See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/26867672

Role of Intracellular Polysaccharide in Persistence of Streptococcus mutans

Article  in  Journal of bacteriology · October 2009

DOI: 10.1128/JB.00425-09 · Source: PubMed

CITATIONS READS

35 194

4 authors, including:

Katarzyna Mackiewicz Bettina A Buttaro

The Children's Hospital of Philadelphia Temple University
15 PUBLICATIONS   405 CITATIONS    45 PUBLICATIONS   2,006 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Drug discovery View project

Synthesis And Biological Evaluation of Macrolide Antibiotics View project

All content following this page was uploaded by Katarzyna Mackiewicz on 26 May 2014.

The user has requested enhancement of the downloaded file.

JOURNAL OF BACTERIOLOGY, Dec. 2009, p. 7315–7322 Vol. 191, No. 23
0021-9193/09/$12.00 doi:10.1128/JB.00425-09
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Role of Intracellular Polysaccharide in Persistence of

Streptococcus mutans䌤
Monica Busuioc, Katarzyna Mackiewicz,† Bettina A. Buttaro, and Patrick J. Piggot*
Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, Pennsylvania 19140
Received 27 March 2009/Accepted 21 September 2009

Intracellular polysaccharide (IPS) is accumulated by Streptococcus mutans when the bacteria are grown in
excess sugar and can contribute toward the cariogenicity of S. mutans. Here we show that inactivation of the
glgA gene (SMU1536), encoding a putative glycogen synthase, prevented accumulation of IPS. IPS is important
for the persistence of S. mutans grown in batch culture with excess glucose and then starved of glucose. The IPS
was largely used up within 1 day of glucose starvation, and yet survival of the parental strain was extended by
at least 15 days beyond that of a glgA mutant; potentially, some feature of IPS metabolism distinct from
providing nutrients is important for persistence. IPS was not needed for persistence when sucrose was the
carbon source or when mucin was present.

Streptococcus mutans is a facultative colonizer of the human present in the same order in the genome of S. mutans (29);
dental plaque, the microbial pellicle that covers the surface of they are thought also to form an operon.
the teeth. It is the major etiological agent of dental caries (17). The IPS can be used as a source of carbohydrate for fer-
Sugar metabolism is central to the behavior of S. mutans (4, 7). mentation upon nutrient depletion (11, 13). In planktonic cul-
It can use a variety of sugars. The sugars are fermented by tures, IPS reserves are largely consumed within 12 h of the
glycolysis with production of organic acids, particularly lactic imposition of sugar starvation (11, 13, 32). In S. mutans, IPS
acid (4, 7). In addition to providing energy, sucrose is used to utilization may prolong acid production and hence the period
produce extracellular polysaccharides to form the biofilm ma- of lowered pH of the resting (between meals) plaque, a factor
trix that aids in the association of S. mutans with the dental that contributes to the incidence of caries. Indeed, IPS is im-
plaque. Once the S. mutans biofilm becomes part of the dental plicated in dental caries: a mutant that synthesized elevated
plaque, the acidic by-products of sugar fermentation dissolve levels of IPS was hypercariogenic in germfree rats (27). Strains
tooth enamel, eventually resulting in dental caries (17). The isolated from human carious lesions were nearly all stable IPS
presence of sugars in the dental plaque is periodic and reflects producers, whereas most strains from caries-inactive persons
the intake of dietary sugars. If there is excess sugar available, in were variable IPS producers (13, 33).
addition to producing organic acids and matrix, intracellular Since S. mutans deep in the dental plaque may not have
(iodophilic) polysaccharide (IPS; glycogen) is formed. access to nutrients because of competition with the bacteria at
The IPS of S. mutans is a polymer of the glycogen-amylopec- the surface of the plaque, the bacteria may need to survive
tin type, with ␣-(1, 4)- and ␣-(1, 6)-linked glucose, and is stored longer periods of nutrient starvation. Previous studies in our
as intracellular granules (10). Intracellular glycogen storage laboratory showed that S. mutans can survive under sugar
reserves in various bacterial species are synthesized from glu- starvation conditions, provided that the pH remains above
cose-1-P via ADP-glucose (1). The synthesis involves at least ⬃5.5 (22). The presence of spent medium and mucin signifi-
three enzymes: glycogen synthase, glucose-1-phosphate pyro- cantly prolonged survival of sugar-starved biofilms and batch
phosphorylase, and branching enzyme. The genes encoding cultures (22; also unpublished observations). Here we examine
these enzymes are commonly found in a glg operon, although the role of IPS.
the order of genes differs between species. In two gram-posi- The role of IPS (glycogen) in bacterial survival has been
tive species, Bacillus subtilis and Bacillus stearothermophilus, tested for several other bacterial species. It was found to ex-
the gene order is glgB-glgC-glgD-glgA-glgP (15, 29): glgA en- tend survival of Aerobacter aerogenes (8) and Escherichia coli
codes glycogen synthase, glgB encodes glucan branching en- (28). Intracellular glycogen was also shown to support the
zyme, and glgC and glgD encode subunits of glucose-1-phos- survival of Streptococcus mitis during stationary-phase starva-
phate pyrophosphorylase. The glgP gene encodes glycogen tion (32). In contrast, glycogen-rich Sarcina lutea died at a
phosphorylase, which is unlikely to be involved in glycogen higher rate during starvation than did bacteria without glyco-
synthesis (29). Genes putatively encoding similar enzymes are gen (2).
In order to test the role of IPS in S. mutans survival, we con-
structed an IPS-deficient mutant by inactivating glgA (GenBank
* Corresponding author. Mailing address: Department of Microbi- SMU.1536) (http://www.oralgen.lanl.gov/), putatively encoding
ology and Immunology, 3400 North Broad Street, Philadelphia, PA the glycogen synthase. We also constructed a mutant poten-
19140. Phone: (215) 707-7927. Fax: (215) 707-7788. E-mail: piggotp tially altered in IPS metabolism by inactivating the putative
@temple.edu.
† Present address: Department of Pediatrics, University of Pennsyl-
pullulanase structural gene, pul (SMU.1541). Pullulanases are
vania School of Medicine, Philadelphia, PA 19104. responsible for hydrolyzing ␣-(1,6) linkages (and in some cases
䌤
Published ahead of print on 2 October 2009. 1,4 linkages) in pullulan and in other polysaccharides (35) and

7315
7316 BUSUIOC ET AL. J. BACTERIOL.

