CIBA TM Series 2019 No.

15

Training manual on
Biofloc Technology for Nursery and
Growout Aquaculture

24 - 28 September 2019

Published by
Dr. K. K. Vijayan
Director, ICAR-CIBA

Course Co-ordinator
Dr. A. Panigrahi
Principal Scientist, CCD, ICAR-CIBA

Sponsored by Organized by

ICAR - CENTRAL INSTITUTE OF BRACKISHWATER AQUACULTURE

75, Santhome High Road, R. A. Puram, Chennai – 600 028
Tamil Nadu, India
Training manual: Biofloc Technology for Nursery and Growout Aquaculture

Brackishwater aquaculture for food, employment and prosperity

Published by
Dr. K.K. Vijayan, Director, ICAR-CIBA

Course Coordinator
Dr. A. Panigrahi, Principal Scientist, CCD

Course Facilitator
Dr. C.P.Balasubramanian, Principal Scientist, HOD-CCD

Co-cordinators

Dr. M. Jayanthi, Dr. S. Kannappan, Dr. P. Nila Rekha, Dr. T. Ravisankar, Dr. J. Syamadayal,
Dr. R. Saraswathy, Dr. S.K.Otta, Dr. K. P. Kumaraguru Vasagam, Dr. P.S. Shyne Anand,
Dr. Sujeetkumar, Mr. K.P. Sandeep, Dr. T.N. Vinay, Dr. N.S. Sudheer, Mr. I.F. Biju,
Mr. R. Aravind

Prepared and Edited by

Dr. A. Panigrahi, Dr. S.K. Otta, Dr. K.P. Kumaraguru Vasagam, Dr. P.S. Shyne Anand,
Mr. I.F. Biju, Mr. R. Aravind

Cite as: Panigrahi A, Otta S. K., Kumaraguru Vasagam K. P., Shyne Anand P. S., Biju I. F.,
and Aravind R. Training manual on Biofloc technology for nursery and growout aquaculture,
CIBA TM series 2019 No. 15, 172 pp.

Disclaimer
All rights reserved. No part of this publication may be reproduced, stored in a retrieval
system or transmitted in any form or by any means, electronic, mechanical, recording or
otherwise, without the prior written permission of Director, ICAR-CIBA.

The author and publisher are providing this book and its contents on an “as is” basis and
make no representations or warranties of any kind with respect to this book or its contents.
In addition, theauthor and publisher do not represent or warrant that the information
accessible via this book isaccurate, complete or current.

Except as specifically stated in this book, neither the author or publisher, nor any authors,
contributors, or other representatives will be liable for damages arising out of or in
connection with the use of this book.
 CONTENTS

Sl. No Topics Page No

Innovative culture practices in brackishwater aquaculture with
1 ecosystem approach 1-8
K. K. Vijayan and A. Panigrahi
Biosecurity and Best Management practices in shrimp aquaculture
2 C. P. Balasubramanian, P. Shyne Anand and A. Panigrahi 9-12

Introduction to biofloc technology: Principles, prospects and challenges

3 13-21
Dr. A. Panigrahi
Biofloc technology: Standard operating procedure
4 22-32
Panigrahi. A, Saranya C, Kumaran M and Rashmiranjan Das
Integration of submerged substrates in biofloc based system
5 33-35
P. S. Shyne Anand and Sujeet Kumar

Emerging diseases in brackishwater aquaculture in India

6 36-39
S. V. Alavandi
Microbial role in biofloc system
7 40-45
Sujeet Kumar
Design consideration of biofloc production systems
8 46-56
P. Nila Rekha, Neethu K. C. and A. Panigrahi
Biofloc technology for water quality management in aquaculture
9 57-63
Saraswathy R, Muralidhar M, A Panigrahi, N. Lalitha and P. Kumararaja
BMP for pond soil management
10 64-67
M. Muralidhar, R. Saraswathy and A. Panigrahi
Aeration requirements in biofloc based shrimp culture systems
11 68-74
M. Jayanthi and A. Panigrahi
Nutrition and feeding strategy in a biofloc system
12 J. Syama Dayal, K. Ambasankar, K. P. Kumaraguru Vasagam 75-81
and A. Panigrahi
Biofloc meal could be a sustainable ingredient in aqua feed
13 K. P. Kumaraguru Vasagam, K. Ambasankar, J. Syama Dayal 82-86
and K. P. Sandeep
Current status of aqua feed industry in India and CIBA’s initiative in
14 newer feed Technologies 87-93
Ambasankar J. Syama Dayal, K. P Kumaraguru Vasagam, Sandeep K. P
and P. Nila Rekha
Biofloc shrimp farming and health management strategies
15 94-96
Subhendu Kumar Otta, Sudheer N. S. and Akshaya Panigrahi
Effect of bio-flocs on the shrimp immune system
16 97-103
A. Panigrahi, C. Saranya, Vinay T. N., S. K. Otta and Ashok Kumar J
Applications of biofloc technology
17 104-107
Anil Ghanekar
 Ecosystem based biofloc shrimp farming: nursery rearing experiences
18 108-112
A. Panigrahi, Shyne Anand P.S., Saranya C. and Biju I. F
Insights into the biofloc based shrimp grow out technology
19 A. Panigrahi and T. Govind Raj
113-118

Controlling aquatic pathogens through bft: w.r.t luminescence causing

20 Vibrio harveyi 119-124
Kannappan S, Yuvaraj S and A. Panigraghi
Role of microalgae, isolation and identification in biofloc culture system
21 R. Aravind, K. P. Sandeep and A. Panigrahi
125-133

Aquamimicry: an innovative organic approach

22 A. Panigrahi, R. Aravind and Biju I. F.
134-138

Economics of bio floc based farming

23 T. Ravisankar, Akshya Panigrahi and Anil Ghanekar
139-146

24 PRACTICALS 147-171
 INNOVATIVE CULTURE PRACTICES IN BRACKISHWATER
AQUACULTURE WITH ECOSYSTEM APPROACH
K. K. Vijayan and A. Panigrahi
E mail: [email protected]

Brackishwater aquaculture is a “sun rise sector” in India, which plays a crucial role in socio-
economic expansion and is considered as influential income and employment generator. In the last
three decades (1980–2010), world aquaculture production has expanded by almost 12 times,
atanaverageannualrate of 8.8 percent (FAO, 2010). Brackishwater aquaculture in India especially
has evolved as a commercial enterprise with an impressive annual growth rate of 6-7 percent.
However, along with intensification of commercial shrimp culture, industry started to face issues
like spiralling price of commercial feed, diseases outbreaks, sustainability concern etc. Hence, the
concepts of delivering high production with sustainable approach through evolvingeco-friendly
technologies started getting momentum worldwide. Modern, industrial aquaculture could
strengthen its social and ecological roots by articulating its evolution along a sustainability
trajectory and by adopting fully the Food and Agriculture Organization (FAO) ecosystems approach
to aquaculture (EAA; Soto et al., 2007). While acknowledging the economicgains and employment
opportunities provided by shrimp sector, it is essential to recognize that the growth of brackishwater
aquaculture in India is skewed towards monoculture of shrimp. During 2014 -15 shrimp
aquaculture has shown a tremendous growth (30.64%) and achieved highest production
(4,34,558MT).

Ecosystem approach to aquaculture (EAA) is a strategy for the integration of the activity
within the wider ecosystem in such a way that it promotes sustainable development, equity, and
resilience of interlinked social and ecological systems” (Soto et al., 2007). The present article
provides innovative aquaculture practices for Indian brackishwater aquaculture keeping in mind
the ecosystem approach, its principle, relevance and conceptual framework.

Ecosystem approach to aquaculture (EAA)

The Fisheries and aquaculture department of FAO recognized the need of development of
ecosystem based management for aquaculture in the line of the code of conduct for responsible
fisheries in the year 2006. EAA is defined as “a strategy for the integration of aquaculture with the
wider ecosystem such that it promotes sustainable development, equity and resilience of interlinked
social-ecological systems”. FAO suggested three objectives for the ecosystem approach of
aquaculture: human wellbeing, ecological wellbeing and ability to achieve these by effective
governance, and these can be measured at farm, region and global level. EAA works on three
interlinked principles. These three principles are operated at three levels, farm level, watershed or
region level and globe level (Figure 1 a & b). These three principles are:

1
Principle 1“Aquaculture development and management should take account of the full range of
ecosystem functions and services, and should not threaten the sustained delivery of these to society”

Development of aquaculture within the acceptable limits of environmental variable requires

an understanding about the carrying capacity of the ecosystem and ecosystem functioning. Any
aquaculture pond orcage is the ‘aquaculture ecosystem’ and the ecosystem where this production
system is embedded is the wider ecosystem. The resilient or carrying capacity of this ecosystem
should bedefined.
Principle 2 “Aquaculture should improve human well-being and equity for all relevant
Stakeholders”
Aquaculture should promote food security and environmental safety. Here food security does
not suggest that it should solve the problems of hunger, particularly area where aquaculture is
anewactivity. However, it should promote livelihood and generate employment opportunity.
Aquaculture development should ensure that it benefits are properly shared among all
thestakeholders.

Principle 3 “Aquaculture should be developed in the context of other sectors, policies and goals”
This principle acknowledge the opportunity of integrating or linking aquaculture with other
producing sector to promote material and energy recycling and optimal use of resources.
Aquaculture does not take place in isolation, although its impact to other human activities is rather
lesser than agriculture and industry.

Figure 1 a) Ecosystem based approach to aquaculture-guiding principles and scales.

b) Sustainable intensification.

Ecosystem approach to brackishwater aquaculture (EABA) in India

Considering the full range of ecosystem functions and management has traditionally been
practiced in brackishwater aquaculture in India, which is closely associated with the principle one.
Further, there has been research initiation to refine the technique and document the current
practices. In this system effluents and residues from the farming system has been recycled and used
as resource.

2
Traditional brackishwater aquaculture system in India
In the coastal states like Kerala, West Bengal, Karnataka and Goa, traditional brackishwater
aquaculture prevails which are classical examples of integrated aquaculture, essentially falls under
the framework of EABA. It is practiced in two forms 1) Temporal integration of rice with shrimp
2) Simultaneous integration of rice and fish culture. In this type of system, tall, salt tolerant rice
varieties are cultured during the monsoon season (summer monsoon: June to Nov) in the fields
bordering the backwaters of Kerala, and during the post monsoon and summer season shrimps are
cultivated. In the later during the rainy season when salinity is negligible, rice and brackishwater
fishes are cultivated simultaneously. Chemical fertilizers or pesticides are notused.
The economic return of rice-fish/shrimp integrated system indicates that rice and fish followed
by shrimp provides significantly high economic returns. Presently, the traditional system is
modified by stocking with hatchery reared seed and supplementary feeding. The recent research
also attempts to use improved salinetolerantrice varieties to circum vent the low productivity of
traditional ricevarieties, to enable increased economic returns to the farmer. The availability of
hatchery produced seeds of penaeid shrimps and fin fishes such as sea bass, pearl spot and
increasing knowledge about this ecosystem provides an opportunity to optimize the sustainability
and economic viability of this type of farming practices.

Research efforts at CIBA

Over the years, ICAR-CIBA has generated significant information on shrimp, fish, crab
hatchery and grow-out production, nutrition and feed-technology, disease diagnosis and
management to address the growing needs of brackishwater aquaculture sector and provided a
platform for interaction with stakeholders. These technologies have the ecosystem approach based
footprints and are discussed here.

Polyculture based production system

ICAR-CIBA carried out several experiments to evaluate the production potential of
polyculture of brackishwater fin fishes and shell fishes. In an experiment to evaluate the poly
culture in an extensive system, farm level performance of two systems were evaluated: shrimp with
mullets (Mugil cephalus, Liza parsia and L. tade), and shrimp milk fish (Chanos chanos). In the
180 day culture experiments, it was found that the production is similar in both systems. However,
tiger shrimp out performed in mullet-shrimp system than the milk fish shrimp system. It indicates
that the mullet is more compatible with shrimp than milk fish. Further, this study also concludes
that resource poor farmers can adopt this system as the input cost and expenditure is low.

Organic production system for brackishwater species

Organic aquaculture is a process of production of aquatic plants and animals with the use of
only organic inputs in terms of seeds, supply of nutrients and management of diseases. Organic
3
production system is an ecosystem based approach to aquaculture.Organic foods have a separate
niche market and many farmers are attracted to these farming practices due to lower cost of
production and better economic returns. In India, INDOCERT provides certification for organic
production systems. Although organic aquaculture is in a very nascent stage in India, its traditional
system is close to the organic way of farming.

Organic Aquaculture: periphyton based farming

CIBA has attempted research effort to enhance the production and sustainability of shrimp
farming within the frame work of EABA. Periphyton based farming is an attempt in this direction.
Periphyton refers to the entire complex of attached aquatic biota on submerged substrates
comprising phytoplankton, zooplankton, benthic organisms and detritus. The study conducted by
CIBA clearly indicates that periphyton has a beneficial effect on growth and production of shrimp.
Better growth rate with a productivity of 1640 to 2796 kg/ha/crop at a stocking density 8-12
individuals/m2 was observed. Further, the rate of return over operational cost was higher in
periphyton-based system (92%) compared to the conventional farming (54%). This level of
improvement of pond production with cheap on farm resources enhance the productivity of shrimp
ponds without deteriorating ecosystem.

Integrated multi-tropic Aquaculture (IMTA)

Integrated Multi-Tropic Aquaculture is the farming of different aquaculture species to gether
in a way that allows one species’ wastes to be utilized as feed for another. Farmers can combine
fed aquaculture (e.g., fish, shrimp) with inorganic extractive (e.g., seaweed) and organic extractive
(e.g., shellfish) aquaculture to create balanced systems for environment remediation
(biomitigation), economic stability (improved out put, lower cost, product diversification and
riskreduction) and social acceptability (better management practices) (Barrington et al., 2009). This
forming model can be developed for augmenting the average productivity of open waterbodies.

Bio secured zero water exchange shrimp farming technology (BZEST)

Bio secure zero-exchange system for shrimp represents an emerging technology that provides
a high degree of pathogen exclusion with minimal or zero water exchange. This zero water
exchange shrimp farming system is an evolving culture practice with use of probiotics (Panigrahi,
et al. 2007) and zero tolerance to banned chemicals and antibiotics. CIBA has developed a BZEST
for application in the shrimp farming sector, which is characterized by the improved productivity
and better FCR. This BZEST system is amenable for control of disease through Best Management
Practices and preservation of waterresources.

Bio-floc based technology for brackishwater species

This is a relatively new technology to support high density, better water quality, water
conservation, bio security, lower feed requirement and reduce the production cost. The concept of
biofloc technology work saround the formation of dense heterotrophic bacterial community.
4
Eventually the system becomes bacterial dominated rather than algae dominated and forms
microbial flocs by utilizing the waste materials in the pond. Biofloc is the conglomeration of micro
organisms (such as heterotrophic bacteria, algae (dinoflagellates & diatoms), fungi, ciliates,
flagellates, rotifers, nematodes, metazoans & detritus). Constant aeration and intermittent addition
of carbon source as organic matter for the bacteria is needed to prevent the collapse of the system.
In a typical brackishwater pond, 20–25% of fed protein is retained in the fish/shrimp, rest is
wasted as ammonia and other metabolites. Manipulating the C:N ratio in the pond enhances
conversion of toxic nitrogenous wastes into microbial biomass available as food for culture
animals. CIBA has initiated efforts to develop a biofloc model suitable for Indian brackishwater
farming systems. A series of experiments in pilot scale was conducted at CIBA showed measurable
gain in the production as well as FCR in tiger shrimp P. monodon farming by following these eco
based techniques (Shyne et al. 2012). Several studies (Panigrahi etal., 2014; Sujeet etal.,2015)
indicates that bio-floc with periphyton systems (BPT) increased growth, survival and protective
response.

Seaweed integration with brackishwater aquaculture species

There are attempts from research organization as well as private sectors to integrate shrimp
aquaculture with seaweeds to make the intensive aquaculture more environmentally non
degradable. Pacific Reef Fisheries, Pvt Ltd. started growing sea weed, Ulva spp in the 5 ha race
way of their 98 ha P.monodon farm, and reported that this would be sufficient to remove the
Nitrogen and Phosphorous from the effluent water from the shrimp farm. Further, the secondary
crop provides additional income. CIBA have initiated research in this direction developing model
farming with seaweed integration.

Carrying capacity
Carrying capacity is the major component of the EABA that helps to set upper limits of
aquaculture production within the limits of environment or ecosystem and social acceptability
(Ross et al., 2013). Carrying capacity is definedas “Ingeneralterms, carrying capacity for any
sector can be defined as the level of resource use both by humans or animals that can be sustained
over the long term by the natural regenerative power of the environment” (FAO, 2010).
Aquaculture is a resource based industry, and therefore, it will compete with other allied industries,
for example, fisheries, agriculture and tourism. It is therefore, essential to determine the carrying
capacity for the sustainable development tofaquaculture. Carrying capacity has been categorized
into four: physical, production, ecological and social (McKindsey et al., 2006).1) Physical carrying
capacity quantifies the potential area available for aquaculture in the ecosystem. 2) Production
carryingcapacity estimates the maximum aquaculture production.

3) Ecological carrying capacity determines the magnitude of aquaculture production without

leading to the detrimental changes to the ecosystem. 4) Social carrying capacity is the amount of
aquaculture that can be developed without major environmental and social impacts. CIBA has
5
developed decision support software in visual basic to estimate the maximum allowable farming
area for a particular creek ordrainagecanal (Muralidhar., 2009). This software helps to determine
are liable estimation of impact of shrimp farming and other land use impact in a region under
various scenarios of increased development.

Conclusion
CIBA have developed and demonstrated some of the ecobased system of farming based on
Low Input Sustainable Aquaculture (LISA); like improved traditional system, Organic farming
system; including periphyton based farming, brackishwater polyculture system, Bio-floc, and
integrated farming system involving rice, fish and horticulture. The ecosystem approach to
aquaculture is mainly focused on low input based simple technology suited to the local conditions,
providing sustainable, economically viable and socially acceptable models. India has vast resources
of traditional farms which are close to nature which can be easily modified to suite these
technologies. Most innovations and development of brackishwater aquaculture show casing the
economic earnings is mainly due to the “industrial” aquaculture, using SPF seeds, formulated
extruded feeds, aeration and with the use of various pond management inputs. Balanced growth of
these different trajectories on complementary and integrated mode is the need of the hour. Ecobased
innovative technologies like Biofloc or periphyton will certainly ensure to develop ecologically
integrated aquafarming systems that are community-based, sustainable, and economically viable,
along the side of industrial farming sector.

References
Barrington, K., Chopin, T., Robinson, S. 2009.Integrated multi-trophic aquaculture (IMTA) in
marine temperate waters. In D. Soto (ed.). Integrated mariculture: a global review. FAO
Fisheries and Aquaculture Technical Paper: 529:7–46.
FAO.2014.The State of World Fisheries and Aquaculture 2014. Rome 223 pp. available at
www.fao.org/docrep/013/i1820e/i1820e00.htm).
McKindsey, C.W., Thetmeyer, H., Landry, T., Silvert, W. 2006. Review of recent carrying capacity
models for bivalve culture and recommendations for research and management. Aquaculture,
26: 451–462.

Muralidhar, M., B. P. Gupta, P. Ravichandran, S. M. Pillai, C. Gopal, Ch. Sarada and A. G. Ponniah.
2008. Decision support software on carrying capacity: Estimation of maximum area under
shrimp farming for a selected water body. CIBA technology series,2.
Panigrahi A., Sundaram., M., Ravichandran, P., Gopal, C. 2014.Microbial based approach for
shrimp culture and management. ENVIS Newsletter (12)3-6.
Panigrahi, A., Azad, I. S. 2007. Microbial intervention for better fish health in aquaculture: the
Indian scenario. Fish Physiology and Biochemistry, 33:429-440.

6
Ross, L.G., Telfer, T.C., Falconer, L., Soto, D., Aguilar-Manjarrez, J.2013.Site selection and
carrying capacities for inland and coastal aquaculture.FAO/Institute of Aquaculture,
University of Stirling, ExpertWorkshop,6 8 December 2010. Stirling, the United Kingdom of
Great Britain and Northern Ireland. FAO Fisheries and Aquaculture Proceedings No. 21.
Rome, FAO. pp46
Shyne Anand, P.S., Sujeet Kuma, Panigrahi, A., Ghoshal, T. K., Syama Daya, J., Biswas, G.,
Sundaray,J.K. De, D., Ananda Raja, R., Deo, A. D., Pillai, S. M., Ravichandran. P. 2012. Effects
of C:N ratio and substrate integrationon periphyton biomass, microbial dynamics and growth of
Penaeus monodon juveniles. Aquaculture International. 2:1511–524.
Soto,D.,Aguilar-Manjarrez,J.,Hishamunda,N.Buildinganecosystemapproachtoaquaculture.FAO/
Universitat de les Illes Balears Expert Workshop.7–11 May 2007, Palma de Mallorca, Spain,
FAO Fisheries and Aquaculture Proceedings.No. 14. Rome, FAO.pp15–35.

Sujeet Kumar., Shyne Anand., PS, De, D., Deo, A.D., Ghoshal, T.K., Sundaray, J.K., Ponniah, A
G., Jithendran, KP., Raja, RA., Biswas G., Lalitha, N., 2015.Effects of biofloc under different
carbon sources and protein levels on water quality, growth performance and immune responses
in black tiger shrimp Penaeus monodon (Fabricius, 1978). Aquaculture Research. 1-15

Biofloc and periphyton based farming

Biosecured Probiotic based farming

7
Organic farming system

8
 BIOSECURITY AND BEST MANAGEMENT PRACTICES IN
SHRIMP AQUACULTURE
C. P. Balasubramanian, P. Shyne Anand and A. Panigrahi
Email- [email protected]

Aquaculture has evolved from a simple but an elegant system, which has deep community and
family roots. In 1980s, there was a drive towards the export oriented agriculture crops. Thus, many
traditional agriculture has grown from basic food producing system to a market driven complex export
oriented enterprise. Shrimp culture in the tropics is the paradigmatic example for this transformation.
Tropical shrimp farming is considered to be one of the few success stories of modern aquaculture.
Evolution of shrimp aquaculture from a fishery based pond production system of 1970s to a mature
industry of 1990s is spectacular. Its early success attracted many farmers, and this industry has become
the focal point of export in many tropical developing countries. However, the early success and image
of risk-free clean-industry has not lasted for many years due to the frequent disease hits and crop failures.
Success of shrimp culture often depends on how successfully disease out-break can be prevented and
controlled. Further environmental protection, conservation of biosecurity and social equity are equally
important for the long-term sustainability of shrimp farming, although these elements are masked by the
short term gains and success.
It is extremely difficult to differentiate suboptimal performance and disease in aquaculture
system due to the complexity of this ecosystem. Disease is the end result of series of linked events
involving environmental factors, health status of cultured stocks, presence of an infectious agent and
poor husbandry. In order to prevent the disease out-break and negative environmental effect of
aquaculture, the whole aquatic ecosystem including ecological process must be taken into consideration.
The traditional pathogen-focused approach, therefore, should be replaced by more holistic approach
focusing the whole ecosystem. The best management practices and the strict biosecurity measures are
the essential tool to manage the disease and environmental health
History of best management practices can be traced back to the history of aquaculture or the
history of any production system. It is evolved from the producers’ quest to reduce the input and costs,
and vast majority of the best management practices are generated by the producers. No single BMP
reduces key impact equally, as there is no one-size fit for all. The most effective BMP depends on species
cultured, type and magnitude of impact, scale of production, resource available to producers and overall
management of the system. As best management practices in aquaculture and biosecurity protocols are
intimately linked, in this lecture note, these aspects are treated together.

Biosecurity
The entire stake holders of aquaculture concerned about biosecurity: Consumers need to ensure
the seafood that they eat are safe, the processors have to follow HACCP guidelines to provide safe
seafood, investors should protect their investment from the preventable losses. The Biosecurity
workshop for aquaculture defined biosecurity as: “an essential group of tools for the prevention, control,
9
and eradication of infectious disease and the preservation of human, animal, and environmental health”
The principles of bio-security are not only to keep away the pathogen from the farming environment but
also from the country.

The success of poultry industry world-wide is the successful implementation of biosecurity. It

has been prompted the use of similar protocol in shrimp farming. In Poultry biosecurity is defined as:
“cumulative steps taken to keep disease from a farm and to prevent the transmission of disease within
an infected farm to neighboring farms.” It is a team effort, shared responsibility and an ever-time process.
Basic philosophy behind biosecurity is to prevent the entry of pathogen, ensure the best living condition
to the animals and to provide a clean product to the customer. The principles of biosecurity in the poultry
can be applied to the aquaculture
In the following section, BMP and biosecurity measures to be taken at each stage or each
component of farming has been dealt.
Site selection: Poorly located sites are often found to be failed and provide negative ecological impacts.
Potential problems should be identified and measures should be taken to avoid maximum problems.
Mangrove sites and other coastal wet lands should be avoided, as these habitats are inherently important
for ecological well-being.
Farm design: Modular seawater system with reservoir ponds before use in culture is found to be
effective. All these farm design directly depends on the characteristic site and level of intensity.
All inlet and outlet system should be free from leakage, and to avoid carriers such as crabs and birds,
preventing nets should be installed. Additionally, the management measures to improve soil quality and
other preventive measures should be taken as per the following Table

Strategies Benefits

Sludge removal and disposal away from the pond Increase the carrying capacity of the
sites pond, and improve the pond general
conditions

Adoption of minimal water exchange Increase the stability of culture

environment, minimize the entry of
influent pathogens

Water filtration using twin bag filters of 300 µm Prevent the entry of disease carrying
filters vectors

Water treatment using approved chemicals such as Eradication of pathogens

chlorine, and aging the water

Maintaining the water depth at least 80 cm at shallow Prevent the formation of benthic algae
part of depth

10
Broodstock and post larvae
During the early days of shrimp farming, farmers used wild seed stock entering along with the
tidal inflow or captured wild broodstock. This practice was replaced later with the use of hatchery
produced seeds obtained from the wild caught broodstock. This wild caught broodstock are often carriers
of pathogens. Thus, it is understood that dependence of wild broodstock are important source of
pathogen entry, and without de linking the wild fishery and aquaculture, the disease management cannot
be attained effectively. Thus, use of captive reared and specific pathogen free broodstock are found to
be crucial. The process of development of specific pathogen free broodstock are given below

Development of Specific Pathogen Free stock

Whatever the methods have been incorporated to eradicate the occurrence and out -break of disease
in aquaculture ponds, none could provide enough protection, if we use seed stocks derived from the wild
brooders. Therefore, the most important principle of biosecurity is the use of domesticated stocks, which
have been cultured under controlled conditions and that have been under active disease surveillance
program. The development and use of specific pathogen free (SPF) stock is, perhaps, the best
management strategy for stock control in farms or regions or countries. Although in market place, these
stocks are called as “disease free” in reality they are free of specific disease causing agents. SPF means
the stock of interest has at least 2 years of documented historical freedom of pathogens listed on the
working list. This pathogen should have the following criteria: 1) the pathogens must be excludable; 2)
adequate diagnostic methods should available and 3) pathogen should pose significant threat to industry.

The process of SPF development begins with identification of wild or cultured shrimp stocks. The
samples of this stock then will be tested for specific pathogens using appropriate diagnostic procedures.
If these stocks are free from specific pathogens they are designated as founder population or F0, and they
will be reared in a primary quarantine facility. During the primary quarantine F0 stock will be monitored
periodically for the specific pathogens. If this stock is detected for any of the specific pathogens, the
stock will be destroyed. The stock will be moved to secondary quarantine, if they are free of specific
pathogens. At this facility these stocks will be matured, selected and produce F1 generation. These F1
stocks will be maintained in quarantine further to ensure that they are free from specific pathogens.
These SPF stocks will be supplied to hatcheries and breeding centers.

Use of stress test

Exposure to weak concentration of formalin or with change in salinity can be used to determine
whether post larvae are strong enough to survive stocking into ponds.

Feeds and feed management

Manufactured feeds account for 60 -70% of total operating cost in shrimp aquaculture. Feeds are
one of the important concerns for environmental group because it depends marine capture fishery for
fish meal and fish oil. Further, 20 to 40% of feed becomes remained unused by shrimp become pollutant
to the pond. Use high quality feed, and feed should not contain more nitrogen and phosphorus than
shrimp needed. Feed management practices should be carefully monitored. It should be assured that
shrimp consume as much as feed shrimp consume, to avoid the wastage of feed. Check tray should be
11
used to avoid over feeding and under feeding. Feeding should be practiced four to five times per day,
and it should be broadcasted widespread. Feed should be adjusted with biomass and appetite of shrimp.
Natural productivity has an important role in the nutrition of farmed shrimp. The larvae at early stages
cannot consume pellet feed as efficiently as larger shrimps, and therefore, natural biota of the culture
pond plays an important role in the nutrition during the early phase of culture. Therefore, production and
maintenance of natural productivity has important role in the sustainable shrimp farming. Do not use
fresh feed or other material for feeding the farmed shrimp.

Health management
Regular monitoring of shrimp for the health status should be carried out, the sick and moribund
shrimp should be removed regularly. In the case of disease out-break of disease strict quarantine protocol
should be followed to prevent the spread of disease. As many stressors reduce the innate immunity of
many cultured shrimp, the measures should be taken to minimize the stress such as maintenance of high
oxygen content in the water, maintaining stable pH, temperature and salinity of rearing water, minimize
the use of feed, water exchange etc. The eradication of disease at the beginning is easier and do not use
antibiotic. Use probiotics judiciously and only when the efficacy of the product is proved.

Conclusion
BMP and implementation is most crucial component of successful shrimp aquaculture. The most
important step of the biosecurity is the exclusion of pathogen from the system. Education on biosecurity
makes farmers more awareness. It provides set of tools to protect the crop, and eventually it makes
shrimp farming more profitable and sustainable.

12
 INTRODUCTION TO BIOFLOC TECHNOLOGY: PRINCIPLES,
PROSPECTS AND CHALLENGES
Dr. A. Panigrahi

Email: [email protected]/[email protected]
Introduction
Economic growth and sustainability are the major driving force behind the growth of fish/shrimp
farming sector. In light of increasing disease out breaks in shrimp aquaculture and price of commercial
feed, the concept of delivering high production with evolving eco-friendly technologies like Biofloc and
periphyton based farming system are gaining momentum. “Biofloc” technology is changing the facet of
intensive aquaculture with scope to attain high productivity with a sustainable approach. Bio-floc is an
assemblage of beneficial microorganisms such as heterotrophic bacteria, algae (dinoflagellates &
diatoms), fungi, ciliates, flagellates, rotifers, nematodes, metazoans & detritus. As it contains
predominantly heterotrophic bacterial community over autotrophic and denitrifying bacteria, this can be
controlled by maintaining high carbon to nitrogen ratio (C:N). Biofloc in combination with periphyton
(BPT) increases the natural production and in turn productivity. The lower/minimal water exchange
facility in biofloc system also improves the pathogen exclusion in culture pond.
BFT supports high density and biosecurity, maintain the waterquality even in the absence of water
exchange, maximum utilization of nitrogen input in the form of feed and finally results in economically
viable system. Through developing dense heterotrophic bacterial community by C:N ratio manipulation,
the system becomes bacterial dominated rather than algae, and maintains water quality through in situ
bioremediation. As disease outbreaks and their impact on commercial shrimp farming operations during
the past two decades greatly affected the operational management of shrimp farms, BFT approach
promises a healthy rearing system, which is increasingly identified as one possible approach for disease
prevention.

Principle
In a typical brackishwater pond, only 20–25% of fed protein is utilised by the fish/shrimp, rest of
which goes as waste in the form of nitrogenous metabolites. Manipulation of carbon: nitrogen ratio in
shrimp/fish ponds encourages the uptake of this inorganic nitrogen in to microbial protein known as
biofloc. The biofloc principle combines the removal of nutrients from the water with the production of
microbial biomass, which can be used by the cultured species, in situ as additional food source. The
optimum C:N ratio in an aquaculture system can be maintained (C:N ratio 12-15:1) by adding different
locally available cheap carbon sources and / or reducing protein percentage in feed. Under optimum C:N
ratio, inorganic nitrogen is immobilized into bacterial cell while organic substrates are metabolized.

13
 Fig1.Schematic diagram showing the concept of biofloc in a grow-out system and b) Nitrogen
conversion pathway in biofloc system.

Evolution of biofloc concept

As early as in the year 1976, Steve Surfling put forward the‘microbialsoup’concept that eventually
led to the development of “bio-floc” based aqua farming. Dense heterotrophic bacterial community is
developed to make the system bacterial dominated. Accumulation of these bacteria, called flocs, engulf
up the nitrogenous wastes ten to hundred times more efficiently than algae, and turn them into high-
protein feed. In early 1980s BFT was developed at Ifremer-COP (French Research Institute for
Exploitation of the Sea, Oceanic Center of Pacific) with different penaeid species including Penaeus
monodon, Litopenaeus vannamei. Later, Prof. Yoram from Israel, contributed immensely for the further
modification and promotion of this encouraging technology. The technique developed in Israel
subsequently spread to many other countries due to its several advantages.

Microbial community and their management

At elevated C:N ratio, bacterial bio-floc recycles nitrogen to keep TAN below safe level (1ppm)
enabling shrimps to be stress free in pond ecosystem. Based on the contributing microorganisms, three
basic types, green, black and brown bio-floc systems have been categorized. Brown flocs are more
heterotrophic and gave better stability to pond, nutritionally better and more predictable. Also the
bacterial biomass need to be in suspension through constant aeration of 35-50 hp/ha. The number of
total bacteria in bio-floc group was significantly higher (106 to 108 cfu mL-1) than that of conventional

14
system. The “natural probiotic” effect in bio-floc could act internally and/or externally against, Vibrio
sp. and ectoparasites. While Jang (2013) recorded 351-773 operational taxonomic units (essentially
equivalent to “species”) in water from bio-floc systems many as thousand which could be there in such
a conglomeration and proper environment and management strategy should be there to optimise the
system.

Advantages of bio-floc based aquaculture technology

• Biosecurity of the system can be maintained with Zero/minimal water exchangesystem

• Heterotrophic bacteria can reduce toxic metabolites (NH3 -NNO2--N)

• Easier management and environmental friendly approach (reduced protein requirement, fish meal
usage and water/nutrient discharge), diurnal changes (pH, O2, CO2) in pond water isreduced

• Doubling the protein utilization as the shrimp use proteins twice - eat feed and then harvest flocs.
Enhance digestion (with enzymes and growth promoters)
• Probiotic action - more diverse aerobic gut flora reducing pathogenic bacteria (Vibrios).

• Role in immune response by stimulating humoral and cellularimmunity

• Reduced costs (15-20% lower cost of production) including 30-50% cost savings infeed

• Augmentation of natural food and improvement of FCR

• Reduced sensitivity to lightfluctuation

• Major advantage of growing shrimp in biofloc will not require of multiple external filtration. It
reduces the start up operational expenses.

Limitations
• To sustain the bio-floc, high stocking density-biomass of shrimp is required.
• Since oxygen is very critical, aeration and energy cost increases
• Involved more technicality and understanding of the system

• Start up time period required

• Limited progress due to lack of proper technical and infrastructural facilities and restrictions

Bio-floc based integrated nursery and grow-out system

Nursery rearing of penaeid shrimps enhances the growth and survival of shrimps in grow out
systems. BFT has been applied successfully in nursery phase in different shrimp species such as L.
vannamei, P. monodon, and F. setiferus. Bio-floc and periphyton based nursery systems results in
increases of 30 to 50% in weight and almost 60-80% in final biomass in shrimp at early post larval stage
when compared to conventional clear-water system. Other advantages include better health and
increased immunity through the continuous consumption of bio-floc which in turn positively influence
grow-out performance. In a trial in India, the weight of the shrimp postlarvae/juveniles were enhanced
from 15 to 250mg with rearing densities above10,000/m3 of water showing better performance in bio-
15
floc system for P. monodon and F. indicus. Nursery rearing under bio-floc system gives better result in
terms of performance (growth and survival) and protective response.

Fig. 2a. Biofloc image taken under phase contrast microscope (4X). Fig 2b. Nursery reared shrimp

Recirculating shrimp nursery systems with the use of bio-floc shows promising results and reduces
the size and cost of the filtration system. It is also reported that the bio-floc also can reduce the costs for
standard starter feed up to 50% without compromising the growth, health and survival of the animals.
The bio-floc based nursery can improve the optimization of farm facility with high stocking density in
nursery phase along with ensuring the successful cross over from early mortalities. Several studies
indicates that bio-floc with periphyton systems (BPT) increased growth, survival and protective response
further while also contributing to more favorable water quality.

Similar advantage in bio-floc based grow-out systems has also been reported by many studies. As
20-30 % of the shrimp feeding is taken care by the floc particles, there is a potential gain in FCR. The
selective breeding program for Pacific white shrimp, L. vannamei, involving the super-intensive shrimp
culture with bio-floc has been conducted at Oceanic Institute in Waimanalo, Hawaii, USA, since 1997.
These trials are conducted in a 75-m3 super-intensive BFT raceway stocked at 300-400 shrimp/ m3 in
Oceanic Institute’s Nucleus Breeding Center. In an experimental microbial floc culture system, shrimp
given feed with less than 25% crude protein performed similarly to shrimp raised under regular intensive
culture with a 37%-protein diet.

Reproductive performance under Bio-floc

As closed-life cycle broodstock shrimp and captive breeding with genetic improvement program
become priority. Biofloc model with its integral biosecurity can be successfully adopted as it also assures
stabilized waterquality parameters in indoor facilities and healthy shrimps. Improved spawning
performance of L.stylirostris and F. duorarum shrimps is reported in BFTsystems. The high protein-lipid
rich nutrients in bio-floc, including fatty acids, vitamins, phospholipids could be utilized continuously
and there by help in building reserve energy, broodstocks gonads formation and superior reproductive
performance.

16
Bio-floc and Periphyton based research and development
Considering the feed composition, immune effects, shrimp growth rates and other properties,
development of target oriented bio-flocs are being widely practiced in academic institutions as well as
by commercial companies. The regular addition of carbon to the water is known to select for
polyhydroxyalkanoates (PHA) accumulating bacteria which produce several biodegradable polymer
storage products, like poly-ß-hydroxybutyrate (PHB). The cell wall components of these beneficial
microbes have potential immunomodulatory properties. Studies in the similar line also revealed an up-
regulation of immune genes with exposure to bio-floc implying immunomodulation in the shrimp.
In India institutes like CIBA and TNFU have recognized the potential of this technology and its
environmental benefits (which otherwise proved a major impediment in nutrient dense production
system) and projects are going on to further standardizing a set pattern; so that the farmers can adopt
this in nursery and grow-out production practices. Among the various studies reported worldwide, a
higher production of 20 to 50 tons per ha was obtained with this technology. In India, also a production
of 16-18 tons of P. monodon and 30-45 tonnes of L. vannamei has been reported using the biofloc
technique where carbon addition was practiced with very high aeration rate. Hi tide sea farm at
Tamilnadu have pioneered the bio-floc and periphyton based farming in India. Similarly, in few
entrepreneurial farmers in Andhra Pradesh are getting into the BFT system of shrimp farming. While
there are instances of very healthy harvest, certain experience of failure have also been recorded which
needs further investigation and standardization. Even in low input based farming systems, addition of
molasses or other yeast derivatives is being added by farmers to have good bacterial population and
stable plankton bloom.

In our experimental trial at ICAR-CIBA, application of bifloc technology in white shrimp F. indicus
and pacific white shrimps by modulating the C:N ratio and at different protein levels have shown better
performance in terms of growth and survival of shrimp. Further, there was substantial gain in the
production as well as FCR in tiger shrimp P. monodon farming by following these eco-based periphyton
techniques. At ICAR-CIBA we have successfully demonstrated the bio-floc and periphyton based
nursery technology for shrimp culture in nursery tank system, where a very high survival of 98-99%
was achieved compared to the conventional system (91-92%).

Biofloc improves production performance

Through adoption of biofloc based system, total biomass can be escalated up to 41% when biofloc
concentration was managed through the use of external settling chambers compared to conventional
farming. Also, the yield can be further increased if RAS systems are incorporated with floc systems.
Recently our protein sparing experiment, a production level of 4 to 4.5 kg/cu. m (40 to 45 tones per ha)
was achieved through this BPT system compared to 2.5 to 3kg/cum in conventional autotrophic system
(Panigrahi et. al,2014).

17
 Fig 3: (A) Bio-floc cones (B) Shrimps harvested in BPT (C) Periphyton study
Bioflocs on in situ bioremediation
As it is well documented that amount of organic matter, nitrogen, and phosphorous discharged in
the effluents range from 500 to 1625 kg, 26 to 117 kg, and 13 to 38 kg, respectively, for each ton of
shrimp harvest, bioremediation through microbial floc can play a pivot role in maintain environmental
sustainability.

Biofloc as Immunomodulation and disease control

• Biofloc have the potential to provide shrimp with pattern recognition and other molecules that lead
to stimulation of the non-specific immune system.
• As microbial community develops, a density in the order of 107 colonies forming units/ml−1.
Beneficial micro-floras enveloped in the system helps to prevent colonization of pathogenic bacteria
and improve animal health through the induction of the immunesystem.

