Scribd Logo
Upload

Welcome to Scribd!

  • 122 views

    MANAS, Biochem Lab June 29 PDF

    Uploaded by

    lovelykiss
    The document summarizes the key steps and enzymes involved in DNA replication, transcription, and translation. It describes how the leading strand is synthesized continuously while the lagging strand is synthesized discontinuously in fragments called Okazaki fragments. The main enzymes involved in DNA replication include helicase, gyrase, primase, DNA polymerase III, DNA polymerase I, and ligase. The process of transcription involves RNA polymerase enzymes copying DNA to produce mRNA, which is then translated by the ribosome into a protein with the assistance of tRNA.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd

    MANAS, Biochem Lab June 29 PDF

    Uploaded by

    lovelykiss
    122 views2 pages
    The document summarizes the key steps and enzymes involved in DNA replication, transcription, and translation. It describes how the leading strand is synthesized continuously while the lagging strand is synthesized discontinuously in fragments called Okazaki fragments. The main enzymes involved in DNA replication include helicase, gyrase, primase, DNA polymerase III, DNA polymerase I, and ligase. The process of transcription involves RNA polymerase enzymes copying DNA to produce mRNA, which is then translated by the ribosome into a protein with the assistance of tRNA.

    Original Title

    MANAS, Biochem lab june 29.pdf

    Copyright

    © © All Rights Reserved

    Available Formats

    PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    The document summarizes the key steps and enzymes involved in DNA replication, transcription, and translation. It describes how the leading strand is synthesized continuously while the lagging strand is synthesized discontinuously in fragments called Okazaki fragments. The main enzymes involved in DNA replication include helicase, gyrase, primase, DNA polymerase III, DNA polymerase I, and ligase. The process of transcription involves RNA polymerase enzymes copying DNA to produce mRNA, which is then translated by the ribosome into a protein with the assistance of tRNA.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Download as pdf or txt
    122 views2 pages

    MANAS, Biochem Lab June 29 PDF

    Uploaded by

    lovelykiss
    The document summarizes the key steps and enzymes involved in DNA replication, transcription, and translation. It describes how the leading strand is synthesized continuously while the lagging strand is synthesized discontinuously in fragments called Okazaki fragments. The main enzymes involved in DNA replication include helicase, gyrase, primase, DNA polymerase III, DNA polymerase I, and ligase. The process of transcription involves RNA polymerase enzymes copying DNA to produce mRNA, which is then translated by the ribosome into a protein with the assistance of tRNA.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Download as pdf or txt
    of 2

    MANAS, Sandra Alexis A.

    June 29, 2020


    BIOCHEM LAB

    DNA REPLICATION
    1. Make a concept map illustrating the process of DNA replication

    2. Differentiate leading and lagging strands

    A leading strand is the strand which is synthesized in the 5'-3'direction


    while a lagging strand is the strand which is synthesized in the 3'-5' direction.
    The leading strand is moving towards the replication fork so it is synthesized
    continuously while a lagging strand is moving away from the replication fork so it
    is synthesized in fragments which are called Okazaki fragments.

    3. 3. What are the enzymes involved in DNA replication and what are their functions?
    • Helicase – they unwind the DNA double helix
    • Gyrase – they relieve the buildup of torque during unwinding
    • Primase – they are the ones who lays down RNA primers
    • DNA polymerase III - these are the main DNA synthesis enzyme
    • DNA polymerase I - they replace RNA primers with DNA
    • Ligase – the ones who fills in the gaps

    4. What are Okazaki fragments?


    Okazaki Fragments are short sequences of DNA nucleotides which are
    synthesized discontinuously and later linked together by the enzyme DNA
    ligase to create the lagging strand during DNA replication.

    5. Describe the process of transcription and translation


    Transcription is the process by which DNA is copied (transcribed) to
    mRNA, which carries the information needed for protein synthesis. Transcription
    takes place in two broad steps. First, pre-messenger RNA is formed, with the
    involvement of RNA polymerase enzymes. The process relies on Watson-Crick
    base pairing, and the resultant single strand of RNA is the reverse-complement
    of the original DNA sequence. Second, the pre-messenger RNA is then "edited"
    to produce the desired mRNA molecule in a process called RNA splicing.

    Translation is the process by which mRNA directs protein synthesis with


    the assistance of tRNA. The mRNA formed in transcription is transported out of
    the nucleus, into the cytoplasm, to the ribosome (the cell's protein synthesis
    factory). Here, it directs protein synthesis. Messenger RNA is not directly
    involved in protein synthesis − transfer RNA (tRNA) is required for this.

    6. Try to decode a protein. Indicate where it stops and ends. How did you arrive at
    your answer? Explain.
    According to the third video the peptide formed was Met-Pro-Arg-Val-Ser
    from the chain {GACCAUGCCGCGAGUGUCGUGACCAG}, in order to identify
    the peptides formed in a chain the first step is to find the Starting codon which is
    AUG this codon equates to Met and throughout the translation process continue
    to identify the different each codon and identify their equivalent peptide name using
    the given sheet, until you come across either UAA, UAG, or UGA which is the
    indication that the translating process is to be stopped, in the example given the
    stop codon signal is UGA.

    7. You may indicate the answers to the other questions in your concept map except
    for 5 and 6. Please highlight for easy identification.

    REFERENCES

    Transcription, Translation and Replication. (n.d.). Retrieved June 29, 2020, from
    https://www.atdbio.com/content/14/Transcription-Translation-and-Replication

    Schafferer, S. (n.d.). Retrieved June 29, 2020, from


    http://www.rnomics.at/index.php/projects/protsynthanddecgroupmenu

    Decoding DNA-Modeling Protein Synthesis. (2020, March 04). Retrieved June 29, 2020,
    from https://kscorn.com/lesson/dnalesson/

    What enzymes are used in DNA replication?: Socratic. (2014, October 19). Retrieved
    June 29, 2020, from https://socratic.org/questions/what-enzymes-are-used-in-dna-
    replication

    Berg JM, Tymoczko JL, Stryer L. Biochemistry. 5th edition. New York: W H Freeman;
    2002. Section 27.4, DNA Replication of Both Strands Proceeds Rapidly from Specific
    Start Sites.Available from: https://www.ncbi.nlm.nih.gov/books/NBK22587/

    You might also like