Journal Pre-proof

Cigarette smoke exposure and inflammatory signaling increase the expression of the
SARS-CoV-2 receptor ACE2 in the respiratory tract

Joan C. Smith, Erin L. Sausville, Vishruth Girish, Monet Lou Yuan, Anand Vasudevan,
Kristen M. John, Jason M. Sheltzer
PII: S1534-5807(20)30401-9
DOI: https://doi.org/10.1016/j.devcel.2020.05.012
Reference: DEVCEL 4870

To appear in: Developmental Cell

Received Date: 30 March 2020

Revised Date: 26 April 2020
Accepted Date: 12 May 2020

Please cite this article as: Smith, J.C., Sausville, E.L., Girish, V., Yuan, M.L., Vasudevan, A., John,
K.M., Sheltzer, J.M., Cigarette smoke exposure and inflammatory signaling increase the expression
of the SARS-CoV-2 receptor ACE2 in the respiratory tract, Developmental Cell (2020), doi: https://
doi.org/10.1016/j.devcel.2020.05.012.

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition
of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of
record. This version will undergo additional copyediting, typesetting and review before it is published
in its final form, but we are providing this version to give early visibility of the article. Please note that,
during the production process, errors may be discovered which could affect the content, and all legal
disclaimers that apply to the journal pertain.

© 2020 Elsevier Inc.

Cigarette smoke exposure and inflammatory signaling increase the expression of the
SARS-CoV-2 receptor ACE2 in the respiratory tract

Joan C. Smith1,2, Erin L. Sausville2, Vishruth Girish2,3, Monet Lou Yuan2,4, Anand Vasudevan2,
Kristen M. John2,5, and Jason M. Sheltzer2*

1. Google, Inc., New York City, NY, 10011, USA.

2. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 11724, USA.

3. Stony Brook University, Stony Brook, NY, 11794, USA.

4. Johns Hopkins University, Baltimore, MD, 21218, USA.

5. Hofstra University, Hempstead, NY, 11549, USA.

Lead contact: Jason M. Sheltzer, [email protected].

* To whom correspondence should be addressed. Email: [email protected].

Abstract

The factors mediating fatal SARS-CoV-2 infections are poorly understood. Here, we show that
cigarette smoke causes a dose-dependent upregulation of Angiotensin Converting Enzyme 2
(ACE2), the SARS-CoV-2 receptor, in rodent and human lungs. Using single-cell sequencing
data, we demonstrate that ACE2 is expressed in a subset of secretory cells in the respiratory
tract. Chronic smoke exposure triggers the expansion of this cell population and a concomitant
increase in ACE2 expression. In contrast, quitting smoking decreases the abundance of these
secretory cells and reduces ACE2 levels. Finally, we demonstrate that ACE2 expression is
responsive to inflammatory signaling and can be upregulated by viral infections or interferon
treatment. Taken together, these results may partially explain why smokers are particularly
susceptible to severe SARS-CoV-2 infections. Furthermore, our work identifies ACE2 as an
interferon-stimulated gene in lung cells, suggesting that SARS-CoV-2 infections could create
positive-feedback loops that increase ACE2 levels and facilitate viral dissemination.
Introduction

In December 2019, a novel respiratory disease emerged in a seafood market in Wuhan, China
(Zhu et al., 2020). Genomic sequencing demonstrated that the causative agent was a highly-
contagious coronavirus, since named SARS-CoV-2 (Wu et al., 2020; Zhou et al., 2020). The
disease, called COVID-19, rapidly spread worldwide, and as of May 2020, more than 4 million
people have been infected and more than 300,000 people have died (Our World in Data, 2020).
No clinically-validated treatment or vaccine for COVID-19 is currently available. Thus,
understanding the factors that mediate susceptibility to SARS-CoV-2 is crucial for controlling
disease transmission.

Molecular analysis has begun to shed light on how SARS-CoV-2 infections occur. Like a related
coronavirus that emerged in 2003 (Li et al., 2003), SARS-CoV-2 enters human cells by binding
to the extracellular domain of Angiotensin Converting Enzyme 2 (ACE2)(Hoffmann et al., 2020;
Zhou et al., 2020). Importantly, ACE2 is both necessary and sufficient for infection by SARS-
CoV-2: ACE2-targeting antibodies block viral uptake in permissive cells while transgenic
expression of human ACE2 allows viral entry in non-human cells. ACE2 normally functions in
the renin-angiotensin system (RAS) by cleaving the vasoconstrictive hormone angiotensin-II into
the vasodilator angiotensin 1-7 (Jiang et al., 2014). Sequestration of ACE2 by coronavirus
dysregulates the RAS pathway, contributing to morbidity (Kuba et al., 2005). Additionally, ACE2
levels are capable of influencing disease progression: among a cohort of mice engineered to
express human ACE2, mice expressing the highest levels of ACE2 mRNA exhibited the shortest
survival time following coronavirus exposure (McCray et al., 2007). Thus, the regulation of
ACE2 expression likely has a significant effect on SARS-CoV-2 susceptibility.

Epidemiological studies have identified multiple demographic features that correlate with the
severity of clinical COVID-19 cases. While fewer than 5% of SARS-CoV-2 infections are fatal
(Ruan, 2020; Wu and McGoogan, 2020), men and elderly patients are particularly at risk of
developing severe disease (Guan et al., 2020; Luo et al., 2020; Rabin, 2020; Remuzzi and
Remuzzi, 2020). Additionally, cigarette smokers with COVID-19 are significantly more likely to
develop critical illnesses that require aggressive medical intervention (Patanavanich and Glantz,
2020; Zhao et al., 2020a). For instance, in a study of 1,099 patients with laboratory-confirmed
COVID-19, 12.3% of current smokers required mechanical ventilation, were admitted to an ICU,
or died, compared to only 4.7% of non-smokers (Guan et al., 2020). The causes underlying
these differences in outcome are at present unknown.

Several clinical features have also been identified that can differentiate between patients with
severe and non-severe coronavirus infections. Notably, a dysregulated immune response has
been found to be a crucial mediator of COVID-19 mortality (Pedersen and Ho, 2020). Patients
who present with elevated levels of inflammatory cytokines are more likely to develop critical
illnesses (Chen et al., 2020a; Shi et al., 2020; Yang et al., 2020). These so-called “cytokine
storms” cause an increase in vascular permeability that facilitates immune cell efflux into
affected tissues, but may also worsen pneumonia (Zhang et al., 2020a). How this
immunopathology affects the regulation of the host factors required for coronavirus infections is
poorly understood.

Results

ACE2 levels in mammalian lungs are not strongly affected by age or sex
In order to study factors that could potentially influence susceptibility to SARS-CoV-2 infection,
we investigated the expression of the coronavirus receptor ACE2. We first assessed the
expression of ACE2 in a variety of rodent and human tissues (Figure S1 and Table
S1)(Carithers et al., 2015; Lonsdale et al., 2013; Schaum et al., 2019; Yu et al., 2014). ACE2
was expressed at high levels in mouse, rat, and human kidneys, consistent with its role as a
regulator of the RAS pathway. ACE2 was also expressed in rodent and human lungs, the
predominant location of coronavirus infections (Wölfel et al., 2020). Interestingly, significant
ACE2 expression was also evident in the mouse and human small intestine. Viral RNA has
been detected in stool samples from patients with COVID-19 (Xu et al., 2020), and
gastrointestinal symptoms have been reported in a subset of affected individuals (Guan et al.,
2020), suggesting a potential alternate route for SARS-CoV-2 transmission. However, as SARS-
CoV-2 appears to be primarily spread through viral inhalation (Wölfel et al., 2020), we focused
our study on factors that affect ACE2 expression in the lung and associated respiratory tissue.

Age and male sex are significant risk factors for severe SARS-CoV-2 infections (Guan et al.,
2020; Zhao, Xianxian et al., 2020). We therefore investigated whether either feature was
associated with increased ACE2 expression. In four different cohorts of aging mice and one
cohort of aging rats, we did not detect a significant age-dependent change in ACE2 expression
in the lung (Figure 1A-B and S1D-F)(Consortium et al., 2020; Jonker et al., 2013; Misra et al.,
2007; Soundararajan et al., 2016; Yu et al., 2014). Similarly, ACE2 expression in rodent lungs
was not significantly different between sexes (Figure 1C-D)(Crowley et al., 2015; Yu et al.,
2014). We next assessed the expression of ACE2 in three different human cohorts: 1) lung
tissue from the Genotype-Tissue Expression project (GTEx)(Carithers et al., 2015; Lonsdale et
al., 2013), 2) whole-lung tissue samples from organ donors (Gruber et al., 2006), and 3)
pathologically-normal lung tissue from a cohort of patients analyzed as part of The Cancer
Genome Atlas (The Cancer Genome Atlas Research Network et al., 2013). These datasets
yielded results that were consistent with our rodent analyses: ACE2 expression was equivalent
between men and women and between young individuals (<29 years) and elderly individuals
(>70 years)(Figure 1E-J). In total, these findings suggest that the increased morbidity of men
and older patients with COVID-19 is unlikely to result from inherent differences in the basal level
of ACE2 expression in the lung.

Cigarette smoke increases the expression of ACE2 in the mammalian respiratory tract

Cigarette smoking is strongly associated with adverse outcomes from COVID-19 (Guan et al.,
2020; Hu, 2020; Patanavanich and Glantz, 2020; Qi et al., 2020; Wang et al., 2020; Zhang et
al., 2020b; Zhao et al., 2020a). To investigate whether smoking could affect ACE2 levels, we
first assessed gene expression in mouse lungs. We analyzed a cohort of mice exposed to
diluted cigarette smoke for 2, 3, or 4 hours per day for five months (Gebel et al., 2010).
Strikingly, we found a dose-dependent increase in ACE2 expression according to smoke
exposure (Figure 2A). Mice exposed to the highest dose of cigarette smoke expressed ~80%
more ACE2 in their lungs compared to sham-treated mice. To determine whether this
association was present in humans as well, we assessed tissue collected from three cohorts of
current smokers and never-smokers (Butler et al., 2011; Turetz et al., 2009; Yang et al., 2017).
For these analyses, lung epithelial cells were sampled by fiberoptic bronchoscopy from either
the trachea, the large airways, or the small airways (Figure 2B). In each cohort, we observed
that tissue samples from smokers exhibited ~30%-55% more ACE2 compared to tissue from
non-smokers (Figure 2C-E). In a combined analysis comprised of data from all three tissue
locations, ACE2 was in the top 2% of genes most strongly dysregulated by smoke exposure
(Figure 2F).
Next, we sought to determine whether human ACE2 expression showed a dose-dependent
relationship with cigarette smoke, as we had observed in mice. To investigate this, we analyzed
two human datasets: 1) lung tissue from a cohort of smokers undergoing thoracic surgery for
transplantation, lung volume reduction, or nodule resection (Morrow et al., 2017) and 2)
pathologically-normal lung tissue from TCGA patients (The Cancer Genome Atlas Research
Network et al., 2013). In both cohorts, lung samples from patients who reported smoking the
greatest number of pack-years also expressed the highest levels of ACE2 (Figure 2G-H). For
instance, among smokers undergoing thoracic surgery, patients who had smoked more than 80
pack-years exhibited a ~100% increase in ACE2 expression relative to patients who had
smoked less than 20 pack-years (Figure 2G).

We then investigated whether other demographic features could explain the upregulation of
ACE2 in the lungs of smokers. Multivariate linear regression on the thoracic surgery cohort
confirmed that smoking history was a significant predictor of ACE2 expression even when
controlling for a patient’s age, sex, race, and body-mass index (Table 1). In the TCGA cohort,
pack-year history did not remain significantly associated with ACE2 in a regression with
additional clinical variables, which may reflect the very small number of patients who could be
included in this analysis (22 patients; data not shown). However, demographic information was
available for the tracheal epithelium cohort analyzed above (Figure 2E), and smoking status
remained correlated with ACE2 in a regression that included each patient’s age, sex, and race
(Table 1).

Finally, we examined the effects of quitting smoking on ACE2 expression. In a cohort of patients
comprised of either current smokers or former smokers who had refrained from smoking for at
least 12 months, quitting smoking was associated with a ~40% decrease in ACE2 expression
(Figure 2I). ACE2 was among the top 5% of genes most strongly affected by quitting smoking
(Figure 2J). In total, our results demonstrate that exposure to cigarette smoke increases the
expression of the coronavirus receptor ACE2 in rodent and human respiratory tissue, and this
upregulation is potentially reversible.

Coronavirus infections are facilitated by a set of host proteases that cleave and activate the viral
spike (S) protein (Millet and Whittaker, 2015). SARS-CoV-2 primarily relies on the serine
protease TMPRSS2 but can also utilize an alternate pathway involving Cathepsin B/L in
TMPRSS2-negative cells (Hoffmann et al., 2020). Interestingly, we observed that Cathepsin B
expression, but not TMPRSS2 or Cathepsin L expression, was consistently increased in mice
and humans exposed to cigarette smoke (Figure S2). In a meta-analysis across the trachea,
large airways, and small airways, Cathepsin B was in the top 11% of genes dysregulated in the
respiratory tract of cigarette smokers (Figure S2D). Thus, smoking can upregulate both the
coronavirus receptor as well as a protease that SARS-CoV-2 is capable of using for viral
activation.

