UNIVERSITATEA ”OVIDIUS” DIN CONSTANŢA

FACULTATEA DE FARMACIE
PROGRAM DE STUDII FARMACIE

Pluripotent anti-inflammatory immunomodulatory effects

of papaverine against cerebral ischemic-reperfusion injury

GRUPA 1

1. Introduction
Ischemic stroke is increasing in prevalence and has become the leading cause of morbidity and
mortality, but the therapeutic options are limited.1 Many studies have indicated that inflammation
plays a central role in all aspects of stroke, including initiation, propagation, and recovery.2 The
central target of inflammation is disruption of the blood-brain barrier (BBB) from the view of the
dynamic neurovascular unit (NVU),3 which functions to regulate communication between the
brain and cerebrovascular network, most notably in the context of coupling neuronal activity to
blood flow. In addition to involving the inflammatory response, cerebral ischemic injury is a
complex system of pathological processes, which include excitotoxicity and cell
death.4,5 Network pharmacology, which provides a straightforward method for identifying find
the connections between drugs and diseases, is a promising approach for uncovering the potential
pathways and biological processes in target network.6 To date, substantial achievements have
been made in determining the pathways and biological processes related to target drugs used in
treating cerebral ischemia via network pharmacology analysis.7

Papaverine (PV) is an opium alkaloid that has been used as a vasodilator agent for over 70 years
to treat cerebral and coronary artery vasospasm.8 This vasodilator can increase the intracellular
levels of cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate
(cGMP) by inhibiting corresponding phosphodiesterases in smooth muscle.9 Additionally, it can
block calcium ion channels and inhibit the release of calcium. It can increase the mean
circulation time, improve the cerebral oxygenation,10, 11, 12 and significantly reduce blood-
brain barrier (BBB) disruption.13 In addition, recent reports have suggested that papaverine may
have a potential neuroprotective effect when used locally.14,15 However, some studies have
suggested that the use of papaverine leads to rapid increases in intracranial pressure16 and
transient neurological deficits17,18 by increasing reperfusion-induced vasodilation/hyperemia13, as
well as increases the risk of cerebral infarction19 and emboli due to precipitation.20,21 Baicalin
(BA) is an active natural compound extracted from the Chinese medicine Scutellaria
baicalensis with powerful anti-inflammatory effects, and it was proven to have a positive effect
in the treatment of cerebral ischemia via polypharmacological mechanisms related to immunity,
apoptosis, development, cytoskeletal remodeling, transduction and neurophysiology in our
previous studies.22, 23, 24 Therefore, in this study, we will first evaluate the effect of PV in
reducing the infarction volume of mice induced by focal cerebral ischemia-reperfusion and then
compare the differences in canonical pathways and biological processes between PV-treated
animals and BA-treated ones to uncover the potential pharmacological mechanism by which PV
can treat cerebral ischemia.

2. Materials and methods

2.1. Animal model

Animal experiments were conducted in accordance with the Prevention of Cruelty to Animals
Act (1986) and the National Research Council's Guide for the Care and Use of Laboratory
Animals. The experimental protocol was approved by the Committee on the Ethics of Animal
Experiments of China Academy of Chinese Medical Sciences. Forty-two healthy 12-week-old
Adult mice (male, Kunming) weighing 38–48 g and aged 12 weeks were randomly assigned to
three groups (the PV-treated, BA-treated, vehicle-treated groups), with 14 mice in each group.
After being anesthetized with pentobarbital (4 mg/kg, i.p), the mice in the BA-treated and PV-
treated groups underwent 1.5 h of focal middle cerebral artery occlusion (MCAO) using an
intraluminal suture and 24 h of reperfusion. The mice in the vehicle-treated group underwent the
same surgical procedures, but a suture was not inserted into the external carotid artery (ECA).
Throughout the entire surgical procedure, the mice were maintained at a temperature of 37 °C
with normal blood pressure, glucose levels and blood gas levels.

2.2. Drug administration

The Chinese herbal drugs BA and PV were validated using fingerprint chromatographic
methodologies. In the experiment, 42 mice were randomized into three groups: the vehicle (0.9%
NaCl), BA-treated (5 mg/ml), and PV-treated (4 mg/ml) groups.7,22,23 After 1.5 h of focal cerebral
ischemia, BA (5 mg/ml) and PV (4 mg/ml) were dissolved in 0.9% sodium chloride, and both
compounds were injected into the tail vein of mice in the BA-treated and PV-treated groups at a
dose of 2 ml/kg body weight. Mice in the vehicle-treated group were injected through the tail
vein with 0.9% NaCl (2 ml/kg body weight) at the same time point.

