0% found this document useful (0 votes)
52 views18 pages

Explore Problems Mock Contest Discuss: A Summary: How To Use Bit Manipulation To Solve Problems Easily and Efficiently

Uploaded by

bobby jones
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
52 views18 pages

Explore Problems Mock Contest Discuss: A Summary: How To Use Bit Manipulation To Solve Problems Easily and Efficiently

Uploaded by

bobby jones
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 18

Explore

Problems

Mock

Contest

Discuss

Store

🚀 January LeetCoding Challenge 🚀


Premium
1
Description

Solution

Discuss (746)

Submissions

Back

A summary: how to use bit manipulation to solve problems easily and efficiently

2.8K

LHearen
4399

Last Edit: October 25, 2018 11:51 PM

183.1K VIEWS

Wiki

Bit manipulation is the act of algorithmically manipulating bits or other pieces of data shorter than a

word. Computer programming tasks that require bit manipulation include low-level device control,

error detection and correction algorithms, data compression, encryption algorithms, and

optimization. For most other tasks, modern programming languages allow the programmer to work

directly with abstractions instead of bits that represent those abstractions. Source code that does bit

manipulation makes use of the bitwise operations: AND, OR, XOR, NOT, and bit shifts.

Bit manipulation, in some cases, can obviate or reduce the need to loop over a data structure and

can give many-fold speed ups, as bit manipulations are processed in parallel, but the code can

become more difficult to write and maintain.

Details

Basics
At the heart of bit manipulation are the bit-wise operators & (and), | (or), ~ (not) and ^ (exclusive-or,

xor) and shift operators a << b and a >> b.

There is no boolean operator counterpart to bitwise exclusive-or, but there is a simple explanation.

The exclusive-or operation takes two inputs and returns a 1 if either one or the other of the inputs is

a 1, but not if both are. That is, if both inputs are 1 or both inputs are 0, it returns 0. Bitwise

exclusive-or, with the operator of a caret, ^, performs the exclusive-or operation on each pair of bits.

Exclusive-or is commonly abbreviated XOR.

● Set union A | B
● Set intersection A & B
● Set subtraction A & ~B
● Set negation ALL_BITS ^ A or ~A
● Set bit A |= 1 << bit

● Clear bit A &= ~(1 << bit)


● Test bit (A & 1 << bit) != 0
● Extract last bit A&-A or A&~(A-1) or x^(x&(x-1))
● Remove last bit A&(A-1)
● Get all 1-bits ~0

Examples

Count the number of ones in the binary representation of the given number
int​ ​count_one​(​int​ n)​ {
​while​(n) {
n = n&(n​-1​);
count++;
}
​return​ count;
}

Is power of four (actually map-checking, iterative and recursive methods can do the same)

bool​ i ​ sPowerOfFour​(​int​ n)​ {


​return​ !(n&(n​-1​)) && (n&​0x55555555​);
​//check the 1-bit location;
}

^​ tricks

Use ​^​ to remove even exactly same numbers and save the odd, or save the distinct bits and remove

the same.

Sum of Two Integers

Use ​^​ and ​&​ to add two integers


int​ ​getSum​(​int​ a, ​int​ b)​ {
​return​ b==​0​? a:getSum(a^b, (a&b)<<​1​); ​//be careful about the terminating
condition;
}

Missing Number

Given an array containing n distinct numbers taken from 0, 1, 2, ..., n, find the one that is missing

from the array. For example, Given nums = [0, 1, 3] return 2. (Of course, you can do this by math.)

int​ ​missingNumber​(vector<​int​>& nums)​ {


​int​ ret = ​0​;
​for​(​int​ i = ​0​; i < nums.size(); ++i) {
ret ^= i;
ret ^= nums[i];
}
​return​ ret^=nums.size();
}

|​ tricks

Keep as many 1-bits as possible

Find the largest power of 2 (most significant bit in binary form), which is less than or equal to the

given number N.
long​ l ​ argest_power​(​long​ N)​ {
​//changing all right side bits to 1.
N = N | (N>>​1​);
N = N | (N>>​2​);
N = N | (N>>​4​);
N = N | (N>>​8​);
N = N | (N>>​16​);
​return​ (N+​1​)>>​1​;
}

Reverse Bits

Reverse bits of a given 32 bits unsigned integer.

