Primer-Blast Results
Primer-Blast Results
cgi
1 of 8 11/24/2016 7:58 PM
Primer-Blast results https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
Primer pair 1
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer CACTGACTGACCGCCTGAAT Plus 20 84 103 60.04 55.00 3.00 2.00
Reverse primer CTCGCGGGTGTTTCGTTTTT Minus 20 165 146 59.97 50.00 4.00 0.00
Internal oligo Plus
Product length 82
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron
size
Products on intended target
2 of 8 11/24/2016 7:58 PM
Primer-Blast results https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
>AF288233.1 Draco spilopterus TNHC 57775 tRNA-Met gene, partial sequence; NADH dehydrogenase subunit 2 (ND2) gene,
complete cds; tRNA-Trp gene, complete sequence; and tRNA-Ala gene, partial sequence; mitochondrial genes for mitochondrial
products
product length = 82
Forward primer 1 CACTGACTGACCGCCTGAAT 20
Template 84 .................... 103
Primer pair 2
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer CAACTTAGGCTGGGCCATGA Plus 20 566 585 60.03 55.00 5.00 2.00
Reverse primer GTGGCAGAAGCAGGAGAGTT Minus 20 940 921 59.96 55.00 3.00 0.00
Internal oligo Plus
Product length 375
Product Tm
Product Tm -
min(OLIGO
Tm)
Exon junction
Total intron
size
Products on intended target
>AF288233.1 Draco spilopterus TNHC 57775 tRNA-Met gene, partial sequence; NADH dehydrogenase subunit 2 (ND2) gene,
complete cds; tRNA-Trp gene, complete sequence; and tRNA-Ala gene, partial sequence; mitochondrial genes for mitochondrial
products
Primer pair 3
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer TCGCCCTCATTATCGGCATC Plus 20 469 488 60.04 55.00 3.00 0.00
Reverse primer GGGGGTGAGGGTTTGCATTA Minus 20 842 823 59.96 55.00 4.00 2.00
Internal oligo Plus
Product length 374
Product Tm
Product Tm -
min(OLIGO Tm)
3 of 8 11/24/2016 7:58 PM
Primer-Blast results https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
Exon junction
Total intron
size
Products on intended target
>AF288233.1 Draco spilopterus TNHC 57775 tRNA-Met gene, partial sequence; NADH dehydrogenase subunit 2 (ND2) gene,
complete cds; tRNA-Trp gene, complete sequence; and tRNA-Ala gene, partial sequence; mitochondrial genes for mitochondrial
products
Primer pair 4
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer GATCGCCCTCATTATCGGCA Plus 20 467 486 60.04 55.00 4.00 0.00
Reverse primer TGTTTTGGTGGCCATTGCAG Minus 20 689 670 59.89 50.00 6.00 2.00
Internal oligo Plus
Product length 223
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron size
Products on intended target
>AF288233.1 Draco spilopterus TNHC 57775 tRNA-Met gene, partial sequence; NADH dehydrogenase subunit 2 (ND2) gene,
complete cds; tRNA-Trp gene, complete sequence; and tRNA-Ala gene, partial sequence; mitochondrial genes for mitochondrial
products
Primer pair 5
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer ACAATGGTTGGAGGCTGAGG Plus 20 495 514 59.96 55.00 4.00 1.00
Reverse primer AAAAGCCTGTGAGAGGTGGG Minus 20 792 773 59.89 55.00 5.00 0.00
Internal oligo Plus
Product length 298
4 of 8 11/24/2016 7:58 PM
Primer-Blast results https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
Product Tm
Product Tm -
min(OLIGO
Tm)
Exon junction
Total intron
size
Products on intended target
>AF288233.1 Draco spilopterus TNHC 57775 tRNA-Met gene, partial sequence; NADH dehydrogenase subunit 2 (ND2) gene,
complete cds; tRNA-Trp gene, complete sequence; and tRNA-Ala gene, partial sequence; mitochondrial genes for mitochondrial
products
Primer pair 6
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer TCAATTGCTGGACTCCCACC Plus 20 759 778 59.96 55.00 6.00 3.00
Reverse primer TGGAGTTGGGCAACGTCATT Minus 20 971 952 60.18 50.00 6.00 3.00
Internal oligo Plus
Product length 213
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron
size
Products on intended target
>AF288233.1 Draco spilopterus TNHC 57775 tRNA-Met gene, partial sequence; NADH dehydrogenase subunit 2 (ND2) gene,
complete cds; tRNA-Trp gene, complete sequence; and tRNA-Ala gene, partial sequence; mitochondrial genes for mitochondrial
products
Primer pair 7
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
5 of 8 11/24/2016 7:58 PM
Primer-Blast results https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
>AF288233.1 Draco spilopterus TNHC 57775 tRNA-Met gene, partial sequence; NADH dehydrogenase subunit 2 (ND2) gene,
complete cds; tRNA-Trp gene, complete sequence; and tRNA-Ala gene, partial sequence; mitochondrial genes for mitochondrial
products
Primer pair 8
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer GCAATGGCCACCAAAACACT Plus 20 672 691 59.89 50.00 6.00 1.00
Reverse primer AGGATGGTTGTTCCGGTTGG Minus 20 742 723 60.25 55.00 4.00 0.00
Internal oligo Plus
Product length 71
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron
size
Products on intended target
>AF288233.1 Draco spilopterus TNHC 57775 tRNA-Met gene, partial sequence; NADH dehydrogenase subunit 2 (ND2) gene,
complete cds; tRNA-Trp gene, complete sequence; and tRNA-Ala gene, partial sequence; mitochondrial genes for mitochondrial
products
product length = 71
Forward primer 1 GCAATGGCCACCAAAACACT 20
Template 672 .................... 691
6 of 8 11/24/2016 7:58 PM
Primer-Blast results https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
Primer pair 9
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward primer AACTCTCCTGCTTCTGCCAC Plus 20 921 940 59.96 55.00 3.00 1.00
Reverse primer TGCATTCGGGTGATGTGAGT Minus 20 1151 1132 59.68 50.00 4.00 1.00
Internal oligo Plus
Product length 231
Product Tm
Product Tm -
min(OLIGO Tm)
Exon junction
Total intron size
Products on intended target
>AF288233.1 Draco spilopterus TNHC 57775 tRNA-Met gene, partial sequence; NADH dehydrogenase subunit 2 (ND2) gene,
complete cds; tRNA-Trp gene, complete sequence; and tRNA-Ala gene, partial sequence; mitochondrial genes for mitochondrial
products
Primer pair 10
Template Self Self 3'
Sequence (5'->3') Length Start Stop Tm GC%
strand complementarity complementarity
Forward
CAATTGCTGGACTCCCACCT Plus 20 760 779 59.96 55.00 6.00 1.00
primer
Reverse primer CTGTGGCAGAAGCAGGAGAG Minus 20 942 923 60.39 60.00 3.00 0.00
Internal oligo Plus
Product length 183
Product Tm
Product Tm -
min(OLIGO
Tm)
Exon junction
Total intron
size
Products on intended target
>AF288233.1 Draco spilopterus TNHC 57775 tRNA-Met gene, partial sequence; NADH dehydrogenase subunit 2 (ND2) gene,
complete cds; tRNA-Trp gene, complete sequence; and tRNA-Ala gene, partial sequence; mitochondrial genes for mitochondrial
products
7 of 8 11/24/2016 7:58 PM
Primer-Blast results https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
8 of 8 11/24/2016 7:58 PM