Microbial Pathogenesis 51 (2011) 121e132

Contents lists available at ScienceDirect

Microbial Pathogenesis
journal homepage: www.elsevier.com/locate/micpath

Tn5AraOut mutagenesis for the identification of Yersinia pestis genes involved in

resistance towards cationic antimicrobial peptides
Jitao Guo b,1, Manoj K.M. Nair a, Estela M. Galván a, 2, Shu-Lin Liu b, 3, Dieter M. Schifferli a, *
a
Department of Pathobiology, University of Pennsylvania, School of Veterinary Medicine, Philadelphia, PA 19104, USA
b
Department of Microbiology, Peking University Health Science Center, Beijing 100191, China

a r t i c l e i n f o a b s t r a c t

Article history: Bacterial pathogens display a variety of protection mechanisms against the inhibitory and lethal effects of
Received 23 March 2010 host cationic antimicrobial peptides (CAMPs). To identify Yersinia pestis genes involved in CAMP resis-
Received in revised form tance, libraries of DSY101 (KIM6 caf1 pla psa) minitransposon Tn5AraOut mutants were selected at 37
C
21 April 2011
for resistance to the model CAMPs polymyxin B or protamine. This approach targeted genes that needed
Accepted 29 April 2011
Available online 7 May 2011
to be repressed (null mutations) or induced (upstream PBAD insertions) for the detection of CAMP
resistance, and predictably for improved pathogen fitness in mammalian hosts. Ten mutants demon-
strated increased resistance to polymyxin B or protamine, with the mapped mutations pointing towards
Keywords:
Yersinia pestis
genes suspected to participate in modifying membrane components, genes encoding transport proteins
Minitransposon or enzymes, or the regulator of a ferrous iron uptake system (feoC). Not all the mutants were resistant to
Polymyxin B both CAMPs used for selection. None of the polymyxin B- and only some protamine-resistant mutants,
Protamine including the feoC mutant, showed increased resistance to rat bronchoalveolar lavage fluid (rBALF)
LL-37 known to contain cathelicidin and b-defensin 1. Thus, findings on bacterial resistance to polymyxin B or
protamine don’t always apply to CAMPs of the mammalian innate immune system, such as the ones in
rBALF.
Ó 2011 Elsevier Ltd. All rights reserved.

1. Introduction suggested to be due to Psa binding to host receptors that don’t

direct internalization [4]. Y. pestis injects several antiphagocytic
Yersinia pestis is best known as the causative agent of bubonic proteins directly into host cells through its type III secretion system
plague, a disease transmitted by the bite of infected fleas. However, (T3SS) [5,6], some of which have strong anti-inflammatory prop-
if inhaled, this pathogen also produces a severe primary pneumonia erties [6e11]. In addition, Y. pestis also makes a non-inflammatory
known as pneumonic plague, which is contagious and most often LPS at mammalian body temperature, thereby escaping the
lethal. This bacterial agent uses an arsenal of virulence factors that typical LPS-induced stimulation of TLR4 [12,13]. Although the anti-
render its entrance into the host as surreptitious as possible. These inflammatory activities of Y. pestis also affect DCs and their
tools are thought to be most important during the first few hours migratory properties [14,15], Y. pestis delivered through a fleabite
following infection to avoid alarming the innate immune system still spreads to the local lymph node, causing lymphadenitis (bubo).
and to avoid phagocytosis. We and others have previously shown Further spreading steps leading to bacteremia or septicemia are not
that in addition to being antiphagocytic, the surface proteins F1 and infrequent, particularly when bubonic plague remains untreated.
Psa inhibit bacterial uptake by respiratory tract epithelial cells or Plague lethality is generally assumed to be due to sepsis. Dissemi-
macrophages [1e3]. The antiphagocytic mechanism of Psa was nation is facilitated by core LPS, the Psa fimbriae, the outer
membrane adhesin Ail and the plasminogen activator outer
membrane protein Pla [16e20]. Pla acts as a protease that cleaves
* Corresponding author. Tel.: þ1 215 898 1685; fax: þ1 215 898 7887. plasminogen to plasmin and mediates bacterial binding to extra-
E-mail addresses: [email protected] (J. Guo), [email protected] cellular matrix proteins [21,22]. It is essential for bubonic plague,
(E.M. Galván), [email protected] (S.-L. Liu), [email protected] (D.M. Schifferli). (but not for septicemic plague) after flea-mediated transmission
1
Tel.: þ86 10 8280 2963; fax: þ86 10 8280 5465. [18,19,23,24]. Pla is also essential for the development of (but not
2
Present address: Fundación Instituto Leloir, University of Buenos Aires and
for the dissemination from) primary pneumonic plague [25].
CONICET, C1405BWE Buenos Aires, Argentina.
3
Present address: Genomics Research Center, Harbin Medical University, 157 Y. pestis has not only evolved to survive but also to thrive in
Baojian Road, Harbin 150081, China. a hostile host environment that includes the antimicrobial peptides

0882-4010/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.micpath.2011.04.010
122 J. Guo et al. / Microbial Pathogenesis 51 (2011) 121e132

of the innate immune system, as best exemplified by successful polymyxin B-free broth. In contrast, four of the five mutants grew
bacterial replication in local lymph nodes or lungs, leading to well at the significantly higher dose of 5 mg/ml polymyxin B, growth
bubonic or primary pneumonic plague, respectively. Although the of three of these resistant mutants (PB7-23, PB8-2 and PB8-4) being
anti-inflammatory molecules of Y. pestis might down-regulate the clearly arabinose-dependent, since their growth was inhibited by
expression of host cationic antimicrobial peptides (CAMPs) [26,27], polymyxin B only in the absence of arabinose. Mutant PB8-8
it is likely that this bacterium also expresses a battery of tools demonstrated arabinose-independent polymyxin B resistance, its
aimed at inactivating CAMPs in vivo. Accordingly, we recently growth being not inhibited by polymyxin B, irrespective of the
observed that Pla, through its proteolytic activities, increased presence or absence of arabinose (Fig. 1A). Similarly, mutant PB7-10
bacterial resistance to CAMPs at 37
C in vitro [48]. Curiously, this still grew in the presence of twice the concentrations of polymyxin
activity was counteracted in vitro by the F1 protein, an in-vivo B that was killing the parental strain in the presence of arabinose
expressed protein, suggesting that Y. pestis might use additional
mechanisms of bacterial resistance to CAMPs. In addition to anti-
microbial peptide degradation by proteases, other bacteria have
been reported to trap CAMPs extracellularly, alter their surface,
particularly their surface charge, pump CAMPs out, or modulate
host cell expression or degradation of CAMPs [28,29]. The aim of
this study was to identify new Y. pestis genes involved in any of
these survival strategies. For this purpose, a minitransposon with
an outward-oriented inducible promoter was constructed and used
to identify genes that either increase CAMP resistance by being
repressed (null mutants) or that demonstrate resistance by being
activated (inducible gene expression).

2. Results

2.1. Isolation of CAMP-resistant minitransposon mutants

Tn5AraOut mutants of strain DSY101 that demonstrated

increased resistance to polymyxin B or protamine were isolated as
described in Materials and Methods. Briefly, Y. pestis strain DSY101
was transformed with plasmid pTn5AraOut and bacteria were
selected on kanamycin-containing media at 37
C containing L-
arabinose and supplemented with polymyxin B or protamine at
concentrations previously shown to inhibit strain DSY101 growth.
Selection was done in the presence of arabinose to simultaneously
obtain both arabinose-dependent and -independent CAMP-
resistant mutants. Consistency in the phenotypes of clone-
purified mutants was confirmed for five polymyxin-resistant and
five protamine-resistant isolates on selective agar plates. No
spontaneous resistant bacteria could be isolated in parallel control
experiments with mock (H2O)-transformed bacteria, strongly sug-
gesting that the isolated polymyxin- and protamine-resistant
clones were due to the minitransposon insertions. These mutants
were further characterized by determining the arabinose-
dependency of their resistance and by a quantitative analysis of
their CAMP resistance levels. For this, each strain was grown in
broth to log phase and further multiplication or killing was studied
in the presence or absence of CAMPs. Bacterial growth was moni-
tored in the presence of 0.2% arabinose, to activate the inducible
promoter on the minitransposon, or 0.2% glucose as a repressor of
this promoter (negative control). All our studies were done with
bacteria grown at 37
C, since our aim was to evaluate CAMP effects
on Y. pestis at mammalian body temperature. In addition to the
determination of MICs, growth was analyzed more precisely by
determining absorbance values (A600). That all the mutants and the
parental strain grew somewhat better in the presence of arabinose Fig. 1. Bacterial growth with the CAMPs used to select the mutants. (A) Bacteria were
than in the presence of glucose was probably related to a previously grown in BHI with or without glucose or arabinose to an A600 of 0.3 at 37
C, polymyxin
B was added to a concentration of 5 mg/ml (or a0.625 mg/ml, b1.25 mg/ml, and
described negative effect of glucose on Y. pestis growth [30]. c
2.5 mg/ml), the cultures were further incubated for 18 h before measuring growth
However, this effect did not interfere with the interpretation of the (A600). MICs were determined in microtiter plates and were 1 mg/ml for DSY101 and
results concerning antimicrobial resistance, since bacterial growth 8 mg/ml for all the mutants (except PB7-10, 4 mg/ml). (B) Bacteria were grown in BHI to
of the mutants was compared with growth of the parental strain an A600 of 0.3 at 37
C, diluted to an A600 of 0.05 (to use concentrations of protamine
studying both media with or without polymyxin B. Fig. 1A shows that do not interfere significantly with A600 reading), protamine was added to
a concentration of 0.4 mg/ml and the cultures were further incubated for 18 h before
that polymyxin B was clearly bactericidal on parental strain DSY101 measuring growth (A600). MICs were determined in microtiter plates and were 0.4 mg/
at 1.25 mg/ml or more, the lower dose of 0.625 mg/ml being still able ml for DSY101 and 0.8 mg/ml for all the mutants. All the data are means of at least
to inhibit bacterial growth, as compared to the bacteria in three independent experiments with standard errors.
 J. Guo et al. / Microbial Pathogenesis 51 (2011) 121e132 123

