Leetcode Offline

------------------------------
Single Element in a Sorted Array
------------------------------

Given a sorted array consisting of only integers where every element

appears twice except for one element which appears once. Find this
single element that appears only once.

Example 1:

Input: [1,1,2,3,3,4,4,8,8]
Output: 2

Example 2:

Input: [3,3,7,7,10,11,11]
Output: 10

Note:
Your solution should run in O(log n) time and O(1) space.

------------------------------
------------------------------
Coin Change 2
------------------------------

You are given coins of different denominations and a total amount of

money. Write a function to compute the number of combinations that
make up that amount. You may assume that you have infinite number of
each kind of coin.

Note:
You can assume that

0 <= amount <= 5000

1 <= coin <= 5000
the number of coins is less than 500
the answer is guaranteed to fit into signed 32-bit integer

Example 1:

Input: amount = 5, coins = [1, 2, 5]

Output: 4
Explanation: there are four ways to make up the amount:
5=5
5=2+2+1
5=2+1+1+1
5=1+1+1+1+1

Example 2:

Input: amount = 3, coins = [2]

Output: 0
Explanation: the amount of 3 cannot be made up just with coins of 2.

Example 3:

Input: amount = 10, coins = [10]

Output: 1

------------------------------
------------------------------
Largest Palindrome Product
------------------------------
Find the largest palindrome made from the product of two n-digit
numbers.
Since the result could be very large, you should return the largest
palindrome mod 1337.

Example:
Input: 2
Output: 987
Explanation: 99 x 91 = 9009, 9009 % 1337 = 987

Note:
The range of n is [1,8].

------------------------------
------------------------------
Find All Duplicates in an Array
------------------------------
Given an array of integers, 1 &le; a[i] &le; n (n = size of array),
some elements appear twice and others appear once.

Find all the elements that appear twice in this array.

Could you do it without extra space and in O(n) runtime?

Example:
Input:
[4,3,2,7,8,2,3,1]

Output:
[2,3]

------------------------------
------------------------------
Two Sum
------------------------------
Given an array of integers, return indices of the two numbers such
that they add up to a specific target.

You may assume that each input would have exactly one solution, and
you may not use the same element twice.

Example:

Given nums = [2, 7, 11, 15], target = 9,

Because nums[0] + nums[1] = 2 + 7 = 9,

return [0, 1].

------------------------------
------------------------------
Add Two Numbers
------------------------------
You are given two non-empty linked lists representing two non-
negative integers. The digits are stored in reverse order and each
of their nodes contain a single digit. Add the two numbers and
return it as a linked list.

You may assume the two numbers do not contain any leading zero,
except the number 0 itself.

Input: (2 -> 4 -> 3) + (5 -> 6 -> 4)

Output: 7 -> 0 -> 8
------------------------------
------------------------------
Longest Substring Without Repeating Characters
------------------------------
Given a string, find the length of the longest substring without
repeating characters.

Examples:

Given "abcabcbb", the answer is "abc", which the length is 3.

Given "bbbbb", the answer is "b", with the length of 1.

Given "pwwkew", the answer is "wke", with the length of 3. Note that
the answer must be a substring, "pwke" is a subsequence and not a
substring.
------------------------------
------------------------------
Median of Two Sorted Arrays
------------------------------
There are two sorted arrays nums1 and nums2 of size m and n
respectively.

Find the median of the two sorted arrays. The overall run time
complexity should be O(log (m+n)).

Example 1:

nums1 = [1, 3]
nums2 = [2]

The median is 2.0

Example 2:

nums1 = [1, 2]
nums2 = [3, 4]

The median is (2 + 3)/2 = 2.5

------------------------------
------------------------------
Longest Palindromic Substring
------------------------------
Given a string s, find the longest palindromic substring in s. You
may assume that the maximum length of s is 1000.

Example:

Input: "babad"

Output: "bab"

Note: "aba" is also a valid answer.

Example:

Input: "cbbd"

Output: "bb"

------------------------------
------------------------------
ZigZag Conversion
------------------------------

The string "PAYPALISHIRING" is written in a zigzag pattern on a

given number of rows like this: (you may want to display this
pattern in a fixed font for better legibility)

P A H N
A P L S I I G
Y I R

And then read line by line: "PAHNAPLSIIGYIR"

Write the code that will take a string and make this conversion
given a number of rows:

string convert(string text, int nRows);

convert("PAYPALISHIRING", 3) should return "PAHNAPLSIIGYIR".

------------------------------
------------------------------
Reverse Integer
------------------------------
Reverse digits of an integer.

Example1: x = 123, return 321

Example2: x = -123, return -321

click to show spoilers.

Have you thought about this?

Here are some good questions to ask before coding. Bonus points for
you if you have already thought through this!

If the integer's last digit is 0, what should the output be? ie,
cases such as 10, 100.

Did you notice that the reversed integer might overflow? Assume the
input is a 32-bit integer, then the reverse of 1000000003 overflows.
How should you handle such cases?

For the purpose of this problem, assume that your function returns 0
when the reversed integer overflows.
Note:
The input is assumed to be a 32-bit signed integer. Your function
should return 0 when the reversed integer overflows.

------------------------------
------------------------------
String to Integer (atoi)
------------------------------
Implement atoi to convert a string to an integer.

Hint: Carefully consider all possible input cases. If you want a

challenge, please do not see below and ask yourself what are the
possible input cases.

Notes:
It is intended for this problem to be specified vaguely (ie, no
given input specs). You are responsible to gather all the input
requirements up front.

Update (2015-02-10):
The signature of the C++ function had been updated. If you still see
your function signature accepts a const char * argument, please
click the reload button to reset your code definition.

spoilers alert... click to show requirements for atoi.

Requirements for atoi:

The function first discards as many whitespace characters as

necessary until the first non-whitespace character is found. Then,
starting from this character, takes an optional initial plus or
minus sign followed by as many numerical digits as possible, and
interprets them as a numerical value.

The string can contain additional characters after those that form
the integral number, which are ignored and have no effect on the
behavior of this function.

If the first sequence of non-whitespace characters in str is not a

valid integral number, or if no such sequence exists because either
str is empty or it contains only whitespace characters, no
conversion is performed.

If no valid conversion could be performed, a zero value is returned.

If the correct value is out of the range of representable values,
INT_MAX (2147483647) or INT_MIN (-2147483648) is returned.

------------------------------
------------------------------
Palindrome Number
------------------------------
Determine whether an integer is a palindrome. Do this without extra
space.

click to show spoilers.

Some hints:

Could negative integers be palindromes? (ie, -1)

If you are thinking of converting the integer to string, note the

restriction of using extra space.

You could also try reversing an integer. However, if you have solved
the problem "Reverse Integer", you know that the reversed integer
might overflow. How would you handle such case?

There is a more generic way of solving this problem.

------------------------------
------------------------------
Regular Expression Matching
------------------------------
Implement regular expression matching with support for '.' and '*'.

'.' Matches any single character.

'*' Matches zero or more of the preceding element.

The matching should cover the entire input string (not partial).

The function prototype should be:

bool isMatch(const char *s, const char *p)

Some examples:
isMatch("aa","a") → false
isMatch("aa","aa") → true
isMatch("aaa","aa") → false
isMatch("aa", "a*") → true
isMatch("aa", ".*") → true
isMatch("ab", ".*") → true
isMatch("aab", "c*a*b") → true

------------------------------
------------------------------
Container With Most Water
------------------------------
Given n non-negative integers a1, a2, ..., an, where each represents
a point at coordinate (i, ai). n vertical lines are drawn such that
the two endpoints of line i is at (i, ai) and (i, 0). Find two
lines, which together with x-axis forms a container, such that the
container contains the most water.
Note: You may not slant the container and n is at least 2.

------------------------------
------------------------------
Integer to Roman
------------------------------
Given an integer, convert it to a roman numeral.

Input is guaranteed to be within the range from 1 to 3999.

------------------------------
------------------------------
Roman to Integer
------------------------------
Given a roman numeral, convert it to an integer.