2.3. Calculation of infarct volume

The infarct volume was measured in nine mice from each of the BA-treated, PV-treated and
vehicle-treated groups. The 2,3,5-triphenyltetrazolium blue staining method was used to estimate
the cerebral infarct size.25 The individuals who measured the infarct volume were unaware of the
treatment conditions. The infarct area was calculated using a pathological image analysis system
(Topica), and the ratio of the infarct volume to the total volume of the section was calculated. To
compare the average infarct volume between different groups, one-way analysis of variance was
used. The null hypothesis was rejected at 0.05.

2.4. RNA isolation

The left hippocampi of 5 randomly selected mice from each of the BA-treated, PV-treated, and
vehicle-treated groups were homogenized with TRIzol reagent (Invitrogen, USA) to extract total
RNA. A previously published method was used for RNA extraction and microarray data
analysis.6 The RNA samples were purified and concentrated using an RNeasy MicroKit (Qiagen,
Valencia, CA, USA). This process was described in detail in previous studies.6,26,27

2.5. Microarray

Gene expression profiling was conducted using a mouse brain array (Boao Capital, Beijing,
China), a microarray chip containing 16,463 oligoclones (Incyte Genomics, Santa Clara, CA,
USA). Each clone was repeated on each chip so that there were four technical iterations of each
clone. The intensity value of each clone was determined by averaging the four intensities after
spline smoothing. Each clone was verified by DNA sequencing. RNA from the vehicle-treated
group was labeled with Cy3 and pooled, and the rest of the RNA was labeled with Cy5.
Hybridization, washing and scanning of the microarrays were performed according to standard
protocols.

2.6. Microarray data analysis

All experimental data were uploaded to the ArrayTrack system (US Food and Drug
Administration, USA). All experimental analyses were performed based on the Minimum
Information About a Microarray Experiment (MIAME) guidelines and the Microarray Quality
Control (MAQC) project. The results were submitted to the Array Express database. To reduce
experimental variability, all microarray data were normalized by locally weighted linear
regression (LOWESS) (smoothing factor: 0.2; robustness iterations: 3). One-way ANOVA and
fiber-optic microarray analysis were used to compare altered genes between the PV-treated and
vehicle-treated groups as well as between the PV-treated and BA-treated groups. Genes with a P
value less than 0.05 and a fold change greater than 1.5 were selected for further analysis. The P
values were adjusted by Bonferroni correction, and significantly changed genes were selected for
further analysis. In addition, a >1.5-fold increase or <0.5-fold decrease in the expression levels
indicated upregulation or downregulation, respectively.

2.7. Pathway and biological processes analysis

All differentially expressed genes were uploaded to GeneGo MetaCore™ in the ArrayTrack
system. The likelihood of a significant association between the gene and a canonical pathway or
biological process was measured using P-values and calculated by Fisher's exact test. The level
of statistical significance was set at P < 0.05. Canonical pathways and biological processes with
a P < 0.05 and a fold change >1.5 were selected and analyzed.

2.8. Validation by quantitative real-time PCR

Another eight mice from each group were decapitated after anesthesia with Pelltobarbitalum
Natricum (40 mg/kg). Total RNA was extracted from the left brains of the mice using TRIzol
(Invitrogen) and reverse transcribed into cDNA using a reverse transcription system kit (Takara,
Shanghai, China) according to the manufacturer's protocol. qRT-PCR was performed on an ABI
7500 Real-Time PCR System (Applied Biosystems, Foster City, USA) using the SYBR Green
PCR Kit to determine mRNA expression levels. The relative expression of G-CSF (primers:
CACTATGGTCAGGACGAGAGG and CTCACTTGCTCCAGGGACTTA) and p38MAPK
(primers: TGCTCGTTTTGGACTCAGATAAGA and ATCATAGGTCAGGCTCTTCCACTC)
was analyzed using the comparative CT method for relative quantitation and the 2-ΔΔCt method
by normalizing to β-actin expression, and relative expression is presented as the percent change
compared to matched controls. The results are expressed as the mean ± standard deviation.
Differences between two groups were assessed using Student's t test, and one-way analysis of
variance (ANOVA) was used to assess differences between multiple groups; P < 0.05 was
considered to indicate statistical significance.

