Vol 2019
Uploaded by
Arisitica VinilescuVol 2019
Uploaded by
Arisitica VinilescuUniversity of Agronomic Sciences
SCIENTIFIC BULLETIN. SERIES F. BIOTECHNOLOGIES. Volume XXIII, 2019
and Veterinary Medicine of Bucharest
Faculty of Biotechnologies
SCIENTIFIC BULLETIN
SERIES F. BIOTECHNOLOGIES
Volume XXIII
ISSN 2285 – 1364 2019
ISSN-L 2285 – 1364 BucharesT
SCIENTIFIC BULLETIN
SERIES F. BIOTECHNOLOGIES
Volume XXIII, 2019
1
2
University of Agronomic Sciences
and Veterinary Medicine of Bucharest
Faculty of Biotechnologies
SCIENTIFIC BULLETIN
SERIES F. BIOTECHNOLOGIES
Volume XXIII
2019
BucharesT
3
SCIENTIFIC COMMITTEE
• Petru ALEXE – Faculty of Food Science and Engineering, “Dunărea de Jos” University of Galați, Romania
• Paulo Jose do AMARAL SOBRAL – Depto de Eng. De Alimentos – FZEA USP, Pirassununga, Brazil
• Ioan ARDELEAN – Institute of Biology, Romanian Academy, Romania
• Narcisa BĂBEANU – Faculty of Biotechnology, USAMV of Bucharest, Romania
• Gabriela BAHRIM – Faculty of Food Science and Engineering, “Dunărea de Jos” University of Galați, Romania
• Gustavo V. BARBOSA-CANOVAS – Washington State University Pullman, State of Washington, USA
• Judith BARETTE – Manchester Metropolitan University, United Kingdom
• Nastasia BELC – Faculty of Biotechnologies, USAMV of Bucharest, Romania
• Daniela BORDA – Faculty of Food Science and Engineering, “Dunărea de Jos” University of Galați, Romania
• Monica BOSCAIU- Mediterranean Agroforestry Institute (IAM, UPV), Universitat Politècnica de València, Spain
• Dorica BOTĂU – Faculty of Agriculture, USAMVB from Timișoara, Romania
• Călina Petruța CORNEA – Faculty of Biotechnologies, USAMV of Bucharest, Romania
• Ortansa CSZUTAK – University of Bucharest, Romania
• Delia DIMITRIU – Manchester Metropolitan University, United Kingdom
• Katherine FLYNN – European Association for Food Safety, Brussels, Belgium
• Gustavo Fidel GUTIERREZ-LOPEZ – ENCB-IPN, National School of Biological Sciences, National Polytechnic
Institute, Mexico
• Florentina ISRAEL-ROMING – Faculty of Biotechnologies, USAMV of Bucharest, Romania
• Ștefana JURCOANE – Faculty of Biotechnologies, USAMV of Bucharest, Romania
• Huub LELIEVELD – GHI Association Netherlands and EFFoST Executive Committee, Netherlands
• Florentina MATEI – Faculty of Biotechnologies, USAMV of Bucharest, Romania
• Amalia Carmen MITELUȚ – Faculty of Biotechnologies, USAMV of Bucharest, Romania
• Dumitru MILITARU – Institute Pasteur, Bucharest, Romania
• Anca NICOLAU – Faculty of Food Science and Engineering, “Dunărea de Jos” University of Galați, Romania
• Estela de Oliveira NUNES – Santa Catarina West University – UNOESC Biotechnological Nucleus, Brazil
• Paola PITTIA – Dipartimento di Scienze degli Alimenti, University of Teramo, Italy
• Mona Elena POPA – Faculty of Biotechnologies, USAMV of Bucharest, Romania
• Cristina SILVA – ISEKI Food, Catholic University of Portugal, Portugal
• Ileana STOICA – University of Bucharest, Romania
• Tatiana VASSU – University of Bucharest, Romania
• Margarida VIEIRA – Directora do Dep. De Engenharia Alimentar, Instituto Superior de Engenharia, Universidade do
Algarve, Portugal
• Medana ZAMFIR – Institute of Biology, Romanian Academy, Romania
EDITORIAL BOARD
General Editor: Călina Petruţa CORNEA
Executive Editor: Ştefana JURCOANE
Secretariat: Oana LIVADARIU, Luminița VIȘAN, Daniela BĂLAN
PUBLISHERS:
University of Agronomic Sciences and Veterinary Medicine of Bucharest, Romania –
Faculty of Biotechnologies
Address: 59 Mărăşti Blvd., District 1, Zip code 011464, Bucharest, Romania,
Phone: + 40 21 318 25 64, Fax: +40 21 318 28 88,
E-mail: [email protected], Webpage: http://biotechnologyjournal.usamv.ro
CERES Publishing House
Address: 29 Oastei Street, District 1, Bucharest, Romania
Phone: + 40 21 317 90 23, E-mail: [email protected], Webpage: www.editura-ceres.ro
Copyright 2019
To be cited: Scientific Bulletin. Series F. Biotechnologies, Volume XXIII, 2019
The publisher is not responsible for the opinions published in the Volume.
They represent the authors’ point of view.
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
International Database Indexing: COPERNICUS, CABI, GOOGLE SCHOLAR, DOAJ, Scipio, PBN (Polish Scholarly
Bibliography), OCLC, Research Bible, Cite Factor (Academic Scientific Journals), Universal Impact Factor
4
IN VITRO Allium tuncelianum
Lycopersicum esculentum
Pinanga dicksonii
(Arecaceae)
Varroa destructor
IN VITRO
5
Brassicaceae
A Chlorella sorokiniana
Synechocystis
IN VITRO Bacillus licheniformis
(Equus asinus)
6
Hyssopus officinalis .
7
8
Agricultural
biotechnology
9
10
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
A REVIEW OF IN VITRO STUDIES ON
Allium tuncelianum (Kollman) Ozhatay, Matthew, Siraneci
Faika YARALI KARAKAN1, 2
1
Kilis 7 Aralik University, Faculty of Agriculture, Department of Horticulture,
Dogan Gures Pasa Bd., No 134, Kilis, Turkey
2
Kilis 7 Aralik University, Advanced Technology Application and Research Center (ATARC),
Kilis, Turkey
Corresponding author email: [email protected]
Abstract
Allium tuncelianum (Kollman) Ozhatay, Matthew, Siraneci is an endemic plant species only grown in Turkey. Unlike
common garlic, it has only one clove bulb and it can also produce fertile flowers and seeds. Due to the similarity of its
flavor and taste to Allium sativum, it is called ʻtunceli garlicʼ and ʻovacik garlicʼ in the region. In recent years, the
amount of consumption has increased due to revealing the benefits of biochemical content to human health. For this
reason, Allium tuncelianum has been collected from nature for domestic and medical purpose by herbalists and local
people. So, it is in danger of extinction due to unconscious and over-exploitation from the nature. In recent years,
different strategies have been developed to protect Allium tuncelianum from destruction. Germination problems of its
seeds have led researchers to use in vitro techniques. These studies focus to develop an efficient protocol for
propagation and conservation of this endemic species. In this review, in vitro studies on Allium tuncelianum were
evaluated.
Key words: Allium tuncelianum, Tunceli garlic, in vitro propagation.
INTRODUCTION strong antioxidant and antiradical activity than
Allium sativum L. Because of high amount of
Allium tuncelianum (Kollman) Ozhatay, p-Coumaric acid content of Allium
Matthew, Siraneci has a limited distribution in tuncelianum, it has much higher antioxidant
eastern Anatolia in the Tunceli and Erzincan activity compared with the Allium sativum.
areas. It is locally called as ‘Tunceli garlic’ or And also in terms of fatty acid compositions
‘Ovacik garlic’. Allium tuncelianum is Allium tuncelianum is observed having more
originally named as Allium macrochaetum effective level of essential omega acids
Boiss and Haussk subsp. tuncelianum compared to the common garlic (Sehitoglu et
Kollmann. It is an important endemic species al., 2014; 2018).
for Turkey. It was discovered in 1980s. The Picking of endangered geophytes for trade is
bulbs and young leaves of A. tuncelianum are banned in Turkey for conservation purpose in
used as vegetable and spice locally, being very agreement with the “Convention on the
similar in flavor to Allium sativum (Ozhatay & International Trade in Endangered Species
Mathew, 1995; Etoh & Simon, 2002; Yanmaz (CITES)”. However, Allium tuncelianum has
& Ermis, 2005; Kosar et al., 2006; Ipek et al., been collected from nature for domestic and
2008; Yanmaz et al., 2010; Baktir et al., 2013; medical purpose by herbalists and local people
Kiralan et al., 2013; Aasim, 2015; Yarali & in Turkey. So, it is in danger of extinction due
Yanmaz, 2016). to unconscious and over-exploitation from the
Consumption of Allium tuncelianum has nature (Yanmaz et al., 2010; Aasim, 2015).
several benefits such as stimulates the body's Conservation efforts can be complemented by
immune system, lowers the level of sugar and development of in vitro conservation protocols
cholesterol in the blood, improve blood along with improved agronomic techniques
circulation thus reduces the risk of heart attack suitable for cultivation of the plant in other
(Agbas et al., 2013; Aasim, 2015; Atila et al., areas of Turkey. The application of in vitro
2017). In addition, Allium tuncelianum has a culture techniques for the protection of
11
endemic Allium tuncelianum is less common
than for Allium sativum. Therefore, extensive
studies are needed to develop tissue culture
techniques for Tunceli garlic with significant
advantages (Kosar et al., 2006; Yazar, 2006;
Kizil et al., 2014; Aasim, 2015). In recent
years, different strategies have been developed
to protect Allium tuncelianum from destruction.
However, there are a limited number of studies
on in vitro conservation of endemic ʻTunceli
garlicʼ. In this review, in vitro studies on
Allium tuncelianum were evaluated.
Figure 3. Seeds of Allium tuncelianum (Photographed
IN VITRO STUDIES by: Faika YARALI KARAKAN)
Unlike Allium sativum, Allium tuncelianum has Allium tuncelianum multiplies naturally by seed
only one clove bulb and it can also produce or vegetative by newly regenerated bulb
fertile flowers and seeds (Yazar, 2006; Yanmaz attached to mother bulbs. However, the
et al., 2010; Agbas et al., 2013; Baktir et al., percentage of new regenerated bulbs and the
2013; Kiralan et al., 2013; Aasim, 2015; Kizil number of plantlets per bulb is too low for
& Khawar, 2015; Takim, 2015; Yarali & practical regeneration purposes. In addition,
Yanmaz, 2016; Babacan et al., 2017) (Figures seeds have germination problem (Yanmaz et
1, 2 and 3). al., 2010; Kizil et al., 2014). In vitro techniques
are useful tool to develop propagation methods
for Allium tuncelianum (Yanmaz et al., 2010).
For this reason, researchers aimed to develop in
vitro protocols by using in vitro techniques,
such as shoot and root culture, leaf culture,
bulb culture, in vitro seed germination and
gynogenesis.
Root and shoot culture
In vitro root and shoot tip culture methods used
to propagation of Allium tuncelianum by Yazar
(2006). Murashige and Skoog (MS) basal
Figure 1. Bulbs of Allium tuncelianum medium supplemented with BA (0.0, 0.1 and
(Photographed by: Faika YARALI KARAKAN)
1.0 mg/l), 2,4-D (0.0, 1.0 and 2.0 mg/l), NAA
(0.0, 1.0 and 2.0 mg/l) were used in root tip
culture. Root tip explants prepared from root
tissues are planted in petri dishes then cultured
at 25 ± 10°C under dark conditions and taken 1
month later under fluorescent light to 16/8 h. In
shoot tip culture, bulbs were opened under a
binocular microscope then explants having 0.5-
1.0 cm long leaflets were prepared after bulbs
were disinfected. They were cultured in MS
basal medium supplemented with BA (0.0, 0.05
and 0.1 mg/l); 2,4-D (0.0, 0.1 and 0.5 mg/l);
NAA (0.0, 0.1 and 0.5 mg/l). As a result of the
Figure 2. Inflorescence of Allium tuncelianum research, it was stated that callus formation
Photographed by: Faika YARALI KARAKAN) couldn’t be provided in root tip culture
12
experiments. But in the shoot tip culture NAA. The bulblet regeneration rate increased
experiment, shoot formation started to 60% at a concentration of 4 mg/l BAP + 0.5
approximately 1 month after shoot tip planting. mg/l NAA and reached 100% at a
After 4 sub-cultures, it was determined that MS concentration of 5 mg/l BAP + 0.5 mg/l NAA.
medium containing IAA gave out better results For obtaining virus-free plant, Taskin et al.
than NAA with regard to the number of shoots. (2013) aimed to combine meristem culture
The highest shoot rate was obtained from the technique by shoot tip culture technique. They
medium supplemented with 0.05 mg/l BA+0.1 used two different culture media (Medium 1;
mg/l IAA with 76%. This was followed by MS + 0.5 mg/l 2-IP + 0.2 mg/l NAA + 30 g/l
medium supplemented with 0.1 mg/l BA, 0.1 sucrose and Medium 2: MS + 2 mg/l BA + 0.5
mg/l BA + 0.1 mg/l NAA with 67% and 0.05 mg/l IBA + 30 g/l sucrose) and two garlic
mg/l BA + 0.5 mg/l IAA with 65%, 0.05 mg/l species, Allium sativum and Allium
BA with 56%. In a similar study, Yanmaz et al. tuncelianum. They stated that Medium 2 was
(2010) aimed to develop a novel found more effective in term of number of
micropropagation method for in vitro shoots than Medium 1. In the first propagation,
propagation of Allium tuncelianum by root tip 14.10 shoots/plant and 4.63 shoots/plant were
and shoot culture techniques. Root tips were obtained from Medium 2 and Medium1,
obtained from 18 days old in vitro plantlets. To respectively. And also Medium 2 has been
determine the best combinations of the growth successful at subculture. It was obtained 13.27
regulators; 2,4-D and NAA (0, 1.0, 2.0 mg/l) shoots per plant from Medium 2. Similar
and BA (0, 0.1, 1.0 mg/l) were used in MS results were obtained in shoot tip culture. 11.37
medium. According to results, the root tip and 2.41 shoots per plant were obtained from
culture was not found as a proper method for Medium 2 and Medium 1 in the first
shoot proliferation. On the other hand, shoot propagation, respectively. Considering the
culture was found effective on shoot formation. explant types, meristem explants were found to
As an average, 1 or 2 shoots were obtained per be more successful compared to shoot tip
explant. The researchers stated that Allium explants for both Allium sativum and Allium
tuncelianum could be propagated at lower tuncelianum. Real-time PCR analysis revealed
doses of plant growth regulators such as IAA that in vitro plants obtained from meristem
and BA (0.1 mg/l, 0.1 mg/l) via in vitro shoot culture do not have any onion yellow dwarf
culture. Contrary to these findings Kizil et al. virus (OYDV) and leek yellow stripe virus
(2014) suggested that root tip explants were (LYSV). Contrary to these findings OYDV and
most suitable for bulblet regeneration of Allium LYSV viruses were detected in plants obtained
tuncelianum. They used MS medium via shoot tip culture.
supplemented with 1.0, 2.0, 3.0, 4.0, 5.0 mg/l
2,4- D and 1.0, 2.0, 3.0, 4.0, 5.0 mg/l BAP and Leaf culture
0.5 mg/l NAA. The results indicated that root
tip explants were most suitable for bulblet Kizil et al. (2014) used leaf tips, the middle
regeneration on MS medium containing 5.0 portions of leaves and leaf bases explants and
mg/l BAP and 0.5 mg/l NAA. Similarly, Icgil MS medium supplemented with different
(2012) stated that root explants showed bulblet concentrations of 2,4- D, BAP and NAA. They
regeneration on root tips on MS medium stated that regeneration or callusing was not
containing various concentrations of BAP and observed on day 28 of culture on leaf tips or on
NAA. The bulblet regeneration rate from root the middle portion of leaves on MS medium
explants ranged from 13.33% to 100%. When containing 0.5-1.0 mg/l BAP + 0.5 mg/l NAA
the effect of MS medium containing different (five combinations). In addition, no bulblet
concentration of BAP and 0,5 mg/l NAA on the regeneration was induced from leaf bases on
bulblet regeneration rate was examined, it was MS medium supplemented with 1.0 mg/l BAP
seen that the bulblet regeneration rate and the plus 0.5 mg/l NAA, or 5.0 mg/l BAP plus 0.5
number of bulblets per explant decreased as the mg/l NAA. A maximum of 13.3% regeneration
concentration of BAP increased in the media was recorded on MS medium supplemented
containing 1, 2 and 3 mg/l BAP + 0.5 mg/l with 1.0 mg/l BAP plus 0.5 mg/l NAA. All
13
other culture media showed low regeneration This is very important for cultivation of Allium
percentages (6.7% each). Mean values of 1.0, tuncelianum (Yanmaz et al., 2010). Aasim
1.0 and 0.7 bulblets per leaf base were recorded (2015) used wintered and unwintered half
on MS medium containing 2.0 mg/l BAP plus cloves. Bulb explants were cultured at MS
0.5 mg/l NAA, 3.0 mg/l BAP plus 0.5 mg/l medium supplemented with 0.25, 0.50 and 1.0
NAA, or 4.0 mg/l BAP plus 0.5 mg/l NAA, mg/l BA and 0.25, 0.50 and 1.0 mg/l of KNAA
respectively. Similarly, İcgil (2012) stated that for regeneration. As a result, the study
no regeneration was recorded on leaf tip determined that unwintered and wintered upper
explant from MS medium with different and lower half clove explants failed to
concentrations of BAP-NAA, 2,4-D. Contrary regenerate new bulblets. However, proximal
to these findings, the highest regeneration rate half clove of the wintered bulbs was evaluated
(13.3%) on petiole explants was obtained from as the best explant for regeneration on MS
MS medium containing 2.0 mg/l BAP and 0.5 medium supplemented with 0.50 mg/l BA with
mg/l NAA. 0.50 mg/l KNAA. The rooted bulbs were
acclimatized and transferred to pots and fields.
Bulb culture It was concluded that the protocol could be
safely used to conserve this plant.
Icgil (2012) investigated the effects of different
concentrations of BAP, NAA, 2,4-D on Seed germination
different bulb explants such as; longitudinally
sectioned ½ and ¼ bulb explants. It was Allium tuncelianum has fertile black seed that
determined that plant growth regulators can easily be used for propagation. But they
substances and explant types were effective on undergo deep seed dormancy soon after
the shoot formation. While the highest shoot maturity. For this reason, the aim of in vitro
number per explant (83.33%) was obtained studies is to eliminate seed dormancy.
from MS medium containing 2 mg/l 2,4-D and Dormancy can be broken with the cold
no shoot formation was observed from MS treatment given to garlic before planting. Kizil
medium containing 1 mg/l 2,4-D from et al., (2017), aimed to break seed dormancy of
longitudinally sectioned 1/2 bulb explants. Allium tuncelianum and determine the
While the highest shoot number per explant (3) conditions for induction of bulblets on these
was obtained from MS medium supplemented seeds. They collected ʻTunceli garlicʼ seeds
with 1 mg/l BAP+ 0.5 mg/l NAA, the lowest from field grown plants. After being surface
shoot number per explant (0.67 ) was obtained sterilized, seeds were germinated on MS
from MS medium containing 2 and 3 mg/l medium with or without 20 g/l sucrose
BAP+ 0.5 mg/l NAA from longitudinally followed by their culture on 1 × 1900 mg/l, 2 ×
sectioned 1/4 bulb explants. Contrary to these 1900 mg/l, 4 ×1900 mg/l and 6 × 1900 mg/l
positive findings, Kizil et al. (2014) stated that KNO3 to increase bulb diameter. At the end of
vertically-sectioned half or quartered bulb or the study, it was reported that bulb formation
both horizontally-sectioned upper and lower rate on each of the germinated seeds was not
half-bulb explants were unsuitable for the parallel to seed germination rate. A total of
regeneration of new bulblets. They cultured all 34% seeds (with 138 seeds that converted to
these explants on MS medium supplemented bulbs) and 28.5% (with 94 seeds that converted
with different concentrations of 2,4-D, BAP to bulbs) on MS medium with and without 20
and NAA. Their results showed that no bulblet g/l sucrose, respectively. The results showed
regeneration was obtained from any vertically- that MS medium containing sucrose had
sectioned half or quartered bulb and both significantly positive effect on seed
horizontally-sectioned upper and lower half- germination and bulb induction and vegetative
bulb explant. growth. The best increase in bulb diameter was
Over wintered ʻTunceli garlicʼ bulbs had a noted on MS medium containing 1×1900 mg/l
potential to produce bigger bulbs than KNO3 after 178 days with bulblet diameter and
unwintered materials. These bulbs had a bulblet weight of 0.54 cm and 0.048 g,
significant effect on uniform plant formation. respectively.
14
Gynogenesis REFERENCES
There have been conducted out several studies Aasim, M. (2015). Adventitous bulblet regeneration of
for in vitro propagation of Allium tuncelianum endemic Ovacik garlic (Allium tuncelianum Kollman,
Ozhatay, Mathew, Siraneci) using wintered half
but breeding studies were not carried out. clove explant. Romanian Biotechnological Letters,
Today, biotechnological breeding methods 20(5), 10845‒108551.
offer great benefits in breeding. Using dihaploi- Agbas, B., Karakus, D., Adiguzel, G., Keser, S., Demir,
dization techniques provides great advantages E. (2013). Comparison of total antioxidant properties
in obtaining the inbreed lines used in hybrid and dry matter content of Tunceli garlic (Allium
tuncelianum) and normal garlic (Allium sativum),
breeding in a short time. Different methods Bilim ve Genclik Dergisi, 1(2), 50-62. ISSN: 2148-
have been improved for in vitro haploid 0273.
production, but only gynogenesis has been Atila, G., Uslu, H., Erdag, D., Ozkan, O. (2017).
reported to be successful in Alliums. Yarali and Antioxidative and antihyperglycemic effects of
Yanmaz (2016) aimed to ensure optimization Allium tuncelianum on streptozotocin induced type I
diabetes, International Congress on Medicinal and
technique for Allium tuncelianum which were Aromatic Plants, s: 411, May 10-12, 2017, Konya.
used successfully for other Allium species. It is Babacan, E. Y., Polat, R., Cakilcioglu, U. (2017).
the first research about determining of Munzur garlic (Allium tuncelianum Kollman,
gynogenic induction frequency of Allium Ozhatay, Mathew, Siraneci) and traditional use,
tuncelianum via flower bud culture. They used International congress on medicinal and aromatic
plants, s: 1343, May 10-12, 2017, Konya.
BDS medium supplemented with 0, 1 and 2 Baktir, I., Yilmaz, G., Gokturk, R. S., Karaguzel, O.
mg/l of 2,4-D and BAP and their combinations (2013). Edible flowering geophytes of Turkey. Acta
to determine the effect of plant growth Hortic., 1002, 297–300, DOI:
regulators on gynogenic embryo induction. 10.17660/ActaHortic.2013.1002.38,http://dx.doi.org/
They stated that BDS medium supplemented 10.17660/ActaHortic.2013.1002.38.
Etoh, T., Simon, P. W. (2002). Diversity, fertility and
with different combinations of auxin (2,4-D) seed production of garlic. In H. D. Rabinowitch, L.
and cytokinin (BAP) were effective on callus Currah (Eds.), Allium Crop Science: Recent
development on explants. The highest callus Advances (pp. 101–117). CABI Publishing, New
formation rate was obtained from BDS medium York.
supplemented with 2+1 mg/l 2,4-D+BAP and Icgil, D. Y. (2012). In vitro micropropagation of Tunceli
garlic (Allium tuncelianum (Kollman), Ozhatay,
2+2 mg/l 2,4-D+BAP. In this research, callus Matev, Şiraneci). University of Dicle, Institute of
development was provided on flower buds at Natural and Applied Sciences, Department of Field
55.28% but plantlets could not be achieved Crops, MS thesis, Diyarbakir, Turkey.
from callus. This study is important due to the Ipek, M., Ipek, A., Simon, P. W. (2008). Genetic
guidance for future studies about haploid plant characterization of Allium tuncelianum: An endemic
edible Allium species with garlic odor. SciHortic.,
production on Allium tuncelianum. 115, 409–415.
Kiralan, M., Rahimi, A., Arslan, N., Bayrak, A. (2013).
CONCLUSIONS Volatiles in an endemic Allium specie: Allium
tuncelianum by headspace solid phase
In vitro studies on Allium tuncelianum were microextraction, TEOP, 16(3), 417–420.
Kizil, S., Icgil, D. Y., Khawar, K. M. (2014). Improved
carried out by several researchers. This subject in vitro regeneration and propagation of Tunceli
is important, considering that it is an endemic garlic (Allium tuncelianum L.), Journal of
species and has biochemical content, important Horticultural Science & Biotechnology, 89(4), 408–
for human health. Researches have been aimed 414.
to reveal the well-established protocols for in Kizil, S., Khawar, K. M. (2015). Effect of planting
depths on some agronomic characteristics of Allium
vitro propagation and conservation, and in part, tuncelianum, Scientific Papers. Series B,
some successful results have been achieved. Horticulture, Vol. LIX, Print ISSN 2285-5653, CD-
Efforts have been done to regenerate plants ROM ISSN 2285-5661, Online ISSN 2286-1580,
under in vitro conditions. But, there is need for ISSN-L 2285-5653.
doing extensive work for development of Kizil, S., Sogut, T., Khawar, K.M. (2017). Germination
and bulb formation of Allium tuncelianum L. under in
comparatively more efficient and reproducible vitro condition, ICAB 2017: 19th International
in vitro protocols for propagation, breeding and Conference on Agriculture and Biotechnology. 13-14
conservation purposes of Allium tuncelianum. July, Stockholm, Sweden.
15
Kosar, M., Koyuncu, M., Baser, K. H. C. (2006). Folk producing virus free plant in garlic and their
use of some wild and cultivated Allium species in identification through real-time PCR, Hindawi
Turkey. Proceedings of the IVth International Publishing Corporation, The Scientific World
Congress of Ethnobotany (ICEB 2005), Istanbul, Journal, Vol. 2013, Article ID 781282, 5 pages.
Turkey. https://doi.org/10.1155/2013/781282
Ozhatay, N., Mathew, B. (1995). New taxa and notes on Yanmaz, R., Ermis, S. (2005). Researches on
the genus Allium (Alliaceae) in Turkey and Arabia, overcoming the germination problems of Tunceli
Kew Bulletin, 50(4), 723‒731. garlic seeds (Allium tuncelianum (Kollman), N.
Sehitoglu, M. H., Yarali, F., Oztopuz, R. O., Kizilkaya, Ozhatay, D. Matthew, Siraneci). Turkey 2th Seed
B. (2014). Comparison of antioxidant and antiradical Congress, Adana, Turkey, 101‒106.
activities of lyophilized water extracts of two Yanmaz, R., Yazar, E., Kantoğlu, Y., Alper, A. (2010).
different types of Garlic (Allium sativum L. and In vitro plant regeneration and bulblet formation of
Allium tuncelianum L.), Workshop on Determining Tunceli garlic (Allium tuncelianum (Kollman)
Antioxidants as Reactive Species Scavengers, 27-28 Ozhatay, Matthew, Siraneci) by shoot and root
October, İstanbul, Turkey. culture, Journal of Food, Agriculture & Environment,
Sehitoglu, M. H., Yarali, Karakan, F., Kizilkaya, B., 8(3&4), 572‒576.
Oztopuz, R. O., Gulcin, I. (2018). Determination of Yarali, F., Yanmaz, R. (2016).The effects of media
some biofunctional properties of Allium tuncelianum composition on in vitro gynogenic embryo induction
(Kollman), N. Ozhatay, D. Matthew, Siraneci) and in Allium tuncelianum (Kollman) Ozhatay, Matthew,
Allium sativum L., 4th International Symposium of Siraneci. International Journal of Agriculture
Medicinal and Aromatic Plants, 2-4 October 2018, Sciences, ISSN: 0975-3710 & E-ISSN: 0975-9107,
Cesme-İzmir, Turkey. 8(58), 3247‒3251.
Takim, K. (2015). Measurement of in vitro antioxidant Yazar, E. (2006). Propagation of Tunceli garlic (Allium
activity of Tunceli rural garlic (Allium tuncelianum), tuncelianum (Kollman), N. Ozhatay, D. Matthew, S.
determination of its effect on the antioxidant enzyme Siraneci) through in vitro root and shoot tip culture,
activity and anticancer characteristics on rats, Inonu Ankara University, Graduate School of Natural and
University, Institute of Natural Sciences, Department Applied Sciences, Department of Horticulture,
of Chemistry, Ph.D. Thesis, Malatya, Turkey. Master thesis, Ankara, Turkey.
Taskin, H., Baktemur, G., Kurul, M., Buyukalaca, S.
(2013). Use of tissue culture techniques for
16
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
BIOTECHNOLOGICAL RECYCLING OF FRUIT TREE WASTES
THROUGH ORGANIC CULTIVATION OF MUSHROOM SPECIES
Gabriela ȚEȚU
University of Piteşti, 1 Târgul din Vale Street, Piteşti, 110040, Romania
Corresponding author email: [email protected]
Abstract
The excessive and long-term accumulation of large amounts of redundant lignocellulose materials, as outcome wastes
from the specific activities of all fruit tree farms across the whole country in Romania, has become a huge problem
which needs to be solved by using biological means for their conversion into beneficial products. Thus, the main aim of
this work was to solve this problem by recycling the fruit tree wastes through organic cultivation of two mushroom
species, Ganoderma lucidum and Pleurotus ostreatus. The fruit body productions of each one of these mushroom
species registered the highest levels as 1,830 g for G. lucidum and 2,750 g for P. ostreatus, relative to 5 kg of substrates
made of fruit tree wastes. According to these results, the suitable biotechnological procedures for recycling of apple,
plum and cherry tree wastes through organic cultivation of mentioned mushroom species is presented in this paper.
Key words: biotechnology, Ganoderma lucidum, Pleurotus ostreatus, lignocellulose wastes.
INTRODUCTION MATERIALS AND METHODS
It is well known that every year huge amounts Mushroom species used in experiments
of redundant lignocellulose materials outcome As a mushroom species belonging to the group
from any orchard as fruit tree wastes which of white rot fungi, Ganoderma lucidum (Curt.
cause serious environmental troubles if they Fr.) P. Karst is a wood degrading fungus,
accumulate in the local fruit tree farms or they belonging to lignin decomposers. Until now, G.
are burned on the soil of other areas (Chahal, lucidum species has been cultivated mainly on
1993; Carlile & Watkinson, 1996). wood substrates or as fungal mycelium in
All these natural but redundant materials, synthetic liquid media in small scale production
mainly composed of dried trunks and branches processes (Stamets, 1993; Cohen et al., 2002).
of fruit trees, could be recycled as main On the other side, P. ostreatus (Jacquin ex
substrates for solid-state cultivation of Fries) Kummer is a mushroom species with a
mushroom species belonging to the group of high potential to grow on lignocellulose wastes
Basidiomycetes (Stamets, 1993; Moser, 1994). and form mushroom fruiting bodies during
In this respect, the experiments were set up on their biological cycles (Sanchez, 2010).
testing and optimizing the biotechnological In order to achieve the experiments related to
processes of fruit tree wastes recycling through biotechnological recycling of fruit tree wastes
controlled cultivation of edible and medicinal through organic cultivation of mushroom
mushroom species Ganoderma lucidum and species, selected pure cultures of mushrooms
Pleurotus ostreatus, in order to get their from the culture collection belonging to the
carpophores to be used as food and University of Pitesti were used. The stock
nutraceuticals (Smith, 1998). cultures were maintained on malt-extract agar
The main aim of this research work was (MEA) slants at 25°C for 5-7 days and after
focused to find out the best biotechnological that, they were stored at 4°C. To achieve the
procedure for recycling the fruit tree wastes experiments, the mushroom pure cultures were
from orchards through the organic cultivation transferred in 250-mL flasks containing
of certain mushroom species on these wastes 100 mL of MEB medium (20% malt extract,
made of lignocellulose materials and finally get 2% yeast extract and 20% peptone solution in
the carpophores of edible and medicinal pure water up to 100%) and let to grow at 23°C
mushrooms.
17
on rotary shaker incubators at 110 rev min-1 for polypropylene bags, formed the fruit bodies
5-7 days (Petre et al., 2014) belonging to both mushroom species.
During the process of fruit body formation the
Substrate variants for mushroom cultivation culture parameters were set up and maintained
For the optimal cultivation of mushroom at the following levels depending on each
species G. lucidum and P. ostreatus, there were mushroom species used in experiments: the air
set up three variants of mushroom cultivation temperature, 18-20oC, the air flow volume, 5-7
substrates, mainly consisting of natural m3/h, air flow speed, 0.2-0.3 m/s, the relative
compounds like woody wastes made of moisture content, 95-97%, the light intensity,
sawdust resulted from milled branches of 500-1,000 luces for 8-10 h/day. The whole
apple, plum and cherry, which were chopped, period of mushroom growing from the
mixed and hydrated (24-30 h) with a solution inoculation up to the fruit body formation
made of following ingredients: wheat bran, lasted between 30-35 days for P. ostreatus and
yeast extract, calcium carbonate and tap water, 60-70 days for G. lucidum.
as it is shown in Table 1.
RESULTS AND DISCUSSIONS
Table 1. The composition of substrate variants
for the controlled cultivation of mushroom species After the first stage of primordial formation,
Substrate ingredients The composition of each the carpophores belonging to both mushroom
substrate variant (w/w) species have developed continuously in a fast
S1 S2 S3
growing process. Thus, during the five crop
Sawdust from milled
apple branches
70 - - stages of such biological process, the
Sawdust from plum carpophores of both species were studied
- 70 - regarding their body development and
milled branches
Sawdust from cherry
- - 70
increasing in significant weight. In this respect,
milled branches during a period of time lasting between 30 and
Wheat bran 10 10 10 70 days, the mature carpophores belonging to
Yeast extract 3.5 3.5 3.5
both mushroom species were collected and
Calcium carbonate 1.5 1.5 1,5
Tap Water 15 15 15 after that, they were weighted.
The results regarding the harvest of
Then, all three variants of substrates, S1, S2, S3 carpophores for each one of the mushroom
were soaked in a nutritive aqueous solution species were registered and assessed during a
made of natural ingredients, having the period of time lasting from 35 up to 70 days,
composition presented in Table 1, and then depending on the mushroom species used in
were placed in thermorezistant polypropylene experiments, as it is shown in Tables 2 and 3.
bags with 5 kg weight, subsequently being
Table 2. The mushroom harvest variation, depending on
sterilized in an autoclave at the temperature of each crop stage and substrate variant, during the
121oC, for 50 min. After cooling, the contents cultivation of G. lucidum
of sterilized polypropylene bags containing the Crop Mushroom Mushroom Mushroom
substrate variants were aseptically inoculated stage harvest on harvest on harvest on
with the pure cultures of mushroom species G. substrate substrate substrate
lucidum and P. ostreatus. Next, all bags with S1* (w/w) S2* (w/w) S3* (w/w)
the variants of substrates, previously I 610 490 530
disinfected by sterilization and inoculated with II 475 350 450
pure cultures of mentioned mushroom species, III 350 270 320
IV 240 210 250
were placed into automatic growing chambers V 155 140 120
and kept at the constant temperature of 23oC, Total 1,830 1,460 1,670
for 15-30 days depending on the mushroom weight
species used in experiments. Then, during the (g)
*
incubation, the whole mycelial biomass, The average of harvest which were registered during
developed inside the substrates, placed in three repeated cultivation cycles
18
Table 3. The mushroom harvest variation, depending on
each crop stage and substrate variant, during the
cultivation of P. ostreatus
Crop Mushroom Mushroom Mushroom
stage weights on weights on weights on
substrate S1* substrate S2* substrate S3*
(w/w) (w/w) (w/w)
I 730 770 590
II 650 630 430
III 510 530 310
IV 370 470 250
V 310 350 210
Total 2,570 2,750 1,790
weight
(g)
*
The average of weights which were registered during
three repeated cultivation cycles
Regarding the registered results, it is of great
importance to take into consideration that each
value of weight, presented both in Table 2 and
Table 3 means the average of weights which
were registered during three repeated
cultivation cycles, by keeping constant the
environmental factors (the air temperature at
18-20oC, the air flow volume, 5-7 m3/h, the air
flow speed, 0.2-0.3 m/s, the relative moisture Figure 1. G. lucidum carpophores,
content, 95-97%, the light intensity, 500-1,000 developed on the substrate S1
luces for 8-10 h/day).
Comparing the values of registered amounts of
mushroom carpophores belonging to G.
lucidum species, it has to be mentioned that the
highest total weights were noticed when it was
used the substrate variant S1, followed by the
substrate variant S3, and finally, by the
substrate variant S2.
Significant differences of mushroom weights
between the crop stages were noticed in the
case of G. lucidum, respectively between the
first three crop stages corresponding to the
mushroom harvest on substrate variants S1 and
S2, as they are shown in Table 2.
At the same time, there were determined
significant differences between the crop stages
of P. ostreatus, mainly between the first three
crop stages related to the mushroom harvest on
substrate variants S2 and S3, like they were
presented in Table 3.
In Figures 1, 2 and 3, the carpophores
belonging to G. lucidum mushroom species,
which have developed on substrate variants S1,
Figure 2. G. lucidum carpophores, grown on the
S2 and S3, are displayed. substrate variant S2
19
Figure 5. A bunch of P. ostreatus carpophores,
developed on the substrate variant S1
Figure 3. G. lucidum carpophores, grown on the
substrate variant S3
The collected carpophores belonging to the
mushroom species P. ostreatus are illustrated
in the Figures 4, 5 and 6.
Figure 6. P. ostreatus carpophores, grown on the
substrate variant S3
Regarding the results of P. ostreatus
harvesting, almost the same significant
differences between the crop stages were
noticed, but the highest total weights of
mushroom carpophores were registered for the
Figure 4. Bunches of P. ostreatus carpophores, substrate S2, followed by S1 and the last one
developed on the substrate variant S1 being the substrate S3.
20
According to the registered results, the optimal It is expected to implement this biotechnology
biotechnology for recycling fruit tree wastes by for recycling the fruit tree wastes, by following
using G. lucidum and P. ostreatus mushroom the controlled process previously presented, by
species was established and it is shown in decomposing such lignocellulose materials and
Figure 7: getting significant amounts of carpophores, as
well as providing the environment protection in
orchards designed for growing apple, plum and
Sawdust of fruit trees Pure cultures of
(apple, plum, cherry) G. lucidum, P. ostreatus cherry trees.
mushroom species
CONCLUSIONS
According to the registered results, the best
Preparation of Inoculation of pure
substrate variant for G. lucidum cultivation was
substrate variants cultures in liquid media
from fruit tree wastes and shaking incubation determined as being S1 and for P. ostreatus
mushroom species it was proven to be the
substrate variant S2.
By comparing the amounts of carpophores
Steam sterilization of Mushroom mycelia belonging to G. lucidum mushroom species
substrates inside growing in liquid
polypropylene bags media during the harvested on the substrate variants which have
at 123°C, 50 min incubation been used in experiments, it has to be
mentioned that the highest total weights were
noticed when it was used the substrate variant
Inoculation with liquid mycelia of all S1, followed by the substrate variant S3, and
substrate variants prepared from woody finally, by the substrate variant S2.
wastes of apple, plum and cherry trees
Speaking about the mushroom species P.
ostreatus, there were registered the highest
total weights of mushroom carpophores when
Incubation of inoculated substrate the substrate variant S2 was used, followed by
variants with liquid mycelia
in thermorezistant polypropylene bags, the substrate variant S1 and the last one being
placed in growing chambers, at 23-25°C, the substrate S3.
for 15-30 days Significant differences of mushroom weights
between the crop stages were noticed in the
case of G. lucidum, respectively between the
Formation and development of first three crop stages corresponding to the
carpophores at 18-20oC, for mushroom harvest on substrate variants S1 and
30-70 days, depending on the
mushroom species
S2. At the same time, there were determined
significant differences between the crop stages
of P. ostreatus, mainly between the first three
The harvest of carpophores
crop stages related to the mushroom harvest on
belonging to G. lucidum and substrate variants S2 and S3.
P. ostreatus species The fruit body productions of each one of these
mushroom species have registered the highest
Figure 7. Biotechnology for recycling the fruit tree levels as 1,830 g for G. lucidum and as 2,750 g
wastes by using G. lucidum and P. ostreatus mushroom in the case of P. ostreatus, relative to 5 kg of
species, through organic cultivation
substrate variants S1 and respectively S2,
mainly made of fruit tree wastes.
The most important advantage of using such
However, in-depth experiments regarding the
biotechnology for recycling the fruit tree
optimal valorizing of different types of
wastes by using G. lucidum and P. ostreatus is
lignocellulose wastes coming every year from
that the carpophores which were collected from
fruit tree growing works through controlled
the substrate variants are 100% natural food
cultivation of mushroom species like G.
products, being obtained through the organic
lucidum as well as P. ostreatus are going to be
cultivation of these mushroom species.
carried out in the next period of time.
21
ACKNOWLEDGMENTS Cohen, R., Persky, L., Hadar, Y. (2002).
Biotechnological applications and potential of wood-
degrading mushrooms of the genus Pleurotus. Appl
The author takes this opportunity to express her Microbiol Biot., 58(5), 582‒594.
gratefulness to Prof. PhD. Marian PETRE for Leahy, J. G., Colwell, R. R. (1990). Microbial
his academic supervision and useful advises to Degradation of Hydrocarbons in the Environment,
reach the main aim of presented experiments as Microbial Rev., 54, 305‒315.
a part of her PhD thesis. Moser, A. (1994). Sustainable biotechnology
development: from high-tech to eco-tech. Acta
This work was supported through the grant Biotechnology, 12, 2‒6.
awarded by the Romanian National Authority Petre, M., Petre, V., Duță, M. (2014). Mushroom
for Scientific Research and Innovation, biotechnology for bioconversion of fruit tree wastes
CNCS/CCCDI-UEFISCDI for the research into nutritive biomass. Rom. Biotechnol. Lett., 19(6),
project PN-III-P2-2.1-CI-2018-0975, in the 9952‒9958.
Sanchez, C. (2010). Cultivation of Pleurotus ostreatus
framework of PNCDI III, through the Funding and other edible mushrooms. Appl. Microbiol. Biot.,
Contract no 164/2018. 85(5), 1321‒1326.
Smith, J.E. (1998). Biotechnology. Cambridge University
REFERENCES Press, third edition.
Stamets, P. (1993). Growing Gourmet and Medicinal
Carlile, M. J., Watkinson, S. C. (1996). The Fungi. Mushrooms. Ten Speed Press, Berkeley, Toronto.
Academic Press: London.
Chahal, D. S. (1994). Biological Degradation and
Bioremediation of Toxic Chemicals. Chapman &
Hall, London.
22
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
PRELIMINARY RESULTS REGARDING THE TESTING
OF TREATMENTS WITH LED ON THE SEED GERMINATION
OF Lycopersicum esculentum L.
Oana LIVADARIU, Ruxandra-Daniela DUMITRU
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mărăști Blvd.,
District 1, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
The present study discusses the preliminary results obtained from testing the influence of LED treatments over seed
germination of three different Lycopersicum esculentum L. varieties. The respective varieties have been chosen for
their determined growth pattern, which would make them suitable for implementation within a vertical farming
system. Speeding up the germination process and ensuring that most, if not all the seeds germinate is relevant in
obtaining healthy and productive L. esculentum L. crops suitable for indoor farming, which will provide a
sustainable solution for a round-the-year constant production which can meet the market request, no matter the
climatic conditions specific to the area. The experimental results obtained show that treatments with light emitted of
LED (white, blue, red and natural light), on the seed germination of Lycopersicum esculentum L. varieties (Buzău
4C, Rio Grande ST and Saint Pierre ST), may influences: the sprouts rate, the fresh weight of sprouts, the fresh
weight of cotyledons, the fresh weight of hypocotyls, the fresh weight of roots, the length of hypocotyls and length of
roots.
Key words: Lycopersicum esculentum L., LED, seed germination.
INTRODUCTION Previous research conducted on L. esculentum
L. has shown a very strong connection
The present article discusses preliminary between productivity and the interaction
results regarding the testing of LED between temperature and light, from seed
treatments on seed germination of germination to harvesting (Verkerk, 1955).
Lycopersicum esculentum L. The intensive exploitation of arable land, the
Lycopersicum esculentum L. is an annual need for more and more space to satisfy the
herbaceous plant species from the Solanaceae needs of the planet’s population, call for
family, originating from South America, Peru, sustainable solutions, like the concept of
Bolivia and Ecuador (Popescu, 2008). The vertical farming (Despommier, 2009).
Solanaceae family is, from either an Applying this modern agricultural concept
economical, industrial or nutritional point of requires the development of technologies and
view, extremely important, as it includes very selection of species that will enable it.
valuable species, Lycopersicum esculentum L. Also, smart management of resources is
being one of the most representative (Kimura important (resources such as energy), thus
& Sinha, 2008). Aside from being one of the making LEDs extremely efficient (Yeh &
most commonly consumed fresh vegetable Chung, 2009).
around the world, the tomato (Lycopersicum However, there are many inconsistencies
esculentum L.) bears a fruit that has many when it comes to the physiological effects of
nutritional qualities (Suarez et al., 2007). LEDs over the course of the plant’s
Therefore, it is only natural for scientists to be development (Berkovich et al., 2017).
experimenting in improving the quality and The industrial importance of L. esculentum L.
the production rate of L. esculentum L., thus crops is undeniable therefore it is desirable
obtaining a remarkable number of mutants, that the production be increased without
which express a wide variety of selected traits affecting the quality of the final product.
(Kimura & Sinha, 2008). There are many aspects that press on food
23
industry and urge the development of modern V5, V6, V7, V8 – experimental variants
agricultural concepts. The discussions for Rio Grande ST variety;
surrounding the concept of Vertical Farming V9, V10, V11, V12 – experimental
are increasing, as global population and food variants for Saint Pierre ST variety.
demand increase (Kalantari et al., 2017). The working method, in terms of the
As far as lighting solutions go, previous Lycopersicum esculentum L. biological mate-
studies have shown increased efficiency in the rial is compliant with the conditions of the in
use of LEDs for growing sprouts and plants, vitro method, thus meaning the seeds have
such as pomegranate (Punica granatum). The been subjected to aseptization by means of
obtained sprouts have presented an ideal Domestos solution (2.5 ml of Domestos, 97.5
development state that resulted in extremely ml of aseptized distilled water) for 30 se-
efficient transplantations (Bantis et al., 2018). conds, followed by three washing sessions
Other studies conducted on Cucumis sativus with aseptized distilled water (10 minutes for
have shown that the production of qualitative each wash). The seeds have been inoculated
sprouts has increased while using LED on aseptized gauze and placed in transparent
supplementary illumination, while harvesting containers. The gauze has been moistened with
was conducted eight days earlier in compa- a share of 17 ml of aseptized distilled water
rison to a conventional, natural light based upon inoculation, followed by another share,
protocol (AGROBIZNES.MD, 2017). of 10 ml on the third day post inoculation.
Another study on the effect of LEDs on The experimental device was made up of
Lycopersicum esculentum L. seed germina- three sets of LEDs (Light Emitting Diodes),
tion was concluded with a recommendation of which have emitted light out of the white, blue
a certain balance between blue light and red and red light spectrum. The technical
light for a faster development (Yingchao Xu specifications of LEDs are: power 18 W,
et al., 2017). Moreover, studies conducted on voltage 220 V, light flux 435 lm and dominant
Lactuca sativa L. have demonstrated LED wavelength (Livadariu & Maximilian, 2017).
efficiency, not only from the yield point of The light variants used in the experiment are
view, but also when it comes to energy costs as follows: W- white LEDs, R- red LEDs, B-
and quality of harvest (Poulet et al., 2014; Lin blue LEDs, N- natural light.
et al., 2013). The experimental variants have been exposed
to the different types of lighting as follows:
MATERIALS AND METHODS
V1, V5, V9 – white LEDs (W);
V2, V6, V10 – blue LEDs (B);
The seeds used in order to obtain the prelim-
nary results regarding the testing of germina- V3, V7, V11 – red LEDs (R);
tion under LED treatments have been selected V4, V8, V12 – natural light (N).
as the adult plants have a determined growth, The incubation of the seeds was conducted
meaning they will not need any supplemen- under the following conditions: temperature
tary support during their vegetation period of 22°C ± 2°C with enforcement of light
and should be suitable for a vertical farming treatment for 16 h within a 24 h period.
system as well (Popescu & Zăvoianu, 2013). For each inoculation, quantitative determi-
The biological material used in the experi- nations (sprouts rate, fresh weight of sprouts,
ment consisted of seeds which have procee- fresh weight of cotyledons, fresh weight of
ded from three Lycopersicum esculentum L. hypocotyls and fresh weight of roots) as well
varieties: Buzău 4C, Rio Grande ST, Saint as morphometric determinations (length of
Pierre ST - respectively 60 seeds from each hypocotyls and length of roots) have been
variety, thus enabling the performance of 3 conducted.
repetitions by 15 experimental variants (one
variant contains 15 seeds from one of the RESULTS AND DISCUSSIONS
tested varieties) as follows:
V1, V2, V3, V4 – experimental variants The preliminary results regarding seed germi-
for Buzău 4C variety; nation of L. esculentum L. under the influence
24
of LEDs show clearly noticeable differences exposed to white LEDs, in comparison to the
in different aspects of sprout development. one exposed to natural light. In a more
The first aspect that should be discussed is the general approach, the discrepancy between
average value of seed germination (Figures 1, the blue LED lighting variant (B) and the rest
2 and 3). of the lighting variants (W, R, N) is the most
Significant differences can be noticed for the obvious, while there seems to be little to no
Rio Grande ST variety (V1, V2, V3, V4), as difference in their influence on germination.
results show that blue LED lights (B) have However, the red LEDs (R) prove themselves
had quite an impact in the encouragement of to be, again, most inefficient.
seed germination, in comparison with the red
LEDs (R). The results for the natural light (N)
are slightly under the ones for the blue LEDs, V8/N 12.66
8.66
while for the seeds treated with white LEDs,
even though in day 7 (D7) the number of V7/R 12.00
10.33
germinated seeds was similar to the results in
the red LED variant (R), in day 18 (D18), the 14.00
V6/B 11.00
gap is noticeably greater. Therefore, these
results show that in this variety’s case, blue 12.66
V5/W
LEDs (B) were the most efficient in 10.00
stimulating germination, while the red LEDs
0 5 10 15 20
(R) were the most inefficient.
For the Buzău 4C variety (V5, V6, V7, V8) D 18 D7
tested in this experiment, the results for the
germination rate (Figure 2) are not very Figure 2. The average values of the rate of seed
different from the ones for Rio Grande ST germination for the Buzău 4C variety, in day 7 (D7)
and day 18 (D18) post incubation
variety (Figure 1).
As for the Saint Pierre ST variety (V9, V10,
13.33
V11 and V12) tested (Figure 3), the
V4/N germination rates for the natural light (N), red
11.33
LED (R), blue LED (B) and white LED (W)
9.00
V3/R 8.66 lighting variants are very similar. However, in
terms of numbers and end results (D 18), the
V2/B 14.33
12.00
white LED (W) light has been apparently
most effective followed closely by the results
V1/W 10.66 of blue LED lighting.
9.00
0 5 10 15 20
V12/N 12.66
D 18 D7 11.00
Figure 1. The average value of the rate of seed V11/R 13.00
10.00
germination (no.) for the Rio Grande ST variety, in day
7 (D7) and day 18 (D18) post incubation 13.33
V10/B
9.66
The results show that in this case as well, the
blue LEDs (B) has represented one of the V9/W 10.66
13.66
most efficient lighting method. An interesting
observation is that the results for day 18 0 5 10 15 20
(D18) post inoculation, for the white LEDs D 18 D7
(W) and the natural light (N), are the same.
The only difference seems to be an increase in Figure 3. The average values of the rate of seed
the germination speed, as on day 7 (D7) there germination for the Saint Pierre ST variety, in day 7
were more germinated seeds in the variant (D7) and day 18 (D18) post incubation
25
Also, it seems that the germination speed was
higher in the white LED variant - as N
20.00
33.00
suggested by the observations for day 7 (D7). 53.00
After germination, the results regarding the R
26.66
40.00
development of the sprouts show differences 40.00
depending on the lighting variants (Figure 4). 23.33
B 67.00
Therefore, as noticeable in Figure 4, for the 67.00
experimental variants that represent the Rio 40.00
Grande ST variety (V1, V2, V3 and V4), as W 40.00
53.00
well as for the experimental variants that
0 20 40 60 80 100
represent the Buzău 4C variety (V5, V6, V7
and V8) the value of the fresh weight of the St. P. ST Buzau 4C R. Gr. ST
sprouts is highest under the blue LED lighting
(B). However, for the Saint Pierre ST variety, Figure 5. The average values of the fresh weight of
blue LEDs (B) seem to have been the most cotyledons (mg), varieties tested reported to light
inefficient, followed shortly by the natural variants (W, B, R, N)
light (N).
Also, during the experimental observations,
one has noticed that in the case of white LED
740.00 lighting (W) and blue LED lighting (B), all
N 820.00
460.00 the hypocotyls from all the varieties tested, in
all their repetitions, have developed a purple
500.00
R 780.00 coloration. There has been no sign of such
700.00 coloration in any of the other experimental
350.00
light variants.
B 880.00 Another interesting observation concerns the
820.00
development of the roots, more precisely,
560.00 adventive roots, in the case of plants treated
W 740.00
720.00 under the blue LED (B) variant. Adventive
roots have grown up to the middle of the
0 200 400 600 800 1000 hypocotyl length in some cases. This kind of
St. P. ST Buzau 4C R. Gr. ST root growth is not abnormal for L. esculentum
L. However, the other experimental variants,
Figure 4. The average values of the fresh weight of tested under different types of lighting have
sprouts (mg), varieties tested reported to light variants
not shown such an obvious particularity.
(W, B, R, N)
Moreover, the discrepancies seem to repeat
themselves when it comes to the value of the 120.00
N 187.00
fresh weight of cotyledons (Figure 5), blue 187.00
LEDs (B) being most efficient for the first two
varieties tested, while for the Saint Pierre 120.00
R 180.00
variety, it proves itself most inefficient, in this 173.00
case, natural light (N) taking the leading place.
60.00
There is an obvious similarity when it comes B 160.00
147.00
to the results regarding the fresh weight of the
hypocotyls (Figure 6), between all tested 100.00
varieties, as they all seem to prefer natural W
140.00
140.00
lighting (N). There is a small discrepancy
between the results for red LEDs (R) and 0 100 200 300
St. P. ST Buzau 4C R. Gr. ST
natural light (N) variant results, thus sugges-
ting the two lighting options tend to have Figure 6. The average values of the fresh weight of
similar effects on the fresh weight of the hypocotyls (mg), varieties tested, reported to light
hypocotyls. variants (W, B, R, N)
26
Regarding the development of the roots
(Figure 7), the outcome of the experiment N
1.84
5.50
4.80
shows that blue LED light (B) seems to
encourage it, at least for the first two varieties R
2.44
4.78
4.92
tested, Rio Grande ST (V1 to V5) and Buzău
4C (V6 to V10). B
2.83
4.18
3.75
2.60
W 5.32
26.66 4.26
N 26.66
33.33 0 5 10 15
26.66 St. P. ST Buzau 4C R. Gr. ST
R 40.00
20.00
Figure 8. The average values of root length (cm),
33.33 varieties tested, reported to light variants (W, B, R, N)
B 66.66
60.00
46.66 3.12
N 4.26
W 60.00 4.23
46.66
3.87
R 4.49
0 50 100 150 6.26
St. P. ST Buzau 4C R. Gr. ST 2.26
B 2.66
3.66
Figure 7. The average values of the fresh weight of
roots (mg), varieties tested, reported to light variants 3.19
W 3.20
(W, B, R, N) 4.33
0 2 4 6 8 10
The discrepancy is most obvious with the
St. P. ST Buzau 4C R. Gr. ST
Buzău 4C variety, the fresh weight of roots
reaching the highest value on day 18 post
Figure 9. The average values of the hypocotyl
inoculation. Natural light (N) does a poor job length (cm), varieties tested, reported to light variants
in stimulating root growth for all tested (W, B, R, N)
varieties, with a slight discrepancy for the Rio
Grande ST, which seems to have done a bit Therefore, the right combination of the differ-
better than the other two. Quite equally rent colours of the spectrum may provide
inefficient when it comes to root growth most efficient lighting, thus enabling farmers
stimulation is the red LED light (R) variant. to apply modern farming methods, for a fast,
White LEDs (W) and blue LEDs (B) show round-the-year, constant production of
most potential in this aspect of the qualitative food.
experiment. However, further studies should be conducted
The average values of the root length, in order to be able to draw clear conclusions,
presented in Figure 8, show that each variety while other parameters should be taken into
has a certain preference when it comes to the consideration, such as temperature variations
development in length of the radicular or light intensity.
system. These preferences are strangely
different and further studies should be CONCLUSIONS
conducted over this aspect.
However, when it comes to the length of the The experiment conducted on the three
hypocotyl (Figure 9), results show that the Lycopersicum esculentum L. varieties shows
preference for the red LED (R) lighting that some LED lighting variants may prove
variant is obvious for all tested varieties, themselves very useful in different develop-
especially in the case of the Rio Grande ST ment stages (seed germination, sprout
variety. development).
27
The results indicate certain lighting Scientia Horticulturae, 150. 86-91.
preferences that each variety may have, https://doi.org/10.1016/j.scienta.2012.10.002
8. Livadariu O., Maximilian C. (2017). Studies
depending on their state of development. regarding treatment s of LED-s emitted light on
sprouting Fagopyrum esculentum Moench. Bulletin
REFERENCES UASVM Animal Science and Biotechnologies, 74
(2). 102-111.
1. AGROBIZNES.MD. (2017). 9. Popescu V., Popescu A. (2008). Cultura legumelor
https://agrobiznes.md/sfaturi-pentru-legumicultori- în câmp și în solarii. Editura M.A.S.T., București,
avantajele-sistemului-de-iluminare-cu-led-uri-la- România.
producerea-rasadurilor.html Accessed 20.11.2018 10. Popescu V., Zăvoianu R. (2013). Cultura
2. Bantis F., Karamanoli K., Ainalidou A., Radoglou tomatelor, ardeiului si vinetelor. Editura M.A.S.T.,
K., Constantinidou H. I. A. (2018). Light emitting București, România.
emitting diodes (LEDs) affect morphological, 11. Poulet L., Massa G. D., Morrow R. C., Bourget C.
physiological and phytochemical characteristics of M., Wheeler R. M., Mitchell C. A. (2014).
pomegranate seedlings. Scientia horticulturae, 234. Significant reduction in energy for plant-growth
267-274. doi: lighting in space using targeted LED lighting and
doi.org/10.1016/j.scienta.2018.02.065 spectral manipulation. Life Sciences in Space
3. Berkovich, Yu. A., Konovalova I. O., Smolyanina Research, 2. 43-53. doi: 10.1016/j.lssr.2014.06.002
S. O., Erokhin A. N., Avercheva O. V., 12. Raiciu A. D., Livadariu O., Maximilian C., Crețu
Bassarskaya E. M., Kochetova G. V., Zhigalova T. A. M. (2018). The assessment of the effect induced
V., Yakovleva O. S., Tarakanov I. G. (2017). LED by LED-s irradiation on garlic sprouts (Allium
crop illumination inside space greenhouses. sativum L.). Romanian Biotechnological Letters, 23
REACH - Reviews in Human Space Exploration, 6. (6). 14187-14191.
11-24.http://dx.doi.org/10.1016/j.reach.2017.06.001 13. Hernández Suárez H., Rodríguez Rodríguez E. M.,
4. Despommier D. (2009). The rise of vertical farms. Díaz Romero C. (2007). Chemical composition of
Scientific American, 301(5). 80-87. tomato (Lycopersicum esculentum) from Tenerife,
https://pdfs.semanticscholar.org/b523/45c6b55ed2f the Canary Islands. Food Chemistry, 106(3). 1046-
64a6cb9ab699748c0fe75bd09.pdf. Accessed 1056.
20.11.2018 https://doi.org/10.1016/j.foodchem.2007.07.025
5. Kalantari F., Tahir O. M., Lahijani A. M., Kalantari 14. Verkerk K. (1955). Temperature, light and the
S. (2017). A review of vertical farming technology: tomato. Mededelingen van de
a guide for implementation of building integrated Landbouwhogeschool te Wageningen/Nederland,
agriculture in cities. Advanced Engineering Forum, 55(4). 175-224. http://edepot.wur.nl/290701
24. 76-91. doi:10.4028/www.scientific.net/ 15. Yeh N., Chung J. P. (2009). High-brightness
AEF.24.76 LEDs–Energy efficient lighting sources and their
6. Kimura S., Sinha N. (2008). Tomato (Solanum potential in indoor plant cultivation. Renewable and
lycopersicum): A Model Fruit-Bearing Crop. Sustainable Energy Reviews, 13(8). 2175-2180.
https://www.ncbi.nlm.nih.gov/pubmed/21356708 https://doi.org/10.1016/j.rser.2009.01.027
Accessed 20.11.2018 16. Xu Y., Chang Y., Chen G., Lin H. (2016). The
7. Lin K. H., Huang M. Y., Huang W. D., Hsu M. H., research on LED supplementary lighting system for
Yang Z. W., Yang C. M. (2013). The effects of red, plants. Optik – International Journal for Light and
blue and white light-emitting diodes on the growth, Electron Optics, 127(18). 7193-7201.
development, and edible quality of hydroponically doi:10.1016/j.ijleo.2016.05.056
grown lettuce (Lactuca sativa L. var. capitata).
28
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
COMPARATIVE ANALYSES OF PLANT RESPONSES TO SALINITY
IN RELATED TAXA: A USEFUL APPROACH TO STUDY SALT STRESS
TOLERANCE MECHANISMS
Oscar VICENTE1, Monica BOSCAIU2
1
Universitat Politècnica de València (UPV), Institute for Plant Molecular and Cell Biology
(IBMCP, UPV-CSIC), Camino de Vera 14, 46022 Valencia, Spain
2
Universitat Politècnica de València (UPV), Mediterranean Agroforestry Institute (IAM, UPV),
Camino de Vera 14, 46022 Valencia, Spain
Corresponding author email: [email protected]
Abstract
The progressive salinisation of irrigated cropland is causing substantial losses in agricultural production, a problem
that will worsen due to climate change effects. Enhancing crop salt tolerance is a sensible strategy to achieve
significant increases in crop yields, but requires a deep understanding of the underlying mechanisms. When challenged
by salinity, all plants, regardless of their degree of tolerance, activate a series of basic responses, including the control
of ion transport, the synthesis of compatible solutes for osmotic adjustment, or the activation of antioxidant systems.
Yet, for a given species, the biological relevance and the relative contribution of different responses to the mechanisms
of salt tolerance remain largely unknown. Over the last years, we have performed comparative analyses on the
responses to salinity in different taxa, genetically related but with varying levels of tolerance. Correlating salt-induced
changes in the concentrations of suitable biochemical stress markers with the relative tolerance of the investigated
species, we are obtaining novel and interesting information on those mechanisms. Some examples with taxa of several
genera are discussed, to show the usefulness of our approach.
Key words: climate change, ion transport, osmolytes, salt stress, salt tolerance.
INTRODUCTION soil salinity are the environmental factors most
relevant for this reduction of crop productivity
Modern agriculture is largely dependent on a (Buchanan et al., 2000).
limited number of cultivars of a few major In the current climate change scenario – with
crops, derived, directly or indirectly, from the increasing average temperatures, reduced
‘Green Revolution’ of the 1960s and 1970s rainfall and alteration of the normal seasonal
(Borlaug & Dowswell, 2005). These cultivars weather patterns – crops in arid and semi-arid
were developed for a high-input, industrialised regions are being affected by drought periods
agriculture and can provide high yields under which are longer, more frequent and more
optimal – artificial – growing conditions, in intense than in the near past.
either greenhouses or open fields, although The progressive ‘secondary’ salinisation of
generally require large amounts of irrigated land – by the accumulation of toxic
agrochemicals (chemical fertilisers, herbicides ions dissolved in irrigation water – is also
and pesticides) and irrigation water; they are, contributing to the extension of desertification
however, relatively sensitive to stressful of former fertile cropland.
conditions, such as cold, high temperatures, Therefore, increasing, or even maintaining the
waterlogging, drought or salinity. In fact, for all present production levels is becoming a severe
major crops there is a large difference between challenge for agriculture.
average yields and the record yields obtained Additional factors, not directly dependent of
under the most favourable growing conditions; climate change effects – such as the massive
these losses, which can vary from 50% to more movement of rural population to the cities,
than 80%, depending on the species, are mostly change of land use (for urban development,
due to abiotic stress conditions affecting the tourism or industrialisation) leading to a further
plants in the fields; among them, drought and reduction of the area of available farmland, or
29
the growing demand of cereals and oilseed There is also a ‘new generation’ of fertilisers,
crops for biofuel production, competing with namely, slow-release and controlled-released
food – are also limiting the potential fertilisers; they can (modestly) increase crop
productivity of agriculture at the global level. yields when used at the same doses than
Crop production is still growing, both in traditional fertilisers – or maintain the same
absolute terms and per capita; however, the production at lower doses – but their main
rate of growth has been decreasing since the advantage is that they could help protect the
mid-1980s. Nowadays, there is enough food to environment, being less contaminating for soil
feed everybody on earth – although that food is and water and having a smaller ‘carbon
not evenly distributed – but if this trend footprint’. The application to crops of
continues, soon this will not be true anymore. ‘biostimulants’, a disparate group of different
substances (humic substances, protein
STRATEGIES FOR INCREASING hydrolysates, seaweed extracts, chitin-derived
AGRICULTURAL PRODUCTION biopolymers, or some chemical elements) or
microorganisms (beneficial fungi and bacteria)
In the present circumstances, it is clear that an should also be mentioned as a means to
increase in crop production cannot be based on enhance the efficiency of plant nutrition,
a significant extension of the total agricultural facilitate growth under stress conditions and/or
land area, which is actually decreasing. As improve the quality of the harvested product
water for irrigation is becoming an increasingly (Boscaiu et al., 2018; Xu & Geelen, 2018).
scarce resource, it is also not possible to
enlarge the area of land cultivated under Developing drought and salt-tolerant crops
irrigation, which is much more productive than All approaches mentioned above will no doubt
rain-fed farmland. Also, there is an urgent need contribute to improving crop yields, but the
to switch the present agricultural practices to a expected increase in food production will not
more sustainable agriculture, stopping or be sufficient to cope with population growth.
reducing depletion of natural resources and the Since the most substantial reduction in
destruction of areas of high ecological value. productivity is due to environmental abiotic
Therefore, we should also exclude growing our stress conditions, especially drought and
present crops in low-fertility, marginal land, salinity, the most effective alternative would be
which would require the use of large amounts to develop crop varieties more resistant to salt
of chemical fertilisers and would not be and water stress. For this, all available
sustainable. strategies should be used including, obviously,
An extension of the global area of biotech traditional breeding techniques. This approach
(transgenic) crops, including the development has not been very successful in the past, due to
of varieties with new traits, will also contribute the complexity of the stress-tolerance traits, but
to increasing food production, as they provide now the breeder can use an array of modern
higher yields than the corresponding molecular tools – marker-assisted selection
conventional crops (ISAAA, 2017). (MAS), next-generation sequencing (NGS)
Nevertheless, these transgenic plants are technologies, high-throughput genotyping
derived from ‘Green Revolution’ varieties and platforms, among others – which significantly
pose the same problems than non-transgenic increase the efficiency and reduce the time
cultivars regarding high inputs requirements required to carry out breeding programmes; in
and sustainability issues. fact some successful examples of crops with
Many other strategies are being tried to enhanced salt or water stress tolerance obtained
increase, or at least maintain crop yields, but in by ‘classical’ breeding, have been reported in
the frame of a more sustainable agriculture. recent years, for instance several specific
They include, for example, organic agriculture, cultivars mentioned by Fita et al. (2015).
which is obtaining good results in terms of Genetic engineering can also be used to express
productivity as well as a business, due to the ‘stress-tolerance’ genes in transgenic crops;
interest of consumers on food products here again, many laboratory experiments point
obtained without the use of agrochemicals. to the feasibility of this strategy. However, up
30
to now no biotech crop with enhanced abiotic of antioxidant compounds – since drought and
stress tolerance is commercially cultivated in high soil salinity generate oxidative stress as a
our fields, except for a drought-resistant maize secondary effect; iv) changes in gene
variety, developed by Monsanto and BASF, expression leading to the synthesis of
expressing a bacterial RNA chaperonin gene ‘protective’ proteins, such as heat-shock
(Castiglioni et al., 2008). Progress is also being proteins, LEA proteins, osmotin, and many
made in the recovery and improvement of local others.
or neglected crop varieties, and in the Stress tolerance is obviously based on the
domestication of wild plants with relatively activation of these conserved responses,
higher stress tolerance than our standard crops. justifying to some extent the use of non-
Some of those wild species are extremely tolerant models for its study. However, it is
resistant in nature to salinity (halophytes) or clear that the efficiency of the response must
drought (xerophytes), and could be the basis of largely vary in different species, as plants show
a sustainable, ‘saline’ or ‘arid’ agriculture (Fita a very wide range of tolerance. Furthermore,
et al., 2015; Boscaiu et al., 2018). the relative contribution of specific responses
We can conclude that the biotechnological to the mechanisms of tolerance may also vary
improvement of crop abiotic stress tolerance, and, for a given species, is generally unknown.
especially to drought and soil salinity, is the
most promising strategy to quickly increase Our experimental approach for the study of
crop yields and food production, needed to feed abiotic stress tolerance in plants
a growing human population in the next few We are investigating the mechanisms of salt
decades. To reach this goal, applying the and drought tolerance in different plants,
different strategies mentioned in the previous including some wild species, vegetable and
paragraph, a deep understanding of the ornamental crops and forest trees, such as taxa
mechanisms underlying abiotic stress tolerance of the genera Plantago, Juncus, Limonium,
in plants is required. Phaseolus, Tagetes, Portulaca or Picea, among
others. Our work is based on the hypothesis
ELUCIDATION OF THE MECHANISMS that performing comparative analyses of the
OF STRESS TOLERANCE IN PLANTS responses to stress of taxonomically – and,
therefore, genetically – closely related taxa that
Paradoxically, most studies on drought and salt show different degrees of stress resistance
tolerance in plants have been carried out using should help to distinguish those responses that
species that are not tolerant, mostly the model are relevant for tolerance from those which are
Arabidopsis thaliana or some crops, such as not, and thus contribute to elucidate general
tobacco or rice. It is doubtful that the results mechanisms of tolerance in plants. In our
obtained can be generalised to all species, but studies, as ‘closely related taxa’ we have
this is generally assumed, partly due to the included: i) wild species of the same genus,
confusion in the literature between two related, adapted to natural habitats affected by varying
but distinct concepts: responses to stress and types and levels of environmental stress; ii)
stress tolerance. different ecotypes/varieties/cultivars of the
same species, which often also show
Stress responses vs. tolerance to stress differences in stress resistance; iii) a crop and
All plants, independently of their degree of some of its wild relatives; or iv) different
tolerance, use the same general responses to populations/provenances of the same species.
water and salt stress (and also to other abiotic Our experimental strategy consists on applying
stresses), based on the activation of a series of salt stress (different concentrations of NaCl)
conserved mechanisms, including: i) control of and water deficit (withholding irrigation)
ion transport and ion homeostasis, at the cell treatments to the plants under controlled
and whole plant levels; ii) biosynthesis and greenhouse conditions and determining the
accumulation of compatible solutes or stress-induced changes in the levels of different
osmolytes for osmotic adjustment; iii) biochemical stress markers associated to
activation of antioxidant enzymes and synthesis specific response pathways – ions, osmolytes,
31
antioxidant compounds, antioxidant enzyme and in ‘Judía de Franco’, Na+ increased
activities. Correlation of the contents of these significantly (but only slightly in ‘Moonlight’)
markers with the relative tolerance of the in the presence of the highest NaCl
investigated taxa – estimated from their concentration tested (150 mM), but not at lower
distribution in nature and/or the relative growth salinities. Cl- ions accumulated in leaves in
inhibition caused by the stress treatment – parallel with increasing external salinities, in
allows establishing which specific responses all tested cultivars, and reaching in all cases
are involved in each case in tolerance absolute levels much higher than those of
mechanisms. sodium. However, the qualitative patterns of
In the following sections, we describe a brief accumulation were similar to those of Na+; that
selection of published results to show the is, the highest contents were measured in the
usefulness of the strategy outlined above. least salt tolerant cultivar (‘The Prince’), and
These examples are limited to salt tolerance the lowest in the most tolerant cv. ‘Maxidor’.
mechanisms based on the control of ion There is, therefore, a negative correlation
transport and osmotic adjustments, in taxa of between tolerance and the efficiency of ion
three genera: Phaseolus, Plantago and Juncus. transport to the aerial part of the plants,
Salt tolerance based on other plant responses, indicating that, in Phaseolus, salt tolerance is
such as the activation of antioxidant systems, or based, at least partly, on the inhibition of Na+
the mechanisms of tolerance to drought, will (and, to a lesser extent, Cl-) transport to the
not be mentioned here. leaves.
SALT TOLERANCE IN Phaseolus Osmotic adjustment
According to the ‘ion compartmentalisation
Experimental material and salt treatments hypothesis’ (Wyn Jones et al., 1977), Na+ and
Plants of three cultivars of common beans Cl- ions must be sequestered in the cell
(Phaseolus vulgaris) – ‘The Prince’, ‘Judía de vacuoles to avoid reaching toxic levels in the
Franco’ and ‘Maxidor’ – and one cultivar of the cytoplasm; this requires the accumulation of
runner bean (P. coccineus) – ‘Moonlight’ – compatible solutes in the cytosol, to maintain
were grown for three weeks in the presence of cellular osmotic balance. Proline (Pro) is one of
0 (control), 50, 100 or 150 mM NaCl. After the the commonest plant osmolytes. Leaf Pro
treatments, the plants were harvested, and contents increased in response to the salt
several growth parameters were determined: treatment in the four Phaseolus cultivars, but
stem length, number of leaves, leaf fresh and its accumulation showed a negative correlation
dry weight, and leaf water content. with their relative salt tolerance: Pro reached
Based on the salt-induced inhibition of growth, the highest levels in cv. ‘The Prince’ and the
the following ranking of salt tolerance was lowest in ‘Maxidor’. This means that Pro
established: ‘Maxidor’ > P. coccineus cannot be directly involved in the mechanisms
(‘Moonlight’) > ‘Judía de Franco’ > ‘The of salinity tolerance in Phaseolus, although it
Prince’ appears to be a reliable biochemical salt stress
marker, accumulating in those cultivars that are
Control of ion transport relatively more sensitive and therefore more
Generally, Na+ and Cl- ions accumulate in plant stressed in the presence of salt.
leaves, to a greater or lesser extent, in response Regarding other putative osmolytes, glycine
to NaCl treatments. In Phaseolus, Na+ leaf betaine did not accumulate in response to the
levels increased with increasing external salt stress treatment in any of the four
salinity, in a concentration-dependent manner, Phaseolus cultivars. Sucrose and fructose
only in the most salt-sensitive cultivar, ‘The contents clearly increased in cv. ‘The Prince’ in
Prince’. In ‘Maxidor’, the most tolerant, Na+ parallel with increasing external salinity, but
content was maintained at the same level than not in the other three cultivars. Of those tested,
in the non-stressed control at all external salt only myo-inositol appears to be a functional
concentrations tested. In the second-most osmolyte in this genus as its accumulation in
tolerant cultivar, ‘Moonlight’ (of P. coccineus)
32
leaves correlates positively with the relative Accordingly, we measured relatively high leaf
salt tolerance of the bean cultivars. concentrations of this polyalcohol in the three
selected Plantago species. The highest value,
SALT TOLERANCE IN Plantago 2 mmol g-1 DW, was observed in the presence
of 800 mM NaCl in P. crassifolia, the most
Experimental material and salt treatments tolerant species. However, both the absolute
Three species of the genus Plantago, P. levels and the patterns of accumulation of
crassifolia, P. coronopus and P. major, were sorbitol in response to salt stress were similar
selected for this study. The two first species are in the three species. Therefore, even though
halophytes, growing in natural saline sorbitol could be necessary for cellular osmotic
ecosystems, whereas P. major is considered a balance, it cannot be responsible for the
glycophyte and is only found in the field in differences in salt tolerance, since there is no
habitats of low salinity. According to their differential accumulation of the osmolyte in the
distribution in nature, the relative salt tolerance three analysed taxa. Pro contents, on the other
of these species is: P. crassifolia ≥ P. hand, were very low in the controls and largely
coronopus > P. major. Plants of the three increased in response to the salt treatment, but
species were grown in the greenhouse for four only at high external salt concentrations (600-
weeks, watered with NaCl solutions of 800 mM NaCl) and, most important, only in the
increasing concentration, from 0 (control) to halophytes, not in the salt-sensitive P. major.
800 mM. Quantification of the degree of salt- Therefore, salt tolerance in Plantago seems to
induced growth inhibition confirmed the be partly dependent on the activation in tolerant
relative tolerance to salinity indicated above, species (but not in salt-sensitive ones) of the
for the three analysed Plantago species. synthesis of a secondary osmolyte, Pro, in
response to high salinity stress.
Control of ion transport
Leaf ion (Na+, Cl-) contents increased in the SALT TOLERANCE IN Juncus
three Plantago species in parallel with
increasing external salinity, both ions reaching Experimental material and salt treatments
similar absolute levels. Contrary to Phaseolus, In this case, we also selected three species, two
in this case, the highest ion contents were halophytes (Juncus maritimus and J. acutus)
measured in the two halophytes, slightly higher and one glycophyte (J. articulatus). According
in the most tolerant P. crassifolia; the most to the salinity of the natural habitats of these
sensitive P. major showed substantially lower species, and the degree of salt-induced growth
concentrations of Na+ and Cl- in the leaves. inhibition in controlled salt treatments, the
This accumulation pattern indicates that, in relative tolerance to salinity of these species is
Plantago, salt tolerance is based on the active J. maritimus > J. acutus >> J. articulatus. Salt
transport of ions to the leaves. Interestingly, treatments were carried out by watering the
both halophytes showed relatively high leaf plants with increasing NaCl concentrations,
concentrations of Na+ (in the most tolerant P. from 0 (controls) to 400 mM, during eight
crassifolia, also of Cl-) in control, non-stressed weeks.
plants, whereas the two ions were present at
much lower levels in the glycophyte P. major. Control of ion transport
This observation suggests that salt-tolerant Plants of the three selected Juncus species
plants of this genus can use inorganic ions as showed a progressive increase in the root levels
osmotica, even under conditions of low soil of Na+ and Cl-, correlated to the increase of
salinity, which supports the existence of active NaCl concentration in the watering solution.
mechanisms of ion transport from roots to the The absolute ion concentrations reached and
aerial part of the plants. the patterns of accumulation were similar for
the two ions and the three species, regardless of
Osmotic adjustment their relative tolerance to salt. We also
It is well established that sorbitol is the observed a concentration-dependent increase of
functional osmolyte in the genus Plantago. Na+ and Cl- contents in the shoots, in response
33
to increasing salinity; although the some tolerant plants show a peculiar pattern of
concentration of the two ions was similar, as in salt-induced changes in leaf K+ contents, first
roots, there were significant differences decreasing at low or moderate salinities, and
between species. We observed a clear negative then increasing again in the presence of higher
correlation between ion concentrations and salt external salt concentrations. This indicates the
tolerance: the highest levels were reached in specific activation of K+ transport from roots to
the less tolerant J. articulatus, followed by J. leaves in response to strong salt stress
acutus, whereas J. maritimus, the most tolerant, conditions. We have observed this
showed the lowest accumulation of Na+ and Cl- phenomenon, for example, in the tested
. Therefore, salt tolerance in Juncus is halophytes of the genera Plantago (P.
associated with the inhibition of ion transport crassifolia and P. coronopus) and Juncus (J.
from the roots to the aerial part of the plants. maritimus and J. acutus), but not in the more
salt-sensitive species P. major and J.
Osmotic adjustment articulatus, respectively. These data support
Glycine betaine (GB) and total soluble sugars the relevance of the activation of K+ transport
(TSS) both increase with increasing salinity in to the aerial part of the plants in different
the shoots of salt-treated Juncus plants. tolerant taxa.
Although these osmolytes may contribute to
osmotic balance in this genus, their patterns of SUMMARY OF SALT STRESS
accumulation and the concentrations reached TOLERANCE MECHANISMS IN THE
were similar in the three selected species, so SELECTED GENERA
that salt-induced GB and TSS biosynthesis
cannot be responsible for the observed In Phaseolus, salt tolerance is dependent, at
differences in tolerance. Pro contents, on the least in part, on specific mechanisms blocking
other hand, were very low in the controls and transport of Na+ cations (and, to a lesser extent,
increased > 20-fold in the presence of 400 mM of Cl- anions) from roots to leaves, and on the
NaCl, but only in the salt-tolerant J. maritimus accumulation of myo-inositol for osmotic
and J. acutus; in the glycophyte J. articulatus, balance and as an osmoprotectant. Pro is a
the increase of Pro concentration with respect reliable marker of stress, accumulating to
to the control, although statistically significant, higher levels on those taxa which are more
was less than twofold. Therefore, Pro sensitive to stress (and, therefore, more stressed
accumulation is most likely involved in the at the same salinity levels), as compared to
mechanisms of salt tolerance in Juncus, as it related more tolerant taxa. However, Pro does
correlates positively with the relative degree of not seem to be directly involved in salt
tolerance of the investigated species. tolerance mechanisms (Al Hassan et al.,
2016c).
SALT TOLERANCE AND K+ In Plantago, salt tolerance depends on the
HOMEOSTASIS efficient transport of toxic ions (Na+, Cl-) to the
leaves – where they are predominantly stored
An increase in cellular Na+ concentration is in vacuoles – and on the activation of K+
generally accompanied by a decrease in K+ transport under high external salinity. Plants of
levels, as the two cations compete for the same this genus use sorbitol as the main osmolyte for
transport proteins (Rodríguez-Navarro, 2000). osmotic adjustment, but tolerant species also
Mechanisms leading to the maintenance of accumulate a secondary osmolyte (Pro) at high
relatively low Na+/K+ ratios under high salinity external salinity. Salt-tolerant Plantago taxa
conditions are considered relevant for can accumulate Na+ (or both, Na+ and Cl-) in
tolerance. A reduction in leaf K+ contents in the leaves, to be used as osmotica, also under
response to salt treatments has been observed low soil salinity conditions (Al Hassan et al.,
in different species, in agreement with the 2016d).
general behaviour mentioned above, whereas in Finally, in Juncus, salt tolerance is associated
other species K+ is maintained at the same level with the inhibition of Na+ and Cl- transport
than in the non-stressed controls. Interestingly, from roots to shoots, the activation of K+
34
transport to the leaves in the presence of high the responses to stress in closely related taxa,
external salt concentrations, and the salt- but showing varying degrees of tolerance, has
induced accumulation of Pro for osmotic been proved to be very useful for the
adjustment and osmoprotection (Al Hassan et elucidation of those mechanisms. However, the
al., 2016a). studies must be carried out in different genera,
species, cultivars or populations, as no single
A GLIMPSE TO OTHER SPECIES model, not even Arabidopsis thaliana, can
provide a general and accurate view of the
Additional studies have revealed that some of subject.
the responses to salt stress mentioned above for
Phaseolus, Plantago or Juncus are relevant for REFERENCES
tolerance also in other plants species, unrelated
taxonomically. For example, in oleander Al Hassan, A., López-Gresa, M. P., Boscaiu, M.,
Vicente, O. (2016a). Stress tolerance mechanisms in
(Nerium oleander) salt tolerance is dependent Juncus: responses to salinity and drought in three
on mechanisms blocking transport of toxic ions Juncus species adapted to different natural
to the leaves (as in Juncus), and on the environments. Functional Plant Biology, 43, 949-
accumulation of GB and TSS as functional 960. doi: 10.1071/FP16007
osmolytes (Kumar et al., 2017). In Norway Al Hassan, M., Chaura, J., López-Gresa, M. P., Borsai,
O., Daniso, E., Donat-Torres, M. P., Mayoral, O.,
spruce (Picea abies), salt stress activates Vicente, O., Boscaiu, M. (2016b). Native-invasive
transport of Na+ and K+ from the roots to the plants vs halophytes in Mediterranean salt marshes:
needles and accumulation of Pro, whereas Stress tolerance mechanisms in two related species.
soluble sugars do not seem to be involved in Frontiers in Plant Science, 7, 473. doi:
tolerance mechanisms (Schiop et al., 2015). In 10.3389/fpls.2016.00473.
Al Hassan, M., Estrelles, E., Soriano, P., López-Gresa,
Inula crithmoides, an extremely tolerant M. P., Bellés, J. M., Boscaiu, M., Vicente, O. (2017).
succulent halophyte, salt tolerance is based on Unraveling salt tolerance mechanisms in halophytes:
the efficient transport of toxic ions to the aerial A comparative study on four Limonium species with
part of the plants (as in Plantago), the different geographic distribution patterns. Frontiers
activation of K+ transport from the roots at high in Plant Science, 8, 1438, doi: 10.3389/fpls.2017.
01438
external salinity, and the use of GB as the main Al Hassan, M., Morosan, M., López-Gresa, M. P.,
physiological osmolyte, with contribution of Prohens, J., Vicente, O., Boscaiu, M. (2016c).
some sugars (arabinose, fructose and glucose) Salinity-induced variation in biochemical markers
to osmotic adjustment under stress (Al Hassan provides insight into the mechanisms of salt tolerance
et al., 2016b); similar mechanisms seem to in common (Phaseolus vulgaris) and runner (P.
coccineus) beans. International Journal of Molecular
operate in the genus Limonium – which Sciences, 17, 1582. doi:10.3390/ijms17091582
includes a large number of halophytes – except Al Hassan, M., Pacurar, A., López-Gresa, M. P., Donat-
that Pro, not GB, is the major functional Torres, M. P., Llinares, J. V., Boscaiu, M., Vicente,
osmolyte (Al Hassan et al., 2017). Inhibition of O. (2016d). Effects of salt stress on three ecologically
Na+ transport to the leaves and maintenance of distinct Plantago species. PLoS ONE, 11(8),
e0160236. doi:10.1371/journal.pone. 0160236
high K+ concentrations even at high salinity Borlaug, N. E., Dowswell, C.R. (2005). Feeding a world
levels are also important for salt tolerance in of ten billion people: a 21st century challenge. In R.
the genus Silene (Kozminska et al., 2018). Tuberosa, R. L. Phillips, M. Gale (Eds.) Proceedings
of the international congress in the wake of the
CONCLUSIONS double helix: from the Green Revolution to the gene
revolution (pp. 3–23). Bologna, Italy: Avenue Media.
Boscaiu, M., Naranjo, M., Vicente, O. (2018). Strategies
The general conclusion of the work carried out to increase crop yields in a climate change scenario.
in our laboratory over the last years, and partly Scientific Bulletin. Series F. Biotechnologies, Vol.
summarised here, is that the mechanisms of salt XXII, 15-20.
stress tolerance – as well as tolerance to Buchanan, B. B., Gruissem, W., Jones, R.L. (2000).
Biochemistry & molecular biology of plants.
drought and other abiotic stresses – vary widely Rockville, MD: American Society of Plant
in different plant species, even though they are Physiologists.
based on the same conserved responses. Our Castiglioni, P., Warner, D., Bensen, R. J., Anstrom, D.
strategy of performing comparative studies of C., Harrison, J., Stoecker, M., Abad, M., Kumar, G.,
Salvador, S., D'Ordine, R., Navarro, S., Back, S.,
35
Fernandes, M., Targolli, J., Dasgupta, S., Bonin, C., Kumar, D., Al Hassan, M., Naranjo, M.A., Agrawal, V.,
Luethy, M. H., Heard, J. E. (2008). Bacterial RNA Boscaiu, M., Vicente, O. (2017). Effects of salinity
chaperones confer abiotic stress tolerance in plants and drought on growth, ionic relations, compatible
and improved grain yield in maize under water solutes and activation of antioxidant systems in
limited conditions. Plant Physiology, 147, 446–455. oleander (Nerium oleander L.). PLoS ONE, 12 (9),
doi:10.1104/pp.108.118828. e0185017. doi: 10.1371/journal.pone.0185017.
Fita, A., Rodríguez-Burruezo, A., Boscaiu, M., Prohens, Rodríguez-Navarro, A. (2000). Potassium transport in
J., Vicente, O. (2015). Breeding and domesticating fungi and plants. Biochimica et Biophysica Acta,
crops adapted to drought and salinity: a new 1469, 1–30. doi: 10.1016/S0304-4157 (99)00013-1.
paradigm for increasing food production. Frontiers in Schiop, S. T., Al Hassan, M., Sestras, A.F., Boscaiu, M.,
Plant Science, 6:978. doi: 10.3389/fpls.2015. 00978. Sestras, R. E., Vicente, O. (2015). Identification of
ISAAA (2017). Global Status of Commercialized Salt Stress Biomarkers in Romanian Carpathian
Biotech/GM Crops in 2017: Biotech Crop Adoption Populations of Picea abies (L.) Karst. PLoS ONE,
Surges as Economic Benefits Accumulate in 22 10(8), e0135419, doi: 10.1371/journal.pone.
Years. ISAAA Brief No. 53. Ithaca, NY: ISAAA. 0135419.
Retrieved July 11, 2018, from Wyn Jones, R., Storey, R., Leigh, R. A., Ahmad, N.,
https://www.isaaa.org/resources/publications/briefs/5 Pollard, A. (1977). A hypothesis on cytoplasmic
3/default.asp. osmoregulation. In E. Marre, O. Ciferri (Eds.)
Kozminska, A., Al Hassan, M., Hanus-Fajerska, E., Regulation of cell membrane activities in plants. (pp.
Naranjo, M. A., Boscaiu, M., Vicente, O. (2018). 121–136). Amsterdam: Elsevier.
Comparative analysis of water deficit and salt Xu, L., Geelen, D. (2018). Developing Biostimulants
tolerance mechanisms in Silene. South African from Agro-Food and Industrial By-Products.
Journal of Botany, 117, 193-206. Frontiers in Plant Science, 9, 1567. doi:
doi:10.1016/j.sajb.2018.05.022. 10.3389/fpls.2018.01567.
36
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
PHYLOGENETIC ANALYSES OF SUGARCANE CULTIVARS
USING SIMPLE SEQUENCE REPEAT MARKERS
Rakesh TAWADARE1, *, Devarajan THANGADURAI1, Rayappa KHANDAGAVE2,
Jeyabalan SANGEETHA3, Ramachandra PANDHARI1
1
Department of Botany, Karnatak University, Dharwad, Karnataka, 580003, India
2
S. Nijalin gappa Sugar Institute, Belagavi, Karnataka, 590009, India
3
Department of Environmental Science, Central University of Kerala, Kasaragod, Kerala, 671316,
India
*Corresponding author email: [email protected]
Abstract
Sugarcane (Saccharum sp.) is one of the world’s most commercial and extensively grown crops. The breeding of
sugarcane is keystone of all advanced sugarcane industries and several research institutes. The success of sugarcane
breeding program lies in the appropriate selection of genetically rich and diverse genotypes. Research rationale of
present study was to analyze genetic diversity among 24 promising flowering and non-flowering sugarcane cultivars.
Molecular marker based screening was done with PCR analysis using 10 SSR primers. SCM-32 primer showed highest
polymorphic bands. The genetic similarity and UPGMA clustering were analyzed for all 24 sugarcane cultivars. The
similarity index values for S19, S21, S22 and S23 suggested them as closest ones and S17 as the most distant one.
UPGMA clustering based dendrogram showed that the correlation between Jaccard coefficient and similarity index is
high and significant. All 5 clusters showed a mixture of flowering and non-flowering cultivars, indicating that
molecular marker can play a potential role in sugarcane breeding programs than morphology based analysis.
Key words: cluster analysis, genetic similarity coefficients, simple sequence repeats, sugarcane.
INTRODUCTION genotypes when compared with conventional
techniques, viz., morphological and
Sugarcane (Saccharum sp.) is the most biochemical markers (Sindhu et al., 2011).
prominent source of sugar and bio-fuel across Generally, molecular markers are found to be
the globe. Thus, it is one of the most useful in genetic diversity, systematic and
commercially important crops. More than 75% phylogenetic analysis. Nevertheless they have
of world sugar production is achieved from also proved to be advantageous in construction
sugarcane which is grown across 100 countries. of genetic maps and genetic linkage studies in
The sugarcane breeding is the mainstay of all combination with other markers (Anderson,
advancements in sugarcane based industries 2007; Bosland et al., 2012).
and technologies in most of the research Microsatellites (Simple Sequence Repeats) are
institutes. Hence, the application of modern ubiquitous on eukaryotic genomes. Apparently,
molecular techniques will strengthen varities to their sequence patterns are capable to induce
achieve high levels of yield (Silva & Bressiani, hyper-variability in multiple repeats at
2005). particular locus, during DNA replication and
The success of sugarcane breeding program recombination. This kind of variation among
lies in the appropriate selection of genetically microsatellite markers has proved to be
rich and diverse genotypes. However, advantageous for genetic marking.
understanding the genetic diversity among the Further, these markers exhibit high level of
cultivars may provide platform for improved polymorphisms and extensively exploited for
traits. evaluating genetic diversity, in construction of
Studies have shown that genetic markers genetic map and cultivar identification.
greatly aid in early identification of genotypes Microsatellite markers are likely to have many
as they are rapid, reliable and reproducible. applications in sugarcane genetics and breeding
Thus, allowing early identification of including germplasm analysis, cultivar
37
identification, parent evaluation and marker aid of Nano-Drop spectrophotometer (ND-
assisted breeding (Cordeiroa et al., 2000). 1000, version 3.1.1, USA). The DNA samples
Several types of molecular markers have been were diluted to 20 ng μl−1 for polymerase chain
successfully employed for better understanding reaction (PCR) amplification.
genetic relatedness among the commercial
Table 1. List of Sugarcane Cultivars – Flowering and Non
crops such as Wheat (Mohapatra et al., 2003) Flowering
and Phaseolae (Vir et al., 2009). Among Sample Code Name of the Cultivars
sugarcane crops different molecular markers Flowering
have been used. Recently, genetic markers such S1 Co 2012-109
S2 Co06027
as RAPD, ISSR and ITS, have been used to S3 Co 11024
study genetic diversity among Erianthus and S. S4 Co 10023
spontaneum species (Zhang et al., 2004). Singh S5 Co 10024
S6 Co 2001-15
et al. (2010) analyzed the genetic diversity S7 CoC 671
among eighty four genotypes of Saccharum S8 Co SNK 0632
barberi, S. spontaneum and S. officinarum S9 Com 0265
S10 Co SNK 09268
origin which included Indian and non-Indian S11 Co 13006
commercial cultivars. Thirty two microsatellite S12 Co 10027
markers consisting of sugarcane cDNA derived Non-flowering
S13 Co 2012-23
microsatellite markers (SCM), genomic S14 Co 2012-24
microsatellites and unigene sugarcane S15 Co 11023
microsatellite markers (UGSM) were used. S16 Co SNK 7658
S17 Co SNK 07337
More recently, Sindhu et al. (2011) reported the S18 Co SNK 07680
use of sequence tagged microsatellite sites S19 Co SNK 09227
(STMS) in genetic diversity analysis and S20 Co SNK 09293
S21 Co SNK 09232
concluded that 12 unique markers may aid in S22 CO SNK 0811324
varietal identification. In the present study, S23 Co SNK 83495
SSR markers were employed to assess genetic S24 Co 86032
diversity of 24 commercial cultivars. Similarly,
Singh et al. (2017) investigated genetic Simple Sequence Repeat Marker Analysis
relatedness among 24 sugarcane cultivars using Ten microsatellite markers were selected based
12 RAPD markers. The objective of the present on the previous studies of Singh et al. (2010,
study was to analyze genetic diversity among 2017). PCR reactions were carried out in a
24 promising flowering and non-flowering 25µl reaction volume comprising genomic
sugarcane cultivars. DNA (20 ng), forward primer (0.5 µl), reverse
primer (0.5 µl), dNTP (1.5 µl), Taq buffer (1×),
MATERIALS AND METHODS Taq DNA polymerase (1.5U) and finally
making the volume to 25 µl using nanopure
Plant Material water. The PCR amplification was performed
In the present study, 24 sugarcane commercial using Mastercycler gradient (Eppendorf) with
cultivars were used for the analysis of genetic the following conditions; the initial
diversity which is widely grown across the denaturation at 95°C for 5 min, following 40
Northern Karnataka, India (Table 1). All cycles of denaturation at 94°C for 1 min;
cultivars were maintained at S. Nijalingappa annealing condition was set depending on the
Sugarcane Research Institute, Belgavi, standardized annealing temperature (Table 2)
Karnataka. Young leaf samples were collected of each SSR primer with common time
and kept at -20°C until further analysis. duration of 1 min extension at 72°C for 2 min
and ended with final extension step for 10 min.
Genomic DNA Extraction The PCR reactions were repeated thrice for
Genomic DNA was extracted following the each primer for better reproducibility. Only
protocol of Doyle and Doyle (1987). The DNA highly reproducible and polymorphic primers
quality was confirmed by agarose gel were chosen for the data analysis.
electrophoresis (0.8%) and quantified with the
38
Scoring of DNA Bands similarity index and unweighted pair group
method with arithmetic mean (UPGMA) to plot
Fragments that were clearly readable were a dendrogram representing genetic diversity
considered for data analysis. Each amplified among 24 accessions (Figure 2). The genetic
product was considered to be a unit character similarity indices among cultivars ranged from
and the populations were scored for their 0.083 to 1 (Table 3). The cultivar S17 showed
presence (1) or absence (0) of a band on the gel least genetic similarity; the cultivar S18 with
(Botstein et al., 1980; Anderson et al., 1993) similarity index 0.083 and S19 was 100%
and the cluster analysis was performed. similar to S21, S22 and S23 with the similarity
Dendrogram was plotted with the aid of index of 1. Further, cluster analysis categorized
DendroUPGMA online server and similarity the cultivars into five clusters (Figure 2).
matrix was calculated using Jaccard’s
Table 2. List of SSR Primers with their Annealing Temperatures used
coefficient. in the present study
Oligo (Name) Primer (Sequence) AT
RESULTS AND DISCUSSIONS SCM4-F CATTGTTCTGTGCCTGCT(18) 52
SCM4-R CCGTTTCCCTTCCTTCCC(18)
SCM21-F CCCTCCCATAACACACAC(18) 55
The present investigation was undertaken to SCM21-R TTGACAGCCCAAAGAGTT(18)
evaluate genetic relatedness within 24 cultivars SCM27-F TTCTCTGACTTCCAATCCAA(20) 56
SCM27-R ATCAAGCACGCCCGCCTC(18)
of Saccharum sp. These 24 accessions were SCM32-F GATGAAGCCGACACCGAC(18) 55
maintained by S. Nijalingappa sugar institute, SCM32-R AGTTGCCTGTTCCCATTT(18)
SOMS58-F CCGCTTTCAACCTCTACAC(19) 52
Belgaum, Karnataka, India. Among 24 SOMS58-R GGCTTGGTGATTCTTCTCT(19)
cultivars, 12 were flowering (S1-S12) and 12 SOMS118-F GAGGAAGCCAAGAAGGTG(18) 57
SOMS118-R TAGAGCGAGGAGCGAAGG(18)
were non flowering (S13-S24) (Table 1). SOMS135-F TCTTCAACTTCCTCTGCCT(19) 55
Sugarcane is a heterozygous and considered to SOMS135-R GTTCCTGACTGTTCCCTTG(19)
SOMS148-F GATGACTCCTTGTGGTGG(18) 52
be genetically complex aneu-polyploid species. SOMS148-R CTTGACGACCCTGCTGCT(18)
Studies revealed that sugarcane readily UGSM60-F CGACTCCACACTCCACTC(18) 55
UGSM60-R CCGAACACCACCTTCTTG(18)
undergoes inbreeding depression upon selfing UGSM542-F ACCTCCACCTCCACCTCAGTTC(22) 55
(Stevenson, 1965). Hence, it is highly essential UGSM542-R CGTTCAGCTTCAGGGTGTCGAT(22)
AT: Annealing Temperature (oC)
to understand the genetic diversity of
Saccharum sp. in order to work on genetic
improvement of the germplasm for commercial Cluster 1 consists of one cultivar, S9. Cluster 2
purpose. Thus, in this study, we have made an consists of two groups; first group consists of
effort to decipher the genetic diversity of this S7, S12, S18, S20 cultivars. Second group
species using microsatellite markers especially consists of S4, S6, S8, S11 and S15. S17 with
SSR. A total of 10 SSR primers were used lowest genetic similarity is situated in the
which are specific for Saccharum sp. Among cluster 3. Cluster 4 consists of three groups.
ten primer sets, eight primers showed Cultivars S13, S16, S24 are situated in the first
reproducible bands (Figure 1). The detailed group, cultivars S19, S21, S22, S23 with 100%
information about the primers used in this similarity are situated in the second group and
study is tabulated in Table 2. cultivars S2, S3 are situated in the third group.
We noted that primer SCM-32 amplified Cluster 5 consists of S1, S5, S10 and S14. All
highest polymorphic bands as compared with clusters showed the mixture of flowering and
other selected primers. The above mentioned non-flowering cultivars which suggests the
primers amplified a total of 56 alleles out of 15 application of large number of SSR markers for
loci with a range of 1 to 6 alleles and an precise differentiation of cultivars. However,
average of 5.3 alleles per locus; proving the the present SSR markers used in the study is
efficiency of these SSR markers as a potential revealing the wide genetic diversity in studied
tool for detecting genetic variations in cultivars cultivars suggesting that SSR markers are
of studied Saccharum sp. important tool to assess the genetic diversity
Based on generated SSR profiles, cluster and relatedness in Saccharum sp. commercial
analysis was performed using Jaccard cultivars (Singh et al., 2010).
39
Figure 1. SSR Marker Analyses of Sugarcane Cultivars (1a: SOMS118-F, 1b: SOMS118-R, 2a:
UGSM542-F, 2b: UGSM542-R)
Table 3. Similarity Index Computed with Jaccard Coefficient
S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12
S13 S14 S15 S16 S17 S18 S19 S20 S21 S22 S23 S24
S1 1 0.625 0.625 0.263 0.667 0.250 0.231 0.385 0.125 0.700 0.211 0.143
0.429 0.545 0.429 0.250 0.222 0.231 0.571 0.154 0.571 0.571 0.571 0.429
S2 1 0.714 0.211 0.556 0.267 0.364 0.417 0.143 0.455 0.222 0.250
0.286 0.333 0.462 0.500 0.250 0.250 0.667 0.273 0.667 0.667 0.667 0.286
S3 1 0.211 0.556 0.267 0.364 0.417 0.143 0.600 0.222 0.250
0.286 0.333 0.462 0.286 0.250 0.250 0.667 0.273 0.667 0.667 0.667 0.286
S4 1 0.316 0.765 0.444 0.556 0.118 0.421 0.941 0.529
0.176 0.421 0.579 0.111 0.167 0.529 0.105 0.471 0.105 0.105 0.105 0.111
S5 1 0.400 0.417 0.462 0.250 0.636 0.263 0.308
0.222 0.500 0.500 0.222 0.200 0.417 0.500 0.333 0.500 0.500 0.500 0.222
S6 1 0.571 0.600 0.154 0.438 0.706 0.692
0.143 0.438 0.625 0.143 0.214 0.692 0.133 0.615 0.133 0.133 0.133 0.067
S7 1 0.667 0.222 0.357 0.471 0.800
0.091 0.357 0.467 0.333 0.182 0.636 0.182 0.700 0.182 0.182 0.182 0.200
S8 1 0.182 0.615 0.588 0.538
0.273 0.400 0.600 0.273 0.071 0.538 0.250 0.583 0.250 0.250 0.250 0.273
S9 1 0.200 0.125 0.222
0.250 0.200 0.154 0.250 0.200 0.222 0.200 0.250 0.200 0.200 0.200 0.250
S10 1 0.368 0.267
0.300 0.538 0.643 0.182 0.167 0.357 0.400 0.286 0.400 0.400 0.400 0.300
S11 1 0.562
0.188 0.368 0.526 0.118 0.176 0.471 0.111 0.500 0.111 0.111 0.111 0.110
S12 1
0.091 0.267 0.467 0.200 0.182 0.800 0.083 0.889 0.083 0.083 0.083 0.091
S13 1 0.300 0.143 0.200 0.167 0.091 0.400 0.100 0.400 0.400 0.400 0.500
S14 1 0.438 0.182 0.400 0.267 0.400 0.200 0.400 0.400 0.400 0.300
S15 1 0.231 0.133 0.571 0.308 0.500 0.308 0.308 0.308 0.143
S16 1 0.167 0.200 0.400 0.222 0.400 0.400 0.400 0.500
S17 1 0.083 0.333 0.091 0.333 0.333 0.333 0.167
S18 1 0.083 0.889 0.083 0.083 0.083 0.091
S19 1 0.091 1.000 1.000 1.000 0.400
S20 1 0.091 0.091 0.091 0.100
S21 1 1.000 1.000 0.400
S22 1 1.000 0.400
S23 1 0.400
S24 1
40
Figure 2. Phylogenetic Tree Analyses Based on Jaccard Coefficient
CONCLUSIONS sugarcane (Saccharum sp.), a highly polyploid
species. Plant Science, 155(2), 161‒168.
Doyle, J. J., Doyle, J. L. (1987). A rapid DNA isolation
In sugarcane, cultivars morphological tools procedure from small quantities of fresh leaf tissue.
have limited implication in progeny Phytochem Bull., 19, 11‒15.
identification as all sugarcane cross often Mohapatra, T., Krishanpal, Singh, S. S., Swain, S. C.,
consist of hybrids, selfs, and off-types. Hence Sharma, R. K., Singh, N. K. (2003). STMS-based
molecular markers can play vital role in DNA fingerprints of the new plant type wheat lines.
Current Science, 84(8), 1125‒1129.
sugarcane breeding program. Among the Silva, J. A. D., Bressiani, J. A. (2005). Sucrose synthase
various molecular markers, SSR markers may molecular marker associated with sugar content in
efficiently be used to evaluate the genetic elite sugarcane progeny. Genetics and Molecular
polymorphism to establish the breeding and Biology, 28(2), 294‒298.
conservation strategies for cultivated plants like Sindhu, R., Govindaraj, P., Balamurugan, A., Appunu,
C. (2011). Genetic diversity in sugarcane hybrids
Saccharum sp. (Saccharum spp. complex) grown in tropical India
based on STMS markers. Journal of Plant
REFERENCES Biochemistry and Biotechnology, 20(1), 118‒124.
Singh, R. K., Mishra, S. K., Singh, S. P., Mishra, N.,
Anderson, N. O. (2006). Flower Breeding and Genetics: Sharma, M. L. (2010). Evaluation of microsatellite
Issues, Challenges and Opportunities for the 21st markers for genetic diversity analysis among
Century. Springer, New York, pp. 586‒587. sugarcane species and commercial hybrids.
Anderson, A., Churchill, G.A., Autrique, J.E., Tanksley, Australian Journal of Crop Science, 4(2), 116.
S.D., Sorrells, M.E. (1993). Optimizing parental Singh, P., Singh, S. P., Tiwari, A. K., Sharma, B. L.
selection for genetic linkage maps. Genome, 36(1), (2017). Genetic diversity of sugarcane hybrid
181‒186. cultivars by RAPD markers. 3Biotech, 7(3), 222.
Bosland, P.W., Votava, E.J., Votava, E.M. (2012). Stevenson G. C. (1965). Genetics and Breeding of Sugar
Peppers: Vegetable and Spice Capsicums. CABI, Cane. (pp. 264). London: Logmans Green.
Wallingford, UK, pp. 76‒77. Vir, R., Bhat, K. V., Lakhanpaul, S. (2009).
Botstein, D., White, R.L., Skolnick, M., Davis, R.W. Transferability of sequence tagged microsatellite
(1980). Construction of a genetic linkage map in man sites (STMS) primers to pulse yielding taxa
using restriction fragment length polymorphisms. belonging to Phaseolae. International Journal of
American Journal of Human Genetics, 32(3), 314. Integrated Biology, 5, 62‒66.
Cordeiro, G. M., Taylor, G. O., Henry, R. J. (2000). Zhang, M. Q., Zheng, X. F., Yu, A. L., Xu, J. S., Zhou,
Characterisation of microsatellite markers from H. (2004). Molecular marker application in
sugarcane. Sugar Tech., 6(4), 251‒259.