TABLE 1. S. mutans strains used amphenicol, 10 ␮g/ml; erythromycin, 25 ␮g/ml. All the cloning procedures were
carried out with E. coli DH5␣, which was grown in Luria-Bertani lysogeny broth
a
Strain Relevant genotype Source (LB). The antibiotic concentrations used for E. coli were as indicated: kanamy-
cin, 50 ␮g/ml; chloramphenicol, 50 ␮g/ml; erythromycin, 300 ␮g/ml.
SL13178 ⌬pul (pul::kan) This study
Batch culture growth and survival. Overnight cultures grown in FMC with 24
SL13180 ⌬glgA (glgA::kan) This study
SL14602 ⌬fruAB (fruAB::cat) This study mM glucose were diluted 25-fold into fresh FMC containing limiting or excess
SL14642 ⌬glgA ⌬fruAB (glgA::kan fruAB::cat) This study sugar. Bacteria were grown in stationary culture tubes in a 5% CO2 incubator at
SL14646 ⌬pul ⌬fruAB (pul::kan fruAB::cat) This study 37°C. Growth was monitored with a BioMate 3 spectrophotometer (Thermo
SL15068 UA159 with pMC50 关Pspac(Hy)兴 This study Electron Scientific Instrument Corporation) by measuring the optical density at
SL15070 UA159 with pMC51 关Pspac(Hy)-glgA兴 This study 675 nm (OD675). For determinations of survival, 25-ml cultures were grown in
SL15072 SL13180 with pMC50 关glgA::kan Pspac(Hy)兴 This study 50-ml culture tubes at 37°C and 5% CO2. At different times, samples were
SL15074 SL13180 with pMC51 关glgA::kan This study removed and serial dilutions of each culture were made in phosphate-buffered
Pspac(Hy)-glgA兴 saline (PBS; 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, and 1.4 mM
KH2PO4) and plated onto TH agar. Survival was documented as CFU per ml of
a
All strains have the genetic background of S. mutans UA159. culture. The limit of detection was 10 CFU/ml.
Transformation of S. mutans. S. mutans was transformed using the method of
Lindler and Macrina (16). Briefly, a 5-ml culture of S. mutans UA159 was grown
may be important in determining the branching in IPS and/or overnight in TH broth, at 37°C. The overnight culture was diluted 25-fold into
fresh TH broth containing 10% glucose and 10% heat-inactivated horse serum
affecting the catabolism of IPS. We studied the persistence of (MP Biomedicals, Inc.), which has been shown to induce competence in S.
bacteria under conditions of sugar limitation and of sugar mutans (19). The bacteria were allowed to grow at 37°C for 3.5 h, a time reported
excess in both batch cultures and biofilms. We found that IPS to give optimal transformation of S. mutans (16). A 0.5-ml portion of this culture
can play a role in supporting S. mutans persistence in batch was transferred to a 13-ml culture tube containing various concentrations (0.5 to
cultures but found no role for IPS in survival in biofilms. 10 ␮g/ml) of plasmid or chromosomal DNA and incubated at 37°C for 2 h.
Transformants were selected on TH agar containing the appropriate antibiotic;
transformant colonies were generally obtained after 2 days of incubation at 37°C
MATERIALS AND METHODS in a 5% CO2 incubator.
Bacterial strains and growth conditions. The parental strain was S. mutans Construction of S. mutans deletion mutants. The glgA and pul genes were
UA159. Other strains are listed in Table 1. Strains were stored in 15% glycerol disrupted by double crossover recombination with plasmid donors. The plasmids
at ⫺76°C and revived for experiments by growth overnight at 37°C in a 5% CO2 were constructed using a vector, pVK262, that lacks an origin of replication for
incubator in either Todd-Hewitt (TH) broth (Difco, Detroit, MI) or chemically gram-positive organisms and contains a kanamycin resistance cassette. The re-
defined medium (FMC) (30) supplemented with 24 mM glucose or on TH agar. sulting plasmids contained fragments of about 600 bp of S. mutans DNA flanking
The FMC (30) was supplemented with 100 mM glucose or 50 mM sucrose to the kan cassette. These fragments were regions immediately 5⬘ and 3⬘ and
achieve sugar excess conditions. It was supplemented with 6 mM glucose or 3 extending into glgA (pKM6) or pul (pKM4) and were PCR amplified from the
mM sucrose to achieve sugar-limited conditions (22). The flow cell biofilm parental strain chromosomal DNA by using specific primers (Table 2). The
starvation medium was fresh FMC with no sugar. TH agar was used; when pKM4 and pKM6 plasmids was designed to replace a DNA fragment between
appropriate, it was supplemented with 2% glucose. A 5% stock solution of type codon 117 and codon 500 of the pul open reading frame (ORF) and from codon
III pig gastric mucin (Sigma, St. Louis, MO) was prepared by dissolving the 176 to codon 330 of the glgA ORF, respectively, with the kan gene; there was no
mucin powder in 0.01 M potassium phosphate buffer (K2HPO4-KH2PO4, 21:4). transcription terminator downstream of the kan gene. The plasmids were used to
When indicated, it was added to the culture medium to a final concentration of transform S. mutans UA159, selecting for kanamycin resistance. Transformants
0.5% and filter sterilized. When appropriate, S. mutans was grown in the pres- were isolated and tested for disruption of glgA or pul by double crossover
ence of antibiotics at the concentrations indicated: kanamycin, 300 ␮g/ml; chlor- recombination (Fig. 1). Replacement of pul and glgA with kan by double cross-

