0% found this document useful (0 votes)
65 views

Notes On Introduction To Unix

This lecture covers basic system administration concepts and tasks, namely: The superuser root. Shutdown and system start-up. Adding users. Controlling user groups. Reconfiguring and recompiling the Linux kernel. Cron jobs. Keeping essential processes alive.

Uploaded by

Sembi Emmanuel
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
65 views

Notes On Introduction To Unix

This lecture covers basic system administration concepts and tasks, namely: The superuser root. Shutdown and system start-up. Adding users. Controlling user groups. Reconfiguring and recompiling the Linux kernel. Cron jobs. Keeping essential processes alive.

Uploaded by

Sembi Emmanuel
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 87

Oliver | An Introduction to Unix http://oliverelliott.

org/article/computing/tut_unix/

HOME
Oliver
Sitemap

Section Contents
Advertising
Top

< > >>


An Introduction to Unix
Everybody Knows How to Use a Computer, but Not Everyone Knows How to Use the Command Line.
Yet This is the Gateway to Doing Anything and Everything Sophisticated with a Computer and the
Most Natural Starting Place to Learn Programming
by Oliver; 2014-01-13
unix command_line bash learn_unix learn_command_line unix_tutorial command_line_tutorial introduction_to_unix tutorial awk

perl

Table of Contents
1. Introduction VIEW_AS_PAGE
2. 100 Useful Unix Commands VIEW_AS_PAGE
3. Getting Started: Opening the Terminal VIEW_AS_PAGE
4. The Definitive Guides to Unix, Bash, and the Coreutils VIEW_AS_PAGE
5. The Unix Filestructure VIEW_AS_PAGE
6. The Great Trailing Slash Debate VIEW_AS_PAGE
7. Where Are You? - Your Path and How to Navigate through the Filesystem VIEW_AS_PAGE

8. Gently Wading In - The Top 10 Indispensable Unix Commands VIEW_AS_PAGE


9. ls VIEW_AS_PAGE
10. Single Line Comments in Unix VIEW_AS_PAGE
11. The Primacy of Text Files, Text Editors VIEW_AS_PAGE
12. echo and cat VIEW_AS_PAGE
13. cp, mv, and rm VIEW_AS_PAGE
14. Variables in Unix VIEW_AS_PAGE
15. Escape Sequences VIEW_AS_PAGE
16. Global Variables in Unix VIEW_AS_PAGE
17. The PATH VIEW_AS_PAGE
18. Links VIEW_AS_PAGE
19. What is Scripting? VIEW_AS_PAGE
20. File Suffixes in Unix VIEW_AS_PAGE
21. The Shebang VIEW_AS_PAGE
22. bash VIEW_AS_PAGE
23. chmod VIEW_AS_PAGE
24. ssh VIEW_AS_PAGE
25. Saving to a File; Stdout and Stderr VIEW_AS_PAGE
26. More on Stdout and Stderr; Redirection VIEW_AS_PAGE
27. Conditional Logic VIEW_AS_PAGE
28. File Test Operators; Return or Exit Status VIEW_AS_PAGE
29. Basic Loops VIEW_AS_PAGE
30. Arguments to a Script VIEW_AS_PAGE
31. Multi-Line Comments, Multi-Line Strings in Bash VIEW_AS_PAGE
32. Source and Export VIEW_AS_PAGE
33. Dotfiles (.bashrc and .bash_profile) VIEW_AS_PAGE
34. Working Faster with Readline Functions and Key Bindings VIEW_AS_PAGE
35. More on Key Bindings, the ASCII Table, Control-v VIEW_AS_PAGE
36. Aliases, Functions VIEW_AS_PAGE
37. The Top 20 Indispensable Unix Commands VIEW_AS_PAGE
38. head and tail VIEW_AS_PAGE
39. less and more VIEW_AS_PAGE
40. grep VIEW_AS_PAGE

1 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
41. sort VIEW_AS_PAGE
Sitemap 42. history VIEW_AS_PAGE
Section Contents
43. Piping in Unix VIEW_AS_PAGE
Top

< > >>


44. Command Substitution VIEW_AS_PAGE
45. Process Substitution VIEW_AS_PAGE
46. Interlude - Bell Laboratories 1982 Unix Video VIEW_AS_PAGE
47. Processes and Running Processes in the Background VIEW_AS_PAGE
48. sudo and the Root User VIEW_AS_PAGE
49. awk VIEW_AS_PAGE
50. sed VIEW_AS_PAGE
51. More awk Examples VIEW_AS_PAGE
52. Regular Expressions and Globbing in Bash VIEW_AS_PAGE
53. Command Line Perl and Regex VIEW_AS_PAGE
54. Text Editors Revisited: Vim VIEW_AS_PAGE
55. Example Problems on the Command Line VIEW_AS_PAGE
56. Example Bash Scripts VIEW_AS_PAGE
57. Using the Python Shell to do Math, and More VIEW_AS_PAGE
58. tmux VIEW_AS_PAGE
59. Installing Programs on the Command Line VIEW_AS_PAGE
60. Bash in the Programming Ecosystem (or When Not to Use Bash) VIEW_AS_PAGE

61. Concluding Notes VIEW_AS_PAGE


62. Acknowledgements and Postscript VIEW_AS_PAGE

Introduction TOP VIEW_AS_PAGE


I took programming in high school, but I never took to it. This, I strongly believe, is because it wasn't taught
right—and teaching it right means starting at the beginning, with unix. The reason for this is three-fold: (1) it
gives you a deeper sense of how a high-level computer works (which a glossy front, like Windows,
conceals); (2) it's the most natural port of entry into all other programming languages; and (3) it's super-
useful in its own right. If you don't know unix and start programming, some things will forever remain hazy
and mysterious, even if you can't put your finger on exactly what they are. If you already know a lot about
computers, the point is moot; if you don't, then by all means start your programming education by learning
unix!

A word about terminology here: I'm in the habit of horrendously confusing and misusing all of the precisely
defined words "Unix", "Linux", "The Command Line", "The Terminal", "Shell Scripting", and "Bash." Properly
speaking, unix is an operating system while linux refers to a closely-related family of unix-based operating
[1]
systems, which includes commercial and non-commercial distributions . (Unix was not free under its
developer, AT&T, which caused the unix-linux schism.) The command line, as Wikipedia says, is:

... a means of interacting with a computer program where the user issues commands to the program in the
form of successive lines of text (command lines) ... The interface is usually implemented with a command line
shell, which is a program that accepts commands as text input and converts commands to appropriate
operating system functions.

So what I mean when I proselytize for "unix", is simply that you learn how to punch commands in on the
command line. The terminal is your portal into this world. Here's what my mine looks like:

2 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap

Section Contents

Top

< > >>

There is a suite of commands to become familiar with—The GNU Core Utilities (wiki entry)—and, in the
course of learning them, you learn about computers. Unix is a foundational piece of a programming
education.

In terms of bang for the buck, it's also an excellent investment. You can gain powerful abilities by learning
just a little. My coworker was fresh out of his introductory CS course, when he was given a small task by our
boss. He wrote a full-fledged program, reading input streams and doing heavy parsing, and then sent an
email to the boss that began, "After 1.5 days of madly absorbing perl syntax, I completed the exercise..." He
didn't know how to use the command-line at the time, and now a print-out of that email hangs on his wall as
a joke—and as a monument to the power of the terminal.

You can find ringing endorsements for learning the command line from all corners of the internet. For
instance, in the excellent course Startup Engineering (Stanford/Coursera) Balaji Srinivasan writes:

A command line interface (CLI) is a way to control your computer by typing in commands rather than clicking
on buttons in a graphical user interface (GUI). Most computer users are only doing basic things like clicking
on links, watching movies, and playing video games, and GUIs are fine for such purposes.

But to do industrial strength programming - to analyze large datasets, ship a webapp, or build a software
startup - you will need an intimate familiarity with the CLI. Not only can many daily tasks be done more
quickly at the command line, many others can only be done at the command line, especially in non-Windows
environments. You can understand this from an information transmission perspective: while a standard
keyboard has 50+ keys that can be hit very precisely in quick succession, achieving the same speed in a GUI
is impossible as it would require rapidly moving a mouse cursor over a profusion of 50 buttons. It is for this
reason that expert computer users prefer command-line and keyboard-driven interfaces.

To provide foreshadowing, here are some things you can do in unix:

make or rename 100 folders or files en masse


find all files of a given extension or any file that was created within the last week
log onto a computer remotely and access its files with ssh
copy files to your computer directly over the network (no external hard drive necessary!) with rsync
run a Perl or Python script
run one of the many programs that are only available on the command line
see all processes running on your computer or the space occupied by your folders
see or change the permissions on a file
parse a text file in any way imaginable (count lines, swap columns, replace words, etc.)
soundly encrypt your files or communications with gpg2
run your own web server on the Amazon cloud with nginx

What do all of these have in common? All are hard to do in the GUI, but easy to do on the command line. It
would be remiss not to mention that unix is not for everything. In fact, it's not for a lot of things. Knowing
which language to use for what is usually a matter of common sense. However, when you start messing
about with computers in any serious capacity, you'll bump into unix very quickly—and that's why it's our
starting point.

3 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap Is this the truth, the whole truth, and nothing but the truth, so help my white ass? I believe it is, but also my
Section Contents trajectory through the world of computing began with unix. So perhaps I instinctively want to push this on
Top
other people: do it the way I did it. And, because it occupies a bunch of my neuronal real estate at the
< > >>
moment, I could be considered brainwashed :-)

[1] Still confused about unix vs linux? Refer to the full family tree and these more precise definitions from Wikipedia:

unix: a family of multitasking, multiuser computer operating systems that derive from the original AT&T Unix, developed in the 1970s at the Bell

Labs research center by Ken Thompson, Dennis Ritchie, and others

linux: a Unix-like and mostly POSIX-compliant computer operating system assembled under the model of free and open-source software

development and distribution [whose] defining component ... is the Linux kernel, an operating system kernel first released [in] 1991 by Linus

Torvalds ↑

100 Useful Unix Commands TOP VIEW_AS_PAGE


This article is an introduction to unix. It aims to teach the basic principles and neglects to mention many of
the utilities that give unix superpowers. To learn about those, see 100 Useful Unix Commands.

Getting Started: Opening the Terminal TOP VIEW_AS_PAGE


If you have a Mac, navigate to Applications > Utilities and open the application named "Terminal":

If you have a PC, abandon all hope, ye who enter here! Just kidding—partially. None of the native Windows
shells, such as cmd.exe or PowerShell, are unix-like. Instead, they're marked with hideous deformities that
betray their ignoble origin as grandchildren of the MS-DOS command interpreter. If you didn't have a
[1]
compelling reason until now to quit using PCs, here you are . Typically, my misguided PC friends don't use
the command line on their local machines; instead, they have to ssh into some remote server running Linux.
(You can do this with an ssh client like PuTTY, Chrome's Terminal Emulator, or MobaXterm, but don't ask me
how.) On Macintosh you can start practicing on the command line right away without having to install a Linux
[2]
distribution (the Mac-flavored unix is called Darwin).

For both Mac and PC users who want a bona fide Linux command line, one easy way to get it is in the cloud
with Amazon EC2 via the AWS Free Tier. If you want to go whole hog, you can download and install a Linux
distribution—Ubuntu, Mint, Fedora, and CentOs are popular choices—but this is asking a lot of non-
hardcore-nerds (less drastically, you could boot Linux off of a USB drive or run it in a virtual box).

[1] I should admit, you can and should get around this by downloading something like Cygwin, whose homepage states: "Get that Linux feeling -

on Windows" ↑

[2] However, if you're using Mac OS rather than Linux, note that OS does not come with the GNU coreutils, which are the gold standard. You

should download them ↑

The Definitive Guides to Unix, Bash, and the Coreutils TOP VIEW_AS_PAGE

Before going any further, it's only fair to plug the authoritative guides which, unsurprisingly, can be found
right on your command line:

$ man bash
$ info coreutils

(The $ at the beginning of the line represents the terminal's prompt.) These are good references, but
overwhelming to serve as a starting point. There are also great resources online:

4 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
The Linux Information Project
Sitemap GNU Bash Reference Manual
Section Contents The Linux Documentation Project
Top
SS64 | Command line reference
< > >>
Stack Overflow
Wikipedia

although these guides, too, are exponentially more useful once you have a small foundation to build on.

The Unix Filestructure TOP VIEW_AS_PAGE


All the files and directories (a fancy word for "folder") on your computer are stored in a hierarchical tree.
Picture a tree in your backyard upside-down, so the trunk is on the top. If you proceed downward, you get to
big branches, which then give way to smaller branches, and so on. The trunk contains everything in the
sense that everything is connected to it. This is the way it looks on the computer, too, and the trunk is called
the root directory. In unix it's represented with a slash:

The root contains directories, which contain other directories, and so on, just like our tree. To get to any
particular file or directory, we need to specify the path, which is a slash-delimited address:

/dir1/dir2/dir3/some_file

Note that a full path always starts with the root, because the root contains everything. As we'll see below, this
won't necessarily be the case if we specify the address in a relative way, with respect to our current location
in the filesystem.

Let's examine the directory structure on our Macintosh. We'll go to the root directory and look down just one
level with the unix command tree. (If we tried to look at the whole thing, we'd print out every file and
directory on our computer!) We have:

While we're at it, let's also look at the directory /Users/username, which is the specially designated home
directory on the Macintosh:

5 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap

Section Contents

Top

< > >>

One thing we notice right away is that the Desktop, which holds such a revered spot in the GUI, is just
another directory—simply the first one we see when we turn on our computer.

If you're on Linux rather than Mac OS, the directory tree might look less like the screenshot above and more
like this:

(Image credit: The Geek Stuff: Linux Directory Structure)

The naming of these folders is not always intuitive, but you can read about the role of each one at
thegeekstuff.com.

If the syntax of a unix path looks familiar, it is. A webpage's URL, with its telltale forward slashes, looks like a
unix path with a domain prepended to it. This is not a coincidence! For a simple static website, its structure
on the web is determined by its underlying directory structure on the server, so navigating to:

http://www.example.com/abc/xyz

will serve you content in the folder websitepath/abc/xyz on the host's computer (i.e., the one owned by
example.com). Modern dynamic websites are more sophisticated than this, but it's neat to reflect that the
whole word has learned this unix syntax without knowing it.

To learn more, see the O'Reilly discussion of the unix file structure.

6 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
The Great Trailing Slash Debate TOP VIEW_AS_PAGE
Sitemap
Sometimes you'll see directories written with a trailing slash, as in:
Section Contents

Top
dir1/
< > >>

This helpfully reminds you that the entity is a directory rather than a file, but on the command line using the
more compact dir1 is sufficient. There are a handful of unix commands which behave slightly differently if
you leave the trailing slash on, but this sort of extreme pedantry isn't worth worrying about.

Where Are You? - Your Path and How to Navigate through the Filesystem TOP
VIEW_AS_PAGE

When you open up the terminal to browse through your filesystem, run a program, or do anything, you're
always somewhere. Where? You start out in the designated home directory when you open up the terminal.
The home directory's path is preset by a global variable called HOME. Again, it's /Users/username on a
Mac.

As we navigate through the filesystem, there are some conventions. The current working directory (cwd)—
whatever directory we happen to be in at the moment—is specified by a dot:

Sometimes it's convenient to write this as:

./

which is not to be confused with the root directory:

When a program is run in the cwd, you often see the syntax:

$ ./myprogram

which emphasizes that you're executing a program from the current directory. The directory one above the
cwd is specified by two dots:

..

With the trailing slash syntax, that's:

../

A tilde is shorthand for the home directory:

or:

~/

To see where we are, we can print working directory:

$ pwd

To move around, we can change directory:

$ cd /some/path

By convention, if we leave off the argument and just type:

$ cd

we will go home. To make directory—i.e., create a new folder—we use:

$ mkdir

7 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
As an example, suppose we're in our home directory, /Users/username, and want to get one back to
Sitemap /Users. We can do this two ways:
Section Contents

Top
$ cd /Users
< > >>

or:

$ cd ..

This illustrates the difference between an absolute path and a relative path. In the former case, we specify
the complete address, while in the later we give the address with respect to our cwd. We could even
accomplish this with:

$ cd /Users/username/..

or maniacally seesawing back and forth:

$ cd /Users/username/../username/..

if our primary goal were obfuscation. This distinction between the two ways to specify a path may seem
pedantic, but it's not. Many scripting errors are caused by programs expecting an absolute path and
receiving a relative one instead or vice versa. Use relative paths if you can because they're more portable: if
the whole directory structure gets moved, they'll still work.

Let's mess around. We know cd with no arguments takes us home, so try the following experiment:

$ echo $HOME # print the variable HOME


/Users/username
$ cd # cd is equivalent to cd $HOME
$ pwd # print working directory shows us where we are
/Users/username

$ unset HOME # unset HOME erases its value


$ echo $HOME

$ cd /some/path # cd into /some/path


$ cd # take us HOME?
$ pwd
/some/path

What happened? We stayed in /some/path rather than returning to /Users/username. The point? There's
nothing magical about home—it's merely set by the variable HOME. More about variables soon!

Gently Wading In - The Top 10 Indispensable Unix Commands TOP VIEW_AS_PAGE

Now that we've dipped one toe into the water, let's make a list of the 10 most important unix commands in
the universe:

1. pwd
2. ls
3. cd
4. mkdir
5. echo
6. cat
7. cp
8. mv
9. rm
10. man

Every command has a help or manual page, which can be summoned by typing man. To see more

8 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
information about pwd, for example, we enter:
Sitemap

Section Contents $ man pwd


Top

< > >>


But pwd isn't particularly interesting and its man page is barely worth reading. A better example is afforded
by one of the most fundamental commands of all, ls, which lists the contents of the cwd or of whatever
directories we give it as arguments:

$ man ls

The man pages tend to give TMI (too much information) but the most important point is that commands have
flags which usually come in a one-dash-one-letter or two-dashes-one-word flavor:

command -f
command --flag

and the docs will tell us what each option does. You can even try:

$ man man

However, as the old unix joke goes, this won't work:

$ man woman
No manual entry for woman

Below we'll discuss the commands in the top 10 list in more depth.

ls TOP VIEW_AS_PAGE
Let's go HOME and try out ls with various flags:

$ cd
$ ls
$ ls -1
$ ls -hl
$ ls -al

Some screen shots:

First, vanilla ls. We see our files—no surprises. And ls -1 merely displays our files in a column. To show the
human-readable, long form we stack the -h and -l flags:

ls -hl

9 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
This is equivalent to:
Sitemap
ls -h -l
Section Contents

Top Screenshot:
< > >>

This lists the owner of the file; the group to which he belongs (staff); the date the file was created; and the
file size in human-readable form, which means bytes will be rounded to kilobytes, gigabytes, etc. The column
on the left shows permissions. If you'll indulge mild hyperbole, this simple command is already revealing
secrets that are well-hidden by the GUI and known only to unix users. In unix there are three spheres of
permission—user, group, and other/world—as well as three particular types for each sphere—read, write,
and execute. Everyone with an account on the computer is a unique user and, although you may not realize
it, can be part of various groups, such as a particular lab within a university or team in a company. To see
yourself and what groups you belong to, try:

$ whoami
$ groups

A string of dashes displays permission:

---------
rwx------
rwxrwx---
rwxrwxrwx

This means, respectively: no permission for anybody; read, write, execute permission for only the user; rwx
permission for the user and anyone in the group; and rwx permission for the user, group, and everybody
else. Permission is especially important in a shared computing environment. You should internalize now that
two of the most common errors in computing stem from the two P words we've already learned: paths and
permissions. The command chmod, which we'll learn later, governs permission.

If you look at the screenshot above, you see a tenth letter prepended to the permission string, e.g.:

drwxrwxrwx

This has nothing to do with permissions and instead tells you about the type of entity in the directory: d
stands for directory, l stands for symbolic link, and a plain dash denotes a file.

The -a option in:

ls -al

lists all files in the directory, including dotfiles. These are files that begin with a dot and are hidden in the
GUI. They're often system files—more about them later. Screenshot:

10 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap

Section Contents

Top

< > >>

Note that, in contrast to ls -hl, the file sizes are in pure bytes, which makes them a little hard to read.

A general point about unix commands: they're often robust. For example, with ls you can use an arbitrary
number of arguments and it obeys the convention that an asterisk matches anything (this is known as file
globbing, and I think of it as the prequel to regular expressions). Take:

$ ls . dir1 .. dir2/*.txt dir3/A*.html

This monstrosity would list anything in the cwd; anything in directory dir1; anything in the directory one above
us; anything in directory dir2 that ends with .txt; and anything in directory dir3 that starts with A and ends with
.html. You get the point.

