Zhang et al.

Journal of Translational Medicine 2014, 12:155

http://www.translational-medicine.com/content/12/1/155

RESEARCH Open Access

NF-κB-modulated miR-130a targets TNF-α in

cervical cancer cells
Jian Zhang1†, Haidong Wu1†, Pu Li1,2†, Yanzheng Zhao1, Min Liu1 and Hua Tang1*

Abstract
Background: Nuclear factor-κB (NF-κB) induces a variety of biological processes through transcriptional gene
control whose products are components in various signaling pathways. MicroRNAs are a small endogenous
non-coding RNAs that regulate gene expression and are involved in tumorigenesis. Using human cervical cancer
cell lines, this study aimed to investigate whether NF-κB could regulate miR-130a expression and the functions and
targets of miR-130a.
Methods: We used the HeLa and C33A cervical cancer cell lines that were transfected with NF-κB or miR-130a
overexpression plasmids to evaluate their effects on cell growth. We utilized bioinformatics, a fluorescent reporter
assay, qRT-PCR and Western blotting to identify downstream target genes.
Results: In HeLa and C33A cells, NF-κB and miR-130a overexpression promoted cell growth, but genetic knockdowns
suppressed growth. TNF-α was identified as a target of miR-130a by binding in a 3’-untranslated region (3’UTR) EGFP
reporter assay and by Western blot analysis. Furthermore, low TNF-α concentrations stimulated NF-κB activity and then
induced miR-130a expression, and TNF-α overexpression rescued the effects of miR-130a on cervical cancer cells.
Conclusions: Our findings indicate that TNF-α can activate NF-κB activity, which can reduce miR-130a expression, and
that miR-130a targets and downregulates TNF-α expression. Hence, we shed light on the negative feedback regulation
of NF-κB/miR-130a/TNF-α/NF-κB in cervical cancer and may provide insight into the carcinogenesis of cervical cancer.
Keywords: miRNA, miRNA-130a, NF-κB, Cervical cancer, TNF-α

Background which phosphorylates IκB, and IκB then becomes sus-

Nuclear factor-κB (NF-κB) is a nuclear transcription fac- ceptible to ubiquitination and degradation through the
tor that regulates the expression of a large number of proteasome system. Free p50 and p65 or c-Rel then trans-
genes associated with inflammation [1,2], tissue damage locate into the nucleus to activate related genes, and this
and repair [3,4], cell differentiation [5,6], apoptosis [7,8] gene regulation occurs mainly through promoter element
and tumor growth [9,10]. NF-κB is composed of five dis- binding [13,14]. Some pro-inflammatory cytokines, che-
tinct but structurally related subunits: RelA, RelB, c-Rel, mokines, and many oncogenes associated with tumor
p50 and p52, and these five mature proteins can form development and progression are NF-κB activators,
various homodimeric and heterodimeric combinations including palmitic acid, the most abundant long chain
[11,12]. The dimers remain in an inactive form in the saturated fatty acid [15]. Furthermore, the mitochondrial
cytoplasm, sequestered by one of the IκB family mem- antiviral signaling (MAVS) protein can recruit several
bers, mainly IκBα. In canonical NF-κB signaling, nuclear TRAF proteins, and these proteins are associated with
translocation of NF-κB is controlled by the signal-induced NF-κB activation [16]. Another protein, protein-arginine
degradation of IκBs. Exposure of cells to stimuli, such as methyltransferase 5 (PRMT5), is overexpressed in many
pro-inflammatory cytokines, activates the IκB kinase (IKK), cancers and promotes tumorigenesis by stimulating
NF-κB [17]. Though these activators, TNF-α acts as an
* Correspondence: [email protected] important proinflammatory cytokine to stimulate NF-κB
†
Equal contributors activity.
1
Tianjin Life Science Research Center and School of Basic Medical Sciences,
Tianjin Medical University, No. 22 Qi-Xiang-Tai Road, Tianjin 300070, China
Full list of author information is available at the end of the article

© 2014 Zhang et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain
Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article,
unless otherwise stated.
Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 2 of 14
http://www.translational-medicine.com/content/12/1/155

TNF-α, one form of TNF [18], acts as a proinflammatory an important role in the growth regulation of cervical
cytokine, and increased TNF-α levels have been observed cancer cells.
in serum and other patient samples with inflammation
[19]. It is mainly produced by monocytes, macrophages, Materials and methods
initial hemorrhages and necrosis of tumor tissue [20,21]. Cell culture and transfection
TNF-α is a secreted protein, mature TNF-α protein plays The human cervical cancer cell lines HeLa and C33A were
its role mainly through its receptors on the surface [22-24]. grown in RPMI1640 medium (GIBCO BRL, Grand Island,
So far, TNF-α seem powerful to destroy tumor, but has NY, USA) supplemented with 10% fetal bovine serum
fallen short of expectations in clinical use as an anti-tumor (FBS), 100 IU/ml of penicillin and 100 mg/ml of strepto-
agent because of its indeterminacy at therapeutic doses. mycin. The cell lines were incubated at 37°C in a humidi-
The autocrine or paracrine TNF-α expression can make fied chamber supplemented with 5% CO2. Transfections
the opposite effect, like some reports showed TNF-α play a were performed using the Lipofectamine 2000 Reagent
role in the promotion of cell growth in low concentration (Invitrogen, Carlsbad, CA, USA) according to the manu-
[25,26]. Low doses of endogenous TNF-α produced by facturer’s instructions. All transfections were performed in
normal epithelial cells or epithelial-derived cancer cells three independent experiments.
can also act as a tumor promoter, in NSCLC cells, the
TNF-α expression may affect the normal lung adjacent to Bioinformatics
the tumor [27], in human breast cancer cell, TNF-α en- miRNA targets were predicted using the following algo-
hanced invasiveness of the malignant cells dependent on rithms: Target-Scan, PicTar, and MiRBase Targets.
matrix metalloprotease [28], in ovarian cancer cells the
CXCR4 expression also in a TNF-α–dependent manner Plasmid construction
[29]. Many studies have demonstrated the role of TNF-α To construct the pcDNA3/NF-κB vector expressing p50
in cell proliferation, and some reports have shown that subunit, we amplified a DNA fragment carrying p50 by
TNF-α acts as an apoptotic mediator in some cell lines, PCR using sense and antisense NF-κB primers, and then
such as hematopoietic cells [30] and cartilage progenitor the fragment was cloned into the pcDNA3 vector at the
cells [31]. This proapoptotic effect can be weakened by EcoRI and Xhol restriction sites.
other substances in the body, such as miRNAs. However, To construct the pSilencer/shR-NF-κB vector interfere
little is known about the ability of miRNAs to regulate p50 subunit expression, a 70-bp double-stranded fragment
TNF-α expression. was obtained via an annealing reaction using two single-
miRNAs are small non-coding RNAs that regulate gene strands. The fragment was then cloned into a pSilencer 2.1
expression at the post-transcriptional level through transla- vector plasmid (Ambion) at the BamHI and Hind III sites.
tional repression or mRNA degradation. They exert con- To construct a pcDNA3/pri-miR-130a vector express-
trol over approximately 60% of human genes associated ing miR-130a, we amplified a DNA fragment carrying
with development, cell differentiation, growth, motility and pri-miR-130a from genomic DNA using sense and anti-
apoptosis [32,33], which render miRNAs one of the most sense Pri-130a primers. The 3’UTR, including predicted
abundant classes of regulatory molecules. Particularly in target sites, was amplified by PCR using TNF-α-3’UTR-
malignancies, aberrant miRNA expression has emerged sense and -antisense primers, and the amplified sequence
as a hallmark of cancer [34]. Because each miRNA is was cloned into an expression plasmid (pcDNA3/EGFP)
thought to regulate hundreds of mRNAs, and each mRNA downstream of the EGFP gene between the EcoRI and
is also modulated by many miRNAs [35], the identification BamHI restriction sites. Similarly, the 3’UTR containing
of miRNA targets represents an important step in un- mutated miR-130a binding sites was amplified using PCR
derstanding miRNA function. miR-130a, a miRNA has site-directed mutagenesis and cloned into the pcDNA3/
been shown to promote cell survival in several cell lines EGFP plasmid between the same restriction sites with
through different signaling mechanisms [36-38], but its TNF-α-3’UTR-mut-sense and -antisense primers. The
mechanism of action and expression are still not clear in resulting vectors were designated as pcDNA3/EGFP-TNF-
cervical cancer. α-3’UTR and pcDNA3/EGFP-TNF-α-3’UTRmut.
In this study, we found that NF-κB and miR-130a The human TNF-α mRNA lacking the 3’UTR was amp-
promoted cervical cancer cell growth. miR-130a dir- lified from human HeLa cell cDNA by PCR using sense
ectly targeted the 3’UTR of TNF-α and repressed its and antisense TNF-α primers, which are listed in Table 1,
translation, and TNF-α activated NF-κB to upregulate and then cloned into the pcDNA3 vector at the EcoRI and
miR-130a expression. Thus, TNF-α can stimulate NF-κB Xhol restriction sites, which created the pcDNA3/TNF-α
activity and enhance miR-130a levels, which then re- plasmid.
duces TNF-α levels. Therefore, this NF-κB/miR-130a/ All DNA oligonucleotides used are listed in Table 1,
TNF-a/NF-κB feedback signaling pathway may play and all constructs were confirmed by DNA sequencing.
Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 3 of 14
http://www.translational-medicine.com/content/12/1/155