(Fig. 1A) or glucose (data not shown), indicating also arabinose- and Methods (Table 1). Briefly, DNA including Tn5AraOut for each of
independent polymyxin B resistance. The five mutants selected the ten resistant mutants was cloned by using different restriction
on protamine agar were able to grow significantly in the presence enzymes. For each mutant-restriction enzyme pair, plasmid clones of
of a protamine-concentration that blocked multiplication of the similar sizes were obtained and DNA flanking the minitransposon
parental strain DSY101 (Fig. 1B). Interestingly, protamine resistance inserts of these plasmids was sequenced. Sequencing plasmids from
was arabinose-independent for all the five mutants (data not each individual mutant always yielded the same flanking sequences,
shown). Although three of the mutants grew slower than the strongly suggesting that each mutant had only one Tn5AraOut copy
parental strain in the absence of protamine, mutants PM2-3 and in its genome. This was confirmed by Southern blot analysis using
PM3-2 grew as well, indicating that protamine resistance wasn’t genomic DNA restricted with either one of two different enzymes and
necessarily linked to some effect on bacterial multiplication under a probe lacking the corresponding sites, each mutant showing only
the used growth conditions. Taken together, the quantitative one major hybridizing fragment (Supplemental Fig. 1). Moreover,
analysis of bacterial growth in broth clearly confirmed the poly- since spontaneous resistant mutants were not detected with mock
myxin B and protamine resistance phenotypes of the mutants.

2.2. Dissociation of polymyxin B and protamine resistance

To determine whether the two CAMPs target different bacterial

components or possibly share their mode of actions, the polymyxin
B-resistant mutants were tested for protamine resistance, and vice
versa, using the same experimental conditions described above,
including the inducer arabinose in all the assays. Although four
polymyxin B-resistant mutants were also resistant to protamine,
strain PB8-8 didn’t multiply significantly with protamine (Fig. 2A).
Conversely, mutant strains PM2-3 and PM3-2 that showed resis-
tance to protamine were killed by polymyxin B, whereas the other
three protamine-resistant mutants grew in the presence of poly-
myxin B (Fig. 2B). That some mutants showed a dissociation of
resistance properties between polymyxin B and protamine high-
lighted the existence of different cationic peptide-specific mecha-
nisms of CAMP resistance.

2.3. Susceptibility of selected mutants towards rBALF antimicrobials

and LL-37

Since the polymyxin B- and protamine-resistance profiles were

only partially overlapping, we wondered how the mutants would
respond to constitutively expressed respiratory tract antimicrobial
peptides. Again, the assays were undertaken as described above, in
the presence of arabinose. By first testing bacterial growth in rBALF,
which contains rCRAMP [4], the rat ortholog of the human cath-
elicidin LL-37, it was observed that all the mutants selected for
polymyxin B resistance did not multiply (Fig. 3A). In contrast and
with the exception of strain PM2-3 and PM3-2, the three other
mutants selected for protamine resistance were able to grow in the
presence of rBALF. To test these results more specifically, we
investigated growth of these mutants in the presence of the puri-
fied mammalian CAMP, LL-37. Confirming the data obtained with
rBALF, all the rBALF-susceptible mutants were also sensitive to
LL-37, as exemplified with mutant PB7-23 (Fig. 3B). The other
rBALF-susceptible mutants showed comparable LL-37 concentra-
tion-dependent killing effects, with 103 reductions of CFUs for
160 mg/ml LL-37. Conversely, the three rBALF-resistant mutants
were also resistant to LL-37 (Fig. 3B). To summarize, only two of the
polymyxin B-susceptible mutants (PM2-3 and PM3-2) were resis-
tant to protamine and rBALF/LL-37 and all polymyxin B-resistant
mutants (most being also protamine-resistant) were susceptible to
rBALF/LL-37. These results indicated that polymyxin B- or prot- Fig. 2. Bacterial growth with CAMPs different from the ones used to select the
mutants. (A) The polymyxin B-resistant mutants and the parental strain DSY101 were
amine resistance is not necessarily representative of resistance
grown in BHI to an A600 of 0.3 at 37
C, diluted to an A600 of 0.05, protamine was added
towards mammalian antimicrobial peptides, such as the ones of the to a concentration of 0.4 mg/ml and the cultures were further incubated for 18 h before
respiratory tract. measuring growth (A600). MICs were determined in microtiter plates and were
0.8 mg/ml for all the mutants. (B) The protamine-resistant mutants were grown in BHI
2.4. Mapping Tn5AraOut in the CAMP-resistant mutants to an A600 of 0.3 at 37
C, polymyxin B was added to a concentration of a1.25 mg/ml or
b
5 mg/ml, the cultures were further incubated for 18 h before measuring growth (A600).
MICs were determined in microtiter plates and were 1 mg/ml (PM2-3, PM3-2) or
The mutants were further characterized by mapping their 16 mg/ml (PM2-49, PM5-6 and PM12-3). All the data are means of at least three
Tn5AraOut insertion sites and orientations as described in Materials independent experiments with standard errors.
124 J. Guo et al. / Microbial Pathogenesis 51 (2011) 121e132

upstream of the pbgP operons, which includes 7 cotranscribed genes

(pmrHFIJKLM or arnBCADTEF) required for the synthesis of 4-amino-
arabinose that is added to the phosphates of lipid A in Y. pestis LPS
[13,31,32]. Arabinose-dependent induction of pmrH transcription
was confirmed in this mutant by qRT-PCR (mean  standard
error ¼ 15.0  4.5 fold increase with the inducer, n ¼ 4, versus
1.4  0.7 without inducer, n ¼ 3, P ¼ 0.037). The detection of such
a mutant in our screen supported our experimental method, since it
had been previously shown that 4-aminoarabinose-decorated LPS
renders Y. pestis more resistant to polymyxin B. The two other
mutants with arabinose-inducible resistance to polymyxin B (PB8-4
and PB8-2) had minitransposon insertions upstream of two single or
monocistronic genes, y2568 which encodes a hypothetical protein,
and y1522 which encodes an Hcp-like protein that is not linked to any
of the five predicted type 6 secretion systems (T6SS) of Y. pestis [33].
In contrast, two arabinose-independent polymyxin B-resistant
mutants (PB7-10 and PB8-8) had minitransposon insertions in the
promoter region of asmA and hflC orthologs of Escherichia coli. AsmA
modulates porins, glycerophosphates and LPS levels in the outer
membrane [34e36], whereas hflC encodes a repressor of the
proteolytic activity of the integral inner membrane protein FtsH [37]
which can regulate LPS concentrations through proteolysis of LpxC
[38,39]. Thus, apart from the targeted hypothetical protein, the
mutants selected for increased resistance to polymyxin B had
a Tn5AraOut insertion in gene loci for bacterial envelope components
or potentially secreted molecules. Of the five additional CAMP-
resistant mutants that were selected with protamine, four had
mutations in orthologs of E. coli or Salmonella transport systems,
including two independent minitransposon insertions (PM2-3 and
PM3-2) in the gene for the low affinity metal phosphate transporter
PitA [40,41]. The PM2-49 mutant had its transposon insertion map-
ped 42 bp upstream of a predicted operator site for the GalR repressor
of the galactose import system MglBAC [42]. Polymyxin B resistance
of this mutant was arabinose-independent. This was consistent with
mglB transcription in PM2-49, which was turned on whether it was
induced (mean  standard error ¼ 6.9  4.8 fold increased transcript
levels, n ¼ 4, as compared to the parental strain) or not (9.2  6.1 fold
increased transcript levels, n ¼ 3; induction effect P ¼ 0.394), as
detected by qRT-PCR. Thus, the minitransposon insert of PM2-49 is
suggested to have inactivated GalR-mediated repression of the
mglBAC operon [43]. The protamine-resistant mutant PM5-6 had an
insertion in y0958 that encodes a putative glycerophosphoryldiester
diesterase, designated GlpQ-like. That protamine resistance of this
mutant was linked to the inactivation of this gene and not to
a potential activation of downstram dinP transcription was confirmed
by dinP qRT-PCR (comparison with the parental strain, P ¼ 0.99). The
Fig. 3. Bacterial growth of all the mutants in the presence of rBALF or LL-37. (A) GlpQ-like orf predicts a significantly different primary structure than
Bacteria were grown in BHI to an A600 of 0.3 at 37
C, diluted to an A600 of 0.08, rBALF
was added to a concentration of 60 mg/ml protein and the cultures were further
those of the E. coli (or Y. pestis) GlpQ and UgpQ enzymes, which are
incubated for 18 h before measuring growth (A600). MICs were determined in micro- involved in the intracellular uptake and production of sn-glycerol-3-
titer plates and were 60 mg/ml protein for DSY101, all the polymyxin B mutants, PM2-3 phosphate, a carbon and energy source and a precursor for novel
and PM3-2, and 120 mg/ml protein for PM2-49, PM5-6 and PM12-3. (B) Bacteria were phospholipid synthesis and recycling of membrane phospholipids
grown in BHI to an A600 of 0.3 at 37
C, diluted to an A600 of 0.08, LL-37 was added to
[44]. The last protamine-resistant mutant (PM12-3) mapped in the
20, 40, 80 or 160 mg/ml protein and the cultures were further incubated for 18 h before
determining bacterial survival (CFUs). All the data are means of at least three inde- predicted inhibitor of the ferrous iron importer system designated
pendent experiments with standard errors. Feo, as discussed later [45].

