World Research Journal of Agricultural Sciences

Vol. 8(1), pp. 292-297, April, 2021. © www.premierpublishers.org. ISSN: 2326-3997

Research Article

Transcript level of genes involved in “Rebaudioside A”

biosynthesis pathway under Gibberellic acid treatment
in Stevia
Mahboobeh Sasaninezhad1*, Behzad Sorkhi-laleloo2, Bahram Malekie-zanjani3, Farid Soleymani4
1*Masterof science, University of Zanjan.
2Seed and Plant improvement Institute, Department of Genetic Research and National Gene Bank, Iran.
3Zanjan university, Department of Plant Engineering and Plant Genetics.
4Topaz Gene Company, Karaj, Iran.

Stevia rebaudiana Bertoni is a plant which has recently been used widely as a sweetener. This
medicinal plant has some components such as diterpenoid glycosides called steviol glycosides
[SGs]. Rebaudioside A is a diterpenoid steviol glycoside which is 300 times sweeter than table
sugar. This study was done to investigate the effect of GA3 (50 mg/L) on the expression of 14
genes involved in Rebaudioside A biosynthesis pathway in Stevia rebaudiana under in vitro
conditions. The expression of DXS remarkably decreased by day 3. Also, probably because of the
negative feedback of GA3 on MEP-drived isoprenes, GGDS transcript level reached its lowest
amount after GA3 treatment. The abundance of DXR, CMS, CMK, MCS, and CDPS transcripts
showed a significant increase at various days after this treatment. A significant drop in the
expression levels of KS and UGT85C2 is detected during the first day. However, expression
changes of HDR and KD were not remarkable. Results revealed that the level of transcript of
UGT74G1 and UGT76G1 up regulated significantly 4 and 2 times higher than control, respectively.
However, more research needs to shed more light on the mechanism of GA3 on gene expression
of MEP pathway.

Key words: Stevia rebaudiana, steviol glycosides, Rebaudioside A, Transcript level, MEP pathway

INTRODUCTION

S. rebaudiana B, is a small branching shrub that belongs pathway in its primary steps of biosynthesis [Lucho et al,
to the Asteraceae family.It is native to the Amambay region 2018]. SGs are formed through plastid 2-C-methyld-
in northeast Paraguay, butrecently cultivated in many erythritol-4-phosphate [MEP] pathway followed by
tropical and subtropical countries and has been in great hydroxylation of kaurenoic acid and glycosylation of steviol
demand in food and beverages industries due to its low- [Lucho et al, 2018], in which 15 genes are involved [figure
calorie sweetening metabolites [Gupta et al, 2015; 1].
Kinghorn et al, 2002; Yadav and Guleria, 2012; Ceunen S,
Geuns, 2013]. Stevia is a source of a sweetened diterpene *Corresponding Author: Mahboobeh Sasaninezhad,
glycoside called “Rebaudioside A” which is sweeter 300 Master of Science, University of Zanjan.
times more than table sugar [Modi et al, 2015]. Among the Email: [email protected]
230 of Stevia genus, only the Robediana and Philobophila Co-Authors 2Email: [email protected]
produce steviol glycosides [Brandle and Telmer, 2007]. 3
Email: [email protected]
Steviol glycosides [SGs] are synthesized in the leaves and 4
Email: [email protected]
have a common precursor with gibberellins metabolism

