www.nature.

com/scientificreports

OPEN Epigenetic regulation of the

nuclear-coded GCAT and
SHMT2 genes confers human
received: 29 October 2014
accepted: 14 April 2015
Published: 22 May 2015
age-associated mitochondrial
respiration defects
Osamu Hashizume1,*, Sakiko Ohnishi1,*, Takayuki Mito1,*, Akinori Shimizu1, Kaori Ishikawa1,
Kazuto Nakada1,2, Manabu Soda3, Hiroyuki Mano3, Sumie Togayachi4, Hiroyuki Miyoshi4,5,
Keisuke Okita6 & Jun-Ichi Hayashi1,2,7

Age-associated accumulation of somatic mutations in mitochondrial DNA (mtDNA) has been

proposed to be responsible for the age-associated mitochondrial respiration defects found in
elderly human subjects. We carried out reprogramming of human fibroblast lines derived from
elderly subjects by generating their induced pluripotent stem cells (iPSCs), and examined another
possibility, namely that these aging phenotypes are controlled not by mutations but by epigenetic
regulation. Here, we show that reprogramming of elderly fibroblasts restores age-associated
mitochondrial respiration defects, indicating that these aging phenotypes are reversible and are
similar to differentiation phenotypes in that both are controlled by epigenetic regulation, not by
mutations in either the nuclear or the mitochondrial genome. Microarray screening revealed that
epigenetic downregulation of the nuclear-coded GCAT gene, which is involved in glycine production
in mitochondria, is partly responsible for these aging phenotypes. Treatment of elderly fibroblasts
with glycine effectively prevented the expression of these aging phenotypes.

The mitochondrial theory of aging proposes that age-associated overproduction of reactive oxygen spe-
cies (ROS) and the resultant accumulation of somatic mutations in mtDNA are responsible for aging
phenotypes including age-associated mitochondrial respiration defects1–5. This concept is supported par-
tially by subsequent findings that mtDNA mutator mice expressing a proofreading-deficient mtDNA
polymerase show accelerated accumulation of somatic mutations in mtDNA, resulting in the expres-
sion of mitochondrial respiration defects and premature aging phenotypes6–8. In contrasts, our previ-
ous studies proposed that the age-associated respiration defects found in human fibroblasts are caused

1
Faculty of Life and Environmental Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8572,
Japan. 2International Institute for Integrative Sleep Medicine (WPI-IIIS), University of Tsukuba, 1-1-1 Tennodai,
Tsukuba, Ibaraki 305-8572, Japan. 3Department of Cellular Signaling, Graduate School of Medicine, University
of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan. 4Subteam for Manipulation of Cell Fate, BioResource
Center, RIKEN Tsukuba Institute, 3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan. 5Department of Physiology,
Keio University School of Medicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan. 6Center for iPS Cell
Research and Application, Kyoto University, Kawahara-cho 53, Shogoin, Sakyo-ku, Kyoto, 606-8507 Japan. 7TARA
Center, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8572, Japan. *These authors contributed
equally to this work. Correspondence and requests for materials should be addressed to J.-I.H. (email: jih45@
biol.tsukuba.ac.jp)

Scientific Reports | 5:10434 | DOI: 10.1038/srep10434 1

www.nature.com/scientificreports/

Figure 1.  Examination of the mitochondrial theory of aging by using human fibroblast lines derived from
young and elderly subjects. The ‘young’ group included fibroblast lines TIG3S (fetus), TIG121 (age 8 months
[8mo]), TIG120 (6 years [6y]), and TIG118 (12 years [12y]). The ‘elderly’ group included fibroblast lines
TIG106 (80 years [80y]), TIG107 (81 years [81y]), TIG101 (86 years [86y]), and TIG102 (97 years [97y]).
(a) Comparison of mitochondrial respiratory function between young and elderly groups by estimation of
O2 consumption rates. ‘Average’ indicates the average O2 consumption rates of each group. (b) Comparison
of amounts of mitochondrial ROS (superoxide) between young and elderly groups by estimation of
mitochondrial superoxide levels. Relative superoxide levels are expressed as mean fluorescence intensity of
MitoSox-Red. ‘Average’ indicates the average fluorescence intensity of each group. Experiments in (a) and (b)
were performed in triplicate; error bars, ± SD. *P <  0.05. Black and open bars represent young and elderly
groups, respectively. (c) Comparison of mutation frequencies in mtDNA populations from young and elderly
groups by using deep sequence analysis. Upper, middle, and lower panels represent frequencies of total,
rare, and frequent mutations, respectively. Rare mutations existing in less than 1% mtDNA correspond to
somatic mutations, whereas frequent mutations existing in 1% or more of mtDNA correspond to inherited
mutations. Black and open circles represent young and elderly groups, respectively.

not by mtDNA mutations9–11 but by nuclear-recessive mutations11. However, these findings can also
be explained by assuming the involvement of epigenetic regulation of nuclear genes in the absence of
nuclear-recessive mutations. Here, we addressed these controversial issues by reprogramming fibroblasts
derived from elderly human subjects and examining whether age-associated mitochondrial respiration
defects could be restored after the reprogramming.

