Journal of Biotechnology 238 (2016) 30–34

Contents lists available at ScienceDirect

Journal of Biotechnology
journal homepage: www.elsevier.com/locate/jbiotec

Aptamer-based trapping of phytosphingosine in urine samples

Christin Fischer, Sven Klockmann, Hauke Wessels, Tim Hünniger, Jil Schrader,
Angelika Paschke-Kratzin, Markus Fischer ∗
HAMBURG SCHOOL OF FOOD SCIENCE; Institute of Food Chemistry, University of Hamburg, Grindelallee 117, 20146 Hamburg, Germany

a r t i c l e i n f o a b s t r a c t

Article history: Usually, small molecules like single metabolites used in clinical diagnostic can be quantified by instru-
Received 13 July 2016 mental approaches like LC–MS or bioanalytical techniques using antibodies or aptamers as selective
Received in revised form 1 September 2016 receptors. The present work comprises the generation of aptamers with an affinity towards the medi-
Accepted 12 September 2016
cally relevant metabolite phytosphingosine via the previously reported just in time-Selection approach
Available online 13 September 2016
(Hünniger et al., 2014). The whole approach could be seen as a proof of concept to extend the existing just
in time-Selection protocol for selection towards small molecules with dissociation constants in the low
Keywords:
nanomolar range. Moreover it is conceivable that the shown methods could be quickly adapted to further
just in time-Selection
Metabolite
scopes. Aptamers could be applied for clean-up or concentration processes prior to further analysis. As
Urine an example, we used the selected aptamers towards phytosphingosine bound to magnetic particles for
Aptamer affinity enrichment in both selection buffer and urine samples. As an outcome, enrichment factors of up
Trapping to 9-fold (selection buffer)/4-fold (urine samples) were achieved by this approach.
Small molecule © 2016 Published by Elsevier B.V.

1. Introduction by exponential enrichment) process. Due to their single stranded

conformation, they are able to form distinct three dimensional
Various small chemical compounds like metabolites up to a structures, which are the basis for highly affine interactions –
molecular mass of 2000 Da are of great importance as markers in comparable to these of antibodies – to several target molecules
medical diagnosis (Blaas et al., 2011). For instance, metabolites or (Ellington and Szostak, 1990, 1992; Stoltenburg et al., 2007; Tuerk
degradation products thereof are often used in therapy monitoring and Gold, 1990). Aptamers, once generated, can be used for a wide
or as key substances to tackle the state of health. Thus, their role in range of applications, like detection, sensing, labeling or trapping,
analytical applications is rapidly increasing. On the other hand, the of e.g. spores or molecules with different physical or chemical prop-
authentication of food and commodities for food production based erties (Chi et al., 2011; Fischer et al., 2015; Hünniger et al., 2015;
on small marker molecules, e.g. metabolites, becomes more and Kim et al., 2009; Levy et al., 2005; McCauley et al., 2003; Ng and
more important. Single small molecules can be quantified by instru- Adamis, 2006; Savla et al., 2011).
mental approaches e.g. by LC–MS or by bioanalytical techniques The present work presents the suitability of the just in time-
using antibodies or aptamers depending on (i) the chemical struc- Selection process for small molecules. Furthermore a trapping
ture and the physical properties, (ii) the technical configuration and application in urine via aptamer-linked magnetic particles was
(iii) the education and training of the staff (Hanzlick and Gowitt, developed exemplary. So far only aptamers towards proteins
1991; Roth and Breaker, 2009; Wink, 1999; Zhang et al., 2009). If gained via just in time-Selection were published. The present work
metabolites, contaminants or residues are embedded in a complex demonstrates herein the novel proof of concept, that this selec-
matrix or are only present in low concentrations a clean-up and/or tion method is also suitable for other target classes than proteins
enrichment step using trapping techniques might be appropriate. (Hünniger et al., 2014). The target chosen for the present work
Aptamers are short single stranded DNA or RNA oligonu- (phytosphingosine) is known as a medical biomarker in urine
cleotides, which are usually selected from a randomized oligonu- for chronic kidney disease and chronic renal failures. Thereby
cleotide library via the SELEX (systematic evolution of ligands a manifestation includes changes in renal detoxification capac-
ity, deregulation of salt and water balance and altered endocrine
functions (Zhao, 2013; Zhao et al., 2012). Furthermore phytosphin-
∗ Corresponding author. gosine is indicated as potential ovarian cancer biomarker in urine
E-mail address: [email protected] (M. Fischer). (Chen et al., 2012). Classical sphingolipid analysis is performed

