Pesq. Vet. Bras.

40(8):598-603, August 2020

DOI: 10.1590/1678-5150-PVB-6466

Original Article
Livestock Diseases
ISSN 0100-736X (Print)
ISSN 1678-5150 (Online)

PVB-6466 LD

Phenotypic and molecular characterization of

erythromycin resistance in Campylobacter jejuni and
Campylobacter coli strains isolated from swine and
broiler chickens1
Thomas S. Dias2*, Leandro S. Machado2,3 , Julia A. Vignoli3, Nathalie C. Cunha3,
Elmiro R. Nascimento2,3, Virginia Léo A. Pereira2,3 and Maria Helena C. Aquino2,3
ABSTRACT.- Dias T.S., Machado L.S., Vignoli J.A., Cunha N.C., Nascimento E.R., Pereira V.L.P.
& Aquino M.H.C. 2020. Phenotypic and molecular characterization of erythromycin
resistance in Campylobacter jejuni and Campylobacter coli strains isolated from swine
and broilers. Pesquisa Veterinária Brasileira 40(8):598-603. Faculdade de Veterinária,
Universidade Federal Fluminense, Rua Vital Brazil Filho 64, Niterói, RJ 24230-340, Brazil.
E-mail: [email protected]
Campylobacter spp. is a bacterial agent that causes gastroenteritis in humans and may trigger
Guillain-Barré Syndrome (GBS) and is also considered one of the main foodborne diseases
in developed countries. Poultry and pigs are considered reservoirs of these microorganisms,
as well as raw or undercooked by-products are often incriminated as a source of human
infection. Treatment in human cases is with macrolide, such erythromycin, that inhibits the
protein synthesis of the microorganism. This study aimed to isolate Campylobacter jejuni
and Campylobacter coli from intestinal content samples of broiler chickens (n=20) and
swine (n=30) to characterize the erythromycin resistance profile of the strains and to detect
molecular mechanisms involved in this resistance. The minimum inhibitory concentration was
determined by agar dilution. The Mismatch Amplification Mutation Assay-Polymerase Chain
Reaction (MAMA-PCR) was performed to detect mutations at positions 2074 and 2075 of 23S
rRNA region, in addition to PCR test to detect the erm(B) gene. From the intestinal content of
broiler chickens, 18 strains of C. jejuni and two strains of C. coli were isolated, whereas, from
swine samples, no C. jejuni strain and 14 strains of C. coli were isolated. All C. coli strains were
resistant, and three C. jejuni strains from broilers chickens were characterized with intermediate
resistance to erythromycin. The MIC of the strains ranged from ≤0.5mg/µL to ≥128mg/µL. All
resistant strains had the A2075G mutation, and one strain with intermediate resistance had
the A2075G mutation. However, the A2074C mutation and the erm(B) gene were not detected.
High resistance levels were detected in C. coli strains isolated from swine. The MAMA-PCR is
a practical tool for detecting the erythromycin resistance in Campylobacter strains.
INDEX TERMS: Phenotype, molecular characterization, erthromycin resistance, Campylobacter jejuni,
Campylobacter coli, strains, swine, broiler chickens, foodborne pathogens, MAMA-PCR, macrolides, A2075G.

RESUMO.- [Caracterização fenotípica e molecular da Campylobacter spp. é um agente bacteriano causador de

resistência à eritromicina em cepas de Campylobacter jejuni gastroenterite em humanos e associado à síndrome de
e Campylobacter coli isoladas de suínos e frangos de corte.] Guillain–Barré, sendo a campilobacteriose considerada uma
das principais enfermidades de origem alimentar. Aves e
Received on December 7, 2019.
1
suínos são importantes reservatórios desses microrganismos
Accepted for publication on March 30, 2020. e seus produtos derivados crus ou mal cozidos são muitas
2
Graduate Program in Veterinary Medicine with emphasis in Veterinary
vezes incriminados como fonte de infecção humana. A
Hygiene and Technological Processing of Products of Animal Origin, Faculdade
de Veterinária, Universidade Federal Fluminense (UFF), Rua Vital Brazil Filho 64, primeira escolha para o tratamento em casos humanos
Niterói, RJ 24230-340, Brazil. *Corresponding author: [email protected] são os antimicrobianos da classe dos macrolídeos como à
3
Departamento de Saúde Coletiva Veterinária e Saúde Pública, Universidade eritromicina. Dentro desse contexto, o objetivo deste estudo
Federal Fluminense (UFF), Rua Vital Brazil Filho 64, Niterói, RJ 24230-340, Brazil. foi isolar Campylobacter jejuni e C. coli a partir de 20 amostras

