J Acupunct Meridian Stud 2012;5(6):310e318

Available online at www.sciencedirect.com

Journal of Acupuncture and Meridian Studies

journal homepage: www.jams-kpi.com

- RESEARCH ARTICLE -

Ameliorative Effects of Syzygium jambolanum

Extract and its Poly (lactic-co-glycolic) Acid
Nano-encapsulated Form on Arsenic-induced
Hyperglycemic Stress: A Multi-parametric Evaluation
Asmita Samadder, Sreemanti Das, Jayeeta Das, Avijit Paul,
Anisur Rahman Khuda-Bukhsh*

Cytogenetics and Molecular Biology Laboratory, Department of Zoology, University of Kalyani,

Kalyani, India

Available online Sep 18, 2012

Received: Apr 21, 2012 Abstract

Revised: Aug 7, 2012 In South East Asia, groundwater arsenic contamination has become a great menace.
Accepted: Aug 22, 2012 Chronic arsenic intoxication leads to a hyperglycemic condition in animals and man.
Because of undesirable side-effects and affordability, orthodox medicine, like insulin,
KEYWORDS is not preferred by many who like natural products instead. Unfortunately, such natural
blood-brain-barrier; products mostly lack scientific validation. Therefore, we became interested in assessing
hyperglycemia; the efficacy of the ethanolic seed extract of Syzygium jambolanum (SJ), traditionally
L6 cells; used against diabetic conditions. We also formulated poly (lactic-co-glycolic) acid
mice; (PLGA)-encapsulated nano-SJ (NSJ) and tested whether the ameliorative potentials of
PLGA-nano- SJ could be enhanced by nano-encapsulation. In this study, we conducted both in vitro
encapsulation;
(in L6 cells) and in vivo (in mice) experiments to assess the relative efficacy of SJ and
Syzygium jambolanum
NSJ. We characterized the physico-chemical features of NSJ by atomic force microscopy
and critically analyzed several bio-markers and signal proteins associated with arsenic-
induced stress and hyperglycemia. We also determined the relative ameliorative poten-
tials of SJ and NSJ by using standard protocols. NSJ could cross the blood brain barrier
in mice. Overall results suggested that NSJ had a greater potential than that of SJ, indi-
cating the possibility of using NSJ in the future drug design and management of arsenic-
induced hyperglycemia and stress.

* Corresponding author. Department of Zoology, University of Kalyani, Kalyani 741235, W.B., India.
E-mail: [email protected], [email protected].
Copyright ª 2012, International Pharmacopuncture Institute
pISSN 2005-2901 eISSN 2093-8152
http://dx.doi.org/10.1016/j.jams.2012.09.001
Nano-Syzygium reduces arsenic induced stress 311

1. Introduction 2.2. Source of the drug (ethanolic extract of SJ)

Arsenic-induced hyperglycemia has become one of the Dried seeds of SJ, procured from the market, were
major concerns of human health worldwide. Hydro- macerated to a powder, extracted in ethanol and filtered.
arsenicism, through arsenic-contaminated drinking water, Following evaporation of the filtrate in a rotary evaporator

has increased the risk of diabetes development in arsenic- at 40 C, it was dried in vacuum desiccators for further
prone areas [1]. Exposure to arsenic produces multiple experimental use.
biochemical sequelae including arsenic-induced oxidative
stress, resulting in interference with insulin, insulin 2.3. Formation of blank and drug loaded nano-
receptors, glucose transporters (GLUTs), and inflammatory particles
responses, thereby bringing about a change in the gene
expression leading to the progression of hyperglycemia. For PLGA encapsulation of SJ, we deployed the solvent
Therapeutic arsenals of modern medicine are quite displacement technique of Fessi et al [7] under optimal
prevalent in combating diabetes, but they produce consid- conditions. To 20 mL of an aqueous solution of F68; w/v
erable side-effects. Therefore, it is necessary to develop stabilizer (1% polyoxyethylene-polyoxypropylene), we
a traditionally adapted, but more advanced, complemen- added an organic phase mixture containing 10 mg of dried SJ
tary and alternative drug formulation, to treat several dissolved in 3 mL acetone along with 50 mg PLGA in a drop-
symptoms of diabetes and its complications [2]. There are wise manner (0.5 mL/min). Stirring the mixture continu-
several drugs of plant origin containing substantial amounts ously at room temperature until complete evaporation of the
of alkaloids, glycosides and flavonoids bearing strong anti- organic solvent, the redundant stabilizer was removed by


