
6. Nissen NN, Polverini PJ, Koch AE et al (1998) 18. Dancey DR, Hayes J, Gomez M et al (1999)
Vascular endothelial growth factor mediates ARDS in patients with thermal injury. Intensive
angiogenic activity during the proliferative phase Care Med 25:1231–1236
of wound healing. Am J Pathol 152:1445–1552 19. Le HQ, Zamboni W, Eriksson E et al (1986)
7. Swift ME, Kleinman HK, DiPietro LA (1999) Burns in patients under 2 and over 70 years of
Impaired wound repair and delayed angiogen- age. Ann Plast Surg 17:39–44
esis in aged mice. Lab Invest 79:1479–1487 20. Nomellini V, Brubaker AL, Mahbub S et al
8. Sen CK, Gordillo GM, Roy S et al (2009) (2012) Dysregulation of neutrophil CXCR2
Human skin wounds: a major and snowballing and pulmonary endothelial ICAM-1 promotes
threat to public health and the economy. age-related pulmonary inflammation. Aging
Wound Repair Regen 17:763–771 Dis 3:234–247
9. Kaye KS, Anderson DJ, Sloane R et al (2009) 21. Birjandi SZ, Ippolito JA, Ramadorai AK et al
The effect of surgical site infection on older (2011) Alterations in marginal zone macro-
operative patients. J Am Geriatr Soc 57:46–54 phages and marginal zone B cells in old mice.
10. Vowden KR, Vowden P (2009) The preva- J Immunol 186:3441–3451
lence, management and outcome for patients 22. Zook EC, Krishack PA, Zhang S et al (2011)
with lower limb ulceration identified in a Overexpression of Foxn1 attenuates age-
wound care survey within one English health associated thymic involution and prevents the
care district. J Tissue Viability 18:13–19 expansion of peripheral CD4 memory T cells.
11. Christensen K, Doblhammer G, Rau R et al Blood 118:5723–5731
(2009) Ageing populations: the challenges 23. Bhattacharyya TK, Thomas JR (2004)
ahead. Lancet 374:1196–1208 Histomorphologic changes in aging skin:
12. Brubaker AL, Palmer JL, Kovacs EJ (2011) observations in the CBA mouse model. Arch
Age-related dysregulation of inflammation and Facial Plast Surg 6:21–25
innate immunity: lessons learned from rodent 24. Brubaker AL, Schneider DF, Palmer JL, Faunce
models. Aging Dis 2:346–360 DS, Kovacs EJ (2011) Wound cell isolation for
13. Panda A, Arjona A, Sapey E et al (2009) flow cytometric and functional analysis neutro-
Human innate immunosenescence: causes and phils and natural killer T cells as negative regula-
consequences for immunity in old age. Trends tors of wound healing. J Immunol Methods
Immunol 30:325–333 373:161–166
 Chapter 5

Multicolor Digital Flow Cytometry in Human

Translational Immunology
Samit R. Joshi, Subhasis Mohanty, and Albert C. Shaw

Abstract
By facilitating the simultaneous analysis of parameters from diverse cell lineages and biological pathways,
multicolor flow cytometry is integral to many studies in human immunology—particularly those in older
individuals—where sample amounts may be limiting. Studies in human cohorts require particular attention
to fluorochrome panel design and procedures to standardize instrument performance; reproducible instru-
ment conditions (over time and between centers) are crucial to accurate comparisons and conclusions in
the analysis of heterogeneous groups of human subjects. Here, we describe procedures for multicolor digi-
tal flow cytometry, our experience in flow cytometry panel design and our approach in standardizing
instrument performance using BD Biosciences hardware and software (BD Biosciences, San Jose, CA).
These techniques allow for the generation of accurate and precise data in a variety of settings.

Key words Multicolor flow cytometry, Translational immunology, Application settings, Flow cytometry
standardization, Flow cytometry panel design

1 Introduction

Multicolor digital flow cytometry expands the opportunities for

investigators to conduct translational immunological studies par-
ticularly in the context of limited samples (commonly encountered
with human samples in general and with samples in studies of aging
in particular). An increasing number of fluorochromes and anti-
bodies, and advances in instrumentation/software have facilitated
a growing number of applications; however, experimental design
remains complex because of the need to maintain sample resolu-
tion in the context of controlling spillover in complex compensa-
tion matrices [1]. Thus, the optimal antibody panel for a given
application depends upon variables such as: cytometer configuration,
the type of sample (and the types/numbers of cells), and availability
of flurochrome-conjugated antibodies [2].

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_5, © Springer Science+Business Media New York 2015

53
54 Samit R. Joshi et al.

Here, we describe techniques our laboratory uses routinely,

such as in the study of innate immune system parameters in freshly
isolated PBMCs stimulated ex-vivo from patients. Specifically, we
describe flow cytometry experimental design and processes for
standardizing instrument performance using our center’s experi-
ence with BD Biosciences hardware and software (BD Biosciences,
San Jose, CA). We will not discuss sample preparation and staining
which have been described in detail elsewhere [2, 3]. Rather, we
focus on several practical “highlights” of this tool. Many of the
techniques described below were utilized in several manuscripts
and can be adapted for use in other applications [4, 5]. Ultimately,
accurate and standardized data generated using these techniques
are important in conducting large-scale (multicenter) translational
studies.

2 Methods

2.1 Selection 1. The investigator should identify the specific cytometer, available
of Color Matrix lasers, and installed filters at their institution. This information
can be entered into an online spectral viewer allowing for an
approximation of the spectral overlap between wavelengths
(e.g. http://www.bdbiosciences.com/research/multicolor/
spectrum_viewer/index.jsp). In our experience, employing
more than 8–9 colors can lead to an increase in spectral overlap
and subsequent difficulties in compensation. However, others
have developed 15-color panels with success [6]. Consider that
even though an instrument may support n colors, given the
need to maintain resolution of populations, optimal panel design
may only employ a portion of the available colors (e.g. n − 2).
Sufficient time should be dedicated to panel design to optimize
results (see Note 1).

2.2 Selection 1. After identifying available fluorochromes, determine antibodies

of Antibodies for the desired cell surface and intracellular markers of interest;
the investigator should note which markers are relatively more
important to their desired application than others. Some inves-
tigators advocate factoring in antigen density (number of
molecules/cell) and whether the antigen is distinct or has a
range of expression. One can consider prioritizing bright fluo-
rochromes (e.g. PE or APC) on dim antigens (and more dim
fluorochromes such as FITC or Alexa-700 paired with more
abundant antigens) [7]. Consider using a site (e.g. http://
www.biocompare.com) to conduct a screen of available anti-
bodies for a given antigen. Keeping cost and antibody qual-
ity in mind, creating a matrix of fluorochromes and various
cellular markers can aid in experimental design and maximize
 Digital Flow Cytometry 55

the number of interrogated cellular targets (see Note 2).

Arrive at a final list of cell surface and/or intracellular anti-
bodies and obtain trial sizes of the desired antibodies from
the manufacturers.

2.3 Optimizing 1. While all antibody manufacturers suggest a working dilution of

Antibody antibody, the investigator should always take the opportunity
Concentration to optimize antibody concentration for their application. For
for Staining each new antibody, one can try several dilutions (e.g. 1:10,
1:50, 1:100) on the cells of interest (see Note 3). For cellular
targets with relatively low baseline expression (e.g. inflamma-
tory cytokines), consider using conditions similar to your
experimental protocol. For example, our experimental timeline
for interrogating dendritic cells requires 2 h of stimulation
with TLR ligands followed by the addition of Brefeldin A and
4 additional hours of incubation [4]. Accordingly, when opti-
mizing our intracellular antibody concentration for assessing
production of a given pro-inflammatory cytokine, we will con-
duct the antibody concentration optimization trial following
the same experimental conditions. Additionally, the optimal
dilution should be tested on approximately the same number
of cells that will be present in the experimental sample.
Consider using the dilution at which the Mean Fluorescence
Intensity plateaus (on a histogram plot) (see Note 4).
2. Once optimal antibody concentrations have been developed,
carry out a trial experiment using experimental conditions with
the full antibody panel to evaluate panel performance and
identify, in the early stages, possible refinements to the steps
above [6] (see Note 5).

2.4 Create 1. Since many institutions, including our own, use BD Flow
Application Settings Cytometers (BD Biosciences, San Jose, CA), we will take this
opportunity to briefly describe key features in BD FACSDiva
v6.0 software. Like many others, our center utilizes Cytometer
Setup and Tracking (CST) beads for reproducible instrument
setup and tracking of performance on a daily basis. We find this
leads to decreased variability and improved data quality. Using
the information gathered from the CST baseline cytometer
support, Application settings can be established for a particular
assay. We find the use of Application settings allows for consis-
tent settings, less spillover, higher resolution, and more repro-
ducible data by automatically adjusting Photomultiplier Tube
(PMT) voltages based upon daily instrument performance. In
our experience, the use of both Application settings and CST
beads will keep a consistent Mean Fluorescence Intensity
(MFI) for a particular parameter over time despite any potential
minor variations in instrument performance. This is particularly
56 Samit R. Joshi et al.

Fig. 1 Sample cytometer baseline report. Red arrows indicate baseline maximum linearity and electronic noise
rSD for each respective parameter, respectively. The operator should calculate one-half the maximum linearity
and 2.5–3× the rSD (this can be done separately on paper or using computer software)

important for data accuracy and consistency when frequently

running clinical samples over a long period of time or between
multiple centers (see Note 6).
2. First, using information gathered from the cytometer baseline
report (see Fig. 1), separately calculate 2.5–3× the baseline
robust standard deviation of the electronic noise (rSD) and
one-half of the baseline maximum linearity for each desired
parameter. This will optimize resolution by keeping the nega-
tive population above the background electronic noise and the
positive population below the maximum of the range in which
the relation between MFI and PMT voltage is linear.
3. For our experiments, we prepare freshly isolated unstained
human PBMCs and also stain (with one color) PBMCs with
anti-CD8 antibodies. For most fluorochromes (including
Alexa 700, FITC, APC-Cy7, PerCP, and APC) we use 10 μl of
stock antibody. However, for PE and PE-Cy7 we use a 5 μl
1:10 dilution (in PBS alone) and for PE-Texas Red we prefer a
5 μl 1:100 dilution (in PBS alone) (see Note 7).
4. Next, we create a new experiment with all of the desired param-
eters (adding or deleting as necessary). For human PBMCs, we
prefer to set the Forward Scatter (FSC) threshold to 10,000
(see Inspector—Cytometer settings, Thresholds tab). In Fig. 2,
the global worksheet is arranged with a scatter plot gating on
the lymphocyte population (P1). This population (P1) will be
used to evaluate the unstained and stained (for CD8+) PBMCs
through histograms and related statistics. Create one table of
statistics for rSD that will be later used when recording
unstained cells (Fig. 3).
 Digital Flow Cytometry 57

Fig. 2 Lymphocyte gate (P1) in global worksheet. Note adjustments using FSC,
SSC, and actual gate can be adjusted when acquiring PBMCs

Fig. 3 Table of statistics (rSD). Creation of a table of statistics only with rSD values (red arrow). Notice how our
sample experiment only uses six flurochromes
58 Samit R. Joshi et al.

Fig. 4 Adjust parameter voltage. While recording events, the voltage of each parameter can be adjusted
individually (red arrow)

5. Use unstained PBMCs to record approximately 2000 events.

Adjust the voltage of each flurochrome (Fig. 4) to ensure the
rSD statistic for that flurochrome in P1 (the lymphocyte
gate) is inside a range of 2.5–3× the baseline standard deviation
of the electronic noise value (calculated above in step 2).
On a practical note, it is easier for the operator to focus on
one flurochrome at a time; this process can be repeated when
the voltage for any parameter is optimized (creating a new
tube after each adjustment) until all voltages for all parameters
reflect their respective rSD to be within a range of 2.5–3×
the baseline standard deviation of the electronic noise (Fig. 5)
(see Note 8).
6. Create another table of statistics for medians (Fig. 6) and a
histogram for each parameter (showing the P1 population)
with an interval gate located on the bright (CD8+) population
(P2 for the first parameter, P3 for the second parameter, etc.)
for their respective fluorochromes (Fig. 7) (see Note 9). Next,
use the single fluorochrome-stained PBMCs to ensure the
median is one-half the baseline maximum linearity (calculated
above in step 2) for the respective populations (P2, P3, etc.).
This can be accomplished by adjusting only the voltage of the
parameter corresponding to the actively recorded single
fluorochrome-stained PBMCs for CD8+. For example, if using
v450-stained CD8+ PBMCs, only adjust the v450 voltage to
 Digital Flow Cytometry 59

Fig. 5 Using unstained PBMCs to optimize voltage based on 2.5–3× the baseline rSD. A new tube (red arrow)
is created after each adjustment of the voltage for the respective parameter’s rSD (in this case V450, green
arrow) to be within 2.5–3× the baseline value

Fig. 6 Table of statistics (median) creation of a new table of statistics only with median values (red arrow)
60 Samit R. Joshi et al.

Fig. 7 Creation of individual histograms. Creation of individual histograms for each respective parameter (each
with their own gate on their own bright population) showing only the P1 population (in our case PBMCs stained
for CD8 using a v450-conjugated antibody, red arrow). Note: prior to running the single flurochrome stained
PBMCs, this is a reasonable estimate of where the bright CD8+ population will be. This can be modified during
acquisition of the PBMCs (see Fig. 8)

ensure the median statistic of the PBMC CD8+ v450 popula-

tion is within one-half the baseline maximum linearity for the
relative population (i.e. P2, Fig. 8). If using APC-stained CD8+
PBMCs, adjust only the APC voltage to ensure the PBMC
CD8+ APC population median statistic is within one-half
the baseline maximum linearity for the relative populations
(i.e. P3, Fig. 9). Repeat this process for the remaining fluoro-
chromes (see Note 10).
7. Finally, right click on cytometer settings, save, and name
Application settings. The instrument may ask whether the user
wishes to apply a modified threshold; our response is yes. New
Application settings should be created if conditions change,
such as: a new instrument baseline is obtained, new CST bead
 Digital Flow Cytometry 61

Fig. 8 Individual histogram when recording PBMCs stained with a v450-conjugated CD8+ antibody. The table
of statistics shows the Median (P2 gate) of PBMCs stained for CD8 using a v450-conjugated antibody, red
arrow. Notice how the initial position of the P2 gate has changed from Fig. 7 to the actual position of the bright
population

lot is used, or hardware (lasers/filters) is changed. Running

CST beads on a routine basis will inform the operator whether
the cytometer is performing optimally.

2.5 Run 1. When conducting a new experiment, first apply the Application
Compensation settings to the experiment by right clicking on cytometer
settings and then clicking on Application settings. The optimized
voltages (created above) will be imported.
2. Use unstained PBMCs and single color stained CompBeads (BD
Biosciences, San Jose, CA) to create a compensation matrix.
With the designated Application settings, we find we do not
need to further adjust our PMT voltages and subsequent
spectral overlap should be optimized. With low spillover the
operator should achieve the best resolution possible. Finally,
the operator can record their experiment.
62 Samit R. Joshi et al.

Fig. 9 Individual histogram when recording PBMCs stained with APC-conjugated CD8+ antibody. The table of
statistics shows the Median (P3 gate) of PBMCs stained for CD8 using a APC-conjugated antibody, red arrow.
Again, notice how the P3 gate is on the bright population

3 Notes

1. The operator may need to revisit this critical planning step if

subsequent difficulties in population resolution are found in
the planned experimental conditions. If in doubt and assuming
enough sample is available, a conservative number of parameters
should be chosen.
2. Our experiments utilize a relatively fixed number of PBMCs iso-
lated. Thus in order to maximize our data output, we use the matrix
to plan for a panel of extracellular targets and a separate panel for
intracellular targets using the same experimental conditions.
 Digital Flow Cytometry 63

3. We generally find relatively bright fluorochromes require

greater dilution (for example with PE-Texas red we use a 1:100
dilution).
4. This can be accomplished by staining a fixed number of cells of
interest in various dilutions of a single fluorochrome. When
performing this evaluation, we do not apply Application settings
or a compensation matrix.
5. Although we could follow standard manufacturer recommenda-
tions for antibody dilution, these usually call for a vast excess in
antibody. While in theory excess unbound antibody can be
washed away, we have found on occasion that such concentra-
tions result in fluorescence that is beyond the linear range.
Consequently, we carry out our own titrations for each antibody
and repeat them for new lots of the same antibody clone.
6. We have applied some of these techniques to achieve accuracy
and precision across two highly similar instruments within our
institution. Generally, using guidance from BD Biosciences,
we identified the highest rSD and lowest maximum linearity
for matched parameters between instruments; next we used
these numbers for calculating 2.5–3× the rSD and one-half the
maximum linearity (see Subheading 2.4, step 2). We ultimately
found our experimental results to be reproducible across the
two instruments. In theory this approach could be used to
reproduce settings across remote locations. However, we rec-
ommend expert guidance from the instrument manufacturer
since a variety of factors need to be considered (e.g. model,
filters, lasers, etc.).
7. The unstained PBMCs will be used for adjusting parameter
voltage based on rSD and the stained PBMCs will be used for
adjusting parameter voltage based on maximum linearity. Most
of our procedures are conducted in 96-well round bottom
plates. To be efficient, we plate 1 × 106 PBMCs/well, centri-
fuge, and then flick out the supernatant. Our antibody staining
is then conducted on re-suspended cells within the well in anti-
body cocktails. For antibodies where we do not dilute, we
directly pipette antibody from the manufacturer’s tube to the
cells in the well.
8. This important step again highlights the need to have an ample
number of unstained PBMCs available. Also, it is expected that
the rSD values of already optimized parameters may slightly
change from tube to tube. This is acceptable as long as the
subsequent values are still within 2.5–3× the baseline value.
9. The operator can change the position of the respective interval
gates once the precise location of the bright peaks are known
when running the single color stained PBMCs.
64 Samit R. Joshi et al.

10. If substantial changes are made to the voltage of a particular

parameter when using the single colored PBMCs, consider
re-running unstained PBMCs to ensure that the rSD continues
to remain with 2.5–3× the baseline value. On very rare occa-
sions we have made the observation that the optimal voltage
for such a parameter must balance between the voltage settings
for these two individual variables.

Acknowledgements

Work in Dr. Shaw’s laboratory is supported, in part, by U19

AI089992, NIAID contract 272201100019C-3-0-1, K24
AG042489, and the Yale Claude D. Pepper Older Americans
Independence Center (P30AG021342). Additional support (to
S.J.) was from NIA T32 AG019134 and NIAID T32 AI007517.

References
1. Sugar IP, Gonzalez-Lergier J, Sealfon SC (2011) RR, Shaw AC (2010) Age-associated decrease
Improved compensation in flow cytometry by in TLR function in primary human dendritic
multivariable optimization. Cytometry A cells predicts influenza vaccine response. J
79(5):356–360. doi:10.1002/cyto.a.21062 Immunol 184(5):2518–2527. doi:10.4049/
2. Kalina T, Flores-Montero J, van der Velden VH, jimmunol.0901022
Martin-Ayuso M, Bottcher S, Ritgen M, Almeida 5. van Duin D, Allore HG, Mohanty S, Ginter S,
J, Lhermitte L, Asnafi V, Mendonca A, de Tute Newman FK, Belshe RB, Medzhitov R, Shaw
R, Cullen M, Sedek L, Vidriales MB, Perez JJ, te AC (2007) Prevaccine determination of the
Marvelde JG, Mejstrikova E, Hrusak O, expression of costimulatory B7 molecules in acti-
Szczepanski T, van Dongen JJ, Orfao A (2012) vated monocytes predicts influenza vaccine
EuroFlow standardization of flow cytometer responses in young and older adults. J Infect Dis
instrument settings and immunophenotyping 195(11):1590–1597. doi:10.1086/516788
protocols. Leukemia 26(9):1986–2010. 6. Mahnke YD, Roederer M (2007) Optimizing a
doi:10.1038/leu.2012.122 multicolor immunophenotyping assay. Clin Lab
3. Maino VC, Picker LJ (1998) Identification of Med 27(3):469–485. doi:10.1016/j.
functional subsets by flow cytometry: intracellu- cll.2007.05.002, v
lar detection of cytokine expression. Cytometry 7. Edinger M (2009) Multicolor flow cytometry—
34(5):207–215 principles of panel design. http://www.bd.
4. Panda A, Qian F, Mohanty S, van Duin D, com/videos/bdb/webinars/multicolor_flow_
Newman FK, Zhang L, Chen S, Towle V, principals_of_panel_design/. Accessed 21 Feb
Belshe RB, Fikrig E, Allore HG, Montgomery 2013
 Chapter 6

Flow Cytometry-Based Methods to Characterize Immune

Senescence in Nonhuman Primates
Christine Meyer*, Kristen Haberthur*, Mark Asquith*, and Ilhem Messaoudi

Abstract
Flow cytometry is an invaluable technique that can be used to phenotypically and functionally characterize
immune cell populations ex vivo. This technology has greatly advanced our ability to gain critical insight
into age-related changes in immune function, commonly known as immune senescence. Rodents have been
traditionally used to investigate the molecular mechanisms of immune senescence because they offer the
distinct advantages of an extensive set of reagents, the presence of genetically modified strains, and a short
lifespan that allows for longevity studies of short duration. More recently, nonhuman primates (NHPs), and
specifically rhesus macaques, have emerged as a leading translational model to study various aspects of
human aging. In contrast to rodents, they share significant genetic homology as well as physiological and
behavioral characteristics with humans. Furthermore, rhesus macaques are a long-lived outbred species,
which makes them an ideal translational model. Therefore, NHPs offer a unique opportunity to carry out
mechanistic studies under controlled laboratory conditions (e.g., photoperiod, temperature, diet, and med-
ications) in a species that closely mimics human biology. Moreover similar techniques (e.g., activity record-
ing and MRI) can be used to measure physiological parameters in NHPs, making direct comparisons
between NHP and human data sets possible. In addition, the outbred genetics of NHPs enables rigorous
validation of research findings that goes beyond proof of principle. Finally, self-selection bias that is often
unavoidable in human clinical trials can be completely eliminated with NHP studies. Here we describe flow
cytometry-based methods to phenotypically and functionally characterize innate immune cells as well as T
and B lymphocyte subsets from isolated peripheral blood mononuclear cells (PBMC) in rhesus macaques.

Key words Flow cytometry, Lymphocyte, B cell, T cell, Regulatory T cell, Rhesus macaque, Age,
Proliferation, Cytokine, Dendritic cell, Monocyte, Natural killer cell, Pattern recognition receptor

1 Introduction

The immune system can be broadly divided into two branches:

innate and adaptive. The innate immune system is poised to
respond rapidly to infection and is composed of several cell types
including monocytes/macrophages, dendritic cells (DC), natural
killer (NK) cells, and granulocytes. Adaptive immunity is medi-
ated primarily by T and B lymphocytes that require several days

*These authors made equal contributions to this work.

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_6, © Springer Science+Business Media New York 2015

65
66 Christine Meyer et al.

to generate responses tailored specifically for each pathogen.

The main distinguishing characteristic of these two branches of the
immune response is antigen recognition. Innate immunity relies
on germline-encoded receptors to sense the presence of patho-
gens, whereas adaptive immunity utilizes a highly diverse set of
receptors generated through somatic mutation and gene recombi-
nation. The second major defining and unique characteristic of the
adaptive immune system is the development of immunological
memory that manifests itself as increased functionality and fre-
quency of responding cells upon reexposure to the same antigen.
Aging results in several structural and functional changes in the
immune system that affect both innate and adaptive immunity.
These changes lead to a dysregulation of immune function and
increased vulnerability to infection. These complex changes are
grouped under the umbrella term “immune senescence”. In recent
years, the use of rhesus macaques in gerontology research has
increased dramatically. Several studies have shown that rhesus
macaques experience immune senescence in a similar fashion as
described for humans, thereby providing a robust translational
model to further our understanding of the mechanisms and impact
of immune senescence. In this chapter, we first outline several
staining protocols to allow: (1) discrimination of monocyte and
dendritic cells subpopulations as well as NK cells in peripheral
blood; (2) measurement of cytokine production by innate immune
cells; (3) delineation of major T and B cell subsets; (4) assessment
of the magnitude and kinetics of T and B cell proliferation; and (5)
measurement of the frequency of antigen-specific T cells.

2 Materials

1. RP10: RPMI 1640 medium (1×) supplemented with 10 %

fetal bovine serum and penicillin/streptomycin/L-glutamine
(100 U/ml penicillin, 100 μg/ml streptomycin/2 mM
L-glutamine).

2. 1× phosphate buffered saline.

3. Fixation buffer (containing 4 % paraformaldehyde; BioLegend).
4. PermWash 10× buffer (BioLegend): dilute to 1× (contains
0.1 % saponin) in diH2O.
5. Superperm: 1× PermWash buffer supplemented with 10 %
DMSO.
6. Antibodies (Tables 1, 2, 3 for a complete list of antibodies,
clones, and vendors).
7. Toll-like receptor (TLR) agonists: Escherichia coli K12
Lipopolysaccharide (LPS, 2 ng/ml) and Imiquimod (10 mg/
ml) (Invivogen).
Flow Cytometry of Immunosenescence in Non-Human Primates 67

Table 1
Innate cell antibody information for use in rhesus macaques

Marker Clone Manufacturer

AQUA Live/Dead – Invitrogen
CD3 Pacific Blue UCHT1 BD Biosciences
HLA-DR APC-Cy7 L243 BioLegend
CD14 Alexa Fluor 700 HCD14 BioLegend
CD8α PeCy5 B9.11 Beckman Coulter
CD16 PeCy7 3G8 BD Biosciences
CD20 ECD B9E9 BD Biosciences
CD123 PerCyP-Cy5.5 6H6 BioLegend
CD11c Alexa Fluor 647 3.9 BioLegend

Table 2
Intranuclear and intracellular antibody information
for use in rhesus macaques

Marker Clone Manufacturer

Ki67 FITC B56 BD Pharmingen
IFNy PeCy7 4S.B3 eBioscience
TNFα APC MAb11 eBioscience
IL-2 Alexa Fluor 700 MQ1-17H12 BioLegend
IL-17 Alexa Fluor 647 BL168 BioLegend
IL-6 APC MQ2-13A5 eBioscience
MIP-1β PE D21-1351 BD Pharmingen
IFNα FITC MMHA-11 PBL interferon source

8. Brefeldin A (BFA, Sigma).

9. Dimethyl sulfoxide solution (DMSO).
10. 96-well tissue-culture-treated round bottom plate (BD
Falcon).
11. Microtiter tubes.
12. Flow cytometer (LSRII or similar instrument).
13. Analytic software (e.g., FlowJo (TreeStar)).
68 Christine Meyer et al.

Table 3
Rhesus macaque B and T cell antibody panel

B cell panel Clone Manufacturer

CD3 Pacific Blue SP34-2 BD Biosciences
CD20 ECD B9E9 Beckman Coulter
CD27 APC O323 BioLegend
a
IgD Biotin Pooled antisera from goats hyperimmunized SouthernBiotech
with human IgD paraproteins
T cell panel
CD4 PerCp-Cy5.5 RPA-T4 BioLegend
CD8β ECD 2ST8.5H7 Beckman Coulter
CD25 APC-Cy7 BC96 BioLegend
CD28 PE CD28.2 BioLegend
CD95 Pacific Blue DX2 BioLegend
CD127 A647 A019D5 BioLegend
CCR7 PE-Cy7 3D12 BD Biosciences
a
Requires addition of secondary antibody conjugated to a fluorophore Streptavidin-BD Horizon V500 (BD biosciences)

3 Methods

3.1 Delineating The innate immune system is the first line of defense against patho-
Innate Immune Cells gens and its action is mediated by several immune cell subsets that
by Flow Cytometry include granulocytes (e.g., neutrophils), natural killer (NK) cells,
dendritic cells (DC), and monocytes/macrophages. Because little
information is available for rhesus macaque granulocytes, they are
not discussed here.
1. Add 2 × 106 peripheral blood mononuclear cells (PBMC) per
well in a 96-well round bottomed plate (see Notes 1 and 2).
Rhesus PBMC are isolated from whole blood by centrifuga-
tion over Ficoll (density 1.077) exactly as described for human
blood. PBMC yields per milliliter blood are also comparable
between rhesus and humans.
2. Add 150 μl of PBS to each well (washing step) and spin down
plate at 900 × g for 3 min. Discard the supernatant and briefly
vortex the plate (see Notes 3 and 4).
3. Repeat step 2 with 200 μl of PBS.
4. Add surface antibody cocktail described in Table 1 diluted to
50 μl of PBS (see Note 5) resuspend, and incubate for 20 min
at 4 °C in the dark.
 Flow Cytometry of Immunosenescence in Non-Human Primates 69

5. Add 150 μl of PBS to each well and spin down plate at 900 × g
for 3 min at 4 °C. Discard supernatant, and briefly vortex
plate.
6. Repeat step 5 with 200 μl of PBS.
7. Resuspend cells in 100 μl fixation buffer. Incubate for 30 min
at 4 °C (see Note 6).
8. Add 100 μl of PBS to each well, spin down at 900 × g for 3 min
at 4 °C, discard supernatant, and briefly vortex pellet. Repeat
this wash step with 200 μl of PBS.
9. Resuspend cells in 100 μl of PBS and transfer to microtiter
tubes for acquisition on flow cytometer. Samples may be
stored at 4 °C for up to 48 h until they can be acquired.
10. Acquire samples on LSR II or similar instrument and analyze
data using FlowJo or comparable software. Since monocytes
represent 3–5 % and DC 1–2 % of the PBMC, it is important
to acquire at least 1 × 106 events.
11. Following acquisition by flow cytometer, samples can be
analyzed as depicted in Fig. 1: First, exclude AQUA LIVE/
DEAD+ cells (dead), CD3 (T cells), and CD20 (B cells) to
define the live “non-lymph” population. From here, classical
monocytes are defined as CD14hiCD16- cells, whereas
nonclassical monocytes are defined as CD14loCD16+ cells [1];
DCs are defined as HLA-DR+CD14- cells and can be further
subdivided using CD123 and CD11c markers into CD123+
plasmacytoid DCs (pDCs) and CD11c+ myeloid DCs (mDCs)
[2]; NK cells are defined as CD14-HLA-DR-CD8α+ and can
be subdivided into a major CD16+ cytolytic population and a
minor CD16- cytokine-producing population. Two major
differences between human and rhesus macaque NK cells
should be noted here: (1) rhesus macaque NK cells, but not
human NK cells, express high-levels of CD8α [3]; and (2)
human but not rhesus macaque NK cells express CD56. CD56
is expressed by monocytes in rhesus macaques [4].

3.2 Analysis Functional changes in cytokine production by innate immune cells

of Innate Immune Cell can also be examined by flow cytometry [5]. Here we outline a
Cytokine Production protocol for examining cytokine production by monocytes and
dendritic cell subsets following stimulation with the Toll-Like
Receptor (TLR) agonists LPS (TLR4) and Imiquimod (TLR7) to
model stimulation with bacterial (TLR4) and viral (TLR7) patho-
gen associated molecular patterns (PAMPs), respectively [6].
1. Maintain sterile conditions by using a tissue culture hood and
fresh media to avoid microbial contamination of cell cultures.
2. Add 2 × 106 PBMC in 200 μl of RP10 into a 96-well round
bottomed plate (see Note 2). For each sample aliquot three
70 Christine Meyer et al.

a b c

CD20
non-lymph
FSC

SSC Live/Dead CD3

d e CD16+
monocytes

CD16
DC CD16-
monocytes
HLA-DR CD14

g f
pDC
IFNγ- Cytotoxic
CD8a

NK cells
CD123

NK cells

mDC

CD16 CD11c

Fig. 1 Delineation of innate immune cells using flow cytometry. Live PBMCs are discriminated by forward scat-
ter (FSC) and side scatter (SSC) measuring size and granularity, respectively (a), and Live/Dead gating (b). CD3
to CD20− cells are identified as non-lymph cells (c). Monocytes and DCs are HLA-DR+ (d). CD14 and CD16
co-staining can be used to delineate major monocyte/macrophage subpopulations (e). HLA-DR+ CD14− cells
can be gated to delineate DCs (e), which are further subdivided into CD123+ plasmacytoid DC (pDC) and
CD11c+ myeloid DCs (mDC) (f). NK cells are identified as HLA-DR− cells that are CD8α+ and are subdivided
into a major CD16+ cytotoxic subset and a minor CD16− IFNγ-producing subset (g)

wells (LPS, Imiquimod, and unstimulated control). Spin the

plate at 900 × g for 3 min. Discard supernatant and briefly vor-
tex plate (see Note 4).
3. Resuspend cells in 200 μl of either RP10/LPS solution, RP10/
Imiquimod solution, or RP10 alone. Incubate for 1 h in a
humidified incubator at 37 °C and 5 % CO2 (see Notes 7 and 8).
 Flow Cytometry of Immunosenescence in Non-Human Primates 71

4. Add 2 μl of Brefeldin A stock solution (500 μg/ml) to all wells

(see Note 9).
5. Incubate for an additional 5 h in a humidified incubator at
37 °C and 5 % CO2.
6. Spin down cells at 900 × g for 3 min. Discard supernatant and
vortex plate.
7. Add 200 μl of PBS to all wells. Spin down at 900 × g for 3 min.
Discard supernatant and vortex plate.
8. Repeat step 7 with 200 μl of PBS.
9. Add surface antibody cocktail described in Table 1 diluted to
50 μl of PBS (see Note 5) and incubate at 4 °C for 20 min in
the dark.
10. Add 150 μl of PBS to all wells. Spin down at 900 × g for 3 min
at 4 °C. Discard supernatant and vortex plate.
11. Repeat wash step 10 with 200 μl PBS.
12. Resuspend cells in 100 μl of fixation buffer (see Note 6).
Incubate for 30 min at 4 °C.
13. Add 150 μl Perm/Washbuffer to all wells and spin plate at
900 × g for 3 min at 4 °C. Discard supernatant and vortex plate.
14. Repeat step 13 with 200 μl PermWash buffer.
15. Resuspend cells in 50 μl of intracellular cytokine antibody
panel in PermWash buffer (Table 2). Incubate at 4 °C in the
dark for 20 min or overnight.
16. Add 150 μl of Perm/Wash to all wells. Spin plate at 900 × g for
3 min at 4 °C. Discard supernatant and vortex plate.
17. Repeat step 16 with 200 μl of PBS.
18. Resuspend cells in 100 μl of PBS and transfer to microtiter
tubes for acquisition on flow cytometer. Samples may be
stored at 4 °C for up to 48 h until they can be acquired.
19. Acquire samples on LSR II or similar instrument and analyze
data using FlowJo or comparable software.
20. Once acquired, cells can be gated as depicted in Fig. 2. First,
exclude AQUA LIVE/DEAD+, CD3+ and CD20+ cells to gate
on live, non-lymph cells. You can then gate on specific popula-
tions such as monocytes and DC subsets as described in Fig. 1.
The frequency of TNFα+, IL-6+, and IFNα+ cells can be deter-
mined using the unstimulated control sample to adjust/sub-
tract for background fluorescence (Fig. 2).

3.3 Delineating The adaptive immune branch is composed of B and T lympho-

Lymphocyte cytes, which unlike cells of the innate immune system can generate
Subpopulations responses tailored to specific pathogens. Specificity is acquired
by Flow Cytometry through the expression of diverse, clonally distributed antigen
receptors. Aging results in disturbances in lymphocyte homeosta-
sis. Here we discuss how to delineate T and B cell subsets.
72 Christine Meyer et al.

Non-Lymph gate
a b c
Monocyte pDC

CD123
CD14
CD3

mDC
DC

CD20 HLA-DR CD11c

d Unstimulated 0.0 e LPS 21.9 f Unstim

Imiquimod
IL-6

IL-6

13.4
96.2 3.2 17.8 60.1

TNFa IFNa

Fig. 2 Cytokine production by innate immune cells. PBMC were incubated for 6 h with either RP-10 alone
(“unstimulated”), or in the presence of LPS or Imiquimod. Non-lymph cells are identified as CD3 to CD20− cells
(a). Cells were then stained for surface markers to delineate monocytes (HLA-DR+ CD14+ cells) or DCs (HLA-DR+
CD14−) (b), with CD123 and CD11c used to delineate pDC and mDC respectively (c). Cells were stained intracel-
lularly for TNFα, IL-6, and IFNα. Representative TNFα/IL-6 costaining by monocytes unstimulated (d) or incu-
bated with LPS (e) and representative IFNα staining by pDCs unstimulated or stimulated with Imiquimod (f)

1. Add 1 × 106 PBMCs per well into a 96-well plate (see Note 6,
Table 3).
2. Spin plates at 900 × g for 3 min. Discard supernatant and vor-
tex plate (see Note 3).
3. Add surface antibodies described in Table 3 in 50 μl of PBS
per well and incubate in the dark at 4 °C for 30 min.
4. Wash plate with 150 μl of PBS, spin for 3 min at 900 × g at
4 °C. Discard supernatant and vortex plate.
5. Repeat step 4 with 200 μl of PBS.
6. If staining panel requires a secondary antibody (see Note 10)
dilute in 50 μl of PBS per well and incubate plate in dark for
20 min at 4 °C.
7. Add 150 μl of PBS to the wells and spin for 3 min at 900 × g at
4 °C. Discard supernatant and vortex plate.
8. Repeat step 7 using 200 μl of PBS.
 Flow Cytometry of Immunosenescence in Non-Human Primates 73

9. Add 100 μl fixation buffer and incubate in dark for 20 min

at 4 °C.
10. Wash plate with 100 μl of PBS and spin for 3 min at 900 × g at
4 °C. Discard supernatant and vortex plate.
11. Repeat step 10 with 200 μl of PBS.
12. Resuspend cells in 100 μl PBS and transfer to microtiter tubes
for acquisition on flow cytometer. Samples may be stored at
4 °C for up to 48 h until they can be acquired.
13. Acquire samples on LSR II or similar instrument and analyze
data using FlowJo or comparable software. Since CD4 T cells
account for 30–40 %, CD8 T cells account for 15–25 % and
CD20 B cells account for 10–20 % of PBMC, acquiring 5 × 105
events is sufficient.
14. Once acquired, samples can be analyzed as depicted in Figs. 3
and 4. B cells can be identified in rhesus macaques based on
the expression of CD20 and can then be subdivided into four
subsets based on the expression of IgD and CD27 (Fig. 3): (1)
naïve B cells express surface bound IgD and lack expression of
CD27; (2) antigen-experienced memory B cells are defined as
IgD−CD27+; (3) a transitional subset referred to as marginal
zone-like (MZ-like) B cells, are identified as IgD+CD27+; and
(4) a minor exhausted highly differentiated memory subset is
defined as IgD-CD27- [7, 8].
Rhesus macaque CD4 and CD8 T cells can be subdivided into
naïve, central memory (CM), and effector memory (EM) subsets
based on expression of CD28 (co-stimulatory molecule) and
CD95 (FAS receptor) (Fig. 4) [9]. Naïve T cells are identified as
CD95−CD28+, CM T cells are identified as CD95+CD28+, and EM
T cells are identified as CD95+CD28−. This differentiation can be
further refined based on the expression of the chemokine receptor
CCR7, which allows cells to circulate through blood and lymphoid
organs. The expression of CCR7 together with CD28 allows

a b c

B cell naïve MZ-like

exhausted
SSC

CD3

IgD

lymphocyte memory memory

FSC CD20 CD27

Fig. 3 Flow-cytometric gating strategy to delineate B cell populations. Live PBMC are delineated as previously
described (a). B cells are identified as CD3− CD20+ (b). Naïve B cells are IgD+ CD27−, marginal zone-like
(MZ-like) B cells are IgD+ CD27+, and memory B cells are IgD− CD27+ (c)
74 Christine Meyer et al.

a b CD4 c
transitional CM
naïve CM CM

EM EM

CD28
CD28
CD4

CD8 CD95 CCR7

d CD4 e
CD25+
CD127+

T reg
CD25

CD127 Foxp3
Fig. 4 Flow-cytometric gating strategy to delineate T cell populations. Lymphocytes are separated into CD4+
and CD8+ T cells (a). CD4 T and CD8 T cells are subdivided into naïve CD95− CD28+, central memory (CM,
CD95+ CD28+) and effector memory (EM, CD95+ CD28−) T cells (b). The addition of CCR7 allows further
subdivision of the memory CD95+ T cells population and the identification of transitional CM T cells CD95+
CD28+ CCR7− (c). T regulatory (T reg) cells are defined as CD4+ CD25+ CD127− (d). Confirmation is provided
by the expression of Foxp3+ in this population (e)

the identification of fourth subset called transitional CM T cells

that are CD95+CD28+CCR7−, whereas terminally differentiated
EM T cells are CD95+CD28−CCR7− and CM T cells are
CD95+CD28+CCR7+ (Fig. 4) [10]. As described for humans,
aging is accompanied by a loss of naïve T cells and the accumula-
tion of EM CD8 T cells and CM CD4 T cells in the rhesus macaque
[5]. Regulatory T (Treg) cells are important mediators of immune
tolerance and are classically defined based on expression of CD4,
CD25, and the transcription factor FoxP3. Additionally, in the
RM, the IL-7 receptor or CD127 can be alternatively used to iden-
tify Treg cells as CD4+CD25+CD127− (Fig. 4).

3.4 Monitoring One of the hallmarks of the adaptive immune response is a robust
Immune Cell proliferative burst. Ki67 is a nuclear protein that is upregulated
Proliferation Through during the G2–S phase of the cell cycle [11], and is an excellent
the Detection of Ki67 marker for determining kinetics and magnitude of a proliferative
Expression burst. Rhesus macaques are an outbred population with a complex
Flow Cytometry of Immunosenescence in Non-Human Primates 75

MHC locus that remains incompletely understood. Consequently,

very few tetramers have been designed and all are specific for
Simian Immunodeficiency Virus (SIV). Therefore, Ki67 expres-
sion is used to determine the kinetics and magnitude of the prolif-
erative burst instead, which reliably assesses the adaptive immune
response quantitatively and qualitatively.
1. Add 1 × 106 PBMC per well of a 96-well plate.
2. Spin plate for 3 min at 900 × g. Discard supernatant and vortex
plate.
3. Add surface antibodies to cells diluted in 50 μl PBS. This
staining can be easily combined with that described in
Subheading 3.1 or 3.3 to measure proliferation within a vari-
ety of immune cells.
4. Incubate plate in dark at 4 °C for 30 min.
5. Add 150 μl PBS, spin for 3 min at 900 × g at 4 °C. Discard
supernatant and vortex plate.
6. Repeat step 5 with 200 μl PBS.
7. If staining panel requires a secondary antibody, add it diluted
in 50 μl of PBS per well and incubate plate in dark for 20 min
at 4 °C. If not continue with step 10.
8. Add 150 μl PBS, spin for 3 min at 900 × g at 4 °C. Discard
supernatant and vortex plate.
9. Repeat step 8 with 200 μl PBS.
10. Add 100 μl l fixation buffer to each well. Incubate in dark for
20 min at 4 °C.
11. Add 100 μl Perm/Wash buffer, spin for 3 min at 900 × g at
4 °C. Discard supernatant and vortex plate.
12. Repeat step 11 with 200 μl Perm/Wash buffer.
13. Add 100 μl superperm buffer to each well. Incubate in dark
for 20 min at 4 °C.
14. Add 100 μl Perm/Wash buffer, spin for 3 min at 900 × g at
4 °C. Discard supernatant and vortex plate.
15. Repeat step 14 with 200 μl Perm/Wash buffer.
16. Add Ki67 antibody (Table 2) diluted in 50 μl of 1× PermWash
buffer to each well. Incubate in dark for 4 h or overnight
at 4 °C.
17. Add 150 μl PermWash buffer, spin for 3 min at 900 × g at
4 °C. Discard supernatant and gently vortex plate.
18. Repeat step 17 with 200 μl PermWash buffer.
19. Wash plate in 200 μl 1× PBS. Spin for 3 min at 900 × g at
4 °C. Discard supernatant.
76 Christine Meyer et al.

a b

EM

CD28
CD4

d
CD8 CD95 50

% Ki67+ CD4 EM T cells

day 0 day 14 40

30

20
30.8
4.34 10

0
-14 3 7 10 14 17 21 28
Ki67 days post infection

Fig. 5 Measuring T cell proliferation via analysis of Ki67 expression. Lymphocytes are separated into CD4+ and
CD8+ T cells (a). CD4 EM T cell subsets are delineated based on CD28 and CD95 expression (b). Ki67+ expres-
sion in CD4 EM T cells increases dramatically 14 days post-infection with simian varicella virus (SVV) com-
pared to day 0 post-infection (c). Representative example of CD4 EM T cell proliferative burst following SVV
infection (average values of six animals, d)

20. Resuspend samples in 100 μl 1× PBS and transfer to microtiter

tubes for running on the flow cytometer. Store at 4 °C for up
to 48 h until they can be acquired.
21. Acquire samples on LSR II instrument or similar instrument
and analyze data using FlowJo or comparable software.
22. To analyze the samples, first follow instructions provided
above in Figs. 3 and 4 to gate on the lymphocyte population
of choice. The percentage of Ki67+ cells can be obtained using
a histogram as depicted in Fig. 5 for CD4 EM T cells.

3.5 Monitoring Antigen recognition by T cells results in the production of cyto-

the Frequency kines such as IFNγ and TNFα. Detection of these can be accom-
of Antigen-Specific T plished through the use of intracellular cytokine staining (ICS), a
Cells by Intracellular widely used flow cytometry-based assay that takes advantage of the
Cytokine Staining protein transport inhibitory effects of Brefeldin A. Briefly, samples
(ICS) are (1) stimulated with a specific antigen in the presence of
Brefeldin A, (2) stained with the appropriate cell surface antibod-
ies, (3) fixed and permeabilized, (4) stained with antibodies
directed against cytokines of choice such as IFNγ and TNFα, and
(5) analyzed via flow cytometry.
Flow Cytometry of Immunosenescence in Non-Human Primates 77

1. Add 1 × 106 cells in 100 μl of RP10 per well into a 96-well

plate. Aliquot at least three wells for each sample.
2. Add the following to each of the wells: (1) experimental anti-
gen (see Note 11); (2) positive control (see Note 12); and (3)
negative control (see Note 13).
3. Incubate at 37 °C for 1 h.
4. Add 2 μl per well of Brefeldin A. Incubate in a humidified
incubator 5 % CO2 at 37 °C overnight (9–14 h).
5. Spin plate for 3 min at 900 × g at 4 °C. Discard supernatant
and vortex plate.
6. Wash plate with 200 μl 1× PBS. Spin for 3 min at 900 × g at
4 °C. Discard supernatant and vortex plate.
7. Add T cell surface antibodies to cells diluted in 50 μl PBS
(see Note 14).
8. Incubate plate in dark at 4 °C for 20 min.
9. Add 150 μl PBS, spin for 3 min at 900 × g at 4 °C. Discard
supernatant and vortex plate.
10. Repeat step 9 with 200 μl PBS buffer
11. Add 100 μl fixation buffer to each well. Incubate in dark for
20 min at 4 °C.
12. Add 100 μl Perm/Wash buffer, spin for 3 min at 900 × g at
4 °C. Discard supernatant and gently vortex plate.
13. Repeat step 12 with 200 μl PermWash buffer.
14. Add the cytokine-specific antibodies (Table 2) diluted in 50 μl
of 1× PermWash buffer to each well. Incubate in dark for 4 h
or overnight at 4 °C.
15. Add 150 μl PermWash buffer, spin for 3 min at 900 × g at
4 °C. Discard supernatant and vortex plate.
16. Repeat step 15 with 200 μl PermWash buffer.
17. Add 200 μl 1× PBS. Spin for 3 min at 900 × g at 4 °C. Discard
supernatant and vortex plate.
18. Resuspend samples in 100 μl 1× PBS and transfer to microtiter
tubes for acquisition on a flow cytometer. Store at 4 °C until
needed.
19. Acquire samples on LSR II or comparable instrument and
analyze data using FlowJo or similar software.
20. Samples can be analyzed by gating on either total CD4 or
CD8 T cells or specific memory subsets as delineated in
Subheading 3.3 (see Note 14). An example of CD4 cytokine
production following Simian Varicella Virus (SVV) infection is
depicted in Fig. 6.
78 Christine Meyer et al.

a 24.1
b 0.265 0.0294 3 22.2

0dpi 14dpi

IFNg
62.3
CD4

99.4 0.361 68.2 6.64

CD8 TNFa

c 0.252 0.021 3.4 6.67 d 50

% IFNg+ CD4 T cells

0dpi 14dpi 40

30
IL-2

20

10

99.1 0.651 80.2 9.76

0
MIP-1b 0 7 14 21 28
days post-infection

Fig. 6 Measuring frequency of antigen-specific T cells using intracellular cytokine production by flow cytom-
etry. Lymphocytes are separated into CD4+ and CD8+ T cells (a). Representative examples of the frequency of
IFNγ/TNFα− producing (b) and IL-2/MIP-1β− producing (c) CD4 T cells at 0 and 14 days post-infection with
simian varicella virus (SVV) following ex vivo stimulation with SVV lysate are shown. Frequency of antigen-
specific T cells can be reliably monitored over the course of SVV infection using ICS as demonstrated in panel
d with the monitoring of the frequency of IFNγ+ CD4 T cells (average of six animals)

4 Notes

1. The number of PBMC to use depends on the frequency of

target cell of interest. Some cells (e.g., plasmacytoid DC) are
infrequent in peripheral blood and will require the acquisition
of more total events to obtain a reliable population size.
2. Since innate immune cells are frequently adherent, use non-
adherent tissue-culture-treated plates to improve cell yields.
The plate material will also modulate the activation state of
CD14+ cells.
3. After centrifugation, flick the supernatant into a waste con-
tainer in a fast downward motion. Do not allow the superna-
tant to contaminate the adjacent wells.
4. When carrying out wash steps under sterile conditions, use a
200 μl pipette to slowly remove supernatant and discard super-
natant. To ensure the pellet is not disrupted, it may help to
angle the 96-well plate towards yourself.
Flow Cytometry of Immunosenescence in Non-Human Primates 79

5. For up to date information regarding cross-reactivity data

please visit http://nhpreagents.bidmc.harvard.edu/NHP/
reagentlist.aspx. Fluorochrome choices should be based on
the instrument and laser configuration. Those suggested in
the tables were optimized for a BD LSRII instrument. Use
the antibodies at the amount recommended by the manufac-
turer. To titrate antibodies for which a recommended amount
is not known or available, we recommend beginning with
1 μg and testing dilutions of the antibody in twofold incre-
ments. Run all dilutions on the flow cytometer and determine
the concentration of antibody that best delineates the popula-
tion of interest.
6. Fully resuspend cells immediately in fixation buffer, as this
helps to limit clumping of cells. Use pipetting instead of vor-
texing to increase the efficiency of this step.
7. The bioactivity of TLR agonists is highly variable depending
on manufacturer. We recommend careful titration of all TLR
agonists to optimize stimulation conditions.
8. Make small aliquots of TLR agonists to avoid freeze-thawing
and loss of bioactivity. Carefully follow manufacturer’s storage
specifications and expiration date.
9. Addition of Brefeldin A results in the accumulation of proteins
(in this case, the proteins of interest are cytokines) within the
endoplasmic reticulum [12]. To look at global PBMC cyto-
kine production (rather than on a per cell basis), cells can be
incubated in the absence of Brefeldin A for 6 h and superna-
tants harvested for subsequent analysis of cytokines (e.g., by
ELISA or cytometric bead assay).
10. If one of the primary antibodies is labeled with biotin and not
fluorescently conjugated, you will need to add the secondary
antibody streptavidin conjugated to a fluorophore.
11. The reagents that can be used to stimulate T cell cytokine
production are varied. When assessing antigen specific
responses, one can use viral or bacterial lysate generated by
disrupting infected cells. Alternatively purified viral or bacte-
rial preps can also be used at a multiplicity of infection of typi-
cally 1–3. If the immunodominant antigens are known, then
purified protein or overlapping peptide libraries can be also be
used. The optimal stimulation conditions are determined spe-
cifically for each experimental system.
12. Positive controls are essential to ensure that the assay has
worked. Polyclonal mitogens (that can stimulate a majority of
T cells regardless of their antigen-specificity) are often used.
The options include but are not limited to: CD3, PMA, PMA/
ionomycin, superantigens, and ConA.
80 Christine Meyer et al.

13. It is important that negative controls receive the same media/

buffer that the experimental antigen was prepared in. For
instance, if you were stimulating with viral lysate the negative
control would be disrupted non-infected cells. Similarly, if you
are using peptides, the negative control wells should receive the
solution the peptides were reconstituted in (usually DMSO).
14. One can add anti-CD4 and CD8 antibodies only or together
with CD28, CD95, and CCR7 if the goal is to delineate the
exact subset of T cells producing cytokines. Naïve T cells are
antigen inexperienced and typically do not produce cytokines
following short term ex vivo stimulation.

References
1. Passlick B, Flieger D, Ziegler-Heitbrock HW of memory B cells expressing costimulatory
(1989) Identification and characterization of a molecules in the resting state. J Immunol
novel monocyte subpopulation in human 167:5669–5677
peripheral blood. Blood 74:2527–2534 8. Weller S, Braun MC, Tan BK et al (2004)
2. Coates PT, Barratt-Boyes SM, Zhang L et al Human blood IgM “memory” B cells are cir-
(2003) Dendritic cell subsets in blood and culating splenic marginal zone B cells
lymphoid tissue of rhesus monkeys and their harboring a prediversified immunoglobulin
mobilization with Flt3 ligand. Blood 102: repertoire. Blood 104:3647–3654
2513–2521 9. Pitcher CJ, Hagen SI, Walker JM et al (2002)
3. Ramothea L, Webster RPJ (2005) Delineation Development and homeostasis of T cell mem-
of multiple subpopulations of natural killer cells ory in rhesus macaque. J Immunol 168:
in rhesus macaques. Immunology 115:206–214 29–43
4. Carter LL, Murphy KM (1999) Lineage- 10. Picker LJ, Reed-Inderbitzin EF, Hagen SI
specific requirement for signal transducer and et al (2006) IL-15 induces CD4 effector mem-
activator of transcription (Stat)4 in interferon ory T cell production and tissue emigration in
gamma production from CD4(+) versus nonhuman primates. J Clin Invest 116:
CD8(+) T cells. J Exp Med 189:1355–1360 1514–1524
5. Asquith M, Haberthur K, Brown M et al 11. Gerdes J, Lemke H, Baisch H et al (1984) Cell
(2012) Age-dependent changes in innate cycle analysis of a cell proliferation-associated
immune phenotype and function in rhesus human nuclear antigen defined by the mono-
macaques (Macaca mulatta). Pathobiol Aging clonal antibody Ki-67. J Immunol 133:
Age Relat Dis. doi:10.3402/pba.v2i0.18052 1710–1715
6. Kawai T, Akira S (2011) Toll-like receptors and 12. Fujiwara T, Oda K, Yokota S et al (1988)
their crosstalk with other innate receptors in Brefeldin A causes disassembly of the Golgi
infection and immunity. Immunity 34:637–650 complex and accumulation of secretory pro-
7. Bar-Or A, Oliveira EM, Anderson DE et al teins in the endoplasmic reticulum. J Biol
(2001) Immunological memory: contribution Chem 263:18545–18552
 Chapter 7

Multiparameter Phenotyping of Human PBMCs

Using Mass Cytometry
Michael D. Leipold, Evan W. Newell, and Holden T. Maecker

Abstract
The standard for single-cell analysis of phenotype and function in recent decades has been fluorescence
flow cytometry. Mass cytometry is a newer technology that uses heavy metal ions, rather than fluoro-
chromes, as labels for probes such as antibodies. The binding of these ion-labeled probes to cells is quan-
titated by mass spectrometry. This greatly increases the number of phenotypic and functional markers that
can be probed simultaneously. Here, we review topics that must be considered when adapting existing flow
cytometry panels to mass cytometry analysis. We present a protocol and representative panels for surface
phenotyping and intracellular cytokine staining (ICS) assays.

Key words Mass cytometry, CyTOF, Immunophenotyping, Panel design

1 Introduction

Flow cytometry has become the method of choice in immunology

for phenotypic and functional analysis of single cells, owing to its
high throughput and ability to analyze multiple parameters in
combination (up to 15 or so with advanced instruments). Still, the
enormous complexity of immune cells makes even this degree of
multiplexed readouts limiting. While it is possible to do single-cell
analysis of gene expression across the entire genome [1], no tech-
nology has allowed a similar degree of comprehensive probing of
proteins at the single-cell level.
By replacing fluorescent labeling of probes for flow cytometry
with heavy metal ion labels, the potential for higher multiplexing is
greatly enhanced. Unlike the highly overlapping emission spectra
of typical fluorochromes, the readout of atomic masses by mass
spectrometry is very discrete, and can span a wide mass window.
Thus, the use of ion-labeled probes and mass spectrometry as a
readout for flow cytometry (i.e., mass cytometry) is a conceptually
attractive approach [2, 3].

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_7, © Springer Science+Business Media New York 2015

81
82 Michael D. Leipold et al.

The development of mass cytometry as a viable research tool

for multiparameter analysis of immune cells was greatly facilitated
by the availability of a commercial mass cytometer (CyTOF, DVS
Sciences, Toronto; hereafter referred to as mass cytometer), along
with software for conversion of the mass spectrometry signals to
conventional flow cytometry standard (fcs) files. At least two labo-
ratories have since exploited this technology to examine the het-
erogeneity of human immune cells in unprecedented detail [4–7].
Among the theoretical advantages of mass cytometry are (1)
increased numbers of simultaneous probes that can be used, with-
out loss of sensitivity and (2) lack of spillover between mass chan-
nels. In fluorescence flow cytometry, the number of simultaneous
probes one can use is limited not only by the optical spectrum, but
also by the availability of sufficiently bright fluorophores. Similarly,
optical spillover between fluorochromes requires the application of
compensation matrices to fluorescence flow cytometry data, increas-
ing the complexity of analysis and the chances for errors of interpre-
tation. Here we will address the degree to which these factors are in
fact resolved by mass cytometry, and the considerations that remain.
One important difference between fluorescence flow cytome-
ters and a mass cytometer is that there is no mass cytometer analog
to either forward scatter or side scatter. Therefore, there is a strict
requirement for metal-labeling to discriminate cell types, or to
identify cell events at all. If a cell is not labeled with at least one
metal in the mass range of the mass cytometer, it will not be
counted, adversely affecting percent-of-parent statistics. This is
commonly addressed by labeling all cells containing DNA using
iridium-containing intercalators (Atomic mass, AM 191, 193).
Similarly, live-dead stains must also contain appropriate metal ions
to be counted. Molecules containing both a chelator and maleimide
moiety [5], or cisplatin [8] have been used as viability stains in
mass cytometry. See Fig. 1 for an example of gating on iridium
intercalator, viability stain, and monocytes vs. lymphocytes using
CD14 and CD33.
The collection of pulse height and area (or width) information
in fluorescence flow cytometers allows for reasonably efficient dis-
crimination of cell aggregates, which differ from single cells in the
ratio of these parameters. This is obviously not possible on a mass
cytometer, and hence positive identification of single-cell events is
more difficult. The use of the “cell length” parameter, or the
amount of time over which a cell event is detected, during gating
analysis only partially eliminates cell aggregates (see Fig. 1). Slowing
the acquisition rate by diluting the sample reduces doublets at the
cost of increased time per sample. More complex strategies can be
undertaken, such as “cell barcoding” [6], followed by gating out
of events that contain more than a single barcode. This strategy
can be effective if the majority of aggregation occurs after the stage
of barcode labeling.
 Multiparameter Phenotyping of Human PBMCs Using Mass Cytometry 83

104 Intact cells 104

76.1

103 103
DNA1:Ir191

DNA1:Ir191
102 102

Intact singlets
71.6
101 101

0 0

0 101 102 103 104 0 30 60 90 120

DNA2:Ir193 Cell _length

104 Monocytes
30.7 104

103
CD33:Er166

103
DNA1:Ir191

102
102
Live cells
96.1
101
101

0 Lymphocytes
69.1 0

0 101 102 103 104

0 101 102 103 104
CD14:Sm154
Live-Dead:In115
Fig. 1 Initial gating of a PBMC sample in CyTOF. Top, left: Gating on the dense cluster of events with strong
staining for the two isotopes of Ir intercalator eliminates much of the debris, and events within the gate are
referred to as “intact cells.” Top, right: Further gating on the Cell_length parameter eliminates some presumed
cell aggregates, and events within this gate are referred to as “intact singlets.” Bottom, right: A thiol-reactive
dye is taken up by cells with compromised membranes, so those with low staining are gated as “live cells.”
Bottom, left: Initial marker-based gating is done on CD14 vs. CD33, to separate monocytes from lymphocytes.
Because clean discrimination of these populations is essential to further analysis, we routinely use both mark-
ers for this purpose. All data was collected using Data Dual (Dd) calibration. The mass cytometer can give data
in three different outputs: Intensity, Pulses Count, or Dual (d) mode. Dual mode is the calibration curve relating
Intensity and Pulses Count, and is least dependent upon a particular machine. This calibration can be done
using a commercial tuning solution containing known amounts of specified elements spanning the instrumen-
tal mass window (instrument Dual: Di), and will be saved as the calibration file until the calibration is run again.
Data Dual (Dd) uses the first milliseconds of ion events from that particular sample to create the calibration,
then uses that calibration to determine the cell event data. Di calibration information is written into the header
of all files, regardless of whether the user specifies Di or Dd acquisition. Therefore, the data can be processed
from one format to the other post-acquisition
84 Michael D. Leipold et al.

