Accepted Manuscript

Investigation of the potential of a membrane bioreactor followed by solar Fenton

oxidation to remove antibiotic-related microcontaminants

P. Karaolia, I. Michael-Kordatou, E. Hapeshi, J. Alexander, T. Schwartz, D.

Fatta-Kassinos

PII: S1385-8947(16)30563-0
DOI: http://dx.doi.org/10.1016/j.cej.2016.04.113
Reference: CEJ 15119

To appear in: Chemical Engineering Journal

Please cite this article as: P. Karaolia, I. Michael-Kordatou, E. Hapeshi, J. Alexander, T. Schwartz, D. Fatta-
Kassinos, Investigation of the potential of a membrane bioreactor followed by solar Fenton oxidation to remove
antibiotic-related microcontaminants, Chemical Engineering Journal (2016), doi: http://dx.doi.org/10.1016/j.cej.
2016.04.113

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
 Investigation of the potential of a membrane bioreactor followed by solar Fenton

oxidation to remove antibiotic-related microcontaminants

P. Karaolia1,2, I. Michael-Kordatou1, E. Hapeshi1, J. Alexander3, T. Schwartz3, D. Fatta-

Kassinos1,2*.

1
Department of Civil and Environmental Engineering and Nireas-International Water Research Centre,

School of Engineering, University of Cyprus, P.O. Box 20537, 1678 Nicosia, Cyprus.
2
Nireas-International Water Research Center, University of Cyprus, P.O. Box 20537, Nicosia, Cyprus.
3
Institute of Functional Interfaces, Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1,

Eggenstein-Leopoldshafen, 76344, Germany

*Corresponding author

Email: [email protected]; Tel: +357 22893515; Fax: +357 22895319

Abstract

There is limited research regarding alternative technologies of controlling the presence of

antibiotic residues and antibiotic tolerance/resistance in urban wastewater treatment plants

(UWTPs). This study deals with the efficiency of a Membrane BioReactor integrated with

solar Fenton oxidation for the removal of selected antibiotic-related microcontaminants, at a

pilot scale. More specifically, the aspects examined in this study included: i) the removal of

three antibiotics, namely sulfamethoxazole (SMX), erythromycin (ERY) and clarithromycin

(CLA) ii) the prevalence of total and antibiotic-tolerant bacteria iii) the total DNA and

antibiotic resistance gene (ARG) removal efficiency of the integrated process, as well as the

abundance of taxon-specific markers. The quantitative examination of the presence of

antibiotic residues in the MBR treated effluent revealed a concentration of SMX of 5.5 ng L-
1
, of CLA of 7.2 ng L-1 while ERY concentration was below the limit of detection (LOD).

1
Due to the low antibiotic concentrations in the MBR effluent, spiking of the examined

antibiotics (100 µg L-1) was done to examine their photo-persistence after solar Fenton

oxidation. SMX and ERY concentrations were below the LOD after t30w,n=119.2 minutes

while CLA was reduced by 84%. Total and antibiotic-tolerant cultivable bacteria E. coli and

Klebsiella spp. were completely inactivated. On the other hand there was repair of

Pseudomonas aeruginosa observed, with 2 CFU 100 mL-1 growing on the selective media 24

hours after solar Fenton oxidation. The total DNA concentration was reduced by 97%, while

in the remaining total DNA determined after treatment, the Enterococcus spp. specific gene

marker (3.9 log10 CE 100 ng-1 DNA), and the ARG sul1 and ermB (1.56 and 1.53 log10 CE

100 ng-1 DNA respectively) were still present, indicating the further challenge of their

removal.

2
1. Introduction

Antibiotic resistance is a natural phenomenon which has been acknowledged as a public

health challenge over the last years, due to its acceleration by the selective pressure exerted

because of the use and misuse of antibiotic agents in humans and animals [1]. Multiple

reservoirs and paths of antibiotic resistance dissemination have been identified, among which

are urban wastewater treatment plants (UWTPs), which have been acknowledged as

important antibiotic resistance contributors [2,3]. The progressive spread and accumulation of

antibiotic compounds and of their metabolites in conventionally treated wastewater effluents

may lead to their presence in natural and artificial aquatic environments at sub-inhibitory

concentrations, contributing to the selection, evolution and spread of antibiotic resistance in

commensal and pathogenic bacteria [4]. In addition to the selective pressure induced by sub-

inhibitory antibiotic concentrations (below minimum inhibitory concentrations, MIC) which

is exerted on wastewater bacterial populations, the direct contact of antibiotic

tolerant/resistant bacteria and their associated resistance genes (ARB & ARG) released in

urban wastewater effluents with environmental aquatic bacteria may contribute to the

development and exchange of novel mechanisms of antibiotic tolerance/resistance from one

bacterial community to another, making UWTPs ‘hotspots’ of antibiotic resistance [5]. These

acquired gene transfer mechanisms may enable the development of bacterial

tolerance/resistance to multiple classes of antibiotics, often equipping the bacteria with

multidrug tolerance/resistance [6], threatening the successful treatment of nosocomial

infections [7].

The Membrane BioReactor (MBR) technology is widely accepted as alternative technology

to conventional activated sludge treatment for the recovery of highly clarified wastewater

effluent [8]. Its wide use has been attributed to its notable advantages in comparison with the

3
conventional activated sludge (CAS) process, including high biodegradation capacity and

efficiency, as well as low sludge production, low cost and simplicity of construction. In order

to ensure a high quality and according to current standards effluent, a ‘multiple-barrier

approach’ [9] may be adopted, with MBR as the first barrier followed by a post-treatment,

such as an Advanced Oxidation Process (AOP), i.e. the solar Fenton treatment, which aims at

polishing the MBR effluent through non-selective oxidation of persistent microcontaminants

through the production of hydroxyl radicals (HO•) [10]. Such integration of technologies aims

at targeting a larger variety of microcontaminants than a single technology would do, while

improving the quality of the final treated effluent compared to conventionally treated

effluent. The high suspended solid (SS) removal (>99%) by the MBR technology when

compared to the CAS process, enhances the further application efficiency of the applied

AOP, improving the end-result as to the removal of microcontaminants [11]. The increase in

efficiency has been attributed to the removal of light-scattering solids which reduce bacterial

removal efficiency. These solids have been shown to agglomerate with pathogenic influent

wastewater bacteria, providing them with physical protection against applied treatment

[12,13].

A study by Michael et al. [14] examined the inactivation of total and antibiotic-resistant (AR)

enterococci by a pilot-scale solar Fenton treatment in a real urban wastewater effluent. The

applied treatment led to a complete inactivation of total and AR enterococci in the presence

of ofloxacin and trimethoprim after 120 minutes of solar Fenton treatment, using a Fe2+

concentration of 5 mg L-1 and an H2O2 concentration of 75 mg L-1. Additionally, a study by

Rodríguez-Chueca et al. [15] evaluated the reduction of Escherichia coli and Enterococcus

faecalis in secondary wastewater effluents with the solar Fenton process, at a pilot scale

under natural sunlight. A complete bacterial inactivation (3-log reduction) was demonstrated

at a UV-A dose of 24-30 kJ L-1 at pH 5 (near-neutral conditions) and 2-20 kJ L-1 at pH 3.

4
Furthermore, Ferro et al. [16] examined the removal of a multidrug-resistant strain of E. coli

to ampicillin, ciprofloxacin and tetracycline by photo-Fenton at pH 4 under natural sunlight

in secondary urban wastewater at a pilot scale. A complete inactivation was observed after 20

minutes using Fe2+ and H2O2 concentrations of 0.090 and 0.294 mM respectively. However,

the survival of bacteria due to the presence of repair mechanisms and the re-growth potential

of the examined types of bacteria after their inactivation has not been extensively examined.

Moreover, despite the availability of numerous studies on the effect of AOPs on ARB [17–

22] there is very limited published research available on the impact of alternative biological

treatments such as the MBR and of AOPs on the prevalence of ARG. More specifically,

Yang et al. [23] investigated the transfer of the RP4 plasmid in a bench-scale MBR by

horizontal gene transfer. The results showed an average transfer frequency of the examined

plasmid from donor strain to cultivable bacteria in activated sludge of 2.76 x 10-5 per

recipient. In addition, Zhang et al. [24] investigated the reduction of the sul1, tetX, tetG, int1

and 16S rRNA genes in a urban secondary effluent treated with Fenton oxidation at a bench

scale, at a molar ratio of Fe2+/H2O2 of 0.1 at pH 3. The results of this study showed a 2.58-

3.79 log removal of the target genes after 2 hours.

No studies have been conducted so far in the framework of an alternative integrated urban

wastewater treatment approach, to examine the removal of antibiotics and other antibiotic-

related microcontaminants, such as tolerant bacteria to environmentally-relevant antibiotic

concentrations, ARB & ARG. Consequently, the aim of this study was to explore the

potential of integrating the MBR process with solar Fenton oxidation at a pilot scale, for the

removal of the macrolide antibiotics clarithromycin (CLA) and erythromycin (ERY), and of

the sulfonamide antibiotic sulfamethoxazole (SMX), while antibiotic tolerance prevalence

patterns of Pseudomonas aeruginosa, E. coli and Klebsiella spp. were investigated in solid

5
selective media containing these antibiotics, at antibiotic-relevant concentrations.

Furthermore, the quantification of the total DNA content in treated wastewater samples was

performed and q-PCR molecular analysis was employed to investigate the presence of

selected taxon-specific markers and ARG of interest.

2. Materials and methods

2.1. Chemicals and reagents

The standards of the antibiotic compounds were of high purity (≥98%) and were purchased

from Fluka Analytical (CLA, [CAS number 81103-11-9], ERY, [CAS number 114-07-8] and

SMX, [CAS number 723-46-6]). The reagents used in the solar Fenton experiments were

FeSO4·7H2O (Sigma Aldrich) and H2O2 (30% w/w, Merck). The pH was adjusted with 1M

H2SO4 (Sigma Aldrich) at 2.8. Ultra-pure water (Milli-Q) and LC/MS-grade solvents such as

methanol (Merck) and formic acid (Merck) were used for the chromatographic analysis.