oxidant properties, for the treatment of diabetes, which centrifugation at 2500 g at 4 C for 30 minutes. The pellet was
are described in ancient literature. However, these drugs re-suspended in Milli-Q water and washed three times and


prove to be mostly effective in long-term treatment and so the nano-particles obtained were stored in suspensions at 4 C
often lose their importance when compared to the faster until further use. Following the same method, except for the
onset of action of orthodox medicines. Therefore, not only addition of SJ particles, we also prepared blank nano-
do these drugs need proper scientific validation, but efforts particles which did not show any ameliorative efficacy
are also needed to enhance their action and increase their when administered to arsenicestressed conditions (in both
bioavailability to targeted organs/organ systems. in vitro and in vivo models); only drug-loaded nano-particles
In recent years, nanotechnology has been used in were considered for further studies.
medicine as a basic science tool [3,4] in therapeutic
applications. Nano-particles offer a non-toxic and efficient
carrier system for targeted-delivery and enhanced drug
2.4. Atomic force microscopic (AFM) studies of
bioavailability within the cells, tissues, or both. nano-SJ (NSJ)
An effort has been made in the present study to explore
one of the modern ways of pharmaceutical interventions to Samples for AFM imaging were prepared by placing a drop
formulate nano-encapsulation of the seed extract of a tradi- of NSJ-suspension on a freshly cleaned mica sheet and
tional Indian folk medicine, Syzygium jambolanum (SJ) [5,6]. allowing it to dry in air. The observation was recorded
Our study also focuses on the evaluation of the relative anti- through AFM (Veeco di CP-11, Plainview, NY, USA) imaging
diabetic efficacy of this nano-encapsulated-SJ (NSJ) in in amplitude and tapping modes.
regard to the reference unencapsulated form (SJ alone).
Studies related to its target specific delivery, availability to 2.5. Cell culture procedure
cells/tissues and pace of action in arsenic-induced hyper-
glycemic conditions, were also considered in both in vitro L6 (rat skeletal muscle cell line) cells were obtained from
(L6: rat skeletal muscle cell line) and in vivo (mice) models. the National Centre for Cell Science, Pune, India and grown


Therefore, the main objectives were: (1) to formulate at 37 C in a 5% carbon-dioxide atmosphere, in Dulbecco’s
poly (lactic-co-glycolic) acid (PLGA)-nano-encapsulation of Modified Eagle’s Medium (DMEM) supplemented with 10%
SJ seed extract; (2) to characterize the SJ-nano-particles fetal-bovine-serum (FBS) and 1% antibiotic (penicillin-
by several advanced scientific techniques, to verify their streptomycin-amphotericin). For experimental studies, the
size and planar orientation frequency; (3) to track down the cells were grown to 80e90% confluence, harvested in ice-
target of the nano-particles delivered, pace of action and cold phosphate buffered saline (PBS) and plated at the
capability of crossing the blood-brain-barrier (BBB); and (4) desired density. The cells were allowed to re-equilibrate
to examine the relative efficacy of NSJ versus SJ in for 24 hours before any treatment [8].
ameliorating arsenic-induced stress in L6 skeletal muscle
cells and arsenic-induced hyperglycemia in mice.
2.6. Introduction of arsenic in L6 cells

2. Materials and methods Sodium arsenite (NaAsO2, SA) was dissolved in sterilized
Milli-Q water at a concentration of 100 mM and stored at