http://dx.doi.org/10.1016/j.jbiotec.2016.09.005
0168-1656/© 2016 Published by Elsevier B.V.
 C. Fischer et al. / Journal of Biotechnology 238 (2016) 30–34 31

using thin layer chromatography, high-performance liquid chro- 2.2. Characterization of selected aptamers via fluorescence assay
matography, immunochemical and coupled mass spectrometry
methods. Thus low detection limits could be achieved especially The target beads used for selection were also used for deter-
by mass spectrometry, but these technologies are in terms of costs mination of dissociation constants using a fluorescence assay. The
and time highly demanding. As the concentration of biomarkers fluorescently labeled aptamers (labeling protocol see supplemen-
in real samples were often near the detection limits of instrumen- tary material (SM)) were diluted in a total volume of 90 ␮L to
tal approaches, a trapping/enrichment prior to the analysis can be 20 nM, 40 nM, 60 nM, 80 nM, 100 nM, 200 nM, and 400 nM with
useful to gain a valuable diagnostic tool. binding buffer. Afterwards, 10 ␮L of target beads (10 mg/mL) were
Generally, trapping applications e.g. with antibodies are known added to each dilution and the resulting solution was mixed and
to be important for routine analysis as they allow a rapid clean-up incubated for 30 min under agitation and exclusion of light. The
of samples. Considering the directive 2010/63/EU on the protection solutions were centrifuged (10 min at 18,400 × g) and the super-
of animals used for scientific purposes, the demand for alternatives natant was removed. The resulting pellet, containing the bound
for antibodies is continuously increasing. The physical properties fluorescently labeled aptamers, was washed once with 100 ␮L
of aptamers (e.g. binding constants) are comparable to antibodies. binding buffer to remove unspecific bound aptamers. Afterwards,
Aptamer driven trapping enables the enrichment of target com- the solution was centrifuged (10 min at 18,400 × g), each pellet was
pounds such as pesticides, antibiotic residues, vegetative cells or resuspended in 100 ␮L ddH2 O and used directly for fluorescence
spores, which could not be detected without an enrichment step measurement using the SpectraMaxx® 2 (extinction 485 nm, emis-
which can be time consuming (Hünniger et al., 2015). The pre- sion: 525 nm, Molecular Devices Analytical Technolgies GmbH,
sented enrichment technique, which is based on aptamer-linked Ismaning, Germany). The obtained fluorescence data were fitted
magnetic particles, offers a rapid and easy to handle applica- nonlinear (Hill-fit) using OriginPro 9.0G and the dissociation con-
tion demonstrated in spiked urine samples and could be seen as stants were extrapolated at Vmax /2.
proof of concept for aptamer-based biomarker enrichment in real
samples. 2.3. Magnetic trapping and enrichment of phytosphingosine

First, the aptamers towards phytosphingosine (phyto-Apt-1)