• Since Biofloc technology (BFT) systems developed to minimize effluent discharge, the system
protects the surrounding water resources and improves farm biosecurity. Continuous aeration in the
system avoiding stratifications, releases anoxic gases and the stable water creates better stress-free
environment.

• Diverse beneficial bacterial community in the biofloc can stimulate the non-specific immunity and
limit establishment of pathogenic strains.
• The settled solids and suspended solid waste in this system are recognized and are removed from
the biofloc system through central drain system or sludge removal prevents the risk of disease from
the sludge.

• Priming of immune system of the host helps in immunomodulation and disease resistance in
the animals reared in this system. Gene expression measured in mysis, post larvae and adult of L.
vannamei was found to be enhanced in the presence of biofloc. Our studies suggest that microbes
associated with bioflocs may enhance expression of certain immune-related genes.

18
Bio-flocs as biocontrol measure
• Bio-flocs can act as a natural probiotic which could act internally and/or externally against, Vibrio sp.
and ectoparasites.
• Regular additions of carbon stimulate polyhydroxyalkanoates (PHA) accumulating bacteria that
produce several biodegradable polymers like poly-ß-hydroxybutyrate (PHB) with biocontrol
properties.

• Beneficial bacterial communities in biofloc system controls the pathogenic Vibrio population
regulates the expression of virulence factor (Quorum sensing) and results in better growth and
survival rate attributed to up regulation of immune relatedgenes.

Biofloc as feed for aquaculture species

The nutritional quality of biofloc to cultured animals is good but rather variable. The dry-weight
protein content of biofloc ranges from 20 to 50 percent, with most estimates between 25 and 45 percent.
Fat content ranges from 0.5 to 15 percent, with most estimates between 1 and 5 percent. Being a rich
source of essential nutrients like aminoacids, fatty acids, vitamins biofloc forms an ideal feed ingredient
or dietary supplements. Studies reveals that externally produced biofloc can be used as a fishmeal
replacement purpose.

Researchable issues and challenges

• Customized biofloc preparations (with inoculums of defined probiotics and algae), modulating the
bio-floc yield by C: N ratio manipulation and their evaluation for host performance is a matter of
further research.

• Molecular and biochemical characterization of microorganisms (quorum sensing), constituent of

biofloc including heterotrophic-autotrophic organism through community approach

• Improvement of floc nutritional value (i.e. using different carbon sources or a mixture of
phytoplankton and bacteria) needs further investigations

• Influence of bio-flocs (poly-beta-hydroxybutyrate, Short Chain Fatty Acid –SCFA like constituents)
on the protective response in host using immunological and functional genomics-based approaches.
Immune response of host by looking at humoral, cellular and immune gene expression at molecular
levels when treated after bio-floc/probiotic treatment.
• Exploring the potential antagonistic properties (through in vitro and in vivo studies), Efficacy of
bioflocs to influence viral and bacterial load and its clearance ability should be looked into through
pathogenic vibrio (immersion or oral) or WSSV challenge studies.

• Elucidating the mode of action of the microbial interventions through bioremedial and ecological
approach.

• Evaluating biofloc and/or periphyton based system for advantage. Standardization of the protocol to
generate biofloc through manipulation of C: N ratio and inoculums.
19
 • Nutritional characterization of different types of bio-floc and optimization of their inclusion in feeds.
Scaling up for bio-floc and mass scale production for further application as feed ingredient.

Strategy to mitigate the challenges

• Development of biofloc within various aquaculture practices–semi-intensive/super-intensive/RAS.

• Focusing more on a semi-floc mode of production system to suite Indian farmers.

• Mechanism to control the unregulated growth of biofloc in the existing pond systems and evaluating
biofloc and/or periphyton based waste for utilisation as feed ingredient.
• Extending the BFT/ BPT research outputs on other penaeid species for better understanding, since
endogenous species show greater adaptation to local conditions and may be used in restocking
programs or cultured in their natural environment.

• Promoting the BFT/BPT based nursery rearing to overcome the disease problem at early stages.
• Working towards shift in policy for these environment friendly technologies with modifications in
stocking density or biomass limit and restrictions on use of molasses as carbon source.
• Encouragement of this ecologically sustainable symbiotic system through demonstration and capital
subsidy and road map for the development should be prepared.

Conclusion
BFT like eco-based technologies will enable aquaculture practices towards an environmental
friendly approach. With the appearance of emerging disease problems and escalating costs for energy,
Biofloc technology can be an innovative strategy for disease prevention and control in contrast tousual
tactics such as antibiotic, antifungal, probiotic and prebiotic application. bio-floc technology with
biosecure modular systems may be an answer for more efficient, sustainable, profitable aquaculture
production. This technology have the obvious advantage of minimizing water requirement, recycling in
situ nutrients and organic matter and in turn improving farm biosecurity by exclusion of pathogens,
augmentation of natural food and improvement of FCR, providing stress-free environment. Use of
chemicals and other medicines could easily be avoided thereby having negligible environmental impact.
Availability of natural food in the form of microbialbio-floc compensate for higher protein requirement
of aquatic species. Biofloc technologies have potential to revolutionise the aquaculture sector. However,
this is still in an initial stage and lots of research is necessary for its modification, standardization and
implementation.

Reference
Anand, P. S., Sujeet Kumar., Panigrahi, A., Ghoshal, T. K., Syama Dayal, J., Biswas, G., Sundaray, J. K.,
De, D., Ananda Raja, R., Deo, A. D.,. Pillai S. M., Ravichandran, P. 2013. Effects of C: N ratio and
substrate integration on periphyton biomass, microbial dynamics and growth of juveniles.
Aquaculture International,21:511–524.
Avnimelech,Y.2007.Feeding with microbial flocs by tilapia in minimal discharge bio-flocs technology
20
 ponds. Aquaculture264:140–147.

Crab, R., Avnimelech, Y., Defoirdt, T., Bossier, P., Verstraete, W. 2007.Nitrogen removal in aquaculture
towards sustainable nitrogen in aquaculture systems. Aquaculture, 257: 346–358.

Emerenciano, M., Cuzon, G., Goguenheim, J., Gaxiola, G., Aquacop. 2011. Floc contribution on
spawning performance of blue shrimp Litopenaeus stylirostris. Aquac Res. 44: 75–85.

Ghanekar, A. 2009. How biofloc technology reduces feed and filtration costs in recirculated shrimp
nursery systems. Aqua Culture Asia Pacific. 5:10-11.

Hargreaves, J.A. 2006. Photosynthetic suspended-growth systems in aquaculture. Aquaculture

Engineering 34: 344–363.

Nunes, A.J.P., Castro, L.F., Sabry-Neto, H. 2010. Microbial flocs spare protein in white shrimp diets.
Global Advocate 10:28-30.

Panigrahi, A., Azad, I. S. 2007. Microbial intervention for better fish health in aquaculture: the Indian
scenario. Fish Physiology and Biochemistry.33:429-440.
Panigrahi A., Sundaram, M., Ravichandran, P., Gopal, C.2014.Microbial soup-Eco based approach for
shrimp culture and management. ENVIS Newsletter.12:3-6.

Ray, A.J., Seaborn, G., Leffler, J.W., Wilde, S.B., Lawson, A., Browdy, C.L. 2010. Characterization of
microbial communities in minimal-exchange, intensive aquaculture systems and the effects of
suspended solids management. Aquaculture310:130–138.
Samocha, T.M., Patnaik, S., Speed, M., Ali, A.M., Burger, J.M., Almeida, R.V., Ayub, Z., H ar i s an t o,
M.,Horowitz, A., Brock,D.L.2007.Use of molasses as carbon source in limited discharge nursery
and grow-out systems for Litopenaeus vannamei. Aquac Eng36:184–191.

Samocha, T.M., Xu, W. 2013. The effect of two commercial feeds and different C:N ratios on selected
water quality indicators and performance of Litopenaeus vannamei juveniles cultured at high
density in a bio-floc-dominated zero exchange outdoor tank system. Aquaculture. 2013.
SujeetKumar, Shyne Anand,P.S.,De,D.,Sundaray,J.K., AnandaRaja, R., Biswas,G.,Ghoshal,T.K.,
Deo,A.D.,Panigrahi,A.,Muralidhar,M.2013.Effects of carbohydrate supplementation on water
quality, microbial dynamics and growth performance of giant tiger prawn (Penaeus monodon).
Aquaculture International. 22:901–912.

Xu, W., Pan, L. 2012.Effects of bio-flocs on growth performance, digestive enzyme activity and body
composition of juvenile Litopenaeus vannamei in zero-water exchange tanks manipulating C/N
ratio in feed. Aquaculture.356–357:147–152

21
 BIOFLOC TECHNOLOGY: STANDARD OPERATING
PROCEDURE
A. Panigrahi, Saranya C, Kumaran M and Rashmiranjan Das

Email: [email protected]

The aquaculture industry in the world is gaining momentum and is displaying a steady growth in
the past two decades. Aquaculture is considered a dynamic food-producing sector, which produce high
value protein. Fish is a sough after protein source for not only humans but also for animals, due to its
high nutritive composition compared to other protein sources. Above all this features of aquaculture, it
was always in the debate regarding sustainability and environmental pollution. In any given aquaculture
venture 50% of the cost incurs towards the use of feed. The dependence of aquaculture feed production
on the fishmeal is a hot topic in the industry. The search for closed aquaculture system with the concept
of recycling sprouts from this thought. These thoughts have resulted in thinking out of the box and
producing commercially viable technologies like biofloc and circulatory aquaculture system.
Harboring biofloc in shrimp culture systems to recycle organic and inorganic nutrients by utilizing
the services of microalgae and bacteria and providing biofloc itself as a natural feed for the shrimps is a
novel concept that is eco-friendly, cost-effective and has considerable potential for further intensification
by increasing the shrimp stocking density in a unit area provided. Biofloc based shrimp farming has a
great opportunity to fine tune for better production. Biofloc technology can be further improved by better
biosecurity, fine-tuning the stocking density, physical, management of water quality. Feed management
and carbon addition strategies are the major two corner stones in biofloc technology and this aspect
should be handled with at most care for maximizing the profit. In this article, the biofloc based culture
system is discussed for adoption of better shrimp culture practices.

Pond design and construction for biofloc based culture

HDPE lined pond with well-prepared dyke is preferred for the biofloc based shrimp farming. In
low-lying areas near the creek the elevation of the pond should be higher than the high tide line to avoid
water accumulating under the pond lining. HDPE lined ponds with sufficient elevation and central
drainage can be used for effective biofloc based farming. Central drainage system is a must and it helps
in the removal of sludge periodically. However, earthen ponds also have their merits as far as interaction
with soil phase and effective nutrient release is concerned. Biofloc based system can also be developed
in the earthen ponds, but the control over the water quality parameters will be minimal due to soil water
interaction.
Bio-floc technology can be conveniently applied in recirculatory aquaculture systems or raceway
systems either with in situ inclusion or ex situ floc production through activated sludge system and
putting the harvested bio-flocs in the production system. The system can be adequately agitated and
aerated to keep the microbial floc in suspension.

22
 Fig. 1: Schematic diagram of principle and methodology of biofloc technology

Fig. 2a: Schematic diagram of central drainage system

for removal of sludge in the shrimp culture pond
Fig. 2b: substrate for periphyon
development in pond

Appropriate animal model and stocking density

BFT technology has been adapted with Tilapia production in aquaculture, which is suitable for
high-density culture of species like P.vannamei which are effective at utilizing natural productivity in
the biofloc based culture system. Other penaeid shrimp species like P. monodon, P. stylirostris and
Macrobrachium sp. may not be suitable for the purpose, at high density. Generally, in BFT technology
the nursery and grow-out culture of shrimp are segregated. In nursery trial, post larvae with stocking
density 5000 to 10000 PLs/m3 and in grow-out culture a stocking density to achieve 10-30 mt / ha shrimp
or 1-400 mt/ha fish can be supported. Again, higher stocking under Biofloc was found to reduce protein
requirement substantially, although still expecting the same growth pattern and better survival to a
considerable extent. In contrast, there are reports where biofloc system can be operated with as minimum
23
as 6 nos/m 2, aiming a higher growth.

Feeding strategies and requirement of feed protein regime in BFT system

Based on the observation of feeding behavior of fish/shrimp in the BFT treatments during the first
several days and rationed at 3-1.5% of the total standing biomass daily, feeding rates are to be adjusted
depending on the daily consumption and sampling. Daily feed rations are to be split into two to five
times to be given at adjusted intervals. Moreover, higher growth was observed when protein levels in
the BFT based shrimp culture system were reduced as optimum C:N ratio converts/regenerate microbial
flocs/protein (Avnimelech, 1999).
In the BFT system, feed quantity must been reduced in the culture system and feed cost can
substantially be reduced by decreasing the protein level in feed. In the case of L. vannamei, the growth
and survival is reported to be equal or better at 20-30% protein (7% lipid) than 40 % in commercial
closed pond systems due to enhanced nutrition on flocs and reduced N-wastes. The guiding standard is
that around 95% of N added to pond is from feed/fertilizers and more than 50% of N in feed is released
into the environment. One should lower protein content to achieve good C: N ratio and reduce production
of N-waste. At <25% feed protein, heterotrophic removal of TAN starts to dominate over autotrophic.

Biofloc generation in the culture system

Biofloc generation is an important phenomenon for shrimp/fish culture in BFT system before or
after stocking. There are different approaches to prepare the system for biofloc based shrimp farming
depending on the design and compatibility of the system, the species to be cultured, intensity of farming
and the buffering time for biofloc generation. Further, the system can operate with complete biofloc or
semi biofloc mode with or without integrating substrates for periphyton growth.

Ponds are prepared following the Standard Operating Procedures (SOP) like drying, ploughing
refilling the ponds with aged soil (minimum for 4-5 days) and disinfected water properly sieved through
a 60-100μ screen and also adhering to all biosecurity protocols. Autotrophic bloom is developed by
fertilizing with nitrogen and phosphorous fertilizers and/or in combination with any other biofertilisers.
The pH is maintained by liming with dolomite or hydrated lime. In the beginning, nitrogen level is built
up using feed or any organic substance.
Subsequently, CHO source like molasses is applied, depending on the feed quantity (while
calculating the CHO requirements, the feed CHO content should be taken into account) and the TAN
level so that a high C: N ratio (15:1) can be maintained to stimulate the flocs. Typically, ponds start
getting dominated by autotrophic algae and after a few days, the water turns brown and foamy as floc
develops and the system becomes heterotrophic without much algae. Ammonia levels rises to a peak
and thereafter falls, following the rise of nitrite which stabilizes after sometime and can be controlled by
adding more C. Transition from algae to bacteria can be stimulated by adding molasses every 1-3 days
interval for 2-3 weeks.
Once heterotrophic population establishes, the molasses or other carbohydrate additives can be
regulated to keep high C:N ratio based on the TAN level and the feed quantity. There can be a
modification in the process if the purpose is to generate biofloc in a shorter duration. If the nursery
24
reared juveniles are stocked, feed quantity is high enough to quick-start the bioflocs with addition of a
considerable amount of carbohydrates.
To hasten the process, biofloc inoculum from other ponds or its preserved form can also be applied.
However, care should be taken before using any commercial inoculum for this purpose. Heavy aeration
is required for keeping the floc under suspension. Pond liner allows easier maintenance of floc in
suspension avoiding dead spots and stops accumulation of inorganic material from pond banks/walls
caused by excessive water circulation.

i) Natural transition approach

In natural approach we generate autotrophs through addition of fertilizers, feed and other ingredients.
These autotrophs have to be converted into heterotrophs by addition of carbon sources and control of C:
N ratio maintenance. We can observe the colour transition from green to brown with floc build-up. This
method takes a long time process that means 7 to 10 days for conversion of autotrophs to heterotrophic
system.

Fig.3: Schematic diagram of various methods to generate biofloc based shrimp culture practices Bio-
floc generation may be classified based on the process of making the biofloc with additives in the
culture system.

ii) Inoculum approach

Inoculum approach is based on three aspects i.e. (a) Inoculate the biofloc based culture water of the
previous successful crop after checking its suitability in terms of water quality and nutrients. (b)
fermented products of carbon sources (molasses, rice bran, wheat flour etc.,) and yeast to be aerated
with source water from 24-48 h and adding the fermented products for biofloc generation (c) cultured
biofloc mass produced and dried (fermentation and freeze drier may be employed) to get the powder
form. These powders are dissolved and fermented with carbon sources to be added in the form of
fermented products. In this approach, biofloc can be generated in a very short duration.

iii) Customization approach

Probiotics are promoted as an alternative health management tools in many fields including in
shrimp hatcheries. These natural beneficial bacteria are now well accepted and widely used in fish/shrimp
aquaculture practice. Antibiotics not only develop resistant strains creating health hazards, but also are
25
proved to induce immune-suppression. As designated by WHO, antibiotic resistance is a growing public
health concern. Different microorganisms (probiotic or microalgae) have been shown to be capable of
inducing better production performance and protective response by modulating the immune system in
several ways. These probiotics were widely used in culture practices of P. vannamei and these strains
present in biofloc can be blended in right combinations to get best flocs. Through domestication, the floc
can be prepared to contain naturally occurring bacteria that are capable of producing high concentration
of enzymes, omega-3 fatty acids having the ability to degrade organic matter and reduce hydrogen
sulfide, ammonia, nitrite, and nitrate accumulations. Probionts like lactic acid bacteria Vibrionacea,
Pseudomonads and Bacillus are found to give protection to turbot, salmon, cod, shrimp and oysters. The
mode of action of probiotics includes the production of inhibitory compounds, competition for chemicals
or available energy, competition for adhesion sites, inhibition of virulence gene expression or disruption
of quorum sensing, enhancing the immune response, source of macro and/or micronutrients and
enzymatic contribution to digestion. Bioremediation involves organic matter mineralization to carbon
dioxide, maximizing primary productivity that stimulates shrimp production. Nitrification and
denitrification eliminate excess nitrogen from ponds and maintain a diverse and stable pond community
by excluding the pathogens from the system by desirable species.

Carbohydrate addition
CHOs are added to promote heterotrophic bacteria (HB) as these bacteria use organic C as energy
source and utilize N for their growth. Simple sugars like sucrose and molasses induce the floc to grow
faster, however they require frequent additions. In contrast, complex starches i.e. corn, cassava, tapioca,
wheat and cellulose are more stable but slow to react and can also act as bacterial substrates and contain
suites of enzymes useful for digestion once ingested by shrimp. The lower the feed protein level, the
less CHO required. In another study using tilapia farm effluent, it was determined that 1 kg of microbial
floc could be produced for every 1.49 kg of sucrose. In minimal/zero exchange intensive systems, excess
nutrients are assimilated and mineralized by a dense microbial community in the water column, thus
alleviating potential toxicity. (please refer the end of the chapter for C:N ratio calculation)

Management and control mechanism

Floc management is basically done keeping in mind the needs of the bacteria and not the shrimp as
at times total bacterial biomass is 2-5 times than that of the shrimp. Floc volumes typically measure 2-
4 ml/L first 1-2 months, then 6-20 ml/L later. Total soluble solids should be managed to be less than 300
ppm to reduce aeration requirements. With carbon addition, TAN can be limited at 0.5-1 ppm. The pH
should be controlled by addition of lime /dolomite/bicarbonate and better alkalinity should be
maintained. Controlling the unregulated growth of biofloc in the pond system is required to avoid a
number of critical problems like declining oxygen level and increase in sludge. Hence, proper handling
of carbon addition and feeding quantity and schedule as per the standing biomass is required for having
a control over biofloc generation.

26
 Fig. 4: Schematic diagram of carbon requirements for biofloc based shrimp culture system
Environmental requirements for BFT
BFT works under zero water exchange too, which also makes the system more biosecure. In floc
system, ammonia is consumed by bacteria and nitrite increases, with tolerance upto a higher level. There
is a need to correct the declining alkalinity which must be maintained >75-150 ppm. Another important
requirement in the bio-floc system is to meet the high oxygen demand. There will be also need to suspend
the aerator of aspirator type at the sludge pile. Typical aeration requirements are 1 HP/350- 400 kg shrimp
biomass. The biofloc system requires high aeration/mixing with aerators and blowers not only to provide
DO and remove CO2 but also to keep biofloc in suspension and prevent production of nitrogenous
metabolites, sulphides and organic acids.

Water Quality Management

During the culture period, the water chemistry in the system should be monitored and maintained.
Mainly few water quality parameters should be monitored on daily basis other should be monitored
periodically like every 3 days once. Dissolved Oxygen, pH, Temperature, turbidity can be monitored
twice a day, NH3, NO3, NO2 and TAN can be monitored on daily basis .Algal community, alkalinity,
hardness salinity can be seen once a week. Floc volume should be maintained at 12-20 ml/L should be
maintained. Total heterotrophic count can be monitored on every 3 days once. The levels of water quality
parameters should be kept -in optimal condition for retaining the shrimp’s health. All the physico-
chemical parameter should be maintained at optimal level for better production of shrimp.

Biosecurity
Quality of Seed: Whether quality of seed is been checked from the vendor on screening of disease and
SPF stock availability
27
Quality of incoming water: This is a more or less controllable variable depending on the rearing system
that is applied. The water must then be sampled periodically. This is a key parameter that needs to be
monitored and assessed on an ongoing basis.

Disinfection vehicle accessing the farming area: is common that the vehicles entering a farm to
circulate in between several fish farms as they are likely to be veterinarians, feed manufacturers, fish
transporter.
Disinfection of equipment’s handled in the pond: Precautionary measures related to pathogens must
be applied to all production units - ponds, cages, ponds or aquarium - within each farm. Therefore, the
transfers of equipment from pond to pond must be spaced out as much as possible, especially when it
comes to the transfers of nets, which are the most likely tools to be directly in contact with animals.
Employee hygiene: farm workers must regularly wash their hands; this rule especially applies to those
who manipulate animals through, sorting, feeding, etc. Hydro-alcoholic solutions have proved efficient.
In addition, all employees must have their shoes thoroughly decontaminated. In this respect, placing
footbaths and brushes at the entrance of each livestock compartment can help limit the spread of
pathogens. Keeping a regularly updated register of visits also constitutes an important component of the
protection process.
Fencing: Bird fencing and crab fencing must be covering the complete pond for restricting the activity
of them.

Conclusion
Standard operation procedures must been followed for sustainable and equally eco-friendly/ biofloc
based shrimp culture systems. Not only do they enhance the production, cost effectiveness and
prevalence of the disease occurrence is reduced in the vast aquatic environment. Major benefit accrues
in the reduced feed cost of the farmers and increased profit through this technology. Toxic nitrogen
metabolites have been prohibited and lead to better management practices of shrimp culture.

References
Avnimelech, Y., 1999. C/N ratio as a control element in aquaculture systems. Aquaculture 176, 227–235.
Avnimelech Y (2007) Feeding with microbial flocs by tilapia in minimal discharge bioflocs technology
ponds. Aquaculture 264:140–147.

Crab, R., Avnimelech, Y., Defoirdt, T., Bossier, P., Verstraete, W., 2007. Nitrogen removal techniques in
aquaculture for a sustainable production. Aquaculture 270, 1–14.

Samocha T. M., Patnaik S., M., Ali A. M., Burger J. M., Almeida R.V., AyubZ., HarisantoM.,
HorowitzA. & BrockD.L. (2007) Use of molasses as carbon source in limited discharge nursery
and grow-out systems for Litopenaeus vannamei. Aquacultural Engineering36, 184–191

28
 C:N Ratio Dynamics in BFT System and Calculation for its Maintenance

Carbon/ Nitrogen (C/N) ratio in aquaculture production especially biofloc production systems
having noteworthy effect of shrimp health and survival. Maintaining proper C/N, would be an important
factor followed reducing the ammonia level and this provided a origin for improving development of
biofloc aquaculture systems. The maintenance of C/N ratio attributed in two steps: (i) initial
development phase, which utilizes a C/N ratio of 12–20:1, and (ii) maintenance phase, utilizing a C/N
of 6:1, according to the total ammonianitrogen values.

Usually enough amount of nitrogen will be available in normal pond system for the growth of
heterotrophic bacterial and this can be included mainly by feed. But in Zerowater exchange system like
biofloc system specifically added with more carbohydrate material mainly having more carbon and less
nitrogen. The carbohydrate materials mainly used in worldwide in molasses and apart from this plant
based flours, by products like rice bran, wheat bran also now popularly used and it creates the need of
nitrogen. Normally in biofloc system C/N ratio maintained above 10:1 ratio level and it pave the way to
grow heterotrophic bacterial population.
These bacterial populations take nitrogen for their growth and control the water quality by reducing
the ammonia level. Because microorganisms to develop new cells and also for their metabolic activity
requires nitrogen and it can be taken up by decomposing organic residues found in biolfloc system and
It was estimated that 100 grams of organic residue results in 3 to 8 grams of bacterial biomass. Bacteria
and other heterotrophic microorganisms have short live spans and divided continuously so that they
contribute to the organic matter pool when they die. Microbial biomass has a low C/N ratio and
decomposes easily.

Chemical fertilizers containing nitrogen often are applied in aquaculture ponds offers a quick source
of nitrogen to increase the rate of organic decomposition and resulting mineralization of phosphorus to
stimulate primary productivity. Another one source is feed and it has narrow C/N ratios (7:1 to 10:1). It
was recommended that maintaining higher C/N ratios of 12:1 to 15:1 results in better production in
biofloc system, leads to ammonia nitrogen immobilization. Shrimp feed having the crude protein level
of 35% and if 6.25 as conversion factor then percentage of nitrogen in feed is more than 5.6%. To
balance the nitrogen level external addition of carbon source in pond, in form of sugar, molasses or
jaggery which will be utilized along with nitrogen by microorganisms for various metabolic pathways
and cell biomass generation. Simply it can be described as the bacteria and other microorganisms will
utilize available nitrogen if carbon and oxygen are available to form cell biomass and also for various
metabolic pathways.

Before starting the external carbon sources could be fermented with suitable probiotic bacterium
will be more helpful to make this method very effective. Fermentation of this carbon sources in sterile
seawater for 12-48h with proper aeration makes slurry and after fermentation it could be filtered and
applied directly to the tanks. This will increase the count of probiotic bacteria and lowers the chance
for Vibrio population. Higher density of probiotic applied with proper fermented carbon sources
increases the higher rate of waste degradation and enables the clean and healthy pond bottom and water.

29
Dominated increase of good bacteria and planktons gives natural feed for cultured shrimp and reduce
the chance for disease.

How to manipulate the C: N ratio?

Before we go into the calculation things to consider is amount of feed used, carbon content of the
carbon used to be used, nitrogen amount in feed.

Carbon % in feed

Amount of feed applied = 1000 gm

Dry matter of the feed = 90 % dry matter and 10 % moisture

Protein percentage in the feed = 35 % protein feed (meaning 350gm of protein in
1000gm of feed)
Total dry matter in the feed = 1kg feed X feed dry matter percentage= 1000x 90%=
900gm
Total uneaten feed by the shrimp is 70%, if so = Total dry matter x % feed unutilized= 900x
70% = 630gm
Total % of carbon in the feed is 50 %, if so, = 630 x 50 % = 315 gm C

C=315

Nitrogen % in feed:

Dry matter of the feed = 90 % dry matter and 10 % moisture

Total uneaten feed by the shrimp is 70%, if so, = Total dry matter x % feed unutilized= 900x
70%= 630gm
= 630 x 35 % protein in feed = 220.5g protein = 33.075

N= 33.075
C/N = 315/33.07= 9.525

C:N = 9.525:1
To make upto 15: 1

33.07 x 15 = 496.05gm carbon source required and feed containing % carbon is 315gm

= Required carbon source - Feed containing carbon source

= 496.05-315= 181.05gm
Finally to make up to 15:1 ratio the carbon source should be added as 181.05gm/kg of feed.

30
 This amount is calculated as per the content of carbon present in various carbon sources

Table : 1 List of commonly used carbon source and their % carbon content.

Carbon source Percentage of Carbon content Reference

(Approx.)
Molasses 28% Sujeet Kumar et al., 2017
Sugar 40 % Serra et al., 2015
Dextrose 40.89% Serra et al., 2015
Rice flour 40% Sujeet kumar et al., 2017
Rice bran 43% Romano et al., 2018
Tapioca 46% Silva et al., 2017
Jaggaery 28.8% Sakkaravarthi et al., 2015

Example, if we are using molasses as carbon source,

=181.05/28x 100 = 646.6gm of molasses is required to maintain C:N ratio 15:1 for 1kg of feed
with 35 % protein content.
=181.05/40x 100 = 452.6g of sugar is required to maintain C:N ratio 15:1 for 1kg of feed with 35
% protein content.

C: N Ratio from different percentage protein feed

(Biofloc Technology: Practical guide. Avnimelech, 2009)

Table: 2 Different percentage protein feed and their C:N ratio

Protein Content % C/N ratio

15 21.5
20 16.1
25 12.9
30 10.8
35 9.2
40 8.1

C: N ratio calculation based on the TAN level in the ongoing culture

Initially the carbon source applied based on the amount of feed and the protein percentage of the
feed applied, later during the culture period, as the floc level increase and available nitrogen source
increases due to unutilized feed, excretion etc., and the carbon addition should be based on the TAN
level in the culture system. As per the previous reports on C:N ratio, if the TAN level goes beyond
1mg/L, the carbon source addition is recommended with C:N ratio of 6:1

Example
If we have 1.5mg/L TAN was measured in 15000L tank (carbon sourced used rice flour 40%
carbon content)
31
= 0.0015x 15000

= 22.5gm of TAN
If we want to maintain the C: N ratio with 6:1

= 6 x 22.5 = 135g of carbon are required.

= 337.5gm of rice flour will be required

32
 INTEGRATION OF SUBMERGED SUBSTRATES IN BIOFLOC
BASED SYSTEM
P. S. Shyne Anand and Sujeet Kumar

Though shrimp feed forms more than 40–60 % of the total operational cost, major part of the feed
remains either unused or excreted as toxic nitrogen metabolites in shrimp ponds, which generally leads to
nutrient rich effluents at the end of harvesting. Optimum harvest of these nutrients and its conversion in
to protein rich biomass becomes a major area of interest while exhorting for zerowater water exchange
systems. As we know biofloc based systems utilizes the total ammonia nitrogen generated in the system
for formation of protein rich flocculated microbial biomass in elevated C: N ratio which form an additional
quality feed to shrimps. Many times if amount of floc generated exceed the shrimp consumption it can
lead to high turbidity in water column and deposition of particles which demand pumping out the
generated flocs. Incorporation of submerged substrates in biofloc system results in the development of
microalgal complex over the submerged substrates known as “periphyton” has added advantage in
enhancing aquaculture production through improved nutrients utilization and control of toxic nitrogen
metabolites. These ecofriendly techniques like periphyton based farming systems utilizes the autotrophic
food web or primary productivity as a potential food source for culture fishes whereas biofloc based
techniques depends on the generation of microbial floc or heterotrophic food web through manipulation
of C: N ratio.

Periphyton based farming are widely accepted technology in finfish culture in Asian countries for
the fishes like tilapia, Indian major carps, milkfishes and mullets. Similarly,
promising result in terms of growth performance, survival and production was
observed with periphyton in nursery and growout rearing of penaeid shrimps
like black tiger shrimps and pacific white shrimps. Recently, biofloc
technology started getting momentum in intensive minimal water exchange
shrimp farming systems where nutrient or generated waste is converted in to
quality microbial protein through external addition ion of carbohydrate or
reduction in protein content via manipulation of C: N ratio.
Though these techniques utilize autotrophic or heterotrophic food
webs, integregation of these techniques makes it standalone techniques and can enhance the productivity.
Though biofloc technology became a highly soughtafter technology among the shrimp farmers, judicious
manipulation of C: N ratio to maintain optimum biofloc becomes a major challenge. Moreover, high
microbial load in the systems demands heavy aeration and pond modification with polythene lining or
central drainage systems for periodical removal of unutilized bioflos. At this juncture, application of
immomobile submerged substrates can helps to trap the suspended microbial floc in the systems. Various
researchers found that the use of submerged substrate and C: N ratio manipulation significantly affects
the inorganic nitrogen and phosphorous in water column through uptake of inorganic N ions by bacteria
for microbial protein synthesis.

33
 As quality and quantity of periphyton developed on substrates, vary with type of ecosystem, type
of substrate and nutrient availability, manipulation of C: N ratio can increases the heterotrophic bacterial
population over submerged substrates which can be easily grazed by the shrimps than filtering from water
column. When C: N ratio increased from 10 to 20, there was about 40-90 % increases in total heterotrophic
bacterial load. Thus, heterotrophic community facilitated to
maintain water quality through formation of single-cell
bacterial protein that acted as protein source for shrimp leading
to higher growth rate at high C: N ratio.
Availability of natural food in the form of epiphytic
algae and heterotrophic microbial community compensates the
higher protein requirement of shrimp juveniles and serves as
supplementary nutrient for shrimp. In freshwater systems,
increasing C: N ratio from 10 to 20 increased the net yield of
freshwater prawn by 40 % and addition of periphyton substrates
increased net yield by 23 %. Our experimental trials revealed
that integration of submerged substrates improved 18 and 25%
improvement in final body weight in substrate integrated C: N
ratio manipulated systems compared to biofloc or periphyton
based system alone respectively. Similarly, a better Food
conversion ratio, protein effiency ratio was noticed in integrated
systems compared to either C: N ratio system or periphyton
system. Since substrates reduces the turbidity by trapping
suspended particles, their incorporation in floc system improves
t he transparency and clogging of respiratory systems of
shrimps in floc system.

Conclusion Shrimps grazing on substrate

Periphyton in combination with high C: N ratio facilitates to maintain better water quality by
reducing toxic metabolites like TAN, NO2–N and improved the FCR, growth rate and survival of the
penaeids shrimps. Substrate allows the growth of epiphytic algal community and served as natural feed
while the increase in C:N ratio converts toxic inorganic nitrogen waste into single-cell microbial protein
which increases heterotrophic bacterial load and lower inorganic nitrogen content in water. In summary,
high C: N ratio with substrate system increases the amount and quality of natural food available in the
periphyton biomass for shrimp grazing.

References
Anand P. S. S., Kumar S, Panigrahi A, Ghoshal T. K., Dayal J. S., Biswas G, Sundaray J. K., De D, Raja
R. A., Deo A. D., Pillai S. M. & Ravichandran P (2013a) Effects of C: N ratio and substrate
integration on periphyton biomass, microbial dynamics and growth of Penaeus
monodonjuveniles. Aquaculture International21, 511–524.

34
Anand P. S. S., Kohli M. P. S., Dam Roy S., Sundaray J. K., Kumar S., Sinha A., Venkateshwarlu G &
Pailan G.H, (2014a) Effect of dietary supplementation of biofloc on growth performance
and digestive enzyme activities in Penaeus monodon. Aquaculture418–419,108–115.

Asaduzzaman M, Rahman MM, Azim ME, Islam MA, Verdegem MCJ, Verreth JAJ, Wahab MA (2010).
Effects of C/N ratio and substrate addition on natural food communities in freshwater prawn
monoculture ponds. Aquaculture 305:127–136.
Avnimelech Y (1999) Carbon/nitrogen ratio as a control element in aquaculture systems. Aquaculture,
176:227–235.

35
 EMERGING DISEASES IN BRACKISHWATER
AQUACULTURE IN INDIA
S. V. Alavandi

E-mail : [email protected]
Introduction
The Indian aquaculture production has considerably improved during the last six years, especially
after the introduction of the exotic Pacific white shrimp, Litopenaeus vannamei. Availability of imported
specific pathogen free (SPF) broodstock provided the much needed boost to India’s brackishwater
aquaculture sector. Because of its SPF status, fast growth rate and culture feasibility in wide salinity
range, this got readily accepted by the farmers and has become the dominant cultured species. The
shrimp production through aquaculture touched an all-time high 435,000metrictons during 2014-2015,
contributing to export revenues to the tune of US$3.7 billion. However, the intensification of vannamei
farming has exacerbated the epizootics and disease issues are becoming a constraint, affecting
productions and profitability. Among the OIE (World Organisation for Animal Health) listed viruses of
the farmed crustaceans, the white spot syndrome virus (WSSV) and infectious hypodermal
hematopoietic necrosis virus (IHHNV) have been frequently reported from Indian subcontinent and both
these pathogens can be considered as endemic in India. Other viral pathogens such as infectious my
necrosis virus(IMNV), Taura syndrome virus (TSV), yellow head virus (YHV) which have been
responsible for causing losses to aquaculture in the Americas and the Southeast Asian countries have so
far not been reported from India. The early mortality syndrome (EMS) or acute hepatopancreatic
necrosis disease (AHPND) in the South East Asian countries has also been found to have severe
economic impact on shrimp industry of these regions. During the last couple of years, a number of
disease syndromes such as running mortality syndrome (RMS) or chronic mortality syndrome (CMS),
white faeces syndrome (WFS)/ white gut syndrome and stunted growth / growth retardation have been
negatively impacting shrimp aquaculture in India. Some of these problems associated with current
shrimp culture practice in India are discussed in this article.

Hepatopancreatic microsporidiosis
Hepatopancreatic microsporidiosis (HPM) is caused by Enterocytozoon hepatopenaei (EHP), an
yeast-like fungus belonging to a group called “microsporidia”. It was first reported in 2004 as an
unnamed microsporidian from growth retarded black tiger shrimp Penaeus monodon from Thailand.
There are no other specific signs and symptoms of EHP infection in shrimp. It was discovered in slow
growing shrimp and also from shrimp that exhibited mortality associated with white faeces syndrome.
The target organ of EHP is hepatopancreas and affects its digestive and absorptive functioning resulting
in poor growth and immunity. Although EHP does not appear to cause mortality in P. monodon and L.
vannamei, information from shrimp farmers indicates that it is associated with severe growth retardation
in P.vannamei.
EHP produces smaller spores of approximately 1 μm in length can be detected microscopically and
by polymerase chain reaction technique. Diagnosis of infection can be achieved by microscopic
36
examination of squash preparation of hepatopancreas and demonstration of the spores. Other diagnostic
methods such as histopathology, insitu hybridization, polymerase chain reaction (PCR), loop-mediated
isothermal amplification (LAMP) and real-time PCR have also been reported.

It has been found that EHP can be transmitted directly from shrimp to shrimp by cannibalism and
cohabitation. E. hepatopenaei (EHP) is confined to hepatopancreatic (HP) tubule epithelial cells of the
shrimp and shows no gross signs of disease. It is likely that other penaeid shrimp and crustaceans may
also be susceptible to infection. The EHP spores in fecal pellets or dried cadavers can remain viable up
to six months and retain infectivity for over a year under aqueous conditions.
Shrimp farmers and hatchery operators should monitor L. vannamei and P. mondon for EHP in
broodstock, PL and rearing ponds. The best approach for maturation and hatchery facilities to avoid
EHP is not to use wild, captured, live animals (Eg.,live polychaetes, clams, oysters, etc.) as feeds for
broodstock. Better would be pasteurization (heating at 70oC for 10 minutes). Another alternative would
be to use gamma irradiation with frozen feeds. Alternatively, polychaetes could be selected and tested
for freedom from shrimp pathogens and then reared as broodstock feed in biosecure settings designed
to maintain their freedom from shrimp pathogens (i.e., SPF polychaetes). There is no drug for the control
of EHP infection in shrimp. Application of lime and maintaining the soil pH to 12 has been suggested
for the disinfection of ponds. Better management practices (BMPs) and proper biosecurity is the only
way to keep this parasite away from the aquaculture ecosystem.

White faeces syndrome

White faeces syndrome (WFS) reported since last decade, has recently been noted as serious
problem for P.vannamei. It has been estimated that the Thai production losses due toWFS in 2010 were
10–15%. WFS has been reported from both cultured black tiger shrimp and pacific white shrimp. It
usually occurs after about 45 days of culture (DOC) and it may be accompanied by shrimp mortality.
Ponds affected with WFS show white faecal strings floating on the pond surface while the shrimps show
white/golden brown intestine, reduced feed consumption, growth retardation and often associated with
looseshell. The disease can cause moderate to severe economic loss by reducing the shrimp survival by
20–30percent.While investigating the aetiology of WFS, it has been observed that it is associated with
the presence of vermi form gregarine like bodies, Vibriosis, Enterocytozoan hepatopenaei, blue green
algae and loose shell syndrome. Sriurairatana et al (2014) revealed that 96% of the ponds exhibiting
WFS presented vermi form bodies resembling gregarines.When the contents of the gut or faecal strings
were examined in squash mounts with the light microscope, they consisted of masses of vermiform
bodies that superficially resembled gregarines. Bacteriological results showed that total bacteria and
Vibrio spp. found in haemolymph and intestine were significantly higher in diseased shrimp than in
healthy shrimp. Six species of fungi (Aspergillus flavus, A. ochraceus, A. japonicus, Penicillium spp.,
Fusarium spp., and Cladosporium cladosporioides) were isolated from shrimp naturally infected with
white faeces syndrome. Histopathological examination revealed diffused haemocyte encapsulation and
dilated hepatopancreatic tubules accompanied by necrosis. Tangprasittipapetal.,2013 reported that the
microsporidian found in L. vannamei is nonspecific with previously described E. hepatopenaei and it is
not causally associated with WFS. Sriurairatana etal.(2014) based on transmission electronmicroscopic
37
study suggested that vermiform structures superficially resembling gregarines and commonly found in
the shrimp hepatopancreas (HP) are not independent organisms but result from the transformation,
sloughing and aggregation of microvilli from the HP tubule epithelial cells themselves. The denuded
epithelial cells subsequently undergo lysis and possibly lead to the phenomenon called white faeces
syndrome (WFS). The cause of white faeces syndrome and treatment is uncertain. However, reduced
stocking density, proper water exchange together with better management practices will be helpful in
evading White Faeces syndrome (WFS).