2.1. Reagents 4 C. L6 Cells were exposed to freshly prepared SA 0.5 mM in
DMEM media for 30 minutes [9]. Earlier, in a range finding
All the chemicals used were of analytical grade and trial, different concentrations of SA (0.1 mM, 0.3 mM,
provided by Sigma Chemical Co. St. Louis, MO, USA. 0.5 mM, 0.7 mM and 1 mM) were tested at different time
312 A. Samadder et al.

intervals. We observed that treatment with 0.1 mM SA did cellular peroxides [13] and analyzed in FACS (BD FACS Aria,
not show toxicity, even after very long SA exposures and Franklin Lakes, New Jersey, USA).
0.3 mM SA showed toxicity only after exposure to arsenic
which was too long; these doses were therefore not taken 2.12. Immunofluorescence assay
into consideration. At 0.5 mM of SA exposure, we observed
toxicity after 30 min. However, the doses 0.7 mM and 1 mM An immunofluorescence study of NFkb protein was
showed severe toxicity immediately after treatment, so undertaken in L6 cells following standard procedure [14]
these doses were also not taken into consideration for the and observed under a fluorescence microscope (Leica,
study. Therefore, 0.5 mM SA treatment for 30 minutes was Wetzlar, Germany).
further used to conduct several parameters of the present
in vitro study.
2.13. Analysis of several proteins in L6 cells by
immunoblotting
2.7. Dose of SJ and NSJ
To analyze the expressions of different proteins, immuno-
SJ and NSJ were prepared in DMEM media at blot was conducted by using anti- GLUT4, inducible nitric
a concentration of 1 mg/mL stock solution and stored at oxide synthase (iNOS) (Santa Cruz Biotechnology, Santa


4 C. Cells were exposed to freshly prepared SJ at a dose of Cruz, CA, USA) and alkaline phosphatase-conjugated
100 ng/mL and NSJ at doses of 50 ng/mL, and 100 ng/mL for secondary antibody (Sigma, Claremont, California, USA)
30 minutes. The dose and time of exposure were optimized [15] for the purpose. For quantitative analysis of each
in a range finding trial earlier [5]. band, we determined the band intensity using the Total Lab
software (Ultra Lum, Claremont, California, USA).
2.8. In vitro release of NSJ
2.14. RNA extraction and quantitative reverse
In vitro release of SJ from its nano-encapsulated form, transcriptase-polymerase chain reaction (RT-PCR)
after being administered in L6 cells, was estimated from
analysis
the SJ standard curve. The cells were lysed in PBS and
centrifuged at 2000 g. The absorbance was taken to
Total RNA was extracted from the L6 cells using Trizol reagent,
calculate the amount of SJ in it at 369 nm (lmax of SJ).
according to the manufacturer’s instructions and converted to
cDNA by reverse transcriptase. This cDNA served as the
2.9. Cell viability assay template for PCR amplification by Taq polymerase, as per the
standard practice [4]. Sequences (Bioserve Biotech, Hyder-
The 3(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium abad, India) of the forward and reverse primers used for
bromide (MTT) assay [10] was used to determine the specific amplifications were as follows: G3PDH(5’-ATGGGGA
percentage cell viability in different groups of L6 cells. L6 AGGTGAA-GGTCGG-3’and5’-GGATGCTAAGCAGTTGGT-3’);GL
cells (106 cells/mL) were cultured for 24 hours on 96-well UT4(5’-AAGATGGCCACGGAGA-GAG-3’and5’GTGGGTTGTGGC
microplates. The cells were incubated for 30 minutes with AGTGAGTC-3’);Glucokinase(5’-CACCCAACTGCGAA-ATCACC-3’
and without SA and then incubated with SJ and NSJ in SA- and 5’CATTTGTGGGGTGTGGAGTC).
treated and untreated cells for 30 minutes. Then MTT was After PCR amplification, we photographed the DNA
added and after 4 hours, formazan crystals were solubilized bands and densitometrically analyzed them through the
with DMSO and the absorbance of the solution was Total Lab software (Ultra Lum, Claremont, California, USA).
measured at 595 nm using an ELISA reader.
2.15. In vivo studies
2.10. Glucose uptake
2.15.1. Animals
Glucose uptake by L6 cells after treatment with SJ and NSJ Healthy Swiss albino strain of inbred mice (Mus musculus) (6/8
was estimated following the standard procedure [11] and weeks: w25 g, both sexes), housed for at least 14 days in an