were linked to magnetic particles (SiMAG-Carboxyl, chemicell
2. Materials and methods GmbH, Berlin, Germany) according to the manufacturerı́s proto-
col. The linked particles were washed twice and resuspended using
2.1. Selection of aptamers towards phytosphingosine binding buffer. To ensure that aptamers exhibit their specific three-
dimensional structure, which is of prime importance for successful
Selection of aptamers with an affinity towards phytosphingo- trapping, the aptamer-linked magnetic particles were unfolded for
sine (Santa-Cruz Biotechnology Inc., Purity 98%) was performed 5 min at 95 ◦ C. Afterwards, the solution was cooled down quickly
using just in time-Selection (Hünniger et al., 2014). For defined to 4 ◦ C to inhibit unspecific hybridization. Subsequent trapping was
interaction conditions the following buffer conditions were used performed in (i) binding buffer and (ii) four different urine samples
for aptamer selection: 0.5 mM EDTA, 1 M NaCl, 5 mM Tris-HCl, pH gained from test persons at the Hamburg School of Food Science.
7.5 (Hünniger et al., 2015). The aptamer pool for the first selection The urine samples were buffered prior to the trapping with 5-
round consisted of the following sequence and included a ran- fold binding buffer. 10 ␮L of the linked particles were incubated
domized part comprising of 40 bases: 5 -CATCCGTCACACCTGCTC- for 30 min under rotation with 1 ␮L phytosphingosine (100 ppm)
(N)40 -GGTGTTGGCTCCCGTATC-3 (Thermo Fisher Scientific Inc., in a total volume of 1000 ␮L binding buffer or buffered urine
Darmstadt, Germany). For the first selection step, the so called (containing 20% binding buffer). Subsequently, the reaction mix-
FISHing, the metabolite was immobilized on the surface of carboxy- ture was centrifuged (2 min at 10,000 × g), the supernatant was
lated magnetic particles (SiMAG-Carboxyl, chemicell GmbH, Berlin, discarded, the particle pellet, containing the bound targets, was
Germany) regarding the manufactures protocol to enable the fol- washed with 1000 ␮L binding buffer and resuspended in 100 ␮L
lowing semi-automated steps as described elsewhere (Hünniger methanol. Finally, a heat elution (5 min at 75 ◦ C) was performed
et al., 2014). FISHing includes both several washing respectively and the hot supernatant, including the targets, was transferred
discarding steps and a final elution step for each round. The result- into a new reaction tube. The trapping technique is schematically
ing eluate contains the enriched aptamers. This semi-automated shown in Fig. 1. The concentrations of phytosphingosine before
process was performed using the KingFisher Duo (Thermo Fisher and after trapping were analyzed by LC-ESI–MS/MS. To gain valid
Scientific Oy, Vantaa, Finland). enrichment factors and to proof the suitability of the developed LC-
During the subsequent BEAMing, the amplification of the ESI–MS/MS method, samples without trapping were also analyzed
enriched aptamer fraction takes part (Schütze et al., 2011). This step by LC-ESI–MS/MS.
also includes a strand separation to obtain single stranded aptamers
again. After 15 selection rounds the resulting enriched aptamer 2.4. Monitoring of phytosphingosine trapping via LC-ESI–MS/MS
pool was ligated using TOPO TA cloning kit (Thermo Fisher Scientific
Inc., Darmstadt, Germany) and transformed into E. coli XL1 cells. The Liquid chromatography was performed on a PRPTM -C18 HPLC
plasmids were isolated using the QlAprep Spin miniprep kit (Qiagen Column (5 ␮m, 150 mm × 2.1 mm i.d., Hamilton Company, Reno,
GmbH, Hilden, Germany). Afterwards the cloned aptamers were NV, USA) at 20 ◦ C with a flow rate of 200 ␮L/min using an Agi-
sequenced by GATC Biotech AG (Constance, Germany) using M13 lent 1260 Infinity Quarternary LC System (Agilent Technologies,
forward primers. The obtained sequences were analyzed regard- Waldbronn, Germany). The mobile phase A was water and B
ing their percent identity matrix (Clustal Omega and Gentle) and methanol, both containing 0.1 % formic acid. The gradient elution
secondary structures were predicted using mfold, considering the is shown in SM Table S1. The injection volume for all sam-
buffer specifications (Peyret, 2000; Zuker, 2003). Furthermore, the ples was 5 ␮L. For detection a triple quadrupole-MS/MS API
dissociation constants were determined via fluorescence assay 2000 (Applied Biosystems, Darmstadt, Germany) equipped with a
(see below) to gain information about the interaction behavior of turbo ion spray source was used, operating in positive ion mode
aptamers and target. Thereby a low dissociation constant is striven with the following mass spectrometer settings: ion spray volt-
indicating a good interaction. age = 4500 V; temperature = 450 ◦ C; ion source gas 1 = 50 psi; ion
32 C. Fischer et al. / Journal of Biotechnology 238 (2016) 30–34

and used for subsequent selection rounds after a strand separation.

During the first four rounds of selection a counter-SELEX was per-
formed with ethanolamine, in order to exclude aptamers with an
affinity towards this molecule. This counter-SELEX was necessary,
due to the fact that ethanolamine was used for blocking of free
binding sites on the magnetic particles, during target bead produc-
tion. Usually ten to 20 selection rounds using the semi-automatic
just in time-Selection protocol are sufficient for identifying highly
affine aptamers.
Aptamer sequences and determined dissociation constants are
shown in Table 1. Two aptamers with a high affinity were obtained
by the selection. The alignment of sequences (see SM Fig. S2)
shows highly corresponding apatmer sequences gained for phy-
tosphingosine. The aptamers phyto-Apt-1 and phyto-Apt-2 exhibit
a percent identity of above 90%, excluding the primer binding sites.
All predicted secondary structures are shown in the Supplementary
material (Fig. S1). After sequence analysis the obtained aptamers
were characterized via fluorescence assay to gain further informa-
tion about their binding properties.

