Biochem. Cell. Arch. Vol. 18, No. 2, pp. 2533-2546, 2018 www.connectjournals.

com/bca ISSN 0972-5075

CHARACTERIZATION AND OPTIMIZATION OF AgNPs BIOSYNTHESIS BY

KLEBSIELLA PNEUMONIAE HHHS1 ISOLATED FROM SILVER RICH
ENVIRONMENT
Hussein Hameed Hassan1 and Nawfal Hussein Aldujaili2
1
Department of Environmental Planning, Faculty of Physical Planning, University of Kufa, Najaf, Iraq.
2
Department of Biology, Faculty of Science, University of Kufa, Najaf, Iraq.
E-mail: [email protected], [email protected]
(Accepted 26 August 2018)

ABSTRACT : Silver rich soil samples were screened for the potent bacteria for AgNPs biosynthesis. Silver resistant
bacteria are the potent for AgNPs biosynthesis. K. pneumoniae strain HHHS1 was isolated and characterized using
16sRNA gene sequencing and VITEK-II and used for extracellular synthesis of AgNPs by cell free supernatant of BHI
culture media. Conditions of synthesis were optimized and biogenic AgNPs were characterized physically using SEM,
EDS, AFM and XRD and biologically by examining for antibacterial, antibiofilm and antioxidant activity. Sequencing
of 16sRNA gene and distance tree analysis revealed that the isolated K. pneumoniae is a new strain submitted to the
NCBI as HHHS1. SEM, EDS, AFM and XRD analysis for biogenic AgNPs fabricated by this strain revealed spherical,
monodispersed NPs with average size 21.9 nm. Optimum conditions of the synthesis environment were found: pH 8,
370C, 8h, substrate concentration was found proportional to AgNPs characteristic.
Key words :Nanotechnology, nanobiotechnology, K. pneumoniae, optimization, characterization, optimization, silver resistance,
silver rich soil, 16Srna sequencing, HHHS1.

