reproductive biology 16 (2016) 138–146

Available online at www.sciencedirect.com

ScienceDirect

journal homepage: http://www.elsevier.com/locate/repbio

Original Research Article

Effect of recombinant-LH and hCG in the absence of

FSH on in vitro maturation (IVM) fertilization and
early embryonic development of mouse germinal
vesicle (GV)-stage oocytes

Vasiliki Dinopoulou, Peter Drakakis, Stella Kefala, Erasmia Kiapekou,

Ritsa Bletsa, Elli Anagnostou, Konstantinos Kallianidis,
Dimitrios Loutradis *
Division of Human Reproduction, IVF Unit, 1st Department of Obstetrics and Gynaecology, Alexandra Hospital,
Athens University Medical School, 80 Vasilissis Sofias Avenue, Athens 11528, Greece

article info abstract

Article history: During in vitro maturation (IVM), intrinsic and extrinsic factors must co-operate properly in
Received 15 September 2015 order to ensure cytoplasmic and nuclear maturation. We examined the possible effect of LH/
Received in revised form hCG in the process of oocyte maturation in mice with the addition of recombinant LH (r-LH)
18 January 2016 and hCG in our IVM cultures of mouse germinal vesicle (GV)-stage oocytes. Moreover, the
Accepted 22 January 2016 effects of these hormones on fertilization, early embryonic development and the expression
Available online 4 February 2016 of LH/hCG receptor were examined. Nuclear maturation of GV-stage oocytes was evaluated
after culture in the presence of r-LH or hCG. Fertilization rates and embryonic development
Keywords: were assessed after 24 h. Total RNA was isolated from oocytes of different stages of
IVM maturation and from zygotes and embryos of different stages of development in order to
r-LH examine the expression of LH/hCG receptor, using RT-PCR. The in vitro nuclear maturation
hCG rate of GV-stage oocytes that received hCG was significantly higher compared to the control
GV group. Early embryonic development was increased in the hCG and LH cultures of GV
LH/hCG receptor oocytes when LH was further added. The LH/hCG receptor was expressed in all stages of
in vitro matured mouse oocytes and in every stage of early embryonic development. Addition
of hCG in IVM cultures of mouse GV oocytes increased maturation rates significantly. LH,
however, was more beneficial to early embryonic development than hCG. This suggests a
promising new technique in basic science research or in clinical reproductive medicine.
# 2016 Society for Biology of Reproduction & the Institute of Animal Reproduction and
Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Sp. z o.o. All
rights reserved.

* Corresponding author.
E-mail address: [email protected] (D. Loutradis).
http://dx.doi.org/10.1016/j.repbio.2016.01.004
1642-431X/# 2016 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of
Sciences in Olsztyn. Published by Elsevier Sp. z o.o. All rights reserved.
 reproductive biology 16 (2016) 138–146 139

the same receptor, the LH/hCG receptor (LHCGR) [13]. A critical

1. Introduction
difference, however, occurs regarding the half-life of LH and
hCG; the half-life of LH is approximately 60 min [14], while that
In vitro maturation (IVM) of mouse oocytes provides not only the of hCG exceeds 24 h [15].
means to produce a uniform population of developmentally Granulosa cells of primary follicles express FSH receptors
competent oocytes, but also holds promise for applications in (FSHR), while the theca cells of secondary follicles express
basic laboratory settings. More than two decades have passed LH/hCG receptors [16,17]. During ovulation, most probably
since the report of the first live mouse offspring using IVM. The under the influence of LH/hCG, the main target cells for LH/hCG
same technique has been widely used in several mammalian switch from theca interna cells/small luteal cells to granulosa
species and was applied clinically in human assisted reproduc- cells/large luteal cells [18]. The binding of gonadotropins to their
tive technology, leading to live-born offspring using human G-protein-receptor activates adenyl cyclase and induces an
oocytes after IVM [1,2]. In vivo, human oocytes are arrested at intracellular rise in cyclic AMP levels [19]. Our studies showed
prophase in meiosis I (MI) for 12–50 years before ovulation. This that FSH and LH receptors' messenger RNA was also observed in
pre-ovulation stage involves an intricate process of dominant both human and mouse oocytes (metaphase II), indicating a
follicle selection followed by nuclear maturation, germinal physiological role in the oocyte maturation [20,21].
vesicle (GV) breakdown, chromosomal arrangement, and Comparing the use of recombinant LH and hCG in oocyte
completion of MI by extrusion of the first polar body, all of maturation during clinical IVM permits us to investigate the
which occur concurrently with a not so well characterized differences between the effects of these gonadotropins in a
process of cytoplasmic maturation. Likewise, during IVM, well-designed in vitro system. In oocytes matured in vitro,
intrinsic and extrinsic environmental factors such as hor- recombinant FSH and hCG are added to the culture medium,
mones, growth factors, and nutrients must co-operate properly and maternal serum is also used as a supplement in clinical
to ensure cytoplasmic and nuclear maturation. IVM programs [22]. However, the cellular response upon FSH
There are many clinical benefits regarding IVM despite cannot entirely substitute for LHCGR signaling during the final
certain pitfalls. In in vitro fertilization (IVF) the number of stages of follicle growth and ovulation as shown in the LHCGR
collected oocytes increases by using external gonadotropins knockout mouse [23] and in women with inactivating
for ovarian stimulation. Unfortunately, stimulation protocols mutations of LHCGR [24].
increase the chance of ovarian hyperstimulation syndrome Many studies have creatively found ways to use animal
(OHSS) [3]. The amount of external gonadotropin administra- model experiments, in vitro or in vivo, to analyze the effects of
tion is reduced during IVM, thus minimizing the risk of gonadotropins on mammalian oocyte maturation and this
hyperstimulation. IVM is also proposed as a solution to kind of research is expected to provide further support for their
preserve fertility [4] concerning patients with polycystic ovary clinical application [25,26]. Given the importance of the use of
syndrome [5,6] and patients with a high risk of future both LH and hCG in in vitro maturation systems during ART,
infertility, such as young females undergoing aggressive the aim of the current study was to assess the effect of LH and
gonadotoxic chemotherapy [7]. Recent reports have described hCG addition to the IVM culture medium of mouse GV-stage
the use of IVM for oocytes retrieved from antral follicles with oocytes before and after fertilization through early embryonic
subsequent successful fertilization and pregnancy [8,9]. development. Furthermore, we examined the expression of
Despite previous data demonstrating low pregnancy outcome LH/hCG receptor mRNA at both mouse oocytes and early
and caution in IVM indications, innovative findings in this field embryos using RT-PCR.
have opened new horizons in the treatment of patients [10]. In
addition, GV oocytes obtained during an IVF/intracytoplasmic
sperm injection (ICSI) cycle are not used clinically and are 2. Materials and methods
usually discarded. Although some of these oocytes may be
atretic or may have been resistant to the in vivo gonadotropin 2.1. Experimental animals
stimulus, some are still capable of undergoing maturation and
fertilization, if appropriate conditions are present in vitro [11]. All female and male mice used in this study were (C57BL/6,

