03/05/2017 Code - A

Regd. Office : Aakash Tower, 8, Pusa Road, New Delhi-110005; Ph.: 011-47623456

MM : 720 Test Series : Test – 10 (Objective) Time : 3 Hrs.

(for NEET - 2017 )

MOCK TEST FOR NEET

Instructions :
(i) Use Blue/Black ball point pen only to darken the appropriate circle.
(ii) Mark should be dark and should completely fill the circle.
(iii) Dark only one circle for each entry.
(iv) Dark the circle in the space provided only.
(v) Rough work must not be done on the Answer sheet and do not use white-fluid or any other rubbing material on
Answer sheet.
(vi) Each question carries 4 marks. For every wrong response 1 mark shall be deducted from total score.

PHYSICS
Choose the correct answer :
1. Error in measurement of radius of a cylinder is 2% 3. A particle is projected with initial velocity
 
and in length it is 1%. The error in the measurement u  30iˆ  40 ˆj under gravity a  10 ˆj . The
of volume of the cylinder is
trajectory equation for the particle will be
(1) 1%
(1) y = 30x – 4x2 (2) y = 40x – 8x2
(2) 3.5%
(3) y = 100x – 24x2 (4) 180 y = 240x – x2
(3) 4%
4. A particle having a velocity v = v 0 at t = 0 if
(4) 5%
decelerated at a rate equals to  v , where  is
⎛1 ⎞ positive constant. After what time and after covering
2. Figure shows ⎜⎝  v ⎟⎠ graph. Find time taken by
a what distance will the particle come to rest?
particle to change its velocity from 20 m/s to 40 m/s.
1 2 2v 03/ 2 2 v 01/ 2 2v 01/ 2 2 v 03/ 2
(s /m) (1) , (2) ,
a  3   3 
20
v 01/ 2 3 v 03/ 2 v 03/ 2 5 v 05/ 2
(3) , (4) ,
10  2   2 

v (m/s) 5. A ship is travelling due east at a speed of 10 km/hr.

20 40 Calculate the speed of a boat heading 30º east of
(1) 5 minutes north if it appears always moving due north from the
(2) 10 minutes ship.

(3) 5 seconds (1) 10 2 km/h (2) 10 km/h

(4) 50 seconds (3) 20 km/h (4) 3 km/h
(1)
Test-10 (Code A) Test Series for NEET - 2017
6. Two particles, each of mass m are connected by a F
light string of length 2l. The whole system is kept on
a frictionless horizontal surface with the string held
tight. Now the mid point of the string is pulled
vertically upward with constant force F. As a result,
the particles move towards each other on the 10 F 10 F
surface. The magnitude of acceleration, when the (1) (2)
7m 6m
separation between them becomes 2x, is
10 F 15 F
F (3) (4)
3m 7m
m m 10. A stone weighs 100 N on the surface of the earth.
The ratio of its weight at a height of half the radius
l l of the earth to a depth of half the radius of the earth
F l will be nearly equal to
F x
(1) 2m (2)
l x
2 2
2m l (1) 0.4 (2) 0.9
(3) 1.8 (4) 2.4
F x F l x
2 2
(3) 2m (4) 11. If 0 is natural frequency of damped forced oscillation
l 2  x2 2m x and p that of driving force, then for amplitude
7. 1 kg block collides with a spring (k = 1000 N/m). resonance
The block compresses the spring 20 cm from the (1) pr = 0
rest position. If coefficient of kinetic friction between
(2) pr < 0
block and horizontal surface is 0.25, what was the
speed of the block at the instant of collision? (3) pr > 0
(4) pr may be equal to greater than or less than 0
12. Starting from the origin a body oscillates simple
harmonically with a period of 2 s. After what time will
k
the kinetic energy be 75% of its total energy?
1 1
(1) 6.4 m/s (2) 6 m/s (1) s (2) s
6 4
(3) 4 m/s (4) 5.2 m/s
1 1
8. Two boys A (20 kg) and B (10 kg) are standing at (3) s (4) s
the extremes of a 10 m long plank (30 kg). If A and 3 12
B exchange their position. Find the shift of the plank. 13. A material has Poisson’s ratio 0.20. If a uniform rod
(Friction between the plank and surface is of it suffers longitudinal strain 4×10 –3 ; find the
neglected) percentage change in its volume.
A B (1) 0.14% (2) 0.56%
(3) 0.08% (4) 0.24%
14. Water from a tap emerges vertically downwards with
an initial speed of 1 m/s. The cross-sectional area
10 m of tap is 10–4 m2. Assume that the flow is steady,
5 the cross-sectional area of stream 0.15 m below the
(1) m towards right tap is
3
5 (1) 5 × 10–4 m2 (2) 10–4 m2
(2) m towards left
3 (3) 5 × 10–5 m2 (4) 2 × 10–5 m2
10 15. A small sphere falls from rest in a viscous liquid. Due
(3) m towards right to friction, heat is produced. The correct relation
3
between the rate of production of heat and the radius
10 of the sphere at terminal velocity is
(4) m towards left
3 (1) H  r3
9. A force F acts tangentially at the highest point of a (2) H  r4
sphere of mass m kept on a rough horizontal plane.
If the sphere rolls without slipping, find the (3) H  r5
acceleration of the centre of sphere. (4) H  r0
(2)
Test Series for NEET - 2017 Test-10 (Code A)
16. The temperature of the two outer surfaces of a 21. To produce standing wave
composite slab consisting of two materials having y = 0.4 cm sin [(0.314 cm–1)x] cos[(600 s–1)t]
coefficient of thermal conductivities of k and 2k,
thickness x and 4x respectively are T2 and T1 (T2 > on a string fixed at both ends what would be the
T1). The rate of heat transfer through the slab in a smallest length of the string?
steady state is (1) 5 cm (2) 6 cm
(3) 7 cm (4) 10 cm
T2 k 2k T1 22. The sound level at a point 5 m away from a point
source is 40 dB. What will be the level at a point
x 4x 50 m away from the source?
KA T2  T1  KA T1  T2  (1) 20 dB (2) 40 dB
(1) (2)
3x 3x (3) 10 dB (4) 15 dB
KA T2  T1  3KA T2  T1  23. A point charge is placed at distance 2a from the
(3) (4) centre of a thin conducting uncharged spherical shell
5x 5x
of radius a. Then the charge on the shell will be
17. An ideal gas expands isothermally from a volume V1
to V2 and then compressed to original volume V1 a +Q
adiabatically. Initial pressure is p1 and final pressure O A
is p3. The total work done is W. Then
2a
(1) p3 > p1, W > 0 (2) p3 < p1, W < 0
Q
(3) p3 > p1, W < 0 (4) p3 = p1, W = 0 (1)  (2) Q
2
18. Two trains are travelling towards each other both at (3) –Q (4) Zero
a speed of 90 km/h. If one of the trains sounds a
whistle at 500 Hz; what will be the apparent 24. The angles of inclination of the suspended identical
charged pendulum are 30º and 60º due to electric
frequency heard in the other train? Speed of sound
in air = 350 m/s. field of the infinite sheets of surface charge densities
1
(1) 560 Hz (2) 540 Hz 1 and 2 respectively. Then  is equal to
2
(3) 577 Hz (4) 544 Hz 1 2
19. The x-t graph of a particle undergoing simple
harmonic motion is shown below. The acceleration of
4
the particle at t  s is
3
30º 60º
x (cm)