Suppose I create some nested directories:

$ mkdir -p squirrel/mouse/fox

(The -p flag is required to make nested directories in a single shot) The directory fox is empty, but if I ask you
to list its contents for the sake of argument, how would you do it? Beginners often do it like this:

$ cd squirrel
$ cd mouse
$ cd fox
$ ls

But this takes forever. Instead, list the contents from the current working directory, and—crucially—use bash
autocompletion, a huge time saver. To use autocomplete, hit the tab key after you type ls. Bash will show
you the directories available (if there are many possible directories, start typing the name, sq..., before you
hit tab). In short, do it like this:

$ ls squirrel/mouse/fox/ # use autocomplete to form this path quickly

Single Line Comments in Unix TOP VIEW_AS_PAGE


Anything prefaced with a # —that's pound-space—is a comment and will not be executed:

$ # This is a comment.
$ # If we put the pound sign in front of a command, it won't do anything:
$ # ls -hl

Suppose you write a line of code on the command line and decided you don't want to execute it. You have
two choices. The first is pressing Cntrl-c, which serves as an "abort mission." The second is jumping to the
beginning of the line (Cntrl-a) and adding the pound character. This has an advantage over the first method

11 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
that the line will be saved in bash history (discussed below) and can thus be retrieved and modified later.
Sitemap

Section Contents In a script, pound-special-character (like #!) is sometimes interpreted (see below), so take note and include a
Top
space after # to be safe.
< > >>

The Primacy of Text Files, Text Editors TOP VIEW_AS_PAGE


As we get deeper into unix, we'll frequently be using text editors to edit code, and viewing either data or code
in text files. When I got my hands on a computer as a child, I remember text editors seemed like the most
boring programs in the world (compared to, say, 1992 Prince of Persia). And text files were on the bottom of
my food chain. But the years have changed me and now I like nothing better than a clean, unformatted .txt
file. It's all you need! If you store your data, your code, your correspondence, your book, or almost anything
in .txt files with a systematic structure, they can be parsed on the command line to reveal information from
many facets. Here's some advice: do all of your text-related work in a good text editor. Open up clunky
Microsoft Word, and you've unwittingly spoken a demonic incantation and summoned the beast. Are these
the words of a lone lunatic dispensing hateration? No, because on the command line you can count the
words in a text file, search it with grep, input it into a Python program, et cetera. However, a file in Microsoft
Word's proprietary and unknown formatting is utterly unusable.

Because text editors are extremely important, some people develop deep relationships with them. My co-
worker, who is a Vim aficionado, turned to me not long ago and said, "You know how you should think about
editing in Vim? As if you're talking to it." On the terminal, a ubiquitous and simple editor is nano. If you're
more advanced, try Vim or Emacs. Not immune to my co-worker's proselytizing, I've converted to Vim.
Although it's sprawling and the learning curve can be harsh—Vim is like a programming language in itself—
you can do a zillion things with it. There's a section on Vim near the end of this article.

On the GUI, there are many choices: Sublime, Visual Studio Code, Atom, Brackets, TextMate (Mac only),
Aquamacs (Mac only), etc.

Exercise: Let's try making a text file with nano. Type:

$ nano file.txt

and make the following three-row two-column file:

1 x
4 b
z 9

(It's Cntrl-o to save and Cntrl-x to exit.)

echo and cat TOP VIEW_AS_PAGE


More essential commands: echo prints the string passed to it as an argument, while cat prints the contents
of files passed to it as arguments. For example:

$ echo joe
$ echo "joe"

would both print joe, while:

$ cat file.txt

would print the contents of file.txt. Entering:

$ cat file.txt file2.txt

would print out the contents of both file.txt and file2.txt concatenated together, which is where this command
gets its slightly confusing name.

12 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap Finally, a couple of nice flags for these commands:


Section Contents

Top
$ echo -n "joe" # suppress newline
< > >>
$ echo -e "joe\tjoe\njoe" # interpret special chars ( \t is tab, \n newline )
$ cat -n file.txt # print file with line numbers

cp, mv, and rm TOP VIEW_AS_PAGE


Finishing off our top 10 list we have cp, mv, and rm. The command to make a copy of a file is cp:

$ cp file1 file2
$ cp -R dir1 dir2

The first line would make an identical copy of file1 named file2, while the second would do the same thing for
directories. Notice that for directories we use the -R flag (for recursive). The directory and everything inside it
are copied.

Question: what would the following do?

$ cp -R dir1 ../../

Answer: it would make a copy of dir1 up two levels from our current working directory.

To rename a file or directory we use mv:

$ mv file1 file2

In a sense, this command also moves files, because we can rename a file into a different path. For example:

$ mv file1 dir1/dir2/file2

would move file1 into dir1/dir2/ and change its name to file2, while:

$ mv file1 dir1/dir2/

would simply move file1 into dir1/dir2/ or, if you like, rename ./file1 as ./dir1/dir2/file1.

Finally, rm removes a file or directory:

$ rm file # removes a file


$ rm -r dir # removes a file or directory
$ rm -rf dir # force removal of a file or directory
# (i.e., ignore warnings)

Variables in Unix TOP VIEW_AS_PAGE


To declare something as a variable use an equals sign, with no spaces. Let's declare a to be a variable:

$ a=3 # This syntax is right (no whitespace)


$ a = 3 # This syntax is wrong (whitespace)
-bash: a: command not found

Once we've declared something as a variable, we need to use $ to access its value (and to let bash know it's
a variable). For example:

$ a=3
$ echo a
a
$ echo $a

13 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
3

Sitemap

Section Contents So, with no $ sign, bash thinks we just want to echo the string a. With a $ sign, however, it knows we want to
Top
access what the variable a is storing, which is the value 3. Variables in unix are loosely-typed, meaning you
< > >>
don't have to declare something as a string or an integer.

$ a=3 # a can be an integer


$ echo $a
3

$ a=joe # or a can be a string


$ echo $a
joe

$ a="joe joe" # Use quotes if you want a string with spaces


$ echo $a
joe joe

We can declare and echo two variables at the same time, and generally play fast and loose, as we're used
to doing on the command line:

$ a=3; b=4
$ echo $a $b
34
$ echo $a$b # mesh variables together as you like
34
$ echo "$a$b" # use quotes if you like
34
$ echo -e "$a\t$b" # the -e flag tells echo to interpret \t as a tab
3 4

As we've seen above, if you want to print a string with spaces, use quotes. You should also be aware of how
bash treats double vs single quotes. If you use double quotes, any variable inside them will be expanded
(the same as in Perl). If you use single quotes, everything is taken literally and variables are not expanded.
Here's an example:

$ var=5
$ joe=hello $var
-bash: 5: command not found

$ joe="hello $var"
$ echo $joe
hello 5

$ joe='hello $var'
$ echo $joe
hello $var

An important note is that often we use variables to store paths in unix. Once we do this, we can use all of our
familiar directory commands on the variable:

$ d=dir1/dir2/dir3
$ ls $d
$ cd $d

$ d=.. # this variable stores the directory one above us (relative path)
$ cd $d/.. # cd two directories up

Escape Sequences TOP VIEW_AS_PAGE

14 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME Escape sequences are important in every language. When bash reads $a it interprets it as whatever's stored
Sitemap in the variable a. What if we actually want to echo the string $a? To do this, we use \ as an escape
Section Contents
character:
Top

< > >>


$ a=3
$ echo $a
3
$ echo \$a
$a
$ echo "\$a" # use quotes if you like
$a

What if we want to echo the slash, too? Then we have to escape the escape character (using the escape
character!):

$ echo \\\$a # escape the slash and the dollar sign


\$a

This really comes down to parsing. The slash helps bash figure out if your text is a plain old string or a
variable. It goes without saying that you should avoid special characters in your variable names. In unix we
might occasionally fall into a parsing tar-pit trap. To avoid this, and make extra sure bash parses our variable
right, we can use the syntax ${a} as in:

$ echo ${a}
3

When could this possibly be an issue? Later, when we discuss scripting, we'll learn that $n, where n is a
number, is the nth argument to our script. If you were crazy enough to write a script with 11 arguments, you'd
discover that bash interprets a=$11 as a=$1 (the first argument) concatenated with the string 1 while
a=${11} properly represents the eleventh argument. This is getting in the weeds, but FYI.

Here's a more practical example:

$ a=3
$ echo $a # variable a equals 3
3
$ echo $apple # variable apple is not set

$ echo ${a}pple # this describes the variable a plus the string "pple"
3pple

Global Variables in Unix TOP VIEW_AS_PAGE


In general, it is the convention to use capital letters for global variables. We've already learned about one:
HOME. We can see all the variables set in our shell by simply typing:

$ set

Some basic variables deserve comment:

HOME
PS1
TMPDIR
EDITOR
DISPLAY

HOME, as we've already seen, is the path to our home directory (preset to /Users/username on
Macintosh). PS1 sets the shell's prompt. For example:

$ PS1=':-) '

15 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
changes our prompt from a dollar-sign into an emoticon, as in:
Sitemap

Section Contents

Top

< > >>

This is amusing, but the PS1 variable is actually important for orienting you on the command line. A good
prompt is a descriptive one: it tells you what directory you're in and perhaps your username and the name of
the computer. The default prompt should do this but, in case you want to nerd out, you can read about the
arcane language required to customize PS1 here. (If you're familiar with git, you can even have your prompt
[1]
display the branch of the git repository you're on. )

On your computer there is a designated temporary directory and its path is stored in TMPDIR. Some
commands, such as sort, which we'll learn later, surreptitiously make use of this directory to store
intermediate files. At work, we have a shared computer system and occasionally this common directory
$TMPDIR will run out of space, causing programs trying to write there to fail. One solution is to simply set
TMPDIR to a different path where there's free space. EDITOR sets the default text editor (you can invoke it
by pressing Cntrl-x-e). And DISPLAY is a variable related to the X Window System.

Many programs rely on their own agreed-upon global variables. For example, if you're a Perl user, you may
know that Perl looks for modules in the directory whose path is stored in PERL5LIB. Python looks for its
modules in PYTHONPATH; R looks for packages in R_LIBS; Matlab uses MATLABPATH; awk uses
AWKPATH; C++ looks for libraries in LD_LIBRARY_PATH; and so on. These variables don't exist in the
shell by default. A program will make a system call and look for the variable. If the user has had the need or
foresight to define it, the program can make use of it.

[1] Here's the trick, although it's beyond the scope of this introduction. Add these lines to your bash configuation file:

# via: https://techcommons.stanford.edu/topics/git/show-git-branch-bash-prompt
parse_git_branch() {
git branch --no-color 2> /dev/null | sed -e '/^[^*]/d' -e 's/* \(.*\)/()/'
}

# add git branch to prompt


export PS1="\[\033]0;\h:\W\007\]\h:\W\$(parse_git_branch)] "

The PATH TOP VIEW_AS_PAGE


The most important global variable of all is the PATH. This is the PATH, as distinct from a path, a term
we've already learned referring to a location in the filesystem. The PATH is a colon-delimited list of
directories where unix will look for executable programs when you enter something on command line. If your
program is in one of these directories, you can run it from any location by simply entering its name. If the
program is not in one of these directories, you can still run it, of course, but you'll have to include its path.

Let's revisit the idea of a command in unix. What's a command? It's nothing more than a program sitting in a
[1]
directory somewhere. So, if ls is a program , where is it? Use the command which to see its path:

$ which ls # on my work computer


/bin/ls

$ which ls # on my home Mac


/usr/local/Cellar/coreutils/8.20/libexec/gnubin/ls

16 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
For the sake of argument, let's say I download an updated version of the ls command, and then type ls in
Sitemap my terminal. What will happen—will the old ls or the new ls execute? The PATH comes into play here
Section Contents because it also determines priority. When you enter a command, unix will look for it in each directory of the
Top
PATH, from first to last, and execute the first instance it finds. For example, if:
< > >>

PATH=/bin/dir1:/bin/dir2:/bin/dir3

and there's a command named ls in both /bin/dir1 and /bin/dir2, the one in /bin/dir1 will be executed.

Let's see what your PATH looks like. Enter:

$ echo $PATH

For example, here's a screenshot of the default PATH on Ubuntu:

To emphasize the point again, all the programs in the directories specified by your PATH are all the
programs that you can access on the command line by simply typing their names.

The PATH is not immutable. You can set it to be anything you want, but in practice you'll want to augment,
rather than overwrite, it. By default, it contains directories where unix expects executables, like:

/bin
/usr/bin
/usr/local/bin

Let's say you have just written the command /mydir/newcommand. If you're not going to use the
command very often, you can invoke it using its full path every time you need it:

$ /mydir/newcommand

However, if you're going to be using it frequently, you can just add /mydir to the PATH and then invoke the
command by name:

$ PATH=/mydir:$PATH # add /mydir to the front of PATH - highest priority


$ PATH=$PATH:/mydir # add /mydir to the back of PATH - lowest priority
$ newcommand # now invoking newcommand is this easy

This is a frequent chore in unix. If you download some new program, you will often find yourself updating the
PATH to include the directory containing its binaries. How can we avoid having to do this every time we
open the terminal for a new session? We'll discuss this below when we learn about .bashrc.

If you want to shoot yourself in the foot, you can vaporize the PATH:

$ unset PATH # not advisable


$ ls # now ls is not found
-bash: ls: No such file or directory

but this is not advisable, save as a one-time educational experience.

[1] In fact, if you want to view the source code (written in the C programming language) of ls and other members of the coreutils, you can

download it at ftp.gnu.org/gnu/coreutils. E.g., get and untar the latest version as of this writing:

17 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

$ wget ftp://ftp.gnu.org/gnu/coreutils/coreutils-8.9.tar.xz
HOME
$ tar -xvf coreutils-8.9.tar.xz
Sitemap

Section Contents

Top or use git:


< > >>

$ git clone git://git.sv.gnu.org/coreutils

Links TOP VIEW_AS_PAGE


While we're on the general subject of paths, let's talk about symbolic links. If you've ever used the Make
Alias command on a Macintosh (not to be confused with the unix command alias, discussed below), you've
already developed intuition for what a link is. Suppose you have a file in one folder and you want that file to
exist in another folder simultaneously. You could copy the file, but that would be wasteful. Moreover, if the file
changes, you'll have to re-copy it—a huge ball-ache. Links solve this problem. A link to a file is a stand-in for
the original file, often used to access the original file from an alternate file path. It's not a copy of the file but,
rather, points to the file.

To make a symbolic link, use the command ln:

$ ln -s /path/to/target/file mylink

This produces:

mylink --> /path/to/target/file

in the cwd, as ls -hl will show. Note that removing mylink:

$ rm mylink

does not affect our original file.

If we give the target (or source) path as the sole argument to ln, the name of the link will be the same as the
source file's. So:

$ ln -s /path/to/target/file

produces:

file --> /path/to/target/file

Links are incredibly useful for all sorts of reasons—the primary one being, as we've already remarked, if you
want a file to exist in multiple locations without having to make extraneous, space-consuming copies. You
can make links to directories as well as files. Suppose you add a directory to your PATH that has a particular
version of a program in it. If you install a newer version, you'll need to change the PATH to include the new
directory. However, if you add a link to your PATH and keep the link always pointing to the most up-to-date
directory, you won't need to keep fiddling with your PATH. The scenario could look like this:

$ ls -hl myprogram
current -> version3
version1
version2
version3

(where I'm hiding some of the output in the long listing format.) In contrast to our other examples, the link is
in the same directory as the target. Its purpose is to tell us which version, among the many crowding a
directory, we should use.

18 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap Another good practice is putting links in your home directory to folders you often use. This way, navigating to
Section Contents those folders is easy when you log in. If you make the link:
Top

< > >>


~/MYLINK --> /some/long/and/complicated/path/to/an/often/used/directory

then you need only type:

$ cd MYLINK

rather than:

$ cd /some/long/and/complicated/path/to/an/often/used/directory

Links are everywhere, so be glad you've made their acquaintance!

What is Scripting? TOP VIEW_AS_PAGE


By this point, you should be comfortable using basic utilities like echo, cat, mkdir, cd, and ls. Let's enter a
series of commands, creating a directory with an empty file inside it, for no particular reason:

$ mkdir tmp
$ cd tmp
$ pwd
/Users/oliver/tmp
$ touch myfile.txt # the command touch creates an empty file
$ ls
myfile.txt
$ ls myfile_2.txt # purposely execute a command we know will fail
ls: cannot access myfile_2.txt: No such file or directory

What if we want to repeat the exact same sequence of commands 5 minutes later? Massive bombshell—we
can save all of these commands in a file! And then run them whenever we like! Try this:

$ nano myscript.sh

and write the following:

# a first script
mkdir tmp
cd tmp
pwd
touch myfile.txt
ls
ls myfile_2.txt

Gratuitous screenshot:

This file is called a script (.sh is a typical suffix for a shell script), and writing it constitutes our first step into

19 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
the land of bona fide computer programming. In general usage, a script refers to a small program used to
Sitemap perform a niche task. What we've written is a recipe that says:
Section Contents

Top create a directory called "tmp"


< > >> go into that directory
print our current path in the file system
make a new file called "myfile.txt"
list the contents of the directory we're in
specifically list the file "myfile_2.txt" (which doesn't exist)

This script, though silly and useless, teaches us the fundamental fact that all computer programs are
ultimately just lists of commands.

Let's run our program! Try:

$ ./myscript.sh
-bash: ./myscript.sh: Permission denied

WTF! It's dysfunctional. What's going on here is that the file permissions are not set properly. In unix, when
you create a file, the default permission is not executable. You can think of this as a brake that's been
engaged and must be released before we can go (and do something potentially dangerous). First, let's look
at the file permissions:

$ ls -hl myscript.sh
-rw-r--r-- 1 oliver staff 75 Oct 12 11:43 myscript.sh

Let's change the permissions with the command chmod and execute the script:

$ chmod u+x myscript.sh # add executable(x) permission for the user(u) only
$ ls -hl myscript.sh
-rwxr--r-- 1 oliver staff 75 Oct 12 11:43 myscript.sh

$ ./myscript.sh
/Users/oliver/tmp/tmp
myfile.txt
ls: cannot access myfile_2.txt: No such file or directory

Not bad. Did it work? Yes, it did because it's printed stuff out and we see it's created tmp/myfile.txt:

$ ls
myfile.txt myscript.sh tmp
$ ls tmp
myfile.txt

An important note is that even though there was a cd in our script, if we type:

$ pwd
/Users/oliver/tmp

we see that we're still in the same directory as we were in when we ran the script. Even though the script
entered /Users/oliver/tmp/tmp, and did its bidding, we stay in /Users/oliver/tmp. Scripts always work
this way—where they go is independent of where we go.

If you're wondering why anyone would write such a pointless script, you're right—it would be odd if we had
occasion to repeat this combination of commands. There are some more realistic examples of scripting
below.

File Suffixes in Unix TOP VIEW_AS_PAGE


As we begin to script it's worth following some file naming conventions. We should use common sense

20 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
suffixes, like:
Sitemap

Section Contents
.txt - for text files
Top .html - for html files
< > >>
.sh - for shell scripts
.pl - for Perl scripts
.py - for Python scripts
.cpp - for c++ code

and so on. Adhering to this organizational practice will enable us to quickly scan our files, and make
[1]
searching for particular file types easier . As we saw above, commands like ls and find are particularly
well-suited to use this kind of information. For example, list all text files in the cwd:

$ ls *.txt

List all text files in the cwd and below (i.e., including child directories):

$ find . -name "*.txt"

[1] An astute reader noted that, for commands—as opposed to, say, html or text files—using suffixes is not the best practice because it violates

the principle of encapsulation. The argument is that a user is neither supposed to know nor care about a program's internal implementation

details, which the suffix advertises. You can imagine a program that starts out as a shell script called mycommand.sh, is upgraded to Python as

mycommand.py, and then is rewritten in C for speed, becoming the binary mycommand. What if other programs depend on mycommand? Then

each time mycommand's suffix changes they have to be rewritten—an annoyance. Although I make this sloppy mistake in this article, that

doesn't excuse you! Read the full argument

Update: There's a subtlety inherent in this argument that I didn't appreciate the first time around. I'm going to jump ahead of the narrative here, so

you may want to skip this for now and revist it later. Suppose you have two identical Python scripts. One is called hello.py and one is simply

called hi. Both contain the following code:

#!/usr/bin/env python

def yo():
print('hello')

In the Python shell, this works:

>>> import hello

but this doesn't:

>>> import hi
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
ImportError: No module named hi

Being able to import scripts in Python is important for all kinds of things, such as making modules, but you can only import something with a .py

extension. So how do you get around this if you're not supposed to use file extensions? The sage answers this question as follows:

The best way to handle this revolves around the core question of whether the file should be a command or a library. Libraries have

to have the extension, and commands should not, so making a tiny command wrapper that handles parsing options and then calls

the API from the other, imported one is correct.

To elaborate, this considers a command to be something in your PATH, while a library—which could be a runnable script—is not. So, in this

example, hello.py would stay the same, as a library not in your PATH:

#!/usr/bin/env python

21 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
def yo():
Sitemap
print('hello')
Section Contents

Top

< > >>


hi, a command in your PATH, would look like this:

#!/usr/bin/env python

import hello

hello.yo()

Hat tip: Alex

The Shebang TOP VIEW_AS_PAGE


We've left out one important detail about scripting. How does unix know we want to run a bash script, as
opposed to, say, a Perl or Python script? There are two ways to do it. We'll illustrate with two simple scripts,
a bash script and a Perl script:

$ cat myscript_1.sh # a bash script


echo "hello kitty"

$ cat myscript_1.pl # a Perl script


print "hello kitty\n";

The first way to tell unix which program to use to interpret the script is simply to say so on the command line.
For example, we can use bash to execute bash scripts:

$ bash ./myscript_1.sh # use bash for bash scripts


hello kitty

and perl for Perl scripts:

$ perl ./myscript_1.pl # use Perl for Perl scripts


hello kitty

But this won't work for a Perl script:

$ ./myscript_1.pl # this won't work


./myscript_1.pl: line 1: print: command not found

And if we purposefully specify the wrong language, we'll get errors:

$ bash ./myscript_1.pl # let's purposefully do it backwards


./myscript_1.pl: line 1: print: command not found

$ perl ./myscript_1.sh
String found where operator expected at ./myscript_1.sh line 1,
near "echo "hello kitty""
(Do you need to predeclare echo?)
syntax error at ./myscript_1.sh line 1, near "echo "hello kitty""
Execution of ./myscript_1.sh aborted due to compilation errors.

