foods

Article
Carotenoid Biosynthesis in Oriental Melon
(Cucumis melo L. var. makuwa)
Pham Anh Tuan 1,† , Jeongyeo Lee 2,† , Chang Ha Park 1 , Jae Kwang Kim 3 , Young-Hee Noh 2 ,
Yeon Bok Kim 4 , HyeRan Kim 2,5, * and Sang Un Park 1, *
1 Department of Crop Science, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon 34134,
Korea; [email protected] (P.A.T.); [email protected] (C.H.P.)
2 Plant Systems Engineering Research Center, Korea Research Institute of Bioscience and
Biotechnology (KRIBB), 125 Gwahangno, Yuseong-gu, Daejeon 305-806, Korea; [email protected] (J.L.);
[email protected] (Y.-H.N.)
3 Division of Life Sciences, College of Life Sciences and Bioengineering, Incheon National University,
Yeonsu-gu, Incheon 406-772, Korea; [email protected]
4 Department of Medicinal and Industrial Crops, Korea National College of Agriculture & Fisheries, 1515,
Kongjwipatjwi-Ro, Jeonju, Jeonbuk 54874, Korea; [email protected]
5 Systems and Bioengineering, University of Science and Technology, 217 Gajung-ro, Daejeon 34113, Korea
* Correspondence: [email protected] (H.K.); [email protected] (S.U.P.); Tel.: +82-42-860-4345 (H.K.);
+82-42-821-6730 (S.U.P.); Fax: +82-42-860-4149 (H.K.); +82-42-822-2631 (S.U.P.)
† These authors contributed equally to this work.




Received: 23 January 2019; Accepted: 13 February 2019; Published: 19 February 2019


Abstract: Full-length cDNAs encoding ξ-carotene desaturase (CmZDS), lycopene ε-cyclase

(CmLCYE), β-ring carotene hydroxylase (CmCHXB), and zeaxanthin epoxidase (CmZEP), and
partial-length cDNA encoding ε-ring carotene hydroxylase (CmCHXE) were isolated in Chamoe
(Cucumis melo L. var. makuwa), an important commercial fruit. Sequence analyses revealed that these
proteins share high identity and common features with other orthologous genes. Expression levels
of entire genes involved in the carotenoid biosynthetic pathway were investigated in the peel, pulp,
and stalk of chamoe cultivars Ohbokggul and Gotgam. Most of the carotenoid biosynthetic genes
were expressed at their highest levels in the stalk, whereas carotenoids were highly distributed in the
peel. The expression levels of all carotenoid biosynthetic genes in fruits of the native cultivar Gotgam
chamoe were higher than those in the cultivar Ohbokggul chamoe, consistent with the abundant
carotenoid accumulation in Gotgam chamoe fruits and trace carotenoid content of Ohbokggul
chamoe fruit. Lutein and β-carotene were the dominant carotenoids; high levels (278.05 µg g−1 and
112.02 µg g−1 dry weight, respectively) were found in the peel of Gotgam chamoe. Our findings may
provide a foundation for elucidating the carotenoid biosynthetic mechanism in C. melo and inform
strategies for developing new chamoe cultivars with improved characteristics.

Keywords: β-carotene; carotenoids; Cucumis melo L. var. makuwa; chamoe; gene characterization;
lutein

1. Introduction
Melon (Cucumis melo L.), which belongs to the Cucurbitaceae family, is one of the most highly
consumed fruit crops worldwide because of its pleasant flavor and nutritional value. Melons provide
a rich source of protein, minerals, vitamins, and a wide range of antioxidant compounds [1–3]. The
fruit can be consumed as a salad or as juice and is used by the food industry in products such as jam,
ice cream, and yogurt. Melon fruits are diverse in shape, size, color, and flavor. In Korea, oriental
melon (Cucumis melo L. var. makuwa), commonly known as chamoe, is an important commercial fruit