The CyTOF 2 mass cytometer is currently tuned for a mass

window approximately AM 89-209. The high end and the low end
of the mass window have somewhat lower signal intensities (“dim
channel”) compared to the middle of the mass range (“bright
channel”). Maximum sensitivity is centered slightly higher than the
middle of the range. The lanthanide metals are La139-Yb176, and
vary in signal intensity by less than a factor of 4. Nonetheless, it is
important to understand that the relative “brightness” of the chan-
nels is a function of their position within the measured mass win-
dow. Therefore, if the mass window is significantly expanded or
shifted to higher or lower masses, the peak intensities will shift
accordingly.
Design of Antibody Panels for Mass Cytometry. The factors to con-
sider when pairing antibodies with metals are similar to pairing an
antibody with a fluorochrome [9–11].
1. The expression level of the marker. Markers with higher
expression can be used in “dimmer” channels. Conversely,
markers with lower expression require “brighter” channels in
order for the positive population to be resolved from the back-
ground. For markers induced with in vitro stimulation, those
with small fold changes in expression after stimulation would
require brighter metals to resolve the difference over the
unstimulated sample.
2. The resolution needed for gating. It is often beneficial to use
two markers in a bivariate plot to cleanly resolve a population
of interest, rather than relying on histograms. In such cases,
one bright channel and one dimmer channel are usually suffi-
cient for resolution: for instance, B cells (CD19+ CD20+) can
be cleanly gated from total CD3− cells using CD20-Dy164
(bright) vs. CD19-Nd142 (dim). In some instances, two chan-
nels of intermediate sensitivity may be needed, such as when
both bivariate markers are of medium or low expression.
3. The type of expression. Some markers, such as CD27, exhibit
bimodal expression: These can generally be labeled with dim-
mer metals, since they exhibit clearly resolved positive and
negative populations, with no intermediate population.
Alternatively, other markers such as CCR7 or CD45RA
have a spectrum or “smear” of expression. These often require
brighter metals to allow finer distinction between important
cell populations, even in bivariate plots.
4. If you need to redesign a panel, shifting metals up or down by
one or two mass units will generally not impact signal/
resolution.
5. Tm169 is the brightest metal for the AM 89-209 mass
window for current commercially available polymer reagents/
lanthanides. If labeling with Tm169 yields no signal for cells of
Multiparameter Phenotyping of Human PBMCs Using Mass Cytometry 85

known positivity, either: (1) the target molecule is not expressed

in sufficient density for resolution by mass cytometry; or (2)
the antibody is losing binding specificity upon labeling. Use of
different labeling chemistry, or polymer-labeling a commercial
fluorescent conjugate and checking it for binding by fluores-
cence analysis, can help resolve the second possibility.
6. Quantum dots (Qdots) and nanocrystals. Particles of hundreds
to tens of thousands of metal atoms can efficiently be burned
in the mass cytometry argon plasma, and the resulting ions can
be quantified. Therefore, Qdots and similar nanocrystals
labeled with antibodies can be one way to boost signal for a
particular marker. As in fluorescence, non-specific binding
needs to be carefully monitored.
Most commercial Qdots contain cadmium (usually CdSe),
which lies within the mass cytometer mass window. Typically, only
one Cd-Qdot can be used in a given panel: they contain natural-
abundance Cd, which has eight naturally occurring isotopes (AM
106-116, 114 the most abundant). Cadmium is at the very low
end of the sensitivity range and therefore would normally only be
useful for markers of extremely high abundance. However, each
Qdot contains thousands of Cd atoms, effectively increasing the
signal of most markers to a reasonable level.
CdSe/CdTe Qdots contain tellurium (AM 120-130).
However, since they also contain Cd, they cannot easily be used
simultaneously with CdSe Qdots. Additionally, the xenon impuri-
ties (AM 124-136) present in the argon gas could potentially cause
a noticeable background in the tellurium mass range.
Commercial InGaP Qdots contain primarily In115 (95.71%
natural abundance). Cadmium lacks a 115 isotope, so these could
be compatible with Cd Qdots, if Cd112 and In115 are monitored.
Potential Sources of Contaminating Signals. Due to the mass reso-
lution of the time-of-flight separation, there is little or no spillover
from one channel to the next due to the detector itself. In addi-
tion, most of the metals used in the AM 89-209 window, such as
the lanthanides, Ir, Pt, In, Pd, or Cd, are seldom found in biologi-
cal samples from healthy individuals. Therefore, there is no equiva-
lent to “autofluorescence.”
However, other sources of contaminating signals must be con-
sidered, including metal and environmental impurities, and oxida-
tion products [12].
1. Metal impurities. These can be impurities either of different
elements, or of alternative isotopes of the same element; most
typically, the greatest amount of impurity is seen in the next
higher mass channel (“M+1”), with sometimes significant
impurity in “M−1” or “M+2” as well; this is due to the nature
of the isolation procedure.
86 Michael D. Leipold et al.

The metals that are sold as part of antibody labeling kits are
of very high purity (98% and higher in most cases). As a practi-
cal matter, this means that “compensation” analogous to fluo-
rescent antibodies is not needed, as most of the signal will be
of the specified mass, with little to no signal at “M+1” or
another contaminating mass. However, metal salts from other
commercial sources may be of lesser purity. For example, the
chemistries of the lanthanides (Ln) are sufficiently similar that
undesired lanthanides (often La139) can be contaminants in
purchased salts since they are difficult to purify using only
chemical methods. There are currently no labeling kits con-
taining Gd157 due to purity concerns about the available salts.
If using these less-pure isotopes, some caveats to consider
include the following:
(a) Consider using them for “dump” channels or exclusion
markers. If only events that are negative for the label in
question are subjected to further analysis, the impurities
present should not cause any issues.
(b) Put a lower-abundance marker at a less-pure “M” so that
the absolute spillover (usually up to 0.5–1% of “M” sig-
nal) is reduced. If “M” is a less pure isotope and is labeling
a high-abundance marker, do not put a low-abundance
marker at the M+1 position. Aim for at least medium-
abundance so that positive and negative populations can
still be clearly resolved if there is isotopic “spillover.”
(c) For channels that have significant spillover, use combina-
tions of markers that label mutually exclusive populations.
For instance, put a T-cell-specific marker at M+1 when
using a B-cell-specific marker labeled with a less-pure iso-
tope M.
2. Impurities from the sample or environment. There are several
sources of impurities to guard against. When in doubt, a highly
diluted aliquot of the suspected stock can be injected into the
mass cytometer in tuning/liquid mode and observed for
contamination.
(a) Many laboratory dish soaps have high levels of barium
(AM 130-138). Barium tends to persist even after multi-
ple rinses. This is a problem even if these masses are not
being used in the experiment, as it leads to detector aging,
and can result in oxidation signals in M+16 channels (see
point #3 below). It is therefore generally advised to store
mass cytometry buffers in brand-new plastic or glass ves-
sels that have never been through laboratory wash.
(b) Low levels of mercury, lead, or tin can sometimes be
found in lab buffers, especially those made with "house"
distilled water rather than reverse osmosis (e.g., MilliQ)
Multiparameter Phenotyping of Human PBMCs Using Mass Cytometry 87

water, or from commercial stock solutions that were not

specified as metal-free. Even iodine (mass 127) is in the
mass window of the mass cytometer.
(c) Unexpected sources of contamination include, for exam-
ple, striker flints for Bunsen burners. These contain high
levels of cerium (AM 136-142) and lanthanum, as well as
traces of neodymium and other lanthanides.
3. Oxidation products. All metals exhibit some degree of
oxidation in the argon plasma. This cannot be eliminated, but
can be minimized with proper instrument warm-up and tuning
of the current and make-up gas each day. This tuning should
result in oxides <3% of maximum signal. Technically, oxide
formation decreases signal at M, while increasing signal at
M+16. However, it is easier to detect a small increase in oxide
at M+16 than to detect a small decrease in signal at M.
Some lanthanides are more easily oxidized than others. La139
is the worst (oxide mass 155). Pr141 (oxide AM 157), Nd (oxide
AM 158-166), and Gd (oxide AM 172-176) have notable levels of
oxidation as well. Eu (oxide AM 167, 169) has very low oxide
levels. When using a more-easily oxidized metal, it is useful to use
it for markers that are relatively low-abundance compared to the
marker at M+16, so that M+16 spillover (≤0.5–1% of “M” signal)
is minimized.
It is important to remember that the undesired signals listed
above are all a function of the signal intensity of M. Even with a
less pure isotope such as Gd157, the total interference may only
add up to a few percent of M signal, distributed among all spillover
channels (M+1, M−1, M+16, environmental contamination, Ln,
etc.). Therefore, careful pairing of marker abundance and metal
signal intensity, along with metal salt purity will minimize any
potential spillover. Generally, a signal of <101 Dual counts can be
considered as background. Therefore, if the signal at M is <103
Dual counts, any spillover contribution would be at or below back-
ground level in the affected channels.
Qualification of Antibody Conjugates. As with standard fluores-
cence flow cytometry, qualification of antibodies for assay purposes
is critical. This is particularly relevant since comparatively few pre-
conjugated metal–antibodies are currently commercially available.
Therefore, many antibody–metal conjugates will have to be conju-
gated in-house by the end-user. In most cases, an antibody clone
that works for fluorescence flow cytometry can be successfully con-
jugated for use in mass cytometry. In most of the remaining cases,
another widely used clone can be substituted successfully. See Fig. 2
for some representative examples comparing various markers in
fluorescence and mass cytometry. However, with the relatively
young state of the field, there are occasionally markers for which
no suitable antibody clone has yet been identified.
88 Michael D. Leipold et al.

Fig. 2 Representative comparisons of fluorescence (top row) and mass cytometry (bottom row) for the same
antibody combinations on cryopreserved PBMC from the same donor. Parent populations are shown at the top
of each column. Left to right: naïve and memory B cell sub-populations, CD4+ and CD8+ T cells, and NK cells.
In each case, the staining patterns differ somewhat, especially with regard to background staining of negative
populations; but overall frequencies of each gated population are very similar. All data was collected using
Data Dual (Dd) calibration

Furthermore, we recommend that even after a successful anti-

body clone–metal pairing is found, each new batch of conjugated
antibodies should be checked for activity against a reference before
use in assays with unknown samples.
There are several points to keep in mind when testing new
antibody conjugates.
1. The expected expression pattern of the marker. This includes:
cell type (monocytes, NK cells, T cells, B cells, etc.); location
(peripheral circulation, bone marrow, lymph node, gut lumen,
etc.); and effects of stimulation, differentiation, or cell cycle
phase. For example, one might test an antibody on stimulated
cells if antigen expression is not expected on unstimulated cells.
2. Effects of sample processing. Some markers (e.g., CD62L,
PD-1) are reduced upon cryopreservation (though these can
Multiparameter Phenotyping of Human PBMCs Using Mass Cytometry 89

be partially restored after resting of thawed cells). Some cell

types are also lost or reduced after processing (e.g., granulo-
cytes and dendritic cells after Ficoll gradient separation).
Finally, staining after fixation and/or permeabilization can
destroy epitopes. For example, many anti-CD16 antibodies
lose binding after fixation. Conversely, there can be a large
increase in nonspecific binding of many anti-CD56 antibodies
after fixation.
3. Use of both positive and negative controls. Often, different
cell types within the same sample can provide positive and
negative controls for antibody staining. For example, B cells
can serve as a negative control for T cell markers, etc. However,
beware of limitations of this approach, as many markers are
expressed by more than one type of cell, often at lower levels
or in small subpopulations.
If doing two-step staining with element-labeled secondary
antibodies, one should include additional controls such as:
secondary antibody in the absence of the primary antibody,
and secondary antibody in the presence of a known primary
antibody.
Cell lines can be useful for antibody qualification (see pro-
teinatlas.org for immunohistochemistry data for ~4300 pro-
teins on 47 cell lines). Of course, the antigen expression on a
cell line may be higher or lower than seen on primary cells.
Also, data from proteinatlas.org are from samples fixed,
paraffin-embedded, deparaffinized with xylene, rehydrated
with ethanol, boiled in antigen-retrieval solution, stained,
then read by a computer. Thus, the staining may not match
that seen on fresh samples in flow cytometry.
4. Use of more than one donor during antibody-conjugate
validation. Some donors have unusual patterns of expression
or cell distribution. TCRγδ+ T cells are an example of a highly
donor-dependent population. We have observed occasional
donors with low or negative expression of CD33 on monocytes,
or very skewed distributions of memory T-cell subsets (e.g.,
nearly all CD8+ T cells are CD28+ or CD28−). By use of
more than one donor, false conclusions about the performance
of the antibody are less likely.
Once a panel is designed and conjugates are tested and titrated,
it is advisable to test performance and reproducibility of the panel
on control samples such as healthy subject PBMC. See Fig. 3 for an
example of the staining pattern of PMA+ionomycin-activated
normal PBMC with a selection of markers from a 38-antibody
intracellular cytokine panel.
 90

4 4
10 104 104 CD8+ cells 10 104
CD20+ cells 25
Monocytes
3 17.3 3 3
103 6.95 10 10 103 10

2 2 2
102 10 10 102 10
NK cells
36.1
1 1
10 101 101 10 101
NonB NonT B cells
CD3+ cells

CD8:Nd144
6.5 93.4

CD33:Er166
CD20:Dy164
CD56:Yb174

CD19:Nd142
75.4
0 Lymphocytes 0 0 CD4+ cells
0 0
Michael D. Leipold et al.

91.7 50.3
1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4
0 101 102 103 104 0 10 10 10 10 0 10 10 10 10 0 10 10 10 10 0 10 10 10 10

Live cells CD14:Sm154 Lymphocytes CD3:Nd150 CD3+ cells CD4:Nd143 CD20+ cells CD19:Nd142 NonB NonT CD16:Sm149

4 6.92 73.3 4 4.51 94.9 0.808 0.0614

104 10 10 104 7.33 104 3

103 103 103 3

10 103

2
10 102 102 102 102

1 1
10 101 101 101 10

CD28:Er167
CD38:Eu151

Treg
CD85j:Sm147

CD127:Ho165
0 0 0 0 0

CD45RA:Dy162
4.91
6.02 13.7 0.114 0.435 87.4 4.44 96.1 0.795

0 101 102 103 104 1 2 3 4 1 2 3 4 1 2 3 4

0 10 10 10 10 0 10 10 10 10 0 10 10 10 10 0 101 102 103 104

CD4+ cells CD25:Yb176 CD4+ cells CCR7:Gd160 CD4+ cells CD27:Sm152 CD4+ cells CD94:Gd156 CD4+ cells HLADR:Lu175

Fig. 3 Representative staining of various cell-surface (a) and intracellular (b) markers in a 38-antibody panel that includes eight intracellular cytokines. Plots show stain-
ing from a positive control, stimulated with PMA+ionomycin, but the panel has been successfully used with antigen-specific stimulations as well. Resolution of surface
and intracellular markers is generally quite good. The parent population is shown at the bottom of each plot. All data was collected using Data Dual (Dd) calibration
 4 IL-2+ 4 4 4
10 10 10 10
0.104

3 3 3 3 MIP1b+
10 10 IFNg+ 10 IL-17+ 10
0 5.62e-3 0.0281
CD4+ T cells
2 2 2 2
10 10 10 10
unstimulated
1 1 1 1
10 10 10 10

IL-2:Gd157
IFNg:Gd158
IL-17:Dy164
MIP1b:Nd148
CD107a+
0 0 0 GMCSF+ 0
0.177 TNFa+ 0.141 CD69+
0.127 2.56
1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4
0 10 10 10 10 0 10 10 10 10 0 10 10 10 10 0 10 10 10 10

CD107a:Sm154 TNFa:Sm152 GMCSF:Gd155 CD69:Nd144

4 IL-2+ 4 4 4
10 10 10 10
30.1

103 103 IFNg+ 103 IL-17+ 103 MIP1b+

13.6 0.509 8.98

2 2 2 2
CD4+ T cells
10 10 10 10
stimulated with
1 1 1 1
10 10 10 10 PMA + ionomycin

IL-2:Gd157
IFNg:Gd158
IL-17:Dy164
MIP1b:Nd148

CD107a+ GMCSF+ CD69+

0 2.63 0 TNFa+
0 0 81.5
4.24
32
1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4
0 10 10 10 10 0 10 10 10 10 0 10 10 10 10 0 10 10 10 10

CD107a:Sm154 TNFa:Sm152 GMCSF:Gd155 CD69:Nd144

Fig. 3 (continued)
Multiparameter Phenotyping of Human PBMCs Using Mass Cytometry
91
92 Michael D. Leipold et al.

2 Materials

1. 96-well round bottom plates (see Note 1).

2. CyFACS buffer: 0.1% BSA+ 2 mM EDTA+ 0.1% NaAzide in
PBS made with MilliQ water and no heavy metal contami-
nants (no glass or beakers washed with soap). Filter with a
0.2 μm filter; store at room temperature.
3. CyPBS: PBS without heavy metal contaminants (10× PBS
from Rockland). No contact with beakers or bottles washed
with soap. Filter with a 0.2 μm filter; store at room
temperature.
4. MilliQ dH2O: No contact with beakers or bottles washed with
soap.
5. DOTA-maleimide: B-272 from Macrocyclics.
● Use to make 5 mg/mL In115*-DOTA-maleimide, dis-
solved in MilliQ water. Add 100 μl 3% nitric acid per
10 mL solution to maintain low pH and store at 4 °C.
● In115* is natural-abundance indium from a high-purity
metal salt.
6. 0.1 μm spin filters: Millipore UFC30VV00.
7. 16% Paraformaldehyde: Electron Microscopy Sciences Cat.
15710.
8. DVS Sciences iridium intercalator solution: 2000× or 500×
stock, use at final 1×.
9. Saponin-based permeabilization buffer (Ebioscience Cat.
00-8333-56).
10. Set of MAXPAR-labeled antibodies–labeled as per MAXPAR
kit from DVS Sciences (see Note 2).

3 ICS Staining Protocol

3.1 Sample 1. Two million viable cells per well (as measured by dye exclusion
Collection method such as Vicell; rested, if desired) (see Note 3).

3.2 Cell Activation 1. Perform as described in Lovelace and Maecker [13].

3.3 Sample 1. Wash 1× in CyFACS buffer (flick plate or aspirate to remove

Processing supernatant).
2. Make Ab cocktail in CyFACS buffer (Filter with 0.1 μm spin
filter).
3. Resupend cells in 50 μL filtered Ab cocktail.
4. Incubate for 30–60 min on ice.
 Multiparameter Phenotyping of Human PBMCs Using Mass Cytometry 93

5. Wash 2× in CyFACS buffer (see Note 4).

6. Resuspend cells in 100 μl of 1:3000 diluted In115-DOTA
maleimide in CyPBS.
7. Incubate for 30 min on ice.
8. Wash 3× in CyFACS buffer.
9. Resuspend in 100 μl of 2 % PFA in CyPBS (see Notes 5 and 6).
10. Incubate at 4°C overnight.
11. Wash 2× in 1× eBioscience perm buffer (1× in MilliQ water).
12. Make intracellular staining cocktail in 1× perm. buffer and fil-
ter with 0.1 μm spin filter.
13. Incubate on ice for 45 min.
14. Wash 3× in CyFACS buffer.
15. Resuspend in 2 % PFA+ 1× Ir-Interchelator in CyPBS.
16. Incubate for 20 min at room temperature.
17. Wash 1× in CyFACS buffer.
18. Wash 3× in MilliQ water (see Note 7).
19. Resuspend in MilliQ water for running on mass cytometer
(see Note 8). Filter through a 25 μM cell strainer prior to
acquisition (see Note 9).
To perform only surface phenotyping: Subheading 3.1: 1 million live
cells are usually sufficient. Omit stimulations in Subheading 3.2. In
Subheading 3.3, omit step 13, and 2 % PFA in step 16.

3.4 Data Acquisition 1. Start the machine. Warm up and tune as in Ref. [14].
and Analysis 2. Acquire data as in Ref. [14]. The length of the run will be
dependent upon the volume of your sample: dilution with
MilliQ water to ~1 million cells/mL is recommended for
minimizing doublets as well as maximizing sample throughput
(see Note 10).
3. Analyze data using third-party flow analysis software such as
FlowJo (Treestar) or Cytobank (see Note 11 and Fig. 1). Note
that some display settings may need to be altered for proper
viewing.

4 Notes

1. Plates vs. tubes: cells can be handled in 96-well microtiter

plates or in 12 × 75 mm polystyrene tubes. Deepwell plates are
useful for additional volume per wash (see Note 4).
2. Lanthanides cannot be photobleached. Therefore, there is no
need to protect antibody stocks or samples from standard lab
lighting.
94 Michael D. Leipold et al.

3. The current cell transmission efficiency of the mass cytometer

is 20–25%, compared to 95+% for a standard fluorescence flow
cytometer. Therefore, coupled with cell loss due to the sug-
gested number of wash steps (see Note 4) greater starting
numbers of cells will be required for similar cell event counts.
4. Due to the sensitivity of the detector, mass cytometry samples
require a large number of washes to minimize nonspecific
background from staining steps. While this must be balanced
against the loss of cells with each wash step, reducing the num-
ber of washes below what is listed here is not recommended.
5. All cells that are injected into the mass cytometer have been
fixed and permeabilized. This is necessary to allow the iridium
intercalator to effectively enter the cell.
6. MilliQ water can cause improperly fixed cells to lyse (see Note
5). Therefore, ensure that your PFA is fresh. While it is not
always necessary to open a new bottle/ampule, PFA should be
generally protected from light and exposed to atmosphere for
less than a month to be completely active.
7. Ultrapure (e.g., MilliQ) water is required for washes and final
resuspension at the end of the staining protocol. This helps
ensure that there is little or no free metal or antibody upon
injection into the mass cytometer. This also ensures that there
are no buffer salts carried along with the sample. While most
buffer salts will not make it through the quadrupole mass filter
window (AM 89-209), they will accumulate on the metal
cones at the entry to the machine. Over long run-times, buffer
salts can accumulate and cause the tuning to drift, particularly
the Current setting.
8. Stained samples can be kept at 4 °C for up to a week. However,
fresher samples are optimal. If samples must be stored, it is pref-
erable that they be stored in 2 % PFA/CyPBS, or at least in
CyFACS. Regardless of the storage conditions, it will be neces-
sary to do at least one MilliQ water wash prior to resuspension
in MilliQ water and injection. Do not freeze stained samples.
9. All samples must be filtered through 25 μm cell strainers
before injecting into the mass cytometer. This will minimize
the likelihood that a clog will form in the nebulizer tubing or
the nebulizer itself.
10. While the mass cytometer is capable of acquiring cells at up to
1000 cells/s, this usually causes an unacceptable number of
doublets. Event rates of approximately 300–500 cells/s strike
a better balance between optimizing the number of singlet
events while still allowing sample acquisition in a reasonable
timeframe. The event viewing window in the software shows
~1/350 snapshot of the data actually being acquiring per sec-
ond. Therefore, an average of ~1 cell event/screen refresh
would be in this 300–500 cells/s range.
 Multiparameter Phenotyping of Human PBMCs Using Mass Cytometry 95

11. The number of cell events counted by the mass cytometer

during acquisition is an upper limit to the number of true cell
events. The software registers a cell event as metal signal in any
mass channel that is a number of standard deviations above
background (default = 3 S.D.). Therefore, debris or other
background signal from your sample could achieve this thresh-
old and be counted. High signal in both iridium channels
(Ir191 and Ir193) represents intact cells and is a useful first
gate (Fig. 1). The number of Intact cells/Singlets/Live cells
in a standard sample is often 50–60% of the total initially
counted by the machine.

Acknowledgments

The authors thank Sean Bendall for helpful discussions, and Sheena
Gupta and Meena Malipatlolla for contributing example data.
Development of this protocol was funded in part by grant 2 U19
AI057229 S4 from the National Institutes of Health.

References
1. Kalisky T, Quake SR (2011) Single-cell 7. Behbehani GK, Bendall SC, Clutter MR, Fantl
genomics. Nat Methods 8:311–314 WJ, Nolan GP (2012) Single-cell mass cytom-
2. Ornatsky O, Bandura D, Baranov V, Nitz M, etry adapted to measurements of the cell cycle.
Winnik MA, Tanner S (2010) Highly multipa- Cytometry A 81:552–566
rametric analysis by mass cytometry. J Immunol 8. Fienberg HG, Simonds EF, Fantl WJ, Nolan
Methods 36:1–20 GP, Bodenmiller B (2012) A platinum-based
3. Bandura DR, Baranov VI, Ornatsky OI, covalent viability reagent for single-cell mass
Antonov A, Kinach R, Lou X, Pavlov S, cytometry. Cytometry A 81:467–475
Vorobiev S, Dick JE, Tanner SD (2009) Mass 9. Maecker HT (2009) Multiparameter flow
cytometry: technique for real time single cell cytometry monitoring of T cell responses.
multitarget immunoassay based on inductively Methods Mol Biol 485:375–391
coupled plasma time-of-flight mass spectrom- 10. Maecker HT, Frey T, Nomura LE, Trotter J
etry. Anal Chem 81:6813–6822 (2004) Selecting fluorochrome conjugates for
4. Newell EW, Sigal N, Bendall SC, Nolan GP, maximum sensitivity. Cytometry A 62:169–173
Davis MM (2012) Cytometry by time-of- 11. Rundberg Nilsson A, Bryder D, Pronk CJ
flight shows combinatorial cytokine expression (2013) Frequency determination of rare popu-
and virus-specific cell niches within a contin- lations by flow cytometry: a hematopoietic stem
uum of CD8(+) T cell phenotypes. Immunity cell perspective. Cytometry A 83:721–727
36:142–152 12. Ornatsky OI, Kinach R, Bandura DR, Lou X,
5. Bendall SC, Simonds EF, Qiu P, Amir el AD, Tanner SD, Baranov VI, Nitz M, Winnik MA
Krutzik PO, Finck R, Bruggner RV, Melamed R, (2008) Development of analytical methods for
Trejo A, Ornatsky OI, Balderas RS, Plevritis SK, multiplex bio-assay with inductively coupled
Sachs K, Pe'er D, Tanner SD, Nolan GP (2011) plasma mass spectrometry. J Anal At Spectrom
Single-cell mass cytometry of differential immune 23:463–469
and drug responses across a human hematopoi- 13. Lovelace P, Maecker HT (2010) Multi-
etic continuum. Science 332:687–696 parameter intracellular cytokine staining.
6. Bodenmiller B, Zunder ER, Finck R, Chen TJ, Methods Mol Biol 699:165–178
Savig ES, Bruggner RV, Simonds EF, Bendall 14. Leipold MD, Maecker HT (2012) Mass
SC, Sachs K, Krutzik PO, Nolan GP (2012) cytometry: protocol for daily tuning and run-
Multiplexed mass cytometry profiling of ning cell samples on a CyTOF mass cytometer.
cellular states perturbed by small-molecule J Vis Exp. doi:10.3791/4398
regulators. Nat Biotechnol 30:858–867
 Chapter 8

Imaging Immunosenescence
Feng Qian and Ruth R. Montgomery

Abstract
To demonstrate effects of aging visually requires a robust technique that can reproducibly detect small
differences in efficiency or kinetics between groups. Investigators of aging will greatly appreciate the ben-
efits of Amnis ImageStream technology (www.amnis.com/), which combines quantitative flow cytometry
with simultaneous high-resolution digital imaging. Imagestream is quantitative, reproducible, feasible with
limited samples, and it facilitates in-depth examination of cellular mechanisms between cohorts of samples.

Key words Flow cytometry, Microscopy, Image analysis, Immune response, Signal transduction,
Aging, Monocyte, Dendritic cell, Neutrophil

1 Introduction

Advances in imaging techniques and analysis modalities present an

unprecedented ability to view cellular events and trace intracellular
signaling pathways and mechanisms [1]. Using transfected fluores-
cent proteins, it is now possible to resolve kinetics of cellular pro-
cesses, organelle localization, and dynamic interactions in living
cells by fluorescence recovery after photobleaching (FRAP).
Fluorescence resonance energy transfer (FRET) can localize mol-
ecules interacting within 2–6 nm or resolve temporal interactions
in living cells [1]. Super-resolution microscopy combines increased
sensitivity of imaging hardware with novel image analysis to achieve
nanometer resolution at the light level [2], and multiphoton imag-
ing allows deep penetration (500 nm) into living tissue with mini-
mal damage to surrounding tissue [3]. These dramatic advances in
imaging are now feasible for many general uses in cell biology, but
remain for the most part impractical for the study of aging,
although multiphoton imaging may be valuable for investigation
of differences in murine models of aging [3]. The use of imaging
to demonstrate effects of aging requires a robust visualization
technique that can detect small differences (10–30 %) in efficiency
or kinetics between groups and can be repeated routinely so that

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_8, © Springer Science+Business Media New York 2015

97
98 Feng Qian and Ruth R. Montgomery

samples from older or younger subjects may be directly compared.

The technique should be able to be conducted with minimal
manipulation of cells ex vivo and should not introduce new sources
of variability. Both FRAP and FRET entail introducing fluores-
cently labeled components into cells—by transfection or injec-
tion—to detect their localization or interaction in the cells. The
variability associated with adding these manipulations—potentially
different in cells of different ages—may mask the ability to detect
effects of aging.
For these reasons, the benefits of Amnis ImageStream technol-
ogy (www.amnis.com/) will be greatly appreciated among investi-
gators of aging. Imagestream combines quantitative flow cytometry,
which can be employed without manipulation of cells and has suffi-
cient sensitivity to assess differences from only a few thousand cells,
and combines it with simultaneous high-resolution digital imaging.
ImageStream allows gating of cell subsets and imaging of cell
responses from gated, but unsorted cell populations. Imagestream
has been employed to elucidate many cellular functions, e.g. to
quantify nuclear translocation of transcription factors [4], bacterial
phagocytosis and oxidative burst [5], as well as differences in signal-
ing in studies of aging subjects and disease cohorts [6–8].
Imagestream’s advantages include quantitation, reproducibility, fea-
sibility with limited samples, and ability to promote in-depth exami-
nation of cellular mechanisms between cohorts of samples. Here, we
provide a protocol to evaluate Toll-like Receptor (TLR) function in
monocytes from human peripheral blood mononuclear cells.

2 Materials

All samples must be collected in accordance with appropriate

IACUC, IRB, and biosafety regulations governing laboratory
investigation. Comparison groups must be carefully selected to
reduce any variations other than age such as manner of sample col-
lection and handling. Sufficient samples must be collected to sup-
port robust statistical analysis such as mixed effects modeling [9]
of factors such as gender, race, and co-morbid conditions.
1. AMNIS ImageStream X imaging cytometer (Amnis.com)
equipped with ≥4 lasers (Excitation lasers: 488 nm blue laser,
561 nm green laser, 642 nm red laser, 405 nm violet laser and
a Darkfield (SSC) laser 785 nm laser).
2. Computer: The Amnis IDEAS software currently requires a
32- or 64-bit Windows computer with recommended mini-
mum specifications as follows: a quad core processor with 4GB
of RAM and a PC bus speed of at least 1066 MHz. We have
not found the Imagestream analysis program files to be com-
patible with MAC computers.
 Imaging Immunosenescence 99

3. Fresh blood samples from younger and older human subjects

collected in anticoagulated vacutainer tubes or BD Vacutainer®
CPT™ Cell Preparation Tubes; or equivalent source of murine
cells.
4. Cell culture media and sera: RPMI, MEM, pooled human
serum or FBS for murine cells. We pre-screen aliquots of mul-
tiple test lots of serum from commercial sources (Lonza Group
Ltd., Gemini Bio-Products, Valley Biomedical Products &
Services, Inc.) to identify sera that optimize cell conditions.
We culture monocytes from two to five donors in each sera
and assess viability, morphology, and cytokine production in
response to ligand stimulation.
5. Buffers for flow cytometry: We use phosphate-buffered saline
(PBS) to wash cells, BD Staining Buffer and Perm/Wash buf-
fer (BD Biosciences, NJ) for antibody labeling, we fix cells in
4 % paraformaldehyde (Electron Microscopy Sciences) in PBS
(PFA/PBS), freezing buffer is 90 % FBS containing 10 %
DMSO.
6. Fluorescently conjugated monoclonal antibodies: lineage
markers Lin-1 (lineage-1 marker includes CD3, CD14, CD19,
CD20, CD56), HLA-DR, CD45, CD11c, CD123. Functional
markers: TLRs, signaling components (e.g., IRF1, IRF3,
IRF5, IRF7, NF-κB). Commercial sources for these antibod-
ies include BD Biosciences, BD Pharmingen, eBioscience,
Invitrogen, CA, SantaCruz Biotechnology, CA (Table 1).

Table 1
Antibody panel for cell lineage staining of signaling pathways

Cell type FITC PE Alexa 647 Pacific blue

Monocyte Anti-CD14 (61D3; NF-κB (anti-p65, C-20;
eBioscience) Santa Cruz)
Neutrophil Anti-CD15 (HI98; BD
Biosciences)
mDC Lin1 Anti-CD11c (S-HCl-3; NF-κB (anti-p65, C-20; Anti-CD4 (RPA-T4;
BD Biosciences) Santa Cruz) BD Biosciences)
pDC Lin1 Anti-CD123 (9 F5; BD NF-κB (anti-p65, C-20; Anti-CD4 (RPA-
Biosciences) Santa Cruz) T4 ; BD
Biosciences)
Monocyte: CD14+
Neutrophil CD15+
mDC: Lin1−, CD4dim, CD11c+
pDC: Lin1−, CD4dim, CD123+
Lin1 (lineage) marker includes CD3 (SK7), CD14 (MφP9), CD16 (3G8), CD19 (SJ25C1), CD20 (L27), CD56
(NCAM16.2)—the combination available from BD Biosciences
100 Feng Qian and Ruth R. Montgomery

3 Methods

1. Procedures with human blood should be conducted in a laminar

flow hood for Biosafety level 2 containment. Carry out proce-
dures at room temperature unless otherwise specified. To mini-
mize technical variability, samples can be collected and treated as
available and frozen to be assessed together at one time.
2. Obtain 10–50 ml heparinized blood from study volunteers
after written informed consent under the guidelines of the
local Institutional Review Board (see Note 1).
3. Dilute blood 1:1 with PBS.
4. Prepare 50 ml tubes with 12.5 ml filtered Ficoll-Hypaque Plus
gradient separation gradient gel (GE Healthcare, NJ, density
1.077 g/ml). Dispense approximately 35 ml diluted blood
very slowly and gently down the side of tube so that it forms a
layer of diluted blood over the Ficoll. Take care to minimize
any blood entering into the Ficoll layer.
5. Centrifuge at 800 × g for 20 min at RT with brake off; for CPT
tubes, centrifuge at 1500–1800 × g for 20 min at RT.
6. Peripheral blood mononuclear cells (PBMCs) will form a
white band in the middle of the tube. Using a pipette, remove
and discard the upper supernatant to within 0.5 cm of the cell
layer. Collect cells from the white layer into a new 15 ml tube
containing 5–7 ml RPMI.
7. Pellet cells at 500 × g for 10 min at 4 °C, discard supernatant,
and resuspend PBMC pellet in culture medium. For human
cells we use RPMI with 20 % human serum. With murine cells,
we use MEM with 10 % FBS.
8. Count cells and divide for treatment groups, ~1 × 106 cells/
condition. You may use wells of a 96-well plate or autoclaved
1.5 ml Eppendorf tubes.
9. To study kinetics of cell responses, add the stimulating agent
to the series of samples. In the example shown in Figs. 1 and 2,
we show mock treated cells and cells stimulated with flagellin
(2.5 μg/ml), a TLR5 agonist (see Note 2).
10. Incubate cells at 37 °C in 5 % CO2 incubator for the desired
time(s). If cells are to be incubated in PBS rather than tissue
culture medium, incubations should not be done in a 5 % CO2
atmosphere as PBS will not have sufficient buffering capacity
to maintain cultures at physiological pH. Instead when using
PBS choose a warm room or incubator with room air at 37 °C.
11. We label surface markers on the day of isolation and then cells
are fixed and stored in freezing buffer at −80 °C until all the
samples are collected. Intracellular markers are labeled in
batches of cells at one time to minimize assay variability.
 Imaging Immunosenescence 101

Fig. 1 Gating strategy for human monocytes from PBMCs. Monocytes are distinguished in gates with normal
nuclear dye DAPI intensity and high DAPI aspect ratio (R1) which are labeled with lineage marker CD14 (R2).
A high correlation of NF-κB with DAPI nuclear dye localization is reflected in a high similarity score and indi-
cates the degree of activation in CD14+ monocytes (R3)

12. To label cell surface lineage markers, we first remove the stim-
ulation medium by centrifuging samples at 300 × g for 10 min
at 4 °C, then remove the supernatant taking care to avoid dis-
turbing the pellet.
13. Wash cells once by resuspending samples in 200 μl cold
Staining Buffer, centrifuge at 300 × g for 10 min at 4 °C, and
discard the supernatant.
14. Label cells by resuspending samples in 50 μl Staining Buffer
containing specific antibodies or isotype controls and incubate
for 20 min at 4 °C protected from light. A sample staining
panel is shown in Table 1 (see Note 3).
15. At the end of the staining period, wash cells by adding 200 μl
cold Staining Buffer, and centrifuge at 300 × g for 10 min at
4 °C. Remove the supernatant.
16. Fix cells by adding 0.1 ml 4 % paraformaldehyde in PBS for
10 min at RT protected from light.
102 Feng Qian and Ruth R. Montgomery

Fig. 2 Translocation of NF-κB in human monocytes after stimulation. The translocation of NF-κB (p65) into the
nucleus after stimulation (R3) is depicted in populations of untreated and stimulated cells. The median value
of similarity scores is 1.16 in untreated sample and 2.34 in stimulated sample (a). Digital images collected
simultaneously of the untreated or flagellin-stimulated cell populations show representative cells and the
intensity of NF-κB translocated into the cell nucleus (b)

17. At the end of the fixation period, centrifuge samples at 500 × g

for 10 min at 4 °C. Remove the supernatant and resuspend
cells in 0.1 ml 90 % fetal calf serum/10 % DMSO for storing
at −80 °C.
18. To minimize technical variability, batches of untreated and
stimulated cells from a group of donors should be processed
together. On the day of analysis, thaw cells quickly in a 37 °C
water bath, and centrifuge at 500 × g to remove freezing
buffer.
19. Wash cells by adding 0.3 ml Staining Buffer (BD Biosciences),
and centrifuge at 500 × g for 10 min at 4 °C. Remove the
supernatant.
20. Before intracellular staining, resuspend cells in 0.2 ml
PermWash Buffer (BD Biosciences). Centrifuge at 500 × g for
10 min at 4 °C. Remove the supernatant.
21. Resuspend cells in 0.1 ml PermWash Buffer and incubate for
15 min at 4 °C. Centrifuge at 500 × g for 10 min at
4 °C. Remove the supernatant.
 Imaging Immunosenescence 103

22. Label intracellular signaling components or organelle struc-

tures with specific antibodies and isotype controls in PermWash
Buffer for 20 min at RT, e.g. rabbit anti-NF-κB (p65) anti-
body (10 μg/ml, SantaCruz Biotechnology, CA), detected
using F(ab’)2 goat anti-rabbit IgG-Alexa647 (Invitrogen,
CA). These incubations are conducted at RT according to the
instrument manufacturer.
23. Immediately prior to imaging, counterstain nuclei with DAPI
(final concentration 0.2 μg/ml, Invitrogen) or propidium
iodide (PI; final concentration 20 ng/ml, Invitrogen). These
concentrations should be optimized for new stocks of reagents
and for different cell types.
24. Power up ImageStream, launch INSPIRE software and load
default template as the setting. The calibration steps are auto-
mated by the instrument software. Initialize Fluidics and load
the SpeedBead calibration reagent (Amnis) until the Flow
Speed CV is consistently less than 0.2 %. To calibrate and test
the instrument, use “Start All” command in the ASSIST tab.
25. After the ImageStream system is calibrated, define instrument
settings using a sample that is bright in all the fluorescent
channels employed for the study samples. Load the experi-
ment’s brightest sample and set the laser power for each fluo-
rochrome to show maximum pixel values between 100 and
4000 counts, as measured in the dot plots. To normalize set-
tings of batches of samples, primary cells may be used if in
plentiful supply, or stored aliquots of frozen cells may be used.
Compensation beads are not recommended by Amnis because
speed control beads are used during the sample runs.
26. Set the “Cell Classification” criteria to eliminate collection of
unwanted events, and set a number of events to acquire
(a minimum of 5000 events for monocytes).
27. Click “FLL: Flush, Lock, Load.” The sample pathway will be
flushed first so wait until prompted before placing the sample
on the left sample uptake line. To initiate readings, load labeled
cells into sample chambers—either place a 96-well plate of
labeled cells in the sample plate dock for autoplate reader
instruments, or add tubes to the loading rack for instruments
that use tubes.
28. Begin collecting sample data using the “Run Acquire” com-
mand to collect the data and save the file. Once acquisition
finishes, click “FLL” to load the next sample. When finished
collecting data on the last sample, click “FLL” and leave the
system on. When the last user of the day is finished, choose
Sterilize System from the instrument menu to prepare for
shutting down.
104 Feng Qian and Ruth R. Montgomery

29. Design a gating strategy template for the study and apply the
gates equivalently across all study samples (see Note 4).
30. For data processing, identify monocytes using Amnis IDEAS
software and follow gates as shown in Fig. 1. To distinguish
in-focus single cells from debris, gate on events with a normal
nuclear dye DAPI intensity and high aspect ratio (defined as
the ratio of the width of a shape to its height) for DAPI (R1).
31. To identify monocytes, choose cells gated with high intensity
labeling of the CD14 marker (R2).
32. To identify activated cells after stimulation, the similarity score
of NF-κB and the nuclear dye DAPI will be calculated in
CD14+ cells. Similarity measures the degree to which two
images (NF-κB/DAPI) are correlated on a pixel-by-pixel
basis. A high correlation of NF-κB with DAPI, indicating co-
localization of the two markers, is reflected in a high
“Similarity” score (R3). After stimulation, the treated cells
were determined to have a significantly higher similarity score
of NF-κB p65 with DAPI, indicating that NF-κB p65 translo-
cated into the nucleus after stimulation. Representative images
of cells are shown in Fig. 2.
33. The labeling and gating strategy described here works well for
both monocytes and dendritic cells and should be effective for
other cell types that show nuclear translocation of NF-κB after
stimulation.
34. Differences between subject groups will be readily apparent
through dot plots, histograms, and cell images. Data represen-
tative of the study cohort may be presented as populations in
histogram format, and/or representative images (where they
are particularly compelling). Data from within a defined
gate—such as the “Similarity” score—can be tabulated for
each study subject and/or group and is suitable for statistical
determinations.

4 Notes

1. Design your experimental plan so that you can efficiently handle

the number of samples sufficiently quickly. Examining samples
from multiple study subjects at once reduces variability but only
when the protocol can be managed smoothly. If many condi-
tions per subject are required you may need to cap the maxi-
mum number of subjects you can assess per study day.
2. We have found it more efficient to add the stimulus at staggered
intervals and then harvest all the samples together to facilitate
staining at the final time point. We have found this is more effi-
cient for labeling all samples together at the final time point.
 Imaging Immunosenescence 105

In the example shown in Figs. 1 and 2, Flagellin was added at

time 0, 30, and 45 min for harvest at 60 min. In this way,
we determined changes evident after 60, 30, and 15 min of
stimulation.
3. To design a labeling panel, markers should be tested singly and
in combination to build a panel with specific signal after sub-
traction of isotype staining, consistent detection across the
channels, and faithful quantitation of each marker [6]. For tran-
scription factors that translocate into the nucleus, it is better to
use a small molecular weight dye such as Alexa 647 or FITC;
larger molecular weight dyes such as PE and PE-Texas Red may
reduce efficiency of translocation. Choices for additional anti-
bodies to include in the panel will be driven by the availability
of the antibody of choice in a given fluorochrome. Custom con-
jugations may be necessary for less common or lab-specific
markers. It may be necessary to design separate panels to detect
markers that form a complex in the cells of interest. For exam-
ple, we have found that we cannot detect authentic levels of
TLR4 in cells labeled with CD14, and we have substituted CD4
dim or CD11c staining to define cell lineage for samples in
which we measure TLR4.
4. While automated gating strategies are becoming more accurate
and gaining popularity, we find at present that individual varia-
tion among human subjects is best addressed by manual gating.

Acknowledgement

The authors are grateful to the Yale Human Immunophenotyping

Consortium and IMAGIN teams for insightful discussions.
Funding: This work was supported in part by the National
Institutes of Health (HHS N272201100019C, U19AI089992).
Conflicts of Interest: The authors declare no commercial or other
association that might pose a conflict of interest for this work.

References
1. Higashi T, Watanabe W, Matsunaga S (2012) 4. George TC, Fanning SL, Fitzgerald-Bocarsly P
Application of visualization techniques for cell et al (2006) Quantitative measurement of
and tissue engineering. J Biosci Bioeng 115: nuclear translocation events using similarity
122–126 analysis of multispectral cellular images obtained
2. Herbert S, Soares H, Zimmer C et al (2012) in flow. J Immunol Methods 311:117–129
Single-molecule localization super-resolution 5. Ploppa A, George TC, Unertl KE et al (2011)
microscopy: deeper and faster. Microsc ImageStream cytometry extends the analysis of
Microanal 18:1419–1429 phagocytosis and oxidative burst. Scand J Clin
3. Masedunskas A, Milberg O, Porat-Shliom N Lab Invest 71:362–369
et al (2012) Intravital microscopy: a practical 6. Qian F, Montgomery RR (2012) Quantitative
guide on imaging intracellular structures in live imaging of lineage specific Toll-like receptor
animals. Bioarchitecture 2:143–157 mediated signaling in monocytes and dendritic
106 Feng Qian and Ruth R. Montgomery

cells from small samples of human blood. J Vis monocytes of systemic lupus erythematosus
Exp 62:e3741 patients is triggered by circulating autoantigens
7. Qian F, Wang X, Zhang L et al (2012) Age- independent of type I interferons. Arthritis
associated elevation in TLR5 leads to increased Rheum 64:788–798
inflammatory responses in the elderly. Aging 9. Schluchter MD, Elashoff JD (1990) Small-
Cell 11:104–110 sample adjustments to tests with unbalanced
8. Stone RC, Feng D, Deng J et al (2012) repeated measures assuming several covariance
Interferon regulatory factor 5 activation in structures. J Statist Comput Simul 37:69–87
 Chapter 9

Activation-Induced Cytidine Deaminase and Switched

Memory B Cells as Predictors of Effective In Vivo
Responses to the Influenza Vaccine
Daniela Frasca, Alain Diaz, and Bonnie B. Blomberg

Abstract
Aging impairs humoral immune responses, leading to increased frequency and severity of infectious
diseases and reduced protective effects of vaccination. We have identified B-cell biomarkers that are reduced
by aging and that can be used as predictive markers of the response of an individual to vaccination. The
identification of these biomarkers will have an impact on the development of effective vaccines to protect
the elderly from infections and other debilitating diseases.

Key words Activation-induced cytidine deaminase, Class switch recombination, Antibody vaccine
response

1 Introduction

The enzyme activation-induced cytidine deaminase (AID) is essen-

tial for DNA cleavage required for both class switch recombination
(CSR) and somatic hypermutation (SHM) of Ig genes [1, 2].
These processes are crucial for the generation of high-affinity anti-
bodies and robust humoral immunity. CSR and SHM occur in ger-
minal center B cells in response to both T-dependent and
T-independent stimuli [3, 4]. AID triggers CSR and SHM by
deaminating cytosines in the variable and switch regions of the Ig
locus and converting them to uracils; the resulting mismatches are
recognized by specific enzymes and excised, leading to DNA
double-strand breaks [5, 6].
We [7, 8] and others [9] have shown that specific B-cell defects
occur during aging. These include decreases in CSR [7, 8, 10] and
in the ability to increase antibody affinity after antigenic challenge,
a direct result of SHM [11]—both dependent on the decrease in
expression of AID and the transcription factor E47 [8], whose

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_9, © Springer Science+Business Media New York 2015

107
108 Daniela Frasca et al.

activity is required for the efficient induction of AID transcription

[12]. These defects are at least in part responsible for the reduced
ability of elderly individuals to respond well to vaccination against
tetanus, encephalitis viruses, Salmonella, S. pneumoniae and influ-
enza [7, 10, 13–15].
We have recently identified B-cell-specific biomarkers which
can be used to track the in vivo response to the influenza vaccine.
These biomarkers are the in vitro vaccine-induced increase in
AID gene expression after vaccination and the ex vivo vaccine-
induced increase in the percentage of switched memory B cells
(CD19+IgD-CD27+), which are both significantly decreased with
age [7, 10]. Our results showing that switched memory B cells are
increased by influenza vaccination are of great importance because
these cells carry the immune memory of the individual in terms of
specific immune responses [16].
Moreover, AID expression can be measured in CpG-stimulated
B-cell (or PBMC) cultures before vaccination and can be used as a
predictive marker of the response of an individual to the influenza
vaccine. This AID response decreases with age and is positively
correlated with the in vivo humoral response, as evaluated by the
increase in antibody titers after vaccination. Also the percentage of
switched memory B cells measured in blood before vaccination
decreases with age and is correlated with the in vivo response to
the vaccine and therefore can be another good predictive marker of
the vaccine response. Here, we describe our protocol to measure
these two predictive markers of the response: AID in CpG-
stimulated B-cell cultures by quantitative (q)PCR and switched
memory B cells in blood by flow cytometry and we show how
these are correlated with the in vivo antibody response, measured
by hemagglutination inhibition assay (HAI) or by ELISA.

2 Materials

2.1 B-Cell Isolation We perform this procedure using the MACS Cell separation proto-
col from Miltenyi Biotec (Miltenyi), that is why we buy most of the
materials and reagents from this company.
1. Suspension of human PBMC in complete medium (RPMI
1640, supplemented with 10 % FBS, 10 μg/ml Pen-Strep,
1 mM Sodium Pyruvate, and 2 × 10–5 M 2-Mercaptoethanol
and 2 mM L-glutamine).
2. CD19 Microbeads (Miltenyi Biotec).
3. MACS buffer. A solution of 0.5 % fetal bovine serum (FBS) or
0.5 % Bovine Serum Albumin in 1× Phosphate-Buffered Saline
(PBS).
 AID and Memory B Cells in Vaccine Response 109

4. MS columns with plungers (Miltenyi).

5. MACS separator (Miltenyi).
6. Trypan blue 0.2 %. Dilute stock solution of Trypan blue 0.4 %
1:1 with 1× phosphate-buffered saline (PBS). Store at room
temperature.

2.2 B-Cell Culture 1. Complete medium.

2. CpG (Invivogen ODN 2006).

2.3 mRNA Extraction 1. μMACS mRNA isolation kit (Miltenyi), containing Oligo
(dT) Microbeads, Lysis/Binding, Wash and Elution buffers.
2. Lysate clear columns and μMACS columns (Miltenyi).
3. μMACS separator (Miltenyi).

2.4 Quantitative To reverse transcribe mRNA and obtain cDNA:

(q) PCR
1. PCR buffer II and MgCl2, Deoxynucleoside triphosphates
[dNTPs: dATP, dCTP, dGTP, dTTP], Random hexamers,
MuLV Reverse transcriptase, RNase inhibitor. All reagents are
from Life Technologies.
To amplify cDNA:
1. Taqman gene assay master mix, primers + probe mix
(Hs00221068, AID; Hs99999905, GAPDH) (Life
Technologies).
2. qPCR microplates and plastic covers (Life Technologies).

2.5 Flow Cytometry 1. Human blood.

2. APC-conjugated anti-CD19 (clone HIB19), PE-conjugated
anti-CD27 (clone M-T271), FITC-conjugated anti-IgD
(clone IA6-2) antibodies (see Note 1).
3. RBC Lysing Solution BD PharmLyse (BD).
4. FACS buffer (Dissolve 9.8 g Hanks Balanced Salts, 0.35 g
NaHCO3, 1 g BSA, 0.2 g Sodium Azide in deionized water
for 1 L of buffer).
5. Fixation buffer (BD Cytofix).

2.6 In Vivo Antibody This can be measured by the hemagglutination inhibition assay
Response (HAI), which is the most established correlate with vaccine protec-
tion [7, 10, 17, 18]. The technique is not described here but it will
be used below for correlations with our B-cell-specific biomarkers
(see Figs. 1 and 2).
110 Daniela Frasca et al.

AID after stimulation with CpG

at t0 (relative expression)
0.5

0.4

0.3

0.2

0.1
p=0.0030
0.0
0 100 200 300 400
Vaccine-specific HAI
(reciprocal of the titers
after vaccination)

Fig. 1 The in vitro AID response of B cells to CpG at t0 is significantly correlated

with the serum response. Thirty-two subjects (16 young and 16 elderly), enrolled
during the 2011–2012 influenza vaccination season, were evaluated. Results are
expressed as raw qPCR values of AID mRNA, calculated as 2−ΔCt. AID value is the
fraction of the value of GAPDH, e.g. 0.25 means AID is ¼ of the amount of
GAPDH. The serum response is measured by the reciprocal of the titers after vac-
cination as evaluated by the HAI assay. A titer of 1:40 indicates protection and a
positive response. Pearson’s r = 0.5175, p = 0.0029 (two-tailed). Open symbols:
young; filled symbols: elderly
Switched memory B cells at t0

8
(% of CD19+)

p=0.0081
0
0 100 200 300 400
Vaccine-specific HAI
(reciprocal of the titers
after vaccination)

Fig. 2 The percentage of switched memory B cells at t0 significantly correlates

with the in vivo serum response. The same subjects of Fig. 1 were evaluated. The
percentages of switched memory B cells are evaluated by flow cytometry at t0.
The serum response is measured by the reciprocal of the titers after vaccination
as evaluated by the HAI assay. A titer of 1:40 indicates protection and a positive
response. Pearson’s r = 0.4548, p = 0.0089 (two-tailed). Open symbols: young;
filled symbols: elderly
 AID and Memory B Cells in Vaccine Response 111

3 Methods

3.1 Isolation This procedure should be performed under a laminar flow hood to
of Human B Cells preserve sterility and in a BSL-2 laboratory, implementing all the
by Positive Selection adequate safety measures for working with potentially infectious
with CD19 Microbeads human samples. All personnel should be immunized with the
Hepatitis B vaccine.
Positive selection of B cells is the best protocol to obtain highly
purified B cells, without other contaminating cell types (T cells,
NK cells, monocytes, macrophages). In long-term cultures (2–7
days), B cells isolated with this procedure, compared to B cells
isolated with negative selection, give comparable results. Negative
selection should be preferred only in studies on signal transduction
performed in minutes from selection (5–30 min), in order to avoid
effects of antibody cross-linking of cell surface proteins.
1. Resuspend PBMC in MACS buffer at a concentration of
107 cells/80 μl of buffer (see Note 2).
2. Add CD19 Microbeads (20 μl per 107 cells), mix well, and incu-
bate for 15–20 min at 4 °C. Usually the B-cell yield is about
2–10 % of the total PBMC. A minimum of 105 B cells can be
used for activation in culture and reliable detection of AID.
3. Wash cells with 5 ml of buffer, by centrifuging at 300 × g for
10 min. Discard supernatant and resuspend in 500 μl of MACS
buffer.
4. Place the MS columns (one per sample) in the MACS separa-
tor, rinse the columns with 500 μl of MACS buffer and apply
cell suspension onto the column.
5. Wash the column twice with 500 μl of MACS buffer.
6. Remove column from the separator and place it in a centrifuge
tube for collection of the adherent fraction.
7. Add 1 ml of complete RPMI onto the column, and collect
CD19+ cells by pushing the plunger into the column. Count
the cells by Trypan blue exclusion dye with a hemocytometer.

3.2 Culture 1. Resuspend the B cells at a concentration of 106/ml of com-

and Stimulation plete RPMI (see Note 3).
of Human B Cells 2. Add CpG to a final concentration of 1 μg/ml (see Note 4).
3. Incubate the cells at 37 °C, 5 % CO2, for 5–7 days (see Note 5).
In case cryopreserved PBMC are used, incubation time should
be only 3 days.

3.3 mRNA Extraction 1. Extract mRNA from cultured cells using the μMACS mRNA
from Activated Human isolation kit. Before starting, the Lysis/Binding buffer and the
B Cells Wash buffer should be brought to room temperature, whereas
the Elution buffer must be heated at 65 °C in a water bath.
112 Daniela Frasca et al.

2. Collect cultured cells by pipetting up and down several times

(see Note 6).
3. Centrifuge at 300 × g for 5 min and remove the supernatant.
4. Resuspend the cells in maximum of 0.7 ml of Lysis/Binding
buffer.
5. Apply lysate on top of the LysateClear Column and centrifuge
at 13,000 × g for 3 min to remove any debris and reduce vis-
cosity of the lysate.
6. Add 50 μl of Oligo (dT) Microbeads to the lysate and mix.
Further incubation is not necessary for the hybridization of
mRNA to Oligo (dT) Microbeads.
7. Place a μMACS Column in the magnetic field of the μMACS
separator, rinse the column with 100 μl of Lysis/Binding buf-
fer and let buffer run.
8. Apply cell lysate on top of the column matrix and let it run
through. Magnetically labeled mRNA is retained in the
column.
9. Rinse column twice with 200 μl of Lysis/Binding buffer to
remove proteins and DNA and then four times with 100 μl of
Wash buffer to remove rRNA and DNA. Wait until buffer runs
through before each rinsing step.
10. To elute mRNA, apply 120 μl of 65 °C pre-heated Elution
buffer to the column. mRNA is eluted by gravity. Collect the
second, third, and fourth drops (see Note 7).

3.4 qPCR 1. To reverse transcribe mRNA and obtain cDNA, prepare a

to Detect AID reaction RT mix by pipetting the following reagents: 1 μl
DNase/RNase-free water, 4 μl MgCl2, 2 μl PCR Buffer II,
2 μl of each dNTPs, 1 μl random hexamers, 1 μl MuLV Reverse
transcriptase, 1 μl RNase inhibitor. This RT mix will be mixed
in an Eppendorf (0.2 ml) tube with 18 μl (1:1; vol:vol) of the
mRNA obtained as described above.
2. Place the Eppendorf tubes in the thermocycler and run the
samples at the following conditions: 1 cycle of 40 min at
42 °C, followed by 1 cycle of 5 min at 65 °C.
3. To run qPCR and detect AID, prepare a reaction mix by pipet-
ting the following reagents to the wells of a PCR microplate:
10 μl Taqman gene assay master mix, 1 μl primers + probe mix
(for AID or GAPDH), 5 μl DNase/RNase-free water, 4 μl of
the cDNA sample. Seal the microplate with an adhesive cover
and quickly spin it for 20 s at 300 × g to mix the reagents well.
4. Run the qPCR reaction in an ABI 7300 system machine. The
settings are the following: 1 cycle of 2 min at 50 °C, then 1
cycle of 10 min at 95 °C, followed by 40 cycles of 15 s at
95 °C plus 1 min at 60 °C. The ABI 7300 software calculates
 AID and Memory B Cells in Vaccine Response 113

the number of amplification cycles at which transcripts reach a

significant fluorescence threshold (Ct) for the sample gene
(AID) and the housekeeping gene (GAPDH). Then Ct values
for the housekeeping gene are subtracted from those of the
target gene (ΔCt) and the following formula is calculated and
used as qPCR value: 2−ΔCt, as reported previously [19]. CpG-
induced AID expression before vaccination is positively cor-
related with the serum response and therefore can be used as
a predictive marker of the response of an individual to the
vaccine (Fig. 1).