TABLE 2. Primers used in this study

Region, fragment, or gene Primer Sequence (5⬘–3⬘)

glgA 3⬘ region glgA Fw.5 TACATGAATTCCATCAGGCTATGCTGATTT

glgA Rev.6 ATGTATACGTAAGCTAGTTCTTTATATAGA

glgA 5⬘ region glgA Fw.7 ATACAGCCGGAAGGGCTAGCAGCGGAAGG

glgA Rev.8 TTCAATCCTTCTATGTTAGGGCCCTTCCGGCGTAT

pul 3⬘ region 3⬘ pul Fw.7 ATCGAGAATTCGGTGCTGAAGTTTACGGCGGGCTCCT

3⬘ pul Rev.8 TGCTAGTACGTAGCGTTTTATATTTGT

pul 5⬘ region pul Fw.5 TCATGAAGGCACCATTAGAATTCTTTGCTA

pul Rev.6 TAGTAGATTAGGTGCCAGTTTTATCT

Overlapping PCR fragment 1 (IGR62-cat) OL PCR Fw.1 GATATCTGACTGATGAAACAGCATCG

OL PCR Rev.2 cat-1 AACAAATTTTCATCAATTCCTTGCTCTCCTTT

Overlapping PCR fragment 2 OL PCR Fw.3 cat-2 ATGACTGGCTTTTATAACAGCAATAAAACT

(cat-IGR63-hrcA) OL PCR Rev.4 CGAAAAGCTTCAAAATCAAATGCC

cata gene for overlapping PCR cat gene Fw.1 TTGATGAAAATTTGTTTGATTTT

cat gene Rev.2 TTATAAAAGCCAGTCATTAGGCC

glgA gene for complementation studies glgA gene Complem. Fw.1 SmaI CCAGCCCGGGAAAGCAAGTGAAGTTG
glgA gene Complem. Rev.2 BglI CGGCGCCATTCAGGCTAAGCTAGTTCTTTATATAG
a
The cat gene was amplified from pR326 (6).
VOL. 191, 2009 INTRACELLULAR POLYSACCHARIDE OF S. MUTANS 7317

FIG. 1. Schematic representation of genetic regions studied. (A) The pul and glg region of the S. mutans UA159 genome. The glg and pul genes
are indicated by arrows. IGR indicates an intergenic region. The sites of gene replacement of pul and glgA by a kan cassette are shown below. The
pul gene was inactivated by replacing an internal fragment of the gene (positions 1469911 to 1468763 of the S. mutans genome [http://www.oralgen
.lanl.gov/], the deleted 1,148 bp corresponding to 383 codons of the ORF) with a kan cassette. Similarly, the glgA gene was inactivated by replacing
an internal fragment (positions 1462665 to 1463113, the deleted 448 bp corresponding to 149 codons of the ORF) with a kan cassette. (B) The
fru region. The fruA and fruB genes are indicated by arrows. The region of gene replacement by a cat cassette is shown below; the region replaced
was between positions 77576 and 83477 and encompassed both ORFs (http://www.oralgen.lanl.gov/).

over in strains SL13778 and SL13780, respectively (Fig. 1), was confirmed by samples and used as a blank. IPS content was expressed in adjusted OD units (9,
appropriate PCR. 10). For determination of IPS production, cultures were assayed approximately
A strain with the adjacent fruA and fruB genes deleted was constructed by long 8 h after the end of exponential growth in FMC containing different concentra-
flanking PCR (34). Specific primers were designed to replace the entire fruA and tions of glucose or sucrose. The amount of IPS present did not change substan-
fruB ORFs with a chloramphenicol resistance (cat) cassette (Table 2). Replace- tially during the first 16 h after the end of exponential growth, provided that
ment of fruA-fruB with cat by double crossover recombination in strain SL14602 sugar remained present (9, 10; unpublished observations).
was confirmed by appropriate PCR. The ⌬fruAB::cat construct was introduced Flow cell biofilms. Biofilms were grown in flow cell chambers as described
into strains SL13778 and SL13780 to produce strains SL14646 and SL14642, previously (18, 22). S. mutans was grown overnight in batch cultures in FMC
respectively. Details of constructions are available on request. containing 24 mM glucose in a 5% CO2 incubator at 37°C. The bacteria were
Complementation of a ⌬glgA mutant. Plasmids pMC50 and pMC51 were diluted 25-fold into fresh FMC containing 24 mM glucose and were allowed to
constructed using the pJAR2 plasmid, which has an origin of replication for S. grow for 4 to 5 h. The bacteria were washed twice with PBS or sterile water and
mutans and carries an erythromycin resistance gene, erm (5). pJAR2 was di- then diluted to an OD675 of 0.1. Five hundred microliters of the diluted culture
gested with PvuI, the ends were made blunt and then digested with EcoRV, and was injected directly into the flow chamber tubing with a syringe. Immediately
the 6.3-kb vector fragment was purified by electrophoresis. The Pspac(Hy) pro- after all chambers were inoculated, a flow (200 ␮l min⫺1) of FMC containing 50
moter (21), lacking the associated repressor sequence and thus being constitu- mM sucrose and 15 mM NaHCO3 was started using an Ismatec (Glattbrugg,
tively expressed, was extracted from pVK55 as a 321-bp EcoRI-BglII fragment, Switzerland) digital pump. The chambers were initially inverted for 20 min to
and the ends were filled in with Klenow polymerase. This promoter fragment was allow the bacteria to adhere to the glass coverslip, and then the chambers were
ligated to the 6.3-kb fragment from pJAR2 to yield pMC50, which is the control returned to an upright position and incubated for 16 to 18 h at 37°C before
empty vector plasmid. The glgA gene was PCR amplified using UA159 chromo- examination. When the role of IPS in biofilm survival was being tested, chambers
somal DNA as template and primers containing SmaI and BglI restriction en- were incubated with FMC with 50 mM sucrose and 15 mM NaHCO3 for 10 h
zyme sites (Table 2). These sites were also present downstream of the Pspac(Hy) before the imposition of sugar starvation; chambers established for longer times
promoter in pMC50, allowing for directional cloning of the glgA gene. The were prone to clogging.
resulting plasmid, pMC51, was introduced in UA159 (parental strain) and Static biofilms. Static biofilms of S. mutans were established in 24-well plates
SL13180 (⌬glgA), giving rise to SL15070 and SL15074, respectively. For vector containing 12-mm-diameter sterile coverslips (Fisherbrand; Fisher Scientific,
control, we introduced pMC50 into the parental strain and the ⌬glgA mutant, Pittsburgh, PA). S. mutans was inoculated in 5 ml FMC containing 24 mM
giving strains SL15068 and SL15072, respectively. glucose and incubated overnight at 37°C in a 5% CO2 incubator. These cultures
IPS determination. Bacteria were streaked on TH agar containing 2% glucose were diluted 25-fold into fresh FMC containing 24 mM glucose and incubated for
and incubated for 2 days either in a 5% CO2 incubator or in a candle jar at 37°C. 4 to 6 h. The bacteria were harvested by centrifugation, washed twice with 5 ml
Then the agar plates were flooded with 3 ml of 0.2% (wt/vol) iodine in 2.0% PBS, and then diluted to a nominal OD675 of 0.001 in FMC containing the
(wt/vol) potassium iodide solution. IPS was detected by the rapid formation of a indicated concentration of sugar. Each well was inoculated with 1 ml of culture,
brown pigment. and the plates were incubated at 37°C in a 5% CO2 incubator for 14 h. When
The IPS content of bacterial cultures was determined by the chemical method appropriate, the spent medium was removed from biofilms developed with 3 mM
of DiPersio et al. (9, 10). Ten-milliliter samples from cultures were heated for 5 sucrose, filter sterilized, and kept on ice. The supernatant of the biofilms grown
min at 100°C. Bacteria were collected by centrifugation at 4,000 ⫻ g for 10 min in excess sugar was also removed; the biofilms were washed by gently pipetting
and washed twice with ice-cold water. Bacterial suspensions were adjusted to 5.0 1 ml of PBS in each chamber, and then 1 ml of either spent medium from the
nominal OD675 units in 1 ml ice-cold water for the IPS determinations. One- biofilms developed in limiting sugar concentrations or fresh FMC was added to
milliliter amounts were placed in 15-ml conical tubes, and 0.3 ml of 5.3 M KOH the chambers to induce starvation.
was added to each tube. Tubes were covered and placed in a boiling water bath To monitor biofilm survival, supernatant was removed and the well was
for 90 min. After cooling, the now-clear solutions were neutralized by the addi- washed twice with 1 ml PBS to remove planktonic bacteria. The glass coverslip
tion of 0.3 ml of HCl (5.3 M). The tubes were vortexed, and 1.0 ml of 1.0 M was extracted from the chamber with sterile forceps and placed in 5 ml PBS in
potassium phosphate, pH 7.0, was added. After mixing, 0.6 ml of freshly prepared a 15-ml conical tube, which was kept on ice. To disperse bacteria from the
0.2% (wt/vol) iodine in 2.0% (wt/vol) potassium iodide solution was added with biofilm, the biofilm-covered coverslip was sonicated using a cell disrupter (Sonic
mixing. The OD520 was determined using a BioMate 3 spectrophotometer. A Dismembrator, model 500; Fisher Scientific, Pittsburgh, PA) with a microtip for
1.0-ml amount of water was treated in a manner similar to that for the bacterial 20 s at a voltage amplitude of approximately 60%. The suspension was serially
7318 BUSUIOC ET AL. J. BACTERIOL.