41
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
RAPID DNA ISOLATION AND ISSR-PCR OPTIMIZATION FOR FIBROUS
LEAF TISSUES OF WILD PALMS OF SOUTHERN PENINSULAR INDIA
Umesh MADAR1, *, Devarajan THANGADURAI1, Suyamindra KULKARNI2, Pramod GAI2,
Jeyabalan SANGEETHA3
1
Department of Botany, Karnatak University, Dharwad, 580003, Karnataka, India
2
Karnataka Institute for DNA Research, Dharwad, 580003, Karnataka, India
3
Department of Environmental Science, Central University of Kerala, Kasaragod, 671316,
Kerala, India
*Corresponding author email: [email protected]
Abstract
Isolation of pure DNA is a significant component for PCR amplification and DNA fingerprinting analysis of plant
species. Leaves of wild palms are generally hard, enormously fibrous, and are difficult to grind. The 25 species belong
to 9 genera such as Areca (one species), Arenga (one species), Bentickia (one species), Borassus (one species),
Calamus (fifteen species), Caryota (one species), Corypha (one species), Phoenix (three species) and Pinanga (one
species) of the family Arecaceae and were collected from various parts of Southern India. An experiment was done to
isolate the high molecular weight DNA from fibrous young leaves of twenty five wild palm species followed by several
modifications in the novel CTAB DNA isolation method. DNA was isolated with slight modification in the CTAB method
with liquid nitrogen and the quantification of obtained DNA was measured using a spectrophotometer and 0.8%
agarose gel electrophoresis. DNA was further diluted with T10E1 buffer and optimized for ISSR-PCR amplification.
Hence, the described protocol has proven to be advantageous due to its simple, efficient, affordable reagents resulting
in a high molecular weight DNA of good quality from leaf fibrous tissues.
Key words: Arecaceae, CTAB, genomic DNA isolation, ISSR, Western Ghats.
INTRODUCTION geographical regions such as Peninsular India,
Northeastern India and Andaman and Nicobar
Palms are woody monocotyledons belongs to Islands (Takhtajan, 1987). Palms are less
family Arecaceae or Palmae. They are one of distributed in few regions of India, especially in
the prominent biotic components of the forest Gangetic plains and in the lower hill valleys of
ecosystem. Oftenly they fascinate with graceful North India.
architecture; they usually dominate the Various molecular biology tools were utilized
landscape of tropical habitats by providing for isolation of genomic DNA to attain
wide range of utility for human life. Palms appropriate purity. Several conventional
have been extensively exploited by the local methods have been established for isolation of
communities for food, fodder, handicrafts and pure and integral DNA from plant tissues
construction purpose. Food and allied products (Saghai Maroof et al., 1984; Doyle & Doyle,
have gained importance due to its nutritional 1990; Scott & Playford, 1996; Sharma et al.,
quality and also the fibrous tissue present in 2000; Pirttilä et al., 2001; Drábková et al.,
palm species is very flexible, strong and has a 2002; Shepherd et al., 2002; Mogg & Bond,
significant role in furniture industry. Thus, a 2003; Haymes, 1996). Thus, plant species
large number of inhabitants depend upon the comprises of same or related genera may
palms and palm byproducts for their livelihood, exhibit tremendous variability in the complex
which ultimately leads to the consumption of pathways of expendable functions. Due to
land areas for supplying physical space and variability among species or genera the same
expanding population and industry. Globally, DNA extraction procedure cannot be utilized
there are 211 genera consists of 3000 palm for all the plant species (Porebski et al., 1997;
species, whereas in India there are about 22 Ribeiro & Lovato, 2007; Fatemeh et al., 2018).
genera and 105 species present in three major Whereas, cetyltrimethylammonium bromide
42
(CTAB) process and its modifications have 2600 m were collected from KFRI (Palmetum),
proved as one of the prominent methods for Peechi, Kerala and some of them were also
good quality DNA for amplification based on collected from wild habitats of Western Ghats
polymerase chain reaction (PCR) downstream region of Chikmagalur, Shivamogga, Dakshina
applications. Numerous commercial extraction Kannada and Uttara Kannada districts of
kits are available such as DNeasy Plant Mini Karnataka. Soon after collection, leaf samples
Kits but due to high cost price, sensitivity for were transferred to the laboratory and washed
certain temperature, the constituent of the in 70% alcohol, blotted with tissue paper,
buffers is unknown to the user, and the lysis quickly frozen by dipping in liquid nitrogen
step is not always sufficient for some types of and kept at -80°C until further use.
plant material (Ahmed et al., 2009). So using
such commercially available kits hence proved Reagents, Chemicals and Laboratory
to be laborious, time consuming and expensive. Materials
Certain limitations necessitate the advancement
of universally accepted protocol for isolating CTAB extraction buffer consisted of 2%
DNA from diverse plant species. Hence, in the CTAB, 5 M NaCl, 0.5 M EDTA and 1 M Tris-
present study genomic DNA isolation protocol HCl. Stock solutions for the different CTAB
was optimized for 25 species that belong to 9 buffer components were prepared to
genera such as Areca (one species), Arenga homogenize the following protocol. Other
(one species), Bentickia (one species), reagents and materials such as 3% β-
Borassus (one species), Calamus (fifteen mercaptoethanol, 15% PVP-4.0, propanol,
species), Caryota (one species), Corypha (one ethanol (absolute), Tris-EDTA (T10E1) buffer
species), Phoenix (three species) and Pinanga solutions were prepared. Laboratory pestle and
(one species) of the family Arecaceae. This mortar, 1.5 and 2 mL microcentrifuge tubes,
method does not require any hazardous micropipettes, microtips, pair of scissors, and a
chemicals. Based on the quantity and quality of 40-well holding racks were used for the
the DNA obtained by this modified protocol is experiments. Centrifugation was done by
well enough to perform thousands of PCR- Centrifuge 5415-R at maximum speed of 14000
based reactions and also used for DNA rpm.
manipulation techniques, such as restriction
digestion, AFLP, Southern blotting and DNA Extraction and Quantification
cloning. Due to its low cost price, consumption
of short time period makes this method one of CTAB method was followed for the extraction
the phenomenal technique for isolating and isolation of DNA as prescribed by Doyle
genomic DNA in wild palms. The main and Doyle (1987). Several modifications were
objective to develop this protocol was to make made to the original protocol in order to fit
this technique readily available for isolating with the current experimental conditions. The
highly pure genomic DNA from fibrous leaves CTAB buffer was prepared using 2%
of wild palm and to optimize the DNA cetyltrimethylammonium bromide, 1 M Tris-
concentration. The isolated high quality HCl pH 8.0, 0.5 M EDTA pH 8.0, 5 M NaCl,
genomic DNA is amenable to ISSR (Inter- 3% β-mercaptoethanol and 2% PVP. About
Simple Sequence Repeats). 0.5-1 g leaf sample was ground into fine
powder using liquid nitrogen in a mortar and
MATERIALS AND METHODS pestle and 4 ml of preheated 2× CTAB lysis
buffer at 65 to make the paste. The mixture is
Collection of Samples incubated at 65°C for 90 minutes for lyses and
lysate was extracted with phenol: chloroform:
Young leaves of twenty-five wild palm belong isoamyl alcohol (25: 24: 1) upon cooling to
to 9 genera which are basically an endemic, room temperature. The DNA is precipitated by
endangered and rare species which possess adding an equal quantity of prechilled
limited distribution range and only available in isopropanol. The DNA pellet is washed twice
selected regions with the elevation of 400 m to in 70% alcohol, air dried, dissolved in T10E1
43
and stored at -20°C until further use. Gel Doyle, 1987) (Table 1). Fresh leaf samples are
electrophoresis of genomic DNA was done recommended for genomic DNA isolation. If
with 0.8% agarose gel in 1× TAE buffer (Mini any tissues are immersed in liquid nitrogen it
Sub System, BioRad, India). The image of the will be brittle hard to ease crushing into
gel obtained is shown in Figure 1. powder, the main purpose is to maintain low
temperature of plant material. This step can be
ISSR-PCR based Amplification using skipped for spongy tissues and easy to grind
Extracted DNA Samples material like flower petals. Cellular DNA
extraction from hard, fibrous leaves of palm is
An experiment was conducted to optimize very complex when compared to flower petals
DNA concentration by Polymerase Chain and soft leaves. Most of the developing
Reactions (PCR). A total volume of 10 µl PCR countries still facing problem of unavailability
reaction mixture consisted of Taq buffer, of liquid nitrogen as its storage and
MgCl2, primers (UBC 834 maintenance also quite difficult.
AGAGAGAGAGAGAGAGYT), dNTPs, Milli Cetyltrimethylammonium bromide (CTAB) is
Q water and Taq polymerase (3 U/µl), along one of the phenomenal methods for DNA
with DNA sample. PCR amplification was extraction from a variety of plant materials
carried out in a 10 µl reaction volume (Sambrok et al., 1989). Generally, there will be
containing 1 µl genomic DNA, Taq Buffer 1.5 certain contaminants associated with plant
µl, MgCl2 1 µl, UBC 834 1 µl, dNTPs 1 µl, DNA interfere PCR reactions such as
Milli Q water 3.75 µl and Taq Polymerase 0.25 polyphenolic compounds and polysaccharides
µl. Amplification was carried out in initial (Krishna et al., 2012).
denaturation step at 95°C for 3 min, followed
by 32 cycles denaturation 95°C for 30 sec. Table 1. Qualitative Analysis of Genomic DNA Isolated
UBC 834 Primer annealing temperature was from Wild Palms of Southern Peninsular India
Palm Species OD DNA
59.1°C, for 45 sec, 72°C for 2 min (primer Ratio ng/µL
extension) and a final extension at 72°C for 10 Areca triandra Roxb. 1.85 763.7
min. Electrophoresis was carried out to perform Arenga wightii Griff. 1.85 470.6
ISSR-PCR products on 1.8% agarose gel with Bentinckia condapanna Berry ex 1.75 297.6
1× TAE and a standard 1 kb ladder. Roxb.
Borassus flabellifer Linn. 1.96 797.7
Calamus brandisii Becc. 1.98 532.8
Agarose Gel Electrophoresis Calamus delessertianus Becc. 1.97 381.1
Calamus dransfieldii Renuka 1.99 225.2
The PCR products were visualized on a 1.8% Calamus hookerianus Becc. 1.99 512.4
agarose gel with a standard 50 bp ladder. Calamus karnatakensis Renuka & 1.78 209.3
Agarose gels were prepared using 1× TAE Lakshmana
Calamus lacciferus Lakshmana & 2.02 437.5
buffer. A concentration of 0.6 µl of ethidium Renuka
bromide was added to the gel for visualization Calamus lakshmanae Renuka 1.89 398.0
of the bands. The PCR product mixture was Calamus metzianus Schltdl. 1.89 215.9
loaded along with loading dye 0.0042 g Calamus nagbettai R.R. Fernald & 1.98 195.8
bromophenol blue in 0.0607 g of sucrose Dey
Calamus prasinus Lakshmana & 1.97 235.7
solution. The gel profile of each ISSR primer Renuka
amplicons was visualized in a UV Trans- Calamus stoloniferus Renuka 1.91 352.3
illuminator Gel Documentation System (Vilber Calamus thwaitesii Becc. 1.83 228.8
Lourmat Infinity-1000/26 M). Calamus travancoricus Bedd. 1.88 202.6
Calamus vattayila Renuka 1.78 672.4
Calamus viminalis Willd. 1.97 816.3
RESULTS AND DISCUSSIONS Caryota urens L. 2.01 254.8
Corypha umbraculifera L. 1.69 748.3
High yield pure DNA was obtained for twenty- Phoenix loureiroi Kunth 1.88 280.4
five different species of Arecaceae members Phoenix pusilla Gaertn. 1.78 249.8
followed by few modifications in the novel Phoenix sylvestris (L.) Roxb. 1.96 286.5
Pinanga dicksonii (Roxb.) Blume. 1.81 507.1
CTAB DNA isolation protocol (Doyle and
44
Figure 1. Genomic DNA Isolated from Twenty Five Wild Palms: 1 – Areca triandra; 2 – Arenga wightii; 3 –
Bentinckia condapanna; 4 – Borassus flabellifer; 5 – Calamus brandisii; 6 – C. delessertianus; 7 – C.
dransfieldii; 8 – C. hookerianus; 9 – C. karnatakensis; 10 – C. lacciferus; 11 – C. lakshmanae; 12 – C.
metzianus; 13 – C. nagbettai; 14 – C. prasinus; 15 – C. stoloniferus; 16 – C. thwaitesii; 17 – C. travancoricus;
18 – C. vattayila; 19 – C. viminalis; 20 – Caryota urens; 21 – Corypha umbraculifera; 22 – Phoenix loureiroi;
23 – P. pusilla; 24 – P. sylvestris; 25 – Pinanga dicksonii
Figure 2. Optimization of DNA Concentration for ISSR-PCR: M-1kb DNA Ladder: 1 – Areca triandra; 2 –
Arenga wightii; 3 – Bentinckia condapanna; 4 – Borassus flabellifer; 5 – Calamus brandisii; 6 – C.
delessertianus; 7 – C. dransfieldii; 8 – C. hookerianus; 9 – C. karnatakensis; 10 – C. lacciferus; 11 – C.
lakshmanae; 12 – C. metzianus; 13 – C. nagbettai; 14 – C. prasinus; 15 – C. stoloniferus; 16 – C. thwaitesii; 17 –
C. travancoricus; 18 – C. vattayila; 19 – C. viminalis; 20 – Caryota urens; 21 – Corypha umbraculifera; 22 –
Phoenix loureiroi; 23 – P. pusilla; 24 – P. sylvestris; 25 – Pinanga dicksonii
Polyphenols are potent oxidizing agent present exclusion of chlorophyll and various coloring
in various plant species which are capable of agents such as pigments and dyes. To remove
decrease in the yield and purity of the DNA detergents and proteins precipitation steps were
(Katterman & Shattuck, 1983; Peterson & increased by increasing the speed and time of
Boehm, 1997; Porebski et al., 1997). centrifugation. The modification necessitates
Avoidance of contamination is made by adding amplifying high quality and quantity of
PVP along with CTAB which promotes to bind genomic DNA. The purity and quantity may
with polyphenolic compounds by forming a differ among applications (Hussein et al., 2005;
compound with hydrogen bonds (Maliyakal, Zidani et al., 2005).
1992). The minimum OD 1.69 and maximum of 2.02
Secondary metabolites such as phenolics, was observed (Table 1). High quality DNA was
terpenes and alkaloids are very difficult to obtained from all the wild palm leaf samples
separate from DNA (Ziegenhagen & Scholz, and amount of DNA isolated between 195.8
1998). For removal of polysaccharides and to μg/ml and maximum 816.3 μg/ml. Reading was
avoid damage in leaf tissue, NaCl is used in taken using spectrophotometer. Both the
DNA extraction buffer (Fang et al., 1992). nucleic acids (DNA and RNA) absorb at 260
Phenol: chloroform: isoamyl alcohol is used for nm, so evaluation of concentration of DNA
45
sample is done with same spectrophotometric extraction of DNA from large populations of
conditions. wild palm.
A protein also absorbs light at this wavelength
so it is possible to obtain contamination of CONCLUSIONS
protein in high concentration which gives a
false result in sample. Though, protein, also Here we have illustrated a very efficient,
absorb light at 280 nm by evaluating both A260 simple, cost-effective and less time consumable
and A280 it is easy to measure the ratio of modified CTAB DNA extraction method that
nucleic acid to protein in the solution and thus provides high-quality DNA from wild palms
estimate the accuracy of DNA concentration. containing an elevated concentration of
The absorbance ratio obtained was polyphenolic compounds and polysaccharides.
(A260/A280) 1.8-2.0 is considered acceptable For removal of polysaccharides and to avoid
(Sambrook & Russell, 2001; Iruela et al., 2002; damage in leaf tissue, 5 M NaCl is used in
Wang et al., 2011; Wang et al., 2012). Lower DNA extraction buffer. This method eliminates
values comprise of high level of protein the need to use environmentally hazardous
contamination and estimation of the DNA chemicals to obtain high-quality genomic
concentration will not be accurate. DNA. The resulting optimized CTAB protocol
facilitates the isolation of high quality genomic
It is necessary to obtain high quality DNA that DNA amenable to ISSR and various other
is proportionately free from the various processes such as enzyme digestion and
contaminants found in plant cells (Shiv et al., cloning techniques. A fibrous leaf of palm is
2017). Naturally large amount of proteins are very complex when compared to flower petals
found in most of the plant species and several and soft leaves, this method proved to be
other components are rectified which can bind phenomenal especially the plant with high
firmly to nucleic acids during isolation of DNA fibrous tissue. The CTAB percentage was
and can interfere in DNA amplification increased though there will be certain
(Angeles et al., 2005; Ribeiro & Lovato, 2007). contaminants associated with plant DNA
Storing of isolated DNA is a significant factor, interfere PCR reactions such as polyphenolic
generally at -20°C gave positive percentage. compounds and polysaccharides. Prevention of
This is an expected result because room contamination is made by adding PVP along
temperature is certainly not a suitable condition with CTAB which promotes to bind with
for storing isolated DNA (Supriya et al., 2019). polyphenolic compounds by forming a
The DNA obtained was used for PCR analysis compound with hydrogen bonds. Therefore this
and possess high intensity amplification. PCR method can be recommended for low-
amplification also showed that the DNA was of technology laboratories for high-throughput
high quality, free from several interfering sample preparation suitable for various
compounds and that it would be capable for molecular analytical techniques.
various other DNA analyses such as ISSR
(Lavanya et al., 2008; Sunil Kumar et al., 2012; ACKNOWLEDGEMENTS
Shafiei-Astani et al., 2015). The present study
was carried out to optimize the concentration of The authors would like to thank Karnataka
total genomic DNA for the PCR using ISSR Institute for DNA Research, Dharwad for
primers. The amplification of DNA from PCR providing laboratory facilities and first author
analysis with ISSR primer was clear as shown UM wish to thank Karnatak University,
in Figure 2. Dharwad for providing financial assistance in
The absence of RNA, polysaccharides and the the form of UPE (University with Potential for
amplification of molecular bands are evident of Excellence) Fellowship.
a good DNA quality with modified Doyle and
Doyle protocol. The satisfactory quality and REFERENCES
DNA yield was obtained from this protocol and
hence considered as a simple, cost effective and Ahmed, I., Islam, M., Arshad, W., Mannan, A., Ahmad,
time saving protocol can further be used for W., Mirza, B. (2009). High quality plant DNA
46
extraction for PCR: an easy approach. Journal of levels of polyphenolic compounds. Plant Molecular
Applied Genetics, 50(2), 105‒107. Biology Reporter, 15(2), 148‒153.
Angeles, J. G. C., Laurena, A. C., Tecson-Mendoza, E. Pirttilä, M. A., Hirsikorpi, M., Kämäräinen, T., Jaakola,
M. (2005). Extraction of Genomic DNA from the L., Hohtola, A. (2001). DNA isolation methods for
lipid, polysaccharide and polyphenol rich coconut medicinal and aromatic plants. Plant Molecular
(Cocos nucifera L.). Plant Molecular Biology Biology Reporter, 19(3), 273.
Reporter, 23, 297. Porebski, S., Bailey, L. G., Baum, B. R. (1997).
Doyle, J. J., Doyle, J. L. (1987). A rapid DNA isolation Modification of a CTAB DNA extraction protocol
procedure for small quantities of fresh leaf tissue. for plants containing high polysaccharide and
Phytochemical Bulletin, 19(1), 11‒15. polyphenol components. Plant Molecular Biology
Doyle, J. J., Doyle, J. L. (1990). Isolation of plant DNA Reporter, 15(1), 8‒15.
from fresh tissue. Focus, 12(1), 13‒15. Ribeiro, R. A., Lovato, M. B. (2007). Comparative
Drábková, L., Kirschner, J., Vlcek, C. (2002). analysis of different DNA extraction protocols in
Comparison of seven DNA extraction and fresh and herbarium specimens of the genus
amplification protocols in historical herbarium Dalbergia. Genetics and Molecular Research, 6(1),
specimens of Juncaceae. Plant Molecular Biology 173‒187.
Reporter, 20(2), 161‒175. Saghai-Maroof, M. A., Soliman, K. M., Jorgensen, R. A.,
Fang, G., Hammar, S., Grumet, R. (1992). A quick and Allard, R. W. (1984). Ribosomal DNA spacer-length
inexpensive method for removing polysaccharides polymorphism in barley: mendelian inheritance,
from plant genomic DNA. Biotechniques, 13(1), chromosomal location, and population dynamics.
52‒54. Proc Natl Acad Sci USA. 81(24), 8014‒8019.
Fatemeh, A., Mehdi, T., Ali Teimoori., Nozhat, Z., Sambrook, J., Fritsch, E. F., Maniatis, T. (1989).
Bahman, C. (2018). Evaluation of three protocols of Molecular cloning: a laboratory manual (2nd ed.).
DNA extraction for detection of Giardia duodenalis Cold Spring Harbor, (pp. 6.3-6.62), N.Y: Cold Spring
in human fecal specimens. Jundishapur Journal of Harbor Laboratory Press.
Microbiology, 11(4), e63096. Sambrook, J., Russell, D. W. (2001). Molecular cloning:
Haymes, K. M. (1996). Mini-prep method suitable for a a laboratory manual (3rd ed.). Cold Spring Harbor,
plant breeding program. Plant Molecular Biology N.Y: Cold Spring Harbor Laboratory Press.
Reporter, 14(3), 280‒284. Scott, K. D., Playford, J. (1996). DNA extraction
Hussein, E. H. A., Adawy, S. S., Ismail, S. E. M. E., El- technique for PCR in rain forest plant species.
Itriby, H. A. (2005). Molecular characterization of Biotechniques, 20(6), 974‒979.
some Egyptian date palm germplasm using RAPD Shafiei-Astani, B., Ong, A. H. K., Valdiani, A., Tan, S.
and ISSR markers. Arab Journal of Biotechnology, G., Yong, C. S. Y., Ahmady, F., Alitheen, N. B., Ng,
8(1), 83‒98. W. L., Kaur, T. (2015). Molecular genetic variation
Iruela, M., Rubio, J., Cubero, J. I., Gil, J., Millan, T. and structure of Southeast Asian crocodile
(2002). Phylogenetic analysis in the genus Cicer and (Tomistoma schlegelii): comparative potentials of
cultivated chickpea using RAPD and ISSR markers. SSRs versus ISSRs. Gene, 571, 107‒116.
Theoretical and Applied Genetics, 104(4), 643‒651. Sharma, K. K., Lavanya, M., Anjaiah, V. (2000). A
Katterman, F. R. H., Shattuck, V. I. (1983). An effective method for isolation and purification of peanut
method of DNA isolation from the mature leaves of genomic DNA suitable for analytical applications.
Gossypium species that contain large amounts of Plant Molecular Biology Reporter, 18(4), 393.
phenolic terpenoids and tannins. Preparative Shepherd, M., Cross, M., Stokoe, R. L., Scott, L. J.,
Biochemistry, 13(4), 347‒359. Megan, E. J. (2002). High throughput DNA
Krishna, R. B., Reddy, S. R. R., Javangula, H., Swapna, extraction from forest trees. Plant Molecular Biology
D., Reddy, K. J. (2012). An easy and simple method Reporter, 20, 425.
of isolation and purification of genomic DNA from Shiv, M. D., Sujeet, K., Antre, S. H., Ramanjini, G. P. H.
the leaves of Gymnema sylvestre an anti-diabetic (2017). Comparative study of high quality genomic
plant. International Journal of Life science and DNA extraction protocols in rice and tomato crops.
Pharma Research, 2(1), 15‒20. International Journal of Current Microbiology and
Lavanya, G. R., Srivastava, J., Ranade, S. A. (2008). Applied Sciences, 6(11), 2763‒2772.
Molecular assessment of genetic diversity in Supriya, S., Riti, M., Sandeep, K., Neelima, M., Bina, S.,
mungbean germplasm. Journal of Genetics, 87(1), Neena, V., Anupkumar, R. A. (2019). A simple and
65‒74. cost-effective freeze-thaw based method for
Maliyakal, E. J. (1992). An efficient method for isolation plasmodium DNA extraction from dried blood spot.
of RNA and DNA from plants containing Iran Journal of Parasitology, 14(1), 29‒40.
polyphenolics. Nucleic Acids Research, 20(9), 2381. Sunil Kumar, S., Muthusamy, T., Kandasamy, K. (2012).
Mogg, R. J., Bond, J. M. (2003). A cheap, reliable and DNA extraction protocol for plants with high levels
rapid method of extracting high quality DNA from of secondary metabolites and polysaccharides
plants. Molecular Ecology Notes, 3, 666‒668. without using liquid nitrogen and phenol.
Peterson, D. G., Boehm, K. S. (1997). Isolation of International Scholarly Research Network,
milligram quantities of nuclear DNA from tomato doi:10.5402/2012/205049.
(Lycopersicon esculentum), a plant containing high Takhtajan, A. (1987) Systema Magnoliophytorum (in
Russian). Nauka Publication: Moscow, pp. 1‒439.
47
Wang, X., Yang, R., Feng, S., Hou, X., Zhang, Y., Li, Zidani, S., Ferchichi, A., Chaieb, M. (2005). Genomic
Y., Ren, Y. (2012) Genetic variation in Rheum DNA extraction method from pearl millet
palmatum and Rheum tanguticum (Polygonaceae), (Pennisetum glaucum) leaves. African Journal of
two medicinally and endemic species in China using Biotechnology, 4(8), 862‒866.
ISSR markers. PLOS One, 7(12), e51667, Ziegenhagen, B., Scholz, F. (1998). Methods for difficult
https://doi.org/10.1371/journal.pone.0051667 plant species. In A. Karp., P.G. Issac., D.S. Ingram
Wang, T. Y., Wang, L., Zhang, J. H., Dong, W. H. (Eds.), Molecular Tools for Screening Biodiversity
(2011). A simplified universal genomic DNA 2.2. Plants and Animals, (pp. 32‒35). London:
extraction protocol suitable for PCR. Genetics and Chapman and Hall.
Molecular Research, 10(1), 519‒525.
48
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
MOLECULAR DIVERSITY IN WILD POPULATIONS
OF Pinanga dicksonii (Roxb.) Blume (Arecaceae) FROM WESTERN
GHATS OF KARNATAKA USING MICROSATELLITE MARKERS
Umesh MADAR1, *, Devarajan THANGADURAI1, Kusum Pramod ANGADI1,
Vadakkethil Balakrishnan SREEKUMAR2, Jeyabalan SANGEETHA3
1
Department of Botany, Karnatak University, Dharwad, 580003, Karnataka, India
2
Division of Forest Ecology and Biodiversity Conservation, Kerala Forest Research Institute,
Peechi, Thrissur, 680653, Kerala, India
3
Department of Environmental Science, Central University of Kerala, Periye, Kasaragod, 671316,
Kerala, India
*Corresponding author email: [email protected]
Abstract
A precise understanding of genetic diversity and relatedness of Pinanga dicksonii (Roxb.) is an important component in
its genetic improvement and germplasm conservation. P. dicksonii is an understory endemic palm of Western Ghats of
Karnataka. The genetic diversity analysis among nine genotypes of P. dicksonii has been carried out using SSR
markers. Among the 10 tested SSR markers, 9 successfully revealed polymorphism, SSRs demonstrating 123 alleles in
total, with a range of 20 to 22 alleles at each primer. Allele frequency at each locus ranged from 22.22% to 100% with
a mean of 71.92%. The PIC of each primer varied from 0.25 to 0.87 with an average of 0.38. The UPGMA-based
clustering analysis performed by NTSYS pc program (version 2.0) revealed that among the 9 studied genotypes, there
was a high level of polymorphism among some genotypes, as well as genetic similarities, with index values ranging
from 0.473 to 0.928.
Key words: genetic diversity, Pinanga dicksonii, SSR markers, UPGMA, dendrogram.
INTRODUCTION Ghats. The plant grows up to 5-7 meters height.
It is widely distributed in Puttur Ghat,
Palms are one of the significant economically Kerekatte, Gerusoppa, Kuduremukha and
essential classes of tropical and subtropical Agumbe forests at an elevation of 250-1000 m.
plants which play a vital role in food and raw Some local tribes consume the fruits of this
material. Although they are under-explored plant as a substitute for betel nuts. The stem is
species, they certainly amplify the chances of used to make walking sticks and as building
survival for people in developing countries. material for huts (Renuka, 1998).
Throughout the world, they are represented by Molecular markers are relevant for genetic
212 genera encompassing 3000 species. diversity assessments being able to define
Whereas, India it is very well represented by 22 population relationships. They are not harmful
genera with 105 species. Small quantities of to the environment and can be detected in all
palm species occur elsewhere in India, stages of plant growth and development
predominantly in Gangetic plains and in the (Mondini et al., 2002). But isozymes markers
lower hill valleys of Northern India (Bhat, are not adequately variable due to their low
2011; Renuka & Sreekumar, 2012). polymorphism (Ghesquiere, 1985; Purba et al.,
P. dicksonii (Roxb.) Blume is an endemic palm 2000). In genetic diversity analysis, Random
of the Western Ghats of Karnataka and Kerala, Amplified Polymorphism DNA (RAPD) has
commonly recognized as Ivory crown shaft certain limitations, like poor reproducibility of
palm (Bhat, 2011). It is commonly grown amplification (Rafalski, 1997). Restriction
across the moist area, as an understory-solitary fragment length polymorphic DNA (RFLP) is
palm. Usually, stem emerges beneath stolon. It another vigorous molecular marker which
is found as colonizer under favorable requires a relatively large amount of purified
conditions in the evergreen forests of Western DNA with high molecular weight, which is a
49
time-consuming and overlong protocol MATERIALS AND METHODS
(Maizura et al., 2006). Ultimately, Amplified
fragment length polymorphism (AFLP) is Plant Material
scored either as a presence/absence Nine genotypes of P. dicksonii were considered
polymorphism. Simple sequence repeats for this study. This plant is an endemic species
(SSRs) are most commonly used molecular for Karnataka and Kerala. It has a limited
markers in studying interspecies and distribution range and is available only in the
intraspecies genetic diversity of the specified zones (Figure 1). The leaf samples
microsatellite loci. Microsatellites can be were collected from forest areas of Uttara-
implemented as mono locus co-dominant Kannada, Shivamogga, Dakshina Kannada,
markers by amplifying single microsatellite Chikmagalur and Udupi districts of Karnataka.
loci into molecular markers by designing Collected plants are listed in Table 1. Young
primers with the aid of specific sequence leaves were collected from the wild habitat and
flanking (Kumar et al., 2009). Microsatellites stored at -80°C prior to DNA extraction.
offer a high level of polymorphism (Ellegren,
2004; Moges et al., 2016). As a result, they act DNA Isolation and Purification
as unique markers for studying population The DNA extraction followed the CTAB
genetics, and gene mapping (Hearne et al., method described by Doyle and Doyle (1987)
1992; Jarne & Lagoda, 1996). Among all types with certain modifications. CTAB lysis buffer
of PCR based molecular markers, the SSRs are (2×) was prepared by mixing 2%
more informative, efficient and also cost- cetyltrimethylammonium bromide, 100 mM
effective. The factor of abundance, co- Tris-HCl pH 8.0, 20 mM EDTA pH 8.0, 1.4 M
dominance, highly reproducible and NaCl, 2% β-Mercaptoethanol and 2% PVP-40.
interspersed nature of microsatellite loci An amount of 7.5 ml 2× CTAB lysis buffer
throughout the genome make the SSR marker was preheated at 65ºC and mixed with 2 g leaf
the most potential and highly applicable in powder, prepared by grinding the leaf samples
genetic diversity studies (Matin et al., 2012). in liquid nitrogen. The mixture was then
Several previous reports suggest that SSR incubated for lysis at 65ºC for 60 min. The
markers are suitable for studying genetic lysate was extracted with Phenol: Chloroform:
variation and relationship among different Isoamyl Alcohol (25: 24: 1) and DNA were
genotypes, thus finds its application as a potent precipitated by adding an equal quantity of pre-
molecular marker in studying genetic variation chilled isopropanol. The DNA pellet was
(Eujayl et al., 2001; Russell et al., 2004). SSRs washed in 70% alcohol, air dried and dissolved
markers are widely used for studying the in T10E1. The DNA samples were stored at
genetic diversities of different plant species, -20ºC until further use.
viz., maize (Garcia et al., 2004; Afaf et al.,
2009), Medicago sativa L. (Wang et al., 2014), DNA Quantification
Coffea canephora Pierre ex A. Froehner The genomic DNA was profiled using 0.8% gel
(Hendre et al., 2014); raspberry and blackberry electrophoresis in 1× TAE buffer (Mini Sub
(Eric et al., 2005), Myrica rubra (Yun et al., System, BioRad, India). Gel imaging was
2012), cucumber (Hu et al., 2011), Cynodon performed using UV trans-illuminator
transvaalensis (Tan et al., 2014), garlic (VilberLourmat Infinity-1000/26 M). Genomic
(Meryem et al., 2015) and rice (Matin et al., DNA was quantified using NanoDrop
2012; Shahriar et al., 2014; Nivedita et al., Spectrophotometer (Quawell 3000-UV
2016). Many investigators have also Spectrophotometer). The genomic DNA
demonstrated the use of SSR markers (Powell samples having absorbance ratios of 260/280
et al., 1996; Afaf et al., 2009). between 1.8-1.9 were used for SSR
In the present study, we used SSR markers to amplification.
analyze the intraspecies genetic diversity and
relationship among the 9 wild genotypes of P.
dicksonii from different locations of Karnataka
region of Western Ghats.
50
products were mixed with loading dye 0.25%
bromophenol blue in 40% of sucrose solution.
The gel profile of each SSR primer amplicons
was visualized in a UV trans-illuminator Gel
documentation system (Infinity-1000/26M,
VilberLourmat, France).
Scoring of Amplified Fragments
The best gel profile showing the perfectly
resolved bands of each allele was considered
for further analysis. Clear PCR products were
transcripted in binary code, where each
amplicon was recorded as one (1) for presence,
and as zero (0) for the absence of DNA band in
the gel. The number of alleles per loci was
documented; accordingly average allele
Figure 1. P. dicksonii. A – habit; B – leaves; C – trunk; frequency was estimated. Polymorphism
D – inflorescence; E – fruit information content value was calculated by
following a standardized method for each
SSR Primers primer in order to evaluate the primer
A total of 10 palm specific microsatellite efficiency (Botstein et al., 1980; Anderson et
markers (Table 3) were used to estimate the al., 1993). Cluster analysis and dendrogram
genetic diversity among 9 genotypes of P. were drawn using NTSYS-pc software version
dicksonii considered in this study. SSR primers 2.0 by UPGMA method, and the similarity
were purchased from Sigma Aldrich, matrix was deduced using Dice coefficient
Bangalore. (Garcia-Vallvé et al., 1999).
SSR-PCR Amplification RESULTS AND DISCUSSIONS
The SSR primers were chosen selectively based
on those which yielded amplification of In the present investigation, 9 genotypes of P.
microsatellite loci in the genome of the studied dicksonii were studied for their intra-species
plant species. PCR amplification was carried genetic diversity and clustering. The OD values
out in a 20 µl reaction volume containing Taq ranged between 1.82 and 1.97 (Table 2). High-
buffer 1×, dNTP mix 2 mM, Forward Primer 5 quality DNA was obtained from all the
pM, Reverse Primer 5 pM, Taq Polymerase 1 Pinanga leaf samples and high amount of DNA
U, genomic DNA 100 ng. Amplification was was isolated, between 110.0 μg/ml and 498.5
carried out using The Master Cycler Gradient μg/ml. A total of 10 SSR markers reported in
thermal cycler (Eppendorf AG 22331, earlier studies were selected for generation of
Hamburg, Germany) under the following polymorphic SSR in the present study (Table 3)
conditions: initial denaturation at 95ºC for 30 (Singh et al., 2008; Ngoot-Chin et al., 2010;
sec, and 40 cycles of denaturation at 95ºC for Noorhariza et al., 2012). Among the SSR
15 sec, specific primer annealing temperature markers used, 9 primer pairs showed
for 15 sec, primer extension at 68ºC for 1 min amplification of DNA fragments. These
and a final extension at 68ºC for 5 min. markers were coded as sEg00090, sEg00113,
sEg00036, sMo00020, sMo00130, sEg00067,
Agarose Gel Electrophoresis sMo00154, sMo00138 and sEg00038. Primer
The PCR products were visualized on a 2% pair sEg00090 revealed the most relevant
agarose gel prepared in 1× TAE buffer, with a results among all tested primers, as this primer
standard 50 bp ladder. A concentration of 0.05 pair amplified the highest number of
µg/ml of ethidium bromide was added to the polymorphic bands (Figure 2).
gel for visualization of the bands. The PCR
51
Table 1. Plant sampling locations and their accession names
Collection area Accession name Latitude (°N) Longitude (°L)
PutturGhat, Puttur, Dakshina Kannada District Putghat 12° 50 75° 31
Bhagavathi, Kuduremukha, Chikmagalur District Bgvti 13° 11 75° 11
Jamble, Kuduremukha, Chikmagalur District Jmble 13° 13 75° 15
Gerusoppa, Uttara Kannada District Grspa 14° 13 74° 39
Agumbe, Thirthahalli, Shivamogga District Agmbe 13° 30 75° 05
SK Border, Sringeri, Chikmagalur District Skbrdr 13° 17 75° 08
GanapathiKatte, Sringeri, Chikmagalur District Gptkte 13° 25 75° 19
Jamble, Koppa, Chikmagalur District Jmbko 13° 31 75° 21
Gulaganjimane, Sringeri, Chikmagalur District Glgjmne 13° 20 75° 10
Table 2. Nano-drop values for genomic DNA quantification of P. dicksonii
Samples 260/280 ng/ml
Putghat 1.88 110.0
Bgvti 1.83 159.5
Jmble 1.83 120.1
Grspa 1.85 169.1
Agmbe 1.97 199.4
Skbrdr 1.82 271.9
Gptkte 1.86 183.5
Jmbko 1.92 498.5
Glgjmne 1.91 240.7
Nine tested markers efficiently produced 123 sEg00036 showed highest PIC and sMo00020
amplicons with a range of 20 to 22 alleles. The showed lowest PIC value among all primers
gel profile of each primer pair was analyzed used. This indicates the efficiency of the
and the allele frequency at each locus was selected markers in presenting the
estimated ranging from 22.22% to 100% with a polymorphism among related genotypes of P.
mean of 71.92%, demonstrating the efficiency dicksonii. Afaf et al. (2009) have reported that
of each primer based on allele frequency. SSR markers are twice more informative than
Genetic diversity or similarities among the 9 AFLP and RAPD in terms of revealing alleles
genotypes were calculated at each locus for per locus. The alleles were scored individually
allelic Polymorphism Information Content based on the comparison with molecular weight
(PIC). The calculation for each SSR primer pair ladder. The similarity matrix was derived based
used in the study was made following the on Jaccard-coefficient and the dendrogram was
standardized method (Botstein et al., 1980; constructed by Unweighted Pair Group Method
Anderson et al., 1993), by analyzing the allele with Arithmetic Mean (UPGMA). The
frequencies of 9 primers among all 9 dendrogram showed two distinct groups
genotypes. According to the prescribed (Figure 3) in which the genotypes Puttur Ghat
standards, the PIC value must be between zero (Putghat), Bhagavathi (Bgvti) and Gerusoppa
(0) and one (1) depending upon primer (Grspa) formed a cluster A whereas genotypes
efficiency in order to demonstrate the allelic Agumbe (Agmbe), Jamble (Jmble), SK Border
variation. In this study, the PIC of the loci (Skbrdr), Ganapathi Katte (Gptkte), Jamble-
ranged from 0.25 to 0.87 with a mean of 0.38. Koppa (Jmbko), and Gulaganjimane (Glgjmne)
PIC value for primer pairs sEg00090, formed a distinctive cluster B. The cluster A
sEg00113, sEg00036, sMo00020, sEg00038, was further divided into 2 subgroups, with
sMo00130, sEg00067, sMo00138 and Puttur Ghat (Putghat) and Bhagavathi (Bgvti)
sMo00154 was 0.277778, 0.623457, 0.876543, as one subgroup with the highest similarity
0.277778, 0.0, 0.255144, 0.592593, 0.0 and index of 0.928, and Gerusoppa (Grspa) formed
0.598765, respectively, where primer an individual subgroup with a similarity index
52
with its neighboring subgroup of 0.733. Cluster Jambli-Koppa (Jmbko) and Gulaganjimane
B possessed two closest subgroups, with one (Glgjmne) genotypes as revealed by their
subgroup formed between SK Border (Skbrdr) similarity index of 0.882. Whereas Agumbe
and Ganapathi Katte (Gptkte) genotypes with a (Agmbe) and Jamble (Jmble) genotypes
similarity index of 0.875, indicating their appeared to form separate individual lineages
genetic relationship and the other subgroup in cluster B, showing their genetic divergence
formed between genetically closely related from the other genotypes under study.
Table 3. List of SSR primer pairs sequences and annealing temperature used in the present study
SSR Sequence 5 →3 Repeated motif Amplicon Annealing
Markers (bp) temperature
(°C)
sEg00090 F- TCAGAAATGCCTACATCAAAC (AT)9 230-250 62.3
R- AGGGACACGAGAATACATACA
sEg00113 F- GTCACCGAACCCTAATAAAAT (CT)15 100-110 62.3
R- ATGCAGTTGAGGACAAAAAG
sEg00036 F- GGACCCTTTTTGTTACTGTTT (AG)9 115-125 62.3
R- AGCCTACCACAACTTCCTTT
sMo00020 F- CCTTTCTCTCCCTCTCCTTTTG (AG)15 100-110 60.7
R- CCTCCCTCCCTCTCACCATA
sEg00038 F- ATCAAGCGGCAGTTATGAGAT (AAT)9 140-150 60.7
R- ATACATTATTCCCACCACCA
sMo00130 F- TAAGCAAAAGATCAGGGCACTC (AAG)11 170-178 60.7
R- GGCTGGTGAAAATAGGTTTACAAAG
sEg00067 F- GATTAAGTCCCAACCGTCTC (TGTA)6 145-155 60.7
R- TAAGAGAGCACGCAGTTCAG
sMo00138 F- AGGGTTGTCGCTCCAATTTAT (TTTTC)6 70-78 60.7
R- GGCATCTTTTTGACCTGTAGAAG
sMo00154 F- CAAAAGGGTTGTTTGTATACGTG (TG)7cgcgcgtgtgcgcgtg(TA)8 168-175 60.7
R- TGCATGAATATCCTCTCAAAGTTAC
sEg00066 F- ACTGATGCAGGAAAGAGGAA (AT)8 - -
R- GAAGTACACAAGGTAAGTTCATAG
F - Forward; R - Reverse
Table 4. Similarity matrix index of 9 wild genotypes of P. dicksonii
Putghat Bgvti Jmble Grspa Agmbe Skbrdr Gptkte Jmbko Glgjmne
Putghat 1
Bgvti 0.928 1
Jmble 0.533 0.571 1
Grspa 0.733 0.666 0.500 1
Agmbe 0.687 0.625 0.692 0.562 1
Skbrdr 0.611 0.555 0.600 0.500 0.750 1
Gptkte 0.705 0.647 0.600 0.500 0.866 0.875 1
Jmbko 0.578 0.526 0.562 0.555 0.705 0.823 0.823 1
Glgjmne 0.578 0.611 0.562 0.473 0.705 0.823 0.823 0.882 1
The similarity index values ranged from 0.473 On the contrary, the lowest similarity index
to 0.928. The highest similarity index value value observed was 0.473 between Glgjmne
observed was 0.928 which was shown by and Grspa genotypes, indicating the highest
several samples. genetic divergence between these genotypes. A
The P. dicksonii genotypes Putghat and Bgvti high genetic similarity was also seen between
showed highest similarity index value of 0.928, Glgjmne and Jmbko (0.882).
the same was revealed in the dendrogram, The similarity matrix index is given in (Table
indicating they are the closely related among 4). These values suggest that the genetically
all the genotypes, possessing the fewest related plants subjected to this study have some
divergence between each other. variability at DNA level.
53
et al., 2014; Wang et al., 2014; Meryem et al.,
2015; Nivedita et al., 2016). Various studies
have demonstrated the importance of SSR
markers (Powell et al., 1996; Afaf et al., 2009).
The molecular evaluation of genetic diversity
within the 9 studied genotypes of P. dicksonii
showed high genetic similarity in plants from
nearby locations, while plants from different
geographic location exhibit a low level of
genetic similarity.
CONCLUSIONS
Figure 2. Gel profile showing the amplicons produced by
primer pair sEg00090. 1 – Putghat; 2 – Bgvti; 3 – Jmble; This study throws the light on genetic diversity
4 – Grspa; 5 – Agmbe; 6 – Skbrdr; 7 – Gptkte; of the endemic plant species, P. dicksonii found
8 – Jmbko; 9 – Glgjmne
to grow in the wild. This species is not very
well known and needs to be studied and
conserved to maintain its’ germplasm. The
present study provides evidence on the genetic
variation observed in the collected plant
samples from the wild condition of Karnataka
and Kerala. The present study also reveals the
ability of SSR markers to generate polymorphic
bands within P. dicksonii palm species. Among
the 10 SSR markers used in this study, 9 have
successfully amplified the plant genomic DNA
fragments. This study reveals the existence of
genetic differentiation among the collected
Figure 3. Dendrogram indicating phylogenetic plant species. Among the analysed plant
relationships among 9 P. dicksonii genotypes constructed samples, there was a high level of
using UPGMA cluster analysis based on Jaccard polymorphism as well as genetic similarity.
similarity index obtained from 9 SSR markers This variation is indicative of the evolution of
the species in their natural habitat. The plants
Reports indicate the immense application of
from different geographical locations exhibited
SSR markers in various studies on plant
less genetic similarity while species from the
interspecies or intraspecies genetic variation.
same localities showed more genetic similarity.
Zhao et al. (2012) identified and categorized
Thus more studies of this nature need to be
gene based SSR markers in date palm (Phoenix
conducted to assess the phylogeny of the plant
dactylifera L.). The genetic structure and
species at the molecular level and hence aid in
diversity of Acrocomia emensis (Arecaceae)
the conservation of their germplasm.
using SSR molecular markers showed low level
of genetic variability among the populations
ACKNOWLEDGEMENTS
and high, positive and significant inbreeding
quality, which determines the level of
First author Umesh Madar thank Karnatak
homozygotes (Neiva et al., 2016). Such studies
University, Dharwad for providing the financial
lay a strong platform for improvement of plant
support in the form of a University Grant
quality for better of human welfare and also in
Commission–University with Potential for
the conservation of respective germplasm. SSR
Excellence (UGC–UPE) fellowship.
markers are most widely and commonly used
tool in studying the genetic diversity among
REFERENCES
plants (Eric et al., 2005; Afaf et al., 2009; Hu et
al., 2011; Matin et al., 2012; Yun et al., 2012; Afaf, I. S., Haila, A. A., Ali, A. A. (2009). Application
Hendre et al., 2014; Shahriar et al., 2014; Tan of simple sequence repeat (SSR) markers for
54
molecular diversity and heterozygosity analysis in Maizura, I., Rajanaidu, N., Zakri, A. H., Cheah, S. C.
maize inbred lines. Saudi Journal of Biological (2006). Assessment of genetic diversity in oil palm
Sciences, 16(2), 57‒62. (Elaeis guineensis Jacq.) using restriction fragment
Anderson, J. A., Churchill, G. A., Sutrique, J. E., length polymorphism (RFLP). Genetic Resources
Tanksley, S. D., Sorrells, M. E. (1993). Optimizing and Crop Evolution, 53, 1287‒1295.
parental selection for genetic linkage maps. Genome, Matin, S., Ashrafuzzaman, M., Monirul, I. M., Saif, U.
36(1), 181‒186. S., Nayem, Z. (2012). Molecular marker based (SSR)
Bhat, K. G. (2011). Palms of Karnataka. Udupi, India. genetic diversity analysis in deep water rice
pp. 1‒93. germplasms of Bangladesh. International Journal of
Botstein, D., White, R. L., Skolnick, M., Davis, R. W. Biosciences, 10(2), 64‒72.
(1980). Construction of genetic linkage map in man Meryem, I., Nihan, S., Ahmet, I., Asuman, C., Philipp,
using restriction fragment length polymorphisms. W. S. (2015). Development and validation of new
American Journal of Human Genetics, 32(3), SSR markers from expressed regions in the garlic
314‒331. genome. Scientia Agricola, 72(1), 41‒46.
Doyle, J. J., Doyle, J. L. (1987). A rapid DNA isolation Moges, A. D., Admassu, B., Belew, D., Yesuf, M.,
procedure for small quantities of fresh leaf tissue. Njuguna, J., Kyalo, M., Ghimire, S. R. (2016).
Phytochemical Bulletin, 19(1), 11‒15. Development of microsatellite markers and analysis
Ellegren, H. (2004). Microsatellites: simple sequences of genetic diversity and population structure of
with complex evolution. Nature Reviews Genetics, Colletotrichum gloeosporioides from Ethiopia. PLoS
5(6), 435‒445. One 11(3), e0151257, doi:
Eric, T. S., John, R. C., Courtney, A. W., Julie, G., Kim, 10.1371/journal.pone.0151257
S. L. (2005). Simple sequence repeats (SSR) markers Mondini, L., Noorani, A., Pagnotta, M. A. (2009)
for genetic mapping of Raspberry and Blackberry. Assessing plant genetic diversity by molecular tools.
Journal of the American Society for Horticultural Diversity, 1, 19‒35.
Science, 130(5), 722‒728. Neiva, S. D., Farias de, M. J., Afrânio O. D., Royo, V.,
Eujayl, I., Sorrells, M., Baum, M., Wolter, P., Powell, Brandão, M., Menezes, E. (2016). Acrocomia
W. (2001). Assessment of genotypic variation among emensis (Arecaceae) genetic structure and diversity
cultivated durum wheat based on EST-SSRs and using SSR molecular markers. Genetics and
genomic SSRs. Euphytica, 119(1), 39‒43. Molecular Research, 15, 1‒15.
Garcia, A. A. F., Benchimol L. L., Barbosa A. M. M., Ngoot-Chin, T., Noorhariza, M. Z., Rozana, R., Eng-Ti,
Geraldi I. O., Souza, J. R., Cláudio, L., Souza, A. P. L. L., Maizura, I., Suan-Choo, C., Soon-Guan, T.,
D. E. (2004). Comparison of RAPD, RFLP, AFLP Rajinder, S. (2010). SSR mining in oil palm EST
and SSR markers for diversity studies in tropical database: application in oil palm germplasm diversity
maize inbred lines. Genetics and Molecular Biology, studies. Journal of Genetics, 89(2), 135‒145.
27(4), 579‒588. Nivedita, S., Debjani Roy, C., Gunjan, T., Amit Kumar,
Garcia-Vallvé, S., Palau, J., Romeu, R. (1999). S., Sundeep, K., Kalyani, S., Tyagi, R. K., Sharma,
Horizontal gene transfer in glycosyl hydrolases A. D., Singh, N. K., Rakesh, S. (2016). Genetic
inferred from codon usage in Escherichia coli and diversity trend in Indian rice varieties: an analysis
Bacillus subtilis. Molecular Biology and Evolution, using SSR markers. BMC Genetics, 17(127), 1‒13.
16(9), 1125‒1134. Noorhariza, M. Z., Rajinder, S., Rozana, R., Ismanizan,
Ghesquiere, M. (1985). Enzyme polymorphism in oil I. (2012). Elaeis oleifera genomic-SSR markers:
palm (Elaeis guineensis Jacq) II. Variability and exploitation in oil palm germplasm diversity and
genetic structure of seven origins of oil palm. cross-amplification in Arecaceae. International
Oleagineux, 40, 529‒540. Journal of Molecular Sciences, 13(4), 4069‒4088.
Hearne, C. M., Ghosh, S., Todd, J. A. (1992). Powell, W., Morgante, M., Andre, C., Hanafey, M.,
Microsatellites for linkage analysis of genetic traits. Vogel, J., Tingey, S., Rafalski, A. (1996). The
Trends in Genetics, 8(8), 288‒294. comparison of RFLP, RAPD, AFLP and SSR
Hendre, P. S., Aggarwal, R. K. (2014). Development of (microsatellite) markers for germplasm analysis.
genic and genomic SSR markers of Robusta Coffee Molecular Breeding, 2(3), 225‒238.
(Coffea canephora Pierre ex A. Froehner). PLoS Purba, A. R., Noyer, J. L., Baudouin, L., Perrier, X.,
One, 9(12), e113661, doi: Hamon, S., Lagoda, P. J. L. (2000). A new aspect of
10.1371/journal.pone.0113661 genetic diversity in Indonesian oil palm (Elaeis
Hu, J., Wang, L., Li, J. (2011). Comparison of genomic guineensis Jacq) revealed by isozymes and AFLP
SSR and EST-SSR markers for estimating genetic markers and its consequences for breeding.
diversity in cucumber. Biologia Plantarum, 55(3), Theoretical and Applied Genetics, 101, 956‒961.
577‒580. Rafalski, J. A. (1997). Randomly Amplified
Jarne, P., Lagoda, P. J. (1996). Microsatellites from Polymorphic DNA (RAPD) Analysis. In G.C.
molecules to populations and back. Trends in Anolles., P.M. Gresshoff (Eds.), DNA markers:
Ecology and Evolution, 11(10), 424‒429. Protocols, Applications and Overviews (pp. 75‒83).
Kumar, P., Gupta, V. K., Misra, A. K., Modi, D. R., Wiley-VCH, New York.
Pandey, B. K. (2009). Potential of molecular markers Renuka, C. (1998). Palm resources of Kerala, their
in plant biotechnology. Plant Omics Journal, 2(4), distribution and conservation. Journal of Tropical
141‒162. Forestry, 14(3), 167‒172.
55
Renuka, C., Sreekumar, V.B. (2012). A field guide to the characterization of genomic SSR markers in Cynodon
palms of India. KFRI, Kerala, India. pp. 1‒165 transvaalensis Burtt-Davy. Molecular Genetics and
Russell, J., Booth, A., Fuller, J., Harrower, B., Hedley, Genomics, 289(4), 523‒531.
P., Machray, G., Powell, W. (2004). A comparison of Wang, Z., Yu, G., Shi, B., Wang, X., Qiang, H., Gao, H.
sequence-based polymorphism and haplotype content (2014). Development and characterization of simple
in transcribed and anonymous regions of the barley. sequence repeat (SSR) markers based on RNA
Genome, 47(2), 389‒398. sequencing of Medicago sativa and in silico mapping
Shahriar, M. H., Robin, A. H. K., Begum, S. N., Hoque, onto the M. truncatula genome. PLoS One 9(7),
A. (2014). Diversity analysis of some selected rice e103682, doi:10.1371/journal.pone.0103682
genotypes through SSR based molecular markers. Yun, J., Hui-Min, J., Xiong-Wei, L., Ming-Liang, C.,
Journal of the Bangladesh Agricultural University, Hui-Juan, J., Zhe, C., Guo-Yun, W., Chun-Yan, C.,
12(2), 307‒311. Eric Van, D. E. W., Zhong-Shan, G. (2012).
Singh, R., Noorhariza, M. Z., Ting, N. C., Rozana, R., Development of simple sequence repeats (SSR)
Tan, S. G., Low, L. E. T., Ithnin, M., Cheah, S. C. markers from a genome survey of Chinese bayberry
(2008). Exploiting an oil palm EST the development (Myrica rubra). BMC Genomics, 13(201), 1‒16.
of gene-derived and their exploitation for assessment Zhao, Y., Roxanne, W., Prakash, C.S., Guohao, H.
of genetic diversity. Biologia, 63(2), 227‒235. (2012). Identification and characterization of gene-
Tan, C., Wu, Y., Taliaferro, C. M., Bell, G. E., Martin, based SSR markers in date palm (Phoenix dactylifera
D. L., Smith, M. W. (2014). Development and L.). BMC Plant Biology, 12(1), 237.
56
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
IDENTIFICATION OF A SMALL HEAT SHOCK PROTEIN GENE
FROM PISTACHIO
Mehmet KOC1, 4 *, Muhittin KULAK2, Muhammet KARAMAN3, Hakan ÇETINKAYA1
1
Kilis 7 Aralik University, Faculty of Agriculture, Department of Horticulture, Kilis, Turkey
2
Igdir University, Vocational School of Technical Sciences, Department of Herbal and Animal
Production, Igdir, Turkey
3
Kilis 7 Aralik University, Department of Molecular Biology and Genetics,
Faculty of Arts and Science, Kilis, Turkey
4
Kilis 7 Aralik University, Advanced Technology Application and Research Center (ATACR),
Kilis, Turkey
*Corresponding author email: [email protected]
Abstract
High temperature and water scarcity drastically influence adversely growth and production of pistachio (Pistacia
vera). In this case, breeders have been faced this challenge between resistant to abiotic stress factors and high yield of
varieties development. Understanding the responses of plants to abiotic stress factors will make significant
contributions to solve this problem. Pistachio is among the important agricultural products for Turkey, which is grown
in hot and dry regions during summer months. High temperature stress caused protein dysfunctions in plants. Small
Heat Shock Proteins (sHSP) play an important role due to its function to protect the structures of denatured proteins
against these stresses. In this study, we determined partial gene sequence of Small Heat Shock Protein from P. vera via
degenerate primers prepared from National Center for Biotechnology Information. Herewith, it can be used for gene
expression in abiotic stress studies in pistachio plants.
Key words: abiotic stress, chaperone, phylogeny, Pistacia vera, sHSP.
INTRODUCTION addition to different purposes as soap, coffee
and medical purposes in Turkey (Ertürk et al.,
Pistacia genus (Anacardiaceae family) has 2015).
been reported to consist of at least eleven Production is concentrated especially in the
species. Of those species, P. mexicana and P. south-eastern Anatolia region of Turkey. This
texana are of USA and Mexico originated. The region is classified as a dry and semi-dry area.
other species are mainly distributed within the For this reason, cultivation is done almost
Mediterranean region, Western and Central without irrigation.
Asia and the Middle East (Esmail-Pour, 2001). Pistachio is an economically long-lasting fruit
Turkey is of the important pistachio producer species. Therefore, selecting rootstock is a very
and suppliers in the world and possesses many important factor in new pistachio orchard
wild species of pistachio nut. Of those species, layout. Although pistachios are relatively
P. vera, P. terebinthus, P. khinjuk, P. atlantica, tolerant to abiotic stress factors such as drought
P. mutica, P. palaestina and P. lentiscus and salt, drought stress adversely affects
exhibit distribution in different regions of growth, dry matter, and yield (Esmaeilpour et
Turkey. The main pistachio rootstock used in al., 2015).
Turkey is P. vera, and followed by P. khinjuk, In addition to heat stress, plant sHSPs are also
P. terebinthus and P. atlantica (Acar et al., produced under other stress conditions such as
2017). Of those species, pistachio (Pistacia drought and salinity. Small heat shock proteins
vera) is the most important commercial (sHSPs) play an important role against abiotic
agricultural products. Pistacia is the only stress factors. sHSPs are known to protect cells
commercially grown Pistacia species compared in response to stress from the detrimental effect
to other Pistacia species. Other Pistacia of stress. However, the mechanisms of cell
species are commonly evaluated as rootstock in protection by sHSPs are largely unknown (Sun
57
et al., 2002). In recent years, molecular studies agarose gel and purified DNA bands from
related to abiotic stresses such as drought, heat agarose gel by the PCR Gel purification kit
stress have increased with rapid and sharp (The Vivantis Gel DNA Recovery Kit).
changes in environmental conditions. However, Positive bands were sequenced on an ABI377
the molecular studies of pistachio have Automated Sequencer (Applied Biosystem),
remained extremely limited. and the resulting sequences were verified and
There are only a few genome sequences in The subjected to cluster analysis.
National Center for Biotechnology Information Sequence analysis of sHSPs: The searches for
(NCBI) about Pistacia species (Jazi et al., nucleotide and amino acid sequence similarities
2016). were conducted with BLAST programs at the
This study was designed to identify a partial National Center for Biotechnology Information
sHSPs gene sequence for used gene expression (http://www.ncbi.nlm.nih.gov/BLAST/).
study in Pistacia species.
For this reason, along with the study, the pre- Phylogenetic analysis of sHSPs gene
sent results and identifications are considered A phylogenetic tree was constructed by using
to contribute to the forthcoming studies regar- the MEGA 7.0 software by the maximum-
ding gene expression profiles in response to the likelihood (ML) and neighbor-joining (NJ). For
abiotic stress conditions. statistical reliability, the nodes of the tree were
evaluated by boot- strap analysis with 1000
MATERIALS AND METHODS replicates.
Plant Materials RESULTS AND DISCUSSIONS
Leaf samples were collected from the
collection orchard of the Kilis 7 Aralik Plant sHSPs are all encoded by nuclear genes
University Agricultural Research and Practice and are divided into six classes. sHSPs are
Center (TUAM). Leaves of plants were localized in cell of cytosol, nucleus, plastids,
collected in triplicate from pistachio trees and endoplasmic. In eukaryotes, sHSPs are
immediately frozen in liquid nitrogen for stored abundant and different in high plants compared
at ‒80oC. to other eukaryotes (Waters et al., 1996; Lee &
Vierling, 2000). Heat shock proteins as a
DNA Extraction molecular chaperone are not only triggered by
DNA was extracted from young leaf tissue heat stress but they are also expressed in
using CTAB DNA isolation method response to the effect of osmotic stress. In this
(Untergasser, 2008). Subsequently, an RNase context, there are some studies reporting the
treatment was performed on the eluted DNA sHSP-encoding genes induced by water stress
samples. Purity and concentration of the DNA (Coca et al., 1996), cold stress (Pla et al.,
were checked both on 1% (w/v) agarose gels 1998), heavy metal (Györgyey et al., 1991),
and by µDrop Plate spectrophotometer. UV radiation (Murakami et al., 2002).
(Thermo Scientific Multiskan GO). In this study, the partial sequence of HSP gene
from Pistacia vera was reported for the first
PCR analysis time. Based on sequences, a phylogenetic tree
Two degenerated primers Forward 5’- was constructed by using MEGA7.0.
CGCYTCYTCAACACCAACGC – 3’ and Plants were separated and formed two distinct
Reverse 5’- GGCGGAGATGAAGAACGG – branches in the phylogenetic tree.
3’were designed based on the conserved The relationship in the tree was generally
sequence of known sHSPs in NCBİ. PCR displayed a good agreement by being taxonomy
reaction was performed in a 20 ml reaction (Figure 1). Pistachio, a member of commonly
volume. The PCR temperature profile was known as the cashew family has shown a 100%
94°C for 5 min followed by 35 cycles of 94°C similarity with mango from the same family in
for 45 sec., 55°C for 45 sec., 72°C for 1 min comparison to other species. Moreover, sHSPs
and a final extension step at 72°C for 10 min. gene sequence of Pistacia vera exhibited 66 %
The PCR products were separated on 1.5% similarity with Citrus sinensis.
58
91
Ziziphus jujuba
REFERENCES
41 Morus notabilis
Acar, I., Yasar, H., Ercisli, S. (2017). Effects of
39 Populus euphratica
37 Carica papaya dormancy-breaking treatments on seed germination
Citrus sinensis and seedling growth of Pistacia khinjuk Stocks using
66 Mangifera indica as rootstock for pistachio trees. Journal of Applied
100 Pistacia Vera Botany and Food Quality, 90, 191‒196.
Arabidopsis thaliana Coca, M. A., Almoguera, C., Thomas, T. L., & Jordano,
Nelumbo nucifera J. (1996). Differential regulation of small heat-shock
98
Vitis vinifera genes in plants: analysis of a water-stress-inducible
75 Cucumis sativus
and developmentally activated sun-flower promoter.
71 Pyrus x bretschneideri
Plant Molecular Biology, 31, 863–876.
Ertürk, Y. E., GeçEr, M. K., GüLsoy, E., & YalçIn, S.
(2015). Antepfıstığı Üretimi ve Pazarlaması. Iğdır
Figure 1. A phylogenetic tree of HSP family members Üniversitesi Fen Bilimleri Enstitüsü Dergisi, 5(2),
constructed with the neighbor-joining method 43‒62.
Esmaeilpour, A., Labeke, M. V., Samson, R. R., &
The common names, species names and the Damme, P. V. (2015). Osmotic stress affects
GenBank accession numbers are the same as physiological responses and growth characteristics of
three pistachio cultivars. Acta Physiologiae
those in Table 1. Numbers at each branch Plantarum, 37, 1‒14.
indicate the percentage of times a node is Esmail-Pour, A. (2001): Distribution, use and
supported in 1000 bootstraps pseudo- conservation of pistachio in Iran. In Toward a
replication by neighbor-joining. Comprehensive Documentation and Use of Pistacia
Genetic Diversity in Central and West Asia, North
Table 1 Sequences used in the phylogenetic tree Africa and Europe. Report of the IPGRI Workshop:
Sequence ID Plant Species Localization 16‒26.
EU513278.1 Mangifera indica --------------- Györgyey, J., Gartner, A., Németh, K., Magyar, Z., Hirt,
XM_006490055.3 Citrus sinensis mitochondrial H., Heberle-Bors, E., & Dudits, D. (1991). Alfalfa
XM_016022420.2 Ziziphus jujuba mitochondrial heat shock genes are differentially expressed during
XM_010265959.2 Nelumbo nucifera chloroplastic somatic embryogenesis. Plant molecular biology,
XM_022053869.1 Carica papaya mitochondrial 16(6), 999‒1007.
XM_010091379.2 Morus notabilis mitochondrial Jazi, M. M., Khorzoghi, E. G., Botanga, C., & Seyedi, S.
XM_011012544.1 Populus euphratica mitochondrial M. (2016). Identification of reference genes for
XR_002031999.1 Vitis vinifera mitochondrial quantitative gene expression studies in a non-model
EU289284.1 Arabidopsis thaliana mitochondrial tree pistachio (Pistacia vera L.). PloS one, 11(6),
XM_004147155.2 Cucumis sativus chloroplastic e0157467.
XM_009350311.2 Pyrus x bretschneideri chloroplastic Lee, G. J., Vierling, E. (1998). Expression, purification,
and molecular chaperone activity of plant
CONCLUSIONS recombinant small heat shock proteins. Methods
Enzymol, 290, 350–365.
Along with the present study, we-for the first Murakami, T., Matsuba, S., Funatsuki, H., Kawaguchi,
time-isolated and identified a small heat shock K., Saruyama, H., Tanida, M., & Sato, Y. (2004).
protein gene from pistachio. Moreover, we can Over-expression of a small heat shock protein,
sHSP17. 7, confers both heat tolerance and UV-B
underline and note that there a few molecular resistance to rice plants. Molecular Breeding, 13(2),
studies for Pistacia species hitherto, highlight- 165‒175.
ting the present first report to be fundamental for Pla, M., Huguet, G., Verdaguer, D., Puigderrajols, P.,
the ahead studies related to possible gene Llompart, B., Nadal, A., & Molinas, M. (1998).
expression profiles against abiotic stress factors. Stress proteins co-expressed in suberized and
lignified cells and in apical meristems. Plant Science,
139(1), 49‒57.
ACKNOWLEDGEMENTS Sun, W., Van Montagu, M., & Verbruggen, N. (2002).
Small heat shock proteins and stress tolerance in
This work was supported by grants from Kilis 7 plants. Biochimica et Biophysica Acta (BBA)-Gene
Aralik University Coordinatorship of Scientific Structure and Expression, 1577(1), 1‒9.
Research (Projects ID: 16-10887). Untergasser, A. (2008). DNA Miniprep using CTAB
Untergasser’s Lab. Summer of 2008.
Additional Information Waters, E. R., Lee, G. J., Vierling, E. (1996). Evolution,
For access partial gene sequence of Small Heat structure and function of the small heat shock
Shock Protein of P. vera by being FASTA proteins in plants. J Exp Bot, 47, 325–338
format at www.orobanche.net/P.vera.shsp.fasta.
59
60
Biotechnology
in veterinary
medicine
61
62
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
RECENT DISCOVERIES IN Varroa destructor TREATMENT,
PREVENTION AND PARASITE - HOST INTERACTION
Thomas VEZETEU, Adriana AURORI, Daniel DEZMIREAN, Adriana CRISTE
USAMV of Cluj-Napoca, 3-5 Calea Mănăştur, Cluj-Napoca, Cluj, Romania
Corresponding author email: [email protected]
Abstract
The European honey bee, Apis mellifera, as most insects of the world, is currently facing major difficulties and,
particularly for honey bees, this results in significant colony losses. One of the most stressful factors for A. mellifera is
the ectoparasitic mite, Varroa destructor. V. destructor invasions are largely treatable and preventable, however they
bring forth great challenges to A. mellifera populations and breeders, making apiculture increasingly time and resource
consuming. The global research in apiculture pathology is mostly focused on Varroa sp. This review will be focusing on
the recent literature in Varroa treatment, prevention and parasite - host interaction.
Key words: Apis mellifera, Varroa destructor, pathology, host-parasite interaction.
INTRODUCTION possibility of host adaptability. Examples of V.
destructor resistant A. mellifera populations
Varroa destructor’s original host was the Asian can be found in most parts of the world
honeybee, Apis cerana which through (DeJong et al., 1997; Fries et al., 2006; Le
coevolution was able to develop tolerance Conte, 2007). These honey bee populations
toward the mite. This trait was not carried over prove that through long-term exposure to the
to the western honeybee, as the host-parasite Varroa mite, resistance can be developed.
relationship between Apis mellifera and V. This review will focus on recent discoveries in
destructor is relatively recent (Le Conte et al., the host-parasite relationship of Varroa
2007). A Varroa infestation can, therefore, era- destructor and Apis mellifera, new treatment
dicate a colony of A. mellifera within 1-3 years, methods and the underlying mechanisms of
if left untreated. The lack of a balanced host- resistance towards the mite.
parasite relationship between the European
honeybee and the mite has facilitated a world- Varroa destructor AND VIRAL
wide spread of Varroa, within a relatively short INFECTIONS
period of time.
A codependent relationship with humans means In addition to the numerous negative effects
they always receive adequate treatment against Varroa directly inflicts upon A. mellifera, mite
infestations, in order to keep the colonies infestations are usually also associated with
healthy and productive. At first glance, this viral infections (reviewed by Tantillo et al.,
relationship may seem advantageous for the 2015). Recent research has helped shed light on
bees, because they don’t have to suffer major Varroa’s role as a viral vector and how
losses or be weakened by Varroa infestations, infections can become a contributing factor in
however at a second glance, such grooming colony losses.
hides a darker side. Namely, it breaks the cycle Deformed wing virus (DWV) copy number in
of natural selection which is required to honeybee pupae is directly associated with the
become tolerant to pathogens. Thus, under copy number in infesting V. destructor (Wu et
constant treatment, any individual who can al., 2017). The presence of large DWV copies
reproduce, regardless of its genetic sensitivity, induces immunosuppession in the honeybee in
is able to pass on its genes, which hinders the order to more easily replicate (Di Prisco et al.,
63
2016), which acts as an additional stressor and the age of the bees and on the level of social
adds to the likelihood of a colony to perish. interaction (Van Buren et al., 1992). An
Studies suggest that a longer phoretic stage additional disadvantage to chemical treatments
does not necessarily mean a more successful is that Varroa can become resistant, which is
reproductive cycle but that the longer the why efficient management practices are equally
phoretic stage lasts, there is a higher chance of as important in Varroa control (Thoms et al.,
deformities to appear on the young honeybee. 2018). Environmental conditions seem to be the
Additionally, DWV load increases with the predominant factor in mite infestation levels,
time spent in the phoretic stage, thus leading to followed closely by beekeeper management
more frequent and severe infections (Piou et al, (Giacobino et al., 2017).
2016). No new active compounds against Varroa were
DWV severity, transmitted by V. destructor can discovered in the past 25 years (Mutinelli,
be dependent on the climate. Overt infections 2016), although some recent studies present
are much more common in temperate climates promising results. Lithium salts were shown to
than they are in tropical climates, without any completely eliminate Varroa mites in caged
differences in infestation rates (Anguiano-Baez environments, without affecting worker bee
et al, 2016). This could happen in part because mortality as compared to untreated controls
Varroa is a better vector for viruses in (Ziegelmann et al., 2018).
temperate climates. This theory is supported by Plant extracts offer a great alternative to
Giacobino et al. (2016), who showed that conventional chemical treatments. These “soft”
colonies in temperate climates had a much chemicals offer a similar antiacaricidal effect
higher viral load compared to colonies in and are potentially less toxic.
subtropical climates. Fumigation with oregano essential oil can rid a
This study, however, also reports that Varroa colony of Varroa within the first two weeks of
infestation levels were higher in temperate treatment, while not showing toxic effects
climate compared to tropical climate, as was towards the honey bees. The constant output of
the case for viral load. Currently there is no essential oil through fumigation results in a
knowledge of DWV in honeybees in Australia more efficient treatment (Sabahi et al., 2017).
(Roberts et al., 2017). This could be due in part Plant based extracts such as Thymus algeriensis
because Varroa destructor has only recently essential oil also offer a great solution against
been able to spread to this continent and Varroa.
because Australia’s climate is partly tropical This extract contains large quantities of thymol,
and mostly arid, which, as established above, which is a known antivarroa agent (Noureddine
are poor conditions for the DWV. The fact that et al., 2016) and has been shown to reduce mite
V. destructor infestations are milder in populations by 32.6%, without harming the
Australia and usually doesn’t lead to colony honeybees (Kouache et al., 2017). Mild
losses supports the idea that honeybee mortality acaricide effect was shown in sage - Salvia
is a result of multiple stress factors working officinalis L. (Lamiaceae) - essential oil
together against the bees. (Bendifallah et al., 2018) and costic acid
extracted from Dittrichia viscosa proved to be
FRESH INSIGHTS IN METHODS OF 80% as effective as commercial acaricides
Varroa CONTROL (Sofou, 2017).
In addition to good management practices and
As far as Varroa control goes, the most chemical treatments, the use of technological
efficient and widely used methods consist of methods, like the removal of drone brood
either synthetic ‘hard’ chemicals or plant based (Wantuch and Tarpy, 2009) offers an efficient
‘soft’ chemicals (Rosenkranz et al., 2010). and cost effective solution against Varroa.
These treatments function as miticides against Irradiation of honeybee colonies did not seem
Varroa and, although effective, they also bring to influence Varroa infestation levels and
numerous negative side effects for the overall effectiveness in pest control could be
honeybees, including mortality (Gregorc et al., described as mild, at best (de Guzman et al.,
2018). Severity of these effects is dependent on 2019).
64
The use of Stratiolaelaps scimitus, a mite that TREATMENT RESISTANT MITES
feeds on small insects, showed promising
effects against varroa infestations. This method Chemical treatments offer the most effective
isn’t 100% safe though, since the mite also solution for treating varoosis but they also
consumed honeybee eggs in lab conditions, but bring forth multiple downsides amongst which
not in the hive (Rondeau et al., 2018) and toxicity for the honeybees, pollution of bee
treatment applied in late or early fall was not products and development of treatment
efficient in controlling varroa (Rondeau et al., resistance in Varroa (Rosenkranz et al., 2010).
2019). While product pollution and toxicity are
Bacillus thuringiensisis is virulent and negligible in terms of severity and economic
pathogenic in small insects and acarids, impact, the spreading of treatment resistant
including varroa (reviewed by Chandler et al., Varroa mites could be disastrous for honeybee
2001), however, it does not affect the honeybee populations. The following part of the review
and can be used alongside conventional will be focusing on recent scientific discoveries
treatments for Varroa control (Alquisira- in resistance to treatment.
Ramírez et al., 2017). Overall, bacteria, Evidence for resistant Varroa populations has
especially from the Bacillus and Lactobacillus started to emerge at the end of the 20th century
genus, act as probiotics and bring important (Lodesani et al., 1995; Hillesheim et al., 1996;
benefits for the honeybees by increasing the Milani, 1999) and continue to emerge to this
immune response, stimulating queen egg laying day. Recent studies have helped shed light on
and significantly increasing honey yield resistance mechanisms. A link was found
(reviewed by Audisio, 2017) between two novel mutations at Leucine 925 of
Entomopathogenic fungi could also reduce the Voltage-Gated Sodium Channel gene
varroa damage to honeybee brood by both (L925M, L925I) and resistance to pyrethroids,
infecting the parasite and preventing varroa- tau-fluvalinate and flumethrin, in USA
associated suppression of honeybee immunity. (Gonzales-Cabrera et al., 2016). Mutations at
Three immune genes of the honeybee, this residue were also found in Pyrethroid
hymenoptaecin, pUf68 and BlCh, are usually resistant mites from Southern England
suppressed by varroa. When inoculated with (Gonzales-Cabrera et al., 2013) and in the
Metarhizium anisopliae and Beauveria Czech Republic (Stara et al., 2018; Hubert et
bassiana, varroa cannot suppress the al., 2014). This mutation was found in 98% of
expression of these genes (Hamiduzzaman et mites that went through miticide treatment and
al., 2012). in only 45% of non-treated individuals which
The sensory limitations of the varroa mite can means that when selective pressure is applied,
be used against it. Given the lack of sight, the mite populations can develop resistance to the
varroa mite is dependent on chemoreceptors to treatment. A connection between point muta-
find its next host (Dillier et al., 2006). By tions at position 925 in the sodium channel
inhibiting the chemoreceptors, varroa will have gene and treatment resistance has been confir-
difficulties in choosing the right host. One way med in a biological assay (Stara et al., 2019).
in which olfactory detection can be inhibited is Varroa destructor is a highly inbred species,
through the use of racemic compounds due to its reproductive mechanism. Genetic
(Govardhana et al., 2016) diversification only occurs once the Varroa
In addition to grooming and hygienic population grows, in the middle of the
behaviors, honeybees were also found to honeybee productive period, when brood cells
change normal behavior in order to alleviate are populated by more than one foundress.
pathogenic pressures. A. mellifera colonies Applying antivarroa treatments before this
have been found to change foraging patterns as stage, when the Varroa population is low and
a response to pressure from varoosis. Colonies goes through a population “bottleneck” could
infested with V. destructor increased the help with fixating variants responsible for
number resin foragers, thus increasing the miticide resistance (Beaurepaire et al., 2017).
quantity of collected resin as a means of self- These findings are alarming considering the
medication (Pusceddu et al., 2019). slow development of new control methods and
65
the fast spreading of the mite. Hierarchical success, because infested individuals would be
genetic variation can be found at a colony level, removed. Consequently, affected brood in A.
which indicates that Varroa transmission cerana, was not able to reach maturity,
doesn’t only happen vertically from one supporting the idea that resistance is based on
generation to the next but also horizontally, behavioral traits (Lin et al., 2018).
between hives and apiaries (Dynes et al., 2016). A V. destructor surviving A. mellifera
Horizontal transmission is facilitated by population from Norway was analyzed in order
Varroa’s capacity to quickly climb on its host to find traits which helped reduce the
(Peck et al., 2016). V. destructor has also been reproductive success of Varroa. A 10% shorter
found in drone congregation areas, which than normal post capping period was found to
increases the mite’s transmission capabilities differentiate resistant colonies from susceptible
even further (Mortensen et al., 2018). ones (Oddie et al., 2018). Spermatozoa
Luckily, though, bee populations have a few capacitation in inseminated mites takes 5 days.
aces up their sleeves. This could explain, as the phoretic phase is not
vital (Ruijter, 1987), why a shortened post
WESTERN HONEYBEE RESISTANCE capping period would be problematic for
AGAINST Varroa Varroa (Häußermann et al., 2016).
The oldest Western honeybee population CONCLUSIONS
resistant to Varroa was recorded in 1997 by De
Jong and coworkers. Twenty Italian honeybee Although behavior traits seem to offer a
colonies infested with Varroa were brought in complete explanation of defense mechanisms
1984 to the Island of Fernando de Noronha, off for Varroa resistant honey bees (i.e. Apis
the coast of Brazil. They were genetically mellifera scutellata), most comparative studies
isolated, as to prevent genetic contamination link resistance to physiological traits. While it
and were left to face Varroa without any is currently unknown what the molecular basis
treatment. This population survived the for resistance against V. destructor is, studies
infestation and is still alive to this day (De suggest that interferences in the moulting
Mattos et al., 2016). hormone biosynthesis are a likely cause.
The first experimental insight on A. mellifera Further research is needed to fully understand
resistance to V. destructor was brought forth in these mechanisms.
2006 by Fries et al. After three years a V. Additionally, in order for the two species, A.
destructor infested, untreated A. mellifera mellifera and V. destructor, to coevolve and
population of 150 colonies had an 80% create a balanced host-parasite relationship,
mortality rate during winter. This rate selective pressure needs to be applied. The
decreased to 13% and 19% in the 5th and 6th success of breeders in obtaining resistant A.
year respectively, while infestation levels in the mellifera populations should inspire global
fall also significantly decreased. This is a great programs of resistance-based selection.
example of adaptability by A. mellifera and V.
destructor, and proves that coevolution is REFERENCES
possible when selective pressure is applied.
Varroa surviving colonies also show a similar Alquisira-Ramírez, E. V., Peña-Chora, G., Hernández-
mortality rate when compared to treated Velázquez, V. M., Alvear-García, A., Arenas-Sosa,
I., Suarez-Rodríguez, R. (2017). Effects of Bacillus
colonies, at the expense of lower honey thuringiensis strains virulent to Varroa destructor on
productivity (Le Conte et al., 2007). larvae and adults of Apis mellifera. Ecotoxicology
When compared to control populations, V. and environmental safety, 142, 69‒78.
destructor resistant colonies have a similar Anguiano-Baez, R., Guzman-Novoa, E., Hamiduzzaman,
hygienic and grooming behavior but the M., Espinosa-Montano, L. G., Correa-Benítez, A.
(2016). Varroa destructor (Mesostigmata: Varroidae)
reproductive success of Varroa is significantly parasitism and climate differentially influence the
reduced (Locke and Fries, 2011). When prevalence, levels, and overt infections of deformed
compared to A. mellifera, mites infesting Apis wing virus in honey bees (Hymenoptera: Apidae).
cerana had similar reproductive initiation Journal of Insect Science, 16(1), 44.
66
Audisio, M. C. (2017). Gram-positive bacteria with ectoparasite of honey bees, Varroa destructor.
probiotic potential for the Apis mellifera L. honey Journal of Agricultural and Food Chemistry, 64(45),
bee: the experience in the northwest of Argentina. 8653‒8658
Probiotics and antimicrobial proteins, 9(1), 22‒31. Gregorc, A., Alburaki, M., Sampson, B., Knight, P.,
Beaurepaire, A., Krieger, K., Moritz, R. (2017). Seasonal Adamczyk, J. (2018). Toxicity of Selected Acaricides
cycle of inbreeding and recombination of the to Honey Bees (Apis mellifera) and Varroa (Varroa
parasitic mite Varroa destructor in honeybee colonies destructor Anderson and Trueman) and their use in
and its implications for the selection of acaricide controlling Varroa within honey bee colonies.
resistance. Infection, Genetics and Evolution, 50, Insects, 9(2), 55.
49‒54. de Guzman, L. I., Simone-Finstrom, M., Frake, A. M.,
Bendifallah, L., Belguendouz, R., Hamoudi, L., Arab, K. Tokarz, P. (2019). Comb irradiation has limited,
(2018). Biological activity of the Salvia officinalis L. interactive effects on colony performance or
(Lamiaceae) essential oil on Varroa destructor pathogens in bees, Varroa destructor and wax based
infested honeybees. Plants, 7(2), 44. on two honey bee stocks. Insects, 10(1), 15.
Chandler, D., Sunderland, K. D., Ball, B. V., Davidson, Fries, I., Imdorf, A., Rosenkranz, P. (2006) Survival of
G. (2001). Prospective biological control agents of mite infested (Varroa destructor) honey bee (Apis
Varroa destructor n. sp., an important pest of the mellifera) colonies in a Nordic climate. Apidologie,
European honeybee, Apis mellifera. Biocontrol 37(5), 564‒570
Science and Technology, 11(4), 429‒448. doi: Hamiduzzaman, M., Sinia, A., Guzman Novoa, E.,
10.1080/09583150120067472 Goodwin, P. H. (2012). Entomopathogenic fungi as
Dillier, F. X., Fluri, P., Imdorf, A. (2006). Review of the potential biocontrol agents of the ecto-parasitic mite,
orientation behaviour in the bee parasitic mite Varroa Varroa destructor, and their effect on the immune
destructor: Sensory equipment and cell invasion response of honey bees (Apis mellifera L.). J. Invert.
behaviour. Revue Suisse de Zoologie, 113, 857‒877. Pathol., 111(3), 237‒243.
doi:10.5962/bhl.part.80381 Häußermann, C. K., Ziegelmann, B., Rosenkranz, P.
Di Prisco, G., Annoscia, D., Margiotta, M., Ferrara, R., (2016). Spermatozoa capacitation in female Varroa
Varricchio, P., Zanni, V., Pennacchio, F. (2016). A destructor and its influence on the timing and success
mutualistic symbiosis between a parasitic mite and a of female reproduction. Experimental and Applied
pathogenic virus undermines honey bee immunity Acarology, 69(4), 371‒387.
and health. Proceedings of the National Academy of Hillesheim, E., Ritter, W., Bassand, D. (1996). First data
Sciences, 113(12), 3203‒3208. on resistance mechanisms of Varroa jacobsoni
Dynes, T. L., Roode, J. D., Lyons, J. I., Berry, J. A., (Oud.) against tau-fluvalinate. Experimental &
Delaplane, K. S., Brosi, B. J. (2016). Fine scale applied acarology, 20(5), 283‒296.
population genetic structure of Varroa destructor, an Hubert, J., Nesvorna, M., Kamler, M., Kopecky, J., Tyl,
ectoparasitic mite of the honey bee (Apis mellifera). J., Titera, D., Stara, J. (2014). Point mutations in the
Apidologie, 48, 93‒101. sodium channel gene conferring tau‐fluvalinate
Giacobino, A., Pacini, A., Molineri, A., Cagnolo, N. B., resistance in Varroa destructor. Pest management
Merke, J., Orellano, E., Signorini, M. (2017). science, 70(6), 889‒894.
Environment or beekeeping management: What De Jong, D., Soares, A. E. E. (1997). An isolated
explains better the prevalence of honey bee colonies population of Italian bees that has survived Varroa
with high levels of Varroa destructor?. Research in jacobsoni infestation without treatment for over 12
veterinary science, 112, 1‒6. years. American Bee Journal, 4, 742‒745.
Giacobino, A., Molineri, A. I., Pacini, A., Fondevila, N., Kouache, B., Brada, M., Saadi, A., Fauconnier, M. L.,
Pietronave, H., Rodríguez, G., Palacio, A., Bulacio Lognay, G., Heuskin, S. (2017). Chemical
Cagnolo, N., Orellano, E., Salto, C. E., Signorini, M. Composition and Acaricidal Activity of Thymus
L., Merkej, J. (2016). Varroa destructor and viruses algeriensis Essential Oil against Varroa destructor.
association in honey bee colonies under different Natural product communications, 12(1), 135‒138.
climatic conditions. Environmental microbiology Le Conte, Y., De Vaublanc, G., Crauser, D., Jeanne, F.,
reports, 8(3), 407‒412. Rousselle, J. C., Bécard, J. M. (2007). Honey bee
González-Cabrera, J., Rodríguez-Vargas, S., Davies, T. colonies that have survived Varroa destructor.
E., Field, L. M., Schmehl, D., Ellis, J. D., Apidologie, 38(6), 566‒572.
Williamson, M. S. (2016). Novel mutations in the Lin, Z., Qin, Y., Page, P., Wang, S., Li, L., Wen, Z., Hu,
voltage-gated sodium channel of pyrethroid-resistant F., Neumann, P., Zheng, H., Dietemann, V. (2018).
Varroa destructor populations from the South Reproduction of parasitic mites Varroa destructor in
Eastern USA. PloS one, 11(5), e0155332. original and new honeybee hosts. Ecology and
Gonzalez-Cabrera, J., Davies, T. E., Field, L. M., evolution, 8(4), 2135‒2145.
Kennedy, P. J., Williamson, M. S. (2013). An amino Lodesani, M., Colombo, M., Spreafico, M. (1995).
acid substitution (L925V) associated with resistance Ineffectiveness of Apistan® treatment against the
to pyrethroids in Varroa destructor. PLoS One, 8(12), mite Varroa jacobsoni Oud in several districts of
e82941. Lombardy (Italy). Apidologie, 26(1), 67‒72.
Govardhana, R. P., Nitin, K. S., Soroker, V., Plettner, E. Locke, B., Fries, I. (2011). Characteristics of honey bee
(2016). Synthesis of enantiopure alicyclic ethers and colonies (Apis mellifera) in Sweden surviving Varroa
their activity on the chemosensory organ of the destructor infestation. Apidologie, 42(4), 533‒542.
67
De Mattos, I. M., De Jong, D., Soares, A. E. E. (2016). Ruijter, A. (1987). Reproduction of Varroa jacobsoni
Island population of European honey bees in during successive brood cycles of the honeybee.
Northeastern Brazil that have survived Varroa Apidologie 18(4) 321‒326
infestations for over 30 years. Apidologie, 47(6), Sabahi, Q., Gashout, H., Kelly, P. G., Guzman-Novoa, E.
818‒827. (2017). Continuous release of oregano oil effectively
Milani, N. (1999). The resistance of Varroa jacobsoni and safely controls Varroa destructor infestations in
Oud. to acaricides. Apidologie, 30(2-3), 229‒234. honey bee colonies in a northern climate.
Mortensen, A. N., Jack, C. J., Ellis, J. D. (2018). The Experimental and Applied Acarology, 72(3),
discovery of Varroa destructor on drone honey bees, 263‒275.
Apis mellifera, at drone congregation areas. Sofou, K., Isaakidis, D., Spyros, A., Büttner, A., Giannis,
Parasitology research, 117(10), 3337‒3339. A., Katerinopoulos, H. E. (2017). Use of costic acid,
Mutinelli, F. (2016). Veterinary medicinal products to a natural extract from Dittrichia viscosa, for the
control Varroa destructor in honey bee colonies control of Varroa destructor, a parasite of the
(Apis mellifera) and related EU legislation-an update. European honey bee. Beilstein journal of organic
Journal of Apicultural Research, 55(1), 78‒88. chemistry, 13(1), 952‒959.
Noureddine, A., Haddad, N., Ounesse, T. A. R. E. K. Stara, J., Pekar, S., Nesvorna, M., Erban, T., Vinsova,
(2016). Effectiveness of treatments with thymol in H., Kopecky, J., Doskocil, I., Kamler, M., Hubert, J.
controlling Varroa destructor parasite of the honey (2019). Detection of tau-fluvalinate resistance in the
bee in algeria. Bulletin of Pure & Applied Sciences- mite Varroa destructor based on the comparison of
Zoology, 1. vial test and PCR–RFLP of kdr mutation in sodium
Oddie, M., Dahle, B., Neumann, P. (2018). Reduced channel gene. Experimental and Applied Acarology,
Postcapping Period in Honey Bees Surviving Varroa 77(2), 161‒171.
destructor by Means of Natural Selection. Insects, Stara, J., Pekar, S., Nesvorna, M., Kamler, M., Doskocil,
9(4), 149. I., Hubert, J. (2018). Spatio temporal dynamics of
Peck, D. T., Smith, M. L., Seeley, T. D. (2016). Varroa Varroa destructor resistance to tau fluvalinate in
destructor mites can nimbly climb from flowers onto Czechia, associated with L925V sodium channel
foraging honey bees. PloS one, 11(12), e0167798. point mutation. Pest management science.
Piou V, Tabart J, Urrutia V, Hemptinne J-L, Vétillard A Tantillo, G., Bottaro, M., Di Pinto, A., Martella, V., Di
(2016) Impact of the Phoretic Phase on Reproduction Pinto, P., Terio, V. (2015). Virus infections of
and Damage Caused by Varroa destructor (Anderson honeybees Apis mellifera. Italian journal of food
and Trueman) to Its Host, the European Honey Bee safety, 4(3).
(Apis mellifera L.). PLoS ONE 11(4): e0153482 Thoms, C. A., Nelson, K. C., Kubas, A., Steinhauer, N.,
Pusceddu, M., Piluzza, G., Theodorou, P., Buffa, F., Wilson, M. E. (2018). Beekeeper stewardship, colony
Ruiu, L., Bullitta, S., Floris, I., Satta, A. (2019). loss, and Varroa destructor management. Ambio,
Resin foraging dynamics in Varroa destructor 1‒10.
infested hives: a case of medication of kin? Insect Wantuch, H. A., Tarpy, D. R. (2009). Removal of drone
science, 26(2), 297‒310. brood from Apis mellifera (Hymenoptera: Apidae)
Roberts, J. M., Anderson, D. L., Durr, P. A. (2017). colonies to control Varroa destructor (Acari:
Absence of deformed wing virus and Varroa Varroidae) and retain adult drones. Journal of
destructor in Australia provides unique perspectives economic entomology, 102(6), 2033‒2040.
on honeybee viral landscapes and colony losses. Wu, Y., Dong, X., Kadowaki, T. (2017).
Scientific reports, 7(1), 6925. Characterization of the copy number and Variants of
Rondeau, S., Giovenazzo, P., Fournier, V. (2018). Risk Deformed Wing Virus (DWV) in the pairs of honey
assessment and predation potential of Stratiolaelaps bee pupa and infesting Varroa destructor or
scimitus (Acari: Laelapidae) to control Varroa Tropilaelaps mercedesae. Frontiers in Microbiology,
destructor (Acari: Varroidae) in honey bees. PloS 8, 1558.
one, 13(12), e0208812. Ziegelmann, B., Abele, E., Hannus, S., Beitzinger, M.,
Rondeau, S., Giovenazzo, P., Fournier, V. (2019). The Berg, S., Rosenkranz, P. (2018). Lithium chloride
Use of the Predatory Mite Stratiolaelaps scimitus effectively kills the honey bee parasite Varroa
(Mesostigmata: Laelapidae) to Control Varroa destructor by a systemic mode of action. Scientific
destructor (Mesostigmata: Varroidae) in Honey Bee reports, 8(1), 683.
Colonies in Early and Late Fall. Journal of economic
entomology, 112(2), 534‒542.
68
Food
biotechnology
69
70
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
COMPARATIVE STUDY ON EXTRACTION METHODS OF PECTIN
FROM BY-PRODUCTS OF JUICED CARROTS
Agnes TOMA, Oana CRĂCIUNESCU, Rodica TATIA
National Institute of Research and Development for Biological Sciences,
296, Splaiul Independenţei, 060031, District 5, Bucharest, Romania
*Corresponding author: [email protected]
Abstract
Carrot juice is a product of interest in food industry. Pomace, a by-product of the carrot juice industry, contains a
significant amount of pectin. This natural polymer is rich in galacturonic acid and is used as food additive due to its
gelling, thickening and stabilizing properties. The objective of this study was to compare different extraction methods
of carrot pectin. Sodium citrate buffer, pH 5.0 and carrot pulp were used for pectin extraction. Methods used to obtain
pectin required temperature, microwaves, ultrasounds and Celluclast 1.5L enzyme treatment. The extraction yield of
each method was determined. The obtained pectin was characterized by the content of galacturonic acid, the degree of
esterification, the degree of emulsification and cytotoxicity in a fibroblast cell line. The enzymatically extracted carrot
pectin contained at least 65% galacturonic acid and had a high degree of esterification and emulsification. In vitro
cytotoxicity tests have demonstrated the biocompatibility of pectin extracts. The results of this study have showed that
valuable carrot pectin with high content of galacturonic acid and good biocompatibility can be obtained from carrot
pomace. The enzymatic extraction method could be further studied for various industrial applications, and the obtained
carrot pectin could be useful especially in food supplements.
Key words: cytotoxicity, emulsion, esterification, galacturonic acid, pectin.
INTRODUCTION which was sold as a gelling agent. At present,
apple pomace and citrus peels are the main
Food industry produces several by-products sources for obtaining commercial pectin (Dranca
during fruits and vegetables processing, & Oroian, 2018). 85.5% of the market pectin is
especially for natural juices manufacture, from citrus peels, 14% from apple pomace and
which can be valorised. The generated 0.5% from sugar beet pulp (Cirimina et al.,
pomace is a valuable by-product that contains 2016). New sources of pectin have been studied,
pectin, besides other components of interest. such as tomatoes (Grassino et al., 2016), carrots
Pectin is a group of natural polysaccharides, (Jafaria et al., 2017), watermelon (Petkowicz et
rich in D-galacturonic acid units linked by α- al., 2017), banana peels (Happi Emaga et al.,
1,4 glycosidic bonds, present in the cell walls 2008), passion fruit peels (Liew et al., 2014;
of the superior plants. The galacturonic acid Vasco-Correa et al., 2017), dragon fruit peels
from pectin chain is largely esterified with (Tongkham et al., 2017), grape pomace
methoxy and acetyl groups (Harholt et al., (Minjares-Fuentes et al., 2014) etc.
2010). Due to its gelling, thickening and Both the extraction method and the source
stabilizing properties, pectin is intensively influence the quantity and the properties of the
used in the food industry, especially sweets, obtained pectin. The temperature and the buffer
as an additive. It is a very safe food additive pH are parameters of great importance, which
with no consumption limit. It is also used in can vary during pectin extraction process.
the medical, cosmetic and pharmaceutical Pasandide et al. (2017) extracted a high
industries (May, 1990). There are no esterified pectin from an aqueous solution of
indications on its genotoxicity and it has no Citrus medica peel, at different temperatures and
side effects or allergenic potential (Mortensen periods of extraction, with a maximum yield of
et al., 2017). At the beginning of the 20th 21.85%. Liew et al. (2014) obtained a high
century, the German apple juice producers esterified pectin from passion fruit peels, varying
used the remaining residue to obtain pectin, the pH of citrate buffer and the maximum yield
71
corresponded to pH 2. Commercial pectin in two different weight ratios of 1: 60 (variant a)
was also extracted from citrus peels or apple and 1: 15 (variant b), 50°C, for 20 h (Sabater et
pomace using hot dilute acid at pH 2 (May, al., 2018; Wikiera et al., 2015). The enzyme
1990). activity was stopped by boiling the mixture at
Currently, environment-friendly methods 100°C, for 10 min. Controls (variants a1, b1)
based on microwaves, ultrasounds and were prepared in the same conditions without
enzymes are used in pectin extraction. adding the enzyme. The extracts were filtered
Tongkham et al. (2017) obtained pectin from through Whatman paper to remove the vegetal
an aqueous solution of dragon fruit peels residues.
using microwaves at different powers and the
maximum yield was 23.11%. Minjares- Thermal extraction method
Fuentes et al. (2014) prepared a high Carrot powder (0.5 g) was incubated in 15 ml
esterified pectin with a yield of 29.4% from citrate buffer, pH 5, at 120°C, for 2 h (Pasandide
grape pomace in citric acid using ultrasounds. et al., 2017). After cooling at room temperature,
A maximum output of 19% pectin was the solution was filtered through Whatman paper
obtained from apple pomace using a (variant c) and further processed for analysis.
treatment with Celluclast 1.5L enzyme
(Wikiera, 2015). Microwaves-assisted extraction method
The use of pectin on a larger scale requires In the case of microwaves-assisted extraction, a
new methods of extraction and valorisation of weight ratio of 1: 100 between the carrot powder
different sources, in order to obtain products and the citrate buffer was used. The
with convenient properties. Carrot (Daucus homogenized solution was exposed to
carota) is a root plant, consumed worldwide microwaves, at a power of 560 W, for 160 s
in both fresh and cooked state for its high (Tongkham et al., 2017). After cooling, the
content in minerals and carbohydrates. solution was filtered through Whatman paper
During carrot juice preparation, an important and further analysed (variant d).
amount of pomace is obtained, with a high
content of valuable compounds including Ultrasonic extraction method
carotenoids, dietary fibres and pectin (Sharma A mixture of carrot powder and citrate buffer pH
et al., 2012). Jafaria et al. (2017) extracted the 5, in a weight ratio of 1: 30 was exposed to
carrot pomace pectin in citric acid. ultrasounds treatment, at 10 kHz frequency, at
The purpose of this study was to compare the 60°C, for 40 min (Minjares-Fuentes et al., 2014).
enzymatic methods of pectin extraction with The vegetal residues were removed by filtration
the chemical methods using carrot pulp in and further processed (variant e).
citrate buffer as a source. The physical and
chemical characterization of pectin was Purification method
performed in order to obtain a product with Pectin was purified by precipitation of filtrate
improved properties for applications in the with ethanol. In the first step, 2 volumes of
food and cosmetics industry. ethanol were added over the obtained filtrate and
incubated at 4°C, overnight. Then, it was
MATERIALS AND METHODS centrifuged at 7000 g, for 30 min. The
supernatant was discarded and the precipitate
Materials was washed with 10 ml absolute ethanol and
Carrots originating from Romania were separated by centrifugation at 7000 g, for 30
bought from the supermarket, washed, cut min. Pectin extract was dried at 50°C until
and dried at 50°C, for 24 h. Then, the material constant mass was reached.
was powdered using a grinder and stored in All pectin extracts were prepared in two separate
food bags, at -20°C until analysis. experiments, in triplicate.
Enzymatic extraction method Yield determination
The powdered carrot was incubated in citrate For each extraction method, the yield was
buffer, pH 5 containing 88 U Celluclast 1.5L, calculated using the following equation:
72
% yield = (final weight/initial weight) x 100 Cell cytotoxicity tests
where the final weight was the amount of Cells from mouse fibroblast NCTC clone L929
dried pectin and the initial weight was the cell line were seeded in 96-well culture plates
dried amount of raw material. and incubated in 5% CO2 humid atmosphere, at
37°C, for 24 h. For experiments, the culture
Determination of galacturonic acid medium was replaced with fresh medium
Determination of galacturonic acid content containing pectin extracts in the concentration
was performed by orcinol method (Moldovan range of 50-1000 µg/ml and the plates were
et al., 2008). Briefly, over 1 ml of pectin incubated in standard conditions for 24 h and 48
solution, 3 ml orcinol reagent (orcinol mixed h. Cell viability was determined at the end of
with FeCl3 and concentrated HCl) were incubation period by MTT assay, as previously
added. The mixture was incubated at 100°C, described (Scudiero et al., 1988; Quentin-
for 40 min with gentle shaking. After cooling, Leclercq et al., 1992). MTT assay consists in the
the absorbance of each processed sample was reduction of tetrazolium bromide salt by
read at 665 nm using a UV-VIS mitochondrial dehydrogenases present in
spectrophotometer. A standard curve was metabolically active cells. Briefly, the culture
built using dilutions of 0.15 mM galacturonic medium was replaced with MTT solution,
acid solution. Determinations were performed followed by incubation at 37ºC, for 3 h. The
in triplicate. formed formazan crystals were dissolved in
isopropanol by gentle shaking and the
Determination of esterification degree absorbance of the coloured solution was read at
Determination of the esterification degree 570 nm using a microplate reader. Untreated
(DE) was performed by titrimetry (Liew et cells served as negative control, considered as
al., 2014). A pectin solution of 1 mg/ml 100% viable cells, while cells treated with
concentration was titrated with NaOH, in the 0.03% H2O2 represented the positive control.
presence of 2 drops of phenolphthalein, until Determinations were performed in triplicate.
the colour turned pink (initial NaOH volume). Cell morphology observations of the cultures
The mixture was left at room temperature, for treated with pectin extracts for 48 h were
2 h to de-esterize galacturonic acid. HCl was performed using an optic microscope equipped
used to neutralize excess NaOH until the with a digital camera.
solution became colour-less. After that, 2-3
drops of phenolphthalein was added again RESULTS AND DISCUSSIONS
and the obtained mixture was titrated with
NaOH until pink (final NaOH volume). In this study, pectin was extracted from carrot
pulp in sodium citrate buffer, pH 5.0 using the
enzymatic, thermal, microwave- and ultrasound-
assisted methods.
Determination of emulsification degree Extraction of pectin and yield
Determination of the emulsification degree The purified pectin extract was dried to obtain a
was performed by vortexing a mixture of 0.5 yellowish or white powder (Figure 1).
mg/ml pectin solution and sunflower oil The yield of pectin extraction from carrot in
containing 0.02% sodium azide, in equal citrate buffer, pH 5, varied between 7-20%,
parts, at maximum speed (Jafaria et al., according to each treatment procedure (Figure 2).
2017). Then, the emulsion was centrifuged at Thus, the highest value was 20%, in the case of
4000 g, for 5 min. The emulsification degree microwave extraction of pectin from carrot pulp.
was calculated using the following equation: In the case of ultrasonic extraction, the yield was
almost 3 times lower than that of microwave-
assisted extraction of pectin. Enzymatic
extraction of pectin in variant b had a yield of
where emulsion volume was the volume of 17%, which was with 23.52% higher than the
emulsion phase and the system volume was yield obtained in enzymatic treatment variant a.
the volume of total system.
73
Pectin extracts obtained in the same conditions,
but enzyme-free (a1 and b1 controls) had a very
small yield of 3% and 5%, respectively,
indicating that Celluclast was efficient in pectin
extraction.
Celluclast 1.5L is a cocktail of enzymes with
xylanolytic and cellulolytic activity. This
enzymatic cocktail helps to release the pectin by
destroying the cellulosic wall of the plant cell
Variant a
(Wikiera et al., 2015). Still, the yield of
enzymatic extraction variant b was with 15%
lower than the yield of microwave-assisted
extraction. Thermal extraction of pectin had a
yield of 12%. Similar studies indicated a yield of
23.1% in the case of microwave-assisted
extraction of pectin from dragon fruit peels, in
citrate buffer pH 2, for 10 min, at a power of 600
W (Tongkham et al., 2017).
Variant c
Liew et al. (2016) extracted the pectin from the
passion fruit by the enzymatic method using
Celluclast and obtained a maximum yield of
9.17%. Wikiera et al. (2015) obtained apple
pectin with a maximum yield of 19%. Jahari et
al. (2017) obtained pectin from carrot pomace
using a temperature of 50- 90°C for 30-150 min,
at a pH ranging between 0.5-2.5. By varying
temperature, time and pH parameters, yields
ranged between 5-15.2%. The maximum yield
was obtained in the case of pH 1.3, 90°C for
Variant d
79.8 minutes.
Galacturonic acid content
Figure 1. Pectin extracts obtained from carrot
The method of pectin extraction from carrot pulp
pulp by enzymatic (a), thermal (c)
and microwave-assisted (d) methods influences its galacturonic acid content.
According to FAO, pectin used in the food
90
industry have at least 65% galacturonic acid
content, as an indicator of its purity (May, 1990).
In this study, pectin obtained by enzymatic
80
70
extraction with Celluclast had a high content of
60 galacturonic acid (Figure 2), ranging from 71.5%
percentage (%)
50 (variant a) and 73% (variant b). The percentage
40
yield of galacturonic acid in thermal extracted pectin
%galacturonic acid was 68% and in microwaves extracted pectin
30
was 66%. The pectin extracted by ultrasound had
20
a lower percentage of galacturonic acid (44%).
10
By enzymatic extraction, using Celluclast, we
0 obtained a pectin with a 73% galacturonic acid
a1 b1 a b c d e
content. Jafaria et al. (2012) showed that pectin
Figure 2. Extraction yield and galacturonic acid obtained from carrot pomace, under acidic
content of carrot pectin obtained by enzymatic (1: 60) conditions, at high temperature contained 75.5%
(a) with its control (a1), enzymatic (1: 15) (b) with its galacturonic acid. In turn, pectin obtained from
control (b1), thermal (c), microwave-assisted (d) and passion fruit by enzymatic extraction using an
ultrasonic (e) extraction methods
74
extract from G. klebahii had 85.4% Venzon et al. (2015) attempted to decrease the
galacturonic acid content (Vasco-Correa et pectin esterification degree by treatment with
al., 2017). NaOH for 1 h, at 55°C. Lowering the esteri-
fication degree with a few percent, the pectin
Esterification degree solution viscosity was reduced.
The esterification degree represents the
percentage of galacturonic acid carboxyl Emulsion degree
groups esterified with methoxy (in most Pectin can be used as an emulsifier in the food
cases) or acetyl groups. industry and its quality depends on the degree of
The pectin extracted by different extraction emulsification. In this study, enzymatically
methods in this study had a high degree of obtained carrot pectin had the highest degree of
esterification. It was higher than 70% for all emulsification (65%) (Figure 3). The pectin
treatment procedures, as presented in Figure obtained by ultrasounds treatment had a lower
3. The highest esterification degree of pectin emulsification degree (57%). Thermally obtained
extracted from carrot was 87%. A product pectin had the emulsification degree of 60%,
with an esterification degree of 81% was while that of microwaves-extracted pectin was
obtained by thermal extraction. The 58%. A similar degree of emulsification of
microwave-assisted extraction resulted in a 60.3% was reported for pectin obtained from
product with 77% esterification degree, while carrot pomace (Jafaria et al., 2017).
ultrasound-extracted pectin had a degree of
esterification of 75%. Cytotoxicity tests
Cytotoxicity of pectin extracts was tested in
100 NCTC fibroblast culture after 24 h and 48 h of
90
cultivation, by MTT assay and cell morphology
80
observations. The results are presented in Figure
4.
