0% found this document useful (0 votes)
85 views37 pages

10 1210@clinem@dgaa336 PDF

Download as pdf or txt
Download as pdf or txt
Download as pdf or txt
You are on page 1/ 37

VERY-LOW-CALORIE KETOGENIC DIETS WITH WHEY,

VEGETABLE OR ANIMAL PROTEIN IN PATIENTS WITH

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


OBESITY: A RANDOMIZED PILOT STUDY.

Sabrina Basciani1, Elisabetta Camajani1*, Savina Contini1*, Agnese Persichetti2*, Renata

t
Risi1, Loris Bertoldi3, Lidia Strigari4, Giancarlo Prossomariti1, Mikiko Watanabe1, Stefania

ip
Mariani1, Carla Lubrano1, Alfredo Genco5, Giovanni Spera1, Lucio Gnessi1.

cr
us
1
Department of Experimental Medicine, University of Rome “La Sapienza”, Rome, Italy

2
Service of Pharmacovigilance, IRCCS-Regina Elena National Cancer Institute, Rome, Italy
an
3
BMR Genomics s.r.l., Padova, Italy
M

4
Department of Medical Physics, Policlinico S. Orsola-Malpighi, Bologna, Italy

5
Department of Surgical Sciences, Surgical Endoscopy Unit, University of Rome “La
d

Sapienza”, Rome, Italy


e

*Authors contributed equally to this work


pt
ce

Corresponding author:

Lucio Gnessi, MD, PhD


Ac

Department of Experimental Medicine

University of Rome “La Sapienza”,

Rome, Italy

e-mail: [email protected]

phone: 0039.06.49970721

fax: 0039.06.4461450

© Endocrine Society 2020. All rights reserved. For permissions, please e-mail:
[email protected] jc.2020-00128 See endocrine.org/publications for Accepted
Manuscript disclaimer and additional information.
Financial support. Financial support as well as meal replacement protein preparations were
kindly provided by New Penta s.r.l. (Cuneo, Italy). The funding source had no involvement in
the study design, recruitment of patients, study interventions, data collection, or
interpretation of the results.

Disclosure Summary. The authors declare no conflicts of interest.

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


Trial Registration: This study was registered under ClinicalTrials.gov NCT04019431

t
ip
cr
us
an
M
e d
pt
ce
Ac
Abstract

Context

We compared the efficacy, safety and effect of 45-day isocaloric very-low-calorie ketogenic

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


diets (VLCKDs) incorporating whey, vegetable or animal protein on the microbiota in patients

with obesity and insulin resistance to test the hypothesis that protein source may modulate

the response to VLCKD interventions.

Subjects and Methods

t
Forty-eight patients with obesity [19 males and 29 females, HOMA index ≥ 2.5, age 56.2±6.1

ip
years, body mass index (BMI) 35.9±4.1 kg/m2] were randomly assigned to three 45-day

cr
isocaloric VLCKD regimens (≤800 kcal/day) containing whey, plant or animal protein.

us
Anthropometric indexes; blood and urine chemistry, including parameters of kidney, liver,

glucose and lipid metabolism; body composition; muscle strength; and taxonomic
an
composition of the gut microbiome were assessed. Adverse events were also recorded.

Results
M

Body weight, BMI, blood pressure, waist circumference, HOMA index, insulin, and total and

LDL cholesterol decreased in all patients. Patients who consumed whey protein had a more
d

pronounced improvement in muscle strength. The markers of renal function worsened


e
pt

slightly in the animal protein group. A decrease in the relative abundance of Firmicutes and

an increase in Bacteroidetes were observed after the consumption of VLCKDs. This pattern
ce

was less pronounced in patients consuming animal protein.

Conclusions
Ac

VLCKDs led to significant weight loss and a striking improvement in metabolic parameters

over a 45-day period. VLCKDs based on whey or vegetable protein have a safer profile and

result in a healthier microbiota composition than those containing animal proteins. VLCKDs

incorporating whey protein are more effective in maintaining muscle performance.

Key words: Very low calorie ketogenic diet, VLCKD, obesity, whey proteins, vegetable proteins,
animal proteins, intestinal microbiota, therapy
1. Introduction

Obesity is strongly related to comorbidities, such as type 2 diabetes, inflammation, excess

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


fat within the liver and pancreas, hypertension, and certain types of cancer (1, 2). Obesity

management can delay the progression from prediabetes to type 2 diabetes (T2DM) and

result in sustained remission of T2DM (3).

t
For many individuals with obesity and prediabetes, weight loss produces beneficial

ip
outcomes in regard to glycemic control, lipids, and blood pressure, and more intensive

cr
weight loss maximizes these benefits (3, 4). Despite the agreement on the important role of

us
diet in treating insulin resistance and T2DM, there is little consensus about the optimal diet

and ideal dietary macronutrient ratio (5). Weight loss and improvement in glucose
an
homeostasis, including diabetes remission, were seen both after the consumption of a low-

energy diet (825–853 kcal/day) with a carbohydrate content that exceeded 50% of total
M

calories (3) and after the consumption of very low-calorie diets (VLCDs) (≤800 kcal/day)

containing less than 30% carbohydrates/day (6). Recently, very-low-calorie ketogenic diets
d

(VLCKDs) with <50 g of carbohydrates/day were found to be associated with greater weight
e

loss along with amelioration of glycemic control in subjects with T2DM compared with the
pt

effects of a standard care nutritional intervention (7-11). In patients with obesity who did not
ce

have diabetes, the effects of VLCKDs were found to be powerful in reducing plasma insulin

levels (5). Furthermore, the source of dietary protein while following an energy-restricted diet
Ac

was associated with benefits in body weight (BW) maintenance, blood pressure, insulin and

homeostasis model assessment of insulin resistance (HOMA-IR) (12). Epidemiological

studies indicate that diets containing whey proteins and vegetable proteins protect against

obesity, whereas diets characterized by increased meat consumption are associated with

greater weight gain (13). The mechanisms underlying these effects are not known.

Interactions with the intestinal microbiota (14), appetite regulation (15, 16), effects on insulin

and incretin secretion (17-20), and palatability (19, 21) have been suggested as contributing
factors that deserve in-depth analysis (22). We conducted a prospective pilot study

comparing the efficacy and safety of VLCKDs incorporating either whey, plant or animal

protein on metabolic and body composition parameters and on the composition of the gut

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


microbiota in a population of patients with obesity and insulin resistance.

2 MATERIALS AND METHODS

2.1 Study design and participants

t
ip
This was a prospective, open, nutritional intervention pilot study that enrolled patients with

cr
obesity and pharmacologically naïve insulin resistance among those attending the Center for

us
the Study of Eating Disorders and Obesity, Department of Experimental Medicine, Section of

Medical Pathophysiology, Food Science and Endocrinology of the University of Rome “La
an
Sapienza”, Italy. We compared VLCKDs based on whey protein [(16 patients, whey protein

group (WPG)], vegetable protein [(16 patients, vegetable protein group (VPG)] or animal
M

protein [(16 patients, animal protein group (APG)]. Eligible patients were randomly assigned

(in a 1:1:1 ratio) through automated allocation. The primary outcome measure was change in
d

BMI. Key secondary outcomes were changes in lipids, glucose, insulin resistance as
e

estimated by HOMA-IR, IGF-1, body composition, muscle strength and composition of the
pt

gut microbiota. Male and postmenopausal female outpatients were eligible. The inclusion
ce

criteria were as follows: stable BW in the previous 3 months, age between 50 and 70 years,

BMI between 30 and 40 kg/m2, and HOMA-IR ≥ 2.5. The exclusion criteria were the following
Ac

conditions either self-reported or derived from medical records or examination:

hypersensitivity to components used in the protocol products; renal, cardiac, cerebrovascular

or gastrointestinal diseases; psychiatric disturbances; hydroelectrolytic alterations; type 1

diabetes; lack of informed consent; and bariatric surgery. Adverse events (AEs) were

monitored throughout the treatment. This trial was registered at clinicaltrials.gov

(NCT04019431).
2.2 Dietary interventions

All patients followed a VLCKD [780 kcal/day, with the following composition in

macronutrients, percentage of caloric intake and g/kg of ideal BW of proteins (derived by the

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


BMI set at 25 kg/m2): carbohydrates 26 g (13.5%), olive oil 20 g plus 15 g of lipids from other

sources (40.4%), protein 90 g (46.1%, 1.2 -1.4 g/kg)] for 45 days. The amount of protein was

within the proposed essential composition of total diet replacements for weight control and

was adjusted for the patients with overweight or obesity (23). WPG and VPG patients were

t
ip
given five meals/day [timing was at main meals (8 a.m., 1.00 p.m. and 8.00 pm), mid-

morning and mid-afternoon] containing whey protein (WPG) or vegetable protein derived

cr
from soya, green peas or cereals and one serving of vegetables with a low glycemic index at

us
lunch and dinner (VPG). Patients in the APG were given five meals/day containing natural

animal protein (meat, fish, eggs). Supplements containing vitamins, minerals and omega-3
an
fatty acids were provided in accordance with international recommendations (EFSA 2017,

https://doi.org/10.2903/sp.efsa.2017.e15121). The diets were prepared by New Penta s.r.l.