Foods 2019, 8, 77; doi:10.3390/foods8020077 www.mdpi.com/journal/foods

Foods 2019, 8, 77 2 of 9

due to its vigorous growth, good quality, and unique flavor, and consumer demand for the fruit is
high. Chamoe has also been used in traditional medicine as a liver tonic and for its cardio-protective,
antidiabetic, anti-obesity, and anticancer properties [4,5]. The cultivar Ohbokggul chamoe, which has a
golden-colored skin with silver lines and sweet white flesh, is one of the most popular fruits on the
market. The native Korean cultivar chamoe, Gotgam, has green skin with distinctive green stripes
running from end to end, and very thick, light-green flesh. Gotgam chamoe has greater flavor, nutrient
content, and disease resistance than other chamoe cultivars [6]. Given these favorable characteristics,
Gotgam chamoe has recently acquired agronomic relevance for melon breeding programs in Korea.
Carotenoids, which contain 40 carbon molecules and are formed through the condensation of
isoprenoids, represent a diverse group of pigments in nature [7]. In plants, carotenoids contribute
to yellow, orange, and red coloration, and play a major role in the quality of flowers and fruit.
The biosynthesis of biomolecules as carotenoids could be related to agri-environmental factors [8].
Several studies have demonstrated a positive correlation between phytochemical biosynthesis and
light intensity and the spectral quality of vegetables and microgreens produced in controlled
environments [9]. Carotenoids are accessory pigments that harvest light for photosynthesis, protect
the photosystem from photooxidation, and attract pollinators and agents of seed dispersal [10–12].
In addition, the oxidative cleavage of carotenoids produces apocarotenoids, which serve as
development signals and antifungal agents and contribute to the flavor and aroma of flowers and
fruit [13]. In terms of human health, carotenoids play an important protective role as antioxidants, and
a diet containing carotenoid-rich vegetables and fruit can reduce the risk of cancer, cardiovascular
disease, macular degeneration, cataracts, and ultraviolet-induced skin damage [14–17]. More than
50 carotenoids with β-ring end groups (e.g., β-carotene and β-cryptoxanthin) are precursors of
vitamin A, which is one of the most important micronutrients affecting human health [18,19]. Vitamin A
deficiency increases the risk of infectious disease, especially measles, diarrhea, and malaria, and is
considered the most common public health problem among preschool-aged children [20,21]. The
importance of carotenoids to human health has led to an increase in studies of vegetables and fruit
that contain these compounds.
In higher plants, carotenoids are synthesized and localized in the plastids, while the corresponding
genes are located in the nucleus. To date, genes involved in carotenoid biosynthetic pathways in
higher plants have been described in detail [22]. The first step in the formation of carotenoids is
the condensation of two geranylgeranyl diphosphate (GGDP) molecules to form phytoene, which is
catalyzed by phytoene synthase (PSY) (Figure 1). Phytoene undergoes a series of four desaturations
to form lycopene via ξ-carotene, which is catalyzed by two enzymes, phytoene desaturase (PDS)
and ξ-carotene desaturase (ZDS). Lycopene is a branching point in the pathway and is cyclized
to form α-carotene by lycopene β-cyclase (LCYB) together with lycopene ε-cyclase (LCYE) or to
produce β-carotene by LCYB alone through two reactions. Thereafter, α-carotene and β-carotene
are hydroxylated to produce lutein and zeaxanthin, respectively. These reactions are catalyzed by
β-ring carotene hydroxylase (CHXB) and ε-ring carotene hydroxylase (CHXE). Further epoxidation
of zeaxanthin by zeaxanthin epoxidase (ZEP) produces violaxanthin, which is used to synthesize
plant hormone abscisic acid (ABA) through oxidative cleavage catalyzed by 9-cis epoxycarotenoid
dioxygenase (NCED) [23]. Along the pathway, carotenoids can be cleaved by carotenoid cleavage
dioxygenases (CCD) to produce a diverse set of apocarotenoids [13].
Here, full-length cDNAs encoding ZDS, LCYE, CHXB, and ZEP, and partial-length cDNA
encoding CHXE were isolated in C. melo. The expression levels of genes involved in carotenoid
biosynthesis and carotenoid accumulation were investigated in fruits of the cultivar Ohbokggul
and the native cultivar Gotgam chamoe using quantitative real-time PCR and high-performance
liquid chromatography (HPLC), respectively. Therefore, this study will help elucidate the carotenoid
biosynthetic mechanism in C. melo and will provide valuable information for breeding chamoe cultivars
with improved characteristics.
Foods 2019, 8, 77 3 of 9
Foods 2019, 8, x FOR PEER REVIEW 3 of 9