Table 1 Oligonucleotide sequences

Name Sequence (5’-3’)
NF-κB-sence CGGAATTCGCCACCAGAATGGCAGAAGATGATC
NF-κB-antisence TGTCACTCGAGGCAATTTTGCCTTCTAGAGGTC
NF-κB-siR-Top GATCCCGCCTGAACAAATGTTTCATTTGGTCAAGAGCCAAATGAAACATTTGTTCAGGCTTTTTTGGAAA
NF-κB-siR-Bot AGCTTTTCCAAAAAAGCCTGAACAAATGTTTCATTTGGCTCTTGACCAAATGAAACATTTGTTCAGGCGG
Pri-130a-sense ATGGGATCCAGAGGGAGCCCGTGAGCTG
Pri-130a-antisense CGGAATTCGTATAACTAACAAGTGAGGCTACC
ASO-miR-130a AUGCCCUUUUAACAUUGCACUG
ASO-NC TGACTGTACTGAGACTCGACTG
miR-130a-RT GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACATGCCCT
miR-130a-Forward TGCGGCAGTGCAATGTTA
U6-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGG
U6- Forward TGCGGGTGCTCGCTTCGGCAGC
miR-Reverse primer CCAGTGCAGGGTCCGAGGT
TNF-α-3’UTR-sense CGGGATCCGAAATTGACACAAGTGGACC
TNF-α-3’UTR-antisense CGGAATTCCTCCCAAATAAATACATTCATCTG
TNF-α-3’UTR-mut-sense CCCTCTATTTATGATACGAGTTGTGATTATTT
TNF-α-3’UTR-mut-antisense AAATAATCACAACTCGTATCATAAATAGAGGG
TNF-α-sense CGGAATTCGCCACCATGAGCACTGAAAGC
TNF-α-antisense CCCGCTCGAGGCCAGGGCAATGATCCCAAAG
β-actin-sense CGTGACATTAAGGAGAAGCTG
β-actin-antisense CTAGAAGCATTTGCGGTGGAC
GAPDH-sense GCGAATTCCGTGTCCCCACTGCCAACGTGTC
GAPDH-antisense GCTACTCGAGTTACTCCTTGGAGGCCATGTGG

Fluorescent reporter assay 15 min, the absorbance at 570 nm (A570) was measured
HeLa and C33A cells were co-transfected with pcDNA3/ using an uQuant Universal Microplate Spectrophotometer
pri-miR-130a or ASO-miR-130a in a 48-well plate followed (Bio-Tek Instruments, Winooski, USA).
by the pcDNA3/EGFP-TNF-α-3’UTR or pcDNA3/EGFP-
TNF-α-3’UTR-mut reporter plasmids. The RFP expression Colony formation assay
vector, pDsRed2-N1 (Clontech, Mountain View, CA), was Following transfection in 24-well plates as described
used for normalization. Cells were lysed with RIPA 48 h above, HeLa and C33A cells were counted and seeded in
after transfection, and proteins were collected. EGFP and 12-well plates (in triplicate) at a density of 200 cells/well.
RFP fluorescence intensities were determined using an The plates were incubated at 37°C in a 5% CO2 humidi-
F-4500 fluorescence spectrophotometer (HITACHI, Tokyo, fied incubator. The culture medium was replaced every
Japan). 3 days. After 14 days in culture, cells were stained with
crystal violet and counted. Colonies with at least 50 cells
Cell viability assay were considered for quantification.
HeLa and C33A cells were seeded in 24-well plates over-
night and then transfected with plasmid (1 μg each) or RNA preparation and Quantitative reverse transcrption
oligonucleotides (final concentration 200 nM). After- PCR (qRT-PCR)
wards, cells were trypsinized and counted, seeded in 96- Total RNA extracted from HeLa and C33A cells was using
well plates (in triplicate) for an MTT assay at a density the TRIZOL reagent (Invitrogen, Carlsbad, CA), according
of 8,000 cells/well (HeLa) or 10,000 cells/well (C33A), to the manufacturer’s instructions. RNA extraction from
and incubated at 37°C for 24 h. Then, at 24, 48 and 72 h tissue samples was performed by using the mirVana
after cell seeding, 10 μl MTT (final concentration, 0.5 mg/ miRNA Isolation Kit (Ambion) according to the manufac-
ml) was added, and the cells were maintained at 37°C for turer’s instructions. To assess RNA integrity, a portion
another 4 h. The medium was removed, and the precipi- each RNA sample was used for concentration and purity
tate was dissolved in 100 μl DMSO. After shaking for measurements (A260 and A280 by spectrophotometry),
Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 4 of 14
http://www.translational-medicine.com/content/12/1/155

and a separate portion was subjected to denaturing elec- Immunofluorescent staining

