JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2002, p. 779–787 Vol. 40, No.

3
0095-1137/02/$04.00⫹0 DOI: 10.1128/JCM.40.3.779–787.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

GP5⫹/6⫹ PCR followed by Reverse Line Blot Analysis Enables

Rapid and High-Throughput Identification of
Human Papillomavirus Genotypes
Adriaan J. C. van den Brule,1* René Pol,1 Nathalie Fransen-Daalmeijer,1 Leo M. Schouls,2
Chris J. L. M. Meijer,1 and Peter J. F. Snijders1
Department of Pathology, Vrije Universiteit Medical Center, Amsterdam,1 and Department of Bacteriology,
National Institute of Public Health and the Environment, Bilthoven,2 The Netherlands
Received 30 July 2001/Returned for modification 22 September 2001/Accepted 21 December 2001

Downloaded from http://jcm.asm.org/ on January 31, 2021 by guest

In this study, we developed a simple and fast typing procedure for 37 mucosotropic human papillomavirus
(HPV) types using a nonradioactive reverse line blotting (RLB) procedure for general primer (GP5ⴙ/6ⴙ) PCR
products. This system has the advantages not only that in a simple format, up to 42 PCR products can be
simultaneously typed per membrane per day, but also that after stripping, the membranes can be easily
rehybridized at least 15 times without a loss of signal. RLB appeared highly specific, and its sensitivity was
identical to that of conventional typing performed with type-specific oligonucleotide probes in an enzyme
immunoassay (EIA). The performance of RLB typing was evaluated with samples of HPV-positive cervical
scrapings (n ⴝ 196) and biopsies of cervical premalignant lesions (n ⴝ 100). The distribution of HPV genotypes
detected in these samples was in line with the distribution expected on the basis of literature data. In addition,
RLB and EIA typing procedures were compared for the typing of high-risk HPV types in GP5ⴙ/6ⴙ PCR
products of 210 cervical scrapings from high-risk HPV-positive women who participated in a population-based
screening program. The typing procedures had an excellent overall agreement rate of 96.5% (kappa value,
0.77). RLB was successful in detecting multiple HPV infections as well as single infections. In conclusion, the
GP5ⴙ/6ⴙ PCR-RLB procedure appeared to be a reliable and simple approach that may be of great value for
large epidemiological studies, population-based cervical cancer screening programs, and vaccination trials
that require high-throughput HPV typing.

High-risk human papillomavirus (HR-HPV) DNA has been simultaneously in one assay, i.e., HR-HPV group detection.
shown to be present in 99.7% of cervical cancers worldwide (1, The latter can be accomplished by HR-HPV GP5⫹/6⫹ PCR-
29), and the persistence of HR-HPV infection appears neces- enzyme immunoassay (EIA) or HC2 (7, 8, 25). However, there
sary for the development of cervical premalignant lesions and is a strong need to identify individual HPV genotypes to in-
invasive cervical cancer (14, 15, 20, 30). Therefore, HR-HPV vestigate the epidemiology and clinical behavior of particular
testing may have implications for the clinical management of types. Moreover, HPV typing is of importance for character-
women with cervical lesions (25) and for primary screening for izing study populations being used for HPV vaccination trials
cervical cancer (17, 20). In addition, several human papilloma- and for monitoring the efficiency of HPV-targeted therapies
virus (HPV)-targeted therapies have been or are being devel- and vaccines.
oped, and the first trials with prophylactic HPV vaccines are HPV type determination after general-primer PCR assays
being conducted. has been done by nucleotide sequencing (19, 28) or oligonu-
To date, the detection of HPV genotypes has been done cleotide probe (oligoprobe) hybridization (Southern dot blot-
predominantly by L1 general- or consensus-primer PCR assays ting [7, 16, 26] and EIA [8] formats) of the PCR products or by
(3, 6, 12, 16, 24, 26) and by the commercially available liquid HPV type-specific PCR (27). However, all of these methods
hybridization assay Hybrid Capture 2 (HC2) (25). General- are very laborious (2). Recently, more convenient typing meth-
primer PCR assays enable the detection of a broad spectrum of ods based on reverse hybridization have been described; in
mucosotropic HPV types, since the primers anneal to a highly these methods, initially cloned HPV plasmids (4) and later
homologous region of the HPV types spanning a polymorphic HPV type-specific oligonucleotides (5, 13) were used. The
inner region, allowing specific HPV typing. Of these general- most recently described assays, the MY09/11 reverse line blot
primer PCR assays, the GP5⫹/6⫹ and the MY09/11 PCR assay (5) and the SPF line probe assay (13), can type 27 and 25
systems (3, 16) are the most frequently used and clinically HPV genotypes, respectively, in a nonradioactive format using
evaluated ones. Despite the existence of more than 70 HPV precipitating color substrates. However, these assays use indi-
genotypes, HPV testing for clinical purposes has been greatly vidual hybridization strips for each PCR product, and these
simplified and facilitated by testing for all HR-HPV types strips can be used only once. As a consequence, these assays
are rather expensive and not ideal for high-throughput analy-
ses.
* Corresponding author. Mailing address: Department of Pathology,
Vrije Universiteit Medical Center, De Boelelaan 1117, 1081 HV Am-
Here we developed an easy and rapid reverse line blot
sterdam, The Netherlands. Phone: 31-20-444.4023. Fax: 31-20-444.2964. (RLB) assay for large-scale identification of 37 HPV genotypes
E-mail: [email protected]. after GP5⫹/6⫹ PCR. The assay is based on the use of a

779
780 VAN DEN BRULE ET AL. J. CLIN. MICROBIOL.

TABLE 1. Conditions for GP5⫹/6⫹ PCR with in relation to the previous protocol (8) to minimize the possibility of cross-
PTC225 and PE9700 hybridization between related HPV types. First, the hybridization temperature
was increased from 37 to 55°C. Second, the oligoprobe sequence of HPV type 45
Conditions used with: was changed (Table 2), since the originally described 30-mer oligoprobe of HPV
Parameter
PTC225 PE9700a type 45 tended to cross-react with HPV type 43 DNA despite the presence of
seven mismatches. The sequences of the EIA oligoprobes used in this study are
Start 4 min at 94°C 4 min at 94°C shown in Table 2. For HR-HPV and low-risk HPV (LR-HPV) group-specific
detection, oligoprobe cocktails for 14 HR-HPVs (i.e., HPV types 16, 18, 31, 33,
Cycles (n ⫽ 40) 20 s at 94°C (denaturation) 20 s at 94°C (denaturation) 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68) and 23 LR-HPVs (i.e., HPV types 6, 11,
In 24 s to 90°C In 33% of SA to 38°C 26, 34, 40, 42, 43, 44, 53, 54, 55, 57, 61, 70, 71 [CP8061], 72, 73, 81 [CP8304],
In 66 s to 48°C 30 s at 38°C (annealing) 82/MM4, 82/IS39, 83 [MM7], 84 [MM8], and CP6108), respectively, were used.
In 30 s to 38°C In 44% of SO to 71°C
RLB of GP5ⴙ/6ⴙ PCR products. RLB analyses were performed using a
30 s at 38°C (annealing) 80 s at 71°C (elongation)
previously described system (10, 11, 23). The system is based on the use of a
In 18 s to 42°C In 62% of SO to 94°C
miniblotter for spotting in parallel up to 42 different oligoprobes containing a
In 42 s to 66°C
In 18 s to 71°C 5⬘-amino group on a carboxyl-coated nylon membrane. Subsequently, up to 42
80 s at 71°C (elongation) PCR products can be pipetted into the parallel channels of the miniblotter in