3.2. Characterization of selected aptamers via fluorescence assay

Obtained aptamer sequences were purchased from Thermo

Fisher Scientific Inc. (Darmstadt, Germany) and fluorescently mod-
ified as described before. The fluorescence assay provides several
advantages over other applications such as surface plasmon reso-
nance spectroscopy which are mostly performed in a flow system.
Furthermore, sample preparation for the fluorescence assay is easy
to perform and due to the fact that the targets are linked to magnetic
Fig. 1. Schematic presentation of used aptamer-based trapping technique. (A) Urine particles, this method uses identical conditions as used during the
solution for trapping including the target molecules, (B) Incubation with aptamer-
linked magnetic particles, (C) Magnetic separation of aptamer-linked magnetic
aptamer selection. Therefore, ideal interactions between aptamers
particles and bound target molecules, (D) Removing the supernatant; (E) Resus- and targets are theoretical enabled. The assay was first optimized
pension of aptamer-linked magnetic particles and bound target molecules in lower with regard to the fluorescence-labeled aptamer concentration to
volumes, (F) Removal of aptamer-linked magnetic particles by heat elution. gain ideal saturation curves, which are needed for determination
of dissociation constants. Fig. 2 shows an exemplary gained curve
source gas 2 = 50 psi; curtain gas = 20 psi; collision gas = 6 psi. Phy- after optimization for determination of dissociation constants for
tosphingosine was identified by chromatographic characteristics phyto-Apt-2.
(retention time = 7.3 min) and specific fragmentations using mass In the present work, dissociation constants for both generated
transitions between precursor and product ions. Analyst® Software aptamers were determined (see Table 1). As expected the con-
(AB Sciex, version 1.5.2, Foster City, CA, USA) was used to opti- stants are located in the low nanomolar range (from 17.4 nM up
mize data acquisition parameters for multiple reaction monitoring to 41.9 nM). A low dissociation constant implies a good interac-
(MRM) mode by automatically selecting the best compound- tion between ligand (here: aptamer) and substrate (here: target).
dependent device voltages and collision energies for each transition The results indicate that the aptamers exhibit a high affinity
(see SM Table S2). The quantitation of phytosphingosine was towards their selection targets (here: phytosphingosine). Thus is
achieved using calibration standards ranging from 0.02 ␮M to worth mentioning that the dissociation constants are compara-
2.5 ␮M dissolved in methanol with a resulting regression line of ble to respective published antibody binding parameters (Friguet
y = 1881263.8 × + 48348.3 (R2 = 0.99). et al., 1985; Sato et al., 1983). Comparing the binding parameters
of aptamers in this study with published aptamers towards small
3. Results and disscusion molecules, it figures out that the binding constants of aptamers in
the present study are at least equal or better. For instance, aptamers
3.1. Selection of aptamers towards phytosphingosine towards another sphingosine (sphingosyl-phosphocholine), which
is quite similar to phytosphingosine, exhibit disscoation constants
To identify aptamers with binding properties towards the small from 20 to 250 nM (McKeague and DeRosa, 2012). Due to the
molecular weight target phytosphingosine, a SELEX protocol was comparable binding properties of generated aptamers, the further
performed initially. Aptamers expressing high affinity towards the advantages of just in time-Selection move into focus. The just in
target molecules were selected within 15 rounds from a highly time–Selection enables a simultaneous aptamer selection for up
divers randomized oligonucleotide library. During the selection to 12 different targets in a short period of time (approx. 10 to 20
the non-binding aptamers were removed by consecutive wash- days). Due to the fact that FISHing is fully automated, the selection
ing steps. Afterwards, the affine aptamers were amplified by PCR method provides a higher reproducibility as a common selection

Table 1
Selected aptamer sequences towards phytosphingosine and fluorescence assay estimated dissociation constants (primer regions are marked in italics).