the amount of glucose in the media was calculated using environmentally controlled room temperature (24e26  2 C;
anthrone reagent by following the standard protocol [12]. humidity Z 55  5%, 12-hour light/dark cycle), with access to
To measure non-specific glucose uptake, we incubated the food and water ad libitum, were used for the present study.
cells simultaneously in the presence of 10 mM cytochalasin The Animal Ethics Committee, University of Kalyani,
B in another experimental set, to block transporter- approved the experimental protocols (Vide:Certificate for
mediated glucose uptake, and subtracted these data from Proposal No.KU/IAEC/Z-11/07 dt.18.5.2007).
the data of total glucose uptake in each assay [11].
2.15.2. Induction of arsenic-induced-hyperglycemia (iAs)
2.11. Quantification of intracellular ROS in mice
Hyperglycemia was induced in mice by oral administration
For this purpose, we also used a cell permeable fluores- of SA at a dose of 20 mg/kg [16] for 8 weeks. Blood glucose
cent probe, 2’7’-dichloro dihydrofluorescein diacetate level was measured in pre- and post-fed mice. Mice having
(H2DCF-DA), a non fluorescent compound, which is con- blood glucose levels higher than 180 mg/dL were consid-
verted into highly fluorescent dichlorofluorescein (DCF) by ered to be hyperglycemic and used for this study.
Nano-Syzygium reduces arsenic induced stress 313

2.15.3. Dose of SJ and NSJ in vivo from Cogent Diagnostics Ltd, Sachin, Surat, India (code:
SJ and NSJ were orally administered through gavage in SA- 93DP100-74) [17].
induced hyperglycemic mice, at a dose of 20 mg/kg to each Glycosylated hemoglobin (GHB): To determine GHB
mouse for SJ [6] and at two different doses of NSJ, namely, quantitatively in blood, we used a standardized GHB ion
10 mg/kg (I) and 20 mg/kg (II), respectively, for 8 weeks. SJ exchange resin method kit from Coral, Crest Biosystems,
and NSJ when fed to normal mice did not show any Verna, Goa, India (M.L.No.623, Lot: GHB1177) [18] in
cytotoxicity. different sets of experimental [normal, SA-treated,
SA þ SJ, SA þ NSJ (I) and SA þ NSJ (II) treated] mice.
2.15.4. Diabetic marker analysis in vivo Assessment of the ability of PLGA-NSJ to cross the BBB:
Blood glucose level: Blood glucose levels were measured To specifically determine if NSJ had the ability to cross the
in different sets of experimental [normal, SA-treated, BBB, we deployed the FITC-PLGA tagging technique [19]
SA þ SJ treated, SA þ NSJ (I) and SA þ NSJ (II) treated] where PLGA was labeled with FITC (fluorescein iso-
mice using a standardized GOD-POD Glucose kit (Autospan) thiocyanate) at first. Then this FITC-labeled-PLGA was used

Figure 1 Atomic force microscopic images of PLGA-encapsulated-nano-SJ (NSJ) in: (A) 2D; (B) 3D; (C) Fast Fourier Transformation
mode; (D) in vitro release of NSJ; (E) graphical representation of percentage cell viability assessment; and (F) glucose uptake of
different sets of L6 cells before and after the treatment of the drugs; (i) normal; (ii) SA; (iii) SA þ SJ; (iv) SA þ NSJ (I); (v) SA þ NSJ
(II). ***p < 0.001, **p < 0.01 vs. sodium arsenite treated group.
314 A. Samadder et al.