Results
Characterization of human fibroblast lines.  We used eight human fibroblast lines—four from
young and four from elderly subjects—to examine the mitochondrial theory of aging. First, we examined
mitochondrial respiratory function by estimating O2 consumption rates; we confirmed the presence of
age-associated respiration defects in human fibroblast lines (Fig.  1a). However, the lines did not show
age-associated increases in the production of superoxide (mitochondrial ROS) (Fig.  1b). Moreover, no

Scientific Reports | 5:10434 | DOI: 10.1038/srep10434 2

www.nature.com/scientificreports/

decreases in mtDNA copy number (Supplementary Fig. 1a) or abnormalities in mitochondrial morphol-
ogy (Supplementary Fig. 1b) were observed in the elderly fibroblasts.
We then quantitatively estimated the mutation frequency at each nucleotide position of mtDNA by
deep sequence analysis of whole mtDNA prepared from the eight lines (Supplementary Fig. 2). The
results unexpectedly showed that the total frequency of mtDNA mutations did not differ substantially
between fibroblast lines from young and elderly subjects (Fig. 1c). Moreover, the frequency of rare muta-
tions (existing in less than 1% of mtDNA), which have been proposed to be somatic mutations12, was not
significantly greater in the fibroblast lines from elderly subjects than in those from young ones (Fig. 1c).
The frequency of mutations existing in 1% or more of mtDNA, which have been proposed to be inherited
mtDNA mutations12, also did not differ substantially between fibroblast lines from the young and elderly
(Fig.  1c and Supplementary Table 1). Because we observed no age-associated overproduction of mito-
chondrial ROS and no age-associated accumulation of somatic mutations in the mtDNA of the human
fibroblast lines we used (Fig. 1b and c), neither was associated with the mitochondrial respiration defects
found in the fibroblast lines derived from the elderly subjects (Fig. 1a).

Effects of redifferentiation of reprogrammed fibroblasts on respiration defects.  Our previ-

ous report11 proposed that nuclear-recessive mutations are responsible for age-associated mitochondrial
respiration defects in human fibroblast lines, because the respiration defects were restored by the intro-
duction of pure nuclei (uncontaminated by mtDNA) from mtDNA-less HeLa cells into the fibroblasts.
However, our previous results could also have been explained by epigenetic regulation of nuclear genes
in the absence of nuclear-recessive mutations. In the case of epigenetic regulation, expression of mito-
chondrial respiration defects would be reversible and restorable with reprogramming.
To examine this possibility, we randomly chose two young fibroblast lines (TIG3S and TIG121) and
two elderly fibroblast lines (TIG107 and TIG102) and used them to generate human induced pluripotent
stem cells (hiPSCs). These cells were then redifferentiated into fibroblasts and their mitochondrial res-
piratory function examined. For effective generation of hiPSCs from elderly human fibroblast lines, the
conventional reprogramming gene set OCT3/4, SOX2, KLF4, and C-MYC required to isolate hiPSCs13
was replaced by the gene set OCT3/4, SOX2, KLF4, L-MYC, LIN28, and p53shRNA14. Moreover, virus
vectors were replaced by episomal plasmids for transient introduction of the gene set into fibroblasts14.
Small colonies with flat embryonic-stem-cell-like morphology (Supplementary Fig. 3a) were picked up
about 4 weeks after transfection with the gene set. All the colonies expressed pluripotency marker genes
of reprogrammed cells15, such as Nanog, TRA-1-60 and SSEA4 (Supplementary Fig. 3b), indicating that
these colonies were hiPSCs. The cells were subsequently cultured in the absence of the feeder cells to
allow their redifferentiation into fibroblasts16. The resultant growing cells were confirmed to be fibroblasts
by their immunostaining with antibody to the beta subunit of prolyl 4-hydroxylase (Fig. 2a), which is a
specific marker for fibroblasts16.
Next, we examined the O2 consumption rates of fibroblast lines redifferentiated from hiPSCs. The O2
consumption rates of redifferentiated fibroblast lines R107 and R102 were significantly greater than those
in the original lines TIG107 and TIG102, respectively. Moreover, all of the fibroblast lines redifferentiated
from hiPSCs had O2 consumption rates comparable to those of the fetal fibroblast line TIG3S, irrespec-
tive of whether they were derived from young or elderly subjects (Fig.  2b). Thus, the results in Fig.  2b
reflect the reversibility of expression of age-associated mitochondrial respiration defects, indicating that
these aging phenotypes are controlled by epigenetic regulation, not by mutations.

Screening for nuclear genes regulating age-associated mitochondrial respiration defects.  To