2.5. CAMP resistance and bacterial surface modifications

transformed bacteria, the mapped minitransposon inserts were most
likely responsible for the described resistance phenotypes. Further Most of the mutants detected in this study had Tn5AraOut
supportive evidence on single transposon insertions responsible for insertions that were located in or upstream of genes encoding
resistance phenotypes in individual mutants were derived from proteins involved in membrane components or molecular transport
detailed characterization of mutants of interest, as described below. through membranes. LPS, a major component of the outer
Three of the CAMP-resistant mutants selected with polymyxin B had membrane, is known to interact with CAMPs. Accordingly, one
an arabinose-dependent resistance phenotype that was presumably Tn5AraOut insertion located upstream of the pbgP operon involved
linked to the activation of downstream genes (Table 1 and Fig.1A). For in LPS modification (Table 1, PB7-23) showed arabinose-dependent
example, mutant PB7-23 had the arabinose-inducible promoter resistance to CAMPs. Thus, we wondered whether the increased
 J. Guo et al. / Microbial Pathogenesis 51 (2011) 121e132 125

Table 1
Mapped Tn5AraOut insertions in CAMPs-resistant mutants.

CAMP resistance of some of the other mutants could be related to PB8-2 phenotype. The Hcp-like protein could not be detected in
an indirect effect on LPS. We first analyzed LPS levels by SDS-PAGE membrane fractions or on the surface of PB8-2 (not shown),
and found no significant differences between the mutants and the possibly because of the insufficient basal expression of a comple-
parental strain (data not shown). Subsequently, we evaluated mentary type 6 export machinery. That the observed phenotype
whether the mutations affected bacterial surface properties
resulting in a reduction of CAMP binding by labeling the bacteria
grown at 37
C with dansyl-conjugated polymyxin B. Preliminary
microscopic evaluation suggested decreased binding of polymyxin
B for several mutants (not shown). To evaluate this effect in
a quantitative manner, the level of binding was determined by
fluorometry. Five polymyxin B-resistant mutants (PB7-10, PB7-23,
PM2-49, PM5-6 and PM12-3) showed a significant decrease in
polymyxin B binding (Fig. 4), whereas polymyxin-B susceptible
mutant PM2-3 bound polymyxin B as well as the parental strain.
These data supported the assumption that the polymyxin B-resis-
tant mutants with the corresponding mapped mutations (asmA,
pbgP, mglB, glpQ-like and feoC) are involved in modifying the
molecules or molecular composition of the bacterial outer
membrane. Other mechanisms might explain the phenotypes of
mutants PB8-4 (hypothetical gene) and PB8-2 (hcp-like gene).
Arabinose-induced expression of the latter gene (y1522) in PB8-2
slightly increased polymyxin B binding, albeit not significantly.
Since Hcp proteins have been reported in other bacteria to be
secreted in the medium, spent broth of PB8-2 was tested by
western blot analysis. Although the protein was present in the
bacteria, it could not be detected in spent broth of the mini-
transposon mutant (not shown). A mutant lacking the corre-
sponding gene and complemented with a plasmid expressing the
Hcp-like protein from an ITPG-inducible plasmid gave the same
result (not shown). Increased polymyxin B resistance was only
detected in the complemented strain when production of the Fig. 4. Binding of polymyxin B to bacterial surfaces. Standardized concentrations of
plasmid-encoded protein was activated, confirming the arabinose- bacteria were incubated with dansyl-polymyxin B for fluorometric analysis and
dependency of the minitransposon mutant phenotype. Moreover, determination of arbitrary units (A.U.) of fluorescence, as described in Material and
Methods. All the data are means of at least three independent experiments with
deletion of the neighboring y1523 gene, which could have been standard errors. Unpaired t-tests comparing each mutant to the parental strain DSY101
affected in its promoter region (Table 1), did not increase poly- showed statistical significant differences for several comparisons (*P < 0.05,
**
myxin B resistance, indicating that this gene was not involved in the P < 0.001).
126 J. Guo et al. / Microbial Pathogenesis 51 (2011) 121e132

was due to an indirect effect resulting from the accumulation of the over time. Interestingly, the parental strain was always found in
y1522 gene product in the cytoplasm was unlikely, since E. coli or higher numbers than the feoB mutant when bacteria were isolated
Salmonella enterica strains expressing the y1522 in trans were not from the livers and spleens (Fig. 6). Bacteria could not be detected in
polymyxin B resistant (not shown). the organs of many mice, indicating that Y. pestis KIM5 administered
s.c. at the dose used had been rapidly eliminated in the host.
2.6. CAMP resistance and inactivation of feoC Although daily differences were statistically significant in the liver
only at day 4 (P < 0.005), differences of the aggregated data for the
As expected, polymyxin B resistance of the feoC::Tn5AraOut four studied days were highly significant (P < 0.002 for the livers
strain and a feoC deletion were comparably increased (Figs. 2B and and P < 0.0004 for the spleens). These results suggested that feoB is
5). Since the feoC gene has been suggested to be a repressor of the expressed in vivo and improves bacterial dissemination, possibly by
feoAB genes [45], polymyxin B resistance was thought to be asso- increasing CAMP resistance and/or purveying iron to the multi-
ciated with feoAB derepression. Accordingly, a feoBC mutant (and plying bacteria.
a feoB mutant, not shown) was as sensitive to polymyxin B as the
parental strain DSY101 (Fig. 5). Moreover, when the feoAB genes 3. Discussion
were expressed from an inducible vector, they overrode feoC
repression in DSY101, confirming the proposed model (Fig. 5). These Y. pestis encounters constitutively expressed CAMPs such as the
results suggested that feoC represses the feoAB genes in vitro and cathelicidin LL-37 when it accesses the lower respiratory tract or
that the feoAB genes are involved in mediating polymyxin B resis-
tance. Increased FeoAB-mediated ferrous iron uptake is anticipated
to cause oxidative stress by the Fenton reaction, resulting in
induction of the Fur regulon. In addition to repressing iron uptake
systems, Fur up-regulates the expression of a variety of genes,
including the ones for several surface proteins and catalase (or
hydroperoxidase II) [46]. Accordingly, the feoC::Tn5AraOut mutant
was four times as much resistant to peroxide as the parental strain
(MIC of 16 mM versus 4 mM, respectively), suggesting increased
catalase expression as a response to the activation of the FeoAB-
mediated ferrous iron import. Since the feoC::Tn5AraOut mutant
was also more resistant to protamine and rBALF, as compared to the
parental strain, we wondered whether the feoC gene was repressed
in vivo, possibly increasing bacterial resistance to CAMPs, and thus
improving bacterial survival, growth and dissemination in an
infected host. To test this possibility, the parental strain KIM5 and an
isogenic feoB mutant were administered together by the s.c. route to
C57BL/6 mice and dissemination of the two bacteria was studied