3.5 Evaluation 1. To evaluate the switched memory B-cell subset, 100 μl of

of Switched Memory B blood is stained with fluorescent-labeled antibodies to CD19,
Cells by Flow CD27, and IgD. Switched memory B cells are CD19+IgD−
Cytometry CD27+. With the same staining protocol, it is possible also to
measure the other major B-cell subsets: naive
(CD19+IgD+CD27−), IgM memory (CD19+IgD+CD27+),
and late/exhausted memory (CD19+IgD−CD27−).
2. After 20 min incubation at room temperature, red blood cells
are lysed using the RBC Lysing solution. Then samples are
washed thoroughly with FACS buffer and fixed using Cytofix
solution. Up to 105 events in the lymphocyte gate are acquired
on an LSR-Fortessa (BD), equipped with five lasers, and ana-
lyzed using FACS Diva (BD) software. Any FACS equipment
capable of measuring three colors simultaneously can be used.
Single color controls are included in every experiment for
compensation. Switched memory B-cell percentages before
vaccination are positively correlated with the serum response
and therefore can also be used as predictive markers of the
response to the vaccine (Fig. 2).

4 Notes

1. We had previously used the IgG+/IgA+ stain instead of IgD

to identify the memory subsets [7, 10, 20] which agree in
general with these, but in order to measure B-cell subsets in
cryopreserved cells the former is problematic because IgG and
IgA markers are lost during the freezing/thawing procedure.
Therefore, we switched to the protocol that includes IgD.
2. Cryopreserved PBMC can also be used, thawed and rested in
complete medium in a 5 % CO2 incubator at 37 °C, for at least
1 h (and up to 3 h).
3. For cultures of 5 × 105 cells or less, use a 48-well tissue culture
plate, otherwise, seed the cells in a 24-well plate.
4. A stock solution of 1 mg/ml of CpG should be prepared and
stored for use.
114 Daniela Frasca et al.

5. We have shown in kinetic experiments that the optimum

expression of AID occurs after this time in culture.
6. At least 20 times are required to recover most of the cells from
the wells.
7. The second to fourth drop will contain more than 90 % of the
isolated mRNA in a volume of approximately 75 μl. Store
mRNA at −80 °C until use.

References
1. Okazaki IM, Kinoshita K, Muramatsu M et al 11. Khurana S, Frasca D, Blomberg B et al (2012)
(2002) The AID enzyme induces class switch AID activity in B cells strongly correlates with
recombination in fibroblasts. Nature 416: polyclonal antibody affinity maturation in-vivo
340–345 following pandemic 2009-H1N1 vaccination
2. Yoshikawa K, Okazaki IM, Eto T et al (2002) in humans. PLoS Pathog 8:e1002920
AID enzyme-induced hypermutation in an 12. Sayegh CE, Quong MW, Agata Y et al (2003)
actively transcribed gene in fibroblasts. Science E-proteins directly regulate expression of
296:2033–2036 activation-induced deaminase in mature B
3. Pone EJ, Zan H, Zhang J et al (2010) Toll-like cells. Nat Immunol 4:586–593
receptors and B-cell receptors synergize to 13. Gardner EM, Bernstein ED, Dran S et al
induce immunoglobulin class-switch DNA (2001) Characterization of antibody responses
recombination: relevance to microbial anti- to annual influenza vaccination over four years
body responses. Crit Rev Immunol 30:1–29 in a healthy elderly population. Vaccine
4. Stavnezer J, Guikema JE, Schrader CE (2008) 19:4610–4617
Mechanism and regulation of class switch recom- 14. LeMaoult J, Szabo P, Weksler ME (1997)
bination. Annu Rev Immunol 26:261–292 Effect of age on humoral immunity, selection
5. Muramatsu M, Nagaoka H, Shinkura R et al of the B-cell repertoire and B-cell develop-
(2007) Discovery of activation-induced cyti- ment. Immunol Rev 160:115–126
dine deaminase, the engraver of antibody 15. McElhaney JE, Effros RB (2009)
memory. Adv Immunol 94:1–36 Immunosenescence: what does it mean to
6. Rada C, Williams GT, Nilsen H et al (2002) health outcomes in older adults? Curr Opin
Immunoglobulin isotype switching is inhib- Immunol 21:418–424
ited and somatic hypermutation perturbed 16. Amanna IJ, Carlson NE, Slifka MK (2007)
in UNG-deficient mice. Curr Biol 12: Duration of humoral immunity to common
1748–1755 viral and vaccine antigens. N Engl J Med
7. Frasca D, Diaz A, Romero M et al (2010) 357:1903–1915
Intrinsic defects in B cell response to seasonal 17. Murasko DM, Bernstein ED, GardnerE M
influenza vaccination in elderly humans. et al (2002) Role of humoral and cell-medi-
Vaccine 28:8077–8084 ated immunity in protection from influenza
8. Frasca D, Landin AM, Lechner SC et al (2008) disease after immunization of healthy elderly.
Aging down-regulates the transcription factor Exp Gerontol 37:427–439
E2A, activation-induced cytidine deaminase, 18. Skowronski DM, Tweed SA, De Serres G
and Ig class switch in human B cells. J Immunol (2008) Rapid decline of influenza vaccine-
180:5283–5290 induced antibody in the elderly: is it real, or is
9. Gibson KL, Wu YC, Barnett Y et al (2009) it relevant? J Infect Dis 197:490–502
B-cell diversity decreases in old age and is cor- 19. Schmittgen TD, Livak KJ (2008) Analyzing
related with poor health status. Aging Cell real-time PCR data by the comparative C(T)
8:18–25 method. Nat Protoc 3:1101–1108
10. Frasca D, Diaz A, Romero M et al (2012) 20. Frasca D, Diaz A, Romero M et al (2011) Age
Unique biomarkers for B-cell function predict effects on B cells and humoral immunity in
the serum response to pandemic H1N1 influ- humans. Ageing Res Rev 10:330–335
enza vaccine. Int Immunol 24:175–182
 Chapter 10

Analyzing the Effect of Aging on CD8+ T-Cell Phenotype

Using Flow Cytometry
Min Sun Shin and Insoo Kang

Abstract
One of the most noticeable changes in T-cell immunity with aging is the expansion of memory CD8+ T
cells, with a decline in naïve phenotype T cells that reflects both diminished thymopoiesis and the effects
of chronic antigenic stimulation with age. Flow cytometry is a useful tool in evaluating immune cells
including the phenotype characteristics of different T-cell subsets. Here, we show flow cytometric methods
measuring the different subsets of human CD8+ T cells that change with aging.

Key words Human, T cells, Flow cytometry

1 Introduction

T cells are a component of the adaptive immune system characterized

by immunological memory. The progenitors for T cells that develop
in the bone marrow migrate to the thymus where they become
immature T cells or thymocytes [1, 2]. After undergoing positive and
negative selection, a small number of immature T cells are exported
into the circulation as mature but naïve T cells [2, 3]. Upon the rec-
ognition of appropriate antigen in the context of the major histo-
compatibility complex (MHC) and receiving co-stimulation from
antigen-presenting cells (APCs) in secondary lymphoid tissues, naïve
T cells become activated, proliferate, and differentiate into effector
cells [2]. Once the source of antigen (e.g. viral infection) is removed,
most effector T cells die but a few cells survive and become memory
T cells providing long-term immune protection.
T cells can be classified into CD4+ and CD8+ T cells. The for-
mer cells recognize antigen presented in the context of MHC class
II molecules while the latter cells recognize antigen presented in the
restriction of MHC class I molecules. CD4+ and CD8+ T cells that
are referred as T helper (Th) and cytotoxic T cells, respectively, have
distinct functions although both cell populations can produce cyto-
kines. The primary function of CD4+ T cells is to help other immune

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_10, © Springer Science+Business Media New York 2015

115
116 Min Sun Shin and Insoo Kang

cells like B cells and monocytes become fully activated by producing

cytokines and expressing co-stimulatory molecules [1, 4]. CD8+ T
cells with the expression of cytotoxic molecules destroy infected
host cells or tumor cells [5]. Th cells can be further divided into
Th1, Th2, and Th17 cells based on the cytokines dominantly pro-
duced by these cells. Th1 and Th2 cells produce high levels of IFN-γ
and IL-4, respectively, while Th17 cells produce IL-17 [2, 6].
Alterations in T-cell immunity occur with aging. Probably, the most
noticeable change in T-cell immunity is the expansion of memory T
cells, in particular CD8+ T cells [2, 7]. Such expanded memory
CD8+ T cells have increased expression of natural killer (NK) cell-
associated molecules, loss of CD28 expression as well as decreased
expression of interleukin 7 receptor alpha chain (CD127) [2]. Of
interest, reactivation of latent cytomegalovirus infection has been
linked to the expansion of memory CD8+ T cells [8].
Human naïve and memory T cells are traditionally classified by
the reciprocal expression of the T-cell receptor (TCR) co-receptors
CD45RA and CD45RO. Memory T cells can be divided into cen-
tral and effector memory cells (CM and EM, respectively) based
on the expression of lymphoid tissue homing molecules such as
CCR7 and CD62L [9]. CCR7 expressed on CM T cells allows
them to migrate to secondary lymphoid tissues [9]. Based on the
expression of CD45RA and CCR7, human CD4+ and CD8+ T
cells are divided into naïve (CD45RA+CCR7+), central (CM,
CD45RA-CCR7+), and effector (EM, CD45RA−CCR7−) mem-
ory cells (Fig. 1) [7, 9]. In CD8+ T cells, an additional subset of
EM cells with the expression of CD45RA but not CCR7 is found.
This subset can be referred to as CD45RA+ EM CD8+ T cells
(Fig. 1). Aging also affects the expression of cell surface molecules
such as IL-7Rα (CD127) on T cells [2, 10]. The expression of
these molecules including CD45RA, CCR7, and IL-7Rα can be
easily measured using flow cytometry.
Flow cytometry is a technology that is used to analyze the
phenotype and function of cells that has become an essential tool
in studying immune cells including T cells in humans and animals
(reviewed in Ref. [11]). Over the past decade, hardware and soft-
ware for flow cytometry have substantially advanced. Here, we
show flow cytometric methods to identify subsets of human CD8+
T cells that change with aging.

2 Materials

1. Blood collection tubes with anticoagulants (heparin, EDTA,

or acid citrate dextrose) (BD Bioscience).
2. Ficoll-Paque PLUS (GE Healthcare).
3. Antibodies to CD3, CD4, CD8, CD45RA, chemokine receptor
(CCR7), and IL-7 receptor alpha chain (CD127) (see Table 1)
(see Note 1 for CD127 polyclonal goat antibodies).
 Flow Cytometric Analysis of CD8 T Cell Subsets 117

a b lymphocytes c CD3+ T cells d CD8+ T cells

250K 5 5
10 10
6000
200K
4 4
10 10
150K 4000
3 3
10 10
100K

CCR7
2000

CD6
2
SSC

10
50K 0
0
0 0
2 3 4 5 2 3 4 5 2 3 4 5
0 50K 100K 150K 200K 250K 0 10 10 10 10 0 10 10 10 10 0 10 10 10 10

FSC CD3 CD4 CD45RA

e CD8+ T cells

1.Naive 2.CM 3.CD45RA- EM 4.CD45RA+ EM

100 100 100 100
IL-7Ra
80 80 80 80

60 60 60 60
Isotype
40 40 40 40

20 20 20 20

0 0 0 0
3 4 5 3 4 5 3 4 5 3 4 5
0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10

Fig. 1 Identification of different CD8+ T cell subsets with differential expression of IL-7Rα in human peripheral
blood using flow cytometry. Peripheral blood was drawn into a heparinized tube from a healthy control after
obtaining informed consent. Peripheral blood mononuclear cells (PBMCs) were purified by Ficoll-Paque centrifu-
gation. PBMCs were stained with antibodies to CD3, CD4, CD8, CD45RA, CCR7 and IL-7Rα or isotype antibodies.
Stained cells were analyzed on an LSRII® flow cytometer. (a) Lymphocytes were identified by forward and side
light scatters. (b–c) CD4+ and CD8+ T cells were identified based on CD3, CD4 and CD8 expression. (d) Naïve
(CD45RA+ CCR7+), central memory (CM, CD45RA− CCR7+), CD45RA− effector memory (EM, CD45RA− CCR7-)
and CD45RA+ effector memory (CD45RA+ CCR7−) CD8+ T cells are identified. (e) IL-7Rα expression by differ-
ent CD8+ T cell subsets is detected based on staining with antibodies to IL-7Rα (open) and isotype control

Table 1
Antibodies used in analyzing T-cell phenotype

Antibody Clone (manufacturer)

APC-Cyc7 CD3 SK7 (BD Bioscience)
Alexa700 CD4 RPA T4 (BD Bioscience)
PB CD8 RPA-T8 (BD Bioscience)
PE-Cy5 CD45RA HI100 (BD Bioscience)
PE-Cy7 CCR7 3D12 (BD Bioscience)
IL-7Rα (CD127) Clone 40131 (R&D Systems)

4. Donkey anti-goat IgG antibodies conjugated with FITC

(Molecular Probes).
5. 1× Phosphate buffered saline (PBS) and FACS Buffer (PBS,
0.5–1 % bovine serum albumin (BSA, Sigma-Aldrich)).
6. 2 % paraformaldehyde (PFA) solution: Dilute 32 % PFA
1:32 in 1× PBS. Store at 4 °C.
118 Min Sun Shin and Insoo Kang

3 Methods

1. Peripheral blood is collected into tubes containing heparin or

EDTA (BD Vacutainer® or equivalent).
2. Mix blood with PBS at 1:1–3 ratio (V/V) (see Note 2).
3. Place 15 ml of Ficoll-Paque PLUS into a 50 ml conical tube.
4. Slowly layer the 20 ml of diluted blood onto the Ficoll, avoid-
ing mixing the blood and Ficoll.
5. Spin sample at 400 × g for 30 min at room temperature with
no brake.
6. Carefully collect PBMC layer into a separate 50 ml tube using
a Pasteur pipette and mix with PBS up to 40 ml.
7. Wash cells by spinning sample at 200 × g for 5–10 min at room
temperature. Repeat this step.
8. Count cells.
9. Resuspend cells with FACS buffer at 1 × g 107 cells/ml
(see Note 3).
10. Place 1 × 106 cells (0.1 ml) into a 12 × 75 mm, 5 ml polystyrene
round bottom test tube (see Note 4).
11. Add the appropriate amounts of antibodies or isotype controls
to each tube (see Note 5). Mix cells with antibodies by vortex-
ing gently.
12. Incubate cells for 30 min at room temperature (see Note 6).
13. Wash cells with FACS buffer by spinning at 200–300 × g for
5 min. This step can be repeated.
14. Add donkey anti-goat IgG antibodies conjugated with FITC
and incubate for 30 min at room temperature.
15. Wash cells with FACS buffer by spinning at 200–300 × g for
5 min. This step can be repeated.
16. Add 200 μl of 2 % PFA in FACS buffer and incubate at room
temperature for 15–30 min.
17. Wash cells with FACS buffer by spinning at 200–300 × g
for 5 min.
18. Resuspend cells with 200 μl of FACS buffer.
19. Acquire data according to the flow cytometer instruction at
individual institutions.
20. Analyze the acquired data using appropriate software (e.g.
FlowJo). Identify lymphocyte population using forward and
side scatter. Based on isotype control staining, populations
positively and negatively stained for individual molecules can
be identified.
 Flow Cytometric Analysis of CD8 T Cell Subsets 119

4 Notes

1. Monoclonal and polyclonal antibodies are available for human

IL-7Rα chain (CD127). We prefer goat polyclonal antibodies
from R&D Systems since these antibodies provide the most
optimal results in identifying EM CD8+ T cells with high and
low levels of IL-7Rα.
2. Higher dilution with PBS may increase the yield of PBMC
purification.
3. PBMCs can be resuspended at lower or higher concentrations.
4. A cocktail of multiple antibodies (e.g. anti-CD3, CD4, CD8,
CD45RA, and CCR7) can be used to stain multiple samples.
5. The number of tubes to be set up depends on the number of
antibodies to be used. Also, tubes for isotype, unstained, and
single color controls should be included as appropriate.
6. Incubation temperature should be determined according to
the manufacturer’s instruction for individual antibodies.

References
1. Reiner SL (2007) Development in motion: memory and effector CD8+ T cells. Mech
helper T cells at work. Cell 129:33–36 Ageing Dev 125:615–618
2. Lee N, Shin MS, Kang I (2012) T-cell biology 8. Lee WW, Shin MS, Kang Y et al (2012) The
in aging, with a focus on lung disease. J relationship of cytomegalovirus (CMV) infec-
Gerontol A Biol Sci Med Sci 67:254–263 tion with circulatory IFN-alpha levels and IL-7
3. Starr TK, Jameson SC, Hogquist KA (2003) receptor alpha expression on CD8(+) T cells in
Positive and negative selection of T cells. Annu human aging. Cytokine 58:332–335
Rev Immunol 21:139–176 9. Sallusto F, Lenig D, Forster R et al (1999)
4. Murphy KM, Stockinger B (2010) Effector T Two subsets of memory T lymphocytes with
cell plasticity: flexibility in the face of changing distinct homing potentials and effector func-
circumstances. Nat Immunol 11:674–680 tions. Nature 401:708–712
5. Cui W, Kaech SM (2010) Generation of effec- 10. Kim HR, Hong MS, Dan JM et al (2006)
tor CD8+ T cells and their conversion to Altered IL-7R{alpha} expression with aging
memory T cells. Immunol Rev 236:151–166 and the potential implications of IL-7 therapy
6. Shin MS, Lee N, Kang I (2011) Effector T-cell on CD8+ T-cell immune responses. Blood
subsets in systemic lupus erythematosus: 107:2855–2862
update focusing on Th17 cells. Curr Opin 11. Soloski MJ, Chrest FJ (2013) Multi-parameter
Rheumatol 23:444–448 flow cytometry for discovery of disease mecha-
7. Hong MS, Dan JM, Choi JY et al (2004) Age- nisms in rheumatic diseases. Arthritis Rheum
associated changes in the frequency of naive, 65:1148–1156
 Chapter 11

Cell-Mediated Immune Response to Influenza

Using Ex Vivo Stimulation and Assays of Cytokine
and Granzyme B Responses
Janet E. McElhaney and Beth Gentleman

Abstract
The antibody response to vaccination has been the industry and regulatory standard for evaluating influenza
vaccine efficacy. Although antibodies are an important defense mechanism providing sterilizing immunity,
in older adults, the cellular immune response is also needed for clinical protection against the serious com-
plications of influenza. Thus, the demonstration of enhanced antibody responses as a strategy for advanc-
ing new influenza vaccines through the standard clinical development pipeline may fail to translate to
enhanced protection in the older population. In peripheral blood mononuclear cells (PBMC) challenged
with live influenza virus, an increase in the interferon-γ:interleukin-10 (IFN-γ:IL-10) ratio and the level of
the cytolytic mediator, granzyme B (GrzB), correlates with protection against influenza in vaccinated older
adults. This chapter provides detailed methods for measuring these cell-mediated immune responses,
which have been validated according to the International Conference on Harmonisation (ICH) guide-
lines. These immune correlates could be combined with antibody responses to improve the prediction of
enhanced protection in vaccine trials in the older population.

Key words Influenza, Granzyme B, IL-10, IFN-gamma, Aging

1 Introduction

Largely supported by our work showing that antibody titers against

influenza do not predict protection in older adults [1], there has been
a paradigm shift in understanding the limitations of antibody titers as
a sole measure of influenza efficacy [2]. Thus, antibody titers alone as
a correlate of protection may fail to detect vaccine failures. This is not
to say that antibodies are not an important defense mechanism, but
suggests that the cellular immune response is also needed for clinical
protection against influenza in older adults. In peripheral blood
mononuclear cells (PBMC) challenged with live influenza virus, we
have shown that risk for influenza illness in older adults correlates
with a reduced interferon-γ:interleukin-10 (IFN-γ:IL-10) ratio in
PBMC supernatants and a low level of the cytolytic mediator,

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_11, © Springer Science+Business Media New York 2015

121
122 Janet E. McElhaney and Beth Gentleman

granzyme B (GrzB), in PBMC lysates [1]. Assays of the ex vivo

response (GrzB and IFNγ:IL-10) to influenza challenge have been
developed, validated (according to the International Conference on
Harmonisation guidelines) [3], and established as correlates of pro-
tection [1, 4] and as indicators of influenza disease severity [5] in
older adults. The assay of GrzB activity capitalizes on the enzyme’s
unique substrate specificity for cleavage at the aspartate residue of
the modified peptide IEPDpna, resulting in paranitroanalide (pna)
release that correlates with cytolytic activity in influenza-stimulated
peripheral blood mononuclear cells [6]. Assays of GrzB and the
IFNγ:IL-10 ratio validated for precision and robustness in four
international laboratories compare very favorably with humoral
assays; a 25 % difference in the means can be detected with 95 %
confidence in as few as 13 subjects/group for GrzB activity and 33
subjects/group for the IFNγ:IL-10 ratio [3]. To establish specific-
ity with respect to the response to influenza virus, we have shown
that in older adults with acute respiratory illness, GrzB levels
increase following the illness only in those with laboratory-
confirmed influenza illness (LCII). Prior to infection, a low level of
GrzB and INFγ:IL-10 ratio was highly correlated (r = 0.99, p = 0.03)
with the presence of febrile influenza illness (i.e., more severe ill-
ness) [5]. Thus, these assays of the cell-mediated immune response
to influenza could complement serologic measures of vaccine effi-
cacy in the selection of novel influenza vaccines to advance through
the clinical development pipeline.

2 Materials

2.1 Abbreviations PBMC Peripheral blood mononuclear cell.

TC Tissue culture.
HAU Hemagglutination units.
MOI Multiplicity of infection.
VP Virus particles.

2.2 Equipment/ 1. Biological safety cabinet (BSL2 facilities).

Supplies for PBMC 2. Microcentrifuge (Beckman, Eppendorf, or equivalent).
Stimulation
3. CO2 Incubator (37 °C).
with Influenza Virus
and Culture Harvest 4. Refrigerator (2–8 °C) for storage of medium and reagents.
5. Freezer (−70/80 °C) for storage of supernatant and lysate
samples.
6. Conical, PP 1.5 mL microcentrifuge tubes for collection of cell
lysates (red color or equivalent).
7. Skirted, PP 2.0 mL cryogenic tube, siliconized/low retention,
with screw caps, and O-rings for collection of culture
supernatants.
 Cytokine and Granzyme B Assessment of Influenza Response 123

8. Screw caps for 2.0 mL cryogenic tubes (yellow color or

equivalent).
9. Sterile/autoclaved, conical polypropylene (PP) 5 mL centrifuge
tubes.
10. Disposable, sterile, individually wrapped serological pipettes
(10, 25, and 50 mL).
11. Pipette Aid for use with serological pipettes.
12. Rack, open, 42 × 1.5 mL microcentrifuge tubes.
13. Cardboard storage boxes, 81 place for supernatant and lysate
tubes.
14. Tissue culture plates, 48 well, sterile, TC treated, individually
wrapped (Corning or equivalent).
15. Micropipettes ranging from 10 to 1000 μL.
16. Sterile precision pipette tips (10–1000 μL) for micropipettes.
17. Equipment for counting cells: microscope, hemocytometer
(Burker chamber, Kova chamber, or equivalent) or other count-
ing instrument such as the Countess automated cell counter
(Invitrogen) with counting chamber slides (Invitrogen).
18. Cryopreservation labels for identifying vials, 1.5–2 mL size
vials.
19. Cryopreservation labels for identifying vials, circles for vial
tops.
20. Tilting stand, adjustable for holding TC plates—optional
Gloves (latex, vinyl, nitrile).
21. Laboratory Coat.
22. Appropriate biohazard waste bags and containers.

2.3 Equipment/ 1. Plate reader.

Supplies 2. Microcentrifuge with refrigeration (4 °C) capacity (Beckman,
for Immunologic Eppendorf, or equivalent).
Assays
3. CO2 Incubator (37 °C).
4. Refrigerator (2–8 °C) for storage of medium and reagents.
5. Freezer (−70/80 °C) for storage of lysate samples.
6. Vortex apparatus.
7. Humidified Chamber (see Note 1).
8. Water Bath (37 °C).
9. Conical, PP 1.5 mL microcentrifuge tubes for collection of cell
lysates and for preparation of standards (red color or
equivalent).
10. Microtiter plates, flat bottom, nontreated, 96 well (Nunc or
Corning) (see Note 2).
11. Thermoplastic plate sealers.
124 Janet E. McElhaney and Beth Gentleman

12. Disposable, sterile, individually wrapped serological pipettes

(10, 25, and 50 mL).
13. Pipette Aid for use with serological pipettes.
14. Rack, open, 42 × 1.5 mL microcentrifuge tubes.
15. Single channel micropipettes ranging from 10 to 1000 μL and
multichannel pipettes with 200 μL dispense capacity.
16. Reagent reservoirs, to hold master mix when dispensing to
plates.
17. Precision pipette tips (10–1000 μL) for micropipettes and
multichannel pipettes.
18. Cryopreservation labels for identifying vials, 1.5–2 mL size vials.
19. Cryopreservation labels for identifying vials, circles for vial
tops.
20. Laboratory Coat and Gloves (latex, vinyl, nitrile).
21. Appropriate biohazard waste bags and containers.

2.4 Reagents 1. AIM V serum-free cell culture medium (Invitrogen, cat #

for Virus Stimulation 12055083 (Gibco)); store in refrigerator.
2. Trypan Blue (0.4 %) for staining cells during counting procedure;
store at room temperature.
3. Influenza A/Puerto Rico/8/34 (H1N1), purified, live virus
(Charles River, cat # 10100374); store at −80 °C.
4. Influenza A/Aichi/68 (H3N2), purified, live virus (Charles
River, cat # 10100375); store at −80 °C.
5. Influenza A/Victoria/3/75 (H3N2), purified, live virus
(Charles River, cat # 10100376); store at −80 °C.
6. Influenza B/Lee/40, purified, live virus (Charles River, cat #
10100379); store at −80 °C.

2.5 Reagent 1. All the Influenza virus strains detailed are routinely used to
Preparation for Virus stimulate PBMC samples but other virus strains or stimulants
Stimulation such as Concanavalin A can be used.
2. For each virus strain (stock tube and dilution tube), resuspend
and mix well with micropipette before creating aliquots or
stimulating cultures. Virus particles tend to settle to the
bottom of the tube and may not reach full infectivity if insuf-
ficiently distributed.
3. Thaw each stock tube quickly by rolling in between hands and
once thawed, create aliquots (to limit freeze/thaw cycles) of
the appropriate size based on the number of stimulations to
be performed per week, and then immediately refreeze and
store at −80 °C. Do not create aliquots smaller than 100 μL.
Also, if all of the aliquot is not used, do not refreeze as more
 Cytokine and Granzyme B Assessment of Influenza Response 125

than a total of two freeze/thaw cycles will affect the viability

of the virus.
4. Dilute the stock virus in Aim V medium to deliver a multiplic-
ity of infection (MOI) of 2 in a 20 μL volume to each PBMC
culture (see Note 3).
5. Make a fresh batch of diluted virus every week for PBMC
culture stimulations, as it is only good for 5 days when stored
at 4 °C.
6. Do not make up diluted virus at final volumes greater than
3 mL to effectively deliver the right amount of stimulation to
each culture.
7. Concanavalin A (Con A) at a final concentration of 2 μg/mL
is a good positive control for PBMC cultures.

2.6 Reagents 1. Colorimetric Substrate—Isoleucine-Glutamate-Proline-

for Immunologic Aspartate-paraNitroanalide (IEPDpNA) (EMD Chemicals, cat
Assays # 368067, 5 mg size); store at −20 °C for up to 2 years.
2. Triton X-100; store at room temperature.
3. Sodium Chloride (NaCl); store at room temperature.
4. CHAPS (Sigma Aldrich, cat # C5070, 5 g size); store at room
temperature.
5. Dimethylsulfoxide (DMSO); store at room temperature.
6. HEPES; store at room temperature.
7. Tris-HCI store at room temperature.
8. Sucrose; store at room temperature.
9. Hydrochloric acid, 1 N (HCl); store at room temperature.
10. Sodium Hydroxide, 10 N (NaOH); store at room
temperature.
11. Biomol Granzyme B, human recombinant (Enzo Life Sciences,
cat # SE-238, 50 μL or 5000 U size); store at −80 °C (GrzB
activity is quite stable across multiple years when stored at
−80 °C).
12. BCA Protein Assay Kit (Pierce); store at room temperature.
13. Dithiothreitol, 99 % (DTT) (5 g size); store at 4 °C.
14. Bovine Serum Albumin (BSA) Fraction V, ≥96 % (Sigma
Aldrich, cat # A9647, 10 g size); at 4 °C.

2.7 Reagent 1. Cell Lysis Buffer—final concentrations:

Preparation (a) 150 mM NaCl.
for Immunologic
(b) 15mM Tris-HCI.
Assays
(c) 1 % Triton X-100.
126 Janet E. McElhaney and Beth Gentleman

For 200 mL volume Cell Lysis Buffer, combine:

Tris-HCI 3.63 g
Triton X-100 2 mL
Deionized H2O 100 mL
NaCl 1.753 g

● Adjust pH to 8.0 using HCl (~15–20 mL of 1 N HCl) and

adjust final volume to 200 mL. Store at 4 °C, expires after
~6 months (see Note 4).
2. Cell Lysis Buffer with BSA:
(a) Cell Lysis Buffer with the addition of BSA is used specifically
to prepare the GrzB standards (ONLY GrzB standards).
Remove a portion of Cell Lysis Buffer from your stock
bottle, add 2 μg/μL BSA (or 2 mg/mL), and transfer to
new bottle and label appropriately. Store at 4 °C, expires
after ~6 months.
3. 2× Reaction Buffer—final concentrations:
(a) 20 % Sucrose.
(b) 0.2 % CHAPS.
(c) 100 mM HEPES, pH 7.5.
For 500 mL volume 2× Reaction Buffer, combine:

Sucrose 100 g
CHAPS 1g
HEPES 23.83 g
Deionized H2O 400 mL

● Adjust pH to 7.5 using NaOH (~5 mL of 10 N NaOH)

and adjust final volume to 500 mL. Store at 4 °C, expires
after 6–9 months.
4. Biomol Granzyme B standard preparation:
(a) Must be handled with particular care in order to retain
maximum enzymatic activity.
(b) Defrost quickly by rubbing between fingers, spin down
briefly in mini-centrifuge (~5 s) to ensure all GrzB is
collected in the base of the tube and then immediately
place on ice.
(c) To limit the number of freeze/thaw cycles, aliquot the GrzB
into separate tubes (5 μL fractions). To create the aliquots,
remove 1.5 mL precooled tubes from fridge and place on
ice. Initially, resuspend the GrzB standard thoroughly and
in between each 5 μL aliquot transfer also resuspend thor-
oughly to ensure delivery of the same amount of GrzB to
 Cytokine and Granzyme B Assessment of Influenza Response 127

each tube. Change pipette tips in between each transfer,

and when dispensing 5 μL, place pipette tip right to bottom
of the tube and ensure the entire contents in the tip are
discharged.
(d) Immediately freeze the GrzB standard aliquots by placing
the tubes in an open rack and snap freeze at −80 °C.
(e) The above steps should be performed as quickly as possible.
5. DTT Preparation:
(a) Combine 1.54 g of DTT (MW 154.25) with 10 mL
deionized H2O to make a 1 M solution. Note: When pre-
paring DTT work in fume hood.
(b) Aliquot in to 1.5 mL tubes, store at −80 °C until ready for
use, and limit to one freeze/thaw cycle. Once thawed, it
should be stored at 4 °C and can be used for up to 1 week;
the supply should be as fresh as possible.
6. Colorimetric Substrate Preparation:
(a) IEPDpNA, stored at −20 °C (5 mg of MW 634.6), is dis-
solved in 400 μL of DMSO to a concentration of
20 mM. When adding the DMSO, drip it along the sides
of the vial to fully collect all the substrate, which may be
adhering to the sides of the vial. After the addition of
DMSO, roll the vial in between your hands to further
encourage the substrate to dissolve and then vortex
(medium speed for ~10 s). Resuspend well before addition
to assay master mix. Undissolved substrate remnants may
still persist in the bottom of the vial and appear almost
gum-like; therefore, be diligent to ensure the entire vial
contents are fully dissolved.
(b) Use fresh substrate preparations in the assay master mix
and make up just before addition to the master mix.
Leftover substrate preparations may be stored at −20 °C
for later use but limit to one freeze/thaw cycle.

3 Methods

The purpose of this Standard Operating Procedure (SOP) is to

describe the methodological steps necessary to: (1) stimulate
PBMC with live influenza virus in order to obtain cell culture
supernatants for cytokine assays and cell culture lysates for
Granzyme B (GrzB) measurements; (2) determine Granzyme B
(GrzB) levels from human peripheral blood mononuclear cell
(PBMC) lysates using (a) assay of GrzB activity (Units) and (b)
protein level to calculate GrzB levels as Units/mg protein. Cytokine
assays on PBMC supernatants are completed using multiplex assays
according to the manufacturer’s directions.
128 Janet E. McElhaney and Beth Gentleman

3.1 Stimulation 1. After isolation and counting of PBMC, the final cell concentration
of PBMC with Live is to be adjusted to 3 × 106 viable PBMC/mL suspended in
Influenza Virus AIM V medium (see Note 5).
2. Distribute 0.6 mL of 3 × 106 cells/mL cell suspension to the
appropriate number of wells in the tissue culture plate pre-
pared for virus stimulation. Each culture well is stimulated
with only one virus strain; therefore, when testing multiple
strains of virus, set up the necessary number of cultures to test
all the required strains/subject (final number of cells per well:
3 × 106 cells/mL × 0.6 mL/well = 1.8 × 106 cells/well).
3. Stimulate each well with virus (MOI = 2) by placing pipette tip
directly into culture and injecting the contents. Place the TC
plate in a 37 °C CO2 incubator for 20 h and then harvest the
culture supernatants and cell lysates (see Note 6).

3.2 Harvesting Cell 1. Remove cell culture plates from 37 °C CO2 incubator, and
Culture Supernatants inspect cultures under microscope to observe changes to
and Cell Lysates PBMC. It is not necessary to centrifuge the plate as the cells
will have all settled to the bottom of the culture wells within
the 20 h incubation period.
2. Working in the biological safety cabinet, remove the superna-
tants and transfer to 2 mL cryogenic tubes. To avoid drawing
up cells at the bottom of the well and remove as much super-
natant as possible, tilt the plate towards you, at a gentle/slight
angle so as to not draw the cells down, and get as close to the
bottom of the well as possible without touching it. Then, draw
up the supernatant from the front corner of the well very
slowly. It’s important that only approximately ≤20 μL of
supernatant remains in the well to minimize dilution of the
lysis buffer to be added.
3. During the collection process, tubes with cell supernatants
should be placed on ice and then frozen at −80 °C for later use
in assay for cytokines.
4. After removing the supernatant, add 200 μL Cell Lysis Buffer
to the well containing 1.8 × 106 cells/culture. If the cell quan-
tity/culture changes, adjust the amount of Cell Lysis Buffer
added accordingly. Process at room temperature. To ensure no
drying of the cells after you have removed the supernatant,
immediately add the Cell Lysis Buffer and process each well
individually before moving on to the next (see Note 7). To
effectively lyse all the cells, scrape the bottom of the well thor-
oughly (approximately minimum of 1 min scrapping/well) with
the pipette tip (use a motion as if coloring), being sure to scrape
along the edges as well and then resuspend a couple times, from
the front corner of the well, to fully collect all the lysate and
transfer this suspension to 1.5 mL microcentrifuge tubes.
During this step it is also important to avoid the formation of
 Cytokine and Granzyme B Assessment of Influenza Response 129

bubbles, which will hinder the removal of all the lysate from the
well. To avoid bubbles, use a fluid motion and avoid picking
up the pipette tip, keeping it in constant contact with the well
bottom. The well should appear clean after successful removal
of cells (see Note 8).
5. Once the lysate has been transferred to a tube, let each lysate
sit for approximately 5–10 min at room temperature to allow
the Triton X-100 to fully permeate the cells. If processing
larger batches of cultures, after 5–10 min at room temperature,
transfer the lysate tubes to ice and then freeze within 30 min of
collection to preserve GrzB activity. Freeze the lysates in open
racks at −80 °C to ensure quick freezing and then once frozen
transfer to freezer storage boxes. Do not store at −20 °C under
any conditions.
6. When ready, continue to GrzB/Protein and Multiplex
Cytokine assays.

3.3 Lysate 1. Prepare the cell lysates by completing three freeze/thaw cycles,
Preparation vortexing after each thaw cycle:
(a) Place tubes in −80 °C freezer until the lysates are frozen
(~5 min in open racks to allow faster freeze cycles).
(b) Immediately place the tubes into a 37 °C water bath for
~2 min or until the frozen lysates have thawed. Do not
leave unattended in water bath.
(c) Vortex the samples vigorously (high speed for 30 s).
(d) Immediately repeat the freeze/thaw cycle two more times.
2. Using a refrigerated microcentrifuge, centrifuge samples at top
speed (~16,000 × g) for 5 min to 4 °C to keep the lysates cold
and to pellet cell debris, nuclei, and DNA.
3. Remove most of the lysate while safely avoiding contact with
the pellet (~150 μL of lysate is removed if the original volume
of Cell Lysis Buffer used to lyse the cells was 200 μL as leaving
behind 50 μL is best to fully avoid the pellet—contact with
the pellet introduces contaminants which introduces back-
ground activity to the GrzB assay) and transfer to two fresh-
labeled tubes (100 μL dispensed into one tube and 50 μL in
other tube). When splitting lysate between tubes, resuspend
well in between to dispense the same concentration of protein
into the tubes. One aliquot can be used for initial GrzB/
Protein assays (need minimum of ~70 μL for both assays) and
the other for later repeats if necessary. For this entire step all
original sample tubes and transfer tubes (precool) need to be
on ice (see Note 9).
4. Continue to keep samples on ice, to preserve GrzB activity, and
proceed directly to GrzB/Protein assays or freeze at −80 °C
until later use (limit to one freeze/thaw cycle) (see Note 10).
130 Janet E. McElhaney and Beth Gentleman

3.4 Determination Assay Principle: Lysates are transferred to microtiter plates following
of Granzyme B Activity three freeze/thaw cycles and incubated with the substrate IEPDpNA
(Part A: Granzyme (Isoleucine-Glutamate-Proline-Aspartate-paraNitroanalide). GrzB (a
Assay) serine protease) levels are measured by cleavage of the substrate,
IEPDpNA at the aspartate (D) residue. The released paranitroanalide
(pNA) forms a yellow colored end product within 20 h at 37 °C in a
humidified container.
1. Biomol Standard Preparation:
(a) Standards are prepared from Biomol GrzB units; initial
stock is supplied as 100 U/μL in 50 μL total starting vol-
ume. Begin with a 1:67 dilution for the top (A) standard
by adding 328.3 μL cell lysis buffer containing 2 μg/μL
BSA (BSA preserves the GrzB enzyme activity) to a 5 μL
stock aliquot of Biomol GrzB. This will result in a new
concentration of 1.5 GrzB units/μL (see Note 11).
(b) Prepare an additional seven standard tubes; label “B to H”
(see recipe below).

Volume of Final
Volume diluenta volume
of biomol GrzB (μL) (μL) Final biomol units
5 μL stock 328.3 166.7 30 units (A)
166.7 μL of (A) 166.7 166.7 15 units (B)
166.7 μL of (B) 166.7 166.7 7.5 units (C)
166.7 μL of (C) 166.7 166.7 3.75 units (D)
166.7 μL of (D) 166.7 166.7 1.875 units (E)
166.7 μL of (E) 166.7 166.7 0.938 units (F)
166.7 μL of (F) 166.7 166.7 0.469 units (G)
0 μL 166.7 166.7 0 units (only Cell Lysis Buffer
with 2 μg/μL BSA) = blank (H)
a
Cell lysis buffer w/BSA
(c) When performing the standard serial dilutions, be sure to
vortex each tube (medium speed for ~5 s), resuspend well,
transfer appropriate volume, and change pipette tip after
every volume transfer. Also, minimize bubble formation.
After final volume transfer to standard G, draw up and dis-
card 166.7 μL which will result in the same volume of
standard in all tubes (see Note 12).
2. Pipette 20 μL in duplicate of each standard (A–H) to the
appropriate wells of microtiter plate using a micropipette (see
plate template below). Before use, vortex the tube (medium
speed for ~5 s), resuspend and directly dispense the appropriate
Cytokine and Granzyme B Assessment of Influenza Response 131

volume to the plate. Resuspend standards between replicates

(see Note 13).
3. Pipette 20 μL in duplicate of each lysate sample after standards
to the appropriate wells. Before use, vortex the tube (medium
speed for ~5 s), resuspend well, and directly dispense the
appropriate volume to the plate. Also resuspend sample
between replicates (see Notes 13 and 14).

1 2 3 4 5 6 7 8 9 10 11 12
A 30 units Unknown samples 1–40 in duplicate
B 15 units
C 7.5 units
D 3.75 units
E 1.875 units
F 0.938 units
G 0.469 units
H 0 units

4. Master Mix Preparation:

(a)
Individual well Final concentration
50 μL (2×) Reaction Buffer 1×
1 μL (1 M) DTT 10 mM
2 μL (20 mM) Colorimetric 400 μM
Substrate, IEPDpNA
27 μL Deionized H2O
80 μL total/well

(b) Be sure to make up enough master mix daily to run all plates
(# of samples + # standards + minimum 20 % extra).
(c) Directly after a batch of master mix is prepared and just
before addition to the plates, thoroughly mix by very gen-
tle inversion of tube to avoid formation of bubbles.
5. Pipette 80 μL of previously prepared master mix to all wells
with a multichannel pipette (see Note 15).
6. Cover each plate with a thermoplastic seal and seal very well to
prevent moisture from entering wells.
7. Incubate for 20 h in a dark humidified chamber at 37 °C
( see Notes 1 and 16).
8. Once the plates have been placed in the incubator, immediately
proceed to the protein assay (Part B).
9. After 20 h incubation, read the plates using a single wavelength
on the plate reader. Measure the absorbency of GrzB at 405 nm
(see Note 17).
132 Janet E. McElhaney and Beth Gentleman

10. Determine the concentration of GrzB in Biomol units/20 μL

lysate using a quadratic curve with a log (concentration)-linear
(absorbance) plot (see Note 18).

3.5 Determination Assay Principle: The BCA Protein Assay is a detergent-compatible

of Granzyme B Activity formulation based on bicinchoninic acid (BCA) for the colorimet-
(Part B: Protein Assay) ric detection and quantitation of total protein. This method com-
bines the well-known reduction of Cu2+ to Cu1+ by protein in an
alkaline medium (the Biuret reaction) with the highly sensitive and
selective colorimetric detection of the cuprous cation (Cu1+) using
a unique reagent containing bicinchoninic acid. The purple-
colored reaction product of this assay is formed by the chelation of
two molecules of BCA with one cuprous ion. This water-soluble
complex exhibits a strong absorbance at 562 nm.
1. Initial BCA Standard Preparation:
(a) Prepare 9 × 1.5 mL tubes; label one tube “Stock” and the
remaining eight “A–H”.
(b) Transfer contents of BSA standard vial to “Stock” tube.
Vortex vial vigorously (between medium to high speed
for ~10 s), resuspend thoroughly, and then transfer to
the tube.
(c) Add the appropriate volume of Cell Lysis Buffer to the
remaining tubes (see recipe below).
(d) At this point, keep the Stock tube and standard tubes
containing Cell Lysis Buffer at room temperature. The
final preparation of the standards, with the addition of
BSA, will be completed after the lysate samples are plated
(see Note 19).

Volume Volume of Final volume Final BSA concentration

of BSA diluenta (μL) (μL) (standard letter)
50 μL Stock 50 50 1000 μg/mL (A)
50 μL of (A) 50 50 500 μg/mL (B)
50 μL of (B) 50 50 250 μg/mL (C)
50 μL of (C) 50 50 125 μg/mL (D)
50 μL of (D) 75 75 50 μg/mL (E)
50 μL of (E) 50 90 25 μg/mL (F)
10 μL of (F) 40 50 5 μg/mL (G)
0 μL 50 50 0 μg/mL (only Cell Lysis
Buffer) = blank (H)
a
ONLY pure Cell Lysis Buffer used as standard diluent for BCA Assay

2. Pipette 10 μL in triplicate of each lysate sample to the appro-

priate wells of microtiter plate (leave columns 1–3 of the plate
 Cytokine and Granzyme B Assessment of Influenza Response 133

free for standards and begin plating the samples at column 4).
Before use, vortex the tube (medium speed for ~5 s), resus-
pend well, and directly dispense the appropriate volume to the
plate. Also, resuspend between replicates (see Note 13). Keep
samples and microtiter plate cold at all times during the plating
process in same manner as the GrzB assay.
3. Final BCA Standard Preparation:
(a) While the plates, loaded with samples, remain in the fridge,
complete preparation of the standards by adding the appro-
priate volume of BSA to tubes as per the recipe.
(b) When performing the standard dilutions be sure to vortex
each tube (between medium to high speed for ~5 s), resus-
pend well, transfer appropriate volume, and change pipette
tip after every volume transfer. Also, minimize bubble
formation.
4. Unused BSA stock should be stored at 4 °C and is good for 1
week. Pipette 10 μL in triplicate of each standard (A–H) to
the appropriate wells of microtiter plate (columns 1–3).
Before use, vortex the tube (between medium to high speed
for ~5 s), resuspend well, and directly dispense the appropri-
ate volume to the plate. Also, resuspend between replicates
(see Notes 13 and 20).
5. Determine quantity of A + B reagent needed at 200 μL per well,
then dilute A:B at 50:1, and mix by inversion/swirling until the
solution becomes clear green (for a single plate: 22.540 mL
reagent A + 460 μL reagent B → provides 20 % extra).
6. Add 200 μL of the A + B mixture to all wells with a multichannel
pipette (see Note 21).
7. Cover each plate with a thermoplastic seal and incubate in CO2
incubator at 37 °C for 30 min (see Note 22).
8. Wipe bottom of microtiter plate before inserting in plate
reader.
9. Read plate immediately at 560 nm.
10. Determine the concentration of protein in μg/mL using linear
curve fit.

3.6 Calculation 1. Limits of the assay:

of Granzyme B Activity (a) Check the uniformity of the standard curves intra-assay
(Units/mg Protein) and inter-assay and check that the r2 value of the standard
curve is greater than 0.990 prior to accepting the results.
Any plate that does not meet these criteria is rejected.
(b) Check that each standard dilution point has a Coefficient
of Variance (CV) ≤ 20 %. Any standard curve not meeting
these criteria is rejected.
134 Janet E. McElhaney and Beth Gentleman

(c) Check that each sample concentration (after subtraction of

the blanks) is ≥blank concentration. If the concentration
of an unknown is less than the concentration of the blank,
then the sample concentration is rejected and must be
re-assayed.
(d) Check that each sample concentration has a %CV ≤ 20 %
for GrzB assay and %CV ≤ 10 % for protein assay. If the
result gives a %CV ≥ 20 % or %CV ≥ 10 % or if only one of
the replicate wells is calculated, do not accept the result.
The unknown must be re-assayed (see Note 23).
2. Obtain GrzB concentration in Biomol units/20 μL lysate and
protein concentration in μg/mL from the plate reader soft-
ware reports.
(a) Divide the Biomol units/20 μL of GrzB by the μg
protein/mL.
(b) To determine the protein values in mg protein/mL, divide
the μg/mL protein by 1000.
(c) Multiply your answer by 1000 μL (same as 1 mL) to correct
for the 1 mL unit in the protein concentration (mg/mL)
and cancel the μL unit from 20 μL lysate. Express the final
answer as Biomol units/mg protein (see Note 24).

3.7 Determination We use the Bio-Ples Pro color-coded, bead-based multplex assays
of INFγ and IL-10 that are designed to measure multiple cytokines in diverse solu-
Cytokine Levels tions including serum, plasma, and tissue culture supernatants.
IFNg and IL-10 levels are measured in harvested PBMC superna-
tant samples.

4 Notes

1. For the humidified chamber, any plastic container with a lid

will be sufficient, line the bottom with a layer of wet paper
towels and an additional top layer to cover the assay plate.
2. Plates which provide optical clarity are necessary and newer
plates are preferred, old stock may not be optimal due to the
sensitivity of the assay; therefore, only purchase the plates as
specified.
3. The following are the calculations for preparation of the virus
strains:
(a) To set up 3.0 × 106 PBMC/mL at 0.6 mL volume cul-
tures = 3.0 × 106 × 0.6 mL = 1.8 × 106cells/culture. PBMC
are stimulated at a MOI of 2, which means there should be
twice as many virus particles (VP) as PBMC; therefore
1.8 × 106 cells × 2 = 3.6 × 106 VP/culture is needed.
Cytokine and Granzyme B Assessment of Influenza Response 135

(b) An effective volume of diluted virus to add to each culture

has been determined to be 20 μL; therefore the 20 μL ali-
quot contains 3.6 × 106 VP = 3.6 × 106 VP/20 μL = 1.8 × 105
VP/μL OR 1.8 × 108 VP/mL. 20 μL is the optimized
volume to reproducibly deliver the same amount of virus
without appreciably changing the overall culture volume.
(c) Convert the titer of the stock virus to the concentration VP/
mL, using the approximated conversion factor for influenza
virus, that 1 Hemagglutination Unit (HAU) = 1 × 104 VP.
Alternatively, the antilog of the median tissue culture infective
dose (TCID50) or the number of plaque forming units (pfu)
is equivalent to the number of VP in your calculations.
(d) To prepare the final virus dilution, use the following
calculation:
● C1V1 = C2V2.
● C1 = Virus concentration of original stock virus.
● V1 = X (the volume of virus to be prepared).
● C2 = Final concentration of diluted virus to effectively
deliver a MOI of 2 to each culture.
● V2 = Final volume of diluted virus you will use for
stimulations, i.e.: 20 cultures to stimulate per day × 5
days (1 week) × 20 μL per culture × 1.20 (20 %
extra) = 2.400 mL.
(e) Example calculations:
● Charles River Influenza Strain: A/Victoria/3/75
(H3N2)
Original total volume: 1 mL.
Stock → 32,768 HAU/50 µL.
=655.36 HAU/µL.
=655,360 HAU/mL.
Conversion: 1 HAU = 1x104 VP.
655,360 HAU/mL × 1 × 104 VP/HAU = 6.5536
× 109 VP/mL.
Using C1V1 = C2V2:
(6.5536 × 109 VP/mL) (V1) = (1.8 × 108 VP/mL)
(2.400 mL).
V1 = 0.066 mL virus stock + 2.334 mL Aim V
Media
● Charles River Influenza Strain: B/Lee/40
Original total volume: 1 mL
Stock → 262,144 HAU/50 µL
=5242.88 HAU/µL
=5.24288 × 106 HAU/mL
Conversion: 1 HAU = 1 × 104 VP
136 Janet E. McElhaney and Beth Gentleman

5.24288 × 106 HAU/mL × 1 × 104 VP/HAU =

5.24288 × 1010 VP/mL
Using C1V1 = C2V2:
(5.24288 × 1010 VP/mL) (V1) = (1.8 × 108
VP/mL) (2.400 mL)
V1 = 0.008 mL virus stock + 2.392 mL Aim V
If dealing with a highly concentrated stock virus as
specified for B/Lee above, a 2-step dilution is alterna-
tively recommended as follows:
● Dilution 1:
If prepared 100 µL aliquots of stock virus, you
would use almost the entire aliquot:
(5.24288 × 1010 VP/mL) (0.085 mL) = (C2)
(2.400 mL) → add 0.085 mL virus stock + 2.315 mL
Aim V
C2 = 1.85685 × 109 VP/mL
● Dilution 2:
(1.85685 × 109 VP/mL) (V1) = (1.8 × 108 VP/mL)
(2.400 mL)
V1 = 0.233 mL virus from Dilution 1 + 2.167 mL
Aim V
4. The Cell Lysis Buffer is used to prepare the standards for both
the GrzB and protein assays, so the same batch of Cell Lysis
Buffer should ideally be used to prepare the standards and the
subject samples to be tested. To ensure the same batch of Cell
Lysis Buffer is used, the buffer can be used up to 9 months if
necessary. This can be an important consideration if subject
lysates samples are being collected over a longer period of time
prior to being tested. As microbial growth in the Cell Lysis
Buffer will affect the blank sample reading for the protein assay,
to a greater degree with time, it is advisable to further mini-
mize microbial growth by removing desired quantities under a
biosafety cabinet with sterile serological pipettes.
5. To set up a smaller number of culture quantities per subject,
such as five or less, it may be best to make up the desired final
cell concentration in a new tube (i.e., 5 mL tube), which can
help minimize the amount of culture media used, particularly
when starting with concentrated cell suspensions.
(a) Example: if original cell concentration is 8 × 106 cells/mL
and only three cultures required.
(b) Use C1V1 = C2V2:
● (8 × 106 cells/mL) (V1) = (3 × 106 cells/mL) (2.0 mL)
→ 3 cultures × 0.6 mL × 0.200 extra = 2.0 mL
● Solve for V1, V1 = 0.750 mL; therefore, transfer
0.750 mL of your original cell suspension to a
 Cytokine and Granzyme B Assessment of Influenza Response 137

new tube and add 1.250 mL Aim V (2.0 mL −

0.750 mL = 1.250 mL) to make up your desired final
cell concentration.
(c) If you notice what may appear to be any remaining platelet
clusters in your original cell suspension, avoid drawing
them up in your pipette tip when transferring to make up
your final cell concentration as it can affect culture purity
and thus cell performance during the incubation with the
virus (platelets can deplenish culture media nutrients).
6. If time constraints do not permit harvesting the cultures at
exactly 20 h, the incubation period can range from a minimum
of 20 h to an absolute maximum of 24 h.
7. The maximum amount of time allowed between removing the
supernatant and adding the Cell Lysis Buffer, to prevent any
drying of the cells, is 5 min.
8. To remove the supernatant without touching the cell pellet
and to effectively collect all of the cell lysate from the culture
well, it can be helpful to use an adjustable tilting stand to hold
the TC plate, at the appropriate angle, during the above
process. The tilting stand can help you acquire the right angle
to be able to observe the bottom of the culture well and posi-
tioning of your pipette tip while removing the supernatant but
also avoid tilting the plate too much as to draw the cells down.
The stand can also help you find the right angle to make sure
the Cell Lysis Buffer covers the entire well surface, during the
lysing process, and ensures the best tilt for resuspension and
collection.
9. The pellet may look more like mucous at the bottom of the
tube rather than a dense pellet; therefore take note of this to
further aid in pellet avoidance.
10. Both the GrzB and Protein assays should be performed on the
same day to leave one lysate aliquot banked for any future
repeat assays (order: first GrzB assay and second Protein assay).
In the case of preparing lysates and proceeding directly to per-
forming the assays on the same day, limiting the number of
plates to be run per day (i.e., ~5 plates total = 2 GrzB + ~3
Protein) is suggested. If all your lysates are first prepared and
frozen, then more plates/day can be run (i.e., 8 plates total = 3
GrzB + 5 Protein). This will better preserve GrzB activity in
the sample and limit the gap in time between when the sam-
ples were first plated and the master mix added.
11. Standard Dilution Explanation:
(a) Using C1V1 = C2V2.
● C1 = 100 U/µL; V1 = 5 µL; C2 = if plate 20 µL/well
and desire 30 U/well top standard, what are the final
units/µL = 30 U/20 µL = 1.5 U/µL; V2 = the volume
138 Janet E. McElhaney and Beth Gentleman

of standard to be prepared → (100 unit/µL) (5 µL)

= (1.5 unit/µL) (V2).
● V2 = 333.3 μL.
● Add 328.3 μL Cell Lysis Buffer w/BSA to 5 μL
Biomol GrzB to create top standard (A).
12. To ensure everything is kept cold, precool the standard tubes,
only add cold Cell Lysis Buffer w/BSA, and place all tubes on
ice the entire time.
13. Due to the nature of the Cell Lysis Buffer as media, if the
micropipette leaves an insignificant residual sample in the tip
at the first dispensing stop point, it is not necessary to go to
the second stop of the pipette to dispense the correct amount
of GrzB units to each well and no tip change is required
between replicates. If the pipette leaves a significant residual
sample in the tip at the first stop, it is best to go to the second
stop of the pipette and tip change is recommended between
replicates, as the Cell Lysis Buffer (detergent base) will create
a bubble in the tip after a full blowout. When undertaking a
full blow out, make sure to do so gently to minimize the devel-
opment of any bubbles in the plate well.
14. Keep standards, samples, and microtiter plate cold at all times
during the plating process. Precool the plates in the fridge and
when loading, place the plate ideally upon a cold pack which
was stored at 4 °C (not frozen) and then return the plate to
the fridge immediately afterwards. If the plate is placed directly
on ice, any residual moisture should be wiped off the bottom
of the plate when loading is finished. Replenish the cold packs
often (ideal is a fresh cold pack for every plate) and ensure that
the plates are covered when in the fridge, which can be accom-
plished by stacking the plates and placing an empty plate on
top of the stack. Standards may be prepared and plated up to
a maximum of 3 h in advance of sample plating completion. If
the standards are plated ahead of time, keep the plates in the
fridge and covered.
15. Avoid bubbles and do not vortex. When loading wells, do not
dispense to second stop point to further avoid bubble forma-
tion and no change in pipette tips are required between addi-
tions. Simply dispense high enough against well wall to ensure
no contamination with samples. In addition, when drawing
the master mix into the pipette tip, do so in a steady and con-
trolled manner for vigorous uptake can cause bubbles to form
in the tips. Dispense in similar fashion. After every third dis-
pense, re-mix the master mix gently once again by moving the
reservoir dish back and forth, to ensure equal distribution of
master mix to sample wells. The master mix may be prepared
 Cytokine and Granzyme B Assessment of Influenza Response 139

up to a maximum of 3 h in advance of addition to the plates

and should be stored in the fridge until time of use.
16. Do not stack the plates in the container to limit edge effects.
Simply place them side by side; this may require use of more
containers based on plate quantity. Place container(s) in 37 °C
incubator.
17. Before reading, with plate sealers still on, thoroughly wipe off the
plates to remove all moisture. When slowly removing the plate
sealer, bubbles may form at the top of the plate wells, briefly allow
the bubbles to settle, and then directly read the plate.
18. The GrzB results can be affected to a significant degree by
plate-to-plate standard curve variability. To limit this effect the
following should be undertaken:
(a) Biomol GrzB Standard Lot Variation:
There can be lot differences for the GrzB standard obtained
from the manufacturer. Therefore, it is advisable to test all
samples using the same lot. If comparing data between
sites, ensure each site is using the same lot of GrzB stan-
dard. If comparing data between years of a study, ordering
enough vials for the duration of the study is recommended.
To further aid in curve reproducibility, use the same lot of
colorimetric substrate as well.
(b) Distribution of Biomol GrzB Standard in Aliquot Tubes:
When creating aliquots of the GrzB standard, unequal
distribution of GrzB between tubes can also contribute to
curve variability. Generally, within the same lot, the top
standard between plates should not differ by more than
0.1 OD. If there is greater variability than this, more dili-
gence may be needed when creating the stock aliquots.
(c) Sample Organization on Plate:
Before sample plating, decide how the data will be analyzed
and presented, then plate the samples accordingly. That is,
if examining the response to vaccination across four visits
based on certain culture conditions, it would be best to
plate all four visit samples, inclusive of all the conditions,
for one subject on the same plate; including any background
and control samples.
(d) Overall, if OD readings are as low as 0.300 s OD for
the highest concentration of the standard, which is too
low for 30 units of expected GrzB activity, it may be due to
the following contributing factors:
● Loss of activity within Biomol GrzB standard due to
prolonged thaw cycle when creating stock aliquots.
● Colorimetric substrate not fully dissolved in DMSO
before addition to master mix.
140 Janet E. McElhaney and Beth Gentleman

● Using diluted standards which are not freshly prepared

(use within 3 h of preparation).
● Expired solutions/reagents (follow all suggested
expiration dates).
19. The standard preparation recipe provides sufficient quantities
for one plate; therefore, if running multiple protein plates/day,
increase recipe quantities by the appropriate factor.
20. When you begin plating the standards, remove all plates from
the fridge to ensure samples and plates come to room tempera-
ture before addition of the final reagent A + B mixture. Keep
plates covered.
21. When loading wells, do not dispense to second stop point and
no change in pipette tips is required between additions. As the
200 μL volume size will come close to the top of the well, be
extra careful when dispensing to ensure no contamination
with samples. After every few dispenses mix the A + B reagent
before draw up, by moving the reservoir dish back and forth,
to ensure equal distribution of the mixture to sample wells.
The standards and master mix should be as freshly prepared as
possible and plated right after final preparation to ensure good
standard curves.
22. Do not stack the plates on the incubator shelf; place them side
by side, to limit edge effects.
23. Overall, in general the protein levels can be more variable,
between replicates, due to utilizing a smaller volume of lysate
sample (10 μL) and create the need for samples to be run in
triplicate. Also, the %CV requirement, between replicates, is
lower for the protein assay due to the fact that the protein
value is in the denominator of the calculation and can more
greatly affect the overall result; therefore, it is quite important
to ensure the most precise value is represented.
24. Grz B Activity Calculations:
(a) (GrzB assay concentration ÷ Protein assay concentration).
● (Biomol units/20 μL) ÷ (μg protein/mL).
● μg protein/mL × 0.02 = μg protein/20 μL then
calculate.
● Biomol units/20 μL ÷ μg protein/20 μL = Biomol
units/μg protein.
(b) Biomol units/μg protein × 1000 = Biomol units/mg
protein.
(c) Excel Formula: 1000 × (Cell A/20)/(Cell B/1000).
● Cell A = Biomol U/20 μL and Cell B = protein μg/mL.
 Cytokine and Granzyme B Assessment of Influenza Response 141

References
1. McElhaney JE, Xie D, Hager WD et al (2006) T enhanced CTL response to influenza vaccination
cell responses are better correlates of vaccine pro- in older adults. Vaccine 27:2418–2425
tection in the elderly. J Immunol 176:6333–6339 5. Shahid Z, Kleppinger A, Gentleman B, Falsey
2. Effros RB (2007) Role of T lymphocyte replicative AR et al (2010) Clinical and immunologic pre-
senescence in vaccine efficacy. Vaccine 25:599–604 dictors of influenza illness among vaccinated
3. Gijzen K, Liu WM, Visontai I et al (2010) older adults. Vaccine 28:6145–6151
Standardization and validation of assays deter- 6. Ewen CL, Rong J, Kokaji AI et al (2006)
mining cellular immune responses against influ- Evaluating antigen-specific cytotoxic T lym-
enza. Vaccine 28:3416–3422 phocyte responses by a novel mouse granzyme
4. McElhaney JE, Ewen C, Zhou X et al (2009) B ELISPOT assay. J Immunol Methods 308:
Granzyme B: correlates with protection and 156–166
 Chapter 12

Assays for Monitoring Macroautophagy Activity in T cells

Yair Botbol and Fernando Macian

Abstract
Autophagy is an essential catabolic process that regulates a diverse array of functions by targeting cellular
components for degradation by lysosomes. Studies in mammalian cells have shown that the regulation of
autophagy is highly complex and optimization of experimental approaches to analyze this process needs to
be developed for each model studied. This chapter provides an overview of two of the most commonly
used ways to monitor autophagy activity in T cell. It involves description of common techniques, namely
Western blot and cell immunostaining, giving specific recommendations for working with T cells and
monitoring macroautophagy. We also discuss the analysis required for correct interpretation of the results
and quantification of macroautophagy activity.