aptamer sequence (5 -3‘) KD [nM]

phyto-Apt-1 CATCCGTCACACCTGCTCCACCCGACACACCCATCCGTCACACCTGCTCCCCCCACTGGGTGTTCGGTCCCGTATC 17.4

phyto-Apt-2 CATCCGTCACACCTGCTCCACCCGTCACACTCATCCGGCACACCTGCTCTCCCCACTGGGTGTTCGGTCCCGTATC 41.9
 C. Fischer et al. / Journal of Biotechnology 238 (2016) 30–34 33

Fig. 3. Exemplary extracted ion chromatograms from LC-ESI–MS/MS measure-

ments of phytosphingosine (A) before trapping and (B) after trapping with
aptamer-linked magnetic particles in binding buffer.
Fig. 2. Exemplary fit of fluorescence signal for determination of dissociation con-
stant via fluorescence assay using phyto-Apt-2 (sigmoidal hill fitted using Origin Pro
9.0G).

protocol. Thus the selection of aptamers is also possible with less

expertise and time, with fewer material costs. Further advantages
of just in time–Selection compared to common pull down methods
are published in detail by Hünniger et al. (2014).

3.3. Magnetic trapping and enrichment of phytosphingosine

monitored via LC-ESI–MS/MS

To verify the suitability and specificity of the trapping method,

the success was proved by LC-ESI–MS/MS, which is known as a
highly selective quantitation method for metabolites (Piller et al.,
2014). A linear calibration was performed using phytosphingosine
dissolved in methanol in increasing concentrations from 0.02 ␮M
up to 2.5 ␮M. The resulting calibration curve is featured by its good
regression coefficient R2 = 0.99. Thus, the LC–MS/MS method was Fig. 4. Enrichment factors with error bars for trapping in (i) binding buffer, (ii) urine
1, (iii) urine 2, (iv) urine 3, and (v) urine 4.
chosen for quantitation of target metabolite concentration before
and after trapping. Trapping was performed as proof of concept
in both binding buffer and four different urine samples. To enable ment was performed in four different urine samples, to provide
the aptamer-based trapping in urine the samples were buffered a trapping technique which is useable under real conditions. To
using a 5-fold binding buffer, which was used (as 1-fold dilution) enable an ideal binding behavior of the aptamers in urine samples,
for aptamer selection. The resulting sample composition was 80% which is indispensable for a successful trapping, the urine samples
urine and 20% binding buffer. were buffered using a 5-fold selection buffer.
To prevent errors of measurement, samples without trapping The obtained enrichment factors differ from 2.3 ± 0.5 to 4.3 ± 0.6
and enrichment were additionally quantified in every measure- with a mean value of 3.4 ± 0.9 (see Fig. 4). Using Kolmogorov-
ment. The quantitation via LC-ESI–MS/MS determines an average Smirnov test of normality (␣= 0.001) all data were normal
concentration from 0.16 ± 0.01 ␮M for the sample without trap- distributed. Furthermore a two-sided t-test (␣= 0.001) proves that
ping. The samples after trapping procedure were quantified to the enrichment factors in all urine samples are not significantly dif-
determine the enrichment factors. Fig. 3 shows exemplary (A) the ferent. To gain further information about the used urine samples the
area peak before trapping and (B) after trapping in binding buffer. It pH value and the sodium concentration were determined. Although
can be already visually seen that the sample after trapping exhibits the pH values in buffered urine samples ranges from 5.4 to 6.4 and
a higher concentration leading to a larger area. The concentrations the sodium concentration ranges from 23.3 to 23.6 g/L, the enrich-
after trapping were mathematically determined using the linear ment was successful and there were no significant differences
regression. Afterwards, the quotient between samples with and between the obtained enrichment factors, leading to the conclu-
without trapping was formed to gain enrichment factors (EF) for sion that the trapping technique is applicable in different urine
every trapping. Trapping was performed multiple times to vali- samples. Considering the volume of a human urine sample (approx.
date the obtained factors. Overall enrichment factors are listed in 100 mL), it is conceivable to obtain much higher enrichment factors
Table 2. The maximal enrichment factor is mathematically limited by rising the initial volume used for trapping. Thus the imple-
to 10, because of volume reduction from 1000 ␮L to 100 ␮L during mentation of an adequate enrichment technique enables higher
trapping procedure. degree of sensitivity and therefore the analysis can be performed
As expected the highest enrichment factor (8.6 ± 0.1) was by less sophisticated methods like thin layer chromatography or
obtained after trapping in binding buffer. As the pH value and salt high performance liquid chromatography. This work demonstrates
concentration have an impact on the aptamer folding, they should as a proof of concept that aptamer-based trapping of metabolites
exhibit their highest affinity in their selection milieu. The enrich- such as biomarkers is feasible. The exhibited trapping procedure
34 C. Fischer et al. / Journal of Biotechnology 238 (2016) 30–34

