Piis0092867420304943 PDF

Article
Structural Basis for Potent Neutralization of

Betacoronaviruses by Single-Domain Camelid
Antibodies
Graphical Abstract Authors
Daniel Wrapp, Dorien De Vlieger,
Kizzmekia S. Corbett, ..., Bert Schepens,
Xavier Saelens, Jason S. McLellan
Correspondence
[email protected] (B.S.),
[email protected] (X.S.),
[email protected] (J.S.M.)
In Brief
Using llamas immunized with prefusion-
stabilized betacoronavirus spike
proteins, Wrapp et al. identify neutralizing
cross-reactive single-domain camelid
antibodies, which may serve not only as
useful reagents for researchers studying
the viruses causing MERS, SARS, and
COVID-19, but also potential therapeutic
candidates. Crystal structures further
reveal how these antibodies bind spike
proteins to prevent virus entry into cells.
Highlights
d VHHs isolated from a llama immunized with prefusion-
stabilized coronavirus spikes
d Structural characterization of VHHs reveals conserved

mechanism of neutralization
d SARS-CoV-1 S-directed VHH cross-reacts with SARS-CoV-

2S
d Bivalent VHH neutralizes SARS-CoV-2 pseudoviruses
Wrapp et al., 2020, Cell 181, 1–12

May 28, 2020 ª 2020 Elsevier Inc.
https://doi.org/10.1016/j.cell.2020.04.031 ll
Please cite this article in press as: Wrapp et al., Structural Basis for Potent Neutralization of Betacoronaviruses by Single-Domain Camelid
Antibodies, Cell (2020), https://doi.org/10.1016/j.cell.2020.04.031
ll
Article
Structural Basis for Potent
Neutralization of Betacoronaviruses
by Single-Domain Camelid Antibodies
Daniel Wrapp,1,9 Dorien De Vlieger,2,3,4,9 Kizzmekia S. Corbett,5 Gretel M. Torres,6 Nianshuang Wang,1
Wander Van Breedam,2,3 Kenny Roose,2,3 Loes van Schie,2,3 VIB-CMB COVID-19 Response Team, Markus Hoffmann,7
Stefan Pöhlmann,7,8 Barney S. Graham,5 Nico Callewaert,2,3 Bert Schepens,2,3,4,* Xavier Saelens,2,3,4,*
and Jason S. McLellan1,10,*
1Department of Molecular Biosciences, The University of Texas at Austin, Austin, TX 78712, USA
2VIB-UGent Center for Medical Biotechnology, VIB, 9052 Ghent, Belgium
3Department of Biochemistry and Microbiology, Ghent University, 9052 Ghent, Belgium
4Department of Biomedical Molecular Biology, Ghent University, 9052 Ghent, Belgium
5Vaccine Research Center, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, USA
6Department of Microbiology and Immunology, Geisel School of Medicine at Dartmouth, Lebanon, NH 03756, USA
7Infection Biology Unit, German Primate Center – Leibniz Institute for Primate Research, 37077 Göttingen, Germany
8Faculty of Biology and Psychology, University Göttingen, 37077 Göttingen, Germany
9These authors contributed equally
10Lead Contact
*Correspondence: [email protected] (B.S.), [email protected] (X.S.), [email protected] (J.S.M.)

https://doi.org/10.1016/j.cell.2020.04.031
SUMMARY
Coronaviruses make use of a large envelope protein called spike (S) to engage host cell receptors and cata-
lyze membrane fusion. Because of the vital role that these S proteins play, they represent a vulnerable target
for the development of therapeutics. Here, we describe the isolation of single-domain antibodies (VHHs) from
a llama immunized with prefusion-stabilized coronavirus spikes. These VHHs neutralize MERS-CoV or SARS-
CoV-1 S pseudotyped viruses, respectively. Crystal structures of these VHHs bound to their respective viral
targets reveal two distinct epitopes, but both VHHs interfere with receptor binding. We also show cross-reac-
tivity between the SARS-CoV-1 S-directed VHH and SARS-CoV-2 S and demonstrate that this cross-reactive
VHH neutralizes SARS-CoV-2 S pseudotyped viruses as a bivalent human IgG Fc-fusion. These data provide
a molecular basis for the neutralization of pathogenic betacoronaviruses by VHHs and suggest that these
molecules may serve as useful therapeutics during coronavirus outbreaks.
INTRODUCTION The surfaces of coronaviruses are decorated with a spike (S)

glycoprotein, a large class I fusion protein (Bosch et al., 2003).
Coronaviruses are enveloped, positive-sense RNA viruses that The S protein forms a trimeric complex that can be functionally
are divided into four genera (a, b, g, and d) and infect a wide categorized into two distinct subunits, S1 and S2, that are sepa-
variety of host organisms (Woo et al., 2009). There are at least rated by a protease cleavage site. The S1 subunit contains the
seven coronaviruses that can cause disease in humans, and receptor-binding domain (RBD), which interacts with a host-
four of these viruses (HCoV-HKU1, HCoV-OC43, HCoV-NL63, cell receptor protein to trigger membrane fusion. The S2 subunit
and HCoV-229E) circulate seasonally throughout the global contains the membrane fusion machinery, including the hydro-
population, causing mild respiratory disease in most patients phobic fusion peptide and the a-helical heptad repeats. The
(Gaunt et al., 2010). The three remaining viruses, SARS- functional host cell receptors for SARS-CoV-1 and MERS-CoV
CoV-1, MERS-CoV, and SARS-CoV-2, are zoonotic pathogens are angiotensin converting enzyme 2 (ACE2) and dipeptidyl
that have caused epidemics or pandemics with severe and peptidase 4 (DPP4), respectively (Li et al., 2003; Raj et al.,
often fatal symptoms after emerging into the human population 2013). The interactions between these receptors and their
(Chan et al., 2020; Huang et al., 2020; Ksiazek et al., 2003; Lu respective RBDs have been thoroughly characterized, both
et al., 2020; Zaki et al., 2012). For these highly pathogenic be- structurally and biophysically (Li et al., 2005; Wang et al.,
tacoronaviruses, prophylactic and therapeutic interventions are 2013). Recently, it has been reported that SARS-CoV-2 S also
needed. makes use of ACE2 as a functional host-cell receptor, and
Cell 181, 1–12, May 28, 2020 ª 2020 Elsevier Inc. 1

ll
Article
several structures of this complex have already been reported virus (RSV) (Detalle et al., 2015; Rossey et al., 2017). The use
(Hoffmann et al., 2020; Lan et al., 2020; Wan et al., 2020; Yan of VHHs as biologics in the context of a respiratory infection is
et al., 2020; Zhou et al., 2020). a particularly attractive application, because the highly stable
Recent advances in cryoelectron microscopy (cryo-EM) have VHHs can be nebulized and administered via an inhaler directly
allowed researchers to determine high-resolution structures of to the site of infection (Respaud et al., 2015). Moreover, because
the trimeric S protein ectodomains and understand how S func- of their stability after prolonged storage, VHHs could be stock-
tions as a macromolecular machine (Kirchdoerfer et al., 2016; Li piled as therapeutic treatment options in case of an epidemic.
et al., 2005; Walls et al., 2016; Wang et al., 2013). Initial cryo-EM Although therapeutics against MERS-CoV and SARS-CoV-2
characterization of the SARS-CoV-1 spike revealed that the are sorely needed, the feasibility of using VHHs for this purpose
RBDs adopted at least two distinct conformations. In the ‘‘up’’ has not yet been adequately explored. Several MERS-CoV
conformation, the RBDs jut out away from the rest of S, such S-directed VHHs have been reported as a result of camelid im-
that they can easily engage ACE2 without steric clash. In the munization, but their epitopes remain largely undefined, other
‘‘down’’ conformation, the RBDs are tightly packed against the than being classified as RBD-directed (Stalin Raj et al., 2018;
top of the S2 subunit, preventing binding by ACE2 (Gui et al., Zhao et al., 2018).
2017). Subsequent experiments have corroborated this phe- Here, we report the isolation of two potently neutralizing VHHs
nomenon and similar dynamics have been observed in MERS- directed against the SARS-CoV-1 and MERS-CoV RBDs,
CoV S, SARS-CoV-2 S, and in alphacoronavirus S proteins respectively. These VHHs were elicited in response to immuniza-
(Kirchdoerfer et al., 2018; Pallesen et al., 2017; Walls et al., tion of a llama with prefusion-stabilized SARS-CoV-1 and
2020; Wrapp and McLellan, 2019; Wrapp et al., 2020; Yuan MERS-CoV S proteins. We solved the crystal structures of these
et al., 2017). Because of the relatively low abundance of particles two VHHs in complex with their respective viral epitopes, which
that can be observed by cryo-EM with three RBDs in the up suggested likely mechanisms of neutralization were occlusion of
conformation, it is thought that this conformation may corre- the receptor-binding interface and trapping of the RBDs in the up
spond to an energetically unstable state (Kirchdoerfer et al., conformation. We also show that the SARS-CoV-1 RBD-
2018; Pallesen et al., 2017). These observations have led to the directed VHH cross-reacts with the SARS-CoV-2 RBD and can
hypothesis that the CoV RBDs might act as a molecular ratchet: block the receptor-binding interface. After engineering this
a receptor-binding event would trap the RBD in the less stable up VHH into a bivalent Fc-fusion, we show that this cross-reactive
conformation, leading to gradual destabilization of S1 until S2 is VHH can also neutralize SARS-CoV-2 S pseudoviruses. We
finally triggered to initiate membrane fusion. Recent experiments further demonstrate that the VHH-Fc fusion can be produced
characterizing RBD-directed anti-SARS-CoV-1 antibodies that at high yields in an industry-standard CHO cell system, suggest-
trap the SARS-CoV-1 RBD in the up conformation and lead to ing that it merits further investigation as a potential therapeutic
destabilization of the prefusion S have lent support to this hy- for the ongoing COVID-19 pandemic.
pothesis (Walls et al., 2019).
Numerous anti-SARS-CoV-1 RBD and anti-MERS-CoV RBD RESULTS
antibodies have been reported, and their mechanisms of neutral-
ization can be attributed to the occlusion of the receptor-binding Isolation of Betacoronavirus S-Directed VHHs
site and to trapping the RBD in the unstable up conformation, Our initial aim was to isolate VHHs that could potently neutralize
effectively acting as a receptor mimic that triggers a premature MERS-CoV and SARS-CoV-1. Therefore, we sequentially immu-
transition from the prefusion-to-postfusion conformation nized a llama subcutaneously twice with SARS-CoV-1 S protein,
(Hwang et al., 2006; Walls et al., 2019; Wang et al., 2018; twice with MERS-CoV S protein, once again with SARS-CoV-1
Wang et al., 2015). In addition to conventional antibodies, camel- S, and finally with both SARS-CoV-1 and MERS-CoV S protein
ids also produce heavy-chain-only antibodies (HCAbs), which (Figure S1A). To obtain VHHs directed against these S proteins,
contain a single variable domain (VHH) instead of two variable two consecutive rounds of panning were performed by phage
domains (VH and VL) that make up the equivalent antigen-bind- display using either SARS-CoV-1 S or MERS-CoV S proteins.
ing fragment (Fab) of conventional immunoglobulin G (IgG) anti- Positive clones were sequenced, and multiple sequence align-
bodies (Hamers-Casterman et al., 1993). This single variable ment and phylogenetic analysis using the neighbor-joining
domain, in the absence of an effector domain, is referred to as method revealed that seven unique MERS-CoV S and five
a single-domain antibody, VHH, or Nanobody and typically can unique SARS-CoV-1 S VHHs were isolated (Figure S1B). These
acquire affinities and specificities for antigens comparable to VHHs and an irrelevant control (RSV F-VHH, directed against
conventional antibodies. VHHs can easily be constructed into the F protein of human respiratory syncytial virus) were subse-
multivalent formats and they have higher thermal stability and quently expressed in Pichia pastoris and purified from the yeast
chemostability than most antibodies (De Vlieger et al., 2018; Du- medium (Rossey et al., 2017). The binding of the purified VHHs to
moulin et al., 2002; Govaert et al., 2012; Laursen et al., 2018; Rot- prefusion-stabilized MERS-CoV S and SARS-CoV-1 S was
man et al., 2015; van der Linden et al., 1999). VHHs are also confirmed by ELISA (Figure S1C). As expected, the irrelevant
known to be less susceptible to steric hindrances that might pre- control had no detectable binding to MERS-CoV S and SARS-
vent the binding of larger conventional antibodies (Forsman CoV-1 S. Four clones (MERS VHH-55, -12, -34, and -40), ob-
et al., 2008). Their advantageous biophysical properties have tained after panning on MERS-CoV S protein, bound with high
led to the evaluation of several VHHs as therapeutics against affinity to prefusion-stabilized MERS-CoV S, whereas the affin-
common respiratory pathogens, such as respiratory syncytial ities of VHH-2, -20 and -15 were 100- to 1000-fold weaker. Of
2 Cell 181, 1–12, May 28, 2020