identify nuclear-coded genes that were controlled epigenetically and could be responsible for age-associated
mitochondrial respiration defects (Fig. 1a), we performed a microarray analysis and compared the gene
expression spectra of the two young (TIG3S and TIG121) and two elderly (TIG107 and TIG102) fibro-
blast lines that had been used to isolate the hiPSCs (all microarray data were deposited at NCBI GEO
database and received accession number GSE67000). Because our focus here was age-associated respi-
ration defects, which are considered to be caused by a reduction in mitochondrial translation10,11, genes
were selected by using the gene ontology (GO) term ‘mitochondria’ followed by four GO terms related
to translation and respiration (Supplementary Fig. 4a). As a result, we selected 371 genes from among
the 27,958 nuclear-coded genes used for the microarray analysis. From among these 371 genes, we fur-
thermore selected six genes that showed age-associated regulation in the two sets of fibroblast lines with
a log2 ratio of signal intensities of > 0.585 or < –0.585, corresponding respectively to > 1.5-fold upregu-
lation or downregulation (Supplementary Fig. 4b).
To confirm the microarray results, we performed real-time quantitative PCR to estimate the mRNA
levels of the six genes. Comparison of their mRNA levels between the four lines from young subjects
and the four lines from elderly subjects showed that MRPL28 and GCAT were downregulated, whereas
EHHADH was upregulated, in elderly fibroblast lines (Fig.  3a, Supplementary Fig. 5). In contrast, the
remaining three genes showed no significant differences in age-associated regulation.
Because age-associated respiration defects were restored after reprogramming (Fig. 2b), we expected
that the reprogramming of elderly fibroblasts would result in the reprogramming of age-associated
down- or upregulation of the three genes. We examined this possibility by using redifferentiated fibro-
blasts from hiPSCs. Reprogramming of gene expression in elderly fibroblasts occurred in GCAT (Fig. 3b),

Scientific Reports | 5:10434 | DOI: 10.1038/srep10434 3

www.nature.com/scientificreports/

Figure 2.  Effects of reprogramming of fibroblasts on age-associated mitochondrial respiration defects.

(a) Immunostaining of original fibroblasts and fibroblasts redifferentiated from hiPSCs (reprogrammed
fibroblasts) with antibody to a fibroblast-specific marker enzyme, namely the beta subunit of prolyl
4-hydroxylase. R3S, R121, R107, and R102 represent fibroblasts reprogrammed from the original fibroblasts
TIG3S, TIG121, TIG107, and TIG102, respectively. Bars, 100 μ m. (b) Estimation of O2 consumption rates
of original and reprogrammed fibroblasts. Black and open bars are original fibroblasts from young and
elderly subjects, respectively. Gray bars represent reprogrammed fibroblasts. Experiments were performed in
triplicate; error bars indicate ± SD. *P <  0.05.

which regulates glycine production in mitochondria17,18. It was therefore likely that reduced glycine pro-
duction in mitochondria by epigenetic downregulation of GCAT (Fig. 3a) resulted in the age-associated
respiration defects (Fig. 1a).

Effects of down- or upregulation of the genes regulating age-associated respiration

defects.  We then examined whether downregulation of GCAT in TIG3S (from a fetus) would induce
respiration defects, and whether the gene’s upregulation in TIG102 (from an elderly subject) would
restore reduced mitochondrial respiratory function. Downregulation of GCAT in TIG3S by using shRNA
led to a reduction in mitochondrial respiratory function (Fig.  4a). Moreover, overexpression of GCAT
in TIG102 by infection with lentivirus including the cDNA of GCAT restored the respiration defects
(Fig. 4a). These observations suggest that epigenetic downregulation of GCAT with aging is responsible,
at least in part, for age-associated respiration defects.
Because glycine production in mitochondria is regulated by SHMT217 as well as by GCAT18, downreg-
ulation of SHMT2 with aging may also be involved in age-associated respiration defects. To examine this
possibility we used real-time quantitative PCR and compared the mRNA levels of SHMT2 in the eight
lines from young and elderly subjects. We found age-associated downregulation of SHMT2 (Fig.  4b),
even though our microarray results had not revealed its age-associated downregulation (Supplementary
Fig. 3b). Moreover, reprogramming of fibroblast lines from aged subjects restored the reduced expression

Scientific Reports | 5:10434 | DOI: 10.1038/srep10434 4

www.nature.com/scientificreports/

Figure 3.  Use of real-time quantitative PCR to identify nuclear-coded genes regulating age-associated
mitochondrial respiration defects. (a) Comparison of mRNA levels of the candidate six genes in the
young and elderly groups. The six gene candidates for regulation of age-associated respiration defects were
selected by using gene ontology terms and a microarray heatmap (Supplementary Fig. 4b). Black and open
bars are the average gene expression levels of fibroblasts from young and elderly groups, respectively. The
young group consisted of fibroblast lines TIG3S (fetus), TIG121 (age 8 months), TIG120 (6 years), and
TIG118 (12 years). The elderly group consisted of lines TIG106 (80 years), TIG107 (81 years), TIG101 (86
years), and TIG102 (97 years). Levels of transcripts were normalized against UBC expression. The results
of each fibroblast line were shown in the Supplemental Figure 5. Of the six genes examined, age-associate
regulation was confirmed to be present in MRPL28, EHHADH, and GCAT. (b) Comparison of mRNA
levels of MRPL28, EHHADH, and GCAT in original and reprogrammed fibroblasts. R3S, R121, R107,
and R102 represent fibroblasts reprogrammed from the original fibroblasts TIG3S, TIG121, TIG107, and
TIG102, respectively. Levels of transcripts were normalized against UBC expression. Black and open bars
are fibroblasts from young and elderly subjects, respectively. Gray bars represent reprogrammed fibroblasts.
Experiments were performed in triplicate; error bars indicate ± SD. *P <  0.05.