The second way to specify the proper interpreter—and the better way, which you should emulate—is to put it
in the script itself using a shebang. To do this, let's remind ourselves where bash and perl reside on our
system. On my computer, they're here:

$ which perl
/usr/bin/perl

22 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME $ which bash


Sitemap /bin/bash
Section Contents

Top
although perl could be somewhere else on your machine (bash should be in /bin by convention). The
< > >>
shebang specifies the language in which your script is interpreted according to the syntax #! followed by the
path to the language. It should be the first line of your script. Note that it's not a comment even though it
looks like one. Let's add shebangs to our two scripts:

$ cat myscript_1.sh
#!/bin/bash
echo "hello kitty"

$ cat myscript_1.pl
#!/usr/bin/perl
print "hello kitty\n";

Now we can run them without specifying the interpreter in front:

$ ./myscript_1.sh
hello kitty
$ ./myscript_1.pl
hello kitty

However, there's still a lingering issue and it has to do with portability, an important software principle. What
if perl is in a different place on your machine than mine and you copy my scripts and try to run them? The
path will be wrong and they won't work. The solution to this issue is courtesy of a neat trick using env. We
can amend our script to be:

$ cat myscript_1.pl
#!/usr/bin/env perl
print "hello kitty\n";

Of course, this assumes you have a copy of env in /usr/bin, but this is usually a correct assumption. What
env does here is to use whatever your environmental variable for perl is—i.e., the perl that's first in your
PATH.

This is a useful practice even if you're not sharing scripts. Suppose you've updated your version of perl and
there's a newer copy than /usr/bin/perl. You've appropriately updated your PATH such that the directory
containing the updated perl comes before /usr/bin. If you have env in your shebang, you're all set.
[1]
However, if you've hardwired the old path in your shebang, your script will run on the old perl .

The question that the shebang resolves—which program will run your script?—reminds us of a more
fundamental distinction between interpreted languages and compiled languages. The former are those like
bash, Perl, and Python, where you can cat a script and look inside it. The later, like C++, require
compilation, the process whereby code is translated into machine language (the result is sometimes called a
binary). This can be done with a command line utility like g++:

$ g++ MyProgram.cpp -o MyProgram

Compiled programs, such as the unix utilities themselves, tend to run faster. Don't try to cat a binary, such
as ls, or it will spew out gibberish:

$ cat $( which ls ) # don't do this!

[1] Of course, depending on circumstances, you may very well want to stick with the old version of Perl or whatever's running your program. An

23 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

update can have unforeseen consequences and this is the motivation for tools like virtualenv (Python), whose docs remind us: "If an application
HOME
works, any change in its libraries or the versions of those libraries can break the application" ↑
Sitemap

Section Contents

Top bash TOP VIEW_AS_PAGE


< > >>
We've thrown around the term bash a few times but we haven't defined it. To do so, let's examine the special
command, sh, which is more primitive than bash and came before it. To quote Wikipedia and the manual
page:

The Bourne shell (sh) is a shell, or command-line interpreter, for computer operating systems. The shell is a
command that reads lines from either a file or the terminal, interprets them, and generally executes other
commands. It is the program that is running when a user logs into the system ... Commands can be typed
directly to the running shell or can be put into a file and the file can be executed directly by the shell

As it describes, sh is special because it's both a command interpreter and a command itself (usually found at
/bin/sh). Put differently, you can run myscript as:

$ sh ./myscript

or you can simply type:

$ sh

to start an interactive sh shell. If you're in this shell and run:

$ ./myscript

without specifying an interpreter or using a shebang, your script will be interpreted by sh by default. On most
computers, however, the default shell is no longer sh but bash (usually located at /bin/bash). To mash up
Wikipedia and the manual page:

The Bourne-Again SHell (bash) a Unix shell written by Brian Fox for the GNU Project as a free software
replacement for the Bourne shell. bash is an sh-compatible command language interpreter that executes
commands read from the standard input or from a file ... There are some subtle differences between bash
and traditional versions of sh

Like sh, bash is a command you can either invoke on a script or use to start an interactive bash shell. Read
more on Stackoverflow: Difference between sh and bash.

Which shell are you using right now? Almost certainly bash, but if you want to double check, there's a neat
command given here to display your shell type:

$ ps -p $$

There are more exotic shells, like Z shell and tcsh, but they're beyond the scope of this article.

chmod TOP VIEW_AS_PAGE


Let's take a closer look at how to use chmod. Remember the three domains:

u - user
g - group
o - other/world

and the three types of permission:

r - read
w - write
x - execute

we can mix and match these how we like, using a plus sign to grant permissions according to the syntax:

24 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
chmod entity+permissiontype
Sitemap

Section Contents or a minus sign to remove permissions:


Top

< > >>


chmod entity-permissiontype

E.g.:

$ chmod u+x myfile # make executable for you


$ chmod g+rxw myfile # add read write execute permissions for the group
$ chmod go-wx myfile # remove write execute permissions for the group
# and for everyone else (excluding you, the user)

You can also use a for "all of the above", as in:

$ chmod a-rwx myfile # remove all permissions for you, the group,
# and the rest of the world

If you find the above syntax cumbersome, there's a numerical shorthand you can use with chmod. The only
two I have memorized are 777 and 755:

$ chmod 777 myfile # grant all permissions (rwxrwxrwx)


$ chmod 755 myfile # reserve write access for the user,
# but grant all other permissions (rwxr-xr-x)

Read more about the numeric code here. In general, it's a good practice to allow your files to be writable by
you alone, unless you have a compelling reason to share access to them.

ssh TOP VIEW_AS_PAGE


In addition to chmod, there's another command it would be remiss not to mention. For many people, the first
time they need to go to the command line, rather than the GUI, is to use the Secure Shell (ssh) protocol.
Suppose you want to use a computer, but it's not the computer that's in front of you. It's a different computer
in some other location—say, at your university, your company, or on the Amazon cloud. ssh is the command
that allows you to log into a computer remotely over the network. Once you've sshed into a computer, you're
in its shell and can run commands on it just as if it were your personal laptop. To ssh, you need to know the
[1]
address of the host computer you want to log into, your user name on that computer, and the password .
The basic syntax is:

ssh username@host

For example:

$ ssh [email protected]

If you're trying to ssh into a private computer and don't know the hostname, use its IP address
(username@IP-address).

ssh also allows you to run a command on the remote server without logging in. For instance, to list of the
contents of your remote computer's home directory, you could run:

$ ssh [email protected] "ls -hl"

Cool, eh? Moreover, if you have ssh access to a machine, you can copy files to or from it with the utility
rsync—a great way to move data without an external hard drive.

The file:

~/.ssh/config

determines ssh's behavior and you can create it if it doesn't exist (the dot in the name .ssh confers
invisibility—see the discussion about dotfiles below). On your own private computer, you can ssh into

25 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
selected servers without having to type in a password by updating this configuration file. To do this, generate
Sitemap rsa ssh keys:
Section Contents

Top
$ mkdir -p ~/.ssh
< > >>
$ cd ~/.ssh
$ ssh-keygen -t rsa -f localkey

This will create two files on your computer, a public key:

~/.ssh/localkey.pub

and a private key:

~/.ssh/localkey

You can share your public key, but do not give anyone your private key! Suppose you want to ssh into
myserver.com. Normally, that's:

$ ssh [email protected]

Instead of doing this, add these lines to your ~/.ssh/config file:

Host Myserver
HostName myserver.com
User myusername
IdentityFile ~/.ssh/localkey

Next, cat your public key and paste it into:

~/.ssh/authorized_keys

on the remote machine (i.e., the myserver.com computer). Now on your local computer, you can ssh into
myserver.com without a password:

$ ssh Myserver

[2]
You can also use this technique to push to github.com , without having to punch your password in each
time, by pasting your public key into:

Settings > SSH Keys > Add SSH Key

on GitHub (read the official tutorial).

If this is your first encounter with ssh, you'd be surprised how much of the work of the world is done by ssh.
It's worth reading the extensive man page, which gets into matters of computer security and cryptography.

[1] The host also has to enable ssh access. On Macintosh, for example, it's disabled by default, but you can turn it on, as instructed here. For

Ubuntu, check out the official docs. ↑

[2] As you get deeper into the game, tracking your scripts and keeping a single, stable version of them becomes crucial. Git, a vast subject for

another tutorial, is the neat solution to this problem and the industry standard for version control. On the web GitHub provides free hosting of

script repositories and connects to the command line via the git interface ↑

Saving to a File; Stdout and Stderr TOP VIEW_AS_PAGE


To save to a file in unix, use an angle bracket:

$ echo joe > junk.txt # save to file


$ cat junk.txt
joe

To append to the end of a pre-existing file, use a double angle bracket:

26 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME $ echo joe >> junk.txt # append to already-existing file


Sitemap $ cat junk.txt
Section Contents joe
Top joe
< > >>

Returning to our first script, myscript.sh, let's save the output to a file:

$ ./myscript.sh > out.txt


mkdir: cannot create directory ‘tmp’: File exists
ls: cannot access myfile_2.txt: No such file or directory

$ cat out.txt
/Users/oliver/tmp/tmp
myfile.txt

This is interesting: out.txt has its output. However, not everything went into out.txt, because some error
messages were echoed to the console. What's going on here is that there are actually two output streams:
stdout (standard out) and stderr (standard error). Look at the following figure from Wikipedia:

(Image credit: Wikipedia: Standard streams)

Proper output goes into stdout while errors go into stderr. The syntax for saving stderr in unix is 2> as in:

$ # save the output into out.txt and the error into err.txt
$ ./myscript.sh > out.txt 2> err.txt
$ cat out.txt
/Users/oliver/tmp/tmp
myfile.txt
$ cat err.txt
mkdir: cannot create directory ‘tmp’: File exists
ls: cannot access myfile_2.txt: No such file or directory

When you think about it, the fact that output and error are separated is supremely useful. At work,
sometimes we parallelize heavily and run 1000 instances of a script. For each instance, the error and output
th
are saved separately. The 758 job, for example, might look like this:

./myjob --instance 758 > out758.o 2> out758.e

(I'm in the habit of using the suffixes .o for output and .e for error.) With this technique we can quickly scan
through all 1000 .e files and check if their size is 0. If it is, we know there was no error; if not, we can re-run
the failed jobs. Some programs are in the habit of echoing run statistics or other information to stderr. This is
an unfortunate practice because it muddies the water and, as in the example above, would make it hard to
tell if there was an actual error.

Output vs error is a distinction that many programming languages make. For example, in C++ writing to
stdout and stderr is like this:

cout << "some output" << endl;


cerr << "some error" << endl;

In Perl it's:

print STDOUT "some output\n";


print STDERR "some error\n";

27 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
In Python it's:
Sitemap

Section Contents import sys


Top sys.stdout.write("some output\n")
< > >> sys.stderr.write("some error\n")

and so on.

More on Stdout and Stderr; Redirection TOP VIEW_AS_PAGE


For the sake of completeness, we should note that you can redirect standard error to standard output and
vice versa. Let's make sure we get the syntax of all things pertaining to stdout and stderr right:

1> # save stdout to (plain old > also works)


2> # save stderr to

as in:

$ ./myscript.sh 1> out.o 2> out.e


$ ./myscript.sh > out.o 2> out.e # these two lines are identical

What if we want to choose where things will be printed from within our script? Then we can use the following
syntax:

&1 # standard out stream


&2 # standard error stream

Let's examine five possible versions of our Hello Kitty script:

#!/bin/bash
# version 1
echo "hello kitty"

#!/bin/bash
# version 2
echo "hello kitty" > somefile.txt

#!/bin/bash
# version 3
echo "hello kitty" > &1

#!/bin/bash
# version 4
echo "hello kitty" > &2

#!/bin/bash
# version 5
echo "hello kitty" > 1

Here's how they work:

version 1 - echo "hello kitty" to stdout


version 2 - echo "hello kitty" to the file somefile.txt
version 3 - same as version 1
version 4 - echo "hello kitty" to sterr
version 5 - echo "hello kitty" to the file named 1

This illustrates the point of the ampersand syntax: it distinguishes between the output streams and files
named 1 or 2. Let's try running script version 4 as a sanity check to make sure these scripts are working as
expected:

28 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME $ # output saved to file but error printed to console


Sitemap $ ./hellokitty.sh > junk.txt
Section Contents hello kitty
Top

< > >>


hello kitty is indeed stderr because it's echoed to the console, not saved into junk.txt.

This syntax makes it easy to see how we could, e.g., redirect the standard error to standard output:

$ ./somescript.sh 2> &1 # redirect stderr to stdout

I rarely have occasion to do this and, although it's not something you need in your introductory unix toolkit,
it's good to know.

Conditional Logic TOP VIEW_AS_PAGE


Conditional Logic is a universal feature of programming languages. The basic idea is, if this condition, then
do something. It can be made more complex: if this condition, then do something; else if that condition, then
do another thing; else (if any other condition), then do yet another thing. Let's see how to implement this in
bash:

$ a=joe
$ if [ $a == "joe" ]; then echo hello; fi
hello

or:

$ a=joe
$ if [ $a == "joe" ]; then echo hello; echo hello; echo hello; fi
hello
hello
hello

The structure is:

if [ condition ]; then ... ; fi

Everything between the words then and fi (if backwards in case you didn't notice) will execute if the
condition is satisfied. In other languages, this block is often defined by curly brackets: { }. For example, in a
Perl script, the same code would be:

#!/usr/bin/env perl

my $a="joe";

if ( $a eq "joe" )
{
print "hello\n";
print "hello\n";
print "hello\n";
}

In bash, if is if, else is else, and else if is elif. In a script it would look like this:

#!/bin/bash

a=joe

if [ $a == "joe" ]; then
echo hello;
elif [ $a == "doe" ]; then
echo goodbye;
else
echo "ni hao";

29 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap

Section Contents You can also use a case statement to implement conditional logic. See an example of that here.
Top

< > >>


Although I said in the intro that unix is the best place to start your computer science education, I have to
admit that the syntax for if-then logic is somewhat unwieldy—even unfriendly. Bash is a bad teaching
language for conditional logic, arrays, hashes, etc. But that's only because its element is not heavy-duty
programming with lots of functions, numerical operations, sophisticated data structures, and logic. Its
mastery is over the quick and dirty, manipulating files and directories, and doing system stuff. I still maintain
it's the proper starting point because of its wonderful tools, and because knowing its fundamentals is a great
asset. Every language has its place in the programming ecosystem. Back in College, I stumbled on a
physics book called The Tiger and the Shark: Empirical Roots of Wave-Particle Dualism by Bruce Wheaton.
The book had a great epigraph:

It is like a struggle between a tiger and a shark,


each is supreme in his own element,
but helpless in that of the other.
J.J. Thomson, 1925

In our context, this would read: bash is supreme on the command line, but not inside of a script.

File Test Operators; Return or Exit Status TOP VIEW_AS_PAGE


File Test Operators and exit status are two completely different topics, but since they both go well with if
statements, I'll discuss them here. File Test Operators are things you can stick in an if statement to give you
information about a file. Two common problems are (1) checking if your file exists and (2) checking if it's non-
zero size: Let's create two files, one empty and one not:

$ touch emptyfile # create an empty file


$ echo joe > nonemptyfile # create a non-empty file

The operator -e tests for existence and -s tests for non-zero-ness:

$ file=emptyfile
$ if [ -e $file ]; then echo "exists"; if [ -s $file ]; then echo "non-0"; fi; fi
exists

$ file=nonemptyfile
$ if [ -e $file ]; then echo "exists"; if [ -s $file ]; then echo "non-0"; fi; fi
exists
non-0

Read The Linux Documentation Project's discussion of file test operators here.

Changing the subject altogether, you may be familiar with the idea of a return value in computer science.
Functions can return a value upon completion. In unix, commands also have a return value or exit code,
queryable with:

$?

This is usually employed to tell the user whether or not the command successfully executed. By convention,
successful execution returns 0. For example:

$ echo joe
joe
$ echo $? # query exit code of previous command
0

Let's see how the exit code can be useful. We'll make a script, test_exitcode.sh, such that:

$ cat test_exitcode.sh

30 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
#!/bin/bash

Sitemap
sleep 10
Section Contents

Top This script just pauses for 10 seconds. First, we'll let it run and then we'll interrupt it using Cntrl-c:
< > >>

$ ./test_exitcode.sh; # let it run


$ echo $?
0

$ ./test_exitcode.sh; # interrupt it
^C
$ echo $?
130

The non-zero exit code tells us that it's failed. Now we'll try the same thing with an if statement:

$ ./test_exitcode.sh
$ if [ $? == 0 ]; then echo "program succeeded"; else echo "program failed"; fi
program succeeded

$ ./test_exitcode.sh;
^C
$ if [ $? == 0 ]; then echo "program succeeded"; else echo "program failed"; fi
program failed

In research, you might run hundreds of command-line programs in parallel. For each instance, there are two
key questions: (1) Did it finish? (2) Did it run without error? Checking the exit status is the way to address the
second point. You should always check the program you're running to find information about its exit code,
since some use different conventions. Read The Linux Documentation Project's discussion of exit status
here.

Question: What's going on here?

$ if echo joe; then echo joe; fi


joe
joe

This is yet another example of bash allowing you to stretch syntax like silly putty. In this code snippet,

echo joe

is run, and its successful execution passes a true return code to the if statement. So, the two joes we see
echoed to the console are from the statement to be evaluated and the statement inside the conditional. We
can also invert this formula, doing something if our command fails:

$ outputdir=nonexistentdir # set output dir equal to a nonexistent dir


$ if ! cd $outputdir; then echo "couldnt cd into output dir"; fi
-bash: pushd: nonexistentdir: No such file or directory
couldnt cd into output dir

$ mkdir existentdir # make a test directory


$ outputdir=existentdir
$ if ! cd $outputdir; then echo "couldnt cd into output dir"; fi
$ # no error - now we're in the directory existentdir

Did you follow that? (! means logical NOT in unix.) The idea is, we try to cd but, if it's unsuccessful, we echo
an error message. This is a particularly useful line to include in a script. If the user gives an output directory
as an argument and the directory doesn't exist, we exit. If it does exist, we cd into it and it's business as
usual:

if ! cd $outputdir; then echo "[error] couldn't cd into output dir"; exit; fi

31 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
Without this line, the script will run in whatever directory it's in if cd fails. Once in lab, I was running a script
Sitemap that didn't have this kind of protection. The output directory wasn't found and the script starting making and
Section Contents deleting files in the wrong directory. It was powerfully uncool!
Top

< > >>


We can implement similar constructions using the && and || operators rather than an if statement. Let's see
how this works by making some test files:

$ touch file{1..4}
$ ls
file1 file2 file3 file4

The && operator will chug through a chain of commands and keep on going until one of the commands
fails, as in:

$ ( ls file1 ) && ( ls file2 ) && ( ls file3 ) && ( ls file4 )


file1
file2
file3
file4

$ ( ls file1 ) && ( ls file2 ) && ( ls fileX ) && ( ls file4 )


file1
file2
ls: cannot access fileX: No such file or directory

In contrast, the || operator will proceed through the command chain and stop after the first successful one,
as in:

$ ( ls file1 ) || ( ls file2 ) || ( ls file3 ) || ( ls file4 )


file1

$ ( ls fileX ) || ( ls fileY ) || ( ls fileZ ) || ( ls file4 )


ls: cannot access fileX: No such file or directory
ls: cannot access fileY: No such file or directory
ls: cannot access fileZ: No such file or directory
file4

Basic Loops TOP VIEW_AS_PAGE


In programming, loops are a way of performing operations iteratively. Loops come in different flavors, but the
for loop and while loop are the most basic. In bash, we can implement a for loop like this:

$ for i in 1 2 3; do echo $i; done


1
2
3

The structure is:

for variable in list; do ... ; done

Put anything you like in the list:

$ for i in 1 2 hello; do echo $i; done


1
2
hello

Many other languages wouldn't let you get away with combining data types in the iterations of a loop, but this
is a recurrent bash theme: it's fast; it's loose; it's malleable.

32 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
To count from 1 to 10, try:
Sitemap

Section Contents $ for i in {1..10}; do echo -n "$i "; done; echo


Top 1 2 3 4 5 6 7 8 9 10
< > >>

But if we can just write:

$ echo {1..10}

why do we need a loop here? Loops really come into their own in bash when—no surprise!—we're dealing
with files, paths, and commands. For example, to loop through all of the text files in the cwd, use:

$ for i in *.txt; do echo $i; done

Although this is nearly the same as:

$ ls *.txt

the former construction has the advantage that we can stuff as much code as we like in the block between
do and done. Let's make a random directory structure like so:

$ mkdir -p myfolder{1..3}/{X,Y}

We can populate it with token files (fodder for our example) via a loop:

$ j=0; for i in myfolder*/*; do echo "*** "$i" ***"; touch ${i}/a_${j}.txt ${i}/b_${j}.txt; ((j++)); done

In bash, ((j++)) is a way of incrementing j. We echo $i to get some visual feedback as the loop iterates.
Now our directory structure looks like this:

To practice loops, suppose we want to find any file that begins with b in any subfolder and make a symbolic
link to it from the cwd:

$ for i in myfolder*/*/b*; do echo "*** "$i" ***"; ln -s $i; done

As we learned above, a link is not a copy of a file but, rather, a kind of pointer that allows us to access a file
from a path other than the one where it actually resides. Our loop yields the links:

b_0.txt -> myfolder1/X/b_0.txt


b_1.txt -> myfolder1/Y/b_1.txt
b_2.txt -> myfolder2/X/b_2.txt
b_3.txt -> myfolder2/Y/b_3.txt

33 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
b_4.txt -> myfolder3/X/b_4.txt

Sitemap
b_5.txt -> myfolder3/Y/b_5.txt
Section Contents

Top allowing us to access the b files from the cwd.