ACE2 is expressed at high levels in secretory cells in the lung epithelium

Mammalian lungs harbor more than 30 distinct cell types representing a variety of epithelial,
endothelial, stromal, and immune compartments (Franks et al., 2008). Of note, the upper
respiratory epithelium is comprised of mucociliary cells, including goblet cells, club cells, and
ciliated cells, that secrete protective fluids and remove inhaled particles from the airways
(Whitsett, 2018). The lower respiratory epithelium includes alveolar type 1 cells, which allow gas
exchange with the blood, and alveolar type 2 cells, which regulate alveolar fluid balance and
can differentiate into type 1 cells following injury (Whitsett and Weaver, 2015).
To gain further insight into coronavirus infections, we profiled multiple single-cell RNA-Seq
experiments to identify the cell type(s) that express ACE2. We first examined a dataset
containing 13,822 cells from normal mouse lungs (Reyfman et al., 2018). We performed
unsupervised Leiden clustering to separate the cells into distinct populations and then we
assigned cell types to major clusters using established markers (Angelidis et al., 2019; Ardini-
Poleske et al., 2017; Plasschaert et al., 2018; Wolf et al., 2018). ACE2 was expressed solely in
the EpCAM+ clusters that comprise the lung epithelium (Kasper et al., 1995), and was not
detected in CD45+ immune cells (Thomas, 1989), PDGFRA+ mesenchymal cells (Li et al.,
2018), or TMEM100+ endothelial cells (Figure 3A-B)(Moon et al., 2010). We therefore focused
on localizing ACE2 within the epithelial lineage. We found that ACE2 was present in a cluster of
cells that express secretory markers including MUC5AC, GABRP, and SCGB1A1 that we
identified as being comprised of closely-related goblet and club cells (Figure 3C-D)(Angelidis et
al., 2019; Guha et al., 2014; Hovenberg et al., 1996; Rawlins et al., 2009). ACE2 expression
was also observed in a subset of LAMP3+ alveolar type 2 cells (Salaun et al., 2004), but was
largely absent from RTKN2+ alveolar type 1 cells (Angelidis et al., 2019).

We then extended our findings to an independent single-cell dataset from human lungs
(Reyfman et al., 2018). Consistent with our initial observations, we found that ACE2+ cells were
found almost exclusively in the EPCAM+ epithelial compartment (Figure 3E-F). Within this
lineage, we observed ACE2 expression in the LAMP3+ alveolar type 2 cluster and the
MUC5AC+ goblet/club cell cluster (Figure 3G-H). Additionally, in human cells, there was some
expression of ACE2 in FOXJ1+ ciliated cells (Yu et al., 2008). In total, our combined analysis
demonstrates that ACE2 is expressed in the mammalian lung epithelium, and is present at
particularly high levels in secretory club and goblet cells as well as in alveolar type 2 cells.

Cigarette smoke triggers an increase in ACE2+ cells by driving secretory cell expansion

Our findings on ACE2’s expression pattern suggested a possible explanation for its upregulation
in the lungs of cigarette smokers. Chronic exposure to cigarette smoke has been reported to
induce the expansion of secretory goblet cells, which produce mucous to protect the respiratory
tract from inhaled irritants (Cosio et al., 1980; Liu and Di, 2012; Saetta et al., 2000). Thus, the
increased expression of ACE2 in smokers’ lungs could be a byproduct of smoking-induced
secretory cell hyperplasia.

To investigate this hypothesis, we examined a dataset of single-cell transcriptomes collected

from the tracheas of current smokers and never-smokers (Goldfarbmuren et al., 2019). As these
cells were derived from the upper airways, they were highly-enriched for pseudostratified
respiratory epithelial cell types and contained few alveolar cells. Consistent with the initial
analysis of this dataset, Leiden clustering revealed a large population of TP63+ basal cells (the
putative stem cell population for the airway epithelium)(Rock et al., 2010), an intermediate
KRT8high population that showed evidence of ongoing differentiation (Goldfarbmuren et al.,
2019), and populations of mature FOXJ1+ ciliated cells and MUC5AC+ secretory cells (Figure
4A-B and Figure S3A-B). We also identified markers for submucosal gland (SMG) clusters as
well as rare epithelial cell types, including CFTR+ ionocytes (Montoro et al., 2018) and CHGA+
neuroendocrine cells (Gu et al., 2013). Within this dataset, ACE2 was expressed at the highest
levels in the MUC5AC+ secretory cell cluster, followed by SMG-secretory cells, KRT8high
intermediate cells, and FOXJ1+ ciliated cells.

We next identified the transcripts whose expression correlated with ACE2. Across all cells,
ACE2 levels were strongly correlated with several mucin genes, including MUC1, MUC4,
MUC15, and MUC16, as well as other genes associated with barrier epithelia, including ALCAM
(Tomita et al., 2000), CLDN7 (Farkas et al., 2015), and TJP3 (González-Mariscal et al.,
2003)(Table S2A). Gene ontology analysis revealed that ACE2-correlated transcripts were
enriched for genes involved in secretion, glycosylation, and the response to toxic substances,
consistent with the airway epithelium’s role as a producer of mucus and a barrier against foreign
matter (Figure 4C and Table S2B)(Fahy and Dickey, 2010). ACE2+ correlates overlapped with
but were not identical to goblet/club markers: several genes were widely expressed in both
populations (MUC16, CLDN7, S100P), while others were more restricted to single lineages
(PIGR, PSCA)(Figure 4D). In general, the ACE2+ signature was expressed in both secretory
cells and ciliated cells but not in the basal stem cell compartment.

We next separated the cells harvested from current smokers and never-smokers and then
analyzed each population separately. Consistent with previous reports (Cosio et al., 1980; Liu
and Di, 2012; Saetta et al., 2000), we detected a significant expansion of the secretory cell
compartment in smokers’ airways, as evidenced by both cluster analysis and by the increase in
the number of cells expressing the canonical goblet cell marker MUC5AC (Figure 4E-F).
FOXJ1+ ciliated cells decreased in abundance, likely reflecting the fact that smoke exposure
inhibits ciliogenesis (Tamashiro et al., 2009). These trends remained apparent when the cells
from each patient were examined individually (Figure S4C-D). Notably, smoking caused an
increase in both the number of ACE2+ positive cells and in ACE2 expression within ACE2+ cells
(Figure 4G-H). This expansion resulted from hyperplasia of the secretory cell compartment:
smoke exposure triggered a two-fold increase in the frequency of MUC5AC+/ACE2+ double-
positive cells, while there was no significant change in the frequency of MUC5AC-/ACE2+ cells.
In total, these results provide single-cell evidence that the increase in ACE2 expression in
smokers’ respiratory tracts is caused by the expansion of mucous-secreting goblet cells that co-
express ACE2.

To further validate these findings, we derived gene signatures for each of the cell types
identified from tracheal single-cell sequencing, and we applied these signatures to analyze the
bulk gene expression datasets from smokers and non-smokers that we had previously
investigated (Figure 2). The goblet/club cell gene signature was significantly upregulated in
current smokers compared to never smokers, while in former smokers these genes were
strongly downregulated (Figure 4I-J). A signature based on ACE2-correlated transcripts showed
a similar expression pattern. In contrast, a ciliated cell transcriptional signature was strongly
downregulated among current smokers. As some FOXJ1+ ciliated cells co-express ACE2, this
smoking-dependent suppression of ciliogenesis may partially blunt the increase in ACE2+ cells
caused by smoke-induced goblet cell hyperplasia.

Secretory cell differentiation of lung epithelium can be modeled in vitro by culturing cells at an
air-liquid interface (ALI)(Jiang et al., 2018; Upadhyay and Palmberg, 2018). Under appropriate
conditions, primary respiratory cells growing at an ALI will undergo mucociliary differentiation
into a stratified epithelium consisting of ciliated cells, goblet cells, and club cells (Ross et al.,
2007). As our single-cell analysis suggested that the coronavirus receptor ACE2 is expressed at
higher levels in differentiated secretory and ciliated cells compared to basal stem cells, we
investigated whether in vitro mucociliary differentiation increases ACE2 expression. Indeed, in
mouse tracheal extracts (Nemajerova et al., 2016) and primary human lung cells (Martinez-
Anton et al., 2013), mucociliary differentiation resulted in a highly-significant upregulation of
ACE2 (Figure 4K-L). Finally, to investigate the link between smoking, differentiation, and ACE2
expression, we examined data from human bronchial epithelial cells cultured at an ALI in which
cells were either exposed to clean air or to diluted cigarette smoke (Gindele et al., 2020).
Remarkably, treatment with cigarette smoke during in vitro differentiation resulted in a significant
upregulation of ACE2 relative to cells that were differentiated in clean air (Figure 4M). Smoke
exposure increased ACE2 expression by ~42%, comparable to the increases that we observed
between the lungs of non-smokers and smokers (Figure 2). Differentiation in the presence of
cigarette smoke similarly resulted in an upregulation of the goblet/club cell transcriptional
signature and a downregulation of the ciliated cell transcriptional signature (Figure 4N). In full,
our results demonstrate that a subset of lung secretory cells express the coronavirus receptor
ACE2, and cigarette smoke promotes the expansion of this cell population.

ACE2 is upregulated in smoking-associated diseases and by viral infections

To follow up on these observations, we investigated whether ACE2 expression was affected by

other lung diseases and/or carcinogen exposures. Indeed, we observed increased ACE2
expression in multiple cohorts of patients with chronic obstructive pulmonary disease (COPD)
and idiopathic pulmonary fibrosis (IPF)(Figure S4A-D)(Cruz et al., 2019; Kim et al., 2015;
McDonough et al., 2019; Pardo et al., 2005). Interestingly, both COPD and IPF are strongly
associated with prior cigarette exposure (Baumgartner et al., 1997; Laniado-Laborín, 2009), and
COPD in particular has been identified as a risk factor for severe COVID-19 (Lippi and Henry,
2020; Zhao et al., 2020a). However, ACE2 expression was generally not affected by other lung
conditions or toxins. We did not observe a significant difference in ACE2 expression in lung
samples from a large cohort of patients with asthma or from patients with the lung disease
sarcoidosis (Figure S4E-F)(Crouser et al., 2009; Voraphani et al., 2014). Similarly, ACE2
expression was unaltered in lung tissue from a mouse model of cystic fibrosis and in mice
exposed to a variety of carcinogens, including arsenic, ionizing radiation (IR), and 1,3-butadiene
(Figure S4G-J)(Chappell Grace A. et al.; Citrin et al., 2013; Haston et al., 2006; Kozul Courtney
D. et al., 2009). We conclude that ACE2 upregulation in the lung is tightly associated with a
history of cigarette smoking and is not a universal response to pulmonary diseases.

So-called “cytokine storms”, characterized by high levels of circulating inflammatory cytokines,

have been identified as a cause of COVID-19-related mortality (Chen et al., 2020a; Pedersen
and Ho, 2020; Shi et al., 2020). Cytokine release can be triggered by viral infections, which
serve to induce immune cell activation and expansion (Mogensen and Paludan, 2001).
Cigarette smoke is also an inflammatory agent, and smokers tend to exhibit an increase in
inflammation-related serological markers (Arnson et al., 2010; Gan et al., 2005). To investigate
a potential link between inflammation and the expression of the host factors required for
coronavirus infections, we first examined the levels of ACE2 in published datasets of respiratory
epithelial cells challenged with different viruses. We observed a highly significant upregulation of
ACE2 in airway cells that were infected with two RNA viruses, influenza and Respiratory
Syncytial Virus (Figure 5A-B)(Ioannidis et al., 2012). Infection with two coronaviruses, SARS
and MERS, that are closely related to the 2019 pandemic strain also caused an increase in
ACE2 levels (Figure 5C-D)(Menachery et al., 2017; Mitchell et al., 2013). Double-stranded RNA
that is produced during viral replication can be detected by host pattern recognition receptors,
triggering a strong immune response (Gantier and Williams, 2007). Accordingly, transfection of
the dsRNA mimic poly(I:C) into airway epithelial cells was sufficient to induce the upregulation of
ACE2 (Figure 5E)(Wagener et al., 2014). These results reveal that inflammatory signals – like
those triggered by smoking or by a viral infection – are capable of increasing the expression of
ACE2 in the respiratory epithelium.

To further investigate the stimuli that are sufficient to upregulate ACE2, we cultured primary
epithelial cells from either the small airways or the trachea in the presence of different
compounds. We found that exposure to interferons resulted in a significant upregulation of
ACE2 expression (Figure 5F-G). IFN-α, IFN-β, and IFN-γ treatment increased ACE2 expression
in tracheal cells, while only IFN-α and IFN-β affected ACE2 in small airway cells. To further
verify these results, we re-analyzed a published gene expression dataset of airway epithelial
cells exposed to IFN-β, and we found a similar increase in ACE2 levels following interferon
treatment (Figure 5H)(Rusinova et al., 2013; Shapira et al., 2009). The results identify ACE2 as
an interferon-regulated gene and suggest a potential mechanism by which inflammatory stimuli
could facilitate SARS-CoV-2 infections.