Key words: Macroautophagy, T cell, Lysosome, LC3

1 Introduction

Autophagy is an essential catabolic process that regulates cellular

homeostasis through the lysosomal degradation of damaged or
altered cellular components. Other than this crucial role, autoph-
agy has also been shown to participate in the response to different
environmental cues and the regulation of a wide array of cellular
processes, ranging from the control of tissue remodeling or the
regulation of the cell energetic balance to the development of
adaptation responses to different types of cellular stress or aging
[1–3]. In the immune system, autophagy has been reported to have
specific functions in different cell types. For instance, in phago-
cytic cells such as macrophages, autophagy plays an important role
during pathogen killing, either in cooperation with the phago-
cytic system or as an alternative system that can control pathogens
that have developed virulence mechanisms to allow them escap-
ing destruction following phagocytosis [4]. Autophagy also allows
antigen presenting cells to process peptides derived from intracel-
lular proteins in MHC class II molecules, by providing the class
II loading compartment with additional input [5]. Three main

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_12, © Springer Science+Business Media New York 2015

143
144 Yair Botbol and Fernando Macian

different forms of autophagy have been described in mammalian

cells: macroautophagy, microautophagy, and chaperone-mediated
autophagy. Each of these forms of autophagy has different mecha-
nisms of regulation and distinct functions; therefore, specific assays
have been developed to measure their activity. This manuscript will
focus on macroautophagy, a process through which in-bulk or tar-
geted cargo (which can include, among others, soluble cytosolic
proteins, lipid droplets, whole organelles, or pathogens) is engulfed
in a de novo formed double membrane vesicle, the autophago-
some, which will deliver the cargo to lysosomes for degradation.
As with other tissues and systems, the immune system is
affected by aging. The age-associated decline in immune responses
has been termed immunosenescence. The T cell compartment is
specially affected by age, and defective T cell function underlies
inefficient responses to pathogens and diminished efficacy of vac-
cinations, which are commonly found in aging organisms [6].
Decline of different forms of autophagy has been reported in many
cell types and tissues [1] including T cells [7]. In T lymphocytes,
macroautophagy can be induced in response to TCR engagement
and contributes to the control of cell homeostasis and survival,
activation-induced responses, and energy metabolism [8–11].
Accurately measuring autophagic activity in aged T cells could
therefore constitute an indicator of age-associated decline in T cell
function. Although the protocols we will describe are tailored for
the analysis of the regulation of macroautophagy in T cells, they
can be easily applied to other cells of the immune system to mea-
sure basal or induced macroautophagy in response to specific sig-
nals (e.g., TLR engagement in macrophages, or BCR activation in
B cells) that may activate or inhibit this process in a given cell type.
Several methods to monitor macroautophagy have been devel-
oped, including image-based procedures such as electron micros-
copy (which is commonly used for morphology analysis and
quantification of autophagosomes), direct fluorescence through
the use of fluorescent reporter proteins and immunostaining, as
well as biochemical procedures such as immunoblot to measure
steady-state levels of related proteins and macroautophagy flux [12].
In this chapter, we describe two of the most widely employed
methods to measure macroautophagy activity, which we routinely
use in our laboratory to monitor macroautophagy in T cells. First,
we will address how to measure endogenous microtubule-
associated protein 1 light chain 3 (LC3) conjugation and degrada-
tion by immunoblot, and then we will describe how to quantify
autophagosome generation and turnover in cells using LC3
immunostaining.
LC3 protein is one of the most common and reliable markers
for macroautophagy quantification. LC3 coexists in the cell in two
forms: LC3-I (cytosolic form) and LC3-II (membrane-bound
lipidated form). During autophagosome formation, LC3 is
 Assays of Macroautophagy in T Cells 145

converted to LC3-II through a process that involves proteolytic

processing by Atg4 to form LC3-I, and subsequent Atg7/Atg3-
mediated conjugation to phosphatidylethanolamine of the newly
exposed C-terminal glycine residue. The lipidated LC3-II can
now associate to the membrane of the forming autophagosome
[13]. Hence, LC3-II can be used to quantify autophagosome for-
mation in the cell by comparing levels and subcellular localization
of this protein under different experimental conditions. However,
since macroautophagy is a dynamic process, the simple static
quantification of LC3-I or LC3-II levels does not provide an
accurate measure of macroautophagy activity. Therefore, specific
experimental approaches have been developed to monitor the
dynamic macroautophagy flux combining different static mea-
surements [12, 14]. The macroautophagy flux represents the frac-
tion of autophagosomes undergoing a full cycle of macroautophagy,
from autophagosome formation to degradation in the lysosome.
Static quantifications of autophagosomes by electron microscopy,
immunofluorescence, or LC3 conversion by immunoblot do not
represent macroautophagy flux, and changes in their steady-state
levels could be the result of very different conditions. For exam-
ple, an increased number of autophagosome structures seen in a
snapshot of a cell could be the consequence of either increased
autophagosome formation or inhibition of autophagosome deg-
radation. However, the rate of macroautophagy flux would be
completely different for these two possibilities. The best way to
assess macroautophagy flux is to block the last step of the process
(degradation of autophagosomes) and analyze the effect of this
treatment on levels of autophagosome markers. We use the com-
bination of ammonium chloride (increases lysosomal pH) and leu-
peptin (a protease inhibitor) to inhibit lysosomal degradation
(other lysosomal inhibitors such as bafilomycin are also widely uti-
lized). This treatment must be as short as possible to minimize
effects on the cells studied but long enough to ensure quantifiable
accumulation. The level of accumulation of LC3-II and/or
autophagosomes caused by this treatment in a given experimental
condition compared to the same condition without any inhibitors
allows measurement of the flux of macroautophagy (i.e., LC3-II
turnover) [15]. In our case, we use basal level of autophagy on
resting cells as a reference to measure enhanced macroautophagy
following T cell activation.
In the following paragraphs, we will describe protocols we
have improved to obtain reliable and reproducible conditions to
study macroautophagy induction in activated mouse CD4+
T cells (see Figs. 1 and 2). As stated above, this method may be
easily adapted to measure macroautophagy in other cell types or
other conditions.
146 Yair Botbol and Fernando Macian

Fig. 1 Macroautophagy flux monitored by LC3-II turnover on immunoblot. Freshly

isolated mouse CD4+ T cells were incubated in TCM for 24 h in resting or acti-
vated conditions. Cells were treated with or without the indicated autophagy
inhibitors for the last 3 h (NH4Cl and leupeptin are respectively at 20 mM and
100 μM, and vinblastine at 100 μM). Twelve micrograms of protein extract was
loaded per well

Fig. 2 Macroautophagy flux monitored by LC3-II turnover by immunofluores-

cence. Freshly isolated mouse CD4+ T cells were incubated in TCM for 24 h
in resting or activated condition. Cells were treated with or without the indi-
cated autophagy inhibitors for the last 3 h. Macroautophagy flux was
monitored by measuring LC3 puncta accumulation using immunostaining.
Orange arrows indicate the LC3-II puncta (autophagosome) in each condition
(magnification ×630)
 Assays of Macroautophagy in T Cells 147

2 Materials

2.1 Common 1. Phosphate-buffered solution, PBS 1×.

Reagents, Solutions, 2. Protein SDS-PAGE and Blotting buffers and equipment.
and Equipment
3. CO2 tissue culture incubator.
4. Image J software (National Institutes of Health, http://imagej.
nih.gov/ij/).

2.2 CD4+ T Cell 1. C57BL/6 mice, 6–10 week old.

Culture 2. T cell media (TCM): DMEM/high glucose (Hyclone), sup-
plemented with, 10 % (v/v) FBS, 5 IU/mL Penicillin, 5 μg/mL
streptomycin, 4 mM glutamine, 1× Non-Essential Amino acids
(Lonza), 1× MEM Eagle Vitamin Mixture (Lonza), 50 μM
β-Mercaptoethanol, 660 μM L-Arginine, 270 μM L-Aspartic
acid, 6 μM Folic Acid, 10 mM HEPES, 1 mM Sodium Pyruvate
in the composition of media.
3. Dynabeads® Mouse CD4 (L3T4) (Invitrogen), DETACHa-
BEAD® Mouse CD4 (Invitrogen), and magnet.
4. Activator antibodies (Ab): anti-mouse CD3ε (clone 145-2C11),
anti-mouse CD28 (clone 37–51).
5. 24-well tissue culture plate.
6. 2 M Ammonium chloride freshly prepared and filtered
sterilized.
7. 100 mM leupeptin in sterile H2O. Aliquots can be stored at
−20 °C.

2.3 Cell Lysis 1. RIPA buffer 1×: 50 mM Tris–HCl pH 7.7, 150 mM NaCl, 1 %
and Western Blot (v/v) NP40, 0.5 % Sodium deoxycholate, 0.1 % SDS. Add
fresh Complete Protease Inhibitor cocktail 1× (Roche), 2 mM
PMSF, 1 mM DTT.
2. 15 % Tris-Glycine SDS-PAGE buffers and solutions and nitro-
cellulose membrane.
3. Blocking buffer: 1× PBS, 0.1 % (v/v) Tween-20, 5 % Non-fat
dry milk.
4. Antibody Incubation Buffer (AIB): 1× PBS, 0.1 % Tween-20,
4 % BSA.
5. Wash buffer (WB): 1× PBS, 0.1 % (v/v) Tween-20.
6. Anti-mouse LC3 (MBL PM036), anti-mouse β-Actin (clone
AC-15 from Abcam).
7. HRP-conjugated secondary antibodies (rabbit and mouse).

2.4 Immunostaining: 1. Cytology Funnel and cytospin centrifuge.

Tools and Reagents 2. Cell Fixation Buffer: 4 % Paraformaldehyde (PFA) solution in
1× PBS, pH adjusted to 7.5.
148 Yair Botbol and Fernando Macian

3. Cell Permeabilization Buffer: 1× PBS, 0.015 % (v/v) Digitonin.

4. Cell Blocking Buffer (CBB): 1× PBS, 10 % (v/v) FBS.
5. Wash buffer (WB): 1× PBS.
6. DAPI-Fluoromount-G (Southern Biotech).
7. Anti-mouse LC3 (MBL PM036).
8. Secondary fluorophore-conjugated antibody.

3 Methods

3.1 CD4+ T Cell 1. Prepare plate with bound anti-mouse CD3ε using a 10 μg/mL
Isolation Ab solution in sterile 1× PBS. Add 250 μL per well in 24-well
and Activation plate and incubate for 3.5 h at 37 °C in a tissue culture incuba-
tor under 10 % CO2. Wash the wells twice with 1× PBS just
before adding the cells on step 2 (see Note 1).
2. Isolate Lymph nodes and/or spleen from the mouse and
perform CD4+ isolation using Dynabeads® Mouse CD4
(L3T4) and following the manufacturer’s protocol (see Note
2). Bring cells to a final density of 1.25 × 106 cells/mL of TCM.
Add 0.5 μg/mL of anti-mouse CD28 and seed the cells in the
plate with bound antiCD3e prepared in step 1 of
Subheading 3.1 (1 mL per well). Incubate at 37 °C in 10 %-CO2
incubator (see Note 3).
3. After 21 h of culture add ammonium chloride/Leupeptin
solution (NL) to a final concentration of 20 mM and 100 μM,
respectively, for 3 h to half of the wells used for each condition
analyzed (see Note 4).

3.2 Cell Lysate 1. From this step on keep everything on ice. Harvest T cells after
and Western Blot the 3 h treatment with NL, centrifuge 5 min at 300 × g at 4 °C,
and discard the supernatant.
2. Wash cell pellet with 1 mL of ice-cold 1× PBS (for immunos-
taining take an aliquot of these cells and go to Subheading 3.3),
pellet the cells as in step 1, and gently aspirate the
supernatant.
3. Flick the tube to break up the cell pellet and resuspend it in
RIPA buffer. Homogenize by pipetting up and down 5–10
times (see Note 5). Leave the tubes on ice for 30 min to com-
plete lysis. Flick the tubes a couple of times during the lysis.
Freeze at −80 °C for storage or proceed directly to step 4.
4. Centrifuge the crude extract at 4 °C, for 30 min at 20,000 × g.
Transfer the supernatant to a new tube and perform an addi-
tional run of centrifugation. Collect the supernatant.
5. Measure the protein concentration (see Note 6).
 Assays of Macroautophagy in T Cells 149

6. Add Laemmli sample buffer and load 10 μg of your samples

per lane on a Tris-glycine SDS-PAGE (4 % stacking and 15 %
resolving) and run it at constant current (see Note 7).
7. Electrotransfer the protein from the gel to a nitrocellulose
membrane and probe the membrane with the appropriate anti-
bodies (see Note 8).
All following blot steps are performed at room tempera-
ture with agitation.
8. Block the membrane for 45 min in western blot blocking
buffer.
9. Remove blocking buffer and add LC3 antibody solution
(1/1500 in AIB). Incubate for 45 min (see Note 9).
10. Wash the membrane three times (10 min each) in WB.
11. Add anti-rabbit HRP-conjugated secondary antibody diluted
in AIB and incubate for 45 min.
12. Wash as in step 10, and perform an additional final wash in 1×
PBS.
13. Develop the blot.
14. Blot the membrane with anti β-Actin antibody (1/100000 in
AIB) repeating step 9–13 (use anti-mouse secondary Ab).

3.3 LC3 Immuno- 1. From step 2 of Subheading 3.2, take an aliquot of cells, pellet
staining in T Cells down (5 min at 300 g) and resuspend in ice-cold 1× PBS at 106
cells/ml.
From here on all steps are performed at room temperature.
2. Load cells into a cytology funnel (~105 cells in 100 μL) attached
to a glass slide.
3. Centrifuge in cytospin for 5 min at 220 × g.
4. Immediately draw a ring in the slide around the cells using a
hydrophobic-ink pen and add fixation buffer. Incubate for
10 min.
5. Wash once with 1× PBS.
6. Add permeabilization buffer and incubate for 12 min.
7. Wash cells with 1× PBS, twice for 10 min each time.
8. Incubate cells with CBB for 45 min to block unspecific binding
of the antibodies.
9. Incubate cells with LC3 antibody dilution (1/750) in CBB for
30 min.
10. Wash the cells in WB, three times for 10 min.
11. Incubate with secondary Ab fluorophore conjugated in CBB
for 45 min.
12. Wash as in step 10.
150 Yair Botbol and Fernando Macian

13. Wash once with 1× PBS for 10 min.

14. Briefly wash with water to remove salts, and add a drop of
mounting solution DAPI-Fluoromount-G and mount your
slide immediately.
15. Let slide dry for 20 min in the dark before microscope visual-
ization and acquisition of images.

3.4 Data Acquisition As described previously, macroautophagy is a dynamic process and

and Macroautophagy quantification of the flux is required to assess macroautophagy
Flux Quantification activity.
On Immunoblot, the protocol gives a clear separation between
LC3-I and LC3-II, and allows quantification of LC3-II turnover
in every condition.
1. Quantify bands for LC3-II and β-actin using ImageJ analyze/
measure/gel function (see Note 10).
2. Normalized LC3-II value to its corresponding β-actin
(see Note 11).
3. Subtract the normalized LC3-II densitometric value in the
sample without lysosomal inhibitors from the one with inhibi-
tors. This value corresponds to the amount of LC3-I converted
to LC3-II and degraded during the time of the lysosome inhi-
bition treatment (flux) (see Note 12).
4. Divide each flux value to your reference condition to represent
fold change in the tested conditions.
On the immunofluorescence images the number of LC3
puncta in cells has to be quantified.
1. Count LC3-II(+) puncta and number of cells in all conditions
(see Note 13).
2. Calculate the number of puncta per cell.
3. Subtract the puncta per cell value in the sample without lyso-
somal inhibitors from the value measure in the sample treated
with inhibitors. This value corresponds to the accumulation of
autophagosome during the time of the lysosome inhibition
treatment (flux).
4. Finally, calculate the fold of this accumulation normalizing to
your reference condition.

4 Notes

1. Coat only half of the wells in a plate to keep the other half for
resting condition. For other plate sizes, use the same CD3ε Ab
dilution adjusting the volume in proportion to the surface area
(1 well of 24-well plate is 1.9 cm2).
 Assays of Macroautophagy in T Cells 151

2. We observe the same results using T cells isolated with MACS

and also with primed Th1 and Th2 cells restimulated after 5 or
6 days of culture. However, experimental conditions on primed
cells require few modifications of the described protocol.
3. We recommend starting with 24-well plates and using at least
three wells per condition to get enough protein. For each con-
dition tested you will need double the number of wells: for
untreated cells and cells treated with the lysosomal inhibitors,
to get the value of the macroautophagy flux.
4. Several inhibitors of autophagy acting at different stages of the
process have been used in the literature. For instance we have
also used 100 μM Vinblastine for 3 h instead of NL to measure
macroautophagy flux in T cells (see Fig. 1). But, since vinblas-
tine inhibits macroautophagy before autophagolysosome for-
mation (by preventing autophagosome and lysosome fusion),
the absolute quantity of LC3-II accumulated might be slightly
lower than the one observed with NL and corresponds to
autophagic structures before autophagosome-lysosome fusion.
Bafilomycin and chloroquine can also be used to alter the lyso-
some acidification and prevent LC3 degradation, although
chloroquine is less recommended because it can alter protein
synthesis in some cells. The use in parallel of more than one
method to inhibit LC3 turnover and measure macroautophagy
flux is recommended.
5. Use 20 μL of RIPA per ~3 × 106 cells to obtain enough protein
concentration to get reliable quantification.
6. Quantification of protein extract can become tricky especially
when using high percentage of detergents in the lysis buffer.
We optimized the Bradford protocol using 2 μL of lysate in
18 μL of water added to 1 mL of 1× Bradford solution. Do not
use more than 2 μL of sample, which corresponds to a 1/500
dilution of the RIPA buffer, since the detergent concentration
can start to significantly disturb measurements above that dilu-
tion. A standard curve using BSA must be linear between 1
and 8 μg of BSA per mL of 1× Bradford in the same RIPA
dilution as the samples. Following the recommendation in this
protocol, one should get all samples’ OD in the linear part of
this standard curve, and enough proteins to run 2–3 gels.
7. Since LC3 is a small protein (~16 kDa apparent size of LC3-I)
and LC3-II shift to a lower size (~14 kDa), we recommend
starting with a 15 % polyacrylamide gel. Then, after becoming
familiar with the pattern of LC3 on the blot, the polyacryl-
amide concentration may be reduced to 13 % without losing
LC3-I/LC3-II resolution but allowing a better separation of
higher MW protein in case other proteins in addition to LC3
and β-Actin need to be analyzed in the same blot. Running
conditions for Mini-Protean size:Setup the current at 20 mA
152 Yair Botbol and Fernando Macian

per gel and fixed Voltage max at 125 V. The voltage at the
beginning of the run should be around 70 V and then will
increase up to the max setup.
8. Transfer at no more than 150 mA per transfer cell (mini size of
Protean Biorad) for at least 3 h, rather than using higher
current and shorter times. This will avoid excessive heating of
the transfer buffer, producing a cleaner membrane and a more
reproducible blot.
9. Increasing LC3-Ab binding time does not usually improve
specific signal, but will increase the appearance of nonspecific
bands.
10. Follow ImageJ commands for gel densitometry. Select both
LC3-I and LC3-II bands. Even if macroautophagy flux quan-
tification considers only LC3-II accumulation, this allows to
precisely quantifying background around LC3 bands by
measuring pixel intensity between the two peaks. We have
observed that the level of LC3-II protein in the absence of
lysosome inhibitors is very low in both resting and activated
T cells, which suggest a very fast rate of macroautophagy
activity in T cells. However, with lysosome inhibitors the bands
become very intense, especially in activated cells, where macro-
autophagy is highly induced. In any case, if the signal is still
low, increase the quantity of protein loaded on gel to 12–15 μg
per lane (no more than 15 μg is recommended to avoid satura-
tion of LC3-II signal in activated cells).
11. We have checked protein level as well as mRNA level of β-Actin
and we did not observe any differences in any of the conditions
used to study macroautophagy in T cells so far, making this
protein a good housekeeping gene.
12. The ratio of the LC3-II levels between samples treated with or
without inhibitors has also been used and it provides a mea-
surement of the “speed of the process”; however subtraction
will quantify the real net change in total levels of LC3-II.
Although initially ratio of LC3-II to LC3-I was widely used, it
has become clear that the amount of LC3 primed for conjuga-
tion (LC3-I) is very cell type dependent and this ratio is not
indicative of macroautophagy activity. Furthermore, differ-
ences in the affinity of different anti-LC3 antibodies for LC3-I
and LC3-II may lead to inaccurate estimations of the real rate
of conversion of LC3-I into LC3-II.
13. This process can be done manually or using an image analysis
software such as ImageJ. The particle-counting’s functions of
ImageJ must be used very carefully and always with a shrewd
eye since many parameters still need to be defined manually
(threshold, particles size, etc.). We found that ImageJ
MaxEntropy auto-threshold method appeared to be a good
 Assays of Macroautophagy in T Cells 153

tools in order to keep same threshold calculation in all pic-

tures and to give a reliable estimation of LC3 punctates. Also,
to avoid any user bias, it is important to count a high number
of cells and if possible to perform an additional analysis by
another experimenter, both in blind conditions. In any case,
clear and clean images are strictly required to make this analy-
sis reliable. If the experimental conditions used lead to a high
density of LC3 positive structures that prevents their resolu-
tion as individual puncta, area positive for LC3 (also calcu-
lated when using the measure particles option in Image J) can
be used instead.

Acknowledgments

This work was supported by NIH grant AG021904.

References
1. Cuervo AM (2008) Autophagy and aging: 9. Bell BD, Leverrier S, Weist BM, Newton RH,
keeping that old broom working. Trends Arechiga AF, Luhrs KA et al (2008) FADD
Genet 24:604–612 and caspase-8 control the outcome of autoph-
2. Mizushima N (2009) Physiological functions agic signaling in proliferating T cells. Proc Natl
of autophagy. Curr Top Microbiol Immunol Acad Sci U S A 105:16677–16682
335:71–84 10. Pua HH, Dzhagalov I, Chuck M, Mizushima
3. Sridhar S, Botbol Y, Macian F, Cuervo AM N, He YW (2007) A critical role for the
(2012) Autophagy and disease: always two autophagy gene Atg5 in T cell survival and
sides to a problem. J Pathol 226:255–273 proliferation. J Exp Med 204:25–31
4. Deretic V (2012) Autophagy as an innate 11. Li C, Capan E, Zhao Y, Zhao J, Stolz D,
immunity paradigm: expanding the scope and Watkins SC et al (2006) Autophagy is induced
repertoire of pattern recognition receptors. in CD4+ T cells and important for the growth
Curr Opin Immunol 24:21–31 factor-withdrawal cell death. J Immunol 177:
5. Gannage M, Munz C (2009) Autophagy in MHC 5163–5168
class II presentation of endogenous antigens. Curr 12. Klionsky DJ, Abdalla FC, Abeliovich H,
Top Microbiol Immunol 335:123–140 Abraham RT, Acevedo-Arozena A, Adeli K
6. Maue AC, Yager EJ, Swain SL, Woodland DL, et al (2012) Guidelines for the use and inter-
Blackman MA, Haynes L (2009) T-cell immu- pretation of assays for monitoring autophagy.
nosenescence: lessons learned from mouse mod- Autophagy 8:445–544
els of aging. Trends Immunol 30:301–305 13. Mizushima N, Yoshimori T, Ohsumi Y (2011)
7. Phadwal K, Alegre-Abarrategui J, Watson AS, The role of Atg proteins in autophagosome
Pike L, Anbalagan S, Hammond EM et al formation. Annu Rev Cell Dev Biol 27:
(2012) A novel method for autophagy detec- 107–132
tion in primary cells: impaired levels of macro- 14. Mizushima N, Yoshimori T, Levine B (2010)
autophagy in immunosenescent T cells. Methods in mammalian autophagy research.
Autophagy 8:677–689 Cell 140:313–326
8. Hubbard VM, Valdor R, Patel B, Singh R, 15. Tanida I, Minematsu-Ikeguchi N, Ueno T,
Cuervo AM, Macian F (2010) Macroautophagy Kominami E (2005) Lysosomal turnover, but
regulates energy metabolism during effector not a cellular level, of endogenous LC3 is a
T cell activation. J Immunol 185:7349–7357 marker for autophagy. Autophagy 1:84–91
 Chapter 13

Fluorescence-Based Approaches for Quantitative

Assessment of Protein Carbonylation, Protein Disulfides,
and Protein Conformation in Biological Tissues
Asish R. Chaudhuri, Rochelle Wei, Arunabh Bhattacharya,
and Ryan Hamilton

Abstract
Protein oxidation and misfolding have been considered as key players for progression of aging and etiology
of various pathological conditions. However, few attempts have been made to develop sensitive and repro-
ducible assays to quantify the changes in protein oxidation and alteration in structure. Here we describe
three distinct fluorescence-based assays to quantify changes in protein oxidation, namely carbonylation and
disulfides and alteration in protein surface hydrophobicity as a reporter for protein conformation. These
techniques will provide investigators the opportunity to address important biological questions in their
experimental models.

Key words Protein oxidation, Carbonylation, Disulfide, Oxidative stress

1 Introduction

Substantial evidence in the literature has elegantly shown that

protein oxidation has deleterious effects in aging and in the etiology
of several age-related diseases, including diabetes, cardiovascular
disease, and neurodegenerative diseases [1–8]. Most of the amino
acids in proteins are sensitive to oxidation; for instance, side chains
on amino acids such as lysine, arginine, proline, and cysteine are
susceptible to carbonylation [9–11]. In addition, the thiol group
in cysteine is particularly important because it is often found at the
catalytic and regulatory sites of proteins and enzymes and is highly
sensitive to oxidation. It undergoes various reversible (disulfide,
S-thiolated, S-nitrosylated, and sulfenic acid) as well as irreversible
(sulfinic and sulfonic acids) oxidations depending on the status of
intracellular glutathione [12–15]. Oxidation of critical amino acid
residues often leads to protein misfolding/conformational changes
that lead to the formation of deleterious oligomers or aggregates

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_13, © Springer Science+Business Media New York 2015

155
156 Asish R. Chaudhuri et al.

which could be damaging to normal cellular homeostasis and con-

tribute to the pathophysiology of several diseases. Therefore, it
is essential to utilize sensitive and reliable assays for quantitative
assessments of the oxidation and conformational states of proteins.
In this chapter, we provide detail on three distinct and sensitive
fluorescence-based assays developed by our group to monitor spe-
cific types of protein modifications [8, 16–23], which include (1)
protein carbonylation, (2) protein disulfides, and (3) alteration
of protein surface hydrophobicity as a reporter of protein conforma-
tion. Protein carbonyls are one of the most commonly measured
modifications over the past 20 years. However, the sensitivity and
precision of the spectrometric and immunological based assays are
compromised by interference from the free probe, dinitrophenyl
hydrazine (DNPH), and by nonspecific interactions of anti-DNPH
with proteins. In contrast, our gel-based fluorescent technique
using a fluorescein thiocarbazide probe detects only bound protein
carbonyls; the free probe does not interfere in the quantification as
it is removed during sample preparation. Importantly, all the pro-
tein carbonyl data reported in the literature have been performed
with the soluble cellular fractions, while our fluorescence-based
assay can quantify both soluble and detergent-soluble states of pro-
tein carbonyls [8, 17, 18]. The thiol group in cysteine is sensitive
to oxidation and undergoes several oxidation states including the
disulfide bond which often initiates the formation of both intramo-
lecular and intermolecular bonds usually observed in higher-order
protein aggregates. Our fluorescence-based assay [16, 19] using
the probe, 6-iodoacetamidofluorescein, specifically recognizes the
disulfide linkage on proteins. Our third assay utilizes an apolar
fluorescent probe, 4, 4′-dianilino-1,1′-binaphthyl-5,5′-disulfonic
acid, to monitor the alteration of the surface hydrophobic domains
globally or in specific proteins [20, 21, 23]. UV crosslinking of the
probe with surface exposed hydrophobic domain in proteins can
distinguish these changes in protein conformation.
These gel-based assays can be used in both in vitro and in vivo
studies to determine the effect of oxidative stress on protein oxida-
tion and misfolding. One of the common and unique aspects of all
these technologies is the use of fluorescent molecules as probes.
This is important as fluorescent probes in general give high quan-
tum yields (the number of fluorescent photons emitted per excita-
tion photon absorbed) which helps quantify low levels of oxidation
and conformational changes in potential target proteins during
aging and in age-related diseases. Development of these techniques
is an important part of basic and clinical research, particularly since
the oxidative stress theory remains one of the most widely accepted
theories in explaining biochemical changes in various pathophysi-
ological conditions. Thus, these techniques will give investigators
necessary tools to delve into the molecular mechanisms involved in
various oxidative stress-related disease conditions. Using mouse
 Quantitative Assessment of Protein Oxidation 157

models that are either deficient in the superoxide radical detoxifying

enzyme, copper-zinc superoxide dismutase (SOD), or overexpress
the human mutant SOD protein (familial Amyotrophic Lateral
Sclerosis model), we demonstrate here that the techniques are not
restricted to studies on aging and age-related diseases but may also
be applicable in any disease state that is associated with an increase
in oxidative stress. Most importantly, all three techniques can also
be used as proteomic tools to identify the potential target proteins
that are carbonylated, undergo aberrant disulfide formation or
alteration in protein conformation [17, 19, 20].

2 Materials

Prepare all solutions using sterile filtered deionized water with a

resistance of 18 MΩ/cm unless indicated otherwise. Prepare and
store all reagents as indicated.

2.1 SDS 1. Resolving gel buffer: Prepare a 1 L stock of 2 M Tris–HCl,

Polyacrylamide Gel pH 8.8. Weigh 242.28 g Tris–HCl and transfer to a 1 L grad-
Components uated cylinder. Add water to graduated cylinder up to a volume
of 900 mL. Mix until Tris is dissolved in the water, then adjust
for pH with HCl (see Note 1). When pH is adjusted, add
water to graduated cylinder up to a volume of 1 L and mix.
Store at 4 °C.
2. Stacking gel buffer: Prepare a 350 mL stock of 1.25 M Tris–
HCl, pH 6.8. Weigh 53.0 g Tris–HCl and transfer to a 500 mL
graduated cylinder. Mix, adjust pH, and store as described in
step 1.
3. 30 % Acrylamide/Bis solution 37.5:1.
4. Ammonium persulfate (APS): 10 % solution dissolved in water
(see Note 2).
5. Sodium dodecyl sulfate (SDS): Prepare a 10 mL stock of 10 %
SDS dissolved in water. Add 1 g SDS, add water up to a vol-
ume of 10 mL, and mix (see Note 3).
6. N,N,N,N′-tetramethyl-ethylenediamine (TEMED). Store at
room temperature in fume hood (see Note 4).
7. Prepare 10× Tris/glycine running buffer by adding 30.3 g
of Tris, and 144 g of glycine into 1000 mL of water or use
(Bio-Rad catalog number 161-0772): Prepare 1 L 1× working
solution by mixing 100 mL 10× buffer with 900 mL water
with 4 g of SDS. Store at room temperature (see Note 5).
8. 10× loading dye: 0.2 M Tris–HCl (pH 6.8), 10 % SDS, 40 % glyc-
erol, 10 % β-mercaptoethanol (β-ME), 0.2 % bromophenol blue.
158 Asish R. Chaudhuri et al.

The mixture is dissolved in water and separated into 1 mL aliquots.

Store at −20 °C (see Note 6).
9. Precision Plus Kaleidoscope protein standards (Bio-Rad cata-
log number 161-0375) (see Note 7).
10. Gel loading tips.
11. 1.0 mm thick Criterion Empty Cassettes (Bio-Rad catalog
number 345-9903) (see Note 8).
12. Criterion Cell and PowerPac Basic Power Supply.

2.2 BisANS, 1. Homogenizer (Glas-Col catalog number 099C K54).

Disulfide, 2. Tissue Grind Tube (Kimble Chase catalog number 885452-
and Carbonyl Assay 0021) (see Note 9).
Shared Equipment
3. Tissue Grind Pestle SZ 21 (Kimble Chase catalog number
and Components 885451-0021) (see Note 9).
4. Sonic Dismembrator F60 (Fisher Scientific) (see Note 10).
5. Sorvall Discovery M120 SE or equivalent centrifuge.
6. 1.0 mL PC thick-walled tubes (Thermo Scientific catalog
number 45237).
7. 0.2 mL PC thick-walled tubes (Thermo Scientific catalog
number 45233).
8. S120-AT2 rotor (Thermo Scientific catalog number 45583)
(see Note 11).
9. S100-AT3 rotor (Thermo Scientific catalog number 45595)
(see Note 11).
10. Protease inhibitor cocktail set III (pi) (Calbiochem catalog
number 539134) (see Note 12).
11. Pierce BCA protein assay kit (Thermo Scientific catalog num-
ber 23227).
12. Water bath or incubator set to 37 °C.
13. Aluminum foil.
14. Plastic wrap.
15. Bio-safe Coomassie stain (Bio-Rad catalog number 161-0772)
(see Note 13).
16. AlphaImager 3400 (Alpha Innotech) or equivalent imaging
system.

2.3 BisANS Assay 17. 1× BisANS labeling buffer: 50 mM Tris–HCl and 1 mM

Components Magnesium Sulfate (MgSO4), pH 7.4 with pi. Prepare a 50 mL
stock by adding 0.303 g Tris and 0.006 g Magnesium Sulfate
(see Note 14). Add up to 50 mL water, mix, and adjust for
pH. Store at room temperature if pi has not yet been added
(see Note 12).
 Quantitative Assessment of Protein Oxidation 159

18. 4,4′-Dianilino-1,1′-Binaphthyl-5,5′-Disulfonic Acid, Dipotassium

Salt (BisANS) (Invitrogen catalog number B-153) fluorescent
probe: Prepare 10 mM aliquots by adding 1.486 mL dimethyl
sulfoxide (DMSO) to 10 mg of BisANS and mix. Cover aliquots
with foil and store at −20 °C (see Note 14).
19. Flat-bottomed 96-well plate (see Note 16).
20. Handheld long wave UV light (UVP Model UVL-56)
(see Note 17).

2.4 Disulfide Assay 1. 10× KP buffer, pH 8.0: 200 mM potassium phosphate (KP),
Components 5 mM magnesium chloride (MgCl2), and 10 mM
ethylenediamine-tetraacetic acid (EDTA), pH 8.0. First, pre-
pare 50 mL stocks of 200 mM KP monobasic and dibasic. Add
1.36 g of KP monobasic, add up to 50 mL water, and mix. Add
1.74 g of KP dibasic, add up to 50 mL water, and mix. Next,
prepare a 50 mL stock of 10× KP buffer, pH 8.0. Add 0.24 g
of MgCl2, 0.146 g of EDTA, 47 mL of KP dibasic, and 3 mL
KP of monobasic (see Note 18). Add up to 50 mL water and
mix (the 10× KP buffer should be pH 8.0). Store at room
temperature.
2. 1× KP buffer, pH 8.0: 20 mM KP, 0.5 mM MgCl2, and
1 mM EDTA, pH 8.0 with pi. To make 50 mL stock, mix
5 mL of 10× KP buffer, pH 8.0 and 45 mL water. Store at
room temperature if protease inhibitors have not yet been
added (see Note 12).
3. 1× KP buffer, pH 8.0 with 200 mM iodoacetamide (IAM) and
pi: 20 mM KP, 0.5 mM MgCl2, and 1 mM EDTA, pH 8.0
with pi. Add IAM, dilute 10× KP buffer, pH 8.0 to 1× with
water, and mix. Store at room temperature if IAM and pi have
not yet been added (see Notes 12 and 19).
4. 1× P3 buffer, pH 8.0: 1× KP buffer, pH 8.0 with 2 % SDS,
0.5 % IGEPAL CA-630, 0.5 % Sodium Deoxycholate, and pi
(see Note 12). Prepare a 50 mL stock by adding 1 g of SDS,
750 μL of IGEPAL CA-630, 0.75 g of Sodium Deoxycholate,
and 5 mL of 10× KP buffer, pH 8.0. Add up to 50 mL of water
and mix. Store at room temperature if pi has not yet been
added (see Note 12).
5. 1× P3 buffer, pH 8.0 with 200 mM IAM and pi (see Notes 12
and 19).
6. 6 and 8 M Urea dissolved in water (see Note 20).
7. 20 % trichloroacetic acid (TCA) dissolved in water.
8. 1:1 ethanol/ethyl acetate: Prepare 50 mL of 1:1 ethanol/ethyl
acetate mixture by adding 25 mL of 200 proof ethanol and
25 mL ethyl acetate.
160 Asish R. Chaudhuri et al.

9. Dithiothreitol (DTT): Prepare a 1 mL stock of 200 mM

DTT. Dissolve 0.031 g of DTT, add up to 1 mL of water, and
mix. Store at 4 °C.
10. 6-iodoacetamidofluorescein (6-IAF) fluorescent probe
(Invitrogen catalog number I-30452): Prepare 100 mM
aliquots by adding 485.19 μL DMSO to the bottle (25 mg)
and mix. Cover aliquots with foil and store at −20 °C
(see Note 15).
11. Typhoon 9400 Variable Mode Imager (GE Healthcare Life
Sciences).

2.5 Carbonyl Assay 1. 10× KP buffer, pH 6.0: 200 mM potassium phosphate (KP),
Components 5 mM magnesium chloride (MgCl2), and 10 mM
ethylenediamine-tetraacetic acid (EDTA), pH 8.0. First, pre-
pare 50 mL stocks of 200 mM KP monobasic and dibasic. Add
1.36 g of KP monobasic, add up to 50 mL water, and mix. Add
1.74 g of KP dibasic, add up to 50 mL water, and mix. Next,
prepare a 50 mL stock of 10× KP buffer, pH 6.0. Add 0.24 g
of MgCl2, 0.146 g of EDTA, 6.6 mL of KP dibasic, and
43.4 mL KP of monobasic (see Note 18). Add up to 50 mL
water and mix (the 10× KP buffer should be pH 6.0). Store at
room temperature.
2. 1× KP buffer, pH 6.0: 20 mM KP, 0.5 mM MgCl2, and 1 mM
EDTA, pH 6.0 with pi. To make 50 mL stock, mix 5 mL of
10× KP buffer, pH 6.0 and 45 mL water. Store at room tem-
perature if pi has not yet been added (see Note 12).
3. 1× P3 buffer, pH 6.0: 1× KP buffer, pH 6.0 with 2 % SDS,
0.5 % IGEPAL CA-630, 0.5 % Sodium Deoxycholate, and pi
(see Note 12). Prepare a 50 mL stock by adding 1 g of SDS,
750 μL of IGEPAL CA-630, 0.75 g of Sodium Deoxycholate,
and 5 mL of 10× KP buffer, pH 6.0. Add up to 50 mL of water
and mix. Store at room temperature if pi has not yet been
added (see Note 12).
4. Dithiothreitol (DTT): Prepare a 1 mL stock of 200 mM
DTT. Dissolve 0.031 g of DTT, add up to 1 mL of water, and
mix. Store at 4 °C.
5. Fluorescein-5-thiosemicarbazide (FTC) fluorescent probe
(Invitrogen catalog number F-121): Prepare 100 mM aliquots
by adding 2.37 mL DMSO to the bottle and mix. Cover ali-
quots with foil and store at −20 °C (see Note 15).
6. Guanidine hydrochloride: Prepare 1 mL stock of 3 M guani-
dine hydrochloride. Add 0.287 g of guanidine hydrochloride,
add up to 1 mL with water, then mix.
7. 20 % trichloroacetic acid (TCA) dissolved in water.
 Quantitative Assessment of Protein Oxidation 161

8. 1:1 ethanol/ethyl acetate: Prepare 50 mL of 1:1 ethanol/ethyl

acetate mixture by adding 25 mL of 200 proof ethanol and
25 mL ethyl acetate.
9. 8 M Urea dissolved in water (see Note 20).
10. Typhoon 9400 Variable Mode Imager (GE Healthcare Life
Sciences).

3 Methods

3.1 12 % Sodium All steps are performed at room temperature unless indicated
Dodecyl Sulfate otherwise.
Polyacrylamide Gel
1. Remove well comb from empty criterion cassette, and place
Electrophoresis cassette on a rack to keep it vertical.
(SDS-PAGE)
2. Prepare the 12 % running gel by mixing 2.5 mL of resolving
gel buffer, 5 mL of 30 % acrylamide/Bis solution, 125 μL of
10 % SDS, and 4.8 mL of water. Add 6 μL of TEMED and
63 μL of 10 % APS, then mix again (see Note 21).
3. Quickly fill empty criterion cassette with running gel mixture
up to 2–3 mm below the bottom of the well insert.
4. Gently layer with 2 mL isopropanol (see Note 22).
5. Let set for 1 h to allow for full gel polymerization.
6. Rinse isopropanol out of the cassette with water, and briefly
dry (see Note 23).
7. Prepare the 4 % stacking gel by mixing 833 μL of stacking gel
buffer, 444 μL of 30 % acrylamide/Bis solution, 33 μL of 10 %
SDS, and 2 mL of water. Add 3 μL of TEMED and 33 μL of
10 % APS, then mix again (see Note 21).
8. Quickly fill criterion cassette with stacking gel mixture to the
top (see Note 24).
9. Carefully place well comb into the criterion cassette (see
Note 25).
10. Let set for 40 min to allow for full gel polymerization.
11. Prepare samples to run in SDS-PAGE by adding appropriate
volume of 10× loading dye and mix (see Note 6).
12. Warm samples to 37 °C for 5 min.
13. Spin down samples at 1000 × g for 30 s to bring down any con-
densate or sample stuck on the walls.
14. Remove sticker strip from the bottom of the criterion cassette
(see Note 26).
15. Place criterion cassette into criterion cell.
16. Fill criterion cell with 1× Tris/glycine/SDS running buffer up
to marked fill line.
162 Asish R. Chaudhuri et al.

17. Fill top buffer reservoir of criterion cassette with 1× Tris/

glycine/SDS running buffer (see Note 27).
18. Carefully remove well comb without disrupting polymerized
stacking gel (see Note 28).
19. Load 5 μL of protein standard into the first well.
20. Carefully start loading samples into the gel (see Note 29).
21. After all samples are loaded, load 5 μL of protein standard into
the next well.
22. Electrophorese at constant 130 V for 1 h 40 min or until the
dye front has reached the bottom of the gel (see Note 30).

3.2 BisANS Assay 1. Homogenize tissue/sonicate harvested cells in 1× BisANS

labeling buffer, pH 7.4 with pi (see Notes 9 and 10).
(a) Use 150–200 μL for ~100 mg of tissue.
(b) Use 50–100 μL for cells harvested from 100 mm Petri dish
(see Note 31).
2. Transfer to thick wall ultracentrifuge tubes.
3. Spin down at 100,000 × g for 1 h at 4 °C.
4. Transfer supernatant to fresh tubes and keep on ice.
5. Measure protein concentration as instructed by BCA kit.
6. Turn lights off for as long as BisANS is being worked with.
7. Remove an aliquot of 10 mM BisANS and allow it to thaw
before use.
8. In a clear flat-bottomed 96-well plate, prepare reaction
mixtures at 1 mg protein/mL with 0.1 mM BisANS in
1 × 50 mM Tris–HCl, pH 7.4 (see Note 32).
9. Place the 96-well plate securely on ice and rest a handheld
longwave UV light directly on the plate. Make sure the light
will cover all of the wells uniformly.
10. Turn on the UV light and allow samples to crosslink with
BisANS for 1 h in the dark (see Note 33).
11. Turn off the UV light, then add appropriate volume of 10×
loading dye and buffer to prepare samples for SDS-PAGE
(see Note 6).
12. Load 5–15 μg of BisANS-labeled protein per gel well and
subject to SDS-PAGE (see Note 29).
13. After electrophoresis, place gel in a plastic container with wash
consisting of 30 % methanol, 10 % 1× Tris/glycine/SDS
running buffer, and 60 % water.
14. Leave plastic container gently rocking for 5 min.
15. Capture BisANS fluorescence image under 365 nm UV light.
16. Wash gel 3× in water for 5 min (at this point, the lights can be
turned back on).
 Quantitative Assessment of Protein Oxidation 163

17. Add enough Bio-safe Coomassie stain to cover gel (see Note 17).
This will correct for protein loading.
18. Wrap plastic container with plastic wrap and let gel stain over-
night with gentle rocking.
19. Wash gel 3× in water for 5 min. There should be noticeable
blue bands visible in the gel.
20. Capture Coomassie image under visible light.
21. Analyze all images using Unscanit software (see Note 34).
22. Figure 1 represents the use of the BisANS assay in two distinct
mouse models of oxidative stress; (A) Sod1−/− and (B) f-ALS.

Fig. 1 Alteration in global protein conformation in mouse models of in vivo oxidative stress and f-ALS. BisANS
UV crosslinked skeletal muscle proteins were analyzed by SDS-PAGE in (a) 20-mo-old wild-type (WT) and
Sod1−/− mice and (b) SOD1G93A and SOD1H46R/H48Q mouse models of human f-ALS. Results are expressed as
mean ± standard error of the mean of 4–5 mice/group and analyzed by two-tailed t-test (**p < 0.01,
***p < 0.001). Panel (a) demonstrates a 22 ± 3 % reduction in BisANS labeling in old Sod1−/− mice compared
with old WT controls. Panel (b) demonstrates a 24 ± 2 % reduction in BisANS labeling in SOD1G93A mice com-
pared to the longer-lived SOD1H46R/H48Q mice. Previously, we reported that creatinine kinase (43 kDa) and glyc-
eraldehyde 3-phosphate dehydrogenase (37 kDa) are affected conformationally in response to oxidative stress
[20–22] and these proteins were also affected in the f-ALS and Sod1−/− mouse models as depicted in (a) and
(b) by (1) and (2), respectively
164 Asish R. Chaudhuri et al.

3.3 Disulfide Assay 1. Homogenize tissue/sonicate harvested cells in 1× KP buffer,

pH 8.0 with 200 mM IAM and pi (see Notes 9 and 10).
(a) Use 150–200 μL for ~100 mg of tissue.
(b) Use 50–100 μL for cells harvested from 100 mm Petri dish
(see Note 31).
2. Transfer to thick-walled ultracentrifuge tubes.
3. Spin down at 100,000 × g for 1 h at 4 °C.
4. Transfer supernatant to fresh tubes and keep on ice.
5. Add 1× P3 buffer, pH 8.0 with 200 mM IAM and pi to the
remaining pellets.
(a) Use 100–150 μL for pellet obtained from tissue.
(b) Use 50–75 μL for pellet obtained from cells (see Note 31).
6. Sonicate samples to dissolve insoluble pellet (see Note 10).
7. Spin down at 100,000 × g for 10 min at room temperature
(see Note 35).
8. Transfer new supernatant to fresh tubes and keep at room
temperature.
9. Measure protein concentration as instructed by BCA kit.
10. Prepare reaction mixtures at 1 mg protein/mL in 6 M Urea
(see Note 36). Use 1× KP buffer, pH 8.0 with 200 mM IAM
and pi for initial soluble supernatant; use 1× P3 buffer, pH 8.0
with 200 mM IAM and pi for insoluble pellet supernatant.
This step will block all free sulfhydryl groups.
11. Incubate reaction mixtures for 1 h at 37 °C.
12. After incubation, add an equal volume of 20 % TCA to the
samples in order to precipitate the protein (see Note 37).
13. Incubate for 15 min on ice (supernatant) or room temperature
(pellet) (see Note 38).
14. Spin down at 16,000 × g for 15 min at 4 °C (supernatant) or
room temperature (pellet).
15. Carefully remove TCA and add 300 μL of 1:1 ethanol/ethyl
acetate.
16. Break up the protein pellet using flattened pipette tip or
sonicator (see Note 10).
17. Spin down at 16,000 × g for 15 min at 4 °C (supernatant) or
room temperature (pellet).
18. Carefully remove first 1:1 ethanol/ethyl acetate wash.
19. Add another 300 μL 1:1 ethanol/ethyl acetate.
20. Break up the protein pellet again using flattened pipette tip or
sonicator (see Note 10).
21. Carefully remove second 1:1 ethanol/ethyl acetate wash.
 Quantitative Assessment of Protein Oxidation 165

22. Dissolve protein with 300 μL of 8 M Urea (sonicate if necessary)

(see Note 10).
23. Add DTT to 1 mM final concentration and mix.
24. Incubate for 30 min at 37 °C. This step will break the disulfide
bridges.
25. Turn lights off for as long as 6-IAF is being worked with.
26. Remove an aliquot of 6-IAF and allow it to thaw before use.
27. Add 6-IAF to samples to 1 mM final concentration and mix.
28. Incubate for 30 min at 37 °C in the dark. This step will label
the reduced sulfhydryl groups that were previously oxidized in
the disulfide bridges.
29. After incubation, add an equal volume of 20 % TCA to the
samples in order to precipitate the protein (see Note 37).
30. Incubate for 10 min on ice (supernatant) or room temperature
(pellet) (see Note 38).
31. Spin down at 16,000 × g for 5 min at 4 °C (supernatant) or
room temperature (pellet).
32. Carefully remove TCA and add 1 mL of 1:1 ethanol/ethyl acetate.
33. Continue with breaking the pellet, spinning down, removing
wash, and adding a new wash until three washes have been
completed (see Note 39).
34. After last wash, remove all excess 1:1 ethanol/ethyl acetate.
35. Dissolve supernatant protein with 8 M Urea with pi and pellet
protein with 1× P3 buffer, pH 8.0 with pi.
36. Sonicate all samples (see Note 10).
37. If necessary, incubate samples for up to 30 min at 37 °C to
help dissolve protein.
38. Spin down all samples at 16,000 × g for 2 min at room tem-
perature to pellet any insoluble protein.
39. Transfer supernatant to fresh tubes.
40. Measure protein concentration as instructed by BCA kit.
41. Add appropriate volume of 10× loading dye and buffer to pre-
pare samples for SDS-PAGE (see Note 6).
42. Load 5–15 μg of labeled protein per well and subject to SDS-
PAGE (see Note 29).
43. Place gel in a plastic container with water.
44. Leave plastic container gently rocking for 5 min.
45. Capture disulfide fluorescence image on Typhoon 9400
Variable Mode Imager under the settings 526 SP filter, 350
PMT sensitivity, 532 nm excitation (see Note 40).
46. Wash gel 3× in water for 5 min (at this point, the lights can be
turned back on).
166 Asish R. Chaudhuri et al.

47. Add enough Bio-safe Coomassie stain to cover gel (see Note 17).
This will correct for protein loading.
48. Wrap plastic container with plastic wrap and let gel stain
overnight while gently rocking.
49. Wash gel 3× in water for 5 min. There should be noticeable
blue bands visible in the gel.
50. Capture Coomassie image under visible light.
51. Analyze all images using Unscanit software (see Note 33).
52. Figure 2 represents the use of the disulfide assay in f-ALS
mouse model.
53. Quantification for disulfides was performed utilizing Unscanit
software as described previously for BisANS (see Note 33).

Fig. 2 Global change in protein disulfides in a mouse model of f-ALS. 6-IAF

labeled spinal cord protein homogenates were run on 12 % SDS-PAGE and ana-
lyzed by fluorescence spectroscopy in postsymptomatic (140 days) SOD1G93A
mice and aged-matched wild-type (WT) mice. Results are expressed as
mean ± standard error of the mean of 3 mice/group and analyzed by two-tailed
t-test (***p < 0.001). Figure 2 shows a ~2-fold increase in protein disulfides in
the postsymptomatic SOD1G93A mice compared to WT littermate controls
 Quantitative Assessment of Protein Oxidation 167

3.4 Carbonyl Assay 1. Homogenize tissue/sonicate harvested cells in 1× KP buffer,

pH 6.0 with pi (see Notes 9 and 10).
(a) Use 150–200 μL for ~100 mg of tissue.
(b) Use 50–100 μL for cells harvested from 100 mm Petri dish
(see Note 31).
2. Transfer to thick wall ultracentrifuge tubes.
3. Spin down at 100,000 × g for 1 h at 4 °C.
4. Transfer supernatant to fresh tubes and keep on ice.
5. Add 1× P3 buffer, pH 6.0 with pi to the remaining pellets.
(a) Use 100–150 μL for pellet obtained from tissue.
(b) Use 50–75 μL for pellet obtained from cells (see Note 31).
6. Sonicate samples to dissolve insoluble pellet (see Note 10).
7. Spin down at 100,000 × g for 10 min at room temperature
(see Note 35).
8. Transfer new supernatant to fresh tubes and keep at room
temperature.
9. Measure protein concentration as instructed by BCA kit.
10. Prepare reaction mixtures at 1 mg protein/mL (see Note 36).
Use 1× KP buffer, pH 6.0 with pi for initial soluble superna-
tant; use 1× P3 buffer, pH 6.0 with pi for insoluble pellet
supernatant.
11. Add DTT to 1 mM final concentration to pellet samples only.
This will help with dissolving the protein in subsequent steps.
12. Turn lights off for as long as FTC is being worked with.
13. Remove an aliquot of FTC and allow it to thaw before use.
14. Add FTC to 1 mM final concentration and mix.
15. Add guanidine hydrochloride to 0.3 M final concentration to
all samples and mix (see Note 37).
16. Incubate for 2 h at 37 °C in the dark.
17. After incubation, add an equal volume of 20 % TCA to the
samples in order to precipitate the protein (see Note 38).
18. Incubate for 15 min on ice (supernatant) or room temperature
(pellet) (see Note 39).
19. Spin down at 16,000 × g for 15 min at 4 °C (supernatant) or
room temperature (pellet).
20. Carefully remove TCA and add 1 mL of 1:1 ethanol/ethyl
acetate.
21. Break up the protein pellet using flattened pipette tip or soni-
cator (see Note 10).
168 Asish R. Chaudhuri et al.

22. Spin down at 16,000 × g for 15 min at 4 °C (supernatant) or

room temperature (pellet).
23. Carefully remove first 1:1 ethanol/ethyl acetate wash.
24. Continue with breaking the pellet, spinning down, removing
wash, and adding a new wash until four washes have been
completed (see Note 40).
25. After last wash, remove all excess 1:1 ethanol/ethyl acetate.
26. Dissolve supernatant protein with 8 M Urea with pi and pellet
protein with 1× P3 buffer, pH 8.0 with 1 mM DTT and pi.
27. Sonicate all samples (see Note 10).
28. If necessary, incubate samples for up to 30 min at 37 °C to
help dissolve protein.
29. Spin down all samples at 16,000 × g for 2 min at room
temperature to pellet any insoluble protein.
30. Transfer supernatant to fresh tubes.
31. Measure protein concentration as instructed by BCA kit.
32. Add appropriate volume of 10× loading dye and buffer to
prepare samples for SDS-PAGE (see Note 6).
33. Load 5–15 μg of labeled protein per well and subject to SDS-
PAGE (see Note 29).
34. Place gel in a plastic container with water.
35. Leave plastic container gently rocking for 5 min.
36. Capture carbonyl fluorescence image on Typhoon 9400
Variable Mode Imager under the settings 526 SP filter, 600
PMT sensitivity, 532 nm excitation (see Note 41).
37. Wash gel 3× in water for 5 min (at this point, the lights can be
turned back on).
38. Add enough Bio-safe Coomassie stain to cover gel (see Note
17). This will correct for protein loading.
39. Wrap plastic container with plastic wrap and let gel stain over-
night while gently rocking.
40. Wash gel 3× in water for 5 min. There should be noticeable
blue bands visible in the gel.
41. Capture Coomassie image under visible light.
42. Analyze all images using Unscanit software (see Note 33).
43. Figure 3 represents the use of carbonyl assay in f-ALS mouse
model.
44. Quantification of global carbonyls was performed utilizing
Unscanit software as described previously for BisANS
(see Note 33).
 Quantitative Assessment of Protein Oxidation 169

Fig. 3 Global change in protein carbonyls in a mouse model of f-ALS. Skeletal

muscle protein carbonyls in post. Symptomatic ALS mice (140 days) and aged-
matched wild-type (WT) mice were measured by FTC fluorescence. Results are
expressed as mean ± standard error of the mean of 3 mice/group and analyzed
by two-tailed t-test (*p < 0.05). Figure 3 demonstrates a ~2.3-fold increase in
protein carbonyls in post. Symptomatic SOD1G93A mice compared to WT litter-
mate controls

4 Notes

1. The 100 mL gap is to allow for the addition of concentrated

HCl, as a considerable volume is used to adjust for pH in this
solution.
2. 10 % APS solution is always prepared fresh.
3. Wear gloves and mask when handling powder; SDS is an irri-
tant and harmful by inhalation, ingestion, skin or eye contact.
4. TEMED is stored and used in the fume hood to reduce odor.
5. 1× buffer: 25 mM Tris–HCl, 192 mM glycine, 0.1 % SDS,
pH 8.3. 1× buffer may be used 4–5 times before discarding as
waste.
170 Asish R. Chaudhuri et al.