INTRODUCTION nitrate reduction and regarded as metabolically versatile

Nanobiotechnology is a new discipline of nanoscience bacteria (Mortlock and Bartkus, 1992; Pal et al, 2015).
emerged by interception of nanotechnology and Therefore, isolation and identification of the most potent
biotechnology. Along the span of nano-techniques microorganism for NPs biosynthesis is a part of the
evolution, the need for green and ecofriendly, optimization of nanobiosynthesis process.
biocompatible and cost effective approaches has emerged Morphological features including size, shape,
as the need-of-the-hour. Investigators, therefore, oriented homogeneity and dispersity of the produced nanoparticles
their projects towards bio-systems for their belonging to is highly correlated to the biological activities of the
the biosphere part of the environment. Microbial systems nanomaterials (Imtiyaz et al, 2016; Masarudin et al,
are highly-organized, regarding metabolic pathways, 2015). Size and shape control can be controlled by
capable of synthesizing size and structure controlled optimizing conditions of the synthesis environment such
nanoparticles. In addition, biogenic nanoparticles often as pH, substrate concentration, time of incubation and
are biocompatible and either colloidal in water or water incubation temperature (Aldujaili et al, 2017).
soluble, a crucial property for many applications. Silver nanoparticles are biocompatible material,
Soil is largest depository of microorganisms; it therefore; AgNPs gets specific attention by researchers
includes a wide diversity of microorganisms adapted to for applicability of their biomedical characteristics
habitat environments of different composition (Bilkisu (Antimicrobial and Antibiofilm action, in addition to their
and Babatunde, 2015). The only microorganisms that unique physicochemical, biological features and their
successes in a unique environment are those have the applications in the field of medicine, electronics and optics
machinery to resist and detoxify noxious components in (Bhimba et al, 2015; Kannaiyan et al, 2015).
the environment. Silver metal is known to have Several approaches are used for synthesis of
antimicrobial effect (Ouay and Stellacci, 2015), nanoparticles assorted under physical chemical and
Klebsiella pneumoniae encodes for silver resistant biological techniques; biological techniques are preferred
machinery and the pathways for nitrogen fixation and
2534 Hussein Hameed Hassan and Nawfal Hussein Aldujaili
over physical and chemical approaches due to ecofriendly Sequencing and Sequence Alignment
and cost effectiveness of the bio-approaches (Narayanan The PCR products were separated on a 2% agarose
et al, 2011; Thampi et al, 2015). Bacterial species have gel electrophoresis and redsafe stained gel was
been used for synthesis of AgNPsextracellularly and found documented at 302 nm. PCR product was sequenced at
to be adequate to variety of applications (Mohanpuria et the national instrumentation center for environmental
al, 2008; Chaudhari et al, 2012), including production management (nicem) (http://nicem.snu. ac.kr/ main/
of effective new generations of antimicrobial agents that ?en_skin= index.html) using DNA Sequencer 3730XL,
struggle the increasing MDR microorganisms (Karthick Applied Biosystem. Homology search was conducted
et al, 2016). Therefore, the present investigation has been using (BLAST) available at NCBI. Multiple alignments
designed for optimization; biosynthesis and were performed using BioEdit program.
characterization of silver nanoparticles using K.
Biosynthesis of AgNPs using cell free supernatant
pneumoniae strain HHHS1 isolated from silver rich
environment and assessment their antimicrobial activity. Silver nanoparticles were biosynthesed by K.
pneumoniae HHHS1 using AgNO3 as a substrate. AgNO3
METHODOLOGY
was optimized by using serial concentrations (1, 2.5, 5,
Preparation of cell free supernatant of K. pneumoniae 7.5 and 10mM) to cell free supernatant flasks, which
Klebsiella pneumoniae was selected from screening mixed. This step was prepared in dark condition to avoid
of many different bacterial isolates from silver-rich soil oxidation of AgNO3. The optimum pH for synthesis of
samples based on their resistance to commercial AgNPs AgNPs was detected by adjusting serial pH values (pH:
and the opportunity for extracellular biosynthesis of 5, 6, 7, 8, 9 and control). The resultant solutions were
AgNP. Klebsiella pneumoniae inoculated Brain Heart incubated in shaking incubator 150 rpm at 37°C for 24
Infusion broth (BHI) was incubated under aerobic hrs. Incubation temperature was optimized by applying
condition at 37°C for 24 hrs. Colonies were identified as serial temperatures (22, 27, 32, 37, 42, 47 and 50oC) and
K. pneumoniae after morphological, biochemical incubated in a shaking incubator at 200 rpm. The optimum
investigation using VITEK and 16sRNA sequencing (Holt conditions were used in the synthesis of AgNPs in 1liter
et al, 1994). Broth culture was centrifuged at 4500xg for flask.
20 min, 4°C to prepare the cell free supernatant (CFS) After incubation, colour change from yellowish to
from K. pneumoniae culture. Cell free supernatant was brown indicates the production of AgNPs. Reaction
used for biosynthesis of silver nanoparticles (Chaudhari solution was centrifuged at 10000 rpm for 25 min, 4°C,
et al, 2012). the supernatant was discarded and pellet resuspended in
Molecular identification of K. pneumoniae distil water and washed five times with distil water and
Genomic DNA was extracted from K. pneumoniae one time with ethanol at the same conditions and dried in
using G- spin DNA extraction kit (Cat #17045 intron oven at 50°C for 18-24 hours. The dehydrated residue
biotechnology/Korea), according to the manufacturer was carefully collected and subjected for subsequent
instruction. The concentration of DNA was determined analysis (Chaudhari et al, 2012; Sarvamangala et al,
spectrophotometrically by measuring its OD at 260 nm. 2013).
DNA purity was indicated by OD260/OD280, which was Characterization of silver nanoparticles
in the range of 1.8±0.2 for pure DNA (Stephenson, 2003). XRD analysis
The PCR was performed to identify K. pneumoniae Silver nanoparticle was subjected for X-ray
using universal primers for 16S rRNA gene, foreword diffraction characterization in the department of Geology,
primer (8fpl) 5‘AGAGTTTGATCCTGGCTCAG 3‘ and Faculty of Science, Baghdad University.
reverse primer (1492rpl)
SEM analysis
5‘GGTTACCTTGTTACGACTT 3‘.
SEM analysis was performed using electron
The (1239 bp) PCR Product was immigrated on a
microscope model (Inspect S50 FEI) for the
1% agarose gel stained with RedSafe stain and
characterization of the morphology of AgNPs at unit of
documented by UV gel document.
electron microscopy in the Faculty of Science, University
Gel extraction Protocol for (Sequencing) of Kufa. The microscopy was at an acceleration voltage
Absolute ethanol was added to the wash buffer prior 15 KV and low vacuum, spot size 4 and working distances
to initial use. The workflow of Vogelstein and co-workers 5-10mm (Natarajan et al, 2014).
(1979) were used for Gel Extraction DNA.
 Characterization and optimization of AgNPs biosynthesis by K. pneumoniae 2535
Table 1 : The optimum PCR conditions (Rajeshkumar and Malarkodi, 2014; Ourlad Alzeus G
No. Phase Tm ( C) 0
Time No. of cycle Tantengco et al, 2016).
1- Initial Denaturation 0
95 C 3 min. Antibiofilm activity of silver nanoparticles
2- Denaturation -2 0
95 C 45sec Three concentrations (100, 150, 200ug/ml) of each
3- Annealing 520 C 45sec 40 cycle biogenic AgNPs and commercial AgNPs was prepared.
0.1ml of cell suspension having 0.5 O.D600 have been
4- Extension-1 720 C 50sec
inoculated in 1.9 ml TSB medium, 150ul of the cultured
5- Extension -2 720 C 10 min. TSB then transferred into each well of 96-well
microtiterplate in use. 50 ul of each concentration was
Table 2 : Standard pathogenic bacteria examined for antimicrobial
characterization of the AgNPs.
added to the corresponding wells. 200 µl of autoclaved
distilled water was added in peripheral wells (to reduce
Gram -ive Gram +ive
the water loss). Microtiterplate was Incubate for 16 h at
Proteus mirabilis Kocuria spp
37oC. Planktonic cells then aspirated and fixed with 99%
Shigella soni Staphylococcus aureus
methanol. Plates then washed twice with phsphate buffer
Salmonella typhi
saline or sterile saline water and air-dried. 200 µl of crystal
Klebsiella pneumonia
violet solution (0.2%) then added to all wells. After 5
Enterobacter spp
