Bacteriophages - Methods and Protocols, Volume IV
Bacteriophages - Methods and Protocols, Volume IV
Martha R. J. Clokie
Andrew Kropinski
Rob Lavigne Editors
Bacteriophages
Methods and Protocols
Volume IV
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
Edited by
Martha R. J. Clokie
Department of Genetics and Genome Biology, University of Leicester, University Road, Leicester, UK
Andrew Kropinski
Departments of Food Science, and Pathobiology, University of Guelph, Guelph, ON, Canada
Rob Lavigne
Laboratory of Gene Technology, KU Leuven, Leuven, Belgium
Editors
Martha R. J. Clokie Andrew Kropinski
Department of Genetics and Genome Biology Departments of Food Science, and Pathobiology
University of Leicester, University Road University of Guelph
Leicester, UK Guelph, ON, Canada
Rob Lavigne
Laboratory of Gene Technology
KU Leuven
Leuven, Belgium
This Humana Press imprint is published by the registered company Springer Science+Business Media, LLC, part of
Springer Nature.
The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.
Preface
v
vi Preface
As a final note, we would like to thank the contributing authors for their work and
patience for the completion of this volume. And, in the end, we are all indebted to the
scientists who came before us for their example, creativity, and knowledge. We hope this
book can in turn inspire a next generation of phage biologists.
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
1 PhageFISH for Monitoring Phage Infections at Single Cell Level . . . . . . . . . . . . . 1
Jimena Barrero-Canosa and Cristina Moraru
2 Fluoromycobacteriophages for Drug Susceptibility Testing (DST)
of Mycobacteria. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
Mariana Piuri and Graham F. Hatfull
3 Engineering Bacteriophage-Based Biosensors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
Daniel Brownell, John King, Brian Caliando, Lada Sycheva,
and Michael Koeris
4 Introduction of Phage Genome into Escherichia coli by Electroporation . . . . . . . 51
Nika Janež, Saša Haberl Meglič, Karel Flisar, Damijan Miklavčič,
and Matjaž Peterka
5 Site-Specific Mutagenesis of Bacillus subtilis Phage SPO1 . . . . . . . . . . . . . . . . . . . . 57
Charles R. Stewart
6 Genetic Manipulation of Lytic Bacteriophages with BRED:
Bacteriophage Recombineering of Electroporated DNA . . . . . . . . . . . . . . . . . . . . . 69
Laura J. Marinelli, Mariana Piuri, and Graham F. Hatfull
7 Isolation of Competitive Phage Display-Modified Bacteriophage
T4 with Affinity Chromatography. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
Krystyna Da˛browska
8 Immobilization of Intact Phage and Phage-Derived Proteins
for Detection and Biocontrol Purposes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
Hany Anany, Luba Y. Brovko, Denis Arutyunov, Nilufar Poshtiban,
Amit Singh, Upasana Singh, Michael Brook, Christine Szymanski,
Stephane Evoy, and Mansel W. Griffiths
9 Peptidoglycan Hydrolytic Activity of Bacteriophage Lytic Proteins
in Zymogram Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107
Lorena Rodrı́guez-Rubio, David M. Donovan, Beatriz Martı́nez,
Ana Rodrı́guez, and Pilar Garcı́a
10 Analyzing Phage–Host Protein–Protein Interactions
Using Strep-tag® II Purifications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117
Jeroen De Smet, Hanne Hendrix, and An Van den Bossche
11 Techniques to Assess Phage–Biofilm Interaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137
Diana Vilas Boas, Carina Almeida, Nuno Azevedo,
Sanna Sillankorva, and Joana Azeredo
12 Screening for Growth-Inhibitory ORFans in Pseudomonas
aeruginosa-Infecting Bacteriophages . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147
Hanne Hendrix, Ines Staes, Abram Aertsen, and Jeroen Wagemans
vii
viii Contents
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 215
Contributors
ix
x Contributors
Abstract
PhageFISH uses the power of fluorescence in situ hybridization to monitor intracellular phage infections at
single cell level. It combines host cell identification via rRNA probes and phage identification via phage-
specific gene probes, allowing for the quantification of the infected cell fraction and the discrimination
between infection stages. This book chapter covers all aspects of the procedure, from phage probe design
and synthesis, to the phageFISH protocol itself, to microscopy and image analysis.
Key words PhageFISH, Virus, Phage, Microorganisms, Fluorescence in situ hybridization, FISH,
Infection cycle, Infection stages
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_1, © Springer Science+Business Media, LLC, part of Springer Nature 2019
1
2 Jimena Barrero-Canosa and Cristina Moraru
are applied. The bound HRP enzymes catalyze the covalent bind-
ing of multiple fluorochrome-labeled tyramides to cellular proteins
in a so-called catalyzed reporter deposition (CARD) step. This
results in both signal amplification and fixation of the signal inside
the cells (Fig. 1e). By dual color epifluorescence microscopy host
cells can be identified in one color and intracellular and extracellular
phage particles in another color (Fig. 1f). Since the writing of this
book chapter, a new method for gene detection in microorganisms
has been developed, called direct-geneFISH [4]. It uses polynucle-
otide probes directly labeled with fluorochromes and therefore
eliminates the antibody binding and CARD steps. As a conse-
quence, the protocol is significantly shorter and simpler. We are
currently testing the protocol in our labs on phage infected samples
and the results a very promising.
So far phageFISH has been applied to pure cultures, to model
the infection dynamics of a lytic phage–host system. However, its
use can be extended to the study of lysogenic systems and, since it
allows for both host and virus identification, also to the study of
more complex environmental systems. It should furthermore be
possible to apply phageFISH not only to double-stranded DNA
viruses but also to single-stranded DNA viruses and RNA viruses.
2 Materials
Always use ultrapure water, which was 0.22 μm filtered and auto-
claved, for the preparation of solutions. Unless indicated otherwise,
prepare and store the solutions at room temperature. Avoid expos-
ing the fluorescent reagents to light, by storing them in nontran-
sparent tubes/racks or wrapped in aluminum foil. Several of the
chemicals used are toxic and/or volatile. Use appropriate protec-
tion measures; for example, always work with formamide and para-
formaldehyde in fume hood cabinets equipped with special waste
disposal bins.
2.1 Stock Solutions 1. PCR Dig Probe Synthesis Kit (Roche, cat. no. 11636090910).
and Chemicals Store at 20 C.
2. Alternative to the PCR Dig Probe Synthesis Kit: 1 mM
Dig-dUTPs (Jena Biosciences, cat. no. NU-803-DIGXS),
5 Prime Master Taq Kit (5 PRIME, cat. no. 2200230),
100 mM dNTP Set, PCR Grade (Invitrogen, cat. no. 10297-
117). Store at 20 C.
3. Gene Clean Turbo kit (Q-Biogene, cat. no. 1102-600) or
QIAquick PCR purification kit (Qiagen, cat. no. 28106).
4. 3-aminopropyl-triethoxysilane (TESPA), (Sigma, cat. no.
A-3648) or poly-L-lysine (Sigma Cat. No. P-2636).
4 Jimena Barrero-Canosa and Cristina Moraru
2.2 Glassware 1. Thin forceps, from materials resistant to acids, bases, organic
and Plasticware solvents, and temperature (e.g., from Electron Microscopy
Sciences, cat. no. 72692-F; https://www.emsdiasum.com/).
2. Petri dishes, various sizes, sterile, DNase free.
3. 15 and 50 ml Falcon tubes, sterile, DNase free.
4. Scalpels: sterile, disposable.
5. Hybridization chambers: any tightly closing, temperature resis-
tant container that seals with a silicone O-ring (e.g., food
containers with glass bottom used in the kitchen).
6. Hybridwell sealing chamber (Electron Microscopy Sciences,
cat. no. 70328-01). Press-To-Seal silicone isolators (Sigma-
Aldrich, cat. no. GBL 664301-25 EA).
7. 0.22 μm sterile syringe filters.
8. 0.2 μm polycarbonate membrane filters (GTTP, Millipore, cat.
no. GTTP02500).
9. Diamond Retractable Tip Scriber: for writing on glass, metal
and plastic (Electron Microscopy Sciences, cat. no. 70036).
10. Glass slides, frosted end.
11. Poly-L-Lysine Coated Slides (Electron Microscopy Sciences,
cat. no. 63410-02).
12. Coverslips, # 1.5, high precision (Marienfeld, cat.
no. MARI0107052; http://www.marienfeld-superior.com/
home.html).
3 Methods
3.1 Phage Probe 1. Use the bioinformatics tools you have in your laboratory to
Design select a phage-specific genomic region (not more than 70%
identity with other, non-target, sequences, see Note 10),
which is not found in the other microbial members of the
sample being studied (the host, or coinfecting viruses, other
bacteria, archaea, viruses, etc., which might be present in the
sample). This requires having a priori genomic/metagenomic
information for the sample of interest. If such information is
not available, then compare your phage genome against the
NCBI database.
2. Next, in the selected region identify at least six probes (see Note
11), each ~300 bp, with similar %GC. In a first step, calculate
the variation of the %GC along the selected DNA region, using
the bioinformatics tools in your laboratory. One such tool is
DAN (http://www.hpa-bioinfotools.org.uk/pise/dan.html),
which can calculate the denaturation profile, including the %
GC. When using DAN, choose the following parameters:
“window size” ¼ 100, “shift increment” ¼ 1, “DNA concen-
tration” ¼ 1 nm, “salt concentration” ¼ 1000 mM, and “out-
put format” ¼ excel. In Excel, plot the base position (for DAN,
this would be column “Start” in the output file) versus the %
GC (see Note 12). To select the probes, avoid sequence
stretches with high variations (e.g., more than 10 units) in
the %GC. Furthermore, if possible, choose sequence stretches
with 30–40 %GC (see Note 13). Perform a Blast search with
the individual probes against the database relevant for your
samples, to identify potential nonspecific binding sites (regions
with more than 80% identity on higher than 20–30 base
stretches). If necessary, discard probes with potential for non-
specific binding. The last step is to design primers for the ends
of each 300 bps probe.
10 Jimena Barrero-Canosa and Cristina Moraru
3.2 Phage Probe The phageFISH probes are dsDNA molecules labeled with Dig.
Synthesis They are produced by incorporating Dig into dsDNA during a
PCR reaction (see Fig. 1d).
1. Optimize the PCR conditions (to avoid expenses you can leave
out Dig) for the template and primers of interest. Use either
viral DNA or plasmid DNA as PCR template.
2. Proceed to the probe synthesis PCR. A labeling kit is available
from Roche—the PCR Dig Probe Synthesis Kit. Follow man-
ufacturer’s instructions for probe synthesis. Because Dig incor-
poration results in lower product yields, you can use two kit
reactions per probe and pool them for purification. For an
alternative to the kit, see Note 14.
3. Purify the PCR products using PCR purification kits, as for
example the Gene Clean Turbo kit or QIAquick PCR purifica-
tion kit. At the end of the purification, elute the probes in TE
buffer, pH 8.0.
4. Check the probes on 2.5–3% agarose gels. Due to Dig incor-
poration, the probes will migrate slower than the unlabeled
counterparts.
5. Measure the probe concentration using a spectrophotometer.
6. Prepare stocks of 5 ng μl1 each probe, by diluting in TE
buffer, pH 8.0.
7. Store at 20 C.
3.3 Determination The hybridization and washing stringency will influence not only
of the Stringency the specificity, but also the detection efficiency of the hybridization.
Parameters for Gene The stringency refers to how close to the melting temperature of
Hybridization the probe–target hybrids the hybridization or washing takes place.
It can be modulated by modifying the formamide concentration in
the hybridization buffer and by changing the hybridization and the
washing temperatures.
1. Calculate the formamide concentration which will allow for a
hybridization temperature in the range 42–50 C (see Note
15). For this, use the HPC module of the PolyPro software
to calculate for each probe–target pair the graph of the melting
temperature as a function of formamide concentration. As
input parameters use DNA–DNA hybridization, Naþ concen-
tration of 975 mM, formamide in between 1 and 100%, and
criterion of 25 (distance from Tm, see Note 16). As output
option, choose “Hybridization temperature function of %
formamide.” Using the graphs for all probe–target pairs, select
a formamide concentration that will give a hybridization tem-
perature in the range 42–50 C for every probe–target pair.
2. Use the chosen formamide concentration to test the detection
efficiency at different gene hybridization temperatures (in the
PhageFISH for Monitoring Phage Infections at Single Cell Level 11
3.4 PhageFISH During the FISH procedure the cells are immobilized on solid
Protocol support, most often on 0.22 μm polycarbonate filters or glass slides.
See Note 18 for general instructions for handling polycarbonate
filters and Note 19 for glass slides. Avoid excessive light exposure
during the procedure. Avoid sample drying, unless specifically
instructed in the protocol (see Note 20). Unless stated otherwise,
perform all incubations at room temperature. Prewarm or precool
reagents before use, to bring them to the required incubation
temperature. Whenever working with toxic substances,
e.g. paraformaldehyde during fixation, formamide during hybridi-
zation, use a chemical fume hood. Unless otherwise specified, all
washing steps should be performed in large volumes, e.g. 50 ml, see
Notes 18 and 19.
1. Sample fixation and immobilization. Add 20% PFA directly to
the sample of interest (e.g., culture, seawater), to result in a
final concentration of 1–4% paraformaldehyde (PFA). Incubate
for 1 h at room temperature or overnight at þ4 C (see Notes
21 and 22). To remove the PFA and bring the cells on solid
support, filter the fixed culture on 0.22 μm polycarbonate
filters (see Notes 23 and 24 for other methods to remove
PFA, concentrate the cells and immobilize them on glass
slides). Apply a vacuum pressure as low as possible and not
higher than 0.2 mBar. Initially, test different culture volumes to
see which one gives a uniform distribution of cells on the filter,
avoiding too little or too many cells. Consider using a volume
that will give a denser cell distribution because during the
phageFISH protocol some cells will detach from the solid
support (see Note 25). After filtering the fixed culture, filter
through 10–15 ml 1 PBS and then 10–15 ml water, to wash.
Allow filters to air-dry. Store at 20 C, or directly proceed
further.
2. Permeabilization. Overlay samples with permeabilization
solution (e.g., 0.5–1 ml per 25 mm filter or per glass slide),
incubate on ice for 1 h, and then wash 5 min with 1 PBS and
1 min with water. Permeabilization can be sample specific. See
Notes 18 and 19 for washing and Note 26 for permeabiliza-
tion details.
3. Inactivation of endogenous peroxidases. Immerse the samples
in 0.01 M HCl (e.g., place filter pieces in a petri dish with 20 ml
inactivation solution; alternatively, when working with glass
slides, cover the sample area with 1–2 ml inactivation solu-
tion) for 10 min. Then, wash with 1 PBS for 5 min, water
12 Jimena Barrero-Canosa and Cristina Moraru
for 1 min, and 96% ethanol for 1 min. Allow samples to air-dry.
Store at 20 C, or directly proceed further. Inactivation of
peroxidases can be sample specific. See Note 27 for more
details.
4. rRNA hybridization. Cover samples with hybridization buffer -
probe mix. For example, place filter pieces in a petri dish,
sample face up, and cover them with enough mix to completely
cover the filters (30–100 μl are enough for a 1/8 piece from a
25 mm filter). Alternatively, when working on glass slides, add
the hybridization buffer – probe mix on top of the sample area,
in suficient volume to completely cover it. Transfer the petri
dish or the glass slides to a humidity chamber (see Note 20).
Incubate at 46 C for 1.5–3 h. For washing, quickly rinse the
samples in rRNA washing buffer, then transfer them in 50 ml of
prewarmed rRNA washing buffer and incubate for 15 min at
48 C (see Notes 18 or 19). CAUTION: remove samples from
the hybridization buffer under a fume food, to avoid exposure
to formamide vapors.
5. CARD for rRNA detection. Incubate the samples for
10–15 min in 1 PBS. Further, transfer the samples in
rRNA-CARD buffer–Alexa488 tyramide mix (e.g., place ~20
small filter pieces in 10 ml mix in a petri dish) and incubate for
10 min at 37 C (see Note 28). For washing, quickly rinse the
samples in 1 PBS, then transfer in 1 PBS, 10 min at 46 C,
followed by 1 min with water and 1 min with 96% ethanol.
Air-dry and store at 20 C, or directly proceed further.
6. RNase treatment (see Note 29). Cover the samples with RNase
solution (e.g., place ~20 small filter pieces in 10 ml RNase
solution; for glass slides, cover sample area with 0.5–2 ml
solution) and incubate for 1h at 37 C. Wash twice for 5 min
in 1 PBS and one for 1 min with water.
7. Inactivation of HRP introduced with the rRNA probe.
Immerse the samples in 0.2 M HCl for 10 min. Wash with
1 PBS for 1 and 5 min, then 1 min with water, 1 min with
96% ethanol. Allow samples to air-dry and store at 20 C, or
directly proceed further.
8. Gene hybridization — prehybridization. Cover samples with
hybridization buffer. For example, place filters face up on petri
dishes and overlay them with 30–100 μl of hybridization
buffer. Introduce the petri dish in a humidity chamber (see
Note 20) and incubate for 0.5–1 h at the hybridization tem-
perature (see “Determination of the stringency parameters for
gene hybridization” section 3.3).
9. Gene hybridization — denaturation and hybridization. On a
petri dish, place as many 30–100 μl droplets of gene hybridiza-
tion buffer–probe mix as the number of filters. Gently, remove
PhageFISH for Monitoring Phage Infections at Single Cell Level 13
the filters from the prehybridization buffer and place them face
down into the droplets of gene hybridization buffer–probe
mix. See Note 30 for working on glass slides.
Place the samples back in the humidity chamber and dena-
ture for 1 h at 85 C–90 C (see Note 31). Further, quickly
move the humidity chambers in an oven set at the hybridization
temperature and hybridize for 2 h or overnight (see Note 32).
For washing, first immerse samples in gene washing buffer I,
3 for 1 min at room temperature and for 30 min at 42 C,
followed by gene washing buffer II, 3 for 1 min at room
temperature and 1.5 h at 42 C. The 42 C incubations should
be performed in a slow shaking water bath. Finally, wash for
1 min in 1 PBS at RT. CAUTION: remove samples from the
hybridization buffer under a fume food, to avoid exposure to
formamide vapors.
10. Antibody binding. Incubate samples in antibody blocking
solution for 30 min. Use sufficient volume to completely
cover the samples. For example, ~20 small filter pieces (1/8
of a 25 mm filter) could fit in 15 ml antibody solution in a Petri
Dish. Alternatively, samples on glass slides should be covered
with 1–2 ml solution. Transfer samples in antibody binding
solution and incubate for 1.5 h. For washing, immerse samples
in antibody washing solution for 1 min and then 3 10 min.
During these steps, slow shaking (e.g., 20 rpm) could improve
results, but could also result in cell loss.
11. CARD for gene detection. Cover samples with gene CARD
amplification buffer–Alexa594 tyramide mix (30–100 μl) and
incubate for 45 min at 37 C. Quick wash for 1 min in 1 PBS
at room temperature, and then for 5 min and 2 10 min with 1
PBS in a 46 C oven, slow shaking, then 1 min with water, 1 min
with 96% ethanol. Allow filters to air-dry and store at 20 C, or
directly proceed further.
12. Embedding and counterstaining. Place the filters face up on a
microscopy glass slide, in a droplet (1–2 μl) of embedding
reagent. On top of the sample add sufficient embedding
reagent (usually 2–5 μl per filter piece), so that when placing
next a coverslip on top, the whole sample surface will be
covered by the embedding reagent. If a nonhardening medium
is used (e.g., SlowFade Gold), then samples can be imaged
immediately. If a hardening media is used (e.g., ProLong
Gold), then allow the samples to cure for 24 h at room
temperature.
3.5 Microscopy 1. Image acquisition. Use the Alexa488 filter set to image the 16S
and Data Analysis rRNA signals and the Alexa594 filters set to image the phage
signals. Because the phage signals can vary greatly with respect
to intensity, take a series of images with increasing exposure
14 Jimena Barrero-Canosa and Cristina Moraru
4 Notes
15. Because high temperatures are damaging for the cells, form-
amide is used in hybridization buffers to lower the melting
temperatures and to allow for stringent hybridization at rela-
tively low temperatures (42–50 C). On the downside, high
concentrations of formamide are decreasing the
hybridization rate.
16. Theoretical considerations indicate that the highest hybridiza-
tion rate for polynucleotides is at 25 C below their Tm. Get-
ting closer to the Tm will decrease the hybridization rate (and
thus, detection efficiency), while getting away from the Tm will
not only decrease the hybridization rate, but also favor the
formation of short mismatched hybrids [5].
17. There are two controls which can be used for phage-
FISH: (1) the same sample, but not infected, and/or (2) a
negative control gene probe, (e.g., NonPolyPro350 [3] or a
probe binding to other phage).
18. Working with filters.
l To label the filters, use a carbon pencil and write preferably
on the edge of the filter, where there are no cells. Do not use
permanent marker pens, they might interfere with the fluo-
rescent signals.
l To treat the filters with different reagents:
– If the reagents used are rather expensive and economical
use is preferred (e.g., when working with enzymes or
with hybridization buffers): place the filters face up on a
petri dish plate, add the reagents on top of the filters
while making sure that the filters are completely covered.
– If the reagents are relatively inexpensive (e.g., when
inactivating the endogenous peroxidases with 0.1 M
HCl): fill a 25 or 50 ml petri dish (depending on the
number of filters, crowding should be avoided) with the
reagent of interest and immerse the filters in it. Make sure
the filters are completely immersed and they are not
floating on top of the solution.
l To wash the filters, always use large volumes (e.g. 50 ml) of
the corresponding washing buffer:
– If the incubation is performed at room temperature or in
the oven, then place the filters in a 50 ml petri dishes
filled with the washing solution of interest.
– If the incubation is performed in the water bath, then
place the filters in 50 ml Falcon tubes filled with the
washing solution of interest. To remove them from the
Falcon tube, either pour the solution in a petri dish and
remove the filters from there, or pour the solution
through a ceramic sieve which will catch the filters.
20 Jimena Barrero-Canosa and Cristina Moraru
Acknowledgments
The authors would like to thank Rudi Amann and Bernhard Fuchs
(Max Planck Institute for Marine Microbiology, Bremen) for criti-
cal reading of the manuscript and helpful discussions, to Elke Allers
(Vibalogics GmbH, Germany), Melissa Duhaime (University of
Michigan, USA) and Matthew B. Sullivan (The Ohio State Univer-
sity, USA) for the close partnership which led to the development
of the phageFISH method, and finally, to Max Planck Society,
Germany, for funding.
References
1. Allers E et al (2013) Single-cell and population 3. Moraru C, Lam P, Fuchs B, Kuypers M,
level viral infection dynamics revealed by pha- Amann R (2010) GeneFISH – an in situ tech-
geFISH, a method to visualize intracellular and nique for linking gene presence and cell iden-
free viruses. Environ Microbiol 15:2306–2318 tity in environmental microorganisms. Environ
2. Vinh T. Dang, Cristina Howard-Varona, Sarah Microbiol. https://doi.org/10.1111/j.1462-
Schwenck, Matthew B. Sullivan (2015) Vari- 2920.2010.02281.x
ably lytic infection dynamics of large podovirus 4. Barrero-Canosa J, Moraru C, Zeugner L,
phi38:1 against two host strains. Environ Bernhard M. Fuchs, Amann R (2017) Direct-
Microbiol 17(11):4659–4671 geneFISH: a simplified protocol for the
26 Jimena Barrero-Canosa and Cristina Moraru
Abstract
Fluoromycobacteriophages are a new class of reporter phages that contain Laboratorio fluorescent reporter
genes (gfp, ZsYellow, and mCherry) and provide a simple means of revealing the metabolic state of
mycobacterial cells and therefore their response to antibiotics. Here we described a simple and rapid
method for drug susceptibility testing (DST) of Mycobacterium spp using a fluorescence microscope, a
flow cytometer, or a fluorimeter in a convenient multiwell format.
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_2, © Springer Science+Business Media, LLC, part of Springer Nature 2019
27
28 Mariana Piuri and Graham F. Hatfull
2 Materials
2.3 Preparation of Rifampicin (RIF) (50 mg/ml) in DMSO and ofloxacin (OFLO)
Antibiotic Stock (10 mg/ml) in NaOH 1 N, further dilutions starting at 5 mg/ml
Solutions can be prepared in water. Isoniazid (INH) (5 mg/ml), ethionamide
(ETH) (10 mg/ml), ethambutol (EMB) (10 mg/ml), kanamycin
(KAN) (5 mg/ml), streptomycin (STR) (10 mg/ml) carbenicillin
(50 mg/ml), and cycloheximide (10 mg/ml) prepared in distilled
deionized water and filter sterilized. Antibiotic stocks can be stored
at 20 C.
2.4 Cell Fixation PBS (0.1 M sodium phosphate, 0.15 M sodium chloride).
Paraformaldehyde 4% in PBS.
2.5 Fluorimetric Black, flat, clear bottom 96-well microplates (Greiner Bio-One;
Assays https://www.gbo.com/en_US.html).
Black light-absorbing sealing film (AbsorbMax, Excel Scientific
Inc.; http://www.excelscientific.com/blackwhite_content.
html).
3 Methods
3.1 Preparation of It is not convenient to amplify fluorophages from stocks more than
Fluorophage Stocks two times since phage mutants that render less fluorescence could
be obtained. Ideally, M. smegmatis mc2155 cells are electroporated
with phasmid DNA and individual plaques are amplified to further
obtain a high titer stock (see below).
30 Mariana Piuri and Graham F. Hatfull
Fig. 1 Kinetics of expression of fluorescent genes after infection of M. tuberculosis mc26230 with mCherry-
bomb phage in the presence of different concentrations of streptomycin
4 Notes
References
1. WHO (2014) Global Tuberculosis Report. questions, challenges, and priority needs. J
World Health Organization, Geneva Infect Dis 205(Suppl 2):S228–S240
2. Zumla A et al (2012) Drug-resistant tubercu- 3. Watterson SA, Drobniewski FA (2000) Mod-
losis--current dilemmas, unanswered ern laboratory diagnosis of mycobacterial
infections. J Clin Pathol 53(10):727–732
36 Mariana Piuri and Graham F. Hatfull
Abstract
Bacteriophages have been used for diagnostic purposes in the past, but a lack of parallelizable engineering
methods had limited their applicability to a narrow subset of diagnostic settings. More recently, however,
advances in DNA sequencing and the introduction of more sensitive reporter systems have enabled novel
engineering methods, which in turn have broadened the scope of modern phage diagnostics. Here we
describe advanced methods to engineer the genomes of bacteriophages in a modular and rapid fashion.