6. SDS precipitates at 4 °C. Make sure loading dye is warmed to

room temperature prior to use. β-ME is hazardous, avoid skin
contact, eye contact, and inhalation.
7. Any gel protein standards will work. Make sure to take note of
the molecular weight bands for that particular product.
8. We primarily use 26-well combs, but the company has a variety
of other well comb sizes available.
9. Be very careful to only apply pressure vertically while homog-
enizing tissue, as the tissue grind pestle is made of glass and can
easily break.
10. Wear sound mufflers to protect your hearing while sonicating.
To avoid loss of precious sample, try to keep sonicator tip
closer to the bottom of tube and carefully move tip up and
down. Always keep sonicator tip away from the surface of
sample as this will spray sample out of the tube.
11. Always double check for proper placement of rubber O-ring
on the inner side of rotor cover. This will prevent loss of
sample.
12. Hydrated magnesium sulfate (MgSO4-xH2O) can also be used
in this case. Keep in mind that the amount weighed for the
stock solution will be different in order to correct for higher
molecular weight.
13. Stocks are prepared without pi and stored at room tempera-
ture. Pi is treated as 1000× (e.g., 5 μL of pi in 5 mL of buffer)
and is added right before using buffer.
14. Fluorescent probe is light sensitive. Keep the lights off anytime
fluorescent probe is being worked with.
15. Any flat-bottomed 96-well plate will work. It can be clear or
black.
16. UV light wavelength 365 nm. UV light is harmful to bare skin
and eyes, avoid exposure to those areas. Never look at the UV
light while it is illuminated.
17. Coomassie is a total protein stain. Avoid using bare fingers
when moving gel around, as this can leave fingerprints directly
on the gel.
18. Combining certain percentages of KP monobasic and dibasic
will result in a set pH. To obtain pH 8.0 for the disulfide assay,
we combined 94 % KP dibasic with 6 % KP monobasic. To
obtain pH 6.0 for the carbonyl assay, we combine 13.2 % KP
dibasic with 86.8 % KP monobasic.
19. IAM is always prepared fresh.
20. 6 and 8 M Urea is always prepared fresh. It is normal for the
solution to get colder while dissolving in water, let it warm to
room temperature before use.
 Quantitative Assessment of Protein Oxidation 171

21. Always add TEMED and APS last to the mixture, as this will
start the gel polymerization process.
22. It is normal to observe a slight rolling effect at the border of
the running gel mixture and isopropanol.
23. To dry, invert the cassette onto paper towels and lightly tap to
remove excess water.
24. Try to add stacking gel mixture carefully and avoid bubbles.
25. We try to push any bubbles to the side as we slide the well
comb in. If bubbles remain in the stacking gel mixture, sam-
ples will not run properly.
26. Failure to remove sticker strip will prevent current flow and
samples will not run down gel.
27. We completely fill the top buffer reservoir. It is crucial to have
the wells covered in 1× Tris/glycine/SDS buffer. Failure to do
so will prevent current flow and samples will not run down gel.
28. Stacking gel is fragile and can break off or bend if well comb
removal is not careful.
29. We pipette samples starting from the bottom of the well and
slowly raising pipette tip as well is filled with sample.
30. The dye front generally runs faster than the smallest molecular
weight band of the precision plus kaleidoscope protein stan-
dards, so is easy to spot when to stop electrophoresis.
31. We generally try to prepare reaction mixtures of 100 μg pro-
tein in 100 μL total volume in 1× BisANS buffer plus protease
inhibitors. A lower total volume will be difficult to uniformly
cover the entire well surface of the 96-well plate.
32. It is very important to keep the plate on ice to avoid sample
evaporation, as the plate will heat up over time while the UV
light is on.
33. Unscanit software utilizes the area under the curve for given
bands and allows you to calculate the areas under the curve for
each band which can be summed after analysis for all bands on
the gel. For all analysis, the total BisANS, disulfides, or carbon-
yls were measured as an area under the curve in arbitrary units
for all bands and normalized to the area under the curve for
the total protein loaded on the gels as measured by coomassie.
Values were converted to fold change relative to the wild-type
animals. Arrows located in Fig. 1 indicate two proteins that we
observed in our 2006 manuscript which confirmed the pro-
teins that were misfolded by mass spectrometry analysis [20].
Any alternative image analysis software will work for the
analysis.
34. For sonicating volumes of 50–100 μL, we suggest using
0.2 mL thick wall ultracentrifuge tubes.
172 Asish R. Chaudhuri et al.

35. SDS precipitates at 4 °C; make sure that all samples containing
P3 buffer are worked with at room temperature.
36. We generally try to prepare reaction mixtures of at least 200 μg
protein in 200 μL total volume if limited on sample. Ethanol/
ethyl acetate wash steps lose a lot of protein; use at maximum
500 μg protein in 500 μL total volume.
37. Add an equal volume of 20 % TCA as the total volume of
reaction mixture (e.g., 200 μL TCA to 200 μL total volume
reaction mixture).
38. Reaction mixture becoming cloudy or speckled is a good indi-
cation of protein precipitation. If working with very low
amounts of protein, TCA precipitation time can be increased.
39. Several washes are required to get rid of excess TCA and free
fluorescent probe. Failure to do so will cause the gel fluores-
cence to look streaky and lack distinguished band patterning.
40. Fluorescence imaging will also work with other imagers with
similar excitation/emission/filter capabilities.
41. The addition of guanidine hydrochloride will make pellet sam-
ples difficult to work with, so make sure to add it last to the
reaction mixture.

References

1. Christians ES, Benjamin IJ (2012) Proteostasis 7. Curtis JM, Hahn WS, Long EK, Burrill JS,
and REDOX state in the heart. Am J Physiol Arriaga EA, Bernlohr DA (2012) Protein car-
Heart Circ Physiol 302:H24–H37 bonylation and metabolic control systems.
2. Bokov A, Chaudhuri A, Richardson A (2004) Trends Endocrinol Metab 23:399–406
The role of oxidative damage and stress in 8. Bhattacharya A, Leonard S, Tardif S,
aging. Mech Ageing Dev 125:811–826 Buffenstein R, Fischer KE, Richardson A,
3. Butterfield DA, Kanski J (2001) Brain protein Austad SN, Chaudhuri AR (2011) Attenuation
oxidation in age-related neurodegenerative of liver insoluble protein carbonyls: indicator
disorders that are associated with aggregated of a longevity determinant? Aging Cell 10:
proteins. Mech Ageing Dev 122:945–962 720–723
4. Olivares-Corichi IM, Ceballos G, Medina- 9. Uchida K (2003) Histidine and lysine as tar-
Santillan R, Medina-Navarro R, Guzman- gets of oxidative modification. Amino Acids
Grenfell AM, Hicks JJ (2005) Oxidation by 25:249–257
reactive oxygen species (ROS) alters the struc- 10. Amici A, Levine RL, Tsai L, Stadtman ER
ture of human insulin and decreases the (1989) Conversion of amino acid residues in
insulin-dependent D-glucose-C14 utilization proteins and amino acid homopolymers to car-
by human adipose tissue. Front Biosci bonyl derivatives by metal-catalyzed oxidation
10:3127–3131 reactions. J Biol Chem 264:3341–3346
5. Uchida K, Toyokuni S, Nishikawa K, Kawakishi 11. Doorn JA, Petersen DR (2002) Covalent
S, Oda H, Hiai H, Stadtman ER (1994) modification of amino acid nucleophiles by the
Michael addition-type 4-hydroxy-2-nonenal lipid peroxidation products 4-hydroxy-2-non-
adducts in modified low-density lipoproteins: enal and 4-oxo-2-nonenal. Chem Res Toxicol
markers for atherosclerosis. Biochemistry 15:1445–1450
33:12487–12494 12. Berlett BS, Stadtman ER (1997) Protein oxi-
6. Nakamura A, Kawakami K, Kametani F, dation in aging, disease, and oxidative stress.
Nakamoto H, Goto S (2010) Biological J Biol Chem 272:20313–20316
significance of protein modifications in aging 13. Huggins TG, Wells-Knecht MC, Detorie NA,
and calorie restriction. Ann N Y Acad Sci Baynes JW, Thorpe SR (1993) Formation of
1197:33–39 o-tyrosine and dityrosine in proteins during
 Quantitative Assessment of Protein Oxidation 173

radiolytic and metal-catalyzed oxidation. J Biol Detection and quantification of protein disul-
Chem 268:12341–12347 fides in biological tissues a fluorescence-based
14. Thomas JA, Mallis RJ (2001) Aging and proteomic approach. Methods Enzymol 473:
oxidation of reactive protein sulfhydryls. Exp 161–177
Gerontol 36:1519–1526 20. Pierce A, deWaal E, Van Remmen H, Richardson
15. Zhou JQ, Gafni A (1991) Exposure of rat A, Chaudhuri A (2006) A novel approach for
muscle phosphoglycerate kinase to a nonenzy- screening the proteome for changes in protein
matic MFO system generates the old form of conformation. Biochemistry 45:3077–3085
the enzyme. J Gerontol 46:B217–B221 21. Pierce A, Mirzaei H, Muller F, De Waal E,
16. Chaudhuri AR, Khan IA, Luduena RF (2001) Taylor AB, Leonard S, Van Remmen H,
Detection of disulfide bonds in bovine brain Regnier F, Richardson A, Chaudhuri A (2008)
tubulin and their role in protein folding and GAPDH is conformationally and functionally
microtubule assembly in vitro: a novel disul- altered in association with oxidative stress in
fide detection approach. Biochemistry 40: mouse models of amyotrophic lateral sclerosis.
8834–8841 J Mol Biol 382:1195–1210
17. Chaudhuri AR, de Waal EM, Pierce A, Van 22. Pierce AP, de Waal E, McManus LM, Shireman
Remmen H, Ward WF, Richardson A (2006) PK, Chaudhuri AR (2007) Oxidation and
Detection of protein carbonyls in aging liver structural perturbation of redox-sensitive
tissue: a fluorescence-based proteomic enzymes in injured skeletal muscle. Free Radic
approach. Mech Ageing Dev 127:849–861 Biol Med 43:1584–1593
18. Salmon AB, Leonard S, Masamsetti V, Pierce 23. Wei R, Bhattacharya A, Chintalaramulu N,
A, Podlutsky AJ, Podlutskaya N, Richardson Jernigan AL, Liu Y, Van Remmen H,
A, Austad SN, Chaudhuri AR (2009) The long Chaudhuri AR (2012) Protein misfolding,
lifespan of two bat species is correlated with mitochondrial dysfunction and muscle loss are
resistance to protein oxidation and enhanced not directly dependent on soluble and aggre-
protein homeostasis. FASEB J 23:2317–2326 gation state of mSOD1 protein in skeletal
19. Perez VI, Pierce A, de Waal EM, Ward WF, muscle of ALS. Biochem Biophys Res
Bokov A, Chaudhuri A, Richardson A (2010) Commun 417:1275–1279
 Chapter 14

Monitoring the DNA Damage Response

at Dysfunctional Telomeres
Rekha Rai and Sandy Chang

Abstract
Telomeres are repetitive DNA repeats that cap the ends of all eukaryotic chromosomes. Their proper
maintenance is essential for genomic stability and cellular viability. Dysfunctional telomeres could arise
through natural attrition of telomeric DNA or due to the removal of shelterin components. These
uncapped chromosomal ends are recognized as DSBs by the DDR pathway, leading to the accumulation
of DNA damage sensors at telomeres. The association of these DDR proteins with dysfunctional telo-
meres forms telomere dysfunction induced DNA damage foci (TIFs). Detection of TIFs at telomeres
provides an opportunity to quantify the extent of telomere dysfunction and monitor downstream DNA
damage signaling pathways. Here we describe a method for the detection of TIFs using a fluorescent in situ
hybridization (FISH) approach.

Key words DNA damage, Telomere dysfunction, Telomere induced foci, Telomere FISH

1 Introduction

DNA double-strand (ds) breaks are highly genotoxic lesions which

must be repaired by the DNA damage response (DDR). Failure to
properly repair these lesions results in genomic instability and
could promote the onset of cancer. The DDR functions to delay
cell cycle progression until the damaged DNA is repaired by either
the non-homologous end joining or homologous recombination
repair pathways, or if the damage is too severe for repair, the initia-
tion of apoptosis. Persistent DNA damage promotes the onset of a
permanent arrested state—termed senescence. Activation of a
potent tumor suppressive senescence program is associated in vivo
through the activation of the DDR by dysfunctional telomeres [1].
Telomeres are ribonucleoprotein complexes at the chromosome
ends and consist of TTAGGG repetitive sequences. Telomeres ter-
minate with a 3′ single-stranded G-overhang, and the enzyme
telomerase utilizes this structure to add de novo telomere sequences
to chromosome ends. In mammals, telomeres are bound by six

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_14, © Springer Science+Business Media New York 2015

175
176 Rekha Rai and Sandy Chang

telomeric core proteins: telomeric-repeat-binding factor 1 (TRF1)

and 2 (TRF2), TRF1-interacting protein 2 (TIN2), transcriptional
repressor/activator protein RAP1, protection of telomeres 1
(POT1), and POT1- and TIN2-organizing protein (TPP1) [2].
This so-called shelterin complex contributes to the formation of
protective telomere loop (t-loop) structures in which the single-
stranded 3′-overhang invades the telomeric duplex in order to
prevent chromosome ends from being recognized as DSBs by the
DDR pathway. Failure of the protective features of telomeres due to
natural telomere attrition or to alterations in the shelterin complex
leads to the formation of “dysfunctional” telomeres incapable of
maintaining normal protective functions [3]. Dysfunctional telo-
meres are sensed by the MRN (Mre11/Rad50/Nbs1) complex,
which activates an ATM/ATR dependent DNA damage signaling
cascade leading to the recruitment of DNA damage response factors
such as 53BP1, γ-H2AX, and MDC1 to initiate inappropriate non-
homologous end joining (NHEJ) or homologous recombination
(HR) DNA repair pathways at chromosome ends [4, 5]. The recruit-
ment of DNA damage response factors to dysfunctional telomeres
can be efficiently visualized in interphase nuclei using telomere fluo-
rescent in situ hybridization (FISH). These foci, known as dysfunc-
tional telomere induced DNA damage foci (TIFs), mark dysfunctional
telomeres. They provide an opportunity to quantify the extent of
telomere dysfunction in all cell types and to monitor the DDR
pathways activated by dysfunctional telomeres [6, 7].

2 Materials

2.1 Cell Culture 1. Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented

with 10 % fetal bovine serum (FBS, Sigma), OPTI-MEM
(Gibco).
2. 293T (ATCC) and Mouse Embryonic Fibroblast (MEFs) Cells.
3. 0.25 % Trypsin.
4. Phosphate-buffered saline (PBS).

2.2 Retroviral 1. pCL Eco, Empty pBabe, p-Babe shTRF2, Empty pQCXIP,
Production pQCXIP TPP1ΔRD [8].
and Infection 2. Polybrene Stock 6 mg/ml. Filter through a 0.2 μm filter, ali-
quot, and store at −20 °C.
3. Lipofectamine Plus Reagent (Invitrogen), Fugene 6 (Roche).
4. 0.45 μm syringe filters (Millipore).

2.3 Immunofluo- 1. Nunc Lab-Tek 8 well slide chambers (Nalgene Nunc, 12-565-1),
rescence-Telomere Microscope coverslips 18 × 18-1 (Fisher-12-548-A), Microscope
FISH Slides (Fisher 12-544-3).
 Detection of Telomere Dysfunction 177

2. Phosphate-buffered saline (PBS): Prepare 10× stock with

1.37 M NaCl, 27 mM KCl, 100 mM Na2HPO4, 18 mM
KH2PO4 (adjust to pH 7.4 with HCl if necessary) and auto-
clave before storage at room temperature. Prepare working
solution by dilution of one part with nine parts water.
3. Fix Solution: 2 % paraformaldehyde/2 % sucrose.
4. Blocking Solution PBG: 0.2 % fish gelatin (Sigma), 0.5 % BSA
(Sigma). Aliquot PBG and store at −20 °C.
5. Permeabilization Buffer: 0.5 % (v/v) Nonidet-P40 in PBS.
6. TBST: 1× PBS with 0.1 % Triton.
7. Primary antibodies: 53BP1 and γ-H2AX antibodies (Upstate).
8. Secondary antibodies: Alexa Fluor 568 goat anti-mouse IgG
{H + L} (Molecular Probes A-11004).
9. 20× SSC (3.0 M NaCl and 0.3 M sodium citrate, pH 7.0).
10. Formamide (Fisher).
11. TelC-TAMRA, TAMRA-OO-(CCCTAA)3 Peptide Nucleic Acid
(PNA) Probe (Pan agene-F2002). Stock solution 1 μg/μl in H2O.
12. Yeast tRNA (Invitrogen). Stock solution 1 mg/ml in H2O.
13. Wash Solution I: (70 % formamide, 0.1 % Tween-20, 0.1 %
BSA, 10 mM Tris–HCl, pH 7.5).
14. Wash Solution II: (50 mM Tris–HCl, pH 7.5, 150 mM NaCl,
0.1 % BSA, 0.1 % Tween-20).
15. Mounting Medium with Antifate: DAPI (Vectashield H-1200).

3 Methods

TIFs can sometimes be detected in human or mouse cells which

have experienced natural telomere attrition. However, robust TIF
formation is accompanied by the disruption of normal telomere
structure through depletion of TRF2, or removal of the TPP1-
POT1a/b complex from telomeres [4–9]. To accomplish efficient
induction of TIFs in Mouse Embryonic Fibroblasts (MEFs), deple-
tion of TRF2 using shRNA against TRF2 [4] or overexpression of
TPP1ΔRD (a TPP1 mutant lacking the POT1 interaction domain)
to disrupt endogenous TPP1-POT1a/b interactions [9] is
performed. Induction of TIFs in human cells can be achieved simi-
larly [8]. For infecting MEFs, use the pCL-ECO packaging plas-
mid, and for infecting human cells, use VSV-G/Gag-Pol packaging
constructs for generating high titer shTRF2 or TPP1ΔRD retroviral
particles [8]. To achieve high titer retroviral particles, use early pas-
sage 293T cells and high quality DNA preparations. Cells with ≥5
53BP1 or γ-H2AX signals co-localized with telomere signals are
considered TIF-positive. Score at least 100–200 TIFs positive cells
to reach statistical significance.
178 Rekha Rai and Sandy Chang

3.1 Retrovirus 1. Day 0: On the day before transfection, plate 0.5–1 ×1 06 293T
Production in 293T cells into a 6 cm tissue culture dish in 4.0 ml DMEM supple-
Cells mented with 10 % FBS (see Note 1). The cells are ready for
transfection after 18–20 h, or when they are about 60–70 %
confluent. Plate slightly more cells when making VSV-G pseu-
dotyped viruses.
2. Day 1: Aspirate the medium and replace the cells with 2.0 ml
DMEM without FBS or any antibiotic. Transfect 293T cells
with 2.0 μg pCL-ECO and 4.0 μg of transfer vectors (p-Babe
shTRF2, pQXCIP TPP1ΔRD) using Lipofectamine Plus Reagent
following the manufacturer’s protocol. For making VSV-G
retroviruses by triple transfection, use 0.9 μg Gag/Pol expres-
sion vector, 0.1 μg VSV-G expression vector, and 1.0 μg trans-
fer vector. For making VSV-G pseudotype viruses, use Fugene
6 following the manufacturer’s protocol.
3. Change the medium 5–7 h after transfection with 4.0 ml of
fresh medium (see Note 2).
4. Day 3: Harvest the viral supernatants at 48 h post-transfection.
Filter the viral supernatant with a 0.45 μm syringe filter. Add
10 ml of fresh DMEM medium supplemented with 10 % FBS
to the cells.
5. Day 4: Harvest the viral supernatant at 72 h of post-infection
as above.

3.2 Retroviral 1. Day 2: Grow 20 % confluent target cells either on coverslips in

Infection 6-well plates or in 8-well slide chambers (see Note 3).
2. Day 3: Infect the cells with retroviral particles harvested at
48 h. Add 2.0 ml viral particles (1:1 diluted in
DMEM/10%FBS) in a 6-well plate and 500 μl in 8-well
chambers to infect MEFs/Human cells. Add 6 μg/ml polybrene
for infecting MEFs and 4 μg/ml polybrene for infecting Hela
or U2OS cells (see Note 4).
3. Day 4: After 24 h, reinfect the cells with the 72 h harvest of
retroviral particles.
4. Day 5: Replace the cells with fresh medium (see Note 5).

3.3 Immunofluo- 1. Day 6: Aspirate the medium and wash the cells twice for 5 min
rescence-Telomere each with 1× PBS at room temperature (RT).
FISH 2. Fix the cells with 2 % paraformaldehyde/2 % sucrose for 10 min
at RT.
3. Wash the fixed cells twice for 5 min each with 1× PBS.
4. Permeabilize the cells with 0.5 % Nonidet-P40 for 10 min at RT.
5. Wash the cells thrice for 5 min with 1× PBS.
6. Incubate the cells with PBG for 1 h to block nonspecific
binding.
 Detection of Telomere Dysfunction 179

7. Incubate the cells with the primary antibody diluted in PBG

(1:2000 53BP1 or γ-H2AX) overnight at 4 °C in a humidified
chamber (see Note 6). Add 60 μl antibody for 8-well cham-
bers, and 30–50 μl for cells on coverslips. For cells on cover-
slips, drop antibodies on paraffin film and gently place coverslips
with cells facing down on top of antibody drop.
8. Day 7: Wash the cells thrice for 5 min each with PBST followed
by 5 min blocking with PBG.
9. Incubate the cells with appropriate secondary antibody diluted
in PBG (1:2000) for 1 h at RT. Incubation should be per-
formed in the dark.
10. Wash the cells thrice for 5 min each with 1× PBST.
11. Post-fix the secondary antibody to primary antibody by incu-
bating the cells in 4 % paraformaldehyde for 10 min at room
temperature (see Note 7).
12. Wash the cells twice for 5 min each with PBS, RT.
13. Add freshly prepared PNA-FISH hybridization mix: (30 μl/
coverslip, face down on paraffinized slides; 60 μl per eight
chamber slide). PNA-hybridization mix recipe:

H2O 2.85 μl
2 % BSA 1.5 μl
100 μg/ml tRNA 0.15 μl
0.6× SSC 3.0 μl
100 % Formamide 21.0 μl
10 ng/μl PNA Probe 1.5 μl
Total 30.0 μl

14. Denature the slide at 85 °C on a hot plate for 3 min; place the
slide in the dark overnight in a humidified chamber (see Note 8).
15. Day 8: Wash twice for 15 min each in Wash Solution I. For
slides use a Coplin jar, for coverslips use a 6-well plate.
16. Wash thrice for 5 min each in Wash Solution II.
17. Ethanol dehydrate the slides for 2 min each with 70, 85, and
95 % Ethanol.
18. Counterstain with DAPI and seal with nail vanish. The cover-
slip should be carefully inverted to a drop of mounting medium
on a microscope slide. For 8-well chambers, carefully remove
the gasket and place a few drops of mounting medium and
cover with coverslips (see Note 9). The slides can be viewed
immediately when the varnish is dried or can be stored in the
dark at 4 °C for up to a month.
19. Visualize and image under a fluorescent microscope.
180 Rekha Rai and Sandy Chang

4 Notes

1. It is very important to have single cell suspensions (trypsinize

well) and evenly distributed cells.
2. 293T cells detach easily, be careful with all media changes.
3. Coverslips must be autoclaved or sterilized by flaming with
95 % alcohol. Place the coverslips in 6-well plates to cool down.
4. Polybrene enhances the rate of infection.
5. Visualize any GFP control plates under the fluorescent micro-
scope to be sure the cells are expressing GFP. If they are, you
can assume the cells have taken in the DNA and are producing
virus.
6. Make sure cells are covered and will not dry out.
7. It is critical to post-fix the secondary antibody to primary anti-
body using paraformaldehyde in order to retain the primary
antibody signals.
8. Make absolutely sure that the temperature is exactly 85 °C
using a thermometer.
9. Air bubbles are undesirable in the mounting medium.

References
1. Cosme-Blanco W, Shen MF, Lazar A et al end-joining pathways in the fusion of dysfunc-
(2007) Telomere dysfunction suppresses spon- tional telomeres. EMBO J 29:2598–2610
taneous tumorigenesis in vivo by activating 6. d'Adda di Fagagna F, Reaper PM, Clay-Farrace
p53-mediated cellular senescence. EMBO Rep L et al (2003) A DNA damage checkpoint
8:497–503 response in telomere initiated senescence.
2. de Lange T (2005) Shelterin: the protein com- Nature 426:194–198
plex that shapes and safeguards human telo- 7. Takai H, Smogorzewska A, de Lange T (2003)
meres. Genes Dev 19:2100–2110 DNA damage foci at dysfunctional telomeres.
3. Deng Y, Chan SS, Chang S (2008) Telomere Curr Biol 13:1549–1556
dysfunction and tumour suppression: the senes- 8. Liu D, Safari A, O’Connor MS et al (2004) PTOP
cence connection. Nat Rev Cancer 8:450–458 interacts with POT1 and regulates its localization
4. Deng Y, Guo X, Ferguson DO et al (2009) to telomeres. Nat Cell Biol 6:673–680
Multiple roles for MRE11 at uncapped telo- 9. Guo X, Deng Y, Lin Y et al (2007) Dysfunctional
meres. Nature 460:914–918 telomeres activate an ATM-ATR-dependent
5. Rai R, Zheng H, He H et al (2010) The func- DNA damage response to suppress tumorigenesis.
tion of classical and alternative non-homologous EMBO J 26:4709–4719
 Chapter 15

Single-Cell Analysis of T-Cell Receptor αβ Repertoire

Pradyot Dash*, George C. Wang*, and Paul G. Thomas

Abstract
The unbiased, paired analysis of T-cell receptor (TCR) α- and β-chain usage at the single-cell level provides
a valuable window of understanding into the TCR repertoire and the nature of the immune response.
Earlier technologies for TCR repertoire analysis were often limited to examining TCR complementarity-
determining region 3 (CDR3) β expression or required in vitro cloning procedures that can artificially
skew the TCR repertoire from its in vivo state. We describe here a direct ex vivo, single-cell-based strategy
for the clonotypic analysis of TCRαβ repertoires that utilizes multiplexed panels of TCRα and TCRβ-
specific primers in a nested PCR to amplify expressed transcripts from individual, epitope-specific T cells.
This strategy yields the paired TCRαβ sequences of any given population of αβ T cells of interest.

Key words T-cell receptor repertoire, Complementarity-determining region 3, TCR alpha, TCR
beta, TCR diversity, Single-cell analysis, Unbiased repertoire, Paired analysis, Clonotype, Epitope

1 Introduction

The ability to characterize the repertoire of a population of T cells

responding to an epitope, whether pathogen- or host-derived,
offers unique insights into the immune response. The T-cell recep-
tor (TCR) αβ heterodimer binds to peptides presented in the con-
text of self major histocompatibility complex (MHC) glycoproteins
on cell membranes. The third complementarity-determining
region (CDR3) of the TCR, which interacts specifically with the
MHC-bound peptide [1], is primarily responsible for the varia-
tions in TCR structure that enable T cells to bind to unique
peptide-MHC (pMHC) complexes. The uniqueness of each CDR3
derives from somatic rearrangements within the variable (V) and
joining (J) gene segments of the TCRα chain and the V, D (diver-
sity), and J gene segments of the TCRβ chain [1–3].
Historically, the tools for studying epitope-specific TCR reper-
toires can be categorized by their level of resolution. Flow
cytometry-based TCR Vβ frequency analysis [4] and spectratyping

*These authors made equal contributions to this work.

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_15, © Springer Science+Business Media New York 2015

181
182 Pradyot Dash et al.

[5] offer limited-resolution snapshots of the TCR repertoire by

examining percentages of T cells expressing particular Vβ chains
and distributions in CDR3 size, respectively. Various molecular
cloning and sequencing methods provide clonotype-level resolu-
tion of the TCR repertoire, ranging from establishment of cell lines
[6, 7] to direct sequencing by anchored polymerase chain reaction
(PCR) of cells ex vivo [8]. Any procedure that involves in vitro
cloning of T cells can potentially artificially skew the TCR reper-
toire from its in vivo state. Additionally, any bulk amplification of
RNA may be biased by variation between cells in RNA levels. Thus,
recent advances in high-throughput sequencing of TCR clonotypes
primarily focus on genomic DNA in order to maintain relative
quantification [9, 10]. This bulk-sequencing approach does not
currently allow the concurrent characterization of CDR3α and
CDR3β sequences or knowledge of allelic expression, a component
required for an assessment of the true repertoire structure and
diversity that only a single-cell, RNA-based approach can provide.
Therefore, we developed a method for the unbiased, paired
analysis of epitope-specific TCRαβ repertoire at the single-cell
level, using multiplexed panels of CDR3α- and CDR3β-specific
primers in a nested PCR to amplify the expressed CDR3α and
CDR3β segments from individual T cells [11, 12]. The co-
expression data of CDR3α and CDR3β sequences are then obtained
by nucleotide sequencing of the single-cell-derived, amplified
CDR3 products. This strategy can be used on any given popula-
tion of αβ T cells of interest (e.g., epitope-specific CD4+ or CD8+
T cells), from mice [11] or humans [12], thus allowing cloning
and expression of paired TCR for further characterization.
Subsequently, other investigators have used a different single-cell
approach to study TCRαβ chains in human CD8+ T cells [13].
This chapter focuses on the analysis of human T cells. An example
is given in Subheadings 2 and 3 whereby cytomegalovirus (CMV)
epitope-specific human T cells are the cells of interest and are iso-
lated via tetramer staining and flow cytometry-based single-cell
sorting. This method can be applied to other cell populations
single-cell sorted via other strategies.

2 Materials

2.1 Cell Sorting 1. Human peripheral blood mononuclear cells (PBMC): Fresh
Reagents or frozen PBMC isolated by density gradient (e.g., GE
and Instrument Healthcare Ficoll-Paque PLUS) centrifugation from peripher-
ally withdrawn venous whole blood collected into sodium
heparin-coated collection tubes. Frozen PBMC should be
cryopreserved in liquid nitrogen.
2. Fluorochrome-conjugated monoclonal antibodies and tetra-
mer: The following list of reagents is used for the isolation
 Single-Cell Analysis of Human αβT Cell Repertoire 183

of human leukocyte antigen (HLA) A*0201-restricted

CMV pp65495–503 NLVPMVATV (CMV-NLV) CD8+ T cells.
(Use other reagents and/or cell-identification strategies as
appropriate for the isolation of other cell populations). Live
dead discrimination dye (LIVE/DEAD Fixable Aqua Dead
Cell Stain Kit, for 405 nm excitation), FITC-conjugated anti-
human CD3 (e.g., BD 349201), PE-Cy7-conjugated anti-
human CD8 (e.g., BD 557746), PE-conjugated anti-human
CD14 (e.g., BD 340683), and APC-conjugated, peptide-
loaded pMHCI tetramer (e.g., HLA-A*0201-CMV pp65
(NLVPMVATV), Beckman Coulter, T01023). The antibodies
and tetramer should be titrated to determine the optimal dilu-
tion required for staining with minimal background. Store the
antibodies and tetramer at +4 °C in the dark.
3. Sort buffer: PBS containing 0.1 % BSA, fraction V (Life
Technologies). Make a fresh batch and filter sterilize before
each sorting experiment.
4. RNase inhibitor: Add 200 U/ml RNAsin (Promega) to sort
buffer to be used for final resuspension of cells prior to
sorting.
5. Polypropylene DNase- and RNase-free 96-well PCR plates
(Eppendorf) and adhesive sealing films (MicroAmp, Applied
Biosystems).
6. Centrifuge with a plate carrier.
7. MoFlo, iCyt, or equivalent flow cytometric cell sorter with a
single-cell sorting module.

2.2 RT-PCR and Gel 1. Multichannel pipette and tips: 12-channel (5–50 μl) and
Electrophoresis 8-channel (0.5–10 μl) pipettes, 10, 20, and 200 μl DNase-
and RNase-free barrier tips.
2. Individually wrapped sterile reservoir boats.
3. Reverse transcription kit: iScript cDNA Synthesis Kit (Bio-
Rad) containing 5× iScript reaction mix and iScript reverse
transcriptase.
4. Triton X-100, molecular biology grade (Sigma).
5. PCR kit: Taq polymerase-based PCR kit (Qiagen) with 10×
PCR buffer containing 15 mM MgCl2, CoralLoad buffer
(10×) containing 15 mM MgCl2, 10 mM dNTP and Taq
DNA polymerase (5 U/μl).
6. Oligonucleotide primers (Table 1) (see Note 1):
Stock dilution: Resuspend primers to 200 μM using 1× TE
buffer (low EDTA; 10 mM Tris–HCl, 0.1 mM EDTA, pH 8.0;
USB). Store the stock dilutions in −20 °C.
184 Pradyot Dash et al.

Table 1
Primers targeting T-cell receptor alpha (TRA) and beta (TRB) genes

TRA gene(s)
targeted by
primer External primer sequence (EXT) Internal primer sequence (INT)
TRAV1 5′ AACTGCACGTACCAGACATC 3′ 5′ GCACCCACATTTCTKTCTTAC 3′
TRAV2 5′ GATGTGCACCAAGACTCC 3′ 5′ CACTCTGTGTCCAATGCTTAC 3′
TRAV3 5′ AAGATCAGGTCAACGTTGC 3′ 5′ ATGCACCTATTCAGTCTCTGG 3′
TRAV4 5′ CTCCATGGACTCATATGAAGG 3′ 5′ ATTATATCACGTGGTACCAACAG 3′
TRAV5 5′ CTTTTCCTGAGTGTCCGAG 3′ 5′ TACACAGACAGCTCCTCCAC 3′
TRAV6 5′ CACCCTGACCTGCAACTATAC 3′ 5′ TGGTACCGACAAGATCCAG 3′
TRAV7 5′ AGCTGCACGTACTCTGTCAG 3′ 5′ ACAATTTGCAGTGGTACAGG 3′
TRAV8-1 5′ CTCACTGGAGTTGGGATG 3′ 5′ GTCAACACCTTCAGCTTCTC 3′
TRAV8-2, 8-4 5′ GCCACCCTGGTTAAAGG 3′ 5′ AGAGTGAAACCTCCTTCCAC 3′
TRAV8-3 5′ CACTGTCTCTGAAGGAGCC 3′ 5′ TTTGAGGCTGAATTTAAGAGG 3′
TRAV8-6 5′ GAGCTGAGGTGCAACTACTC 3′ 5′ AACCAAGGACTCCAGCTTC 3′
TRAV8-7 5′ CTAACAGAGGCCACCCAG 3′ 5′ ATCAGAGGTTTTGAGGCTG 3′
TRAV9-1, 9-2 5′ TGGTATGTCCAATATCCTGG 3′ 5′ GAAACCACTTCTTTCCACTTG 3′
TRAV10 5′ CAAGTGGAGCAGAGTCCTC 3′ 5′ GAAAGAACTGCACTCTTCAATG 3′
TRAV12-1, 5′ CARTGTTCCAGAGGGAGC 3′ 5′ AAGATGGAAGGTTTACAGCAC 3′
12-2, 12-3
TRAV13-1 5′ CATCCTTCAACCCTGAGTG 3′ 5′ TCAGACAGTGCCTCAAACTAC 3′
TRAV13-2 5′ CAGCGCCTCAGACTACTTC 3′ 5′ CAGTGAAACATCTCTCTCTGC 3′
TRAV14 5′ AAGATAACTCAAACCCAACCAG 3′ 5′ AGGCTGTGACTCTGGACTG 3′
TRAV16 5′ AGTGGAGCTGAAGTGCAAC 3′ 5′ GTCCAGTACTCCAGACAACG 3′
TRAV17 5′ GGAGAAGAGGATCCTCAGG 3′ 5′ CCACCATGAACTGCAGTTAC 3′
TRAV18 5′ TCCAGTATCTAAACAAAGAGCC 3′ 5′ TGACAGTTCCTTCCACCTG 3′
TRAV19 5′ AGGTAACTCAAGCGCAGAC 3′ 5′ TGTGACCTTGGACTGTGTG 3′
TRAV20 5′ CACAGTCAGCGGTTTAAGAG 3′ 5′ TCTGGTATAGGCAAGATCCTG 3′
TRAV21 5′ TTCCTGCAGCTCTGAGTG 3′ 5′ AACTTGGTTCTCAACTGCAG 3′
TRAV22 5′ GTCCTCCAGACCTGATTCTC 3′ 5′ CTGACTCTGTGAACAATTTGC 3′
TRAV23 5′ TGCTTATGAGAACACTGCG 3′ 5′ TGCATTATTGATAGCCATACG 3′
TRAV24 5′ CTCAGTCACTGCATGTTCAG 3′ 5′ TGCCTTACACTGGTACAGATG 3′
TRAV25 5′ GGACTTCACCACGTACTGC 3′ 5′ TATAAGCAAAGGCCTGGTG 3′

(continued)
 Single-Cell Analysis of Human αβT Cell Repertoire 185

Table 1
(continued)

TRA gene(s)
targeted by
primer External primer sequence (EXT) Internal primer sequence (INT)
TRAV26-1 5′ GCAAACCTGCCTTGTAATC 3′ 5′ CGACAGATTCACTCCCAG 3′
TRAV26-2 5′ AGCCAAATTCAATGGAGAG 3′ 5′ TTCACTTGCCTTGTAACCAC 3′
TRAV27 5′ TCAGTTTCTAAGCATCCAAGAG 3′ 5′ CTCACTGTGTACTGCAACTCC 3′
TRAV29 5′ GCAAGTTAAGCAAAATTCACC 3′ 5′ CTGCTGAAGGTCCTACATTC 3′
TRAV30 5′ CAACAACCAGTGCAGAGTC 3′ 5′ AGAAGCATGGTGAAGCAC 3′
TRAV34 5′ AGAACTGGAGCAGAGTCCTC 3′ 5′ ATCTCACCATAAACTGCACG 3′
TRAV35 5′ GGTCAACAGCTGAATCAGAG 3′ 5′ ACCTGGCTATGGTACAAGC 3′
TRAV36 5′ GAAGACAAGGTGGTACAAAGC 3′ 5′ ATCTCTGGTTGTCCACGAG 3′
TRAV38-1, 5′ GCACATATGACACCAGTGAG 3′ 5′ CAGCAGGCAGATGATTCTC 3′
38-2
TRAV39 5′ CTGTTCCTGAGCATGCAG 3′ 5′ TCAACCACTTCAGACAGACTG 3′
TRAV40 5′ GCATCTGTGACTATGAACTGC 3′ 5′ GGAGGCGGAAATATTAAAGAC 3′
TRAV41 5′ AATGAAGTGGAGCAGAGTCC 3′ 5′ TTGTTTATGCTGAGCTCAGG 3′
TRAC 5′ GACCAGCTTGACATCACAG 3′ 5′ TGTTGCTCTTGAAGTCCATAG 3′

TRB gene(s)
targeted by
primer External primer sequence (EXT) Internal primer sequence (INT)
TRBV2 5′ TCGATGATCAATTCTCAGTTG 3′ 5′ TTCACTCTGAAGATCCGGTC 3′
TRBV3-1 5′ CAAAATACCTGGTCACACAG 3′ 5′ AATCTTCACATCAATTCCCTG 3′
TRBV4-1, 5′ TCGCTTCTCACCTGAATG 3′ 5′ CCTGCAGCCAGAAGACTC 3′
4-2, 4-3
TRBV5-1, 5′ GATTCTCAGGKCKCCAGTTC 3′ 5′ CTTGGAGCTGGRSGACTC 3′
5-3, 5-4
TRBV5-5, 5′ GTACCAACAGGYCCTGGGT 3′ 5′ TCTGAGCTGAATGTGAACG 3′
5-6, 5-7,
5-8
TRBV6-1, 5′ ACTCAGACCCCAAAATTCC 3′ 5′ GTGTRCCCAGGATATGAACC 3′
6-2, 6-3,
6-5, 6-6,
6-7, 6-8,
6-9

(continued)
186 Pradyot Dash et al.

Table 1
(continued)

TRB gene(s)
targeted by
primer External primer sequence (EXT) Internal primer sequence (INT)
TRBV6-4 5′ ACTGGCAAAGGAGAAGTCC 3′ 5′ TGGTTATAGTGTCTCCAGAGC 3′
TRBV7-1, 5′ TRTGATCCAATTTCAGGTCA 3′ 5′ TCYACTCTGAMGWTCCAGCG 3′
7-2, 7-3
TRBV7-4, 5′ GSWTCTYTGCAGARAGGCC 3′ 5′ TGRMGATYCAGCGCACA 3′
7-6, 7-7,
7-8, 7-9
TRBV9 5′ GATCACAGCAACTGGACAG 3′ 5′ GTACCAACAGAGCCTGGAC 3′
TRBV10-1, 5′ TGTWCTGGTATCGACAAGACC 3′ 5′ TCCYCCTCACTCTGGAGTC 3′
10-2, 10-3
TRBV11-1, 5′ CGATTTTCTGCAGAGACGC 3′ 5′ GACTCCACTCTCAAGATCCA 3′
11-2, 11-3
TRBV12-3, 5′ ARGTGACAGARATGGGACAA 3′ 5′ CYACTCTGARGATCCAGCC 3′
12-4, 12-5
TRBV13 5′ AGCGATAAAGGAAGCATCC 3′ 5′ CATTCTGAACTGAACATGAGC 3′
TRBV14 5′ CCAACAATCGATTCTTAGCTG 3′ 5′ ATTCTACTCTGAAGGTGCAGC 3′
TRBV15 5′ AGTGACCCTGAGTTGTTCTC 3′ 5′ ATAACTTCCAATCCAGGAGG 3′
TRBV16 5′ GTCTTTGATGAAACAGGTATGC 3′ 5′ GAAAGATTTTCAGCTAAGTGCC 3′
TRBV17 5′ CAGACCCCCAGACACAAG 3′ 5′ TGTTCACTGGTACCGACAG 3′
TRBV18 5′ CATAGATGAGTCAGGAATGCC 3′ 5′ CGATTTTCTGCTGAATTTCC 3′
TRBV19 5′ AGTTGTGAACAGAATTTGAACC 3′ 5′ TTCCTCTCACTGTGACATCG 3′
TRBV20-1 5′ AAGTTTCTCATCAACCATGC 3′ 5′ACTCTGACAGTGACCAGTGC 3′
TRBV23-1 5′ GCGATTCTCATCTCAATGC 3′ 5′ GCAATCCTGTCCTCAGAAC 3′
TRBV24-1 5′ CCTACGGTTGATCTATTACTCC 3′ 5′ GATGGATACAGTGTCTCTCGA 3′
TRBV25-1 5′ ACTACACCTCATCCACTATTCC 3′ 5′ CAGAGAAGGGAGATCTTTCC 3′
TRBV27, 28 5′ TGGTATCGACAAGACCCAG 3′ 5′ TTCYCCCTGATYCTGGAGTC 3′
TRBV29-1 5′ TTCTGGTACCGTCAGCAAC 3′ 5′ TCTGACTGTGAGCAACATGAG 3′
TRBV30 5′ TCCAGCTGCTCTTCTACTCC 3′ 5′ AGAATCTCTCAGCCTCCAGAC 3′
TRBC 5′ TAGAACTGGACTTGACAGCG 3′ 5′ TTCTGATGGCTCAAACACAG 3′
Primers targeting TRAV and TRBV genes are sense. Primers targeting TRAC and TRBC genes are antisense. TRAV
T-cell receptor Vα, TRAC T-cell receptor Cα, TRBV T-cell receptor Vβ, TRBC T-cell receptor Cβ
 Single-Cell Analysis of Human αβT Cell Repertoire 187

Working dilution: TRAV-EXT (cocktail of external TCRα

primers): Mix 25 μl of each TRAV-EXT forward primers (40 of
them, 200 μM stock) and make up the volume to 1000 μl with
1× TE buffer (low EDTA; 10 mM Tris–HCl, 0.1 mM EDTA,
pH 8.0) to achieve a working stock of 5 pmol/μl for each
primer in the cocktail.
TRBV-EXT (cocktail of external TCRβ primers): Mix
25 μl of each TRBV-EXT forward primers (27 of them,
200 μM stock) and make up the volume as above to 1000 μl
of diluted primer cocktail with each primer at 5 pmol/μl
working concentration.
TRAV-INT (cocktail of internal TCRα primers): Mix 25 μl
of each TRAV-INT forward primer (40 of them, 200 μM stock)
and make up the volume as above to 1000 μl of diluted primer
cocktail with each primer at 5 pmol/μl working concentration.
TRBV-INT (cocktail of internal TCRβ primers): Mix
25 μl of each TRBV-INT forward primers (27 of them,
200 μM stock) and make up the volume as above to 1000 μl
of diluted primer cocktail with each primer at 5 pmol/μl work-
ing concentration.
Resuspend all four reverse primers (TRAC-EXT, TRAC-
INT, TRBC-EXT, TRBC-INT) to 20 μM working stocks
(see Note 2).
7. Thermocyclers with heated lid.
8. Agarose gel electrophoresis instrument: e.g., Owl™ A3-1
Large-Gel Electrophoresis System with 50-well microwell
combs. The microwell-format combs provide rapid sample
loading with a multichannel pipette. Up to six 96-well plates
worth of samples can be analyzed at the same time.
9. 1× TAE buffer: 0.04 M Tris-acetate with 0.001 M EDTA.
10. GelRed nucleic acid stain, 10,000× (Biotium).
11. Imager: e.g., Bio-Rad Geldoc system.

2.3 Sequencing 1. PCR product purification: Exonuclease I (USB), Shrimp

and Analysis Alkaline Phosphatase (SAP, 7 USB), Tris–Cl, 50 mM, pH 8.0.
2. Big Dye® Terminator (v3.1) kit (Life technologies) and
3730XL DNA Analyzers (Applied Biosystems).
3. Software: Chromas chromatogram viewer (Technelysium) and
MegAlign DNA sequence alignment and analysis program
(DNASTAR Laser gene).
4. Macro-enabled, customized Microsoft Excel analysis sheet.
5. St. Jude TCR web application: https://tcr.stjude.org/tcr/.
Access to the application can be acquired through correspon-
dence with the authors.
188 Pradyot Dash et al.

3 Methods

3.1 Immunofluo- The following subsection provides an example of immunofluores-

rescence Staining cence staining for the identification and sorting of HLA A*0201-
restricted CMV-NLV CD8+ T cells. For the identification of other
cell populations, use other established procedures accordingly.
1. After isolating fresh PBMC or after thawing and washing
cryopreserved PBMC according to established procedures,
resuspend the isolated PBMC in 1 ml of D-PBS-Ca++Mg++
with no extraneous proteins.
2. Stain cells with LIVE/DEAD Fixable Aqua Dead Cell Stain
for 30 min at room temperature in the dark.
3. At the end of the incubation, wash two times with sort buffer
by centrifuging at 350 × g and +4 °C for 5 min.
4. Resuspend the cells in 200 μl sort buffer containing APC-
conjugated, peptide-loaded pMHCI tetramer, FITC-conjugated
anti-human CD3, PE-Cy7-conjugated anti-human CD8, and
PE-conjugated anti-human CD14 in appropriate dilutions.
Incubate the cells at room temperature in the dark for 30 min.
5. Wash the cells twice in sort buffer.

3.2 Single-Cell 1. Resuspend the cells in 0.5 ml of sort buffer containing RNase
Sorting inhibitor at a concentration of 200 U/ml (see Note 3).
2. Filter the cell suspension through a 40 μm cell strainer.
3. (This step describes the gating strategy for the sorting of tet-
ramer + CD8+ cells. Substitute appropriate gating strategies
for other cell populations accordingly.) Gate the lymphocytes
first on their scatter properties based on an FSC-A/SSC-A
plot. From the probable lymphocyte population, select the
live cells based on Live/Dead staining and CD14 negativity.
Then gate on CD3+CD8+ cells to enrich the tetramer+ cells
for sorting.
4. Set the parameter on MoFlo to “single cell 1” with a drop
envelope of 1 (or corresponding parameter on other cell sort-
ers) to ensure stringency for single-cell only sorting. Additional
crosschecks for single-cell deposition accuracy should be car-
ried out by the users by visualization under light microscopy
of single cells in 96-well culture plates and by confirmation
of clonality in single-cell sorted hybridomas from mixed
cultures.
5. Sort the cells of interest into each well in Columns 1–10 of a
96-well polypropylene PCR plate (Eppendorf). Leave
Columns 11 and 12 empty. Column 12 will be the negative
(no template) control. Following the sort, seal the plate with
adhesive plate seal. Make sure that the edges of the adhesive
 Single-Cell Analysis of Human αβT Cell Repertoire 189

seal are pressed thoroughly using an applicator or similar blunt

end object (e.g., round edge of a marker pen) to ensure a
proper seal. Place the plate on ice. After the sort is completed,
spin the plates briefly to settle the contents to the bottom of
the wells and store at −80 °C until ready to perform reverse
transcription and PCR.

3.3 Reverse The reverse transcription of the TCRα and β mRNA is carried out
Transcription (RT) directly on the lysed cells in the 96-well plate without any RNA
extraction step. Lysis is achieved by the combination of freeze-
thaw cycle and inclusion of a detergent, Triton X-100, in the RT
mixture.
1. Remove the plate from −80 °C and thaw on ice.
2. Centrifuge the plate at 500 × g for 2 min and keep on ice.
3. Prepare master mix for RT. We have reduced the final volume
of RT mix to one-eighth of the manufacturer’s recommenda-
tion (from 20 to 2.5 μl) for single-cell reactions with a modi-
fication where we add Triton-X 100 to a final concentration of
0.1 % (see Note 4).

1 plate (88 ± 22 = 110

Per well (μl) reactions) (μl)
5× RT Buffer 0.5 55
iScript RT enzyme 0.125 13.25
Water, Nuclease free 1.6 178.75
Triton-X100 (1 %) 0.25 27.5

4. Keep 8-channel (0.5–10 μl) pipette, barrier tips (10 μl),

reagent reservoir, adhesive plate seal, and its applicator ready.
Take the plate containing single cells from ice, hold down
firmly, and remove the adhesive seal carefully. Add 2.5 μl of RT
master mix to each well using a multichannel pipette, chang-
ing tips for each column. Work quickly to avoid evaporation.
Add to Columns 1–10 (samples) and 12 (negative control).
5. Seal the plate with a new adhesive plate film thoroughly and
centrifuge at 500 × g for 2 min.
6. Run cDNA synthesis program on a thermocycler as follows:
5 min at 25 °C; 45 min at 42 °C; 5 min at 85 °C; hold at 4 °C.
7. Store the plate at −20 °C if you would like to proceed to the
next step later.

3.4 Nested PCR Carry out a nested PCR protocol as described below for amplifying
the TCRα and β chain from single cells. A schematic for the PCR
is shown in Fig. 1.
190 Pradyot Dash et al.

Fig. 1 Overview of single-cell multiplex clonotypic analysis of epitope-specific T cells. Single epitope-specific
CD8+ T cells are sorted on a flow cytometric cell sorter into 96-well PCR plates. RT-PCR is performed on the
individual cells. The resultant cDNA is subjected to two rounds of nested PCR. In the first round, CDR3α and
CDR3β transcript amplification is achieved with the use of a multiplexed, comprehensive panel of external
sense Vα and Vβ and antisense Cα and Cβ segment-specific primers. First-round PCR products are subjected
to two separate second-round PCRs, incorporating, respectively, a multiplexed panel of external sense Vα and
antisense Cα or external sense Vβ and antisense Cβ segment-specific primers. PCR products thus derived are
sequenced and translated to yield paired CDR3αβ repertoire data. Inset: Nucleotide products from nested PCR
performed on cDNA derived from single CMV-NLV-specific CD8+ T cells from a young adult donor, incorporat-
ing TCRα- (top two rows) and TCRβ-specific primers (bottom two rows). Reproduced with permission from
Wang et al., 2012 [12]
 Single-Cell Analysis of Human αβT Cell Repertoire 191

1. First-round PCR: Prepare a reaction master fix as follows

(see Note 4):

1 plate (88 ± 12 = 100

Per well (μl) reactions) (μl)
Nuclease-free water 17.35 1735
PCR buffer, 10× 2.5 250
(Containing 15 mM MgCl2)
dNTP, 10 mM 0.5 50
TRAC-EXT (20 μM) 0.5 50
TRAV-EXT 0.5 50
(Cocktail of α primers)
TRBC-EXT (20 μM) 0.5 50
TRBV-EXT 0.5 50
(Cocktail of β primers)
Taq DNA Polymerase 0.15 15
Total 22.5 2250

2. Remove the plate seal carefully and add 22.5 μl of master mix
to all samples and control wells using a 12-channel pipette
(5–50 μl) (see Note 5).
3. Reseal the plate thoroughly with a new adhesive plate seal,
ensuring the edges are sealed tightly, and centrifuge the plate
to settle the contents to the bottom of wells.
4. Perform PCR in a thermocycler as follows:
Initial denaturation, 5 min at 95 °C; denaturation, 20 s at
95 °C; primer annealing, 2 0 s at 52 °C; polymerase exten-
sion, 45 s at 72 °C; repeat denaturation to extension step 34
times; final extension, 7 min at 72 °C; and hold at +4 °C. The
plates can be stored at −20 °C until the next step.
5. Second-round PCR: At this point, you will set up TCRα and
TCRβ PCRs separately. Thus, identical wells of α and β plates
will be derived from single cells. For example, well position A1
of the α plate will pair with A1 of the β plate. Prepare two reac-
tion master mixes (α and β) as follows (see Note 4):

1 plate (88 ± 12 = 100

Per well (μl) reactions) (μl)
Nuclease-free water 18.35 1835
CoralLoad PCR buffer, 10X 2.5 250
(continued)
192 Pradyot Dash et al.

1 plate (88 ± 12 = 100

Per well (μl) reactions) (μl)
(Containing 15 mM MgCl2)
dNTP, 10 mM 0 .5 50
TRAC-INT (20 μM) OR 0.5 50
TRBC-INT (20 μM)
TRAV-INT OR TRBV-INT 0.5 50
(Cocktail of TCRα or β primers)
Taq DNA Polymerase 0.15 15
Total 22.5 2250

6. Add 22.5 μl of the respective master mix to each well of new

plates labeled α and β in the hood or similar dedicated space
for PCR work.
7. Add 2.5 μl of the product from the first-round PCR plate to
each well of both α and β plates containing their respective
master mix (see Note 5).
8. Seal the plates thoroughly with adhesive plate seals, ensuring
the edges are sealed tightly, and centrifuge the plates briefly to
settle the contents to the bottom of wells.
9. Perform PCR in a thermocycler as described above (step 4). The
plates can be stored at 4 °C (short term) or −20 °C (long term)
until analysis of the samples by agarose gel electrophoresis.

3.5 Agarose Gel 1. Cast a 2 % agarose gel in 1× TAE buffer using the tray and
Electrophoresis combs described in Subheading 2.2.
2. Using an 8-channel micropipette (0.5–10 μl), load the gel
wells with 5 μl of PCR products. The CoralLoad buffer con-
tains gel-loading dye, thus allowing direct loading of the PCR
reactions into the wells of the agarose gel.
3. Perform electrophoresis at 175 V for 40 min to separate the
PCR products.
4. At the end of the electrophoresis, visualize and record the
image of the agarose gel using a Bio-Rad or similar gel docu-
mentation system.
5. Count the number of bands and verify the negative controls
(see Note 6).

3.6 Sequencing Following a successful PCR reaction, the PCR products can be puri-
fied and sequenced by standard procedures. For example, the PCR
products can be purified using a silica-based column purification
system (Wizard SV96 PCR purification kit, Promega) as described
[11, 12]. Recently, we have adopted an Exonuclease I and Shrimp
 Single-Cell Analysis of Human αβT Cell Repertoire 193

Alkaline Phosphatase (SAP) based enzymatic purification method as

a low cost option, which is described below.
1. Prepare a master mix for the purification of the PCR products
as follows.

1 plate
Per reaction (μl) (100 reactions) (μl)
Shrimp alkaline 0.2 20
phosphatase (SAP, USB)
Exonuclease I (ExoI) (USB) 0.2 20
Tris–HCl, 50 mM, pH 8 4.6 460
Total 5 500

2. Distribute 5 μl of the Exo/SAP master mix to a 96-well PCR

plate.
3. Using a multichannel pipette (0.5–10 μl), add 1 μl of the PCR
product from the second-round PCR plate.
4. Seal the plate with adhesive plate seal, centrifuge, and incubate
at 37 °C for 15 min followed by 80 °C for 15 min.
5. Chill the plate on ice. Prepare the primer master mix for the
sequencing reaction as described in the following table.

Per plate
Primer mix Per reaction (μl) (100 reactions) (μl)
TRAC INT REV (20 μM) 0.25 25
OR TRBC INT REV
(20 μM)
Water, Nuclease free 5.75 575
Total 6 600

6. Remove the plate seal carefully and add 6 μl of appropriate

primer mix to the α and β plates (see Note 7).
7. The purified PCR product and primer mix is then sequenced
using Big Dye® Terminator (v3.1) Chemistry on a 3730XL
DNA Analyzers (Applied Biosystems). Sequence data are con-
firmed by inspection of chromatograms using a trace viewer
such as Chromas (Technelysium).

3.7 Sequence Data We analyze the sequence data using a custom-made Microsoft Excel
Analysis analysis spreadsheet that utilizes macros obtained from http://
www.bioc.uzh.ch/antibody and ref. 14 and a TCR web application
https://tcr.stjude.org/tcr/ [11] that queries the international
ImMunoGeneTics information system (IMGT) database [15].
194 Pradyot Dash et al.

The output returns the CDR3α and CDR3β nucleotide and amino
acid sequence information and their frequencies, paired expression
profile, TRAV, TRAJ, TRBV, TRBJ, and TRBD usage data in the
same Excel spreadsheet, thus allowing further downstream calcula-
tions and statistics. The Excel spreadsheet consists of three work-
sheets for CDR3α and three worksheets for CDR3β analysis. The
data are summarized in the data summary worksheet. The next two
worksheets integrate the TRAV, TRAJ, TRBV, TRBJ, and TRBD
assignments derived from the TCR web application, https://tcr.
stjude.org/tcr/. The next two worksheets consist of pivot tables
that summarize the pairing data for CDR3, TRAV-TRAJ and
TRBV-TRBJ. A template for the customized, macro-enabled Excel
analysis spreadsheet is available from the authors upon request.
1. Download the sequence data in .ab1 and .seq format.
2. Using MegAlign software (DNASTAR Lasergene), import the
.ab1 files.
3. Copy the alignment report and paste into Cell A1 of the
“DNA seqs-Valpha” worksheet of the Excel spreadsheet.
4. Select Cells B5–B85 and run the reverse complement macro
(“revcomp.revcomp”). Over the next seven columns (C–H),
the nucleotide sequences (64 nt) are then pruned to extract
the CDR3 region (V end-CDR3-J-C beginning) and summa-
rized in Columns K, L, and M of the worksheet.
5. In the “Parsed-Valpha” worksheet, the extracted nucleotide
sequences are converted into amino acid sequences. Select
Cells A4–A83 and run the “AA_Parse_3Letter” macro. The
64 nucleotides of the CDR3 region are then parsed into three
letter blocks in Columns B4–V4.
6. Select Cells B4–V83 and run the “AA_Convert_NtoAA”
macro to derive the amino acid sequences.
7. In the “AA seqs-Valpha” worksheet, the amino acid sequence
data of the CDR3 region are further processed to extract the
exact CDR3 sequences, and their frequencies are calculated.
8. The exact same steps are followed for the analysis of the TCRβ
sequences to extract CDR3β data in the next three
worksheets.
9. The data are then summarized to derive paired CDR3αβ
expression in the “Data Summary” worksheet.
10. To assign the TRAV-TRAJ and TRBV-TRBD-TRBJ nomen-
clature, a compressed file of the .seq files is uploaded to the
https://tcr.stjude.org/tcr/ web application written in PHP 5
and MySQL 5 [11]. This interface allows users to upload indi-
vidual FASTA files or zipped archives of multiple FASTA files
and queries them against the IMGT online database using PHP
cUrl. The resulting output containing receptor family names,
 Single-Cell Analysis of Human αβT Cell Repertoire 195

an amino acid translation of the receptor, and nucleotide

sequence of the translation can be downloaded in .csv format.
11. The TRAV-TRAJ and TRBV-TRBD-TRBJ data can then be
copied into the analyzed Excel spreadsheet (in the “Data
Summary” worksheet) and are then summarized in subse-
quent worksheets.

4 Notes

1. IMGT nomenclature of TCRα and β variable, junctional, and

diversity family notation is used throughout the text.
2. Recently, we preferred diluting primers in TE buffer instead of
water to increase the stability of the primers in storage. The
final concentration of EDTA in the diluted primer cocktail in
the PCR mix is well below the inhibitory level.
3. Single-cell sorting can be done by two methods: (a) by directly
sorting into empty PCR plate so each well contains cell with
approximately 1/1000th of a μl of sort buffer. (b) The PCR
plates can be preloaded with 2.5 μl of reverse transcription mix
before sorting single cells into each well. The former method
is cost effective in comparison to the preloading method as
multiple plates can be sorted and stored as backup from same
sample without the need to use expensive reverse transcription
reagents. However, the latter method of preloading the PCR
plate with reverse transcription mix gives approximately 5 %
more bands in single-cell PCR. If the preloading method is
used, there is no need of using RNAsin in sort buffer prior to
sorting as the Reverse transcription kit usually contains RNAse
inhibitor as a component.
4. Because of the small volume used per well for RT and PCR, an
additional 22 or 12 reactions, respectively, are taken to account
for pipetting error and evaporation.
5. To avoid contamination, the master mix should be prepared in
a dedicated space with dedicated pipettes for PCR. Barrier tips
should be used for all pipetting. The master mix should be
added to the cDNA plate away from the PCR station on a
bench.
6. In a multiplex PCR, it is critical to prevent aerosol contamina-
tion. In our protocol, we have eight negative control wells
(Column 12) separated by an empty column (Column 11)
from the samples (Column 1–10). In the event that a band
(even a weak 1) appears in the gel products from the control
wells, we remake the primer stock, replace the working PCR
reagents, and decontaminate the PCR workstation and pipettes
with DNA Zap (Life Technologies). It also helps to prevent
196 Pradyot Dash et al.

contamination by separating the PCR setup area (RT and

PCR) from the post-PCR processing (gel electrophoresis and
sequencing reactions) and routinely cleaning all work and
storage areas with DNA Zap.
7. The sequencing reaction will have a red tinge from the
CoralLoad PCR buffer of the nested PCR reaction. This
should not be a problem for sequencing, as the dye will be
removed following post-sequencing reaction cleanup.