ACE2 RNA and protein levels are tightly correlated

This paper describes a series of analyses and experiments to identify factors that drive the
expression of the coronavirus receptor ACE2. However, these results could potentially be
confounded if changes in ACE2 RNA levels fail to affect the steady-state levels of ACE2 protein.
While we lack the data to directly test that link in the lungs of smokers, we conducted three
additional analyses to investigate whether ACE2 RNA and protein expression are generally
correlated. First, we examined a dataset of human cancer cell lines that had been profiled at the
transcriptional level by RNA-Seq and at the protein level by mass spectrometry (Barretina et al.,
2012; Nusinow and Gygi, 2020; Nusinow et al., 2020). Across 53 cell lines, ACE2 RNA and
protein levels were strongly correlated (r = 0.82, p < .0001; Figure S5A). Indeed, ACE2’s RNA-
protein correlation coefficient was higher than 95% of human genes that could be reliably
detected (Figure S5B). Next, we compared ACE2 RNA levels with ACE2 immunohistochemistry
staining in untransformed human tissues. We similarly observed a strong correlation between
ACE2 RNA and protein staining: five of the six tissues with the highest levels of RNA expression
exhibited strong staining, while none of the 35 other tissues with lower RNA levels exhibited
strong staining (Figure S5C)(Uhlén et al., 2015). Lastly, we directly compared ACE2 expression
in seven human cell lines by qRT-PCR and by western blotting. We found that cell lines that
displayed the highest levels of ACE2 RNA (LoVo, Caco-2, and Calu3) also exhibited the most
ACE2 protein, while cell lines with very low levels of ACE2 RNA (HCT116, CAL148, and A2780)
had undetectable levels of ACE2 protein (Figure S5D-E). Thus, while we cannot rule out the
possibility that ACE2 RNA and protein levels are differentially regulated in certain
circumstances, our analysis reveals that ACE2 RNA and protein levels are generally correlated.

Discussion

While SARS-CoV-2 has infected more than 4 million people worldwide, fewer than 5% of
COVID-19 cases are fatal (Guan et al., 2020; Our World in Data, 2020). Here, we show that
cigarette smokers harbor consistently higher levels of the SARS-CoV-2 receptor ACE2 in their
respiratory tracts. This upregulation is likely mediated by the expansion of ACE2+ secretory
cells caused by chronic smoke exposure. Certain inflammatory cytokines also trigger ACE2
upregulation, which could further influence ACE2 expression due to smoking-associated lung
inflammation. The overabundance of ACE2 in the lungs of smokers may partially explain why
smokers are significantly more likely to develop severe SARS-CoV-2 infections that require
aggressive medical interventions (Guan et al., 2020; Patanavanich and Glantz, 2020; Qi et al.,
2020; Zhao et al., 2020a). Furthermore, as quitting smoking is associated with a decrease in
ACE2 expression, it is possible that giving up cigarettes may reduce susceptibility to deadly
COVID-19.

Several contrasting findings exist in the literature on ACE2 and cigarette exposure (Brake et al.,
2020; Cai, 2020; Ferrari et al., 2007, 2008; Leung et al., 2020; Oakes et al., 2018; Yilin et al.,
2015; Yue et al., 2018). In particular, it has been reported that nicotine and/or cigarette smoke
has the potential to downregulate ACE2 expression in certain tissues or cell types (Ferrari et al.,
2007, 2008; Oakes et al., 2018; Yue et al., 2018). In this manuscript, we focused our analysis
on factors affecting ACE2 expression in the mammalian lungs and associated respiratory
epithelia. We observed a consistent correlation between smoking history and ACE2 expression
that was dose-dependent (Figure 2G-H), that could be recapitulated in mice (Figure 2A) and in
vitro (Figure 4M), that was detectable in both bulk and single-cell analyses (Figure 2F and 4G-
H), and that remained significant when controlling for other demographic variables (Table 1).
Thus, we propose that cigarette smoke causes the upregulation of ACE2 expression in the
respiratory tract. However, we recognize that individual components found within cigarettes, like
nicotine, may have a different effect on ACE2 than whole smoke, and smoking itself could alter
ACE2 levels in non-respiratory organs in different ways (Ferrari et al., 2008).

Several previous studies have examined the localization of ACE2 within the respiratory tract
(Ding et al., 2004; Hamming et al., 2004; Jia et al., 2005; Lukassen et al., 2020; Sungnak et al.,
2020; Travaglini et al., 2020; Wiener et al., 2007; Wu and Zheng, 2020; Xudong et al., 2006;
Yilin et al., 2015; Zhao et al., 2020b; Ziegler et al., 2020). Consistent with our results, ACE2
expression has been detected in the respiratory epithelium, including prominent staining in
alveolar type 2 cells. However, some prior studies have also documented ACE2 expression in
lung endothelial and smooth muscle cells (Hamming et al., 2004; Wiener et al., 2007; Xudong et
al., 2006), which we did not observe. These findings could represent non-specific staining
resulting from the particular antibodies that were used (Bradbury and Plückthun, 2015).
Alternately, ACE2 may be expressed in mesenchymal or other lineages within the lung, and our
inability to detect it may be a limitation of the single-cell samples that we analyzed. Nonetheless,
by examining datasets from both mice and humans, and by including cells collected from
bronchial brushing, we demonstrated consistently high levels of ACE2 transcripts in the
secretory cells that participate in mucociliary clearance (Whitsett, 2018). As these cells line the
upper respiratory tract, they may represent the initial site of coronavirus infections, followed by
an eventual spread and migration into the alveoli.

Cigarette smoke has a profound impact on the lungs of chronic smokers. Notably, prolonged
smoke exposure triggers secretory cell hyperplasia, thereby increasing the production of
mucous in the respiratory tract (Cosio et al., 1980; Liu and Di, 2012; Saetta et al., 2000). We
found that this smoking-induced expansion of secretory cells also causes an increase in ACE2
levels, as smoking doubled the number of cells co-expressing ACE2 and MUC5AC. Additionally,
consistent with a recent report (Ziegler et al., 2020), we found that ACE2 is an interferon-
regulated gene, and is over-expressed in lung epithelial cells following viral infection or
interferon treatment. Lung damage and inflammation caused by smoking could also contribute
to ACE2 upregulation. Additionally, we speculate that the interferon-dependent upregulation of
ACE2 could create a positive-feedback loop for SARS-CoV-2 infections. That is, interferon
secretion following an initial infection could increase ACE2 expression within neighboring cells,
thereby rendering those cells susceptible to SARS-CoV-2 and facilitating viral dissemination.
Accordingly, clinical interventions to dampen the immune response could benefit patients in part
by breaking this positive-feedback cycle (Roumier et al., 2020; Zhang et al., 2020a).

The factors that mediate overall susceptibility to SARS-CoV-2 infections are poorly understood.
We speculate that the increased expression of ACE2 that we found in the lungs of smokers
could partially contribute to the severe cases of COVID-19 that have been observed in this
patient population. Chronic smokers may exhibit a number of co-morbidities, including
emphysema, atherosclerosis, and immune dysregulation (Office of the Surgeon General (US)
and Office on Smoking and Health (US), 2004), that are also likely to affect COVID-19
progression. While the effects of smoking can last for years, smoking cessation causes an
improvement in lung function and an overall decrease in disease burden (Office of the Surgeon
General (US) and Office on Smoking and Health (US), 2004). Quitting smoking leads to a
normalization of respiratory epithelial architecture (Bertram and Rogers, 1981), a decrease in
hyperplasia (Lee et al., 2001), and a downregulation of ACE2 levels. Thus, for multiple reasons,
smoking cessation could eventually lessen the risks associated with SARS-CoV-2 infections.

Limitations

Our analysis in this manuscript has a number of important limitations. First, the relationship
between age, sex, and ACE2 expression remains controversial. In the literature, ACE2
expression in the lung has been reported to both increase (Chen et al., 2020b; Muus et al.,
2020) and decrease (A. Sina Booeshaghi and Lior Pachter, 2020; Xudong et al., 2006) during
aging. Across five rodent and three human datasets, we did not observe a significant correlation
in either direction between ACE2 levels and age. It remains possible that such a difference
could be found using tissue from older or younger individuals. Additionally, it is possible that
ACE2 expression within single cell types correlates with age, but such differences are not
prominent enough to detect using bulk microarray and RNA-Seq analysis.

In order for SARS-CoV-2 to infect a host cell, the virus must bind to ACE2 protein that is present
on the cell surface. Here, we have described the expression of ACE2 transcripts in mammalian
lungs, but our work does not guarantee that stimuli affecting the levels of ACE2 mRNA will have
the same effect on ACE2 protein. In general, we have documented a strong correlation between
ACE2 mRNA and protein levels (Figure S5), but it remains possible that ACE2 protein is
differentially regulated in mammalian lungs, or that the localization of ACE2 protein to the cell
surface is strictly controlled. Immunohistochemistry using tissue samples from smokers and
virus-infected patients will be needed to confirm that these factors also increase the levels of
ACE2 protein available to interact with SARS-CoV-2 particles.

Finally, the exact role of ACE2 as a mediator of disease severity remains to be determined.
Mice that were engineered to express high levels of human ACE2 succumbed to infections with
the SARS coronavirus more quickly than mice that expressed low levels of human ACE2,
suggesting that increasing ACE2 enhances viral susceptibility (McCray et al., 2007). At the
same time, ACE2-knockout mice are vulnerable to a variety of lung injuries, and ACE2
expression has been reported to play a protective role in the respiratory tract (Imai et al., 2005;
Kuba et al., 2005; Rey-Parra et al., 2012). As ACE2 expression is both necessary and sufficient
for SARS-CoV-2 infections (Hoffmann et al., 2020; Zang et al., 2020), it seems highly likely that
an expansion of ACE2+ cells in the lungs will facilitate viral dissemination. However, the exact
relationship between ACE2 expression and SARS-CoV-2 uptake remains to be determined, and
it is possible that the expression of ACE2 has some beneficial consequences as well. Additional
work will be required to determine the precise impact of ACE2 levels on the clinical course of
COVID19.
Author contributions

Conceptualization, J.C.S. and J.M.S.; Methodology, J.C.S. and J.M.S.; Software, J.C.S.; Formal
analysis, J.C.S. and J.M.S.; Writing – Original Draft, J.M.S.; Writing – Review & Editing, J.C.S.
and J.M.S; Supervision, J.M.S.; Investigation, J.C.S., E.L.S., V.G., M.L.Y., A.V., K.M.J., and
J.M.S.

Declaration of Interests

J.C.S. is a co-founder of Meliora Therapeutics and is an employee of Google, Inc. This work
was performed outside of her affiliation with Google and used no proprietary knowledge or
materials from Google. J.M.S. has received consulting fees from Ono Pharmaceuticals, is a
member of the Advisory Board of Tyra Biosciences, and is a co-founder of Meliora
Therapeutics.

Acknowledgments

Research in the Sheltzer Lab is supported by an NIH Early Independence award

(1DP5OD021385), NIH grant R01CA237652-01, a Damon Runyon-Rachleff Innovation award,
an American Cancer Society Research Scholar Grant, and a grant from the New York
Community Trust. We thank Julia Kuhl (www.somedonkey.com) for assistance with artwork.
Table 1. Patient characteristics and ACE2 expression.

Multivariate regression between various patient characteristics, smoking status, and ACE2
expression. The thoracic surgery cohort is from GSE76925 and the tracheal epithelium cohort is
from GSE13933. Bolding indicates significant variables. *, p < .05; **, p < .005; ***, p < .0005.

β value Standard Error P value

Age 0.0014 0.0086 0.8700
Thoracic surgery cohort

BMI -0.0199 0.0127 0.1193

Smoking Pack-years 0.0081 0.0025 0.0015**
Race 0.2527
Caucasian = 0 0.1910 0.1663
Not Caucasian = 1
Sex
Female = 0 0.3335 0.1338 0.0138*
Male = 1

Age -0.0027 0.0080 0.7364

Tracheal epithelium cohort

Smoking status
Never smoker = 0 0.5638 0.1269 7 x 10-5***
Current smoker = 1
Race
Caucasian = 0 0.1252 0.1331 0.3527
Not Caucasian = 1
Sex
0.2538 0.1328 0.0632
Female = 0
Male = 1
Figure Legends

Figure 1. ACE2 expression in the lung is uncorrelated with age or sex.

(A) ACE2 expression in the lungs of young mice (<26 weeks old) and old mice (>78 weeks
old).

(B) ACE2 expression in the lungs of young rats (6 weeks old) and old rats (104 weeks old).

(C) ACE2 expression in the lungs of female mice and male mice.

(D) ACE2 expression in the lungs of female rats and male rats.

(E) ACE2 expression in lungs from the GTEx cohort by age.

(F) ACE2 expression in lungs from the GTEx cohort by sex.

(G) ACE2 expression in lungs from a cohort of organ donors by age.

(H) ACE2 expression in lungs from a cohort of organ donors by sex.

(I) ACE2 expression in pathologically normal lung tissue from patients from TCGA by age.

(J) ACE2 expression in pathologically-normal lung tissue from patients from TCGA by sex.

Each panel displays log2-normalized ACE2 expression relative to a control group. Data
analyzed in A and C were from GSE132040. Data analyzed in B and D were from GSE53960.
Data analyzed in E and F were from www.gtexportal.org. Data analyzed in G and H were from
GSE1643. Data analyzed in I and J were from https://gdac.broadinstitute.org/. Additional
information on the data sources and sample sizes are included in Table S1.

Figure 2. Cigarette smoke increases the expression of ACE2 in mouse and human lungs.

(A) ACE2 expression in the lungs of mice that were sham-treated or that were exposed to
diluted cigarette smoke for two, three, or four hours a day (low, medium, and high smoke
exposure, respectively).

(B) A diagram showing the approximate locations of tissue samples used in this analysis.
Tracheal, large airway epithelial, and small airway epithelial specimens were collected
by fiberoptic bronchoscopy as described in their respective publications. Lung resections
were collected surgically from various locations.

(C) ACE2 expression in human tracheal epithelia analyzed according to smoking history.

(D) ACE2 expression in human large airway epithelia analyzed according to smoking
history.

(E) ACE2 expression in human small airway epithelia analyzed according to smoking
history.
 (F) A volcano plot comparing gene expression in the respiratory epithelia of current smokers
and never-smokers from C, D, and E. The dotted lines indicate various p-value
thresholds (e.g., genes located above the 10th percentile have a combined p value
greater than 90% of the genes included in the meta-analysis). The location of ACE2 is
indicated with a red star.