70
percentage(%)
60
esterification degree (A)
50
emulsion degree
40
120
30 100
Cell viability (%)
20 80 a
10 60 c
0 40 d
a b c d e 20
0
Figure 3. The esterification and emulsion degree of Control 50 100 250 500 750 1000 M+
carrot pulp pectin obtained by enzymatic (1: 60) (a),
Concentration (μg/mL)
enzymatic (1: 15) (b), thermal (c), microwave-assisted
(d) and ultrasonic (e) extraction methods
(B)
A similar result was obtained by Liew et al. 120
(2016) for enzymatically extracted passion 100
Cell viabiliy (%)
fruit pectin, presenting 86.96% esterification 80 a
degree. 60 c
Pectin esterification degree is >50% for high 40 d
methylated pectin or <50% for low 20
methylated pectin, respectively. The 0
esterification degree affects pectin properties Control 50 100 250 500 750 1000 M+
Concentration (μg/mL)
(Liew et al., 2014). The high methylated
pectin can form gels at low pH. Low Figure 4. Cytotoxicity of carrot pectin extracted
esterified pectin forms gels in the presence of enzymatically (a), thermal (c) and microwave-assisted (d)
Ca2+ (Venzon et al., 2015). and cultivated in NCTC fibroblast cell culture for 24 h (A)
and 48 h (B)
75
The viability was high after 24 h of NCTC CONCLUSIONS
cells cultivation in the presence of pectin,
surpassing 94% (Figure 4. A). All results demonstrated that high quality pectin
It was observed that cells cultivated with extract could be obtained from carrot pulp by
microwaves-extracted pectin with environmentally friendly methods based on
concentrations of 50-1000 μg/ml presented enzymatic or microwaves treatment. They avoid
high values of viability, between 110.94- strong acids or high temperature treatment for
117.61%. long periods of time. Each method of extraction
The viability of cells cultivated with influenced pectin extract characteristics. Thus,
thermally-extracted pectin increased in a pectin extracts were highly esterified (>70%),
concentration-dependent manner, with the had a high degree of emulsification (>50%) and
highest value at 1000 μg/ml concentration. over 65% galacturonic acid content. The best
After 48 h of cultivation in the presence of yield was obtained in the case of microwaves
pectin extracts, the cell viability was similar extraction, while the highest percentage of
or higher than that of control cells, considered galacturonic acid was found in enzymatic-
100%, excepting microwaves-extracted pectin extracted pectin. The MTT assay results showed
at 1000 μg/ml (Figure 4. B). that thermally-, enzymatically- and microwaves-
Thermally-extracted pectin maintained a high extracted pectin did not have cytotoxic effects in
value of cell viability, ranging between a fibroblast cell culture. In conclusion, the high
103.72% and 124.44%, for concentrations of quality pectin extracted from carrot pulp could
50-750 μg/ml. be further studied for various industrial
Cell morphology of NCTC fibroblasts applications, especially in food supplements.
cultivated in the presence of pectin extracts
was observed after 48 h of cultivation (Figure ACKNOWLEDGMENTS
5). No change was observed in the
morphology of pectin-treated cells, compared This work was supported by the Romanian
to untreated cells. Fibroblast cells presented Ministry of Research and Innovation,
the characteristic spindle-shape phenotype. UEFISCDI, project No. PN-III-P11.2-PCCDI-
These observations confirmed the quantitative 2017-0569.
data obtained by MTT assay.
REFERENCES
Bayar, N., Friji, M., Kammoun, R. (2018). Optimization of
enzymatic extraction of pectin from Opuntia ficus
indica cladodes after mucilage removal, Food
variant 1 variant 2 Chemistry, 241, 127‒134.
Ciriminna, R., Fidalgo, A., Delisi, R. (2016). Pectin
production and global market, Food Industry Hi Tech,
27, 17–20.
Craciunescu, O., Gaspar, A., Trif, M., Moisei, M., Oancea,
A., Moldovan, L. (2014). Preparation and
characterization of a collagen-liposome-chondroitin
variant 4 sulfate matrix with potential application for
variant 3
inflammatory disorders treatment, Journal of
Nanomaterials, Article ID 903691, 9 pages.
Figure 5. Morphology of NCTC cells cultivated with Datt Sharma, K., Karki S., Singh Thakur, N. (2012).
250 µg/ml pectin extracted by enzymatic method (1), Chemical composition, functional properties and
microwaves method (2) and thermal method (3), processing of carrot, Journal of Food Science and
for 48 h. Control cells were cultivated in plastic Technologie, 49, 22‒32.
culture plates (4) Dranca, F., Oroian, M. (2018). Extraction, purification
and characterization of pectin from alternative
sources with potential technological applications, Food
The cytotoxicity tests demonstrated that all Research International, 113, 327‒350.
three types of carrot pectin were not Grassino, A. N., Halambek, J., Djaković, S., Rimac
cytotoxic. Moreover, thermally-extracted Brnčić, S., Dent, M., Grabarić, Z. (2016). Utilization of
pectin stimulated the growth of NCTC cells. tomato peel waste from canning factory as a potential
76
source for pectin production and application as tin (E 440ii) as food additives, EFSA Journal, 15, 4866.
corrosion inhibitor, Food Hydrocolloids, 52, Mouna, A., Catherine, M. G. C., Renard, A., Aude, W.,
265‒274. Imen, F., Hamadi, A. (2016). Yield and composition of
Happi Emaga, T., Ronkart, S. N., Robert, C., Wathelet, pectin extracted from Tunisian pomegranate peel,
B., Paquot, M. (2008). Characterisation of pectins International Journal of Biological Macromolecules,
extracted from banana peels (Musa AAA) under 93, 186‒194.
different conditions using an experimental design, Pasandide, B., Khodaiyan, F., Mousavi, Z. E., Hosseini S.
Food Chemistry, 108, 463‒471. S. (2017). Optimization of aqueous pectin extraction
Harholt, J., Suttangkakul, A., Scheller H.V. (2010). from Citrus medica peel, Carbohydrate Polymers, 178,
Biosynthesis of Pectin. Plant Physiology, 153, 27‒33.
384‒395. Petkowicz, C. L. O., Vriesmann, L. C., Williams, P. A.
Jafaria, F., Khodaiyana, F., Kianib, H., Saeid Hossein (2017). Pectins from food waste: extraction,
S. (2017). Pectin from carrot pomace: Optimization characterization and properties of watermelon rind
of extraction and physicochemical properties, pectin, Food Hydrocolloids, 65, 57‒67.
Carbohydrate Polymers, 157, 1315‒1322. Quetin-Leclercq, J., Elias, R., Balansard, G. (1992).
Liew, S. Q., Chin, N. L., Yusof, Y. A. (2014). Cytotoxic activity of some triterpenoid saponins,
Extraction and characterization of pectin from Planta Medica, 58, 279-280.
passion fruit peels, Agriculture and Agricultural Sabater, C., Corzo, N., Olano A., Montilla A. (2018).
Science Procedia, 2, 231‒236. Enzymatic extraction of pectin from artichoke (Cynara
Liew, S. Q., Chin, N. L., Yusof, Y. A., scolymus L.) by products using Celluclast®1.5L,
Sowndhararajan, K. (2016). Comparation of acidic Carbohydrate Polymers, 190, 43‒49.
and pectin extraction from passion fruit peels and Scudiero, D. A., Shoemaker, R. H., Paull, K. D., Monks,
its gel properties, Journal of Food Process A., Tierney, S., Nofziger, T. H., Currens, M. J., Seniff,
Engineering, 39, 501‒511. D., Boyd, M. R. (1988). Evaluation of a soluble
May, C. D. (1990). Industrial pectins: sources, tetrazolium/formazan assay for cell growth and drug
production and applications, Carbohydrate sensivity in culture using human and other tumor cell
Polymers, 12, 79‒99. lines, Cancer Research, 48, 4827‒4833.
Minjares-Fuentes, R., Femenia, A, Garau, M. C., Tongkham, N., Juntasalay, B., Lasunon, P.,
Meza-Velázquez, J. A., Simal, S., Rosselló, C. Sengkhamparn, N. (2017). Dragon fruit peel pectin:
(2014). Ultrasound-assisted extraction of pectins microwave-assisted extraction and fuzzy assessment,
from grape pomace using citric acid: a response Agriculture and Natural Resources, 51, 262‒267.
surface methodology approach, Carbohydrate Vasco-Correa, J., Zapata, A.D. (2017). Enzymatic
Polymers, 106, 179‒189. extraction of pectin from passion fruit peel (Passiflora
Mitchell, R., Novo, Z. (1964). Effect of bacterial edulis f. flavicarpa) at laboratory and bench scale, LWT
polyssacharide accumulation on infiltration of - Food Science and Technology, 80, 280‒285.
water through sand, Applied Microbiology, 12, Venzon, S. S., Canteri, M. H. G., Granato, D.,. Junior, B.
219‒233. D., Maciel, G. M., Stafussa, C. W. I., Haminiuk, A. P.
Moldovan, L., Craciunescu, O., Balan, M., Gaspar, A., (2015). Physicochemical properties of modified citrus
Gherghina, E. (2008). The purification, physico- pectins extracted from orange pomace, Journal of
chemical characterization and bioactivity of Food Science and Technologie, 52, 4102‒4112.
polysaccharides from Viscum album, Revista de Wikiera, A., Mika, M., Starzynska-Janiszewska, A.,
Chimie (Bucuresti), 59, 1022‒1025. Stodolak, B. (2015). Application of Celluclast 1.5L in
Mortensen, A., Aguilar, F., Domenico, A., Dusemund, apple pectin extraction, Carbohydrate Polymers, 134,
B., Frutos, M.J., Galtier, P., et al. (2017), Re- 251‒257.
evaluation of pectin (E 440i) and amidated pectin
77
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
EFFECT OF CLIMATE CONDITIONS ON THE RIPENESS
QUALITY INDICATORS OF SOME RED GRAPES FROM
VALEA CĂLUGĂREASCĂ VINEYARD
Elena COARFĂ, Mona Elena POPA
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mărăşti Blvd.,
District 1, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
Grape maturation is a very complex biochemical process which influences wine quality. During maturation, grapes
accumulates the sugars content, polyphenols, flavors, nitrogenous compounds, mineral substances, enzymes, vitamins,
and other chemical compounds that participate in the formation of the wine quality. Grape maturation is strongly
influenced by climatic conditions, so the quality of raw materials for wine varies widely from one year to another, from
one vineyard to another. The aim of the present work is o evaluate the effects of pedo climatic influence of the year
2017 on grape maturation and quality parameters for 3 red cultivars in Valea Călugărească vineyard. For this
purpose, three grapes cultivars: Cabernet Sauvignon, Merlot and Fetească neagră were analised from characteristics
such us : sugar content, total acidity, 1000 grain weight , glucoacidimetric index. The experimental measurements were
conducted during august-september of 2017 year. The research established the relation between the heliothermal
regime of those year and quality indicators of the raw material for obtaining a good technological, phenolic and
aromatic maturation for a superior quality of red wine.
Key words: glucoacidimetric index, grapes characteristics, grape maturation, sugar content, total acidity.
INTRODUCTION color, aroma, and flavor, making the difference
between different assortments of wine (Mitic et
Wine is a complex matrix which contains many al., 2010).
classes of compounds like sugars, alcohols, For these reasons, there is an increased
acids, tannins, and other components like tendency to study the wine composition in its
minerals and proteins. Its composition is minor constituents with the aim to achieve
influenced by many factors related to the better characterization, contributing thus to the
specific production area, like grape variety, soil commercial enhancement of the product
and climate, ripening of the grapes, yeasts, and (Geana et al., 2014).
winemaking technique (Gonzálvez et al., 2009; The type and concentration of the phenolic
La Torre et al., 2006). compounds in wine depends on grape variety,
There are various reasons for which the ripening, atmospheric conditions, viticulture
concentrations of some major and trace and winemaking techniques. Generally, the
elements in wines are further monitored (Geana major determinant factor for the variation in the
et al., 2014). Some of them are related to the polyphenolic content of different red wines
effects these elements may have on the throughout the world is probably the amount of
organoleptic properties of the wines (Lara et sunlight to which the grapes are exposed during
al., 2005) and to their ability to discriminate cultivation (Geana et al., 2011).
wines according to the geographical region in To determine the optimum moment to harvest
which grapes were grown (Geana et al., 2013) red wine grapes, as well as the sugar/acidity
as well as to detect wine adulteration (Geana et ratio (technological ripeness), it is also impor-
al., 2014). tant that the grape has a high concentration of
The presence of phenolic substances in wine easily extractable phenolic compounds in the
and the pedoclimatic conditions are funda- skin, such as anthocyanins and tannins, and that
mental, these being a major contributor to the the seeds have a hard-outer coating (Cuzmar et
formation of specific characteristics such as al., 2018).
78
The optimum moment to harvest red wine At the beginning of ripening, grape samples are
grapes is therefore defined by technological taken from 5 to 5 days, and as the aging process
and phenolic ripeness (Ribereau-Gayon et al., progresses, samples are taken more often from
2006). 3 to 3 days. The sample of grapes come from at
Maturity could be described as the time when least 10-20 stocks of plot, located in various
the analytical parameters such as sugar content, points. There are taken small portions of
acidity, and other compounds reach the proper bunches from the grapes who are in the middle
balance, and the varietal characteristics, of the hub, grapes on the sunny side and the
including aroma, flavor and color are fully ones inside the hub.
developed for the style of wine to be produced. Sampling is taken in plastic bags where a label
The determination of harvest time is a complex is insert, with the following characteristics:
compromise between availability of harvesting variety from which the sample is taken, in our
labor or a mechanical harvester, the weather, case from Cabernet Sauvignon, Merlot and
the likelihood of pest and disease damage, and Fetească Neagră; date of harvest; the name of
the stage of ripeness of the grapes. Timing is the place where the plantation is; any data on
most critical when all the fruit is harvested plantation. Samples of grapes are brought on
concurrently since only rarely is it economi- the same day in the laboratory to be analysed.
cally feasible to selectively and repeatedly Sample analysis consists of the following
harvest for fruit of a particular quality for determinations: weight of 100 grains, total
winemaking. The best harvest decisions are sugar content and acidity of the grapes and
made by grape growers and winemakers who glucoacidimetric index. First is proceeded to
work closely together using a practical, detaching bunches grain from residues by
integrated approach toward maturity cutting with laboratory scissors above grape
assessment1. grain burelet so the berries remain intact and
The objectives and goals of the work is to study not lose the juice.
the effects of pedoclimatic influence of the year Healthy grapes berries are counted, separating
2017 on grape maturation and quality para- the healthy from the damaged ones. Grapes
meters for 3 red cultivars in Dealu Mare region. berries are weighted at technically, laboratory
The aim of this study was to quantify the balance setting the weight of 100 berries.
different components during the maturation After weighting the berries are crushed in
process of Cabernet Sauvignon, Merlot and gauze bag and by hand squeezing the must is
Fetească Neagră grapes grown in Valea divided. Must collection is made in conical
Călugărească vineyard center, from the flasks Erlenmeyer glasses which then are kept
beginning of maturation until harvest to verify in the fridge for 2-3 hours for clarifying the
whether they meet the requirements to produce wine pressing. From the clear must,
high-quality wines. unfermented, are determined the total acidity
and total sugar content. The sugars content is
MATERIALS AND METHODS determined out by refractometer method. The
total acidity is determined by the titrimetric
Most varieties for wine grapes fall into method, neutralizing the acidity of the must
maturation in seasons like IV and V. The with a 0,1 N NaOH solution in the presence of
period of grapes ripening is 45-50 days (second bromothymol blue indicator.
half of August-September month) that The tests are listed in the register of laboratory
harvesting grapes period begins after the 15th to and the graphs are drawn based on their
the 20th of September. maturing varieties.
Starting from the fact that the sugar content of
Technological ripeness grapes during maturation moves backwards
The maturation process is followed from the with the total acidity, for determining the
entrance of the first fruits in grape (early ripeness degree was considered the report
ripeness) by taking periodic samples of the sugars content/total acidity (S/A):
grape who are analysed in the laboratory. Glucoacidimetric index (S/A) = Sugars (%)/
1 Total Acidity (g H2SO4/l)
Vineyard and Vintage view, July/August (1995), 10(4), 325.
79
Glucoacidimetric index values in the full The number of insolate hours totalling the
maturation of the grapes are between 35-45, average amount in 2071 hours by year
depending on the variety. Between these limits providing a normal ripening grapes and wood
the grapes values have reached optimum degree chords.
of maturity that insures good quality wines. Pluviometric data indicate the average annual
amount of precipitation being between 510-590
Phenolic ageing mm, with large variations in them from one
The rich grape phenolic compounds year to another.
(anthocyanins, tannins) is a technological Distribution of rains during the vegetation
condition for insuring the quality of red wines. period is uneven, in May-June a single
When colored grapes (black) have reached maximum rainfall. Hail falls fairly infrequently,
ripeness, peeled grains make up cell mem- but can produce significant damage.
branes to disrupt through the action of enzymes From the ecoclimatic point of view, the year of
and let to distribute in must (juice grapes) the 2017 was characterized by a moderate regime
colorants materials, so the grapes are makeing heliothermic, against a background of rich
phenolic maturation. water resources, especially in April and May,
Seed maturity is a controversial concept when it was overcome multiannual values.
because oenologists often wait too long for the The vegetation period (April), it started with
grapes to reach this hypothetical maturity stage temperatures lower than the normal (10.9ºC to
and excessively delay the harvest without 11.7ºC), and a higher water regime (107 l/m2 to
achieving any advantages (Casassa et al., 2013) 44.8 l/m2), confronted with multiannual values.
suggested that delaying harvest to achieve seed Air wettability in 2017 year was higher by
browning may be a relatively lesser factor 1.3% in April, with 0.6% in June, by 7.7% in
affecting tannin extraction during maceration. July and 1.6% less in May, and by 4.3% in
This controversy springs from a confusion August (Table 1) compared to the previous
between seed browning and seed maturity; the year.
former is related to a chemical composition as
well as to representative colour, and the latter Tabel 1. Rainfall, wettability during the period
April - October 2017
to acoustic and mechanical properties (Torchio
et al., 2012), seed texture (Le Moigne et al., Precipitation No days Hygroscopicity
2008), chemical properties (Kennedy et al., (mm) with rain %
Month
Year
2000), as well as seed colour properties (Ristic Nor IV-X Nor IV-X
& Iland, 2005). >10
mal 2017 mal 2017
IV 44.8 107.0 9 67.7 68.3
RESULTS AND DISCUSSIONS
V 67.3 56.4 9 68.4 65.9
2 VI 81.5 84.7 6 70.1 69.5
Valea Călugărească vineyard center shows 0
VII 75.8 86.6 11 67.5 71.0
viticulture potential for the culture of vine 1
7 VIII 62.7 36.4 6 66.5 61.1
varieties to obtain high-quality red wines. For IX 54.4 40.2 9 70.7 65.3
the elaboration of the study concerning the X 46.2 86.8 4 77.0 76.4
climate, vineyard center have used data
recorded at the meteorological station Valea The optimal time for harvesting the grapes was
Călugărească (latitude 44º59’, longitude established both by the weight of the berries
26º13’, altitude 210 m). and grapes glucoacidimetric index (sugar levels
The global radiation, considered as the most to acidity). At first these indices were followed
important factor of climate, in its viticultural up by 5 to 5 days, then with 5-6 days before
center Valea Călugărească has some annual harvesting, the grapes were pursued every day
values ranging around 125 kcal/cm2. (maturation stroke).
The highest values of global radiation records Vintage achieved optimal time when the weight
during the warm year (April-September), varies of 100 grains reached the maximum value, the
around 92.5 kcal/cm2 horizontal surface. acidity of the grapes won’t change, and the
80
sugar level from the berries has not increased All these factors can be found in experimental
for 2-3 days. records below (Tables 2, 3, 4, 5):
Table 2. Ripening grapes on 24.08.2017
Characteristics of grapes
No. Variety Parcel Sugar (g/l) Total Acidity W 100 Glucoacidime-
(g/l H2SO4) berries (g) tric Index
1 Cabernet Sauvignon 4406 140.80 7.09 119.19 20
(CS)
2 Cabernet Sauvignon 4403 155.60 6.90 109.27 23
(CS)
3 Cabernet Sauvignon 4409 153.50 6.52 103.42 24
(CS)
4 Merlot (M) 187.50 4.10 122.04 46
5 Fetească Neagră (FN) 155.60 4.92 110.45 32
Table 3. Ripening grapes on 30.08.2017
Characteristics of grapes
No. Variety Parcel Sugar Total Acidity W 100 Glucoacidime-
(g/l) (g/l H2SO4) berries (g) tric Index
1 Cabernet Sauvignon 4406 150.00 6.04 120.00 25
(CS)
2 Cabernet Sauvignon 4403 172.60 5.65 107.86 31
(CS)
3 Cabernet Sauvignon 4409 160.00 6.15 105.00 26
(CS)
4 Merlot (M) 174.80 4.44 97.70 39
5 Fetească Neagră (FN) 179.00 4.34 135.69 41
Table 4. Ripening grapes on 07.09.2017
Characteristics of grapes
No. Variety Parcel Sugar Total Acidity W 100 Glucoacidime-
(g/l) (g/l H2SO4) berries (g) tric Index
1 Cabernet Sauvignon 4406 168.00 5.30 120.00 32
(CS)
2 Cabernet Sauvignon 4403 172.60 5.07 113.43 34
(CS)
3 Cabernet Sauvignon 4409 183.30 4.35 114.09 42
(CS)
4 Merlot (M) 225.80 3.04 132.92 74
5 Fetească Neagră (FN) 189.60 3.72 151.30 51
Table 5. Ripening grapes on 14.09.2017
Characteristics of grapes
No. Variety Parcel Sugar Total Acidity W 100 Glucoacidime-
(g/l) (g/l H2SO4) berries (g) tric Index
1 Cabernet Sauvignon 4406 182.3 4.40 119.24 41
(CS)
2 Cabernet Sauvignon 4403 202.40 4.63 118.47 44
(CS)
3 Cabernet Sauvignon 4409 183.30 4.35 114.09 42
(CS)
4 Merlot (M) 225.80 3.04 120.98 74
5 Fetească Neagră (FN) 189.60 3.72 157.71 51
From the point of view of grape maturation the maximum on the 14.09.2017, 225.8 g/l
following results have been registered: (Table 5). Over a period of 13 days, Merlot
Following the dynamics of grape ripeness by has accumulated 38 g of sugar, a daily
setting specific parameters we concluded average of about 3 g/l. Regarding Cabernet
that the highest accumulation of sugar was Sauvignon grapes the accumulation are
recorded in Merlot, which achieved the slower, fact that made the grape harvest to
start later compared to other black varieties.
81
The total acidity expressed in g/l H2SO4 Sauvignon and Fetească neagră are
with sugar content pursue the ripening reaching increase values from 114.09 to
evolution of grapes. Acidity reduction is 118.47 g Cabernet Sauvignon (Tables 4
quantitatively the most important and 5) and 157.71 g Fetească neagră
biochemical process that occurs in (Table 5). Merlot increased from 97.70
grapes during maturation. In the variety g (Table 3) to 120.98 g (Table 5).
Cabernet Sauvignon we may notice a Values of glucoacidimetric index are
decrease in acidity from 7.09-6.52 g/l between 35-45 which indicates a full
H2SO4 (Table 2) up to the target of maturity of the grapes, as demonstrated
4.63-4.35 g/l H2SO4 (Table 5). For by the experimental measurements
Merlot variety a significant decrease can carried out, so: for the Cabernet
be observed up to 3.04 g/l H2SO4 (Table Sauvignon and Fetească Neagră the
4), which was maintained constant for 7 values are starting from 20.32 (Table 2)
days - 3.04 g/l H2SO4 (Table 5). For to 31.41 (Table 3), reaching a maximum
Fetească neagră total acidity decrease at 42-44 for Cabernet Sauvignon (Table
became constant, from values of 4.92 5) and 51 for Fetească neagră (Table 5).
g/l H2SO4 (Table 2) up to 3.72 g/l Merlot maximum values are recorded to
H2SO4 (Table 4), and the value remains 74 (Table 4 and Table 5).
the same after a week. The lowest total To highlight the degree maturation of grape
acidity was registered to Merlot variety. varieties under study I prepared the schedule of
Weight of 100 berries is an important ripening-indicating the weight evolution of
parameter in determining the optimum berries, accumulation of sugars and the reduce
date for harvesting grapes and it must of the acidity from grape Figure 1 to Figure 4.
reach the maximum. Both Cabernet
250,00
200,00
150,00
100,00
50,00
0,00
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Fetească Neagră (FN)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Fetească Neagră (FN)
Fetească Neagră (FN)
Fetească Neagră (FN)
Merlot (M)
Merlot (M)
Merlot (M)
Merlot (M)
24.08.2017 30.08.2017 07.09.2017 14.09.2017
Sugar content (g/L)
Figure 1. Graphical representation of grapes sugar content (g/l) from august-september 2017
82
0
1
2
3
4
5
6
7
8
0
100
120
140
160
20
40
60
80
Cabernet Sauvignon (CS)
Variety Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS) Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
24.08.2017
Merlot (M)
Cabernet Sauvignon (CS)
Fetească Neagră (FN)
Merlot (M)
24.08.2017
Fetească Neagră (FN) Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS) Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS) Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
30.08.2017
Merlot (M)
Merlot (M)
30.08.2017
Fetească Neagră (FN)
83
Fetească Neagră (FN)
Cabernet Sauvignon (CS) Cabernet Sauvignon (CS)
W 100 berries (g)
Cabernet Sauvignon (CS) Cabernet Sauvignon (CS)
Total Acidity (g/l H2SO4)
Cabernet Sauvignon (CS) Cabernet Sauvignon (CS)
Merlot (M)
07.09.2017
07.09.2017
Merlot (M)
Fetească Neagră (FN)
Fetească Neagră (FN)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS) Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS) Cabernet Sauvignon (CS)
Merlot (M)
14.09.2017
Cabernet Sauvignon (CS)
Fetească Neagră (FN)
14.09.2017
Merlot (M)
Figure 3. Graphical representation of grapes W 100 berries (g) from august-september 2017
Fetească Neagră (FN)
Figure 2. Graphical representation of grapes total acidity (g/l H2SO4) from august-september 2017
80,00
70,00
60,00
50,00
40,00
30,00
20,00
10,00
0,00
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Variety
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Fetească Neagră (FN)
Fetească Neagră (FN)
Fetească Neagră (FN)
Cabernet Sauvignon (CS)
Cabernet Sauvignon (CS)
Fetească Neagră (FN)
Merlot (M)
Merlot (M)
Merlot (M)
Merlot (M)
24.08.2017 30.08.2017 07.09.2017 14.09.2017
Glucoacidimetric Index
Figure 4. Graphical representation of grapes glucoacidimetric index from august-september 2017
Full maturation of the grapes (MF) is when the 2007) as we can see from the presented
grapes reached their maximum weight and measurements.
curve of evolution begins to descend; grape The grape berries mass during maturation is
sugar content is also the maximum (Figure 1) correlated with sugar accumulation, availability
and the curve of evolution of sugar remains of water in the soil and atmosphere, and the
stationary for a few days; total acidity decree- number of seeds. Smaller fruits ultimately
sed substantially (Figure 2) and evolutionary release larger quantities of minerals including
curve indicating a slow decrease acidity. potassium, calcium, and magnesium, which
In the full ripeness of the grapes the largest as greatly influence pH and total titratable acidity.
the maximum weight of the grapes is reached Smaller grapes berry also affect the organo-
(Figure 3). Any delay harvest thereafter leptic characteristics of the wine due to the
translates into loss of production (harvest). release of high quantities of tannins, which are
A combination of sugar and acid concentrations present in large concentrations in the seeds and
are generally used to determine whether the may turn the wine astringent (Conde et al.,
grapes have reached optimum ripeness (Falcao 2007).
et al., 2008). Environmental factors are impor-
tant to obtain high quality V. vinifera grapes for CONCLUSIONS
winemaking. The wine style that a region
produces is the result of the specific local Valea Călugărească vineyard centre belongs to
climate and soil characteristics. Climatic a temperate climate, with the most warm month
changes therefore have the potential to bring temperature (July) with more than 22ºC and a
about changes in wine styles (Falcao et al., maximum rainfall in early summer.
2008). Thermal regime is characterized by annual
Grape berries, like other berry fruits, undergo a average temperatures of 10.4-10.6ºC and a sum
complex series of physical and biochemical of active temperatures ranging between 3300-
changes during development (Deluc et al., 4040ºC.
84
Autumns are generally warm, dry and quite Deluc, G. L., Grimplet, J., Wheatley, D. M., Tillett, L.
lengthy, which allows carrying out in good R., Quilici, R. D., Osborne, C., Schooley, A. D.,
Schlauch, A. K., Cushman, C. J., Cramer, R. G.
conditions of the process of maturation of the (2007). Transcriptomic and metabolite analyses of
grapes and coloring substances accumulation in Cabernet Sauvignon grape berry development,
red wine varieties. http://www.biomedcentral.com/1471-2164/8/429.
Winters are relatively short, the average Falcao, D. L., Chaves, S. E., Burin, M. V., Falcao, P. A.,
temperature of the coldest month of stage Gris, F. E., Bonin, V., Bordignon-Luiz (2008).
Maturity of Cabernet Sauvignon berries from
(January) being -2.1ºC. Number of days that grapevines grown with two different training systems
records average temperatures more than 10ºC in a new grape growing region in Brazil, Cien. Inv.
varies between 175-226 days/year. Agr. 35(3): 321‒332.
Grapes varieties reach maturation stages Geana, I. E., Marinescu, A., Iordache, M. A., Sandru, C.,
according to their biological nature and the Ionete, E. R., Bala, C. (2014). Differentiation of
Romanian Wines on Geographical Origin and Wine
evolution of climate conditions of that year. Variety by Elemental Composition and Phenolic
Grape maturation has three main aspects: Components, Food Anal. Methods. doi:
technological maturation (refer to the 10.1007/s12161-014-9846-2.
accumulation of sugars in the grapes and to Geana, I., Iordache, A., Ionete, R., Marinescu, A., Ranca,
reduce acidity); phenolic ripeness refers to the A., Culea, M. (2013). Geographical origin
identification of Romanian wines by ICP-MS
accumulation of anthocyanins and tannins in elemental analysis. Food Chem., 138(2-3), 1125‒
grapes; aromatic maturation refers to the 1134.
accumulation of the primary grape flavors. Geana, I. E., Ionete, E. R., Tudorache, A., Pasa, R.,
Winemaker technologist who is interested in Postolache, E., Ranca, A. (2011). Phenolic Contents
obtaining good quality wines follows the of Romanian Wines with Different Geographical
Origins, Asian Journal of Chemistry, 23(12), 5197‒
evolution of ripening grapes, in order to 5201.
determine the best time to harvest. Gonzálvez, A., Llorens, A., Cervera, M. L., Armenta, S.,
In red grape varieties, the polyphenol de la Guardia, M. (2009). Elemental fingerprint of
composition can be perceived as the key wines from the protected designation of origin
element that significantly differentiates the Valencia. Food Chem., 112(1), 26‒34.
Kennedy, J. A., Troup, G. J., Pilbrow, J. R., Hutton, D.
final products, considering their specific agro- R., Hewitt, D., Hunter, C. R., Ristic, R., Iland, P. G.,
biological characteristics, in conjunction with Jones, G. P. (2000). Development of seed
the biosynthetic pathways of phenolics. polyphenols in berries from Vitis vinifera L. cv.
Therefore, the harvest stage, the temperature, Shiraz. Aust. J. Grape Wine Res., 6, 244‒254.
the duration of the maceration-fermentation Kharadze, M., Japaridze, I., Kalandia, A., Vanidze, M.,
(2018). Anthocyanins and antioxidant activity of red
process, and the winemaking technique are wines made from endemic grape varieties, Annals of
among the factors involved in the quality of the Agrarian Sciences. doi: 10.1016/j.aasci.2018.04.006.
resulting product (Palade & Popa, 2018). La Torre, G. L., Saitta, M., Vilasi, F., Pellicanὸ, T.,
Dugo, G. (2006). Direct determination of phenolic
REFERENCES compounds in Sicilian wines by liquid
chromatography with PDA and MS detection. Food
Chem., 94(4), 640‒650.
Casassa, F., Beaver, C. W., Mireles, M. S., Larsen, R. C., Lara, R., Cerutti, S., Salonia, J. A., Olsina, R. A.,
Hopfer, H., Heymann, H., Harbertson, J. F. (2013). Martinez, L. D. (2005). Trace element determination
Influence of fruit maturity, maceration length, and of Argentine wines using ETAAS and USNICP-OES.
ethanol amount on chemical and sensory properties Food Chem Toxicol., 43(2), 293‒297.
of Merlot wines. Am. J. Enol. Vitic., 64, 437‒449. Le Moigne, M., Symoneaux, R., Jourjon, F. (2008). How
Conde, C., Silva, P., Fontes, N., Dias, A. C. P., Tavares, to follow grape maturity for wine professionals with a
R. M., Sousa, M. J., Agasse, A., Delrot, S., Geros, H. seasonal judge training? Food Qual. Pref., 19, 672‒
(2007). Biochemical changes throughout grape berry 681.
development and fruit and wine quality. Food, 1(1), Mitic, M. N., Obradovic, M. V., Grahovac, Z. B.,
1‒22. Pavlovic, A. N. (2010). Antioxidant capacities and
Cuzmar, D. P., Salgado, E., Ribalta-Pizarro, C., Olaeta, phenolic levels of different varieties of Serbian white
A. J., Lopez, E., Pastenes, C., Caceres-Mella, A. wines. Molecules, 15(3), 2016‒2027.
(2018). Phenolic composition and sensory Palade, L. M., Popa, E. M. (2018). Polyphenol
characteristics of Cabernet Sauvignon wines: effect Fingerprinting Approaches in Wine Traceability and
of water stress and harvest date, International Authenticity: Assessment and Implications of Red
Journal of Food Science and Technology. Wines, Beverages 2018, 4(4), 75.
doi:10.1111/ijfs.13757.
85
Penso, A. G., Citadin, I., Castilho Maro, A. L., Scariotto, Ristic, R., Iland, P. (2005). Relationships between seed
S., Chicoki, A., Ambrosio, R. (2014). Study of the and berry development of Vitis vinifera L. cv. Shiraz.
maturation of grapes (Vitis vinifera L.) grown in Dois Developmental changes in seed morphology and
Vizinhos, Paraná, Semina: Ciências Agrárias, 35(6), phenolic composition. Aust. J. Grape Wine Res. 11,
3085-3098. doi: 10.5433/1679- 43‒58.
0359.2014v35n6p3085. Torchio, F., Giacosa, S., Río Segade, S., Mattivi, F.,
Ribereau-Gayon, P., Glories, Y., Maujean, A., Gerbi, V., Luca, R. (2012). Optimization of a method
Dubourdieu, D. (2006). Handbook of Enology, based on the simultaneous measurement of acoustic
Volume 2: The Chemistry of Wine Stabilization and and mechanical properties of winegrape seeds for the
Treatments, 2nd edn. New Jersey: John Wiley & Sons, determination of the ripening stage. J. Agr. Food
Ltd. Chem. 60, 9006‒9016.
86
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
IN VITRO RESEARCH ON THE INHIBITORY EFFECTS OF FENNEL,
SAGE AND SEABUCKTHORN ESSENTIAL OILS ON SOME FOOD
SPOILAGE FUNGI
Georgia OLARU, Elena Mona POPA
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mărăşti Blvd.,
District 1, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
Essential oils from natural plants are antimicrobial agents that can be used to control food spoilage and
pathogenic food; they have long been used as flavoring agents in beverages and food. The antimicrobial
activity of essential oils is attributed to a number of small terpenoids and phenolic compounds that provide
antifungal or antibacterial activity. The experimental research carried out in this work focus on the in vitro
study of the antimicrobial effect of fennel and sage essential oils on two food spoilage molds with the
evaluation of the minimal lethal concentration (MLC). The fungi used in experimental work were Aspergillus
niger and Penicillum expansum from Faculty of Biotechnologies collection. Minimum lethal concentrations
were determined using a modified disc diffusion method in agar after puncture the fungus in the center of the
Petri dishes. Sage and fennel essential oils proved to be the strongest antifungic agents, the minimum
volumes that inhibited the growth and development of two fungi ranging between 14 to 19 μL. Seabuckthorn
essential oil, even in higher doses of 250-300 μL, did not show antifungal activity.
Key words: sage oil, fennel oil, seabuckthorn oil, in vitro, modified microdiffusion method, in vitro antimicrobial
activity.
INTRODUCTION β-thujone constituents (Newall et al., 1996). S.
officinale seed oil has antimicrobial properties,
Different chemical and synthetic chemicals mainly attributed to the presence of tijons
have been used in the food industry as (Bradley, 2006; Newall et al., 1996).
antimicrobials to prevent the development of Fennel (Foeniculum vulgare Mill., Apiaceae) is
food microorganisms, but the current trend in a well known aromatic plant species. Mature
using preservatives has led to the use of fruits and essential oil of fennel are used as
essential oils. Essential oils (EO) have the flavoring agents in food products suchas
potential to prevent the development of micro- liqueurs, bread, pickle, pastries and cheeses.
organisms, which contribute to the degradation The essential oil of fennel are mainly
of food. Due to the composition of essential concentrated in the fruits and provide the
plant oils and their high antimicrobial extracts unique aroma and taste, they are composed of
and spectrum, associated with their low aroma of several monoterpenes and
toxicity, they are potential natural food phenylpropanoids. Trans-anethole, often is the
preservatives (Conner, 1993). most prevalent constituent, counts for the anise
The essential oil of S. officinalis comprises taste,fenechone provides the bitterness and
α- and β-t-butone monomers, camphor, estragole (methyl-chavicol) the sweetness.
1,8-cineol and borneol, and sometimes higher According to some studies esssential oil of
amounts of sesquiterpene, α-humulin and fennel and its seed extracts have been reported
β-cariopilin. Di- and triterpenes have been to have antimicrobial and anticonidic activity
found in leaves (Máthé et al., 2007), i.e. manol. (Abed, 2007).
There is a high chemical variability among Seabuckthorn is used as a functional food
S. officinalis essential oils, however, it can be ingredient - the beans are particularly rich in
generally argued that the predominant α- and vitamin C and flavonoids. Both soft parts (pulp
87
and bark) and seeds contain oil and high levels
of tocopherols and vegetal sterols (Kallio et al.,
2002). Sea buckthorn oil is characterized by a
unique fatty acid content compared to other
vegetable oils.
This oil contains rare palmitooleic acid
(omega-7) which is a component of skin lipids
and stimulates regenerative processes in the
epidermis and healing of wounds. Fig. 1. The distribution of Whatman filter
Seabuckthorn oil contains saturated fatty acids paper disks (Φ = 6 mm) impregnated
in the form of palmitic acid (30-33%), stearic with EO in the Petri plates
acid and has a wide range of essential
unsaturated fatty acids (UFA), especially so- Finally, 2 μl of spore suspension of each fungus
called PUFAs (polyunsaturated fatty acids); culture (the initial concentration is 106 ufc/ml)
these include alpha-linolenic acid (omega-3), was inoculated on culture medium in the center
gamma-linolenic acid (omega-6), linoleic acid of the plate. All determinations were performed
(omega-6), oleic acid (omega-9) and eicosanoic in three replicates and the results were
acid (omega-9). statistical analysed. The negative control were
The research have focused on the in vitro study performed with paper disks with ethanol, used
of the antimicrobial effect of fennel, sage and for EO extraction. Also, the positive control
seabuckthorn essential oils on two food were tested. The dishes were sealed with
spoilage molds (Aspergillus niger, Penicillium parafilm to prevent the evaporation of essential
expansum) with the evaluation of the minimal oils and incubated for 7 days at 25°C. The
lethal concentration (MLC). efficacy of the treatment was evaluated after 7
days of incubation by measuring the diameter
MATERIALS AND METHODS of the inhibition zone.
Antimicrobial agents and strains Minimum lethal concentration (MLC)
Three types of essential oils from Foeniculum determination
vulgare, Salvia officinalis and Hippophae Medium was inoculated with 2 μl spore
rhamnoides, purchased from the company suspension of strains Aspergillus niger or
Hofigal (Bucharest, Romania), were used to Penicillum expansum activated in PDA, to
carry out the experiments. Fungi Penicillum achieve a concentration of 106 spores/ml. Filter
expansum and Aspergillusniger were provided paper disks with different quantities of essential
from collection of Faculty of Biotechnologies, oils were placed on the surface of the medium.
University of Agronomic Sciences and The control sample consisted of a plate with
Veterinary Medicine of Bucharest, Romania. culture media without essential oils. All
The fungus cultures were prepared on PDA experiments were conducted in 3 replicates and
plate and incubated at 25°C for 7 days. results were statistical analysed. The plates
were incubated for 7 days at 25°C. The colony
Antifungal assay diameters of fungal species used in treatment
The antifungal activity of essential oils was and control samples were measured.
determined by modified disc diffusion method The minimum lethal concentration (MLC) was
on PDA and the medium was prepared defined as lowest concentration inhibiting
according to the instructions on the package. visible growth of the tested fungi as the
Subsequently, filter paper disks (6 mm Ø; samples were measured.
Whatman) were placed on the surface of Petri
dishes and impregnated with different RESULTS AND DISCUSSIONS
quantities of essential oils from 3 μl to 20 μl
(Figure 1). Antifungal activity of fennel, sage and
In case of seabuckthorn essential oil was used seabuckthorn essential oils was determined
higher doses of 250-300 μl. against two antifungal strains Aspergillus niger
and Penicillium expansum.
88
The obtained results showed that the diameter the experimental results, seabuckthorn oil has
of the colony growth is significantly depended no antifungal activity, at the same condition of
by the dose of EO and the fungal species tested incubation, microorganisms growing normally
(Figures 2 and 3). even at rates of 250-300 µl.
The rate of fungal inhibition is directly For Aspergillus niger at lower concentration
proportional to the concentration of tested EO. (3 µl) fennel EO is stronger than sage EO,
Result showed that sage and fennel oils have as the colony diameter (cm) decreased from
antifungal activity at 19 μl (MLC), after 7 days 7,3 cm for control group to 5,4 cm, while for
at a temperature of 25°C, against Apergillus sage EO decreased to 6,4 cm.
niger. In the same conditions, against the Also, we noticed that the 50% decrease of
development of Penicillum expansum the colony diameter compared to the control group
minimum lethal concentration (MLC) was was generated by 9 µl fennel EO for
14 μL for both fennel and sage EO. Following P. expansum and 6-7 µl for A. niger.
6,00
Colony Diameter (cm)
5,00
4,00
3,00
A.niger
2,00 P.expansum
1,00
0,00
3 5 8 9 11 13 14 16 18 19 20
Fennel EO concentration (µl)
Figure 2. Aspergillus niger and Penicillum expansum average colony diameter (cm) after 7 days
of incubation in PDA medium exposed fennel essential oils (EO)
Colony Diameter (cm)
8,00
6,00
4,00
2,00
0,00
3 5 8 9 11 13 14 15 16 17 18 19 20
A. niger P. expansum Sage EO concetration (µl)
Figure 3. Aspergillus niger and Penicillum expansum average colony diameter (cm) after 7 days
of incubation in PDA medium exposed sage essential oils (EO)
The investigation of the antimicrobial activity while seabuckthorn EO even in higher doses do
of the tested natural essential oils showed that not has antifungal activity (Table 1).
only sage and fennel EO have antifungal effects
89
Table 1. Aspergillus niger and Penicillum expansum colony diameter (cm) after 7 days of incubation
in PDA medium exposed seabuckthorn essential oil
Control group
Concentration Standard
Colony Colony Diameter
Essential oil Fungal strains essential oils deviation
diameter (cm)/ day 7
(μl) (SD)
cm/day
Seabuckthorn Aspergillus niger 7.5 250 7.2 ± 0.51
300 6.7 ± 0.15
Penicillum expansum 3.5 250 3.4 ± 0.12
300 3.1 ± 0.06
CONCLUSIONS Labra, M., Miele, M., Ledda, B., Grassi, F., Mazzei, M.,
Sala, F. (2004). Morphological characterization,
essentials oils composition and DNA genotyping of
The research showed that two types of essential Ocimum basilicum L. cultivars. Plant Science, 167,
oils (fennel and sage EO) inhibited the growth 725‒731. doi:10.1016/j.plansci.2004.04.026.
of the tested fungi, while in the presence of Machinski, Jr. M. (2015). Antifungal activity and
seabuckthorn oil fungi developed normally and inhibition of fumonisin production by Rosmarinus
even in high doses 250-300 µl seabuckthorn officinalis L. essential oil in Fusarium verticillioides
(Sacc.) Nirenberg, Food Chemistry, 166, 330‒336.
EO has not antifungal effects. Also, the results Mahilrajan, S., Nandakumar, J., Kailayalingam, R.,
of this study showed that the tested oils, sage Monoharan, N. A., Srivijeindran, S. (2014).
and respectively fennel EO, have a different Screening the antifungal activity of essential oils
pattern of action in their antifungal activity. against decay fungi from palmyrah leaf handicrafts.
Both, sage and fennel essential oils, can be Biological Research 47, 35.
Moreira M. R., Ponce A. G., del Valle C. E., Roura S. I.
used as natural antifungal agents. (2005). Inhibitory parameters of essential oils to
reduce a foodborne pathogen. LWT, 38, 565‒570.
REFERENCES Newall, C. A., Anderson, L. A., Phillipson, J. D. (1996).
Herbal Medicines: A Guide for Healthcare
Akgül, A. (1989). Antimicrobial activity of black cumin Professionals. London: Pharmaceutical Press.
(Nigella sativa L.) essential oil. Gazi J. Faculty Özcan, M., Boyraz, N. (2000). Antifungal properties of
Pharmacol, 6, 63‒68. some herb decoctions. Eur Food Res Technol., 212,
Campanniello, D., Corbo, M. R., Sinigaglia, M. (2010). 86‒88.
Antifungal activity of eugenol against Penicillium, Prakash, B., Singh, P., Kedia, A., Dubey, N. K., 2012.
Aspergillus and Fusarium species, Journal of Food Assessment of some essential oils as food
Protection, 73(6), 1124‒1128. preservatives based on antifungal, antiaflatoxin,
Carlone, N. A. (2007). Antifungal activity of essential antioxidant activities and in vivo efficacy in food
oils against filamentous fungi determined by broth system, Food Research International 49, 201‒208.
microdilution and vapour contact methods. Journal of Tullio, V., Nostro, A., Mandras, N., Dugo, P., Banche,
Applied Microbiology, 102, 1544‒1550. G., Cannatelli, M.A., Cuffini, A.M., Alonzo, V.,
Conner, D. E. (1993). Naturally occurring compounds. Samson R.A., Hoekstra E.S., Frisvad J.C., Filtenborg
In: Davidison P.M., Branen A.L., editors. O. (1996). Introduction to food - borne fungi.
Antimicrobials in Foods (pp. 441‒468.). New York, Cantraalbureau voor Schimmelcultures. 5th ed. Baarn.
NY, USA: Marcel Dekker. Pruesse, U., Vorlop K. D., The JetCutter Technology
Demyttenaere, J. C. R., Willemen, H. M., Herrena, M. (2004). Fundamentals of Cell Immobilisation
C., Verhe, R. (1997). Antifungal properties of Biotechnology. Focus on Biotechnology Series, Vol.
essential oil components. In: Proceedings of the 28th 8A, edited by V. Nedovic and R. Willaert, Kluwer
ISEO (International Symposium on Essential Oils): Academic Publishers, Dordrecht.
1-3 September 1997. Eskis¸ehir, Turkey, pp. 9. Yang, B., Kallio, H. (2002). Composition and
Kordali, S., Kotan, R., Mavi, A., Cakir, A., Ala, A., physiological effects of sea buckthorn (Hippophae)
Yildirim, A. (2005). Determination of the chemical lipids. Trends Food Sci Technol., 13, 160‒167.
composition and antioxidant activity of the essential Saharkhiz, M. J., Tarakemeh, A. (2013). Essential Oil
oil of Artemisia dracunculus and of the antifungal Content and Composition of Fennel (Foeniculum
and antibacterial activities of Turkish Artemisia vulgare L.) Fruits at Different Stages of
absinthium, Artemisia dracunculus, Artemisia Development, Journal of essential oil-bearing plants
santonicum, Artemisia spicigera essential oils. JEOP, 14(5). https://www.researchgate.net/
Journal of Agricultural and Food Chemistry, 53, publication/261583103.
9452‒9458.
90
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
HEAVY METALS AND PHYSICO-CHEMICAL COMPOSITION OF
MATERNAL BREAST MILK AND COLOSTRUM
Igori BALTA, Dragoș OLA, Roxana FILIP, Ana Maria PUI, Renata SALANTAI,
Mihai COTÎRȚĂ, Ioan ȚÂNTEA, Adina Lia LONGODOR,
Zamfir MARCHIŞ, Aurelia COROIAN
University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca,
Faculty of Animal Science and Biotechnology, 3-5 Mănăştur Str., 400372, Cluj-Napoca, Romania
Corresponding author email: [email protected]
Abstract
Mother's milk is a very valuable food for newborns, providing all the nutrients necessary for children's health.
Colostrum is an important source of biologically active natural components and due to antimicrobial agents, can
reduce gastrointestinal infections in newborns. Physical and chemical parameters were analyzed from maternal breast
milk and colostrum for five days. The fat content of the colostrum shows the lowest values in the first postpartum days,
after which it increases, reaching the highest values on day 5. Heavy metals in colostrum and mother's milk were
evaluated considering their area of origin and all the samples were positive regarding Al, Pb, Rb, Sr, Cr. The variation
in the metal concentration in maternal breast milk and colostrum could be due to their geographical origin and
furtherly can affect the quality of milk.
Key words: Breast milk, colostrum, heavy metals, physico-chemical composition.
INTRODUCTION food chain. It is observed that the human body,
the last key point of the trophic chain retains
Breast milk is an important nutritional source the highest concentrations of heavy metals due
for the growth and development of newborns, to the bioaccumulation effect (Vinodhini &
an extremely complex and highly variable Narayanan 2008). Lead is a heavy metal natu-
biofluid that has evolved over millennia to rally occurring in the earth crust and has
nourish infants and protect them from disease nobeneficial impact on living organisms.
whilst, their own immune system matures Bioaccumulation of Pb arise in maternal bones,
(Fujita et al., 2012). lately being released along with calcium
Colostrum contains a wide range of biolo- intoher blood,and subsequently providingits
gically active substances, including immuno- pathway into breast milk.
globulins, hormones, growth factors and at Mercury is a toxic metal, ubiquitous in nature,
least 60 enzymes, ensuring immunological and is secreted in the breast milk from exposed
anti-inflammatory properties against many mothers and may affect infant neuro-
diseases.In this century toxic heavy metals development (Johnson et al., 2009; Evers et al.,
represent a major source of the ever-increasing 2005; Wu et al., 1991).
problem of environmental pollution. Of these, The development of cadmium (Cd) toxicity is
lead (Pb), mercury (Hg), cadmium (Cd), zinc known to be related to zinc (Zn) and copper
(Zn), copper (Cu) and iron (Fe) are the most (Cu) accumulation in the liver, kidney of
common toxic heavy metals that can be present animals (Sato & Nagai, 1989; Liu et al., 1992,
in the human milk, exhibiting harmful impact 1994) and humans (Nordberg, 2004; Godt,
for the human body.When these elements arrive 2006). During the lactation period, Cd is
in the main feed sources, they can easily spread transported from maternal plasma to mammary
to all food chains, thus affecting the entire food gland and secreted into breast milk together
chain. with Cu and Zn (Sower et al., 1993; Kalkwarf
Besides this aspect, another risk is bioaccu- et al., 1999).
mulation of heavy metals in living organisms Zinc is an essential trace element that has a
which are considered primary elements of the complex biological role, playing the main
91
function in the activation of numerous enzy- MATERIALS AND METHODS
matic systems that can regulate and degrade
pituitary hormones of appetite (Shay & Sampling
Mangian, 2000). Twenty milliliters of breast milk and colostrum
Copper is a chemical element, soft, malleable, samples were collected aseptically from each
and ductile metal with high thermal and lactating mother using sterile breast pumps, in
electrical conductivity. Deficiency of Cu, as sterile containers and stored at 4ºC until
well as toxicity, may present a concern for analyzes were performed. The samples were
children, although precise copper concen- collected from Romanian localities such as:
trations have not been established yet for this Cluj, Sălaj, Bistrița-Năsăud, Turda, Baia-Mare,
age group (Lönnerdal, 1998). Satu-Mare, Târgu-Mureș, Cehu Silvaniei and
Iron is the most common element on Earth, Carei.
mainly forming Earth's outer and inner core. It
is the fourth most common element estimated Characteristics of the Lactating Mothers
in the Earth's crust. Being a key factor, some of In the present study analyzed colostrum and
the bacteriostatic properties of human milk are milk samples were collected from a total of 45
associated with levels and/or bioavailability of women (N = 5) per locality. Colostrum samples
this element in breast milk (Rowland et al., were obtained from day 1 to day 5 after
1980). postpartum. After three months, milk samples
Breast milk influences the intestinal microflora were harvested from the same mothers. The
ensures the structural and functional maturity average age of the mothers was ranged between
of mucous membranes, reduces the risk of 25-30 years. Healthy mothers were included in
allergies and autoimmune disorders, and the study, mothers suffering from any illnesses
contributes to the proper development of the or infections were excluded from the present
gastrointestinal, central nervous, endocrine and study. They did not smoke or drink alcohol and
immune systems (Leon-Cava et al., 2002). Due coffee during pregnancy and breastfeeding
to the fact that heavy metals and trace elements period.
are found in low concentrations in milk sam-
ples, ICP-MS is a suitable and precise analy- Physico-chemical analysis
tical technique. In addition, the acid digestion Lactoscan (Milk analyzer Lactoscan) device
assay has been considered to show the best was used for physico-chemical analysis. A
results in sample preparation (Huynh et al., method previously reported by (Marchis et al.,
2015; Dico et al., 2015). Therefore, the aims of 2018). The following % of parameters were
this study were to evaluate the heavy metal determined: fat, protein and lactose. A number
profile and physicochemical composition of of 5 samples were used for each locality.
maternal breast milk and colostrum depending
on the reference region. In Cluj, Sălaj, Bistrița- Chemicals
Năsăud, Turda, Baia-Mare, Satu-Mare, Târgu- The chemicals from the present work were of
Mureș, Cehu Silvaniei and Carei no published analytical reagent grade. Hydrochloric acid
study has evaluated the levels of heavy metals fuming HCl 37% (Merk, Germany), nitric acid
in breast milk and colostrum. Considering the HNO3 65% (Merk, Germany), ultrapure water,
toxic potential of these compounds and the Milli-Q (Millipore, Bedford, MA, USA),
importance of milk for children development, Hydrogen peroxide H2O2 30% (Merk,
as a source of protein, fats and other essential Germany), and ICP multi-element standard
nutrients we analyzed the physicochemical solution 1000 mg/l (Merk, Darmstadt,
parameters to determine the influence of Germany).
postpartum on protein; fat; lactose content of
milk from the mothers used in that study. Quality Assurance
Moreover, the aim was to observe the For the quantitative determination of the
differences between these parameters in both desired elements, the external calibration
milk and colostrum samples and if high-fat method was performed. With the help of
content influences heavy metals assimilation. interpolation, the concentration of the analyte
in the unknown sample can be easily deter-
92
mined. Therefore, calibrations were performed obtained from different regions of Romania.
with multi-element standard solutions (Merk, Heavy metals and essential mineral concen-
Darmstadt, Germany) at different concentration trations from different regions of Romania are
levels and then the calibration curves were described in Table1 and Table 2. Values
drawn. represent the average of concentrations ±
standard deviation.
Mineralization of samples
Heavy metals determination was based on an Table1. Essential mineral concentrations from breast milk
assay previously reported by Coroian et al.,
Average ±s.d. (mg/l)
(2017). Milk and colostral samples were Area/metal
Na Mg Ca Fe
subjected to microwave digestion with 8 ml Cluj 178.79±2.39 36.57±0.74 640.98±2.47 1.76±0.05
Nitric acid (65% HNO3) and 2 ml Hydrogen Sălaj 147.18±3.20 29.08±0.71 614.63±2.50 0.71±0.02
Bistrița-
peroxide (30% H2O2). The milk samples were Năsăud
71.22±2.83 30.33±1.07 590.88±2.55 0.85±0.04
digested according to the following program: Turda 158.86±0.93 32.09±0.74 608.94±2.63 0.91±0.01
Baia-Mare 178.07±2.27 25.53±0.51 578.00±4.71 1.20±0.02
(i) temperature 145°C, pressure 30 (bar), ramp Satu-Mare 188.26±2.41 37.71±0.82 555.66±3.85 1.09±0.02
time 5 min, hold time 15 min; (ii) temperature Târgu-
181.03±3.05 40.36±0.57 380.98±5.98 0.91±0.02
180°C, pressure 30 (bar), ramp time 1 min, Mureș
Cehu
hold time 10 min; (iii) temperature 120°C, Silvaniei
157.54±3.75 34.25±0.90 479.90±2.12 1.07±0.03
pressure 30 (bar), ramp time 1 min, hold time Carei 166.79±3.29 35.37±0.87 636.78±3.39 1.07±0.01
15 min; (iv) temperature 100°C, pressure 0
(bar), ramp time 1 min, hold time 10 min. The highest Na counts from breast milk where
Digested samples were allowed to cool to observed in the samples from Satu-Mare
ambient temperature, transferred to polypro- (188.26±2.41) following in descending order
pylene tubes and diluted to 25 ml of ultrapure by > Târgu-Mureș (181.03±3.05) and Cluj
water. The samples were filtered through a 0.45 (178.79±2.39) > Baia-Mare (178.07±2.27) >
μm cellulose membrane filter. Simultaneously, Carei (166.79±3.29) > Turda (158.86±0.93) >
blank samples were prepared. Cehu Silvaniei (157.54±3.75) > Sălaj
(147.18±3.20) and Bistrița-Năsăud
Determination of minerals and heavy metals (71.22±2.83) mg/l, respectively. Magnesium
For determination of heavy metals from levels from samples acquired from Târgu-
colostrum and milk samples a number of 5 Mureș presented elevated values compared
samples were used for each locality. Determi- with another regions. Altun et al. (2018) using
nation of minerals and heavy metals from milk ICP-MS noticed higher values of sodium
and colostrum samples was evaluated by compared with our results and the values
inductively coupled plasma mass spectrometry ranged between (44.7-1703) mg/l in breast milk
or ICP-MS used for the identification and samples from Turkey. According to Björklund
quantification of Cr, Fe, Cu, Na, Mg, Cu, Al, et al. 2012 Na presented increased concen-
Pb, Rb, Sr, and Zn elements at a concentration tration 217±77 mg/l compared to our results.
level of mg/L or higher concentrations by the Similar concentrations of Mg was found in the
appropriate dilution of the sample. Determi- milk from Satu-Mare (37.71±0.82), Cluj
nation of Pb, Zn, Cu, Fe and Cr traces was (36.57±0.74), Carei (35.37±0.87) and Cehu
determined according to SR EN 14082: 2003; Silvaniei (34.25±0.90). Our results are in line
LOD - 0.05 mg/l; LOQ -0.1 mg/L. As equip- with those reported by Altun et al. (2018) and
ment was used in that study Digestor Berghoff Björklund et al. (2012) with the Mg mean
MWS-3+ Microwave (Eningen, Germany) was values of 32.6±15.5 and 28±4.8 mg/l. The most
used followed by ICP-MS ELAN DRC II decreased values of magnesium parameter
Perkin-Elmer. resulted in Baia-Mare (25.53±0.51) and Sălaj
(29.08±0.71) mg/l samples.
RESULTS AND DISCUSSIONS One of the most important mineral for skeletal
system development and namely calcium
Maternal breast milk samples were analyzed presented high values in the area of Cluj
for seven heavy metals, Pb, Rb, Cr, Zn, Sr, Cu, (640.98±2.47) followed by Carei (636.78±3.39)
Al and four trace elements, Na, Mg, Ca and Fe > Sălaj (614.63±2.50) > Turda (608.94±2.63) >
93
Bistrița-Năsăud (590.88±2.55) > Baia-Mare in samples from Baia-Mare (1.20±0.02), Satu-
(578.00±4.71) > Satu-Mare (555.66±3.85) > Mare (1.09±0.02), Cehu Silvaniei (1.07±0.03)
Cehu Silvaniei (479.90±2.12) and Târgu-Mureș and Carei (1.07±0.01). In addition, iron content
(380.98±5.98), mg/l, respectively. Ca levels from Târgu-Mureș (0.91±0.02) and Turda
from Swedish and Turkish mother milk de- (0.91±0.01) specimens demonstrated a simi-
monstrated lesser concentrations compared to larity between values. Moreover, minimal con-
our results, between 305±45 and 193±53.2 centration of Fe was observed in samples from
mg/l, respectively (Altun et al., 2018; Sălaj (0.71±0.02) and Bistrița-Năsăud
Björklund et al., 2012). Iron is a transition (0.85±0.04), mg/l. Futhermore, resulted Fe
metal, playing an important key-role in human values in breast milk are higher than concen-
metabolism and is responsible for oxygen trations reported in studies from Australia
transport and oxygen storage in the muscular (Mohd-Taufek et al., 2016), Sweeden
system. Fe showed increased concentrations in (Björklund et al., 2012), and Turkey (Altun et
maternal breast milk from Cluj (1.76±0.05) and al., 2018), 47±99, 339±134 μg/l and 1.65±1.43
similar values among the samples were found mg/l, respectively.
Table 2. Heavy metals concentrations from maternal milk samples
Area Average ±s.d. (mg/l)
Pb Rb Cr Sr Cu Zn Al
Cluj 0.04±0.01 1.03±0.04 0.30±0.01 0.22±0.03 0.97±0.08 1.56±0.03 1.87±0.12
Sălaj 0.08±0.00 0.90±0.02 0.41±0.02 0.27±0.02 1.87±0.06 1.33±0.03 2.20±0.15
Bistrița-Năsăud 0.01±0.00 1.09±0.01 0.20±0.01 0.28±0.03 0.05±0.01 0.18±0.03 1.61±0.18
Turda 0.03±0.01 1.12±0.01 0.57±0.02 0.45±0.03 0.64±0.16 0.86±0.03 2.93±0.28
Baia-Mare 0.05±0.01 1.13±0.02 0.76±0.03 0.56±0.03 2.87±0.08 1.13±0.03 4.97±0.05
Satu-Mare 0.06±0.01 1.16±0.02 0.80±0.01 0.50±0.02 1.24±0.09 1.33±0.06 5.79±0.20
Târgu-Mureș 0.03±0.14 1.15±0.03 0.88±0.03 0.38±0.01 2.25±0.11 1.53±0.03 4.03±0.06
CehuSilvaniei 0.02±0.01 1.00±0.08 0.36±0.01 0.39±0.01 0.59±0.08 0.95±0.03 3.97±0.23
Carei 0.09±0.02 1.20±0.04 0.60±0.01 0.40±0.01 1.08±0.10 1.05±0.03 4.02±0.06
From the detected concentrations of toxic ranged between (0.45 and 22.36) ng/ml. Rb did
heavy metals, lead was found in relative not present significant variations among the
reduced amounts in breast maternal milk samples and comprise the values in ranged
samples compared among other metals. The between 0.90-1.20 mg/l. Values of Rb were
highest concentration of Pb mg/l was identified reported in a study of Björklund et al. (2012)
in maternal milk from Carei (0.09±0.02) showed decreased concentrations (714±108
followed by reduced amounts in the areas of > µg/l) of Rb compared to those obtained by us.
Sălaj (0.08±0.00) and > Satu-Mare (0.06±0.01) Cr levels of breast milk varied between 0.88
> Baia-Mare (0.05±0.01) > Cluj (0.04±0.01) > and 0.20 mg/l. Recommended Cr intakes in
Târgu-Mureș (0.03±0.14) > Turda (0.03±0.01) maternal breast milk for infants aged from < 6
> Cehu Silvaniei (0.02±0.01) > Bistrița Năsăud months should comprise doses ranged from 10-
(0.01±0.00), respectively. According to World 40 μg (Anderson, 1998). Elevated amounts of
Health Organisation, the acceptable Pb chromium were find areas such as Târgu-
concentrations in breast milk are reported to Mureș (0.88±0.03) and Satu-Mare (0.80±0.01)
reach values between 2 and 5 ng/g (Choi et al., and the most reduced in samples from Bistrița-
2008). Swedish maternal breast milk samples Năsăud (0.20±0.01) and Cluj (0.30±0.01)
demonstrated reduced levels of Pb (1.5±90 (mg/l). In contrast to our result, Cr was find in
µg/l) compared to ours. Chao et al. (2014) lower concentrations in the samples analyzed
findings showed that Pb levels varied between by Björklund et al. (2012) with a mean of
different lactation stages indicating values 0.30±0.27 µg/l. Maternal breast milk strontium
94
concentrations values resulted between 0.22 samples are reported by various authors
and 0.56 mg/l. Lowest Sr content was detected (Mohd-Taufek et al., 2016; Björklund et al.,
in Cluj (0.22±0.03) followed by Sălaj 2012; Altun et al., 2018).
(0.27±0.02) and Bistrița-Năsăud (0.28±0.03). The results regarding Zn concentrations are in
Lower levels of Sr from human milk samples concordance with Taufek et al. (2016) that
are reported in Swedish mother milk specimens obtained similar concentrations of this element
comprising means of 33±12 µg/l. in milks samples (1390±211 µg/l). Slightly
However, increased Sr numbers were detected elevations of Zn are presented in the study of
in Baia-Mare (0.56±0.03) followed by a slight Björklund et al. (2012) and Altun et al. (2018)
decrease in Satu-Mare (0.50±0.02)>Turda with the means of 3471±979 µg/l and
(0.45±0.03) > Cehu Silvaniei (0.39±0.01) > 2.89±3.23 mg/l. According to the study of Levi
Târgu-Mureș (0.38±0.01) > Bistrița-Năsăud et al. (2018) milk obtained from Argentina
(0.28±0.03) > Sălaj (0.27±0.02) > and Cluj mothers was subjected to acid digestion
(0.22±0.03) (mg/l), respectively. Copper plays through ICP-MS showing median means for
an important role in the processes of heme and elements such as Na, Mg, Ca, Zn as follows
hemoglobin biosynthesis. Therefore, its defi- 139/101 (28-1360), 31/30 (15-52), 247/246
ciency as well as iron can cause anemia. Zinc (151-370) and 1.7/1.4 (0.17-7.9) (ng/g),
stimulates the hormonal activity of the pituitary respectively.
gland contributing to the normal development Predominantly high concentrations of Al were
of the body increasing its weight. detected in samples from Satu-Mare
However, deficiency of this trace element leads (5.79±0.20), Baia-Mare (4.97±0.05), Târgu-
to growth retardation and weight loss. Greatly Mureș (4.03±0.06) and Carei (4.02±0.06).
increased copper values were noticed in the Aluminum is exerting nephrotoxic and
samples from Baia-Mare (2.87±0.08) and hepatotoxic potential at low concentrations
Târgu-Mureș (2.25±0.11). Intermediate values leading to poisoning in children and adults
were indicated for areas such as Sălaj Chao et al. (2014). Average concentrations of
(1.87±0.06) and Satu-Mare (1.24±0.09) aluminum were noticed in breast milk from
followed by decreased concentrations in Carei Cehu Silvaniei (3.97±0.23), Turda (2.93±0.28)
(1.08±0.10) > Cluj (0.97±0.08) > Turda and Sălaj (2.20±0.15) (mg/l), respectively. The
(0.64±0.16) > Cehu Silvaniei (0.59±0.08) and lowest values for that parameter was registred
Bistrița-Năsăud (0.05±0.01) (mg/l), with the in Bistrița-Năsăud (1.61±0.18) and Cluj
minimal amount of Cu. Copper concentrations samples (1.87±0.12) (mg/l), respectively.
from the present study are higher compared to Aluminum and lead are heavy metals with
results reported by others (Mohd-Taufek et al., neurotoxic potential, and are responsible to
2016; Björklund et al., 2012; Altun et al., induce nervous system disorders in children
2018). Specimens from the region Cehu Rebelo and Caldas (2016). Further, lesser
Silvaniei exhibit similar concentrations of Cu concentrations are reported in maternal breast
(0.59±0.08) compared to the region of milk specimens from Swedish healthy mothers
Şanlıurfa from Turkey (0.54±0.46), mg/l. with a mean of 185±584 μg/l.
According to European Union Scientific Food Cadmium, lead, aluminum, and copper are
Committee, the recommended doses of Cu and heavy metals presenting mainly negative
Zn for 6-11 month children are 0.3 mg/d and impact on the development of biological
4.0 mg/d, respectively (Mandic et al., 1996). organisms, and according to governmental
Another important mineral indicator, zinc, was regulations, the limits of these elements in food
detected in predominant concentrations in should be restricted. Contamination of breast
samples from Cluj (1.56±0.03) and Târgu- milk with heavy metals from Lebanon showed
Mureș (1.53±0.03) (mg/l). Sălaj and Satu-Mare different loads of arsenic (2.36±1.95),
Zn values revealed a similarity among cadmium (0.87±1.18) and lead (18.17±13.31)
concentrations (1.33±0.03), (1.33±0.06), (μg/l) (Bassil et al., 2018).
respectively. Decreased Zn values were found Concentrations of Na, Mg and Ca from
in Bistrița-Năsăud (0.18±0.03) milk samples. colostrum are represented in Figure 1. Sodium
Cu and Zn concentrations from human milk concentration from maternal colostrum varied
95
between 142.7 and 189.2 mg/l. Bistrița-Năsăud same region (71.22 mg/l). Calcium values from
concentrations demonstrated the lowest Na maternal colostrum were in the range of 521.3-
content (88.56 mg/l) compare to samples from 632.1 mg/l. Baia-Mare and Târgu-Mureș
other regions. Additionally, a similar fact was samples revealed the highest content of Ca.
observed in our breast milk samples from the
700 621,3
612,01 609,01 608,03 632,1 591,6
575,9 559,7
600 521,3
500
400
300 179,01
185,3 189,2
162,08 158,9 157,2 168,1
200 142,7
88,56
100 28,4 25,8 27,5 32,1 25,03 36,8 42,1 37,3 36,2
Na Mg Ca
Figure 1. Values for essetial minerals obtained from colostrum depending on the reference region
Interestingly, by using ICP-MS, our study higher in colostrum compared to breast milk
revealed elevated calcium contents from samples, a similar characteristic remarked in a
maternal milk samples and colostrum and that study of Chao et al. (2014). Lead concen-
may be attributed due to Romanian cultural trations in Croatian (non-smoker) transitional
gastronomy consisted of different traditional milk was 3.4 μg/kg dry matter; mature milk
types of cheeses and other dairy products. showed lower values of 2.6 and colostrum Pb
Magnesium from colostral specimens presented concentrations were predominant, 5.0 μg/kg
values in the range between 25.03 and 42.1 dry matter, respectively (Letinić et al., 2016).
mg/l. Moreover, increased numbers were Suciu et al. (2008) results denoted that Câmpia
registered in the colostrum samples obtained Turzii (Turda) region is considered least
from Târgu-Mureș and the lowest in the region contaminated area showing Cu, Cr, Pb, values
of Baia-Mare. These results can be correlated varying from 15.70 to 63.20 ppm, 20.70 to
with Mg concentrations that were acquired 62.40 ppm and 27.00 to 868.60 ppm,
from maternal breast milk samples with the
respectively. Rb and Cr in mother colostrum
similar values in a range 25.53 and 40.36 mg/l, samples collected from different regions of
respectively.
Romania presented levels ranged between 0.83-
Figure 2 indicates the content of heavy metals, 1.36 and 0.26-1.02 mg/l, respectively. Highest
Pb, Rb, Cr, Sr, Cu, Zn Al, and Fe from rubidium concentrations detected in colostrum
maternal colostrum depending on the reference were noticed in Turda samples, and chromium
region. From the analyzed heavy metals from increased concentrations are attributed to Sălaj
colostrum, lead being the most toxic was in the samples. The excessive level of Sr among all
range of 0.01-0.09 mg/l. Pb values in colostrum samples was 0.66 mg/l, identified in colostrum
from Cluj indicated lowest concentration. from Baia-Mare. Instead, the lowest and the
However, samples from other areas exhibit highest concentrations of Cu from the studied
elevated concentrations of Pb. Hence, Pb localities were observed in Bistrița-Năsăud
concentration from the present study was 0.03 mg/kg and Baia-Mare 2.83 mg/kg
96
[VALUE]
6,5
5,66
6
5,02
5,5 5,09
2,83
5
4,21
4,5 1,06
4 1,02 2,06 2,48
1,47 2,83
3,5 1,03
1,32 1,42 1,39 0,97 1,66 1,54 1,08
3 1,55
1,36 1,94
1,84 1,01 0,91 0,91
2,5 0.09 0,89 0,55
0,55 1,02 0,87 0,03 1,22 1,15
0,83 0,35
2 1,54 0,85
0,58 0,98 1,24 0,63 1,08 1,18 0,94
0,95 1,31
1,5
1,04 0,43 0,53 0,66 0,47 1,03 0,39
1 0,55
0,5 0.01 0.08 0.09 0.07 0.08 0.09 0.09
0.09 0.08
0
Pb Rb Cr Sr Cu Zn Al Fe
Figure 2. Heavy metal concentrations obtained from colostrum depending on the reference region
Rodna (Bistrița-Năsăud) samples from mining area is highly polluted by heavy metals. Baia-
area soil presented Cu variations among the Mare is considered polluted due to processing
means from 8.5 to 108 mg/kg and Pb 3.5-4712 wastes from non-metallic ores and anthro-
mg/kg (Nimirceag, 2012). Interestingly, >90% pogenic activities such as Pb, Zn and Cu
of samples had increased lead concentrations refineries Damian et al. (2008). Lowest values
above the normal values. Concentrations of Zn of Al mg/l are represented in Cluj (1.02) and
in the samples with the highest concentration Bistrița-Năsăud (1.06) colostral specimens.
was 1.58 (Satu-Mare), followed in order by Iron concentration in colostrum was not much
reduced concentrations in Baia-Mare (1.55) different among the samples and was between
>Târgu-Mureș (1.54) > Turda (1.47) > Sălaj the level of 0.87 and 1.57 mg/l. In both types of
(1.42) > Bistriţa-Năsăud (1.39) > Cluj (1.32) samples, predominant Fe values were detected
>Carei (1.08) and Cehu Silvaniei (1.03) mg/l, in Cluj. On another hand, decreased amounts in
respectively. In a Ph.D. thesis reported soil either sample were observed in Sălaj region.
samples from Zlatna (central Transilvania) Heavy metal content measurements obtained
locality showed numerical variations for Pb from Rovinari (South-West of Romania) soil
(160.5-563), Cd (0.94-3.28), Cu (111-446.5) samples between 2009 and 2010 presented
and Zn (84-576.5) (mg/kg) (Buzgău, 2013). values for copper depending on sampling
According to Geana et al. (2011) study, Cr depths varied from 11.4 to 157.4 mg/kg. Most
concentrations from soil samples of Sălaj elevated Cu concentration was 157.4 mg/kg,
showed means of 16.36 and for Cluj-Tarnita being over the alert threshold. Soil zinc
area 83.41 mg/kg. Zinc amounts for Sălaj concentrations presented differences in 2009
samples presented values of 22.2 and 150.44 between 38.6 and 118.4 and for 2010 values
mg/kg for Cluj-Tarnita locality. Moreover, for from 25.8 to 91.8 mg/kg. Regarding Pb, in
either locality Pb varied between 1.44 and 9.88 2009 the values ranged from 3.2 to 20.8 and for
mg/kg. We found that aluminum concentrations 2010 the means were 4.4 to 11.0 mg/kg.
were the highest in colostrum from Târgu- Figure 3 indicates means ± standard deviation,
Mureș (6.12) followed by Baia-Mare (5.66). for fat content analyzed from mother colostrum
Senila et al. (2011) remarked that Baia-Mare during the days 1-5.
97
7
6 4,11 4,49 4,03 4,06 4,61 4,12 4,49 4,3 3,98
3,68 4,02
3,74 3,75 3,94 3,93 3,94 4,02 3,78
5 3,77
3,96 3,73 3,08 3,16 3,75
3,57 3,04 3,11
4 2,95 2,93
3,16 2,06
2,58 3,55 3,61 3,07 3,72
3,05 3,26
2,94 1,81 3,22 3,03 3,07
2,11 2,8
3
0
Cluj Sălaj Bistriţa-Năsăud Turda Baia-Mare Satu-Mare Târgu-Mureş Cehu Silvaniei Carei
1st day 2nd day 3rd day 4th day 5th day
Figure 3. Fat content from maternal colostrum depending on the region
The fat content varied between 3.046±0.06 Lactose content evaluated from mother
for the 1st day (Sălaj) and 4.49±0.22 g/100 ml colostrum during the days 1-5 is shown in
for 5th day, postpartum period. Figure 4. The lactose content is influenced by
It can be noticed that regardless of the sam- the colostral period, a physiological pheno-
pling area, the fat content shows the lowest menon reported by Shi et al. (2011) that
mean values on day 1 (2.80-3.26), after which observes the highest lactose levels during the
this parameter gradually increases reaching colostral period and decreases in transitional
the highest values on day 4 (3.68-4.02) and milk and reaching the lowest values in mature
day 5 postpartum (3.98-4.61) g/100 ml. milk. Proteins and lipids are behaving in a
The fat content for the colostrum period is similar way.
within the characteristic values for the Protein content obtained from maternal
postpartum period. colostrum during the days 1-5 is depicted in
Figure 5.
9
6,19 6,23 6,1 6,3 6,27 6,26 6,33 6,28
6,07
8 5,76 6,12
5,73 5,96 5,87 5,98 5,81 5,96
6,03
5,71 5,98 5,99 5,81 5,71 5,73 5,75
7 5,79 5,7
5,87 5,67 5,63 5,82 5,76
6 5,75
5,16 5,82 5,83 5,74 5,85 5,73 5,7
5,65
5,72 5,86 5,6
5,68
0
Cluj Sălaj Bistriţa-Năsăud Turda Baia-Mare Satu-Mare Târgu-Mureş Cehu Silvaniei Carei
1st day 2nd day 3rd day 4th day 5th day
Figure 4. Lactose content from maternal colostrum
98
6
2,59 2,62 2,79 2,41 2,67 2,67 2,77 2,66
4
2,7 2,22 2,31
2,14 2,4
2,73 2,06 2,15 2,21 2,07 2,07
2,33 2,53 2,15
3 2,19 1,96 2,27 2,17 2,22 2,13 2,09
2,17 2,39 2,22
2,22 2,07 2,06 2,08
1,93 2,06 1,86 1,89 1,96 1,98 2,06
2 1,86 1,73
0
Cluj Sălaj Bistriţa-Năsăud Turda Baia-Mare Satu-Mare Târgu-Mureş Cehu Silvaniei Carei
1st day 2nd day 3rd day 4th day 5th day
Figure 4. Protein content from maternal colostrum
Protein composition resulted in maternal From the present study, it can be observed that
colostrum, behaves as lactose and fat, maternal breast milk exhibits lower
previously described parameters. During the concentrations of protein (1.27±0.07) and fat
1st-day the protein profile showed lesser values (3.52±0.15), compared to colostrum nutritional
of means (1.73 and 2.06%), compared with the parameters.
other days. Notably, regardless of regions Moreover, lactose from milk samples showed
between the 2nd (2.06-2.53), 3rd (1.96-2.73) and an increase compared to maternal colostrum
4th-day (2.07-2.70), the protein profile samples.
moderately elevates reaching the highest Maternal breast milk samples from collected
concentrations on day 5 (2.31-2.79%), from Indian women presented a median fat
respectively. Moreover, samples from Cehu composition of 3.02% slightly decreased
Silvaniei (2.77±0.07) and Bistrița-Năsăud compared to our average value of 3.52±0.15,
(2.79±0.05) exhibited the highest protein Bedi et al. (2013).
contents compared to other regions during
postpartum, while Turda (2.41±0.08) and Baia- CONCLUSIONS
Mare (2.31±0.04) %, presented decreased mean
values. The physico-chemical parameters of colostrum
Figure 6 indicates the total average of values ± are influenced by postpartum, as can be
standard deviation of physico-chemical observed on day 5 of postpartum when the
parameters from all the localities described in values are reaching the highest increases.
the present study. Maternal milk and colostrum have a balanced
compositional and nutritive matrix for the
development of young children. Lactose was
7 6,4 the component with the highest level in the
6 mother's milk. Hence, it may be concluded that
5 the variation in the metal concentration in
3,52
4 maternal breast milk and colostrum could be
due to their geographical origin. The high level
3
of heavy metals could potentially affect the
2
1,27 breast milk and therefore the infant health.
1
0 ACKNOWLEDGEMENTS
Fat (%) Protein (%) Lactose (%)
This project is funded by the Ministry of
Figure 6. Basic physico-chemical composition of Research and Innovation through Program 1 -
maternal milk Development of the National Research and
99
Development System, Subprogram 1.2 - Validation. Environmental & Analytical Toxicology,
Institutional Performance - Projects for 5(6).
Evers, D. C., Clair, T. A. (2005). Mercury in
Financing the Excellence in CDI, Contract no. Northeastern North America: A synthesis of Existing
37PFE/06.11.2018. Title of the project: Databases. Ecotoxicology, 14(1-2), 7‒14.
"Increasing the institutional performance Fujita, M., Roth, E., Lo, Y.J., Hurst, C., Vollner, J.,
through consolidation and development of Kendell, A. (2012). In poor families, mothers'milk is
research directions within the USAMV Cluj- richer for daughters than sons: a test of Trivers-
Willard hypothesis in agropastoral settlements in
Napoca". Northern Kenya. Am J PhysAnthropol., 149(1),
52‒59.
REFERENCES Gămăneci, G., Căpățînă, C. (2011). Study on soil
pollution with heavy metals in Rovinari area. Annals
Anderson, R. A. (1998). Chromium, Glucose Intolerance of the „Constantin Brâncuşi” University of Târgu
and Diabetes. Journal of the American College of Jiu, Engineering Series, 3.
Nutrition, 17(6), 548‒555. Geana, E. I., Iordache, A. M., Voica, C., Culea, M.,
Altun, S. K., Dinç, H., Paksoy, N., Temamoğulları, F. K., Ionete, R. E. (2011). Comparison of Three Digestion
Savrunlu, M. (2017). Analyses of Mineral Content Methods for Heavy Metals Determination in Soils
and Heavy Metal of Honey Samples from South and and Sediments Materials by ICP-MS Technique.
East Region of Turkey by Using ICP-MS. Asian Journal of Chemistry, 23(12), 5213‒5216.
International Journal of Analytical Chemistry, 6. Godt, J., Scheidig, F., Siestrup, C.G., Esche, V.,
Bassil, M., Daou, F., Hassan, H., Yamani, O., Kharma, J. Brandenburg, P., Reich, A., Groneberg, D.A. (2006).
A., Attieh, Z., Elaridi, J. (2018). Lead, cadmium and The toxicity of cadmium and resulting hazards for
arsenic in human milk and their socio-demographic human health. Journal of Occupational Medicine and
and lifestyle determinants in Lebanon. Chemosphere, Toxicology, 1, 22.
191, 911‒921. Huynh, D., Zhou, S. J., Gibson, R., Palmer, L.,
Bedi, J. S., Gil, J. P. S., Aulakh, R. S., Kaur, P., Sharma, Muhlhausler, B. (2015). Validation of an optimized
A., Pooni, P. A. (2013). Pesticide residues in human method for the determination of iodine in human
breast milk: Risk assessment for infants from Punjab, breast milk by inductively coupled plasma mass
India. Science of The Total Environment, 463-464, spectrometry (ICPMS) after tetramethylammonium
720‒726. hydroxide extraction. J Trace Elem Med Biol., 29,
Björklund, K. L., Vahter, M., Palm, B., Grandér, M., 75‒82.
Lignell, S., Berglund, M. (2012). Metals and trace Johnson, F. O., Atchison, W. D. (2009). The role of
element concentrations in breast milk of first time environmental mercury, lead and pesticide exposure
healthy mothers: a biological monitoring study. in development of amyotrophic lateral sclerosis.
Environmental Health, 11, 92. NeuroToxicology, 30(5), 761‒765.
Buzgău, C. O. (2013). Cercetarea regimului metalelor Kalkwarf, H. J., Specker, B. L., Mono, H. O. (1999).
grele în solurile poluate din zona Zlatna. Rezumatul Effects of calcium supplementation on calcium
tezei de doctorat. homeostasis and bone turnover in lactating women. J.
Chao, H., Guo, C., Huang, C., Chen, P. C., Li, H. C., Clin. Endocrin. Metab., 84, 464‒470.
Hsiung, D. Y., Chou, Y. K. (2014). Arsenic, Leon-Cava, N., Lutter, C., Ross, J., Martin, L. (2002).
Cadmium, Lead, and Aluminium Concentrations in Quantifying the benefits of breastfeeding: a summary
Human Milk at Early Stages of Lactation. Pediatrics of the evidence. Food and Nutrition Program (HPN)
& Neonatology, 55(2), 127‒134. of the Division of Health Promotion and Protection
Choi, J., Tanaka, T., Koren, G., Ito, S. (2008). Lead (HPP) of the Pan American Health Organization
exposure during breastfeeding. Canadian family (PAHO). PAHO©, Washington, DC.
physician Medecin de famille canadien, 54(4), Letinić, J. G., Sarić, M. M., Piasek, M., Jurasovic, J.,
515‒516. Varnai, V. M., Grgec, A. S., Orct, T. (2016). Use of
Coroian, A., Miresan V., Cocan, D., Raducu, C., human milk in the assessment of toxic metal
Longodor, A. L., Pop, A., Feher, G., Andronie, L., exposure and essential element status in breast
Marchis, Z. (2017). Physical–chemical parameters feeding women and their infants in coastal Croatia.
and the level of heavy metals in cow milk in the Baia Journal of Trace Elements in Medicine and Biology,
Mare area. Banat's Journal of Biotechnology, 8(16). 38, 117‒125.
Damian, F., Damian, G., Lăcătușu, R., Macovei, G., Levi, M., Hjelm, C., Harari, F., Vahter, M. (2018). ICP-
Iepure, G., Năprădean, I., Chira, R., Kollar, L., Rață, MS measurement of toxic and essential elements in
L., Zaharia, D. C. (2008). Soils from the Baia Mare human breast milk. A comparison of alkali dilution
zone and the heavy metals pollution. Carpth. J. of and acid digestion sample preparation methods.
Earth and Environmental Sciences, 3(1), 85‒98. Clinical Biochemistry, 53, 81‒87.
Dico, G. M. L., Cammilleri, G., Macaluso, A., Vella, A., Liu, X., Jin, T., Nordberg, G. F., Sjorstrom, M., Zhou,
Giangrosso, G., Vazzana, M., Ferrantelli, V. (2015). Y., (1994). Influence of zinc and copper
Simultaneous Determination of As, Cu, Cr, Se, Sn, administration on metal disposition in rats with
Cd, Sb and Pb Levels in Infant Formulas by ICP-MS cadmium-metallothionein-induced nephrotoxicity.
after Microwave-Assisted Digestion: Method Toxicology and Applied Pharmacology, 126, 84–90.
100
Liu, X. Y., Jin, T. Y., Nordberg, G. F., Rännar, S., vivo protection of their infants against diarrhoeal
Sjöström, M., Zhou, Y. (1992). A multivariate study disease. J Hyg. Camb., 85, 405.
of protective effects of Zn and Cu against Sato, M., Nagai, Y. (1989). Effect of zinc deficiency on
nephrotoxicity induced by cadmium metallothionein the accumulation of metallothionein and cadmium in
in rats. Toxicology and Applied Pharmacology, 114, the rat liver and kidney. Archives of Environmental
239‒245. and Contamination Toxicology, 18, 587–593.
Lönnerdal, B. (1998). Copper nutrition during infancy Scientific Committee for Food, European Union. (1993).
and childhood. Am J ClinNutr., 67(5 suppl), Proposed Nutrient and Energy Intakes for the
1046S‒1053S. European Community: A Report of the Scientific
Mandic, Z., Mandic, M. L., Grgic, J., Grgić, Z., Klapec, Committee for Food of the European Community.
T., Primorac, L., Hasenay, D. (1996). Copper and Nutr Rev, 51, 209–212.
zinc content in human milk in Croatia. European Senila, M., Levei, E., Miclean, M., Senila, L.,
Journal of Epidemiology, 13, 185‒188. Stefanescu, L., Mărginean, S., Ozunu, A., Roman, C.
Marchis, Z., Odagiu, A., Coroian, A., Oroian, I., Mîrza, (2011). Influence of pollution level on heavy metals
M., Buruhos, P. (2018). Analysis of Environmental mobility in soil from NW Romania. Environmental
Factors’ Impact on Donkeys’ Colostrum Quality. Engineering and Management Journal, 10(1), 59-64.
Sustainability, 10(9), 2958. Shay, N. F., Mangian, H. F. (2000). Neurobiology of
Mohd-Taufek, N., Cartwright, D., Davies, M., Zinc-Influenced Eating Behavior. The Journal of
Hewavitharana, A. K., Koorts, P., Shaw, P. N., Nutrition, 130(5), 1493‒1499.
Sumner, R., Lee, E., Whitfield, K. (2016). The Shi, Y., Sun G., Zhang Z., et al. (2011). The chemical
Simultaneous Analysis of Eight Essential Trace composition of human milk from Inner Mongolia of
Elements in Human Milk by ICP-MS. Food China. Food Chemistry, 127(3), 1193‒1198.
Analytical Methods, 9(7), 2068‒2075. Sower, M., Corton, G., Shapiro, B., Jannaussh, M. L.,
Nimirceag, R. (2012). Heavy metals in the soils of Crutchfield, M. C., Smith, M. L., Randolph, J. F.,
Rodna mining area, Romania and zeolite efficiency Hollis, B. (1993). Changes in bone density with
for remediation. Environmental Engineering and lactaion. J. Am. Med. Assoc., 269, 3130‒3135.
Management Journal, 11(2), 421‒426. Suciu, I., Cosma, C., Todică, M., Bolboacă, S. D.,
Nordberg, G. F. (2004). Cadmium and health in the 21st Jäntschi, L. (2008). Analysis of Soil Heavy Metal
Century – historical remarks and trends for the future. Pollution and Pattern in Central Transylvania. Int. J.
Biometals, 17(5), 485‒489. Mol. Sci., 9, 434‒453.
Rebelo, F. M., Caldas E. D. (2016). Arsenic, lead, Vinodhini, R., Narayanan, M. (2008). Bioaccumulation
mercury and cadmium: Toxicity, levels in breast milk of heavy metals in organs of fresh water fish
and the risks for breastfed infants. Environmental Cyprinus carpio (Common carp). Int. J. Environ. Sci.
Research, 151, 671‒688. Tech., 5(2), 179‒182.
Rowland, M. G. M., Cole, T. J., Tully, M., Dolby J. M., Wu, Y., Zhou, Q. (1991). Interim environmental
Honour, P. (1980). Bacteriostasis of Escherichia coli guidelines for cadmium and mercury in soil of China.
by milk. VI. The in vitro bacteriostatic property of Water, Air, and Soil Pollution, 57-58, 733‒743.
Gambian mothers’ breast milk in relation to the in-
101
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
APPLICATION OF HURDLE TECHNOLOGY AS A NOVEL
APPROACH TO NEW DIETARY FIG-BASED PRODUCTS
DEVELOPMENT IN RURAL AREAS OF ALBANIA
Luziana HOXHA, Renata KONGOLI
Agricultural University of Tirana, Pajsi Vodica, Koder Kamez, 1029, Tirana, Albania
Corresponding author email: [email protected]
Abstract
Application of hurdle technology even more is getting a special attention from food scientist and producers, due to its
economical convenience, simplicity and flexibility in use. In Albania fig fruit is widespread, usually sold in summer in
local markets as fresh fruit, and during the year could be found as dried figs, which is traditionally sun-dried, and a
small amount is preserved with addition of sugar. A big challenge still facing rural areas in Albania is the lack of
preservation methods and capacities, the high perishable nature of fig and the supply of local markets with imported fig
products, which could lead in a stock creation of country produce. So the application of hurdle technology was the aim
of this work, as a novel approach to new dietary dried fig-based products development, with the attempt to minimize
stock creation of dried figs produce, and market diversification with a range of products competing imported fig
products. This study may serve as suggestions for further development of dried fig-based products, also may have an
impact for rural areas development in Albania.
Key words: dried fig-based product development, hurdle technology, rural development.
INTRODUCTION processing, also another a typical product
produced is “gliko”.
Nutrition is strongly linked with people health Hurdle technology is even more in the focus of
and longevity, besides the need for consuming food scientist and industries for application,
to meet minimal requirements for energy, and a due to its economical convenience, simplicity
good health is an asset for everyone. and flexibility in use, other than providing
One of the fruit that is known from antiquity as nutritious, tasty and stable products, and that is
symbol of longevity is fig, being an excellent why is considered here as a novel approach for
source of minerals, vitamins, dietary fibres and development of new products.
amino acids, and it's free of fat and cholesterol As promoters to our work for converting dried
(Solomon et al., 2006; Veberic et al., 2008). figs into new value added products with
Have potential health-promoting constituents as enhanced shelf-life, were the challenges faced
phytosterols (Jeong & Lachance, 2001), yearly by farmers of rural fig growing areas,
carotenoid (Su et al., 2002), anthocyanins the lack of fig preservation techniques and
(Solomon et al., 2008; Del Caro & Piga, 2008; methods, waste of fig due to high perishable
Duenas et al., 2008) and polyphenols (Del Caro nature, stock creation of dried fig, need for its
& Piga, 2008; Veberic et al., 2008). utilization during winter months, in the
The tree is deciduous in nature, it is earliest meantime helping in development of rural
cultivated and ranked third among fruit trees areas, needs for diversified products and
cultivated in Albania, and is well-grown in competing imported products in the market etc.
regions of Berat, Tirana, Elbasan, Shkodra, So the actual work may represent a preliminary
Himara etc. (Hoxha & Kongoli, 2018). contribution, filling the gap so far as no
Fruit is utilized by the rural people of the fig scientific work or documented data are
growing regions in Albania, where most of the available for development of new dietary dried
local production is consumed fresh while the fig-based products and suggesting their recipes
remainder goes for drying figs with traditional for further implementation.
technique of sun-drying, also preservation with The actual study may serve as a true reflection
addition of sugar to jam and marmalade of the importance and potential of this crop,
102
and would provide sustainable means to the
Collection
development of rural fig growing areas in
Albania, also would be useful to farmers and
industries for utilization, adoption and Sorting
development of new minimally processes based
on hurdle technology application as novel
Cleaning/washing
approach to preserve figs during the winter
months.
The actual conducted work, beside the aim to Blanching
develop tasty, healthy, and nutritious new
dietary dried fig-based products with added .
Cut/Grinding
value, served as preliminary work for testing
the product samples in-house and to a set of
customers, prior launching in the market and Mixing/ Dough formation
commercial production.
Weighting/Final product formed
MATERIALS AND METHODS
New product development Mild heat treatment
In this study was used ʻRoshnikʼ sundried fig
variety, which is an autochthonous variety
Cooled at RT/Refrigerated
mostly grown in Berat region, and well known
for its suitability for drying.
The combination of preserving factors were Packed/Stored
based on the nature of dried fig for processing
and converting into new value added products Figure 1. Flow chart for the development of new dietary
with minimal processes (Figure 1). dried fig-based products
Collected and sorted dried figs, after were
Preparation of 11 recipes for each product from
cleaned and washed, were blanched by dipping
FP0 to FP10 (are coded FP: fig-based product,
the fruits into hot water (temperature 88 ± 2oC)
and numbered in subscript to distinguish each
(1: 1 ratio) for 1 min and then cutting and
product recipe from another).
grinding.
Mixing process lasted 1 ± 0.5 h, till formation
The dried fig grinded was thoroughly mixed in
of dough, and immediately the final products
an open pan with continuous stirring with other
were differently shaped, after equally weighted
ingredients. For recipes development were used
in portions of 25 ± 0.5 g and 100 ± 0.5 g.
different proportions of dried figs, including
Mild heat treatment (for 7 ± 1 h at 55 ± 1oC)
other locally available dried fruits and additives
was applied for further moisture content
selected with intend to enhance nutritional,
reduction. The final products after cooled to
quality parameters, to prevent microorganism
room temperature were kept in refrigerator
growth, and having low cost in the same time.
until packaging and/or further quality
Ingredient used were as follow: dried fig (59.5-
parameters evaluation.
96.5%), dried cranberry (till 35%), dried
The final products packed with plastic wrap,
apricot (21-25%), walnut (7.3-22%), hazelnut
were stored at ambient conditions.
(till 2%), unsweetened cocoa powder (till
1.5%), coconut flour (till 1.5%), oats (till
Quality parameters evaluation
3.7%), finely grated orange zest (0.3-3.3%),
Dried fig fruits were evaluated for quality
grounded cinnamon (till 0.17%), grounded
parameters, besides which was content of total
clove (till 0.017%), citric acid (lemon or orange
ash (AOAC, ref. 942.05), total protein (AOAC,
juice) (till 3%), and vanilla extract (0.04-
ref. 976.05), total fat (AOAC, ref. 963.15), total
0.85%). In some of the products were used
carbohydrates (Hedge & Hofreiter, 1962),
coats of: sesame seeds, coconut flour, pumpkin
reducing sugars (AOAC, ref. 925.36), crude
seeds and walnut.
fibre (AOAC, ref. 962.09), and the energy
103
expressed in kcal, was calculated using Atwater provides gluten free, with no added sugar, and
factors. healthy products.
The methods used for evaluation of quality
parameters of new developed dried fig-based Table 1. Quality parameters of dried fig, as the main
products, were for moisture AOAC (ref. ingredient of new products developed
934.06), for titratable acidity AOAC (ref. Quality parameters Mean SD
942.15), and for pH AOAC (ref. 981.12). Carbohydrate (g/100 g) 69.34 0.107
Protein (g/100 g) 2.66 0.011
Sensory evaluation
Fat (g/100 g) 1.17 0.001
The sensory characteristics of the new
Fiber (g/100 g) 8.85 0.023
products, including: appearance, aroma, color,
texture, flavor, and overall acceptability, were Ash (g/100 g) 2.60 0.015
evaluated by 10 semi trained panel members, in Reducing sugar (g/100 g) 59.58 0.081
order to get the most acceptable level from the Energy (kcal) 298.57 0.435
new developed recipes. To rate the products, to
each panel member was given a sensory The results of quality attributes evaluated for
evaluation form of composite scoring (20 point new dried fig-based products developed,
for each characteristic), also was used fresh showed that for moisture content of new
water for rinsing the mouth prior tasting the products ranged 14.85-20.98% (Figure 2),
next sample. based on these values could be considered as
safe interval for preserved product, but other
Data processing supporting microbiological determinations are
The analysis of Mean, Standard Deviation and foreseen to be performed, as this is an ongoing
bar diagram was used for the result obtained for study. Between different recipes, additions of
each determined parameter, at least in three other ingredients had an impact in lowering
independent replicates. moisture content compared to FP0, which is the
product with the highest proportion of fig
RESULTS AND DISCUSSIONS (almost 100%), and here we have considered as
control for other recipes. From result it is noted
Data obtained from evaluation of quality that different ingredient had different impact in
attributes of dried fig fruit (Table 1), showed moisture content, especially in the case of
that dried fig variety ʻRoshnikʼ possess nutrient addition of walnuts product FP7, also for coated
content in such amounts that its consumption products with sesame seeds, pumpkin seeds,
may provide a good source of energy till walnuts resulted to have lower moisture
298.57 kcal per 100 g product. Based on content.
obtained results, dried fig evaluated could
serves as a good source of nutrients which
might play a beneficial role for a good health,
especially for mineral content and fiber content
respectively for total ash till 2.60 g/100 g and
fiber till 8.85 g/100 g, which have resulted in
greater amounts compared to similar study of
Vora et al. (2017).
From the results for evaluated quality
parameters, is noted that dried fig ʻRoshnikʼ
variety has attributes that make it suitable to be
transformed into new products with added Figure 2. Moisture content of new products
value, offering thus products with high
nutritive value. Furthermore development of Referring to Figure 2 products FP7 and FP8
new products, other as an effective way for results with lowest moisture content, maybe
utilization of dried figs with added value during due to the ingredient used in their recipes,
winter months, have further strengths, as which can have more affinity to bind water,
104
and as result is expected a reduced water An effect in lowering pH had presence of
activity, which is one of the most important orange zest in products FP4 and FP10, and dried
hurdle factors. apricot in products FP8 and FP10. Usage of
Titratable acidity parameter was found to be in other ingredients had no effect in pH values, as
the range 1.53-2.80% citric acid (Figure 3). between other products were not noted
Between products FP9 resulted to have the significant differences compared to FP0.
highest total acidity values, maybe due to the The average results for appearance, aroma,
presence in product of dried cranberry. Also, color, texture, and flavor for different new
with an impact in total acidity value rising products evaluated by panel members are listed
showed orange zest used in two recipes for in Table 2.
product FP4 and FP10. Dried apricot used in The highest score for appearance has product
product FP8 and FP10, showed to have similar FP6, for aroma has the product FP4, for color
effect in total acidity content, whereas there has the product FP5 and FP9, which had the
were not noted significant differences between darker color by the presence of cocoa and
other products. cranberry respectively, for the texture there was
no significant differences between products,
where for the flavor was highly scored product
FP4.
Table 2. Sensory properties of new dried fig-based
products
Quality Products
Score
attributes
FP0 FP1 FP2 FP3 FP4 FP5
Appearance 20 16 18.7 18.7 17.7 16.3 17.7
Aroma 20 16.4 16.7 16.4 17.7 19.4 17.7
Color 20 17.5 17.5 17.5 17.5 17.5 17.8
Figure 3. Titratable acidity content of new products Texture 20 17.5 17.5 17.4 17.4 17.9 17.4
Flavor 20 16.4 16.9 16.7 17.8 19.5 18.1
The pH of products ranged from 3.47 to 4.44
(Figure 4), which could considered as safe Total score 100 83.8 87.3 86.7 88.1 90.6 88.7
interval for microorganism growing, and is one
of the most important hurdles for food Quality
Products
Score
preservation. The low pH value might be attributes
FP6 FP7 FP8 FP9 FP10
influenced by the presence of added lemon Appearance 20 18.7 17.8 16 18.4 18.5
and/or orange juice, besides other ingredient Aroma 20 16.7 16.7 16.4 17.8 18.2
used. Among different products, the highest pH Color 20 17.5 17.5 17.5 17.8 17.5
content had product FP7 (fig plus walnut),
Texture 20 17.5 17.5 17.5 17.5 17.5
while with the lowest pH content had FP9 (fig
Flavor 20 16.7 16.7 16.4 17.8 18.7
plus dried cranberry).
Total score 100 87.1 86.2 83.8 89.3 90.4
According to the results of overall acceptability
(Figure 5), product FP4 resulted to be mostly
accepted by panel members, as this product had
the highest scores 90.6 out of 100, followed by
products FP10 and FP9. In general products with
added value were highly scored compared to
FP0. Between product FP8 and FP0 was no
differences in total score, noting that presence
of dried apricot was not very distinguishable
compared with that of fig, for the used
Figure 4. pH values of new dried fig-based products
proportions in that recipe. Whereas the coats
105
used were noted to have an impact in e
appearance of products, as those products FP1
(sesame seeds), FP2 (pumpkin seeds), FP3 and
FP5 (coconut), FP6 (walnut plus oats) have the
highest score compared to FP0.
Figure 6. Some from the new dried fig-based products
developed: a) fig+apricot (FP8); b) fig+craneberry (FP9);
c) fig+orange zest (FP4); d) fig+walnut (FP7);
e) fig+coconut (FP6)
CONCLUSIONS
Figure 5. Overall acceptability scores of new dietary
dried fig-based From this study can be concluded that Albanian
dried figs possess considerable amount of
Below are presented some of new dried fig- nutrients, especially fiber and minerals, and
based products developed for this study, which may serve as good source energy. Due to its
resulted mostly evaluated and sensorially attributes is suitable to be effectively utilized
accepted by panel members (Figure 6), which for new dietary dried fig-based products, as one
might be attractive for consumers too, and for alternative way for adding value to the crop, in
their success in the market further work would the meantime may serve as an income source to
be suggested. people that cultivate fig in rural areas of
Albania.
Application of hurdle technology and develop-
a ment of new recipes provided tasty, natural,
nutritive and healthy products, with low water
content and pH, which are important hurdles
b for food preservation.
With regards to food stability of these new
products, and since this is an ongoing study,
further microbiological analyses are going to be
c performed in order to support our first results.
Furthermore inclusion of cranberry, orange
zest, also other additives in recipes added value
to products, based on evaluation quality para-
meters and overall acceptability results, new
d products may be attractive to consumers as a
potential for marketing as innovative products,
which may compete other imported fig-based
products in market.
The knowledge of new preservation method
based on application of hurdle technology, and
the quality parameters of these new products,
may encourage the farmers to develop the
products in a larger scale.
Further work is needed to be developed for new
dried fig-based products success in the future.
106
REFERENCES të freskët dhe të tharë. PhD, Agriculutral University
of Tirana, Albania.
AOAC International. (2000). Official methods of Jeong, W. S., Lachance, P. A. (2001). Phytosterols and
analysis of AOAC International. 17th edition. 1st fatty acids in fig (Ficuscarica var. Mission) fruit and
revision. Gaithersburg, MD, USA, Association of tree components. Food and Chemical Toxicology, 66,
Analytical Communities. 278‒281.
AOAC International. (2002). Official methods of Solomon, A., Golubowicz, S., Yablowicz, Z. (2006).
analysis of AOAC International. 17th edition. 1st Antioxidant activities and anthocyanin content of
revision. Gaithersburg, MD, USA, Association of fresh fruits of common fig (Ficuscarica L.). Journal
Analytical Communities. of Agricultural and Food Chemistry, 54, 7717‒7723.
Del Caro, A., Piga, A. (2008). Polyphenol composition Su, Q., Rowley, K. G., Itsiopoulus, C., O’Dea, K. (2002).
of peel and pulp of two Italian fresh fig fruits Identification and quantitation of major carotenoids
cultivars (Ficuscarica L.). European Food Research in selected components of the Mediterranean diet:
and Technology, 226, 715‒719. green leafy vegetables, figs and olive oil. Eur J Clin
Duenas, M., Perez-Alanso, J. J., Santos-Buelga, C., Nutr., 56 (11), 1149‒54.
Escribano-Bailon, T. (2008). Anthocyanin compo- Veberic, R., Colaric, M., Stampar, F. (2008). Phenolic
sition in fig (Ficus carica L.). Journal of Food acids and flavonoids of fig fruit (Ficuscarica L.) in
Composition and Analysis, 21, 107‒115. northern Mediterranean region. Food Chemistry, 106,
Hedge, J. E. Hofreiter, B. T. (1962). In: Carbohydrate 153‒157.
Chemistry, 17 (Eds. Whistler R.L. and Be Miller, Vora J. D., Vora, D., Pednekar, S. R. Patwardhan, A. U.,
J.N.). Academic Press, New York. Shaikh, S., (2017). Biochemical, Organoleptic
Hoxha, L. Kongoli, R. (2018). Vlerësimi i aktivitetit Assessment of Fig (Ficus carica). Journal of
antioksidant tek disa kultivarë vendas të frutit të fikut Biotechnology and Biochemistry, 3(2), 95‒104.
107
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
RESEARCHES REGARDING THE ANTIOXIDANT POTENTIAL
OF SELECTED Brassicaceae VEGETABLES REPRESENTATIVE
FOR HUMAN NUTRITION
Mihaela MULȚESCU1, 2, Marta ZACHIA2, Floarea BURNICHI3,
Florentina ISRAEL-ROMING1
1
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mărăşti Blvd.,
District 1, Bucharest, Romania
2
National Institute of Research and Development for Food Bioresources – IBA Bucharest, Romania
3
Research and Development Station for Vegetables Buzău, Romania
Corresponding author email: [email protected]
Abstract
Brassica vegetables belong to the Cruciferous family and include different kinds of cabbage (white, red), cauliflower
and broccoli. These vegetables are recognised for their contribution to human health and nutrition. Brassica vegetables
are extensively studied, analysed and characterised lately due to their antioxidant character and antioxidant capacity.
The aim of the study was to investigate the antioxidant capacity of four white cabbage varieties (ʻDe Buzăuʼ,
ʻBuzoianaʼ, ʻMăguraʼ, ʻDe Işalniţaʼ). The content of total polyphenolics of fresh vegetables (Folin Ciocalteu
procedure) was assessed as well as carotenoids and chlorophyll pigments (spectrophotometric methods) and vitamin C
content (titrimetric assay using 2,6-dichlorphenol indophenol). The antioxidant activity of the vegetables was
determined according to DPPH (2,2-diphenyl-1-picrylhydrazyl) protocol. The results showed the highest concentration
of antioxidant compounds for Magura variety, while the lowest one was for De Isalnita variety. A study regarding
stability of antioxidant capacity during storage for three months was performed too.