598
 Phenotypic and molecular characterization of erythromycin resistance in Campylobacter jejuni and Campylobacter coli strains 599

de conteúdo intestinal de frangos de corte e de 30 de suínos mechanism, adenine is replaced by guanine at position 2075
ao abate e investigar a resistência à eritromicina das estirpes and/or by cytosine at position 2074 (Alonso et al. 2005,
obtidas e os possíveis mecanismos moleculares envolvidos Ladely et al. 2009). At the same time, low levels of resistance
nesta resistência. A concentração inibitória mínima foi to macrolides occur due to mutations in genes that encode
determinada pela diluição em ágar e a técnica MAMA-PCR ribosomal proteins, such as L4 and L22 (Luangtongkum et al.
foi utilizada para detecção de mutações nas posições 2074 e 2009). For many years, it has been accepted that high levels
2075 da região 23s rRNA, foi pesquisado também a presença of resistance to macrolides in Campylobacter spp. occurred
do gene erm(B) pela PCR. A partir do conteúdo intestinal exclusively due to mutations in the 23S rRNA region associated
de frangos de corte foram isoladas 18 estirpes de C. jejuni e with efflux pumps, such as CmeABC. However, Qin et al. (2014)
duas de C. coli, enquanto de suínos foram obtidas 14 estirpes identified the presence of the erm(B) gene in a strain of C. coli.
de C. coli e nenhuma estirpe de C. jejuni. Todas as estirpes This gene encodes a methylase that mediates high resistance
de C. coli de suínos foram identificadas como resistentes levels to macrolides and can be transferred through bacterial
e três estirpes de C. jejuni de frangos foram caracterizadas transformation, a frequent mechanism in Campylobacter spp.
com resistência intermediária. A CIM das estirpes variou de (Wiesner et al. 2003). Through horizontal transmission, there
≤0,5mg/µL a ≥128mg/µL. Todas as estirpes resistentes tinham is a higher possibility of spread resistance among strains (Qin
a mutação A2075G e uma cepa com resistência intermediária et al. 2014, Wang et al. 2014). To date, strains of Campylobacter
também apresentou a mutação A2075G. Não foi detectada a spp. possessing the erm(B) gene has only been described in
mutação A2074C ou a presença do gene erm(B) em nenhuma isolates in China, Spain, and the United States of America
das estirpes obtidas. Os resultados revelam um alto nível de (USA) (Qin et al. 2014, Wang et al. 2014, Florez-Cuadrado et
resistência em estirpes de C. coli isoladas de suínos frente al. 2016, Zhang et al. 2016, Chen et al. 2018).
a eritromicina. A técnica MAMA PCR utilizada se constitui The detection of these point mutations can be performed
em uma ferramenta prática para detecção da resistência à through sequencing, a technique with high accuracy, high cost,
eritromicina em estirpes de C. jejuni e C. coli. and limited availability in laboratories. Therefore, Alonso et
al. (2005) described a specific Polymerase Chain Reaction
TERMOS DE INDEXAÇÃO: Caracterização fenotípica, caracterização
(PCR) to detect mutations in the 23rRNA region, called
molecular, resistência à eritromicina, cepas, Campylobacter jejuni,
Mismatch Amplification Mutation Assay-PCR (MAMA-PCR).
Campylobacter coli, suínos, frangos de corte, patógenos de origem
This technique can detect these point mutations without
alimentar, macrolídeos, MAMA-PCR, A2075G.
the need for DNA sequencing, once these mutations are
already known. The MAMA-PCR uses a conserved forward
INTRODUCTION primer from the 23S rRNA region in conjunction with the
ERY2075-R/ERY2074-R reverse primers to detect A2075G/
Campylobacter spp. is a bacterial agent that causes gastroenteritis
A2074C mutations. A 485 bp PCR product is generated when
in humans and despite its importance in unique health, studies
the isolates have the corresponding mutation (Han et al.
on human campylobacteriosis in Brazil are scarce. However,
2016). Several studies have already reported the efficiency of
in the European Union (EU), campylobacteriosis is the leading
MAMA-PCR for detecting mutations in the 23S rRNA region
disease that has its agent transmitted by food, since 2004
when compared to DNA sequencing techniques (Qin et al.
(Gibbons et al. 2014, EFSA & ECDC 2018a, 2018b). Among the
2011, Giacomelli et al. 2012, Maćkiw et al. 2012, Han et al.
main reservoirs of these microorganisms, birds and pigs stand
2016, Zhang et al. 2016).
out, with the same genotypes of Campylobacter spp. being
This study aimed to isolate Campylobacter spp. from the
reported in some countries, circulating between humans and
intestinal content of swine and broiler chickens, characterize
domestic animals, thus reinforcing their zoonotic potential.
the profile of resistance to erythromycin of these strains, and
The transmission of microorganisms to people can occur
to detect molecular mechanisms involved in this resistance.
through the ingestion of contaminated animal products and
direct contact with animal feces (Wilson et al. 2008, Rosner et
al. 2017, Asakura et al. 2019). Human campylobacteriosis is MATERIALS AND METHODS
usually self-limiting, but in some cases treatment is performed Material collection. The project was submitted to and approved
with macrolide antibiotics (Bolinger & Kathariou 2017). by the Animal Ethics Council of “Universidade Federal Fluminense”
The use of (WHO 2013), especially in farm animals, allow (UFF) under number 5223141018. From September to November
the selection of resistant strains in livestock. Thus, there is the 2018, intestines of 20 broiler chickens (10 animals/batch), slaughtered
possibility of contamination of animal origin products with under state sanitary inspection, and intestinal content of 30 swines
resistant strains, which can lead to the subsequent infection (10 animals/batch), slaughtered under federal inspection were
of people who consume these products (Pyörälä et al. 2014). collected, the animals came from the states of Rio de Janeiro and
Antibiotics of the macrolide class can act by inhibiting protein Minas Gerais, respectively. The intestines and intestinal contents were
synthesis in the 50s subunit of ribosomal RNA by interrupting sent to the “Laboratório de Doenças Infecciosas”, at the “Faculdade
peptide translocation that prevents protein synthesis. de Veterinária” (UFF,) in isothermal boxes and processed on the
Erythromycin is considered to be the representative of this same day of collection.
class (Vázquez-Laslop et al. 2018). Isolation and identification. An aliquot of the content was
The primary mechanism that confers high levels of resistance diluted in 3mL of sterile distilled water with subsequent filtration
to macrolides in Campylobacter spp. involves a modification through a 0.65µM filter membrane (Sartorius). The filtrate was
of the antimicrobial binding site to the ribosome by a point streaked on Columbia Agar (Kasvi, Brazil) supplemented with 0.4%
mutation at the target site in the peptidyl transferase region activated carbon and selective supplement CAMPYLOFAR® (CEFAR,
regarding the 23S region of the ribosomal RNA gene. In this Brazil). The plates were incubated at 37°C under microaerophilia for