to encapsulate SJ, by following the solvent displacement which display the size of the NSJ to be 122 nm, spherical in
technique of Fessi et al [7] for preparation of FITC-labeled- shape, with a smooth surface, but without any pinholes or
PLGA-SJ-nano-particles, which were orally administered to cracks. The 2D Fast Fourier Transformation (FFT) image in
mice for 7 days at a dose of 10 mg/kg. FITC-labeled-PLGA AFM also shows a uniform spatial frequency of topographic
served as the positive control of our study. At the end of planar signal of SJ-nano-particles (Fig. 1C).
the treatment period, the mice were sacrificed via cervical
dislocation [8]. The brain tissues were dissected out and fixed 3.2. In vitro release kinetics of SJ-nano-particles
in normal-buffer-formalin, dehydrated and processed for
histological samples preparation as per standard practice [4]
Constant release of SJ from its nano-encapsulated form was
and were observed under a fluorescence microscope.
observed from 0 to 30 minutes post treatment with NSJ in
L6 cells (Fig. 1D).
2.16. Statistical analysis
3.3. Cell viability assay
All the experimental data are presented as mean values of
three independent experiments and statistically analyzed
The % viability of cells was decreased in SA cells, but it
by Student t test and one-way ANOVA.
reverted back to an almost normal value on administration
of SJ and NSJ, the latter providing better result (Fig. 1E).
3. Results
3.4. Analysis of uptake of glucose by L6 cells
3.1. Characterization of PLGA-NSJ
A significant inhibition of glucose uptake was observed in L6
The surface morphology of NSJ was studied under AFM. The cells treated with 0.5 mM SA when compared to controls.
corresponding 2D and 3D images are shown in Fig. 1A and B, Treatment with SJ and NSJ elevated the level of glucose

Figure 2 (A) flow cytometric analysis of generation of reactive oxygen species (ROS); (B) immunofluorescence determination of
NFkb protein in L6 cells; (i) normal; (ii) SA; (iii) SA þ SJ; (iv) SA þ NSJ (I); and (v) SA þ NSJ (II); (C) expression of beta actin
(housekeeping gene) GLUT4 and iNOS proteins by immunoblot techniques; and (D) RT-PCR analysis of mRNA expression of G3PDH
(housekeeping gene), GLUT4 and glucokinase in different sets of experimental cells before and after drug treatment.
Ln1 Z normal; Ln2n Z nSA; Ln3 Z SA þ SJ; Ln4 Z SA þ NSJ (I); Ln5 Z SA þ NSJ (II).
Nano-Syzygium reduces arsenic induced stress 315

Figure 3 (A) study of mean blood glucose; and (B) glycosylated hemoglobin levels in different groups of experimental mice.
***p < 0.001, **p < 0.01, *p < 0.05 vs. sodium-arsenite-treated group. Capability of NSJ to cross the blood-brain-barrier by fluo-
rescence microscopy: (C) FITC-PLGA; and (D) FITC-PLGA-SJ-nano-particles.

uptake significantly (p < 0.001 in both cases) (Fig. 3A), the treated series; the NSJ treated cells showed lesser fluo-
latter showing greater efficacy (Fig. 1F). rescence intensity (Fig. 2B).

3.7. Western blot and RT-PCR analyses

3.5. Flow cytometric estimations of generation
of ROS Different levels of protein expression by immunoblot and
mRNA expression by RT-PCR (Fig. 2C and D) were analyzed
We estimated and analyzed through FACS the formation of in different groups of L6 cells with or without treatment.
intracellular reactive oxygen species from L6 cells. We The results are presented below individually.
observed that the amount of fluorescence intensity in the
SA treated group increased (Fig. 2A) and shifted towards 3.7.1. Disruption of GLUT4 glucose transporter
the right side of the quadrate (i.e., towards FL1), indicating A gradual decrease was observed in the expressions of GLUT4
that the generation of ROS had been increased (cells protein and mRNA in L6 cells treated with SA. Administration
producing higher amounts of ROS possess better efficacy to of both SJ and NSJ increased the level of GLUT4, but the
bind with the dye). On the other hand, in the SJ and NSJ increase by NSJ was more notable than that of SJ.
treated groups, much less shifting of the fluorescence
towards FL1 was observed, NSJ showing a lesser shift. 3.7.2. Expression of glucokinase
A decrease in glucokinase mRNA expression was also
observed in arsenic stressed cells; the expression was up-
3.6. Immunofluorescence of NFkb protein regulated in both SJ and NSJ treatments, the up-regulation
expression in L6 cells by NSJ being more.