(G) ACE2 expression in the lungs of a cohort of patients undergoing thoracic surgery
analyzed according to the number of pack-years each patient smoked.

(H) ACE2 expression in the lungs of TCGA patients analyzed according to the number of
pack-years each patient smoked.

(I) ACE2 expression in respiratory epithelia collected by fiberoptic bronchoscopy among

either current smokers or former smokers.

(J) A volcano plot comparing gene expression between current smokers and former
smokers. The dotted lines indicate various p-value thresholds (e.g., genes located above
the 10th percentile have a combined p value greater than 90% of the genes included in
the meta-analysis). The location of ACE2 is indicated with a red star.

Each panel displays log2-normalized ACE2 expression relative to a control group. Data
analyzed in A were from GSE18344. Data analyzed in C were from GSE13933. Data analyzed
in D were from GSE22047. Data analyzed in E were from GSE64614. Data analyzed in G were
from GSE76925. Data analyzed in H were from https://gdac.broadinstitute.org/. Data analyzed
in I were from GSE79209. Additional information on the data sources and sample sizes are
included in Table S1. *, p < .05; **, p < .005; ***, p < .0005 (Student’s t-test).

Figure 3. ACE2 is expressed in secretory club and goblet cells along with alveolar type 2
cells in the mammalian lung.

(A) T-SNE clustering of cells from the mouse lung. Cells expressing ACE2 are highlighted in
the right panel.

(B) Cells in the mouse lung that express various lineage markers (TMEM100 for endothelial
cells, EPCAM for epithelial cells, PDGFRA for mesenchymal cells, and PTPRC for
immune cells) are highlighted.

(C) Cells expressing markers for various epithelial lineages are highlighted: RTKN2 for
alveolar type 1 cells, LAMP3 for alveolar type 2 cells, FOXJ1 for ciliated cells, GABRP
for both goblet and club cells, MUC5AC for goblet cells, and SCGB1A for club cells.

(D) A track plot displaying the expression of ACE2 and several lineage-related genes in
different cell populations obtained from Leiden clustering.

(E) T-SNE clustering of cells from the human lung. Cells expressing ACE2 are highlighted in
the right panel.
 (F) Cells in the human lung that express various lineage markers (TMEM100 for endothelial
cells, EPCAM for epithelial cells, PDGFRA for mesenchymal cells, and PTPRC for
immune cells) are highlighted.

(G) Cells expressing markers for various epithelial lineages are highlighted: LAMP3 for
alveolar type 2 cells, FOXJ1 for ciliated cells, TP63 for basal cells, GABRP for both
goblet and club cells, MUC5AC for goblet cells, and SCGB1A1 for club cells.

(H) A track plot displaying the expression of ACE2 and several lineage-related genes in
different cell populations obtained from Leiden clustering.

The gene expression data used in A, B, C, and D are from GSE121611. The gene expression
data used in E, F, G, and H are from GSE122960. Additional information on the data sources
and sample sizes are included in Table S1.

Figure 4. Cigarette smoke causes the expansion of ACE2+ secretory cells.

(A) T-SNE clustering of the transcriptomes from single cells derived from the airway
epithelia of smokers and never-smokers. Cells expressing ACE2 are highlighted in the
right panel.

(B) Cells in the human airway that express various lineage markers (FOXJ1 for ciliated cells,
TP63 for basal cells, MUC5AC for goblet cells, and SCGB1A1 for club cells) are
highlighted.

(C) GO terms enriched among ACE2-correlated transcripts.

(D) Dot plots displaying the expression of the top 10 differentially-expressed marker genes
for various airway lineages and for ACE2+ cells.

(E) The fraction of cells expressing the indicated marker genes are displayed. FOXJ1 is a
marker for ciliated cells, MUC5AC is a marker for goblet cells, and TP63 is a marker for
basal cells.

(F) The fractions of cells found in each cell type cluster are displayed.

(G) The numbers of counts per ACE2+ cell are displayed.

(H) The fraction of ACE2+ cells co-expressing MUC5AC or that are found within the
goblet/club cell cluster are displayed.

(I) The 100 top-ranked differentially-expressed genes from each cluster in (A) as well as the
100 genes most strongly correlated with ACE2 were used to re-analyze the bulk gene
expression data from smokers and non-smokers in Figure 2F. A volcano plot displays
the mean expression change of each cell type signature.

(J) The same transcriptional signatures as in Figure 4I were used to re-analyze the data
from current smokers and former smokers in Figure 2J. A volcano plot displays the
mean expression change of each cell type signature.
 (K) ACE2 expression in mouse tracheal explants undergoing mucociliary differentiation.

(L) ACE2 expression in human airway epithelial cells undergoing mucociliary differentiation.

(M) ACE2 expression in human airway epithelial cells that underwent mucociliary
differentiation in the presence of clean air or cigarette smoke.

(N) The same transcriptional signatures as in Figure 4I were used to re-analyze the data
from smoke exposure during differentiation from Figure 4M. A volcano plot displaying the
mean expression change of each cell type signature is displayed.

Data analyzed in A through H were from GSE131391. Data analyzed in K were from
GSE75715. Data analyzed in L were from GSE39059. Data analyzed in M were from
GSE135188. Additional information on the data sources and sample sizes are included in Table
S1. In E, F, and H, a chi-square test is applied. In G, a Mann-Whitney U test is applied. In K, L,
and M, a Student’s t-test is applied. *, p < .05; **, p < .005; ***, p < .0005.

Figure 5. ACE2 is an interferon-stimulated gene that is upregulated by viral infections.

(A) ACE2 expression in airway epithelial cells that were infected with influenza.

(B) ACE2 expression in airway epithelial cells that were infected with respiratory syncytial
virus.

(C) ACE2 expression in airway epithelial cells that were infected with SARS.

(D) ACE2 expression in airway epithelial cells that were infected with MERS.

(E) ACE2 expression in airway epithelial cells that were transfected with the dsRNA mimic
poly(I:C).

(F) ACE2 expression in human tracheal cells that were cultured in the presence of the
indicated cytokine for 24 hours.

(G) ACE2 expression in human small airway epithelial cells that were cultured in the
presence of the indicated cytokine for 24 hours.

(H) ACE2 expression in airway epithelial cells that were cultured in the presence of IFN-β.

Each panel displays log2-normalized ACE2 expression relative to a control group. Data
analyzed in A and B were from GSE32138. Data analyzed in C were from GSE47963. Data
analyzed in D were from GSE100504. Data analyzed in E were from GSE51392. Data analyzed
in H were from GSE19392. Additional information on the data sources and sample sizes are
included in Table S1. *, p < .05; **, p < .005; ***, p < .0005 (Student’s t-test).
STAR Methods

RESOURCE AVAILABILITY

LEAD CONTACT

Further information and requests for resources should be directed to and will be fulfilled by the
Lead Contact, Dr. Jason Sheltzer ([email protected]).

MATERIALS AVAILABILITY

This study did not generate any new unique reagents.

DATA AND CODE AVAILABILITY

All of the data used in this manuscript are publicly accessible and are described in Table S1.
The code used for performing these analyses is available at github.com/joan-smith/covid19.

EXPERIMENTAL MODELS AND SUBJECT DETAILS

Cell lines

All cell lines used in this study were acquired from ATCC, except for CAL148 cells that were
acquired from DSMZ and A2780 cells that were acquired from ECACC. Primary small
airway epithelial cells and primary bronchial/tracheal epithelial cells were cultured in Airway
Epithelial Cell Basal Medium (ATCC; Cat. No. PCS-300-030) supplemented with the Bronchial
Epithelial Cell Growth Kit (ATCC; Cat. No. PCS-300-040™). HCT116, CAL148, and A375
cell lines were cultured in Dulbecco's Modified Eagle Medium (DMEM) (Gibco; Cat.
No. 11995073) supplemented with 10% fetal bovine serum (FBS)(Corning; Cat. No. 35-010-
CV). LoVo and A2780 were cultured in RPMI 1640 (Lonza; Cat. No. 12-
115F) supplemented with 10% FBS. Calu-3 was cultured in Eagle's Minimum Essential Medium
(EMEM) (ATCC; Cat. No. 30-2003™) supplemented with 10% FBS. Caco-2 was cultured in
EMEM supplemented with 20% FBS. All cell lines were grown in a humidified environment at
37°C and 5% CO2.

METHOD DETAILS

Overall analysis strategy

The analysis described in this paper was performed using Python, Excel, and Graphpad Prism.
Gene expression data was acquired from the Gene Expression Omnibus (GEO)(Edgar et al.,
2002), the GTEx portal (Lonsdale et al., 2013), the Broad Institute TCGA Firehose (Broad
GDAC Firehose, 2016), the Human Cell Atlas (Regev et al., 2017), and the Single-Cell
Expression Atlas (Papatheodorou et al., 2020), as described below. For microarray datasets,
probeset definitions were downloaded from GEO, and probes mapping to the same gene were
collapsed by averaging. For each gene expression comparison, a control population was
identified (e.g., young rats, sham-treated mice, non-smokers, etc.), and gene expression values
were log2-transformed and normalized by subtraction so that the mean expression of a gene of
interest in the control population was 0. Graphs of gene expression values were then generated
using Graphpad Prism; all data points are displayed and no outliers were excluded from
analysis.

Multivariate regression and smoking history

Multivariate regression to investigate the relationship between ACE2 expression and smoking
history was performed on the GSE76925 lung tissue dataset and the GSE13933 tracheal
epithelium dataset. Regressions were performed in Python using ordinary least squares from
the statsmodels package (Seabold and Perktold, 2010). Results reported include the standard
errors (‘bse’), betas, and p-values.

Single-cell analysis

Single-cell clustering and analysis on the datasets listed in Table S1 was performed in Python
using the Scanpy and Multicore-TSNE packages (Ulyanov, 2020; Wolf et al., 2018). To filter out
low-quality cells, only cells in which 500 or more genes were detected were included in this
analysis. Before clustering, transcript counts were counts-per-million normalized and log2
transformed. Highly variable genes were selected using the Seurat approach in Scanpy, and
these highly variable genes were used to produce the principal component analysis. A t-SNE
projection and unsupervised Leiden clustering were then performed on each dataset using
nearest neighbors, as described in the associated code. Parameter selection was performed
according to the method described in (Kobak and Berens, 2019).

In order to label each cluster, a gene ranking analysis was obtained using Scanpy. The 20 most
highly-ranked genes from each cluster (as determined by a t-test with overestimated variance)
were identified. These genes were then compared against gold-standard marker lists from
multiple sources to produce the cluster labels (Angelidis et al., 2019; Ardini-Poleske et al., 2017;
Goldfarbmuren et al., 2019; Plasschaert et al., 2018; Wolf et al., 2018).

Gene ontology analysis

In order to identify the genes whose expression correlates with ACE2, pairwise Pearson
correlations coefficients (PCCs) were calculated between ACE2 and every other expressed
gene. Genes whose PCC were more than three standard deviations greater than the average
gene’s PCC were classified as strongly correlated with ACE2. Gene ontology terms enriched in
this group were then identified with GProfiler against the background list of non-strongly
correlated genes using a Benjamini-Hochberg FDR of .05 (Raudvere et al., 2019).

Volcano plots

For the meta-analysis of gene expression changes in the small airways, large airways, and
trachea, p values from each independent dataset were combined using Fisher’s method and
fold change values were combined by averaging. To deconvolve the bulk gene expression
datasets based on cell type signatures, the 100 highest ranking genes from each cell type
cluster (found using a t-test with overestimated variance, as described above) were identified
and the 100 genes exhibiting the strongest correlation with ACE2 were identified. Volcano plots
were generated using the mean expression of the 100 genes comprising each signature and the
p-value of a t-test comparing the signature genes to all genes within a dataset.
Cytokine treatments

Early-passage human tracheal epithelial cells and small airways epithelial cells were acquired
from ATCC and cultured according to the supplier’s recommended method. Cells were grown
for 48 hours to approximately 70% confluence, treated with the indicated compound for 24
hours, and then total RNA was harvested.

RNA expression analysis

qRT-PCR was performed as described in (Vasudevan et al., 2020). In short, RNA was extracted
using TRIzol (Life Technologies; Cat. No. 15596018) and then purified with a Qiagen RNeasy
Mini Kit (Cat. No. 74106). RNA was converted to cDNA using SuperScript IV VILO Master Mix
(ThermoFisher Scientific; Cat. No. 11756500). Quantitative PCR was performed using SYBR
Premier Ex Taq (Takara; Cat No. RR420L) and quantified using the QuantStudio 6 Flex Real-
Time PCR system (Applied Biosystems). The primers for ACE2 were as follows: (set 1) 5’-
CGAAGCCGAAGACCTGTTCTA and 5’-GGGCAAGTGTGGACTGTTCC and (set 2) 5’-
CAAGAGCAAACGGTTGAACAC and 5’-CCAGAGCCTCTCATTGTAGTCT. GAPDH was
assessed as a control using primers 5’-TGCACCACCAACTGCTTAGC and 5’-
GGCATGGACTGTGGTCATGAG.