3. Results

3.1. The pharmacodynamic effects of BA and PV on ischemic infarct volume

In our study, we found that the ischemic infarct volume was significantly reduced in both the
PV-treated and BA-treated groups compared with the vehicle-treated group (P < 0.05) (Fig. 1a).
A greater reduction in the infarct volume was observed in the PV-treated group.
Fig. 1. The effect of papaverine and canonical pathways and biological processes activated
by papaverine compared with vehicle. (a) The effects of BA and PV on the ischemic infarct
volume. (b) The top 10 canonical pathways activated in the PV-treated group compared with the
vehicle-treated group (P < 0.05). (c) The top 10 biological processes activated in the PV-treated
group compared with the vehicle-treated group (P < 0.05).

3.2. The canonical pathways activated in the PV-treated group compared with the vehicle-
treated group

A total of 24 canonical pathways were identified (P < 0.05) to be activated in the PV-treated

group compared with the vehicle-treated group (Supplementary Table 1). Of these 24 pathways,
10 (41.67%) were related to the immune response, 8 (33.33%) were related to cytokine-mediated
signaling pathways, and 3 (12.5%) were related to G-protein coupled receptor protein signaling
pathways. Of the 10 canonical pathways with the lowest p-values, 6 (60%) were related to the
immune response, and 4 of these pathways were cytokine-mediated signaling pathways (Fig. 1b).

3.3. The top 10 biological processes activated in the PV-treated group compared with the
vehicle-treated group

The top 10 biological processes activated in the PV-treated group compared with the vehicle-
treated group were mainly related to multiple immunomodulatory processes of neurovascular
inflammation, including neuropeptide signaling pathways, Th17-derived cytokines, the
regulation of angiogenesis, cell adhesion related to leukocyte chemotaxis, antigen presentation,
cell adhesion related to synaptic contact, and inflammation related to amphoterin signaling
(Fig. 1c). In particular, the top biological process was “signal transduction_neuropeptide
signaling pathways”, which showed that many neuroimmunoregulatory peptides, such as alpha-
MSH, beta-MSH, and gamma-MSH, DA-alphaMSH, were inhibited (Fig. 2).
Fig. 2. The top biological process activated in the PV-treated group compared with the
vehicle-treated group-signal transduction_neuropeptide signaling pathways. The circles in
the figure indicate the target nodes of papaverine. Red circles indicate upregulation, and blue
circles indicate downregulation.

3.4. The canonical pathways activated in the PV-treated group compared with the BA-
treated group

There were 17 pathways that were unique to the PV-treated group compared to the BA-treated
group (P < 0.05) (Supplementary Table 2). Ten (58.82%) of the 17 pathways were related to the
immune response, with 4 (23.53%) of these pathways being cytokine-mediated signaling
pathways (Fig. 3a). Moreover, the 10 canonical pathways with the lowest p-values were mainly
related to the immune response (50%) (Fig. 3b), especially cytokine production and cytokine-
mediated signaling pathways, including cytokine production by Th17 cells in the CF, immune
response_IL-17 signaling pathways (Fig. 4) and immune response_IL-27 signaling pathway. As
shown in Fig. 4, IL-6, IL-23, granulocyte-macrophage colony stimulating factor (GM-CSF),
granulocyte colony stimulating factor (G-CSF), receptor activator of nuclear factor-kB ligand
(RANKL), p38 MAPK and nuclear factor-kB (NF-κB), which are cytokines in the IL-17
signaling pathway that are important for inflammation, were all activated.
Fig. 3. The canonical pathways and biological processes activated by papaverine compared
with BA. (a) The 17 pathway-related cellular processes activated in the PV-treated group
compared with the BA-treated group. (b) The top 10 pathways activated in the PV-treated group
compared with the BA-treated group (P < 0.05). (c) The top 10 biological processes activated in
the PV-treated group compared with the BA-treated group (P < 0.05).

Fig. 4. One of the canonical pathways activated by PV compared with BA-immune

response_IL-17 signaling pathways. The columns in the figure indicate the target site of
papaverine. Red columns indicate upregulation, while blue columns indicate downregulation.