Figure 1.
Figure Carotenoid biosynthetic
1. Carotenoid biosynthetic pathway
pathway in in plants
plants and
andphotographs
photographsofofOhbokggul
OhbokggulandandGotgam
Gotgam
chamoes. GGDP (geranylgeranyl diphosphate); PSY (phytoene synthase); PDS (phytoene desaturase);
chamoes. GGDP (geranylgeranyl diphosphate); PSY (phytoene synthase); PDS (phytoene desaturase);
ZDS (ξ-carotene
ZDS (ξ-carotene desaturase);
desaturase); LCYB
LCYB (lycopene β-cyclase);LCYE
(lycopeneβ-cyclase); LCYE(lycopene ε-cyclase);CHXB
(lycopeneε-cyclase); CHXB(β-ring
(β-ring
carotene hydroxylase); CHXE (ε-ring carotene hydroxylase); ZEP (zeaxanthin epoxidase);
carotene hydroxylase); CHXE (ε-ring carotene hydroxylase); ZEP (zeaxanthin epoxidase); NCEDNCED(9-cis(9-
epoxycarotenoid
cis dioxygenase).
epoxycarotenoid dioxygenase).
2. Materials and Methods
2. Materials and Methods
2.1. Plant Materials
2.1. Plant Materials
Two chamoe cultivars, Cucumis melo L. var. makuwa ‘Ohbokggul’ and C. melo L. var. makuwa
Two chamoe
‘Gotgam’, cultivars,
were grown Cucumis melo
in a greenhouse L. experimental
at an var. makuwa ‘Ohbokggul’ and C. from
farm, and obtained melo Nongwoo
L. var. makuwa
Bio
‘Gotgam’, werethe
(Korea) during grown in aseason
fruiting greenhouse at an
in October experimental
2012. Ohbokggulfarm, and obtained
and Gotgam chamoes from Nongwoo Bio
are differentiated
(Korea)
by shape,during the color
size, and fruiting season
(Figure in October
1). Three fruits of2012. Ohbokggul
each cultivar wereand Gotgam
collected, andchamoes
their peels,are
differentiated
pulps, and stalksby shape, size, and The
were separated. colorsamples
(Figurewere
1). Three
frozenfruits of each
in liquid cultivar
nitrogen andwere collected,
stored ◦
at −80 andC
their
until peels, pulps, and stalks were separated. The samples were frozen in liquid nitrogen and stored
analysis.
at –80 °C until analysis.
2.2. Isolation of cDNAs Encoding Carotenoid Biosynthetic Genes
2.2. Isolation
GenBank of accession
cDNAs Encoding
numbersCarotenoid Biosynthetic NM_001125948,
U38550, NM_125085, Genes NM_180954, and U58919 were
usedGenBank
as queriesaccession
to search numbers
for homologous
U38550, sequences in ourNM_001125948,
NM_125085, internal chamoeNM_180954,
transcriptome database
and U58919
(unpublished data). Full-length cDNAs encoding ZDS, LCYE, CHXB, and ZEP, and partial-length
were used as queries to search for homologous sequences in our internal chamoe transcriptome
cDNA encoding
database CHXEdata).
(unpublished were Full-length C. melo encoding
isolated in cDNAs and designated as CmZDS,
ZDS, LCYE, CHXB,CmLCYE,
and ZEP, CmCHXB,
and partial-
CmCHXE, and CmZEP (GenBank accession numbers: KF668331, KF668332, KF668333,
length cDNA encoding CHXE were isolated in C. melo and designated as CmZDS, CmLCYE, KF668334, and
KF668335, respectively).
CmCHXB, CmCHXE, and CmZEP (GenBank accession numbers: KF668331, KF668332, KF668333,
KF668334, and KF668335, respectively).
2.3. Quantitative Real-Time PCR Analysis
QuantitativeReal-Time
2.3. Quantitative RT-PCR was
PCRperformed
Analysis for the precise analysis of transcript levels. Primers targeted
to CmPSY, CmPDS, CmLCYB, CmCCD1, CmNCED, and CmACT2 (Accession Nos. GU361622,
Quantitative RT-PCR was performed for the precise analysis of transcript levels. Primers
KC507802, GU457407, XM_004170465, JF838293, and AB033599, respectively) and five genes isolated in
targeted to CmPSY, CmPDS, CmLCYB, CmCCD1, CmNCED, and CmACT2 (Accession Nos.
this study were designed using the Primer Quest computer program (http://eu.idtdna.com/Scitools/
GU361622, KC507802, GU457407, XM_004170465, JF838293, and AB033599, respectively) and five
genes isolated in this study were designed using the Primer Quest computer program
(http://eu.idtdna.com/Scitools/Applications/Primerquest/), producing fragments of 80 to 90 bp (Table
Foods 2019, 8, 77 4 of 9

Applications/Primerquest/), producing fragments of 80 to 90 bp (Table 1). Total RNA (5 µg) from each
sample was combined with random hexamer primers in a SuperScript first-strand cDNA synthesis
system according to the manufacturer’s instructions (Invitrogen Life Technologies, Carlsbad, CA,
USA). After cDNA synthesis, quantitative real-time PCR was performed using SYBR® Green SuperMix
RT-PCR kit (IQ Sybr SYBR Green Super Mix, Bio-Rad, Hercules, CA, USA) on a MiniOption detection
system (Bio-Rad, Hercules, CA, USA). Results were analyzed using Bio-Rad software (GeneXpression
Macro Chromo4) and the comparative threshold cycle (Ct) method using CmACT2 as the reference
according to the manufacturer’s instructions for data normalization.

Table 1. Primers used in this study for quantitative real-time PCR analysis.

Primer Sequence (50 to 30 )

Gene Name
Forward Primer Reverse Primer
CmPSY TGTGCAGAGTATGCCAAGAC GTCCGCCTACACCATACATAAA
CmPDS GGCTGGAGAAGTGGAGTTATTG CCTCAGCTTAAAGCCAGAATACA
CmZDS ACACTCCAGACGCAGATTTC GCAATGATCCCTGTCCTTCA
CmLCYB GTTTCTTCCCGAGCTGTTACT GAGTTCCCTTTGCCATGATTTC
CmLCYE TGGTCCAGATCTGCCATTTAC CCGGCCATACATGCTCTATAC
CmCHXB GCTGTCATGGCGGTTTATTAC GGCACCAACAGAGAGAGAAA
CmCHXE AATCGTTGCACTTGCCATATTC GCTCCAGTAGTCATCCCAATG
CmZEP GTAGAAGAATACGGGTTGCTGTA CCGAGTCCAACTCCCAAATAA
CmCCD1 CATGATGAGACTCCTCCGATTAC GATTTGGTCCCACCCTAACA
CmNCED CAATCCTCTCTTCCAACCAACT CTAGCGGAACCGTGATTGATAG
CmACT2 CTACGAACTTCCTGATGGACAAG CCAATGAGAGATGGCTGGAATAG

2.4. Sequence Analysis

The deduced amino acid sequences of carotenoid biosynthetic genes from C. melo
were analyzed for homology using the BLAST program and the NCBI GenBank database
(http://www.ncbi.nlm.nih.gov/BLAST). Sequence alignments were carried out using BioEdit
Sequence Alignment Editor, version 5.0.9 (Department of Microbiology, North Carolina State University,
Raleigh, NC, USA). The predicted molecular mass of protein was calculated using an online website
(http://www.sciencegateway.org/tools/proteinmw.htm).