Western blotting

Western blotting was performed as described in (Vasudevan et al., 2020). In short, whole cell
lysates were harvested and resuspended in RIPA buffer [25 mM Tris, pH 7.4, 150 mM NaCl, 1%
Triton X 100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, protease inhibitor
cocktail (Sigma; Cat. No. 4693159001), and phosphatase inhibitor cocktail (Sigma, Cat. No.
4906845001)]. Protein lysates were loaded onto a 10% SDS-PAGE gel. The Trans-Blot Turbo
Transfer System (Bio-Rad) and polyvinylidene difluoride membranes were used for protein
transfer. Antibody blocking was done with 5% milk in TBST (19 mM Tris base, NaCl 137 mM,
KCl 2.7 mM and 0.1% Tween-20) for 1 hour at room temperature. Primary antibodies used were
ACE2 (Abcam; Cat. No. ab108252), used at a 1:1000 dilution in 5% milk, and GAPDH (Santa
Cruz Biotechnology; Cat. No. sc-365062), used at a 1:1000 dilution in 5% milk. Blots were
incubated overnight at 4°C. Membranes were then washed three times for 10 minutes each
before they were incubated in secondary antibodies for an hour at room temperature. For the
ACE2 blot, goat anti-rabbit IgG H&L (HRP) (Abcam; Cat. No. ab-97051) was used as a
secondary antibody at a 1:20000 dilution in 5% milk. For the GAPDH blot, goat anti-mouse IgG
(H + L)-HRP Conjugate (Bio-Rad; Cat. No. 1706516) was used as a secondary antibody at a
1:20000 dilution in 5% milk. Membranes were washed three more times and then developed
using ProtoGlow ECl (National Diagnostics; Cat. No. CL-300).

QUANTIFICATION AND STATISTICAL ANALYSIS

For the qPCR assays in Figure 5F-G and Figure S5D, we performed three biological replicates
(for each cytokine) or six biological replicates (for the untreated cells) using two ACE2 primer
pairs. Sample sizes of the gene expression datasets that were analyzed are listed in Table S1.
Gene expression values in Figure 1, Figure S1, Figure 2, Figure S2, Figure S3, Figure 4K-M,
Figure S5, and Figure 5 were compared by a two-sided Student’s t-test. Gene expression
values in Figure 4G were compared by a Mann-Whitney U test. The fractions of cells expressing
a particular marker in Figure 4E-F and Figure 4H were compared by a chi-square test. No
outliers were excluded from these analyses.
References

A. Sina Booeshaghi, and Lior Pachter (2020). Decrease in ACE2 mRNA expression in aged
mouse lung.

Angelidis, I., Simon, L.M., Fernandez, I.E., Strunz, M., Mayr, C.H., Greiffo, F.R., Tsitsiridis, G.,
Ansari, M., Graf, E., Strom, T.-M., et al. (2019). An atlas of the aging lung mapped by single cell
transcriptomics and deep tissue proteomics. Nature Communications 10, 1–17.

Ardini-Poleske, M.E., Clark, R.F., Ansong, C., Carson, J.P., Corley, R.A., Deutsch, G.H.,
Hagood, J.S., Kaminski, N., Mariani, T.J., Potter, S.S., et al. (2017). LungMAP: The Molecular
Atlas of Lung Development Program. American Journal of Physiology-Lung Cellular and
Molecular Physiology 313, L733–L740.

Arnson, Y., Shoenfeld, Y., and Amital, H. (2010). Effects of tobacco smoke on immunity,
inflammation and autoimmunity. Journal of Autoimmunity 34, J258–J265.

Barretina, J., Caponigro, G., Stransky, N., Venkatesan, K., Margolin, A.A., Kim, S., Wilson, C.J.,
Lehár, J., Kryukov, G.V., Sonkin, D., et al. (2012). The Cancer Cell Line Encyclopedia enables
predictive modelling of anticancer drug sensitivity. Nature 483, 603–607.

Baumgartner, K.B., Samet, J.M., Stidley, C.A., Colby, T.V., and Waldron, J.A. (1997). Cigarette
smoking: a risk factor for idiopathic pulmonary fibrosis. Am J Respir Crit Care Med 155, 242–
248.

Bertram, J.F., and Rogers, A.W. (1981). Recovery of bronchial epithelium on stopping smoking.
Br Med J (Clin Res Ed) 283, 1567–1569.

Bradbury, A., and Plückthun, A. (2015). Reproducibility: Standardize antibodies used in

research. Nature News 518, 27.

Brake, S.J., Barnsley, K., Lu, W., McAlinden, K.D., Eapen, M.S., and Sohal, S.S. (2020).
Smoking Upregulates Angiotensin-Converting Enzyme-2 Receptor: A Potential Adhesion Site
for Novel Coronavirus SARS-CoV-2 (Covid-19). Journal of Clinical Medicine 9, 841.

Broad GDAC Firehose (2016). Broad GDAC Firehose.

Butler, M.W., Fukui, T., Salit, J., Shaykhiev, R., Mezey, J.G., Hackett, N.R., and Crystal, R.G.
(2011). Modulation of cystatin A expression in human airway epithelium related to genotype,
smoking, COPD, and lung cancer. Cancer Res. 71, 2572–2581.

Cai, G. (2020). Tobacco-Use Disparity in Gene Expression of ACE2, the Receptor of 2019-
nCov.

Carithers, L.J., Ardlie, K., Barcus, M., Branton, P.A., Britton, A., Buia, S.A., Compton, C.C.,
DeLuca, D.S., Peter-Demchok, J., Gelfand, E.T., et al. (2015). A Novel Approach to High-
Quality Postmortem Tissue Procurement: The GTEx Project. Biopreservation and Biobanking
13, 311–319.
Chappell Grace A., Israel Jennifer W., Simon Jeremy M., Pott Sebastian, Safi Alexias, Eklund
Karl, Sexton Kenneth G., Bodnar Wanda, Lieb Jason D., Crawford Gregory E., et al. Variation in
DNA-Damage Responses to an Inhalational Carcinogen (1,3-Butadiene) in Relation to Strain-
Specific Differences in Chromatin Accessibility and Gene Transcription Profiles in C57BL/6J and
CAST/EiJ Mice. Environmental Health Perspectives 125, 107006.

Chen, G., Wu, D., Guo, W., Cao, Y., Huang, D., Wang, H., Wang, T., Zhang, X., Chen, H., Yu,
H., et al. (2020a). Clinical and immunological features of severe and moderate coronavirus
disease 2019. J. Clin. Invest.

Chen, Y., Shan, K., and Qian, W. (2020b). Asians Do Not Exhibit Elevated Expression or
Unique Genetic Polymorphisms for ACE2, the Cell-Entry Receptor of SARS-CoV-2.

Citrin, D.E., Shankavaram, U., Horton, J.A., Shield, W., Zhao, S., Asano, H., White, A., Sowers,
A., Thetford, A., and Chung, E.J. (2013). Role of type II pneumocyte senescence in radiation-
induced lung fibrosis. J. Natl. Cancer Inst. 105, 1474–1484.

Consortium, T.T.M., Pisco, A.O., McGeever, A., Schaum, N., Karkanias, J., Neff, N.F.,
Darmanis, S., Wyss-Coray, T., and Quake, S.R. (2020). A Single Cell Transcriptomic Atlas
Characterizes Aging Tissues in the Mouse. BioRxiv 661728.

Cosio, M.G., Hale, K.A., Niewoehner, D.E., and Markert, M. (1980). Morphologic and
Morphometric Effects of Prolonged Cigarette Smoking on the Small Airways. Am Rev Respir Dis
122, 265–271.

Crouser, E.D., Culver, D.A., Knox, K.S., Julian, M.W., Shao, G., Abraham, S., Liyanarachchi, S.,
Macre, J.E., Wewers, M.D., Gavrilin, M.A., et al. (2009). Gene Expression Profiling Identifies
MMP-12 and ADAMDEC1 as Potential Pathogenic Mediators of Pulmonary Sarcoidosis. Am J
Respir Crit Care Med 179, 929–938.

Crowley, J.J., Zhabotynsky, V., Sun, W., Huang, S., Pakatci, I.K., Kim, Y., Wang, J.R., Morgan,
A.P., Calaway, J.D., Aylor, D.L., et al. (2015). Analyses of allele-specific gene expression in
highly divergent mouse crosses identifies pervasive allelic imbalance. Nat. Genet. 47, 353–360.

Cruz, T., López-Giraldo, A., Noell, G., Casas-Recasens, S., Garcia, T., Molins, L., Juan, M.,
Fernandez, M.A., Agustí, A., and Faner, R. (2019). Multi-level immune response network in
mild-moderate Chronic Obstructive Pulmonary Disease (COPD). Respiratory Research 20, 152.

Ding, Y., He, L., Zhang, Q., Huang, Z., Che, X., Hou, J., Wang, H., Shen, H., Qiu, L., Li, Z., et al.
(2004). Organ distribution of severe acute respiratory syndrome (SARS) associated coronavirus
(SARS-CoV) in SARS patients: implications for pathogenesis and virus transmission pathways.
The Journal of Pathology 203, 622–630.

Edgar, R., Domrachev, M., and Lash, A.E. (2002). Gene Expression Omnibus: NCBI gene
expression and hybridization array data repository. Nucl. Acids Res. 30, 207–210.

Fahy, J.V., and Dickey, B.F. (2010). Airway Mucus Function and Dysfunction. New England
Journal of Medicine 363, 2233–2247.
Farkas, A.E., Hilgarth, R.S., Capaldo, C.T., Gerner-Smidt, C., Powell, D.R., Vertino, P.M.,
Koval, M., Parkos, C.A., and Nusrat, A. (2015). HNF4α Regulates Claudin-7 Protein Expression
during Intestinal Epithelial Differentiation. The American Journal of Pathology 185, 2206–2218.

Ferrari, M.F.R., Raizada, M.K., and Fior-Chadi, D.R. (2007). Nicotine modulates the renin-
angiotensin system of cultured neurons and glial cells from cardiovascular brain areas of Wistar
Kyoto and spontaneously hypertensive rats. J. Mol. Neurosci. 33, 284–293.

Ferrari, M.F.R., Raizada, M.K., and Fior-Chadi, D.R. (2008). Differential regulation of the renin-
angiotensin system by nicotine in WKY and SHR glia. J. Mol. Neurosci. 35, 151–160.

Franks, T.J., Colby, T.V., Travis, W.D., Tuder, R.M., Reynolds, H.Y., Brody, A.R., Cardoso,
W.V., Crystal, R.G., Drake, C.J., Engelhardt, J., et al. (2008). Resident cellular components of
the human lung: current knowledge and goals for research on cell phenotyping and function.
Proc Am Thorac Soc 5, 763–766.

Gan, W.Q., Man, S.F.P., and Sin, D.D. (2005). The Interactions Between Cigarette Smoking
and Reduced Lung Function on Systemic Inflammation. Chest 127, 558–564.

Gantier, M.P., and Williams, B.R.G. (2007). The response of mammalian cells to double-
stranded RNA. Cytokine Growth Factor Rev 18, 363–371.

Gebel, S., Diehl, S., Pype, J., Friedrichs, B., Weiler, H., Schüller, J., Xu, H., Taguchi, K.,
Yamamoto, M., and Müller, T. (2010). The transcriptome of Nrf2-/- mice provides evidence for
impaired cell cycle progression in the development of cigarette smoke-induced emphysematous
changes. Toxicol. Sci. 115, 238–252.

Gindele, J.A., Kiechle, T., Benediktus, K., Birk, G., Brendel, M., Heinemann, F., Wohnhaas,
C.T., LeBlanc, M., Zhang, H., Strulovici-Barel, Y., et al. (2020). Intermittent exposure to whole
cigarette smoke alters the differentiation of primary small airway epithelial cells in the air-liquid
interface culture. Scientific Reports 10, 1–17.

Goldfarbmuren, K.C., Jackson, N.D., Sajuthi, S.P., Dyjack, N., Li, K.S., Rios, C.L., Plender,
E.G., Montgomery, M.T., Everman, J.L., Vladar, E.K., et al. (2019). Dissecting the cellular
specificity of smoking effects and reconstructing lineages in the human airway epithelium.
BioRxiv 612747.

González-Mariscal, L., Betanzos, A., Nava, P., and Jaramillo, B.E. (2003). Tight junction
proteins. Progress in Biophysics and Molecular Biology 81, 1–44.

Gruber, M.P., Coldren, C.D., Woolum, M.D., Cosgrove, G.P., Zeng, C., Barón, A.E., Moore,
M.D., Cool, C.D., Worthen, G.S., Brown, K.K., et al. (2006). Human lung project: evaluating
variance of gene expression in the human lung. Am. J. Respir. Cell Mol. Biol. 35, 65–71.

Gu, X., Karp, P.H., Brody, S.L., Pierce, R.A., Welsh, M.J., Holtzman, M.J., and Ben-Shahar, Y.
(2013). Chemosensory Functions for Pulmonary Neuroendocrine Cells. Am J Respir Cell Mol
Biol 50, 637–646.

Guan, W.-J., Ni, Z.-Y., Hu, Y., Liang, W.-H., Ou, C.-Q., He, J.-X., Liu, L., Shan, H., Lei, C.-L.,
Hui, D.S.C., et al. (2020). Clinical Characteristics of Coronavirus Disease 2019 in China. N.
Engl. J. Med.
Guha, A., Vasconcelos, M., Zhao, R., Gower, A.C., Rajagopal, J., and Cardoso, W.V. (2014).
Analysis of Notch Signaling-Dependent Gene Expression in Developing Airways Reveals
Diversity of Clara Cells. PLoS One 9.

Hamming, I., Timens, W., Bulthuis, M.L.C., Lely, A.T., Navis, G.J., and van Goor, H. (2004).
Tissue distribution of ACE2 protein, the functional receptor for SARS coronavirus. A first step in
understanding SARS pathogenesis. J. Pathol. 203, 631–637.