Table 2
Enrichment factors for aptamer-based magnetic trapping of phytosphingosine in binding buffer and urine samples determined by LC-ESI–MS/MS measurements.

trapping measurement Area after trapping [counts] Determined concentration enrichment factor**
after trapping [␮M]*

binding buffer 2625000 1.37 8.6 ± 0.1

urine 1 727333 0.36 2.3 ± 0.5
urine 2 1227500 0.63 3.9 ± 0.8
urine 3 954333 0.48 3.0 ± 0.4
urine 4 1320000 0.68 4.3 ± 0.6
urine mean value 3.4 ± 0.9
*
concentration of samples before trapping was determined as 0.16 ␮M.
**
enrichment factor was determined mathematical to 10 (duo to the reduction of volume).

was adapted from previous research, which leads to the conclusion Ellington, A.D., Szostak, J.W., 1992. Selection in vitro of single-stranded DNA
that the trapping method is applicable, with slight changes, for a molecules that fold into specific ligand-binding structures. Nature 355,
850–852.
broad range of target molecules (Fischer et al., 2015). Fischer, C., Hünniger, T., Jarck, J.-H., Frohnmeyer, E., Kallinich, C., Haase, I., Hahn, U.,
Fischer, M., 2015. Food sensing: aptamer-based trapping of Bacillus cereus
spores with specific detection via real time PCR in milk. J. Agric. Food Chem. 63,
4. Conclusion 8050–8057.
Friguet, B., Chaffotte, A.F., Djavadi-Ohaniance, L., Goldberg, M.E., 1985.
We successfully demonstrate the selection of aptamers towards Measurements of the true affinity constant in solution of antigen-antibody
complexes by enzyme-linked immunosorbent assay. J. Immunol. Methods 77,
small molecules via just in time-Selection. During the subsequent 305–319.
characterization dissociation constants in the low nanomolar range Hünniger, T., Wessels, H., Fischer, C., Paschke-Kratzin, A., Fischer, M., 2014. Just in
were determined, which indicates the high affinity of generated time-Selection: a rapid semiautomated SELEX of DNA aptamers using magnetic
separation and BEAMing. Anal. Chem. 86, 10940–10947.
aptamers towards their target molecule. Additional the aptamers Hanzlick, R., Gowitt, G.T., 1991. Cocaine metabolite detection in homicide victims.
were used for a trapping application for phytosphingosine trapping JAMA 265, 760–761.
in both buffer and different urine real samples. Thereby enrich- Hünniger, T., Fischer, C., Wessels, H., Hoffmann, A., Paschke-Kratzin, A., Haase, I.,
Fischer, M., 2015. Food sensing: selection and characterization of DNA
ment factors up to 9-fold (mathematically limited to 10) could be aptamers to Alicyclobacillus spores for trapping and detection from orange
achieved. juice. J. Agric. Food Chem. 63, 2189–2197.
Regarding the potential of aptamers, due to their properties of Kim, K.S., Lee, H.-S., Yang, J.-A., Jo, M.-H., Hahn, S.K., 2009. The fabrication,
characterization and application of aptamer-functionalized Si-nanowire FET
selectivity, affinity and in vitro-manufacturing, the shown work-
biosensors. Nanotechnology 20, 235501.
flow is a very useful guide to implement aptamers for further issues Levy, M., Cater, S.F., Ellington, A.D., 2005. Quantum-dot aptamer beacons for the
and adapt several aptamer-based applications in a very short period detection of proteins. ChemBioChem 6, 2163–2166.
of time. Considering the directive 2010/63/EU on the protection of McCauley, T.G., Hamaguchi, N., Stanton, M., 2003. Aptamer-based biosensor arrays
for detection and quantification of biological macromolecules. Anal. Biochem.
animals used for scientific purposes, which entered into force 2013, 319, 244–250.
the inquiry of aptamers is continuously increasing. Even more easy McKeague, M., DeRosa, M.C., 2012. Challenges and opportunities for small
selection methods are of great significance enabling the selection of molecule aptamer development. J. Nucleic Acids 2012.