ll
Article
Figure 1. Epitope Determination and Biophysical Characterization of MERS VHH-55 and SARS VHH-72
(A) Reactivity of MERS-CoV and SARS-CoV RBD-directed VHHs against the MERS-CoV and SARS-CoV-1 RBD, respectively. A VHH against an irrelevant antigen
(F-VHH) was included as a control. Datapoints represent the mean of three replicates and error bars represent the standard errors of the mean.
(B) SPR sensorgrams showing binding between the MERS-CoV RBD and MERS VHH-55 (left) and SARS-CoV-1 RBD and SARS VHH-72 (right). Binding curves
are colored black, and fit of the data to a 1:1 binding model is colored red.
the five clones isolated after panning on SARS-CoV-1 S protein, (Figure 1A; Figure S3).The MERS-CoV S-specific VHHs strongly
three VHH clones (SARS VHH-72, -1, and -6) interacted strongly bound to MERS-CoV S1 and RBD in a concentration-dependent
with prefusion stabilized SARS-CoV-1 S protein. We observed manner and failed to bind to the MERS-CoV NTD. Similarly,
no cross-reactivity of MERS VHHs with SARS-CoV-1 S and strong binding of SARS VHH-72 to the SARS-CoV-1 RBD protein
vice versa (data not shown). but not the SARS-CoV-1 NTD protein was observed. No binding
of SARS VHH-44 to either the SARS-CoV-1 S or NTD protein was
VHHs Neutralize Coronavirus S Pseudotyped Viruses detected, leaving the domain that this VHH recognizes undeter-
To assess the antiviral activity of the MERS-CoV and SARS-CoV mined. These data demonstrate that the neutralizing SARS VHH-
S-directed VHHs, we performed in vitro neutralization assays us- 72 and MERS VHH-55 target the RBDs. Based on the specificity
ing MERS-CoV England1 S and SARS-CoV-1 Urbani S pseudo- and potent neutralizing capacity of SARS VHH-72 and MERS
typed lentiviruses. The high-affinity MERS VHH-55, -12, -34, and VHH-55, we measured the affinities of these VHHs by immobiliz-
-40 neutralized MERS-CoV S pseudotyped virus with IC50 values ing recombinantly expressed VHH to a surface plasmon reso-
ranging from 0.014 to 2.9 mg/mL (0.9 nM to 193.3 nM), whereas nance (SPR) sensorchip and determined the binding kinetics
the lower affinity MERS-CoV- or SARS-CoV-1-specific VHHs for their respective RBDs. We found that both of these VHHs
had no inhibitory effect (Table S1). SARS VHH-72 and -44 bound to their targets with high affinity. SARS VHH-72 bound
neutralized lentiviruses pseudotyped with SARS-CoV-1 S with to its target with an affinity of 1.2 nM and MERS VHH-55 bound
IC50 values of 0.14 (9 nM) and 5.5 mg/mL (355 nM), respectively. to its target with an affinity of 79.2 pM, in part due to a very slow
No binding was observed for SARS VHH-44 to prefusion-stabi- off-rate constant (kd = 8.2 x105 s1) (Figure 1B).
lized SARS-CoV-1 S protein in the ELISA assay. Sequence anal-
ysis revealed that the neutralizing MERS-CoV-specific VHHs Structural Basis of VHH Interaction with RBDs
-12, -40, and -55 have highly similar complementarity-deter- To investigate the molecular determinants that mediate potent
mining regions (CDRs), indicating that they likely belong to the neutralization and high-affinity binding by MERS VHH-55, we
same clonal family and may bind to the same epitope (Figure S2). solved the crystal structure of MERS VHH-55 bound to the
In contrast, the CDRs from the SARS-CoV S-specific VHHs -44 MERS-CoV RBD. Crystals grew in space group C2221 and dif-
and -72 are very different. fracted X-rays to a resolution of 3.4 Å. After determining a molec-
ular replacement solution and iterative building and refinement,
Mapping Domain Specificity of Betacoronavirus our structure reached an Rwork/Rfree of 24.7%/27.8% (Table
S-Directed VHHs S2). The asymmetric unit of this crystal contained eight copies
To map the epitopes targeted by the neutralizing VHHs, we of the MERS VHH-55 + MERS-CoV RBD complex and had a sol-
tested binding to recombinant MERS-CoV S1, RBD, and N-ter- vent content of ~58%. The electron density allowed unambigu-
minal domain (NTD) and SARS-CoV-1 RBD and NTD by ELISA ous definition of the interface between the RBD and VHH, with
Cell 181, 1–12, May 28, 2020 3

ll
Article
Figure 2. The Crystal Structure of MERS
VHH-55 Bound to the MERS-CoV RBD
(A) MERS VHH-55 is shown as blue ribbons and
the MERS-CoV RBD is shown as a tan-colored
molecular surface. The DPP4 binding interface on
the MERS-CoV RBD is colored red.
(B) The structure of DPP4 bound to the MERS-CoV
RBD (PDB ID: 4L72) is aligned to the crystal
structure of MERS VHH-55 bound to the MERS-
CoV RBD. A single monomer of DPP4 is shown as
a red, transparent molecular surface.
(C) A zoomed-in view of the panel from (A), with the
MERS-CoV RBD now displayed as tan-colored
ribbons. Residues that form interactions are
shown as sticks, with nitrogen atoms colored dark
blue and oxygen atoms colored red. Hydrogen-
bonds and salt bridges between MERS VHH-55
and the MERS-CoV RBD are shown as black dots.
(D) The same view from (C) has been turned by
approximately 90 to show additional contacts.
Residues that form interactions are shown as
sticks, with nitrogen atoms colored dark blue and
oxygen atoms colored red. Hydrogen bonds and
salt bridges between MERS VHH-55 and the
MERS-CoV RBD are shown as black dots.
the three CDRs forming extensive binding contacts with the likely that MERS VHH-55 would cross-react with any of these
RBD, burying 716 Å2 of surface area by pinching the RBD be- more distantly related S proteins.
tween the CDR2 and CDR3. The CDR3 of MERS VHH-55 is We also sought to discover the molecular determinants of
looped over the DPP4-binding interface, occluding DPP4 from binding between SARS VHH-72 and the SARS-CoV-1 RBD by
productively engaging the MERS-CoV RBD (Figures 2A and 2B). determining the crystal structure of this complex. Crystals
There are numerous contacts between the CDRs of MERS grew in space group P3121 and diffracted X-rays to a resolution
VHH-55 and the MERS-CoV RBD; most are confined to CDRs of 2.2 Å. We obtained a molecular replacement solution and
2 and 3. A network of interactions from all three CDRs (Figures refined the structure to an Rwork/Rfree of 20.3%/23.6% through
2C and 2D) suggests that RBD residue Arg542 has a critical iterative building and refinement (Table S2). Our structure reveals
role in MERS VHH-55 binding. This arginine has previously that CDRs 2 and 3 contribute to most of the 834 Å2 of buried sur-
been identified as one of the 12 conserved residues that are face area at the binding interface (Figure 3A). This epitope
crucial for high-affinity DPP4 engagement (Figure S4A) (Wang does not, however, overlap with the ACE2 footprint on the
et al., 2013; 2014). SARS-CoV-1 RBD. Rather, ACE2 would clash with the CDR-
In addition to forming a salt bridge with Glu513 from the distal framework of SARS VHH-72, as opposed to classical
MERS-CoV RBD, Trp99 of the MERS VHH-55 CDR3 is posi- receptor blocking in which the CDRs would occupy the ACE2
tioned near a hydrophobic patch formed by Phe506 (Figure S4B). binding interface (Figure 3B). ACE2 also carries an N-glycan
This residue exhibits natural sequence variation in several modification at position Asn322 (Yan et al., 2020). When bound
MERS-CoV strains, such that a Leu is occasionally observed at to the RBD, this N-glycan points into the space that is occupied
this position. To evaluate the extent to which this substitution im- by SARS VHH-72, forming an even larger clash (Figure 3C).
pacts MERS VHH-55 binding, we generated a F506L substitu- SARS VHH-72 binds to the SARS-CoV-1 RBD through a
tion and measured binding by SPR (Figure S4C). This substitu- hydrogen-bond network involving CDRs 2 and 3, in which back-
tion resulted in a ~200-fold reduction in MERS VHH-55 binding bone groups participate extensively (Figures 3D and 3E). This
affinity. Despite this substantial reduction, the affinity of MERS network probably accounts for the high-affinity binding that we
VHH-55 to MERS-CoV RBD F506L remained high, with a KD = observed for these two molecules.
16.5 nM. Other than the variability that is observed at position
506 of the MERS-CoV RBD, the rest of the MERS VHH-55 SARS VHH-72 Cross-Reacts with WIV1-CoV and SARS-
epitope is highly conserved across the 863 strains that are CoV-2
curated in the MERS-CoV Virus Variation database (Figure S4A). Analysis of 10 available SARS-CoV-1 sequences revealed a high
Despite this predicted broad recognition of MERS-CoV strains, degree of conservation in the residues that make up the SARS
the average sequence identity of 24% between the MERS-CoV VHH-72 epitope, prompting us to explore the breadth of SARS
RBD and the RBDs from the seasonal coronaviruses HCoV- VHH-72 binding (Figure S5A). WIV1-CoV is a betacoronavirus
HKU1, HCoV-OC43, HCoV-229E, and HCoV-NL63 makes it un- found in bats that is closely related to SARS-CoV-1 and also
4 Cell 181, 1–12, May 28, 2020

ll
Article
Figure 3. The Crystal Structure of SARS VHH-72 Bound to the SARS-CoV-1 RBD
(A) SARS VHH-72 is shown as dark blue ribbons and the SARS-CoV-1 RBD is shown as a pink-colored molecular surface. The ACE2 binding interface on the
SARS-CoV-1 RBD is colored red.
(B) The structure of ACE2 bound to the SARS-CoV-1 RBD (PDB ID: 2AJF) is aligned to the crystal structure of SARS VHH-72 bound to the SARS-CoV-1 RBD.
ACE2 is shown as a red, transparent molecular surface.
(C) A simulated N-linked glycan containing an energy-minimized trimannosyl core (derived from PDB ID: 1HD4) is modeled as red sticks, coming from Asn322 in
ACE2. ACE2 is shown as a red molecular surface, the SARS-CoV-1 RBD is shown as pink ribbons, and SARS VHH-72 is shown as a dark blue, transparent
molecular surface.
(D) A zoomed-in view of the panel from (A) is shown, with the SARS-CoV-1 RBD now displayed as pink-colored ribbons. Residues that form interactions are
shown as sticks, with nitrogen atoms colored dark blue and oxygen atoms colored red. Hydrogen bonds and salt bridges between SARS VHH-72 and the SARS-
CoV-1 RBD are shown as black dots.
(E) The same view from (D) has been turned by 60 to show additional contacts. Residues that form interactions are shown as sticks, with nitrogen atoms colored
dark blue and oxygen atoms colored red. Interactions between SARS VHH-72 and the SARS-CoV-1 RBD are shown as black dots.
utilizes ACE2 as a host-cell receptor (Ge et al., 2013). Because of makes direct contact with SARS VHH-72 is Arg426, which is
the relatively high degree of sequence conservation between Asn439 in the SARS-CoV-2 RBD (Figure 3C). This mutation pre-
SARS-CoV-1 and WIV1-CoV, we expressed the WIV1-CoV vents the formation of a salt bridge with Asp61 from SARS VHH-
RBD and measured binding to SARS VHH-72 by SPR (Fig- 72, which likely contributes to the increased dissociation rate
ure S5B). SARS VHH-72 exhibited high-affinity binding to the constant. Because of an average sequence identity of only
WIV1-CoV RBD (7.4 nM), demonstrating that it cross-reacts 25% between the SARS-CoV-1 RBD and the RBDs of the sea-
with these two closely related coronaviruses (Figure S5C). sonal coronaviruses, we predict that SARS VHH-72 cross-reac-
Based on the high degree of structural homology that has tivity is likely confined to the RBD from SARS-CoV-2 and closely
been reported between SARS-CoV-1 S and SARS-CoV-2 S related betacoronaviruses such as WIV1-CoV.
(Walls et al., 2020; Wrapp et al., 2020), we also tested SARS
VHH-72 for cross-reactivity against the SARS-CoV-2 RBD and VHHs Disrupt RBD Dynamics and Receptor Binding
subdomain 1 (SARS-CoV-2 RBD-SD1) by SPR (Figure 4). The The RBDs of MERS-CoV S, SARS-CoV-1 S, and SARS-CoV-2 S
equilibrium dissociation constant of SARS VHH-72 for the undergo dynamic conformational rearrangements that alter-
SARS-CoV-2 RBD-SD1 was ~39 nM, substantially higher than nately mask and present their receptor-binding interfaces and
for the SARS-CoV-1 RBD. The weaker binding can primarily be potential neutralizing epitopes to host molecules. By aligning
attributed to an increase in the dissociation rate constant (Fig- the crystal structures of the MERS VHH-55 and SARS VHH-72
ure 4A). The only variant residue on the SARS-CoV-1 RBD that complexes to the cryo-EM structures of the MERS-CoV,
Cell 181, 1–12, May 28, 2020 5