Fig. 6. Y. pestis KIM5 and DSY137 (KIM5 feoB) competition experiment in mice. C57BL/
Fig. 5. Growth of feo mutants and complemented strains in the presence of polymyxin 6 mice were challenged s.c. with a 1:1 mixture of KIM5 and DSY137 (3  107 CFU each).
B. (A) Bacteria were grown in BHI to an A600 of 0.3 at 37
C, polymyxin B was added to Five mice were sacrificed on days 1, 2, 4 and 5 and CFUs were determined in livers (A)
a concentration of a1.25 mg/ml or b5 mg/ml, the cultures were further incubated for 18 h and spleens (B) to calculate competitive index (C.I.) scores (KIM5 CFUs divided by the
before measuring growth (A600). All the data are means of at least three independent DSY137 CFUs). C.I. scores for each mouse are shown as diamonds and bars represent
experiments with standard errors. geometric means.
 J. Guo et al. / Microbial Pathogenesis 51 (2011) 121e132 127

the skin after a fleabite [47]. We have previously shown that encoded by the yfeABCD genes [56]. Consistent with the regulatory
cathelicidins and b-defensins have bactericidal activities towards role of FeoC, FeoC-independent expression of FeoA and FeoB
Y. pestis and that Pla inactivates these CAMPs [48]. Since the F1 mimicked the CAMP-resistant phenotype obtained with the feoC
protein inhibits the CAMP-inactivating effect of Pla and both mutant. Moreover, a feoBC deletion mutant was as sensitive to
proteins are expressed in vivo, it is likely that Y. pestis utilizes other CAMP as the parental non-mutated strain. Taken together, these
mechanisms to resist CAMPs in host tissues. The goal of this study data indicated that induction of FeoAB expression increased CAMP
was to identify new Y. pestis genes involved in CAMP resistance. resistance and supported a regulatory role for FeoC. How activation
Traditionally, such genes have been detected in various pathogens of ferrous iron uptake into the bacterial cytoplasm results by itself
by screening for CAMP sensitive mutants out of a library of in CAMP resistance is not clear. One potential mechanism is that
knockout mutants [49e51]. This approach implies that the “resis- this resistance was directed by the Y. pestis Fur protein, which
tance” genes are expressed in vitro. Here, we used a mini- differentially regulates a large number of proteins, including
transposon engineered with an inducible promoter to identify membrane proteins [46]. This would be consistent with our finding
genes that need to be repressed or activated for detection of CAMP that feoC--mediated resistance to all tested CAMPs was linked to
resistance. By selecting mutants for increased resistance towards decreased polymyxin B-binding, suggesting some membrane
CAMPs, we focused on genes that could be beneficial to bacterial modifications. Moreover, intracellular iron acts as a coregulator of
survival in vivo whether repressed or activated, as determined with the Fur protein to down-regulate iron uptake systems, protecting
null mutations or inducible promoter insertions, respectively. the bacterial cell against the toxic effects of the Fenton reaction
The used protocol identified several genes encoding proteins [57]. In addition, Fur activates the expression of various scavenging
that were previously described in other bacteria to be involved proteins of oxidative intermediates, including catalase [46,58].
directly or indirectly in the organization of the outer membrane. Consistent with the activation of the Fur pathway, the feoC mutant
For example, a mutation resulting in an inducible polymyxin B was also more resistant to peroxide than the parental strain. A feoB
resistance was related to the activation of the pbgP operon which mutant of Y. pestis was attenuated in a competition assay with the
decorates the phosphates of lipid A with 4-aminoarabinose, an LPS parental strain after s.c. administration to mice, highlighting the
modification reported to increase polymyxin B resistance in various bacterial use of its Feo system in vivo to augment virulence. Simi-
bacteria [31]. Other genes involved in polymyxin B resistance larly, E. coli or Salmonella feoA or feoB mutants demonstrated
detected in this study, such as asmA [34e36] and hflC [37,38] have reduced virulence properties in mice models of infections [45].
been previously shown to have indirect effect on LPS levels in the Interestingly, Y. pestis has two ferrous uptake systems (Yfe and Feo)
outer membrane. Consistent with a reduction in LPS levels, we and both systems were shown to be needed but redundant for
observed that polymyxin B binding to the surface of the corre- optimal Y. pestis growth in a murine macrophage cell line [56]. A yfe
sponding mutants was reduced. Whether import machineries for mutant had a 100-fold increased LD50 after s.c. infection of mice
phosphate (PitA, GlpQ-like protein) and galactose (MglBAC) have [59]. In vivo studies with a feo yfe double mutant might show
indirect effects on species structures and compositions of a more drastic effect on virulence and bring further evidence to the
membrane lipids that can explain CAMP resistance remains to be current data that supports a role for intra-macrophage survival of
studied. Y. pestis in the early stages of plague [60]. Additional studies will be
The y1522 and y3910 genes were investigated in more details needed to differentiate the contributions of the feo genes in iron
since their gene products were potentially involved in modulating replenishment and CAMP resistance for the intracellular survival
new mechanisms of CAMP resistance. Expression of the Hcp-like and growth of Y. pestis. Interestingly, another study has recently
protein encoded by the y1522 gene determined CAMP resistance, linked iron uptake with polymyxin B resistance in Yersinia pseu-
irrespective of whether induced expression was from the ara dotuberculosis, a coregulator of the yfe and pbgP genes being
promoter of the minitransposon or from the trc promoter of responsible for both phenotypes [61].
a complementing plasmid in a y1522 mutant. Hcp proteins are type Finally, this study illustrates a clear dissociation between the
6 secreted proteins that form hexameric rings suggested to resistance profiles of Y. pestis mutants towards polymyxin B, prot-
assemble in a tubular system for effector molecule delivery to amine and rBALF/LL-37. Increased resistance of the hflC or pitA
eukaryotic cells [52,53]. Similar to some hcp genes of other bacteria, mutants was specific for polymyxin B or for protamine, respec-
y1522 is an orphan hcp gene (i.e. unlinked to any of the T6SS gene tively. Moreover, only three of the protamine-resistant and none of
clusters). Hcp proteins are either secreted or tightly associated to the polymyxin B-resistant mutants showed increased resistance
bacterial surfaces [33,52,54]. Interestingly, the y1522 gene product towards rBALF, known to contain at least rCRAMP and rat b-
was not secreted or detected in bacterial membranes under the defensin 1 [48]. The three rBALF-resistant mutants were also
growth conditions used. Thus, it remains possible that the y1522 resistant to human cathelicidin LL-37, whereas growth of the
product is only secreted under specific conditions that were not polymyxin B-resistant mutant PB7-23 with an activated pbgP
duplicated here. Alternatively, artificial expression of the Hcp-like operon was significantly affected by LL-37. The latter result was
product of y1522 without activated expression of its correspond- surprising since LL-37 was described to activate the PhoPQ two-
ing T6SS might not result in secretion. Finally, expression of the Hcp- component system in Salmonella [62], which itself activates the
like product of y1522 might result in activation of an intracellular pbgP operon in Salmonella and Y. pestis [31]. Whether mammalian
response that indirectly leads to CAMP resistance independent of CAMPs are not good activators of the Y. pestis PhoPQ system, ami-
type 6 secretion. Although a Y. pestis mutant lacking one of its Hcp noarabinose decoration of LPS doesn’t protect Y. pestis significantly
molecule was not attenuated in models of bubonic or pneumonic from LL-37 or the experimental conditions used were suboptimal to
plague, replication of this mutant in J774.A1 macrophages was detect an effect remains to be determined. Previously detected
limited, suggesting some nonessential role of a T6SS in Y. pestis differences between polymyxin B, cecropin A and/or defensin A
pathogenesis [55]. resistance of Y. pestis phoP or lpxM lpxP or Y. pseudotuberculosis pbgP
CAMP resistance of the feoC::Tn5AraOut mutant was duplicated operon mutants remained essentially unexplained [13,63,64].
with a feoC (y3910) deletion mutant, confirming that the pheno- Nevertheless, accumulating evidence indicates that CAMP resis-
type was due to the disruption of feoC. FeoC has been proposed to tance is CAMP-type specific and that this specificity is determined
be a repressor of the feoAB operon [45], which encodes one of the by a variety of bacterial genes, particularly those capable of
two ferrous iron uptake systems of Y. pestis, the other one being modulating directly or indirectly the bacterial surface architecture,
128 J. Guo et al. / Microbial Pathogenesis 51 (2011) 121e132

including the composition and content of its protein and lipid IPTG, respectively, using X-Gal (40 mg/l) as chromogenic substrate
species. with the latter. Reagents, including polymyxin B sulfate salt and
salmon protamine sulfate salt were from SigmaeAldrich Corp.
(St Louis, MO), and LL-37 was from AnaSpec (Fremont, CA). Rat
4. Materials and methods bronchoalveolar lavage fluid (rBALF) was generously supplied by
Sandra R. Bates-Kenney, and was shown to contain the cathelicidin
4.1. Bacterial strains, growth conditions and reagents rCRAMP and rat b-defensin 1 [48].