For the determination of the antibiotics after solar Fenton through chromatographic analysis,

the Fenton reaction was stopped using methanol, while for the determination of DOC and

COD the H2O2 was removed using sodium sulfite (Na2SO3) and manganese oxide (MnO2),

respectively (Sigma Aldrich). For the microbiological analysis, the residual H2O2 of the

treated solution was removed with catalase solution (Micrococcus lysodeikticus, Fluka) after

neutralization with 2M NaOH (Himedia). The presence of H2O2 in samples was checked with

the use of Quantofix Peroxid 100 (Sigma Aldrich).

2.2. Experimental setup and procedure

2.2.1. Pilot-scale MBR unit

The pilot-scale MBR unit, located at the University of Cyprus premises in Nicosia, Cyprus, is

designed to treat 10 m3 day-1 of sewage. The wastewater is pumped into the MBR system

6
with the use of a self-priming feed pump through a basket screen with 2 mm openings,

installed inside the MBR. A constant supply of air provides content mixing and enhanced

oxidation of organic carbon substances with the use of two blowers (33 m3 h-1) in pre-

aeration tank and the MBR section. There are 25 flat-sheet membrane cartridges (Kubota,

Japan) each with an effective membrane surface area of 0.8 m2 (total effective membrane

surface area 100 m2) and the membrane nominal pore diameter is 0.4 µm. The polymeric

material of the membrane structure is chlorinated polyethylene. The final effluent is pumped

out of the MBR unit via a permeate pump, into the solar system storage tank with the help of

a peristaltic pump.

The optimization of the MBR operation was accomplished through the establishment of the

optimum sludge retention time (SRT) and hydraulic retention time (HRT), which were

estimated to be 30 days and 9 hours respectively, for the most efficient reduction of dissolved

organic carbon (DOC) content. More specifically, the optimization was based on the

necessary time for the mixed liqueur suspended solids (MLSS) to act on the influent

wastewater followed by the filtration of the treated wastewater, for the optimum DOC

removal. The physicochemical and microbiological characteristics of the influent wastewater

of the MBR reactor are given in Table 1. As shown in Table 1, the inherent antibiotic

concentrations MBR influent were in the ng L-1 level, with 540 ng L-1 for SMX, ERY was 92

ng L-1 and CLA was 43 ng L-1.

2.2.2. Solar Fenton pilot plant

The experiments of the solar photocatalytic degradation were conducted in a compound

parabolic collector (CPC) pilot plant which consists of 6 mounted glass tubes (55 mm x 1.5

m) on a fixed platform, which is situated at an angle (35°) of the local latitude and has a total

volume of 60 L (CT) [25]. The reflective surface is constructed of resistant and highly

7
reflective polished aluminium. The wastewater flows directly from one tube to the other

through a meandering flow into a reservoir tank and is returned to the collectors through a

centrifugal pump, in a closed circuit at a flow rate of 150 L h-1. The total irradiated tube

volume is 21.4 L (Vi), while the rest consists of the dead reactor volume including the

reservoir tank and the piping.

The UV solar irradiation was recorded continuously throughout the experimental procedure,

through a UV radiometer (UV_air_ABC, Scitec Instruments) mounted on the CPC platform.

The solar irradiation data was compared on different days and at different times of the day

under different solar irradiation conditions with the use of “normalised illumination time”

(equation 1) [26].
 

, =
, + 
  
∆tn = tn – tn-1 Equation 1

In the above equation, t30W,n and t30W,n-1 are the adjusted experimental times according to UV

energy (kJ L-1) at experimental times tn and tn-1, respectively. The value of 30 refers to a

constant solar UV power of 30 W m-2, the typical solar UV power on a sunny day around

noon. UV is the average incident solar ultraviolet irradiation of the irradiated area (λ < 400

nm) measured between experimental times n and n-1. ∆tn is the experimental time for each

sample, while Vi is the irradiated sample volume (L) and Vt is the sample total volume (L).

During the loading of the reactor with the chemicals, the collectors were covered with a thick

UV resistant canvas to avoid any photoreaction. At the beginning, the reactor was filled with

the MBR treated effluent. Then, in order to examine the photo-persistence of the selected

antibiotics during solar Fenton oxidation, a predetermined volume of standard solution of

CLA, ERY and SMX was added to reach a concentration of 100 µg L-1 each, in mixture. This

concentration of antibiotics was spiked because the inherent concentration of antibiotics

inside the MBR effluent was too low to enable the accurate monitoring and quantification of

8
these antibiotics during solar Fenton treatment. More specifically, the concentration of SMX

in the MBR effluent used for solar Fenton treatment was 5.5 ng L-1, CLA concentration was

7.2 ng L-1 and ERY was found to be lower than the limit of detection (LOD).

After homogenization (15 min) a sample was taken, representing the initial antibiotic

concentration. The recirculation of the solution in the reactor was chosen to be 15 min, time

duration sufficient for good mixing, according to the operative flow rate and the detection of

the examined compounds at the outlet of the system. The pH was then adjusted (pH=2.8)

with 1M H2SO4 and the appropriate volume of ferrous solution was added. The iron

concentration used for the optimization was 5 mg L−1, which agrees with the Cypriot

regulation on iron discharge limits (Cypriot Law on Water and Soil Pollution Control,

106(I)/2002). Mixing followed for 15 min. Then, the predetermined amount of H2O2 was

added. The range of H2O2 evaluated in this study (20-100 mg L-1) was selected after careful

review of the relevant bibliography of solar Fenton treatment of municipal wastewater

effluents, in order to examine a H2O2 range which is appropriate as to degradation of organic

microcontaminants in urban wastewater [14,15,27].

A sample was taken after some minutes of dark Fenton (-15 min) process (zero-illumination

time, t0) and the collectors were uncovered. At this time solar Fenton process began. During

the process, samples were withdrawn at specified time intervals and were further analyzed.

2.3. Analytical methods

DOC was measured using a TOC analyser (Aurora 1030). COD determination was performed

using the Merck Spectroquant® kits (Merck). The determination and monitoring of H2O2 was

performed according to the method described by [28] which employs ammonium

metavanadate, with maximum absorbance at 450 nm. The monitoring of total iron residues

was performed according to the ISO method 6332, which makes use of 1, 10 phenanthroline

9
(Fluka). The photometric measurements were performed using a double beam UV-Vis Jasco

V-530 spectrophotometer.

The presence of the antibiotics in the treated samples was monitored on an ACQUITY TQD

UPLC-MS/MS system (Waters Corporation) equipped with a triple quadrupole mass

spectrometer (TQD, serial number QBA012), operated in positive electrospray (ESI) mode. A

BEH Shield RP18 column (1.7 µm; 2.1×50 mm; Waters) was used for the chromatographic

analysis with mobile phase consisting of water + 0.1% formic acid as eluent A and methanol

as eluent B. The elution gradient was 5% B (0 min), 5% B (1.5 min), 30% B (2 min), 50% B

(3 min), 70% B (5 min), 90% B (6 min), 90% B (7 min), 5% B (7.1 min), 5% B (9 min). The

flow rate was 0.3 mL min-1, and the sample injection volume was 20 µL. Data acquisition

was performed in a multiple reaction monitoring mode (MRM), recording the transitions

between the precursor ion and the most abundant fragment ions. The most abundant transition

product ion was typically used for quantification of the target compound, while the second

transition product together with the ratio of the intensities of the two transitions were used for

confirmation purposes (Table 2). The accurate mass and composition for the precursor and

the fragment ions were calculated using software MassLynxTM incorporated in the

instrument.

In order to quantify the inherent concentration of antibiotics in MBR influent and effluent,

solid phase extraction (SPE) for pre-concentration of analytes in samples was carried out

using Oasis HLB cartridges (3 cc, 60 mg) from Waters Corporation (Milford MA, USA). The

method of SPE has been described previously [29]. Target antibiotics in wastewater samples

were extracted off-line at inherent sample pH. Prior to the SPE procedure, the samples (100

mL) were filtered through a PVDF membrane filter (0.45 µm pores, Merck). The cartridges

were conditioned with 5 mL methanol and 5 mL ultra-pure water. After the conditioning, the

10
samples were percolated through the cartridges by gravity and then the cartridges were

washed with 5 mL water before being vacuum dried for 20 min. Finally, the analytes were

eluted with 8 mL methanol and the extracts were evaporated to dryness at 40 °C, under a

gentle stream of nitrogen and reconstructed in 1 mL of 25% methanol aqueous solution.

2.4. Enumeration of total bacteria and determination of bacterial antibiotic tolerance

Aliquots of samples taken from the treated wastewater were stored at 4 °C and were analysed

within 24 hours of sampling. Different selective media were prepared for each type of

microorganism examined. Hi-Chrome Klebsiella selective agar (Fluka) was prepared for

Klebsiella spp., Cetrimide agar (Fluka) was prepared for P. aeruginosa enumeration and

TBX agar (Fluka) was prepared for E. coli enumeration, according to the manufacturers’

instructions.

The selection of these three Gram-negative bacteria was based on the consensus that these

bacteria pose an important risk to public health among all bacteria, as there is a faster

increase in prevalence of Gram-negative ARB compared to prevalence of Gram-positive

ARB according to Kumarasamy et al. [30]. The increase in prevalence of resistance in Gram-

negative bacteria has been mainly due to mobile genetic elements like plasmids that can

readily spread through Gram-negative bacterial populations, with species such as Klebsiella

pneumonia and other members of the Enterobacteriaceae including E. coli prevailing in

tolerance/resistance to antibiotics around the world [31]. Moreover, the three bacterial types

E. coli, Klebsiella spp. and P. aeruginosa have been observed to have a frequent presence in

UWTP influents, as they are excreted through fecal pathways in urban domestic

environments [32] and they can survive and thrive throughout the conventional activated

sludge (CAS) wastewater treatment [33].