ll
Article
Figure 4. SARS VHH-72 Cross-Reacts with
SARS-CoV-2
(A) An SPR sensorgram measuring the binding of
SARS VHH-72 to the SARS-CoV-2 RBD-SD1.
Binding curves are colored black, and fit of the
data to a 1:1 binding model is colored red.
(B) The crystal structure of SARS VHH-72 bound to
the SARS-CoV-1 RBD is shown with SARS VHH-
72 as dark blue ribbons and the RBD as a pink
molecular surface. Amino acids that vary between
SARS-CoV-1 and SARS-CoV-2 are colored green.
SARS-CoV-1, and SARS-CoV-2 S proteins, we can begin to un- Bivalent SARS VHH-72 Neutralizes SARS-CoV-2 S
derstand how these molecules might function in the context of Pseudoviruses
these dynamic rearrangements. When the MERS-CoV RBDs Despite the relatively high affinity determined by SPR of SARS
are all in the down conformation or all in the up conformation, VHH-72 for the SARS-CoV-2 RBD, we could not detect the inter-
MERS VHH-55 would be able to bind all three of the protomers action by ELISA. Moreover, SARS VHH-72 did not neutralize
making up the functional spike trimer without forming any SARS-CoV-2 S vesicular stomatitis virus (VSV) pseudoviruses,
clashes. However, if a down protomer was bound by MERS possibly because of the high dissociation rate constant,
VHH-55 and the neighboring protomer sampled the up confor- although it readily neutralized SARS-CoV-1 pseudotyped re-
mation, this RBD would then be trapped in this state by the pres- porter viruses (Figures 6A–6D). In an attempt to compensate
ence of the neighboring MERS VHH-55 molecule (Figure 5A). for this rapid dissociation, we engineered two bivalent variants
This conformational trapping would be even more pronounced of SARS VHH-72. These included a tail-to-head fusion of two
upon SARS VHH-72 binding to the SARS-CoV-1 S protein or SARS VHH-72 molecules connected by a (GGGGS)3 linker
the SARS-CoV-2 S protein. Because of the binding angle of (VHH-72-VHH-72) and a genetic fusion of SARS VHH-72 to the
SARS VHH-72, when a bound SARS-CoV-1 or SARS-CoV-2 Fc domain of human IgG1 (VHH-72-Fc) (Figures S6A–S6C).
RBD samples the down conformation, it would clash with the These bivalent SARS VHH-72 constructs bound to both prefu-
S2 fusion subunit, regardless of the conformations of the neigh- sion SARS-CoV-1 S and SARS-CoV-2 RBD-SD1 as demon-
boring RBDs (Figures 5B and 5C). Therefore, once a single SARS strated by ELISA and by a dose-dependent reduction in the bind-
VHH-72 binding event took place, the bound protomer would be ing of SARS-CoV-2 RBD-SD1 to the ACE2 receptor on Vero E6
trapped in the up conformation until either SARS VHH-72 was cells (Figures 6C–6D; Figures S6B and S6C). We also detected
released or until the S protein was triggered to undergo the pre- binding of both of these constructs to full-length SARS-CoV-
fusion-to-postfusion transition. Based on the binding angles of 1 S and SARS-CoV-2 S expressed on the surface of mammalian
MERS VHH-55 and SARS VHH-72, we can conclude that these cells (Figures S6D and S6E). Supernatants of HEK293S cells
molecules would likely disrupt the RBD dynamics in the context transiently transfected with VHH-72-Fc exhibited neutralizing
of a trimeric S protein by trapping the up conformation. Because activity against both SARS-CoV-1 and SARS-CoV-2 S VSV
this up conformation is unstable and leads to S protein triggering, pseudoviruses in the same assay, which showed no such
it is possible that this conformational trapping may at least cross-reactive neutralization for monovalent SARS VHH-72 (Fig-
partially contribute to the neutralization mechanisms of ures 6E and 6F). A BLI experiment measuring binding of VHH-72-
these VHHs. Fc to immobilized SARS-CoV-2 RBD-SD1 further confirmed that
To investigate the receptor-blocking ability of the VHHs, we bivalency was able to compensate for the high dissociation con-
performed a biolayer interferometry (BLI)-based assay in which stant of the monomer (Figure 7A). Furthermore, the cross-
the SARS-CoV-1, SARS-CoV-2, and MERS-CoV RBDs were im- neutralizing VHH-72-Fc construct reached expression levels of
mobilized to biosensor tips, dipped into VHHs, and then dipped ~300 mg/L in ExpiCHO cells (Figure 7B). Using VHH-72-Fc puri-
into wells containing the recombinant, soluble host cell recep- fied from ExpiCHO cells and a SARS-CoV-2 S pseudotyped VSV
tors. We found that when tips coated with the MERS-CoV RBD with a luciferase reporter, we evaluated the neutralization capac-
were dipped into MERS VHH55 before being dipped into ity of VHH-72-Fc and found that it neutralized pseudovirus with
DPP4, there was no increase in response that could be attributed an IC50 of approximately 0.2 mg/mL (Figure 7C).
to receptor binding. When tips coated with the MERS-CoV RBD
were dipped into SARS VHH-72 and then DPP4, a robust DISCUSSION
response signal was observed, as expected. Similar results
were observed when the analogous experiments were per- Here, we report the isolation and characterization of two potently
formed using the SARS-CoV-1 or SARS-CoV-2 RBDs, SARS neutralizing single-domain antibodies from a llama immunized
VHH-72, and ACE2 (Figure 5D). These results are consistent with prefusion-stabilized MERS-CoV and SARS-CoV-1 spikes.
with conclusions from our structural analysis that these VHHs These VHHs bind to the spike RBDs with high affinity and are
can neutralize their respective viral targets by directly interfering capable of neutralizing S pseudotyped viruses in vitro. To our
with host cell receptor binding. knowledge, the isolation and characterization of SARS-CoV-1
6 Cell 181, 1–12, May 28, 2020

ll
Article
Figure 5. Neutralizing Mechanisms of MERS VHH-55 and SARS VHH-72

(A) The MERS-CoV spike (PDB ID: 5W9H) is shown as a transparent molecular surface, with each monomer colored either white, gray, or tan. Each monomer is
bound by MERS VHH-55, shown as blue ribbons. The clash between MERS VHH-55 bound to the white monomer and the neighboring tan RBD is highlighted by
the red ellipse.
(B) The SARS-CoV-1 spike (PDB ID: 5X58) is shown as a transparent molecular surface, with each protomer colored either white, gray, or pink. Every monomer is
bound by a copy of SARS VHH-72, shown as dark blue ribbons. The clashes between copies of SARS VHH-72 and the two neighboring spike monomers are
highlighted by the red circle.
(C) The SARS-CoV-2 spike (PDB ID: 6VXX) is shown as a transparent molecular surface, with each protomer colored either white, gray, or green. Every monomer
is bound by a copy of SARS VHH-72, shown as dark blue ribbons. The clashes between copies of SARS VHH-72 and the two neighboring spike monomers are
highlighted by the red circle. The SARS-CoV-2 trimer appears smaller than SARS-CoV-1 S because of the absence of flexible NTD-distal loops, which could not
be built during cryo-EM analysis.
(D) CoV VHHs prevent MERS-CoV RBD, SARS-CoV-1 RBD, and SARS-CoV-2 RBD-SD1 from interacting with their receptors. The results of the BLI-based
receptor-blocking experiment are shown. The legend lists the immobilized RBDs and the VHHs or receptors that correspond to each curve.
S-directed VHHs have not been described before. Several (Chen et al., 2017; Li et al., 2015; Wang et al., 2015; 2018; Ying
MERS-CoV S-specific VHHs have been described, all of which et al., 2015; Yu et al., 2015) (Figure S7A). The epitope of SARS
have been directed against the RBD. Several of these VHHs VHH-72 does not significantly overlap with the epitopes of any
have also been reported to block DPP4 binding, much like previously described antibodies other than that of the recently
MERS VHH-55 (Stalin Raj et al., 2018; Zhao et al., 2018). By solv- described CR3022, which can also bind to the RBDs of both
ing the crystal structures of these newly isolated VHHs in com- SARS-CoV-1 and SARS-CoV-2 S (Hwang et al., 2006; Pak
plex with their respective viral targets, we provide detailed in- et al., 2009; Prabakaran et al., 2006; Walls et al., 2019; Yuan
sights into epitope binding and their mechanisms of et al., 2020) (Figure S7B). However, unlike SARS VHH-72,
neutralization. CR3022 does not prevent the binding of ACE2 and it lacks
A number of RBD-directed conventional antibodies that are neutralizing activity against SARS-CoV-2 (Tian et al., 2020;
capable of neutralizing SARS-CoV-1 or MERS-CoV have been Yuan et al., 2020). This discrepancy in function, despite the
described. The epitope of MERS VHH-55 overlaps with the epi- partially overlapping epitope, is likely due to the different angles
topes of several of these MERS-CoV RBD-directed antibodies of approach that these two antibodies adopt (Figure S7C).
including C2, MCA1, m336, JC57-14, D12, 4C2, and MERS-27 Because SARS VHH-72 binds with a nanomolar KD to a portion
Cell 181, 1–12, May 28, 2020 7

ll
Article
Figure 6. SARS VHH-72 Bivalency Permits SARS-CoV-2 Pseudovirus Neutralization

(A and B) SARS-CoV-1 S (A) and SARS-CoV-2 S (B) VSV pseudoviruses were used to evaluate the neutralization capacity of SARS VHH-72. MERS VHH-55 and
PBS were included as negative controls. Luciferase activity is reported in counts per second (c.p.s.). NI, cells were not infected.
(C and D) Binding of bivalent VHHs was tested by ELISA against SARS-CoV-1 S (C) and SARS-CoV-2 RBD-SD1 (D). VHH-72-Fc refers to SARS VHH-72 fused to a
human IgG1 Fc domain by a GS(GGGGS)2 linker. VHH-72-Fc (S) is the same Fc fusion with a GS, rather than a GS(GGGGS)2, linker. GBP is an irrelevant GFP-
binding protein. VHH-72-VHH-72 refers to the tail-to-head construct with two SARS VHH-72 proteins connected by a (GGGGS)3 linker. VHH-23-VHH-23 refers to
the two irrelevant VHHs linked via the same (GGGGS)3 linker.
(E and F) SARS-CoV-1 S (E) and SARS-CoV-2 S (F) pseudoviruses were used to evaluate the neutralization capacity of bivalent VHH-72-Fc. GBP and PBS were
included as negative controls. NI, cells were not infected.
of the SARS-CoV-1 S RBD that exhibits low sequence variation, directed VHHs that have been evaluated (Detalle et al., 2015;
as demonstrated by its cross-reactivity with the WIV1-CoV and Ibañez et al., 2011; Koch et al., 2017; Rossey et al., 2017). The
SARS-CoV-2 RBDs, it may broadly bind S proteins from other possibility of administering these molecules via a nebulized
SARS-CoV-like viruses. We show that by engineering a spray is particularly attractive in the case of respiratory patho-
bivalent VHH-72-Fc construct, we can compensate for the rela- gens because the VHHs could theoretically be inhaled directly
tively high off-rate constant of the monovalent SARS VHH-72. to the site of infection in an effort to maximize bioavailability
This bivalent molecule expresses well in transiently transfected and function (Larios Mora et al., 2018). Because of the current
ExpiCHO cells (~300 mg/L) and can neutralize SARS-CoV-2 S lack of treatments for MERS, SARS, and COVID-19 and the
pseudoviruses in vitro. Future panning efforts using existing li- devastating effects associated with pandemic coronavirus out-
braries and SARS-CoV-2 S may yield even more potent breaks, both prophylactic and therapeutic interventions are
neutralizers. sorely needed. It is our hope that because of their favorable bio-
Because of the inherent thermostability and chemostability of physical properties and their potent neutralization capacity,
VHHs, they have been investigated as potential therapeutics MERS VHH-55, SARS VHH-72, and VHH-72-Fc may serve as
against several diseases. HIV- and influenza-directed VHHs both useful reagents for researchers and as potential therapeutic
have been reported previously, and there are multiple RSV- candidates.
8 Cell 181, 1–12, May 28, 2020

ll
Article
Figure 7. VHH-72-Fc Neutralizes SARS-CoV-2 S Pseudoviruses

(A) BLI sensorgram measuring apparent binding affinity of VHH-72-Fc to immobilized SARS-CoV-2 RBD-Fc. Binding curves are colored black, buffer-only blanks
are colored gray, and the fit of the data to a 1:1 binding curve is colored red.
(B) Time course analysis of VHH-72-Fc expression in ExpiCHO cells. Cell culture supernatants of transiently transfected ExpiCHO cells were removed on days
3–7 after transfection (or until cell viability dropped below 75%), as indicated. Two control mAbs were included for comparison, along with the indicated amounts
of purified GBP-Fc as a loading control.
(C) SARS-CoV-2 S pseudotyped VSV neutralization assay. Monolayers of Vero E6 cells were infected with pseudoviruses that had been pre-incubated with the
mixtures indicated by the legend. The VHH-72-Fc used in this assay was purified after expression in ExpiCHO cells (n = 4). VHH-23-Fc is an irrelevant control
VHH-Fc (n = 3). NI, cells were not infected. Luciferase activity is reported in counts per second (c.p.s.) ± SEM.
STAR+METHODS B Flow cytometry

B RBD competition assay on Vero E6 cells
Detailed methods are provided in the online version of this paper d QUANTIFICATION AND STATISTICAL ANALYSIS
and include the following:
d KEY RESOURCES TABLE SUPPLEMENTAL INFORMATION

d RESOURCE AVAILABILITY
Supplemental Information can be found online at https://doi.org/10.1016/j.
B Lead Contact
cell.2020.04.031.
B Materials Availability
B Data and Code Availability
d EXPERIMENTAL MODEL AND SUBJECT DETAILS ACKNOWLEDGMENTS
B Cell Lines
We thank members of the McLellan Laboratory for providing helpful comments
d METHOD DETAILS
on the manuscript. We would like to thank Dr. John Ludes-Meyers for assis-
B Llama immunization
tance with cell transfection and protein production. This work was supported
B Isolation of MERS- and SARS-CoV VHH phages by a National Institutes of Health (NIH)/National Institute of Allergy and Infec-
B Periplasmic ELISA to select MERS- and SARS- tious Disease (NIAID) grant R01-AI127521 (to J.S.M.) and in part by intramural
CoV VHHs NIAID funding (B.S.G.). Research was supported by funding from VIB, Ghent
B VHH cloning into a Pichia pastoris expression vector University GOA project to N.C. and X.S., FWO and VLAIO fellowships and
B Generating bivalent VHHs for P. pastoris expression research projects to various VIB-CMB COVID-19 response team members.
We acknowledge the team of the VIB Nanobody Service Facility for their ser-
B Purification of MERS- and SARS-CoV VHHs from
vices. D.D.V. was supported by a FWOsb fellowship, W.V.B. by the FWO-SBO
Pichia grant ‘‘GlycoDelete,’’ S.P. by BMBF (RAPID consortium, 01K11723D), and
B Enzyme-linked immunosorbent assay B.S. by FWO-EOS project VIREOS. We are deeply indebted to the VIB-CMB
B CoV pseudovirus neutralization COVID-19 response team members, who volunteered to offer their expertise
B Mammalian protein expression and purification and agile work under conditions of almost complete lockdown and societal
B Surface plasmon resonance standstill. We thank the support staff of both VIB-IRC and VIB-CMB centers,
the members of VIB Discovery Sciences units’ COVID-19 team for rapid and
B Crystallization and data collection
consistent support and input. Argonne is operated by UChicago Argonne,
B Structure determination
LLC, for the U.S. Department of Energy (DOE), Office of Biological and Envi-
B Biolayer interferometry ronmental Research under Contract DE-AC02-06CH11357.
Cell 181, 1–12, May 28, 2020 9