< > >>

I can't overstate all the heroic things you can do with loops in bash. Suppose we want to change the
extension of any text file that begins with a and resides in an X subfolder from .txt to .html:

$ for i in myfolder*/X/a*.txt; do echo "*** "$i" ***"; j=$( echo $i | sed 's|\.txt|\.html|' ); echo $j; mv $i $j; echo; don

But I've jumped the gun! This example features three things we haven't learned yet: command substitution,
piping, and sed. You should revisit it after reading those sections, but the idea is that the variable j stores a
path that looks like our file's but has the extension replaced. And you see that a knowledge of loops is like a
stick of dynamite you can use to blow through large numbers of files.

Here's another contrived example with these yet-to-be-discussed techniques:

$ for i in $( echo $PATH | tr ":" " " ); do echo "*** "$i" ***"; ls $i | head; echo; done | less

Can you guess what this does? It shows the first ten commands in each folder in our PATH—not something
you'd likely need to do, but a demonstration of the fluidity of these constructions.

If we want to run a command or script in parallel, we can do that with loops, too. gzip is a utility to compress
files, thereby saving hard drive space. To compress all text files in the cwd, in parallel, do:

$ for i in *.txt; do { echo $i; gzip $i & }; done

But I've gotten ahead of myself again. We'll leave the discussion of this example to the section on processes.

The structure of a while loop is:

while condition; do ... ; done

I use while loops much less than for loops, but here's an example:

$ x=1; while ((x <= 3)); do echo $x; ((x++)); done


1
2
3

The while loop can also take input from a file. Suppose there's a file junk.txt such that:

$ cat junk.txt
1
2
3

You can iterate over this file as such:

$ while read x; do echo $x; done < junk.txt


1
2
3

Arguments to a Script TOP VIEW_AS_PAGE


Now that we've covered basic control flow, let's return to the subject of scripting. An important question is,
how can we pass arguments to our script? Let's make a script called hellokitty.sh:

#!/bin/bash

34 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
echo hello

Sitemap

Section Contents Try running it:


Top

< > >>


$ chmod 755 hellokitty.sh
$ ./hellokitty.sh
hello

We can change it to the following:

#!/bin/bash

echo hello $1

Now:

$ ./hellokitty.sh kitty
hello kitty

In bash $1 represents the first argument to the script, $2 the second, and so on. If our script is:

#!/bin/bash

echo $0
echo hello $1 $4

Then:

$ ./hellokitty.sh my sweet kitty cat


./hellokitty.sh
hello my cat

In most programming languages, arguments passed in on the command line are stored as an array. Bash
stores the nth element of this array in the variable $n. $0 is special and refers to the name of the script itself.

For casual scripts this suits us well. However, as you go on to write more involved programs with many
options, it becomes impractical to rely on the position of an argument to determine its function in your script.
The proper way to do this is using flags that can be deployed in arbitrary order, as in:

command --flag1 1 --flag2 1 --flag3 5

or, in short form:

command -f1 1 -f2 1 -f3 5

You can do this with the command getopts, but it's sometimes easier just to write your own options parser.
Here's a sample script called test_args. Although a case statement would be a good way to handle
numerous conditions, I'll use an if statement:

#!/bin/bash

helpmessage="This script showcases how to read arguments"

### get arguments


# while input array size greater than zero
while (($# > 0)); do
if [ "$1" == "-h" -o "$1" == "-help" -o "$1" == "--help" ]; then
shift;
echo "$helpmessage"
exit;
elif [ "$1" == "-f1" -o "$1" == "--flag1" ]; then
# store what's passed via flag1 in var1
shift; var1=$1; shift

35 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
elif [ "$1" == "-f2" -o "$1" == "--flag2" ]; then

Sitemap
shift; var2=$1; shift
Section Contents
elif [ "$1" == "-f3" -o "$1" == "--flag3" ]; then
Top shift; var3=$1; shift
< > >> # if unknown argument, just shift
else
shift

done

### main
# echo variable if not empty
if [ ! -z $var1 ]; then echo "flag1 passed "$var1; fi
if [ ! -z $var2 ]; then echo "flag2 passed "$var2; fi
if [ ! -z $var3 ]; then echo "flag3 passed "$var3; fi

This has some things we haven't seen yet:

$# is the size of our input argument array


shift pops an element off of our array (the same as in Perl)
exit exits the script
-o is logical OR in unix
-z checks if a variable is empty

The code loops through the argument array and keeps popping off elements until the array size is zero,
whereupon it exits the loop. For example, one might run this script as:

$ ./test_args --flag1 x -f2 y --flag3 zzz


flag1 passed x
flag2 passed y
flag3 passed zzz

To spell out how this works, the first argument is --flag1. Since this matches one of our checks, we shift.
This pops this element out of our array, so the first element, $1, becomes x. This is stored in the variable
var1, then there's another shift and $1 becomes -f2, which matches another condition, and so on.

The flags can come in any order:

$ ./test_args --flag3 x --flag1 zzz


flag1 passed zzz
flag3 passed x

$ ./test_args --flag2 asdf


flag2 passed asdf

We're brushing up against the outer limits of bash here. My prejudice is that you usually shouldn't go this far
with bash, because its limitations will come sharply into focus if you try to do too-involved scripting. Instead,
use a more friendly language. In Perl, for example, the array containing inputs is @ARGV; in Python, it's
sys.argv. Let's compare these common scripting languages:

Bash Perl Python Description


$0 $0 sys.argv[0] Name of Script Itself
$* String Containing All Input Arguments
[1]
("$@") @ARGV sys.argv Array or List Containing All Input Arguments
$1 $ARGV[0] sys.argv[1] First Argument
$2 $ARGV[1] sys.argv[2] Second Argument

Perl has a Getopt package that is convenient for reading arguments, and Python has an even better one
called argparse. Their functionality is infinitely nicer than bash's, so steer clear of bash if you're going for a

36 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
script with lots of options.
Sitemap

Section Contents

Top

< > >> [1] The distinction between $* and $@ is knotty. Dive into these subtleties on Stackoverflow ↑

Multi-Line Comments, Multi-Line Strings in Bash TOP VIEW_AS_PAGE

Let's continue in the realm of scripting. You can do a multi-line comment in bash with an if statement:

# multi-line comment
if false; then
echo hello
echo hello
echo hello

(Yes, this is a bit of a hack!)

Multi-line strings are handy for many things. For example, if you want a help section for your script, you can
do it like this:

cat <<_EOF_

Usage:

$0 --flag1 STRING [--flag2 STRING] [--flag3 STRING]

Required Arguments:

--flag1 STRING This argument does this

Options:

--flag2 STRING This argument does that


--flag3 STRING This argument does another thing

_EOF_

How does this syntax work? Everything between the _EOF_ tags comprises the string and is printed. This is
called a Here Document. Read The Linux Documentation Project's discussion of Here Documents here.

Source and Export TOP VIEW_AS_PAGE


Question: If we create some variables in a script and exit, what happens to those variables? Do they
disappear? The answer is, yes, they do. Let's make a script called test_src.sh such that:

$ cat ./test_src.sh
#!/bin/bash

myvariable=54
echo $myvariable

If we run it and then check what happened to the variable on our command line, we get:

$ ./test_src.sh
54
$ echo $myvariable

The variable is undefined. The command source is for solving this problem. If we want the variable to
persist, we run:

37 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME $ source ./test_src.sh


Sitemap 54
Section Contents $ echo $myvariable
Top 54
< > >>

and—voilà!—our variable exists in the shell. An equivalent syntax for sourcing uses a dot:

$ . ./test_src.sh # this is the same as "source ./test_src.sh"


54

But now observe the following. We'll make a new script, test_src_2.sh, such that:

$ cat ./test_src_2.sh
#!/bin/bash

echo $myvariable

This script is also looking for $myvariable. Running it, we get:

$ ./test_src_2.sh

Nothing! So $myvariable is defined in the shell but, if we run another script, its existence is unknown. Let's
amend our original script to add in an export:

$ cat ./test_src.sh
#!/bin/bash

export myvariable=54 # export this variable


echo $myvariable

Now what happens?

$ ./test_src.sh
54
$ ./test_src_2.sh

Still nothing! Why? Because we didn't source test_src.sh. Trying again:

$ source ./test_src.sh
54
$ ./test_src_2.sh
54

So, at last, we see how to do this. If we want access on the shell to a variable which is defined inside a
script, we must source that script. If we want other scripts to have access to that variable, we must source
plus export.

Dotfiles (.bashrc and .bash_profile) TOP VIEW_AS_PAGE


Dotfiles are simply files that begin with a dot. We can make a test one as follows:

$ touch .test

Such a file will be invisible in the GUI and you won't see it with vanilla ls either. (This works the same way for
directories.) The only way to see it is to use the list all option:

ls -al

or to list it explicitly by name. This is useful for files that you generally want to keep hidden from the user or

38 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
discourage tinkering with.
Sitemap

Section Contents Many programs, such as bash, Vim, and Git, are highly configurable. Each uses dotfiles to let the user add
Top
functionality, change options, switch key bindings, etc. For example, here are some of the dotfiles files each
< > >>
program employs:

bash - .bashrc
vim - .vimrc
git - .gitconfig

The most famous dotfile in my circle is .bashrc which resides in HOME and configures your bash. Actually,
let me retract that: let's say .bash_profile instead of .bashrc (read about the difference here). In any case, the
idea is that this dotfile gets executed as soon as you open up the terminal and start a new session. It is
therefore ideal for setting your PATH and other variables, adding functions (like this one), creating aliases
(discussed below), and doing any other setup related chore. For example, suppose you download a new
program into /some/path/to/prog and you want to add it to your PATH. Then in your .bash_profile you'd
add:

export PATH=/some/path/to/prog:$PATH

Recalling how export works, this will allow any programs we run on the command line to have access to our
amended PATH. Note that we're adding this to the front of our PATH (so, if the program exists in our PATH
already, the existing copy will be superseded). Here's an example snippet of my setup file:

PATH=/apps/python/2.7.6/bin:$PATH # use this version of Python


PATH=/apps/R/3.1.2/bin:$PATH # use this version of R
PATH=/apps/gcc/4.6.0/bin/:$PATH # use this version of gcc
export PATH

There is much ado about .bashrc (read .bash_profile) and it inspired one of the greatest unix blog-post titles
of all time: Pimp my .bashrc—although this blogger is only playing with his prompt, as it were. As you go on
in unix and add things to your .bash_profile, it will evolve into a kind of fingerprint, optimizing bash in your
own unique way (and potentially making it difficult for others to use).

If you have multiple computers, you'll want to recycle much of your program configurations on all of them. My
co-worker uses a nice system I've adopted where the local and global aspects of setup are separated. For
example, if you wanted to use certain aliases across all your computers, you'd put them in a global settings
file. However, changes to your PATH might be different on different machines, so you'd store this in a local
settings file. Then any time you change computers you can simply copy the global files and get your familiar
setup, saving lots of work. A convenient way to accomplish this goal of a unified shell environment across all
the systems you work on is to put your dotfiles on a server, like GitHub or Bitbucket, you can access from
anywhere. This is exactly what I've done and you can get the up-to-date versions of my dotfiles on GitHub.

Here's a sketch of how this idea works: in HOME make a .dotfiles/bash directory and populate it with your
setup files, using a suffix of either local or share:

$ ls -1 .dotfiles/bash/
bash_aliases_local
bash_aliases_share
bash_functions_share
bash_inirun_local
bash_paths_local
bash_settings_local
bash_settings_share
bash_welcome_local
bash_welcome_share

When .bash_profile is called at the startup of your session, it sources all these files:

39 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME # the directory where bash configuration files reside


Sitemap INIT_DIR="${HOME}/.dotfiles/bash"
Section Contents

Top # to make local configurations, add these files into this directory:
< > >> # bash_aliases_local
# bash_paths_local
# bash_settings_local
# bash_welcome_local

# this line, e.g., protects the functionality of rsync by only turning on the below if the shell is in interactive mod
# In particular, rsync fails if things are echo-ed to the terminal
[[ "$-" != *i* ]] && return

# bash welcome
if [ -e "${INIT_DIR}/bash_welcome_local" ]; then
cat ${INIT_DIR}/bash_welcome_local
elif [ -e "${INIT_DIR}/bash_welcome_share" ]; then
cat ${INIT_DIR}/bash_welcome_share

#--------------------LOCAL------------------------------
# aliases local
if [ -e "${INIT_DIR}/bash_aliases_local" ]; then
source "${INIT_DIR}/bash_aliases_local"
echo "bash_aliases_local loaded"

# settings local
if [ -e "${INIT_DIR}/bash_settings_local" ]; then
source "${INIT_DIR}/bash_settings_local"
echo "bash_settings_local loaded"

# paths local
if [ -e "${INIT_DIR}/bash_paths_local" ]; then
source "${INIT_DIR}/bash_paths_local"
echo "bash_paths_local loaded"

#---------------SHARE-----------------------------
# aliases share
if [ -e "${INIT_DIR}/bash_aliases_share" ]; then
source "${INIT_DIR}/bash_aliases_share"
echo "bash_aliases_share loaded"

# settings share
if [ -e "${INIT_DIR}/bash_settings_share" ]; then
source "${INIT_DIR}/bash_settings_share"
echo "bash_settings_share loaded"

# functions share
if [ -e "${INIT_DIR}/bash_functions_share" ]; then
source "${INIT_DIR}/bash_functions_share"
echo "bash_functions_share loaded"

A word of caution: echoing things in your .bash_profile, as I'm doing here, can be dangerous and break the
functionaly of utilities like scp and rsync. However, we protect against this with the cryptic line near the top.

Taking care of bash is the hard part. Other programs are less of a chore because, even if you have different
programs in your PATH on your home and work computers, you probably want everything else to behave
the same. To accomplish this, just drop all your other configuration files into your .dotfiles repository and link

40 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
to them from your home directory:
Sitemap

Section Contents .gitconfig -> .dotfiles/.gitconfig


Top .vimrc -> .dotfiles/.vimrc
< > >>

Working Faster with Readline Functions and Key Bindings TOP VIEW_AS_PAGE

If you've started using the terminal extensively, you might find that things are a bit slow. Perhaps you need
some long command you wrote yesterday and you don't want to write the damn thing again. Or, if you want
to jump to the end of a line, it's tiresome to move the cursor one character at a time. Failure to immediately
solve these problems will push your productivity back into the stone age and you may end up swearing off
the terminal as a Rube Goldberg-ian dystopia. So—enter keyboard shortcuts!

The backstory about shortcuts is that there are two massively influential text editors, Emacs and Vim, whose
users—to be overdramatic—are divided into two warring camps. Each program has its own conventions for
shortcuts, like jumping words with your cursor, and in bash they're Emacs-flavored by default. But you can
toggle between either one:

$ set -o emacs # Set emacs-style key bindings (this is the default)


$ set -o vi # Set vi-style key bindings

Although I prefer Vim as a text-editor, I use Emacs key bindings on the command line. The reason is that in
Vim there are multiple modes (normal mode, insert mode, command mode). If you want to jump to the front
of a line, you have to switch from insert mode to normal mode, which breaks up the flow a little. In Emacs
there's no such complication. Emacs commands usually start with the Control key or the Meta key (usually
Esc). Here are some things you can do:

Cntrl-a - jump cursor to beginning of line


Cntrl-e - jump cursor to end of line
Cntrl-k - delete to end of line
Cntrl-u - delete to beginning of line
Cntrl-w - delete back one word
Cntrl-y - paste (yank) what was deleted with the above shortcuts
Cntrl-r - reverse-search history for a given word
Cntrl-c - kill the process running in the foreground; don't execute current line on the command line
Cntrl-z - suspend the process running in the foreground
Cntrl-l - clear screen. (this has an advantage over the unix command clear in that it works in the
Python, MySQL, and other shells)
Cntrl-d - end of transmission (in practice, often synonymous with quit - e.g., exiting the Python or
MySQL shells)
Cntrl-s - freeze screen
Cntrl-q - un-freeze screen

These are supremely useful! I use these numerous times a day. (On the Mac, the first three even work in the
Google search bar!) The first bunch of these fall under the umbrella of ReadLine Functions (read GNU's
extensive documentation here). There are actually tons more, and you can see them all by entering:

$ bind -P # show all Readline Functions and their key bindings


$ bind -l # show all Readline Functions

Four of the most excellent Readline Functions are:

forward-word - jump cursor forward a word


backward-word - jump cursor backward a word
history-search-backward - scroll through your bash history backward
history-search-forward - scroll through your bash history forward

For the first two—which are absolutely indispensable—you can use the default Emacs way:

41 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME Meta-f - jump forward one word


Sitemap Meta-b - jump backward one word
Section Contents

Top However, reaching for the Esc key is a royal pain in the ass—you have to re-position your hands on the
< > >>
keyboard. This is where key-binding comes into play. Using the command bind, you can map a Readline
Function to any key combination you like. Of course, you should be careful not to overwrite pre-existing key
bindings that you want to use. I like to map the following keys to these Readline Functions:

Cntrl-forward-arrow - forward-word
Cntrl-backward-arrow - backward-word
up-arrow - history-search-backward
down-arrow - history-search-forward

In my .bash_profile (or, more accurately, in my global bash settings file) I use:

# make cursor jump over words


bind '"\e[5C": forward-word' # control+arrow_right
bind '"\e[5D": backward-word' # control+arrow_left

# make history searchable by entering the beginning of command


# and using up and down keys
bind '"\e[A": history-search-backward' # arrow_up
bind '"\e[B": history-search-forward' # arrow_down

[1]
(although these may not work universally .) How does this cryptic symbology translate into these particular
keybindings? There's a neat trick you can use, to be revealed in the next section.

Tip: On Mac, you can move your cursor to any position on the line by holding down Option and clicking your
mouse there. I rarely use this, however, because it's faster to make your cursor jump via the keyboard.

[1] If you have trouble getting this to work on OS's terminal, try iTerm2 instead, as described here ↑

More on Key Bindings, the ASCII Table, Control-v TOP VIEW_AS_PAGE


Before we get to the key binding conundrum, let's review ASCII. This is, simply, a way of mapping every
character on your keyboard to a numeric code. As Wikipedia puts it:

The American Standard Code for Information Interchange (ASCII) is a character-encoding scheme originally
based on the English alphabet that encodes 128 specified characters—the numbers 0-9, the letters a-z and
A-Z, some basic punctuation symbols, some control codes that originated with Teletype machines, and a
blank space—into the 7-bit binary integers.

For example, the character A is mapped to the number 65, while q is 113. Of special interest are the control
characters, which are the representations of things that cannot be printed like return or delete. Again from
Wikipedia, here is the portion of the ASCII table for these control characters:

Binary Oct Dec Hex Abbr [a] [b] [c] Name


000 0000 000 0 00 NUL ␀ ^@ \0 Null character
000 0001 001 1 01 SOH ␁ ^A Start of Header
000 0010 002 2 02 STX ␂ ^B Start of Text
000 0011 003 3 03 ETX ␃ ^C End of Text
000 0100 004 4 04 EOT ␄ ^D End of Transmission
000 0101 005 5 05 ENQ ␅ ^E Enquiry
000 0110 006 6 06 ACK ␆ ^F Acknowledgment
000 0111 007 7 07 BEL ␇ ^G \a Bell
000 1000 010 8 08 BS ␈ ^H \b Backspace
000 1001 011 9 09 HT ␉ ^I \t Horizontal Tab
000 1010 012 10 0A LF ␊ ^J \n Line feed

42 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME 000 1011 013 11 0B VT ␋ ^K \v Vertical Tab


Sitemap 000 1100 014 12 0C FF ␌ ^L \f Form feed
Section Contents
000 1101 015 13 0D CR ␍ ^M \r Carriage return
Top
000 1110 016 14 0E SO ␎ ^N Shift Out
< > >>
000 1111 017 15 0F SI ␏ ^O Shift In
001 0000 020 16 10 DLE ␐ ^P Data Link Escape
001 0001 021 17 11 DC1 ␑ ^Q Device Control 1 (oft. XON)
001 0010 022 18 12 DC2 ␒ ^R Device Control 2
001 0011 023 19 13 DC3 ␓ ^S Device Control 3 (oft. XOFF)
001 0100 024 20 14 DC4 ␔ ^T Device Control 4
001 0101 025 21 15 NAK ␕ ^U Negative Acknowledgement
001 0110 026 22 16 SYN ␖ ^V Synchronous idle
001 0111 027 23 17 ETB ␗ ^W End of Transmission Block
001 1000 030 24 18 CAN ␘ ^X Cancel
001 1001 031 25 19 EM ␙ ^Y End of Medium
001 1010 032 26 1A SUB ␚ ^Z Substitute
001 1011 033 27 1B ESC ␛ ^[ \e Escape
001 1100 034 28 1C FS ␜ ^\ File Separator
001 1101 035 29 1D GS ␝ ^] Group Separator
001 1110 036 30 1E RS ␞ ^^ Record Separator
001 1111 037 31 1F US ␟ ^_ Unit Separator
111 1111 177 127 7F DEL ␡ ^? Delete

([a], [b], and [c] refer to different notations—unicode, caret notation, and escape codes.)

So, the punchline: on the terminal you can press Cntrl-v followed by a special key, like up-arrow or delete, to
see its key binding. For example, what's the code for the up-arrow key? Press Cntrl-v up-arrow. On my
computer the result is:

$ ^[[A

Cntrl-v down-arrow is:

$ ^[[B

while Cntrl-v Cntrl-left-arrow is:

$ ^[[5D

and so on. These may be different on your computer. As the chart above shows us, the ^[ is the terminal's
notation for Escape (it can also be represented as 033 or \e). To state the obvious, a sequence of characters
following the escape character can take on a life of its own: Esc-f means something different than f. So, after
all this effort, we finally get the payoff of understanding how the following lines work:

# make cursor jump over words


bind '"\e[5C": forward-word' # control+arrow_right
bind '"\e[5D": backward-word' # control+arrow_left

# make history searchable by entering the beginning of command


# and using up and down keys
bind '"\e[A": history-search-backward' # arrow_up
bind '"\e[B": history-search-forward' # arrow_down

If you want to use different key bindings than mine or more functions, go for it, but the important thing is that
you make use of the Readline Functions—they will save you loads of time. Remember, you can list their
names with bind -l.