3.5. The top 10 biological processes activated in the PV-treated group compared with the
BA-treated group

The top 10 targeted pathways of biological processes activated in the PV-treated group compared
with the BA-treated group, as in the PV-treated group compared with the vehicle-treated group,
were also mainly related to multiple immunomodulatory processes of neurovascular
inflammation, such as the regulation of signal transduction factors like neuroimmunoregulatory
peptides, Th17-derived cytokines, the regulation of angiogenesis, the activation of the WNT
signaling pathway and the IL-10-mediated anti-inflammatory response (Fig. 3c). The top
biological process was also the “signal transduction_neuropeptide signaling pathways”
(Supplementary Figure 1), and many neuroimmunoregulatory peptides of the MSH family were
also inhibited.

3.6. Real-time PCR validation

P38MAPK and G-CSF mRNA expression was consistently altered in individual samples from
the sham, vehicle-treated, BA-treated and PV-treated groups (Fig. 5). There was a statistically
significant difference between the vehicle-treated group and the sham group (P < 0.05). The BA-
treated group and the PV-treated group showed statistically significant differences compared
with the vehicle-treated group (P < 0.05). There was a trend but no significant difference
between the BA-treated group and the PV-treated group.

Fig. 5. Validation by the mRNA expression levels of G-CSF and P38MAPK using real-time
RT-PCR. ∗P < 0.05.

4. Discussion

Our study indicated that PV may be effective in reducing the ischemic infarct volume and
therefore might have potential for treating cerebral ischemia in clinical practice. We found that
compared with those activated in the vehicle-treated and BA-treated groups, the canonical
pathways and biological processes activated in the PV-group were both mainly related to the
immune response, especially related to inflammation, which has been reported to play a key role
in cerebral ischemia and ischemia-reperfusion injury.28,29 For example, one canonical pathway
identified to be significantly activated in the PV-treated group compared with the vehicle-treated
and BA-treated groups was the IL-17 signaling pathway, which is related to the immune
response; this is a complicated pathway associated with the induction of proinflammatory
molecule and chemokine production, the recruitment of neutrophils, and the promotion of T
lymphocyte function (Fig. 4).30,31 Our findings are consistent with previous studies showing that
PV has anti-inflammatory effects in preventing vasospasm and anti-inflammatory actions.32,33

In recent years, a number of studies have suggested that postischemic reperfusion injury is
associated with a distinct pattern of immune cell responses and extracellular signaling
molecules.34, 35, 36, 37 It has been reported that T cells are recruited to postischemic brain
tissue through the blood-brain barrier, causing inflammation and nerve damage. T cells release
neurotoxic cytokines to aggravate nerve damage, for example, TH7 cells secrete IL-17.2 Our
study showed that the main pathways and biological processes associated with the effect of
papaverine were all related to the immune response, especially the modulation of neurovascular
inflammation. For example, PV regulated both Th17-derived cytokine production and the IL-17
signaling pathway by acting on cytokines such as G-CSF, p38MAPK, IL-6 and RANKL. Studies
have found that IL-17 activates G-CSF secretion by peripheral cells and terminates
mitochondrial outer membrane permeability and caspase 9 activation, thereby prolonging
neutrophil survival.38 Granulocyte colony-stimulating factor (G-CSF) is an endogenous growth
factor that exhibits multiple neuroprotective mechanisms against stroke. For example, protecting
endoplasmic reticulum homeostasis promotes the weakening of apoptotic protein expression and
the enhancement of anti-apoptotic protein expression.39 Weise et al performed experiments
showing that high concentrations of G-CSF can reduce monocyte infiltration after
stroke.40 Related studies show that p38 MAPK and G-CSF play important roles in the cerebral
ischemia. Inhibition of p38 MAPK can reduce cerebral infarction volume and neurological
deficits after cerebral infarction.41 Studies have found that p38MAPK is a key MAPK involved in
the production of transmission media including TNF-α and COX-2, and the p38MAPK signal
plays a critical role in regulating cellular processes, especially inflammation.42 G-CSF is an
endogenous growth factor that shows multiple neuroprotective mechanisms against stroke.43 G-
CSF plays a key role in controlling the immune response and leads to anti-inflammatory
cytokines, preventing excessive activation of monocytes and lymphocytes by reducing the
release of pro-inflammatory mediators.44 In addition, the receptor-activated nuclear factor-kB
(NF-κB) ligand (RANKL)/RANK signaling pathway has been found to attenuate inflammatory
responses through TOLL-like receptor signaling pathways in microglia, and the activation of the
(RANKL)/RANK signaling pathway has neuroprotective effects and can reduce the expression
of inflammatory cytokines.45 In our study, we found that the expression of G-CSF and RANK
was upregulated after treatment with PV compared with BA; thus, the neuroprotective effect of
PV may be different from that of BA.