Haston, C.K., Cory, S., Lafontaine, L., Dorion, G., and Hallett, M.T. (2006). Strain-dependent
pulmonary gene expression profiles of a cystic fibrosis mouse model. Physiol. Genomics 25,
336–345.

Hoffmann, M., Kleine-Weber, H., Schroeder, S., Krüger, N., Herrler, T., Erichsen, S.,
Schiergens, T.S., Herrler, G., Wu, N.-H., Nitsche, A., et al. (2020). SARS-CoV-2 Cell Entry
Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor.
Cell.

Hovenberg, H.W., Davies, J.R., and Carlstedt, I. (1996). Different mucins are produced by the
surface epithelium and the submucosa in human trachea: identification of MUC5AC as a major
mucin from the goblet cells. Biochem J 318, 319–324.

Hu, L. (2020). Risk Factors Associated with Clinical Outcomes in 323 COVID-19 Patients in
Wuhan, China | medRxiv. medRxiv.

Imai, Y., Kuba, K., Rao, S., Huan, Y., Guo, F., Guan, B., Yang, P., Sarao, R., Wada, T., Leong-
Poi, H., et al. (2005). Angiotensin-converting enzyme 2 protects from severe acute lung failure.
Nature 436, 112–116.

Ioannidis, I., McNally, B., Willette, M., Peeples, M.E., Chaussabel, D., Durbin, J.E., Ramilo, O.,
Mejias, A., and Flaño, E. (2012). Plasticity and virus specificity of the airway epithelial cell
immune response during respiratory virus infection. J. Virol. 86, 5422–5436.

Jia, H.P., Look, D.C., Shi, L., Hickey, M., Pewe, L., Netland, J., Farzan, M., Wohlford-Lenane,
C., Perlman, S., and McCray, P.B. (2005). ACE2 receptor expression and severe acute
respiratory syndrome coronavirus infection depend on differentiation of human airway epithelia.
J. Virol. 79, 14614–14621.

Jiang, D., Schaefer, N., and Chu, H.W. (2018). Air–Liquid Interface Culture of Human and
Mouse Airway Epithelial Cells. In Lung Innate Immunity and Inflammation: Methods and
Protocols, S. Alper, and W.J. Janssen, eds. (New York, NY: Springer), pp. 91–109.

Jiang, F., Yang, J., Zhang, Y., Dong, M., Wang, S., Zhang, Q., Liu, F.F., Zhang, K., and Zhang,
C. (2014). Angiotensin-converting enzyme 2 and angiotensin 1–7: novel therapeutic targets.
Nature Reviews Cardiology 11, 413–426.

Jonker, M.J., Melis, J.P., Kuiper, R.V., van der Hoeven, T.V., Wackers, P.F.K., Robinson, J.,
van der Horst, G.T., Dollé, M.E., Vijg, J., Breit, T.M., et al. (2013). Life spanning murine gene
expression profiles in relation to chronological and pathological aging in multiple organs. Aging
Cell 12, 901–909.
Kasper, M., Behrens, J., Schuh, D., and Müller, M. (1995). Distribution of E-cadherin and Ep-
CAM in the human lung during development and after injury. Histochem Cell Biol 103, 281–286.

Kim, W.J., Lim, J.H., Lee, J.S., Lee, S.-D., Kim, J.H., and Oh, Y.-M. (2015). Comprehensive
Analysis of Transcriptome Sequencing Data in the Lung Tissues of COPD Subjects. Int J
Genomics 2015, 206937.

Kobak, D., and Berens, P. (2019). The art of using t-SNE for single-cell transcriptomics. Nature
Communications 10, 1–14.

Kozul Courtney D., Hampton Thomas H., Davey Jennifer C., Gosse Julie A., Nomikos Athena
P., Eisenhauer Phillip L., Weiss Daniel J., Thorpe Jessica E., Ihnat Michael A., and Hamilton
Joshua W. (2009). Chronic Exposure to Arsenic in the Drinking Water Alters the Expression of
Immune Response Genes in Mouse Lung. Environmental Health Perspectives 117, 1108–1115.

Kuba, K., Imai, Y., Rao, S., Gao, H., Guo, F., Guan, B., Huan, Y., Yang, P., Zhang, Y., Deng,
W., et al. (2005). A crucial role of angiotensin converting enzyme 2 (ACE2) in SARS
coronavirus–induced lung injury. Nature Medicine 11, 875–879.

Laniado-Laborín, R. (2009). Smoking and Chronic Obstructive Pulmonary Disease (COPD).

Parallel Epidemics of the 21st Century. Int J Environ Res Public Health 6, 209–224.

Lee, J.J., Liu, D., Lee, J.S., Kurie, J.M., Khuri, F.R., Ibarguen, H., Morice, R.C., Walsh, G., Ro,
J.Y., Broxson, A., et al. (2001). Long-Term Impact of Smoking on Lung Epithelial Proliferation in
Current and Former Smokers. J Natl Cancer Inst 93, 1081–1088.

Leung, J.M., Yang, C.X., Tam, A., Shaipanich, T., Hackett, T.-L., Singhera, G.K., Dorscheid,
D.R., and Sin, D.D. (2020). ACE-2 Expression in the Small Airway Epithelia of Smokers and
COPD Patients: Implications for COVID-19. Eur Respir J.

Li, R., Bernau, K., Sandbo, N., Gu, J., Preissl, S., and Sun, X. (2018). Pdgfra marks a cellular
lineage with distinct contributions to myofibroblasts in lung maturation and injury response. ELife
7, e36865.

Li, W., Moore, M.J., Vasilieva, N., Sui, J., Wong, S.K., Berne, M.A., Somasundaran, M.,
Sullivan, J.L., Luzuriaga, K., Greenough, T.C., et al. (2003). Angiotensin-converting enzyme 2 is
a functional receptor for the SARS coronavirus. Nature 426, 450–454.

Lippi, G., and Henry, B.M. (2020). Chronic obstructive pulmonary disease is associated with
severe coronavirus disease 2019 (COVID-19). Respir Med.

Liu, Y., and Di, Y.P. (2012). Effects of second hand smoke on airway secretion and mucociliary
clearance. Front. Physiol. 3.

Lonsdale, J., Thomas, J., Salvatore, M., Phillips, R., Lo, E., Shad, S., Hasz, R., Walters, G.,
Garcia, F., Young, N., et al. (2013). The Genotype-Tissue Expression (GTEx) project. Nature
Genetics 45, 580–585.

Lukassen, S., Chua, R.L., Trefzer, T., Kahn, N.C., Schneider, M.A., Muley, T., Winter, H.,
Meister, M., Veith, C., Boots, A.W., et al. (2020). SARS-CoV-2 receptor ACE2 and TMPRSS2
are primarily expressed in bronchial transient secretory cells. The EMBO Journal n/a, e105114.
Luo, X., Xia, H., Yang, W., Wang, B., Guo, T., Xiong, J., Jiang, Z., Liu, Y., Yan, X., Zhou, W., et
al. (2020). Characteristics of patients with COVID-19 during epidemic ongoing outbreak in
Wuhan, China. MedRxiv 2020.03.19.20033175.

Martinez-Anton, A., Sokolowska, M., Kern, S., Davis, A.S., Alsaaty, S., Taubenberger, J.K.,
Sun, J., Cai, R., Danner, R.L., Eberlein, M., et al. (2013). Changes in microRNA and mRNA
expression with differentiation of human bronchial epithelial cells. Am. J. Respir. Cell Mol. Biol.
49, 384–395.

McCray, P.B., Pewe, L., Wohlford-Lenane, C., Hickey, M., Manzel, L., Shi, L., Netland, J., Jia,
H.P., Halabi, C., Sigmund, C.D., et al. (2007). Lethal Infection of K18-hACE2 Mice Infected with
Severe Acute Respiratory Syndrome Coronavirus. Journal of Virology 81, 813–821.

McDonough, J.E., Ahangari, F., Li, Q., Jain, S., Verleden, S.E., Herazo-Maya, J., Vukmirovic,
M., DeIuliis, G., Tzouvelekis, A., Tanabe, N., et al. (2019). Transcriptional regulatory model of
fibrosis progression in the human lung. JCI Insight 4.

Menachery, V.D., Mitchell, H.D., Cockrell, A.S., Gralinski, L.E., Yount, B.L., Graham, R.L.,
McAnarney, E.T., Douglas, M.G., Scobey, T., Beall, A., et al. (2017). MERS-CoV Accessory
ORFs Play Key Role for Infection and Pathogenesis. MBio 8.

Millet, J.K., and Whittaker, G.R. (2015). Host cell proteases: Critical determinants of coronavirus
tropism and pathogenesis. Virus Research 202, 120–134.

Misra, V., Lee, H., Singh, A., Huang, K., Thimmulappa, R.K., Mitzner, W., Biswal, S., and
Tankersley, C.G. (2007). Global expression profiles from C57BL/6J and DBA/2J mouse lungs to
determine aging-related genes. Physiol. Genomics 31, 429–440.

Mitchell, H.D., Eisfeld, A.J., Sims, A.C., McDermott, J.E., Matzke, M.M., Webb-Robertson, B.-
J.M., Tilton, S.C., Tchitchek, N., Josset, L., Li, C., et al. (2013). A network integration approach
to predict conserved regulators related to pathogenicity of influenza and SARS-CoV respiratory
viruses. PLoS ONE 8, e69374.

Mogensen, T.H., and Paludan, S.R. (2001). Molecular Pathways in Virus-Induced Cytokine
Production. Microbiol Mol Biol Rev 65, 131–150.

Montoro, D.T., Haber, A.L., Biton, M., Vinarsky, V., Lin, B., Birket, S.E., Yuan, F., Chen, S.,
Leung, H.M., Villoria, J., et al. (2018). A revised airway epithelial hierarchy includes CFTR-
expressing ionocytes. Nature 560, 319–324.

Moon, E.-H., Kim, M.-J., Ko, K.S., Kim, Y.S., Seo, J., Oh, S.P., and Lee, Y.J. (2010). Generation
of mice with a conditional and reporter allele for Tmem100. Genesis 48, 673–678.

Morrow, J.D., Zhou, X., Lao, T., Jiang, Z., DeMeo, D.L., Cho, M.H., Qiu, W., Cloonan, S., Pinto-
Plata, V., Celli, B., et al. (2017). Functional interactors of three genome-wide association study
genes are differentially expressed in severe chronic obstructive pulmonary disease lung tissue.
Scientific Reports 7, 1–11.

Muus, C., Luecken, M.D., Eraslan, G., Waghray, A., Heimberg, G., Sikkema, L., Kobayashi, Y.,
Vaishnav, E.D., Subramanian, A., Smilie, C., et al. (2020). Integrated analyses of single-cell
atlases reveal age, gender, and smoking status associations with cell type-specific expression
of mediators of SARS-CoV-2 viral entry and highlights inflammatory programs in putative target
cells. BioRxiv 2020.04.19.049254.

Nemajerova, A., Kramer, D., Siller, S.S., Herr, C., Shomroni, O., Pena, T., Gallinas Suazo, C.,
Glaser, K., Wildung, M., Steffen, H., et al. (2016). TAp73 is a central transcriptional regulator of
airway multiciliogenesis. Genes Dev. 30, 1300–1312.

Nusinow, D.P., and Gygi, S.P. (2020). A Guide to the Quantitative Proteomic Profiles of the
Cancer Cell Line Encyclopedia. BioRxiv 2020.02.03.932384.

Nusinow, D.P., Szpyt, J., Ghandi, M., Rose, C.M., McDonald, E.R., Kalocsay, M., Jané-
Valbuena, J., Gelfand, E., Schweppe, D.K., Jedrychowski, M., et al. (2020). Quantitative
Proteomics of the Cancer Cell Line Encyclopedia. Cell 180, 387-402.e16.

Oakes, J.M., Fuchs, R.M., Gardner, J.D., Lazartigues, E., and Yue, X. (2018). Nicotine and the
renin-angiotensin system. American Journal of Physiology-Regulatory, Integrative and
Comparative Physiology 315, R895–R906.

Office of the Surgeon General (US), and Office on Smoking and Health (US) (2004). The Health
Consequences of Smoking: A Report of the Surgeon General (Atlanta (GA): Centers for
Disease Control and Prevention (US)).

Our World in Data (2020). Total confirmed deaths due to COVID-19.

Papatheodorou, I., Moreno, P., Manning, J., Fuentes, A.M.-P., George, N., Fexova, S.,
Fonseca, N.A., Füllgrabe, A., Green, M., Huang, N., et al. (2020). Expression Atlas update: from
tissues to single cells. Nucleic Acids Res 48, D77–D83.

Pardo, A., Gibson, K., Cisneros, J., Richards, T.J., Yang, Y., Becerril, C., Yousem, S., Herrera,
I., Ruiz, V., Selman, M., et al. (2005). Up-Regulation and Profibrotic Role of Osteopontin in
Human Idiopathic Pulmonary Fibrosis. PLOS Medicine 2, e251.

Patanavanich, R., and Glantz, S.A. (2020). Smoking is Associated with COVID-19 Progression:
A Meta-Analysis. MedRxiv 2020.04.13.20063669.

Pedersen, S.F., and Ho, Y.-C. (2020). SARS-CoV-2: a storm is raging. J Clin Invest 130.

Plasschaert, L.W., Žilionis, R., Choo-Wing, R., Savova, V., Knehr, J., Roma, G., Klein, A.M.,
and Jaffe, A.B. (2018). A single-cell atlas of the airway epithelium reveals the CFTR-rich
pulmonary ionocyte. Nature 560, 377–381.