min, excess crystal violet was removed and washed twice.
Serratiam arcescens
After that the plate was air dried and the cell bound crystal
E. coli
violet was dissolved in 33% acetic acid. Biofilm growth
Sphingomonas paucimobilis
was Read at O.D570 nm using micro plate reader modified
Pseudomonas aeroginosa
from (Shukla and Rao, 2017).
EDS analysis Antioxidant activity of biogeneic silver nanoparticles
Bruker EDS linked to SEM was used to analyze in vitro
elemental composite ratio of single particle at the unit of 1, 1-diphenyl-2-picrylhydrazyl (DPPH) free radical
electron microscopy, Faculty of Science, University of scavenging assay was used to evaluate the ability of the
Kufa. EDS point analysis was performed at accelerating commercial AgNPs and biogenic AgNPs fabricated by
voltage 10 KV, working distances 10mm and spot size 5 Klebsiella pneumoniae HHHS1 strain to eradicate the
(Sarvamangala et al, 2013). DPPH free radical (Thaipong et al, 2006) with some
AFM analysis modification. DPPH was diluted till we get absorbance
of about 0.98±0.02 used as control and methanol was
Atomic force microscope (AFM) was used for used as blank. The biogenic AgNPs from Klebsiella
characterization of the 3D profile, dispersity and mean pneumoniae HHHS1 strainand commercial at
particulate size of silver nanoparticle. AFM analysis was concentrations of (0.75, 1.5 and 2 mg/ml) methanol were
performed at the Department of Chemistry, Faculty of assayed. 3ml of DPPH working solution was mixed with
Science, Baghdad University. 100 µl of biogenic AgNPs separately, this was performed
Antibacterial activity of nanoparticles for the thee concentrations. Commercial AgNPs was
Biogenic silver nanoparticles (AgNPs) were mixed independently with DPPH in the same manner. The
biosynthesized by Klebsiella pneumoniae HHHS1 strain reaction mixtures were incubated for 30 min in dark room
were examined for their antimicrobial activity against at 37°C and the absorbance (A) was read at 517 nm in
different types of pathogenic bacteria, including both spectrophotometer for the test (T) and the experiment was
Gram negative and Gram positive bacteria (Table 2) using repeated for three times. The inhibition of the DPPH
agar well diffusion method. radical by biogenic AgNPs was calculated according to
the following formula (Garcia et al, 2012; Ahmed et al,
Standardized suspension of each tested bacteria (1.5x
2015):
cfu/ml) by McFarland standard (0.5N) was swabbed
separately onto sterile Brain Heart Agar (BHA) plates [(AbsC – AbsB) – (AbsT – AbsB)] × 100
% Antioxidant = ____________________________________________________
using sterile cotton swabs. Agar was digged with sterilized (AbsC – AbsC)
cork borer 6 mm and 100µl from biogenic AgNPs from
RESULTS
Klebsiella pneumoniae HHHS1 strain and commercial
AgNPs were added into each well. After incubation for Macroscopic identification
24 hours, at 37°C, Petridishs were examined for the Colonies appear small smooth slimy and foul odor
inhibition zone diameter measured in millimetre with. By repeated sub-culturing K. pneumoniae HHHS1
2536 Hussein Hameed Hassan and Nawfal Hussein Aldujaili
strain retains colonial slimy and smoothness (Fig. 1).
Microscopic identification
Microscopic examination under oil immersion
(1000X) revealed gram negative short bacilli with slightly
weak counter staining properties K. pneumoniae isolate
HHHS1 (Fig. 2).
Identification using VITEK2
K. pneumoniae isolate S1 were identified using a
VITEK 2 automated compact system with GN/ID card
with 64 biochemical tests. Referring to the report of the
results, S1 isolate was identified after 4 hours as Klebsiella Fig. 1 : Macroscopic illustration of the strain S1, the figure shows
pneumoniae spp pneumonia with probability of 94% colonial morphology and cultural characteristics.
(Table 4).
Molecular identification
In addition to biochemical identification, isolates was
identified through 16sRNA sequencing by amplification
and extraction of this gene.
Extraction of genomic DNA
Genomic DNA has been extracted according the
manufacturer protocol and electrophoresed on Agarose
gel documented using gel document. The resulted UV
document reveals three bands having the same
electrophoretic level indicating the presence of genomic Fig. 2 : Microscopic images of the three Klebsiella isolate S1,
DNA (Fig. 3). The three samples of DNA, was used as 1000X amplified under oil immersion lens.
templates for PCR while amplification of 16sRNAgene.
from enterobacteriacea (Fig. 6).
Amplification of 16sRNA gene
Optimization of synthesis conditions
Genomic DNA templates, extracted and approved by
Before production of biogenic AgNPs, environmental
agarose gel electrophoresis were used in the amplification
conditions (PH, substrate concentration, Temperature and
of 16sRNA gene using 16sRNA gene universal primers.
Time) have been optimized.
The product of PCR then electrophoresed on Agarose gel
and documented on gel document. The resulted 16sDNA pH optimization
bands were1250bp in size (Fig. 4). The bands then Among the 5 pH levels investigated (5, 6, 7, 8 and
extracted for sequencing. 9), based on antimicrobial activity of the biogenic AgNPs
Sequencing the 16sRNA gene measured by inhibition zone diameter in millimetres and
colour change, optimal Bio-Nano-Synthesis activity was
The results of 16sRNA gene sequencing was received
at pH 8 (Table 6).
online and aligned to NCBI database using Blast software
and submitted to NCBI through Sequin software. Data Optimization of substrate concentration
of S1 strain made available to ENA in Europe and the Substrate (AgNO3) concentration have been
DNA Data Bank of Japan at the locus (MG372007), optimized using 5 concentrations (1, 2.5, 5, 7.5 and 10)
accession (MG372007), version (MG372007.1), defined mg/ml of AgNO3 as a substrate nano-bio-synthesis using
as Klebsiella sp. strain HHHS1 16S ribosomal RNA gene, Klebsiella strain HHHS1, results showed that the
partial sequence, author name. productivity was proportional to substrate concentration
Pairwise alignment (Table 7).
Pairwise alignment and distance phylogeny has been Optimization of incubation temperature
investigated for bacterial 16sRNA gene sequences through Incubation temperature of extracellular AgNPs
BLAST online. The strain HHHS1 found to be nearest biosynthesis have been optimized by applying 7 incubation
neighbour to Klebsiella pneumoniae strain ATCC 13883 temperatures (22, 27, 32, 37, 42, 47 and 500C). Based on
with identity 98% and E-value 0.0 (Table 5) and rooted colour change and antimicrobial activity of the produced
 Characterization and optimization of AgNPs biosynthesis by K. pneumoniae 2537
showed optimum production at 8h, on the basis of colour
change, and antimicrobial activity of the produced AgNPs
against standard bacteria (pseudomonas sp.) (Table 9).
Production of AgNPs
Klebsiella pneumoniae strain HHHS1 found to be
potent for extracellular biosynthesis of AgNPs using cell
free supernatant after addition of silver nitrate (AgNO3)
as a substrate at optimum conditions that have been
optimized previously. During incubation in shaking
incubator at 200 RPM, colour change of the reaction
mixture from yellow to reddish brown represents an
Fig. 3 : Gel electrophoresis of genomic DNA on 1% Agarose gel at indicator for biosynthesis of AgNPs-. It’s found that colour
5 vol /cm for 1:15 hour.
of the reaction medium was changed from yellowish to
reddish brown (Fig. 8).
Characterization of biogenic AgNPs
The results of biogenic AgNPs characterization have
been sorted as follows:
Antimicrobial activity
Antibacterial activity represents the gold standard
characteristic of ofAgNPs. Biogenic AgNPs synthesized
by Klebsiella pneumonia strain S1 have been evaluated
for their antimicrobial activity against some clinical
bacteria using agar well diffusion method. Commercial
AgNPs was used as control for this investigation (Table
10).
It’s found that, at concentration of 150µg/ml, gram
Fig. 4 : PCR produce bands with size 1250 bp. The product was positive bacteria showed the largest inhibition zone in
electrophoresed on 2% Agarose at 5 volt/cm2. TBE buffer
1x for 1:30 hours. L: DNA ladder (100). F1 DNA of 16sRNA
Staphyllococcus aureous produced by AgNPs fabricated
gene of the three final isolates, from (Iron, Gold and Silver) by Klebsiella pneumonia S1 (18mm) compared to
rich environment. commercial AgNPs which was resisted by all the studied
Table 3 : The results of biochemical identification of S1 isolate using VITEK2, the results include the probability and confidence estimation
of the diagnosis.