Input is guaranteed to be within the range from 1 to 3999.

------------------------------
------------------------------
Longest Common Prefix
------------------------------
Write a function to find the longest common prefix string amongst an
array of strings.

------------------------------
------------------------------
3Sum
------------------------------
Given an array S of n integers, are there elements a, b, c in S such
that a + b + c = 0? Find all unique triplets in the array which
gives the sum of zero.

Note: The solution set must not contain duplicate triplets.

For example, given array S = [-1, 0, 1, 2, -1, -4],

A solution set is:

[
[-1, 0, 1],
[-1, -1, 2]
]

------------------------------
------------------------------
3Sum Closest
------------------------------
Given an array S of n integers, find three integers in S such that
the sum is closest to a given number, target. Return the sum of the
three integers. You may assume that each input would have exactly
one solution.
 For example, given array S = {-1 2 1 -4}, and target = 1.

The sum that is closest to the target is 2. (-1 + 2 + 1 = 2).

------------------------------
------------------------------
Letter Combinations of a Phone Number
------------------------------
Given a digit string, return all possible letter combinations that
the number could represent.

A mapping of digit to letters (just like on the telephone buttons)

is given below.

Input:Digit string "23"

Output: ["ad", "ae", "af", "bd", "be", "bf", "cd", "ce", "cf"].

Note:
Although the above answer is in lexicographical order, your answer
could be in any order you want.

------------------------------
------------------------------
4Sum
------------------------------
Given an array S of n integers, are there elements a, b, c, and d in
S such that a + b + c + d = target? Find all unique quadruplets in
the array which gives the sum of target.

Note: The solution set must not contain duplicate quadruplets.

For example, given array S = [1, 0, -1, 0, -2, 2], and target = 0.

A solution set is:

[
[-1, 0, 0, 1],
[-2, -1, 1, 2],
[-2, 0, 0, 2]
]

------------------------------
------------------------------
Remove Nth Node From End of List
------------------------------
Given a linked list, remove the nth node from the end of list and
return its head.
For example,

Given linked list: 1->2->3->4->5, and n = 2.

After removing the second node from the end, the linked list
becomes 1->2->3->5.

Note:
Given n will always be valid.
Try to do this in one pass.

------------------------------
------------------------------
Valid Parentheses
------------------------------
Given a string containing just the characters '(', ')', '{', '}',
'[' and ']', determine if the input string is valid.

The brackets must close in the correct order, "()" and "()[]{}" are
all valid but "(]" and "([)]" are not.

------------------------------
------------------------------
Merge Two Sorted Lists
------------------------------
Merge two sorted linked lists and return it as a new list. The new
list should be made by splicing together the nodes of the first two
lists.
------------------------------
------------------------------
Generate Parentheses
------------------------------

Given n pairs of parentheses, write a function to generate all

combinations of well-formed parentheses.

For example, given n = 3, a solution set is:

[
"((()))",
"(()())",
"(())()",
"()(())",
"()()()"
]
------------------------------
------------------------------
Merge k Sorted Lists
------------------------------

Merge k sorted linked lists and return it as one sorted list.

Analyze and describe its complexity.

------------------------------
------------------------------
Swap Nodes in Pairs
------------------------------

Given a linked list, swap every two adjacent nodes and return its
head.

For example,
Given 1->2->3->4, you should return the list as 2->1->4->3.

Your algorithm should use only constant space. You may not modify
the values in the list, only nodes itself can be changed.

------------------------------
------------------------------
Reverse Nodes in k-Group
------------------------------

Given a linked list, reverse the nodes of a linked list k at a time

and return its modified list.

k is a positive integer and is less than or equal to the length of

the linked list. If the number of nodes is not a multiple of k then
left-out nodes in the end should remain as it is.

You may not alter the values in the nodes, only nodes itself may be
changed.

Only constant memory is allowed.

For example,
Given this linked list: 1->2->3->4->5

For k = 2, you should return: 2->1->4->3->5

For k = 3, you should return: 3->2->1->4->5

------------------------------
------------------------------
Remove Duplicates from Sorted Array
------------------------------

Given a sorted array, remove the duplicates in place such that each
element appear only once and return the new length.

Do not allocate extra space for another array, you must do this in
place with constant memory.

For example,
Given input array nums = [1,1,2],

Your function should return length = 2, with the first two elements
of nums being 1 and 2 respectively. It doesn't matter what you leave
beyond the new length.

------------------------------
------------------------------
Remove Element
------------------------------
Given an array and a value, remove all instances of that value in
place and return the new length.

Do not allocate extra space for another array, you must do this in
place with constant memory.

The order of elements can be changed. It doesn't matter what you

leave beyond the new length.

Example:
Given input array nums = [3,2,2,3], val = 3

Your function should return length = 2, with the first two elements
of nums being 2.

Try two pointers.

Did you use the property of "the order of elements can be
changed"?
What happens when the elements to remove are rare?

------------------------------
------------------------------
Implement strStr()
------------------------------

Implement strStr().

Returns the index of the first occurrence of needle in haystack, or

-1 if needle is not part of haystack.

------------------------------
------------------------------
Divide Two Integers
------------------------------

Divide two integers without using multiplication, division and mod

operator.

If it is overflow, return MAX_INT.

------------------------------
------------------------------
Substring with Concatenation of All Words
------------------------------

You are given a string, s, and a list of words, words, that are all
of the same length. Find all starting indices of substring(s) in s
that is a concatenation of each word in words exactly once and
without any intervening characters.

For example, given:

s: "barfoothefoobarman"
words: ["foo", "bar"]

You should return the indices: [0,9].

(order does not matter).

------------------------------
------------------------------
Next Permutation
------------------------------

Implement next permutation, which rearranges numbers into the

lexicographically next greater permutation of numbers.

If such arrangement is not possible, it must rearrange it as the

lowest possible order (ie, sorted in ascending order).
The replacement must be in-place, do not allocate extra memory.

Here are some examples. Inputs are in the left-hand column and its
corresponding outputs are in the right-hand column.
1,2,3 &#8594; 1,3,2
3,2,1 &#8594; 1,2,3
1,1,5 &#8594; 1,5,1

------------------------------
------------------------------
Longest Valid Parentheses
------------------------------
Given a string containing just the characters '(' and ')', find the
length of the longest valid (well-formed) parentheses substring.

For "(()", the longest valid parentheses substring is "()", which

has length = 2.

Another example is ")()())", where the longest valid parentheses

substring is "()()", which has length = 4.

------------------------------
------------------------------
Search in Rotated Sorted Array
------------------------------
Suppose an array sorted in ascending order is rotated at some pivot
unknown to you beforehand.

(i.e., 0 1 2 4 5 6 7 might become 4 5 6 7 0 1 2).

You are given a target value to search. If found in the array return
its index, otherwise return -1.

You may assume no duplicate exists in the array.

------------------------------
------------------------------
Search for a Range
------------------------------
Given an array of integers sorted in ascending order, find the
starting and ending position of a given target value.

Your algorithm's runtime complexity must be in the order of O(log

n).

If the target is not found in the array, return [-1, -1].

For example,
Given [5, 7, 7, 8, 8, 10] and target value 8,
return [3, 4].
------------------------------
------------------------------
Search Insert Position
------------------------------
Given a sorted array and a target value, return the index if the
target is found. If not, return the index where it would be if it
were inserted in order.

You may assume no duplicates in the array.

Here are few examples.

[1,3,5,6], 5 &#8594; 2
[1,3,5,6], 2 &#8594; 1
[1,3,5,6], 7 &#8594; 4
[1,3,5,6], 0 &#8594; 0

------------------------------
------------------------------
Valid Sudoku
------------------------------
Determine if a Sudoku is valid, according to: Sudoku Puzzles - The
Rules.

The Sudoku board could be partially filled, where empty cells are
filled with the character '.'.

A partially filled sudoku which is valid.

Note:
A valid Sudoku board (partially filled) is not necessarily solvable.
Only the filled cells need to be validated.