ll
Article
AUTHOR CONTRIBUTIONS Emsley, P., and Cowtan, K. (2004). Coot: model-building tools for molecular
graphics. Acta Crystallogr. D Biol. Crystallogr. 60, 2126–2132.
Conceptualization, D.W., D.D.V., B.S.G., B.S., N.C., X.S., and J.S.M.; Investi- Evans, P.R., and Murshudov, G.N. (2013). How good are my data and what is
gation and Visualization, D.W., D.D.V., K.S.C., G.M.T., N.W., W.V.B., K.R., the resolution? Acta Crystallogr. D Biol. Crystallogr. 69, 1204–1214.
L.v.S., M.H., S.P., and B.S.; Writing - Original Draft, D.W. and D.D.V.; Writing –
Forsman, A., Beirnaert, E., Aasa-Chapman, M.M., Hoorelbeke, B., Hijazi, K.,
Reviewing & Editing, D.W., D.D.V., K.S.C., G.M.T., N.W., B.S.G., N.C., B.S.,
Koh, W., Tack, V., Szynol, A., Kelly, C., McKnight, A., et al. (2008). Llama anti-
X.S., and J.S.M.; Supervision, B.S.G., N.C., B.S., X.S., and J.S.M.
body fragments with cross-subtype human immunodeficiency virus type 1
(HIV-1)-neutralizing properties and high affinity for HIV-1 gp120. J. Virol. 82,
DECLARATION OF INTERESTS 12069–12081.
Gaunt, E.R., Hardie, A., Claas, E.C., Simmonds, P., and Templeton, K.E.
K.S.C., N.W., B.S.G., and J.S.M. are inventors on US patent application no. 62/
(2010). Epidemiology and clinical presentations of the four human coronavi-
412,703, entitled ‘‘Prefusion Coronavirus Spike Proteins and Their Use.’’ D.W.,
ruses 229E, HKU1, NL63, and OC43 detected over 3 years using a novel multi-
K.S.C., N.W., B.S.G., and J.S.M. are inventors on US patent application no. 62/
plex real-time PCR method. J. Clin. Microbiol. 48, 2940–2947.
972,886, entitled ‘‘2019-nCoV Vaccine.’’ D.W., D.D.V., B.S.G., B.S., X.S., and
J.S.M. are inventors on US patent application no. 62/988,610, entitled ‘‘Coro- Ge, X.Y., Li, J.L., Yang, X.L., Chmura, A.A., Zhu, G., Epstein, J.H., Mazet,
navirus Binders.’’ D.W., L.v.S., N.C., B.S., X.S., and J.S.M. are inventors on US J.K., Hu, B., Zhang, W., Peng, C., et al. (2013). Isolation and characterization
patent application no. 62/991,408, entitled ‘‘SARS-CoV-2 Virus Binders.’’ of a bat SARS-like coronavirus that uses the ACE2 receptor. Nature 503,
535–538.
Received: March 25, 2020 Goddard, T.D., Huang, C.C., Meng, E.C., Pettersen, E.F., Couch, G.S., Morris,
Revised: April 14, 2020 J.H., and Ferrin, T.E. (2018). UCSF ChimeraX: Meeting modern challenges in
Accepted: April 17, 2020 visualization and analysis. Protein Sci. 27, 14–25.
Published: May 5, 2020 Govaert, J., Pellis, M., Deschacht, N., Vincke, C., Conrath, K., Muylder-
mans, S., and Saerens, D. (2012). Dual beneficial effect of interloop disul-
REFERENCES fide bond for single domain antibody fragments. J. Biol. Chem. 287,
1970–1979.
Adams, P.D., Grosse-Kunstleve, R.W., Hung, L.W., Ioerger, T.R., McCoy, A.J., Gui, M., Song, W., Zhou, H., Xu, J., Chen, S., Xiang, Y., and Wang, X. (2017).
Moriarty, N.W., Read, R.J., Sacchettini, J.C., Sauter, N.K., and Terwilliger, T.C. Cryo-electron microscopy structures of the SARS-CoV spike glycoprotein
(2002). PHENIX: building new software for automated crystallographic struc- reveal a prerequisite conformational state for receptor binding. Cell Res. 27,
ture determination. Acta Crystallogr. D Biol. Crystallogr. 58, 1948–1954. 119–129.
Afonine, P.V., Poon, B.K., Read, R.J., Sobolev, O.V., Terwilliger, T.C., Urz- Hamers-Casterman, C., Atarhouch, T., Muyldermans, S., Robinson, G.,
humtsev, A., and Adams, P.D. (2018). Real-space refinement in PHENIX for Hamers, C., Songa, E.B., Bendahman, N., and Hamers, R. (1993). Naturally
cryo-EM and crystallography. Acta Crystallogr D. Struct. Biol. 74, 531–544. occurring antibodies devoid of light chains. Nature 363, 446–448.
Battye, T.G., Kontogiannis, L., Johnson, O., Powell, H.R., and Leslie, A.G. Hoffmann, M., Kleine-Weber, H., Krüger, N., Müller, M., Drosten, C., and Pöhl-
(2011). iMOSFLM: a new graphical interface for diffraction-image processing mann, S. (2020). The novel coronavirus 2019 (2019-nCoV) uses the SARS-co-
with MOSFLM. Acta Crystallogr. D Biol. Crystallogr. 67, 271–281. ronavirus receptor ACE2 and the cellular protease TMPRSS2 for entry into
Berger Rentsch, M., and Zimmer, G. (2011). A vesicular stomatitis virus repli- target cells. bioRxiv. https://doi.org/10.1101/2020.01.31.929042.
con-based bioassay for the rapid and sensitive determination of multi-species Huang, C., Wang, Y., Li, X., Ren, L., Zhao, J., Hu, Y., Zhang, L., Fan, G., Xu, J.,
type I interferon. PLoS ONE 6, e25858. Gu, X., et al. (2020). Clinical features of patients infected with 2019 novel coro-
Bosch, B.J., van der Zee, R., de Haan, C.A., and Rottier, P.J. (2003). The co- navirus in Wuhan, China. Lancet 395, 497–506.
ronavirus spike protein is a class I virus fusion protein: structural and functional Hwang, W.C., Lin, Y., Santelli, E., Sui, J., Jaroszewski, L., Stec, B., Farzan, M.,
characterization of the fusion core complex. J. Virol. 77, 8801–8811. Marasco, W.A., and Liddington, R.C. (2006). Structural basis of neutralization
Chan, J.F., Yuan, S., Kok, K.H., To, K.K., Chu, H., Yang, J., Xing, F., Liu, J., Yip, by a human anti-severe acute respiratory syndrome spike protein antibody,
C.C., Poon, R.W., et al. (2020). A familial cluster of pneumonia associated with 80R. J. Biol. Chem. 281, 34610–34616.
the 2019 novel coronavirus indicating person-to-person transmission: a study Ibañez, L.I., De Filette, M., Hultberg, A., Verrips, T., Temperton, N., Weiss, R.A.,
of a family cluster. Lancet 395, 514–523. Vandevelde, W., Schepens, B., Vanlandschoot, P., and Saelens, X. (2011).
Chen, Z., Bao, L., Chen, C., Zou, T., Xue, Y., Li, F., Lv, Q., Gu, S., Gao, X., Cui, Nanobodies with in vitro neutralizing activity protect mice against H5N1 influ-
S., et al. (2017). Human Neutralizing Monoclonal Antibody Inhibition of Middle enza virus infection. J. Infect. Dis. 203, 1063–1072.
East Respiratory Syndrome Coronavirus Replication in the Common Kirchdoerfer, R.N., Cottrell, C.A., Wang, N., Pallesen, J., Yassine, H.M.,
Marmoset. J. Infect. Dis. 215, 1807–1815. Turner, H.L., Corbett, K.S., Graham, B.S., McLellan, J.S., and Ward, A.B.
Croll, T.I. (2018). ISOLDE: a physically realistic environment for model building (2016). Pre-fusion structure of a human coronavirus spike protein. Nature
into low-resolution electron-density maps. Acta Crystallogr. D Struct. Biol. 74, 531, 118–121.
519–530. Kirchdoerfer, R.N., Wang, N., Pallesen, J., Wrapp, D., Turner, H.L., Cottrell,
De Vlieger, D., Ballegeer, M., Rossey, I., Schepens, B., and Saelens, X. (2018). C.A., Corbett, K.S., Graham, B.S., McLellan, J.S., and Ward, A.B. (2018). Sta-
Single-Domain Antibodies and Their Formatting to Combat Viral Infections. bilized coronavirus spikes are resistant to conformational changes induced by
Antibodies (Basel) 8, 1. receptor recognition or proteolysis. Sci. Rep. 8, 15701.
Detalle, L., Stohr, T., Palomo, C., Piedra, P.A., Gilbert, B.E., Mas, V., Millar, A., Koch, K., Kalusche, S., Torres, J.L., Stanfield, R.L., Danquah, W., Khazaneh-
Power, U.F., Stortelers, C., Allosery, K., et al. (2015). Generation and Charac- dari, K., von Briesen, H., Geertsma, E.R., Wilson, I.A., Wernery, U., et al.
terization of ALX-0171, a Potent Novel Therapeutic Nanobody for the Treat- (2017). Selection of nanobodies with broad neutralizing potential against pri-
ment of Respiratory Syncytial Virus Infection. Antimicrob. Agents Chemother. mary HIV-1 strains using soluble subtype C gp140 envelope trimers. Sci.
60, 6–13. Rep. 7, 8390.
Dumoulin, M., Conrath, K., Van Meirhaeghe, A., Meersman, F., Heremans, K., Ksiazek, T.G., Erdman, D., Goldsmith, C.S., Zaki, S.R., Peret, T., Emery, S.,
Frenken, L.G., Muyldermans, S., Wyns, L., and Matagne, A. (2002). Single- Tong, S., Urbani, C., Comer, J.A., Lim, W., et al.; SARS Working Group
domain antibody fragments with high conformational stability. Protein Sci. (2003). A novel coronavirus associated with severe acute respiratory syn-
11, 500–515. drome. N. Engl. J. Med. 348, 1953–1966.
10 Cell 181, 1–12, May 28, 2020