1
(1) 3 (2) 2 : 3
0 t (s) 1 1
4 8 12
(3) (4)
3 3
–1
25. Consider the situation shown in the figure. The
capacitor A has a charge q on it whereas B is
 2 3 2 uncharged. The charge appearing on the capacitor B
(1) cm s 2 (2)   cm s2 a long time after the switch is closed in
32 32
q
2 3 2
(3) cm s 2  cm s2
(4) + –
32 32
20. A block is kept on a horizontal table. The table is
undergoing SHM of frequency 3 Hz in a horizontal S
place. The coefficient of static friction between the
block and the table surface is 0.72. Find the
maximum amplitude of the table in which the block + –
does not slip on the surface. A B
(1) 2q (2) q
(1) 2 cm (2) 2.5 cm
q
(3) 3 cm (4) 4 cm (3) (4) Zero
2
(3)
Test-10 (Code A) Test Series for NEET - 2017
26. In the circuit shown in figure, the ratio of charges on 30. A magnet of length 14 cm and magnetic moment M
capacitors 5 F and 3 F in steady state is is broken into two parts of lengths 6 cm and 8 cm
they are put at right angle to each other with
5 F
opposite pole together. The magnetic moment of the
combination is
1 2 3
M
(1) (2) M
10

3 F M
(3) (4) 2.8M
1.4

10 V 4 31. The energy of a photon is equal to the kinetic energy

of a proton. The energy of the photon is E. Let 1 be
1 3 the de Broglie wavelength of the proton and 2 be the
(1) (2)
2 1 1
wavelength of the photon. The ratio of  is
2
1
(3) (4) 1 proportional to
4
(1) Eº
27. The magnetic field at O is
(2) E
(3) E–1
a
I (4) E–2
120º

I O
32. In an n-p-n transistor circuit, the collector current is
10 mA. If 90% of the electrons emitted reach the
collector, then

 0I ⎛ 3 1 ⎞  0I ⎛ 2 1 ⎞ (1) The emitter current will be 9 mA

(1) ⎜  ⎟ (2) ⎜  ⎟
2a ⎝  3⎠ 2a ⎝  2⎠ (2) The base current will be 6 mA

 0I ⎛ 3 1 ⎞  0I ⎛ 3 1 ⎞ (3) The emitter current will be 11 mA

(3) ⎜  ⎟ (4) ⎜  ⎟
a ⎝  3⎠ 4a ⎝  3⎠ (4) The base current will be 4 mA
28. A non conducting ring of radius r and mass m which 33. The short linear object of length L lies along the axis
has a total charge q distributed uniformly on it. The of a spherical mirror of focal length f at a distance
ring is rotated about its axis with an angular speed u from the mirror. Its image has an axial length l
. Find the ratio of magnetic moment and angular equal to
momentum of disc. 1
⎡ f ⎤2
2q (1) L ⎢
(1) ⎣ u  f ⎥⎦
m 1
⎡u  f ⎤2
q (2) L ⎢
(2) ⎣ f ⎥⎦
2m 2
⎡ f ⎤
q (3) L ⎢
(3) ⎣ u  f ⎥⎦
m 2
⎡ f ⎤
q (4) L ⎢
(4) ⎣ u  f ⎥⎦
4m
34. A concave lens of glass, refractive index 1.5, has
29. Find the percentage increase in magnetic field when both surfaces of same radius of curvature R. On
the space within a current carrying solenoid is filled immersion in a medium of refractive index 1.75, it
with substance of susceptibility 1.2 ×10–1 will behave as
(1) 12% (1) Convergent lens of focal length 3.5R
(2) 6% (2) Convergent lens of focal length 3R
(3) 4% (3) Divergent lens of focal length 3.5R
(4) No charge (4) Divergent lens of focal length 3R
(4)
Test Series for NEET - 2017 Test-10 (Code A)
35. A ray of light undergoes deviation of 30º when 40. An AND gate can be prepared by use of
incident on an equilateral prism of refractive index
(1) OR gates
2 . The angle made by ray inside the prism with
the base of the prism is (2) NAND gates

(1) Zero (3) NOR gates

(2) 30º (4) Both (2) & (3)

(3) 45º 41. Find the current through the resistance 1  in figure

(4) 60º 4V 12 

36. The dispersive power of the material of the two

lenses is in the ratio 4 : 3. If the achromatic 6V 12 
combination of these two lenses in contact is a
convex lens of focal length 60 cm. Then the focal
length of the component lenses is 1
(1) –20 cm and +25 cm
(1) 0.21 A (2) 0.42 A
(2) 20 cm and –25 cm
(3) 0.1 A (4) Zero
(3) –35 cm and +20 cm
42. Two radioactive materials x1 and x2 have decay
(4) +15 cm and –20 cm constant 10 and  respectively. If initially they have
the same number of nuclei, then the ratio of the
37. Two coherent point sources S1 and S2 vibrating in
1
phase emit light of wavelength . The separation number of nuclei of x1 to that of x2 will be after
between two sources is 2. Consider a line passing e
through S2 and perpendicular to S1S2. What is the a time
smallest distance from S 2 where a minimum of
intensity occurs?
1 1
(1) (2)
7 7 10 11
(1) (2)
6 12
11 1
(3) (4)
3 4 10 9
(3) (4)
2 3 43. A coil has an inductance of 0.7 henry and joined in
38. The de-Broglie wavelength of a neutron at 27ºC is . series with a resistance of 220 . When an
The wavelength at 927ºC will be alternating e.m.f. of 220 V at 50 cps is applied then
the wattless component of the current in the circuit
 is
(1)
2 (1) 5 A (2) 0.5 A
 (3) 0.7 A (4) 7 A
(2)
3
44. An observer is r m from an isotropic point light
 source whose power is H watt. The r.m.s. value of
(3)
4 electric field at the position of observer is

 1 H 2 H
(4) (1) 2r  0c (2) r  c
9 0

39. The temperature of an object that emits 1 H 1 H

electromagnetic wave must be (3) 4r  0c (4) r  c
0

(1) Higher than 0°C

45. The charging current for capacitor is 0.5 A. The value
(2) Higher than 273°C of displacement current is

(3) Higher than 0 K (1) 0.25 A (2) 1 A

(4) Higher than its surrounding temperature (3) 0.5 A (4) Zero

(5)
Test-10 (Code A) Test Series for NEET - 2017

CHEMISTRY
46. Consider the following statements : NH2
I. Dilute aqueous boric acid is used as a weak (3)
antiseptic for eyes.
II. Bithional is added to soap to impart colour.
III. Chlorine in concentration of 20 to 40 parts per
million is used as a disinfectant for drinking N=N
water. (4)
Choose the incorrect statements :
(1) I & II (2) II & III NH2
Br2 (aq) (i) NaNO2+ HCl, 0ºC
(3) I & III (4) I, II & III X (ii) CuBr
51.
47. Which of the following is the repeating unit of O2N
polymer neoprene? (i) Sn + HCl
Y (ii) NaNO2 + HCl, 0ºC
Z .
(1) (CH2 – C = CH – CH2)n (major)
(iii) H3PO2
Cl
Z is
(2) (CH2 – C = CH – CH2)n Br Br
CH3 Br
(CH2 – CH = CH – CH2 – CH – CH2)n (1) (2)
(3)
CN Br Br Br
Br Br
(4) (CH2 – CH)n
CN
48. Choose the incorrect statement about cellulose : (3) (4)
Br
(1) It does not form osazone Br Br
(2) It is used in the manufacturing of gun cotton 52. Consider the following compounds :
(3) It is a branched chain polymer of -D-glucose CHO CHO
(4) The molecular mass of cellulose is in the range
of 50,000 – 5000,000 H3C
49. Choose the incorrect statement. (I) (II)
(1) Except glycine, all other naturally occurring - O
aminoacids are optically active CHO
C
(2) Most naturally occurring amino acids have L-
CH3
configuration
O2N
(3) Polypeptides are most soluble at their isoelectric
points (III)
(IV)
(4) Polypeptides are amphoteric in nature Choose the correct order of reactivity in nucleophilic
addition reactions :
NO2 (1) III > II > I > IV (2) IV > I > II > III
Zn + NaOH
50. (MeOH)
X. Identify X. (3) IV > II > I > III (4) III > I > II > IV
53. Which of the following compound does not undergo
either aldol condensation and Cannizzaro reaction?
NHOH
(1) Methanal (2) 1-Phenylpropanone
(1) (3) Benzophenone (4) Cyclohexanone
54. The number of isomeric primary alcohols possible
with molecular formula C5H12O is
(2) N=N (1) 5 (2) 6
(3) 4 (4) 3
O
(6)
Test Series for NEET - 2017 Test-10 (Code A)
55. The Fischer projection formula of