------------------------------
------------------------------
Sudoku Solver
------------------------------
Write a program to solve a Sudoku puzzle by filling the empty cells.

Empty cells are indicated by the character '.'.

You may assume that there will be only one unique solution.

A sudoku puzzle...
...and its solution numbers marked in red.

------------------------------
------------------------------
Count and Say
------------------------------
The count-and-say sequence is the sequence of integers beginning as
follows:
1, 11, 21, 1211, 111221, ...

1 is read off as "one 1" or 11.

11 is read off as "two 1s" or 21.
21 is read off as "one 2, then one 1" or 1211.

Given an integer n, generate the nth sequence.

Note: The sequence of integers will be represented as a string.

------------------------------
------------------------------
Combination Sum
------------------------------

Given a set of candidate numbers (C) (without duplicates) and a

target number (T), find all unique combinations in C where the
candidate numbers sums to T.

The same repeated number may be chosen from C unlimited number of

times.

Note:

All numbers (including target) will be positive integers.

The solution set must not contain duplicate combinations.

For example, given candidate set [2, 3, 6, 7] and target 7,

A solution set is:

[
[7],
[2, 2, 3]
]
------------------------------
------------------------------
Combination Sum II
------------------------------

Given a collection of candidate numbers (C) and a target number (T),

find all unique combinations in C where the candidate numbers sums
to T.

Each number in C may only be used once in the combination.

Note:

All numbers (including target) will be positive integers.

The solution set must not contain duplicate combinations.

For example, given candidate set [10, 1, 2, 7, 6, 1, 5] and target

8,
A solution set is:

[
[1, 7],
[1, 2, 5],
[2, 6],
[1, 1, 6]
]

------------------------------
------------------------------
First Missing Positive
------------------------------

Given an unsorted integer array, find the first missing positive

integer.

For example,
Given [1,2,0] return 3,
and [3,4,-1,1] return 2.

Your algorithm should run in O(n) time and uses constant space.

------------------------------
------------------------------
Trapping Rain Water
------------------------------

Given n non-negative integers representing an elevation map where

the width of each bar is 1, compute how much water it is able to
trap after raining.

For example,
Given [0,1,0,2,1,0,1,3,2,1,2,1], return 6.

The above elevation map is represented by array

[0,1,0,2,1,0,1,3,2,1,2,1]. In this case, 6 units of rain water (blue
section) are being trapped. Thanks Marcos for contributing this
image!
------------------------------
------------------------------
Multiply Strings
------------------------------
Given two non-negative integers num1 and num2 represented as
strings, return the product of num1 and num2.

Note:

The length of both num1 and num2 is < 110.

Both num1 and num2 contains only digits 0-9.
Both num1 and num2 does not contain any leading zero.
You must not use any built-in BigInteger library or convert the
inputs to integer directly.

------------------------------
------------------------------
Wildcard Matching
------------------------------
Implement wildcard pattern matching with support for '?' and '*'.

'?' Matches any single character.

'*' Matches any sequence of characters (including the empty
sequence).

The matching should cover the entire input string (not partial).

The function prototype should be:

bool isMatch(const char *s, const char *p)

Some examples:
isMatch("aa","a") → false
isMatch("aa","aa") → true
isMatch("aaa","aa") → false
isMatch("aa", "*") → true
isMatch("aa", "a*") → true
isMatch("ab", "?*") → true
isMatch("aab", "c*a*b") → false

------------------------------
------------------------------
Jump Game II
------------------------------

Given an array of non-negative integers, you are initially

positioned at the first index of the array.

Each element in the array represents your maximum jump length at

that position.

Your goal is to reach the last index in the minimum number of jumps.

For example:
Given array A = [2,3,1,1,4]

The minimum number of jumps to reach the last index is 2. (Jump 1

step from index 0 to 1, then 3 steps to the last index.)

Note:
You can assume that you can always reach the last index.
------------------------------
------------------------------
Permutations
------------------------------

Given a collection of distinct numbers, return all possible

permutations.

For example,
[1,2,3] have the following permutations:

[
[1,2,3],
[1,3,2],
[2,1,3],
[2,3,1],
[3,1,2],
[3,2,1]
]

------------------------------
------------------------------
Permutations II
------------------------------

Given a collection of numbers that might contain duplicates, return

all possible unique permutations.

For example,
[1,1,2] have the following unique permutations:

[
[1,1,2],
[1,2,1],
[2,1,1]
]

------------------------------
------------------------------
Rotate Image
------------------------------
You are given an n x n 2D matrix representing an image.
Rotate the image by 90 degrees (clockwise).
Follow up:
Could you do this in-place?
------------------------------
------------------------------
Group Anagrams
------------------------------
Given an array of strings, group anagrams together.

For example, given: ["eat", "tea", "tan", "ate", "nat", "bat"],

Return:

[
["ate", "eat","tea"],
["nat","tan"],
["bat"]
]

Note: All inputs will be in lower-case.

------------------------------
------------------------------
Pow(x, n)
------------------------------
Implement pow(x, n).
------------------------------
------------------------------
N-Queens
------------------------------
The n-queens puzzle is the problem of placing n queens on an n×n
chessboard such that no two queens attack each other.

Given an integer n, return all distinct solutions to the n-queens

puzzle.

Each solution contains a distinct board configuration of the n-

queens' placement, where 'Q' and '.' both indicate a queen and an
empty space respectively.

For example,
There exist two distinct solutions to the 4-queens puzzle:

[
[".Q..", // Solution 1
"...Q",
"Q...",
"..Q."],

["..Q.", // Solution 2
"Q...",
"...Q",
".Q.."]
]

------------------------------
------------------------------
N-Queens II
------------------------------
Follow up for N-Queens problem.

Now, instead outputting board configurations, return the total

number of distinct solutions.

------------------------------
------------------------------
Maximum Subarray
------------------------------

Find the contiguous subarray within an array (containing at least

one number) which has the largest sum.

For example, given the array [-2,1,-3,4,-1,2,1,-5,4],

the contiguous subarray [4,-1,2,1] has the largest sum = 6.
click to show more practice.

More practice:

If you have figured out the O(n) solution, try coding another
solution using the divide and conquer approach, which is more
subtle.

------------------------------
------------------------------
Spiral Matrix
------------------------------
Given a matrix of m x n elements (m rows, n columns), return all
elements of the matrix in spiral order.

For example,
Given the following matrix:

[
[ 1, 2, 3 ],
[ 4, 5, 6 ],
[ 7, 8, 9 ]
]

You should return [1,2,3,6,9,8,7,4,5].

------------------------------
------------------------------
Jump Game
------------------------------

Given an array of non-negative integers, you are initially

positioned at the first index of the array.

Each element in the array represents your maximum jump length at

that position.

Determine if you are able to reach the last index.

For example:
A = [2,3,1,1,4], return true.

A = [3,2,1,0,4], return false.

------------------------------
------------------------------
Merge Intervals
------------------------------
Given a collection of intervals, merge all overlapping intervals.

For example,
Given [1,3],[2,6],[8,10],[15,18],
return [1,6],[8,10],[15,18].

------------------------------
------------------------------
Insert Interval
------------------------------
Given a set of non-overlapping intervals, insert a new interval into
the intervals (merge if necessary).

You may assume that the intervals were initially sorted according to
their start times.

Example 1:
Given intervals [1,3],[6,9], insert and merge [2,5] in as [1,5],
[6,9].

Example 2:
Given [1,2],[3,5],[6,7],[8,10],[12,16], insert and merge [4,9] in as
[1,2],[3,10],[12,16].

This is because the new interval [4,9] overlaps with [3,5],[6,7],

[8,10].

------------------------------
------------------------------
Length of Last Word
------------------------------
Given a string s consists of upper/lower-case alphabets and empty
space characters ' ', return the length of last word in the string.

If the last word does not exist, return 0.

Note: A word is defined as a character sequence consists of non-

space characters only.

For example,
Given s = "Hello World",
return 5.