A significant reduction in the fluorescence intensity of NFkb 3.7.3. Role of iNOS in arsenic stressed condition
protein was observed in arsenic-intoxicated L6 cells treated The protein expression of iNOS was observed to be up-
with SJ and NSJ when compared to those of the only SA regulated in the arsenic treated L6 cells, as compared to
316 A. Samadder et al.

that of normal controls. On the contrary, its expression in 3.9. Fluorescence microscopic study to detect the
SJ and NSJ administered series decreased significantly, NSJ presence of nano-particles in mouse brain
showing a greater decrease.
The presence of green fluorescing nano-particles was
3.8. In vivo assessment of diabetes markers: Anti- observed in the brain tissue of mice. FITC-PLGA was taken as
hyperglycemic effect of SJ and NSJ in arsenic- the control, shown in Fig. 3C-(i), in comparison to FITC-PLGA-
induced-hyperglycemia in mice SJ-nano-particles as in Fig. 3C-(ii). This would clearly suggest
the ability of the nano-encapsulated-SJ to cross the BBB.
A significant elevation in the levels of blood glucose and
glycosylated hemoglobin (Fig. 3A and B) in arsenic-induced 4. Discussion
hyperglycemic mice was detected, when compared to
controls. Administration of SJ and NSJ showed a significant The nano-encapsulation method, using PLGA, has been
reversal of values in the above parameters. The NSJ had used in a wide variety of anti-cancer drugs of plant origin,
greater efficacy in modulating these parameters than its like curcumin, scopoletin [20], Polygala senega [21] and
un-encapsulated counterpart. many others. This seems to be the first attempt to

Figure 4 Summary of overall results.