diluted in PBS and plated on TH agar. The results were recorded in CFU per
well.
Biofilm imaging. Flow cell chambers were disconnected from the tubing and
inverted for microscopy. Static biofilms were visualized by removing the glass
coverslip from the microtiter plate well and carefully inverting it over a 10-well
multitest slide (ICN Biomedicals, Inc.). Biofilms were stained using the BacLight
stain (Invitrogen; Molecular Probes) as described previously (19). Images were
captured using a Leica DM IRE2 microscope with a TCS SL system, using a
100⫻ oil-immersion objective and Leica imaging software.

RESULTS
Inactivation of putative genes for IPS metabolism. Analysis
of the annotated S. mutans genome sequence (http://www
.oralgen.lanl.gov/) suggested that the putative genes for glyco-
gen synthesis form an operon, with the order being glgB-glgC-
glgD-glgA-glgP (Fig. 1A). The pul gene lies immediately
upstream of this glg operon and is separated from it by an
intergenic space of 219 nucleotides, which contains a likely
transcription terminator (http://www.oralgen.lanl.gov/). The
putative glycogen synthase for IPS synthesis is encoded by glgA
(SMU1536). We inactivated glgA by replacement of a 448-bp
internal fragment of the gene with a kanamycin resistance
cassette via double crossover recombination (Fig. 1). We sep-
arately inactivated pul, thought to encode a pullulanase for
modification and/or metabolism of IPS, by a similar method.
The starch-iodide method was used to test for IPS synthesis in
bacterial colonies that had been grown on TH agar containing
2% glucose for 48 h at 37°C. Colonies of the parental strain
UA159 gave a dark brown color, whereas those of the glgA FIG. 2. Comparison of IPSs formed by the parental strain S. mu-
mutant gave a yellow color, suggesting that the mutant lacked tans UA159 and glgA and pul mutants (SL13180 and SL13178, respec-
tively) grown at different sugar concentrations. (A and B) Bacteria
IPS. Colonies of the pul mutant gave a brown color, similar to
were grown in FMC containing glucose (A) or sucrose (B), and IPS
colonies of the parental strain. The chemical method of was determined 8 h after the end of exponential growth. (C) Change in
DiPersio et al. (9) was used to quantify IPS production. IPS content after transfer to spent medium of bacteria grown in FMC
Bacteria were grown in the chemically defined medium FMC containing 100 mM glucose. Numbers are the averages of three exper-
(30) containing 100 mM glucose or 50 mM sucrose. The pa- iments ⫾ standard deviations.
rental strain and the pul mutant, SL13178, formed substantial
amounts of iodine-reactive material (IPS), whereas the glgA
mutant, SL13180, exhibited only background levels of iodine- in 6 mM glucose. The transfer to the spent medium had pre-
reactive material (Fig. 2). Production of IPS was restored by viously been shown to prolong survival, presumably because it
the introduction into SL13180 of pMC51, an autonomously provided some important product that had been secreted into
replicating plasmid containing an intact copy of the glgA gene the medium and also avoided the damaging effects of low pH
expressed from the Pspac(Hy) promoter (as determined by plate (spent medium from cultures grown with 100 mM glucose had
assay). No IPS accumulation was detected when SL13180 was a pH below the critical threshold for survival [22]). Under
transformed with the vector control plasmid pMC50. Thus, the these conditions, the glgA and pul mutants survived for 5 to 8
loss of IPS production in strain SL13180 was because of glgA days (Table 3), with a representative survival curve shown in
inactivation and not because of any polar effect on a down- Fig. 3A. In contrast a subpopulation of the parental strain
stream gene. When bacteria were grown in FMC with only 6 UA159 persisted for much longer (Fig. 3A). The same results
mM glucose or 3 mM sucrose, none of the strains formed a were obtained whether the spent medium was derived from
significant amount of IPS (Fig. 2). We were unable to assay IPS strain UA159, the glgA mutant, or the pul mutant. When a
accurately for bacteria grown in biofilms, probably because of plasmid-borne copy of the intact glgA gene was introduced into
inefficient removal of the extracellular polysaccharide matrix of the glgA mutant, survival (⬎35 days; strain SL15074, Table 3)
the biofilms. was comparable to that of the parental strain, UA159. In con-
Role of IPS in the persistence of S. mutans in batch cultures. trast, introduction of the empty plasmid vector did not affect
We tested the persistence of the glgA and pul mutants under survival of the glgA mutant. Neither plasmid affected the sur-
conditions that were modified from those described by Renye vival of the parental strain, UA159. Thus, the effect on survival
et al. (22). Bacteria were grown in FMC containing 100 mM of glgA inactivation was direct and not because of a polar effect
glucose for 14 h. At this time, the bacteria had accumulated on a downstream gene. The extent of the persistence of the
IPS. Bacteria were then harvested by centrifugation, washed, parent varied considerably between experiments, but the per-
and resuspended in an equal volume of filter-sterilized spent sistence was always at least 15 days longer than that of the
medium from a 14-h culture of the corresponding strain grown mutants and always at least 21 days (Table 3).
VOL. 191, 2009 INTRACELLULAR POLYSACCHARIDE OF S. MUTANS 7319