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_3, © Springer Science+Business Media, LLC, part of Springer Nature 2019
37
38 Daniel Brownell et al.
essential genes and very little noncoding DNA. This feature can
make it difficult to find acceptable sites for engineering modifica-
tions that are aimed at either inserting heterologous sequence or
replacing parts of the genome [7].
One approach for cloning bacteriophage DNA relies on isolat-
ing bacteriophage DNA, cutting the DNA with restriction
enzymes, ligating the heterologous sequence and transforming
the DNA back into the host either for assembly of the engineered
phage [8]. A second approach is to clone a smaller segment of a
bacteriophage genome into a plasmid, modify this segment by
adding a heterologous sequence, transform this modified plasmid
into the appropriate bacterial host strain and then infect the host
with wild type phage. At some low frequency, homologous recom-
bination between the bacteriophage genome and the plasmid will
occur resulting in the insertion of the heterologous sequence into
the wild-type phage genome [9]. Screening the phage progeny for
the recombinant phenotype will reveal the engineered phages.
While these basic techniques have succeeded in a number of
isolated instances, they also have a number of limitations. For
instance, prior to functionally testing a recombinant phage isolate’s
diagnostic properties, the phage sample must undergo thorough
genotypic characterization to ensure that its DNA was modified as
intended. In addition, for each engineered variant created or new
insertion site tested the whole engineering process must be
repeated from beginning to end [1, 9]. To overcome these limita-
tions, we have introduced several improvements into this engineer-
ing protocol to make it faster and more efficient [10, 11]. This
improved protocol we call Phage-Infective Engineering (PIE,
Fig. 1) [10, 11].
To engineer the phage, we create a Phage Targeting Vector
(PTV), which consists of a reporter gene (luciferase) flanked by
about 1 kb of bacteriophage genomic sequence, corresponding to
the loci directly upstream and downstream of the desired insertion
site. The PTVs are assembled from PCR fragments, which are
amplified using primers that deliberately incorporate 20 bp of over-
lapping sequence into each pair of adjacent insert fragments in
order to facilitate assembly via recombination-based cloning
methods [12].
2 Materials
Fig. 1 Schematic of phage infective engineering (PIE) workflow. Recombination-based cloning methods are
used to construct the phage targeting vector (PTV) in which a reporter gene (green arrow), such as luciferase,
is flanked by ~1 kb of DNA sequence homologous to the upstream (UHR, yellow rectangle) and downstream
(DHR, blue rectangle) regions of the phage chromosome that is targeted for modification. This vector is
transformed into a permissive bacterial host strain. Subsequently, the strain is infected with wild-type phage.
During the course of infection, there is a low probability that a double-crossover homologous recombination
event occurs between the PTV and the wild-type phage DNA that results in the insertion of reporter gene
sequence into the phage genome. These recombinant phage genomes, which express the reporter gene
phenotype, are typically a minority among those present during the cycle of infection, and so viral packaging
yields a mixed pool containing few recombinant phage virions among mostly wild-type phage virions. Iterative
rounds of screening and enrichment for the recombinant phages are then performed until a pure monoclonal
sample is obtained and subsequently amplified (see Fig. 2 for greater detail on enrichment procedures)
2.1 Materials for l Phusion® High-Fidelity PCR Master Mix with HF Buffer.
Construct Design and – M0531S, New England Biolabs, USA.
Assembly l Primers, 25 nM, standard desalting.
– Integrated DNA Technologies, USA.
l Mastercycler pro and Control Panel.
– 6321 000.515, Eppendorf, USA
l GeneArt® Seamless Cloning and Assembly Kit.
– A13288, Thermo Fisher Life Technologies, USA.
l Base plasmid pMK4 or other gram-negative/gram-positive
shuttle vector.
– ATCC 37315.
l One Shot® TOP10 Chemically Competent E. coli.
– C4040-10, Thermo Fisher Life Technologies, USA.
40 Daniel Brownell et al.
3 Methods
3.1 Targeting DNA To target the reporter to a specific location in the phage genome, a
Vector Design and plasmid must be created that contains the reporter gene flanked by
Assembly specific upstream and downstream homology regions. To maximize
recombination efficiency, homology fragments are typically
3.1.1 Design designed to be ~1 kb in length. Desired promoter(s), ribosome
binding site(s), and spacer region(s) can be easily introduced into
the junctions between upstream, reporter, and downstream DNA
fragments with PCR primers. This plasmid, once assembled, will
allow site-specific recombination of the reporter gene into the locus
of interest to occur. In this protocol we describe the introduction of
a promoterless luciferase gene into the phage genome downstream
of the major capsid protein of the Listeria phage A511 [10, 11, 13].
3.2 Assembly, In this section, we describe the propagation of the PTV in the
Transformation and E. coli host followed by transfer to the Listeria host.
Propagation in Host
Strains
3.2.1 Assembly l Amplify the required fragments using PCR according to 2 Phu-
sion Master Mix protocol.
l Linearize the vector (pMK4) by digestion with SmaI and PstI.
l Assemble the final vector by mixing three amplified fragments
with the linearized vector using a homology-based assembly kit
(GeneArt Seamless Cloning kit, Thermo Fisher Scientific).
3.2.2 Transformation The GeneArt Seamless cloning kit includes TOP10 chemically
competent cells. If using a different assembly kit follow the instruc-
tions for that kit.
l Add 6–8 μL of the seamless cloning and assembly reaction into a
vial of One Shot® TOP10 chemically competent E. coli and mix
gently by swirling.
l IMPORTANT! Do not mix by pipetting up and down. Note: If
you are performing transformation control, add 2.5 μL of
pUC19 Control DNA into a separate vial of One Shot®
TOP10 chemically competent E. coli and follow the transforma-
tion procedure.
l Incubate the transformation mix on ice for 20 to 30 min.
l Heat-shock the cells for 30 s at 42 C without shaking.
l Immediately transfer the tubes to ice and incubate on ice for
2 min.
42 Daniel Brownell et al.
3.2.3 E. coli: PTV To screen for colonies containing the correctly assembled vector, it
Screening is expedient to carry out a colony PCR with the primers flanking the
desired insert. However, we routinely use a faster, more higher-
Screening
throughput method for the initial screening of transformants that
takes advantage of the strong and constitutive expression of the
reporter NanoLuc luciferase gene with in the E. coli host.
l Prepare a microcentrifuge tube with 50 μL of LB medium for
each of the colony to be screened.
l Pick each colony to be tested with a sterile P200 pipette tip and
place it into the prepared microcentrifuge tube. Mix the content
of the tube well by vortexing for 10 s. Use the obtained colony
suspension for all subsequent steps.
l Transfer 5 μL of each of the resuspended colonies into its own
well of a Lumitrac 200 medium 96-well binding plate, retain the
remainder colony suspension for future steps.
l Prepare a Nano-Glo® reagent according to the manufacturer
instructions.
l Add 5 μL of Nano-Glo® to each well.
l Measure the luminescence on a Promega GloMax96 lumin-
ometer using the built-in “SteadyGlo” protocol (1 s integra-
tion), or equivalent.
l Those colonies that exhibit prominent brightness during this
screen are likely to harbor the correctly assembled vector. This
shall be confirmed by colony PCR and sequencing using the
reserved colony suspension as the template.
l Culture those clones for which sequencing confirms that their
plasmids had assembled correctly by inoculating LB supplemen-
ted with the appropriate antibiotic.
l Prepare the plasmid using a QIAGEN maxi-prep kit.
Engineering Bacteriophage-Based Biosensors 43
3.2.4 Listeria: In Vivo After assembly and sequence verification of the recombination
Recombination plasmid, it must be transferred in to an appropriate host for the
phage of interest. In this example, A511 can infect the Listeria
monocytogenes strain EGD-e (ATCC BAA-679). Competent cells
must be prepared and transformed prior to recombination.
3.4 Test Infection To determine if the marker has recombined into the phage, a test
infection must be performed. If the recombinant lysate can produce
signal upon infection of wild-type cells, recombination has
occurred and the enrichment process can begin.
l Prepare an infection of wild-type EGD-e cells by mixing 190 μL
of 0.5 BHI with 5 μL of the recombinant lysate from Subhead-
ing 3.3 and 5 μL of an overnight culture of EGD-e.
Engineering Bacteriophage-Based Biosensors 45
3.5 Enrichment l Prepare the phage bacterial host cell culture in advance, so that it
reaches log phase (an OD600 of 0.2) prior to the start of enrich-
ment procedure.
l Prepare different phage dilutions according to Table 1. Dispos-
able reservoirs are a good choice for preparation of the mixtures
if multichannel pipettes are to be used.
l Pipette 200 μL of the solution containing the highest C[phage]
into each well of the top three rows of the first 96-well plate.
l Pipette 200 μL of the solution containing the intermediate C
[phage] into each well of the bottom five rows of the first
96-well plate.
l Pipette 200 μL of the solution containing the lowest C[phage]
into each well of the second plate (Fig. 2).
l Cover the plates to minimize evaporation and incubate over-
night at 26–28 C.
l On the next day, follow the screening protocol for luminescence;
mix 5 μL from the test well with 25 μL of Nano-Glo® substrate.
Measure the bioluminescence using the GloMax 96 lumin-
ometer as before.
Table 1
Recipe for preparation of different phage dilutions
Fig. 2 Schematic representation of iterations of enrichment procedure. Orange wells represent bioluminescent
wells that contain recombinant phage. Before the sufficient dilution of phage is achieved the enrichment has to
be repeated decreasing the phage concentration in each round as depicted here: the highest phage
concentration used in enrichment (B) is 10 lower compare to the lowest phage concentration of the initial
enrichment (A). As more rounds of enrichment are performed, the frequency of occurrence of wells with
recombinant phage shall increase. As depicted on the schematic, the number of wells showing bright
bioluminescence has increased in enrichment B compared to initial enrichment A
Fig. 3 Images of the plated plaques. (a) Colorimetric image, plaques present as white/clear spots in the image,
while the nonlysed bacterial lawn is opaque and shows shading due to polymerization artifacts of the top agar.
(b) Chemiluminescent image, exposed for 10 s using the Bio-Rad XRS+ ChemiDoc system. (c) Composite
image, artificially colored using the ImageLab software package. This image highlights the difference between
wild-type (nonluminescent) and recombinant (luminescent) plaques. The arrow on panels (a) and (c) shows a
well-isolated, recombinant plaque
3.5.1 Plating of l Prepare serial dilutions of the recombinant lysate (range of dilu-
Recombinant Lysate tions) and plate those onto 0.5 BHI agar plates using the top
agar overlay method.
l Incubate plates overnight at 30 C.
3.5.3 Isolation of l Using a P1000 pipet tip attached to a P1000 pipet, puncture the
Recombinant Plaques agar to isolate the desired plaque (or zone of lysis), and then
eject the isolated plaque material in a microcentrifuge tube con-
taining 100 μL of 0.5 BHI broth.
l Pipet the mixture up and down to break up the agar and
homogenize the mixture.
l Incubate the mixture for 10 min at room temperature to allow
the phages to diffuse into the broth.
l Remove bacterial cells and debris by filtration through a 0.22 μm
syringe filter or by adding 10 μL of chloroform to the tube.
l Titer the filtrate to determine the phage concentration.
48 Daniel Brownell et al.
4 Notes
References
1. Loessner MJ, Rees CE, Stewart GS, Scherer S repressor, and increase host range and produc-
(1996) Construction of luciferase reporter bac- tivity of lytic infection. Microbiology
teriophage A511::luxAB for rapid and sensitive 159:1023–1035
detection of viable listeria cells. Appl Environ 8. Makowski L (1994) Phage display: structure,
Microbiol 62:1133–1140 assembly and engineering of filamentous bac-
2. Klumpp J, Loessner MJ (2014) In: teriophage M13. Curr Opin Struct Biol
Thouand G, Marks R (eds) Bioluminescence: 4:225–230
fundamentals and applications in biotechnol- 9. Pouillot F, Blois H, Iris F (2010) Genetically
ogy—volume 1. Springer, Berlin Heidelberg, engineered virulent phage banks in the detec-
p 155–171. http://link.springer.com/chap tion and control of emergent pathogenic bac-
ter/10.1007/978-3-662-43385-0_5 teria. Biosecurity Bioterrorism Biodefense
3. Loessner MJ, Rudolf M, Scherer S (1997) Strategy Pract Sci 8:155–169
Evaluation of luciferase reporter bacteriophage 10. Koeris MS, Shivers RP, Brownell, DR, Holder
A511::luxAB for detection of Listeria monocy- JW, Bowers JL (2014) Recombinant phage and
togenes in contaminated foods. Appl Environ bacterial detection methods. http://www.
Microbiol 63:2961–2965 google.com/patents/US20140302487
4. Lu TK, Bowers J, Koeris MS (2013) Advancing 11. Lu TKT et al (2013) Recombinant phage and
bacteriophage-based microbial diagnostics methods. http://www.google.com/patents/
with synthetic biology. Trends Biotechnol US20130122549
31:325–327 12. Gibson DG et al (2009) Enzymatic assembly of
5. Karlin S, Burge C, Campbell AM (1992) Sta- DNA molecules up to several hundred kilo-
tistical analyses of counts and distributions of bases. Nat Methods 6:343–345
restriction sites in DNA sequences. Nucleic 13. Klumpp J et al (2008) The terminally redun-
Acids Res 20:1363–1370 dant, nonpermuted genome of Listeria bacteri-
6. Gelfand MS, Koonin EV (1997) Avoidance of ophage A511: a model for the SPO1-like
palindromic words in bacterial and archaeal myoviruses of gram-positive bacteria. J Bacter-
genomes: a close connection with restriction iol 190:5753–5765
enzymes. Nucleic Acids Res 25:2430–2439 14. Monk IR, Gahan CGM, Hill C (2008) Tools
7. Zhang H, Fouts DE, DePew J, Stevens RH for functional postgenomic analysis of Listeria
(2013) Genetic modifications to temperate monocytogenes. Appl Environ Microbiol
Enterococcus faecalis phage ϕEf11 that abolish 74:3921–3934
the establishment of lysogeny and sensitivity to
Chapter 4
Abstract
Electroporation has been an established tool for DNA delivery into prokaryotic and eukaryotic cells, thus
facilitating basic research studies and improving medical treatments. Here we describe its use for introduc-
tion of phage genomic DNA into Escherichia coli cells, including preparation of electrocompetent cells,
electric pulse optimization and recovery of electrotransformed cells. The technique can also be adapted for
other bacterial species.
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_4, © Springer Science+Business Media, LLC, part of Springer Nature 2019
51
52 Nika Janež et al.
2 Materials
2.1 Preparation of 1. Suitable host E. coli strain, e.g., DSM 4230 (see Note 1).
Electrocompetent Cells 2. Lysogeny Broth (LB) agar plates: prepare the medium accord-
ing to the manufacturer’s instructions, add 15 g/L technical
agar and heat-sterilize. Aliquot 18–25 mL to sterile petri dishes
and allow to solidify at room temperature.
3. Prewarmed LB broth (see above Subheading 2.)
4. Cultivation flasks.
5. Incubator or warm water bath set to 37 C with shaker.
6. Spectrophotometer to measure OD600.
7. Ice.
8. 50 mL sterile plastic tubes suitable for centrifugation
9. Centrifuge.
10. Ice-cold sterile distilled water.
11. 10% (v/v) ice-cold sterile glycerol
12. Cryovials.
13. Freezer 20 C (for short time storage) or 80 C (for long
time storage).
Electroporation of phageDNA into E. coli 53
3 Methods
4 Notes
5. Make sure that cuvette is dry from outside and sample equally
distributed between electrodes in the cuvette, without bubbles
that may be formed during pipetting. It is advised to use each
time a new cuvette, because cleaning may cause changes on the
electrodes and subsequently affect pulse application.
6. To electrotransform the same E. coli strain with 4 kb plasmid
1 1 ms, 2 kV, 1 Hz pulse is applied.
7. Here bacterial culture is mixed with overlay agar similarly as in
protocol for double agar overlay technique. Please see for
details reference [9].
References
1. Kotnik T, Kramar P, Pucihar G, Miklavčič D, Saunders JA, Chassy BM, Sowers AE (eds)
Tarek M (2012) Cell membrane electropora- Guide to electroporation and electrofusion. Aca-
tion—Part 1: the phenomenon. IEEE Electr demic Press, San Diego
Insul Mag 28:14–23 6. Pucihar G, Krmelj J, Rebersek M, Batista
2. Satkauskas S, Ruzgys P, Venslauskas MS (2012) Napotnik T, Miklavcic D (2011) Equivalent
Towards the mechanisms for efficient gene pulse parameters for electroporation. IEEE
transfer into cells and tissues by means of cell Trans Biomed Eng 58:3279–3288
electroporation. Expert Opin Biol Ther 7. Lelieveld HLM, Notermans S, de Haan SWH
12:275–286 (eds) (2007) Food preservation by pulsed elec-
3. Lu Y-P, Zhang C, Lv FX, Bie XM, Lu Z-X tric fields. Woodhead Publishing, Abington
(2012) Study on the electro-transformation 8. Flisar K, Haberl Meglič S, Morelj J, Golob J,
conditions of improving transformation effi- Miklavčič D (2014) Testing a prototype pulse
ciency for Bacillus subtilis. Lett Appl Microbiol generator for a continuous flow system and its
55:9–14 use for E. coli inactivation and microalgae lipid
4. Rivera AL, Magaña-Ortı́z D, Gómez-Lim M, extraction. Bioelectrochemistry 100:44–51
Fernández F, Loske AM (2014) Physical meth- 9. Kropinski AM, Mazzocco A, Waddell TE,
ods for genetic transformation of fungi and Lingohr E, Johnson RP (2009) Enumeration
yeast. Phys Life Rev 11:184–203 of bacteriophages by double agar overlay plaque
5. Dower WJ, Chassy BM, Trevors JT, Blaschek assay. In: Clokie MRJ, Kropinski AM (eds) Bac-
HP (1992) Protocols for the transformation of teriophages: volume 1: isolation, characterisa-
bacteria by electroporation. In: Chang DC, tion and interactions. Humana Press, New York
Chapter 5
Abstract
This chapter describes the procedure that we have used to introduce suppressible nonsense mutations into
various genes of Bacillus subtilis bacteriophage SPO1. The targeted gene is cloned in a B. subtilis/Escher-
ichia coli shuttle vector. Using an in vitro enzymatic procedure dependent on mutant oligonucleotide
primers, a mutation is inserted into the cloned gene, replacing an early lysine codon (AAA or AAG) with a
nonsense codon (TAG or TAA). The mutant plasmid is recovered by transformation into E. coli, and is then
transformed into B. subtilis carrying a suppressor that inserts lysine at TAG or TAA codons. Recombination
is allowed between the mutant plasmid and superinfecting wild-type SPO1, and mutant progeny phage are
identified by plaque-lift hybridization to labeled oligonucleotides having the mutant sequence. This
procedure is adaptable for other types of mutations, and for other phage–bacteria combinations for
which appropriate strains and plasmids are available.
Key words Site-specific mutagenesis, Bacteriophage SPO1, Bacillus subtilis, Primer-directed muta-
genesis, Recombination, Hybridization
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_5, © Springer Science+Business Media, LLC, part of Springer Nature 2019
57
58 Charles R. Stewart
2 Materials
2.1 B. subtilis CB313 and CB10 are the SU+ (suppressor plus) and Su strains,
Strains respectively [4]. The suppressor in CB313 inserts lysine at nonsense
codons [5].
2.2 Cloning Vector The primary B. subtilis/E. coli shuttle vector that we have used is
pPW19, previously described by Wei and Stewart [6]. It has a
selectable chloramphenicol-resistance gene, and an IPTG-inducible
promoter just upstream of its polylinker.
2.3 Growth Media 1. TSA plates: 40 g trypticase soy agar (BBL), 1 L water. This is
used for plating for colonies and as bottom agar for plating
phage.
2. TC plates: TSA plates containing 10 μg/ml of chloramphenicol
(Cm).
3. TC2 plates: TSA plates containing 20 μg/ml of Cm.
4. TBAB top agar: 15.4 g Tryptose Blood Agar Base (Difco), 1 L
water. This is used as top agar for plating phage for plaque
formation.
5. VY broth: 25 g Veal Infusion Broth (Difco), 5 mg yeast extract
(Difco), 1000 ml water.
6. Penassay Broth: 17.5 mg Antibiotic Medium 3 (Difco),
1000 ml water.
3 Methods
3.1 Clone the Gene The cloning vector used is pPW19, as described above. We have
to Be Mutated usually made the fragment to be cloned by PCR amplification from
an SPO1 genomic DNA template. The restriction site to be used
for cloning is included near the 50 end of each PCR primer. The
longer the distance from the mutation site to the ends of the PCR
fragment, the greater will be the frequency of recombination. As a
result a smaller number of plaques need to be tested for the pres-
ence of the mutation. However, several of our genes had nearby
promoters whose presence on a fragment precluded its cloning, so
quite short distances have been used successfully. In one case, a
fragment with 108 and 760 bp to the left and right of the mutation
site, respectively, produced a frequency of 0.4% mutants among the
plaques tested. We have obtained significant recombination fre-
quencies with one end as short as 63 bp.
3.2 Mutate the We have used the QuikChange II Site-Directed Mutagenesis Kit,
Cloned Gene In Vitro available from Agilent Technologies (formerly Stratagene). Oligo-
nucleotides including the mutant codon are used as primers for
in vitro amplification of the plasmid. Any remaining wild-type
plasmids are inactivated by cleavage by DpnI, which is specific for
methylated and hemimethylated DNA. The mutant plasmids are
then transformed into E. coli XL1-Blue (competent cells are sup-
plied with the kit), where the nicks are repaired. Since detailed
protocols are provided with the kit, I will only describe modifica-
tions in the protocol that have given us improved results.
1. Choice of mutant codon. Each of our mutations has converted
an early lysine codon (AAA or AAG) into a nonsense codon
(TAG or TAA). We have usually made the mutation that
involves changing two nucleotides, to maximize the
60 Charles R. Stewart
3.3 Transformation The mutant plasmids are transferred from the E. coli XL1-Blue cells
of the Mutant Plasmid into B. subtilis CB313, the Su+ strain, for use in recombination with
into the B. subtilis Host superinfecting SPO1.
3.4 Recombine the The procedure for recombination between the mutant plasmid and
Mutation into the SPO1 wild-type SPO1 is a modification of the procedure first described by
Genome Sayre and Geiduschek [7]. For production of multiple mutants, it
can be modified by using a mutant strain of SPO1 as the infecting
phage.
1. Grow CB313 carrying the cloned mutant gene, on a 37
shaker, in 10 ml VY plus 5 μg/ml Cm, in a 250 ml Klett flask,
labeled flask 1, to a cell density of about 5 107/ml. Plate an
appropriate dilution for colonies on TC plates to get a precise
count (see Notes 2 and 3).
2. As soon as the first dilution has been prepared for that plating,
infect flask 1 with about 5 108 SPO1 wt. The objective is to
have the multiplicity of infection (MOI) be approximately 1.
3. After shaking 5 min at 37 C, plate again for colonies as in
paragraph 1, to determine the number of surviving cells, and
thus the actual effective MOI (see Note 4).
4. Continue shaking 10 more minutes at 37 C. Dilute 0.2 ml
from flask 1 into flask 2, a 250 ml Erlenmeyer containing
Site-Specific Mutagenesis of Bacillus subtilis Phage SPO1 61
3.5 Identify the If the targeted mutation has a predictable and readily testable
Mutant Phage by phenotype, it would be easiest to identify mutant plaques by testing
Plaque-Lift for that phenotype. Most of our mutations were not in that cate-
Hybridization gory. Since comprehensive searches for conditional lethal mutants
had previously identified most essential SPO1 genes, we assumed
(correctly as it turned out) that the additional genes that we were
targeting would not be essential, and thus not readily identifiable by
their plaque-forming capabilities. Therefore, we have used
sequence-specific hybridization to identify unequivocally the pla-
ques having the mutant sequence, and growth on the suppressor
strain to assure that the mutations did not restrict plaque
formation.
1. Preparation of plaque-lift filters (see Note 6).
(a) We use the BA85, 82 mm diameter, nitrocellulose mem-
brane filters, available from GE Healthcare. Preferably, use
62 Charles R. Stewart
4 Notes
References
1. Campbell A (1961) Sensitive mutants of bacteri- lysine insertion at ochre codons. J Bacteriol
ophage lambda. Virology 14:22–32 171:5322–5324
2. Edgar RS, Denhardt GH, Epstein RH (1964) A 6. Wei P, Stewart CR (1993) A cytotoxic early gene
comparative study of conditional lethal mutations of Bacillus subtilis bacteriophage SPO1. J Bac-
of bacteriophage T4D. Genetics 49:635–648 teriol 175:7887–7900
3. Sampath A, Stewart CR (2004) Roles of genes 7. Sayre MH, Geiduschek EP (1988) TF1, the bac-
44, 50 and 51 in regulating gene expression teriophage SPO1-encoded type II DNA-binding
and host takeover during infection of Bacillus protein, is essential for viral multiplication. J Virol
subtilis by bacteriophage SPO1. J Bacteriol 62:3455–3462
186:1785–1792 8. Sambrook J, Russell DW (2001) Molecular
4. Glassberg JS, Franck M, Stewart CR (1977) cloning, a laboratory manual, 3rd edn. Cold
Initiation and termination mutants of Bacillus Spring Harbor Laboratory Press, Cold Spring
subtilis phage SPO1. J Virol 21:147–152 Harbor, New York
5. Mulbry WW, Ambulos NP, Lovett PS (1989)
Bacillus subtilis mutant allele sup3 causes
Chapter 6
Abstract
We describe a recombineering-based method for the genetic manipulation of lytically replicating bacter-
iophages, focusing on mycobacteriophages. The approach utilizes recombineering-proficient strains of
Mycobacterium smegmatis and employs a cotransformation strategy with purified phage genomic DNA
and a mutagenic substrate, which selects for only those cells that are competent to take up DNA. The
cotransformation method, combined with the high rates of recombination obtained in M. smegmatis
recombineering strains, allows for the efficient and rapid generation of bacteriophage mutants.