Hence, mouse oocytes could be used to study and optimize the CBA<) F1 hybrids raised and cared at the Pasteur Institute
culture conditions for human IVM. (Athens, Greece). This study was reviewed and approved by the
Luteinizing hormone (LH) and human chorionic gonado- University Hospital Ethics Committee and the Animal Care and
tropin (hCG) are integral components of the hypothalamic– Use Committee of the Pasteur Institute (Ethics Committee of the
pituitary–gonadal axis, which controls sexual maturation and ‘‘Alexandra Hospital’’, Reference number: 662, Date: 4/12/14).
functionality. LH is a key regulator of gonadal steroidogenesis
and ovulation, in contrast to hCG that is predominantly active 2.2. Experimental groups
in pregnancy and fetal development. However hCG is consid-
ered the wonder of today's science [12], since it is the most 2.2.1. In vitro maturation of mouse oocytes
acidic glycoprotein containing the highest proportion of sugars In order to assess the effect of LH and hCG on in vitro
and is involved in functions ranging from control of human maturation of mouse GV-stage oocytes, three experimental
pregnancy to human cancer. During assisted reproductive groups were studied:
technology (ART) protocols, hCG has been used as a surrogate
for the natural midcycle LH surge. Due to the structural and (A) Control group: GV-stage oocytes cultured in vitro in the basic
biological similarities, both hCG and LH activate and bind to culture medium.
140 reproductive biology 16 (2016) 138–146

(B) LH group: GV-stage oocytes cultured in vitro in the basic Falcon, Franklin Lakes, NJ) under 1 mL mineral oil. The culture
culture medium supplemented with recombinant LH medium consisted of 40 mL a-MEM (a minimal essential
(Luveris, Merck-Serono, Merck KGaA, Darmstadt, Germany) medium, Invitrogen, Life Technologies, Paisley, UK) supple-
in a concentration of 1.5 IU/mL. mented with 1% FBS (Fetal Bovine Serum, Invitrogen). Culture
(C) HCG group: GV-stage oocytes cultured in vitro in the basic conditions were adjusted to 37 oC, 5% CO2 in air and 95%
culture medium supplemented with hCG (Pregnyl, Orga- humidity. Half of the medium was renewed on alternate days.
non, Oss, The Netherlands) in a concentration of 1.5 IU/mL.
2.6. In vitro fertilization of the in vitro matured GV–stage
2.3. Embryonic development of IVM mouse oocytes oocytes