5. Conclusion
In this study, we performed a comparative analysis to determine the difference in the
pharmacological mechanism of PV compared with BA in the treatment of cerebral ischemia-
reperfusion injury. By comparing the effects of and the canonical pathways and biological
processes activated by PV compared with vehicle and BA, we found that PV reduced the infarct
size in ischemic cerebral infarction; the findings suggested that PV might act as an efficacious
pluripotent anti-inflammatory agent against cerebral ischemic-reperfusion injury by targeting
multiple immunomodulatory processes of neurovascular inflammation.

Funding

The work was supported by National Natural Science Foundation of China (Grant

No. 81673833) and National 11th Five-year Plan Supporting R&D Project (2006BAI08B04-06).

Declaration of Competing Interest

We declare no conflict of interest.

Acknowledgements

All authors participated in the study design, interpretation of the results and analysis of the data
and reviewed the manuscript.

Appendix A. Supplementary data

Download all supplementary files included with this article

Supplementary Table 1. The pathway map analysis of PV versus vehicle (P < 0.05).

Supplementary Table 2. The pathway map analysis of PV versus BA (P < 0.05).

 Supplementary Figure 1. The top 1 biological process of PV compared with BA-signal
transduction_Neuropeptides signaling pathways. The circles in the figure indicate the
target nodes of papaverine. Red circle indicates the expression of up-regulation and blue
indicates down-regulation.

References

G. Zhou, M.H. Li, G. Tudor, H.T. Lu, R. Kadirvel, D. KallmesRemote ischemic conditioning

in cerebral diseases and neurointerventional procedures: recent Research progress

Front Neurol, 16 (9) (May 2018), p. 339, 10.3389/fne

CrossRefView Record in ScopusGoogle Scholar

S. Shekhar, M.W. Cunningham, M.R. Pabbidi, S. Wang, G.W. Booz, F. FanTargeting vascular
inflammation in ischemic stroke: recent developments on novel immunomodulatory
approaches

Eur J Pharmacol, 833 (Aug 2018), pp. 531-544, 10.1016/j.ejphar.2018.06.028

ArticleDownload PDFView Record in ScopusGoogle Scholar

3
C. IadecolaThe neurovascular unit coming of age: a journey through neurovascular
coupling in health and disease

Neuron, 96 (2017), pp. 17-42, 10.1016/j.neuron.2017.07.030

ArticleDownload PDFView Record in ScopusGoogle Scholar

U. Dirnagl, C. Iadecola, M.A. MoskowitzPathobiology of ischaemic stroke: an integrated

view

Trends Neurosci, 22 (9) (1999), pp. 391-397

ArticleDownload PDFView Record in ScopusGoogle Scholar

A. Martín, M. Domercq, C. MatuteInflammation in stroke: the role of cholinergic, purinergic

and glutamatergic signaling

Ther Adv Neurol Disord, 4 (2018), p. 11, 10.1177/1756286418774267

View Record in ScopusGoogle Scholar

L. Gao, J. Hao, Y.Y. Niu, M. Tian, X. Yang, C.H. ZhuNetwork pharmacology dissection of

multiscale mechanisms of herbal medicines in stage IV gastric adenocarcinoma treatment

Medicine (Baltim), 95 (35) (2016), p. e4389

CrossRefGoogle Scholar

P.Q. Wang, B. Li, J. Liu, et al.Phenotype-dependent alteration of pathways and networks

reveals a pure synergistic pharmacological mechanismfor anti-cerebral ischemia

Acta Pharmacol Sin, 36 (2015), pp. 734-747, 10.1038/aps.2014.168

CrossRefView Record in ScopusGoogle Scholar

J.K. Liu, M.S. Tenner, O.N. Gottfried, et al.Efficacy of multiple intraarterial papaverine

infusions for improvement in cerebral circulation time in patients with recurrent cerebral
vasospasm
J Neurosurg, 100 (3) (2004), pp. 414-421, 10.3171/jns.2004.100.3.0414