Solution

uint32_t​ ​reverseBits​(​uint32_t​ n)​ {


​unsigned​ ​int​ mask = ​1​<<​31​, res = ​0​;
​for​(​int​ i = ​0​; i < ​32​; ++i) {
​if​(n & ​1​) res |= mask;
mask >>= ​1​;
n >>= ​1​;
}
​return​ res;
}

uint32_t​ ​reverseBits​(​uint32_t​ n)​ {


uint32_t​ mask = ​1​, ret = ​0​;
for​(​int​ i = ​0​; i < ​32​; ++i){
ret <<= ​1​;
if​(mask & n) ret |= ​1​;
mask <<= ​1​;
}
return​ ret;
}

&​ tricks

Just selecting certain bits

Reversing the bits in integer

x = ((x & 0xaaaaaaaa) >> 1) | ((x & 0x55555555) << ​1);


x = ((x & 0xcccccccc) >> 2) | ((x & 0x33333333) << 2);
x = ((x & 0xf0f0f0f0) >> 4) | ((x & 0x0f0f0f0f) << 4);
x = ((x & 0xff00ff00) >> 8) | ((x & 0x00ff00ff) << 8);
x = ((x & 0xffff0000) >> 16) | ((x & 0x0000ffff) << 16);

Bitwise AND of Numbers Range

Given a range [m, n] where 0 <= m <= n <= 2147483647, return the bitwise AND of all numbers in

this range, inclusive. For example, given the range [5, 7], you should return 4.

Solution
int​ ​rangeBitwiseAnd​(​int​ m, ​int​ n)​ {
​int​ a = ​0​;
​while​(m != n) {
m >>= ​1​;
n >>= ​1​;
a++;
}
​return​ m<<a;
}

Number of 1 Bits

Write a function that takes an unsigned integer and returns the number of ’1' bits it has (also known

as the Hamming weight).

Solution

int​ ​hammingWeight​(​uint32_t​ n)​ {


int​ count = ​0​;
while​(n) {
n = n&(n​-1​);
count++;
}
return​ count;
}

int​ ​hammingWeight​(​uint32_t​ n)​ {


ulong mask = ​1​;
​int​ count = ​0​;
​for​(​int​ i = ​0​; i < ​32​; ++i){ ​//31 will not do, delicate;
​ f​(mask & n) count++;
i
mask <<= ​1​;
}
​return​ count;
}

Application

Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example:

"ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within

the DNA. Write a function to find all the 10-letter-long sequences (substrings) that occur more than

once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return: ["AAAAACCCCC", "CCCCCAAAAA"].

Solution
class​ ​Solution​ {
public​:
​vector​<​string​> ​findRepeatedDnaSequences​(string s)​ {
​int​ sLen = s.length();
​vector​<​string​> v;
​if​(sLen < ​11​) ​return​ v;
​char​ keyMap[​1​<<​21​]{​0​};
​int​ hashKey = ​0​;
​for​(​int​ i = ​0​; i < ​9​; ++i) hashKey = (hashKey<<​2​) | (s[i]-​'A'​+​1​)%​5​;
​for​(​int​ i = ​9​; i < sLen; ++i) {
​if​(keyMap[hashKey = ((hashKey<<​2​)|(s[i]-​'A'​+​1​)%​5​)&​0xfffff​]++ == ​1​)
v.push_back(s.substr(i​-9​, ​10​));
}
​return​ v;
}
};

But the above solution can be invalid when repeated sequence appears too many times, in which

case we should use ​unordered_map<int, int> keyMap​ to replace ​char keyMap[1<<21]{0}​here.

Majority Element

Given an array of size n, find the majority element. The majority element is the element that appears

more than ⌊ n/2 ⌋ times. (bit-counting as a usual way, but here we actually also can adopt sorting

and Moore Voting Algorithm)

Solution

int​ ​majorityElement​(vector<​int​>& nums)​ {


​int​ len = ​sizeof​(​int​)*​8​, size = nums.size();
​int​ count = ​0​, mask = ​1​, ret = ​0​;
​for​(​int​ i = ​0​; i < len; ++i) {
count = ​0​;
​for​(​int​ j = ​0​; j < size; ++j)
​if​(mask & nums[j]) count++;
​if​(count > size/​2​) ret |= mask;
mask <<= ​1​;
}
​return​ ret;
}

Single Number III

Given an array of integers, every element appears three times except for one. Find that single one.

(Still this type can be solved by bit-counting easily.) But we are going to solve it by ​digital logic design

Solution

//inspired by logical circuit design and boolean algebra;


//counter - unit of 3;
//current incoming next
//a b c a b
//0 0 0 0 0
//0 1 0 0 1
//1 0 0 1 0
//0 0 1 0 1
//0 1 1 1 0
//1 0 1 0 0
//a = a&~b&~c + ~a&b&c;
//b = ~a&b&~c + ~a&~b&c;
//return a|b since the single number can appear once or twice;
int​ ​singleNumber​(vector<​int​>& nums)​ {
​int​ t = ​0​, a = ​0​, b = ​0​;
​for​(​int​ i = ​0​; i < nums.size(); ++i) {
t = (a&~b&~nums[i]) | (~a&b&nums[i]);
b = (~a&b&~nums[i]) | (~a&~b&nums[i]);
a = t;
}
​return​ a | b;
}
;

Maximum Product of Word Lengths

Given a string array words, find the maximum value of length(word[i]) * length(word[j]) where the two

words do not share common letters. You may assume that each word will contain only lower case

letters. If no such two words exist, return 0.