Downloaded from http://jcm.asm.org/ on January 31, 2021 by guest

In 24 s to 69°C such a way that the channels are perpendicular to the rows of oligoprobes
In 90 s to 94°C deposited previously. In this format, hybridization is followed by incubation of
the membrane with antibiotin conjugate and enhanced chemiluminescence
Final step 4 min at 71°C 4 min at 72°C (ECL) detection. Most of the HPV-specific 5⬘-amino-linked oligonucleotides
(Isogen, Maarssen, The Netherlands) selected for RLB were adapted from the
Hold Forever at 4°C Forever at 4°C oligonucleotides selected for use in EIA detection (8) (Table 2) in such a way
a
that melting temperature was (approximately) 55°C and the length was approx-
SA, standard cool-down temperature (5.39°C/s); SO, standard warm-up tem-
imately 20 bp. Only for HPV types 34, 44, 45, and 52 were oligoprobe sequences
perature (4.43°C/s).
selected outside the EIA probe region to fulfill the above-mentioned criteria
without a loss of specificity.
The sequences of the RLB oligoprobes are shown in Table 2. The oligoprobes
miniblotter system to type GP5/6⫹ PCR products derived from were covalently bound to negatively charged membranes (Biodyne C; Pall Bio-
up to 42 patient samples concurrently per hybridization mem- Support, East Hills, N.Y.). Briefly, membranes were activated by using 16%
brane. Moreover, membranes can be easily stripped and rehy- (wt/vol) EDAC [1-ethyl-3-(3-dimethylaminopropyl)carbodiimide; Sigma, St.
Louis, Mo.] and placed in a miniblotter system (MN 45; Immunetics, Cambridge,
bridized at least 15 times without a loss of signal.
Mass.). The oligonucleotides were applied in parallel lines; after 1 min of incu-
bation, the channels were aspirated and the membranes were inactivated using
MATERIALS AND METHODS 100 mM NaOH, followed by washing in 2⫻ SSPE (1⫻ SSPE is 0.18 M NaCl, 10
mM NaH2PO4, and 1 mM EDTA [pH 7.7); Life Technologies, Rockville, Md.)
HPV test panel. For the evaluation of the sensitivity and specificity of the RLB
supplemented with 0.1% sodium dodecyl sulfate (SDS) (BDH, Dorset, England).
typing method, plasmid clones of the following HPV types were used as a test
For hybridization, 10␮l of biotinylated GP5⫹/6⫹ PCR product was diluted in
panel: HPV types 6, 11, 16, 18, 26, 31, 34, 35, 39, 40, 42, 43, 44, 45, 51, 52, 53, 54,
150 ␮l of 2⫻ SSPE–0.1% SDS, heat denatured (96°C), and rapidly cooled on ice.
55, 56, 57, 58, 59, 61, 66, and 68 (for sources, see reference 8). To complement
The PCR products were pipetted into the parallel channels perpendicular to the
this test panel with types for which no HPV clones were available (HPV types 70,
rows of oligoprobes. Hybridization was performed at 42°C for 1 h, followed by
71 [previously named CP8061], 72, 73, 81 [CP8304], 82/MM4, 82/IS39, 83 [MM7],
two washings in 2⫻ SSPE–0.5% SDS at 51°C. Subsequently, membranes were
84 [MM8], and CP6108), we used cervical smears in which these types were
incubated with streptavidin-peroxidase conjugate for 45 to 60 min at 42°C (1:
identified in previous studies performed in our laboratory.
4,000 dilution in 2⫻ SSPE–0.5% SDS; Roche), washed twice in 2⫻ SSPE–0.5%
Clinical specimens. For the evaluation of HPV typing of clinical specimens,
both cervical scraping specimens and formalin-fixed, paraffin-embedded as well SDS for 10 min at 42°C, and rinsed twice in 2⫻ SSPE for 5 min at room
as frozen tissues were used; these specimens were derived from women partic- temperature. Detection was done by using ECL detection liquid (Amersham,
ipating in a cervical cancer screening program and from women attending a Buckinghamshire, England) followed by exposure to film (Hyperfilm; Amer-
gynecologic clinic, respectively. sham) for 1 to 10 min. Films were subsequently developed. For repeated use, the
For detection of HPV in crude cell suspensions, a cervical brush was placed in membranes were stripped by washing two times in 1% SDS at 80°C for 30 min
5 ml of phosphate-buffered saline containing 0.005% merthiolate (27). After each time followed by incubation in 20 mM EDTA (pH 8) at room temperature
vigorous vortexing, the suspensions were centrifuged for 10 min at 3,000 ⫻ g. The for 15 min. Membranes were sealed in plastic and stored at 4°C until further use.
cell pellets were resuspended in 0.01 M Tris-HCl (pH 7.5) and frozen at ⫺80°C. HPV E7 type-specific PCR. The HPV E7 type-specific PCR was used for
Aliquots (100 ␮l) were boiled for 10 min and cooled on ice. For PCR, 10 ␮l of analysis of the few cases that showed discrepant typing results in the RLB and
the extract was used. EIA. PCR primers and conditions were described previously (29). Detection of
For detection of HPV in tissue specimens, 5-␮m sections were cut using the PCR products was performed by EIA under the same conditions as those men-
so-called sandwich method (29). Briefly, outer sections were stained with hema- tioned above. However, some of the E7 oligoprobe sequences were different
toxylin-eosin for histological analyses, whereas inner sections (in total, approxi- from those described earlier (29). Oligonucleotide sequences of the E7 primers
mately 1 cm2 of tissue) were placed in a tube and used for PCR. Lysis mix (10 and probes (Eurogentec, Liege, Belgium) for 14 HR-HPV types are shown in
mM Tris-HCl [pH 7.5], 0.45% Tween 20, 500 ␮g of proteinase K [Roche, Table 3.
Mannheim, Germany]) (250 ␮l) was added and incubated overnight at 37°C. The
sample was boiled and centrifuged for 1 min in a standard tabletop centrifuge
(8,000 ⫻ g). After cooling, 10 ␮l of the sample was used for PCR.
RESULTS
GP5ⴙ/6ⴙ PCR. Pretreated samples were subjected to GP5⫹/6⫹ PCR as
previously described (3, 8) with some modifications in the PCR program, de- Development of RLB. (i) RLB oligoprobes. A database search
pending on the thermal cycler used (PTC225 [Biozyme, Landgraaf, The Neth-
erlands] or PE9700 [Perkin-Elmer, Foster City, Calif.]) (Table 1). The modified
(BLAST from National Center for Biotechnology Information
ramping times between the temperatures used for denaturation, annealing, and [NCBI] and NTI [Informax, Oxford, United Kingdom]) of all
elongation appeared essential for optimal PCR. PCRs were performed in dupli- oligoprobe sequences selected for RLB revealed complete
cate, and PCR products were pooled to obtain sufficient material for subsequent matches with corresponding HPV types, at least two mis-
typing by both EIA and RLB.
EIA of GP5ⴙ/6ⴙ PCR products. The EIA was performed as previously de-
matches with other HPV genotypes, and at least four mis-
scribed (8) with the exception that a different brand of streptavidin-coated matches with non-HPV sequences present in the NCBI nucle-
microtiter plates (Roche) was used. In addition, two further changes were made otide sequence database (GenBank). Also, the selected probes
VOL. 40, 2002 RAPID IDENTIFICATION OF HPV GENOTYPES 781