Acknowledgments

This work was supported by NIH—National Institute of Allergy

and Infectious Diseases grants AI077714 and AI107625, the
American Syrian Lebanese Associated Charities, NIH—National
Institute on Aging grant AG033113, Atlantic Philanthropies,
American Geriatrics Society, the John A. Hartford Foundation,
and the Association of Subspecialty Professors.

References
1. Jorgensen JL, Esser U, de St F, Groth B, Reay Kieff E, Sculley TB, Misko IS (1994) Dominant
PA, Davis MM (1992) Mapping T-cell selection of an invariant T cell antigen receptor
receptor-peptide contacts by variant peptide in response to persistent infection by Epstein-
immunization of single-chain transgenics. Barr virus. J Exp Med 180:2335–2340
Nature 355:224–230 8. Price DA, Brenchley JM, Ruff LE, Betts MR,
2. Davis MM, Bjorkman PJ (1988) T-cell antigen Hill BJ, Roederer M, Koup RA, Migueles SA,
receptor genes and T-cell recognition. Nature Gostick E, Wooldridge L, Sewell AK, Connors
334:395–402 M, Douek DC (2005) Avidity for antigen
3. Blackwell TK, Alt FW (1989) Molecular char- shapes clonal dominance in CD8+ T cell popu-
acterization of the lymphoid V(D)J recombina- lations specific for persistent DNA viruses.
tion activity. J Biol Chem 264:10327–10330 J Exp Med 202:1349–1361
4. Valmori D, Dutoit V, Lienard D, Lejeune F, 9. Wang C, Sanders CM, Yang Q, Schroeder HW
Speiser D, Rimoldi D, Cerundolo V, Dietrich Jr, Wang E, Babrzadeh F, Gharizadeh B, Myers
PY, Cerottini JC, Romero P (2000) Tetramer- RM, Hudson JR Jr, Davis RW, Han J (2010)
guided analysis of TCR beta-chain usage High throughput sequencing reveals a com-
reveals a large repertoire of melan-A-specific plex pattern of dynamic interrelationships
CD8+ T cells in melanoma patients. J Immunol among human T cell subsets. Proc Natl Acad
165:533–538 Sci U S A 107:1518–1523
5. Pannetier C, Even J, Kourilsky P (1995) T-cell 10. Sherwood AM, Desmarais C, Livingston RJ,
repertoire diversity and clonal expansions in Andriesen J, Haussler M, Carlson CS, Robins
normal and clinical samples. Immunol Today H (2011) Deep sequencing of the human
16:176–181 TCRγ and TCRβ repertoires suggests that
6. Trautmann L, Rimbert M, Echasserieau K, TCRβ rearranges after αβ and γδ T Cell com-
Saulquin X, Neveu B, Dechanet J, Cerundolo mitment. Sci Transl Med 3:90ra61
V, Bonneville M (2005) Selection of T cell 11. Dash P, McClaren JL, Oguin TH III, Rothwell
clones expressing high-affinity public TCRs W, Todd B, Morris MY, Becksfort J, Reynolds
within Human cytomegalovirus-specific CD8 C, Brown SA, Doherty PC, Thomas PG
T cell responses. J Immunol 175:6123–6132 (2011) Paired analysis of TCRα and TCRβ
7. Argaet VP, Schmidt CW, Burrows SR, Silins SL, chains at the single-cell level in mice. J Clin
Kurilla MG, Doolan DL, Suhrbier A, Moss DJ, Invest 121:288–295
 Single-Cell Analysis of Human αβT Cell Repertoire 197

12. Wang GC, Dash P, McCullers JA, Doherty 14. Ewert S, Huber T, Honegger A, Pluckthun A
PC, Thomas PG (2012) T cell receptor αβ (2003) Biophysical properties of human anti-
diversity inversely correlates with pathogen- body variable domains. J Mol Biol 325:
specific antibody levels in human cytomegalo- 531–553
virus infection. Sci Transl Med 4:128ra42 15. Lefranc MP, Giudicelli V, Ginestoux C,
13. Sun X, Saito M, Sato Y, Chikata T, Naruto T, Jabado-Michaloud J, Folch G, Bellahcene F,
Ozawa T, Kobayashi E, Kishi H, Muraguchi A, Wu Y, Gemrot E, Brochet X, Lane J, Regnier
Takiguchi M (2012) Unbiased analysis of L, Ehrenmann F, Lefranc G, Duroux P (2009)
TCRα/β chains at the single-cell level in IMGT, the international ImMunoGeneTics
human CD8+ T-cell subsets. PLoS One information system. Nucleic Acids Res
7:e40386 37:D1006–D1012
 Chapter 16

Assessment of B Cell Repertoire in Humans

Yu-Chang Wu, David Kipling, and Deborah Dunn-Walters

Abstract
The B cell receptor (BCR) repertoire is highly diverse. Repertoire diversity is achieved centrally by somatic
recombination of immunoglobulin (Ig) genes and peripherally by somatic hypermutation and Ig heavy
chain class-switching. Throughout these processes, there is selection for functional gene rearrangements,
selection against gene combinations resulting in self-reactive BCRs, and selection for BCRs with high affin-
ity for exogenous antigens after challenge. Hence, investigation of BCR repertoires from different groups
of B cells can provide information on stages of B cell development and shed light on the etiology of B cell
pathologies. In most instances, the third complementarity determining region of the Ig heavy chain (CDR-
H3) contributes the majority of amino acids to the antibody/antigen binding interface. Although CDR-
H3 spectratype analysis provides information on the overall diversity of BCR repertoires, this fairly simple
technique analyzes the relative quantities of CDR-H3 regions of each size, within a range of approximately
10–80 bp, without sequence detail and thus is limited in scope. High-throughput sequencing (HTS) tech-
niques on the Roche 454 GS FLX Titanium system, however, can generate a wide coverage of Ig sequences
to provide more qualitative data such as V, D, and J usage as well as detailed CDR3 sequence information.
Here we present protocols in detail for CDR-H3 spectratype analysis and HTS of human BCR
repertoires.

Key words B cell, B cell receptor, Immunoglobulin, Antibody, Repertoire, High-throughput

sequencing, Next generation sequencing, Spectratyping

1 Introduction

There are a number of processes that contribute to B cell diversity.

B cell receptors (BCR), or immunoglobulins (Ig), are comprised of
heavy and light chain proteins encoded by genes that undergo
rearrangement during B cell development in the bone marrow.
Rearrangement of Ig heavy chain genes (IGH), in which variable
(IGHV), diversity (IGHD), and joining (IGHJ) genes are ran-
domly selected and joined together occurs first [1]. During the
process of somatic recombination in the IGH, further BCR
diversity is introduced by imprecise insertion and deletion of
nucleotides at the junctions of the rearranged genes, resulting in

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_16, © Springer Science+Business Media New York 2015

199
200 Yu-Chang Wu et al.

the third complementarity determining (CDR-H3) region. The

CDR-H3 serves as a genetic fingerprint for an individual B cell
clone throughout its development. There is further random assort-
ment of pairing between the IGH and the light chain genes. Light
chain proteins consist of either kappa or lambda isotypes; kappa
(IGK) or lambda (IGL) genes are formed as a result of rearrange-
ment of variable and joining region genes (either IGKV to IGKJ or
IGLV to IGLJ).
The diverse repertoire created by these mechanisms can then
be shaped by events external to the cell. Negative selection to
remove cells with self-reactive BCRs occurs, and positive selection
to expand cells reactive to exogenous pathogen challenge also
occurs. Upon activation by exogenous antigens in the periphery,
the B cell repertoire is further diversified by processes of somatic
hypermutation (SHM), heavy chain class switch recombination
(CSR), and affinity maturation of the rearranged Ig genes. Due to
the constant selection pressures on the B cell repertoire, the quality
and diversity of IGH, IGK, and IGL repertoires may reflect B cell
development [2–4], the history of antigen challenge [5, 6], the
ageing process [7, 8], and many pathological conditions [9, 10].
The complexity and diversity of the BCR repertoire has previ-
ously made it difficult to analyze in great detail. Initially, a poly-
merase chain reaction (PCR)-based method that amplifies the Ig
gene fragment across the CDR-H3 region, termed CDR-H3 spec-
tratype analysis, made it possible to examine global changes of
BCR repertoires with ageing [9] and in response to vaccination
[6]. CDR-H3 spectratyping has also been a useful tool to detect
expansion of a particular clone such as might be seen in lympho-
mas. However, spectratyping is limited to the measurement of
CDR-H3 size and cannot provide additional information on BCR
repertoires, e.g., the usage of different Ig genes, the extent of
hypermutation, and the exact sequence of CDR-H3. Although the
traditional Sanger sequencing technique can overcome the limita-
tions of CDR-H3 spectratyping with respect to providing detailed
sequence information, it does not have the advantage that spectra-
typing has, of being able to easily evaluate sufficient numbers of Ig
sequences with coverage that could reflect the diversity of the BCR
repertoire in humans. With advances in next generation sequenc-
ing (NGS) technologies, several platforms have been developed
that yield large numbers of reads that Sanger sequencing tech-
niques cannot deliver [11]. Currently, there are two main competi-
tors in NGS technologies: Illumina and Roche 454 platforms. As
compared with the Illumina MiSeq platform with a capacity of
15 × 106 reads per run and a maximum read length of 250 bp, the
upgraded Roche 454 GS FLX+ system is able to produce long-read
sequences up to 1000 bp—albeit with a smaller coverage of 1 × 106
reads per run. Since the length of an Ig gene from the beginning
 Assessment of Human B Cell Repertoire 201

of the Ig gene, through the CDR-H3 region, to the constant

region is 400–500 bp, this longer read length makes the 454 GS
FLX+ system ideal for high-throughput sequencing (HTS) of
human Ig genes. By incorporating Multiplex Identifier (MID)-
containing adaptors into 454 NGS technology, several BCR reper-
toire libraries can be multiplexed in order to reduce cost [12].
We have previously used CDR-H3 spectratype analysis in con-
junction with HTS techniques on the 454 GS FLX Titanium sys-
tem to demonstrate temporal and age-related changes in human
peripheral blood IGH repertoires in response to vaccination [6, 7].
We have also shown that IGH repertoires in different B cell subsets
can be distinguished from one another by HTS techniques [13,
14]. Here we describe detailed protocols for CDR-H3 spectratyp-
ing on the ABI 3730xl DNA Analyzer system and HTS from IGH
and IGK or IGL repertoires on the 454 GS FLX Titanium system
using human cDNA.

2 Materials

Analyses of gene families by methods that use PCR are particularly

at risk for cross contamination, especially for low abundance tar-
gets such as in single cell analyses. UV isolation cabinets should be
used and different steps in the protocol should be carried out in
different areas of the lab, or in different rooms, wherever possible.
A DNA/RNA-free UV isolation hood with dedicated pipettes
should be reserved for preparation of Sort-Lysis Reverse
Transcription (SLyRT) buffers and PCR mixes. Areas where PCR
products are analyzed by electrophoresis should be as far away
from sample preparation areas as possible. PCR-grade water should
be used throughout for all sample preparation.

2.1 Components Sort-Lysis Reverse Transcription (SLyRT) buffer and SuperScript

for Direct cDNA III Reverse Transcription (RT) enzyme allow direct cDNA synthe-
Synthesis from Cells sis from cells. The buffer lyses the cells, stabilizes the mRNA, and
bypasses mRNA purification steps, allowing synthesis of cDNA
from low cell numbers or single cells. This does, however, mean
that contaminants such as protein and genomic DNA are present
along with cDNA (see Note 1).
1. Polymerase chain reaction (PCR)-grade H2O.
2. Detergents Triton X-100: 5 % in PCR-grade H2O (see Note 2).
3. dNTP mix: 20 mM each of dATP, dTTP, dCTP, dGTP in
PCR-grade H2O (see Note 3).
4. Random hexamers pd(N)6: diluted to 50 ng/μl in PCR-grade
H2O (Qiagen, UK).
5. RiboSafe RNase inhibitor: 40 U/μl (Bioline, UK).
202 Yu-Chang Wu et al.

6. 0.1 M dithiothreitol (DTT).

7. 5× First-Strand RT buffer: 250 mM Tris–HCl (pH 8.3 at RT),
375 mM KCl, 15 mM MgCl2 (supplied with SuperScript III
RT enzyme; Invitrogen, UK).
8. 25 U/μl SuperScript III RT enzyme (Invitrogen, UK): diluted
from 200 U/μl with PCR-grade H2O.
9. 200 μl PCR tubes.
10. PCR thermal cycler.

2.2 Components PCR components listed below are used to generate products for
for Polymerase Chain CDR-H3 spectratyping and HTS, using appropriate primers as
Reaction indicated in different sections.
1. PCR-grade H2O.
2. dNTP mix: 20 mM each of dATP, dTTP, dCTP, dGTP in
PCR-grade H2O.
3. Phusion High-Fidelity polymerase (NEB, UK) diluted in
PCR-grade water.
4. 5× GC buffer (supplied with Phusion High-Fidelity poly-
merase; NEB, UK).
5. Complete primer mix: choose accordingly as indicated [6, 15].
6. cDNA (see Subheading 3.1).
7. 96-well PCR plates.
8. PCR thermal cyclers.
9. Thermal seals.

2.3 Components 1. Multiplex Identifier (MID)-tagged amplicons of human

for HTS of Human immunoglobulin genes (see Subheading 3.3).
Immuno 2. Agarose gels: Dissolve 1.5 g of agarose powder in 100 ml of
globulin Genes 1× TAE buffer in a microwave. Once the agarose solution is
cooled to 55 °C, add 10 μl of 10,000× GelStar Nucleic Acid
Gel Stain (final concentration = 1×; Lonza, UK) or 1 μl of
10 mg/ml ethidium bromide (EtBr; final concentra-
tion = 0.1 μg/ml), as indicated.
3. 1X Tris-Acetate-EDTA (TAE) running buffer: 40 mM Tris-
acetate and 1 mM EDTA at pH 8.3 in distilled water (see
Note 4).
4. Hyper Ladder IV Ladder (Bioline, UK).
5. Horizontal electrophoresis system (e.g., multiSUB-4
(Wolflabs, UK)).
6. 6× Orange G loading dye: 10 mM Tris–HCl (pH 7.6), 0.15 %
orange G, 60 % glycerol, 60 mM EDTA in distilled water
(see Note 5).
 Assessment of Human B Cell Repertoire 203

7. 15 ml Falcon tubes.
8. Disposable scalpels.
9. DarkReader 46B Transilluminator instrument (LabTech, UK).
10. QIAquick gel purification kit (Qiagen, UK).
11. Qubit 2.0 Fluorometer and Qubit dsDNA HS Assay Kits
(Invitrogen, UK).
12. QIAquick PCR purification kit (Qiagen, UK).

2.4 Components 1. PCR products of human immunoglobulin genes (see

for Spectratype Subheading 3.2).
Analysis of Human 2. Highly deionized (Hi-Di) formamide (AppliedBiosystems, UK).
Immunoglobulin
3. GeneScan 350 TAMRA Size Standard (AppliedBiosystems, UK).
CDR-H3
4. Non-skirted, 96-well PCR plate.
5. Applied Biosystems 3730xl DNA Analyzer system
(AppliedBiosystems, UK).
6. GeneMapper software (AppliedBiosystems, UK).

3 Methods

3.1 Direct cDNA 1. Assemble the components of SLyRT buffer as listed in Table 1.
Synthesis from Cells Keep SLyRT buffer on ice for immediate use or store at
−20 °C.
2. Aliquot 36 μl of the SLyRT buffer into PCR tubes.
3. Deposit 1000–10,000 B cells from the flow cytometry sorter
directly into PCR tubes containing 36 μl of SLyRT buffer.

Table 1
SLyRT buffer

Initial 1 reaction 50 reaction Final reaction

Reagents concentration volumes (μl) volumes (μl) concentrationa
First-Strand RT buffer 5× 8 400 1×
pd(N)6 50 ng/μl 12 600 15 ng/μl
Triton X 5% 1 50 0.13 % (v/v)
RiboSafe RNase inhibitor 40 U/μl 2.5 125 2.5 U/μl
DTT 0.1 M 4.5 225 11.25 mM
dNTP mix 10 mM each 2 100 500 μM
PCR-graded H2O NA 6 300 NA
a
The final reaction concentration indicates the concentration in a total reaction volume of 40 μl after cDNA, Superscript
III RT enzyme, and primers are added
204 Yu-Chang Wu et al.

Table 2
Reverse transcriptase reaction conditions

Steps Temperatures (°C) Time (min)

Denaturation 42 10
Annealing 25 10
RT (extension) 55 60
RT termination 72 15

4. Invert PCR tubes several times to ensure all cells are immersed
in SLyRT buffer. Briefly centrifuge the PCR tubes at 3000 rpm
in a microfuge for 2 min.
5. Add 4 μl of SuperScript III RT enzyme at 25 U/μl, final reac-
tion concentration 2.5 U/μl.
6. Carry out the RT reaction on the thermal cycler, programmed
as in Table 2.
7. Once the RT reaction is complete, centrifuge the PCR tubes at
13,000 rpm in a microfuge for 5 min. Immediately transfer
35 μl of the reaction mix to a clean PCR tube without dis-
turbing any cell debris at the bottom of the tube.
This step reduces cellular contaminants from being carried
forward to downstream applications.
8. Add 70 μl of PCR-grade H2O to 35 μl of the reaction mix and
pipette several times to mix (see Note 1).
9. Store samples at −20 °C.

3.2 Spectratype Spectratype analysis allows investigation of BCR repertoires by

Analysis of Human measuring relative quantities of different sizes of CDR-H3 regions.
Immunoglobulin It is relatively cheap and quick compared to HTS techniques. If
CDR-H3 Regions HTS is employed the information will be in the sequencing data
and spectratyping will not be necessary. This section includes
generation of PCR products, which span across human immuno-
globulin CDR-H3 regions and into the 5′-end of the constant
region (Fig. 1), and preparation of samples prior to fragment size
analysis on the Applied Biosystems 3730xl DNA Analyzer system.
1. Assemble reagents for PCR master mix and vortex to mix
thoroughly. Change the 3′-end primer for different isotypes of
the heavy chains. The concentration for each reagent is shown
in Table 3.
2. Aliquot the PCR master mix to a 96-well plate, 23 μl per well.
3. Add cDNA to the 96-well PCR1 plate, 2 μl per well (see Note 7;
see Subheading 3.1).
 Assessment of Human B Cell Repertoire 205

Fig. 1 Schematic presentation of immunoglobulin gene cDNA showing the primer

binding sites for CDR-H3 spectratyping

Table 3
Spectratype PCR reaction mix (25 μl per reaction)

Initial 1 reaction 110 reaction Final reaction

Reagents concentration volumes (μl) volumes (μl) concentrationa
GC buffer 5× 5 550 1×
1:20 Phusion polymerase 0.25 U/μl 2 220 0.02 U/μl
dNTP mix 20 mM each 0.5 55 400 μM each
5′-end FW3-FAM primer b
10 μM 1 110 400 nM
3′-end constant primerb 10 μM 1 110 400 nM
PCR-grade H2O NA 13.5 1485 NA
a
The final reaction concentration indicates the concentration after cDNA is added
b
See Note 6

Table 4
PCR thermal cycling conditions

Steps Temperature (°C) Time (s)

Initial denaturation 95 60
15 cycles Denaturation 95 45
Annealing 61 (IgA); 55 (IgG and IgM) 45
Extension 72 45
Final extension 72 600

4. Seal PCR plates with thermal seals and carry out PCR reaction
on the thermal cycler programmed as Table 4.
5. Briefly centrifuge the PCR plate to collect the content.
6. In a non-skirted PCR plate, add 3 μl of the PCR products to
1.5 μl GeneScan 350 TAMRA Size Standard and 13.5 μl
Hi-Di formamide per well. Pipette up and down a couple of
times to mix thoroughly (see Note 8).
206 Yu-Chang Wu et al.

7. Centrifuge the PCR plate to collect the content and ensure no

air bubbles are present.
8. Place the plate on the 3730xl DNA Analyzer system for spec-
tratyping (see Note 9).
9. Collect and analyze the data on the GeneMapper software
according to the manufacturer’s instructions (see Note 10).

3.3 HTS of Human HTS allows analysis of BCR repertoires in detail, including the dis-
Immuno tribution of CDR-H3 sizes. This section includes production of
globulin Genes immunoglobulin gene amplicons, gel purification of amplicons,
assembly of multiple amplicons (up to 12 MID barcodes per
sequencing sample), and enrichment of pooled amplicons.
Sequencing on the 454 GS FLX Titanium instrument is performed
by LGC Genomics, where each sequencing sample (containing 12
MIDS) is run on 1/16th of a chip. Take care to avoid cross contami-
nation between samples. Each research (cDNA) sample that is
required to be distinguishable from other research samples needs
to be amplified with its own MID tag. Within that MID tag it is
possible to combine three different isotypes of heavy chains, and
kappa and lambda light chains for that particular research sample,
since these can be distinguished later by their sequence (see Note 11).
1. To generate MID-tagged amplicons, perform semi-nested
PCR reactions (Fig. 2).
2. Assemble reagents for PCR1 master mix (Table 5), and vortex
to mix thoroughly. Change primer mix accordingly to pro-
duce different types of amplicons (different heavy chain classes
or kappa light chain or lambda light chains).
3. Aliquot the PCR1 master mix into a 96-well PCR1 plate,
22 μl per well.
4. Add 1:3 diluted cDNA (see Subheading 3.1) to the 96-well
PCR1 plate, 3 μl per well. Use one PCR plate for each type of
amplicon (i.e., either IgA, IgG, IgM, IgK, or IgL) and per-
form eight PCR1 reactions for each sample.
5. Seal PCR plates with thermal seals and carry out PCR1 reac-
tion on the thermal cycler programmed as in Table 6.

Fig. 2 Schematic representation of immunoglobulin gene cDNA and primer binding sites for HTS, semi-nested
PCR
 Assessment of Human B Cell Repertoire 207

Table 5
HTS PCR1 reaction mix (25 μl per reaction)

Initial 1 reaction 110 reaction Final reaction

Reagents concentration volume (μl) volumes (μl) concentrationa
GC buffer 5× 5 550 1×
1:40 Phusion polymerase 0.125 U/μl 5 550 0.025 U/μl
dNTP mix 20 mM each 0.25 27.5 200 μM each
b
Primer mix 1.25 125
5′-end variable primers 835 nM each 41.75 nM each
3′-end constant primer 5 μM 250 nM
PCR-grade H2O NA 10.5 1155 NA
a
The final reaction concentration indicates the concentration after cDNA and primers are added
b
See Note 12

Table 6
PCR1 thermal cycling conditions

Steps Temperature (°C) Time (s)

Initial denaturation 98 30
15 cycles Denaturation 98 10
Annealing 58 15
Extension 72 30
Final extension 72 600

6. Briefly centrifuge plates to collect the contents and store the

plate at −20 °C.
7. Assemble reagents for PCR2 master mix (110 reactions), and
vortex to mix thoroughly. Concentrations for each reagent are
shown in Table 7.
(a) Aliquot the PCR2 master mix to 96-well PCR plates, 17 μl
per well.
(b) Add MID-containing primer mix (see Note 13) to the
96-well PCR2 plate, 1 μl per well.
(c) Add 2 μl per well of PCR1 products accordingly to the
96-well PCR plate. For each PCR1 product, perform
duplicate of PCR2 reactions. This results in 16 wells of
final PCR product per amplicon type and research sample
to be purified for sequencing. This, together with the short
PCR amplification reactions, is designed such that larger
208 Yu-Chang Wu et al.

Table 7
HTS PCR2 reaction mix (20 μl per reaction)

Initial 1 reaction 110 reaction Final reaction

Reagents concentration volume (μl) volumes (μl) concentrationa
GC buffer 5× 4 440 1×
1:20 Phusion 0.25 U/μl 2 220 0.025 U/μl
polymerase
dNTP mix 20 mM each 0.2 22 200 μM each
PCR-grade NA 10.8 1188 NA
H2O
a
The final reaction concentration indicates the concentration after sample and
primers are added

Table 8
PCR2 thermal cycling conditions

Steps Temperature (°C) Time (s)

Initial denaturation 98 30
20 cycles Denaturation 98 10
Annealing 58 15
Extension 72 30
Final extension 72 600

amounts of product for sequencing can be obtained while

at the same time maximizing the representation of in vivo
diversity over in vitro PCR amplification processes.
(d) Seal PCR plates with thermal seals and carry out the PCR2
reaction on the thermal cycler programmed as in Table 8.
(e) Briefly centrifuge plates to collect the contents and store
the plate until required at −20 °C.
8. Combine all 16 wells of PCR2 products (20 μl per well; 320 μl
in total) into one 15 ml Falcon tube. Each 15 ml Falcon tube
therefore contains 320 μl of PCR2 products in total per ampli-
con type (having the same MID and type of Ig gene amplified
from the same research sample).
9. Add 64 μl of 6× orange G loading dye per tube to the com-
bined PCR2 products.
10. Preheat samples at 98 °C on a heat block for 5–10 min.
11. Place 1.5 % agarose/TAE gels containing 1× GelStar Nucleic
Acid Gel Stain in the horizontal electrophoresis apparatus
filled with 1× TAE buffer.
 Assessment of Human B Cell Repertoire 209

Fig. 3 Diagram to illustrate the PCR amplicon sizes of different IGH isotypes, IGL and IGK, in relation to the
Hyperladder IV DNA size marker, on a 1.5 % TAE agarose gel

12. Load the preheated samples on the gel and use 5 μl of Hyper
Ladder IV Ladder. Separate DNA fragments by electrophoresis
at 100 V for 60 min.
13. Visualize DNA fragments using the DarkReader 46B
Transilluminator instrument.
14. Excise fragments of the right size (Fig. 3), using sterile scalpels
and transfer gel slices into 15 ml Falcon tubes.
210 Yu-Chang Wu et al.

15. Extract DNA using the QIAquick gel purification kit, according
to the manufacturer’s instructions, except for the following
changes:
(a) Incubate gel slices in 5 ml of Buffer QG per amplicon type
in 15 ml Falcon tubes at 55 °C. Vortex frequently until gel
slices are melted. Expect approximately 6 ml of the solu-
tions in total per amplicon type in the 15 ml Falcon tube.
(b) Use one QIAquick spin column per amplicon type: apply
750 μl of the solution to the QIAquick spin column and
centrifuge at 13,000 rpm in a microfuge for 30 s. Collect,
rather than discard, the flow-through in a separate 15 ml
Falcon tube. Repeat this process until all mixture has been
applied to the same column, spun and recollected in a sep-
arate 15 ml Falcon tube.
(c) Apply the flow-through (750 μl at a time) back to the same
spin column, spin at 13,000 rpm, and discard the second
flow-through.
(d) Wash the spin column with 750 μl Buffer PE by centrifug-
ing at 13,000 rpm for 1 min.
(e) Add 55 μl PCR-grade H2O to the column membrane and
leave at RT for 3 min.
(f) Centrifuge the column at 13,000 rpm for 1 min and col-
lect the elution in 1.5 ml microcentrifuge tube.
(g) Add additional 55 μl of PCR-grade water to the same col-
umn membrane and leave at RT for 3 min.
(h) Spin to collect the elution in the same 1.5 ml microcentri-
fuge tube. In total, approximately 100 μl of elution will be
collected in one 1.5 ml microcentrifuge tube.
16. Measure the concentration and quality of the gel-purified
products for each amplicon type using the Qubit dsDNA HS
Assay Kits on the Qubit 2.0 Fluorometer.
17. Assemble the multiple amplicons into one sequencing sample.
When 12 MID barcodes are used, transfer 900 ng of
products per MID to a clean 1.5 ml microcentrifuge tube,
i.e., a total of 10,800 ng are pooled from 12 MID types (see
Note 14). If amplicons of multiple isotypes of heavy chain
and light chains are allocated to the same MID barcode,
divide 900 ng equally. Examples for the amount (in ng) of
gel-purified products for pooling multiple amplicon types are
listed in Table 9.
18. Enrich pooled products using the QIAquick PCR purification
kit, according to the manufacturer’s instructions. This step is
carried out in a similar way as step 9, except Buffer PBI is used
to mix with the pooled gel-purified solutions. Elute products
in two lots of 55 μl PCR-grade water as step 9.
 Assessment of Human B Cell Repertoire 211

Table 9
Assembly of sequencing samples

IgA IgG IgM IgK IgL Total (ng/MID)

MID 1 900 NA NA NA NA 900
MID 2 300 300 300 NA NA 900
MID 3 NA NA NA 450 450 900
MID 4 180 180 180 180 180 900
MID 5 NA 450 NA NA 450 900
MID 6 225 225 225 NA 225 900
MID 7 180 180 180 180 180 900
MID 8 180 180 180 180 180 900
MID 9 180 180 180 180 180 900
MID 10 180 180 180 180 180 900
MID 11 180 180 180 180 180 900
MID 12 180 180 180 180 180 900
Total = 10,800 ng per 1/16th microtitre chip

19. Measure the concentration and quantity of the pooled mixture

as step 10. The pooled mixture for the final sequencing sam-
ple needs to be a total of at least 5 μg at a concentration of
100 ng/μl.
20. Analyze 100 ng of the final sequencing sample on 1.5 % aga-
rose/TAE/EtBr gel to check that all primers have been
removed before HTS is carried out. Samples are sent for
sequencing according to the instructions from the contractor
(LGC Genomics).
21. Sequence data are output as the .FASTA format and the raw
FASTA files are analyzed in a three-stage approach [6, 15].
(a) First, individual potential IGH sequences are subjected to
a series of quality control (QC) assessments with the aim of
identifying sequences that are implausible from a biologi-
cal perspective (e.g., an interval between the two Ig prim-
ers that is too short based on known Ig gene sequences, or
an arrangement or spacing of internal Ig motifs that is
incompatible with known Ig gene sequences), contain evi-
dence of PCR or library construction artifacts (such as
internal MID sequences, or mis-matches between the start
and finish MID motifs), or are too short to provide data
on isotype or CDR-H3 region. Sequences that fail this ini-
tial QC step are excluded from further analysis.
212 Yu-Chang Wu et al.

(b) Sequences that pass this quality control are then edited to
remove any terminal adapter and MID sequences added
as part of the sequencing protocol, and each sequence is
renamed so as to capture and embed sample information
based on the MID tag. Sequences are then passed in bulk
to HighV-QUEST [16, 17]. This is a freely available
online resource (http://www.imgt.org/HighV-QUEST/
index.action) that analyzes each sequence with reference
to a database of human Ig sequences and returns a sum-
mary file cataloguing a range of outputs for each sequence
including V, D, and J gene usage and CDR-H3 sequence
and length.
(c) The V-QUEST output file is then parsed locally to further
summarize the data for each sequence regarding gene
usage. The amino acid sequence of the CDR-H3 junction
peptide is extracted and analyzed for a range of physico-
chemical properties (hydrophobicity, charge, amino acid
use, and so forth) using a locally scripted version of the
ProtParam tool that is available on the ExPASy server [18].
In addition, the DNA sequence of the CDR3 region is
used, in combination with hierarchical clustering and tree
cutting, to identify clusters (“clones”) of sequences that
share related CDR-H3 sequences. Further analysis high-
lights clones that span multiple isotypes (indicative of class
switching). Finally, a single sequence from each clone is
identified that represents the most common pattern of
gene usage as a reference sequence for further analysis,
such as regarding overall repertoire (see Note 15).

4 Notes

1. At low cell numbers this is not an issue but if high cell numbers
(over 6000 cells) are used, the subsequent PCR steps may be
more efficient if the cDNA sample synthesized using SLyRT
buffer is diluted 1 in 3 (35+ 70 μl) with PCR-grade water.
2. 100 % Triton is difficult to pipette due to high viscosity so it
may be helpful to cut the end of the pipette tip with a scalpel
to make it wider, and pipette slowly.
3. Add 200 μl each of dATP, dTTP, dCTP, dGTP (20 mM each;
Promega, UK) to 200 μl DNase/RNase-free H2O and vortex
to mix.
4. 1× TAE running buffer contained 40 mM Tris-borate and
1 mM EDTA. To make 50× TAE, 242 g Tris base, 57.1 ml
glacial acetic acid (Merck, UK), and 100 ml EDTA (pH 8.0)
 Assessment of Human B Cell Repertoire 213

Table 10
Spectratyping primers

Sequence (5′–3′)
5′-end primer
FW3-FAM ACACGGCTGTGTATTACTGT
In combination with
3′-end primer
IGHA or GGAAGAAGCCCTGGACCAGGC
IGHG or CACCGTCACCGGTTCGG
IGHM CAGGAGACGAGGGGGAA

were dissolved in 1 l distilled water, and then filtered to steril-

ize. 1 volume of 50× TAE was then diluted with 49 volumes
of distilled water to make 1× TAE.
5. To make 6× Orange loading dye, add 0.25 g Orange G (Sigma
Aldrich, UK) to 30 ml glycerol and 70 ml distilled water in a
50 ml Falcon tube and vortex to mix thoroughly.
6. Primers for spectratyping are listed in Table 10 below.
7. cDNA can be either obtained using SLyRT buffer or commer-
cially available kits, e.g., RNeasy Mini kit (Qiagen, UK) in con-
junction with First-Strand cDNA synthesis kit (Invitrogen, UK).
The amount of cDNA used for PCR should be optimized.
8. If necessary, PCR products for spectratype analysis can be ana-
lyzed on 10 % polyacrylamide gels to check before running on
the analyser.
9. FW3-FAM primers are light sensitive and should avoid expo-
sure to the light. PCR products for spectratyping should not
be kept in the fridge longer than 3 days before analysis, as the
signals from the 3730xl DNA Analyzer system could be
reduced.
10. The primers for the C regions in the different isotypes do not
all bind at the same distance away from the joining region.
Therefore a correction will need to be applied to normalize
the data. To get the actual CDR-H3 size without primer
sequences, subtract 70 bp (IGHM primers) or 146 bp (IGHG
primers) or 126 bp (IGHA primers).
11. An example of experimental organization for HTS samples is
shown in Table 11, where 12 research samples are multiplexed
as one sequencing sample.
214 Yu-Chang Wu et al.

Table 11
Example of multiplex sequencing sample assembly

Patient Tissue Cell type IgM IgG IgA kappa lambda Multiplex ID
A Blood Transitional B cell × NA NA × × MID1
Blood Naive B cell × NA NA × × MID2
Blood Memory B cell × × × × × MID3
Blood Plasma cell × × × × × MID4
B Blood Transitional B cell × NA NA × × MID5
Blood Naive B cell × NA NA × × MID6
Blood Memory B cell × × × × × MID7
Blood Plasma cell × × × × × MID8
C Blood Transitional B cell × NA NA × × MID9
Blood Naive B cell × NA NA × × MID10
Blood Memory B cell × × × × × MID11
Blood Plasma cell × × × × × MID12

12. PCR1 primer mix (Table 12) contains 5′-end multiplex primers
that anneal to all families of the variable regions and 3′-end prim-
ers that anneal to the constant region. 1.25 μl of the primer mix,
containing 835 nM each of 5′-end primers and 5 μM 3′-end
primer, is used in a final reaction volume of 25 μl, to give the final
concentrations at 41.75 nM each and 250 nM, respectively.
13. PCR2 primers are comprised of gene-specific sequences and
non-gene-specific, 10-base MID sequence motifs. PCR2
primer mix contains 5′-end multiplex MID-containing prim-
ers that anneal to all families of the variable regions and 3′-end
MID-containing primers that anneal to the constant region.
1 μl of the MID-containing primer mix, containing 835 nM
each of 5′-end primers and 5 μM 3′-end primer, is used in a
final reaction volume of 20 μl, to give the final concentrations
at 41.75 nM each and 250 nM, respectively. Each primer mix
contains only one MID barcode for amplification from one
research sample and a total of 12 different MID barcodes can
be used for 12 different research samples (Table 13).
The gene-specific sequences of 5′-end primers for the heavy
and light chains and 3′-end primers for the light chains are same as
PCR1. The gene-specific sequences in the 3′-end primers of the
heavy chains anneal for PCR2 reactions (Table 14) to the template
more upstream to those used in PCR1.
For space consideration, MID1-containing primers for IgA are
shown as an example (Table 15).
14. Although it only requires 5 ng (50 ng/μl) in total of the puri-
fied pooled mixture to be sequenced as one sequencing sample
using a 1/16th microchip on the 454 GS FLX Titanium
Table 12
PCR1 primer mix

5′-end Sequence 3′-end Sequence

primer (5′–3′) primers (5′–3′) Amplicon type
IGHV1 CCTCAGTGAAGGTCTCCTGCAAGG combined with IGHA GGCTCCTGGGGGAAGAAGCC IgA
IGHV2 TCCTGCGCTGGTGAAACCCACACA or
IGHV3 GGTCCCTGAGACTCTCCTGTGCA IGHG GCGCCTGAGTTCCACGACAC IgG
IGHV4 TCGGAGACCCTGTCCCTCACCTGC or
IGHV5 CAGTCTGGAGCAGAGGTGAAA IGHM GGGGAATTCTCACAGGAGAC IgM
IGHV6 CCTGTGCCATCTCCGGGGACAGTG
IGKV1 CATCCAGWTGACCCAGTCTCC combined with
IGKV2 GATATTGTGATGACCCAGWCT
IGKV3 GACRCAGTCTCCAGCCACCCTG IGKC CCTTCCACTGTACTTTGGCCTC Kappa heavy chain
IGKV4 GACATCGTGATGACCCAGTCT
IGKV5 GAAACGACACTCACGCAGTCT
IGKV6 GAAATTGTGCTGACTCAGTCT
IGLV1 CAGTCTGTGCTGACKCAGCC combined with
IGLV2 CAGTCTGCCCTGACTCAGCC
IGLV3 CCTATGAGCTGACWCAGCCAC IGLC GCCACTGTCACRGCTCCCGGG Lambda light chain
IGLV4/5 CAGCCTGTGCTGACTCARYC
IGLV6 CCAGNCTGTGSTGACTCAG
Assessment of Human B Cell Repertoire
215
216 Yu-Chang Wu et al.

Table 13
PCR2 primer mix

Sequence (5′–3′)
MID 1 acgagtgcgt
MID 2 acgctcgaca
MID 3 agacgcactc
MID 4 agcactgtag
MID 5 atcagacacg
MID 6 atatcgcgag
MID 7 cgtgtctcta
MID 8 ctcgcgtgtc
MID 9 tagtatcagc
MID 10 tctctatgcg
MID 11 tgatacgtct
MID 12 tactgagcta

Table 14
3′ Heavy chain primers

Sequence (5′–3′)
IGHA″ GGAAGAAGCCCTGGACCAGGC
IGHG″ CACCGTCACCGGTTCGGGG
IGHM″ CAGGAGACGAGGGGGAAAAGG

Table 15
MID1-containing IgA primers

3′-end primer
5′-end primer Sequence (5′–3′) Sequence (5′–3′)
MID1:IGHV1 acgagtgcgtCCTCAGTGAA combined MID1:IGHA″
GGTCTCCTGCAAGG with acgagtgcgtGGCTCCTGG
MID1:IGHV2 acgagtgcgtTCCTGCGCTG GGGAAGAAGCC
GTGAAACCCACACA
MID1:IGHV3 acgagtgcgtGGTCCCTG
AGACTCTCCTGTGCA
MID1:IGHV4 acgagtgcgtTCGGAGAC
CCTGTCCCTCACCTGC
MID1:IGHV5 acgagtgcgtCAGTCTG
GAGCAGAGGTGAAA
MID1:IGHV6 acgagtgcgtCCTGTGCCA
TCTCCGGGGACAGTG
 Assessment of Human B Cell Repertoire 217

platform, a significant amount of products can be lost during

the gel purification and enrichment steps. It is therefore ideal
to prepare more products than 5 ng in total before gel purifi-
cation and enrichment steps and then dilute final sequencing
sample to the concentration of 50 ng/μl.
15. All the analyses (other than online submission to HighV-
Quest) are performed using custom scripts written in the
open-source R language [19] using additional packages, nota-
ble Biostrings, from the Bioconductor project [20]. All the
R/Bioconductor packages are open source and freely avail-
able. A full work flow, including custom R scripts to perform
the pre-V-QUEST quality control filtering and editing, the
parsing of the V-QUEST output files and ProtParam analysis,
and the clustering-based clone identification, is available from
the authors ([email protected]) upon request.

References
1. Sanz I (1991) Multiple mechanisms participate 9. Gibson KL, Wu YC, Barnett Y, Duggan O,
in the generation of diversity of human H chain Vaughan R, Kondeatis E, Nilsson BO, Wikby
CDR3 regions. J Immunol 147:1720–1729 A, Kipling D, Dunn-Walters DK (2009) B-cell
2. Tonegawa S (1983) Somatic generation of diversity decreases in old age and is correlated
antibody diversity. Nature 302:575–581 with poor health status. Aging Cell 8:18–25
3. Raaphorst FM, Raman CS, Tami J, Fischbach 10. Tschumper RC, Asmann YW, Hossain A,
M, Sanz I (1997) Human Ig heavy chain Huddleston PM, Wu X, Dispenzieri A, Eckloff
CDR3 regions in adult bone marrow BW, Jelinek DF (2012) Comprehensive
pre-B cells display an adult phenotype of diver- assessment of potential multiple myeloma
sity: evidence for structural selection of DH immunoglobulin heavy chain V-D-J intra-
amino acid sequences. Int Immunol clonal variation using massively parallel pyrose-
9:1503–1515 quencing. Oncotarget 3:502–513
4. Volpe JM, Kepler TB (2008) Large-scale anal- 11. Warsame AA, Aasheim HC, Nustad K, Troen
ysis of human heavy chain V(D)J recombina- G, Tierens A, Wang V, Randen U, Dong HP,
tion patterns. Immunome Res 4:3 Heim S, Brech A, Delabie J (2011) Splenic
5. Larimore K, McCormick MW, Robins HS, marginal zone lymphoma with VH1-02 gene
Greenberg PD (2012) Shaping of human rearrangement expresses poly- and self-reactive
germline IgH repertoires revealed by deep antibodies with similar reactivity. Blood
sequencing. J Immunol 189:3221–3230 118:3331–3339
6. Ademokun A, Wu YC, Martin V, Mitra R, Sack 12. Luo C, Tsementzi D, Kyrpides N, Read T,
U, Baxendale H, Kipling D, Dunn-Walters DK Konstantinidis KT (2012) Direct comparisons
(2011) Vaccination-induced changes in human of Illumina vs. Roche 454 sequencing tech-
B-cell repertoire and pneumococcal IgM and nologies on the same microbial community
IgA antibody at different ages. Aging Cell DNA sample. PLoS One 7:e30087
10:922–930 13. Meyer M, Stenzel U, Myles S, Prufer K,
7. Wu YC, Kipling D, Dunn-Walters DK (2012) Hofreiter M (2007) Targeted high-through-
Age-related changes in human peripheral put sequencing of tagged nucleic acid samples.
blood IGH repertoire following vaccination. Nucleic Acids Res 35, e97
Front Immunol 3:193 14. Wu YC, Kipling D, Dunn-Walters DK (2011)
8. Cuisinier AM, Guigou V, Boubli L, Fougereau The relationship between CD27 negative and
M, Tonnelle C (1989) Preferential expression positive B cell populations in human peripheral
of VH5 and VH6 immunoglobulin genes in blood. Front Immunol 2:81
early human B-cell ontogeny. Scand J Immunol 15. Wu YC, Kipling D, Leong HS, Martin V,
30:493–497 Ademokun AA, Dunn-Walters DK (2010)
218 Yu-Chang Wu et al.

High-throughput immunoglobulin repertoire 18. Gasteiger E, Hoogland C, Gattiker A, Duvaud

analysis distinguishes between human IgM S, Wilkins MR, Appel RD, Bairoch A (2005)
memory and switched memory B-cell popula- Protein Identification and Analysis Tools on
tions. Blood 116:1070–1078 the ExPASy Server. In: Walker JM (ed) The
16. Alamyar E, Duroux P, Lefranc MP, Giudicelli proteomics protocols handbook. Humana
V (2012) IMGT® tools for the nucleotide Press, Clifton, UK, pp 571–607
analysis of immunoglobulin (IG) and T cell 19. R Development Core Team, R Foundation for
receptor (TR) V-(D)-J repertoires, polymor- Statistical Computing, Vienna, Austria (2010)
phisms, and IG mutations: IMGT/V-QUEST ISBN 3-900051-07-0
and IMGT/HighV-QUEST for 20. Gentleman RC, Carey VJ, Bates DM, Bolstad B,
NGS. Methods Mol Biol 882:569–604 Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y,
17. Alamyar E, Giudicelli V, Li S, Duroux P, Gentry J, Hornik K, Hothorn T, Huber W, Iacus
Lefranc MP (2012) IMGT/HIGHV-QUEST: S, Irizarry R, Leisch F, Li C, Maechler M, Rossini
the IMGT® web portal for immunoglobulin AJ, Sawitzki G, Smith C, Smyth G, Tierney L,
(Ig) or antibody and T cell receptor (TR) anal- Yang JY, Zhang J (2004) Bioconductor: open
ysis from NGS high throughput and deep software development for computational biology
sequencing. Immunome Res 8:26 and bioinformatics. Genome Biol 5:R80
 Chapter 17

Laboratory and Data Analysis Methods for Characterization

of Human B Cell Repertoires by High-Throughput DNA
Sequencing
Chen Wang, Yi Liu, Krishna M. Roskin, Katherine J.L. Jackson,
and Scott D. Boyd

Abstract
High-throughput DNA sequencing techniques have greatly accelerated the pace of research into the
repertoires of antibody and T cell receptor gene rearrangements that confer antigen specificity to adaptive
immune responses. Studies of aging-related changes in human B cell repertoires have benefited from
the ability to detect and quantify thousands to millions of B cell clones in human samples, and study the
mutational lineages and isotype switching relationships within each clonal lineage. Correlation of reper-
toire analysis with antibody gene data from antigen-specific B cells is poised to give much greater insight
into clinically relevant B cell responses and memory storage. Here, we describe strategies for preparing and
analyzing human antibody gene libraries for studying B cell repertoires.

Key words Antibody, Immunoglobulin, High-throughput DNA sequencing, Deep sequencing,

Repertoire, Immunome, Aging

1 Introduction

The antigen receptors expressed by human B cells and T cells provide

the basis for recognition of diverse antigens by the adaptive immune
system, and are the molecular basis for antigen-specific immune
system memory. The immunoglobulins (Ig) expressed by B cells,
and T cell receptors (TCR) expressed by T cells, are encoded by
some of the more complicated regions of the human genome, in
which an array of potential variable (V), diversity (D), and joining
(J) gene segments are arranged in series. During the formation of
new B cells, the genomic DNA at the immunoglobulin heavy chain
(IGH), and the kappa or lambda light chain (IGK, IGL) loci, is
physically rearranged by the RAG protein complex to bring
together single V, D, and J gene segments (for IGH) or V and J
segments (for IGK and IGL), with additional diversification of the

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_17, © Springer Science+Business Media New York 2015

219
220 Chen Wang et al.

junctions between gene segments mediated by variable degrees of

exonuclease digestion of segment ends, and addition of non-
templated nearly random junctional nucleotides (N nucleotides)
[1]. The combinatorial diversity resulting from V, D, and J seg-
ment choice, and the additional diversity due to exonuclease diges-
tion of segment ends and addition of randomized nucleotides,
results in a vast potential repertoire of expressed Ig receptors, each
containing two molecules of the B cell’s IGH product paired with
the IGK or IGL product.
Although the genetic mechanisms responsible for generating
Ig receptors have been studied for more than three decades, the
advent of “next-generation” DNA sequencing has enabled rapid
progress in the comprehensive study of immunoglobulin gene
rearrangements [2, 3]. This methodology permits tracking of B cell
populations involved in normal physiological responses to patho-
gens and vaccinations, and study of the alterations seen in immune-
mediated diseases and immune deficiencies, including the immune
system impairments that accompany human aging. Current high-
throughput DNA sequencing (HTS) technologies enable mea-
surement of thousands to millions of Ig or TCR sequences at costs
that are orders of magnitude lower than Sanger sequencing [3–12].
The power of these new sequencing methods is enhanced if experi-
mental design and sequencing library preparation are guided by
the data analysis plans for the questions that are of greatest interest
in the experiment.
HTS of Ig gene rearrangements generates rich and complex
data sets, with data analysis typically including one or more of the
following approaches: analysis of overall repertoire features or rep-
ertoire features associated with particular antibody isotypes; detec-
tion and analysis of Ig expressed by clonally expanded B cell
populations; and detection of Ig sequences known to be of bio-
logical interest, identified by selection of B cells that specifically
bind a particular antigen, or B cells from a particular functional
subset defined by cell surface markers or other phenotypic features.
Overall repertoire features include the frequency of usage of
particular V, D, and J segments; numbers of bases removed from
segment ends by exonuclease digestion, and the number of
non-templated bases added; length and amino acid usage of the
complementarity-determining region 3 (CDR3); frequency and
distribution of somatic hypermutation; isotype usage for particular
VDJ rearrangements, and measurement of the number of distinct
sequences obtained from a sample of known B cell number; and
evidence of unusual sequence features such as receptor editing or
rare large-scale mutations such as insertions or deletions within
gene segments [3, 13, 14]. It can be very informative to analyze
the Ig sequences expressed by B cells that have undergone clonal
expansion to the extent that more than one member of the clone is
captured in the sample studied, particularly in cases where there is
 Antibody Gene Repertoire Sequencing 221

an acute stimulation such as vaccination. Finally, detection of

members of clonal populations for which functional data are
available (such as antigen-specific B cells isolated by flow cytomet-
ric sorting, or B cells cultured at limiting dilution under conditions
where the binding activity of their secreted antibodies can be mea-
sured), followed by IGH and IGK/L determination by single-cell
PCR and sequencing, has proved to be a powerful method for
studying the evolution of HIV-specific or other pathogen-specific
B cell responses in humans [14, 15].
The major decision points in preparing HTS libraries for Ig
sequencing are (1) choice of template (genomic DNA or cDNA),
(2) choice of gene-specific primers in amplifying V(D)J rearrange-
ments, versus a method such as 5′ rapid amplification of cDNA
ends (5′RACE), and (3) choice of sequencing platform.
The advantage of genomic DNA (gDNA) as template for PCR
amplification is that each B cell only contributes a single-template
molecule to its productive IGH and IGK/L rearrangements; thus,
separately amplified library pools made from different aliquots of
gDNA can be considered as samplings of separate cell populations,
if the productive gene rearrangements are analyzed. cDNA tem-
plates, in contrast, provide numerous and generally unknown
numbers of template molecules from each B cell, such that genera-
tion of replicate sequence libraries from a sample must begin with
separation of different cell aliquots and isolation of RNA from each
separately prior to cDNA synthesis. Despite this disadvantage,
constant (C) gene-specific primers can be used to amplify cDNA
templates to identify IGH from each antibody isotype, providing
valuable functional information about the B cell from which a
given transcript was isolated. In addition, cDNA templates facili-
tate the use of 5′ primers complementary to the leader exon
sequences that lie upstream of a short intron preceding each V gene;
such leader sequences are less affected by somatic hypermutation
than the V gene, and primers targeting the leader sequence may
permit amplification of heavily mutated IGH which would fail to
amplify with V segment-specific primers [16].
A number of primer sets have been designed to amplify human
IGH and IGK/L gene rearrangements. Our group has typically
used IGHV gene framework 1 (FR1) and framework 2 (FR2)
primers, paired with a single IGHJ primer, based on the BIOMED-2
set that was devised for clinical lab diagnostic use, as well as primers
targeting the V gene leader sequences, paired with primers specific
for antibody isotype sequences in the first exon of the constant
chain [3, 14, 16, 17]. We usually generate several libraries using
each primer set from each sample, to avoid missing sequences that
amplify poorly with any one primer set. An alternate approach is to
use a 5′RACE protocol with the initial reverse transcription step of
the protocol primed with constant chain primers for each isotype.
The 5′RACE method does not rely on 5′-end gene-specific
222 Chen Wang et al.

primers, so it is likely to be an effective way of detecting heavily

mutated antibody gene sequences, although it has so far not been
widely applied to HTS library generation [18].
The following protocols focus on preparation of libraries for
sequencing with the 454 platform (Roche, Basel, Switzerland), but
similar methods can be used for Illumina MiSeq or HiSeq library
preparation (Illumina, San Diego, CA). These instruments have
been the most popular choices of investigators working in this area.
The 454 platform provides long single-read lengths (~500 bases)
and moderate throughput (one million reads per run), but is more
expensive than the Illumina platform which gives higher through-
put (tens to hundreds of millions of reads per run) for comparable
cost, but shorter single-read lengths (currently up to 250 base
reads from each end of a DNA molecule). The ability of the 454
instrument to sequence nearly the full length of an IGH VDJ
sequence in a single read facilitates analysis of hypermutation pat-
terns, but as the read lengths of Illumina sequencing have increased
to their current levels, the relative advantage of 454 in these
analyses has been decreasing [3, 5, 7, 9, 15, 19, 20]. The Illumina
platform is well suited to TCR sequencing, where somatic hyper-
mutation is not present [4, 8, 21].

2 Materials

1. RNA and DNA template isolation: All-prep DNA/RNA mini

kit, or separate DNA/RNA prep kits (Qiagen).
2. Reverse transcription: SuperScript III Reverse Transcriptase kit
(Invitrogen); Random hexamer primers (Promega).
3. PCR Primers: Primers are ordered as standard quality synthe-
sis, or as “ultramer” higher quality synthesis (Integrated DNA
Technologies), without additional purification.
4. PCR amplification: AmpliTaq Gold polymerase (Applied
Biosystems) with “buffer II” that comes with that polymerase
(adding Mg2+ to give a final concentration of 1.5 mM in each
reaction); dNTP (Roche).
5. Agarose gel electrophoresis: Agarose (Invitrogen).
6. Tris-acetate-EDTA buffer: Tris 40 mM, acetic acid 20 mM,
EDTA 1 mM, pH 8.0.
7. DNA ladder for product size determination: Quick-load
100 bp ladder (New England Biolabs).
8. Gel extraction: gel extraction kit (Qiagen).
9. Qubit DNA quantitation: Qubit DNA kit (Invitrogen).
 Antibody Gene Repertoire Sequencing 223

3 Methods

3.1 Primer Design 1. For 454 library preparation, forward and reverse PCR primers
and Barcoding are designed with the following elements in 5′–3′ order: 454
instrument-specific primer regions (required for emulsion
PCR and initiation of sequencing in the instrument protocols),
followed by a 10-base “barcode” sequence that encodes the
sample identity and PCR replicate library identity, followed by
the IGHV or IGHJ gene-specific primer sequence. Primer
sequences and barcodes are indicated in Tables 1 and 2.

3.2 Template 1. Genomic DNA and RNA are isolated from peripheral blood
Preparation mononuclear cell samples, or purified B cell samples using the
standard protocols in the Qiagen All-Prep kit.
2. cDNA synthesis is carried out with priming by random hex-
amer primers at 20 ng/μl final concentration, following the
manufacturer’s protocol for reverse transcription (Invitrogen).
The RNase H RNA hydrolysis step following cDNA synthesis
does not appear to be necessary for subsequent Ig PCR
amplifications.

3.3 PCR 1. We typically amplify up to 250 ng of genomic DNA template

Amplification of Ig in a 30 μl reaction. Depending on the amount of template
Gene Rearrangements, available from a sample, we will set up 6 replicate PCR per
and Analysis by Gel sample, with 100 ng or 200 ng of PBMC-derived genomic
Electrophoresis DNA template per replicate.
2. The IGHV primers for each barcoded reaction should be com-
bined to make the FR1 mix (containing 6 primers), the FR2
mix (containing 7 primers), or the leader primer set. The con-
centrations listed below (3.3 μM) are for the sum of all the
primers in the V primer mixes.
3. PCR is set up in 96-well plates on ice, with primers being
added to each well first, followed by template, followed by the
master mix containing all the remaining components of the
PCR reaction (see Note 1). Mix by pipetting up and down
several times gently (see Note 2).
4. PCR mixture components are:
Template: 100–200 ng genomic DNA, or cDNA from 100 to
200 ng total RNA
3.3 μM V Primer mix (FR1, FR2, or leader primers): 3 μl
3.3 μM J Primer or Constant region primer: 3 μl
10× PCR buffer: 3 μl
MgCl2: 1.8 μl
224 Chen Wang et al.

Table 1
Primer sequences for PCR amplification of gDNA library 1st reaction. The 5′-end primers consist of
adapter sequences for 454 platform (454-A), barcodes encoding sample identity, and sequences
complementary to the FR1 or FR2 regions of different V-gene families [3, 7, 17]. The 3′-end primers
consist of adapter 454-B, barcodes encoding replicate identity, and sequence complementary to the
J region

Primer name 454 adapter_[barcode]_gene-specific sequence

V-FR1-primer
454A_VH1-FR1 cgtatcgcctccctcgcgccatcag_[barcode]_GGCCTCAGTGAAGGTCTCCTGCAAG
454A_VH2-FR1 cgtatcgcctccctcgcgccatcag_[barcode]_GTCTGGTCCTACGCTGGTGAAACCC
454A_VH3-FR1 cgtatcgcctccctcgcgccatcag_[barcode]_CTGGGGGGTCCCTGAGACTCTCCTG
454A_VH4-FR1 cgtatcgcctccctcgcgccatcag_[barcode]_CTTCGGAGACCCTGTCCCTCACCTG
454A_VH5-FR1 cgtatcgcctccctcgcgccatcag_[barcode]_CGGGGAGTCTCTGAAGATCTCCTGT
454A_VH6-FR1 cgtatcgcctccctcgcgccatcag_[barcode]_TCGCAGACCCTCTCACTCACCTGTG
V-FR2-primer
454A_VH1-FR2 cgtatcgcctccctcgcgccatcag_[barcode]_CTGGGTGCGACAGGCCCCTGGACAA
454A_VH2-FR2 cgtatcgcctccctcgcgccatcag_[barcode]_TGGATCCGTCAGCCCCCAGGGAAGG
454A_VH3-FR2 cgtatcgcctccctcgcgccatcag_[barcode]_GGTCCGCCAGGCTCCAGGGAA
454A_VH4-FR2 cgtatcgcctccctcgcgccatcag_[barcode]_TGGATCCGCCAGCCCCCAGGGAAGG
454A_VH5-FR2 cgtatcgcctccctcgcgccatcag_[barcode]_GGGTGCGCCAGATGCCCGGGAAAGG
454A_VH6-FR2 cgtatcgcctccctcgcgccatcag_[barcode]_TGGATCAGGCAGTCCCCATCGAGAG
454A_VH7-FR2 cgtatcgcctccctcgcgccatcag_[barcode]_TTGGGTGCGACAGGCCCCTGGACAA
J-primer
454B_J ctatgcgccttgccagcccgctcag_[barcode]_CTTACCTGAGGAGACGGTGACC

2 mM dNTP: 3 μl
AmpliTaq Gold (5 U/μl): 0.3 μl
Water to 30 μl
5. Although the AmpliTaq Gold is a hot-start polymerase, we
keep the PCR plate on ice until the thermocycler block has
reached 95 °C, and then add the plate to the thermocycler.
6. The PCR program is as follows: Denaturation 95 °C for 7 min;
35 cycles of 95 °C for 30 s, 60 °C for 45 s, and 72 °C for 90 s;
and final extension: 72 °C for 10 min. If the PCR will run
overnight, we set the thermocycler to keep the plate at 10 °C
indefinitely after the run is complete.
7. Products of PCR are analyzed by 1.5 % agarose gels with
1×TAE running buffer, using ethidium bromide for DNA
visualization under ultraviolet light (ethidium bromide is
added to running buffer as well as the TAE used to make the
gel). We usually use the NEB Quick-load 100 bp ladder for
size comparison.
 Antibody Gene Repertoire Sequencing 225

Table 2
Examples of sequence barcodes in the IGHJ primer being used to indicate the sample (Sample 1–
Sample 4) from which a library was generated, while barcodes in the IGHV FR1 and FR2 primer sets
are used to label the different replicate libraries generated by PCR of distinct aliquots of genomic
DNA template from the sample (replicate libraries R1–R6 for each sample). Different replicate
libraries from the same sample share the J-barcode and are distinguished by V-barcodes

V-barcode J-barcode V-barcode J-barcode

Sample 1 Sample 3
R1 TTATGCCAGG R1 TTATGCCAGG
R2 TCCTGCCAGG R2 TCCTGCCAGG
R3 CCTTCCTAAG TAGAAGCAAG R3 CCTTCCTAAG CGGAAGCAAG
R4 AGCTCCTAAG R4 AGCTCCTAAG
R5 ACGTCCTAAG R5 ACGTCCTAAG
R6 TAGTGCCAGG R6 TAGTGCCAGG
Sample 2 Sample 4
R1 TTATGCCAGG R1 TTATGCCAGG
R2 TCCTGCCAGG R2 TCCTGCCAGG
R3 CCTTCCTAAG TGTAAGCAAG R3 CCTTCCTAAG CCTAAGCAAG
R4 AGCTCCTAAG R4 AGCTCCTAAG
R5 ACGTCCTAAG R5 ACGTCCTAAG
R6 TAGTGCCAGG R6 TAGTGCCAGG

3.4 Library Pooling 1. Based on the intensities of amplified bands from each PCR
and Gel Purification reaction, we pool the barcoded products in approximately
equimolar amounts (or with greater representation of particu-
lar samples, if more reads are wanted from them).
2. Run the pooled library on a new 1.5 % agarose gel in 1×TAE
buffer (using a comb with several teeth taped together to give
a broad single well), and cut out the gel slice containing the
desired PCR bands, being generous in the cutting to include
some gel above the highest band and below the lowest band.
We exclude the tips of the band from the excised slice, as
“smiling” of the band can cause the separation to be poorer at
the ends.
3. DNA is isolated from the gel slice using a Qiagen gel purification
kit, and eluted in TE buffer. The final gel-purified library band is
run on a final analytical 1.5 % agarose 1×TAE gel (see Note 3).
4. Quantitation of the pooled gel-extracted library is conducted
with Nanodrop spectrometry or Qubit fluorimetry.
226 Chen Wang et al.