AgNPs against standard bacteria (Pseudomonas sp.), gram positive bacteria. On the other hand, among the
results showed optimum production at 37 oC, with studied gram negative bacteria, AgNPs fabricated by
diminished activity at 52oC for the production (Table 8). Klebsiella pneumonia S1 revealed that Pseudomonas
Optimization of time of production auroginosa have been recorded to have the largest
inhibition zone (32mm), followed by Klebsiella
Incubation time for extracellular AgNPs biosynthesis
pneumoniae (24mm) and E. coli (23mm), respectively.
has been optimized by incubation of the production
medium for 34h with 4h sampling precision. Results The results showed that gram negative bacteria were
2538 Hussein Hameed Hassan and Nawfal Hussein Aldujaili
Table 4 : Sequences producing significant alignments with S1 16s RNA gene sequence.
Description Query cover E value Identity Accession
K. pneumoniae strain ATCC 13883 16S rRNA gene, partial sequence 98% 0.0 98% NR_114506.1
K.pneumoniae strain JCM166216S rRNA gene, partial sequence 98% 0.0 98% NR_112009.1
K.pneumoniae strain DSM 3010416S rRNA gene, partial sequence 98% 0.0 98% NR_036794.1
K.pneumoniae strain DSM 3010416S rRNA gene, partial sequence 98% 0.0 98% NR_117686.1
K.pneumoniae strain DSM 3010416S rRNA gene, partial sequence 98% 0.0 98% NR_117684.1
K.pneumoniae strain DSM 3010416S rRNA gene, partial sequence 98% 0.0 98% NR_117683.1
K.pneumoniae strain ATCC 13883 16S ribosomal RNA gene, partial sequence 98% 0.0 97% NR_119278.1
K.pneumoniae strain NBRC 14940 16S rRNA gene, partial sequence 98% 0.0 97% NR_113702.1