CrossRefView Record in ScopusGoogle Scholar

C. Lugnier, J.C. StocletInhibition by papaverine of cGMP and cAMP phosphodiesterases

from the rat heart

Biochem Pharmacol, 23 (1974), pp. 3071-3074

ArticleDownload PDFView Record in ScopusGoogle Scholar

10

J.M. Milburn, C.J. Moran, D.T. Cross, M.N. Diringer, T.K. Pilgram, R.G. Dacey Jr.Effect of
intraarterial papaverine on cerebral circulation time

AJNR Am J Neuroradiol, 18 (1997), pp. 1081-1085

View Record in ScopusGoogle Scholar

11

J.M. Milburn, C.J. Moran, D.T. Cross, M.N. Diringer, T.K. Pilgram, R.G. Dacey Jr.Increase in
diameters of vasospastic intracranial arteries by intraarterial papaverine administration

J Neurosurg, 88 (1998), pp. 38-42, 10.3171/jns.1998.88.1.0038

CrossRefView Record in ScopusGoogle Scholar

12

J. Fandino, Y. Kaku, B. Schuknecht, A. Valavanis, Y. YonekawaImprovement of cerebral
oxygenation patterns and metabolic validation of superselective intraarterial infusion of
papaverine for the treatment of cerebral vasospasm

J Neurosurg, 89 (1) (1998), pp. 93-100, 10.3171/jns.1998.89.1.0093

CrossRefView Record in ScopusGoogle Scholar

13

Z. Jiang, C. Li, D.M. Arrick, S. Yang, A.E. Baluna, H. SunRole of nitric oxide synthases in

early blood-brain barrier disruption following transient focal cerebral ischemia

PloS One, 9 (3) (2014), p. e93134, 10.1371/journal.pone.0093134

CrossRefGoogle Scholar

14

L. Brian, R. Edward, H.B. Eugene, et al.Spinal cord protective strategies during descending

and thoracoabdominal aortic aneurysm repair in the modern era: the role of intrathecal
papaverine

The 37th annual meeting of the Western thoracic surgical association, Colorado springs (2011)

Google Scholar

15

I. Kanako, I. Tamaki, K. Jan, et al.Potentiation of NGFinduced neurite outgrowth in PC12

cells by papaverine: role played by PLC-g, IP3 receptors

Brain Res, 1377 (2011), pp. 32-40

Google Scholar

16

W. McAuliffe, M. Townsend, J.M. Eskridge, D.W. Newell, M.S. Grady, H.R. WinnIntracranial
pressure changes induced during papaverine infusion for treatment of vasospasm

J Neurosurg, 83 (1995), pp. 430-434, 10.3171/jns.1995.83.3.0430

CrossRefView Record in ScopusGoogle Scholar

17

L.E. Hendrix, J.E. Dion, M.E. Jensen, C.D. Phillips, S.A. NewmanPapaverine-induced
mydriasis

AJNR Am J Neuroradiol, 15 (1994), pp. 716-718

View Record in ScopusGoogle Scholar

18

J.D. Barr, J.M. Mathis, J.A. HortonTransient severe brain stem depression during

intraarterial papaverine infusion for cerebral vasospasm

AJNR Am J Neuroradiol, 15 (1994), pp. 719-723

View Record in ScopusGoogle Scholar

19

S. Reddy, D.R. Goldman, A. Kaines, J.P. Hubschman, D. SarrafIntracisternal irrigation of
papaverine leading to choroidal infarction

Arch Ophthalmol, 127 (11) (2009), pp. 1550-1551, 10.1001/archophthalmol.2009.279

View Record in ScopusGoogle Scholar

20

M. Sawada, N. Hashimoto, T. Tsukahara, S. Nishi, Y. Kaku, S. YoshimuraEffectiveness of
intra-arterially infused papaverine solutions of various concentrations for the treatment of
cerebral vasospasm