Transcript level of genes involved in “Rebaudioside A” biosynthesis pathway under Gibberellic acid treatment in Stevia
Figure 1. The principal pathways for “rebaudioside A” biosynthesis in Stevia. The responsible enzymes are as follows: 1-
deoxy-D-xylulose 5-phosphate synthase [DXS], 1-deoxy-D-xylulose 5-phosphate reductoisomerase [DXR], 4-
diphosphocytidyl-2-C-methyl-D-erythritol synthase [CMS], 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase [CMK], 2C-
methyl-D-erythritol 2,4-cyclodiphosphate synthase [MCS], [E]-4-hydroxy-3-methylbut-2-enyl diphosphate synthase [HDS],
[E]-4-hydroxy-3-methylbut-2-enyl diphosphate reductase [HDR], geranylgeranyl diphosphate synthase [GGDS], copalyl
pyrophosphate synthase [CDPS], kaurene synthase [KS], ent-kaurene oxidase [KO], Kaurenoic acid hydroxylase [KAH],
UDP-glycosyltransferase 85C2 [UGT85C2], UDP-glycosyltransferase 74G1 [UGT74G1], UDPglycosyltransferase 76G1
[UGT76G1].
There are 8 genes involved in MEP pathway to produce In order to obtain a sufficient plant sample for experiments,
geranylgeranyl diphosphate [GGDP] inclouding HDR, a number of Stevia cuttings, containing two buds, were
MCS, CMS, DXS, DXR, CMK, HDS, and GGDS. In the provided from National Plant Gene-Bank of IRAN and
next step, GGDP is convert to kaurenoic acid through cultured in MS medium [Murashige, Skoog, 1962], Then,
copalyl diphosphate synthase [CPPS], kaurene synthase new shoots were again reproduced in sterile conditions of
[KS]; kaurene is then transformed to steviol by ent-kaurene MS medium, in order to avoid diversity of individuals. Next,
oxidase [KO], Kaurenoic acid hydroxylase [KAH] and Shoots containing 8 leaves [4 pairs of leaves] were cut and
finally uridine-diphosphate-dependentglycosyltransferases replaced on liquid MS medium containing 10 μM
[UGTs] including UDP-glycosyltransferase 85C2 Gibberellic acid [Sigma Aldrig company, Germany] and set
[UGT85C2], UDP-glycosyltransferase 74G1 [UGT74G1], up under growth conditions of 16 h light and 8 h dark at 25
UDPglycosyltransferase 76G1 [UGT76G1] produce °C. Leaves from the untreated [control] and treated plants
Rebaudioside A by C-19 carboxylation and C-13 alcohol were excised at 1, 3 and 5 days after treatment.
oxygenation of steviol [Richman et al, 2005; Humphrey et Extraction of RNA, cDNA synthesis, primer design and
al, 2006; Shibata et al, 1991; Shibata et al, 1995; Lucho et qRT-PCR reaction
al, 2019; Abdelsalam et al, 2019].
Total RNA was extracted from the Stevia leaves using
Gibberellins belong to tetracyclic diterpene plant GeneAll® RiboEx ™kit [BioFrontier, Korea] according to
hormones produced through plastidial GGPP derived from the manufacturer’s protocol, and then its quality was
the MEP pathway and have a significant effect on the assessed by 1% agarose gel electrophoresis. In order to
biosynthesis of secondary metabolites plant cells synthesis the first strand cDNA, Fermentas kit [Revert Aid
[Soleymani et al, 2017]. There are eight enzymatic ™ First Strand cDNA Synthesis Kit] was used. Primer pairs
reactions in the MEP pathway to transfer GGPP To GA. of genes of DXS, DXR, CMS, CMK, MCS, HDS, HDR,
Studies clarified new insights into the regulation of GA GGDS, CDPS, KS, KD, UGT85C2, UGT74G1, and
concentration in plants through analyzing gene expression UGT76G1 were designed with online primer Quest
in GA biosynthesis pathway [Olszewski et al, 2002]. This software according [Table 1]. The qRT-PCR performed
study was carried out to investigate the effect of time- using RealQ Plus Master Mix [Ampliqon] Master mix and
course application of Gibberellic acid on Stevia under in Real-Time PCR Detection System [Biorad] under the
vitro conditions in terms of 14 gene expression level following conditions: 95°C for 30 s followed by 40 cycles
involved in Rebaudioside A biosynthesis pathway. 95°C for 15 s, 60°C for 20 s and 72°C for 20 s. The genes'
relative expression levels were calculated by the ΔΔCT
MATERIALS AND METHODS method and the Relative Expression Software Tool
Plant Materials, GA3 Treatment and Samplings [REST]® [Pfaffl, 2001].