Pesq. Vet. Bras. 40(8):598-603, August 2020

600 Thomas S. Dias et al

48 hours, and colonies were selected for presumptive identification, et al. (2015), Chen et al. (2010), and Hald et al. (2000) also
due to their morphotintorial characteristics, and later identification
reported more significant colonization of C. jejuni in broiler
by PCR. According to Sambrook et al. (2006), strains of DNA were
extracted by the phenol-chloroform method. Multiplex PCR was chickens when compared to C. coli, demonstrating that this
performed to identify the species (Harmon et al. 1997 modified by
is the predominant species in broilers.
Aquino et al. 2002). The amplification reaction was performed with
a final volume of 50μL, containing 5μL of the sample DNA, 1X PCR
Buffer (500mM KCl, 100mM Tris-HCl [pH 8.5]), 5.5mM/L MgCl2, Table 1. Strains, origin, minimum inhibitory concentration
0.4μM dNTP, 0.4μM of each primer pg3 and pg50, 0.2μM of each (MIC) and molecular mechanisms involved in resistance in
primer C1 and C4 and 2.5U of Taq DNA polymerase (Invitrogen, Campylobacter jejuni and Campylobacter coli strains
Brazil). Initial denaturation was carried out at 94°C for four minutes, Species Origin MIC µl/mL* A2075G A2074C erm(B)
followed by 25 amplification cycles consisting of one minute at C. coli Swine/MG >128 + - -
94°C, one minute at 55°C, one minute at 72°C and final extension
C. coli Swine/MG >128 + - -
at 72°C for seven minutes. Strains of Campylobacter jejuni ATCC
C. coli Swine/MG >128 + - -
33560 and Campylobacter coli NCTC 11366 were used as positive
C. coli Swine/MG 128 + - -
controls of the reaction.
Minimum inhibitory concentration. The sensitivity of C. coli Swine/MG >128 + - -
Campylobacter spp. to erythromycin was determined by the antibiotic C. coli Swine/MG >128 + - -
dilution method on agar to determine the Minimum Inhibitory C. coli Swine/MG >128 + - -
Concentration (MIC) according to the criteria determined by the C. coli Swine/MG 128 + - -
Clinical and Laboratory Standards Institute (CLSI 2010). The C. coli Swine/MG >128 + - -
concentrations of erythromycin used were 128µg/mL, 64µg/mL, C. coli Swine/MG >128 + - -
32µg/mL, 16µg/mL, 8µg/mL, 4µg/mL, 2µg/mL, 1µg/mL and 0.5µg/ C. coli Swine/MG >128 + - -
mL. The breakpoint for erythromycin was defined according to the C. coli Swine/MG >128 + - -
established by CLSI (2013), where strains with a MIC of up to 8µg/ C. coli Swine/MG >128 + - -
mL were considered sensitive, 16µg/mL intermediate and ≥32µg/ C. coli Swine/MG >128 + - -
mL as resistant (Table 1).
C. jejuni Broiler chicken/RJ 16 + - -
MAMA-PCR. Strains characterized as resistant or intermediate,
C. jejuni Broiler chicken/RJ 16 - - -
by MIC, were analyzed by MAMA-PCR (Table 2), described by Alonso
C. jejuni Broiler chicken/RJ 16 - - -
et al. (2005). A 23SRNA-F forward primer was used in conjunction
with the ERY2075 primer to detect the A2075G mutation. In parallel, C. jejuni Broiler chicken/RJ 1 - - -
the ERY2074 primer was used to detect the A2074C mutation. A C. jejuni Broiler chicken/RJ 0.5 - - -
485 bp amplicon was obtained for each reaction in the strains that C. jejuni Broiler chicken/RJ <0.5 - - -
presented the mutation. The PCR reaction had a final volume of 25µl C. jejuni Broiler chicken/RJ <0.5 - - -
containing: 1X PCR buffer (10mM Tris HCl, 1.5mM MgCl2, 50mM KCl C. jejuni Broiler chicken/RJ <0.5 - - -
(pH 8.3), 1.5mM MgCl2, 5µL of DNA, 0.2µM of the 23S rRNA-F primer C. coli Broiler chicken/RJ 0.5 - - -
and 0.2µM of ERY 2074 or ERY 2075 primer, 0.2mM of dNTP and 1U C. jejuni Broiler chicken/RJ <0.5 - - -
of Taq polymerase (Invitrogen, Brazil). The initial denaturation was C. jejuni Broiler chicken/RJ <0.5 - - -
carried out at 94°C for 5 min, followed by 30 cycles of denaturation C. jejuni Broiler chicken/RJ <0.5 - - -
at 94°C for 30s, annealing at 59°C for 30s, extension at 72°C for 45s C. coli Broiler chicken/RJ 0.5 - - -
and final extension at 72°C for 5 min.
C. jejuni Broiler chicken/RJ <0.5 - - -
erm(B) gene detection. The erm(B) gene detection was performed
C. jejuni Broiler chicken/RJ <0.5 - - -
in strains characterized as resistant or intermediate, following the
C. jejuni Broiler chicken/RJ <0.5 - - -
PCR proposed by Zhang et al. (2016). The reaction contained 1X PCR
buffer (10mM Tris HCl, 1.5mM MgCl2, 50mM KCl (pH 8.3), 1.5mM C. jejuni Broiler chicken/RJ <0.5 - - -
MgCl2, 0.2mM dNTP, 0.5mM of each primer and 1U of Taq polymerase C. jejuni Broiler chicken/RJ <0.5 - - -
(Invitrogen, Brazil). An initial cycle was used for denaturation at C. jejuni Broiler chicken/RJ <0.5 - - -
94°C for 5 min; followed by 30 cycles of amplification at 94°C for C. jejuni Broiler chicken/RJ <0.5 - - -
30 s, 60°C for 30s for annealing and 72°C for 45s for extension. The * Interpretation parameters according to CLSI (2013): ≤8µl/mL = sensitive,
final extension was performed at 72°C for 5 min. 16µl/mL = intermediate, ≥32µl/mL = resistant.