43 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap Note: On the Mac you can also see and edit some key bindings for the terminal in:
Section Contents

Top
Terminal > Preferences > Settings > Keyboard
< > >>
Screenshot:

Aliases, Functions TOP VIEW_AS_PAGE


Let's look at another convenience bash offers: the alias command. Aliasing is a way of mapping one word to
another. It can reduce your typing burden by making a shorter expression stand for a longer one:

alias c="cat"

This means every time you type a c the terminal is going to read it as cat, so instead of writing:

$ cat file.txt

you just write:

$ c file.txt

Another use of alias is to weld particular flags onto a command, so every time the command is called, the
flags go with it automatically, as in:

alias cp="cp -R"

or

alias mkdir="mkdir -p"

Recall the former allows you to copy directories as well as files, and the later allows you to make nested
directories. Perhaps you always want to use these options, but this is a tradeoff between convenience and
freedom. In general, I prefer to use new words for aliases and not overwrite preexisting bash commands.
Here are some aliases I use in my setup file (see the complete list here):

alias c="cat"
alias s="less -S"
alias l="ls -hl"
alias lt="ls -hlt"
alias ll="ls -al"
alias rr="rm -r"
alias r="readlink -m"
alias ct="column -t"

44 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
alias ch="chmod -R 755"

Sitemap
alias chh="chmod -R 644"
Section Contents
alias grep="grep --color"
Top alias yy="rsync -azv --progress"
< > >> # remove empty lines with white space
alias noempty="perl -ne '{print if not m/^(\s*)$/}'"
alias awkf="awk -F'\t'"
alias length="awk '{print length}'"

Aliases are a godsend. But they also have their limitations. If you're familiar with git, you know the following
commands might go together:

$ git add .
$ git commit -m "some message"
$ git push

If you always want to call them together, you can put them in a function which gets sourced in your setup
file. We'll call this function gup for git update:

# stage all changes, commit, then push


gup ()
{
local mymessage="next update";

# if $1 not zero length


if [ ! -z "$1" ]; then
mymessage=$1

git add .
git commit -m "$mymessage"
git push
}

A couple of notes about functions in bash: (1) the arguments to a functions are retrieved as $1, $2, etc., just
as in a script; (2) if you're making a function in a script, variables are global by default unless you declare
them as local. I declared mymessage as a local variable, even though in this case there's no danger I'd
confuse it with a global variable of the same name.

This teaches us how to build functions but it's not terribly useful, because because you can git add and git
commit in a single step anyway—so this is a lot of overhead merely to call two commands together. The
Linux Documentation Project provides a sample .bashrc with the following more interesting function:

extract () {
if [ -f $1 ] ; then
case $1 in
*.tar.bz2) tar xvjf $1 ;;
*.tar.gz) tar xvzf $1 ;;
*.bz2) bunzip2 $1 ;;
*.rar) unrar x $1 ;;
*.gz) gunzip $1 ;;
*.tar) tar xvf $1 ;;
*.tbz2) tar xvjf $1 ;;
*.tgz) tar xvzf $1 ;;
*.zip) unzip $1 ;;
*.Z) uncompress $1 ;;
*.7z) 7z x $1 ;;
*) echo "don't know how to extract '$1'..." ;;
esac
else
echo "'$1' is not a valid file!"

}

45 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
There are many ways to compress files in unix, such as zip and bzip2. And the command tar is for archiving
Sitemap —taking a whole directory structure and rolling it up into a single file (sometimes called a tarball). This
Section Contents function serves as a one-size-fits-all command to untar and/or uncompress these many different
Top
compression formats. Note that, because there are so many cases, it's better to use a case statement than
< > >>
an if statement.

To use this function, the syntax would simply be:

$ extract my_compressed_file.gz

$ extract my_compressed_file.bz2

$ extract my_compressed_tarball.tar.gz

The Top 20 Indispensable Unix Commands TOP VIEW_AS_PAGE


Before going any further, let's learn some more bedrock commands that—according to any unix primer—it
would be impossible to get by without knowing:

1. pwd
2. ls
3. cd
4. mkdir
5. echo
6. cat
7. cp
8. mv
9. rm
10. man
11. head
12. tail
13. less
14. more
15. sort
16. grep
17. which
18. chmod
19. history
20. clear

We've already seen the first 10, along with which and chmod. The easiest new one on the above list is
clear, which simply clears your screen. We'll cover the rest below.

head and tail TOP VIEW_AS_PAGE


head and tail print the first or last n lines of a file, where n is 10 by default. For example:

$ head myfile.txt # print the first 10 lines of the file


$ head -1 myfile.txt # print the first line of the file
$ head -50 myfile.txt # print the first 50 lines of the file

$ tail myfile.txt # print the last 10 lines of the file


$ tail -1 myfile.txt # print the last line of the file

These are great alternatives to cat, because you usually don't want to spew out a giant file. You only want to
peek at it, get a sense of the formatting, or hone in on some specific portion. If you combine head and tail
together in the same command chain—we'll see how to do this in the section about unix pipelines—you can
get a row of your file by number.

46 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap Another thing I like to do with head is look at multiple files simultaneously. For example, whereas cat
Section Contents concatenates files together:
Top

< > >>


$ cat hello.txt
hello
hello
hello

$ cat kitty.txt
kitty
kitty
kitty

$ cat hello.txt kitty.txt


hello
hello
hello
kitty
kitty
kitty

head will print out the name of the file when it takes multiple arguments, as in:

$ head -2 hello.txt kitty.txt


==> hello.txt <==
hello
hello

==> kitty.txt <==


kitty
kitty

This is useful if you're previewing many files—say doing:

$ head *

less and more TOP VIEW_AS_PAGE


less is, as the manual pages say, "a filter for paging through text one screenful at a time...which allows
backward movement in the file as well as forward movement." If you have a big file, vanilla cat is not a
suitable command because printing thousands of lines of text to stdout will flood your screen. Instead, use
less, the go-to command for viewing files in the terminal:

$ less myfile.txt # view the file page by page

Type the arrow keys to scroll up and down, Space to page down, and q to exit. Another nice thing about
less: it has many Vim-like features you can read about on its man page, and this is not a coincidence. For
example, if you want to search for the word apple in your file, you just type slash ( / ) followed by apple.

If you have a file with many columns, it's hard to view in the terminal. A neat less flag to solve this problem is
-S:

$ less -S myfile.txt # allow horizontal scrolling

This enables horizontal scrolling instead of having rows messily wrap onto the next line. This flag works
particularly well in combination with the column command, which forces the columns of your file to line up
nicely:

cat myfile.txt | column -t | less -S

47 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME (this construction will be clearer when we learn about unix pipes below.) column delimits on whitespace by
Sitemap default, so if your fields themselves contain spaces and you want to delimit on tabs, amend it to:
Section Contents

Top
cat myfile.txt | column -s' ' -t | less -S
< > >>

(where you make a tab in the terminal by typing Cntrl-v tab). This makes the terminal feel almost like an
Excel spreadsheet. Observe how it changes the viewing experience for this file of fake financial data:

I included less and more together because I think about them as a pair, but I told a little white lie in calling
more indispensable: you really only need to use less, which is an improved version of more. Less is more
:-)

grep TOP VIEW_AS_PAGE


Unix has many file processing utilities, and grep and sort are among them. These are tremendously useful
commands for gleaning information about files. grep is the terminal's analog of find from ordinary computing
(not to be confused with unix find). If you've ever used Safari or Chrome or Microsoft Word, you can find a
word with ⌘F (Command-f) on Macintosh. Similarly, grep searches for text in a file and returns the line(s)
where it finds a match. For example, if you were searching for the word apple in your file, you'd do:

$ grep apple myfile.txt # return lines of file with the text apple

grep has many nice flags, such as:

$ grep -n apple myfile.txt # include the line number


$ grep -i apple myfile.txt # case insensitive matching
$ grep --color apple myfile.txt # color the matching text

Also useful are what I call the ABCs of Grep—that's After, Before, Context. Here's what they do:

$ grep -A1 apple myfile.txt # return lines with the match,


# as well as 1 after

$ grep -B2 apple myfile.txt # return lines with the match,


# as well as 2 before

$ grep -C3 apple myfile.txt # return lines with the match,


# as well as 3 before and after.

48 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME You can also do an inverse grep with the -v flag. To find lines that don't contain apple, try:
Sitemap

Section Contents $ grep -v apple myfile.txt # return lines that don't contain apple
Top

< > >>


To find any occurrence of apple in any file in some directory, use the recursive flag:

$ grep -R apple mydirectory/ # search for apple in any file in mydirectory

You can exit after, say, finding the first two instances of apple, so you don't waste more time searching:

$ grep -m 2 apple myfile.txt

There are more powerful variants of grep, like egrep, which permits the use of regular expressions (more
on these later), as in:

$ egrep "apple|orange" myfile.txt # return lines with apple OR orange

as well as other fancier grep-like tools, such as ack, available for download. For some reason—perhaps
because it's useful in a quick and dirty way and doesn't have any other meanings in English—grep has
inspired a peculiar cult following. There are grep t-shirts, grep memes, a grep function in Perl, and—
unbelievably—even a whole O'Reilly book devoted to the command:

(Image credit: O'Reilly Media)

sort TOP VIEW_AS_PAGE


As you guessed, the command sort sorts files. It has a large man page, but we can learn its basic features
by example. Let's suppose we have a file, testsort.txt, such that:

$ cat testsort.txt
vfw 34 awfjo
a 4 2
f 10 10
beb 43 c
f 2 33
f 1 ?

Then:

$ sort testsort.txt
a 4 2
beb 43 c
f 1 ?
f 10 10
f 2 33
vfw 34 awfjo

49 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME What happened? The default behavior of sort is to dictionary sort the rows of a file according to what's in the
Sitemap first column, then second column, and so on. Where the first column has the same value—f in this
Section Contents
example—the values of the second column determine the order of the rows. Dictionary sort means that
Top
things are sorted as they would be in a dictionary: 1,2,10 gets sorted as 1,10,2. If you want to do a numerical
< > >>
sort, use the -n flag; if you want to sort in reverse order, use the -r flag. You can also sort according to a
specific column. The notation for this is:

sort -kn,m

where n and m are numbers which refer to the range column n to column m. In practice, it may be easier to
use a single column rather than a range so, for example:

sort -k2,2

means sort by the second column (technically, from column 2 to column 2).

To sort numerically by the second column:

$ sort -k2,2n testsort.txt


f 1 ?
f 2 33
a 4 2
f 10 10
vfw 34 awfjo
beb 43 c

As is often the case in unix, we can combine flags as much as we like.

Question: What does this do?

$ sort -k1,1r -k2,2n testsort.txt


vfw 34 awfjo
f 1 ?
f 2 33
f 10 10
beb 43 c
a 4 2

Answer: The file has been sorted first by the first column, in reverse dictionary order, and then—where the
first column is the same—by the second column in numerical order. You get the point!

Two more notes about sort. Sometimes it is necessary to sort rows uniquely and the flag for this is -u:

$ sort -u testsort.txt # sort uniquely

To get really in the weeds, another interesting flag is -T:

$ sort -T /my/tmp/dir testsort.txt # sort using a designated tmp directory

We touched on this briefly in the section about global variables. Behind the curtain, sort does its work by
making temporary files, and it needs a place to put those files. By default, this is the directory set by
TMPDIR, but if you have a giant file to sort, you might have reason to instruct sort to use another directory
and that's what this flag does.

history TOP VIEW_AS_PAGE


Bash is a bit like the NSA in that it's secretly recording everything you do—at least on the command line. But
fear not: unless you're doing something super unsavory, you want your history preserved because having
access to previous commands you've entered in the shell saves a lot of labor. You can see your history with
the command history:

$ history

50 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME The easiest way to search the history, as we've seen, is to bind the Readline Function history-search-
Sitemap backward to something convenient, like the up arrow. Then you just press up to scroll backwards through
Section Contents
your history. So, if you enter a c, pressing up will step through all the commands you entered that began with
Top
c. If you want to find a command that contains the word apple, a useful tool is reverse intelligent search,
< > >>
which is invoked with Cntrl-r:

(reverse-i-search)`':

Although we won't cover unix pipelines until the next section, I can't resist giving you a sneak-preview. An
easier way to find any commands you entered containing apple is:

$ history | grep apple

If you wanted to see the last 10 commands you entered, it would be:

$ history | tail

What's going on under the hood is somewhat complicated. Bash actually records your command history in
two ways: (1) it stores it in memory—the history list—and (2) it stores it in a file—the history file. There are a
slew of global variables that mediate the behavior of history, but some important ones are:

HISTFILE - the path to the history file


HISTSIZE - how many commands to store in the history list (memory)
HISTFILESIZE - how many commands to store in the history file

Typically, HISTFILE is a dotfile residing in HOME:

~/.bash_history

It's important to understand the interplay between the history list and the history file. In the default setup,
when you type a command at the prompt it goes into your history list—and is thus revealed via history—but
it doesn't get written into your history file until you log out. The next time you log in, the contents of your
history file are automatically read into memory (your history list) and are thus searchable in your session. So,
what's the difference between the following two commands?

$ history | tail
$ tail ~/.bash_history

The former will show you the last 10 commands you entered in your current session while the later will show
you last 10 commands from the previous session. This is all well and good, but let's imagine the following
scenario: you're like me and you have 5 or 10 different terminal windows open at the same time. You're
constantly switching windows and entering commands, but history-search is such a useful function that you
want any command you enter in any one of the 5 windows to be immediately accessible on all the others.
We can accomplish this by putting the following lines in our setup dotfile (.bash_profile):

# append history to history file as you type in commands


shopt -s histappend
export PROMPT_COMMAND='history -a'

How does this bit of magic work? Here's what the histappend option does, to quote from the man page of
shopt:

If set, the history list is appended to the history file when the shell exits, rather than overwriting the history file.
shopt -s histappend
To append every line to history individually set:
PROMPT_COMMAND='history -a'
With these two settings, a new shell will get the history lines from all previous shells instead of the default
'last window closed'>history (the history file is named by the value of the HISTFILE variable)

Let's break this down. shopt stands for "shell options" and is for enabling and disabling various
miscellaneous options. The

51 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
history -a
Sitemap

Section Contents part will "Append the new history lines (history lines entered since the beginning of the current Bash session)
Top
to the history file" (as the man page says). And the global variable PROMPT_COMMAND is a rather funny
< > >>
one that executes whatever code is stored in it right before each printing of the prompt. Put these together
and you're immediately updating the ~/.bash_history file with every command instead of waiting for this to
happen at logout. Since every shell can contribute in real time, you can run multiple shells in parallel and
have access to a common history on all of them—a good situation.

What if you are engaged in unsavory behavior and want to cover your tracks? You can clear your history as
follows:

$ history -c # clear the history list in memory

However, this only deletes what's in memory. If you really want to be careful, you had better check your
history file, .bash_history, and delete any offending portions. Or just wipe the whole thing:

$ echo > ~/.bash_history

You can read more about history on gnu.org.

A wise man once said, "Those who don't know history are destined to [re-type] it." Often it's necessary to
retrace your footsteps or repeat some commands. In particular, if you're doing research, you'll be juggling
lots of scripts and files and how you produced a file can quickly become mysterious. To deal with this, I like
to selectively keep shell commands worth remembering in a "notes" file. If you looked on my computer, you'd
see notes files scattered everywhere. You might protest: but these are in your history, aren't they? Yes, they
are, but the history is gradually erased; it's clogged with trivial commands like ls and cd; and it doesn't have
information about where the command was run. A month from now, your ~/.bash_history is unlikely to have
that long command you desperately need to remember, but your curated notes file will.

To make this easy I use the following alias:

alias n="history | tail -2 | head -1 | tr -s ' ' | cut -d' ' -f3- | awk '{print \"# \"\$0}' >> notes"

which—you know the refrain!—will be easier to understand after we learn pipes. To use this, just type n (for
notesappend) after a command:

$ ./long_hard-to-remember_command --with_lots --of_flags > poorly_named_file


$n

Now a notes file has been created (or appended to) in our cwd and we can look at it:

$ cat notes
# ./long_hard-to-remember_command --with_lots --of_flags > poorly_named_file

I use notesappend almost as much as I use the regular unix utilities.

Piping in Unix TOP VIEW_AS_PAGE


Piping is, without a shred of exaggeration, one of the greatest things in unix. To pipe in unix is to string
commands together such that the output of the previous one becomes the input of the next one. It's the cat's
meow! The beauty of piping is that commands become modular components—building blocks you can snap
together a million different ways. A vertical line ( | ) is the syntactic connector:

$ cat file.txt | sort | less

Let's parse this: instead of going to stdout, the output of cat goes into sort, and the output of sort, in turn,
goes into less, whose output finally lands on our screen. This is perfect when you have a big file you want to

52 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
view page by page, but you want to see it sorted. Remember that there are two streams, stdout and stderr.
Sitemap With piping, only the stdout stream gets passed through the pipeline; the stderr—we hope there isn't any—
Section Contents hits our screen right away. There's a nice figure from Wikipedia summarizing this:
Top

< > >>

(Image credit: Wikipedia: Pipeline (Unix))

It's been hard to get this far without mentioning pipes and you saw we were starting to break down in the
section about about loops as well as history:

$ history | tail # show the last 10 lines of history


$ history | grep apple # find commands in history containing "apple"

because there's no other simple way to do these things. I also mentioned that we'd learn how to print, say,
th
the 37 line of a file using pipes. In unix there's always more than one way to skin a cat, so here are two:

$ cat -n file.txt | head -37 | tail -1 # print row 37


$ cat -n file.txt | awk 'NR==37' # print row 37

(In awk, which we'll learn about below, NR is a special variable which refers to the row number.) Another
command you can use in your pipelines is tee. Consider the following. We have a file text.txt such that:

$ cat test.txt
1 c
3 c
2 t
1 c

Then:

$ cat test.txt | sort -u | tee tmp.txt | wc -l


3

$ cat tmp.txt
1 c
2 t
3 c

tee, in rough analogy with a plumber's tee fitting, allows us to save a file in the middle of the pipeline and
keep going. In this case, the output of sort is both saved as tmp.txt and passed through the pipe to wc -l,
which counts the lines of the file.

Using pipes expands the number of things you can do in the shell exponentially. The following are some
miscellaneous examples of command pipelines.

Print the number of unique elements in the second column of a file:

$ cat file.txt | cut -f2 | sort -u | wc -l

53 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
Number the fields in a tab-delimited header and display them as a column:
Sitemap

Section Contents $ head -1 file.txt | tr "\t" "\n" | nl -b a


Top

< > >>


Find the key-binding for history-search-backward:

$ bind -P | grep history-search-backward

Display columns 2 through 4 of a file for rows such that the first column equals 1.

$ cat file.txt | awk '$1==1' | cut -f2-4

Find all the commands in your history with pipes:

$ history | grep "|" | less

In the previous section, I talked about my homemade alias n for notesappend. To flesh out this code snippet,
the last command in history is the one we just typed:

$ history | tail -1
1022 history | tail -1

We want one before the last:

$ echo Hello
Hello
$ history | tail -2 | head -1
1023 echo Hello

The next part is subtle:

$ history | tail -2 | head -1 | tr -s ' '


1023 echo Hello

The -s flag in tr stands for squeeze-repeats and the point of this is that there can be a varying number of
space characters in the whitespace. Since we're going to cut on space as the delimiter, we have to make
sure this doesn't trip us up. With this out of the way, we simply cut on space and use awk to put a pound
sign in front of the command, so it's read as a comment:

$ history | tail -2 | head -1 | tr -s ' ' | cut -d' ' -f3- | awk '{print "# "$0}'
# echo Hello

One can always write a script to do something but some unix programmers like to rely on pipes to create
long (sometimes unreadable) chains of commands, all the while staying on the same line. This is called a
one-liner. I've witnessed some epic ones in my day!

Command Substitution TOP VIEW_AS_PAGE


Command substitution is another powerful technique that allows you to run a command on the fly and use its
output as an argument for another command or store it in a variable. Let's look at the later case first. It's
sometimes useful to store the current working directory in a variable. With command substitution, you can do
it like this:

$ d=$( pwd )

$ d=`pwd`

These are two different syntaxes for doing the same thing. You should use the first one, because it's much
cleaner and nicer (if you're a Perl user, you'll recognize the second one, which Perl shares). To take another

54 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
example, suppose you want to store the length of your file in a variable:
Sitemap

Section Contents $ len=$( cat file.txt | wc -l )


Top

< > >>


We can also nest command substitutions. In a script you often want to use a variable to store the directory in
which the script itself resides. There might be other scripts in this directory you want your script to execute,
even if the script cds into another location. To pull this out, use the line:

# save scripts directory in the variable d


d=$( dirname $( readlink -m $0 ) )

Recall that in a unix script $0 refers to the script itself. The readlink command is a fancy way of getting the
absolute path of our script and dirname gets the directory part of the path. Neat, eh?

Let's look at the first thing we said command substitution could do, using the output of a command as an
argument. To head all files with extension .txt in a directory, the command is:

$ head *.txt

We could be unnecessarily verbose and do this with command substitution as:

$ head $( ls *.txt )
$ head $( find . -maxdepth 1 -name "*.txt" )

You would never use these in practice, because there's a simpler way to do it. However, more often than not,
command substitution is the shortcut. Let's say you want to look at myscript.pl and it's in your PATH but you
can remember where it's located. Then you could use:

$ cat $( which myscript.pl )

Command substitution is also very useful in loops. For example, seq prints a sequence of numbers, so:

$ for i in $( seq 1 3 ); do echo $i; done


1
2
3

Question: What do the following do?