Scientific Reports | 5:10434 | DOI: 10.1038/srep10434 5

www.nature.com/scientificreports/

Figure 4.  Effects on respiratory function of down- or upregulation of the genes regulating age-associated
respiration defects. (a) Down- and upregulation of GCAT and their effects on respiratory function. Control,
untreated; scramble, scrambled shRNA treated; shGCAT, downregulation of GCAT in fibroblast line TIG3S
by using shRNA; tgGCAT, upregulation of GCAT in line TIG102 by using its cDNA-based transgene. Upper
panel, mRNA levels; lower panel, O2 consumption rates. Black and open bars represent TIG3S and TIG102,
respectively. (b) Comparison of mRNA levels of SHMT2 in young and elderly groups (left panel) and in
original and reprogrammed fibroblasts (right panel). Black and open bars are young and elderly groups,
respectively. ‘Average’ in the left panel indicates the average gene expression levels of each group. R3S, R121,
R107 and R102 (gray bars) in the right panel represent fibroblasts reprogrammed from TIG3S, TIG121,
TIG107, and TIG102, respectively. (c) Downregulation of SHMT2 or both GCAT and SHMT2, and their
effects on respiratory function in TIG3S. Control, untreated; scramble, scrambled-siRNA-treated; siSHMT2,
downregulation of SHMT2 by siRNA; shGCAT +  siSHMT2, simultaneous downregulation of GCAT and
SHMT2 by shRNA and siRNA, respectively. Upper panel, mRNA levels; lower panel, O2 consumption rates.
Black bars represent TIG3S. Experiments were performed in triplicate; error bars indicate ± SD. *P <  0.05.

Scientific Reports | 5:10434 | DOI: 10.1038/srep10434 6

www.nature.com/scientificreports/

of SHMT2 (Fig.  4b). Furthermore, downregulation of SHMT2 in the TIG3S fibroblast line by using
siRNA resulted in a reduction in respiratory function (Fig.  4c), and simultaneous downregulation of
GCAT by using shRNA and of SHMT2 by using siRNA had a synergic effect in reducing mitochon-
drial respiratory function (Fig. 4c). These observations indicated that epigenetic downregulation of both
GCAT and SHMT2 with aging (Fig. 3a) was at least partly responsible for the age-associated respiration
defects found in elderly fibroblasts (Fig. 1a) by inducing a decrease in glycine production and a resultant
decrease in mitochondrial translation. This possibility was supported by our observations that adding
glycine to the medium for 10 days restored the reduced respiratory function of TIG102 (Supplementary
Fig. 6), suggesting that glycine treatment can effectively prevent elderly fibroblasts from expressing
age-associated respiration defects.

Discussion
We reprogrammed human fibroblast lines by generating iPSCs, and showed that the reprogramming
of fibroblasts derived from elderly subjects restored age-associated respiration defects. Therefore, these
age-associated phenotypes found in elderly fibroblasts are regulated reversibly and are similar to differen-
tiation phenotypes in that both are controlled by epigenetic regulation, not by mutations in either nuclear
or mtDNA. Given that human aging can be seen as a consequence of a programmed phenomenon, it
is possible that epigenetic regulation also controls human aging. However, further studies are required
to generalize the concept that human aging and age-associated disorders—in the same way as the res-
piration defects found in elderly fibroblasts—are expressed under the control of epigenetic regulation.
We also showed that age-associated mitochondrial respiration defects (Fig. 1a) were expressed in the
absence of either ROS overproduction in the mitochondria (Fig.  1b) or the accumulation of somatic
mutations in mtDNA (Fig. 1c). One explanation for the absence of an age-associated increase in somatic
mutations in mtDNA (Fig.  1c) is the presence of a dynamic balance between the creation and seg-
regation of somatic mutations in mtDNA during repeated cell division. This absence could also be a
consequence of the preferential growth of cells possessing mtDNA without somatic mutations during
repeated division of the primary fibroblasts obtained by biopsy. Here, however, our focus was on the
causes of respiration defects expressed in elderly human fibroblast lines (Fig. 1a), and respiration defects
were still expressed even after repeated divisions of cells from the primary biopsy samples. It is therefore
likely that these age-associated respiration defects are caused neither by ROS overproduction nor by the
accumulation of somatic mutations in mtDNA. Furthermore, even when somatic mutations accumulate
in the mtDNA, consequent mitochondrial respiration defects would still be prevented by the exchange of
genetic products throughout the mitochondria within a cell19–22. The question that then arises is: What
causes age-associated mitochondrial respiration defects by epigenetic regulation?
Our findings revealed that epigenetic downregulation of nuclear-coded genes, including GCAT and
SHMT2, which regulate glycine production in mitochondria17,18, results in respiration defects. Our pre-
vious studies showed that the age-associated respiration defects in elderly fibroblasts10 are likely due in
part to reduced translation activity in the mitochondria, but not in the cytoplasm11. Therefore, defects
in glycine metabolism in the mitochondria as a result of a reduction in SHMT2 and GCAT expression
would be partly responsible for the reduction in mitochondrial translation, resulting in the expression of
age-associated respiration defects. Because continuous glycine treatment restored respiration defects in
elderly human fibroblasts (Supplementary Fig. 6), glycine supplementation may be effective in preventing
age-associated respiration defects and thus benefiting the health of elderly human subjects. To confirm
this hypothesis model mice deficient in GCAT or SHMT2, or both, would need to be generated to exam-
ine whether they expressed respiration defects and premature aging phenotypes and, if so, whether these
disorders could be prevented by continuous glycine administration.
Recently, abnormalities of autophagy were proposed to be involved in the dysfunction of organelles,
including mitochondria23. We showed that no genes were selected from our microarray analysis by using
the GO terms, aging and autophagy (Supplementary Fig. 4a), and that no morphological abnormalities
developed in the mitochondria of elderly fibroblasts (Supplementary Fig 1b). However, further work is
required to examine whether age-associated abnormalities of autophagy in the mitochondria are in fact
involved in the expression of age-associated respiration defects and are under the control of epigenetic
regulation.