TABLE 3. Persistence of S. mutans strains in batch culturesb mM NaHCO3 for 10 h. The biofilms were then perfused with
Latest time at which viable
fresh FMC containing NaHCO3 but lacking sucrose. Survival
bacteria were recovered of bacteria in the biofilms was monitored by dispersing the
Strain Mucin
(days in stationary phase) bacteria and testing their viability on TH agar. Under these
in different experiments
conditions, UA159 survived for about 8 days. There was no
SL13180 (glgA::kan) ⫺ 6, 6, 6, 6, 7, 8 significant difference in survival between the parental strain
SL13178 (pul::kan) ⫺ 5, 5, 5, 6, 6, 6 and the glgA and pul mutants. Nor was there any difference in
UA159 ⫺ 21, 35, 35, 97, 104
SL13180 (glgA::kan) ⫹ 51, 65, 66, 75
biofilm structure. It is plausible to think that strain UA159
SL13178 (pul::kan) ⫹ 70, 102, 126 would have accumulated IPS, although the presence of the
UA159 ⫹ 71, 75, 87, 95 extracellular matrix prevented direct determination of IPS. If
SL15072 关glgA::kan Pspac(Hy)兴 ⫺ 3, 3a this inference is correct, then IPS did not support longer sur-
SL15074 关glgA::kan Pspac(Hy)-glgA兴 ⫺ 59, 59 vival of the parental strain, in contrast to the effect observed
a
These cultures were alive at day 3 and dead at day 10. with batch cultures.
b
Bacteria were cultured in FMC containing 100 mM glucose and then trans- A significant difference between the studies of batch cultures
ferred to FMC containing spent medium from cultures of the same strain grown
in FMC with 6 mM glucose. Cultures did (⫹) or did not (⫺) contain 0.5% mucin. and those of flow cell biofilms was the way in which sugar
starvation was imposed. With batch cultures, starvation was
imposed by transferring bacteria from sugar-rich growth me-
dium into spent medium from a sugar-limited culture. In con-
There was no difference between the mutants and the parent trast, sugar starvation was induced in flow cell biofilms by
strain in the pH of cultures: the pH after 16 h of growth in sudden removal of sucrose from the fresh medium being sup-
FMC containing 100 mM glucose or 50 mM sucrose was ⬃4.5; plied to the biofilm. Our studies with batch cultures indicate
the corresponding cultures with 6 mM glucose or 3 mM su- that the difference in sugar starvation conditions between
crose were at pH ⬃6.0, which was maintained throughout spent medium and fresh medium can be important for survival
survival experiments. It is formally possible that the mutants (J. A. Renye, Jr., P. J. Piggot, and B. A. Buttaro, unpublished
were more sensitive to stress even though they were not subject data); it may be that the spent medium contains metabolites
to lower pH than was the parent. However, we detected no
difference between the mutants and the parent strain in their
sensitivity to the oxidative stress caused by 0.2% hydrogen
peroxide, suggesting that the mutants did not display a general
sensitivity to stress.
The survival of the parent was longer than that obtained by
Renye et al. (22) because cultures were incubated in an atmo-
sphere containing 5% CO2 as opposed to ambient atmosphere
in the presence of bicarbonate buffer. We think it likely that
the bicarbonate buffer failed to maintain an adequate CO2
environment, and so survival was impaired.
The IPS content of the parental strain UA159 and the pul
mutant had declined substantially within 1 day of transfer to
the starved medium and by day 3 approached background
level, comparable to the level in the glgA mutant (Fig. 2C). This
result is in good agreement with previous studies of oral bac-
teria, which showed that the intracellular glycogen reserves are
largely metabolized within 12 h of the removal of sugar (11, 13,
32). Thus, the effect of IPS accumulation on survival extends
well beyond its utilization.
We had previously found that inclusion of 0.5% mucin in
FMC could extend the survival of batch cultures of the paren-
tal S. mutans strain UA159 (22). Addition of 0.5% mucin also
extended the survival of the glgA and pul mutants grown in
FMC containing 100 mM glucose and transferred to spent
medium (Fig. 3B). Indeed their survival reached values com-
parable to those of the parental strain UA159 (Table 3). Ad-
dition of 0.5% starch had an effect very similar to that of the
addition of mucin. The mucin had little if any effect on the FIG. 3. Effect of glgA and pul mutations on the persistence of S.
accumulation or metabolism of IPS by strain UA159 or the pul mutans cultures grown in FMC containing 100 mM glucose. After
mutant (data not shown); the presence of exogenous starch overnight growth, bacteria were transferred to spent medium without
interfered with the assay for IPS. (A) or with (B) 0.5% mucin. Survival was determined as CFU obtained
from 1 ml of culture. Filled squares, S. mutans UA159; open squares,
IPS deficiency and the persistence of S. mutans in biofilms. glgA mutant SL13180; diamonds, pul mutant SL13178. In each case,
To test the importance of IPS in biofilm survival, we estab- the results of an experiment representative of at least three experi-
lished flow cell biofilms using FMC with 50 mM sucrose and 15 ments are shown.
7320 BUSUIOC ET AL. J. BACTERIOL.