Bacterial strains and plasmids used in this study are listed in 4.2. Construction and testing of plasmid pTn5AraOut
Table 2. Media and media components were from Difco (BD Diag-
nostics, Sparks, MD). Y. pestis strains were grown overnight in brain Preliminary studies showed that the minitransposon miniTn5 of
heart infusion (BHI) broth at 26
C, diluted to an A600 of 0.1 in BHI pRL27 transposed efficiently in KIM6. Plasmid pTn5AraOut was
and further grown at 37
C. For colony selection, Y. pestis was grown engineered by inserting the EcoRI fragment of pNJ17 that contains
on BHI or TB agar (10 g tryptose, 2.5 g NaCl, 3.0 g Bacto beef extract the araC gene and PBAD promoter [65] into the SwaI site of pRL27,
paste and 1.5% Bacto-agar per liter) for 24e48 h at 26
C for colony which carries a miniTn5 delivery vector [66]. The araC-PBAD DNA
counts or at 37
C for mutant selection. For quantitative RT-PCR, fragment was blunted by filling in its protruding ends with the
bacteria grown at 26
C in heart Infusion (HI) were sub-cultured Klenow fragment of DNA polymerase before the ligation reaction. A
in HI for 4 h at 37
C. E. coli strains were grown at 37
C in LB successful construct carrying the miniTn5 with PBAD facing out was
broth or agar. When required, the media were supplemented with identified by restriction analysis and renamed pTn5AraOut.
kanamycin (Km, 45 mg/l), ampicillin (Ap, 200 mg/l) or chloram- Preliminary studies showed that the minitransposon of pRL27
phenicol (Cm, 20 mg/l). When appropriate, the arabinose and transposed efficiently in KIM6 and the transposition efficiency of
lactose promoters were induced with 0.2% L-arabinose and 1 mM Tn5AraOut was only marginally lower than that of pRL27. To test
the function of the arabinose-dependent promoter in Tn5AraOut,
Table 2 E. coli DH5a harboring the promoter-trap plasmid pRS415 was
Bacterial strains and plasmids. transformed with pTn5AraOut and the bacteria were screened for
Strain or plasmid Description Source
b-galactosidase activity on LB agar plates containing Ap, Km, X-gal
and L-arabinose. Bacteria isolated from Lacþ (blue) colonies were
E. coli
CC118lpir D(ara-leu) araD DlacX74 galE [74]
shown by restriction analysis to harbor Tn5AraOut upstream of the
galK phoA thi-1 rpsE rpoB lacZ gene in pRS415. Arabinose-dependent induction was further
argE(Am) confirmed on MacConkey agar plates.
recA1, lysogenized
with lpir phage
4.3. Minitransposon mutagenesis, mutant selection and screening
DH5a fhuA2 D(argF-lacZ)U169 Invitrogen Corp.,
phoA glnV44 Carlsbad, CA
F80 D(lacZ)M15 gyrA96 Y. pestis strain DSY101 was randomly mutagenized with the
recA1 relA1 minitransposon Tn5AraOut. For this, plasmid pTn5AraOut was
endA1 thi-1 hsdR17 introduced into strain DSY101 by 20 independent electroporations,
BL21(DE3) E. coli B (DE3)[Fe dcm Novagen, EMD Biosc.,
ompT hsdSB (rBe mBe)] Madison, WI
using in parallel water as negative controls. After 3 h recovery at
Y. pestis 26
C, the bacteria were incubated in kanamycin-containing BHI
KIM5 Y. pestis KIM pgm [75] broth at 37
C, overnight, in a roller drum. Mutants resistant to
KIM6 KIM5 pCD1e (LCRe) [75] antimicrobial peptides were then selected on TB-kanamycin agar
DSY88 KIM6 Dcaf Dpsa pPCP1 [48]
plates containing 0.2% L-arabinose and supplemented with poly-
UaphA Dpla
DSY101 DSY88 PCP1Dpla This study myxin B (4 mg/l, 4  MIC) or protamine (1 g/l, 1  MIC on agar
DSY131 DSY101 Dy1522::aphA This study plates) after incubation at 37
C for 2e3 days. Colonies were iso-
DSY132 DSY101 Dy1523::aphA This study lated and resistance to the corresponding cationic antimicrobials
DSY133 DSY131 pTrc99A This study was verified by growing the bacteria to an A600 of 0.6 in BHI-
DSY134 DSY131 pHcpy1522 This study
DSY135 DSY101 Dy3910(feoC)::aphA This study
kanamycin broth with 0.2% L-arabinose at 37
C and plating in
DSY136 DSY101 Dy3910-y3911 This study duplicate 0.01 ml onto corresponding cationic antimicrobial
(feoBC)::aphA selection agar plates. Growth was inspected after incubation at
DSY137 KIM5 Dy3911(feoB)::aphA This study 37
C for 1e3 days. Because of the intrinsic property of Y. pestis to
Plasmids
aggregate [67,68], most consistent absorbance data (A600) were
pNJ17 TnAraOut delivery [65]
vehicle; Kmr obtained by growing the bacteria in glass tubes and dissociating the
pRL27 Plasmid with miniTn5 [66] aggregated bacteria by strong vortex mixing just before absorbance
and oriR6K; Kmr readings. Bacteria were grown at 37
C to an A600 of 0.3 in 3 ml BHI-
pTn5AraOut pRL27 with araC-PBAD This study kanamycin broth, with 0.2% L-arabinose or 0.2% D-glucose when
from pNJ17; Kmr
pRS415 lacZ transcriptional [76]
appropriate to differentiate arabinose-dependent from arabinose-
fusion vector; Apr independent resistance. Serial two-fold dilutions of polymyxin
pSIM9 pRK2 gam exo bet; Cmr [77] B (1.25e5 mg/l) were directly added to such cultures. In contrast,
pKD4 Plasmid with the Kmr [72] dilutions of protamine (0.2e0.8 g/l), rat bronchoalveolar lavage
template for PCR
fluid (rBALF, 30e240 mg protein/ml), LL-37 (20e160 mg/ml) or H2O2
pET22b(þ) Expression vector; Novagen
His6 affinity tag; Apr (1e32 mM) were added to BHI cultures, prepared as described
pETHcp pET22b(þ)-y1522; Apr This study above and diluted 10-fold. The latter dilutions were needed to use
pTrc99A Expression vector with [78] concentrations of inhibitors that did not interfere significantly with
trc (trp-lac) promoter; Apr A600 readings. The experiments with rBALF were done with 0.5 ml
pHcpy1522 pTrc99A-y1522 This study
pFeoAB pTrc99A-y3911-y3912 This study
cultures and the ones with LL-37 were done with 0.1 ml cultures in
smaller tubes. The bacterial cultures were further incubated in
 J. Guo et al. / Microbial Pathogenesis 51 (2011) 121e132 129

a roller drum or agitated at 37
C for 18 , when final A600 values Table 3

were checked, or CFUs were determined for the LL-37 experiment. Primers.