Key words: Brassicaceae, cabbage, antioxidant capacity, polyphenolics, carotenoids, chlorophyll.
INTRODUCTION anticarcinogenic activity (Kris-Etherton et al.,
2002).
Recent research associated the reduced risk of White cabbage (Brassica oleracea var.
cardiovascular disease with a rich diet in fruit capitata f. alba) is among the world’s most
and vegetables (Kaur & Kapoor, 2001). They commonly cultivated vegetables. Due to its
are also an excellent source of antioxidants as affordable price and availability at local
polyphenolic compounds, carotenoid and markets, white cabbage stands out as an
chlorophyll pigments and vitamins (ascorbic important source of phytonutrients in the
acid, vitamin E, vitamin K) (Krinsky, 2001). human diet. It may be stored raw for long
The nutritional quality of vegetables has been periods of time and hence could be available
extensively studied focusing on the role of diet throughout the year. Throughout history it has
in human health (Tiwari & Cummnis, 2013). also been known as ‘medicine for the poor’
Brassica vegetables represent a group of and has been used for the general
horticulture species that are very important in improvement of health and the treatment of
human nutrition (Cartea & Velasco, 2008). various inflammation and gastrointestinal
Vegetables from the Brassicaceae family are (Hatfield, 2004; Cavender, 2006; Passalacqua
known for their antioxidant properties that are et al., 2007). White cabbage is an
scientifically correlated with lower risk of inexpensive, very nutritive source of food,
developing prostate cancer by 40%. providing nutrients and health-promoting
Cruciferous are an excellent source of phytochemicals.
antioxidant and glucosinolate vitamins, being Phytochemicals have attracted much recent
the precursors of a group of isocyanates that scientific attention and it is well known that
have been shown to be compounds with white cabbage is a significant source of
108
glucosinolates, phenolic compounds, carote- Carotenoids are synthesized by all plants and
noids and various vitamins. Several reviews many microorganisms (bacteria and fungi), but
have been published on the phytochemistry not by animals, including humans, who
and health benefits of Brassica vegetables therefore rely on dietary uptake. Due to the
(Podsędek et al., 2006; Cartea et al., 2011; correlation of carotenoid intake and chronic
Jahangir et al. 2009; Björkman et al., 2011; diseases, methods allowing the rapid, accurate
Kapusta-Duch et al., 2012; Avato & determination of carotenoids in these matrices
Argentieri, 2015), but to the best of our are highly desired. Without prior separation
knowledge nobody has focused specifically on carotenoids may be determined in plants
white cabbage (Brassica oleracea var. together with chlorophylls, absorbing at similar
capitata f. alba). wavelengths (Bieler et al., 2010). In white
Polyphenolic compounds or “phenolics” are a cabbage, the level of chlorophyll varies
complex group of compounds of plant origin. between 1.5 and 3.2 mg/100 g fresh weight and
(Blasco Antonio J. et al., 2005). The interest of the level of carotenoids ranges between
phenolic acids is continuously increasing 0.01and 0.12 mg/100 g fresh weight.
because of their antioxidant properties among According to the USDA National Nutrient
others (Cadenas E. & Packer, 1996). The “total Database for Standard Reference and dietary
phenolics” determination is very difficult intake recommendations for adults (USDA),
because of their chemical complexity, difficult the white cabbage contains approximately 72 %
extraction from plant matrix, and the presence of the recommended daily value (DV) for
of complex interferences in food samples. Total vitamin K, and 44 % of DV, 11 % of DV and
phenolics in white cabbage has been reported 10 % of DV for vitamin C, folate and vitamin
by different authors (Kaulmann et al., 2014; B6, respectively.
Vicas et al., 2013; Deng et al., 2013) and the The variation in antioxidant content is caused
range of concentrations was between 9.3- by many factors such as geographical region,
1043.6 mg galic acid/100 g fresh weight. climate, variety, harvest maturity, growth
Vitamins and carotenoids are essential conditions, soil condition and post-harvest
compounds which promote human health and conservation and processing method
are responsible for accurate functioning of (Goncçalves et al., 2004).
human metabolism and immune response. The aim of the present work was the assessing
Considerable attention was focused on ascorbic of antioxidant capacity of white cabbage
acid (AA), known for its reductive properties varieties (Brassica oleracea var. capitata f.
and for its use on a wide scale as an antioxidant alba) correlated with total phenolics,
agent in foods; it is also important for caretonoids and chlorophyll content and
therapeutic purposes and biological metabolism vitamin C level. The stability of these
(Raoof, Ojani & Beitollahi, 2007). Due to its biochemical parameters was monitored during
properties, vitamin C represents an important three months storage period.
quality indicator of foodstuffs (Wawrzyniak,
Ryniecki & Zembrzuski, 2005) and contributes MATERIALS AND METHODS
to the antioxidant capacity of food (Glevitzky
et al., 2008; Popa et al., 2010; Pisoschi et al., Materials
2008; Pisoschi et al., 2010; Pisoschi et al., Four white cabbage varieties were analysed:
2011). Vitamin C concentration in white ʻDe Buzăuʼ, ʻBuzoianaʼ, ʻMăguraʼ and ʻDe
cabbage ranges between 23.0-55.8 mg ascorbic Işalniţaʼ. All varieties were cultivated
acid/100 g fresh weight (Podsęsdek et al., 2006; (Research and Development Station for
Tiwuri & Cummins, 2013). Vegetables Buzău, Romania) in the same
The determination of leaf pigment content is conditions, the same location, with the same
another important analytical tool in the field of agro-technical practices and harvested when
plant physiology (Pompelli et al., 2012). reached the optimal maturity.
Therefore, the chlorophyll (Chl) level is an After harvesting the samples were transported
accurate indicator of plant vigour and is and analysed at the Food Chemistry
routinely measured in physiological research. Laboratory. Then were selected the
109
inflorescences without infection or mechanical study. The results were expressed in mg
damage weighting about 2 kg each one. ascorbic acid/100 g fresh weight.
Chemical substances 6-hydroxy-2,5,7,8-
tetramethylchromane-2-carboxylic acid Determination of pigments
(TROLOX), 2,2-diphenyl-1-picrylhydrazyl Carotenoid and chlorophyll pigments were
(DPPH) and 2,6 diclorphenol-indophenol were extracted from 3 g fresh white cabbage using a
purchased from SIGMA-ALDRICH mixture of acetone/water (80: 20, v/v/). The
CHEMICAL CO. Meta-phosphoric acid, final mixture was vortexed (15 min., 2000 rpm,
ethylendiaminetetraacetic acid, sodium 20°C) and centrifuged (15 min., 3500 rpm.
hydrogen carbonate and sodium carbonate were 20°C). The obtained extract was filtrated and
purchased from ROTH. Folin-Ciocalteau the absorbance was recorded at 470, 646, 663
reagent and ascorbic acid were purchased from nm with Specord 210 spectrophotometer
MERCK. The organic solvents (methanol and (Analytic Jena, Germany) as described by
acetone) were of analytical grade (MERCK). Lichtenthaler (1987). The results were
expressed in µg /1 g fresh weight.
Methods
Fresh samples were cleaned, cut and Determination of antioxidant capacity using
homogenized for optimum results. Methanol: DPPH protocol
water (1: 1, v/v) and acetone: water (80: 20, The method is based on the color modification
v/v) were used for extraction. Triplicates were (from purple to yellow) of DPPH (2,2-difenyl-
prepared for each one. 1-picrylhydrazyl) radical.
A modified protocol was used (A. Culetu et al.,
Determination of total phenolics 2016) and consisted in extraction of the
The phenolics content was measured with samples in methanol:water (1: 1, v/v). One ml
Folin-Ciocalteau reagent (Singleton & Rossi, of extract was treated with 6 ml DPPH.
1965) using gallic acid as standard. The Following a 30 minutes rest in the dark, the
samples were prepared by mixing 1 ml with 5 absorbance at 517 nm was measured with a
ml Folin-Ciocalteau reagent and 4 ml sodium Specord 210 spectrophotometer (Analytic Jena,
bicarbonate (7.5% w/v). The solution was kept Germany).
in the dark, at room temperature, for 20 min; The results were expressed in µmol Trolox/g
the absorbance was measured at 752 nm with a fresh weight.
Specord 210 spectrophotometer (Analytic Jena,
Germany). Total phenolics content was Stability of cabbage varieties
expressed as mg gallic acid equivalents per 100 In order to determine the stability over time,
g fresh weight (mg GAE/100 g FW), calculated cabbage samples were stored in the Vegetables-
based on a calibration curve obtained with 1 Fruits Section at a temperature of 20 C, for 3
mg/ml gallic acid solution. months period. After two months and three
months, the same parameters was re-analysed
Determination of ascorbic acid for the selected cabbage samples.
The dye-titration method was used, according
to AOAC procedure, 2006. Metaphosphoric RESULTS AND DISCUSSIONS
acid extracts of vegetables were analysed by
titration with 2,6-dichlorophenolindophenol Samples of the white cabbage varieties were
reagent (DCIP). In this oxidation-reduction assayed for antioxidant phytonutrients:
reaction, ascorbic acid in the extract was phenolics, vitamin C, chlorophyll and
oxidized to dehydroascorbic acid and the carotenoid pigments. Total phenolics content
indophenol dye reduced to a colourless (TP) ranged between 5.78 and 7.28 mg GAE/g
compound. End point of the titration was FW, with highest value for ʻDe Buzăuʼ cabbage
detected when excess of the unreduced dye variety (Figure 1). The obtained results showed
gave a rose pink colour in acid solution. The rather similar level of TP for ʻDe Buzăuʼ,
tests were carried out on white cabbage. ʻBuzoianaʼ and ʻMăguraʼ varieties, while for
Dehydroascorbic acid was not analysed in this ʻDe Işalniţaʼ variety this was about 20% lower.
110
It is difficult to compare these results with
those of other authors because the reported Isalnita cabbage
values are spread over a wide range (9.3-1043.6 Magura cabbage
mg GAE/100 g FW). This high variability Buzoiana cabbage
suggests that TP content may be influenced by
Buzau cabbage
a lot of factors, not only by the tested variety,
geographic origin, agro-technical practices, 0 0,5 1 1,5 2 2,5
Antioxidant capacity (µmol Trolox/g FW)
harvest time, but also by extraction method and
analytical determination parameters.
Regarding the ascorbic acid (AA) content, the Figure 2. Antioxidant capacity of cabbage varieties
highest value was registered for ʻMăguraʼ using DPPH radical
cabbage variety with 42.85 mg/100 g FW
(Figure 1). The obtained results are similar to The stability of antioxidants during cabbage
those reported by other authors (Podsęsdek et storage was assayed for three months. After
al., 2006; Tiwuri & Cummins, 2013). two months of storage an insignificant decrease
The tested white cabbage varieties showed of the amount of phenolic compounds was
close values, the results obtained for the registered (Figure 3).
chlorophyll pigments being in the order: But the determinations made after three months
ʻBuzoianaʼ variety > ʻMăguraʼ variety > ʻDe showed 30% lower level of the total phenolics
Buzăuʼ variety > De Işalniţa variety (Figure 1). for all the tested cabbage varieties (p<0.05).
In terms of carotenoids, the highest value was These results suggest that phenolic compounds
recorded for ʻMăguraʼ variety (2.73 μg/g) and were affected by abiotic factors (light,
the lowest for ʻDe Buzăuʼ variety (1.7 μg/g) temperature, relative humidity) especially after
(Figure 1). The obtained results are close to 60 days storage.
previously published works of Fernandez-Leon
et al. (2014).
Figure 3. Stability of phenolics during storage
Figure 1. Variation of antioxidant parameters
for different varieties of cabbage Analysing the stability of vitamin C during
(TP - total phenolics; AA - ascorbic acid; storage, the results presented in Figure 4
Chl - chlorophyll; Car – carotenoid) showed a significant decrease of the obtained
values after two months (p<0.05).
The antioxidant capacity, based on DPPH The results confirm ascorbic acid sensitivity to
radical scavenging activity, assayed for degradation during handling and storage of
cabbage varieties showed comparable results fruits and vegetables (Balan et. al., 2016;
for ʻDe Buzăuʼ, ʻBuzoianaʼ and ʻMăguraʼ Tiwuri & Cummins, 2013).
varieties, and about 25% lower for ʻDe Işalniţaʼ The loss of ascorbic acid is attributed to the
variety (Figure 2). Best correlation (r2 0.899) conversion to dehydroascorbic acid and further
was found between antioxidant capacity and on to 2,3-diketogulonic acid, favoured by
the total phenolic content of the selected exposure to oxygen, heavy metals, alkaline pH
cabbage varieties. This suggests that total and high temperature.
phenolic content may be used to predict the
antioxidant activity of cabbage.
111
especially vitamin C and chlorophyll and
carotenoid pigments.
ACKNOWLEDGEMENTS
This research work was carried out with the
support of Research and Development Station
for Vegetable Growing Buzău and also was
supported by National Institute of Research and
Development for Food Bioresources – IBA
Figure 4. Stability of ascorbic acid during storage Bucharest.
REFERENCES
Avato, P., Argentieri, M. P. (2015). Brassicaceae: a rich
source of health improving phytochemicals.
Phytochem Rev. doi: 10.1007/s11101-015-9414-4.
Balan D., Israel-Roming F., Luta G., Gherghina E.
(2016). Changes in the nutrients content of some
green vegetables during storage and thermal
processing, Romanian Biotechnological Letters,
21(5), 11857‒11865.
Bieler, E., Mayer, F., Hoffmann, L., Krause E., Bohn T.
Figure 5. Stability of chlorophyll during storage (2010). Comparison of 3 Spectrophotometric
Methods for Carotenoid Determination in Frequently
Consumed Fruits and Vegetables. Journal of Food
Science, 00.
Blasco Antonio, J., Rogerio, M. C., Gonzalez, M. C.,
Escarpa, A. (2005). “Electrochemical Index” as a
screening method to determine “total polyphenolics”
in foods: A proposal, Analytica Chimica Acta,, 539,
237‒244.
Björkman, M., Klingen, I., Birch, A. N. E., Bones, A.
M., Bruce, T. J. A., Johansen, T. J., Meadow, R.,
Mølmann, J., Seljåsen, R., Smart, L. E., Stewart, D.
(2011). Phytochemicals of Brassicaceae in plant
protection and human health. Influences of climate,
Figure 6. Stability of carotenoids during storage environment and agronomic practice.
Phytochemistry, 72, 538‒556.
Cadenas, E., Packer, L. (1996). Handbook of
With regard to chlorophyll and carotene Antioxidants, Marcel Dekker, New York.
pigments, it can be seen that they decreased Cartea, M. E., Velasco, P. (2008). Glucosinolates in
over time, along with storage. Their Brassica foods: bioavailability in food and
degradation is due to the temperature and lack significance for human health. Phytochemistry
Reviews, 7, 213‒229.
of natural light (Figures 5 and 6).
Cartea, M. E., Francisco, M., Soengas, P., Velasco, P.
(2011). Phenolic compounds in Brassica vegetables.
CONCLUSIONS Molecules, 16, 251-280.
Cavender, A. (2006). Folk medical uses of plant foods in
The antioxidants content in cabbage depends southern Appalachia, Ethnopharmacol, 108, 74‒84.
Culetu, A., Fernandez-Gomez, B., Ullate, M., Del
on the tested varieties. The highest
Castillo, M. D., Andlauer, W. (2016). Effect of
concentration of antioxidant compounds was theanine and polyphenols enriched fractions from
found in ʻMăguraʼ variety, while the lowest one decaffeinated tea dust on the formation of Maillard
in ʻIşalniţaʼ variety. Antioxidant capacity reaction products and sensory attributes of breads.
assayed with DPPH method was best correlated Food Chemistry, 197, 14‒23.
Deng, G. F., Lin,X., Xu, X. R., Gao, L. L., Xie, J. F., Li,
with total phenolic content. Cabbage storage
H. B. (2013). Antioxidant capacities and total
for three months period at 20 C resulted in phenolic contents of 56 vegetables. J Funct Foods, 5,
significant decrease of antioxidant compounds, 260‒266.
112
Fernandez-Leon M. A., Lozano M., Gonzales D., Ayuso medicine in Calabria region (Southern Italy).
M. C., Fernandez-Leon M. F. (2014), Bioactive Fitoterapia, 78, 52‒68.
compounds and total antioxidant activity of two Pisoschi, A. M., Danet, A. F., Kalinowski, S. (2008).
savoy cabbages, Czech J. Food Sci., 32, 549‒554. Ascorbic acid determination in commercial fruit juice
Glevitzky, M., Pop, M., Brusturean, G. A., Bogdan, I., samples by cyclic voltammetry. JAMMC 8.
Calisevici, M., Perju, D. (2008). Efficent use of Pisoschi, A. M., Negulescu, Gh. P., Pisoschi, A. (2010).
antioxidants to preserve fruit juice. Rev Chim Ascorbic acid determination by an amperometric
(Bucharest) 59, 1291‒1295 ascorbate oxidase-based biosensor. Rev Chim.
Gonçalves, B., Landbo, A., Knudsen, D., Silva, A. P., (Bucharest), 61, 339‒344.
Moutinho-Pereira, J., Rosa, E., Meyer, A. S. (2004). Pisoschi, A. M., Pop, A., Negulescu, Gh. P., Pisoschi, A.
Effect of ripeness and postharvest storage on the (2011) Determination of ascorbic acid content of
phenolic profiles of cheeries (Prunus avium L.). some fruit juices and wine by voltammetry performed
Journal of Agricultural and Food Chemistry, 52, at Pt and carbon paste electrodes. Molecules, 16,
523‒530. 1349‒1365.
Hatfield, G. (2004). Encyclopedia of folk medicine: old Podsęsdek, A. (2007). Natural antioxidants and
world and new world traditions. ABC-CLIO, 59‒60. antioxidant capacity of Brassica vegetables: A
Jahangir, M., Kim, H. K., Choi, Y. H., Verpoorte, R. review. LWT, 40, 1–11.
(2009). Healthaffecting compounds in Brassicaceae. Podsęsdek, A., Sosnowska, D., Redzynia, M., Anders, B.
Compr Rev Food Sci Food Saf., 8, 31‒43. (2006). Antioxidant capacity and content of Brassica
Lichtenthaler, H. K., 1987. Chlorophylls and oleracea dietary antioxidants. Int J Food Sci Tech,
carotenoids: pigments of photosynthetic 41, 49‒58.
biomembranes. Methods Enzymol., 148, 350‒382. Popa, C. V., Danet, A. F., Jipa, S., Zaharescu, T. (2010).
Kapusta-Duch, J., Kopeć, A., Piatkowska, E., Borczak, Determination of total antioxidant activity of wines
B., Leszczyńska, T. (2012). The beneficial effects of using a flow injection method with
Brassica vegetables on human health. Rocz Panstw chemiluminescence detection. Rev Chim.
Zakl Hig, 63, 389‒395. (Bucharest), 61, 11‒16.
Kaulmann, A., Jonville, M. C., Schneider, Y. J., Raoof, J. B., Ojani, R., Beitollahi, H. (2007).
Hoffmann, L., Bohn, T. (2014). Carotenoids, Electrocatalytic determination of ascorbic acid at
polyphenols and micronutrient profiles of Brassica chemically modified carbon paste electrode with 2, 7-
oleracea and plum varieties and their contribution to bis(ferrocenyl ethynyl) fluoren-9-one. Int J
measures of total antioxidant capacity. Food Chem., Electrochem., 2, 534‒548.
155, 240‒250. Singleton, V. L., Rossi, J. A., (1965). Colorimetry of
Kaur, C., Kapoor, H. (2001). Antioxidants in fruit and total phenolics (in grapes and wine) with
vegetables – The millenium’s health. International phosphomolybdic-phosphotungstic acid reagents.
Journal of Food Science and Technology, 36, Am. J. Enol. Viticult., 16, 144‒158.
703‒725. Tiwuri, U., Cummins, E. (2013). Factors influencing
Kris-Etherton, P. M., Hecker, K. D., Bonanome, A., levels of phytochemicals in selected fruit and
Coval, S. M., Binkoski, A. E., Hilpert, K. F., Griel, vegetables during pre- and post-harvest food
A. E., Etherton, T. D. (2002). Bioactive compounds processing operations. Food Res Int, 50(2), 497‒506.
in foods: Their role in the prevention of Vicas, S. I., Teusdea, A. C., Carbunar, M., Socaci, S. A.,
cardiovascular disease and cancer. American Journal Socaciu, C. (2013). Glucosinolates profile and
of Medicine, 113, 71S‒88S. antioxidant capacity of Romanian Brassica
Krinsky, N. I. (2001). Carotenoids as antioxidants. vegetables obtained by organic and conventional
Nutrition, 17, 815‒817. agricultural practices. Plant Food Hum Nutr, 68,
Pompelli, M. F., França1, S. C, Carvalho, Tigre R., 313‒32.
Oliveira, M. T., Sacilot, M., Pereira, E. C. (2012). Wawrzyniak, J., Ryniecki, A., Zembrzuski, W. (2005).
Spectrophotometric determinations of chloroplastidic Application of voltammetry to determine vitamin C
pigments in acetone, ethanol and dimethylsulphoxide, in apple juices. Acta Sci Pol Technol Aliment, 42,
Brazilian Journal of Biosciences, 11, 52‒58. 5‒16.
Passalacqua, N. G., Guarrera, P. M., De Fine, G. (2007).
Contribution to the knowledge of the folk plant
113
114
Industrial
and environmental
biotechnology
115
116
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
ISOLATION AND IDENTIFICATION OF EFFECTIVE MICROBIAL
STRAIN FOR ACCELERATED BIODEGRADATION OF LEATHER
INDUSTRY WASTE
Mioara Ancuța DUMITRU1, Ștefana JURCOANE2, Daniela BĂLAN3, Oana SICUIA3
1
Research Institute for Fruit Growing of Pitești, 110006, Romania
2
Microbial Biotechnological Center BIOTEHGEN, 59 Mărăști Blvd., District 1, 011464,
Bucharest, Romania
3
University of Agronomic Sciences and Veterinary Medicine of Bucharest, Faculty of
Biotechnologies, 59 Mărăști Blvd., District 1, 011464, Bucharest, Romania
Corresponding author email: [email protected]
Abstract:
Ecological biotechnology reduces the negative impact of industrial activities to the environment, by different
bioremediation processes. Such biotechnological measures are non-polluting and environmentally safe. The use of
specific microorganisms for the degradation of leather residues is an ecological alternative and an ecological tool for
bioremediation. The aim of this study was to isolate some microbial strain capable to accelerate the degradation of
leather waste, reducing the pollution that causes environmental damage. Three isolated bacterial strains, DA7, DA10
and DA13, were selected for their ability to produce extracellular proteases. These strains were identified with the
Biolog-Microbial Identification System as Brevundimonas diminuta, Bacillus cereus/thuringiensis and Bacillus cereus,
respectively. Studies revealed that the best enzymatic activity is higher after 120 hours cultivation, at 35oC temperature,
135 rpm and pH 7.0 units.
Key words: bacterial, isolation, identification, protease, leather, degradation, waste, pollution.
INTRODUCTION furmis, B. alcalophilus, B. subtilis (Ellaiah et
al., 2011). Bacillus species are the main produ-
Accelerated and disorganized industrial de- cers of extracellular proteases and industrial
velopment has generated several environmental sectors frequently use B. subtilis for the produc-
hazards. Therefore, it is demanding to promote tion of various enzymes (Dubal et al., 2008).
sustainable development of rationally used The aim of the present study was to evaluate the
natural resources to maintain existing ecosys- proteases producing potential of three selected
tems or to restore contaminated environments. bacterial strains isolated from leather waste.
This could be achieved by reducing, degrading,
collecting or recycling the polluting materials as MATERIALS AND METHODS
well as by improving industrialization
processes, diminishing the side effects on Bacterial isolation
humans, animals and on the environment. The microorganisms were obtained from leather
Proteolytic enzymes catalyze the hydrolysis of waste decomposition for 90 days in the soil.
the peptide bonds between amino-acids residues Samples of this substrate was introduced into
of protein (Dhillon et al., 2016). Such enzymes sterile medium with pH 7.0 containing 0.5 g/l
are produced by a wide range of microor- NaCl, 0.5 g/l CaCO3, 0.35g/l K2HPO4.
ganisms, like bacteria, including actinomycetes, After 48 h of incubation at 35oC and 135 rpm,
molds, yeast etc. (Akcana & Uyar, 2011). the culture was diluted ten times and plated on
Selected microorganisms have the capacity to agar Petri dishes.
produce proteolytic enzymes using leather as
unique source of carbon and nitrogen. In Bacterial characterization
bacteria, this enzyme is produced mainly by Newly isolated bacteria (90 colonies) were
strains belonging to Bacillus genus, especially, tested on three specific media: PCA containing
B. licheniformis, B. horikoshii, B. sphaericus, B. 0.5% tryptone, 0.1% glucose, 0.25% yeast
117
extract and 2% agar, pH 7; Starch-Agar, incubated at 33oC for 22-24 hours. After 22 to
containing 0.5% tryptone, 1% starch, 0.25% 24 hours of incubations, the optical densities
yeast extract, 2% agar, pH 7.2 and CMC-Agar were measured at 590nm and 750nm using the
containing 0.5% tryptone, 0.1% carboxymethyl semi-automated Biolog Spectrophotometer. The
cellulose, 0.25% yeast extract, 2% agar, pH 7. phenotypic pattern was analyzed with
Cultures were incubated for 48h at 35oC in MicroLog3 software compared with 2650
order to select the highest enzyme producing different microbial species included in the
strains (Habib et al., 2012). Biolog database.
Protease production was evaluated on Slim Milk
Agar. RESULTS AND DISCUSSIONS
Biomass production of leather degrading Isolation of leather degradation bacteria
bacteria A total number of 90 isolates was harvested
The isolates were grown in minimal media from the leather wastes after 90 days of
containing 1.0 g/l NaCl, 0.05 g/l CaCl2, 0.7 g/l decomposition in soil. These bacterial strains
KH2PO4, 0.9g/l MgSO4, 2.38 g/l K2HPO4, 3.0 were tested for different enzymes production
g/l sucrose, 0.6 g/l leather and incubated 120 h like cellulase and amylase (Figure 1).
at 135 rpm, 35oC.
Biomass growth was evaluated by measuring
the optical density (O.D.) at 600 nm using
Biomate 3 spectrophotometer.
Proteolytic activity was spectrophotometric
measured at 578 nm, according to Anson
method (1938). The reaction mixture contained
0.5 mL of enzymatic solution and 1 mL of 1%
casein in 0.2M phosphate buffer (pH 7). Figure 1. Amylase producing bacterial stains
Samples were incubated at 37oC for 10 min.
In order to reveal the CMC-ase activity, the
The enzymatic reaction was stopped with 2 mL
culture plated were treated with 0.1% Congo red
of 5% tricloracetic acid. The reaction mix was
solution and washed with 1% acetic acid. After
kept 30 min at room’s temperature and then it
these two step treatment the bacterial strains
was filtrated through 0.22 µm membrane. For
having cellulose activity presented a clear halo
every 0.5 mL filtrate was added 0.5 mL HCl
around their colonies. To detect amylase
0.2N, 2 mL NaOH 0.5N and 0.6 mL Folin-
producing bacteria, the microbial cultures
Ciocâlteu 1:2. After 30 min. at room’s
grown on starch containing medium were
temperature the extinction was measured.
flooded with iodine solution. The enzyme
producing strains revealed a clear halo around
Identification of the selected strains using
their colony. However, the remaining non-
Biolog-Microbial Identification System -
degraded starch formed an indigo-colored
GEN III Bacterial identification
compound in the presence of iodine.
The selected bacterial isolated were
biochemically identified using the GEN III
Protease-producing bacteria
Biolog-Microbial Identification System.
Around the proteases-producing bacteria it was
Selected microbial strains were grown over
observed an opalescent halo, having 0.2-1.1 cm
night, in isolated colonies, on BUG (Biolog
diameter, after first 24 hours of incubation at
Universal Growth) media at 33oC. Fresh
35oC. Most of the tested isolates were milky
biomass was resuspended in Biolog specific
white colored, dotted, with a diameter between
inoculation fluid, type A or B (depending on
0.1-1 cm, with regular shape. Other colonies
bacterial multiplication rate), at 84 to 88%
were yellow colored punctiform with irregular
turbidity (at 590nm according to the standard
edges, having a diameter between 0.1-0.5cm
protocol). Specific 96 well GEN III microplates
(Table 1).
were inoculated with freshly prepared bacterial
Oliveira et al. (2016) found, on Slim Milk Agar
suspension, 100 μl/well. Plates were then
(SMA), hydrolysis zone ranging from 2.5 to 1
118
mm, while Barros et al. (2013) observed Those that presented the best activity following
clearance zones ranging from 2.5 to 10.0 mm tests were selected for further experiments.
for B. subtilis stains grow on SMA plates at
30oC for 24 h. Singh et al. (2010) reported that Bacterial biomass productivity
among 70 proteolytic bacteria isolated from The maximum biomass production (0.590 U/ml)
soil, among which 40% were considered good was obtained in the minimal media supple-
protease producers, exhibit clearing zones mented with 3 g of sucrose and leather
higher than 3 mm on milk agar plates after their substrate, after incubation at 35oC (Table 2).
incubation for 20 to 30 h at 37oC.
Table 1. Results of bacterial- and halo-diameter measurements after 24 h of incubation at 35oC
on Slim Milk Agar for protease detection
Sample Bact. Halo Sample Bact. Halo Sample Bact. Halo Sample Bact. Halo
diam. diam. diam. diam. diam. diam. diam. diam.
(cm) (cm) (cm) (cm) (cm) (cm) (cm) (cm)
DA1 0.3 0.3 DA25 0.9 0.9 DA49 0.2 0.4 DA73 0.3 0.7
DA2 0.9 0.8 DA26 0.3 0.6 DA50 0.3 0.4 DA74 0.2 0.3
DA3 0.2 0.3 DA27 0.7 0.9 DA51 0.1 0.5 DA75 0.2 0.5
DA4 0.7 0.7 DA28 0.2 0.3 DA52 0.5 0.9 DA76 0.7 0.9
DA5 0.7 0.8 DA29 0.4 0.4 DA53 0.1 0.3 DA77 0.9 0.7
DA6 0.8 0.8 DA30 0.1 0.3 DA54 0.2 0.6 DA78 0.1 0.5
DA7 0.8 1.0 DA31 0.8 0.7 DA55 0.7 0.7 DA79 0.1 0.3
DA8 0.2 0.3 DA32 0.9 0.9 DA56 0.8 0.8 DA80 0.3 0.5
DA9 0.5 0.7 DA33 0.7 0.8 DA57 0.3 0.7 DA81 0.1 0.5
DA10 1.0 1.1 DA34 0.1 0.6 DA58 0.6 0.9 DA82 0.4 0.8
DA11 0.1 0.2 DA35 0.1 0.3 DA59 0.7 0.7 DA83 0.7 0.7
DA12 0.3 0.5 DA36 0.2 0.3 DA60 0.7 0.8 DA84 0.8 0.7
DA13 0.9 0.9 DA37 0.2 0.5 DA61 0.9 0.6 DA85 0.8 0.5
DA14 0.7 0.9 DA38 0.2 0.3 DA62 0.8 0.9 DA86 0.5 0.9
DA15 0.8 0.9 DA39 0.3 0.4 DA63 0.7 0.9 DA87 0.2 0.5
DA16 0.3 0.7 DA40 0.6 0.8 DA64 0.5 0.9 DA88 0.2 0.6
DA17 0.4 0.7 DA41 0.9 0.9 DA65 0.3 0.6 DA89 0.7 0.8
DA18 0.1 0.4 DA42 0.7 0.9 DA66 0.2 0.5 DA90 0.1 0.4
DA19 0.5 0.6 DA43 0.7 0.8 DA67 0.8 0.8
DA20 1.0 0.9 DA44 0.5 0.7 DA68 0.9 1.0
DA21 0.9 0.9 DA45 0.9 0.9 DA69 1.0 0.9
DA22 1.0 0.8 DA46 0.9 0.9 DA70 0.5 0.7
DA23 0.1 0.4 DA47 0.3 0.7 DA71 0.5 0.8
DA24 0.7 0.8 DA48 0.7 0.8 DA72 0.9 0.8
Table 2. Bacterial biomass production after 48 h
Sample D.O Sample D.O Sample D.O Sample D.O
600 nm 600 nm 600 nm 600 nm
DA1 0.187 DA24 0.197 DA47 0.210 DA70 0.187
DA2 0.198 DA25 0.191 DA48 0.282 DA71 0.266
DA3 0.183 DA26 0.207 DA49 0.297 DA72 0.278
DA4 0.180 DA27 0.189 DA50 0.202 DA73 0.295
DA5 0.188 DA28 0.203 DA51 0.271 DA74 0.266
DA6 0.191 DA29 0.297 DA52 0.189 DA75 0.263
DA7 0.299 DA30 0.239 DA53 0.186 DA76 0.251
DA8 0.189 DA31 0.215 DA54 0.205 DA77 0.280
DA9 0.197 DA32 0.199 DA55 0.201 DA78 0.222
DA10 0.590 DA33 0.219 DA56 0.180 DA79 0.278
DA11 0.201 DA34 0.281 DA57 0.191 DA80 0.235
DA12 0.203 DA35 0.263 DA58 0.207 DA81 0.290
DA13 0.347 DA36 0.254 DA59 0.219 DA82 0.244
DA14 0.219 DA37 0.233 DA60 0.189 DA83 0.188
DA15 0.193 DA38 0.279 DA61 0.231 DA84 0.207
DA16 0.204 DA39 0.289 DA62 0.276 DA85 0.183
DA17 0.289 DA40 0.255 DA63 0.203 DA86 0.189
DA18 0.277 DA41 0.199 DA64 0.218 DA87 0.199
DA19 0.180 DA42 0.277 DA65 0.297 DA88 0.272
DA20 0.287 DA43 0.264 DA66 0.246 DA89 0.263
DA21 0.288 DA44 0.200 DA67 0.239 DA90 0.209
DA22 0.182 DA45 0.185 DA68 0.222
DA23 0.181 DA46 0.191 DA69 0.214
119
Spectrophotometric quantification of as Brevundimonas diminua (strain DA7) –
proteolytic activity Figure 2, Bacillus cereus/thuringiensis (strain
Bacterial growth and protein digestion were DA10), and Bacillus cereus (strain DA13).
evaluated for the three selected bacterial strains The Biolog identification revealed a similarity
(DA7, DA10 and DA13). Results showed that index higher than 0.5 for each analysed strain,
DA10 was the most efficient strain, reaching the and distance value of at least 2 points between
highest OD values at 578nm. Enzyme activity the most similar microbial profiles, which
was evaluated as 0.556 U/ml after 24 h, and reveals a clear species-specific identification for
0.987 U/ml after 120h of incubation (Table 3). DA7 and DA13.
However, this identification system cannot
Identification of selected microorganisms reveal all de differences between B. cereus and
Based on the Biolog GEN III fingerprints of B. thuringiensis.
each strain, the selected bacteria were identified
Table 3. Proteolytic activity evaluated by spectrophotometric quantification at 578 nm
Incubation time
Strain 24 h 48 h 72 h 96 h 120 h Average
DA 13 0.231 0.415 0.586 0.938 0.993 0.633
DA 10 0.556 0.630 0.815 0.906 0.987 0.779
DA 7 0.183 0.139 0.426 0.506 0.616 0.374
a b
Figure 2. Brevundimonas diminua strain DA7:
a. Inoculated GEN III plate after 22 h of incubation at 33°C; b. MicroLog3 scanned fingerprint of the microplate
CONCLUSIONS REFERENCES
Three bacterial strains were isolated from Akcana, N., Uyar, F. (2011). Production of extracellular
leather degrading wastes. alkaline protease from Bacillus subtilis RSKK96 with
solid fermentation. EurAsian Journal of BioScience, 5,
The selected bacterial strains exhibit the highest 64‒72.
proteolytic activity of 0.987 U/ml after 120 Anson, M. L. (1938). The estimation of pepsin, trypsin,
hours of cultivation, at 35oC. papain, and cathepsin with haemoglobin. J. Gen.
Upon identification, it was revealed that the Physiol., 22, 79‒89.
microbial strains were: Brevundimonas Barros, F. F., Simiqueli, A. P., de Andrade, C. J., Pastore,
G. M. (2013). Production of enzyme from
diminuta (DA7), Bacillus cereus/thuringiensis agroindustrial waste by biosurfactant-producing strain
(DA10) and Bacillus cereus (DA13). of Bacillus subtilis. Biotechnology Research
International.
ACKNOWLEDGEMENTS Dhillon, A., Sharma, K., Rajulapati, V., Goyal, A. (2017).
Proteolytic enzyme. In Current developments in
biotechnology and bioengineering. Production,
The research was supported by BIOFUR E
isolation and purification of industrial products, Ed. 1,
5770/2012, project funded by UEFISCDI. Chapter 7, 149‒173.
120
Dubal, S. A., Tilkari, Y. P., Momin, S. A., Borkar, I. V. Oliveira, C. T., Pellenz, L. J. Q., Bradelli, A., Daroit, D. J.
(2008). Biotechnological routes in Flavour industries. (2016). Screening of bacteria for proteinase production
Advanced Biotech., 20‒31. and feather degradation. Waste and biomass
Ellaiah, P., Srinivasulu, B., Adinarayana, K. (2002). A valorization, 7(3), 447‒53.
review on microbial alkaline proteases. Journal of Singh, S. K., Tripathi, V. R., Jain, R. K., Vikam, S., Garg,
Scientific & Industrial Research, 61, 690‒04. S. K. (2010). An antibiotic, heavy metal resistant and
Habib, S. M. A., Fakhruddin, A. N. M., Begum, S., halotolerant Bacillus cereus SIU1 and its
Ahmed, M. M. (2012). Isolation and screening of thermoalkaline protease. Microbial Cell Factories, 9(1),
thermostable extracellular alkaline protease producing 59.
bacteria from tannery effluents. J. Sci. Res., 4, 515‒522.
121
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
EFFECT OF ACUTE GAMMA IRRADIATION ON GENERATION
TIME, LIPID, CHLROPHYLL A AND CAROTENS,
IN Chlorella sorokiniana UTEX 2130 AND Synechocystis PCC 6803
Cristina MOISESCU1, Ana-Valentina ARDELEAN1, 2,
Daniel NEGUT3, Ioan I. ARDELEAN1
1
Institute of Biology Bucharest, Romanian Academy, Splaiul Independenţei 296, District 5, 060031,
Bucharest, Romania
2
USAMV Bucharest, Faculty of Biotechnologies, 59 Mărăști Blvd., District 1, 011464,
Bucharest, Romania
3
Horia Hulubei National Institute of Physics and Nuclear Engineering, IRASM Radiation
Processing Department, 30 Reactorului Street, 077125, Măgurele-Ilfov, Romania
Corresponding author email: [email protected]
Abstract
Microalgae are microorganisms very important for fluxes of matter, energy and information on planet Earth as well as
for a plethora of biotechnological applications. In this paper, we present our original results concerning the use of
acute gamma irradiation (0.9 Gy/s) to challenge the cells of Chlorella sorokiniana UTEX 2130 and Synechocystis PCC
6803.The main results obtained on Chlorella sorokiniana UTEX 2130 are: a) a great decrease in the generation time to
56% after 10 Gy irradiation, to 60% after 50 Gy irradiation, and to77% after 100 Gy irradiation, whereas b)the
relative lipid content increased by 20% and 50% after 10 Gy and 100 Gy (as compared with the non-irradiated
control). The main results obtained on Synechocystis PCC 6803 are: a) the generation time decreased to 90% after 10
Gy irradiation, to 85% after 50 Gy irradiation, whereas b) there is an increase in the chlorophyll a content (by 33%)
and carotene (by 22%) after an irradiation of 50 Gy.
Key words: acute gamma irradiation, lipids, carotenoids, Chlorella sorokiniana, Synechocystis PCC 6803.
INTRODUCTION Huang, 2010; Mata et al., 2010; Amaro et al.,
2011; Schuhmann et al., 2012; Borowitzka,
Photosynthetic microorganisms, both 2013; Rawat et al., 2013; Velea et al., 2014;
prokaryotes and eukaryotes, have the ability to Ardelean & Manea, 2016; Ardelean et al.,
use water, carbon dioxide and some minerals to 2017; 2018).
perform complex endergonic biochemical One important task is to increase the content of
reactions enabling them to synthesize a lipid inclusions of the strains in order to
plethora of cellular constituents thus sustaining develop an economically viable biotechnology.
their multiplication. Furthermore, some of them In this respect, the main strategies are: i) the
are capable of mixotrophic growth, using both selection from naturally occurring strains of
inorganic and some organic substances as those with high lipid content; ii) the
primary carbon sources. This is why mutagenesis of this naturally occurring
photosynthetic microorganisms, in addition to populations in order to further select the most
the major planetary role in solar energy productive cells; iii) the use of genetic
conversion and biogeochemical cycles, have a engineering tools (including site directed
major contribution to a wide range of mutagenesis and metabolic engineering) to
biotechnological applications (Whitton, 2012 change the metabolic flux toward lipid
and references herein). One such direction deposition, and iv) the control of growing
concerns the ability of the majority of conditions (the so called stressors) such as
microalgae to accumulate lipids inside the cell nutrient depletion, nitrogen starvation, pH, and
(Sheehan et al., 1998; Chisti, 2007; Li et al., temperature shock. All these strategies have the
2008; Liang et al., 2009; Demirbas, 2010; potential to increase the lipid content (%
mass/mass) in microalgae (Sheehan et al.,
122
1998; Sharma et al., 2012; Sibi et al., 2016; These results obtained on both prokaryotic and
Yong et al., 2019). Recently, a new stressor, eukaryotic photosynthetic microorganisms are
namely Co60 γ-irradiation at low, non-lethal promising with respect to the aim of our goals,
doses, received attention with respect to the especially in the case of Chlorella sorokiniana
induction of increased lipid content in UTEX 2130 where differences in GT reached
irradiated microalgae (Tale et al., 2018; values up to 30-40% in irradiated populations
Ermavitalini et al., 2017). as compared with the control. However, at this
The aim of this contribution is to challenge the time, there is no causal explanation for these
cyanobacterium Synechocystis PCC 6803 and differences and further studies are necessary in
the green alga Chlorella sorokiniana UTEX order to elaborate a true working hypothesis.
2130 by acute, non-lethal gamma irradiation in
Table 2. Generation time for Chlorella sorokiniana
order to check if any changes in their UTEX 2130 at different irradiation doses
phenotypic traits, with special emphasis on the
Irradiation dose Generation time
generation time (in both strains) and lipid (Gy) (h)
%
inclusions (only in the green alga) will occur. Control 188.59 100.00
10 105.34 55.86
RESULTS AND DISCUSSIONS 50 118.89 63.04
100 145.01 76.89
Doubling time
In Table 1 are presented the results concerning Lipid inclusions content
the calculated generation time (GT) for the In Table 3, is presented the estimated lipid
cyanobacterium Synechocystis PCC 6803 inclusions content of Chlorella sorokiniana
irradiated at 10Gy, 50Gy, and 100Gy, as UTEX 2130 population irradiated at 10 Gy and
compared with the non-irradiated control. 100 Gy, as compared with non-irradiated
control. The estimation of lipid inclusions
Table 1. Generation time for Synechocystis PCC 6803 at content by Nile red fluorescence method
different irradiation doses showed a much stronger increase in the
Irradiation dose Generation time fluorescence signal after Nile red addition in
%
(Gy) (h) irradiated populations (10 Gy and 100 Gy) as
Control 77.09 100.00 compared with the control.
10 68.93 89.41
50 65.26 84.65 Table 3. The intensity of the fluorescence signal without
100 81.29 105.45 (-) and with (+) Nile red and the calculated ratio (+/-)
and % difference
The GT in control is taken as 100% and all Irradiation (-) Nile (+)Nile Numerical
%
other results are reported to the control. One dose (Gy) Red Red ratio ( +/-)
can see that the GT is shorter in populations Control 2222 9402 4.23 100.00
irradiated at 10Gy and 50Gy, as compared with 10 1594 8152 5.11 120.80
100 1823 11655 6.39 151.06
the control, whereas the irradiation at 100Gy
showed a longer GT, within the range of These results are very promising because the
standard deviation (5%). The irradiation at increased lipid droplet content (20% and 50%
500Gy and 1000Gy indicated the cell death in the 10Gy and 100Gy irradiated cells, occurs
(results non shown). in populations with shorter GT than in the
In Table 2 there are presented the GT for the control (55.86% and 76.89%, respectively).
green alga Chlorella sorokiniana UTEX 2130 Interestingly, the increase in lipid droplet
irradiated at 10Gy, 50Gy, and 100Gy, as content occurs when cells are grown in normal
compared with the non-irradiated control. The conditions, without any attempt (so far) to
results showed that the GT is much shorter in manipulate the growing conditions in order to
populations irradiated at 10Gy, 50Gy, and facilitate intracellular deposition of lipid
100Gy as compared with the control. The droplet, such as the decrease of nitrogen
irradiation at 500Gy and 1000Gy induced the concentration (Yong et al., 2019).
cell death, as in the case of cyanobacterium In Figure 1 there are presented individual cells
Synechocystis PCC 6803. of Chlorella sorokiniana UTEX 2130 after
123
labelling with Nile red, irradiated populations presented only images obtained in green
as compared with the control. There are fluorescence,
(a) (b)
(c) (d)
Figure 1. Individual cells of Chlorella sorokiniana UTEX 2130 after labelling with Nile red: (a) control,
non-irradiated cells; (b) 10Gy irradiated cells; (c) 50Gy irradiated cells; (d) 100Gy irradiated cells
where only the emission of Nile red in the PCC 6803 as wild cyanobacterial strains do not
hydrophobic ambient of lipid droplets is have true lipid inclusions, besides
evident (Greenspan, 1985) and one can see an polyhydroxybutyrate which is a common
increased surface (corresponding to labelled inclusion in cyanobacteria.
lipid droplets) emitting green fluorescence. The
images in red fluorescence are not shown as the Chlorophyll a and carotenoids content in
red fluorescence of Nile red lipid droplets is Synechocystis PCC 6803
mixed together with the red fluorescence of In the next table one can see the concentration
chlorophylls in the alga. of chlorophyll a and carotenoid pigments in
Microscopic investigations show larger areas Synechocystis PCC 6803.
inside the cells and also a larger number of Table 4. The concentration of chlorophyll a and
cells emitting green fluorescence, which carotenoid pigments in Synechocystis PCC 6803
indicates that these cells contain a higher lipid
Carotenoid
inclusions content. These microscopic images Irradiation Chlorophyll a
pigments
only document the presence of lipid droplets dose (Gy) (µg/mL)
(µg/mL)
without any numerical quantification, as no Control 12.65 8.20
image analysis has yet been performed on 10 14.48 9.37
them. The lipid inclusions content was not 50 16.77 10.05
100 14.71 9.76
estimated in the cyanobacterium Synechocystis
124
The results in the above table show that there phycobiliproteins productivity showed a
are some changes in the chlorophyll a and significant decrease by 10 and 36% below the
carotenes content. Taking the control as 100% control at 2 and 2.5 kGy of gamma radiation,
the increase in chlorophyll a concentration respectively whereas protein production was
went up to 114, 132, and 116%, respectively at decreased significantly with the concomitant
10, 50, and 100Gy. The same increases were increased of carbohydrate production by 106,
registered for the total carotenes (i.e. 114, 122, 246 and 146%, respectively and lipid content
and 119%). increased significantly over the control at 0.5
The cyanobacterium Synechocystis PCC 6803 kGy. Interestingly, carotenoid productivity
and the green alga Chlorella sorokiniana showed significant increase at all used gamma
UTEX 2130 had been chosen for our doses up to 155% over the control.
experiments as they are versatile photosynthetic In a recent paper (Ermavitalini et al., 2017), the
microorganisms intensively used in both work done on Botryococcus sp. irradiated at
fundamental and applicative research (Whitton, low doses (2, 4, 6, 8 and 10 Gy) showed that
2012; Lizzul et al., 2018 and references herein) irradiation using gamma rays changed the
able to grow either strictly photosynthetically characteristics of their growth, biomass,
but also mixotrophic or even heterotrophic, not percentage of total lipids cell and fatty acid
only on pure organic substances but also on profile. More precisely, the highest biomass
waste feedstock, with short doubling times. The and lipid content found in 10 Gy irradiated
scientific community strongly agree that these microalgae are 0.833 g biomass and 41 % lipid
strains have a strong industrial potential (Lizzul content. Furthermore, fatty acid profile of
et al., 2018; Whitton, 2012 and references Botryococcus sp. control has 6 fatty acids while
herein; Hu et al., 1990) studied the effect of 10 Gy irradiated microalgae has 12 fatty acids,
gamma radiation on the growth and with the long-chain fatty acids increased,
morphology of A. platensis. They reported that whereas short-chain fatty acids decreased. Tale
low doses of gamma rays, less than 1 kGy, et al. (2018) used gamma irradiation as a
could stimulate its growth. Small changes in stressor to trigger lipid accumulation in two
the morphology of the filament were found at strains of Chlorella sorokiniana (i.e. C.
doses less than 0.5 kGy. The LD50 was 1.0 sorokiniana KMN2 and C. sorokiniana
kGy, while 2.5 kGy caused 100% lethality. KMN3). These strains were treated by Co60 γ-
Wang et al. (1998) studied the effect of gamma irradiation, in the range of 100 to 1100 Gy,
radiation (up to 6 kGy) on the growth and much higher than the dosses used by us in the
morphology of four different strains of algal strain Chlorella sorokiniana UTEX 2130.
Arthrospira sp. and concluded that it showed The authors (Tale et al., 2018) reported the
resistance to gamma irradiation with enhancement of the lipid content of more than
stimulation of growth at low doses, while the 40% of biomass as well as the level of
filaments would break up or even disintegrate intracellular reactive oxygen species. They also
at high doses. Although many studies have showed that the expression patterns of
evaluated the biological response of microalgae regulatory genes involved in lipid biosynthesis,
to high doses of gamma radiation, few studies namely acetyl-CoA carboxylase and
have focused on stimulation of bioactive diacylglycerolacyl transferase, were up
compounds production in A. platensis. regulated immediately after irradiation and
Abomohra et al. (2016) studied the influence of were highest 3 days post irradiation (Tale et al.,
gamma radiation on the growth and production 2017). The authors also performed the analysis
of some active substances of the of the fatty acids composition in irradiated and
cyanobacterium Arthrospira platensis. In their control populations, showing that γ-irradiation
important paper they found the following: i) induced lipid enhancement is accompanied by
biomass production was significantly inhibited higher accumulation of shorter carbon chain
by 21 and 34%, with respect to the control at fatty acid (C-16) compared to longer chain fatty
2.0 and 2.5 kGy, respectively and chlorophyll a acids. They claimed that the novel strategy of
content showed 11% reduction at 2.5 kGy using gamma radiation as a faster andextremely
compared to the control. In addition, potent stressor for triggering lipid biosynthesis
125
in microalgae has immense potential in irradiation, whereas b) there is an increase in
industrial biodiesel production. They put the chlorophyll a content (by 33%) and
forward the hypothesis that γ-irradiation in carotene (by 22%) after an irradiation of 50 Gy.
microalgae causes oxidative stress and up-
regulationof lipid biosynthetic pathway which ACKNOWLEDGEMENTS
in turn leads to lipid accumulation.
Another study (Badri et al., 2015) showed that This work was funded by the PN-III-P1-1.2-
Arthrospira sp. PCC 8005 is highly tolerant to PCCDI2017-0323 Project “Utilization of
gamma raysand can survive to at least 6400 Gy Gamma irradiation in biotechnological
(dose rate of 527 Gy/h). Their detailed processes with applications in bioeconomy”
proteomic and transcriptomic analyses (BIO-GAMMA). Thanks are due to Mrs
performed after irradiation with 3200 or CIRNU Marinela for her skilled technical
5000Gy showed a decline in photosystem II assistance and kind devotion.
quantum yield, reduced carbon fixation, and
reduced pigment, lipid, and secondary REFERENCES
metabolite synthesis. On the other hand,
transcription of photo-sensing and signalling Abomohra, A. E. F., El-Shouny, W., Sharaf, M., Abo-
pathways, and thiol-based antioxidant systems Eleneen, M. (2016). Effect of gamma radiation on
growth and metabolic activities of Arthrospira
was induced. Furthermore, transcriptomics did platensis. Braz. Arch. Biol. Technol., 59: e16150476.
show significant activation of ssDNA repair Amaro, H. M., Guedes, A. C., Malcata, F. X. (2011).
systems and mobile genetic elements (MGEs) Advances and perspectives in using microalgae to
at the RNA level. Interestingly, the cells did not produce biodiesel. Appl. Energy, 88, 3402‒3410
induce the classical antioxidant or DNA repair Ardelean, A. V., Ardelean, I. I., Sicuia-Boiu, O. A.,
Cornea, P. (2018). Random mutagenesis in
systems, such as superoxide dismutase (SOD) photosynthetic microorganisms further selected with
enzyme and the RecA protein. Arthrospira sp. respect to increased lipid content. Sciendo, 1, 501-
cells lack the catalase gene and the LexA 507. DOI: 10.2478/alife-2018‒0079
repressor. Based on the observation that Ardelean, A. V., Cîrnu, M., Ardelean, I. I. (2017).
irradiated Arthrospira cells did induced Selection of microalgal strains with low starch
content as potential high lipid - containing isolates.
strongly a group of conserved proteins, the Scientific Bulletin. Series F. Biotechnologies, XXI,
authors (Badri et al., 2015) put forward the 210‒215.
hypothesis that these proteins could be Ardelean, I. I., Manea, M. (2016). Indoor cultivation of
involved in the response of cyanobacterial cells selected oil – containing consortia of photosynthetic
to irradiation, which remains to be checked. microorganisms for further biodiesel production;
preliminary financial evaluation. Scientific Bulletin.
In our opinion, the interactions between Series F. Biotechnologies, XX, 237‒242.
photosynthetic microorganisms (both Badri, H., Monsieurs, P., Coninx, I., Wattiez, R., Leys,
prokaryotes and eukaryotes) and gamma N. (2015). Molecular investigation of the radiation
irradiation, at low, non-mutagenic doses, is still resistance of edible cyanobacterium Arthrospira sp.
in its infancy. PCC 8005. Microbiology Open, 4, 187‒207.
Borowitzka, M. A. (2013). High-value products from
microalgae-their development and
CONCLUSIONS commercialisation. J. Appl. Phycol., 25, 743‒756.
Chisti, Y. (2007). Biodiesel from microalgae. Biotechnol.
Acute gamma irradiation in Chlorella Adv., 25, 294‒306.
sorokiniana UTEX 2130 showed the Demirbas, M. F. (2010). Microalgae as a feedstock for
biodiesel. J. Energy Education Science and
followings: a) a great decrease in the GT to Technology Part A, 25(1-2), 31‒43.
56% after 10Gy irradiation, to 60% after 50Gy Ermavitalini, D., Yuliansari, N., Prasetyo, E. N., Saputro
irradiation, and to7 7% after 100 Gy irradiation, T. B. (2017). Effect of Gamma 60Co Irradiation on
whereas b)the relative lipid content increased the growth, lipid content and fatty acid composition
by 20% and 50% after 10Gy and 100Gy as of Botryococcus sp. microalgae. Biosaintifika:
Journal of Biology & Biology Education, 9(1), 58‒
compared with the non-irradiated control. 65.
Acute gamma irradiation in Synechocystis PCC Greenspan, P., Mayer, E. P., Fowler, S. D. (1985). Nile
6803 show that: a) the GT decreased to 90% red - a selective fluorescent stain for intracellular
after 10Gy irradiation and to 85% after 50Gy lipid droplets. J. Cell Biol., 100, 965‒973.
126
Hu, T, Yang, S, Mao, Y. (1990). The effect of γ- Energy’s Aquatic Species Program: Biodiesel from
irradiation on Spirulina platensis. Acta Agriculturae Algae; National Renewable Energy. NREL/TP-580-
Nucleatae Sinica, 4(2), 120‒124 24190.
Huang, G., Chen, F., Wei, D., Zhang, X., Chen, G. Sibi, G., Shetty, V., Mokashi, K. (2016). Enhanced lipid
(2010). Biodiesel production by microalgal productivity approaches in microalgae as an alternate
biotechnology. Appl. Energy. Elsevier Ltd, 87(1), 38‒ for fossil fuels - A review. J. Energy Inst., 89, 330‒
46. 334.
Li, Y., Horsman, M., Wang, B., Wu, N., Lan, C. Q. Tale, P. M., Singh, R., Kapadnis, P. B., Ghosh, B. S.
(2008). Effects of nitrogen sources on cell growth (2018). Effect of gamma irradiation on lipid
and lipid accumulation of green alga Neochloris accumulation and expression of regulatory genes
oleoabundans. Appl. Microbiol. Biotechnol., 81(4), involved in lipid biosynthesis in Chlorella sp. J.
629‒636. Appl. Phycol., 30, 277
Liang, Y. N., Sarkany, N., Cui, Y. (2009). Biomass and https://doi.org/10.1007/s10811-017-1229-9.
lipid productivities of Chlorella vulgaris under Wang, Z., Xu, B., Zhao, X., Jiang, J., Chen, S. (1998).
autotrophic, heterotrophic and mixotrophic growth The effect of gamma-irradiation on different strains
conditions. Biotechnol. Lett., 31, 1043‒1049. and morphological filaments of Spirulina. Acta
Lizzul, A. M., Lekuona-Amundarain, A., Purton, S. I., Agriculturae Universitatis Zhejiangensis., 24(02),
Dand Campos, L. C. (2018). Characterization of 121‒125.
Chlorella sorokiniana UTEX 1230. ID Biology, 7, Velea, S., Ilie, L., Stepan, E., Chiurtu, R. (2014). New
25. doi:10.3390/biology7020025. photobioreactor design for enhancing the
Mata, T. M., Martins, A. A., Caetano, N. S. (2010). photosynthetic productivity of Chlorella
Microalgae for biodiesel production and other homosphaera culture. Revista de Chimie (Bucharest),
applications: A review. Renew. Sustain. Energy Rev., 65, 56‒60.
14, 217‒232. Whitton, B. A. (2012). Ecology of Cyanobacteria II.
Rawat, I. R., Ranjith Kumar, T., Mutanda, F. (2013). Their Diversity in Space and Time. Springer
Biodiesel from microalgae: A critical evaluation from Science Business Media B.V. ISBN 978-94-007-
laboratory to large scale production. Applied Energy, 3854-6, pp. 760
103, 444‒446. www.doubling-time.com/compute.php.
Schuhmann, H., Lim, D. K. Y., Schenk, P. M. (2012). Yong, W. K., Lim, P. E., Vello, V., Sim, K. S, Majid,
Perspectives on metabolic engineering for increased N. M., Mustafa, E. M., Sulaiman, N. M. N., Liew, K.
lipid contents in microalgae. Biofuels, 3, 71‒86. E., Chen, B. J. T., Phang, S. M. (2019). Metabolic
Sharma, K. K., Schuhmann, H., Schenk, P. M. (2012). and physiological regulation of Chlorella sp.
High lipid induction in microalgae for biodiesel (Trebouxiophyceae, Chlorophyta) under nitrogen
production. Energies, 5, 1532‒1553. deprivation. Journal of Oceanology and
Sheehan, J., Dunahay, T., Benemann, J., Roessler, P. Limnology, 37(1), 186‒198.
(1998). A Look Back at the U.S. Department of
127
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
LACCASE: MACRO AND MICROBIAL SOURCES, PRODUCTION,
PURIFICATION AND BIOTECHNOLOGICAL APPLICATIONS
Cristina Valentina ALBU (PROCA), Raluca Ştefania ENCEA, Camelia DIGUŢĂ,
Florentina MATEI, Călina Petruţa CORNEA
University of Agronomic Sciences and Veterinary Medicine of Bucharest,
Faculty of Biotechnologies, 59 Mărăşti Blvd., District 1, 011464, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
Laccase belongs to the blue multicopper oxidases and participates in degradation of polymers, ring cleavage of
aromatic compounds and cross-linking of monomers. It is distributed in higher plants and fungi. It is present in
Ascomycetes, Deuteromycete, and Basidiomycetes and abundant in lignin-degrading white-rot fungi. Lacasse has
been reported to be produced by different mushrooms (Trametes, Ganoderma, Pleurotus) and by filamentous
bacteria (Streptomyces) or fungi (Aspergillus). The article proposes a comparative analysis of the optimal
conditions for laccase production in the case of macromycetes and some micromycetes, like fungi or filamentous
bacteria, meanwhile describing the isolation, purification and characterization of the laccase produced by such
organisms. All these issues will be approached through the biotechnological application of these enzymes (dye
decoloration, bioremediation etc).
Key words: laccase, macromycetes, micromycetes, bacteria, fungi.
INTRODUCTION preserving the enzymatic activity of laccases
(Agematu et al., 1993).
Laccase was first detected in the Japanese lac
tree Toxicodendron verniciflua. Later, it was LACCASE – BIOCHEMISTRY
found in other plants, in many insects and in In recent years, enzymes, like laccase, have
fungi, including yeasts (e.g., Cryptococcus), gained great importance in industries.
molds (e.g., Penicillium), mushrooms (e.g., Laccases are the oldest and most studied
Agaricus), and white-rot fungi (e.g., enzymatic systems present in nature. These
Pleurotus) (Mikolasch et al., 2009). enzymes contain 15-30 % carbohydrate and
Laccases play an important role in the food have a molecular mass of 60-90 kDa.
proccessing industry, dye decolorization, Laccase is a copper-containing molecule, 1,4-
bioremediation and biodegradation, pulp and benzenediol: oxygen oxidoreductases (EC
paper industry (Couto et al., 2006) and some 1.10.3.2) found in higher plants and
medical applications. Laccase is an enzyme microorganisms. These oxidoreductases are
used for degradation of pesticide and glycosylated polyphenol oxidases that contain
insecticide, organic synthesis and pulp 4 copper ions per molecule that carry out 1
delignification (Couto et al., 2008), waste electron oxidation of phenolic and its related
detoxification, biosensor and analytical compound, and reduce oxygen to water
applications, textile dye transformation and (Couto et al., 2006; Gianfreda et al., 1999).
food technology. Recently the activity of When the substrate is oxidized by laccase, it
laccases have been efficiently applied to loses a single electron and usually forms a
nanobiotechnology due to their ability to free radical which may undergo further
catalyze electron transfer reactions without oxidation or non-enzymatic reactions
additional cofactor. The technique for the including hydratation, disproportionation, and
immobilization of biomolecule such as layer- polymerization (Faccelo et al.,1993). These
by-layer, self-assembled monolayer technique enzymes are polymeric and generally contain
and micropatterning can be used for one of each type 1, type 2 and type 3 copper
128
center/subunit where the type 2 and type 3 are aspects. Enzymatic activity research of these
closer together forming a trinuclear copper mushrooms was, is and will be one of the
cluster. important topics for understanding their
Laccases are divided into “low-redox physiological and biochemical features in
potential” and “high-redox potential”, depen- order to emphasize the considerable potential
ding on the structure and properties of the for biotechnological and industrial
copper center. applications.
The high-redox potential laccases occur Laccase is one of the most studied enzymes,
mainly in basidiomycetes, especially white- because, according with Krupodorova et al.
rot fungi, the low-redox potential laccases (2014), its positive reaction was detected in
seem to be widely distributed in molds, 21 species, frequently in 2-4 days after
bacteria, insects, and plants. inoculation. It formed a reddish-brown zone
Unlike most enzymes, laccases have the around the mycelium. The most active
ability to display their activity on a wide producers of laccase were Lentinus edodes, L.
range of substrates like monophenols, luscina and Coprinus comatus (the latter two
diphenols, methoxyphenols, polyphenols, mentioned species are referred to soil
aromatic amines, benzenethiols and even saprotrophic). Krupodorova et al. (2014)
some inorganic compounds such as iodine mentioned laccase presence in two out of four
(Burlacu et al., 2018). brown-rot species (Agrocybe aegerita and
Given their versatility and broad substrate Fomitopsis pinicola). Souza et al. (2008)
specificity, laccases, as a family of copper- found silencing genes of laccase in the
containing oxidases catalyzing a variety of genome of brown-rot microorganisms.
oxidations, could become one of the most Investigations showed laccase activity for the
important biocatalysts in fungal species L. luscina, Crinipellus schevczenkovi,
biotechnology. Because of this, their A. aurea, Hypsizygus marmoreus, L. schimeji,
biochemical properties and molecular Oxyporus obducens and S. litschaueri for the
evolution are of considerable interest and first time.
have been summarized in several reviews The existence of laccase has been detected in
(Mikolasch et al., 2009). earlier studies in similar species: A. agerita,
Laccase activity was determined using C. comatus, Fomes fomentarius, Fomitopsis
guaiacol as substrate. The reaction mixture pinicola, Flamulina velutipes, Ganoderma
contained 1 ml enzyme sample, 3 ml sodium lucidum, G. applanatum, Grifola frondosa, L.
acetate buffer (10 mM, pH 5.0) and 1 ml edodes, P. eryngii and P. ostreatus. This
guaiacol (2 mM). The mixture was incubated enzyme has been found in P. djamor, H.
at 30oC for 15 min. The changes in myxotricha, L. sulphureus and T. versicolor
absorbance due the oxidation of guaiacol in (Krupodorova et al., 2014).
the reaction mixture were recorded by Nicolcioiu et al. (2018) research regarding
spectrophotometer at 450 nm, with a molar laccase activity has lead to the conclusion that
extinction coefficient for guaiacol (Ɛ450 = among all tested isolates Pleurotus ostreatus
6740 M-1 cm-1). One unit of enzyme activity var. ʻFloridaʼ, Trametes versicolor and
(U/ml) is defined as the amount of enzyme Ganodrema applanatum, the fungal strains
that oxidized 1 μmol of guaiacol per minute were more efficient in laccase production than
(Nicolcioiu et al., 2018). Laetiporus sulphureus and Flammulina
velutipes.
MACROBIAL SOURCES OF LACCASE
Research studies in recent decades have been MICROBIAL SOURCES OF LACCASE
focused on the different mushroom species, Considering microbial sources, laccase is
which belong particularly to Macrofungi produced by a large variety of bacteria (Table
(Macromycetes). Ascomycetes and 1) and filamentous fungi (Table 2).
Basidiomycetes are two of the most important In lower fungi, as Zygomycetes or
group of Macrofungi that have been Chytridiomycetes, the production of laccase
intensively investigated regarding various was not demonstrated (Baldrian et al., 2006).
129
There are also laccase-producing yeasts, like and are thought to be more valuable in dye
Kluyveromyces dobzhanskii, Pichia decolorization, biofuel production and
manshurica (Wakil et al., 2017) and biobleaching.
Cryptococcus neoformans, but they have far There are some actinomycetes with lignolytic-
fewer known representants than other classes activity, like Trichoderma sp. or
of microorganisms. Botryosphaeria sp., that displayed laccase
production.
Table 1. Bacterial laccase sources The laccase produced by Monocillium
(after Desai and Nityanand, 2011) indicum was the first Ascomycetae laccase
Sources References
Bacteria
characterized, that had similar immunological
Azospirillium lipoferum Givaudan et al., 1993; Faure features with Coriolus versicolor and
et al., 1994 Agaricus bisporus laccases and with lignin
Bacillus subtilis Martins et al., 2002 peroxidase activity similar to Phanerochaete
S. maltophilia AAP56 Galai et al., 2009 chrysosporium laccase (Thakker et al., 1992;
Streptomyces coelicolor Dube et al., 2008 Shraddha et al., 2011).
Pseudomonas putida was revealed to be a
Table 2. Fungal laccase sources laccase-producing bacteria, with the attribute
(after Baldrian, 2006) of decolorizing synthetic dyes and industrial
Sources References
effluents.
Fungi
Aspergillus nidulans Scherer and Fischer, 1998 Streptomyces cyaneus and Streptomyces
Botrytis cinerea Slomczynski et al., 1995 ipomoea exhibit laccase activity, the former
Chalara paradoxa Robles et al., 2002 having an activity tens of times higher
Chetomium Chefetz et al., 1998 (Margot et al., 2013). Although it is known
thermophilum that Streptomyces griseus is also a producer of
Magnaporthe grisea Iyer and Chattoo, 2003 laccase, in the cited assessment it did not
Mauginiella sp. Palonen et al., 2003
Melanocarpus Kiiskinen et al., 2002
show this kind of enzymatic activity - the
albomyces localization of the laccase could be
Monocillium indicum Thakker et al., 1992 responsible for the absence of activity
Myrothecium Sulistyaningodyah et al., detected.
verrucaria 2004 A fungal laccase, produced by and isolated
Neurospora crassa Froehner and Eriksson, from the Ascomycete Chaetomium sp., was
1974
Ophiostoma novo- Binz and Canerascini, characterized with the ability to decolorize
ulmi 1997 different dyes, even in the presence of high
Podospora anserina Durrens, 1981 concentrations of sodium chloride (Mtibaa et
Rhizoctonia solani Wasaki et al., 1967 al., 2017). The purified laccase from this
Trichoderma Wang and Ng, 2004 fungus is able to degrade or transform various
giganteum
synthetic dyes, such as Acid Orange, Direct
Red, Direct Blue and RBBR (Remazol
The properties of laccase includes: extracel- Brilliant Blue R), with and without mediators.
lular localization, molecular weight of appro- Another laccase, able to decolorize synthetic
ximatively 60 to 70 kDa (typical in fungi), dyes, is the one produced by Spirulina
isoelectric pH point between 3.0 and 7.0, platensis, a cyanobacterium. Afreen et al.
optimal pH in fungi between 3.6 and 5.2 (2017) purified and characterized the laccase
(highly dependent on the substrate), usually from this Spirulina genus and evaluated its
monomeric structure (homodimeric laccases decolorization property on Reactive Blue 4,
were found too in Gaeumannomyces the results indicating an almost complete
graminis, Monocillium indicum, Podospora decolorization, without any mediators.
anserina), optimal temperature around 55- A psychrotolerant bacterial strain of Serratia
60°C (for B.cinerea). In spectrophotometry, marescens was studied for its laccase
purified laccase has a blue appearance around production (Kaira et al., 2015). It was proved
600 nm. to synthesize laccase even under extreme
Bacterial laccases have a higher thermostat-
bility and halotolerance than fungal laccases
130
conditions, which is likely to be beneficial for monomeric laccase with a specific activity of
biotechnological applications. 91.443 Umg−1 (Hess et al., 2002). Laccase
The laccase obtained from Ascomycetae from T. versicolor is purified with ion
Myceliophtora thermophila is suitable for exchange chromatography followed by gel
industrial pulp bleaching and delignification filtration with a specific activity of 101
(Babot et al., 2011). UmL−1 and 34.8-fold purification (Cordi et
al., 2007). Laccase from Stereum ostrea is
ISOLATION, PURIFICATION AND purified with ammonium sulfate followed by
CHARACTERIZATION OF LACCASE Sephadex G-100 column chromatography
Isolation of laccase with 70-fold purification (Viswanath et al.,
When the enzyme is immobilized, it becomes 2008). Laccase from fruiting bodies is
more resistant to alteration in the environ- purified with ammonium sulfate precipitation
ment, allowing easy recovery and reuse of with 40-70% saturation and DEAE cellulose
enzyme for multiple purposes. That is why chromategraphy then 1.34 and 3.07 fold
researchers are moving towards the efficient purification is obtained, respectively
methods of immobilization that influence the (Shraddha et al., 2011).
properties of the biocatalyst. Laccase has Laccase can be immobilized on different
been studied with a wide range of different pyrolytic graphite (best support), ceramics
immobilization methods and substrates supports and on a carbon fiber electrode
(Shraddha et al., 2011). where it acts as a biosensor. At the 12th day,
A variety of methods include immobilization maximum laccase activity of 40.774 UL−1
on polyamide matrices, on glass supports, on was achieved (Minussi et al., 2007). An
epoxy-activated carriers, on magnetically optical biosensor is fabricated by using
separable silica spheres, on magnetic chitosan stacked films for the detection of phenolic
microspheres, on nanoparticles and on compounds; 3-methyl-2-benzothiazolinone
kaolinite. Laccase may be immobilized by hydrazone (MBTH) was immobilized on a
entrapment in alginate - chitosan microcap- silicate film and laccase on a chitosan film
sules or in Cu-Al and Cu-alginate beads. In (Alimin Abdul et al., 2009).
most cases, immobilization lead to increased
enzyme stability and improved resistance to Characterization of laccase
changes in temperature and pH (Mikolasch et Laccase was first characterized when it was
al., 2009). extracted from the Japanese lacquer tree Rhus
vernicifera in 1883. Later, in 1896, it was
Purification of laccase demonstrated that laccases were also present
Ammonium sulfate is being used for the in fungi (Desai and Nityanand, 2011).
enzyme purification. Researchers have found In higher plants, laccases can be found in
much more methods such as protein precipi- Rhus vernicifera, Rhus succedanea, Lactarius
tation by ammonium sulfate, anion exchange piperatus, Prunus persica, Acer
chromatography, gel filtration chromate- pseudoplatanus, Chaetomiaceae sp.
graphy and desalt/buffer exchange of protein. According to Takao Saito et al. (2003), the
Single-step laccase purification from purified laccase produced one band on an
Neurospora crassa takes place by using celite SDS-PAGE gel at the apparent molecular
chromatography and 54 fold purifycation was mass of approximately 73 kDa (Figure 1A).
obtained with a specific activity of 333 Umg−1 This laccase was used in gel filtration
(Grotewold et al., 1998). Laccase from LLP13 chromatography on a HiLoad 16/60 Superdex
was first purified with column chromate- 200 pg column, the molecular mass of the
graphy and then purified with gel filtration native enzyme being estimated at 80 kDa. The
(Kiiskinen et al., 2004a; Kiiskinen et al., isoelectric point (pI), determined by analytic
2004b). Laccase from T. versicolor is purified isoelectric focusing, was 3.5 (Figure 1B). This
by using ethanol precipitation, DEAE- pI is similar to that of the laccase from the
Sepharose, Phenyl-Sepharose and Sephadex basidiomycete PM1 (Coll PM et al., 1993),
G-100 chromatography which is a single which has an acidic isoelectric point.
131
of laccase from Botrytis cinerea affected the
beans in the must, thus resulting in a
significant reduction of phenolic compounds.
The important polyphenols in wine, including
their major classes (phenolic acids, catechins,
anthocyanins, tannins and stilbenes), are
converted to the corresponding quinones, that
will pass into dark-colored polymers. These
polymers are insoluble in water and aqueous
solutions and precipitates from the must and
wine. Moreover, the oxidation of the phenolic
compounds can adversely affect the sensorial
and nutritional properties of the wine.
Figure 1. SDS-PAGE (A) and IEF (B) of the purified The storage of beer depends on various
strain I-4 laccase (Takao Saito et al., 2003) factors, such as the haziness, the oxygen con-
tent, the temperature. The haziness is caused
To determine the state of its catalytic center, by small amounts of proanthocyanidins,
the laccase was characterized spectrosco- which are naturally occurring polyphenols
pically. The purified laccase had a blue color, and proteins that could cause precipitation.
typical of copper-containing proteins. The This type of complex is known as “cold haze”
UV-VIS spectrum of laccase showed a peak and occurs during chilling – can be re-
absorption at about 611 nm, typical for the dissolved at room temperature or at higher
type I Cu(II), that is responsible for the deep temperatures. Even the products that do not
blue color of the enzyme. A shoulder at about have this disorder when packaged, could form
333 nm suggests the presence of type III it during long storage. The usage of laccase
binuclear Cu(II) pair (Eggert et al., 1996). for the oxidation of polyphenols as an alter-
The EPR spectrum of the laccase showed the native to traditional therapy has been tested
superimposed signals from type I and type II many times. Also, laccase is used to eliminate
Cu(II), each in a different coordination the oxygen at the end of the production
environment. The parameters of the type I process of beer (Osma et al., 2010).
Cu(II) signal were gII = 2.21 and AII = 8.3 × Sugar beet pectin is a functional aliment,
10−3 cm−1, and those of the type II Cu(II) which can form thermo-irreversible gelatins.
signal were gII = 2.25 and AII = 1.93 × 10−2 These types of gelatin are very interesting and
cm−1. These spectral characteristics are can be used in the food industry because they
similar to those of other blue copper proteins can be warming while retaining the gel
that have four copper atoms (Dedeyan et al., structure. Compared with peroxidase, which
2000; Shin KS et al., 2000). is used as a food additive, laccase proved to
be more effective and safer for consumption.
APPLICATIONS OF LACCASE IN One of the biggest problems in the fruit juice
BIOTECHNOLOGY processing is the enzymatic and the chemical
Food Processing Industry browning. The color and the taste of the fruit
In the food industry, laccase is used for the depends on the phenolic compounds, which
elimination of undesirable phenolic com- should be selectively removed from the
pounds in wine and beer stabilization, in composition, in order to prevent any alteration
baking, in juice processing and in the biore- of taste, flavor, and color – attributed to oxi-
mediation of wastewater (Shraddha et. al., dation of polyphenols. To prevent the disco-
2011). loration of the fruit beverages, by replacing
Wine browning, due, primarily, to enzymatic the chemical adsorbents, enzymes are being
and chemical oxidation of phenolic com- used, such as laccase. This enzyme has the
pounds, represents one of the most unwanted potential to eliminate unwanted phenols res-
processes that can occur in wine-making. ponsible for browning and disorder in many
During the crushing of the grapes, the release beverages, such as fruit juice, beer, and wine.
132
In the bread-making process, it is known that is a laccase inducing agent, that modifies the
additives are added to improve bread and enzymatic activity by increasing it, the
bread dough, from which results improved concentration of dissolved oxygen is reduced
texture and flavor, a larger volume and longer (Unal et al., 2001).
freshness. In recent years, enzymes have been Romero et al. studied Stenotrophomonas
increasingly used as enhancing agents, maltophilia bacteria and found that it is able
including laccase. Even if the laccase used in to decolorize Congo Red, Toluidine Blue,
the preparation of doughs could be of any Methylene Blue, Methyl Green and Methyl
origin, inclusively vegetal, it is preferable to Orange (Shraddha et al., 2011).
be of microbial origin, because it is easier to
handle and produce on a larger scale (Si, Bioremediation and Biodegradation
2001). Laccase is used in bioremediation, bio-
solubilization, and desulfurization, in the
Dye Decolorization production of biosensors and biofuels and
In the textile industry, there are used nu- also in the production of fiberboards. Laccase
merous chemicals (which vary from organic is used for degradation of industrial wastes,
to inorganic compounds) and a large volume like paper, oil, leather, pharmaceutical,
of water. These chemical compounds make pesticides because of her oxidizing ability
the dyes resistant to fading when exposed to towards phenolic and non-phenolic compound
water, to light, or to other chemicals. Laccase (Senthivelan et al., 2016).
is able to degrade this kind of dyes, which is The presence of phenols in the industrial
why there were created industrial processes wastewater attracted interest in the application
based on laccase treatment of the syntethic of bioremediation processes and their treat-
dyes (Dominguez et al., 2005; Hou et al., ment with laccase. The presence of phenolic
2004). compounds in drinking water is a real danger.
Blanquez et al. (2004) manipulated Trametes The distillery wastewater is generated during
versicolor into pellets, with which they the production of ethanol by the fermentation
treated black liquor, to decompose its of sugar cane molasses. This produces a
aromatic compounds, to reduce its color and major environmental impact, due to the high
its chemical oxygen consumption. Their content of soluble organic matter and due to
results showed that the color and the content its dark brown color. Fungal laccase showed
of aromatic compound was decreased up to better properties in the reduction of total
almost 80% and the COD (chemical oxygen phenolic compounds in color than the laccase
demand) was reduced up to 60%. Their from other sources.
conclusions were the following: Trametes The intensive use of pesticides and the fast
versicolor produces laccase, which is able to industrialization cause the pollution of the
completely decolorize five dyes (Acid Red soil, the water and the air. Chemical
27, Reactive Blue 15, Congo Red, Reactive substances persists in the environment and
Black 5 and Acid Orange 6) without can be removed with high difficulties.
absorbing them and to partially decolorize Trametes versicolor and Pleurotus ostreatus
other three dyes (Remazol Brilliant Blue R, are used in the bioremediation of the soil and
Brilliant Yellow and Brilliant Red) while in the degradation of polychlorinated
absorbing them. Also, they discovered that biphenyls, pyrocatechines, protocatechuic
the toxicity of a few of the dyes remained the acid and benzoic acid (Udayasoorian et al.,
same, while the toxicity of others decreased 2005).
all the way to becoming non-toxic. Ahn et al. (2002) conducted an experiment
The laccase-based hair dyes are less irritant with two types of soil and Thermopsis villosa
and easier to handle that standard hair dyes, laccase, each sample with different percen-
because the enzyme replaces the oxygen tage of water in it. They used free laccase and
peroxide in the formula. immobilized laccase (on montmorillonite) for
Laccase is also used in the dechlorination this research. Thermopsis villosa laccase has
processes. In the presence of xylidine, which proved to be able to degrade dichlorophenol
133
from the soil, most likely from the industrial effluents and help in wastewater
immobilized form. treatment. They act on both phenolic and
The laccase from another source, Cerrena nonphenolic lignin-related compounds as well
unicolor, had the capacity of decreasing the as highly recalcitrant environmental
lignin amount from sugarcane bagasse, up to pollutants which help researchers to use them
almost 40%, within 24 hours (D’Souza-Ticlo in various biotechnological applications.
et al., 2009). They can be used and act as a biosensor in
textile industries, paper and pulp industries,
Pulp and Paper Industry xenobiotic degradation, and bioremediation.
The industrial manufacture of paper involves Laccase has been applied to nanobio-
the separation and degradation of lignin, by technology which is an increasing research
treating the wood pulp with ozone or chlorine field and catalyzes electron transfer reactions
dioxide. To reduce the pollution of chlorine- without additional cofactors.
based processes, an alternative involved Recently, several techniques have been
laccase-based processes, that provided a developed for the immobilization of
milder and cleaner delignification biomolecules such as micropatterning, self-
(Kunamneni et al., 2007). assembled monolayer, and layer-by-layer
TEMPO oxidation by laccase is used in the technique which immobilize laccase and
production of hydrophobic cotton fibers and preserve their enzymatic activity.
hydrophobic jute fibers (with dodecyl gallate
in this case). REFERENCES
Medical applications Afreen, S., Shamsi, T. N., Baig, M. A., Ahmad, N.,
The biosensors used in biomedical Fatima, S., Qureshi, M. I., Hassan, Md. I., Fatma,
T. (2017). A novel multicopper oxidase (laccase)
engineering are also produced with laccase. In from cyanobacteria: Purification, characterization
the determinations of chemical compounds, in with potential in the decolorization of
nanobiotechnology and biomedicine and anthraquinonic dye. PLOS ONE Journal, 12(4).
cosmetics is used laccase too. Agematu, H., Tsuchid, A. T., Kominato, K. et al.
The effect of poison ivy dermatitis, which is (1993). Enzymatic dimerization of penicillin X.
Journal of Antibiotics, 46(1), 141‒148.
caused by urushiol, can be reduced with Ahn, M. Y., Dec J., Kim J. E., Bollag, J. M. (2002).
laccase treatment. It has been shown that Treatment of 2,4-dichlorophenol polluted soil with
laccase can oxidize the urushiol to a quinone free and immobilized laccase. Journal of
derivative, that is innocuous (Madhavi et al., Environmental Quality, 31(5), 1509‒1515.
2009). Alimin, K. M., Annuar, M. S. M. (2009). Novel
application of coconut husk as growth support
Some important drugs, like anti-cancer drugs, matrix and natural inducer of fungal laccase
antioxidants, hormones and hormone production in a bubble column reactor. Asia-Pacific
derivatives are prepared with the help of Journal of Molecular Biology and Biotechnology,
laccase (by oxidation) and are added to some 17(2), 47‒52.
cosmetics (Senthivelan et al., 2016). Babot, E. D., Rico, A., Rencoret, J., Kalum, L., Lund,
H., Romero, J., del Rio, J. C., Martinez, A. T.,
Laccase can also oxidize iodide to iodine, Gutierrez, A. (2011). Towards industrially-feasible
which is used as a disinfectant. delignification and pitch removal by treating paper
pulp with Myceliophtora thermophila laccase and a
CONCLUSIONS phenolic mediator. Bioresource Technology
Journal, 102(12), 6712‒6722.
Baldrian, P. (2006). Fungal laccases - occurrence and
Laccases are the versatile enzymes which properties. FEMS Microbiology Reviews, 30(2),
catalyze oxidation reactions coupled to four- 215‒242.
electron reduction of molecular oxygen to Blanquez, P., Casas, N., Font, X. et al. (2004).
water. They are multicopper enzymes which Mechanism of textile metal dye biotransformation
are widely distributed in higher plants and by Trametes versicolor. Water Research, 38(8),
2166‒2172.
fungi. They are capable of degrading lignin Burlacu, A., Israel-Roming, F., Cornea, C. P. (2018).
and are present abundantly in many white-rot Depolymerization Of Kraft Lignin With Laccase
fungi. They decolorize and detoxify the
134
And Peroxidase: A Review. Scientific Bulletin. Kiiskinen, L. L., Kruus, K., Bailey, M., Ylösmäki, E.,
Series F. Biotechnologies, XXII. Siika-aho, M., Saloheimo, M. (2004a). Expression
Coll, P. M., F-Abalos, J. M., Villanueva, J., of Melanocarpus albomyces laccase in
Santamaria, R., Perez, P. (1993). Purification and Trichoderma reesei and characterization of the
characterization of a phenoloxidase (laccase) from purified enzyme. Microbiology, 150(9), 3065‒3074.
the lignin-degrading basidiomycete PM1 (CECT Kiiskinen, L. L., Rättö, M., Kruus, K. (2004b).
2971). Appl Environ. Microbiol., 59, 2607‒13 Screening for novel laccase-producing microbes,
Cordi, L., Minussi, R. C., Freire, R. S., Duràn, N. Journal of Applied Microbiology, 97(3), 640‒646.
(2007). Fungal laccase: copper induction, semi- Krupodorova, T., Ivanova, T., Barshteyn, V. (2014).
purification, immobilization, phenolic effluent Screening Of Extracellular Enzymatic Activity Of
treatment and electrochemical measurement. Macrofungi. Journal of Microbiology,
African Journal of Biotechnology, 6(10), Biotechnology and Food Sciences.
1255‒1259. Kunamneni, A., Ballesteros, A., Plou, F. J., Alcalde,
Couto, S. R., Toca Herrera, J. L. (2006). Industrial and M. (2007). Fungal laccase - a versatile enzyme for
biotechnological applications of laccases: a review. biotechnological applications. In Communicating
Biotechnology Advances, 24(5), 500‒513. Current Research and Educational Topics and
Dedeyan, B., Klonowska, A., Tagger, S., Tron, T., Trends in Applied Microbiology. A. Mendez-Vilas
Iacazio, G., Gil, G. et al. (2000). Biochemical and Ed., vol. 1, 233‒245, Formex, Badajoz, Spain.
molecular characterization of a laccase from Madhavi, V., Lele, S. S. (2009). Laccase: properties
Marasmius quercophilus. Appl Enviro. Microbiol, and applications. BioResources Journal, 4(4).
66, 925‒9. Margot, J., Bennati-Granier, C., Maillard, J., Blanquez,
Desai, S. S., Nityanand, C. (2011). Microbial Laccases P., Barry, D. A. (2013). Bacterial versus fungal
and their Applications. Asian Journal of laccase: potential for micropollutant degradation.
Biotechnology, 3(2), 98‒12. AMB Express, 3(1).
Dominguez, A., Couto, S. R., Sanrom´an, M. A. Mikolasch, A., Schauer, F. (2009). Fungal laccases as
(2005). Dye decolorization by Trametes hirsuta tools for the synthesis of new hybrid molecules and
immobilized into alginate beads. World Journal of biomaterials. Applied Microbiology and
Microbiology and Biotechnology, 21(4), 405‒40. Biotechnology, 82, 605‒624.
D’Souza-Ticlo, D., Sharma, D., Raghukumar, C. Minussi, R. C., Miranda, M. A., Silva, J. A. et al.
(2009). A thermostable metal-tolerant laccase with (2007). Purification, characterization and
bioremediation potential from a marine-derived application of laccase from Trametes versicolor for
fungus, Marine Biotechnology, 11(6), 725‒737. color and phenolic removal of olive mill
Eggert, C., Temp, U., Eriksson, K. E. (1996). The wastewater in the presence of 1-
ligninolytic system of the white rot fungus hydroxybenzotriazole. African Journal of
Pycnoporus cinnabarinus: purification and Biotechnology, 6(10), 1248‒1254.
characterization of the laccase. Appl Environ Mtibaa, R., de Eugenio, L., Gharlani, B., Louati, I.,
Microbiol, 62,1151‒8. Belbahri, L., Nasri, M., Mechichi, T. (2017). A
Faccelo, J., Cruz, O. (2008). Banana skin: a novel halotolerant laccase from Chaetomium strain
material for low-cost production of laccase. M.S. isolated from desert soi land its ability for dye
thesis, Universitat Rovira I Virgil. decolorization. 3 Biotech, 7.
Gianfreda, L., Xu, F., Bollag, J. M. (1999). Laccases: a Nicolcioiu, B. M., Popa, G., Matei, F. (2018).
useful group of oxidoreductive enzymes. Biochemical Investigations Of Different Mushroom
Bioremediation Journal, 3(1), 1‒25. Species For Their Biotechnological Potential.
Grotewold, E., Taccioli, G. E., Aisemberg, G. O., Popa, G., Nicolcioiu, B. M., Toma, R. (2018).
Judewicz, N. D. (1998). Purification of an Extracellular Laccase production in submerged
extracellular fungal laccase. Mircen Journal of culture of some white-rot fungi and their impact for
Applied Microbiology and Biotechnology, 4, textile dyes decolorization. AgroLife Scientific
357‒363. Journal, 7(2).
Hess, J., Leitner, C., Galhaup, C. et al. (2002). Riva, S. (2006). Laccases: blue enzymes for green
Enhanced formation of extracellular laccase activity chemistry. Trends in Biotechnology, 24(5),
by the white-rot fungus Trametes multicolor. 219‒226.
Applied Biochemistry and Biotechnology - Part A. Saito, T., Honga, P., Kato, K., Okazaki, M., Inagaki,
Enzyme Engineering and Biotechnology, 98-100, H., Maedac, S., Yokogawa, Y. (2003). Purification
229‒241. and characterization of an extracellular laccase of a
Hou, H., Zhou, J., Wang, J., Du, C., Yan, B. (2004). fungus (family Chaetomiaceae) isolated from soil.
Enhancement of laccase production by Pleurotus Enzyme and Microbial Technology, 33, 520‒526.
ostreatus and its use for the decolorization of Senthivelan, T., Kanagaraj, J., Panda, R. C. (2016).
anthraquinone dye. Process Biochemistry, 39(11), Recent trends in fungal laccase for various
1415‒1419. industrial applications: an eco-friendly approach - a
Kaira, G. S., Dhakar, K., Pandey, A. (2015). A review. Biotechnology and Bioprocess Engineering,
psychrotolerant strain of Serratia marescens 21.
(MTCC 4822) produces laccase at wide Wakil, S. M., Adebayo-Tayo, B. C., Odeniyi, O. A.,
temperature and pH range. AMB Express, 5(1). Salawu, K. O., Eyiolawi, S. A., Onilude, A. A.
135
(2017). Production, Characterization and Laccase from Monocillium indicum Saxena.
Purification of Laccase by Yeasts Isolated from Applied Microbiology and Biotechnology.
Ligninolytic Soil. Journal of Pure and Applied Udayasoorian, C., Prabu P. C. (2005). Biodegradation
Microbiology.
of phenols by ligninolytic fungus Trametes
Shin, K. S., Lee, Y. J. (2000). Purification and
characterization of a new member of the laccase versicolor. Journal of Biological Sciences, 5,
family from the white-rot basidiomycete Coriolus 824‒827.
hirsutus. Arch Biochem Biophys, 384, 109‒15. Unal, A., Kolankaya, N. (2001). Dechlorination of
Shraddha, S. R., Sehgal, S., Kamthania, M., Kumar, A. bleached kraft pulp by laccase enzyme produced
(2011). Laccase: Microbial sources, production, from some white-rot fungi. Turkish Electronic
purification and potential biotechnological Journal of Biotechnology, 25, 67‒72.
applications. Enzyme Research, 2011, Article ID Viswanath, B., Subhosh Chandra, M., Pallavi, H.,
217861, 11 pages doi:10.4061/2011/217861. Rajasekhar Reddy, B. (2008). Screening and
Si, J. Q. (2001). Use of laccase in baking (USA patent). assessment of laccase producing fungi isolated from
Thakker, D., Geeta S., Evans, C., Koteswara Rao, K. different environmental samples. African Journal of
(1992). Purification and Characterization of Biotechnology, 7(8), 1129‒113.
136
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
TRENDS ON PHARMACEUTICAL PACKAGING MATERIALS
Denisa CIOTEA, Mona Elena POPA
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mărăşti Blvd.,
District 1, 011464, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
Filling and packaging are very important processes in the pharmaceutical sector. Packaging is important as it provides
protection of the dosage form, from the environment and keeps them safe until is opened by the customer. Environmental
sustainability has to be also taken into account in this field. Pharmaceutical packaging materials should be eco-friendly.
These materials are derived from natural resources, like plant or animal derived proteins, cellulose, starch etc. A type of
primary packaging material is the capsule. It has the advantage that provide a slippery, smooth and a tasteless shell. This
article is reviewing various aspects of eco-friendly pharmaceutical packaging materials, as: types of packaging materials
like capsules as well as recent trends of pharmaceutical packaging in pharmaceutical market.
Key words: eco-friendly, packaging material, pharmaceutical products.
INTRODUCTION department. They examine and analyse the
sample and report it as approved or rejected.
In general, the pharmaceutical formulations Primary packaging is the term used to indicate
have three important constituents as: the active that the packaging is in contact with the
part, excipients and the packaging material. pharmaceutical formulations. The stability of
The active ingredient is the pharmacological the pharmaceutical formulations mainly
active substance that is generally preserved by depends on the packaging material because it is
excipients and packaged in a packaging in direct contact (Campbell & Vallejo, 2015).
material (Kumar, 2013) A few examples of primary packaging
The packaging materials should prevent the containers are vials, ampoules and capsules.
product from damage, such as light, foreign The secondary packaging has two goals: to
particles, temperature, atmospheric gases, protect the primary packaging and the product,
microorganisms and moisture. and it never comes in direct contact with the
One of the key characteristics of packaging product. The secondary packaging is visible to
materials is to protect the pharmaceutical the consumer and it contains information such
formulations from leaching, loss of any volatile as the name of the product, the usage, the
material and loss or gain of water from the ingredients, fabrication and expiration date as
content. blisters, boxes (Kassarjian et al., 2014).
Packaging should prevent mechanical hazards Tertiary packaging is removed by retailers
like shock, compression, abrasion, vibration before products are arranged for sale. The
and perforation. The packaging materials consumers don’t see the tertiary packaging.
should not react with the product and should be The tertiary packaging containers protects the
able to preserve the product throughout the product from the damage which may occur
shelf-life (Kim et al., 2014) during the shipping transportation from
manufacturer to market or drugstore (Kerry,
MATERIALS AND METHODS 2014). Examples of tertiary packaging
materials: carton box, wooden box.
The primary, secondary and tertiary packaging Monies and Dublane are credited with the
of pharmaceutical products constitutes an invention of the gelatin capsule. In December
essential element of the technological of 1834 they patented a method for producing a
procedures. The quality control of packaging single-piece, olive shaped, gelatin capsule,
material has been done by the quality control which was dosed after filling, by a drop of
137
concentrated warm gelatin solution. Capsules region of pH = 9, whereas type B gelatin has its
become a popular formulation because of their isoelectric point in the region of pH = 4.7. In
advantage of use as: slippery, smooth and a practice, hard capsules are produced from the
tasteless shell. The main advantage of capsules mixture of skin and bone gelatins. This gelatin
is that they have not unpleasant taste like has a high strength and it produces a tough,
tablets. Due to an inexpensive production clear and a firm film. They are in the form of
process, they are produced in large quantities elongated cylinders, rounded to the heads that
and in a wide range of colors. Capsules provide are inching through the boot. They usually
a ready availability of the compounds. Cap- contain mixtures of substances in the form of
sules are not usually used for the administration powders or granules.
of extremely soluble materials such as Soft gelatin capsules (pearls) which consist of
potassium bromide, potassium chloride or a continuous and soft gelatin coating have a
ammonium chloride, since the sudden release spherical or oval shape. They contain active
in the stomach could be irritating. The substances in the form of paste or solids in
dehydration of compounds could be prevented solution. Gelatin capsules have a thicker
by using small volumes of inert oils in the coating than hard capsules. The capsule shell is
powder mixture. composed of gelatin, a plasticizer, water,
Capsules are pharmaceutical formulations preservatives, coloring agents, opacity agents
made of coatings containing unit doses of and flavorings. The shell may contain also
active substances, associated or not with active substances. Gelatin should not contain
excipients, such as: solvents and lubricants. more than 15 ppm of iron. In soft gelatin
Capsules are used for oral administration. The capsules is used as plasticizers glycerin,
gelatin and starch used to prepare the capsule propylene glycol and sorbitol. Glycerin and
shell as well as the substances used to adjust propylene glycol cannot be the major
the consistency of the capsules must fit with the constituents of the capsule content, because
Pharmacopoeia guidelines or other quality they have softening effect on the gelatin shell,
standards like ISO. A few examples of other which can make the capsule more susceptible
excipients are the opacity agents, surfactants, to extern factors like humidity and heat. Soft
fragrance substances, coloring agents and gelatin capsules can be classified according to
preservatives. Capsules can be engraved. The the ratio between glycerin and gelatin in hard
contents of the capsules may be solid, liquid or (0.4/1), medium (0.6/1) and soft (0.8/1).
solid paste. The content must not damage the Gelatin capsules are generally formed, filled
coat after administration, when is attacked by and closed by a single operation, but in some
the digestive juices when the capsule releases cases for extemporaneous use, the shells can be
the content. prefabricated. Liquid substances should be
In the formulation, the talc must be at most 3%, homogenous and air-free before they are
stearic acid not more than 1%, magnesium or included in the capsule, and solid compounds
calcium stearate not more than 1% and aerosol are generally dissolved or dispersed in a
not more than 10% of the weight of the capsule solubilizer, to obtain a solution or a dispersion
content. Depending on the nature of the of the consistency of a paste. All these
coating, there are different types of capsules: substances should be formulated to produce the
- gelatinous (hard and soft) capsules; smallest possible capsule containing the
- modified released capsules; maximum ingredient and physical stability,
- amylaceous capsules (cassettes). therapeutic effectiveness and production
Hard gelatin capsules (opaque capsules) are efficiency. The active ingredients are mostly
prepared from gelatin. Gelatin is a hetero- oily, and they derive from vegetable oils
geneous product, derived from treated animal (soybean oil, sea buckthorn oil), mineral oil
collagen. Common sources of collagen are and fish oil. These ingredients also function as
frozen pork skin and animal bones. Skin and solvents in vitamin capsules. Oily matrix do not
bone collagen are available in most areas of the retain moisture, water do not pass from the
world. Type A gelatin is derived from a shell of the capsule into the fill material and out
precursor and has the isoelectric point in the during the manufacture and drying of this
138
capsule. Depending on the nature of the Humidity and light are factors which degrade
substances (water miscible and volatile liquids) the packaging materials and also the capsule
and the contact surface, it can cause a partial and active ingredients. Packaging of oral
migration of the constituents from the content tablets should be easy to dispense, child resis-
of the capsule in the capsule case and vice tance but in the same time adult-friendliness.
versa. Modified released capsules are hard cap- Packs must also be easily recognizable by
sules or gelatin capsules, whose contents, aspect, functional and hermetically sealed.
coating or both components contain special In our lifestyle the blister packs ensure hygiene
excipients, or they are made by special methods, and they offer convenience. Blister packs are
in order to change the speed, place or time when ideal in our quick rhythm lifestyle and because
the active substance will be released. Modified of that there has been a large increase in their
released capsules include extended release use across the years. Indeed, blister packaging
capsules and delayed release capsules. has provided the best worldwide growth among
Amylaceous capsules (cassettes) are solid all pharmaceutical packaging products.
preparations, made of a hard shell. These Pharmaceutical producers confront with cost
cassettes contain one or more active substances pressures during the packaging process and
prepared from starch. They are flat cylinders also with the production process. It should be a
whose diameters, slightly different in size and challenge to build efficient, user friendly and
allow their closure by overlapping and gentle easy to operate packaging machines (Kunal,
pressing. They contain substances or mixtures 2012)
of powdered substances. Before administration, All packaging materials must be tested on
the cassettes are soaking in the water for a few stability studies. Packaging of pharmaceutical
seconds and then put on the tongue and products plays a very important role in the
swallow with water. maintenance of their quality. Eco-friendly
Constant innovations in the pharmaceutical packaging materials are packaging that uses
industry have a direct impact on the packaging. environment safe materials in its production.
Traditionally, medicines on the pharmaceutical These eco-friendly materials should not harm
market could be found in different shapes like the environment and should be marked with
tablets or capsules packed in blister packs or eco-labels (Bird, 2009). For example, eco-
bottled into plastic pharmaceutical bottles. friendly packs include paper which is recycled
Oral tablets are available in a wide range of and corn starch because is biodegradable in
different shapes, colors and sizes as we can see nature.
in Figure 1. Corn starch is used as an eco-friendly pack in
different products including bags, boxes and
trays. Corn starch is an alternative material to
plastic because it has similar functional proper-
ties and it’s biodegradable. When the product is
in the market it is very difficult to be rebuilt so
the changes should be made in an early stage of
the development (Edward, 2009).
Greener packaging designs accomplish the
needs of most pharmaceutical producers
without sacrificing our environment. Packaging
materials are manufactured and designed to
allow recycling. The percentage of recycling
depends on the weight or on the minimum
calorific value. Eco-friendly packaging should
be modernized, biodegradable, well-designed,
easily recyclable or reusable (Bird, 2009).
Eco-friendly pharmaceutical packaging mate-
Figure 1. Oral tablets as: hard gelatin capsules colored in rials have two concepts: the first is that the
white, beige and green; soft gelatin capsules colored in material should be recyclable and the second is
red-garnet
139
that the material should be biodegradable. Xylan is naturally found in plant cell walls and
Some products are also enhancing their brand algae. It forms a group of substances called
image by adopting this type of eco-friendly hemi-cellulose. Xylan is a biodegradable,
pharmaceutical packaging because is one of the compostable and eco-friendly derivate.
hottest trends (Hunt, 2010). Xylophane is thus used as an environment
Eco-friendly pharmaceutical packaging friendly packaging material.
materials can be classified in several ways: Chitin is the second most abundant
based on their uses, based on the chemical polysaccharide resource after cellulose. It is
constituent and polysaccharide content. found in the exoskeleton of invertebrates.
Based on their uses, the packaging materials Chitin is used in packaging because it has
should have a barrier protection which provides antimicrobial property, protects the product
protection against moisture, light, oxygen and from unnecessary microbial growth and it
temperature variations, the biological protect- maintains the preservative action. Heavy metal
tion provides protection against biological ions are absorbed by the chitin. Chitin is mostly
contaminants, the physical protection ensures used as packaging material in edible coatings
protection against any physical damage. The (Srinivasa & Tharanathan, 2007)
information communicated on the packs should Protein. A protein is formed of repeating units
offer to the consumer information about the of amino acids. Protein based materials are
correct usage of dosage forms, their prove- derived from agricultural materials or agro-
nance, their side-effects and warnings. The eco- packaging materials that are renewable and
friendly pharmaceutical packaging should have biodegradable and they are used in edible
security protection from small children and packaging. Agro-packaging concept refers to
against counterfeiting. the use of renewable products and control of
Examples of eco-friendly packs: the end products. Numerous animal proteins
Starch is an eco-friendly polysaccharide and a and plant proteins are commonly used as raw
widely available raw material. Starch is material for agro-packaging materials. Thus
obtained from various sources like cereals and proteins can be split into plant origin proteins
legumes. The most known source of starch is (e.g. soy, gluten, pea, potato etc.) and animal
potato, corn, wheat and rice (Weber, 2000). origin proteins (e.g. casein, whey, collagen,
Starch is used for flexible or rigid packaging, keratin etc.) (Platt, 2006).
bags and sacks. Since starch packaging mate- The point of eco-friendly packaging materials
rials are fragile in nature, when a high concen- is the decrease of the amount of packaging
tration of starch is used, various biodegradable material which ought to be effectively
plasticizers like glycerol and other low- biodegradable, nontoxic, reusable and inert.
molecular weight polyhydroxy compounds, Recycling of materials like aluminum, paper
polyether and urea are added. Plasticizers and glass creates less or no waste and they are
inhibit the microbial growth by lowering the environmentally safe. Incineration of
water activity. These four types of starch based pharmaceutical packaging is recommended to
on the polymers types are thermoplastic starch eliminate the contaminated packs. The plastic
products, starch synthetic aliphatic polyester materials that cannot be recycled are therefore
blends, starch-Polyvinyl alcohol blends and incinerated. The recycled materials (glass and
starch polybutylene succinate (PBSA) polyester metal) are considerate safer for formulations
blends (Edward, 2009) against microorganisms (Marsh & Bugusu,
Cellulose is a linear polymer which is found 2007). Renewing the materials is the property
abundantly in nature. Cellophane is the most of eco-friendly packaging obtained from
common cellulose-based biopolymer. Methyl renewable natural resources that can be
and ethyl cellulose, hydroxyethyl cellulose, reprocessed into new packaging, e.g.
carboxymethyl cellulose, hydroxypropyl thermoplastic. Repurpose the materials the
cellulose and cellulose acetate are cellulose property of eco-friendly packaging material to
derivatives used for packaging. These are be molded in another new forms with another
widely used in pharmaceutical packaging pharmaceutical purpose in mind.
(Weber, 2000).
140
Agro-based materials are renewable and packaging because the packaging materials
biodegradable, and they contribute to should protect the product against damages
development of pharmaceutical sustainable produced by external factors as: light, foreign
packaging and this reduces their environmental particles, temperature, atmospheric gases,
impact. Such biodegradable packaging microorganisms and moisture. One of the key
materials are suitable for single use disposable attributes of packaging materials is to protect
packaging applications. the pharmaceutical formulation from draining,
loss of volatile substances and misfortune or
The primary idea of eco-friendly packaging increase of water from the content. Packaging
materials depends on its biodegradable ought to avert mechanical dangers like shock,
viability. The biodegradation of pharmaceutical abrasion, compression, perforation and
packaging materials mechanism is the initial vibration. The materials ought not react with
scission of the enzyme forming a chain. Then the product and ought to have the capacity to
the metabolized portions are leading to the preserve the product throughout the shelf life.
enzymatic dissimilation of the macromolecule Eco-friendly packaging materials should be
from the chain ends. The oxidative cleavage of packaging that uses environment safe materials
macromolecules constitutes the basic skeleton in its production and it should not harm the
of pharmaceutical packaging material. This is environment. This types of environmentally
often leads to better metabolization of the friendly pharmaceutical packaging materials
fragments. These fragments are converted by are marked with eco-labels. Eco-friendly
microorganisms because they are smaller pharmaceutical packaging materials should
enough. The decomposed of eco-friendly have two concepts the first is that the material
pharmaceutical packaging material is made in a should be recyclable and the second is that the
bio-waste collection. This bio–waste collection material should be biodegradable. For example,
is composted into environment friendly starch is an eco-friendly polysaccharide and it’s
products like carbon dioxide and water a widely available raw material. It is obtained
(Petkewich, 2003). from various sources like potato, corn, wheat
Another mechanism is the photo degradation and rice and it is used for flexible or rigid
of pharmaceutical packaging material. The packaging, bags and sacks. Cellulose is another
photo degradation role is to make smaller eco-friendly material which is found abun-
disposable materials which do not create any dantly in nature. Xylan is also a biodegradable,
environmental hazard. When biodegradable compostable and an eco-friendly derivate.
pharmaceutical packaging material are Xylophane is used as an environment friendly
exposed to chemical based aqueous solutions packaging material. Chitin is used in packaging
they rapidly dissolute it. After the rapid because it has antimicrobial property, protects
dissolution the materials suffers a microbial the product from unnecessary microbial
digestion. These packaging materials growth, it maintains the preservative action and
disintegrate when they are exposed to aqueous it has the unique property to absorb heavy
solutions, which are used for the transport and metal ions. Protein based eco-friendly materials
disposal of pharmaceutical wastes (Petkewich, are derived from agricultural materials or agro-
2003). packaging materials and they are renewable
and biodegradable.