Methods
Cells and cell culture.  TIG3S, TIG101, TIG102, TIG106, TIG107, TIG118, TIG120, and TIG121 are
human diploid fibroblast lines. TIG3S, TIG101, TIG102, TIG107, TIG120, and TIG121 were purchased
from the Japanese Collection of Research Bioresources (Tokyo, Japan), and TIG106 and TIG118 were
obtained from the Tokyo Metropolitan Institute of Gerontology (Tokyo, Japan). Fibroblasts were grown
in Minimum Essential Medium (MEM; Gibco, USA) containing 10% fetal bovine serum (SIGMA, USA)
and 1% penicillin/streptomycin (Gibco).

Measurement of O2 consumption rates.  Oxygen consumption rates of fibroblasts were estimated

in 2 ml PBS by using a YSI model 5331 Clark-type oxygen probe (YSI Incorporated, USA) and Monitor
(YSI Model 5300). The reaction chambers were placed in a YSI Model 5301 standard bath assembly and
were maintained at 37 °C by water circulation in the bath. PBS was placed in the reaction chambers and

Scientific Reports | 5:10434 | DOI: 10.1038/srep10434 7

www.nature.com/scientificreports/

the probe was calibrated with PBS before the experiment. The O2 consumption rate was calculated as
the rate of decrease in O2 concentration following the addition of 106 fibroblast cells; it was expressed
as % O2 consumed per second and then finally normalized by cell volumes. Cell volumes V (mm3) were
calculated by using the formula for the volume of a sphere,

V = 4 / 3πr 3
and cell radius r were measured with Image J (NIH Image, USA).

Measurement of mitochondrial ROS.  Generation of mitochondrial ROS (superoxide) was quan-

titatively estimated by using the mitochondrial superoxide indicator MitoSOX-Red (Invitrogen, USA).
Cells were mildly trypsinized and then suspended at a density of 1 ×  105 cells/ml in PBS. Next, they were
incubated with 5 μ M MitoSOX-Red for 15 min at 37 °C in PBS. They were then washed twice with PBS
and immediately analyzed with a FACScan flow cytometer (Becton Dickinson, USA). Data were analyzed
with FlowJo software (Tree Star, USA).

Deep sequence analysis of mtDNA.  Total cellular DNA (500 ng) extracted from fibroblasts by using
a Puregene Core Kit A (Qiagen, USA) was used as template for each PCR reaction. Amplicons gener-
ated with eight sets of primers were produced with Takara PrimeSTAR HS DNA polymerase (Takara
Bio, Japan) in a reaction volume of 50 μ l containing 2.5 mM dNTP mixture, 0.3 μ M forward primer,
0.3 μ M reverse primer, and PrimeSTAR HS DNA polymerase. The sequences of the primers are shown
in Supplementary Table 2. The cycling conditions used were as follows: 1 cycle of 98 °C for 1 min; then 16
cycles of 98 °C for 10 s, 55 °C for 15 s, and 72 °C for 3 min. PCR amplicons were purified with a QIAquick
PCR purification kit (Qiagen). Purified DNA was subjected to deep sequencing with a Genome Analyzer
IIx (Illumina, USA). Sequencing reads were assembled and compared with the reference sequences
(GenBank accession no. AB055387).

Imaging of mitochondria.  Fibroblasts were treated for 30 min at 37 °C with 100 nM Mitotracker
Red (Molecular Probes, USA), in accordance with the manufacturer’s instructions, for specific staining
of mitochondria in the culture medium. Cells were then fixed with paraformaldehyde for 10 min and
stained with 4’,6-diamidino-2-phenylindole, dihydrochloride for nuclear counterstaining. Mitochondrial
morphology was analyzed by confocal microscopy (LSM700; Carl Zeiss Microscopy, Germany).