Running Mortality Syndrome (RMS)

Since 2011, a new syndrome, loosely termed by the farming community as running mortality
syndrome (RMS) or chronic mortality syndrome (CMS) has been causing substantial morbidity and
mortality affecting shrimp farming. The affected ponds show different mortality patterns with unusual
symptoms, and no relation to any known pathogens associated with slow mortality rate (e.g.<1%/day),
but the cumulative loss over the period will be significant. Some farmers have lost up to four crops, with
mortalities reaching 70%. Affected shrimp often show white abdominal patches and generally
mortalities start after a month or 40DOC, but a portion of shrimp continue to survive grow to fully
harvestable size. Investigations conducted at ICAR-CIBA has revealed that there was no association of
RMS with known shrimp viral infection. Affected shrimp show patches of whitish musculature in the
abdominal segments as a clinical sign. Investigations have revealed no association with known shrimp
viral infection. Shrimp from RMS affected ponds tested negative for WSSV, IHHNV, IMNV, TSV,
YHV, MBV, HPV and PvNV. Further, bacteriological examination of haemolymph samples of RMS
affected shrimp indicated predominance of bacteria of Vibrio spp., such as Vibrio parahaemolyticus and
Vibrio azureus. The population of anaerobic bacteria in the gut of RMS affected shrimp ranged from72-
252x1014mL-1. The bacteria identified based on 16SrRNA gene analysis as Enterococcusfaecium,
E.hirae, and Lactobacillus plantarum. Bacterial diversity of RMS affected shrimp gut examined by
Denaturing Gradient Gel Electrophoresis (DGGE) revealed a number of uncultured bacterial sequences.
Histopathological examination of the hepatopancreas was largely normal. However, some samples
showed karyomegaly and increased inter hepatopancreatic tubular space with haemolymph infiltration,
muscle necrosis, loosened lymphoid organ (LO) tubule cells and constricted lumen. Bioassay
experiments carried out by feeding RMS affected shrimp tissue to healthy 13-14 g shrimp did not elicit
any disease in the experimental shrimp. All the experimental animals were healthy and active even after
44 hrs of feeding RMS affected shrimp tissue like that of control animals. RMS affected shrimp showed
recovery and appeared healthy and active after 155 hrs of transferring to wet lab in water with optimal
parameters. Co-habitation experiment with healthy shrimp and the infected animals also failed to induce
RMS.

In view of no evidence for the involvement of an infectious aetiology to RMS, the role of better
management practices, especially with regard to pond preparation protocols adopted indicated that
critical environmental parameters viz., TAN, NO2-N and turbidity in water and organic carbon in soil
were significantly high in ponds that were not dried adequately and correlated with incidence of diseases

38
such as RMS and crop failure.

Size variation/ Growth retardation

More recently shrimp farmers have been reporting several cases of size variation/growth retardation
in L. Vannamei grow out cultures. It is reported that viruses,viz., infectious hypodermal and
haematopoietic necrosis virus (IHHNV), lymphoid organ vacuolization virus (LOVV), monodon
baculovirus (MBV), hepatopancreatic parvovirus (HPV )and Laem-Singhvirus (LSNV) are associated
with slow growth and size variation in shrimp. In India, Madhavi et al. (2002) recorded multiple viral
infections in shrimp with stunted growth. Raietal. (2009) observed IHHNV, MBVand HPV associated with
slow growth shrimp and stated that IHHNV could be one of the causes of slow growth in cultured P.
monodon. In the event of white faeces syndrome affected animals there is a decrease in feed consumption
and growth rates were reduced as revealed by average daily weigh tgain (ADG) for the whole crop
operation of less than 0.1 g/day compared to 0.2 g/day in normal ponds. Feed conversion ratios (FCR)
ranged from 1.7 to 2.5 when compared to 1.5 or less for normal ponds (Sriurairatana et al, 2014). Recently
Enterocytozoan hepatopenaei found to be associated with size variation/growth retardation. Studies
carried out at CIBA revealed that 36% and 42% of L.vannamei samples affected by stunted growth were
positive for IHHNV and LSNV respectively. Histopathology investigation carried out on monodon slow
growth (MSGS) affected shrimp showed pathognomonic lesions in different tissues, especially destruction
of organ of Bellonci in eyestalk. Although the precise etiology of stunted growth and MSGS remains
elusive, it appears that IHHNV and LSNV appear to play some role in growth retardation in farmed L.
vannamei.

Summary
The Indian aquaculture production has substantially improved during the last five years, especially
after the introduction of the exotic Pacific white shrimp. However, the intensification of vannamei
farming has exacerbated the epizootics and emergence of new diseases of known and unknown
aetiologies, affecting productions and profitability. Hepatopancreatic microsporidiosis due to a new
microsporidian parasite “Enterocytozoon hepatopenaei (EHP)” associated with growth retardation
resulting in reduced farm productivity has emerged in the Southeast Asian region since 2009. Disease
syndromes of unknown aetiologies such as white faeces syndrome, running mortality syndrome, growth
retardation have been significantly contributing to morbidity and productivity of L. vannamei grow-out
cultures. Scientific literature has evidence that incidence of these aquaculture ecosystem related
syndromes could be significantly minimized with biofloc shrimp farming technology.

39
 MICROBIAL ROLE IN BIOFLOC SYSTEM
Sujeet Kumar
E mail: [email protected]

The primary theme of biofloc technology is to convert nitrogenous waste of aquaculture system in
to a microbial protein, a valuable nutrient for shrimp and fishes. The biofloc is generated by
manipulation of C: N ratio. It serves multitude of function like provision of surplus microbial protein as
feed, control toxic ammonia nitrogen and improve the immune system of aquatic animals. The present
chapter deals with the various aspects of microbes and the role it plays in biofloc system.

1. Bacterial growth characteristics

Bacteria need simple nitrogen like ammonium ion and carbon source such as sugar, starch, cellulose
etc. to run its cellular machinery. This makes it amenable for utilization of toxic ammonia nitrogen from
intensive shrimp aquaculture system. Another characteristic feature of bacterial growth is its faster
growth rate, as it almost doubles its number within 30 minutes. The bacterial efficiency of nutrient
conversion is as high as 50%. Therefore, in nutshell bacteria with its fast multiplication rate are highly
efficient in converting toxic product of the aquatic system into the useful, highly nutritious, much
demanded microbial protein.

1.1. Carbon nitrogen ratio in bacterial growth

The adjustment of C:N ratio in the feed is the single most crucial factors for microbial growth. This
has been derived by considering;

1. The carbon nitrogen ratio of microbial biomass is around 4.

2. Microbial conversion efficiency range between 40-60% with an average of 50%

3. Carbon content in the feed is roughly 50%

Taking these facts together the carbon nitrogen ratio of 10 has been found optimum for bacterial growth.

1.2 Bacterial nutritional composition

The nutritional composition of bacteria has been presented in Table 1. The table indicates that
bacteria have almost 60% protein.

1.3 Aeration is crucial in biofloc formation

Intensive aeration is required in biofloc system to meet enhanced oxygen demand for microbial
growth and shrimp. It also assists to keep biofloc in suspension. Our study indicated that a drop of
oxygen above 1 ppm/h happens in biofloc system compared to control.

40
 Table 1. Nutritional composition of bacteria

Dry matter 25%

On dry matter basis

Carbon 48.9%

Hydrogen, 5.2%

Oxygen 24.8%

Nitrogen 9.46% (=61% crude protein)

Ash 9.2%

Bacteria in isolation Bacteria infloc

Fig 1. Microbial constituent in biofloc

2. Autotrophic verses heterotrophic microbial system

Three predominant pathways for ammonia-nitrogen assimilation function in aquaculture systems.
This includes photoautotrophic, chemo-autotrophic and heterotrophic system. The photoautotrophic
system is mediated by algae and diatoms and mostly works at nitrate level, the last and the least toxic
metabolite of nitrogen cycle. However, the other two systems (chemo-autotrophic and heterotrophic)
system is mediated by bacteria and start functioning from ammonia level, the most important toxic
metabolite in shrimp culture. The chemo-autotrophic microbial system is managed by aerobic
Nitrosomonas and Nitrobacter and the end product is nitrate. In contrast heterotrophic microbial system
not only reduces ammonia level but also convert it into single cell microbial protein called biofloc.

41
 Fig 2. Autotrophic and Heterotrophic microbial system in nitrogen cycle

Table 2. Difference between chemoautotrophic and heterotrophic system

Chemoautotrophic
Feature Heterotrophic
(Nitrifying bacteria)

Multiplication speed Very slow Very fast

Generation time of bacteria Many hours to days 30 min

Must, as bacteria are obligate Required to keep biofloc in

Oxygen demand aerobe. Without oxygen these suspension but not indispens-

bacteria will die. able for bacterial growth.

Nitrite accumulation Chances is high, if aeration is low

42
 Table 3. Difference between photoautotrophic and heterotrophic system

PROPERTY BACTERIA CONTROL ALGAE CONTROL

Energy source Mostly organic matter Solar radiation

Dominance in ponds with Ponds with low organic

high supply and matter concentration. Algae
concentration of organic density increases with the

substrate, normally limited to availability of nutrients up to

Occurrence limitation of light
intensive ponds with zero or

low water exchanges

Does not need light. Adapts to Light is essential (activity

a variety of conditions and lowered in cloudy days)
Sensitivity toward
stable Crashes are common and less
environmental variables
stable

Effect on Oxygen Oxygen is consumed and Oxygen is produced during

demand is high the day, consumed at night

Degradation of organic Primary production produces

matter. Production of organic matter and oxygen
microbial protein through uptake of dissolved nitrate and
Relevant activities uptake of inorganic phosphate
nitrogen

Uptake of nitrogen affected by

the C/N ratio of organic Uptake driven by primary
matter. Practically unlimited
Inorganic nitrogen control production
capacity

Limited by substrate Normally, daily primary

concentration and rate of
Potential capacity production <4gO /m2
application

3. Microbial consortium of biofloc

The last few years have witnessed extensive research on the microbial composition of biofloc. The
recent study suggests that biofloc is mostly dominated by Gram negative bacteria. Recently researchers
reported that most of the screened bacteria belong to Proteobacteria phylum followed by Bacteroides
and Cyanobacteia. The member of phylum proteobacteria is widely dispersed in the marine environment
43
and plays an important role in the process of nutrient cycling and the mineralization of organic
compounds. It was also found that among Proteobacteria, Vibrio group is the most predominant one.
Our study indicated that biofloc system had increased level of Bacillus and Lactobacillus bacterium
which have probiotics properties.

4. Microbial role in bioflocsystem

4.1. Bioremediation of toxic ammonia: The biofloc system maintains adequate water quality especially
toxic nitrogen metabolites. At higher C: N ratio, bacteria immobilize toxic ammonia into microbial
protein within fewhours as compared to slow conventional nitrification process which takes a month to
get established.

4.2. Biocontrol agent: Numerous studies have reported that shrimps are healthiest and grow best in
aquaculture systems that have high levels of algae, bacteria and other natural microbiota. Probiotics are
viable microbial cells and have beneficial effect on health of shrimp by stimulation of immune system
and microbial equilibrium in intestine, and by inhibition of pathogenic microbes. Microbes store poly-
β-hydroxy butyrate (PHB) as a stored product of carbon and energy. Its synthesis is stimulated in the
condition of limited nitrogen supply and with excess carbon supplementation. Condition available in
biofloc system thus enhances its production. The PHB particles offer preventive and curative protection
in Artemia nauplii against luminescent pathogenic Vibrio campbelli. This indicates that biofloc can
serves as novel strategy for disease management on long term basis.
4.3. Healthy supplementary food: The protein content of bacteria is almost 60%. Therefore, its
consumption becomes an alternate source of protein for aquatic animals like shrimp.
4.4 Probiotics and immunostimulant: Biofloc is a microbial consortium, which has large number of
bacteria, which could play a powerful role in digestive enzyme secretion and as immunostimulant. Our
study indicated that biofloc system improves the load of Bacillus and Lactobacillus bacterium which is
expected to play role in probiotics and immunostimulant effect. Our experimental trial on biofloc work
carried at ICAR-CIBA and Kakdwip Research Centre of CIBA, WestBengal revealed that biofloc
formation starts 24 hours after addition of carbon source when bacterial count reaches 106-107 cfu.
Biofloc was mainly composed of bacterial aggregates, zooplankton and phytoplankton. The increase in
C:N ratio reduced the total ammonia nitrogen level. The CN20 was most effective while CN5 was least
effective in reducing ammonia level. This corresponded to increased biofloc volume and the highest floc
volume was observed in CN20 while the least was observed at CN5. Integration of substrate with biofloc
system have profound effect on growth performance and immunity improvement in juvenile and sub
adult stages of penaeid shrimps.

Reference
SSujeet Kumar, Shyne Anand, P S., De, D., Sundaray, J. K., Ananda Raja, R., Biswas, G., Ponniah, A.,
G. T. K. Ghoshal, G. T. K., Deo, A. D., Panigrahi, A., Muralidhar, M., 2014. Effects of
carbohydrate supplementation on water quality, microbial dynamics and growth performance of
giant tiger prawn (Penaeus monodon). Aquaculture International, 22:901-912.

44
Sujeet Kumar., Shyne Anand., P S, De, D., Deo, A.D., Ghoshal, T.K., Sundaray, J.K., Ponniah, A G.,
Jithendran, KP., Raja, RA., Biswas G., Lalitha, N., 2015. Effects of biofloc under different carbon
sources and protein levels on water quality, growth performance and immune responses in black
tiger shrimp Penaeus monodon (Fabricius, 1978). Aquaculture Research, 1-15

45
 DESIGN CONSIDERATION OF BIOFLOC PRODUCTION
SYSTEMS
P. Nila Rekha, Neethu K. C. and A. Panigrahi

E.mail: [email protected] /[email protected]

Introduction
Biofloc production systems were developed to improve environmental control over intensive
production. In places where water is scarce or land is expensive, more intensive forms of aquaculture
must be practiced for cost-effective production and biofloc technology seems to be the solution.
Biofloc technology has become a popular in farming of Pacific white shrimp, P. vannamei and now it
is used in other shrimp and fish as well. It is now a very popular system of semi-intensive and intensive
shrimp and fish farming with low or no water exchange. It is comparatively much profitable and bio-
secured system of aquaculture. A basic factor in designing a biofloc system is waste treatment. Biofloc
systems work best with species that are able to derive some nutritional benefit from the direct
consumption of floc. At its core, biofloc is a wastewater treatment system and was developed to
mitigate the introduction of diseases into aquaculture facilities or farms from incoming water (water
exchange, typically used in prawn farming). Biofloc systems employ a counter-intuitive approach to
more traditional aquaculture designs. Where more traditional aquaculture designs seek to remove
suspended solids, bio-floc systems allow and encourage solids and the associated microbial
communities to accumulate in the water. Assuming sufficient aeration and amalgamation in order to
maintain an active “floc” in suspension, water quality can be maintained and controlled. Bioflocs’ may
also have probiotic effects in some species. Essentially, bioflocs’ provide two very critical services,
which also helps a little to understand how they work. They treat wastes from feeding and provide
nutrition from floc consumption.

Specifications and design of biofloc systems

“Flocs” are a supplementary food resource that can be consumed between feeding times (pellet
use). One of the benefits of biofloc systems is it capacity to recycle waste nutrients via microbial
protein into fish or prawns. The main component of biofloc is nitrogen that is incorporated into
bacterial cells. One other benefit of biofloc systems is the benefit of improved feed conversion ratios
derived from the consumption of microbial protein. It should also be noted that bi-floc systems are
generally implemented as pond based systems as they add the most benefits to pond based aquaculture.
Additionally, biofloc is not suitable for just any species and works best with species that are able to
derive nutritional benefit from the direct consumption of “floc”. Implementing biofloc technology to
culture shrimp in ponds and recirculating systems could offer several advantages, including
improvement of water quality and animal nutrition.

46
Basic types of biofloc systems
Few types of biofloc systems have been used in commercial aquaculture or evaluated in
research. The two basic types are those that are exposed to natural light and those that are not. Biofloc
systems exposed to natural light include outdoor, lined ponds or tanks for the culture of shrimp or
tilapia and lined raceways for shrimp culture in greenhouses. A complex mixture of algal and bacterial
processes control water quality in such “greenwater” biofloc systems. Most biofloc systems in
commercial use are greenwater. However, some biofloc systems (raceways and tanks) have been
installed in closed buildings with no exposure to natural light. These systems are operated as “brown-
water” biofloc systems, where only bacterial processes control water quality.
Based on the waste treatment, there are two primary biofloc technology systems that can be considered
for shrimp culture.
(i) in-situ biofloc systems, where biofloc form in the culture pond/tank along with the shrimp.

(ii) ex-situ biofloc systems, in which effluent waters are diverted into a suspended-growth
biological reactor where biofloc are generated and subsequently can be used as an ingredient
in shrimp feed.
In-situ systems are currently in use, and ex-situ systems are in the developmental stage. Each
option (in-situ versus ex-situ) has unique benefits and limitations. For example, in-situ biofloc systems,
under proper conditions, can assimilate ammonia directly into microbial proteins, thereby preventing
the accumulation of nitrate (from nitrification). Additional benefits are that the biofloc provide
nutrition directly to the shrimp. However, the downside is lack of control regarding manipulation of
biofloc nutritional profiles. Furthermore, in-situ biofloc systems exert a high oxygen demand because
oxygen is being used by both biofloc and shrimp. With ex situ biofloc systems, one has better control
of floc nutritional profiles and can manage the demand for oxygen by floc and shrimp in separate tanks.

Design consideration
Bioflocs production systems are either of ponds, tanks, raceways and RAS indoor or outdoor

Pond design-outdoor
Aquaculture ponds are dynamic and complex ecosystems, which will only produce the targeted
cultivable production, if nutrient cycling and waste decomposition are properly managed. A number
of physical, chemical and biological methods used in treating this kind of problem, management
practices influencing the load and decomposition rates in ponds include water exchange, sediment
removal, aeration, fallowing period between crop cycles, liming etc. Ponds are designed so that it may
be possible to maximise the viability of a low water exchange and maintenance of microbial floc
system. These specifications include pond shape to maximise active suspension and oxygen
distribution, maximum and minimum depths, drainage capability, and lining. The influence of pond
design on system viability has not been fully researched and at present different designs is being
adopted at different places. The basic requirements for biofloc system operation include high stocking
47
density and high aeration with correct paddlewheel position in ponds. Ponds must be lined with
concrete or high density polyethylene (HDPE). An intensive BFT pond has to be planned bearing in
mind the need to provide proper aeration to all parts of the pond, mixing the water to minimize
anaerobic sludge accumulation and to enable periodic drainage of the sludge both during the crop and
between crops. Additionally, designs should facilitate efficient harvest and easy feeding. General rules
and demands of pond design should be followed in designing BFT systems also. But as per the site
condition it needs to be modified

Pond shape
The classical design BFT ponds is based upon a round pond concept with aerators inducing
radial water flow, or otherwise square or rectangular ponds where water flow is sort of radial, mostly
in parallel to the pond dykes. In such cases, corners are rounded or cut to minimize stagnant areas.
Round ponds are the most common design for small ponds, used in hatcheries and some production
units. Building larger round ponds is more difficult (digging, utilizing land, lining) and rectangular or
similar are more common.

Pond Size
Intensive ponds should not be too large. The biomass in the ponds is high, controlling large
volumes of water is difficult, harvesting of too high biomass is complicated and the risk of holding
dense fish or shrimp populations in very large reservoirs may be too high. In addition, the risk of
losses if something goes wrong in large intensive ponds is very high. The typical size range of intensive
ponds is normally in the range of 100-1,000 m2 while the typical size of intensive BFT shrimp ponds
is 1,000 – 20,000 m2 (0.1-2ha).

Pond depth
The depth of ponds is in the range of 1-2 m. The advantage of deep ponds is their high heat
buffering capacity, which helps to avoid over-heating or over-cooling during the diurnal cycle. In
addition, the deeper water column minimizes contact of the surface water to pond bottom anaerobic
conditions and allows a deeper water column for feeding and biological processes. However,
constructing deeper ponds demands a higher investment and in cases of limited gradient to the drainage
base makes drainage and harvest more of a problem.

Pond lining
BFT ponds are most always lined. It could be lined with Concrete, Bricks, Fiberglass, Wood,
Plywood, HDPE, PVC, EPDM. Lining of ponds is usually done with High Density Polyethylene
(HDPE) sheets of about 1 mm (30-40 mil). Cheaper alternatives may be constructing a pond bottom
with compacted laterite soil (or laterite crushed stones). Laterite, the red soil commonly found in
tropical regions, makes a stable pond bottom upon compaction. However, in this case, the banks
should also be covered with plastic sheets. Another possibility is to line the pond with a soil cement
mixture. In sandy soils one can mix cement with a top layer of soil and obtain a stable lining. The
48
bottom should be smooth to ease draining and cleaning. The relatively fast water movement within the
pond (10-30 cm/sec) may induce a significant erosion of earthen banks. Boyd and others (Boyd, 1995)
found that such eroded material constitutes a large portion of the accumulated sludge and causes
difficulties in pond maintenance. Avnimelech and co-workers (1986) found that a soft clay dominated
pond bottom becomes highly anaerobic due to the mixing of organic matter with the clay and the very
limited oxygen diffusion into the deep bottom layer. Additional advantages of lining are the ease of
cleaning pond bottom in between cycles and possibly more efficient utilization of feed residues sinking
to the bottom. It is interesting and important to note that the nature of organic matter accumulating on
the pond bottom differs between lined and earthen bottoms. In earthen ponds, the organic residues
mix with the soil, forming a rather stable complex, in comparison to highly degradable, unstable and
bio-reactive organic residues that accumulate adjacent to the lining. This difference affects pond
management: in earthen ponds, organic matter accumulates over a period covering several cycles and
has to be periodically removed. In the case of lined ponds, organic deposits do not accumulate, yet
due to the high reactivity they affect chemical and biological processes in the pond vigorously and
may cause a real problem for production in the pond. One very clear example of the difference between
earthen and lined ponds is demonstrated by following phosphorus interactions. In earthen ponds, the
soluble phosphorus interacts with soil components and is, to a large extent adsorbed. In lined ponds,
such interaction does not take place and excessive phosphorus remains, mostly as soluble phosphorus
in the water (Avnimelech and Ritvo, 2003).

Central drainage system

In recent time there is a noble concept of shrimp toilet or central drain applied by aquaculturists
are showing interest in establishing shrimp pits or shrimp toilets or central drain at the center of the
culture pond. For this purpose, they are utilizing about 5- 7% of the total surface area of pond. Ideally,
the pond size should be about 1000-5000 m2 for the establishment of shrimp toilet. Establishments
include 7-10 feet concrete cement with a smooth slope to the center where there will be a small well
of about 2-3 feet depth. Smooth and slope surface (25-30o) at center allows fast movement of waste
toward the central pit with the additional advantage of lesser requirement of water with concentrated
organic waste removal. By the continuous movement of water by intensive aeration all the waste
materials will be dragged in to well. This waste can be removed using a siphoning motor or submersible
or floating pump (power of about 2 hp) for every week so that there will not be any sludge. Natural
gravitational force can also be used for draining the organic waste like in central drain. In the recent
time, there is an addition to shrimp toilet concept is an HDPE and rubber parabola cover (2.5 meters
in diameter), placed over the central drain of a pond. The purpose of the keeping parabola is to extend
the area of sludge removal. The achievement of thorough drainage is very important in extensive BFT
ponds, where a very good exposure to the air and drying are essential. In CIBA, under NFDB project
biofloc based P. vannamei culture is being undertaken in lined central drainage ponds at Muttukadu
experimental station.

49
Prefabricated ponds/tanks
A new and interesting approach is the installation of pre-fabricated ponds. Such ponds are
produced presently in both Mexico and Colombia (possibly else-where as well), are relatively
inexpensive and can be installed within a few days. The ponds (tanks) are relatively small (up to about
150 m2) and can be used as a starting technology for individual farmers. Such ponds are suitable for
the production of dense fish biomass (shrimp in special cases, to provide fresh shrimp) and can easily
be placed in green-houses. Organic residues are always produced and their accumulation as bottom
sludge is an unavoidable problem. The basic solution to this problem is to concentrate the sludge in
limited points in the pond (sludge traps) and design for the capacity to drain out the sludge, during the
production cycle and between cycles.

Race ways – outdoor and indoor

A raceway usually consists of rectangular basins or canals constructed of concrete and
equipped with an inlet and outlet. A continuous water flow-through is maintained to provide the
required level of water quality, which allows animals to be cultured at higher densities within the
raceway. Most raceways are made of reinforced concrete, though some earthen raceways are also built.
Earthen raceways with plastic liners cost little and are easy to build, but cleaning and disinfecting them
is difficult and plastic linings are fragile. Reinforced concrete is more expensive, but is durable and
can be shaped in complex ways. Raceway tanks can also be built from polyester resin. A raceway is
most often a rectangular canal with a water current flowing from a supply end to an exit end. The
length to width ratio is important in raceways. To prevent the fish stock from swimming in circular
movements, which would cause debris to build up in the centre, a length to width ratio of at least six
to one is recommended. If the width is too large this could result in a feeble current speed which is not
desirable (see below). The length of a raceway unit is usually constrained by the water quality or by
how much stock a unit can hold for ease of management. The average depth of a raceway for fin fish,
such as rainbow trout, is about one meter. This means each section in a raceway should be about 30 m
long and 2.5–3 m wide. The landscape should sloped to one or two percent, so the flow through the
system can be maintained by gravity. The raceway should not be curved, so the flow will be uniform.
Generally the water should be replaced about every hour. This means a typical raceway section
requires a flow rate around 30 liters per second. However, the optimum flow through rate depends on
the species, because there are differences in the rates at which oxygen is consumed and metabolic
wastes are produced. The flow rate necessary to maintain water quality can also change through the
year, as the temperature changes and the cultured species grow larger. For reason such as these,
continuous monitoring of water quality is important, including measurements of water flow rates, pH
levels and temperature, as well as the levels of dissolved oxygen, and suspended and solid waste
material

50
Closed raceway
Another BFT system design is the closed raceway approach. The closed raceway is based upon
a linear rather than a radial water movement pattern. Closed raceway units can be constructed as such,
when all walls and flow partitions are built as an integral part of the system (e.g. walls and partitions
built of concrete). A cheaper and easier mode is to put in a partition, dividing the pond the rectangular
pond into a closed raceway. It is important to note that the flow partition is separating two sides having
the same water head and that the separation does not have to be tight. Thus, a partition made of simple
plastic sheets placed in position supported by poles may be sufficient. Aerator placement is generally
parallel to the raceways. Sludge tends to accumulate in closed raceways at the ends of the flow
partitions where water flows around the baffle and relatively dead volumes are created. The linear flow
mode of the closed raceways seems to enable the operation of long ponds. Pond length can be as long
as there are enough aerators along the pond (and as long as you can have all pond length sloping toward
the outlet). The width of the raceway should be such that enable smooth water flow and easy access.
A width of about 10-30 m seems to be appropriate.

Mr Adam Body in the Northern Territory, Australia operated a shrimp farm that included four
2.5 ha ponds, 500 m long and 50 m wide (Chamberlain, 2000). The ponds were divided into 2
raceways, about 25 m wide by earthen baffles. The ponds were each equipped with 4 long arm paddle
wheel aerators. Such ponds seem to have many advantages, are relatively inexpensive and simple. Yet,
more experience in planning and operating closed BFT raceways is required.

Green house
Greenhouses are framed or inflated structures covered with transparent or translucent material
large enough under partial or fully controlled environmental conditions for the shrimp or fish culture.
In India use of greenhouse technology started only during 1980’s and it was mainly used for research
activities for agriculture and horticulture purposes. The National Committee on the use of Plastics in
Agriculture (NCPA-1982) has recommended location specific trials of greenhouse technology for
adoption in various regions of the country. Greenhouse structure of various types are used. Although
there are advantages in each type for a particular application, in general there is no single type
greenhouse, which can be constituted as the best. Different types of greenhouses are designed as per
the location based on shape, utility, material and construction:
The green house can be of wooden framed or pipe framed structure or truss framed structure. The type
of covering material as

 Glass glazing.

 Fibre glass reinforced plastic (FRP) glazing

o Plain sheet
o Corrugated sheet.

51
  Plastic film
o UV stabilized LDPE film.
o Silpaulin type sheet.

o Net house.
Different greenhouse designs are available, ranging from small ponds (a few hundred m) up to
structures covering large ponds. Stability of these structures during strong winds may be a problem,
calling for a solid and expensive structure. In all cases, ventilation is needed, to enable release of heat
and allow better temperature control.

Greenhouse raceways for shrimp

Building upon the intensification of lined, outdoor shrimp ponds, member institutions of the former
U.S. Marine Shrimp Farming Consortium developed biofloc technology in intensive lined raceways
in standard greenhouses (100 feet long × 25 feet wide). These greenhouses can be sited inland to avoid
expensive coastal land and in areas with a temperate climate if supplemental heat is provided.
Experimental or nursery-scale raceways (40 to 50 m3) and commercial-scale systems (250 to 300 m3)
are constructed to fit in a standard greenhouse.
Raceways are shallow (about 50 to 100 cm) and typically include a central baffle or partition to
improve internal circulation. Water movement is provided by banks of air-lift pumps that draw water
from the tank bottom and release it at the tank surface or by pumps that inject water through nozzles
designed to provide aeration. Water is directed to flow along the tank in one direction and in the
opposite direction on the other side of the partition. Raceways also have an extensive network of
diffused aeration to maintain biofloc in suspension. At the highest intensities and standing crops,
oxygen may be injected for a short time after feeding or continuously as needed.

Biofloc solids concentration is managed with settling tanks. Settling tank volume is less than 5
percent of system volume. Some systems include foam fractionation to capture fine solids and foam.
Best operation occurs when settleable solids are 10 to 15 mL/L; best shrimp feed consumption occurs
at the low end of that range.

Shrimp (SPF) juveniles are stocked at 300 to 500 PL per m2 (up to 750 to 1,000 PL per m2). Yields
of 3 to 7 kg/m2 are typical, with yields of 10 kg/m2 possible with pure oxygen supplementation. Water
use is about 200 to 400 L/kg. In addition to shrimp grow-out, biofloc technology can be used in
commercial nursery systems. The relatively small and shallow raceway is physically suitable for inten-
sive nursery culture. Importantly, juvenile shrimp may be able to take better advantage of the
nutritional benefits of biofloc than larger shrimp.

52
Greenhouse raceway for shrimp (Clemson system)
A variation of a shrimp biofloc system in a greenhouse has been evaluated at Clemson
University. The system consists of three shrimp rearing tanks, each of which is 250 m2, containing 150
m3 of water. The system is operated with a solids concentration of 200 to 500 mg/L (15 to 50 mL/L).
Water from rearing tanks flows to a primary solids settling tank where it is allowed to become anoxic.
Denitrification and some alkalinity recovery occur here under those conditions. Water then passes to
an aerated tank stocked with tilapia, which provide filtration (polishing) and nutrient recovery. Next,
water flows into an intensively mixed tank with dense biofloc (1,000 to 2,000 mg/L) that serves as a
biofilter to oxidize ammonia. Water then flows to a tank for solids settling before returning to the
rearing tank. Settled solids are recycled to the suspended-growth biofilter. The main difference
between this and the previously described system is the use of a dense suspension of biofloc separate
from the shrimp as a biofilter. The Clemson system is also different in that it includes an anaerobic
component in the treatment loop. The system has produced 2.5 to 3.5 kg/m2 in a 150- to 180-day
growing season. Sustainable feeding rates in excess of 1,000 kg/ha and peak

Fig 3. Raceway culture system

RAS and Recirculatory Biofloc system - RBFT

A different approach, recirculating aquaculture systems, RAS, is based upon the treatment of
water quality in a separate compartment using mechanical solids separation, biofilters of different types
and often water sterilization,

53
 The basic components of RAS are unique, irrespective of the aquatic species. The capacity of
RAS is decided, based on the biomass and feed rate. The important processes in RAS are waste solids
removal, biofiltration, degassing, aeration and disinfection.Recirculation can be carried out at different
intensities depending on how much water is recirculated or re-used.

Design considerations
The basic components of RAS are unique, irrespective of the aquatic species. The capacity of
RAS is decided, based on the biomass and feed rate. The important processes in RAS are waste solids
removal, biofiltration, degassing, aeration and disinfection.

Solid waste removal

Solids removal is very important in RAS. The solids in the form uneaten feeds and excreta
must be removed as soon as possible, because it may result in biofouling, NH3 production, oxygen
depletion, high microbial load and eventually occurrence of disease within the system. There are
different techniques being employed for solids removal i.e. sedimentation/settling tank, screens,
granular media filters, porous media filters, hydrocyclones and later on foam fractionation and
ozonation for fine and dissolved solids removal. The use of the above mentioned treatments are specific
to the size of solids and may be used in combination.

• Sedimentation – Settling tank, Tube settler is used for sedimentation of large particles.>100
µm particles can be removed by this process. The drawback is low hydraulic loading and only
40-60 % solids removal is possible.

• Granular media filters – Rapid sand filter, Pressure sand filter, Bead filter etc. comes under
this category. About >20 µm paricles can be removed by granular media filters. They have
moderate hydraulic loading rate and 60 – 90 % solids removalis possible. The disadvantage is
high head loss in the filtration.

• Screen – Coarse screen, Micro screen, Drum filter can be used to segregate particles of >60
µm size. These equipments have negligible head loss and high hydraulic loading. About 5-50
% solids removal is possible.

• Porous media filters – DE filter, Cartridge filter comes under porous media filters. These are
used in micro-particles removal. Upto 0.1 µm particles can be separated used cartridge filters.
They have moderate head loss andaverage hydraulic loading rate. About 90% solids removal
is possible with porous media filters.

• Hydrocyclones –Swirl separators are used in old times. They are very simple in construction
and capable of separating large particles of >200 µmsize. The disadvantage is very high head
loss and low hydraulic loading.

• Foam fractionation - fine and dissolved solids are removed in protein skimmer. About <30
µm size particles are separated by foam fractionation.

54
 Selection of method/equipment for solids removal is based on hydraulic loading rate, head loss,
fine solids removal efficiency, water loss and resistance to biofouling. The method can be used alone
or in combination based on the size of particles to be removed.

In RBFT system each tank, there is an annular air diffuser (porous rubber with an external
diameter, 16 mm andinternal diameter, 8 mm, length, 650 mm each) and a 2-Hp aerator (Blower) to
provide air and to keep the solids suspended. The recirculating pump offered the power to make sure
the recirculation of RBFT system, which results in a velocity of the inlet water (the regulation of water
inlet velocity is based on valve and water flowmeter). The inlet velocity greatly changed the flow
pattern of the rearing tank, which could affect the distribution of biofloc particles, just like the size of
bubble supplied by aerator. To a certain water inlet velocity and bubble size, the rearing tank could
obtain a homogenous distribution of biofloc. According to the homogenous distribution, the TSS of
rearing tank would decrease to an expected level because HDVS could discharge the biofloc particles
effectively and exactly.

RAS has numerous advantages over the other conventional farming systems. In RAS aquatic
animals can be grown in controlled conditions that influence their growth and can better manage
economic and production performance. RAS uses only upto 10% of water exchange daily, and thus,
the animals can be grown in places where limited water is available with efficient use of water
resources. Indoor aquaculture through RAS creates high density farming and thus, reduction in land
area compared to traditional pond based systems. Bio-security can be maintained through RAS.

Conclusion
High-density rearing typically requires some waste treatment infrastructure. At its core, biofloc
is a waste treatment system. Biofloc systems were also developed to prevent the introduction of disease
to a farm from incoming water. Shrimp farming began moving toward more closed and intensive
production where waste treatment is more internalized. Super-intensive shrimp culture systems require
a unique set of engineering and management criteria. Many of these issues are still being explored by
the scientific community as well as by the aquaculture industry. The future surely holds a place for
super-intensive biofloc systems or some adaptation of this technology if responsible aquaculture
development is to progress.

References
Avnimelech, Y. (ed.). 2009. Biofloc Technology, Second Edition. World Aquaculture Society, Baton
Rouge, LA.

Burford, M.A., P.J. Thompson, R.P. McIntosh, R.H. Bau¬man, and D.C. Pearson. 2003. Nutrient and
microbial dynamics in high-intensity, zero-exchange shrimp ponds in Belize. Aquaculture
219:393-411.
DeSchryver, P., R. Crab, T. Defroit, N. Boon, and W. Verstraete. 2008. The basics of biofloc
technology: the added value for aquaculture. Aquaculture 277:125-137.
55
Ebeling, J.M., M.B. Timmons, and J.J. Bisogni. 2006. Engineering analysis of the stoichiometry of
photoau¬totrophic, autotrophic, and heterotrophic removal of ammonia-nitrogen in aquaculture
systems. Aquacul¬ture 257:346-358.
Hargreaves, J.A. 2006. Photosynthetic suspended growth systems in aquaculture. Aquacultural
Engineering 34:344-363.

56
 BIOFLOC TECHNOLOGY FOR WATER QUALITY
MANAGEMENT IN AQUACULTURE
Saraswathy R., Muralidhar M, A. Panigrahi, N. Lalitha and P. Kumararaja

Email: [email protected]
Introduction
In aquaculture systems, much of the nitrogen input enters the water column as total ammonia-
nitrogen generated by feed is not fully converted into shrimp tissue. Generally, metabolites like
ammonia-nitrogen and nitrite-nitrogen are generated during intensive aquaculture as a consequence
of aquatic animal excretion, sediment mineralization and microbial process in water column.
Nitrogen loss varied from 14.7% to 34.7% based on stocking density under zero water exchange
culture system. The presence of TAN in water above 1.0 ppm can cause adverse health effects in
aquatic animals and create environmental concerns if effluent is not properly treated. The
metabolites are deleterious to the animal which causes increase in blood pH, reduction in oxygen
content of blood, affects gills, causes stress, reduced feeding, retarded growth, poor survival and
high susceptibility to disease. Many biological treatment systems have been developed to maintain
low ammonia and nitrite-N concentrations in culture water.

Pathways to control ammonia in aquaculture pond environment

The three nitrogen conversion pathways by microbes for removal of ammonia nitrogen in
aquaculture system are photoautotrophic removal by algae, autotrophic bacterial conversion of
ammonia nitrogen to nitrate nitrogen and heterotrophic bacterial conversion of ammonia nitrogen
directly to bacterial biomass (Biofloc). Phytoplankton based systems are attractive because of their
simplicity and low operational cost but fail to sustain a stable operation because of periodic
phytoplankton bloom and crash cycles. Nitrifying biofilters have been successfully employed in
various aquaculture applications. Despite many advantages, the use of nitrifying bio filters remains
costly. Currently, biofloc technology systems have been receiving attention because they feature
high production, water quality control, and feed protein recycling simultaneously in the same
culture unit Biofloc system leads to sustainable production through reduction of cost of feed and
water exchange and protect the surrounding environment.

Biofloc Technology

The Biofloc technology (BFT) is based on the manipulation of microbial community through
the addition of a carbon source that promotes the development of heterotrophic bacteria. These
bacteria use the organic carbon and the inorganic nitrogen present in the water to produce their
biomass by removing toxic ammonia from the culture system. This system facilitates the
production of aquatic animals at high stocking densities in a sustainable and bio-secure fashion. In
57
some cases, the protein content of feed can be reduced due to partial protein supplementation by
the microbial community.

Biofloc as a bioremediator to improve water quality

Biofloc is nothing but aggregates of bacteria dominated by heterotrophic, organic material,
inorganic flocculants and suspended algae. All of these microscopic organisms have their own
function and interact between each other in the biofloc system to make the bioremediation process
successful and maintain water quality during the culture. The algae serve as a food for the
animal/pond stock and the bacteria promotes direct conversion of nitrogenous waste to simpler
compounds. This process maintains or greatly improves the quality of pondwater. Improvement in
waterquality drastically reduces the need to use large volume of additional water in the pond. This
leads to sustainable activity that is in balance with the environment and reduces the cost of water
and feed for the pond stock. The biological processes in biofloc system to improve waterquality
are shown in the figure below.

Fig. Biological processes in biofloc system to improve waterquality

58
Factors controlling ammonia concentration in Biofloc System
1. Balancing input C:N ratio
In biofloc systems a major factor that controls ammonia concentration is the C:N ratio off
other inputs. A feed with 35 percent protein concentration has a relatively low C: N ratio of about
9 to 10:1. Increasing the C: N ratio to 12 to 15:1 favours the heterotrophic pathway for ammonia
control. The low C: N ratio of feed can be augmented by adding supplemental materials with high
C: N ratio or, by reducing feed protein content. At high C:N ratio, heterotrophic bacteria dominate
autotrophic microorganisms, immobilize the ammonium ion for production of microbial protein
and maintain inorganic nitrogen level in the water within the limit. Immobilization of ammonium
by heterotrophic bacteria occurs much more rapidly because the growth rate and microbial biomass
yield per unit substrate of heterotrophs are a factor 10 higher than that of nitrifying bacteria.