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_6, © Springer Science+Business Media, LLC, part of Springer Nature 2019
69
70 Laura J. Marinelli et al.
(plating cells) and soft agar. Plaques formed from the infectious
centers can then be screened by PCR to identify those containing
the mutant allele. Because recombination appears to use replicating
substrates, all plaques contain the wild-type allele, but mutant and
wild-type progeny can be easily separated by plaque isolation and
PCR. The efficiency of recombination is sufficiently high that,
provided the mutation does not interfere with lytic growth, only
12–18 plaques need to be tested in each of the two rounds of PCR.
2 Materials
2.3 Electrocom- 1. The recombineering plasmid pJV53 [11] (or another recombi-
petent Cell Preparation neering proficient plasmid).
2. M. smegmatis mc2155.
72 Laura J. Marinelli et al.
2.4 Transformation 1. Recombineering substrate and purified DNA from the phage
and Mutant Recovery to be modified.
2. Microcentrifuge tubes and electroporation cuvettes.
3. Electroporator.
4. 7H9 liquid media.
5. 0.1 M stock CaCl2, autoclave to sterilize.
6. Sterile Pasteur pipettes.
7. Mycobacterial top agar (MBTA): 7H9 with 0.7% Bacto agar,
autoclaved to sterilize.
8. 7H10 plates, containing 10% (v/v) ADC, CB (50 μg/ml),
CHX (10 μg/ml), and 1 mM CaCl2. Prepare media according
to manufacturer instructions, autoclave, and supplement with
ADC, CB, CHX, and CaCl2.
3 Methods
3.2 Design Primers 1. Primers should be approximately 25–30 nt, with a melting
for Mutant Screening temperature 60 C.
2. Flanking primers should anneal upstream and downstream of
deletion, insertion, or replacement in the phage genome and
should generate products, such that the mutant product can be
easily distinguished from the wild type (i.e., that are not too
similar in size) and neither product is too small (i.e., > 300 bp).
3. You may also order more selective primers that anneal either to
a specific tag sequence (inserted by the substrate), or across the
new junction created by the mutation, termed deletion ampli-
fication detection assay (DADA)-PCR [32]. Point mutations
can be engineered to insert a unique restriction site or can be
found using mismatch amplification mutation assay (MAMA)-
PCR [45].
4. Resuspend flanking primers to 100 μM in TE and dilute
in nuclease-free dH2O to make 10 μM stock.
4 Notes
11. This protocol routinely generates cells that yield 106 transfor-
mants/μg extrachromosomally replicating plasmid DNA. It is
also important to check the competency of the cells using the
DNA of the phage to be mutated. Ideally, 100–300 plaques
should be obtained from a transformation with 50–150 ng
phage DNA alone. The amount of phage DNA can be increased
to generate more plaques if necessary, but this should be done
without adding large volumes of DNA to the transformation.
12. The time constant is important, particularly when transform-
ing large DNAs, such as phage genomic DNA. This should be
>18 ms; 19–21 ms is best. Time constants <18 ms will result in
very few to no plaques. Inadequate washing of the competent
cells or the presence of salt in either the phage DNA or the
substrate will adversely affect time constants, which is why all
DNA used in transformations should be resuspended in sterile
dH2O. Ideal time constants range from 19–22 ms but will
decrease as larger volumes of DNA are added to the reaction,
likely due the presence of residual salts. If addition of substrate
is lowering time constants below 18 ms, there are a few trou-
bleshooting options: (1) add less substrate (deletions can be
made with as little as 100 ng of substrate DNA; although it is
somewhat less efficient); (2) dilute the competent cells with
ice-cold water (low time constants may be a result of cells that
are too concentrated); (3) remake the substrate so that it is
more concentrated.
13. BRED employs a cotransformation strategy that uses phage
DNA to select against nontransformable cells, and transforma-
tions are plated prior to host cell lysis. This ensures only cells
competent to take up DNA will give rise to infectious centers
(termed “primary plaques”). Depending on the method of
screening, ~5–50% of the primary plaques will contain a mix-
ture of mutant and wild-type DNA.
14. Plating mix amounts given are for one plate; this should be
scaled up for multiple recoveries.
15. Mutant phage are isolated by replating one of the primary
“mixed” plaques containing a high proportion of the mutant
allele, and screening the “secondary” plaques by PCR. If the
mutant is viable, a proportion of these will contain a pure
population of mutant. It is also helpful to make a lysate from
a plate containing approximately 1000–5000 secondary pla-
ques. If the mutation is in an essential gene, the mutant prod-
uct will no longer be present when this lysate is analyzed by
flanking primer PCR. Mutants in essential genes can often be
isolated by complementation using a strain of M. smegmatis
expressing a wild-type copy of the mutated gene [32].
16. Mutant products that are larger than the WT product (such as
insertions) may be difficult to detect with flanking primers, and
BRED Recombineering 79
Acknowledgments
References
1. Hatfull GF, Hendrix RW (2011) Bacterio- 9. Piuri M, Hatfull GF (2006) A peptidoglycan
phages and their genomes. Curr Opin Virol hydrolase motif within the mycobacteriophage
1:298–303 TM4 tape measure protein promotes efficient
2. Katsura I (1976) Isolation of lambda prophage infection of stationary phase cells. Mol Micro-
mutants defective in structural genes: their use biol 62:1569
for the study of bacteriophage morphogenesis. 10. Martel B, Moineau S (2014) CRISPR-Cas: an
Mol Gen Genet MGG 148:31 efficient tool for genome engineering of viru-
3. Katsura I, Hendrix RW (1984) Length deter- lent bacteriophages. Nucleic Acids Res 42:9504
mination in bacteriophage lambda tails. Cell 11. van Kessel JC, Hatfull GF (2007) Recombi-
39:691 neering in Mycobacterium tuberculosis. Nat
4. Selick HE, Kreuzer KN, Alberts BM (1988) Methods 4:147
The bacteriophage T4 insertion/substitution 12. van Kessel JC, Hatfull GF (2008) Efficient
vector system. A method for introducing site- point mutagenesis in mycobacteria using
specific mutations into the virus chromosome. single-stranded DNA recombineering: charac-
J Biol Chem 263:11336 terization of antimycobacterial drug targets.
5. Struthers-Schlinke JS, Robins WP, Kemp P, Mol Microbiol 67:1094
Molineux IJ (2000) The internal head protein 13. van Kessel JC, Hatfull GF (2008) Mycobacterial
Gp16 controls DNA ejection from the bacteri- recombineering. Methods Mol Biol 435:203
ophage T7 virion. J Mol Biol 301:35 14. van Kessel JC, Marinelli LJ, Hatfull GF (2008)
6. Moak M, Molineux IJ (2000) Role of the Recombineering mycobacteria and their
Gp16 lytic transglycosylase motif in bacterio- phages. Nat Rev Microbiol 6:851
phage T7 virions at the initiation of infection. 15. Court DL, Sawitzke JA, Thomason LC (2002)
Mol Microbiol 37:345 Genetic engineering using homologous
7. Oppenheim AB, Rattray AJ, Bubunenko M, recombination. Annu Rev Genet 36:361
Thomason LC, Court DL (2004) In vivo 16. Little JW (1967) An exonuclease induced by
recombineering of bacteriophage lambda by bacteriophage lambda. II. Nature of the enzy-
PCR fragments and single-strand oligonucleo- matic reaction. J Biol Chem 242:679
tides. Virology 319:185 17. Joseph JW, Kolodner R (1983) Exonuclease
8. Murray NE (2006) The impact of phage VIII of Escherichia coli. II. Mechanism of
lambda: from restriction to recombineering. action. J Biol Chem 258:10418
Biochem Soc Trans 34:203
80 Laura J. Marinelli et al.
18. Datsenko KA, Wanner BL (2000) One-step recombinant bacteriophage genomes. PLoS
inactivation of chromosomal genes in Escher- One 3:e3957
ichia coli K-12 using PCR products. Proc Natl 33. Marinelli LJ, Hatfull GF, Piuri M (2012)
Acad Sci U S A 97:6640 Recombineering: a powerful tool for modifica-
19. Yu D et al (2000) An efficient recombination tion of bacteriophage genomes. Bacteriophage
system for chromosome engineering in Escher- 2:5
ichia coli. Proc Natl Acad Sci U S A 97:5978 34. Payne K, Sun Q, Sacchettini J, Hatfull GF
20. Hall SD, Kolodner RD (1994) Homologous (2009) Mycobacteriophage Lysin B is a novel
pairing and strand exchange promoted by the mycolylarabinogalactan esterase. Mol Micro-
Escherichia coli RecT protein. Proc Natl Acad biol 73:367
Sci U S A 91:3205 35. Catalao MJ, Gil F, Moniz-Pereira J, Pimentel
21. Kolodner R, Hall SD, Luisi-DeLuca C (1994) M (2010) The mycobacteriophage Ms6
Homologous pairing proteins encoded by the encodes a chaperone-like protein involved in
Escherichia coli recE and recT genes. Mol the endolysin delivery to the peptidoglycan.
Microbiol 11:23 Mol Microbiol 77:672
22. Noirot P, Kolodner RD (1998) DNA strand 36. Catalao MJ, Milho C, Gil F, Moniz-Pereira J,
invasion promoted by Escherichia coli RecT Pimentel M (2011) A second endolysin gene is
protein. J Biol Chem 273:12274 fully embedded in-frame with the lysA gene of
23. Li Z, Karakousis G, Chiu SK, Reddy G, Rad- mycobacteriophage Ms6. PLoS One 6:e20515
ding CM (1998) The beta protein of phage 37. Catalao MJ, Gil F, Moniz-Pereira J, Pimentel
lambda promotes strand exchange. J Mol Biol M (2011) Functional analysis of the holin-like
276:733 proteins of mycobacteriophage Ms6. J Bacter-
24. Rybalchenko N, Golub EI, Bi B, Radding CM iol 193:2793
(2004) Strand invasion promoted by recombi- 38. Savinov A, Pan J, Ghosh P, Hatfull GF (2012)
nation protein beta of coliphage lambda. Proc The Bxb1 gp47 recombination directionality
Natl Acad Sci U S A 101:17056 factor is required not only for prophage exci-
25. Murphy KC (1998) Use of bacteriophage sion, but also for phage DNA replication. Gene
lambda recombination functions to promote 495:42
gene replacement in Escherichia coli. J Bacter- 39. Jacobs-Sera D et al (2012) On the nature of
iol 180:2063 mycobacteriophage diversity and host prefer-
26. Zhang Y, Buchholz F, Muyrers JP, Stewart AF ence. Virology 434:187
(1998) A new logic for DNA engineering using 40. Dedrick RM et al (2013) Functional require-
recombination in Escherichia coli. Nat Genet ments for bacteriophage growth: gene essenti-
20:123 ality and expression in mycobacteriophage
27. Muyrers JP, Zhang Y, Testa G, Stewart AF Giles. Mol Microbiol 88:577
(1999) Rapid modification of bacterial artificial 41. da Silva JL et al (2013) Application of BRED
chromosomes by ET-recombination. Nucleic technology to construct recombinant D29
Acids Res 27:1555 reporter phage expressing EGFP. FEMS
28. Murphy KC, Campellone KG, Poteete AR Microbiol Lett 344:166
(2000) PCR-mediated gene replacement in 42. Piuri M, Rondon L, Urdaniz E, Hatfull GF
Escherichia coli. Gene 246:321 (2013) Generation of affinity-tagged fluoro-
29. Ellis HM, Yu D, DiTizio T, Court DL (2001) mycobacteriophages by mixed assembly of
High efficiency mutagenesis, repair, and engi- phage capsids. Appl Environ Microbiol
neering of chromosomal DNA using single- 79:5608
stranded oligonucleotides. Proc Natl Acad Sci 43. Feher T, Karcagi I, Blattner FR, Posfai G
U S A 98:6742 (2012) Bacteriophage recombineering in the
30. Lee EC et al (2001) A highly efficient Escher- lytic state using the lambda red recombinases.
ichia coli-based chromosome engineering sys- Microb Biotechnol 5:466
tem adapted for recombinogenic targeting and 44. Shin H, Lee JH, Yoon H, Kang DH, Ryu S
subcloning of BAC DNA. Genomics 73:56 (2014) Genomic investigation of lysogen for-
31. Muyrers JP, Zhang Y, Stewart AF (2001) Tech- mation and host lysis systems of the Salmonella
niques: recombinogenic engineering—new temperate bacteriophage SPN9CC. Appl Envi-
options for cloning and manipulating DNA. ron Microbiol 80:374
Trends Biochem Sci 26:325 45. Swaminathan S et al (2001) Rapid engineering
32. Marinelli LJ et al (2008) BRED: a simple and of bacterial artificial chromosomes using oligo-
powerful tool for constructing mutant and nucleotides. Genesis 29:14
Chapter 7
Abstract
Phage recovery from various solutions, including physiological samples, as well as phage purification from
crude lysates often requires a specific isolation method. Here, we demonstrate that T4-like phages can be
efficiently isolated by affinity chromatography. This approach employs specific affinity tags (GST (glutathi-
one S-transferase) or His-tag) that allow for the isolation of the phage. These affinity tags are exposed on
the phage head using phage display. By combining competitive phage display and affinity chromatography,
wild-type phages can be specifically recovered from mixtures with other phage/s, from solutions of very low
phage concentration, or purified from crude phage lysates.
Key words Phage purification, Affinity chromatography, Competitive phage display, T4 bacterio-
phage, Hoc protein, Escherichia coli
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_7, © Springer Science+Business Media, LLC, part of Springer Nature 2019
81
82 Krystyna Da˛browska
Fig. 1 Schematic diagram of the steps involved in affinity purification of phage [9]
Isolation of Competitive Phage Display-Modified Bacteriophage T4. . . 83
2 Materials
2.1 Phage Display 1. Expression vector containing hoc gene of T4 phage fused
Components 50 -terminally to GST- or His-tag-coding sequence (see Note 1).
2. Selection antibiotic suitable for the expression vector used in
the procedure (according to vector manufacturer’s
information).
3. Inducer of protein expression suitable for the expression vector
used in the procedure (according to vector manufacturer’s
information, e.g., IPTG 0.5 mM).
4. Host bacteria: Escherichia coli expression strain sensitive to T4
phage (e.g., E. coli expression strain B834, Novagen; EMD
Millipore Corporation; http://www.emdmillipore.com/) (see
Note 2).
5. T4 bacteriophage in a liquid culture (see Note 3).
6. Culture medium LB: casein enzymic hydrolysate 10.0 g/l,
yeast extract 5.0 g/l, sodium chloride 10.0 g/l,
pH 7.5 0.2 at 25 C, optional: (1) selection antibiotic
adequate for the expression vector used in the procedure,
(2) agar 15 g/l for solid media in petri dishes.
7. Polyacrylamide gel electrophoresis of proteins: standard mate-
rials and reagents [10].
8. Baffled Erlenmeyer flasks 1 l.
9. Flask incubator with temperature regulation and shaking.
10. Sterile filters 0.22 μm (Millipore: Steritop bottle top filter) with
a vacuum pump and glass bottles.
2.2 Components for 1. Standard affinity chromatography resins adequate to the affin-
Affinity ity tag that is fused to the recombinant Hoc product: glutathi-
Chromatography one Sepharose for GST affinity tag, Ni-NTA agarose for
6-Histidine affinity tag.
2. Sodium phosphate buffer: 50 mM Na2HPO4, 300 mM NaCl,
pH 7.5.
84 Krystyna Da˛browska
3 Methods
4 Notes
References
1. Chibani Azaı̈ez SR, Fliss I, Simard RE et al alternative to CsCl gradient purification of bac-
(1998) Monoclonal antibodies raised against teriophage particles. Virology 434:265–270
native major capsid proteins of lactococcal 8. Oksanen HM, Domanska A, Bamford DH
c2-like bacteriophages. Appl Environ Micro- (2012) Monolithic ion exchange chro-
biol 64:4255–4259 matographic methods for virus purification.
2. Shelton CB, Crosslin DR, Casey JL et al Virology 434:271–277
(2000) Discovery, purification, and characteri- 9. Ceglarek I, Piotrowicz A, Lecion D et al
zation of a temperate transducing bacterio- (2013) A novel approach for separating bacter-
phage for Bordetella avium. J Bacteriol iophages from other bacteriophages using
182:6130–6136 affinity chromatography and phage display. Sci
3. McLaughlin MR, King RA (2008) Characteri- Rep 3:3220
zation of Salmonella bacteriophages isolated 10. Sambrook J, Russell DW (eds) (2001) Molec-
from swine lagoon effluent. Curr Microbiol ular cloning: a laboratory manual, 3rd edn.
56:208–213 Cold Spring Harbor Laboratory, New York
4. Boratyński J, Syper D, Weber-Dabrowska B 11. Adams MH (1956) Bacteriophages. Inter Sci-
et al (2004) Preparation of endotoxin-free bac- ence Publication, New York
teriophages. Cell Mol Biol Lett 9:253–259 12. Ren Z, Black LW (1998) Phage T4 SOC and
5. Brorson K, Shen H, Lute S et al (2008) Char- HOC display of biologically active, full-length
acterization and purification of bacteriophages proteins on the viral capsid. Gene
using chromatofocusing. J Chromatogr A 215:439–444
1207:110–121 13. Shivachandra SB, Li Q, Peachman KK et al
6. Kramberger P, Honour RC, Herman RE et al (2007) Multicomponent anthrax toxin display
(2010) Purification of the Staphylococcus aureus and delivery using bacteriophage T4. Vaccine
bacteriophages VDX-10 on methacrylate 25:1225–1235
monoliths. J Virol Methods 166:60–64 14. Jiang J, Abu-Shilbayeh L, Rao VB (1997) Dis-
7. Adriaenssens EM, Lehman SM, Vandersteegen play of a PorA peptide from Neisseria meningi-
K et al (2012) CIM(®) monolithic anion- tidis on the bacteriophage T4 capsid surface.
exchange chromatography as a useful Infect Immun 65:4770–4777
Chapter 8
Abstract
The natural specificity of bacteriophages toward their hosts represents great potential for the development
of platforms for the capture and detection of bacterial pathogens. Whole phage can carry reporter genes to
alter the phenotype of the target pathogen. Phage can also act as staining agents or the progeny of the
infection process can be detected. Alternatively, using phage components as probes offer advantages over
whole phage particles, including smaller probe size and resilience to desiccation. Phage structures can be
engineered for improved affinity, specificity, and binding properties. However, such concepts require the
ability to anchor phage and phage-components onto mechanical supports such as beads or flat surfaces. The
ability to orient the anchoring is desired in order to optimize binding efficiency. This chapter presents
various methods that have been employed for the attachment of phage and phage components onto
support structures such as beads, filters, and sensor surfaces.
Key words Campylobacter jejuni phage NCTC1267, ColorLok paper, Immobilization, Inkjet print-
ing, Paramagnetic silica beads, Receptor-binding proteins
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_8, © Springer Science+Business Media, LLC, part of Springer Nature 2019
89
90 Hany Anany et al.
area. Different tools can be used to have an estimate for the density
of the immobilized phage particles such as scanning electron
microscopy (SEM), atomic force microscopy (ATM) and evanes-
cent wave light scattering.
2.1.2 Methods (a) Separate magnetic silica beads (100 mg) from the storage
solution by centrifugation at 4000 g for 2 min, and wash
Paramagnetic Silica Beads
three times with 5 mL deionized water by multiple centrifuga-
Modification
tion steps, and then dry at 110 C under nitrogen for 1 h.
(b) Redisperse the beads in tetrahydrofuran (THF) containing
(3-aminopropyl triethoxylsilane (20% w/v, 5 mL) and the
suspension sonicate at room temperature for 2 h.
(c) Centrifuge at 4000 g for 2 min and then heat the mixture to
100 C under nitrogen for 1 h.
(d) Wash for five times with THF by centrifugation at 4000 g
for 2 min and then dry under vacuum for 10 h at 50 C to
remove residual THF.
(e) Measure the zeta potential of the modified silica beads at
25 C with a ZETA PALS instrument (Brookhaven Instru-
ments Corp., Holtsville, NY). Calculate the mean zeta poten-
tial for each batch of modified silica beads by suspending the
beads in 2 mM NaCl (the zeta potential of beads should be
around 18–20 mV).
(f) Store the dried APTS modified beads at 4 C until used for
phage immobilization.
Preparation of Phage (a) Propagate phage with its host as described in Volume 1,
Chapter 7.
(b) Purify the phage on a cesium chloride gradient as described in
Volume 2 Chapter 13, then titrate and store at 4 C.
92 Hany Anany et al.
Immobilization Step (a) Resuspend the dry paramagnetic modified silica beads
(PMSB) to a final concentration of 20 mg/mL and wash six
times with magnetic microfuge tube rack, Dynal MPC-S (Life
Technologies, Burlington, ON) using SM buffer without gel-
atin, (5.8 g NaCl, 4 g MgSO4.·7H2O, 50 mL 1 M Tris-Cl
pH 7.5, adjusted to pH 6.5 with HCl, final volume 1 L).
(b) Add 10 μL of purified phage (diluted to around to 106
PFU/mL) to 60 μL of washed PMSB beads and 930 μL of
SM buffer to achieve a final concentration of around 105
PFU/mL of phage.
(c) Rotate the phage-beads mixture for 24 h at 4 C using a
Boekel Scientific Orbitron Rotator II.
(d) Wash the immobilized phage five times in phage buffer (0.74 g
CaCl2, 2.5 g MgSO4·H2O, 0.05 g gelatin, 1 M Tris–HCl,
pH 7.0 in a final volume of 1 L of double deionized water) to
remove unbound phage particles from the beads using a mag-
netic microfuge tube rack and finally resuspended in 1 mL of
phage buffer.
(e) To determine the infectivity of the beads, concentrate the
phage-coated magnetic beads at the bottom of a microfuge
tube using the magnetic particle separator, and spot them
onto a fresh lawn of the host bacterium. A 30 μL aliquot of
free phage (105pfu/mL) should also be spotted onto the same
lawn of bacteria to gauge the infectivity of the phage-coated
magnetic beads. The infectivity of the immobilized phage can
be determined using a scale to indicate the extent of lysis,
where: 5+ ¼ complete lysis; 4+ ~75% lysis; 3+ ~50–75% lysis;
2+ ~25–50% lysis; 1+ < 25% lysis.
2.2.2 Methods (a) Propagate phage with its host as described in Volume 1,
Chapter 7.
(b) Prepare the phage containing bioink by adding Triton X-100
(2 mM) and glycerol (30% v/v) to phage lysate (109
Immobilization of Intact Phage and Phage-Derived Proteins for Detection. . . 93
2.2.3 Notes (a) A myovirus (rV5) isolated against E. coli O157:H7 [26], was
used for the whole phage immobilization experiment on mod-
ified paramagnetic silica beads and ColorLok cationic paper.
Optimization of the initial phage concentration is required for
other phages.
(b) Based on our current results using whole phage immobiliza-
tion protocols, it is recommended to use the immobilized
phages on PMSB for the detection (capturing) of the target
bacterium within 2 h after washing off excess phages. Storage
of the immobilized phages for more than 24 h will affect the
capture efficiency. On the other hand, the bioactive phage-
based paper can be stored for 1 week at 4 C in a container at
80–85% relative humidity.
94 Hany Anany et al.
Production Methods (a) Characterization and cloning of the gene encoding putative
Campylobacter cell binding protein Gp047 from C. jejuni
phage NCTC1267 were described previously [29].
(b) Transform the E. coli BL21 cells with the pGEX 6P-2 plasmid
containing the phage gene.
(c) Grow the 2 L culture of bacterial cells at 30 C to an OD600 of
0.5 using the LB medium with ampicillin.
(d) Induce the culture with 0.1 mM IPTG and incubate overnight
at 30 C with shaking at 250 rpm using the standard micro-
biological shaker.
(e) Harvest the cells by centrifugation using the conventional
procedure.
Production Methods (a) Selection and cloning of gene(s) encoding putative mycobac-
teriophage cell binding protein(s) were described previously
[30]. The appropriate gene was amplified directly from the
lysate of the mycobacteriophage L5. Cloning procedures were
performed using conventional methods;
98 Hany Anany et al.
Purification Methods (a) Resuspend the E. coli cells in 100 mL of ice-cold IMAC buffer
A with the protease inhibitor cocktail;
(b) Disrupt the cells by sonication using a conventional
procedure;
(c) Remove the cell debris by centrifugation at 27,000 g for
30 min at 4 C;
(d) Filter the supernatant through a 0.22 μm filter;
(e) Load the filtrate onto a 1 mL HisTrap HP column equili-
brated with buffer A;
(f) Wash the column with 5 mL of buffer A with the protease
inhibitor cocktail and then with 20 mL of buffer A;
(g) Elute the target protein with 2 mL of buffer B;
(h) Let the column stand for 10 min and then elute the rest of the
protein with another 2 mL of buffer B;
(i) Combine the eluates and dialyze against PBS (can be done
overnight at 4 C).
3.1.3 Notes (a) It was found that a number of genes cannot be amplified
directly using the NCTC12673 Campylobacter phage lysate
or the phenol–chloroform-purified DNA of this phage.
Apparently, neither Taq nor Vent polymerase could use
phage DNA as the substrate. It is hypothesized that this may
be caused by the presence of the yet unknown modification(s)
of the phage DNA. To overcome this obstacle the isothermal
preamplification step was performed as described in ref. 29.
Briefly, 40 mL of the NCTC12673 phage lysate (107pfu/mL)
was treated with DNase I and RNase H (1 μg/mL each) to
remove the host DNA and RNA. Phage DNA was subse-
quently extracted three times with phenol/chloroform solu-
tion followed by two chloroform extractions. DNA was then
precipitated by isopropanol and dissolved in 100 μL of 10 mM
Tris, pH 8.0. Then 5 μL of this phage DNA solution was used
in the 50 μL preamplification reaction with phi29 DNA poly-
merase (Fermentas/Thermo Fisher Scientific) at 37 C
Immobilization of Intact Phage and Phage-Derived Proteins for Detection. . . 99
Binding Assay (a) Wash bacterial cells twice in PBS to remove the media.
(b) Expose the protein immobilized substrates to 109 cfu/mL of
mycobacterial cells in PBS followed by incubation for 1 h at
room temperature. M. marinum and E. coli cells were used to
determine the specificity of the protein.
(c) Wash the immobilized surfaces in 0.05% of Tween 20 before
analysis.
(d) For fluorescence microscopy, stain the bacterial cells with
50 μM resazurin for 20 min before exposure with protein-
immobilized substrates.