CHO
120 kJ/mol
160 kJ/mol
C
63. Potential
H CH2OH energy Reactant
HO Product

is : Reaction co-ordinate
If use of catalyst decreases the activation energy by
CHO CHO 20 kJ mol–1. The enthalpy change of the reaction
(1) HO (2) H OH would be
H
CH2OH (1) –20 kJ/mol (2) –60 kJ/mol
CH2OH
(3) –40 kJ/mol (4) +60 kJ/mol
CHO 64. Given that :
(3) H CH2OH (4) All of these 2Hg2(aq) + 2e(–) Hg22(aq); Eº = 0.920 V
OH Hg22(aq) + 2e(–) 2Hg(l); Eº = 0.797 V
56. Which of the following ligand cannot act as a What is the Gº for the following process at 25ºC?
-acceptor in a complex compound? Hg22(aq) Hg2 (aq) + Hg(l)
(1) CN– (2) H2O (1) 2.37 × 104 J (2) 1.19 × 104 J
(3) C2H4 (4) CO (3) 1.66 × 105 J (4) 3.32 × 105 J
57. The complex which is diamagnetic and square planar 65. Which of the following is true for ideal solution?
is
(1) Hmix = 0 (2) Vmix = 0
(1) [Pt(CN)4]2(–) (2) [Ni(CO)4]
(3) PA = PAº × xA (4) All of these
(3) [NiCl4]2(–) (4) All of these
66. 31 g of ethylene glycol (C2H6O2) is mixed with 500
58. Choose the correct order of melting point g of water. What is the freezing point of the solution?
(1) W > Cr > Mo (2) Mo > W > Cr [K f (H2O)  1.86 K kgmol1 ]
(3) Cr > Mo > W (4) W > Mo > Cr
(1) 271.29 K (2) 275.01 K
59. Which of the following is not present in bleaching
powder? (3) 273.15 K (4) 269.43 K
(1) CaSO4 (2) Ca(OCl)2 67. Consider the following statements :
(3) CaCl2 (4) Ca(OH)2 I. Ferrimagnetic material, Fe 3 O 4 becomes
paramagnetic at 850 K.
60. Which of the following is used as a gaseous
insulator in high voltage generators due to its II. Paramagnetic behaviour is due to the presence
inertness and good dielectric properties? of unpaired electrons.
(1) SO3(g) (2) SF6(g) III. Maximum coordination number possible in ionic
solids is 8.
(3) NO2(g) (4) O2(g)
Choose the correct statements :
61. Choose the incorrect match :
(1) I & II only (2) II & III only
(1) Calamine – ZnCO3
(3) I & III only (4) I, II & III
(2) Malachite – Cu2S
68. 30 g of an alloy of Al and Mg when heated with
(3) Azurite – Cu(OH)2.2CuCO3 excess of dil. HCl forms MgCl2 and AlCl3. If the
(4) Galena – PbS volume of H2(g) released is 33.6 L at N.T.P, the
composition of the alloy is
x
62. In Freundlich adsorption isotherm,  K  p1/n , the (1) 18 g Al, 12 g Mg
m
value of n cannot be (2) 20 g Al, 10 g Mg
(1) 1 (2) 0.1 (3) 12 g Al, 18 g Mg
(3) 10 (4) 100 (4) 10 g Al, 20 g Mg
(7)
Test-10 (Code A) Test Series for NEET - 2017
69. Consider the following blackbody radiation curves at 75. An air bubble with a radius of 1.5 cm at the bottom
various temperatures. of a lake where the temperature is 7ºC and the
pressure is 2.8 atm rises to the surface where the
temperature is 27ºC and pressure is 1 atm. What is
the radius of the bubble when it reaches the surface?
T1
Intensity [(3)1/3 = 1.44]

T2 (1) 3.16 cm (2) 2.56 cm

(3) 2.16 cm (4) 3.56 cm
T3
76. The van der Waals constants ‘a’ and ‘b’ for benzene
are 18.00 atm L 2 mol –2 and 0.115 L mol –1
respectively. What is the critical pressure of
 benzene?
(1) 5.8 atm (2) 50.8 atm
Choose the correct order of temperatures
(3) 5.04 atm (4) 50.4 atm
(1) T1 > T2 > T3
77. The standard enthalpies of combustion of fumaric
(2) T3 > T2 > T1 acid and maleic acid are –1336.0 kJ mol–1 and
(3) T1 = T2 = T3 –1359.2 kJ/mol, respectively. What will be the
enthalpy of the isomerisation process?
(4) (T1 + T3) = 2T2
70. Consider the following reaction : COOH COOH H COOH

N2H4 + H2O2 HNO3 + H2O C=C C=C

If reaction goes on completion, what is the amount H H HOOC H
of H2O2 required to obtain 252 g of HNO3 provided (1) Zero (2) +23.2 kJ/mol
the percentage impurity of H2O2 is 20%?
(3) –23.2 kJ/mol (4) +46.4 kJ/mol
(1) 476 g (2) 595 g
78. Select the correct statement(s) :
(3) 545 g (4) 445 g
I. The mixing of two ideal gases at the same
71. Which of the following is the correct plot kinetic temperature and pressure lead to an increase in
energy of the ejected electrons (KE) versus the entropy.
frequency of incident radiation (v)?
II. Expansion of an ideal gas against vacuum does
not result in a change in its internal energy.
III. When ice melts spontaneously at 20ºC to form
KE KE water, the internal energy of the system
(1) (2) increases.
v v (1) I & II only (2) II only
(3) I, II & III (4) I & III only
79. The solubility product of a salt AB2 in water is 8 ×
KE KE 10–12. What is the concentration of A2 ions in the
(3) (4) saturated solution of the salt?