ll
Article
Lan, J., Ge, J., Yu, J., Shan, S., Zhou, H., Fan, S., Zhang, Q., Shi, X., Wang, Q., Rossey, I., Gilman, M.S., Kabeche, S.C., Sedeyn, K., Wrapp, D., Kanekiyo, M.,
Zhang, L., and Wang, X. (2020). Crystal structure of the 2019-nCoV spike re- Chen, M., Mas, V., Spitaels, J., Melero, J.A., et al. (2017). Potent single-domain
ceptor-binding domain bound with the ACE2 receptor. bioRxiv. https://doi. antibodies that arrest respiratory syncytial virus fusion protein in its prefusion
org/10.1101/2020.02.19.956235. state. Nat. Commun. 8, 14158.
Larios Mora, A., Detalle, L., Gallup, J.M., Van Geelen, A., Stohr, T., Duprez, L., Rotman, M., Welling, M.M., van den Boogaard, M.L., Moursel, L.G., van der
and Ackermann, M.R. (2018). Delivery of ALX-0171 by inhalation greatly re- Graaf, L.M., van Buchem, M.A., van der Maarel, S.M., and van der Weerd, L.
duces respiratory syncytial virus disease in newborn lambs. MAbs 10, (2015). Fusion of hIgG1-Fc to 111In-anti-amyloid single domain antibody frag-
778–795. ment VHH-pa2H prolongs blood residential time in APP/PS1 mice but does not
Laursen, N.S., Friesen, R.H.E., Zhu, X., Jongeneelen, M., Blokland, S., Ver- increase brain uptake. Nucl. Med. Biol. 42, 695–702.
mond, J., van Eijgen, A., Tang, C., van Diepen, H., Obmolova, G., et al. Schoonooghe, S., Kaigorodov, V., Zawisza, M., Dumolyn, C., Haustraete, J.,
(2018). Universal protection against influenza infection by a multidomain anti- Grooten, J., and Mertens, N. (2009). Efficient production of human bivalent
body to influenza hemagglutinin. Science 362, 598–602. and trivalent anti-MUC1 Fab-scFv antibodies in Pichia pastoris. BMC Bio-
Li, W., Moore, M.J., Vasilieva, N., Sui, J., Wong, S.K., Berne, M.A., Somasun- technol. 9, 70.
daran, M., Sullivan, J.L., Luzuriaga, K., Greenough, T.C., et al. (2003). Angio-
Stalin Raj, V., Okba, N.M.A., Gutierrez-Alvarez, J., Drabek, D., van Dieren, B.,
tensin-converting enzyme 2 is a functional receptor for the SARS coronavirus.
Widagdo, W., Lamers, M.M., Widjaja, I., Fernandez-Delgado, R., Sola, I., et al.
Nature 426, 450–454.
(2018). Chimeric camel/human heavy-chain antibodies protect against MERS-
Li, F., Li, W., Farzan, M., and Harrison, S.C. (2005). Structure of SARS corona- CoV infection. Sci Adv 4, eaas9667.
virus spike receptor-binding domain complexed with receptor. Science 309,
Tian, X., Li, C., Huang, A., Xia, S., Lu, S., Shi, Z., Lu, L., Jiang, S., Yang, Z., Wu,
1864–1868.
Y., and Ying, T. (2020). Potent binding of 2019 novel coronavirus spike protein
Li, Y., Wan, Y., Liu, P., Zhao, J., Lu, G., Qi, J., Wang, Q., Lu, X., Wu, Y., Liu, W., by a SARS coronavirus-specific human monoclonal antibody. Emerg. Mi-
et al. (2015). A humanized neutralizing antibody against MERS-CoV crobes Infect. 9, 382–385.
targeting the receptor-binding domain of the spike protein. Cell Res. 25,
van der Linden, R.H., Frenken, L.G., de Geus, B., Harmsen, M.M., Ruuls, R.C.,
1237–1249.
Stok, W., de Ron, L., Wilson, S., Davis, P., and Verrips, C.T. (1999). Compar-
Lin-Cereghino, J., Wong, W.W., Xiong, S., Giang, W., Luong, L.T., Vu, J., John-
ison of physical chemical properties of llama VHH antibody fragments and
son, S.D., and Lin-Cereghino, G.P. (2005). Condensed protocol for competent
mouse monoclonal antibodies. Biochim. Biophys. Acta 1431, 37–46.
cell preparation and transformation of the methylotrophic yeast Pichia pasto-
ris. Biotechniques 38, 44, 46, 48. Walls, A.C., Tortorici, M.A., Bosch, B.J., Frenz, B., Rottier, P.J.M., DiMaio, F.,
Rey, F.A., and Veesler, D. (2016). Cryo-electron microscopy structure of a co-
Lu, R., Zhao, X., Li, J., Niu, P., Yang, B., Wu, H., Wang, W., Song, H., Huang, B.,
ronavirus spike glycoprotein trimer. Nature 531, 114–117.
Zhu, N., et al. (2020). Genomic characterisation and epidemiology of 2019
novel coronavirus: implications for virus origins and receptor binding. Lancet Walls, A.C., Xiong, X., Park, Y.J., Tortorici, M.A., Snijder, J., Quispe, J., Camer-
395, 565–574. oni, E., Gopal, R., Dai, M., Lanzavecchia, A., et al. (2019). Unexpected Recep-
tor Functional Mimicry Elucidates Activation of Coronavirus Fusion. Cell 176,
McCoy, A.J. (2007). Solving structures of protein complexes by molecular
1026–1039.15.
replacement with Phaser. Acta Crystallogr. D Biol. Crystallogr. 63, 32–41.
McLellan, J.S., Chen, M., Joyce, M.G., Sastry, M., Stewart-Jones, G.B., Yang, Walls, A.C., Park, Y.J., Tortorici, M.A., Wall, A., McGuire, A.T., and Veesler, D.
Y., Zhang, B., Chen, L., Srivatsan, S., Zheng, A., et al. (2013). Structure-based (2020). Structure, function, and antigenicity of the SARS-CoV-2 spike glyco-
design of a fusion glycoprotein vaccine for respiratory syncytial virus. Science protein. Cell 181, 281–292.e6.
342, 592–598. Wan, Y., Shang, J., Graham, R., Baric, R.S., and Li, F. (2020). Receptor recog-
Morin, A., Eisenbraun, B., Key, J., Sanschagrin, P.C., Timony, M.A., Ottaviano, nition by the novel coronavirus from Wuhan: An analysis based on decade-
M., and Sliz, P. (2013). Collaboration gets the most out of software. eLife 2, long structural studies of SARS coronavirus. J. Virol. 94, e00127-20.
e01456. Wang, N., Shi, X., Jiang, L., Zhang, S., Wang, D., Tong, P., Guo, D., Fu, L., Cui,
Motulsky, H.J., and Brown, R.E. (2006). Detecting outliers when fitting data Y., Liu, X., et al. (2013). Structure of MERS-CoV spike receptor-binding domain
with nonlinear regression - a new method based on robust nonlinear regres- complexed with human receptor DPP4. Cell Res. 23, 986–993.
sion and the false discovery rate. BMC Bioinformatics 7, 123.
Wang, Q., Qi, J., Yuan, Y., Xuan, Y., Han, P., Wan, Y., Ji, W., Li, Y., Wu, Y.,
Pak, J.E., Sharon, C., Satkunarajah, M., Auperin, T.C., Cameron, C.M., Kelvin, Wang, J., et al. (2014). Bat origins of MERS-CoV supported by bat coronavirus
D.J., Seetharaman, J., Cochrane, A., Plummer, F.A., Berry, J.D., and Rini, J.M. HKU4 usage of human receptor CD26. Cell Host Microbe 16, 328–337.
(2009). Structural insights into immune recognition of the severe acute respira-
Wang, L., Shi, W., Joyce, M.G., Modjarrad, K., Zhang, Y., Leung, K., Lees,
tory syndrome coronavirus S protein receptor binding domain. J. Mol. Biol.
C.R., Zhou, T., Yassine, H.M., Kanekiyo, M., et al. (2015). Evaluation of candi-
388, 815–823.
date vaccine approaches for MERS-CoV. Nat. Commun. 6, 7712.
Pallesen, J., Wang, N., Corbett, K.S., Wrapp, D., Kirchdoerfer, R.N., Turner,
Wang, L., Shi, W., Chappell, J.D., Joyce, M.G., Zhang, Y., Kanekiyo, M.,
H.L., Cottrell, C.A., Becker, M.M., Wang, L., Shi, W., et al. (2017). Immunoge-
Becker, M.M., van Doremalen, N., Fischer, R., Wang, N., et al. (2018). Impor-
nicity and structures of a rationally designed prefusion MERS-CoV spike anti-
tance of Neutralizing Monoclonal Antibodies Targeting Multiple Antigenic Sites
gen. Proc. Natl. Acad. Sci. USA 114, E7348–E7357.
on the Middle East Respiratory Syndrome Coronavirus Spike Glycoprotein To
Prabakaran, P., Gan, J., Feng, Y., Zhu, Z., Choudhry, V., Xiao, X., Ji, X., and
Avoid Neutralization Escape. J. Virol. 92, e02002–e02017.
Dimitrov, D.S. (2006). Structure of severe acute respiratory syndrome corona-
virus receptor-binding domain complexed with neutralizing antibody. J. Biol. Woo, P.C., Lau, S.K., Huang, Y., and Yuen, K.Y. (2009). Coronavirus diversity,
Chem. 281, 15829–15836. phylogeny and interspecies jumping. Exp. Biol. Med. (Maywood) 234,
1117–1127.
Raj, V.S., Mou, H., Smits, S.L., Dekkers, D.H., Müller, M.A., Dijkman, R., Muth,
D., Demmers, J.A., Zaki, A., Fouchier, R.A., et al. (2013). Dipeptidyl peptidase 4 Wrapp, D., and McLellan, J.S. (2019). The 3.1 A cryo-EM structure of the
is a functional receptor for the emerging human coronavirus-EMC. Nature 495, porcine epidemic diarrhea virus spike protein in the prefusion conformation.
251–254. J Virol. https://doi.org/10.1128/JVI.00923-19.
Respaud, R., Vecellio, L., Diot, P., and Heuzé-Vourc’h, N. (2015). Nebulization Wrapp, D., Wang, N., Corbett, K.S., Goldsmith, J.A., Hsieh, C.L., Abiona, O.,
as a delivery method for mAbs in respiratory diseases. Expert Opin. Drug Deliv. Graham, B.S., and McLellan, J.S. (2020). Cryo-EM structure of the 2019-
12, 1027–1039. nCoV spike in the prefusion conformation. Science 367, 1260–1263.
Cell 181, 1–12, May 28, 2020 11

ll
Article
Yan, R., Zhang, Y., Li, Y., Xia, L., Guo, Y., and Zhou, Q. (2020). Structural basis Yuan, M., Wu, N.C., Zhu, X., Lee, C.D., So, R.T.Y., Lv, H., Mok, C.K.P., and Wil-
for the recognition of the SARS-CoV-2 by full-length human ACE2. Science son, I.A. (2020). A highly conserved cryptic epitope in the receptor-binding do-
367, 1444–1448. mains of SARS-CoV-2 and SARS-CoV. Science. https://doi.org/10.1126/sci-
ence.abb7269.
Ying, T., Prabakaran, P., Du, L., Shi, W., Feng, Y., Wang, Y., Wang, L., Li, W.,
Jiang, S., Dimitrov, D.S., and Zhou, T. (2015). Junctional and allele-specific Zaki, A.M., van Boheemen, S., Bestebroer, T.M., Osterhaus, A.D., and Fouch-
residues are critical for MERS-CoV neutralization by an exceptionally potent ier, R.A. (2012). Isolation of a novel coronavirus from a man with pneumonia in
germline-like antibody. Nat. Commun. 6, 8223. Saudi Arabia. N. Engl. J. Med. 367, 1814–1820.
Zhao, G., He, L., Sun, S., Qiu, H., Tai, W., Chen, J., Li, J., Chen, Y., Guo, Y.,
Yu, X., Zhang, S., Jiang, L., Cui, Y., Li, D., Wang, D., Wang, N., Fu, L., Shi, X., Li, Wang, Y., et al. (2018). A Novel Nanobody Targeting Middle East Respiratory
Z., et al. (2015). Structural basis for the neutralization of MERS-CoV by a hu- Syndrome Coronavirus (MERS-CoV) Receptor-Binding Domain Has Potent
man monoclonal antibody MERS-27. Sci. Rep. 5, 13133. Cross-Neutralizing Activity and Protective Efficacy against MERS-CoV.
Yuan, Y., Cao, D., Zhang, Y., Ma, J., Qi, J., Wang, Q., Lu, G., Wu, Y., Yan, J., J. Virol. 92, e00837–18.
Shi, Y., et al. (2017). Cryo-EM structures of MERS-CoV and SARS-CoV spike Zhou, P., Yang, X.L., Wang, X.G., Hu, B., Zhang, L., Zhang, W., Si, H.R., Zhu,
glycoproteins reveal the dynamic receptor binding domains. Nat. Commun. Y., Li, B., Huang, C.L., et al. (2020). A pneumonia outbreak associated with a
8, 15092. new coronavirus of probable bat origin. Nature 579, 270–273.
12 Cell 181, 1–12, May 28, 2020

ll
Article
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Anti-VSV-G antibody (I1, produced from CRL-2700 mouse ATCC Cat.# CRL-2700
hybridoma cells) RRID:CVCL_G654
Anti-foldon antibody Provided by Dr. Vicente Mas N/A
Insituto de Salud Carlos III:
National Centre for Microbiology
Purified anti-HA.11 Epitope Tag Antibody Biolegend Cat# MMS-101P
Mouse IgG HRP Linked Whole Ab GE Healthcare Cat# NXA931
Mouse anti Histidine Tag Bio-Rad Cat# MCA1396
Streptavidin-HRP BD Biosciences Cat#554066
Rabbit anti-camelid VHH HRP GenScript Cat# A01861-200
Alexa fluor 647 donkey anti mouse IgG Invitrogen Cat# A31571
Alexa fluor 633 goat anti human IgG Invitrogen Cat# A21091
Bacterial and Virus Strains
TG1 cells Immunosource Cat# 60502-2
Gerbu LQ#3000 Gerbu Biotechnik Cat# 3000-25
VSV*DG-FLuc PMID: 21998709 N/A
SARS-CoV-1 S pseudotype VSV PMID: 32142651 https://doi.org/10.1016/j.cell.2020.02.052
SARS-CoV-2 S pseudotype VSV PMID: 32142651 https://doi.org/10.1016/j.cell.2020.02.052
Chemicals, Peptides, and Recombinant Proteins
Trimethylamine (TEA) solution Sigma-Aldrich Cat# 471283
Zeocin GIBCO Cat# R25001
MERS-CoV S-2P protein PMID: 28807998 N/A
SARS-CoV-1 S-2P protein PMID: 28807998 N/A
SARS VHH-72 protein This manuscript N/A
MERS VHH-55 protein This manuscript N/A
SARS-CoV-2 S-2P protein PMID: 32075877 N/A
DS-Cav1 protein PMID: 24179220 N/A
MERS-CoV RBD protein PMID: 23835475 N/A
MERS-CoV NTD protein PMID: 28807998 N/A
MERS-CoV S1 protein This manuscript N/A
SARS-CoV-1 RBD protein PMID: 32075877 N/A
SARS-CoV-1 NTD protein This manuscript N/A
WIV1-CoV RBD protein This manuscript N/A
SARS-CoV-2 RBD-SD1 protein PMID: 32075877 N/A
ACE2 protein PMID: 30356097 N/A
DPP4 protein PMID: 28807998 N/A
SARS-CoV-2 RBD Fc protein Sino Biological Cat# 40592-V05H
VHH-23 protein PMID: 31921179 N/A
Bovine serum Albumin Sigma-Aldrich Cat# A8327
Anti-Mouse IgG Fc Capture (AMC) Biosensors FortéBio Cat# 18-5090
Polyethylenimine, Linear, MW 25000, Transfection Polysciences Cat# 23966-1
Grade (PEI 25K)
ExpiCHO Expression Medium GIBCO A2910001
FreeStyle 293 Expression Medium GIBCO Cat# 12338002
(Continued on next page)
Cell 181, 1–12.e1–e8, May 28, 2020 e1

ll
Article
Continued
EX-CELL 293 Serum-Free Medium Sigma-Aldrich Cat# 14571C
Kifunensin GlycoSyn Cat# FC-034
25 kDa linear polyethylenimine Polysciences Cat# 3966-2
Critical Commercial Assays
Dual-Luciferase Reporter Assay System Promega Cat# E1910
TMB Substrate Reagent Set BD PharMingen Cat# 555214
pcDNA3.3-TOPO TA Cloning Kit Invitrogen Cat# K8300-01
NEBNext dA-Tailing Module New England Biolabs Cat# E6053
ExpiFectamine CHO Transfection Kit GIBCO Cat# A29129
NucleoBond Xtra Midi kit Macherey-Nagel Cat# MN740410.100
FuGENE HD Transfection Reagent Promega Cat# E2311
Deposited Data
Crystal structure of SARS-CoV-1 RBD + SARS VHH-72 This manuscript PDB ID: 6WAQ
Crystal structure of MERS-CoV RBD + MERS VHH-55 This manuscript PDB ID: 6WAR
SARS VHH-72 sequence This manuscript GenBank ID: MT350284
MERS VHH-55 sequence This manuscript GenBank ID: MT350283
Experimental Models: Cell Lines
Huh7.5 cells Provided by Dr. Deborah N/A
R. Taylor of the US FDA
Freestyle 293F cells ThermoFisher Scientific Cat# R7007
Vero E6 cells ATCC Cat# CRL-1586
HEK293T cells ATCC Cat# CRL-3216
HEK293S cells PMID: 25182477 N/A
ExpiCHO-S TM cells GIBCO Cat# A29127
Experimental Models: Organisms/Strains
Llama VIB Nanobody Core Chip No. 967000009804581
Pichia pastoris: strain GS115 Invitrogen Cat# C18100
Oligonucleotides
MP057 primer: 50 -TTATGCTTCCGGCTCGTATG-30 This manuscript N/A
Primers for cloning the VHHs in the pKai61 vector: This manuscript N/A
50 GGCGGGTATCTCTCGAGAAAAGGCAGGTGCAGCTG
CAGGAGTCTGGG-30
50 CTAACTAGTCTAGTGATGGTGATGGTGGTGGCTGGA
GACGGTGACCTGG-30
Primers for generation of bivalent VHH-constructs: This manuscript N/A
50 GGGGTATCTCTCGAGAAAAGGCAGGTGCAGCTGGTG
GAGTCTGGG-30
50 AGACTCCTGCAGCTGCACCTGACTACCGCCGCCTCC
AGATCCACCTCCGCCACTACCGCCTCCGCCGCTGGAG
ACGGTGACCTGGG-30
Recombinant DNA
pCG1-SARS-2-S PMID: 32142651 N/A
pCG1-SARS-S PMID: 24023659 N/A
pKai61 vector PMID: 19671134 N/A
paH expression plasmid Jason McLellan Laboratory N/A
paH-SARS-CoV-1 S TM This manuscript N/A
paH-SARS-CoV-2 S TM This manuscript N/A
paH-SARS VHH-72 This manuscript N/A
paH-MER VHH-55 This manuscript N/A
paH-MERS-CoV RBD PMID: 24179220 N/A
(Continued on next page)
e2 Cell 181, 1–12.e1–e8, May 28, 2020