3.5 High-Throughput 1. The 454 libraries are sequenced using 454 Titanium chemistry,
DNA Sequencing with amplicon sequencing reagents, and only from the “B” side.
Using the primer design presented here, the sequencing reads
start from the J segment end of the amplicon, and the Ig gene
rearrangement is sequenced as the reverse complement of the
mRNA sequence. The advantage of sequencing starting from
the J segment is that the VDJ junctional region is measured early
in the sequencing run when the read quality is highest.
2. Illumina libraries are sequenced with the MiSeq instrument,
using paired 250 bp read reagent kits. Using the primer design
presented here, the J segment end of the amplicon is sequenced
in the first read, while the second read begins from the V
segment.

3.6 DNA Sequence 1. There are a large number of options for processing and filtering
Data Analysis DNA sequence data. Our data analysis pipeline is integrated
with a PostgreSQL database for maintaining analysis results in
a consistent and orderly format, and to facilitate comparison
between sequences obtained from different experiments and
different sequencing runs. The components of the data analy-
sis pipeline are carried out sequentially as indicated below.
2. Identifying which sequences in the 454 instrument output files
came from each sample and each replicate sequence library
from that sample is carried out by searching for exact matches
to the “barcode” sequences encoded in the forward and reverse
PCR primers for each sample and replicate library. In addition
to matching the barcode sequence perfectly, the 7 bases of
gene-specific primer that follow the barcode sequence are
required to match exactly. This criterion enables the use of
pooled libraries in which the same barcode sequence can be
used with different primer sets, such as IGH primers and T cell
receptor primers, in the same sequencing run.
3. Gene-specific primer sequences are trimmed from the sequence
reads, to avoid incorporating primer-encoded sequence into
the later steps in the data analysis. For IGH amplicons that are
to be further analyzed with the iHMMune-align algorithm, we
do not trim the IGHJ primer, as the program requires the
additional length of IGHJ sequence to function. In this par-
ticular case, downstream data analysis does not make use of
apparent hypermutation positions that occur in the IGHJ
primer-encoded parts of the sequence.
4. Alignment of Ig gene products to germline V, D, and J gene
segments can be carried out with a variety of different
programs. We have used iHMMune-align (www.ihmmune.
unsw.edu.au), IgBLAST (www.ncbi.nlm.nih.gov/igblast/),
and IMGT/V-QUEST (www.imgt.org) in the past [22–24].
 Antibody Gene Repertoire Sequencing 227

We currently use iHMMune-align as the main sequence alignment

program in the analysis pipeline as the program builds a proba-
bilistic model of VDJ rearrangement with alignments per-
formed against the model rather than as independent local
sequence alignments for each gene segment set, as is the case
for IgBLAST and IMGT/V-QUEST. The probabilistic model
accounts for the mutation state of V gene segment in deter-
mining the most likely D gene segment, and considers the
interplay between nucleotide addition, removal, and mutation
in determining the processing of the gene segment ends and
the extent of non-template-encoded bases at the V-D and D-J
junctions. The output of each of these alignment programs
provides the predicted germline V, D, and J gene segments
used in each Ig rearrangement, non-templated junctional
nucleotides, positions of mutations compared to the predicted
germline gene segments, predicted amino acid sequences of
the encoded protein, including the CDR3 region, and a num-
ber of other metrics.
5. Summary measures of the sequences obtained from a sample,
such as the frequency of rearrangements using each V, D, and
J segment, extent of exonuclease digestion and non-templated
base addition, length and amino acid usage of the CDR3, and
frequency and distribution of somatic hypermutation changes,
can be readily calculated from the sequence parsing output
from iHMMune-align or other alignment programs. Our lab-
oratory uses a variety of scripts in the Python scripting lan-
guage (www.python.org) or the R statistical language (http://
www.r-project.org/) to aggregate these data, perform statisti-
cal tests, and generate plots for data visualization. In experi-
ments where multiple replicate libraries have been generated
from either gDNA template or cDNA from distinct cell ali-
quots, it is often advisable to “collapse” sequences within each
replicate library if they share identical V(D)J segment usage
and non-templated bases, as variations in sequence count for
different species within a replicate library are usually the result
of differences in PCR amplification efficiency for templates
which were each derived from one cell (see Note 4). Analysis
of B cell repertoire features in a sample can be affected by
many variables, such as the proportion of naïve vs. memory B
cells or the proportion of B cells expressing various switched
antibody isotypes. It is advisable to compare similar kinds of
sequence data sets between healthy controls and experimental
subjects, where the data have been generated using the same
library generation approach, and sequenced with the same
sequencing platform, preferably within the same instrument
run (see Note 5).
228 Chen Wang et al.

6. Identification of clonally related sequences within a data set

can be carried out with various degrees of strictness, and is
impacted by the extent of somatic hypermutation within the
clone of B cells, and the differences in mutation levels between
clone members. To avoid being overly sensitive to the effects
of hypermutation on allele calling for V or J segments, and to
permit some hypermutation changes in the VDJ junctional
regions, we usually search for sequences that share the same V
and J segment calls (omitting the allele call) and have CDR3
regions of the same length that are 80 % identical at the amino
acid level. The threshold for CDR3 similarity is a parameter
that can be adjusted according to the experimental question
being asked. For example, if the goal is to detect all potentially
related members of a clone that contains highly hypermutated
members as well as near-germline members, then a more per-
missive threshold for CDR3 similarity would help to prevent
false-negative results.
7. Quantitation of the degree of B cell clonality observed in a
sample has not been standardized within the HTS literature,
but is an important measure. Simple approaches such as count-
ing the number of unique sequences detected within a given
number of total sequences can be strongly affected by both
biological and experimental parameters, such as the expression
level of an Ig transcript in experiments where HTS libraries are
generated from cDNA template, or differences in PCR ampli-
fication efficiency. A primary benefit of preparing independent
replicate sequencing libraries from each sample is that it enables
a more accurate identification of sequences that are derived
from clonally expanded B cells. In such experimental designs,
an IGH sequence is designated as evidence of a clonally
expanded B cell population only if it is observed in more than
a single replicate library from the sample. With this approach,
a “clonality score” normalized for the depth of sequencing
performed on each library can be calculated.
We represent the clonality score as a ratio of a numerator
against a normalizing denominator. The numerator counts the
total number of unordered pairings of reads, in which the two
reads arise from different replicate libraries, but belong to the
same clone. The denominator normalizes the numerator against
the sequencing depth in each replicate library by counting the
number of such pairwise comparisons made. For each pair of
distinct replicate libraries, the number of comparisons made is
the number of reads in one replicate library multiplied by the
number of reads in the other replicate library. The denominator
counts the total number of comparisons made, across all unor-
dered pairings of replicate libraries. When the clonality score is
viewed as a fraction, it can be interpreted as the probability that
two random and independently drawn reads from a given
sample would belong to the same clone.
 Antibody Gene Repertoire Sequencing 229

Therefore, the clonality score is calculated as follows: sum

of Nij × Nik (j ≠ k) over i, j, k divided by the sum of Tj × Tk (j ≠ k)
over j, k, where Nij and Nik are the copy numbers of clone i
observed in independent replicate PCR libraries j and k gener-
ated from independent aliquots of template DNA, or from
RNA isolated from separate cell aliquots from the sample. Tj
and Tk are total read numbers in the corresponding replicate
libraries.
Empirically, the clonality scores across different samples
tend to follow a lognormal distribution. Thus, it is often sen-
sible to apply t-tests to the logarithms of the clonality scores
during data analysis. Taking logarithms requires us to system-
atically address the occasions where no pair of replicate librar-
ies shares any reads. This issue is frequently encountered and
well discussed in various branches of the machine learning lit-
erature. We apply Laplace smoothing, which involves adding 1
to the numerator and 2 to the denominator, to avoid this
problem [25].
The clonality score is simple to interpret, and the specific
procedure provided above is unbiased. In part due to this esti-
mator’s simplicity, not all the known subtleties of the experi-
mental reality are directly addressed; for example, some replicate
libraries may contain fewer B cells, or experience more variation
during PCR or sequencing. In addition, the presence of a single
large clonal population, or many smaller clones, can give rise to
equivalent clonality scores, so graphical visualization of the
number and size of expanded clones detected in a sample is
helpful for further exploration of the data.
8. Estimation of the diversity of a B cell population based on HTS
Ig repertoire data is more challenging than the estimation of
clonality. If “diversity” is taken to mean the true number of dis-
tinct species within a population, then current experimental
methods are still somewhat underpowered to obtain the correct
answer, and ethical limits on human subjects research present a
more significant barrier to collecting samples containing enough
cells to permit accurate determination of the answer. Most esti-
mates of “diversity” in the published literature on lymphocyte
populations are in fact estimates of the lower limit of diversity,
not the upper limit or the most likely value [3, 4, 26]. There are
approximately one to two billion circulating B cells in healthy
individuals’ blood, and probably tens to hundreds of billions of
B cells in the entire human body [27–29]. Experiments sam-
pling thousands or millions of cells from these much larger pools
have limited ability to assess the number and size of rare clonal
populations, which may make up most of the actual diversity of
a sample. In contrast, a metric such as the clonality score that
emphasizes the quantification of large clonal populations is more
easily reproducible because it relies little on contributions from
the rare members of the population.
230 Chen Wang et al.

4 Notes

1. It is convenient to create stock primer plates containing pre-

aliquoted barcoded IGHV and IGHJ or Ig constant region
primer combinations, and then to use a multichannel micropi-
pettor to create a number of replica plates from the stock plate,
so that primers do not have to be separately aliquoted for each
experiment. Such primer plates can be stored for several
months at −80 °C.
2. PCR contamination is a danger in any experiment using com-
mon PCR primers to amplify similar kinds of amplicons in suc-
cessive experiments, and HTS is an excellent way to be able to
detect such contaminants. Maintaining strict separation of
separate laboratory rooms for pre-PCR experimental work,
and post-PCR analysis of products, pooling of libraries, and
other manipulations is essential.
3. In this analytical gel of the pooled library, we usually also run
a titration of the 100 bp ladder (four different concentrations
of the ladder) to confirm the proportions of the library compo-
nents, and for comparison with the concentration values given
by spectrophotometric or fluorimetric measurement methods.
4. Exceptions to this rule would include samples in which there
are large clonal B cell populations, such that many or most
replicate libraries generated from the sample contain instances
of the IGH expressed by the clone, in which case the propor-
tion of that IGH sequence in each replicate library is likely to
be more meaningful.
5. As one example of potentially confounding variables that can
affect B cell repertoire analysis, IGH rearrangements using
some V segments tend to be under- or overrepresented in the
memory B cell pool (such as the lower frequency of
IGHV1-69 in memory B cells) [13]. Therefore, if two samples
differ in the proportion of memory B cells that are present, it
would be expected that V1-69 usage would appear to differ
between the samples as well. Comparing only sequences that
are hypermutated, or are not hypermutated, between different
samples would help to correct for this source of error.

References
1. Jung D, Alt FW (2004) Unraveling V(D)J 3. Boyd SD, Marshall EL, Merker JD, Maniar JM,
recombination; insights into gene regulation. Zhang LN, Sahaf B, Jones CD, Simen BB,
Cell 116(2):299–311 Hanczaruk B, Nguyen KD, Nadeau KC, Egholm
2. Hozumi N, Tonegawa S (1976) Evidence for M, Miklos DB, Zehnder JL, Fire AZ (2009)
somatic rearrangement of immunoglobulin Measurement and clinical monitoring of human
genes coding for variable and constant regions. lymphocyte clonality by massively parallel VDJ
Proc Natl Acad Sci U S A 73(10):3628–3632 pyrosequencing. Sci Transl Med 1(12):12–23
 Antibody Gene Repertoire Sequencing 231

4. Robins HS, Campregher PV, Srivastava SK, between T cell subsets and individuals revealed
Wacher A, Turtle CJ, Kahsai O, Riddell SR, by pyrosequencing. J Immunol 186(7):4285–
Warren EH, Carlson CS (2009) Comprehensive 4294, doi: jimmunol.1003898 [pii]10.4049/
assessment of T-cell receptor beta-chain diversity jimmunol.1003898
in alphabeta T cells. Blood 114(19):4099–4107, 11. Glanville J, Zhai W, Berka J, Telman D, Huerta
doi: blood-2009-04-217604 [pii]10.1182/ G, Mehta GR, Ni I, Mei L, Sundar PD, Day
blood-2009-04-217604 GM, Cox D, Rajpal A, Pons J (2009) Precise
5. Campbell PJ, Pleasance ED, Stephens PJ, determination of the diversity of a combinato-
Dicks E, Rance R, Goodhead I, Follows GA, rial antibody library gives insight into the
Green AR, Futreal PA, Stratton MR (2008) human immunoglobulin repertoire. Proc Natl
Subclonal phylogenetic structures in cancer Acad Sci U S A 106(48):20216–20221, doi:
revealed by ultra-deep sequencing. Proc Natl 0909775106 [pii]10.1073/pnas.0909775106
Acad Sci U S A 105(35):13081–13086, doi: 12. Bentley DR, Balasubramanian S, Swerdlow
0801523105 [pii]10.1073/pnas.0801523105 HP, Smith GP, Milton J, Brown CG, Hall KP,
6. Wang C, Sanders CM, Yang Q, Schroeder HW Evers DJ, Barnes CL, Bignell HR, Boutell JM,
Jr, Wang E, Babrzadeh F, Gharizadeh B, Myers Bryant J, Carter RJ, Keira Cheetham R, Cox
RM, Hudson JR Jr, Davis RW, Han J (2010) AJ, Ellis DJ, Flatbush MR, Gormley NA,
High throughput sequencing reveals a com- Humphray SJ, Irving LJ, Karbelashvili MS,
plex pattern of dynamic interrelationships Kirk SM, Li H, Liu X, Maisinger KS, Murray
among human T cell subsets. Proc Natl LJ, Obradovic B, Ost T, Parkinson ML, Pratt
Acad Sci U S A 107(4):1518–1523, doi: MR, Rasolonjatovo IM, Reed MT, Rigatti R,
0913939107 [pii]10.1073/pnas.0913939107 Rodighiero C, Ross MT, Sabot A, Sankar SV,
7. Margulies M, Egholm M, Altman WE, Attiya Scally A, Schroth GP, Smith ME, Smith VP,
S, Bader JS, Bemben LA, Berka J, Braverman Spiridou A, Torrance PE, Tzonev SS, Vermaas
MS, Chen YJ, Chen Z, Dewell SB, Du L, EH, Walter K, Wu X, Zhang L, Alam MD,
Fierro JM, Gomes XV, Godwin BC, He W, Anastasi C, Aniebo IC, Bailey DM, Bancarz
Helgesen S, Ho CH, Irzyk GP, Jando SC, IR, Banerjee S, Barbour SG, Baybayan PA,
Alenquer ML, Jarvie TP, Jirage KB, Kim JB, Benoit VA, Benson KF, Bevis C, Black PJ,
Knight JR, Lanza JR, Leamon JH, Lefkowitz Boodhun A, Brennan JS, Bridgham JA, Brown
SM, Lei M, Li J, Lohman KL, Lu H, Makhijani RC, Brown AA, Buermann DH, Bundu AA,
VB, McDade KE, McKenna MP, Myers EW, Burrows JC, Carter NP, Castillo N, Chiara
Nickerson E, Nobile JR, Plant R, Puc BP, ECM, Chang S, Neil Cooley R, Crake NR,
Ronan MT, Roth GT, Sarkis GJ, Simons JF, Dada OO, Diakoumakos KD, Dominguez-
Simpson JW, Srinivasan M, Tartaro KR, Fernandez B, Earnshaw DJ, Egbujor UC,
Tomasz A, Vogt KA, Volkmer GA, Wang SH, Elmore DW, Etchin SS, Ewan MR, Fedurco
Wang Y, Weiner MP, Yu P, Begley RF, Rothberg M, Fraser LJ, Fuentes Fajardo KV, Scott Furey
JM (2005) Genome sequencing in microfabri- W, George D, Gietzen KJ, Goddard CP, Golda
cated high-density picolitre reactors. Nature GS, Granieri PA, Green DE, Gustafson DL,
437(7057):376–380, doi: nature03959 Hansen NF, Harnish K, Haudenschild CD,
[pii]10.1038/nature03959 Heyer NI, Hims MM, Ho JT, Horgan AM,
Hoschler K, Hurwitz S, Ivanov DV, Johnson
8. Freeman JD, Warren RL, Webb JR, Nelson MQ, James T, Huw Jones TA, Kang GD,
BH, Holt RA (2009) Profiling the T-cell recep- Kerelska TH, Kersey AD, Khrebtukova I,
tor beta-chain repertoire by massively parallel Kindwall AP, Kingsbury Z, Kokko-Gonzales
sequencing. Genome Res 19(10):1817–1824, PI, Kumar A, Laurent MA, Lawley CT, Lee
doi: gr.092924.109 [pii]10.1101/gr.092924. SE, Lee X, Liao AK, Loch JA, Lok M, Luo S,
109 Mammen RM, Martin JW, McCauley PG,
9. Wu YC, Kipling D, Leong HS, Martin V, McNitt P, Mehta P, Moon KW, Mullens JW,
Ademokun AA, Dunn-Walters DK (2010) Newington T, Ning Z, Ling Ng B, Novo SM,
High-throughput immunoglobulin repertoire O'Neill MJ, Osborne MA, Osnowski A,
analysis distinguishes between human IgM Ostadan O, Paraschos LL, Pickering L, Pike
memory and switched memory B-cell popula- AC, Chris Pinkard D, Pliskin DP, Podhasky J,
tions. Blood 116(7):1070–1078, doi: blood- Quijano VJ, Raczy C, Rae VH, Rawlings SR,
2010-03-275859 [pii]10.1182/blood-2010- Chiva Rodriguez A, Roe PM, Rogers J, Rogert
03-275859 Bacigalupo MC, Romanov N, Romieu A, Roth
10. Venturi V, Quigley MF, Greenaway HY, Ng RK, Rourke NJ, Ruediger ST, Rusman E,
PC, Ende ZS, McIntosh T, Asher TE, Almeida Sanches-Kuiper RM, Schenker MR, Seoane
JR, Levy S, Price DA, Davenport MP, Douek JM, Shaw RJ, Shiver MK, Short SW, Sizto NL,
DC (2011) A mechanism for TCR sharing Sluis JP, Smith MA, Ernest Sohna Sohna J,
232 Chen Wang et al.

Spence EJ, Stevens K, Sutton N, Szajkowski L, (2009) Broad diversity of neutralizing antibodies
Tregidgo CL, Turcatti G, Vandevondele S, isolated from memory B cells in HIV-infected
Verhovsky Y, Virk SM, Wakelin S, Walcott GC, individuals. Nature 458(7238):636–640.
Wang J, Worsley GJ, Yan J, Yau L, Zuerlein M, doi:10.1038/nature07930
Mullikin JC, Hurles ME, McCooke NJ, West JS, 17. van Dongen JJ, Langerak AW, Bruggemann
Oaks FL, Lundberg PL, Klenerman D, Durbin M, Evans PA, Hummel M, Lavender FL,
R, Smith AJ (2008) Accurate whole human Delabesse E, Davi F, Schuuring E, Garcia-Sanz
genome sequencing using reversible terminator R, van Krieken JH, Droese J, Gonzalez D,
chemistry. Nature 456(7218):53–59, doi: Bastard C, White HE, Spaargaren M, Gonzalez
nature07517 [pii]10.1038/nature07517 M, Parreira A, Smith JL, Morgan GJ, Kneba
13. Glanville J, Kuo TC, von Budingen HC, Guey M, Macintyre EA (2003) Design and standard-
L, Berka J, Sundar PD, Huerta G, Mehta GR, ization of PCR primers and protocols for
Oksenberg JR, Hauser SL, Cox DR, Rajpal A, detection of clonal immunoglobulin and T-cell
Pons J (2011) Naive antibody gene-segment receptor gene recombinations in suspect lym-
frequencies are heritable and unaltered by phoproliferations: report of the BIOMED-2
chronic lymphocyte ablation. Proc Natl Acad Concerted Action BMH4-CT98-3936.
Sci U S A 108(50):20066–20071, doi: Leukemia 17(12):2257–2317. doi:10.1038/
1107498108 [pii]10.1073/pnas.1107498108 sj.leu.2403202
14. Liao HX, Lynch R, Zhou T, Gao F, Alam SM, 18. Tobisawa Y, Maruyama T, Tanikawa T,
Boyd SD, Fire AZ, Roskin KM, Schramm CA, Nakanishi K, Kurohane K, Imai Y (2011)
Zhang Z, Zhu J, Shapiro L, Becker J, Benjamin Establishment of recombinant hybrid-IgG/IgA
B, Blakesley R, Bouffard G, Brooks S, Coleman immunoglobulin specific for Shiga toxin. Scand
H, Dekhtyar M, Gregory M, Guan X, Gupta J, J Immunol 74(6):574–584. doi:10.1111/j.
Han J, Hargrove A, Ho SL, Johnson T, Legaspi 1365-3083.2011.02617.x
R, Lovett S, Maduro Q, Masiello C, Maskeri B, 19. Weinstein JA, Jiang N, White RA 3rd, Fisher
McDowell J, Montemayor C, Mullikin J, Park DS, Quake SR (2009) High-throughput
M, Riebow N, Schandler K, Schmidt B, Sison sequencing of the zebrafish antibody repertoire.
C, Stantripop M, Thomas J, Thomas P, Science 324(5928):807–810, doi:
Vemulapalli M, Young A, Mullikin JC, 324/5928/807 [pii]10.1126/science.11700
Gnanakaran S, Hraber P, Wiehe K, Kelsoe G, 20. Wu X, Zhou T, Zhu J, Zhang B, Georgiev I,
Yang G, Xia SM, Montefiori DC, Parks R, Wang C, Chen X, Longo NS, Louder M,
Lloyd KE, Scearce RM, Soderberg KA, Cohen McKee K, O’Dell S, Perfetto S, Schmidt SD,
M, Kamanga G, Louder MK, Tran LM, Chen Shi W, Wu L, Yang Y, Yang ZY, Yang Z, Zhang
Y, Cai F, Chen S, Moquin S, Du X, Joyce MG, Z, Bonsignori M, Crump JA, Kapiga SH, Sam
Srivatsan S, Zhang B, Zheng A, Shaw GM, NE, Haynes BF, Simek M, Burton DR, Koff
Hahn BH, Kepler TB, Korber BT, Kwong PD, WC, Doria-Rose NA, Connors M, Mullikin
Mascola JR, Haynes BF (2013) Co-evolution JC, Nabel GJ, Roederer M, Shapiro L, Kwong
of a broadly neutralizing HIV-1 antibody and PD, Mascola JR (2011) Focused evolution of
founder virus. Nature 496(7446):469–476. HIV-1 neutralizing antibodies revealed by
doi:10.1038/nature12053 structures and deep sequencing. Science
15. Liao HX, Chen X, Munshaw S, Zhang R, 333(6049):1593–1602, doi: science.1207532
Marshall DJ, Vandergrift N, Whitesides JF, Lu [pii]10.1126/science.1207532
X, Yu JS, Hwang KK, Gao F, Markowitz M, 21. Robins H, Desmarais C, Matthis J, Livingston
Heath SL, Bar KJ, Goepfert PA, Montefiori R, Andriesen J, Reijonen H, Carlson C,
DC, Shaw GC, Alam SM, Margolis DM, Nepom G, Yee C, Cerosaletti K (2011) Ultra-
Denny TN, Boyd SD, Marshal E, Egholm M, sensitive detection of rare T cell clones. J
Simen BB, Hanczaruk B, Fire AZ, Voss G, Immunol Methods 375(1-2):14–19, doi:
Kelsoe G, Tomaras GD, Moody MA, Kepler S0022-1759(11)00246-8 [pii]10.1016/j.
TB, Haynes BF (2011) Initial antibodies bind- jim.2011.09.001
ing to HIV-1 gp41 in acutely infected subjects
are polyreactive and highly mutated. J Exp 22. Brochet X, Lefranc MP, Giudicelli V (2008)
Med 208(11):2237–2249. doi:10.1084/ IMGT/V-QUEST: the highly customized and
jem.20110363 integrated system for IG and TR standardized
V-J and V-D-J sequence analysis. Nucleic Acids
16. Scheid JF, Mouquet H, Feldhahn N, Seaman Res 36(Web Server issue):503–508.
MS, Velinzon K, Pietzsch J, Ott RG, Anthony doi:10.1093/nar/gkn316
RM, Zebroski H, Hurley A, Phogat A,
Chakrabarti B, Li Y, Connors M, Pereyra F, 23. Giudicelli V, Brochet X, Lefranc MP (2011)
Walker BD, Wardemann H, Ho D, Wyatt RT, IMGT/V-QUEST: IMGT standardized analy-
Mascola JR, Ravetch JV, Nussenzweig MC sis of the immunoglobulin (IG) and T cell
 Antibody Gene Repertoire Sequencing 233

receptor (TR) nucleotide sequences. Cold diversity. Science 286(5441):958–961, doi:

Spring Harb Protoc 2011(6):695–715. 7939 [pii]
doi:10.1101/pdb.prot5633 27. Ganusov VV, De Boer RJ (2007) Do most
24. Gaeta BA, Malming HR, Jackson KJ, Bain ME, lymphocytes in humans really reside in the gut?
Wilson P, Collins AM (2007) iHMMune-align: Trends Immunol 28(12):514–518, doi:
hidden Markov model-based alignment and S1471-4906(07)00231-1 [pii]10.1016/j.it.
identification of germline genes in rearranged 2007.08.009
immunoglobulin gene sequences. Bioinformatics 28. Greer JP, Foerster J, Rodgers GM, Paraskevas F,
23(13):1580–1587, doi: btm147 [pii]10.1093/ Glader B, Arber DA, Means RT (2008)
bioinformatics/btm147 Wintrobe’s clinical hematology, vol 1. Lippincott
25. Russell SJ, Norvig P (2003) Artificial intelli- Williams & Wilkins, Philadelphia, PA
gence: a modern approach. Pearson Education, 29. Morbach H, Eichhorn EM, Liese JG,
Upper Saddle River, NJ Girschick HJ (2010) Reference values for B
26. Arstila TP, Casrouge A, Baron V, Even J, cell subpopulations from infancy to adult-
Kanellopoulos J, Kourilsky P (1999) A direct hood. Clin Exp Immunol 162(2):271–279.
estimate of the human alphabeta T cell receptor doi:10.1111/j.1365-2249.2010.04206.x
 Chapter 18

Discovery of Novel microRNAs in Aging

Caenorhabditis elegans
Alexandre de Lencastre and Frank Slack

Abstract
The rapid development of deep sequencing technologies over the last few years and concomitant increases
in sequencing depth and cost efficiencies have opened the door to a ever-widening range of applications in
biology—from whole-genome sequencing, to ChIP-seq analysis, epigenomic and RNA transcriptome sur-
veys. Here we describe the application of deep sequencing to the discovery of novel microRNAs and
characterization of their differential expression during adulthood in Caenorhabditis elegans.

Key words Caenorhabditis elegans, microRNA, Differential gene expression, Deep sequencing

1 Introduction

microRNAs (miRNAs) are short, endogenous RNAs with func-

tions in post-transcriptional regulation in a wide variety of eukary-
otes [1]. As a novel class of gene regulatory elements, miRNAs
have been implicated in a wide variety of functions during develop-
ment in plants and animals and accumulating evidence points to
functions of certain miRNAs as oncogenes and tumor suppressors
[2]. Recent breakthroughs expand the repertoire of post-
developmental functions for miRNAs and suggest that alteration
of miRNA levels can directly affect the health span and longevity of
organisms. In work pioneered in C. elegans we have shown that
mutations to certain miRNAs can significantly lengthen or shorten
nematode life-span [3, 4]. At least four of these miRNAs were first
identified as miRNAs that are up-regulated during adulthood in C.
elegans [4]. Importantly, these miRNAs function in longevity at
least partially through conserved pathways such as the insulin-like
and DNA damage response pathways. We have shown that these
functions are at least partially mediated by miRNA repression of
genes in these pathways, consistent with stereotypical miRNA-
mediated regulation. These results expand the universe of known

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_18, © Springer Science+Business Media New York 2015

235
236 Alexandre de Lencastre and Frank Slack

functions for miRNAs but it is clear that much remains to be

discovered. Surveys of miRNA mutations in C. elegans have so far
identified only a handful of miRNAs with obvious phenotypes, and
the vast majority of miRNAs have unknown functions [5–7].
Furthermore, many other miRNAs remain undiscovered. In our
deep sequencing surveys of aged nematodes, we identified and
validated the expression of 17 novel miRNAs [4, 8]. Finally, miR-
NAs have the potential to target a vast number of genes. Together,
these results suggest possible functional roles of many new miR-
NAs during adulthood and emphasize the power of deep sequenc-
ing technologies in uncovering these new regulatory factors or
their targets. Here we discuss methods for discovery and differen-
tial expression analysis of miRNAs during adulthood in C.
elegans.

2 Materials

2.1 C. elegans 1. Strains: Obtain C. elegans strains from the Caenorhabditis

Maintenance Genetics Center (CGC). Some useful strains for the discovery
and Growth of novel miRNAs during aging: wild-type N2 (Bristol), daf-
2(e1370) and alg-1(gk214). All mutant strains are backcrossed
against the reference N2 strain at least three times before fur-
ther characterization.
2. Nematode growth medium (NGM): Mix 6 g NaCl, 34 g agar
and 5 g BACTO peptone in 2 L of water. After autoclaving, let
cool to 55 °C in a water bath for 15 min and then mix the fol-
lowing, in order, allowing each to mix completely: 50 ml 1 M
potassium phosphate pH 6.0 (108.3 g KH2PO4, 35.6 g
K2HPO4, in 1 L of water); 2 ml 5 mg/ml cholesterol, 2 ml
1 M MgSO4 and 2 ml 1 M CaCl2. Finally, dispense the NGM
solution into petri dishes. Fill plates 2/3 full of agar (for small
6 cm plates, that would be about 10 ml of NGM).
3. M9 buffer: Mix 3 g of KH2PO4, 5 g NaCl, and 6 g Na2HPO4
in 1 L water. After autoclaving, add 1 ml 1 M MgSO4.
4. FUDR: Prepare 40× stock solution of 5′-fluoro-2′deoxyuridine
(Roche) in water (4 mg/ml) and filter-sterilize through 0.2 μm
filter discs. Store individual aliquots at 20 °C. Once thawed,
discard unused FUDR solution.

2.2 RNA Isolation, 1. Siliconized, RNase/DNase-free microcentrifuge tubes.

Cloning, Deep 2. TRIzol reagent (Roche).
Sequencing,
3. miRVana miRNA isolation kit (Ambion).
and qRT-PCR
4. Superscript III Reverse Transcriptase (Invitrogen).
5. Turbo DNAfree kit (Ambion).
6. DGE-Small RNA Sample Prep Kit ver. 1.0 (Illumina).
 microRNAs in Caenorhabditis elegans 237

7. Taqman miRNA Assays (Applied Biosystems).

8. Custom Taqman miRNA Assays (Applied Biosystems).
9. Taqman miRNA Reverse Transcription Kit (Applied
Biosystems), containing Multi-scribe RT (50 U/μl), RNase
Inhibitor (20 U/μl), 10 mM dNTP mix.
10. TaqMan® Universal PCR Master Mix, No AmpErase® UNG
(Applied Biosystems).
11. miScript II RT Kit (Qiagen), containing 5× miScript HiFlex
Buffer.
12. miScript Primer Assays (Qiagen), including RNA6B control.
13. miScript SYBR Green PCR Kit (Qiagen).

2.3 Bioinformatic 1. Required input files:

Analysis C. elegans genome: cel_ws201.fa from wormbase: ftp://ftp.
wormbase.org/pub/wormbase/genomes/c_elegans/
sequences/dna/
C. elegans mature miRNA sequences, mature_cel.fa in fasta
format obtained from miRBase (mirbase.org):
C. elegans precursor miRNA sequences, mature_other.fa,
obtained from miRBase.
mature miRNA sequences of other species, precursor_cel.fa,
obtained from miRBase.
Deep sequencing reads, in fastq or fasta format.
2. Software packages:
Differential expression of miRNAs and novel miRNA discov-
ery: miRDeep2 [9]. Other prerequisite software can be
installed automatically or manually (see miRDeep2 docu-
mentation and tutorial).
Statistical analysis of differential expression: Any of a number
of software packages: DESeq, DEGseq, edgeR, baySeq,
mirZ, or SAMseq [10–15].

3 Methods
3.1 RNA Isolation Routine C. elegans culture procedures are carried using standard,
from Synchronized published protocols [16].
Populations of Adult
1. Allow animals to grow for at least three generations on E. coli
C. elegans
strain OP50 without starvation. In order to obtain 15–20 μg
of RNA, a mixed population of animals (medium density pop-
ulation, unstarved, on a NGM plate) are harvested from 10 to
20 small (6 cm) NGM plates or 1–2 large (15 cm) NGM plates
using 10–15 ml of M9 buffer (see Note 1). The worm pellets
238 Alexandre de Lencastre and Frank Slack

are washed 3–4 times with M9 to remove OP50. These ani-

mals are then bleach-treated in 0.1 % (vol/vol) sodium hypo-
chlorite and 0.5 M NaOH in total volume of 5 ml in a 15 ml
falcon tube for a maximum of 5 min and washed with M9 buf-
fer 5–6 times (see Note 2). The remaining eggs are then resus-
pended in 20–50 ml of M9 buffer and incubated overnight at
20 °C (or appropriate temperature for temperature sensitive
mutants) with gentle shaking/nutation in a 200 ml Erlenmeyer
flask covered loosely with aluminum foil (to prevent hypoxia).
2. Synchronized, starved L1-stage larvae are plated on large
NGM plates containing OP50 and grown at 20 °C (or appro-
priate temperature) until late L4-early adulthood stage. At this
point, animals are transferred using M9 to plates containing
5′-fluoro-2′-deoxyuridine (FUDR) (0.1 mg/ml) (to prevent
progeny production) and maintained at 20 °C (or appropriate
temperature). At selected time points of adulthood, animals
are harvested using M9, washed 6 times with M9 buffer, flash
frozen in liquid N2, and stored at −80 °C for later analysis.
3. Worm lysis for RNA extraction: Worms can be lysed by tradi-
tional mortar and pestle grinding of frozen worm pellets or by
alternative methods. Currently, we lyse worm preps using
Zirconia beads (1 mm, Biospec) in a Fastprep24 homogenizer
(MP Biomedicals), which permits rapid and uniform lysis of
multiple C. elegans samples at one time.
4. Small RNA extraction: Isolate total RNA by guanidine thio-
cyanate hydrochloride/phenol method or using the commer-
cial TRIzol reagent (Roche) (see Note 3). Small RNAs can be
harvested from total RNA by size selection in the presence of
32
P-labeled RNA oligonucleotide size markers using polyacryl-
amide gel electrophoresis (PAGE) [4, 17]. Alternatively, iso-
late small RNAs using specialized commercial kits, such as the
miRVana miRNA isolation kit (Ambion) following the manu-
facturer’s protocols. We have had good success extracting RNA
enriched for small RNAs by either method [4, 8].
5. Small RNA cloning: cDNA libraries of small RNAs are pre-
pared using the DGE-Small RNA Sample Prep Kit ver. 1.0
(Illumina) following the manufacturer’s recommended proto-
cols. Small RNAs corresponding to sizes of 10–30 nucleotides
are selectively purified and ligated to adapters and amplified by
RT-PCR (see Notes 4 and 5). Consider the use of multiplexing
in order to substantially decrease the cost of sequencing and
increase the number of samples to be sequenced [18]. Purified
DNA is then loaded on an Illumina Flow Cell for cluster gen-
eration and sequenced according to the manufacturer’s instruc-
tions. For miRNA sequencing, 36-cycle, single-end read
sequencing is appropriate—following the manufacturer’s pro-
tocols for the DGE-Small RNA Cluster Generation Kit and 36
Cycle Solexa (Illumina) Sequencing Kit.
 microRNAs in Caenorhabditis elegans 239

3.2 Analysis Using 1. Collect sequencing data and ensure that it is in a format that is
miRDeep2 compatible with miRDeep2 [9]. Typically, sequencing data
from Illumina will be in fastq format, which is compatible with
miRDeep2. However, if necessary (see miRDeep2 documenta-
tion for information on compatible input formats), convert the
sequencing file into an acceptable input format using any num-
ber of appropriate tools—one option is the online web server,
Galaxy [19].
2. To facilitate sequence alignment, obtain the C. elegans genome
from Wormbase and build an index of it using Bowtie and the
Bowtie-build command included in miRDeep2: bowtie-build
cel_genome.fa cel_genome
This will generate several .ebwt files which miRDeep2
will use.
3. Create a text file, config.txt, containing the filenames of your
samples, and a chosen sample ID (three-letter format), with
one sample per line, in the general format:

Filename SamplenameID (3 letter format)

N2_young.fa N2y
N2_old.fa N2o
daf2_young.fa d2y
daf2_old.fa d2o

4. Collapse deep sequencing reads and map against reference

genome by running script “mapper.pl” (part of miRDeep2
package) from command line:
mapper.pl config.txt -d -k AGCAGTGACGTGTGTGTGT -c
-m -i -j -l 17/-p genome_cel -s reads.fa -t reads_vs_
genome.arf
Explanation of parameters:
config.txt contains list of samples (see Subheading 3.3, step 3).
-d tells mapper to use config file for names of input files to
process.
-c specifies that read samples are in fasta format.
-m collapses the reads.
-k trims the 3′ adapter sequence.
-i converts rna to dna.
-j removes any sequence other than ATGC.
- l 17 removes any sequences shorter than 17 bases.
240 Alexandre de Lencastre and Frank Slack

-p genome_cel specifies the reference genome.

-s reads.fa specifies the filename of the output.
-t prints read mappings to this file (which is used in subsequent
steps).
The output of this mapping procedure will be a “reads.fa”
file (or whatever was chosen as the output filename) containing
all the reads that match the reference genome in collapsed for-
mat. The name of each read will contain the samplenameID
and a_x index, where x represents the number of identical, col-
lapsed reads found in the sequencing data.
5. To determine differential expression, run the miRDeep2 script
“quantifier.pl”:
quantifier.pl -p precursor-cel.fa -m mature12-cel.fa -r reads.fa
-c config.txt -g 1 -t cel
where -p precusor-cel.fa specifies the file containing known
miRNA precursors from mirbase.
-m mature-cel.fa specifies the file containing mature miRNA
sequences.
-r reads.fa specifies the input file of deep sequencing reads
(generated by mapper.pl).
-c config.txt contains list of samples and sample code
(3-letter).
-g 1 allows one mismatch.
-t cel specifies the reference genome (3-letter species code).
As output, the quantifier.pl script will generate a file named
expression.html which is viewable in a browser and contains a
summary of the data and links to pdfs that show the miRNA
mappings, with pileup of reads, read counts, frequency dia-
grams, and signature and secondary structure of the precursor
hairpins (Fig. 1). Optional parameters can be used in quanti-
fier.pl to report mismatches, take star sequences into consider-
ation, or alter the mapping parameters to the precursors
sequences (see Note 6). The expression tables generated by
quantifier.pl script will include both raw number of reads as
well as normalized reads. It is important to consider which
normalization method is appropriate to the biological question
being studied (see Note 7) and to ensure that proper biological
controls and replicates are integrated into the study design (see
Note 8). The quantifier.pl program will also generate a .csv file
with full read counts for all known miRNAs which can be
exported to spreadsheet programs and/or to various packages
for further statistical analysis (see Note 9).
 microRNAs in Caenorhabditis elegans 241

Fig. 1 Analysis of deep sequencing reads of known miRNAs using miRDeep2. Frequency diagram, pileup of
reads, identification of mismatches (mm), 2° structure of precursor, and mature sequence highlighted in red

6. To identify novel miRNAs, use the “miRDeep2.pl” script:

miRDeep2.pl reads.fa genome_cel.fa reads_vs_genome.arf
mature-cel.fa \
mature-other.fa precursors-cel.fa -t cel -b -2 2>report.log
where reads.fa and reads_vs_genome.arf represent the files
generated by mapper.pl; genome_cel.fa is the reference
genome; and mature-cel.fa and precursors-cel.fa are the
C. elegans mature miRNAs and precursors from miRBase.
The file mature-other.fa contains miRNA sequences for other
species, with potential overlap or homology with new candi-
date miRNAs.
-b minimum cutoff score for predicted novel miRNAs to be
displayed in table. Default is 0. Adjust or -1 or -2 to iden-
tify more candidates (including more false positives).
The miRDeep2.pl script will generate various output files,
including a table in html format that summarizes the informa-
tion for the top candidate novel miRNAs identified by the
program, including miRDeep score, p-values, read counts
242 Alexandre de Lencastre and Frank Slack

Fig. 2 Identification of novel miRNAs using miRDeep2. Frequency diagram, 2° structure of putative precursor,
and identification of potential mature and star sequences from deep sequencing data

(mature, star, and loop regions), homology to other miRNAs,

and sequences of predicted mature, star, and precursor hair-
pins. In addition, there will be links to read pileups, frequency
diagrams, and secondary structure diagrams, including pre-
dicted mature and star sequences (Fig. 2). The reported
miRDeep2 scores and associated information is used to nar-
row down the top candidate, novel miRNAs that should be
further characterized (see Note 10).

3.3 Validation For validation by qRT-PCR, extract total RNA as described before
of miRNA Expression (Subheading 3.1, step 4). To confirm expression changes of known
miRNAs during aging, RNA should be obtained from synchro-
nized animals at relevant time-points during adulthood. To vali-
date novel miRNAs, RNA should be obtained from synchronized
wild-type N2 animals as well as alg-1(gk214) mutants in young
adulthood and/or later time points (according to its expression
pattern from deep-sequencing) (see Note 11).
1. Northern analysis of known miRNAs: For confirmation of the
expression of known miRNAs, we use ~15–20 μg of total RNA
 microRNAs in Caenorhabditis elegans 243

obtained from animals at different points of adulthood. We

design probes using the StarFire Oligonucleotide Labelling Kit
(from Integrated DNA Technologies) which are complemen-
tary to the mature sequences of miRNAs in question. We use a
probe for U6 small nuclear RNA sequence as a normalization
control (5′-GCA GGG GCC ATG CTA ATC TTC TCT GTA
TT). As an additional control, we utilize a probe for miR-66
(5′-TCA CAT CCC TAA TCA GTG TCA TG), whose expres-
sion remains constant during development [20, 21], during
aging or in daf-2(e1370) mutants [4] (see Note 12).
2. Quantitative RT-PCR of novel miRNAs: RNA samples
(1–10 μg) are treated with Turbo DNAse according to the
manufacturer’s protocols (Ambion, Turbo DNAfree kir). The
expression of miRNAs is then measured using Taqman small
RNA Assays (Applied Biosystems). To validate candidate novel
miRNAs, custom Taqman assays are purchased from Applied
Biosystems and tested according to the manufacturer’s proto-
cols, except that we use a Lightcycler 480 qPCR instrument.
We adapted qPCR cycling conditions appropriate for miRNA
Taqman detection on LightCycler 480 instruments
[22]:Enzyme activation: 95 °C for 10 min; amplification
(45 cycles): 95 °C for 15 s (ramp: 4,4 °C/s, analysis mode:
quantification), 60 °C for 60 s (ramp: 2,2 °C/s); cooling:
40 °C for 30 s (ramp: 2 °C/s). The detection format was set to
“Mono Color Hydrolysis Probe” and the second derivative
maximum method was used for absolute quantification.
Expression levels are normalized against endogenous control,
the small nucleolar RNA (snoRNA), U18 (Taqman). For pur-
pose of validating the expression of these candidate miRNAs,
we consider only miRNAs with amplification < 35 cycles and
those miRNAs whose expression is reduced in alg-1(gk214)
mutants (Fig. 3).
3. Quantitative RT-PCR of known miRNAs: For known miR-
NAs, in addition to the Taqman method we also use miRScript
qRT-PCR (Qiagen). RNA samples (1–10 μg) are treated with
Turbo DNase according to the manufacturer’s protocols
(Ambion, Turbo DNA-free). DNase-free RNA (1 μg) is con-
verted to cDNA as per the manufacturer’s protocols (Qiagen),
using the “HighFlex” protocol, which allows measurement of
the levels of small RNAs and large RNAs simultaneously. PCR
cycling conditions are as per the manufacturer’s protocols.
Typically, we use primers against mRNA genes CDC-42, PMP-
3, and Y45F10D.4 for Geometric Means Normalization
(see Note 13).
244 Alexandre de Lencastre and Frank Slack

Fig. 3 Validation of expression of novel mi RNAs in aging C. elegans. The expres-

sion of four candidate miRNAs identified by deep sequencing was confirmed by
Taqman qRT-PCR. Consistent with their classification as miRNAs, their expres-
sion was significantly reduced in alg-1(gk214) mutant animals. The expression
of known miRNA let-7 is shown as a positive control (image reproduced from [4]
with permission from Elsevier)

4 Notes

1. RNA yields. Total RNA: 8 μg from 25 μl of packed pellet of

worms (~300 worms from one small (6 cm) plate). On large
plate (16 cm), 2500–3000 worms yielded ~100–150 μl packed
worm pellet, which yielded ~40–100 μg of RNA.
2. For maximum yield of eggs, bleach treat a plate enriched for
gravid adults. During bleach treatment, vortex tube every
~2 min and observe through microscope. Once gravid adults
rupture (body will bend and split), arrest bleach treatment by
adding 2 volumes of M9 buffer, spin down, and aspirate super-
natant. It is important to then wash bleached worm pellets at
least 4–6 times with M9 to remove any residual bleach.
3. Use reagent/conditions that do not deplete small RNAs (i.e.,
use regular TRIzol, not “LS TRIzol”). Make sure to use sili-
conized, RNase-free tubes throughout to prevent adsorption
of RNA to tubing. Glycogen or Glycoblue can be utilized as a
carrier to facilitate precipitation and visualization of RNA pel-
lets after precipitation. RNA pellets after precipitations should
be air-dried until ethanol is fully evaporated (~5–10 min) but
they should not be excessively dried, or the pellet will become
difficult to resuspend.
4. Cloning other small RNAs: Piwi-interacting RNAs (piRNAs,
i.e., 21U-RNAs) will be also cloned by this procedure. For
 microRNAs in Caenorhabditis elegans 245

cloning of other small RNAs, such as siRNAs, consider alterna-

tive protocols [23, 24].
5. Small RNA cloning considerations: To avoid biases in miRNA
representation, these are the most important factors to con-
sider during cloning: maintain similar conditions for 3′- and
5′-adapter ligation, use similar concentrations of input RNA
for all samples and avoid too many cycles of PCR after RT
extensions [25].
6. Additional (optional) parameters in quantifier.pl: Using the -g
option to allow mismatches between read and precursor map-
pings might allow the identification of interesting miRNAs iso-
forms (such as edited sites). Other possible options to consider
are -s star.fa, to compare sequences against a file of star
sequences from miRBase. This will allow the determination of
mature and star sequences mapping to the precursors. Options
-e and -f specify how far upstream (-e, default 2 nucleotides)
and downstream (-f, default = 5 nucleotides) of the mature/
star sequence the program should consider as a match to the
sequencing sequences.
7. As of version 2.0.4 of miRDeep, quantifier.pl normalizes
miRNA reads according to total number of miRNAs in each
sample. If one suspects that there might be biological reasons
for the total numbers of miRNAs to be different in different
samples, one might normalize against total number of genome-
matching reads. This can be done by recovering the raw
miRNA count number from the .csv file generated by quanti-
fier.pl. As an alternative, during RNA preparation one might
consider “spiking” the pool with a known amount of one or
more known oligonucleotide “calibrator” sequences (that do
not match the reference genome) and which can be used as a
normalization controls after sequencing [18, 26, 27].
8. Estimation of miRNA abundance: In general, it is not appro-
priate to compare the abundance of one miRNA versus another
within the same sample due to biases inherent to the small
RNA cloning procedures, and which depend on the secondary
structure and sequence of each miRNA [25]. These biases,
however, do not affect the estimation of the relative abun-
dances of each miRNAs between samples [25]. Therefore,
with appropriate controls and normalization it is generally pos-
sible to determine relative changes in expression of individual
miRNAs across different samples.
9. Statistical analysis of differential expression: In order to deter-
mine statistical significance of changes in expression of miR-
NAs read counts determined by miRDeep2, one can export
the .csv data into any of a number of tools for differential anal-
ysis of deep sequencing data, such as DESeq, DEGseq, edgeR,
baySeq, mirZ, and SAMseq [10–15].
246 Alexandre de Lencastre and Frank Slack

10. Analysis and curation of novel miRNA identifications by

miRDeep2: The reported miRDeep2 scores and associated
information is used to narrow down the top candidate, novel
miRNAs that should be further characterized. In particular, we
consider characteristics reported by miRDeep2 such as read
scores, secondary structure of putative precursor hairpins, and
homology with known miRNAs in other species. Manual cura-
tion is essential too. Although miRDeep2 attempts to exclude
reads that overlap with annotated regions of the genome, it is
important to confirm that the latest annotations are consistent
with possible miRNA classification. For example, miRNAs
should not exist within annotated coding region of an open
reading frame (either sense or antisense), and it is unlikely that
it would be encoded in 5′ or 3′ UTRs of a known gene.
Therefore, we manually perform blast analysis of candidate
miRNAs against the reference genome to ensure that a candi-
date miRNA does not overlap with already annotated regions
and also to discover possible overlap with annotated small
RNAs in other species. Sequences that survive this curation
process and exhibit good secondary structures characteristics
are then considered for validation by qRT-PCR.
11. Validation of novel miRNA expression: ALG-1 is a miRNA-
associated factor and it is known that functional ALG-1 is
required for mature miRNA accumulation [28]. Therefore, to
confirm that a putative novel miRNA is indeed expressed, we
check (a) if it is expressed by qRT-PCR, and (b) if its level is
reduced in alg-1(gk214) animals. In our experience, we observe
a two- to fivefold reduction in bona fide miRNA levels in alg-
1(gk214) mutants as measured by qRT-PCR.
12. Validation of differential expression of miRNAs obtained by
deep sequencing can be accomplished by typical methods of
RNA expression analysis, such as Northern analysis or qRT-
PCR. However, for miRNAs that are expressed at low levels,
especially candidate novel miRNAs, it will be difficult to mea-
sure their expression by Northern. Therefore, we typically vali-
date the expression of novel miRNAs using qRT-PCR.
13. Validation of differential expression of known miRNAs: The
advantage of quantitative PCR using miScript is that it allows
the quantification of small RNAs and large RNAs simultane-
ously from the same cDNA sample. This permits the use of
multiple RNAs as endogenous controls, allowing for better
normalization of data. We utilize the genes CDC-42, PMP-3,
and Y45F10D.4, and perform geometric means normalization
of our qRT-PCR data as recommended [29]. As an additional
endogenous control we utilize the small RNA, RNA6B
(Qiagen).
 microRNAs in Caenorhabditis elegans 247

Acknowledgement

Some C. elegans strains were provided by the CGC, which is

funded by NIH Office of Research Infrastructure Programs (P40
OD010440). We thank Dr. Giovanni Stefani and Dr. Masaomi
Kato for help with methods. A.d.L. was supported by a National
Research Service Award Postdoctoral Fellowship from the National
Institutes of Health (NIH; 1F32AG030851). F.J.S. was supported
by a Breakthroughs in Gerontology grant from the American
Federation for Aging Research, the Ellison Medical Foundation,
and the NIH (AG033921).

References

1. Bartel DP (2009) MicroRNAs: target recognition 12. Wang L, Feng Z, Wang X, Wang X, Zhang X
and regulatory functions. Cell 136:215–233 (2010) DEGseq: an R package for identifying
2. Esquela-Kerscher A, Slack FJ (2006) differentially expressed genes from RNA-seq
Oncomirs—microRNAs with a role in cancer. data. Bioinformatics 26:136–138
Nat Rev Cancer 6:259–269 13. Anders S, Huber W (2010) Differential expres-
3. Boehm M, Slack F (2005) A developmental sion analysis for sequence count data. Genome
timing microRNA and its target regulate life Biol 11:R106
span in C. elegans. Science 310:1954–1957 14. Li J, Tibshirani R (2013) Finding consistent
4. de Lencastre A et al (2010) MicroRNAs both patterns: a nonparametric approach for identi-
promote and antagonize longevity in C. ele- fying differential expression in RNA-Seq data.
gans. Curr Biol 20:2159–2168 Stat Methods Med Res 22(5):519–536
5. Brenner JL, Jasiewicz KL, Fahley AF, Kemp 15. Hardcastle TJ, Kelly KA (2010) baySeq: empir-
BJ, Abbott AL (2010) Loss of individual ical Bayesian methods for identifying differen-
microRNAs causes mutant phenotypes in sen- tial expression in sequence count data. BMC
sitized genetic backgrounds in C. elegans. Curr Bioinformatics 11:422
Biol 20:1321–1325 16. Brenner S (1974) The genetics of Caenor
6. Alvarez-Saavedra E, Horvitz HR (2010) Many habditis elegans. Genetics 77:71–94
families of C. elegans microRNAs are not 17. Lau NC, Lim LP, Weinstein EG, Bartel DP
essential for development or viability. Curr Biol (2001) An abundant class of tiny RNAs with
20:367–373 probable regulatory roles in Caenorhabditis
7. Miska EA et al (2007) Most Caenorhabditis ele- elegans. Science 294:858–862
gans microRNAs are individually not essential for 18. Hafner M et al (2012) Barcoded cDNA library
development or viability. PLoS Genet 3, e215 preparation for small RNA profiling by
8. Kato M, Chen X, Inukai S, Zhao H, Slack FJ next-generation sequencing. Methods 58:
(2011) Age-associated changes in expression of 164–170
small, noncoding RNAs, including microR- 19. Goecks J, Nekrutenko A, Taylor J, Team G
NAs, in C. elegans. RNA 17:1804–1820 (2010) Galaxy: a comprehensive approach for
9. Friedländer MR, Mackowiak SD, Li N, Chen supporting accessible, reproducible, and trans-
W, Rajewsky N (2012) miRDeep2 accurately parent computational research in the life sci-
identifies known and hundreds of novel ences. Genome Biol 11:R86
microRNA genes in seven animal clades. 20. Lim LP et al (2003) The microRNAs of
Nucleic Acids Res 40:37–52 Caenorhabditis elegans. Genes Dev 17:
10. Robinson MD, McCarthy DJ, Smyth GK 991–1008
(2010) edgeR: a Bioconductor package for dif- 21. Kato M, de Lencastre A, Pincus Z, Slack FJ
ferential expression analysis of digital gene (2009) Dynamic expression of small non-
expression data. Bioinformatics 26:139–140 coding RNAs, including novel microRNAs
11. Hausser J et al (2009) MirZ: an integrated and piRNAs/21U-RNAs, during Caenor
microRNA expression atlas and target prediction habditis elegans development. Genome Biol
resource. Nucleic Acids Res 37:W266–W272 10:R54
248 Alexandre de Lencastre and Frank Slack

22. Hofig KP, Feller A, Merz H (2007) New appli- by high-throughput sequencing. RNA 15:
cation for the LightCycler 480 system: qPCR- 992–1002
based microRNA-profiling. Biochemica:7–9 27. Farazi TA et al (2011) MicroRNA sequence
23. Pak J, Fire A (2007) Distinct populations of and expression analysis in breast tumors by
primary and secondary effectors during RNAi deep sequencing. Cancer Res 71:4443–4453
in C. elegans. Science 315:241–244 28. Grishok A et al (2001) Genes and mechanisms
24. Hafner M et al (2008) Identification of microR- related to RNA interference regulate expression
NAs and other small regulatory RNAs using of the small temporal RNAs that control C.
cDNA library sequencing. Methods 44:3–12 elegans developmental timing. Cell 106:23–34
25. Hafner M et al (2011) RNA-ligase-dependent 29. Hoogewijs D, Houthoofd K, Matthijssens F,
biases in miRNA representation in deep- Vandesompele J, Vanfleteren JR (2008)
sequenced small RNA cDNA libraries. RNA Selection and validation of a set of reliable
17:1697–1712 reference genes for quantitative sod gene
26. Fahlgren N et al (2009) Computational and expression analysis in C. elegans. BMC Mol
analytical framework for small RNA profiling Biol 9:9
 Chapter 19

Analysis of DNA Methylation by Pyrosequencing

Colin Delaney*, Sanjay K. Garg*, and Raymond Yung

Abstract
Pyrosequencing is a technique that uses a sequencing-by-synthesis system which is designed to quantify
single-nucleotide polymorphisms (SNPs). Artificial C/T SNP creation via bisulfite modification permits
measurement of DNA methylation locally and globally in real time. Alteration in DNA methylation has
been implicated in aging, as well as aging-related conditions such as cancer, as well as cardiovascular,
neurodegenerative, and autoimmune diseases. Considering its ubiquitous presence in divergent clinical
pathologies, quantitative analysis of DNA CpG methylation both globally and at individual genes helps to
elucidate the regulation of genes involved in pathophysiological conditions. The ability to detect and
quantify the methylation pattern of DNA has the potential to serve as an early detection marker and poten-
tial drug target for several diseases. Here, we provide a detailed technical protocol for pyrosequencing
supplemented by critical information about assay design and nuances of the system that provides a strong
foundation for beginners in the field.

Key words Pyrosequencing technique, DNA CpG methylation, Global methylation, Biomarker
detection, SNPs, Bisulfide conversation, Assay design

1 Introduction

Epigenetic changes are heritable alterations in DNA that affect gene

expression and function by mechanisms other than those from
changes in DNA sequence. While each cell in an organism shares the
same genetic material, epigenetic instructions define the expression
of a gene that is conserved in mitosis. Epigenetic mechanisms regu-
late many cellular processes including development, differentiation,
embryogenesis, X-chromosome inactivation, chromosomal stability,
and genomic imprinting [1–4]. A number of epigenetic processes
have been described including histone modification, chromatin
remodeling, micro RNAs, and DNA methylation. Epigenetic “drift,”
particularly T cell DNA demethylation, has been shown to contrib-
ute to immune dysfunction in aging. DNA methylation involves
addition of a methyl group at the 5th carbon of cytosines preceding

*
These authors made equal contributions to this work.