(e) To record the fluoroscopic images, an Olympus IX81 micro-
scope equipped with a FITC filter and a Roper Scientific Cool-
Snaps HQ CCD camera, can be used.
(f) Fix the samples with 2% glutaraldehyde for 2 h at room
temperature followed by gradient of ethanol from 50% to
100% before SEM.
(g) Finally dry the samples by exposure to nitrogen.
(h) Record the SEM images by using a Hitachi S-4800/LEO
1430 microscope.
(i) Use ImageJ software (USA NIH) to analyze the microscopic
images. Average numbers of the cells bound to the surface are
indicated on the basis of the assessment of the cell number in
the field of view and using eight gold-covered chips per test.
102 Hany Anany et al.
3.2.3 Immobilization of (a) Dynabead M-280 Tosyl activated and/or Lyophilized Dyna-
Campylobacter phage bead M-270 Epoxy beads
Gp047 Protein onto (b) 0.1 M Na-phosphate buffer.
Beads [31]
(c) 3 M ammonium sulfate.
Materials (d) GST-Gp48 phage RBPs.
(e) 0.1% (w/v) BSA.
(f) PBS.
(g) Glutathione.
(h) Magnetic rack.
(i) Eppendorf tube.
(j) Orbital shaker.
Oriented Immobilization of (a) For oriented immobilization, incubate the washed beads in
GST-GP48 RBPs onto 100 μL of 1 mg per mL solution of glutathione in PBS, and
Beads incubate overnight on an orbital shaker at 1000 rpm to form a
self-assembled monolayer of glutathione (GSH SAM)).
Immobilization of Intact Phage and Phage-Derived Proteins for Detection. . . 103
(b) Wash the GSH SAM beads in PBS once and then place on a
magnet and remove the supernatant. Incubate the GSH-SAM
beads in 40 μg of GST-Gp48 RBPs in PBS for 1 h on an orbital
shaker at 1000 rpm.
(c) Wash the RBP derivatized magnetic beads four times in
PBS-BSA buffer to block the free surface.
(d) Resuspend the BSA blocked beads in 1 mL of PBS buffer
(pH 7.4) and store at 4 C until used for bacterial capture.
Acknowledgments
The authors would like to thank Dr. Roger Johnson from Public
Health Agency of Canada, National Microbiology Laboratory
(Guelph) for providing rV5 phage used in the whole phage immo-
bilization experiments. Also, we would like to thank Drs. Carlos
Filipe and Robert Pelton and his research groups from McMaster
University for his help in the phage printing experiment.
References
1. Brovko LY, Anany H, Griffiths MW (2012) 11. Gervals L et al (2007) Immobilization of bio-
Bacteriophages for detection and control of tinylated bacteriophages on biosensor surfaces.
bacterial pathogens in food and food- Sensors Actuators B-Chem 125(2):615–621
processing environment. In: Jeyakumar H 12. Arya SK et al (2011) Chemically immobilized
(ed) Advances in food and nutrition research. T4-bacteriophage for specific Escherichia coli
Academic Press, Cambridge, pp 241–288 detection using surface plasmon resonance.
2. Anany H et al (2015) Bacteriophages as anti- Analyst 136(3):486–492
microbials in food products: history, biology 13. Balasubramanian S et al (2007) Lytic phage as a
and application. In: Taylor M (ed) Handbook specific and selective probe for detection of
of natural antimicrobials for food safety and Staphylococcus aureus—a surface plasmon res-
quality. Woodhead Publishing, Cambridge, pp onance spectroscopic study. Biosens Bioelec-
69–83 tron 22(6):948–955
3. Murthy K, Engelhardt R (2012) .Encapsulated 14. Grimes CA et al (2011) Theory, instrumenta-
bacteriophage formulation, United States tion and applications of Magnetoelastic reso-
Patents nance sensors: a review. Sensors 11
4. Salalha W et al (2006) Encapsulation of bacte- (3):2809–2844
ria and viruses in electrospun nanofibres. 15. Chai Y et al (2012) Rapid and sensitive detec-
Nanotechnology 17(18):4675 tion of Salmonella Typhimurium on eggshells
5. Zhang J et al (2010) Development of an anti- by using wireless biosensors. J Food Prot 75
Salmonella phage cocktail with increased host (4):631–636
range. Foodborne Pathog Dis 7 16. Horikawa S et al (2011) Effects of surface func-
(11):1415–1419 tionalization on the surface phage coverage and
6. Ma Y et al (2008) Microencapsulation of bac- the subsequent performance of phage-
teriophage felix O1 into chitosan-alginate immobilized magnetoelastic biosensors. Bio-
microspheres for oral delivery. Appl Environ sens Bioelectron 26(5):2361–2367
Microbiol 74(15):4799–4805 17. Mi-Kyung P et al (2012) The effect of incuba-
7. Stanford K et al (2010) Oral delivery systems tion time for Salmonella Typhimurium binding
for encapsulated bacteriophages targeted at to phage-based magnetoelastic biosensors.
Escherichia coli O157:H7 in feedlot cattle. J Food Control 26(2):539–545
Food Prot 73(7):1304–1312 18. Park M-K, Oh J-H, Chin BA (2011) The effect
8. Yongsheng M et al (2012) Enhanced alginate of incubation temperature on the binding of
microspheres as means of oral delivery of bac- Salmonella typhimurium to phage-based mag-
teriophage for reducing Staphylococcus aureus netoelastic biosensors. Sensors Actuators
intestinal carriage. Food Hydrocoll 26 B-Chem 160(1):1427–1433
(2):434–440 19. Singh A et al (2010) Bacteriophage tailspike
9. Anany H et al (2011) Biocontrol of Listeria proteins as molecular probes for sensitive and
monocytogenes and Escherichia coli O157: selective bacterial detection. Biosens Bioelec-
H7 in meat by using phages immobilized on tron 26(1):131–138
modified cellulose membranes. Appl Environ 20. Singh A et al (2012) Bacteriophage based
Microbiol 77(18):6379–6387 probes for pathogen detection. Analyst 137
10. Singh A et al (2009) Immobilization of bacter- (15):3405–3421
iophages on gold surfaces for the specific cap- 21. Amit S et al (2011) Specific detection of Cam-
ture of pathogens. Biosens Bioelectron 24 pylobacter jejuni using the bacteriophage
(12):3645–3651
Immobilization of Intact Phage and Phage-Derived Proteins for Detection. . . 105
NCTC 12673 receptor binding protein as a for the optimized capture of bacteria. Bacterio-
probe. Analyst 136(22):4780–4786 phage 2(1):15–24
22. Sun W, Brovko L, Griffiths M (2000) Use of 28. Javed MA et al (2013) Bacteriophage receptor
bioluminescent Salmonella for assessing the binding protein based assays for the simulta-
efficiency of constructed phage-based biosor- neous detection of Campylobacter jejuni and
bent. J Ind Microbiol Biotechnol 25 Campylobacter coli. PLoS One 8(7)
(5):273–275 29. Kropinski AM et al (2011) Genome and prote-
23. Tolba M et al (2010) Oriented immobilization ome of Campylobacter jejuni bacteriophage
of bacteriophages for biosensor applications. NCTC 12673. Appl Environ Microbiol 77
Appl Environ Microbiol 76(2):528–535 (23):8265–8271
24. Minikh O et al (2010) Bacteriophage-based 30. Arutyunov D et al (2014) Mycobacteriophage
biosorbents coupled with bioluminescent ATP cell binding proteins for the capture of myco-
assay for rapid concentration and detection of bacteria. Bacteriophage
Escherichia coli. J Microbiol Methods 82 31. Poshtiban S et al (2013) Phage receptor bind-
(2):177–183 ing protein-based magnetic enrichment
25. Cademartiri R et al (2010) Immobilization of method as an aid for real time PCR detection
bacteriophages on modified silica particles. of foodborne bacteria. Analyst 138
Biomaterials 31(7):1904–1910 (19):5619–5626
26. Kropinski A et al (2013) The host-range, geno- 32. Singh U et al (2014) Mycobacteriophage
mics and proteomics of Escherichia coli O157: lysin-mediated capture of cells for the PCR
H7 bacteriophage rV5. Virol J 10(1):76 detection of Mycobacterium avium subspecies
27. Naidoo R et al (2012) Surface-immobilization paratuberculosis. Anal Methods 6
of chromatographically purified bacteriophages (15):5682–5689
Chapter 9
Abstract
Zymogram or zymography is an electrophoretic technique based on sodium dodecyl sulfate polyacrylamide
gel electrophoresis (SDS-PAGE), which enables visualization of enzymatically active protein species sepa-
rated by molecular mass. The strategy is to perform SDS-PAGE on the proteins in question while including
an opaque substrate of the enzyme embedded within the polyacrylamide gel. Here, we describe a zymo-
gram protocol for phage lytic proteins (peptidoglycan hydrolases) using peptidoglycan (or whole cells)
from a susceptible gram-positive bacterial species as substrate. Proteins are prepared and analyzed simulta-
neously on two separate gels: First, standard denaturing SDS-PAGE followed by conventional protein
staining (e.g., Coomassie) is run to identify the migration pattern of the protein species in the sample;
second, the zymogram gel in which either cells or peptidoglycan from a susceptible bacterium have
embedded in the SDS gel matrix is performed. After electrophoresis, the SDS is removed from the
zymogram gel, allowing the proteins (now separated by molecular mass) to assume an active conformation
and ultimately digest the opaque substrate (yielding a nonopaque product). This results in a cleared spot in
an otherwise opaque gel which corresponds to the location of an enzymatically active protein species. This
assay can be used to qualitatively assay the enzymatic activity of endolysins from cell extracts, or to identify
virion-associated peptidoglycan hydrolases in phage particles.
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_9, © Springer Science+Business Media, LLC, part of Springer Nature 2019
107
108 Lorena Rodrı́guez-Rubio et al.
the cell wall peptidoglycan and lyse the host bacteria to release the
phage progeny at the last step of the lytic infection cycle. Some
phages also encode structural lysins or virion-associated peptido-
glycan hydrolases (VAPGHs) to degrade the peptidoglycan in the
earliest stages of the infection cycle. Both types of proteins have an
extremely high potential as antimicrobial alternatives to antibiotics
in the fight against pathogenic bacteria, and thus, their study has
increased recently in the face of worldwide increase in multidrug
resistant pathogens [3, 4]. As substrate, live whole cells [5–9],
autoclaved cells [10–19], freeze-dried cells [20–23] or crude pep-
tidoglycan [24] can be used to identify peptidoglycan hydrolase
activity. Usually, live whole cells are used to assess the hydrolytic
potential of peptidoglycan hydrolases encoded by phages infecting
gram-positive bacteria, while the other substrates are used for lytic
proteins encoded by phages infecting both gram-positive or gram-
negative bacteria. This technique provides advantages for the anal-
ysis of peptidoglycan hydrolases, e.g., proteins do not need to be
purified, crude cell extracts containing the protein of interest can be
used [6, 10, 12, 13, 18, 19, 21, 22, 25]. Related to this advantage,
this technique allows detecting the presence and determining the
molecular mass of structural peptidoglycan hydrolytic proteins in
fully assembled virions, i.e., without cloning and overexpression
[11, 14, 15, 26]. However, zymograms also have some inherent
disadvantages including the need for correct refolding of the pro-
tein after SDS denaturation and electrophoresis. It is also helpful if
the researcher is aware of the conditions required for high activity of
the peptidoglycan hydrolase of interest (such as ionic strength,
cations, and temperature), so that these can be included during
the renaturation step.
Here, we describe a zymogram protocol to detect the catalytic
activity of phage-encoded peptidoglycan hydrolases, using fresh
cultured live bacterial cells embedded in the polyacrylamide gel
(Fig. 1).
2 Materials
2.1 For the Substrate 1. Appropriate medium for growing the target bacterium.
(Bacterial Cells) 2. 50 mM sodium phosphate buffer pH 7: prepare 50 mM
NaH2PO4 and 50 mM Na2HPO4. Add slowly the NaH2PO4
solution onto the Na2HPO4 solution until the desired pH is
achieved.
Zymogram of Phage Lytic Proteins 109
ZYMOGRAM
SDS - PAGE
Staining and destaining SDS gel following Wash in excess water and incubate in
Coomassie blue protocol water or under the specific conditions
for the enzyme.Peptidoglycan
hydrolytic activities are visualized as
clearing zones in the turbid gel
Fig. 1 Scheme of the steps to perform a zymogram analysis of phage-encoded lytic proteins using live whole
cells embedded in the gel as substrate. Arrows in the SDS gel indicate the proteins in the mixture with
peptidoglycan hydrolytic activity in the zymogram gel
3 Methods
3.1 Bacterial Cells Grow 300 ml culture of bacterial strain of interest to mid-log phase
Preparation (OD600 ~0.5) and separate cells from culture media by centrifuga-
tion. Add 300 μl of 50 mM sodium phosphate buffer pH 7 to the
cell pellet see Note 1). This will make a total volume of about
500–600 μl cells in buffer. Put cells on ice until they are added to
the SDS gel mix (see Note 2).
3.2 SDS-PAGE and 1. To perform a zymogram analysis, an SDS gel and a zymogram
Zymogram gel should be run in parallel. The Coomassie stained SDS
PAGE will be a reference for the zones of clearing in the
zymogram gel. Set up two sets of clean glass plates in the
polyacrylamide mini-gel electrophoresis apparatus (e.g., Mini-
PROTEAN® 3 Cell, Bio-Rad).
2. Prepare four 50 ml conical tubes to make the polyacrylamide
gel mixtures.
3. Tube 1 contains the Gel Master Mix: 3.3 ml H2O, 3.6 ml 1 M
Tris–HCl pH 8.0, 5 ml 40% acrylamide–bis-acrylamide
(37.5:1), 120 μl 10% (w/v) SDS.
4. Tube 2 contains the Running Gel (regular SDS gel): 5 ml Gel
Master Mix, 600 μl 50 mM sodium phosphate buffer pH 7 (see
Note 3), 70 μl 10% APS. Immediately before pipetting gel into
glass plates, add 7 μl TEMED and swirl gently; then pipet the
mixture into the glass plates (see Note 4). Gently overlay the
running gel prior to polymerization with water or butanol to
prevent contact with atmospheric oxygen and to provide an
interface for a flat and level upper surface of the gel once
polymerized.
5. Tube 3 contains the gel for the Zymogram: 5 ml Gel Master
Mix, 600 μl bacterial cells in 50 mM sodium phosphate buffer
pH 7, 70 μl 10% APS. The cell number should be sufficient to
create an opaque solution. Immediately before pipetting the
gel into a second set of glass plates, add 7 μl TEMED and swirl
gently, then pipet the mixture into the zymogram glass plates.
As with the SDS gel, gently overlay with water or butanol to
prevent contact with atmospheric oxygen and permit leveling
the running gel upper surface once polymerized.
Zymogram of Phage Lytic Proteins 111
3.3 Staining/ 1. Incubate SDS gel in the staining solution for 30 min at room
Destaining SDS Gel temperature with gentle shaking (see Note 9).
2. Pour off the staining solution (see Note 10). Add enough
destaining solution to cover the gel (see Note 11) and incubate
at least 1 h at room temperature with gentle shaking (see Notes
9 and 12).
3.4 Determining 1. After running the zymogram, place it into deionized water for
Peptidoglycan 15 min to wash it, pour off water, add clean water and incubate
Hydrolase Activity in at room temperature (see Note 13).
the Zymogram 2. Monitor the time the zymogram gel spends in water for con-
sistency from zymogram to zymogram in the timing of the
photo documentation (see Note 14).
3. Depending on the level of enzyme activity, you might see
clearing as early as 15 min (see Note 15).
112 Lorena Rodrı́guez-Rubio et al.
4 Notes
Acknowledgments
References
1. Abaev I, Foster-Frey J, Korobova O, encoded by Lactobacillus plantarum phage
Shishkova N, Kiseleva N, Kopylov P, phig1e. Gene 299(1–2):227–234
Pryamchuk S, Schmelcher M, Becker SC, 11. Kenny JG, McGrath S, Fitzgerald GF, van Sin-
Donovan DM (2013) Staphylococcal phage deren D (2004) Bacteriophage Tuc2009
2638A endolysin is lytic for Staphylococcus encodes a tail-associated cell wall-degrading
aureus and harbors an inter-lytic-domain sec- activity. J Bacteriol 186(11):3480–3491
ondary translational start site. Appl Microbiol 12. Yokoi KJ, Kawahigashi N, Uchida M,
Biotechnol 97(8):3449–3456 Sugahara K, Shinohara M, Kawasaki K,
2. Vandooren J, Geurts N, Martens E, Van den Nakamura S, Taketo A, Kodaira K (2005) The
Steen PE, Opdenakker G (2013) Zymography two-component cell lysis genes holWMY and
methods for visualizing hydrolytic enzymes. lysWMY of the Staphylococcus warneri M
Nat Methods 10(3):211–220 phage ϕWMY: cloning, sequencing, expres-
3. Nelson DC, Schmelcher M, Rodriguez-Rubio- sion, and mutational analysis in Escherichia
L, Klumpp J, Pritchard DG, Dong S, Donovan coli. Gene 351:97–108
DM (2012) Endolysins as antimicrobials. Adv 13. Wang S, Kong J, Zhang X (2008) Identifica-
Virus Res 83:299–365 tion and characterization of the
4. Rodrı́guez-Rubio L, Martı́nez B, Donovan two-component cell lysis cassette encoded by
DM, Rodrı́guez A, Garcı́a P (2013) Bacterio- temperate bacteriophage phiPYB5 of Lactoba-
phage virion-associated peptidoglycan hydro- cillus fermentum. J Appl Microbiol 105
lases: potential new enzybiotics. Crit Rev (6):1939–1944
Microbiol 39(4):427–434 14. Takáč M, Bl€asi U (2005) Phage P68 virion-
5. Becker SC, Dong S, Baker JR, Foster-Frey J, associated protein 17 displays activity against
Pritchard DG, Donovan DM (2009) LysK clinical isolates of Staphylococcus aureus. Anti-
CHAP endopeptidase domain is required for microb Agents Chemother 49(7):2934–2940
lysis of live staphylococcal cells. FEMS Micro- 15. Garcı́a P, Martı́nez B, Obeso JM, Lavigne R,
biol Lett 294(1):52–60 Lurz R, Rodrı́guez A (2009) Functional geno-
6. Rodrı́guez L, Martı́nez B, Zhou Y, mic analysis of two Staphylococcus aureus
Rodrı́guez A, Donovan DM, Garcı́a P (2011) phages isolated from the dairy environment.
Lytic activity of the virion-associated peptido- Appl Environ Microbiol 75(24):7663–7673
glycan hydrolase HydH5 of Staphylococcus 16. Lai MJ, Lin NT, Hu A, Soo PC, Chen LK,
aureus bacteriophage vB_SauS-phiIPLA88. Chen LH, Chang KC (2011) Antibacterial
BMC Microbiol 11:138 activity of Acinetobacter baumannii phage
7. Rodrı́guez-Rubio L, Martı́nez B, Rodrı́guez A, ϕAB2 endolysin (LysAB2) against both gram-
Donovan DM, Garcı́a P (2012) Enhanced sta- positive and gram-negative bacteria. Appl
phylolytic activity of the Staphylococcus aureus Microbiol Biotechnol 90(2):529–539
bacteriophage vB_SauS-phiIPLA88 HydH5 17. Saravanan SR, Paul VD, George S,
virion-associated peptidoglycan hydrolase: Sundarrajan S, Kumar N, Hebbur M,
fusions, deletions, and synergy with LysH5. Kumar N, Veena A, Maheshwari U, Appaiah
Appl Environ Microbiol 78(7):2241–2248 CB, Chidambaran M, Bhat AG, Hariharan S,
8. Schmelcher M, Korobova O, Schischkova N, Padmanabhan S (2013) Properties and muta-
Kiseleva N, Kopylov P, Pryamchuk S, Donovan tion studies of a bacteriophage-derived chime-
DM, Abaev I (2012) Staphylococcus haemolyti- ric recombinant staphylolytic protein P128:
cus prophage ΦSH2 endolysin relies on cyste- Comparison to recombinant lysostaphin. Bac-
ine, histidine-dependent amidohydrolases/ teriophage 3:e26564
peptidases activity for lysis ‘from without’. J 18. Keary R, McAuliffe O, Ross RP, Hill C,
Biotechnol 162(2–3):289–298 O’Mahony J, Coffey A (2014) Genome analy-
9. Roach DR, Khatibi PA, Bischoff KM, Hughes sis of the staphylococcal temperate phage DW2
SR, Donovan DM (2013) Bacteriophage- and functional studies on the endolysin and tail
encoded lytic enzymes control growth of con- hydrolase. Bacteriophage 4:e28451
taminating Lactobacillus found in fuel ethanol 19. Sanz-Gaitero M, Keary R, Garcia-Doval C,
fermentations. Biotechnol Biofuels 6(1):20 Coffey A, van Raaij MJ (2014) Crystal struc-
10. Kakikawa M, Yokoi KJ, Kimoto H, Nakano M, ture of the lytic CHAP(K) domain of the endo-
Kawasaki K, Taketo A, Kodaira K (2002) lysin LysK from Staphylococcus aureus
Molecular analysis of the lysis protein Lys bacteriophage K. Virol J 11:133
Zymogram of Phage Lytic Proteins 115
20. Henry M, Begley M, Neve H, Maher F, Ross 24. Westbye AB, Leung MM, Florizone SM, Tay-
RP, McAuliffe O, Coffey A, O’Mahony JM lor TA, Johnson JA, Fogg PC, Beatty JT
(2010) Cloning and expression of a mureino- (2013) Phosphate concentration and the puta-
lytic enzyme from the mycobacteriophage tive sensor kinase protein CckA modulate cell
TM4. FEMS Microbiol Lett 311(2):126–132 lysis and release of the Rhodobacter capsulatus
21. Uchiyama J, Takemura I, Hayashi I, gene transfer agent. J Bacteriol 195
Matsuzaki S, Satoh M, Ujihara T, (22):5025–5040
Murakami M, Imajoh M, Sugai M, Daibata M 25. Gaidelyte A, Cvirkaite-Krupovic V,
(2011) Characterization of lytic enzyme open Daugelavicius R, Bamford JK, Bamford DH
reading frame 9 (ORF9) derived from Entero- (2006) The entry mechanism of membrane-
coccus faecalis bacteriophage phiEF24C. Appl containing phage Bam35 infecting Bacillus
Environ Microbiol 77(2):580–585 thuringiensis. J Bacteriol 188(16):5925–5934
22. Catalão MJ, Milho C, Gil F, Moniz-Pereira J, 26. Moak M, Molineux IJ (2004) Peptidoglycan
Pimentel M (2011) A second endolysin gene is hydrolytic activities associated with bacterio-
fully embedded in-frame with the lysA gene of phage virions. Mol Microbiol 51:1169–1183
mycobacteriophage Ms6. PLoS One 6(6): 27. Kurien BT, Scofield RH (2012) Accelerated
e20515 Coomassie Blue staining and destaining of
23. Payne KM, Hatfull GF (2012) Mycobacter- SDS-PAGE gels with application of heat. In:
iophage endolysins: diverse and modular Kurien BT, Scofield RH (eds) Protein electro-
enzymes with multiple catalytic activities. phoresis: methods and protocols, Methods in
PLoS One 7(3):e34052 molecular biology, vol 869. Springer,
New York, pp 471–479
Chapter 10
Abstract
After injecting their genome into the bacterial host cell, bacteriophages need to convert the host metabo-
lism toward efficient phage production. For this, specific proteins have evolved which interact with key host
proteins to inhibit, activate or redirect the function of these proteins. Since 70% of the currently annotated
phage genes are hypothetical proteins of unknown function, the identification and characterization of these
phage proteins involved in host–phage protein–protein interactions remains challenging. Here, we describe
a method to identify phage proteins involved in host–phage protein–protein interactions using a combina-
tion of affinity purifications and mass spectrometry analyses. A bacterial strain is engineered in which a
bacterial target protein is fused to a Strep-tag® II at the C-terminal end. This strain is infected with a specific
bacteriophage, followed by an affinity purification of the tagged protein which allows the copurification of
all bacterial and phage specific interacting proteins. After SDS-PAGE analysis and an in-gel trypsin
digestion, the purified interacting proteins are identified by mass spectrometry analysis. The identification
of phage proteins involved in interactions provides first hints toward the elucidation of the biological
function of these proteins.
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_10, © Springer Science+Business Media, LLC, part of Springer Nature 2019
117
118 Jeroen De Smet et al.
Fig. 1 Overview of the protocol used for the identification of interacting phage proteins. After selecting a
bacterial target protein, a Strep-tag® II is fused at the C-terminal end of this target using in vivo homologous
recombination. In the next step, the recombinant strain is infected with a specific bacteriophage and the
infection cycle is stopped in the early phase of infection. The cells are lysed and an affinity purification is
performed to purify the target protein and all interacting proteins. The eluted protein samples are loaded on
SDS-PAGE. Finally, the samples are subject to an in-gel trypsin digestion and the resulting peptides are
analysed by mass spectrometry, to identify interacting phage proteins
2 Materials
Prepare all solutions with ultrapure water and use analytical grade
reagents. Prepare and store all reagents at room temperature
(unless stated otherwise).
120 Jeroen De Smet et al.
Fig. 2 Steps to produce the DNA construct for homologous recombination. In step 1, the separate fragments
are amplified (C-terminal part of target gene without the stop codon, cassette containing Strep-tag® II + GmR
gene and the 30 region of the gene). In step 2, the two fragments are allowed to fuse and primers are added to
get the two constructs which share the GmR cassette. In step 3, the fragments obtained in step 2 are fused
and primers are added. In step 4, the full DNA fragment is amplified using the outer primers
2.2.2 The Production of 1. P. aeruginosa PAO1 target::StrepII strain and the wild type
the Strep-tag® II-Fused P. aeruginosa PAO1 strain.
Protein 2. 50 ml autoclaved LB containing 30 μg/ml gentamicin (using a
1000 stock of 30 mg/ml).
3. Filtered (0.22 μm) TE buffer: 50 mM Tris (pH 8.0),
2 mM EDTA.
4. Cooled transfer buffer: 25 mM Tris, 192 mM Glycine, 20%
(v/v) Ethanol (see Note 2).
5. PBST buffer: 140 mM NaCl, 10 mM KCl, 10 mM Na2PO4,
1.8 mM KH2PO4, 0.1% (v/v) Tween, pH 7.5 (see Note 3).