ll
Article
Continued
paH-SARS-CoV-1 RBD PMID: 32075877 N/A
paH-WIV1-CoV RBD This manuscript N/A
paH-SARS-CoV-2 RBD-SD1 PMID: 32075877 N/A
paH-SARS-CoV-1 NTD This manuscript N/A
paH-MERS-CoV NTD PMID: 28807998 N/A
paH-MERS-CoV S1 This manuscript N/A
paH-SARS-CoV-1 S-2P PMID: 28807998 N/A
paH-MERS-CoV S-2P PMID: 28807998 N/A
paH-SARS-CoV-2 S-2P PMID: 32075877 N/A
paH-ACE2 PMID: 30356097 N/A
paH-DPP4 PMID: 28807998 N/A
pHR0 CMV-Luc Barney Graham Laboratory N/A
CMV/R-MERS-CoV S Barney Graham Laboratory N/A
CMV/R-SARS-CoV-1 S Barney Graham Laboratory N/A
Software and Algorithms
Flowing Software http://flowingsoftware.btk.fi/ V2.5.1
Octet Data Analysis software FortéBio v11.1
GraphPad Prism Motulsky and Brown, 2006 V7.0.4
Biacore X100 Evaluation Software GE Healthcare V2.0.1
iMOSFLM Battye et al., 2011 https://www.mrc-lmb.cam.ac.uk/
harry/imosflm/ver721/downloads.html
Aimless Evans and Murshudov, 2013 www.ccp4.ac.uk/download/
Phaser McCoy, 2007 www.ccp4.ac.uk/download/
COOT Emsley and Cowtan, 2004 http://bernhardcl.github.io/coot/
Phenix Adams et al., 2002; Afonine et al., 2018 https://www.phenix-online.org/
ISOLDE Croll, 2018 http://preview.cgl.ucsf.edu/chimerax/

download.html
ChimeraX Goddard et al., 2018 https://www.rbvi.ucsf.edu/chimerax/
Other
Strep-Tactin Superflow resin IBA Lifesciences Cat# 2-1206-010
PierceTM Protein A Agarose ThermoFisher Scientific Cat# 20334
Biacore X100 Sensorchip NTA GE Healthcare Cat# BR100407
HiLoad 16/600 Superdex75 GE Healthcare Cat# 28989333
Superose6 XK 16/70 GE Healthcare Cat# 90100042
RESOURCE AVAILABILITY
Lead Contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Jason S.
McLellan ([email protected]).
Materials Availability
Plasmids generated in this study will be made available on request by the Lead Contact with a completed Materials Transfer Agree-
ment (MTA).
Data and Code Availability

The X-ray crystallographic data and atomic models have been deposited at the Protein Data Bank with accession codes PDB: 6WAQ
(SARS-CoV-1 RBD bound by SARS VHH-72) and PDB: 6WAR (MERS-CoV RBD bound by MERS VHH-55). The sequences of MERS
Cell 181, 1–12.e1–e8, May 28, 2020 e3

ll
Article
VHH-55 and SARS VHH-72 have been deposited in GenBank under accession numbers MT350283 and MT350284. A list of software
used in this study can be found in the Key Resources Table.
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Cell Lines
FreeStyle293F cells (ThermoFisher Scientific) and HEK293-S cells (ThermoFisher Scientific) were cultured in FreeStyle293 expres-
sion media (Life Technologies), cultured at 37 C with 8% CO2 while shaking at 130 rpm. HEK293-T cells (ATCC) and Vero E6 cells
(ATCC) were cultured at 37 C in the presence of 5% CO2 in DMEM supplemented with 10% heat-inactivated FBS, 1% penicillin, 1%
streptomycin, 2 mM l-glutamine, non-essential amino acids (Invitrogen) and 1 mM sodium pyruvate. Huh7.5 cells (provided by Dr.
Deborah R. Taylor) were cultured at 37 C with 8% CO2 in flasks with DMEM + 10% FBS. ExpiCHO-S cells (GIBCO) were cultured
at 37 C with 8% CO2 while shaking at 130 rpm in ExpiCHO expression media (GIBCO). Cells lines were not tested for mycoplasma
contamination nor authenticated.
METHOD DETAILS
Llama immunization
Llama immunizations and subsequent VHH library generation were performed by VIB Nanobody Core as follows. A llama, negative
for antibodies against MERS-CoV and SARS-CoV-1 S glycoprotein, was subcutaneously immunized with approximately 150 mg re-
combinant SARS-CoV-1 S-2P protein on days 0, 7, 28 and 150 mg recombinant MERS-CoV S-2P protein on days 14 and 21 and
150 mg of both MERS-CoV S-2P and SARS-CoV-1 S-2P protein on day 35 (Kirchdoerfer et al., 2018; Pallesen et al., 2017). The adju-
vant used was Gerbu LQ#3000. Immunizations and handling of the llama were performed according to directive 2010/63/EU of the
European parliament for the protection of animals used for scientific purposes and approved by the Ethical Committee for Animal
Experiments of the Vrije Universiteit Brussel (permit No. 13-601-1). Blood was collected 5 days after the last immunization for the
preparation of lymphocytes. Total RNA from the peripheral blood lymphocytes was extracted and used as template for the first strand
cDNA synthesis with oligo dT primer. Using this cDNA, the VHH encoding sequences were amplified by PCR and cloned between the
PstI and NotI sites of the phagemid vector pMECS. In the pMECS vector, the VHH encoding sequence is followed by a linker, HA and
His6 tag (AAAYPYDVPDYGSHHHHHH). Electro-competent E.coli TG1 cells were transformed with the recombinant pMECS vector
resulting in a VHH library of about 3 3 108 independent transformants. The resulting TG1 library stock was then infected with VCS
M13 helper phages to obtain a library of VHH-presenting phages.
Isolation of MERS- and SARS-CoV VHH phages

Phages displaying MERS-CoV-specific VHHs were enriched after 2 rounds of biopanning on 20 mg of immobilized MERS-CoV S-2P
protein in one well of a microtiter plate (type II, F96 Maxisorp, Nuc). For each panning round an uncoated well was used as a negative
control. The wells were then washed 5 times with phosphate-buffered saline (PBS) + 0.05% Tween 20 and blocked with SEA BLOCK
blocking buffer (Thermo Scientific) in the first panning round and 5% milk powder in PBS in the second panning round. About 1011
phages were added to the coated well and incubated for 1 h at room temperature. Non-specifically bound phages were removed by
washing with PBS + 0.05% Tween 20 (10 times in the first panning round and 15 times in the second panning round). The retained
phages were eluted with TEA-solution (14% trimethylamine (Sigma) pH 10) and subsequently neutralized with 1 M Tris-HCl pH 8. The
collected phages were amplified in exponentially growing E.coli TG1 cells, infected with VCS M13 helper phages and subsequently
purified using PEG 8,000/NaCl precipitation for the next round of selection. Enrichment after each panning round was determined by
infecting TG1 cells with 10-fold serial dilutions of the collected phages after which the bacteria were plated on LB agar plates with
100 mg/mL ampicillin and 1% glucose.
Phages displaying SARS-CoV-1 directed VHHs were enriched after 2 rounds of biopanning on 20 mg of SARS-CoV-1 S-2P protein
captured with an anti-foldon antibody (generously provided by Dr. Vicente Mas) in one well of a microtiter plate (type II, F96 Maxisorp,
Nuc). Before panning phages were first added to DS-Cav1 protein (McLellan et al., 2013) containing a C-terminal foldon domain, to
deplete foldon specific phages. The unbound phages were next added to the coated well. Panning was performed as
described above.
Periplasmic ELISA to select MERS- and SARS-CoV VHHs

After panning, 45 individual colonies of phage infected bacteria isolated after the first panning round on MERS-CoV S-2P or SARS-
CoV-1 S-2P protein and 45 individual colonies isolated after the second panning round on MERS-CoV S-2P or SARS-CoV-1 S-2P
protein were randomly selected for further analysis by ELISA for the presence of MERS-CoV and SARS-CoV-1 specific VHHs,
respectively. The individual colonies were inoculated in 2 mL of terrific broth (TB) medium with 100 mg/mL ampicillin in 24-well
deep well plates. After growing individual colonies for 5 h at 37 C, isopropyl b-D-1-thiogalactopyranoside (IPTG) (1 mM) was added
to induce VHH expression during overnight incubation at 37 C. To prepare periplasmic extract, the bacterial cells were pelleted and
e4 Cell 181, 1–12.e1–e8, May 28, 2020

ll
Article
resuspended in 250 mL TES buffer (0.2 M Tris-HCl pH 8, 0.5 mM EDTA, 0.5 M sucrose) and incubated at 4 C for 30 min. Subse-
quently 350 mL water was added to induce an osmotic shock. After 1 h incubation at 4 C followed by centrifugation, the periplasmic
extract was collected.
VHH-containing periplasmic extracts were then tested for binding to either MERS-CoV S-2P or SARS-CoV-1 S-2P protein. Briefly,
in the PE-ELISA screen after panning on MERS-CoV S-2P protein, wells of microtiter plates (type II, F96 Maxisorp, Nuc) were coated
overnight at 37 C with 100 ng MERS-CoV S-2P (without foldon), MERS-CoV S-2P protein (with foldon) or as negative controls coated
with SARS-CoV-1 S-2P protein (with foldon), HCoV-HKU1 S-2P (without foldon), DS-Cav1 (with foldon) or bovine serum albumin
(BSA, Sigma-Aldrich). In the PE-ELISA screen after panning on SARS-CoV-1 S protein wells of microtiter plates (type II, F96 Maxi-
sorp, Nuc) were coated with 100 ng SARS-CoV-1 S-2P protein (with foldon), SARS-CoV-1 S-2P protein captured with an anti-foldon
antibody (with foldon) or as negative controls coated with MERS-CoV S-2P (without foldon), HCoV-HKU1 S-2P (without foldon), DS-
Cav1 (with foldon) or bovine serum albumin (BSA, Sigma-Aldrich). The coated plates were blocked with 5% milk powder in PBS and
50 mL of the periplasmic extract was added to the wells. Bound VHHs were detected with anti-HA (1/2,000, MMS-101P Biolegend)
mAb followed by horseradish peroxidase (HRP)-linked anti-mouse IgG (1/2,000, NXA931, GE Healthcare). Periplasmic fractions, for
which the OD450 value of the antigen coated wells were at least two times higher than the OD450 value of the BSA coated wells, were
considered to be specific for the coated antigen and selected for sequencing. The selected clones were grown in 3 mL of LB medium
with 100 mg/mL ampicillin. The DNA of the selected colonies was isolated using the QIAprep Spin Miniprep kit (QIAGEN) and
sequenced using the MP057 primer (50 -TTATGCTTCCGGCTCGTATG-30 ).
VHH cloning into a Pichia pastoris expression vector

In order to express the MERS- and SARS-CoV VHHs in Pichia pastoris, the VHH encoding sequences were cloned in the pKai61
expression vector (described by Schoonooghe et al., 2009). In the vector, the VHH sequences contain a C-terminal 6x His-tag,
are under the control of the methanol inducible AOX1 promotor and in frame with a modified version of the S.cerevisae a-mating fac-
tor prepro signal sequence. The vector contains a Zeocine resistance marker for selection in bacteria as well as in yeast cells. The
VHH encoding sequences were amplified by PCR using the following forward and reverse primer (50 -GGCGGGTATCTCTCGA
GAAAAGGCAGGTGCAGCTGCAGGAGTCTGGG-30 ) and (50 - CTAACTAGTCTAGTGATGGTGATGGTGGTGGCTGGAGACGGTGAC
CTGG-30 ) and cloned between the XhoI and SpeI sites in the pKai61 vector. The vectors were linearized by PmeI and transformed
in the Pichia pastoris strain GS115 by electroporation at 1500 V using a Gene Pulser electroporator (Bio-Rad) (Lin-Cereghino et al.,
2005). After transformation, the yeast cells were plated on YPD plates (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose
and 2% (w/v) agar) supplemented with zeocin (100 mg/mL) for selection.
Generating bivalent VHHs for P. pastoris expression

To generate bivalent tandem tail-to-head VHH constructs, the VHH sequence was amplified by PCR using the following forward (50 -
GGGGTATCTCTCGAGAAAAGGCAGGTGCAGCTGGTGGAGTCTGGG-3 0 ) and reverse (50 - AGACTCCTGCAGCTGCACCTGACTAC
CGCCGCCTCCAGATCCACCTCCGCCACTACCGCCTCCGCCGCTGGAGACGGTGACCTGGG-3 0 ) primers, thereby removing a PstI
site from the beginning of the VHH coding sequence and adding a (GGGGS)3 linker and the start of the VHH coding sequence with a
PstI site at the end of the sequence. After PCR, the fragment was cloned between the XhoI and SpeI sites in a SARS VHH-72 con-
taining pKai61 vector, thereby generating a homo-bivalent construct. The vector containing this bivalent VHH was linearized and
transformed in GS155 Pichia pastoris cells as outlined above.
Purification of MERS- and SARS-CoV VHHs from Pichia