trophoresis in a 1% agarose gel stained with ethidium Cells were seeded on 14-well slides at a concentration of
bromide. 2000 cells/well and incubated overnight. After the cells
qRT-PCR used to detect the miRNA and mRNA levels adhered to the slides, the culture medium was replaced
and was performed using an iQ5 real-time PCR detec- with medium containing TNF-α (Sigma-Aldrich, St. Louis,
tion system (Bio-Rad). Moloney murine leukemia virus MO) at a final concentration of 20 ng/mL, and the cells
(M-MLV) reverse transcriptase (Promega, Madison, WI) were cultured for 24 h. Cells were fixed with 4% parafor-
was used to reverse transcribe cDNA from RNA samples. maldehyde for 30 min, permeabilized with 0.5% Triton X-
The SYBR Premix Ex Taq™ kit (TaKaRa, Otsu, Shiga, Japan) 100 for 5 min, and blocked with 10% donkey serum at
was used to measure amplified DNA. Related primers room temperature for 2 h. Following blocking, primary
were purchased from AuGCT, Inc. (Beijing, China), and antibodies were diluted in 1% normal donkey serum,
sequences are shown in Table 1. placed on the slide surface, and incubated at 4°C over-
To detect miR-130a, 2 μg of total RNA (in triplicate) night. Cells were washed, and a FITC-labeled donkey
was reverse transcribed to cDNA using M-MLV. U6 was anti-rabbit secondary antibody was diluted in 1% normal
used as a housekeeping gene to normalize gene expres- donkey serum and added to the slides. Finally, DAPI was
sion. The following PCR cycles were used: 94°C for 3 min used to stain the nuclei. Fluorescent images were acquired
followed by 40 cycles of 94°C for 30 s, 56°C for 30 s, and using a Digital Sight DS-U1 scanning microscope (Nikon,
72°C for 30 s. To detect target genes, 5 μg of total RNA Tokyo, Japan) at an excitation wavelength of 488 nm. Im-
(in triplicate) was reverse transcribed into cDNA. En- ages were superimposed using the NIS Elements F 2.20
dogenous β-actin gene levels were used as a control to imaging software (Nikon).
normalize gene expression. The following PCR cycles were
used: 94°C for 3 min followed by 40 cycles of 94°C for Tumor xenograft experiment
30 s, 58°C for 30 s, and 72°C for 30 s. For in vivo tumor study, 3 × 106 Hela cells transfected
with pri-miR-130a and it is control vector were suspended
Western blot in 150 μl of serum-free 1640 for each mouse. Each mouse
Western blotting was performed to determine protein (6 in each group, female, BALB/c-nu/nu at 6 weeks of
expression. Briefly, HeLa and C33A cells were transfected age) were implanted subcutaneously in the right armpit of
with plasmid (4 μg each) or control oligonucleotides nude mice. All mice were killed 14 days after implant-
(final concentration of 200 nM). After seeding in 25-ml ation. The samples were frozen in liquid nitrogen or fixed
culture flasks, cells were washed with PBS and lysed with phosphate-buffered neutral formalin. All studies were
after 30 min in RIPA lysis buffer at 4°C to harvest total performed under the American Association for the Ac-
protein. To collect nucleoproteins, cells were harvested creditation of Laboratory Animal Care guidelines for hu-
with PBS, centrifuged to obtain a cell precipitate, 0.4% mane treatment of animals and adhered to national and
NP-40 added, and the cell precipitate resuspended. After international standards. Ethical approval was given by the
centrifugation, the supernatant contained the nucleo- medical ethics committee of the Ethics Committees of
proteins. Next, 0.1% NP-40 was added to the remaining Tianjin Medical University with the following reference
cell precipitate, the precipitate was resuspended and number: TMUhMEC 2011018.
centrifuged, the supernatant was discarded, and the
remaining material resuspended in RIPA buffer to ob- Immunohistochemistry
tain cytoplasmic proteins. Equal amounts of protein The tissue samples were fixed in phosphate-buffered neu-
were subjected to electrophoresis using a 10% SDS- tral formalin, embedded in paraffin, and cut into 5 μm
polyacrylamide gel under denaturing conditions and were thick sections. Tissue sections were deparaffinized, rehy-
then transferred onto a nitrocellulose membrane. To drated, and microwave-heated in sodium citrate buffer for
assess protein levels, membranes were incubated in antigen retrieval. The sections were then incubated with
blocking buffer for 4 h at room temperature and then 0.3% hydrogen peroxide/phosphate-buffered saline for
with antibodies raised against p50 or TNF-α overnight 30 min. Sections were incubated with a primary antibody
at 4°C. Membranes were then washed and subsequently against TNF-α at a 1:50 dilution and incubated overnight at
incubated with secondary antibody. Protein expression 4°C. Detection of the primary antibody was performed
was assessed by enhanced chemiluminescence and expos- using goat anti-rabbit-HRP for 1 hour at room temperature
ure to chemiluminescent film. The LabWorks™ Image and visualized with DAB substrate.
Acquisition and Analysis Software (UVP, Upland, CA)
were used to quantify the protein band intensities. All Statistical analysis
the antibodies were purchased from Tianjin Saier Biotech Data are expressed as the mean ± standard deviation (SD).
(Tianjin, China). Statistical analyses were performed with a paired t-test.
Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 5 of 14
http://www.translational-medicine.com/content/12/1/155

P < 0.05 was considered statistically significant. Experiments and found that pcDNA3/pri-miR-130a increased cell via-
were performed in triplicate, and one representative experi- bility and the colony formation rate by approximately 20%
ment is shown in the Figures. compared with the control group (Figure 2C and E).
Moreover, ASO-miR-130a led to a suppression of cell via-
Results bility and colony formation (Figure 2D and F) rate. These
NF-κB promotes the growth of human cervical cancer results indicate that miR-130a facilitates HeLa and C33A
cells cell viability and growth, which is consistent with NF-κB’s
NF-κB has been shown to promote tumorigenesis, tumor effects on HeLa and C33A cells.
cell proliferation, invasion and metastasis [39]. To investi- As miR-130a and NF-κB plays the same role on the
gate the role of NF-κB in cervical cancer cells, we con- growth of cancer cells, which prompt us miR-130a
structed an NF-κB overexpression vector (pcDNA3/NF-κB) maybe one of the regulatory mechanisms of NF-κB, in
and an NF-κB interference vector (pSilencer/shR-NF-κB) order to verify this, we performed an experiment using
which over express or knock down p50 protein that were by NF-κB in cells with miR-130a knockdown. Results
validated by western blot in transfected HeLa and C33A showed that as miR-130a knockdown, cell growth ability
cells (Figure 1A and B). Next, an MTT assay showed that decreased compare with the group only overexpressed
NF-κB overexpression increased HeLa and C33A cell via- NF-κB both in the MTT and colony formation assays
bility compared with the control group at 24, 48, and 72 h (Figure 2G and H).
after cell seeding (Figure 1C). Conversely, the knock down
of NF-κB suppressed cell viability (Figure 1D). The colony miR-130a directly targets and negatively regulates TNF-α
formation assay also demonstrated that NF-κB overex- expression
pression increased HeLa and C33A colony numbers by miRNAs regulate a number of cellular functions through
approximate 25% and 40%, respectively, compared with the downregulation of target gene expression by binding
the control vector (Figure 1E), but decreased NF-κB levels to 3’UTRs. To predict candidate target genes of miR-
reduced the colony numbers (Figure 1F). These results in- 130a, we used three algorithm programs, TargetScan,
dicate that NF-κB promotes cervical cancer cell viability PicTar, and miRanda. Using these programs, we selected
and growth. TNF-α as a miR-130a target gene for further study be-
cause of its ability to suppress cancer cell growth and to
NF-κB promotes human cervical cancer cell growth activate NF-κB. The complementary sequence between
through miR-130a the seed sequence of miR-130a and the TNF-α 3’UTR is
In our previous experimental work, gene chip results shown in Figure 3A. To elucidate miR-130a’s direct regu-
showed some miRNAs which may regulated by NF-κB, lation of TNF-α, an enhanced green fluorescent protein
miR-130a was in them and relatively few existing reports (EGFP) reporter assay was used to identify the target site
about it, so we picked it as our object of study for a further in the TNF-α 3’UTR. We first constructed an EGFP re-
explore. When HeLa and C33A cells were transfected with porter plasmid by inserting the miR-130a binding site in
pcDNA3/NF-κB or pSilencer/shR-NF-κB, qRT-PCR indi- the TNF-α 3’UTR downstream of the EGFP stop codon
cated that NF-κB overexpression increased the miR-130a (pcDNA3/EGFP-TNF-α-3’UTR) and a mutant seed se-
levels by approximately 50% and 40% compared to that of quence in a reporter plasmid (pcDNA3/EGFP-TNF-α-
control vector, but a knock down of NF-κB decreased the 3’UTR-mut). Next, HeLa and C33A cells were cotrans-
miR-130a levels by 25% in both HeLa and C33A cells, re- fected with the pcDNA3/EGFP-TNF-α-3’UTR reporter
spectively (Figure 2A). These results indicate that NF-κB plasmid and pcDNA3/pri-miR-130a or ASO-miR-130a
may induce miR-130a expression. plasmids. We found that pcDNA3/pri-miR-130a expres-
Some reports have shown that miR-130a can mediate sion led to a 25% decrease in EGFP fluorescence intensity
endothelial cancer cell growth [40,41], and our data also compared with the control group, and the EGFP fluores-
showed that NF-κB enhanced the growth of cervical can- cence intensity in cells transfected with ASO-miR-130a in-
cer cells and induced miR-130a expression. Thus, we spec- creased more than 25% (Figure 3B). However, there were
ulated that miR-130a may mediate NF-κB’s cell growth no significant changes in the fluorescence intensities of
effects. First, we validated the efficiencies of pcDNA3/ the pcDNA3/EGFP-TNF-α-3’UTR-mut group regardless
pri-miR-130a or miR-130a antisense oligomers (ASO- of altered miR-130a levels (Figure 3C). Furthermore, we
miR-130a). qRT-PCR revealed that cells transfected with examined endogenous TNF-α that had been downregu-
pcDNA3/pri-miR-130a produced 7.5 and 6-fold increases lated by miR-130a. Overexpression of miR-130a led to
in miR-130a levels. However, ASO-miR-130a reduced an approximately 50% reduction in TNF-α mRNA levels,
miR-130a levels by almost 50% in transfected HeLa and but conversely, blocking miR-130a expression increased
C33A cells (Figure 2B). Then, we performed MTT and col- TNF-α mRNA levels by approximately 50% (Figure 3D).
ony formation assays in transfected HeLa and C33A cells Western blot analysis showed that pcDNA3/pri-miR-130a
Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 6 of 14
http://www.translational-medicine.com/content/12/1/155