Nano-Syzygium reduces arsenic induced stress 317

nano-encapsulate an anti-diabetic drug of plant origin. This study, it became clear that NSJ was able to penetrate the
method appears to be one of the best, because of its BBB, and could reach one of the target tissues like brain
optimum level of entrapment efficacy, gradual drug after oral administration in mice [8].
delivery and site-specific action. In recent years, more emphasis has been given to
In the present study, both in vitro and in vivo models formulate advanced organ/tissue/cell-specific drugs.
were intoxicated with arsenic to induce a hyperglycemic- Therefore, biological drug research today is more focused
stress condition affecting a variety of diabetic and stress on the enhanced bioavailability of drugs to target organisms
markers, that gave us an opportunity to study the effect of or organ systems with better efficacy in minimum dosage.
SJ and NSJ in modulating them (Fig. 4). In this context, nano-encapsulated drugs appear to have
Glucose transport is the rate limiting step for glucose greater advantages due to their: (1) small size; (2) more
disposal and GLUT4 translocation in the plasma membrane. rapid entry into target cells; (3) biodegradable nature; (4)
A loss of glucose homeostasis exhibited inhibition of glucose ability to render greater bioavailability of the drug; (5)
uptake in SA-treated-L6 cells. The introduction of NSJ in lesser amount of drug requirement; and (6) ability to cross
arsenic-stressed cells initiated re-establishment of net the BBB, etc. Hopefully, further in-depth research in this
glucose uptake and glucose homeostasis in a better way direction can pave the way for the discovery of newer
than its un-encapsulated form. drugs, more precise and organ/tissue-specific in nature,
GLUT4 has a role in glucose sensing in L6 cells. We from the plant kingdom, by utilizing nanotechnology.
observed that arsenic-exposure possibly restricts GLUT4
transporters from working normally, resulting in a blockage
of glucokinase activity, and thereby setting the first step of Acknowledgement
disparity in the glucose metabolism pathway. Introduction
of NSJ and un-encapsulated SJ resists the blockage of Grateful acknowledgements are made to Boiron Labora-
GLUT4, thus allowing glucokinase to re-incorporate glucose tory, Lyon, France, for partial financial support provided to
in the glycolysis pathway. NSJ was relatively more effective Prof. A.R. Khuda Bukhsh for this work.
in action.
Arsenic causes severe toxicity to cells and tissues
through the generation of reactive oxygen species (ROS). References
ROS acts as a cellular messenger that regulates the
expression of genes, leading to cellular dysfunction and 1. Longnecker MP, Daniels JL. Environmental contaminants as
death. This evidence could be possibly reflected by the etiologic factors for diabetes. Environ Health Perspect. 2001;
decrease of % cell viability in arsenic-intoxicated L6 cells. 109:871e876.
The effect of NSJ shows a potential protection/recovery of 2. Leduc C, Coonishish J, Haddad PS, Cuerrier A. Plants used by
the damaged condition of the cells. Earlier studies sug- Cree Nation of Eeyou Istchee (Quebec, Canada) for the treat-
gested that quantitative analysis of cell-specific-ROS in the ment of diabetes: a novel approach in quantitative ethno-
diabetic condition was useful, because ROS plays a critical botany. J Ethnopharmacol. 2006;105:55e63.
role in signaling the cellular inflammatory response by 3. Karakoti AS, Hench LL, Seal S. The potential toxicity of nano-
materialsethe role of surfaces. JOM. 2006;58:77e82.
activating the transcription factor, NF-kB. The invading
4. Bhattacharyya SS, Paul S, Khuda-Bukhsh AR. Encapsulated
immune cells then induced iNOS expression, leading to the plant extract (Gelsemium sempervirens) PLGA nanoparticles
formation of nitric oxide [22]. It is believed that this enhance cellular uptake and increase bioactivity in vitro. Exp
cascade results in a cyclic amplification of ROS leading to Biol Med. 2010;235:678e688.
cell destruction. Our findings reveal that the administration 5. Rajasekar V, Kirubanandan S, Lakshmi BS. Assessment of anti-
of NSJ brought back the cellular architecture to a normal or diabetic activity of Syzygium jambolanum using in vitro
near-normal level. Cellular components of the aforesaid model. Am J Infec Dis. 2009;5:99e105.
proteins and mRNA expressions, would lend further support 6. Samadder A, Chakraborty D, De A, Bhattacharyya SS, Bhadra K,
towards its ability to effectively reduce the generation Khuda-Bukhsh AR. Possible signaling cascades involved in
of ROS. attenuation of alloxan-induced oxidative stress and hypergly-
cemia in mice by ethanolic extract of Syzygium jambolanum:
The biocompatibility and capability of tissue-specific
drug-DNA interaction with calf thymus DNA as target. Europ J
actions of the NSJ and SJ were tested in a mouse model. It Pharm Sci. 2011;44:207e217.
was found that SJ and NSJ reversed arsenic-induced 7. Fessi H, Puisieux F, Devissaquet JP, Ammoury N, Benita S.
increased blood glucose and glycosylated-hemoglobin Nanocapsule formation by interfacial polymer deposition
levels. The activity was manifested more in NSJ than in following solvent displacement. Int J Pharm. 1989;55:1e4.
SJ, presumably through reducing oxidative stress. 8. Bhattacharyya SS, Paul S, De A, Das D, Samadder A,
PLGA is a biodegradable polymer, approved for human Boujedaini N, et al. Poly (lactic-co-glycolic) acid nano-
use, which readily gets decomposed without any inflam- encapsulation of a synthetic coumarin: cytotoxicity and bio-
mation or immune reactions [23]. Nano-particles made of distribution in mice, in cancer cell line and interaction with
PLGA had also been shown earlier to cross the BBB after calf thymus DNA as target. Toxicol Appl Pharmacol. 2011;253:
270e281.
in vivo administration [24]. The BBB, being the homeostatic
9. McDowell HE, Eyers PA, Hundal HS. Regulation of system A
defense mechanism of the brain against pathogens and amino acid transport in L6 rat skeletal muscle cells by insulin,
toxins, restricts the entry of many compounds that might chemical and hyperthermic stress. FEBS Letters. 1998;441:
be otherwise of therapeutic value in the treatment of 15e19.
a variety of diseases. Therefore, we examined whether NSJ 10. Mossam T. Rapid colorimetric assay for cellular growth and
had the potential permeability to cross the BBB. From this survival. J Immunol Methods. 1983;55:65.
318 A. Samadder et al.