2.5. Carotenoid Extraction and HPLC Analysis

Extraction and measurement of carotenoids by HPLC were performed as previously described by
our group [24]. Briefly, carotenoids were released from the chamoe samples (0.02 g) by adding 3 mL
of ethanol containing 0.1% ascorbic acid (w/v), vortex mixing for 20 s, and placing in a water bath at
85 ◦ C for 5 min. The carotenoid extract was saponified with potassium hydroxide (120 µL, 80% w/v) in
the 85 ◦ C water bath for 10 min. After saponification, samples were placed immediately on ice, and
cold deionized water (1.5 mL) was added. β-Apo-80 -carotenal (0.2 mL, 25 g/mL) was added as an
internal standard. Carotenoids were extracted twice with hexane (1.5 mL) by centrifugation at 1200× g
to separate the layers. Aliquots of the extracts were dried under a stream of nitrogen and redissolved in
50:50 (v/v) dichloromethane/methanol before analysis by HPLC. The carotenoids were separated on a
C30 YMC column (250 × 4.6 mm, 3 µm; Waters Corporation, Milford, MA, USA) by Agilent 1100 HPLC
(Massy, France) equipped with a photodiode array (PDA) detector. Chromatograms were generated at
450 nm. Solvent A consisted of methanol/water (92:8 v/v) with 10 mM ammonium acetate. Solvent B
consisted of 100% methyl tert-butyl ether. Gradient elution was performed at 1 mL/min under the
following conditions: 0 min, 90% A/10% B; 20 min, 83% A/17% B; 29 min, 75% A/25% B; 35 min,
30% A/70% B; 40 min, 30% A/70% B; 42 min, 25% A/75% B; 45 min, 90% A/10% B; and 55 min, 90%
A/10% B. Carotenoid standards were purchased from CaroteNature (Lupsingen, Switzerland). For
quantification, calibration curves were created by plotting four different concentrations of carotenoid
standards according to the peak area ratios with β-apo-80 -carotenal. Quantification was performed
Foods 2019, 8, 77 5 of 9

using calibration curves ranging from 0.3 to 5 µg/mL. The linear equations were y = 0.1178x − 0.027
for zeaxanthin, y = 0.1194x − 0.0063 for lutein, y = 0.0822x − 0.0003 for β-carotene, y = 0.0822x − 0.0003
for 9-cis β-carotene, y = 0.0822x − 0.0003 for 13-cis β-carotene, y = 0.0822x − 0.0003 for α-carotene,
and y = 0.0884x − 0.0251 for β-cryptoxanthin.

2.6. Statistical Analysis

The data on expression levels of carotenoid biosynthetic genes were analyzed using the computer
software Statistical Analysis System (SAS version 9.2). Treatment means were compared by Duncan’s
multiple range test.

3. Results

3.1. Sequence Analyses of Carotenoid Biosynthetic Genes from C. melo

CmZDS was composed of 1976 bp, with a 1731-bp open reading frame (ORF) encoding a protein
of 576 amino acids (predicted molecular mass of 63.90 kDa; Figure S1). The closest homolog of
CmZDS was ZDS from Cucumis sativus (98% identity and 99% similarity), followed by ZDS from
Cucurbita moschata (93% identity and 96% similarity), ZDS from Vitis vinifera (89% identity and 95%
similarity), and ZDS from Citrus unshiu (84% identity and 90% similarity). As shown in Figure S1,
CmZDS contained a conserved dinucleotide-binding motif (GXGX2 GX3 AX2 LX3 GX6 EX5 GG) and a
carotenoid-binding domain also found in other orthologous genes [25,26].
CmLCYE was 1958 bp long and had a 1602-bp ORF, encoding a protein of 533 amino acids with a
predicted molecular mass of 58.81 kDa (Figure S2). CmLCYE shared 97% identity and 97% similarity
with Cucumis sativus LCYE, 82% identity and 91% similarity with Camellia sinensis var. assamica LCYE,
83% identity and 90% similarity with Glycine max LCYE, and 79% identity and 88% similarity with
Vitis vinifera LCYE. The deduced amino acid sequence of CmLCYE comprised a dinucleotide binding
motif and two cyclase motifs, which are the common features of carotenoid cyclases [27,28].
CmCHXB consisted of 1292 bp with a 933-bp ORF and encoded a protein of 310 amino acids
(predicted molecular mass of 34.78 kDa; Figure S3). CmCHXB exhibited 96% identity and 97%
similarity with Cucumis sativus CHXB, 89% identity and 94% similarity with Cucurbita moschata CHXB,
77% identity and 86% similarity with Vitis vinifera CHXB, and 74% identity and 85% similarity with
Ipomoea nil CHXB. Four conservatively spaced histidine motifs proposed to be involved in iron binding
during hydroxylation reactions are marked in Figure S3 [29].
CmCHXE was composed of 933 bp encoding a partial 30 -end ORF of 148 amino acids. A BLAST
search at the amino acid level showed that CmCHXE exhibited high homology to other CHXEs
(Figure S4). Specifically, CmCHXE shared 97% identity and 97% similarity with Cucumis sativus
CHXE, 84% identity and 92% similarity with Vitis vinifera CHXE, 88% identity and 94% similarity
with Fragaria vesca subsp. vesca CHXE, and 83% identity and 93% similarity with Daucus carota subsp.
sativus CHXE.
CmZEP was composed of 2514 bp with a 1998-bp ORF and encoded a protein of 665 amino
acids with a predicted molecular mass of 73.20 kDa (Figure S5). CmZEP shared 98% identity and 98%
similarity with Cucumis sativus ZEP, 95% identity and 96% similarity with Citrullus lanatus ZEP, 88%
identity and 94% similarity with Cucurbita moschata ZEP, and 75% identity and 85% similarity with
Prunus armeniaca ZEP. CmZEP displayed two short motifs typical of the lipocalin family of proteins
and a phosphopeptide-binding domain (The forkhead-associated (FHA) domain), which are present
in all known ZEP genes [30,31].