M

(Cuneo, Italy) following the indications of nutritionists and were delivered in preassembled
d

boxes.
e

Participants received counseling by physicians and nutrition experts at baseline (T0)


pt

and every two weeks up to day 45 (T45); dietary compliance was also assessed.
ce

Participants were encouraged to exercise for 30 minutes at least 3 times weekly, but

no formal exercise program or incentives were provided.


Ac

2.3 Anthropometric assessment

BW, height, systolic and diastolic blood pressure (BP), waist circumference (WC),

thigh circumference (TC) and hip circumference (HC) were measured at T0 and

every two weeks. Anthropometric measurements were recorded after an overnight

fast under resting conditions using calibrated equipment. BW was measured using a

balance-beam scale (Seca GmbH & Co). Systolic and diastolic blood pressure were
measured using a mercury-gravity manometer. Height was rounded to the closest

0.5 cm. BMI was calculated as weight divided by squared height in meters (kg/m2).

WC was measured midway between the costal arch and the iliac crest, HC was

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


measured at the symphysis-greater trochanter level to the closest 1.0 cm, and TC

was measured directly below the gluteal fold of the right thigh.

2.4 Blood and urine chemistry

Blood count (ADVIA 2120i Hematology System, Siemens Healthcare s.r.l., Italy),

t
ip
electrolytes [chloride, potassium and sodium (indirect ion-selective electrode

cr
potentiometry), calcium and magnesium (colorimetric assay)], glucose (enzymatic

colorimetric assay), insulin (electrochemiluminescence immunoassay), lipids

us
[(triglycerides, total, HDL and LDL cholesterol) (enzymatic colorimetric assay)], total
an
protein and albumin (capillary system), C-reactive protein (CRP)

(immunoturbidimetric assay), erythrocyte sedimentation rate (ESR) (capillary


M

photometric assay), plasma creatinine (kinetic colorimetric compensated aff

method), blood urea nitrogen (BUN), uric acid, alanine transferase (ALT) and
e d

aspartate transaminase (AST) (enzymatic colorimetric assay), and estimated


pt

glomerular filtration rate (eGFR) were determined at baseline and T45. All analyses

were performed on a COBAS 6000 (Roche Diagnostics, Risch-Rotkreuz,


ce

Switzerland) and on CapillarysR Systems (Sebia, Evry, France).


Ac

The hepatic steatosis index (HSI), a noninvasive screening tool for hepatic steatosis,

was calculated according to Lee et al. (24). IGF-1 plasma levels were measured

after an overnight fast using commercial ELISA assay kits (R&D Systems, Inc.,

Minneapolis, MN, USA). Insulin resistance was determined using HOMA-IR (25).

The semiquantitative concentration of acetoacetic acid was measured in the first


morning urine at baseline and every week until the end of the study by the patients

(Ketur-Test, Accu-Chek, Roche Diagnostics, Italy).

2.5 Dual-energy X-ray absorptiometry measurement (DEXA)

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


Body composition, total and regional body fat mass and fat-free mass were

measured by DEXA (Hologic 4500, Bedford, MA, USA) at baseline and at the end of

the trial. Trunk fat was defined as the adipose tissue localized within the region

below the chin, delineated by vertical lines within the left and right glenoid fossae

t
ip
bordering laterally to the ribs and by the oblique lines that cross the femoral necks

cr
and converge below the pubic symphysis.

2.6 Muscular strength

us
Handgrip strength (HG) was measured with a digital dynamometer (DynEx, Akern,
an
Pontassieve, FI, Italy) at T0 and T45 with the patients seated, shoulder adducted

and forearms resting flat on the chair arms. Before starting, patients were asked to
M

squeeze the dynamometer as hard as possible for at least 3 seconds. Three

measurements were repeated with both the dominant and nondominant arms. The
e d

highest value measured was recorded.


pt

2.7 Taxonomic composition of the gut microbiome

Fecal sampling was performed using a sterile swab (FLmedical, Italy) and tubes
ce

(Starlab Group, Italy) in the morning of the day of initiating the VLCKD and at T45;
Ac

the samples were put on ice immediately after collection, brought to the hospital

within 2 h, and stored at −80 °C. The samples were transferred to the laboratory on

dry ice within 24 h of collection and stored at −80 °C until DNA extraction. DNA was

extracted using the Cador Pathogen 96 QIAcube HT Kit (Qiagen srl, Italy) with lysis

step modification according to the Mobio PowerFecal kit (Qiagen). The V3-V4

regions of the 16S ribosomal RNA gene were amplified using the Illumina tailed
primers Pro341F (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-

CCTACGGG AGGCAGCA-3′) and Pro805R (5′-

GTCTCGTGGGCTCGGAGATGTGTATAAGAGA CAG-

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


GACTACNVGGGTATCTAATCC-3′) using Platinum Taq (Thermo Fisher Scientific

Inc, USA) to conduct PCR (94 °C for 2 min, followed by 25 cycles at 94 °C for 30 s,

55 °C for 30 s, and 68 °C for 30 s, and a final extension at 68 °C for 7 min). PCR

amplicons were purified with Agencourt AMPure XP Beads 0.8X (Beckman Coulter,

t
ip
Inc., CA, USA) and amplified following the Nextera XT Index protocol (Illumina, Inc.,

cr
CA, USA). The purified amplicons were normalized by SequalPrep™ Normalization

Plate Kit (Thermo Fisher Scientific Inc.) and multiplexed. The pool was purified with

us
1X Magnetic Beads Agencourt XP (Beckman Coulter, Inc.) loaded on the MiSeq
an
System (Illumina, Inc.) and sequenced following the V3 - 300PE strategy. The

bioinformatic analysis was performed by Qiime2 (26). Raw reads were first trimmed
M

by applying Cutadapt to remove residual primer sequences and then processed with

DADA2 plug-in to perform the denoising step (27, 28). DADA2 was run with default
e d

parameters except for the truncation length: forward and reverse reads were
pt

truncated at 270 and 260 nucleotides, respectively. The resulting amplicon sequence

variant (ASV) sequences were filtered out by applying a 0.005% frequency threshold
ce

to discard singletons and very rare sequences. Greengeens v.13-8 and Silva v.132
Ac

databases were used to associate the taxonomy to the remaining ASVs.

2.8 Questionnaires

Adherence to the dietary interventions was evaluated through a daily food diary. Safety was

monitored throughout the trial based on the reported AEs either collected spontaneously or

actively assessed by the investigators. Quality of life was assessed through the SF-36

questionnaire every two weeks. Vivacity, agitation, sadness, calmness, energy,

discouragement, happiness, and satiety were evaluated using a 5-point scale.


2.9 Data management and statistical methods

Data are expressed as the mean values ± SDs or percentages where appropriate.