Measurement of mtDNA copy number.  Total mtDNA content was estimated by a real-time PCR tech-
nique using a Quantitect Cyber Green Kit (Qiagen) and an ABI PRISM 7900HT sequence detection system
(Applied Biosystems, USA). To compare the total mtDNA content, nuclear gene glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) was measured as an internal control. The primer set specific for mtDNA was
5′ -TACATTACTGCCAGCCACCA-3′  and 5′ -GTGGCTTTGGAGTTGCAGTT-3′ . The primer set spe-
cific for GAPDH was 5′ -TACAGGGGTGATGTGGGGAG-3′  and 5′ -AGTGATGGCATGGACTGTGG-3′ .

hiPSC generation and redifferentiation.  hiPSCs were generated by using episomal vectors, as
described previously14. Briefly, human diploid fibroblasts cultivated in DMEM supplemented with 10%
FBS were transfected with episomal plasmids including the reprogramming gene set (OCT3/4, SOX2,
KLF4, L-MYC, LIN28, and p53shRNA) by using a Neon electroporation system (Life Technologies,
USA). After 7 days, the transfected cells were harvested, plated onto 10-cm dishes covered with
mitomycin-C-treated mouse embryonic fibroblasts or SNL feeder cells, and then cultured in primate ES
cell medium (Gibco) supplemented with 4 ng/ml basic fibroblast growth factor (PEPRO TECH, USA) as
described previously13. About 4 weeks after the transfection, ES-like cells were collected and expanded
on SNL feeder cells for further analysis. For redifferentiation of the hiPSCs into fibroblasts, hiPSCs were
induced to form embryoid bodies by culture on gelatin-coated plates. After five passages, most of the
cells had a fibroblast-like morphology and were designated as redifferentiated fibroblasts.

Immunocytochemistry.  Immunocytochemistry was performed as described previously13. The

primary antibodies used were P4HB (Acris Antibodies, USA), SSEA-4 (Millipore, USA), TRA-1-
60 (Millipore, USA), and Nanog (Reprocell, Japan). Secondary antibodies were GFP anti-rabbit IgG
(Molecular Probes, USA) to detect P4HB, Alexa Fluor 594 anti-mouse IgG (Molecular Probes) to detect
SSEA-4 and TRA-1-60, and Alexa Fluor 488 anti-rabbit IgG (Molecular Probes) to detect Nanog.

Microarray and data analysis.  Microarray experiments were performed with an Agilent Expression
Array Whole Human Genome Oligo DNA microarray (Agilent Technologies, USA) at the Takara-Bio
Corporation (Shiga, Japan), with the microarray service certificated by Agilent Technologies. Total RNA
was extracted from each fibroblast line in accordance with the manufacturer’s protocol. Treatment with
DNase I was conducted to eliminate genomic DNA contamination. The quality of the extracted RNA
was assessed with a BioAnalyzer 2100 system (Agilent Technologies). The RNA was then Cy3-labeled by
using a Low Input Quick Amp Labeling Kit (Agilent Technologies). Labeled cRNA samples were hybrid-
ized to a SurePrint G3 Human GE 8 ×  60 K v2 Microarray (Agilent Technologies) at 65 °C for 17 h by

Scientific Reports | 5:10434 | DOI: 10.1038/srep10434 8

www.nature.com/scientificreports/

using a Gene Expression Hybridization Kit (Agilent Technologies). After hybridization, the microarrays
were washed and scanned with an Agilent microarray Scanner. Signal intensities were evaluated with
Agilent Feature Extraction software. Microarray data analysis was performed with the R software and
Bioconductor packages.

Real-time quantitative PCR.  Total RNA was extracted from human fibroblast cells by using ISOGEN
reagent (Nippon Gene, Japan). RNA samples were subjected to DNase I treatment (Invitrogen) to elim-
inate DNA contaminants and reverse transcribed by using Oligo (dT)12-18 primer, 10 mM dNTP Mix,
0.1 M DTT, RNase Out Recombinant Ribonuclease Inhibitor, and SuperScript II-Reverse Transcriptase
(Invitrogen). cDNA samples were subjected to RNase H treatment (Invitrogen), and applied to the
real-time PCR reaction. Real-time monitoring PCR was performed with SYBR Green PCR Master Mix
(Qiagen) and an ABI PRISM 7900HT sequence detection system (Applied Biosystems). The relative
mRNA expression was quantified by using the comparative Δ Δ CT method. The relative expression
level of each gene was represented as a cycle threshold (CT). The normalized expression level was then
calculated as Δ CT =  CT (target gene) – CT (control gene). Differential expression was calculated as
Δ Δ CT =  Δ CT (target sample) – Δ CT (control sample). Fold change was calculated as 2–ΔΔCT. UBC was
used as an internal control. The sequences of the primers are shown in Supplementary Table 3.

Construction of lentiviral vectors.  Human GCAT cDNA was provided by the RIKEN Bio-Resource
Center (BRC) through the National Bio-Resource Project of the MEXT, Japan24–27. The GCAT cDNA was
amplified by PCR using the full-length cDNA clone IRAL03F16 (RIKEN BRC) with the following primers:
5′ -CACCATGTGGCCTGGGAACGCC-3′  (forward) and 5′ -TCAGGGCAGTGCCCCGTG-3′  (reverse).
The PCR-amplified cDNA was inserted into the pENTR/D-TOPO entry vector plasmid (Invitrogen)
and verified by DNA sequencing. The GCAT cDNA in pENTR/D-TOPO was then transferred to
the CSII-EF-RfA-IRES-Puro lentiviral vector plasmid by using the Gateway LR clonase (Invitrogen),
resulting in CSII-EF-GCAT-IRES-Puro. The shRNA sequence targeting human GCAT mRNA,
CCTTAACTTCTGTGCCAACAA, and the scrambled sequence were inserted into pENTR4-H1tetOx1
entry vector plasmid (RIKEN BRC) and then transferred to the CS-RfA-CG lentiviral vector plas-
mid by using Gateway LR clonase, resulting in CS-GCAT-shRNA-CG and CS-Scramble-shRNA-CG.
Recombinant lentiviral vector expressing GCAT cDNA or shRNA was produced by transient trans-
fection of three plasmids, pCAG-HIVgp, pCMV-VSV-G-RSV-Rev, and the lentiviral vector plasmid
(CSII-EF-GCAT-IRES-Puro or CS-GCAT-shRNA-CG or CS-Scramble-shRNA-CG), into 293 T cells.
Culture supernatant containing lentiviral vector was concentrated by ultracentrifugation (50,000 ×  g for
2 hours at 20 °C), and the viral pellet was resuspended in Hank’s balanced salt solution. The titer of
vectors was determined by infection of HeLa cells with serial dilutions of the vector stocks followed
by measurement of puromycin-resistant cells for cDNA vector and FACS analysis for GFP +  cells for
shRNA vector.