RESULTS AND DISCUSSIONS
CONCLUSIONS
Organizations such as ISO (International
Organization for Standardization) and WHO Nowadays, packaging of pharmaceutical
(World Health Organization) have officially set products plays a very important role in the
the standards for protected and effective pharmaceutical sector. The pharmaceutical
packaging materials and technologies which industry need to focus on the development of
ought to be pursued. Therefore, the new biodegradable materials, regarding the
Pharmaceutical sector has to be specific when generation of environmental friendly packaging
is using these eco-friendly materials for material that adds value to the pharmaceutical
141
products as well as it creates a new outlook into Kerry, J. P. (2014). New packaging technologies,
the concept of eco-friendly pharmaceutical materials and formats for fast-moving consumer
products. Innovations in Food Packaging, 2nd ed.
packaging materials. The objective for Elsevier.
pharmaceutical organizations is to concentrate Kim, Y. T., Min, B., Kim, K. W. (2014). General
on the development of a single eco-friendly characteristics of packaging materials for food
packaging material that acknowledge the system. Innovations in Food Packaging, 2nd ed.
combined characteristics of glass, plastic, Elsevier.
Kumar, S. (2013). Pharmaceutical packaging technology
paper, metal and rubber. Starch, cellulose, - A review. Int. J. Res. Pharm. Biomed. Sci., 4,
xylan and chitin could be used as eco-friendly 1400‒1414.
packaging materials because they have Kunal, M., Akhilesh, D., Kumar, B. S. (2012). Recent
antimicrobial properties and because they are Trends in Pharmaceutical Packaging: A Review.
compostable and biodegradable. International Journal of Pharmaceutical and
Chemical Sciences, 1, 1282‒1292.
Marsh K. S., Bugusu B. (2007). Food Packaging-Roles,
REFERENCES Materials and Environmental Issues. Journal of Food
Sci., 72(3), 39‒53.
Bird, K. (2009). Green Packaging is more about Petkewich, R. (2003). Microbes manufacture plastic
improving recycling than new materials. Decision from food waste. Environmental Science and
News Media. Technol., 5, 175‒176.
Campbell, G. A., Vallejo, E. (2015). Primary packaging Platt, D. K. (2006). Biodegradable polymers: market
considerations in developing medicines for children: report. Smithers Rapra Press, 4, 57‒60.
oral liquid and powder for constitution. J. Pharm. Srinivasa, P. C., Tharanathan, R. N. (2007).
Sci., 104(1), 52‒62. Chitin/Chitosan - Safe, Eco friendly Packaging
Edward, J. B. (2009). Pharmaceutical Packaging. Materials with Multiple Potential Uses. Food
Handbook. Informa Healthcare (pp: 200‒240). Reviews International, 23(1), 53‒72.
European Pharmacopoeia 9th edition (2017). Tiwari, B. N. (2016). Current aspect of pharmaceutical
Hunt, J., 2010. All the Types of Packaging. Ezine packing materials, importance and its future trend. A
Articles; http://www.Eco-Friendly Packaging review. Int. J. Chem. Pharm. Anal., 3(1).
Concepts Design Reviver.html. US Environmental Protection Agency (2008).
International Standard ISO, 8362-6: Injection containers http://www.epa.gov/smartway/transport/document
for injectables and accessories (2010). Caps made of s/faqs/partnership_overview.pdf.
aluminium plastics combinations for injection vials. Weber, C. J. (2000). Bio based Packaging Materials for
Kassarjian, O. K., Bello, N., Bix, L., Burgess, G., Linz, the Food Industry. Status and Perspectives. A
J. (2014). Examining the effect of secondary European Concerted Action, 3‒39.
packaging on microbial penetration into sterile World Health Organization (2002). Annex 9-Guidelines
medical device trays. J. Appl. Packag. Res., 6(1), 2. on packaging for pharmaceutical Products. WHO
Technical Report Series, No. 902.
142
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
HIGHER UTILIZATION OF WASTE FROM THE FOOD INDUSTRY
THROUGH BIOTECHNOLOGICAL METHODS
Diana GROPOŞILĂ-CONSTANTINESCU, Luminiţa VIŞAN, Gabriela MĂRGĂRIT,
Radu-Cristian TOMA, Dana BARBA, Marius HANGAN
University of Agronomic Sciences and Veterinary Medicine of Bucharest,
Faculty of Biotechnologies, 59 Mărăşti Blvd., District 1, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
Until now, the most important way to get rid of food waste was to use it in animal feed. Four methods are used to
remove food waste: recovery in agriculture and animal husbandry, incineration, anaerobic fermentation, composting.
This paper aims to evaluate new methods of recycling waste from the food industry through biotechnological methods.
The wastes that were the subject of the research were the following: apple pomace, bakery waste, milk whey. All these
have been processed using the strains of the Biotechnology Faculty Collection in order to determine the potential to
obtain useful products of high economical value like bioethanol or probiotics. The experimental yield of 0.26-0.24 l of
bioethanol/1000 g of food waste was at the minimum data mentioned in the literature (0.265 l) but justifies the
capitalization of this food waste.
Key words: apple pomace, whey, bioethanol, probiotic, biomass.
INTRODUCTION The following general methods (Russ et al.,
2007) may be used to remove solid waste in
The food industry is subject to increased general: recovery in agriculture or animal
pressures to improve environmental husbandry; incineration; anaerobic or aerobic
performance, both on the part of consumers and fermentation; composting. In the case of liquid
on the part of the legislation, which, in turn, waste, the following methods can be used:
responds to consumer pressure. A series of ground application; various methods of
"friendly and clean" food processing physico-chemical treatment, fermentation.
technologies have been designed precisely to In the case of waste with more than 50%
enable manufacturers to better understand the humidity, anaerobic fermentation with the pro-
effects of their activities on the environment duction of biofuels is much more appropriate
and to adopt practical measures to achieve (Gavrila, 2007). If cellulosic polysaccharides
sustainable production (Gavrila, 2007). can be decomposed, the rate of decomposition
The two crucial issues related to food is low, defining the limit of fermentation by
technologies are energy management and waste producing biogas (Akpan et al., 2008).
management. The production of food is done Food industry waste should be viewed as a raw
with high energy consumption, and relatively material source for the production of high
large quantities of waste result from the added value products rather than as waste
process. Waste from the food industry can be (Shalini et al., 2010).
divided into three categories: waste from For example, monosaccharides can be obtained
production processes, food waste from by selective hydrolysis of whey, lactose and
municipal waste and packaging. oligopeptides can be obtained from whey
Current methods of waste use have been protein concentrate by peptide hydrolysis.
developed along with traditional production Enzymatic conversion of cellulose-rich waste
lines, being closely linked to the agricultural can produce ethanol. Pectin can be recovered
origin of raw materials (Manimehalai et al., from effluents from fruit juice production (Pap
2007). Traditional methods used in the past and et al., 2000). There is practically no "waste" of
beyond for the use of food waste, were: animal the food industry that can not be used as a raw
feed and fertilizer on farmland (Gavrila, 2007). material to get value-for-money products.
143
This paper aims to evaluate new methods of Fermentations with Lactobacillus bulgaricus
recycling waste from the food industry through were carried out under the following
biotechnological methods. All food waste, conditions: 3 days, 35oC, 20 rpm, pH = 5.5.
apple pomace, bakery waste, milk whey, have Analytical control of the fermentation
been processed in order to determine the process
potential to obtain useful products of high Determination of dry cell weight (DCW).
economical value, bioethanol, probiotics, using 10 ml of whey medium was centrifuged in a
strains from the Collection of the Faculty of centrifuge tube at 4000 rpm for 20 minutes.
Biotechnologies from UASMV Bucharest. After the supernatant was removed, the
biomass was weighed. Wet biomass was then
MATERIALS AND METHODS dried at 105-110oC, to constant weight using a
thermobalance.
Raw materials Post-biosynthesis processing
The main raw materials were: apple pomace, After the completion of the fermentation
bakery waste and milk whey. process of whey, the first post-biosynthesis
The whey was provided by a private manufac- operation was to separate the biomass by
turer and stored at 4oC until processing. centrifugation at 4000 rpm for 20 minutes.
The apple pomace was obtained in the After centrifugation, wet biomass was collected
laboratory, after the preparation of apple juice and weighed, placed in trays and dried in the
with a fruit-maker. oven at 105oC. Finally, the total amount of dry
Bakery wastes were purchased from a local lactobacilli biomass was weighed.
pastry and consisted of specific product scraps. In the case of alcoholic fermentation, the media
Microorganisms were vacuum filtered on filter paper. The
To obtain bioethanol and probiotics, strains of filtrate was distilled using a rotary evaporator
Saccharomyces cerevisiae SC2 and to obtain bioethanol.
Lactobacillus bulgaricus L16 from the
Microorganism Collection of the Faculty of RESULTS AND DISCUSSIONS
Biotechnologies were used.
Microbial strains were grown on their specific Probiotic yield from milk whey
media, respectively YPG medium for yeast and For probiotic biosynthesis milk whey was
MRS for lactobacilli. inoculated with Lactobacillus bulgaricus strain.
Processing of waste Following the post-biosynthesis of the lacto-
The whey was first centrifuged for semipuri- bacilli media, 2.8-3.2 g/l of dry biomass was
fication by removing solid residues and grease obtained, 36% lower than those mentioned in
(8000 rpm, 15 min, 3oC). Next, filtration was the literature, which stated amounts of 5-5.1 g/l
performed for removing residual impurities left (Rezvani et al., 2016) (Figure 1).
after centrifugation.
Apple pomace, bakery waste were suspended
in water in a ratio of 1: 2 g/v and boiled for 5 3
minutes.
The products obtained were used as the single 2,5
nutritional source for microorganisms. 2
Obtaining of bioethanol and probiotics
For the biosynthesis of bioethanol and 1,5
probiotics each processed waste was inoculated
1
with 10% Saccharomyces cerevisiae inoculum.
In addition, milk whey was inoculated with 0,5
10% Lactobacillus bulgaricus inoculum to
0
obtain the probiotic preparation. Batch 1 Batch 2 Batch 3
Dry biomass (g/L) 2,8 2,7 3,1
Fermentations with Saccharomyces cerevisiae
were carried out under the following Figure 1. Dry biomass obtained
conditions: 5 days, 25oC, pH = 4.8. from lactic fermentation
144
Bioethanol yield from apple pomace and By comparing the amounts of bioethanol
bakery waste obtained from the two nutrient sources, apple
The alcoholic fermentation process was pomace has a 9-13% higher productivity than
characterized by two important parameters: the bakery waste.
amount of dry biomass obtained and the
resulting bioethanol volume.
25
From the data presented in the Figure 2, it can
be concluded that apple pomace is a valuable
Bioethanol (mL/100 g)
20
nutrition source for the growth of yeasts in
order to obtain bioethanol, achieving 15
productivity of 2.56-2.62 ml/g of solid
substrate. 10
5
3
0
Batch Batch Batch
2,5
1 2 3
Apple pomace 26,2 25,6 25,9
2
Bakery waste 23,1 23,4 22,8
1,5
Figure 4. Comparison of the amounts of bioethanol
1 obtained from the raw materials tested
0,5 The volume of bioethanol produced from 100 g
of food waste was 26 ml. As reported in
0
Batch 1 Batch 2 Batch 3 literature by Mathewson (1980), that a 1 ton of
Dry biomass (g/L) 2,38 2,36 2,31
40%-60% fermentable sugar substrate can
Bioethanol (mL/g) 2,62 2,56 2,59
produce 265-378 l of bioethanol, this means
Figure 2. Dry biomass and bioethanol obtained that substrate of 1000 g can produce a
from alcoholic fermentation of apple pomace maximum bioethanol yield of about 0.265 l and
a minimum yield of 0.378 l.
In the case of alcoholic fermentation of bakery The experimental yield of 0.26-0.24 l of
waste, the results were slightly weaker than bioethanol from 1000 g of food waste is well
apples (Figure 3). The productivity in within acceptable range.
bioethanol ranged between 22.8-23.4 ml/100 g The experimental results obtained in this work
of material (Figure 4). showed that fermentation processes was at the
minimum data mentioned in the literature for
3 production of bioethanol from food waste.
2,5
CONCLUSIONS
2
For lactobacilli, 2.8-3.2 g/l of dry biomass was
1,5 obtained on whey, 36% lower than data
mentioned in the literature,
1
For bioethanol, from the two nutrient sources,
0,5
apple pomace has a 9-13% higher productivity
than bakery waste.
0 The experimental yield of 0.26-0.24 l of
Batch 1 Batch 2 Batch 3
Dry biomass (g/L) 2,5 3 2,4
bioethanol/1000 g of food waste was at the
Bioethanol (mL/g) 2,31 2,34 2,28 minimum data mentioned in the literature but
justifies the capitalization of this food waste.
Figure 3. Dry biomass and bioethanol obtained
from alcoholic fermentation of bakery waste
145
REFERENCES engineering. CRC Press, Taylor & Francis Group.
Chapter 19, 595‒630.
Akpan, U. G., Alhakim, A. A., Ijah, U. J. J. (2008). Rezvani, F., Ardestani, F., Najafpour, G. (2016). Growth
Production of ethanol fuel from organic and food kinetic models of five species of Lactobacilli and
waste. Leonardo Electronic Journal of Practices and lactose consumption in batch submerged culture.
Technologies, 13, 1‒11. Braz J Microbiol., Apr-Jun, 48(2), 251‒258.
Gavrila, L. (2007). Gestionarea valorificarea si Russ, W., Schnappinger, M. (2007). Waste related to the
minimizarea deseurilor industriei alimentare. Faculty food industry: a challenge in material loops. In:
of Engineering, Online course, 1-8. Oreopoulou V., Russ W. (eds.), Utilization of By-
Manimehalai, N., 2007. Fruit and waste utilization. Bev Products and Treatment of Waste in the Food
Food World, 34(11), 53‒54. Industry. Springer, 1‒13.
Pap, N., Pongrácz, E., Myllykoski, L., Riitta L. Keiski Shalini, R., Gupta, D. K. (2010). Utilization of pomace
(2014). Waste minimization and utilization in the from apple processing industries: a review. J Food
food industry. Jatindra Kumar Sahu (Ed.). Sci Technol., 47(4), 365‒71.
Introduction to advanced food processing
146
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
EFFICIENT UTILIZATION OF WATERMELON WASTES
Indira GALIT, Alexandru Cristian GROSU, Narcisa BĂBEANU, Ovidiu POPA
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mărăşti Blvd.,
District 1, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
The watermelon is a fruit used on a large scale in human nutrition. Cucurbitceae species are a source of many
nutrients such as protein,minerals, lipids as well as ingredients for medicine. The main non-edible parts are the
seeds and the rind that make them agro-wastes. Watermelon seeds and rind may represent an appropiate tool for
the treatment of various diseases in those countries that use a more classical therapeutic approach. In this article is
made a brief analysis of the ways to recover the resulted wastes from the cultivation of watermelon. The most
promising directions are obtaining the bioactive compounds, biofertilizers and biogas.
Key words: watermelon, Citrullus lanatus, wastes.
INTRODUCTION solitary, on pedicels long up to 4.5, with pale
green united petals. Fruit of wild plants are
Watermelon (Citrullus lanatus L.) is a fruit nearly spherical, in diameter 1.5- 20 cm,
crop part of the Cucurbitaceae family, along green combined with darker green. The fruit
with the cucumber, zucchini and melon. It of the cultivated plants are up to 20x60 cm,
grows in temperate regions of Africa, Turkey, weight between 3 and 5 kg, the form
China, Egypt, Iran, Mexico, South Korea, ellipsoidal or spherical, colour is green or
India and some parts of the United States. The yellowish, or variously mottled or striped.
fruit of the Citrullus lanatus L. is usually used The fruits vary in colour, taste and odour
as food and in the pharmaceutical industry for (Dane F., 2007).
the nutritional factors of the fruit and as well Seeds are numerous, 6-10 mm long,
as seeds. compressed, pyriform, black or dark brown.
Present review is a collection of information They continue to mature as the fruit rind
about the phytochemistry, pharmacology and lightens in colour.
utilization of the watermelon wastes. Botanical name: Citrullus lanatus
BOTANICAL CLASSIFICATION PRODUCTION TECHNOLOGY
Kingdom: Plantae
Division: Magnoliophyta Watermelon is cultivated in all over the world
Order: Cucurbitales in the warmer parts, but is trully native from
Family: Cucurbitaceae the Tropical Africa where are sandy and dry
Genus: Citrullus areas.
Species: lanatus As climate Citrullus lanatus needs a dry and
warm climate and to develop and grow
BIOLOGY successfully must be cultivated at a 30-35°C
Citrullus lanatus known as watermelon, is an temperature. The flowering as the fruit
annual herbaceous vine with up to 10 m stems development are helped by high light
creeping or liying on the ground. Leaves are intensity and temperature. The areas with high
3-20 cm, deeply palmately lobed with 3 to 5 humidity during the fruit formation stage and
lobes. Leaf stalks are between 2 and 19 cm more rain at maturity are not going to thrive.
long. Male flowers on 1.2-4.5 cm long It is compatible with all types of soil but most
pedicels. Flowers 1-2.5 cm long and coloured suitable are the sandy soils with a pH range
in pale green. Flowers are monoecious, from 5.5-7.5. The soil must be drained.
147
COMPOSITION activity and a high content of flavonoids and
polyphenols.
Table 1. Seed nutritonal values (per 100g) The n-hexane extract of Citrullus lanatus
COMPONENT VALUE AUTHOR seeds showed the highest antioxidant activity
Protein 34.1 g Gopalan C., 1971 and total phenolic content where the ethanol
35.66 g Tarek A. El-Adawy, extract had highest total flavonoid content.
2001 Antioxidant activity of Citrullus lanatus of
35% Okunrobo O., 2012
chloroform, ethyl acetate and methanol,
Fat 52.6g Gopalan C., 1971
50.10g Tarek A. El-Adawy, mesured by DPPH method. Methanolic
2001 extract of Citrullus lanatus seed showed
50% Okunrobo O., 2012 maximum antioxidant potential (Naresh Singh
Arginine 900 mg/g Gopalan C., 1971 Gill, 2011).
of N
1161.25 Tarek A. El-Adawy,
PHARMACOLOGY
mg/g 2001
Calcium 100 mg Gopalan C., 1971
150 mg Tarek A. El-Adawy, Laxative activity of aqueous fruit pulp extract
2001 at doses depending on the body weight (250,
16.8 mg Okunrobo O., 2012 500, 1000 mg/kg), was based on the weight of
Phosphorus 937 mg Gopalan C., 1971 the faeces matter. The laxative activity was
1279 mg Tarek A. El-Adawy, seen after administered orally and on treat-
2001
Zinc 10.6 mg Tarek A. El-Adawy, ments with loperamide to induce constipation.
2001 Another thing is that happened is a significant
1.2 mg Okunrobo O., 2012 increase of the intestinal transit (in compa-
Magnesium 11.4 mg Okunrobo O., 2012 rison with castor oil (Swapnil Sharma, 2011).
Fiber 5% Okunrobo O., 2012 Antimicrobial activity of chloroformic,
Potasium 7.8 mg Okunrobo O., 2012 hexane and ethanolic extracts of leaves, stem,
Sodium 5.7 mg Okunrobo O., 2012
fruits and seeds against bacteria (E. coli,
Staphylococcus aureus, Pseudomonas
Chemical components
aeruginosa, Bacillus subtilis and Proteus
The watermelon seeds are free from glucoside
vulgaris) and fungi ( Aspergillus niger,
and alkaloids. The resin has cucurbitol
Candida albicans). The activity was tested by
(C24H40O4) and a small amount of phytosterol.
cup-plate diffusion methods and disc
The shell of the seed it’s 48.7% of the entire
diffusion method. The highest antimicrobial
seed weight. Another fatty acid present but in
results was in using the chloroform extract of
small amount and in the shell is the arachidic
the fruit and it showed results against Bacillus
acid (Biswas R. et al., 2016).
subtilis (38 mm), Escherichia coli (37 mm),
Staphylococcus aureus (36 mm), Proteus
Anti-nutritional factors from watermelon
vulgaris (23 mm) and Pseudomonas
seed
aeruginosa (19 mm). The highest antifungal
Citrullus vulgaris has a source of protein
activity was shown using ethanolic extract of
inhibitors from the watermelon seeds are the
the fruit pulp and stem on Candida albicans
amino acid sequences of two trypsin
(41 mm). Aspergillus niger on the chloroform
inhibitors that contain Arg5-Ile6 bond at their
extract of the seed was very sensitive and also
reactive site.
on the ethanolic extract of the leaves (37
In the seed kernel flour of Citrullus lanatus
mm), in comparison with drugs as clotrimazol
phytic acid and trypsin inhibitor were found
and gentamicin (Loiy Elsir Ahmed Hassan,
in considerable amount (Biswas R. et al.,
2011).
2016).
Cucurbitacin L 2-O- -glucoside pure and
Cucurbitacin E isolated from Citrullus lanatus
Antioxidants – Polyphenols and flavonid
var. citroides have a strong antigiardial
content
activity against Giardia lamila in vitro (IC =
The methanolic extract from seeds of
2 and 5 µg/ml after 5 days). The best of all
Citrullus vulgaris have a high antioxidants
148
examinated extract was the ethyl acetate ingredients in the diets of broiler chicks at up
extract and then petroleum ether followed by to 20%. Male albino rats fed with Citrullus
butanol with IC50 0.1, 0.2 and 0.5 µg/ml) lanatus seeds had higher weight gain (P<0.01)
(Loiy Elsir Ahmed Hassan, 2011). and protein efficiency ratio than the group of
Anti ulcer activity of Citrullus lanatus seeds rats fed with stock diet.
of methanolic extract was tested by pyloric
ligated and water immersion stress induced Anti-diabetic effect
ulcer models on rats. The rats trated with Citrullus colocynthis seeds aqueous extracts
methanolic extract in 300 mg/kg have shown in streptozotocin induced in diabetic rats had
a significant decrease in the gastric volume, a anti hyperglycemic effect, glucose homeo-
free acidity and total acidity for the pyloric stasis and body weight maintenance.
ligated ones and an inhibition of ulcer by
decrease in ulcertive index (Altas S. et al., Cardioprotective effect
2011; Biswas R. Et al., 2016). A group of male albino rats fed with Citrullus
vulgaris had the level of serum triglyceride
Anti-inflammatory activity of Citrullus and VLDL-C significantly decreased
lanatus seed oil in vivo and in vitro (P<0.05). Serum total cholesterol, LDL and
evaluation atherogenic index decreased where HDL was
In vitro anti-inflamatory activity was screened increased.
for human red blood cell membrane stabili-
zation method and in vivo by carrageenan- Anti-obesity and anti-arthritic effect
induced paw edema in rat model. The oil had At the highest dose level of 2000 mg/kg with
a significant reduction of the edema maxi- alcoholic and aqueous extract of Citrullus
mum at 3 hours (the percentage in the vulgaris seed no mortality or abnormal
reduction of the paw volume 44.44%, 44.56% behavior happened at mice. The seed extracts
and 63.11% with 50 mg/kg, 100 mg/kg of with 200 mg/kg and 4000 mg/kg had a
Citrullus lanatus seed oil and 10 mg/kg with significant result with body weight lose,
diclofenac. (Madhavi P. et al., 2012) reducing the food intake, reducing serum
glucose, trygliceride, cholesterol levels with
Anti-hyperlipidemic on hypercholestero- an increased HDL levels in CD and AD
lemia induced atherosclerosis in mice induced obese rats (Biswas R., 2016).
Mice that consumed Citrulls lanatus extract
had very increased plasma citrulline concen- VALORIFICATION OF WATERMELON
trations, lower body weight and fat mass, a WASTES
significant decrease plasma cholesterol
concentration by the reduction of lipoprotein Yeast cultivation
cholesterol. The consumption of the extract Using the water extracts from watermelon,
resulted in reduction of atherosclerosis in cabbage, a mix of residual biomass of tropical
aortic arch and thoracic regions (Poduri A. et fruits and green salads can be used as
al., 2012). substrate for yeast cultivation. Vegetables and
fruit processing wastes cantain organic acids
In vivo activity of watermelon seeds and soluble sugars, that can be used by some
Effect on growth microorganisms, most by yeast, to produce a
Watermelon seed full-fat and watermelon high contented protein biomass with no need
seed meal samples were analyzed for to add any nutrients. Is possible to increase
composition and introduced in the diet of the economic value and nutrients of yeast by
broiler chicks. The full fat increased the adding aprox. 5 µg/ml of selenium
weight gaining (P<0.05), the protein (Stabnikova O., 2005).
consumption and feed intake. The feed intake
was increased linearly with increasing levels Carbon source for carotene production
of watermelon seed meal. This shows that A main carbon source for carotene production
watermelon seed full-fat can be used as food can be made using solid agro-food wastes
149
such as watermelon rind, cabbage and peach the biggest pH level (5.15) compared to the
peels and a heterothallic fungus, Blakeslea banana one that was 4.52, papaya 4.45,
trispora. This fungus was able to use different pineapple 4.42 and citrus the lowest, 4.08.
origin agro-food waste, almost equivalently, The potassium content was the biggest at the
for carotenoids production with a yield of banana fertilizer with 3.932 g K/l, followed
over 76% in all examinated cases by pineapple with 2.828, papaya 2.245,
(Papaioannou E.H. et al., 2012). watermelon 1.529 and the least citrus orange
0.472.
Cutin source The efficiency of the biofertilizer is reflected
A new alternative cutin source can be found by crop growth rate. After applying on the
in agro industrial wastes as inducers of first batch biofertilizers on the Mustard plant,
cutinase production by Fusarium oxysporum. Brassica juncea var. rugosa, the average
The cutin that is isolated from watermelon weight showed that the biofertilizer had the
peels can yield 6.77 U/ml and the cutinase biggest impact of growth from the
using apple cutin 9.64 U/ml. The Fourier watermelon one with a value of 0.100 g and
transform infrared spectroscopy and C cross the lowest from the citrus orange with 0.026
polarization-magic angle spinning nuclear g. The second batch the best weight was still
magnetic resonance spectra solid state NMR from the watermelon fertilizer with 0.208 g,
studies show the nature of watermelon to be the papaya 0.103 g, banana 0.072 g, citrus
an aliphatic polyester of polyhydroxy fatty orange 0.059 g and the least weight 0.051 g.
acids. During submerged fermentation the The untreated plant had 0.027 g. This shows
ester linkages in watermelon were completely shows that the acidity content in the
hydrolyzed. biofertilizer affects the growth of the plant.
The GC-MS indicate the critical structural The average lenght of longest root in the
feature of the hydroxyl groups at ɯ-position Mustard plant sample with watermelon
and middle of the fatty acid chain. X-ray biofertilizer was 40.6 mm after the first batch
diffraction of the watermelon show thats it and the second batch 70.8 mm, papaya with
has amorphous nature. Differential scanning 31.8 mm and 47.7 mm, pineapple 28.0 mm
calorimetry indicates two endothermic and 37.4 mm, banana 31.6 mm and 25.8 mm
transition peaks, one of the broads appear at and citrus orange 19.8 mm and 13.6 mm. The
30-60°C and the other one at 145°C. untreated plant had 20.1 mm.
Thermogravimetric analysis of watermelon The untreated mustard plant had the average
shows that it can be thermally stable up to number of leaves 3.5. The watermelon
200°C. Use of watermelon peels as a cutin fertilizer grew 5.2 leaves and 5.6, papaya 3.8
source in the production of cutinase can and 5.1, banana 4.2 and 3.4, pineapple 3.6 and
receive commercial value and the industries 2.7, citrus orange 3.6 and 2.5.
of processing the watermelons can financially This shows that agro-wastes biofertilizers
boost (Sandeep A. et al., 2015). from watermelon, papaya and banana are
suitable to be used as biofertilizers using
Producing biofertilizer solid-state fermentation (Soh-Fong Lim,
In farming situation the agro-wastes is often Sylvester Usan Matu, 2015).
useless and will be discarded. The Biogas generation
accumulation may cause environmental, Nowadays energy represents a very important
health, esthetic and safety concern and that is factor and an inadequat energy energy supply
why it requires safe disposal. can affect socio-economic activities and limit
Produceing a biofertilizer using agro-wastes economic growth. Because of the rising prices
represents a simple and cost-effective method. of the crude oil and the degradation of the
Using wastes from watermelon, papaya, environment we have to find alternative
pineapple, banana and citrus orange and solid- energy sources that are renewable. Some of
state fermentation method it can produce these sources are represented by biofuels like
biofertilizer and then apply on vegetable biogas, biodisel and bioethanol because they
plantation. The watermelon biofertilizer had are feasible energy source, compatible with
150
current combustion engine technology and products may be low-cost effective and have
distribution networks that already exist. better sorbents.
Watermelon rind and pineapple peels were In process effluents we find Ni2+ and Co2+
each co-digested with food wastes in ratio 1: ions from battery manufacturing, electro-
1 while using rumen contents of cattle as planting and mineral processing and for
inoculum. The generated gas had 68% because is toxic to humans and animal life we
Methan, 20% Carbon dioxide, 6% Nitrogen, have to remove them. The watermelon rind is
2.5% Hydrogen, 1.5% Hydrogen sulfide and rich in polymers like citrulline, proteins,
1% Oxygen. In terms of pathogen treatment cellulose and carotenoids with functional
the anaerobic digestion is found efficient, and groups such as amine (proteins), hydroxyl
five logarithmic units were reached with the (cellulose) and carboxylic (pectin) and can
reduction of coliforms. The establishment of easily bind metal ions. The maximum
using these substrates for biogas plants will sorption capacity of watermelon rind was
reduce solid wastes and ensure a low-carbon found to be 35.3 and 23.3 mg g−1 for Ni2+ and
and safe environment (Dahunsi S.O. et al., Co2+ ions, respectively. Ni2+ ions showed
2015). higher affinity and adsorption rate compared
with Co2+ ions under the experimental
Biosorbent for removal of trivalent conditions. Extraction of Ni2+ and Co2+ ions
chromium from aqueous solution was significantly affected by the presence of
One of the most toxic heavy metal ions is other metals due to competition
Chromium that has adverse effects on humans (Lakshmipathy R. et al., 2013).
and aquatic life. There are many conventional
treatment processes like precipitation, ion Biosorbent for adsorption of methylene
exchange, filtration, membrane filtration, blue
electrochemical treatment and reverse Various industries release effluents containing
osmosis, but they have disadvantages like less dyes and cause negative impact for the
efficiency, high treatment and disposal costs. aquatic organisms and humans. These are one
Adsorption is cost effective and more of the causes of eutrophication and pollution,
efficient technique for the removal of heavy toxic and because of their aromatic complex
metals from wastewater. structure and syntethic nature and potetially
The watermelon rind was evaluated as carcinogenic due. Most of the widely used
economical sorbent for the removal of Cr3+ basic dye for cotton, silk and wool is
from aqueous solution. By using varying pH, represented by methylene blue. Is known to
contact time, adsorbent dose and initial metal cause dysfunction of the liver, central nervous
ion concetration was performed a batch mode and reproductive system, brain and kidney.
adsorbtion. Watermelon rind maximum The most effective technique for the removal
loading capacity was 172.6mg g-1 for Cr3+ of methylene blue is adsorption because of its
ions at pH 3. The removal is found as rapid simplicity, flexibility and without generating
and the equilibrum was reached in aprox. 30 hazardous secondary products.
minutes and follows pseudosecond order Physicochemical characterization of the
kinetic model. Desorption studies show that watermelon rind show that the carboxyl and
watermelon rind could be used without any hydroxyl groups have an important role in the
decrease in efficiency (Nimmala Anvesh adsorption of methylene blue.
Reddy et al., 2014). The adsorption capacity of the watermelon
rind for the methylene blue was 188.68 mg/g
Sorbent for removal of nickel and cobalt at 303K. The best dossage was 0.06 g and
from aqueous solution superior methylene blue adsortion capacity
The most used sorbent for metal removal was in pH 5 solution. Acording to the
from effluents is activated carbon, but its thermodynamic adsorption parameters,
application is limited due to high costs for watermelon rinds was exotheric and
activation and incomplete regeneration and spontaneous (Ali H. et al., 2018).
thats why agricultural waste and industrial by-
151
Adsorbent for zinc removal atherosclerosis in LDL receptor-deficient mice.
Waste water from mosaic industry has zinc in Journal of Nutritional Biochemistry.
concentration range of 350 mg/l to 450 mg/l. Biswas, R., Dey, T., Datta, S. (2016). A comprehensive
review on watermelon seed - the sptted one.
Biosorption had some advantages over Dahunsi, S. O., Owolabi, J. B., Oranusi, S. (2015).
conventional treatment methods wich are high Biogas generation from watermelon peels,
efficiency, low cost, minimization of pineapple peels and food wastes. International
chemical and biological sludge, regeneration Conference on African Development Issues.
of biosorbent and the possibility of metal Dane, F., Jiarong, Liu (2007). Diversity and origin of
cultivated and citron type watermelon (Citrullus
recovery. Biosorbents from fruit rinds lanatus). Genetic Resources and Crop Evolution,
consists in citrulline, pectin, proteins, 54(6), 1255‒1265.
cellulose and carotenoids that have groups of Gopalan, C., Ramasastri, B. V., Balasubramaniam, S.
hydroxyl, amine and corboxylic. These can C. (1971). Nutritive Value of Indian Foods, 1st ed.
easily bind to metal ionsby changing their Hyderabad: National Institute of Nutrition, ICMR.
Lakshmipathy, R., Sarada, N. C. (2013). Application of
hydrogen ions for metal ions or giving an watermelon rind as sorbent for removal of nickel
electron pair coplexes with the metal ions. and cobalt from aqueous solution. International
The silica from the structure o the watermelon Journal of Mineral Processing.
rind can enhance the biosorption process. Loiy Elsir Ahmed Hassan (2011). In vitro antigiardial
The optimum pH was 8, biosorbent amount activity of Citrullus lanatus var. citroides extracts
and cucurbitacins isolated compounds. Journal of
1.5 g, zinc concentration 400 mg/l and Medicinal Plants Research, 5(15), 3338‒3346.
contact time was 30 minutes (Othman N. et Loiy Elsir Ahmed Hassan (2011). In vitro
al., 2014). antimicrobial activities of chloroformic, hexane and
ethanolic extracts of Citrullus lanatus var.
citroides. Journal of Medicinal Plants Research,
CONCLUSIONS 5(8), 1338‒1344.
Madhavi, P., Maruthi Rao, Kamala Vakati, Habibur
There are lots of parts of the watermelon that Rahman, Chinna Eswaraiah M. (2012). Evaluation
are not consumed by the human because they of Anti-Inflammatory Activity of Citrullus lanatus
are considered not edible. The seeds are a Seed Oil by In vivo and In vitro Models. Int. Res J
Pharm. App Sci., 2(4): 104‒108.
source of nutrients such as minerals, proteins Othman, N., Kueh, Y. S., Azizul-Rahman, F. H.,
and lipids that are used in medicine. The Hamdan, R. (2014). Watermelon rind: A Potential
watermelon seeds have low molecular weight Adsorbent for zinc removal. Applied Mechanics
polypeptides like albumin, globulin, glutein and Materials, 680, 146‒149.
and lots of glutamic acid, aspartic acid and Naresh Singh Gill (2011). Evaluation of Antioxidant
activity of Citrullus lanatus Seed extract in Rats.
serine. Because they are rich in protein they Latin American journal of pharmacy (formely Acta
could be used in food formulations as Farmaceutica Bonaerense), Lat. Am. J. Pharm.,
ingredients. They have a good impact on the 30(3), 429‒34.
human health as anti-diabetic effect, Nimmala Anvesh Reddy, Lakshmipathy, R., Sarada, N.
cardioprotective, anti- ulcerogenic and anti- C. (2014). Application of Citrullus lanatus rind as
biosorbent for removal of trivalent chromium from
obesity. In most of the countries there are lots aqueous solution. Alexandria Engineering Journal.
of products that have incorporated Okunrobo O. Lucky, Uwaya O. John, Imafidon E.
watermelon seed oil although is not Kate, Osarumwense O. Peter, Omorodion E. Jude
considered an oil seed. (2012). Quantitative determination, Metal analysis
and Antiulcer evaluation of Methanol seeds extract
of Citrullus lanatus Thunb (Cucurbitaceae) in Rats.
REFERENCES Asian Pacific Journal of Tropical Disease,
S1261‒S1265.
Ali H. Jawad, Y.S. Ngoh, Khairul Adza Radzun Papaioannou, E. H., Liakopoulou-Kyriakides, M.
(2018). Utilization of watermelon (Citrullus (2012). Agro-food wastes utilization by Blakeslea
lanatus) rinds as a natural low-cost biosorbent for trispora for carotenoids production. Acta Biochim
adsorption of methylene blue: kinetic, equilibrum Pol, 59, 151‒3.
and thermodynamic studies. Journal of Taibah Sandeep A. Chadhari, Rekha S. Singhal (2015). Cutin
University for Science. from watermelon peels: A novel inducer for
Aruna Poduri, Debra L. Rateri, Shubin K. Saha, Sibu cutinase production and its physicochemical
Saha, Alan Daugherty (2012). Citrullus lanatus characterization. International Journal of
‘sentinel’ (watermelon) extract reduces Biological Macromolecules.
152
Sevcan Altas, Göksel Kızıl, Murat Kızıl, Aydın Ketani, enriched with selenium. Bioresource Technol, 96,
Parvez I. Haris, 2011. Protective effect of 747‒751.
Diyarbakır watermelon juice on carbon Swapnil Sharma (2011). First report on Laxative
tetrachloride-induced toxicity in rats. Food and activity of Citrullus lanatus. Pharmacology online,
Chemical Toxicology, 49, 2433–2438. 2, 790‒797.
Soh-Fong Lim, Sylvester Usan Matu, (2015). Tarek A. El-Adawy, Taha K. M. (2001).
Utilization of agro-wastes to produce biofertilizer. Characteristics and composition of watermelon,
International Journal of Energy Environmental pumpkin, and paprika seed oils and flours. J. Agric.
Engineering. Food Chem., 49, 1253‒1259.
Stabnikova, O. (2005). Biotransformation of vegetable
and fruit processing wastes into yeast biomass
153
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
MAPPING GEOGRAPHICAL DISTRIBUTION OF ROMANIAN
ORCHIDS AND THEIR BIOLOGICAL ACTIVE SUBSTANCES
Laura-Simona IRIMESCU, Narcisa BĂBEANU, Florentina MATEI
University of Agronomic Sciences and Veterinary Medicine of Bucharest, Faculty
of Biotechnologies, 59 Mărăști Blvd., District 1, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
The present review aims to map the various species of orchids in Romania, in search of reported biological active
substances. Several authors have reported that the main biological active compounds of this botanical group are
tannins, volatile oils and phenanthrene quinones, which are not water soluble. The review will pay a special attention to
autochthonous Orchidaceae species. In Romania most of these plants were identified in the Iron Gates Natural Park
and surroundings. The data analysis will also cover the polyphenolic profile of the underground parts of Orchidaceae
group to evaluate their antioxidant and antimicrobial potential, as well as to identify some other biochemical reported
compounds as source for new biotechnological applications.
Key words: Orchidaceae, biologically active compounds.
INTRODUCTION treatment for the gastrointestinal tract, diarrhea
and bilious affections. The main component of
The Orchidaceae family, despite all beliefs, is orchid flour is glucomannan, a polysaccharide,
one of the most widespread families of plants comprising of mannose and glucose (Kaya &
in the world. Total number of species counts Tekin, 2001). The plant that vanilla is made
almost 26,567 species worldwide (World from is also an orchid: Vanilla planifolia. This
Checklist of Selected Plant Families, Kew species contains a substance, vanillin, that is
WCSP, 2011). These species are mainly known the main responsible for the famous flavor.
as ornamental ones, but numerous orchids are Two other orchids are known that contain
known for their healing properties, also as a vanillin, V. pompona and V. tahitensis, but the
reliable food source, fragrance and flavor quality of the flavoring substances is very low
usage. Due to the wide spreading, the orchids and they are not effective from industrial usage.
have many uses in many different cultures. In In Bhutan, orchids are used to make a kind of
Southern Africa, the orchid tubers are used for dip or sauce from Cymbidium hookerianum
a meatless type of sausage called “chikanda”, called Olatshe. Another Bhutanese delicacy
representing a cheap source of food. The high made from Cymbidium is Olachoto.
consumption of orchid tubers affected very In the USA, Dendrobium genus is used as an
much the orchid population, because of the edible food decoration, but the orchid species
wide consumption of this kind of food, used is a hybrid one, not found in nature.
especially in Zambia, bringing the species Dendrobium is also used for making deferent
almost to extinction in that area. A Turkish kinds of sauces or dips in Singapore, Thailand
kind flour, called “salep”, is made using mainly and Japan. Australian aborigines use
Orchis mascula or Orchis militaris plants, but Dendrobium kingianum as food, mainly the
also related species can be used. Salep, with stems (pseudo-stems). We encounter orchids
small recipe change, is encountered also in usage even in Hawaii as salads, Dendrobium
Greece (“salapi”), United Kingdom (“saloop”) salaccense is used as a condiment in Malaysia.
and Middle Eastern countries (Arabian In Nepal and China Dendrobium orchids are
“sahlab”). It is well known as a predecessor of used for tea. In China, there is even an Orchid
coffee because of his rejuvenating properties. Wine produced, and it is very popular. Faham
Salep has also powerful aphrodisiac effects, a tea is made in Mauritius and Isle de Reunion.
154
Although used for their remarkable beauty, Many of the epiphytic Orchids are used as
Orchids can be found in cosmetic products and traditional medicine. Chemical components and
play a role in herbal medicines. In other pharmacology have been studied in recent 15
countries, they are used for their therapeutically years. Medicinal orchids, in general, are not
properties. Most of them have been listed in subject to detailed pharmacological studies.
folk medicine. In the cosmetic industry, the Extracts and metabolites of these plants,
plants from Orchidaceae family are valued for particularly those from flowers and leaves,
anti-ageing potential and skin moisturizing possess useful pharmacological activities.
agent. Particular attention has been given to diuretic,
In Romania, Orchids are mainly use for their antirheumatic, anti-inflammatory, anti-
ornamental beauty, although there are almost carcinogenic, hypoglycemic activities,
58 species identified in our country. Almost all antimicrobial, anticonvulsive, relaxation,
the studies concerning the Romanian Orchids, neuroprotective, and antivirus, activities.
aimed to identify the species, the treats and a A comprehensive account of chemical
proper conservation, if needed. constituents and biological activities is
The aim of this review is to update and to presented and a critical appraisal of the
present a comprehensive analysis of traditional ethnopharmacological issues is included in
and folklore uses, pharmacological reports and view of the many recent findings of importance
phyto-constituents isolated from the of these orchids. A large number of orchids
Orchidaceae family, found on Romanian soil. have been empirically used for treatment of
different diseases, thus, several studies have
MATERIALS AND METHODS been undertaken to provide scientific proof to
justify the medicinal use of various plants in
The information on Orchidaceae family from treatment of diseases. The orchids extracts have
Romania was gathered from worldwide been used for their diuretic, relaxation, anti-
accepted scientific databases via an electronic rheumatic, hypoglycemic activities, anti-
search (Google Scholar, Web of Science, inflammatory, antimicrobial and antivirus,
ScienceDirect, ACS Publications, PubMed, anticarcinogenic, anticonvulsive, neuroprotec-
Wiley Online Library, SciFinder, CNKI). tive properties.
Information was also obtained from The Plant A wide range of orchids’ chemical compounds
List, Chinese pharmacopoeia, Chinese herbal are presented in Table 2, including alkaloids,
classics books, PhD and MSc dissertations, bibenzyl derivatives, flavonoids, phenanthrenes
unpublished materials, and local conference and terpenoids which have been isolated
papers on toxicology. Plant taxonomy was recently from orchid species. Phytochemicals
confirmed to the database “The Plant List” are substances produced by every plant for
(www.theplantlist.org). various reasons as: reproduction, defense,
rejecting other plants or animals etc. In orchid’s
RESULTS AND DISCUSSIONS case, there are few studies made about these
substances, and for some of them we do not
As we can see from Table 1, Orchids reports in know at all their biological function.
Romania are more numerous in the National We can group the phytochemicals encountered
Park Nera Gorges-Beuşniţa, Iron Gate National in orchids as: flavonoids, alkaloids, antho-
Park and Piatra Craiului National Park, and, cyanins, carotenoids and sterols.
unfortunately, few of them are Red listed
species.
155
Table 1. Orchids from Romania: Localization
Ref. Area Species References
No.
1. Babadag-Codru Forest Orchis simia
- Tulcea County
2. Bicaz Gorges - Cephalanthera damasonium (Romanescu G. et al, 2013)
Hăghimaș National
Park
3. Bucegi Mountains Chamorchis alpina (Biţă-Nicolae, 2011)
4. Bucegi Mountains - Epipogium aphyllum Fotograful de orhidee din Bucegi (Galerie FOTO).
Prahova and Brașov "Clubul Rotary Valea Prahovei" Association.
County Retrieved from https://www.rotarybvp.ro/fotograful-
de-orhidee-din-bucegi-galerie-foto/
5. Bucegi Mountains, Coeloglossum viride (Irimia, 2011)
Călimani Mountains -
Pietrosu, Red Lake,
Retezat Mountains,
Giumalău Mountains
6. Buzău County Ophrys scolopax ssp. cornuta var. banatica (Atanasiu, 2014)
7. Buzăului Mountains Nigritella nigra, Nigritella rubra Margoi, D. (2015, June 20). Montaniarzi: Sangele
voinicului, orhideea salbatica din Carpati. Retrieved
December 22, 2018, from
http://www.montaniarzi.ro/sangele-voinicului-
orhideea-salbatica-din-carpati/
8. Ciucului Mountains, Nigritella nigra, Nigritella rubra Pușcarciuc, M. (2012, June 17). Munte&Flori:
Bucegi Mountains Nigritella nigra (2013, January 11). Retrieved from
http://www.muntesiflori.ro/nigritella-nigra-foto/
9. Defileul Dunării/Porțile Anacamptis pyramidalis Photo-hunting: La vânătoare de orhidee sălbatice prin
de Fier Banat. S.C. Tymes Globetrotter S.R.L. Retrieved
from http://www.tymestours.ro/RO/X/X-orhidee-
banat-excursii/01-orhidee-banat-excursii.htm
10. Dobrogea Liparis loeselii (Sârbu et al., 2006)
11. Glodeasa Forest - Herminium monorchis
Prahova County
12. Grohotiș and Hășmas Orchis ustulata Munte&Flori: Orchis ustulata. Retrieved from
Mountains - Prahova http://www.muntesiflori.ro/orchis-ustulata-foto/
County
13. Hăghimas National Orchis coriophora, Orchis morio ssp. alba, Orchis morio ssp. picta, (Romanescu G. et al, 2013)
Park - Neamț County Orchis tridentata, Traunsteinera globosa
14. Iron Gates Nature Park Orchis mascula, Orchis militaris, Orchis pallens, Orchis (Milanovici, 2014)
papilionacea, Orchis purpurea, Platanthera chloranth, Pseudorchis
albida, Spiranthes spiralis
15. Jibou City Area - Sălaj Orchis purpurea (Szatmari, 2016), page 34
County
16. Măcinului Mountains- Orchis purpurea Zana Florilor. Flori din Padure: Orhidee alba in
Dobrogea County Muntii Macinului (Orchis purpurea sau gemanarita).
(2017, September5). Retrieved from
http://zanaflorilor.eu/flori-padure-orhidee-salbatice-
muntii-macinului-orchis-purpurea-sau-gemanarita/
17. Mădăraș Mountain - Dactylorhiza fuchsia Munte&Flori: Orhideele genului Dactylorhiza.
Harghita County Retrieved from http://www.muntesiflori.ro/genul-
dactylorhiza/
18. Meseş Mountains - Platanthera bifolia (Szatmari, 2016, page 35)
Sălaj County
19. Mic Mountain – Caraș- Dactylorhiza fuchsia Milanovici, S. (2016, November 2). The orchid flora
Severin County, of the Muntele Mic (Caraş-Severin County,
Romania). Journal of Biological Sciences. Retrieved
December 22, 2018 from
http://journal.pmf.ni.ac.rs/bionys/index.php/bionys/art
icle/view/185
20. National Park Nera Epipactis microphylla, Himantoglossum hircinum, Limodorum (Bâtea, 2014)
Gorges – Caraș-Severin abortivum, Liparis loeselii , Listera ovata, Neottia nidus-avis,
County Ophrys apifera, Ophrys scolopax ssp. cornuta var. banatica, Orchis
coriophora, Orchis mascula, Orchis morio ssp. alba, Orchis
morio ssp. morio, Orchis morio ssp. picta, Orchis pallens, Orchis
papilionacea, Orchis simia, Orchis tridentata, Platanthera bifolia
156
Ref. Area Species References
No.
21. Only mentioned - no Epipactis palustris, Orchis x gennarii (hibrid) (Gubandru-Tomescu, 2018)
exact area defined
22. Ortelec Hills - Zalău Orchis militaris (Szatmari, 2016, page 35)
City
23. Piatra Craiului National Anacamptis pyramidalis, Cephalanthera rubra, Chamorchis alpina, (Gubandru-Tomescu, 2018)
Park - Brașov/Argeș Corallorhiza trifida, Dactylorhiza cordigera, Dactylorhiza
County cordigera ssp. siculorum, Dactylorhiza incarnata, Dactylorhiza
maculata, Dactylorhiza majalis, Dactylorhiza saccifera, Epipactis
atrorubens, Epipactis helleborine, Epipactis microphylla,
Gymnadenia conopsea, Gymnadenia odoratissima,
Gymnoleucorchis x strampfii (hibrid), Herminium monorchis,
Himantoglossum hircinum, Leuchorchis albida, Limodorum
abortivum, Liparis loeselii, Listera cordata, Listera ovata, Neottia
nidus-avis, Nigritella nigra, Nigritella rubra, Ophrys apifera,
Ophrys scolopax ssp. cornuta var. banatica, Ophrys sphegodes,
Orchis coriophora, Orchis mascula, Orchis militaris, Orchis
morio ssp. alba, Orchis morio ssp. morio, Orchis morio ssp. picta,
Orchis pallens, Orchis papilionacea, Orchis purpurea, Orchis
tridentata, Orchis ustulata, Platanthera bifolia, Platanthera
chlorantha, Pseudorchis albida, Traunsteinera globosa
24. Piatra Mare Mountains Epipactis helleborine, Epipactis palustris (Ardelean et al., 2018)
- Brașov County
25. Piatra Mare Mountains Orchis mascula (Ardelean et al., 2018)
- Brașov County
26. Plopiș Mountains- Ophrys apifera, Ophrys sphegodes (Szatmari, 2016)
Bihor/Sălaj County
27. Postăvaru Mountains - Cephalanthera damasonium Romfilatelia: Frumusețea florilor rare pe timbre:
Brașov County Orhidee sălbatice din România. Retrieved from
http://www.romfilatelia.ro/ro/frumusetea-florilor-
rare-pe-timbre-orhidee-salbatice-din-romania/
28. Postăvaru Mountains - Platanthera bifolia (Ardelean et al., 2018)
Prahova County
29. Rarău-Giumălău Goodyera repens (Oprea & Sîrbu, 2012)
Mountains - Suceava
County
30. Retezat Mountains - Herminium monorchis (Benedek & Dragulescu, 2006)
Hunedoara County
31. Rosia Montana Area - Listera ovate (Roman & Cristea)
Alba County
32. Sibiu County Orchis militaris
33. Solovan Hill - Dactylorhiza sambuccina (Goja, 2014)
Maramureș County
34. Stânișoara Mountains- Listera cordata, Listera ovata, Neottia nidus-avis, Orchis (Oprea & Sîrbu, 2012)
Neamt/Suceava County coriophora, Orchis laxiflora ssp. elegans, Orchis
laxiflora ssp. palustris, Orchis militaris, Orchis morio ssp. alba,
Orchis morio ssp. morio, Orchis morio ssp. picta, Orchis purpurea,
Orchis tridentata, Orchis ustulata, Platanthera bifolia,
Traunsteinera globosa
35. Strâmtura - Maramureş Cypripedium calceolus Schlesinger, A. (2012, 27 May). Munte&Flori:
County, Hășmaș Cypripedium calceolus. Retrieved from
Mountains - http://www.muntesiflori.ro/cypripedium-calceolus-
Maramureș County, foto/
Cucului Mountains -
Harghita County
36. Tazlăului Cephalanthera longifolia Zana Florilor. Flori din Padure: Orhidee alba in
Subcarpathians, Muntii Macinului (Cephalanthera longifolia). (2017,
Măcinului Mountains August 5). Retrieved from http://zanaflorilor.eu/flori-
padure-orhidee-alba-muntii-macinului-cephalanthera-
longifolia/
37. Sugău Cave - Harghita Corallorhiza trifida (Flaviu-Crisan et al., 2014)
County
38. Tarcăului Mountains, Cephalanthera longifolia Photo-hunting: La vânătoare de orhidee sălbatice prin
Vrancei Mountains Banat. S.C. Tymes Globetrotter S.R.L. Retrieved
from http://www.tymestours.ro/RO/X/X-orhidee-
banat-excursii/01-orhidee-banat-excursii.htm
39. The National Park Nera Dactylorhiza maculata, Dactylorhiza majalis, (Bâtea, 2014)
Gorges-Beușnița Dactylorhiza saccifera
157
Ref. Area Species References
No.
40. Trotușului Mountains - Dactylorhiza incarnata Marelena şi Radu Puşcarciuc - Orhidee din Munţii
Bacău County Trotuşului, floră -
https://sites.google.com/site/romanianatura56/home/c
arpatii-rasariteni/trotusului/orhidee-din-muntii-
trotusului-flora
41. Turda Gorge - Cluj Platanthera bifolia Nagy, Z. (2014, July 29). Lesser Butterfly-orchid
County (Platanthera bifolia) in the forests around Turda
Gorge, Romania. Retrieved December 22, 2018, from
https://www.naturepl.com/stock-photo-lesser-
butterfly-orchid-platanthera-bifolia-in-the-forests-
around-image01469679.html
42. Umbrărești Village - Cephalanthera rubra
Galați County
The most important of them is the alkaloid, a (Kukuczanka % Wojciechowska, 1983;
type of substance containing carbon, hydrogen Kukuczanka, 1985; Mironowicz et al., 1987),
and nitrogen atoms (with additional atoms of primarily the hydrolysis of (±)-menthyl acetate
oxygen and sulfur). Quinine is an alkaloid to menthol (75-85%), the hydrolyzation of
found in different orchid species and has a phenol acetates, aromatic-aliphatic alcohols
pharmacological importance in antimalarial and acatates of racemic aromatic-aliphatic
medicines. The most studied substances from alcohols (Mironowicz et al., 1993).
Orchids, from a pharmacologically point of Phenanthrene derivatives have been found to be
view, are: alkaloids, phenanthrenes, terpenoids, potent phytoalexins, while others act as
bibenzyl derivatives, and flavonoids. They can endogenous plant growth regulators (Gorham,
be found in whole plant, but also in leaves, 1980; Majumder et al., 2001). Convallarioides
flowers and roots. nudol, eranthridin, sitosterol, erianol were
Other secondary metabolites isolated from Eria convallarioides (Majumder
Organic compounds that are either specific to & Kar, 1989). Sitosterol, betulinic acid and
the plant family or xenobiotic can be some perfumery constituents were isolated
transformed in tissue culture. Many orchid from Luisia indivisa (Majumder & Lahiri,
species produce secondary metabolites which 1989). Flavone C-glycosides and flavonols
are either isoprenoid compounds, including were the most common constituents found in
sterols (Hills et al., 1968; Wan et al., 1971), or 53 and 37%, respectively of 142 species (75
derivatives of shikimic acid. Tissue cultures of genera) leaves (Williams, 1979).
Cymbidium ‘Saint Pierre’, Dendrobium Bulbophyllanthrone: a cytotoxic
phalaenopsis, Epidendrum ochraceum phenanthraquinone from Earina autumnalis
maintained in vitro on media used for other (Hinkley & Lorimer, 1999). The addition of
orchids transformed some isoprenoids
Table 2. Active compounds
Species Bioactive compound References
Anacamptis pyramidalis Phenenathrene quinone: Marchantine A=Orchinol (Reinhold et al.,1980)
Mucin content and Orchinol, (Teoh, 2016)
and p-hydroxybenzyl alcohol
Cephalanthera longifolia Alkaloids, Quercitin and Kaempferol-O-glicosides (Teoh, 2016)
Cephalanthera rubra, Loroglossin, alkaloids and quercitin (Teoh, 2016)
Cephalanthera damasonium
Chamorchis alpina Phytoalexin Orchinol and p-hydroxybenzyl alcohol (Pridgeon et al., 2001)
Coeloglossum viride Phenenathrene quinone (Reinhold et al.,1980)
Cypripedium calceolus Fatty acid derivatives, isoprenoids, and (Teixeira da Silva, 2013)
phenyl derivatives
Alkaloids, saponins, sugars, essential oils, phenolic compound,tannins, (Jimenez & Pourhashemi,
anthocyanins,lipds, coumarins, luteolin, arbutin 2014)
Dactylorhiza fuchsii, Seven anthocyanins (chrysanthemin, cyanin, seranin, ophrysanin, orchicyanin I/II, (Teixeira da Silva, 2013)
Dactylorhiza incarnata, serapianin)
Dactylorhiza maculata, cyanidin 3-oxalylglycosides (Soare et al., 2011)
Dactylorhiza majalis,
Dactylorhiza saccifera,
Dactylorhiza sambuccina
158
Species Bioactive compound References
Epipactis atrorubens - Metabolite: Ophrysanin Epipactis atrorubens.
Dumbrăviță roșcată PhytoChemical Interactions
DB. Retrieved from
https://www.genome.jp/db/pc
idb/kna_species/12930#meta
bolite
Epipactis helleborine A series of four mannose(Man)-, three N-acetylglucosamine (GlcNAc)n-, ten N- (Bazarini et al., 1992)
acetylgalactosamine/galactose(GalNAc/Gal)-, one 5-acetylneuraminic acid(α-2,3-
Gal/GalNAc)- and one 5-acetylneuraminic acid(α-2,6-Gal/GalNAc)-specific plant
agglutinins were evaluated for their antiviral activity in vitro
Epipogium aphyllum Carotenoids: neoksantin, lutein, (Jimenez & Pourhashemi,
violaxanthin 2014)
Goodyera repens Loroglossin (Pridgeon et al., 2003)
Alkaloids, rutin, loroglossin, Kaempferol-3-0-rutinozid, gudayerin, izoramnetin-3-0- (Jimenez & Pourhashemi,
rutinozid 2014)
Gymnadenia conopsea Anthocyanins Gymconopin A, Gymconopin B, Gymconopin D, and 3,3'-Dihydroxy- (Pérez Gutiérrez, 2010)
2,6-bis(4-hydroxybenzyl)-5- methoxybibenzyl, Antiallergic phenanthrenes and
stilbenes
Herminium monorchis Glucomannans, Hydrophylic carbohydrates of high viscosity are found in tubers (Teoh, 2016)
Himantoglossum hircinum Phytoalexin orchinol (2,4ǦdimethoxyǦ7ǦhydroxyǦ9, 10Ǧdihydrophenanthrene) (Carey & Farrell, 2002)
and pǦhydroxybenzylalcohol, 4ǦmethoxyǦ2,5ǦdihydroxyǦ9,10Ǧdihydrophenanthrene
(Phytoalexin hircinol), Loroglossin (phenolic glicoside). The chemical composition of
the flowers(E)Ǧ3ǦmethylǦ4Ǧdecenoic acid (Z)Ǧ4Ǧdecenoic acid and lauric acid.
Liparis loeselli Alkaloids (Teoh, 2016)
Listera ovata A series of four mannose(Man)-, three N-acetylglucosamine (GlcNAc)n-, ten N- (Bazarini et al., 1992)
acetylgalactosamine/galactose(GalNAc/Gal)-, one 5-acetylneuraminic acid(α-2,3-
Gal/GalNAc)- and one 5-acetylneuraminic acid(α-2,6-Gal/GalNAc)-specific plant
agglutinins were evaluated for their antiviral activity in vitro
Nigritella nigra Phenenathrene quinone: Marchantine A (Reinhold et al., 1980)
Seven anthocyanins (chrysanthemin, cyanin, seranin, ophrysanin, orchicyanin I/II, (Teixeira da Silva, 2013)
serapianin)
cyanidin 3-oxalylglycosides (Soare et al., 2011)
Nigritella rubra Seven anthocyanins (chrysanthemin, cyanin, seranin, ophrysanin, orchicyanin I/II, (Teixeira da Silva, 2013)
serapianin)
cyanidin 3-oxalylglycosides (Soare et al., 2011)
Ophrys apifera, Ophrys Seven anthocyanins (chrysanthemin, cyanin, seranin, ophrysanin, orchicyanin I/II, (Teixeira da Silva, 2013)
scolopax ssp. Cornuta serapianin)
var. banatica, Ophrys sphegodes, cyanidin 3-oxalylglycosides (Soare et al., 2011)
Orchis coriophora, Orchis
laxiflora ssp. elegans, Orchis
laxiflora ssp. palustris
Orchis mascula, Orchis militaris, Phenenathrene quinone (Reinhold et al., 1980)
Orchis morio ssp. alba, Orchis cyanidin 3-oxalylglycosides (Soare et al., 2011)
morio ssp. morio, Orchis Seven anthocyanins (chrysanthemin, cyanin, seranin, ophrysanin, orchicyanin I/II, (Teixeira da Silva, 2013)
morio ssp. picta serapianin)
Orchis pallens, Orchis Seven anthocyanins (chrysanthemin, cyanin, seranin, ophrysanin, orchicyanin I/II, (Teixeira da Silva, 2013)
papilionacea, Orchis purpurea, serapianin)
Orchis simia, Orchis tridentata, cyanidin 3-oxalylglycosides (Soare et al., 2011)
Orchis ustulata, Orchis x gennarii
(hibrid)
Platanthera bifolia Volatiles from flowers:benzyl benzoate, benzyl salicylate, cinnamyl alcohol, lilac (Plepys et al., 2002)
aldehydes, methyl benzoate and methyl salicylate
Liliac aldehyde (Baxter et al., 1998)
Pseudorchis albida Phytoalexin orchinol (2,4ǦdimethoxyǦ7ǦhydroxyǦ9,10Ǧdihydrophenanthrene) (Jersáková et al., 2011)
and pǦhydroxybenzylalcohol. Flavonoid glycones content of the leaves of P. albida
revealed the presence of quercetin and kaempferol The scent was rich in terpenoid
compounds, and most of the dominant compounds (e.g. 4Ǧoxoisophorone, βǦmyrcene,
limonene, βǦphellandrene, and verbenone) are frequently found in various orchid
species
Traunsteinera globosa Ophrysanin KNApSAcK Metabolite
C00006794.
PhytoChemical Interactions
DB. Retrieved from
https://www.genome.jp/db/pc
idb/kna_cpds/6794#species
glyphosate (as RoundUp®) resulted in the formation depending on wounding and the
production of orchinol, a phenolic compound, extent of fungal infection (Gehlert & Kindl,
in Orchis morio liquid culture (Beyrle et al., 1991).
1995). Dihydrophenanthrenes and bibenzyl Species that has no active substances studied or
synthase are produced in the rhizomes of known: Corallorhiza trifida, Epipactis
orchids after wounding, their induced microphylla, Epipcatis palustris, Gymnadenia
159
odoratissima, Gymnoleucorchis x strampfii fuchsii, Dactylorhiza majalis, Dactylorhiza
(hibrid), Leuchorchis albida, Limodorum saccifera, Dactylorhiza sambuccina, Epipactis
abortivum, Limodorum abortivum Listera atrorubens, Epipactis microphylla, Epipcatis
cordata, Neottia nidus-avis, Platanthera palustris, Gymnadenia odoratissima,
chlorantha, Spiranthes spiralis. Gymnoleucorchis x strampfii (hibrid),
As we can see in Table 3, there are many Leuchorchis albida, Limodorum abortivum,
medicinal uses for orchids, but not all species Listera cordata, Neottia nidus-avis, Nigritella
encountered in Romania have one. Species nigra, Nigritella rubra, Orchis pallens, Orchis
without a medicinal use known or studied are: papilionacea, Orchis purpurea, Orchis
Cephalanthera rubra, Cephalanthera tridentata, Orchis x gennarii (hibrid),
damasonium, Chamorchis alpina, Corallorhiza Platanthera chlorantha, Pseudorchis albida,
trifida, Dactylorhiza cordigera, Dactylorhiza Traunsteinera globose.
cordigera subsp. siculorum, Dactylorhiza
Table 3. Medicinal uses
Species Medicinal uses References
Anacamptis pyramidalis Demulcent Rich., L. (N/A). Anacamptis pyramidalis Pyramidal Orchid
PFAF Plant Database. Retrieved December 23, 2018 from
https://pfaf.org/user/Plant.aspx?LatinName=Anacamptis+p
yramidalis
Skin whitener, neuroprotective (Teoh, 2016)
Cephalanthera longifolia Appetizer, tonic, it heals wound (Pant, 2013)
Coeloglossum viride Memory impairment in mice (Zhang et al., 2005)
Cypripedium calceolus - Antispasmodic, anxiety, astringent, cramps, delirium (Liu D., Ju J.H., Zou Z.J., et al., 2005)
Papucul doamnei tremens, diaphoretic (promotes sweating), diarrhea,
enhancing recovery from surgery or illness, hypnotic,
hysteria, insomnia, menorrhagia (heavy menstrual bleeding),
mood (elevate), muscle spasms, nervousness, pain, pruritus
(severe itching), sedative, stimulant, stress, styptic (stops
bleeding), tension (emotional), tooth pain.
Dactylorhiza incarnata Demulcent, nutritive Soó, L. (N/A). Dactylorhiza incarnata Marsh Orchid
PFAF Plant Database. Retrieved December 23, 2018 from
https://pfaf.org/user/Plant.aspx?LatinName=Dactylorhiza+i
ncarnata
Dactylorhiza maculata - Impotence treatment, genital vasodilatation (Bivolaru, 2001)
Poroinic
Epipactis helleborine Relief of moderate an severe pain - oxycodone
Highly inhibitory to human (Bazarini et al., 1992)
immunodeficiency virus type 1 (HIV-1) and type 2 (HIV-2),
and showed a marked anti-human cytomegalovirus,
respiratory syncytial virus and influenza A virus activity
Epipogium aphyllum Restorative, pain reliever, tonic (Jimenez & Pourhashemi, 2014)
Goodyera repens Improve the appetite and treatment of colds, kidney and Goodyera repens Creeping Lady's Tresses, Lesser
bladder problems rattlesnake plantain PFAF Plant Database. Retrieved from
https://pfaf.org/user/Plant.aspx?LatinName=Goodyera+rep
ens
Roots and leaves were used medicinally, by native (Pridgeon et al., 2003)
Americans of British Columbia to treat cancers, ulcers,
lupus,colds, burns, rheumatism
Emollient, detoxification, to imrpove appetite, as a remedy (Jimenez & Pourhashemi, 2014)
for snake bites, diseases of the stomach, bladder
Gymnadenia conopsea Demulcent; Nutritive. Gymnadenia conopsea Fragrant Orchid PFAF Plant
Database. Retrieved from
https://pfaf.org/user/Plant.aspx?LatinName=Gymnadenia+
conopsea
Tubers are used as aphrodisiac. Alcohol extract of rhizomes (Pérez Gutiérrez, 2010)
of Gymnadenia conopsea
showed effect on the collagen synthesis in rat lungs exposed
to silica under the influence on antioxidase activities. The
extract can ameliorate silica-induced pulmonary fibrosis by
increasing activities of antioxidase and alleviating damage of
lipid peroxidation to the lungs. Methanol extract from the
tubers of Gymnadenia conopsea showed an antiallergic effect
on ear passive cutaneous anaphylaxis reactions in mice.
Inhibit antigen-induced
degranulation.
160
Species Medicinal uses References
Herminium monorchis Treat kidneys and stomach,and also used for nervous (Teoh, 2016)
breakdown, insomnia, confusion, anorexia.
Himantoglossum hircinum The antifungal activity of orchinol and (Carey & Farrell, 2002)
hircinol against Candida lipolytica
Liparis loeselli Activity against bacteria and fungi suggesting that there may (Teoh, 2016)
be a basis for their usage to treat superficial infections.
Pyrrolizidine alkaloids possess anti-oxidant activity
Listera ovata Skin The use of Orchid for medicinal purposes. Retrieved from
http://www.orchids-world.com/evergreen/med.pdf
inhibitory to human immunodeficiency virus type 1 (HIV-1) (Bazarini Et al., 1992)
and type 2 (HIV-2) in MT-4, and showed a marked anti-
human cytomegalovirus (CMV), respiratory syncytial virus
(RSV) and influenza A virus activity in HEL, HeLa and
MDCK cells, respectively
Tubers were used as a tincture for Stomach disease. (Pérez Gutiérrez, 2010)
Externally skin tone
Ophrys apifera Aphrosidiac (Pant, 2013)
Ophrys Demulcent; Nutritive. Ophrys scolopax. Woodcock Orchid PFAF Plant Database.
scolopax ssp. cornuta Retrieved from
var. banatica https://pfaf.org/user/Plant.aspx?LatinName=Ophrys+scolo
pax
Ophrys sphegodes Aphrosidiac Pant, B., 2013. Medicinal orchids and their uses: Tissue
culture a
potential alternative for conservation, pages 450-453
Orchis coriophora Antiflatulent; Demulcent Orchis coriophora . Bug Orchis PFAF Plant Database.
Retrieved from
https://pfaf.org/user/Plant.aspx?LatinName=Orchis+coriop
hora
Orchis Diarrhea, bronchitis and convalescence (Singh & Duggal, 2009)
laxiflora ssp. elegans
Orchis Diarrhea, bronchitis and convalescence (Singh & Duggal, 2009)
laxiflora ssp. palustris
Orchis mascula Aphrosidiac (Pant, 2013)
Orchis militaris Demulcent Orchis militaris. Military Orchis PFAF Plant Database.
Retrieved from
https://pfaf.org/USER/Plant.aspx?LatinName=Orchis+milit
aris
Orchis morio ssp. alba, Gastroenteritis, antistringent Orchis morio Herb Uses, Cures, Side effects, Nutrients.
Orchis morio ssp. morio, Herbpathy.com. Retrieved from
Orchis morio ssp. picta https://herbpathy.com/Uses-and-Benefits-of-Orchis-Morio-
Cid3278
Orchis simia Aphrosidiac (Pant, 2013)
Orchis ustulata Antiflatulent Orchis ustulata. Dark-Winged Orchis PFAF Plant
Database. Retrieved from
https://pfaf.org/user/Plant.aspx?LatinName=Orchis+ustulat
a
Platanthera bifolia Demulcent Platanthera bifolia. Butterfly Orchid PFAF Plant
Database. Retrieved from
https://pfaf.org/user/Plant.aspx?LatinName=Platanthera+bi
folia
Spiranthes spiralis Relieve the symptoms of burns. Spiranthes autumnalis- Spiranthes spiralis root liquid.
(2009, January 5). U.S. National Library of Medicine.
Retrieved from
https://dailymed.nlm.nih.gov/dailymed/drugInfo.cfm?setid
=01ec3c41-fa6d-4f10-87d8-d1032662cfa3
CONCLUSIONS treatment of different diseases, for pain relief,
for problems concerning skin, the reproduction
The Orhidaceae family represented in Romania organs, and respiratory system.
by 58 species, have not only an ornamental Clinical trials with phytochemicals from
value, but also an etnopharmacology orchids from Romania, are lacking, so therefore
importance which was overlooked. In different medical recommendation are not to be taken
countries various Orchids species were used in into consideration, at the moment. However, it
the herbal medicine for their therapeutic is hoped, that newer explorations of these
activities. botanical species, will be ongoing to design
Extracts and metabolits of Orchids plants have pharmaceutical products, since Orchids should
have etnopharmacological properties, that be seen as a therapeutic plant, not only as an
should be included in future studies. So far, ornamental one, by the public ant the medical
these plants have been used empirically for the community.
161
REFERENCES Milanovici, S. (2014). Orchidaceae family in the “Iron
Gates” Park, Transylv. Rev. Syst. Ecol., Res. 16 -
Ardelean, C. et al. (2018). New Epipactis (Orchidaceae) special issue, 68.
species for the Romanian flora. Research Journal of Oprea, A., Sîrbu, C. (2012). The vascular flora of Rarău
Agricultural Science, 9. Masiff (Estern Carpathians, Romania). Note I,
Atanasiu, P. (2014). New chronological data for rare Memoirs of the Scientific Sections of the Romanian
vascular plants from Romania. Biodiversity: Academy, Tome XXXV, 61.
Research and Conservation, 35(1), 75‒85. Pant, B. (2013). Medicinal orchids and their uses: Tissue
Bâtea, N. D. (2014). Present state and conservation culture a potential alternative for conservation,
measures for Orchidaceae species in the National 450‒453.
Park Nera Gorges, Research Journal of Agricultural Pérez Gutiérrez, R. M. (2010). Orchids: A review of uses
Science, 46(2), 25. in traditional medicine, its phytochemistry and
Baxter, H., Harborne, J. B., Moss, G. P. (1998). pharmacology. Journal of Medicinal Plants Research
Phytochemical Dictionary: A Handbook of Bioactive 4(8), 592‒638.
Compounds from Plants, Second Edition, CRC Press, Plepys, D., Ibarra, F., Löfstedt, C. (2002). Volatiles from
68. flowers of Platanthera bifolia (Orchidaceae)
Bazarini, J. et al. (1992). The mannose-specific plant attractive to the silver Y moth, Autographa gamma
lectins from Cymbidium hybrid and Epipactis (Lepidoptera: Noctuidae), Oikos 99(1), 69‒74.
helleborine and the (N-acetylglucosamine) n-specific Pridgeon, A. M., Cribb, P. J., Chase, M. W., Rasmussen,
plant lectin from Urtica dioica are potent and F. N. (2001). Genera Orchidacearum: Volume 2.
selective inhibitors of human immunodeficiency Orchidoideae. Oxford University Press, 272.
virus and cytomegalovirus replication in vitro, Pridgeon, AM., Cribb, P.J., Chase, M.W., Rasmussen,
Antiviral Research, 18(2), June, 191-207. F.N. (2003). Genera Orchidacearum: Volume 3.
Benedek, A. M., Dragulescu, C. (2006). The cormoflora Orchidoideae. Oxford University Press, 97.
from the South-Eastern area of Retezat National Reinhold, L., Harborne, J.B., Swain, T. (1980). Progress
Park, Transylvanian Review of Systematical and in Phytochemistry, Volume 6. Pergamon Press LTD.,
Ecological Research, 3: 11‒34, 11. 230.
Biţă-Nicolae, C. D. (2011). The Natural Priority Habitats Roman, A., Cristea V. (2012). Spontaneous vegetation
in the Alpine zone of Bucegi Massif, Biomedica development on mining waste dumps from Roșia
serbica, 35(2): 79‒85, 81. Montană (Romania). Studia UBB Biologia, LVII(1), p
Bivolaru, G. (2001). Enciclopedia Naturistă a 15‒20.
Afrodiziacelor-Vol. 2, Ed. Shambala, 139‒140. Romanescu, G. et al. (2013). Limnology of the Red
Carey, P. D., Farrell, L. (2002). Biological flora of the Lake, Romania: An Interdisciplinary Study, Springer
British Isles. Journal of Ecology, 206‒218. Science+Business Media Dordrecht, 46‒47.
De Eng Soon Teoh (2016). Medicinal Orchids of Asia. Sârbu, A. et al. (2006). Chapter - Globally and European
Springer International Pubishing AG Switzerland, threatened plants present in Dobrogea (South-Eastern
page 102, 186, 458‒461. Romania), Nature Conservation: Concepts and
Flaviu-Crisan, H. et al. (2014). The presence of the rare Practice, 116‒122.
orchid Corallorhiza trifida (L.) Châtelain at the Singh, A., Duggal, S. (2009). Medicinal Orchids - An
Sugău-Cave (Harghita County, Romania), Overview, Ethnobotanical Leaflets, 2009(3), Article
Brukenthal. Acta Musei, IX.(3), 555. 3.
Gubandru-Tomescu, A. (2018). Orhideele: nestemate ale Singh, D. R., et al. (2016). Orchid Preparations-
florei spontane din România. Editura Academiei Technical Bulletin, ICAR- National Research Centre
Oamenilor de Știință din România, Bucharest, 97. for Orchids, 55.
Irimia, I. (2011). Revision Of The Orchidaceae Family Soare, L. C., Ferdes, M., Dobrescu, C. M. (2011).
From The Herbarium Of “Alexandru Ioan Cuza” Species with potential for anthocyanins extraction in
University Of Iaşi - 1'st section, Analele ştiinţifice ale Arges county flora, Studii si comunicări. Științele
Universităţii „Al. I. Cuza” Iaşi, Tomul LVII, fasc. 2, Naturii. 27(2), 21.
s. II a. Biologie vegetală , 104‒105. Szatmari, P. M. (2016). Ophrys apifera (Orchidaceae) in
Jersáková, J., Malinová, T., Jeřábková, K., Dötterl, S. Transylvanian flora, Romania, Acta Horti Botanici
(2011). Biological Flora of the British Isles: Bucurestiensis 43: 31‒40, 34‒35.
Pseudorchis albida (L.) Á. & D. Löve, Journal of Teixeira da Silva, J. A. (2013). Orchids: Advances in
Ecology, 99(5), 1282‒1298. Tissue Culture, Genetics, Phytochemistry and
Jimenez, A., Pourhashemi, A. (2014). Chemical Process Transgenic Biotechnology, Floriculture and
in Liquid and Solid Phase: Properties, Performance Ornamental Biotechnology, 7(1): 1‒52, 32‒33.
and Applications. Apple Academic Press, 382. Zhang, D. et al. (2005). Coeloglossum viride var.
Liu, D., Ju. J. H., Zou, Z. J. et al. (2005). Isolation and bracteatum extract attenuates d-galactose and NaNO2
structure determination of cypritibetquinone A and B, induced memory impairment in mice. Journal of
two new phenanthraquinones from Cypripedium Ethnopharmacology, 104, 250‒256.
tibeticum, pages 255‒257. Internet resources:
Photo-hunting: La vânătoare de orhidee sălbatice prin
Banat. S.C. Tymes Globetrotter S.R.L. Retrieved
162
from http://www.tymestours.ro/RO/X/X-orhidee- 23, 2018), from
banat-excursii/01-orhidee-banat-excursii.htm https://pfaf.org/user/Plant.aspx?LatinName=Anacam
Zana Florilor. Flori din Padure: Orhidee alba in Muntii ptis+pyramidalis
Macinului (Cephalanthera longifolia). (2017, August Soó, L. (N/A). Dactylorhiza incarnata Marsh Orchid
5). Retrieved from http://zanaflorilor.eu/flori-padure- PFAF Plant Database. Retrieved (December 23,
orhidee-alba-muntii-macinului-cephalanthera- 2018) from
longifolia/ https://pfaf.org/user/Plant.aspx?LatinName=Dactylor
Puşcarciuc, R. (2009, May 31). Munte&Flori: hiza+incarnata
Cephalanthera longifolia. Retrieved from Goodyera repens Creeping Lady's Tresses, Lesser
http://www.muntesiflori.ro/cephalanthera-longifolia- rattlesnake plantain PFAF Plant Database. Retrieved
foto/ from
Romfilatelia: Frumusețea florilor rare pe timbre: Orhidee https://pfaf.org/user/Plant.aspx?LatinName=Goodyer
sălbatice din România. Retrieved from a+repens
http://www.romfilatelia.ro/ro/frumusetea-florilor- Gymnadenia conopsea Fragrant Orchid PFAF Plant
rare-pe-timbre-orhidee-salbatice-din-romania/ Database. Retrieved from
Schlesinger, A. (2012, 27 May). Munte&Flori: https://pfaf.org/user/Plant.aspx?LatinName=Gymnad
Cypripedium calceolus. Retrieved from enia+conopsea
http://www.muntesiflori.ro/cypripedium-calceolus- The use of Orchid for medicinal purposes. Retrieved
foto/ from http://www.orchids-
Milanovici, S. (2016, November 2). The orchid flora of world.com/evergreen/med.pdf
the Muntele Mic (Caraş-Severin County, Romania), Ophrys scolopax Woodcock Orchid PFAF Plant
Journal of Biological Sciences. Retrieved December Database. Retrieved from
22, 2018 from https://pfaf.org/user/Plant.aspx?LatinName=Ophrys+
http://journal.pmf.ni.ac.rs/bionys/index.php/bionys/ar scolopax
ticle/view/185 Orchis coriophora Bug Orchis PFAF Plant Database.
Munte&Flori: Orhideele genului Dactylorhiza. Retrieved Retrieved from
from http://www.muntesiflori.ro/genul-dactylorhiza/ https://pfaf.org/user/Plant.aspx?LatinName=Orchis+c
Fotograful de orhidee din Bucegi (Galerie FOTO). oriophora
"Clubul Rotary Valea Prahovei" Association. Orchis militaris Military Orchis PFAF Plant Database.
Retrieved from https://www.rotarybvp.ro/fotograful- Retrieved from
de-orhidee-din-bucegi-galerie-foto/ https://pfaf.org/USER/Plant.aspx?LatinName=Orchis
Pușcarciuc, M. (2012, June 17). Munte&Flori: Nigritella +militaris
nigra (2013, January 11). Retrieved from Orchis morio Herb Uses, Cures, Side effects, Nutrients.
http://www.muntesiflori.ro/nigritella-nigra-foto/ Herbpathy.com. Retrieved from
Margoi, D. (2015, June 20). Montaniarzi: Sangele https://herbpathy.com/Uses-and-Benefits-of-Orchis-
voinicului, orhideea salbatica din Carpati. Retrieved Morio-Cid3278
December 22, 2018, from Orchis ustulata Dark-Winged Orchis PFAF Plant
http://www.montaniarzi.ro/sangele-voinicului- Database. Retrieved from
orhideea-salbatica-din-carpati/ https://pfaf.org/user/Plant.aspx?LatinName=Orchis+
Zana Florilor. Flori din Padure: Orhidee alba in Muntii ustulata
Macinului (Orchis purpurea sau gemanarita). (2017, Platanthera bifolia Butterfly Orchid PFAF Plant
September 5). Retrieved from Database. Retrieved from
http://zanaflorilor.eu/flori-padure-orhidee-salbatice- https://pfaf.org/user/Plant.aspx?LatinName=Platanthe
muntii-macinului-orchis-purpurea-sau-gemanarita/ ra+bifolia
Munte&Flori: Orchis ustulata. Retrieved from Spiranthes autumnalis- spiranthes spiralis root liquid.
http://www.muntesiflori.ro/orchis-ustulata-foto/ (2009, January 5). U.S. National Library of
Nagy, Z. (2014, July 29). Lesser Butterfly-orchid Medicine. Retrieved from
(Platanthera bifolia) in the forests around Turda https://dailymed.nlm.nih.gov/dailymed/drugInfo.cfm
Gorge, Romania. Retrieved (December 22, 2018), ?setid=01ec3c41-fa6d-4f10-87d8-d1032662cfa3
from https://www.naturepl.com/stock-photo-lesser- Goja, L.P. (2014). Maramureșul Istoric (Sighetu
butterfly-orchid-platanthera-bifolia-in-the-forests- Marmației) – Peștera Solovan
around-image01469679.html http://turismmaramures.ro/maramuresul-istoric-
Rich., L. (N/A). Anacamptis pyramidalis Pyramidal sighetu-marmatiei-pestera-solovan/
Orchid PFAF Plant Database. Retrieved (December
163
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
PRELIMINARY CHARACTERIZATION IN VITRO OF Bacillus licheniformis
STRAIN FOR USED AS DIETARY PROBIOTIC
Mihaela DUMITRU1, 2 *, Ionuț SORESCU1, Mihaela HĂBEANU1, Cristina TABUC1,
Ştefana JURCOANE2, 3
1
National Research Development Institute for Biology and Animal Nutrition (IBNA), Bucharest,
No. 1, Balotesti, Ilfov, 077015, Romania
2
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mărăşti Blvd.,
District 1, Bucharest, Romania
3
Academy of Romanian Scientists, 54 Spl. Independenței, District 5, Bucharest, Romania
*Corresponding author email: [email protected]
Abstract
The purpose of this paper was to provide a direction for evaluating the probiotic potential and safety of a microbial
strain in order to use in weaning piglets. Bacillus licheniformis ATCC 21424 was analyzed morphologically, culturally,
biochemically, for hemolytic activity and enzymatically (amylase and protease screening). In vitro, some probiotic
properties were study as: resistance to pH by simulated gastric juice (pH 2 and 3) and bile salts (simulated intestinal
fluid). The biochemical characteristics was performed by catalase assay, API 50 CHB Biomerieux strips, apiweb API
50 CHB V 4.0 soft (B. licheniformis, % ID 99.9) and ABIS online (~90.6% similarity). The hemolytic activity was
assayed on blood agar medium. The strain was grown in nutrient medium, in two ways: static incubation (37 C, 24 h, 4
x 108 CFU/ml) and under constant agitation (37 C, 24 h, 120 rpm, 1.56 x 1010 CFU/ml). To screen out, the most
favorable carbon source was included in the basal medium (1% w/v, pH = 7) glucose (12.11 ± 0.1), fructose (11.73 ±
0.67), lactose (12.03 ± 0.14) and starch (12.51 ± 0.27). The strain is a Gram-positive, rod-shaped bacteria, arranged in
short chains or in small irregular pairs with ability to produce spores. The endospores were central, paracentral and
subterminal. The strain growth was aerobic and was non – hemolytic. The enzymatic process was observed by
appearance of distinct zones around strain colonies. The strain presents relatively good viability at pH 3 and tolerated
oxgall (0.3%). In conclusion, the results suggested that the strain present some probiotic traits and can be further
assessed for other probiotic characters as antibacterial activity, induction of local immune response etc.
Key words: Bacillus licheniformis, biochemical characters, probiotic properties, hemolytic activity, enzymatic
screening.
INTRODUCTION Microorganisms used in animal feed in the EU
are mainly bacterial strains of Gram-positive
The administration of live microbial bacteria belonging to the genus Bacillus,
preparations as “dietary supplements” provides Enterococcus, Lactobacillus, Pedicoccus,
a strategy for animal’s breeders to raise up Streptococcus and strains of yeast belonging to
meat production, quality and animal health the Saccharomyces and Kluveromyces.
status etc. (Dumitru et al., 2018a; Habeanu et From the all types, Bacillus spp. occurred the
al., 2016; Duc et al., 2004). most attention (Cutting, 2011); spores of these
Since 2006, the European Union has banned microorganisms can resist to unfavorable
the use of antibiotics in food-producing conditions, present potential probiotic pro-
(European Union, 2006). The probiotics perties as resistant to heat, radiation, enzymatic
administration which are called direct-fed degradation during to the animal
microbials (DFM) (Chen et al., 2006), have gastrointestinal tract (GIT) and stomach’s
been demonstrated to be useful when are acidic medium (pH, acid tolerance, bile
ingested in a sufficient amount and can be an resistance etc.) (Lee et al., 2012; Dumitru et al.,
alternative with high positive effects on the 2018a). Bacillus spp. represent an importance
animals’ health, by maintaining intestinal sources for produce various extracellular
ecosystem and their performance (Kaewtapee enzymes that enhance feed digestibility,
et al., 2017; Dumitru et al., 2018a). improving growth performance, feed
164
conversion ratio and meat quality of animals months. Long-time preservation (years) was
(Pant et al., 2015). done at -800C, with addition of glycerol 20%.
According to Upadhaya et al. (2015), dietary Bacterial viability will be assessed every 2
supplementation of B. licheniformis have years (Sorescu et al., 2019).
positive effects on pigs’ growth performance.
The probiotics activity is influenced by diet Biochemical test
composition (Blank et al., 1999); a high protein The strain was tested for biochemical
content in diet can affect the piglet microbiota characters (catalase assay, API 50 CHB
in the first 14 d after weaning (Wu et al., 2015). Biomerieux strips) and identified by API 50
The present study describes in vitro some CHB V4.0 and ABIS online soft (Stoica &
probiotic properties of B. licheniformis ATCC Sorescu, 2017).
21424 strain as morphological, cultural,
biochemical characteristics, hemolytic ability, The catalase test
enzymatic production (amylase and protease The catalase test was done according to the
screening), viability at pH 2 and 3 and bile protocol described by Dumitru et al. (2018b,
resistance by simulated intestinal fluid as a 2017). The method consists in highlighting the
preliminary investigation of probiotic potential enzyme catalase from a bacterial culture by
in order to use it in piglet nutrition. using hydrogen peroxide (H2O2) in a
concentration of 3%. The catalase enzyme
MATERIALS AND METHODS facilitates the breakdown of H2O2 into oxygen
and water (2H2O2 + Catalase → 2H2O + O2);
Characterization of bacterial strain, growth the reaction was positive when a small
media and enumeration of spore counts inoculum is introduced in the H2O2 and visible
Morphological and cultural properties of B. effervescently bubbles were observed by the
licheniformis ATCC 21424 strain was rapid elaboration of oxygen.
investigated according to the methods
described in Bergey’s Manual of Systematic The API 50 CHB test
Bacteriology (1957) (Ludwig et al., 2012). The API 50 CHB strips were used for evaluated the
strain was grown in nutrient broth and agar carbohydrate acidification of B. licheniformis
medium (Merck), 90 mm in Petri dishes, to ATCC 21424 according to the manufacturer’s
evaluate the cultural traits. Serial dilution (1: protocol (BioMerieux) described by Dumitru et
10, in 0.85% sterile physiological serum - SPS) al. (2018a). The results are interpreted using
was done (105 - 1010 - fold), for counts number database system API 50 CHB V4.0 and ABIS
(CFU/ml) in broth culture, incubated static online software.
(37 C, 24 h) and under a constant agitation
(37 C, 24 h, 120 rpm). An aliquot of 1 ml from Hemolysis production
each dilution was homogenized and spread on Blood agar plates [Trypticase soy agar (TSA,
nutrient agar plate. At least three replicas were Sanimed) containing 5% (w/v) sheep blood],
done for each dilution. The strain was stored at were used to test hemolysis activity (Jeon et al.,
room temperature, 4°C and -80 C with 20% 2018, cited by Dumitru et al., 2018a).
sterile glycerol, until will be establish the Interpretation was followed after incubation at
preservation viability. Bacteria viability will be 37°C, for 24 h.
assessed every 2 years.
The strain was deposited in the Collection of Specific Growth of B. licheniformis ATCC
National Research Development Institute for 21424 in minimal medium containing
Biology and Animal Nutrition Balotești different carbon sources
(INCDBNA), Romania, under the code IBNA To investigate the effects of various carbon
80. sources, Bacillus licheniformis ATCC 21424
strain was grown in nutrient broth flash (pH 7),
Preservation of bacterial strain 24 h at 37oC in a rotary shaker at 120 rpm, with
The medium preservation (months) was done different substrate addition (1% w/v) in the
by culture in nutrient agar medium tubes. The basal medium: glucose, fructose, lactose and
strain viability was evaluated after 3 and 6 starch (Mageshwaran et al., 2014). Loop full of
165
culture of B. licheniformis ATCC 21424 was Cell pellets (biomass) were washed with PBS,
inoculated into separate flasks, with continuous collected by centrifugation (5,000 x g, 20 min,
agitation of 120 rpm, containing nutrient broth at 4oC) and resuspended in nutrient broth (pH
with different carbon sources used as substrate. 7) containing 0.3% oxgall (BD Science).
Viable cells were determined by serial dilutions Bacterial suspensions were incubated for 0, 1,
(1012-fold) of the culture in SPS on nutrient 2, 3, and 4 h at 37oC on a rotary shaker at 120
agar by plates incubating at 37oC, 24 h. The rpm. Viable cells were counted by plating 10-
number of bacteria was calculated according to fold dilutions of the culture in SPS on nutrient
the standard of ISO 7218 (2007). agar and plates incubating at 37oC, 24 h. The
number of bacteria was calculated according to
Screening of amylase producing bacteria the standard of ISO 7218 (2007).
According to the protocol instructions (Singh et
al. 2015, cited by Dumitru et al., 2018), the Data analysis
bacterial strain was screened for amylolytic The analytical data were compared using
properties by starch hydrolysis test, on starch variance analysis (ANOVA) with STATVIEW
(1% w/v) agar plate. for Windows (SAS, version 6.0). The results
were expressed as mean values and standard
Screening of protease producing bacteria error of the mean (SEM), the differences
Bacillus licheniformis ATCC 21424 was between means considered statistically
screened for proteolytic activity. The bacteria significant at P<0.05, using Fisher's PLSD test
strain was inoculated on the agar plates for untitled compact variable.
containing casein (1% w/v) and milk powder
(1% w/v), incubated at 37 C, for 48 h. RESULTS AND DISCUSSIONS
According to Josephine et al. (2012), it was
following the protocol and data interpretation. Morphological and biochemical
characterization
Acid tolerance test The taxonomic classification of strain was
The resistance of Bacillus licheniformis ATCC performed by culturally (aerobic growth),
21424 strain was investigated under simulated morphologically (Gram-positive, spore forming
gastric juice (SGJ) by following the method rods), and biochemically traits (positive
described (Lee et al., 2012) with some catalase test). On nutrient agar after 24 h at
modification: 1 ml of culture grown in nutritive 37°C, under aerobic conditions, the B.
broth for 24 h at 37°C, 120 rpm, representing licheniformis ATCC 21424 presents opaque
about 109 colony forming units (CFU/ml), was colonies, whitish with rough matte surface,
transferred to 9 ml of SGJ [0.5% NaCl, 0.3% irregular edged (type R) and diameter 0.7-0.9
pepsin (from gastric mucosa, Sigma), 0.1%v mm (Figure 1).
peptone (BD Science)], whose pH was adjusted
to 2 and 3 with a Portable meter (Waterproof,
pH 7+DHS) using HCl 1 N, then incubated for
0, 30, 60, 90 and 120 minutes at 37°C, 120
rpm. Viable cells of the culture were enu-
merated by plating 10-fold dilutions [1:10, in
NaCl 0.85%] on nutrient agar and plates
incubating at 37oC, 24 h.
Bile resistance test Figure 1. Cultural aspect on agar plate for
Bile tolerance was determined as previously Bacillus licheniformis ATCC 21424
described (Lee et al., 2012) with the following
After growth in the nutrient medium, the tested
modifications: 10 ml of culture strain (about
strain at microscopic observation appeared as
109 CFU/ml) grown in nutritive broth (pH 7)
Gram positive rods shaped, arranged in diploid
for 24 h at 37oC on a rotary shaker (120 rpm),
form, in long chains (nutrient agar) or in small
was spun down at 5,000 x g, 20 min, at 4oC.
irregular pairs (nutrient broth) (Figure 2 a, b).
166
The sporulation capacity of genus Bacillus, located central, paracentral or subterminal
determine them a high stability to survive at without distorting the vegetative cell.
low pH; the strain produced oval endospores
Figure 2. Microscopic observation of Bacillus licheniformis ATCC 21424 strain (1000x):
a. culture on agar plate; b. culture from nutrient broth
Bernardeau et al. (2017) reported that the feed The strain was catalase positive, gas bubbles
supplementation with specific Bacillus strains was observed at addition of 3% H2O2; this is a
can provide numerous benefits including characteristic that differentiates Bacillus spp.
improvement in digestibility, the gut from the anaerobic spore-forming, for example
microbiota, immune modulation and growth Clostridium spp. (Barbosa et al., 2005). The
performance. catalase production can stimulate, according to
These positive effects can be sustained by the Hosoi et al. (2011), the growth and viability of
ability of bacilli to produce spores, considering Lactobacillus spp. from GIT.
a direction in a long storage of processing feed, Results obtained from the API 50 CHB tests
involving resistant to survive at environmental indicated that used test was able to confirm B.
conditions. More Bacillus strains can remain licheniformis ATCC 21424 around 99.9% ID
viable for hundreds of years (Liao & Nyachoti, (very good percentage identification) and ABIS
2017). online (~90.6% similarity, Figure 3).
The strain sporulation is necessary to regain The fermentation capacity of carbohydrate was
after entering in the host, the metabolism is observed by the discoloration of the basal
reactivated and benefits positive effects will be medium, from red to yellow, as positive answer
observed (Cutting, 2011). (Figure 4).
Figure 3. Strain identification by ABIS online Figure 4. API 50 CHB strips inoculated with Bacillus
(www.tgw1916.net) licheniformis ATCC 21424, before and after
incubation (24 h, 37°C)
The results by API 50 CHB were registered as salicin, D-cellobiose, D-arabinose, D-maltose,
final interpretation after 48 h, at 37°C (Table L-arabinose, D-lactose, D-ribose, D-melibiose,
1). From the analysis of Table 1, is observed D-xylose, D-saccharose (sucrose), D-trehalose,
that, the strain fermented esculin, glycerol, D-raffinose, starch, D-glucose, D-fructose,
167
glycogen, D-mannose, D-turanose, inositol, D- blood. The assay is based on the ability of
tagatose, D-mannitol, D-sorbitol, methyl-αD- strain to lyse blood cells of culture medium.
glucopyranoside, amygdalin and arbutin. The The safety of B. licheniformis ATCC 21424 to
strain did not ferment of erythritol, D- be used as a possible probiotic in piglets’ feed
arabinose, L-arabinose, D-lactose, D-melibiose, was confirmed by non-hemolytic activity on
L-xylose, D-adonitol, inulin, methyl-βD- 5% sheep blood agar plate (γ-hemolysis, Figure
xylopyranoside, D-galactose, D-melezitose, 5). A clear zone around colonies on TSA
xylitol, L-sorbose, gentibiose, dulcitol, D- medium indicate a complete hydrolysis (β-
lyxose, D-fucose, L-fucose, methyl-αD- hemolysis), the strain must to be eliminated for
mannopyranoside, D-arabitol, L-arabitol, utilization as a probiotic in animal nutrition.
potassium gluconate, potassium 2- According to Prieto et al. (2012) and Seker
ketogluconate, potassium 5 ketogluconate and (2010), non-hemolysis (γ-hemolysis) and α-
N-acetylglucosamine. hemolysis (a green zone around colony) are
considered to be safety.
Table 1. The results obtained with API 50 CHB for
Bacillus licheniformis ATCC 21424
Interpretation
Biochemical tests
24h 48h 24h 48h
Control - - Esculin + +
Glycerol + + Salicin + +
Erythritol - - D-cellobiose + +
D-arabinose - - D-maltose + +
L-arabinose + + D-lactose - +
D-ribose + + D-melibiose - +
D-xylose ? + D-saccharose + +
(sucrose)
L-xylose - - D-trehalose + + Figure 5. Hemolysis assay of Bacillus licheniformis
D-adonitol - - Inulin - - ATCC 21424, at 37°C, 24 h
Methyl-βD- - - D-melezitose - -
xylopyranoside
D-galactose - - D-raffinose - + Growth of the bacterial strain
D-glucose + + Starch + +
D-fructose + + Glycogen + + The growth of B. licheniformis was
D-mannose + + Xylitol - - investigated after 24 h incubation at 37°C
L-sorbose - - Gentibiose ? - under static conditions and under a constant
L-rhamnose - + D-turanose - ?/+
Dulcitol - - D-lyxose - - agitation, by incubating culture flasks at 150
Inositol + + D-tagatose + + rpm. After static incubation number cells of B.
D-mannitol + + D-fucose - -
D-sorbitol + + L-fucose - - licheniformis were approximatively 4 x 108
Methyl-αD- - - D-arabitol - - (CFU/ml), while it in case of agitation were
mannopyranoside
Methyl-αD- + + L-arabitol - - amounted 1.56 x 1010 (CFU/ml).
glucopyranoside The experimental results, in Figure 6, showed
N- - - Potassium - -
acetylglucosamine gluconate that agitation is a better parameter for growing
Amygdalin + + Potassium 2- - - bacteria, compared with the static incubation.
ketogluconate
Arbutin + + Potassium 5- - - The result was expressed as logarithm of
ketogluconate colony forming units/ml (log10 CFU/ml).
- = negative; + = positive; ? = doubtful, weakly positive.
The API 50 CHB test gives information about Log10 CFU/ml
the strain capacity to act on the substrate and to 15
fermented it; also, this analyze represents an
10
alternative to understand the strain’s enzymatic
equipment and can be observed by 5 8,6 10,19
discoloration of the basal medium. 0
24 h, 37°C, static 24 h, 37°C, 150 rpm
incubation
Hemolysis production
The hemolytic evaluation was determined on Figure 6. The viability of B. licheniformis ATCC 21424
TSA agar plates supplemented with 5% sheep at different conditions
168
Specific Growth of strain in minimal diet, with benefits in feed cost reduction,
medium containing different carbon sources without compromising young pig performance
To screen out, the most favorable carbon after weaning (Barletta, 2011).
source was included in the basal medium:
glucose, fructose, lactose and starch (1%). The Screening of amylase enzyme
bacterial growth on different substrates was The amylase method, as qualitative assay, was
registered in Table 2. based on the reduction in blue color intensity
resulting from enzyme hydrolysis of different
Table 2. Log10 CFU/ml of B. licheniformis ATCC 21424 quantity of starch addition in the basal medium
on minimal medium containing different carbon sources (1%, 2% and 3%, w/v). Production of this
Carbon sources Log10 CFU/ml
enzyme was studied after 24 h of incubation at
Control 12.11±0.16b 37°C and pH 7. After addition of Lugol solu-
Starch 12.08±0.14a tion, a clear zone of hydrolysis on starch was
Fructose 11.73±0.67ab observed on agar plates (Figure 8). On the plate
Glucose 12.11±0.1 with 1% starch addition was registered the
Lactose 12.03±0.022 maximum zone of hydrolysis and this concen-
Results represent the mean ± standard deviation of three experiments
(n=3).
tration will be selected for other investigations.
a, b
Values which differ significantly at P <0.05.
1% 2% 3%
The maximum growth rate of B. licheniformis
was registered in agar medium containing
glucose, following by starch, lactose and
fructose (Figure 7). The medium with starch
addition was selected to put in evidence the
enzymatic capacity of strain. Figure 8. Screening of hydrolysis amylase of Bacillus
licheniformis ATCC 21424:
1%, 2%, 3%: the quantity of starch addition in the basal
medium
The capacity of selected Bacillus strains to
produce and secrete large quantities of extra-
1 2 cellular enzymes has placed them the most
important industrial enzyme producers
(Manabe et al., 2013). Dumitru et al. (2018a),
reported similar data about the screening for
amylase producing by a strain from Bacillus
spp.
3 4 The addition of microbial enzymes as DFM,
Figure 7. Growth of B. licheniformis ATCC 21424 in can aiding the digestion process of young
nutrient agar medium containing different carbon sources animals (piglets, broilers etc.), whose enzy-
(1: glucose, 2: starch, 3: lactose, 4: fructose) matic system is incomplete development.
Improving feed efficiency, nutrients supple-
Amylases break down starch; by increasing mentation, palatability, health in the stressful
starch digestibility, amylases potentially permit piglet period by decrease the numbers of
pigs to extract more energy from the feed, pathogenic bacteria from GIT and increase the
which can be efficiently converted into meat benefic bacteria colonization, DFM with
production. In young pig diets, amylases enzymatic action represent a systematic role in
provide benefits by supplementing an immature young animal life (Van der Aar et al., 2016).
digestive system where low feed intake post-
weaning is associated with a slow maturation of Screening of protease enzyme
amylase secretion. In addition, amylase also Bacillus licheniformis ATCC 21424 strain was
tolerates the use of less cooked grain in the screened for extracellular protease production,
169
on agar plates containing casein (1% w/v, left Preservation of bacterial strain
photo) and milk powder (1% w/v, right photo). In Table 3 are presented the results of strain
The strain hydrolysis capacity can be observed viability test which was preserved at 4°C and at
by appearance of a clear zone around bacteria room temperature.
growth, at addition of TCA 25% (Figure 9).
Table 3. Testing the viability of Bacillus licheniformis
ATCC 21424 strain preserved at 4°C and room
temperature
Strain Viability at 4°C Viability at
room temperature
Bacillus +/3 months; +/3 months;
licheniformis +/6 months +/6 months
ATCC 21424
+ = positive, - = negative.
The strain viability will be tested at 9 months,
Figure 9. Screening of hydrolysis protease of Bacillus
licheniformis ATCC 21424 until will be establish the long-time
preservation.
Strains from the genus Bacillus produce a huge
variety of extracellular enzymes, proteases Resistance to pH
Bacillus licheniformis ATCC 21424 strain,
occurring an important role in animal nutrition.
conserved on nutrient agar tubes at 4°C and
Feed supplementation with specific enzymes
room temperature (6 months), was tested for
improves the nutritional value of raw resistance to simulated gastric juice (pH 2 and
compound’s feed, increasing the efficiency of 3), under a constant agitation (37°C, 24 h, 120
digestion. Using bacterial strains as sources of rpm, Table 4).
extracellular proteases, provide a serial of The strain preserved in different conditions,
benefits by break down the proteins from presents a best survival rate, during 120 min
various raw materials, releasing bound energy incubation at pH 2 and 3. In Table 4, can be
that can be digested by the animal body observed the strain resistance when was
(Barletta, 2011). exposed to simulated gastric juice.
According to Merchant et al. (2011) the The strain preserved at 4°C, pH 2, present
Bacillus spp. can be used as DFM in animal significative different between all times of
nutrition because the pH value in the small incubation according to Lee et al. (2012)
method. The pH 2 reduced slowly the cell
intestine is 6 to 7, which is optimal for spores
numbers at 4°C and room temperature
to germinate, grow and produce enzymes and,
preservation, compared with pH 3 at 4°C,
also, to resist of the enzymatic degradation and where the survivability did not differ
low pH of the gastric barrier (Barbosa et al., significantly between the all incubation times.
2005).
Table 4. The effect of synthetic gastric juice (pH 2 and pH 3) on the Bacillus licheniformis ATCC 21424 viability
during 120 min under constant agitation exposure
Strain pH of synthetic 0 min 30 min 60 min 90 min 120 min SEM P value
gastric juice
pH 2/4°C 10.803a 8.393ab 10.15bc 8.593ac 8.393ac 0.283 ˂0.0001
Bl pH 3/4°C 10.353 10.16 10.067 10.1 10.047 0.060 ˂0.5548
ATCC pH 2/room 10.487a 10.16ab 10.083ac 9.177abcd 8.697abcd 0.182 ˂0.0001
21424 temperature
pH 3/room 11.533a 9.913ab 9.6ac 8.687abc 8.45abc 0.301 ˂0.0001
temperature
Viable counts (log10 CFU/ml) of strain at 30, 60, 90 and 120 min was compared with counts at 0 min.
Results represent the mean of three experiments (n = 3). a, b, c, dMeans in the same row differ significantly at P <0.05.
170
In addition, Lee et al. (2012), reported low where the strain is capable to survival at low
values of analyzed strains from Bacillus spp. pH (2 and 3).
during 30 min incubation at pH 2. The Bacillus
licheniformis strain can be a possible probiotic Bile resistance test
candidate in piglet nutrition, because it The strain was resistant to oxgall bile salt
maintained high viability during 120 min (Table 5). During incubation at 4 h in medium
incubation, at 2 and 3 pH. with 0.3% bill salt, the strain presents a high
According to Nhi and Huong (2016), the level of bile tolerance with a slow loss of
numbers of Bacillus spp. strains have reduced viability.
prominently, comparative with our result,
Table 5. Effect of oxgall bile salt on the viability of Bacillus licheniformis ATCC 21424 strain during 4 hours exposure
Preserved conditions Viable count (log10 CFU/ml) of Bacillus licheniformis ATCC 21424
0h 1h 2h 3h 4h SEM P values
4°C 9.187a 9.06b 9.043c 9.437d 8.44abcd 0.112 0.0332
Room temperature 10.153a 10.347b 9.527abc 8.91abcd 8.28abcd 0.213 0.0001
a, b, c,
Viable counts (log10 CFU/ml) of strain at 1, 2, 3 and 4 h was compared with counts at 0 h. Results represent the mean of three experiments (n=3).
d
Means in the same row differ significantly at P <0.05.
The Bacillus licheniformis ATCC 21424 pre- & D, Contract no. 17 PFE and Project
servation at 4°C differ significantly compared 8PCCDI/2018 pc2.
with room temperature preservation, suggesting We thank to the technician Dana Bulgaru for
that the spores are able to germinate without to her excellent technical assistance.
be inhibited by the presence of bile salt in the
small intestine (Guo et al., 2006). REFERENCES
CONCLUSIONS Barbosa, T. M., Serra, C. R., La Regione, R. M.,
Woodward, M. J., Henriques, A. O. (2005).