6. Blocking solution: PBST + 5% (w/v) Powder milk.
7. Ultrapure H2O.
8. A protein carrying a Strep-tag® II (positive control).
9. Amersham ECL Prime Western Blotting Detection Reagent
(GE Healthcare).
10. Hen Egg White Lysozyme (HEWL, Sigma Aldrich; https://
www.sigmaaldrich.com/).
11. Pefabloc® SC (4-(2-aminoethyl)-benzene-sulfonyl fluoride,
aebsf, aminoethyl-benzene-sulfonyl fluoride, 4-2-, proteinase
k inhibitor; https://www.sigmaaldrich.com/).
12. Benzonase® nuclease (EMD Millipore Corporation; http://
www.emdmillipore.com/).
13. Prestained reference ladder (e.g., the PageRuler Prestained
Protein Ladder (Thermo Fisher Scientific)).
14. Monoclonal anti-Strep-tag® II antibodies conjugated to horse-
radish peroxidase (HRP, IBA).
15. Whatman paper (Sigma-Aldrich).
16. Transparant paper.
17. Nitrocellulose membrane (Hybond-C Extra, Ge Healthcare).
18. Amersham Hyperfilm ECL (18 24 cm) (GE Healthcare).
19. Hypercassette Blue Std Depth 18 24 cm (GE Healthcare).
20. Mini Trans-Blot® Cell (Bio Rad): Gel Holder Cassette, Foam
Pads, Trans-Blot Central Core, Bio-Ice Cooling Unit and
Mini-PROTEAN® Tetra Cell Systems (electrophoresis
chamber).
Phage-Host Protein Interaction Analyses 123
2.3 Affinity 1. P. aeruginosa PAO1 target::StrepII strain and the wild type
Purifications P. aeruginosa PAO1 strain.
2. 600 ml autoclaved LB containing 30 μg/ml gentamicin.
3. Pure stock of selected phage (>1010 PFU/ml), stored in phage
buffer at 4 C (see Note 1).
4. Resuspension buffer: 10 mM Tris (pH 8.0), 150 mM NaCl,
0.1% (v/v) NP-40 (see Note 4).
5. Wash buffer: 100 mM Tris (pH 8.0), 150 mM NaCl, 1 mM
EDTA, or Strep-tag® Washing Buffer (IBA) (see Note 4).
6. Elution buffer: 100 mM Tris (pH 8.0), 150 mM NaCl, 1 mM
EDTA, 2.5 mM desthiobiotin, or dilute 10 Strep-tag® II
Elution (Buffer E, IBA).
7. Regeneration buffer: dilute 10 Strep-tag® Regeneration
Buffer (IBA).
8. Hen Egg White Lysozyme (HEWL, Sigma Aldrich).
9. Pefabloc® SC (Merck).
10. Benzonase® nuclease (EMD Millipore Corporation).
11. 10 BugBuster® Protein extraction reagent (http://www.
emdmillipore.com/).
12. Strep-Tactin® Sepharose beads (Sigma-Aldrich).
13. A 10 ml Bio-Rad Poly-Prep® Chromatography column
(Bio-Rad Laboratories; http://www.bio-rad.com/).
14. An ice-cold collection tube (300–600 ml) (stored at 80 C, at
the start of the procedure).
15. An icy water bath.
3 Methods
3.2 Verification of Once a correct strain is constructed, the effect of the insert on the
the Constructed viability of the bacterial cells and the infectivity by P. aeruginosa-
Strains specific phages is tested. Neither of these parameters should expe-
rience an effect compared to a wild type P. aeruginosa strain. First
3.2.1 Effect on the the viability of the mutant is analysed.
Bacterial Viability and the
Infectivity of the Phage 1. Inoculate 4 ml of LB/Gm30 with 40 μl of an overnight culture
of P. aeruginosa PAO1 target::StrepII and 4 ml of LB with 40 μl
of an overnight culture of the wild type P. aeruginosa PAO1
strain.
2. Measure the OD600nm every 20 min during 5 h, for both
cultures.
3. Plot the OD600nm in function of time and compare both
curves. No differences should be present.
Next, the effect on phage infection has to be investigated.
For this, the “efficiency of plating” (EOP) is determined, using
the double-agar method.
4. Mix 4 ml LB Soft with 200 μl of an overnight culture of
P. aeruginosa PAO1 target::StrepII and 100 μl of a dilution of
the phage (see Note 17).
5. Pour the mix on top of an LB agar plate (see Note 18).
6. Repeat steps 4 and 5 by using the wild type P. aeruginosa
PAO1 strain.
7. Incubate the plates overnight at 37 C.
8. Count the number of plaques formed and determine the
“plaque forming units” (PFU)/ml. Calculate the EOP as the
ratio of the PFU/ml on the constructed strain to the PFU/ml
on the wild type strain. The EOP should approximately be 1.
128 Jeroen De Smet et al.
3.2.2 Production of the After verifying the viability and infectivity of the engineered strain,
Strep-tag® II-Fused Protein the presence of the tagged protein under physiological conditions is
investigated (see Note 19). Therefore, a Western blot is performed
on the cell lysate of the constructed cells (without phage infection).
If the protein is produced, a signal should be detected when using
monoclonal anti-Strep-tag® II antibodies which target the Strep-
tag® II.
1. Inoculate 50 ml of LB/Gm30 in a 200 ml flask with 1 ml of an
overnight culture of the engineered P. aeruginosa strain target::
StrepII. As a negative control, inoculate 50 ml LB with an
overnight culture of wild type P. aeruginosa PAO1 cells and
follow the same procedure.
2. Grow the cells at 37 C to an OD600nm of 0.3 (see Note 20),
transfer them to a 50 ml-tube and collect the cells by centrifu-
gation (30 min, 4600 g, 4 C).
3. Discard the supernatant, dissolve the cell pellet in 500 μl TE
buffer and transfer the sample to a 1.5 ml Eppendorf tube.
4. To lyse the cells, the sample is first subjected to one freeze-thaw
cycle (see Note 21).
5. Subsequently, incubate the sample for 15 min at room temper-
ature while gently agitating, after the addition of 10 μl of
5 mg/ml HEWL, 10 μl of 100 mM Pefabloc® SC, and 1 μl
Benzonase® nuclease.
6. Sonicate the sample 8 times 5 s (amplitude 40%) and add 166 μl
4 loading buffer.
7. Boil the sample for 5 min at 95 C (see Note 22).
8. Load 15–20 μl of the sample on a polyacrylamide gel and
subject it to SDS-PAGE as described in ‘Subheading 3.4 (see
Note 23). Load 5 μl of the prestained reference ladder next to
the sample (see Note 24). As a negative control, load 15–20 μl
of the cell lysate of the wild type cells. As a positive control, load
a fraction of a protein carrying a Strep-tag® II.
9. Prepare a Western blot “sandwich”: Soak the foam pads in
transfer buffer and put them on each side of the holder. Soak
two Whatman papers (size of the foam pads) in transfer buffer
and put them on each side of the holder. Soak the nitrocellulose
membrane (size of the gel) in transfer buffer and put it on the
side which will be connected with the positive pool of the
power source. Soak the gel in transfer buffer and put it on the
negative side of the holder. Close the holder (see Note 25–27).
10. Place the holder in a tank filled with cooled transfer buffer and
run an electrical field of 100 V (350 mA) over it during 1 h–1 h
30 min (see Notes 28 and 29).
Phage-Host Protein Interaction Analyses 129
3.4 SDS-PAGE The eluted fractions are subsequently subjected to SDS-PAGE. The
one-dimensional separation of the proteins present in the samples,
allows a first analysis of the composition of the eluted fractions.
Moreover, gel electrophoresis removes low molecular weight impu-
rities, including detergents and buffer components, which are often
not compatible with downstream mass spectrometry analysis.
1. Prepare a 12% SDS-PAGE gel: Pour the separation gel mixture
between the two glace plates of the Mini-PROTEAN® Tetra
Cell Systems (see Note 40). Add a small layer of isopropanol
Phage-Host Protein Interaction Analyses 131
and wait until the gel has solidified. Remove the isopropanol
and pour the stacking gel mixture (see Note 40). Place the
comb insight and wait until the gel has solidified.
2. Place the gel in the holder and subsequently place the holder in
the tank. Fill the tank with running buffer.
3. Suspend aliquots of 10–15 μl proteins in SDS-PAGE 4 load-
ing buffer and denature by heating them at 95 C for 5 min.
4. Load the protein samples in the wells (after removal of the
comb) and run an electric field of 200 V until the electropho-
resis front reaches the bottom of the gel (see Note 41).
5. Remove the gel from the glace plates, place it in a box and wash
the gel with water for 15–30 min.
6. Stain the SDS-PAGE gel for 0.5–2 h with a MS-compatible
standard Coomassie stain like GelCode Blue Safe Stain
(Thermo Fisher Scientific).
7. Wash the gel overnight with water, to reduce the background
stain.
3.5 Mass Lastly, the composition of the samples has to be identified. There-
Spectrometry fore, gel pieces are sliced from the SDS-PAGE gel and subjected to
Analyses an in-gel trypsin digestion. Afterward, the obtained peptides are
analysed by LC-MS/MS analyses. During the experiment, gloves
must be worn at all times, and contact with skin, hair, and clothes
should be avoided (see Note 42). Moreover, keratin-free materials
should be used.
1. Excise protein bands (8–13 spots in total) from the gel using a
1000 μl micropipette after widening the opening of the tip with
a scalpel (see Note 43–45).
2. Transfer each gel piece into a separate 1.5 ml Eppendorf tube.
3. Remove the residual water, submerge each gel piece in 100 μl
25 mM NH4HCO3 in 50% acetonitrile, and incubate for
10 min at room temperature.
4. Remove the liquid, and repeat step 3 until the Coomassie blue
is completely removed from the gel pieces (approx. 3 times).
5. Dry the pieces in a vacuum centrifuge for 10–15 min at 40 C
(see Note 46).
6. Submerge the pieces in 30 μl 10 mM DTT in 100 mM
NH4HCO3 to reduce all disulfide bonds (reduction) and incu-
bate for 1 h at 56 C.
7. Cool the samples to room temperature and remove the liquid.
8. Submerge the pieces in 30 μl 55 mM IAA in 100 mM
NH4HCO3 to modify cysteine residues and prevent reforma-
tion of disulfide bonds (alkylation).
132 Jeroen De Smet et al.
4 Notes
References
1. Roucourt B, Lavigne R (2009) The role of 11. Van den Bossche A, Ceyssens PJ, De Smet J
interactions between phage and bacterial pro- et al (2014) Systematic identification of hypo-
teins within the infected cell: a diverse and thetical bacteriophage proteins targeting key
puzzling interactome. Environ Microbiol protein complexes of Pseudomonas aeruginosa.
11:2789–2805 J Proteome Res 13:4446–4456
2. Liu J, Dehbi M, Moeck G et al (2004) Antimi- 12. Korndörfer IP, Skerra A (2002) Improved
crobial drug discovery through bacteriophage affinity of engineered streptavidin for the
genomics. Nat Biotechnol 22:185–191 Strep-tag II peptide is due to a fixed open
3. Yano ST, Rothman-Denes LB (2011) A phage- conformation of the lid-like loop at the binding
encoded inhibitor of Escherichia coli DNA rep- site. Protein Sci 11:883–893
lication targets the DNA polymerase clamp 13. Schmidt TGM, Skerra A (2007) The Strep-tag
loader. Mol Microbiol 79:1325–1338 system for one-step purification and high-
4. Nechaev S, Severinov K (2003) Bacteriophage- affinity detection or capturing of proteins. Nat
induced modifications of host RNA polymer- Protoc 2:1528–1535
ase. Annu Rev Microbiol 57:301–322 14. Lesic B, Rahme LG (2008) Use of the lambda
5. H€auser R, Blasche S, Dokland T et al (2012) Red recombinase system to rapidly generate
Bacteriophage protein-protein interactions. mutants in Pseudomonas aeruginosa. BMC
Adv Virus Res 83:219–298 Mol Biol 9:20
6. De Smet J, Hendrix H, Blasdel BG et al (2017) 15. Armengaud J, Trapp J, Pible O (2014)
Pseudomonas predators: understanding and Non-model organisms, a species endangered
exploiting phage-host interactions. Nat Rev by proteogenomics. J Proteome 105:5–18
Microbiol 61:517–530 16. Choi KH, Kumar A, Schweizer HP (2006) A
7. Stover CK, Pham XQ, Erwin AL et al (2000) 10-min method for preparation of highly elec-
Complete genome sequence of Pseudomonas trocompetent Pseudomonas aeruginosa cells:
aeruginosa PAO1, an opportunistic pathogen. application for DNA fragment transfer between
Nature 406:959–964 chromosomes and plasmid transformation. J
8. Gellatly SL, Hancock REW (2013) Pseudomo- Microbiol Methods 64:391–397
nas aeruginosa: new insights into pathogenesis 17. Ceyssens PJ, Minakhin L, Van den Bossche A
and host defenses. Pathog Dis 67:159–173 et al (2014) Development of giant bacterio-
9. Wodak S, Vlasblom J, Turinsky A et al (2013) phage ϕKZ is independent of the host tran-
Protein-protein interaction networks: puzzling scription apparatus. J Virol 88:10501–10510
riches. Curr Opin Struct Biol 23:941–953 18. Shevchenko A, Tomas JH, Olsen J et al (2007)
10. Fields S, Song O (1989) A novel genetic system In-gel digestion for mass spectrometric charac-
to detect protein-protein interactions. Nature terization of proteins and proteomes. Nat Pro-
340:245–246 toc 1:2856–2860
Chapter 11
Abstract
Biofilms are ubiquitous in nature found on nearly every type of living and inert surface. They basically
consist of microorganisms attached to surfaces and surrounded by a self-produced matrix of extracellular
polymeric substances. Phages have proven to be successful in controlling biofilms. Here, we describe
methods to characterize phage–biofilm interactions, specifically to assess biofilm biomass and to visualize
the biofilm structure, discriminating infected cells using targeted molecular probes.
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_11, © Springer Science+Business Media, LLC, part of Springer Nature 2019
137
138 Diana Vilas Boas et al.
2 Materials
2.4 Biofilm Cell 1. Agar plates with appropriate growth media (20 plates).
Enumeration 2. 96-well microplates.
3. Sterile saline solution: 0.9% NaCl.
4. Static incubator.
2.6 Biofilm Fixation 1. Biofilms of the bacteria of interest prepared in coupons (see
for Microscopy Note 1).
Techniques 2. Methanol 100% (v/v).
3. Tissue paper.
4. Phosphate buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl,
10 mM Na2HPO4, 2 mM KH2PO4, at pH 7.2).
5. Paraformaldehyde 4% (vol./vol.) prepared in PBS.
6. Ethanol 50% (vol./vol.) prepared in water.
7. Probe: Dissolve the original probe aliquot (lyophilized) in 10%
acetonitrile and 1% trifluoroacetic acid at a final concentration
of 100 μM. Prepare a probe stock solution at 4 μM, adding
40 μL of the original solution to 960 μL of ultrapure water. Use
the stock solution to prepare a probe working solution at
200 nM, in hybridization solution (10% dextran sulfate,
10 mM NaCl, 30% formamide, 0.1% sodium pyrophosphate,
0.2% polyvinylpyrrolidone (Sigma-Aldrich), 0.2% (wt./vol.)
140 Diana Vilas Boas et al.
3 Methods
3.1 Biofilm Biofilms samples are prepared in sterile culture medium and washed
Formation with the appropriate buffer, after which they can be directly stained
in the adhesion support or stained after a fixation step to evaluate
biofilms structure, or for a quantitative approach, after sonicated in
the buffer, determine the amounts of bacteria present in biofilms
(CFU) and also measure plaque-forming unit (PFU) counts in
biofilm infected.
1. Add to a 24-well microplate 1 mL of sterile culture medium.
2. Add 10 μL of a bacterial culture grown overnight diluted to an
O.D.600 of 1.0.
3. Incubate the plate in an incubator at appropriate temperature
conditions and under agitation (120 rpm) during the desired
period of time (e.g., 24 h–7 days). For periods longer than 24 h
replace the media (remove all media by pipetting and add 1 mL
of fresh medium) to remove planktonic bacteria and enhance
biofilm formation.
4. At the end of the desired biofilm formation period, remove all
media and planktonic bacteria by pipetting.
5. Wash the wells twice with 1 mL of saline solution.
Phage/Biofilm Interaction Methods 141
3.2 Biofilm Control After quantifying the numbers of viable cells in the biofilms, in at
with Bacteriophages least three independent experiments were performed in triplicate,
the efficacy of bacteriophages for biofilm control can be evaluated.
To maintain the infection parameters identical between the experi-
ments, a constant initial multiplicity of infection (MOI) must be
used. MOI is calculated according to the number of bacteriophages
per number of viable host cells and for instance, an MOI of 1 repre-
sents that there is one bacteriophage to each host cell (see Note 4).
1. After biofilm formation and washing (Subheading 3.1), add
950 μL of sterile media and 50 μL of bacteriophage at a proper
concentration to ensure the desired constant multiplicity of
infection (MOI) (see Note 5).
2. Incubate the plate in an incubator with an orbital shaker, at the
proper temperature during at least 4 h (see Note 6).
3. Take samples to quantify the numbers of bacteriophages and
viable cells (see Subheadings 3.3 and 3.4), respectively, present
in the planktonic stage (see Note 7).
4. Remove the spent media and wash twice with saline solution, to
remove unattached bacteria and phages.
5. Add 1 mL of fresh saline solution.
6. Use a cell scraper to scrape the biofilm from the surface.
7. Put the 24-well microplate on a sonication bath for 5 min.
8. Take samples to quantify the numbers of bacteriophages and
viable cells (see Subheadings 3.3 and 3.4), respectively, present
in the biofilm.
3.4 Biofilm Cell 1. In 96-well plates, serially dilute the bacterial samples in sterile
Enumeration saline solution (20 μL of sample in 180 μL of saline solution).
2. Add a drop of 20 μL of sample on placed in Petri plate contain-
ing solid medium (see Note 8).
3. Allow the drop to dry completely.
4. Incubate overnight at the proper growth temperature for
16–18 h.
5. Count the colonies formed in the drop of the dilution with
3–30 colonies.
6. Calculate the number of viable cells using Eq. 2.
No: of viable cells ðCFU per mLÞ
No: of colonies Dilution factor
¼ ð2Þ
Volume of sample ðmLÞ
3.5 Biomass 1. After biofilm washing step (Subheading 3.1) add methanol
Quantification by the (1 mL) to each well and allow fixation of biofilms to occur for
Crystal Violet Assay 15 min.
2. Remove the methanol and allow the wells to dry at room
temperature for about 20 min.
3. Add 1 mL of 1% crystal violet to each well and incubate for
5 min at room temperature without shaking.
4. Remove the excess of crystal violet with tap water.
5. Wash the wells twice with 1 mL of deionized water and allow
the wells to dry at room temperature.
6. Solubilize the dye crystals formed inside the cell by adding
1 mL of 33% acetic acid to each well.
7. Read the absorbance at 570 nm, using 33% acetic acid as blank.
Phage/Biofilm Interaction Methods 143
Fig. 1 Staining biofilm. (a) Biofilm fixation; (b) PNA FISH hybridization; (c) DAPI
staining
3.6 Biofilm Fixation After biofilms formed and washed (see Subheadings 3.1 and 3.2),
for Cell Microscopy the biofilm is fixed directly on the coupon and using PNA FISH
Techniques (specific stains) and DAPI staining (nonspecific stain) to assess the
biofilm spatial organization and the species distribution.
3.6.1 Hybridization 1. After washing the biofilms with the saline solution (see Sub-
Procedure in the Adhesion headings 3.1 and 3.2), apply a volume of methanol sufficient to
Substrata cover the entire surface (in this case add 1 mL in each well)
(Fig. 1a).
2. Incubate at room temperature during 15 min (see Note 9).
3. Remove excess of methanol with a paper towel, allow to air dry.
4. Apply enough paraformaldehyde, to cover the surface and let it
soak for 10 min. Remove paraformaldehyde excess as described
above.
144 Diana Vilas Boas et al.
3.6.2 PNA FISH 1. After fixation of the biofilm samples (see Subheading 3.6.1),
Hybridization and DAPI apply 20–40 μL of probe working solution in the well, cover
Staining with a coverslip, and incubate for 90 min at the proper hybri-
dization temperature in Petri dishes previously wrapped in
aluminum foil and with moist absorbent paper inside
(Fig. 1b) (see Note 10).
2. Fill a Coplin jar with washing solution and place in the hybri-
dization chamber, together with the coupons, to heat.
3. Remove coupons from the Petri dishes, remove the coverslip
and immerse coupons in the wash solution. Incubate for
30 min.
4. Remove coupons from the Coplin jar and allow to air dry
(in the dark).
5. Apply 100 μL of DAPI, and incubate for 10 min in dark
(Fig. 1c) (see Note 11).
6. Wash the samples with PBS, drain excess buffer, leave to air-dry.
7. Place the immersion oil and coverslip, and observe by fluores-
cence (fluorescence microscopy and/or confocal microscopy)
using an appropriate filter for the fluorochrome coupled to the
probe (see Notes 12 and 13).
4 Notes
References
1. Xavier JB, Picioreanu C, Abdul Rani S, van control of Pseudomonas aeruginosa PAO1
Loosdrecht MCM, Stewart PS (2005) and ATCC 10145 biofilms. Res Microbiol
Biofilm-control strategies based on enzymic 162:798–806
disruption of the extracellular polymeric sub- 7. Sillankorva S, Neubauer P, Azeredo J (2008)
stance matrix–a modelling study. Microbiology Pseudomonas fluorescens biofilms subjected to
151:3817–3832 phage phiIBB-PF7A. BMC Biotechnol 8:79
2. Cerqueira L, Oliveira JA, Nicolau A, Azevedo 8. Cerqueira L, Azevedo NF, Almeida C,
NF, Vieira MJ (2013) Biofilm formation with Jardim T, Keevil CW, Vieira MJ (2008) DNA
mixed cultures of Pseudomonas aeruginosa/ mimics for the rapid identification of microor-
Escherichia coli on silicone using artificial ganisms by fluorescence in situ hybridization
urine to mimic urinary catheters. Biofouling (FISH). Int J Mol Sci 9:1944–1960
29:829–840 9. Almeida C, Azevedo NF, Santos S, Keevil CW,
3. Bjarnsholt T (2013) The role of bacterial bio- Vieira MJ (2011) Discriminating multi-species
films in chronic infections. APMIS Suppl populations in biofilms with peptide nucleic
136:1–51 acid fluorescence in situ hybridization (PNA
4. Donlan RM (2001) Biofilms and device- FISH). PLoS One 6:e14786
associated infections. Emerg Infect Dis 10. Malic S, Hill KE, Hayes A, Percival SL, Thomas
7:277–281 DW, Williams DW (2009) Detection and iden-
5. Azeredo J, Sutherland I (2008) The use of tification of specific bacteria in wound biofilms
phages for the removal of infectious biofilms. using peptide nucleic acid fluorescent in situ
Curr Pharm Biotechnol 9:261–266 hybridization (PNA FISH). Microbiology
6. Pires D, Sillankorva S, Faustino A, Azeredo J 155:2603–2611
(2011) Use of newly isolated phages for
Chapter 12
Abstract
Like all viruses, bacteriophages heavily depend on their host’s physiology for reproduction. Therefore,
phages have evolved numerous proteins that influence the host metabolism to facilitate the infection
process. Some of these proteins strongly perturb the host cell, ultimately leading to cell death. These
growth-inhibitory phage proteins presumably target key metabolic processes, which may provide a basis for
innovative phage-derived antibacterials. Unfortunately, most of these proteins are the so-called ORFans,
since they have no known function or sequence homology to any other gene. We here describe a screening
method for the identification of growth-inhibitory ORFans of bacteriophages infecting gram-negative
bacteria (e.g., Pseudomonas aeruginosa), using the pUC18-mini-Tn7T-Lac vector system, which allows for
stable single-copy integration of the phage ORFans in the Pseudomonas genome under the control of an
IPTG-inducible promoter. Furthermore, we describe a method to examine the effect of the phage proteins
in different hosts, using different vector copy numbers. Finally, we explain how to investigate the effect of
ORFan expression on the host morphology using time-lapse microscopy.
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_12, © Springer Science+Business Media, LLC, part of Springer Nature 2019
147
148 Hanne Hendrix et al.
2 Materials
2.1 Cloning 1. Chemically competent E. coli cells, e.g., One Shot TOP10
of the Phage ORFan chemically competent E. coli (ThermoFisher Scientific, Wal-
tham, Massachusetts, USA).
2. pUC18-mini-Tn7T-Lac vector and the Gateway Vector Con-
version System (ThermoFisher Scientific).
3. LB medium: 10 g tryptone, 5 g yeast extract, 10 g NaCl, (15 g
agar). Bring up to 1 L with demineralized water and autoclave.
Cool down to room temperature before adding antibiotics.
4. Antibiotics: 1000 stock of kanamycin sulfate (50 mg/ml;
final concentration for selection: Km50 ¼ 50 μg/ml) and
1000 stock of ampicillin (100 mg/ml; final concentration
for selection: Amp100 ¼ 100 μg/ml).
5. Ultrapure water.
6. Mineral oil.
7. Glycerol.
8. Agarose.
9. Phage DNA as PCR template.
10. Primers:
ORFan primers
pENTR_F: GCGGCCGCCTTGTTTAAC
pENTR_R: GTCGGCGCGCCCACCCTT
pUC18-mini-Tn7T-LAC_F: CGGTTCTGGCAAATATTCTGA
pUC18-mini-Tn7T-LAC_R: GGAGGGGTGGAAATGGAGTT.
11. High fidelity DNA polymerase.
12. Taq DNA polymerase.
13. pENTR/SD/D-TOPO cloning kit (ThermoFisher Scientific).
14. 10 mM dNTP solution.
15. DNA marker.
16. Plasmid miniprep kit.
17. LR Clonase Enzyme mix (ThermoFisher Scientific).
18. Proteinase K.
150 Hanne Hendrix et al.
3 Methods
3.1 Cloning Because of the usually large numbers of ORFans and the need for
of the Phage ORFan several vector systems containing the same phage genes, we have
used the Gateway cloning system from ThermoFisher Scientific (see
Note 1). This system is based on exploiting the enzymes from
bacteriophage λ, utilized by this temperate phage for integration
and excision of the phage genome to and from a well-defined
location in the bacterial genome with the use of specific recognition
sites (attachment (att) sites) [7].