responsible for the degradation of fructan. fruB encodes a

similar enzyme, but its role in the degradation of fructan is
minor (12, 14, 24).
To test for the role of fructan, we inactivated the fruA and
fruB genes in the parental strain, UA159, and in the glgA and
pul mutants. Accumulation of IPS was not impaired by inacti-
vation of the fruAB genes (data not shown). To test the sur-
vival, we cultured the fruAB mutant and the glgA fruAB and pul
fruAB double mutants under conditions that permitted IPS
accumulation (batch cultures in FMC containing 50 mM su-
crose). Then the bacteria were washed and starved by switch-
ing to sterile spent medium from cultures of the same strains
grown in 3 mM sucrose. The fruAB mutation did not impair the
FIG. 4. Persistence of S. mutans strains in static biofilms. Wells of survival of the parental strain or of the glgA and pul mutants;
microtiter plates were loaded with cultures in FMC containing 50 mM experiments were terminated after approximately 40 and 80
sucrose. After 14 h the supernatants and associated planktonic bacteria days, and in each case all the strains were viable.
were removed and replaced with spent medium. Filled squares, S.
mutans UA159; open squares, glgA mutant SL13180; diamonds, pul
mutant SL13178. Results of an experiment representative of three
experiments are shown. DISCUSSION

In this study, we report that inactivation of the glgA gene

that prolong survival. To more closely reproduce the starvation prevents formation of IPS by S. mutans (Fig. 2). The homolo-
conditions of the batch cultures, we developed static biofilms in gous glgA gene of other species encodes glycogen synthase,
24-well microtiter plates. Biofilms were established for 14 h by responsible for synthesis of ␣-1,4-glucan chains using ADP-
using FMC containing 50 mM sucrose. They were then placed glucose as a glucose donor (15, 29). Insertional inactivation of
in spent medium from 3 mM sucrose biofilms (which mimics glgA blocked IPS synthesis. Introduction of an intact plasmid-
the batch culture setup). The biofilms for all strains were viable borne copy of glgA restored IPS synthesis to the glgA mutant.
for more than 40 days. There was no difference in persistence Thus, we consider that loss of IPS synthesis was not a polar
between the mutants and the parental strain under the condi- effect on glgP. Rather, we infer that glgA is the structural gene
tions tested (Fig. 4). for IPS synthase in S. mutans; further, that glgB encodes glucan
We also tested the possibility that the difference between branching enzyme; and that glgC and glgD encode subunits of
batch cultures and biofilms was a consequence of the sugar glucose 1-phosphate pyrophosphorylase. Previous studies by
used (glucose for batch cultures versus sucrose for biofilms) by Spatafora and coworkers have shown that inactivation of dltA
examining the survival of bacteria grown in batch cultures with also impairs IPS synthesis; the dltA gene encodes a putative
sucrose instead of glucose. Bacteria were grown in FMC con- D-alanine-activating enzyme, so that its involvement in IPS
taining 50 mM sucrose and then transferred to spent medium synthesis is indirect (26).
from bacteria grown in FMC containing 3 mM sucrose. Under IPS accumulates toward the end of exponential growth when
these conditions, the bacteria grew embedded in extracellular S. mutans is grown in the chemically defined medium FMC
polysaccharides, forming large aggregates, which sedimented containing excess glucose or sucrose (9, 10) (Fig. 2). We have
to the bottom of the culture tubes. The glgA and pul mutants found that inactivation of glgA severely impaired the persis-
persisted for times comparable to that for the parental strain tence of bacteria grown in batch culture with excess glucose
UA159; experiments were terminated after approximately 40, and then transferred to spent medium lacking glucose. The
80, and 240 days, and in each case all the strains were still mutant survived for only about 6 days in stationary phase,
viable. whereas the parental strain persisted for at least 21 days and
Inactivation of fruAB did not influence persistence of S. generally for substantially longer, as did the glgA mutant when
mutans. The results reported above indicate that IPS extended a plasmid-borne intact copy of glgA had been introduced into
survival when glucose was a carbon source but not when su- the mutant. Yet the IPS was largely used up within 24 h of
crose was a carbon source. During growth in excess sucrose, S. transfer of the bacteria to FMC lacking glucose (Fig. 2C),
mutans synthesizes two types of extracellular polysaccharides, which is consistent with previous observations (11, 13, 32).
fructan and glucan. Fructan is thought to be a reserve carbo- Thus, the advantage of the IPS to the parent strain is probably
hydrate, ready to be used when the environment is depleted of not as an energy reserve that is parsimoniously used up over an
nutrients. In contrast, glucan is primarily used for the assembly extended period. Rather, the advantage may consist of the
of the extracellular matrix, which is an essential part of a priming by IPS, within the first day of starvation, of some
biofilm (24, 36). We hypothesized that fructan accumulated metabolic pathway and/or trait that leads to the long-term
during growth in excess sucrose could be used as a source of persistence. The effect is unlikely to result from a distinctive
carbohydrate during starvation, through the hydrolytic activity secreted nutrient or signal, because survival depended on the
of fructanase, and thus could help in extending survival regard- strains themselves and not on any difference between their
less of the presence of IPS. The fru operon in S. mutans UA159 culture supernatants. Intriguingly, the survival of the pul mu-
consists of fruA and fruB genes (Fig. 1B). fruA encodes a tant was as severely impaired as that of the glgA mutant (Fig.
fructanase (FruA), which is thought to be the main enzyme 3A; Table 3). This result lends support to the idea that some
VOL. 191, 2009 INTRACELLULAR POLYSACCHARIDE OF S. MUTANS 7321