In order to assess the effect of LH and hCG on early embryo Mouse oocytes were controlled at 12 and 24 h for oocyte
development, five experimental groups were studied: maturation by microscopic examination (Nikon, Tokyo, Japan).
The nuclear maturation rate was expressed as oocytes at the
(A) Control group: GV-stage oocytes cultured in vitro in the basic MII stage to total number of GV oocytes ratio. Progression to
culture medium and after fertilization through early the MII stage was identified by extrusion of the first polar body
embryonic development still in the basic culture media. into the perivitelline space. The number of GV oocytes that
(B) r-LH/r-LH group: GV-stage oocytes cultured in vitro in the remained at GV stage and the number of GV oocytes that
basic culture medium supplemented with recombinant LH reinitiated meiosis (GV breakdown or GVBD oocytes) were also
in a concentration of 1.5 IU/mL. After fertilization through recorded, and their ratios were calculated.
early embryonic development the culture medium of this Three to six months old male mice were sacrificed via
group was supplemented with 1.5 IU/mL r-LH. cervical translocation. Their epididymides were freed and each
(C) r-LH/hCG group: GV-stage oocytes cultured in vitro in the of them was placed in droplets of 100 mL Ham's Medium (Ham's
basic culture medium supplemented with recombinant LH F10 Medium () Hypoxanthine, Gibco) supplemented with 5 mg/
in a concentration of 1.5 IU/mL. After fertilization through mL BSA under mineral oil. Epididymal contents were carefully
early embryonic development the culture medium of this squeezed out to release spermatozoa. The suspensions were
group was supplemented with 1.5 IU/mL hCG. allowed to capacitate for 2 h in the incubator (37 oC, 5% CO2 in
(D) hCG/hCG group: GV-stage oocytes cultured in vitro in the air, 95% humidity) and the spermatozoa were transferred to the
basic culture medium supplemented with hCG in a IVM oocytes for insemination at a final motile sperm concen-
concentration of 1.5 UI/mL. After fertilization through tration of 1–2
106/mL. Four hours later, fertilized oocytes were
early embryonic development the culture medium of this washed several times through drops of DPBS with 10% BSA and
group was supplemented with 1.5 UI/mL hCG. then transferred to plates, seeded and cultured in 1 mL Ham's
(E) hCG/r-LH group: GV-stage oocytes cultured in vitro in the Medium with 5 mg/mL BSA, 1.5 U/mL rLH or 1.5 UI/mL hCG,
basic culture medium supplemented with hCG in a according to the new groups, under mineral oil for 5 days in
concentration of 1.5 UI/mL. After fertilization through order to evaluate early embryo development. Fertilization was
early embryonic development the culture medium of this assessed by the presence of male and female pronuclei.
group was supplemented with 1.5 UI/mL r-LH. Cleavage to the two-cell stage was assessed at 24 h after sperm
insemination. Evaluation of embryonic development was then
followed through to the morulae stage for 96 h.
2.4. GV-stage oocyte collection for in vitro maturation
2.7. RNA extraction and cDNA preparation
Prepubertal mice (aged 21–28 days) were sacrificed via cervical
translocation and their ovaries were aseptically removed and Total RNA was extracted from oocytes of GV stage, GVBD stage
placed in isolating medium consisted of DPBS (Dulbecco's and metaphase II stage as well as 2-cell, 4-cell and morula stage
Phosphate Buffered Saline, Gibco, Invitrogen, Life Technologies, development. Total RNA extraction kit was obtained from
Paisley, UK) with 10% BSA (Albumin, bovine serum fraction V, Qiagen (RNeasy micro kit, Qiagen, Valencia, CA, USA) and the
Sigma–Aldrich, St. Louis, Missouri, United States). The ovaries extraction was performed according to manufacturer's protocol.
were mechanically dissected using hypodermic needles Aliquots (500 ng/mL) of extracted total RNA were reverse
(26 gauges) and denuded oocytes were collected mechanically transcribed using Ambion retroscript kit, (Retroscript kit,
by puncturing. Oocytes were isolated at the late stages of Ambion, Austin, TX, USA), 0.5 mM dNTPMix (Ambion), 5 mM
development, when not surrounded by layers of cumulus cells, oligo dT Primer (Ambion), 80U RNease Inhibitor (Invitrogen),
and the germinal vesicle was clearly visible. In total, 983 GV- 1
First Standard Buffer (Invitrogen), 1600U MML-V reverse
stage oocytes were collected and randomly distributed in the transcriptase (Invitrogen) and up to 40 mL total volume of
three experimental groups. In particular, 297, 348, 338 GV-stage reaction nuclease free water. The reactions were performed at
oocytes were assigned to control, LH and hCG group respectively. 80 oC for 3 min, at 42 oC for 60 min and at 92 oC for 10 min on
Mastercycler (Eppendorf, Hamburg, Germany).
2.5. GV-stage oocyte culture for in vitro maturation
2.8. Nested PCR
After two washing steps in isolating medium and one wash in
culture medium the preantral follicles were cultured in groups The expression of LH/hCG receptor gene in GV, GVBD,
of 10 GV-stage oocytes in microdrops in Petri dishes (BD, metaphase II oocytes as well as 2-cell, 4-cell and morula
 reproductive biology 16 (2016) 138–146 141

Table 1 – Oligonucleotide primers used for RT–PCR assay.

mRNA Primers Sequence of oligonucleotide Annealing temperature (8C) Product size (bp)
LH/hCG receptor 50 –30 AACTCTGCCCTCCAGAGAAA 55 480
Outer pair 30 –50 CAAAAGTCTGCAAAGGAGAGA 55

LH/hCG receptor 50 –30 TGAGGAGAATGAACTCAGTGG 55 177

Inner pair 30 –50 ACTGTCAAGTTGCCAAAGATG 55

GAPDH 50 –30 TGCACCACCAACTGCTTAG 55 177

30 –50 GGATGCAGGGATGATGTTC 55
Primer pairs for increased sensitivity were designed by the program primer [27].