11
For the viability testing of the examined bacterial microorganisms, the LOD was determined

through the membrane filtration method. The LOD of E. coli and P. aeruginosa was 5 colony

forming units (CFU) 100 mL-1 and 3 CFU 100 mL-1 respectively, while the LOD of

Klebsiella spp. was 4 CFU 100 mL-1. The membrane filtration method was used for the

enumeration of total and AR cultivable bacteria in examined samples. Where necessary, such

as in the case of enumeration of bacteria in the MBR influent, sample serial dilutions were

performed at 1:10, 1:100 and 1:1000 using a sterile saline solution (NaCl, 0.85%) and diluted

samples were filtered using a sterile Millipore filtration apparatus, through cellulose acetate

membrane filters of a pore size of 0.45 µm (Millipore). The filters were then placed on the

prepared solid agar medium, and incubated at 37 °C for 24 hours before enumeration. The

representative colonies were maroon for Klebsiella spp., milky yellow for P. aeruginosa

which are fluorescent under UV light and blue for E. coli.

For the evaluation of the fate of tolerance of examined bacteria to environmentally relevant

concentrations of antibiotics in the influent wastewater in the MBR and after MBR followed

by solar Fenton, the prepared agar was spiked with 100 µg L-1 of each antibiotic (or all

antibiotics in the case of the mixture). This concentration of antibiotics was chosen as it is

slightly higher than the environmentally relevant antibiotic concentrations [34] and is at the

range of concentration at which bacteria would potentially only be sub-lethally injured, which

would give them the opportunity to repair antibiotic-induced damage and subsequently

survive [35]. As a result, only tolerant bacteria are present, while susceptible bacteria are

killed or affected in growth, enabling this study to investigate solely the prevalence of

bacterial antibiotic tolerance after the integrated treatment. The colonies which grew on each

selective agar containing each antibiotic separately and in mixture, were considered tolerant

to the individual antibiotic or to the antibiotic mixture present. The prevalence of antibiotic

tolerance in each respective bacterial population (E. coli, P. aeruginosa and Klebsiella spp.)

12
was expressed as the ratio of enumerated antibiotic-tolerant CFU (in presence of the selected

antibiotic(s)) to the total enumerated CFU (no antibiotic(s) present) (Equation 2):

  ! " #$% $&'$((*)

  


 =   ! " #$%',$ $&'$((*)
Equation 2

In addition to the effect of recirculation inside the reactor in the dark, and of solar light alone

on the bacterial population, a control sample was taken prior to light exposure which was

kept in the dark, and plated out twice, once at the time of sampling and once at the end of the

experiment. This control ensured the cell viability without any of the treatments. Moreover,

additional samples were taken at the end of the solar Fenton experimental process, in order to

observe recovery of sub-lethally injured cells. The liquid samples were placed in a sterile

container and sealed, followed by incubation at 37 °C for 24 hours before being serially

diluted in tryptic soy broth (TSB) and plated onto the solid media not containing antibiotic.

Any colonies grown on the non-selective media were subsequently examined for tolerance to

the examined antibiotics, by spreading them on selective media containing the antibiotics of

interest, separately and in mixture.

2.5. Determination of total genomic DNA and of ARG

After MBR and solar Fenton treatment, obtained samples were stored at 4 ºC in the dark until

molecular analysis, within 24 hours of sampling.

The DNA extraction took place using the PowerWater® DNA isolation Kit (MoBio)

following filtration of the samples with 45 mm diameter, 0.22 µm polycarbonate filter

membranes (Millipore). The amount and purity of the DNA extracts was measured using the

NanoDrop ND-1000 instrument (PEQLab BioTechnology, Erlangen, Germany).

13
The microbial density can be indicated through the determination of the DNA content inside

a water matrix, where the dissemination and exchange of clinically relevant ARG among

non-pathogenic bacterial fractions can take place via horizontal gene transfer, contributing to

the risk of the spread of antibiotic resistance in the aquatic environment [36,37]. Therefore,

the DNA concentration evaluation and the calculation of log10 cell equivalent values (CE)

comprise a consistent means of assessment of the overall relative abundance and genetic flux

in bacterial communities of the examined water environments.

For the quantitative PCR (q-PCR) analysis, the specific primers used to quantify ARG and

opportunistic bacteria in 100 ng of total DNA are given in Table 3. The q-PCR assessment

was carried out using the Bio-Rad CFX 96 TouchTM Real-Time PCR Detection System. The

samples were tested against specific selected gene primers, which are specific to wastewater

native bacterial species, using the Kapa SYBR system by absolute quantification, per 100 ng

of total DNA. A 20 µL qPCR reaction mixture was prepared for each sample, containing 10

µL of Kapa SYBR fast qPCR master mix (PeqLab, Erlangen, Germany), 5 µL of BSA, 1 µL

of forward and reverse primer (5 µM), and 3 µL of genomic DNA template. All analyses

were repeated in duplicate and a control without the sample template was tested for each

sequence. The PCR protocol used includes 95 °C (3 minutes) followed by 95 °C (10

seconds), 60 °C (30 seconds) 39 times for annealing of the primers and elongation.

Fluorescence was measured after every elongation/annealing step. To determine the

specificity of the amplification, a melting curve was added by raising the temperature from

65 °C to 95 °C with an increment of 0.5 °C for 5 seconds. A threshold above the background

was chosen to determine the significant increase in fluorescence produced by the

amplification. The point where the signal intersected the threshold line determines the

threshold cycle (Ct). For the determination of the gene absolute abundance, calibration curves

derived from different ARB carrying the genetic targets of interest were used. Serial dilutions

14
of reference strains were made to determine the correlation between plate count experiments

and Ct values. Using these curves, the measured Ct values of ARG or taxon-specific gene

markers from water samples can be converted into CE [37,38]. In order to conduct a more

direct comparison of gene relative abundance across samples, the obtained results were

normalized to account for the CE per mass of extracted DNA (CE per 100 ng of DNA).

3. Results and discussion

3.1. Removal of selected antibiotics and DOC

3.1.1. Assessment of MBR efficiency

The MBR influent antibiotic concentrations can be found in Table 1. The influent SMX

concentration in the MBR was 540 ng L-1, while the observed average removal percentage of

SMX in the MBR treated effluent was 98% (average Ceff=5.5 ng L-1). A lower removal of

SMX by MBR was demonstrated by Radjenovic et al. [39] who observed a removal of SMX

of 60.5% in a 21 L pilot-scale MBR unit treating real municipal wastewater (flat sheet fibres,

nominal pore size 0.4 µm, surface area 0.106 m2), whose HRT was 14 hours and SRT was

infinite due to no discharge of sludge from the reactor. Moreover, Sahar et al. [40] observed a

removal of SMX by 70% after MBR treatment of municipal wastewater in a reactor with a

volume of 110 L, an HRT of 9-12 hours and SRT of >70 days (immersed hollow fibres,

surface area 2 m2). Also, Dolar et al. [41] reported a similar removal of SMX (69%) in a

pilot-scale MBR treating municipal wastewater (flat sheet fibres, nominal pore size 0.4 µm,

surface area 8 m2), which had an HRT of 12.5 hours and an SRT of 45 days, attributing this

removal to a moderate sorption to sludge and to limited biodegradability.

The influent average CLA concentration was 43 ng L-1 whereas its average removal was high

in this study with 83% (average Ceff=7.2 ng L-1). Generally, CLA is a highly recalcitrant

compound with low observed elimination efficiencies in conventional UWTPs worldwide,

15
with an elimination percentage of less than 20% [42]. CLA was removed by 50% in a real

MBR influent via sorption of the macrolide on activated sludge in a study by Abegglen et al.

(flat sheet membranes, nominal pore size 0.04 µm, HRT 6.3 hours, SRT >150 days, total

volume 1.5 m3, surface area 4 m2) [43], but in an MBR pilot plant in another study (HRT 13

hours, SRT 60-80 days, flat sheet fibre membranes, nominal pore size 0.4 µm) even at high

HRT conditions the range of its removal remained low around 11-14% [44],. According to

this study, the varying results in MBR removal of macrolide antibiotics (CLA and ERY) may

be attributed to their partial enclosure in faeces and bile particles during their entrance in the

MBR, followed by their potential release/storage in the mixed liqueur suspended solids

(MLSS) during biological treatment, causing the concentration under- or overestimation of

their load, if only the dissolved fraction is considered. On the other hand, Sahar et al. [40]

observed a removal of CLA by 91.4%, a removal which is similar to the one observed in this

study. The high removal rates in that study were attributed to the relatively high biomass

concentration in the MBR (MLSS>4000 mg L-1), which enhances biological degradation and

removal of CLA through the existence of binding sites on the MLSS, enabling the rate of

CLA sorption to increase. Also, they reported that removal does not change with further

increases in biomass concentration.

ERY average influent concentration was 92 ng L-1 , while the ERY concentration in the MBR

effluent was was found to be lower than the LOD, which is in agreement with Sahar et al.,

[40] who observed a removal of 91% of ERY after MBR treatment of a raw urban influent

feed. On the other hand, Radjenović et al., [45] investigated the removal of ERY by two

MBR configurations, a flat-sheet (FS) and a hollow fibre (HF) configuration (HRT 15 and 7.2

hours, total volume 4.7 and 3.6 m3, nominal pore size 0.4 µm and 0.05 µm, respectively) and

observed that the ERY removal was 42-52% by the FS configuration, while the HF

configuration achieved an elimination of 25-109% of the antibiotic in the aqueous phase.

16
Moreover, Dolar et al., [41] observed a removal of ERY by 75% after a pilot-scale MBR

treatment and the large variation in removal was attributed to the adsorption/desorption

processes of the antibiotics on the MLSS, the diversified microbial activity and the balance

between these two processes. Moreover, in real urban wastewater treatment conditions the

adsorption/desorption processes on antibiotics depend on a combination of different

degradation rates in both the aqueous and solid phase. Despite the observation of sorption of

the investigated antibiotics by various authors on the MLSS inside MBR units, this was not in

the scope of research in this study, as this study aims to focus on the effluent quality of MBR

regarding antibiotic-related microcontaminants.