Table 5 : Inhibition zones produced by AgNPs fabricated at different (negative antioxidant activity (–AI%) (Table 10).
pH values.
Antibiofilm activity
Inhibition zone in (mm) against pseudomonas
pH Biofilm is the most important feature of some bacteria
S1
that enhance attachment of bacteria to the surfaces surgical
5 21 tools and prosthetics. Therefore, it is targeted by
6 22 bionanotechnology researchers. AgNPs fabricated by
7 18 HHHS1, and commercial AgNPs were examined for
8 23 antibiofilm activity using different concentrations (3mg/
9 19 ml, 1.5mg/ml, and 0.75mg/ml) via plate method against
Table 6 : Inhibition zone produced by AgNPs produced five strains of bacteria including G +ive and G –ive.
extracellularly by Klebsiella strain HHHS1 using different Results (Table 11) revealed that the antibiofilm activity
AgNO3 concentrations. varies according to the targeted bacteria and the source
Inhibition zone in (mm) produced by of AgNPs applied.
substrate concentration
Strain Against Shigella sonnei, both commercial AgNPs,
1mM 2.5mM 5mM 7.5mM 10mM
and biogenic AgNPs showed significant antibiofilm
S1 10 11 14 15 18 activity inversely proportional to the concentration.
Table 7 : Optimization of incubation temperature applied for Against Salmonella typhi, commercial AgNPs showed
synthesis of AgNPs by HHHS1 strain indicated by significant antibiofilm activity inversely proportional to
inhibition zone measured in (mm). the concentration; on the other hand biogenic AgNPs
Inhibition zones at expressed significant antibiofilm activity at AgNPs
Strain
22O C 27O C 32O C 37OC 42OC 47OC 52O C concentration of (3mg/ml). Against Klebsiella
S1 20 19 18 23 21 19 -ive pneumoniae, commercial AgNPs expressed significant
antibiofilm activity with highest activity at AgNPs
higher sensitive than gram positive bacteria to both concentration of (3mg/ml), while AgNPs showed
biogenic and commercial AgNPs and biogenic AgNPs significant antibiofilm activity at AgNPs concentrations
showed higher activity than commercial AgNPs (Table of (3 and 0.75mg/ml). Against Aeromonas sobria,
10). commercial AgNPs expressed significant antibiofilm
Antioxidant activity activity with highest activity at AgNPs concentration of
Free radical’s scavenging assay using (DPPH) as a (1.5mg/ml); biogenic AgNPs expressed significant
free radical oxidant, were used to detect the antioxidant antibiofilm activity with highest activity at concentration
activity of the biogenic AgNPs fabricated by Klebsiella of (0.75mg/ml). Against Staphylococcus aureus,
pneumonia strain HHHS1. Antioxidant activity was commercial AgNPs expressed significant antibiofilm
measured colorimetrically at wave length 517nm, decrease activity proportional to the AgNPs concentration; while
absorbance indicates scavenging of free radicals by biogenic AgNPs expressed significant antibiofilm activity
AgNPs (antioxidant activity). Results revealed that with highest activity at concentration of (0.75mg/ml).
biogenic AgNPs fabricated by Klebsiella pneumonia Results revealed that biogenic AgNPs presents higher
strain HHHS1 deviates from the results of many antibiofilm activity than commercial AgNPs.
researchers. Antioxidant activity of AgNPs fabricated by Physical characterization of biogenic AgNPs
Klebsiella pneumonia showed increased absorbance over Physical characteristics of AgNPs are represented by
the control indicating increase in the oxidant activity
 Characterization and optimization of AgNPs biosynthesis by K. pneumoniae 2539

Fig. 6 : Phylogenetic distance tree showing the lineage of S1 strain and neighbourhood to other members of enterobacteriacea.

Table 8 : Optimization of incubation time used for synthesis of

AgNPs by HHHS1 strain, indicated by inhibition zone
measured in (mm).
Inhibition zones at
Strain
0h 4h 10h 24h 28h 34h
S1 13 14 18 14 0 14

The process of silver ions reduction into elemental silver

improved by the presence of elemental silver through
recording of the spot profile mode of the EDS spectrum.
Several signals was detected, the strongest one was
reflected by silver, while the medium signal was reflected
Fig. 8 : Biosynthesis of silver nanoparticles in BHI broth by K.
by oxygen and the other weaker signals was reflections
pneumoniae HHHS1 strain, colour changed from yellowish from other atoms (Fig. 10). The percentage of elemental
before synthesis to reddish brown after synthesis. constituents weight of the AgNPs fabricated by S1strain
was 76.93% silver and 23.07% oxygen (Fig. 10). Optical
SEM, EDX, AFM and XRD.
absorption peak of biogenic AgNPs have been detected
Scanning Electron Microscopy (SEM) analysis at 3keV, which is atypical absorbance of metallic AgNPs.
Scanning Electron Microscopy analysis results Atomic Force Microscopy (AFM)
revealed that different strains exhibited different biogenic
Atomic force microscope image of AgNPs fabricated
AgNPs characteristics. Scanning Electron Microscopy
by strain S1 have been used to describe the morphology,
analysis of biogenic AgNPs fabricated by S1 strain
the average diameter and the roughness of AgNPs. Both
showed homogenous, mono-dispersed NPs and the most
etching time and current density have been used to control
predominant shape found to be spherical (Fig. 9).
shape and size of the final structure. Analysis of AFM
Energy Dispersive X-Ray Spectroscopy (EDS) imaging of the biogenic AgNPs fabricated by S1 strain
Energy Dispersive-x-ray Spectroscopy (EDS) have revealed that the average diameter was 62.88nm (Fig.
been used in the quantitative assessment of AgNPs through 12).
detecting the peaks of optical absorption by silver metal.
2540 Hussein Hameed Hassan and Nawfal Hussein Aldujaili

Fig. 9 : SEM Micrograph of silver nanoparticle fabricated by Klebsiela sp. Strain (HHH S1).

Fig. 10 : EDS point analysis spectrum of AgNPs film biosynthesized by HHHS1 strain showing availability and abundance of AgNPs.