3.2. Expression Levels of Carotenoid Biosynthetic Genes in Ohbokggul and Gotgam Chamoes
Expression levels of carotenoid biosynthetic genes in the peel, pulp, and stalk of Ohbokggul
were compared to those in Gotgam (Figure 2). In Ohbokggul chamoe, the highest expression levels of
CmPSY were found in the stalk, with lower levels in the pulp and peel. This same pattern of expression
Foods 2019, 8, 77 6 of 9

was observed for CmPDS, CmLCYB, CmLCYE, CmCCD1, and CmNCED. Transcript levels of CmCHXE
Foods 2019, 8, x FOR PEER REVIEW 6 of 9
were highest in the peel and lowest in the stalk of Ohbokggul; CmZDS, CmCHXB, and CmZEP were
expressed
CmZEP were at similar levels
expressed in the peel,
at similar levelspulp,
in theand
peel,stalk ofand
pulp, Ohbokggul. In general,InmRNA
stalk of Ohbokggul. levels
general, mRNAof
carotenoid biosynthetic genes in all fruit parts were higher in Gotgam than in Ohbokggul.
levels of carotenoid biosynthetic genes in all fruit parts were higher in Gotgam than in Ohbokggul. Transcription
of most carotenoid
Transcription biosynthetic
of most carotenoid genes
biosynthetic CmPDS,
(CmPSY, genes CmCHXB,
(CmPSY, CmCCD1,
CmPDS, and CmNCED)
CmCHXB, CmCCD1, wasand
highest
CmNCED) in thewasstalk andinlowest
highest in the
the stalk andpeel of Gotgam
lowest chamoe.
in the peel CmLCYE
of Gotgam chamoe. CmZEP showed
andCmLCYE and CmZEPthe
highest expression levels in the pulp and peel, respectively. No differences in transcript
showed the highest expression levels in the pulp and peel, respectively. No differences in transcript levels of
CmZDS
levels ofand
CmZDS CmCHXE were found
and CmCHXE were in the
foundpeel,
inpulp, or stalk
the peel, pulp,ofor
Gotgam
stalk ofchamoe.
Gotgam chamoe.

Figure 2.2. Expression levels of carotenoid

Figure carotenoid biosynthetic
biosynthetic genes
genes in
in different
different parts
parts of
of Ohbokggul
Ohbokggul and
and
Gotgam chamoe
Gotgam chamoe fruit.
fruit. Values are means; means; bars represent standard
standard error
error from
from three
three independent
independent
measurements.The
measurements. Theletters
lettersa,a,b,
b,c,c, d,
d, e,
e, and
and f indicate
indicate significant
significant differences
differencesatatthe
the 5%
5% level
level by
by Duncan’s
Duncan’s
multiple range
multiple rangetest.
test.

3.3.
3.3. Analysis
Analysis of
of Carotenoid
Carotenoid Content
Content in
in Ohbokggul
Ohbokggul and
andGotgam
GotgamChamoes
Chamoes
The
The same
same Ohbokggul
Ohbokgguland and Gotgam
Gotgam peel,
peel, pulp,
pulp, andand stalk
stalk materials
materials usedused for
for quantitative
quantitative real-time
real-time
PCR
PCR were used to analyze carotenoid composition and content by HPLC (Table 2).
were used to analyze carotenoid composition and content by HPLC (Table 2). Surprisingly,
Surprisingly,
carotenoids
carotenoids were
were very
very poorly
poorly synthesized
synthesized in in Ohbokggul
Ohbokggul fruit,
fruit, with
with only
only trace
trace amounts
amounts of of total
total
carotenoids measured in the peel (0.89 µg g − 1 ), pulp (0.02 µg g − 1 ), and stalk (0.51 µg g − 1 ). In contrast,
carotenoids measured in the peel (0.89 μg g ), pulp (0.02 μg g ), and stalk (0.51 μg g ). In contrast,
−1 −1 −1