Comparisons between groups were evaluated using Student’s t test. Differences between

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


groups were tested by ANOVA, and for differences 0-45, an ANCOVA model was used

when a significant group effect was observed. A Tukey post hoc test was used for multiple-

comparison purposes in the case of F significant values. The number of subjects was

identified considering the number of subjects generally included in similar published pilot

t
studies (29-32). Assuming a power of 0.80 and alpha of 0.05, 48 participants (total sample

ip
size, 16 participants in each of 3 groups) were considered appropriate to highlight an effect

cr
size of 0.46 (high). Differences were considered statistically significant when P was ≤0.05.

us
Since this was a pilot study, we also reported values with P<0.1 as "trending towards

significance". Statistical analysis was carried out using R-package version 3.6.3.
an
2.10 Ethical aspects
M

The study protocol was approved by the Ethics Committee of the University of Rome “La

Sapienza” (code 3920) and was conducted in accordance with the Declaration of Helsinki
d

and Good Clinical Practice. All patients were informed about the possible risks and benefits
e

of the proposed interventions and provided written consent.


pt
ce

3 RESULTS
Ac

We screened 350 patients with obesity for eligibility from January 2019 to June 2019. We

enrolled and randomized 48 participants. Sixteen patients were allocated to the VLCKD with

whey protein group (WPG), 16 to the VLCKD with vegetable protein group (VPG), and 16 to

the VLCKD with animal protein group (APG) (Fig. 1). All the participants were followed up to

the completion of the study. The baseline characteristics of the patients were similar

between groups and are summarized in table 1. Compliance was comparable in all groups.
Urine acetoacetic acid, reflecting ketosis, increased significantly from baseline to the end of

the VLCKD interventions (table 1), and a plateau value was reached after 7 days in all

groups (data not shown).

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


We recorded a significant reduction in initial BW both in the WPG and the VPG at T45. A

reduction in BW was also observed in the APG (-6.4±2.4 kg compared to baseline, range -

2.0/-11.1 kg, average percent BW loss -6.5%), although it did not reach statistical

significance. BMI followed the same pattern, with the exception that the improvement in BMI

t
ip
was statistically significant in the APG as well. Significant reductions in WC and systolic and

diastolic blood pressure were recorded in all groups. HC and TC reductions were observed

cr
in all groups and reached significance in the VPG and the APG and the WPG and the VPG,

respectively.

us
an
A significant reduction in fasting glycemia, fasting insulin and HOMA-IR was observed in all

groups, with the exception of fasting glycemia in the VPG. Circulating IGF-1 levels increased
M

in the WPG and decreased in the VPG. The increase in IGF-1 seen in the APG was not

statistically significant.
d

A decreasing trend in total fat and trunk fat mass was consistently recorded, although the
e

significance was seen only for trunk fat mass in the WPG and the VPG. A relative increase
pt

in the percentage of lean mass was also seen consistently. Electrolytes (data not shown)
ce

and liver function tests did not change during the study within groups. Small, nonsignificant

variations in plasma creatinine values were observed in all groups. Of note, in the APG,
Ac

blood urea nitrogen and uric acid increased while eGFR decreased significantly compared

with baseline. Urinary pH values varied within the normal reference intervals (data not

shown). At the baseline visit, no ketosis was recorded. The mean values of urinary

acetoacetic acid increased from T0 to T45 in all groups (table 1).

The HSI was slightly reduced at T45; however, the difference was significant only for VPG.

All groups experienced a profound reduction in total cholesterol, LDL cholesterol and
triglycerides. Despite a strong improvement in the inflammatory markers ESR and CRP,

changes in these measures did not show statistical significance. HG did not change during

the observation period in any of the groups.

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


The P values of multiple comparisons of delta percent variations in the measured

parameters between groups that were statistically significant are shown in table 2. No

differences were seen for the majority of parameters, with the exception of IGF-1, creatinine,

eGFR, blood urea, uric acid and HG, whose variations differed between groups. Figure 2

t
ip
shows the box plot of the within-group percent change values from baseline. Although the

variations remained within the normal range, the group of patients who consumed a VLCKD

cr
containing animal protein (APG) showed an increase in creatinine levels and a significant

us
reduction in eGFR compared to the same parameters of the other two treatment groups. The

delta percent increase in BUN was more pronounced in the WPG and the APG, while uric
an
acid increased more in the VPG. HG was maintained to a greater extent in the WPG than in

the VPG. The delta percent increase in IGF-1 values was more pronounced in the WPG and
M

the APG than in the VPG.


d

The dominant phyla in the fecal samples of the patients at T0 were Firmicutes,
e

Bacteroidetes, Proteobacteria, Verrucomicrobia, Fusobacteria, and Actinobacteria (Fig. 3A).


pt

The relative abundance of Firmicutes was significantly diminished, and that of Bacteroidetes
ce

increased proportionally 45 days after the initiation of the VLCKDs (Fig. 3B). The mean

relative abundance of Proteobacteria also increased, while that of Actinobacteria decreased


Ac

(data not shown). The abundance of the two predominant bacterial divisions (Firmicutes and

Bacteroidetes) was almost superimposable in the three dietary intervention groups of

patients at baseline, with no differences according to multiple comparison (Fig. 4). Over time,

the relative abundance of Bacteroidetes increased, and the abundance of Firmicutes

significantly decreased, irrespective of diet type, with the only exception in the VPG, in which

the increase in Bacteroidetes did not reach statistical significance (Fig. 4). To verify whether

the different protein sources in the VLCKDs could influence the variation in the abundance of
Firmicutes and Bacteroidetes, a two-way ANOVA test was performed. The increase in

Bacteroidetes and the decrease in Firmicutes were influenced by the protein composition of

the diets. In particular, whey protein and vegetable protein were more potent in reducing the

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


percentage of Firmicutes than the dietary intervention incorporating animal protein.

Regarding the Bacteroidetes gut microbiota content, a significant difference was only

observed between the individuals exposed to the diets incorporating whey protein and

vegetable protein, with the VLCKD containing whey protein exhibiting a more potent ability to

t
increase the percentage of total sequences of Bacteroidetes.

ip
The AEs were mild; in fact, none of the patients dropped out of the study, and the

cr
differences between the diet interventions were negligible (table 3 shows the most frequent

us
side effects and the number of participants reporting them). During ketosis, the intragroup

variation as well as the intergroup variation in the quality of life scores did not change (data
an
not shown).
M
d

4 DISCUSSION
e

Our data show that a 45-day-long VLCKD causes a profound reduction in BW and improves
pt

glycemic control, lipid metabolism and arterial pressure in patients with obesity and insulin
ce

resistance. The VLCKD is safe and well tolerated; the gut microbiota composition is

influenced by the VLCKD, and the source of dietary protein modulates the variation in the
Ac

gut microbiota caused by the VLCKD. Whey protein intake contributes more substantially to

the preservation of muscle performance.

These results provide important implications. First, VLCKDs may hold promise as a strategy

to simultaneously improve glycemic control while facilitating profound weight loss in patients

with insulin resistance. All individuals who consumed VLCKDs showed a decrease in fasting

plasma glucose, insulin and HOMA-IR. Of note, no episodes of hypoglycemia were


observed. Numerous studies on VLCKDs have shown diabetes improvement and remission

(8, 9, 11, 33). Here, we show that this pattern applies to individuals with insulin resistance as

well. We hypothesize that the improvement in carbohydrate metabolism might correlate with

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


both weight loss and low sugar content, although additional mechanisms cannot be excluded

(34). The short duration of our intervention prevents the assessment of the durability of the

effect.

An important concern with low carbohydrate diets is the potential negative impact on lipid

t
ip
metabolism due to the increased proportion of calories coming from fat. Clearly, this does

not apply to a 45-day VLCKD, for which the daily lipid intake is still low, as can be inferred by

cr
the profound reduction in the circulating cholesterol and triglyceride levels measured in our

us
patients. Many other mechanisms may contribute to the reduction in circulating lipids, such

as the improvement in insulin resistance with positive effects on lipid metabolism through the
an
action on HMG-CoA reductase and striking effects on lipoprotein size and subclass particle

concentrations (35). Moreover, it has been reported that even high-fat ketogenic diets are
M

capable of ameliorating nonalcoholic fatty liver disease through de novo lipogenesis


d

inhibition and fatty acid oxidation induction, leading to weight loss and reduced hepatic fat
e

content. It is therefore unsurprising that serum triglycerides, well-established markers of liver


pt

fat, are almost invariably reduced upon the adoption of any kind of ketogenic diet (36).
ce

Many studies have shown that dietary protein content may play a role in weight management

(37-39). Much less is known about the importance of the sources from which these proteins
Ac

are derived (40). In the face of significant variations in the anthropometric measures

between T0 and T45 within each group, the intake of different kinds of protein was not

associated with meaningful changes in BW, WC, BMI or the remaining anthropometric

parameters among groups. Some differences that might have clinical significance reflect the

proportion of lean and fat mass in different body regions. The loss of trunk fat mass was less

pronounced in the group of patients who consumed animal protein. However, the between-

group comparison of trunk fat content did not reveal a significant difference.
Analogous to a previous report (32), crude HG did not vary significantly during our dietary

intervention. This is notable due to the well-known cardiovascular advantages of maintaining

muscle strength (41-42). Interestingly, the individuals fed whey protein preserved their HG