The transformed Pichia pastoris clones were first expressed in 2 mL cultures. On day 1, 4 clones of each construct were inoculated in
2 mL of YPNG medium (2% pepton, 1% Bacto yeast extract, 1.34% YNB, 0.1 M potassium phosphate pH 6, 0.00004% biotin, 1%
glycerol) with 100 mg/mL Zeocin (Life Technologies) and incubated while shaking at 28 C for 24 h. The next day, the cells were
pelleted by centrifugation and the medium was replaced by YPNM medium (2% pepton, 1% Bacto yeast extract, 1.34% YNB,
0.1 M potassium phosphate pH 6.0, 1% methanol) to induce VHH expression. Cultures were incubated at 28 C and 50 mL of
50% methanol was added at 16, 24 and 40 h. After 48 h, the yeast cells were pelleted and the supernatant was collected. The pres-
ence of soluble VHHs in the supernatants was verified using SDS-PAGE and subsequent Coomassie Blue staining. VHH-containing
supernatants of the different clones for each construct were pooled and the VHHs were purified using HisPurTM Ni-NTA Spin Plates
(88230, Thermo Scientific). Next, purified VHHs were concentrated on AcroPrepTM Advance 96-well filter plates for ultrafiltration
3 kDa cutoff (8033,Pall) and the imidazole-containing elution buffer was exchanged with PBS.
Production was scaled up (50 mL) for the VHHs with neutralizing capacity. Growth and methanol induction conditions and harvest-
ing of medium were similar as mentioned above for the 2 mL cultures. The secreted VHHs in the medium were precipitated by ammo-
nium sulfate (NH4)2SO4 precipitation (80% saturation) for 4 h at 4 C. The insoluble fraction was pelleted by centrifugation at 20,000 g
and resuspended in 10 mL binding buffer (20 mM NaH2PO4 pH 7.5, 0.5M NaCl and 20 mM imidazole pH 7.4). The VHHs were purified
from the solution using a 1 mL HisTrap HP column (GE Healthcare). To elute the bound VHHs a linear imidazole gradient starting from
20 mM and ending at 500 mM imidazole in binding buffer over a total volume of 20 mL was used. VHH containing fractions were
pooled and concentrated and the elution buffer was exchanged with PBS with a Vivaspin column (5 kDa cutoff, GE Healthcare).
Cell 181, 1–12.e1–e8, May 28, 2020 e5

ll
Article
Enzyme-linked immunosorbent assay

Wells of microtiter plates (type II, F96 Maxisorp, Nuc) were coated overnight at 4 C, respectively, with 100 ng recombinant MERS-
CoV S-2P protein (with foldon), SARS-CoV-1 S-2P protein (with foldon), MERS-CoV RBD, MERS-CoV NTD, MERS-CoV S1, SARS-
CoV-1 RBD, SARS-CoV-1 NTD or Fc-tagged SARS-CoV-2 RBD-SD1. The coated plates were blocked with 5% milk powder in PBS.
Dilution series of the VHHs were added to the wells. Binding was detected by incubating the plates sequentially with either mouse
anti-Histidine Tag antibody (MCA1396, Abd Serotec) followed by horseradish peroxidase (HRP)-linked anti-mouse IgG (1/2000,
NXA931, GE Healthcare) or Streptavidin-HRP (554066, BD Biosciences) or by an HRP-linked rabbit anti-camelid VHH monoclonal
antibody (A01861-200, GenScript). After washing 50 mL of TMB substrate (Tetramethylbenzidine, BD OptETA) was added to the
plates and the reaction was stopped by addition of 50 mL of 1 M H2SO4. The absorbance at 450 nM was measured with an iMark
Microplate Absorbance Reader (Bio Rad). Curve fitting was performed using nonlinear regression (Graphpad 7.0).
CoV pseudovirus neutralization

Pseudovirus neutralization assay methods have been previously described (Pallesen et al., 2017; Wang et al., 2015). Briefly, pseu-
doviruses expressing spike genes for MERS-CoV England1 (GenBank ID: AFY13307) and SARS-CoV-1 Urbani (GenBank ID:
AAP13441.1) were produced by co-transfection of plasmids encoding a luciferase reporter, lentivirus backbone, and spike genes
in 293T cells (Wang et al., 2015). Serial dilutions of VHHs were mixed with pseudoviruses, incubated for 30 min at room temperature,
and then added to previously-plated Huh7.5 cells. 72 h later, cells were lysed, and relative luciferase activity was measured. Percent
neutralization was calculated considering uninfected cells as 100% neutralization and cells transduced with only pseudovirus as 0%
neutralization. IC50 titers were determined based on sigmoidal nonlinear regression.
To generate replication-deficient VSV pseudotyped viruses, HEK293T cells, transfected with MERS-CoV S, SARS-CoV-1 S or
SARS-CoV-2 S were inoculated with a replication deficient VSV vector containing eGFP and firefly luciferase expression cassettes.
After a 1 h incubation at 37 C, inoculum was removed, cells were washed with PBS and incubated in media supplemented with an
anti-VSV G mAb (ATCC) for 16 h. Pseudotyped particles were then harvested and clarified by centrifugation (Berger Rentsch and
Zimmer, 2011; Hoffmann et al., 2020). For the VSV pseudotype neutralization experiments, the pseudoviruses were incubated for
30 min at 37 C with different dilutions of purified VHHs or with dilution series of culture supernatant of 293S cells that had been trans-
fected with plasmids coding for SARS VHH-72 fused to human IgG1 Fc (VHH-72-Fc) or with GFP-binding protein (GBP: a VHH spe-
cific for GFP). The incubated pseudoviruses were subsequently added to confluent monolayers of Vero E6 cells. Sixteen h later, the
transduction efficiency was quantified by measuring the firefly luciferase activity in cell lysates using the firefly luciferase substrate of
the dual-luciferase reporter assay system (Promega) and a Glowmax plate luminometer (Promega).
Mammalian protein expression and purification

Mammalian expression plasmids encoding SARS VHH72, MERS VHH55, residues 367-589 of MERS-CoV S (England1 strain), res-
idues 320-502 of SARS-CoV-1 S (Tor2 strain), residues 307-510 of WIV1-CoV S, residues 319-591 of SARS-CoV-2 S, residues 1-281
of SARS-CoV-1 S (Tor2 strain), residues 1-351 of MERS-CoV S (England1 strain), residues 1-751 of MERS-CoV S (England1 strain),
residues 1-1190 of SARS-CoV-1 S (Tor2 strain) with K968P and V969P substitutions (SARS-CoV-1 S-2P), residues 1-1291 of MERS-
CoV S (England1 strain) with V1060P and L1061P substitutions (MERS S-2P), residues 1-1208 of SARS-CoV-2 S with K986P and
V987P substitutions (SARS-CoV-2 S-2P), residues 1-615 of ACE2 and residues 40-766 of DPP4 were transfected into FreeStyle293
cells using polyethylenimine (PEI). All of these plasmids contained N-terminal signal sequences to ensure secretion into the cell
supernatant. Supernatants were harvested and constructs containing C-terminal HRV3C cleavage sites, 8x His-Tags and Twin-
Strep-Tags (SARS VHH72, MERS VHH55, MERS-CoV S1, SARS-CoV-1 S-2P, MERS-CoV S-2P, SARS-CoV-2 S-2P, ACE2 and
DPP4) were purified using Strep-Tactin resin (IBA). Constructs containing C-terminal HRV3C cleavage sites and Fc-tags (SARS-
CoV-1 RBD, MERS-CoV RBD, WIV1-CoV RBD, SARS-CoV-2 RBD-SD1, SARS-CoV-1 NTD, MERS-CoV NTD) were purified using
Protein A resin (Pierce). The SARS-CoV-1 RBD, MERS-CoV RBD, WIV1-CoV RBD, SARS-CoV-2 RBD-SD1, SARS VHH-72,
MERS VHH-55, MERS-CoV NTD and SARS-CoV-1 NTD were then further purified using a Superdex 75 column (GE Healthcare)
in 2 mM Tris pH 8.0, 200 mM NaCl and 0.02% NaN3. MERS-CoV S1, SARS-CoV-1 S-2P, MERS-CoV S-2P, ACE2 and DPP4
were further purified using a Superose 6 column (GE Healthcare) in 2 mM Tris pH 8.0, 200 mM NaCl and 0.02% NaN3.
HEK293S cells were transfected with VHH-72-Fc or VHH-72-Fc (S) encoding plasmids using PEI. Briefly, suspension-adapted and
serum-free HEK293S cells were seeded at 3 3 106 cells/mL in Freestyle-293 medium (ThermoFisher Scientific). Next, 4.5 mg of
pcDNA3.3-VHH72-Fc plasmid DNA was added to the cells and incubated on a shaking platform at 37 C and 8% CO2, for 5 min.
Next, 9 mg of PEI was added to the cultures, and cells were further incubated for 5 h, after which an equal culture volume of Ex-
Cell-293 (Sigma) was added to the cells. Transfections were incubated for 4 days, after which cells were pelleted (10’, 300 g) and
supernatants were filtered before further use.
VHH-72-Fc was expressed in ExpiCHO cells (ThermoFisher Scientific), according to the manufacturer’s protocol. Briefly, a 25 mL
culture of 6 x106 cells/mL, grown at 37 C and 8% CO2 was transfected with 20 mg of pcDNA3.3-VHH-72-Fc plasmid DNA using Ex-
piFectamine CHO reagent. One day after transfection, 150 mL of ExpiCHO enhancer and 4 mL of ExpiCHO feed was added to the
cells, and cultures were further incubated at 32 C and 5% CO2. Cells were fed a second time 5 days post-transfection. Cultures
were harvested as soon as cell viability dropped below 75%. For purification of the VHH-72-Fc, supernatants were loaded on
a 5 mL MabSelect SuRe column (GE Healthcare). Unbound proteins were washed away with McIlvaine buffer pH 7.2, and bound
e6 Cell 181, 1–12.e1–e8, May 28, 2020

ll
Article
proteins were eluted using McIlvaine buffer pH 3. Immediately after elution, protein-containing fractions were neutralized using a
saturated Na3PO4 buffer. These neutralized fractions were then pooled, and loaded onto a HiPrep Desalting column for buffer ex-
change into storage buffer (25 mM L-Histidine, 125 mM NaCl).
Surface plasmon resonance

His-tagged SARS VHH-72 or MERS VHH-55 was immobilized to a single flow cell of an NTA sensorchip at a level of ~400 response
units (RUs) per cycle using a Biacore X100 (GE Healthcare). The chip was doubly regenerated using 0.35 M EDTA and 0.1 M NaOH
followed by 0.5 mM NiCl2. Three samples containing only running buffer, composed of 10 mM HEPES pH 8.0, 150 mM NaCl and
0.005% Tween 20, were injected over both ligand and reference flow cells, followed by either SARS-CoV-1 RBD, WIV1-CoV
RBD, SARS-CoV-2 RBD-SD1 or MERS-CoV RBD serially diluted from 50-1.56 nM, with a replicate of the 3.1 nM concentration.
The resulting data were double-reference subtracted and fit to a 1:1 binding model using the Biacore X100 Evaluation software.
Crystallization and data collection

Plasmids encoding for MERS VHH-55 and residues 367-589 of MERS-CoV S with a C-terminal HRV3C cleavage site and a mono-
meric human Fc tag were co-transfected into kifunensin-treated FreeStyle 293F cells, as described above. After purifying the cell
supernatant with Protein A resin, the immobilized complex was treated with HRV3C protease and Endoglycosidase H to remove
both tags and glycans. The complex was then purified using a Superdex 75 column in 2 mM Tris pH 8.0, 200 mM NaCl and
0.02% NaN3. The purified complex was then concentrated to 5.0 mg/mL and used to prepare hanging-drop crystallization trays.
Crystals grown in 1.0 M Na/K phosphate pH 7.5 were soaked in mother liquor supplemented with 20% ethylene glycol and frozen
in liquid nitrogen. Diffraction data were collected to a resolution of 3.40 Å at the SBC beamline 19-ID (APS, Argonne National
Laboratory)
Plasmids encoding for SARS VHH-72 and residues 320-502 of SARS-CoV-1 S with a C-terminal HRV3C cleavage site and a mono-
meric human Fc tag were co-transfected into kifunensin-treated FreeStyle 293F cells, as described above. After purifying the cell
supernatant with Protein A resin, the immobilized complex was treated with HRV3C protease and Endoglycosidase H to remove
both tags and glycans. The processed complex was subjected to size-exclusion chromatography using a Superdex 75 column in
2 mM Tris pH 8.0, 200 mM NaCl and 0.02% NaN3. The purified complex was then concentrated to 10.0 mg/mL and used to prepare
hanging-drop crystallization trays. Crystals grown in 0.1 M Tris pH 8.5, 0.2 M LiSO4, 0.1 M LiCl and 8% PEG 8000 were soaked in
mother liquor supplemented with 20% glycerol and frozen in liquid nitrogen. Diffraction data were collected to a resolution of
2.20 Å at the SBC beamline 19-ID (APS, Argonne National Laboratory)
Structure determination
Diffraction data for both complexes were indexed and integrated using iMOSFLM before being scaled in AIMLESS (Battye et al.,
2011; Evans and Murshudov, 2013). The SARS-CoV-1 RBD+SARS VHH-72 dataset was phased by molecular replacement in Pha-
serMR using coordinates from PDBs 2AJF and 5F1O as search ensembles (McCoy, 2007). The MERS-CoV RBD+MERS VHH-55
dataset was also phased by molecular replacement in PhaserMR using coordinates from PDBs 4L72 and 5F1O as search ensembles.
The resulting molecular replacement solutions were iteratively rebuilt and refined using Coot, ISOLDE and Phenix (Adams et al., 2002;
Croll, 2018; Emsley and Cowtan, 2004). The MERS-CoV+MERS VHH-55 structure was refined using NCS. Crystallographic software
packages were curated by SBGrid (Morin et al., 2013).
Biolayer interferometry
Anti-human capture (AHC) tips (FortéBio) were soaked in running buffer composed of 10 mM HEPES pH 7.5, 150 mM NaCl, 3 mM
EDTA, 0.005% Tween 20 and 1 mg/mL BSA for 20 min before being used to capture either Fc-tagged SARS-CoV-1 RBD, Fc-tagged
SARS-CoV-2 RBD-SD1 or Fc-tagged MERS-CoV RBD to a level of 0.8 nm in an Octet RED96 (FortéBio). Tips were then dipped into
either 100 nM MERS VHH-55 or 100 nM SARS VHH-72. Tips were next dipped into wells containing either 1 mM ACE2 or 100 nM
DPP4 supplemented with the nanobody that the tip had already been dipped into to ensure continued saturation. Data were refer-
ence-subtracted and aligned to each other in Octet Data Analysis software v11.1 (FortéBio) based on a baseline measurement that
was taken before being dipped into the final set of wells that contained either ACE2 or DPP4.
BLI measurements were also performed with VHH-72-Fc fusion produced in HEK293S cells. SARS-CoV-2 RBD with a mouse IgG1
Fc tag (Sino Biological) was immobilized to an anti-mouse IgG Fc capture (AMC) tip (FortéBio) to a response level of 0.5 nm. Super-
natant of non-transfected and VHH-72-Fc transfected HEK293-S cells was applied in a three-fold dilution series in kinetics buffer.
Binding was measured at 30 C, with baseline and dissociation measured in equal dilution of non-transformed HEK293S supernatant
in kinetics buffer. Between analyses, biosensors were regenerated by three times 20 s exposure to regeneration buffer (10 mM
glycine pH 1.7).
Flow cytometry
Binding of VHH-72-Fc, VHH-72-Fc (S) and monomeric and bivalent SARS VHH-72 to SARS-CoV-1 and SARS-CoV-2 S was
analyzed by flow cytometry using cells transfected with a GFP expression plasmid combined with an expression plasmid for
either SARS-CoV-1 or SARS-Cov-2 S. HEK293S culture media (1/20 diluted in PBS + 0.5%BSA) of VHH-72-Fc and VHH-72-Fc
Cell 181, 1–12.e1–e8, May 28, 2020 e7