Screening for Bacillus isolates in the broiler
The results suggested that the Bacillus gastrointestinal tract. Applied and Environmental
licheniformis ATCC 21424 strain presents Microbiology, 71(2), 968‒978.
some probiotic properties. This strain has the Barletta, A. (2011). Introduction: Current market and
capacity to secret amylase and protease expected developments. Chapter I from Enzymes in
farm animal nutrition, 2nd Edition, 3.
enzymes, resists 6 months at 4°C and room Blank, R., Mosenthin, R., Sauer, W. C., Huang, S.
temperature, does not show hemolytic activity (1999). Effect of fumaric acid and dietary buffering
(γ- hemolysis) on TSA medium confirming that capacity on ileal and fecal amino acid digestibilities
is not pathogenic. in early-weaned pigs. Journal of Animal Science.
The strain spores were able to tolerate bile salt https://doi.org/10.2527/1999.77112974x.
Chen, Y. J., Min, B. J., Cho, J. H., Kwon, O. S., Son, K.
and survives at low pH in the conditions of S., Kim, H. J., Kim, I. H. (2006). Effects of dietary
stimulate gastric juice after 120 minutes. Bacillus-based probiotic on growth performance,
This in vitro study can represent an alternative nutrients digestibility, blood characteristics and fecal
to improve animal health by increasing noxious gas content in finishing pigs. Asian Australis
nutrition digestibility. Further experiments on J. of Anim. Sci., 19, 587‒592.
Cutting, S. M. (2011). Bacillus probiotics. Food
animals are necessary to confirm the probiotic Microbiol., 28(2), 214‒220.
potential and to validate the importance of Duc, L. H., Hong, H. A., Barbosa, T. M., Henriques, A.
bacterial strain as source of feed additive. O, Cutting, S. M. (2004). Characterization of Bacillus
probiotics available for human use. Appl. Environ.
ACKNOWLEDGEMENTS Microbiol., 70, 2161‒2171.
Dumitru, M., Sorescu, I., Habeanu, M., Tabuc, C.,
This study was funded by Romanian Ministry Idriceanu, L., Jurcoane, S. (2018a). Preliminary
characterisation of Bacillus subtilis strain use as a
of Research and Innovation through Program 1 dietary probiotic bio-additive in weaning piglet. Food
– Development National Research- and Feed Research, 45(2), 203‒211.
Development, Sub-program 1.2 – Institutional Dumitru, M., Tabuc, C., Jurcoane, S. (2018b). Obtaining
Performance - Projects funding excellence in R a feed additive based of Lactobacillus plantarum
171
strain. Scientific Papers. Series A. Agronomy, 61(2), Manabe, K., Kageyama, Y., Morimoto, T., Shimizu, E.,
115‒122. Takahashi, H., Kanaya, S., Ara, K., Ozaki, K., and
European Union (2005). Ban on antibiotics as growth Ogasawara, N. (2013). Improved production of
promoters in animal feed enters into effect secreted heterologous enzyme in Bacillus subtilis
(1831/2003/EC). strain mgb874 via modification of glutamate
Guo, X., Li, D., Lu, W., Piao, X., Hen, X. (2006). metabolism and growth conditions. Microbial Cell
Screening of Bacillus strains as potential probiotics Factories, 12, 18. http://dx.doi.org/10.1186/1475-
and subsequent confirmation of the in vivo 2859-12-18.
effectiveness of Bacillus subtilis MA 139 in pigs. Merchant, H. A., McConnell, E. L., Liu, F.,
Antonie van Leeuwenhoek, 90, 139‒146. Ramaswamy, C., Kulkarni, R. P., Basit, A. W.,
Hăbeanu, M., Tabuc, C., Gheorghe, A., Ropota, M., Murdan, S. (2011). Assessment of gastrointestinal
Dumitru, M., Călin, L., Mihalcea, T., Palade, M. pH, fluid and lymphoid tissue in the Guinea pig,
(2016). Preliminary study on the interrelation rabbit and pig and implications for their use in drug
between sow milk quality and litter performance in development. European Journal of Pharmaceutical
relation to their health. Scientific Papers-Animal Science, 42, 3‒10.
Science Series, 66, 35‒40. Nhi, H. T. H., Huong, T. (2016). Examining some
Hosoi, T., Ametani, A., Kiuchi, K., Kaminogawa, S. probiotics activities of Bacillus subtilis Natto.
(2011). Improved growth and viability of lactobacilli International Journal of Modern Eng. Research, 6(5),
in the presence of Bacillus subtilis (natto), catalase or 33‒37.
subtilisin. Canadian Journal of Microbiology, 46, Pant, G., Prakash, A., Pavani, J. V. P., Bera, S., Deviram,
892‒897. G. V. N. S., Kumar, A., Panchpuri, M., Prasun, R.
International Organization for Standardization: ISO 7218 (2015). Production, optimization and partial
(2007). Food Microbiology-General Requirements purification of protease from Bacillus subtilis. J. of
and Recommendations, 66. Taibah University for Science, 9, 50‒55.
Jha, R., Berrocoso, J. F. D. (2015). Dietary fiber and Prieto, M. L., O’Sullivan, L., Tan, S. P., McLoughlin, P.,
protein fermentation in the intestine of swine and Hughes, H., Gutierrez, M., Jonathan, A., Lane, J.,
their interactive effects on gut health and on the Hickey, R. M. G., Lawlor, P. G., Gardiner, G. E.
environment: A review. Animal Feed Science and (2014). In vitro assessment of marine Bacillus for use
Technology, 212, 18‒26. as livestock probiotics. Mar. Drugs, 12, 2422‒2445.
Jeon, H. L., Yang, S. J., Son, S. H., Kim, W. S., Lee, N. Seker E. (2010). Identification of Candida species
K., Paik, H. D. (2018). Evaluation of probiotic isolated from bovine mastitis milk and their in vitro
Bacillus subtilis P229 isolated from cheonggukjang hemolytic activity in Western Turkey.
and its application in soybean fermentation. Food Mycopathologia, 169, 303‒308.
Science and Technology, 97, 94‒99. Stoica, C., Sorescu, I. (2017). ABIS online - Advanced
Kaewtapee, C., Burbach, K., Tomforde, G., Hartinger, Bacterial Identification Software, an original tool for
T., Silva, A. C., Heinritz, S., Seifert, J., Wiltafsky, phenotypic bacterial identification. Regnum
M., Mosenthin, R. F., Rosenfelder-Kuon, P. (2017). Prokaryotae, www.tgw1916.net.
Effect of Bacillus subtilis and Bacillus licheniformis Sorescu, I., Dumitru, M., Ciurescu, G. (2019).
supplementation in diets with low- and high-protein Lactobacillus spp. and Enterococcus faecium strains
content on ileal crude protein and amino acid isolation, identification, preservation and quantitative
digestibility and intestinal microbiota composition of determinations from turkey gut content. Romanian
growing pigs. Journal of Animal Science and Biotechnological Letters, 24(1), 41‒49.
Biotechnology, 8(37), 1‒15. Upadhaya, S. D., Kim, S. C., Valientes, R. A., Kim, I. H.
Lee, J., Park, I., Choi, Y., Cho, J. (2012). Bacillus strain (2015). The effect of Bacillus-based feed additive on
as feed additive: in vitro evaluation of its potential growth performance, nutrient digestibility, fecal gas
probiotic properties. Rev. Colombiana de Ciencias emission, and pen cleanup characteristics of growing-
Pecuarias, 25, 577‒585. finishing pigs. Asian Australas J. Anim. Sci., 28,
Lyao, S. F., Nyachoti, M. (2017). Using probiotics to 999‒1005.
improve swine gut health and nutrient utilization. Van der Aar Molist, F., Van der Klis, J. D. (2016). The
Animal Nutrition, 3, 331‒343. central role of intestinal health on the effect of feed
Liao, S. F., Nyachoti, M. (2017). Using probiotics to additives on feed intake in swine and poultry. Animal
improve swine gut health and nutrient utilization. Feed Science and Technology, 233, 64‒75.
Animal Nutrition, 3(4), 331‒343, Wu, Y. P., Jiang, Z. Y., Zheng, C. T., Wang, L., Zhu, C.,
https://doi.org/10.1016/j.aninu.2017.06.007. Yang, X. F.,Wen, X., Ma, X. (2015). Effects of
Ludwig, W., Euzéby, J., Whitman, W. B. (2012). protein sources and levels in antibiotic-free diets on
Taxonomic outline of the phylum Actinobacteria. In diarrhea, intestinal morphology and expression of
Bergey’s Manual of Systematic Bacteriology. tight junctions in weaned piglets. Anim. Nutrition,
https://doi.org/10.1007/978-0-387-68233-4_2. 1(3), 170‒17.
172
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
RESEARCHES CONCERNING THE USE OF CAMELINA OIL
IN THE COMPOSITION OF COSMETIC PRODUCTS: REVIEW
Simona COPACI1 *, Ştefana JURCOANE1, 2, 3
1
University of Agronomic Sciences and Veterinary Medicine of Bucharest,
Faculty of Biotechnologies, 59 Mărăşti Blvd., District 1, Bucharest, Romania
2
Microbial Biotechnological Center - BIOTEHGEN, 59 Mărăşti Blvd., District 1, Bucharest,
Romania,
3
Academy of Romanian Scientists, 54 Splaiul Independenţei, District 5, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
Camelina (Camelina sativa) is a flower plant belonging to the family Brassicaceae, originating in Eastern Europe.
Vegetable oil is not only for food use, it can also be used in many fields, such as the cosmetics industry. The oil
obtained from Camelina seeds has a varied content of fatty acids with an intake of 50-60% unsaturated fatty acids, 35-
40% omega 3 content and 15-20% omega 6. It has a high content of omega 3, being one of the richest vegetable
sources compared to this fatty acid.
In this review, we discuss how some of the latest scientific advances such as the high content of tocopherol (E vitamin),
the ability to extract lecithin from Camelina oil and the likelihood of being a replacement for the castor oil. Other
approaches demonstrate the stability of Camelina oil both in the presence of synthetic and natural antioxidants.
Finally, we discuss the potential of Camelina oil to be used in the cosmetics industry.
Key words: Camelina oil, fatty acids, tocopherol, lecithin, stability, antioxidants.
INTRODUCTION potential has not yet been decimated. It is part
of the Brassicaceae family being a plant that
Ever since ancient times, emollients based on does not require a special and complicated
animal fats and vegetable oils have been used. cultivation technology (Waraich, 2013).
Technology has advanced today no longer uses With seed oil content (36-47%) twice that of
vegetable fat or oil as such, but incorporates soybean (18-22%) and a fatty acid profile (with
into more complex preparations for a much >90% unsaturated fatty acids) suitable for
better effect, called cosmetics. Many vegetable making jet fuel, biodiesel and high-value
oils such as coconut oil, avocado oil, castor oil, industrial lubricants, Camelina sativa has
argan oil, wheat germ oil, saffron oil, and hemp tremendous potential to serve as a viable and
oil are used in the cosmetic industry (Berdick, renewable feedstock for multiple industries.
1972). In today's cosmetics science, the role of One of the most important used who has beed
natural ingredients is very important because study was for sustainable bio-kerosene
on the one hand their structure is compatible production.
with human physiology, having no toxic role The technology of Camelina oil was
and very low allergenic capacity, and on the optimizated and can be valued all parts of the
other hand, the interest is more and more for plant: roots, leaves, straw, silicules and the
the protective properties and beneficial proteic part of the seed (included in camelina
reactivation for the skin (Rigano et al., 2006). meal). Additionally, due to exceptionally high
Camelina oil is the main compound obtained levels of α-linolenic acid (32-40% of total oil
from Camelina seeds, and its yield is between content), Camelina sativa oil offers an
30-40% DM (Budin et al., 1995; Rode, 2002; additional source of essential fatty acids.
Zubr, 2003). Camelina oil has been used since The residual essential fatty acids combined
ancient times for medical purposes as well as with low glucosinolate levels in C. sativa meal
for lightening gas, but in the cosmetics make it desirable as an animal feed (Kagale et
industry, although its use is attempted, its true al., 2014).
173
GENETIC STRUCTURE OF Camelina sativa phytosterol content of the cold pressed oil was
significantly lower than that of SC-CO2 and
Camelina sativa represents the first crop Soxhlet (hexane) (P < 0.05). Conclusion of the
species to be sequenced from lineage I of the study was that the oil yield of SC-CO2
Brassicaceae. The well-preserved hexaploid extraction was higher than that of cold press
genome structure of C. sativa surprisingly (Belayneh et al., 2015).
mirrors those of economically important
amphidiploid Brassica crop species from CHARACTERIZATION OF CAMELINA
lineage II as well as wheat and cotton (Kagale OIL
et al., 2014). study was undertaken to
characterize two genes in the fatty acid Herbal vegetable oils are not only a non-
biosynthesis pathway, fatty acid desaturase polluting renewable source but also provide a
(FAD) 2 and fatty acid elongase (FAE) 1, wide range of fatty acids with various
which revealed unexpected complexity in the applications (Kumar et al., 2016). The chemical
C. sativa genome. Genetically, Camelina sativa composition of Camelina oil is suitable for
is closly to the model of Arabidopsis thaliana, many branches of the industry, the one covered
and the regions downstream of CsFAD2 and by this review is the cosmetics industry. The
upstream of CsFAE1 demonstrate co-linearity main characteristic of Camelina oil is its
with this (Hutcheon et al., 2010). composition in linolenic fatty acid, 20-40% -
essential and very rare omega 3 (Aldivia,
EXTRACTION OF CAMELINA OIL 2007). The oil obtained from Camelina seeds
has a varied content in fatty acids with an
In a study made of Moslavac et al. (2014) they intake of 50-60% unsaturated fatty acids, 35-
evaluated the oil extraction process from 40% omega 3 content and 15-20% omega 6.
Camelina sativa (L.) Crantz seeds by screw Recently in a study, new proportions of
pressing followed by extraction with component oils have been identified, namely
supercritical CO2. In pressing experiments, the 22,31-26,57% linolenic acid, 21,25-24,05%
response surface methodology (RSM) was linoleic acid and 19,46-21,47% oleic acid
conducted in order to study the effects of (Ergönül, 2018). The process of extracting it is
temperature, frequency and nozzle size on oil always improved to keep it as high as possible.
recovery and quality parameters. The cake The optimum condition for obtaining the best
resulting from pressing at optimal conditions recovery oil and the best oil quality were
was extracted with CO2 in a new designed and recorded at 52°C, 20 Hz and 9 mm ID
built a homemade supercritical fluid extraction (Moslavac et al., 2014).
system. The residual oil in the pressed cake
was almost totally extracted by supercritical BIOCOMPOUNDS FROM CAMELINA
CO2 (Moslavac et al., 2014). Another OIL
procceding of extraction like SC-CO2
extraction of Camelina seed oil was reported The antioxidant activities of Camelina sativa
and compared with traditional extraction methanolic extracts were evaluated by various
methods. The conditions used for this study chemical tests: reduction power, 2,2-diphenyl-
was: pressure (35-45 MPa), temperature (50- 1-picrylhydrazyl (DPPH) test, beta-carotene
70°C), and time (90-250 min). Oil yield whitening method and metal chelating activity
increased with pressure and time, but not analysis (Terpinc, 2012). This study revealed
temperature. Oil yield was further increased to that after pressing the oil, most of the phenolic
31.6% at the RSM-optimized conditions by compounds remain in seed residues, only a few
increasing the SC-CO2 extraction time to 510 compounds have been identified in the oil
min. Soxhlet (hexane) and cold press methods (Terpin, 2012). An interesting biocomponent
yielded 35.9% and 29.9% oil, respectively. found in camelina oil is lecithin. It is not found
Extraction method did not have a significant as such in camelina or oil seeds but is obtained
effect on the fatty acid composition and by processes called enzymatic degumming and
tocopherol content (P > 0.05); however, water degumming (Balayneh et al., 2018).
174
Lecithin obtained by enzymatic degumming to rape or sunflower oils. We have tried to
contains a higher amount of lisophospholipids, stabilize Camelina oil with 21 antioxidants,
generating a more stable emulsion. Camelina both natural and synthetic, based on the Oil
oil analyzed from this point of view promises Stability Index (OSI). The stability index of
to be a good alternative of emulsifier (Balazneh Camelina oil was higher than that of rapeseed
et al., 2018). oil with TBHQ and its formulation with citric
A comparison was been made regarding the acid and above the sunflower oil with EGC,
total phenols content between safflower oil and EGCG, carnosic acid, propyl gallate, extract of
camelina oil. The total phenol content of rosemary with ascorbyl palmitate or gallic acid.
safflower oils was higher (272.20-525.30 mg Accordingly, stabilized Camelina oils with
GAE/kg) than Camelina seed oils (25.90-63.70 TBHQ/citric acid and rosemary/ascorbyl pal-
mg GAE/kg). Apigenin, luteolin, tyrosol, mitate extract were more stable than rapeseed
siringic acid, 3-hydroxytirozole, p-coumaric and sunflower oils, respectively in terms of OSI
acid and synaptic acid have been detected in induction times and p-anisidine rates (Frohlich
seed oils. Camelina seed oil was rich in et al., 2011).
tocopherol (144.11-168.69 mg/100 g). γ- A natural antioxidant that protects Camelina oil
Tocopherol was the predominant tocopherol in very well against oxidation is Rosmarin extract,
Camelina seed oils, consisting of 80% total as studies have shown (Moslavac et al., 2014).
tocopherol (Ergönül, 2018).
Another study was made to investigate the THE BEHAVIOR OF CAMELINA OIL
effects of protein extraction methods on the COMPARED TO OTHER VEGETABLE
adhesion performance of different camelina OILS
protein fractions. Two Camelina protein
fractions, globulin and glutelins, were isolated The behavior of Camelina oil has been
from defatted Camelina meal using three analyzed compared to other vegetable oils,
different methods resulting in total of six such as linseed oil, rapeseed oil, and sunflower
protein fractions including globulin 0-2 and oil. Several parameters have been analyzed,
glutelin 0-2. Dry adhesion strength of camelina depending on the study. In order to make this
protein adhesives exhibited nearly 100% wood comparison with linseed oil, a series of
cohesive failure at the curing temperatures of compounds, namely the fatty acid composition,
150-190°C, except glutelin 2 and globulin 0. the peroxide value, the acid value, the anisidine
Glutelin had higher protein aggregation than value, the chlorophyll pigments, the carotenoid
globulin, as indicated by higher crystallinity, pigments were analyzed. It was highlighted that
higher thermal stability, and dense protein they adhere to the Codex Alimentarius (2009)
aggregation (Ningbo Li et al., 2015). parameters for cold-pressed oils, even though
there were differences between the two oils.
CAMELINA OIL STABILITY Significant differences between the two were
recorded for chlorophyll content and
The stability of vegetable oils depends very chlorophyll pigments. Regarding oxidative
much on chemical and physical factors. An stability, Camelina oil proved to be more stable
important impact for maintaining stability is the than the flax (Raczyk et al., 2015).
method and storage conditions. The storage The cosmetic particle composition can
changes in tocopherol content, phenolic content essentially comprise Camelina sativa seed oil
as well as the presence of primary and which is 100% completely hydrogenated, being
secondary oxidative compounds wew studied in the form of strong cosmetic particles and
(Abramovic, 2007). By the oil storage at 50°C transformed into soft cosmetic particles after
and 60°C, respectively, the total content of introduction into a topical formulation. The
phenolic compounds was reduced to 72% of its transformed cosmetic particles can be adapted
original value and 21% of its initial value to have a soothing effect on the skin, hair
(Abramovic, 2007). Camelina oil has been and/or nails of a mammalian subject or other
found to have a much lower oil stability index target. A study that had the purpose of building
and higher p-anisidine storage rates compared a patent, has fully utilized fully hydrolysed
175
Camelina oil. Camelina seed oil has at least Antioxidants. Journal of the American Oil Chemists'
17% of its total fatty acid weight greater than Society, 89(5), 837‒847.
Hoekmana, S. K., Brocha, A., Robbins, C., Ceniceros,
18 carbon atoms. Oil obtained from Camelina E., Natarajan, M. (2012). Review of biodiesel
seeds is relatively inexpensive compared to composition, properties, and specifications.
many other seed oils, so the cosmetic particles Renewable and Sustainable Energy Reviews, 16,
formed with them are relatively cheap natural 143‒169.
products (Kleiman et al., 2013). Hutcheon, C., Ditt, R. F., Beilstein, M., Comai, L.,
Schroeder, J., Goldstein, E., Shewmaker, C. K.,
Nguyen, T., Rocher, J., Kiser, J. (2010). Polyploid
CONCLUSIONS genome of Camelina sativa revealed by isolation of
fatty acid synthesis genes. BMC Plant Biology, 10,
The researches emphasized the high content of 233.
tocopherol (E vitamin), the ability to extract Imbrea, F., Jurcoane, S., Hălmăjan, H. V., Duda, M.,
Botoş, L. (2011). Camelina sativa: A new source of
lecithin from Camelina oil and the posibility of vegetal oils. Romanian Biotechnological Letters,
being a replacement for castor oil, the stability 16(3).
of Camelina oil both in the presence of Janko, R. (2002). Study of Autochthon Camelina sativa
synthetic and natural antioxidants. In conclu- (L.) Crantz in Slovenia. Journal of Herbs, Spices and
sion, Camelina oil has a potential to be used in Medicinal plants, 9, 4, 313‒318.
Kagale, S., Koh, C., Nixon, J., Bollina, V., Clarke, W.
the cosmetics industry. E., Tuteja, R., Spillane, C., Robinson, S. J., Links, M.
G., Clarke, C., Higgins, E. E., Huebert, T., Sharpe, A.
REFERENCES G., Parkin, I. A. P. (2014). The emerging biofuel crop
Camelina sativa retains a highly undifferentiated
Abramovič, H., Abram, V. (2006). Effect of added hexaploid genome structure. Nature
rosemary extract on oxidative stability of Camelina Communications, 5, article number: 3706.
sativa oil. Acta agriculturae Slovenica, 87 - 2, str. Kleiman, R., Brown, J. H., Dwyer, K., James, S., Brown,
255-261. G. (2009). Cosmetic particles that transform from
Abramovič, H., Butinar, B., Nikolič, V. (2007). Changes hard to soft particles comprising hydrogenated long-
occurring in phenolic content, tocopherol chan triglyceride oils. United States patent, us 8, 613,
composition and oxidative stability of Camelina 956 b2.
sativa oil during storage. Food Chemistry, 104(3), Kumar, A., Sharma, A., Upadhyaya, K. C. (2016).
pages 903‒909. Vegetable Oil: Nutritional and Industrial Perspective.
Belayneh, D. H., Wehling, R. L., Cahoon, E., Ciftcia, O. Curr Genomics, 17(3), 230‒240.
N. (2015). Extraction of omega-3-rich oil from Kurkin, V. A., Pavlenko, K. S. (2014). Flavonoids from
Camelina sativa seed using supercritical carbon Camelina sylvestris Seeds. Chemistry of Natural
dioxide. Journal of Supercritical Fluids, 104, Compounds, 50(3), 539‒540.
153‒159. Laatikainen, M., Srithammavut, W., Toukoniitty, B.,
Belayneh, D. H., Wehling, R. L., Cahoon, E., Ciftci, O. Turunen, I., Sainio, T. (2015). Phospholipid
N. (2018). Lipid composition and emulsifying adsorption from vegetable oils on acid-activated
properties of Camelina sativa seed lecithin. Food sepiolite. Adsorption, 21(5), 409‒417.
Chemistry, 242, 139‒146. Lee, K. R., Chen, G. Q., Uk Kim, H. (2015). Current
Budin, J. T., Breene, W. M., Putnam, D. H. (1995). progress towards the metabolic engineering of plant
Some compositional properties of Camelina seed oil for hydroxy fatty acids production. Plant
(Camelina sativa L. Crantz) seeds and oils. Journal Cell Reports, 34(4), 603‒615.
of the American Oil Chemists’ Society, 72(3), Li, N., Qi, G., Sun, X. S., Xu, F., Wang, D. (2015).
309‒315. Adhesion properties of camelina protein fractions
Dwyera, P. S., O' Beirne, D., Eidhin, D. A., Hennessy, isolated with different methods. Industrial Crops and
A. T., O' Kennedy, K. (2013). Formation, rheology Products, 69, 263‒272.
and susceptibility to lipid oxidation of multiple Li, Y., Sun, Y. S. (2015). Camelina oil derivatives and
emulsions (O/W/O) in table spreads containing adhesion properties. Industrial Crops and Products,
omega-3 rich oils. LWT - Food Science and 73, 73‒80.
Technology, 51(2), 484‒491. Lohani. U. C., Fallahi, P., Muthukumarappan, K. (2015).
Ergönül, P. G., Özbek, Z. A. (2018). Identification of Comparison of Ethyl Acetate with Hexane for Oil
bioactive compounds and total phenol contents of Extraction from Various Oilseeds. Journal of the
cold pressed oils from safflower and camelina seeds. American Oil Chemists' Society, 92(5), 743‒754.
Journal of Food Measurement and Characterization, Moslavac, T., Jokića, S., Šubarić, D., Aladić, K.,
12(4), 2313‒2323. Vukojac, J., Prce, N. (2014). Pressing and
Fröhlich, A., O’Dea, G., Hackett, R., O’Beirne, D., Ni supercritical CO2 extraction of Camelina sativa oil.
Eidhin, D., Burke, J. (2012). Stabilization of Industrial Crops and Products, 54, 122‒129.
Camelina Oil with Synthetic and Natural Nosal, H., Nowicki, J., Warzała, M., Semeniuk, I.,
Sabura, E. (2016). Synthesis and characterization of
176
alkyd resins based on Camelina sativa oil, glycerol Szterk, A., Roszko, M., Sosińska, E., Derewiaka, D.,
and selected epoxidized vegetable oils as functional Lewicki, P. P. (2010). Chemical Composition and
modifiers. Progress in Organic Coatings, 101, Oxidative Stability of Selected Plant Oils. Journal of
553‒568. the American Oil Chemists' Society, 87(6), 637‒645.
Omonov, T. S., Kharraz, E., Curtis, J. M. (2017). Terpinca, P., Polaka, T., Makucbc, D., Poklar Ulriha, N.,
Camelina (Camelina sativa) oil polyols as an Abramovič, H. (2012). The occurrence and
alternative to Castor oil. Industrial Crops and characterisation of phenolic compounds in Camelina
Products, 107, 378‒385. sativa seed, cake and oil. Food Chemistry, 131(2),
Raczyk, M., Popis, E., Kruszewski, B., Ratusz, K., 580‒589.
Rudzińska, M. (2015). Physicochemical quality and Waraich, E. A., Ahmed, Z., Ahmad, R., Muhammad, Y.
oxidative stability of linseed (Linum usitatissimum) A., Saifullah, Naeem, M. S., Rengel, Z. (2013).
and camelina (Camelina sativa) coldǦpressed oils Camelina sativa, a climate proof crop, has high
from retail outlets. European Journal of Lipid nutritive value and multipleuses: a review. Australian
Science and Technology, 118(5), 834‒839. Journal of Crop Science.
Ratusz, K., Popis, E., Ciemniewska-Zytkiewicz, H., Yea, D., Jo, S. H., Lim, J. C. (2018). Synthesis of Eco-
Wroniak, M. (2016). Oxidative stability of camelina friendly Nano-Structured Biosurfactants from
(Camelina sativa L.) oil using pressure differential Vegetable Oil Sources and Characterization of Their
scanning calorimetry and Rancimat method. J Therm Interfacial Properties for Cosmetic Applications.
Anal Calorim, 126, 343‒351. Material Research Society, 23 November 2018.
Rigano, I., Giammarrusti, G., Rastrelli, F. (2006). Yuan, L., Mao, X., Zhao, K., Ji, X., Ji, C., Xue, J., Li, R.
Vegetable Oils - The Base of New Active Principles. (2017). Characterisation of phospholipid:
SÖFW-Journal, 132. diacylglycerol acyltransferases (PDATs) from
Snapp, A. R., Lu, C. (2013). Engineering industrial fatty Camelina sativa and their roles in stress responses.
acids in oilseeds. Frontiers in Biology, 8(3), Biol Open, 6(7), 1024‒1034.
323‒332. Zubr, J. (2003). Qualitative variation of Camelina sativa
seed from different locations. Industrial Crops and
Products, 17, 161‒169.
177
178
Food
safety
179
180
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
ANTIOXIDANT CAPACITY IN DONKEY MILK (Equus asinus)
DEPENDING ON LACTATION
Adina Lia LONGODOR1, Vioara MIREŞAN1, Răzvan A. CODEA2, Camelia RĂDUCU1,
Luisa ANDRONIE1, Zamfir MARCHIȘ1, Igori BALTA1, Codruţa MARIŞ3, Aurelia COROIAN1
1
University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Faculty of
Animal Science and Biotehnology, Mănăştur Str. 3-5, 400272, Cluj-Napoca, Romania
2
University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Faculty of
Veterinary Medicine, Mănăştur Str. 3-5, 400272, Cluj-Napoca, Romania
3
Universitat de Lleida, Department of Environment and Soil Sciences, UdL, Av Rovira Roure, 191
25198 Lleida, Spain
Corresponding author email: [email protected]
Abstract
Donkey milk is used as an alternative source in the diet of young children and newborns due to the similar composition
to breast milk. The donkey milk is considered to be a functional food by the chemical composition it presents, thus being
beneficial in the nutrition of people suffering from food allergies. The chemical composition and antioxidant capacity of
the donkey milk are significantly influenced by lactation and also by the lactation period. Donkey milk has a low fat
content compared to other species and high lactose content. These parameters are influenced by the variables such as:
lactation, animal age, and feeding. The purpose of this study was to determine the effect of lactation on the antioxidant
capacity and physicochemical compounds in the donkey milk.
Key words: donkey, milk, lactation, antioxidant, fat, protein, lactose.
INTRODUCTION the diet of adults and susceptible persons
(Martemucci et al., 2012; Martini et al., 2014).
The chemical composition of milk and
Donkey milk is used in different directions: for
colostrum is influenced by feed, climatic
dairy products, creams, soaps and supplements
conditions, lactation, animal health and housing
for people suffering from food allergies
conditions (Marchiş et al., 2018; Longodor et
(Piovesana et al., 2015; Coroian, 2018). It has a
al., 2018; Coroian et al., 2016; 2017;
high a high antimicrobial activity and benefits
Diaconescu et al., 2002; Martini et al., 2014).
the gastrointestinal and immune system. Due to
The physicochemical and amino acid
its composition, it can be used against
composition of donkey milk according to
microbial infections and in the diet of people
lactation was studied by different authors (Guo
suffering from food allergies (Gubic et al.,
et al., 2007; Polidori et al., 2009). Aspects
2015; Longodor et al., 2018; Carminati et al.,
related to the influence of nutrition and
2014; Cavallarin et al., 2015). Donkey milk has
lactation on the composition of donkey milk
a rich chemical composition very similar to
are also shown in the studies of (Salimei et al.,
maternal breast milk, so it can be used in
2012). Compared to other species, donkey milk
newborn nutrition (El-Hatmi et al., 2015;
has a higher content of lysozyme. Moreover,
Polidori et al., 2009). The physico-chemical
lysozyme helps to reduce the number of
composition of milk varies according to
bacteria, so it can be used to prevent intestinal
species, individual, race, feed, lactation, health,
infections in infants (Polidori et al., 2009).
season, climate and age (Coroian et al., 2016).
Ascorbic acid is present in donkey milk, which
Donkey milk can be used in the diet of people
is also present in colostrum and breast milk.
with atherosclerosis and hypercholesterolemia
Ascorbic acid has a multitude of biochemical
(Chiofalo et al., 2011). The composition in
functions, such as maintaining a natural barrier
fatty acids suggests its consumption as a
against microbial infections (Vincenzetti et al.,
functional food for infant nutrition as well as in
2011).
181
Donkey milk was widely researched in various was used to measure the antioxidant capacity.
aspects, such as: mineral content at the The calibration and measurement of samples
different stages of lactation (Bilandzic et al., was based upon the inhibition of free radicals.
2014); protein from donkey whey compared to After each measurement two purges of the
other species (Brumini et al., 2015). Murua et apparatus were performed using ultrapure
al. (2013) studied the bactericidal activity of water. Determination of the amount of antio-
donkey milk, while (Monti et al., 2008) xidant capacity was achieved by establishing
evaluated the influence of donkey milk on measurement curves that were compared to the
nutrition of children suffering from food aller- measurement curves obtained for the standard
gies. Immunological aspects of donkey milk solution. The calibration curve evaluation
and the effect in preventing arteriosclerosis principle consists of: determining the integrated
were studied by (Tafaro et al., 2007), while calibration curve. All the abovementioned
hygiene and health of donkeys was evaluated calculations were made automatically using a
by (Pilla et al., 2010). Donkey milk contains software program called PCL soft.
nutrients such as proteins, fats, lactose and
minerals that can also be detected in milk from RESULTS AND DISCUSSIONS
other species. The difference between species
is given by the different distribution of these Physico-chemical composition of donkey milk
nutrients. Protein content is influenced by The physico-chemical composition analysed
breed, food, climate, season and udder health for donkey milk corresponds to the reference
(Gubic et al., 2014; Hosoi et al., 2005; values for this species. The results are similar
Yamawaki et al., 2005). The health of the to those reported by (Longodor et al., 2018).
animal and the udder influences the quality and Figure 1 show the fat content, which varies
quantity of milk. The highest milk production according to the harvesting and lactation area,
is realized in the third lactation. Between as follows: 0.98% (L I) - 2.81% (L IV) for Cluj
individuals and breeds there may be conside- area and lower values for Sălaj area, 0.92% (L
rable variations in both productive and nutri- I) - 2.77% (L IV).
tional value of milk (Popelka et al., 2002). The
purpose of this paper was to characterize the Cluj Sălaj
100%
composition of donkey milk and antioxidant
capacity under the influence of lactation. 80%
0,98 1,58 2,66 2,81
60%
MATERIALS AND METHODS 40%
20% 0,92 1,45 2,45 2,77
The donkey milk was harvested from lactating
animals (lactation I-IV), from small farms in 0%
Cluj and Sălaj. Milk samples were collected I II III IV
individually in sterile containers and kept cool
until physico-chemical analysis and antioxidant Figure 1. Fat content of donkey milk (%)
capacity were performed. Samples were (I-IV lactation period)
harvested in the winter season.
The average fat content of the donkey milk
Physico-chemical analysis of donkey milk (0.3-1.8%) is similar to the observed values in
The physico-chemical parameters of donkey horse milk (0.3-0.5%) and is much lower com-
milk (fat, protein, lactose, water content and pared to other mammals (3.5-4-4% for human
pH) were determined using Lactoscan apart. milk, 3.5-3.9% for cow's milk) (Guo et al.,
2007; Polidori et al., 2009). One of the main
Determination of the antioxidant capacity of causes of a lower fat content in milk is due to
the donkey milk the incomplete removal of milk from the udder
The ACL method (antioxidant capacity of (Doreau et al., 1989; Caroprese et al., 2006).
lipid-soluble compounds) is used to determine The amount of fat also varies during the lac-
the antioxidant capacity. The photochem V02 tation period, being higher in colostrum, and
182
decreases to the end of lactation (Gibbs et al., Swar et al. (2012) reports for donkeys and
1982). The protein content is influenced by horses, that water has the highest content in the
lactation: (L I) - 1.68% and (L IV) - 1.94%, composition.
with the highest values in lactation IV (Figure
2). The protein in the donkey milk decreases Cluj Sălaj
100%
from one month to the next, averaging 2%. The
milk protein content was not influenced by the 80%
86,2 86,5 87,1 89,5
breed. On the contrary, milk protein content 60%
varied strongly during lactation and had a
decreasing trend until 1.72 (g/100 g). 40%
20% 85,4 84,7 86,3 88,4
Cluj Sălaj
100% 0%
I II III IV
80%
1,75 1,84 1,91 1,94
60% Figure 4. Water content of donkey milk (%)
(I-IV lactation period)
40%
20% 1,68 1,77 1,86 1,91 From the data reported by Salimei et al. (2004)
0% and Guo et al. (2007), donkey milk has a pH
I II III IV between 7.14-7.22 and does not vary
significantly during lactation compared to
Figure 2. Protein content of donkey milk (%) horse milk (Mariani et al., 2001).
(I-IV lactation period)
100% Cluj Sălaj
Whey protein content remains constant during
80%
lactation. Whey protein content in the donkey 6,82 7,14 7,21 7,04
0.68 (g/100 g) is close to human and horse 60%
(Alabisio et al., 2005). In the present study, the 40%
protein content was lower in donkey milk than
20% 6,75 7,02 6,98 7,11
values reported by (Ling et al., 2008).
Lactose is the major disaccharide in milk, being 0%
an important parameter for donkey milk also, I II III IV
especially if we use milk to produce dairy
products. Figure 5. pH of donkey milk
(I-IV lactation)
Donkey milk has a high content of lactose, with
variation between 6.71% (L I) - 6.88% (L IV),
for donkey milk in the Cluj area and 6.62% - (L The average pH (7.18) of the donkey milk is
I) and 6.91% (L IV) for Sălaj donkey milk higher than that of cow's milk (6.6-6.7).
(Figure 3).
Antioxidant capacity of donkey milk
Cluj Sălaj Donkey milk was considered a substitute for
100%
breast milk due to nutritional value and
80% antioxidant properties, which can reduce
6,71 6,79 6,85 6,88
disease (asthma, bronchitis, diabetes, anabrosis,
60%
gastritis, gastric ulcer) and oxidative stress
40% (Beghelli et al., 2016; Lu et al., 2006; Ma et al.,
6,62 6,69 6,77 6,91 2005; Nazzaro et al., 2010).
20%
Figure 6 shows the mean values for the
0% antioxidant capacity of donkey milk during
I II III IV four lactations in both areas (Sălaj and Cluj).
The total antioxidant capacity in donkey milk
Figure 3. Lactose content of donkey milk (%) varies between 16.02 U/ml and 17.55 U/ml
(I-IV lactation period)
(lactation IV), in the Cluj area.
183
40 Brumini, D., Criscione, A., Bordonaro, S., Vegarud E.,
Marletta D. (2015). Whey proteins and their
30 antimicrobial properties in donkey milk: a brief
17,32 17,55 review. Dairy Science & Technology, Catania, 1‒14.
16,02 16,6 Cluj Carminati, D., Tidona, F., Fornasari, M. E., Rossetti, L.,
20 Meucci, A., Giraffa, G. (2014). Biotyping of
cultivable lactic acid bacteria isolated from donkey
10 17,01 17,58 17,63 milk. Letters in Applied Microbiology, Lodi,
15,68 Sălaj
299‒305.
0 Caroprese, M., Napolitano, F., Albenzio, M.,
I II III IV Annicchiarico, G., Muscio, A., Sevi, A. (2006).
Influence of gentling on lamb immune response and
human-lamb interactions. Appl. Anim. Behav. Sci.,
Figure 6. Total antioxidant capacity donkey milk (U/ml) 99, 118‒131.
Cavallarin, L., Giribaldi, M., Dolores Soto-Del, R. M.,
The antioxidant capacity of donkey milk in Emanuela, V., Barbarino, G., Gennero, M. S., Civera,
Sălaj area varied between 15.68 (U/ml) (L I) T. (2015). A survey on the milk chemical and
microbiological quality in dairy donkey farms located
and 17.63 (U/ml) in the fourth lactation. In both
in NorthWestern Italy. Food Control, Bari, 50,
studies areas, the third and fourth lactations 230‒235.
showed the highest values. Chiofalo, B., Paola, D., Ivana, L. B., Bonaccorsi, L. M.
These results are in the same line with those (2011). Comparison of major lipid components in
reported by Bucevic-Popovic et al. (2014) and human and donkey milk: new perspectives for a
hypoallergenic diet in humans.
Ling et al. (2018) in donkey milk. Donkey milk
Immunopharmacology and Immunotoxicology,
has a high antioxidant capacity; therefore it is Rome, 633‒644.
used in the case of allergies, cardiovascular Coroian, A. (2018). Toxicologie, Alergii alimentare.
diseases and diabetes mellitus (Ling et al., Editura Academic Pres, Cluj-Napoca.
2018). Coroian, A., Miresan, V., Cocan, D., Raducu, C.,
Longodor, A. L., Pop, A., Feher, G., Andronie, L.,
Marchis, Z. (2017). Physical-chemical parameters
CONCLUSIONS and the level of heavy metals in cow milk in the Baia
Mare area. Banat s Journal of Biotechnology,
The physico-chemical composition of donkey VIII(16), 69.
milk was influenced by lactation. The highest Coroian, A., Miresan, V., Odagiu, A., Andronie, L.,
content of fat, protein and lactose were Raducu, C., Marchis, Z., Coroian, C. O. (2016).
Influence of Season on Physico-Chemical
observed in third and fourth lactation. In both Composition of Donkey Milk from Primiparous and
studied areas (Sălaj and Cluj), the antioxidant Multiparous. ProEnvironment, 9, 400‒403.
capacity was influenced by lactation; the lowest Coroian, A., Erler E., Matea, C. T., Mireșan V., Răducu
content was observed in first and second C., Bele C., Coroian C. O. (2013). Seasonal changes
lactation, while the highest in third and fourth of buffalo colostrum: physicochemical parameters,
fatty acids andcholesterol variation. Chemistry
lactation. Central Journal, 7, 40.
Diaconescu, A., Săndulescu, D., Nicolae, C. (2002).
REFERENCES Metode fizico-chimice moderne folosite în analiza
laptelui de vacă. Lucrări ştiinţifice, Seria D, XLV,
Alabiso, M., Russo, G., Giosue`, C., Alicata, M. L., Seria Zootehnie, Bucureşti, 93‒95.
Torrisi, C. (2005). La produzione di latte nell’arco di Doreau, M., Martin-Rosset W. (2002). Horse.
una intera lattazione in asine allevate in Sicilia. Encyclopedia of Dairy Sciences, 630‒637.
Proceedings of the 7th congress, Nuove acquisizioni El-Hatmi, H., Jrad, Z., Salhi, I., Aguibi, A., Nadri, A.,
in materia di Ippologia, Lodi, Italy, 152‒158. Khorchani, T. (2015). Comparison of composition
and whey protein fractions of human, camel, donkey,
Beghelli, D., Lupidi, G., Damiano, S., Cavallucci, C.,
goat and cow milk, Mljekarstvo, Gabes, 159‒167.
Bistoni, O., De Cosmo, A., Polidori, P. (2016). Rapid
Gibbs, P. D., Potter, G. D., Blake, R. W., Mc Mullan, W.
Assay to Evaluate the Total Antioxidant Capacity in
C. (1982). Milk production of quarter horse mares
Donkey Milk and in more Common Animal Milk for
during 150 days of lactation. J. Anim. Sci., 54,
Human Consumption. Austin Food Sci., 1(1), 1003.
496‒499.
Bilandzic, N., Sedak, M., Dokic, M., Kolanovic, B. S.,
Gubic, J., Milovanovic, I., Ilicic, M., Tomic, J., Torbica,
Varenina, I., Bozic, D., Koncurat, A. (2014).
A., Saric, L., Ilic, N. (2015). Comparison of the
Differences of the essential mineral element levels in
protein and fatty acid fraction of Balkan donkey and
the milk of Croatian Cold blood horse and Littoral-
human milk. Mljekarstvo, Novi Sad, 168‒176.
Dinaric donkey, Mljekarstvo, Zagreb, 12‒18.
184
Gubic, J. M., Saric, L. C., Saric, B. M., Mandic, A. I., donkey’s milk in treating highly problematic cow’s
Jovanov, P. T., Plavsic, D. V., Okanovic, D. G. milk allergic children: an in vivo and in vitro study.
(2014). Microbiological, chemical and sensory Pediatric Allergy and Immunology, 19, 85‒88.
properties of domestic donkey’s milk from Murua, A., Todorov, S. D., Vieira, A. D. S., Martinez, R.
autochthones serbian breed. Journal of Food and C. R., Cencic, A., Franco, B. D. (2013). Isolation and
Nutrition Research, 2633‒637. identification of bacteriocinogenic strain of
Guo, H. Y., Pang, K., Zhang, X. Y., Zhao, L., Chen, S. Lactobacillus plantarum with potential beneficial
W., Dong, M. L., Ren, F. Z. (2007). Composition, properties from donkey milk. Journal of Applied
Physiochemical Properties, Nitrogen Fraction Microbiology, Maribor, 1793‒1809.
Distribution, and Amino Acid Profile of Donkey Pilla, R., Daprà, V., Zecconi, A., Piccinini, R. (2010).
Milk. J. Dairy Sci., 90, 1635‒1643. Hygienic and health characteristics of donkey milk
Hosoi, K. (2005). Possibilities and prospects of on-line during a followup study. Journal of Dairy Research,
games in Asia, in Gaming, Simulations, and Society - 77, 392‒397.
Research Scope and Perspective, Berlin: Springer, Piovesana, S., Capriotti, A.L., Cavaliere, C., La Barbera,
269‒277. G., Samperi, R., Chiozzi, R. Z., Laganà, A. (2015).
Ling, L., Xinfeng, L., Hong, G. (2018). The nutritional Peptidome characterization and bioactivity analysis
ingredients and antioxidant activity of donkey milk of donkey milk. Journal of Proteomics breed,
and donkey milk powder. Food Sci Biotechnol., 633‒637.
27(2), 393‒400. Polidori, P., Beghell, D., Mariani, P., Vincenzetti, S.
Longodor, A. L., Miresan, V., Raducu, C., Coroian, A. (2009). Donkey milk production: state of the art.
(2018). Influence of the area and lactation on Italian Journal of Animal Science, Camerino, 8:
physico-chemical parameters and the content of 677‒683.
heavy metals in the donkey milk. Scientific Papers. Popelka, P., Horská, D., Golian, J., Marcinčák, S. (2002).
Series D. Animal Science, LXI(1), 127‒131. Detection of sheep milk and cheeses adulteration
Marchiș, Z., Odagiu, A., Coroian, A., Oroian, I., Mîrza, using enzyme immunoanalysis (Elisa). Slov. Vet. J.
M., Burduhos, P. (2018). Analysis of Environmental 27(3), 36‒37.
Factors’ Impact on Donkeys’ Colostrum Quality. Salimei, E., Cattaneo, M., Chiofalo, B., Dell’Orto, V.
Sustainability, 10, 2958. (1996). Exploitation of mare’s milk by
Mariani, E., Pulsatelli, L., Meneghetti, A., Dolzani, P., polyunsaturated fatty acids enrichment. Food &
Mazzetti, I., Neri, S., Ravaglia, G., Forti, P., Health: role of animal products, 223‒227.
Facchini, A. (2001). Different IL-8 production by T Salimei, E., Fantuz, F. (2012). Equid milk for human
and NK lymphocytes in elderly subjects. Mech consumption. International dairy journal, 24,
Ageing Dev. 15, 122(13), 1383‒95. 130‒142.
Martemucci, G., D’Alessandro, A. G. (2012). Fat Tafaro, A., Magrone, T., Jirillo, F., Martemucci, G.,
content, energy value and fatty acid profile of donkey D’Alessandro, A. G., Amati, L. Jirillo, E. (2007).
milk during lactation and implications for human Immunological properties of donkey’s milk: Its
nutrition. Health and Disease, Bari, 11‒13. potential use in the prevention of atherosclerosis.
Martini, M., Altomonte, I., Salari, F. (2014). Amiata Current Pharmaceutical Design, 13, 3711‒3717.
donkeys: fat globule characteristics, milk gross Vincenzetti, S., Savini, M., Cecchini, C., Micozzi, D.,
composition and fatty acids. Italian Journal of Carpi, F., Vita, A., Polidori, P. (2011). Effects of
Animal Science, Pisa, 123‒126. Lyophilization and Use of Probiotics on Donkey’s
Martini, M., Altomonte, I., Salari, F., Caroli, A. M. Milk Nutritional Characteristics. International
(2014). Monitoring nutritional quality of Amiata Journal of Food Engineering, Camerino, 7‒8.
donkey milk: effects of lactation and productive Yamawaki, N., Tschanz, B.T. (2005). Rape Perception
season. Journal of Dairy Science, Pisa, 97(11), Differences Between Japanese and American College
6819‒6822. Students: On the Mediating Influence of Gender Role
Monti, G., Bertino, E., Cristina, M. M., Coscia, A., Traditionality. Sex Roles: A Journal of Research,
Cresi, F., Silvestro, L., Fabris, C., Fortunato, D., 52(5-6), 379‒392.
Gabriella, M. G., Conti, A. (2008). Efficacy of
185
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
PHYSICO-CHEMICAL COMPOSITION AND ANTIOXIDANT CAPACITY
OF BUFFALO MILK
Aurelia COROIAN1, Camelia RĂDUCU1, Vioara MIREŞAN1, Daniel COCAN1,
Igori BALTA1, Adina Lia LONGODOR1, Luisa ANDRONIE1, Mircea MUNTEAN2,
Zamfir MARCHIŞ1
1
University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Faculty of Animal
Science and Biotehnology, Mănăştur Str. 3-5, 400272, Cluj-Napoca, Romania
2
University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Faculty of Agriculture,
Mănăştur Str. 3-5, 400272, Cluj-Napoca, Romania
Corresponding author email: [email protected]
Abstract
Buffalo milk due to its high fat content from the energy point of view is more valuable compared to cow's milk. The
percentage of fat varies depending on the stage of lactation, season, individual, health, animal age and diet. The study
of the chemical composition and the antioxidant capacity of buffalo milk is required for both scientific and
technological considerations, given the importance of this type of milk in the consumer's diet. The purpose of this study
was to evaluate the antioxidant capacity and the physico-chemical composition of buffalo milk by lactation. Buffalo
milk can have different qualities, so the quality of buffalo milk is also determined by its content in its components
(protein, fat, lactose, vitamins, fatty acids, water content, antioxidant capacity). The physicochemical parameters and
antioxidant capacity were influenced by lactation, presenting the highest values in lactations III and IV. During
lactation I, parameters such as fat, protein and lactose showed a content of 7.88, 4.35 and 4.71%, respectively.
Furthermore, in lactation IV, fat, protein and lactose had increased, showing the content of these parameters as follows
9.53, 4.68 and 4.77%. Antioxidant capacity of buffalo milk showed the highest numbers in lactation III (360.1) and IV,
358.9 μg/ml. From all of the analyzed parameters, only total dry substance content presented the most increased values
18.9% in lactation I.
Key words: buffalo milk, antioxidant capacity, lactation, fat.
INTRODUCTION buffalo milk is appearing rarely in the market
squares and is a potentially valuable source of
Nowadays, more and more consumers are essential minerals and vitamins that have a
concerned in nutritious, good-tasting and high- positive effect on human health (Ahmad et al.,
quality food products containing bioactive 2013; Pasquini et al., 2018; Cazacu et al.,
compounds that ensure beneficially health 2014). Natural antioxidants from milk, are a
impact (Shah et al., 2000). Generally, milk is valuable asset for a healthy alimentation and
regarded as an indispensable food product represents a basic concern of interest for
particularly for children and infants diet researchers from different fields such as
(Koletzko et al., 2011.) From all of the pharmacology, biotechnology, biochemistry,
ruminant species, buffaloes are taken into physiology and so on. Antioxidants are acting
consideration as second main milk producers at as chemical scavengers neutralizing free
the global scale after cows, respectively. The radicals. Reactive oxygen species (ROS) are
significance of the Buffalo is attributed by precursors of oxidative stress and are
prolonged longevity of the animals, an commonly associated to induce cell damage,
increased dry matter of milk, bioactive fatty altering DNA, proteins, and triggering various
acids content and development of nutritionally human diseases (Lobo et al., 2010; Mann et al.,
dairy products on markets compared with 2016). Sources of antioxidants include
cows. (Bainbridge et al., 2016; Coroian et al., tocopherols, polyphenols, vitamins, flavonoids,
2013; Cazacu et al., 2014; Diaconescu et al., carotenoids, amino acids, fatty acids, minerals,
2002; Diaconescu et al., 2013). In addition, proteins, some Maillard reaction products,
186
sterols, peptides and phospholipids (Carocho et and fetotoxicity in animals. (Govind et al.,
al., 2016). Considering antioxidant 2014; Samiee et al., 2019). Moreover, the
characteristics, buffalo milk has a higher composition of milk is rich in antioxidant
antioxidant capacity compared to cow milk, enzymes and non-enzymatic antioxidants.
meaning that buffalo milk is rich in bioactive Superoxide dismutase (SOD), catalase,
compounds that can benefit a healthier diet glutathione peroxidase (GSHPx) are
(Khan et al., 2017). In addition, milk possess antioxidative enzymes that have the potential to
two antioxidant systems, lipophilic and prevent the formation of radicals such as
hydrophilic. Lypophilic antioxidant fraction hydrogen peroxide, superoxide anion, and other
also known as fat soluble, is mostly consisted peroxides (Lindmark-Månsson et. al., 2000).
of vitamins A, E, phospholipids and fatty acids Based on these findings and to the fact that
(Khan et al., 2017). Both antioxidant systems Buffalo milk has a rich source of antioxidants,
perform an essential role for the human body proteins and other bioactive compounds that
namely supporting antioxidant and pro-oxidant may exert beneficial effects on human health,
homeostasis by disrupting the activity of photochemiluminescence method was applied
reactive oxygen species (Grażyna et al., 2017). in order to evaluate antioxidant capacity of
Also, fat-soluble antioxidants present higher milk samples. Therefore, the aims of this study
thermal stability, remaining active in most of were to evaluate the physicochemical compo-
the milk products, compared to hydrophilic sition and antioxidant capacity of buffalo milk
antioxidants. Hydrophilic antioxidant system influenced by lactation period.
(water soluble) is mainly comprised of
minerals, trace elements, proteins, vitamins and MATERIALS AND METHODS
bioactive peptides (Basilicata et al., 2018;
Grażyna et al., 2017). On one hand elements Milk sampling
from milk such as zinc (Zn), copper (Cu), Samples of buffalo milk were individually
selenium (Se), iron (Fe), and magnesium (Mg) harvested from buffaloes according to lactation.
play a crucial role in the development of human Five samples were collected for each lactation.
growth. On another hand trace elements, such It was taken from a small farm in Buciumi
as mercury (Hg), lead (Pb), cadmium (Cd) and commune, Salaj county. Samples were
aluminum (Al), in high concentrations can harvested in sterile containers and stored at 4ºC
affect human wellbeing. These heavy metals, until analyzes were performed (Coroian et al.,
exert a serious threat due to their toxicity, 2013; Marchis et al., 2018). The buffaloes in
bioaccumulation in food products (Babu et al., the study are of Romanian buffalo breed and
2018). Unfortunately, ruminants that are raised are in lactation (I-IV). The buffaloes received
especially near industrial polluted sectors can the same feed and had the same maintenance
cumulate high concentrations of heavy metals site.
through the intake of contaminated feeds
(Meshref et al., 2014). Thereupon, animals are Physico-chemical analysis
secreting those contaminants in milk, presen- Lactoscan (Milk analyzer Lactoscan) device
ting a hazard for human health. (Tunegova et was used for physico-chemical analysis, a
al., 2016; Younus et al., 2016). Heavy metals method also reported by Marchis et al. (2018).
have a bioaccumulation potential, inducing The following parameters were determined: fat,
harmful effects in living organisms as chronic protein, lactose and total dry substance %.
toxicity, decreasing fetal development,
damaging the DNA and so forth (Zhang et al., Antioxidant capacity analysis
2019; Govind et al., 2014). Interestingly, the Antioxidant capacity of milk samples was done
absorption of Pb occurs faster in children by the photochemiluminescence method,
compared to adults, accumulating mainly in according to (Popov & Lewin, 1996) and
soft tissues and bones (Norouzirad et al., 2018). protocol of (Photochem producer), for the
The element as trivalent Cr (III) presents low measurement of lipidsoluble substances (ACL).
toxicity, while hexavalent Cr (VI) is considered PHOTOCHEM® instrument (Analytik Jena
carcinogenic, associated with embryotoxicity AG, Jena, Germany) was used to measure the
187
antioxidant capacity. The principle of the ACL Photochemiluminescence assay used in that
method: free radicals are produced by study demonstrated many advantages among
irradiating a photosensitizing substance the other techniques, due to the fact that is fully
(luminol). Then they are partially removed automatic, sensitive and quick. Moreover, this
from the sample by the chemical reactions that methodology doesn't need complicated sample
occur between the existing antioxidants in the preparation steps or time-consuming
sample and free radicals released by the procedures that are required for example in the
photosensitizer. TROLOX equivalent in the case case of ORACFL assay, DPPH method or FRAP
of lipid soluble and in ascorbic acid equivalent method (Sielicka et al., 2014).
in the case of water soluble antioxidant Photochemiluminescence method is widely
capacity. Thus, the antioxidant capacity used in various studies for antioxidant capacity
obtained is measured in equivalent standard analysis of samples such as blood, fruits,
units. The reagents used for this assay were the berries, various plants as well as honey, dairy
following: reagent 1 - methanol, reagent 2 - products and so on (Moffarts et al., 2005;
buffer solution, reagent 3-250 μl/ bottle stock Hegedüs et al., 2011; Balogh et al., 2010;
solution PS-2 (photosensitizer and detection Prasad et al., 2012; Zielińska et al., 2007;
agent), and reagent 4-standard calibration Wesołowska et al., 2017). Figure 1 shows the
solution for the quantification of lipid-soluble mean values for the antioxidant capacity of
antioxidants, equivalent to TROLOX. The buffalo milk by lactation. The lactation
working solutions were prepared according to stimulates both the physico-chemical
the following protocol: 1st reagent - methanol composition of buffalo milk and the antioxidant
without dilutions, 2nd reagent - ready to use, 3rd capacity. The antioxidant capacity in lactation
reagent is obtained by defrosting the vial with 1 showed the lowest mean values of 325.6
the basic solution and adding an amount of 750 (μg/ml). As the number of lactations increases,
μl of 2nd reagent, 4th reagent - stock solution - it can be noticed that the values for antioxidant
is obtained by adding 500 μl of 1st reagent to capacity are higher. Lactation 3 and 4 show the
4th reagent, and 5th reagent- The previously highest values, 360.1 (μg/ml) and 358.9
obtained reagent is diluted with the 1st reagent (μg/ml). These values are similar to those
in a ratio of 1: 100; 10 μl of the solution thus reported in the literature: Physical and chemical
obtained will contain 1 nmol of standard parameters for buffalo milk are shown in
TROLOX calibration solution. All calculations Figure 2. Studies on the composition of buffalo
were performed automatically using a software milk and cow milk were in line with Hamad
program called PCL soft. All measurements and Baiomy in 2010.
were done in triplicate. Five samples were
analyzed for the antioxidant capacity of buffalo 370 Antioxidant capacity (μg/mL)
milk for each lactation. The ANOVA (JMP 12, 360
SAS) program for data analysis was used. 350
340
RESULTS AND DISCUSSIONS
330
Different versatile methods of measuring the 320
antioxidant capacity of milk products are 310
presented in the literature and the most 300
mentioned are FRAP and DPPH methods. Lactation I Lactation II Lactation IIILactation IV
Moreover (Zulueta et al., 2009) using ORACFL Figure 1. Antioxidant capacity (μg/ml)
assay, observed that total antioxidant capacity of buffalo milk by lactation (lactation I-IV)
is especially attributed to casein. Deproteinized
milk and whey showed statistically significant Many studies have shown that milk proteins
differences of (TAC) obtained from UHT- have antioxidant action, for example, peptic
treated and pasteurized milk. Total antioxidant digestion of casein exhibited to the release of
capacity values were not significantly different radical scavenging active peptides (Suetsuna et
for UHT and pasteurized milk. al., 2000; Virtanen et al., 2006). In addition,
188
peptides derived from whey proteins have also and having the most increased protein values
exhibit antioxidant activity. They can be 3.38 (%) compared to full-cream milk and
released through fermentation of the milk and enriched full-cream milk (Smet et al., 2008).
enzymatic hydrolysis (Park et al., 2007). Figure The chemical composition of raw, pasteurized
2 shows the mean values for physicochemical and boiled buffalo and cow milk was reported
profile of buffalo milk influenced by lactation. by Khan et al., 2017. The fat content of raw,
Buffalo milk fat fraction presented decreased pasteurized and boiled buffalo milk showed
mean values for the lactation I 7.88 (%), it can values (6.45 ± 0.16), (6.42 ± 0.08) and (6.53 ±
be observed as the number of lactations grows 0.07), respectively. Cow milk had a lower
up, the means are increasing constantly content of fat comprising values (4.17 ± 0.13),
presenting values for lactation II 8.52 (%), (4.14 ± 0.05) and (4.21 ± 0.11). The protein
lactation III 9.02 (%) and the lactation IV concentration of raw, pasteurized and boiled of
comprising 9.53 (%) of fat, respectively. The buffalo milk presented values (3.82 ± 0.14),
same observation is attributed to the protein (3.80 ± 0.05) and (3.88 ± 0.12), whereas cow
content, presenting low protein values in the samples revealed significantly lower protein
lactation I 4.35 (%) and the highest in the last content (3.22 ± 0.09), (3.19 ± 0.03) and (3.26 ±
lactation IV 4.68 (%). Lactose variable 0.02), respectively. Lactose differences among
presented the highest values during the the milk samples were not so significant
lactation III with the mean values 4.8 (%) depending on the thermal treatment applied.
followed by lactation IV 4.77 (%), lactation I Presenting values for cow milk as follows (4.54
4.71 (%) and lactation II with the lowest ± 0.19), (4.52 ± 0.23) and (4.61 ± 0.17),
content of lactose 4.69 (%). Banu et al., in whereas buffalo milk showed (4.85 ± 0.26),
1998, in the study of buffalo in our country (4.87 ± 0.12) and (4.94 ± 0.25), respectively.
obtained a mean value for fat of 7.80%, similar Our results regarding proteins, fat, lactose and
values being reported by Georgescu et al., in total dry substances are in concordance with
2000. Khan et al. (2017) presenting similarities of
measurements with those from our study. In
12 Fat (%) Protein (%) Lactose (%) addition, the same method was used for
10 physicochemical determination of samples
8 (Lactoscan). Figure 3 indicates the total dry
substance from buffalo milk samples according
6
to lactation, revealing the most elevated dry
4 content during the lactation I 18.9 (%), it can
2 be noticed that over lactation II this variable is
0 decreasing presenting the lowest values 18.55
Lactation I Lactation II Lactation III Lactation IV (%). Furthermore, during the progression of
Figure 2. Physico-chemical composition
lactation III and IV, the content of this
of buffalo milk by lactation parameter is increasing again presenting values
of 18.64 (%) and 18.72 (%), respectively.
Physico-chemical composition of milk is
reported in various studies. The results of the Dry substance (%)
present study are in line with (Smet et al., 19
2008) showing fat, protein and lactose content 18,8
of different types of milk. Full-cream milk
presented a fat content of 3.26 (%), protein 18,6
3.18 (%) and an elevated level of lactose 5.47
18,4
(%). PUFA enriched full-cream milk presented
the highest fat fraction (3.73%), followed by 18,2
lactose (4.64%) and protein content (3.35%). Lactation I Lactation II Lactation III Lactation IV
Low-fat milk, have the lowest content of fat
Figure 3. Dry substance level according
presenting values of 1.61 (%), lactose 4.72 (%) to different stage of lactation
189
According to Khan et al. (2017) findings, total mentioned mineral is elevating selenium levels
dry substances from cow and buffalo raw, in the blood and milk of the animals.
pasteurized and boiled milk presented an Additionally, vitamin A administrated at the
average means of (12.7 ± 0.34), (12.6 ± 0.28) doses of 220 IU/kg of BW to the cows, can
and (12.9 ± 0.30) (%) instead, the buffalo milk significantly raise the total antioxidant capacity
demonstrates the significantly higher values and hydroxyl radical inhibition capability
(16.21 ± 0.43), (16.05 ± 0.24) and (16.29 ± enhancing milk production performance (Jin et
0.18) (%) compared to cow milk. al., 2014).
Interestingly, according to Khan et al. (2017)
remarked a suggestion that pasteurized milk CONCLUSIONS
preferentially may be consumed within three
days for better antioxidant activity effects, also The buffalo milk has a high fat content in all
according to their results buffalo milk has a four lactations. This is influenced by the
higher antioxidant capacity than cow milk. number of lactations and shows the highest
Animal diet is influencing directly values in lactation IV.
antioxidative properties of milk, increasing The buffalo milk is a food beneficial to the
compounds as α-Tocopherol and β-Carotene. human body due to its high level of fat, protein,
Grass-clover silage fed animals excreted milk lactose and antioxidant capacity. Antioxidant
with higher concentrations of α-Tocopherol and capacity has the highest content in lactation III
β-Carotene, comprising values of (472 ± 33) g/l and IV.
and (440 ± 23) g/l whereas cows that received
hay roughage diet had a lower means of these ACKNOWLEDGEMENTS
antioxidants (504 ± 48) and a decrease (from
445 to 264) g/l, respectively (Havemose et al., This project is funded by the Ministry of
2006). Research and Innovation through Program 1-
The fatty acid content of milk is well-known to Development of the National Research and
impact oxidative balance stability (Barrefors et Development System, Subprogram 1.2-Institu-
al., 1995; Havemose et al., 2004, 2006). In tional Performance-Projects for Financing the
addition, fatty acids unsaturation degree Excellence in CDI, Contract no.
contributes to lipid hydroperoxides cumulation 37PFE/06.11.2018. Title of the project:
(Havemose et al., 2006). Unfortunately, goats "Increasing the institutional performance
infected with mastitis demonstrated decreased through consolidation and development of
values of antioxidative properties of milk. research directions within the USAMVCN".
Using FRAP method (Silanikove et al., 2014)
reported lower values of antioxidant properties REFERENCES
in contaminated goat milk (305 ± 36) μM
compared to uninfected samples with Ahmad, S. (2013). Buffalo Milk, In Milk and Dairy
Products in Human Nutrition, Production,
significantly increased values (427 ± 35) μM.
Composition and Health. In Park Y.W. and Haenlein
Moreover, subclinical mastitis affects G.F.W. editors.
antioxidant/oxidant balance of milk, reducing Analytik Jena AG manual (2005). Determination of the
the total antioxidant capacity (TAC), presenting Lipid Soluble Antioxidative Capacity (ACL) of
values of (mmol Trolox Equv./l) 0.54 ± 0.051 Heating Oil. Leipzig, Germany.
Atakisi, O., Oral, H., Atakisi, E., Merhan, O., Metin
for healthy cows and 0.42 ± 0.047 for mastitis
Pancarci, S., Ozcan, A., Marasli, S., Polat, B., Colak,
infected, as well as (TOC) total oxidant A., Kaya, S. (2010). Subclinical mastitis causes
capacity (lmol H2O2 Equv./l) 15.91 ± 0.57 for alterations in nitric oxide, total oxidant and
healthy animals and 20.88 ± 0.90 for infected antioxidant capacity in cow milk. Research in
(Atakisi et al., 2010). Veterinary Science, 89(1), 10‒13.
Babu, A. J., Supriya, R. A., Swetha, C. S., Suganya, G.,
Interestingly, that administration of selenium in
Vijayabhaskar, R. G., Sasikala, V., Surendra, R.,
the nutrition of dairy cows significantly Yeshwanth Sreenivas, K. (2018). Estimation of
increases catalase activity (CAT) and (TAC), chromium, copper and lead in milk by inductively
compared with inorganic selenium supplemen- coupled plasma-optical emission spectrometry in
tation (Gong et al., 2014). Furthermore, the Tirupati, Andhra Pradesh. Pharma Innovation
Journal, 7(8), 90‒93.
190
Banu, C., Vizireanu, C. (1998). Procesarea industrială a Hegedüs, A., Pfeiffer, P., Papp, N., Abranko, L.,
laptelui. Editura Tehnică Bucureşti. Blazovics, A., Pedryc, A., Banyai, E. S. (2011).
Bainbridge, M. L., Cersosimo, L. M., Wright, A. D. G., Accumulation of Antioxidants in Apricot Fruit
Kraft, J. (2016). Content and Composition of through Ripening: Characterization of a Genotype
Branched-Chain Fatty Acids in Bovine Milk Are with Enhanced Functional Properties. Biol. Res.,
Affected by Lactation Stage and Breed of Dairy Cow. 44(4), 339‒344.
PLoS ONE, 11(3), pp.?? Jin, L., Yan, S., Shi, B., Bao, H., Gong, J., Guo, X., Li, J.
Balogh, E., Hegedus, A., Banyai, E. S. (2010). (2014). Effects of vitamin A on the milk
Application of and correlation among antioxidant and performance, antioxidant functions and immune
antiradical assays for characterizing antioxidant functions of dairy cows. Animal Feed Science and
capacity of berries. Scienia Horticulturae, 125(3), Technology, 192, 15‒23.
332‒336. Khan, I. T., Nadeem, M., Imran, M., Ayaz, M., Ajmal,
Basilicata, M. G., Pepe, G., Adesso, S., Ostacolo, C., M., Ellahi, M. Y., Khalique, A. (2017). Antioxidant
Sala, M., Sommella, E., Scala, M. C., Messore, A., capacity and fatty acids characterization of heat
Autore, G., Marzocco, S., Campiglia, P. (2018). treated cow and buffalo milk. Lipids in Health and
Antioxidant Properties of Buffalo-Milk Dairy Disease, 16, 163.
Products: A β-Lg Peptide Released after Koletzko, B., Agostoni, C., Bergmann, R., Ritzenthaler,
Gastrointestinal Digestion of Buffalo Ricotta Cheese K., Shamir, R. (2011). Physiological aspects of
Reduces Oxidative Stress in Intestinal Epithelial human milk lipids and implications for infant
Cells. Int. J. Mol. Sci., 19, 1955. feeding: a workshop report. Acta Paediatrica, 100,
Carocho, M., Morales, P., Ferreira, I. C. F. R. (2018). 1405‒1415.
Antioxidants: Reviewing the chemistry, food Lindmark-Månsson, H., Åkesson, B. (2000).
applications, legislation and role as preservatives. Antioxidative factors in milk. British Journal of
Trends in Food Science & Technology, 71, 107‒120. Nutrition, 84(1), 103‒110.
Cazacu, S., Rotsios, K., Moshonas, G. (2014). Lobo, V., Patil, A., Phatak, A., Chandra, N. (2010). Free
Consumers’ Purchase Intentions towards Water radicals, antioxidants and functional foods: Impact on
Buffalo Milk Products (WBMPs) in the Greater Area human health. Pharmacogn Rev., 4(8), 118‒126.
of Thessaloniki, Greece. Procedia Economics and Mann, S., Shandilya, U. K., Sodhi, M., Kumar, P.,
Finance, 9, 407‒416. Bharti, V. K., Verma, P., Sharma, A., Mohanty, A.,
Coroian, A., Erler, S., Matea, C. T., Miresan, V., Mukesh, M. (2016). Determination of Antioxidant
Raducu, C., Bele, C., Coroian, C. O. (2013). Seasonal Capacity and Free Radical Scavenging Activity of
changes of buffalo colostrum: physicochemical Milk from Native Cows (Bos indicus), Exotic Cows
parameters, fatty acids and cholesterol variation. (Bos taurus), and Riverine Buffaloes (Bubalus
Chemistry Central Journal, 7(40), pp.?? bubalis) Across Different Lactation Stages. Int J.
Diaconescu, A., Săndulescu, D., Nicolae, C. (2002). Dairy Sci. Process. 3(4), 66‒70.
Metode fizico-chimice moderne folosite în analiza Marchis, Z., Odagiu, A., Coroian, A., Oroian, I., Mirza,
laptelui de vacă. Lucrări ştiinţifice. Seria D, XLV, M., Burduhos, P. (2018). Analysis of Environmental
Seria Zootehnie, Bucureşti, 93‒95. Factors’ Impact on Donkeys’ Colostrum Quality.
Diaconescu, S., Nicolae, C. (2013). Tehnologia creşterii Sustainability, 10(9), 2958.
animalelor - ediţie reeditată. Centrul poligrafic Meshref, A. M. S., Moselhy, W. A., Hassan, N. E. H.
USAMV Bucureşti. (2014). Heavy metals and trace elements levels in
EFSA (2009). Cadmium in food. Scientific opinion of the milk and milk products. Journal of Food
Panel on Contaminants in the Food Chain. Measurement and Characterization, 8, 381‒388.
Georgescu, G. (2000). Laptele şi produsele lactate. Moffarts, B., Kirschvink, N., Art, T., Pincemail, J.,
Editura Ceres, Bucureşti. Lekeux, P. (2005). Effect of oral antioxidant
Gond, J., Ni, L., Wang, D., Shi, B., Yan, S. (2014). supplementation on blood antioxidant status in
Effect of dietary organic selenium on milk selenium trained thoroughbred horses. Veterinary Journal,
concentration and antioxidant and immune status in 169(1), 65‒74.
midlactation dairy cows. Livestock Science, 170, Norouzirad, R., Gonzalez-Montaña, J. R., Martinez-
84‒90. Pastor, F., Hosseini, H., Shahrouzian, A.,
Govind, P., Madhuri, S. (2014). Heavy Metals Causing Khabazkhoob, M., Ali Malayeri, F., Moallem
Toxicity in Animals and Fishes. Research Journal of Bandani, H., Paknejad, M., Foroughi-Nia, B., Fooladi
Animal, Veterinary and Fishery Sciences, 2(2), Moghaddam, A. (2018). Lead and cadmium levels in
17‒23. raw bovine milk and dietary risk assessment in areas
Grażyna, C., Hanna, C., Adam, A., Magdalena, B. M. near petroleum extraction industries. Science of Total
(2017). Natural antioxidants in milk and dairy Environment, 635, 308‒314.
products. Int J. Dairy Technol., 70, 165‒178. Park, Y. W., Juarez, M., Ramos, M., Haenlein, G. F. W.
Havemose, M. S., Weisbjerg, M. R., Bredie, W. L. P., (2007). Physico-chemical characteristics of goat and
Poulsen, H. D., Nielsen, J. H. (2006). Oxidative sheep milk. Small Ruminant Research, 68, 88‒113.
Stability of Milk Influenced by Fatty Acids, Pasquini, M., Osimani, A., Tavoletti, S., Moreno, I.,
Antioxidants, and Copper Derived from Feed. J. Clementi, F., Trombetta, M. F. (2018). Trends in the
Dairy Sci., 89, 1970‒1980. quality and hygiene parameters of bulk Italian
191
Mediterranean buffalo (Bubalus bubalis) milk: A peptides derived from casein. J. Nutr. Biochem., 11,
three year study. Anim. Sci J., 89, 176‒185. 128‒131.
Popov, I. N., Lewin, G. (1996). Photochemiluminescent Tunegova, M., Toman, R., Tancin, V. (2016). Heavy
detection of antiradical activity; IV: Testing of lipid metals - environmental contaminants and their
soluble antioxidant. J. Biochem. Biophys. Methods, occurrence in different types of milk. Slovak J. Anim.
31, 1‒8. Sci., 49(3), 122‒131.
Prasad, R., Kamal, S., Sharma, P. K., Oelmüller, R., Virtanen, T., Pihlanto, A., Akkanen, S., Korhonen, H.
Varma, A. (2013). Root endophyte Piriformospora (2006). Development of antioxidant activity in milk
indica DSM 11827 alters plant morphology, whey during fermentation with lactic acid bacteria.
enhances biomass and antioxidant activity of Journal of Applied Microbiology, 102, 106‒115.
medicinal plant Bacopa monniera. J. Basic Wesołowska, M., Dżugan, M. (2017). The Use of the
Microbiol., 53, 1016‒1024. PHOTOCHEM Device in Evaluation of Antioxidant
Samiee, F., Vahidinia, A., Javad, M.T., Leili, M. (2019). Activity of Polish Honey. Food Analytical methods,
Exposure to heavy metals released to the 10(5), 1568‒1574.
environment through breastfeeding: A probabilistic Younus, M., Abbas, T., Zafar, M., Raza, S., Khan, A.,
risk estimation. Science of Total Environment, Saleem, A. H., Idrees, M. A., Nisa, Q. U., Akhtar, R.,
650(2), 3075‒3083. Saleem, G. (2016). Assessment of heavy metal
Shah, N. (2000). Effects of milk-derived bioactives: An contamination in raw milk for human consumption.
overview. British Journal of Nutrition, 84(S1), 3‒10. South African Journal of Animal Science, 46(2), pp.
Sielicka, M., Malecka, M., Purlan, M. (2013). ??
Comparison of the antioxidant capacity of lipid Zhang, T., Ruan, J., Zhang, B., Lu, S., Gao, C., Huang,
soluble compounds in selected cold pressed oils using L., Bai, X., Xie, L., Gui, M., Qiu, R. (2019). Heavy
photochemiluminescence assay (PCL) and DPPH metals in human urine, foods and drinking water
method. Eur. J. Lipid Sci. Technol., 116, 388‒394. from an e-waste dismantling area: Identification of
Silanikove, N., Merin, U., Shapiro, F., Leitner, G. exposure sources and metal-induced health risk.
(2014). Subclinical mastitis in goats is associated Ecotoxicology and Environmental Safety, 169,
with upregulation of nitric oxide-derived oxidative 707‒713.
stress that causes reduction of milk antioxidative Zielinska, D., Szawara-Nowak, D., Michalska, A.
properties and impairment of its quality. Journal of (2007). Antioxidant capacity of thermally-treated
Dairy Science, 97(6), 3449‒3455. buckwheat. Polish Journal of Food and Nutrition
Smet, K., Raes, K., Block, J. D., Herman, L., Sciences, 57(4), pp.??
Dewettinck, K., Coudijzer, K. (2018). A change in Zulueta, A., Maurizi ,A., Frigola, A., Esteve, M. J., Coli,
antioxidative capacity as a measure of onset to R., Burini, G. (2009). Antioxidant capacity of cow
oxidation in pasteurized milk. International Dairy milk, whey and deproteinized milk. International
Journal, 18(5), 520‒530. Dairy Journal, 19(6), 380‒385.
Suetsuna, K., Ukeda, H., Ochi, H. (2000). Isolation and
characterization of free radical scavenging activities
192
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
CHARACTERIZATION OF MERLOT DRY RED WINE COMPOSITION
ACCORDING TO THE YEAR OF PRODUCTION
Camelia RĂDUCU1, Vioara MIREȘAN1, Igori BALTA1, Adina Lia LONGODOR1,
Ștefania MARIS2, Aurelia COROIAN1
1
University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca
Faculty of Animal Science and Biotehnology, Mănăştur Str. 3-5, 400272, Cluj-Napoca, Romania
2
Universitat de Lleida, UDL, Department of Environment and Soil Sciences,
Av. Rovira Roure, 191 25198 Lleida, Spain
Corresponding author email: [email protected]
Abstract
Knowing the physico-chemical composition of the wine allows it to be authenticated and to detect the frauds that can be
encountered in marketed wines. The physico-chemical analysis of wine is the basis for controlling and observing the
technological flow of wine production. It is also necessary to evaluate the organoleptic characteristics of wine as there
is a close link between the sensory characteristics and the chemical composition of the final product. The raw material
and the harvest year significantly influence the final composition of the wine. The temperature and precipitations of the
raw material harvest year significantly influence the chemical composition of the wine. Tartaric acid varies between
2.51 ± 0.05 and 2.82 ± 0.04 for red Merlot dry wines. The mean values for malic acid are between 1.01 ± 0.04 and 1.57
± 0.03. The average citric acid values range from 0.19 ± 0.01 to 0.24 ± 0.01 for red Merlot dry wines. These values
correspond to the average values reported by other authors in the literature. The purpose of this study was to
characterize the content of tartaric, malic, citric and lactic acid in dry red Merlot wine, as well as sensory and physico-
chemical properties according to the year of production.
Key words: Merlot red wine, malic acid, acidity, pH.
INTRODUCTION groups of phenolic substances and
anthocyanins for the achievement of the desired
Wine is an alcoholic beverage obtained color, preventing their oxidation, and excessive
exclusively from total or partial alcoholic astringency (Shirahigue et al., 2010; Francesca
fermentation of crushed fresh grapes or grape et al., 2014). One of the essential factors
must and continues to surprise consumers with determining the specificity of red wines is the
its incredible flavors and aromas. Making wine accumulation of phenolic compounds formed in
is a long and laborious process in which the the grape berries which are undergoing
total efficiency of all technological operations biochemical changes in the processing of wine
ultimately determines the quality and price of raw materials. Phenolic compounds play an
the finished products. In recent years, the important role in the addition of the
popularity of red wine consumption has organoleptic properties of various foods
increased worldwide. Due to the increased (Cheynier et al., 2012). They are contributing
content of phenolic compounds, primarily to bitter and astringent properties to the taste of
anthocyanins, leuco-anthocyanins, flavonols fruits and fruit juices, due to the interaction of
(quercetin) and flavan-3-ols (catechin and phenolic substances mainly procyanidins and
epicatechin) red wines are characterized by a glycoproteins. As well, these compounds are
high biological value (Liu et al., 2018; Motilva the main substances that can attribute the color
et al., 2016). Consumers demands for red wine differences in wines, juices, and products made
quality the necessity of continuous from fruits and vegetables (Liu et al., 2018).
improvement of technological processes of Most of the components of the phenolic
wine production. Specifically, control of complex from grapes and wine belong to the
extraction processes is required in order to group of biologically active substances, making
extract optimal amounts of coloring and other red wines increasingly used to treat numerous
193
diseases (Giacosa et al., 2013; Biasi et al., reduced acidities, due to phenolic compounds
2014; Tresserra et al., 2015). Grape-derived that have the potential to increase acidity, and
polyphenols are possessing cytoprotective also play role in wine maintaining during the
properties and antioxidant properties, thereby aging processes (Kučerová et al., 2011).
effectively binding free radicals and preventing Therefore, the aims of this study were to
from the diseases such as the risk of evaluate the content of organic acids in Merlot
cardiovascular disease, metabolic disorders and dried wine, as well as sensory and
certain types of cancers (Jiang et al., 2019; physicochemical parameters.
Zadnipryany et al., 2017; Agouni et al., 2017;
Biasi et al., 2014). Moreover, polyphenols from MATERIALS AND METHODS
red wine possess a significant anti-
inflammatory action protecting the intestinal Wine description
barrier integrity (Nunes et al., 2019). For most Commercially Merlot wines from Asconi
popular Merlot and Cabernet Sauvignon wines winery were used in the present study. Asconi
the total flavonoid, phenolic, and anthocyanin company owns about 500 hectares of vineyards
content are increasing with the high-altitude. located near Geamana village, in the county of
Also, that content is varying due to such factors Anenii Noi, Moldova. Cultivated varieties of
as climate and soil conditions (Jiang et al., grapes are Merlot, Cabernet Sauvignon,
2019; Jin et al., 2017). Another significantly Sauvignon Blanc, Chardonnay and Muscat
important characteristics of wines are pH, Brix Ottonel and so on. Grapes are harvested only
and the acid composition also known as manually, which prevents the fall of leaves or
titratable acidity (TA) composed of acids such pieces of a vine in the buckets. Moreover, only
as lactic, citric, malic and tartaric acids. An matured grapes are harvested. In addition,
improper harvest treatment can negatively wines produced in particular harvest year
influence these parameters (Casassa et al., which have benefited from favorable climatic
2019). According to (Casassa et al., 2013), Brix conditions have special qualities that are highly
from Merlot grapes presented means between appreciated by consumers but are also reflected
(20.18 and 24.9) and pH showed variations in the terms of marketing price.
between (3.17 and 3.70), respectively.
Organoleptic characteristics of the wine are Wine analysis
strongly correlated with organic acids and Merlot red wine samples were collected
sugars (Coelho et al., 2017). Unwanted according to the year of production (2013-
quantities of sugars and organic acids presented 2017). A number of 10 samples were used for
in grape must or wine can have a negative each year. FOSS Wine Scanner device that
influence on the taste and Bouquet balance of measures many parameters of grape must and
beverage (Silva et al., 2014). Acetic acid and wine, based on Fourier Transform Infrared
butyric acid presence in wines can be a (FTIR) technology to scan a sample of liquid
precursor of undesirable microbiological (sample - 50 ml). The measurement results are
alterations that affect the quality of the final obtained in only 30 seconds, analysing critical
product (Lima et al., 2014; Kučerová et al., quality control variables. The analyser is
2011). Tang et al. (2013) demonstrated connected to a computer, for data
cardioprotective effects of malic and citric interpretation. Facilities regarding software
acids on myocardial ischemia, due to anti- platform allow improved parameter control by
inflammatory and antiplatelet aggregation measuring and monitoring the results in
properties of organic acids. Total amounts of documents. Final test results help to define the
malic and tartaric acids can consist of <80% of strategy for the next harvest.
the overall amount of acids in grape berries and
must. In addition, concentrations of the acids RESULTS AND DISCUSSIONS
may be different because of factors such as
level of maturation, the variety of grapes, Wine is not only rich in alcohol but is also rich
climate and so forth (Coelho et al., 2017). in content of acids. Acids in wine are arising
Interestingly to the fact that red wines can resist from grapes as a result of alcoholic
194
fermentation as a by-product or as a result of parameters are consistent with other studies
the treatments, operations of wine caring and (Casassa et al., 2013; Jin et al., 2017; Jiang et
clarifying. Grapes derived acids such as (acidic al., 2012; Casassa et al., 2019).
acid, malic acid) have the highest contribution,
therefore it is said that acidity of the wine is Ph
born in grape must (Ţârdea et al., 2007; 3,6
3,56 3,55
Gheorghita et al., 2002; 2006; Bulancea et al., 3,55
3,49
2009). Table 1 and Table 2 shows the mean 3,5
3,44
values for the main analyzed acids in high 3,45 3,41
quality Merlot red wine. 3,4
3,35
Table 1. Content in tartaric and malic acid in red Merlot
3,3
dry wine - superior quality according to year of
production 2013 2014 2015 2016 2017
Tartaric acid Malic acid Figure 1. Average pH values for red Merlot red SQ wine
Year X±sx V% X±sx V%
2017 2.60±0.11 1.3 1.18±0.15 1.22 Color intensity
2,5
2,17 2,01
2016 2.51±0.05 4.79 1.28±0.06 1.58
2
2015 2.44±0.06 5.27 1.01±0.04 1.94 1,5 1,25
0,78
2014 2.61±0.05 4.30 1.11±0.17 4.81 1
0,25
2013 2.82±0.04 3.32 1.57±0.03 4.29 0,5
(n = 5; sx - standard deviation; V- variability; X - average value) 0
2013 2014 2015 2016 2017
Table 2. Merlot dry red wine content Figure 2. Color intensity for red Merlot red SQ wine
of citric and lactic acid
Citric acid Lactic acid 7 6,4 Total Acidity 6,1
6 5,5 5,7
X±sx V% X±sx V% 5,3
0.23±0.02 1.19 0.30±0.01 1.31 5
0.19±0.01 4.23 0.33±0.01 3.63 4
3
0.24±0.01 2.03 0.32±0.02 3.20
2
0.21±0.02 3.04 0.39±0.02 5.37
1
0.24±0.01 2.29 0.38±0.03 6.32
0
(n = 5; sx- standard deviation; V- variability; X - average value) 2013 2014 2015 2016 2017
Figure 3. Mean values for total acidity for Merlot red dry
Tartaric acid in analyzed samples varies wine SQ
between (2.51 ± 0.05) and (2.82 ± 0.04). The
mean values for malic acid are between (1.01 ± Total acidity is the acidity determined by
0.04) and (1.57 ± 0.03). neutralizing acidic functions with a known
The average values for citric acid are between concentration of (NaOH) solution (alkaline).
(0.19 ± 0.01) and (0.24 ± 0.01). These values For this reason, it is also called titratable acidity
correspond to the average values reported by (TA). The end of dosing is also currently
other authors in the literature (Casassa et al., appreciated by a color indicator, such as
2019; Peres et al., 2009). bromothymol blue, which turns to pH = 7 or
Figures 1-3 show average values for pH, color phenolphthalein, which turns to pH = 9 (Țârdea
intensity and total acidity in superior Merlot et al., 2007; Gheorghiţă et al., 2002, 2006;
dry red wine, depending on the year of Bulancea et al., 2009). According to
production. The values presented for these (Petropulos et al., 2015) chemical composition
195
of Macedonian red wines (Merlot) total acidity (61.2 ± 2.0) in meq l-1, pH of 3.57
demonstrated a total acidity of (5.6-6.0) g/l, and and sugar content (221.5±1.9) g l-1
color intensity values as it follows (11.41, (GonzálezǦNeves et al., 2015). Jiang et al.
12.35, 21.08, and 24.20) in accordance to (OIV (2012) compared general composition of
2014). In addition, another study revealed that Merlot wine and musts from different regions
Macedonian merlot wines can exert maximum of China, founding out that titratable acidity for
antioxidant activity as a consequence of longer wine varied from 6.7 to 8.3 g/l with a pH from
exposure to grape pomace (Kostadinović et al., 3.0 to 3.6 and for the must, 6.9 and 8.9 g/l, with
2012). Total acidity in organic and 3.0 and 3.3 pH, respectively. In addition, a
conventional Merlot wines from different recent study regarding the chemical
regions of Italy, according to (Garaguso et al., composition of Merlot grapes from China,
2015) comprised means between 6.19 and 5.74 presented values for titratable acidity varying
g/l, respectively. Organic acid concentrations from 6.7 to 8.3 g/l having a pH from 3.0 to 3.6.
for Brazilian Merlot wine for tartaric, malic, Additionally, tartaric acid of Cabernet
lactic and acetic acid presented values between Sauvignon grapes was differing (from 6.3 to
(1495 ± 6), (2243 ± 23), (35 ± 4) and (269 ± 7.3), depending on the region of China (Jiang et
20) (mg/l), respectively. Moreover, Merlot red al., 2019). Recently (Casassa et al., 2019),
from 2001, showed increased values of lactic performed a physicochemical analysis on
acid (7306 ± 35) and acetic acid (671 ± 13) Merlot wines from Argentina, using three
(mg/l), using a capillary electrophoresis method different harvests of grapes (from 3 Feb., 27
(Peres et al., 2009). Regarding, Merlot grape Feb., and 29 Mar.). Wines made from the first
chemistry content by (Casassa et al., 2013) they harvest showed a pH of 3.43 ± 0.09, titratable
found out tartaric acid differences between the acidity 5.57 ± 0.03, tartaric acid 2.32 ± 0.03,
maturity levels during 2011 and 2012. Early citric acid 0.31 ± 0.05, malic acid 0.50 ± 0.06
harvested grapes from 2011 and 2012 season and lactic acid contents of 1.53 ± 0.03,
presented significantly higher levels of tartaric measurements units where expressed in g/l.
acid with the values range of 7.66 and 8.14 g/l. Second harvest obtained wines presented a pH
Later berries harvests showed lower values, of 3.60 ± 0.07, TA 5.53 ± 0.17, tartaric acid
5.69 and 6.37 g/l, respectively. Also, the pH of 1.73 ± 0.10, citric acid 0.37 ± 0.05, malic acid
earlier season grapes from 2011 and 2012 0.93 ± 0.06, and lactic acid 1.49 ± 0.06.
showed values of 3.47 and 3.17, followed by Beverages obtained third harvest (29 Mar.),
late harvest berries with the values between demonstrated a pH of 3.58 ± 0.09, TA (5.08 ±
3.70 and 3.66. Furthermore, Merlot wines from 0.12) was significantly lower compared to
2011 and presented values of tartaric acid, pH, previous harvests, tartaric acid (2.11 ± 0.06),
malic acid and lactic acid as follows: 5.31 and citric acids presented a significantly decrease
5.75 g/l, 3.73 and 3.47, 39 and 27 mg/l, 0.84 (0.05 ± 0.02), malic acid (0.50 ± 0.11) and a
and 0.97 g/l, respectively. In addition, extended slight decline in lactic acid content (1.33 ±
maceration of Merlot wines presented tartaric 0.03) (g/l) compared to the first and second
acid content of 5.55 g/l with the pH 3.63, malic harvests was observed, respectively. Altogether,
acid concentration of 39 mg/L and lactic acid our results provide some useful information on
0.92 g/l. (Casassa et al., 2013) find similar high-quality Merlot wine production.
results when they finished Merlot red wines at
bottling presenting average values of titratable CONCLUSIONS
acidity between 5.4-5.6 g/l tartaric acid, with
pH 3.76-3.82, malic acid and lactic acid, 0.10- In conclusion, obtained results showed that
0.13 g/l and 1.26-1.53 g/l, respectively. these wine varieties fall below the maximum
According to Jin et al. (2017), red Merlot wines admissible limit for parameters such as total
from Northern China regions presented values acidity, and pH indicating that these wines are
of tartaric acid with a range between 5.38-6.44 of superior quality. Thus, the year of
g/l, with a pH 3.48-3.30 and color intensity of production influences the chemical
7.9-9.4 AU (absorbance unit). Merlot grapes composition, namely the total acidity, and the
composition obtained from Uruguay showed physicochemical composition of wines.
196
REFERENCES Tannat, Syrah and Merlot made using maceration
enzymes and cold soak. Int. J. Food Sci. Technol., 51,
Agouni, A., Mostefai, H. A., Lagrue, A. H., Sladkova, 260‒267.
M., Rouet, P., Desmoulin, F., Pechanova, O., Jiang, B., Zhang, Z. W. (2012). Comparison on Phenolic
Martinez, M. C., Andriantsitohaina, R. (2017). Compounds and Antioxidant Properties of Cabernet
Paradoxical Effect of Nonalcoholic Red Wine Sauvignon and Merlot Wines from Four Wine Grape-
Polyphenol Extract, Provinols™, in the Regulation of Growing Regions in China. Molecules, 17(8),
Cyclooxygenases in Vessels from Zucker Fatty Rats 8804‒8821.
(fa/fa), Oxidative Medicine and Cellular Longevity, Jiang, B., Zhang, Z. W. (2019). Free Radical-scavenging
1-12. Activity and Anthocyanin Profiles of Cabernet
Biasi, F., Deiana, M., Guina, T., Gamba, P., Sauvignon and Merlot Wines from Four Wine
Leonarduzzi, G., Poli, G. (2014). Wine consumption Grapegrowing Regions in China. S. Afr. J. Enol.
and intestinal redox homeostasis. Redox Biology, 2, Vitic., 40(1).
795-802. Jin, X. D., Wu, X., Liu, X. (2017). Phenolic
Bulancea, M., Râpeanu, G. (2009). Autentificarea și characteristics and antioxidant activity of Merlot and
identificarea falsificărilor produselor alimentare. Cabernet Sauvignon wines increase with vineyard
Editura Didactică și Pedagogică R.A., București. altitude in a high-altitude region. S. Afr. J. Enol.
Casassa, L. F., Beaver, C. W., Mireles, M. S., Vitic., 38(2), 132‒143.
Harbertson, J. F. (2013). Effect of extended Kostadinović, S, Wilkens, A., Stefova, M., Ivanova, V.,
maceration and ethanol concentration on the Vojnoski, B., Mirhosseini, H., Winterhalter, P.
extraction and evolution of phenolics, colour (2012). Stilbene levels and antioxidant activity of
components and sensory attributes of Merlot wines. Vranec and Merlot wines from Macedonia: Effect of
Australian Journal of Grape and Wine Research, 19, variety and enological practices. Food Chemistry,
25‒39. 135(4), 3003‒3009.
Casassa, L. F., Beaver, C. W., Mireles, M., Larsen, R. C., Kučerová J., Široký J. (2011). Study of changes organic
Hopfer, H., Heymann, H., Harbertson, J. F. (2013). acids in red wines during malolactic fermentation.
Influence of Fruit Maturity, Maceration Length, and Acta Universitatis Agriculturae et Silviculturae
Ethanol Amount on Chemical and Sensory Properties Mendelianae Brunensis, 59(5), 145‒150.
of Merlot Wines. Am. J. Enol. Vitic., 64, 437‒449. Lima, M. D. S., Silani, I. D. S. V., Toaldo, I. M., Correa,
Casassa, L. F., Sari, S. E., Bolcato, E. A., Fanzone, M. L. L. C., Biasoto, A. C. T., Pereira, G. E., Luiz, M. T.
(2019). Microwave-Assisted Extraction Applied to B., Ninow, J. L. (2014). Phenolic compounds,
Merlot Grapes with Contrasting Maturity Levels: organic acids and antioxidant activity of grape juices
Effects on Phenolic Chemistry and Wine Color. produced from new Brazilian varieties planted in the
Fermentation, 5(1), 15. Northeast Region of Brazil. Food Chemistry, 161,
Coelho, E. M., Padilha, C. V. D. S., Miskinis, G. A., 94‒103.
Barroso, A. G., Pereira, G. E., Azevedo, L. C., Lima, Liu, Y., Yan, J., Li, Q., Wang, J., Shi, Y. (2018). Effect
M. D. S. (2018). Simultaneous analysis of sugars and of Training Systems on Accumulation of Flavan-3-
organic acids in wine and grape juices by HPLC: ols in Cabernet Sauvignon Grape Seeds at the North
Method validation and characterization of products Foot of Mt. Tianshan. S. Afr. J. Enol. Vitic., 39(1).
from northeast Brazil. Journal of Food Composition Motilva, M. J., Macià, A., Romero, M. P., Rubió, L.,
and Analysis, 66, 160‒167. Mercader, M., Ferrero, C. G. (2016). Human
Garaguso, I., Nardini, M. (2015). Polyphenols content, bioavailability and metabolism of phenolic
phenolics profile and antioxidant activity of organic compounds from red wine enriched with free or
red wines produced without sulfur dioxide/sulfites nano-encapsulated phenolic extract. Journal of
addition in comparison to conventional red wines. Functional Foods, 25, 80‒93.
Food Chemistry, 179, 336‒342. Nicola, F., Romano, R., Sannino, C., Grottaglie, L. L.,
Gheorghiță, M., Băducă, C. C., Muntean, C., Giugea, N. Settanni, L., Moschetti, G. (2014). Evolution of
(2002). Oenologie, Vol. II, Obținerea, păstrarea și microbiological and chemical parameters during red
condiționarea produselor vinicole. Editura Sitech, wine making with extended post-fermentation
Craiova. maceration. International Journal of Food
Gheorghiță, M., Băducă, C. C., Muntean, C., Giugea, N. Microbiology, 171, 84‒93.
(2006). Oenologie, Vol. I, Bazele Industriei vinicole. Nunes, C., Freitas, V., Almeida, L., Laranjinha, J.
Editura Sitech, Craiova. (2019). Red wine extract preserves tight junctions in
Giacosa, A., Barale, R., Bavaresco, L., Gatenby, P., intestinal epithelial cells under inflammatory
Gerbi, V., Janssens, J., Johnston, B., Kas, K., La conditions: implications for intestinal inflammation.
Vecchia, C., Mainguet, P., Morazzoni, P., Negri, E., Food Funct Journal.
Pelucchi, C., Pezzotti, M., Rondanelli, M. (2013). OIV (2014). International Organization of Vine and
Cancer prevention in Europe: The Mediterranean diet Wine. Compendium of International Methods of
as a protective choice. European Journal of Cancer Analysis of Wines and Musts 1.
Prevention, 22(1), 90‒95. Peres, R. G., Moraes, E. P., Micke, G. A., Tonin, F. G.,
González Neves, G., Favre, G., Piccardo, D., Gil, G. Tavares, M. F. M., Rodriguez-Amaya, D. B. (2009).
(2015). Anthocyanin profile of young red wines of Rapid method for the determination of organic acids
197
in wine by capillary electrophoresis with indirect UV Effects of Citric Acid and L-Malic Acid on
detection. Food Control, 20(6), 548-‒552. Myocardial Ischemia/Reperfusion Injury. Evidence-
Petropulos, V. I., Ricci, A., Nedelkovski, D., Dimovska, Based Complementary and Alternative Medicine, 11.
V., Parpinello, G. P., Versari, A. (2015). Targeted Țârdea, C., Sârbu, G., Țârdea, A. (2000). Tratat de
analysis of bioactive phenolic compounds and vinificație. Editura “Ion Ionescu de la Brad”, Iași.
antioxidant activity of Macedonian red wines. Food Tresserra-Rimbau, A., Medina-Remón, A., Lamuela-
Chemistry, 171, 412‒420. Raventós, R., Bulló, M., Salas-Salvadó, J., Corella,
Shirahigue, L. D., Plata Oviedo, M., De Alencar, S. M., D., Estruch, R. (2015). Moderate red wine
D’Arce, M. A., De Souza Vieira, T. M., Oldoni, T. consumption is associated with a lower prevalence of
L., Contreras Castillo, C. J. (2010). Wine industry the metabolic syndrome in the PREDIMED
residue as antioxidant in cooked chicken meat. population. British Journal of Nutrition, 113(2),
International Journal of Food Science and 121‒130.
Technology, 45, 863‒870. Veronique, C. (2012). Phenolic compounds: from plants
Silva, F. L. N., Schmidt, E. M., Messias, C. L., Eberlin, to foods. Phytochemistry Reviews, 11(2-3).
M. C., Sawaya, A. C. H. F. (2015). Quantitation of Zadnipryany, I. V., Sataieva, T. P., Tretiakova, O. S.,
organic acids in wine and grapes by direct infusion Kubyshkin, A. V., Zukow, V. (2017). Grape
electrospray ionization mass spectrometry. Royal polyphenols concentrate demonstrates
Society of Chemistry, Anal. Methods, 7, 53‒62. cardioprotection in terms of hypoxic myocardial
Tang, X., Liu, J., Dong, W., Li, P., Li, L., Lin, C., Zhen, injury. Russian Open Medical Journal, 6(4).
Y., Hou, J., Li, D. (2013). The Cardioprotective
198
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
AN OVERVIEW ON HUMAN POTENTIAL EXPOSURE TO
BISPHENOL A FROM FOOD-CONTACT MATERIALS USED IN FRUITS
PACKAGING AND PROCESSING
Elena UNGUREANU1, 2, Gabriel MUSTĂȚEA2, Mona Elena POPA1
1
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mărăşti Blvd.,
District 1, Bucharest, Romania
2
National Research and Development Institute for Food Bioresources, 6 Dinu Vintilă Street,
Bucharest, Romania
Corresponding author email: [email protected]
Abstract
Food contamination during the migration process from food contact materials is an important food safety issue and
many researches are focused on this topic in the last decades.
Bisphenol A is a hazardous chemical compound used as intermediate in the production of polycarbonate-based
materials and epoxy resins, used to obtain plastic food containers for packaging and storage, but also for inner surface
coatings of cans. Through contaminated products, this compound can reach the human body where it causes a number
of adverse health effects. As a result of this consumption, Bisphenol A can cause diseases of the cardiovascular system,
endocrine system, reproductive system, metabolic system. The aim of this review was to investigate Bisphenol A levels
from worldwide fruits and fruits products, fresh or processed, packed in different food contact materials. Despite the
fact that the values found in the literature are not high, it poses a risk to human health because it can accumulate in the
body. To prevent this hazard, the European Food Safety Authority recommended a tolerable daily intake (TDI) of 50
µg/kg body weight/day. As a conclusion the authors try to investigate differences between canned and non-canned fruit
products and to establish which material can leach more Bisphenol A and what factors influence this process.
Key words: Bisphenol A, exposure, fruits, human health.
INTRODUCTION or organs (Zielinska et al., 2019) associated
with a number of side effects.
Bisphenol A, BPA, is a chemical compound The aim of this review is to summarize, on the
used as an additive in the process of obtaining basis of literature, the level of BPA
polycarbonate plastics and epoxy resins with contamination of worldwide fruits, both fresh
estrogenic activity, being a known endocrine and processed, as well as products derived
disrupter (Chouhan et al., 2014). Estrogenic therefrom, but also a number of side effects that
endocrine disruptors are exogenous chemicals may occur as a result of the ingestion of this
that mimic or antagonize the effect of compound.
estrogenic hormones (Posnack, 2014).
People are exposed to this compound mainly by BISPHENOL A EFFECTS ON HUMAN
eating food contaminated with this compound HEALTH
which is able to migrate from food packaging
materials in food products under certain time, Studies have shown that BPA can bind to
temperature and pH conditions, but there may estrogen receptors, act as an anti-estrogen and
be other sources of exposure such as air, dust, block their activity. It can also bind to the
contaminated surface water (Michalowicz, receptors of the thyroid gland, perturbing its
2014). function, and other organs and systems in the
BPA entered in the body by ingestion, body (cardiovascular system, endocrine system,
inhalation or dermal contact (Rochester et al., nervous system) (Rochester et al., 2013).
2013) may undergo bioaccumulation and Regarding the reproductive system, it has been
bioconcentration processes in different tissues observed that BPA can affect the reproduction
function (Muhamad et al., 2016; Li et al.,
199
2010), reduces sperm quality (decrease in legislation, as well as a daily intake value
sperm count, changes in morphology and (TDI).
motility) (Li et al., 2011), can lead to polycystic In the European Union, the use of this
ovarian syndrome (PCOS) (Muhamad et al., compound has been regulated for the first time
2016), decreases fertility (decreases the number by EC Directive no. 90/128, where the specific
of mature oocytes) (Ehrlich et al., 2012), and migration limit for this compound was 3
affects prostate function and morphology (Tang mg/kg, later reduced to 0.6 mg/kg (EC
et al., 2012). Directive No 72/2002). Regulation 10/2011
Increased levels of BPA in the body could also replacing Directive No. 72/2002, maintained
be related to a number of metabolic disorders this value of 0.6 mg/kg until 2018, when
such as increased incidence of obesity cases through EU Regulation No. 213/2018, which is
(Muhamad et al., 2016) and type 2 diabetes an amendment to EU Regulation No 10/2011,
(Kim et al., 2013). Concerning the effects of the value was reduced to 0.05 mg/kg.
BPA on pancreatic cells, studies have At the same time, during the years, tolerable
suggested that this compound produces insulin daily intake has undergone significant changes.
resistance (Almeida et al., 2018). Also, some If in 1986 the TDI was 0.05 mg/kg of body
correlations have been established between weight/day (Scientific Committee for Food,
high levels of serum BPA and elevated LDL 1986), in 2002 this was 0.01 mg/kg of body
and HDL cholesterol levels (Olsen et al., 2012). weight/day (Scientific Committee for Food,
Experimental studies demonstrated its 2002). In 2006, in an EFSA report, TDI
association with altered liver or thyroid increased to 0.05 mg/kg of body weight/day
function (Muhamad et al., 2016). On the (EFSA, 2006). Between 2006 and 2015, this
cardiovascular system it has been shown to value remained constant, and in 2015 this value
increase the risk of cardiovascular disease such would fall to 0.004 mg/kg of body weight/day,
as heart attack, hypertension or angina pectoris a value that has remained unchanged to date
(Almeida et al., 2018) when exposed to BPA. (EFSA, 2015).
Exposure of the body to low doses of BPA may Another regulation on BPA across the
also result in cardiovascular system European Union was to prohibit its use in
dysfunctions such as cardiac arrhythmia, articles for infants and young children
increased blood pressure, atherosclerosis, and a (Directive No 8/2011) because it produces
negative impact on ventricular contractility and different behavioural or developmental
intracellular calcium circulation (Poscnack et disorders, and because this category is one of
al., 2014b). Also, high levels of BPA in the the most sensitive and vulnerable categories of
body could be correlated with increased the population (Almeida et al., 2018).
myocardial infarction (Patel et al., 2015). The first countries that renounced the use of
High levels of this compound in blood or urine this compound in packages for infants and
could also be correlated with other side effects, children up to 3 years were Denmark and
such as premature birth (Cantonwine et al., Austria in 2011, Belgium and France in 2012,
2010), lower birth weight (Chou et al., 2011), and Sweden in 2013 (Ludwicka et al., 2015;
impaired immune function, the ability to Boudalia & Oudir, 2016; Almeida et al., 2018).
produce oxidative stress and inflammatory In countries like Algeria, BPA is an unknown
processes, effects on the expression of genes substance, with no known health effects, and
(Muhamad et al., 2016) and DNA stability this is why there is no legislation on this
(Almeida et al., 2018). compound (Boudalia & Oudir, 2016).