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


strength to a greater extent than in the vegetable protein-fed group. Whether this is due to

the higher relative increase in IGF-1 levels associated with whey protein consumption is

unclear. Our data are in line with the reported association between protein intake, largely

attributable to milk intake, and circulating IGF-1 levels, an association that has been related

t
to muscle strength (43-44). Our evidence is purely associative, and many other

ip
mechanisms, including neural mechanisms, learning effects, and improvement in the actin-

cr
myosin machinery, among others, may explain this finding. Furthermore, our measurements,

us
although accurately conducted, suffer from the variation in current methods of assessing grip

strength (45); thus, an analysis of a larger sample is warranted.


an
The intestinal microbiota is relatively stable throughout adult life (46-48). Each individual has

his or her own unique microbial community whose profile is stable over time. However, much
M

is still unknown regarding how stable the microbiota is to perturbations, such as those arising
d

from antibiotics, diet and the immune system. KDs influence the taxonomic and functional
e

composition of the gut microbiota with mixed contradictory results (49). We observed a
pt

pattern in the variation in the microbiota that resembled that in children affected by refractory

epilepsy treated with KDs, with increased amounts of Bacteroides and decreased amounts
ce

in Firmicutes (50,51). Moreover, we found divergent responses to VLCKDs containing

protein from different sources with substantial effects on the Firmicutes-to-Bacteroidetes


Ac

ratio. Recent evidence suggests that the quality of dietary protein may impact the gut

environment, shaping the microbiota and the host-microbe (co)metabolic pathways and

products and linking protein-dependent changes in the obese gut microbiota (52, 53). The

gut microbiota composition in mice (54), rats (55), and piglets (56) revealed divergent

responses to diets containing protein from different sources. Although the prospect of health-

interpretable microbiota data is exciting (57,58), and despite a decade of research


establishing a strong association between the gut microbiota and various diseases, including

obesity and diabetes, in humans a causal relationship and the underlying mechanism remain

unknown (59-61). The strongest effect of the VLCKD containing whey protein in reducing

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


Firmicutes and increasing Bacteroidetes compared with the vegetable- and animal-

containing VLCKDs observed here warrants further investigation.

The profound metabolic effects associated with VLCKDs were observed in the absence of

serious AEs that were previously associated with VLCKD interventions (8,49,62,63). Quality

t
ip
of life score variations were negligible.

cr
Regarding the potential issues of our pilot study, the number of subjects enrolled was small,

although sufficient, to appreciate the variations induced by VLCKDs. The short duration is a

us
further limitation together with the lack of follow-up. Moreover, the measurement of capillary
an
blood concentration of beta hydroxybutyrate would have been a more accurate method of

ketosis assessment than the urinary acetoacetate semiquantitative determination used in


M

this study for technical reasons. However, the fundamental objectives that our study had set

were achieved, and the additional information obtained will certainly lead to further
d

investigation.
e

In summary, these data show that a 45-day-long VLCKD is safe and quickly reduces weight
pt

and fasting glycemia in patients with obesity and insulin resistance. The investigated protein
ce

sources did not differentially impact anthropometric or metabolic parameters under the acute

conditions of the intervention in our experimental design. However, whey proteins and
Ac

vegetable proteins showed a safer profile and directed the intestinal microbiota towards a

healthier composition.
ACKNOWLEDGMENTS

The authors would like to thank Dr Settimia Di Bernardo and Dr Maria Faro for their

contribution in the management of the patients.

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


DATA AVAILABILITY

The datasets generated and/or analyzed during the current study are not publicly available

but are available from the corresponding author on reasonable request.

t
ip
AUTHOR CONTRIBUTIONS

cr
The author contributions to the paper were as follows. Study concept: SB and GS; design:

us
S.B., G.S., and L.G.; acquisition of data: SB, SC, AP, EC, LB, RR, GP, and MW;

interpretation of the data: SM, CL, AG, MW, and LS; analysis: LS, LB, and AP; writing of the
an
manuscript: SB, EC, AP, and LG; all authors approved the final version of the manuscript.
M
e d
pt
ce
Ac
REFERENCES

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


1. GBD 2015 Obesity Collaborators, Afshin A, Forouzanfar MH, Reitsma MB, Sur P, Estep

K, Lee A, Marczak L, Mokdad AH, Moradi-Lakeh M, Naghavi M, Salama JS, Vos T, Abate

KH, Abbafati C, Ahmed MB, Al-Aly Z, Alkerwi A, Al-Raddadi R, Amare AT, Amberbir A,

Amegah AK, Amini E, Amrock SM, Anjana RM, Ärnlöv J, Asayesh H, Banerjee A, Barac A,

t
Baye E, Bennett DA, Beyene AS, Biadgilign S, Biryukov S, Bjertness E, Boneya DJ,

ip
Campos-Nonato I, Carrero JJ, Cecilio P, Cercy K, Ciobanu LG, Cornaby L, Damtew SA,

cr
Dandona L, Dandona R, Dharmaratne SD, Duncan BB, Eshrati B, Esteghamati A, Feigin VL,

Fernandes JC, Fürst T, Gebrehiwot TT, Gold A, Gona PN, Goto A, Habtewold TD, Hadush

us
KT, Hafezi-Nejad N, Hay SI, Horino M, Islami F, Kamal R, Kasaeian A, Katikireddi SV,
an
Kengne AP, Kesavachandran CN, Khader YS, Khang YH, Khubchandani J, Kim D, Kim YJ,

Kinfu Y, Kosen S, Ku T, Defo BK, Kumar GA, Larson HJ, Leinsalu M, Liang X, Lim SS, Liu
M

P, Lopez AD, Lozano R, Majeed A, Malekzadeh R, Malta DC, Mazidi M, McAlinden C,

McGarvey ST, Mengistu DT, Mensah GA, Mensink GBM, Mezgebe HB, Mirrakhimov EM,
d

Mueller UO, Noubiap JJ, Obermeyer CM, Ogbo FA, Owolabi MO, Patton GC, Pourmalek F,
e

Qorbani M, Rafay A, Rai RK, Ranabhat CL, Reinig N, Safiri S, Salomon JA, Sanabria JR,
pt

Santos IS, Sartorius B, Sawhney M, Schmidhuber J, Schutte AE, Schmidt MI, Sepanlou SG,
ce

Shamsizadeh M, Sheikhbahaei S, Shin MJ, Shiri R, Shiue I, Roba HS, Silva DAS, Silverberg

JI, Singh JA, Stranges S, Swaminathan S, Tabarés-Seisdedos R, Tadese F, Tedla BA,


Ac

Tegegne BS, Terkawi AS, Thakur JS, Tonelli M, Topor-Madry R, Tyrovolas S, Ukwaja KN,

Uthman OA, Vaezghasemi M, Vasankari T, Vlassov VV, Vollset SE, Weiderpass E,

Werdecker A, Wesana J, Westerman R, Yano Y, Yonemoto N, Yonga G, Zaidi Z, Zenebe

ZM, Zipkin B, Murray CJL. Health Effects of Overweight and Obesity in 195 Countries over

25 Years. N Engl J Med. 2017;377:13-27.


2. Apovian CM. Obesity: definition, comorbidities, causes, and burden. Am J Manag Care.

2016;22:s176-185.

3. Lean ME, Leslie WS, Barnes AC, Brosnahan N, Thom G, McCombie L, Peters C,

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


Zhyzhneuskaya S, Al-Mrabeh A, Hollingsworth KG, Rodrigues AM, Rehackova L, Adamson

AJ, Sniehotta FF, Mathers JC, Ross HM, McIlvenna Y, Stefanetti R, Trenell M, Welsh P,

Kean S, Ford I, McConnachie A, Sattar N, Taylor R. Primary care-led weight management

for remission of type 2 diabetes (DiRECT): an open-label, cluster-randomised trial. Lancet.

t
ip
2018;391:541-551.

cr
4. Norris SL, Zhang X, Avenell A, Gregg E, Bowman B, Schmid CH, Lau J. Long-term

effectiveness of weight-loss interventions in adults with pre-diabetes: a review. Am J Prev

Med. 2005;28:126-139.
us
an
5. Caprio M, Infante M, Moriconi E, Armani A, Fabbri A, Mantovani G, Mariani S, Lubrano C,

Poggiogalle E, Migliaccio S, Donini LM, Basciani S, Cignarelli A, Conte E, Ceccarini G,


M

Bogazzi F, Cimino L, Condorelli RA, La Vignera S, Calogero AE, Gambineri A, Vignozzi L,

Prodam F, Aimaretti G, Linsalata G, Buralli S, Monzani F, Aversa A, Vettor R, Santini F, Vitti


d

P, Gnessi L, Pagotto U, Giorgino F, Colao A, Lenzi A; Cardiovascular Endocrinology Club of


e

the Italian Society of Endocrinology. Very-low-calorie ketogenic diet (VLCKD) in the


pt

management of metabolic diseases: systematic review and consensus statement from the
ce

Italian Society of Endocrinology (SIE). J Endocrinol Invest. 2019;42:1365-1386.