Transcript level of genes involved in “Rebaudioside A” biosynthesis pathway under Gibberellic acid treatment in Stevia
 Table 1, Sequence, Tm and Product size of Primers used in this study.
Gene Primer sequence [5'-3'] TM[°C] Product size [bp]
ACT F TCTGTTCCAACCGTCTTTG 60 124
R CCACTGAGCACGATGTTAC 60
DXS F GGTTCCCAAGAGGCAATG 60 120
R CCGTATCCCAATATCGCAAC 60
DXR F TCCCGATAATGTGAAATACCC 60 110
R ACATCTCAACCGCTTTCTC 60
CMS F ACTTGGTGTTCCTGCTAAAG 60 111
R TTGATGACCTGTGGAGTTTG 60
CMK F GAATGGTCTGGTGAGATTGG 60 112
R CAAACGGTACAGGTGAAGG 60
MCS F ATGGCTACTTCTTCGTCGTG 60 120
R AATGGGAGAGCGTCTGTTG 60
HDS F CAGGATGGTCTTGGTGATAC 60 121
R CCACGCCTTGTTGAATTTG 60
HDR F GGGAGAAACAGAGGAAATTGG 60 122
R GTCGTTCTTGAGTAGCATCAC 60
GGDS F CAATAAGCCACAAGGTGTACG 60 122
R TCGGACGATCCTGTCTTTG 60
CDPS F CTACACGGCTTCGCTTTG 60 119
R TCCGCTGTCACATCTACTC 60
KS F AACGGAGAAAGTGGGAAAG 60 122
R GCTCTAGGAACAATGCTACC 60
KO F GGTGGCGATGAGTGATTATG 60 112
R CATGATGTCCCTATGGATGC 60
KAH F CATCGAGAGCTTGTCTGC 60 123
R TTCACTTTGGTTCCCATCTC 60
UGT85C2 F CATCGAGAGCTTGTCTGC 60 123
R TTCACTTTGGTTCCCATCTC 60
UGT74G1 F TTAGCACACGAATCAGTAGG 60 128
R AGCTTGGCATTTGTAGTTTG 60
UGT76G1 F TCAGGAGTCATCTGGAACTC 60 122
R CTGGAAGAGGCTGTCAAATG 60
RESULTS AND DISCUSSION signalings would increase the expression level of genes
involved in Rebaudioside A biosynthetic pathway in Stevia.
The 28s and 18s ribosomal RNA bands in 1% agarose gel Therefore, 14 genes [DXS, DXR, CMS, CMK, MCS, HDS,
electrophoresis clearly showed the extracted RNA quality HDR, GGDS, CDPS, KS, KD, UGT85C2, UGT74G1, and
[Figure 2]. The extracted RNA and synthesized cDNA was UGT76G1 ] which are identified till now, were selected for
measured in term of concentratration using NanoDrop® their expression analysis in GA3 treated and control plants
which was 200-400 and 1500-2000 ng/µl respectively. by qRT-PC.

During time-course GA3 elicitation, the abundance of

studied genes transcripts was remarkably different
comparing with each other. Accordingly, the transcript
level of DXS , a key enzyme which catalyzes the first
reaction of the MEP pathway, after 3 days of GA3
treatment had a remarkable decrease [approximately 5
times lower than those in the control] while at the same
time, DXR and CMK genes transcript reached to their
highest level [41 and 23 fold respectively].

A significant drop in the expression levels of CMS was

Figure 2, RNA samples on a 1% agarose gel. found at 5 days post-treatment. The MCS mRNA level
Expression of genes involved in Rebaudioside A increased slightly within 3 and 5 days [which were 2 and
biosynthetic pathway 2.5 fold higher than control] whereas, the amount of HDS
mRNA had a drop in all times which just at 5 days was
Elicitors have a stimulant effect on terpenoid biosynthesis, significant. There was no considerable change in HDR
so it is of interest looking for wether these molecular gene expression [Figure 3].