Name Sequence 50 e30

4.4. Determination of MICs Tn5AraOutUP tgccatagcatttttatccat
Tn5AraOutLOW aacaagccagggatgtaacg
Y. pestis DSY101 and its derived mutants being unable to grow dinP-PrMK140 ggtaagtttggtcgcgtattgtgg
dinP-PrMK141 atcctcggccagtgttttctcc
significantly at 37
C in small volumes of cation-adjusted Mueller-
pmrH-PrMK142 cgagatcaatggattggtgagcag
Hinton broth (100 ml/well, 96-well microtiter plate; according to pmrH-PrMK143 gaacttaagccgacggactctgg
the NCCLS, now CLSI, guidelines), MICs were evaluated by the mglB-PrMK144 gtattgctggctaagggcgtgaaag
following method. Briefly, bacteria were grown to an A600 of mglB-PrMK145 gtagctatccaatgccttgcgagaag
0.08e0.1 in BHI broth at 37
C, diluted 10 fold in BHI (approximately 16SrDNA-PrMK146 gtgtgaagaaggccttcgggttg
16SrDNA-PrMK147 ttagccggtgcttcttctgcgag
106 CFU/ml), and distributed into round-bottom wells of 96-well rpoB-PrMK148 tgctgtacaacgcacgtatcatccc
microtiter plates (105 CFU/well). Serial two-fold dilutions of the rpoB-PrMK149 caggcaatttacggcgacggtc
various antimicrobials were prepared in triplicates and MICs were PrMK150 tcgggcaatcaggtgcgacaatctat
determined after overnight incubation on a rotary shaker at 37
C. PrMK151 gtctgcgattccgactcgtccaacat
y1522KOUP aataataagggatggtgtaggccatcc
MICs were defined as the lowest concentration of antimicrobials
ccgaataaagtgtaggctggagctgcttc
that inhibited visible growth. y1522KOLOW ccctgcatcttgaaggcgacgggtatata
aggacatcatatgaatatcctccttag
4.5. Southern blotting, subcloning and sequencing of y1522VFUP tcaccccctgaggatatagat
minitransposon insertion sites y1522VFLOW ggatgagcaagggcaactaac
y1523KOUP gaagctgtcctcagtatgaccacgtaggaaac
caggtgcggtgtaggctggagctgcttc
To check for single insertions by Southern blotting, genomic y1523KOLOW tcgccataaccagagcggagcctcagttcttg
DNA was extracted from parental strain Y101 or minitransposon gaacccgtcatatgaatatcctccttag
mutants (DNA purification kit, Gentra, USA) and digested with StyI y1523VFUP caggcgagcggttattctatc
y1523VFLOW ctccatgtcggcttaactgtt
or HpaI and separated on a 0.8% Seakem LE agarose gel. DNA was
feoCKOUP attgatcacccattagccagccgtaaaaagag
then transferred to Nytran SPC nylon membranes (GE Healthcare ggggaacggtgtaggctggagctgcttc
BioSciences Corp., Piscataway, NJ) by the capillary transfer method. feoCKOLOW atacggaatcaacatattgagatgcccatat
A 575-bp coding region of the kanamycin resistance gene that lacks gggcatctccatatgaatatcctccttag
StyI and HpaI sites was amplified from pTn5AraOut with primers feoCVFUP tcacccattagccagccgtaa
feoCVFLOW gctgacgccgaggtttat
PrMK150 and PrMK151 (Table 3), labeled with the DIG High Prime feoBKOUP cgcgcagtttgattttaatttattgatatcacgt
DNA Labeling and Detection Starter Kit II (Roche, Indianapolis, IN) tggatcgtgtaggctggagctgcttc
and used for hybridization as described by the supplier. To clone feoBKOLOW cgttgagggcaatcgcatcacgtag
minitransposon insertion sites, genomic DNA of each mutant was ttgcagtaggctggccatatgaatatcctccttag
feoBVFUP ttctatctgcgctacggtttg
digested with either one of a variety of restriction enzymes.
feoBVFLOW gctgatggccttcgggaca
Subsequently, the digested DNA was treated with T4 DNA ligase and y1522CMUP gactcccgggttaatacacgcgatcatcccat
used to transform E. coli CC118lpir by electroporation. Circularized y1522CMLOW gactcgtctcccatgagaatggctaacatgatt
DNA fragments containing the Tn5AraOut replicated as plasmids, feoABCMUP gactcgtctcccatgcatcttatcccccaacgatcctacaaa
most clones originating from genomic DNA originally restricted feoABCMLOW gactcccgggtttttacggctggctaatgggtga
pETHCP-UP gactcatatgagaatggctaacatgatt
with BclI or BamHI. The plasmids were isolated and served as pETHCP-LOW gactctcgagatacacgcgatcatcccagatgctataaccact
template for DNA sequencing, using a pair of outward-facing
primers (pTn5AraOutUP and pTn5AraOutLOW, Table 3) that
anneal to the oriR6 K or araC-PBAD ends of the minitransposon. The
Y. pestis KIM genome [69] was analyzed by BLAST [70] with the the transcription levels for the house keeping gene rpoB [20].
obtained sequences to determine the minitransposon insertion Statistical significance of compared results between the parental
sites. strain and mutants or arabinose-induced and non-induced condi-
tions was determined by the unpaired t-test (P < 0.05).
4.6. Quantitative RT-PCR
4.7. Preparation and analysis of LPS
HI broth cultures of bacteria grown to log-phase at 37
C were
split in two and grown further in the presence of 0.2% arabinose or LPS was prepared and resolved by SDS-PAGE as described
glucose for 20 . The cells were pelleted at 6000  g for 10 min at 4
C elsewhere [71]. Briefly, overnight bacterial cultures were diluted to
and RNA was extracted using Trizol reagent (Invitrogen Corp., an A600 of 0.5, and the cell pellets from 1 ml aliquots were sus-
Carlsbad, CA) according to the manufacturer’s protocol. Residual pended in 50 ml of lysis buffer (2% SDS, 4% 2-mercaptoethanol, 10%
genomic DNA contamination in 10 mg RNA samples was removed by glycerol, 1 M TriseHCl [pH 6.8], 0.002% bromophenol blue). The
treating with the Turbo DNA-free Kit (Ambion, Austin, TX). RNA samples were heated at 100
C for 10 min, cooled to room
concentration was determined with the ND1000 spectrophotometer temperature, and incubated with 25 mg of proteinase K (Roche
(NanoDrop products, Wilmington, DE) and RNA integrity was veri- Diagnostics, Mannheim, Germany) at 60
C for 1 h. The sample
fied by agarose gel electrophoresis. Four hundred nanogram of RNA preparations were resolved by electrophoresis on a 12% poly-
was used in reverse transcription reactions using random hexamer acrylamide gel at 150 V, and the gels were silver stained (Silver
primers and Superscript RTIII Reverse Transcriptase (Invitrogen Stain Kit; Bio-Rad, Hercules, CA).
Corp.) according to manufacturer’s protocol. Quantitative Real-Time
RT-PCR was carried out using cDNA corresponding to 20 ng RNA, 4.8. Dansyl-polymyxin B binding test
gene-specific primers (Table 3) and the Power SYBR Green PCR
Master Mix with the ABI Fast 7500 Real-Time PCR System (Applied Bacteria were grown at 37
C to an A600 of approximately
Biosystems, Foster City, CA). Expression levels were normalized to 0.3e0.4 in 3 ml BHI broth. Bacteria were twice centrifuged and
130 J. Guo et al. / Microbial Pathogenesis 51 (2011) 121e132

resuspended in PBS, adjusted to an A600 of 0.3 and 3 ml aliquots specific antibody, HRP-conjugated secondary antibody and
were concentrated by centrifugation and resuspension in 400 ml enhanced chemiluminescence substrate [73].
PBS. Half of this bacterial suspension was supplemented with
dansyl-polymyxin B (Molecular Probes, Eugene, OR) to a final 4.11. Infection of mice
concentration of 2 mg/ml, whereas the other half was used as
negative control to evaluate background fluorescence. After incu- Six to eight week old female C57BL/6 mice were purchased from
bation at 37
C for 5 min, the bacteria were centrifuged and washed the Jackson Laboratories. The mice were provided food and fresh