RESULTS AND DISCUSSION Table 2. Primers used in the investigation of molecular

mechanisms in Campylobacter jejuni and Campylobacter coli
From the intestinal content of 30 swines, 14 (46.6%) strains resistant to erythromycin
of Campylobacter coli, and none of Campylobacter jejuni were
Gene Primer Sequence (5’ → 3’) Fragment Reference
isolated. The presence of C. coli in swine is more frequent than
23S
in birds, and this microorganism can be considered a natural RNA-F
TTAGCTAATGTTGCCCGTACCG
inhabitant of the swine intestine (Varela et al. 2007). Kempf et 23S Alonso et al.
485 pb
rRNA ERY2075-R TAGTAAAGGTCCACGGGGTCGC 2005
al. (2017) and Gebreyes et al. (2005), as well as in this study,
ERY2074-R AGTAAAGGTCCACGGGGTCTGG
isolated only C. coli from swine feces. From the 20 samples
of intestinal content from broiler chickens, 18 (90%) strains erm(B)-F GAAGGAGTGATTACATGAACAA Zhang et al.
erm(B) 760 pb
of C. jejuni and two (20%) of C. coli were obtained. Frasão erm(B)-R TCATAGAATTATTTCCTCCCGT 2016

Pesq. Vet. Bras. 40(8):598-603, August 2020

 Phenotypic and molecular characterization of erythromycin resistance in Campylobacter jejuni and Campylobacter coli strains 601