siRNAs and transfection.  Stealth RNAi oligonucleotides were used for siRNA experiments
(Invitrogen). The SHMT2 Stealth Select RNAi oligonucleotide (Target Accession No. NM_001166356)
was used for knockdown of SHMT2. The Stealth RNAi negative control Duplex (Invitrogen) was used
as a scramble oligonucleotide. The Stealth RNAi oligonucleotides were transfected into the fibroblasts by
using Lipofectamine RNAiMAX transfection reagent (Invitrogen) in accordance with the manufacturer’s
protocols (15 μ l Stealth RNAi oligonucleotide and 30 μ l Lipofectamine RNAiMAX in 10 ml MEM).

Statistical analysis.  Results are expressed as means ±  SD; probability values < 0.05 were considered
statistically significant. Statistical analysis of the data was done with the two-tailed unpaired Student’s
t-test.

References
1. Wallace, D. C. Mitochondrial diseases in man and mouse. Science 283, 1482–1488; DOI:10.1126/science.283.5407.1482 (1999).
2. Jacobs, H. T. The mitochondrial theory of aging: dead or alive ?. Aging Cell 2, 11–17; DOI:10.1046/j.1474-9728.2003.00032.x
(2003).
3. Taylor, R. W. & Turnbull, D. M. Mitochondrial DNA mutations in human disease. Nature Rev. Genet. 6, 389–402; DOI:10.1038/
nrg1606 (2005).
4. Khrapko, K. & Vija, J. Mitochondrial DNA mutations and aging: devils in the details ?. Trends Genet. 25, 91–98; DOI:10.1016/j.
tig.2008.11.007 (2008).
5. Bratic, A. & Larsson, N. G. The role of mitochondria in aging. J. Clin. Invest. 123, 951–957; DOI:10.1172/JCI64125 (2013).
6. Trifunovic, A. et al. Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature 429, 417–423;
DOI:10.1038/nature02517 (2004).
7. Kujoth, G. C. et al. Mitochondrial DNA mutations, oxidative stress, and apoptosis in mammalian aging. Science 309, 481–484;
DOI:10.1126/science.1112125 (2005).
8. Trifunovic, A. et al. Somatic mtDNA mutations cause aging phenotypes without affecting reactive oxygen species production.
Proc. Natl. Acad. Sci. USA. 102, 17993–17998; DOI:10.1073/pnas.0508886102 (2005).
9. Hayashi, J.-I. et al. Introduction of disease-related mitochondrial DNA deletions into HeLa cells lacking mitochondrial DNA
results in mitochondrial dysfunction. Proc. Natl. Acad. Sci. USA. 88, 10614–10618 (1991).
10. Hayashi, J.-I. et al. Nuclear but not mitochondrial genome involvement in human age-related mitochondrial dysfunction. J. Biol.
Chem. 269, 6878–6883 (1994).