LEGISLATION ON BISPHENOL A BPA IN FRUIT AND FRUITS PRODUCTS
MIGRATION
As it can be seen in Table 1, the literature
To reduce the risk of ingestion of this review shows that the highest values of BPA
compound from food packed in different were obtained in canned samples because these
materials, a specific BPA migration limit for food products are the most exposed to BPA
plastics has been imposed by European which is mostly present in coating lakes
200
Table 1. Bisphenol A concentrations in fruit and fruit products
Food category Origin/commercial area Packaging Range Method Reference
Citrus, apple, strawberry Florida Fresh fruit 2.0 ± 1.4 – 9.0 ± 4.9 μg/kg GC-MS/MS Lu et al., 2013
Apple, pear, pitaya Hetey Fresh fruit 1.056 - 2.35 µg/kg DSMIP-SPE- HPLC Li et al., 2014
Fruit mix, Peaches, Pears Belgium Can 10.1 - 20 ng/g in content SPE-SIM-GC-MS Geens et al., 2010
6.4 - 14.3 ng/ml in syrup
Pineapple, apple sauce Belgium Glass 0.3 - 1.28 ng/g SPE-SIM-GC-MS Geens et al., 2010
Pineapple Belgium plastic 0.11 ng/g SPE-SIM-GC-MS Geens et al., 2010
Apple sauce, Orange juice, tropical juice Belgium can 0.2 - 4.73ng/g SPE-SIM-GC-MS Geens et al., 2010
Fruit and vegetables juice Belgium PET <0.02 ng/ml SPE-SIM-GC-MS Geens et al., 2010
Apple juice Belgium Tetra Pak <0.02 ng/ml SPE-SIM-GC-MS Geens et al., 2010
Pineapple, peaches Spain canned < 2.9 - 13 ± 1 µg/kg HPLC/FLD Alabi et al., 2014
Pineapple, Organic pineapple, Almond jelly, Sliced SUA canned < 2 - 19 ng/g HPLC-MS/MS Noonan et al., 2011
peaches, Fruit cocktail
Fresh peach, Fruit and vegetable juice Texas Non-canned 0.24 - 0.41 ng/g LLE- HRGC/LRMS Lorber et al., 2015
Oranges, peach slices Texas canned 0.31 - 2.03 ng/g LLE- HRGC/LRMS Lorber et al., 2015
Passion fruit pulp, Mango pulp, Papaya in syrup, Pears Thailand, Indonesia, canned < 1.0 - 10.2 µg/kg QuEChER-DLLME-GC/MS Cunha and Fernandes, 2013
in syrup, Mango in syrup, Pineapple in syrup, Peach in Kenia, European Union
syrup, Fruit cocktail in light syrup
Fruits and vegetables Thailand canned <0.0015 - 0.0087 mg/kg GC-MS Poovarodom et al., 2017
Walnuts, chestnuts, jujubes, plums, hawthorn, raisins China - < 0.01 - 132 ng/g HPLC – MS/MS Liao, 2014
Tropical fruits, Apple in syrup, Mandarin in syrup, Thailand, China, canned < 1 - 200 ng/g GC – MS Kawamura, 2014
Mango in syrup, Pineapple in syrup, Peach in syrup, Indonesia, Tokyo
Grape juice, Cocktail fruits, Coconut milk, Apple juice
201
Pineapple in syrup, Peach in syrup Iran canned 3.7 ± 0.3 - 7.7 ± 0.8 SPE-DLLME-SFO-HPLC Sadeghi et al., 2016
Pineapple chunks in pineapple juice, Apple juice from Texas can < 0.20 - 0.49 ng/g LLE-HRGC/LRMS Schecter et al., 2010
concentrate
Organic cinnamon apple sauce Texas plastic < 0.20 ng/g LLE-HRGC/LRMS Schecter et al., 2010
Fruit juice, Peach juice Mahdia Cardboard box with plastic < 0.002 mg/kg UPLC-MS/MS Beltifa et al., 2017
cap and metal foil
Orangeade Dongguan, China can 6.16 ± 0.13 µg/L UA-ULME-MSD Mo et al., 2017
Orangeade Dongguan, China Plastic bottle < 1.10 µg/L UA-ULME-MSD Mo et al., 2017
Nectar juice, cocktail, guava Egypt Tetrapak, aluminium pouch 2,23 - 26,4 ng/ml HPLC El-Dars et al., 2018
Pomegranates fresh juice, mango juice drink, Egypt plastic 0.46 - 82.97 ng/ml HPLC El-Dars et al., 2018
strawberry jam, fig jam
Jam Norway Glass with plastic or metal 0.38 µg/kg SPE-UPLC–MS/MS Sakhi, 2014
cap
Juice Norway Cardboard box with plastic < 0.020 µg/kg SPE-UPLC–MS/MS Sakhi, 2014
cap and metal foil
GC-MS/MS – Gas-chromatography tandem mass spectrometry; DSMIP-SPE-HPLC – Dummy surface molecularly imprinted polymer - solid - phase extraction - high performance liquid chromatography; LLE-
HRGC/LRMS – Liquid/liquid extraction - High Resolution Gas Chromatography/Low Resolution Mass Spectrometry; HPLC/FLD - High Performance Liquid Chromatography with Fluorescence Detection; HPLC-MS/MS -
High Performance Liquid Chromatography tandem mass spectrometry; UPLC-MS/MS - ultra performance liquid chromatography tandem mass spectrometry; SPE-DLLME-SFO-HPLC - Solid-Phase Extraction–Dispersive
Liquid-Liquid Microextraction - Solidification of Floating Organic Drop - high-performance liquid chromatography; SPE-UPLC–MS/MS - solid phase extraction - ultra performance liquid chromatography - tandem mass
spectrometry; HPLC - High Performance Liquid Chromatography; UA-ULME-MSD - Ultrasound-assisted upper microextraction and molecular fluorescence detection; QuEChER-DLLME-GC/MS -
ǦDispersive Liquid–Liquid Microextraction – gas-chromatography mass spectrometry.
(Michalowicz, 2014). This may be mainly due between the food product and the lid is
to the sterilization process and storage occasional, by shaking the packaging during
conditions. Studies have shown that for cans, handling, transport or inadequate storage (Cao
between 80-100% of the compounds present in et al., 2011; Almeida et al., 2018).
the coating lakes can migrate during In case of tetra Pak or cardboard boxes
sterilization (Almeida et al., 2018). laminated on the inside with plastic foil and
This process is also influenced by the plastic cap, the possibility of contamination of
composition of the packaged product, so that in products with BPA is lower. For this type of
products high in sugar, vegetable oils (corn, packaging, the values obtained for this
soybean, olive oil) or salt, the BPA values compound in the product were below the
found in the product were significant (Almeida detection limit of the apparatus (Table 1)
et al., 2018; Sungur et al., 2014). (Geens et al., 2010; Sakhi, 2014)Ǥ Also, when
Differences in BPA content from the same packaged products are kept in proper
product type but from different lots were conditions, the migration of BPA from food
observed (Sungur et al., 2014), because contact materials takes place at a much lower
changes in the composition of can coatings may rate and the concentration found in products are
occur (Almeida et al., 2018; Noonan et al., insignificant and do not represent a danger to
2011). human health (Almeida et al., 2018).
The migration process is also influenced by the
type of product packaged, so in the case of CONCLUSIONS
foods containing solid and liquid fractions,
syrup for example, BPA can migrate in both From this literature review, it was concluded,
components, but especially in the solid fraction that through packaging, food products are
(Geens et al., 2010; Noonan et al., 2011; predisposed to chemical contamination with a
Almeida et al., 2018). multitude of compounds, among which
In the case of plastic packaging, this compound bisphenol A occupies an important place.
can migrate from packages through two Out of the packaging materials used in the food
different processes: diffusion of residual BPA industry, it can be stated that food packed in
resulted from the manufacturing process of cans is more susceptible to be chemically
packages or hydrolysis of polymers containing contaminated with BPA, when compared to the
ester bonds (Aschberger et al., 2010; Hoekstra rest of the packaging materials. This fact is due
et al., 2013; Ludwicka et al., 2015). to a large number of factors related to the
For food packaged in polycarbonate plastics, technology of cans manufacturing (type and
the migration process is amplified over time quality of inner coatings - epoxy-phenolic
due to the hydrolysis of polymers in the resins, polyvinyl chloride organosol resins)
packaging material, while for reusable plastics (Poovarodom et al., 2017), the temperature to
the migration process tends to stabilize which the food is subjected, or composition of
(Almeida et al., 2018). the food products (pH, salt content, sugar)
From the factors that can influence the (Sungur et al., 2014).
migration of BPA from plastic materials, As a preventive measure to reduce this type of
temperature is the main one, so by exposing the contamination, the inner coatings could be
material to about 100°C, the migration rate can replaced with materials that don’t contain BPA
be up to 55 times higher than exposure of the and have better resistance to different
same type of material at temperatures of 20°C processing temperatures.
(Le, 2015; Almeida et al., 2018).
Also, in Table 1, it can be seen that for ACKNOWLEDGEMENTS
products packed in glass jars with a lid, the
values of BPA are much lower than in the case This study was achieved through Core
of cans and plastics. This fact is mainly due to Program, with the support of the Ministry of
the possibility of migration of BPA only from Research and Innovation (MCI), contract
the lid, which contains inside epoxy resins used 22N/2019, project PN 19 02 03 02.
as coating paints. In this case, the contact
202
REFERENCES come in contact with food. Official Journal of the
European Union, L12, 1‒89.
Alabi, A., Casero-Caballero, N., Rubio, S. (2014). Quick Commission Regulation (EU) no. 213/2018 of 12
and simple sample treatment for multi residue February 2018 on the use of bisphenol A in varnishes
analysis of bisphenols, bisphenol diglycidyl ethers and coatings intended to come into contact with food
and their derivates in canned foods prior to liquid and amending Regulation (EU) no. 10/2011 as
chromatography and fluorescence detection. Journal regards the use of that substance in plastic food
of Chromatography A, 1336, 23‒33. contact materials. Official Journal of the European
Almeida, S., Raposo, A., Almeida-Gonzalez, M., Union, L41, 6‒12.
Carrascosa, A. (2018). Bisphenol A: Food exposure Commission Directive 2002/72/EC of 6 August 2002
and impact on human health, Comprehensive Reviews relating to plastic materials and articles intended to
in Food Science and Food Safety, 17(6), 1503‒1517. come into contact with foodstuffs. Official Journal of
Aschberger, K., Castello, P., Hoekstra, E., Karakitsios, the European Communities, L220, 18‒58.
E., Munn, S., Pakalin, S., Sarigiannis, D. (2010). Commission Directive 90/128/EEC of 23 February 1990
Bisphenol A and baby bottles: Challenges and relating to plastics materials and articles intended to
perspectives. Luxembourg: Publications Office of the come into contact with foodstuffs. Official Journal of
European Union, 5‒50. the European Communities, L75, 19‒40.
Beltifa, A., Feriani, A., Machreki, M., Ghorbel, A., EFSA (European Food Safety Authority) 2015. Scientific
Ghazouani, L., Di Bella, G., Van Loco, J., Reyns, T., opinion on the risks to public health related to the
Mansour, H. B. (2017). Plasticizers and bisphenol A presence of bisphenol A (BOA in foodstuffs:
in packaged foods sold in the Tunisian markets: study Executive summary - EFSA Panel on Food Contact
of their acute in vivo toxicity and their environmental Materials, Enzymes, Flavouring and Processing Aids
fate. Environmental science and pollution research (CEF), Question number EFSA-Q-2012-00423,
international, 24(28), 22382‒22392. Adopted: 11 December 2014. EFSA Journal, 13(1),
Boudalia, S., Oudir, M. (2016). Bisphenol A: Legislation 3978.
in Industrials Countries and in Algeria. Research EFSA (European Food Safety Authority) 2006. Opinion
Journal of Environmental Toxicology, 10(3), 189-192. of the Scientific Panel on Food Additives,
Cantonwine, D., Meeker, J. D. Hu H., Sanchez, B. N., Flavourings, Processing Aids and Materials in
Lamadrid-Figueroa, H., Mercado-Garcia, A., contact with food on a request from the Commission
Fortenberry, G. Z., Calafat, A. M., Tellez-Rojo, M. related to 2,2-bis(4-hydroxyphenyl)propane
M. (2010). Bisphenol A exposure in Mexico City and (Bisphenol A), Question number EFSA-Q-2005-100,
risk of prematurity: a pilot nested case control study. Adopted: 29 November 2006. EFSA Journal, 428,
Environmental health: a global access science 1‒75.
source, 9: 62. El Dars, F., Hashim, H. A., Ameen, S. M. (2018).
Cao, X. L., Perez-Locas, C., Dufresne, G., Clement, G., Determination of Bisphenol A (BPA) levels in some
Popovic, S., Beraldin, F. J., Dabeka, R., Feeley, M. preserved food Products in Egypt, Current Science
(2011). Concentration of bisphenol A in the compo- International, 7(3), 439‒450.
site food samples from the 2008 Canadian total diet Ehrlich, S. Williams, P. L., Missmer, S. A., Flaws, J. A.,
study in Quebec City and dietary intake estimates. Ye, X., Calafat, A. M., Petrozza, J. C., Wright, D.,
Food Additives and Contaminants, 28(6), 791‒198. Hauser, R. (2012). Urinary bisphenol A concentration
Cunha, S. C., and Fernandes J. O. (2013). Assessment of and early reproductive health outcomes among
bisphenol A and Bisphenol B in canned vegetables women undergoing IVF. Human reproduction,
and fruit by gas chromatography - mass spectrometry 27(12), 3583‒3592.
after QuEChERs and dispersive liquid-liquid Geens, T., Aeplbaum, T. Z., Goeyens L., Neels, H.,
microextraction. Food Control, 33(2), 549‒555. Covaci A. (2010). Intake of bisphenol A from canned
Chou W. C., Chen J. L., Lin C. F., Chen Y. C., Shi F. C., beverages and foods on the Belgian market. Food
Chuang C. Y. (2011). Biomonitoring of bisphenol A Additives and Contaminants, 27(11), 1627‒1637.
concentrations in maternal and umbilical cord blood Hoekstra, E. J., Simoneau, C. (2013). Release of
in regard to birth outcomes and adipokine expression: Bisphenol A from polycarbonate - a review. Critical
a birth cohort study in Taiwan. Environmental health: reviews in Food Science and Nutrition, 53(4),
a global access science source, 10: 94. 386‒402.
Chouhan, S., Satyndra, K. Y., Prakash, J., Swati Surya, Kawamura, Y., Etoh, M., Hirakawa, Y., Abe, Y.,
P. S. (2014). Effect of Bisphenol A on human health Mutsuga, M. (2014). Bisphenol A in domestic and
and its degradation by microorganisms: a review. imported canned foods in Japan. Food Additives &
Annals of Microbiology, 64(1), 13‒21. Contaminants: Part A, 31(2), 330‒340.
Commission Regulation (EU) 2011/8/EU of 28 January Kim, K, Parh, H. (2013). Association between
2011 amending Directive 2002/72/EC as regards the concentrations of bisphenol A and type 2 diabetes in
restriction of use of Bisphenol A in plastic infant Korean adults: a population-based cross-sectional
feeding bottles. Official Journal of the European study. International journal of hygiene and
Union, L26, 11‒14. environmental health, 216(4), 467‒471.
Commission Regulation (EU) no. 10/2011 of 14 January Le Corre, L., Besnard, P., Chagnon, M. C. (2015). BPA,
2011 on plastic materials and articles intended to an energy balance disruptor. Critical Reviews in Food
Science and Nutrition, 55(6), 769‒777.
203
Li, D.K., Zhou, Z., Miao, M., He, Y., Qing, D., Wu, T., myocardial infection in male C57bl/6n mice.
Wang, J., Weng, X., Ferber, J., Herrinton, L. J., Zhu, Toxicological sciences: an official journal of the
Q., Gao, E., Yuan, W. (2010). Relationship between Society of Toxicology, 146(1), 101‒115.
urine bisphenol A level and declining male sexual Poovarodom, N., Jinkarn, T., Tangmongkollert, P.,
function. Journal of andrology, 31(5), 500‒506. Chaloeijitkul, W., Charubhum, S. (2017). Survey of
Li, D. K., Zhou, Z., Miao, M., He, Y., Wang, J., Ferber, food can coatings in Thailand - Their use, extractable
J., Herrinton, L. J., Gao, E., Yuan, W. (2011). Urine residues and migrations. Packaging Technology and
bisphenol A (BPA) level in relation to semen quality. Science, 30(7), 317‒329.
Fertility and sterility, 95(2), 625‒630. Posnack, N. G. (2014). The adverse cardiac effects of di
Li, J., Zhou, H., Liu, Y. X., Yan, X. Y., Xu, Y. P., Liu, S. (2-ethylhexyl) phthalate and Bisphenol A.
M. (2014). Solid-phase extraction for selective Cardiovascular toxicology, 14, 339‒357.
determination of bisphenol A in drinks and fruits by Posnack, N. G., Rafael Jaimes, H. A., Swift, L. M.,
dummy surface molecularly imprinted polymer with Wengrowski, A. M, Sarvazyan, N., Kay, M. W.
direct synthetic method. Food Additives & (2014b). Bisphenol A exposure and cardiac electrical
Contaminants: Part A, 31(6), 1139‒1146. conduction in excised rat hearts. Environmental
Liao, C., Kanna, K. (2014). A survey of bisphenol A and Health Perspectives, 122(4), 384‒390.
other bisphenol analogues in foodstuffs from nine Rochester, J. R. (2013). Bisphenol A and human health:
cities in China. Food Additives & Contaminants: Part A review of the literature. Reproductive toxicology,
A, Chemistry, analysis, control, exposure and risk 42, 132‒155.
assessment, 31(2), 319‒329. Sadeghi, M., Nematifar, Z., Fattahi, N., Pirsaheb, M.,
Lorber, M., Schecter, A., Paepke, O., Shropshire, K. C., Shamsipur, M. (2016). Determination of Bisphenol A
Birnabaum, L. (2015). Exposure assessment of adult in food and environmental samples using combined
intake of bisphenol A (BPA) with emphasis on solid-phase extraction dispersive liquid-liquid
canned food dietary exposures. Environmental microextraction with solidification of floating organic
International, 77, 55‒62 drop followed by HPLC. Food Analytical Methods,
Lu, J., Wu, J, Stoffella, P. J., Wilson, P. C. (2013). 9(6), 1814‒1824.
Analysis of bisphenol A, nonylphenol, and natural Sakhi, A. K., Therese, I. L., Lillegaard, B., Voorspoels,
estrogens in vegetables and fruits using gas S., Carlsen, M. H., Loken, E. B., Brantsaeter, A. L.,
chromatography–tandem mass spectrometry. Journal Haugen, M., Melter, H. M., Thomsen, C. (2014).
of Agricultural and Food Chemistry, 61(1), 84‒89. Concentrations of phthalates and Bisphenol A in
Ludwicka, K. C. (2015). Bisphenol A (BPA) in food Norwegian foods and beverages and estimated
contact materials – new scientific opinion from EFSA dietary exposure in adults. Environment
regarding public health risk. Roczniki Panstwowego International, 73, 259‒269.
Zakladu Higieny, 66(4), 299‒307. SCF (Scientific Committee for Food) 1986. Certain
Michalowicz, J. (2014) Bisphenol A – Sources, toxicity monomers and other starting substances to be used in
and biotransformation. Environmental toxicology and the manufacture of plastic materials and articles
pharmacology, 37, 738‒758. intended to come into contact with foodstuffs,
Mo, R., Liu, H., Lai, R., Deng, G., Zhang, Z., Pei, Z., Li, Reports of the Scientific Committee for Food
H., Xia, E. (2017). Ultrasound-Assisted Upper Liquid (seventeenth series), Opinion expressed 14th
Microextraction Coupled to Molecular Fluorescence December 1984, EUR 10778, 48 pp.
for Detection of Bisphenol A in Commercial SCF (Scientific Committee for Food) 2002. Opinion of
Beverages, Food Analytical Methods, 10(5), the Scientific Committee on Food on Bisphenol A.
1575‒1581. SCF/CS/PM/3936 Final.
Muhamad, M. S., Salim, M. R., Lau, W. J., Yusop, Z. Schecter, A., Malik, N., Haffner, D., Smith, S., Harris, T.
(2016). A review on bisphenol A occurrences, health R., Peapke, O., Birnbaum, L. (2010). Bisphenol A
effects and treatment process via membrane (BPA) in U.S. Food. Environmental Science &
technology for drinking water. Environmental science Technology, 44(24), 9425‒9430.
and pollution research international, 23(12), Sungur, S., Koroglu, M., Ozkan, A. (2014).
11549‒11567. Determination of bisphenol A migrating from canned
Noonan, G. O., Aherman, L. K., Begley, T. H. (2011). food and beverages in markets. Food chemistry, 142,
Concentration of Bisphenol A in Highly Consumed 87‒91.
Canned Foods on the U.S. Market. Journal of Tang, W. Y., Morey, L. M., Cheung, Y. Y., Birch, L.,
Agricultural and Food Chemistry, 59(13), Prins, G. S., Ho, S. M. (2012). Neonatal exposure to
7178‒7185. estradiol/bisphenol A alters promoter methylation
Olsen, L., Lind, L., Lind, P. M. (2012). Associations and expression of nsbp1 and hpcal1 genes and
between circulating levels of bisphenol A and transcriptional programs of dnmt3a/b and mbd2/4 in
phthalate metabolites and coronary risk in the elderly. the rat prostate gland throughout life. Endocrinology,
Ecotoxicology and environmental safety, 80, 153(1), 42‒55.
179‒183. Zielinska, M., Wojnowska Baryla, I., Cydzik
Patel, B. B., Kasnecia., Bolt, A. M., Di Lalla, V., Di Kwiatkowska, A. (2018). Bisphenol A removal from
Iorio, M. R., Raad, M., Mann, K. K., Chalifour, L. E. water and wastewater. Springer International
(2015). Chronic exposure to bisphenol A reduces Publishing AG, part of Springer Nature 2019.
successful cardiac remodelling after an experimental
204
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
TRENDS IN REFRIGERATION TECHNOLOGIES USED FOR FOOD
PRESERVATION – A REVIEW
Elisabeta Elena POPA, Amalia Carmen MITELUȚ, Mona Elena POPA
University of Agronomic Sciences and Veterinary Medicine of Bucharest,
Faculty of Biotechnologies, 59 Mărăşti Blvd., Bucharest, Romania
Corresponding author email: [email protected]
Abstract
Food is a perishable commodity. The primary objective of food preservation is to prevent or slow down the growth of
microorganisms including moulds, yeasts and bacteria as their growth causes spoilage of food but also to reduce the
speed of enzymatic reactions which take place during postharvest or post-slaughter life of raw material or during food
product shelf-life. Refrigeration has become an essential part of the food chain. It is used in all stages of the value
chain, from farm, food processing, to distribution, retail and final consumption at home. The food industry employs
both chilling and freezing processes where the food is cooled from ambient to temperatures above 0°C in chilling and
between -18°C and -35°C in freezing to slow the physical, microbiological and chemical activities that may cause
deterioration in foods. The use of refrigeration for food production and its preservation is undoubtedly the most
extensive technique. The aim of this study is to present the latest trends in refrigeration techniques used for food
preservation.
Key words: refrigeration technologies, food preservation, chilling, freezing.
INTRODUCTION scale applications, while the former is used
widely in applications encountered on a daily
Food spoilage represent a continuous threat basis (Zink et al., 2010). In terms of food
along the entire food chain, consequently industry, refrigeration represents an essential
suitable and efficient conservation methods are part of the food chain, being used in all stages
needed. For food products that cannot be from processing to distribution, retail and final
deposited at room temperature, the consumption at consumer’s home (Tassou et
technologies currently applied are in general al., 2009).
represented by chilling and freezing which, The aim of this study was to provide a brief
while effective, are energy consuming (Santos review of some refrigeration techniques that are
et al., 2015). New technologies have been or could be used in food industry.
presented lately to improve food quality during
storage along the cold chain. Despite their Air cycle refrigeration
advantages, there is still needed the The advantages of air as a refrigerant are
improvement of some factors that may obvious: it is free, safe for environment and
compromise food product’s thermal stability operators and, above all, available everywhere
and distribution and furthermore causing direct (Shengjun et al., 2011; Giannetti & Milazzo,
impact on food quality and energy efficiency 2014). Using air as refrigerant has great
(Tsang et al., 2017). advantages over conventional refrigerants,
Refrigeration is omnipresent in daily life, for many of which have negative environmental
example in homes, and vehicles, as well as in effects, are toxic or flammable (Shengjun et al.,
less obvious applications, such as cryogenic 2011). This technique allows continuous
cooling. The large need for refrigeration on charge/discharge to the ambient, a unique
multiple levels of different temperatures has feature among refrigerant fluids, eliminating
created a vast variety of refrigeration and the need for a sealed circuit. The circuit can be
freezing techniques. For most applications, open to the ambient or to the refrigerated space.
vapor compression cycles and absorption In both cases, irreversibility related to heat
cycles are used. The latter are used for large transfer and flow friction, as well as cost,
205
weight and volume, are avoided. Regarding the Ejectors are widely used in the refrigeration
second case, elimination of the evaporator has system, fuel cell system, vacuum equipment
many advantages in terms of frost avoidance on and desalination plant due to its simple
cold surfaces. If the cold air is introduced at an structure, long service life and low mainte-
acceptable speed in the cold space, the electric nance cost. The ejector refrigeration system
fan integrated on the evaporator can be was studied in recent years due to its promising
eliminated as well (Giannetti & Milazzo, ability to use the low-grade thermal energy
2014). such as solar energy. Nevertheless, compared
An air circulation system is mostly composed with the traditional vapor compression
of a compressor, expander, indoor and outdoor refrigeration system, the ejector refrigeration
heat exchanger. In an ideal condition, this system has relative lower efficiency and
refrigeration cycle includes two isobaric and presents a complex thermodynamic behaviour
two isentropic processes. The circulating air due to the supersonic flow phenomenon inside
gets into the compressor and becomes the ejector chamber (Liu et al., 2017).
compressed (isentropic process) and the Ejector refrigeration system has many
temperature and pressure rise; the compressed advantages over traditional compressor-based
air of high temperature and high pressure gets systems, such as simplicity, the ability to work
into the outdoor heat exchanger and lets out with different types of refrigerants, low
heat (isobaric process) and the temperature installation and low operating costs.
falls; the air flow then gets into the expander Furthermore, the direct correlation between the
and expands to the demanded temperature and peak cooling load and peak solar radiation
pressure; the air flow of low temperature and makes solar ejector cooling systems more
low pressure gets into the indoor heat advantageous. However, low coefficient of
exchanger and absorbs the indoor heat (isobaric performance (COP) and dependency on the
process), then the air flow gets into the environmental conditions are the main
compressor and the new refrigeration drawbacks of this type of systems (Aligolzadeh
circulation begins (Xing et al., 2016). & Hakkaki-Fard, 2019). One way to improve
Foster et al. (2011) build and tested a closed air COP is to include a booster refrigeration
cycle cooling and heating equipment to be used system with ejector which modifies the
in the food industry. The equipment used a conventional booster refrigeration system by
bootstrap unit developed for aircraft air adding an ejector between evaporator and
conditioning in a system that has been modified compressor, which can effectively enhance the
to run at low temperature necessary for food system COP when the ambient temperature is
freezing, by using a parallel compressor. This high according to Huang et al. (2018).
approach allowed temperatures as low as - Ahammed et al. (2018) conducted a
140°C leaving the turbine and as high as 234°C thermodynamic analysis of transcritical CO2
leaving the bootstrap compressor. The system systems that use ejector instead of throttle
has been shown to produce cooling at valve for chilling and heating of milk in the
cryogenic temperatures, with waste heat process of pasteurization in a dairy plant. The
capable of cooking and boiling water, being a analysis showed that for pasteurization process,
good alternative to current systems used in energy savings of about 10% can be reached by
food industry (Foster et al., 2011). Air cycle replacing the conventional throttle valve with
technology could be used in food industry in an ejector. Compared to the conventional
processes like fast chilling and/or freezing, cold pasteurization process that use separate heating
storage, refrigerated transport or refrigerated disposition, use of ejector based transcritical
storage cabinets (Tassou et al., 2009). CO2 system yields a primary energy savings of
about 29% even under conservative values of
Ejector refrigeration system energy conversion (Ahammed et al., 2018).
The ejector, as a key device in the ejector Applications in the food sector could be for
refrigeration system, is used to create a region example in areas where waste heat is available
with low pressure in the evaporator (Liu et al., to drive the ejector system. Such applications
2018). can be found in food processing factories
206
where the ejector refrigeration system can be products preservation, and vaccines and
used for product and process cooling and medicines conservation (Fan et al., 2007;
refrigerated transport (Tassou et al., 2009). N’Tsoukpoe et al., 2014). These technologies
are attractive for refrigeration applications in
Sorption-adsorption refrigeration remote or rural areas of developing countries
Sorption technology is used in thermal cooling where the access to electricity is impossible
methods. An absorption machine consists of (Fan et al., 2007).
four main components: a desorber, an absorber, For freezing application that needs temperature
a condenser and an evaporator (N’Tsoukpoe et below 0°C, like icemaking or frozen storage; an
al., 2014). absorption chiller, an adsorption chiller, or a
Sorption technology can be classified as either chemical reaction chiller can also be used.
open sorption system or closed sorption Overall, the lower cooling temperatures
system. Open systems refer to solid or liquid demanded, the higher generation temperatures
desiccant systems that are used for either are needed for driving a sorption refrigeration
dehumidification or humidification. system (Fan et al., 2007).
Principally, desiccant systems transfer moisture
from one airstream to another by using sorption Stirling refrigeration cycle
and desorption processes. In closed sorption The Stirling refrigeration cycle is one of the
technology, there are two primary methods: major cycle models in cryogenics. It consists of
absorption refrigeration and adsorption two reversible isothermal processes and two
refrigeration (Sarbu & Sebarchievici, 2015). reversible constant co-ordinate processes such
Solid sorption refrigeration cycle, which is as constant volume or isomagnetic processes.
driven by low-grade heat, is extensively used The working matter of a Stirling refrigeration
for air-conditioning, freezing, sub-cooling for cycle can be a gas, a magnetic material etc. For
vapor compression systems to get for example different working substances, the Stirling
extreme low temperature energy. It shows refrigeration cycle will have different regene-
promising alternatives for application due to its rative properties such as its coefficient of
properties for saving energy, decreasing performance is not only dependent on the
pollution, and beneficial to sustainable temperatures of the two heat reservoirs but
development. For solid-gas sorption refrige- also, in general, on the specific properties of
ration, chemical working pairs generally have the working substance (Chen & Yan, 1993).
the advantage of high sorption capacity and The duplex Stirling refrigerator is an integrated
volume cooling density over physical sorbents refrigerator consisting of a Stirling cycle engine
(Li et al., 2012). Because the sorbents generally and a Stirling cycle refrigerator used for
have extremely low thermal conductivity, the cooling. The equitability of the work genera-
conventional solid sorption refrigeration tion of the heat engine to the work consumption
systems were mostly driven by hot water or oil, of the refrigerator is the main limitation of the
which present much higher heat transfer duplex Stirling (Erbay et al., 2017).
coefficient than gas. This way the system will Gadelkareem et al. (2019) performed a study
be compact, but having the drawbacks of regarding the optimization of different
complicated structure for the heat recovery in parameters of the Stirling refrigerator/heat
exhaust gas due to additional heat transfer pump cycle for a drinking water cooler/heater.
process between the gas and the liquid, which In this sense, a mathematical model was
is required (Gao et al., 2018). developed, based on Schmidt analysis, to
The existing systems for producing cold using evaluate the equipment performance taking into
solar thermal energy are mainly based on account the flow losses and the regenerator
sorption technology: the process by absorption efficacy. Some of the main conclusion of the
liquid–gas and the process by adsorption solid– authors are: (i) the Stirling refrigerator/ heat
gas (Fan et al., 2007). Solar sorption pump has a great potential to be used for
refrigeration technologies are considered as a drinking water cooler/heater; (ii) the presented
promising way to meet the growing Stirling cycle for water dispensers consumes
refrigeration needs for thermal comfort, food the minimum electric power compared to the
207
other commercially available technologies; (iii) Thermoelectric refrigeration
the presented Stirling cycle can produce hot Thermoelectric machines are composed of
water at 95°C without using heating elements, semiconductor materials that can directly
which consumes high electric energy convert heat into electricity. Thermoelectric
(Gadelkareem et al., 2019). machines which convert a temperature
A study performed by Sun et al. (2008) difference into electrical power are called
investigated the reverse Stirling cycle for use in thermoelectric generators (TEGs). This form of
refrigeration processes. This type of cycle is energy conversion is called the See beck effect.
referred to as Stirling cooling or Stirling cooler. The conversion of current to temperature that
An experimental free-piston Stirling cooler occurs when an electric current flow through a
(FPSC) was developed and the effects of the thermoelectric device (Enescu, 2018) called
device parameters in relation to the thermoelectric coolers (TECs) is called the
performance of the cooler were studied; the Peltier effect. Although the efficiency of TEC
equipment was then experimentally applied to is not very high when compared with
churning butter. The results indicated that by conventional refrigeration equipment, it is
churning butter using the Stirling cooler, irreplaceable. TEC is portable, quiet, environ-
coagulation of the butter occurred more rapidly mentally friendly and it has high temperature-
compared to when the control was used in the controlling capacity (He et al., 2017). Recently,
process; the water content of the obtained thermoelectric devices are taken into
butter was lower, having a higher fat content consideration in a practical power generation,
when the Stirling cooler was used, showing that refrigeration and energy recovery applications.
the feasibility of using the Stirling cooler for This fact is thanks to remarkable features and
churning butter is high (Sun et al., 2008). The properties of these devices, including sim-
Stirling cycle equipment can have many plicity, small size and weight, lack of moving
applications in food industry due to the fact that parts, ability to heat and cool with the same
can it work down to cryogenic temperatures. module, precise temperature control, absence
of working fluid and solid-state operation, high
Thermoacoustic refrigeration reliability and environmentally friendly
Thermoacoustic technology received a great operation (Hadidi, 2017).
attention due to the fact that it uses simple
devices without mobile mechanical parts Trigeneration
compared with conventional technologies Polygeneration energy systems are shown to be
(Belaid and Hireche, 2018). Thermoacoustics is a reliable, competitive and efficient solution for
a domain that focuses on the interaction energy production. The recovery of otherwise
between thermodynamics and acoustics. The wasted energy is the first reason for the high
thermoacoustic effect represents the energy efficiency of polygeneration systems
transformation of acoustic work absorbed to (Urbanucci et al., 2019). Polygeneration can be
transport heat (thermoacoustic refrigerator defined as the combined production of two or
TAR) or the energy conversion of the heat more energy services from a common resource.
supplied to produce acoustic work cogeneration, or combined heat and power, is
(thermoacoustic Stirling heat engine TAE) the simplest form of polygeneration, and
(Alcock et al., 2018), resulting in a system that generally refers to the joint production of
can operate on waste heat and does not contain electricity (and/or mechanical energy) and heat
refrigerants or moving parts (Zink et al., 2010). from a common resource. A typical extension
Heat-driven thermoacoustic refrigeration of cogeneration is trigeneration, also known as
presents great advantages of high reliability and combined cooling, heating and power, which
external heat-driven mechanism. In a system usually refers to the combined production of
like this, heat can be first of all converted into electricity, heat, and cooling (Pina et al., 2018).
acoustic power and then the acoustical power The principle of operation for a trigeneration
operates a refrigerator to generate cooling system is the conversion of the heat taken from
effect without any moving mechanical a high temperature process by the heat engine
components (Wang et al., 2019). into mechanical work achieving a maximum
208
efficiency equal to the Carnot cycle. Mainly, REFERENCES
trigeneration systems integrate various devices
such as refrigeration units, heat engines, heat Ahammed, E., Bhattacharyya, S., Ramgopal, M. (2018).
pumps, hydrogen production units and Analysis of CO2 based refrigeration systems with and
without ejector for simultaneous pasteurization and
desalination units (Leonzio, 2018). chilling of milk. International Journal of
Depending on the user’s refrigeration needs, Refrigeration, 95, 61‒72.
direct or indirect activation can be used Alcock, A. C., Tartibu, L. K., Jen, T. C. (2018).
between the cogeneration and the absorption Experimental investigation of an adjustable
chiller in food applications, having good thermoacoustically-driven thermoacoustic
refrigerator. International Journal of Refrigeration,
results. Direct activation consists of the direct 94, 71‒86.
use of exhaust gases to drive the absorption Aligolzadeh, F., Hakkaki-Fard, A. (2019). A novel
chiller. methodology for designing a multi-ejector
Indirect activation uses the exhaust gases to refrigeration system. Applied Thermal Engineering,
produce hot water or steam in a heat exchanger 151, 26‒37.
Belaid, K. N., Hireche, O. (2018). Influence of heat
that is afterwards used as a heating exchangers blockage ratio on the performance of
environment for the chiller (Marimón et al., thermoacoustic refrigerator. International Journal of
2011). Heat and Mass Transfer, 127, 834‒842.
Chen, J., Yan, Z. (1993). Regenerative characteristics of
CONCLUSIONS magnetic or gas Stifling refrigeration cycle.
Cryogenics, 33(9), 863‒867.
Erbay, L. B., Ozturk, M. M., Dogan, B. (2017). Overall
The food industry relies mainly on the vapor performance of the duplex Stirling refrigerator.
compression refrigeration cycle for food Energy Conversion and Management, 133, 196‒203.
preservation and processing (Tassou et al., Enescu, D. (2018). 11. Thermoelectric Refrigeration
2009). To reduce environmental impact, there Principles, in Bringing Thermoelectricity into
Reality, 221‒246, DOI: 10.5772/intechopen.75439.
were developed and tested many technologies Fan, Y., Luo, L., Souyri, B. (2007). Review of solar
based on air cycle refrigeration, ejector sorption refrigeration technologies: Development and
refrigeration system, sorption-adsorption applications. Renewable and Sustainable Energy
refrigeration, Stirling refrigeration cycle, Reviews, 11, 1758‒1775.
thermoacoustic refrigeration, thermoelectric Foster, A. M., Brown, T., Gigiel, A. J., Alford, A.,
Evans, J. A. (2011). Air cycle combined heating and
refrigeration or trigeneration, technologies that cooling for the food industry. International Journal
can reduce the quantity of used energy, that can of Refrigeration, 34(5), 1296‒1304.
use solar energy instead of conventional ones Gadelkareem, T. M., Eldein Hussin, A. M. T. A.,
or that can use refrigerants which are Hennes, G. M., El-Ehwany, A. A. (2019). Stirling
environmentally friendly. cycle for hot and cold drinking water dispenser,
International Journal of Refrigeration, 99, 126‒137.
In the food industry, refrigeration technologies Gao, J., Wang, L. W., Gao, P., An, G. L., Lu, H. T.
are applied in all stages from raw materials (2018). Design and analysis of a gas heating/cooling
storage and food processing to distribution, sorption refrigeration system with multi-salt solid
retail and final consumption at consumer’s sorbent of CaCl2 and MnCl2. International Journal of
home and from hundreds of years now Heat and Mass Transfer, 126, 39‒47.
Giannetti, N., Milazzo, A. (2014). Thermodynamic
compression refrigeration cycle is used analysis of regenerated air-cycle refrigeration in high
everywhere. and low pressure configuration. International Journal
However, the potential to save energy, of Refrigeration, 40, 97‒110.
resources and significant amounts of money Hadidi, A. (2017). A novel approach for optimization of
requires more than simply using new electrically serial two-stage thermoelectric
refrigeration systems using chemical reaction
technologies. optimization (CRO) algorithm. Energy, 140,
It requires an entirely new approach to 170‒184.
engineering the whole system with which a He, R. R., Zhong, H. Y., Cai, Y., Liu, D., Zhao, F. Y.
facility operates, not just the refrigeration (2017). Theoretical and Experimental Investigations
system and components themselves. More of Thermoelectric Refrigeration Box Used for
Medical Service. Procedia Engineering, 205,
research and developments are needed to 1215‒1222.
replace the old techniques at industrial level. Huang, Z., Zhao, H., Yu, Z., Han, J. (2018). Simulation
and optimization of a R744 two- temperature
209
supermarket refrigeration system with an ejector. Sarbu, I., Sebarchievici, C. (2015). General review of
International Journal of Refrigeration, 90, 73‒82. solar-powered closed sorption refrigeration systems.
Leonzio, G. (2018). An innovative trigeneration system Energy Conversion and Management, 105, 403‒422.
using biogas as renewable energy. Chinese Journal of Shengjun, L., Zhenying, Z., Lili, T. (2011).
Chemical Engineering, 26, 1179-1191. Thermodynamic analysis of the actual air cycle
Li, T. X., Wang, R. Z., Kiplagat, J. K., Ma, L. (2012). refrigeration system. Systems Engineering Procedia,
Performance analysis of a multi-mode 1, 112‒116.
thermochemical sorption refrigeration system for Sun, J. F., Kitamura, Y., Satake, T. (2008). Application
solar-powered cooling. International Journal of of Stirling cooler to food processing: Feasibility
Refrigeration, 35, 532‒542. study on butter churning. Journal of Food
Liu, J., Wang, L., Jia, L. (2017). A predictive model for Engineering, 84, 21‒27.
the performance of the ejector in refrigeration Tassou, S. A., Lewis, J. S., Ge, Y. T., Hadawey, A.,
system. Energy Conversion and Management, 150, Chaer, I. (2009). A Review of Emerging
269‒276. Technologies for Food Refrigeration Applications.
Liu, J., Wang, L., Jia, L., Wang, X. (2018). Applied Thermal Engineering, 30(4), 263.
Thermodynamic modeling and sensitivity analysis of Tsang, A. H. F., Yung, W. K. (2017). Development of an
ejector in refrigeration system. International Journal Adaptive Food Preservation System for food quality
of Heat and Mass Transfer, 126, 485‒492. and energy efficiency enhancement. International
Marimón, M.A., Arias, J., Lundqvist, P., Bruno, J.C., Journal of Refrigeration, 76, 342‒355.
Coronas, A. (2011). Integration of trigeneration in an Urbanucci, L., Bruno, J. C., Testi, D. (2019).
indirect cascade refrigeration system in supermarkets. Thermodynamic and economic analysis of the
Energy and Buildings, 43, 1427‒1434. integration of high temperature heat pumps in
N’Tsoukpoe, K. E., Yamegueu, D., Bassole, J. (2014). trigeneration systems. Applied Energy, 238, 516‒533.
Solar sorption refrigeration in Africa. Renewable and Wang, H., Zhang, L., Yu, G., Hu, J., Luo, E., Ma, Y.,
Sustainable Energy Reviews, 35, 318‒335. Jiang, C., Liu, X. A. (2019). A looped heat-driven
Pina, E. A., Lozano, M. A., Serra, L. M. (2018). thermoacoustic refrigeration system with direct-
Thermoeconomic cost allocation in simple coupling configuration for room temperature cooling.
trigeneration systems including thermal energy Science Bulletin, 64, 8‒10.
storage. Energy, 153, 170‒184. Zink, F., Vipperman, J. S., Schaefer, L. A. (2010).
Santos, M. D., Queiros, R. P., Fidalgo, L. G., Inacio, R. Environmental motivation to switch to
S., Lopes, R. P., Mota, M. J., Sousa, S. G., thermoacoustic refrigeration. Applied Thermal
Delgadillo, I., Saraiva, J. A. (2015). Preservation of a Engineering, 30, 119‒126.
highly perishable food, watermelon juice, at and Xing, X., Fenglan, W., Sheng, L. (2016). Research
above room temperature under mild pressure Progress of Air Cycle Refrigeration Technology, 6th
(hyperbaric storage) as an alternative to refrigeration. International Conference on Mechatronics, Materials.
LWT - Food Science and Technology, 62, 901‒905. Biotechnology and Environment (ICMMBE 2016).
210
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
THE MOUNTAIN PRODUCT - THE VISIT CARD
OF THE MOUNTAIN AREAS
Ioana TOMA1, Florentina MARIN HADDAD1, Cristina GARLEA2,
Mariana PIPIRIGEANU2, Mona Elena POPA1
1
University of Agronomic Sciences and Veterinary Medicine of Bucharest,
59 Mărăşti Blvd., District 1, Bucharest, Romania
2
CSCBA-INCE, Romanian Academy, Path13 September, No 13, District 5,
Bucharest, Romania
Corresponding author email: [email protected]
Abstract
The paper presents the path of the linear economy to the circular economy for sustainable development and growth.
Moving to a circular economy generates opportunities such as: reduced environmental pressures; increased security of
the supply chain of raw materials; increased competitiveness; innovation; growth and development of new jobs. In this
way, small farmers and producers who use the results of research studies in the production process, in the manufacture
of products or the packaging process gain added value, which enables them to be better value on the domestic or
foreign markets. The sustainability and resilient development of mountain rural communities can be made by increasing
the use of local resources to mitigate/stop village depopulation and local natural heritage degradation requires the
identification of existing structural and functional connections between existing resources and their use by local
communities. It is thus possible to establish measures for the sustainable use of natural resources, reducing
environmental pressures, enhancing the security of raw materials supply; use of biotechnology’s advantages; increased
competitiveness, increasing the quality of life of the population.
Key words: bioeconomy, circular economy, mountain product, sustainable development, small farmers, agriculture.
INTRODUCTION situation generates a demand for food products
with certain identifiable characteristics,
Providing consumers with high-quality food especially with regard to the geographical
products, from mountain areas, has always origin of the ingredients and their quality
provided a support to small-scale farmers to (Muscalu et al., 2015).
develop and ensure working conditions and life
make them continue their activity in these THE CONCEPT OF CIRCULAR
areas, keep and pass on to future generations ECONOMY
the knowledge, customs and traditions of these
areas, while complying with food safety and The circular economy is increasingly becoming
security requirements. a way to resource management, including in the
Food products that are produced in the agri-food industry. It is essentially linked to the
mountain areas, labelled with the phrase environment, industrial ecology, technological
"mountain product", guarantees the quality of innovation, re-use, and resource recycling. This
the raw materials used, thus meeting the has to be addressed in the general context of
requirements of citizens and consumers around organizational development, focusing on
the world, increasingly demanding both quality business and operational management
products and traditional products, being also principles, technological innovation promoted
concerned with maintaining the diversity of by all means, leading to efficient resource
agricultural production, meeting the demands management, but also to the role that the state
of consumers, has shown the need to create a has in creating a framework of regulations to
legislative framework that allows small farmers boost the implementation of the circular
to develop and promote their products. This economy (Muscalu & Mateescu, 2016).
211
In order to cope with global population growth,
rapid resource exhaustion, increased environ-
mental pressures and climate change, in line
with the EU Bioeconomy Strategy, Europe has
to radically change its approach to production,
consumption, processing, storage, recycling
biological resources (Zaman, 2019).
By the specifics of the activities carried out, the
research, development and the innovation in
the field of bioeconomics at the national level
should develop on the same priority directions,
consistent with those enumerated at the
community level, namely investing in research,
innovation and skills for bio-economy;
The Europe 2020 strategy advocates bio-
economy as an essential element for smart,
green growth in Europe. Progress in bio-eco-
nomy research and innovating will enable
Europe to improve the management of its own
Figure1. Mountain area - Vatra Dornei, Suceava county renewable bio-resources and open up new and
Source: Personal archive diversified markets for food and bio-products.
The establishment of bio-economy in Europe
Bioeconomy offers alternative solutions to has special advantages: the ability to maintain
manufacture products other than using fossil and generate growth and jobs in rural and
fuel or energy and can contribute to the circular industrial areas to reduce dependence on fossil
economy. fuels and to increase the economic and envi-
In order to prevent food waste production and ronmental sustainability of primary production
to cope with situations that can vary from one and manufacturing (Suciu, 2015).
country to another and from one region to
another, it is essential to take action across the AGRICULTURE OF THE MOUNTAIN
value chain. AREA
In this context, Romania has achieved targets at
European and international levels, with regard In Romania, about 30% of the country's
to: the circular economy, the reduction of food territory is classified as a mountain area,
waste (by 50% by 2030) and the reduction of amounting to 656 administrative-territorial
carbon footprint. units (ATUs). The mountain range is recog-
The transition to a low-carbon economy is one nized for its low pollution level, which gives
of the objectives of rural development, the the food coming from this area more value.
achievement of which contributes to the Europe On 05.02.2019, it was published in the Official
2020 strategy for smart, sustainable and Gazette, Part I, no. 90, Order of the Ministry of
favourable growth, focusing on the following: Agriculture and Rural Development no. 49 of
The efficiency of water use in agriculture; 14.01.2019 amending and supplementing the
the efficiency of energy uses in the agri- annex to the Order of the Ministry of Agri-
food sector; culture and Rural Development no. 52/2017
the facilitation of the supply and use of approving the procedure for checking the
renewable energy sources, by-products, conformity of the data contained in the tender
waste and residues and other non-food raw dossier in order to grant the right of use of the
materials, in order to achieve bio-economy; "mountain product" option and to verify the
reducing greenhouse gas and ammonia compliance of the European and national
emissions from agriculture; legislation by the economic operators who have
promoting sequestration and carbon obtained the right of use of that mention
sequestration in agriculture and forestry. (Mountain Product, Retrieved from
212
www.madr.ro/industrie-alimentara/sisteme-de- interaction between traditional culture,
calitate-europene-si-indicatii-geografice/ gastronomy and the livelihoods of peasant
produse-agricole-si-alimentare/produs- farms in the mountainous countryside. It is
montan.html). imperative to develop optimized models on
The mountain farming is the result of the: product groups as well as the analysis of
developing markets and competitiveness in economic, social and cultural aspects that
the bio-economy sectors through a sustainable contribute to the capitalization through short
increase in primary production through the chains of production, acquisition, storage and
conversion of waste streams into value-added marketing of mountain products for reviving
products and through mutual learning and increasing household profitability and of
mechanisms to improve production and mountain agricultural holdings (Isachi &
resource efficiency; Chitiga, 2016).
enhance policy coordination and stakeholder
involvement, by setting up a bio-economy PROMOTING AGRICULTURAL
group, a bio-economic observer, and by organi- PRODUCTS
zing stakeholder conferences on a regular basis.
Due to the global economic climate, Romanian
agri-food products have to cope with strong
competitive pressure from imported products,
which in some cases do not meet the high
standards of European food quality and safety,
being delivered at prices below the production
costs of Romanian products, thus creating a
competitive gap to the detriment of Romanian
farmers (Alexandri, 2016).
The marketing of locally grown food, short
chains, and local markets should become an
important component of the agri-food sector in
Romania.
Supporting and encouraging the development
Figure 2. Logo "mountain product" of short supply chains is necessary for terms of
Source: National Legislation, Order of the Ministry of opening up market opportunities to active
Agriculture and Rural Development no. 49/14.01.2019 farmers by promoting and selling products in
the vicinity either individually or jointly. In this
Products that possess the optional label context, the marketing of agri-food products
"mountain product" are marked with a national can make a significant contribution to the
logo (logo, trademark, symbol). The "mountain development and relaunch of the agricultural
product" logo is used exclusively on the labels sector, based on a product promotion policy,
of products that meet the requirements of and consequently on exports tailored to the real
Regulation (EU) no. 1151/2012, Delegated needs of the Romanian agricultural sector.
Regulation (EU) no. 665/2014 (Regulation Combined with the promotion of offensive
(EU) No 1151/2012 of the European interests on third-country markets, and taking
Parliament - EUR-Lex, Retrieved from into account the crisis situations that persist in
https://eurlex.europa.eu/LexUriServ/LexUriServ. certain sectors of agriculture at national and
A number of sectors such as mountain farming European level, especially in the dairy, pig
face specific challenges in the context of the meat cycle are fully taken into account
cyclical economy, given the particularities of throughout the value chain (Gavrilescu et al.,
their products or their value chains, their 2016).
environmental footprint or their dependence on For this purpose, for better visibility and
materials outside of Europe. A clearly targeted valorification of the mountain area potential, it
approach is needed in this sector to ensure that is necessary to develop guides for processors
interactions between the different phases of the regarding the use of modernized traditional
213
technologies to ensure the reproducibility and which in some cases do not meet the high
food safety of the mountain products made. standards of European food quality and safety,
Action plans for local authorities to create local being delivered at prices below the production
fairs/markets for consumer information and costs of Romanian products, thus creating a
awareness on the quality and safety of competitive gap to the detriment of Romanian
Romanian agro-food products, and last but not farmers. (Rosu, 2016).
least, awareness-raising campaigns to change In this context, Romania needs to register as
consumer behaviour. many agri-food products as possible on
European and National quality schemes, in
order to capitalize on the potential of our
country.
Figure 3. Promoting agri-food products from the
mountain area to the Green Week in Berlin, 2019
Source: Personal archive
Figure 4. Romanian food products
Thus, the emphasis will be on increasing the Source: Personal archive
presence of Romanian products and improving/
strengthening the position on the markets of CONCLUSIONS
interest at European and National level.
Also, the implementation of trade and Romanian agriculture must reach a level of
cooperation agreements with third countries development comparable to that of other
will create a competitive advantage for the European Member States that already have
agri-food sector in Romania by obtaining tariff modern agriculture, steps must be taken to
concessions on imports in these countries, thus achieve sustainable growth. These stages
favouring the growth of agricultural exports depend on economic growth, creating new jobs
and high value-added exports with impact and improving competitiveness at international
positive and fruit and vegetables sectors, level.
Romania must maintain a high degree of Romania needs to focus on manufacturing high
protection for imports of agri-food products, value-added products that meet environmental,
mainly for the following products: beef, poultry animal health and animal welfare and quality
and pig meat, sunflower and rapeseed, cereals requirements in line with European standards.
(wheat, corn and barley), grain and oil In addition to national quality legislation,
soybeans, sugar, tobacco and cigarettes, in Romania implements European legislation on
order to protect the domestic production and quality systems. These systems allow consu-
the competitiveness of Romanian farmers on mers to identify products that have specific
the European and international market. qualities due to their origin and/or production
Due to the global economic climate, Romanian methods.
agri-food products have to cope with strong In order to make consumers trust the legitimate
competitive pressure from imported products, nature of label labels, compliance with the
214
product specification is monitored by public REFERENCES
authorities or a private certification body.
Regulation (EU) No. 1151/2012 of the Euro- Alexandri, C. L. (2016). Labor productivity in Romanian
agriculture - regional analysis by type of farms,
pean Parliament and of the Council of 21 Espera.
November 2012 on quality systems for agri- Gavrilescu, C., Toma, C., Turtoi, C. (2016). Structure of
cultural and food products and Regulation (EU) Agrifood trade as an indicator of sectoral
No. 1169/2011 of the European Parliament and competitiveness - a comparison between the new
of the Council of 25 October 2011, on informa- member states.
Isachi, S. E., Chitiga, G. (2016). Implications of Food
tion to consumers on foodstuffs, amending Security on Rural Development. Muscalu, M. S.,
Council Regulation (EC) 1924/2006 and (EC) Mateescu, M. (2016). Using efficiency and natural
No. 1925/2006 of the European Parliament and resources. Mathematical and software tools.
of the Council and repealing Commission Muscalu, M. S., Bulgaria, M., Neagu, C. (2015).
Directive 87/250/EC, Directive 90/496/EC Sustainable Management of Primary Energy
Resources - What We Leave to Future Generations.
Council Directive 1999/10/EC, Directive Rosu, E. (2016). Regional Competitiveness in Regional
2000/13/EC of the European Parliament and of Profile.
the Council the European Parliament and the Suciu, M. C. (2015). Knowledge and Innovation - Key
Council, Commission Directives 2002/67/EC Factors of Sustainable Competitive Advantage.
and 2008/5/EC; Council Regulation (EC) No Zaman, GH. (2019). Sustainable Development of a New
Paradigm of Agenda 2030. Academica Magazine, 3.
608/2004 of the Commission. ***Mountain Product.
http://www.madr.ro/industrie-alimentara/sisteme-de-
ACKNOWLEDGMENTS calitate-europene-si-indicatii-geografice/produse-
agricole-si-alimentare/produs-montan.html,Accessed
The authors must consider the smart on 2019.
contribution of the specialists in Espera Regulation (EU) No 1151/2012 of the European
Parliament - EUR-Lex
conferences, let by the PhD. Prof. Luminita https://eurlex.europa.eu/LexUriServ/LexUriServ,
Chivu, Romanian Academy. Accesssed on 2019.
215
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
REVIEW ON LEGAL, SOCIAL AND ECONOMIC ASPECTS OF
THE NEW BREEDING TECHNIQUES
Luminiţa Raluca SIMIONESCU, Narcisa BĂBEANU, Călina Petruţa CORNEA
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mărăşti Blvd.,
District 1, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
The paper aimed to present a review on the social and economic aspects of NBTs, the studies on two different species of
plants, subjects of NBT's. The plants variants generated by NBTs are more readily accepted in the market and for crop
improvement. In this article we will present briefly the benefits, application and expected developments, regulatory
status of NBTs in and outside the EU. It was developed a system for the detection of a broad spectrum of GMOs for
analysis of food/feed matrices by the characterization of transgene flanking regions and the typical combinations for
transgene constructs. We will describe two different species of plants, subjects of NBTs: 1) Tomatoes for carotenoid
sequestration mechanisms and the carotenoid biosynthesis. The carotenoid accumulation and changes in carotenoid
profiles suggest that the plastid can adapt to changes in carotenoid content through plastid differentiation and
preferential sequestration; 2) Edited maize genome by biolistic delivery of pre-assembled Cas9-gRNA
ribonucleoproteins into maize embryo cells and regeneration of plants with both mutated and edited alleles. As a
conclusion, CRISPR/Cas9 is the most used technology for genome editing due to its simplicity and efficiency. In this
article, we aim to highlight the application of CRISPR/Cas9 technique system, like the powerful genome editing tool for
crop improvement.
Key words: CRISPR/Cas9, genome editing, crop improvement, NBTs.
INTRODUCTION It is less time-consuming and easier to accept
on the market.
In the next 37 years, by 2050, the world
population is estimated to grow by about MATERIALS AND METHODS
200,000 net people per day to a total of 9.6
billion people (Populaire Reference Bureau, The research methodology used in this paper
2012). has the following main aspects:
Among the benefits of genetic engineering in • bibliographic study of the national and inter-
agriculture are increasing crop yields, reducing national literature;
costs for food or feed production, reducing the • collecting the concrete information within the
need for pesticides, increasing nutrient researched area;
composition and food quality, resistance to • ordering, processing and presenting of results
pests and diseases, and the benefits of food in synthetic form;
intake for the growing population world. • analysis and interpretation of results, for-
In support of these goals, agricultural and food mulation of conclusions and recommend-
scientists have developed new plant breeding dations.
techniques (NBT) in recent years, including
CRISPR/ Cas9, the simplest and most effective RESULTS AND DISCUSSIONS
technique for crop improvement, known as
genome editing. This is a technique that allows The site-specific nucleoside-based genomic
the plant genome to be precisely modified by editing system can be classified into three
removing unwanted genes or byspecifying categories: the zinc nucleus finger (ZFN), the
which genes can get new functions (Wolt et al., transcriptional effector nucleases (TALEN),
2016). The genome-generated varieties are and the intermediate short-acting palindromic
similar to the naturally occurring variations. groups that have been associated with the
216
binding protein of Cas9 on specific DNA RNA-guided Streptococcus pyogenes Cas9
sequences (CRISPR/Cas9). The main endonuclease was successfully used to modify
differences between categories consist in their the genome in several plant species. In most of
mechanism of inducing the double-catenary the experiments, guideline RNA (gARN) as
break and their efficiency in targeting the well as selectable marker genes and Cas9 were
desired sequences. delivered to plant cells using either T DNA
In plants, the administration of Cas9-RNA (Agrobacterium tumefaciens infection) or
complexes (Figure 1.) has been demonstrated plasmid DNA (particle bombardment).
through protoplasts of several species. The supplied DNA integrates relatively easily
Protoplasts are "bare" cells generated by the into the target genome, but can lead to various
enzymatic removal of cell walls and have a side effects, such as gene disruption, plant
unique property of cell wall reforming and mosaicism, and potential off-site cutting.
regeneration in plants. Protoplasts have been To alleviate potential negative effects, pre-
successfully used to edit the genome in a integrated Cas9 nucleosus plants were
variety of plants such as tobacco, salad, rice generated and used to administer RNAs in the
and some flowers. form of RNA molecules.
For most monocotyledonous species such as This approach requires time and resources for
corn, wheat, rice, barley and sorghum, plant the development and characterization of pre-
regeneration in protoplasts is less effective. integrated lines (Abdallah et al., 2015).
New genome editing techniques may be
accompanied by some unintended effects
(cellular damage if repair mechanisms are
imprecise, cleavage and mutation to similar
unwanted genomic sites, mutations outside the
target to genomic edited plants).
The genomic editing techniques, in general,
show a much smaller number or a lack of
unintentional mutations compared to organisms
obtained by conventional reproductive
techniques (Table 1.).
The absence of unintentional, potentially
harmful effects can be verified with the whole
genome sequencing (SAM, 2017).
The main modes of action in genome editing,
as seen in Table 1, were:
• gene disturbance,
• genetic regulation,
• gene insertion.
Among the main attributes and expressed
functions of the modified genes were:
• biosynthesis of important nutritional and
health substances, as well carotene, inositol,
tartaric acid, phytic acid, acetolactate,
gibberellin,
• growth regulators,
• RNA regulation of biogenesis,
• initiating factor of translation,
• luorescence,
• cereal dormancy regulator,
Figure 1. The CRISPR/Cas9 system involves • growth of root hair factors,
three steps - acquisition, crRNA biogenesis and • auxin response factor.
interference at DNA target cleavage
Source: www.intechopen.com
217
Table 1. List of plants based on genome modification via tool for crop improvement, with the potential to
CRISPR Cas9 system quickly generate new phenotypes.
Source: www.intechopen.com
Species Target Gene Description Action
name gene function mode
Arabidopsis BR11, growth displayed Gene
thaliana JAZ1, regulators retarded disturbance
GAI growth
Brassica BolC.GA biosynthesis displayed Gene
oleracea 4.a of dwarf disturbance
gibberellin phenotype
Citrus CsPDS carotenoid displayed Genetic
sinensis biosynthesis albinism regulation
expression
Cucumis eIF4E Initiating developed Gene
sativus factor resistance disturbance
translation toward a broad
range of virus
Figure 2. Global scheme of biotechnology acceptance
Glycine Bar, Growth of displayed Genetic
max GmFE11 root hair higher root regulation Source: www.nbtplatform.org
GmFE12 factors hair growth
induction
Hordeum HvPM19 Cereal displayed Gene It arise the question how genetically modified
vulgare dormancy signs of disturbance plants with the desired characteristics will be
regulator dormancy
Marchantia ARF1 Auxin showed no Gene received by the public and regulated under
polymorpha response response disturbance GMO legislation.
factor toward auxins
Medicago GUS Fluorescenc displayed no Gene
According to a recent study comparing the
truncatula e signs of disturbance views of researchers and citizens on a range of
staining
Nicotiana NbPDS Carotenoid displayed Gene scientific, engineering and technology issues
benthamian biosynthesis albinism insertion (Funk and Lee, 2015), 37% of the general
a expression
Nicotiana NtPDS Carotenoid displayed Gene public responded that genetically modified
tabacum biosynthesis albinism disturbance foods are safe for consumption and 88% of
expression
scientists interviewed recognize genetically
Oryza OsPDS, Carotenoid displayed Gene
sativa OsMPK2 biosynthesis albinism and disturbance modified foods as safe (Wolt et al., 2016).
OsBAD2 , growth
regulator
dwarfism With all the studies done so far, it is undeniable
Petunia PDS Carotenoid displayed Gene that the CRISPR Cas9 system is about to
hybrid biosynthesis albinism
expression
disturbance
change the pace and course of the agricultural
Populus PtoPDS Carotenoid displayed Gene industry.
tomentosa biosynthesis albinism disturbance
expression
Solanum SlAGO7 Involved in displayed Gene Judgment of the European Court of Justice
lycopersicu
m
the RNA
regulation of
needle-like or
lacking lamina
disturbance (C528/16ECJ)
biogenesis leaves As stated in the European Law, the definition
Solanum
tuberosum
StALS1 Acetolactate
biosynthesis
showed
increased
Gene
insertion
of GMO means an organism except human
resistance on beings where the genetic material has been
herbicides
Sorghum DsRED2 Fluorescenc showed signs Gene
altered in a way that does not occur naturally
bicolor e of red insertion by mating and / or natural recombination.
fluorescence
Triticum TaINOX, Inositol and displayed Gene
The European Commission has stressed that the
aestivum TaPDS carotenoid albinism disturbance decision to include or exclude a technique
biosynthesis expression
Vitis IdnDH Tartaric showed no Gene
within the scope of Directives 2001/18 and
vinifera biosynthesis signs of disturbance 2009/41 EC depends only on the interpretation
tartaric acid in
their fruits
of the definition of genetically modified orga-
Zea mays ZmIPK Phytic acid showed Gene nisms and genetically modified micro-orga-
biosynthetic reduction of disturbance
pathway phytic acid nisms and the conditions for exemption laid
catalyst level down in the two directives (Laaninen, 2016).
There are regulatory authorities such as the
Global acceptance of plant biotechnology German Consumers Protection Association or
The genome editing with modified nucleases known as the Verbraucherzentrale
has evolved as a highly specific and efficient Bundesverband (VZBV) and Swedish scientists
218
who call for the exclusion of such a "genetic that the new GMOs will be traceable and
modification" from the GMO Regulation if labelled is good news for organic farmers,
such crops do not contain any "foreign DNA" farmers and processors, but also for all
(Ammann, 2016). European producers and consumers, the
On 25 July 2018, the European Court of Justice freedom to avoid such genetically modified
delivered its judgment in Case C-528/16, products and the protection of the environment
holding that organisms obtained by mutage- against the potential risks of these new
nesis must be considered as GMOs, binding on technologies."(IFOAM EU Press Release: New
national courts. The judgment of the above- genetic engineering techniques will be
mentioned European Court of Justice says that regulated as EU-EU GMOs welcomes the ECJ
organisms created by new gene editing decision, 2018).
techniques (such as CRISPR Cas9 and related Franziska Achterberg, EU Greenpeace Director
methods) are GMOs - Directive 2001/18/EC. for Food Policy: "The Court clarifies that plants
The Directive requires organisms produced by and animals derived from genetic publishing
genome editing to be detected as such by are subject to the same safety and labelling
testing laboratories. EURL-GMFF has develop- requirements as other genetically modified
ped a draft report in this area that is not public organisms. These requirements exist to prevent
yet but discusses detection issues and suggests harm and to inform consumers the release of
potential ways to detect these products. these new GMOs into the environment without
adequate safety measures is illegal and
Examples of legal status of new breeding irresponsible, especially given that gene editing
techniques outside the EU can lead to unintended side effects. The
Argentina is one of the first countries in the European Commission and European
world to establish a regulatory framework and Governments need to ensure that all new
to underline the legal heterogeneity that GMOs are fully tested and labelled and that all
characterizes cultures derived from New field trials are brought into line with GMO
Breeding Techniques in Resolution 173/2015. standards.", she said. (EURACTIV: Industry
It establishes a case-by-case assessment if a shocked by the European Court's decision to
product falls under the category of a GMO or put the genetically engineered technique in
not. place with GM law, 2018).
Brazil, in line with the new regulatory USDA Secretary Perdue Statement on the ECJ
resolution 16 (NR 16) published on 16 January judging genomic publishing: "We encourage
2018, the Brazilian National Biosafety Techni- the European Union to seek the contribution of
cal Commission may exempt new products the scientific and agricultural communities and
from the same assessment of the GMO its trading partners to determine the proper
regulation, which has an annex to the BNT implementation of the decision of innovations
procedures that can create a product that is not in biotechnology, such as genome editing,
considered GMO. include their benefits include healthier, high-
The United States of America, through the quality foods at affordable prices. For farmers,
United States Department of Agriculture they include improvements in productivity,
(USDA), has confirmed that it does not intend plant and animal health and environmental
to impose new or additional regulations on sustainability."(USDA Press, Release No.
crops developed by new breeding techniques, 0155.18, 2018).
such as gene editing. The agency says new
breeding methods can introduce new plant Socioeconomic aspects of new breeding
features faster and more accurately, saving techniques in plants
years or bringing farmers new varieties. Based on the position expressed by various
stakeholders, such as farmers' associations,
The position of other world stakeholders researchers and plant breeders, the ECJ's
interested in new plant breeding techniques decision is expected to have a profound impact
Jan Plagge, President of IFOAM in the EU: on European agriculture, research and trade.
"The European Court of Justice's confirmation
219
Benefits for plant growth: an authorization) detailing the modified DNA
• increased yield, sequence of the gene region being edited and
• reducing the use of natural resources, providing complete details of the organism
• reducing dependence on chemical protection itself (example variety), it would be possible
• contribution to biodiversity, To identify if an unknown sample corresponds
• adapting to changing conditions. to the edited variety. This clearly shows that
the unknown sample originates from a gene
Benefits for farmers with an edited genome, but it is not a direct
• Increased resistance to biotic and abiotic proof that the sample was from an edited
stress factors (reduced pesticide treatment). genome.
• Reducing the impact on the environment. • If the suspect sample originates from a
• Improving land and investment efficiency. cultivated plant, the sample genome could be
• Improving crop efficiency and product compared to a genomic reference database of
diversity. non-genomic varieties of that plant to identify
• Rapid adaptation to climate change. DNA sequence differences. Differences would
• Longer preservation time, so less food waste. be modifications by genome editing. This is a
• Development of the plant breeding sector poor assumption because new mutations could
(selection of edible species from wild have occurred (naturally or by mutagenesis) in
populations, selection of plant species with any variety in each generation. The proposal to
desired characteristics) (Figure 3). set up a database for genomic comparisons
would be a very large economic effort. There
are 14,442 varieties of wheat bread, Durham
wheat, maize, soy beans, barley, rape, rape and
potatoes registered in the EU, as shown by the
European Commission's plant varieties
database.
From Wikipedia, there are 7500 apple varieties
and 10,000 varieties of tomatoes, without their
varieties. This very costly way may be
impossible to put into practice and would
Figure 3. Highlights for plant breeding provide relative proofs.
Source: www.nbtplatform.org
Editing corn genome through ribonucleo-
Problem of detected genome edited protein complexes
Modifications of the DNA sequence introduced The biolistic introduction of Cas9-gARN
by genomic editing methods are not presently ribonucleoproteins pre-assembled as ribonu-
identified, as compared to DNA sequence cleoprotein complexes into maize embryo cells
changes produced by natural processes or by particle bombardment and plant regene-
conventional mutagenesis. The exception is ration with mutant alleles and edited was
when genome editing is used to introduce more successfully performed, using this method,
than two base pair changes into DNA at a DNA-tagged DNA mutagenesis is also
single location, these being less likely to be obtained in maize (Zhang et al., 2016).
natural or mutagenic. Four genomic regions, liguleless1 (LIG),
If there is no information about the changes acetolactate synthase (ALS2), and two male
introduced (no known target), it is difficult to fertility genes (MS26 and MS45) were targeted
detect the changes. Detection could only be by pre-assembled Cas9 protein pre-assembled
possible with a suitable reference genome for with in vitro transcribed gRNAs. Cas9-gRNA
comparison (Lusser et al., 2011). complexes were delivered to corn embryonic
cells on gold particles (0.6 μm) using a helium
Ways suggested to detect the genome edited gene gun. Total genomic DNA was extracted
• If a body with the genome edited has and fragments surrounding the target sequences
undergone a documentation process (example were amplified by PCR and analysed by
220
sequencing (Table 2). Mutations were found at Because of their unique characteristics,
all target sites where the Cas9-gARN com- carotenoids can function as modulators of
plexes were provided (Svitashev et al., 2016). membrane structures, a hypothesis that has
been tested in bilateral lipid models mixed with
Table 2. Mutations in corn embryonic cells different carotenoids in vitro.
Source: www.ncbi.nlm.nih.gov The way in which carotenoids are captured
Target Cas9 DNA
Cas9
g
(Figure 4) in the membrane depends on the
site
Target site sequence with PAM
(%) (%) ARN trans or cis configuration and leads to different
(%)
LIG GCGTACGCGTACGTGTGAGG 0.004 0.56 0.57 ways of membrane integration (Widomska et
ALS2 GCTGCTCGATTCCGTCCCCATGG 0.020 0.51 0.45 al., 2009).
MS26 GCACGTACGTCACCATCCCGCCGG 0.004 0.43 0.21
MS45 GGCCGAGGTCGACTACCGGCCGG 0.002 0.34 0.69
To measure the frequency of plant-level
mutations, 60 bombarded embryos were placed
on growth medium and 36 segments of
herbicide-resistant callus segments, which were
tested for mutations, were regenerated. Of the
36 events, 17 (47%) contained mutant alleles
and 19 (53%) had only wild type alleles. The Figure 4. Carotenoid lipid interactions
ability to provide Cas9-gARN complexes on Source: www.pure.royalholloway.ac.uk
gold particles in corn cells combined with the
high frequency of mutant plant recovery DNA for the coding sequences of the genes of
without selection makes this approach practical interest was obtained from Escherichia coli
for genome editing in cultured species. The DH5a genomic DNA samples and Rhesus
results obtained on maize provide new oppor- capsicum annuum (sweet pepper) RNA
tunities for advancement of agricultural repro- samples for plastid extraction (Cheng and
ductive practices for any species of plants Jiang, 2006).
subject to biolytic delivery (Svitashev et al., An optimized vector used for overexpression of
2016). bacterial carotenoid genes crtZ and crtW was
used as a source for promoter and terminator
Differential accumulation of carotene in parts of the constructs created (Misawa and
tomatoes by chromoplasts Shimada, 1998).
Carotenoids are high-value compounds for the Qualitative confirmation for expression of the
food industry. The global market for these coding sequences was performed by PCR
substances will grow to $ 1.95 billion by 2025, method.
based on an annual growth rate of 5.1% The selected lines were mutant lines disrupted
(Accuray Research LLP, 2017). in the overexpressed carotenoid biosynthesis of
Tomato (Solanum lycopersicum) is the plant the psy1, crt-iso, LCY-b and crt1 genes (Ailsa
model for carotenoid-related studies because Craig). Sub-chromoplastic fractions show the
the fruits contain high levels. The study of a accumulation of specific carotenoids, which
tomato line specifically designed for a higher may have changes at the grip sites. An im-
capacity of carotenoid accumulation via the portant modifier of the grip preference is the
PSY1 gene (psy1 - the carotenoid biosynthesis "cis" or "trans" (Widomska et al., 2009).
enzyme) has led to the observation of These structural changes specifically modify
chloroplast differentiation in chromoplasts in the membrane integration of carotenoids
immature fruits. (Gruszecki and Strzalka, 2005).
The PSYsense overexpression line has a The significantly higher capacity of chro-
phenotype in which the associated carotenes moplast accumulation allows them to function
accumulate at the onset of fruit growth, as a storage reservoir for carotenoids compared
resulting in a pink-orange colour of the mature to chloroplasts (reviewed by Egea et al., 2010).
green fruit (Fraser et al., 2007). The increase in carotenoid content occurs
simultaneously with chloroplast differentiation
221
in chromoplast, because the chromoplastic are well understood by consumers, the true
structures are found in the immature fruits of beneficiaries of research and innovation in the
the PSY-1 sense line (Fraser et al., 2007). agro-food industry.
More regulation will be needed to apply new
plant breeding techniques to ensure that they
are used responsibly without slowing down
development and research. Generally, new
mutagenesis techniques are faster and cheaper
than conventional reproductive techniques.
There are already several plants generated with
the new mutagenesis techniques that are near or
in the phase of field testing or marketing.
By editing the genome, mutations can be
targeted. Depending on the technique, non-
Figure 5. Different accumulation of carotenoids specific mutations (allele insertion) or specific
Source: www.pure.royalholloway.ac.uk mutations (oligonucleotide genetic mutation,
targeted insertion) can be rapidly introduced
Early activation of the PSY1 enzyme results in into a desired gene, creating a desired donor
the accumulation of carotenoids and the allele. In polyploid plant species (wheat), all
differentiation of chloroplasts in chromoplasts homologous copies of a gene may be targeted
in immature fruits that have the green crown, at the same time, so that traits that may be
but the tissues are orange pink. obtained with great difficulty through trade-
Was observed two-fold increase in total tional mutagenesis can be obtained.
carotenoid content (lycopene and β-carotene) Mutagenesis would allow farmers to combat
for the PSY-1 sense line compared to control. the pests of plants resistance of pesticides,
This growth is explained by the occurrence of increase yields and improve the nutritional
phytotecine (6.4 μg), phytophluene (4.3 μg), z- content of crops, and allow Europe to remain
carotene (4.7 μg) and lycopene (2.0 μg) and competitive with other major agricultural
lutein growth (1.5 times) carotene and powers, such as the US and Brazil.
xanthophils (1.5 times). (Nogueira et al., 2013). The results obtained in plants such as corn and
Over-expression of psy1 in the PSY-1 sense tomatoes open new opportunities to develop
line gives a similar response to immature fruits. new reproductive practices in a wide variety of
Chromoplastic differentiation in tomato fruits cultured species. The ability to provide Cas9-
occurs at the onset of maturation and regulates gARN complexes on gold particles in corn
carotenoid biosynthesis at transcriptional level cells combined with the high frequency of
(Llorente et al., 2016; Toledo-Ortiz et al., mutant plant recovery without selection makes
2014). this approach practical for genome editing in
cultured species. Tomato mutant lines appear
CONCLUSIONS due to overactive or inactive key steps in
carotenoid synthesis, and the significantly
There are still many uncertainties about the use higher capacity of chromoplast accumulation
of plant genome editing. Therefore, in-depth allows them to function as a reservoir for
studies are needed to ensure that these new carotenoid storage.
plant breeding technologies will have zero
risks, while maximizing benefits. The idea of REFERENCES
editing the genome could also raise ethical
questions from the public, and they should be Abdallah, N. A., Prakash, C. S., McHughen, A. G.
(2015). Genome editing for crop improvement:
approached appropriately by scientists who are Challenges and opportunities. GM Crops Food, 6(4).
well-trained in genome engineering. Educa- 183‒205.
tional discussions or workshops on genomic Ammann, K. (2016). How Should Europe Regulate
editing should also be offered to non-scientists CRISPR, New Breeding Technologies (NBTs
to ensure that the benefits of this technology [Internet]). Available from:
222
https://geneticliteracyproject.org/2016/01/15/europer European Commission Plant variety database
egulate-crispr-new-breeding-technologies-nbts http://ec.europa.eu/food/plant/plant_propagation_mat
Ananiev, E. V. et al. (2009). Artificial chromosome erial/plant_variety_catalogues_databases/search/publi
formation in maize (Zea mays L.). Chromosoma, 118. c/index.cfm?event=SearchForm&ctl_type=A,
157‒177. February 2019.
Armstrong, C. L., Green C. E. (1985). Establishment and Fraser, P.D., Enfissi, E.M.A., Halket, J.M., Truesdale,
maintenance of friable, embryogenic maize callus M.R., Yu, D., Gerrish, C., and Bramley, P.M. (2007).
and the involvement of L-proline. Planta, 164. Manipulation of Phytoene Levels in Tomato Fruit:
207‒214. Effects on Isoprenoids, Plastids, and Intermediary
Au, K. F., Underwood, J. G., Lee, L., Wong, W. H. Metabolism. The Plant Cell, 19. 3194-3211.
(2012). Improving PacBio long read accuracy by Funk, C., Lee, R. (2015). Public and Scientists’ Views
short read alignment. PLoS ONE, 7. e46679. on Science and Society |Pew Research Center
Baktavachalam, G. B., Delaney, B., Fisher, T. L., Ladics, [Internet]. Available from:
G. S., Layton, R. J., Locke, M. E. et al. (2015). http://www.pewinternet.org/2015/01/29/public-
Transgenic maize event TC1507: Global status of andscientists-views-on-science-and-society/,
food, feed, and environmental safety. GM Crops February 2019.
Food, 6(2). 80‒102. DOI: Gordon-Kamm, W. et al. (2002). Stimulation of the cell
10.1080/21645698.2015.1054093 cycle and maize transformation by disruption of the
Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. plant retinoblastoma pathway. Proc. Natl Acad. Sci.
J., Nekrasov, V. (2015). Editing plant genomes with USA, 99. 1975‒11980 (2002).
CRISPR/Cas9. Current Opinion in Biotechnology, Holland, J. B. (2007). Genetic architecture of complex
32. 76‒84. DOI: 10.1016/j.copbio.2014.11.007 traits in plants. Curr Opin Plant Biol., 10(2).
Bortesi, L., Fischer, R. (2015). The CRISPR/Cas9 156‒161.
system for plant genome editing and beyond. Hsu, P. D. et al. (2013). DNA targeting specificity of
Biotechnology Advances, 33(1). 41‒52. DOI: RNA-guided Cas9 nucleases. Nat. Biotechnol. 31.
10.1016/j.biotechadv.2014.12.006 827‒832.
Broeders, S. R. M., De Keersmaecker, S. C. J., Roosens, Huang, Y., Niu, B., Gao, Y., Fu, L., Li, W. (2010). CD-
N. H. C. (2012c). How to Deal with the Upcoming HIT Suite: a web server for clustering and comparing
Challenges in GMO Detection in Food and Feed. biological sequences. Bioinformatics, 26. 680–682.
Journal of Biomedicine and Biotechnology, ID International Standard ISO 21571 (2005). Foodstuffs -
402418. Methods of analysis for the detection of genetically
Cheng, H.R., Jiang, N. (2006). Extremely rapid modified organisms and derived products - Nucleic
extraction of DNA from bacteria and yeasts. acid extraction. Genève, Switzerland: International
Biotechnol. Lett. 28. 55-59. Organisation for Standardisation.
Chilcoat, D., Liu, Z. B., Sander, J. (2017). Use of Jiang, W., Zhou, H., Bi, H., Fromm, M., Yang, B.,
CRISPR/Cas9 for Crop Improvement in Maize and Weeks, D. P. (2013). Demonstration of
Soybean. Progress in Molecular Biology and CRISPR/Cas9/sgRNA-mediated targeted gene
Translational Science, 149, 27‒46, 1st ed. Elsevier modification in Arabidopsis, tobacco, sorghum and
Inc. DOI: 10.1016/bs.pmbts.2017.04.005. rice. Nucleic Acids Research, 41(20). e188-e188.
Collard, B. C. Y., Jahufer, M. Z. Z., Brouwer, J. B., DOI: 10.1093/nar/gkt780.
Pang, E. C. K. (2005) . An introduction to markers, Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna,
quantitative trait loci (QTL) mapping and marker- J. A., Charpentier, E. (2012). A programmable dual-
assisted selection for crop improvement: The basic RNA-guided DNA endonuclease in adaptive bacterial
concepts, 169‒196. DOI: 10.4236/ajps.2014.59125. immunity. Science (80-), 337(6096). 816‒821. DOI:
Davey, M. R., Anthony, P., Power, B., Lowe, K. C. 10.1126/science. 1225829.
(2005). Plant protoplasts: status and biotechnological Kim, H., Kim, J. S. (2014). A guide to genome
perspectives. Biotechnol. Adv., 23. 131‒171. engineering with programmable nucleases. Nature
Doudna, J. A., Charpentier, E. (2014). The new frontier Reviews. Genetics, 15(5). 321‒334. DOI:
of genome engineering with CRISPR-Cas9. Science 10.1038/nrg3686
(80-), 346(6213). 1258096‒1258096. DOI: Kumar, V., Jain, M. (2015). The CRISPR-Cas system for
10.1126/science.1258096. plant genome editing advances and opportunities. J.
Eeckhaut, T., Lakshmanan, P. S., Deryckere, D., Van Exp. Bot., 66. 47‒57.
Bockstaele, E., Van Huylenbroeck, J. (2013). Kuzma, J. (2016). Policy: Reboot the debate on genetic
Progress in plant protoplast research. Planta, 238. engineering. Nature, 531(7593). 165‒167. DOI:
991‒1003. 10.1038/531165a.
Eszterhas, S. K., Bouhassira, E. E., Martin, D. I. K., Laaninen, T. (2016). New Plant-Breeding Techniques
Fiering, S. (2002). Transcriptional interference by Applicability of GM Rules [Internet]. Available
independently regulated genes occurs in any relative from:
arrangement of the genes and is influenced by http://www.europarl.europa.eu/RegData/etudes/BRIE
chromosomal integration position. Molecular and /2016/582018/EPRS_BRI(2016)582018_EN.pdf,
Cellular Biology, 22(2). 469‒479. DOI: February 2019.
10.1128/MCB.22.2.469-479.2002. Li, L., Wu, L. P., Chandrasegaran, S. (1992). Functional
domains in Fok I restriction endonuclease.
223
Proceedings of the National Academy of Sciences of Puchta, H. (2005). The repair of double-strand breaks in
the United States of America, 89(10). 4275‒4279 plants: Mechanisms and consequences for genome
Liu, X., Wu, S., Xu, J., Sui, C., Wei, J. (2017). evolution. Journal of Experimental Botany, 56(409),
Application of CRISPR/Cas9 in plant biology. Acta 1‒14. DOI: 10.1093/jxb/eri025.
Pharmaceutica Sinica B, 7(3). 292‒302. DOI: SAM 2018. Statement by the Group of Chief Scientific
10.1016/j.apsb.2017.01.002. Advisors: A Scientific Perspective on the Regulatory
Llorente, B., D'Andrea, L., Ruiz-Sola, M.A., Botterweg, Status of Products Derived from Gene Editing and
L., Pulido, P., Andilla, J., Loza-Alvarez, P., the Implications for the GMO Directive.
Rodriguez-Concepcion M. (2016). Tomato fruit https://ec.europa.eu/info/sites/info/files/2018_11_gcs
carotenoid biosynthesis is adjusted to actual ripening a_statement_gene_editing_1.pdf, February 2019.
progression by a light-dependent mechanism. Plant Shin, J., Jiang, F., Liu, J. J., Bray, N. L., Rauch, B. J.,
J., 85. 107-119. Baik, S. H. et al. (2017). Disabling Cas9 by an anti-
Lowe, K., Wu, E., Wang, N., Hoerster, G., Hastings, C., CRISPR DNA mimic. Science Advances, 3(7).
Cho, M. J. et al. (2016). Morphogenic regulators e1701620. DOI: 10.1126/sciadv.1701620.
baby boom and Wuschel improve monocot Sprague, G. F., Brimhall, B., Hixon, R. M. (1943). Some
transformation. Plant Cell., 28(9). 1998‒2015. DOI: effects of the waxy gene in corn on properties of the
https://doi.org/10.1105/tpc.16.00124. endosperm Starch1. Agronomy Journal, 35(9). 817.
Lowder, L. G., Zhang, D., Baltes, N. J., Paul, J. W., Sprink, T., Eriksson, D., Schiemann, J., Hartung, F.
Tang, X., Zheng, X. et al. (2015). A CRISPR/Cas9 (2016). Regulatory hurdles for genome editing:
toolbox for multiplexed plant genome editing and Process- vs. product-based approaches in different
transcriptional regulation. Plant Physiology, 169(2). regulatory contexts. Plant Cell Reports, 35(7).
971‒985. DOI: 10.1104/pp.15.00636 1493‒1506. DOI: 10.1007/s00299-016-1990-2.
Luo, M., Gilbert, B., Ayliffe, M. (2016). Applications of Steenhuyse L. Van (2017). DuPont Pioneer’s Next
CRISPR/Cas9 technology for targeted mutagenesis, Generation of Waxy Corn Shows the Green Side of
gene replacement and stacking of genes in higher CRISPR-Cas9 [Internet]. Available from:
plants. Plant Cell Rep., 35. 1439‒1450. https://biovox.eu/insights/detail/dupont-pioneer-
Lusser, M., Parisi, C., Plan, D., Rodríguez-Cerezo, E. rsquo-s-next-generation-of-waxy-corn-shows-the-
(2011) New plant breeding techniques. State-of-the- green-side-of-crisprcas9, February 2019.
art and prospects for commercial development. Sternberg, S. H., Redding, S., Jinek, M., Greene, E.
European Commission, JRC-IPTS, p 218. C., Doudna, J. A. (2014). DNA interrogation by the
Misawa, M., Shimada, H. (1998) Metabolic engineering CRISPR RNA-guided endonuclease Cas9. Nature,
for the production of carotenoids in non 507(7490), 62‒67. DOI: 10.1038/ nature13011.
carotenogenic bacteria and yeasts, J. Biotechnol. Svitashev, S. et al. (2016). Genome editing in maize
59(3). 169-181. directed by CRISPR–Cas9 ribonucleoprotein
Nelson, O. E., Rines, H. W. (1962). The enzymatic complexes. Nat. Commun., 7, 13274 doi:
deficiency in the waxy mutant of maize. Biochemical 10.1038/ncomms13274.
and Biophysical Research Communications, 9(4). Toledo-Ortiz, G., Huq, E., Rodríguez-Concepción, M.
297‒300. (2010) Direct regulation of phytoene synthase gene
Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., expression and carotenoid biosynthesis by
Shehata, S. I., Dohmae, N. et al. (2014). Crystal phytochrome-interacting factors. Proc. Natl. Acad.
structure of Cas9 in complex with guide RNA and Sci. USA, 107, pp. 11626-11631
target DNA. Cell., 156(5). 935‒949. DOI: Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. (2013).
10.1016/j.cell.2014.02.001. RNA-guided genome editing for target gene
Nogueira, M., Mora, L., Enfissi, E.M.A., Bramley, mutations in wheat. G3 (Bethesda), 3(12).
P.M., Fraser, P.D. (2013) Subchromoplast 2233‒2238. DOI: 10.1534/g3.113.008847
sequestration of carotenoids affects regulatory Voytas, D. F., Gao, C. (2014). Precision genome
mechanisms in tomato lines expressing different engineering and agriculture: opportunities and
carotenoid gene combinations. Plant Cell, 25. 4560- regulatory challenges. PLOS Biol., 12, e1001877.
4579 Yang, H., Wang, H., Jaenisch, R. (2014). Generating
Papapetrou, E. P., Schambach, A. (2016). Gene insertion genetically modified mice using CRISPR/Cas-
into genomic safe harbors for human gene therapy. mediated genome engineering. Nature Protocols,
Molecular Therapy, 24(4). 678‒684. DOI: 9(8). 1956‒1968. DOI:10.1038/nprot.2014.134.
10.1038/mt.2016.38. Yi, Zhang et al. (2016). Efficient and transgene-free
Piatek, A., Ali, Z., Baazim, H., Li, L., Abulfaraj, A., Al- genome editing in wheat through transient expression
Shareef, S. et al. (2015). RNA-guided transcriptional of CRISPR/Cas9 DNA or RNA. Nat. Commun., 7,
regulation in planta via synthetic dCas9-based 12617.
transcription factors. Plant Biotechnology Journal. Yin, K, Gao, C, Qiu J. L. (2017). Progress and prospects
13(4), 578‒589. DOI: 10.1111/pbi.12284. in plant genome editing. Nature Plants, 3(8), 17107.
Puchta, H., Fauser, F. (2014). Synthetic nucleases for DOI: 10.1038/nplants.2017.107.
genome engineering in plants: Prospects for a bright Widomska, J., Kostecka-Gugała, A., Latowski, D.,
future. Plant Journal, 78, 727‒741. DOI: Gruszecki, W.I., Strzałka, K. (2009) Calorimetric
10.1111/tpj.12338 studies of the effect of cis-carotenoids on the
224
thermotropic phase behavior of phosphatidylcholine technology. Journal of Genetics and Genomics,
bilayers. Biophys Chem, 140. 108–114. 43(5), 251‒262. DOI: 10.1016/j.jgg.2016.03.001.
Waltz, E. (2016). Gene-edited CRISPR mushroom Zhou, H., Liu, B., Weeks, D. P., Spalding, M. H., Yang,
escapes US regulation. Nature, 532(7599), 293‒293. B. (2014). Large chromosomal deletions and
DOI: 10.1038/nature.2016.19754. heritable small genetic changes induced by
Wolt, J. D., Wang, K., Yang, B. (2016). The Regulatory CRISPR/Cas9 in rice. Nucleic Acids Research,
Status of Genome-edited Crops. 4 (October 2015), 42(17). 10903‒10914. DOI: 10.1093 /nar /gku806.
510‒518. DOI: 10.1111/pbi.12444 Zimin Aleksey V., Daniela Puiu, Richard Hall, Sarah
Woo, J. W. et al. (2015). DNA-free genome editing in Kingan, Bernardo J. Clavijo, Steven L. Salzberg
plants with preassembled CRISPR-Cas9 (2017). The first near-complete assembly of the
ribonucleoproteins. Nat. Biotechnol., 33. 1162‒1164. hexaploid bread wheat genome, Triticum aestivum.
Zhang, D., Li, Z., Li, J. F. (2016). Targeted gene Gigascience.
manipulation in plants using the CRISPR/Cas www.nbtplatform.org, September 2018.
225
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
INFLUENCE OF LACTATION ON COMPOSITION OF MARE'S MILK
Zamfir MARCHIȘ1, Adina Lia LONGODOR1*, Răzvan A. CODEA2, Igori BALTA1,
Aurelia COROIAN1
1
University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca, Faculty of Animal
Science and Biotechnology, 3-5 Mănăştur Street, Cluj-Napoca, Romania
2
University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca, Faculty of
Veterinary Medicine, 3-5 Mănăştur Street, Cluj-Napoca, Romania
*Correspondent author email: [email protected]
Abstract
Mare's milk is valuable because of its nutritional properties. It is used in human food and tartamente for various
diseases. Mare milk changes its composition depending on the lactation. It has the lowest values in first and second
lactation in lactating 3, the highest values. The fat content varies between 1.88 g/100 g (lactation 1) and 2.17 g/100 g
(lactation 3). Milk protein varies between 1.74 g/100g (lactation 1) and 1.92 g/100 g (lactation 3). For colostrum,
affecting all day postpartum physico-chemical parameters. The highest values for these parameters are within 3 days
postpartum. On day 5, the low values are observed. The fat content of the colostrum varies between 2.85 g/100 g, on
day 1, and 2.13 g/100 g, on day 5.
Key words: mare milk, colostrum, fat, protein, lactose.
INTRODUCTION processes applied (Doreau et al., 1989;
Uniacke-Lowe et al., 2010; Orlandi et al., 2003;
Markiewicz-Keszycka et al., 2015; Cosentino
Mare's milk is used in food, cosmetics and
et al., 2015; Caroprese et al., 2007). Aim of the
medical. It is used for various diseases
study was to evaluate the influence of lactation
(tuberculosis, liver disease, gastritis, allergies)
and postpartum day on milk and colostrum
(Doreau et al., 1989; Salhanov et al., 1979;
Malacarne et al., 2002). Mare's milk from the mare.
composition (high content of protein and MATERIALS AND METHODS
globulin, essential amino acids, fatty acids) it is
Sampling. Milk was collected from a total of 5
advisable to cancer patients, people with low
copies per lactation. And samples were
immunity, heart problems, those suffering from
collected according to the postpartum period
atherosclerosis (Kharitonova et al., 1978, Mao
(day 1, 3, 5). Were studied animals breed
et al., 2009; Chen et al., 2010; Jirillo et al.,
Semigreu Românesc. It was chosen race,
2010). Studies on the milk and colostrum from
Semigreu Românesc because heavy breeds
the mare are: the influence of lactation on the
have a higher milk production. Sampling was
chemical composition of mare's milk; influence
performed manually in sterile containers and
on nutrient colostrum postpartum day; mare's
stored in the cold until analysis.
milk benefits; caseins in milk distribution;
Physico-chemical analysis. Analysis of
mare's milk protein (Wells et al., 2012;
physico-chemical parameters of milk and
Salamon et al., 2009; Mateja et al., 2014;
colostrum from the mare were analyzed with
Solaroli et al., 1993; Malacarne et al., 2000;
the device Lactoscan S (Figures 1 and 2).
Klemen et al., 2011). Quality, composition and
Physico-chemical parameters are analyzed
production of mare milk are influenced by:
milk: fat, protein, lactose, and pH. Colostrum
feed, race, maintenance conditions, the process
we have examined: fat, protein, lactose, dry
of milking, milk preservation and thermal
matter and pH.
226
RESULTS AND DISCUSSIONS 7 Fat (g/100g) Protein (g/100 g)
6 6,18 6,04 5,85
5
Mare milk 4
2,17 2,85
2,2 2,56
2,09 3 2,13
2,1
2
2
1,88 1
1,9
0
1,8 Day 1 Day 3 Day 5
a
1,7
Lactation 1 Lactation 2 Lactation 3
a 4,2 4,16
Lactose (g/100 g)
4,15
1,95 1,92 4,09
Mare milk 4,1
1,9 1,86
4,05 4,01
1,85
4
1,8
1,74 3,95
1,75
1,7 3,9
Day 1 Day 3 Day 5
1,65 b
Lactation 1 Lactation 2 Lactation 3
b 25
19,61 Dry substance (g/100g)
6,85 20 16,82
Mare milk 6,81
15 13,23
6,8
6,75 10
6,75
6,71 5
6,7 0
Day 1 Day 3 Day 5
6,65 c
Lactation 1 Lactation 2 Lactation 3 c 6,8
6,75 pH
6,75
6,9 6,88
Mare milk
6,7
6,8 6,75 6,64
6,65
6,7 6,59
6,62 6,6
6,6
6,55
6,5
6,5
6,4 Day 1 Day 3 Day 5
d
Lactation 1 Lactation 2 Lactation 3 d Figure 2 (a-d). Physico-chemical parameters
Figure 1 (a-d). Physico-chemical composition of colostrum
of the mare milk on three lactations: a- fat; b-protein;
c-lactose; d-ph Figure 2 (a-d) are given values for physico-
chemical parameters of influence colostrum
postpartum day (day 1, 3 and 5).
227
Mare's milk REFERENCES
The amount of fat varies depending on the
lactation stage of lactation and in increasing Caroprese, M., Albenzio, M., Marino, R., Muscio, A.,
quantities in colostrum (Gibbs et al., 1982). Zezza, T., Sevi, A. (2007). Behavior, milk yield, and
milk composition of machine and hand-milked
The amount of the higher fat is 2.17 g/100 g, in Murgese mares. Journal of Dairy Science, 90,
3 lactation. Diet influences the composition of 2773‒2777.
the milk, a diet rich in fiber such oil and causes Chen, Y., Wang, Z., Chen, X., Liu, Y., Zhang, H., Sun,
a higher fat content (Hoffman et al., 1998). The T. (2010). Identification of angiotensine l-converting
amount of protein is influenced by the enzyme inhibitory peptides from koumiss, a
traditional fermented mare’s milk. Journal of Dairy
properties of the month lactation and changes Science, 93, 884‒892.
from one month to another (Gibbs et al., 1982). Ciesla, A., Palacz, R., Janiszewska, J., Skorka, D.
Similar values are reported for the protein of (2009). Total protein, selected protein fractions and
(Gibbs et al., 1982). Aspects of chemical elements in the colostrum and milk of
physicochemical parameters change depending mares. Archiv fur Tierzucht, 52, 1‒6.
Cosentino, C., Labella, C., Musto, M., Paolino, R.,
on the time period of lactation and colostrum Naturali, S., Freschi, P. (2015). Effect of different
are reported (Ciesla et al., 2009; Oftedal et al., physical treatments on antioxidant activity of jenny
1983; Pagliarini et al., 1993). Similar values for milk. International Journal of Agricultural Sciences,
physico-chemical composition of mare's milk 5, 874‒877.
are reported Leaflet et al., 2012. Lactose in Doreau, M., Boulot, S. (1989). Recent Knoledge on mare
milk production: A review. Livestock Production
mare's milk varies between 6.71 g/100 g, Science, 22, 213‒235.
(lactation 1) and 6.81 g/100g (lactation 3) Gibbs, P. G., Potter, G. D., Blake, R. W., McMullan, W.
(Figure 1, c). C. (1982). Milk production of quarter horse mares
during 150 days of lactation. J Anim Sci., 54(3),
Colostrum 496‒9.
Gobesso, A. O., Gonzaga, I. V. F., Taran, F. M. P.,
The fat content is influenced by the postpartum Françoso, R., Centini, T. N., Moreira, C. G., Ferreira
day (Figure 2a). The fat content of the J. R., Rodrigues, F. P., Baldi F. (2012). Influence of
colostrum is higher than milk. Similar fat supplementation on mare’s milk composition.
appearance was also reported (Pikul et al., Forages and grazing in horse nutrition, 132,
2008). Salamon et al., 2009 reports the 347‒350.
Hoffman, R. M., Kronfeld, D. S., Herbein, J. H.,
influence of the race on the chemical Swecker W. S., Cooper, W. L., Harris, P. A. (1998).
composition of colostrum according to the Dietary carbohydrates and fat influence milk
postpartum day. Values similar to those composition and fatty acid profile of mare’s milk.
obtained for the colostrum are also reported by Journal of nutrition, 128, 27088‒27118.
Salamon et al. (2009). The colostrum phase Jirillo, E., D’Alessandro, A. G., Amati, L., Jirillo, F.,
Pugliese, V., Martemucci, G. (2010). Modulation of
significantly influences the protein content in human aged immune response by donkey milk intake.
the early postpartum days (Ullrey et al., 1996). Annual Meeting of Animal Production, Heraklion,
Lactose shows higher values in the early Crete Island, Greece.
postpartum days and decreases towards the end Kharitonova, I. (1978). Fatty acids and phospholipids in
of the colostrum (4.16 g/100g day 1 and 4.01 mare’s milk. Konevodstvoi Konnyi Sport, 12, 24.
Klemen, P., Gantner, V., Kuterovac, K., Cividini, A.
g/100g day 5). The dry substance in colostrum (2011). Mare’s milk: composition and protein
is 19.61 (g/100 g) on day 1, postpartum and fraction in comparison with different milk species.
13.23 (g/100 g), 5th day postpartum. Mljekarstvo, 61(2), 107‒113.
Malacarne, M., Martuzzi, F., Summer, A., Mariani, P.
(2002). Protein and fat Composition of mare’s milk:
some nutritional remarks wirh reference to human
CONCLUSIONS and cow’s milk. International Dairy Journal, 12,
869‒877.
The physico-chemical parameters of colostrum Malacarne, M., Summer, A., Formaggioni, P., Mariani,
show the highest values in the early postpartum P. (2000). Observations on percentage distribution of
days, and decrease towards the end of the the main mare milk caseins separated by reversed-
phase HPLC. Annali Facolta di Medicina
colostrum. The physicochemical parameters of Veterinaria, Universita di Parma, 20, 143‒152.
milk change its properties according to Mao, X., Gu, J., Xu, Y. S. S., Zhang, X., Yang, H., Ren,
lactation. F. (2009). Antiproliferative and anti-tumor effect of
228
active components in equine milk. International colostrums and milk during fi ve lactation months.
Daidy Journal, 19, 703‒708. Livestock Science, 113, 285‒290.
Markiewicz-Keszycka, M., Czyzak-Runowska, G., Salamon, R. V., Salamon, S., Csapo-Kiss, Z., Csapo, J.
Wojtowski, J., Jozwik, A., Pankiewicz, R., Leska, B., (2009). Composition of mare's colostrum and milk I.
Krzyzewski, J., Strzalkowska, N., Marchewka, J., Fat content, fatty acid composition and vitamin
Bagnicka, E. (2015). Influence of stage of lactation Contents. Acta Univ. Sapientiae, Alimentaria, 2(1):
and year season on composition of mares’ colostrum 119‒131.
and milk and method and time of storage on vitamin Salhanov, B. A., Sharmanov, T. S. (1979). Treatment of
C content in mares’ milk. Journal of the Science of patients with gastric ulcer and duodenal ulcer with
Food and Agriculture, 95, 2279‒2286. the inclusion in the diet of whole camel and mare’s
Mateja, Č., Brezovečki, A., Mikulec, N., Antunac, N. milk. Dissertation of the candidate of medical
(2014). Composition and properties of mare’s milk of sciences, Bishkek.
Croatian Cold blood horse breed. Mljekarstvo, 64(1): Solaroli, G., Pagliarini, E., Peri, C. (1993). Composition
3‒11. and nutritional quality of mare’s milk. Italian Journal
Oftedal, O. T., Hintz, H. F., Schryver, H. F. (1983). of Food Science, 5, 3‒10.
Lactation in the horse: milk composition and intake Ullrey, D. E., Struthers, R. D., Hendricks, D. G., Brent,
by foals. Journal of Nutrition, 113, 2096‒2106. B. E. (1966). Composition of mare’s milk. Journal of
Orlandi, M., Goracci, J., Curadi, M. (2003). Fat Animal Science, 25, 217‒222.
composition of mare’s milk with reference to human Uniacke-Lowe, T., Huppertz, T., Fox, P. F. (2010).
nutrition. Annalidella Facolta di Medicina Equine milk proteins: chemistry, structure and
veterinaria, 56, 97‒105. nutritional significance. International Dairy Journal,
Pagliarini, E., Solaroli, G., Peri, C. (1993). Chemical and 20, 609‒629.
physical characteristic of mare milk. Italian Journal Wells, S., Ferwerda, N., Timms, L. (2012). Evaluation of
of Food Science, 4, 323‒332. Mare Milk Composition-Quality during Lactation.
Pikul, J., Wójtowski, J. (2008). Fat and cholesterol Animal Industry Report: AS 658, ASL R2719.
content and fatty acid composition of mares’
229
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
THE NUTRITIONAL AND LIFESTYLE HABITS OF THE STUDENTS'
POPULATION AT THE UNIVERSITY OF BIHAĆ AND PRESENTS
THE RISK FACTORS FOR COLORECTAL CANCER
Suzana JAHIĆ1, Jasmina CEPIĆ2, Emina MALKIĆ3
1
Biotechnical Faculty, University of Bihać, Luke Marjanovića bb, 77 000, Bihać,
Bosnia and Herzegovina
2
Public Health Institute of the Una-Sana Canton, Irfana Ljubijankića bb, 77 000, Bihać,
Bosnia and Herzegovina
3
Veterinary Institute Bihać, Omera Novljanina bb, 77 000, Bihać, Bosnia and Herzegovina
Corresponding author email: [email protected]
Abstract
Colorectal cancer is the second leading cause of death due to malignant diseases in developed countries, and the fourth
in the world, despite the fact that this disease can be cured by surgery if the diagnosis is set at an earlier stage. Risk
factors include diet, lifestyle, habits and genetic factors. People with the highest risk are those who eat low-fiber foods
and many proteins, fat and carbohydrates. People with Chron's disease also fall into a risk group. The aim of this
research was to determine the nutritional and lifestyle habits of the students' population and on the basis of the
obtained results to determine whether there are risk factors for colorectal cancer in the same population. Our results
are showing the presence of a large number of risk factors associated with colon cancer. These are a high prevalence of
increased body mass (12%) and obesity (9%), high smoking prevalence (42%), low physical activity level (54%
inactive), alcoholic beverages consumption (53% once or more weekly, 3% daily). Among nutritional habits of the
studied population of students has noticed a high intake of meat and meat products, and a low intake of fish and fruits
and vegetables.
Key words: colorectal cancer, risk factors, students, nutritional habits.
INTRODUCTION is the immutable factors such as age and family
anamnesis (Banjari & Fako, 2014). Though the
Cancer is one of the leading cause of death risk factors can influence on the development
over the world, and colorectal cancer there is in of cancer, most of them don't directly influence
the third place of the malignant diseases in the the development of cancer. It is very important
world in the men and women. The incidence of to note that the nutritional and lifestyle habits
cancer increases with the age of the population, overcome the genetic predisposition of the
starts at the age of 40th, significantly grows in person for the development of colorectal cancer
50th, and later grows with geometric (Johnson et al., 2013).
progression (Marković Bergman, 2015). According to data of the World Cancer
According to registered data of the Institute for Research Fund International (2007), almost
the public health of the Una-Sana Canton, in one-third adult in the whole world isn't enough
the period of 2012-2016, the number of physically active. The physical activity protects
incidences of malignant diseases colorectal the human body of the development of
cancer were 93 suffering from this illness, 53 colorectal cancer.
men and 43 women (data of the Institute for the Some studies showed that smokers have
public health of the Una-Sana Canton, 115/18). increased the risk for the mortality causes with
The risk factors associated with etiology to colorectal cancer opposite nonsmokers
colorectal cancer can be divided into two (Leufenks et al., 2011).
categories. There are the shreds of evidence which showed
The first is the risk factors which can be that the consummation of the alcoholic
controlled, and they are in the relationship with beverages increased the risk of the following
nutritional and lifestyle habits, and the second types of carcinoma: intestine (colorectal),
230
breast, mouth, pharynx and larynx, esophagus examination, and they got the instructions for
(carcinoma of the laminar cells), liver and the filling of the questionnaire. Anthropometric
stomach. data about body mass and height filled the
The persons who consume in average 2 to 4 respondents ourselves.
alcoholic beverages per day, they have 23% From these data, it was calculating the body
more highest risk of colorectal cancer, mass index (BMI), and regarding obtained
compared to those who consume less of one results, all respondents were categorized in the
alcoholic beverage per day (ASC, 2011). four groups following the world standards.
The students have a bad nutritional habits, The body mass index was calculated that the
because of different obligations, they have the body mass of the respondent (kg) divided with
tendency of the skipping some meals, less the square of the height (m) (Grujić, 2002).
choice of the food, more often they consume The given results were analyzed by applying
unhealthy food for the snack, and they consume the corresponding mathematical-statistical
the inadequate meal in terms of nutrition, what methods, and it was assessed the significance
can negatively affect on the mental activity and of the obtained results.
possibility of the learning. The level of significance p<0.05 was used for
With bad nutritional habits, there are bad all comparisons and for the discussion of the
lifestyle habits, such as decreasing of the obtained results. For comparing the data inside
physical activity, the consummation of and outside the groups used the Fisher’s test.
alcoholic beverages and smoking (Banjari et The differences between two independent
al., 2011.) groups were tested with nonparametric Mann-
The aim of this work was the establish the Whitney U test.
nutritional and lifestyle habits of the students'
population at the University of Bihać and on RESULTS AND DISCUSSIONS
the basis of the obtained results, determine
which the risk factors there are present for the The average age of the respondents (Table 1)
appearance of colorectal cancer. was 21 years for the women and 22.09 for the
men. The range for the men was from 18 to 32
MATERIALS AND METHODS years, and the range for the women was from
18 to 27 years.