ll
Article
(S) transformants were incubated with transfected cells. Binding of the VHH-72-Fc and VHH-72-Fc (S) to cells was detected with an
AF633 conjugated goat anti-human IgG antibody, whereas binding of monomeric and bivalent VHHs to SARS-CoV-1 or SARS-CoV-
2 S was detected with a mouse anti-HisTag antibody and an AF647 conjugated donkey anti-mouse IgG antibody. Binding was calcu-
lated as the mean AF633 fluorescence intensity (MFI) of GFP expressing cells (GFP+) divided by the MFI of GFP negative cells (GFP-).
RBD competition assay on Vero E6 cells

SARS-CoV-2 RBD fused to murine IgG Fc (Sino Biological) at a final concentration of 0.4 mg/mL was incubated with a dilution series of
tail-to-head bivalent VHHs or VHH-Fc fusions and incubated at room temperature for 20 min before an additional 10 min incubation
on ice. Vero E6 cells grown at sub-confluency were detached by cell dissociation buffer (Sigma) and trypsin treatment. After washing
once with PBS the cells were blocked with 1% BSA in PBS on ice. All remaining steps were also performed on ice. The mixtures
containing RBD and tail-to-head bivalent VHHs or VHH-Fc fusions were added to the cells and incubated for one h. Subsequently,
the cells were washed 3 times with PBS containing 0.5% BSA and stained with an AF647 conjugated donkey anti-mouse IgG anti-
body (Invitrogen) for 1 h. Following additional 3 washes with PBS containing 0.5% BSA, the cells were analyzed by flow cytometry
using an BD LSRII flow cytometer (BD Biosciences).
QUANTIFICATION AND STATISTICAL ANALYSIS
Binding and neutralization assays were conducted with at least duplicate measurements and presented as the mean ± SEM of the
indicated number of replicates. Details can be found in figure legends.
e8 Cell 181, 1–12.e1–e8, May 28, 2020

ll
Article
Supplemental Figures
Figure S1. CoV VHH Immunization and Panning, Related to Figure 1

(A) Schematic depicting the immunization strategy that was used to isolate both SARS-CoV-1 S and MERS-CoV S-directed VHHs from a single llama. The
prefusion stabilized SARS-CoV-1 spike is shown in pink and the prefusion stabilized MERS-CoV spike is shown in tan.
(B) Phylogenetic tree of the isolated MERS-CoV and SARS-CoV S-directed VHHs, based on the neighbor joining method.
(C) Reactivity of MERS-CoV and SARS-CoV S-directed VHHs with the prefusion stabilized MERS-CoV S and SARS-CoV-1 S protein, respectively. A VHH against
an irrelevant antigen (F-VHH) was included as a control.
ll
Article
Figure S2. Sequence Alignment of Neutralizing SARS-CoV and MERS-CoV S-Directed VHHs, Related to Figure 1
Invariant residues are shown as black dots. The CDRs are shown in boxes and Kabat numbering is shown above.
ll
Article
Figure S3. Lack of Binding of MERS-CoV and SARS-CoV-Directed VHHs to Non-RBD Epitopes, Related to Figure 1
ELISA data showing binding of the MERS-CoV specific VHHs to the MERS-CoV S1 protein and absence of binding of the MERS-CoV and SARS-CoV specific
VHHs against the MERS-CoV NTD and SARS-CoV-1 NTD, respectively. A VHH against an irrelevant antigen (F-VHH) was included as a control.
ll
Article
Figure S4. MERS VHH-55 Binds to a Relatively Conserved Epitope on the MERS-CoV RBD, Related to Figure 2
(A) The crystal structure of MERS VHH-55 bound to the MERS-CoV RBD is shown with MERS VHH-55 in white ribbons and the MERS-CoV RBD as a multicolored
molecular surface. More variable residues are shown in warm colors and more conserved residues are shown in cool colors according to the spectrum (bottom).
Sequence alignments and variability mapping was performed using ConSurf.
(B) The crystal structure of MERS VHH-55 bound to the MERS-CoV RBD is shown as ribbons with MERS VHH-55 colored blue and the MERS-CoV RBD colored
tan. Phe506 from the MERS-CoV RBD and Trp99 from MERS VHH-55, which are thought to form hydrophobic interactions with one another are shown as sticks
surrounded by a transparent molecular surface.
(C) SPR sensorgram measuring the binding of MERS VHH-55 to the naturally occurring MERS-CoV RBD F506L variant. Binding curves are colored black and the
fit of the data to a 1:1 binding model is colored red.
ll
Article
Figure S5. SARS VHH-72 Binds to a Broadly Conserved Epitope on the SARS-CoV-1 RBD, Related to Figure 3
(A) The crystal structure of SARS VHH-72 bound to the SARS-CoV-1 RBD is shown, with colors corresponding to those of Figure S4A.
(B) The crystal structure of SARS VHH-72 bound to the SARS-CoV-1 RBD is shown with SARS VHH-72 as dark blue ribbons and the RBD as a pink molecular
surface. Amino acids that vary between SARS-CoV-1 and WIV1-CoV are colored teal.
(C) SPR sensorgram measuring the binding of SARS VHH-72 to the WIV1-CoV RBD. Binding curves are colored black and the fit of the data to a 1:1 binding model
is colored red.
ll
Article
Figure S6. Engineering a Functional Bivalent VHH Construct, Related to Figure 6

(A) Flow cytometry measuring the binding of the bivalent SARS VHH-72 tail-to-head fusion (VHH-72-VHH-72) to SARS-CoV-1 or SARS-CoV-2 S expressed on the
cell surface. VHH-23-VHH-23, a bivalent tail-to-head fusion of an irrelevant nanobody, was included as a negative control.
(B) Binding of SARS-CoV-2 RBD-SD1 to Vero E6 cells is prevented by VHH-72-VHH-72 in a dose-dependent fashion. Binding of SARS-CoV-2 RBD-SD1 to Vero
E6 cells was detected by flow cytometry in the presence of the indicated bivalent VHHs (n = 2 except VHH-72-VHH-72 and VHH-23-VHH-23 at 5 mg/mL, n = 5).
(C) Binding of SARS-CoV-2 RBD-SD1 to Vero E6 cells is prevented by bivalent VHH-72-Fc fusion proteins in a dose-dependent fashion. Binding of SARS-CoV-2
RBD-SD1-Fc to Vero E6 cells was detected by flow cytometry in the presence of the indicated constructs and amounts (n = 2 except no RBD, n = 4).
(D) Cell surface binding of SARS VHH-72 to SARS-CoV-1 S. 293T cells were transfected with a GFP expression plasmid together with a SARS-CoV-1 S
expression plasmid. Binding of the indicated protein is expressed as the median fluorescent intensity (MFI), measured to detect the His-tagged MERS VHH-55 or
SARS VHH-72 or the SARS VHH-72-Fc fusions, of the GFP positive cells divided by the MFI of the GFP negative cells.
(E) Cell surface binding of SARS VHH-72 to SARS-CoV-2. MFI was calculated using the same equation as Figure S6D.
ll
Article
Figure S7. Comparison of the CoV VHH Epitopes with Known RBD-Directed Antibodies, Related to Figures 2 and 3
(A) The structure of MERS VHH-55 bound to the MERS-CoV RBD is shown with MERS VHH-55 as blue ribbons and the MERS-CoV RBD as a white molecular
surface. Epitopes from previously reported crystal structures of the MERS-CoV RBD bound by RBD-directed antibodies are shown as colored patches on the
MERS-CoV RBD surface. The LCA60 epitope is shown in yellow, the MERS S4 epitope is shown in green, the overlapping C2/MCA1/m336 epitopes are shown in
red and the overlapping JC57-14/D12/4C2/MERS-27 epitopes are shown in purple.
(B) The structure of SARS VHH-72 bound to the SARS-CoV-1 RBD is shown with SARS VHH-72 as dark blue ribbons and the SARS-CoV-1 RBD as a white
molecular surface. Epitopes from previously reported crystal structures of the SARS-CoV-1 RBD bound by RBD-directed antibodies are shown as colored
patches on the SARS-CoV-1 RBD surface. The 80R epitope is shown in blue, the S230 epitope is shown in yellow, the CR3022 epitope is shown in purple and the
overlapping m396/F26G19 epitopes are shown in red.
(C) The SARS-CoV-1 RBD is shown as a white molecular surface, ACE2 is shown as a transparent red molecular surface, SARS VHH-72 is shown as dark blue
ribbons and CR3022 Fab is shown as purple ribbons.

Piis0092867420304943 PDF

Uploaded by

Copyright:

Available Formats

Piis0092867420304943 PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Piis0092867420304943 PDF

Uploaded by

Copyright:

Available Formats

Article

Structural Basis for Potent Neutralization of

d Structural characterization of VHHs reveals conserved

d SARS-CoV-1 S-directed VHH cross-reacts with SARS-CoV-

d Bivalent VHH neutralizes SARS-CoV-2 pseudoviruses

Wrapp et al., 2020, Cell 181, 1–12

*Correspondence: [email protected] (B.S.), [email protected] (X.S.), [email protected] (J.S.M.)

INTRODUCTION The surfaces of coronaviruses are decorated with a spike (S)

Cell 181, 1–12, May 28, 2020 ª 2020 Elsevier Inc. 1

2 Cell 181, 1–12, May 28, 2020

Cell 181, 1–12, May 28, 2020 3

4 Cell 181, 1–12, May 28, 2020

Cell 181, 1–12, May 28, 2020 5

6 Cell 181, 1–12, May 28, 2020

Figure 5. Neutralizing Mechanisms of MERS VHH-55 and SARS VHH-72

Cell 181, 1–12, May 28, 2020 7

Figure 6. SARS VHH-72 Bivalency Permits SARS-CoV-2 Pseudovirus Neutralization

8 Cell 181, 1–12, May 28, 2020

Figure 7. VHH-72-Fc Neutralizes SARS-CoV-2 S Pseudoviruses

STAR+METHODS B Flow cytometry

d KEY RESOURCES TABLE SUPPLEMENTAL INFORMATION

Cell 181, 1–12, May 28, 2020 9

10 Cell 181, 1–12, May 28, 2020

Cell 181, 1–12, May 28, 2020 11

12 Cell 181, 1–12, May 28, 2020

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Cell 181, 1–12.e1–e8, May 28, 2020 e1

e2 Cell 181, 1–12.e1–e8, May 28, 2020

ISOLDE Croll, 2018 http://preview.cgl.ucsf.edu/chimerax/

Data and Code Availability

Cell 181, 1–12.e1–e8, May 28, 2020 e3

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Isolation of MERS- and SARS-CoV VHH phages

Periplasmic ELISA to select MERS- and SARS-CoV VHHs

e4 Cell 181, 1–12.e1–e8, May 28, 2020

VHH cloning into a Pichia pastoris expression vector

Generating bivalent VHHs for P. pastoris expression

Purification of MERS- and SARS-CoV VHHs from Pichia

Cell 181, 1–12.e1–e8, May 28, 2020 e5

Enzyme-linked immunosorbent assay

CoV pseudovirus neutralization

Mammalian protein expression and purification

e6 Cell 181, 1–12.e1–e8, May 28, 2020

Surface plasmon resonance

Crystallization and data collection

Cell 181, 1–12.e1–e8, May 28, 2020 e7

RBD competition assay on Vero E6 cells

QUANTIFICATION AND STATISTICAL ANALYSIS

e8 Cell 181, 1–12.e1–e8, May 28, 2020

Figure S1. CoV VHH Immunization and Panning, Related to Figure 1

Figure S6. Engineering a Functional Bivalent VHH Construct, Related to Figure 6

You might also like