X-Ray Diffraction analysis (XRD) DISCUSSION

X-ray diffraction pattern of the biogenic AgNPs Screening of bacteria for AgNPs biosynthesis
showed intense peaks at 2θ = 37.749, 43.916, 63.833, Bacteria that have potential to endure high
and 76.666 corresponding to arround the lattice planes concentrations of heavy metals are habitat environment
indexes 111, 200, 220 and 311 respectively (Fig. 13). since they inbuilt diverse biochemical, physiological, and/
Based on face centered cubic silver structure (FCC), the or genetic encoded machineries. These mechanisms play
resulted lattice planes were indexed by referring to JCPDS as potential means for bioremediation of polluting heavy
data file number (04-0783). Debye-Scherrer equation have metals (Fashola et al, 2016).
been used to calculate the average size of AgNPs Upon exposed to metal ions, microbes develops
fabricated byHHHS1 strain, the result was (21.918) nm. insignificant duty to fight metal stress. Metal-microbe
Diffractograms of XRD shows that HHHS1 strain relationships have organized for a crucial role in many
produces average AgNPs crystallite size 21.9 nm, and applications of biotechnology by establishing for
the average dislocation was 39.33, while average strain investigation and apply those MOs as potential bio-
21.22. machines for fabrication of metallic NPs (Ojuederie and
Babalola, 2017).
 Characterization and optimization of AgNPs biosynthesis by K. pneumoniae 2541
to be quantitatively and qualitatively proportional
to the product. The optimum incubation time for
production of AgNPs reached after 8h. Variation
in optimal conditions of the nanobiosynthesis
process supported by the fact that the
nanobiosynthesis is an enzymatically catalyzed
mechanism and the enzymes varies in their optimal
conditions (Hans, 2014). Colour change from
yellow to reddish brown represent distinct
evidence for the formation of silver nanoparticles
in the reaction mixture as a result of reduction of
ionic (Ag+) in to elemental silver (Ag0) mediated
by a variety of reducing agents in the culture
supernatants which were documented as eco-
friendly (Sreedevi et al, 2015; Aldujaili et al,
2017).
Fig. 12 : AFM analysis, the figure shows topography and Granularity Extracellular method was found to be the gold
Cumulation Distribution report. 3D characterization of biogenic standard approach for size-controlled fabrication
AgNPs fabricated by S1 strain. of AgNPs. Parameters of the biosynthesis
environment using culture supernatant can be easily
maintained and modified compared to the biomass
approach, where the buffering living system in the in
vivo biomass method tend to maintain constant
environment by excretory prteins such as curli, Biofilm
and heat shock proteins thus requires more purification
(Gurunathan et al, 2009; Krishna et al, 2017). Not all
organisms have the potential for nanobiosynthesis.
Exact mechanismsresulting in the formation of biogenic
AgNPs is not strictly predicted yet. Silver-resistant
organisms that inherent Silver resistance machinery (sil
gene) are supreme organisms for AgNPs biosynthesis.
Constituents of extracts of the microbial culture
(supernatant) may act both as reducing and capping
Fig. 13 : XRD report, lattice planes resulted by AgNPs fabricated by S1
strain, indexed to JCPDS data file number (04-0783).
Table 9 : Antimicrobial activity measured by inhibition zone in mm
Present investigation NBS have been optimized by of different pathogenic bacteria produced by AgNPs
fabricated by Klebsiella pneumonia HHHS1 and
screening of many MOs from silver rich environment and commercial AgNPs at concentration of (150 µg/ml).
isolation of the optimal strains for nanobiosynthesis. The
Inhibition zone (mm) produced
optimal strain was a new K. pneumoniaestrain which was by AgNPs from
submitted to the NCBI as HHHS1 with accession number Test bacteria
S1 C
(MG372007.1), respectively. This result supported by the
Proteus mirabilis R R
fact that Klebsiella contains inherent pathways involving
Shigella soni 16 10
nitrogen assimilation and control such as (nacK gene)
Salmonella typhi 19 R
(Muse and Bender, 1998) and nitrogen fixation and nitrate
Klebsiella pneumonia 24 R
reduction such as (nif gene) (Cali et al, 1989).
Enterobacter spp 21 R
Optimization of AgNPs biosynthesis Serratiam arcescens 17 R
K. pneumoniae HHHS1, exhibits optimum E. coli 23 R
production at Alkaline pH (8). The optimum incubation Sphingomonas paucimobilis 15 10
temperature for the production mixes prepared for AgNPs Pseudomonas aeroginosa 32 R
biosynthesis found to be 370C. Concentration of substrate Kocuria spp 11 R
(AgNO3 mg/ml) used in the production of AgNPs found Staphylococcus aureus 18 R
2542 Hussein Hameed Hassan and Nawfal Hussein Aldujaili
Table 10: Antioxidant activity of the biogenic AgNPs fabricated by threshold limit of AgNPs concentration. The resistance
Klebsiella strain HHHS1. mechanism that the MO follow to override threshold limit
Antioxidant Index (AI%) of AgNPs concentration varies from one MO to another.
Concentration of AgNPs(mg\ml)
S1 Extracts from bio-organisms may act both as reducing
3 -6.35362
and capping agents in AgNPs synthesis (Fatima, 2017).
1.98 -5.1498 Morphology of the NPs can be controlled by adjusting
1.5 -5.69806 the conditions of the reaction environment (temperature,
0.75 -2.01567 pH, incubation time and substrate concentration)
0.00 0 (Gurunathan et al, 2009). Standardization of such
conditions would be desirable; however a
Table 11: Antibiofilm activity of commercial and biogenic AgNPs at different
concentrations expressed by absorbance at 630nm against several
variety of the characteristics of various
pathogenic G +ive and G -ive bacteria. enzymes prevents unification of those
Absorbance (630nm) after
parameters. For this reason, specific
Concentration of treatment with AgNPs characteristics of particular enzyme determine
Bacteria Cont. special catalytic conditions, which can diverge
AgNPs (mg/ml) Commer. S1
significantly from recommended conditions
3.00 0.470 0.301
(Bisswanger, 2014). This idea supports the
Shigella sonnei 1.50 0.883 0.332 0.252 variation in the optimal conditions obtained
0.75 0.280 0.249 by present study. Present study disagreed with
3.00 0.745 0.317 Gurunathan (2009), which hypothesized that
Salmonella typhi 1.50 1.59 0.536 0.463
“at acidic pH the AgNPs synthesis decreased
and there will be less silver crystal nucleation
0.75 0.344 0.456
and formation and vis versa reaching to pH10”
3.00 0.221 0.511 (Gurunathan et al, 2009; Sanghi and Verma,
Klebsiella pneumoniae 1.50 2.784 2.686 0.790 2009). Present study revealed that the nature
0.75 2.692 0.458 of the environment dictate the optimum
3.00 0.361 0.289
biosynthesis conditions. Klebsiella HHHS1
extract produced AgNPs at optimum pH 8.
Aeromonassobria 1.50 2.776 0.248 2.751
Biological characterization of biogenic
0.75 0.425 0.210
AgNPS
3.00 0.849 1.193
Antimicrobial activity
Staph. aureus 1.50 2.660 1.285 2.104
Because of the emergence of increasing
0.75 2.324 1.120
multi drug resistance (MDR) threat, scientific
agents in the course of AgNPs synthesis (Sütterlin et al, community puts their duty to search the
2014; Singh et al, 2015; Elias et al, 2017). efficient alternative to replace traditional resisted
Nitrate reductase produced by Klebsiella sp found antibiotics. Nanoparticles are now considered a viable
to work at optimum pH rangingfrom (6.5-7.5), which may alternative and synergizing to the traditional antibiotics
be responsible for bioreduction of Ag+ to Ag0 and and seem to have a high potential to solve this problem.
aggregation in to AgNPs (Cole and Brown, 1979; Recently, AgNPs were considered an attractive target for
Ranganath et al, 2012). Aldehyd group present in the the fabrication of a new generation of antimicrobials (Le
external polysaccharides secreted by the Klebsiella sp. Ouay and Stellacci, 2015; Singha et al, 2017).
complicated in the reduction of silver ions to silver metal Biogenic AgNPs were examined to assess their
(Durán et al, 2011; Siddiqi et al, 2018). The shortest antibacterial activity against gram-positive and gram
incubation time to start synthesis of nanoparticles has negative bacteria using agar well diffusion method.
been documented using Pseudomonas aeroginosa, where Biogenic AgNPs depicted significant but variable
biosynthesis of silver nanoparticles was detected within antibacterial effects on gram positive and gram negative
2 hours after treatment of the reaction mix with AgNO3 bacteria except Proteus mirabilis. Antibacterial activity
(Ramalingam et al, 2014). Organisms that inherent sil against test bacteria was observed to vary regarding the
gene (Silver resistance machinery) can synthesize silver source of biogenic AgNPs applied. This results in
nanoparticles indicating that each MO has its own agreement with Wypij et al (2017).
 Characterization and optimization of AgNPs biosynthesis by K. pneumoniae 2543
Differential susceptibility to AgNPs among G+ and immune system. Due to the lack of effective antibiofilm