Figure 1 NF-κB promotes the growth of human cervical cancer cells. (A and B) Western blot analysis was utilized to detect NF-κB levels in
HeLa cells and C33A cells transfected with pcDNA3/NF-κB or pSilencer/shR-NF-κB. After transfecting both cell lines, cells were cultured for 48 h,
and then lysed for 30 min with RIPA buffer at 4°C. The endogenous GAPDH expression levels were used to normalize protein expression.
(C and D) The effects of NF-κB on cell viability was assessed by MTT assays. HeLa and C33A cells were detached from 24-well plates after
transfection with pcDNA3/NF-κB and pSilencer/shR-NF-κB or their respective control vectors. Relative cell growth was assessed at 24, 48 and 72 h after
seeding in 96-well plates. (E and F) The effects of NF-κB on colony formation. Cells were detached from 24-well plates after transfection and seeded in
12-well plates, and on the 14th day after seeding, the number of colonies was counted. Experiments were performed in triplicate. (*P < 0.05, **P < 0.01).
Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 7 of 14
http://www.translational-medicine.com/content/12/1/155

Figure 2 (See legend on next page.)

Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 8 of 14
http://www.translational-medicine.com/content/12/1/155

(See figure on previous page.)

Figure 2 miR-130a promotes the growth of human cervical cancer cells. (A) The effects of NF-κB on miR-130a expression. Real-time RT-PCR
was used to evaluate miR-130a levels in HeLa and C33A cells transfected with the pcDNA3/NF-κB or pSilencer/shR-NF-κB plasmids. Total RNA was
extracted 24 h post-transfection and used for reverse transcription and real-time PCR. U6 snRNA was used to normalize gene expression.
(B) Real-time RT-PCR was performed to detect the miR-130a levels in the two cell lines treated with pri-miR-130a or ASO-miR-130a. U6 snRNA was
used to normalize gene expression. (C and D) MTT assays were performed to determine the effects of miR-130a on cell viability. HeLa and C33A cells
were detached from 24-well plates after transfection with pcDNA3/pri-miR-130a or a control vector and ASO-miR-130a or control oligonucleotides,
and the relative cell growth was determined at 24, 48 and 72 h after seeding in 96-well plates. (E and F) The effects of miR-130a on cell proliferation
were evaluated by a colony formation assay. Cells were detached from 24-well plates after transfection and seeded in 12-well plates. On the 14th day
after seeding, the number of colonies was determined. (G and H) MTT and colony formation assays using by NF-κB in cells with miR-130a knockdown.
Experiments were performed in triplicate. (*P < 0.05, **P < 0.01).

reduced TNF-α protein expression levels by 40% in HeLa extracted cytoplasmic and nuclear proteins from HeLa
cells and 30% in C33A cells (Figure 3E), and blocking en- and C33A cells to detect NF-κB and found that the nu-
dogenous miR-130a expression increased TNF-α protein clear p50 content was significantly increased as assessed
levels by 50% in both cells types (Figure 3F). We also by Western blot (Figure 5B). Immunofluorescent staining
verified this result in vitro, cells were transfected with also showed that TNF-α increased nuclear p50 (red) levels
pcDNA3/pri-miR-130a and its control vector then injected with compared with the control (Figure 5C and D). In
subcutaneously in the flank and collected the tumor tis- Figure 2G and H, we seen NF-κB increased the growth
sue. In the RNA extracted from tissue, miR-130a was capacity of crvical cncer cells through miR-130a, and we
increased compared to the control group (Figure 3G), have demonstrated that miR-130a can direct targeting
and staining of TNF-α was decline (Figure 3H). Altogether, TNF-α, so we made a transfection of ASO-miR-130a and
these results indicate that miR-130a can bind to the TNF-α NF-κB, we found that the consume of miR-130a rescue
3'UTR and negatively regulate its mRNA and protein ex- the reduction of TNF-α inducted by NF-κB (Figure 5E),
pression levels. these results strongly support our hypothesis. Moreover,
TNF-α treatment upregulated miR-130a levels by approxi-
TNF-α overexpression counteracts the effects of miR-130a mately 5-6.5-fold in HeLa and C33A cells (Figure 5F).
To confirm that miR-130a promotes cervical carcinoma Altogether, TNF-α initially stimulated NF-κB activation to
cell growth through at least a partial downregulation of induce miR-130a expression, which in turn targeted and
TNF-α, we generated a TNF-α expression vector (pcDNA3/ down-regulated TNF-α expression and suggests a TNF-α/
TNF-α) lacking the TNF-α 3’UTR to minimize miRNA NF-κB negative feedback loop acting through miR-130a in
interference. miR-130a was overexpressed with TNF-α in cervical cancer cells (Figure 5G).
HeLa and C33A cells, and then growth activity was exam-
ined by MTT and colony formation assays. Western blot Discussion
analysis showed that the miR-130a-induced reduction in NF-κB is one of the most important intracellular nuclear
TNF-α levels was rescued by the pcDNA3/TNF-α plasmid transcription factors, and it plays a central role in the
transfected into HeLa and C33A cells (Figure 4A and B). transcriptional regulation of many genes that are influ-
In the colony formation assay, ectopic TNF-α expres- enced by various stimuli. Some studies have shown that
sion abrogated the cell growth enhancement caused by NF-κB promotes tumorigenesis through transcriptional
miR-130a compared with the control vector (Figure 4C regulation. NF-κB activation is involved in Ras-induced
and D), but in the MTT assay, no obvious changes were carcinogenic effects and telomerase reverse transcriptase
observed between the experimental and control groups activity [44-46], but it can also promote apoptosis [47-49].
(Figure 4E and F). Therefore, these results provide further Here, utilizing MTT and colony formation assays, we
evidence that TNF-α overexpression counteracts the re- demonstrated that NF-κB played a growth-promoting role
pressive effects of miR-130a on cell growth. in the HeLa and C33A human cervical cancer lines.
miRNAs have been found to be involved in physio-
TNF-α stimulates NF-κB to upregulate miR-130a expression logical and pathological processes. Moreover, NF-κB has
to form a TNF-α/NF-κB/miR-130a feedback loop been shown to regulate miRNA expression, and in turn,
TNF-α is a strong activator of NF-κB [42,43], and our some miRNAs modulate NF-κB expression directly or
findings indicated that NF-κB could stimulate miR-130a indirectly [50,51]. We are interested in miRNA regula-
expression, which in turn downregulated TNF-α expres- tion of the NF-κB signal pathway. Hence, we found that
sion (Figure 5A). Therefore, we speculated that TNF-α NF-κB induced miR-130a expression to significantly
may regulate miR-130a expression through the NF-κB increase, whereas the knockdown of NF-κB repressed
pathway. Twenty-four hours after TNF-α treatment, we miR-130a expression. Therefore, we conclude that NF-κB
Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 9 of 14
http://www.translational-medicine.com/content/12/1/155