2. Type of carbon source

Capacity of the biofloc system to control water quality in the culture system and the nutritional
properties of the flocs are influenced by the type of carbon source used to produce the flocs. Some
of the carbon sources are tapioca flour, wheat flour, molasses, sugar etc.

3. Amount ofcarbon
The amount of carbon addition depends on several factors such as water quality, physiology
and density of the animal, and solubility of carbon source. To operate biofloc system efficiently,
C: N ratio has to be maintained in the ratio between 10:1 and 20:1. Under optimum C: N ratio,
inorganic nitrogen is immobilized into bacterial cell while organic substances are metabolized.

4. Aeration and mixing of water

Constant intensive turbulent mixing is essential in a BFT system in order to keep the solid
suspended in the water column at all times. Without mixing, bioflocs can settle out of suspension
and form dense piles that rapidly consume nearby dissolved oxygen, creating an anaerobic zone.
These zones can lead to the release of chemical compounds such as hydrogen sulphide, methane
and ammonia that are toxic to shrimps and fish. In practice, aeration is used to supply oxygen and
provide adequate mixing. Various configurations of aeration equipment are possible, depending on
the specific form of biofloc system. In lined ponds or tanks, multiple paddle wheel aerators are
arrayed to provide whole-pond circular mixing. Shrimp raceways in greenhouses often use banks
of airlift pumps placed at intervals around raceways to aerate and circulate water. Diffused aeration
can be used in small tanks. Devices that circulate water at low head, such as low-speed
paddlewheels and airlift pumps, can be used. Biofloc shrimp ponds are aerated with 25 to 35 hp/ha,
and some intensive tilapia systems are aerated with 100 to 150 hp/ha (Hargreaves, 2013). These
intensive aeration rates could not be applied to earthen ponds without significant erosion, thus most
biofloc systems are lined. Biofloc systems are not a good choice in areas where power supplies are

59
unreliable or electricity is expensive.

Changes in water quality under biofloc system

Under biofloc system, ammonia and nitrite concentration are generally low due to the removal
of these compounds by microbial community. Nitrate concentration was low due to the lower
concentration of ammonia nitrogen available to the oxidation by nitrifying bacteria. The absorption
of the reduced form of inorganic nitrogen by phytoplankton is probably the primary cause for high
concentration of chlorophyll a concentrations in this system. The use of carbon sources in intensive
systems promotes succession and dominance of bacteria over microalgae.

Physical-chemical characteristics of water under biofloc system

Temperature
Temperature is one of the most influential parameters in pond system. It affects metabolic rate
of animal & microorganism, oxygen consumption, pH and concentration of ionized and un-ionized
ammonia during culture. The optimum temperature range will depend on the animal species,
bacteria adapted to the system temperature as well as seasonal and environmental variations.
Biofloc system is more efficient when water temperature is between 28 and 30oC. Nitrifying
bacteria can support a range from 8-30oC, but efficiency is reduced by 50% at 16oC and by 80% at
10oC.

Dissolved oxygen
Oxygen in aquatic system should be >5 ppm. In a biofloc system, as the algae and bacteria
also have oxygen demand, dissolve oxygen should be maintained at 7-8 ppm to ensure proper
functioning of the system.

pH
pH is to be maintained in the range between 7 and 8.5. Hydrated lime (Ca (OH)2) is to be used to
maintain alkalinity and pH above 100 ppm of CaCO3 and 7.5, respectively in the Biofloc system.
pH reduction generally occurs due to alkalinity consumption during ammonia–nitrate nitrogen
conversion processes. According to Furtado etal. (2011), levels less than 100ppm of CaCO3 and pH
7 for prolonged periods of time can affect the growth performance of shrimp in biofloc.

Alkalinity
Alkalinity is the capacity of water to buffer or resist changes in pH in response to additions of
acid or base. Water in biofloc systems should be maintained with ample reserves of alkalinity
because it is constantly depleted by the activity of nitrifying bacteria in nitrification. Once alkalinity
is depleted, pH can drop steeply, inhibiting bacterial function, including important nitrifying
bacteria. In this situation, ammonia accumulates to the point where shrimp feeding response will
deteriorate. This limits daily feeding rate, feed conversion efficiency and ultimately production.
Alkalinity should be kept between 100 and 150 ppm as CaCO3 by regular additions of sodium
60
bicarbonate. Other liming agents are less suitable. Every kilogram of feed added to the system
should be supplemented with 0.25 kilogram of sodium bicarbonate.

Suspended solids, Settelable solids and volatiles

Bacteria depend on suspended solids as a substrate for adhesion and as a source of energy from
carbon. In biofloc system, TSS in the range of 250-450 ppm ensures efficient bacterial activity and
a good system to control ammonia without excessive water respiration. An excess of TSS affects
the breathing process of animals, lead to stress or in extreme cases, lead to death by clogging gills.
Culture of L.vannamei in biofloc system contained 453±50 ppm of TSS and 256±106 ppm of
volatile solids improved shrimp production provided efficient exchange of oxygen. The desired
range of settleable solids concentration is 10 to 15 mL/L for shrimp and 25 to 50 mL/L for tilapia
under good biofloc system.

Turbidity
In aquaculture system, turbidity is due to suspended solids, phytoplankton, zooplankton and
bacteria. Turbidity is measured by Secchi disk and the value of 35-40cm is acceptable. Turbidity
of 75 to 150 NTU is comparable to the recommended settleable solids concentration provided that
colour interference is not too severe.

Total Ammonia Nitrogen

It is the excretion product of feaces, urine, uneaten food, phytoplankton and zooplankton.
Ammonia or non-ionized ammonia (gaseous) is considered as toxic when compared to ionized
ammonia or ammonium ion (NH4). The unionized form (NH3) increases with a low oxygen
concentration, high pH and high temperature. The recommended ammonia concentration in biofloc
culture is less than 1.5ppm. In L. vannamei, ammonia nitrogen concentration should be less than
1.2 and 6.5 ppm in post-larvae and juveniles (Frias et al.2000).

Nitrite nitrogen
The transformation process to ammonia nitrogen to nitrite nitrogen and their toxicity form
depends on the amount of chlorides, temperature and oxygen concentration in water. Nitrite toxicity
affects transport of oxygen, oxidation of important compounds and tissue damage. Nitrite-nitrogen
concentration should be less than 2 ppm in biofloc culture (Perez-Rostro et al.2014).

Nitrate nitrogen
It is the end product of aerobic nitrification considered as less toxic. The toxicity of these
compounds is due to its effects on osmoregulation and oxygen transport. Nitrate concentration
should not exceed 10 ppm in biofloc culture.

61
Promising features of biofloc technology
Water is becoming scarce or expensive to an extent of limiting aquaculture development.
Secondly, the release of polluted effluents into the environment is prohibited in most countries.
Thirdly, severe outbreaks of infectious diseases led to more stringent biosecurity measures, such as
reducing water exchange rates. Biofloc technology addresses the above issues making it a
promising environment friendly solution.

Benefits accruing in pond water quality due to the use of biofloc technology
1. Improving water quality through removal of toxic nitrogen compounds such as ammonia and
nitrite.
2. The water quality of a heterotrophic microbial-based production system containing bacterial
flocs is more stable than that of a phytoplankton-based production system.
3. Biofloc technology makes it possible to minimize water exchange and water usage in aquaculture
systems, through maintaining adequate water quality within the culture system.
4. Compared to conventional water treatment technologies used in aquaculture, biofloc
technology provides a more economical alternative by reducing the water treatment expenses
to the tune of about 30%.

5. Enhancing the farm biosecurity and health management through zero-water exchange and
possible probiotic effect.

Conclusion
Aquaculture is expected to grow at a rapid pace all over the world in the coming years, hence
there is a need to improve production, productivity while reducing the cost of culture and protecting
the environment. Biofloc offers a lucrative combination of protecting the pond environment using
natural resources, reducing the input cost of feed and effectively managing the additional water
requirement, thereby providing an all-round economically feasible solution. In the future, biofloc
will be one of the major technologies that will be widely utilized for pond water quality
management.

Reference
Avnimelech, Y., Panjaitan, P. 2006.Effects of carbon:nitrogen ratio control on waterquality and
shrimp growth in zero water exchange microcosms. Abstracts.World Aquaculture, Florence,
Italy.

Azim, M.E., Little, D.C. 2008. The biofloc technology (BFT) in indoor tanks: Water quality,
biofloc composition, and growth and welfare of Nile tilapia (Oreochromisniloticus).
Aquaculture, 283: 29–35.

62
Burford, M. A., Glibert, P. M. 1999. Short term nitrogen uptake and regeneration in early and late
growth phase shrimp ponds. Aquaculture research, 30:215-227.

Crab, R., Defoirdt, T., Bossier, P., Verstraete, W. 2012. Biofloc technology in
aquaculture:beneficial effects and future challenges. Aquaculture, 356-357: 351-356.

Ebeling, J. M., Timmons, M. B., Bisogni, J. J. 2006. Engineering analysis of the stoichiometry of
photoau- totrophic, autotrophic, and heterotrophic removal of ammonia-nitrogen in
aquaculture systems. Aquaculture, 257:346-358.
Frías-Espericueta, M. G., Harfush-Meléndez, M., Páez-Osuna, F. 2000. Effects of ammonia on
mortality and feeding of postlarvae shrimp Litopenaeus vannamei. Bulletin of Environmental
Contamination and Toxicology, 65:98-103.

Furtado, P. S., Poersch, L. H., Wasielesky, W. 2011. Effect of calcium hydroxide, carbonate and
sodium bicarbonate on waterquality and zootechnical performance of shrimp Litopenaeus
vannamei reared in bio-flocs technology (BFT) systems. Aquaculture, 321:130–135.
Hargreaves, J. A. 2013. Biofloc Production Systems for Aquaculture.SRAC. 4503, 1-11.

Ray, J. A., Lewis, L. B., Browdy, L. C., Leffler, W. J. 2010. Suspended solids removal to improve
shrimp (Litopenaeusvannamei) production and an evaluation of a plant-based feed in minimal-
exchange, superintensive culture systems. Aquaculture, 299: 89-98.
Saraswathy, R., Muralidhar, M., Kailasam, M., Ravichandran P., Gupta B. P, Krishnani, K. K.,
Ponniah, A. G., Sundaray, J. K., Panigrahi, A., Nagavel, A. 2013.Effect of stocking density on
soil and water quality, nitrogen budget in Penaeus monodon culture under zero water
exchange system. Aquaculture Research, 44:1578-1588.
Zhao, P., Huang J., Wang X. H., Song, X. L., Yang, C. H., Zhang, X. G., Wang, G. C. 2012. The
application of bioflocs technology in high-intensive, zero exchange farming systems of
Marsupenaeus japonicus. Aquaculture, 354–355:97–106

63
 BMP FOR POND SOIL MANAGEMENT
M. Muralidhar, R. Saraswathy and A. Panigrahi

Email: [email protected]

A pond with good soil quality will produce more of healthier shrimp than a pond with poor quality.
Understanding of the soil properties helps in selecting a site for culture, and to decide the management
strategies to be followed in terms of liming, manuring, fertilization, water management etc. A satisfactory
pond soil is the one in which mineralization of organic matter takes place rapidly and nutrients are
absorbed, held and released slowly over a long period. Sandy clay, sandy clay loam and clay loam are
some of the textured names suitable for aquaculture. Soil organic matter is an important index of soil
fertility and also helps in prevention of seepage loss, increases arability of pond soil bottom and supplies
nutrients. The soil rich in CaCO3 content promotes biological productivity as it enhances the breakdown
of organic substances by bacteria creating more favourable oxygen and carbon reserves. Most of the
problems such as low organic matter content or excessive porosity can be avoided by proper management
practices during pond preparation.

Pond preparation
The main objectives of pond preparation are to provide the shrimp with a clean pond base and
appropriate stable water quality. In newly dug out ponds, Soil samples taken from different locations
of the pond are thoroughly mixed together and a representative portion has to be taken for analysis.
Soil deficiencies should be identified and treated in new ponds instead of waiting until poor bottom
soil quality develops later. In the ponds after harvest, drying, ploughing, and liming are required to
correct the pond soil conditions with regard to the accumulated nutrients and acidity. In high density
cultures, there is a possibility of the pond sediment becoming unusable during the next culture due to
high accumulation of nutrient loads. Disposal of such sediments outside will be an environmental
hazard.

In ponds with high sand content or desired to have high productions high stocking density like
biofloc culture, polythene lining is preferred. Monitoring of P.vannnamei(60 /m2) culture in low saline
(2 ppt) plastic lined ponds indicated optimum range of metabolites concentration (TAN - 0.02 to 1.05
ppm; Nitrite-N - 0.003 to 0.17 ppm) during culture period. Though only 60% survival was obtained
due to low salinity and minerals concentration (Calcium – 30 to 79 ppm and Magnesium – 51 to 72
ppm), production of 7 t/ha was achieved with FCR of 0.8.

Drying, liming and fertilisation

Removal of waste from the previous crop by draining and drying of the pond bottom after the
production cycle are some of the steps to be followed for keeping pond environment clean. The sludge
left in the pond, which might have had viral disease outbreak during the previous culture, may contain
high organic load, bacteria, viral particles and DNA as well as many other viral carriers. All these can
64
be removed by the application of burnt lime (CaO) @100 ppm, followed by exposure of the pond
bottom to sunlight for a minimum period of 21 days until it dries and cracks, removal of the top soil
and compacting the bottom soilto prevent the persistence of viral disease. Soil respiration measured in
a pond bottom increased drastically during first 3 days after drying. The optimum moisture content
for drying is 20%, but it might vary among soils from different ponds.
The reason for liming aquaculture ponds is to neutralize soil acidity and increase total alkalinity
and total hardness concentrations in water. This can enhance conditions for productivity of food
organisms and increase aquatic animal production. Either total alkalinity or soil pH may be used to
estimate the agricultural limestone dose. If both the values are not in agreement, use the variable that
gives the greatest agricultural limestone dose. Brackishwater ponds with total alkalinity below 60 mg
l-1, and any pond with soil pH below 7 usually will benefit from liming.
Application of organic fertilizers especially in newly developed ponds is advisable because it
serves as soil conditioner. The rate of application of organic manure in shrimp ponds ranges from 500
to 2000 kg/ha as a basal dose. Enhancement of nutrients using inorganic fertilisers is required in ponds
to increase the phytoplankton production.Decomposition of organic matterin harvest pond soil is slow
because pH usually is low and the amount of carbon relative to nitrogen (C:N ratio) is high. Urea can
be spread over pond bottom @ 200 to 400 kg ha-1 at the beginning of the fallow period to accelerate
decomposition. Sodium nitrate can be applied @ 20 to 40 g m-2 to wet soil to encourage organic matter
decomposition in wet areas. However, nitrate fertilizers are more expensive and are not recommended
where soils can be adequately dried.

Management of pond bottom during culture

All aquaculture pond bottoms become covered with sediment, and this sediment can be
considered as aquaculture pond soil. A core taken through the sediment and extending into the original
bottom soil is called a profile. Layers in the profile are known as horizons (Fig.1). For practical
purposes, the F and S horizons are most important in aquaculture because they exchange substances
with overlaying water to influence water quality.

65
Oxidized Layer
Aquaculture pond soil profile
The oxidized layer at the
sediment surface is highly beneficial
Water
and should be maintained throughout
P F
the shrimp culture. Anaerobic o
n
Flocculent layer
So
Oxidised (aerobic)
d Mixed Sediment
microorganisms are able to use S
layer S
S Reduced (anaerobic) SR
o
oxygen from nitrate, nitrite, iron and i
l
e
d
Mature stable
i M
sediment
manganese oxides, sulfate, and p
m
e
r n
o
carbon dioxide to decompose f
t MT T
i Transitional layer
organic matter, and release nitrogen l
e
PT
P
gas, ammonia, ferrous iron, Original undisturbed pond bottom

manganous manganese, hydrogen Pond soil profile showing different horizons

sulphide, and methane as metabolites. Some of these metabolites, and especially hydrogen sulfideand
nitrite, can enter the water and be potentially toxic to shrimp. It is extremely important to maintain the
oxidized layer at the sediment surface in shrimp culture ponds. Ponds should be managed to prevent
large accumulations of fresh organic matter at the soil surface, or in the upper few millimeters of
soil. If the rate of release of toxic metabolites into water exceeds the rate that metabolites that are
oxidized, equilibrium levels of metabolites in the water may be high enough to have detrimental effects
on culture animals.

Monitoring of soil parameters during culture period

During culture the carbonaceous matter, suspended solids, faecal matter and dead plankton etc.
settle at the pond bottom. Interactions between soil and water that influence water quality in ponds
must not be ignored, because poor soil condition in ponds can impair survival and growth of
aquaculture species. Major concerns in pond bottom soil management are low soil pH, high soil
organic matter, loss of the oxidized layer, and accumulation of soft sediment. In older ponds with
impaired soil quality, problems should be corrected and prevented from recurring. To understand the
condition of the pond bottom, the following parameters are to be monitored regularly.

Organic matter
The change in the bottom in terms of increasing organic load should be recorded regularly for
the management of the pond bottom.

Redox-potential
Anaerobic condition can be developed in pond, when input of organic matter exceeds the supply
of oxygen needed for decomposition of organic matter. This reducing condition can be measured as
the redox potential (Eh). Redox potential indicates whether the water or soil is in reduced (Eh with `-'
value) or oxidized (Eh with `+' ve value) condition. Reduced or anaerobic sediments may occur at the
pond bottom of heavily stocked pond with heavy organic load and poor water circulation. Chain

66
dragging once in fortnight improves the pond bottom condition by maintaining the oxidised layer.
However, it has to be started from the initial period of culture. Central drainage system, an ideal remedy
for the prevention of formation of highly reducing condition during the last phase of culture periodis
suggestedto remove organic waste periodically. Water circulation by water exchange, wind or aeration
helps to move water across mud surface and prevent the development of reduced condition. Bottom
should be smoothened and sloped to facilitate draining of organic waste and toxic substances. The
redox potential (Eh) of mud should not exceed -200 mV.

Aerobic and anaerobic reactions at

the pond bottom soil

On-farm measurement
67 of redox potential
 AERATION REQUIREMENTS IN BIO FLOC BASED
SHRIMP CULTURE SYSTEMS

M. Jayanthi and A. Panigrahi

Central Institute of Brackishwater Aquaculture

Adequate dissolved oxygen is a very important parameter for successful intensive aquaculture
as it affects the quality and quantity of growth. Artificial aeration is provided to increase the oxygen
concentration and also to remove the anoxic gases such as nitrogen and carbon dioxide. The higher
crop biomass and feeding rates of intensive shrimp culture systems require supplemental aeration
to maintain adequate dissolved oxygen levels (above 4 ppm). Farmers adopting high-density
culture are in constant fear of low DO instances and tend to use more aeration as there is no
available information on optimum aeration requirement at different stages of culture and different
stocking density. Too little aeration leads to a hypoxic condition in ponds resulting in mass
mortalities and more aeration results in excessive operating expenses and wastage of energy.
Shrimp die when DO concentrations fall below 1mg/L for more than few hours and also if DO level
goes below 4 mg/L for several hours, it will create severe stress on animals. Less than the optimum
levels of DO can lead to poor water quality, feed conversion ratios (FCR), reduced growth or
survival.

Aeration requirements for different density systems

Extensive /traditional systems do not need any artificial aeration as the DO in the pond or
waterbody is sufficient to meet the animal requirement. When the stocking density goes high, the
bottom layer of the pond water becomes hypoxic or anoxic especially at night hours due to higher
respiration rate and decomposition of accumulated organic matter

Aeration is the mechanism to maintain the aquatic animal free from oxygen deficiency stress
and helps to maintain water circulation. It is the mass transfer phenomena between air and water,
of which the variation of the oxygen concentration in the water as a function of time. Hypoxia or
low DO (less than 2.8 mg/L) can certainly threaten shrimp life. DO values higher than 5 mg/L
have been recommended in intensive culture practices. It has been reported that the lethal DO levels
ranged from 0.2 to 1.27 mg/L for several penaeid shrimps.

In high-density biofloc based farming, intensive turbulent mixing is very much essential for biofloc
systems as solids must be suspended in the water column at all times to make the system function.
Important requirement in the bio-floc system is to meet high oxygen demand. Typical aeration
requirements are 1 HP/300-350 kg shrimp biomass. The bio-floc system requires high
aeration/mixing with aerators, and blowers not only to provide DO and remove CO2 (70-90ppm)
but also to keep bio-floc in suspension and prevent the production of nitrogenous metabolites,
68
sulfides and organic acids. Also, direct an aspirator type aerator at the sludge pile to re-suspend it.
Optimum uninterrupted aeration is essential to maintain high DO whereas less turbulence will lead
to the production of hydrogen sulfide, methane, and ammonia and more turbulence will make it
difficult for shrimp to locate feed or can lead to pond dike aeration. Water respiration in indoor
biofloc systems is normally about 6 mg O2/L per hour. It is believed that aeration requirement of
1 HP of every 200-250 kg of biomass.

Aeration methods

There are three categories of aeration methods, viz., surface or mechanical aeration, diffused
aeration, and combined or turbine aeration method. Mechanical aerators such as paddle wheels,
vertical pumps, pump sprayers, propeller aspirator pumps, and diffuser air systems are widely used
because of better efficiency and convenience of operation. Stationary paddlewheel aerators are
commonly placed parallel to the dikes of the pond, creating a radial or elliptical water flow regime
with rapid water flow in the periphery and stagnant conditions in the center.

Estimation of aeration requirements

Estimating supplemental aeration needs to be done considering the biomass and the feeding
rate. Early attempts in L.vannamei ponds were based on Taiwanese rule of thumb” for intensive
P.monodon culture. This indicates that one horsepower of aeration per 650 kg of anticipated harvest
biomass. There is a real danger in basing the aeration rates on anticipated harvest mass.If higher
than the normal feed rates for given projected biomass is used, critically low oxygen levels can be
experienced.

Aeration requirements depend on the stocking density, feeding rate, and early morning
dissolved oxygen in shrimp ponds, and it is related as:

F/A = 28.83 – (4.31 ×DO)

where F = 5-day average feeding rate (kg/ha/day); A = aeration rate (hp x day/ha); DO = dawn
DO concentration (mg/L). These relationships will facilitate economic optimization based on
capital equipment expenses for electricity, seed, and feed. Supplemental aeration may be needed in
shrimp ponds at feed rates above 40-50 kg/ha. day. L.vannamei shrimp is cultured under intensive
culture, and it is column dwelling species, so the oxygen has to be distributed throughout the pond.

Aerators use in shrimp farms

Aeration with better oxygen transfer rate is very much essential to reduce the production cost
and maintain the good shrimp culture. The placement of aerators in the pond assumes greater
importance given the need to maintain proper water circulation for maintaining feed and biofloc in

69
suspension and also concentrate the waste in one place. While feed accounts for nearly 50-60% of
the total recurring cost, the electricity and diesel charge nearly take away 25 to 30% of the recurring
cost. The electrical power supply has become very erratic and costly. Diesel engines are commonly
used to run aerators that further add input cost.

Different types of paddle wheel aerators with custom made the design are widely used in
shrimp ponds with different length, capacity, No. of blades, source of power, and placement. In
some places, small farmers have changed the paddle wheel aerators to custom made one and
operated using the diesel engine due to non-availability of electricity. The efficiency and energy
consumed per kg of production using different types of aerators are either not known or not
evaluated to optimize the best design to produce maximum oxygen transfer rate with less energy.
Few other types of aerators such as injector types, diffuser types are also being tried by a few
farmers. Monitoring the efficiency of the aerators in farmer’s ponds will pave the way for optimum
design criteria that can deliver maximum oxygen transfer rate with less energy in another way with
a reduction in operation cost.

Oxygen demand and aeration requirement increase with culture period, but there is no system
adopted by the farmers to gradually increase the aeration hours. Operation costs demand the correct
calculations to optimize the type of management used and the region of culture. Estimation of
aeration requirement for each week of culture can bring substantial savings with electricity and
consequently production costs. The study from CIBA indicated that energy used per kg of shrimp
production varied widely and too little or much aeration is given in many ponds as no information
on exact aeration requirement is available for different stocking densities of different species and
pond conditions. In the shrimp farms, the hours of operation of aerators vary from farms, and there
is no standard procedure or mechanism adopted based on the biomass.

Different aerators in shrimp ponds

Paddlewheel aerators: Semi-intensive / intensive ponds are commonly aerated by placing the
paddle wheel aerators parallel to the pond dikes, creating a radial or elliptical water flow regime
with rapid water flow in the periphery and stagnant conditions in the center. Water is pumped into
the air by pushing into the air with the standard water transfer efficiency of 1.7 kg and consumes
the energy of 1HP /hr for 2PW aeration. Normally 1hp aeration is given for 300 to 400 kg of
biomass. The aeration requirement is more when the level of water exchange is reduced, which has
become common as a means to reduce the probability of pathogen transfer. Normally 2, 4 or 6
wheel aerators are used. Paddlewheel, long arm and spiral were three kinds of aerators found
adopted by the farmers. In some places, small farmers have changed the paddle wheel aerators to
custom made one and operated using the diesel engine due to non-availability of electricity.

70
 Custom made 7 wheel and 6 wheel PWA with diesel engine and modified car engine

Aero tubes Round flow pond aerator

Fig. 1Types of aerators

Different types of two, four, seven, eight wheels operated with 3 phase electric motor or
customized car engines (Diesel) were used in the farms. Motors for paddle wheel aerators usually
turn at 1750 rpm, but this speed is reduced so that the paddle wheel rotates at 70–120 rpm. There
is considerable variation in the design of the paddle wheel and in the mechanism for reducing the
speed of the motor output shaft. Many studies indicated the variation in aerator efficiency at varying
salinities.

Water circulation may cause soil erosion in intensive shrimp ponds unless banks are
protected. Aeration of marine shrimp ponds should be arranged in such a way as to sweep the feed
area of the pond. Each 1 kW of aeration will support an additional 500 kg shrimp production,
beyond a base of 2000 kg/ha that may survive by natural re-aeration Square ponds are easier to
manage because four paddlewheels can be arranged to wash out the corners.

71
Round flow pond aerator

This type of aeration devices can be used to increase oxygen levels during feeding. The
oxygen transfer efficiency was measured as 3 kg oxygen transfer the available capacity ranged
from 0.5 to 5 HP.

Injector type submersible aerator

Fig.2 Injector type aerator

This injectors are one of the best and most advanced aeration systems worldwide, and also
suitable for large ponds. They work with a for an endurance run produced, maintenance free,
adjustable, submerged (also seawater resistant), the motor in different power sizes (1.1-1.5 kW
(1.5-2.0 HP) 230 or 380 V/50 Hz). The rotating propeller (2800 r.p.m.) produces an adjustable
current, through which air is drawn from the surface and formed into fine evenly distributed
bubbles. The diffused air aerate from the bottom up, and the circulation created from the fine
bubbles displace the surrounding water, thus breaking up stratified water areas. This constant surge
forces the pond to turn over, bringing cooler bottom water to the surface, where it picks up
additional oxygen from the atmosphere. Therefore the dissolved oxygen is always as high as
possible. Depending on power and depth, the air flow rate is up to 35 m3/hour and the oxygen
introduction up to 3 kg/kw/h/. At an oxygen content of 6 mg O2/L at the beginning, one 1.0 HP unit
in use with air, introduce over 0.32 kg O2/h which is the oxygen demand for over 2600 kg (table
sized 250 g) trouts at a water temperature of 10 °C, for approx. 1000 kg at 20 °C or up to 3000 kg
of other species

Spiral aerator

The stackable type is also developed by assembling HDPE floats discretionally, and the metal frame
is avoided. It can be assembled according to local voltage and frequency. In aero tubes type, the air
is pushed into the water, and less power is consumed while operation. The standard oxygen transfer
efficiency is 3.7 kg. It is recommended to use with paddlewheel aerators.

72
 Fig. 3 Spike aerator in shrimp farms

The initial investment cost is more compared to PW aerators. This method gives supplemental
aeration in addition to PW aeration and currently being adopted in some shrimp farms and getting
popular. However, further validation of the data from different farms is needed to be done to arrive
at the exact energy saving from this method.

Blower and air tubes for biofloc

Blower and air tubes are used for aerating chambers in the biofloc system and also the ponds.
Compared to the other systems it is proved to be more economical. For e.g. 3HP blower can support
6 grids, for biofloc nursery. Bio floc shrimp culture systems are gaining importance for cost-
effective production where water is limited, or land is expensive. Aeration requirement in bio floc
based systems was analyzed based on the primary data collected from the biofloc based shrimp
culture ponds at Tamil Nadu and Andhra Pradesh. Air diffuser systems operated using air blowers
have been widely used in bio floc systems, whereas different types of surface aerators are used in
earthen ponds. Findings revealed that the aeration requirements in the biofloc system vary from
6.2-12 HP/m3 volume of water. Considering the high density per m3 of water, blower system is very
economical per kg of shrimp production.

Economic analysis

Fixed cost includes the initial investment cost, depreciation cost, maintenance cost, and bank
interest mainly for pond preparation and infrastructure development. Life of aerators can be taken
like five years. Variable cost comprises seed, feed, energy, labor, and other consumables. Net profit
73
or loss was arrived based on the difference between the total return and total cost per crop.
ROI = (Net Profit / Cost of Investment) x 100.

ROI, NPV, and IRR were calculated from the functions available in Microsoft Excel. NPV
and IRR values of shrimp culture using different aerators can indicate the variation in profit at
different salinities. NPV should be calculated based on the difference between the present value of
cash inflows and cash outflows over a period and indicated the profitability of aquaculture using
different aerators. IRR will help us to calculate the variation in profitability among different
aerators.

In summary, high-density culture systems like biofloc require efficient aeration mechanisms
for which standard aeration efficiency of the aerators at different environmental conditions should
be made available. Correct calculation of aeration requirement and energy use can give substantial
savings in the production cost.

74
NUTRITION AND FEEDING STRATEGY IN A BIOFLOC SYSTEM
J. Syama Dayal, K. Ambasankar, K. P. Kumaraguru Vasagam and A. Panigrahi

E.mail: [email protected]

Biofloc Technology (BFT) is an environmental friendly aquaculture system since in this

farming method nutrients could be continuously recycled and reused. This system is dominated by
heterotrophic (HS) microorganisms compared to traditional autotrophic (AS) microalgae. BFT is
beneficial by the use of minimum or zero water exchange. The HS has two major roles: (i) maintenance
of water quality, by the uptake of nitrogen compounds generating “in situ” microbial protein; and (ii)
nutrition, increasing culture feasibility by reducing feed conversion ratio and a decrease of feed costs.
The water quality of biofloc system is maintained by control of bacterial community over autotrophic
microorganisms which is achieved using a high carbon to nitrogen ratio (C:N). Nitrogenous by-
products can be easily taken up by heterotrophic bacteria in the presence of adequate quantities of
carbon. High carbon to nitrogen ratio (~15-20:1) is thus essential for optimum heterotrophic bacterial
growth, using this energy for maintenance (respiration, feeding, movement, digestion, etc) and also for
growth and for multiplication to produce new bacterial cells. High carbon quantities in water could
supersede the carbon assimilatory capacity of algae, there by contributing to bacteria growth. Aerobic
microorganisms are more efficient in converting feed to new cellular mass (40-60% of conversion
efficiency), rather than higher organisms which spend about 10-15% for increase in weight. Bacteria
and other microorganisms act as efficient “biochemical systems” to degrade and metabolize organic
residues. In other words, they recycle very efficiently nutrients in a form of organic and inorganic
matter (un-consumed and non-digested feed, metabolic residues and carbon sources applied as
fertilizers) into new microbial cells.
The particulate quantities of organic matter and other organisms in microbial food web are
potential food sources for aquatic animals like shrimp. The macro aggregates (biofloc) is a rich protein-
lipid natural source available “in situ” throughout the day. The BFT is formed in the water column
due to the complex interaction between organic nutrients, physical substrate and variety of
microorganisms such as plankton, free and attached bacteria, conglomerates of particulate organic
matter and also grazers, such as rotifers, flagellates and ciliates and protozoa and copepods. This
natural productivity plays an important role for recycling nutrients and maintaining the water quality
and providing nutrition to the candidate aquatic species like shrimp.

Biofloc as Nutrient
The consumption of biofloc by shrimp has demonstrated several benefits such as enhancement
of growth rate, reduction of FCR and thereby decreased feed costs. Growth improvement has been
attributed to nutritional components of both bacterial and algae. This biofloc nutrition will reduce up
to 30% of conventional feeding ration consumption in shrimp. The short-term feeding study using 15N-
nitrogen enrichment has demonstrated that bioflocs could contribute substantially to the nutrition
of L. vannamei. Moreover, the consumption of bioflocs can increase feed utilization efficiency by

75
recovery of some fraction of excreted nutrients and nitrogen retention from added feed by 7–13%.
Biofloc technology also helps in rationalizing the feeding rates. The results of feeding rates of (10%,
9.5%, 9.0%, 8.5%, and 8.0% body weight day-1 in biofloc system) were compared with control at 10%
feeding level but without biofloc indicated that 8% feeding rate performed on par with control.
In tilapia feed utilization is higher in BFT at a rate of 20% than conventional water-exchange
systems. These results of BFT have driven opportunities to use alternative diets. The feeds were
formulated with low nutritional densities especially for intensive biofloc systems. This has increased
the scope to reduce protein levels in the feeds and also to use alterative feed ingredients by replacing
different marine protein sources (i.e. fishmeal, squid meal, etc) leading “green” market opportunities.

In biofloc particles, protein, lipid and ash contents vary substantially (12 to 49, 0.5 to 12.5 and
13 to 46%, respectively. The same trend of wide variation also occurs with fatty acids (FA) profile.
Essential FA such as linoleic acid (C18:2 n-6 or LA), linolenic acid (C18:3 n-3 or ALA), arachidonic
acid (C20:4 n-6 or ARA), eicosapentanoic acid (C20:5 n-3 or EPA) and docosahexaenoic acid (C22:6
n-3 or DHA), as well as sum of n-3 and sum of n-6 differ considerably between 1.5 to 28.2, 0.04 to
3.3, 0.06 to 3.55, 0.05 to 0.5, 0.05 to 0.77, 0.4 to 4.4 and 2.0 to 27.0% of total FA. Type of carbon
source, freshwater or marine water and production of biofloc biomass (in bioreactors or culture tanks)
definitely influence the FA profile. Information is still scarce about how microorganisms profile and
its nutritional contents could impact shrimp growth.
The amino acid composition of the biofloc produced from different carbohydrate sources like
maida, wheat, gram flour, ragi, rice flour, corn flour, molasses and multigrain atta. The result revealed
higher level of essential amino acids in ragi, molasses and multigrain atta compared to other treatments.
The utilization of protein by the shrimp depends on the availability of essential amino acids in the diet.
Among them certain amino acids like arginine, methionine and lysine are limiting amino acids as they
are generally deficient in the diet. The biofloc samples from ragi, molasses and multigrain atta are
having higher arginine, methionine and lysine levels of 1.35, 1.12, 2.13; 1.32, 1.17, 1.66 and 1.25,
1.093, 1.663 per 100 g dry floc, respectively compared to other treatments and control. Because of
higher essential amino acids, the essential amino acid index is also better in biofloc reared with these
carbohydrate sources viz., ragi, molasses and multigrain atta.

76
Table: Amino acid composition (g/100g dry floc) of the biofloc produced with different carbon sources

C1- C2- C3- C4- C5- C6- C7- C8-

Maida Wheat Gram Ragi Rice Corn Molasses Multigrain
Flour flour flour Atta

Essential Amino acids

Arg 1.143 1.187 1.113 1.353 1.160 1.273 1.320 1.253

His 2.803 2.663 2.740 2.920 2.567 2.440 3.030 2.907

Ile 1.313 1.307 1.193 1.317 1.240 1.173 1.360 1.293

Leu 2.150 2.057 2.050 2.137 1.493 1.727 2.153 1.900

Lys 1.393 1.343 1.463 1.560 1.270 1.257 1.660 1.663

Met 1.007 0.967 1.077 1.127 0.903 0.863 1.170 1.093

Phe 1.547 1.860 1.717 1.803 1.647 1.507 1.773 1.790

Thr 1.653 1.750 1.730 1.870 1.850 1.750 1.810 1.850

Trp 0.290 0.290 0.290 0.330 0.280 0.323 0.367 0.350

Val 1.383 1.373 1.310 1.490 1.373 1.277 1.367 1.313

Non essential amino acids

Ala 2.677 2.560 2.227 2.267 2.450 2.430 2.287 2.277

Asp 2.863 2.493 2.433 2.553 2.673 2.327 2.367 2.373

Cys 0.417 0.393 0.437 0.453 0.370 0.517 0.457 0.477

Glu 3.277 3.617 3.663 3.407 3.060 3.367 3.433 3.600

Gly 2.183 2.443 2.303 2.150 2.820 3.383 3.463 3.427

Pro 1.290 1.293 1.270 1.287 1.367 1.437 1.290 1.313

Ser 1.350 1.550 1.253 1.383 1.483 1.383 1.440 1.360

Tyr 1.223 1.053 1.133 0.963 1.000 0.987 1.147 1.163

77
 Fig. 1. Essential Amino Acid Index (EAAI) of the biofloc produced from different carbon sources

Role of Biofloc on dietary protein levels in shrimp feeds

Dietary protein levels in the diets of whiteleg shrimp reared in clear seawater system has been
studied extensively. Typically commercial shrimp feed contain 38–42% of CP in Asian countries. On
the other hand, as far as we know, only few studies have investigated the optimum dietary protein level
for whiteleg shrimp reared in bioflocs system. These studies demonstrated the positive contribution of
bioflocs aggregates on the optimum dietary protein level in whiteleg shrimp. It was suggested to
substitute high protein (40%) with low-protein (30%) feed in the nursery phase. The other study
reported dietary protein level could be reduced to 25% without affecting the growth of juvenile
whiteleg shrimp reared in bioflocs system. The level of total suspended solids (TSS) also influences
the protein level in the diet. Recommended level of TSS was below 500 mg L−1 for shrimp culture.
The bioflocs tanks fed with high dietary CP (40%) than that of low CP (30%) had higher in
nitrite, nitrate and phosphate content and TAN content showed increasing pattern with the
corresponding increase in dietary protein level, since high-protein feed would have generated more
TAN than the low-protein feed ammonia oxidizing bacteria developed faster than nitrite oxidizing
bacteria. In the BFT, the formation of the bioflocs was likely to be linked with the direct assimilation
of dissolved nitrogenous matters (especially ammonia–nitrogen) from diets and shrimp excretions by
heterotrophic bacteria.

It was showed that juveniles of L. vannamei fed with 35% CP feed grew significantly better in
biofloc conditions as compared to clear-water conditions. The study performed in a heterotrophic-
based condition detected no significant difference in FCR when feeding L. vannamei 30% and 45%
CP diets. These results indicate, floc biomass might provide a complete source of cellular nutrition as
well as various bioactive compounds even at high density. Growth might be enhanced by continuous
consumption of “native protein”, protein source without previous treatment, which could possess a
“growth factor” similar to the one investigated in squid. Is well known that protein, peptides and amino
acids participate fully in synthesis of new membranes, somatic growth and immune function and
78
biofloc can potentially provide all such nutrients.

However, is already known that microorganisms in biofloc might partially replace protein
content in shrimp diets, although were not always the case. Recent studies determined how lowering
the protein content of diet would affect growth performance of shrimp reared in biofloc conditions. In
one of the study it was found that at least 10% of protein content in feed can be reduced when F.
paulensis postlarvae are cultured in BFT conditions. It was observed that shrimp fed with less than
25% crude protein under biofloc conditions performed similarly to shrimp raised under regular clear-
water intensive culture with a 37%-protein diet. The biofloc system also delivered better consistent
survival rates, especially at higher density. A low-protein biofloc meal-based pellet (25% CP) was
evaluated as a replacement of conventional high-protein fishmeal diet (40% CP) for L. vannamei under
biofloc conditions. The results showed that is possible to replace 1/3 part of a conventional diet by
alternative low-protein biofloc meal pellet without interfering survival and shrimp performance.
Our experimental results with graded levels of protein in a biofloc system have indicated that
the dietary protein level could be reduced to 32% without reduction of performance compared to 40%
dietary protein level.