v v (1) 4 × 10–6 (2) 21/3 × 10–4 M

72. La(z = 57) belongs to (3) 2 2  10 6 (4) 2 2  10 4
(1) f-block & 3rd group (2) d-block & 7th period 80. If pH of 1 L of pure water at 25ºC is 7, then molarity
(3) f-block & 6th period (4) d-block & 3rd group of H+ion in pure water (500 mL) at 25ºC would be
73. The most stable structure of NO is 107
(1) M (2) 2 × 10–7 M
(1) N  O (2) NO 2
(3) 10–7 M (4) 10–14 M
(3) N = O (4) N=O 81. x Cu + y NO3(–) + zH  a Cu2(+) + bNO + cH2O
74. Total number of bonding electrons in O2 is If x = 3, then z is equal to
(1) 10 (2) 8 (1) 2 (2) 4
(3) 6 (4) 4 (3) 6 (4) 8
(8)
Test Series for NEET - 2017 Test-10 (Code A)
82. What is the volume strength of 4.5% (wt/vol) H2O2 87. Which of the following can show tautomerism?
solution? (1) H3C – CH2 – NO2
(1) 15 V (2) 10 V
O
(3) 20 V (4) 9 V
83. The by product of Solvay process and it is converted (2)
into ammonia by treating it with, respectively, are
O O
(1) NH4Cl & CaCl2 (2) NH4OH & Ca(OH)2
O
(3) NH4Cl & Ca(OH)2 (4) NH4OH & CaCl2
84. Identify the aromatic substance
(1) Graphite (2) Diamond (3)
(3) Bucky-ball (4) Both (1) & (3) O
(4) All of these
85. has dipole moment higher than expected
O 88. The number of stereoisomers possible for
because pent-3-en-2-ol is
(1) It is a cyclic ketone (1) 2 (2) 3
(3) 4 (4) Infinite
(+)
(2) It exists as which is aromatic h
O(–) 89. n
Diel's-Alder reaction
(3) It is a three membered ring
The number of n is
(4) All of these
(1) 5 (2) 4
86. The hydrocarbon which does not react with sodium
in liquid ammonia is (3) 2 (4) 3
90. BOD of potable water should be
(1) (2) H – C  C – H (1) Less than 5
(2) More than 100
H H
C=C (3) Equal to 7
(3) H – C  C – CH3 (4)
H H (4) More than 10 and less than 100

BOTANY
91. a. Horizontal growth of seedlings. 92. Unisexual condition of plant is described by
b. Apical hook formation in dicot seedlings. (1) Homothallic and monoecious
c. Lateral shoot growth and adventitious shoot (2) Heterothallic and dioecious
formation. (3) Homothallic and dioecious
d. Thinning of cotton, cherry and walnut. (4) Heterothallic and monoecious
e. Elongation and improvement of shape in apple. 93. A small protein which is attached to outer surface of
inner mitochondrial membrane and acts as a mobile
f. Promotes female flowers in cucumber. carrier for electron transfer between complex III and
g. Xylem differentiation and cell division. IV is
Which of the given features are associated with one (1) Cytochrome a3 (2) Cytochrome c1
of the most widely used PGR in agriculture that also (3) Ubiquinone (4) Cytochrome c
helps in internode and petiole elongation in deep
94. Members of leguminosae and cruciferae resemble
water rice plants?
each other in
(1) a, b, c & g
(1) Having marginal placentation
(2) a, b, d & f (2) Lacking vexillary aestivation of petals
(3) All except, f & g (3) Possessing campylotropous ovule
(4) c, e & f (4) Having bicarpellary gynoecium
(9)
Test-10 (Code A) Test Series for NEET - 2017
95. Find the incorrect statement in relation to taxonomic 102. Match the following
categories. Column I Column II
(1) Similar characters are more in number between a. Phenylketonuria (i) Many loops on
families of same order as compared to different finger tips
genera included in a family
b. Down’s syndrome (ii) Rudimentary ovaries
(2) Families are characterized on the basis of both
c. Klinefelter’s syndrome (iii) Inborn error of
vegetative and reproductive features of plant
metabolism
species
d. Turner’s syndrome (iv) Gynecomastia
(3) Each genus may have more than one specific
epithets representing different organisms but (1) a(iv), b(i), c(ii), d(iii) (2) a(iii), b(i), c(iv), d(ii)
having morphological similarities (3) a(ii), b(iv), c(i), d(iii) (4) a(iii), b(ii), c(iv), d(i)
(4) Classes with a few similar characters are 103. Find the incorrect statement in relation to transport
assigned to highest category called division in plants
96. Initiation of lateral roots and cork cambium during (1) Rate of flow of water upward through xylem can
secondary growth takes place from the cells of reach upto 15 m per hour
(1) Conjunctive parenchyma (2) For the same amount of CO2 fixed, C3 plants
lose only half as much water as C4 plant
(2) Pericycle
(3) The movement of water through root layers is
(3) Endodermis
ultimately symplastic in endodermis
(4) Starch sheath
(4) Water channels are made up of eight different
97. Even though water is one of the reactants in light types of aquaporins
reaction, its effect as a factor is more through its
104. Select the correct statement for a population
effect on plant, rather than directly on photosynthesis
growing in a habitat with limited resources.
which includes
a. It grows in geometric fashion.
(1) Closure of stomata
b. Population growth does not maintain equilibrium
(2) Reduction in the surface area of leaves with carrying capacity.
(3) Wilting of leaves and increased metabolic
dN
activity c. Equation  (b  d)  N describe growth
dt
(4) More than one option is correct
pattern resulting in a J-shaped curve.
98. The given mRNA sequence codes for a polypeptide.
This polypeptide will contain how many different d. Shows initially a lag phase, followed by phases
amino acids? of acceleration then deceleration and finally an
asymptote.
5’AUGGUGGAGGUUUGGUAAUGGAGAAGGUAG 3’
(1) a, b & c (2) a & c
(1) 3 (2) 4
(3) c only (4) d only
(3) 5 (4) 6
105. The complex formed by synapsed pair of homologous
99. Find the correct match chromosomes called as bivalent, first occurs in
(1) Ammonifying bacteria – Pseudomonas putida (1) Leptotene (2) Diplotene
(2) Curing of tea leaves – Micrococcus candidans (3) Zygotene (4) Pachytene
(3) Bacitracin – Pseudomonas fluorescens 106. a. The main sources of biofertilisers are bacteria,
(4) Retting of fibres – Bacillus megatherium cyanobacteria and fungi.

100. Trichoderma polysporum helps to produce b. Organic farmer works to create a system where
pests are kept at manageable levels
(1) An immunosuppressive agent
c. Trichoderma species are effective biocontrol
(2) Blood cholesterol lowering agent agents of very few plants pathogens.
(3) Clot buster enzyme (1) Only a & b are correct
(4) Juice clearing enzyme (2) Only b is correct
101. The element which accumulates in older leaves and (3) Only b & c are correct
is needed for formation of mitotic spindle and normal (4) All are correct
functioning of cell membranes is
107. Advanced type of sexual reproduction with
(1) Magnesium (2) Potassium participation of structurally and functionally different
(3) Calcium (4) Molybdenum gametes is not observed in