Figure 3 miR-130a directly targets and negatively regulates TNF-α expression. (A) Wild type (wt) and mutant complementary TNF-α mRNA
3’UTR sequences are shown compared with the miR-130a sequence. (B and C) EGFP reporter assays were performed to confirm the direct
interaction of miR-130a and the TNF-α 3’UTR. HeLa and C33A cells were transfected with an EGFP reporter plasmid and the pcDNA3/pri-miR-130a
or ASO-miR-130a plasmids, and the EGFP intensity was measured. (D) In HeLa and C33A cells, TNF-α expression levels were measured by real-time
RT-PCR. The endogenous expression levels of β-actin mRNA were used to normalize mRNA expression. (E and F) Alterations in the TNF-α
protein levels. miR-130a was overexpressed or its endogenous expression was blocked in both cell lines, and total protein was harvested
for Western blot analysis. GAPDH protein expression levels were used to normalize the protein expression data. (G) HeLa and C33A cells
were transfected with pcDNA3/pri-miR-130a or control vector and then implanted subcutaneously in the right armpit of nude mice, collected tumor
after 14 days and made real-time RT-PCR assay to detect the expression levels of miR-130a in tumors. U6 snRNA was used to normalize gene
expression. (H) Immunohistochemistry detected the levels of TNF-α protein in cervical cancer overexpress miR-130a compare with the
control group. The histograms show the normalized mean ± SD mRNA levels and protein intensities from three independent experiments.
(*P < 0.05, **P < 0.01).
Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 10 of 14
http://www.translational-medicine.com/content/12/1/155

Figure 4 (See legend on next page.)

Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 11 of 14
http://www.translational-medicine.com/content/12/1/155

(See figure on previous page.)

Figure 4 TNF-α overexpression counteracts the effects of miR-130a. (A and B) Western blot analysis was used to determine TNF-α protein
levels and validate the TNF-α overexpression vector. HeLa and C33A cells were co-transfected with the pcDNA3/TNF-α plasmid, which did not
contain the TNF-α 3’UTR, with or without the pcDNA3/pri-miR-130a plasmid. GAPDH protein expression was used to normalize the endogenous
expression data. (C and D) Colony formation assays were performed to determine the effects of TNF-α on cell proliferation. We transfected the
pcDNA3/TNF-α vector with or without cotransfection of pcDNA3/pri-miR-130a as in Figure 2G and H. (E and F) MTT assay used to assess cell
viability. The data represent the mean ± SD of three independent experiments. (*P < 0.05, **P < 0.01).

promotes miR-130a expression. Numerous studies have responses, and most of these processes are regulated
shown that miR-130a plays an important role in cell through downstream regulatory factors [58,59]. Although
function and carcinogenesis by targeting various genes, TNF-α can destroy tumors, in different environments,
such as FOG-2 [36], GAX [37] and Smad4 [38] in cardio- it may possess other effects, even acting as an endogen-
myocytes, vascular smooth muscle cells and granulo- ous tumor promoter [27-29,60]. TNF-α is a strong NF-κB
cytic precursors cells, respectively. In cancer, miR-130a activator [61-63]. While high concentrations of TNF-α
targets MET in non-small cell lung carcinoma [40] and can can induce the death of cervical cancer cells [64-66],
target ATG2B and DICER1 to kill Chronic Lymphocytic we found that low TNF-α concentrations induced cer-
Leukemia cells [41]. To determine whether miR-130a’s vical cancer cell growth. However, how NF-κB provides
effects on cervical cancer growth are downstream of feedback regulation of TNF-α expression is not well
NF-κB, we used gain-of- and loss-of-function assays to known. Here, we found that TNF-α stimulated the
examine the role of miR-130a in cervical cancer cells. nuclear translocation of NF-κB and induced miR-130a
MTT and colony formation assays showed that miR-130a expression in HeLa and C33A cells. A recent report
promoted HeLa and C33A cell viability and colony forma- showed that LPS could increase miR-130a expression,
tion compared with the control, which is consistent with and NF-κB was involved in this process in human bil-
NF-κB’s ability to enhance the growth of human cervical iary epithelial cells [11]. Because LPS is a widely known
cell lines. TNF-α activator, these results support our conclusions.
miRNA possesses diverse roles that up- or down-regulate Thus, TNF-α stimulates NF-κB to induce miR-130a
target gene expression [52-57]. To identify the miR-130a expression, and in turn, miR-130a downregulates TNF-α
target genes responsible for its effects on cervical cancer expression, which may form a feedback loop of TNF-α/
cells, we used bioinformatics and functional knowledge NF-κB/miR-130a/TNF-α. This negative feedback loop
associated with NF-κB and miR-130a and chose TNF-α may regulate TNF-α production to maintain relatively
as a candidate gene for further study. In the EGFP re- low concentrations. These low TNF-α concentrations
porter assay, the expression of an EGFP reporter plasmid may stimulate the nuclear translocation of NF-κB and en-
containing the TNF-α 3’UTR was repressed by miR-130a, able cells to survive. Therefore, this NF-κB/miR-130a/
and the mutated TNF-α 3’UTR abolished this effect. TNF-α feedback loop may contribute to low TNF-α
Furthermore, qRT-PCR and Western blot analysis showed concentrations that avoid the induction of apoptosis
that miR-130a decreased TNF-α mRNA and protein in carcinogenesis.
expression levels in cervical cancer cells compared with
the control. Together, these data suggest that miR-130a Conclusions
downregulates TNF-α expression by binding to its 3’UTR. This study is the first to demonstrate that NF-κB and
Moreover, ectopic TNF-α expression lacking the 3’UTR miR-130a can promote the growth of human cervical
abrogated the effects of miR-130a on cervical cancer cancer cells and identifies TNF-α as a new target gene of
cell growth in the colony formation assay, but cell miR-130a. NF-κB can increase miR-130a expression, and
viability assessed by MTT assay was not obviously af- this enhancement of miR-130a expression inhibited TNF-
fected. These effects may result from miR-130a’s regu- α expression, which is a direct target of miR-130a. Low
lation of TNF-α requiring a certain length of time to levels of TNF-α induced nuclear NF-κB translocation,
be effective or involving other target genes; however, which caused a gradual decline in miR-130a expression.
the detailed mechanism still needs to be investigated. Based on these results, we provide evidence of the exist-
Therefore, we conclude that miR-130a promotes cell ence of an NF-κB/miR-130a/TNF-α/NF-κB feedback loop
growth through at least the partial involvement of in cervical cancer cells (Figure 5G). Our experimental re-
TNF-α. sults may aid in the understanding of the molecular mech-
Tumor necrosis factor-alpha has been reported to be anisms involving NF-κB and tumorigenesis and might
related to a variety of physiological processes, including provide a new potential biomarker of diagnostic and
cytotoxicity and the regulation of anti-viral and immune therapeutic value for cervical cancer patients.
Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 12 of 14
http://www.translational-medicine.com/content/12/1/155