The MIC of C. jejuni strains ranged from ≤0.5µg/mL to CONCLUSIONS

16µg/mL. In Brazil, Hungaro et al. (2015) did not observe the A high level of resistance (≥128µg/ml) to erythromycin
presence of strains resistant to erythromycin in isolates from was detected in Campylobacter coli strains isolated from swine
chicken carcasses, however high frequency of strains resistant by MIC, and the A2075G mutation was observed in all strains
to this antimicrobial were reported in C. jejuni (75%) and C. resistant to this antimicrobial. The A2074C mutation and the
coli (60%) isolated of children with diarrhea in the state of
erm(B) gene were absent in all strains studied.
Minas Gerais (Rodrigues et al. 2015).
The MAMA-PCR technique is a practical tool for detecting the
The C. coli strains from broiler chickens showed a MIC
molecular mechanisms involved in resistance to erythromycin
of 0.5µg/ml, being considered sensitive, while C. coli strains
from swines were characterized as resistant, with two strains in strains of Campylobacter jejuni and C. coli.
(15.3%) showing a MIC of 128µg/ml and twelve (85.7%) with Ackowledgments.- This study was funded by the “Conselho Nacional de
MIC ≥128µg/ml. Asakura et al., 2019 also detected resistance Desenvolvimento Científico e Tecnológico” (CNPq), Brazil.
to erythromycin in 92% of C. coli strains obtained from swines
in Japan. It is accepted that C. coli from swines has a high level Conflict of interest statement.- There are no conflicts of interest.
of resistance to erythromycin (Egger et al. 2012), possibly
due to the greater survival capacity of strains with mutations REFERENCES
associated with resistance to macrolides when compared to
Alonso R., Mateo E., Churruca E., Martinez I., Girbau C. & Fernández-
C. jejuni (Bolinger et al. 2017). Regarding C. jejuni, it could be
Astorga A. 2005. MAMA-PCR assay for the detection of point mutations
noted that the resistance to erythromycin is accompanied by associated with high-level erythromycin resistance in Campylobacter
a reduced ability to colonize birds, potentially contributing jejuni and Campylobacter coli strains. J. Microbiol. Methods 63(1):99-103.
to the low incidence of resistance to macrolides (Bolinger et <http://dx.doi.org/10.1016/j.mimet.2005.03.013> <PMid:15927294>
al. 2018). In the laboratory, strains of C. jejuni that had these
Aquino M.H.C., Mangia A.H.R., Filgueiras A.L.L., Teixeira L.M., Ferreira M.C.S.
mutations induced, in the 23S rRNA region, grew more slowly
& Tibana A. 2002. Use of a multiplex PCR-based assay to differentiate
than their non-mutant clones and showed higher mortality, Campylobacter jejuni and Campylobacter coli strains isolated from human
which may partially contribute to the low levels of resistance and animal sources. Vet. J. 163(1):102-104. <http://dx.doi.org/10.1053/
to macrolides observed in C. jejuni (Han et al. 2009). Several tvjl.2001.0632> <PMid:11749144>
studies (Chen et al. 2010, Wang et al. 2014, Lim et al. 2016,
Asakura H., Sakata J., Nakamura H., Yamamoto S. & Murakami S. 2019.
Zhou et al. 2016, Zhang et al. 2016) have shown higher levels
Phylogenetic diversity and antimicrobial resistance of Campylobacter coli
of resistance to erythromycin in C. coli compared to C jejuni. from humans and animals in Japan. Microbes Environ. 34(2):146-154.
In this study, the A2075G mutation was found in all strains <http://dx.doi.org/10.1264/jsme2.ME18115> <PMid:30905895>
resistant to erythromycin, possibly one of the first reports.
Studies on the molecular mechanisms involved in erythromycin Bolinger H. & Kathariou S. 2017. The current state of macrolide resistance
resistance report this mutation as the leading cause of resistance in Campylobacter spp.: trends and impacts of resistance mechanisms.
Appl. Environ. Microbiol. 83(12):e00416-17. <http://dx.doi.org/10.1128/
in C. jejuni and C. coli. The A2074C mutation was not identified
AEM.00416-17> <PMid:28411226>
in any resistant strain in this study, which corroborates other
studies that report being rare mutations and described in a Bolinger H.K., Zhang Q., Miller W.G. & Kathariou S. 2018. Lack of evidence
few strains in the world (Payot et al. 2004, Lim et al. 2016, Wei for erm(B) infiltration into erythromycin-resistant Campylobacter coli and
& Kang 2018). It was observed that a strain of C. jejuni with Campylobacter jejuni from commercial turkey production in eastern North
Carolina: a major turkey-growing region in the United States. Foodborne
intermediate resistance had the A2075G mutation, suggesting
Pathog. Dis. 15(11):698-700. <http://dx.doi.org/10.1089/fpd.2018.2477>
that intermediate levels of resistance may also be related to this <PMid:30096008>
mutation. In the other two strains of C. jejuni with intermediate
resistance, this mutation was not detected. Other mechanisms, Chen J.C., Tagg K.A., Joung Y.J., Bennett C., Watkins L.F., Eikmeier D. &
such as the presence of point mutations in genes encoding Folster J.P. 2018. Report of erm(B)+ Campylobacter jejuni in the United
States. Antimicrob. Agents Chemother. 62(6):e02615-17. <http://dx.doi.
ribosomal proteins and/or efflux pump mechanisms may be
org/10.1128/AAC.02615-17> <PMid:29632015>
involved (Lehtopolku et al. 2011).
None of the strains tested had the erm(B) gene. Except for Chen X., Naren G.-W., Wu C.-M., Wang Y., Dai L., Xia L.-N., Luo P.-J., Zhang Q. &
a description of this gene in Spain, made by Florez-Cuadrado Shen J.Z. 2010. Prevalence and antimicrobial resistance of Campylobacter
et al. (2016) and a case of a woman who had traveled to isolates in broilers from China. Vet. Microbiol. 144(1/2):133-139.
<http://dx.doi.org/10.1016/j.vetmic.2009.12.035> <PMid:20116182>
Asia, and on returning to the USA presented a picture of
campylobacteriosis from which a strain of C. jejuni with the CLSI 2010. Methods for Antimicrobial Dilution and Disk Susceptibility Testing
erm(B) gene was isolated (Chen et al. 2018). Except in this of Infrequently Isolated or Fastidious Bacteria, Approved guideline-Second
case, all reports of positive strains for this gene have been Edition. CLSI document M45-A2, Clinical and Laboratory Standards
detected in China (Qin et al. 2014, Wang et al. 2014, Zhang Institute, Wayne, PA.
et al. 2016, Liu et al. 2017, 2019). Bolinger et al. (2018), CLSI 2013. Performance Standards for Antimicrobial Disk and Dilution
when studying strains of Campylobacter spp. isolated from Susceptibility Tests for Bacteria Isolated From Animals, Second Informational
commercial turkey farms in the USA, as well as Kempf et al. Supplement. CLSI document VET01-S2, Clinical and Laboratory Standards
(2017), studying strains isolated from swines in France, did Institute, Wayne, PA.
not detect this gene in any of the strains that are resistant EFSA & ECDC 2018a. The European Union summary report on antimicrobial
to erythromycin. The mechanism reported by these studies resistance in zoonotic and indicator bacteria from humans, animals and
was also the presence of the A2075G mutation, corroborating food in 2016. EFSA Journal 16(2):5182. <http://dx.doi.org/10.2903/j.
that this is the most common resistance to erythromycin. efsa.2018.5182>