stage development was assessed using Nested primer pairs 2.9. Statistics
(MWG Biotech Ebersberg, Munich, Germany) which were
designed by the program for primers of increased sensitivity The results of the maturation rates were analyzed by the Chi-
[27]. Primer pairs used for GAPDH mRNA amplification have square test: Statistical Software SPSS 15.0. The fertilization
been described elsewhere [28]. Primer sequences are presented rates were analyzed by the Fisher exact test: Statistical
in Table 1. Software Minitab 16.0. A value of p < 0.05 was considered
For the first PCR, 3 mL reverse transcribed cDNA were added statistically significant.
to the first PCR master mix to a total volume of 50 mL
containing 5 mL of 10
PCR buffer, 1.5 mmol MgCl2/L, 0.2 mmoL
of each specific 50 –30 and 30 –50 outer primer, 0.2 mmoL of each 3. Results
dNTP/L and 1.5U Taq DNA polymerase (Invitrogen, Life
Technologies). Each reaction was overlaid with light white 3.1. In vitro maturation of mouse oocytes
oil and heated to 94 oC for 5 min to denature all proteins and
DNA. PCR cycling conditions were 94 oC denaturation, 55 oC In total, 957 GV-stage oocytes were collected and randomly
annealing and 72 oC extension, each step 1 min. PCR was distributed in the three experimental groups. In particular, 291
carried out for 30 cycles. The reaction was terminated at 72 oC were assigned to control group, 337 to LH group and 329 to hCG
for 10 min. First round PCR products were quenched at 4 oC group. The maturation rate of mouse GV oocytes to the MII
and stored at 20 oC until the second round of PCR. stage in the control medium was compared with the
For the second round of PCR, 5 mL of the primary product maturation rates in the media containing either LH or hCG.
were added to 45 mL freshly prepared PCR master mix as Approximately 32.3% of murine oocytes remained in the GV
described above, containing 0.2 mmoL of each specific 50 –30 and stage when incubated in control medium, 28.5% and 21.6% of
30 –50 inner primer. All reactions were overlaid with light white the oocytes remained in the GV stage when cultured with
oil and PCR was carried out for 30 cycles with inner primer recombinant-LH and hCG, respectively. Approximately 24.1%
pairs using the same program. Samples were stored at 20 oC of murine oocytes remained in the GVBD stage when
until electrophoresis was performed. The amplified products incubated in control medium, 24.0% and 12.2% of the oocytes
were subjected to electrophoresis on 2% (w/v) agarose gels and remained in the GVBD stage when cultured with recombinant-
stained with ethidium bromide (Invitrogen Life Technologies). LH and hCG, respectively. The percentage of oocytes matured
Ten microliters of each PCR product and dye buffer was to MII and extracted polar body was 43.6% in the control
analyzed in parallel with a 100 bp DNA ladder (Invitrogen Life medium and was not significantly different from the LH group
Technologies). After gel electrophoresis was completed, gels in which 47.5% of oocytes matured to MII. In contrast, a
were visualized under ultraviolet light and photographed with significantly greater percentage of the oocytes matured in the
a Polaroid camera. hCG group: 66.3% reached the MII stage (p < 0.0005) (Fig. 1).

Fig. 1 – The effect of r-LH and hCG on in vitro maturation of GV-stage oocytes expressed as the percentage of oocytes showed
the first polar body (PB) extraction. The GV-stage oocytes were cultured for 16–18 h in basic medium (the control group) in
medium supplemented with 1.5 UI/mL r-LH or in medium supplemented with 1.5 UI/mL hCG (*p < 0.0005).
142 reproductive biology 16 (2016) 138–146

Fig. 2 – The effect of r-LH and/or hCG on in vitro fertilization of GV-stage oocytes. After fertilization the culture media were
supplemented again with r-LH (1.5 UI/mL) or hCG (1.5 UI/mL) forming 5 experimental groups: control, r-LH/r-LH, r-LH/hCG,
hCG/hCG and hCG/r-LH. The fertilization percentage is the number of 2-cell embryos comparing to the number of polar body
stage oocytes.

3.2. Embryonic development of IVM mouse oocytes respectively and none of them were significantly different
comparing to the control group. These results indicate that the
After fertilization, the oocytes of the r-LH group were divided quality of oocytes that have undergone IVM in media
into two new groups: the first received 1.5 IU/mL r-LH and the supplemented with rLH and hCG is significantly better than
second received 1.5 IU/mL hCG. As a result two new groups r-LH/ the quality of those matured in basic media only (Fig. 3).
r-LH and r-LH/hCG emerged. The oocytes of the hCG group were
also divided into two new groups: the first received 1.5 IU/mL r- 3.3. The expression of LH/hCG receptor in mouse oocytes
LH and the second received 1.5 IU/mL hCG. As a result two new and early embryos
groups hCG/hCG and hCG/r-LH emerged. The fertilization rates
and morula development rates of the IVM oocytes after culture The LH/hCG receptor (LHCGR) was found in mouse oocytes of
with recombinant-LH and hCG were analyzed. all stages (GV, GVBD and Polar Body) in all three groups.
Fertilization was assessed by the presence of male and Moreover, the LHCGR was detected after fertilization at the
female pronuclei as well as cleavage to the two-cell stage at 24 h zygotes, 2-cell, 4-cell and morula stage embryos in all
after sperm insemination. The hCG/r-LH group had the highest examined groups (control, r-LH/hCG and r-LH/r-LH, hCG/r-
fertilization rate (44.8%) while the hCG/hCG group had the LH and hCG/hCG) (Fig. 4).
lowest fertilization rate (25.7%). These were not significantly The experiments were performed three times with differ-
different compared to the control group (38.3%) (Fig. 2). The ent groups of oocytes and early embryos and the results were
fertilization rates of the groups r-LH/hCG and r-LH/r-LH were concordant.
28.6% and 33.8% respectively, not significantly different either.
The rate of development to morula was significantly
4. Discussion
improved (p = 0.001) in group hCG/r-LH where the percentage
of morula stage embryos was 69.2% compared to the
control group (29.3%). Morula development rates in groups In vitro maturation methods are used in assisted reproduction
r-LH/r-LH, r-LH/hCG and hCG/hCG were 45.5%, 31.3% and 44.4% in order to improve embryo development outcome and