total −1
totalcarotenoid
carotenoidcontent
contentwaswashigh
highininthe
thepeel
peelofofGotgam
Gotgamchamoe
chamoe(428.81
(428.81µg μgg g−1).). Lutein
Lutein and
and β-carotene
β-carotene
were − 1 − 1
were the dominant compounds in Gotgam peel (278.05 μg g and 112.02 μg g , respectively); lower
the dominant compounds in Gotgam peel (278.05 µg g −1and 112.02 µg g −1 , respectively); lower
concentrations −1 −1 and β-cryptoxanthin
concentrationsof of9-cis β-carotene(10.27
9-cisβ-carotene μgg g−1),), 13-cis
(10.27µg β-carotene(11.82
13-cisβ-carotene (11.82µgμggg−1), ), and β-cryptoxanthin
(13.44 −1 were also detected in the peel. Similar to the peel, lutein and β-carotene were the major
(13.44µgμggg−1)) were also detected in the peel. Similar to the peel, lutein and β-carotene were the major
carotenoids
carotenoids synthesized in
synthesized in the
the pulp,
pulp, while
while only β-carotene showed
onlyβ-carotene showed an an appreciable
appreciable concentration
concentration in in
the stalk of Gotgam chamoe.
the stalk of Gotgam chamoe.

Table 2. Carotenoid composition and content in different parts of Ohbokggul and Gotgam chamoe
fruit (μg g−1 dry weight). The results are expressed as means ± standard error from three independent
measurements. N.D., not detected.

Ohbokggul Chamoe Gotgam Chamoe

Carotenoids
Peel Pulp Stalk Peel Pulp Stalk
α-carotene N.D. N.D. N.D. 2.54 ± 0.33 0.38 ± 0.01 N.D.
Lutein 0.45 ± 0.05 0.02 ± 0.00 0.07 ± 0.01 278.05 ± 23.51 14.16 ± 0.37 0.52 ± 0.11
Foods 2019, 8, 77 7 of 9

Table 2. Carotenoid composition and content in different parts of Ohbokggul and Gotgam chamoe
fruit (µg g−1 dry weight). The results are expressed as means ± standard error from three independent
measurements. N.D., not detected.

Ohbokggul Chamoe Gotgam Chamoe

Carotenoids
Peel Pulp Stalk Peel Pulp Stalk
α-carotene N.D. N.D. N.D. 2.54 ± 0.33 0.38 ± 0.01 N.D.
Lutein 0.45 ± 0.05 0.02 ± 0.00 0.07 ± 0.01 278.05 ± 23.51 14.16 ± 0.37 0.52 ± 0.11
β-carotene 0.27 ± 0.04 N.D. 0.33 ± 0.04 112.02 ± 10.69 6.45 ± 1.06 17.64 ± 3.94
9-cis β-carotene 0.02 ± 0.00 N.D. 0.02 ± 0.00 10.27 ± 0.69 0.50 ± 0.05 0.66 ± 0.15
13-cis β-carotene 0.07 ± 0.02 N.D. 0.04 ± 0.01 11.82 ± 1.56 0.96 ± 0.32 2.29 ± 0.53
β-cryptoxanthin 0.03 ± 0.01 N.D. 0.01 ± 0.00 13.44 ± 1.12 1.88 ± 0.19 2.23 ± 0.55
Zeaxanthin 0.05 ± 0.01 N.D. 0.05 ± 0.00 0.67 ± 0.07 0.11 ± 0.02 0.02 ± 0.00
Total 0.89 ± 0.14 0.02 ± 0.00 0.51 ± 0.07 428.81 ± 37.99 24.44 ± 2.01 23.35 ± 5.28

4. Discussion
In the present study, five carotenoid biosynthetic genes, CmZDS, CmLCYE, CmCHXB, CmCHXE,
and CmZEP, were isolated from C. melo. Sequence analyses revealed that they shared high identity and
common features with other orthologous genes. In addition, expression levels of entire genes involved
in carotenoid biosynthetic pathways were investigated in different fruit parts of the Ohbokggul and
Gotgam cultivars, the latter of which is a native Korean variety. CmPSY, which catalyzes the first
committed and rate-limiting step in carotenoid biosynthesis [32,33], and most of the other carotenoid
biosynthetic genes were expressed at their highest levels in the stalk. However, carotenoids were
highly distributed in the peel, where tissue has direct exposure to light, suggesting the essential role
of light in carotenoid accumulation in chamoe. On the other hand, PSY is often encoded by multiple
genes which exhibit distinct expression and regulation in plants. There are two isoforms of PSY in
tomato, where PSY1 is a chromoplast-specific isoform and PSY2 is a chloroplast-specific isoform [34].
It has been suggested that there is another isoform of CmPSY which directly regulates the carotenoid
accumulation in the peel of chamoe. In addition, CmCCD1, which can cleave multiple carotenoid
substrates at various positions, showed the highest expression level in the stalk [13]. Therefore, we
hypothesize that the low content of carotenoids in the stalk of chamoe was because of the high activity
of CmCCD1 found in this part.
The expression levels of all carotenoid biosynthetic genes in Gotgam fruits were higher than those
in Ohbokggul fruits, which probably led to the abundant carotenoid accumulation in Gotgam melons
and the low carotenoid content in fruits of Ohbokggul. However, these higher expression levels of
carotenoid biosynthetic genes cannot entirely account for the substantially higher total carotenoid
content (up to 480-fold) in Gotgam peel compared to Ohbokggul peel. In addition, differences in
carotenoid biosynthesis between the Ohbokggul and Gotgam cultivars provide a basic foundation for
more detailed study of the molecular genetics of C. melo.