TABLE 2. HPV type-specific oligoprobes used for EIA and RLB typing of GP5⫹/6⫹ PCR products
Sequence of oligoprobe for:
HPV type
EIA RLBa

6 ATCCGTAACTACATCTTCCACATACACCAA TCCGTAACTACATCTTCCA
11 ATCTGTGTCTAAATCTGCTACATACACTAA TCTGTGTCTAAATCTGCTAC
16 GTCATTATGTGCTGCCATATCTACTTCAGA CATTATGTGCTGCCATATC
18 TGCTTCTACACAGTCTCCTGTACCTGGGCA TGCTTCTACACAGTCTCCT
26 AGTACATTATCTGCAGCATCTGCATCCACT GTACATTATCTGCAGCATC
31 TGTTTGTGCTGCAATTGCAAACAGTGATAC GCAATTGCAAACAGTGATAC
33 TTTATGCACACAAGTAACTAGTGACAGTAC TGCACACAAGTAACTAGTGA
34 TACACAATCCACAAGTACAAATGCACCATA TTTTCAGTTTGTGTAGGTACA
35 GTCTGTGTGTTCTGCTGTGTCTTCTAGTGA CTGCTGTGTCTTCTAGTGA
39 TCTACCTCTATAGAGTCTTCCATACCTTCT ATAGAGTCTTCCATACCTTC
40 GCTGCCACACAGTCCCCCACACCAACCCCA AGTCCCCCACACCAACC

Downloaded from http://jcm.asm.org/ on January 31, 2021 by guest

42 CTGCAACATCTGGTGATACATATACAGCTG TGGTGATACATATACAGCTG
43 TCTACTGACCCTACTGTGCCCAGTACATAT TCTACTGACCCTACTGTG
44 GCCACTACACAGTCCCCTCCGTCTACATAT TACTAGTGAACAATATAAGCA
45b ACACAAAATCCTGTGCCAAGTACAT TAATTTAACATTATGTGCCTC
51 AGCACTGCCACTGCTGCGGTTTCCCCAACA TGCTGCGGTTTCCCCAA
52 TGCTGAGGTTAAAAAGGAAAGCACATATAA GAATACCTTCGTCATGGC
53 GTCTATGTCTACATATAATTCAAAGCAAAT TGTCTACATATAATTCAAAGC
54 TACAGCATCCACGCAGGATAGCTTTAATAA CACGCAGGATAGCTTTAAT
55 CTGCTACAACTCAGTCTCCATCTACAACAT TCAGTCTCCATCTACAACAT
56 GTACTGCTACAGAACAGTTAAGTAAATATG CAGAACAGTTAAGTAAATATG
57 CCACTGTAACCACAGAAACTAATTATAAAG CCACAGAAACTAATTATAAAG
58 ATTATGCACTGAAGTAACTAAGGAAGGTAC TATGCACTGAAGTAACTAAG
59 TCTACTACTGCTTCTATTCCTAATGTATAC TCTACTACTGCTTCTATTCC
61 TACTGCTACATCCCCCCCTGTATCTGAATA CCCCCCCTGTATCTGAAT
66 TATTAATGCAGCTAAAAGCACATTAACTAA AGCTAAAAGCACATTAACTAA
68 TCTACTACTACTGAATCAGCTGTACCAAT CTGAATCAGCTGTACCAAT
70 CTGCCTGCACCGAAACGGCCATACCTGCTG GAAACGGCCATACCTGCT
72 TGCCACAGCGTCCTCTGTATCAGAATATAC AGCGTCCTCTGTATCAGAA
73 GTGTAGGTACACAGGCTAGTAGCTCTACTA ACAGGCTAGTAGCTCTACT
82/MM4 CGACTCGTGTTACTCAATCTGTTGCACAAA ACTGCTGTTACTCAATCTG
83 (MM7) CAGCTGCTGCTACACAGGCTAATGAATACA TACACAGGCTAATGAATACA
84 (MM8) GTGCTGCTACCAACACCGAATCAGAATATA TGCTACCAACACCGAATCA
82/IS39 GCACTGCTGCTACTCCATCAGTTGCACAGA TGCTACTCCATCAGTTGC
CP6108 GTGCTGCTTCCCAGTCTGCCACAGAATACA CTTCCCAGTCTGCCACA
71 (CP8061) GTGCTACCAAAACTGTTGAGTCTACATATA TGCTACCAAAACTGTTGAG
81 (CP8304) GCACAGCTACATCTGCTGCTGCAGAATACA GCTACATCTGCTGCTGC
a
Except for HPV types 34, 44, 45, and 52, oligoprobes for RLB were selected from the oligoprobe sequence used in EIA and underlined in the EIA oligoprobe
sequence.
b
Modified from a previously published sequence (8).