------------------------------
------------------------------
Spiral Matrix II
------------------------------
Given an integer n, generate a square matrix filled with elements
from 1 to n2 in spiral order.

For example,
Given n = 3,

You should return the following matrix:

[
[ 1, 2, 3 ],
[ 8, 9, 4 ],
[ 7, 6, 5 ]
]

------------------------------
------------------------------
Permutation Sequence
------------------------------
The set [1,2,3,&#8230;,n] contains a total of n! unique
permutations.

By listing and labeling all of the permutations in order,

We get the following sequence (ie, for n = 3):

"123"
"132"
"213"
"231"
"312"
"321"

Given n and k, return the kth permutation sequence.

Note: Given n will be between 1 and 9 inclusive.

------------------------------
------------------------------
Rotate List
------------------------------
Given a list, rotate the list to the right by k places, where k is
non-negative.

For example:
Given 1->2->3->4->5->NULL and k = 2,
return 4->5->1->2->3->NULL.
------------------------------
------------------------------
Unique Paths
------------------------------
A robot is located at the top-left corner of a m x n grid (marked
'Start' in the diagram below).

The robot can only move either down or right at any point in time.
The robot is trying to reach the bottom-right corner of the grid
(marked 'Finish' in the diagram below).

How many possible unique paths are there?

Above is a 3 x 7 grid. How many possible unique paths are there?

Note: m and n will be at most 100.

------------------------------
------------------------------
Unique Paths II
------------------------------
Follow up for "Unique Paths":

Now consider if some obstacles are added to the grids. How many
unique paths would there be?

An obstacle and empty space is marked as 1 and 0 respectively in the

grid.

For example,
There is one obstacle in the middle of a 3x3 grid as illustrated
below.

[
[0,0,0],
[0,1,0],
[0,0,0]
]

The total number of unique paths is 2.

Note: m and n will be at most 100.

------------------------------
------------------------------
Minimum Path Sum
------------------------------
Given a m x n grid filled with non-negative numbers, find a path
from top left to bottom right which minimizes the sum of all numbers
along its path.

Note: You can only move either down or right at any point in time.
------------------------------
------------------------------
Valid Number
------------------------------
Validate if a given string is numeric.
Some examples:
"0" => true
" 0.1 " => true
"abc" => false
"1 a" => false
"2e10" => true

Note: It is intended for the problem statement to be ambiguous. You

should gather all requirements up front before implementing one.

Update (2015-02-10):
The signature of the C++ function had been updated. If you still see
your function signature accepts a const char * argument, please
click the reload button to reset your code definition.

------------------------------
------------------------------
Plus One
------------------------------
Given a non-negative integer represented as a non-empty array of
digits, plus one to the integer.

You may assume the integer do not contain any leading zero, except
the number 0 itself.

The digits are stored such that the most significant digit is at the
head of the list.
------------------------------
------------------------------
Add Binary
------------------------------

Given two binary strings, return their sum (also a binary string).

For example,
a = "11"
b = "1"
Return "100".

------------------------------
------------------------------
Text Justification
------------------------------

Given an array of words and a length L, format the text such that
each line has exactly L characters and is fully (left and right)
justified.
You should pack your words in a greedy approach; that is, pack as
many words as you can in each line. Pad extra spaces ' ' when
necessary so that each line has exactly L characters.

Extra spaces between words should be distributed as evenly as

possible. If the number of spaces on a line do not divide evenly
between words, the empty slots on the left will be assigned more
spaces than the slots on the right.

For the last line of text, it should be left justified and no extra
space is inserted between words.

For example,
words: ["This", "is", "an", "example", "of", "text",
"justification."]
L: 16.

Return the formatted lines as:

[
"This is an",
"example of text",
"justification. "
]

Note: Each word is guaranteed not to exceed L in length.

click to show corner cases.

Corner Cases:

A line other than the last line might contain only one word. What
should you do in this case?
In this case, that line should be left-justified.

------------------------------
------------------------------
Sqrt(x)
------------------------------
Implement int sqrt(int x).

Compute and return the square root of x.

------------------------------
------------------------------
Climbing Stairs
------------------------------
You are climbing a stair case. It takes n steps to reach to the top.

Each time you can either climb 1 or 2 steps. In how many distinct
ways can you climb to the top?

Note: Given n will be a positive integer.

------------------------------
------------------------------
Simplify Path
------------------------------
Given an absolute path for a file (Unix-style), simplify it.

For example,
path = "/home/", => "/home"
path = "/a/./b/../../c/", => "/c"

click to show corner cases.

Corner Cases:

Did you consider the case where path = "/../"?

In this case, you should return "/".
Another corner case is the path might contain multiple slashes '/'
together, such as "/home//foo/".
In this case, you should ignore redundant slashes and return "/home/
foo".

------------------------------
------------------------------
Edit Distance
------------------------------

Given two words word1 and word2, find the minimum number of steps
required to convert word1 to word2. (each operation is counted as 1
step.)
You have the following 3 operations permitted on a word:

a) Insert a character
b) Delete a character
c) Replace a character

------------------------------
------------------------------
Set Matrix Zeroes
------------------------------

Given a m x n matrix, if an element is 0, set its entire row and

column to 0. Do it in place.

click to show follow up.

Follow up:

Did you use extra space?

A straight forward solution using O(mn) space is probably a bad
idea.
A simple improvement uses O(m + n) space, but still not the best
solution.
Could you devise a constant space solution?

------------------------------
------------------------------
Search a 2D Matrix
------------------------------
Write an efficient algorithm that searches for a value in an m x n
matrix. This matrix has the following properties:

Integers in each row are sorted from left to right.

The first integer of each row is greater than the last integer of
the previous row.

For example,

Consider the following matrix:

[
[1, 3, 5, 7],
[10, 11, 16, 20],
 [23, 30, 34, 50]
]

Given target = 3, return true.

------------------------------
------------------------------
Sort Colors
------------------------------

Given an array with n objects colored red, white or blue, sort them
so that objects of the same color are adjacent, with the colors in
the order red, white and blue.

Here, we will use the integers 0, 1, and 2 to represent the color

red, white, and blue respectively.

Note:
You are not suppose to use the library's sort function for this
problem.

click to show follow up.

Follow up:
A rather straight forward solution is a two-pass algorithm using
counting sort.
First, iterate the array counting number of 0's, 1's, and 2's, then
overwrite array with total number of 0's, then 1's and followed by
2's.
Could you come up with an one-pass algorithm using only constant
space?

------------------------------
------------------------------
Minimum Window Substring
------------------------------

Given a string S and a string T, find the minimum window in S which

will contain all the characters in T in complexity O(n).

For example,
S = "ADOBECODEBANC"
T = "ABC"
Minimum window is "BANC".

Note:
If there is no such window in S that covers all characters in T,
return the empty string "".

If there are multiple such windows, you are guaranteed that there
will always be only one unique minimum window in S.

------------------------------
------------------------------
Combinations
------------------------------

Given two integers n and k, return all possible combinations of k

numbers out of 1 ... n.

For example,
If n = 4 and k = 2, a solution is:

[
[2,4],
[3,4],
[2,3],
[1,2],
[1,3],
[1,4],
]

------------------------------
------------------------------
Subsets
------------------------------

Given a set of distinct integers, nums, return all possible subsets.

Note: The solution set must not contain duplicate subsets.

For example,
If nums = [1,2,3], a solution is:

[
[3],
[1],
[2],
 [1,2,3],
[1,3],
[2,3],
[1,2],
[]
]

------------------------------
------------------------------
Word Search
------------------------------

Given a 2D board and a word, find if the word exists in the grid.

The word can be constructed from letters of sequentially adjacent

cell, where "adjacent" cells are those horizontally or vertically
neighboring. The same letter cell may not be used more than once.

For example,
Given board =

[
['A','B','C','E'],
['S','F','C','S'],
['A','D','E','E']
]

word = "ABCCED", -> returns true,

word = "SEE", -> returns true,
word = "ABCB", -> returns false.

------------------------------
------------------------------
Remove Duplicates from Sorted Array II
------------------------------

Follow up for "Remove Duplicates":

What if duplicates are allowed at most twice?