5. Conclusions
In conclusion, differences in the expression levels of carotenoid biosynthetic genes and carotenoid
content between the cultivar Ohbokggul chamoe and the native Korean cultivar Gotgam chamoe
were observed. These findings will contribute to a foundation for the elucidation of carotenoid
biosynthesis in C. melo, an important commercial crop. In addition, further investigations regarding
molecular genetics and enzyme activities may help to identify key genes for improving the carotenoid
accumulation in C. melo.

Supplementary Materials: The following are available online at http://www.mdpi.com/2304-8158/8/2/77/s1,

Figure S1: Multiple alignments of the amino acid sequences of CmZDS with other ZDSs. Figure S2: Multiple
alignments of the amino acid sequences of CmLCYE with other LCYEs. Figure S3: Multiple alignments of the
amino acid sequences of CmCHXB with other CHXBs. Figure S4: Multiple alignments of the amino acid sequences
Foods 2019, 8, 77 8 of 9

of CmCHXE with other CHXEs. Figure S5: Multiple alignments of the amino acid sequences of CmZEP with
other ZEPs.
Author Contributions: S.U.P. and H.K. designed the experiments and analyzed the data. P.A.T., J.L., C.H.P., J.K.K.,
Y.-H.N., and Y.B.K. performed the experiments and analyzed the data. P.A.T. and J.L. wrote the manuscript. All
authors read and approved the final manuscript.
Funding: This work was financially supported by a grant from the Korea Research Institute of Bioscience and
Biotechnology research initiative program.
Conflicts of Interest: The authors declare no conflict of interest.

References
1. Maynard, D.N.; Hochmuth, G.J. Knott’s Handbook for Vegetable Growers, 5th ed.; John Wiley & Sons: Hoboken,
NJ, USA, 1980; pp. 1–621.
2. Vouldoukis, I.; Lacan, D.; Kamate, C.; Coste, P.; Calenda, A.; Mazier, D.; Conti, M.; Dugas, B. Antioxidant
and anti-inflammatory properties of a Cucumis melo LC. extract rich in superoxide dismutase activity.
J. Ethnopharmacol. 2004, 94, 67–75. [CrossRef] [PubMed]
3. Ismail, H.I.; Chan, K.W.; Mariod, A.A.; Ismail, M. Phenolic content and antioxidant activity of cantaloupe
(Cucumis melo) methanolic extracts. Food Chem. 2010, 119, 643–647. [CrossRef]
4. Choi, Y.-J.; Chun, H.; Choi, Y.; Yum, S.; Lee, S.; Kim, H.; Shin, Y.-S.; Chung, D.-S. Nutritional components
content of oriental melon fruits cultivated under different greenhouse covering films. J. Bio-Environ. Control
2007, 16, 67–75.
5. Shin, Y.-S.; Lee, J.-E.; Yeon, I.-K.; Do, H.-W.; Cheung, J.-D.; Kang, C.-K.; Choi, S.-Y.; Youn, S.-J.; Cho, J.-G.;
Kwoen, D.-J. Antioxidant Effects and Tyrosinase Inhibition Activity of Oriental Melon (Cucumis melo L. var
makuwa Makino) Extracts. J. Life Sci. 2008, 18, 963–967. [CrossRef]
6. Kim, J.-H.; Suh, J.-K.; Kang, Y.-H. Anticancer effects of the extracts of oriental melon (Cucumis melo L. var
makuwa Makino) seeds. Korean J. Plant Res. 2012, 25, 647–651. [CrossRef]
7. Britton, G. Overview of carotenoid biosynthesis. Carotenoids 1998, 3, 13–147.
8. Frank, H.A.; Cogdell, R.J. Carotenoids in photosynthesis. Photochem. Photobiol. 1996, 63, 257–264. [CrossRef]
[PubMed]
9. Calzarano, F.; Osti, F.; Baranek, M.; Di Marco, S. Rainfall and temperature influence expression of foliar
symptoms of grapevine leaf stripe disease (esca complex) in vineyards. Phytopathologia Mediterranea 2018, 57,
488–505.
10. Kyriacou, M.C.; Rouphael, Y. Towards a new definition of quality for fresh fruits and vegetables. Sci. Horticult.
2018, 234, 463–469. [CrossRef]
11. Havaux, M. Carotenoids as membrane stabilizers in chloroplasts. Trends Plant Sci. 1998, 3, 147–151. [CrossRef]
12. Ledford, H.K.; Niyogi, K.K. Singlet oxygen and photo-oxidative stress management in plants and algae.
Plant Cell Environ. 2005, 28, 1037–1045. [CrossRef]
13. Auldridge, M.E.; McCarty, D.R.; Klee, H.J. Plant carotenoid cleavage oxygenases and their apocarotenoid
products. Curr. Opin. Plant Biol. 2006, 9, 315–321. [CrossRef] [PubMed]
14. Ziegler, R.G. Vegetables, fruits, and carotenoids and the risk of cancer. Am. J. Clin. Nutr. 1991, 53, 251S–259S.
[CrossRef] [PubMed]
15. Gaziano, J.M.; Hennekens, C.H. The role of beta-carotene in the prevention of cardiovascular disease.
Ann. N. Y. Acad. Sci. 1993, 691, 148–155. [CrossRef] [PubMed]
16. Mayne, S.T. Beta-carotene, carotenoids, and disease prevention in humans. FASEB J. 1996, 10, 690–701.
[CrossRef] [PubMed]
17. Giovannucci, E. Tomatoes, tomato-based products, lycopene, and cancer: Review of the epidemiologic
literature. J. Natl. Cancer Inst. 1999, 91, 317–331. [CrossRef] [PubMed]
18. Fraser, P.D.; Bramley, P.M. The biosynthesis and nutritional uses of carotenoids. Prog. Lipid Res. 2004, 43,
228–265. [CrossRef]
19. Mactier, H.; Weaver, L. Vitamin A and preterm infants: What we know, what we don’t know, and what we
need to know. Arch. Dis. Child. Fetal Neonatal Ed. 2005, 90, F103–F108. [CrossRef]
20. Villamor, E.; Fawzi, W.W. Vitamin A supplementation: Implications for morbidity and mortality in children.
J. Infect. Dis. 2000, 182, S122–S133. [CrossRef]
Foods 2019, 8, 77 9 of 9