Qi, D., Yan, X., Tang, X., Peng, J., Yu, Q., Feng, L., Yuan, G., Zhang, A., Chen, Y., Yuan, J., et
al. (2020). Epidemiological and clinical features of 2019-nCoV acute respiratory disease cases
in Chongqing municipality, China: a retrospective, descriptive, multiple-center study. MedRxiv
2020.03.01.20029397.

Rabin, R.C. (2020). In Italy, Coronavirus Takes a Higher Toll on Men. The New York Times.

Raudvere, U., Kolberg, L., Kuzmin, I., Arak, T., Adler, P., Peterson, H., and Vilo, J. (2019).
g:Profiler: a web server for functional enrichment analysis and conversions of gene lists (2019
update). Nucleic Acids Res 47, W191–W198.
Rawlins, E.L., Okubo, T., Xue, Y., Brass, D.M., Auten, R.L., Hasegawa, H., Wang, F., and
Hogan, B.L.M. (2009). The role of Scgb1a1+ Clara cells in the long-term maintenance and
repair of lung airway, but not alveolar, epithelium. Cell Stem Cell 4, 525–534.

Regev, A., Teichmann, S.A., Lander, E.S., Amit, I., Benoist, C., Birney, E., Bodenmiller, B.,
Campbell, P., Carninci, P., Clatworthy, M., et al. (2017). The Human Cell Atlas. Elife 6.

Remuzzi, A., and Remuzzi, G. (2020). COVID-19 and Italy: what next? The Lancet 0.

Reyfman, P.A., Walter, J.M., Joshi, N., Anekalla, K.R., McQuattie-Pimentel, A.C., Chiu, S.,
Fernandez, R., Akbarpour, M., Chen, C.-I., Ren, Z., et al. (2018). Single-Cell Transcriptomic
Analysis of Human Lung Provides Insights into the Pathobiology of Pulmonary Fibrosis. Am J
Respir Crit Care Med 199, 1517–1536.

Rey-Parra, G.J., Vadivel, A., Coltan, L., Hall, A., Eaton, F., Schuster, M., Loibner, H., Penninger,
J.M., Kassiri, Z., Oudit, G.Y., et al. (2012). Angiotensin converting enzyme 2 abrogates
bleomycin-induced lung injury. J Mol Med 90, 637–647.

Rock, J.R., Randell, S.H., and Hogan, B.L.M. (2010). Airway basal stem cells: a perspective on
their roles in epithelial homeostasis and remodeling. Disease Models & Mechanisms 3, 545–
556.

Ross, A.J., Dailey, L.A., Brighton, L.E., and Devlin, R.B. (2007). Transcriptional Profiling of
Mucociliary Differentiation in Human Airway Epithelial Cells. Am J Respir Cell Mol Biol 37, 169–
185.

Roumier, M., Paule, R., Groh, M., Vallee, A., and Ackermann, F. (2020). Interleukin-6 blockade
for severe COVID-19. MedRxiv 2020.04.20.20061861.

Ruan, S. (2020). Likelihood of survival of coronavirus disease 2019. The Lancet Infectious
Diseases 0.

Rusinova, I., Forster, S., Yu, S., Kannan, A., Masse, M., Cumming, H., Chapman, R., and
Hertzog, P.J. (2013). INTERFEROME v2.0: an updated database of annotated interferon-
regulated genes. Nucleic Acids Res 41, D1040–D1046.

Saetta, M., Turato, G., Baraldo, S., Zanin, A., Braccioni, F., Mapp, C.E., Maestrelli, P.,
Cavallesco, G., Papi, A., and Fabbri, L.M. (2000). Goblet Cell Hyperplasia and Epithelial
Inflammation in Peripheral Airways of Smokers with Both Symptoms of Chronic Bronchitis and
Chronic Airflow Limitation. Am J Respir Crit Care Med 161, 1016–1021.

Salaun, B., de Saint-Vis, B., Pacheco, N., Pacheco, Y., Riesler, A., Isaac, S., Leroux, C., Clair-
Moninot, V., Pin, J.-J., Griffith, J., et al. (2004). CD208/Dendritic Cell-Lysosomal Associated
Membrane Protein Is a Marker of Normal and Transformed Type II Pneumocytes. Am J Pathol
164, 861–871.

Schaum, N., Lehallier, B., Hahn, O., Hosseinzadeh, S., Lee, S.E., Sit, R., Lee, D.P., Losada,
P.M., Zardeneta, M.E., Pálovics, R., et al. (2019). The murine transcriptome reveals global
aging nodes with organ-specific phase and amplitude. BioRxiv 662254.
Seabold, S., and Perktold, J. (2010). Statsmodels: Econometric and Statistical Modeling with
Python. (Austin, Texas), pp. 92–96.

Shapira, S.D., Gat-Viks, I., Shum, B.O.V., Dricot, A., de Grace, M.M., Wu, L., Gupta, P.B., Hao,
T., Silver, S.J., Root, D.E., et al. (2009). A physical and regulatory map of host-influenza
interactions reveals pathways in H1N1 infection. Cell 139, 1255–1267.

Shi, Y., Tan, M., Chen, X., Liu, Y., Huang, J., Ou, J., and Deng, X. (2020). Immunopathological
characteristics of coronavirus disease 2019 cases in Guangzhou, China. MedRxiv
2020.03.12.20034736.

Soundararajan, R., Stearns, T.M., Czachor, A., Fukumoto, J., Turn, C., Westermann-Clark, E.,
Breitzig, M., Tan, L., Lockey, R.F., King, B.L., et al. (2016). Global gene profiling of aging lungs
in Atp8b1 mutant mice. Aging (Albany NY) 8, 2232–2252.

Sungnak, W., Huang, N., Bécavin, C., Berg, M., Queen, R., Litvinukova, M., Talavera-López, C.,
Maatz, H., Reichart, D., Sampaziotis, F., et al. (2020). SARS-CoV-2 entry factors are highly
expressed in nasal epithelial cells together with innate immune genes. Nature Medicine 1–7.

Tamashiro, E., Xiong, G., Anselmo-Lima, W.T., Kreindler, J.L., Palmer, J.N., and Cohen, N.A.
(2009). Cigarette Smoke Exposure Impairs Respiratory Epithelial Ciliogenesis. Am J
Rhinol�Allergy 23, 117–122.

The Cancer Genome Atlas Research Network, Weinstein, J.N., Collisson, E.A., Mills, G.B.,
Shaw, K.R.M., Ozenberger, B.A., Ellrott, K., Shmulevich, I., Sander, C., and Stuart, J.M. (2013).
The Cancer Genome Atlas Pan-Cancer analysis project. Nat Genet 45, 1113–1120.

Thomas, M.L. (1989). The leukocyte common antigen family. Annu. Rev. Immunol. 7, 339–369.

Tomita, K., van Bokhoven, A., Jansen, C.F.J., Bussemakers, M.J.G., and Schalken, J.A. (2000).
Coordinate Recruitment of E-Cadherin and ALCAM to Cell–Cell Contacts by α-Catenin.
Biochemical and Biophysical Research Communications 267, 870–874.

Travaglini, K.J., Nabhan, A.N., Penland, L., Sinha, R., Gillich, A., Sit, R.V., Chang, S., Conley,
S.D., Mori, Y., Seita, J., et al. (2020). A molecular cell atlas of the human lung from single cell
RNA sequencing. BioRxiv 742320.

Turetz, M.L., O’Connor, T.P., Tilley, A.E., Strulovici-Barel, Y., Salit, J., Dang, D., Teater, M.,
Mezey, J., Clark, A.G., and Crystal, R.G. (2009). Trachea epithelium as a “canary” for cigarette
smoking-induced biologic phenotype of the small airway epithelium. Clin Transl Sci 2, 260–272.

Uhlen, M., Oksvold, P., Fagerberg, L., Lundberg, E., Jonasson, K., Forsberg, M., Zwahlen, M.,
Kampf, C., Wester, K., Hober, S., et al. (2010). Towards a knowledge-based Human Protein
Atlas. Nat. Biotechnol. 28, 1248–1250.

Uhlén, M., Fagerberg, L., Hallström, B.M., Lindskog, C., Oksvold, P., Mardinoglu, A., Sivertsson,
Å., Kampf, C., Sjöstedt, E., Asplund, A., et al. (2015). Tissue-based map of the human
proteome. Science 347, 1260419.

Ulyanov, D. (2020). DmitryUlyanov/Multicore-TSNE.

Upadhyay, S., and Palmberg, L. (2018). Air-Liquid Interface: Relevant In Vitro Models for
Investigating Air Pollutant-Induced Pulmonary Toxicity. Toxicol Sci 164, 21–30.

Vasudevan, A., Baruah, P.S., Smith, J.C., Wang, Z., Sayles, N.M., Andrews, P., Kendall, J.,
Leu, J., Chunduri, N.K., Levy, D., et al. (2020). Single-Chromosomal Gains Can Function as
Metastasis Suppressors and Promoters in Colon Cancer. Developmental Cell 52, 413-428.e6.

Voraphani, N., Gladwin, M.T., Contreras, A.U., Kaminski, N., Tedrow, J.R., Milosevic, J.,
Bleecker, E.R., Meyers, D.A., Ray, A., Ray, P., et al. (2014). An airway epithelial iNOS–
DUOX2–thyroid peroxidase metabolome drives Th1/Th2 nitrative stress in human severe
asthma. Mucosal Immunology 7, 1175–1185.

Wagener, A.H., Zwinderman, A.H., Luiten, S., Fokkens, W.J., Bel, E.H., Sterk, P.J., and van
Drunen, C.M. (2014). dsRNA-induced changes in gene expression profiles of primary nasal and
bronchial epithelial cells from patients with asthma, rhinitis and controls. Respir Res 15, 9.

Wang, R., Pan, M., Zhang, X., Fan, X., Han, M., Zhao, F., Miao, M., Xu, J., Guan, M., Deng, X.,
et al. (2020). Epidemiological and clinical features of 125 Hospitalized Patients with COVID-19
in Fuyang, Anhui, China. Int J Infect Dis.

Whitsett, J.A. (2018). Airway Epithelial Differentiation and Mucociliary Clearance. Annals ATS
15, S143–S148.

Whitsett, J.A., and Weaver, T.E. (2015). Alveolar Development and Disease. Am J Respir Cell
Mol Biol 53, 1–7.

Wiener, R.S., Cao, Y.X., Hinds, A., Ramirez, M.I., and Williams, M.C. (2007). Angiotensin
converting enzyme 2 is primarily epithelial and is developmentally regulated in the mouse lung.
Journal of Cellular Biochemistry 101, 1278–1291.

Wolf, F.A., Angerer, P., and Theis, F.J. (2018). SCANPY: large-scale single-cell gene
expression data analysis. Genome Biology 19, 15.

Wölfel, R., Corman, V.M., Guggemos, W., Seilmaier, M., Zange, S., Müller, M.A., Niemeyer, D.,
Jones, T.C., Vollmar, P., Rothe, C., et al. (2020). Virological assessment of hospitalized patients
with COVID-2019. Nature 1–10.

Wu, C., and Zheng, M. (2020). Single-Cell RNA Expression Profiling Shows that ACE2, the
Putative Receptor of Wuhan 2019-nCoV, Has Significant Expression in the Nasal, Mouth, Lung
and Colon Tissues, and Tends to be Co-Expressed with HLA-DRB1 in the Four Tissues.
Preprints.

Wu, Z., and McGoogan, J.M. (2020). Characteristics of and Important Lessons From the
Coronavirus Disease 2019 (COVID-19) Outbreak in China: Summary of a Report of 72 314
Cases From the Chinese Center for Disease Control and Prevention. JAMA.

Wu, F., Zhao, S., Yu, B., Chen, Y.-M., Wang, W., Song, Z.-G., Hu, Y., Tao, Z.-W., Tian, J.-H.,
Pei, Y.-Y., et al. (2020). A new coronavirus associated with human respiratory disease in China.
Nature 579, 265–269.
Xu, Y., Li, X., Zhu, B., Liang, H., Fang, C., Gong, Y., Guo, Q., Sun, X., Zhao, D., Shen, J., et al.
(2020). Characteristics of pediatric SARS-CoV-2 infection and potential evidence for persistent
fecal viral shedding. Nature Medicine 1–4.

Xudong, X., Junzhu, C., Xingxiang, W., Furong, Z., and Yanrong, L. (2006). Age- and gender-
related difference of ACE2 expression in rat lung. Life Sciences 78, 2166–2171.

Yang, J., Zuo, W.-L., Fukui, T., Chao, I., Gomi, K., Lee, B., Staudt, M.R., Kaner, R.J., Strulovici-
Barel, Y., Salit, J., et al. (2017). Smoking-Dependent Distal-to-Proximal Repatterning of the
Adult Human Small Airway Epithelium. Am. J. Respir. Crit. Care Med. 196, 340–352.

Yang, Y., Shen, C., Li, J., Yuan, J., Yang, M., Wang, F., Li, G., Li, Y., Xing, L., Peng, L., et al.
(2020). Exuberant elevation of IP-10, MCP-3 and IL-1ra during SARS-CoV-2 infection is
associated with disease severity and fatal outcome. MedRxiv 2020.03.02.20029975.

Yilin, Z., Yandong, N., and Faguang, J. (2015). Role of angiotensin-converting enzyme (ACE)
and ACE2 in a rat model of smoke inhalation induced acute respiratory distress syndrome.
Burns 41, 1468–1477.