11. Jung KH, Ha E, Kim MJ, Uhm YK, Kim HK, Hong SJ, et al. 18. Bunn HF. Evaluation of glycosylated hemoglobin in diabetic
Ganoderma lucidum extract stimulates glucose uptake in L6 patients. Diabetes. 1981;30:613e617.
skeletal muscle cells. Acta Biochimica Pol. 2006;53:597e601. 19. Cheng F, Wang SP, Su C, Tsai T, Wu P, Shieh D, et al.
12. Mokrasch LC. Analysis of hexose phosphates and sugar mixtures Stabilizer-free poly(lactide-co-glycolide) nanoparticles for
with the anthrone reagent. J Biol Chem. 1954;208:55e59. multimodal biomedical probes. Biomaterials. 2008;29:
13. Dhiman R, Kathania M, Raje M, Majumder S. Inhibition of bfl- 2104e2112.
1/A1 by SiRNA inhibits mycobacterial growth in THP-1 cells 20. Khuda-Bukhsh AR, Bhattacharyya SS, Paul S, Boujedaini N.
by enhancing phagosomal acidification. Biochim Biophys Acta. Polymeric nanoparticle encapsulation of a naturally occurring
2008;1780:733e742. plant scopoletin and its effects on human melanoma cell A375.
14. Bisaws R, Mandal SK, Dutta S, Bhattacharyya SS, Boujedaini N, Chin J Integr Med. 2010;8:853e862.
Khuda-Bukhsh AR. Thujone-rich fraction of Thuja occidentalis 21. Paul S, Bhattacharyya SS, Boujedaini N, Khuda-Bukhsh AR.
demonstrates major anti-cancer potentials: evidences from Anticancer potentials of root extract of Polygala senega and its
in vitro studies on A375 cells. eCAM 2010. http://dx.doi.org/ PLGA nanoparticles-encapsulated form. eCAM 2011. http:
10.1093/ecam/nq042. //dx.doi.org/10.1155/2011/517204.
15. Burnette WN. "Western blotting": electrophoretic transfer of 22. Cnop M, Welsh N, Jonas CJ, Lenzen S, Eizirik DL. Mechanism
proteins from sodium dodecyl sulfate-polyacrylamide gels to of pancreatic ß cell death in type 1 and type 2 diabetes. Diabetes.
unmodified nitrocellulose and radiographic detection with 2005;54:97e107.
antibody and radio iodinated protein. Anal Biochem. 1981;112: 23. Dechy-Cabaret O, Martin-Vaca B, Bourissou D. Controlled ring-
195e203. opening polymerization of lactide and glycolide. Chem Rev.
16. Sinha M, Manna P, Sil PC. Protective effect of arjunolic acid 2004;104:6147e6176.
against arsenic induced oxidative stress in mouse brain. 24. Costantino L, Gandolfi F, Bossy-Nobs L, Tosi G, Gurny R,
J Biochem Mol Toxicol. 2008;22:15e26. Rivasi F, et al. Nanoparticulate drug carriers based on hybrid
17. Kaplan LA. Carbohydrates and metabolite. Clin Chem. 1984: poly(d, l-lactideco-glycolide)-dendron structures. Biomate-
1032e1040. rials. 2006;27:4635e4645.