Fig. 2. Role of Biofloc in replacing fishmeal in the feed

The major limiting factor for aquaculture growth will be the availability of fishmeal and fish
oil for aquafeed production in the years to come. Hence the fish nutritionists are trying to find
alternatives to the Fishmeal and fish oil. This inspired researchers to develop the biofloc technology,
which is also applicable to intensive and semi-intensive systems. With biofloc technology, where
nitrogenous waste generated by the cultivated organisms is converted into bacterial biomass
(containing protein), in situ feed production is stimulated through the addition of an external carbon
source. Although bioflocs show an adequate protein, lipid, carbohydrate and ash content for use as an
aquaculture feed, more research is needed on their amino acid and fatty acid composition. Now,

79
fishmeal and fish oil supply essential amino acids (such as lysine and methionine) that are deficient in
plant proteins and fatty acids (eicosapentanoic acid and docosahexanoic acid) not found in vegetable
oils. Although bioflocs meet nutritional standards to serve as a aquaculture feed in general, research
has shown that the capacity of the technique to control the water quality in the culture system and the
nutritional properties of the flocs are influenced by the type of carbon source used to produce the flocs.
Different organic carbon sources each stimulated specific bacteria, protozoa and algae, and hence
influenced the microbial composition and community organization of the bioflocs and thereby also
their nutritional properties. Feeding experiments revealed that besides these characteristics, the type of
carbon source also influenced the availability, palatability and digestibility for the cultured organisms.
However, further research should focus on the use of low-cost non-conventional agro-industrial
residues as carbon source and hence upgrade waste to nutritious feed. Different carbon sources will
stimulate the growth of the indigenous microbiota in another way and thus exert a distinctive effect on
water quality, in situ feed production and utilization of the flocs by the cultured organisms. In addition,
not only the carbon source, but also the indigenous microbiota present in the pond water will put forth
a characteristic effect that needs to be considered. An important factor here is to determine the role of
algae and their interaction with the bacteria in the bioflocs.
An interesting topic for further research could be the identification of micro-organisms
(bacteria and micro-algae) that are able to produce bioflocs with the desired nutritional properties and
a good ability to control the water quality. Such micro-organisms could be used as an inoculum for the
start-up of aquaculture systems with biofloc technology. All these findings and possible modus
operandi emphasize the need for further study of biofloc composition in order to achieve a desired
nutritional outcome, since different research groups have obtained different results in respect to biofloc
nutritional composition.

The BFT also helped in replacing fish meal up to 40% in shrimp diets. In addition efforts were
also made to use biofloc meal as the feed ingredient in shrimp feeds by replacing fish meal. In a trial
performed in clear-water conditions detected that fishmeal can be completely replace with soy protein
concentrate and biofloc meal (obtained from super-intensive shrimp farm effluent) in 38% CP diets
without adverse effects on L. vannamei performance. Moreover, observed that biofloc produced in
bioreactors using tilapia effluent and sugar as a growth media could offer an alternative protein source
to shrimp feeds. Microbial floc-based diets significantly outperformed control fishmeal-based diets in
terms of weight gain per week with no differences in survival.

Role of Biofoc on Broodstock Nutrition

The BFT has been successfully applied for grow-out, but the information little is known about
biofloc benefits on breeding. The nutritional problems of brood stock and biosecurity issues were
remain unresolved and alternatives should be evaluated for broodstock. Breeders raised in BFT limited
or zero water exchange system are nutritionally benefited by the natural productivity (biofloc)
available continuous in situ nutrition during the whole life-cycle. Biofloc in a form of rich-lipid-protein
80
source could be utilized for initial stages of broodstock’s gonads formation and ovary development.
The continuous availability of nutrients especially fatty acids which are not oxidized could promote
high nutrient storage in hepatopancreas, transferred to hemolymph and directed to ovary, resulting in
a better sexual tissue formation and reproduction activity. Furthermore, production of broodstock in
BFT could be located in small areas close to hatchery facilities, preventing spread of diseases caused
by shrimp transportation. In conventional systems breeders used to be raised in large ponds at low
density. However, risks associated with accumulation of organic matter, cyanobacteria blooms and
fluctuations of some water quality parameters (such as temperature, DO, pH and N-compounds)
remains high and could affect the shrimp health in outdoor facilities. Once the system is stable BFT
provides stabilized parameters of water quality when performed in indoor facilities such as
greenhouses, guaranteeing shrimp health.

81
 BIOFLOC MEAL COULD BE A SUSTAINABLE INGREDIENT IN
AQUA FEED
K. P. Kumaraguru Vasagam, K. Ambasankar, J. Syama Dayal and K. P. Sandeep
E-mail:[email protected]

Aquaculture is growing fast and contributes about 50% to the global total fish production, and
expected to grow at much faster rate to supply the increasing demand of fish for human consumption
(FAO, 2016). Fish culture involving formulated feed usage is increasing in geometric proportion, and
it is creating huge pressure on ingredient supply, especially fishmeal. Therefore, finding sustainable
alternate feed ingredients is the biggest challenge for the aqua nutritionist. We expect biofloc meal
could be a sustainable ingredient for future.

Significance of biofloc in shrimp and fish nutrition

Providing good water quality through biological processing involving consortium of bacteria
and microalgae (‘BIOFLOC”) and use of bioflocs as a fresh feed (in situ feeding) within the system is
considered to be a low cost sustainable feeding tactic, and is receiving popularity in farming of white
leg shrimp around the world. Biofloc is found to be a nutritionally rich and balanced with good amount
of protein, minerals and other micronutrients. More importantly, it is interesting to note that bioflocs
or its attached microorganisms could exert a positive effect on the digestive enzyme activity of shrimp
or fish. Bioflocs not only act as a feed, but also manages water quality with no any additional cost.
Even though bioflocs are known to be consumed a lot by the white leg shrimp as fresh feed, it may not
be consuming all the available biofloc biomass, and many will be will discarded during water
exchange. Furthermore, other cultured species of shrimp and fish are either physiologically or
anatomically restricted to show that much attraction towards consumption biofloc. In such situations,
most of the floc biomass will be thrown in to the receiving water body. Here there is an immense scope
for harvesting these nutrient dense feed particles with advent of various filtration and separation
technologies, and further processing it could add a potential feed ingredient to the aquafeed ingredient
basket.

Concept of biofloc formation and biofloc meal production as a sustainable approach

Feed is a major input in any shrimp farm and it never been completely utilized by the shrimp
for its growth. Naturally, complete utilization of feed consumed by any animal is impossible, and
shrimp is not an exception. Considering a global average of FCR 1.4, one can calculate that, to produce
1kg fresh shrimp (with 80% water) we need 1.4kg dry feed ( with 10% water). In equivalent figures of
dry matter, this will be like this; to produce 1 kg of dry shrimp biomass we need 6.3 kg of organic
matter. Eliminating shrimp biomass (1 kg), about 5.3 kg of organic matter is thrown as waste either on
the pond bottom or in to the nearby water body during water exchange. However, under existing
practices, even in zero water exchange systems, except the nutrients in the shrimp biomass, nothing is
recovered back. Instead, nutrients are simply thrown as sludge or along with the discharged water. The

82
concept of having biofloc to recycle both the organic and inorganic nutrients by utilizing the services
of microalgae and bacteria, and providing biofloc itself as a natural feed for the shrimps is a novel
concept, and it would be eco-friendly, cost-effective, and having a lot of potential for further
intensification by increasing the shrimp stocking density in a unit area provided. On the other hand,
shrimp being an aquatic animal which passes water through their gill lamellae for oxygen uptake from
water, sustaining plenty of suspended particles in the ambient water may lead to gill congestion (Xu et
al., 2012). Therefore, it is assumed that constant removal of flocculated biomass from the system would
be favourable for shrimp. Furthermore, it also makes space for fresh algal and bacterial cells to grow,
which in turn increase the productivity of the system. The removed suspended particles may be
concentrated, dewatered and dried to produce nutrient rich biofloc meal. This is not only a nutritious
meal, but also a sustainable ingredient from the aquaculture practice itself.

Biofloc and biofloc meal

Biofloc is a clumpy assemblage of microorganisms (bacteria, micro algae, cyanobacteria,
fungi, protozoans, micro-zooplanktons, etc.) with dead particulate organic matter suspended in the
water column of an intensively aerated or agitated aquaculture system. Research showed that, bacteria
and some microalgae produces exopolysaccharides (EPS) such as uronic or pyruvic acid (Shipin et al.
1999) under stressed condition. These polymers act as adhesives to aggregate the dispersed cells of
bacteria, microalgae and other particulate organic matter to form a clumpy mass called bioflocs
(Frølund et al. 1996). These dense flocculated assemblages will tend to settle down at the bottom of
rearing system.

Biofloc meal is nothing but a concentrated, dewatered and dried form of biofloc harvested from
the system. Harvesting biofloc would be a costly process, which may add cost to the product. It needs
to be simplified in an economical way. While the existing processes are scaled up to a larger scale, the
price can be significantly reduced. The drying can be either spray drying or drum drying. Spray drying
will preserve the nutritional value of the meal. Freeze-drying would be an option for keeping the
nutrients of the biofloc meal intact, and the meal can be used as ingredient in speciality feeds such as
brood stock and larval feeds.

Culturing and harvesting of Biofloc

Self-circulating out-door microcosm tanks were used for producing bioflocs. Bioflocs were produced
against various C:N ratios and presence of fish and shrimp. Radial flow settlers in combination with
filter meshes were used for harvesting the biofloc from the water. C:N ratios were adjusted using
formulated feed and jaggery.

83
 Fig 1.Self-circulating out-door microcosm tanks used for producing bioflocs

Fig 2.Harvesting of bioflocs using Fig 3. Green bioflocs viewed under

radial settler microscope

Nutritional value of biofloc meal

Since biofloc is formed of various groups of microorganisms and organic particulate matter by
recycling the dissolved nutrients from feed, naturally it will become nutrient dense material. Reported
protein and lipid content of biofloc collected from different culture conditions ranges from 25 to 50%
and 0.5 to 15% respectively (Khun et al., 2009). Bioflocs were found to be good source of nutrients

84
like protein, lipids, vitamins and micro nutrients. Bioflocs may also have potential to provide
exogenous enzymes to the cultured animal and some probiotic effects. There are differing judgment
about the adequacy of bioflocs to provide the limiting amino acids methionine and lysine.

Fig 4. Nutritional characteristics of the biofloc produced under varying C:N ratio

Fig 5. Biofloc meal

85
 Table 1. Mineral Profile of biofloc produced under different C:N ratio

Ca K Mg Na Fe Mn Zn

C:N 10 3.44 0.20 1.30 0.20 0.50 0.05 0.05

C:N 20 1.63 0.20 0.54 0.25 0.35 0.05 0.05

C:N 10 with shrimp 1.10 0.38 0.62 0.38 0.14 0.05 0.05

C:N 20 with shrimp 1.91 0.40 0.80 1.51 1.56 0.10 0.05

References
FAO. 2016. The State of World Fisheries and Aquaculture 2016. Contributing to food security and
nutrition for all. Rome. 200 pp.
Frølund B, Palmgren R, Keiding K, Nielsen PH (1996) Extraction of extracellular polymers from
activated sludge using a cation exchange resin. Water Res Oxf 30:1749. doi:10.1016/0043-
1354(95)00323-1

Kuhn, D.D., Boardman, G.D., Lawrence, A.L., Marsh, L., Flick, G.J., 2009. Microbial floc meals as a
replacement ingredient for fish meal and soybean protein in shrimp feed. Aquaculture 296, 51–
57.
Shipin O, Meiring P, Phaswana R, Kluever H (1999) Integrating ponds and activated sludge process
in the PETRO concept. Water Res 33:1767–1774. doi:10.1016/S0043-1354(98)00389-3
Xu, W.J., Pan, L.Q., Sun, X.H., Huang, J., 2012. Effects of bioflocs on water quality, and survival,
growth and digestive enzyme activities of Litopenaeus vannamei (Boone) in zero-water
exchange culture tanks.Aquaculture Research, http:// dx.doi.org/10.1111/j.1365-
2109.2012.03115.x.

86
CURRENT STATUS OF AQUA FEED INDUSTRY IN INDIA AND
CIBA’S INITIATIVE IN NEWER FEED TECHNOLOGIES
Ambasankar J. Syama Dayal, K. P Kumaraguru Vasagam, Sandeep K. P and P. Nila Rekha
E-mail : [email protected]

Aquaculture has emerged as one of the fastest growing food producing sector in the current
decade. It is estimated that global fish production would increase by 19% between 2014 and 2024
with the main driver being formulated feed. India ranks second in aquaculture production. Indian
aquaculture is mainly contributed by freshwater aquaculture while the brackishwater aquaculture
is poised for vertical and horizontal expansion during the years to come. The rapid expansion of
aquaculture has to be supported by the availability of cost effective sustainable technologies.
Aqua feeds in India have evolved commercially inlate 90’s for shrimp culture and then for
fishes. In the brackishwater aquaculture sector majority of the feed used is scientifically formulated
compounded feed produced by multinational / Indian company. There are some small players with
a capacity to produce 1 tonne per hour operating to cater to the need of local area/undertaking job
works for the nearby farmers. In the fresh water aqua feeds traditional feeding using farm made
feed comprising rice bran and locally available plant protein source is the predominant feeding
system where in about 80-85% of the potentiall is unexplored for manufactured feeds. The sinking
feed for carps and the extruded floating feeds for fish are making a steady and positive impact in
changing traditional feeding system with the focus on increasing the productivity on a sustainable
manner in the longer run.
Brackishwater aquaculture is synonymous with shrimp aquaculture in India and tiger shrimp,
Penaeus monodon is the main species cultured in the brackishwater till 2010. During the year 2011-
12, a total of 135778 MT of tiger shrimps were produced from an area of 115342. After the
introduction of the pacific white shrimp in 2009 there is steady and sharp increase in culture area
as well asproduction and Litopenaeus vannamei has become the main species cultured in
brackishwater. The growth of L.vannamei production has been stupendous. From a production of
about 18247 MT from 2930 ha in 2010-11, theL.vannamei production reached 353413 MT in 2014-
15 registering an increase of 1837% in production. The boom period for vannamei farming began
in the late 2011, when shrimp priceswere very good, and the positive trend continued till early to
2014. However, due to recurrent problem in diseases such as white spot virus and running mortality
syndrome there is a sudden decline production of farmed shrimp. This decreased production
coupled with spiraling hike in all input prices particularly the feed prices has made a significant
impact on the profitability of the shrimp farming. The cost of production of shrimp has increased
from Rs. 180 per kg of shrimp in the year 2010 to Rs. 280 per kg. This sharp increase in price is
mainly due to the steady increase in the cost of feed. The feed cost per kilo of shrimp produced
alone reached an all-time high of Rs. 135 per kg. This scenario resulted in considerable difficulties
87
for the small and medium scale farmers as they could not able to cope up with the double blow of
increased feed price and a drop in shrimp price.

This increase in price has not been commensurate with farm gate price offered to the farmer.
This has made serious dent in the profit margin and farmers started looking for ways and means to
reduce the cost of production of shrimp. The feed cost has been considered as one of the major
factor for the increased cost of production and the feed cost is mainly determined by its protein
content. In this context, it is pertinent to note that L. vannamei is an omnivorous scavenger and is
less aggressive and less carnivorous than P. monodon. The available research information on the
nutritional requirement of this species also indicates that it requires less protein than the tiger
shrimp. Further, it can also accommodate more plant protein sources in the diet than the tiger
shrimp. These inherent advantages should have resulted in availability of more cost effective feeds.
However, the analysis of actual scenario revealed an interesting picture. All the major feed
companies in India maintained their protein content for tiger shrimp in the range of 38-40% while
the crude protein content in vannamei feed was kept in the range of 34-36%. The average price of
shrimp feed for both the species during the period from 2010 to 2015 is given below.

Fig1. Average price of shrimp feed

During the year 2010, the cost of vannamei feed was Rs. 44 per kg against Rs. 66 per kg for
the tiger shrimp feed and the price difference between these two feeds was Rs 22 per kg. Even
though the nutrient contents were maintained uniformly over the years the price difference between
these feeds showed a consistent decrease. Currently, the cost of vannamei feed has reached its peak
at Rs.85per kg while the tiger shrimp feed costs about Rs. 98 per kg and the price difference
narrowed down to Rs. 13 per kg. This showed that the cost of vannamei feed available to the farmer
at present is high against its nutrient content and the feed cost has to be brought down to make the
vannamei farming more profitable and affordable by the shrimp farmer.
As per the available information, during 2014 a total of 1.25 million metric tons of aqua feed
has been produced in India comprising of about 600,000 tons of shrimp feed and 650,000 tons of
88
fish feed. Out of the total shrimp feed produced vannamei contributed about 80-85%. The total
shrimp feed is produced by the eight major feed mills and 30 small feedmills.

Availability of cost effective feed is the felt need of the farmers at present and they started
exploring the possibilities of producing their own feed inorder to reduce the cost of production.
Many bigfarmers and farmer’s group/cooperatives are contemplating to establish smaller feed mill
to produce feed for their own requirement. In addition they can also cater to the small farmers
located in their region with the availability of cost effective feed. This direct marketing channel
from the feed mill to the farmer would result in availability of cost effective feed. Central Institute
of Brackishwater Aquaculture (CIBA) has developed the indigenous shrimp feed technology and
helping them in such endeavors. During the year 2015, CIBA has entered into MOU for feed
technology transfer with four such entrepreneurs. Feed mill with a production capacity of 1-2 tons
per hour is being established in the state of Gujarat, Andhra Pradesh, Kerala and West Bengal in
India. There is a great scope for establishing many such feed mills in the coastal states of India.
This would result in availability of cost effective feed for small and medium farmer. Brackishwater
aquaculture technology is evolving with an array of new array of feed technologies and farming
system and the details are given below.

Indigenous Shrimp Feed Technology

CIBA has taken up research program on a mission mode approach and has made rapid strides
in the area of shrimp feed development. Knowledge on nutritional requirements of candidate
species is essential for the development of feed and hence to begin with the nutritional requirement
of the shrimp species viz., P. monodon and P. indicus have been extensively researched upon.
The feed technology was developed through formulation of several test feeds using indigenous
ingredients to meet the dietary requirements of tiger shrimp (P.monodon) and Indian white shrimp
(P.indicus). These test feeds were first evaluated in laboratory experiments and then in yard
experiments on three size groups namely 2-5g, 5-10g and 15-25g for developing three grades of
feed namely Starter, Grower and Finisher. The feed formulations which gave best growth and feed
conversion ratio (FCR) were selected for up-scaling. A pilot-scale Ring-Die pellet feed mill of
capacity 500kg per hour was set up at the Muttukkadu experimental station of CIBA. The pellet
mill was integrated with a hammer mill, micro-pulverizer, sieve assembly, ribbon mixer, steam
boiler and crumbler for completing the feed processing. All the machinery is of indigenous origin.

The multi locational demonstration of indigenous shrimp feed technology resulted in

commercialization of CIBA developed shrimp feed technology to the following firms.

• M/S Bismi Feeds (P) Ltd, Deencomplex, OSMNagar, Mayiladuthurai, Nagapattinam District,
Tamil Nadu

• M/S. Pisiculture care Unit, Village Madhubati, P.O. Kamarpukr, Hooghly District, West Bengal
The feed produced by M/S Bismi feeds using CIBA shrimp feed technology has

89
 gainedpopularityamong the farmers in Tamil Nadu and has become the sought after brand. The
feed produced using CIBA shrimp feed technology is being sold @ Rs 4-6 lower than the reputed
commercial brand shrimp feeds. The reduced cost of shrimp feed is due to the use of indigenous
raw materials and machineries.

Feed for vannamei: Vannamei Plus

CIBA has developed a cost effective grow out feed using indigenous ingredients. This feed
has been tested in a farmer pond at Gujarat and compared against the commonly used commercial
shrimp feed. The cost of the commercial feed available to the farmer was about Rs.78 per Kg while
the cost of feed (inclusive of cost of ingredients + processing and transportation cost) to the farmer
was Rs. 54 per kg. At the end of 117 days of culture the results showed that shrimps have attained
an average final body weight of 27.1g in the pond fed with CIBA feed while the control pond
shrimps have attained the final body weight of about 24.6g. The total quantity of shrimp harvested
was about 2017 kg in the CIBA feed fed pond while it was about 1913 kg in the control pond fed
with commercial feed. The FCR obtained was 1.68 with CIBA feed and 1.79 in the commercial
feed. Interestingly the feed cost to produce one kg shrimp was Rs.91withCIBA feed against Rs.140
in the commercial feed. This could be potential saving for the shrimp farmers and would pave the
way for considerable reduction in production cost with better profitability for small and medium
farmers. These results showed that the indigenous vannamei grow- out feed developed by CIBA
could be cost-effective and important substitute to bring down the cost of production and increase
the profitability of Indian shrimp farmers.

This feed technology has been commercialized to the following firms

1. Sai AquaFeeds

2. Poshak Bio Research PvtLtd

3. BTrevelations

4. M/S. M.KFeeds
5. Kavya Aquafarm

6. West land marine PvtLtd.

Specialty feeds
The nutritional requirement of shrimp varies depending on the environment in which it is
cultured. In India the shrimp farming is being practiced from low saline (1to5ppt) to high saline
conditions (35- 45ppt). Considering these specific dietary requirements for improving the growth
and FCR under high and low salinity, trials have been carried out and feeds for low and high saline
conditions have been developed. These feeds are ready for field testing and commercialization. The
other specialty feeds developed were to address stress and attractability. Under intensive / semi
intensive farming, shrimps are subjected to considerable stress which in turn affects the growth and
90
FCR. To address this, various stress busters have been explored and feed with specific additives to
mitigate the stress have been developed. Extensive research efforts on palatability and attractability
lead to the development of cost effective feed with good attractability and palatability.

Low protein and Low fish meal based feeds

Fish meal is the mainstay in shrimp feed and CIBA has initiated major research programme
on replacement of fishmeal with alternate protein sources with reasonable rate of success. This has
led to development of organic shrimp feed wherein, there restriction on the usage of fish meal and
fish oil. Similarly, there are exclusive feeds for feeding the shrimp under bioflc system. Since the
bioflc contributes considerable amount of micronutrients it is apt to reduce the protein content and
use more of plant protein based ingredients to meet the protein requirement. This would help in
reducing the cost of feed and will pave the way for sustainability.

Broodstoc Feed Etro brood Plus

Pearlspot is a popular aquarium and food fish, promoted as potential candidate for
brackishwater farming. Farmers produce pearlspot seeds in large ponds in traditional manner by
feeding the adults with commercial carp feeds and farm made feeds. Seed production with such a
low fecund fish in this manner is labour intensive, less productive and uneconomical. CIBA
developed a broodstock diet (Etro brood Plus) to provide specific nutrients vital for maturation and
spawning, and demonstrated for the first time that pearlspot can be made to spawn more than 4
times/year (average) in 1000 L tanks with an average fry yield > 2200/spawning. CIBA also
developed a larval feed and standardized a feeding strategy to rear the pearlspot larvae with
maximum survival and fast growth in the absence of parental care.

MILKFISH BROOD Plus and MULLET BROOD Plus

Institute has developed a unique formulation for Milkfish Broodstock using novel and
speciality ingredients and the feed has been found to be effective for Milkfish breeding and this has
been tested and validated. The feed developed is also being used for Milkfish Broodstock by Aditya
Fish Hatcheries under the Collaborative research cum technology transfer program.

Shrimp Larvi Plus : Shrimp Larval Feed

Development of inert diet for rearing shrimp larvae has been a challenging task. This is mainly
because, besides providing a balanced nutrition package in a tiny particle, which should be digested
and assimilated, the diet particles should be designed to keep them suspended in the rearing medium
so that the filter feeding larvae can utilize it. Live food organisms such as brine shrimp nauplii are
still indispensable for rearing shrimp larvae. Nevertheless, artificial diets are also supplemented to
overcome the uncertainties associated with mass production of live food organisms, their
nutritional imbalances and cost. Increasing costs of imported brine shrimp cyst have pushed the
cost of production of shrimp seed. With fluctuating international market for shrimp the farmers are
looking for reduction in input costs in shrimp production. Use of inert diet supplements for feeding
91
shrimp larvae would certainly reduce the cost of production of shrimp seed. Shrimp Larvi Plus has
been successfully developed for feeding the larvae and post larvae of shrimp. It has been tested in
vannamei larvae in commercial hatcheries and the technology is being commercialized with M/S.
MARITECH.

Seabass Plus : Feed for seabass

SeabassPlusisaformulatedpelletfeeddevelopedbyCIBAforthenurseryandgrow-outcultureof
Asian seabass, Lates calcariferand contains 40-50% protein. It meets the dietary requirements
ofAsian seabass for optimum growth with good feed efficiency. CIBA Seabass Plususes
indigenously available raw materials. The feed processing technology for different grades was
standardized in a Ring-Die pellet mill and also in a Twin-Screw Extruder at the Pilot-scale feed mill
of CIBA at Muttukadu. The feeds were systematically developed through formulation of several
feeds using selected indigenous feed ingredients and evaluation of the test feeds in laboratory and
yard trials and selecting the best performing formulation. Using the selected formulation, the feed
was processed into granules and pellets with indigenous feed mill and processing technology to
suit the growing stages of Asian seabass in nursery and grow-out systems. The feeds were
extensively tested in the institute facilities and also in selected farmers’ fields in different states
such as Andhra Pradesh, Maharastra and Tamil Nadu. CIBA Bhetki ahar resulted in excellent
growth and survival of fry in nursery and grow-out systems in these field trials. The fish was
successfully grown to 1 kg in 8-9 months with an impressive FCR of 1.5to1.8. It is believed that
the performance and cost effectiveness of this indigenous feed will go a long way in propagating
large scale farming of Asian seabass.
Seabass Larvi Plus : Feed for seabass larva developed and tested in commercial Hatcheries

Feed for Crab : Scylla Plus

Similar to the feed development programme of shrimp and fish considerable research has
been carried out in the development of feed for mudcrab. In this context feed for fattening and grow
out culture has been developed and field tested with highly encouraging results.

CIBA developed low cost indigenous automatic feeder for L. vannamei

Automatic feeders are more suitable for L. vannamei culture due to its feeding behaviour as it
is a column dweller and it needs continuous feeding. Entrepreneur farmers have imported automatic
feeders and it is costly. These prompted CIBA to design and develop a low cost feeder for the use
for small farmers. The design of an automatic feeder developed at CIBA consist of four major
components, a feed hopper, a mechanisms for feed distribution an electrical power supply/ solar
power and a control unit for operating (frequency and time of distribution). The hopper bottom
has been designed such that the angle of repose of the hopper bottom is greater than the angle of
repose of the materials for easy dispensing from the hopper. Motor unit was fixed with variable
speed regulator to control the dispensing of the feed. Two timers with digital display were set such

92
that the dispensing of the feed and the duration of feeding could be adjusted easily by the farmers.
This has been successfully demonstrated in the shrimp farm at Marakkanam, Tamil Nadu. The cost
is only Rs 15,000/- and it is easily operated and adjustable with digital display. The provision for
incorporation of solar energy using DC motor has been done. Trial demonstration showed that the
radius of dispersion is 26 m and quantity of feed can be adjusted as per the need.

Conclusion
The feed development programme at CIBA matched the pace and growth of aquaculture
industry. The research planning in the areas of aquaculture nutrition are in tandem with the priority
of the farming community and have lead to development of indigenous feed and processing
technology for brackishwater shrimp and fish. The successful commercialization of CIBA shrimp
feed technology and its presence in the market is the testimony to the strength of feed development
programme of this institute.

93
 BIOFLOC SHRIMP FARMING AND HEALTH MANAGEMENT
STRATEGIES
Subhendu Kumar Otta, Sudheer N. S. and Akshaya Panigrahi
E-mail: [email protected]

Shrimp aquaculture is a highly profitable export oriented industry that has undergone
tremendous changes before evolving to its present form. Particularly culture of Litopenaeus
vannamei has got wide acceptance in many parts of the world due to its several positive attributes
including its suitability for high intensity culture practice. Biofloc based culture of shrimp is a
recently developed practice where shrimps can be grown in high intensity without affecting the
environment. Rather, the animals grow faster and grown healthy through improved immune and
digestive system. Disease is an undesired factor that always threatens the success of an aquaculture
practice. Shrimp aquaculture throughout the world has witnessed several disease outbreaks and
economical losses due to existing and emerging pathogens. Particularly, the high intensity culture
practices are highly susceptible to different disease conditions and require special attention.

Uses of SPF stocks are highly desirable

Prevention is always better than cure. Inclusion of pathogens in a biofloc system should
completely b be avoided. Therefore, larvae from specific pathogen free brooders should be used as
a first step to avoid at least the known diseases. It will be possible to keep the culture environment
free from pathogens through the adoption of stringent biosecurity. Therefore, use of SPF larvae
will ensure a disease free condition for the harvest of a crop. At present it has been possible to
obtain SPF L. vannamei and therefore, it should be the preferred species for culture in biofloc based
culture system.

PCR testing of larvae for presence of pathogens is a healthy practice

Though SPF stock ensures disease free status, it will be still better to check the larvae for their
final status before stocking. This is more important when the brooders are reared in ponds in an
illegal way. Moreover, SPF status is only against a limited number of pathogens. Therefore, the
larvae should also get tested for the presence of some emergent pathogens like AHPND and EHP.

Inclusion of a nursery biofloc based system is essential

Larvae are more susceptible to pathogens due to their under developed immune system.
Particularly the initial 30-40 days of culture period is more important. Moreover, hatchery provides
the utmost suitable environmental parameters which suddenly changes in a pond and the larvae
undergo severe stress condition. Even some period during the beginning of biofloc development,
the flocks are not matured enough to provide immediate immunity. Therefore, inclusion of a
nursery phase will provide sufficient time period for the larvae to get acclimatized to the conditions
and develop their immune system to with stand the adverse pond environmental conditions. During

94
this period it will be still better to maintain the biofloc condition to make the larvae more healthier
and quick development of their immune system. These larvae when released in ponds find no
problem in getting quickly adjusted to the system and providing maximum possible survivability.

Maintenance of stringent biosecurity measures is a must

Though biofloc cultured animals are comparatively resistant, their underdeveloped
immunesystem (non-specific) is not suitable to challenge the highly virulent pathogens (such as
WSSV). Stringent biosecurity measures are therefore should be put in place to avoid any entry of
pathogens from the external sources. The initial water used for culture practice should be filtered
and treated sufficiently to ensure killing of all existing pathogens. The water then should get
matured by addition of beneficial microflora. Once the biofloc matures, then it will be possible to
maintain zero water exchange condition. Till that period sufficient care should be taken for the
treatment of the water. Ponds should be fenced properly to avoid the entry of unwanted animals
those are possible sources for disease spread. All the man, machine and material should be
sufficiently sanitised while moving from one pond to the other during sampling.

Efficient feed management can avoid most of the problems

Feed management is an important aspect in shrimp aquaculture practice. Particularly the
biofloc based system provides natural feed and in this feed management is more desirable. A
majority of the pelleted feed remain underutilised and these can provide nutrients to some of the
pathogens like acute hepatopancreatic necrosis disease (AHPND) Vibrio parahaemolyticus. This
also becomes a nutrient for many of the other bacteria, fungi and parasites. Regular check tray
observation and feed adjustment through periodical biomass determination by sampling can
provide clues for accurate feeduse.

Indiscriminate use of chemicals/materials should be avoided

Biofloc based culture system is more considered as a self-sufficient system where
augmentation of most of the shrimp requirements through natural microbiota takes place. It is
unnecessary to add any other materials, chemicals or antibiotics from the external source. The
beneficial microorganisms produced through the development of biofloc can act both as probiotics
and bioremediators. The indiscriminate use of antibiotics/chemicals will kill the beneficial
organisms alongwith the pathogens. Therefore these are undesirable in biofloc based system.

A central drainage system will be highly beneficial

Though biofloc system enables waste utilization, natural decay of floc and other materials
becomes undesirable. These material can support the growth of pathogenic microorganisms
particularly bacteria, fungi and parasites. Therefore, the pond should have a central drainage system
to pump out settled materials from the bottom. Periodically these waste materials should be taken
away through an efficient central drainage system.

Regular disease monitoring programme should be in place

95
 It is a healthy practice to periodically monitor the culture system for the presence of pathogens.
Random samples of both water and animals should be collected for testing. While the animals
should be tested for all possible known pathogens, the water sample should be tested for pathogenic
bacteria. Animals should also be regularly observed in the check tray. Ponds should be routinely
observed for any abnormal behaviour of animals. If any kind of disease is suspected, immediate
care should be taken to prevent it or confine and avoid the spread.

Conclusion
Biofloc based culture system has several advantages, particularly due to high yield. However,
this high intensity system also provides challenges specifically from disease point of view.
Pathogens like WSSV, AHPND and EHP can be highly dangerous and bring severe mortality or
growth retardation. Specific health management practices should therefore be adopted to avoid
unpleasant situation.

96
 EFFECT OF BIO-FLOCS ON THE SHRIMP IMMUNE SYSTEM
A. Panigrahi, C. Saranya, Vinay T. N., S. K. Otta and Ashok Kumar J

The bioflocs are consortium of particulate matter formed predominantly by a biota of aerobic
and heterotrophic bacteria, protozoa, microalgae, metazoan, exoskeletons, faeces and remains of
dead organisms. The diverse microbial community present in the biofloc system acts like natural
probiotics and stimulates the non specific immune activity. Immunological potential level of
biofloc reared animals were reported that the microbial cell components and their metabolites can
act as immunostimulant that enhances the shrimp innate immune system and provide improved
protection against pathogens. It has been already established that, bacteria and some microalgae
produces exopolysaccharides (EPS) such as uronic or pyruvic acid under stressed condition, and
these polymers are responsible for the adhesion and aggregation of dispersed cells of bacteria and
microalgae, called bioflocs.
Biofloc and periphyton-based complex microbial systems in shrimp and fish aquaculture
system without water exchange are found to be effective to maintain low levels of ammonia and
nitrite as these systems harbor a variety of beneficial probiotic and nitrifying microbial
communities. These microbial communities plays a major role which maintains stability and
control of microbial populations, maintain stable water quality parameters, eliminate the presence
of stressors like NH3-N, NO2-N, NO3-N, through degradation of waste organic matter .etc., not only
these provide a suitable environment and minimize water exchange and decrease the risk of disease
occurrence,but also improves the immunity resulting in high health, growth and survival of animals.

Basics of shrimp immunity

As shrimps lack adaptive immunity, they depend largely on the innate immunity, which
comprises of humoral and cellular immune activity. The innate immune system activity is based on
the pattern associated molecular patterns (PAMPs) and pathogen recognition receptor (PRPs). The
humoral immune system recognize the pathogen by prophenoloxidase cascade activation, clotting
factors activation, and by the activation of antimicrobial peptide, the cellular immunity includes
the activation of phagocytosis, nodule formation and encapsulation. Non-specific defense
mechanism of shrimps response to pathogen intrusion via pattern recognition proteins (PRP)
recognizes the conserved polysaccharides present in different probionts namely, β-1, 3-glucan (βG)
from yeast, lipopolysaccharide (LPS) from Gram- negative bacteria, and peptidoglycan (PG) from
Gram-positive bacteria and in turn trigger cellular and humoral responses. The major proteins that
function as PRPs in crustaceans are

(1) β-glucan binding or recognition protein (βGBP, βGRP)

(2) LPS and glucan binding protein (LGBP)
(3) Gram-negative binding or recognition proteins (GNBPs or GNRPs)
97
 (4) Peptidoglycan recognition protein or peptidoglycan-binding protein (PGRP or PGBP)

Fig. Immune mechasism involved during bacterial derived immunomodulations

It is known that the PRPs, like βGBP, LGBP and PGRP which recognize and respond to
microbial intruders, are involved in activating the innate defense mechanism especially the humoral
defense cascades in shrimp. These responses are nonspecific and target a broad range of bacterial
and fungal invaders. Crustacean haemocytes play important roles in the host immune response
including recognition, phagocytosis, melanization, cytotoxicity and cell to cell communication.
Classification of the haemocyte types in decapod crustaceans is based mainly on the presence of
cytoplasmic granules in the hyaline cells, semigranular cells, and granular cells. Each cell type is
active in defence reactions, for example, the hyaline cells are chiefly involved in phagocytosis, and
the semigranular cells are the cells active in encapsulation, while the granular cells participate in
storage and release of the prophenoloxidase (ProPO) system and cytotoxicity. The haematopoietic
tissue has been described in several crustacean decapod species and shown to be the haemocyte-
producing organ.

Shrimp immune modulation in biofloc system

Biofloc technology can be seen more as a mechanism, which provides shrimps a chance to
keep the immune system active at all times, as they get exposed to various microbes. Shrimps gut
is exposed to natural micro flora, which provides nutritional, immunological benefits, especially
on preventing the infection from the pathogen by competitive exclusion, neutralization of toxins
and bactericidal activity. The natural probiotic effect in biofloc provides antigen to trigger the
immune response ingut. Many reports suggest that wide range of beneficial microbes or there cell
wall components and matabolites is improving the innate immunity and can be employed in the
health management of fish and shellfishes. Biofloc is been proved that it is rich in natural source
for bioactive compound and microbes thus it is proved to be an efficient immune inducer in the
98
 shrimp. Biofloc increases the survival rate even when there in an infection.

Disease resistance
There is diversity of microbes present in the system which is both beneficial as well as
pathogenic to the cultured species and quorum sensing of the microbes that significantly elevates
the number in the system. This antagonism activity between the pathogen and other heterotrophic
bacteria limits the pathogen to multiply. Vibrio is an opportunistic bacterium, they may grow at
higher rate during initial culture period but as the biofloc water matures the system builds a strong
diverse environment against the pathogenic bacteria.

In our study a trial has been made to check the immunity of biofloc reared shrimps by
challenging them with the known pathogen V.parahemolyticus. The bacterial suspension for
challenge has been prepared as per the protocol and when ABW of 15-18g biofloc reared shrimps
were injected in tramuscularly and evaluated against normal saline injected shrimps as control. The
cumulative mortality was found to be significantly lower in the biofloc reared animals.

Fig 2. Cumulative mortality of P. vannamei shrimps challenged against V.

parahemolyticus.
Immune Gene Expression

Transcripts of target immune genes were measured by qPCR. Q-PCR results revealed
appreciably enhanced mRNA expression of certain genes when P. vannamei were cultured in a
biofloc system. Superoxide dismutase (SOD) is an enzyme which alternatively catalyzes
superoxide anions (O2−) to molecular oxygen (O2) and hydrogen peroxide (H2O2). It has diverse
pharmacological activities and also shown to play a crucial role in antioxidant protection.
Propheoloxidase activation is a major part of immune system in shrimp. The upregulation of this
gene indicates that the bacteria associated biofloc play the major role in enhanced immune activity
in the shrimps (Up regulation of immune genes in biofloc reared shrimps- hemocyanin-5.9 fold,
lysozyme 3.3 fold, - Serine proteinase-1.65 fold, Glutathione peroxidase,5.25 fold, SOD- 5.9 fold,
Prophenoloxidase-1.29)

99
Fig 3. Comparative mRNA expression levels of immune gene hemocyanin, lysozyme, serine
proteinase, Glutathione peroxidase, superoxide dismutase, prophenoloxidase in P. vannamei
reared in biofloc systems. A relative expression value of 1.0 indicates no change in response
to treatment.
A similar study revealed six genes that are involved in the innate immune response of shrimp
[proPO1 (prophenoloxidase 1), proPO2 (prophenoloxidase 2), PPAE (prophenoloxidase activating
enzyme), SP1 (serine protease), mas (masquerade-like serine proteinase), ran (ras-related nuclear)
through mRNA expression (Su-Kyoung Kim and In Kwon Jang, 2015)
Following attributes of bio-floc technology helps in prevention of diseases

• Bio-floc technology (BFT) systems were developed to minimize effluent discharge, protect the
surrounding water resources and improve farm biosecurity. Almost zero or minimal water
exchange is good for biosecurity and pathogen exclusion.
• Continuous aeration in the system mixes water thus avoiding stratifications and the stable water
creates better stress-free environment.
• Diverse beneficial bacterial community in the bio-floc can stimulate the non-specific immunity
and limit establishment of pathogenic strains
• The settled solid sand suspended solid waste in this system is recognized and is removed from
the bio-floc system thus preventing any risk of disease from the sludge.
• Priming of immune system of the host helps in immunomodulation and disease resistance in the
animals reared in this system

100
 Gene expression measured in mysis, postlarvae and adult P. vannamei was found to be
enhanced in the presence of bio-floc. Our studies suggest that microbes associated with bio-flocs
may enhance expression of certain immune-related genes.

Bio-flocs as biocontrol measure

The “natural probiotic” effect of bio-floc could act internally and/or externally against, Vibrio
sp. and ectoparasites. The regular addition of carbon in the water is known to select for polyhydroxy
alkanoates (PHA) accumulating bacteria which produces biodegradable polymer storage products,
like poly-ß-hydroxybutyrate (PHB), having antibacterial or biocontrol properties that provide
immunity to the host. Though bio-floc concept is yet to be practiced by many in India, probiotics
is an established business at present in Indian aquaculture.

Fig 4. Reduction of Vibrio load in variuos treatments

Probiotic interventions of L. rhamnosus and B. subtilis were found to be advantageous in terms
of better growth and survival rate and the expression of certain immune related genes in response
to microbal interventions were significantly up-regulated explaining the possible
immunomodulations and in turn better protection in fish (Panigrahi et al., 2007b; 2011). Beneficial
communities in biofloc system control the pathogenic Vibrio population (Crab et al., 2012).

Heterotrophs versus Pathogenic bacteria

There is diversity of microbes present in the system which is both beneficial as well as
pathogenic to the cultured species and quorum sensing of the microbes that significantly elevates
the value in the culture system. In Biofloc system, shrimps were constantly exposed to range of
microbes, while most of them are harmless to the shrimps but few species were pathogenic. Vibrio
is an opportunistic bacterium; which may grow at higher rate during initial culture period but as
the biofloc water ages the system builds a strong diverse environment against the pathogenic
bacteria. When the floc settle in the bottom and starts decomposes, it provides an opportunity for
pathogenic bacteria to increase in the system which may also create an issue in shrimp’s health.
Many investigations had already showed that these beneficial bacteria can be effectively used

101
against luminous Vibriosis.