For example,
Given sorted array nums = [1,1,1,2,2,3],

Your function should return length = 5, with the first five elements
of nums being 1, 1, 2, 2 and 3. It doesn't matter what you leave
beyond the new length.

------------------------------
------------------------------
Search in Rotated Sorted Array II
------------------------------

Follow up for "Search in Rotated Sorted Array":

What if duplicates are allowed?

Would this affect the run-time complexity? How and why?

Suppose an array sorted in ascending order is rotated at some pivot

unknown to you beforehand.

(i.e., 0 1 2 4 5 6 7 might become 4 5 6 7 0 1 2).

Write a function to determine if a given target is in the array.

The array may contain duplicates.

------------------------------
------------------------------
Remove Duplicates from Sorted List II
------------------------------

Given a sorted linked list, delete all nodes that have duplicate
numbers, leaving only distinct numbers from the original list.

For example,
Given 1->2->3->3->4->4->5, return 1->2->5.
Given 1->1->1->2->3, return 2->3.

------------------------------
------------------------------
Remove Duplicates from Sorted List
------------------------------

Given a sorted linked list, delete all duplicates such that each
element appear only once.

For example,
Given 1->1->2, return 1->2.
Given 1->1->2->3->3, return 1->2->3.

------------------------------
------------------------------
Largest Rectangle in Histogram
------------------------------

Given n non-negative integers representing the histogram's bar

height where the width of each bar is 1, find the area of largest
rectangle in the histogram.
Above is a histogram where width of each bar is 1, given height =
[2,1,5,6,2,3].

The largest rectangle is shown in the shaded area, which has area =
10 unit.

For example,
Given heights = [2,1,5,6,2,3],
return 10.

------------------------------
------------------------------
Maximal Rectangle
------------------------------

Given a 2D binary matrix filled with 0's and 1's, find the largest
rectangle containing only 1's and return its area.

For example, given the following matrix:

1 0 1 0 0
1 0 1 1 1
1 1 1 1 1
1 0 0 1 0

Return 6.

------------------------------
------------------------------
Partition List
------------------------------
Given a linked list and a value x, partition it such that all nodes
less than x come before nodes greater than or equal to x.

You should preserve the original relative order of the nodes in each
of the two partitions.

For example,
Given 1->4->3->2->5->2 and x = 3,
return 1->2->2->4->3->5.

------------------------------
------------------------------
Scramble String
------------------------------
Given a string s1, we may represent it as a binary tree by
partitioning it to two non-empty substrings recursively.

Below is one possible representation of s1 = "great":

great
/ \
gr eat
/ \ / \
g r e at
/ \
a t

To scramble the string, we may choose any non-leaf node and swap its
two children.

For example, if we choose the node "gr" and swap its two children,
it produces a scrambled string "rgeat".

rgeat
/ \
rg eat
/ \ / \
r g e at
/ \
a t

We say that "rgeat" is a scrambled string of "great".

Similarly, if we continue to swap the children of nodes "eat" and

"at", it produces a scrambled string "rgtae".

rgtae
/ \
rg tae
/ \ / \
r g ta e
/ \
t a

We say that "rgtae" is a scrambled string of "great".

Given two strings s1 and s2 of the same length, determine if s2 is a

scrambled string of s1.

------------------------------
------------------------------
Merge Sorted Array
------------------------------
Given two sorted integer arrays nums1 and nums2, merge nums2 into
nums1 as one sorted array.

Note:
You may assume that nums1 has enough space (size that is greater or
equal to m + n) to hold additional elements from nums2. The number
of elements initialized in nums1 and nums2 are m and n respectively.
------------------------------
------------------------------
Gray Code
------------------------------
The gray code is a binary numeral system where two successive values
differ in only one bit.

Given a non-negative integer n representing the total number of bits

in the code, print the sequence of gray code. A gray code sequence
must begin with 0.

For example, given n = 2, return [0,1,3,2]. Its gray code sequence

is:

00 - 0
01 - 1
11 - 3
10 - 2

Note:
For a given n, a gray code sequence is not uniquely defined.

For example, [0,2,3,1] is also a valid gray code sequence according

to the above definition.

For now, the judge is able to judge based on one instance of gray
code sequence. Sorry about that.
------------------------------
------------------------------
Subsets II
------------------------------

Given a collection of integers that might contain duplicates, nums,

return all possible subsets.

Note: The solution set must not contain duplicate subsets.

For example,
If nums = [1,2,2], a solution is:

[
[2],
[1],
[1,2,2],
[2,2],
[1,2],
[]
]

------------------------------
------------------------------
Decode Ways
------------------------------

A message containing letters from A-Z is being encoded to numbers

using the following mapping:

'A' -> 1
'B' -> 2
...
'Z' -> 26

Given an encoded message containing digits, determine the total

number of ways to decode it.

For example,
Given encoded message "12",
it could be decoded as "AB" (1 2) or "L" (12).

The number of ways decoding "12" is 2.

------------------------------
------------------------------
Reverse Linked List II
------------------------------

Reverse a linked list from position m to n. Do it in-place and in

one-pass.

For example:
Given 1->2->3->4->5->NULL, m = 2 and n = 4,

return 1->4->3->2->5->NULL.

Note:
Given m, n satisfy the following condition:
1 ≤ m ≤ n ≤ length of list.

------------------------------
------------------------------
Restore IP Addresses
------------------------------
Given a string containing only digits, restore it by returning all
possible valid IP address combinations.

For example:
Given "25525511135",

return ["255.255.11.135", "255.255.111.35"]. (Order does not matter)

------------------------------
------------------------------
Binary Tree Inorder Traversal
------------------------------
Given a binary tree, return the inorder traversal of its nodes'
values.

For example:
Given binary tree [1,null,2,3],

1
\
2
/
3

return [1,3,2].

Note: Recursive solution is trivial, could you do it iteratively?

------------------------------
------------------------------
Unique Binary Search Trees II
------------------------------
Given an integer n, generate all structurally unique BST's (binary
search trees) that store values 1...n.
For example,
Given n = 3, your program should return all 5 unique BST's shown
below.

1 3 3 2 1
\ / / / \ \
3 2 1 1 3 2
/ / \ \
2 1 2 3

------------------------------
------------------------------
Unique Binary Search Trees
------------------------------
Given n, how many structurally unique BST's (binary search trees)
that store values 1...n?

For example,
Given n = 3, there are a total of 5 unique BST's.

1 3 3 2 1
\ / / / \ \
3 2 1 1 3 2
/ / \ \
2 1 2 3

------------------------------
------------------------------
Interleaving String
------------------------------

Given s1, s2, s3, find whether s3 is formed by the interleaving of

s1 and s2.

For example,
Given:
s1 = "aabcc",
s2 = "dbbca",

When s3 = "aadbbcbcac", return true.

When s3 = "aadbbbaccc", return false.

------------------------------
------------------------------
Validate Binary Search Tree
------------------------------

Given a binary tree, determine if it is a valid binary search tree

(BST).

Assume a BST is defined as follows:

The left subtree of a node contains only nodes with keys less than
the node's key.
The right subtree of a node contains only nodes with keys greater
than the node's key.
Both the left and right subtrees must also be binary search trees.

Example 1:

2
/ \
1 3

Binary tree [2,1,3], return true.

Example 2:

1
/ \
2 3

Binary tree [1,2,3], return false.

------------------------------
------------------------------
Recover Binary Search Tree
------------------------------

Two elements of a binary search tree (BST) are swapped by mistake.

Recover the tree without changing its structure.

Note:
A solution using O(n) space is pretty straight forward. Could you
devise a constant space solution?

------------------------------
------------------------------
Same Tree
------------------------------

Given two binary trees, write a function to check if they are equal
or not.

Two binary trees are considered equal if they are structurally

identical and the nodes have the same value.

------------------------------
------------------------------
Symmetric Tree
------------------------------
Given a binary tree, check whether it is a mirror of itself (ie,
symmetric around its center).