Pesq. Vet. Bras. 40(8):598-603, August 2020

602 Thomas S. Dias et al

EFSA & ECDC 2018b. The European Union summary report on trends and jejuni and Campylobacter coli. Antimicrob. Agents Chemother. 55(12):5939-
sources of zoonoses, zoonotic agents and foodborne outbreaks in 2017. 5941. <http://dx.doi.org/10.1128/AAC.00314-11> <PMid:21911571>
EFSA Journal 16(12):5500. <http://dx.doi.org/10.2903/j.efsa.2018.5500>
Lim S.K., Moon D.-C., Chae M.H., Kim H.J., Nam H.-M., Kim S.-R., Jang G.-C.,
Egger R., Korczak B.M., Niederer L., Overesch G. & Kuhnert P. 2012. Genotypes Lee K., Jung S.-C. & Lee H.S. 2016. Macrolide resistance mechanisms and
and antibiotic resistance of Campylobacter coli in fattening pigs. Vet. Microbiol. virulence factors in erythromycin-resistant Campylobacter species isolated
155(2/4):272-278. <http://dx.doi.org/10.1016/j.vetmic.2011.08.012> from chicken and swine feces and carcasses. J. Vet. Med. Sci. 78(12):1791-
1795. <http://dx.doi.org/10.1292/jvms.16-0307> <PMid:27593510>
Florez-Cuadrado D., Ugarte-Ruiz M., Quesada A., Palomo G., Domínguez L.
& Porrero M.C. 2016. Description of an erm(B)-carrying Campylobacter Liu D., Deng F., Gao Y., Yao H. Shen Z., Wu C. Wang Y. & Shen, J. 2017.
coli isolate in Europe. J. Antimicrob. Chemother. 71(3):841-843. <http:// Dissemination of erm(B) and its associated multidrug-resistance genomic
dx.doi.org/10.1093/jac/dkv383> <PMid:26604242> islands in Campylobacter from 2013 to 2015. Vet. Microbiol. 204:20-24.
<http://dx.doi.org/10.1016/j.vetmic.2017.02.022> <PMid:28532801>
Frasão B.S., Côrtes L.R., Nascimento E.R., Cunha N.C., Almeida V.L. & Aquino
M.H.C. 2015. Detecção de resistência às fluoroquinolonas em Campylobacter Liu D., Liu W., Lv Z., Xia J., Li X., Hao Y., Zhou Y., Yao H., Liu Z., Wang Y., Shen
isolados de frangos de criação orgânica. Pesq. Vet. Bras. 35(7):613-619. J., Ke Y. & Shen, Z. 2019. Emerging erm(B)-mediated macrolide resistance
<http://dx.doi.org/10.1590/S0100-736X2015000700003> associated with novel multidrug resistance genomic islands in Campylobacter.
J. Antimicrob. Agents 63(7):e00153-19. <http://dx.doi.org/10.1128/
Gebreyes W.A., Thakur S. & Morrow W.E.M. 2005. Campylobacter coli: AAC.00153-19>
prevalence and antimicrobial resistance in antimicrobial-free (ABF)
swine production systems. J. Antimicrob. Chemoter. 56(4):765-768. Luangtongkum T., Jeon B., Han J., Plummer P., Logue C.M. & Zhang Q.
<http://dx.doi.org/10.1093/jac/dki305> <PMid:16120624> 2009. Antibiotic resistance in Campylobacter: emergence, transmission
and persistence. Future Microbiol. 4(2):189-200. <http://dx.doi.
Giacomelli M., Andrighetto C., Rossi, F., Lombardi A., Rizzotti L., Martini M. & org/10.2217/17460913.4.2.189> <PMid:19257846>
Piccirillo A. 2012. Molecular characterization and genotypic antimicrobial
resistance analysis of Campylobacter jejuni and Campylobacter coli Maćkiw E., Korsak D., Rzewuska K., Tomczuk K., & Rożynek E. 2012. Antibiotic
isolated from broiler flocks in northern Italy. Avian Pathol. 41(6):579-588. resistance in Campylobacter jejuni and Campylobacter coli isolated from
<http://dx.doi.org/10.1080/03079457.2012.734915> <PMid:23237371> food in Poland. Food Control 23(2):297-301. <http://dx.doi.org/10.1016/j.
foodcont.2011.08.022>
Gibbons C.L., Mangen M.J., Plass D., Havelaar A.H., Brooke R.J., Kramarz P.,
Peterson K.L., Stuurman A.L., Cassini A., Fèvre E.M. & Kretzschmar M.E. Payot S., Avrain L., Magras C., Praud K., Cloeckaert A. & Chaslus-Dancla
2014. Measuring underreporting and under-ascertainment in infectious E. 2004. Relative contribution of target gene mutation and efflux to
disease datasets: a comparison of methods. BMC Public Health 14:147. fluoroquinolone and erythromycin resistance, in French poultry and pig
<http://dx.doi.org/10.1186/1471-2458-14-147> <PMid:24517715> isolates of Campylobacter coli. Int. J. Antimicrob. Agents 23(5):468-472.
<http://dx.doi.org/10.1016/j.ijantimicag.2003.12.008>
Hald B., Wedderkopp A. & Madsen M. 2000. Thermophilic Campylobacter spp. in
Danish broiler production: a cross-sectional survey and a retrospective analysis Pyörälä S., Baptiste K.E., Catry B., Duijkeren E.van., Greko C., Moreno M.A.,