G- bacteria might attributed to the structural differences antibiotics, Nanoparticles were used as a candidate
between G+ and G- cell envelop and cuorum sensing antibiofilm substance, AgNPs found to show anti-biofilm
(Kêdziora et al, 2018). Differential susceptibility among activity (Donlan and Costerton, 2002; Markowska et al,
G+ or G- members might attributed to diversity in the 2013; Faller and Kohler, 2017; Aldujaili et al, 2017).
intrinsic resistome i.e. (efflux and other resistance Biogenic and commercial AgNPs were examined for
machineries, presence and strength of silver resistance antibiofilm activity using different concentrations (3mg/
plasmid containing sil gene) (Olivares et al, 2013; ml, 1.5mg/ml and 0.75mg/ml) following 96 microtiter
Sütterlin, 2014). Differential antimicrobial activity among plate method against five strains of bacteria including G
biogenic AgNPs fabricated by different bacteria (even +ive and G –ive. Results revealed that the antibiofilm
strains from the same species) attributed to the variation activity varies according to the targeted bacteria and the
in the capping molecules and the physical characteristics source of AgNPs applied.
of the NPs such as size, shape and dispersity (Saleh and
Several mechanisms proposed to interpret the
Yousaf, 2018).
variations in the extant of and antibiofilm activity of
Antioxidant activity AgNPs: Inhibition of biomass production, Inhibition of
Free radical’s scavenging assay using (DPPH) as a the gene expression of quorum sensing genes (QS genes),
free radical oxidant were used to detect the antioxidant Inhibition of secretion of Biofilm and Alteration Biofilm
activity of the biogenic AgNPs fabricated by Klebsiella structure and reduce adhesivity (González et al, 2015;
pneumonia strains HHHS1. Antioxidant activity was Schmidt et al, 2017).
measured colourimetrically. Normally the colour of the Physical characterization of biogenic AgNPs
solution change from deep violet to yellowish-orange as
Biogenic AgNPs fabricated by Klebsiella
a result of scavenging of free radicals by AgNPs measured
pneumoniae HHHS1 were characterized visually and
by absorbance at wave length 517nm (absorbance of
using SEM, EDX, AFM and XRD assays.
DPPH), absorbance hypothesized to inversely
proportional to the antioxidant activity. At 517 nm, color The initial approval of the extracellular biosynthesis
of DPPH attributed to the presence of an odd electron. of silver nanoparticles were achieved by the observation
When present, an antioxidant donates an electron to the the colour change due to the excitation of surface plasmon
DPPH molecule and quenches the color. A change in the vibrations (SPR) of the synthesized AgNPs. The
color (discoloration) (formation of DPPH-H) would lower conversion of extracellular medium colour clearly
absorbance. Since the control is showing highest indicates the fabrication of AgNPs (Luo et al, 2018).
absorbance (Xie and Schaich, 2014). Scanning electron microscope was used to determine
Present study revealed absorbance near to/ higher than the shape and size of biogenic AgNPs, results displayed
the control (DPPH alone) would might attributed to a well-dispersed, spherical AgNPs. This result supported
carotenoids produced by Klebsiella sp (Boontosaeng et by the results of Luo et al (2018), they found that the
al, 2016). This results supported by the work of Hao et physical characteristics highly affected and determined
al (2015), which declared that the radical portion of the by the composition of the reaction environment (Luo et
molecule is a nitrogen atom located at the center of the al, 2018).
structure. While this centralized location is freely Energy dispersive spectroscopy analysis detected the
accessible to small molecules, larger molecules proteins presence of elemental silver, which indicated the reduction
may have limited access to the radical portion due to the of silver ions to silver metal in the reaction mixture. The
3D hindrances. In addition, materials like carotenoids also percentage weight of elemental constituents of the AgNPs
have a strong absorbance at the same wavelength as fabricated by K. pneumoniae HHHS1 strain was
DPPH, which will interfere with this assay (Hao et al, (76.93%) silver and (23.07%) oxygen. The high weight
2015). percentage of silver indicates the reduction of silver ions
Antibiofilm activity into elemental silver. The optical absorption peak was
compatible to the absorption of silver nanocrystallites
Biofilm is a viscous matrix in which bacterial caused by SPR indicating that the existed element was
community imbedded, biofilm enhance attachment of silver. Another weak signal from oxygen was observed,
bacteria to the surfaces of certain part of the body, surgical the presence of peaks from oxygen together with the Ag
tools and prosthetics causing health difficulties including peak, indicate that the AgNPs are capped by biomolecules
antimicrobial resistance and and tolerance to the human through oxygen atoms. Other small peaks observed
2544 Hussein Hameed Hassan and Nawfal Hussein Aldujaili
attributed to the bio molecules present in the cell-free Ourlad Alzeus G Tantengco, Marlon Lian C Condes, Hanna Hasmin
medium during synthesis (Bonnia et al, 2016). T Estadilla and Elena M Ragragio (2016) Antibacterial activity
of Vitex parviflora A. Juss. and Cyanthillium cinereum (L.)
XRD analysis for AgNPs fabricated by K. H.Rob. against human pathogens. Asian Pac J Trop Dis. 6(12),
pneumoniae HHHS1 strain showed four Bragg reflections 1004-1006.
at four diffraction peaks corresponds to the planes of (1 1 Narayanan K B and Sakthivel N (2011) Green synthesis of biogenic
1), (2 0 0), (2 2 0) and (3 1 1) respectively, which can be metal nanoparticles by terrestrial and aquatic phototrophic and
heterotrophic eukaryotes and biocompatible agents. Adv Colloid
indexed according to the facets of face centered cubic
Interface Sci. 16 (9), 59–79.
crystal structure of silver. The average crystalline size
Mohanpuria P, Rana N K and Yadav S K (2008) Biosynthesis of
was calculated using Debye-Scherrer formula. The nanoparticles: technological concepts and future applications.
calculated average crystallite of the AgNPs synthesized Journal of Nanoparticle Research 10(3), 507–517.
by K. pneumoniae HHHS1 strain was (21.918 nm), Thampi N and Jeyados V S (2015) Biogenic Synthesis and
respectively (Jyoti et al, 2016). Characterization of Silver Nanoparticles Using Syzygium
samaran gense (Wax Apple) Leaves Extract and Their
REFERENCES
Antibacterial Activity. International Journal of PharmTech
Fashola M O, Ngole-Jeme V M and Babalola O O (2016) Heavy Research 8(3), 426-433.
Metal Pollution from Gold Mines: Environmental Effects and
Chaudhari P R, Masurkar S A, Shidore V B and Kamble S B (2012)
Bacterial Strategies for Resistance. International Journal of
Antimicrobial activity of extracellularly synthesized silver
Environmental Research and Public Health 13(11), 1047.
nanoparticles using Lactobacillus species obtained from vizylac
Ojuederie O B and Babalola O O (2017) Microbial and Plant-Assisted capsule. Journal of Applied Pharmaceutical Science 02(03),
Bioremediation of Heavy Metal Polluted Environments: A 25-29.
Review. International Journal of Environmental Research and
Karthick S, Namasivayam R, Aroma R, Manikanta M, Gopinath P
Public Health 14(12), 1504.
and Francis A L (2016) Evaluation of enzyme activity inhibition
Muse W B and Bender R A (1998) The nac (Nitrogen Assimilation of biogenic silver nanoparticles against microbial extracellular
Control) Gene from Escherichia coli. Journal of Bacteriology enzymes. International Journal of PharmTech Research 9(2),
180(5), 1166–1173. 40-47.
Cali B M, Micca J L and Stewart V (1989) Genetic regulation of Bilkisu N G and Babatunde M M (2015) Assessment of microbial
nitrate assimilation in Klebsiella pneumoniae M5al. Journal communities Encountered in soils with organic and inorganic
of Bacteriology 171(5), 2666–2672. fertilizers in Afaka area of Kaduna state, Nigeria. International
Hans B (2014) Enzyme assays, revew. Perspectives in Science 1, Journal of Fisheries and Aquatic Studies 2(4), 01-06.
41–55. Ouay B L and Stellacci D (2015) Antibacterial activity of silver
Sreedevi T P, Thilagam M, Tamil Selvi A and Chandrasekaran B nanoparticles: A surface science insight. 10(3), 339-354.
(2015) Synthesis, characterization and antibacterial studies of Pal R R, Khardenavis A A and Purohit H J (2015) Identification and
silver nanoparticles Using Lactobacillus Plantarum World. monitoring of nitrification and denitrification genes in
Journal of Pharmaceutical Research 4(8), 1757-1773. Klebsiellapneumoniae EGD-HP19-C for its ability to perform
Aldujaili N, Alrufa M M and Sahib F H (2017) Antibiofilm heterotrophic nitrification and aerobic denitrification.
antibacterial and antioxidant activity of biosynthesized silver FunctIntegr Genomics 15(1), 63–76.
nanoparticles using Pantoeaagglomerans. Journal of Mortlock J M and Bartkus R P (1992) Natural and experimentally