Ac

6. Feinman RD, Pogozelski WK, Astrup A, Bernstein RK, Fine EJ, Westman EC, Accurso A,

Frassetto L, Gower BA, McFarlane SI, Nielsen JV, Krarup T, Saslow L, Roth KS, Vernon

MC, Volek JS, Wilshire GB, Dahlqvist A, Sundberg R, Childers A, Morrison K, Manninen AH,

Dashti HM, Wood RJ, Wortman J, Worm N. Dietary carbohydrate restriction as the first

approach in diabetes management: critical review and evidence base. Nutrition. 2015;31:1-

13.
7. Willi SM, Martin K, Datko FM, Brant BP. Treatment of type 2 diabetes in childhood using a

very-low-calorie diet. Diabetes Care 2004;27:348-353.

8. Goday A, Bellido D, Sajoux I, Crujeiras AB, Burguera B, García-Luna PP, Oleaga A,

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


Moreno B, Casanueva FF. Short-term safety, tolerability and efficacy of a very low-calorie-

ketogenic diet interventional weight loss program versus hypocaloric diet in patients with

type 2 diabetes mellitus. Nutr Diabetes 2016;6:e230.

t
9. Hussain TA, Mathew TC, Dashti AA, Asfar S, Al-Zaid N, Dashti HM. Effect of low-calorie

ip
versus low-carbohydrate ketogenic diet in type 2 diabetes. Nutrition 2012;28:1016-1021.

cr
10. Westman EC, Yancy WS Jr, Mavropoulos JC, Marquart M, McDuffie JR. The effect of a

us
low-carbohydrate, ketogenic diet versus a low-glycemic index diet on glycemic control in

type 2 diabetes mellitus. Nutr Metab (Lond) 2008;5:36.


an
11. Romano L, Marchetti M, Gualtieri P, Di Renzo L, Belcastro M, De Santis GL, Perrone
M

MA, De Lorenzo A. Effects of a Personalized VLCKD on Body Composition and Resting

Energy Expenditure in the Reversal of Diabetes to Prevent Complications. Nutrients


d

2019;11: E1526.
e

12. van Baak MA, Larsen TM, Jebb SA, Martinez A, Saris WHM, Handjieva-Darlenska T,
pt

Kafatos A, Pfeiffer AFH, Kunešová M, Astrup A. Dietary intake of protein from different
ce

sources and weight regain, changes in body composition and cardiometabolic risk factors

after weight loss: the DIOGenes study. Nutrients 2017;9: E1326.


Ac

13. Mozaffarian D. Dietary and Policy Priorities for Cardiovascular Disease, Diabetes, and

Obesity: A Comprehensive Review. Circulation 2016;133:187-225.

14. David LA, Maurice CF, Carmody RN, Gootenberg DB, Button JE, Wolfe BE, Ling

AV,Devlin AS, Varma Y, Fischbach MA, Biddinger SB, Dutton RJ, Turnbaugh PJ. Diet

rapidly and reproducibly alters the human gut microbiome. Nature 2014; 23: 559-563.
15. Bendtsen LQ, Lorenzen JK, Bendsen NT, Rasmussen C, Astrup A. Effect of dairy

proteins on appetite, energy expenditure, body weight, and composition: a review of the

evidence from controlled clinical trials. Adv Nutr 2013; 4:418-438.

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


16. Neacsu M, Fyfe C, Horgan G, Johnstone AM. Appetite control and biomarkers of satiety

with vegetarian (soy) and meat-based high-protein diets for weight loss in obese men: a

randomized crossover trial. Am J Clin Nutr 2014; 100:548-558

t
17. Jakubowicz D, Froy O, Ahrén B, Boaz M, Landau Z, Bar-Dayan Y, Ganz T, Barnea M,

ip
Wainstein J. Incretin, insulinotropic and glucose-lowering effects of whey protein pre-load in

cr
type 2 diabetes: a randomised clinical trial. Diabetologia 2014; 57:1807-1811.

us
18. Viguiliouk E, Stewart SE, Jayalath VH, Ng AP, Mirrahimi A, de Souza RJ, Hanley AJ,

Bazinet RP, Blanco Mejia S, Leiter LA, Josse RG, Kendall CW, Jenkins DJ, Sievenpiper JL.
an
Effect of Replacing Animal Protein with Plant Protein on Glycemic Control in Diabetes: A

Systematic Review and Meta-Analysis of Randomized Controlled Trials. Nutrients 2015;


M

1:9804-9824.
d

19. Hutchison AT, Piscitelli D, Horowitz M, Jones KL, Clifton PM, Standfield S, Hausken T,
e

Feinle-Bisset C, Luscombe-Marsh ND. Acute load-dependent effects of oral whey protein on


pt

gastric emptying, gut hormone release, glycemia, appetite, and energy intake in healthy

men. Am J Clin Nutr 2015; 102:1574-1584.


ce

20. Klementova M, Thieme L, Haluzik M, Pavlovicova R, Hill M, Pelikanova T, Kahleova H. A


Ac

Plant-Based Meal Increases Gastrointestinal Hormones and Satiety More Than an Energy-

and Macronutrient-Matched Processed-Meat Meal in T2D, Obese, and Healthy Men: A

Three-Group Randomized Crossover Study. Nutrients. 2019; 11:pii: E157.

21. Flaim C, Kob M, Di Pierro AM, Herrmann M, Lucchin L. Effects of a whey protein

supplementation on oxidative stress, body composition and glucose metabolism among


overweight people affected by diabetes mellitus or impaired fasting glucose: A pilot study. J

Nutr Biochem 2017; 50:95-102.22.

22. Comerford KB, Pasin G. Emerging Evidence for the Importance of Dietary Protein

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


Source on Glucoregulatory Markers and Type 2 Diabetes: Different Effects of Dairy, Meat,

Fish, Egg, and Plant Protein Foods. Nutrients 2016;8:E446.

23. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA). Scientific opinion on the

t
essential composition of total diet replacements for weight control. EFSA J 2015;13:3957.

ip
24. Lee JH, Kim D, Kim HJ, Lee CH, Yang JI, Kim W, Kim YJ, Yoon JH, Cho SH, Sung MW,

cr
Lee HS. Hepatic steatosis index: a simple screening tool reflecting nonalcoholic fatty liver

us
disease. Dig Liver Dis 2010;42:503-508.

25. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner
an
RC.Homeostasis model assessment: insulin resistance and beta‐cell function from fasting
M

plasma glucose and insulin concentrations in man. Diabetologia 1985;28:412-419.

26. Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, Alexander H,
d

Alm EJ, Arumugam M, Asnicar F, Bai Y, Bisanz JE, Bittinger K, Brejnrod A, Brislawn CJ,
e

Brown CT, Callahan BJ, Caraballo-Rodríguez AM, Chase J, Cope EK, Da Silva R, Diener C,
pt

Dorrestein PC, Douglas GM, Durall DM, Duvallet C, Edwardson CF, Ernst M, Estaki M,
ce

Fouquier J, Gauglitz JM, Gibbons SM, Gibson DL, Gonzalez A, Gorlick K, Guo J, Hillmann

B, Holmes S, Holste H, Huttenhower C, Huttley GA, Janssen S, Jarmusch AK, Jiang L,


Ac

Kaehler BD, Kang KB, Keefe CR, Keim P, Kelley ST, Knights D, Koester I, Kosciolek T,

Kreps J, Langille MGI, Lee J, Ley R, Liu YX, Loftfield E, Lozupone C, Maher M, Marotz C,

Martin BD, McDonald D, McIver LJ, Melnik AV, Metcalf JL, Morgan SC, Morton JT, Naimey

AT, Navas-Molina JA, Nothias LF, Orchanian SB, Pearson T, Peoples SL, Petras D, Preuss

ML, Pruesse E, Rasmussen LB, Rivers A, Robeson MS 2nd, Rosenthal P, Segata N, Shaffer

M, Shiffer A, Sinha R, Song SJ, Spear JR, Swafford AD, Thompson LR, Torres PJ, Trinh P,
Tripathi A, Turnbaugh PJ, Ul-Hasan S, van der Hooft JJJ, Vargas F, Vázquez-Baeza Y,

Vogtmann E, von Hippel M, Walters W, Wan Y, Wang M, Warren J, Weber KC, Williamson

CHD, Willis AD, Xu ZZ, Zaneveld JR, Zhang Y, Zhu Q, Knight R, Caporaso JG.