Fig. 3 – The effect of r-LH and/or hCG on in vitro early embryo development of GV-stage oocytes. After fertilization the culture
media were supplemented again with r-LH (1.5 UI/mL) or hCG (1.5 UI/mL) forming 5 experimental groups: control, r-LH/r-LH,
r-LH/hCG, hCG/hCG and hCG/r-LH. The early embryo development percentage is expressed as the number of morulae
comparing to the number of the 2-cell stage embryos. *p = 0.001 comparing to the control group.
 reproductive biology 16 (2016) 138–146 143

Fig. 4 – Gel electrophoresis of RT-PCR products. Gel electrophoresis of RT-PCR products for: (a) LH/hCG receptor in prophase I
stage oocytes (PI), metaphase I stage oocytes (MI) and metaphase II stage oocytes (MII) and zygotes (Z) cultured without
(control) or with r-LH (LH) or hCG (hCG) as well as in and zygotes (Z) in all the study groups: control (C), r-LH/r-LH (L/L), r-LH/
hCG (L/h), hCG/hCG (h/h) and hCG/r-LH (h/L). The LH/hCG receptor was detected in all these groups and the product size was
177 bp; (b) LH/hCG receptor in 2-cell (2c) and 4-cell stage embryo (4c) and morulae (M) in all the study groups. The LH/hCG
receptor was detected in all these groups and the product size was 177 bp; (c) GAPDH mRNA in zygotes (Z), in 2-cell (2c) and 4-
cell stage embryo (4c) and morulae (M); (d) GAPDH mRNA in prophase I stage oocytes (GV), metaphase I stage oocytes (GVBD)
and metaphase II stage oocytes (PB).

increase clinical pregnancy rates. Maturation of oocytes human and murine embryonic developmental competence
outside the body needs optimal environment, similar to was improved by maturing oocytes in the presence of a 1:10
natural milieu inside the body. IVM medium has been ratio of rFSH:rLH. Given the importance of the use of both
supplemented with several factors, including growth factors, gonadotropins in in vitro follicle maturation systems and
cytokines and hormones, aiming to a reciprocally choreo- taking into account that recombinant FSH is always added to
graphed cytoplasmic and nuclear process in order to ensure the culture medium, a condition with FSH was not included in
maturation. our study. The current study intended to reveal changes in
FSH is important for the development of pre-ovulatory maturation and fertilization of oocytes matured in vitro only
follicles in vivo [29] and for induction of LH receptors, therefore with r-LH or hCG and no FSH. The commonly used concentra-
it is added to the culture medium. Studies in humans showed tion of FSH is 0.075 IU/mL [31]. We doubled that concentration,
responsiveness of human oocytes to gonadotropins during since no FSH was used and because it is known that the 1:10
IVM. Improvement in human, bovine and murine oocyte ratio of rFSH:rLH is beneficial for oocytes matured in vitro, we
maturation and embryo cleavage in the presence of FSH and decided to use the concentration 1.5 IU/mL for both rLH and
LH has been reported [30]. Anderiesz et al. reported that hCG. Due to the lack of FSH during our experiments we had
144 reproductive biology 16 (2016) 138–146