Transcript level of genes involved in “Rebaudioside A” biosynthesis pathway under Gibberellic acid treatment in Stevia
Transcript level changes of GGDS [Catalysing the terpens in Arabidopsis [Estévez et al, 2001], and in M.
conversion Dimethylallyl diphosphate to Geranylgeranyl piperita [Mahmoud and Croteau, 2003]. The current study
diphosphate] in plants exposed to GA3 were slightly demonstrated that the trasncript level of DXS gene
different. This gene expression at all days of post- decreased during 3 days after GA3 treatment which lead
treatment had a considerable decrease, which was 30, 22, to reduction of expression of downstream genes like HDS,
and 18 fold lower than control at 1, 3, and 5 days, GGDS, KS, UGT85C2 and uneffected transcript level of
respectively. In contrast, the CDPS showed a continuous HDR and KD genes. However, there were some up-
and significant increase within all days of GA3 treatment regulated genes including DXR, CMS, CMK, and MCS.
reaching maximum levels at 5 days. While the level of Also in Mentha piperita, GA3 along with an elicitor resulted
transcript of KD was unaffected by GA3, a decrease in in down-regulating of genes [MNMR and MMR] involved in
transcription of KS and UGT85C2 detected by 3 and 1-day later stage of Menthol biosynthesis pathway [Soleymani et
post-treatment, respectively. For UGT74G1, the al, 2017]. By decreasing the DXS acivity, the synthesis of
expression level sharply up regulated at 5 days. Also, plastidic isoprenoids drived from MEP pathway after
UGT76G [Catalysing the transformation of Stevioside to exogenous application of GA3 has been limited in
Rebaudioside A] showed a drop at 1 day and then cannabis plant [Mansouri et al, 2011]. Gibberellins are also
accumulated rapidly having its highest transcript at 5 days a diterpen produced through GGPP derived from MEP
[2 times higher than that in the control] [figure 4]. pathway. Studies confirmed that the expression of genes
involved in GA3 biosynthesis pathway are regulated by
feedback control of GA3 exogenous application
[Soleymani et al, 2017; Ross et al, 1999]. Therefore, it is
likely that the biosynthesis of secondary metabolites drived
from the MEP pathway and the expression of related
genes may be affected by the self-regulating effect of this
hormone. An interest consequence in present study was
detected that the transcript level of GGDS reached to its
lowest amount in treated plant which was paralel with
previous study (Soleymani et al, 2017). However, the
expression of CDPS [catalising the transformation of
Geranylgeranyl diphosphate to Copalyl diphosphate]
dramatically increased in GA3 treated plant. This study
Figure 3, The relative expression rate of DXS, DXR, CMS, also revealed that UGT74G1 and UGT76G1 genes are key
CMK, MCS, HDS, and HDR genes in 1, 3 and 5 day after regulatory enzymes at the last step of Rebaudioside A
applying GA3 treatment in Stevia. **, * and “ns” indicate biosynthesis pathway [Lucho et al, 2018] transcript level
significant differences respectively at [P < 0.01], [P<0.05] upregulated by GA3. Therefore, probably the amount of
and non- significant differences between control and Rebaudioside A in treated plant had an increase compared
treated plants. with control. However, more investigations still need to
deeply find out a scrutinize the effect of GA3 negative
feedback mechanism in MEP-drived terpenes.

ACKNOWLEDGMENTS

The authors would like to acknowledge the Seed and Plant

improvement Institute, Department of Genetic Research
and National Gene Bank for providing the necessary
laboratory facilities.

REFERENCES
Figure 4, The relative expression rate of GGDS, CDPS,
KS, KD, UGT85C2, UGT74G1, and UGT76G1 genes in 1, Abdelsalam N. R, Botros W. A, Khaled A. E., Ghonema M.
3 and 5 day after applying GA3 treatment in Stevia. **, * A., Hussein S. G., Ali, H. M, & Elshikh, M. S. (2019).
and “ns” indicate significant differences respectively at [P Comparison of uridine diphosphate-glycosyltransferase
< 0.01], [P<0.05] and non- significant differences between UGT76G1 genes from some varieties of Stevia
control and treated plants. rebaudiana Bertoni. Scientific reports, 9(1), 8559.
Brandle, J. E., & Telmer, P. G. (2007). Steviol glycoside
In transgenic plants in which DXS is upregulated, the biosynthesis. Phytochemistry, 68(14), 1855-1863.
synthesis of downstream terpenes of MEP cascade Ceunen S, Geuns JMC. (2013). Steviol glycosides:
controls DXS expression. Studies claimed a positive chemical diversity, metabolism, and function. J Nat
correlation between DXS expression and MEP-derived Prod 76:1201–1228.