152 Hanne Hendrix et al.
3.1.1 Construction The ORFan genes are first amplified from start to stop codon using
of the Phage ORFan a high fidelity DNA polymerase and adding an extra 50 -CACC
Constructs in the pENTR overhang (see Note 2). Subsequently, they are cloned in the
Vector pENTR/SD/D-TOPO vector using the directional pENTR/
SD/D-TOPO Kit.
1. To construct an entry clone for each ORFan, always mix 0.5 μl
PCR product (see Note 3) with 0.25 μl pENTR/SD/D-
TOPO vector (see Note 4) and 1 μl of the provided salt solu-
tion in a final volume of 6 μl.
2. Incubate the mixture for 15 min at 22 C to ligate the PCR
products in the vector (see Note 5).
3. Transform the whole ligation mixture (6 μl) to chemically
competent E. coli cells. Plate the complete cell volume on one
LB plate containing Km50 (see Note 6).
4. To check the transformants using colony PCR, pick up 4 colo-
nies per construct in 100 μl LB/Km50. This can be done in a
96-well microtiter plate (see Note 7).
5. Grow them for 2 h at 37 C.
6. Transfer 2.5 μl of each cell suspension to a 96-well PCR plate
using a multichannel pipette and add the following compo-
nents to each well (see Note 8): 0.05 μl (0.25 U) DreamTaq
DNA polymerase, 0.5 μl 20 μM pENTR_F primer, 0.5 μl
20 μM pENTR_R primer, 2.5 μl 10 DreamTaq DNA poly-
merase Green buffer, 0.5 μl 10 mM dNTP mix, and 18.5 μl
ultrapure water (total volume of 25 μl). Mix everything by
pipetting up and down and spin down the mixture by centrifu-
gation. Finally add one drop of mineral oil on top of each well
(see Note 9).
7. Run the following PCR program in a heated PCR block (lid
temperature set at 99 C) (see Note 10): 5 min at 95 C;
30 cycles of 30 s at 95 C, 30 s at 54 C and 1 min 30 s at
72 C; 5 min at 72 C; hold at 12 C.
8. Once the program is running, prepare a temporary 20 C cell
stock of the picked colonies by adding 60 μl LB and 40 μl 100%
(v/v) glycerol to the remaining cell suspension. Also prepare a
1% agarose gel for DNA electrophoresis.
9. After the PCR, directly run 10 μl of the PCR product on the
solidified gel. Also add to each row of samples a DNA marker
(e.g., GeneRuler DNA Ladder Mix from ThermoFisher Scien-
tific). The expected length is the length of your ORFan gene
plus 57 bp derived from the vector backbone.
10. For each ORFan, select one correct transformant and inoculate
this clone from the 20 C cell stock in 4 ml LB/km50. Grow
overnight (see Note 11).
Screening for Inhibitory Phage Proteins 153
3.1.2 Gateway To express early phage proteins in P. aeruginosa PAO1, all phage
Subcloning to pUC18-Mini- genes are transferred to the E. coli—P. aeruginosa shuttle expres-
Tn7T-LAC-GW sion vector pUC18-mini-Tn7T-Lac [2, 3], which was first made
Gateway compatible using the “Gateway Vector Conversion Sys-
tem” following the instructions provided in the kit.
1. Prepare the following reaction mixture for each phage gene:
150 ng entry clone, 150 ng pUC18-mini-Tn7T-LAC-GW
destination vector, and 1 μl LR Clonase Enzyme mix in a final
volume of 5 μl (see Note 13).
2. Incubate for 2 h at 25 C.
3. Inactivate the enzyme mix for 10 min at 37 C by adding 0.5 μl
(1 μg) proteinase K solution (ThermoFisher Scientific).
4. Transform the entire ligation mixture (5 μl) to chemically
competent E. coli cells. Plate the complete cell volume on one
LB plate containing Amp100 (see note 14).
5. To again verify the transformants using colony PCR, follow
steps 4–10 of Subheading 3.1.1, but replace the Km50 by
Amp100. For the PCR program, change the primers to
pUC18-mini-Tn7T-LAC_F and R. Using these primers, the
expected length of the PCR product is the length of the ORFan
gene plus 443 bp.
6. Perform a plasmid miniprep of the pUC18-mini-Tn7T-
LAC_ORFan constructs. The construct should again be ver-
ified by DNA sequencing (e.g., Sanger sequencing). The
expected sequence from forward to reverse primer is 50 -CGG
TTCTGGCAAATATTCTGAAATGAGCTGTTGACAATTAA
TCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATA
ACAATTTCACACAGGAAACAGAATTCGAGCTCCTCACT
AGTGGATCCCCCATCAAACAAGTTTGTACAAAAAAGCA
GGCTCCGCGGCCGCCTTGTTTAACTTTAAGAAGGAGC
CCTTCACC – ORFan – AAGGGTGGGCGCGCCGACCC
AGCTTTCTTGTACAAAGTGGTTCGATGGGCTGCAGGAA
TTCCTCGAGA AGCTTGGGCCCGGTACCTCGCGAAGGC
CTTGCAGGCCAACCAGATAAGTGAAATCTAGTTCCAAA
CTATTTTGTCATTTTTAATTTTCGTATTAGCTTACGACG
CTACACCCAGTTCCCATCTATTTTGTCACTCTTCCCTA
AATAATCCTTAAAAACTCCATTTCCACCCCTCC-30 .
154 Hanne Hendrix et al.
3.2 Analysis Stable integration into the P. aeruginosa PAO1 genome is achieved
of the Toxicity by cotransformation of the pUC18-mini-Tn7T-Lac_ORFan con-
in Pseudomonas struct and the helper plasmid pTNS2 by electroporation to
aeruginosa P. aeruginosa PAO1. The helper plasmid (a suicide plasmid in
and Escherichia coli Pseudomonas) encodes the Tn7T site-specific transposition path-
way, which facilitates the insertion of the ORFan gene between
3.2.1 Chromosomal P. aeruginosa PAO1 genes PA5548 and PA5549, respectively
Integration into encoding a transporter protein and the glucosamine–fructose-6-
the P. aeruginosa Genome phosphate aminotransferase GlmS (Fig. 1). The in vivo phage
protein expression is under the control of an IPTG-inducible tac
promoter [2]. Although this method is described for P. aeruginosa
PAO1, it can also be applied to other bacteria, as long as the strain
contains a Tn7 attachment site (attTn7) downstream of a glmS
gene [2] (see Note 15).
1. For each ORFan, prepare an overnight culture of the wild-type
PAO1 strain in 4 ml LB medium.
2. The next day, follow the “10 min method to prepare electro-
competent P. aeruginosa cells” described by Choi et al. [8] to
Fig. 1 The pUC18-mini-Tn7T-LAC-GW vector system allows for single-copy expression of phage proteins in
P. aeruginosa. Cotransformation of a pUC18-mini-Tn7T-LAC-GW construct with pTNS2 (encoding TnsABCD
which mediates a site-specific Tn7 transposition pathway) to P. aeruginosa allows for specific integration of
the expression cassette (from Tn7TL to Tn7TR) between P. aeruginosa genes PA5548 and PA5549. As pUC18-
mini-Tn7T-LAC and pTNS2 do not contain an ori for P. aeruginosa, these plasmids are lost during cell division.
The expression cassette from left to right contains the phage gene behind a lac promoter, the lacIq repressor
which prevents basal expression from the lac promoter, a gentamicin resistance gene aacC1 (GmR) and the
transcriptional terminators T0 and T1 to prevent undesired readthrough from chromosomal promoters into
cloned sequences
Screening for Inhibitory Phage Proteins 155
3.2.2 Single Copy Once the correct P. aeruginosa strain is generated, the impact of the
Expression of the Phage phage ORFan on the bacterial growth can be tested. Both the
Protein in P. aeruginosa growth on solid medium and liquid medium is examined, as they
give complementary information about the phenotypical effect
caused by the phage protein. Both experiments are described with
nutritionally rich LB medium. However, it is hypothesized that
certain phage–host interactions may only be crucial under specific
physiological conditions (where the target is present and active).
Therefore, similar experiments can be done on well-defined mini-
mal growth medium for Pseudomonas [9] and on artificial sputum
medium [10], which mimics the sputum of a cystic fibrosis patient
where P. aeruginosa infections are common. First, a spot test on
solid LB medium is performed.
1. Prepare three overnight cultures of each mutant strain in a
96-well microtiter plate. Per well, inoculate a small volume of
20% glycerol stock (from step 13 of Subheading 3.2.1.) in
150 μl of LB/Gm30 (see Note 21). Incubate the plate over-
night at 37 C while shaking.
2. Make a 100-fold dilution series (100, 102, 104, 106) in
LB/Gm30 of each independent overnight culture in a 96-well
microtiter plate using a multichannel pipette.
3. Spot per dilution series in parallel 2 μl sample on LB/Gm30
solid medium with and without IPTG (see Note 22) using a
multichannel pipette (see Note 23). Repeat this step for each
mutant strain.
4. Incubate both plates overnight at 37 C.
5. Compare the growth of the mutant P. aeruginosa strains with
and without induction of expression of the phage protein. A
growth-inhibitory phage ORFan shows reduced bacterial
growth on solid medium with IPTG (see Note 24).
Next, the effect on growth in liquid medium is investi-
gated. In this setup, nutrients are more easily accessible,
which may give different results. Moreover, a growth curve
can give a first hint toward functional prediction. For example,
a growth curve similar to the growth curve of a wild-type
P. aeruginosa strain may indicate filamentous growth. Growth
curves of the individual strains are determined via a Bioscreen
(see Note 25).
6. Prepare overnight cultures similar to step 1.
7. Prepare a dilution of 1:100 in fresh LB/Gm30 for each culture
both with and without (control) IPTG to obtain a final volume
of 100 μl using a multichannel pipette. Transfer the cell dilu-
tions to a Honeycomb microplate (10 10 well plate) (see
Note 26).
Screening for Inhibitory Phage Proteins 157
3.2.3 High Level In Vivo Although single-copy expression is preferred, high-copy expression
Expression of the Phage may also be of interest, as the abundance of a phage protein during
Protein in P. aeruginosa infection is usually unknown. However, it should be noted that
and E. coli high-copy expression can lead to false-positive results due to
expression-associated toxicity. For a high level in vivo expression
of phage proteins in P. aeruginosa, the multicopy E. coli-P. aerugi-
nosa shuttle vector pHERD20T [5] is used, which was first made
Gateway compatible using the “Gateway Vector Conversion Sys-
tem” following the instructions provided in the kit (see Note 28).
This allows for an efficient transfer of the phage ORFan gene from
the already available pENTR/SD/D-TOPO_ORFan plasmid
(Subheading 3.1.1) into the Gateway-compatible pHERD20T
vector.
1. To construct the pHERD20T_ORFan, follow steps 1–6 of
Subheading 3.1.2. For the PCR program, use the primers
pHERD20T_F and pHERD20T_R, which results in a PCR
product with the length of the ORFan gene plus 338 bp. The
expected sequence from forward to reverse primer is 50 -ATCG
CAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGGC
TAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACA
TACCCATGGGATCTGATAAGAATTCGAGCTCGGTACCC
ATCACAAGTTTGTACAAAAAAGCAGGCTCCGCGGCCG
CCTTGTTTAACTTTAAGAAGGAGCCCTTCACC – ORFan
– AAGGGTGGGCGCG CCGACCCAGCTTTCTTGTACAA
AGTTGGTGGGGATCCTCTAGAGTCGACCTGCAGGCAT
GCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTG
ACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTT
GCA-30 .
2. The analysis of the toxicity is similar to steps 1–9 of Subhead-
ing 3.2.2. However, always use Cb200 instead of Gm30 and
induce the phage ORFan expression with 0.2% (w/v) arabi-
nose, as the phage gene is under control of an arabinose induc-
ible pBAD promoter.
Furthermore, to study potential conservation of the bacterial
target for these phage proteins between gram-negative bacteria, the
constructed pUC18-mini-Tn7T-Lac and pHERD20T can also be
tested in E. coli, in which both vectors are present in high copy
number. The analysis is analogous to steps 1–9 of Subheading
3.2.2.
158 Hanne Hendrix et al.
3.3 Live Cell Time To visualize the exerted effect of the toxic phage proteins on cell
Lapse Microscopy morphology and growth, time lapse microscopy is performed. To
this end, the bacteria are transferred to a solid matrix of medium
ensuring sufficient supply of nutrients to the cells during the exper-
iment. Moreover, due to the discontinuity of this matrix, enough
oxygen is present in the reservoir to warrant aerobic conditions.
These solid LB medium pads are made using a protocol also
described by de Jong et al. [11]. This article features an instructive
video of the protocol. The data acquired during time lapse micros-
copy is analyzed with Open source software Fiji.
1. Prepare an overnight culture of each mutant strain which con-
tains a growth-inhibitory ORFan.
2. The next day, start with preparing the agarose pads. First,
remove the plastic foil from one side of the gene frame and
carefully attach this end to a clean microscope glass slide. The
glue assures fixation of the gene frame on the microscope glass
slide.
3. Take a 50 ml falcon containing 75 mg of agarose and add 5 ml
of LB.
4. Boil the mixture in the microwave and assure complete disso-
lution of the agarose.
5. Add 5 μl of 1 M IPTG (1 mM) together with 5 μl Gm30 to the
falcon and vortex briefly to homogenize the mixture.
6. Transfer 500 μl of the LB–agarose mixture inside the attached
gene frame.
7. Mount a clean coverslip on top of the warm medium and gently
press the four corners to assure formation of a planar
agarose pad.
8. Allow the LB-agarose to solidify; these pads can be kept at 4 C
up to a day if necessary (see Note 29).
9. Prewarm the pad at 37 C, preferably at least 2 h before the
start of the experiment.
10. Cut squares of approximately 5 5 mm out of the pad with a
sterile scalpel. Repeat step 1 to make a new microscope glass
slide with gene frame and transfer to the latter the cut squares
with the tip of a scalpel (see Note 30). Multiple pads can be
positioned next to each other inside one 1.7 2.8 cm gene
frame (see Note 31).
11. Dilute the overnight culture 1:100 in LB medium to obtain an
end concentration of approximately 1.107 CFU/ml. This dilu-
tion prevents bacteria being positioned to close to each other,
thus decreasing the risk of nutritional deprivation during
growth under the microscope.
Screening for Inhibitory Phage Proteins 159
4 Notes
References
Abstract
Alternative infection models of bacterial pathogenesis are useful because they reproduce some of the disease
characteristics observed in higher animals. Insect models are especially useful for modeling bacterial
infections, as they are inexpensive, generally less labor-intensive, and more ethically acceptable than
experimentation on higher organisms. Similar to animals, insects have been shown to possess innate
immune systems that respond to pathogenic bacteria.
Key words Galleria mellonella, Insects, Infection model, Wax worm, Pathogenesis, Larvae
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_13, © Springer Science+Business Media, LLC, part of Springer Nature 2019
163
164 Fatima Kamal et al.
Fig. 1 Galleria mellonella larvae in a 10 cm diameter petri dish. For three of the
larvae (between 2 and 4 o’clock on the petri dish), the wax worms are
unresponsive to touch, and have turned dark brown due to melanization 48 h
following infection with a lethal dose of pathogenic bacteria
There are several instances where the wax moth larvae infection
model has also been employed to test the efficacy of bacteriophage
activity against pathogenic bacteria in vivo. In these experiments,
phages are observed to rescue of the wax worms challenged with
lethal doses of pathogenic bacteria. Unlike some seedling- or plant-
infection models that have been observed to inactivate or reduce
the activity of applied phages [27, 34], the wax worm infection
model produces negligible phage inactivation, and provides a ther-
apeutic treatment environment more similar to that observed in
higher organisms such as mice. Examples of different pathogenic
bacteria being successfully treated by bacteriophage application in
the wax worm infection model include the Burkholderia cepacia
complex [5, 34–36], Clostridioides difficile [37], Cronobacter saka-
zakii [38], Klebsiella pneumoniae [39], and Pseudomonas aerugi-
nosa [40–46].
2 Materials
3 Methods
3.2 Additional 1. For time-to-death experiments, live versus dead larvae are
Experimental monitored every 6–12 h postinfection. G. mellonella larvae
Protocols are injected with serially diluted bacteria as before and moni-
tored for their survival over a 72-h period. Three independent
trials are conducted consisting of 10 worms per bacterial con-
centration for each bacterial strain. No more than one control
larva should die in any given trial. In instances where greater
than one control larva die, the data from infected larvae should
not be not used (see Notes 6 and 7).
2. To monitor bacterial loads in larval hemolymph over time,
larvae are injected with between 500 and 800 colony-forming
units (CFU). For more virulent bacteria, this number of CFU
can be reduced. For the zero time point, larvae are infected and
allowed to sit for 20 min before their hemolymph is collected.
Equal volumes of hemolymph are collected from five living
worms at each time point and combined into a microcentrifuge
tube, serially diluted, and plated onto agar for quantification.
Three groups of five larvae are used for each time point in order
to quantify bacterial loads. To extract the hemolymph, place
the petri dish containing the wax worms on ice, until no
movement of the larvae is observed. With a scalpel, make an
incision between two larval segments near the larva tail, and
squeeze the hemolymph into a microfuge tube. Each larva
produces approximately 15–50 μl of hemolymph.
3. During hemolymph extraction it is easy to accidentally disrupt
the wax moth larval gut, resulting in sample contamination. To
reduce the chance of contamination, cut the larvae nearest the
tail and away from the gut. To prevent the hemolymph from
coagulating and turning brown, the hemolymph must be pro-
cessed within 10 min of collection. Autoclave and dispose of wax
worm larvae according to local safety rules (see Notes 8 and 9).
4 Notes
Acknowledgments
References
1. Hendrickson EL, Plotnikova J, Mahajan-Miklos- model for the Burkholderia cepacia complex.
S, Rahme LG, Ausubel FM (2001) Differential Infect Immun 76(3):1267–1275
roles of the Pseudomonas aeruginosa PA14 rpoN 5. Seed KD, Dennis JJ (2009) Experimental bac-
gene in pathogenicity in plants, nematodes, teriophage therapy increases survival of Galle-
insects, and mice. J Bacteriol 183:7126–7134 ria mellonella larvae infected with clinically
2. Jander G, Rahme LG, Ausubel FM (2000) relevant strains of the Burkholderia cepacia
Positive correlation between virulence of Pseu- complex. Antimicrob Agents Chemother 53
domonas aeruginosa mutants in mice and (5):2205–2208. https://doi.org/10.1128/
insects. J Bacteriol 182:3843–3845 AAC.01166-08 PubMed PMID: 19223640
3. Miyata S, Casey M, Frank DW, Ausubel FM, 6. Lithgow KV, Scott NE, Iwashkiw JA, Thom-
Drenkard E (2003) Use of the Galleria mello- son EL, Foster LJ et al (2014) A general pro-
nella caterpillar as a model host to study the tein O-glycosylation system within the
role of the type III secretion system in Pseudo- Burkholderia cepacia complex is involved in
monas aeruginosa pathogenesis. Infect Immun motility and virulence. Mol Microbiol 92
71:2404–2413 (1):116–137
4. Seed KD, Dennis JJ (2008) Development of 7. Fedhila S, Daou N, Lereclus D, Nielsen-
Galleria mellonella as an alternative infection LeRoux C (2006) Identification of Bacillus
170 Fatima Kamal et al.
cereus internalin and other candidate virulence production and virulence of Aspergillus fumi-
genes specifically induced during oral infection gatus in Galleria mellonella. Mycopathologia
in insects. Mol Microbiol 62:339–355 158:73–79
8. Aperis G, Burgwyn Fuchs B, Anderson CA, 19. St. Leger RJ, Screen SE, Shams-Pirzadeh B
Warner JE, Calderwood SB et al (2007) Galle- (2000) Lack of host specialization in Aspergil-
ria mellonella as a model host to study infec- lus flavus. Appl Environ Microbiol
tion by the Francisella tularensis live vaccine 66:320–324
strain. Microbes Infect 9:729–734 20. Cotter G, Doyle S, Kavanagh K (2000) Devel-
9. Sousa PS, Silva IN, Moreira LM, Verı́ssimo A, opment of an insect model for the in vivo path-
Costa J (2018) Differences in virulence ogenicity testing of yeasts. FEMS Immunol
between legionella pneumophila isolates from Med Microbiol 27:163–169
human and non-human sources determined in 21. Borman AM (2018) Of mice and men and
galleria mellonella infection model. Front Cell larvae: Galleria mellonella to model the early
Infect Microbiol 8:97 host-pathogen interactions after fungal infec-
10. Rakic Martinez M, Wiedmann M, Ferguson M, tion. Virulence 9(1):9–12
Datta AR (2017) Assessment of Listeria mono- 22. Wuensch A, Trusch F, Iberahim NA, van West
cytogenes virulence in the Galleria mellonella P (2018) Galleria melonella as an experimental
insect larvae model. PLoS One 12(9):e0184557 in vivo host model for the fish-pathogenic
11. Entwistle FM, Coote PJ (2018) Evaluation of oomycete Saprolegnia parasitica. Fungal Biol
greater wax moth larvae, Galleria mellonella, as 122(2-3):182–189
a novel in vivo model for non-tuberculosis 23. Champion OL, Cooper IA, James SL, Ford D,
Mycobacteria infections and antibiotic treat- Karlyshev A, Wren BW, Duffield M, Oyston
ments. J Med Microbiol 67(4):585–597 PC, Titball RW (2009) Galleria mellonella as
12. Meir M, Grosfeld T, Barkan D (2018) Estab- an alternative infection model for Yersinia pseu-
lishment and validation of Galleria mellonella dotuberculosis. Microbiology 155
as a novel model organism to study Mycobacte- (Pt 5):1516–1522. https://doi.org/10.
rium abscessus infection, pathogenesis, and 1099/mic.0.026823-0
treatment. Antimicrob Agents Chemother 62 24. Hoffmann JA (1995) Innate immunity of
(4):e02539-17 insects. Curr Opin Immunol 7:4–10
13. Morton DB, Dunphy GB, Chadwick JS (1987) 25. Gourbal B, Pinaud S, Beckers GJM, Van Der
Reactions of hemocytes of immune and Meer JWM, Conrath U, Netea MG (2018)
non-immune Galleria mellonella larvae to Pro- Innate immune memory: An evolutionary per-
teus mirabilis. Dev Comp Immunol 11:47–55 spective. Immunol Rev 283(1):21–40. https://
14. Wang-Kan X, Blair JMA, Chirullo B, Betts J, La doi.org/10.1111/imr.12647
Ragione RM, Ivens A, Ricci V, Opperman TJ, 26. Cooper D, Eleftherianos I (2017) Memory and
Piddock LJV (2017) Lack of AcrB efflux function specificity in the insect immune system: current
confers loss of virulence on Salmonella enterica perspectives and future challenges. Front
serovar typhimurium. MBio 8(4):e00968-17 Immunol 8:539. https://doi.org/10.3389/
15. Mannala GK, Koettnitz J, Mohamed W, fimmu.2017.00539
Sommer U, Lips KS, Spröer C, Bunk B, 27. Vilmos P, Kurucz E (1998) Insect immunity:
Overmann J, Hain T, Heiss C, Domann E, Evolutionary roots of the mammalian innate
Alt V (2018) Whole-genome comparison of immune system. Immunol Lett 62:59–66
high and low virulent Staphylococcus aureus iso- 28. Yu XQ, Zhu YF, Ma C, Fabrick JA, Kanost MR
lates inducing implant-associated bone infec- (2002) Pattern recognition proteins in Man-
tions. Int J Med Microbiol S1438-4221 duca sexta plasma. Insect Biochem Mol Biol 32
(17):30603–30603 (10):1287–1293
16. Pérez-Reytor D, Garcı́a K (2018) Galleria mel- 29. Ishii K, Hamamoto H, Kamimura M,
lonella: a model of infection to discern novel Nakamura Y, Noda H, Imamura K, Mita K,
mechanisms of pathogenesis of non-toxigenic Sekimizu K (2010) Insect cytokine paralytic
Vibrio parahaemolyticus strains. Virulence 9 peptide (PP) induces cellular and humoral
(1):22–24 immune responses in the silkworm Bombyx
17. Mylonakis E, Moreno R, El Khoury JB, mori. J Biol Chem 285(37):28635–28642.
Idnurm A, Heitman J et al (2005) Galleria https://doi.org/10.1074/jbc.M110.138446
mellonella as a model system to study Crypto- 30. Paro S, Imler J-L (2016) Immunity in insects.
coccus neoformans pathogenesis. Infect Immun In: Ratcliffe MJH (ed) Encyclopedia of immu-
73:3842–3850 nobiology, vol 1. Academic Press, San Diego,
18. Reeves EP, Messina CG, Doyle S, Kavanagh K pp 454–461
(2004) Correlation between gliotoxin
Use of Greater Wax Moth Larvae (Galleria mellonella). . . 171
31. Kavanagh K, Reeves EP (2004) Exploiting the mellonella infection model. Int J Antimicrob
potential of insects for in vivo pathogenicity Agents 46(2):196–200. https://doi.org/10.
testing of microbial pathogens. FEMS Micro- 1016/j.ijantimicag.2015.04.005 PubMed
biol Rev 28:101–112 PMID: 26100212
32. Brennan M, Thomas DY, Whiteway M, Kava- 41. Latz S, Krüttgen A, H€afner H, Buhl EM, Ritter
nagh K (2002) Correlation between virulence K et al (2017) Differential effect of newly
of Candida albicans mutants in mice and Gal- isolated phages belonging to PB1-like,
leria mellonella larvae. FEMS Immunol Med phiKZ-like and LUZ24-like viruses against
Microbiol 34:153–157 multi-drug resistant Pseudomonas aeruginosa
33. Kocharunchitt C, Ross T, McNeil DL (2009) under varying growth conditions. Viruses 9
Use of bacteriophages as biocontrol agents to (11):E315. https://doi.org/10.3390/
control Salmonella associated with seed sprouts. v9110315 PMID: 29077053
Int J Food Microbiol 128(3):453–459. https:// 42. Forti F, Roach DR, Cafora M, Pasini ME,
doi.org/10.1016/j.ijfoodmicro.2008.10.014 Horner DS et al (2018) Design of a broad-
PubMed PMID:18996610 range bacteriophage cocktail that reduces Pseu-
34. Kamal F, Dennis JJ (2015) Burkholderia cepa- domonas aeruginosa biofilms and treats acute
cia complex Phage-Antibiotic Synergy (PAS): infections in two animal models. Antimicrob
antibiotics stimulate lytic phage activity. Appl Agents Chemother:AAC.02573–AAC.02517.
