Explore Problems Mock Contest Discuss: A Summary: How To Use Bit Manipulation To Solve Problems Easily and Efficiently
Explore Problems Mock Contest Discuss: A Summary: How To Use Bit Manipulation To Solve Problems Easily and Efficiently
Problems
Mock
Contest
Discuss
Store
Solution
Discuss (746)
Submissions
Back
A summary: how to use bit manipulation to solve problems easily and efficiently
2.8K
LHearen
4399
183.1K VIEWS
Wiki
Bit manipulation is the act of algorithmically manipulating bits or other pieces of data shorter than a
word. Computer programming tasks that require bit manipulation include low-level device control,
error detection and correction algorithms, data compression, encryption algorithms, and
optimization. For most other tasks, modern programming languages allow the programmer to work
directly with abstractions instead of bits that represent those abstractions. Source code that does bit
manipulation makes use of the bitwise operations: AND, OR, XOR, NOT, and bit shifts.
Bit manipulation, in some cases, can obviate or reduce the need to loop over a data structure and
can give many-fold speed ups, as bit manipulations are processed in parallel, but the code can
Details
Basics
At the heart of bit manipulation are the bit-wise operators & (and), | (or), ~ (not) and ^ (exclusive-or,
There is no boolean operator counterpart to bitwise exclusive-or, but there is a simple explanation.
The exclusive-or operation takes two inputs and returns a 1 if either one or the other of the inputs is
a 1, but not if both are. That is, if both inputs are 1 or both inputs are 0, it returns 0. Bitwise
exclusive-or, with the operator of a caret, ^, performs the exclusive-or operation on each pair of bits.
● Set union A | B
● Set intersection A & B
● Set subtraction A & ~B
● Set negation ALL_BITS ^ A or ~A
● Set bit A |= 1 << bit
Examples
Count the number of ones in the binary representation of the given number
int count_one(int n) {
while(n) {
n = n&(n-1);
count++;
}
return count;
}
Is power of four (actually map-checking, iterative and recursive methods can do the same)
^ tricks
Use ^ to remove even exactly same numbers and save the odd, or save the distinct bits and remove
the same.
Missing Number
Given an array containing n distinct numbers taken from 0, 1, 2, ..., n, find the one that is missing
from the array. For example, Given nums = [0, 1, 3] return 2. (Of course, you can do this by math.)
| tricks
Find the largest power of 2 (most significant bit in binary form), which is less than or equal to the
given number N.
long l argest_power(long N) {
//changing all right side bits to 1.
N = N | (N>>1);
N = N | (N>>2);
N = N | (N>>4);
N = N | (N>>8);
N = N | (N>>16);
return (N+1)>>1;
}
Reverse Bits
Solution
& tricks
Given a range [m, n] where 0 <= m <= n <= 2147483647, return the bitwise AND of all numbers in
this range, inclusive. For example, given the range [5, 7], you should return 4.
Solution
int rangeBitwiseAnd(int m, int n) {
int a = 0;
while(m != n) {
m >>= 1;
n >>= 1;
a++;
}
return m<<a;
}
Number of 1 Bits
Write a function that takes an unsigned integer and returns the number of ’1' bits it has (also known
Solution
Application
"ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within
the DNA. Write a function to find all the 10-letter-long sequences (substrings) that occur more than
For example,
Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",
Solution
class Solution {
public:
vector<string> findRepeatedDnaSequences(string s) {
int sLen = s.length();
vector<string> v;
if(sLen < 11) return v;
char keyMap[1<<21]{0};
int hashKey = 0;
for(int i = 0; i < 9; ++i) hashKey = (hashKey<<2) | (s[i]-'A'+1)%5;
for(int i = 9; i < sLen; ++i) {
if(keyMap[hashKey = ((hashKey<<2)|(s[i]-'A'+1)%5)&0xfffff]++ == 1)
v.push_back(s.substr(i-9, 10));
}
return v;
}
};
But the above solution can be invalid when repeated sequence appears too many times, in which
Majority Element
Given an array of size n, find the majority element. The majority element is the element that appears
more than ⌊ n/2 ⌋ times. (bit-counting as a usual way, but here we actually also can adopt sorting
Solution
Given an array of integers, every element appears three times except for one. Find that single one.
(Still this type can be solved by bit-counting easily.) But we are going to solve it by digital logic design
Solution
Given a string array words, find the maximum value of length(word[i]) * length(word[j]) where the two
words do not share common letters. You may assume that each word will contain only lower case
Example 1:
Return 16
Return 4
Example 3:
Return 0
Since we are going to use the length of the word very frequently and we are to compare the letters of
● using an array of int to pre-store the length of each word reducing the frequently measuring
process;
● since int has 4 bytes, a 32-bit type, and there are only 26 different letters, so we can just use
one bit to indicate the existence of the letter in a word.
Attention
Sets
A big advantage of bit manipulation is that it is trivial to iterate over all the subsets of an N-element
set: every N-bit value represents some subset. Even better, if A is a subset of B then the number
representing A is less than that representing B, which is convenient for some dynamic programming
solutions.
It is also possible to iterate over all the subsets of a particular subset (represented by a bit pattern),
provided that you don’t mind visiting them in reverse order (if this is problematic, put them in a list as
they’re generated, then walk the list backwards). The trick is similar to that for finding the lowest bit
in a number. If we subtract 1 from a subset, then the lowest set element is cleared, and every lower
element is set. However, we only want to set those lower elements that are in the superset. So the
Actually there are two more methods to handle this using recursion and iteration respectively.
Bitset
A bitset stores bits (elements with only two possible values: 0 or 1, true or false, ...).
The class emulates an array of bool elements, but optimized for space allocation: generally, each
element occupies only one bit (which, on most systems, is eight times less than the smallest
// bitset::count
#include <iostream> // std::cout
#include <string> // std::string
#include <bitset> // std::bitset
Always welcom new ideas and practical tricks, just leave them in the comments!
Comments: 96
Preview
Post
● 1
● 2
● 3
● 4
● 5
●
● 10
Copyright © 2021 LeetCode
● Help Center
● Jobs
● Bug Bounty
● Students
● Terms
● Privacy Policy
United States
|||
Type here...(Markdown is enabled)
Saved