Regarding mineralization, the DOC removal efficiency of the MBR was assessed. The DOC

was reduced to an average concentration of DOCeff=8.8 mg L-1, exhibiting a removal of 79%

(average DOCinf=42.7 mg L-1). In a similar manner, in a study by [45] the influent

concentration of 67.67 mg L-1 was treated by a pilot-scale MBR with a removal of 84%, with

a final concentration of 10.89 mg L-1.

3.1.2. Assessment of solar Fenton process efficiency

In order to monitor the photo-persistence of the examined antibiotics during solar Fenton

oxidation, 100 µg L-1 of each antibiotic was spiked, in mixture in the MBR effluent. This

concentration of antibiotics was spiked, due to the fact that the inherent concentration of

antibiotics inside the MBR effluent was too low to enable accurate quantification after solar

Fenton treatment. More specifically, the concentration of SMX in the MBR effluent was 5.5

ng L-1, CLA concentration was 7.2 ng L-1 and ERY concentration was lower than the LOD.

Prior to the solar Fenton experiments, preliminary trials were performed to determine the

effect of dark recirculation of the MBR effluent in the pilot-scale reactor on the degradation

17
of spiked antibiotics (hydrolysis) at a concentration of 100 µg L-1, as well as the effect of

natural solar light alone on the target antibiotics (photolysis). The duration of the hydrolysis

and photolysis experiments was the same as the duration of the solar Fenton experiments, in

order to establish the contribution of their effect on the overall antibiotic removal. Hydrolysis

experiments showed no significant effect on spiked antibiotics (100 µg L-1) for a total of 3

hours in the dark (removal<8%). Photolytic experiments resulted in a <12% reduction in the

three antibiotic concentrations, after a total of 3 hours of irradiation. The conduction of the

above experiments ensured that subsequent results would be solely due to the solar Fenton

treatment.

Following, solar Fenton photo-oxidation experiments were conducted in the presence of

various H2O2 concentrations ranging from 20 mg L-1 to 100 mg L-1, to establish the best H2O2

dose for the evaluation of the photo-persistence of the examined antibiotics. The complete

removal of ERY and SMX was accomplished with [H2O2]0=50 mg L-1 within t30W,n=119.2

minutes. The oxidant concentrations below this one were consumed very fast during the solar

Fenton treatment, and concentrations above this were too high and in excess throughout the

procedure, scavenging thus the produced HO•. The established optimum conditions of the

solar Fenton oxidation (i.e. [Fe2+]0= 5 mg L-1, [H2O2]0=50 mg L-1) were then used to examine

the efficiency of the solar Fenton process on the removal of antibiotics, ARB, total genomic

DNA and ARG in the MBR wastewater effluent.

The removal of the examined antibiotics by the solar Fenton process is shown in Figure 1.

SMX was completely removed by solar Fenton at the end of the treatment (t30w,n=119.2

minutes). Various authors have investigated the degradation of SMX by photo-Fenton

oxidation. More specifically, Prieto-Rodríguez et al. [46] investigated the effect of the pilot-

scale solar Fenton process ([Fe2+]=5 mg L-1, [H2O2]=60 mg L-1) on the inherent concentration

18
of various pharmaceutical compounds inside a real secondary municipal wastewater effluent,

among which was SMX (603-780 ng L-1). A complete removal was exhibited by the applied

solar Fenton treatment. In another study by Klamerth et al. [47], degradation of SMX was

investigated at a pilot-plant scale in a real municipal effluent, with an initial SMX

concentration of 100 µg L-1. The results showed a complete removal of SMX after 10 t30W,n

minutes.

CLA on the other hand, exhibited lower removal, as this reached 84% after the treatment by

solar Fenton. This behaviour by CLA has been observed before by Giannakis et al. [48], who

conducted photo-Fenton experiments on the removal of a range of pharmaceuticals including

CLA. According to that study, CLA showed the lowest degradation rates at the end of the

process, out of all compounds investigated, including carbamazepine, metoprolol and

diclofenac. The persistent behaviour of CLA may be attributed to its high molecular weight

(748 g mol-1) and its saturated structure, making its degradation difficult. A low removal of

CLA was also observed by Neamţu et al. [49] in a bench-scale study of the removal of

various pharmaceuticals by photo-Fenton, using simulated irradiation in milliQ water. More

specifically, the removal of CLA after the completion of the photo-Fenton treatment was less

than 80%, while its molecule stability was high even after 30 minutes of treatment, meaning

that the majority of the CLA molecules found in solution could not be de-stabilized and

eventually transformed or degraded with the applied treatment.

Interestingly, ERY exhibited different degradation behaviour compared to CLA, and its

removal by solar Fenton was complete after t30w,n=119.2 minutes. The removal of ERY was

investigated by Mackuľak et al. [50], who treated an UWTP secondary effluent with the

photo-Fenton at a bench scale. The results have shown a complete removal of the compound

after 60 minutes of treatment. A study by Chen et al. [51] investigated the degradation of

19
ERY in an ERY-containing wastewater, and the results showed an interruption of the sixteen-

membered ring of ERY molecule after 30 minutes of photo-Fenton treatment and a complete

removal of ERY.

In further experiments, the potential of the solar Fenton process in removing DOC was

examined. The examined DOC concentration is considered the inherent wastewater DOC, as

the spiked antibiotic concentrations were too low to contribute to the overall DOC

concentration. More specifically, the average removal of DOC in the treated wastewater was

53% after t30W,n=119.2 minutes (DOCfinal=4.1 mg L-1), which is in agreement with De la Cruz

et al. [52], where photo-Fenton process in wastewater effluents was applied to examine the

removal of a range of pharmaceuticals, and their mineralization potential. More specifically,

the final concentration of DOC in this study reached 12.9 mg L-1 after 90 minutes of

treatment. Moreover, Neamţu et al. [49] achieved a lower DOC removal percentage (48.8%)

than the one obtained in this study after the conduction of lab-scale photo-Fenton

experiments for the removal of eight pharmaceutical compounds, with the Fenton reagents

present at a 10:1 ratio of H2O2:Fe(II). Moreover, the removal efficiency by Michael et al. [14]

was 21% by solar Fenton of an urban wastewater effluent (Ceff=6.29-8.60 mg L-1).

3.2. Removal and inactivation of total cultivable bacteria and determination of bacterial

antibiotic tolerance

3.2.1. Assessment of MBR efficiency

The total colony counts (including both, antibiotic-tolerant and antibiotic-susceptible colony

counts) for selected bacteria were enumerated in the MBR influent (Table 1). The total E. coli

concentration was 2 x 107 CFU 100 mL-1, while the total P. aeruginosa population was 4 x

108 CFU 100 mL-1. Finally, the total Klebsiella spp. population was 2 x 10 8 CFU 100 mL-1.

20
Next, the antibiotic tolerance patterns were characterised in the MBR influent, and they can

be seen in Figure 2.

The patterns of bacterial tolerance to environmentally-relevant antibiotic concentrations

observed in the MBR influent are given in Figure 2, as the ratio of prevalence of antibiotic-

tolerant bacteria to the total cultivable enumerated bacterial population (Equation 2). It was

observed that the highest prevalence of all three types of bacteria examined was in the

presence of SMX, while the lowest prevalence of antibiotic tolerance was in the mixture of

all three antibiotics. This observed pattern might be due to the lack of a presence of antibiotic

coping mechanisms to the synergistic effects that a cocktail of antibiotics can produce, such

as the one used herein. Moreover, one type of bacterium may be tolerant to one antibiotic, but

this specific bacterial population may be damaged or killed while in the presence of the

mixture present, thus explaining the lower prevalence of resistance or tolerance in the

presence of the antibiotic mixture.

After the filtration step of the MBR treatment, the overall final bacterial concentration

decreased significantly, with more than 99% reduction of all examined types of bacteria (5-

log reduction of E. coli and 6 -log reduction of P. aeruginosa and Klebsiella spp.). Moreover,

no tolerant bacteria to the selected antibiotics were detected in the MBR effluent. More

specifically, the average final bacterial concentration was near the limit of detection, with an

average concentration of 2 CFU 100 mL-1 for E. coli, 4 CFU 100 mL-1 for P. aeruginosa and

3 CFU 100 mL-1 for Klebsiella spp. The very low bacterial counts in the MBR effluent can be

justified by the high removal potential exhibited by the size-exclusion step of the MBR,

which is the physical filtration step, retaining the bacterial bodies into the MBR reactor and

preventing their crossing into the filtered effluent. Despite the fact that the average size of E.

coli bacteria is 0.7 µm-1.1 µm, making them unable to cross the filtration membranes, any

21
bacteria that are smaller than this size, manage to pass through the MBR filtration membrane

with a pore size of 0.4 µm, to enter the receiving aquatic ecosystems [53]. These results are in

agreement with De Luca et al. [54], who also detected low counts of bacterial fecal

indicators such as E. coli and enterococci in the MBR effluent (0.1 log CFU 100 mL-1 and

0.11 log CFU 100 mL-1, respectively) in a full-scale MBR facility with 400 membrane

cartridges with a nominal membrane pore size of 0.4 µm. The few escaping bacteria from the

MBR treatment are the ones that once out of the wastewater treatment, if resistant to specific

antibiotics, may act as means of transfer of antibiotic resistance to surrounding environmental

communities of bacteria which have not been exposed to antibiotics before, or which contain

microorganism communities, which are still susceptible to antibiotics [55].

3.2.2. Assessment of solar Fenton process efficiency

The effect of dark treatment on the bacteria present in the MBR effluent was examined next

in order to establish any potential damage to present bacteria due to possible mechanical

damage caused by effluent recirculation in the pilot plant, for 3 hours. The results indicated

no difference in the bacterial population after recirculation of the MBR effluent in the pilot-

plant reactor in the dark. In addition, the effect of natural solar radiation alone on the bacteria

present in the MBR effluent was examined. It was observed that irradiation alone did not

induce an effect on the bacteria, as there were no changes in the bacterial concentrations of E.

coli, Klebsiella spp. and P. aeruginosa in the MBR effluent.