Example 1:

Given ["abcw", "baz", "foo", "bar", "xtfn", "abcdef"]

Return 16

The two words can be "abcw", "xtfn".


Example 2:

Given ["a", "ab", "abc", "d", "cd", "bcd", "abcd"]

Return 4

The two words can be "ab", "cd".

Example 3:

Given ["a", "aa", "aaa", "aaaa"]

Return 0

No such pair of words.


Solution

Since we are going to use the length of the word very frequently and we are to compare the letters of

two words checking whether they have some letters in common:

● using an array of int to pre-store the length of each word reducing the frequently ​measuring
process;
● since int has 4 bytes, a 32-bit type, and there are only 26 different letters, so we can just use
one bit to indicate the existence of the letter in a word.

int​ ​maxProduct​(vector<string>& words)​ {


​vector​<​int​> ​mask​(words.size())​;
​vector​<​int​> ​lens​(words.size())​;
​for​(​int​ i = ​0​; i < words.size(); ++i) lens[i] = words[i].length();
​int​ result = ​0​;
​for​ (​int​ i=​0​; i<words.size(); ++i) {
​for​ (​char​ c : words[i])
mask[i] |= ​1​ << (c - ​'a'​);
​for​ (​int​ j=​0​; j<i; ++j)
​if​ (!(mask[i] & mask[j]))
result = max(result, lens[i]*lens[j]);
}
​return​ result;
}

Attention

● result after shifting left(or right) too much is undefined


● right shifting operations on negative values are undefined
● right operand in shifting should be non-negative, otherwise the result is undefined
● The & and | operators have lower precedence than comparison operators

Sets

All the subsets

A big advantage of bit manipulation is that it is trivial to iterate over all the subsets of an N-element

set: every N-bit value represents some subset. Even better, ​if A is a subset of B then the number

representing A is less than that representing B​, which is convenient for some dynamic programming

solutions.

It is also possible to iterate over all the subsets of a particular subset (represented by a bit pattern),

provided that you don’t mind visiting them in reverse order (if this is problematic, put them in a list as

they’re generated, then walk the list backwards). The trick is similar to that for finding the lowest bit

in a number. If we subtract 1 from a subset, then the lowest set element is cleared, and every lower

element is set. However, we only want to set those lower elements that are in the superset. So the

iteration step is just ​i = (i - 1) & superset​.

vector​<​vector​<​int​>> subsets(​vector​<​int​>& nums) {


​vector​<​vector​<​int​>> vv;
​int​ size = nums.size();
​if​(size == ​0​) ​return​ vv;
​int​ num = ​1​ << size;
vv.resize(num);
​for​(​int​ i = ​0​; i < num; ++i) {
​for​(​int​ j = ​0​; j < size; ++j)
​if​((​1​<<j) & i) vv[i].push_back(nums[j]);
}
​return​ vv;
}

Actually there are two more methods to handle this using ​recursion​ and ​iteration​ respectively.

Bitset

A ​bitset​ stores bits (elements with only two possible values: 0 or 1, true or false, ...).

The class emulates an array of bool elements, but optimized for space allocation: generally, each

element occupies only one bit (which, on most systems, is eight times less than the smallest

elemental type: char).

// bitset::count
#include <iostream> // std::cout
#include <string> // std::string
#include <bitset> // std::bitset

int​ ​main​ ​()​ {


​std​::​bitset​<8> ​foo​ ​(std::string(​"10110011"​))​;
​std​::​cout​ << foo << ​" has "​;
​std​::​cout​ << foo.count() << ​" ones and "​;
​std​::​cout​ << (foo.size()-foo.count()) << ​" zeros.\n"​;
​return​ ​0​;
}

Always welcom new ideas and ​practical​ tricks, just leave them in the comments!

Comments: 96

BestMost VotesNewest to OldestOldest to Newest

Preview

Post

● 1
● 2
● 3
● 4
● 5

● 10
Copyright © 2021 LeetCode
● Help Center
● Jobs
● Bug Bounty
● Students
● Terms
● Privacy Policy

United States

|||
Type here...(Markdown is enabled)

Saved

You might also like