of risk factors for occurrence in broiler flocks. Avian Pathol. 29(2):123-131. Pomba M.C.M.F., Rantala M., Ružauskas M., Sanders P., Threlfall E.J., Torren-
<http://dx.doi.org/10.1080/03079450094153> <PMid:19184798> Edo J. & Törneke K. 2014. Macrolides and lincosamides in cattle and pigs:
use and development of antimicrobial resistance. Vet. J. 200(2):230-239.
Han F., Pu S., Wang F., Meng J. & Ge B. 2009. Fitness cost of macrolide resistance <http://dx.doi.org/10.1016/j.tvjl.2014.02.028> <PMid:24685099>
in Campylobacter jejuni. J. Antimicrob. Agents 34(5):462-466. <http://
dx.doi.org/10.1016/j.ijantimicag.2009.06.019> <PMid:19651494> Qin S., Wang Y., Zhang Q., Zhang M., Deng F., Shen Z., Wu C., Wang S., Zhang J. &
Shen J. 2014. Report of ribosomal RNA methylase gene erm(B) in multidrug-
Han X., Zhu D., La H., Zeng H., Zhou K., Zou L., Wu C., Han G. & Liu S. 2016. resistant Campylobacter coli. J. Antimicrob. Chemother. 69(4):964-968.
Prevalence, antimicrobial resistance profiling and genetic diversity of <http://dx.doi.org/10.1093/jac/dkt492> <PMid:24335515>
Campylobacter jejuni and Campylobacter coli isolated from broilers at
slaughter in China. Food Control 69:160-170. <http://dx.doi.org/10.1016/j. Qin S.S., Wu C.M., Wang Y., Jeon B., Shen Z.Q., Wang Yu, Zhang Q. & Shen
foodcont.2016.04.051> J.Z. 2011. Antimicrobial resistance in Campylobacter coli isolated from
pigs in two provinces of China. Int. J. Food Microbiol. 146(1):94-98.
Harmon K.M., Ransom G.M. & Wesley I.V. 1997. Differentiation of Campylobacter <http://dx.doi.org/10.1016/j.ijfoodmicro.2011.01.035> <PMid:21349598>
jejuni and Campylobacter coli by polymerase chain reaction. Mol. Cel.
Probes 11(3):195-200. <http://dx.doi.org/10.1006/mcpr.1997.0104> Rodrigues C.G., Melo R.T., Fonseca B.B., Martins P.A., Ferreira F.A., Araújo M.B.J.
& Rossi D.A. 2015. Occurrence and characterization of Campylobacter spp.
<PMid:9232618>
isolates in dogs, cats and children. Pesq. Vet. Bras. 35(4):365-370. <http://
Hungaro H.M., Mendonça R.C.S., Rosa V.O., Badaró A.C.L., Moreira M.A.S. & dx.doi.org/10.1590/S0100-736X2015000400009>
Chaves J.B.P. 2015. Low contamination of Campylobacter spp. on chicken
Rosner B.M., Schielke A., Didelot X., Kops, F., Breidenbach J., Suerbaum S. &
carcasses in Minas Gerais state, Brazil: molecular characterization
Stark K. 2017. A combined case-control and molecular source attribution
and antimicrobial resistance. Food Control 51:15-22. <http://dx.doi.
study of human Campylobacter infections in Germany, 2011-2014. Scient.
org/10.1016/j.foodcont.2014.11.001>
Reports 7(1):5139. <http://dx.doi.org/10.1038/s41598-017-05227-x>
Kempf I., Kerouanton A., Bougeard S., Nagard B., Rose V., Mourand G.,
Sambrook J. & Russell D.W. 2006. Purification of nucleic acids by extraction
Osterberg J., Denis M. & Bengtsson B. O. 2017. Campylobacter coli in
with phenol:chloroform. CSH Protoc. 2006(1):pdb.prot4455. <http://
organic and conventional pig production in France and Sweden: prevalence
dx.doi.org/10.1101/pdb.prot4455> <PMid:22485786>
and antimicrobial resistance. Front. Microbiol. 8:955. <http://dx.doi.
org/10.3389/fmicb.2017.00955> <PMid:28611754> Varela N.P., Friendship R. & Dewey C. 2007. Prevalence of resistance to 11
antimicrobials among Campylobacter coli isolated from pigs on 80 grower-
Ladely S.R., Meinersmann R.J., Englen M.D., Fedorka-Cray P. J. & Harrison
finisher farms in Ontario. Can. J. Vet. Res. 71(3):189-194. <PMid:17695593>
M.A. 2009. 23S rRNA Gene mutations contributing to macrolide resistance
in Campylobacter jejuni and Campylobacter coli. Foodborne Pathog. Dis. Vázquez-Laslop N. & Mankin A.S. 2018. How Macrolide antibiotics work.
6(1):91-98. <http://dx.doi.org/10.1089/fpd.2008.0098> <PMid:19014274> Trends Biochem. Sci. 43(9):668-684. <http://dx.doi.org/10.1016/j.
tibs.2018.06.011> <PMid:30054232>
Lehtopolku M., Kotilainen P., Haanperä-Heikkinen M., Nakari U.M., Hänninen M.L.,
Huovinen P., Siitonen A., Eerola E., Jalava J. & Hakanen A.J. 2011. Ribosomal Wang Y., Zhang M., Deng F., Shen Z., Wu C., Zhang J., Zhang Q. & Shen J. 2014.
mutations as the main cause of macrolide resistance in Campylobacter Emergence of multidrug-resistant Campylobacter species isolates with a