Quorum sensing mechanism and its inhibition by Quorum quenching for control of pathogenic
bacteria
It has been proved that bacteria also highly interactive creatures, which exhibit complex
cooperative behavior like conjugal plasmid transfer, bio-film and virulence. Many of these
behaviours are regulated by quorum sensing. Among bacteria, each one is capable of producing a
signaling molecule (inducer) and each has a receptor too for the inducer. When the inducer binds
to the receptor, it activates the transcription of certain genes including those responsible for the
synthesis of the inducer itself. Once a threshold concentration is attained, activation of the receptor
leads to a signal transduction cascade to switch on specific genes in the bacterial cells, leading to a
coordinated population response. Through these QS, pathogens can increase their virulence and
bring mortality.

Development of quorum sensing inhibitors may potentially be useful in inhibiting the growth
or virulence mechanisms of bacteria in different environments during shrimp culture. Since
appearance of antibiotic-resistant bacteria is universal, there is an increasing need for novel
strategies to control infectious diseases like vibriosis. Bio-film bacteria (bacteria living in the bio-
film mode of growth) tolerate conventional antimicrobial treatments. Biofloc system contains many
of the naturally developing beneficial bacteria and algal components. All these organisms in
combination and the enzymes those they release can act as inhibitor for pathogenic bacteria like
Vibrios to bring higher survival.

Mechanisms of action of the beneficial bacteria

Beneficial bacteria in the biofoc system can act as Probiotics which then can act in different
ways and various mechanisms as proposed for the mode of action of probiotics that is given below.
• Antagonism (By affecting the balance between pathogenic and harmful microbes and beneficial
microbes)
• Competition for adhesion sites and nutrients with other microbes in the niches, for chemicals and
available energy

• Production of inhibitory compounds in host or in culture medium

• Probiotic bacteria can directly take up or decompose the organic matter or toxic material and
improve the quality of water by increasing DO, preventing off flavour, reduction of nitrogen &
phosphorous level, reducing blue green algae etc.

• Interaction with phytoplankton and improving natural productivity

• As a source of macro and micronutrients

102
• Enzymatic contribution to digestion - The microbial cultures produce a variety of enzymes like
amylase, protease, lipase, xylanase, and cellulase in higher concentrations compared to the
native bacteria
• Immunomodulation (Microbial products eliciting immune response at humoral, cellular and
molecular level) results in improving the animal’s over all health by possible exclusion of
pathogens from the production system, enhancement animal’s physical condition, appearance,
average size and weight of the animal and restoration of reduced appetite and feed consumption.
However, modes of action are sometimes circumstantial and based on empirical arguments.

Reference
Azad I. S., Panigrahi, A., Gopal, C., Paulpandi, S., Mahima, C., Ravichandran, P. 2005. Routes of
immunostimulation Vis-a vis survival and growth of Penaeus monodon (Fabricius) postlarvae.
Aquaculture, 248: 227-234.

Panigrahi, A.V., Kiron, S., Satoh, I., Hirono, T., Kobayashi, T., Aoki, J., Puangkaew, H., Sugita.
2007. Immunomodulation and expression of immune related genes in rainbow trout
Oncorhynchus mykiss fed probiotic-supplemented diets. Development and Comparative
Immunology, 31: 372-382.

Rengpipat, S., Phianphak, W., Piyatiratitivorkaul, S., Menasveta, P, 1998. Effects of probiotic
bacteriumin black tiger shrimp Penaeus monodon survival and growth. Aquaculture,
167:301–313.

103
 APPLICATIONS OF BIOFLOC TECHNOLOGY
Anil Ghanekar
Eco Secure Systems, Blue Line Aquafarms, Andhra Pradesh
As we trace the progress of aquaculture through the last 30 years we see that the
aquafarming is slowly but surely evolving from flow through, to water exchange, to zero exchange.
This trend towards zero exchange has been brought about by various factors, majorly, degradation
of water quality in natural waters due to increasing industrial and agricultural activities as well as
rapid urbanisation. Intensification of aquaculture gives rise to various pathogenic blooms in the
culture water, which when released without treatment, further contributes to biological pollution of
the natural waters. Hence water which was seen as a free resource has now become an expensive
commodity which needs to be treated and sterilized before and after use.

Why do we need to change water?

When we feed the aquatic animals with feed which has some protein content, the animals and
the feed wastes release ammonia in the water, this ammonia is toxic to the animals and can be lethal
if not controlled. There are various naturally occurring organisms which feed on ammonia and
utilise it for their growth and energy, amongst the most easily visible is algae which convert
ammonia into algal biomass by using the energy from the sunlight. For a long time aquaculture
systems have been run by controlling these algal blooms with limited water exchange. Algal blooms
being sunlight dependant go through a day and night cycle causing variable oxygen demand,
fluctuating pH etc. within every 24 hour cycle causing stress to the animals if not controlled. The
nitrogen conversion capacity of these algal systems is also limited to the surface area of the pond.

Zero Exchange Technologies

With the rising costs of both water and land there is a lot of pressure to produce more
fish/shrimp per unit of water and land. Bacteria based systems were found to be more efficient as
they are not limited to sunlight. There are two major bacteria based technologies available today,
one is Recirculating aquaculture system, which uses Autotrophic bacteria and the more recent is
Biofloc technology which uses Heterotrophic bacteria.

RAS requires a high capital expenditure because of external biofilters and other water
purifying equipment such as settlers, foam fractionators, Ultra violet, Ozone etc. These systems are
being used for more than 3 decades and most functions can now be automated. Biofloc is a new
technology which requires much less capital expenditure but higher and better trained management
input. Other advantages of this technology are lower feed requirement and better immunity. Due to
these advantages, this technology is becoming very popular and has many applications.

Hatchery application
In 2007 our trials with Scampi Zoea have shown more than 50% reduction of Artemia
104
consumption at double density of Zoea. Recently P.vannamei PL grown in Biofloc have shown
less size variation and have been tested proved to have better immunity as per challenge tests
conducted by CIBA.

Nursery application
Zero exchange high density nursery reared juveniles have been seen to have minimum size
variation and perform better due to better developed immune response systems. This is a very good
biosecurity tool for the farmers and a perfect transition phase between the Hatchery and Farm.
Nurseries should be located away from the farms to avoid exchanging pathogens from overlapping
crops.

Farm application
This is an excellent technology for getting a maximum production per cubic meter of water
and square meter of land, depending on the sludge removal and aeration capacity of the system 2
to 6 kg of shrimp or10 to 50kg of fish can be grown in these farming systems. Continuous
monitoring of DO and Floc levels is critical in these systems.

Brood stock maintenance

Brood stock maintained in zero exchange Biofloc systems have shown to have better fecundity
and fertilisation. Large numbers of animals can be maintained with minimum requirement of water
and space. The cost of Biosetcurity for these systems is much lower than other available systems.
Artemia biomass grown on Biofloc is an excellent feed for broodstock.

As a feed supplement
Biofloc biomass is a high protein live feed which can be produced separately and fed to
animalsin high density culture systems with very good results. Biofloc biomass can also be
incorporated into feed pellets or moist feeds for better growth and health of animals and reducing
the requirement of fish meal component in feed formulations.

Primary feed production

In the new Aqua-mimicry type of systems which promotes the growth of rotifers and
copepods, Biofloc in the form of heterotrophic blooms formed by addition of fermented rice bran
is the primary source of feed for these animals.

Effluent treatment
Biofloc technology can be used to treat waste water with very high ammonia load. This waste
ammonia can be converted to fertilizer of fish feed supplements by addition of carbon and oxygen.

105
 Overall, this new technology has enormous importance in many different applications. With
increasing efficiency in the use of Biofloc we will have more eco-friendly and less wasteful systems
to address the future of food security.

106
107
 ECOSYSTEM BASED BIOFLOC SHRIMP FARMING: NURSERY
REARING EXPERIENCES
A. Panigrahi, Shyne Anand P.S., Saranya C. and Biju I. F

Shrimp aquaculture is the economic face of Indian aquaculture and one of the fastest growing
food producing sectors. Indian shrimp industry had a phenomenal growth with the introduction of
exotic species Penaeus vannamei, reaching 5.66 lakh tonnes of production in 2017-18 and accounting
for 41 % of the quantity and 68 % in value (Rs. 30,880 crores) of total sea food exports (MPEDA,
2018). ICAR-Central Institute of Brackishwater Aquaculture, Chennai has been conducting Frontline
Demonstrations on Biofloc based Nursery rearing Technology for Pacific white shrimp Penaeus
vannamei in different parts of the country with support from the Department of Biotechnology, Govt.
of India. This innovative eco-based technology is a sustainable system in which the waste materials
are recycled into microbial flocs. This unique feature translates into better water quality and pond
environment. The microbial flocs thus formed are a source of protein for the shrimps, thus reducing
the feed cost.
The BFT based production system can be divided into nursery and grow-out farming system.
Each stage has its own important role for the success in production. In order to achieve higher survival
and reduction in the grow-out period, an intermediate nursery phase is essential. Nursery phase is
defined as an intermediate step between hatchery-reared early post larvae and grow-out phase and it
has several advantages suchas optimization of farm land, increase in survival and enhanced growth
performance in grow-out ponds. BFT has been applied successfully in nursery phase and grow out
phases in different shrimp species such as P. vannamei, P. monodon, F. paulensis, F. brasiliensis and
F. setiferus. CIBA has developed BFT and demonstrated the technology in the field with SOP
(Standard Operating Procedure).

Approaches of nursery rearing

There are two kinds of approaches for nursery rearing of penaied shrimps. The first approach is
conventional based nursery rearing in which early postlarvae is reared with pond or tank with stocking
density of 300 to 3000 nos/Cu. M. On the other hand, high tech nursery system with biofloc (BFT) and
recirculatory (RAS) system with 2000 to 20000 nos/Cu.m stocking and requiring more technical
control and expertise.

Advantages in nursery phase

 The primary advantage observed is related to a better nutrition by continuous consumption
of biofloc, which might positively influence grow-out performance as compensatory growth
phenomenon proved.
 Optimization of farm facilities provided by the high stocking densities in BFT nursery phase
seems to be an important advantage to achieve profitability in small farms, mainly in cold
regions or when farmers are operating indoor facilities.
108
  Study revealed that presence of bioflocs resulted in increase of 50% in weight and almost
80% in final biomass in Pink Shrimp, F. paulensis early post larval stage when compared to
conventional clear-water system.
 Another study on F. brasiliensis post larvae reared with or without pelletized feed in biofloc
conditions during 30-d of nursery phase, recorded 40% higher growth performance and
survival compared to conventional clear-water continuous exchangesystem.

 Immune systems of shrimps are improved in the biofloc system due to the bacterial
community, thus presenting a higher health status to the animals.

 It improves productivity, natural food, FCR, economic gain; and reduced costs (15-20%
lower cost of production).

 Heterotrophic bacteria reduce toxic metabolites (NH3-N, NO2-N) in the nursery rearing
phase.

Standard operating procedure for nursery rearing

SOP for nursery rearing includes nursery design and construction, bio-security, species
selection, stocking density, management practices, feed management, carbon addition strategy, water
quality management and sludge removal.

(I). Nursery design and construction

Pond can be either with concrete or HDPE lining work. Facilities for higher uninterrupted aeration
should be in the farm for aeration needs in the biofloc tanks. For this purpose, high pressure fine
diffuser or paddle wheel aerator can be used. In a biofloc system, frequent settling of sludge will be
there and periodic removal of it is necessary to maintain quality pond environment. This point should
be taken into account while constructing the pond. A central drain must be provided for the periodic
removal of the accumulated sludge.

(II). Biosecurity measures

Biosecurity measures should be placed to avoid any entry of pathogens from the external sources on
horizontal route. Proper fencing (Crab, bird fencing) sanitized equipments and/or machineries and
regularized personnel movement.

(III). Species selection and stocking density

Suitable species, which is appropriate for rearing, should be selected. Disease free certified seeds
(specific pathogen free) must be selected for rearing in the nursery. Post larvae of size 5-8 can be
selected for rearing in the nursery system. Stocking density of 10000/m 2 can be stocked into the
system for rearing.

109
(IV). Biofloc generation and maintenance
To generate the biofloc in the nursery rearing system as a first step the culture water is chlorinated
with bleaching powder, @20-30ppm active chlorine. Further fertilization is done with suitable
materials at 5-15ppm dose. Addition of biofloc consortium at a dose of 0.1-0.3gm/Cu.m; along with
addition of carbohydrate sources (Mollasses, rice bran, atta etc.) at a dose of 2-5ppm on daily basis.

(V). Feed management

The size and quantity of feed should be regularized from period to period during nursery phase with
addition of carbon source during the nursery phase. This calculation can be done depending upon the
accumulation of the TAN levels in the nursery system.

(VI). Water quality management (Zero/Minimal water exchange)

Regular monitoring of water quality is essential to rectify/adjust the accumulation of nitrogen
metabolites, floc level and other inputs in the nursery system.

(VII). Sludge management

Excessive and degraded floc increases the production of toxic gases like H 2S, which is highly toxic
to aquatic organisms, higher vibrio load at the pond bottom. Therefore, removal of sludge from the
pond bottom should be done in a routine basis.

Table 2: Nursery rearing performance with the biofloc inoculum supplied

by ICAR-CIBA

TRIAL 1 TRIAL 2

Species Penaeus vannamei Penaeus vannamei

Larval stage PL 7 PL 7

Stocking density 3000 PL/m3 3500 PL/m3

Growth 0.92 ± 0.15 g 0.91 ±0.15 g

Survival 94.20± 2.86 % 92 ± 2.3%

DOC 28-30 Days 28-32 Days

110
Fig: Floc density estimation in an Imhoff cone, Biofloc nursery rearing tank, Nursery reared shrimp
harvested.

111
 Table 2. Growth performance of shrimps in Biofloc based nursery rearing system

Production performance Control Biofloc based nursery

Stocking (Nos/m2) 5000 to 10000 5000 to 10000

Floc volume 0-2 ml 3-12 ml

Nursery rearing days 3-4 weeks 3-4 weeks

Survival (%) 55-80 % 78-92 %

Average body weight at harvest 220-350 mg 320-400 mg

FCR 0.95--1.15 0.65—0.89

Source, GAA, 2009

112
 INSIGHTS INTO THE BIOFLOC BASED SHRIMP GROW OUT
TECHNOLOGY
A. Panigrahi and T. Govind Raj

Biofloc based farming of shrimp is gaining momentum today. Although the principles of this
technology was previously applied to the growout of fishes like Tilapia, the present scenario shows
that it is suitable for shrimp famring also. This technology is being tested world wide for the
sustainable production of shrimp and is providing promising results. In a biofloc system the waste
materials in the pond (nitrogenous wastes) are converted into bacterial flocs which is high in protein.
By doing so the toxic gases like NH3, NO2 are removed from the system, which are otherwise
detrimental to the cultured organism. The bacterial flocs also forms as a feed material for the species
on culture, thus reducing the feed cost. Due to these advantages the biofloc based farming systems
are considered as sustainable and ecosystem based technology.

The major advantages of the biofloc system are reduced feed cost, maintenance of water quality
due to the action of the bacterial community, minimal water exchange etc. Apart from this, recent
studies shows that the shrimps reared in the biofloc system possess a better immune response. The
animals reared in the biofloc system have higher resistance to diseases and stress. Even though there
are lot of advantages for this system, the adoption level of this technology for commercial rearing
system is still in the infant stage. This may be due to the technological complexity and lack of
knowledge about the system. However, in the present scenario, this technology is been tested in
various levels at different locations and the results shows that it is possible to take a successful crop
provided the necessary requirements are met.

Shrimp growout in biofloc technology: Overview

 In biofloc culture conditions, the major advantage is the reduced feed usage. In recent studies, It
was estimated that more than 29% of the daily food intake of L. vannamei consisted of microbial
flocs, decreasing FCR and reducing costs in feed.

 A 120 days trial of L.vannamei with different stocking densities, 150, 300 and 450 shrimp /m2 had
a survival of 92, 81 and 75%, respectively. Moreover, study performed in a heterotrophic-based
condition detected no significant difference in FCR when feeding L. vannamei with 30 and 45%
CP diets and 39% and 43% CP diets, respectively in with and without floc system.

 It is noticed that glucose or a combination of glycerol plus Bacillus as a carbon source in bioreactors
led to higher biofloc protein content, higher n- 6 fatty acids. It is also documented that no significant
differences in growth performance of shrimps fed with 44% CP under BFT and clear-water
conditions.

 One of our studies conducted in ICAR-CIBA reveals the utility of reducing the protein in feed while

113
 customizing feed for BFT.

 In one of the trial in Malaysia, where different stocking densities of 40,60,80,100 and 130 nos/m2
was tried in a bio secured biofloc module of HDPE lined ponds and yielded a production level of
9.75 to 15.43 tonnes/ha/crop with FCR of 1.32 to 1.74 (Taw and Saleh, GAA 2013). Energy input
was found to be 355kg/hp to 643kg/hp.

 Biofloc based recirculatory aquaculture systems conducted at Ocean Institute at Hawaii by Moss
et al., (2006) recorded a productivity of 7.5 kg/m3 with an average body weight 24.7 g in a
stocking density of 300 nos/m3.

 When penaeid shrimps reared at 500 nos/m2 recorded a survival of 78-81% survival with a
production performance at 8.86-9.2 kg/m3(Samocha et al., 2007).

 Recirculatory Aquaculture System conducted at Texas A & M University by Samocha (2009)

recorded a final productivity of 9.37 kg/ m3 with an average body weight 22.36 g from a stocking
density at 450/m3.

 ICAR-CIBA static grow out system recorded a productivity of 5 kg/ m3 with an ABW 36-40g from
a stocking density of 200/m3.

 Growth performance of shrimps reared at biofloc based Hitide farms in TamilNadu recorded 39 g
average body weight with 19.78 t/ha/crop compared to 15.7 t/ha/crop with 31.68 g ABW at 60
days of culture.

Studies on the water quality parameters in the biofloc rearing system shows that the critical
water quality parameters were in the optimum level. The total suspended solids were in the higher
level due to the presence of the bacterial flocs. The major parameters like the ammonia nitrogen and
the nitrite nitrogen were in the acceptable limits.

Table: Water quality parameters of intensive race way based Biofloc shrimp farming
(Samocha et al., 2013)
Water quality parameters Mean (± S.D.)
Five-days biological oxygen demand (mg/L) 48.0 ± 16.9
Alkalinity (mg/L) 170.8 ± 17.7
Total suspended solids (mg/L) 292.4 ± 75.5
Settleable solids (mol/L) 12.2 ± 3.5
Volatile suspended solids (mg/L) 193.4 ± 38.6
Turbidity (NTU) 116.2 ± 42.1
Total ammonia nitrogen (mg/L 0.30 ± 0.14
Nitrite nitrogen (mg/L) 0.36 ± 0.29
Nitrate nitrogen (mg/L) 172.4 ± 91.7

114
 Table: Growth parameters of intensive race way based Biofloc shrimp farming
(Samocha et al., 2013)
Growth parameters Range
Stocking (shrimp/m3) 500
Stocking Weight (g) 3.6
Harvest Weight (g) 22.76
Weekly Growth (g) 2.13
Survival (%) 78-81
Yield (kg/m3) 8.86-9.2
FCR 1.5
Water Use (L/kg) 139-150

Studies on the growth parameters showed that that any given stocking density the final yield
was higher in the biofloc based rearing system than in the conventional shrimp farming system. The
mean bodyweight and the final harvest tonnage was also higher in the biofloc ponds. The higher
tonnage can be related to the higher stocking density in the biofloc system due to better water quality
in these systems. Feed conversion ratio was much lower in the biofloc based system suggesting the
intake of bacterial flocs and reduced feed usage. The survival rate did not differ much between the
conventional and biofloc

Table 4. Production Performance of Biofloc based HDPE lined shrimp farm in

Arc Biru Farm, Malasiya
Parameters Biolfoc 0.4 ha HDP Semi Biolfoc 0.8 ha Conven 0.8 ha
HDPE HDPE
No.of Ponds 2 19 19
PWA Energy (Hp) 14 24 20
Stocking density 130 110 83
DOC (days) 90 101 111
SR% 89.16 81.35 83.19
MBW (gr) 18.78 18.31 17.80
FCR 1.39 1.58 1.77
ADG(gr/day) 0.21 0.18 0.16
Avg Harvest tonnage 9006 12950 9616
Production (kg/ha) 22514 16188 12019

Table 5.Growth performance of shrimps reared in Grow- out system, Indonesia

Description Stock Density (Nos./m2)
660 130 200 130
115
 Initial MBW (g) 4.9 1.7 0.18 0.18

Harvest Biomass (kg) 374.0 151.0 183 187

Final MBW (g) 13.8 18.4 14.3 14.3

Survival rate (%) 66 88 89 100

Productivity (kg/Ha) 61,883 21,001 25,432 18,993

Table 6. Comparative growth performance of Biofloc grow out trails in recirculatory and
static system
Description Ocean Institute Texas A & M University ICAR-CIBA
Hawaii Moss (2006) Samocha (2009) Static system
Stocking Density 300/m3 450/m3 200/m3
FCR 1.49 1.52 1.52
Size 24.7 22.36 g 36 -40g
Production 7.5 kg/m3 9.37 kg/ m3 5 kg/ m3
System RAS RAS Static

In the present day scenario, intensive studies are going on the optimization of the biofloc system
and different models of the biofloc system are designed to maximize the yield and profit. In CIBA
we have used the static system and the production performance were on par with the RAS growout
systems in terms of average body weight and feed conversion ratio.

Table7. Economics of Biofloc and autotrophic based system

Biofloc Autotrophic Remarks
Production (MT) 22 MT/ha 21 M/ha Increase in production =
More profit
Growth (gms/day) 0.16 to 2.1 0.13 to 0.16 Large shrimp size
FCR 1.1 to 1.3 1.5 to 1.7 Lower FCR = lesser feed
cost. FCR 0.1 = 4% of feed
cost
Water exchange Zero water exchange Minimum or flow Energy saving in water
through pumping
Gross profit > 35% < 30% The more the profit the better
Production cost < 15-20 % than Standard autotrophic Less production cost= More
Autotrophic profit

116
 Feed mill – Less sale but more Normal sale Feed mill should include
production sustainable sale grain pellet for Biofloc with
which sustainable sales could
be secured

Table 8. Growth performance of shrimps reared at Hitide farm in Tamil Nadu, India

S.No Particulars Control Pond Biofloc Pond

1 Pond Area (ha) 0.5 0.12

2 Stocking Density (nos/m2) 60 60

3 Duration of crop (days) 149 160

4 ABW at final Harvest (g) 31.68 39.00

5 Yield (t/ha/crop) 15.73 19.78

6 Survival (%) 85 95

7 FCR 1.6 1.4

Source, Anand et al, 2015

A comparative study conducted by CIBA between a biofloc pond and a normal pond showed
better results in the biofloc pond. The average bodyweight was higher in the biofloc pond than in the
control pond. The survival rate was higher in the biofloc pond with better FCR, which was lower
than the control pond. These results shows that there is a definite positive effect of the bacterial flocs
on the growth of the shrimps.

Reference
Emerenciano M, Ballester ELC, Cavalli RO, Wasielesky W (2011) Effect of biofloc technology
(BFT) on the early postlarval stage of pink shrimp Farfantepenaeus paulensis: growth
performance, floc composition and salinity stress tolerance. Aquaculture International,
19:891- 901.
Cohen J, Samocha TM, Fox JM, Gandy RL, Lawrence AL (2005) Characterization of water
quality factors during intensive raceway production of juvenile L. vannamei using limited
discharge and biosecure management tools. Aquaculture Engineering , 32:425–442.
Arnold SJ, Coman FE, Jackson CJ, Groves SA (2009) High-intensity, zero waterexchange
production of juvenile tiger shrimp, Penaeus monodon: An evaluation of artificial substrates and
stocking density. Aquaculture 293:42-48.
117
Anand, T., Suryakumar, B., Nagoormeeran, M and Govindraj T, (2015). Biofloc technology in
shrimp culture systems- field experiments conducted at Hitide sea farms, IWASSSS’15,
TamilNadu Fisheries University and World Aquaculture Society – Asian Pacific Chapter –pp-
105
Emerenciano M, Ballester ELC, Cavalli RO, Wasielesky W (2012) Biofloc technology application
as a food source in a limited water exchange nursery system for pink shrimp Farfantepenaeus
brasiliensis (Latreille, 1817). Aquaculture Research 43:447-457.
Wasielesky W.Jr, Atwood H, Stokes A, Browdy CL (2006) Effect of natural production in a zero
exchange suspended microbial floc based super-intensive culture system for white shrimp
Litopenaeus vannamei. Aquaculture 258:396–403.
Krummenauer D, Peixoto S, Cavalli RO, Poersch LH, Wasielesky W (2011) Superintensive culture
of white shrimp, Litopenaeus vannamei, in a biofloc technology system in southern brazil at
different stocking densities. J. World Aquaculture. Society. 42: 726- 733.
Tzachi M. Samocha, André Braga Vita Magalhães, Bob Advent, Timothy C. Morris. 2013.
Ongoing Studies Advance Intensive Shrimp Culture In Zero-Exchange Biofloc Raceways.
Global Aquaclzulture Advocate.

118
 CONTROLLING AQUATIC PATHOGENS THROUGH BFT:
W.R.T LUMINESCENCE CAUSING VIBRIO HARVEYI
Kannappan S, Yuvaraj S and A. Panigraghi

Email: [email protected], 9677039103

Introduction
Aquaculture is a quickly growing protein rich food-producing sector, but its growth is not
without problems. During shrimp grow-out practices, considerable amounts of waste water effluent,
containing uneaten feed and faeces that release ammonia and nitrite, which is toxic for both fish and
shellfish (Crab et al. 2007). Conventional techniques used to overcome this problem are introduction
of photoautotrophic algae into the grow-out system and frequent water exchange etc (Crab et al. 2007).
These techniques, however, are lacking economical, technical, sustainable and practical competence.
A technique that overcomes these shortcomings is the bioflocs technology. By adding carbohydrates
into the shrimp culture system to increase the Carbon⁄Nitrogen ratio (micro-organisms tend to form
amorphous aggregates called bioflocs and can be used by fish and shrimp as an additional source of
protein (Azim & Little 2008; Kuhn et al. 2009). Bioflocs, more specifically control aquatic pathogen,
because infectious diseases burden the aquaculture industry. These diseases are considered to be the
industry’s single most important cause of mass mortalities and economic losses. While under certain
circumstances antibiotics and other chemical preservatives can provide a useful means of helping to
control some bacterial diseases, there are many problems associated with their use. Improper use of
chemical preservatives and antibiotics has resulted in the development and spread of (multiple)
antibiotic resistance (Defoirdt et al. 2007). As a consequence, there is an urgent need for alternative,
more sustainable control techniques.

Quorum sensing by Vibrio harveyi.

The Gram-negative bacterium Vibrio harveyi is reputed for causing mass mortalities in Penaeid
shrimp, although they can affect almost all types of aquatic animals, causing disease often referred to
as luminescent Vibriosis (Phuoc et al. 2009). Virulence of Vibrio species has been shown to be linked
to quorum sensing, bacterial cell–cell communication with small signal molecules (Defoirdt et al.
2008). Quorum sensing is a mechanism by which bacteria coordinate the expression of certain genes
in response to the presence or absence of small signal molecules (Defoirdt et al. 2008). Phenotypes
that were found to be controlled by quorum sensing in in vitro-grown luminescent Vibrios include
bioluminescence and the production of several virulence factors such as a type III secretion system,
extracellular toxin, metalloprotease, a siderophore and chitinase (Defoirdt et al. 2010). Moreover,
quorum sensing has been shown to regulate in vivo virulence of these bacteria towards different hosts
(Defoirdt et al. 2008). Because quorum sensing regulates the virulence of pathogenic bacteria, its
disruption has been proposed as a new anti-infective strategy for aquaculture (Defoirdt et al. 2004).
One hundred Vibrio strains were isolated from low saline water. Twenty six of them were identified

119
as V. harveyi, following various biochemical tests and by the presence of vhh gene. The expected size
was 234 bps.

Evaluation of AHL production and degradation.

The bacterial strain, Chromobacterium violaceum
(CV026) as AHL biosensor strain when streaked on
Tryptic soya agar. V. harveyi of AHL production was
streaked, next to CV026. If V. harveyi produces AHL
diffusible AHL will induce CV026 to purple pigment. It
was observed that V. harveyi produces AHL. When
marine Bacillus cereus was
streaked it did not produce AHL, hence no purple
pigment formed. It was found that twenty five (25) B.
cereus strains, proved to degrade AHL production.

Extraction of N-Acyl homoserine lactone (AHL) compounds (A1 molecules) from V. harveyi
One ml of V. harveyi was taken as an initial inoculum and added to 1000 ml of LB broth and
kept in a shaker incubator (100 rpm, 28˚C) for 24 h or until OD reached 1.80. Then, the whole inoculum
was aseptically transferred into a sterile centrifuge tubes and centrifuged at 10,000 rpm for 15 min and
cell pellets were discarded. The supernatant was filtered through 0.2 μm membrane filter to remove
the cell debris. Later, 600 ml of filtrate was mixed with 300 ml of ethyl acetate (2: 1 ratio) and shaker
incubated for 10 min. Then, the mixture was allowed to stand for 5 min in a separating funnel to get
two immiscible layers (organic layer and aqueous layer). The upper layer was organic layer and the
bottom layer was aqueous layer. The organic layer was collected in a sterile container and the
remaining aqueous layer was extracted twice as described above. The entire organic layer was pooled
and dried by Roto-vapour instrument with a help of vacuum at 30°C. The dried residues were dissolved
with 50% of acetonitrile and water, mixed thoroughly and stored at -20°C for further analysis using
LC-MS (Ty A Gould et al., 2006). AHL compound 3 - Oxo hexanoyl homoserine lactone (3-Oxo HSL)
was procured from sigma and used as reference standard.

120
Detection of AHL molecules using Liquid chromatography Mass Spectrometry (LC-MS)
LCMS was performed by “AB Sciex 3200 Q TRAP Linear Ion trap quadrupole” (Liquid
chromatography and Mass Spectrometry). The parameters were ion spray voltage of 5500 V, probe
temperature of 500°C, curtain gas of 25 units, Gas source of 1 of 40 units to 2 of 40 units, medium
units of CAD gas, De-clustering potential of 25 V, entrance potential of 6.50 V, collision energy
potential of 16.86 V and collision exit potential of 2V. Nitrogen was used as the collision gas. Multiple
reaction monitoring experiments were conducted using the same. The presence of N-acyl homoserine
lactones (AHL) compounds from the residues of crude extract and the standard “3-Oxo hexanoyl
homoserine lactone” were analyzed separately using Liquid chromatography and mass spectrometry
(LC-MS). Different peaks were detected and peaks corresponding to 214.4 m/z were identified as N-
(3-oxohexanoyl)-L-homoserine lactones in the sample. Different unknown peaks were also identified.

Extraction of Furanosyl borate diester compounds (A2 molecules)

V. harveyi was grown in Auto-induction medium (AI) (17.5gl NaCl, 12.3 g MgSo4), 2.0g L
Casomino acids, 1M KH2P04 (10 ml), 20 ml of 50 % glycerol and 0.1 M L-arginine, 10 ml/L) for 16
hr/30°C to the OD of 1.8. The inoculum was diluted to 5000 times in fresh A-2 medium to get
105cfu/ml. One ml of cell free sample was tested for the presence of AI-2, adding to 9 ml of 5000 times
diluted cells. This was thoroughly mixed and incubated at 30°C/140 rpm. The bio-luminescence was
measured once in 30 min for 12.5 hr by Luminometer. For positive control the reporter strain BB170
(Mutated strain that will respond only to AI-2 molecules) was used to measure the AI-2 molecules.
AI-2 production was observed as growth medium dependent. Media composition can greatly influence
the luminescence of BB 170 and the test Vibrio strain sample added as 10% of the total volume. The
presence of glucose in AB medium at 1.25 g/l could promote 7 times faster growth causing higher
response on BB170. It was found that the signal of the reporter strain was minimal between 5-5.5 hr
after inoculation and the interference from exogenous AI-2 of the reporter was less than 1 % of the
bioluminescence signal.

121
Microbial community in bio-flocs
Bacterial populations in biofloc are primarily responsible for water quality maintenance in
minimal or zero water exchange systems (intensive systems) viz., heterotrophic ammonia-assimilative
and chemoautotrophic nitrifying bacteria. The color changes from green to brown which takes place
as the culture progresses due to the transition from a mostly algal-dominant to a bacterial bio-floc-
dominant system. The number of bacteria in biofloc ponds can be between 106 and 109 /ml of floc plug
which contains between 10 and 30 mg dry matter making the pond a biotechnological industry.
Dominant bacterial species that are present in the bioflocs include Proteobacterium, Bacillus species
and Actinobacterium. Besides this, there are some other minor bacterial species such as Roseobacter
sp. and Cytophaga sp. (Zhao et al. 2012).

Effect of glycerol‐grown biofloc in controlling V. harveyi.

Glycerol–grown biofloc as carbon source were investigated for their antimicrobial and
antipathogenic properties against V. harveyi. The bioflocs and biofloc supernatants decreased quorum
sensing‐regulated bioluminescence of V. harveyi. Live bioflocs, significantly increased the survival
of gnotobiotic brine shrimp (Artemia franciscana) larvae challenged against V. harveyi. (Crab et al
2010). Biofloc can protect white leg shrimp from Vibrio parahaemolyticus bacterial infections.

Biofloc against the growth of other bacteria

Nutritionally, the floc biomass provides a complete source of nutrition as well as various
bioactive compounds that are useful for improving the overall welfare indicators of aquatic
organisms. Beneficial microbial bacterial floc and its derivative compounds such as organic acids,
poly-hydroxy acetate and polyhydroxy butyrate, could resist the growth of other pathogens, thus
serves as a natural probiotic and immunostimulant (Ahmad et al 2017)

Short chain fatty acids as antimicrobial agent.

It was observed that the regular addition of carbon to the culture is known to generate
polyhydroxyalkanoate (PHA) accumulating bacteria such as Alcaligenes eutrophus, Azotobacter
vinelandii, Pseudomonas oleovorans and others that synthesize PHA granules. These PHAs are
122
polymers of β-hydroxy short chain fatty acids and if degraded in the gut, they could have antibacterial
activity similar to short chain fatty acids (SCFAs) or organic acids. The working mechanism of SCFA
may be related to the reduction of pH, as well as their ability to dissociate the surrounding milieu
(Ricke et al 2003). Apart from inhibiting the growth of pathogenic bacteria by lowering the pH of
surrounding milieu, SCFA have also been shown to specifically down-regulate virulence factor
expression and positively influence the gut health of animals. SFA is known to inhibit the growth of
pathogenic bacteria and they also have been used in commercial diets of terrestrial animals to control
pathogens such as Salmonella and E. coli.

Effect of biofloc on the bacterial ecology and their development

BFT promotes higher densities of total culturable Vibrios in the shrimp culture environment.
The practice of increasing carbon: nitrogen ratio enhanced growth of heterotrophic bacterial species
present in the system. Vibrio sp. have long served as models for heterotrophic bacterial processes and
are known to efficiently utilized wide spectrum of carbohydrates present in the water (Takemura et al
2014). Most Vibrio spp. pathogenic to shrimp such as V. harveyi and V. parahaemolyticus form green
colonies when grown in TCBS agar while those that form yellow colonies were reported to have
beneficial effects. The low percentage of green Vibrio spp. in the water samples of BFT indicates that
the culture system promotes the dominance of yellow Vibrios in the rearing water of shrimp. Addition
of molasses could have promoted the proliferation of yellow Vibrios in BFT since Vibrio spp. utilizes
sucrose while the green ones do not (Rahman et al 2010). Also, a decreasing trend in the percentage
of green Vibrios in the BFT tanks was observed in the present study which suggests that there might
be a shift in the Vibrio species abundance within the system to favour the dominance of other species
that may have beneficial roles in the shrimp culture environment. The future of biofloc system is very
promissory because it can help to get high productions required to satisfy the growing human
population needs. Another advantage in the use of the biofloc system is the decline of the production
costs, this is not only beneficial for producers but it could allow the access of more people to this
source of animal protein, and improve of human being with scarce economic resources.

References
Ahmad I, Rani AMB, Verma AK, Maqsood M (2017) Biofloc technology: an emerging avenue in
aquatic animal healthcare and nutrition. Aquaculture International, 25 (3) 1215–1226.
Azim ME, Little DC (2008) The biofloc technology (BFT) in indoor tanks: water quality, biofloc
composition, and growth and welfare of Nile tilapia (Oreochromis niloticus). Aquaculture 283,
29 – 35.

Kuhn DD, Boardman GD, Lawrence AL, Marsh L and Flick GJ (2009) Microbial floc meals as a
replacement ingredient for fish meal and soybean protein in shrimp feed. Aquaculture 296, 51–
57.
Defoirdt T, Boon N, Sorgeloos P, Verstraete W & Bossier P (2007) Alternatives to antibiotics to

123
 control bacterial infections- luminescent Vibriosis in aquaculture as an example. Trends
Biotechnol 25, 472–479.

Defoirdt T, Ruwandeepika HAD, Karunasagar I, Boon N & Bossier, P. (2010) Quorum sensing
negatively regulates chitinase in Vibrio harveyi. Environ Microbiol Rep 2, 44–49

Defoirdt T, Boon N, Sorgeloos P, Verstraete W & Bossier P (2008) Quorum sensing and quorum
quenching in Vibrio harveyi: lessons learned from in vivo work. ISME J 2, 19–26.

Defoirdt T, Boon N, Bossier P & Verstraete W (2004) Disruption of bacterial quorum sensing: an
unexplored strategy to fight infections in aquaculture. Aquaculture 240, 69–88.

Phuoc LH, Corteel M, Thanh NC, Nauwynck H, Pensaert M, Alday-Sanz V, Van den Broeck W,
Sorgeloos P. et al. (2009) Effect of dose and challenge routes of Vibrio spp. On co-infection
with white syndrome virus in Penaeus vannamei. Aquaculture 290, 61– 68.
Crab R, Lambert A, Defoirdt T, Bossier P & Verstraete W (2010) The application of bioflocs
technology to protect brine shrimp (Artemia franciscana) from pathogenic Vibrio harveyi J.
Applied Microbiology. 109 (5) 1643 - 1649

Ahmad I, Babitha Rani AM, & Verma1 AK & Maqsood M (2017) Biofloc technology: an emerging
avenue in aquatic animal healthcare and nutrition. Aquacult Int 25:1215–1226

Michaud L, Blancheton JP, Bruni V & Piedrahita R (2006) Effect of particulate organic carbon on
heterotrophic bacterial populations and nitrification efficiency in biological filters.
Aquacultural Engineering. 34:224-233.
Rahman S, Khan SN, Naser MN & Karim MM (2010) Isolation of Vibrio spp. Frompenaeid shrimp
hatcheries and coastal waters of Cox’s Bazar, Bangladesh. Asian Journal of Experimental
Biological Science 1(2):288-293

Takemura AF, Chien DM, Polz MF (2014) Associations and dynamics of Vibrio naceae in the
environment, from the genus to the population level. Frontiers in Microbiology 5:1-26.

Zhao P, Huang J, Wang XH, Song XL, Yang C, Zhang XG & Wang GC (2012) The application of
bio-flocs technology in high-intensive, zero exchange farming systems of Marsupenaeus
japonicus. Aquaculture 354 - 355: 97–106

124
 ROLE OF MICROALGAE, ISOLATION AND IDENTIFICATION
IN BIOFLOC CULTURE SYSTEM
R. Aravind, K. P. Sandeep and A. Panigrahi

E mail: [email protected]

Introduction
Biofloc technology is considered as the new blue revolution in aquaculture sector. It is an
environmentally friendly aquaculture technique which promotes the retention of waste and its
conversion to biofloc as natural food for shrimp and some fishes in the aquaculture system. The
technology is applied to a variety of system types and is currently most commonly used for the culture
of shrimp and tilapia, although other taxa such as catfish are being explored. The defining features of
BFT systems include high animal stocking densities and restricted water exchange. Biofloc consists of
microorganisms such as heterotrophic bacteria, algae, fungi, ciliates, flagellates, rotifers, nematodes,
metazoans and detritus that conglomerate together and perform symbiotic processes to maintain the
water quality, maintain bio-security, support high density of shrimp culture and reduce water exchange
in the aquaculture system. Each floc is held together in a loose matrix of mucus that is secreted by
bacteria, bound by filamentous microorganisms, or held by electrostatic attraction. A substantial
portion of these organisms are contained on and within biofloc particles which can reach a diameter of
up to a few mm. These microorganisms are responsible for detoxifying waste products; primarily
nutrients excreted by culture animals, and have been shown to provide a repackaging of those nutrients
that is available for consumption by animals, thereby lowering feed costs. The biofloc community also
includes animals that are grazers of flocs, such as some zooplankton and nematodes. Large bioflocs
can be seen with the naked eye, but most are microscopic. Flocs in a typical green water biofloc system
are rather large, around 50 to 200 microns, and will settle easily in calm water.
By increasing the C/N ratio in the system, either through the addition of an external carbon
source or through using a feed with elevated carbon content, heterotrophic bacterial growth is
stimulated or nitrogen uptake through the production of microbial proteins takes place. Although
heterotrophic bacteria play the most important role in biofloc formation, the flocs also contain
microalgae and these might be important for the nutritional quality of the bioflocs, e.g. through the
production of vitamins and fatty acids. The properties of microalgal–bacterial flocs are studied and
found that sucrose as a carbon source resulted in good flocs settlement. Hence, it needs to be
established to what extent bacteria and microalgae are able to produce bioflocs with the desired
nutritional properties. Such microorganisms could be used as an inoculum for the start-up of
aquaculture systems with biofloc technology.