For example, this binary tree [1,2,2,3,4,4,3] is symmetric:

1
/ \
2 2
/ \ / \
3 4 4 3

But the following [1,2,2,null,3,null,3] is not:

1
/ \
2 2
\ \
3 3

Note:
Bonus points if you could solve it both recursively and iteratively.

------------------------------
------------------------------
Binary Tree Level Order Traversal
------------------------------
Given a binary tree, return the level order traversal of its nodes'
values. (ie, from left to right, level by level).

For example:
Given binary tree [3,9,20,null,null,15,7],

3
/ \
9 20
/ \
15 7
return its level order traversal as:

[
[3],
[9,20],
[15,7]
]

------------------------------
------------------------------
Binary Tree Zigzag Level Order Traversal
------------------------------
Given a binary tree, return the zigzag level order traversal of its
nodes' values. (ie, from left to right, then right to left for the
next level and alternate between).

For example:
Given binary tree [3,9,20,null,null,15,7],

3
/ \
9 20
/ \
15 7

return its zigzag level order traversal as:

[
[3],
[20,9],
[15,7]
]

------------------------------
------------------------------
Maximum Depth of Binary Tree
------------------------------
Given a binary tree, find its maximum depth.

The maximum depth is the number of nodes along the longest path from
the root node down to the farthest leaf node.
------------------------------
------------------------------
Construct Binary Tree from Preorder and Inorder Traversal
------------------------------
Given preorder and inorder traversal of a tree, construct the binary
tree.

Note:
You may assume that duplicates do not exist in the tree.

------------------------------
------------------------------
Construct Binary Tree from Inorder and Postorder Traversal
------------------------------
Given inorder and postorder traversal of a tree, construct the
binary tree.

Note:
You may assume that duplicates do not exist in the tree.

------------------------------
------------------------------
Binary Tree Level Order Traversal II
------------------------------
Given a binary tree, return the bottom-up level order traversal of
its nodes' values. (ie, from left to right, level by level from leaf
to root).

For example:
Given binary tree [3,9,20,null,null,15,7],

3
/ \
9 20
/ \
15 7

return its bottom-up level order traversal as:

[
[15,7],
[9,20],
[3]
]

------------------------------
------------------------------
Convert Sorted Array to Binary Search Tree
------------------------------
Given an array where elements are sorted in ascending order, convert
it to a height balanced BST.
------------------------------
------------------------------
Convert Sorted List to Binary Search Tree
------------------------------
Given a singly linked list where elements are sorted in ascending
order, convert it to a height balanced BST.
------------------------------
------------------------------
Balanced Binary Tree
------------------------------
Given a binary tree, determine if it is height-balanced.

For this problem, a height-balanced binary tree is defined as a

binary tree in which the depth of the two subtrees of every node
never differ by more than 1.

------------------------------
------------------------------
Minimum Depth of Binary Tree
------------------------------
Given a binary tree, find its minimum depth.

The minimum depth is the number of nodes along the shortest path
from the root node down to the nearest leaf node.
------------------------------
------------------------------
Path Sum
------------------------------

Given a binary tree and a sum, determine if the tree has a root-to-
leaf path such that adding up all the values along the path equals
the given sum.

For example:
Given the below binary tree and sum = 22,

5
/ \
4 8
/ / \
11 13 4
/ \ \
7 2 1

return true, as there exist a root-to-leaf path 5->4->11->2 which

sum is 22.
------------------------------
------------------------------
Path Sum II
------------------------------

Given a binary tree and a sum, find all root-to-leaf paths where
each path's sum equals the given sum.
For example:
Given the below binary tree and sum = 22,

5
/ \
4 8
/ / \
11 13 4
/ \ / \
7 2 5 1

return

[
[5,4,11,2],
[5,8,4,5]
]

------------------------------
------------------------------
Flatten Binary Tree to Linked List
------------------------------

Given a binary tree, flatten it to a linked list in-place.

For example,
Given

1
/ \
2 5
/ \ \
3 4 6

The flattened tree should look like:

1
\
2
\
3
\
4
\
5
 \
6

click to show hints.

Hints:
If you notice carefully in the flattened tree, each node's right
child points to the next node of a pre-order traversal.

------------------------------
------------------------------
Distinct Subsequences
------------------------------

Given a string S and a string T, count the number of distinct

subsequences of T in S.

A subsequence of a string is a new string which is formed from the

original string by deleting some (can be none) of the characters
without disturbing the relative positions of the remaining
characters. (ie, "ACE" is a subsequence of "ABCDE" while "AEC" is
not).

Here is an example:
S = "rabbbit", T = "rabbit"

Return 3.

------------------------------
------------------------------
Populating Next Right Pointers in Each Node
------------------------------

Given a binary tree

struct TreeLinkNode {
TreeLinkNode *left;
TreeLinkNode *right;
TreeLinkNode *next;
}

Populate each next pointer to point to its next right node. If there
is no next right node, the next pointer should be set to NULL.

Initially, all next pointers are set to NULL.

Note:

You may only use constant extra space.

You may assume that it is a perfect binary tree (ie, all leaves are
at the same level, and every parent has two children).

For example,
Given the following perfect binary tree,

1
/ \
2 3
/ \ / \
4 5 6 7

After calling your function, the tree should look like:

1 -> NULL
\ /
2 -> 3 -> NULL
/ \ / \
4->5->6->7 -> NULL

------------------------------
------------------------------
Populating Next Right Pointers in Each Node II
------------------------------
Follow up for problem "Populating Next Right Pointers in Each Node".
What if the given tree could be any binary tree? Would your previous
solution still work?

Note:
You may only use constant extra space.

For example,
Given the following binary tree,

1
/ \
2 3
/ \ \
4 5 7

After calling your function, the tree should look like:

 1 -> NULL
/ \
2 -> 3 -> NULL
/ \ \
4-> 5 -> 7 -> NULL

------------------------------
------------------------------
Pascal's Triangle
------------------------------
Given numRows, generate the first numRows of Pascal's triangle.

For example, given numRows = 5,

Return

[
[1],
[1,1],
[1,2,1],
[1,3,3,1],
[1,4,6,4,1]
]

------------------------------
------------------------------
Pascal's Triangle II
------------------------------
Given an index k, return the kth row of the Pascal's triangle.

For example, given k = 3,

Return [1,3,3,1].

Note:
Could you optimize your algorithm to use only O(k) extra space?

------------------------------
------------------------------
Triangle
------------------------------
Given a triangle, find the minimum path sum from top to bottom. Each
step you may move to adjacent numbers on the row below.

For example, given the following triangle

[
[2],
 [3,4],
[6,5,7],
[4,1,8,3]
]

The minimum path sum from top to bottom is 11 (i.e., 2 + 3 + 5 + 1 =

11).

Note:
Bonus point if you are able to do this using only O(n) extra space,
where n is the total number of rows in the triangle.

------------------------------
------------------------------
Best Time to Buy and Sell Stock
------------------------------
Say you have an array for which the ith element is the price of a
given stock on day i.

If you were only permitted to complete at most one transaction (ie,

buy one and sell one share of the stock), design an algorithm to
find the maximum profit.

Example 1:

Input: [7, 1, 5, 3, 6, 4]
Output: 5

max. difference = 6-1 = 5 (not 7-1 = 6, as selling price needs to be

larger than buying price)

Example 2:

Input: [7, 6, 4, 3, 1]
Output: 0

In this case, no transaction is done, i.e. max profit = 0.

------------------------------
------------------------------
Best Time to Buy and Sell Stock II
------------------------------
Say you have an array for which the ith element is the price of a
given stock on day i.

Design an algorithm to find the maximum profit. You may complete as

many transactions as you like (ie, buy one and sell one share of the
stock multiple times). However, you may not engage in multiple
transactions at the same time (ie, you must sell the stock before
you buy again).
------------------------------
------------------------------
Best Time to Buy and Sell Stock III
------------------------------
Say you have an array for which the ith element is the price of a
given stock on day i.