showed perfect matches to all known HPV variants (18, 31, tions of the GP5⫹/6⫹ PCR products showed that the sensitiv-
32), as determined by sequence alignments. ity of RLB detection was identical to that of EIA detection.
In order to determine the optimal concentration of the oli- Subsequently, serial dilutions ranging from 100 ag to 100 pg of
goprobes to be used for RLB, oligoprobe concentrations rang- cloned representatives of phylogenetically distant HPV groups,
ing from 25 to 400 pmol/␮l were applied to RLB membranes. i.e., HPV types 6, 11, 16, 18, 33, 39, and 51, were tested by
Subsequently, membranes were hybridized with GP5⫹/6⫹ GP5⫹/6⫹ PCR and the two different readout systems. RLB
PCR products derived from clinical samples which, on the and EIA reached the same detection level, and the sensitivities
basis of EIA typing, were found to contain HPV type 11, 16, 18, for these HPV types were identical to those previously de-
and/or 33 DNA. For all the HPV types, the most optimal scribed for EIA (8), as shown for HPV type 16 (detection level,
signals were obtained with 100 to 200 pmol of oligoprobe/␮l 100 ag) in Fig. 1 (lower panel). It was further evident that
(Fig. 1, upper panel). Consequently, 200 pmol/␮l was chosen dilutions showing borderline EIA signals gave rise to clearly
for generating the RLB membranes for subsequent experi- visible signals with RLB after a standard 5-min ECL exposure.
ments. No signal was obtained with HPV-negative samples, Subsequently, the specificity of RLB was evaluated with
providing evidence that the signals were HPV specific (Fig. 1, GP5⫹/6⫹ PCR products for a panel of HPV types (14 HR-
upper panel). HPV types, i.e., HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56,
(ii) Sensitivity and specificity. First, the sensitivity of RLB 58, 59, 66 and 68, and 23 LR-HPV types, i.e., HPV types 6, 11,
detection was compared with that of conventional EIA detec- 26, 34, 40, 42, 43, 44, 53, 54, 55, 57, 61, 70, 71 [CP8061], 72, 73,
tion. For that purpose, GP5⫹/6⫹ PCR products were gener- 81 [CP8304], 82/MM4, 82/IS39, 83 [MM7], 84 [MM8], and
ated from 100 pg of cloned DNAs of HPV types 6, 11, 16, 18, CP6108) derived from either cloned HPVs or well-character-
31, and 58 and subjected to both EIA using specific probes for ized clinical specimens. RLB analysis with membranes on
the respective types and RLB. Hybridization with serial dilu- which oligoprobes of these 37 HPV types were applied clearly
782 VAN DEN BRULE ET AL. J. CLIN. MICROBIOL.

TABLE 3. Oligonucleotide sequences used in the HPV E7 type-specific PCR

Primer Sequence (5⬘-3⬘) Probe Sequence (5⬘-3⬘)

HPV16E7.667Bio GATGAAATAGATGGTCCAGC 16E7DIGPRO CGGACAGAGCCCATTACAATATTGTAACCT

HPV16E7.774Bio GCTTTGTACGCACAACCGAAGC
HPV18E7.696 AAGAAAACGATGAAATAGATGGA 18E7DIGPRO CCCGACGAGCCGAACCACAACGTCACACAA
HPV18E7.799Bio GGCTTCACACTTACAACACA
HPV31E7.811 GGGCTCATTTGGAATCGTGTG 31E7DIGPRO TACCTGCTGGATCAGCCATTGTAGTTACAG
HPV31E7.890Bio AACCATTGCATCCCGTCCCC
HPV33E7.671Bio TGAGGATGAAGGCTTGGACC 33E7DIGPRO TGTGACAACAGGTTACAATGTAGTAATCAG
HPV33E7.761 TGACACATAAACGAACTGTG
HPV35E7.674Bio CTATTGACGGTCCAGCT 35E7DIGPRO CAACAGGACGTTACAATATTATAATTGGAG
HPV35E7.752 TACACACAGACGTAGTGTCG
HPV39E7.601Bio CCAAAGCCCACCTTGCAGGA 39E7DIGPRO TCCTAATTGCTCGTGACATACAAGGTCAAC
HPV39E7.703 ATGGTCGGGTTCATCTATTTC
HPV45E7.741Bio CCCACGAGCCGAACCACAG 45E7DIGPRO AGCTCAATTCTGCCGTCACACTTACAACAT

Downloaded from http://jcm.asm.org/ on January 31, 2021 by guest

HPV45E7.822 TCTAAGGTCCTCTGCCGAGC
HPV51E7.718 TACGTGTTACAGAATTGAAG 51E7DIGPRO TCAAGTGTAGTACAACTGGCAGTGGAAAGC
HPV51E7.841Bio AACCAGGCTTAGTTCGCCCATT
HPV52E7.691Bio GCAGAACAAGCCACAAGCAA 52E7DIGPRO ATAGCCGTAGTGTGCTATCACAACTGTGAC
HPV52E7.776 TAGAGTACGAAGGTCCGTCG
HPV56E7.784 GGTGCAGTTGGACATTCAGAG 56E7DIGPRO CAAAGAGGACCTGCGTGTTGTACAACAGCT
HPV56E7.886Bio GTTACTTGATGCGCAGAGTG
HPV58E7.98 CGAGGATGAAATAGGCTTGG 58E7DIGPRO ACAGCTAATTACTACATTGTAACTTGTTGT
HPV58E7.761Bio ACACAAACGAACCGTGGTGC
HPV59E7.646 CTCCGAGAATGAAAAAGATGAA 59E7DIGPRO ATCATCCTTTGCTACTAGCTAGACGAGCTG
HPV59E7.749Bio GCTGAAGTTGATTATTACA
HPV66E7.641 AATGCAATGAGCAATTGGACAG 66E7DIGPRO AGGATGAAATAGACCATTTGCTGGAGCGGC
HPV66E7.742Bio CTTATGTTGTTCAGCTTGTC
HPV68E7.4604 AACAACAGCGTCACACAATTCA 68E7DIGPRO AGTGTAACAACCTACTGCAACTAGTAGTAG
HPV68E7.4704Bio AGTTGTACGTTCCGCAGGTT

showed specific hybridization without any cross-reaction. Even described (8). This cross-hybridization disappeared without a
when large amounts of PCR products for phylogenetically loss of sensitivity when EIA hybridization was performed at
closely related HPV types (i.e., HPV types 6 and 11, HPV types 55°C. Therefore, an EIA hybridization temperature of 55°C
39 and 45, and HPV types 33 and 58) were used in combination was applied for this study.
with longer ECL exposure times, no cross-reactivity was ob- In order to determine to what extent membranes can be
served. In contrast, with EIA, weak, mutual cross-hybridization reused, we repeatedly stripped and rehybridized the filters by
was occasionally found between HPV types 33 and 58 when applying the PCR products for the respective HPV types in
hybridization was performed at 37°C, the condition previously different channels per experiment. It appeared that the mem-