Solar Fenton was examined at the optimum Fenton reagent concentrations (i.e. [Fe2+]0= 5 mg

L-1, [H2O2]0=50 mg L-1). The solar Fenton treatment resulted in the complete inactivation of

all types of bacteria, including antibiotic-tolerant and susceptible bacteria, after t30W,n=53,9

minutes with no colonies present on the culture media (initial concentration of E. coli=2 CFU

22
100 mL-1, initial concentration of P. aeruginosa=4 CFU 100 mL-1, initial concentration of

Klebsiella spp.=3 CFU 100 mL-1).

The complete absence of growing bacteria on the agar media does not, however, mean that

the bacteria which were initially present in the solar Fenton-treated wastewater have been

killed or completely inactivated and cannot re-grow, if given some time in a nutrient

environment. The sub-lethally injured cells which have not been killed, may possess repair

mechanisms, which may enable them after repairing their injured structures, to regrow on

solid nutritive media [56]. So, the bacterial damage repair potential after the applied

oxidation treatment was examined by re-plating the obtained samples after 24 hours of

incubation at 37 °C. The results have shown the existence of repair mechanisms of P.

aeruginosa after solar Fenton oxidation, as after 24 hours there were 2 CFU 100 mL-1 grown

on the agar media. These enumerated P. aeruginosa colonies were not tolerant to any of the

examined antibiotics in this study. A similar repair of the examined bacteria was observed by

Fiorentino et al. [22], where after H2O2/sunlight treatment of a secondary effluent, a complete

inactivation of total and multidrug resistant E. coli was achieved. Despite the accomplished

inactivation of the H2O2/sunlight process, 48 hours after the treatment there were 0.3 x 102

CFU mL-1 E. coli re-growing in treated samples with 3% of the enumerated E. coli

population being resistant to the examined mixture of antibiotics, namely ampicillin,

ciprofloxacin and tetracycline.

No E. coli and Klebsiella spp. colonies were shown to re-activate after the incubation period,

indicating a permanent damage to their cellular functions through solar Fenton, disabling

their repair. The repair potential of P. aeruginosa colonies which were enumerated after the

solar Fenton treatment may be related to the irradiation dose received, which may not have

been sufficient to cause mutation and permanent damage to the bacteria in order to disable

their growth on selective media [57]. As a result, prolonged irradiation doses are necessary,

23
such as more than the 3 hour experimental time used in this study, in order to cause heavy

and permanent damage to susceptible bacteria [58].

3.3. Assessment of MBR-solar Fenton process efficiency for the reduction of total DNA

The microbial richness of the biosphere is large and inaccessible as the cultivable fraction of

microorganisms is less than 1%. The gap between the cultivable fraction of microorganisms,

including bacteria and the microbial richness of the biosphere is known as the ‘Great Plate

Count Anomaly’ [59,60]. The use of molecular techniques has supplied in the last decades

the means for examining microbial diversity in detail and detecting specific organisms

without the need for cultivation. Such techniques which do not require the cultivation and

direct observation of specific microorganisms, while providing a holistic community view in

ecosystems such as water and wastewater have enabled the fast and accurate description of

microorganism communities and the shifts in these after wastewater treatment [61].

Total community DNA was successfully extracted from each sample. The total DNA

concentrations throughout the MBR-solar Fenton treatment can be seen in Figure 3. More

specifically, the total DNA concentration yield of the influent at the beginning of the process

before the MBR treatment was 4.2 mg 100 mL-1. As the influent enters the MBR, it gets

mixed inside the MBR reactor with the MLSS, which contains a mixture of the activated

sludge and influent wastewater. Inside the MLSS, the total DNA concentration yield was 3.4

mg 100 mL-1. Next, the biologically treated wastewater is filtered through the chlorinated

polyethylene membranes, which remove all solids above the size of 0.4 µm, producing thus a

high-quality effluent. The total DNA content decreased down to an average yield of 0.42 mg

100 mL-1 in the MBR effluent achieving an average reduction of 90% of total DNA

concentration. At this point, it was observed that although a large fraction of the DNA

concentration was removed, there was still DNA found in the examined effluent, containing

24
free or cell-bound DNA (extracellular and intracellular DNA) which may potentially act as a

driver of the spread of ARG to receiving aquatic and soil environments. Another interesting

observation made was that while the total bacteria were reduced (<99%), there was still free

and cell-bound total DNA in the MBR treated effluent. So, the target of integrating the MBR

with solar Fenton process at this stage was to reduce the total DNA even further, in order to

decrease the potential spread and accumulation of ARG present in the treated effluent.

Indeed, the application of the dark treatment has reduced the total DNA concentration in the

effluent down to 0.35 mg 100 mL-1 yield during the 30 minutes before the solar Fenton

begun, and down to 0.16 mg 100 mL-1 after 120 minutes of solar Fenton treatment of the

MBR effluent. The total reduction of the DNA concentration at the end of the integrated

treatment was 97%.

3.4. Removal of selected ARG and taxon-specific markers

3.4.1. Assessment of MBR efficiency

The abundance of selected ARG in the various stages of the MBR treatment was examined.

The estimated average values expressed as log10 CE 100 ng-1 DNA during the MBR treatment

are given in Figure 4. A negative control not containing the sample was also included in the

analysis to measure the background noise and remove it from the measurements.

The abundance of the ARG (ampC, sul1, ermB) and taxon-specific sequences (ecfX, Enc)

was examined. It was shown that the abundance of the examined genes in the MLSS is higher

than in the primary influent indicating an ARG reservoir-like effect and possible horizontal

gene transfer events [62]. The sludge that is used to biologically degrade microcontaminants

in urban wastewaters is commonly considered as an important reservoir for the evolution and

the spread of ARB [63], as the MLSS provides an ideal environment with abundant nutrients

25
and high bacterial density for genetic exchange. The results of the abundance of species-

specific sequences and ARG, suggest the highest prevalence of these inside the MLSS

(Figure 4). The rich diversity of the MLSS microorganism community and its complex

structure provides a basis for the development of antibiotic-resistant bacterial communities.

This phenomenon can be attributed to the continuous exposure of the MLSS to influent

antibiotic residues, as well as to the potential gene transfer from one bacterial community to

another found in close proximity. More specifically, the AR spreading mechanisms have been

discussed by Schwartz et al. [64], where various ways in which AR can be acquired by

bacterial communities were discussed. These mechanisms include cell homeostasis, signal

trafficking, cell wall permeability to antibiotics, inhibition of protein synthesis and

production of antibiotic degrading enzymes through target modification, molecular bypass,

antibiotic efflux and chemical modification [65]. Once there is an established mechanism of

resistance to antibiotics it may also be conveyed from one environmental compartment to

another and across taxonomic barriers through the horizontal transfer of ARG, leading to

their spread beyond the host, most commonly where the density of bacteria is high, such as in

primary influents or in activated sludge [66].

The enterococci specific taxon marker was detected in the MBR effluent samples examined,

suggesting the presence of Enterococcus spp. along the MBR treatment train. The presence of

enterococci-specific DNA taxon marker in the MBR effluent also shows the challenge faced

for their removal by biological processes. Moreover, the prevalence of pseudomonads during

the MBR treatment steps (MLSS and MBR FE) through the ecfX specific-taxon marker

shows the inability of the MBR treatment to effectively reduce pseudomonad genetic

material. Sul1 was abundant in all MBR treatment steps while ampC concentration seems to

be highest in the MLSS, despite its absence in the incoming primary influent into the MBR

26
reactor, suggesting the accumulation of beta-lactam resistant bacteria inside the MBR reactor

(ARG reservoir). MecA was not detected in any of the samples examined.

3.4.2. Assessment of solar Fenton process efficiency

The abundance of the examined ARG and species-specific taxon markers in the MBR

effluent was shown to change during the solar Fenton treatment (Figure 5). More specifically,

the enterococci-specific taxon marker is the most prevalent parameter during the treatment,

and increases after 60 minutes of solar Fenton treatment. This may be due to the oxidative

damage of bacteria during the first 60 minutes of the solar Fenton treatment, causing them to

releasing the specific gene, as well as a lower inter- and intra-species selective pressure [67].

As a result, a higher abundance is observed during the last 120 minutes of the treatment, and

a limited removal during this time. These results are in agreement with Ferro et al. [68], who

investigated the potential of UV/H2O2 process to remove a beta-lactam resistance gene,

namely bla TEM at a H2O2 dose of 20 mg L-1 in de-ionised water. The results of this study have

shown no statistically significant reduction of the bla TEM after 90 minutes of treatment. The

P. aeruginosa specific marker also seems to increase in a similar manner to enterococci after

60 minutes of treatment, but with a lower overall abundance compared to enterococci. Along

the examined ARGs, ampC was only detected in the initial sample (30 minutes before

illumination of the solar Fenton reactor) and after 120 minutes of treatment, probably due to

the low prevalence found in the treated effluent, making its quantification difficult. Sul1 and

ermB ARG do not seem to be effectively treated after 180 minutes of treatment, as they are

still prevalent in examined samples at the end of the treatment (1.56 and 1.53 log10 CE per

100 ng-1 DNA, respectively). These results are in agreement with Gao et al. [69], whose

findings indicate that Sul1 gene is a commonly encountered ARG in many regions of the

27
world as sulfonamides have been commonly used worldwide to treat gram-negative bacterial

infections.

4. Conclusions

This study is the first effort to investigate the removal of various antibiotic-related

microcontaminants using an alternative biological process (MBR) integrated with an AOP,

namely the solar Fenton treatment. The two types of processes were integrated in order to

establish the overall potential of such a combined treatment train for the removal of

antibiotics, total and antibiotic-tolerant bacteria, total DNA, selected ARG and selected

taxon-specific genetic markers.