feature of IPS metabolism, distinct from providing nutrients, is lactic acid, which could potentially be utilized via pyruvate
important for persistence. metabolism, or amino acids, which could enter pyruvate me-
The protein encoded by the pul gene has putative N-termi- tabolism or be directly used to produce ATP. In our studies,
nal pullulanase and C-terminal alpha-amylase domains, poten- IPS may influence those pathways. Second, mucin is insuffi-
tially able to act on pullulan, amylopectin, or glycogen (20, 35). cient to promote growth of S. mutans (31) but is capable of
The pul gene lies directly upstream from the glg operon, sug- prolonging survival (22) (Fig. 3). In addition, S. mutans cannot
gesting that the encoded protein might be involved in deter- grow with starch as a sole carbon source (25), but we found
mining IPS branch structure and/or IPS metabolism. Inactiva- that starch also prolonged survival. The biofilm matrix of S.
tion of pul did not impair the accumulation of IPS or, within mutans contains both fructans and glucans that potentially
the limits of our assay, its degradation (Fig. 2). This result could be metabolized. While these disparate carbon sources
indicates that the mutation did not have a polar effect on are not used as a primary carbon and energy source, they can
expression of the glg operon, although we were unable to clone potentially be used to prolong survival. Further experimenta-
the intact pul gene and did not directly test by complementa- tion is necessary to determine if these various compounds are
tion for possible polar effects. However, the effects on survival being used as carbon and energy sources or if they are some-
of pul inactivation were very similar to those of glgA inactiva- how playing a protective role, preventing the cells from being
tion under the conditions tested (Fig. 3 and 4). Thus, we think damaged during survival.
it plausible that the putative pullulanase is indeed involved in
determining IPS properties. The difference in survival between ACKNOWLEDGMENT
the pul mutant and the parental strain UA159 suggests that the This work was supported by Public Health Service grant DE14640 to
strains differ in the structure of IPS and/or the path of its P.J.P. from the National Institutes of Health.
degradation. Plausibly, the degradation products of IPS in the
pul mutant cannot prime the metabolic trait that confers an REFERENCES
advantage in survival on the parental strain. However, we can- 1. Ballicora, M. A., A. A. Iglesias, and J. Preiss. 2003. ADP-glucose pyrophos-
phorylase, a regulatory enzyme for bacterial glycogen synthesis. Microbiol.
not exclude an alternative explanation, that pul inactivation Mol. Biol. Rev. 67:213–225.
affects survival in some way that is unrelated to IPS metabo- 2. Burleigh, I. G., and E. A. Dawes. 1967. Studies on the endogenous metab-
lism. olism and senescence of starved Sarcina lutea. Biochem. J. 102:236–250.
3. Burne, R. A., K. Schilling, W. H. Bowen, and R. E. Yasbin. 1987. Expression,
IPS conferred a clear advantage for persistence in batch purification, and characterization of an exo-␤-D-fructosidase of Streptococcus
cultures with glucose as carbon source. In contrast, no advan- mutans. J. Bacteriol. 169:4507–4517.
tage was observed when mucin or starch was added to the 4. Carlsson, J. 1997. Bacterial metabolism in dental biofilms. Adv. Dent. Res.
11:75–80.
medium or when sucrose was used as a carbon source. Thus, 5. Chary, V. K., M. Busuioc, J. A. Renye, Jr., and P. J. Piggot. 2005. Vectors
under conditions that may be closer to those of the dental that facilitate the replacement of transcriptional lacZ fusions in Streptococ-
cus mutans and Bacillus subtilis with fusions to gfp or gusA. FEMS Microbiol.
plaque than batch culture with glucose, IPS had at most a Lett. 247:171–176.
redundant role in promoting survival. Sucrose enables S. mu- 6. Claverys, J. P., A. Dintilhac, E. V. Pestova, B. Martin, and D. A. Morrison.
tans to synthesize extracellular glucan from the glucosyl moiety 1995. Construction and evaluation of new drug-resistance cassettes for gene
disruption mutagenesis in Streptococcus pneumoniae, using an ami test plat-
and fructan from the fructosyl moiety of the sucrose. The form. Gene 164:123–128.
glucan functions as an extracellular matrix to facilitate adher- 7. Colby, S. M., and R. R. Russell. 1997. Sugar metabolism by mutans strep-
ence of the bacteria to the dental plaque (7). However, the tococci. Soc. Appl. Bacteriol. Symp. Ser. 26:80S–88S.
8. Dawes, E. A., and D. W. Ribbons. 1964. Some aspects of the endogenous
fructan is thought to function primarily as a reserve of carbo- metabolism of bacteria. Bacteriol. Rev. 28:126–149.
hydrate, ready to be used when the environment is depleted of 9. DiPersio, J. R., S. J. Mattingly, M. L. Higgins, and G. D. Shockman. 1974.
Measurement of intracellular iodophilic polysaccharide in two cariogenic
nutrients (36); it seemed a plausible candidate to serve as an strains of Streptococcus mutans by cytochemical and chemical methods. In-
alternative to IPS in enhancing survival. Fructan utilization by fect. Immun. 10:597–604.
S. mutans is through the action of the fructanase encoded by 10. DiPersio, J. R., S. J. Mattingly, M. L. Higgins, and G. D. Shockman. 1978.
A quantitative ultrastructural and chemical investigation of the accumulation
fruA (23, 36). The fruA gene is cotranscribed with fruB, which of iodophilic polysaccharide in two cariogenic strains of Streptococcus mu-
encodes a similar protein, although no fructanase activity has tans. Microbios 21:109–126.
been found for FruB (3). To curtail possible use of fructan as 11. Freedman, M. L., and A. L. Coykendall. 1975. Variation in internal polysac-
charide synthesis among Streptococcus mutans strains. Infect. Immun. 12:
a source of carbohydrate during survival, we deleted both 475–479.
genes of the fruAB operon. The deletion did not affect the 12. Germaine, G. R., S. K. Harlander, W. L. Leung, and C. F. Schachtele. 1977.
Streptococcus mutans dextransucrase: functioning of primer dextran and en-
survival of strain UA159 or of the glgA mutant when the strains dogenous dextranase in water-soluble and water-insoluble glucan synthesis.
were grown in the presence of sucrose (with no mucin) either Infect. Immun. 16:637–648.
in batch cultures or in biofilms. Thus, within the limits of this 13. Gibbons, R. J., and S. S. Socransky. 1962. Intracellular polysaccharide stor-
age by organisms in dental plaques. Its relation to dental caries and microbial
test, fructan utilization did not explain the persistence of the ecology of the oral cavity. Arch. Oral Biol. 7:73–79.
glgA mutant when sucrose was used as a carbon source. It is 14. Igarashi, T., A. Yamamoto, and N. Goto. 1992. Characterization of the
possible that some other (still-unknown) enzyme can degrade dextranase purified from Streptococcus mutans Ingbritt. Microbiol. Immunol.
36:969–976.
fructan or that the extracellular glucan might be utilized (7, 15. Kiel, J. A., J. M. Boels, G. Beldman, and G. Venema. 1994. Glycogen in
25). Indeed, we think it possible that various carbon sources Bacillus subtilis: molecular characterization of an operon encoding enzymes
involved in glycogen biosynthesis and degradation. Mol. Microbiol. 11:203–
are able to support survival, although they are not efficiently 218.
utilized and are not able to support growth. 16. Lindler, L. E., and F. L. Macrina. 1986. Characterization of genetic trans-
This possibility is supported by several observations. First, S. formation in Streptococcus mutans by using a novel high-efficiency plasmid
marker rescue system. J. Bacteriol. 166:658–665.
mutans survives in spent medium after exhaustion of glucose 17. Loesche, W. J. 1986. Role of Streptococcus mutans in human dental decay.
where the only carbon and energy sources available are either Microbiol. Rev. 50:353–380.
7322 BUSUIOC ET AL. J. BACTERIOL.