FIG. 1. Optimization of oligoprobe concentration for RLB. (Upper panel) Different concentrations of oligoprobes were spotted onto the
membrane and subsequently hybridized with GP5⫹/6⫹ PCR products derived from clinical specimens containing HPV type 16, HPV types 16 and
33, HPV types 11 and 18, HPV type 16, no HPV (⫺), HPV type 33, and HPV type 16 from (top to bottom). Optimal signals were derived when
100 to 200 pmol of oligoprobe/␮l was used. (Lower panel) Dilutions of cloned HPV type 16 (pHPV16) DNA were subjected to GP5⫹/6⫹ PCR
and RLB, showing that 100 ag of HPV type 16 DNA can easily be detected.
VOL. 40, 2002 RAPID IDENTIFICATION OF HPV GENOTYPES 783

Downloaded from http://jcm.asm.org/ on January 31, 2021 by guest

FIG. 2. Schematic outline of HPV detection and typing approaches for clinical specimens.

branes could be stripped and rehybridized at least 15 times were predominantly found, whereas HPV types 34, 44, 57, 61,
without a loss of signal. MM8, IS39, and CP8061 were not detected. Twenty-two per-
Evaluation of RLB. (i) Comparison of RLB typing with cent of the HPV-positive normal scraping specimens showed
HR-HPV or LR-HPV group-specific EIA. The performance of mixed infections. Interestingly, multiple infections appeared to
RLB for the typing of 37 HPV types in clinical specimens was be age dependent, being most frequent (50%) in women 15 to
first evaluated with HPV-positive cervical scraping (n ⫽ 196) 24 years old (data not shown). Of these mixed infections, 75%
and tissue biopsy (n ⫽ 100) specimens which were pretested by were double infections, 22% were triple, and 3% were quadru-
GP5⫹/6⫹ PCR followed by HR-HPV and LR-HPV group- ple. In cytomorphologically abnormal scraping specimens
specific EIA identification. A schematic outline of this proce- (n ⫽ 33; predominantly mild dyskaryosis), a slightly higher
dure is given in Fig. 2. Results are shown in Table 4. Repre- frequency of multiple infections (27%) was found. In addition,
sentative RLB results are shown in Fig. 3. RLB was performed biopsy specimens showing cervical intraepithelial neoplasia
for 40 samples concurrently per membrane. Clear RLB signals (CIN I (n ⫽ 11), II (n ⫽ 20), and III (n ⫽ 30) and invasive
were obtained for all samples, and the identified types be- cervical carcinoma (n ⫽ 39) showed one or more HR-HPV
longed to the HR-HPV and/or LR-HPV groups for which EIA types in RLB, with HPV type 16 being the predominant HPV
scored positive. In addition to single HPV infections, multiple type (Table 4). However, considerably fewer multiple HPV
infections of up to four HPV types were found, and HR-HPV– infections were detected in these specimens than in the scrap-
LR-HPV multiple infections determined by EIA were success- ing specimens, ranging from 9% for CIN I to 3% for invasive
fully typed as HR-HPV–LR-HPV mixed infections by RLB carcinomas.
(Table 4). In HPV-containing cytomorphologically normal (ii) Comparison of RLB typing with EIA typing for HR-HPV
scraping specimens (n ⫽ 163), HPV type 16 (35%), HPV type types. In order to compare RLB and EIA for identifying
31 (13%), and HPV type 18 (9%) were most frequently found individual HR-HPV genotypes, we analyzed that 210 cervi-
among the HR-HPV types. Among the LR-HPV types, HPV cal scraping specimens previously scored HR-HPV positive in
types 42, 6, 70, and 73 (12.3, 2.5, 2.5, and 2.5%, respectively) the HR-HPV GP5⫹/6⫹ PCR-EIA analysis. Results are shown
784 VAN DEN BRULE ET AL. J. CLIN. MICROBIOL.

TABLE 4. Detection of HPV genotypes by RLB in cervical specimens prescreened by HR- and LR-HPV GP5⫹/6⫹ PCR-EIA
No. of the following specimens in each category (typea [no. of times found]):

Category Cervical scraping Biopsy

Normal Dyskaryosis CIN I CIN II CIN III Carcinomas

b
HR-HPV positive 113 30 11 20 30 39
LR-HPV LR positiveb 34 1
LR-HPV and HR-HPV 16 2
positive

HPV single infections 127 24 10 18 30 38

(type)
16 43 13 8 8 16 30
18 7 1 1 1
31 9 3 2 5 2

Downloaded from http://jcm.asm.org/ on January 31, 2021 by guest

33 6 2 1 2 2
35 2 2 1 3
39 4 1 1
45 3 1 1
51 4 1 1
52 5 1 1 1
56 3 1
58 4 1
59 1
66 3 1 1 1
68 2 1
LR-HPV 31 (HPV 6 [2], 26, 40, 42 [11], 43 [3], 53, 54 [2], 1 (HPV 6)
55, 70 [3], 72, 73, 82MM4 [2], CP6108, 81)

HPV double infections 27 (HPV 6/73, 16/18 [2], 16/31 [3], 16/39, 16/42, [2], 7 (HPV 16/18, 16/31, 16/42, 1 (16/31) 2 (31/51, 33/39) 1 (16/31) 1 (16/59)
16/52, 16/53, 16/70, 16/73, 18/42, 18/82MM4, 16/52, 31/45, 33/52,
31/33, 31/52, 31/56, 31/59, 31/66, 33/51, 39/43, 56/40)
42/81, 42/73, 56/40, 51/42, 56/81)

HPV at least triple 9 (HPV 16/31/51, 18/31/51, 18/31/56, 18/39/42, 31/51/42, 2 (16/33/52, 18/31/58)
infections 39/52/56, 52/6/11, 56/66/55, 16/59/42/83)

a
Type designations indicate the types found in the multiple infections; e.g., 6/73 means that types 6 and 73 were both found in double infections.
b
Including double infections.