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2.

Nat Biotechnol. 2019;37:852-857.

27. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing

reads. EMBnet. journal 2011;17:10-12.

t
ip
28. Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJ, Holmes SP. DADA2: High-

cr
resolution sample inference from Illumina amplicon data. Nat Methods 2016;13:581-583.

us
29. Sajoux I, Lorenzo PM, Gomez-Arbelaez D, Zulet MA, Abete I, Castro AI, Baltar J, Portillo

MP, Tinahones FJ, Martinez JA, Crujeiras AB, Casanueva FF. Effect of a Very-Low-Calorie
an
Ketogenic Diet on Circulating Myokine Levels Compared with the Effect of Bariatric Surgery

or a Low-Calorie Diet in Patients with Obesity. Nutrients 2019;11: pii: E2368.


M

30. Gomez-Arbelaez D, Crujeiras AB, Castro AI, Goday A, Mas-Lorenzo A, Bellon A, Tejera
d

C, Bellido D, Galban C, Sajoux I, Lopez-Jaramillo P, Casanueva FF. Acid-base safety during


e

the course of a very low-calorie-ketogenic diet. Endocrine 2017;58:81-90.


pt

31. Basciani S, Costantini D, Contini S, Persichetti A, Watanabe M, Mariani S, Lubrano C,


ce

Spera G, Lenzi A, Gnessi L. Safety and efficacy of a multiphase dietetic protocol with meal

replacements including a step with very low calorie diet. Endocrine 2015;48:863-70.
Ac

32. Gomez-Arbelaez D, Bellido D, Castro AI, Ordoñez-Mayan L, Carreira J, Galban C,

Martinez-Olmos MA, Crujeiras AB, Sajoux I, Casanueva FF. Body Composition Changes

After Very-Low-Calorie Ketogenic Diet in Obesity Evaluated by 3 Standardized Methods. J

Clin Endocrinol Metab 2017;102:488-498.


33. Westman EC, Tondt J, Maguire E, Yancy WS Jr. Implementing a low-carbohydrate,

ketogenic diet to manage type 2 diabetes mellitus. Expert Rev Endocrinol Metab

2018;13:263-272.

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


34. Bolla AM, Caretto A, Laurenzi A, Scavini M, Piemonti L. Low-Carb and Ketogenic Diets

in Type 1 and Type 2 Diabetes. Nutrients 2019;11:962.

35. Vergès B. Pathophysiology of diabetic dyslipidaemia: where are we? Diabetologia

t
2015;58:886-899.

ip
36. Watanabe M, Tozzi R, Risi R, Tuccinardi D, Mariani S, Basciani S, Spera G,Lubrano C,

cr
Gnessi L. Beneficial effects of the ketogenic diet on nonalcoholic

us
fatty liver disease: A comprehensive review of the literature. Obes Rev. 2020 Mar
an
24.

37. Wadden TA, Hollander P, Klein S, Niswender K, Woo V, Hale PM, Aronne L; NN8022-
M

1923 Investigators. Weight maintenance and additional weight loss with liraglutide after low-
d

calorie-diet-induced weight loss: the SCALE Maintenance randomized study. Int J Obes
e

(Lond). 2013;37:1443-1451.
pt

38. Larsen TM, Dalskov SM, van Baak M, Jebb SA, Papadaki A, Pfeiffer AF, Martinez JA,
ce

Handjieva-Darlenska T, Kunešová M, Pihlsgård M, Stender S, Holst C, Saris WH, Astrup A.

Diet, Obesity, and Genes (Diogenes) Project. Diets with high or low protein content and
Ac

glycemic index for weight-loss maintenance. N Engl J Med 2010;363:2102-2113.

39. Aller EE, Larsen TM, Claus H, Lindroos AK, Kafatos A, Pfeiffer A, Martinez JA,

Handjieva-Darlenska T, Kunesova M, Stender S, Saris WH, Astrup A, van Baak MA. Weight

loss maintenance in overweight subjects on ad libitum diets with high or low protein content

and glycemic index: the DIOGENES trial 12-month results. Int J Obes (Lond) 2014;38:1511-

1517.
40. Gilbert, J.A.; Bendsen, N.T.; Tremblay, A.; Astrup, A. Effect of proteins from different

sources on body composition. Nutr Metab Cardiovasc Dis 2011;21:B16–B31

41. Leong DP, Teo KK, Rangarajan S, Lopez-Jaramillo P, Avezum A Jr, Orlandini A, Seron

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


P, Ahmed SH, Rosengren A, Kelishadi R, Rahman O, Swaminathan S, Iqbal R, Gupta R,

Lear SA, Oguz A, Yusoff K, Zatonska K, Chifamba J, Igumbor E, Mohan V, Anjana RM, Gu

H, Li W, Yusuf S; Prospective Urban Rural Epidemiology (PURE) Study investigators.

Prognostic value of grip strength: findings from the Prospective Urban Rural Epidemiology

t
ip
(PURE) study. Lancet 2015;386:266-273.

cr
42. Lopez-Jaramillo P, Cohen DD, Gómez-Arbeláez D, Bosch J, Dyal L, Yusuf S, Gerstein

HC; ORIGIN Trial Investigators. Association of handgrip strength to cardiovascular mortality

us
in pre-diabetic and diabetic patients: a subanalysis of the ORIGIN trial. Int J Cardiol
an
2014;174:458-461.

43. Holmes MD, Pollak MN, Willett WC, Hankinson SE. Dietary correlates of plasma insulin-
M

like growth factor I and insulin-like growth factor binding protein 3 concentrations. Cancer

Epidemiol Biomarkers Prev 2002;11:852-861.


e d

44. Taekema DG, Ling CH, Blauw GJ, Meskers CG, Westendorp RG, de Craen AJ, Maier
pt

AB. Circulating levels of IGF1 are associated with muscle strength in middle-aged- and

oldest-old women. Eur J Endocrinol 2011;164:189-196.


ce

45. Roberts HC, Denison HJ, Martin HJ, Patel HP, Syddall H, Cooper C, Sayer AA. A review
Ac

of the measurement of grip strength in clinical and epidemiological studies: towards a

standardised approach. Age Ageing 2011;40:423-429.

46. Mehta RS, Abu-Ali GS, Drew DA, Lloyd-Price J, Subramanian A, Lochhead P, Joshi AD,

Ivey KL, Khalili H, Brown GT, DuLong C, Song M, Nguyen LH, Mallick H, Rimm EB, Izard J,

Huttenhower C, Chan AT. Stability of the human faecal microbiome in a cohort of adult men.

Nat Microbiol 2018;3:347-355.


47. Faith JJ, Guruge JL, Charbonneau M, Subramanian S, Seedorf H, Goodman AL,

Clemente JC, Knight R, Heath AC, Leibel RL, Rosenbaum M, Gordon JI. The long-term

stability of the human gut microbiota. Science 2013;341:1237439

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


48. Rinninella E, Raoul P, Cintoni M, Franceschi F, Miggiano GAD, Gasbarrini A, Mele MC.

What is the Healthy Gut Microbiota Composition? A Changing Ecosystem across Age,

Environment, Diet, and Diseases. Microorganisms 2019;7:pii: E14

t
49. Paoli A, Mancin L, Bianco A, Thomas E, Mota JF, Piccini F. Ketogenic diet and

ip
microbiota: friends or enemies? Genes (Basel) 2019;15: E534.

cr
50. Zhang Y, Zhou S, Zhou Y, Yu L, Zhang L, Wang Y. Altered gut microbiome composition

us
in children with refractory epilepsy after ketogenic diet. Epilepsy Res 2018;145:163-168.