embryos at the morula stage only, and not at the blastocyst increase in maturation rates after the addition of hCG in the
stage. culture media. Also LHCGR appears to act directly on the
The inclusion of a 1:10 ratio of FSH:hCG has been used for oocytes from the early stage development without the
the routine culture of immature human oocytes [32] and presence of any cumulus cells. Epidermal growth factor
according to another study [33], human oocytes undergo receptor (EGFR) was detected in all the nuclear maturation
normal cleavage following the addition of gonadotropins to stages of human oocytes and it is known that EGF-like growth
culture medium. However, no comparisons have been made factors act as mediators of LH action in the ovulatory follicle
with respect to the developmental potential of oocytes treated [45]. The expression of both LHCGR and EGFR at oocytes at
with a 10 times concentration of LH and/or hCG. Human stages GV, GVBD and MII supports these data.
menopausal gonadotropin (hMG) and hCG are commonly used We also assessed the fertilization and early embryo
as the main components of the culture system for oocyte development of GV-stage oocytes matured in vitro. After
maturation for the last years [34]. The large N-terminal fertilization and the addition of either r-LH or hCG, the
ectodomain of the LH/hCG receptor is responsible for the fertilization percentages were evaluated comparing the 2-cell
high affinity and selective binding of its two ligands LH and embryos to the polar body stage oocytes. The group that
hCG [35]. Although in vivo, bioactivity of LH or hCG will largely received hCG for IVM and r-LH after fertilization (hCG/r-LH
determine differences in the extent of LHCGR stimulation group) had higher fertilization rate compared to the control
upon LH or hCG addition, it remains to be determined whether group but not significantly different. The early embryo
LH and hCG can elicit intrinsically different responses at the development percentages were expressed according to the
level of the LHCGR. number of morulae compared to the 2-cell stage embryos. The
The effects of LH and hCG on oocyte maturation and r-LH/r-LH, the r-LH/hCG and the hCG/hCG groups were not
development in vitro remain controversial. Hreinsson et al. significantly different compared to the control group but the
showed that recombinant hCG or LH were equally effective in group hCG/r-LH showed increased embryo development rate
promoting oocyte maturation in a clinical IVM program [36] compared to the control group (p = 0.001). In the past, many
while Ge et al. indicated that the addition of hCG to in vitro studies have used hCG to improve the in vitro maturation rates
culture medium did not improve the maturation rate or of oocytes but this is the first study to report the use of r-LH and
development potential of immature oocytes from women with hCG without FSH and especially this is the first study that
PCOS [37]. Many studies in animals have shown that adding shows significantly increased early embryo development rate
hCG to culture medium improves oocyte maturation and when hCG is added during IVM and r-LH after fertilization.
increases the development potential of immature oocytes In the current study, the LHCGR was detected at the
[30,36,38]. This fact suggests that the LH or hCG ratio is crucial zygotes, 2-cell, 4-cell and morula stage embryos in all studied
for in vitro oocyte maturation and development. Other groups and the addition of r-LH or hCG to the culture media did
researchers have demonstrated that a combination of LH not affect the expression of LHCGR in mouse preimplantation
and/or hCG added to the maturation medium had no beneficial embryos. The presence of mRNA for FSH and LH receptors in
effect on oocyte IVM [39,40], nor on the subsequent embryo zygotes and preimplantation embryos has been established
developmental ability [41–43]. In the present study, we used indicating a potential role of the gonadotropins in the
mouse denuded oocytes in the presence of recombinant LH modulation of meiotic resumption and completion of oocyte
and hCG and found that hCG significantly increased maturation, as well as a beneficial effect on early embryonic
the nuclear maturation rate of these oocytes in vitro. With development in mice [20,21]. These data provide support
the addition of 1.5 UI/mL hCG, 66.3% of the GV-stage oocytes concerning the responsiveness of human and bovine oocytes
extracted the first polar body after 16–18 h of in vitro matura- to pure recombinant preparations of human follicle stimulat-
tion. The absence of any supporting cumulus cells suggests the ing hormone (rFSH) and luteinizing hormone (rLH) for meiotic
presence of LHCGR on oocytes at this developmental stage in maturation and subsequent developmental competence
mice and the differences of the half-life of LH and hCG could in vitro [30]. In our study, mouse embryonic developmental
explain why the maturation rates were improved only in the competence was improved when oocytes were exposed during
hCG group. maturation to 1.5 UI/mL hCG and after fertilization to 1.5 UI/
It has been suggested that gap junction-mediated trans- mL r-LH, revealing a new condition totally effective to improve
mission of follicular cell cAMP to the oocyte inhibits oocyte IVM culture media.
maturation, whereas gonadotropin stimulation terminates It is important to find innovative ways to improve
cumulus–oocyte communication and initiates resumption of laboratory procedures as well as clinical aspects to make
meiosis, thus interrupting the direct transfer of cAMP to the the use of immature oocytes more efficient. The proper
oocyte [44]. Moreover, the expression of LH and FSH receptors combination of ovarian stimulation and oocyte culture system
in denuded oocytes indicates a mechanism for their matura- in vitro should be placed in order to achieve successful rates.
tion (free of cumulus cells) mediated by gonadotropins directly The advantages of oocyte IVM in assisted reproduction as an
[20,21]. Our results agree with the previous studies, since the alternative to hormone stimulation for patients with polycys-
LHCGR was detected in metaphase II mouse oocytes (PB) in tic ovary syndrome are clear, in order to avoid ovarian
the presence or absence of r-LH or hCG, which means that the hyperstimulation syndrome. In addition, standard IVF stimu-
expression of LHCGR is not affected by the presence of these lation protocols might be contraindicated in patients with
gonadotropins. According to the best of our knowledge, this is hormonally sensitive tumors. Another emerging population
the first study to reveal the expression of LHCGR at the oocytes who would benefit from IVM is female patients with history of
of prophase I (GV) and metaphase I (GVBD) which explains the cancer who wish to preserve their fertility options before
 reproductive biology 16 (2016) 138–146 145