twice in PBS, resuspended in 400 ml PBS and used for fluorescence water ad libitum during the experiments, which were performed
microscopy or fluorometry. For the latter analysis, the bacterial following the guidelines of the University of Pennsylvania Institu-
suspension was transferred to transparent flat-bottom 96-well tional Animal Care and Use Committee. Bacteria were grown at
microtiter plates in triplicate. The A600 and fluorescence values 26
C, washed two times by centrifugation and suspension steps in
were read with a BioTek’s SynergyÔ HT Microplate Reader. The sterile PBS. Numbers of colony-forming units (CFU) inoculated were
following calculations were done: Standardized fluorescence determined by plating serial dilutions onto TB agar plates [48]. Mice
(arbitrary units or A.U.) value ¼ (fluorescence (A.U.)/A600)test - were anesthetized (ketamine/xylazin 100/10 mg/kg body weight
(fluorescence (A.U.)/A600)control. Data were presented as intra-peritoneally, i.p.) and infected subcutaneously (s.c.) with
means  SD of three separate experiments and statistical signifi- 3  107 CFU each of KIM5 and DSY137 (KIM5 feoB) in 200 ml PBS. At
cance was determined by the unpaired t-test. days 1, 2, 4 and 5, livers and spleens were surgically removed and
homogenized in 5 ml sterile PBS by using a Stomacher Lab Blender
4.9. Construction of deletion mutants and plasmids, and (Seward Medical Limited). CFU/organ were determined by plating
complementation assays serial dilutions onto TB agar plates containing or lacking kana-
mycin. CFUs for KIM5 were calculated by subtracting the DSY137
Some of the genes targeted by Tn5AraOut were deleted from CFUs (Km plates) from the total CFUs (no antibiotic). Competitive
strain DSY101 by using the lambda red recombination system [72]. index (C.I.) scores were calculated as the ratio of the KIM5 CFUs to
Briefly, primers flanking the corresponding genes were designed the DSY137 CFUs. Statistical significance was determined by the
and used with pKD4 (Table 3) as template to prepare amplicons for paired t-test.
the replacement of the target genes with a kanamycin cassette.
Strain DSY101 carrying the lambda red plasmid pSIM9 (Table 2) was
grown to log phase at 26
C, the red recombinase genes were Acknowledgement
induced for 15 min at 42
C, and the bacteria were transformed by
electroporation with the gel-purified amplicons. Kanamycin- We thank Jun (Jay) Zhu and Mark Goulian for plasmids, Sandra
resistant recombinants were selected on BHI agar and verified by Bates for the gifts of rat broncheoalveolar lavage fluid. This work was
colony PCR, using primers that hybridize to flanking sequences of supported by NIH grant RAI076695, a University of Pennsylvania
the target genes. Mutants cured of pSIM9 were selected by bacterial Research Foundation grant and Research Initiative Funds from the
growth at 37
C. Using this approach, deletion mutants were University of Pennsylvania Veterinary Center for Infectious Disease
engineered for genes y1522(hcp-like), y1523, y3910(feoC) and to DMS. JG was a two-year visiting student from Beijing University,
y3910-3911(feoCB) in strain DSY101, and for gene y3911 in strain supported by the China Scholarship Council (CSC).
KIM5. The resulting strains were designated DSY131, DSY132,
DSY135, DSY136 and DSY137, respectively (Table 2). Moreover, Appendix. Supplementary data
genes y1522, or y3911 and y3912(feoA) together, were cloned by
PCR into the NcoI-XmaI sites of the expression plasmid pTrc99A for Supplementary data associated with article can be found in
complementation studies. The generated plasmids were designated online version at doi:10.1016/j.micpath.2011.04.010.
pHcpy1522 and pFeoAB, respectively (Table 2). Gene y1522 was
also cloned by PCR into the NdeI-XhoI restriction sites of pET22b(þ)
References
to generate plasmid pETHcp (Table 2). Mutants complemented
with plasmid constructs or with the empty vector were grown in [1] Liu F, Chen H, Galván EM, Lasaro MA, Schifferli DM. Effects of Psa and F1 on the
BHI broth overnight at 26
C, sub-cultured in BHI with IPTG adhesive and invasive interactions of Yersinia pestis with human respiratory
(0.1 mM) at 37
C and grown for 2e3 h to an A600 of 0.3. Polymyxin tract epithelial cells. Infect Immun 2006;74:5636e44.
[2] Huang XZ, Lindler LE. The pH 6 antigen is an antiphagocytic factor produced
B was added (1.25e5 mg/l) and further growth was monitored by Yersinia pestis independent of Yersinia outer proteins and capsule antigen.
(A600) after 18 h at 37
C. Infect Immun 2004;72:7212e9.
[3] Du Y, Rosqvist R, Forsberg A. Role of fraction 1 antigen of Yersinia pestis in
inhibition of phagocytosis. Infect Immun 2002;70:1453e60.
4.10. Expression and purification of the Hcp-like protein [4] Galván EM, Chen H, Schifferli DM. The Psa fimbriae of Yersinia pestis interact
with phosphatidylcholine on alveolar epithelial cells and pulmonary surfac-
The Hcp-like protein encoded by y1522 was expressed and tant. Infect Immun 2007;2007:1272e9.
[5] Cornelis GR. The Yersinia Ysc-Yop ‘type III’ weaponry. Nat Rev Mol Cell Biol.
purified from E. coli BL21(DE3)pETHcp following the standard 2002;3:742e52.
protocol (Qiagen, Valencia, CA). The protein antigen was used to [6] Viboud GI, Bliska JB. Yersinia outer proteins: role in modulation of host cell
prepare polyclonal rabbit antisera (Cocalico Biologicals, Inc.). To signalling responses and pathogenesis. Annu Rev Microbiol 2005;59:69e89.
[7] Mukherjee S, Keitany G, Li Y, Wang Y, Ball HL, Goldsmith EJ, et al. Yersinia YopJ
determine whether the protein was secreted, bacteria and spent
acetylates and inhibits kinase activation by blocking phosphorylation. Science
media of a 10 ml culture (BHI, 37
C for 18 h) were studied by SDS- 2006;312:1211e4.
PAGE and Western blot. For this, spent media were first filtered [8] Lemaitre N, Sebbane F, Long D, Hinnebusch BJ. Yersinia pestis YopJ suppresses
(Millex, MF-milliporeÔ, 0.22 mm, Millipore, Billerica, MA), tumor necrosis factor alpha induction and contributes to apoptosis of immune
cells in the lymph node but is not required for virulence in a rat model of
concentrated to 1 ml (Amicon Ultra-15, 10 kDa, Millipore), precip- bubonic plague. Infect Immun 2006;74:5126e31.
itated in 10% TCA and the pellet was rinsed twice in 0.5 ml cold [9] Brubaker RR. Interleukin-10 and inhibition of innate immunity to Yersiniae:
acetone before being resuspended in 100 ml sample buffer and split roles of Yops and LcrV (V antigen). Infect Immun 2003;71:3673e81.
[10] Depaolo RW, Tang F, Kim I, Han M, Levin N, Ciletti N, et al. Toll-like receptor 6
in two for SDS-PAGE and Western blot analysis. The gels were drives differentiation of tolerogenic dendritic cells and contributes to LcrV-
stained with Coomassie Blue and the blots were probed with the mediated plague pathogenesis. Cell Host Microbe 2008;4:350e61.
 J. Guo et al. / Microbial Pathogenesis 51 (2011) 121e132 131