(10)
Test Series for NEET - 2017 Test-10 (Code A)
(1) Fucus (2) Volvox 113. A. Shoot apices perceive the stimulus for
(3) Chara (4) Ectocarpus photoperiodism.
108. Find the correct match w.r.t. disease resistant B. Vernalisation prevents precocious reproductive
varieties. development early in the growing season.
Crop Variety Resistance to (1) Only A is correct
disease (2) Only B is correct
(1) Cauliflower Karan Rai Black rot (3) Both A and B are correct
(2) Cowpea Pusa Komal Bacterial blight (4) Both A and B are incorrect
(3) Chilli Pusa Sadabahar White rust 114. Loss of biodiversity in a region may lead to all of the
(4) Wheat Himgiri Tobacco mosaic following except
virus (1) Decline in plant production
109. Read the following statements and find the correct (2) Increased resistance to environmental
answer perturbations
a. Tonoplast facilitates transport of a number of ions (3) Increased variability in plant productivity
and other materials against concentration (4) Increased variability in water use
gradient into the vacuole.
115. The three major pathways by which cells handle
b. Growth of primary wall continues as the cell pyruvic acid produced by glycolysis includes all
matures and secondary wall is formed on the except
inner side of the cell.
(1) Lactic acid fermentation
c. Inclusion bodies are reserve material storage
structure in bacteria that are covered by a single (2) Aerobic respiration
lipid membrane. (3) Alcoholic fermentation
d. Palade particles are ribonucleoproteins and are (4) Pentose phosphate pathway
membraneless organelles found in all living cells. 116. Exploring molecular, genetic and species level
e. Nuclear pores allow movement of RNA and diversity for products of economic importance is
protein molecules in both directions between called
nucleus and cytoplasm. (1) Bioinformatics (2) Bioremediation
(1) a, c & e are correct (3) Bioprospecting (4) Biomagnification
(2) b, c & d are correct 117. Basis of modern taxonomic studies does not include
(3) a, d & e are correct (1) External and internal structure
(4) b, c & d are incorrect (2) Cell structure
110. Find odd events/phenomena w.r.t. negative soil (3) Ecological information of organisms
pollution
(4) Genetics
i. Addition of pesticides and herbicides.
118. Trichomes on the stem
ii. Overgrazing.
(1) Are usually unicellular
iii. Leaching.
(2) Can never be secretory
iv. Release of industrial effluents.
(3) May be soft or stiff
v. Deforestation and desertification.
(4) Help in preventing water loss due to guttation
(1) i & iv (2) ii, iii & v
119. In a trihybrid cross, what is the probability of
(3) ii. iii & iv (4) i, iii & v offsprings to have a pure homozygous genotype for
111. Hypogynous, actinomorphic flowers and alternate the first trait, heterozygous for second and pure
phyllotaxy is found in homozygous for third trait?
(1) Sunflower (2) Calotropis (1) 4/64 (2) 8/64
(3) Datura (4) Sesbania (3) 2/64 (4) 10/64
112. Increased stability of DNA in comparison to RNA is 120. Chemiosmosis during photophosphorylation does not
due to require
(1) Presence of Thymine in place of Uracil (1) A membrane
(2) Presence of H-bond (2) A proton pump
(3) Stacking of base pairs one above the other (3) Electron gradient
(4) More than one option is correct (4) ATPase

(11)
Test-10 (Code A) Test Series for NEET - 2017
121. Resistance to jassids in cotton is induced by which 128. Facilitated diffusion
morphological or physiological feature of plants? (1) Does not require special membrane proteins
(1) Hairy leaves (2) Is non selective in nature
(2) Solid stem (3) Show uphill transport of substances
(3) Smooth leaves and absence of nectar (4) Shows saturation of transport
(4) High aspartic acid, low N2 and sugar content 129. Primary succession starts in
122. Which of the following features is associated with (1) Abandoned farm lands
the fungal group in which asexual spores are (2) Burnt or cut forests
generally not found and sexual reproduction involves
(3) Sand dunes, Igneous rocks
exogenous meiospores?
(4) Flooded land
(1) Mycelium is branched and septate in which asci
arranged in fruiting bodies 130. Most of the organelles duplicate during
(2) Karyogamy and meiosis takes place inside (1) The interval between mitosis and initiation of
basidium DNA replication
(3) Some members are saprophytes, parasites but (2) The most dramatic period of cell cycle
a large number of members are decomposers of (3) Pre-mitotic phase
litter and help in mineral cycling (4) The minor check point of cell cycle and the
(4) Gametes undergoing fusion are similar in quiescent stage
morphology 131. Root cuttings as well as tip layering are used for
123. Natural aging of a lake due to nutrient enrichment of artificial vegetative propagation in case of
water is called (1) Litchi, Pomegranate
(1) Bio-amplification (2) Eutrophication (2) Blackberry, Raspberry
(3) Evencs (4) Incineration (3) Rose, Clerodendron
124. Living nature of virus is indicated by (4) Sansevieria, Lemon
(1) Presence of energy storing system 132. Correct statement in relation to archegoniate plants is
(2) High specific gravity (1) Sporophyte in liverworts is more elaborate than
that in mosses
(3) Ability to get crystallized
(2) Spores of pteridophytes give rise to conspicuous,
(4) Infectivity and host specificity
large but unicellular free living gametophytes
30
(3) Leafy stage is the second stage of mosses
125.
25 D which develops from secondary protonema as a
Mean annual temperature (°C)

20
lateral bud
B
15 C (4) In Pinus, male and female cones are borne on
10 different trees
5 A 133. Vertical distribution of different species occupying
0 different levels is called
–5
(1) Soil profile (2) Stratification
–10 F (3) Standing crop (4) Biocoenosis
–15
50 100 150 200 250 300 350 400 450
Mean annual precipitation (cm)
134. Single membrane structures containing enzymes for
digestion of all types of macromolecules are
Tropical rain forest in the given diagram is indicated (1) Glyoxysomes (2) Lysosomes
by (3) Centrosome (4) Peroxisomes
(1) A (2) B 135. In case of mustard and Argemone
(3) C (4) D (1) Placenta forms a ridge along the ventral suture
126. Some beneficial elements required by higher plants of ovary and the ovules are borne on this ridge
are forming two rows
(1) Na, Mn, Co, Se (2) Si, Na, Co, Se (2) Placenta is axial and ovules are attached to it in
a multilocular ovary
(3) Cu, Na, Se, Ni (4) Co, Se, Mo, Na
(3) Ovary is one chambered, but it becomes two
127. Flowers in Ravenela are pollinated by chambered due to formation of false septum
(1) Gecko lizard (2) Garden lizard (4) Ovules are borne on central axis and septa are
(3) Lemur (4) Rodents absent
(12)
Test Series for NEET - 2017 Test-10 (Code A)

ZOOLOGY
136. Given below are certain animals in box. 140. All of the following have epithelium which provide
Octopus, Locusta, Unio, Nereis, Echinus protection against chemical and mechanical stress,
Balanoglossus, Sepia, Pheretima, Periplaneta, except
Loligo, Hirudo (1) Moist surface of buccal cavity
How many of them have segmented body, closed (2) Pharynx
circulation and bilateral symmetry? (3) Fallopian tube
(1) Four (2) Seven (4) Dry surface of skin
(3) Two (4) Five 141. Muscle fibres present in blood vessels, stomach and
137. In which of the following, the genus name, its two intestine are
characters and its phylum are correctly matched?
(1) Tapering at both ends (2) Branched
Genus Phylum (3) Cylindrical in shape (4) Striated
Name
142. Choose the incorrect option w.r.t. female cockroach
(1) Euspongia – Skeleton is made Porifera
up of spicules and (1) Fat body, nephrocytes and urecose gland also
spongin fibres help in excretion along with malpighian tubules
– Hermaphrodite (2) A pair of spermatheca are present in 6 th
(2) Physalia – Metagenesis Coelenterata abdominal segment which opens into genital
– Tissue level of chamber
organisation
(3) 10th segment bears a pair of jointed filamentous
(3) Ctenoplana – Extracellular Ctenophora structures called anal cerci
digestion only
– Eight pairs (4) Blood vessels are poorly developed and open into
external row of haemocoel
ciliated comb 143. Which of the following amino acid is represented by
plates single letter code ‘E’?
(4) Anopheles – Chitinous Arthropoda
(1) Serine (2) Cysteine
exoskeleton
– Direct (3) Tyrosine (4) Glutamic acid
development 144. On increasing which of the following factors, activity
138. Read the following statements. of enzyme does not increase?
(a) Over one-third of all named species on earth are (1) Substrate concentration
arthropods. (2) Enzyme concentration
(b) All molluscs contain a file like rasping organ for (3) Temperature within optimum limit
feeding.
(4) Product concentration
(c) Nereis possess parapodia which help in
swimming. 145. Among trypsin, rennin, amylase, sucrase,
carboxypeptidase, erepsin, nuclease, lactase,
(d) Development is indirect in Bufo. nucleotidase and dipeptidase, how many of them are
Choose the correct option which includes incorrect brush border enzymes?
statements.
(1) Four (2) Five
(1) (a) & (b) only
(3) Six (4) Seven
(2) (b) & (c) only
146. Which of the following is not a function of largest
(3) (c) & (d) only gland of the body?
(4) (a) & (d) only (1) Erythropoiesis in embryonic stage
139. Which of the following is not a matching pair of a (2) Detoxification of toxic substances
body feature/phenomenon and the animal possessing
(3) Synthesis of vitamin C
it?
(4) Gluconeogenesis
(1) Bioluminescence – Pleurobrachia
147. Select the incorrect match
(2) Ametabolous development – Lepisma
(3) Camouflage – Hemidactylus (1) VC = TLC – RV (2) FRC = TV + ERV