Pesq. Vet. Bras. 40(8):598-603, August 2020

 Phenotypic and molecular characterization of erythromycin resistance in Campylobacter jejuni and Campylobacter coli strains 603

horizontally acquired rRNA methylase. Antimicrob. Agents Chemother. Wilson D.J., Gabriel E., Leatherbarrow A.J.H., Cheesbrough J., Gee S., Bolton
58(9):5405-5412. <http://dx.doi.org/10.1128/AAC.03039-14> E., Fox, A., Fearnhead P., Hart C.A. & Diggle P.J. 2008. Tracing the source
<PMid:24982085> of campylobacteriosis. PLoS Genetics 4(9):e1000203. <http://dx.doi.
org/10.1371/journal.pgen.1000203> <PMid:18818764>
Wei B. & Kang M. 2018. Molecular basis of macrolide resistance in Campylobacter
strains isolated from poultry in South Korea. Biomed Res. Int. 2018:1-9. Zhang A., Song L., Liang H., Gu Y., Zhang C., Liu X., Zhang J. & Zhang M. 2016.
<http://dx.doi.org/10.1155/2018/4526576> <PMid:30069469> Molecular subtyping and erythromycin resistance of Campylobacter in
China. J. Applied Microbiol. 121(1):287-293. <http://dx.doi.org/10.1111/
WHO 2013. Critically important antimicrobials for human medicine. World jam.13135> <PMid:26999516>
Health Organization, Geneva.
Zhou J., Zhang M., Yang W., Fang Y., Wang G. & Ho F. 2016. A seventeen-year
Wiesner R.S., Hendrixson D.R. & Dirita V.J. 2003. Natural transformation of observation of the antimicrobial susceptibility of clinical Campylobacter
Campylobacter jejuni requires components of a type II secretion system. J. jejuni and the molecular mechanisms of erythromycin-resistant isolates
Bacteriool. 185(18):5408-5418. <http://dx.doi.org/10.1128/jb.185.18.5408- in Beijing, China. Int. J. Infec. Dis. 42:28-33. <http://dx.doi.org/ 10.1016/j.
5418.2003> <PMid:12949093> ijid.2015.11.005>

Pesq. Vet. Bras. 40(8):598-603, August 2020