proceeding to aggressive life-saving therapy [46]. Developing a gonadotropin in man. J Clin Endocrinol Metab 1968;28
widespread, safe, and effective method to extract oocytes from (12):1763–7.
[15] Damewood MD, Shen W, Zacur HA, Schlaff WD, Rock JA,
patients followed by IVM would allow these patients to
Wallach EE. Disappearance of exogenously administered
produce embryos with their partners that can be frozen for
human chorionic gonadotropin. Fertil Steril 1989;52(3):
later use and help mitigate their possible loss of fertility. 398–400.
Moreover, since many of the known maturation systems have [16] Erickson GF, Magoffin DA, Dyer CA, Hofeditz C. The ovarian
been used to study oocyte maturation and early embryo androgen producing cells: a review of structure/function
development in the past, our system also may serve as an relationships. Endocr Rev 1985;6(3):371–99.
extra system in basic science research to gain insight into [17] Oktay K, Briggs D, Gosden RG. Ontogeny of follicle-
stimulating hormone receptor gene expression in isolated
oogenesis and embryogenesis.
human ovarian follicles. J Clin Endocrinol Metab 1997;82
(11):3748–51.
[18] Takao Y, Honda T, Ueda M, Hattori N, Yamada S, Maeda M,
Conflict of interest
et al. Immunohistochemical localization of the LH/HCG
receptor in human ovary: HCG enhances cell surface
The authors have nothing to disclose. expression of LH/HCG receptor on luteinizing granulosa
cells in vitro. Mol Hum Reprod 1997;3(7):569–78.
[19] Conti M, Richter W, Mehats C, Livera G, Park JY, Jin C. Cyclic
AMP-specific PDE4 phosphodiesterases as critical
references
components of cyclic AMP signaling. J Biol Chem 2003;278
(8):5493–6.
[20] Patsoula E, Loutradis D, Drakakis P, Kallianidis K, Bletsa R,
[1] Cha KY, Chian RC. Maturation in vitro of immature human Michalas S. Expression of mRNA for the LH and FSH
oocytes for clinical use. Hum Reprod Update 1998;4(2): receptors in mouse oocytes and preimplantation embryos.
103–20. Reproduction 2001;121(3):455–61.
[2] Trounson A, Wood C, Kausche A. In vitro maturation and [21] Patsoula E, Loutradis D, Drakakis P, Michalas L, Bletsa R,
the fertilization and developmental competence of oocytes Michalas S, et al. Messenger RNA expression for the follicle-
recovered from untreated polycystic ovarian patients. Fertil stimulating hormone receptor and luteinizing hormone
Steril 1994;62(2):353–62. receptor in human oocytes and preimplantation-stage
[3] Aboulghar M. Symposium update on prediction and embryos. Fertil Steril 2003;79(5):1187–93.
management of OHSS. Prevention of OHSS. Reprod Biomed [22] Mikkelsen AL, Smith SD, Lindenberg S. In-vitro maturation
Online 2009;19(1):33–42. of human oocytes from regularly menstruating women
[4] Smitz JE, Thompson JG, Gilchrist RB. The promise of in vitro may be successful without follicle stimulating hormone
maturation in assisted reproduction and fertility priming. Hum Reprod 1999;14(7):1847–51.
preservation. Semin Reprod Med 2011;29(1):24–37. [23] Zhang FP, Poutanen M, Wilbertz J, Huhtaniemi I. Normal
[5] Cha KY, Lee DR, Cho JH, Yoon TK. In vitro maturation of prenatal but arrested postnatal sexual development of
immature oocytes and IVF/ICSI in PCOS patients. J Indian luteinizing hormone receptor knockout (LuRKO) mice. Mol
Med Assoc 2006;104(8). 446, 448, 473. Endocrinol 2001;15(1):172–83.
[6] Gremeau AS, Andreadis N, Fatum M, Craig J, Turner K, [24] Huhtaniemi I, Alevizaki M. Gonadotrophin resistance. Best
McVeigh E, et al. In vitro maturation or in vitro fertilization Pract Res Clin Endocrinol Metab 2006;20(4):561–76.
for women with polycystic ovaries? A case–control study of [25] Xie H, Xia G, Byskov AG, Andersen CY, Bo S, Tao Y. Roles of
194 treatment cycles. Fertil Steril 2012;98(2):355–60. gonadotropins and meiosis-activating sterols in meiotic
[7] Cao YX, Chian RC. Fertility preservation with immature and resumption of cultured follicle-enclosed mouse oocytes.
in vitro matured oocytes. Semin Reprod Med 2009;27(6): Mol Cell Endocrinol 2004;218(1–2):155–63.
456–64. [26] Zhang M, Tao Y, Zhou B, Xie H, Wang F, Lei L, et al. Atrial
[8] Ellenbogen A, Shavit T, Shalom-Paz E. IVM results are natriuretic peptide inhibits the actions of FSH and forskolin
comparable and may have advantages over standard IVF. in meiotic maturation of pig oocytes via different signalling
Facts Views Vis Obgyn 2014;6(2):77–80. pathways. J Mol Endocrinol 2005;34(2):459–72.
[9] Grynberg M, Peltoketo H, Christin-Maitre S, Poulain M, [27] Primer 3 code. Available at: http://www.genome.wi.mit.
Bouchard P, Fanchin R. First birth achieved after in vitro edu/genome_software/othr/primer3.html [database on the
maturation of oocytes from a woman endowed with Internet].
multiple antral follicles unresponsive to follicle-stimulating [28] Craven AJ, Ormandy CJ, Robertson FG, Wilkins RJ, Kelly PA,
hormone. J Clin Endocrinol Metab 2013;98(11):4493–8. Nixon AJ, et al. Prolactin signaling influences the timing
[10] Chang EM, Song HS, Lee DR, Lee WS, Yoon TK. In vitro mechanism of the hair follicle: analysis of hair growth
maturation of human oocytes: its role in infertility cycles in prolactin receptor knockout mice. Endocrinology
treatment and new possibilities. Clin Exp Reprod Med 2001;142(6):2533–9.
2014;41(2):41–6. [29] Abir R, Franks S, Mobberley MA, Moore PA, Margara RA,
[11] Janssenswillen C, Nagy ZP, Van Steirteghem A. Maturation Winston RM. Mechanical isolation and in vitro growth of
of human cumulus-free germinal vesicle-stage oocytes to preantral and small antral human follicles. Fertil Steril
metaphase II by coculture with monolayer Vero cells. Hum 1997;68(4):682–8.
Reprod 1995;10(2):375–8. [30] Anderiesz C, Ferraretti A, Magli C, Fiorentino A, Fortini D,
[12] Cole LA. hCG, the wonder of today's science. Reprod Biol Gianaroli L, et al. Effect of recombinant human
Endocrinol 2012;10:24. gonadotrophins on human, bovine and murine oocyte
[13] Kessler MJ, Reddy MS, Shah RH, Bahl OP. Structures of meiosis, fertilization and embryonic development in vitro.
N-glycosidic carbohydrate units of human chorionic Hum Reprod 2000;15(5):1140–8.
gonadotropin. J Biol Chem 1979;254(16):7901–8. [31] Goud PT, Goud AP, Qian C, Laverge H, Van der Elst J, De
[14] Yen SS, Llerena O, Little B, Pearson OH. Disappearance rates Sutter P, et al. In-vitro maturation of human germinal
of endogenous luteinizing hormone and chorionic vesicle stage oocytes: role of cumulus cells and epidermal
146 reproductive biology 16 (2016) 138–146