Acta Neurochir (Wien), 139 (1997), pp. 706-711

View Record in ScopusGoogle Scholar

21

R.S. Polin, C.A. Hansen, P. German, J.B. Chadduck, N.F. KassellIntra-arterially administered
papaverine for the treatment of symptomatic cerebral vasospasm

Neurosurgery, 42 (1998), pp. 1256-1264

View Record in ScopusGoogle Scholar

22

Q. Liu, J. Liu, P. Wang, et al.Poly-dimensional network comparative analysis reveals the

pure pharmacological mechanism of baicalin in the targeted network of mouse cerebral
ischemia

Brain Res, 1666 (2017), pp. 70-79, 10.1016/j.brainres.2017.04.008

ArticleDownload PDFCrossRefView Record in ScopusGoogle Scholar

23

H. Dang, K. Li, Y. Yu, et al.Ariation of pathways and network profiles reveals the

differential pharmacological mechanisms of each effective component to treat middle
cerebral artery ischemia-reperfusion mice

Exp Biol Med (Maywood), 241 (2016), pp. 79-89, 10.1177/1535370215594584

CrossRefView Record in ScopusGoogle Scholar

24

J. Liu, Z.J. Zhang, C.X. Zhou, et al.Outcome-dependent global similarity analysis of

imbalanced core signaling pathways in ischemic mouse hippocampus

CNS Neurol Disord – Drug Targets, 11 (2012), pp. 1070-1082

View Record in ScopusGoogle Scholar

25

Z. Wang, Z.W. Jing, C.X. Zhou, et al.Fusion of core pathways reveals a horizontal

synergistic mechanism underlying combination therapy

Eur J Pharmacol, 667 (1–3) (2011), pp. 278-286, 10.1016/j.ejphar.2011.05.046

Epub 2011 Jun 1

ArticleDownload PDFCrossRefView Record in ScopusGoogle Scholar

26

Y. Chen, C. Zhou, Y. Yu, et al.Variations in target gene expression and pathway profiles in

the mouse hippocampus following treatment with different effective compounds for
ischemia-reperfusion injury

Naunyn Schmiedebergs Arch Pharmacol, 385 (8) (2012), pp. 797-806, 10.1007/s00210-012-

0743-1

CrossRefView Record in ScopusGoogle Scholar

27

Y. Chin, M. Kishi, M. Sekino, et al.Involvement of glial P2Y₁ receptors in cognitive deficit

after focal cerebral stroke in a rodent model

J Neuroinflammation, 10 (2013), p. 95, 10.1186/1742-2094-10-95

View Record in ScopusGoogle Scholar

28

X. Chen, X. Zhang, Y. Wang, et al.Inhibition of immunoproteasome reduces infarction

volume and attenuates inflammatory reaction in a rat model of ischemic stroke

Cell Death Dis (2015), p. 6e1626, 10.1038/cddis.2014.586

Google Scholar
29

H.M. Homi, W.L. Jones, F. de Lange, G.B. Mackensen, H.P. GrocottExacerbation of systemic

inflammation and increased cerebral infarct volume with cardiopulmonary bypass after
focal cerebral ischemia in the rat

J Thorac Cardiovasc Surg, 140 (3) (2010), pp. 660-666, 10.1016/j.jtcvs.2009.10.063

666.e1

View Record in ScopusGoogle Scholar

30

S. Xu, X. CaoInterleukin-17 and its expanding biological functions Cell

Mol Immunol, 7 (3) (2010), pp. 164-174, 10.1038/cmi.2010.21

CrossRefView Record in ScopusGoogle Scholar

31

M. Gelderblom, A. Weymar, C. Bernreuther, et al.Neutralization of the IL-17 axis diminishes

neutrophil invasion and protects from ischemic stroke

Blood, 120 (18) (2012), pp. 3793-3802, 10.1182/blood-2012-02-412726

ArticleDownload PDFCrossRefView Record in ScopusGoogle Scholar

32

J.H. Kim, H.J. Yi, Y. Ko, Y.S. Kim, D.W. Kim, J.M. KimEffectiveness of papaverine cisternal

irrigation for cerebral vasospasm after aneurysmal subarachnoid hemorrhage and
measurement of biomarkers