Role of microalgae in biofloc

Microalgae play an important key role in the dynamics of biofloc technology aquaculture
system. In any biofloc system exposed to sunlight, a dense algal bloom will develop in response to
125
nutrient loading from feeding. Nutrients released from decomposing organic matter are rapidly taken
up and stored in algae cells. The rate of algal uptake in biofloc systems is mainly influenced by
underwater light intensity. In biofloc systems with a primary dependence on algal uptake, extended
periods of cloudy weather can cause spikes of ammonia concentration. The accumulation of biofloc
solids shades out algae and limits ammonia uptake. Daily fluctuation in dissolved oxygen
concentration and pH, despite intensive aeration, is another characteristic of biofloc systems where
algal activity is predominant. Generally, at daily feeding rates less than 300 kg/ha (30 g/m2), algal
activity is the major factor controlling water quality.

The interaction between bacteria and microalgae involves different mechanisms, including the
production of growth stimulatory or inhibitory compounds, cross-signalling, and the ability of
microalgae to act as a vector for specific bacteria. It is expected that well-engineered combinations of
microalgae and bacteria might greatly enhance the productivity, efficiency and sustainability of
aquaculture. In order to optimally benefit from algae-bacteria interactions, it is important to select the
best consortia and thoroughly to investigate the different aspects involved because different
combinations of microalgae and bacteria will most probably exhibit different activities.In these
systems, a co-culture of heterotrophic bacteria and algae can be grown in flocs under controlled
conditions within the culture pond.

Phytoplankton species in biofloc

A diverse group of microalgae include bacillariophyceae, cyanophyceae, chlorophyceae and
dinophyceae will present in most of the biofloc culture systems. The commonly occurring species
include Navicula, Thalassiosira, Nitzschia, Amphora, Cymbella, Cyclotella, Cocsinodiscus,
Oscillatoria, Tetraselmis, and Chlorella etc. The biofloc can be modified with the inoculation of
desired microalgae. Microalgae with high nutrients composition can be inoculated to the system and
enrich the biofloc for better production. The digestion of microalgae (diatoms) by shrimps is studied
and it is found that the diatoms can be easily digested by shrimps.

Identification of microalgae in biofloc

Identification of the microscopic biofloc composition can help in better understanding the
application of biofloc. From the identification of each class of organisms’ function (phytoplankton as
primary producer, zooplankton as the algae grazer, bacteria and protozoa as organic matter
decomposer) that occurs in the zero water exchange culture system, the interaction happening between
the organisms in the biofloc system can be understood. The microalgal identification can be done by
using a standard research microscope. Morphological identification can be done with the help of
standard books in microalgal identification. The species level identification may be difficult by the
morphologically, so further identification can be done by molecular techniques after isolation of the
species.

Microalgal isolation techniques

126
 Often, the first step toward successful isolation is understanding and mimicking the naturally
occurring environmental conditions. For coastal marine algae, temperature and salinity are important,
and for oceanic (open ocean) phytoplankters, water quality and metal toxicity are additional concerns.
The second step toward successful isolation involves the elimination of contaminants, especially those
that can out compete the target species. Techniques of dilution, single-cell isolation by micropipette,
and agar streaking are widely used, among other methods. The final step requires continued growth
upon subculturing. It is not uncommon for the target species to grow in the initial stages of isolation
but then die after one or more transfers to fresh culture medium. This often indicates that the culture
medium is lacking a particular element or organic compound, which is not immediately manifested.
Unfortunately, when this is discovered, it is sometimes too late, because the original sample is gone
and the original isolates are dead. Alternatively, the organism may be accumulating wastes that poison
its environment, causing death. In nature, these wastes are diluted or metabolized by other organisms
(e.g., bacteria). Out of several methods of microalgal isolation; three important methods are explained
here: serial dilution, agar streak plating and manipulation.

Serial dilution
Using aseptic technique, dispense 9 ml of specified chemical media (eg f/2 medium) into each
of ten test tubes with sterile automatic dispenser or sterile 10 ml pipettes. Label tubes 10 -1 to 10-10
indicating the dilution factor. Aseptically add 1 ml of enriched/fresh sample to the first tube (10-1) and
mix gently. Take 1 ml of this dilution and add to the next tube (10-2), mix gently. Repeat this procedure
for the remaining tubes (10-3 to 10-10). Incubate test-tubes under controlled temperature and light
conditions. Temperature and photoperiod should be as close to the natural environment as possible.
Light intensity should be slightly lower than the natural environment.

Then examine cultures microscopically after 2-4 weeks by withdrawing a small sample
aseptically from each dilution tube. A unialgal culture may grow in one of the higher dilution tubes
e.g. 10-6 to 10-10. If the number of cells are more observed in test tubes, more dilution has to do till
geting pure culture. If tubes contain two or three different species methods like micromanipulation or
agar plate streaking can be used to obtain unialgal cultures.

Fig 1: Test tubes in serial dilution

127
Agar streak plating
This is a suitable method for small species (<10m) or algae that grow well on a substrate.
Prepare petri dishes containing growth medium solidified with 1-1.5% agar. The agar should be 1/2-
2/3 the depth of the dish. Place 1-2 drops of mixed phytoplankton sample near the periphery of the
agar. Sterilize a wire loop in flame. Use the sterile loop to make parallel streaks of the suspension on
the agar. Note that there are 16 streaks (4 sets of 4) to be made and the whole surface of the agar plate
is used. Cover and seal plate with parafilm. Invert and incubate under low light at constant temperature.
Select colonies that are free of other organisms for further isolation. Remove a sample using a
sterilized wire loop and place in a drop of sterile culture medium on a glass slide. Check
microscopically that the desired species has been isolated and is unialgal. Repeat the streaking
procedure with the algal cells from a single colony and again allow colonies to develop. This second
streaking reduces the possibility of bacterial contamination and of colonies containing more than one
algal species. Transfer selected colonies to liquid or agar medium.

Fig 2: Streak plating with wire loop

Micromanipulation
Micromanipulation is a powerful tool in microalgal isolation. It is usually performed with a
pasteur pipette or a glass capillary. A Pasteur pipette can be heated in a flame, extended, and broken.
With minimal practice, this technique becomes quick and easy, but the beginner must spend some time
practicing before reliable production of micropipettes is achieved. The pipette is held in one hand, and
a forceps held in the other hand supports the tip. The pipette is rotated to provide even softening as the
pipette warmsto the melting point. When the heated area is sufficiently soft, the pipette is removed
from the flame and simultaneously pulled to produce a thin tube. If drawn out too quickly, or if drawn
out in the flame, then the thin extension breaks or burns through, and the resulting product is
unsatisfactory. The goal of micropipette isolation is to pick up a cell from the sample, deposit the cell
without damage into a sterile droplet, pick up the cell again, and transfer it to a second sterile droplet.
This process is repeated until a single algal cell, free of all other protists, can be confidently placed
128
into culture medium. The process balances two factors: cell damage by excessive handling, which is
bad, and clean isolation of a single cell, which is good. For robust organisms, repeated handling can
be achieved without damage; however, for delicate organisms, cell damage is an important concern.

Fig 3: Micromanipulation technique

Phytoplankton Analysis
For quantitative and qualitative analysis of phytoplankton, the water sample collected in
1000ml plastic bottle. Lugol’s solution was added as preservatives especially for flagellate and ciliates.
It consists of 10g iodine and 20g of potassium iodide dissolved in 200ml of distilled water and 20g of
glacial acetic acid. The Lugol’s solution is added at the ratio of 1 part in 100 parts of seawater sample.
10ml of Lugol’s solution should be added for about 1000ml water sample,

Phytoplankton counting
Water samples were collected from estuary in 500ml bottle, add 2ml of Lugol’s solution for
preservation and allow settling for 24 hours. On the next day, 450ml of the water (upper layer) was
siphoning out carefully and remaining 50ml can be used for plankton counting. Pour 1ml of sample
into a Sedgewick raft counting chamber and counting can done by using microscope. There are 500
numbers of blocks in the Sedgewick raft counting chamber and 100 numbers of blocks can be select
for counting. Select 20 numbers of blocks from the four corner of Sedgewick raft and one from the
center portion in a zig-zag manner and count the number of plankton species individually. Total
number of species can be calculated as follows

Number of species in 100 blocks- X

For 500 blocks (1 ml) = 5X

For 50ml= 50* 5* X= 250X

1 2
20 blocks 20 blocks

129
 3
20 blocks

4 5
20 blocks 20 blocks

Zooplankton in biofloc
Biofloc act as nutrient retention trap in finfish and crustacean pond culture systems. The
composition of phyto and zooplankton of biofloc varies per biofloc maturity time. Zooplankton play a
key role in animal’s nutrition in culture and have proven benefit in growth rates, in food conversion
factor and reduction in costs associated to commercial food. Among the zooplanktons, rotifers,
nematodes, crustaceans and protozoans play an important role in nutrient recycle, improve water
quality and in nutrition of cultured animals. Proximal composition of zooplankton species such as
rotifer (54-60% of raw protein), cladocerans (50-68%) and copepod (70-71%), regarding lipid values
in rotifers (3.9 to 13.2%) depending on species, cladoceran (1-2.9%) and copepod (upto 2.6%) (Ray et
al., 2010)

The sample was collected by filtering the surface and sub-surface layer of water. The diameter
of mouth of net was 30cm and mesh size was 200 micrometer. The samples were fixed and preserved
by using 4-5% formaldehyde. The dilution is in the ratio of 1 part formalin and 9 part of fresh water
or seawater.

Speed of the boat (V) = 1.5 knot= 30 m/min

Duration of hauling (t) =1 minute

Distance of Hauling (d) = V* t= 30m

If a Plankton net of radius ‘r’ towed through the water horizontally, the volume of water passing
through it would be πr2d where d is the distance of tow
Volume of water passing through the water = πr2h= 2.121m3= 2121 litre

Zooplankton counting
Suppose 1000 litre of water get filtered through the plankton net and 20ml get collected in the
collection chamber. Pour 20ml into a plastic bottle and add 2ml of 4% formalin into it for long term
preservation. Pour 1ml of sample into a Sedgewick raft chamber and count the number of zooplankton
in 500 blocks (do it for 5 times for getting precise number of zooplankton).
Number of zooplankton in 5 ml of water= X
Number of zooplankton in 1 ml of water = X/5
Number of zooplankton in 20 ml of water= (X/5)* 20
130
i.e. (X/5)* 20 number of Zooplankton/1000 litre of water
i.e. (X/5)* 20 number of Zooplankton/m3 of water

i.e. (X/5)* 20* 100 number of Zooplankton/100m3 of water

Plankton species in biofloc

Diversity Indices
Species richness index (d)
Species richness is the measure of number of species in the sample.

Pielou Evenness Index (J1): 0-1

Note:- Value closed to 1 indicate more evenness ( For example; suppose there are 100 species
in a sample and it consist of 50 species of Coscinodiscus and 50 species of Nitzchia, then it is evenly
distributed and the index value will be closer to 1.
131
 If there are 100 species in a sample and it consist of 80 species of Coscinodiscus and 20species
of Nitzchia. Hence Coscinodiscus sp is dominating over Nitzchia and the index value may be 0.6.
Hence it is less evenly distributed compare to previous one.
If there are 100 species in a sample and it consist of 60 sp of Coscinodiscus and 40 sp of
Nitzchia, it is not evently distributed and Coscinodiscus is dominating over Nitzchia and the index
value may be 0.7. Hence it is more evenly distributed compare to previous one (80-20) and less
compare to first one (50-50).

Shannon’s diversity index (H1)

1- Indicate less diverse
1-3- indicate Moderate diverse

>3- indicate High biodiversity

Simpson diversity Index (1-λ) - 0-1

1 - Infinite diversity
0 - No diversity

~1- More diverse

~0 - Less diverse

Conclusion
A variety of beneficial features can be attributed to biofloc technology, from water quality
control to in situ feed production and some possible extra features. Biofloc technology offers
aquaculture a sustainable tool to simultaneously address its environmental, social and economic issues
concurrent with its growth. The basics of the technology is there, but its further development, fine-
tuning and implementation will need further research and development from the present and future
generation of researchers, farmers and consumers to make this technique a keystone of future
sustainable aquaculture. The exact manipulation of biofloc with potential microalgae will enhance the
production. For further development of biofloc technology in that line more research has to be done
for the interaction of microalgae with other components of biofloc and their influence in the system.

References
Andersen, R. A. and Kawachi, M., 2005.Traditional Microalgae Isolation Techniques (In: Algal
culturing techniques, Edited by Andersen R A) Elsevier Academic Press, pp 83-100.
FAO fisheries technical paper: 361, Manual on the Production and Use of Live Food for Aquaculture,
7-47.
Fatin M. I. Natrah., Peter Bossier., Patrick Sorgeloos., Fatimah Md. Yusoff.and Tom Defoirdt., 2013.
132
 Significance of microalgal–bacterial interactions for Aquaculture. Reviews in Aquaculture, 5:
1–14.

Jahn, M. T., Schmidt, K. and Mock, T., 2014. A novel cost effective and high-throughput isolation and
identification method for marine microalgae. Plant Methods, 10:26.

P. De Schryver, R. Crab, T. Defoirdt, N. Boon. and W. Verstraete., 2008. The basics of bio-flocs
technology: The added value for aquaculture. Aquaculture, 277: 125–137.

Slocombe, S. P., Zhang, Q. Y., Black, K. D., Day, J. G. and Stanley, M. S., 2013. Comparison of
screening methods for high-throughput determination of oil yields in micro-algal biofuel
strains. J Appl Phycol., 25:961-97.

133
 AQUAMIMICRY: AN INNOVATIVE ORGANIC APPROACH
A. Panigrahi, R. Aravind and Biju I. F.
B. Email: [email protected]

Introduction
Demand of environment friendly farming resulted in introduction of biofloc and biomimicry
kind of technology which is developed by supplementation of external carbon sources leading to
the colonization of microbial/microalgal population. This will convert the harmful sediments into
consumable nutrient source which reduce the toxic deposition and also considerably reduced the
need of water exchange. This is an ecofriendly farming followed in many places and successfully
resulting bio secured shrimp production. More recently organic shrimp farming is also a different
production strategy called as Aquamimicry, has received a great attention worldwide mainly because
of the growing market demand and high commercial value attained by the product. In general shrimp
farming is carried out by artificial or commercial feed management’s methods. Organic shrimp farming
has been applied successfully and effectively in shrimp farming. Organic shrimp farming is a rising
alternative modern method towards more ecofriendly aquaculture production system. This technology
was developed to create economical and environmental benefits via reduced artificial feed supply. This
technology may otherwise called as aquamimicry. It means the connection of aquatic biology and
technology mimicking the nature of aquatic ecosystems to create living organisms for the wellbeing
development of aquatic animals, which is believed to effectively provide a sustainable revival to
shrimp farming industry. Aquamimicry technology adopted to provide natural estuarine environment
by promoting and balancing the natural planktonic community’s growth.

Aquamimicry
Aquamimicry simulate natural pond condition by developing beneficial phyto and zooplankton
blooms as supplemental nutrition to the farmed shrimp and beneficial microbes to maintain water
quality using carbon source such as rice bran and wheat along with probiotics. Aquamimicry concept
is similar to biofloc technology but differing in the following ways;
(i) Reduced carbon sources (especially rice bran) addition and also its quantity not depend
on nitrogen ratio.
(ii) Also sedimentation of suspended bioflocs are frequently removed and reused for other
purposes like manure, animal feed etc.
With these alterations from biofloc, the culture environment preferably mimics natural
estuarine environment with balanced water quality by acquired planktons. So the use of feed and
also water exchange can be reduced. The carbon sources serves as a feed for planktonic growth
which served as feed for microbes and farmed shrimps. The main advantages of this technology is
1. More sustainable than conventional method

134
 2. Shrimp develops good immunity and health
3. Decreasing feed conversion ratio
4. Minimal water exchange is required
5. Chance of disease outbreak is reduced
6. Improve overall nutrition of farmed shrimp
7. Reduce stress to the animals and minimize favorable condition to harmful organism.

Feed used in organic shrimp production shall be produced from natural ingredients. The feed
management can reduce the feed conversion ratio and environmental problem. Feed for organic shrimp
production can be dived into two groups namely natural feed and commercial feed. Natural feed means
live animal s like zooplanktons, artemia and phytoplanktons in the water resources used for shrimp
farming. Shrimp do not feed directly on the phytoplankton. They feed on the small animals that eat the
phytoplankton or on bacteria that grow on the dead phytoplankton cells which accumulate on the
bottom. Zooplanktons are the natural food of the larval stages of many aquaculture commodities. They
are the animal component of plankton and are often referred as herbivores or grazers, feeding heavily
on phytoplankton. In aquaculture seed production, rotifers and cladocerans are the preferred prey of
fish and crustacean larvae due to their suitable size. There is a high chance of success in larval rearing
if there is a good correlation of prey size to the gape size of fish larvae. The culture of zooplankton is
considered as the second order of live food production in aquaculture systems. The success of a multi-
species hatchery mainly depends on the continuous availability of live food of high nutritional value.

Hands on method
Aquamimicry technology particularly aimed to promote the growth of copepods and most
suitable carbon source identified is rice bran fermented with suitable probiotic bact eria. The process
could be initiated by adding probiotic bacteria to grain rice bran and allowed to ferment 24 h.
Fermented rice bran at the rate of 500-1000 Kg / ha will be supplemented to the pond. This will
promoted the dominant growth of copepods within a week time and after that the post larvae will be
stocked (10-20 individuals/ m2). The fermented rice bran at the rate of 1 ppm will be added daily throughout
the culture cycle for the purpose of maintaining the zooplankton as a feed for especially during early stocking
and also for creating minor biofloc (< 25 mL/L as measured by an Imhoff cone). Later for feeding, fermented
soy bean meal will be used which completely reduced the feed cost. Additional development of biofloc
will be very much helpful to fulfill the nutritional requirement and thus reduced the feed cost.
(Chakravarty et al., 2018; Nicholas and Romano 2017; Romano and Kumar 2017)

Aquamimicry shrimp farming protocol

First Step: Pond preparation

 Fill the pond with filtered seawater using filter bag (200-300 µ)
 Add probiotics (Bacillus sp)

135
  Gentle dragging through the bottom of the pond for one week in earthen pond to enhance soil
mixing with added probiotics and minimize biofilm development (harmful to shrimp). In lined
pond, heavy rope can be used to prevent tearing of sheet.
 In order to remove unwanted aquatic weeds, tea seed cake can be applied at the rate of 20ppm
along with fermented rice bran or wheat bran (without husk) at 50-100ppm to develop
zooplankton blooms.
 Heavy aeration is must for proper mixing of nutrients and probiotics and reduces tea seed cake
level.

Second step: Application of carbon source

 Add rice bran/ wheat bran (without husk) mixed with water at a ratio of 1:5 to 1:10 and
probiotics under aeration for 24hr. If the bran is powdered completely, entire mixture can be
added slowly to the pond. If crumbled, upper layer of milk/juice added to the pond.
 pH of the incubation water should be 6-7

Third step: Stocking of Post larvae

 Post larvae can be stocked at a stocking density of 30-40 nos/m2 (Post larvae 12-15)
 Amount of ferment added depending on turbidity of water (30-40 cm) i.e. 1ppm for extensive
system and 2-4ppm for intensive system
 Analyze water quality parameters on daily basis
 Gentle dragging should be done in 15 days intervals after stocking to minimize biofilm
formation
 Additional probiotics should be added on every month during growout period to maintain
water quality and promote plankton growth
 In an intensive culture system, excess sediment should be removed using central drainage
system to sedimentation pond after 2hr of each feeding interval
 Sedimentation pond (Normally 4m deep at center and 2m at edges) can be stocked with fish
species such as milkfish and cat fish at low densities which can feed the plankton and detritus
provide alternate source of income to the farmers. Sediments from growout pond encourage
production of worms and can utilize by the animals.
 Water overflows from sedimentation ponds to another pond to increase retention time and act
as biofilter in which fish species like tilapia can be stocked at low densities. From here, water
can be overflows to grow out pond with little nitrogenous waste. Sedimentation should be
cleaned in every 3 year intervals.

Fourth step: Post harvest

After the harvest, pond is free from black soil, accumulated sediments due to regular removal of
sediments. Therefore pond is ready for next production cycle by addition of fermented rice bran and
probiotics.

136
 Fig 1. General layout of aquamimicry concept adopted in Thailand
A- Grow out pond with eight long arm paddle wheel;
B- Sump; C- Sedimentation pond; D-Biofilter pond

Aquamimicy- Adoption by an innovative farmer from Andhra Pradesh

Ganesh Mokkapati, a farmer from Vijayawada, Andhra Pradesh adopted aquamimicy based
shrimp farming with a stocking density of 40 PL/m2. Long arm aerators with plus shape design were
used to keep the pond bottom in aerobic conditions. Before starting new cycle, he analyzed soil pH,
ammoniacal and nitrate form of nitrogen and treated soil with good soil probiotics. Fermented rice
bran helped in developing good amount of zooplankton. Pond water treated with probiotics and
fermented rice bran turns the colour of the water to golden brown and maintains pH stable throughout
the culture period by adding 5-10 ppm fermented rice bran and also enhance the development of
planktons. Timely removal of sludge kept the bottom clean which prevent production of toxic gases
like ammonia, nitrite to the system. Alternate natural feed like fermented soya with fish sauce for two
meals and commercial pellet for two meals were applied to reduce cost of production. ICAR CIBA
helped the farmer from monitoring the water quality, estimation of greenhouse gases throughout the
culture period ensuring that the aquamimicry farming is environmentally sustainable. With a stocking
density of 40 nos/m2, the production obtained was 5.53 tons with a survival rate of 94%. The cost of
production is Rs 199/ Kg whereas the farm gate price was Rs 330/ Kg.

Conclusion
Aquamimicry is a revolutionary concept to effectively provide a sustainable rival to the shrimp
farming industry. It is an intersection of aquatic technology synergistically working together in
mimicking the nature of aquatic ecosystems to create live food organism for the well-being of aquatic
animals. Shrimp produced this technology are red in color when cooked, likely from the consumption
of natural foods that contain pigments (astaxanthin, amino acids and fatty acids, such as omega-3 fatty
acids) which will add the marketing value as like “Organic shrimp” (Romano and Kumar, 2017).
Organic marine shrimp farming means farm management practices for shrimp that introduces specific

137
requirement to an organic standard. They are based on the holistic agriculture management, ecofriendly
and sustaining biodiversity. All input materials shall be natural products, avoid using synthetic
products and any genetically modified organisms. In order to maintain the specific qualities of organic
status, this management shall be practiced throughout the production chain.

References
Chakravarty S, Kumar S and Prakash S (2018). Back to the Basics: Biomimicry in Shrimp Farming.
Int. J. Curr. Microbiol. App. Sci 7(5): 2172-2184
Romano N and Kumar V (2017). Vegetarian Shrimp: Pellet-free Shrimp Farming. World Aquaculture.

138
 ECONOMICS OF BIO FLOC BASED FARMING
T. Ravisankar, Akshya Panigrahi and Anil Ghanekar

E-mail: [email protected]
Biofloc technology
Biofloc technology became more and more popular with advent of farming of Pacific white
shrimp, Penaeus vannamei. The technology initiated by Yoram Avnimelech (2000) in Israel and
was initially implemented commercially in Belize by Belize. It also has been applied with success
in shrimp farming in Indonesia, Malaysia, Australia etc.
The combination of two technologies, partial harvesting and biofloc, has been studied in
northern Sumatra, Indonesia (Nyan Taw 2008 et. al). The system has been successfully
incorporated in bio secure modular culture system (Nyan Taw, 2011). With emerging viral
problems and rising costs for energy, biofloc technology appears to be an answer for sustainable
production at lower cost. The technology has applied also in super-intensive raceways to produce
more than 9 kg shrimp/ m3. The raceway applications have supported nursery and grow out to
shrimp brood stock rearing and selection of family lines.

In ICAR-CIBA, a number of studies using biofloc as a protein source in shrimp feeds were
conducted. In any aquaculture business as defined by economics-savings are also considered as
profit. Savings such as from feed, time, energy, stability and sustainability can be calculated as
profit.

Biofloc system
For optimized, sustainable commercial bio floc shrimp culture, high-density polyethylene- or
concrete-lined ponds are basic requirements. High stocking densities of 130-150 post larvae/m2
and high aeration rates of 28-32 hp/ha is also essential. Paddlewheel aerators are placed in ponds
to keep dissolved-oxygen levels high and guide sludge toward the central areas of ponds. The
sludge can then be siphoned out periodically when needed. The aerators help suspend the bioflocs
in the pond water – a main requirement for maximizing the potential of microbial processes in
shrimp culture ponds. The suspended biofloc is also readily available as feed for shrimp. Pelleted
grain and molasses are used to sustain carbon: nitrogen ratios above15.

Generally, incoming water is screened to prevent larval crustaceans (especially crabs) from
entering reservoirs and culture ponds. The most important factor is to make sure the screening,
chemical treatment and aging process are efficiently used before stocking ponds with shrimp. Only
specific pathogen-free post larvae should be stocked. Once ponds are stocked, a major factor to
control is biofloc volume. Biofloc volumes need to be maintained below 15 ml/L. Green or brown
water is acceptable, but black water is an indicator of abnormal conditions. Grain pellets and
molasses supply sources of carbon as needed. Generally, grain pellet applications vary from

139
15to20% of the total feed used during operations. Molasses can be applied two or three times.
Dissolved oxygen needs to be monitored as frequently as possible to keep levels higher than 4mg/L.
Especially in biofloc systems, aerators need to be constantly monitored for malfunctions and
repaired or replaced without delay.

In sum biofloc system can be summarised as:

 High stocking density - over 130 – 150 PL10/m2

 High aeration – 28 to 32 HP/haPWAs

 Paddle wheel position in ponds (control biofloc & sludge bysiphoning)

 Biofloc control at <15ml/L

 HDPE / Concrete lined ponds

 Grain(pellet)
 Carbohydrate

 8 C&N ratio >15

 Expected production 20–25 MT/ha/crop with 18-20 gms shrimp.

Culture performance
A comparison of the expected cost savings and culture performance of the biofloc system to a
traditional autotrophic system:
• Shrimp grow faster and yield a larger harvest in bioflocsystems.

• Feed conversion is better with biofloc, so feed costs are lower.

• Days of culture is reduced and hence more cycles can be taken

• Less water is exchanged with biofloc technology, less pumping costs and the pond systems
are more stable than in autotrophic culture. Greater output with bioflocs also improves
energyuse.
In addition to intensive fish and shrimp culture, biofloc technology has been applied in super-
intensive raceways to produce over 9 kg shrimp/ m3. The raceway applications have supported
nursery, growout and shrimp broodstock operations, as well as selection of family lines. Though
feed sales may reduce quantitatively it will be sustained in the long run

Economic perspectives
Since, biofloc technology option needs to be economically evaluated in farmers’ angle so that
the technology can be adopted and up scaled if it is economically advantageous over auto trophic
system. Data on costs and returns obtained from trials conducted by ICAR-CIBA are presented in
Table.1.

140
 It can be noted from the Table.1, the fixed input items are approximately Rs.2.72 lakhs. The
plastic items may need replacement after two years which is taken care in accounting for fixed
investments in a five year cash flow. The variable inputs cost about Rs.5.6 lakhs per cycle. Each
year optimally 6cycles can be taken in normal circumstances. Hence, year wise costs and returns
are calculated on assumption of 6 cycles per year.
The sensitivity analysis in Table.1 portrays the results of financial analyses of the production
data. Apart from normal, best and worst cases were created based on sale price of nursery grown
larvae and survival rate in percent, the two critical parameters in BFT. The IRR is the largest in best
case scenario of 90% survival and sale price of Rs.1/piece, which is not very difficult to achieve in
professionally manged hatcheries. Even in the worst case scenario of 80% survival and sale price
of Rs.0.90/piece,the entrepreneur will get an IRR of 39% which is reasonable.

141
 Table. 1 Cost of production of Nursery grown shrimp seeds under biofloc culture technology

S.No Costs (Rs.) Year 0 I cycle Year 1 (6 Year 2 Year 3 Year 4 Year 5
cycles)

A Fixed Cost

1 100 ton lined nursery pond with central drainage 80000 36000

2 Aerator and Aeration system 30000 13500

3 Lab for water quality, microbiology + DO meter 20000 9000

4 Biosecurity nets and fixers 25000 25000

5 Nets , Pipes etc + drain pit 25000 25000

6 Plastic item(Mug, Feeding tray, Basket) 12000 12000

7 Storage room, blower room, staff quarters, Wash room, OHT 50000

8 Generator, cabling, lighting, pumps 20000 6000

9 Kitchen and mess 10000

Total Fixed cost 272000 126500

B Operational cost

142
(I) Seed @ 0.40 Rs/per seed (Including transportation) SD @ 7000 280000 1680000 1680000 1680000 1680000 1680000
nos/cu m

(II) Seed testing x 3 times 9000 54000 54000 54000 54000 54000

(IIi) Disinfectant (Bleaching, NAOH) 4000 24000 24000 24000 24000 24000

(IV) Feed @ FCR 0.8 (150 kg @100/-) 15000 90000 90000 90000 90000 90000

(V) Carbon source-900 @ 25/- 22500 135000 135000 135000 135000 135000

(VII) Mineral and Other supplements 8000 48000 48000 48000 48000 48000

(V) Diesel @ 54 Rs/1 lit./Power for Water pumping 7425 44550 44550 44550 44550 44550

Labour Cost 24 hour duty 6 labour per 4 tank x 15,000 Rs incl food 45000 270000 270000 270000 270000 270000
stay incentive

Technician 2 x30,000 incl food incentive etc 30000 180000 180000 180000 180000 180000

Management cost incl. seed selection, accounts, purchace, Training, 15000 90000 90000 90000 90000 90000
sales, travel

143
 Table.2 Profit of production of Nursery grown shrimp seeds under biofloc culture technology

S.No Costs in Year 0 I cycle Year 1 (6 Year 2 Year 3 Year 4 Year 5

Rs. cycles)

Labour during stocking , harvest and transportation plus ice, oxygen etc 7500 45000 45000 45000 45000 45000

Testing Costs 3000 18000 18000 18000 18000 18000

EMI Principal+ Interest@14% for 7 lakh loan (fixed and 1 cycle VC) 76514 229542 229542 229542 153028

Variable costs 443425 2755064 2908092 3034592 2908092 2831578

Total Cost A+B 272000 443425

Revenue 560000

Normal Gross Returns Nursery grown shrimp seed sold @ 1.00 per piece 0 560000 3360000 3360000 3360000 3360000 3360000
(SR 80%)

Total expenditure Expected per annum 6 cycles 272000 443425 2755064 2908092 3034592 2908092 2831578

Net profit /Profit (D-C) -272000 116575 604936 451908 325408 451908 528422

B/C Ratio 1.263 1.220 1.155 1.107 1.155 1.187

Rate of Return 111%

Sensitivity analysis for Price and Production changes

144
Best Gross Returns Nursery grown shrimp seed sold @ 1.00 per piece 0 630000 3780000 3780000 3780000 3780000 3780000
(SR 90%)

Total expenditure Expected per annum 6 cycles 0 443425 2755064 2908092 3034592 2908092 2831578

Net profit /Profit (D-C) -272000 186575 1024936 871908 745408 871908 948422

B/C Ratio 1.421 1.372 1.300 1.246 1.300 1.335

Rate of Return 172%

Worst Gross Returns Nursery grown shrimp seed sold @ 0.90 per piece 0 504000 3024000 3024000 3024000 3024000 3024000
(SR 80%)

Total expenditure Expected per annum 6 cycles 0 443425 2755064 2908092 3034592 2908092 2831578

Net profit /Profit (D-C) -272000 60575 268936 115908 -10592 115908 192422

B/C Ratio 1.136607 1.097615155 1.03986 0.99651 1.03986 1.06796

Rate of Return 39%

145
 Fig.1. Sensitivity of Internal Rate of Return under optimistic, Normal and Pessimistic
scenarios
Conclusion

In any aquaculture business, savings from efficient use of feed, time, energy, system stability
and sustainability can improve profits. It seems biofloc technology has these properties. With
emerging viral problems and rising costs for energy, biofloc technology with bio secure modular
systems may be an answer for more efficient, sustainable, profitable aquaculture production. Related
to biofloc meal and its perspectives, an earlier study detected initial estimates of cost for producing
a metric ton of biofloc meal is approximately $400 to $1000. The same authors cited that global
soymeal market varied approximately from $375 to $550/metric ton from January 2008 through
May 2009. During the same time period, fish meal varied approximately from $1000 to $1225,
suggesting feasibility on replacement of either soybean and/or fish meal by biofloc meal. Moreover,
generated from a process that cleans aquaculture effluents biofloc meal production avoids discharge
of waste water and excessive damage to natural habitats. This ingredient seems to be free of
deleterious levels of mycotoxins, antinutritional factors and other constituents that limit its use in
aqua feeds. Large-scale production of biofloc meal for use in aquaculture could result in
environmental benefits to marine and coastal ecosystems, as the need for wild fish as an aqua feed
ingredient is reduced. Sensorial quality of BFT products is also an important issue. BFT may bring
higher profit if fresh non-frozen shrimp/fish is sold to near-by market, mainly at inland locations.
These advantages certainly should be more explored and niche markets achieved, contributing to
social sustainability.

146
PRACTICALS

147
 1. ANALYSIS OF BRACKISHWATER
Total Settleable solids
Principle: This is a portion of organic and inorganic solids that settles in 1 h in an Imphoff cone and
is measured in terms of ml/l.
Procedure: Shake the water sample vigorously and pour 1 litre water into Imhoff cone graduated
at the lower end and leave it for 1 h. Measure the quantity of settleable solids in ml/l.

Total Suspended Solids (TSS) and Total Dissolved Solids (TDS)

Principle:A well-mixed sample is filtered through a weighed standard glass fibre filter disc or
Gooch crucible made of porcelain and the residues retained on the filter is dried to constant weight
at 103oCto 105oC. The increase in weight of filter represents the total suspended solids. For total
dissolved solids, the filtrate is evaporated to dryness in a weighed dish and dried to constant weight.
The increase in dish weight represents the total dissolved solids.
Procedure: Wash filter disc with three successive 20 ml volumes of distilled water using vacuum.
Continue suction to remove all traces of water. Filter a measured volume of well mixed sample
through the glassfibre filter to Gooch crucible. Wash with three successive 10ml volumes of distilled
water allowing complete drainage between washings and continue suction for about 3 minutes after
filtration is complete. Transfer filtrate to a weighed evaporating dish for measurement of total
dissolved solids.

Total suspended solids

Dry filter disc/crucible containing residues for at least 1h at 103ºC-105ºC in an oven. Cool in a
dessicator and weigh. Repeat the cycle of drying, cooling, desiccating and weighing until a constant
is obtained.

(A-B) x 1000
TSS (mg/l) = --------------------------
Sample volume (ml)
A = Weight of filter or crucible + dried residue (mg)
B= Weight of filter or crucible (mg)

Total Dissolved Solids

Evaporate the filtrate in dish to dryness on a steam bath. Dry for atleast 1 h in an oven at 180°C,
cool in a desiccator and weigh. Repeat drying, cooling, desiccating and weighing until a constant
weight is obtained.

148
 (A-B) x 1000
Total dissolved solids (mg/l) = ------------------------

Sample volume (ml)

A = Weight of dried residues + dish (mg)

B = Weight of dish (mg)

Dissolved Oxygen
Principle: DO can be determined by Winkler’s method. In this method divalent manganese solution,
followed by strong alkali, is added to the sample. Any dissolved oxygen rapidly oxidizes an
equivalent amount of divalent manganese to basic hydroxides of higher valency states. When the
solution is acidified in presence of iodide ions, the oxidized manganese ions again reverts to divalent
state and iodine, equivalent to the original dissolved oxygen content of the water, is liberated. This
iodine is titrated with standardized thiosulphate solution.

Reagents

 Winkler A solution (Manganous sulphate): dissolve 480 g MnSO4.4H2O or 400 g of

MnSO4.2H2O or 365 g of MnSO4.H2O in distilled water and make up the volume to 1 litre.

 Winkler B solution (alkaline iodide): Dissolve 500 g of sodium hydroxide and 300 g of
potassium iodide in 900 ml of distilled water and make up the volume to 1 litre.

 Standard thiosulphate solution (0.025 N): To prepare 0.1 N stock solution of sodium
thiosul- phate, dissolve 24.82 g of crystalline Na2S2O3.5H2O and 4.0 g of borax as a
preservative in 700 ml of distilled water and make up the volume to 1 litre. Standardize the
strength of this solution to exactly 0.1N by titrating against 0.1N potassium dichromate. To
make 0.025N thiosolution, dilute 125 ml of this standardized stock solution (0.1 N) to 500ml

 Concentrated sulphuric acid.

 N potassium dichromate: Dissolved 4.904 g of dried and crystalline K2Cr2O7 in 1 litre of

dis- tilled water.

 Starch solution (0.2%): Add 2.0 g starch and 30 ml 20% NaOH solution in 350 ml of
distilled water. Stir until athick, almost clear solution is obtained. Neutralise the alkali with
HCl and acidify with 1 ml of glacial acetic acid. Finally dilute the solution to 1 litre with
distilled water.

Procedure: Collect the water sample in stoppered BOD bottle and add immediately 1 ml of
manganoussulphate reagent with a pipette followed at once by 1.0 ml of alkaline iodide solution.
Restopper the bottle immediately and mix the contents thoroughly by shaking to develop a flocculent

149
precipitate. No air bubble should be trapped in the bottle. Add concentrated sulphuric acid (about 1
ml) to dissolve the precipitate. Transfer 50 ml of dissolved solution into a conical flask. Titrate
atonce with 0.025 N standard thiosulphatesolution until a very pale straw colour remains. Add starch
(about 5 ml) indicator and continue the titration until the blue colour is just discharged. Solution
should remain colourless for at least 20 seconds at the endpoint.

Calculation
8000 N x V1
DO (ppm) = -------------------
V2
V1= Volume (in ml) of Na2S2O3 of normality N required for titration

V2 = volume of water sample titrated.

If N = 0.025N and V2 = 50 ml then DO (ppm) = V1 x 4

Chemical Oxygen Demand

Principle: COD is a measure of organic matter and represents the amount of oxygen required to
oxidize the organic matter by strong oxidizing chemicals (potassium dichromate) under acidic
condition. The excess dichromate is titrated with standard ferrous ammonium sulphate using ferroin
as an indicator. Mercuric sulphate is added to complex the chlorides, thereby effectively eliminating
the chlorides interference.

Reagents
 0.05 N Potassium dichromate: Dissolve 2.452 g dried, crystalline K2Cr2O7 in distilled
water and make up the volume to 1 litre.
 0.05 N Ferrous ammonium sulphate (FAS): Dissolve 19.61 g of Fe(NH4)2(SO4)2.6H2O
in 800 mlof distilled water containing 1 ml of conc. sulphuric acid and make up the volume
to 1 litre.
 Mercuric sulphate
 Ferroinindicator: Dissolve 1.888g of 1:10 phenanthrolin monohydrate and 0.70g of
FeSO4.7H2O in 100 ml of distilled water.

Procedure: Pipette out 20ml of water sample into a125ml Erlenmeyer flask. Add exactly10 ml of
0.05 N K2Cr2O7 solution to the flask. Add 200 mg HgSO4 for each 1000 mg per litre of chloride
(HgSO4 : Cl:: 10 : 1). Swirl until the HgSO4 is dissolved. Add carefully 30 ml of conc. H2SO4 Cover
the flask with watch glass and allow to stand for 30 min. Add 15 ml of distilled water and 3 drops of
ferroin indicator and titrate the whole reaction mixture with FAS of same normality. Prepare blank
with 20ml distilled water and repeat the same procedure.

150
Calculation
(B-S) x Nx 8000 B = Titre value for Blank in ml
COD mg/l = ---------------------- S = Titre value for sample in ml
V N = Normality of FAS
V = Volume of sample in ml
Biochemical Oxygen Demand
Principle: The sample of water or appropriate dilution is incubated for 5 days at 20oC in the dark.
The reduction in DO concentration during the incubation period yields a measure of the BOD.

Reagents: Use all the reagents required for the determination of DO.
Procedure: Collect three water samples from one site into BOD bottle following the procedure for
DO. Determine the DO level in one of these samples, whilst the remaining two samples are firmly
stoppered and placed in an incubator at 20o C in the dark for 5 days. At the end of this time, the DO
level is determined by the usual Winkler’s titration.
In heavily polluted samples, it is necessary to dilute the sample with a known amount of clean,
air saturated water, so as to obtain required dilution (almost 50%). Siphon out the mixed sample into
two sets of specially designed BOD bottles, one set for incubation and the other for determination
of initial DO.