$ for i in $( cat file.txt | cut -f3 | sort -u ); do echo $i; done

$ for i in $( ls *.txt | grep -v apple ); do echo $i; done

Answer: The first loops through all unique elements of the third column of file.txt. Here, it just echoes it, but
you could do anything. The second loops through all .txt files in the cwd that do not contain the word apple.
Note that we're combining command substitution with pipes!

After a long road, we're finally in a better position to understand the code we discussed above to change file
suffixes. To recap, if we make three text files:

$ touch {1..3}.txt

We can change their extension from .txt to .html like so:

$ for i in {1..3}.txt; do j=$( echo $i | sed 's|\.txt|\.html|' ); cmd="mv $i $j"; echo "Run command: $cmd"; echo $c

This line features a trick: saving a command in a variable, cmd, allows us to echo it—showing the user what
will be run—and then execute it by piping it into bash.

55 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap We can get as wacky as we like. For the first three directories in our PATH, the following tells us how many
Section Contents things are in each and how big each is:
Top

< > >>


$ for i in $( echo $PATH | tr ":" "\n" | head -3 ); do echo "*** "$i" ***"; echo "This folder has "$( ls $i | wc -l )" elem
*** /usr/local/sbin ***
This folder has 0 elements and is 4.0K large

*** /usr/local/bin ***


This folder has 7 elements and is 32K large

*** /usr/sbin ***


This folder has 130 elements and is 8.6M large

Process Substitution TOP VIEW_AS_PAGE


Wikipedia nails the definition of Process substitution:

... process substitution is a form of inter-process communication that allows the input or output of a command
to appear as a file. The command is substituted in-line, where a file name would normally occur, by the
command shell. This allows programs that normally only accept files to directly read from or write to another
program.

Let's take an example. Suppose the first line of your file is a header line, and you want to look at the tail of
the file, but you also want to print the header. In that case, you could use:

$ cat <( head -1 file.txt ) <( tail file.txt )

cat expects files as arguments, but we're getting around that with process substitution. Whatever's in the
block:

<( )

is treated as a file. Maybe this looks trivial to you, and you argue that you could do this just as well using:

$ head -1 file.txt; tail file.txt

You are correct. But what if you wanted to pipe all of this into another command (like column -t, which prints
your file arranged into pretty columns)? Then you'd have to do it like this:

$ cat <( head -1 file.txt ) <( tail file.txt ) | column -t

So, is this the only way to do this? As long as I'm arguing with myself, I reiterate that bash is so elastic
there's always another way to do something. Any ideas? Here's one answer:

$ { head -1 file.txt; tail file.txt; } | column -t

Curly brackets create code blocks in bash, as in many other languages. In this case, the code in the curly
brackets is executed first and everything is piped, together, into column -t.

How would you print the second column in a file twice? One way would be with awk, which we'll cover
below:

$ cat test.txt | awk '{print $2"\t"$2}'

However, you could also do this with process substitution:

$ paste <( cat test.txt | cut -f2 ) <( cat test.txt | cut -f2 )

although the first choice is clearly better.

56 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
Sometimes you want to sort a file, but you don't want the sorting to scramble your file header. Here's how to
Sitemap sort on, say, the first column without touching your header:
Section Contents

Top
$ cat <( head -1 temp.txt ) <( cat temp.txt | sed '1d' | sort -k1,1n )
< > >>

As a final example, suppose you have a simple script, test_script, which counts the lines in a file and echoes
some text:

#!/bin/bash

myfile=$1

len=$( cat $myfile | wc -l )

echo "Your file is $len lines long."

The first argument is a file you pass in to the script—say, it's 1.txt—so you could run it like this:

$ ./test_script 1.txt
Your file is 11 lines long.

But what if you've zipped all your files to save space:

$ gzip 1.txt

The program can't handle zipped input, but unzipping your files just to run them in this program is a pain.
Process substitution to the rescue!

$ ./test_script <( gunzip --stdout 1.txt.gz )


Your file is 11 lines long.

This gets at the marrow of what process substitution is really good at—avoiding the creation of temporary
files.

If unix were a video game, piping would be level one, command substitution level two, and process
substitution level three. Once you've gotten comfortable with all three, you've beaten at least one part of this
game. Congratulations!

Interlude - Bell Laboratories 1982 Unix Video TOP VIEW_AS_PAGE

Now it's time for a fun and educational interlude. In 1982, Bell Labs AT&T produced a video touting the
merits of unix. It features funky turtlenecks and futuristic, yet dated, geometrical figures doing an odd dance
number. I don't recognize some of the unix commands they use. Yet, to me the funniest thing about this
video is how relevant many of the principles in it still are (once you get past the part about telephone
switchboards). Check it out:

UNIX: Making Computers Easier To Use --…

57 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
(Video credit: YouTube: UNIX: Making Computers Easier To Use -- AT&T Archives film from 1982, Bell Laboratories)

Sitemap

Section Contents
Processes and Running Processes in the Background TOP VIEW_AS_PAGE

Top
Processes are a deep subject intertwined with topics like memory usage, threads, scheduling, and
< > >>
parallelization. My understanding of this stuff—which encroaches on the domain of operating systems—is
narrow, but here are the basics from a unix-eye-view. The command ps displays information about your
processes:

$ ps # show process info


$ ps -f # show verbose process info

What if you have a program that takes some time to run? You run the program on the command line but,
while it's running, your hands are tied. You can't do any more computing until it's finished. Or can you? You
can—by running your program in the background. Let's look at the command sleep which pauses for an
amount of time specified in seconds. To run things in the background, use an ampersand:

$ sleep 60 &
[1] 6846
$ sleep 30 &
[2] 6847

The numbers printed are the PIDs or process IDs, which are unique identifiers for every process running on
our computer. Look at our processes:

$ ps -f
UID PID PPID C STIME TTY TIME CMD
501 5166 5165 0 Wed12PM ttys008 0:00.20 -bash
501 6846 5166 0 10:57PM ttys008 0:00.01 sleep 60
501 6847 5166 0 10:57PM ttys008 0:00.00 sleep 30

The header is almost self-explanatory, but what's TTY? Wikipedia tells us that this is an anachronistic name
for the terminal that derives from TeleTYpewriter. Observe that bash itself is a process which is running. We
also see that this particular bash—PID of 5166—is the parent process of both of our sleep commands
(PPID stands for parent process ID). Like directories, processes are hierarchical. Every directory, except for
the root directory, has a parent directory and so every process, except for the first process—init in unix or
launchd on the Mac—has a parent process. Just as tree shows us the directory hierarchy, pstree shows us
the process hierarchy:

$ pstree
-+= 00001 root /sbin/launchd
|-+= 00132 oliver /sbin/launchd
| |-+= 00252 oliver /Applications/Utilities/Terminal.app/Contents/MacOS/Terminal
| | \-+= 05165 root login -pf oliver
| | \-+= 05166 oliver -bash
|| |--= 06846 oliver sleep 30
|| |--= 06847 oliver sleep 60
|| \-+= 06848 oliver pstree
|| \--- 06849 root ps -axwwo user,pid,ppid,pgid,command

This command actually shows every single process on the computer, but I've cheated a bit and cut out
everything but the processes we're looking at. We can see the parent-child relationships: sleep and pstree
are children of bash, which is a child of login, which is a child of Terminal, and so on. With vanilla ps, every
process we saw began in a terminal—that's why it had a TTY ID. However, we're probably running Safari or
Chrome. How do we see these processes as well as the myriad others running on our system? To see all
processes, not just those spawned by terminals, use the -A flag:

$ ps -A # show all process info


$ ps -fA # show all process info (verbose)

Returning to our example with sleep, we can see the jobs we're currently running with the command jobs:

58 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME $ jobs
Sitemap [1]- Running sleep 60 &
Section Contents [2]+ Running sleep 30 &
Top

< > >>


What if we run our sleep job in the foreground, but it's holding things up and we want to move it to the
background? Cntrl-z will pause or stop a job and the commands bg and fg set it running in either the
background or the foreground.

$ sleep 60 # pause job with control-z


^Z
[1]+ Stopped sleep 60
$ jobs # see jobs
[1]+ Stopped sleep 60
$ bg # set running in background
[1]+ sleep 60 &
$ jobs # see jobs
[1]+ Running sleep 60 &
$ fg # bring job from background to foreground
sleep 60

We can also kill a job:

$ sleep 60 &
[1] 7161
$ jobs
[1]+ Running sleep 60 &
$ kill %1
$
[1]+ Terminated: 15 sleep 60

In this notation %n refers to the nth job. Recall we can also kill a job in the foreground with Cntrl-c. More
generally, if we didn't submit the command ourselves, we can kill any process on our computer using the
PID. Suppose we want to kill the terminal in which we are working. Let's grep for it:

$ ps -Af | grep Terminal


501 252 132 0 11:02PM ?? 0:01.66 /Applications/Utilities/Terminal.app/Contents/MacOS/Terminal
501 1653 1532 0 12:09AM ttys000 0:00.00 grep Terminal

We see that this particular process happens to have a PID of 252. grep returned any process with the word
Terminal, including the grep itself. We can be more precise with awk and see the header, too:

$ ps -Af | awk 'NR==1 || $2==252'


UID PID PPID C STIME TTY TIME CMD
501 252 132 0 11:02PM ?? 0:01.89 /Applications/Utilities/Terminal.app/Contents/MacOS/Terminal

(that's print the first row OR anything with the 2nd field equal to 252.) Now let's kill it:

$ kill 252

poof!—our terminal is gone.

Running stuff in the background is useful, especially if you have a time-consuming program. If you're
scripting a lot, you'll often find yourself running something like this:

$ script.py > out.o 2> out.e &

i.e., running something in the background and saving both the output and error.

Two other commands that come to mind are time, which times how long your script takes to run, and

59 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME nohup ("no hang up"), which allows your script to run even if you quit the terminal:
Sitemap

Section Contents $ time script.py > out.o 2> out.e &


Top $ nohup script.py > out.o 2> out.e &
< > >>

As we mentioned above, you can also set multiple jobs to run in the background, in parallel, from a loop:

$ for i in 1 2 3; do { echo "***"$i; sleep 60 & } done

(Of course, you'd want to run something more useful than sleep!) If you're lucky enough to work on a large
computer cluster shared by many users—some of whom may be running memory- and time-intensive
programs—then scheduling different users' jobs is a daily fact of life. At work we use a queuing system
called the Sun Grid Engine to solve this problem. I wrote a short SGE wiki here.

To get a dynamic view of your processes, loads of other information, and sort them in different ways, use
top:

$ top

Here's a screenshot of htop—a souped-up version of top—running on Ubuntu:

htop can show us a traditional top output split-screened with a process tree. We see various users—root
(discussed next), ubuntu, and www-data—and we see various processes, including init which has a PID of 1.
htop also shows us the percent usage of each of our cores—here there's only one and we're using just
0.7%. Can you guess what this computer might be doing? I'm using it to host a website, as nginx, a popular
web server, gives away. To echo a point made at the beginning of this article, this is one of the zillion doors
basic command line competence opens.

sudo and the Root User TOP VIEW_AS_PAGE


sudo and the Root User sounds like one of Aesop's Fables, but the moralist never considered file
permissions and system administration a worthy subject. We saw above that, if you're unsure of your user
name, the command whoami tells you who you're logged in as. If you list the files in the root directory:

$ ls -hl /

you'll notice that these files do not belong to you but, rather, have been created by another user named root.
Did you know you were sharing your computer with somebody else? You're not exactly, but there is another
account on your computer for the root user who has, as far as the computer's concerned, all the power (read

60 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
Wikipedia's discussion about the superuser here). It's good that you're not the root user by default because it
Sitemap protects you from yourself. You don't have permission to catastrophically delete an important system file.
Section Contents

Top
If you want to run a command as the superuser, you can use sudo. For example, you'll have trouble if you
< > >>
try to make a directory called junk in the root directory:

$ mkdir /junk
mkdir: cannot create directory ‘/junk’: Permission denied

However, if you invoke this command as the root user, you can do it:

$ sudo mkdir /junk

provided you type in the password. Because root—not your user—owns this file, you also need sudo to
remove this directory:

$ sudo rmdir /junk

If you want to experience life as the root user, try:

$ sudo -i

Here's what this looks like on my computer:

$ whoami # check my user name


oliver
$ sudo -i # simulate login as root
Password:
$ whoami # check user name now
root
$ exit # logout of root account
logout
$ whoami # check user name again
oliver

Obviously, you should be cautious with sudo. When might using it be appropriate? The most common use
case is when you have to install a program, which might want to write into a directory root owns, like
/usr/bin, or access system files. I discuss installing new software below. You can also do terrible things with
sudo, such as gut your whole computer with a command so unspeakable I cannot utter it in syntactically
viable form. That's sudo are em dash are eff forward slash—it lives in infamy in an Urban Dictionary entry.

awk TOP VIEW_AS_PAGE


awk and sed are command line utilities which are themselves programming languages built for text
processing. As such, they're vast subjects as these huge manuals—GNU Awk Guide, Bruce Barnett's Awk
Guide, GNU Sed Guide—attest. Both of these languages are almost antiques which have been pushed into
obsolescence by Perl and Python. For anything serious, you probably don't want to use them. However, their
syntax makes them useful for simple parsing or text manipulation problems that crop up on the command
line. Writing a simple line of awk can be faster and less hassle than hauling out Perl or Python.

The key point about awk is, it works line by line. A typical awk construction is:

cat file.txt | awk '{ some code }'

Awk executes its code once every line. Let's say we have a file, test.txt, such that:

$ cat test.txt
1 c
3 c
2 t
1 c

61 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME In awk, $1 is the notation for the first field, $2 is for second field, and so on. The whole line is $0. For
Sitemap example:
Section Contents

Top
$ cat test.txt | awk '{print}' # print full line
< > >>
1 c
3 c
2 t
1 c

$ cat test.txt | awk '{print $0}' # print full line


1 c
3 c
2 t
1 c

$ cat test.txt | awk '{print $1}' # print column 1


1
3
2
1

$ cat test.txt | awk '{print $2}' # print column 2


c
c
t
c

There are two exceptions to the execute code per line rule: anything in a BEGIN block gets executed before
the file is read and anything in an END block gets executed after it's read. If you define variables in awk
they're global and persist rather than being cleared every line. For example, we can concatenate the
elements of the first column with an @ delimiter using the variable x:

$ cat test.txt | awk 'BEGIN{x=""}{x=x"@"$1; print x}'


@1
@1@3
@1@3@2
@1@3@2@1

$ cat test.txt | awk 'BEGIN{x=""}{x=x"@"$1}END{print x}'


@1@3@2@1

Or we can sum up all values in the first column:

$ cat test.txt | awk '{x+=$1}END{print x}' # x+=$1 is the same as x=x+$1


7

Awk has a bunch of built-in variables which are handy: NR is the row number; NF is the total number of
fields; and OFS is the output delimiter. There are many more you can read about here. Continuing with our
very contrived examples, let's see how these can help us:

$ cat test.txt | awk '{print $1"\t"$2}' # write tab explicitly


1 c
3 c
2 t
1 c

$ cat test.txt | awk '{OFS="\t"; print $1,$2}' # set output field separator to tab
1 c
3 c
2 t
1 c

62 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME Setting OFS spares us having to type a "\t" every time we want to print a tab. We can just use a comma
Sitemap instead. Look at the following three examples:
Section Contents

Top
$ cat test.txt | awk '{OFS="\t"; print $1,$2}' # print file as is
< > >>
1 c
3 c
2 t
1 c

$ cat test.txt | awk '{OFS="\t"; print NR,$1,$2}' # print row num


1 1 c
2 3 c
3 2 t
4 1 c

$ cat test.txt | awk '{OFS="\t"; print NR,NF,$1,$2}' # print row & field num
1 2 1 c
2 2 3 c
3 2 2 t
4 2 1 c

So the first command prints the file as it is. The second command prints the file with the row number added
in front. And the third prints the file with the row number in the first column and the number of fields in the
second—in our case always two. Although these are purely pedagogical examples, these variables can do a
rd
lot for you. For example, if you wanted to print the 3 row of your file, you could use:

$ cat test.txt | awk '{if (NR==3) {print $0}}' # print the 3rd row of your file
2 t

$ cat test.txt | awk '{if (NR==3) {print}}' # same thing, more compact syntax
2 t

$ cat test.txt | awk 'NR==3' # same thing, most compact syntax


2 t

Sometimes you have a file and you want to check if every row has the same number of columns. Then use:

$ cat test.txt | awk '{print NF}' | sort -u


2

In awk $NF refers to the contents of the last field:

$ cat test.txt | awk '{print $NF}'


c
c
t
c

An important point is that by default awk delimits on white-space, not tabs (unlike, say, the command cut).
White space means any combination of spaces and tabs. You can tell awk to delimit on anything you like by
using the -F flag. For instance, let's look at the following situation:

$ echo "a b" | awk '{print $1}'


a

$ echo "a b" | awk -F"\t" '{print $1}'


ab

When we feed a space b into awk, $1 refers to the first field, a. However, if we explicitly tell awk to delimit on

63 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME tabs, then $1 refers to a b because it occurs before a tab.


Sitemap

Section Contents
You can also use shell variables inside your awk by importing them with the -v flag:
Top

< > >>


$ x=hello
$ cat test.txt | awk -v var=$x '{ print var"\t"$0 }'
hello1 c
hello3 c
hello2 t
hello1 c

And you can write to multiple files from inside awk:

$ cat test.txt | awk '{if ($1==1) {print > "file1.txt"} else {print > "file2.txt"}}'

$ cat file1.txt
1 c
1 c

$ cat file2.txt
3 c
2 t

Question: In the following case, how would you print the row numbers such that the first field equals the
second field?

$ echo -e "a\ta\na\tc\na\tz\na\ta"
a a
a c
a z
a a

Here's the answer:

$ echo -e "a\ta\na\tc\na\tz\na\ta" | awk '$1==$2{print NR}'


1
4

The take-home lesson is, you can do tons with awk, but you don't want to do too much. Anything that you
can do crisply on one, or a few, lines is awk-able. I'll do some more involved examples below so you can get
a better sense of awk scripting.

sed TOP VIEW_AS_PAGE


Sed, like awk, is a full-fledged language that is convenient to use in a very limited sphere (GNU Sed Guide).
I only use it for two things: (1) replacing text, and (2) deleting lines. Sed is often mentioned in the same
breath as regular expressions (discussed below) although, like the rest of the world, I'd use Perl and Python
when it comes to that. Nevertheless, let's see what sed can do.

Sometimes the first line of a text file is a header and you want to remove it. Suppose we have a file,
test_header.txt, such that:

$ cat test_header.txt
This is a header
1 asdf
2 asdf
2 asdf

Then:

$ cat test_header.txt | sed '1d' # delete the first line

64 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
1 asdf

Sitemap
2 asdf
Section Contents
2 asdf
Top

< > >> To remove the first 3 lines:

$ cat test_header.txt | sed '1,3d' # delete lines 1-3


2 asdf

1,3 is sed's notation for the range 1 to 3. We can't do much more without entering regular expression
territory. One sed construction is:

/pattern/d

where d stands for delete if the pattern is matched. If we have a file, test_comment.txt, such that:

$ cat test_comment.txt
1 asdf
# This is a comment
2 asdf
# This is a comment
2 asdf

We can remove lines beginning with # like so:

$ cat test_comment.txt | sed '/^#/d'


1 asdf
2 asdf
2 asdf

Another construction is:

s/A/B/

where s stands for substitute. So this means replace A with B. By default, this only works for the first
occurrence of A, but if you put a g at the end, for group, all As are replaced:

s/A/B/g

For example, the following replaces the first occurrence of kitty with X:

$ echo "hello kitty. goodbye kitty" | sed 's/kitty/X/'


hello X. goodbye kitty

Using a vertical bar ( | ) as a separator, instead of a slash, is okay:

$ echo "hello kitty. goodbye kitty" | sed 's|kitty|X|'


hello X. goodbye kitty

To replace all occurrences of kitty with X, we can do:

$ echo "hello kitty. goodbye kitty" | sed 's/kitty/X/g'


hello X. goodbye X

This is such a useful ability that all text editors allow you to perform find-and-replace as well. By replacing
some text with nothing, you can also use this as a delete:

$ echo "hello kitty. goodbye kitty" | sed 's|kitty||'


hello . goodbye kitty

$ echo "hello kitty. goodbye kitty" | sed 's|kitty||g'


hello . goodbye

65 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
Sed is especially good when you're trying to rename batches of files or directories on the command line. I
Sitemap often have occasion to use it in for loops. This example of changing file extensions should be very familiar by
Section Contents now:
Top

< > >>


$ touch file{1..3}.txt
$ for i in file{1..3}.txt; do j=$( echo $i | sed 's|.txt|.html|'); mv $i $j; done
$ ls
file1.html file2.html file3.html

More awk Examples TOP VIEW_AS_PAGE


Let's do some in depth examples with awk. This section gets into gory details so, if you're just here to learn
the standard command line, you can skip it with impunity.

Example 1
Suppose we have some files that start with the prefix myfile and we want to concatenate them together.
However, in the resulting file, we want the first column to be the name of the file from which that row
originated. We can accomplish this as follows:

$ for i in myfile*; do echo "*** "$i" ***"; cat $i | awk -v x=${i} '{print x"\t"$0}' >> files.concat.txt; done

Example 2
Suppose we have a text file of URLs, test_markup.txt:

$ cat test_markup.txt
https://www.google.com
http://www.nytimes.com
http://en.wikipedia.org/wiki/Main_Page

and we want to convert them into HTML links. This is easy with awk:

$ cat test_markup.txt | awk '{print "<a href=\""$1"\">"$1"</a><br>"}'


<a href="https://www.google.com">https://www.google.com</a><br>
<a href="http://www.nytimes.com">http://www.nytimes.com</a><br>
<a href="http://www.wikipedia.org">http://www.wikipedia.org</a><br>

Notice that we've escaped the quote character with a slash where necessary.