Ng, E.W., Adamis, A.P., 2006. Anti-VEGF aptamer (Pegaptanib) therapy for ocular
aptamers towards a wide range of target classes and valid aptamer- vascular diseases. Ann. N. Y. Acad. Sci. 1082, 151–171.
based applications, adaptable in less time. The present workflow is Peyret, 2000. Prediction of Nucleic Acid Hybridization: Parameters and
a first step to challenge the mentioned issues and to applications, Algorithmus PhD Dissertation.
Piller, M., Gilch, G., Scherer, G., Scherer, M., 2014. Simple, fast and sensitive
whose application potential is not exhausted yet. LC-MS/MS analysis for the simultaneous quantification of nicotine and 10 of its
major metabolites. J. Chromatogr. B 951, 7–15.
Roth, A., Breaker, R.R., 2009. The structural and functional diversity of
Acknowledgments metabolite-binding riboswitches. Annu. Rev. Biochem. 78, 305–334.
Sato, J., Kawamoto, T., Le, A., Mendelsohn, J., Polikoff, J., Sato, G., 1983. Biological
Prior fundamental research, which is implemented in the effects in vitro of monoclonal antibodies to human epidermal growth factor
receptors. Mol. Biol. Med. 1, 511–529.
present work, was supported by the German Ministry of Eco- Savla, R., Taratula, O., Garbuzenko, O., Minko, T., 2011. Tumor targeted quantum
nomics and Technology (via AiF) and the FEI (Forschungskreis der dot-mucin 1 aptamer-doxorubicin conjugate for imaging and treatment of
Ernährungsindustrie e. V., Bonn), Project AiF 17245N. cancer. J. Control. Release 153, 16–22.
Schütze, T., Rubelt, F., Repkow, J., Greiner, N., Erdmann, V.A., Lehrach, H., Konthur,
Z., Glökler, J., 2011. A streamlined protocol for emulsion polymerase chain
Appendix A. Supplementary data reaction and subsequent purification. Anal. Biochem. 410, 155–157.
Stoltenburg, R., Reinemann, C., Strehlitz, B., 2007. SELEX–a (r)evolutionary method
to generate high-affinity nucleic acid ligands. Biomol. Eng. 24, 381–403.
Supplementary data associated with this article can be found, in Tuerk, C., Gold, L., 1990. Systematic evolution of ligands by exponential
the online version, at http://dx.doi.org/10.1016/j.jbiotec.2016.09. enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249,
505–510.
005. Wink, M., 1999. Functions of plant secondary metabolites and their exploitation in
biotechnology. Taylor Francis.
Zhang, H., Zhang, D., Ray, K., Zhu, M., 2009. Mass defect filter technique and its
References applications to drug metabolite identification by high-resolution mass
spectrometry. J. Mass Spectrom. 44, 999–1016.
Blaas, N., Schüürmann, C., Bartke, N., Stahl, B., Humpf, H.-U., 2011. Structural Zhao, Y.-Y., Liu, J., Cheng, X.-L., Bai, X., Lin, R.-C., 2012. Urinary metabonomics study
profiling and quantification of sphingomyelin in human breast milk by on biochemical changes in an experimental model of chronic renal failure by
HPLC-MS/MS. J. Agric. Food Chem. 59, 6018–6024. adenine based on UPLC Q-TOF/MS. Clin. Chim. Acta 413, 642–649.
Chen, J., Zhou, L., Zhang, X., Lu, X., Cao, R., Xu, C., Xu, G., 2012. Urinary hydrophilic Zhao, Y.-Y., 2013. Metabolomics in chronic kidney disease. Clin. Chim. Acta 422,
and hydrophobic metabolic profiling based on liquid chromatography-mass 59–69.
spectrometry methods: differential metabolite discovery specific to ovarian Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization
cancer. Electrophoresis 33, 3361–3369. prediction. Nucleic Acids Res. 31, 3406–3415.
Chi, C.-W., Lao, Y.-H., Li, Y.-S., Chen, L.-C., 2011. A quantum dot-aptamer beacon
using a DNA intercalating dye as the FRET reporter: application to label-free
thrombin detection. Biosens. Bioelectron. 26, 3346–3352.
Ellington, A.D., Szostak, J.W., 1990. In vitro selection of RNA molecules that bind
specific ligands. Nature 346, 818–822.