Calculation

Initial DO = Do ppm

Final DO = D ppm

Reduction in DO = Do- D = Dr1 ppm

Dilution water initial DO = D1 ppm

Final DO = D2 ppm

Reduction in DO = D1- D2 = Dr2 ppm

Therefore reduction due to sample = Dr1- Dr2 ppm = Ds

BOD (ppm) = Ds x Dilution factor

Alkalinity
Principle: It can be measured by titrating the water sample with a standard acid using methyl orange.

Reagents:

 0.02 N Sulphuric Acid: Dilute 30 ml of concentrated H2SO4 to 1 litre with distilled water to
get approximately 1N stock solution. To make 0.02N H2SO4, take 20 ml of this stock solution

151
 and dilute to 1 litre with distilled water. Standardise this solution against 0.02N sodium
carbonate using methyl orange as in indicator.

 0.02 N Sodium carbonate: Dissolve 5.3 g anhydrous sodium carbonate in 1 litre distilled
water. Dilute 50 ml of this solution to 250 ml to get 0.02 N sodium carbonate.

 Methyl orange indicator: Dissolve 0.05 g reagent in 100 ml of distilled water.

Procedure: Add 2 drops of methyl orange indicator to 50 ml of water sample. If the sample remains
colorless, no alkalinity is there. If it is yellow, titrate with 0.02N H2SO4 till the color turns taint
orange.

Calculation
Total alkalinity (ppm of CaCO3) = volume of 0.02 N H2SO4 required for titration x 20

Ammonia-N
Principle: Water sample is treated in an alkaline citrate medium with sodium hypochlorite and
phenol in the presence of sodium nitroprusside which acts as a catalyzer. The blue indo phenol
colour formed with ammonia is measured spectrophotometrically.

Reagents

 De-ionised water

 Phenol solution: Dissolve 20 g of analytical grade phenol in 200 ml of 95%v/v ethyl alcohol.

 Sodium nitroprusside solution: Dissolve 1.0 g of sodium nitroprusside,

Na2Fe(CN)5NO.2H2O, in 200 ml of de-ionised water. Store in a dark glass bottle. The solution
is stable for at least a month.

 Alkaline reagent: Dissolve 100 g of sodium citrate and 5 g of sodium hydroxide in 500 ml
of de-ionised water. The solution is stable indefinitely

 Sodium hypochlorite solution

 Oxidising solution: Mix 100 ml of reagent 4 and 25 ml of reagent 5. Prepare fresh every day.
Procedure: Add 50 ml of seawater to an Erlenmeyer flask from 50 ml measuring cylinder. Add 2
ml of phenol solution, swirl to mix and then add in sequence 2ml of nitroprusside 5ml of oxidizing
solution. Mix after each addition by swirling the flasks. Cover the flasks with aluminum foil to
lessen the contamination by atmospheric ammonia and allow the flasks to stand at room temperature
for 1 hr in dark. The colour is stable for about 24 hr after the reaction period. Read the absorbance
at 640 nmin a spectrophotometer against blank or distilled water using 10 cm cell. Carry out the
method exactly as described above for blank also using 50 ml of de-ionized water.
Calculation: Calculate the ammonia concentration by using calibration curve.

152
Standard curve: Dissolve 0.9433 g of analytical reagent quality ammonium sulphate in 950 ml of
distilled water. Add 1ml of chloroform and make up the volume to 1 litre. Store in refrigerator,
sheltered from strong light. This solution contains 200ppm and is stable for many months if well
stoppered. Prepare a series of standard solutions from this stock solution and carry out the method
exactly as described above. After colour development, measure absorbance at 640 nm and prepare
a calibration curve from the absorbance of a series of standards.

Nitrite-N
Principle: The nitrite in water is allowed to react with sulfanilamide in an acid solution. The resulting
diazo compound is reacted with NED and forms a highly coloured azo dye.

Reagents

 Sulfanilamide solution: Dissolve 5.0 g of sulfanilamide in a mixture of 50 ml of conc. HCl and

about 300 ml of distilled water. Dilute to 500 ml with distilled water. The solution is stable for
many months.

 NED (N-(1-naphthyl) ethylene diaminedihydrochloroide solution): Dissolve 0.5 g of the

dihy- drochloride in 500 ml of distilled water. Store the solution in a dark bottle. The solution
should be renewed once a month or directly a strong brown colouration develops.

 Standard nitrite: Dissolve 1.064 g anhydrous, analytical grade potassium nitrite, KNO2 (dried
at 105 C for 1 hr) in distilled water. Add 1 ml 5 N NaOH and dilute to 250 ml. This solution
contains700 mg/l nitrite-N and should be stored in a dark bottle with 1 ml of chloroform as a
preservative in refrigerator. The solution is stable for several months.
Procedure: Add 1.0 ml of sulfanilamide solution from a pipette to each 50 ml sample, mix and
allow the reagent to react for more than 2 minute but less than 10 min. to assure a complete reaction.
Add 1 ml of NED reagent and mix immediately. Leave for 10 minutes and then measure the
absorbance (OD) of the samples and standards against a reagent blank at 540 nm. The colour is
stable for 2 h. calculate the nitrite concentration by using calibration curve.

Nitrate-N
Principle: Nitrate in water sample is reduced almost quantitatively to nitrite. The nitrite produced
is determined by diazotizing with sulfanilamide and coupling with NED to form a highly coloured
azo dye which can be measured spectrophotometrically.

Reagents

 Phenol solutions: 23 g phenol in 500 ml of distilled water.

 NaOH:1.25 g in 500 ml of distilled water.

153
  Buffer reagent: Mix equal volume of phenol solution and NaOH solution.

 Copper sulphate solution: 0.1 g in 1 litre distilled water.

 Hydrazine sulphate: 3.625 g in 500 ml of distilled water.

 Reducing agent: 5 ml of copper sulphate solution to 5 ml of hydrazine sulphate.

 Acetone

 Sulfanilamide: Dissolve 5.0 g in 50 ml of conc. HCl and make up the volume to 500 ml.

 NED: Dissolve 0.5 g of NED in 500 ml of distilled water

 Nitrate standard solutions: Dissolve 0.36119 g potassium nitrate, KNO3 (AR dried at
105oC) in 250 ml distilled water. Dilute 100 ml of this solution to 1 litre with distilled
water. This final solution contains 2 ppm NO3-.

Procedure
Take 10 ml of sample and add 0.4 ml of buffer and mix and then add 0.2 ml reducing agent
and keep the tube in dark for 24 hours. Then add 0.4 ml of acetone and after 2 minutes add 0.2 ml
of sulphanilamide. After 3 minutes, add 0.2 ml of NED solution and after 10 minutes, measure the
absorbance at 540 nm in a spectrophotometer.

Floc volume Analysis: (Imhoff cone method)

It is a crude method that is the measure the floc volume by using Imhoffcone. One liter of water
have to take and allow for settle half an hour. Measure the volume and note down. If higher the floc
volume above 20ml/L reduce the feed level.

Turbidity
Principle: (Nephlometric method)
Turbidity can be caused either by planktonic organisms or by suspended soil particles. Turbidity
due to suspended soil particles be measured by Nephelo-turbidity meter which is based on the

154
 scattering of light beam produced by tungsten filament lamp by particulate material. The quantity
of light scattered is taken as a measured of turbidity in NTU. The higher the intensity of scattered
light, higher the turbidity.

Reagents

 Turbidity freewater

 Standard turbidity suspension

 Solution-I: Dissolve 1g hydrazine sulphate in distilled water and dilute to 100 ml in a

volumetric flask

 Solution-II: Dissolve 10g hexamethylenetetramine in distilled and dilute to 100ml.

Mix 5 ml each of Solutions I and II. Let stand 24 hours at 25oC . Dilute to mark and mix. The turbidity
of this suspension is 400 NTU. Dilute 10 ml of this stock suspension to 40 NTU.
Procedure: Calibrate the instrument using standard turbidity suspension. Shake the sample
thoroughly. Wait until air bubbles disappear and pour sample into turbidity meter tubes. Place the
tube in instrument and read turbidity in NTU directly from instrumentscale.

Transparency
A standard Sacchi disc is a circular metal plate having 10 cm radius. The upper surface of
the disc is divided into four quadrants, painted in black and white colours. The disc is gradually
lowered into the water and depth (cm) at which the upper surface just disappears is noted (d1).
Now the disc is slowly lifted upward and the depth at which the disc reappears is noted(d2).
The value (d1+d2)/2 in cm gives a measure of transparency.

Periphyton biomass and its estimation

Periphyton biomass is estimated in terms of Dry matter (DM), ash free dry matter (AFDM) and
chlorophyll a concentration.

Periphyton biomass
For estimation, take periphyton samples 2 x 2 cm2 from submerged substrates in a pre weighed
crucible and measure the wet weight of the sample. Dry the sample at 105oC for 24 h and keep it in
desiccators. The difference between wet weight and dry weight will give the periphyton dry matter.

Ash free dry matter content in the periphyton dry can be estimated by keeping the samples at
o
450 C for 6 h in a muffle furnace and weigh the ash weight. The difference between the dry weight
of the sample and weight of the ash gives the ash free dry matter (AFDM) content in the periphyton.
To determine chlorophyll concentration in periphyton biomass, transfer the periphyton samples
to centrifuge tubes containing 90 % acetone and store overnight in a refrigerator. The samples were

155
homogenize and centrifuged at 2,000 rpm for 10 min. Then measure the absorbance of the
supernatant measure at 750 and 664 nm, 647 and 630 nm using a spectrophotometer. Estimate the
Chllorphyll a content through tricromatic equations (APHA2005)
The autotrophic index (AI) of the periphyton biomass can be calculated using the following
formula AI = AFDM in µg cm-2/Chlorophyll a in µgcm-2.

156
 2. MICROBIAL QUANTIFICATION AND
CHARACTERIZATION IN BIOFLOC SYSTEM

Biofloc consists of non-living matter, and a variety of microorganisms, principally algae and
bacteria. The presence of microorganism in biofloc confers many beneficial effects to aquatic
animals. This includes provision of supplemental nutrition, maintenance of water quality and control
of waste accumulation. Among microbial community, bacteria play crucial role in nitrogen cycle of
pond ecosystem by converting toxic ammonia nitrogen into the bacterial single cell protein. Their
optimum number is essential for the successful maintenance of biofloc system. On the other hand
the very high number may lead to increased suspended solid, increased competition for oxygen with
shrimp which may prove fatal at the time of crisis. Therefore, the estimation of microbial community
is always at the centre-stage for management of biofloc system. The present chapter describes some
common tools used in microbial estimation and characterization.

1. Total bacterial count

This roughly gives the estimate for total number of live and culturable bacteria exists in the
system. These number should range from 106 to 108 CFU/mL.

Protocol
1.1 Media preparation

 Weigh 20g tryptone soya agar and dissolve in 500mL distilled water. This should be done in
1L conical flask.

 Add extra sodium chloride appropriately to bring the salt concentration of media to 2% for
analysis of marine or brackish water samples. For the present experiment, add 7.5 g of sodium
chloride in above media for our purpose.

 Autoclave the media at 121oC and 15 pond pressure for 15 min. This will kill all the germ and
spore.

 Allow the media to cool.

 Pour 20ml media in 90 mm petridish plate inside laminar flow chamber. Keep the plate
partially open for 30 minute to get the plate dried.

 Store the plate in refrigerator at 4oC.

1.2 Processing biofloc sample

 Collect 200 ml water sample from biofloc pond. Sample should be processed within 2-3h.
Maintain the sample over ice or in refrigerator at 4oC.

157
  Homogenise the sample in kitchen blender for 30second. This will allow bacteria to get
dissociated from thefloc.

 Make a serial 10 fold dilution of water sample in normal saline solution (0.89 g NaCl in 100
ml distilled water). Make 5 dilutions (10-1to10-5) for normal pond and up to 8 dilutions (10-
1
to10-8) for ponds having high load ofbiofloc.

 Spread plate 0.1 mL of diluted sample on tryptone soya agar plate. To prevent unnecessary
wastage of plates, plating should be done starting from 10-3 dilution onward.

 Incubate the plate in inverted position for 24 h at 28 oC or at room temperature.

 Count the plate having 30 – 300 colony.

1.3 Calculation of bacterial count

Bacterial count is expressed in the form of colony forming unit (CFU). This is estimated by the
following formulae.

Total CFU/mL or bacteria/mL = (no. of colonies x dilution factor) / sample volume used for plating
For example, suppose the plate of the 10-6 dilution yielded a count of 130 colonies. The sample volume
used for plating is 0.1 mL. Then, the number of bacteria in 1 ml of the original sample can be calculated
as follows:

Bacteria/ml = (130 x 106)/0.1 = 1.3 × 109

2.1 Total Vibrio count

Vibrio harveyi, V. campbellii and V. parahemolyticus are the major bacterial pathogens in shrimp
culture. Their predominance in biofloc system will signal danger; hence its monitoring should be
taken as part of management criteria. Thiosulphate citrate bile salt sucrose (TCBS) agar is a selective
cum differential medium widely used for Vibrio growth. It contains high concentrations of sodium
thiosulfate and sodium citrate which inhibit the growth of Enterobacteriaceae. Growth of Gram-
positive bacteria is inhibited by oxgall, a bile salt. It is a fermentable carbohydrate which helps in
presumptive identification of Vibrio species. Forexample,
V. harveyi, V. campbellii and V. parahemolyticus are green while V. alginolytiucs and V. cholerae
appear as yellow colony. There fore presence of very high number of green colony is considered as
dangerous scenario in biofloc system.

Protocol
1. Add 8.9 g TCBS agar media for each 100 mL sterile distilled water.

2. The media should be boiled till the agar content gets completely dissolved. Please make a
note that the TCBS agar should never be autoclaved.
3. Pour 20-25 ml media in Petridish, allow the plate to get dried.

158
 4. After preparing the sample as earlier described method, spread plate 0.1 mL of diluted
sample. Undiluted to 10-3 to 10-4 dilution can be plated on agar plate.
5. Count number of green and yellow colony.

4. MICROSCOPY IN BACTERIAL IDENTIFICATION

Bacterial cells are very small in size, usually in the range of 0.5 µ to 20 µ. Limit of vision of
human eye is just 100µ, so they are not visible to naked eye. Hence a microscope is used for
observing bacterial cell. They are semi-transparent, so, we use suitable dyes to stain them to obtain
better contrast. Gram staining is the most common staining procedure followed in microbiology lab
as a first step aid in bacterial identification.

4.1 Grams staining

It was designed by Christian Gram in 1884. The primary staining is done by crystal violet and
counter staining by Safranine.
Procedure
1. Smearpreparation: Young bacterial cultures of 16-24h shall be used for staining. Take dust free
and oil free microscopic glass slide. Take a speck of young culture with the help of inoculation
loop and emulsify with a drop of sterile water in the middle of the slide and spread uniformly.
Dry the smear in the air.
2. Smearfixation: Fix the smear by passing the slide 3-4 times quickly through the blue flame of

Bunsen burner, with the smeared side on the top. Take precaution to not char the smear.

3. Staining

 Primary staing: Flood the smear with Gram’s crystal violet - 1 min.

 Wash with distill water drop by drop.

 Moderant: Flood the smear with Gram’s iodine - 1 min.

 Wash with water drop by drop.

 Destaining: Destain with drop-wise addition of ethyl alcohol until washings are free from
violet color

 Wash with water.

 Counter staining: Counter stain with Safranine - 1 min.

 Wash with water.

 Dry in air.

159
4. Microscopy
Observe the slides under the microscope using oil immersion objective (100X). Note down
following points

 Gram positive or Gram negative - cells stained violet, bluish violet or purple are Gram posi-
tive. Bacteria appearing pink are Gram negative.

 Shape, size and arrangement of cells, i.e., Cocci, Bacilli, Spiral or curved rod, Filamentous etc.
For cocci whether they are in single or pairs or chains or bunch.

 Examine whether the culture is pure or mixed.

 If the cells are Gram-positive rods, examine whether there is spore formation. If spore is
present, there will be unstained area inside the cell, because, spore is not stained by Grams
method.

4.2 Bacterial Identification by biochemical methods

Biochemical methods are routinely followed in microbiology lab for bacterial identification.
Though the test is laborious, it is cheaper and requires less input. Therefore, it could be easily
practiced even at remote area with primary level facility like incubator, laminarflow and autoclave.
We are providing the list of biochemical tests routinely done in our lab for identification of Vibrio
species with description of few commonly used tests.

5. Biochemical tests used for Vibrio identification

 Carbohydrate fermentation test–Sucrose, arabinose, lactose, Mannose,ONPG

 Salt tolerance test–Growth of Vibrio species at 0, 3, 6, 8 and 10% salt in peptone water

 Decarboxylase test – Lysine, arginine, ornithine

 IMViC test–This is a acronym for Indole, Methylred, Voges Proskauer and citrate test.

5.1.1 Carbohydrate fermentation test

Materials
1. Phenol red broth base containing phenol red indicator.

2. Carbohydrate solution – Add 10 gm of carbohydrate in 20.0 ml of distil water. Prepare different

carbohydrate solution such as Glucose, Sucrose, arabinose, lactose, Mannose, ONPG etc
solution separately in a properly labelled flask.
3. Vibrio culture

160
Procedure
1. Sterilise phenol red broth base at 15 pound pressure for 15 minute and carbohydrate solution at
10 pound pressure for 10min. Separately label each carbohydrate solution. Add 0.2 ml of
carbohydrate solution in each test tube containing 9.8 ml of phenol red broth.

2. Using aseptic technique inoculate each tube with bacterial culture.

3. Place the tubes in a test-tube rack and incubate at 30°C for 24 to 48 hours.

4. Examine the tubes carefully at 4 hours, 8 hours, and 18 hours for evidence of acid (A), or acid
and gas (A/G) production. Acid production is detected by the medium turning yellow and gas
production by a gas bubble in the Durham tube. Purple color indicate no fermentation.

5.1.2. Salt tolerance test Procedure

1. Prepare peptone water having 0, 3, 6, 8 and 10% salt. Autoclave at 15 pound pressure for 15min.
2. Transfer these media into sterile test tube and inoculate with a drop ofculture.

3. Incubate at 28 oC for up to 4 days and check for presence of growth daily.

4. Presence of turbidity in the medium should be considered as positive.

5.1.3. Decarboxylasetest
Lysine, Ornithine, and arginine are the three amino acids routinely tested for decarboxylase test.

Procedure
1. Prepare Moellerdecarboxylase base with lysine, ornithine and arginine hydrochloride (1%) in a
separate test tube.
2. Inoculate the test medium with overnight grown inoculum and overlaid with liquid paraffin layer.
3. Incubate the tube at 28oC and read daily for four days.
Result
• Purple color-Positive Decarboxylation

• Yellow color or no color change -Negative i.e. No decarboxylation

5.1.4 IMViC test

5.1.4.1 Indole test
Indole test indicates the presence of tryptophanase enzyme which hydrolyse tryptophan to its
metabolic products, namely, indole, pyruvic acid, and ammonia. The presence of indole is detected
by the addition of Kovacs’reagent, which after reacting with indole produces a bright red compound
on the surface of the medium.

Procedure
1. Prepare tryptic soy broth tube.

161
2. Using aseptic technique, inoculate each tube by a loop ful of culture.
3. Incubate the tubes for about 24 hours at 28°C.

4. After 24 hours, add 0.5 ml (about 10 drops) of Kovacs’ reagent to each tube, and shake the tube
gently. A deep red colour develops in the presence of indole. Negative reactions remain colorless
or light yellow.
Methyl red and Voges Proskauer test the end product coming from glucose metabolism. While
citrate tests identify the utilization of citrate as sole carbon source by bacteria.

6. Bacterial identification by 16S rRNA gene sequencing

The 16SrRNA gene sequence is the most widely used molecular method for bacterial
identification and phylogenetic study. There are multiple reasons for selection of 16Sr-RNA genes
which include
a) It is present in almost all bacteria

b) The function of the 16SrRNA gene over time has not changed, suggesting that random sequence
changes are a more accurate measure of time (evolution).

6.1. Isolation of genomic DNA

1. Take 1.5 ml of a 6-8 h old Vibrio culture. Harvest bacterial cells at 4000 x g for 5min.

2. Suspend the cell pellet in 400µl of lysis buffer (40mMTris-acetate pH7.8, 20mMsodium-acetate,
1 mM EDTA, 1% SDS) by vigorous pipetting.

3. Incubate at 65 oC for 20min.

4. Add 3 micro liter of RNase. Mix by inverting the tube. Incubate for 30 min at 37°C.

5. To remove most proteins and cell debris, add 132µl of 5M NaCl solution. Mixed well by inversion.
6. Centrifuge the viscous mixture at 12,000 rpm for 10 min at 4°C.

7. Transfer the clear supernatant into a new vial. Add an equal volume of chloroform. Invert the
tube at least 50 times when a milky solution completely formed.

8. Centrifuge at 12,000 rpm for 5 min, transfer the supernatant to another vial.
9. Precipitate DNA with equal volume of 100% ethanol. Invert few times to get the visible pellet.

DNA
1. Washed twice with 70% EtOH.
2. Dry the tube in air for 10-20min.

162
3. Redissolve isolated DNA in 100 µl 1 x TE buffer.
4. Keep at 4°C for overnight to get the pillet dissolved otherwise heat at 65 oC for 10 min
todissolve the DNA pellet.

6.2. Preparing PCR reaction solution

Prepare a master mix by mixing PCR component as following

Component 25 μl reaction Final Concentration

10X Standard Taq Reaction Buffer 2.5 μl 1X

10 mM dNTPs 0.5 µl 200 µM

10 µM Forward Primer 0.5 µl 0.2 µM (0.05–1 µM)

10 µM Reverse Primer 0.5 µl 0.2 µM (0.05–1 µM)

Template DNA 1 µl 10-100 ng

Taq DNA Polymerase 0.125 – 0.5 µl 0.5 to 1 units/25 µl PCR

Nuclease-free water to 25 µl

Notes: Gently mix the reaction. Collect all liquid to the bottom of the tube by a quick spin

6.3. PCR reaction setup

Thermo cycling conditions for a routine PCR: Temp Time

Initial Denaturation 95°C 4 min

95°C 30seconds
57°C 45seconds
30 Cycles
72°C 1 min 30 second

Final Extension 72°C 7 minutes

Hold 22°C

Run the PCR products by agarose gel electrophoresis at 1.2% concentration at 100 V for 1 h.
Visualize the PCR product under UV ray or gel documentation system. The PCR product should be
sequenced and examined for homology by BLAST analysis.

163
 5. ALGAL CHARACTERIZATION
Out of several methods of microalgal isolation; three important methods are explained here:
serial dilution, agar streak plating and manipulation.

1. Serial dilution
Using aseptic technique, dispense 9 ml of specified chemical media (eg f/2 medium) into each
of ten test tubes with sterile automatic dispenseror sterile10ml pipettes. Label tubes 10-1 to 10-10
indicating the dilution factor. Aseptically add 1 ml of enriched/fresh sample to the first tube (10-1)
and mix gently. Take 1 ml of this dilution and add to the next tube (10-2), mix gently. Repeat this
procedure for the remaining tubes (10-3 to 10-10). Incubate test-tubes under controlled temperature
and light conditions. Temperature and photoperiod should be as close to the natural environment as
possible. Light intensity should be slightly lower than the natural environment.

Then examine cultures microscopically after2-4 weeks by withdrawing a small sample

aseptically from each dilution tube. A unialgal culture may grow in one of the higher dilution tubes
e.g.10-6to10-10. If tubes contain two or three different species methods like micromanipulation or
agar plate streaking can be used to obtain unialgal cultures.
Fig 1: Test tubes in serial dilution

164
2. Agar streak plating
This is a suitable method for small species or algae that grow well on a substrate. Prepare
petridishes containing growth medium solidified with1-1.5% agar. The agar should be1/2-2/3 the
depth of the dish. Place 1-2 drops of mixed phytoplankton sample near the periphery of the agar.
Sterilize wireloop in flame. Use the sterile loop to make parallel streaks of the suspension on the
agar. Note that there are 16 streaks (4 sets of 4) to be made and the whole surface of the agar plate

is used. Cover and seal plate with parafilm. Invert and incubate under low light at constant
temperature. Select colonies that are free of other organisms for further isolation. Remove a sample
using a sterilized wire loop and place in a drop of sterile culture medium on a glassslide. Check
microscopically that the desired species has been isolated and is unialgal. Repeat the streaking
procedure with the algal cells from a single colony and again allow colonies to develop. This second
streaking reduces the possibility of bacterial contamination and of colonies containing more than
one algal species. Transfer selected colonies to liquid or agar medium.

3. Micromanipulation
Micromanipulation is a powerful tool in microalgal isolation. It is usually performed with a
pasteur pipette or a glass capillary. A Pasteur pipette can be heated in a flame, extended, and broken.
With minimal practice, this technique becomes quick and easy, but the beginner must spend some
time practicing before reliable production of micropipettes is achieved. The pipette is held in one
hand, and a forceps held in the other hand supports the tip. The pipette is rotated to provide even
softening as the pipette warms to the melting point. When the heated area is sufficiently soft, the
pipette is removed from the flame and simultaneously pulled to produce a thin tube. If drawn out
too quickly, or if drawn out in the flame, then the thin extension breaks or burns through, and the
resulting product is unsatisfactory. The goal of micropipette isolation is to pick up a cell from the
sample, deposit the cell without damage into a sterile droplet, pick up the cell again, and transfer it
to a second sterile droplet. This process is repeated until a single algal cell, free of all other protists,

165
can be confidently placed into culture medium. The process balances two factors: cell damage by
excessive handling, which is bad, and clean isolation of a single cell, which is good. For robust
organisms, repeated handling can be achieved without damage; however, for delicate organisms,
cell damage is an important concern.

166
 6. IMMUNE PARAMETERS CHARACTERIZATION
The immune response in invertebrates is innate rather than adaptive and has no known
immunological memory. Immunity in shrimps is defined as nonspecific internal defense response
that includes humoral, cellular and molecular components.
Humoral: immune response involve plasma proteins and peptides with different actions, including
recognition proteins, clotting protein, anti-microbial peptides, agglutinin, lectin and the proPO
system

Cellular: immune system constituted by phagocytic process,encapsulation, nodule formation,

ProPO activating system, clotting system and reactive oxygen intermediates (ROIs) created by the
metabolites from respiratory process. Different kinds of haemocytes: granular, semi-granular, and
hyalins, are involved in activating these functions (adhesion, phagocytosis, encapsulation, and
melanization).
Molecular: immune response constituted by the immune genes involved for various immune
reactions and their qualitative and quantitative assessments. For every cellular and humoral defense,
one or many complex interactions of genes are involved, some are known and majorities are yet to
be sequenced and characterized.
Bacteria and yeast have molecules such as lipopolysaccharide (LPS) and ß-1, 3-glucans on their
surfaces that are recognized by non self recognition molecules and elicit an immune reaction in both
vertebrates and invertebrates. Proteins that recognize the LPS and ß-1, 3-glucans are known as
pattern recognition proteins (PRPs) and differentially regulated in normal and diseased animal.

167
SCHEMATIC DIAGRAM OF IMMUNOLOGICAL PARAMETERS

Penaeus vannamei
Penaeus indicus and
Penaeus monodon

Collect the Hemolymph

Separation of Serum, Plasma and Hemocytes

Estimation of Protein

Immunological parameters

Phenoloxidase
Lysozyme and
Superoxide dismutase activity

159
SCHEMATIC DIAGRAM OF PHAGOCYTOSIS IN CRUSTACEANS HEMO-CYTES
Hyalinehemocyte Semigranularhemocyte Granularhemocyte

Semi granular or Granular hemocyte

Adherence of microbe or foreign particle to phagocyte

Ingestion of microbe or foreign particle by phagocyte

Formation of a phagosome

Fusion of the phagosome with a lysosome to form a phagolysosome

Digestion of ingested microbe or foreign particle by enzymes

Formation of residual body containing indigestible material

Discharge of waste materials

160
 Fig.1. Phagocytosis of hemocyte

PHENOLOXIDASE ACTIVITY SCHEMATIC METHODOLOGY

Penaeus indicus, Penaeus vannamei and Penaeus monodon

Take the 100 µl of sample

Added 100 µl of Trypsin (5 mg/ml)

Added 1.8 ml of 5 mM L-DOPA (Tris-HCl 50 mM, pH 7.5 buffer)

Incubation for 20 minutes

OD at 490 nm

161
 PHAGOCYTOSIS SCHEMATIC METHODOLOGY

Hemolymph (100 μl) collected in 1 ml of tri sodium citrate buffer (30 mM tri sodium citrate, 340
mM NaCl, 10 mM EDTA, 120 mM dextrose; pH 7.55)

Spread on a clean, dry glass slide over an area of 2 cm2

Kept in a moist chamber for 30 min at 23°C

To obtain hemocyte monolayer (50 µl)

Monolayers was overlaid with 50 μl of bacteria

Observed at 20 or 30 min after under light microscope at 40x magnification

162
 TOTAL HAEMOCYTE COUNT SCHEMATIC METHODOLOGY
Hemolymph (100 μl) collected in 1 ml of tri sodium citrate buffer (30 mM tri sodium citrate, 340
mM NaCl, 10 mM EDTA, 120 mM dextrose; pH 7.55)

After they were mixed gently hemocytes

Added 10 µl of hemocytes in hemocytometer

Under light microscope at 40x magnification

Count, calculated as cells ml-1

163
 LABORATORY METHOD FOR DETECTION OF IMPORTANT
SHRIMP PATHOGENS FROM BIOFLOC CULTURE SYSTEM
Shrimp aquaculture is a highly profitable industry which has been constantly developing
through the application of scientific knowledge and developed technologies. Through this process,
it has been possible to increase the production to several folds by intensification of culture process.
Biofloc technology is one of the similar methods where a very high stocking density shrimp culture
is possible through the exploitation of the natural ecosystem. However,disease
alwayscomesontheway to success of any aquaculture practice. Any alteration to the normal
conditions can bring stress on the organism during which the animals become susceptible to various
pathogens. It is also possible that entry of pathogens can occur through various sources. Therefore,
constant monitoring of culture practices is essential. Following are the protocols for detection of
some important pathogens in Indian shrimp aquaculture practices. These methods can be routinely
adopted for the monitoring of the biofloc culture practice for the early detection of pathogens and
then take necessary actions either for treatment or to prevent the spread.

White Spot Disease (WSD)

This is considered as a serious disease as it can bring mass mortality once the culture system
gets contaminated. Mortality starts after 2 to 3 days onset of disease and mass mortality may occur
within 7-10days.This disease struck Indian shrimp aquaculture during late 90’s and even after two
decades of occurrence, it still poses threat to the industry. All the important cultured penaeid shrimps
and all their life stages can get infected by the virus. White Spot Syndrome Virus (WSSV) is the
causative agent, which is a double stranded circular DNA virus of about 300 kb. This pathogen has
large number of crustaceans as carrier and hence once contaminated, it becomes difficult
toeliminate.

Clinical signs
Different clinical symptoms include anorexia and coming to surface or pond sides. Shrimps
become lethargic and during this time the chance of disease spread increases through cannibalism.
Animals may show pink discoloration. One of the characteristic clinical sign includes development
of circular white spots on the carapace and entire abdomen. However, in some cases, particularly in
case of vannamei, white spots may not be visible. Feeding is considerably reduced or completely

stopped.

Disease diagnosis

164
 There are various methods such as direct microscopy, histopathology, in situ hybridization,
polymerase chain reaction (PCR), real time PCR or loop mediated isothermal amplification (LAMP)
are available for the detection of WSSV.

However, amongst all, PCR is widely used as it is rapid, sensitive and easy to perform
compared to other methods.

Different steps in PCR diagnosis of WSSV

Sample collection: Live, moribund, freshly dead and frozen samples are suitable for PCR
detection. Samples can be processed directly or stored in 90-100% ethanol for future analysis. While
cuticular epithelium and sub-cuticular connective tissues are considered as best samples for WSSV,
hepatopancreas, midgut and compound eye are regarded as bad samples. As non-lethal sampling
protocol, tips of pleopods can be cut and used.

DNA extraction: About 100 – 200 mg tissues or 100 µl of haemolymph is sufficient for DNA
extraction. Basic principle involves 4 steps – Tissue lysis, removal of inhibitors (protein, lipid etc),
precipitation of DNA and washing to remove extra salt. Several methods of DNA extraction
protocols are available. OIE manual describes CTAB method. Similarly, Guanidine Hydrochloride
can also be used. Some of the commercially available kits mention partial purification protocols to
have the crude DNA for detection. To get the accurate result, it is advisable to use some of the
established methods.
Thermo cycling: Different components such as PCR buffer, pair of primers, dNTPS and DNA
polymerase enzyme are necessary to set up a PCR reaction. Readily available master mix containing
buffer, dNTPs and polymerase enzymes is also available. Depending on the number of reactions, a
master mix is prepared. All the PCR components except the DNA should be handled in a PCR work
station and in cold condition to avoid contamination. A typical PCR reaction can be of 20, 25, 50 or
100 µl. Nested PCR protocols are available for WSSVdetection

Example
2X master mix:
12.5 µl Forward Primer (10pm):
0.5 µl

Reverse Primer (10pm): 0.5µl

DNA: 1.0 µl (or depending onconcentration)

165
PCR grade water: 10.5 µl
-----------------------------------------

Total: 25µl

Different primers available in the research publications maybe used. Incase of commercial kits,
the primers are already added to the master mix.

With each PCR sample, a positive control (known WSSV positive sample) and a negative
control (known WSSV negative shrimp) should be there. It is also advisable to keep one reaction
for one of the suitable host DNA to check the quality of DNAextraction.
The components are mixed properly and centrifuged briefly. This is then loaded to a
thermocycler. Thermo cycling involves one initial denaturation step (usually 94 ⁰C) for about 5
minutes, followed by repeated cycles (30 – 40 numbers) consisting of denaturation (usually 94 ⁰C
for 30 sec to 1 min), annealing (depends on Tm of primers, 30 sec to 1 minutes) and extension
(usually 72 ⁰C, 30 sec to 2 minutes). A final extension (72 ⁰C) for about 5 -10 minutes is given to
complete there action.
A typical example for WSSV by OIE protocol: 94°C for 4 minutes, 55°C for 1 minute, and
72°C for 2 minutes, followed by 39 cycles of 94°C for 1 minute, 55°C for 1 minute, and 72°C for 2
minutes and a final 5-minute extension at 72°C.

Detection
The PCR amplified product is detected in an agarose gel (1-2% depending on size of the
amplified product). Either TrisAceticacid and EDTA (TAE, 1Xconcentration) or Tris Boric acid
EDTA (TBE,0.5 X concentrations) buffer is used for electrophoresis. Ethidium bromide (0.5 µg/ml)
can be incorporated to the gel (care should be taken not to touch EB asitis carcinogenic). The
amplified products are loaded to the wells of agarose gel and then connected to a power pack (initial
80Vand increased to120 or140 V once the products enter the gel).
The agarose gel is then visualised in a Gel documentation system or UV-transilluminator. A
molecular weight marker is put to verify the size of the amplified products.

Infectious Hypodermal Haematopoetic Necrosis Virus (IHHNV)

Though this virus does not bring mortality, it has been reported to cause body deformity (Rund
deformity syndrome or RDS) and growth variation. Farmers become more worried as it brings size
variation and growth reduction. Both WSSV and IHHNV are frequently being reported from Indian
shrimp aquaculture system.

Clinical signs
Shrimps affected by IHHNV show RDS, smaller size compared to control and there will be

166
 large scale size variation. Usually mortality is not recorded due to IHHNV infection. However, under
severe stress conditions, these shrimps may show mortality.

Disease diagnosis

Similar to WSSV, IHHNV can also be detected by histopathology, PCR, Realtime PCR, in situ
hybridization and LAMP. Here also, PCR is considered as most popular.

Different steps in PCR diagnosis of IHHNV

IHHNV has similar targets as WSSV. Therefore, all the samples used for WSSV detection, can
also be used for IHHNV detection. DNA extracted for WSSV detection can also be used for IHHNV
detection. Different primers have been used for detection of IHHNV. Care should be taken to avoid
primers that can detect integrated IHHNV to shrimp genome. Several commercially available kits
are also available. Nested PCR protocols are available for IHHNV detection. Amplification of
products and agarose gel detection will be similar to that of WSSV.

Enterocytozoonhepatopenaei (EHP)
This is also called as hepatopancreatic microsporidiosis (HPM) and is an emerging disease that
affects seriously to many of the farms in South East Asian countries and in India. First reported as
an un named micro sporidian from growth retarded giant or black tiger shrimp Penaeus monodon
from Thailand and was subsequently characterized in detail. It also has much smaller spores
(approximately 1μm in length) and is currently known to infect both P. monodon and P. vannamei.
It has been found that EHP can be transmitted directly from shrimp to shrimp by cannibalism and
cohabitation

Clinical signs
There are no specific clinical signs for EHP. Associated slow growth and size variations are the
only clinical signs. No mortality has been reported to be associated with EHP. Shrimps affected with
white gut syndrome are of ten found to be positive for EHP but a strong correlation has not yet been
confirmed.

167
Disease detection
Presently direct microscopy, histopathology, in situ hybridization, PCR, Realtime PCR and
LAMP is being used for the detection of EHP.

Different steps in PCR diagnosis of

Sampling: The target organ for EHP is the hepatopancreas. The spores also come out through the
intestine in the faecal strands. Therefore, as a non-lethal sample protocol, the faecal strings can also
be used for EHPdetection.
DNAextraction: The principle of DNA extraction is similar to that of WSSV and IHHNV. As the
target organs here are expected to contain more PCR inhibitors, it is suggested to use one established
method to make sure that the DNA obtained is pure enough to avoid any false positive.
Thermocycling: Basic principles are similar as above. Here the primers sequences are different.
Accordingly, the cycling conditions also vary. A nested PCR protocol is available for EHP
detection.

Detection
The amplified product is detected in similar way as described above.

168
Primer Used for Disease Screening

Disease Forward Rev Base

pairs

First 5’-ACT-ACT-AAC-TTC-AGC- 5’-TAA-TGC-GGG-TGT-AAT-GTT- 1447

CTA-TCTAG-3 CTT-ACG-A-3’

Nested 5’-GTA-ACT-GCC-CCT-TCC- 5’-TAC-GGC-AGC-TGC-TGC-ACC- 941

ATC-TCC-A-3’ TTG-T-3’

WSSV OIE

First 5’ATCATGGCTGCTTCACAGAC- 5’-GGCTGGAGAGG ACAAGACAT- 982

3’ 3’
Kimura
primers

Nested 5’-TCTTCATCAGATGCTACTGC- 5’-TAACGCTATCCAGTATCACG-3’ 570

3’

IHHNV 5-GGG-CGA-ACC-AGA-ATC- 5’-ATC-CGG-AGG-AAT-CTG-ATG- 389

ACT-TA- 3 TG- 3

First 5’- 5’- 779

CAGCAGGCGCGAAAATTGTCC AAGAGATATTGTATTGCGCTTGC
A-3’ TG-3

EHP
Nested 5’- 5’- 176
CAACGCGGGAAAACTTACCA- ACCTGTTATTGCCTTCTCCCTCC-
3’ 3’

169
 RNA EXTRACTION PROTOCOL

Homogenize 50-100mg tissue/106 cells in 1ml TRI soln. Centrifuge @ 12,000 rmp for 10 mins
@ 4ºC.

↓
Add 0.2ml chloroform per 1 ml TRI soln for phase separation, Centrifuge @ 12,000 rpm for
15 mins @ 4ºC.

↓
To the supernatant add 0.5ml isopropanol and precipitate RNA by incubating at RT for 10
mins. Centrifuge @ 10,000 rpm for 15 mins @ 4ºC.

↓
Wash RNA pellet with 1ml of 75% Ethanol per 1ml of TRI soln used. Centrifuge @ 12,000
rpm for 15 mins @ 4ºC.

↓
Air dry the pellet. Resuspend RNA pellet 35-100µl RNase free water.

Quantification of RNA: 50ul cuvette: 10M Tris-cl DEPC water

49ul of sterile or DEPC water+ 1ul of RNA

↓
Vortex for few seconds
↓
The 5ul of sample is quantified in biophotomer 540 nm.

Purity of RNA should be around 1.8 to 2.0 at 260/280 value

Calculation
=40 x 260 OD value X 50
=value X 0.050

=Value/50ul
=convert the value for 1ul concentration.

170
Synthesis of cDNA
About 2µg concentration of total RNA solution was taken. A volume of 4µl Dntp 2.5mM
mix was added. Final volume was made to 16µl with nuclease free water. The sample was
allowed to heat for 3-5 mins at 65-70ºC. Allowed to spin briefly and placed on ice. A volume
of 2µl 5X RT buffer, 1µl of RNase inhibitor, and 1µl of MuLV Reverse Transcriptase enzyme
were added. Incubated at 42ºC for 1hr. The enzyme was inactivated at 80ºC for 5mins. Stored
at -20ºC for further analysis.

PCR Cycles
Intial denaturation: 95°C (3 min)
Denaturation : 95°C (30 sec)

Annealing temperature (based on primer): 30 sec

Extension : 72°C (30 sec)

Final Extension : 72°C (5 min)

171