Example 3
Here's an example from work: the other day I ran multiple instances of a script and had 500 input and output
files. I wanted to check that the number of unique elements in the first column of each corresponding input
and output file was the same. Here was my one-liner:

$ for i in {1..500}; do a=$( cat input${i}.txt | cut -f1 | sort -u | wc -l ); b=$( cat output${i}.txt | cut -f1 | sort -u |

Let's make this more readable:

$ for i in {1..500}; do
a=$( cat input${i}.txt | cut -f1 | sort -u | wc -l );
b=$( cat output${i}.txt | cut -f1 | sort -u | wc -l );
echo -e $i"\t"$a"\t"$b;
done | awk '$2!=$3' # print if col2 not equal to col3

So, any time these numbers disagreed, awk printed the line.

Example 4
Now let's take a detour into the world of bioinformatics, a field in which studying sequencing data is one of
the chief pursuits. (Because bioinformatics relies on numerous different standard, parsable file formats, it's
perhaps the best Petri dish ever created for learning bash, Perl, Python, awk, and sed.) For this example, all

66 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME you need to know is that a fasta file is one type of file format in which sequencing data is stored. In fasta
Sitemap format, every sequence has an ID line, which begins with > followed by some sequence, which is allowed to
Section Contents
span multiple lines. For DNA, the sequence is comprised of the letters A C T G (also called base pairs or
Top
nucleotides). A fasta file of two genes could look like this:
< > >>

$ cat myfasta.fa
>GeneA
ATGCTGAAAGGTCGTAGGATTCGTAG
>GeneB
ATGAACGTAA

(if genes were this small) Suppose we want to create a file with ID vs length. In this example, it would be:

$ cat myfasta.fa | awk '{if ($1 ~ />/) {printf $1"\t"} else {print length}}' | sed 's|>||'
GeneA 26
GeneB 10

Note that length is a keyword in awk.

Another common chore is filtering a fasta file. Sometimes we want to ignore small sequences—say, anything
20 or fewer nucleotides—because either we don't believe they're real or because we'll have trouble aligning
them. This is simply:

$ cat myfasta.fa | awk '{if ($0 ~ />/) {id=$0} else if (length > 20) {print id; print}}'
>GeneA
ATGCTGAAAGGTCGTAGGATTCGTAG

To be 100% accurate, the sequence portions of a fasta file can spill over onto more than one line and the
above examples don't account for this. We can handle this by first piping our fasta file into:

$ cat myfasta.fa | awk 'BEGIN{f=0}{if ($0~/^>/) {if (f) printf "\n"; print $0; f=1} else printf $0}END{printf "\n

and then piping the result into what we have above.

Here is a more difficult problem. When the sequencing machine does its magic, sometimes it can't make a
call what the base is, so instead of writing A C T or G it uses the character N to denote an unknown.
Suppose you have a fasta file—perhaps the sequences are thousands of base pairs long—and you want to
know where the coordinates of these stretches of Ns are. As a test case, let's look at the following miniature
fasta file:

$ cat test.fa
>a
ACTGNNNAGGTNNNA
>b
NNACTGNNNAGGTNN

In the long tradition of one-liners, here's what I wrote to solve this problem:

$ cat test.fa | awk 'BEGIN{flag=0}{if ($0 ~ />/) {if (flag==1) {print nstart"\t"nend;}; print; pos=0; flag=0} els

Got that? Probably not, because the strength of one-liners has never been readability. Let's expand this line
so we can see what it's doing:

$ cat test.fa | awk 'BEGIN{flag=0} {


if ($0 ~ />/) # ID line
{
if (flag==1) {print nstart"\t"nend;};
# print ID, set position to 0, flag to 0
print;
pos=0;

67 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
flag=0;

Sitemap
}
Section Contents
else # sequence line
Top {
< > >> # loop thro sequence
for (i=1; i<=length; i++)
{
# increment position
pos++;
# grab the i-th letter
c=substr($0,i,1);

# set position if char == N


# flag will raise hi if we hit an N char
if (c=="N" && flag==0) { nstart=pos; nend=pos; flag=1; }
else if (c=="N") { nend=pos }
else if (c!="N" && flag==1) { print nstart"\t"nend; flag=0; }
} # for loop
}}END{if (flag==1) {print nstart"\t"nend;}}'
>a
5 7
12 14
>b
1 2
7 9
14 15

Looks like we got the ranges right! Let's talk through this.

In the case we're on an ID line, we reset our position variable and our flag. The flag is a boolean (meaning it
will be either 1, hi, or 0, low) which we're going to set hi every time we see an N. This plays out in the
following way: once we hit a sequence line, we're going to loop over every single character. If the character
is an N and the flag is low—meaning the previous character was not an N—then we record this position,
pos, as being both the start and end of an N streak: nstart=pos and nend=pos. If the character is an N and
the flag is hi, it means the previous character was an N—hence, we're in the middle of a streak of Ns—so
the start position is whatever it was when we saw the first N and we just have to update the end position. If
the character is not an N but the flag is hi, it means the previous character was an N and we just finished
going through a streak, so we'll print the range of the streak and set the flag low to signify we're no longer in
a streak.

There's one more subtlety: what if the sequence line ends on an N character? Then we won't end up printing
it because our logic only prints things the next time we see a non-N. To solve this issue, we add a line in the
if (line == ID line) block to check if our flag is hi. If it is, we print the last-seen range before clearing the
variables. And there's an even more subtle point: what if the last line of our file ends on an N? In this case,
that fix won't work because we won't be hitting any more ID lines. To solve this, we use the END{ } block: if
the flag is hi and we're done reading the file, we'll print the last-seen range. In this example, our fasta file
was small and we could eyeball the N ranges but, with a monster file, we'd need to trust our awk rather than
our eyes.

Example 5
Here's a final example, leaving the world of bioinformatics. Suppose you want to add numbers above each
column at the top of a text file. If your file looks like this:

hellokitty kitty
hellokitty kitty

then the goal is to make it look like this:

1 2 3
hellokitty kitty
hellokitty kitty

68 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
Easy, right? It's actually not trivial because a long word in one of the columns is going to make it so you can't
Sitemap simply print the numbers separated by tabs if you want them to line up with the columns. To get the spacing
Section Contents right, you might need more than one tab in some cases. So, let's awk it:
Top

< > >>


$ cat file.txt | awk -F"\t" '{if (NR==1) { for (i=1; i<=NF; i++) {printf i; for (j=1; j<=int(length($i)/8); j++) {prin

Let's make this readable:

$ cat file.txt | awk -F"\t" '{


if (NR==1) # if first line
{
# loop thro the number of fields
for (i=1; i<=NF; i++)
{
# print number with no tab or newline
printf i;

# use the fact a tab is 8 characters


# print extra tabs for long words
for (j=1; j<=int(length($i)/8); j++) { printf "\t" };

# if last field, print newline; otherwise, print tab


if (i==NF) { printf "\n" } else { printf "\t" }
};

# print first line


print $0
}
else # if not first line, simply print
{
print $0
}}'

What's going on? First, we're going to use the first row only (NR==1) and any other row is printed as is. To
number the columns, we iterate through the number of tab-delimited fields, NF. There's a word in the i-th
field, and we add int(length($i)/8) extra tabs. This is because we need an new tab every eight characters: if
the word is 6 letters long, we don't need any extra tabs, but if it's 12 letters we need one. Then for every field
we add one tab unless we're on the last field (i==NF), in which case we add a newline. Finally, we print the
first line as is.

Regular Expressions and Globbing in Bash TOP VIEW_AS_PAGE

Regular Expressions (regex for short) are a way of describing patterns in text—and once you've gone to the
trouble of describing a pattern, you can write code to match it, extract some piece of it, or parse it in just
about any way you like. Regex come up in so many walks of programming that it's critically important to
understand the basics, even if you're not a guru.

What do the following have in common?

tttxc234
wer1
asfwaffffffff2342525

All follow the pattern: some number of letter characters followed by some number of numerical characters.
You could use a regex to test if a string matches this pattern or to grab the numerical part of any text that fits
this pattern.

What do the following have in common?

[email protected]
[email protected]
[email protected]

69 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME all follow the pattern: string of non-@ characters followed by one @ followed by a string of non-@
Sitemap characters. You can imagine that a form on the internet which requires an email address uses a regex to
Section Contents verify that it follows this pattern.
Top

< > >>


Bash can do regex—read about it on The Linux Documentation Project—but don't waste much time with it.
The syntax is hairy and Perl and Python were born for this, so use them (as we'll discuss next). However,
bash is good at something whose orbit isn't too far from regex and which we've already seen a lot of:
globbing. By now, you're very familiar with the asterisk ( * ) as a wildcard:

$ touch A1f A2a A3c A4d A5a B5x # create files


$ ls # list everything
A1f A2a A3c A4d A5a B5x
$ ls A{2..5}* # list files beginning with A2 through A5
A2a A3c A4d A5a

And you know from above that these constructions are handy in loops. In the next section, to confuse you,
we'll see that asterisk means something different in the regex context.

Command Line Perl and Regex TOP VIEW_AS_PAGE


We've met the scripting language Perl already. Although it's falling out of favor these days—and it's definitely
better to invest your time in Python if you're a beginning programmer (IMHO:)—Perl has always had a good
reputation for regex. For us on the command line, it has another selling point: Perl fits easily into unix
pipelines. You can make Perl run on the command line and execute code line by line using the flags -ne:

cat file.txt | perl -ne '{ some code }'

This makes Perl behave just like awk—and it obeys some of the same conventions, such as using the
BEGIN and END keywords. You can read more about Perl's command line options here and in even gorier
detail here, but let's see how to use it. Suppose you have a text file and you want to format it as an HTML
table:

$ cat test_table.txt
x y z
1 2 3
a b c

Doing this by hand would be pure torture. Let's do it with a one-liner on the command line:

$ cat test_table.txt | perl -ne 'BEGIN{print "<table border=\"1\">\n";}{chomp($_); my @line=split("\t",$_); print

Expanding this for readability:

$ cat test_table.txt | perl -ne 'BEGIN{print "<table border=\"1\">\n";}{


chomp($_);
my @line=split("\t",$_);
print "<tr>";
foreach my $elt (@line) { print "<td>$elt</td>"; }
print "</tr>\n";
}END{print "</table>\n";}'
<table border="1">
<tr><td>x</td><td>y</td><td>z</td></tr>
<tr><td>1</td><td>2</td><td>3</td></tr>
<tr><td>a</td><td>b</td><td>c</td></tr>
</table>

All we're doing here is embedding each line in a table row (tr) tag, and each field in a table data (td) tag, plus
printing table tags at the beginning and end of the file.

If we have to deal with nontrivial regex on the command line, we'll be glad we're using Perl, not bash or awk.
Somewhere off the internet, I stole this regex cheat sheet:

70 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap
Syntax Equivalent Syntax What It Represents
Section Contents
\d [0-9] Any digit
Top

< > >> \D [^0-9] Any character not a digit


\w [0-9a-zA-Z_] Any "word character"
\W [^0-9a-zA-Z_] Any character not a word character
whitespace (space, tab, newline, carriage return,
\s [ \t\n\r\f]
form feed)
\S [^ \t\n\r\f] Any non-whitespace character
. Any character except newline

If we think of the above as nouns, we can think of the following as adjectives:

Quantifiers, etc. What It Means


* Match 0 or more times
+ Match 1 or more times
? Match 1 or 0 times
{n} Match exactly n times
{n,} Match at least n times
{n,m} Match at least n but not more than m times
^ Match at the beginning of a line
$ Match at the end of a line

To get a feeling for how to use these, let's take an example file such that:

$ cat test.txt
889
tttxc234
wer1
CAT
asfwaffffffff2342525

Everything obeys the pattern non-digit string digit string except for 889, just digits, and CAT, just non-digits.
Look at the following:

$ cat test.txt | perl -ne '{chomp($_); if ($_ =~ m/(\d*)/) {print $_,"\n";}}'


889
tttxc234
wer1
CAT
asfwaffffffff2342525

In Perl, the syntax:

some value =~ m/regular expression/

tests for a match against a regular expression. Referring to our cheat sheet, the above command prints
every row because every row has at least 0 digits. Let's change the asterisk to a plus sign:

$ cat test.txt | perl -ne '{chomp($_); if ($_ =~ m/(\d+)/) {print $_,"\n";}}'


889
tttxc234
wer1
asfwaffffffff2342525

This prints everything with at least 1 digit, which is every row except CAT. Let's invert this and print the rows
with non-digits:

$ cat test.txt | perl -ne '{chomp($_); if ($_ =~ m/(\D+)/) {print $_,"\n";}}'

71 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
tttxc234

Sitemap
wer1
Section Contents
CAT
Top asfwaffffffff2342525
< > >>

This prints everything with at least 1 non-digit, which is every row except 889. We can try to match a more
specific pattern:

$ cat test.txt | perl -ne '{chomp($_); if ($_ =~ m/(\d+)(\D+)/) {print $_,"\n";}}'


$

This prints everything with the pattern at least 1 digit, at least 1 non-digit, which no rows follow. What about
this?

$ cat test.txt | perl -ne '{chomp($_); if ($_ =~ m/(\D+)(\d+)/) {print $_,"\n";}}'


tttxc234
wer1
asfwaffffffff2342525

It prints everything with the pattern at least 1 non-digit, at least 1 digit, which three rows follow.

We can also grab pieces of our regular expression as follows:

$ cat test.txt | perl -ne '{chomp($_); if ($_ =~ m/(\D+)(\d+)/) {print $1,"\n";}}'


tttxc
wer
asfwaffffffff

$ cat test.txt | perl -ne '{chomp($_); if ($_ =~ m/(\D+)(\d+)/) {print $2,"\n";}}'


234
1
2342525

$1 refers to the piece in the first ( ), $2 the second, and so on.

Let's take another example, the one with emails. You have a file such that:

$ cat mail.txt
[email protected]
malformed.hotmail.com
malformed@@hotmail.com
[email protected]
[email protected]

Then to get the strings that are appropriately formatted as emails, we could do the following:

$ cat mail.txt | perl -ne '{chomp($_); if ($_ =~ m/(\w+)@(\w+)/) {print $_,"\n";}}'


[email protected]
[email protected]
[email protected]

$ cat mail.txt | perl -ne '{chomp($_); if ($_ =~ m/(\w+)\@{1}(\w+)/) {print $_,"\n";}}'


[email protected]
[email protected]
[email protected]

These do the same thing, but we're being a little more explicit in the second case. Escaping the @ sign with
a slash isn't a bad idea because in Perl @ can denote an array. If we wanted to grab lines with two @s, the
syntax would be:

$ cat mail.txt | perl -ne '{chomp($_); if ($_ =~ m/(\w+)\@{2}(\w+)/) {print $_,"\n";}}'

72 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
malformed@@hotmail.com

Sitemap

Section Contents Question: What would this do?


Top

< > >>


$ cat mail.txt | perl -ne '{chomp($_); if ( $_ =~ m/(\w+)(\@+)(\w+)/) {print $2,"\n";}}'

Answer:

$ cat mail.txt | perl -ne '{chomp($_); if ( $_ =~ m/(\w+)(\@+)(\w+)/) {print $2,"\n";}}'


@
@@
@
@

Aside from doing matching and extracting pieces of patterns with regex, you can also do substitutions, use
variables and logic, and more. Read more about Perl regex here and read about Python regex here. I wrote
a short (unpolished) Perl Wiki which also has some more examples here.

Text Editors Revisited: Vim TOP VIEW_AS_PAGE


By now, you've accepted the command line into your heart. But something's still holding you back, slowing
you down, sabotaging your true potential—keeping you from becoming the man or woman you want to be.
This invisible drag on your abilities is the lack of a good text editor. We touched on the subject of text editors
before but, now that you're a more advanced user, you've probably realized that you spend at least half of
your time in the terminal editing code or text. For serious business, nano is woefully inadequate. The
solution is to use either Vim, the subject of this section, or Emacs.

Borrowing a bit from my Vim wiki, Vim is a powerful text editor that allows you to do almost anything you can
dream up in a text file. It has so many commands, you can almost think of it as a text editor-cum-
programming language. One of the nicest things about Vim is that it's always available in your terminal. If
you use a GUI text editor, like Sublime or Aquamacs, then every time you switch computers, you have to
make sure you've installed the program. If you've ssh-ed into a remote server and you're trying to edit a file
with one of these GUI text editors, then you have to locally mount the server to edit the file—another
headache. If these two reasons aren't compelling enough to switch to Vim, it's also a good editor in its own
right.

The downside is that Vim isn't the easiest thing to learn, and it sometimes seems geared towards those with
a love of the technical. But there is an extensive user manual, a Tips Wiki, and vim.org, which admirably
states:

The most useful software is sometimes rendered useless by poor or altogether missing documentation. Vim
refuses to succumb to death by underdocumentation.

(The manual weighs in at over 250 pages—mission accomplished!) Vim is such a big subject that the goal of
this section will simply be to get your feet wet and set you pointing in the right direction.

Here's a random snippet of the utility wc's source code (written in C) edited in Vim:

73 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME

Sitemap

Section Contents

Top

< > >>

The yellow numbers on the left are line numbers, not part of the document. What about the word INSERT
you see at the bottom? The first lesson of Vim is that it has modes. In insert mode, you write text into your
document, just as in any other editor. But in normal mode, where you start when you open Vim, you issue
commands to the editor. To leave normal mode and enter insert mode, you have various choices, including:

i enter insert mode

I enter insert mode at the beginning of the line

a enter insert mode one character after the cursor

A enter insert mode at the end of the line

o create new line (below cursor), enter insert mode at the beginning of it

O create new line (above cursor), enter insert mode at the beginning of it

To get back into normal mode, use:

Ctrl-c return to normal mode

Esc return to normal mode

If you type a colon ( : ) in normal mode, you enter command mode (technically called command-line mode,
but not to be confused with the unix command line) where you can enter syntactically more complex
commands at the prompt. Delete the colon to return to normal mode. If you type a v in normal mode, you
toggle visual mode, in which you can highlight text. For this section, I'll assume you're in normal mode
(when this is not quite true, I'll use the notation :somecommand instead of saying, more ponderously, go into
command-line mode and enter somecommand).

To save and/or quit, use:

:w save

:q quit

:wq save and quit

:q! quit without saving

74 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
Some basic commands to navigate through your file are:
Sitemap

Section Contents

Top gg jump to top of file


< > >>
G jump to bottom of file

Cntrl-u move up a chunk

Cntrl-d move down a chunk

W jump cursor forward on whitespace

w jump cursor forward on special characters

B jump cursor backward on whitespace

b jump cursor backward on special characters

27gg go to line 27

:27 go to line 27

Here are some basic copying (or "yanking") and pasting commands:

dd delete line (and store in default register)

yy copy or yank line (into default register)

d0 delete everything from cursor to beginning of line (into default register)

d$ delete everything from cursor to end of line (into default register)

p paste (from default register) after cursor

P paste (from default register) before cursor

To undo or redo the previous command, use:

u undo

Cntrl-r redo

To find text in Vim, type a slash ( / ) followed by what you're searching for. To step through each instance of
what you found, it's:

n find next instance

N find prev instance

This completes the whirlwind tour. Consider yourself officially weaned off of nano. For further reading, I put
together a quick and dirty Vim wiki here.

Example Problems on the Command Line TOP VIEW_AS_PAGE


Pulling together everything we've learned, let's look at some examples of working on the command line. As
usual, we'll meet some new commands as we go.

Problem 1
Question: How do we print the most recently modified (or created) file in the cwd?

Answer: ls has a -t flag, which sorts "by time modified (most recently modified first)", so the solution is
simply:

$ ls -t | head -1

75 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
Problem 2
Sitemap Question: How do we print the number of unique elements in column 3 (delimiting on tab) of a text file? For
Section Contents example, suppose tmp.txt is:
Top

< > >>


$ cat tmp.txt
1 aa 3
1 34 z
1 f 32
2 3r z
2 d cc
3 d 34
x e cc
x 1 z

Answer: We can accomplish this with a simple pipeline using the -u flag of sort to sort column 3 uniquely:

$ cat tmp.txt | cut -f3 | sort -u | wc -l


5

Problem 3
Question: How do we print only the odd-numbered rows of a file? For example, suppose tmp.txt is:

$ cat tmp.txt
aaa
bbb
ccc
ddd
eee
fff
ggg
hhh
iii
jjj

Hint: Use awk.

Answer: Let's explicitly list the row number as well as the row number mod 2:

$ cat tmp.txt | awk '{print NR"\t"NR%2"\t"$0}'


1 1 aaa
2 0 bbb
3 1 ccc
4 0 ddd
5 1 eee
6 0 fff
7 1 ggg
8 0 hhh
9 1 iii
10 0 jjj

Now the solution is obvious:

$ cat tmp.txt | awk 'NR%2==1'


aaa
ccc
eee
ggg
iii

Problem 4
Question: Given two files, how do you find the rows that are only in one of them? For example, suppose
file1.txt is:

76 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME $ cat file1.txt


Sitemap 1
Section Contents 200
Top 324
< > >> 95
10
abc

and file2.txt is:

$ cat file2.txt
3
1
200
324
95

Every row in the first file is somewhere in the second file except for the rows with 10 and a b c.

Hint: Use uniq.

Answer: To find the rows that are unique to the first file, try:

$ cat file1.txt file2.txt file2.txt | sort | uniq -u


10
abc

Every row in file2.txt is duplicated because we cat the file twice. And every row file1.txt and file2.txt share
will appear at least 3 times. Then we pipe this into uniq -u which will output only unique rows for a sorted
file.