Pharmaceutical Sciences and Research 9, 1220-1228. evolved pathways for the utilization of D-arabinose in enteric
Ranganath E, Rathod V and Banu A (2012) Screening of Lactobacillus bacteria At. Mortlock R. P. The Evolution of Metabolic
spp, for mediating the biosynthesis of silver nanoparticles from Function. CRC incorporation, NW Florida 1992, 1-15.
silver nitrate. Journal of Pharmacy 2(2), 237-241. Imtiyaz H, Singh N B, Singh Ajey, Singh Himani and Singh Subhash
Garcia E J, CadorinOldoni T L, de Alencar S M, Reis A, Loguercio (2016) Green synthesis of nanoparticles and its potential
A D and Miranda Grande R H (2012) Antioxidant activity by application. Biotechnology Letters 38, 545-560.
DPPH assay of potential solutions to be applied on bleached Aldujaili N H, Abdullah N Y, Khaqani R L, Al-tfaly S A and Al-
teeth. Brazilian Dental Journal 23(1), 22–27. Shammary A H (2015) Biosynthesis and antibacterial activity
Ahmed D, Khan M and Saeed R (2015) Comparative Analysis of of Titanium nanoparticles using Lactobacillus. International
Phenolics, Flavonoids, and Antioxidant and Antibacterial Journal of Recent Scientific Research 6(12), 7741-7751.
Potential of Methanolic, Hexanic and Aqueous Extracts from Bhimba B V, Gurung S and Nandhini S U (2015) Silver nanoparticles
Adiantumcaudatum Leaves. Antioxidants 4(2), 394–409. synthesized from marine fungi Aspergillus oryzae. International
Shukla S K and Rao T S (2017) An Improved Crystal Violet Assay Journal of PharmTech Research 7(01), 68-72.
for Biofilm Quantification in 96-Well Microtitre Plate. bioRxiv, Kannaiyan S and Easwaramoorthi Andal V (2015) Synthesis,
100214. Characterisation and Antibacterial activities of Schiff base [New
Rajeshkumar S and Malarkodi C (2014) In Vitro Antibacterial Activity fuchsin] functionalised silver nanoparticles. International
and Mechanism of Silver Nanoparticles against Foodborne Journal of PharmTech Research 8(5), 54-60.
Pathogens. Bioinorganic Chemistry and Applications Masarudin M J, Cutts S M, Evison B J, Phillips D R and Pigram P J
Vol. 2014 , 10 pages. (2015) Factors determining the stability, size distribution and
 Characterization and optimization of AgNPs biosynthesis by K. pneumoniae 2545
cellular accumulation of small, monodisperse chitosan of silver nanoparticles. Biomaterials 30, 6341-6350.
nanoparticles as candidate vectors for anticancer drug delivery: Hao D C, Gu X and Xiao P G (2015) Phytochemical and biological
application to the passive encapsulation of [14C]- research of Cannabis pharmaceutical resources, in A Medicinal
doxorubicin. Nanotechnology, Science and Applications 8, 67- Plants Chemistry, Biology and Omics (Pages 431–464).
80. Sawston, Cambridge: Woodhead Publishing.
Holt J G, Krieg N R, Sneath P H A, Staley J T and Williams S T Jyoti K, Baunthiyal M and Singh A (2016) Characterization of silver
(1994) Bergy,s Manual of Determinative Bacteriology. 9th.ed. nanoparticles synthesized using Urtica dioica Linn. leaves and
Williams &Wilkins, USA: 532-551. their synergistic effects with antibiotics. Journal of Radiation
Sarvamangala D, Kondala K, Murthy U S N, Narasinga Rao B, Research and Applied Sciences 9(3), 217-227.
Sharma G V R and Satyanarayana R (2013) Biogenic synthesis Kêdziora A, Speruda M, Krzy¿ewska E, Rybka J, £ukowiak A and
of AgNP’s using Pomelo fruit–characterization and Bugla-P³oskoñska G (2018) Similarities and Differences
antimicrobial activity against Gram +Ve and Gram –Ve bacteria. between Silver Ions and Silver in Nanoforms as Antibacterial
International Journal of Pharmaceutical Sciences 19(2), 30– Agents. Int. J. Mol. Sci. 19(2), 444.
35.
Krishna G, PranithaVadapally M A and Singara C (2017) Biogenic
Stephenson F H (2003) Calculations in Molecular biology and synthesis of silver nanoparticles from white rot fungi: Their
biotechnology. Academic press, California, USA. characterization and antibacterial studies. OpenNano. 2, 64-
Vogelstein B and Gillespie D (1979) Preparative and analytical 78.
purification of DNA from agarose. Proceedings of the National Le Ouay B and Stellacci F (2015) Antibacterial activity of silver
Academy of Sciences of the United States of America. 76(2), nanoparticles: A surface science insight Benjamin Le Ouay,
615-619. Francesco Stellacci. Nanotoday 10, 339-354.
Durán N, Marcato P D, Durán M, Yadav A, Gade A and Rai M (2011) Luo K, Jung S, Park K H and Kim Y R (2018) Microbial Biosynthesis
Mechanistic aspects in the biogenic synthesis of extracellular of Silver Nanoparticles in Different Culture Media. J. Agric.
metal nanoparticles by peptides, bacteria, fungi and plants. Food Chem. 66(4), 957–962.
Appl. Microbiol. Biotechnol. 90, 1609 1624.
Markowska K, Anna M, Grudniak, Krystyna I and Wolska (2013)
Donlan R M and Costerton J W (2002) Biofilms: Survival Silver nanoparticles as an alternative strategy against bacterial
Mechanisms of Clinically Relevant Microorganisms. Clinical biofilms. ActaBiochemicapolonica 60(4), 523–530.
Microbiology Reviews 15(2), 167–193.
Olivares J, Bernardini A, Garcia-Leon G, Corona F B, Sanchez M
Elias E, Elemike, Damian C Onwudiwe, Anthony C Ekennia, and Martinez J L (2013) The intrinsic resistome of bacterial
Christopher U Sonde and Richard C Ehiri (2017) Green pathogens. Frontiers in Microbiology 4, 103.
Synthesis of Ag/Ag2O Nanoparticles Using Aqueous Leaf
Extract of Eupatorium odoratum and Its Antimicrobial and Rai M K, Deshmukh S D, Ingle A P and Gade A K (2012) Silver
Mosquito Larvicidal Activities. Molecules 22(5), 674. nanoparticles: The powerful nanoweapon against multidrug-
resistant bacteria. J. Appl. Microbiol. 112, 841–852.
Faller M and Kohler T (2017) The Status of Biofilms in Penile
Implants. Microorganisms 5(2), 19. Ramalingam V, Rajaram R, PremKumar C, Santhanam P, Dhinesh
P, Vinothkumar S and Kaleshkumar K (2014) Biosynthesis of
Bisswanger H (2014) Enzyme assays. Perspectives in Science 1, 41– silver nanoparticles from deep sea bacterium Pseudomonas
55. aeruginosa JQ989348 for antimicrobial, antibiofilm and
Bonnia N N, Kamaruddin M S, Nawawi M H, Ratim S, Azlina H N cytotoxic activity. J. Basic Microbiol. 54, 928-936.
and Ali E S (2016) Green Biosynthesis of Silver Nanoparticles Saleh N and Yousaf Z (2018) Tools and techniques for the optimized
Using ‘Polygonum Hydropiper ’ And Study its Catalytic synthesis, reproducibility and scale up of desired nanoparticles
Degradation of Methylene Blue. Procedia Chemistry 19, 594 from plant derived material and their role in pharmaceutical
– 602. properties in A Nanoscale Fabrication, Optimization, Scale-
Boontosaeng T, Nimrat S and Vuthiphandchai V (2016) Pigments Up and Biological Aspects of Pharmaceutical Nanotechnology
Production of Bacteria Isolated From Dried Seafood and (Pages 85–131). Cambridge, MA 02139: William Andrew.
Capability to Inhibit Microbial Pathogens. IOSR Journal of Sanghi R and Verma P (2009) Biomimetic synthesis and
Environmental Science, Toxicology and Food Technology characterisation of protein capped silver nanoparticles.
(IOSR-JESTFT) 10(5), II: 30-34. Bioresour Technol. 100(1), 501–504.
Cole J A and Brown C M (1979) Nitrite reduction to ammonia by Schmidt H, Thom M, Madzgalla M, Gerbersdorf S U, Metreveli G
fermentative bacteria: a short circuit in the biological nitrogen and Manz W (2017) Exposure to Silver Nanoparticles Affects
cycle. FEMS Microbiology Letters 7(1980), 65-72. Biofilm Structure and Adhesiveness. J Aquat Pollut Toxicol.
Fatima H S (2017) Nanoparticles biosynthhesis using probiotic and 1(2), 9.
study the antimicrobial and antioxida ant activity A. MSc thesis. Siddiqi K S and Husen A (2016) Fabrication of Metal Nanoparticles
Pp:34. from Fungi and Metal Salts: Scope and Application. Nanoscale
González A G, Mombo S, Leflaive J, Lamy A, Pokrovsky O S and Rols Research Letters 11, 98. Http://doi.org /10.11 86 /s11671-016-
J L (2015) Silver nanoparticles impact phototrophic biofilm 1311-2.
communities to a considerably higher degree than ionic silver. Siddiqi K S, Husen A and Rao R A K (2018) A review on biosynthesis
Environ Sci Pollut Res Int. 22(11), 8412-8124. of silver nanoparticles and their biocidal properties. Journal
Gurunathan S, Lee K J, Kalishwaralal K, Sheikpranbabu S, of Nanobiotechnology 16, 14.
Vaidyanathan R and Eom S H (2009) Antiangiogenic properties Singha P, Locklin J and Handa H (2017) A Review of the Recent
2546 Hussein Hameed Hassan and Nawfal Hussein Aldujaili
Advances in Antimicrobial Coatings for Urinary Catheters. Acta Wypij M, Golinska P, Dahm H and Rai M (2017) Actinobacterial-
Biomaterialia 50, 20–40. mediated synthesis of silver nanoparticles and their activity
Sütterlin S, Edquist P, Sandegren L, Adler M, Tangdén T, Drobni M, against pathogenic bacteria. IET Nanobiotechnol 11, 336–342.
Olsen B and Melhusa A (2014) Silver Resistance Genes Are Xie J and Schaich K M (2014) Re-evaluation of the 2,2-Diphenyl-1-
Overrepresented among Escherichia coli Isolates with CTX- picrylhydrazyl Free Radical (DPPH) Assay for Antioxidant
M Production. Applied and Environmental Microbiology 80 Activity. Journal of Agricultural and Food Chemistry 62(19),
(22), 6863–6869. 4251-4260.