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4_19, © Springer Science+Business Media New York 2015

249
250 Colin Delaney et al.

Fig. 1 Methylation of cytosine to 5-methylcytosine. Cytosine preceding guanine

(CpG sites) is methylated on carbon 5 (shown in bold) in the presence of DNA
methyltransferase and SAM. SAM S-adenosyl methionine, SAH S-adenosyl
homocysteine

guanines (CpG dinucleotides), a modification catalyzed by DNA

methyltransferases (DNMTs). S-adenosylmethionine (SAM), an inter-
mediate product of methionine metabolism, acts as a methyl donor in
the process (Fig. 1). DNA methylation has also been implicated in
aging-associated diseases including cancer as well as neurodegenera-
tive and cardiovascular disease and autoimmune syndromes such as
lupus and rheumatoid arthritis (RA) [1, 5–7]. Therefore, it may be
possible to use DNA methylation as a biomarker for disease risk [1,
8–12]. Among several established methods for measuring DNA
methylation including HPLC, methylation-sensitive PCR, bisulfite
sequencing, and next-generation sequencing, pyrosequencing offers
a robust, versatile platform yielding rapid quantitative results without
the onerous time commitment, high costs, and technical difficulty of
alternative methods.

1.1 Principle Pyrosequencing uses a high-throughput platform that can inter-

of Pyrosequencing rogate many CpG sites within an amplicon in real time. The pyro-
sequencing platform is designed to detect single-nucleotide
polymorphisms, or SNPs, which can be artificially created at CpG
sites through bisulfite modification. Treating genomic DNA with
sodium bisulfite selectively converts cytosine to uracil; however,
5-methylcytosine is protected from deamination and the CG
sequence is preserved in downstream reactions (Fig. 2). The tech-
nology is distinct from Sanger sequencing, in which labeled dide-
oxynucleotides are incorporated randomly in the reaction
terminating extension of strands representative of each nucleotide
position; rather, pyrosequencing uses a sequencing-by-synthesis
system in which nucleotides are dispensed one at a time, incorpo-
rated into the extending strand and degraded prior to the next
nucleotide dispensation (Fig. 3).

1.2 The Pyrosequencing requires a single-stranded PCR amplicon that

Pyrosequencing serves as DNA template, four different enzymes including DNA
Enzyme Cascade polymerase, ATP sulfurylase, luciferase, and apyrase, and two
different substrates including adenosine 5′ phosphosulfate (APS)
and luciferin [13]. First, a sequencing primer is annealed to a
single-stranded DNA (ssDNA) template. Upon addition of a single
 CpG Methylation Detection Via Pyrosequencing 251

Fig. 2 Deamination of cytosine via sodium bisulfide conversion. (a) Deamination of cytosine to uracil is pre-
vented by methylation of the 5-carbon position of cytosine. (b) Methylated (above) and unmethylated (below)
CpG-containing DNA undergoes bisulfite conversion. Methylated cytosines are unchanged while unmethylated
cytosines are converted to uracil. Following PCR the cytosine is retained while uracil is converted to thymine.
*C denotes methylated cytosine. Pyrimidines involved in bisulfite conversion are bolded. NaHSO3 sodium
bisulfite, PCR polymerase chain reaction

Fig. 3 Enzyme cascade system in pyrosequencing. An ssDNA template is first hybridized with the sequencing
primer and mixed with enzymes (written in italics) and two substrates (APS and luciferin). After successful
incorporation of a nucleotide by DNA polymerase into a growing DNA strands, the released PPi reacts with APS
in the presence of ATP sulfurylase giving rise to ATP. ATP in the presence of substrate luciferin and enzyme
luciferase produces oxyluciferin that generates visible light, which can be detected by inbuilt CCD camera. Any
unincorporated nucleotides and ATP are degraded into its building blocks by enzyme apyrase prior to the next
nucleotide dispensation. Cascade reactions repeat for every dispensation. ATP adenosine triphosphate, APS
Adenosine 5′ phosphosulfate, PPi pyrophosphate

nucleotide, the DNA polymerase incorporates the dNTP into the

growing strand, releasing pyrophosphate (PPi). ATP sulfurylase then
generates ATP from the PPi and substrate APS, which activates
luciferase-mediated conversion of luciferin to the light-emitting
oxyluciferin. Light is given off proportionate to the amount of
252 Colin Delaney et al.

nucleotide added to the elongating strand and recorded by an

inbuilt CCD camera. Excess nucleotide is degraded by apyrase,
after which the next nucleotide is dispensed. Comparing the peak
light emission of incorporation of C or T at a CpG site within the
amplicon gives a precise measure of the amount of methylation at
that position within the sample.

1.3 Technical Genomic DNA is bisulfite converted, and then the region of inter-
Overview est is amplified via PCR. Incorporation of a single biotinylated
of Pyrosequencing PCR primer allows separation of the two strands of the amplicon
to create a ssDNA template for annealing of a pyrosequencing
primer and extension of the complementary strand by discrete dis-
pensation of nucleotides. This platform is PCR-based, yields rapid
results (i.e., within a single day if starting with PCR), and is highly
quantitative. Many different assays can be performed simultane-
ously (i.e., in a 96-well format, 96 different assays could be per-
formed on one sample, 96 samples could be analyzed with one
assay, or anything in between) and the time required is entirely
dependent on the number of dispensations needed to cover the
region of interest (approximately 5 min + 1 min/dispensation). In
addition, pyrosequencing technology can be used to interrogate
regulatory elements of specific genes [12, 14–16] or as a means of
estimating global methylation [17–19]. However, pyrosequencing
assays can be more difficult to design and extensive optimization
of these assays is required (see Subheading 4). Also, an emerging
pitfall of the system is that Bisulfite modification cannot discrimi-
nate between 5-methylcytosine and the novel modification
5-hydroxymethylcytosine. Nevertheless, pyrosequencing is a vali-
dated means of estimating both global methylation and specific
regulatory loci in mammalian samples (see Note 6).

2 Materials

2.1 Consumables Bisulfite conversion kit (available from multiple suppliers).

PyroPCR kit (Qiagen) or any reliable PCR kit.
96-Well skirted PCR plate, PCR plate stickers.
Agarose.
Ethidium bromide.
Streptavidin Sepharose High Performance beads (GE Healthcare).
PyroMark Gold Q96 Reagent Kit (Qiagen) contains enzymes,
substrates, and dNTPs for pyrosequencing reaction.
PyroMark Q96 HS Reagent Dispensing Tip (Qiagen).
PyroMark Q96 HS Nucleotide Tip (Qiagen)—for longer sequencing
reads >50 dispensations.
 CpG Methylation Detection Via Pyrosequencing 253

PyroMark Q96 HS Capillary Tip (Qiagen)—for short reads <50

dispensations.
PyroMark Q96 HS Plate (Qiagen).
gDNA of interest.
Control low-methylated gDNA.
Control high-methylated gDNA.
Sss1 methylase (NEB).
5-Azacytidine (Sigma).
PCR primers, one biotinylated and HPLC purified: 100 μM stock
in water or TE. Store at −20 °C.
Pyrosequencing primer(s): 0.5 μM in annealing buffer. Store at 4 °C.

2.2 Equipment PCR machine.

Agarose gel electrophoresis cell, power supply, UV imaging system.
Vacuum Prep work station.
96-Well plate heating block (not a PCR machine).
PyroMark MD pyrosequencer or equivalent.

2.3 Buffers 1× TAE: 40 mM Tris–Acetate, 1 mM EDTA, pH 8.

70 % EtOH.
Binding buffer: 10 mM Tris–HCl, 2 M NaCl, 1 mM EDTA, 0.1 %
Tween 20, pH 7.6. Store at 4 °C.
Annealing buffer: 20 mM Tris–Acetate, 2 mM MgAc2. Store at 4 °C.
Denaturation buffer: 0.2 N NaOH. Store at RT.
1× wash buffer: 10 mM Tris–acetate pH 7.6. Store at RT.
ddH2O.

3 Methods

3.1 Generating PCR 1. Isolate genomic DNA of interest.

Amplicon 2. Bisulfite modification of DNA of interest: Treating genomic
for Pyrosequencing DNA with sodium bisulfite selectively converts cytosine to ura-
cil; however, 5-methylcytosine is protected from deamination
and the CG sequence is preserved in downstream reactions
(Fig. 2). Many commercial bisulfite modification kits are
available for purchase. Follow the manufacturer’s instructions.
Use 250–1000 ng per conversion reaction and elute with
10–40 μL as appropriate.
3. PCR region of interest (i.e., regulatory element/promoter/
enhancer/etc.): Use primers designed specifically to bisulfite-
modified DNA. Use 25–100 ng DNA per reaction, 0.1 μM
254 Colin Delaney et al.

biotinylated, and 0.2 μM non-biotinylated PCR primers.

Designing primers for bisulfite-converted DNA may be more
difficult than unmodified DNA because the loss of cytosine
increases the degeneracy of the DNA and increases the likeli-
hood of mispriming (see Note 1).
4. Agarose gel verification of amplicon. Verify that you have a
single, strong band and no unincorporated primers. A robust
amplicon with no primer dimer is critical for success (see Note 2).

3.2 Isolation 1. Add 14 μL of 0.5 μM pyrosequencing primer in annealing

of Biotinylated ssDNA buffer into each appropriate well of a pyrosequencing plate
from PCR Amplicon (white, with clear bottoms).
for Pyrosequencing 2. Isolate single-stranded pyrosequencing template.
Template (a) In a skirted 96-well PCR plate mix together DNA + H2O to
a volume of 40 μL (amplicon DNA usually 5–10 μL per well).
(b) In a tube combine 40 μL binding buffer and 2 μL strepta-
vidin beads per well (e.g., 10 wells = 400 μL binding
buffer + 20 μL beads). For 96-well plate (4 mL + 200 μL
beads). Vortex.
(c) Add 40 μL of the WELL-MIXED binding buffer/bead
suspension to each well containing 40 μL of DNA/H2O in
PCR plate.
(d) Cover plate with plastic PCR sticker to prevent spilling.
Shake plate at RT at 1400 rpm for a minimum of 10 min
to allow streptavidin beads to bind biotin-labeled strand.
3. While plate is shaking, prepare vacuum prep station (Fig. 4).
(a) Add ~200 mL of water, 70 % ethanol, denaturation buffer,
and 1× wash buffer to the appropriate plastic trays.
(b) To activate the vacuum, turn on the vacuum pump, and
then turn on the switch on the vacuum station.
(c) Pass water through the filter probe vacuum system to
prepare the probes for separation.
(d) In a 96-well plate, add water in each of the wells that
correspond to the same position as your test samples to
make sure that the appropriate probes have good suction.
A well-functioning probe will clear a full well in about
10 s. If probe fails to suck out water, it is likely blocked by
salt buildup and should be replaced. Note the color of the
filter tip can be indicative of function. Brighter white tips
are usually newer and functional, while duller tips tend to
be older and less functional.
4. After vacuum prep station is ready and at least 10 min of shaking
has elapsed, stop the shaker. Immediately upon removing the
 CpG Methylation Detection Via Pyrosequencing 255

Fig. 4 A representative picture of vacuum prep station showing four different

trays, probe connected to vacuum system, and appropriate places for the 96-well
plates

plate from the shaker, place the probes into the plate and watch
to make sure all fluid is sucked out of the wells. Delay will give
beads time to settle out of solution, which will lower your
recovery of amplicon.
5. Transfer probes to the tray containing 70 % EtOH. Once fluid
is observed passing through the vacuum hose, count to 10 s to
wash away residual salts and unlabeled DNA.
6. Transfer probes to the tray containing denaturation buffer and
count to 10 as above. Amplicons are denatured and the unla-
beled DNA strands are removed from the sample, leaving a
ssDNA pyrosequencing template strand.
7. Transfer probes to the tray containing 1× wash buffer and
count to 10 to let the fluid drain through. The base in the pre-
vious step is neutralized, allowing the pyrosequencing reaction
to proceed at proper conditions.
256 Colin Delaney et al.

8. Position probes directly above the pyrosequencing plate that has

been seated in the appropriate orientation on the vacuum prep
station. Do not drop probes into the pyrosequencing plate
until the vacuum is disengaged lest the annealing primer/buffer
be suctioned out of the well. Turn off the vacuum and as soon
as pressure gauge has dropped to zero, lower the probes into
the pyrosequencing plate. Vigorously agitate the probes to
facilitate beads dropping from the filters into the annealing
buffer and pyrosequencing primer.
9. Remove the filter probes and place them in the waste water.
Shake as above to remove any excess beads/salts, and then pass
another 200 mL water through probes to rinse away salts.
Store the filter probes dry in an empty 96 tip rack.

3.3 Denaturation 1. Place pyrosequencing plate on a heating block pre-heated to

and Annealing 90 °C for 2 min. This eliminates any secondary structure in the
of Sequencing Primer single-stranded template that may interfere with primer anneal-
ing or enzymatic addition of nucleotides.
2. Remove plate from heat and let cool to RT. (Optional) Turn
off heater, but leave pyrosequencing plate on the block for
10 min. This step may facilitate sequencing primer binding by
allowing a slower cooldown.

3.4 Preparing Note that these steps can and should be performed when time permits
the Pyrosequencer in the above protocol to eliminate unwanted lag between preparation
of the sample and running the pyrosequencing reaction. It is advis-
able to input the assay into the software prior to strand separation.
1. Create a new assay within a folder in the CpG assay folder by
right-clicking the folder and selecting New Assay. Enter the
sequence to analyze in the appropriate field and click
“Generate Dispensation Order.” A theoretical program is dis-
played (see Note 3).
2. Turn on machine. It will take about 2 min to warm up and
establish communication with the computer. Wait for the info
light to begin blinking as an indicator of successful data
exchange.
3. Open PyroCpG software.
4. Under the CpG run folder, select the appropriate subfolder (if
applicable), right-click, and select “New Run.” Name the run.
5. Enter the relevant information (sample ID, assay, notes about
experiment, and type of dispensing tips used) into the PyroCpG
software for each well you are using for this run. Save often to
prevent data loss if software crashes before run commences.
6. Once all wells and assays are entered, select Volume Information
from the drop down Tools menu. Note the amount of enzyme,
substrate, and nucleotides to add to the appropriate dispensing
 CpG Methylation Detection Via Pyrosequencing 257

tips. Enzyme and substrate always go in black RDTs, while

nucleotides in CDTs or NDTs. Tips may be reused several
times, so label each tip with its contents (see Note 4).
7. Add enzyme, substrate, and nucleotides to their respective dis-
pensing tips, and place those tips in the correct slot of the
appropriate tip holder. See diagram for proper placement.
8. Place tip holder in upper chamber of pyrosequencer manually,
with enzyme and substrate tips toward the back of the machine.
9. Using the software, click “Open Process Chamber Lid” either
from the shortcut icon or from the Instrument drop-down
menu.
10. Cover a new pyrosequencing plate with clear plastic PCR
sticker to use to test the dispensation tips. This plate can be
reused ad infinitum if consistently maintained.
11. Place plate inside the lower chamber with the notch in the
upper left corner. Click “Close Process Chamber Lid” com-
mand either from the shortcut icon or from the Instrument
drop-down menu.
12. Test the dispensing tips by clicking “Test dispensing tips” icon
or from the Instrument drop-down menu. Make sure that your
stickered test plate is in position or the dispensations will dam-
age the camera. Each tip will dispense a small volume of fluid,
which will be visible on top of the sticker, validating that the tips
are functional. Do not click “Done” after the dispensation test
finishes until the hissing stops or the software may crash!
13. If all six drops are visible on the film, proceed with pyrose-
quencing. If one or more drops are absent, check to see if there
are bubbles in the tips by flicking them gently. Residual salts
from repeated use eventually will clog the tips. If tips are
blocked, discard and use a new tip. It is recommended to test
the dispensation tips twice, once the tips are ready and imme-
diately prior to starting the run, ensuring the tips have not
clogged in the interim.

3.5 Run 1. Once the plate has cooled to RT, open the process chamber
the Pyrosequencing door using the software, insert the plate in the correct orienta-
Reaction tion, and close the process chamber lid using the software.
2. Click “Run.” The length of the run is determined only by the
number of dispensations in the longest assay selected and is not
dependent on the number of wells used.

3.6 Cleanup 1. Immediately after all runs are finished, clean out dispensing tips
to prevent salt buildup and tip blockage. RDTs and CDTs can be
“milked”; that is, rinse and fill them with water, and then apply
pressure to squeeze water in a stream through the tip. NEVER
milk NDTs as the bore size of the tip is too small; rather, gently
258 Colin Delaney et al.

rinse the tip inside and out with water. Store tips upright in a
5 mL tube rack and avoid contact with the delicate tips, which
are easily bent/damaged.
2. Rinse out plastic trays from the vacuum prep station and allow
to dry.

3.7 Data Analysis While the pyrosequencer is running, the light trace for each well
detected by the camera is presented in real time, generating a pyro-
gram of peaks, the height of which indicate the stoichiometric
incorporation of nucleotides. Each non CpG peak becomes a
reference peak that the software uses to calculate the percent meth-
ylation of the sample (Fig. 5). However, quantitative analysis
cannot be performed until the run is finished.

Fig. 5 Representative pyrograms showing hypomethylation of the B1 element following 5-azacytidine treat-
ment. (a) Theoretical pyrogram generated by analytical software based on the input sequence to analyze for
B1 element pyrosequencing primer 2 (see Table 1). (b) Pyrograms of DNA isolated from T cells cultured in the
absence (control) or presence of cytosine analog 5-azacytidine, a known hypomethylating agent. The B1
“sequence to analyze 2” is shown bolded. Grey shaded areas indicate CpG sites, tan shaded bars indicate
bisulfite control dispensations. Percent methylation is indicated above each CpG site
 CpG Methylation Detection Via Pyrosequencing 259

1. Once the run is completed, the 96-well plate map is displayed.

Click wells of interest to see the pyrogram.
2. Click “Analyze all” found in the lower right corner of the display.
The software will measure the percent methylation at each
CpG site and perform quality control analysis of each run.
Quality control consists of using the non-CpG dispensations as
reference peaks and measuring how well they conform to the
theoretical pyrogram generated from the original sequence to
analyze input into the assay file. Tolerances are typically set
by the manufacturer. CpG sites that pass quality control are
indicated in blue, sites that are questionable due to deviation
from expected peak heights are yellow, and sites that fail are
marked red. It is common to observe different indicated results
within the same run and even within the same well at different
CpG sites.
To facilitate data analysis, right click on the pyrogram and
select “Show Histogram,” which underlays the theoretical
pyrogram beneath the real result. Also, “Show Reference
Peaks” allows elimination of problematic peaks from contrib-
uting to quality control analysis; for example, a long run of
nucleotide (>5) may not reach the theoretical peak height due
to limitations of detection.
3. Once the run is analyzed, export the raw data to a .txt file by
selecting Reports → Analysis Results → Save. The exported file
may be opened in spreadsheet format (semicolon delimited)
for further analysis, and includes percent methylation of each
CpG site, whether that site received a Pass/Check/Fail and
any applicable warnings, the mean methylation across the
entire sequence to analyze and various statistics.
4. To ensure that the assay is not biased toward methylated or
unmethylated DNA, validate the assay using a standard curve
of DNA with known methylation (see Note 5).

4 Notes

1. Assay design: Pyrosequencing assays require three steps—bisulfite

conversion of unmethylated cytosine to uracil, PCR to gener-
ate an amplicon biotin-labeled on one of the two strands, and
a pyrosequencing reaction to analyze the nucleotide content of
the amplified fragment. Following amplification, the PCR
product is purified and denatured, at which time the unlabeled
strand is removed to allow the pyrosequencing primer to
anneal efficiently to the single-strand template. Typically,
assays require at least three primers, a forward and reverse
PCR primer as well as a pyrosequencing primer. One and only
one of the PCR primers must be biotinylated so that the
260 Colin Delaney et al.

single-stranded template can be isolated prior to the pyrose-

quencing reaction, and the pyrosequencing primer must be
complementary to the biotin-labeled strand (i.e., if reverse
PCR primer is labeled, the pyrosequencing primer would be
oriented in the “forward” direction, and vice versa).
Alternatively, it is more economical and feasible to perform a
three-primer PCR incorporating a universal biotinylated
primer [20]. Also, to interrogate distant CpG sites on the
amplicon (greater than ~60 dispensations), multiple pyrose-
quencing primers may be raised against a single amplicon.
There are several software options available to assist in design-
ing pyrosequencing assays as well as companies willing to
design and validate custom assays.
2. Successful PCR conditions: In order to efficiently capture the
biotinylated strand from the amplicon, all biotinylated primer
must be incorporated into the PCR product. Unincorporated
biotinylated primer will compete with the amplicon during the
ssDNA isolation step prior to the pyrosequencing reaction and
interfere with the quantification of C/T ratios during the reac-
tion. Therefore, it is common to increase cycles in the PCR
step to 45 or greater and use lower concentration of labeled
primer to unlabeled primer (e.g., 0.1 μM biotin-primer vs.
0.2 μM unlabeled primer). Increasing the cycles also increases
the risk of amplification of unwanted DNA from the environ-
ment and care should be taken to minimize exposure to sources
of contamination.
3. Understanding and creating proper pyrosequencing assay files:
In many ways “pyrosequencing” is an unfortunate term
because it leads to confusion in scientists familiar with Sanger
sequencing. In contrast to Sanger method, pyrosequencing
uses sequencing by synthesis of an already known DNA
sequence that contains a SNP at a known position. A proper
pyrosequencing run requires entering this “sequence to ana-
lyze” into the operating software and indicating in that
sequence where the CpG sites are. For CpG methylation detec-
tion, inputting the bisulfite converted sequence is necessary.
Typically, indicating the cytosines of CpG sites with either a
“Y” (for pyrimidine) or “C/T” is understood by the software.
For example, a possible bisulfite-converted sequence to ana-
lyze could be ATTTGYGGAAAAAT, derived from the gDNA
sequence ACTTGCGGAAAAAC (Fig. 2). Note that if a bioti-
nylated forward primer is used, the pyrosequencing primer is in
the reverse orientation and the reverse complement sequence
must be input (e.g., in the case of the above sequence, the appro-
priate sequence to analyze would be ATTTTTCCRCAAAT,
where the “R” stands for purine or “A/G”). From the sequence
to analyze, the software generates a “dispensation order” that takes
 CpG Methylation Detection Via Pyrosequencing 261

into account the order of nucleotides in the sequence to analyze,

the length of runs of a single nucleotide, and controls to verify
successful bisulfite conversion and integrity of nucleotides. For
example, the sequence to analyze ATTTGYGGAAAAAT may
generate a dispensation order GATCGCTGAAT. The first G is
a negative control, followed by A producing a single-base peak,
the run of 3 T’s can be measured with a single dispensation of
T nucleotide, the first C is a negative control that verifies com-
plete bisulfite conversion, the G is a single-nucleotide peak, the
C followed by T is quantifying the CpG site of interest,
the next G produces a double-nucleotide peak, and the two A
dispensations ensure that the long run of A nucleotide is com-
pletely filled in. Incomplete synthesis interferes with down-
stream nucleotide incorporation, making data analysis difficult
or impossible.
Because nucleotide droplets are being added sequentially,
as the number of dispensations increases the volume of the
reaction increases accordingly. This volume effect dilutes the
enzyme and substrate reagents, lowering the signal to noise
ratio over time. It follows that there is a finite amount of dis-
pensations per run that will produce usable data. Often data
generated after 90–100 dispensations is not usable. It is advis-
able to use multiple sequencing primers in separate wells to
cover a large amplicon rather than attempt to analyze a large
region with one reaction.
4. Dispensing tip selection: Enzymes and substrates are always dis-
pensed from Reagent Dispensing Tips (RDTs). However,
there are different options for dispensing nucleotides, capillary
dispensing tips (CDTs) and nucleotide dispensing tips (NDTs).
CDTs are easier to maintain and as such may be better for
beginners; however, they dispense a larger volume droplet and
as such are not suited for longer dispensations >50. NDTs are
ideal for longer runs and may produce cleaner results because
they dispense smaller droplets, yet they are easier to clog and
are harder to clean and maintain.
5. Bias testing of pyrosequencing assays: Once an assay is initially
optimized to produce a robust amplicon and a clean pyrogram,
it is important to validate that the efficiency of the PCR reac-
tion is not altered by differing cytosine content at the CpG
sites contained within the region amplified. Differences in effi-
ciencies may skew results, potentially masking or overestimat-
ing differences between treatment groups. To check for PCR
bias, perform the pyrosequencing assay with amplicons gener-
ated from DNA with known methylation content. Start with
DNA from low methylated sources—whole genome amplified
or cloned plasmid DNA. Treat that DNA with Sss1 methylase
enzymes. Alternatively, low-methyl DNA and high-methyl
262 Colin Delaney et al.

Table 1
Primers and reaction conditions for the analyses of LINE1 (human) and B1 (mouse) elements

Line 1 (Human)
PCR primer (F): TTTTGAGTTAGGTGTGTGGGATATA Pyrosequencing primer (F):
PCR primer (R): biotin-AAAATCAAAAAATTCCCTTTC AGTTAGGTGTGGGATATAGT
Reaction conditions: 95 °C for 5 min; (95 °C 30 s, 50 °C 30 s, 72 °C 30 s) × 45 cycles; 72 °C for 5 min
Sequence to analyze: TTYGTGGTGYGTYGTTTTTTAAGTYGGTTTGAAAAGYGTA
B1 element (Mouse)
PCR primer (F): TGGTGGTGGTGGTTGAGAT Pyrosequencing primer 1 (F):
TGGTGGTGGTTGAGAT
PCR primer (R): Pyrosequencing primer 1 (R):
biotin-AATAACACACACCTTTAATCCCAA TTTGTAGATTAGGTTGGTTT
Reaction conditions: 95 °C for 15 min; (95 °C 30 s, 63 °C 30 s, 72 °C 30 s) × 45 cycles; 72 °C for
10 min
Sequence to analyze 1: AGYGTTTTTTTGTGTAGTTTTGGTTATTTTGGAATTTATTTTGTAGA
TTAGGTTGGTTTYGAATTT
Sequence to analyze 2: YGAATTTAGAAATTYGTTTGTTTTTGTTTTTRTTTTYGGAG

DNA are available commercially. Mix these two DNA samples

in known ratios to create a standard curve. If the results diverge
from linearity, the assay may be biased and must be
re-optimized.
6. Application: global methylation measurement: Global methyla-
tion analysis using pyrosequencing technology utilizes the
ubiquity of specific repetitive elements randomly inserted
throughout mammalian genomes. Often these elements num-
ber in the thousands. In humans, LINE1 and Alu elements
have been shown to be useful in measuring changes in global
methylation due to cancer, aging, and environmental stressors
[17, 21–24]. In mice, the B1 element as well as the intracister-
nal alpha particle (IAP) can detect changes in methylation in
cancer and/or cells treated with hypomethylating agents like
the cytosine analog 5-azacytidine [18, 19]. See Table 1 for the
primer sets and conditions reported to amplify these elements
as an estimate of global methylation.

5 Conclusion

Pyrosequencing provides a rapid, high-throughput means of detecting

methylation levels at individual loci or estimating global methylation
changes. Commercially available bisulfite conversion kits and
straightforward PCR amplification step make this technology acces-
sible at reasonable cost while avoiding onerous technical challenges
of next-generation sequencing or the delay and labor inherent in
 CpG Methylation Detection Via Pyrosequencing 263

cloning fragments for Sanger sequencing. The pyrosequencing

platform has been demonstrated to be a versatile means of quantify-
ing DNA methylation globally and at regulatory elements of meth-
ylation sensitive genes addition to its broader uses in SNP analysis,
association studies, and mutation screening. Thus, pyrosequencing
can help elucidate pathogenic dysregulation of gene expression in
methylation sensitive genes and advance the pace of biomedical
science. Recent advances have focused on high-throughput
whole-genome methylation analyses. However, the sensitivity of
these assays has not been compared with pyrosequencing.

Acknowledgement

This work was supported by National Institutes of Health National

Institute on Aging (AG020628, AG028268), National Institute of
Environmental Health Science (P30 ES017885), University of
Michigan (Claude D. Pepper Older American Independence
Center, Nathan Shock Center for the Basic Biology of Aging,
Rheumatic Disease Clinical Center, Caner Center Microarray
Core, Michigan Diabetes and Research Training Center Animal
Phenotyping Core), Geriatrics Research, Education and Clinical
Care Center (GRECC), and the VA Ann Arbor Healthcare System.
The content is solely the responsibility of the authors and does not
necessarily represent the official views of the National Institutes of
Health.

References
1. Portela A, Esteller M (2010) Epigenetic modi- 8. Lund G, Andersson L, Lauria M et al (2004)
fications and human disease. Nat Biotechnol DNA methylation polymorphisms precede any
28:1057–1068 histological sign of atherosclerosis in mice
2. Eden A, Gaudet F, Waghmare A et al (2003) lacking apolipoprotein E. J Biol Chem 279:
Chromosomal instability and tumors promoted 29147–29154
by DNA hypomethylation. Science 300:455 9. Jones PA, Baylin SB (2007) The epigenomics
3. Vera E, Canela A, Fraga MF et al (2008) of cancer. Cell 128:683–692
Epigenetic regulation of telomeres in human 10. Warnecke PM, Bestor TH (2000) Cytosine
cancer. Oncogene 27:6817–6833 methylation and human cancer. Curr Opin
4. Jaenisch R, Bird A (2003) Epigenetic regula- Oncol 12:68–73
tion of gene expression: how the genome inte- 11. Urdinguio RG, Sanchez-Mut JV, Esteller M
grates intrinsic and environmental signals. Nat (2009) Epigenetic mechanisms in neurological
Genet 33 Suppl:245–254 diseases: genes, syndromes, and therapies.
5. Ballestar E, Esteller M, Richardson BC (2006) Lancet Neurol 8:1056–1072
The epigenetic face of systemic lupus erythe- 12. Strickland FM, Hewagama A, Lu Q et al
matosus. J Immunol 176:7143–7147 (2012) Environmental exposure, estrogen and
6. Brooks WH, Le Dantec C, Pers JO et al (2010) two X chromosomes are required for disease
Epigenetics and autoimmunity. J Autoimmun development in an epigenetic model of lupus.
34:J207–J219 J Autoimmun 38:J135–J143
7. Kim M, Long TI, Arakawa K et al (2010) DNA 13. Ronaghi M, Uhlen M, Nyren P (1998) A
methylation as a biomarker for cardiovascular sequencing method based on real-time pyro-
disease risk. PLoS One 5, e9692 phosphate. Science 281:363–365
264 Colin Delaney et al.

14. Polansky JK, Kretschmer K, Freyer J et al and function in f1 mice. J Nutr 142:
(2008) DNA methylation controls Foxp3 gene 1329–1335
expression. Eur J Immunol 38:1654–1663 20. Royo JL, Pascual MH, Salinas A et al (2006)
15. Floess S, Freyer J, Siewert C et al (2007) Pyrosequencing protocol requiring a unique
Epigenetic control of the foxp3 locus in regula- biotinylated primer. Clin Chem Lab Med 44:
tory T cells. PLoS Biol 5, e38 435–441
16. Schoenborn JR, Dorschner MO, Sekimata M 21. Yang AS, Doshi KD, Choi SW et al (2006)
et al (2007) Comprehensive epigenetic profiling DNA methylation changes after 5-aza-2′-
identifies multiple distal regulatory elements deoxycytidine therapy in patients with leukemia.
directing transcription of the gene encoding Cancer Res 66:5495–5503
interferon-gamma. Nat Immunol 8:732–742 22. Bollati V, Baccarelli A, Hou L et al (2007)
17. Yang AS, Estecio MR, Doshi K et al (2004) A Changes in DNA methylation patterns in
simple method for estimating global DNA subjects exposed to low-dose benzene. Cancer
methylation using bisulfite PCR of repetitive Res 67:876–880
DNA elements. Nucleic Acids Res 32, e38 23. Bollati V, Schwartz J, Wright R et al (2009)
18. Jeong KS, Lee S (2005) Estimating the total Decline in genomic DNA methylation through
mouse DNA methylation according to the B1 aging in a cohort of elderly subjects. Mech
repetitive elements. Biochem Biophys Res Ageing Dev 130:234–239
Commun 335:1211–1216 24. Baccarelli A, Wright RO, Bollati V et al (2009)
19. Delaney C, Hoeltzel M, Garg SK et al (2012) Rapid DNA methylation changes after expo-
Maternal micronutrient supplementation sure to traffic particles. Am J Respir Crit Care
suppresses T cell chemokine receptor expression Med 179:572–578
 INDEX

A Biotinylate ........................................ 252, 253–256, 259, 260

Bisulfite ........................................... 250–253, 254, 258–262
Acquisition rate ................................................................. 82 Bivariate
Activation induced cytidine deaminase (AID) ........ 107–114 markers ........................................................................ 84
Acute respiratory distress syndrome .................................. 50 plot .............................................................................. 84
Adenosine 5΄ phosphosulfate (APS) ........................ 250, 251 Bleomycin .......................................................................... 23
Affinity maturation ......................................................... 200 Brefeldin A ............................... 15, 17, 55, 67, 71, 76, 77, 79
Ammonium chloride ....................................... 145, 147, 148 Burn injury ......................................... 36, 38, 39, 41, 44, 467
Amplicon ................................................. 202, 206, 207–209,
210, 215, 226, 230, 250, 252–255, 259–261 C
Amyloid P ......................................................................... 22
Cadmium (Cd) .................................................................. 85
Amyopathic antisynthetase syndrome ............................... 20
Caenorhabditis elegans............................................... 235–247
Angiogenesis ......................................................... 24, 25, 36
Carbonylation .......................................................... 155–172
Antibody............. 9, 10, 13, 14, 26, 27, 29, 42, 49, 50, 53, 54,
Carboxyfluorescein succinimidyl ester (CFSE) ..... 11, 16–17
55, 56, 60, 61, 62, 63, 67, 68, 71, 72, 75, 79, 84,
CCL2 .......................................................................... 23, 24
85, 86, 87–90, 93, 94, 99, 103, 105, 107–111, 117,
CCL3 ................................................................................ 23
121, 147, 148, 149, 179, 180, 220–222, 227
CCL18 .............................................................................. 23
concentration optimization .......................................... 55
CCR2 ................................................................................ 22
Antibody-dependent cell cytotoxicity (ADCC) ............ 9–10
CCR3 ................................................................................ 22
Application settings ............................................... 55–61, 63
CCR4 ................................................................................ 22
Apyrase .................................................................... 250–252
CCR5 .......................................................................... 22, 24
Arginine .......................................................................... 155
CCR7 ............................ 22, 68, 73, 74, 80, 84, 116, 117, 119
Asthma .............................................................................. 20
CCR9 ................................................................................ 22
Ataxia telangiectasia mutated (ATM) ............................. 176
CD3 .......... 11, 14–16, 17, 67–72, 79, 99, 116, 117, 183, 188
Ataxia telangiectasia mutated and Rad3-related
CD4 ........................ 73, 74, 77, 105, 116, 117, 119, 147, 148
(ATR) ............................................................ 176
CD8 ........................................................... 60, 61, 62, 73, 80
Atg3................................................................................. 145
CD9 .................................................................................. 22
Atg7................................................................................. 145
CD10 .......................................................................... 21, 22
ATP sulfurylase ....................................................... 250, 251
CD11b ........................................................................ 21, 22
Autoimmune thyroiditis .................................................... 20
CD11c .......................................... 21, 22, 67, 69, 72, 99, 105
Autophagosome....................................... 144–146, 150, 151
CD11d .............................................................................. 21
Autophagy ............................................... 143–145, 146, 151
CD13 .......................................................................... 21, 22
5-Azacytidine .................................................. 253, 258, 262
CD14 .................... 21, 22, 70, 82, 83, 99, 101, 104, 183, 188
CD16 ................................... 9, 11, 14, 15, 17, 21, 22, 70, 99
B
CD16/32 ........................................................................... 21
Bacterial colonization ............................................ 41, 45, 46 CD19 ........................................................ 99, 108, 111, 113
Bafilomycin ............................................................. 145, 151 CD20 .............................................................. 69, 72, 73, 99
Barcode....................... 82, 206, 210, 214, 223–225, 226, 230 CD27 .................................................................. 73, 84, 113
Barium ............................................................................... 86 CD28 .......................................................... 73, 80, 116, 148
Basic fibroblast growth factor (b-FGF) ............................. 24 CD29 ................................................................................ 22
B cell.................................................... 66, 68, 69, 71, 73, 84, CD33 .................................................................... 82, 83, 89
86, 88, 89, 107–114, 116, 144, 199–217, 219–230 CD34 .......................................................................... 20–22
B cell isolation ......................................................... 108–109 CD35 ................................................................................ 22
B cell receptor (BCR) ................... 9, 144, 199–201, 204, 206 CD36 ................................................................................ 22
Bicinchoninic acid protein assay ...................................... 132 CD44 ................................................................................ 22
β1-integrin......................................................................... 22 CD45 ............................................. 20–22, 25, 26, 29, 30, 99

Albert C. Shaw (ed.), Immunosenecence: Methods and Protocols, Methods in Molecular Biology, vol. 1343,
DOI 10.1007/978-1-4939-2963-4, © Springer Science+Business Media New York 2015

265
 IMMUNOSENECENCE: METHODS AND PROTOCOLS
266 Index

CD45RA ................................................... 84, 116, 117, 119 Cryopreserved ........................ 14, 17, 88, 111, 113, 182, 188
CD45RO......................................................................... 116 CXCL12 ........................................................................... 23
CD49 ................................................................................ 22 CXCR4 ................................................................. 21–23, 29
CD56 ............................................... 9, 11, 14, 15, 16, 69, 99 Cysteine ................................................................... 155, 156
CD57 ..................................................... 9, 10, 13, 14, 15, 17 CyTOF........................................................................ 82–84
CD62L ...................................................................... 88, 116 Cytokine
CD68 ................................................................................ 22 inteferon-γ (IFN-γ) ............................... 10, 12, 116, 121
CD80 .......................................................................... 21–23 interferon-α (IFN-α) ................................................... 67
CD81 ................................................................................ 22 interleukin-6 (IL-6)............................................... 23, 72
CD85j.......................................................................... 12, 14 tumor necrosis factor-α (TNF-α) ................................ 24
CD86 .......................................................................... 21–23 Cytomegalovirus (CMV) .......................... 10, 116, 182, 183
CD94 .............................................................. 10, 12, 13, 14 Cytosine ................... 107, 249–251, 253, 254, 258, 259–262
CD95 .............................................................. 68, 73, 76, 80 Cytotoxic ........................................ 9, 10, 12, 14–16, 23, 116
CD105............................................................................... 22
CD107a ........................................................... 10, 12, 14, 17 D
CD108W .......................................................................... 24 Data dual calibration ............................................. 83, 88, 90
CD112......................................................................... 10, 85 Decorin........................................................................ 22, 24
CD115............................................................................... 22 Deep sequencing ...................... 236–237, 239–242, 244–246
CD123................................................................... 69, 72, 99 Degranulation........................................................ 10, 12, 14
CD127....................................................... 74, 116, 117, 119 Dendritic cell (DC)
CD127 (IL-7 receptor) ............................................. 74, 116 myeloid DC ........................................................... 69, 70
CD155............................................................................... 10 plasmacytoid DC ............................................. 69, 70, 78
CD163......................................................................... 21, 22 Dermis ......................................................................... 37–39
CD164............................................................................... 22 Detergent extraction ............................................................ 2
CD172a ............................................................................. 22 Detergent-resistant membrane (DRM)............................... 2
CD206............................................................................... 22 4, 4’-Dianilino-1,1’-binapthyl-5,5’-disulfonic
CD209............................................................................... 22 acid ........................................................ 156, 159
Cell aggregates ............................................................ 82, 83 Differential gene expression ............................................ 236
Cell cycle ............................................................. 74, 88, 175 Differentiation .................................... 10, 21–23, 73, 88, 249
Cell length ................................................................... 82, 83 Digital flow cytometry................................................. 53–64
Cellular stress ............................................................ 10, 143 Digital imaging.................................................................. 98
Central memory CD8+ T cell ......................................... 117 Dinitrophenyl hydrazine (DNPH) .................................. 156
Centrifugation .............................. 1–6, 68, 78, 117, 148, 182 Disulfide .................................................................. 155–172
Chelator............................................................................. 82 Diversity ............ 181, 182, 195, 199, 200, 208, 219, 220, 229
Chemokine ..................................... 1, 21–23, 25, 35, 73, 116 DNA damage response (DDR) ....................... 175–180, 235
Chloroquine .................................................................... 151 DNAM-1 .............................................................. 10, 12–14
Cisplatin ............................................................................ 82 DNA methyltransferases (DNMTs)................................ 249
Class switch recombination (CSR).......................... 107, 200 DNA polymerase.............................. 183, 191, 192, 250, 251
Clonality score ......................................................... 228, 229 Dy164................................................................................ 84
Clonotype ........................................................................ 182
Coalescence ......................................................................... 2 E
Collagen ...................................................................... 21, 29
E47 .................................................................................. 107
Collagen-Iα (Col-Iα) ........................................................ 23
Effector memory CD8+ T cell ................................ 116, 117
Compensation ................ 28, 53, 54, 61–63, 82, 86, 103, 113
Electrophoresis ............................ 5, 161–162, 171, 183–187,
Compensation matrix .................................................. 61, 63
192, 196, 201, 202, 208, 209, 222–225, 238, 253
Complementarity-determining region 3
Endotoxin ............................................................................ 3
(CDR3) .......... 181, 182, 194, 212, 220, 227, 228
Endotoxin-free .................................................................... 3
Complementarity determining region 3 heavy chain
Eotaxin .............................................................................. 22
(CDR-H3) ........................................... 181, 200,
Epidermis .................................................................... 36–39
201–206, 211, 212, 213, 220
Epigenetic ....................................................................... 249
Concanavalin A ....................................................... 124, 125
Epitope ...................................................... 89, 181, 182, 190
Contracture ....................................................................... 39
Excisional wound injury ............................ 36, 37, 40, 43–45
CpG methylation ............................................................ 260
Exhausted memory B cell ................................................ 113
CpG oligodeoxynucleotide ............................. 108–111, 113
Exonuclease ............................................................. 220, 227
 IMMUNOSENECENCE: METHODS AND PROTOCOLS
Index
267

Extracellular matrix (ECM) ................. 20–22, 24, 25, 30, 36 HLA-DR .............................................................. 67, 70, 99
Extracellular signal-related kinase (Erk)............................ 22 Homologous recombination repair .................................. 175
Hyaluronan.................................................................. 22, 24
F Hydrophobicity ....................................................... 156, 212
Fcγ receptor ................................................................. 21, 22 5-Hydroxymethylcytosine ............................................... 252
Fibroblast ........................................................ 19, 21, 24, 36 Hypodermis ................................................................. 37–39
Fibroblast activation protein (FAP) ................................... 22
Fibrocyte ..................................................................... 19–30 I
Fibronectin ........................................................................ 22 Idiopathic pulmonary fibrosis ...................................... 20, 23
Fibrosis ................................................. 19, 20, 23, 24, 25, 39 IFN-γ ................................................................................ 15
Flagellin........................................................... 100, 102, 105 IFN-γ-IL-10 ratio................................................... 121, 122
Flotillin................................................................................ 6 IgA ................................................... 113, 205, 206, 211, 214
Flow cytometry...................................... 9–18, 21, 26–29, 41, IgD ...................................................................... 68, 73, 113
47, 53–82, 87, 89, 98, 99, 108, 109, 110, 113, IgG ................ 21, 25, 113, 117, 118, 205, 206, 211, 214, 215
115–119, 181, 182, 203 IgM memory B cell ......................................................... 113
Fluorescein-5-thiosemicarbazide (FTC)......... 160, 167, 169 IL-4 ..................................................................... 22, 23, 116
Fluorescence recovery after photobleaching IL-17 ......................................................................... 67, 116
(FRAP) ...................................................... 97, 98 IL-7-receptor-alpha (CD127) .............. 68, 74, 116, 117, 119
Fluorescence resonance energy transfer Imiquimod....................................................... 66, 69, 70, 72
(FRET) ...................................................... 97, 98 Immunoblotting .............................................................. 2, 6
Fluorescent in situ hybridization Immunoglobulin
(FISH) ................................... 176–177, 190–191 constant region .......................................................... 204
Fluorochrome diversity region .................................................. 199, 220
Alexa-700 .................................................................... 54 framework region....................................................... 221
APC (allophycocyanin) ......................................... 54, 60 heavy chain ........................................................ 199, 219
FITC (fluorescein isothiocyanate) ......................... 54, 56 isotype ............................................... 204, 206, 219, 220
PE (phycoerythrin) ........................................ 54, 56, 105 joining region............................................................. 200
Forward scatter ................... 14, 15, 27, 28, 30, 56, 57, 70, 82 leader sequence .......................................................... 221
Foxp3 ................................................................................. 74 light chain
G kappa ........................................................... 200, 206
lambda ......................................................... 200, 206
Gene rearrangement ................................ 220, 221, 223–226 variable region ........................................................... 214
Global methylation .................................................. 252, 262 Immunological synapse ....................................................... 2
Glutathione ..................................................................... 155 Immunome ...................................................................... 219
Glycerophospholipids .......................................................... 2 Immunoprecipitation ........................................................... 5
Gr1 .................................................................................... 21 Immunoreceptor tyrosine-based inhibitory
Gradient ......................................... 1–6, 11, 12, 89, 100, 182 motif (ITIM) ................................................... 22
Granulocyte-macrophage colony stimulating factor Immunostaining .............................................. 144, 146–150
(GM-CSF) ...................................................... 24 In115 ................................................................................. 85
Granzyme A ...................................................... 14, 130–132 Indoleamine oxidase .......................................................... 24
Granzyme B ...................................................... 14, 121–140 Influenza virus .................. 121, 122–123, 124, 127, 128, 135
Inhibitors ........................................... 2–6, 17, 109, 112, 145,
H
146, 147, 150–152, 158, 159, 171, 183, 188, 195,
Hairpins .......................................................... 240, 242, 246 201, 203, 237
γ-H2AX .......................................................... 176, 177, 179 Innate lymphoid cells .......................................................... 9
Heat shock .......................................................................... 3 Intercalator .................................................................. 82, 83
Heavy metal ions ............................................................... 81 iridium ................................................................... 92, 94
Hemagglutination inhibition assay .......................... 108, 109 Intercellular adhesion molecule-1 (ICAM-1) ............. 22, 23
Hemagglutination units................................... 122, 135, 136 Interferon-γ ............................................................... 24, 121
Heparin .......................................... 11, 17, 26, 116, 118, 182 Interferon-γ (IFNγ)................................................... 24, 134
Hepatocyte growth factor (HGF) ..................................... 24 Interleukin-2 (IL-2) .............................................. 11, 67, 78
High-throughput DNA sequencing ........................ 219–230 Interleukin-4 (IL-4) ............................................ 22, 23, 116
High throughput sequencing.......................... 182, 201–204, Interleukin-6 (IL-6) .............................................. 23, 67, 72
206–212, 213, 220, 221, 222, 228, 229, 230 Interleukin-8 (IL-8) .................................................... 23, 24
 IMMUNOSENECENCE: METHODS AND PROTOCOLS
268 Index

Interleukin-10 (IL-10) ...................................... 23, 121, 134 M

Interleukin-12 (IL-12) ...................................................... 22
Interleukin-13 (IL-13) ................................................ 22, 23 Mac2 ................................................................................. 22
Interleukin-17A (IL-17A) ................................................ 22 Macroautophagy...................................................... 143–153
Interleukin-1β (IL-1β) ................................................ 23, 24 Macroautophagy flux ................ 144, 145, 146, 150, 151, 152
Intracellular cytokine staining (ICS) ............... 76–78, 92–93 Macrophage ............. 19, 21, 24, 36, 65, 68, 70, 111, 143, 144
6-Iodoacetamidofluorescein .................................... 156, 160 Major histocompatibility class I (MHC I) ........................ 21
Ionomycin.................................................................... 15, 79 Major histocompatibility class II (MHC II) ..... 21, 115, 143
IRF1 .................................................................................. 99 Maleimide ......................................................................... 82
IRF3 .................................................................................. 99 Mass cytometry ........................................................... 81–95
IRF5 .................................................................................. 99 Mass window .............................................. 81, 83, 84, 85, 87
IRF7 .................................................................................. 99 Matrix metalloproteinase (MMP) ..................................... 24
Isoleucine-Glutamate-Proline-Aspartate-paraNitroanalide Mean fluorescence intensity ........................................ 10, 55
(IEPDpNA).................... 122, 125, 127, 130, 131 Mediator of DNA damage checkpoint 1 (MDC1) ......... 176
Isotype control ................................................. 15, 16, 26, 28, Membrane ....................................................... 1, 2, 6, 24, 29,
29, 30, 101, 103, 117, 118 47, 83, 144, 145, 147, 149, 152, 181, 210
Mesenchymal progenitor ................................................... 20
J Metastasis .................................................................... 20, 24
5-Methylcytosine ............................................ 250, 252, 253
Junctional (N) nucleotides ....................................... 220, 227
microRNAs ............................................................. 235–247
K Microtubule-associated protein 1 light chain 3 (LC3) .... 144
MMP9 .............................................................................. 24
Keratinocytes ............................................................... 35, 36 MOI. See Multiplicity of infection (MOI)
Ketamine ............................................................... 40, 43, 44 Monensin .................................................................... 15, 17
Ki67 ....................................................................... 67, 74–76 Monocyte .................................................. 20–22, 24, 65, 66,
KIR receptor ...................................................................... 12 68–72, 82, 83, 88, 89, 98, 99, 101–104, 111, 116
Monocyte chemotactic protein-1 (MCP-1) ................ 22, 23
L Mre11/Rad50/Nbs1 complex .......................................... 176
Lanthanide mTOR ............................................................................... 21
Eu ................................................................................ 87 Multiparameter............................................................ 81–95
Gd ............................................................................... 87 Multiphoton imaging ........................................................ 97
La139 .................................................................... 86, 87 Multiplexing .............................................................. 81, 238
Nd ............................................................................... 87 Multiplicity of infection (MOI) ......... 79, 122, 125, 134, 135
Pr141 ........................................................................... 87 Myofibroblasts ............................................................. 23, 24
Laplace smoothing .......................................................... 229
Leukocyte specific protein-1 (LSP-1) ................... 21, 22, 29
N
Leupeptin ........................................................ 145, 146–148 Naïve B cell ............................................................... 73, 214
Light chain 3 (LC3) ................................ 144, 145, 146–153 Naïve CD8+ T cell .................................................. 116, 117
Lipid rafts ........................................................................ 1–6 Nanocrystals ...................................................................... 85
Lipopolysaccharide (LPS) ............................ 3, 66, 69, 70, 72 Natural cytotoxicity receptor (NCR) ........................... 10, 12
Luciferase .......................................................... 23, 250, 251 Natural killer (NK) cell.................................... 9, 65, 68, 116
Luciferin .................................................................. 250, 251 Nd142 ............................................................................... 84
Lymphocyte Nephrogenic systemic fibrosis ........................................... 20
antigen-specific T lymphocyte..................................... 78 Neutrophils.................................................... 1–6, 35, 68, 99
B lymphocyte............................................................... 65 Neutrophil stimulation .................................................... 3–4
central memory T lymphocyte ............................. 74, 117 Next generation sequencing (NGS) ..... 27, 42, 200, 201, 262
effector memory T lymphocyte ................................. 144 NF-κB ................................................ 99, 101, 102, 103, 104
marginal zone B lymphocyte ....................................... 73 NGS. See Next generation sequencing (NGS)
memory B lymphocyte ........................................ 73, 113 Nitrogen cavitation .............................................................. 6
proliferation ........................................................... 74, 76 NK cell ............................... 9–18, 65, 66, 68, 69, 70, 88, 111
regulatory T lymphocyte.............................................. 74 activating receptors ...................................................... 12
T lymphocyte ...................................................... 71, 144 inhibitory receptors...................................................... 12
Lysine .............................................................................. 155 NKG2A ...................................................... 10, 12, 13, 14, 17
Lysosome ................................................. 144, 145, 150–152 NKG2C ........................................................... 10, 12–14, 17
 IMMUNOSENECENCE: METHODS AND PROTOCOLS
Index
269

NKG2D .......................................................... 10, 12, 13, 14 Pulmonary hypertension.................................................... 20

NKp30............................................................. 10, 12, 13, 14 Punch biopsy ............................................. 37–41, 43, 44–46
NKp44............................................................................... 12 Puncta ..................................................................... 150, 153
NKp46............................................................. 10, 12, 13, 14 Pyrogram ......................................................... 258, 259, 261
Non-homologous end-joining repair ............................... 175 Pyrophosphate ............................................................. 2, 251
Nonhuman primate ..................................................... 65–80 Pyrosequencing........................................................ 249–263

O Q
Oxidation .................................................... 85–87, 155–157 Quantitative PCR ........................................................... 246
Oxidative stress................................................ 156, 157, 163 Quantitative RT-PCR ..................................................... 243
Quantum dots (Qdots) ...................................................... 85
P
R
Panniculus carnosus ........................................................... 37
Paranitroanalide............................................... 122, 125, 136 5’ Rapid amplification of cDNA ends (5'RACE) ............ 221
P53 binding protein-1 (53BP1)....................... 176, 177, 179 Receptor editing .............................................................. 220
PBMC. See Peripheral blood mononuclear cell (PBMC) Receptors .................................. 1, 2, 9, 10, 12, 13, 21, 22, 23,
PCR. See Polymerase chain reaction (PCR) 66, 69, 71, 73, 74, 116, 181–196, 219, 220, 226
PD-1 ................................................................................. 88 Remodeling phase ....................................................... 35, 36
Pellet .................................................. 4, 6, 12, 13, 16, 17, 26, Repertoire ......................... 181–196, 199–217, 219–230, 235
48, 69, 78, 100, 101, 129, 137, 148, 149, 164, 165, Retrovirus ........................................................................ 178
167, 168, 172, 237, 238, 244 Rhesus macaque .............................................. 66–69, 73, 74
Pentraxin ........................................................................... 22 Rheumatoid arthritis ................................................. 20, 250
Perforin........................................................................ 12, 14
S
Peripheral blood mononuclear cell (PBMC) .............. 12–17,
26–28, 30, 54, 56, 57–64, 68–70, 72, 73, 75, 78, S-adenosyl homocysteine ................................................ 250
79, 81–95, 98, 100, 101, 108, 111, 113, 117–119, S-adenosylmethionine (SAM) ........................................ 250
121, 122–125, 127, 128, 134, 182, 188, 223 Scleroderma ................................................................. 20, 23
Perlecan ............................................................................. 22 Semaphorin 7a (Sema 7a)...................................... 22, 23, 24
Phenotype .................................. 9–18, 23, 30, 115–119, 236 Senescence ........................................................... 65–80, 175
Phorbol 12-myristate 13-acetate (PMA) ........ 15, 79, 89, 90 Senescence associated mutation prone............................... 23
Phosphatidylethanolamine .............................................. 145 Shelterin .......................................................................... 176
Phosphoinositol-3-kinase (PI3 kinase) ............................. 21 Side scatter ...................................................... 14, 15, 27, 28,
Piwi-interacting RNAs (piRNAs) ................................... 244 30, 57, 70, 82, 98, 118, 177, 179
Platelet derived growth factor (PDGF) ............................. 24 Single cell analysis ............................................. 81, 181–196
Platelets ............................................................... 24, 35, 137 Single cell PCR ....................................................... 195, 221
Plexin C1........................................................................... 23 Single nucleotide polymorphisms (SNPs) ....... 250, 260, 263
Pluripotent ........................................................................ 24 α-Smooth muscle actin (α-SMA) ............................... 22, 23
Polymerase chain reaction (PCR) ............................. 50, 108, S-nitrosylated .................................................................. 155
109, 112, 182, 183, 187, 188, 189–193, 195, 196, Somatic hypermutation (SHM) ..................... 107, 200, 220,
200, 201–213, 221–230, 237, 243, 245, 246, 221, 222, 227, 228
250–257, 259–262 Spectral overlap ........................................................... 54, 61
POT1- and TIN2-organizing protein (TPP1) ........ 176, 177 Spectratyping............. 181, 200, 201, 202, 204, 205, 206, 213
Primer....... 109, 112, 182, 183–187, 190–193, 195, 202, 203, Sphingomyelin .................................................................... 2
204, 205–207, 208, 211, 213, 214–216, 221–226, Staphylococcus aureus ........................................................... 45
230, 237, 243, 250, 251–253, 254, 256, 258, 259, S-thiolated ....................................................................... 155
260, 261, 262 Stromal derived factor-1 (SDF-1) ..................................... 23
Proliferative phase ............................................................. 36 Sucrose ......................................... 3–5, 6, 125, 126, 177, 178
Proline ............................................................................. 155 Sulfenic acid .................................................................... 155
Prolyl-4-hydroxylase .......................................................... 22 Sulfinic acid ..................................................................... 155
Protection of telomeres 1 (POT1) ........................... 176, 177 Sulfonic acid .................................................................... 155
Protein .................................. 6, 21, 22, 24, 42, 48, 74, 76, 79, Supernatant ....................................... 4, 6, 12, 13, 16, 26, 48,
125, 127, 129, 131, 132, 133–134, 136, 137, 140, 63, 68–73, 75, 77, 78, 79, 92, 100, 101, 102, 111,
144–149, 151, 152, 155–172, 176, 201, 219, 227 121–123, 127, 128–129, 134, 137, 148, 162, 164,
Pseudomonas aeruginosa ................................................ 45–46 165, 167, 168, 178, 244
 IMMUNOSENECENCE: METHODS AND PROTOCOLS
270 Index

Superoxide dismutase ...................................................... 157 Transforming growth factor β1 (TGF-β1) ............ 22, 23, 24
Switched memory B cells ........................................ 107–114 TRF1-interacting protein 2 (TIN2) ................................ 176
Triton X-100 .................... 4, 6, 125, 126, 129, 183, 189, 201
T Tumor necrosis factor (TNF) ...................................... 22, 24
T cell ......................................... 2, 23, 24, 66, 68, 69, 73, 74, Tumor necrosis factor-α (TNF-α) ......................... 12, 14, 15
76, 77–80, 86, 88, 89, 111, 115–119, 143–153,
U
181–196, 219, 226, 249, 258
T cell receptor (TCR) Uracil ................................................ 107, 250, 251, 253, 259
diversity region .......................................................... 181
joining region..................................................... 200, 213 V
TCR alpha .......................... 181, 187, 189, 191, 192, 195 Vaccination
TCR beta.................................... 181, 187, 190, 191, 194 influenza ............................................................ 108, 110
variable region ........................................................... 214 salmonella .................................................................. 108
Tellurium (Te) ................................................................... 85 Streptococcus pneumoniae ............................................. 108
Telomere .................................................................. 175–180 tetanus ....................................................................... 108
Telomere dysfunction induced DNA damage foci Vascular endothelial growth factor (VEGF)...................... 24
(TIFs) .................................................... 176, 177 Vβ frequency analysis ...................................................... 181
Telomeric-repeat-binding factor 1 (TRF1) ..................... 176 Versican ....................................................................... 22, 24
Telomeric-repeat-binding factor 2 (TRF2) ............. 176, 177 Viability ........................................ 12, 13, 16, 17, 82, 99, 125
Tenascin............................................................................. 22 Vimentin ..................................................................... 22, 29
Tetramer .................................................... 75, 182, 183, 188 Vinblastine .............................................................. 146, 151
T-helper 1 ........................................................................ 116
T-helper 2 ........................................................................ 116 W
T-helper 17 ...................................................................... 116
Wound closure, measurement of............................ 41, 46–47
Thiocarbazide .................................................................. 156
Wound contraction ...................................................... 23, 25
Thiol.................................................................. 83, 155, 156
Wound healing ................................................ 35–39, 43, 45
Th1 T cell .......................................................... 22, 116, 151
Wound tissue
Th2 T cell .......................................................... 22, 116, 151
flow cytometry ............................................................. 41
Th17 T cell ...................................................................... 116
formalin fixation .................................................... 42, 48
Thy1.1 ............................................................................... 22
immunofluorescence .............................................. 42, 49
Tm169 ............................................................................... 84
OCT embedding ................................................... 42, 48
Toll-like receptor (TLR) .............. 23, 55, 66, 69, 79, 98, 144
preparation and isolation ....................................... 40, 43
TLR4................................................................... 69, 105
protein isolation ..................................................... 42, 48
TLR7........................................................................... 69
RNA isolation........................................................ 41, 48
Total body surface area (TBSA) .................................. 39, 44
Trafficking ......................................................... 2, 20, 23, 25 X
Transcriptional repressor/activator protein
(RAP1) .......................................................... 176 Xylazine ................................................................. 40, 43, 44