51. Xie G, Zhou Q, Qiu CZ, Dai WK, Wang HP, Li YH, Liao JX, Lu XG, Lin SF, Ye JH, Ma
an
ZY, Wang WJ. Ketogenic diet poses a significant effect on imbalanced gut microbiota in
M

infants with refractory epilepsy. World J Gastroenterol 2017;23:6164-6171.

52. Madsen L, Myrmel LS, Fjære E, Liaset B, Kristiansen K. Links between dietary protein
d

sources, the gut microbiota, and obesity. Front Physiol 2017;8:1047.


e
pt

53. Blachier F, Beaumont M, Portune KJ, Steuer N, Lan A, Audebert M, Khodorova N,

Andriamihaja M, Airinei G, Benamouzig R, Davila AM, Armand L, Rampelli S, Brigidi P,


ce

Tomé D, Claus SP, Sanz Y. High-protein diets for weight management: Interactions with the

intestinal microbiota and consequences for gut health. A position paper by the my new gut
Ac

study group. Clin Nutr. 2019;38:1012-1022.

54. Kar SK, Jansman AJM, Benis N, Ramiro-Garcia J, Schokker D, Kruijt L, Stolte EH,

Taverne-Thiele JJ, Smits MA, Wells JM. Dietary protein sources differentially affect

microbiota, mTOR activity and transcription of mTOR signaling pathways in the small

intestine. PLoS One 2017;12:e0188282.


55. Zhu Y, Lin X, Zhao F, Shi X, Li H, Li Y, Zhu W, Xu X, Li C, Zhou G. Meat, dairy and plant

proteins alter bacterial composition of rat gut bacteria. Sci Rep 2015;5:15220.

56. Li R, Chang L, Hou G, Song Z, Fan Z, He X, Hou DX. Colonic microbiota and

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


metabolites response to different dietary protein sources in a piglet model. Front Nutr

2019;6:151.

57. Clemente JC, Ursell LK, Parfrey LW, Knight R. The impact of the gut microbiota on

t
human health: an integrative view. Cell 2012;148:1258-1270.

ip
58. Lloyd-Price J, Abu-Ali G, Huttenhower C. The healthy human microbiome. Genome Med

cr
2016;8:51.

us
59. Maruvada P, Leone V, Kaplan LM, Chang EB. The Human Microbiome and Obesity:
an
Moving beyond Associations. Cell Host Microbe 2017;22:589-599.

60. Brunkwall L, Orho-Melander M. The gut microbiome as a target for prevention and
M

treatment of hyperglycaemia in type 2 diabetes: from current human evidence to future


d

possibilities. Diabetologia 2017;60:943-951.


e

61. Gilbert JA, Blaser MJ, Caporaso JG, Jansson JK, Lynch SV, Knight R. Current
pt

understanding of the human microbiome. Nat Med 2018;24:392-400.


ce

62. Paoli A, Rubini A, Volek JS, Grimaldi KA . Beyond weight loss: a review of the

therapeutic uses of very-low-carbohydrate (ketogenic) diets. Eur J Clin Nutr 2013;67:789-


Ac

796.

63. Bruci A, Tuccinardi D, Tozzi R, Balena A, Santucci S, Frontani R, Mariani S, Basciani S,

Spera G, Gnessi L, Lubrano C, Watanabe M. Very Low-Calorie Ketogenic Diet: A Safe and

Effective Tool for Weight Loss in Patients With Obesity and Mild Kidney Failure. Nutrients.

2020 Jan 27;12(2). pii: E333.


Figure legends

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


Figure 1. Flow diagram of the study. A total of 350 individuals were screened. The subjects

enrolled were randomized to either a VLCKD dietary intervention group with whey protein, a

VLCKD dietary intervention group with vegetable protein or a VLCKD dietary intervention

t
group with animal protein.

ip
cr
Figure 2. Box plot of pooled ranking of all observed relative differences (% variation vs.

us
basal values) from day 0 to day 45 in BUN, creatinine, eGFR, uric acid, HG, and IGF1

values in the WPG, the VPG and the APG. The P values of the parameters plotted are
an
shown in table 2.
M

Figure 3. Correlation between VLCK dietary interventions and gut microbial ecology. (A)
e d

Relative abundance of bacterial phyla in each sample among each treatment group (n=7) at
pt

time 0 and after 45 days of VLCKD dietary intervention (group 1, VLCKD with whey protein;

group 2, VLCKD with vegetable protein; group 3, VLCKD with animal protein). (B) Relative
ce

abundance of Bacteroidetes and Firmicutes. For each time point, values from all available

samples were averaged (n was 21 per time point). Mean values ± SDs are plotted. *** =
Ac

p<0.0001
Figure 4. Effect of 45-day VLCKD dietary interventions with whey protein (white bars),

vegetable protein (green bars) and animal protein (red bars) on the relative abundance of

Firmicutes and Bacteroidetes. For each time point, values from all available samples were

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


averaged (n was 7 per time point). Mean values ± SDs are plotted. * = p<0.017; ** =

p<0.0023; *** = p<0.001

t
ip
cr
us
an
M
e d
pt
ce
Ac
Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020
Table 1. Participant characteristics at baseline (T0) and after 45 days (T45) of VLCKD consumption (whey
protein group, WPG; vegetable protein group, VPG; animal protein group, APG)
WPG VPG APG
T0 T45 P T0 T45 P T0 T45 P
BW (kg) 102.02 ± 94.05 ± 0.03 102.10 ± 94.08 ± 0.041 98.36 ± 91.72 ± 0.106
12.04 11.43 2 12.36 11.92 14.49 14.48
BMI (kg/m2) 35.8 ± 5.0 32.6 ± 4.8 0.03 36.1 ± 4.3 32.9 ± 4.0 0.020 35.7 ± 3.7 32.8 ± 3.7 0.016
5

t
WC (cm) 110.0 ± 9.4 102.8 ± 8.4 0.01 108.2 ± 8.5 102.5 ± 7.6 0.031 105.3 ± 99.1 ± 10.2 0.040

ip
4 9.1
HC (cm) 123.6 ± 117.9 ± 0.09 123.3 ± 9.3 117.9 ± 8.4 0.049 122.5 ± 116.1 ± 0.047
12.1 12.2 8 10.6 10.3

cr
TC (cm) 63.6 ± 5.3 59.7 ± 5.2 0.02 64.1 ± 5.3 60.5 ± 5.9 0.043 65.4 ± 7.2 62.1 ± 6.6 0.091
2
Arm circumference 36.6 ± 3.9 34.6 ± 3.7 0.07 36.3 ± 3.7 34.5 ± 3.4 0.083 37.7 ± 3.0 35.6 ± 2.9 0.029
(cm) 2

us
Systolic BP (mmHg) 132 ± 10 124 ± 13 0.03 131 ± 8 121 ± 10 0.005 129 ± 9 121 ± 16 0.036
2
Diastolic BP (mmHg) 78 ± 11 70 ± 9 0.02 78 ± 10 72 ± 10 0.030 78 ± 10 71 ± 9 0.014
0
an
Fasting glycemia 108.1 ± 94.1 ± 11.4 0.01 106.5 ± 100.9 ± 0.193 99.7 ± 92.6 ± 9.2 0.042
mg/dL 22.3 7 17.6 17.6 12.9
Fasting insulin 25.0 ± 18.9 8.5 ± 4.1 0.00 19.4 ± 7.4 8.3 ± 4.7 0.000 17.7 ± 8.7 6.8 ± 4.1 0.000
(μIU/ml) 1
HOMA-IR (ng/ml) 4.15 ± 1.34 2.1 ± 1.2 0.00 5.1 ± 2.0 2.1 ± 1.2 0.000 4.05 ± 1.6 ± 1.1 0.000
M

4 1.72
IGF-1 (ng/ml) 141.4 ± 167.46 ± 0.01 159.82 ± 116.52 ± 0.000 132.88 ± 148.86 ± 0.160
15.91 43.15 8 19.25 22.05 26.92 32.15
Creatinine (mg/dl) 0.90 ± 0.30 0.79 ± 0.22 0.12 0.78 ± 0.17 0.78 ± 0.15 0.465 0.80 ± 0.86 ± 0.19 0.163
0.16
d