Figure 5 NF-κB inhibits TNF-α expression, and TNF-α increases NF-κB activity. (A) HeLa and C33A cells were transfected with pcDNA3/NF-κB,
and total protein from cells was collected to determine the TNF-α levels. The endogenous GAPDH expression levels were used to normalize protein
expression. (B) Cells were treated with TNF-α, and Western blot analysis was used to detect NF-κB activity. Cells were collected in PBS, centrifuged,
resuspended in 0.4% NP-40, and centrifuged again to obtain nucleoproteins. Nuclear protein CENPA were used to normalize protein expression.
(C and D) Cells were seeded on 14-well slides and stimulated with TNF-α (20 ng/mL) for 24 h. Next, cells were fixed with 4% paraformaldehyde,
permeabilized with 0.5% Triton X-100, and blocked with 10% donkey serum. A primary antibody raised against p50 was diluted in 1% normal donkey
serum and incubated at 4°C overnight. Cells were washed, and a FITC-labeled donkey anti-rabbit antibody was diluted in 1% normal donkey serum.
Finally, DAPI was used to stain the nuclei. All the experiments were performed in triplicate. (E) Verify the role of miR-130a in the NF-kB induction of
TNF-α. Cells were transfected with pcDNA3/NF-κB and ASO-miR-130a compare pcDNA3/NF-κB and ASO-NC, the cells were collected totle protein for
Western Blot. GAPDH protein expression was used to normalize the endogenous expression data. (F) Cells were treated with TNF-α (20 ng/mL) for
24 h, and RNA was extracted for real-time RT-PCR. U6 snRNA was used to normalize gene expression. (G) The relationship between NF-κB, miR-130a
and TNF-α. (*P < 0.05, **P < 0.01).
Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 13 of 14
http://www.translational-medicine.com/content/12/1/155