The examination was carried among the Table 1. The average age of the students
students at the University of Bihać during
October - December 2018 year. Student n %
Average ± Range
p
SD (min.-max.)
The experiment included 100 respondents, 46
men, and 54 women. For the purpose of this Male 46 46 22.09 ± 3.02 18-32
experiment, it was developed an anonymous 0.06015
Female 54 54 21.00 ± 2.33 18-27
questionnaire which consisted of four parts. In
the first part of the questionnaire, there were p - Mann-Whitney U test
the general characteristics of the students
In Table 2 there are the results of the
population (age and sex), in the second part,
respondent's body mass index, and in Table 3
there were the questions about life habits of the
there is the distribution of the respondents by
students (consumption of water during a day,
categories of the nutritional status in relation to
consumption of alcoholic beverages, smoking,
body mass index.
and physical activities), the third part was
established on the family anamnesis, and in the Table 2. Body mass index
fourth part was the nutritional habits of
students (for example, the number of meals, the Student n %
Average ±
SD
Range
(min-max)
p
frequency of some food consumption).
The participation in this examination was on a Male 46 46 25.15 ± 3.77 17.3-38.7
5.276
voluntary basis, and before the respondent Female 54 54 22.33 ± 2.64 17.3-28.9 x10-5**
filled in the questionnaire, he or she was Mann-Whitney U test, ** statistical significance p = 0.01
informed about the purpose of this
231
Table 3. Categories of respondents according to body mass index
Category n % % p
Malnutrition M F M F M+F
M F
19.15 ± 1.22 18.15 ± 0.58 0.1066
6 4 13.0 7.4 10
Min. = 17.3 Min.= 17.3
Max.= 20.5 Max.= 18.6
Normal body mass n % %
M F M F M F M+F
24.22±1.56 22.1±1.84 7.171 x10-5**
Min. = 20.8 Min.= 19.1 24 45 52.2 83.3 69
Max.= 26.3 Max.= 25.7
Increased body mass n % % 0.1611
M F M F M F M+F
27.34±0.41 27.0±0.36
Min. = 26.2 Min.= 26.6 9 3 19.5 5.5 12
Max.= 27.8 Max.= 27.3
Obesity of 1. degree n % % 0.4642
M F M F M F M+F
30.66 ± 3.69 28.6 ± 0.42
Min = 27.9 Min= 28.3 7 2 13.0 3.7 9
Max= 38.7 Max= 28.9
Obesity of 2. degree n % %
M F M F M F M+F
38.7 0 1 0 2.17 0 1
n - number of respondents, M- male, F - female, Mann-Whitney U test
**statistical significance p = 0.01
Table 4. Life habits of respondents
n % %
Question The offered response p
M F M F M+F
Never 20 14 43.4 25.9 34
1. How often do you drink
1 to 3 times a day 21 33 45.6 61.1 54 0.18829
coffee?
More than 3 times a day 5 7 10.9 12.9 12
2. Do you smoke Yes 18 24 39.1 44.4 42
0.68546
cigarettes? No 28 30 60.9 55.5 58
Every day 3 0 6.5 0.0 3
3. How often do you drink
1 to 3 times a week 27 26 58.7 48.1 53 0.04383*
alcohol?
Never 16 28 34.8 51.9 44
I am totally inactive 20 34 43.5 63.0 54
4.How physically active I recreate 30 minutes a day for the
17 14 37.0 25.9 31 0.14065
you are? whole year
I'm actively involved in sports 9 6 19.5 11.1 15
n - number of respondents, M-male , F - female, Fischer's exact test, * statistical significance p = 0.05
Table 5. Family history respondents
n % %
p
M F M F M+F
1. Has anyone in the immediate family Yes 2 4 4.3 7.4 6
0.68792
been suffering from colon cancer? No 44 50 95.7 92.6 94
Yes 1 1 2.2 1.9 2
2. Are you on long-term antibiotic
I was 1 2 2.2 3.7 3 1.0
therapy?
No 44 51 96.5 94.4 95
Diabetes 22 20 47.8 37.0 42
Thyroid disease 6 10 13.0 18.5 16
3. Did anyone in your family have, or
Increased blood pressure 20 24 43.5 44.4 44 0.54268
have the following diseases?
Increased fat in the blood 11 14 23.9 25.9 25
Some other form of cancer 3 9 0.07 0.17 12
n - number of respondents, M-male, F - female, Fischer's exact test
232
In the first category of the malnutrition persons, percentage of men who consume alcohol and
there are 13.0% men and 7.4% women, until, in strong alcoholic drinks more often than
the second category of the normal body mass, women.
there are 52.2% men and 83.3% women. Most Regard to physical activity, the conclusion is
of the students have a normal body mass (total that students are inactive, as many as 63.0% of
69%), but there is a prevalence of the increased women and 43.5% of men (both 54%) is totally
body mass and obesity (12% students have physically inactive. Physiological
increased body mass, and 9% students have the characteristics, such as obesity, decreased
obesity of first degree). There are 19.5% men physical activity and increased body mass
with increased in body mass, compared to index (BMI) can increase the risk of colorectal
women (5.5%), while in the 1. degree obesity cancer. Healthy body weight, physical activity,
there are 13.0% of men and 3.7% of women. and proper nutrition reduce the risk of cancer.
Increased body mass is an important risk factor With a change in lifestyle, the risk of colon
for colorectal cancer (Banjari & Fako, 2014). cancer can be reduced by as much as 60-80%.
According to Kushi et al. (2006), in the USA, Physical inactivity may also be one of the
one third from 572,000 carcinoma deaths causes of a weaker bowel discharge, and thus
during the year, can be attributed to nutrition increases an exposure time of the organism to
and physical activity, including increased body potentially toxic metabolites, which also
mass and obesity, and the other deaths were represents one of the risk factors for the
caused by exposure to tobacco products. appearance of colon cancer (Cummings &
54% of students drink coffee 1 to 3 times a day Bingham, 1998; Banjari & Fako, 2014). A
(61.1% women and 45.6% men). 43.4% of men positive family history of colorectal cancer was
never drink coffee, opposite 25.9% of women found in 4.3% of men and 7.4% of women (6%
(Table 4). With caffeine, coffee contains both) (Table 5). However, we do not ignore the
numerous polyphenols that act as antioxidants. high incidence of diseases that have been
In the case of colon cancer, cafestol and associated with studies with an increased risk
kahweol from coffee can be reducing the risk for colon carcinoma, such as diabetes (47.8%
of illness by reducing the secretion of bile acids men and 37% women; 42% both), high blood
into the colon (Naganuma et al., 2007). At the pressure 44% both respondents. Also,
other side, these substances increase the level inflammatory bowel disease poses a risk for
of serum cholesterol, which is a risk factor for colon cancer (Johnson et al., 2013).
the development of cardiovascular disease 90% of established cases of colon cancer are in
(Urgert et al., 1995). direct connection with nutritional habits
According to the results of this survey, 42% of (Banjari & Fako, 2014). The results of this
respondents are an active smoker, with a higher research shown in Table 6, show that one meal
percentage of women smokers, 44.4%, with daily eats 6% of respondents, then 2 to 4 meals
regard to 39.1% men. Smoking is a significant a day consumed 80% of respondents, and 5 and
risk factor for the illness of colorectal cancer more meals daily consume 14% of respondents.
(Banjari & Fako, 2014). Smokers have an The home-cooked meal is most commonly con-
increased risk of mortality due to colon cancer sumed by 84% of students. Men (10.9%) less
with regard to non-smokers (Leufkens et al., consume fast food than women (16.7%).
2001; Colorectal cancer, 2008). According to the results of this survey, the
According to the results of these surveys, 6.5% conclusion is that students have a lower daily
men drink alcohol every day, however, a large intake of water than the recommended amount,
percentage of people who consume alcohol 2300-2700 grams of water per day (Grujić,
once or three times a week have been recorded 2000). 62% of students drink 0.5 to 1.0 L water
(58.7% men and 48.1% women). Men are more a day, women 70.4%, and man 52.2%. 32% both
likely to consume alcohol than women. Colić of students drink recommended amount 2 to 3 L
Barić et al. (2003) points out that the higher water a day, 39.1% men, and 25.9% women.
233
Table 6. Nutritional habits of respondents
n % % p
M F M F M+F
5 and more 8 6 17.4 11.1 14
1. How many meals do you
2-4 34 46 73.9 85.2 80 0.37835
consume during the day?
1 4 2 8.7 3.7 6
A homemade meal 39 45 84.8 83.3 84
2. What do you eat most often? Bakery, Fast food 5 9 10.9 16.7 14 0.22998
Restaurants 2 0 4.3 0.0 2
1 or more times a day 11 5 23.9 9.2 16
3. How often do you eat fast food? Up to 5 times a week 28 40 60.9 74.1 68 0.14812
Never 7 9 15.2 16.7 16
0,5 – 1,0 L 24 38 52.2 70.4 62
4. How much water do you drink
2,0 – 3,0 L 18 14 39.1 25.9 32 0.14851
during the day?
More than 3 L 4 2 8.7 3.7 6
1 to 2 times a day 17 20 37.0 55.6 37
5. How often do you eat fermented
Up to 5 times a week 28 16 56.5 29.6 42 0.00112**
dairy products?
Never 3 18 6.5 14.8 21
1 to 2 times a day 18 28 39.1 51.9 46
6. How often do you eat fresh
Up to 5 times a week 25 24 54.3 44.4 49 0.44346
fruits?
Never 3 2 6.6 3.7 5
1 to 2 times a day 15 15 32.6 27.8 30
7. How often do you eat
Up to 5 times a week 24 28 52.2 51.8 52 0.79858
vegetables?
Never 7 11 15.2 20.4 18
1 to 2 times a day 18 16 39.1 29.6 34
8. How often do you eat fresh
Up to 5 times a week 22 25 47.8 46.3 47 0.32631
vegetables in the form of salads?
Never 6 13 13.1 24.1 19
1 to 2 times a day 9 11 19.6 20.4 20
9. How often do you eat potatoes? Up to 5 times a week 35 41 76.1 75.9 76 1.0
Never 2 2 4.3 3.7 4
1 to 2 times a day 13 15 28.3 27.8 28
10. How often do you eat meat? Up to 5 times a week 33 38 71.7 70.4 71 1.0
Never 0 1 0.0 1.8 1
1 to 2 times a day 15 14 32.6 25.9 29
11. How often do you eat pate,
Up to 5 times a week 21 33 45.6 61.1 54 0.28108
chicken, salami, etc?
Never 10 7 21.8 13.0 17
1 time a day 5 3 10.9 5.6 8
12. How often do you eat fish
2 to 3 times a week 18 35 39.1 64.8 54 0.03408*
and/or sea fruits?
Never 23 16 50.0 29.6 39
n - number of respondents, M-male, F - female, Fischer's exact test, *statistical significance p = 0.05
**statistical significance p = 0.01
According to the results of the frequency of consume fruit up to 5 times per week, and 46%
consuming fermented dairy products, it was of total respondents consume fruits 1 to 2 times
found that 14.8% of women never consumed a day. On the other side, fruits are more
this type of product, also 6.5% of men. consumed than vegetables (only 5% of the total
The components in dairy products that number of respondents never eats fruits). Low
protectively affect against colon cancer include intake of vegetables, ie. vitamins, and minerals,
calcium and vitamin D (World Cancer as well as dietary fiber, is associated with
Research Fund, 2007). Specific cultures of increased risk for colon cancer (Banjari &
lactic acid bacteria which used in the fermen- Fako, 2014).
tation of milk, fall into antimutagenic and The components of fruit, that can provide the
anticarcinogenic substances (Strnad & Babuš, protective role of colon cancer are carotenoids,
1997). Fermented dairy products contain vitamin C, flavonoids, isothiocyanates and
Lactobacillus strains that produce lactic acid. glucosinolates (Turner et al., 2004). A diet rich
Some studies suggest that probiotics produce in red meat, and poor in fruits and vegetables
short-chain fatty acids in the colon, which can increases the risk of developing colon cancer.
reduce the content of the pro-carcinogenic Flavonoids there are in citrus fruits, apples,
enzymes (Divisi et al., 2006). onions, green leafy spices (celery, parsley, and
18% of respondents (20.4% of women and nuts), teas, black wine, soy, cherry,
15.2% of men) never consume vegetables, and strawberries. Polyphenols may have anti-
19% are never consumed fresh vegetables in inflammatory, antiallergic and anticancer
the form of salads. 49% of respondents activity (Jakobek et al., 2008).
234
Nutrition rich in vegetables, especially recorded in 29% of students; 71% of students
cauliflower, broccoli, apricot and cabbage consume meat five times a week, fast food
(Brassicaceae family), tomato and legumes, consumed once or more times during the day
suggests a preventative effect from the by 16% of students.
development of digestive system cancer. In order to avoid the increased risk of colon
Vegetables from a Brassicaceae family is rich cancer, it is necessary to follow the recom-
in nutritional carotenoids, vitamins C, E and K, mended preventive steps in everyday life: limit
minerals and dietary fiber (Marti et al., 2016.) the intake of red meat to 500 grams a week,
71% of respondents consume meat up to 5 increases the intake of fruits and vegetables, as
times per week. 28% consume meat once or well as whole grains and legumes.
twice a day, and never consumes only 1.8% of
women. Other meat products (pate, salami, REFERENCES
etc.) are also often consumed. It has been
shown, that is approximately 15% to 20% American Cancer Society: Colorectal Cancer Facts &
greater risk of colon cancer by consuming 100 Figures 2011-2013. American Cancer Society,
Atlanta, Georgia, Retrieved March 15, 2018,
grams of red meat, or 50 grams of processed from:www.cancer.org/content/dam/cance.rorg/resear
meat per day. ch/cancer-facts-and-statistics/colorectal-cancer-facts-
and-figures/colorectal-cancer-facts-and figures-2011-
CONCLUSIONS 2013.pdf
Banjari, I., Kenjerić, D., Mandić, M. L., Nedeljko, M.
(2011). Is fad diet a quick fix? An observational
The nutritional state of the students’ population study in a Croatian student group. Periodicum
of the University of Bihać with regard to Biologorum, 13(3), 377‒381.
lifestyle and nutrition indicates a negative trend Banjari, I., Fako, J. (2014). The importance of an up-to-
in the form of increase of body mass. 12% of date evidence based diet planning for colorectal
respondents have increased body mass, and 9% cancer patients. Archive of Oncology, 21(3-4):
173‒175.
show the obesity of the first degree. Clinical colorectal cancer: 2008 - the year in review.
The prevalence of increased body mass in the Clin. colorectal cancer (2009). 8(1), 9‒10.
population of students can be considered as a Colić Barić, I., Satalić, Z., Lukesić, Z. (2003). Nutritive
significant risk factor for colon cancer, in value of meals, dietary habits and nutritive status in
particular in male patients. Croatian university students according to gender.
International Journal of Food Sciences and
The living habits of the students show negative Nutrition, 54, 473‒484.
results such as high percentage of coffee Cummings, J. H., Bingham, S. A. (1998). Diet and the
consumption, a high percentage of cigarettes prevention of cancer. British Medical Journal, 317,
and alcohol consumption, and lack of physical 1636‒1640.
activity. Among respondents, 54% consumed Divisi, D., Di Tommaso, S., Salvemini, S., Garramone,
M., Crisci, R. (2006). Diet and cancer. Acta Biomed.,
coffee once or three times a day, 42% of 77(2), 118‒123.
respondents are smokers, and 3% of students Grujić, R. (2000). Nauka o ishrani čovjeka. Tehnološki
consume alcohol every day, while 53% of those fakultet, Banja Luka.
who consume it once, or more than once a Jakobek, L., Šeruga, M., Novak, I. (2008).
week. Regard to the exercise of physical Antioksidacijska aktivnost polifenola iz borovnice i
jagode. Pomologia Croatica, 14(1), 13‒26.
activity, it was found that 54% of students were Johnson, C. M., Wei, C., Ensor, J. E., Smolenski, D. J.,
totally inactive. Amos, C. I., Levin, B. et al. (2013). Meta-analyses of
Most of the surveyed students have a positive colorectal cancer risk factors. Cancer Causes
family history that manifests itself or in the Control, 24(6), 1207‒1222.
diseases involved in the development of colon Leufkens, A. M., van Duijnhoven, F. J. B., Siersema, P.
D., Boshuizen, H. C., Vrieling, A., Agudo, A. (2011).
cancer (eg. elevated blood pressure 44% of res- Cigarette smoking and colorectal cancer risk in the
pondents, fat in the blood 25% of respondents), European prospective investigation into cancer and
or colon cancer (6% of respondents). nutrition study. Clinical Gastroenterology and
Bad nutritional habits were identified among Hepatology, 9, 137‒144.
the examinees, which is one of the major risks Kushi, L. H., Byers, T., Doyle, C., Bandera, E. V.,
McCullough, M., Gansler, T., Andrews, K. S., Thun,
of colon cancer. Consumption of pate, salami, M. J. (2006). American Cancer Society guidelines on
and similar products on a daily basis was nutrition and physical activity for cancer prevention:
235
reducing the risk of cancer with healthy food choices Podaci Zavoda za javno zdravstvo Unsko-Sanskog
and physical activity. CA Cancer Journal for kantona, broj 115/18 od 23.01.2018.god.
Clinicians, 62, 254‒281. Strnad, M., Babuš, V. (1997). Antitumorsko djelovanje
Marković Bergman, B. (2015). Prevencija i rano fermentiranih mliječnih proizvoda. Mljekarstvo,
otkrivanje karcinoma debelog crijeva. Acta Med. 47(3), 201‒207.
Croatica, 69, 365‒371. Turner, F., Smith, G., Sachse, C. et al. (2004). Vegetable,
Martí, R., Roselló, S., Cebolla-Cornejo, J. (2016). fruit and meat consumption and potential risk
Tomato as a source of carotenoids and polyphenols modifying genes in relation to colorectal cancer. Int.
targeted to cancer prevention. Cancers (Basel), 8(6), J .Cancer, 112(2), 259‒264.
1‒28. Urgert, R., Schulz, A. G., Katan, M. B. (1995). Effects of
Naganuma, T., Kuriyama, S., Akhter, M. et al. (2007). cafestol and kahweol from coffee grounds on serum
Coffee consumption and the risk of colorectal cancer: lipids and serum liver enzymes in humans. Am J Clin
A prospective cohort study in Japan. Int. J. Cancer, Nutr., 61(1), 149‒154.
12,(7): 1542‒1547. World Cancer Research Fund (2007). Food, Nutrition,
Pham, N. M., Mizoue, T., Tanaka, K. et al. (2013). Fish Physical Activity and the Prevention of Cancer: a
consumption and colorectal cancer risk: An Global Perspective. The American Institute for
evaluation based on a systematic review of Cancer Research 2009, Retrieved September 3, 2018
epidemiologic evidence among the Japanese from www.wcrf.org.
population. Jpn. J. Clin. Oncol ., 43(9), 935‒941.
236
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
DEBUNKING MISINFORMATION ABOUT FOOD
Huub LELIEVELD, Veslemøy ANDERSEN
Global Harmonization Initiative (GHI), Vienna, Austria
Corresponding author email: [email protected]
Abstract
Not only the general public, but particularly also politicians and opinion makers judge the safety and desirability of
technologies on information that comes free from many media, often provided by self-proclaimed experts. Few people
take the time and effort to check the facts. The result is often that beneficial technologies are dismissed while these
benefits have the potential of increasing the standards of living. While in some parts of the world the benefits are seen
and the technologies accepted and applied, on other parts they are not, even in cases where these technologies have the
potential of solving huge problems. The use of genetically modified (GM) food and the use of irradiation to preserve
food for example, are heavily emotionalised and in parts of the world antis tend to win the battles.
Key words: irradiation, food technology, genetic modification, misinformation, safety.
INTRODUCTION Ancient mechanisms and fears are used by
antis to influence public opinion, similar to
Why misinformation is believed, even trusted, shameless liars like many politicians and
by so many. contemporary presidents. They tell you what
The book "Before you know it: The bad things may happen if you do not follow
unconscious reasons we do what we do" has them or their advises. Because of their
been written by John Bargh, PhD, a reputable positions, their appearance (they may be good
psychologist working at Yale University, a top looking, be friendly, seem to care or be tough),
university in the USA (Bargh J., 2017). He or because they are frequently seen on
summarises the evidence that demonstrates that television, many automatically follow them,
most of what we do in our life is decided by even if they know that they are lying.
our unconscious mind. The unconscious mind Misinformation finds its way in popular
has knowledge from human history (that is why publications and is hard to be countered by
even babies shy away from danger) and is peer-reviewed scientific publications. Most
learning continuously by experience. Try to people have the feeling that there is no smoke
think of every step you take when you walk or without a fire. Publications like "Horrible
even better, when you descent the stairs. If you chemicals in our food" (Thomson, C.K., 2014)
consciously want to decide where to place your and "Don't eat cancer" (Cohen, S.D., 2014) sell
feet with every step, you either go very slowly well. Barbara H. Peterson, an activist with a
or you would fall. Healthy people need not to Bachelor’s degree in Business, leads a personal
think about where to put your spoon or what to revolution against GM food. On her website
do when confronted with a sudden danger. she writes (Peterson, B.H., 2010):
When awake, the unconscious brain is "We are already having to deal with food
constantly deciding what you need to do, your that is injected with foreign genes (GMOs),
conscious brain is too slow and busy with other blasted with pesticides, irradiated beyond
things. As a consequence most of the energy recognition, pasteurized, homogenized,
spent by the brain is for its unconscious tasks. scraped off a slaughterhouse floor, and
While 100,000 years ago a man would jump making us sicker by the minute, and now
away when a ferocious animal wais Codex guidelines are about to set the
approaching him at high speed, today when minimum and maximum levels of so-called
suddenly a car races at you, you would do the “nutrients” we are allowed to have. If it
same, without thinking about it. Thinking doesn’t meet the minimum NRV guideline,
would have killed you. just add a little more GMO such as golden
237
rice, chock full of artificial inserted between 10 and 400 nm, has enough power to
“vitamins” to the food supply and force feed cause significant chemical changes, reason why
it to the public via stealth, free trade exposure to sunlight does change the colour of
sanctions and the SPS agreement, and by all the human skin. The shorter λ, the more energy
means make sure that the upper nutrient is transferred and therefore the more damage
level wouldn’t keep a hamster alive. And if a can be done. Below 10 nm we talk about x-ray
company or nation doesn’t meet Codex and γ-radiation, such radiation frees electrons
guidelines? Then it is creating a barrier to from atoms and molecules and is therefore
free trade and can be prosecuted under the called ionising radiation. In particular γ-radia-
law. tion (having the shortest wavelength and
And we just go along with it. Better to run to therefore the highest power) can deliver enough
the corner store and get more of those energy to ionise atoms and molecules, produce
genetically engineered foods and vitamins radicals and make significant changes to the
designed to strip us of our humanity and irradiated substance. For a clear picture of the
alter our DNA so that big pharma can keep differences between radiations, see
us in its death grip and suck the remaining https://upload.wikimedia.org/wikipedia/commo
life out of our bones by “treating” the ns/9/99/EM_Spectrum3-new.jpg (accessed 15
diseases created by our “new and improved” July 2019).
lifestyles with even more “new and For λ-radiation usually either Cobalt 60 or
improved” designer drugs." Cesium 137 are used. These materials are
On the photograph shown on the website, radiating continually and therefore require
Barbara Peterson looks distinguished and expensive safety measures to protect operators.
convincing. She possibly believes what she Electron beam (e-beam) radiation is also
writes and that believe made her an apostle for ionising and therefore can also be used but the
the cause. She, however, clearly lacks the technology is different. While λ-radiation is
scientific background to judge what she has electromagnetic radiation, e-beam uses high-
picked up from the media. speed electrons and can deliver the same
energy as the Cobalt and Cesium isotopes. The
Critics important difference is that an e-beam is
Not all antis are liars, some have good reasons produced by an electronic device that can be
to be critical and may provide valid arguments switched on and off. When off, there is no
supported by good data. Being critical is a radiation. The isotopes cannot be switched off
fundamental requirement for scientific and when not in use must be stored and
development. That is why evidence is so protected in a dedicated space. Therefore,
important and why food scientists need be although installations for both methods can be
aware of facts and know where to find the operated safely, from an occupational point of
scientific information to debunk or support view, e-beam technology is more attractive.
opinions. If critics have valid questions and
they cannot or not yet be answered, further Irradiation of food
research should be done. If anything has been Food irradiation is the exposure of food to
shown to be wrong, people need to know and ionising radiation to cause chemical changes
want to know and measures to counter the that harm microorganisms, including viruses
wrongness should be taken. and parasites, as well as insects, to the extent
that they cannot reproduce anymore. The same
Irradiation irradiation also causes chemical changes in
Energy can be transferred by electromagnetic food that may result in slowing down ripening
waves, the shorter the wavelengths (or the and does prevents sprouting of some vegetables.
higher the frequency) the higher the power of That way irradiation can be used to increase
the waves and thus the more energy can be shelf life of food.
transmitted in a certain time. Wavelengths (λ) The quantity of chemicals resulting from the
between 400-700 nm does not have power radiation treatment, however, is very small and
enough to cause serious harm, unless the expo- mostly less than the chemical changes caused
sure is very long. UV light, however, with λ by heat treatments aimed at prolongation of
238
shelf life. The safety of the consumption of
food treated with radiation has been thoroughly
investigated for decades (Smith and Pillai,
2004). The only chemicals that rose concern
were benzene and its derivatives, and 2-
alkylcyclobutanones (2-ACBs). Extensive
research, however, showed that the amounts
formed, compared with the consumption from
other food, were too low to be of concern
(McNeal et al., 1993).
Similar to chemicals, radiation may harmful,
depending on the dose. Too much radiation like
too much of a chemical such as Vitamin A will
do harm and thus must be avoided. Irradiated
food, however, is not radioactive food, contrary Figure 1. Exposure to sunlight for just one hour may
cause sunburn. The consumption of fruit exposed to the
to what anti-irradiation activists state, such as same sunlight for months does not cause sunburn
in "Zapped! Irradiation and the death of food"
(Worth and Hauter, 2008). A customer wrote a
review:
"Everybody is focused on GMO and
pesticides, and meanwhile government (or
those behind it to be exact) quietly give
orders to irradiate our food. If some of us
Figure 2. Radura symbol (left) used on packaging of
still manage to find out and ask, they just irradiated food and the radioactivity warning symbol
say it is safe and not radioactive. We are (created in 2006 by Cary Bass;
talking about amounts of radiation, that are https://commons.wikimedia.org/wiki/File:Radioactive.sv
equal to 5 billion times more of the chest g (accessed 16 July 2019)
x-ray. And no, they are not safe. They are
changing our DNA in as little as 2 weeks. Bevelacqua and Mortazavi (2019) illustrated in
Studies with animals showed, that first gene- a very clear way the influence of the environ-
ration eating those foods was sicker, but ment and history on the thinking of people. If
somewhat okay, second was very sick, society applied the radiophobia logic to
and ...you guessed it -there was no third cooking food, it would be viewed as a negative
generation." (https://www.amazon.in/Zapped- technology. A hypothetical example illustrates
Irradiation-Death-Mark-Worth/dp/1567513689; applying the radiophobia mindset to cooking
accessed 16 July 2019). food with thermal radiation:
"Scientists have developed a new technology
Radiation and radioactivity called thermal radiation (e.g., infrared
Food irradiation dose not make food radiation) as a method that is alleged to
radioactive. Similar to that fruit exposed to improve the taste and edibility of foods.
sunlight (= sun radiation) will not cause Thermal radiation proponents claim that it
sunburn (does not make the fruit radiate kills known pathogens and prolongs the
sunlight) (Figure 1). food’s shelf life. Unfortunately, thermal
Another misconception is that many consumers radiation has a number of negative side
often see in the Radura symbol (Figure 2, left) effects that suggest its use is potentially
a warning that the product is radioactive while harmful. Thermal technology produces
the symbol is meant to show that the product carcinogenic materials in meat, reduces the
has been irradiated to make it safe (Ehlermann, vitamin content of fruits and vegetables, and
D.A.E., 2009). Antis persist in telling the produces hazardous chemical compounds in
public that the Radura symbol just replaces the eggs. Therefore, cooking foods with thermal
Radioactivity warning symbol (Figure 2, right) radiation should be avoided and restricted
and that the Radura one has been developed to by regulations until detailed research proves
hide the danger. that it is not harmful to human health."
239
Irradiation of food or food ingredients is Potential benefits of GMOs
practised in many but by far not all countries Resistance to diseases
and nowhere for all food. In many countries a By changing tiny bits of the genetic makeup of
permission is still required. Countries where plants, they can be made and have been made
irradiation of food is at least partially approved: resistant to herbicides, insects and microor-
Australia, China, European Union (28 ganisms. Corn (maize), staple food in South
countries), India, Indonesia, Japan, Malaysia, Africa used to be infested by insects causing
Mexico, South Africa, Thailand, USA, damage to the skin of the corn and thereby
Vietnam. If occupational safety requirements facilitating the growth of moulds that produced
are met and the applied dose is in accordance mycotoxins and made about 50% of the corn
with the levels proven to be safe, based on toxic. Today, 85% of the maize and also 95%
scientific data irradiation could be allowed of the soy in South-Africa is produced with
everywhere. There is global scientific genetically modified species (Groenewald,
consensus that irradiated food is safe to 2019). Central and eastern Africa depend
consume; nutritionally adequate and has the largely on banana as a staple food. In Uganda
same sensory properties as non-irradiated food the government supported the development of
(Koutchma et al., 2018). banana that are resistant to the mould
The bottom line is that irradiation is a Mycosphaerella fijiensis that otherwise causes
technology that is suitable to prevent insects black Sigatoka, a disease that can decrease the
and microorganisms to make food unfit for yield of banana by up to 50% (Namanya, 2019).
consumption, reducing food wastage. It may do
so in particular where other technologies Essential nutrients
cannot be applied. Many people in developing countries suffer
from vitamin A deficiency (VAD), causing
GM food blindness of hundred thousands of children
Definition of GMOs every year and killing millions of people. In
WHO: Genetically modified organisms (GMOs) many developing countries rice is the staple
can be defined as organisms (i.e. plants, food, but rice does not contain ß-carotene, the
animals or microorganisms) in which the precursor that the body converts to vitamin A.
genetic material (DNA) has been altered in a The successful insertion of genes for the
way that does not occur naturally by mating production of ß-carotene into wild rice makes it
and/or natural recombination possible to alleviate the problem. Because of
(https://www.who.int/foodsafety/areas_work/fo the orange colour of ß-carotene, the GM rice
od-technology/faq-genetically-modified- too is orange and has the nickname "Golden
food/en/; accessed 16 July 2019). Rice". Research in underway to make staple
food also producing other essential nutrients
Why GMOs? that many people are lacking due to a very one-
There always have been parts in the world sided availability of food (Hefferon, 2015).
where people were starving. Technology has
helped mankind to improve the production of Stress resistance
food and successfully such that in the western There are many areas in the world where
world there is no shortage of food. In many growing food is impossible, due to lack of or
other parts of the world it the production of too much water; too high or too low
food has been and still is insufficient to feed temperatures; too salty or too acid soil. There is,
the ever growing population. The global food however, vegetation in these areas, specialised
production in the world is enough to feed to cope with the prevailing situation. Obviously,
everyone, if that food would be in the right modification of staple food crops to make them
places. Much of the staple food today actually resistant to stresses where such crops are
is GM food and already for decades although important has the potential of solving hunger
most people do not know. Without this, problems. This probably can be done by using
probably there would not be enough food and genes from stress resistant plants. Work is done
certainly not everywhere. on making crops drought resistant is reviewed
by Liang et al. (2016).
240
There are many more possibilities and if they past experience and future prospects, with the
have the potential to solve serious problems, task to examine evidence regarding potential
they should be investigated and tested for negative effects and benefits of genetically
safety. If safe their use should not be prevented engineered crops as well as the potential
by activists who simply are "against", whatever benefits and negative effects of future GE crops.
the product or technology, because being The findings have been reported in 2016.
against can be profitable and that whole Twenty experts reviewed more than 1,000
populations are deprived from badly needed studies, concluding, based on epidemiological
solutions is not their problem. data on incidence of cancers and other human-
health problems, that there is no evidence that
Can GM food be unsafe and cause diseases? foods from GE crops are less safe than foods
The public is incessantly bombarded with by from non-GE crops (National Academies of
activists and activist organisations claiming to Sciences, Engineering and Medicine, 2016).
know with certainty that GMO food is bad and GENERA is a project of Biology Fortified, Inc.
dangerous to eat. Hundreds of examples of how (BFI), an independent non-profit organization
they do this can be found on incorporated in Middleton, Wisconsin, USA. In
https://nl.pinterest.com/pin/3446661777118217 2017 they reported that currently there are near
74/. Because every knew technology and every 2000 peer-reviewed reports in the scientific
new product may have undesired and even literature that document the general safety and
dangerous properties, before being allowed on nutritional wholesomeness of GM foods and
the market the safety of new products should be feeds (Nicolia et al., 2014).
thoroughly investigated. A potential danger of The most recent review is that of Delaney
GM food that has been made resistant to (2018), who concluded that "Decades of testing
microorganisms to which there originally was food and feed products from insect resistant,
no resistance, might result in microorganisms herbicide tolerant and stacked traits of
resistant to antimicrobials, including antibiotics. previously approved single traits, and other
That will be undesirable and hence this should types of GE crops in laboratory and livestock
be very carefully investigated. If GM food animals have shown that the technology used to
produces proteins that have not been part of the produce them is not inherently hazardous. No
modified food, it must be investigated if that adverse effects have been observed to date".
protein may cause allergy although thorough
review of research in this did not indicate that The success of activists and activist
GM food is more allergenic than their organisations - people die needlessly
conventional counterparts (Dunn et al., 2017). Activist organisations go very far with their
Although GM food has now been on the market actions, among which are the destruction of and
in many countries for more than a decade and experimental fields of genetically modified
probably at least a billion (1000 million) Golden Rice in the Philippines in 2013
consumers eat GM food daily, there have been (https://slate.com/technology/2013/08/golden-
no indications that there is a difference in the rice-attack-in-philippines-anti-gmo-activists-
incidence and types of cancer between people lie-about-protest-and-safety.html; accessed 16
who do and those who do not eat GM food July 2019); GM wheat in the UK in 2012
regularly. (https://www.independent.co.uk/hei-
fi/news/scientists-plead-with-anti-gm-
Safety of GMOs protesters-not-to-destroy-crop-7788322.html;
The EU funded many projects to investigate accessed 16 July 2019) and of corn in Hungary
whether there is any indication that GM food in 2013. It is claimed that the destruction in
would be less safe that non-GM food and 10 Hungary was strongly supported by Hungary’s
years of research did not find any evidence that Minister of Rural Development
it would (European Commission, 2010). (https://www.abcplus.biz/GMO_6-26-
The National Academies of Sciences, 13_Hungary_Torches_GM_Corn; accessed 16
Engineering, and Medicine established a July 2019). The Hungarian government is one
Committee on genetically engineered crops: of those that are blindly following anti-GM
241
activists. Greenpeace claim to know that GM During the massive famine in Southern Africa,
food is dangerous. They never provide in 2001, several governments in the region
evidence, obviously because such evidence objected to genetically modified (GM) grain,
does not exist, but they also do not need to, especially Zambia and Zimbabwe, the countries
because their claim is that they know that they hardest hit by the drought. Citing health and
are right and moreover that all scientists should environmental concerns, Zimbabwe blocked
know too. By frequent and persistent repetition the GM food aid from entering the country. In
of their claims they successfully convince a Zambia, where some GM grain had already
large part of the general public well as many arrived, the government placed it under lock
politicians. There are many books about the and key, banned its distribution and then
dangers of GM food, blaming governments to blocked another 40,000 tonnes that were in the
approve GM food only to help the food pipeline. Source: Africa Renewal, Vol.16 #4
industry to increase profit and that at the (February 2003), page 5 . This is the result of
expense of the misled consumer/taxpayer. An overwhelming activities of antis, in particular
example of such s book is "Altered genes, in Europe, who claim with no evidence that
twisted truth" (Druker, 2015). The subtitle GM food is dangerous. The reality is that
summarises the contents: "How the venture to hundreds of millions of people consume GM
genetically engineer our food has subverted food daily and there is not a single report of a
science, corrupted government, and systema- health incident related to GM food. The local
tically deceived the public". In the book governments choose to let their citizens starve
"Genetic Roulette: The documented health to death rather than giving them GM food.
risks of genetically engineered foods" (Smith,
2007) 65 claims are presented that GM food Letter of Nobel Laureates to Greenpeace:
causes harm in many ways. Academics Review On the 29th of June 2016 Nobel Laureates in
debunked each of the claims based on peer- medicine, chemistry, physics and economics
reviewed evidence and provides all the sent a letter to Greenpeace, the UN and
references Governments around the world. They ask
(http://academicsreview.org/reviewed- Greenpeace to cease and desist in its campaign
content/genetic-roulette/; accessed 17 July against Golden Rice specifically, and crops and
2019). Academics Review is an association of foods improved through biotechnology in
academic professors, researchers, teachers and general. They ask governments to reject
credentialed authors from around the world Greenpeace's campaign against Golden Rice
who are committed to the unsurpassed value of specifically, and crops and foods improved
the peer review in establishing sound science through biotechnology in general; and to do
(http://academicsreview.org/about-academic- everything in their power to oppose
review/purpose/; accessed 17 July 2019). Greenpeace's actions and accelerate the access
NGO's in rich countries, where they have of farmers to all the tools of modern biology,
enough food, have successfully convinced the especially seeds improved through biotech-
governments in poor countries that GM food is nology. Opposition based on emotion and
unsafe. These organisations, lead by dogma contradicted by data must be stopped.
GreenPeace, can be held responsible for the The concluding question is "How many poor
death of millions of people, annually. They lie people in the world must die before we
to the officials in the suffering countries, who consider this a 'crime against humanity'?"
generally lack the capacity to deal with the (Nobel Laureates, 2016).
scientific information and trust the large
international organisations from the developed Essential knowledge for everybody
rich countries. What everybody should be made to realise -
The NGOs cleverly do not refer to the reports and here education at all levels could play an
of the scientific organisations in the those important role - is that genetic modification is
countries that have repeatedly and clearly done by nature, since life started. Nature does
described that GM food is not less safe than so now and will continue do so in the future.
non-GM food (Paarlberg, 2014). Nature, however, does not do it for the benefit
242
of mankind. To survive, everything living in In "Swallow This: Serving Up the Food
nature tries to kill competing living things, Industry's Darkest Secrets " (Blythman, 2015)
including man. Mankind has evolved and you may read:
survived using gathered knowledge. "How clean is your label? Pick up some
Why would "natural" be better than “modified rustic-looking salami and even the most
by man”? Farmers explored - be it guarded shoppers might relax when they
unknowingly - mutations by cross-breeding, notice rosemary extract on the ingredients
trying and selecting crops with improved traits. list. But rosemary extracts are clean label
They did so long before Gregor Mendel found substitutes for old guard of techie-sounding
out how it worked. Since scientists do it, based antioxidants. Manufacturers use them to
on knowledge and experience, enormous slow down the rate at which food go rancid.
hurdles have been created. Rosemary extracts do have an E number
The most recent developments, using CRISPR- (E392) but manufacturers prefer to label
Cas9 enzymes (and similar) can make desired them more poetically as ‘extract of
DNA changes very accurately, eliminating the rosemary’, and loose off ending E. because
chances that the results can be harmful, that way they sound like lovingly made Slow
moreover this is done with much less effort Food ingredients."
than before (Lemay and Moineau, 2019). or
Many countries are exploring this technology "Not sure what to have for dinner? How
but amazingly, thanks again to the efforts of the about a chicken noodle dish? If you noticed
activist organisations, it is not allowed in the that it contained an amino acid such as L-
EU without going through the same time- cysteine E910, your enthusiasm might wane."
consuming and expensive procedures that
apply to the methods of the decades past. Toxicity of chemicals
It is time that children already in the
Labelling Kindergarten learn that everything is chemical
What information is useful on a label? and that chemicals need not scare them. They
The answer is that it should have what need to know that water and air are chemical
consumers need to know about the product and and become resistant to scary misinformation.
thus should want to know and what many of At the basic school they may be shown nice
them would ask if they would have sufficient labels developed by James Kennedy, a
reliable information about food. chemistry teacher in Melbourne, Australia
In the past decade self-proclaimed experts have (Figure 3). His intention is to demonstrate that
told that food has become a great risk and one “natural” products are usually more com-
must be very careful because food today plicated than anything created in a laboratory.
contains chemicals and chemicals are And he omitted the thousands of minority
dangerous. ingredients, including DNA.
After the European commission had decided What everybody should know is that chemicals
that the safety of chemicals added to food as such are not toxic, but that it is the amount
should have been proven safe and that to help of a chemical that may make it toxic, as
consumers to find out about these additions, E- discovered and explained a few hundreds years
numbers had been introduced, making it easier ago by Paracelsus (Bombastus ab Hohenheim,
to look the information up. 1658): "Poison is in everything, and no thing
One would not need to type in "ethyl ester of is without poison. The dosage makes it either
beta-apo-8'-carotenic acid" but just E160f to a poison or a remedy". For many substances
find all information about the substance. the situation is as Paracelsus discovered: if
Promptly you are told that E-numbers have the dose is too high, damage is done. However,
been invented to hide that there are chemicals too low a dose of the substance may also be a
in the food. When as a response manufacturers health risk, as is the case with vitamins
went back to using the chemical names, the and minerals. Without them we get ill and may
message became that chemical names are used die, but too high a dose has the same result
to hide E-numbers. (Figure 4; from GHI, 2016).
243
Figure 3. All the ingredients on this list are 100% natural in a non-GM banana.
None of them are pesticides, fertilisers, insecticides or other contaminant and the label is not complete,
there are also another thousands of minority ingredients
Cyanogenic glycosides, such as amygdalin
(almond, laurel) and linamarin (cassave)
Enzyme inhibitors (soy, peas, beet, cereals)
Glucosinolates such as sinigrin, progoitrin
(cabbage, broccoli, brussels sprouts,
cauliflower, turnip, radish, horseradish,
mustard, rapeseed)
Lectins (or hemaglutinins) (pulses)
Oxalates (rhubarb, spinach, parsley, chives,
Figure 4. This graph illustrates what applies to most purslane, cassava, amaranth, chard, taro
chemicals in our food. Not enough may lead to damage, leaves, radish, kale, monstera fruit)
such as blindness in the case of vitamine A, but too much Piperidines (black pepper)
will also do damage, the amount will make even
vitamins toxic
Saponins (peanut, soy, spinach, broccoli,
potato, apple)
The message is that all food contains Solanine (potatoes, tomatoes, aubergines)
potentially toxic substances, substances that Tomatine (tomatoes)
like any substance, will become toxic if the The good news is that, at least in developed
amount consumed is larger that the body can countries, with normal but not monotonous
handle. In many cases the body needs these eating habits it is unlikely that any component
substances, but not in excess. With not enough of food will be consumed in too high or too low
vitamin A you may turn blind and eventually quantities, perhaps with the exception of
die if it lasts too long. With too much vitamin vitamin D in winter or in case of adverse
A you will die too. Here is a short list of medical conditions.
examples of chemicals present in normal food,
harmless, unless consumed in excess. Organic food
Caffeine, theobromine, theophyline (coffee, All food is organic, people that market "organic
chocolate, tea) food" provide misleading information,
Coumarin (cinnamon, peppermint, green tea, suggesting that other food is not organic. The
chicory, blueberries) food that is labelled "organic" would be of
244
better quality and healthier. There is, however, (Brink et al., 2017). Diets that cut out food
again no evidence that "organic food" is any groups may result in deficiencies and that
better than other food. Insects are as keen as obviously is not healthy.
humans to eat, therefore insects need to be kept A gluten-free diet makes sense only for people
away from the food intended for humans. For with celiac disease or gluten sensitivity (Van
food grown in greenhouses this is possible to a Buul and Broun, 2013) and that are not as
large degree but for food grown in the open, many people as the many who believe they
this is not possible. For that reason insecticides suffer from these disorders (Capannolo et al.,
are used, also on so-called organic food. The 2015).
difference is that, while the synthetic ones used Vegetarian diets are healthy provided sufficient
on normal food have been thoroughly tested for protein is consumed from vegetarian sources.
safety, those used on organic food are not, Vegan diets are also healthy provided care is
because they are organic. When plants are taken that in addition sufficient essential
stressed or damaged, such as during a pest nutrients are consumed.
attack, they may greatly increase their natural Claims that probiotics are good for health are at
pesticide levels, sometimes even to levels that least doubtful (Zmora, 2018).
can be toxic to humans. Americans consume
with their food about 10,000 times more
pesticides than synthetic pesticide residues
(Ames et al., 1990). Although if properly
applied the amount of pesticides, natural or
synthetic, in or on food products is so low that
they will not make the food unsafe, it would in
principle be safer to eat food with the
thoroughly tested synthetic pesticides than the
not tested organic ones. For more and detailed
information on this topic, consult Swirsky et al.
(1997).
Knowledge that should be on the label
Based on the information discussed above, it is Figure 5. The wheel of five, developed by the
concluded that what is needed, in addition to Netherlands Nutrition Centre
information about storage and preparation, a
declaration of constituents that Varying menus will provide all nutrients
• may be harmful if too much is consumed needed for healthy people. The recommend-
(such as sugar and oxalic acid) dation is to pay attention to the wheel of five;
• are essential nutrients and may be lacking not to eat too much; not to add more than a
in a monotonous diet (such as vitamins) little salt; not to add sugar; consume 2 litre of
• may give allergic reactions water per day (but that is including the water
• may be unsuitable for a significant part of present in the food) and last but not least:
the population (such as gluten and lactose) enough physical activity. In case of weight
This will already occupy much problems that cannot be solved by these points:
space and more information will consult a reliable nutritionist.
not be helpful while shopping. For
more information the manufacturer Recommendation
should provide an internet link or QR-code. To fight misinformation, it is recommended to
use the information in this article to teach
Diets students, discuss with colleagues, management,
Unless there are medical disorders, by sticking politicians and whoever else you may be able
to a decent varied diet, you may have control to influence.
over your weight and stay healthy. The wheel If surprising information about food, food
of five, shown in Figure 5, is a good guide safety and food security is encountered, always
245
look for peer-reviewed scientific evidence. and Domagoj Gabrić. Elsevier / Woodhead
Also, in meetings with officials and politicians, Publishing, 2016. ISBN: 978-0-08-100155-4
address regulations that are morally and Hygienic Design of Food Factories. Editors:
scientifically wrong and harm people. John Holah and Huub Lelieveld. Elsevier /
Woodhead Publishing, 2011. ISBN: 978-1-
Books that provide peer-reviewed scientific 84569-564-4
information Food Safety Management – A Practical Guide
Genetically Modified and Irradiated Food - for the Food Industry. Editors: Yasmine
Controversial Issues: Facts versus Perceptions Motarjemi and Huub Lelieveld.
Editor: Veslemøy Andersen. Elsevier, 2019. Elsevier/Academic Press, 2013. ISBN:
ISBN: 9780128172407 9780123815057
Ensuring Global Food Safety - Exploring Les invisibles. Yasmine Motarjemi. Elstir
Global Harmonization. Editors: Christine Editions, 2010. ISBN 2970051257;
Boisrobert, Aleksandra Stjepanovic, Sangsuk 9782970051251
Oh and Huub Lelieveld. Elsevier/Academic English translation: Invisible things. Sara
Press, 2009. ISBN: 9780080889306 Andersson. CreateSpace Independent
Regulating Safety of Traditional and Ethnic Publishing Platform, 2012. ISBN-13: 978-
Foods. Editors: V. Prakash, Olga Martin- 1469985718
Belloso, Larry Keener, Siân Astley, Susanne
Braun, Helena McMahon and Huub Lelieveld. REFERENCES
Elsevier/Academic Press, 2016. ISBN: 978-0-
12-800605-4 Ames, B. N., Profet, M., and Lois Swirsky Gold, L. S.,
(1990). Dietary pesticides (99.99% all natural). Proc.
Nutritional and Health Aspects of Food in Natl. Acad. Sci. USA, 87, 7777‒7781.
Nordic Countries. Editors: Veslemøy Andersen, Bargh, J. (2017). Before You Know It: The Unconscious
Eirin Bar and Gun Wirtanen. Reasons We Do What We Do. William Heinemann,
Elsevier/Academic Press, 2018. ISBN: 978-0- London.
12-809456-3 Bevelacqua, J. J., and Mortazavi, S. M. J. (2019). Can
irradiated food have an influence on people’s health?
Global Food Legislation: An Overview. Editors: In: Genetically modified and irradiated food -
Evelyn Kirchsteiger-Meier and Tobias Controversial issues - facts versus perceptions. Ed.
Baumgartner. Wiley, 2014. ISBN: 978-3-527- Veslemøy Andersen. Elsevier/Academic Press, ISBN:
33555-8 9780128172407.
EU Food Law Handbook. Editor: Bernd van Blythman, J. (2015). Swallow This: Serving Up the Food
Industry's Darkest Secrets. HarperCollins,
der Meulen. Wageningen University Press, Bishopsbriggs, Glasgow, Scotland. ISBN
2014. ISBN: 978-90-8686-246-7 9780007548354.
Genetic Modification and Food Quality: A Bombastus ab Hohenheim, A. P. T., (1658). Opera
Down to Earth Analysis. Robert Blair and Joe omnia medico-chemico-chirurgica (Volumen
M. Regenstein. Wiley, 2015. ISBN: 978-1-118- Primum). Ioan Antonij & Samueles de Tournes,
Genevae, Switzerland.
75641-6 Brink, E. J., Postma-Smeets, A., Stafleu, A., and
Global legislation for food contact materials. Wolvers, D. (2017). The Wheel of Five Fact sheet.
Editor: Joan Sylvain Baughan. Elsevier / Netherlands Nutrition Centre (Voedingscentrum),
Woodhead Publishing, 2015. ISBN 978-1- Den Haag, Netherlands. Downloadable from
78242-014-9 https://www.voedingscentrum.nl/nl/pers/factsheets/fa
ct-sheets-in-english.aspx (accessed 17 July 2019).
The Use of Nanomaterials in Food Contact Capannolo, A., Viscido, A, Barkad, M. A., Valerii, G.,
Materials - Design, Application, Safety - Ciccone, F., Melideo, D., Frieri, G., and Latella, G.
Editor: Rob Veraart. DEStechpublications, (2015). Non-Celiac Gluten Sensitivity among
2017. ISBN: 978-1-60595-136-2 Patients Perceiving Gluten-Related Symptoms.
Hygiene in Food Processing. Editors: Huub Digestion, 92(1), 8‒13.
Cohen, S. D. (2014). Don't Eat Cancer: Modern Day
Lelieveld, John Holah and David Napper. Cancer Prevention. Koehler Books, Virginia Beach,
Elsevier / Woodhead Publishing, 2014. Virginia, USA. ISBN-10: 1940192242; ISBN-13:
ISBN: 9780857094292 978-1940192246.
Handbook of Hygiene Control in the Food Delaney B., Goodman, R.E. and Ladics, G.S. (2018).
Industry. Editors: Huub Lelieveld, John Holah Food and Feed Safety of Genetically Engineered
Food Crops. Toxicol Sci., 162(2). 361‒371.
246
Druker, S.M. (2015). Altered Genes, Twisted Truth. great lakes region of Africa. In: Genetically modified
Clear River Press, Danvers, Massachusetts, USA. and irradiated food - Controversial issues - facts
ISBN: 9780985616908. versus perceptions. Ed. Veslemøy Andersen.
Dunn, S. E., Vicini, J. L., Glenn, K. C., Fleischer, D. M. Elsevier/Academic Press, ISBN: 9780128172407.
and Greenhawt, M. J. (2017). The allergenicity of National Academies of Sciences, Engineering, and
genetically modified foods from genetically Medicine (2016). Genetically Engineered Crops:
engineered crops. A narrative and systematic review. Experiences and Prospects. Washington, DC: The
Ann Allergy Asthma Immunol, 119. 214‒222 National Academies Press. https://doi.org/10.17226/
Ehlermann, D. A. E. (2009). The RADURA-terminology 23395 (accessed 17 July 2019).
and food irradiation. Food Control, 20. 526–528. Nicolia, A, Manzo, A, Veronesi, F, Rosellini, D. (2014).
European Commission, (2010). A decade of EU-funded An overview of the last 10 years of genetically
GMO research (2001-2010). Directorate-General for engineered crop safety research. Crit Rev Biotechnol.,
Research and Innovation Biotechnologies, 34(1), 77‒88.
Agriculture, Food, Brussels, Belgium. ISBN 978-92- Nobel Laureates in medicine, chemistry, physics and
79-16344-9. Downloadable from http://ec.europa.eu/ economics (2016). Letter to Greenpeace, the UN and
research/biosociety/pdf/a_decade_of_eu- Governments around the world 2016-06-29.
funded_gmo_research.pdf (accessed 17 July 2019). http://supportprecisionagriculture.org/nobel-laureate-
GHI, (2016). https://www.globalharmonization.net/sites/ gmo-letter_rjr.html (accessed 17July 2019).
default/files/pdf/final_ghi_ShareSheet1_FeedPeople_ Paarlberg, R. (2014). A dubious success: The NGO
Feb2016.pdf (available in many languages) campaign against GMOs. GM Crops Food, 5(3).
Groenewald, J. H. (2019). Genetically modified (GM) 223–228.
food in South Africa. In: Genetically modified and Peterson, B. H. (2010). Farmwars.info.
irradiated food - Controversial issues - facts versus https://pdf.printfriendly.com/pdfs/1563219421_395f8
perceptions. Ed. Veslemøy Andersen. b/download, accessed 15 July 2019.
Elsevier/Academic Press, ISBN: 9780128172407. Smith, J. M. (2007). Genetic Roulette: The Documented
Hefferon, K. L. (2015). Nutritionally Enhanced Food Health Risks of Genetically Engineered Foods. Yes!
Crops; Progress and Perspectives. Int. J. Mol. Sci., 16, Books, Fairfield, Iowa, USA. ISBN-10: 0972966528;
3895‒3914. ISBN-13: 9780972966528.
Kennedy, J. (2018). Fighting Chemophobia. A survival Smith, J. S., and Pillai, S. (2004). Irradiation and Food
guide against marketers who capitalise on our innate Safety. Food technology, 58(11), 48‒55.
fear of chemicals for financial and political gain. Swirsky Gold, L., Slone, T. H., and Ames, B. N., (1997).
CreateSpace Independent Publishing Platform. ISBN- Prioritization of possible carcinogenic hazards in
10: 1987582586; ISBN-13: 978-1987582581. food. Pages 267-295 in: Food Chemical Risk
Koutchma, T., Keener, L., and Kotilainen, H. (2018). Analysis. Ed. Tennant D.R. Chapman and Hall, New
Consensus Document on Food Irradiation. Global York, N.Y., USA. 1997 267–295. The complete text
Harmonization Initiative, Vienna, Austria can be downloaded from http://toxnet.nlm.nih.gov/
(https://www.globalharmonization.net/sites/default/fil cpdb/text/maff.html (accessed 17 July 2019).
es/pdf/GHI-Food-Irradiation_October-2018.pdf; Thomson, C. K. (2014). There are Horrible Chemicals in
accessed 19 July 2019). Our Food! The Unhealthy Truth about Chemicals in
Lemay, M. L., and Moineau, S. (2019). How are genes Food and Their Link to the Causes of Cancer and
modified? Cross breeding, mutagenesis and CRISPR- Other Diseases. https://www.amazon.com/There-are-
Cas9. In: Genetically modified and irradiated food - Horrible-Chemicals-Food-ebook/dp/B00IN1TIWE.
Controversial issues – facts versus perceptions. Ed. Van Buul, V. J., and Brouns, F. (2013). Tarwekiem-
Veslemøy Andersen. Elsevier/Academic Press, ISBN: lectinen en gezondheid. Tijdschrift voor voeding en
9780128172407. diëtetiek 39(3), 1-8. With English summary
Liang, C. (2016). Genetically Modified Crops with Worth, M., and Hauter, W. (2008). Zapped! Irradiation
Drought Tolerance: Achievements, Challenges, and and the Death of Food. Common Courage Press,
Perspectives. Chapter 19 in: Drought Stress Monroe, Maine, USA.
Tolerance in Plants, Vol 2. Eds. M.A. Hossain, S.H. Zmora, N., Zilberman-Schapira, G., Suez, J., Mor, U.,
Wani, S. Bhattachajee, D.J. Burritt and L-S.P. Tran. Dori-Bachash, M., Bashiardes, S., Kotler, E., Zur, M.,
Springer International Publishing, Switzerland. Regev-Lehavi, D., Ben-Zeev Brik, R., Federici, S.,
McNeal, T. P., Nyman, P. J., Diachenko, G. W., and Cohen, Y., Linevsky, R., Rothschild, D., Moor, A. E.,
Hollifield, H. C. (1993). Survey of benzene in foods Ben-Moshe, S., Harmelin, A., Itzkovitz, S.,
by using headspace concentration techniques and Maharshak, N., Shibolet,O., Shapiro, H., Pevsner-
capillary gas chromatography. J. AOAC Intl., 76(6), Fischer, M., Sharon, I., Halpern, Z., Segal, E., Elinav,
1213‒9. E. (2018). Personalized Gut Mucosal Colonization
Namanya, P., Tindamanyire, J., Buah, S., Namaganda, J., Resistance to Empiric Probiotics Is Associated with
Kubiriba, J., and Tushemereirwe, W. (2019). Unique Host and Microbiome Features. Cell, 174.
Genetically modified bananas for communities of the 1388–1405.
247
248
Miscellaneous
249
250
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
CHEMICAL COMPOSITION AND ANTIOXIDANT ACTIVITY
OF Hyssopus officinalis L. SELECTIVE FRACTIONS
OBTAINED BY DIFFERENT METHODS
Alice GRIGORE1, Svetlana COLCERU-MIHUL2, Corina BUBUEANU1, Lucia PÎRVU1,
Cristina BAZDOACĂ1, Sultana NIŢĂ1
1
National Institute of Chemical-Pharmaceutical Research and Development, 112 Vitan Street,
District 3, Bucharest, Romania
2
SC AGNES ITARA SRL, 13 Veronica Micle Street, Suceava, Romania
Corresponding author email: [email protected]
Abstract
The aim of this study was to obtain selective fractions of Hyssopus officinalis L. by different methods and to investigate
a possible correlation between their chemical content and antioxidant activity in order to establish a potential effect of
this species on counteracting diseases associated with aging processes. HPLC analysis and quantitative determination
of active principles from nine selective fractions show that the values were well correlated with the ones resulted by
spectrophotometrically methods. The selective fractions have a total flavonoid content expressed as rutin from 1.236 to
19.060 % and respectively 0.126 to 16.783% polyphenolcarboxylic acids expressed as rosmarinic acid. It has been
observed that the fractions with high content in polyphenolcarboxylic acids and flavonosides exhibit maximum
antioxidant activity. There are selective fractions containing only one of the classes of compounds (flavonosides or
polyphenolcarboxylic acids) in a higher amount that show great antioxidant activity. A strictly correlation between the
flavones content of the selective fractions and antioxidant activity can not be made by this method.
Key words: antioxidant activit , flavonosides, Hyssopus officinalis L., polyphenocarboxylic acids.
INTRODUCTION volatile oil, calchones, triterpenes (ursolic and
oleanolic acid), β-sitosterol and bitter principles
In two previous studies we presented the results (marubin). These compounds are responsible
regarding the antioxidant action of some for the stomachic, carminative, antispasmodic,
selective fractions obtained from the plant antiasthmatic, anticatarrhal, antiseptic, healing,
species cultivated in Romania with potential antimicrobial and antioxidant effects (Colceru-
effect on the counteracting diseases associated Mihul et al., 2016; 2017).
with aging processes (Ashok & Rashid, 1999; Among chemical compounds derived from
Babovic et al., 2010). plant species, rosmarinic acid, caffeic acid or
In this paper are presented the results of other compounds belonging to polyphenolcar-
researches regarding the obtaining of selective boxylic acids class; diosmin, diosmetin or other
fractions of Hyssopus officinalis L. and their flavonoidic compounds, are very well known
antioxidant action. for their antioxidant properties (Fathiazad &
The species Hyssopus officinalis L., the Hamedeyazdan, 2011; Istudor, 2001).
Lamiaceae family, is known in the Romania in Compounds with antioxidant activity are
the traditional medicine for the therapeutic regarded as basic elements of the anti-aging
effect. Modern medicine has confirmed that, strategy because free radicals are considered
due to existing classes of active compounds in the main responsible agents of premature aging
aerial parts, this species is beneficial in the and also of diseases associated to aging status
treatment of certain diseases. (Marin et al., 1998).
Classes of compounds with demonstrated
therapeutic effects are flavonosides (apigenin, MATERIALS AND METHODS
quercetin, diosmin, luteolin and glucosides
thereof), polyphenolcarboxylic acids (chloro- The plant material consisting of aerial parts of
genic, ferulic, caffeic and rosmarinic acids), Hyssopus officinalis L. (Hyssopi herba) was
251
obtained from culture, dried and ground as a extraction and 1/5 m/v for the second
fine powder (sieve VII). extraction) at boiling temperature of the solvent
Selective fractions obtainment: for one hour per extraction with continuous
Method I consisted of repeated extraction - two mechanical stirring, followed by cooling and
times of the active substances from 200 g filtration of the extracts. Methanolic solutions
Hyssopi herba, with 50% ethylic alcohol v/v were reunited, the solvent removed by
(vegetal material/solvent ratio = 1/10 m/v for rotaevaporation resulting HIII selective
the first extraction and 1/5 m/v for the second fractions.
extraction) at boiling temperature of the solvent Method IV consisted of macerating 200 g
for 1 hour per extraction with continuous Hyssopi herba in acetone (plant/solvent ratio =
mechanical stirring, followed by cooling and 1/7 m/v), removing the solvent from acetone
filtration of the extracts. The reunited solution and re-extracting the residue in
hydroalcoholic solutions were rota-evaporated methanol. The active substances were extracted
for alcohol removal. The resulting aqueous from moist plant material with 20% ethanol
solutions were spray-dried and selective (plant/solvent ratio = 1/10 m/v) at boiling
fractions HI were obtained. temperature of the mixture for 2 hours,
Method II consisted of active principles followed by hydroalcoholic solution
extraction from 300 g Hyssopi herba, with 50% evaporation to an aqueous extract. Methanolic
alcohol (plant/solvent = 1/10 m/v ratio) at and aqueous extract were reunited and filtered.
boiling temperature for 1 hour with continuous The resulting precipitate was dried and
mechanical stirring, followed by cooling and selective fractions HIV were obtained.
filtration of the extracts. Hydroalcoholic extract
solution was evaporated to a volume of 1/1 m/v
plant/solvent mixture and centrifuged. A
precipitate (which was labeled as HII0 after
drying) and an aqueous solution were obtained.
In order to obtain selective fractions, aqueous
solution was further processed by:
- 3 successive liquid-liquid extractions with
ethylic ether, followed by solvent removal from
the reunited etheric by rotaevaporation,
resulting HIIA.
- 3 successive liquid-liquid extractions with
chloroform, followed by solvent removal from
the reunited chloroformic extracts by
rotaevaporation, resulting HIIB.
- 3 successive liquid-liquid extractions with
ethyl acetate, followed by solvent removal from
the reunited ethyl acetate extracts by
rotaevaporation, resulting HIIC.
- 3 successive liquid-liquid extractions with n-
buthylic alcohol, followed by solvent removal
from the reunited buthanolic extracts by
rotaevaporation resulting HIID.
- adding acetone in a 2/1 v/v acetone/aqueous Figure 1. Selective fractions obtainment - method II
extract ratio resting at 4-60C for 24 hours,
filtration and drying the precipitate resulting HPTLC analysis of selective fractions was
HIIE. This is shown in Figure 1. performed using Silica Gel 60F254 as stationary
Method III consisted of repeated extractions - phase and a mixture of ethyl acetate - acetic
two times of the active substances from 200 g acid - formic acid - water (100: 11: 11: 27
Hyssopi herba, with methylic alcohol v/v/v/v) for chromatographic elution. The
(plant/solvent ratio = 1/10 m/v for the first plates were scanned under 360 nm after the
252
derivatization with NP/PEG. The reference measured spectrophotometrically at 515 nm
compounds for HPTLC analysis were from (Wagner & Bladt, 1996).
Sigma-Aldrich: caffeic acid, rosmarinic acid, For determination of antioxidant activity, the
chlorogenic acid, rutin, hyperoside and diosmin selective fractions were chosen according to the
(Reich & Schibli, 2008; Romanian yield obtained from 100 g plant and depending
Pharmacopoeia, 1993). on the flavones and polyphenolcarboxylic acids
HPLC analysis of selective fraction consisted content.
in chromatographic separation on a Purosher
ODS column (250 x 4.6 mm, 5 μ) at 400C, RESULTS AND DISCUSSIONS
using a gradient elution (both mobile phase and
flow). The mobile phase was a binary gradient: Nine Hyssopi herba selective fractions were
water with orthophosphoric acid (pH = 2.5) and obtained by experimental methods mentioned
methanol. The eluent absorbance was above. The quantities of product obtained from
monitored at 330 nm. The reference substances 100 g plant are shown in Table1.
were from Sigma-Aldrich: caffeic acid, Flavonoids (rutin, hyperoside, diosmin) and
rosmarinic acid, rutin, diosmin and luteolin. polyphenolcarboxylic acids (rosmarinic acid,
Quantitative determination of active principles caffeic acid, chlorogenic acid) were identified
from selective fractions consisted of by HPTLC in most of selective fractions.
determination of flavones by a colorimetric The content of caffeic acid, rosmarinic acid,
method based on their property to form diosmine, rutin and luteolin in each fraction
intensely yellow complex with Al3+ and of was determined by HPLC method. The values
determination on polyphenolcarboxylic acids obtained from individual assessment by HPLC
by a colorimetric method based on the property were well correlated with the values obtained
of phenols to form nitrocompouds or nitro by the spectrophotometrically methods
oxime with nitrous acid which give red stain mentioned above. For example, rosmarinic acid
when dissolve in alkaline solutions due to their content from the selective fractions, determined
weak acid character. For the quantification of by HPLC, correlates with the polyphenolic
flavones, rutin was used as reference substance acids content expressed in rosmarinic acid,
and for polyphenolcarboxylic acids determined by the headline method.
quantification rosmarinic acid was used as
reference substance (Sanchez Moreno et al., Table 1. The content of active principles
1998). of Hyssopi herba selective fractions
Analysis of antioxidant action Bioactive Product Flavonoids Polyphenol-
DPPH assay: In each reaction tube 100 μl product yieldt from expressed carboxylic acids
vegetal extract of different concentrations was 100 g plant as rutin expressed as
mixed with 3900 μl of 0.0025 g/l DPPH at % g/g rosmarinic acid
% g/g
room temperature for 30 min. 50% methanol
solution was used as control. The reduction of HI 19.21 g 4.556 3.182
the DPPH free radical was measured by reading HII0 2.90 g 2.513 3.888
the absorbance at 515 nm. Rosmarinic acid HIIA 0.41 g 10.347 1.138
(from Sigma-Aldrich) was used as positive
HIIB 0.65 g 2.326 0.074
control. Inhibition ratio (percent) was
calculated from the following equation HIIC 1.15 g 19.060 14.655
(Wagner & Bladt, 1996): HIID 4.10 g 2.853 1.030
HIIE 6.29 g 2.178 2.726
% inhibition = [(absorbance of control –
absorbance of sample)/absorbance of control] x HIII 15.10 g 2.734 16.783
100 HIV 6.21 g 1.236 3.962
DPPH radicals react with suitable reducing The flavonoid content expressed as rutin and
agents losing color stoichometrically with the polyphenolcarboxylic acids expressed as
number of electrons consumed which is rosmarinic acid of Hyssopy herba selective
fraction are shown in Table 1.
253
The most affluent fractions in Some selective fractions with lower
polyphenolcarboxylic acids expressed as polyphenolcarboxylic acids content such as HI
rosmarinic acid are HIII (16.783%) and HIIC (3.182%), exhibit over 80% antioxidant activity
(14.655%) followed by HIV (3.962%), HII0 in dilutions of 1% and 0.1%. Other selective
(3.888%) and HI (3.182%). HIIE contains fractions, such as HII0 (3.888%) show over
2.726% and the fraction with most low content 80% antioxidant activity only at 1% dilution.
in polyphenolcarboxylic acids are HIIE Even the polyphenolcarboxylic acids content of
(2.726%), HIID (1.030%) and HIIB (0.074%). the selective fraction HIV (3.962%) is similar
The most affluent fractions in flavonosides to the content of HI, HII0 (which exhibits a
expressed in rutin are HIIC (19.060%) and good inhibitory potential), these fractions show
HIIA (10.347%) folowed by HI (4.556%). a weaker antioxidant activity.
HIID, HIII, HII0, HIIB and HIIE containing Comparing the antioxidant activity of selective
2.853%, 2.734%, 2.513%, 2.326% and 2.178%. fractions and the polyphenolcarboxylic acids
The fraction with most low content in expressed as rosmarinic acid and flavones
flavonosides expressed in rutin are HIV expressed as rutin content it can be concluded
(1.236%). that when the concentration of
Antioxidant activity of selective fractions is polyphenolcarboxylic acids increases the
shown in Figure 2. antioxidant activity also increases, though not
an exact correlation can be made.
A correlation between the flavones content of
the selective fractions and antioxidant activity
can not be made by this method.
CONCLUSIONS
From Hyssopus officinalis L. aerial parts
(Hyssopi herba) nine selective fractions
enriched in flavones and polyphenolcarboxylic
acids were obtained by different methods.
Out of six selective fractions tested for
Figure 2. The antioxidant activity of the selective antioxidant activity, three of them exhibited a
fractions from Hyssopus officinalis scavenging activity comparable with the
rosmarinic acid.
It can be concluded that a high content of
Using the method for the analysis of the
polyphenolcarboxylic acids expressed as
antioxidant activity described, it can be noted
rosmarinic acid lead to a higher antioxidant
that rosmarinic acid in a percentage of 1, 0.1,
activity but a precise correlation can not be
0.01 and 0.001% exhibits an antioxidant
made.
activity of 88.99%, 89.84%, 66.15% and
The antioxidant activity of the flavones was not
9.14%.
highlighted by the method used in this study for
The selective fraction in a percentage of 1, 0.1,
the antioxidant activity evaluation.
0.01 and 0.001% exhibits an antioxidant
activity.
ACKNOWLEDGEMENTS
The selective fraction HIII containing 16.783%
polyphenolcarboxylic acids has a similar
This research work has been financed by the
antioxidant activity as rosmarinic acid in a
Romanian National Authority for Scientific
dilution of 1% and a much weaker activity in
Research ANCS, Competitiveness Operational
the dilution of 0.1% while the selective fraction
Programme COP-A1-A1.2.3-G-2015, Project
HIIC containing 14.655% polyphenol-
title “Innovative technologies for new, natural
carboxylic acids has a slightly lower
health products”, ID P_40_406, SMIS 105542/
antioxidant activity compared to rosmarinic
subsidiary “D” contract no. 28/2018.
acid activity in both dilutions.
254
REFERENCES processes. Scientific Bulletin. Series F.
Biotechnologies, 21, 325‒329.
Ashok, B. T., Rashid, A. (1999). The aging paradox: free Fathiazad, F., Hamedeyazdan, S. (2011). A review on
radical theory of aging. Experimental Gerontology, Hyssopus officinalis L.: Composition and biological
34, 239. activities. African Journal of Pharmacy and
Babovic, N., Djilas, S., Jadranin, M., Vajs, V., Ivanovic, Pharmacology, 17(5), 1959‒1966.
J., Petrovic, S., Zizovic, I. (2010). Supercritical Istudor, V. (2001). Farmacologie, Fitochimie,
carbon dioxide extraction of antioxidant fractions Fitoterapie. Ed Medicala, vol II, 119-122.
from selected Laminaceae herbs and their antioxidant Marin, Fr., Ortuno, A., Benaventa-Garcia, O., Del Rio, J.
capacity. Inovative Food Science and Emerging (1998). Distribution of flavone glycoside diosmin in
Technologies, 11, 98‒107. Hyssopus officinalis plants: changes during growth,
Colceru-Mihul, S., Nita, S., Grigore, A., Bubueanu, C., Planta Medica, 64(2), 181‒182.
Draghici, E., Vamanu, E., Rughinis, D. (2016). Reich, E., Schibli, A. (2008). HPTLC for the Analysis of
Selective fractions with antioxidant activity from Medicinal Plants, Thiene N.V.-Stutgart
Romanian cultivated Cynara scolymus L., Scientific Roumanian Pharmacopoeia the Xth Edition, 8, 335
Bulletin. Series F. Biotechnologies, 20, 347‒351. (1993). Ed. Medicala.
Colceru-Mihul, S., Bubueanu, C., Şerban, E. A., Grigore, Sánchez Moreno, C., Larrauri, J., Saura-Calixto, F.
A., Rughinis, D., Bazdoacă, C., Nita, S. (2017). (1998). A procedure to measure the antiradical
Selective fractions obtained from plant species efficiency of polyphenols, J. Sci. Food Agric., 76,
cultivated in Romania with potential effect on 270‒276.
counteracting diseases associated with aging Wagner, H., Bladt, S. (1996). Plant Drug analysis,
Second Edition. Springer.
255
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
COLOUR AND ORIGIN OF POLLEN PELLETS FROM TWO FRESH BEE
POLLEN SAMPLES – A PRELIMINARY ANALYSIS
Monica ENACHE, Larisa ANGHEL
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mărăşti Blvd.,
District 1, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
Food supplements are marketed in large numbers in Romania at present, they are the products of a dynamic and
profitable industry. Bee pollen is a food supplement with variable composition and properties, reflecting the floral
biodiversity used as a source. This product is collected for human use and at the same time it is indispensable for the
survival of bee colonies. In the present work fresh bee pollen samples were obtained from two commercial sources in
Bucharest (CS1 and CS2) and pellets were sorted by colour and analysed microscopically on unacetolised fresh
mounts, one pellet at a time using an optical microscope (magnification 400×; 1000×). The colour of pollen pellets was
variable, in the first sample (CS1) there were for example: white (Pinaceae – Pinus sp.), light yellow (Rosaceae –
Malus sp.), lemon (Brassicaceae – Brassica sp.), orange (Asteraceae – Taraxacum officinale), firebrick (Geraniaceae –
Geranium sp.) and black (Fabaceae – Trifolium pratense) pellets compared to the second sample (CS2) which
contained only yellow and orange shades, for example: lemon (Brassicaceae – Brassica sp.), pale yellow
(Cucurbitaceae – Cucumis sativus), orange (Asteraceae – Taraxacum officinale).
Key words: bee pollen, pellet colour, pollen source.
INTRODUCTION MATERIALS AND METHODS
Palynological studies of bee pollen are used to The analysis of the bee pollen samples was
determine the botanical origin of the pollen carried out at the Laboratory of Biology of the
which is important in assessing the nutritional Faculty of Biotechnologies, University of
quality of this product and at the same time Agronomic Sciences and Veterinary Medicine
indicate the foraging selectivity of the bees in a of Bucharest. Pellet external colour was
geographical area with a high floral diversity. estimated by color-matching using a standard
For example, for the Transilvania region colour chart (Reiter, 1947), then the
(Romania) the analysis of 35 bee pollen microscopic analysis of the pollen was carried
samples showed the predominant plant sources out for each pellet separately without
and their influence on the polyphenol and acetolysis, on wet mounts (sometimes toluidine
carotenoid content of bee pollen (Stanciu et al., blue (TB) was added for better contrast) using a
2016). Micros Austria optical microscope with ocular
Similarly, the botanical origins of selected micrometer (calibration ratio was 1 m for
honeys from Romania were determined by objective 100×, 2.5 m for objective 40×, 10
analysing the frequencies of the pollen grains m for objective 10×). Microscopic images of
found in their composition (Dobre et al., 2013). monofloral pellets have been photograped with
Theoretically color identification of corbicular a Sony Cyber-shot digital camera (Carl Zeiss
pollen could be a very useful tool for Vario-Tessar 5× zoom lens) and were later
macroscopic pollen identification if combined used to describe the grains. Several
with collection time and floral composition of morphological characteristics were studied
an area but in practice it is not possible to sort such as the shape, the size, the apertures and
pellet samples into plant species based on color the surface patterns. Classification of pollen
alone since pellets from different melliferous according to size was based on values from
species can have the same colour, mostly Popescu & Meica (1997). For the present study,
shades of yellow (Mărghitaș, 2002; Newstrom- the pollen descriptions were compared to those
Lloyd et al., 2009; Spulber et al., 2017).
256
found in the literature, for example Tarnavschi
et al. (1981; 1987; 1990), Şerbănescu-Jitariu et
al. (1994), the Pollen-Wiki site (Pollen-Wiki -
Der digitale Pollenatlas, Stebler Th.,
https://pollen.tstebler.ch/MediaWiki/index.php),
the PalDat - Palynological Database
(www.paldat.org) or the Pollen Atlas of the
Medical Faculty of Wiena
(www.pollenwarndienst.at).
RESULTS AND DISCUSSIONS
Figure 2. Medium size 3-colporate pollen seen in light
White pollen pellets
yellow pollen pellets (TB)
White pellets were present in one of the two
samples (CS1) of bee pollen that were analysed
and they were composed of large size (~ 70
m) bisaccate pollen, found in members of the
family Pinaceae, possible Pinus (Figure 1).
Figure 3. Medium size 3-porate spheroidal pollen grain
seen in pale yellow pollen pellets (TB)
Lemon pollen pellets
Figure 1. Large size bisaccate pollen found in white
Lemon coloured pellets were found in both
pollen pellets in the present study, granular cytoplasm CS1 and CS2 pollen and showed the same
can be seen medium size 3-colpate, reticulate pollen grain
(~ 35 m) that is similar to that of Family
Light yellow pollen pellets Brassicaceae (Brassica sp.). Figure 4 shows a
Medium size 3-colporate striate pollen grains triangular (convex) shape in polar view, with 3
(~ 36 m), oblate in equatorial view, with large angular colpi and a thick exine (~ 2-3 m). The
elliptic pores (~ 23 m height, ~ 13 m width) granules have pollenkitt.
and thick exine (~ 1 m) were seen in light
yellow pollen pellets found in CS1. This pollen
is similar to pollen found in Family Rosaceae
(Figure 2).
Pale yellow pollen pellets
Pale yellow pollen pellets were seen in CS2.
The microscopical images showed medium size
3-porate, spheroidal pollen grains (polar axis ~
40 m, equatorial axis ~ 40 m), elliptical
pores and psilate, thick exine (~ 1 m). Some
pollenkitt was present (Figure 3). This pollen
could be Cucumis sativus (cucumber), Family Figure 4. 3-Colpate reticulate medium size pollen grains
Cucurbitaceae. found in lemon coloured pollen pellets (TB)
257
Orange pollen pellets
Orange pellets were also present in CS1 and
CS2 bee pollen samples. Microscopic images
showed medium sized (~ 30 m) 3-aperturate
(porate) spheroidal grains, fenestrate, echinate
and surrounded by a lot of pollenkitt (Figure 5).
This pollen is Taraxacum-type pollen found in
the Asteraceae Family, most likely it is
dandelion pollen (Taraxacum officinale).
Figure 7. Polar view of 3-porate pollen grain from
firebrick pollen pellets, the image shows the surface
pattern (TB)
Black pollen pellets
Large size (~ 50 m) 3-colporate, reticulate,
prolate pollen grains were found in CS1 pollen.
The apical view shows the angular position of
the apertures and a triangular (convex) contour,
lateral view shows long colpi that intersect oval
pores that have annullum (Figures 8, 9). The
Figure 5. Fenestrate pollen grains with large drops of pollen could be from Family Fabaceae, for
pollenkitt (Taraxacum officinale) example Trifolium pratense (red clover).
Firebrick pollen pellets
Large size 3-porate pollen grains (~ 70-80 m)
were seen in firebrick coloured pollen pellets
that were found in CS1 pollen. The shape of
this pollen in polar view is triangular convex,
with pores on the corner of the grain.
Equatorial view shows elliptic (tall) pores, the
size of the polar axis is ~ 50 m, the size of the
equatorial axis is ~75-90 m (Figure 6). There
is a baculate surface pattern (Figure 7). This
pollen could be Geranium sp., Family
Geraniaceae. Figure 8. Large 3-colporate pollen grains seen in black
pollen pellets, the image shows grains in polar and
equatorial view (TB)
Figure 6. Large size 3-porate pollen grains from firebrick
Figure 9. Reticulate 3-colporate, prolate pollen grains,
pollen pellets (side view) (TB)
side view (TB)
258
CONCLUSIONS pdf_file/0017/60254/TfB_2012_Pollen-Pellet-Color-
Purity-Identity-A4-Booklet.pdf.
PalDat – a palynological database. Retrieved March 18,
The current work provided some information 2019, from www.paldat.org.
on the pollen composition of the bee pollen Popescu, N., Meica, S. (1997). Produsele apicole și
samples that were analysed. Several plant analiza chimică. Ed. Diacon Coresi.
families were suggested: Asteraceae, Reiter, R. (1947). The coloration of anther and corbicular
Brassicaceae, Cucurbitaceae, for CS2, and pollen. Ohio Journal of Science, 47(4), 137‒152.
Spulber, R., Dogaroglu, M., Băbeanu., N., Popa, O.
Asteraceae, Brassicaceae, Fabaceae, (2017). Physicochemical characterisyics of fresh bee
Geraniaceae, Rosaceae, for CS1, as well as the pollen from different botanical origins. Romanian
anemophilus Family Pinaceae. Biotechnological Letters, XX(X).
Stanciu, O. G., Dezmirean, D. S., Campos, M. G. (2016).
REFERENCES Bee pollen in Transylvania (Romania): Palynological
characterization and ORACFL values of lipophilic and
hydrophilic extracts of monofloral pollen pellets.
Dobre, I., Alexe, P., Escuredo, O., Seijo, C. M. (2013). Journal of Agricultural Science and Technology A 6,
Palynological evaluation of selected honeys from 18‒37.
Romania. Grana, 52(2), 113‒121. Stebler, Th. - Pollen-Wiki - Der digitale Pollenatlas.
HNO Klinik der Medizinischen Universitaet Wien, https://pollen.tstebler.ch/MediaWiki/index.php.
Forschungsgruppe Aerobiologie und Polleninfor- Şerbănescu-Jitariu, G., Mitroiu-Rădulescu, N.,
mation - Uwe Berger. Pollen Atlas. Retrieved March Rădulescu, D. (1994). Monografia polenului florei
18, 2019, from https://www.pollenwarndienst.at/ din România. Vol. IV. Editura Academiei Române,
aerobiologie/pollenatlas.html. Bucureşti.
Mărghitaș, A. L. (2005). Albinele și produsele lor. Ed. Tarnavschi, I.T., Şerbănescu-Jitariu G., Mitroiu-
Ceres, București. Rădulescu N., Rădulescu D. (1981; 1987; 1990).
Newstrom-Lloyd, L., Scheele, F., Raine, I., Li, X., Monografia polenului florei din România. Vol. I, II,
Gonzales, M., Roper, T. (2012). Pollen pellet colour, III. Editura Academiei Române, Bucureşti.
purity & identification. Retrieved March 18, 2019,
from http://www.treesforbeesnz.org/__data/assets/
259
Scientific Bulletin. Series F. Biotechnologies, Vol. XXIII, 2019
ISSN 2285-1364, CD-ROM ISSN 2285-5521, ISSN Online 2285-1372, ISSN-L 2285-1364
INITIAL STEPS TOWARDS THE ESTABLISHMENT
OF A POLLEN COLLECTION AT USAMV BUCHAREST:
THE STUDY OF ALLERGENIC POLLEN
Monica ENACHE, Matei COMAN, Marius HANGAN
University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mărăşti Blvd.,
District 1, Bucharest, Romania
Corresponding author email: [email protected]
Abstract
Pollen allergy (polinosis) is one of the most common allergic seasonal respiratory diseases in Romania. Allergenic
pollen is generally anemophilous, it is produced in large quantities, it is light and can be transported by the
atmospheric currents and it contains major allergens. The detection of aeroallergens, the inventory of plant species
with allergenic potential and the knowledge of their flowering period provide valuable information for both allergy
sufferers and allergy physicians. Thus, several European countries have developed aerobiological surveillance
networks that make daily bulletins containing data needed to prevent exposure to local allergenic pollen. Considering
the theoretical and practical importance of this subject and the current need to develop a network of aerobiological
monitoring laboratories in our country, the aim of the present work was the morphological study of the pollen with
allergenic potential found in Romania by microscope analysis and the establishment of a collection of pollen images at
our laboratory. Such a collection is needed for comparisons and further identification of pollen grains from the air.
Key words: pollen allergy (polinosis), allergenic pollen, optical microscope.
INTRODUCTION is important for the whole population, but
mostly for allergy sufferers and atopic children.
Pollen grains are the most important cause of The aerobiological monitoring is based on the
outdoor allergies. The pollinic allergens are microscopic counting and identification of
water-soluble proteins or glycoproteins found pollen grains at regular intervals and needs to
in the cytoplasm of the pollen grains but they be carried out by trained specialists (aerobio-
can be released and after contact with the logists) who apply specific methods and
airway mucosa or the conjunctiva of allergic standards (Galán et al., 2014; Garcia-Mozo,
individuals specifically sensitised they can 2017). Because of the difficulties and the time
trigger an IgE antibody-mediated allergic consuming nature of this manual analysis, the
reaction in seconds (Taketomi et al., 2006). aerobiological monitoring is carried out in
According to RNSA (2019) the type of pollinic certain centers only and is not able to provide
allergen determines the allergenicity potential information for the whole territory of a country.
of a particular pollen, but the allergy risk is due According to Raţiu (1971) the research in
to two more factors: the size of the pollen aeropalynology has started in Romania in the
grain, since smaller pollen are lighter and will 60s with the first iatropalynological study
stay longer in the air and the quantity of the having the title “Determination of the degree of
pollen that is released by a plant, since that pollen infestation of the atmospheric air in
influence the risk of exposure too. Bucharest and the sensitizing value of some
During the last several decades airborne pollen allergens prepared from pollen” (Bulla et al.,
and fungal spores started to be recorded perma- 1963), this was followed by other studies
nently by special pollen monitoring stations (Seropian et al., 1963; Popescu et al., 1965;
with air sampling equipment distributed in 1966; 1969; Capetti et al., 1969). Thus, it was
numerous European contries (Thibaudon & found that 1-25% of the medically investigated
Monnier, 2015). This analysis is coupled with allergies are pollinoses, being caused mainly by
the mapping of the allergenic pollen vegetation Poaceae pollen, by pollen of some Asteraceae,
to help prevent environmental exposure which by poplar (Populus) and linden (Tilia) (Raţiu,
260
1971). Also, some studies indicated a higher lanceolata and Urtica sp. (U. dioica and U.
incidence of polynoses in the sub-Carpathian urens). Instead of Amaranthus sp., Celosia
regions, which have a different climate, but cristata was used since its inflorescence was
have similar vegetation represented by deci- very well preserved, this genus has very similar
duous forests dominated by oak, beech, poplar, pollen grains with Amaranthus retroflexus and
birch and other species, as well as plains with with A. graecizanus (Tarnavschi et al., 1981,
grasses, Asteraceae, Plantaginaceae etc. pp. 44).
(Popescu & Capetti, 1971).
More recently, microscopic identification of Table 1 Grasses, trees and weeds that produce allergenic
pollen from allergenic species was carried out pollen found in Romania
in Oradea area (Pallag et al., 2011) and the first Plant family Genus/species
centre for aerobiological study of pollen was Poaceae Alopecurus pratensis (meadow
opened at the Biology Department of the West foxtail)
University of Timișoara (1999-2012) (Ianovici Anthoxantum odoratum (sweet
vernal grass)
& Faur, 2004; Ianovici, 2007a; 2007b; 2016) Avena sativa (oat)
and the second at the Colentina Clinical Hospital Dactylis glomerata (cock's-foot)
in Bucharest (2014-2016) (Leru et al., 2018). Festuca rubra (red fescue)
Holcus lanatus (meadow soft
Grasses
MATERIALS AND METHODS grass)
Hordeum vulgare (barley)
Lolium perenne (perennial
The vegetation that produces allergenic pollen ryegrass)
found in Romania includes species of trees, Phleum pratense (timothy-grass)
grasses and weeds and is spread throughout the Poa pratensis (blue grass)
country (Table 1) (Berghi, 2012). High Secale cereal (rye)
Triticum aestivum (T. vulgare)
allergenicity potential have the Poaceae, (common wheat)
Betula, Corylus, Quercus, Platanus, Ambrosia, Aceraceae Acer sp. (maple)
Artemisia and Parietaria (RNSA, 2019). Betulaceae Alnus sp. (alder)
Poaceae pollen is the most important allergenic Betula sp. (birch)
pollen in Europe where it has a large Carpinus sp. (hornbeam)
Corylus sp. (hazel)
distribution and there are high sensitisation
Cupresaceae Juniperus sp. (junipers)
rates among allergy suferers (McInnes et al., Thuya sp.
2017). Working with allergenic pollen should Fagaceae Castanea sp. (chestnut)
follow specific safety regulations, any expo- Fagus sp. (beech)
Trees
sure, even if very small, entails some risk of Quercus sp. (oak)
sensitisation at any age. Juglandaceae Juglans sp. (walnut)
Moraceae Morus sp. (mulberry)
The present study was carried out at the
Oleaceae Fraxinus sp. (ash)
Laboratory of Biology of the Faculty of Ligustrum sp. (privet)
Biotechnologies, the University of Agronomic Platanaceae Platanus sp. (plane trees)
Sciences and Veterinary Medicine of Salicaceae Populus sp. (poplar)
Bucharest, using fresh plant inflorescences Salix sp. (willow)
collected during spring 2018 and the herbarium Tiliaceae Tilia sp. (lime tree/linden)
Ulmaceae Ulmus sp. (elm)
of the laboratory.
Asteraceae Ambrosia elatior (A.
The analysis of pollen from the herbarium: artemisiifolia)
from the 12 species of Poaceae that are A. trifida (ragweeds)
considered important due to their allergy risk, 4 Artemisia vulgaris (mugwort)
species were found with flowers in the Xanthium strumarium
X. commune (cockleburs)
Weeds
laboratory collection, namely: Hordeum
Amaranthacee Amaranthus sp.
vulgare, Lolium perenne, Phleum pratense and Plantaginaceae Plantago lanceolata (plantain)
Poa pratensis; of the 8 weed genera that are Polygonaceae Rumex sp. (dock, sorrels)
considered important due to their allergy risk Urticaceae Urtica sp. (nettle)
only two were found with flowers in the Parietaria officinalis (common
laboratory collection, namely Plantago pellitory)
261
Pollen was analysed from fresh flowers in the
case of Acer pseudoplatanus, Betula verrucosa
(B. pendula, B. alba), Corylus avellana,
Fraxinus excelsior, Juglans regia, Ligustrum
vulgare, Platanus sp., Quercus robur, Salix
caprea, Tilia sp. and wild grasses.
Pollen wet mounts with or without staining
(toluidine blue - TB) were analysed using an
optical microscope Micros Austria. To
measure, an ocular micrometer was used, the
calibration ratio was 1 m for ob. 100× and 2.5
m for ob. 40×. Microscopic images of the Figure 1. Corylus pollen, polar view (TB)
pollen grains were photographed with a Sony
Cyber-shot digital camera (Carl Zeiss Vario-
Tessar 5× zoom lens) and were later used to
describe the grains. Comparisons were made
with pollen descriptions found in the literature
(Tarnavschi et al., 1981, 1987, 1990;
Şerbănescu-Jitariu et al., 1994) or on various
Internet sites (Pollen-Wiki - Der digitale
Pollenatlas, Stebler, 2019a; the PalDat -
Palynological Database or the Pollen Atlas of
the Medical Faculty of Wiena, Berger, 2019).
The classification of pollen according to size is
from Stebler (2019b).
Figure 2. Corylus pollen, lateral view (TB)
RESULTS AND DISCUSSIONS
A selection of images of the allergenic pollen
grains analysed in the present study are
presented in Figures 1-18. There were:
- triporate pollen grains: Betula verrucosa,
Corylus avellana, Urtica sp.;
- tricolpate pollen grains: Acer
pseudoplatanus, Fraxinus excelsior,
Platanus sp., Quercus robur;
- periporate pollen grains: Juglans regia,
Celosia cristata, Plantago lanceolata;
- tricolporate pollen grains: Ligustrum Figure 3. Betula pollen, polar view (TB)
vulgare, Salix caprea, Tilia sp.;
- monoporate pollen grains: Poaceae.
The triporate pollen grains of the two
Betulaceae that were analysed have similar
grain shapes, exine pattern and protruding
pores (onci), however these are larger in
Corylus than in Betula and in Betula a
vestibulum is present (Figures 1-4). Birch
pollen is small (~ 25 µm) while hazel has
medium size pollen (~30 µm).
Figure 4. Betula pollen, optical section (TB)
262
Triporate Urtica pollen (both U. dioica and U.
urens) is similar to the pollen of Parietaria,
and has small size and psilate exine (Figure 5).
Figure 8. Acer pollen, striate exine (TB)
Figure 5. Urtica pollen, polar view (TB)
The four tricolpate pollen grains that were
analysed (maple pollen, oak pollen, plane tree
pollen, ash pollen) could be difficult to
distinguish, they have similar polar and
equatorial shapes and small to medium sizes
(Figures 6-11). Therefore the colpi length,
width, shape of the colpi apex and the surface
pattern of the grain must be considered. Figure 9. Quercus pollen, polar view (TB)
Figure 6. Acer pollen, polar view Figure 10. Platanus pollen, polar view (TB)
Figure 7. Acer pollen, lateral view (TB) Figure 11. Fraxinus pollen, polar view (TB)
263
The periporate pollen grains that were analysed The analysis of the tricolporate pollen grains,
(Juglans regia, Celosia cristata, Plantago namely Ligustrum vulgare, Salix caprea and
lanceolata) have a medium size and a Tilia sp. included grains that have different
spheroidal shape. Both Plantago and Celosia shapes and characteristics. The pollen of
pollen are pantoporate (Figures 12, 13), but Ligustrum vulgare is medium size, has a
Juglans pores can be distributed unevenly and triangular convex shape in apical view, it is
have a lenticular thickening around them (onci) oblate in equatorial view and on the surface has
(Figure 14). a reticulate pattern (Figure 15).
Figure 12. Plantago pollen, pantoporate, operculate (TB) Figure 15. Ligustrum pollen, polar and lateral view, ~45
µm (TB)
Tilia pollen is medium size, the polar shape is
triangular convex with mid-wall apertures that
have a thickening around them, the equatorial
shape is oblate (Figure 16).
Figure 13. Celosia pollen, pantoporate, verrucate exine
(TB)
Figure 16. Tilia pollen, polar view, ~35 µm (TB)
Salix caprea has a small pollen, is circular with
a reticular pattern (Figure 17).
The fresh Poaceae pollen, similar to the one
from the herbarium showed the characteristics
of the pollen of this family: monoporate,
annulate, heteropolar and of small or medium
size (only some cultivated Poaceae have large
Figure 14. Juglans pollen, size > 40 µm (TB) size pollen grains) (Figure 18).
264
Garcia-Mozo, H. (2017). Poaceae pollen as the leading
aeroallergen worldwide: A review. Allergy, 72(12),
1849‒1858.
Berger, U. (2019). HNO Klinik der Medizinischen
Universitaet Wien, Forschungsgruppe Aerobiologie
und Polleninformation. Aerobiology. Pollen Atlas.
Retrieved March 18, 2019, from
www.pollenwarndienst.at.
Ianovici, N. (2007a). Calendarul polenului aeropurtat
pentru Timișoara - România. Lucrări Științifice 50,
Seria Agronomie, 337‒342.
Ianovici, N. (2007b). The principal airborne and
allergenic pollen species in Timişoara. Annals of
West University of Timisoara, Ser. Biology, X, 11‒26.
Ianovici, N. (2016). Metode de monitorizare a plantelor
Figure 17. Salix pollen, ~18 µm
pentru evaluarea calităţii habitatului urban. Teză de
abilitare. Universitatea din Bucureşti, Facultatea de
Biologie.
Ianovici, N., Faur, A. (2004). Quantitative and
qualitative study of the atmospheric pollen in 2001.
Annals of West University of Timisoara, Ser. Biology,
VII, 35‒44.
Leru, P. M., Eftimie, A. M., Thibaudon, M. (2018). First
allergenic pollen monitoring in Bucharest and results
of three year collaboration with European
aerobiology specialists. Rom. J. Intern. Med., 56(1),
27‒33.
McInnes, R. N., Hemming, D., Burgess, P., Lyndsay, D.,
Osborne, N. J., Skjøth, C. A., Thomas, S.,
Vardoulakis, S. (2017). Mapping allergenic pollen
Figure 18. Medium size Poaceae pollen vegetation in UK to study environmental exposure
and human health. Sci. Total Environ., Dec. 1; 599‒
600: 483‒499.
CONCLUSIONS PalDat - a palynological database. Retrieved March 18,
2019, from www.paldat.org.
Although the number of anemophilous plants is Pallag, A., Bungău, S., Gîtea, D., Blidar, C. F. (2011).
high, there are only about 20 allergenic pollen Pollen microscopic identification of allergenic
species in Oradea area. Analele Universității din
types that are being monitored. The knowledge Oradea, Fascicula Protecția Mediului, 16, 130‒136.
and experience of their morphological forms Popescu, I. G., Capetti, E. (1971). Cercetări cantitative
alow that a visual pollen counting could be şi calitative privind polenul atmosferic din unele zone
achieved at magnification 400×. ale României. În: Pop, E.: Progrese în palinologia
Knowledge of the potential allergy risk that românească. Simpozionul de palinologie, Cluj 14 mai
1970 (pp. 137‒142). Editura Academiei R.S.R.,
some plants have is important in landscaping, Bucureşti.
especially in the case of trees and ornamental Raţiu, F. (1971). Aeropalinologia, importanţa teoretică şi
grasses, but also in the prevention of growth of practică, cercetări aeropalinologice în România. În:
invasive allergenic species such as Ambrosia. Pop, E.: Progrese în palinologia românească.
Simpozionul de palinologie, Cluj 14 mai 1970 (pp.
131‒135). Editura Academiei R.S.R., Bucureşti.
REFERENCES RNSA (2019). Guide d’information végétation en ville.
Retrieved March 29, 2019, from
Berghi, O. (2012). Răspândirea în România a plantelor http://www.vegetation-en-ville.org/
anemofile cu potenţial allergenic. Viaţa medicală 16 Stebler, Th. (2019a). Pollen-Wiki - Der digitale
(1162). Retrieved February 26, 2018, from Pollenatlas. Retrieved March 31, 2019, from
http://www.viata-medicala.ro/*articleID_5124- https://pollen.tstebler.ch/MediaWiki/index.php
dArt.html. Stebler, Th. (2019b). Kategorien, Pollen-Wiki - Der
Galán, C., Smith, M., Thibaudon, M., Frenguelli, G., digitale Pollenatlas,
Oteros, J., Gehrig, R., Berger, U., Clot, B., Brandao, https://pollen.tstebler.ch/MediaWiki/index.php?title=
R., EAS QC Working Group (2014). Pollen Kategorien (12 Mai 2019). Retrieved May 12, 2019.
monitoring: minimum requirements and Taketomi, E. A., Sopelete, M. C., de Sousa Moreira, P.
reproducibility of analysis. Aerobiologia, 30, 385‒ F., de Assis Machado Vieira, F. (2006). Pollen
395. allergic disease: pollens and its major allergens.
265
Revista Brasileira de Otorrinolaringologia, 72(4). Monografia polenului florei din România. Vol. I, II,
Şerbănescu-Jitariu, G., Mitroiu-Rădulescu, N., III. Editura Academiei Române, Bucureşti
Rădulescu, D. (1994). Monografia polenului florei Thibaudon, M., Monnier, S. (2015). RNSA. European
din România. Vol. IV. Editura Academiei Române, Information pollen trap. Retrieved March 26, 2018,
Bucureşti. from
Tarnavschi, I.T., Şerbănescu-Jitariu G., Mitroiu- http://www.pollenstiftung.de/fileadmin/pid/images/ne
Rădulescu N., Rădulescu D. (1981; 1987; 1990). ws/European_Information_pollen_trap.pdf.
266
University of Agronomic Sciences
SCIENTIFIC BULLETIN. SERIES F. BIOTECHNOLOGIES. Volume XXIII, 2019
and Veterinary Medicine of Bucharest
Faculty of Biotechnologies
SCIENTIFIC BULLETIN
SERIES F. BIOTECHNOLOGIES
Volume XXIII
ISSN 2285 – 1364 2019
ISSN-L 2285 – 1364 BucharesT
You might also like
- KUMAR - Recent Advances in Food Biotechnology 2022100% (3)KUMAR - Recent Advances in Food Biotechnology 2022502 pages
- Biotechnology in Medical Sciences (PDFDrive)100% (1)Biotechnology in Medical Sciences (PDFDrive)471 pages
- Frontiers in Food Biotechnology (Springer, 2024)No ratings yetFrontiers in Food Biotechnology (Springer, 2024)501 pages
- Natural Bioactive Products in Sustainable Agriculture - 1st Edition PDF100% (15)Natural Bioactive Products in Sustainable Agriculture - 1st Edition PDF15 pages
- Comprehensive Biotechnology - The Principles, Applications, - Editor-In-chief Murray Moo-Young - Vol - 1, The Principles of - 1st Ed - , Oxford, - 9780080262048 - Anna's ArchiveNo ratings yetComprehensive Biotechnology - The Principles, Applications, - Editor-In-chief Murray Moo-Young - Vol - 1, The Principles of - 1st Ed - , Oxford, - 9780080262048 - Anna's Archive722 pages
- Agroforestry Species A Crop Sheets Manual 1980100% (1)Agroforestry Species A Crop Sheets Manual 1980329 pages
- Biotechnology Prospects and Applications PDF DOCX DOWNLOAD100% (17)Biotechnology Prospects and Applications PDF DOCX DOWNLOAD15 pages
- Applications of Biotechnology For Sustainable Development All Format Download100% (17)Applications of Biotechnology For Sustainable Development All Format Download14 pages
- Advances in Plant & Microbial Biotechnology: Rita Kundu Rajiv Narula EditorsNo ratings yetAdvances in Plant & Microbial Biotechnology: Rita Kundu Rajiv Narula Editors139 pages
- Blackbook of Railway in Hindi 2024 (WWW - Freestudymaterial247.co - In)100% (10)Blackbook of Railway in Hindi 2024 (WWW - Freestudymaterial247.co - In)117 pages
- Scientifical Papers 2012 - Horticulture - SeriesB100% (1)Scientifical Papers 2012 - Horticulture - SeriesB497 pages
- Basic Biotechnology - 3rd Edition Full DownloadNo ratings yetBasic Biotechnology - 3rd Edition Full Download15 pages
- Bioconversion of Wastes To Value-Added ProductsNo ratings yetBioconversion of Wastes To Value-Added Products385 pages
- CA Section 14 - Urogenital System (Chapter 14)100% (1)CA Section 14 - Urogenital System (Chapter 14)30 pages
- Engineering and Manufacturing For BiotechnologyNo ratings yetEngineering and Manufacturing For Biotechnology472 pages
- Predation, Mutualism, Commensalism, or ParasitismNo ratings yetPredation, Mutualism, Commensalism, or Parasitism25 pages
- Book 1991 HorticultureNewTechnologiesAndNo ratings yetBook 1991 HorticultureNewTechnologiesAnd400 pages
- [Advances in Biochemical Engineering_Biotechnology 32] N. Kosaric, A. Wieczorek, G. P. Cosentino (Auth.) - Agricultural Feedstock and Waste Treatment and Engineering (1985, Springer-Verlag Berlin Heidelberg)No ratings yet[Advances in Biochemical Engineering_Biotechnology 32] N. Kosaric, A. Wieczorek, G. P. Cosentino (Auth.) - Agricultural Feedstock and Waste Treatment and Engineering (1985, Springer-Verlag Berlin Heidelberg)261 pages
- CH 10 Dose Limits For Exposure To Ionizing RadiationNo ratings yetCH 10 Dose Limits For Exposure To Ionizing Radiation57 pages
- Production of Single Cell Protein Through FermentaNo ratings yetProduction of Single Cell Protein Through Fermenta147 pages
- PL Fluke Biomedical (Ekatalog Link) 2018 - 2020No ratings yetPL Fluke Biomedical (Ekatalog Link) 2018 - 20202 pages
- Monitoring Barcoding Network and Recording: Matthew Shepherd Senior Specialist, Soil Biodiversity, Natural EnglandNo ratings yetMonitoring Barcoding Network and Recording: Matthew Shepherd Senior Specialist, Soil Biodiversity, Natural England47 pages
- Biol127e Exercise 1 Spermatogenesis in GrasshopperNo ratings yetBiol127e Exercise 1 Spermatogenesis in Grasshopper9 pages
- Biotechnology For Pharmaceutical Sciences Concepts and ApplicationsNo ratings yetBiotechnology For Pharmaceutical Sciences Concepts and Applications97 pages
- A Glimpse Below The Soil Food Web: Teri C. Balser, Assistant Professor, UW-MadisonNo ratings yetA Glimpse Below The Soil Food Web: Teri C. Balser, Assistant Professor, UW-Madison26 pages
- Release of Introduced Maize Hybrid For The SudanNo ratings yetRelease of Introduced Maize Hybrid For The Sudan17 pages
- Encyclopedia of Biotechnology in Agriculture and Food (Print) 1st Edition Secure DownloadNo ratings yetEncyclopedia of Biotechnology in Agriculture and Food (Print) 1st Edition Secure Download17 pages
- Pedoman OECD No 452 - Toksisitas KronisNo ratings yetPedoman OECD No 452 - Toksisitas Kronis18 pages
- Poster - Bioconcorrenza-2014 Page 26 PDFNo ratings yetPoster - Bioconcorrenza-2014 Page 26 PDF77 pages
- Optimizing in Vitro Germination of Capsicum BaccatNo ratings yetOptimizing in Vitro Germination of Capsicum Baccat23 pages
- Biotechnology Prospects and Applications (FULL VERSION DOWNLOAD)No ratings yetBiotechnology Prospects and Applications (FULL VERSION DOWNLOAD)16 pages
- Browse Applications of Biotechnology For Sustainable Development High-Resolution PDF DownloadNo ratings yetBrowse Applications of Biotechnology For Sustainable Development High-Resolution PDF Download14 pages
- Utilizing Bioformulation To Increase Root Colonization, Soil Fertility, and Productivity of Chilli (Capsicum Annuum L.)No ratings yetUtilizing Bioformulation To Increase Root Colonization, Soil Fertility, and Productivity of Chilli (Capsicum Annuum L.)11 pages
- ID Latitude Longitude L1 L1 Type L2 L2 TYPE Remarks - 1 Remarks - 2 Remarks - 3No ratings yetID Latitude Longitude L1 L1 Type L2 L2 TYPE Remarks - 1 Remarks - 2 Remarks - 33 pages
- Cambridge International Advanced Subsidiary and Advanced LevelNo ratings yetCambridge International Advanced Subsidiary and Advanced Level12 pages
- Effect of Acetylation Method On Characterization of Cellulose Acetate Based Sago "Hampas"No ratings yetEffect of Acetylation Method On Characterization of Cellulose Acetate Based Sago "Hampas"18 pages
- Editorial Board 2012 Bioresource TechnologyNo ratings yetEditorial Board 2012 Bioresource Technology1 page
- Current Research in Biotechnology: Contents Lists Available atNo ratings yetCurrent Research in Biotechnology: Contents Lists Available at7 pages
- 2010 Influence of Captopril Treatment of PRA FullNo ratings yet2010 Influence of Captopril Treatment of PRA Full9 pages
- Faculty of Food and Biochemical Technology PragueNo ratings yetFaculty of Food and Biochemical Technology Prague8 pages
- Advances in Biochemical Engineering Biotechnology: Managing Editor: A. FiechterNo ratings yetAdvances in Biochemical Engineering Biotechnology: Managing Editor: A. Fiechter6 pages
- FTB 44 (4) 2006 449-570 Reduce Hardness of AgaveNo ratings yetFTB 44 (4) 2006 449-570 Reduce Hardness of Agave9 pages
- Bioremediation of Heavy Metals in Food Industry AP 2019 Electronic JournalNo ratings yetBioremediation of Heavy Metals in Food Industry AP 2019 Electronic Journal5 pages
- ' Theory: Abt 344 Food Biotechnology 1+1No ratings yet' Theory: Abt 344 Food Biotechnology 1+13 pages