Problem 5
My friend, Albert, gave me this elegant example. Here are the first 300 bases of chromosome 17 of the
human genome (build GRCh37) in a file chr17_300bp.fa:

>17 dna:chromosome chromosome:GRCh37:17:1:81195210:1 REF


AAGCTTCTCACCCTGTTCCTGCATAGATAATTGCATGACAATTGCCTTGTCCCTGCTGAA
TGTGCTCTGGGGTCTCTGGGGTCTCACCCACGACCAACTCCCTGGGCCTGGCACCAGGGA
GCTTAACAAACATCTGTCCAGCGAATACCTGCATCCCTAGAAGTGAAGCCACCGCCCAAA
GACACGCCCATGTCCAGCTTAACCTGCATCCCTAGAAGTGAAGGCACCGCCCAAAGACAC
GCCCATGTCCAGCTTATTCTGCCCAGTTCCTCTCCAGAAAGGCTGCATGGTTGACACACA

Question: How would you count the number of As, Ts, Cs, and Gs in this sequence?

Hint: Use fold.

Answer: We can discard the identifier line with a grep -v ">". The command fold restricts the number of
characters printed per line, allowing us to turn a row into a column, as in:

$ cat chr17_300bp.fa | grep -v ">" | fold -w 1 | head


A
A
G
C
T
T
C
T
C
A

77 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME Now we can sort this file, so all the A, T, C, and G rows go together, and then count them with uniq -c:
Sitemap

Section Contents $ cat chr17_300bp.fa | grep -v ">" | fold -w 1 | sort | uniq -c


Top 73 A
< > >> 100 C
63 G
64 T

Problem 6
Changing a text file from one format into another is a common scripting chore. Suppose you have a file,
example_data.txt, that looks like this:

,height,weight,salary,age
1,106,111,111300,62
2,124,91,79740,40
3,127,176,15500,46

Question: How would you change its format into this:

1 height 106
2 height 124
3 height 127
1 weight 111
2 weight 91
3 weight 176
1 salary 111300
2 salary 79740
3 salary 15500
1 age 62
2 age 40
3 age 46

?
These two different styles are sometimes called wide format data and narrow (or long) format data. (If you're
familiar with the language R, the package reshape2 can toggle between these two formats).

Hint: download GNU datamash.

Answer: Taking this step by step, let's cut everything after the first comma-delimited field:

$ cat example_data.txt | cut -d"," -f2-


height,weight,salary,age
106,111,111300,62
124,91,79740,40
127,176,15500,46

Commas are hard to work with, so let's use a tab delimiter:

$ cat example_data.txt | cut -d"," -f2- | sed 's|,|\t|g'


height weight salary age
106 111 111300 62
124 91 79740 40
127 176 15500 46

Now we're going to transpose the data to make it easier to work with—one of the many great things GNU
datamash does:

$ cat example_data.txt | cut -d"," -f2- | sed 's|,|\t|g' | datamash transpose


height 106 124 127
weight 111 91 176
salary 111300 79740 15500
age 62 40 46

78 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
Finally, we'll throw in a line of awk to finish the job:
Sitemap
awk '{for (i = 2; i <= NF; i++){print i-1"\t"$1"\t"$i}}'
Section Contents

Top This loops from the second field to the last field and prints a row for each iteration of the loop. Scroll
< > >>
horizontally to see the one-liner:

$ cat example_data.txt | cut -d"," -f2- | sed 's|,|\t|g' | datamash transpose | awk '{for (i = 2; i <= NF; i++){print i
1 height 106
2 height 124
3 height 127
1 weight 111
2 weight 91
3 weight 176
1 salary 111300
2 salary 79740
3 salary 15500
1 age 62
2 age 40
3 age 46

If this seems a little messy, it is, and that's a cue to switch to a more powerful parsing language. Let's revisit
this example when we discuss the Python shell below, so we can see how Python cuts through it like a knife
through butter.

Problem 7
You should avoid using spaces in file names on the command line, because it can cause all sorts of
annoyances. Use an underscore or dash instead.

Question: How many files and directories on your computer have spaces in their names?

Answer: To count every single file or directory on our computer, the command is:

$ sudo find / | wc -l
98912

(I'm testing this on Ubuntu Server 14.04 LTS.) How many have a space in their names?

$ sudo find / | grep " " | wc -l


304

Correct? Not quite, because this overcounts, as in:

$ sudo find / | grep " " | head -5


/sys/bus/pnp/drivers/i8042 aux
/sys/bus/pnp/drivers/i8042 aux/bind
/sys/bus/pnp/drivers/i8042 aux/00:06
/sys/bus/pnp/drivers/i8042 aux/uevent
/sys/bus/pnp/drivers/i8042 aux/unbind

But we just want to count the directory or file the first time we see it, not recursively count all the non-space-
containing children of a space-containing parent. We can do this as follows:

$ sudo find / | grep " " | awk -F"/" '$NF ~ / /' | wc -l


70

This works by telling awk to print only the lines such that the last field (delimiting on slash) has a space in it.
Here's an even simpler solution, via Albert:

$ sudo find / -name "* *" | wc -l


70

79 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
Conclusion: only 0.07% of files and directories follow the poor naming convention of using a space.
Sitemap

Section Contents
Example Bash Scripts TOP VIEW_AS_PAGE
Top
When one-liners fail, it's time to script. When we were introduced to scripting above, we didn't have many
< > >>
tools in our toolkit. Now that we do, let's consider some example bash scripts—picking our battles for things
bash can do more cleanly than Python or Perl.

Example 1
We've already seen the construction:

$ cat $( which myscript )

which allows us to look at a script in our PATH without having to remember its exact location. The following
example is courtesy of my friend, Albert, who packaged this up into a script called catwhich:

#!/bin/bash

# cat a file in your path

file=$(which $1 2>/dev/null)

if [[ -f $file ]]; then


cat $file
else
echo "file \"$1\" does not exist!"

The -f file test operator, says The Linux Documentation Project, checks if the "file is a regular file (not a
directory or device file)." The path /dev/null, where any potential error from which gets routed, is a special
unix path that acts like a black hole—saving anything in there makes it disappear. Functionally, it just
suppresses any error because we don't care what it is.

There's a nearly identical version for vim, vimwhich:

#!/bin/bash

# vim a file in your path

file=$(which $1 2>/dev/null)
if [[ -f $file ]]; then
vim $file
else
echo "file \"$1\" does not exist!"

Example 2
In lab we often run scripts in parallel. Each instance of a script will produce two log files, one containing the
stdout of the script and and one containing the stderr of the script. We sometimes use a convention of
printing a [start] at the beginning of the stdout and an [end] at the finish. This is one way of enabling us to
check if the job finished. An output log file might look like this:

[start]

Some output ...

[end]

Here's a script, checkerror, that loops through all of the stdout log files (I assume they have the extension .o)
in a directory and checks for these start and end tags:

80 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME #!/bin/bash
Sitemap

Section Contents # 1st arg is logs directory


Top logs=$1
< > >>

# example: ./checkerror project/logs


tot=0 # number of files scanned

# loop thro .o files in logs directory


for i in ${logs}/*.o*; do

# get file name


filename=$( basename $i );

# check for [start] and [end] tags


if ! grep "\[start\]" $i > /dev/null; then
echo -e "\n[error] no start tag: "${filename};
elif ! grep "\[end\]" $i > /dev/null; then
echo -e "\n[error] no end tag: "${filename};
else
# print a dot for each error-free file
echo -n "."

# increment total
((tot++))
done

echo -e "\n[summary] $tot files scanned"

We're again making use of /dev/null because we don't want grep to return the lines it finds—we just want
to know if it's successful. We haven't encountered basename before. This simply gets the name of a file
from a path, so we don't output the whole file path.

Example 3
The last example is one I wrote to test if the (bioinformatics) programs bwa, blastn, and bedtools are in the
user's PATH:

#!/bin/bash

echo "[checking dependencies]"

# define dependencies
dependencies="bwa blastn bedtools"

for i in $dependencies; do
if ! which $i > /dev/null; then
echo "[error] $i not found"
exit

done

If, for example, you're transferring a program with dependencies to somebody, this double-checks that they
have all of the dependencies installed and accessible in their PATH. It works using the command which,
which throws a bad exit code if its argument isn't found in the PATH. These lines might be something you'd
see at the beginning of a script rather than a complete script in their own right.

Using the Python Shell to do Math, and More TOP VIEW_AS_PAGE

I'm a new convert to Python and that's why I've leaned on Perl in some of the examples. However, these
days it seems inescapable that Perl is the past and Python is the future. Python has many awesome
features and one is the ability to run a Python shell simply by entering:

$ python

81 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
You can do a million things with this shell, but it's certainly the easiest way to do mathematics in the terminal.
Sitemap (Another convenient way is using the R shell, but you have to install R first.) For example:
Section Contents

Top
$ python # open the Python shell
< > >>
>>> 234+234
468
>>> import math
>>> math.log(234,3)
4.96564727304425
>>> math.log(234,2)
7.870364719583405
>>> math.pow(2,8)
256.0
>>> math.cos(3.141)
-0.9999998243808664
>>> math.sin(3.141)
0.0005926535550994539

You can read more about Python's math module here. If you want to do more sophisticated mathematics,
you can install the NumPy package.

The Python command line is great not just for math but for many tasks where bash feels clumsy. Remember
our parsing example above where we had a a file, example_data.txt:

,height,weight,salary,age
1,106,111,111300,62
2,124,91,79740,40
3,127,176,15500,46

and we wanted to transform it into this:

1 height 106
2 height 124
3 height 127
1 weight 111
2 weight 91
3 weight 176
1 salary 111300
2 salary 79740
3 salary 15500
1 age 62
2 age 40
3 age 46

If you don't know Python, skip this section. If you do, how can you do it in the Python shell? Let's start by
opening the file and reading its contents:

>>> with open('example_data.txt', "r") as f: contents = f.read()

Examine our variable contents:

>>> contents
',height,weight,salary,age\n1,106,111,111300,62\n2,124,91,79740,40\n3,127,176,15500,46\n'

Let's convert this string into a list, by splitting on the newline character:

>>> contents.split('\n')
[',height,weight,salary,age', '1,106,111,111300,62', '2,124,91,79740,40', '3,127,176,15500,46', '']

Now lop off the empty field at the end:

>>> contents.split('\n')[:-1]

82 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
[',height,weight,salary,age', '1,106,111,111300,62', '2,124,91,79740,40', '3,127,176,15500,46']

Sitemap

Section Contents Use list comprehension to split the elements of this list on the comma character:
Top

< > >>


>>> [x.split(',') for x in contents.split('\n')[:-1]]
[['', 'height', 'weight', 'salary', 'age'], ['1', '106', '111', '111300', '62'], ['2', '124', '91', '79740', '40'], ['3', '127', '176

Now let's use a trick that if A is a list of lists, you can perform a matrix transpose with zip(*A):

>>> zip(*[x.split(',') for x in contents.split('\n')[:-1]])


[('', '1', '2', '3'), ('height', '106', '124', '127'), ('weight', '111', '91', '176'), ('salary', '111300', '79740', '15500'), ('ag

Let's loop through this list:

>>> for j in zip(*[x.split(',') for x in contents.split('\n')[:-1]])[1:]: print(j)


('height', '106', '124', '127')
('weight', '111', '91', '176')
('salary', '111300', '79740', '15500')
('age', '62', '40', '46')

We can transform any given tuple as follows:

>>> k = ('height', '106', '124', '127')


>>> [str(y+1) + '\t' + k[0] + '\t' + z for y,z in enumerate(k[1:])]
['1\theight\t106', '2\theight\t124', '3\theight\t127']

This is using list comprehension to meld the first element of the tuple, height, to each subsequent element
and add a numerical index, as well. Let's apply this to each tuple in our list, and join everything with a
newline to finish the job:

>>> for j in zip(*[x.split(',') for x in contents.split('\n')[:-1]])[1:]:


... print('\n'.join([str(y+1) + '\t' + j[0] + '\t' + z for y,z in enumerate(j[1:])]))
1 height 106
2 height 124
3 height 127
1 weight 111
2 weight 91
3 weight 176
1 salary 111300
2 salary 79740
3 salary 15500
1 age 62
2 age 40
3 age 46

Whew - done!

I put together a small (unpolished) Python Wiki here.

tmux TOP VIEW_AS_PAGE


There's one last tool I strongly recommend you make into a habit. Imagine the following scenario: you're
working in the terminal and you accidentally close the window or quit or it crashes. If you were logged in
somewhere, you'll have to log in again. If you were in the middle of running a program, you'll have to start it
[1]
again . While your commands should be saved in history, if there was output on the screen you wanted to
refer back to, it's lost forever. This is where tmux comes in. Regardless of whether or not you quit the
terminal, your sessions are persistent processes that you can always access until the computer is shut off.
You can get your exact terminal session back again: you're still logged in wherever you were and, moreover,
you can see everything you typed in this window by simply scrolling up. If you happened to be running a
program, no worries—it will still be going. For this reason, it's a good idea to make using tmux (or its old-
school cousin, screen) a habit every time you're on the terminal, if only as insurance. tmux also allows you

83 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
to access multiple terminal "windows" within the same terminal, err, window and more.
Sitemap

Section Contents Let's get the terminology straight. In tmux there are:
Top

< > >> sessions


windows
panes

Sessions are groupings of tmux windows. For most purposes, you only need one session. Within each
session, we can have multiple "windows" which you see as tabs on the bottom of your screen (i.e., they're
virtual windows, not the kind you'd create on a Mac by typing ⌘N). You can further subdivide windows into
panes, although this can get hairy fast. Here's an example of a tmux session containing four windows (the
tabs on the bottom), where the active window contains 3 panes:

I'm showing off by logging into three different computers—home, work, and Amazon.

In tmux, every command starts with a sequence of keys I'll refer to as Leader. The leader sequence is
[2]
Cntrl-b by default but I like to remap it to Cntrl-f . Here are the basics. To start a new tmux session, enter:

$ tmux

To get out of the tmux universe, detach from your current session using Leader d. To list your sessions,
type:

$ tmux ls
0: 4 windows (created Fri Sep 12 16:52:30 2014) [177x37]

This says we have one grouping of 4 virtual windows whose session id is 0. To attach to a session, use:

$ tmux attach # attach to the first session


$ tmux attach -t 0 # attach to a session by id

To kill a session, use:

$ tmux kill-session -t 0 # kill a session by id

Here's a small list of commands you can invoke within tmux:

<Leader> c Create a new window

84 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
<Leader> x Kill the current window
Sitemap

Section Contents <Leader> n Go to the next window


Top

< > >>


<Leader> p Go to the previous window

<Leader> l Go to the last-seen window

<Leader> 0-9 Go to a window numbered 0-9

<Leader> w List windows

<Leader> s Toggle between sessions

<Leader> d Detach the session

<Leader> , Set a window's title

See a longer list of commands here. tmux is amazing—I went from newbie to cheerleader in about 30
seconds!

Note: tmux does not come with your computer by default—you'll have to download it (see the the next
section).

[1] You could circumvent this with nohup, which makes a program persist even if the terminal quits ↑

[2] You can rebind the Leader using the configuration file ~/.tmux.conf ↑

Installing Programs on the Command Line TOP VIEW_AS_PAGE


In the course of this article, we've made passing references to programs like htop, pstree, nginx, and
tmux. Perhaps you have these on your computer but, if not, how do you get them? You can usually go to a
program's webpage, download the source code, and build it on your computer (google the mantra
./configure; make; make install). However, you'll probably discover that your system has some crucial
deficiency. Something's out of date, plus the program you're trying to install requires all these other programs
which you don't have. You've entered what I call dependency hell, which has a way of sending you to
obscure corners of the internet to scour chat rooms for mysterious lore.

When possible, avoid this approach and instead use a package manager, which takes care of installing a
program—and all of its dependencies—for you. Which package manager you use depends on which
operating system you're running. For Macintosh, it's impossible to live without brew, whose homepage calls
it, "The missing package manager for OS X." For Linux, it depends on your distribution's lineage: Ubuntu has
apt-get; Fedora has yum; and so on. All of these package managers can search for packages—i.e., see
what's out there—as well as install them.

Let's use the program gpg2 (The GNU Privacy Guard), a famous data encryption tool which implements the
OpenPGP standard, to see what this process looks like. First, let's search:

$ brew search gpg2 # Mac


$ yum search gpg2 # Fedora
$ apt-cache search gpg2 # Ubuntu

Installing it might look like this:

$ brew install gpg2 # Mac


$ sudo yum install gnupg2.x86_64 # Fedora
$ sudo apt-get install gpgv2 # Ubuntu

The exact details may vary on your computer but, in any case, now you're ready to wax dangerous and do
some Snowden-style hacking! (He reportedly used this tool.) I have a quick gpg2 primer here.

Bash in the Programming Ecosystem (or When Not to Use Bash) TOP VIEW_AS_PAGE

85 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME All programming languages are the same. This statement is simultaneously true and not true. In the
Sitemap programming landscape, bash occupies a unique place. We've seen it's definitely not for heavy-duty coding.
Section Contents Using basic data structures, like arrays or hashes, or doing any kind of math is unpleasant in bash. Look at
Top
the horrible syntax for floating-point arithmetic (via Wikipedia):
< > >>

result=$(echo "scale=2; 5 * 7 /3;" | bc)

Bash's strength is system stuff, like manipulating files and directories. If you do write a bash script, it's often
a wrapper—the glue which ties a bunch of programs together and bends them to your purpose. Many people
would argue that you should seldom write a script in bash. Confine bash to the command line and use a
modern scripting language if you want to script. Python and Perl can do more, have much friendlier syntax,
and make it easy to call system commands.

However, if you're new to programming, start with unix because it will get you acquainted with important
principles like input and output streams, permissions, processes, etc. faster than anything else. Furthermore,
much of the material we covered above is not bash-specific. Perl is, in many ways, an extension of bash and
it shares a lot of the same syntax—for file test operators, system calls with backticks, here documents, and
more.

Concluding Notes TOP VIEW_AS_PAGE


As you get deeper and deeper into unix, you may be getting the feeling that the GUI is just a painted
facade—or that you're peering behind the clockface into the gears. This is true! If you think of your computer
as a tool, you can do a lot more with it using unix. And given that millions of people spend half their lives in
front of a computer, there are few downsides to having a greater mastery over this tool. Even if you're not
doing something technical, technical questions have a way of insinuating themselves into the picture. This
manual has been more about the principles of unix and hasn't introduced many of the most useful unix
utilities. To learn about them, there's a reference at 100 Useful Unix Commands.

So how do you go about learning unix? Just as reading a detailed book about violin won't transform you into
a violinist, this article is of limited utility and defers to the terminal itself as the best teacher. You have to pay
your dues and experience counts for a lot because there's so much to learn (I'm already a few years in and I
learn things almost daily). Start using it and crash headfirst into problems. There's no substitute for having
somebody to bother who knows it better than you do. Failing that, there's always Stackoverflow and the rest
of the internet, which has become the greatest computer science manual ever compiled. In programming, I'm
always surprised how much more a couple years of work taught me than a couple years of class, and
perhaps this speaks volumes about the merits of apprenticeship versus classroom instruction.

Unix—with its power, elegance, and scope—is a modern marvel. If you know it and your friends don't, it's a
bit like having been exposed to some awesome book or song that they haven't discovered yet. To see all the
commands at your fingertips, type tab tab on the command line (there are over 2200 on my Mac!). Or do
some reading for pleasure in:

$ man bash
$ info coreutils

to remind yourself what you're working with. I bet you didn't think anything this cool came out of the 70s! :D

Acknowledgements and Postscript TOP VIEW_AS_PAGE


I am graciously indebted to the following people, who contributed in ways big and small to this article:

Albert Lee
Vladimir Trifonov
Alex North-Keys
Guido Jansen

Postscript, March 2015

I don't like remembering syntax and I forget what I've learned quickly. Thus this article started out as a memory aid—

86 of 87 25/10/2019, 10:59 AM
Oliver | An Introduction to Unix http://oliverelliott.org/article/computing/tut_unix/

HOME
miscellaneous command line-alia for which I wanted a reference done in my own particular way, prejudices included. Its waistline
Sitemap expanded to its present (large) girth and it got a little play on the internet in early 2015. If I hadn't appreciated the importance of
Section Contents
editors and fact-checkers, I do now—as the editing of this page was nerve-wrackingly crowded-sourced in real time. I've since
Top
corrected many of the errors people pointed out as well as polished and added sections, and the article is better for it.
< > >>

If you've read this far, you know that this article is not, speaking in rigid literals, an introduction to unix. It's not about the nitty-gritty

of how operating system kernels work. And it's not even about UNIX®, which is still a trademark—"the worldwide Single UNIX

Specification integrating X/Open Company's XPG4, IEEE's POSIX Standards and ISO C" (say what!?), according to the official

website. These days UNIX® refers to a detailed specification rather than software. This article, in contrast, is about command line
basics. But it's not about all command lines, which would include rubbish like Windows Powershell. It's about unix-like command

lines—i.e., command lines descended from the ancestral unix progenitor:

(Image credit: Wikipedia: Unix-like)

This is what I mean when I use "unix" as a colloquial shorthand. However, to begin the article by embroiling readers in these

quagmires of terminology would turn them away in the first paragraph.

There were other comments but the funniest one came from my dad:

P.S. I see 2 keys at bottom of my keyboard that say, "command." Is this what all the fuss is about? I'm afraid if I touched them the

computer would blow up like a roadside bomb!

More comments, corrections, or suggestions? Let me know!

© 2018 Oliver

87 of 87 25/10/2019, 10:59 AM

You might also like