Abbreviations 13. Konecny FA: Review of cellular and molecular pathways linking thrombosis
ASO: Antisense oligonucleotide; EGFP: Enhanced green fluorescence protein; and innate immune system during sepsis. J Res Med Sci 2010, 15(6):348–358.
GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; UTR: Untranslated 14. Shishodia S, Aggarwal BB: Nuclear factor-kappaB activation: a question of
region; qRT-PCR: Quantitative Reverse Transcription-PCR. life or death. J Biochem Mol Biol 2002, 35(1):28–40.
15. Kageyama A, Matsui H, Ohta M, Sambuichi K, Kawano H, Notsu T, Imada K,
Competing interests Yokoyama T, Kurabayashi M: Palmitic acid induces osteoblastic differentiation
The authors declare no competing interests. in vascular smooth muscle cells through ACSL3 and NF-kappaB, novel
targets of eicosapentaenoic acid. PLoS One 2013, 8(6):e68197.
Authors’ contributions 16. Liu S, Chen J, Cai X, Wu J, Chen X, Wu YT, Sun L, Chen ZJ: MAVS recruits
JZ: participated in the experimental work and preparation of manuscript. multiple ubiquitin E3 ligases to activate antiviral signaling cascades.
HW, PL, YZ: participated in the experimental work. Ml: analyzed the data and Elife 2013, 2:e00785.
participated in article preparation. HT: designed, directed the experiment. 17. Wei H, Wang B, Miyagi M, She Y, Gopalan B, Huang DB, Ghosh G, Stark GR,
Analyzed data and prepared the manuscript. All authors read and approved Lu T: PRMT5 dimethylates R30 of the p65 subunit to activate NF-kappaB.
the final manuscript. Proc Natl Acad Sci U S A 2013, 110(33):13516–13521.
18. Majetschak M, Obertacke U, Schade FU, Bardenheuer M, Voggenreiter G,
Acknowledgements Bloemeke B, Heesen M: Tumor necrosis factor gene polymorphisms,
This work was supported by the National Natural Science Foundation of leukocyte function, and sepsis susceptibility in blunt trauma patients.
China (No: 31270818; 91029714; 31071191; 31101000) and the Natural Clin Diagn Lab Immunol 2002, 9(6):1205–1211.
Science Foundation of Tianjin (12JCZDJC25100; 09JCZDJC17500). 19. Mittal R, Sharma S, Chhibber S, Harjai K: Evaluation of tumour necrosis
factor-alpha and interleukin-1beta in an experimental pyelonephritis
Author details model induced with planktonic and biofilms cells of Pseudomonas
1
Tianjin Life Science Research Center and School of Basic Medical Sciences, aeruginosa. Can J Infect Dis Med Microbiol 2009, 20(3):e35–e42.
Tianjin Medical University, No. 22 Qi-Xiang-Tai Road, Tianjin 300070, China. 20. He X, Shu J, Xu L, Lu C, Lu A: Inhibitory effect of Astragalus polysaccharides
2
Tianjin Central Hospital of Gynecology Obstetrics, Tianjin, China. on lipopolysaccharide-induced TNF-a and IL-1beta production in THP-1
cells. Molecules 2012, 17(3):3155–3164.
Received: 28 December 2013 Accepted: 20 May 2014 21. Merghani TH, Saeed A, Alawad A: Changes in plasma IL4, TNFa and CRP in
Published: 1 June 2014 response to regular passive smoking at home among healthy school
children in Khartoum, Sudan. Afr Health Sci 2012, 12(1):41–47.
References 22. Aggarwal BB: Signalling pathways of the TNF superfamily: a double-edged
1. Jo MJ, Lee JR, Cho IJ, Kim YW, Kim SC: Roots of erigeron annuus attenuate sword. Nat Rev Immunol 2003, 3(9):745–756.
acute inflammation as mediated with the inhibition of NF- kappa 23. Tartaglia LA, Goeddel DV: Two TNF receptors. Immunol Today 1992,
B-associated nitric oxide and prostaglandin E2 production. Evid Based 13(5):151–153.
Complement Alternat Med 2013, 2013:297427. 24. Varfolomeev EE, Ashkenazi A: Tumor necrosis factor: an apoptosis JuNKie?
2. Park SW, Cho C, Cho BN, Kim Y, Goo TW, Kim YI: 15-deoxy-delta12,14 Cell 2004, 116(4):491–497.
-prostaglandin J 2 down-regulates activin-induced activin receptor, 25. Balkwill F, Joffroy C: TNF: a tumor-suppressing factor or a tumor-
smad, and cytokines expression via suppression of NF- kappa B and promoting factor? Future Oncol 2010, 6(12):1833–1836.
MAPK signaling in HepG2 cells. PPAR Res 2013, 2013:751261. 26. Fajardo LF, Kwan HH, Kowalski J, Prionas SD, Allison AC: Dual role of
3. Ling H, Gray CB, Zambon AC, Grimm M, Gu Y, Dalton N, Purcell NH, tumor necrosis factor-alpha in angiogenesis. Am J Pathol 1992,
Peterson K, Brown JH: Ca2+/Calmodulin-dependent protein kinase II delta 140(3):539–544.
mediates myocardial ischemia/reperfusion injury through nuclear 27. Rube CE, Wilfert F, Uthe D, Schmid KW, Knoop R, Willich N, Schuck A, Rube
factor-kappaB. Circ Res 2013, 112(6):935–944. C: Modulation of radiation-induced tumour necrosis factor alpha
4. Zhang J, Chen J, Yang J, Xu CW, Pu P, Ding JW, Jiang H: Resveratrol (TNF-alpha) expression in the lung tissue by pentoxifylline. Radiother
attenuates oxidative stress induced by balloon injury in the rat carotid Oncol J Eur Soc Ther Radiol Oncol 2002, 64(2):177–187.
artery through actions on the ERK1/2 and NF-kappa B pathway. 28. Hagemann T, Robinson SC, Schulz M, Trumper L, Balkwill FR, Binder C:
Cell Physiol Biochem 2013, 31(2–3):230–241. Enhanced invasiveness of breast cancer cell lines upon co-cultivation
5. Hyldahl RD, Schwartz LM, Clarkson PM: NF-KB activity functions in primary with macrophages is due to TNF-alpha dependent up-regulation of
pericytes in a cell- and non-cell-autonomous manner to affect myotube matrix metalloproteases. Carcinogenesis 2004, 25(8):1543–1549.
formation. Muscle Nerve 2013, 47(4):522–531. 29. Kulbe H, Hagemann T, Szlosarek PW, Balkwill FR, Wilson JL: The
6. Limpert AS, Bai S, Narayan M, Wu J, Yoon SO, Carter BD, Lu QR: NF-kappaB inflammatory cytokine tumor necrosis factor-alpha regulates
forms a complex with the chromatin remodeler BRG1 to regulate chemokine receptor expression on ovarian cancer cells. Cancer Res
Schwann cell differentiation. J Neurosci 2013, 33(6):2388–2397. 2005, 65(22):10355–10362.
7. Ivanov VN, Ronai Z: p38 protects human melanoma cells from UV-induced 30. Sorimachi K, Waring P, Hapel AJ, Fukasawa I, Kaneko Y, Masawa N:
apoptosis through down-regulation of NF-kappaB activity and Fas Characterisation of apoptosis in myb-transformed hematopoietic cell
expression. Oncogene 2000, 19(26):3003–3012. (MTHC-A) lines: TNF-alpha-induced apoptosis and prevention by cAMP.
8. Zhang W, Zhao S, Li Y, Peng G, Han P: Acute blood glucose fluctuation J Clin Exp Hematop 2013, 53(2):115–120.
induces myocardial apoptosis through oxidative stress and nuclear 31. Kim HR, Heo YM, Jeong KI, Kim YM, Jang HL, Lee KY, Yeo CY, Kim SH, Lee
factor-kB activation. Cardiology 2013, 124(1):11–17. HK, Kim SR, Kim EG, Choi JK: FGF-2 inhibits TNF-alpha mediated apoptosis
9. Sung B, Ahn KS, Aggarwal BB: Noscapine, a benzylisoquinoline alkaloid, through upregulation of Bcl2-A1 and Bcl-xL in ATDC5 cells. BMB Rep
sensitizes leukemic cells to chemotherapeutic agents and cytokines 2012, 45(5):287–292.
by modulating the NF-kappaB signaling pathway. Cancer Res 2010, 32. Lukiw WJ, Andreeva TV, Grigorenko AP, Rogaev EI: Studying micro RNA
70(8):3259–3268. function and dysfunction in Alzheimer's disease. Front Genet 2012,
10. Jin HR, Jin SZ, Cai XF, Li D, Wu X, Nan JX, Lee JJ, Jin X: Cryptopleurine 3:327.
targets NF-kappaB pathway, leading to inhibition of gene products 33. Fabbri M: Targeting ncRNAs to combat metastases. Epigenomics 2010,
associated with cell survival, proliferation, invasion, and angiogenesis. 2(6):719–721.
PLoS One 2012, 7(6):e40355. 34. Ryu I, Park JH, An S, Kwon OS, Jang SK: eIF4GI facilitates the MicroRNA-mediated
11. Zhou R, Hu G, Gong AY, Chen XM: Binding of NF-kappaB p65 subunit to gene silencing. PLoS One 2013, 8(2):e55725.
the promoter elements is involved in LPS-induced transactivation of 35. Zhdanov VP: Conditions of appreciable influence of microRNA on a large
miRNA genes in human biliary epithelial cells. Nucleic Acids Res 2010, number of target mRNAs. Mol Biosyst 2009, 5(6):638–643.
38(10):3222–3232. 36. Kim GH, Samant SA, Earley JU, Svensson EC: Translational control of
12. Pfeffer LM: The role of nuclear factor kappaB in the interferon response. FOG-2 expression in cardiomyocytes by microRNA-130a. PLoS One
J Interferon Cytokine Res 2011, 31(7):553–559. 2009, 4(7):e6161.
Zhang et al. Journal of Translational Medicine 2014, 12:155 Page 14 of 14
http://www.translational-medicine.com/content/12/1/155