[11] Ye Z, Kerschen EJ, Cohen DA, Kaplan AM, van Rooijen N, Straley SC. Gr1 þ cells [42] Richarme G, Caldas TD. Chaperone properties of the bacterial periplasmic
control growth of YopM-negative Yersinia pestis during systemic plague. substrate-binding proteins. J Biol Chem 1997;272:15607e12.
Infect Immun; 2009. [43] Semsey S, Krishna S, Sneppen K, Adhya S. Signal integration in the galactose
[12] Montminy SW, Khan N, McGrath S, Walkowicz MJ, Sharp F, Conlon JE, et al. network of Escherichia coli. Mol Microbiol 2007;65:465e76.
Virulence factors of Yersinia pestis are overcome by a strong lipopolysaccha- [44] Tommassen J, Eiglmeier K, Cole ST, Overduin P, Larson TJ, Boos W. Charac-
ride response. Nat Immunol 2006;7:1066e73. terization of two genes, glpQ and ugpQ, encoding glycerophosphoryl diester
[13] Rebeil R, Ernst RK, Gowen BB, Miller SI, Hinnebusch BJ. Variation in lipid A phosphodiesterases of Escherichia coli. Mol Gen Genet 1991;226:321e7.
structure in the pathogenic Yersiniae. Mol Microbiol 2004;52:1363e73. [45] Cartron ML, Maddocks S, Gillingham P, Craven CJ, Andrews SC. Feoetransport
[14] Robinson RT, Khader SA, Locksley RM, Lien E, Smiley ST, Cooper AM. Yersinia of ferrous iron into bacteria. Biometals 2006;19:143e57.
pestis evades TLR4-dependent induction of IL-12(p40)2 by dendritic cells and [46] Zhou D, Qin L, Han Y, Qiu J, Chen Z, Li B, et al. Global analysis of iron assim-
subsequent cell migration. J Immunol 2008;181:5560e7. ilation and fur regulation in Yersinia pestis. FEMS Microbiol Lett 2006;258:
[15] Velan B, Bar-Haim E, Zauberman A, Mamroud E, Shafferman A, Cohen S. 9e17.
Discordance in the effects of Yersinia pestis on the dendritic cell functions [47] Dürr UH, Sudheendra US, Ramamoorthy A. LL-37, the only human member of
manifested by induction of maturation and paralysis of migration. Infect the cathelicidin family of antimicrobial peptides. Biochim Biophys Acta 2006;
Immun 2006;74:6365e76. 1758:1408e25.
[16] Zhang P, Skurnik M, Zhang SS, Schwartz O, Kalyanasundaram R, Bulgheresi S, [48] Galván EM, Lasaro MA, Schifferli DM. Capsular antigen fraction 1 and Pla
et al. Human DC-SIGN (CD209) is a receptor for Yersinia pestis that promotes modulate the susceptibility of Yersinia pestis to pulmonary antimicrobial
phagocytosis by dendritic cells. Infect Immun; 2008. peptides such as cathelicidin. Infect Immun 2008;76:1456e64.
[17] Zhang SS, Park CG, Zhang P, Bartra SS, Plano GV, Klena JD, et al. Plasminogen [49] Groisman EA, Parra-Lopez C, Salcedo M, Lipps CJ, Heffron F. Resistance to host
activator Pla of Yersinia pestis utilizes murine DEC-205 (CD205) as a receptor antimicrobial peptides is necessary for Salmonella virulence. Proc Natl Acad
to promote dissemination. J Biol Chem 2008;283:31511e21. Sci U S A 1992;89:11939e43.
[18] Cathelyn JS, Crosby SD, Lathem WW, Goldman WE, Miller VL. RovA, a global [50] Parra-Lopez C, Baer MT, Groisman EA. Molecular genetic analysis of a locus
regulator of Yersinia pestis, specifically required for bubonic plague. Proc Natl required for resistance to antimicrobial peptides in Salmonella typhimurium.
Acad Sci U S A 2006;103:13514e9. Embo J 1993;12:4053e62.
[19] Sodeinde OA, Subrahmanyam YV, Stark K, Quan T, Bao Y, Goguen JD. A surface [51] Peschel A, Otto M, Jack RW, Kalbacher H, Jung G, Gotz F. Inactivation of the dlt
protease and the invasive character of plague. Science 1992;258:1004e7. operon in Staphylococcus aureus confers sensitivity to defensins, protegrins,
[20] Felek S, Tsang TM, Krukonis ES. Three Yersinia pestis adhesins facilitate Yop and other antimicrobial peptides. J Biol Chem 1999;274:8405e10.
delivery to eukaryotic cells and contribute to plague virulence. Infect Immun [52] Pukatzki S, McAuley SB, Miyata ST. The type VI secretion system: translocation
2010;78:4134e50. of effectors and effector-domains. Curr Opin Microbiol 2009;12:11e7.
[21] Sodeinde OA, Sample AK, Brubaker RR, Goguen JD. Plasminogen activator/ [53] Leiman PG, Basler M, Ramagopal UA, Bonanno JB, Sauder JM, Pukatzki S, et al.
coagulase gene of Yersinia pestis is responsible for degradation of plasmid- Type VI secretion apparatus and phage tail-associated protein complexes
encoded outer membrane proteins. Infect Immun 1988;56:2749e52. share a common evolutionary origin. Proc Natl Acad Sci U S A; 2009.
[22] Lahteenmaki K, Virkola R, Saren A, Emody L, Korhonen TK. Expression of [54] Pieper R, Huang ST, Robinson JM, Clark DJ, Alami H, Parmar PP, et al.
plasminogen activator pla of Yersinia pestis enhances bacterial attachment to Temperature and growth phase influence the outer-membrane proteome and
the mammalian extracellular matrix. Infect Immun 1998;66:5755e62. the expression of a type VI secretion system in Yersinia pestis. Microbiology
[23] Welkos SL, Friedlander AM, Davis KJ. Studies on the role of plasminogen 2009;155:498e512.
activator in systemic infection by virulent Yersinia pestis strain C092. Microb [55] Robinson JB, Telepnev MV, Zudina IV, Bouyer D, Montenieri JA, Bearden SW,
Pathog 1997;23:211e23. et al. Evaluation of a Yersinia pestis mutant impaired in a thermoregulated
[24] Sebbane F, Jarrett CO, Gardner D, Long D, Hinnebusch BJ. Role of the Yersinia type VI-like secretion system in flea, macrophage and murine models. Microb
pestis plasminogen activator in the incidence of distinct septicemic and bubonic Pathog 2009;47:243e51.
forms of flea-borne plague. Proc Natl Acad Sci U S A 2006;103:5526e30. [56] Perry RD, Mier Jr I, Fetherston JD. Roles of the Yfe and Feo transporters of Yersinia
[25] Lathem WW, Price PA, Miller VL, Goldman WE. A plasminogen-activating pestis in iron uptake and intracellular growth. Biometals 2007;20:699e703.
protease specifically controls the development of primary pneumonic plague. [57] Imlay JA. Cellular defenses against superoxide and hydrogen peroxide. Annu
Science 2007;315:509e13. Rev Biochem 2008;77:755e76.
[26] Kerschen EJ, Cohen DA, Kaplan AM, Straley SC. The plague virulence protein [58] Pieper R, Huang ST, Parmar PP, Clark DJ, Alami H, Fleischmann RD, et al.
YopM targets the innate immune response by causing a global depletion of NK Proteomic analysis of iron acquisition, metabolic and regulatory responses of
cells. Infect Immun 2004;72:4589e602. Yersinia pestis to iron starvation. BMC Microbiol 2010;10:30.
[27] Endsley JJ, Torres AG, Gonzales CM, Kosykh VG, Motin VL, Peterson JW, et al. [59] Bearden SW, Perry RD. The Yfe system of Yersinia pestis transports iron and
Comparative antimicrobial activity of Granulysin against bacterial Biothreat manganese and is required for full virulence of plague. Mol Microbiol 1999;
Agents. Open Microbiol J 2009;3:92e6. 32:403e14.
[28] Peschel A, Sahl HG. The co-evolution of host cationic antimicrobial peptides [60] Bliska JB, Casadevall A. Intracellular pathogenic bacteria and fungiea case of
and microbial resistance. Nat Rev Microbiol. 2006;4:529e36. convergent evolution? Nat Rev Microbiol 2009;7:165e71.
[29] Nizet V. Antimicrobial peptide resistance mechanisms of human bacterial [61] Arafah S, Rosso ML, Rehaume L, Hancock RE, Simonet M, Marceau M. An iron-
pathogens. Curr Issues Mol Biol 2006;8:11e26. regulated LysR-type element mediates antimicrobial peptide resistance and
[30] Higuchi K, Carlin CE. Studies on the nutrition and physiology of Pasteurella virulence in Yersinia pseudotuberculosis. Microbiology 2009;155:2168e81.
pestis. I. A casein hydrolyzate medium for the growth of Pasteurella pestis. [62] Bader MW, Sanowar S, Daley ME, Schneider AR, Cho U, Xu W, et al. Recog-
J Bacteriol 1957;73:122e9. nition of antimicrobial peptides by a bacterial sensor kinase. Cell 2005;122:
[31] Winfield MD, Latifi T, Groisman EA. Transcriptional regulation of the 4-amino- 461e72.
4-deoxy-L-arabinose biosynthetic genes in Yersinia pestis. J Biol Chem 2005; [63] Rebeil R, Ernst RK, Jarrett CO, Adams KN, Miller SI, Hinnebusch BJ. Charac-
280:14765e72. terization of late acyltransferase genes of Yersinia pestis and their role in
[32] Yan A, Guan Z, Raetz CR. An undecaprenyl phosphate-aminoarabinose flippase temperature-dependent lipid A variation. J Bacteriol 2006;188:1381e8.
required for polymyxin resistance in Escherichia coli. J Biol Chem 2007;282: [64] Marceau M, Sebbane F, Ewann F, Collyn F, Lindner B, Campos MA, et al. The
36077e89. pmrF polymyxin-resistance operon of Yersinia pseudotuberculosis is upregu-
[33] Bingle LE, Bailey CM, Pallen MJ. Type VI secretion: a beginner’s guide. Curr lated by the PhoP-PhoQ two-component system but not by PmrA-PmrB, and
Opin Microbiol 2008;11:3e8. is not required for virulence. Microbiology 2004;150:3947e57.
[34] Misra R, Miao Y. Molecular analysis of asmA, a locus identified as the [65] Judson N, Mekalanos JJ. TnAraOut, a transposon-based approach to identify
suppressor of OmpF assembly mutants of Escherichia coli K-12. Mol Microbiol and characterize essential bacterial genes. Nat Biotechnol 2000;18:740e5.
1995;16:779e88. [66] Larsen RA, Wilson MM, Guss AM, Metcalf WW. Genetic analysis of pigment
[35] Xiong X, Deeter JN, Misra R. Assembly-defective OmpC mutants of Escherichia biosynthesis in Xanthobacter autotrophicus Py2 using a new, highly efficient
coli K-12. J Bacteriol 1996;178:1213e5. transposon mutagenesis system that is functional in a wide variety of bacteria.
[36] Deng M, Misra R. Examination of AsmA and its effect on the assembly of Arch Microbiol 2002;178:193e201.
Escherichia coli outer membrane proteins. Mol Microbiol 1996;21:605e12. [67] Felek S, Lawrenz MB, Krukonis ES. The Yersinia pestis autotransporter YapC
[37] Gottesman S. Proteolysis in bacterial regulatory circuits. Annu Rev Cell Dev mediates host cell binding, autoaggregation and biofilm formation. Microbi-
Biol 2003;19:565e87. ology 2008;154:1802e12.
[38] Inagawa T, Kato J, Niki H, Karata K, Ogura T. Defective plasmid partition in ftsH [68] Kolodziejek AM, Sinclair DJ, Seo KS, Schnider DR, Deobald CF, Rohde HN, et al.
mutants of Escherichia coli. Mol Genet Genomic 2001;265:755e62. Phenotypic characterization of OmpX, an Ail homologue of Yersinia pestis KIM.
[39] Langklotz S, Schakermann M, Narberhaus F. Control of lipopolysaccharide Microbiology 2007;153:2941e51.
biosynthesis by FtsH-mediated proteolysis of LpxC is conserved in enter- [69] Deng W, Burland V, Plunkett 3rd G, Boutin A, Mayhew GF, Liss P, et al.
obacteria but not in all gram-negative bacteria. J Bacteriol 2011;193:1090e7. Genome sequence of Yersinia pestis KIM. J Bacteriol 2002;184:4601e11.
[40] Jackson RJ, Binet MR, Lee LJ, Ma R, Graham AI, McLeod CW, et al. Expression of [70] Cummings L, Riley L, Black L, Souvorov A, Resenchuk S, Dondoshansky I, et al.
the PitA phosphate/metal transporter of Escherichia coli is responsive to zinc Genomic BLAST: custom-defined virtual databases for complete and unfin-
and inorganic phosphate levels. FEMS Microbiol Lett 2008;289:219e24. ished genomes. FEMS Microbiol Lett 2002;216:133e8.
[41] Willsky GR, Malamy MH. Characterization of two genetically separable inor- [71] Hitchcock PJ, Brown TM. Morphological heterogeneity among Salmonella
ganic phosphate transport systems in Escherichia coli. J Bacteriol 1980;144: lipopolysaccharide chemotypes in silver-stained polyacrylamide gels.
356e65. J Bacteriol 1983;154:269e77.
132 J. Guo et al. / Microbial Pathogenesis 51 (2011) 121e132

[72] Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in [75] Goguen JD, Yother J, Straley SC. Genetic analysis of the low calcium response in
Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 2000;97:6640e5. Yersinia pestis mu d1(Ap lac) insertion mutants. J Bacteriol 1984;160:842e8.
[73] Chen H, Schifferli DM. Mucosal and systemic immune responses to chimeric [76] Simons RW, Houman F, Kleckner N. Improved single and multicopy lac-based
fimbriae expressed by Salmonella enterica Serovar Typhimurium vaccine cloning vectors for protein and operon fusions. Gene 1987;53:85e96.
strains. Infect Immun 2000;68:3129e39. [77] Datta S, Costantino N, Court DL. A set of recombineering plasmids for gram-
[74] Herrero M, De Lorenzo V, Timmis KN. Transposon vectors containing non- negative bacteria. Gene 2006;379:109e15.
antibiotic resistance selection markers for cloning and stable chromosomal [78] Amann E, Ochs B, Abel KJ. Tightly regulated tac promoter vectors useful for
insertion of foreign genes in gram-negative bacteria. J Bacteriol 1990;172: the expression of unfused and fused proteins in Escherichia coli. Gene 1988;
6557e67. 69:301e15.