SMX and ERY were completely removed by MBR treatment, whereas CLA was shown to be

resistant to biodegradation. Following, the solar Fenton oxidation of the spiked MBR

wastewater effluent (100 µg L-1 of each antibiotic) achieved a complete removal of SMX and

ERY, while CLA was not completely removed. The exhibited removal of CLA by oxidation

showcases it as a challenging antibiotic to remove from wastewater effluents through AOPs,

due to its high recalcitrance and photo-persistent structural characteristics. The DOC removal

accomplished by the integrated MBR-solar Fenton process by 90% indicates the high

mineralization potential capacity of the combined process.

Furthermore, the findings of this study clearly demonstrated the high efficiency of the MBR

(>99%) for the removal of both total bacteria and antibiotic-tolerant bacteria. The subsequent

solar Fenton oxidation resulted in complete inactivation of the remaining bacteria. However,

among the three types of investigated Gram-negative bacteria, a very low number of P.

aeruginosa was present after 24 hours, indicating their tolerance to the applied experimental

conditions of solar Fenton. Consequently, further studies are needed, regarding the

28
examination of longer irradiation times, aiming at the elimination of re-activation phenomena

in P. aeruginosa observed after solar Fenton oxidation.

Despite the near complete removal of total bacteria by the MBR process, there was total

genomic DNA found in the MBR effluent, as well as the taxon-specific markers Enc and

ecfX, and the ARG ampC, sul1 and ermB. Furthermore, it was demonstrated in this study for

the first time, that the MBR and solar Fenton oxidation process have the potential to

negatively affect the presence of total DNA which may be found incorporated inside bacteria

or freely suspended in wastewater, but other types of genetic parameters such as taxon-

specific markers and ARG may require a different approach of removal.

5. Acknowledgements

The authors would like to acknowledge the financial support provided by COST-European

Cooperation in Science and Technology, to the COST Action ES1403: New and emerging

challenges and opportunities in wastewater reuse (NEREUS). Disclaimer: The content of this

article is the authors’ responsibility and neither COST nor any person acting on its behalf is

responsible for the use, which might be made of the information contained in it.

Nireas-International Water Research Center (IWRC) was co-financed by the European

Regional Development Fund and the Republic of Cyprus through the Cyprus Research

Promotion Foundation (ΝΕΑ ΥΠΟ∆ΟΜΗ/ΣΤΡΑΤΗ/0308/09).

29
6. References

[1] SURVEILLANCE REPORT: Antimicrobial resistance surveillance in Europe 2014 -

antimicrobial-resistance-europe-2014.pdf, (n.d.).
http://ecdc.europa.eu/en/publications/Publications/antimicrobial-resistance-europe-
2014.pdf (accessed February 12, 2016).

[2] A.R. Varela, O.C. Nunes, C.M. Manaia, Quinolone resistant Aeromonas spp. as
carriers and potential tracers of acquired antibiotic resistance in hospital and municipal
wastewater., Sci. Total Environ. 542 (2016) 665–71.
doi:10.1016/j.scitotenv.2015.10.124.
[3] C.M. Manaia, G. Macedo, D. Fatta-Kassinos, O.C. Nunes, Antibiotic resistance in
urban aquatic environments: can it be controlled?, Appl. Microbiol. Biotechnol.
(2015). doi:10.1007/s00253-015-7202-0.
[4] A. Rodríguez-Rojas, J. Rodríguez-Beltrán, A. Couce, J. Blázquez, Antibiotics and
antibiotic resistance: A bitter fight against evolution, Int. J. Med. Microbiol. 303
(2013) 293–297. doi:10.1016/j.ijmm.2013.02.004.

[5] L. Rizzo, C. Manaia, C. Merlin, T. Schwartz, C. Dagot, M.C. Ploy, et al., Urban
wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes
spread into the environment: A review, Sci. Total Environ. 447 (2013) 345–360.
doi:10.1016/j.scitotenv.2013.01.032.
[6] N. Czekalski, T. Berthold, S. Caucci, A. Egli, H. Bürgmann, Increased levels of
multiresistant bacteria and resistance genes after wastewater treatment and their
dissemination into lake geneva, Switzerland., Front. Microbiol. 3 (2012) 106.
doi:10.3389/fmicb.2012.00106.
[7] N. Czekalski, E. Gascón Díez, H. Bürgmann, Wastewater as a point source of
antibiotic-resistance genes in the sediment of a freshwater lake., ISME J. 8 (2014)
1381–90. doi:10.1038/ismej.2014.8.
[8] S.J. Judd, The status of industrial and municipal effluent treatment with membrane
bioreactor technology, Chem. Eng. J. (2015). doi:10.1016/j.cej.2015.08.141.
[9] C.H. Neoh, Z.Z. Noor, N.S.A. Mutamim, C.K. Lim, Green technology in wastewater
treatment technologies: Integration of membrane bioreactor with various wastewater
treatment systems, Chem. Eng. J. 283 (2016) 582–594. doi:10.1016/j.cej.2015.07.060.
[10] O. Gimeno, J.F. García-Araya, F.J. Beltrán, F.J. Rivas, A. Espejo, Removal of
emerging contaminants from a primary effluent of municipal wastewater by means of
sequential biological degradation-solar photocatalytic oxidation processes, Chem. Eng.
J. 290 (2016) 12–20. doi:10.1016/j.cej.2016.01.022.
[11] E. Dialynas, E. Diamadopoulos, Integration of a membrane bioreactor coupled with
reverse osmosis for advanced treatment of municipal wastewater, Desalination. 238
(2009) 302–311. doi:10.1016/j.desal.2008.01.046.

[12] O.K. Scheible, Development of a rationally based design protocol for the ultraviolet
light disinfection process, J. Water Pollut. Control Fed. 59 (1987) 25–31.
http://www.scopus.com/inward/record.url?eid=2-s2.0-

30
 0023607516&partnerID=tZOtx3y1.
[13] M. Brahmi, N.H. Belhadi, H. Hamdi, A. Hassen, Modeling of secondary treated
wastewater disinfection by UV irradiation: Effects of suspended solids content, J.
Environ. Sci. 22 (2010) 1218–1224. doi:10.1016/S1001-0742(09)60241-2.
[14] I. Michael, E. Hapeshi, C. Michael, A.R. Varela, S. Kyriakou, C.M. Manaia, et al.,
Solar photo-Fenton process on the abatement of antibiotics at a pilot scale:
Degradation kinetics, ecotoxicity and phytotoxicity assessment and removal of
antibiotic resistant enterococci., Water Res. 46 (2012) 5621–34.
doi:10.1016/j.watres.2012.07.049.
[15] J. Rodríguez-Chueca, M.I. Polo-López, R. Mosteo, M.P. Ormad, P. Fernández-Ibáñez,
Disinfection of real and simulated urban wastewater effluents using a mild solar photo-
Fenton, Appl. Catal. B Environ. 150-151 (2014) 619–629.
doi:10.1016/j.apcatb.2013.12.027.
[16] G. Ferro, A. Fiorentino, M.C. Alferez, M.I. Polo-López, L. Rizzo, P. Fernández-
Ibáñez, Urban wastewater disinfection for agricultural reuse: effect of solar driven
AOPs in the inactivation of a multidrug resistant E. coli strain, Appl. Catal. B Environ.
178 (2015) 65–73. doi:10.1016/j.apcatb.2014.10.043.
[17] T. Paul, M.C. Dodd, T.J. Strathmann, Photolytic and photocatalytic decomposition of
aqueous ciprofloxacin: Transformation products and residual antibacterial activity,
Water Res. 44 (2010) 3121–3132. doi:10.1016/j.watres.2010.03.002.
[18] T.-M. Tsai, H.-H. Chang, K.-C. Chang, Y.-L. Liu, C.-C. Tseng, A comparative study
of the bactericidal effect of photocatalytic oxidation by TiO2 on antibiotic-resistant
and antibiotic-sensitive bacteria, J. Chem. Technol. Biotechnol. 85 (2010) 1642–1653.
doi:10.1002/jctb.2476.

[19] P. Karaolia, I. Michael, I. García-Fernández, A. Agüera, S. Malato, P. Fernández-

Ibáñez, et al., Reduction of clarithromycin and sulfamethoxazole-resistant
Enterococcus by pilot-scale solar-driven Fenton oxidation., Sci. Total Environ. 468-
469 (2014) 19–27. doi:10.1016/j.scitotenv.2013.08.027.
[20] L. Rizzo, A. Della Sala, A. Fiorentino, G. Li Puma, Disinfection of urban wastewater
by solar driven and UV lamp - TiO₂ photocatalysis: effect on a multi drug resistant
Escherichia coli strain., Water Res. 53 (2014) 145–52.
doi:10.1016/j.watres.2014.01.020.
[21] F. Lüddeke, S. Heß, C. Gallert, J. Winter, H. Güde, H. Löffler, Removal of total and
antibiotic resistant bacteria in advanced wastewater treatment by ozonation in
combination with different filtering techniques., Water Res. 69 (2015) 243–51.
doi:10.1016/j.watres.2014.11.018.

[22] A. Fiorentino, G. Ferro, M.C. Alferez, M.I. Polo-López, P. Fernández-Ibañez, L.

Rizzo, Inactivation and regrowth of multidrug resistant bacteria in urban wastewater
after disinfection by solar-driven and chlorination processes., J. Photochem. Photobiol.
B. 148 (2015) 43–50. doi:10.1016/j.jphotobiol.2015.03.029.
[23] D. Yang, J. Wang, Z. Qiu, M. Jin, Z. Shen, Z. Chen, et al., Horizontal transfer of
antibiotic resistance genes in a membrane bioreactor., J. Biotechnol. 167 (2013) 441–7.