growth factor in the culture medium. Hum Reprod 1998;13 [39] Fukui Y, Fukushima M, Terawaki Y, Ono H. Effect of
(6):1638–44. gonadotropins, steroids and culture media on bovine
[32] Wynn P, Picton HM, Krapez JA, Rutherford AJ, Balen AH, oocyte maturation in vitro. Theriogenology 1982;18(2):
Gosden RG. Pretreatment with follicle stimulating hormone 161–75.
promotes the numbers of human oocytes reaching [40] Lonergan P, Carolan C, Mermillod P. Development of bovine
metaphase II by in-vitro maturation. Hum Reprod 1998;13 embryos in vitro following oocyte maturation under
(11):3132–8. defined conditions. Reprod Nutr Dev 1994;34(4):329–39.
[33] Armstrong DT, Zhang X, Vanderhyden BC, Khamsi F. [41] Choi YH, Carnevale EM, Seidel Jr GE, Squire EL. Effects of
Hormonal actions during oocyte maturation influence gonadotropins on bovine oocytes matured in TCM-199.
fertilization and early embryonic development. Ann N Y Theriogenology 2001;56(4):661–70.
Acad Sci 1991;626:137–58. [42] Ali A, Sirard MA. The effects of 17beta-estradiol and protein
[34] Barnes FL, Kausche A, Tiglias J, Wood C, Wilton L, Trounson supplement on the response to purified and recombinant
A. Production of embryos from in vitro-matured primary follicle stimulating hormone in bovine oocytes. Zygote
human oocytes. Fertil Steril 1996;65(6):1151–6. 2002;10(1):65–71.
[35] Caltabiano G, Campillo M, De Leener A, Smits G, Vassart G, [43] Silvestre MA, Alfonso J, Garcia-Mengual E, Salvador I,
Costagliola S, et al. The specificity of binding of glycoprotein Duque CC, Molina I. Effect of recombinant human follicle-
hormones to their receptors. Cell Mol Life Sci 2008;65 stimulating hormone and luteinizing hormone on in vitro
(16):2484–92. maturation of porcine oocytes evaluated by the subsequent
[36] Hreinsson J, Rosenlund B, Friden B, Levkov L, Ek I, Suikkari in vitro development of embryos obtained by in vitro
AM, et al. Recombinant LH is equally effective as fertilization, intracytoplasmic sperm injection, or
recombinant hCG in promoting oocyte maturation in a parthenogenetic activation. J Anim Sci 2007;85(5):1156–60.
clinical in-vitro maturation programme: a randomized [44] Loutradis D, Drakakis P, Michalas S, Hatzaki C, Kallianidis K,
study. Hum Reprod 2003;18(10):2131–6. Aravantinos L, et al. The effect of compounds altering the
[37] Ge HS, Huang XF, Zhang W, Zhao JZ, Lin JJ, Zhou W. cAMP level on reversing the 2-cell block induced by
Exposure to human chorionic gonadotropin during in vitro hypoxanthine in mouse embryos in vitro. Eur J Obstet
maturation does not improve the maturation rate and Gynecol Reprod Biol 1994;57(3):195–9.
developmental potential of immature oocytes from [45] Park JY, Su YQ, Ariga M, Law E, Jin SL, Conti M. EGF-like
patients with polycystic ovary syndrome. Fertil Steril growth factors as mediators of LH action in the ovulatory
2008;89(1):98–103. follicle. Science 2004;303(5658):682–4.
[38] Prins GS, Wagner C, Weidel L, Gianfortoni J, Marut EL, [46] Lee SJ, Schover LR, Partridge AH, Patrizio P, Wallace WH,
Scommegna A. Gonadotropins augment maturation and Hagerty K, et al. American Society of Clinical Oncology
fertilization of human immature oocytes cultured in vitro. recommendations on fertility preservation in cancer
Fertil Steril 1987;47(6):1035–7. patients. J Clin Oncol 2006;24(18):2917–31.