BUN (mg/dl) 39.0 ± 12.5 38.5 ± 13.9 0.46 40.0 ± 13.1 37.4 ± 12.1 0.281 39.3 ± 6.8 48.0 ± 14.4 0.019
6
e

eGFR (ml/min) 131.9 ± 136.6 ± 0.39 146.4 ± 131.4 ± 0.091 134.8 ± 115.6 ± 0.049
42.9 56.1 5 33.3 26.8 33.2 30.2
Proteins (g/L) 74.3 ± 4.0 71.8 ± 2.9 0.02 75.0 ± 3.5 74.0 ± 4.1 0.237 74.3 ± 4.4 72.2 ± 3.5 0.070
pt

8
Albumin (g/L) 44.13 ± 43.71 ± 0.32 44.55 ± 43.98 ± 0.283 44.68 ± 44.22 ± 0.293
2.43 2.90 8 2.76 2.69 2.71 1.91
ce

AST (U/L) 23.8 ± 13.0 19.9 ± 5.8 0.14 25.3 ± 13.2 26.8 ± 14.0 0.385 19.8 ± 4.7 19.9 ± 3.7 0.450
6
ALT (U/L) 31.1 ± 15.4 24.0 ± 9.3 0.06 35.0 ± 24.0 35.5 ± 26.9 0.479 23.8 ± 7.0 21.6 ± 4.9 0.151
2
HSI 44.0 ± 5.1 41.6 ± 5.4 0.10 44.1 ± 5.4 40.9 ± 5.2 0.049 44.3 ± 4.4 42.1 ± 4.1 0.077
Ac

1
Uric acid (mg/dl) 5.4 ± 1.1 5.1 ± 1.4 0.25 5.2 ± 1.0 5.8 ± 1.1 0.072 4.9 ± 1.0 5.6 ± 0.8 0.021
7
CRP (g/L) 4700 ± 2662 ± 0.13 7050 ± 5913 ± 0.307 5156 ± 4087 ± 0.237
6740 2414 2 5959 6435 4820 3383
ESR (mm/h) 26.8 ± 16.0 28.5 ± 15.8 0.37 28.0 ± 17.9 25.7 ± 17.1 0.357 28.8 ± 26.1 ± 12.1 0.292
9 15.8
Total cholesterol 214.8 ± 166.2 ± 0.00 220.9 ± 170.7 ± 0.002 226.9 ± 191.2 ± 0.003
(mg/dl) 31.5 43.6 1 51.6 36.3 32.7 34.2
LDL cholesterol 132.8 ± 100.8 ± 0.00 136.1 ± 97.5 ± 32.3 0.004 143.9 ± 118.5 ± 0.003
(mg/dl) 30.8 38.4 8 41.3 25.8 23.1
Triglycerides (mg/dl) 131.0 ± 94.6 ± 32.0 0.00 170.1 ± 117.6 ± 0.069 124.25 ± 82.25 ± 0.009
44.9 7 126.9 42.7 58 33.32
HDL cholesterol 51.7 ± 12.3 46.1 ± 7.5 0.07 51.2 ± 12.8 49.0 ± 9.5 0.298 57.9 ± 56.2 ± 18.0 0.408
(mg/dl) 2 23.7
Urine acetoacetic 1.8 ± 0.8 56.3 ± 31.3 0.00 1.8 ± 0.7 41.1 ± 15.4 0.000 1.6 ± 0.7 44.8 ± 15.3 0.000
acid (mg/dL) 0
Total fat (kg) 36.74 ± 31.92 ± 0.10 37.40 ± 32.00 ± 0.081 37.00 ± 32.85 ± 0.094
10.83 10.19 2 7.77 7.51 8.23 8.88
Total lean (kg) 62.95 ± 59.93 ± 0.15 62.32 ± 59.70 ± 0.246 57.24 ± 56.59 ± 0.434
9.04 7.66 8 1.04 10.02 9.21 12.18
Total fat (%) 35.71 ± 33.33 ± 0.21 36.69 ± 34.06 ± 0.144 37.75 ± 35.89 ± 0.247
8.38 8.33 3 6.46 6.82 6.87 8.04
Total lean (%) 62.01 ± 64.13 ± 0.43 60.96 ± 63.41 ± 0.072 58.57 ± 61.63 ± 0.026

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


8.01 7.88 8 6.29 6.59 7.60 7.99
Trunk fat (kg) 18.40 ± 15.43 ± 0.02 18.69 ± 15.96 ± 0.016 17.43 ± 15.46 ± 0.065
5.54 5.01 2 3.36 3.24 3.27 3.80
HG (kg) 32.47 ± 34.45 ± 0.23 30.13 ± 31.01 ± 0.36 32.64 ± 34.03 ± 0.33
7.73 7.34 6.99 6.92 9.04 9.25

t
ip
cr
us
Abbreviations: BW, body weight; BMI, body mass index; WC, waist circumference; HC, hip
circumference; TC, thigh circumference; BP, blood pressure; HOMA-IR, homeostasis model
an
assessment- insulin resistance; BUN, blood urea nitrogen; eGFR, estimated glomerular filtration
rate; AST, aspartate transaminase; ALT, alanine transferase; HSI, hepatic steatosis index; CRP, C-
reactive protein; ESR, erythrocyte sedimentation rate; HG, handgrip strength. Values in bold
indicate statistically significant results (P≤0.05).
M
e d
pt
ce
Ac
Table 2. Between-group (ANCOVA) and within-group (ANOVA) P values of the percent change from baseline of the
parameters with a significant group effect measured after 45 days of VLCKD consumption (whey protein group,
WPG; vegetable protein group, VPG; animal protein group, APG).

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


Between groups WPG vs VPG WPG vs APG A PG vs VPG
IGF-1 0.0000 0.0000 0.5697 0.0011
Creatinine 0.0010 0.0696 0.0006 0.2004
BUN 0.0019 0.2281 0.0973 0.0013
eGFR 0.0016 0.0334 0.0013 0.4690
Uric acid 0.0112 0.0533 0.0128 0.8316
HG 0.0040 0.0027 0.1351 0.2652
Abbreviations: BUN, blood urea nitrogen; eGFR, estimated glomerular filtration rate; HG, handgrip strength; ALM,

t
appendicular lean mass; DALM, dominant arm lean mass.

ip
Values in bold indicate statistically significant results (P≤0.05) and values "trending towards significance" (P<0.1).

cr
us
an
M
e d
pt
ce
Ac
Table 3. Adverse events during the nutritional interventions (WPG, VLCKD
incorporating whey protein; VPG, VLCKD incorporating vegetable protein; APG,
VLCKD incorporating animal protein) recorded 15 days (T15) and 45 days (T45)
after the start of the diets. Number (percentage) of participants reporting an adverse
event.

Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020


WPG VPG APG
T15 T45 T15 T45 T15 T45
constipation 2 (12.5) 4 (25) 2 (12.5) 4 (25) 2 (12.5) 6 (37.5)
diarrhea 1 (0.6) 1 (0.6) 3 (18.7) 2 (12.5) 1 (0.6) 2 (12.5)
cramps 1 (0.6) 1 (0.6) 2 (12.5) 1 (0.6) 1 (0.6) 1 (0.6)
nausea 2 (12.5) 2 (12.5) 2 (12.5) 1 (0.6) 1 (0.6) 1 (0.6)
fatigue 1 (0.6) 1 (0.6) 3 (18.7) 2 (12.5) 2 (12.5) 1 (0.6)
hunger 3 (18.7) 3 (18.7) 2 (12.5) 2 (12.5) 3 (18.7) 2 (12.5)

t
ip
headache 4 (25) 1 (0.6) 2 (12.5) 1 (0.6) 2 (12.5) 2 (12.5)
dizziness 2 (12.5) 2 (12.5) 2 (12.5) 1 (0.6) 1 (0.6) 1 (0.6)
insomnia 1 (0.6) 1 (0.6) 1 (0.6) 2 (12.5) 2 (12.5) 2 (12.5)

cr
us
an
M
e d
pt
ce
Ac
Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020
t
ip
cr
us
an
Figure 1

M
d e
pt
ce
Ac
Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020
t
ip
cr
us
an
Figure 2

M
d e
pt
ce
Ac
Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020
t
ip
cr
us
an
Figure 3

M
d e
pt
ce
Ac
Downloaded from https://academic.oup.com/jcem/advance-article-abstract/doi/10.1210/clinem/dgaa336/5850439 by Beurlingbiblioteket user on 02 June 2020
t
ip
cr
us
an
Figure 4

M
d e
pt
ce
Ac

You might also like