Environ Microbiol 81(3):1132–1138. https:// https://doi.org/10.1128/AAC.02573-17
doi.org/10.1128/AEM.02850-14 PMID: PMID: 29555626
25452284 43. Muszyńska-Pytel M, Mikołajczyk P, Pszczółk-
35. Lynch KH, Abdu AH, Schobert M, Dennis JJ owski MA, Cymborowski B (1992) Juveniliz-
(2013) Genomic characterization of JG068, a ing effect of ecdysone mimic RH 5849 in
novel virulent podovirus active against Bur- Galleria mellonella larvae. Experientia 48
kholderia cenocepacia. BMC Genomics (10):1013–1017
14:574. https://doi.org/10.1186/1471- 44. Kwadha CA, Ong’amo GO, Ndegwa PN,
2164-14-574 PMID: 23978260 Raina SK, Fombong AT (2017) The biology
36. Lynch KH, Seed KD, Stothard P, Dennis JJ and control of the greater wax moth, Galleria
(2010) Inactivation of Burkholderia cepacia mellonella. Insects 8(2):E61. https://doi.org/
complex phage KS9 gp41 identifies the phage 10.3390/insects8020061
repressor and generates lytic virions. J Virol 84 45. Dutsky SR, Thompson JV, Cantwell GE
(3):1276–1288. https://doi.org/10.1128/ (1962) A technique for mass rearing of the
JVI.01843-09 PMID: 19939932 greater wax moth (Lepidoptera : Galleridae).
37. Nale JY, Chutia M, Carr P, Hickenbotham PT, Proceed Entomol Soc Washington 64:56–58
Clokie MR (2016) ’Get in early’; Biofilm and 46. Mohamed MA, Coppel HC (1983) Mass rear-
wax moth (Galleria mellonella) models reveal ing of the greater wax moth, Galleria mello-
new insights into the therapeutic potential of nella (Lepidoptera : Pyralidae), for small-scale
Clostridium difficile bacteriophages. Front laboratory studies. Great Lakes Entomol 16
Microbiol 7:1383. https://doi.org/10.3389/ (4):139–141
fmicb.2016.01383 PubMed PMID: 27630633 47. Rahman A, Bharali P, Borah L, Bathari M, Taye
38. Abbasifar R, Kropinski AM, Sabour PM, RR (2017) Post embryonic development of
Chambers JR, MacKinnon J et al (2014) Galleria mellonella L. and its management
Efficiency of bacteriophage therapy against strategy. J Entomol Zoo Stud 5(3):1523–1526
Cronobacter sakazakii in Galleria mellonella 48. Meylaers K, Freitak D, Schoofs L (2007) Immu-
(greater wax moth) larvae. Arch Virol 159 nocompetence of Galleria mellonella: sex- and
(9):2253–2261. https://doi.org/10.1007/ stage-specific differences and the physiological
s00705-014-2055-x PubMed PMID: cost of mounting an immune response during
24705602 metamorphosis. J Insect Physiol 53(2):146–156
39. D’Andrea MM, Marmo P, Henrici De Angelis L, 49. Marek M (1979) Influence of cooling and glyc-
Palmieri M et al (2017) φBO1E, a newly discov- erol on metabolism of proteins and esterase
ered lytic bacteriophage targeting isoenzymes in hemolymph of pupae Galleria
carbapenemase-producing Klebsiella pneumo- mellonella (L.). Comp Biochem Physiol A 63
niae of the pandemic Clonal Group 258 clade II (4):489–492
lineage. Sci Rep 7(1):2614. https://doi.org/10. 50. Browne N, Heelan M, Kavanagh K (2013) An
1038/s41598-017-02788-9 PMID: 28572684 analysis of the structural and functional simila-
40. Beeton ML, Alves DR, Enright MC, Jenkins rities of insect hemocytes and mammalian pha-
AT (2015) Assessing phage therapy against gocytes. Virulence 4(7):597–603
Pseudomonas aeruginosa using a Galleria
Chapter 14
Abstract
Antibiotic-resistant bacteria can cause intractable infections in humans and animals, with damaging effects
to health care and economics. Phage therapy is considered a possible alternative to chemotherapy for
treating infections, but still requires laborious in vivo experiments before its introduction into society and
its further development. Recently, silkworm larvae have been recognized as highly convenient and useful
model animals, and an alternative to higher animals. We describe the procedure for experimental phage
therapy to treat Staphylococcus aureus infections in silkworm larvae.
Key words Animal model, Phage purification, Phage therapy, Silkworm larvae, Staphylococcus aureus
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_14, © Springer Science+Business Media, LLC, part of Springer Nature 2019
173
174 Jumpei Uchiyama et al.
2 Materials
3 Methods
&UXGH
SKDJH
VDPSOH
,RGL[DQRO 6DOLQH
,RGL[DQRO
3KDJH 3KDJH
EDQG EDQG
3.2 Silkworm Larvae 1. Silkworm larvae in the larval housing cage are maintained at
Experiment 27 C in an incubator (Fig. 2a). On the final day of the fourth
instar, silkworm larvae are fed for 1 day with antibiotic-free
3.2.1 Preparation
artificial food (see Note 6). On the following day (i.e., the first
for Phage Therapy
day of the fifth instar), the silkworm larvae are used in the
Experiments Using
experiments.
Silkworm Larvae
2. The safety of the phage itself and the vehicles, i.e., iodixanol
and HIMC, is examined. 0.05 mL of the phage suspension,
40% iodixanol, and HIMC are administered into the hemo-
lymph via the dorsal surface of the silkworm larvae using a
32-gauge disposable needle and a 1 mL sterilized disposable
plastic syringe (Fig. 2b) (see Note 7). The silkworm larvae are
then kept in a new clean silkworm larva housing cage without
feeding. The survival and behavior of the larvae are recorded
daily for 1 week. If lethality is not observed after the adminis-
tration of any of the samples into the silkworm larvae, the
phage therapy experiment can be performed.
3.2.2 Phage Therapy 1. The bacteria are cultured in tryptic soy broth until the mid-log
Experiment Using Silkworm phase and are then washed three times with saline and sus-
Larvae pended in sterilized saline. Bacterial suspensions are prepared
at various concentrations using a densitometer/colorimeter
and a Petroff-Hausser counting chamber (see Note 8).
0.05 mL of each bacterial suspension is injected into the hemo-
lymph via the dorsal surface of the silkworm larva (see Note 7)
(Fig. 2b). The infected silkworm larvae are kept in new clean
larval housing cages without feeding. The lethality and
Use of a Silkworm Larva Model in Phage Therapy Experiments 177
Fig. 2 (a) Silkworm larva housing cage. The lid is opened (left) and closed with a rubber band (right). (b)
Injection procedure in silkworm larvae. The silkworm larva is held with the fingers (left) and the needle is
178 Jumpei Uchiyama et al.
4 Notes
Fig. 2 (continued) inserted into the dorsal vessel via the dorsal surface of the silkworm larva, where a
maximum of 0.05 mL is injected slowly into the hemolymph (right). (c) Results of the silkworm larva infection
experiments with S. aureus strains SA27 (top) and SA14 (bottom). S. aureus strain SA27 was more sensitive to
phage S25-4 than SA14. The bacterial dose, i.e., the minimal bacterial concentration that obtained 100%
lethality on day two, was selected for further experiments, i.e., 3.9 107 and 1.6 107 cells of strains SA27
and SA14, respectively. These figures are drawn based on the supplementary Tables S2 and S3 of reference 10
Use of a Silkworm Larva Model in Phage Therapy Experiments 179
Fig. 3 Phage therapy experiments using the staphylococcal silkworm larva infection model with phage S25-4.
(a) Procedure for phage administration into silkworm larvae. Phage S25-4 is classified in the family
Myoviridae, genus Kayvirus [15, 16]. Photograph of the silkworm larvae (left). The arrows with “B” and “P”
indicate the sites of bacterial inoculation and of phage administration respectively. After the silkworm larvae
are infected, as shown in Fig. 2b, the phage is administered via the opposite side of the silkworm larva’s
dorsal surface relative to the site inoculated with bacteria (right). (b) Results of the phage therapy experiments
using S. aureus phage S24-4. Silkworm larvae were infected with S. aureus strain SA27 (left and middle
columns) or SA14 (right column). Then, phage was administered at 10 min (left and right columns) or 6 h after
infection (middle column). The survival rates of the silkworm larvae were recorded daily. Five silkworm larvae
were tested in each treatment group. The phage therapy experiments were performed in triplicate (15 silk-
worm larvae in total) and negative control experiments were performed in quadruplicate (20 silkworm larvae in
total). The survival rates were calculated by the total number of surviving silkworm larvae in the replicate
experiments. Symbols in the left and right columns: ○, MOI of 1; △, MOI of 10 2; □, MOI of 10 4; ●, HIMC-
treated control. Symbols in the middle column: ○, MOI of 1; △, MOI of 10 1; ●, HIMC-treated control.
According to Fisher’s exact test, the survival rates of the phage-treated (MOI of 1) and HIMC-treated groups in
all the panels differed significantly on day two (P < 0.01). The phage-administered groups exhibited longer
life-prolonging effects than the HIMC-administered groups
Acknowledgments
References
Abstract
Nonmammalian infection models have been exploited to understand the various aspects of host-pathogen
interactions and also provided innovative research platforms for identification of virulence factors, screening
for antimicrobial hits, and evaluation of antimicroial efficacy. Here we describe a relatively straightforward
protocol to assess the antibacterial efficacy of bacteriophages (phages) toward the opportunistic human
pathogen, Pseudomonas aeruginosa, based on the systemic infection model using the fruit fly, Drosophila
melanogaster. Since phages, unlike antibacterial chemicals, can be easily and sensitively enumerated by
simple assays, it is also possible to address the pharmacokinetic properties of administered phages even in
this small-scale infection model.
Key words Small-scale, Infection model, Drosophila melanogaster, Pseudomonas aeruginosa, Phage,
Antibacterial efficacy, Pharmacokinetics
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_15, © Springer Science+Business Media, LLC, part of Springer Nature 2019
183
184 Hye-Jeong Jang et al.
2 Materials
Prepare all media and solutions using sterilized water and reagents.
Autoclave is required for all the supplies except for cornmeal media.
Prepare and store all reagents at room temperature (unless other-
wise indicated). Follow the waste disposal regulations when dispos-
ing waste materials and the biosafety guidelines when using
bacterial cultures as described elsewhere [12].
2.1 Fly Maintenance 1. Fly stocks: Store live fly strains at 25 C in cornmeal media.
These can be obtained from: Carolina Biological Supply Com-
pany (http://www.carolina.com/), UC San Diego Drosophila
Stock Center (https://stockcenter.ucsd.edu/info/welcome.
php), Bloomington Drosophila Stock Center at Indiana Uni-
versity (https://bdsc.indiana.edu/), or Ward’s Science
(https://www.wardsci.com/).
Antibacterial Efficacy Evaluation using Drosophila 185
2.2 Phage 1. Phage stocks: Store phage strains at 80 C in a 2:1 mixture of
Preparation phage solution and 60% glycerol or at 4 C in phage buffer (see
Note 1).
2. Phage buffer: 10 mM MgSO4, 10 mM Tris (pH 7.6),
1 mM EDTA.
3. Top agar: 0.7% Bacto agar.
2.3 Bacterial Culture 1. PA stocks: Store bacterial strains at 80 C in a 2:1 mixture of
LB culture broth and 60% glycerol.
2. LB broth: 1% tryptone, 0.5% yeast extract, 1% NaCl.
3. LB agar plate: 1% tryptone, 0.5% yeast extract, 1% NaCl, 2%
Bacto agar.
4. Cetrimide agar plate: 4.53% cetrimide agar (Difco), 1%
glycerol.
2.4 Fly Infection 1. Fly equipments with fly pad for CO2 anesthesia.
2. Sterilized 0.4-mm tungsten needle (see Note 2).
3. Phosphate buffered saline (PBS; 1) solution: 137 mM NaCl,
2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4.
3 Methods
3.1 Fly Preparation 1. Grow the fly strain on cornmeal media (see Note 3).
2. Collect newly hatched female flies and keep them to the age of
5–7 days at 25 C (see Note 4).
3. Perform the experiments using 15–30 flies per group.
3.3 Bacterial 1. Streak frozen glycerol stock of PA onto a fresh LB agar plate
Preparation and incubate overnight (~14 h) at 37 C (see Note 6).
2. Inoculate single colonies from the plates into culture tubes
containing 3 mL LB broth and incubate overnight at 37 C.
3. Subculture by diluting the culture in 3 mL LB so that the optical
density at 600 nm (OD600) is 0.05 and incubate the culture at
37 C until the OD600 reaches 2.7–3.0, which corresponds
to ~109 colony-forming unit (CFU)/mL (see Note 7).
4. Centrifuge 1 mL of the culture aliquot for 2 min at 6000 g
and discard the supernatant.
5. Wash once using 1 mL of PBS and then centrifuge as in step 4.
6. Resuspend the bacteria in 1 mL of PBS and prepare the bacte-
rial suspension with OD600 of 0.03 (i.e., ~107 CFU/mL) by
serially diluting the cells in PBS (see Note 8).
3.4 Measurement 1. Transfer the flies into an empty fly vial for starvation for 3 h.
of Pharmacokinetics 2. After 3-h starvation, transfer the flies into a sucrose media
containing appropriate amount of phages and store the vials
at 25 C for 12 h (see Note 5).
3. Transfer the fed flies into a fresh sucrose media without phages.
4. Remove 3–6 flies from the vial at every 12 h and homogenize
each fly individually in 100 μL of phage buffer using a plastic
pestle (see Note 9).
5. Determine the phage titer in the homogenates by measuring
the PFUs. Two assays (spotting and plaquing) are generally
performed (see Note 10) (Fig. 1).
3.5 Systemic 1. Anesthetize the flies with CO2 and place them as a group on
Infection the fly pad.
2. Dip the sterilized 0.4-mm tungsten needle into PBS-diluted
bacterial suspension with the OD600 of 0.03 (see Note 11).
3. Prick the dorsal thorax by inserting the tip of the needle into
the thorax (see Note 12) (Fig. 2).
4. Repeat steps 2–3 until all flies in the group have been infected.
5. Transfer the infected flies to the sucrose media with or without
phages and incubate the vials at 25 C.
A 5 B 5
MPK1 MPK6
4 (5´107) 4 (5´107)
Log(PFU/fly)
Log(PFU/fly)
3 3
2 2
1 1
0 0
0 12 24 36 48 0 12 24 36 48
( )
Time (h) Time ((h))
C 7 D 6
6 5
Logg(PFU/flyy)
Logg(PFU/flyy)
5 4
4
3
3
2 D3112 2 PP7
1 (1010) 1 (109)
0 0
0 12 24 36 48 0 12 24 36 48
Time (h) Time (h)
Fig. 1 Pharmacokinetics of PA phages. Phage samples (in 50 μL of PBS) of MPK1 (a; myophage, square),
MPK6 (b; podophage, diamond), D3112 (c; siphophage, triangle), and PP7 (d; leviphage, circle) were overlaid
on the surface of the 1-mL sucrose media. Groups of flies (n ¼ 5) were collected at 0.5, 12, 24, 36, and 48 h
and their homogenates were removed to measure the PFU per fly, which is shown in a log scale. The amounts
of phages administered in the sucrose media are designated
Fig. 2 Fly systemic infection. The flies are softly pricked (less than 0.2 mm deep)
with a 0.4-mm tungsten needle that has been slightly dipped into the bacterial
suspension. The dorsolateral thorax is punctured with the tip of the needle. (a)
Top view; (b) side view
188 Hye-Jeong Jang et al.
A B 100
100
25 25
0 0
0 12 24 36 48 0 12 24 36 48
Time ((h)) Time ((h))
C D
100 100
Survvival rate (%)
4 Notes
14. Exclude the flies that die before 12-h postinfection, since this
“initial” death is likely a result of mechanical injury or septic
shock. The percentage of the “initial” death should not exceed
5%, otherwise the survival rate can be confounded.
Acknowledgments
We are grateful to the members of the Cho Lab for their technical
assistance and helpful comments. This work was supported by the
National Research Foundation of Korea (NRF) Grant
(NRF-2017R1A2B3005239).
References
1. Shirasu-Hiza MM, Schneider DS (2007) Con- multihost virulence factors of Pseudomonas aer-
fronting physiology: how do infected flies die? uginosa PA14 and identification of a virulence-
Cell Microbiol 12:2775–2783 attenuating factor, HudA. Infect Immun
2. Lemaitre B, Hoffmann JA (2007) The host 76:4152–4162
defense of Drosophila melanogaster. Annu Rev 8. Apidianakis Y, Rahme LG (2009) Drosophila
Immunol 25:697–743 melanogaster as a model host for studying Pseu-
3. Hoffmann JA, Reichhart JM (2002) Drosophila domonas aeruginosa infection. Nat Protoc
innate immunity: an evolutionary perspective. 9:1285–1294
Nat Immunol 2:121–126 9. Heo Y-J, Lee Y-R, Jung H-H, Lee J, Ko G,
4. D’Argenio DA, Gallagher LA, Berg CA, Man- Cho Y-H (2009) Antibacterial efficacy of
oil C (2001) Drosophila as a model host for phages against Pseudomonas aeruginosa infec-
Pseudomonas aeruginosa infection. J Bacteriol tions in mice and Drosophila melanogaster.
183:1466–1471 Antimicrob Agents Chemother 53:2469–2474
5. Lau GW, Goumnerov BC, Walendziewicz CL, 10. Chung I-Y, Sim N, Cho Y-H (2012) Antibac-
Hewitson J, Xiao W, Mahajan-Miklos S, Tomp- terial efficacy of temperate phage-mediated
kins RG, Perkins LA, Rahme LG (2003) The inhibition of bacterial group motilities. Antimi-
Drosophila melanogaster Toll pathway partici- crob Agents Chemother 56:5612–5617
pates in resistance to infection by the gram- 11. Bae H-W (2014) Antibacterial efficacy and
negative human pathogen Pseudomonas aeru- host spectrum of a Pseudomonas aeruginosa
ginosa. Infect Immun 71:4059–4066 RNA phage. Ph.D Thesis, Korea: CHA
6. Lee J-S, Heo Y-J, Lee JK, Cho Y-H (2005) University
KatA, the major catalase, is critical for osmo- 12. Lee, Y-J, Jang, H-J, Chung, I-Y, and Cho, Y-H
protection and virulence in Pseudomonas aeru- (2018) Drosophila melanogaster as a polymicro-
ginosa PA14. Infect Immun 73:4399–4403 bial infection model for Pseudomonas aerugi-
7. Kim S-H, Park S-Y, Heo Y-J, Cho Y-H (2008) nosa and Staphylococcus aureus. J Microbiol
Drosophila melanogaster-based screening for 56:534–541.
Chapter 16
Abstract
Alternative animal host models of bacterial infection have been developed which reproduce some of the
disease conditions observed in higher animals. Analogously, plants are useful for modeling bacterial
pathogenesis, in some cases revealing broadly conserved infection mechanisms. Similar to animals, plants
have been shown to possess innate immune systems that respond to invading viruses, bacteria, and fungi.
Plant infection models often yield results faster, are more convenient, and less expensive than many animal
infection models. Here, we describe the use of two different plant-based infection models for the discovery
of virulence genes and factors involved in bacterial pathogenesis.
Key words Bacteria, Pathogenesis, Infection models, Virulence, Virulence factors, Duckweed, Alfalfa
1 Introduction
A number of animal models, such as for mice and rats [1–5], have
been adapted for bacterial infection studies. In addition, several
alternative animal infection models have been developed, including
Galleria mellonella (greater wax moth) larvae [6], Drosophila mel-
anogaster (common fruit fly) [7], Caenorhabditis elegans (nema-
tode) [8], and Danio rerio (zebrafish) embryos [9], applying
protocols which have been outlined in this volume. These models
reproduce some of the disease conditions observed in higher ani-
mals. However, plants are also gaining recognition for their useful-
ness in modeling bacterial pathogenesis, in some cases revealing
broadly conserved infection mechanisms [10–13]. Similar to ani-
mals, plants have been shown to possess innate immune systems
that respond to invading viruses, bacteria, and fungi [14, 15] with
the production of oxidative bursts, antimicrobial peptides, and
secondary metabolites [16, 17]. These responses parallel some of
the most important defenses that invasive bacteria encounter in
animal hosts. For bacterial pathogens that are able to infect an
expansive range of hosts, plants represent inexpensive and easily
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_16, © Springer Science+Business Media, LLC, part of Springer Nature 2019
191
192 Fatima Kamal et al.
2 Materials—Alfalfa
3 Methods—Alfalfa
3.2 Recovery of 1. For each bacterial strain, five to ten infected seedlings are
Bacteria from Infected homogenized in a Kontes tissue grinder (Thermo Fisher Scien-
Alfalfa Seedlings tific) in 1 mL of 0.85% NaCl.
2. The resulting suspension is serially diluted in 0.85% NaCl and
plated onto LB agar to determine the number of CFU per
seedling.
3. Seedlings with disease symptoms are randomly selected for bac-
terial quantitation except for seedlings inoculated with strains
that do not cause symptoms of disease (see Notes 1 and 2) .
4. Analysis of variance (ANOVA) and linear regression can be
performed with INSTAT software (GraphPad Software, San
Diego, CA, USA; https://www.graphpad.com/).
4 Materials—Duckweed
5 Methods—Duckweed
5.1 Plant Surface 1. For axenic growth, submerge the duckweed plants in 10%
Sterilization (v/v) bleach for 10 s using a sterile inoculating loop.
2. Transfer the plants to 70% (v/v) ethanol and submerge for 10 s
as above.
3. Finally, transfer the plants into an excess of sterile Schenk-
Hildebrandt medium supplemented with 1% w/v sucrose
(SHS) to recover. The plants should be rinsed in this media
until no trace of bleach and ethanol remains.
5.2 Plant Infections 1. To separately infect each individual plant, fill each well of a
96-well plate with 180 μL of SHS and one duckweed plant
comprising 2–3 fronds (large-divided leafs; e.g., an intermedi-
ate stage of growth).
2. To begin the duckweed plant infection, centrifuge 1 mL of an
overnight bacterial culture for 5 min at 5000 g, and gently
resuspend the cell pellet in 1 mL SHS to wash the cells.
3. Repeat the centrifugation of the bacterial cells as above, and
again, gently resuspend the cells in a final volume of 1 mL SHS.
For bacterial species exhibiting relatively high lethality, dilution
in SHS to an appropriate concentration can be made in order to
best observe the infectious process.
4. Starting at the left side of the 96-well plate, tenfold serial
dilutions are made across the plate: 20 μL of the final washed
bacterial cell suspension is added to the 180 μL in the first
column of eight wells, using a multichannel micropipette
(e.g., Eppendorf Research Plus micropipette, Hamburg,
196 Fatima Kamal et al.
6 Notes
1. For all bacterial strains tested in the alfalfa model, the number
of bacteria recovered was at least tenfold higher than the inoc-
ulum, indicating that all bacteria were able to grow on alfalfa.
For bacteria unable to cause disease in alfalfa seedlings, it may
be due to their inability to grow on the seedlings.
2. Different bacteria occasionally show differing effects in alfalfa.
For example, P. aeruginosa infections are localized to the
wounded leaves and create greater tissue maceration, whereas
some members of the Burkholderia cepacia complex do not
require leaf wounding, and are more damaging to the seedlings
at 37 C rather than 30 C.
Duckweed (Lemna minor) and Alfalfa (Medicago sativa). . . 197
Acknowledgments
References
1. Cash HA, Woods DE, McCullough B, Johan- 11. Lee YH, Chen Y, Ouyang X, Gan YH (2010)
son WG, Bass JA (1979) A rat model of chronic Identification of tomato plant as a novel host
respiratory infection with Pseudomonas aerugi- model for Burkholderia pseudomallei. BMC
nosa. Am Rev Respir Dis 119:453–459 Microbiol 10:28
2. Woods DE, Sokol PA, Bryan LE, Storey DG, 12. Prithiviraj B, Weir T, Bais HP, Schweizer HP,
Mattingly SJ, Vogel HJ, Ceri H (1991) In vivo Vivanco JM (2005) Plant models for animal
regulation of virulence in Pseudomonas aerugi- pathogenesis. Cell Microbiol 7(3):315–324
nosa associated with genetic rearrangement. J 13. Schikora A, Virlogeux-Payant I, Bueso E, Gar-
Infect Dis 163:143–149 cia AV, Nilau T et al (2011) Conservation of
3. Chiu CH, Ostry A, Speert DP (2001) Invasion Salmonella infection mechanisms in plants and
of murine respiratory epithelial cells in vivo by animals. PLoS One 6(9):e24112
Burkholderia cepacia. J Med Microbiol 50 14. Ronald PC, Beutler B (2010) Plant and animal
(7):594–601 sensors of conserved microbial signatures. Sci-
4. Singh KV, Qin X, Weinstock GM, Murray BE ence 330(6007):1061–1064
(1998) Generation and testing of mutants of 15. Cao H, Baldini RL, Rahme LG (2001) Com-
Enterococcus faecalis in a mouse peritonitis mon mechanisms for pathogens of plants and
model. J Infect Dis 178:1416–1420 animals. Annu Rev Phytopathol 39:259–284
5. Urban TA, Griffith A, Torok AM, Smolkin 16. Iriti M, Faoro F (2007) Review of innate and
ME, Burns JL et al (2004) Contribution of specific immunity in plants and animals. Myco-
Burkholderia cenocepacia flagella to infectivity pathologia 164(2):57–64
and inflammation. Infect Immun 72 17. Stotz HU, Waller F, Wang K (2013) Innate
(9):5126–5113 immunity in plants: The role of antimicrobial
6. Seed KD, Dennis JJ (2008) Development of peptides. In: Hiemstra PS (ed) Antimicrobial
Galleria mellonella as an alternative infection peptides and innate immunity. Springer, Basel,
model for the Burkholderia cepacia complex. pp 29–51
Infect Immun 76(3):1267–1275 18. Jander G, Rahme LG, Ausubel FM (2000)
7. Castonguay-Vanier J, Vial L, Tremblay J, Positive correlation between virulence of Pseu-
Déziel E (2010) Drosophila melanogaster as a domonas aeruginosa mutants in mice and
model host for the Burkholderia cepacia com- insects. J Bacteriol 182(13):3843–3845
plex. PLoS One 5(7):e11467 19. Uehlinger S, Schwager S, Bernier SP, Riedel K,
8. Tan MW, Mahajan-Miklos S, Ausubel FM Nguyen DT et al (2009) Identification of spe-
(1999) Killing of Caenorhabditis elegans by cific and universal virulence factors in Burkhol-
Pseudomonas aeruginosa used to model mam- deria cenocepacia strains by using multiple
malian bacterial pathogenesis. Proc Natl Acad infection hosts. Infect Immun 77
Sci U S A 96(2):715–720 (9):4102–4110
9. Vergunst AC, Meijer AH, Renshaw SA, O’Call- 20. Walker TS, Bais HP, Deziel E, Schweizer HP,
aghan D (2010) Burkholderia cenocepacia cre- Rahme LG et al (2004) Pseudomonas aerugi-
ates an intramacrophage replication niche in nosa plant root interactions: pathogenicity, bio-
zebrafish embryos, followed by bacterial dis- film formation, and root exudation. Plant
semination and establishment of systemic Physiol 134:320–331
infection. Infect Immun 78(4):1495–1508 21. Silo-Suh L, Suh S-J, Sokol PA, Ohman DE
10. Kroupitski Y, Golberg D, Belausov E, Pinto R, (2002) A simple alfalfa seedling infection
Swartzberg D et al (2009) Internalization of model for Pseudomonas aeruginosa strains asso-
Salmonella enterica in leaves is induced by light ciated with cystic fibrosis shows AlgT (sigma-
and involves chemotaxis and penetration 22) and RhlR contribute to pathogenesis. Proc
through open stomata. Appl Environ Micro- Natl Acad Sci U S A 99:15699–15704
biol 75(19):6076–6086
198 Fatima Kamal et al.
22. Plotnikova JM, Rahme LG, Ausubel FM dadantii strains from potato disease and bio-
(2000) Pathogenesis of the human opportunis- control by their bacteriophages. Braz J Micro-
tic pathogen Pseudomonas aeruginosa PA14 in biol 46(3):791–797. https://doi.org/10.