in Table 5. The same GP5⫹/6⫹ PCR products were used for typing results were confirmed in 6 cases and EIA typing results
EIA and RLB typing. The typing procedures showed an excel- were confirmed in 7 cases.
lent overall agreement rate of 96.5% (kappa value, 0.77) when
the individual typing results were taken into account. A total of DISCUSSION
175 out of 178 single infections (97.7%) detected by one or
both methods showed identical typing results (Table 5). Com- In this study, we showed that GP5⫹/6⫹ PCR-RLB is an at-
plete agreement for all HPV types detected was found for 19 tractive alternative for easy, rapid, and high-throughput identi-
out of 27 double infections (70.4%) and for 3 out of 5 triple fication of individual HPV genotypes. The sensitivities of RLB
infections (60.0%). When partial agreement was allowed, i.e., were identical to those of EIA, and the intensities of EIA sig-
at least one identical HPV type in double or triple infections, nals (optical densities) always corresponded to the intensities
the typing results obtained by EIA and RLB were almost of spots in RLB. Despite the fact that for RLB, 20-mer oligo-
identical (Table 5). Among the mixed infections detected by probes that sometimes differed by no more than two nucleo-
one or both assays, RLB detected more HPV types than EIA tides from related HPV types were used, the method appeared
in eight cases, whereas EIA detected more HPV types in two to be highly specific; no cross-reactivity was found between
cases. In general, the additional HPV types detected by RLB closely related HPV types, even when high concentrations of
showed weak RLB spots, indicating relatively low viral loads PCR products and long ECL exposure times were used.
for those types. Despite the advantage of its high specificity, the high strin-
Discrepant cases of EIA and RLB typing were subjected to gency of RLB requires that all variants of a certain HPV type
HPV type-specific PCR. The results are shown in Table 5. show a perfect match with the probe, since a single mismatch
With respect to single HPV infections, type-specific PCR con- may result in the failure of detection. Although the selected
firmed the EIA typing result in the three discrepant cases for RLB probes match perfectly the sequences of all HPV variants
which the RLB scored negative. With respect to the 10 dis- currently known (18, 31, 32), the possibility cannot be excluded
crepant cases in double and triple HPV infections, RLB typing that variants showing subtle sequence variations in the probe
results were confirmed in 6 cases and EIA typing results were region exist. Therefore, the probes may be subject to subtle
confirmed in 4 cases. Ultimately, when all 13 discrepant cases changes when more sequence information for HPV variants
of single and multiple infections were taken into account, RLB becomes available in the future. On the other hand, this RLB
VOL. 40, 2002 RAPID IDENTIFICATION OF HPV GENOTYPES 785

Downloaded from http://jcm.asm.org/ on January 31, 2021 by guest

FIG. 3. Representative example of RLB typing of GP5⫹/6⫹ PCR products derived from cervical scraping specimens. Forty cervical scraping
specimens (top panel) were typed for 37 HPV types (left panel: OLIGO). HPV types found are indicated (top panel: HPV typing). In addition,
GP5⫹/6⫹ PCR products for HPV-negative cervical scraping specimens were included to confirm the specificity of RLB (⫺). It is noteworthy that
differences in signal intensity reflect different copy numbers for the HPV types present in the specimens.

system may be suitable for the identification of variants when carcinomas (1). Indeed, HPV type 26 was identified by RLB
probes are selected in regions where variants differ from each for a rare case of cervical carcinoma that previously tested
other. HR-HPV negative but LR-HPV positive by routine HPV di-
A comparison of RLB and EIA typing of HR-HPV types in agnostic tests in our laboratory (data not shown). We found
patient samples revealed excellent agreement, in line with the HPV types 26, 54, 70, and 73 in a substantial number of normal
identical sensitivities determined for the assays. The fact that smears (7%), and their clinical significance in CIN develop-
for the discrepant cases type-specific PCR confirmed about ment will be studied in ongoing follow-up investigations.
half of the RLB results and half of the EIA results further Multiple HPV infections were found in 22% of the HPV-
supports the notion that discordant results are not due to positive normal scraping specimens by RLB (Table 4). Inter-
possible differences in the sensitivities of the assays but rather estingly, these mixed infections appeared to be age dependent,
are due to sampling errors. Generally, the distribution of HPV being most frequent (50%) in younger women (data not
genotypes found in this study by RLB is in line with data from shown), most likely reflecting greater sexual activity. Although
previous studies (1, 13, 14, 20, 21, 29). Although we classified multiple HPV infections were rather uncommon in biopsy
HPV types 26, 34, 54, 70, and 73 as LR-HPVs, it is noteworthy specimens for CIN and invasive carcinoma, a substantial pro-
that their oncogenic potential is still unknown. These types portion of cervical smears showing dyskaryosis were found
have been reported to be rarely present in invasive cervical associated with multiple infections by RLB. This result sug-
786 VAN DEN BRULE ET AL. J. CLIN. MICROBIOL.

TABLE 5. Comparison of typing of HPV in cervical use of two miniblotters allows the typing of up to 84 samples in
specimens by RLB and EIA less than 1 day, whereas conventional typing by EIA with
Identical EIA and Discrepant results individual probes takes 1 week for one full-time technician.
RLB results HPV type found by:
Typing may be even more rapid when a miniblotter with a
Infection larger number of channels becomes available. The identifica-
n Type-specific
HPV type n EIA RLB
PCRa
tion of HPV types on exposed X-ray films can be facilitated
using a special raster (containing both the order of the HPV
Single 16 60 3 35 35 oligoprobes and the sample numbers) photocopied on a trans-
18 18 59 59
31 27 45 45
parent sheet. Alternatively, RLB images can be digitally re-
33 6 corded and processed using specific software packages. Also,
35 4 because the RLB method uses a nonprecipitating ECL sub-
39 9 strate, it has the advantage that nylon filters can be stripped
45 9
51 9
and successfully reused at least 15 times. In contrast, other