18. Palmer, R. J., Jr. 1999. Microscopy flowcells: perfusion chambers for real- D. Barnard, M. el Janne, and M. C. Hudson. 1999. Regulated expression of
time study of biofilms. Methods Enzymol. 310:160–166. the Streptococcus mutans dlt genes correlates with intracellular polysaccha-
19. Perry, D., and H. K. Kuramitsu. 1981. Genetic transformation of Strepto- ride accumulation. J. Bacteriol. 181:2363–2372.
coccus mutans. Infect. Immun. 32:1295–1297. 28. Strange, R. E. 1968. Bacterial “glycogen” and survival. Nature 220:606–607.
20. Plant, A. R., R. M. Clemens, H. W. Morgan, and R. M. Daniel. 1987. 29. Takata, H., T. Takaha, S. Okada, M. Takagi, and T. Imanaka. 1997. Char-
Active-site- and substrate-specificity of Thermoanaerobium Tok6-B1 pullu- acterization of a gene cluster for glycogen biosynthesis and a heterotet-
lanase. Biochem. J. 246:537–541. rameric ADP-glucose pyrophosphorylase from Bacillus stearothermophilus. J.
21. Quisel, J. D., W. F. Burkholder, and A. D. Grossman. 2001. In vivo effects of Bacteriol. 179:4689–4698.
sporulation kinases on mutant Spo0A proteins in Bacillus subtilis. J. Bacte- 30. Terleckyj, B., N. P. Willett, and G. D. Shockman. 1975. Growth of several
riol. 183:6573–6578. cariogenic strains of oral streptococci in a chemically defined medium. In-
22. Renye, J. A., Jr., P. J. Piggot, L. Daneo-Moore, and B. A. Buttaro. 2004. fect. Immun. 11:649–655.
Persistence of Streptococcus mutans in stationary-phase batch cultures and 31. van der Hoeven, J. S., C. W. van den Kieboom, and P. J. Camp. 1990.
biofilms. Appl. Environ. Microbiol. 70:6181–6187. Utilization of mucin by oral Streptococcus species. Antonie van Leeuwen-
23. Schachtele, C. F., A. E. Loken, and M. K. Schmitt. 1972. Use of specifically hoek 57:165–172.
labeled sucrose for comparison of extracellular glucan and fructan metabo- 32. van Houte, J., C. E. de Moor, and H. M. Jansen. 1970. Synthesis of iodophilic
lism by oral streptococci. Infect. Immun. 5:263–266. polysaccharide by human oral streptococci. Arch. Oral Biol. 15:263–266.
24. Schachtele, C. F., R. H. Staat, and S. K. Harlander. 1975. Dextranases from 33. van Houte, J., and H. M. Jansen. 1970. Role of glycogen in survival of
oral bacteria: inhibition of water-insoluble glucan production and adherence Streptococcus mitis. J. Bacteriol. 101:1083–1085.
to smooth surfaces by Streptococcus mutans. Infect. Immun. 12:309–317. 34. Wach, A. 1996. PCR-synthesis of marker cassettes with long flanking homol-
25. Simpson, C. L., and R. R. Russell. 1998. Intracellular alpha-amylase of ogy regions for gene disruptions in S. cerevisiae. Yeast 12:259–265.
Streptococcus mutans. J. Bacteriol. 180:4711–4717. 35. Walker, G. J. 1968. Metabolism of the reserve polysaccharide of Streptococ-
26. Spatafora, G., K. Rohrer, D. Barnard, and S. Michalek. 1995. A Streptococ- cus mitis. Some properties of a pullulanase. Biochem. J. 108:33–40.
cus mutans mutant that synthesizes elevated levels of intracellular polysac- 36. Wexler, D. L., J. E. Penders, W. H. Bowen, and R. A. Burne. 1992. Charac-
charide is hypercariogenic in vivo. Infect. Immun. 63:2556–2563. teristics and cariogenicity of a fructanase-defective Streptococcus mutant
27. Spatafora, G. A., M. Sheets, R. June, D. Luyimbazi, K. Howard, R. Hulbert, strain. Infect. Immun. 60:3673–3681.

View publication stats