(4) Intimate fusion of skull bones – Naja (3) TLC = IC + FRC (4) IC = IRV + TV
(13)
Test-10 (Code A) Test Series for NEET - 2017
148. In oxygen transportation, the binding of oxygen with 154. Select the correct match w.r.t. bones in human
haemoglobin is primarily related to body
(1) Partial pressure of oxygen (1) Coxal bone – Ileum, ischium and pubis
(2) Partial pressure of carbon dioxide (2) Scapula – Acromian and coronoid process
(3) Temperature (3) Rib cage – Formed by thoracic vertebrae and
(4) H+ concentration ribs only

149. Match the following w.r.t. leucocytes in human blood (4) Ear ossicles – Malleus, incus and stapes
and their abundance 155. Unipolar neurons are present in
Column I Column II (1) Cerebral cortex
a. Basophil (i) 60-65 per cent (2) Embryo
b. Eosinophil (ii) 0.5-1 per cent (3) Cochlea of ear
c. Monocyte (iii) 2-3 per cent (4) Dorsal root ganglia of spinal cord
d. Neutrophil (iv) 6-8 per cent 156. When a stimulus is applied at a site on the polarised
(1) a(ii), b(i), c(iv), d(iii) membrane, then membrane become
(2) a(iii), b(i), c(iv), d(ii) (1) Impermeable to Na+
(3) a(ii), b(iii), c(iv), d(i) (2) Freely permeable to Na+
(4) a(ii), b(iii), c(i), d(iv) (3) Freely permeable to K+
150. Consider the following statements: (4) Both (2) & (3)
A. In ECG, the end of T-wave marks the end of 157. Select the incorrect statement w.r.t. sensory organs
ventricular systole.
(1) During photopic vision light induces dissociation
B. Atrium and ventricle of same side are separated of the retinal and opsin resulting in changes in
by a thick fibrous tissues. the structure of the opsin
(1) Only A is correct (2) In Human ear, eustachian tube helps in
(2) Only A is incorrect equalising the pressures on either sides of round
window
(3) Both A & B are incorrect
(3) Organ of Corti is a structure located on the
(4) Both A & B are correct basilar membrane in cochlea
151. Which of the following is not a function of (4) Pinna collects the vibrations in the air which
angiotensin II? produce sound
(1) Release of aldosterone from adrenal cortex
158. Given below is a diagrammatic representation of the
(2) Increase glomerular blood pressure mechanism of hormone action
(3) Activates juxtaglomerular cells to release renin
Uterine
(4) Reabsorption of Na+ and water from proximal epithelium
convoluted tubules
152. In nephric tubule, all of the following are reabsorbed Hormone

actively, except
(1) Glucose Nucleus

(2) Amino acid Genome

mRNA
(3) Na+ ion Hormone-receptor
complex
(4) Chloride ion Proteins

153. During muscular activity, cross bridge is broken due Physiological

to response
(Tissue growth and
(1) Hydrolysis of ATP differentiation)

(2) Binding of calcium with a subunit of troponin Which of the following hormone works on the given
mechanism?
(3) Binding of ATP on globular head of myosin
(1) Thyroxine (2) Adrenaline
(4) Generation of action potential on sarcolemma
due to release of neurotransmitter (3) Insulin (4) Somatotropin
(14)
Test Series for NEET - 2017 Test-10 (Code A)
159. The sudden surge of which of the following hormone How many statement/s is/are correct?
can decrease the blood sugar level?
(1) One (2) Two
(1) Growth hormone (2) Glucagon
(3) Three (4) Four
(3) Cortisol (4) Insulin
167. In evolution of plants, psilophyton evolved from
160. Mark the odd one w.r.t. ploidy of cell
(1) Seed ferns (2) Progymnosperms
(1) Primary spermatocyte
(3) Sphenopsids (4) Rhynia-like plants
(2) Secondary spermatocyte 168. Match the following:
(3) Spermatid Column I Column II
(4) Spermatozoa a. Age of invertebrates (i) Ordovician period
161. Secretory phase is characterised by all, except b. Age of fishes (ii) Carboniferous period
(1) Basal body temperature increases because of c. Age of amphibians (iii) Devonian period
rise of progesterone
d. Age of dinosaurs (iv) Jurassic period
(2) Maintenance of thickening of endometrium
(1) a(i), b(iii), c(iv), d(ii) (2) a(i), b(iii), c(ii), d(iv)
(3) Elevated level of estrogen and progesterone
stimulates GnRH (3) a(ii), b(iii), c(iv), d(i) (4) a(ii), b(iii), c(i), d(iv)

(4) Uterine glands become secretory 169. Which of the following is included in physiological
barrier of innate immunity?
162. Formation of second polar body from secondary
oocyte occurs (1) Skin

(1) In ovary, after the completion of meiosis II (2) Mucus membrane of nose

(2) In ovary, after the contact of the sperm with (3) Cytokine
Zona pellucida (4) Acid in stomach
(3) In fallopian tube, after the entry of sperm into the 170. Which of the following is an example of active
cytoplasm of female gamete and before the immunity?
completion of fertilisation
(1) Antibodies crossing placental barrier to reach
(4) In fallopian tube, as sperm enters in isthmus foetus
163. Inert contraceptive method is (2) Antibodies in mother’s milk to protect infant
(1) Multiload-375 (2) Oral pills (3) Antibodies form after an attack of small pox
(3) Cyclofem (4) Lippes loop (4) All of these
164. Which of the following assisted reproductive 171. The lymphoid organ associated with interaction of
techniques is used in those female who cannot lymphocytes with the antigen, which then proliferate
produce ova but can provide suitable environment for to become effector cells is
fertilisation and further development?
(1) Bone marrow
(1) ZIFT (2) GIFT
(2) Thymus
(3) AI (4) ICSI
(3) Peyer’s patches
165. The STD which is not curable if diagnosed earlier is
(4) More than one option is correct
(1) Genital warts (2) Syphilis
172. ________ is used in the treatment of insomnia
(3) Gonorrhoea (4) Genital Herpes
(1) Barbiturates
166. Consider the following statements:
(2) Cocaine
(a) All existing life forms share similarities to varying
(3) Amphetamines
degrees and also may share common ancestors
(4) Both (2) & (3)
(b) Geological history of earth closely correlates
with the biological history of earth 173. Major cause of death among non-infectious disease
is
(c) Tyrannosaurus was the largest herbivore dinosaur
(1) Cancer (2) Pneumonia
(d) Evolution of DDT resistant mosquitoes is an
example of evolution by anthropogenic action. (3) AIDS (4) Tuberculosis