Scientific Reports | 5:10434 | DOI: 10.1038/srep10434 9

www.nature.com/scientificreports/

11. Isobe, K. et al. Nuclear-recessive mutations of factors involved in mitochondrial translation are responsible for age-related
respiration deficiency of human skin fibroblasts. J. Biol. Chem. 273, 4601–4606; DOI:10.1074/jbc.273.8.4601 (1998).
12. Dillon, L. M. et al. Increased mitochondrial biogenesis in muscle improves aging phenotypes in the mtDNA mutator mouse.
Hum. Mol. Genet. 15, 2288–2297; DOI:10.1093/hmg/dds049 (2012).
13. Takahashi, K. et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872;
DOI:10.1016/j.cell.2007.11.019 (2007).
14. Okita, K. et al. A more efficient method to generate integration-free human iPS cells. Nat. Methods 8, 409–412; DOI:10.1038/
nmeth.1591 (2011).
15. Nakagawa, M. et al. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat.
Biotechnol. 26, 101–106; DOI:10.1038/nbt1374 (2008).
16. Xu, C. et al. Immortalized fibroblast-like cells derived from human embryonic stem cells support undifferentiated cell growth.
Stem Cells 22, 972–980; DOI:10.1634/stemcells.22-6-972 (2004).
17. Locasale, J. W. Serine, glycine and one-carbon units: cancer metabolism in full circle. Nat. Rev. Cancer 13, 572–583; DOI:10.1038/
nrc3557 (2013).
18. Edgar, A. J. & Polak, J. M. Molecular cloning of the human and murine 2-amino-3-ketobutyrate coenzyme A ligase cDNAs. Eur.
J. Biochem. 267, 1805–1812; DOI:10.1046/j.1432-1327.2000.01175.x (2000).
19. Hayashi, J.-I. et al. Human mitochondria and mitochondrial genome function as a single dynamic cellular unit. J. Cell Biol. 125,
43–50 (1994).
20. Ito, S. et al. Functional integrity of mitochondrial genomes in human platelets and autopsied brain tissues from aged patients
with Alzheimer's disease. Proc. Natl. Acad. Sci. USA. 96, 2099–2103 (1999).
21. Nakada, K. et al. Inter-mitochondrial complementation: mitochondria-specific system preventing mice from expression of
disease phenotypes by mutant mtDNA. Nature Med. 7, 934–940; DOI:10.1038/90976 (2001).
22. Ono, T. et al. Human cells are protected from mitochondrial dysfunction by complementation of DNA products in fused
mitochondria. Nature Genet. 28, 272–275; DOI:10.1038/90116 (2001).
23. Rubinsztein, D.C., et al. Autophagy and aging. Cell 146, 682–695; DOI:10.1016/j.cell.07.030 (2011).
24. Ota, T. et al. Complete sequencing and characterization of 21,243 full-length human cDNAs. Nature Genet. 36, 40–45;
DOI:10.1038/ng1285 (2003).
25. Otsuki, T. et al. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or
membrane proteins from oligo-capped cDNA libraries. DNA Res. 12, 117–126; DOI:10.1093/dnares/12.2.117 (2005).
26. Kimura, K. et al. Diversification of transcriptional modulation: Large-scale identification and characterization of putative
alternative promoters of human genes. Genome Res. 16, 55–65; DOI:10.1101/gr.4039406 (2006).
27. Itoh, M. et al. Constructing ORFeome resources with removable termination codons. Biotechniques 41, 44–48;
DOI:10.2144/000112209 (2006).

Acknowledgements
We thank the Research Association for Biotechnology, Dr. Yoshihide Hayashizaki of RIKEN OSC, and
Dr. Sumio Sugano of the University of Tokyo for providing the human GCAT full-length cDNA. This
work was supported by grants-in-aid for Scientific Research A25250011 (to J.-I.H.), Scientific Research
A 23240058 (to K.N.), and Scientific Research on Innovative Areas 24117503 (to J.-I.H.) from the Japan
Society for the Promotion of Science. This work was also supported by the World Premier International
Research Center Initiative of the Ministry of Education, Culture, Sports, Science and Technology (Japan)
(to K.N. and J.-I.H.).

Author Contributions
O.H., S.O., T.M. and J.-I.H. conceived and designed the experiments. O.H. conducted the overall
experiments. T.M., A.S., S.T. and H.M.Y. constructed lentiviral vectors. M.S. and H.M.N. performed
sequencing. M.S., H.M.N., A.S. and T.M. analyzed the sequence data. K.O. generated iPSCs. K.I. and
K.N. helped with the design and coordination of the study. J.-I.H. wrote the paper. All authors reviewed
the manuscript.

Additional Information
Supplementary information accompanies this paper at http://www.nature.com/srep
Competing financial interests: The authors declare no competing financial interests.
How to cite this article: Hashizume, O. et al. Epigenetic regulation of the nuclear-coded GCAT and
SHMT2 genes confers human age-associated mitochondrial respiration defects. Sci. Rep. 5, 10434; doi:
10.1038/srep10434 (2015).
This work is licensed under a Creative Commons Attribution 4.0 International License. The
images or other third party material in this article are included in the article’s Creative Com-
mons license, unless indicated otherwise in the credit line; if the material is not included under the
Creative Commons license, users will need to obtain permission from the license holder to reproduce
the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Scientific Reports | 5:10434 | DOI: 10.1038/srep10434 10

 www.nature.com/scientificreports

OPEN Corrigendum: Epigenetic

regulation of the nuclear-
coded GCAT and SHMT2 genes
confers human age-associated
mitochondrial respiration defects
Osamu Hashizume, Sakiko Ohnishi, Takayuki Mito, Akinori Shimizu, Kaori Ishikawa,
Kazuto Nakada, Manabu Soda, Hiroyuki Mano, Sumie Togayachi, Hiroyuki Miyoshi,
Keisuke Okita & Jun-Ichi Hayashi

Scientific Reports 5:10434; doi: 10.1038/srep10434; published online 22 May 2015; updated on 05 October
2015

The original version of this Article contained a typographical error in the spelling of the author Kaori
Ishikawa, which was incorrectly given as Kaori Iashikawa. This has now been corrected in both the PDF
and HTML versions of the Article.

This work is licensed under a Creative Commons Attribution 4.0 International License. The
images or other third party material in this article are included in the article’s Creative Com-
mons license, unless indicated otherwise in the credit line; if the material is not included under the
Creative Commons license, users will need to obtain permission from the license holder to reproduce
the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Scientific Reports | 5:14591 | DOI: 10.1038/srep14591 1