31
 doi:10.1016/j.jbiotec.2013.08.004.
[24] Y. Zhang, Y. Zhuang, J. Geng, H. Ren, K. Xu, L. Ding, Reduction of antibiotic
resistance genes in municipal wastewater effluent by advanced oxidation processes.,
Sci. Total Environ. 550 (2016) 184–191. doi:10.1016/j.scitotenv.2016.01.078.
[25] L. Ioannou, C. Michael, S. Kyriakou, D. Fatta-Kassinos, Solar Fenton: from pilot to
industrial scale application for polishing winery wastewater pretreated by MBR, J.
Chem. Technol. Biotechnol. 89 (2014) 1067–1076. doi:10.1002/jctb.4203.
[26] N. Klamerth, S. Malato, M.I. Maldonado, A. Agüera, A.R. Fernández-Alba,
Application of photo-fenton as a tertiary treatment of emerging contaminants in
municipal wastewater., Environ. Sci. Technol. 44 (2010) 1792–8.
doi:10.1021/es903455p.
[27] N. Klamerth, S. Malato, A. Agüera, A. Fernández-Alba, Photo-Fenton and modified
photo-Fenton at neutral pH for the treatment of emerging contaminants in wastewater
treatment plant effluents: a comparison., Water Res. 47 (2013) 833–40.
doi:10.1016/j.watres.2012.11.008.
[28] R.F.P. Nogueira, M.C. Oliveira, W.C. Paterlini, Simple and fast spectrophotometric
determination of H(2)O(2) in photo-Fenton reactions using metavanadate., Talanta. 66
(2005) 86–91. doi:10.1016/j.talanta.2004.10.001.
[29] M. Gros, M. Petrović, D. Barceló, WASTEWATER TREATMENT PLANTS AS A
PATHWAY FOR AQUATIC CONTAMINATION BY PHARMACEUTICALS IN
THE EBRO RIVER BASIN (NORTHEAST SPAIN), Environ. Toxicol. Chem. 26
(2007) 1553. doi:10.1897/06-495R.1.
[30] K.K. Kumarasamy, M.A. Toleman, T.R. Walsh, J. Bagaria, F. Butt, R. Balakrishnan,
et al., Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the
UK: a molecular, biological, and epidemiological study., Lancet. Infect. Dis. 10 (2010)
597–602. doi:10.1016/S1473-3099(10)70143-2.
[31] P.M. Hawkey, The growing burden of antimicrobial resistance., J. Antimicrob.
Chemother. 62 Suppl 1 (2008) i1–9. doi:10.1093/jac/dkn241.
[32] S. Forster, J.R. Snape, H.M. Lappin-Scott, J. Porter, Simultaneous Fluorescent Gram
Staining and Activity Assessment of Activated Sludge Bacteria, Appl. Environ.
Microbiol. 68 (2002) 4772–4779. doi:10.1128/AEM.68.10.4772-4779.2002.
[33] E.M.H. Wellington, A.B. Boxall, P. Cross, E.J. Feil, W.H. Gaze, P.M. Hawkey, et al.,
The role of the natural environment in the emergence of antibiotic resistance in gram-
negative bacteria., Lancet. Infect. Dis. 13 (2013) 155–65. doi:10.1016/S1473-
3099(12)70317-1.
[34] I. Michael-Kordatou, M. Iacovou, Z. Frontistis, E. Hapeshi, D.D. Dionysiou, D. Fatta-
Kassinos, Erythromycin oxidation and ERY-resistant Escherichia coli inactivation in
urban wastewater by sulfate radical-based oxidation process under UV-C irradiation,
Water Res. 85 (2015) 346–358. doi:10.1016/j.watres.2015.08.050.
[35] T.E. Cloete, Resistance mechanisms of bacteria to antimicrobial compounds, Int.
Biodeterior. Biodegradation. 51 (2003) 277–282. doi:10.1016/S0964-8305(03)00042-

32
 8.
[36] M.F. Davis, S.A. Iverson, P. Baron, A. Vasse, E.K. Silbergeld, E. Lautenbach, et al.,
Household transmission of meticillin-resistant Staphylococcus aureus and other
staphylococci., Lancet. Infect. Dis. 12 (2012) 703–16. doi:10.1016/S1473-
3099(12)70156-1.
[37] J. Alexander, A. Bollmann, W. Seitz, T. Schwartz, Microbiological characterization of
aquatic microbiomes targeting taxonomical marker genes and antibiotic resistance
genes of opportunistic bacteria., Sci. Total Environ. 512-513 (2015) 316–25.
doi:10.1016/j.scitotenv.2015.01.046.
[38] T. Schwartz, H. Volkmann, S. Kirchen, W. Kohnen, K. Schön-Hölz, B. Jansen, et al.,
Real-time PCR detection of Pseudomonas aeruginosa in clinical and municipal
wastewater and genotyping of the ciprofloxacin-resistant isolates., FEMS Microbiol.
Ecol. 57 (2006) 158–67. doi:10.1111/j.1574-6941.2006.00100.x.
[39] J. Radjenovic, M. Petrovic, D. Barceló, Analysis of pharmaceuticals in wastewater and
removal using a membrane bioreactor., Anal. Bioanal. Chem. 387 (2007) 1365–77.
doi:10.1007/s00216-006-0883-6.
[40] E. Sahar, R. Messalem, H. Cikurel, A. Aharoni, A. Brenner, M. Godehardt, et al., Fate
of antibiotics in activated sludge followed by ultrafiltration (CAS-UF) and in a
membrane bioreactor (MBR)., Water Res. 45 (2011) 4827–36.
doi:10.1016/j.watres.2011.06.023.
[41] D. Dolar, M. Gros, S. Rodriguez-Mozaz, J. Moreno, J. Comas, I. Rodriguez-Roda, et
al., Removal of emerging contaminants from municipal wastewater with an integrated
membrane system, MBR-RO., J. Hazard. Mater. 239-240 (2012) 64–9.
doi:10.1016/j.jhazmat.2012.03.029.

[42] I. Senta, S. Terzic, M. Ahel, Occurrence and fate of dissolved and particulate
antimicrobials in municipal wastewater treatment., Water Res. 47 (2013) 705–14.
doi:10.1016/j.watres.2012.10.041.
[43] C. Abegglen, A. Joss, C.S. McArdell, G. Fink, M.P. Schlüsener, T.A. Ternes, et al.,
The fate of selected micropollutants in a single-house MBR., Water Res. 43 (2009)
2036–46. doi:10.1016/j.watres.2009.02.005.
[44] A. Göbel, C.S. McArdell, A. Joss, H. Siegrist, W. Giger, Fate of sulfonamides,
macrolides, and trimethoprim in different wastewater treatment technologies., Sci.
Total Environ. 372 (2007) 361–71. doi:10.1016/j.scitotenv.2006.07.039.
[45] J. Radjenović, M. Petrović, D. Barceló, Fate and distribution of pharmaceuticals in
wastewater and sewage sludge of the conventional activated sludge (CAS) and
advanced membrane bioreactor (MBR) treatment, Water Res. 43 (2009) 831–841.
doi:10.1016/j.watres.2008.11.043.

[46] L. Prieto-Rodríguez, I. Oller, N. Klamerth, A. Agüera, E.M. Rodríguez, S. Malato,

Application of solar AOPs and ozonation for elimination of micropollutants in
municipal wastewater treatment plant effluents., Water Res. 47 (2013) 1521–8.
doi:10.1016/j.watres.2012.11.002.

33
[47] N. Klamerth, N. Miranda, S. Malato, A. Agüera, A.R. Fernández-Alba, M.I.
Maldonado, et al., Degradation of emerging contaminants at low concentrations in
MWTPs effluents with mild solar photo-Fenton and TiO2, Catal. Today. 144 (2009)
124–130. doi:10.1016/j.cattod.2009.01.024.

[48] S. Giannakis, F.A. Gamarra Vives, D. Grandjean, A. Magnet, L.F. De Alencastro, C.

Pulgarin, Effect of advanced oxidation processes on the micropollutants and the
effluent organic matter contained in municipal wastewater previously treated by three
different secondary methods., Water Res. 84 (2015) 295–306.
doi:10.1016/j.watres.2015.07.030.
[49] M. Neamţu, D. Grandjean, A. Sienkiewicz, S. Le Faucheur, V. Slaveykova, J.J.V.
Colmenares, et al., Degradation of eight relevant micropollutants in different water
matrices by neutral photo-Fenton process under UV254 and simulated solar light
irradiation – A comparative study, Appl. Catal. B Environ. 158-159 (2014) 30–37.
doi:10.1016/j.apcatb.2014.04.001.
[50] T. Mackuľak, K. Nagyová, M. Faberová, R. Grabic, O. Koba, M. Gál, et al.,
Utilization of Fenton-like reaction for antibiotics and resistant bacteria elimination in
different parts of WWTP, Environ. Toxicol. Pharmacol. 40 (2015) 492–497.
doi:10.1016/j.etap.2015.07.002.

[51] N. Chen, L.J. Huang, N. Liu, Y. Liu, S.F. Wang, Analysis of the effect of
erythromycin wastewater degradation by fenton method, Asian J. Chem. 25 (2013)
7208–7210. http://www.scopus.com/inward/record.url?eid=2-s2.0-
84880877631&partnerID=tZOtx3y1.
[52] N. De la Cruz, J. Giménez, S. Esplugas, D. Grandjean, L.F. de Alencastro, C. Pulgarín,
Degradation of 32 emergent contaminants by UV and neutral photo-fenton in domestic
wastewater effluent previously treated by activated sludge., Water Res. 46 (2012)
1947–57. doi:10.1016/j.watres.2012.01.014.
[53] B. Volkmer, M. Heinemann, Condition-dependent cell volume and concentration of
Escherichia coli to facilitate data conversion for systems biology modeling., PLoS
One. 6 (2011) e23126. doi:10.1371/journal.pone.0023126.
[54] G. De Luca, R. Sacchetti, E. Leoni, F. Zanetti, Removal of indicator bacteriophages
from municipal wastewater by a full-scale membrane bioreactor and a conventional
activated sludge process: Implications to water reuse, Bioresour. Technol. 129 (2013)
526–531. doi:10.1016/j.biortech.2012.11.113.
[55] M. Munir, I. Xagoraraki, Levels of Antibiotic Resistance Genes in Manure, Biosolids,
and Fertilized Soil, J. Environ. Qual. 40 (2011) 248. doi:10.2134/jeq2010.0209.
[56] P.S.M. Dunlop, M. Ciavola, L. Rizzo, D.A. McDowell, J.A. Byrne, Effect of
photocatalysis on the transfer of antibiotic resistance genes in urban wastewater, Catal.
Today. 240 (2015) 55–60. doi:10.1016/j.cattod.2014.03.049.
[57] S. Giannakis, A.I. Merino Gamo, E. Darakas, A. Escalas-Cañellas, C. Pulgarin,
Monitoring the post-irradiation E. coli survival patterns in environmental water
matrices: Implications in handling solar disinfected wastewater, Chem. Eng. J. 253
(2014) 366–376. doi:10.1016/j.cej.2014.05.092.