(15)
Test-10 (Code A) Test Series for NEET - 2017
174. In life cycle of Plasmodium, 177. In Bt crops, the genes used to control cotton
bollworms are
(i) Infective stage for mosquito - (a)
(1) cry I Ac and cry I Ab (2) cry I Ac and cry II Ab
(ii) Human RBC and liver cells - (b) (3) cry II Ac and cry I Ab (4) cry II Ac and cry II Ab
178. In ELISA test, the enzyme used is
(iii) Formation of gametes - (c)
(1) Catalase
(iv) Formation of gametocytes - (d) (2) Acid phosphatase
(3) Restriction endonuclease
Choose the correct match
(4) Peroxidase
(1) (a) – Sporozoites
179. Blood capillaries are absent in
(2) (b) – Sporogony
(1) Catla (2) Salamandra
(3) (c) – Salivary gland of mosquito
(3) Salpa (4) Branchiostoma
(4) (d) – Human red blood corpuscles
180. Select the incorrect match
175. Which enzyme is used to open up a fungal cell for
DNA extraction? (1) Inbreeding – Continued inbreeding which
depression reduces fertility and even
(1) Lysozyme
productivity
(2) Cellulase
(2) Outcrossing – Mating of animals within
(3) Chitinase same breed but having no
(4) Ribonuclease common ancestors for 4–6
generations
176. All of the following are the characteristics of an ideal
cloning vector, except (3) Cross breeding – Mating of animals of two
different breeds to produce
(1) Selectable markers better breed
(2) ‘Origin of replication’ sequence (4) Out breeding – Mating of more closely
(3) Polylinker gene sequence related individuals within the
same breed for 4–6
(4) Large size generations

  

(16)
 03/05/2017 Code - A

Regd. Office : Aakash Tower, 8, Pusa Road, New Delhi-110005; Ph.: 011-47623456

MM : 720 Test Series : Test – 10 (Objective) Time : 3 Hrs.

(for NEET - 2017 )

Answers and Hints

PHYSICS
1. Answer (4) 2Tcos = F
2. Answer (1)
T sin 
1 a=
Area = ∫ dv m
a
7. Answer (1)
Area = ∫ dt
Work and energy theorem Wtotal = k
3. Answer (4) 8. Answer (2)
2
1 x
y  x tan   g 20(10)  10(10)
2 u 2 cos2  X
4. Answer (2) 20  10  30
9. Answer (1)
dv
  v
dt
⎛ h⎞
1 ⎟
s  ∫ v dt F ⎜⎝ R ⎠
a
m⎛ k2 ⎞
v
dv
t
⎜⎝ 1  2 ⎟⎠
∫  ∫  dt R
v0 v 0
10. Answer (2)
5. Answer (3)
N 10 vb 11. Answer (2)
12. Answer (1)
30º x
1 75 ⎛ 1 2 2⎞
m  2 ( A2  x 2 )  ⎜ m A ⎟⎠
2 100 ⎝ 2
E
–vs vs
x = A sint
13. Answer (4)

l
x sin30º = 10  4  10 3
l
6. Answer (3)
F r


  0.2  r
l
r
Tcos Tcos
v r l
Tsin Tsin 2 
v r l
a
(1)
Answers & Hints of Test-10 (Code A) Test Series for NEET - 2017
14. Answer (3) 23. Answer (1)

Q Q
At centre O,  0
A1 2a a
24. Answer (4)
A2
qE 
A1v1 = A2v2 tan   ,E 
mg 0
v 22  v12  2gh
25. Answer (4)
15. Answer (3) 26. Answer (4)
H  Fv, F  rv, v  r2
FC
 H  rv2 5
3
 H  r5
A 2 D
16. Answer (1)
K eq. A(T2  T1 )
H 1 3 F
5x
B
l1  l 2
K eq.  i
l1 l 2 4

k1 k2 10
i 1A
17. Answer (3) 10
q1 5 VA  VC 
p3 
q2 3 VB  VD 

p1 27. Answer (1)

 0 ⎛ 2 ⎞ ⎛ 1 ⎞
p2 B1  i⎜ ⎟⎜ ⎟
2a ⎝ 3 ⎠ ⎝ 2 ⎠
0 i
v1 v2 B2  (2sin 60º )
4 a cos 60º
Work = Area
p3 > p1 Bef  B2  B1
18. Answer (3) 28. Answer (2)
vs v0
29. Answer (1)
v r = 1 + xm
⎛ v  v0 ⎞ B = B0 r
f  f ⎜
⎝ v  v s ⎟⎠ B0  r  B0
%B   100
19. Answer (2) B0
a = –  2A sin  t 30. Answer (3)
T = 85 A = 1 cm M1
20. Answer (1)
fmax   mg N
M12 + M22
m  A   mg
2
SN S
M2
21. Answer (4)
31. Answer (2)

Smallest length = hc
2 (photon) 
E
22. Answer (1)
h
r2 (proton) 
L2  L1  10log 12 2Em
r2
(2)
Test Series for NEET - 2017 Answers & Hints of Test-10 (Code A)
32. Answer (3) 38. Answer (1)
ie = ib + ie h

33. Answer (3) 3mkT
34. Answer (1) 39. Answer (3)
1 ⎛ 1.5 ⎞ ⎛ 2⎞ 40. Answer (4)
⎜  1⎟ ⎜  ⎟
f  ⎝ 1.75 ⎠ ⎝ R ⎠ 41. Answer (4)
1 ⎛ 2⎞ 42. Answer (4)
 1.5  1 ⎜  ⎟
f ⎝ R⎠
N1 1
35. Answer (1) 
N2 e
 is min.
N0e  1t
36. Answer (4)  e 1
N0 e   2 t
w1 f
 1 43. Answer (2)
w2 f2
Wattless component = I sin 
1 1 1
  44. Answer (1)
60 f1 f2
37. Answer (2) 1 P
 0E02C 
2 4r 2

x = (2m – 1) 45. Answer (3)
2

CHEMISTRY
46. Answer (2) 54. Answer (3)
Bithional is added to soap to impart antiseptic Pentan-1-ol, 2-methylbutan-1-ol, 3-methylbutan-1-ol
properties. and 2, 2-dimethylpropan-1-ol.
Chlorine in concentration of 0.2 to 0.4 ppm is used 55. Answer (2)
as a disinfectant for drinking water. Configuration is R.
47. Answer (1) 56. Answer (2)
Monomer of neoprene is H2 C  C  CH  CH2 . H2O does not have vacant orbital.
|
Cl 57. Answer (1)
In [Pt(CN) 4] 2(–), Pt 2(+) has d 8 configuration with
48. Answer (3)
dsp2-hybridisation, where pairing of d-electrons takes
It is a straight chain polymer place.
49. Answer (3) 58. Answer (4)
Polypeptides are least soluble at their isoelectric Down the group, in the transition metal series
points. effective nuclear charge increases.
50. Answer (4) 59. Answer (1)
Fact The composition of bleaching powder is
51. Answer (1) Ca(OCl)2.CaCl2.Ca(OH)2.2H2O
Br Br Br 60. Answer (2)
NH2 Br Br
61. Answer (2)
O2N Br O2N Br Br Malachite is Cu(OH)2.CuCO3
(X) (Y) (Z) 62. Answer (2)
52. Answer (4) n = 1, 2, 3 .....
Steric hindrance decreases the nucleophilic addition 63. Answer (3)
53. Answer (3) Hreaction = (Ea)forward – (Ea)reverse
O = 120 – 160
C does not undergo either = –40 kJ/mol
Cannizzaro reaction and aldol condensation. and catalyst does not affect the Hreaction.
(3)
Answers & Hints of Test-10 (Code A) Test Series for NEET - 2017
64. Answer (2) 75. Answer (3)