Design an algorithm to find the maximum profit. You may complete at

most two transactions.

Note:
You may not engage in multiple transactions at the same time (ie,
you must sell the stock before you buy again).
------------------------------
------------------------------
Binary Tree Maximum Path Sum
------------------------------

Given a binary tree, find the maximum path sum.

For this problem, a path is defined as any sequence of nodes from

some starting node to any node in the tree along the parent-child
connections. The path must contain at least one node and does not
need to go through the root.

For example:
Given the below binary tree,

1
/ \
2 3

Return 6.

------------------------------
------------------------------
Valid Palindrome
------------------------------

Given a string, determine if it is a palindrome, considering only

alphanumeric characters and ignoring cases.

For example,
"A man, a plan, a canal: Panama" is a palindrome.
"race a car" is not a palindrome.
Note:
Have you consider that the string might be empty? This is a good
question to ask during an interview.

For the purpose of this problem, we define empty string as valid

palindrome.

------------------------------
------------------------------
Word Ladder II
------------------------------

Given two words (beginWord and endWord), and a dictionary's word

list, find all shortest transformation sequence(s) from beginWord to
endWord, such that:

Only one letter can be changed at a time

Each transformed word must exist in the word list. Note that
beginWord is not a transformed word.

For example,

Given:
beginWord = "hit"
endWord = "cog"
wordList = ["hot","dot","dog","lot","log","cog"]

Return

[
["hit","hot","dot","dog","cog"],
["hit","hot","lot","log","cog"]
]

Note:

Return an empty list if there is no such transformation sequence.

All words have the same length.
All words contain only lowercase alphabetic characters.
You may assume no duplicates in the word list.
You may assume beginWord and endWord are non-empty and are not the
same.
UPDATE (2017/1/20):
The wordList parameter had been changed to a list of strings
(instead of a set of strings). Please reload the code definition to
get the latest changes.

------------------------------
------------------------------
Word Ladder
------------------------------

Given two words (beginWord and endWord), and a dictionary's word

list, find the length of shortest transformation sequence from
beginWord to endWord, such that:

Only one letter can be changed at a time.

Each transformed word must exist in the word list. Note that
beginWord is not a transformed word.

For example,

Given:
beginWord = "hit"
endWord = "cog"
wordList = ["hot","dot","dog","lot","log","cog"]

As one shortest transformation is "hit" -> "hot" -> "dot" -> "dog" -
> "cog",
return its length 5.

Note:

Return 0 if there is no such transformation sequence.

All words have the same length.
All words contain only lowercase alphabetic characters.
You may assume no duplicates in the word list.
You may assume beginWord and endWord are non-empty and are not the
same.

UPDATE (2017/1/20):
The wordList parameter had been changed to a list of strings
(instead of a set of strings). Please reload the code definition to
get the latest changes.

------------------------------
------------------------------
Longest Consecutive Sequence
------------------------------

Given an unsorted array of integers, find the length of the longest

consecutive elements sequence.

For example,
Given [100, 4, 200, 1, 3, 2],
The longest consecutive elements sequence is [1, 2, 3, 4]. Return
its length: 4.

Your algorithm should run in O(n) complexity.

------------------------------
------------------------------
Sum Root to Leaf Numbers
------------------------------
Given a binary tree containing digits from 0-9 only, each root-to-
leaf path could represent a number.
An example is the root-to-leaf path 1->2->3 which represents the
number 123.

Find the total sum of all root-to-leaf numbers.

For example,

1
/ \
2 3

The root-to-leaf path 1->2 represents the number 12.

The root-to-leaf path 1->3 represents the number 13.

Return the sum = 12 + 13 = 25.

------------------------------
------------------------------
Surrounded Regions
------------------------------

Given a 2D board containing 'X' and 'O' (the letter O), capture all
regions surrounded by 'X'.

A region is captured by flipping all 'O's into 'X's in that

surrounded region.
For example,

X X X X
X O O X
X X O X
X O X X

After running your function, the board should be:

X X X X
X X X X
X X X X
X O X X

------------------------------
------------------------------
Palindrome Partitioning
------------------------------

Given a string s, partition s such that every substring of the

partition is a palindrome.

Return all possible palindrome partitioning of s.

For example, given s = "aab",

Return

[
["aa","b"],
["a","a","b"]
]

------------------------------
------------------------------
Palindrome Partitioning II
------------------------------

Given a string s, partition s such that every substring of the

partition is a palindrome.

Return the minimum cuts needed for a palindrome partitioning of s.

For example, given s = "aab",
Return 1 since the palindrome partitioning ["aa","b"] could be
produced using 1 cut.

------------------------------
------------------------------
Clone Graph
------------------------------

Clone an undirected graph. Each node in the graph contains a label

and a list of its neighbors.

OJ's undirected graph serialization:

Nodes are labeled uniquely.

We use # as a separator for each node, and , as a separator for node

label and each neighbor of the node.

As an example, consider the serialized graph {0,1,2#1,2#2,2}.

The graph has a total of three nodes, and therefore contains three
parts as separated by #.

First node is labeled as 0. Connect node 0 to both nodes 1 and 2.

Second node is labeled as 1. Connect node 1 to node 2.
Third node is labeled as 2. Connect node 2 to node 2 (itself), thus
forming a self-cycle.

Visually, the graph looks like the following:

1
/ \
/ \
0 --- 2
/ \
\_/
------------------------------
------------------------------
Gas Station
------------------------------

There are N gas stations along a circular route, where the amount of
gas at station i is gas[i].

You have a car with an unlimited gas tank and it costs cost[i] of
gas to travel from station i to its next station (i+1). You begin
the journey with an empty tank at one of the gas stations.

Return the starting gas station's index if you can travel around the
circuit once, otherwise return -1.

Note:
The solution is guaranteed to be unique.

------------------------------
------------------------------
Candy
------------------------------

There are N children standing in a line. Each child is assigned a

rating value.

You are giving candies to these children subjected to the following

requirements:

Each child must have at least one candy.

Children with a higher rating get more candies than their neighbors.

What is the minimum candies you must give?

------------------------------
------------------------------
Single Number
------------------------------
Given an array of integers, every element appears twice except for
one. Find that single one.

Note:
Your algorithm should have a linear runtime complexity. Could you
implement it without using extra memory?

------------------------------
------------------------------
Single Number II
------------------------------

Given an array of integers, every element appears three times except

for one, which appears exactly once. Find that single one.

Note:
Your algorithm should have a linear runtime complexity. Could you
implement it without using extra memory?

------------------------------
------------------------------
Copy List with Random Pointer
------------------------------

A linked list is given such that each node contains an additional

random pointer which could point to any node in the list or null.

Return a deep copy of the list.

------------------------------
------------------------------
Word Break
------------------------------

Given a non-empty string s and a dictionary wordDict containing a

list of non-empty words, determine if s can be segmented into a
space-separated sequence of one or more dictionary words. You may
assume the dictionary does not contain duplicate words.

For example, given

s = "leetcode",
dict = ["leet", "code"].

Return true because "leetcode" can be segmented as "leet code".

UPDATE (2017/1/4):
The wordDict parameter had been changed to a list of strings
(instead of a set of strings). Please reload the code definition to
get the latest changes.
------------------------------
------------------------------
Word Break II
------------------------------

Given a non-empty string s and a dictionary wordDict containing a

list of non-empty words, add spaces in s to construct a sentence
where each word is a valid dictionary word. You may assume the
dictionary does not contain duplicate words.

Return all such possible sentences.

For example, given

s = "catsanddog",
dict = ["cat", "cats", "and", "sand", "dog"].

A solution is ["cats and dog", "cat sand dog"].

UPDATE (2017/1/4):
The wordDict parameter had been changed to a list of strings
(instead of a set of strings). Please reload the code definition to
get the latest changes.

------------------------------
------------------------------
Linked List Cycle
------------------------------

Given a linked list, determine if it has a cycle in it.

Follow up:
Can you solve it without using extra space?