Arabidopsis. Plant Physiol 124:1766–1774 1590/S1517-838246320140498
23. Yohalem DS, Lorbeer JW (1997) Distribution 34. Born Y, Fieseler L, Thöny V, Leimer N, Duffy
of Burkholderia cepacia phenotypes by niche, B et al (2017) Engineering of bacteriophages
method of isolation and pathogenicity to Y2::dpoL1-C and Y2::luxAB for efficient con-
onion. Ann Appl Biol 130:467–479 trol and rapid detection of the fire blight path-
24. Baldini RL, Lau GW, Rahme LG (2002) Use of ogen, Erwinia amylovora. Appl Environ
plant and insect hosts to model bacterial path- Microbiol 83(12). https://doi.org/10.1128/
ogenesis. Methods Enzymol 358:3–13 AEM.00341-17. pii: e00341-17
25. Rahme LG, Stevens EJ, Wolfort SF, Shao J, 35. Frampton RA, Acedo EL, Young VL, Chen D,
Tompkins RG et al (1995) Common virulence Tong B et al (2015) Genome, proteome and
factors for bacterial pathogenicity in plants and structure of a T7-like bacteriophage of the
animals. Science 268:1899–1902 kiwifruit canker phytopathogen Pseudomonas
26. Jha AK, Bais HP, Vivanco JM (2005) Entero- syringae pv. actinidiae. Viruses 7
coccus faecalis mammalian virulence related fac- (7):3361–3379. https://doi.org/10.3390/
tors exhibit potent pathogenicity in the v7072776
Arabidopsis thaliana plant model. Infect 36. Yu JG, Lim JA, Song YR, Heu S, Kim GH et al
Immun 73:464–475 (2016) Isolation and characterization of bac-
27. Dong X, Mindrinos M, Davis KR, Ausubel FM teriophages against Pseudomonas syringae
(1991) Induction of Arabidopsis defense genes pv. actinidiae causing bacterial canker disease
by virulent and avirulent Pseudomonas syringae in kiwifruit. J Microbiol Biotechnol 26
strains and by a cloned avirulence gene. Plant (2):385–393. https://doi.org/10.4014/jmb.
Cell 3:61–72 1509.09012
28. O’Sullivan LA, Weightman AJ, Jones TH, 37. Bhunchoth A, Phironrit N, Leksomboon C,
Marchbank AM, Tiedje JM (2007) Identifying Chatchawankanphanich O, Kotera S et al
the genetic basis of ecologically and biotechno- (2015) Isolation of Ralstonia solanacearum-
logically useful functions of the bacterium Bur- infecting bacteriophages from tomato fields in
kholderia vietnamienesis. Environ Microbiol 9 Chiang Mai, Thailand, and their experimental
(4):1017–1034 use as biocontrol agents. J Appl Microbiol 118
(4):1023–1033. https://doi.org/10.1111/
29. Bernier SP, Silo-Suh L, Woods DE, Ohman jam.12763
DE, Sokol PA (2003) Comparative analysis of
plant and animal models for characterization of 38. Wei C, Liu J, Maina AN, Mwaura FB, Yu J et al
Burkholderia cepacia virulence. Infect Immun (2017) Developing a bacteriophage cocktail for
71(9):5306–5313 biocontrol of potato bacterial wilt. Virol Sin 32
(6):476–484. https://doi.org/10.1007/
30. Zhang Y, Hu Y, Yang B, Ma F, Lu P et al s12250-017-3987-6
(2010) Duckweed (Lemna minor) as a model
plant system for the study of human microbial 39. Ye J, Kostrzynska M, Dunfield K, Warriner K
pathogenesis. PLoS One 5(10):e13527 (2010) Control of Salmonella on sprouting
mung bean and alfalfa seeds by using a biocon-
31. Thomson EL, Dennis JJ (2013) Common trol preparation based on antagonistic bacteria
duckweed (Lemna minor) is a versatile high- and lytic bacteriophages. J Food Prot 73
throughput infection model for the Burkhol- (1):9–17
deria cepacia complex and other pathogenic
bacteria. PLoS One 8(11):e80102 40. Das M, Bhowmick TS, Ahern SJ, Young R,
Gonzalez CF (2015) Control of Pierce’s dis-
32. Kocharunchitt C, Ross T, McNeil DL (2009) ease by phage. PLoS One 10(6):e0128902.
Use of bacteriophages as biocontrol agents to https://doi.org/10.1371/journal.pone.
control Salmonella associated with seed 0128902
sprouts. Int J Food Microbiol 128
(3):453–459. https://doi.org/10.1016/j. 41. Randhawa MA (2009) Calculation of LD50
ijfoodmicro.2008.10.014 values from the method of Miller and Tainter,
1944. J Ayub Med Coll Abbottabad 21
33. Soleimani-Delfan A, Etemadifar Z, Emtiazi G, (3):184–185
Bouzari M (2015) Isolation of Dickeya
Chapter 17
Abstract
To combat infectious diseases induced by antibiotic-resistant bacteria in human and animals, phage therapy
has regained attention by the scientific community. Before phages can be widely accepted as therapeutics in
the same way as antibiotics, convincing detailed applied experimental evidence must be available. The
embryonated chicken egg model has been used to study the virulence of many pathogens. We describe here
a procedure to test the efficacy of phage therapy to treat colibacillosis using a chicken embryo lethality assay,
this being potentially applied to others bacterial infection.
Key words Animal model, Eggs, Phage therapy, Gallus gallus, Escherichia coli
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_17, © Springer Science+Business Media, LLC, part of Springer Nature 2019
199
200 Angélina Trotereau and Catherine Schouler
2 Materials
3 Methods
3.1 Egg Incubation 1. Obtain specific pathogen-free (SPF) embryonated avian eggs
Conditions from a suitable company.
2. Upon arrival, place eggs in an egg incubator with an automatic
egg turner to rotate eggs regularly (Fig. 1, see Note 1).
3. Incubate eggs at 37.8 C and 45% humidity with the egg air
space up (large end up).
3.2 Egg Candling 1. Use a light egg candler to check eggs for infertility by candling
after about 7 or 8 days of incubation.
2. Remove the eggs from the incubator and place them in a
dark room.
3. Hold the large end of each egg one at a time against the
candler.
4. Observe the egg to determine if it is fertile or infertile (Notes
2 and 3).
5. Discard eggs that are unfertilized, and return the viable eggs to
the incubator. Do not leave eggs outside of the incubator for
more than 30 min.
6. On day 11, again candle the eggs and make a pencil mark about
2 mm from the end of the air sac.
Fig. 2 Examination of embryo lethality by eggs candling. (a) Dead embryo. (b)
Live embryo
4 Notes
Acknowledgments
References
1. Zhuang QY, Wang SC, Li JP, Liu D, Liu S, coli from broiler breeders to broilers. Vet
Jiang WM, Chen JM (2014) A clinical survey Microbiol 207:13–18. https://doi.org/10.
of common avian infectious diseases in China. 1016/j.vetmic.2017.05.029
Avian Dis 58(2):297–302 5. Mellata M (2013) Human and avian extrain-
2. Barnes HJ, L. K. Nolan, and J.-P. Vaillancourt testinal pathogenic Escherichia coli: infections,
(2008) Colibacillosis. In: Y. M. Saif, AM Fadly, zoonotic risks, and antibiotic resistance trends.
J. R. Glisson, L. R. McDougald, L. K. Nolan, Foodborne Pathog Dis 10(11):916–932.
and D. E. Swayne (ed) Diseases of poultry. https://doi.org/10.1089/fpd.2013.1533
12 Blackwell Publishing Hoboken, pp 6. Moulin-Schouleur M, Reperant M, Laurent S,
691–737 Bree A, Mignon-Grasteau S, Germon P,
3. Guabiraba R, Schouler C (2015) Avian coliba- Rasschaert D, Schouler C (2007) Extraintest-
cillosis: still many black holes. FEMS Microbiol inal pathogenic Escherichia coli strains of avian
Lett 362(15):fnv118. https://doi.org/10. and human origin: link between phylogenetic
1093/femsle/fnv118 relationships and common virulence patterns. J
4. Poulsen LL, Thofner I, Bisgaard M, Christen- Clin Microbiol 45(10):3366–3376
sen JP, Olsen RH, Christensen H (2017) Lon- 7. Moulin-Schouleur M, Schouler C, Tailliez P,
gitudinal study of transmission of Escherichia Kao MR, Bree A, Germon P, Oswald E,
Use of a Chicken Embryo Lethality Assay to Assess the Efficacy of Phage Therapy 205
Mainil J, Blanco M, Blanco J (2006) Common Wladyka B (2012) The virulence of Staphylococ-
virulence factors and genetic relationships cus aureus correlates with strain genotype in a
between O18:K1:H7 Escherichia coli isolates chicken embryo model but not a nematode
of human and avian origin. J Clin Microbiol model. Microbes Infect 14(14):1352–1362.
44(10):3484–3492 https://doi.org/10.1016/j.micinf.2012.09.
8. Nobrega FL, Costa AR, Kluskens LD, Azeredo 006
J (2015) Revisiting phage therapy: new appli- 18. Townsend MK, Carr NJ, Iyer JG, Horne SM,
cations for old resources. Trends Microbiol 23 Gibbs PS, Pruss BM (2008) Pleiotropic phe-
(4):185–191. https://doi.org/10.1016/j.tim. notypes of a Yersinia enterocolitica flhD mutant
2015.01.006 include reduced lethality in a chicken embryo
9. Barrow P, Lovell M, Berchieri A Jr (1998) Use model. BMC Microbiol 8:12. https://doi.
of lytic bacteriophage for control of experimen- org/10.1186/1471-2180-8-12
tal Escherichia coli septicemia and meningitis in 19. Wang X, Carmichael DW, Cady EB,
chickens and calves. Clin Diagn Lab Immunol Gearing O, Bainbridge A, Ordidge RJ,
5(3):294–298 Raivich G, Peebles DM (2008) Greater
10. Huff WE, Huff GR, Rath NC, Balog JM, hypoxia-induced cell death in prenatal brain
Donoghue AM (2002) Prevention of Escheri- after bacterial-endotoxin pretreatment is not
chia coli infection in broiler chickens with a because of enhanced cerebral energy depletion:
bacteriophage aerosol spray. Poult Sci 81 a chicken embryo model of the intrapartum
(10):1486–1491 response to hypoxia and infection. J Cereb
11. Huff WE, Huff GR, Rath NC, Balog JM, Blood Flow Metab 28(5):948–960. https://
Donoghue AM (2003) Evaluation of aerosol doi.org/10.1038/sj.jcbfm.9600586
spray and intramuscular injection of bacterio- 20. Wooley RE, Gibbs PS, Brown TP, Maurer JJ
phage to treat an Escherichia coli respiratory (2000) Chicken embryo lethality assay for
infection. Poult Sci 82(7):1108–1112 determining the virulence of avian Escherichia
12. Alnassan AA, Shehata AA, Kotsch M, coli isolates. Avian Dis 44(2):318–324
Lendner M, Daugschies A, Bangoura B 21. Borst LB, Suyemoto MM, Keelara S, Dunnin-
(2013) Embryonated chicken eggs as an alter- gan SE, Guy JS, Barnes HJ (2014) A chicken
native model for mixed Clostridium perfrin- embryo lethality assay for pathogenic Entero-
gens and Eimeria tenella infection in chickens. coccus cecorum. Avian Dis 58(2):244–248
Parasitol Res 112(6):2299–2306. https://doi. 22. Nolan LK, Wooley RE, Brown J, Spears KR,
org/10.1007/s00436-013-3392-5 Dickerson HW, Dekich M (1992) Comparison
13. Blanco AE, Barz M, Cavero D, Icken W, Sharifi of a complement resistance test, a chicken
AR, Voss M, Buxade C, Preisinger R (2018) embryo lethality test, and the chicken lethality
Characterization of Enterococcus faecalis isolates test for determining virulence of avian Escher-
by chicken embryo lethality assay and ERIC- ichia coli. Avian Dis 36(2):395–397
PCR. Avian Pathol 47(1):23–32. https://doi. 23. Da Silva M, Dombre C, Brionne A, Monget P,
org/10.1080/03079457.2017.1359404 Chesse M, De Pauw M, Mills M, Combes-
14. Gibbs PS, Wooley RE (2003) Comparison of Soia L, Labas V, Guyot N, Nys Y, Rehault-
the intravenous chicken challenge method with Godbert S (2018) The unique features of pro-
the embryo lethality assay for studies in avian teins depicting the chicken amniotic fluid. Mol
colibacillosis. Avian Dis 47(3):672–680. Cell Proteomics. https://doi.org/10.1074/
https://doi.org/10.1637/7011 mcp.RA117.000459
15. Gripenland J, Andersson C, Johansson J 24. Bertani G (2004) Lysogeny at mid-twentieth
(2014) Exploring the chicken embryo as a pos- century: P1, P2, and other experimental sys-
sible model for studying Listeria monocytogenes tems. J Bacteriol 186(3):595–600
pathogenicity. Front Cell Infect Microbiol 25. Bewick V, Cheek L, Ball J (2004) Statistics
4:170. https://doi.org/10.3389/fcimb. review 12: survival analysis. Crit Care 8
2014.00170 (5):389–394. https://doi.org/10.1186/
16. Horzempa J, O’Dee DM, Shanks RM, Nau GJ cc2955
(2010) Francisella tularensis DeltapyrF 26. Trotereau A, Gonnet M, Viardot A, Lalmanach
mutants show that replication in nonmacro- AC, Guabiraba R, Chanteloup NK, Schouler C
phages is sufficient for pathogenesis in vivo. (2017) Complete genome sequences of two
Infect Immun 78(6):2607–2619. https://doi. Escherichia coli phages, vB_EcoM_ ESCO5
org/10.1128/IAI.00134-10 and vB_EcoM_ESCO13, which are related to
17. Polakowska K, Lis MW, Helbin WM, Dubin G, phAPEC8. Genome Announc 5(13). https://
Dubin A, Niedziolka JW, Miedzobrodzki J, doi.org/10.1128/genomeA.01337-16
Chapter 18
Abstract
Bacteriophages are being applied in biocontrol of bacterial pathogens in foods and food processing
environments. There is need for the development of standardized protocols to quantify the effectiveness
of phage preparations in reducing food-borne pathogens on foods. Here, we present a procedure for the
verification of the effectiveness of a phage preparation in reducing Listeria monocytogenes on ready-to-eat
(RTE) meats. The protocol is designed taking into account real-world scenarios and avoiding common
errors reported in previous phage decontamination assays.
Key words Bacteriophage, Biocontrol, Listeria monocytogenes, Ready-to-eat meat, LISTEX™ P100
1 Introduction
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9_18, © Springer Science+Business Media, LLC, part of Springer Nature 2019
207
208 Andrew Chibeu and Sampathkumar Balamurugan
effect; (3) The rate of phage and host application are presented per
unit area; (4) The phage decontamination study is performed at
recommended storage temperature of the RTE meat (4 C) in
comparison to abusive temperature (10 C).
2 Materials
3 Methods
3.1 Ready-To-Eat 1. Obtain freshly sliced meat products direct from the processing
Meat Sample facility and store in tightly sealed Tupperware® containers at
Preparation 4 C until ready to use.
2. Place fresh, refrigerated samples on the precooled steel block
work surfaces (wrapped with clean aluminum foil and refriger-
ated to 4 C).
(a) Samples should be kept on a precooled steel plate
throughout.
(b) Replace the plate with chilled one if the temperature
increases noticeably during the previous steps.
3. Using autoclave sterilized meat core cutter or stainless steel
cookie cutters, cut 162 uniform slices of meat with 10 cm2
top-surface area.
4. Discard the remaining meat remnants in a biohazards
waste bag.
210 Andrew Chibeu and Sampathkumar Balamurugan
3.2 Preparation of 1. Place three 10 cm2 meat slices individually on Styrofoam trays
Negative Controls in the BSC and put in individual 800 600 commercial barrier
bags (Fig. 1).
2. Vacuum seal 18 of the bags using the MULTIVAC chamber
machine.
3. Store 9 of the vacuum sealed triplicate sample trays at 4 C and
label them “negative control 4 C” and: 30 min; 1 day; 2 days;
3 days; 7 days; 10 days; 14 days; 20 days; and 28 days
(shelf life).
4. Store the remaining nine vacuum sealed triplicate sample trays
at 10 C and label them “negative control 10 C” and: 30 min;
1 day; 2 days; 3 days; 7 days; 10 days; 14 days; 20 days; and
28 days (shelf life) (Fig. 1).
Quantitating Phage Efficacy in Ready-To-Eat Meats 211
3.4 Inoculating 1. Determine the volume of phage dilution to be spread over the
Samples with Phage meat slice to ensure application of 107 PFU/cm2.
(a) If phage was accurately diluted to ~109 PFU/mL, the
expected plating volume will be 100 μL.
2. Take the remaining 18 triplicate sets of inoculated meat sam-
ples on Styrofoam trays from Subheading 3.3, step 1 and
spread the appropriate volume of phage preparation on the
same surface as the L. monocytogenes inoculation.
3. Vacuum seal 18 of the triplicate sample trays using the MULTI-
VAC chamber machine.
4. Label nine sets of triplicate sample trays “L. mono + phage
4 C” and: 30 min; 1 day; 2 days; 3 days; 7 days; 10 days;
14 days; 20 days; and 28 days (shelf life).
5. Store these samples at 4 C.
6. Label nine sets of triplicate sample trays “L. mono + phage
10 C” and: 30 min; 1 day; 2 days; 3 days; 7 days; 10 days;
14 days; 20 days; and 28 days (shelf life).
7. Store these samples at 10 C.
212 Andrew Chibeu and Sampathkumar Balamurugan
3.5 Enumerating 1. Use dissecting scissors to aseptically open the vacuum sealed
Viable Bacteria in the meat samples.
Samples 2. Using sterile forceps aseptically transfer each meat sample to an
appropriately labeled Stomacher® 80 bag.
(a) Double-bag each sample to minimize the risk of infectious
material leaking from the bags.
3. Using a sterile pipette, add 10 mL of sterile PBS to the bag.
4. Using a sterile pipette, add 5 mL virucidal solution to the bag
to inactivate the remaining phage on the samples.
5. Place the bag in an autoclavable Nalgene™ bucket.
6. Repeat steps 1–5 for all samples.
7. Place the bag into the Stomacher® lab blender, taking care to
leave the top 3–4 in. of the bag above the paddles.
8. Blend the sample for 2 min (use a timer) at medium setting.
9. Transfer the bag containing the homogenized sample to
another autoclavable Nalgene™ bucket.
10. Repeat steps 7–9 for all samples.
11. Serially dilute the homogenate, tenfold, in sterile PBS to yield
1000 μL each of 101 and 102 dilutions.
12. For each sample plate 100 μl of the101 and 102 dilutions on
90 mm Oxford agar plates in triplicate.
13. If no colonies are observed on any of the plates, plate 1000 μL
of undiluted homogenate (spread plate four 250 μL aliquots of
the undiluted homogenate on four 90 mm Oxford agar plate).
14. Incubate the plates for 48 h at 37 C and enumerate typical
Listeria colonies.
15. L. monocytogenes appears on Oxford Agar as green colonies
surrounded by a black halo.
4 Notes
4.1 Phage Fresh LISTEX™ P100 should be prepared and employed in the
Preparation amount recommended by the manufacturer. Phage stock should be
serially diluted in sterile SM buffer to a working stock of
2 109 PFU/mL. Standard soft agar overlay method can be
employed to confirm the phage titers. Titration plates must be
incubated at 30 C. Plated volumes should be adjusted to ensure
plating of 107 PFU/cm2.
References
1. Pao S, Rolph SP, Westbrook EW, Shen H (2004) bacteriophages in reducing Escherichia coli
Use of bacteriophages to control Salmonella in O157:H7 on fresh-cut cantaloupes and lettuce.
experimentally contaminated sprout seeds. J J Food Prot 72:1481–1485
Food Sci 69:M127–M130 5. Soni KA, Desai M, Oladunjoye A, Skrobot F,
2. Abuladze T, Li M, Menetrez MY, Dean T, Nannapaneni R (2012) Reduction of Listeria
Senecal A, Sulakvelidze A (2008) Bacterio- monocytogenes in queso fresco cheese by a com-
phages reduce experimental contamination of bination of listericidal and listeriostatic GRAS
hard surfaces, tomato, spinach, broccoli, and antimicrobials. Int J Food Microbiol 155:82–88
ground beef by Escherichia coli O157:H7. Appl 6. Soni KA, Nannapaneni R, Hagens S (2010)
Environ Microbiol 74:6230–6238 Reduction of Listeria monocytogenes on the sur-
3. Guenther S, Huwyler D, Richard S, Loessner MJ face of fresh channel catfish fillets by bacterio-
(2009) Virulent bacteriophage for efficient bio- phage Listex P100. Foodborne Pathog Dis
control of Listeria monocytogenes in ready-to-eat 7:427–434
foods. Appl Environ Microbiol 75:93–100 7. Chibeu A, Agius L, Gao A, Sabour PM, Kro-
4. Sharma M, Patel JR, Conway WS, Ferguson S, pinski AM, Balamurugan S (2013) Efficacy of
Sulakvelidze A (2009) Effectiveness of bacteriophage LISTEX™P100 combined with
214 Andrew Chibeu and Sampathkumar Balamurugan
Martha R. J. Clokie et al. (eds.), Bacteriophages: Methods and Protocols, Volume IV, Methods in Molecular Biology, vol. 1898,
https://doi.org/10.1007/978-1-4939-8940-9, © Springer Science+Business Media, LLC, part of Springer Nature 2019
215
BACTERIOPHAGES
216 Index
Listeria monocytogenes ............................................. 43, 44, R
163, 200, 207, 209, 211–213
LISTEX™ P100................................................... 209, 212 Ready-to-eat (RTE) meat .................................... 207–213
Luciferase............................................................ 28, 38–42 Recombination ..................................................38, 39, 41,
43, 44, 48, 49, 58–60, 69–71, 118–121, 125–127
M Recombineering ........................................................69–79
Reporter phages .............................................................. 28
Mass spectrometry .............................................. 118, 119, Resistance ................................................. 27, 28, 58, 118,
124, 125, 130–132 120, 125, 148, 164, 199
Microorganisms................................................1, 138, 145
Microscopy ......................................................3, 6, 12–16, S
22, 28, 30–32, 52, 55, 91, 137–140, 143–145,
149, 151, 158, 159 Shape of ......................................................................... 204
Mycobacteria .............................. 27–35, 69, 70, 101, 102 Silkworm larvae .................................................... 173–180
Mycobacteriophages ................................. 28, 70, 97, 102 Site-specific mutagenesis.................................. 57–66, 167
Sodium dodecyl sulfate polyacrylamide gel
O electrophoresis (SDS-PAGE)...................... 84, 86,
109, 110, 112, 119, 123, 124, 128, 130, 131, 135
ORFans ................................................................. 147, 154 Spot test ......................................................................... 155
Staphylococcus aureus ......... 163, 173–175, 178, 179, 200
P
Strep-tag® II ................................................ 117, 119, 120
Pathogenesis ...............................163, 164, 184, 191, 192
Peptidoglycan ......................................................... 81, 107 T
Phage Tail fibers ...................................................................89, 90
assembly intermediates ............................................. 45 T4 bacteriophage ......................................................81–87
genome ....................................................7, 37–39, 41, Time lapse microscopy........................149, 151, 158, 159
51–56, 58, 69, 70, 73, 86, 147, 151
lytic proteins ............................................................ 107 V
purification ........................................ 81, 85, 174, 178
therapy ...................... v, 173–176, 178, 179, 199–204 Virulence.....................................164, 167, 168, 183, 192
PhageFISH .................................................................. 1–25 Virulence factors .................................137, 167, 168, 192
Phage–host protein–protein interactions... 117, 119, 120 Viruses ............................................................3, 7, 23, 191
Pharmacokinetics ........................................ 184, 186, 187
W
Preparative centrifugation............................................... 52
Primer-directed mutagenesis .......................................... 59 Wax worm.................................................... 163, 164, 191
Pseudomonas aeruginosa (PA)......................................118,
120–123, 125–129, 132, 147, 154, 163, 165, Z
173, 184, 192, 196
Zymogram ..................................................................... 107