Hg22 (aq) 
 Hg2 (aq)  Hg(l); P1V1 P2 V2

T1 T2
Eº = (0.797 – 0.920)V = –0.123V
Gº = –nFEº
2.8  r13 1  r23
= –1 × 96500 × (–0.123)  
280 300
1.19 × 104 J
2.8  1.53 1  r23
65. Answer (4)  
280 300
66. Answer (1)
1
Tf = Kf × m
 r2  (3)3  1.5
31  1000
 1.86  = 1.44 × 1.5 cm = 2.16 cm
62  500
76. Answer (4)
= 1.86
a 18
Freezing point of solution = –1.86ºC PC    50.4 atm
27b 2
27  0.115  0.115
= – 1.86 + 273.15
77. Answer (3)
67. Answer (4)
Hisomerisation = –1359.2 – (–1336.6) = –23.2 kJ
Fact
78. Answer (3)
68. Answer (1)
79. Answer (2)
Let mass of Al = x g
KSP = [A2]×[B(–)]2
 mass of Mg + (30 – x)
 8 × 10–12 = 4s3
x 30  x 33.6  s = 21/3 × 10–4
 
9 12 11.2
80. Answer (3)
4x  90  3x 81. Answer (4)
 3
36
3Cu  2NO(3 )  8H 
 3Cu2  2NO  4H2O
 x = 3 × 36 – 90
82. Answer (1)
= 108 – 90
100 volume H2O2  30% H2O2 (wt/vol)
= 18 g
83. Answer (3)
69. Answer (1)
Fact
70. Answer (2)
84. Answer (4)
N2H4 + 7 H2O2 2HNO3 + 8 H2O
85. Answer (2)
∵ 2 × 63 g HNO3  7 × 34 g H2O2
Fact
7  34
 252 g HNO3   252 g H2O2 86. Answer (4)
2  63
476 g H2O2 (pure) Fact
87. Answer (4)
20% impure H2O2  476  100  595 g 88. Answer (3)
80
71. Answer (2) H
72. Answer (4) H3C – CH =* CH –*C – CH3 has two stereocenter
73. Answer (3)
OH
Formal charges are zero without expanded octet
 Number of stereoisomers = 22 = 4
74. Answer (1)
89. Answer (4)
O2 : 1s2, *1s2, 2s2, *2s2, 2px2, 2py2
Fact
= 2pz2, *2py1
90. Answer (1)
= *2pz1

(4)
Test Series for NEET - 2017 Answers & Hints of Test-10 (Code A)

BOTANY
91. Answer (2) 111. Answer (3)
Most widely used PGR is Ethylene. In sunflower, epigynous flower is present
92. Answer (2) In Calotropis, phyllotaxy is opposite.
93. Answer (4) In Sesbania, flower is zygomorphic.
112. Answer (4)
Cytochrome c is a mobile e– carrier.
113. Answer (4)
94. Answer (3)
Vernalisation prevents precocious reproductive
Marginal placentation and vexillary aestivation is not development late in growing season of the plant.
present in Cruciferae. Bicarpellary gynoecium is not
114. Answer (2)
present in leguminosae
Loss of biodiversity leads to decreased resistance to
95. Answer (1)
environmental perturbations.
96. Answer (2) 115. Answer (4)
Pericycle of root gives rise to In pentose phosphate pathway, Glucose-6-P is
a. Lateral roots required
b. Part of vascular cambium 116. Answer (3)
c. Entire cork cambium 117. Answer (4)
118. Answer (3)
97. Answer (4)
119. Answer (2)
Water stress causes decreased metabolic activity.
AaBbCc × AaBbCc
98. Answer (2)
(i) AA Bb CC = 2/64
AUG = Methionine
(ii) AA Bb cc = 2/64
GUG, GUU = Valine
(iii) aa Bb CC = 2/64
GAG = Glutamic acid
(iv) aa Bb cc = 2/64
UGG = Tryptophan
At the sixth position, UAA is present which cause 8/64
premature termination of polypeptide. 120. Answer (3)
99. Answer (2) Proton gradient is required
100. Answer (1) 121. Answer (1)
Trichoderma polysporum forms Cyclosporin A. 122. Answer (2)
101. Answer (3) 123. Answer (2)
102. Answer (2) 124. Answer (4)
103. Answer (2) 125. Answer (2)
For the same amount of CO2 fixed, C4 plants lose 126. Answer (2)
only half as much water as C3 plants. Sodium selenium, cobalt-2, silica are beneficial
104. Answer (4) elements.
105. Answer (3) 127. Answer (3)

106. Answer (1) 128. Answer (4)

Organic farmer holds the view that eradication of 129. Answer (3)
pests is not only possible and is also undesirable. 130. Answer (1)
107. Answer (4) Most organelles duplicate in G1 phase
Ectocarpus shows isogamy or anisogamy. 131. Answer (2)
108. Answer (2) 132. Answer (3)
109. Answer (3) 133. Answer (2)
Growth of primary wall gradually diminishes. 134. Answer (2)
Inclusion bodies are membrane less. 135. Answer (3)
110. Answer (1) Mustard and Argemone show parietal placentation.
(5)
Answers & Hints of Test-10 (Code A) Test Series for NEET - 2017

ZOOLOGY
136. Answer (3) 156. Answer (2)
Nereis, Pheretima and Hirudo are annelida but 157. Answer (2)
Hirudo lack closed circulatory system. Eustachian tube helps in equalizing the pressures on
137. Answer (2) either side of ear drum.
Euspongia lacks spicules. 158. Answer (1)
138. Answer (1) 159. Answer (4)
Over two-thirds of all named species on earth are Insulin decreases the blood sugar level.
arthropods. 160. Answer (1)
139. Answer (4) Primary spermatocytes are diploid cells.
140. Answer (3) 161. Answer (3)
Fallopian tube is lined by ciliated epithelium. 162. Answer (3)
141. Answer (1) 163. Answer (4)
Muscles present in blood vessels, stomach and Lippes loops are non medicated IUDs.
intestine are smooth muscles.
164. Answer (2)
142. Answer (1)
GIFT – Gamete intrafallopian transfer.
Urecose glands are present in only male cockroach.
165. Answer (4)
143. Answer (4)
All STDs are curable if diagnosed earlier except
Serine- ‘S’ AIDS, hepatitis B and Genital Herpes.
Cysteine - ‘C’ 166. Answer (3)
Tyrosine - ‘Y’ Tyrannosaurus was the largest carnivorous dinosaur.
Glutamic acid - ‘E’ 167. Answer (4)
144. Answer (4) 168. Answer (2)
On increasing product concentration enzymatic 169. Answer (4)
activity decreases.
Skin and mucous membrane are included in physical
145. Answer (2) barrier of innate immunity.
Brush border enzymes are present in intestinal juice. 170. Answer (3)
146 Answer (3) Active immunity provides relief after long period and
Liver synthesizes Vit- A from -carotene. is long lasting.
147. Answer (2) 171. Answer (3)
FRC = ERV + RV 172. Answer (1)
148. Answer (1) Barbiturates are depressants and induces sleep.
149. Answer (3) 173. Answer (1)
150. Answer (4) 174. Answer (4)
Atrioventricular septum separates atrium and ventricle (a) – Gametocytes
of same side. (b) – Schizogony
151. Answer (3) (c) – Mosquito body
A fall in glomerular blood flow can activate JG cells (d) – Human RBC
to release renin
175. Answer (3)
152. Answer (4)
176. Answer (4)
Nitrogenous wastes are absorbed by passive
Ideal cloning vector should have small size.
transport.
177. Answer (2)
153. Answer (3)
Cry I Ac and Cry II Ab genes are used to control
A new ATP binds and cross bridge is broken.
cotton bollworms.
154. Answer (4)
178. Answer (4)
Ribcage includes thoracic vertebrate, ribs and
179. Answer (3)
sternum.
Urochordates have open circulatory system.
155. Answer (2)
180. Answer (4)
Unipolar neuron is usually found in embryonic stage.

  
(6)