21. Thorne-Lyman, A.; Fawzi, W.W. Vitamin D during pregnancy and maternal, neonatal and infant health
outcomes: A systematic review and meta-analysis. Paediatr. Perinat. Epidemiol. 2012, 26, 75–90. [CrossRef]
22. Cunningham, F., Jr.; Gantt, E. Genes and enzymes of carotenoid biosynthesis in plants. Annu. Rev. Plant Biol.
1998, 49, 557–583. [CrossRef] [PubMed]
23. Schwartz, S.H.; Tan, B.C.; Gage, D.A.; Zeevaart, J.A.; McCarty, D.R. Specific oxidative cleavage of carotenoids
by VP14 of maize. Science 1997, 276, 1872–1874. [CrossRef] [PubMed]
24. Park, C.H.; Chae, S.C.; Park, S.-Y.; Kim, J.K.; Kim, Y.J.; Chung, S.O.; Arasu, M.V.; Al-Dhabi, N.A.; Park, S.U.
Anthocyanin and carotenoid contents in different cultivars of chrysanthemum (Dendranthema grandiflorum
Ramat.) flower. Molecules 2015, 20, 11090–11102. [CrossRef] [PubMed]
25. Zhu, Y.-H.; Jiang, J.-G.; Yan, Y.; Chen, X.-W. Isolation and characterization of phytoene desaturase cDNA
involved in the β-carotene biosynthetic pathway in Dunaliella salina. J. Agric. Food Chem. 2005, 53, 5593–5597.
[CrossRef] [PubMed]
26. Yan, P.; Gao, X.; Shen, W.; Zhou, P. Cloning and expression analysis of phytoene desaturase and ζ-carotene
desaturase genes in Carica papaya. Mol. Biol. Rep. 2011, 38, 785–791. [CrossRef] [PubMed]
27. Rossmann, M.G.; Moras, D.; Olsen, K.W. Chemical and biological evolution of a nucleotide-binding protein.
Nature 1974, 250, 194–199. [CrossRef]
28. Borchetia, S.; Bora, C.; Gohain, B.; Bhagawati, P.; Agarwala, N.; Bhattacharya, N.; Bharalee, R.;
Bhorali, P.; Bandyopadhyay, T.; Gupta, S. Cloning and heterologous expression of a gene encoding
lycopene-epsilon-cyclase, a precursor of lutein in tea (Camellia sinensis var assamica). Afr. J. Biotechnol. 2011,
10, 5934–5939.
29. Bouvier, F.; Keller, Y.; d’Harlingue, A.; Camara, B. Xanthophyll biosynthesis: Molecular and functional
characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L.). Biochim. Biophys. Acta
1998, 1391, 320–328. [CrossRef]
30. Hieber, A.D.; Bugos, R.C.; Yamamoto, H.Y. Plant lipocalins: Violaxanthin de-epoxidase and zeaxanthin
epoxidase. Biochim. Biophys. Acta 2000, 1482, 84–91. [CrossRef]
31. Durocher, D.; Jackson, S.P. The FHA domain. FEBS Lett. 2002, 513, 58–66. [CrossRef]
32. Rodríguez-Villalón, A.; Gas, E.; Rodríguez-Concepción, M. Phytoene synthase activity controls the
biosynthesis of carotenoids and the supply of their metabolic precursors in dark-grown Arabidopsis
seedlings. Plant J. 2009, 60, 424–435. [CrossRef] [PubMed]
33. Toledo-Ortiz, G.; Huq, E.; Rodríguez-Concepción, M. Direct regulation of phytoene synthase gene expression
and carotenoid biosynthesis by phytochrome-interacting factors. Proc. Natl. Acad. Sci. USA 2010, 107,
11626–11631. [CrossRef] [PubMed]
34. Fraser, P.; Kiano, J.; Truesdale, M.; Schuch, W.; Bramley, P. Phytoene synthase-2 enzyme activity in tomato
does not contribute to carotenoid synthesis in ripening fruit. Plant Mol. Biol. 1999, 40, 687–698. [CrossRef]
[PubMed]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).