Yu, X., Ng, C.P., Habacher, H., and Roy, S. (2008). Foxj1 transcription factors are master
regulators of the motile ciliogenic program. Nat. Genet. 40, 1445–1453.

Yu, Y., Fuscoe, J.C., Zhao, C., Guo, C., Jia, M., Qing, T., Bannon, D.I., Lancashire, L., Bao, W.,
Du, T., et al. (2014). A rat RNA-Seq transcriptomic BodyMap across 11 organs and 4
developmental stages. Nature Communications 5, 1–11.

Yue, X., Basting, T.M., Flanagan, T.W., Xu, J., Lobell, T.D., Gilpin, N.W., Gardner, J.D., and
Lazartigues, E. (2018). Nicotine Downregulates the Compensatory Angiotensin-Converting
Enzyme 2/Angiotensin Type 2 Receptor of the Renin–Angiotensin System. Annals ATS 15,
S126–S127.

Zang, R., Castro, M.F.G., McCune, B.T., Zeng, Q., Rothlauf, P.W., Sonnek, N.M., Liu, Z.,
Brulois, K.F., Wang, X., Greenberg, H.B., et al. (2020). TMPRSS2 and TMPRSS4 mediate
SARS-CoV-2 infection of human small intestinal enterocytes. BioRxiv 2020.04.21.054015.

Zhang, C., Wu, Z., Li, J.-W., Zhao, H., and Wang, G.-Q. (2020a). The cytokine release
syndrome (CRS) of severe COVID-19 and Interleukin-6 receptor (IL-6R) antagonist Tocilizumab
may be the key to reduce the mortality. International Journal of Antimicrobial Agents 105954.

Zhang, R., Ouyang, H., Fu, L., Wang, S., Han, J., Huang, K., Jia, M., Song, Q., and Fu, Z.
(2020b). CT features of SARS-CoV-2 pneumonia according to clinical presentation: a
retrospective analysis of 120 consecutive patients from Wuhan city. Eur Radiol.

Zhao, Q., Meng, M., Kumar, R., Wu, Y., Huang, J., Lian, N., Deng, Y., and Lin, S. (2020a). The
impact of COPD and smoking history on the severity of Covid-19: A systemic review and meta-
analysis. J. Med. Virol.

Zhao, Y., Zhao, Z., Wang, Y., Zhou, Y., Ma, Y., and Zuo, W. (2020b). Single-cell RNA
expression profiling of ACE2, the putative receptor of Wuhan 2019-nCov. BioRxiv
2020.01.26.919985.
Zhao, Xianxian, Zhang, Bill, Li, Pan, Ma, Chaoqun, Jiawei Gu, Hou, Pan, Guo, Zhifu, Wu, Hong,
and Bai, Yuan (2020). Incidence, clinical characteristics and prognostic factor of patients with
COVID-19: a systematic review and meta-analysis.

Zhou, P., Yang, X.-L., Wang, X.-G., Hu, B., Zhang, L., Zhang, W., Si, H.-R., Zhu, Y., Li, B.,
Huang, C.-L., et al. (2020). A pneumonia outbreak associated with a new coronavirus of
probable bat origin. Nature 579, 270–273.

Zhu, N., Zhang, D., Wang, W., Li, X., Yang, B., Song, J., Zhao, X., Huang, B., Shi, W., Lu, R., et
al. (2020). A Novel Coronavirus from Patients with Pneumonia in China, 2019. New England
Journal of Medicine 382, 727–733.

Ziegler, C.G.K., Allon, S.J., Nyquist, S.K., Mbano, I.M., Miao, V.N., Tzouanas, C.N., Cao, Y.,
Yousif, A.S., Bals, J., Hauser, B.M., et al. (2020). SARS-CoV-2 receptor ACE2 is an interferon-
stimulated gene in human airway epithelial cells and is detected in specific cell subsets across
tissues. Cell 0.
 I
E
A
TCGA - normal GTEx
ACE2 expression
ACE2 expression ACE2 expression (normalized)
(normalized) (normalized)

-2
-1
0
1
2

-2
-1
0
1
2
3
4

-3
-2
-1
0
1
2
3
40 20
y- Yo
y- 29 u
49
y y ng
30
50 y-
39
y-
59 y
y 40 O
y- ld
60 49
y
Mouse lung:

y- 50
69
y y-
59
70 y
y- 60
Age vs. ACE2 expression

79 y-
y

Human lung:

Human lung:
69
80 y
70
B

y- y-
89 79 ACE2 expression
y y

Age vs. ACE2 expression

Age vs. ACE2 expression

(normalized)
-2
-1
0
1
2

Yo

J
ACE2 expression
F u
ACE2 expression ng
(normalized) (normalized)

-2
-1
0
1
2
3
4

-2
0
2
Fe Fe O
m m ld
Rat lung:

al al
e e

M M
al al
e e
Age vs. ACE2 expression

Human lung:

Human lung:
C

Sex vs. ACE2 expression

Sex vs. ACE2 expression

ACE2 expression
(normalized)
G

Lung donors
-2
-1
0
1
2

Fe
ACE2 expression m
al
(normalized) e
-1
0
1
2
3

20
y-
39 M
al
40 y e
Mouse lung:

y-
59
60 y
y-
79
Sex vs. ACE2 expression

y
Human lung:
D

ACE2 expression
(normalized)
Age vs. ACE2 expression
-2
-1
0
1
2

ACE2 expression Fe
(normalized) m
al
e
-1
0
1
2
3

Fe
m
al M
e al
e
Rat lung:

M
al
e
Human lung:
Figure 1

Sex vs. ACE2 expression

Sex vs. ACE2 expression

 Figure 2

A B C D
Mouse lung: Human trachea: Human large airway epithelium:
Smoking vs. ACE2 expression Smoking vs. ACE2 expression Smoking vs. ACE2 expression
*** *** 2 *

ACE2 expression

ACE2 expression
ACE2 expression

2 2
**

(normalized)

(normalized)
(normalized)

1
1 1
0
0 0
-1
-1 -1
-2

rs

rs

rs

rs
m

h
ig

e
Lo
a

iu

ok

ok

ok

ok
Sh

H
ed

Sm

Sm
M

-s

-s
on

on
Smoke exposure

N
E F Smokers vs. non-smokers G Human lung:
Human small airway epithelium:
Smoking vs. ACE2 expression 60 Pack-years vs. ACE2 expression

Thoracic surgery
4
2 *** ***

ACE2 expression
ACE2
-log10(p value)
ACE2 expression

**

(normalized)
(normalized)

1 40 2
0
20 0
-1
1%
5%
-2 10% -2
0
s

19

+
-4 -2 0 2 4 6
er

er

-3

-5

-7

80
0-
ok

ok

20

40

60
log2(FC): smokers vs. non-smokers
m

Sm

Pack-Years
-s
on
N

H Human lung: I Human bronchial epithelium:

J
Former smokers vs. current smokers
Smoking vs. ACE2 expression Smoking vs. ACE2 expression 20
TCGA - normal

3 ACE2
* ***
ACE2 expression

ACE2 expression
Quitting smoking

2 -log10(p value)
(normalized)

(normalized)

2 15
1
1
0 10 1%

0 -1 5%

-1 -2 5 10%

0
s

s
0

59

er

er
60

-6 -4 -2 0 2 4 6
1-

ok

ok

Pack-Years
m

sm
ts

log2(FC): former vs. current

er
en

rm
r
ur

Fo
C
 Figure 3

A B

E F

H
 Figure 4

A B

C Gene ontologies enriched in ACE2+ cells D

extracellular vesicle
membrane
O-glycan processing
secretion
apical plasma membrane
protein glycosylation
export from cell
secretory granule
glycoprotein metabolic process
tight junction
microvillus membrane
response to other organism
oxidoreductase activity
primary lysosome
response to toxic substance
endoplasmic reticulum

0 5 10 15 20 25
-log10(p value)

E Smokers vs. non-smokers: F Smokers vs. non-smokers: G Smokers vs. non-smokers:

Marker genes Cell type frequencies ACE2 expression
50 * Non-smokers 40 *** ***
% cells per cluster

Non-smokers 4

ACE2 counts per

40 Smokers ***
30 Smokers

ACE2+ cell
*** 3
% cells

30
***
20
*** 20
*** 2
***
***
10 10 1
**
<1% <1%
0 0 0
1+

s
lls

lls

lls

te

SM G- s

ry
-s asa
C

63

er

er
te

l
in
XJ

SM cel
ia

to
5A

ce

ce

ce

ok

ok
TP

cy
at

ed

re
b
FO

er

Sm
al

ed

e
no

ec
rm
U

in
lu

-s
lif
as

at
M

Io

cr
t/C

on
te
ro
B

ili

G
do
in
-p

N
le
C

en
al

ob

+
T8
as

ro
G

R
B

eu
K
N

H Non-smokers vs. smokers:

I Smokers vs. non-smokers:
J Former smokers vs. current smokers:
ACE2 co-expression Cell type signatures Cell type signatures
5 * 15 30
Non-smokers Goblet/Club cells
NS
-log10(p value)
-log10(p value)

Neuroendocrine cells
4 NS Ciliated cells
Smokers 10 20 KRT8+ intermediate
% cells

Basal cells Neuroendocrine cells

3 Goblet/Club cells
ACE2+ signature
***
ACE2+ signature
2 5 SMG-secretory 10
*** KRT8+ intermediate
SMG-basal
1 Ionocytes Ionocytes SMG-secretory Ciliated cells
SMG-basal Basal cells Basal-proliferating
Basal-proliferating
0 0 0
-0.3 -0.2 -0.1 0.0 0.1 0.2 0.3 -0.5 -0.4 -0.3 -0.2 -0.1 0.0 0.1 0.2
+

te E2 b
+

+
E2

E2

E2

E2
us C lu

log2(FC): smokers vs. non-smokers log2(FC): former smokers vs. current smokers
rs +
cl r/A t/C
C

C
A

-/A

/A
er ste ble
+/

C
C

O clu Go
5A
5A

C
C

U
U

M
M

th

K L M N
Mouse tracheal explants: Human airway epithelial cells: Human airway epithelial cells: Human airway epithelial cells:
Differentiation vs. ACE2 expression Differentiation vs. ACE2 expression Smoke exposure during differentiation Smoke exposure during differentiation
8 *** 5 1.5 40
***
ACE2 expression
ACE2 expression

ACE2 expression

4 *** SMG-basal
Goblet/Club cells
(normalized)

(normalized)

(normalized)

-log10(p value)

6 ACE2+ signature
1.0 30
3
4
2 0.5 KRT8+ intermediate
2 20
1
Ciliated cells
0 0 0.0 10 Ionocytes
SMG-secretory
-2 -1 Basal-proliferating
-0.5 0
Basal cells Neuroendocrine cells
lls

ia ry

lls

ia ry
n

-0.3 -0.2 -0.1 0.0 0.1 0.2 0.3 0.4 0.5

nt lia

nt ia

am

e
ce

ce
tio

tio

ok
l
re ci

re ci
y

Sh

m
ffe co

ffe co

log2(FC): smoke vs. air

ar

ar

+S
im

im
di Mu

di uM
Pr

Pr
 Figure 5

A B C D
Human airway epithelial cells: Human airway epithelial cells: Human airway epithelial cells: Human airway epithelial cells:
Influenza vs. ACE2 expression RSV vs. ACE2 expression SARS vs. ACE2 expression MERS vs. ACE2 expression
10 *** 10 *** 3
***

ACE2 expression
***
ACE2 expression

ACE2 expression

ACE2 expression
2

(normalized)
(normalized)

(normalized)

(normalized)
2
1
5 5
1
0

-1 0
0 0
-2 -1

i ru y

S
k

za

S
oc

l v or

oc
oc

R
s

oc

ER
en

A
ia at
M

M
M

M
+S
lu

+M
yt ir
nc sp
nf
+I

sy +Re
E F G
Human airway epithelial cells: Human tracheal cells: interferon treatment Human small airway cells: interferon treatment
poly(I:C) vs. ACE2 expression 3 *** *** 6
***
ACE2 expression

ACE2 expression
***
*** ***
** *** *** *** ***
ACE2 expression

***
(normalized)

(normalized)
6 2 ***
4
(normalized)

***
4 1
2 *** ***
2 0
-1 0
0

-2 -2 -2
Untreated

+1 ng/ml
+3.3 ng/ml
+10 ng/ml

+1 ng/ml
+3.3 ng/ml
+10 ng/ml

+1 ng/ml
+3.3 ng/ml
+10 ng/ml

Untreated

+1 ng/ml
+3.3 ng/ml
+10 ng/ml

+1 ng/ml
+3.3 ng/ml
+10 ng/ml

+1 ng/ml
+3.3 ng/ml
+10 ng/ml
k

)
I:C
oc

y(
M

ol
+p

IFN- a2 IFN- IFN- IFN- a2 IFN- IFN-

H Human airway epithelial cells:
IFN- treatment
4
***
ACE2 expression
(normalized)

3
2
1
0
-1
ed

-
FN
at
re

+I
nt
U
eTOC blurb

Smith et al. report that smokers’ lungs harbor higher levels of the coronavirus receptor ACE2.
They further demonstrate that ACE2 is expressed in a subpopulation of secretory cells that
expand in response to smoke exposure. Finally, they establish that ACE2 is an interferon-
stimulated gene that is upregulated by viral infections.

Highlights

• Lung ACE2 levels do not vary by age or sex, but smokers exhibit upregulated ACE2.

• ACE2 is expressed in several lung cell types, including the secretory lineage.

• Chronic smoking triggers the expansion of ACE2+ secretory cells.

• ACE2 is also upregulated by viral infections and interferon exposure.