Transcript level of genes involved in “Rebaudioside A” biosynthesis pathway under Gibberellic acid treatment in Stevia
Estévez J.M, Cantero A, Reindl A, Reichler S,and León P. Richman A, Swanson A, Humphrey T, Chapman R,
(2001). 1-Deoxy-D-xylulose 5-phosphate synthase, a McGarvey, B, Pocs R, & Brandle J. (2005). Functional
limiting enzyme for plastidic isoprenoid biosynthesis in genomics uncovers three glucosyltransferases
plants, J. Biol. Chem, vol. 276, no. 25, pp. 22 901–22 involved in the synthesis of the major sweet glucosides
909. of Stevia rebaudiana. The Plant Journal, 41(1), 56-67.
Gupta P, Sharma S, Saxena S. (2015). Biomass yield and Ross J. J, MacKenzie‐Hose A. K, Davies P. J, Lester D. R,
steviol glycoside production in callus and suspension Twitchin B, & Reid J. B. (1999). Further evidence for
culture of Stevia rebaudiana treated with proline and feedback regulation of gibberellin biosynthesis in pea.
polyethylene glycol. Applied biochemistry and Physiologia Plantarum, 105(3), 532-538.
biotechnology, 176(3), 863-874. Shibata H, Sawa Y, Oka T. A, Sonoke S, Kim K. K, &
Humphrey T. V, Richman A. S, Menassa R. & Brandle J. Yoshioka M. (1995). Steviol and steviol-glycoside:
E. (2006). Spatial organization of four enzymes from glucosyltransferase activities in Stevia rebaudiana
Stevia rebaudiana that are involved in steviol glycoside Bertoni-purification and partial characterization.
synthesis. Plant Molecular. Biol. 61, 47–62, Archives of biochemistry and biophysics, 321(2), 390-
Kinghorn, A. D, & Soejarto DD. (2002). Discovery of 396.
terpenoid and phenolic sweeteners from plants. Pure Shibata H, Sonoke S, Ochiai H, Nishihashi H, & Yamada,
and Applied Chemistry, 74(7), 1169-1179. M. (1991). Glucosylation of steviol and steviol-
Lucho S. R, do Amaral M. N, Auler P. A, Bianchi V. J, glucosides in extracts from Stevia rebaudiana Bertoni.
Ferrer M. Á, Calderón A. A, & Braga E. J. B. (2019). Plant Physiol, 95, 152–156,
Salt Stress-Induced Changes in In Vitro Cultured Stevia Soleymani F, Taheri H, & Shafeinia A. R. (2017). Relative
rebaudiana Bertoni: Effect on Metabolite Contents, expression of genes of menthol biosynthesis pathway
Antioxidant Capacity and Expression of Steviol in peppermint (Mentha piperita L.) after chitosan,
Glycosides-Related Biosynthetic Genes. Journal of gibberellic acid and methyl jasmonate treatments.
Plant Growth Regulation, 1-13. Russian journal of plant physiology, 64(1), 59-66.
Lucho S. R, do Amaral M. N, Milech C, Ferrer M. Á, Yadav SK, Guleria P. (2012). Steviol glycosides from
Calderón A. A, Bianchi V. J, & Braga E. J. B. (2018). Stevia: biosynthesis pathway review and their
Elicitor-induced transcriptional changes of genes of the application in foods and medicine. Crit Rev Food Sci
steviol glycoside biosynthesis pathway in Stevia Nutr 52:988–998.
rebaudiana Bertoni. Journal of plant growth regulation,
37(3), 971-985.
Lucho S. R, do Amaral M. N, Milech C, Ferrer MÁ,
Calderón AA, Bianchi V. J, & Braga, E. J. B. (2018).
Elicitor-induced transcriptional changes of genes of the
steviol glycoside biosynthesis pathway in Stevia
rebaudiana Bertoni. Journal of plant growth regulation,
37(3), 971-985.
Mahmoud S. S, & Croteau R. B. (2003). Menthofuran
regulates essential oil biosynthesis in peppermint by
controlling a downstream monoterpene reductase.
Proceedings of the National Academy of Sciences,
100(24), 14481-14486. Accepted 5 March 2021
Mansouri H., Asrar, Z, & Amarowicz R. (2011). The
response of terpenoids to exogenous gibberellic acid in Citation: Sasaninezhad M, Sorkhi-laleloo B, Malekie-
Cannabis sativa L. at vegetative stage. Acta zanjani B, Soleymani F (2021). Transcript Level of Genes
Physiologiae Plantarum, 33(4), 1085-1091. Involved in “Rebaudioside A” Biosynthesis Pathway under
Modi A, Litoriya N, Prajapati V, Rafalia R, Narayanan S Gibberellic Acid Treatment in Stevia. World Research
(2014). Transcriptional profiling of genes involved in Journal of Agricultural Sciences, 8(1): 292-297.
steviol glycoside biosynthesis in Stevia rebaudiana
bertoni during plant hardening. Dev Dyn 243:1067–
1073. Copyright: © 2021 Sasaninezhad et al. This is an open-
Murashige T, & Skoog F. (1962). A revised medium for access article distributed under the terms of the Creative
rapid growth and bio assays with tobacco tissue Commons Attribution License, which permits unrestricted
cultures. Physiologia plantarum, 15(3), 473-497. use, distribution, and reproduction in any medium,
Olszewski N, Sunand T.P, and Gubler F. (2002). provided the original author and source are cited.
Gibberellin signaling: biosynthesis, catabolism, and
response pathways, Plant Cell, vol. 14, pp. 61–80.
Pfaffl M, (2001). A new mathematical for relative
quantification in realtime RT-PCR. Nucleic acids Res
29(9):e45.

Transcript level of genes involved in “Rebaudioside A” biosynthesis pathway under Gibberellic acid treatment in Stevia