34
[58] R.A. Blaustein, Y. Pachepsky, R.L. Hill, D.R. Shelton, G. Whelan, Escherichia coli
survival in waters: temperature dependence., Water Res. 47 (2013) 569–78.
doi:10.1016/j.watres.2012.10.027.
[59] M.S. Rappé, S.J. Giovannoni, The uncultured microbial majority., Annu. Rev.
Microbiol. 57 (2003) 369–94. doi:10.1146/annurev.micro.57.030502.090759.
[60] S. Epstein, The phenomenon of microbial uncultivability, Curr. Opin. Microbiol. 16
(2013) 636–642. doi:10.1016/j.mib.2013.08.003.
[61] K.A. Gilbride, D.-Y. Lee, L.A. Beaudette, Molecular techniques in wastewater:
Understanding microbial communities, detecting pathogens, and real-time process
control., J. Microbiol. Methods. 66 (2006) 1–20. doi:10.1016/j.mimet.2006.02.016.
[62] F. Baquero, J.-L. Martínez, R. Cantón, Antibiotics and antibiotic resistance in water
environments., Curr. Opin. Biotechnol. 19 (2008) 260–5.
doi:10.1016/j.copbio.2008.05.006.
[63] H. Nicholls, Bacteria learn antibiotic resistance in the sludge, Drug Discov. Today. 8
(2003) 1011. doi:10.1016/S1359-6446(03)02908-8.

[64] T. Schwartz, W. Kohnen, B. Jansen, U. Obst, Detection of antibiotic-resistant bacteria

and their resistance genes in wastewater, surface water, and drinking water biofilms.,
FEMS Microbiol. Ecol. 43 (2003) 325–35. doi:10.1111/j.1574-6941.2003.tb01073.x.

[65] J.L. Martinez, Environmental pollution by antibiotics and by antibiotic resistance

determinants., Environ. Pollut. 157 (2009) 2893–902.
doi:10.1016/j.envpol.2009.05.051.
[66] H. Volkmann, T. Schwartz, P. Bischoff, S. Kirchen, U. Obst, Detection of clinically
relevant antibiotic-resistance genes in municipal wastewater using real-time PCR
(TaqMan), J. Microbiol. Methods. 56 (2004) 277–286.
doi:10.1016/j.mimet.2003.10.014.

[67] D. Rubio, E. Nebot, J.F. Casanueva, C. Pulgarin, Comparative effect of simulated solar
light, UV, UV/H2O2 and photo-Fenton treatment (UV-Vis/H2O2/Fe2+,3+) in the
Escherichia coli inactivation in artificial seawater., Water Res. 47 (2013) 6367–79.
doi:10.1016/j.watres.2013.08.006.
[68] G. Ferro, F. Guarino, A. Cicatelli, L. Rizzo, β-lactams resistance gene quantification in
an antibiotic resistant Escherichia coli water suspension treated by advanced oxidation
with UV/H2O2, J. Hazard. Mater. (2016). doi:10.1016/j.jhazmat.2016.03.014.
[69] P. Gao, M. Munir, I. Xagoraraki, Correlation of tetracycline and sulfonamide
antibiotics with corresponding resistance genes and resistant bacteria in a conventional
municipal wastewater treatment plant., Sci. Total Environ. 421-422 (2012) 173–83.
doi:10.1016/j.scitotenv.2012.01.061.

35
Figures

Figure 1. The percentage removal (%) of selected antibiotics in the MBR effluent by solar
Fenton treatment.

Figure 2. The estimated antibiotic tolerance patterns of examined bacteria in the MBR
influent, in the presence of the three examined antibiotics as a proportion of total bacteria
(C/C0).

Figure 3. The average DNA concentration during the integrated MBR-solar Fenton treatment.

Figure 4. The log10 abundance of the examined genetic parameters in the MBR wastewater
samples examined, according to each step of the MBR treatment. Mean values are
represented in log10 cell equivalent values (CE) per 100 ng of DNA.

Figure 5. The log10 abundance of the examined genetic parameters in all wastewater samples
examined during solar Fenton treatment. Mean values are represented in log10 cell equivalent
(CE) values per 100 ng of DNA.

36
 100

80
Removal of antibiotics (%)

60

SMX
40
CLA
ERY

20

-
-30 0 30 60 90 120
Experimental time (t30w,n)

Figure 1. The percentage removal (%) of selected antibiotics in the MBR effluent by solar
Fenton treatment.

37
 SMX CLA ERY MIX

Prevalence of AR bacteria (C/C0)

1

0.8

0.6

0.4

0.2

0
E. coli Pseudomonas aeruginosa Klebsiella spp.

Bacterial species

Figure 2. The estimated antibiotic tolerance patterns of examined bacteria in the MBR
influent, in the presence of the three examined antibiotics as a proportion of total bacteria
(C/C0).

38
 50

Average DNA concentration (ng µL-1) 40

30

20

10

0
Primary MLSS MBR final -30 0 24 60,4 119,2
influent effluent
Solar Fenton treatment experimental time (t30w,n)

Wastewater treatment type

Figure 3. The average DNA concentration during the integrated MBR-solar Fenton treatment.

9 ampC sul1 ermB ecfX Enc

7
Log10 CE 100 ng-1 DNA

0
Primary influent MLSS MBR FE
Wastewater treatment type

39
 Figure 4. The log10 abundance of the examined genetic parameters in the MBR wastewater
samples examined, according to each step of the MBR treatment. Mean values are
represented in log10 cell equivalent values (CE) per 100 ng of DNA.

6 ampC sul1 ermB ecfX Enc

5
Log10 CE 100 ng-1 DNA

0
-30 0 24 60.4 119.2
Solar Fenton treatment time (T30w,n)

Figure 5. The log10 abundance of the examined genetic parameters in all wastewater samples
examined during solar Fenton treatment. Mean values are represented in log10 cell equivalent
(CE) values per 100 ng of DNA.

40
Tables

Table 1. Physicochemical and microbiological characteristics of the real urban wastewater

influent
Table 2. UPLC-MS/MS parameters established for the MRM acquisition mode.
Table 3. The target sequences of q-PCR analysis.

41
Table 1. Physicochemical and microbiological characteristics of the real urban wastewater influent

used in this study.

Average valuea
Parameter Influent average
measurementa
pH 7.2
Conductivity (µS cm-1) 1119
DO (mg L-1) 5.4
TSS (mg L-1) 42000
DOC (mg L-1) 42.7
COD (mg L-1) 122
SMX (ng L-1) 540
CLA (ng L-1) 43
ERY (ng L-1) 92
Escherichia coli (CFU 100 mL-1) 2 x 107
Pseudomonas aeruginosa (CFU 100 mL-1) 4 x 108
Klebsiella spp. (CFU 100 mL-1 ) 2 x 108
a
Average value from 3 separate measurements

42
 Table 2. UPLC-MS/MS parameters established for the MRM acquisition mode.
Compounds Precursor ion (m/z) CV Product
[M+H]+ (eV)a CE (eV)b ion (m/z)c
Clarithromycin 747 40 30 590
747 40 20 158
Sulfamethoxazole 254 20 16 156
254 21 25 92
Erythromycin 734.7 35 20 576.4
734.7 35 30 158.1
734.7 35 15 116.1
a
CV, cone voltage.
b
CE, collision energy.
c
Top, product ion used for quantification; below, the two product ions used for confirmation

43
 Table 3. The target sequences of q-PCR analysis.

Primer name Target Species Sequence Reference

Lak2FP Enterobacter GGGAATGCTGGATGCACAA

Beta-lactam Beta-lactamase
cloacae and other [75]
resistance (ampC)
Lak1RP Enterobacteriaceae CATGACCCAGTTCGCCATATC

qSUL1_653F CCGTTGGCCTTCCTGTAAAG
Sulfonamide Dihydropteroate
[14]
resistance synthase (sul1)
qSUL1_719r TTGCCGATCGCGTGAAGT

ECST784F AGAAATTCCAAACGAACTTG
Enterococcus
23S rRNA (enc) Enterococcus spp. [75]
specific
ENC854R CAGTGCTCTACCTCCATCATT

mecA1FP Chromosomal CGCAACGTTCAATTTAATTTTGTTAA

Methicillin penicillin- Staphylococcus
[75]
mecA1RP resistance binding protein aureus and CNS TGGTCTTTCTGCATTCCTGGA
2a (mecA)

ermB-F Erythromycin- TGAATCGAGACTTGAGTGTGCAA

Erythromycin ribosome-
Streptococcus spp. [43]
resistance methylase
ermB-R GGATTCTACAAGCGTACCTT
(ermB)

EcfXRT-F RNA AGCGTTCGGTCCTGCACAAGT

Pseudomonas Polymerase Pseudomonas
[6]
aeruginosa Sigma-70 factor aeruginosa
ecfXRT-R TCCACCATGCTCAGGGAGAT
(ecfX)

44
Highlights

• An integrated pilot-scale MBR with solar Fenton system was examined.

• The integrated process revealed a high removal efficiency of antibiotics.

• Selected antibiotic-tolerant bacteria were efficiently removed.

• The total DNA content in the examined samples was removed by more than 97%.

• The antibiotic resistance genes Sul1 and ermB were not completely removed.

45