Downloaded from http://jcm.asm.org/ on January 31, 2021 by guest

52 14 systems use color substrates and allow only single analysis.
56 10 Furthermore, owing to the use of negatively charged filters
58 3 rather than the commonly used positively charged filters, the
59 3
background of RLB is minimal. By use of other labels, such as
66 2
68 1 fluorophores, or detection systems, such as enzyme-linked
chemifluorescence (9), signals can be directly detected by a
Total 175 fluorescent scanner and subsequently processed.
Another advantage is that in combination with GP5⫹/6⫹
Doubleb 16/33 1 8 45/52 52 45/52 PCR, which amplifies a fragment of approximately 150 bp, this
16/45 1 31 31/68 31 RLB system provides an ideal compromise between efficient
16/51 1 66 56/66 56/66
16/52 1 39 39/68 39/68 small-fragment amplification and specific HPV typing. Al-
16/56 1 31 31/56 31/56 though the SPF10 system amplifies an even shorter fragment of
16/58 1 18 18/35 18/35 65 bp, typing by a line probe assay is more complicated since it
18/31 1 35/59 35 35/59 requires the interpretation of specific hybridization patterns
18/33 1 35 35/68 35/68
18/58 1 rather than single-probe hybridization results for the typing of
33/58 1 9 of the 25 HPV types used (13). This situation is due to the
39/56 2 small intervening region in the PCR product left for the selec-
39/58 1 tion of specific probes, so that the interpretation of typing
39/66 1
45/51 1 results is not facilitated, especially for multiple HPV infections.
51/52 1 Although the MY09/11 reverse line blot assay uses individual
58/66 3 probes for the identification of types, this method has the
disadvantage that relatively large fragments (i.e., about 450 bp)
Total 19
are amplified. Based on the fact that the GP5⫹/6⫹ primers are
located within the MY09/11 PCR amplicon, our RLB system
Tripleb 16/33/45 1 2 16/39 16/39/51 16/39
has the further advantage that it also can be used for the typing
16/39/56 1 18/39 18/39/66 18/39/66
16/39/52 1 of MY09/11 PCR products.
In principle, different scenarios are possible for the use of
Total 3 the RLB system, i.e., a direct typing approach or typing of
a
Type-specific PCR was performed for HPV types found by either EIA or samples that were prescreened by HPV group-specific assays,
RLB. such as HR-HPV or LR-HPV GP5⫹/6⫹ PCR-EIA or Hybrid
b
See Table 4, footnote a, for an explanation of type designations.
Capture 2. We favor a prescreening approach (Fig. 2), partic-
ularly for testing samples in which a rather low HPV preva-
gests that additional, nonrelevant HPV types which are not lence is expected. This approach would directly couple clini-
present in the underlying lesion are detectable in cervical cally validated HPV detection methods with a high-throughput
scraping specimens. Similar observations were made in recent typing procedure suitable for mass screening. Moreover, HPV
studies with SPF10 PCR (13), although these studies revealed group-specific detection can still be done in an even less labo-
an overall higher frequency of multiple HPV infections in rious way with a microtiter plate format, and the prescreen-
cervical smears and biopsy specimens (13, 22). Hence, the ing approach will prevent redundant typing of HPV-nega-
biological relevance of multiple HPV infections for CIN dis- tive samples. As a prescreening method, HR-HPV or LR-
ease and cervical cancer is yet unknown; further studies on this HPV GP5⫹/6⫹ PCR-EIA is practically most convenient, since
issue deserve attention if the presence of multiple HPV types the resulting PCR products can be used directly for RLB
in these lesions can be confirmed by in situ hybridization tech- typing and no additional PCR is required.
niques. In conclusion, the application of GP5⫹/6⫹ PCR-RLB can
The RLB method developed in this study has the potential be of great value for studies which require reliable high-
for large-scale analysis since it is more user-friendly and less throughput HPV typing. The method can be conveniently ap-
time-consuming than conventional methods. For example, the plied as a second step after GP5⫹/6⫹ PCR and HR-HPV or
VOL. 40, 2002 RAPID IDENTIFICATION OF HPV GENOTYPES 787

LR-HPV detection by EIA, which is at present one of the most Sherman, R. D. Burk, R. J. Kurman, S. Wacholder, B. B. Rush, D. M. Cadell,
P. Lawler, D. Tabor, and M. Schiffman. 1999. Detection of human papillo-
frequently used noncommercial HPV detection systems. mavirus DNA in cytologically normal women and subsequent cervical squa-
mous intraepithelial lesions. J. Natl. Cancer Inst. 91:954–960.
ACKNOWLEDGMENTS 16. Manos, M. M., Y. Ting, D. K. Wright, A. J. Lewis, T. R. Broker, and S. M.
Wolinsky. 1989. Use of polymerase chain reaction amplification for the
We thank A. Splinter for excellent technical assistance, I. van de Pol detection of genital human papillomaviruses. Cancer Cells 7:209–214.
for technical support, M. Jacobs for helpful discussions, and P. Stern 17. Meijer, C. J. L. M., L. Rozendaal, J. C. van der Linden, T. J. M. Helmer-
for critically reading the manuscript. horst, F. J. Voorhorst, and J. M. M. Walboomers. 1997. Human papilloma-
virus testing for primary cervical cancer screening, p. 338–349. In E. Franco
and J. Monsonego (ed.), New developments in cervical cancer screening and
REFERENCES prevention. Blackwell Science Ltd., Oxford, England.
1. Bosch, F. X., M. M. Manos, N. Muñoz, M. Sherman, A. M. Jansen, J. Peto, 18. Meyers, G., C. Baker, K. Münger, F. Svedrup, A. McBride, H.-U. Bernard,
M. H. Schiffman, V. Moreno, R. Kurman, K. V. Shah, et al. 1995. Prevalence and J. Meissner (ed.). 1997. Human papillomaviruses 1997. A compilation
of human papillomavirus in cervical cancer: a worldwide perspective. J. Natl. and analysis of nucleic acid and amino acid sequences. Theoretical Biology
Cancer Inst. 87:796–802. and Biophysics Group T-10, Los Alamos National Laboratory, Los Alamos,
2. Coutlée, F., P. Gravitt, H. Richardson, C. Hankins, E. Franco, N. Lapointe, N. Mex.
H. Voyer, and the Canadian Women’s HIV Study Group. 1999. Nonisotopic 19. Nelson, J. H., G. A. Hawkins, K. Edlund, M. Evander, L. Kjellberg, G.