Neurol Sci, 35 (5) (2014), pp. 715-722, 10.1007/s10072-013-1589-0

ArticleDownload PDFCrossRefView Record in ScopusGoogle Scholar

33

J.W. Hwang, Y.T. Jeon, Y.J. Lim, H.P. ParkSevoflurane postconditioning-induced anti-

inflammation via inhibition of the toll-like receptor-4/nuclear factor kappa B pathway
contributes to neuroprotection against transient global cerebral ischemia in rats

Int J Mol Sci, 18 (11) (2017), 10.3390/ijms18112347

Google Scholar
34

F. Jin, J. XingCirculating pro-angiogenic and anti-angiogenic microRNA expressions in

patients with acute ischemic stroke and their association with disease severity

Neurol Sci, 38 (11) (2017), pp. 2015-2023, 10.1007/s10072-017-3071-x

CrossRefView Record in ScopusGoogle Scholar

35

D. Petrovic-Djergovic, S.N. Goonewardena, D.J. PinskyInflammatory disequilibrium in
stroke

Circ Res, 119 (2016), pp. 142-158, 10.1161/CIRCRESAHA.116.308022

View Record in ScopusGoogle Scholar

36

A. Rayasam, M. Hsu, G. Hernandez, et al.Contrasting roles of immune cells in tissue injury

and repair in stroke: the dark and bright side of immunity in the brain

Neurochem Int, 107 (2017), pp. 104-116, 10.1016/j.neuint.2017.02.009

ArticleDownload PDFView Record in ScopusGoogle Scholar

37

F. Takata, S. Dohgu, J. Matsumoto, et al.Brain pericytes among cells constituting the blood-

brain barrier are highly sensitive to tumor necrosis factor-alpha, releasing matrix
metalloproteinase-9 and migrating in vitro

J Neuroinflammation, 8 (2011), p. 106, 10.1186/1742-2094-8-106

CrossRefView Record in ScopusGoogle Scholar

38

R. Liu, H.M. Lauridsen, R.A. Amezquita, et al.IL-17 promotes neutrophil-mediated

immunity by activating microvascular pericytes and not endothelium

J Immunol, 197 (6) (2016), pp. 2400-2408, 10.4049/jimmunol.1600138

CrossRefView Record in ScopusGoogle Scholar

39
J.M. Menzie-Suderam, P. Mohammad-Gharibani, J. Modi, et al.Granulocyte-colony
stimulating factor protects against endoplasmic reticulum stress in an experimental model
of stroke

Brain Res, 1682 (2018), pp. 1-13, 10.1016/j.brainres.2017.12.022

ArticleDownload PDFView Record in ScopusGoogle Scholar

40

G. Weise, C. Pösel, K. Möller, et al.High-dosage granulocyte colony stimulating factor

treatment alters monocyte trafficking to the brain after experimental stroke

Brain Behav Immun, 60 (2017), pp. 15-26, 10.1016/j.bbi.2016.08.008

ArticleDownload PDFView Record in ScopusGoogle Scholar

41

X.M. Zhang, L. Zhang, G. Wang, et al.Suppression of mitochondrial fission in experimental

cerebral ischemia: the potential neuroprotective target of p38 MAPK inhibition

Neurochem Int, 90 (2015 Nov), pp. 1-8

ArticleDownload PDFCrossRefView Record in ScopusGoogle Scholar

42

Y. Yang, S.C. Kim, T. Yu, et al.Functional roles of p38 mitogen-activated protein kinase in

macrophage-mediated inflammatory responses

Mediat Inflamm, 2014 (2014), p. 352371, 10.1155/2014/352371

Google Scholar

43

C.L. Gibson, P.M. Bath, S.P. MurphyG-CSF reduces infarct volume and improves functional

outcome after transient focal cerebral ischemia in mice

J Cereb Blood Flow Metab, 25 (4) (2005), pp. 431-439

CrossRefView Record in ScopusGoogle Scholar

44

E.M. Boneberg, T. HartungMolecular aspects of anti-inflammatory action of G-CSF

Inflamm Res, 51 (3) (2002), pp. 119-128

View Record in ScopusGoogle Scholar

45

H. Kurinami, M. Shimamura, H. Nakagami, et al.A novel therapeutic peptide as a partial

agonist of RANKL in ischemic stroke

Sci Rep, 6 (2016), p. 38062, 10.1038/srep38062

Google Scholar

Bibliografie

https://www.sciencedirect.com/science/article/pii/S1347861320300724