37. Wu WH, Hu CP, Chen XP, Zhang WF, Li XW, Xiong XM, Li YJ: MicroRNA- 58. Wang G, Wang X, Yu H, Wei S, Williams N, Holmes DL, Halfmann R, Naidoo
130a mediates proliferation of vascular smooth muscle cells in J, Wang L, Li L, Chen S, Harran P, Lei X, Wang X: Small-molecule activation
hypertension. Am J Hypertens 2011, 24(10):1087–1093. of the TRAIL receptor DR5 in human cancer cells. Nat Chem Biol 2013,
38. Hager M, Pedersen CC, Larsen MT, Andersen MK, Hother C, Gronbaek K, Jarmer H, 9(2):84–89.
Borregaard N, Cowland JB: MicroRNA-130a-mediated down-regulation of 59. Leahomschi S, Molinsky J, Klanova M, Andera L, Peterka M, Gasova Z, Klener
Smad4 contributes to reduced sensitivity to TGF-beta1 stimulation in P Sr, Trneny M, Necas E, Simonova T, Zivny J, Klener P Jr: Multi-level
granulocytic precursors. Blood 2011, 118(25):6649–6659. disruption of the extrinsic apoptotic pathway mediates resistance of
39. Hagemann T, Wilson J, Kulbe H, Li NF, Leinster DA, Charles K, Klemm F, leukemia cells to TNF-related apoptosis-inducing ligand (TRAIL).
Pukrop T, Binder C, Balkwill FR: Macrophages induce invasiveness of Neoplasma 2013, 60(2):223–231.
epithelial cancer cells via NF-kappa B and JNK. J Immunol 2005, 60. Sethi G, Sung B, Aggarwal BB: TNF: a master switch for inflammation to
175(2):1197–1205. cancer. Front Biosci 2008, 13:5094–5107.
40. Acunzo M, Visone R, Romano G, Veronese A, Lovat F, Palmieri D, Bottoni A, 61. Rahman I, Gilmour PS, Jimenez LA, MacNee W: Oxidative stress and
Garofalo M, Gasparini P, Condorelli G, Chiariello M, Croce CM: miR-130a TNF-alpha induce histone acetylation and NF-kappaB/AP-1 activation in
targets MET and induces TRAIL-sensitivity in NSCLC by downregulating alveolar epithelial cells: potential mechanism in gene transcription in
miR-221 and 222. Oncogene 2012, 31(5):634–642. lung inflammation. Mol Cell Biochem 2002, 234–235(1–2):239–248.
41. Kovaleva V, Mora R, Park YJ, Plass C, Chiramel AI, Bartenschlager R, Dohner 62. Jackson-Bernitsas DG, Ichikawa H, Takada Y, Myers JN, Lin XL, Darnay BG,
H, Stilgenbauer S, Pscherer A, Lichter P, Seiffert M: miRNA-130a targets Chaturvedi MM, Aggarwal BB: Evidence that TNF-TNFR1-TRADD-TRAF2-
ATG2B and DICER1 to inhibit autophagy and trigger killing of chronic RIP-TAK1-IKK pathway mediates constitutive NF-kappaB activation and
lymphocytic leukemia cells. Cancer Res 2012, 72(7):1763–1772. proliferation in human head and neck squamous cell carcinoma.
42. Wu K, Tian S, Zhou H, Wu Y: Statins protect human endothelial cells from Oncogene 2007, 26(10):1385–1397.
TNF-induced inflammation via ERK5 activation. Biochem Pharmacol 2013, 63. Nickles D, Falschlehner C, Metzig M, Boutros M: A genome-wide RNA
85(12):1753–1760. interference screen identifies caspase 4 as a factor required for tumor
43. Kim JM, Cho HH, Lee SY, Hong CP, Yang J, Kim YS, Suh KT, Jung JS: necrosis factor alpha signaling. Mol Cell Biol 2012, 32(17):3372–3381.
Role of IRAK1 on TNF-induced proliferation and NF-kB activation in 64. Old LJ: Tumor necrosis factor (TNF). Science 1985, 230(4726):630–632.
human bone marrow mesenchymal stem cells. Cell Physiol Biochem 65. Shinobu N, Iwamura T, Yoneyama M, Yamaguchi K, Suhara W, Fukuhara Y,
2012, 30(1):49–60. Amano F, Fujita T: Involvement of TIRAP/MAL in signaling for the
44. Mizumoto Y, Kyo S, Kiyono T, Takakura M, Nakamura M, Maida Y, Mori N, activation of interferon regulatory factor 3 by lipopolysaccharide.
Bono Y, Sakurai H, Inoue M: Activation of NF-kappaB is a novel target FEBS Lett 2002, 517(1–3):251–256.
of KRAS-induced endometrial carcinogenesis. Clin Cancer Res 2011, 66. Suk K, Kim YH, Chang I, Kim JY, Choi YH, Lee KY, Lee MS: IFNalpha
17(6):1341–1350. sensitizes ME-180 human cervical cancer cells to TNFalpha-induced
45. Takada Y, Khuri FR, Aggarwal BB: Protein farnesyltransferase inhibitor (SCH apoptosis by inhibiting cytoprotective NF-kappaB activation. FEBS Lett
66336) abolishes NF-kappaB activation induced by various carcinogens 2001, 495(1–2):66–70.
and inflammatory stimuli leading to suppression of NF-kappaB-regulated
gene expression and up-regulation of apoptosis. J Biol Chem 2004, doi:10.1186/1479-5876-12-155
279(25):26287–26299. Cite this article as: Zhang et al.: NF-κB-modulated miR-130a targets
46. Zuo QP, Liu SK, Li ZJ, Li B, Zhou YL, Guo R, Huang LH: NF-kappaB p65 TNF-α in cervical cancer cells. Journal of Translational Medicine
modulates the telomerase reverse transcriptase in the HepG(2) 2014 12:155.
hepatoma cell line. Eur J Pharmacol 2011, 672(1–3):113–120.
47. Bian X, McAllister-Lucas LM, Shao F, Schumacher KR, Feng Z, Porter AG,
Castle VP, Opipari AW Jr: NF-kappa B activation mediates doxorubicin-
induced cell death in N-type neuroblastoma cells. J Biol Chem 2001,
276(52):48921–48929.
48. Hettmann T, DiDonato J, Karin M, Leiden JM: An essential role for nuclear
factor kappaB in promoting double positive thymocyte apoptosis. J Exp
Med 1999, 189(1):145–158.
49. Campbell KJ, Rocha S, Perkins ND: Active repression of antiapoptotic gene
expression by RelA(p65) NF-kappa B. Mol Cell 2004, 13(6):853–865.
50. Gantier MP, Stunden HJ, McCoy CE, Behlke MA, Wang D, Kaparakis-Liaskos
M, Sarvestani ST, Yang YH, Xu D, Corr SC, Morand EF, Williams BR: A miR-19
regulon that controls NF-kappaB signaling. Nucleic Acids Res 2012,
40(16):8048–8058.
51. Song L, Liu L, Wu Z, Li Y, Ying Z, Lin C, Wu J, Hu B, Cheng SY, Li M, Li J:
TGF-beta induces miR-182 to sustain NF-kappaB activation in glioma
subsets. J Clin Invest 2012, 122(10):3563–3578.
52. Dell'aversana C, Altucci L: miRNA-mediated deregulation in leukemia.
Front Genet 2012, 3:252.
53. Anand S: A brief primer on microRNAs and their roles in angiogenesis.
Vasc Cell 2013, 5(1):2. Submit your next manuscript to BioMed Central
54. Hou X, Tang Z, Liu H, Wang N, Ju H, Li K: Discovery of MicroRNAs and take full advantage of:
associated with myogenesis by deep sequencing of serial developmental
skeletal muscles in pigs. PLoS One 2012, 7(12):e52123.
• Convenient online submission
55. Schmitt MJ, Philippidou D, Reinsbach SE, Margue C, Wienecke-Baldacchino
A, Nashan D, Behrmann I, Kreis S: Interferon-gamma-induced activation of • Thorough peer review
Signal Transducer and Activator of Transcription 1 (STAT1) up-regulates the • No space constraints or color figure charges
tumor suppressing microRNA-29 family in melanoma cells. Cell Commun
Signal 2012, 10(1):41. • Immediate publication on acceptance
56. Jethwa K, Wei J, McEnery K, Heimberger AB: miRNA-mediated immune • Inclusion in PubMed, CAS, Scopus and Google Scholar
regulation and immunotherapeutic potential in glioblastoma. Clin Investig • Research which is freely available for redistribution
(Lond) 2011, 1(12):1637–1650.
57. Biyashev D, Qin G: E2F and microRNA regulation of angiogenesis. Am J
Cardiovasc Dis 2011, 1(2):110–118. Submit your manuscript at
www.biomedcentral.com/submit