Downloaded from http://jcm.asm.org/ on January 31, 2021 by guest

detection and typing of human papillomavirus DNA in genital samples by Wadell, J. Dillner, T. Gerasimova, A. L. Coker, L. Pirisi, D. Petereit, and
the line blot assay. J. Clin. Microbiol. 37:1852–1857 P. F. Lambert. 2000. A novel and rapid PCR-based method for genotyping
3. de Roda Husman, A. M., J. M. M. Walboomers, A. J. C. van den Brule, human papillomaviruses in clinical samples. J. Clin. Microbiol. 38:688–695.
C. J. L. M. Meijer, and P. J. F. Snijders. 1995. The use of general primers 20. Nobbenhuis, M. A. E., J. M. M. Walboomers, T. J. M. Helmerhorst, L.
GP5 and GP6 elongated at their 3⬘ ends with adjacent highly conserved Rozendaal, A. J. Remmink, E. K. J. Risse, H. C. van der Linden, F. J.
sequences improves human papillomavirus detection by polymerase chain Voorhorst, P. Kenemans, and C. J. L. M. Meijer. 1999. Relation of human
reaction. J. Gen. Virol. 76:1057–1062. papillomavirus status to cervical lesions and consequences for cervical-can-
4. Forslund, O., B. G. Hansson, and B. Bjerre. 1994. Typing of human papil- cer screening: a prospective study. Lancet 354:20–25.
lomaviruses by consensus polymerase chain reaction and a non-radioactive 21. Peyton, C. L., P. E. Gravitt, W. C. Hunt, R. S. Hundley, M. Zhao, R. J. Apple,
reverse dot blot hybridization. J. Virol. Methods 49:129–140. and C. M. Wheeler. 2001. Determinants of genital human papillomavirus
5. Gravitt, P. E., C. L. Peyton, R. J. Apple, and C. M. Wheeler. 1998. Geno- detection in a US population. J. Infect. Dis. 183:1554–1564.
typing of 27 human papillomavirus types by using L1 consensus PCR prod- 22. Quint, W. G., G. Scholte, L. J. van Doorn, B. Kleter, P. H. Smits, and J.
ucts by a single-hybridization, reverse line blot detection method. J. Clin. Lindeman. 2001. Comparative analysis of human papillomavirus infections
Microbiol. 36:3020–3027. in cervical scrapes and biopsy specimens by general SPF(10) PCR and HPV
6. Gravitt, P. E., C. L. Peyton, T. Q. Alessi, C. M. Wheeler, F. Coutlée, A. genotyping. J. Pathol. 194:51–58.
Hildesheim, M. H. Schiffman, D. R. Scott, and R. J. Apple. 2000. Improved 23. Rijpkema, S. G., M. J. Molkenboer, L. M. Schouls, F. Jongejan, and J. F.
amplification of genital human papillomaviruses. J. Clin. Microbiol. 38:357– Schellekens. 1995. Simultaneous detection and genotyping of three genomic
361. groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by
7. Jacobs, M. V., A. M. de Roda Husman, A. J. C. van den Brule, P. J. F. characterization of the amplified intergenic spacer region between 5S and
Snijders, C. J. L. M. Meijer, and J. M. M. Walboomers. 1995. Group-specific 23S rRNA genes. J. Clin. Microbiol. 33:3091–3095.
differentiation between high- and low-risk human papillomavirus genotypes 24. Snijders, P. J. F., A. J. C. van den Brule, H. F. J. Schrijnemakers, G. Snow,
by general primer-mediated PCR and two cocktails of oligonucleotide C. J. L. M. Meijer, and J. M. M. Walboomers. 1990. The use of general
probes. J. Clin. Microbiol. 33:901–905. primers in the polymerase chain reaction permits the detection of a broad
8. Jacobs, M. V., P. J. F. Snijders, A. J. C. van den Brule, T. J. M. Helmerhorst, spectrum of human papillomavirus genotypes. J. Gen. Virol. 71:173–181.
C. J. L. M. Meijer, and J. M. M. Walboomers. 1997. A general primer 25. Solomon, D., M. Schiffman, and R. Tarone. 2001. Comparison of three
GP5⫹/6(⫹)-mediated PCR-enzyme immunoassay method for rapid detec- management strategies for patients with atypical squamous cells of undeter-
tion of 14 high-risk and 6 low-risk human papillomavirus genotypes in cer- mined significance: baseline results from a randomized trial. J. Natl. Cancer
vical scrapings. J. Clin. Microbiol. 35:791–795. Inst. 93:293–299.
9. Jordens, J. Z., S. Lanham, M. A. Pickett, S. Amarasekara, I. Abeywickrema, 26. van den Brule, A. J. C., P. J. F. Snijders, R. L. J. Gordijn, O. P. Bleker,
and P. J. Watt. 2000. Amplification with molecular beacon primers and C. J. L. M. Meijer, and J. M. M. Walboomers. 1990. General primer medi-
reverse line blotting for the detection and typing of human papillomavirus. ated polymerase chain reaction permits the detection of sequenced and still
J. Virol. Methods 89:29–37. unsequenced human papillomavirus genotypes in cervical scrapes and car-
10. Kamerbeek, J., L. Schouls, A. Kolk, M. van Agterveld, D. van Soolingen, S. cinomas. Int. J. Cancer 45:644–649.
Kuijper, A. Bunschoten, H. Molhuizen, R. Shaw, M. Goyal, and J. van 27. van den Brule, A. J. C., C. J. L. M. Meijer, V. Bakels, P. Kenemans, and
Embden. 1997. Simultaneous detection and strain differentiation of Myco- J. M. M. Walboomers. 1990. Rapid detection of human papillomavirus in
bacterium tuberculosis for diagnosis and epidemiology. J. Clin. Microbiol. cervical scrapes by combined general primer-mediated and type-specific
35:907–914. polymerase chain reaction. J. Clin. Microbiol. 28:2739–2743.
11. Kaufhold, A., A. Podbielski, G. Baumgarten, M. Blokpoel, J. Top, and L. 28. Vernon, S. D., E. R. Unger, and D. Williams. 2000. Comparison of human
Schouls. 1994. Rapid typing of group A streptococci by the use of DNA papillomavirus detection and typing by cycle sequencing, line blotting, and
amplification and nonradioactive allele specific oligonucleotide probes. hybrid capture. J. Clin. Microbiol. 38:651–655.
FEMS Microbiol. Lett. 119:19–26. 29. Walboomers, J. M. M., M. V. Jacobs, M. M. Manos, F. X. Bosch, A. Kum-
12. Kleter, B., L. J. van Doorn, J. ter Schegget, L. Schrauwen, K. van Krimpen, mer, K. V. Shah, P. J. F. Snijders, J. Peto, C. J. L. M. Meijer, and N. Muñoz.
M. Burger, B. ter Harmsel, and W. Quint. 1998. Novel short-fragment PCR 1999. Human papillomavirus is a necessary cause of invasive cervical cancer
assay for highly sensitive broad-spectrum detection of anogenital human worldwide. J. Pathol. 189:12–19.
papillomaviruses. Am. J. Pathol. 153:1731–1739. 30. Wallin, K. L., F. Wiklund, T. Angstrom, F. Bergman, U. Stendahl, G. Wadell,
13. Kleter, B., L. J. van Doorn, L. Schrauwen, A. Molijn, S. Sastrowijoto, J. ter G. Hallmans, and J. Dillner. 1999. Type-specific persistence of human pap-
Schegget, J. Lindeman, B. ter Harmsel, M. Burger, and W. Quint. 1999. illomavirus DNA before the development of invasive cervical cancer.
Development and clinical evaluation of a highly sensitive PCR-reverse hy- N. Engl. J. Med. 341:1633–1638.
bridization line probe assay for detection and identification of anogenital 31. Yamada, T., C. M. Wheeler, A. L. Halpern, A.-C. M. Stewart, A. Hildesheim,
human papillomavirus. J. Clin. Microbiol. 37:2508–2517. and S. A. Jenison. 1995. Human papillomavirus type 16 variant lineages in
14. Krüger Kjaer, S., A. J. C. van den Brule, J. E. Bock, P. A. Poll, G. Engholm, U.S. populations characterized by nucleotide sequence analysis of the E6,
M. E. Sherman, J. M. M. Walboomers, and C. J. L. M. Meijer. 1996. Human L2, and L1 coding segments. J. Virol. 69:7743–7753.
papillomavirus—the most significant risk determinant of cervical intraepi- 32. Yamada, T., M. M. Manos, J. Peto, C. E. Greer, N. Muñoz, F. X. Bosch, and
thelial neoplasia. Int. J. Cancer 65:601–606. S. M. Wheeler. 1997. Human papillomavirus type 16 sequence variation in
15. Liaw, K.-L., A. G. Glass, M. M. Manos, C. E. Greer, D. R. Scott, M. cervical cancers: a worldwide perspective. J. Virol. 71:2463–2472.