------------------------------
------------------------------
Linked List Cycle II
------------------------------

Given a linked list, return the node where the cycle begins. If
there is no cycle, return null.

Note: Do not modify the linked list.

Follow up:
Can you solve it without using extra space?

------------------------------
------------------------------
Reorder List
------------------------------

Given a singly linked list L: L0→L1→…→Ln-1→Ln,

reorder it to: L0→Ln→L1→Ln-1→L2→Ln-2→…

You must do this in-place without altering the nodes' values.

For example,
Given {1,2,3,4}, reorder it to {1,4,2,3}.

------------------------------
------------------------------
Binary Tree Preorder Traversal
------------------------------
Given a binary tree, return the preorder traversal of its nodes'
values.

For example:
Given binary tree {1,#,2,3},

1
\
2
/
3

return [1,2,3].

Note: Recursive solution is trivial, could you do it iteratively?

------------------------------
------------------------------
Binary Tree Postorder Traversal
------------------------------
Given a binary tree, return the postorder traversal of its nodes'
values.

For example:
Given binary tree {1,#,2,3},
 1
\
2
/
3

return [3,2,1].

Note: Recursive solution is trivial, could you do it iteratively?

------------------------------
------------------------------
LRU Cache
------------------------------

Design and implement a data structure for Least Recently Used (LRU)
cache. It should support the following operations: get and put.

get(key) - Get the value (will always be positive) of the key if the
key exists in the cache, otherwise return -1.
put(key, value) - Set or insert the value if the key is not already
present. When the cache reached its capacity, it should invalidate
the least recently used item before inserting a new item.

Follow up:
Could you do both operations in O(1) time complexity?

Example:

LRUCache cache = new LRUCache( 2 /* capacity */ );

cache.put(1, 1);
cache.put(2, 2);
cache.get(1); // returns 1
cache.put(3, 3); // evicts key 2
cache.get(2); // returns -1 (not found)
cache.put(4, 4); // evicts key 1
cache.get(1); // returns -1 (not found)
cache.get(3); // returns 3
cache.get(4); // returns 4

------------------------------
------------------------------
Insertion Sort List
------------------------------
Sort a linked list using insertion sort.
------------------------------
------------------------------
Sort List
------------------------------
Sort a linked list in O(n log n) time using constant space
complexity.
------------------------------
------------------------------
Max Points on a Line
------------------------------
Given n points on a 2D plane, find the maximum number of points that
lie on the same straight line.
------------------------------
------------------------------
Evaluate Reverse Polish Notation
------------------------------

Evaluate the value of an arithmetic expression in Reverse Polish

Notation.

Valid operators are +, -, *, /. Each operand may be an integer or

another expression.

Some examples:

["2", "1", "+", "3", "*"] -> ((2 + 1) * 3) -> 9

["4", "13", "5", "/", "+"] -> (4 + (13 / 5)) -> 6

------------------------------
------------------------------
Reverse Words in a String
------------------------------

Given an input string, reverse the string word by word.

For example,
Given s = "the sky is blue",
return "blue is sky the".

Update (2015-02-12):
For C programmers: Try to solve it in-place in O(1) space.

click to show clarification.

Clarification:
What constitutes a word?
A sequence of non-space characters constitutes a word.
Could the input string contain leading or trailing spaces?
Yes. However, your reversed string should not contain leading or
trailing spaces.
How about multiple spaces between two words?
Reduce them to a single space in the reversed string.

------------------------------
------------------------------
Maximum Product Subarray
------------------------------

Find the contiguous subarray within an array (containing at least

one number) which has the largest product.

For example, given the array [2,3,-2,4],

the contiguous subarray [2,3] has the largest product = 6.

------------------------------
------------------------------
Find Minimum in Rotated Sorted Array
------------------------------
Suppose an array sorted in ascending order is rotated at some pivot
unknown to you beforehand.

(i.e., 0 1 2 4 5 6 7 might become 4 5 6 7 0 1 2).

Find the minimum element.

You may assume no duplicate exists in the array.

------------------------------
------------------------------
Find Minimum in Rotated Sorted Array II
------------------------------

Follow up for "Find Minimum in Rotated Sorted Array":

What if duplicates are allowed?

Would this affect the run-time complexity? How and why?

Suppose an array sorted in ascending order is rotated at some pivot

unknown to you beforehand.

(i.e., 0 1 2 4 5 6 7 might become 4 5 6 7 0 1 2).

Find the minimum element.

The array may contain duplicates.
------------------------------
------------------------------
Min Stack
------------------------------

Design a stack that supports push, pop, top, and retrieving the
minimum element in constant time.

push(x) -- Push element x onto stack.

pop() -- Removes the element on top of the stack.

top() -- Get the top element.

getMin() -- Retrieve the minimum element in the stack.

Example:

MinStack minStack = new MinStack();

minStack.push(-2);
minStack.push(0);
minStack.push(-3);
minStack.getMin(); --> Returns -3.
minStack.pop();
minStack.top(); --> Returns 0.
minStack.getMin(); --> Returns -2.

------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
Intersection of Two Linked Lists
------------------------------
Write a program to find the node at which the intersection of two
singly linked lists begins.

For example, the following two linked lists:

A: a1 → a2
↘
c1 → c2 → c3
↗
B: b1 → b2 → b3

begin to intersect at node c1.

Notes:

If the two linked lists have no intersection at all, return null.

The linked lists must retain their original structure after the
function returns.
You may assume there are no cycles anywhere in the entire linked
structure.
Your code should preferably run in O(n) time and use only O(1)
memory.

Credits:Special thanks to @stellari for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
Find Peak Element
------------------------------
A peak element is an element that is greater than its neighbors.

Given an input array where num[i] ≠ num[i+1], find a peak element

and return its index.

The array may contain multiple peaks, in that case return the index
to any one of the peaks is fine.

You may imagine that num[-1] = num[n] = -∞.

For example, in array [1, 2, 3, 1], 3 is a peak element and your

function should return the index number 2.

click to show spoilers.

Note:
Your solution should be in logarithmic complexity.

Credits:Special thanks to @ts for adding this problem and creating

all test cases.
------------------------------
------------------------------
------------------------------
Maximum Gap
------------------------------
Given an unsorted array, find the maximum difference between the
successive elements in its sorted form.

Try to solve it in linear time/space.

Return 0 if the array contains less than 2 elements.

You may assume all elements in the array are non-negative integers
and fit in the 32-bit signed integer range.

Credits:Special thanks to @porker2008 for adding this problem and

creating all test cases.
------------------------------
------------------------------
Compare Version Numbers
------------------------------
Compare two version numbers version1 and version2.
If version1 &gt; version2 return 1, if version1 &lt; version2 return
-1, otherwise return 0.

You may assume that the version strings are non-empty and contain
only digits and the . character.
The . character does not represent a decimal point and is used to
separate number sequences.
For instance, 2.5 is not "two and a half" or "half way to version
three", it is the fifth second-level revision of the second first-
level revision.

Here is an example of version numbers ordering:

0.1 &lt; 1.1 &lt; 1.2 &lt; 13.37

Credits:Special thanks to @ts for adding this problem and creating

all test cases.
------------------------------
------------------------------
Fraction to Recurring Decimal
------------------------------
Given two integers representing the numerator and denominator of a
fraction, return the fraction in string format.

If the fractional part is repeating, enclose the repeating part in

parentheses.

For example,

Given numerator = 1, denominator = 2, return "0.5".

Given numerator = 2, denominator = 1, return "2".
Given numerator = 2, denominator = 3, return "0.(6)".

No scary math, just apply elementary math knowledge. Still

remember how to perform a long division?
Try a long division on 4/9, the repeating part is obvious. Now try
4/333. Do you see a pattern?
Be wary of edge cases! List out as many test cases as you can
think of and test your code thoroughly.
Credits:Special thanks to @Shangrila for adding this problem and
creating all test cases.
------------------------------
------------------------------
Two Sum II - Input array is sorted
------------------------------
Given an array of integers that is already sorted in ascending
order, find two numbers such that they add up to a specific target
number.

The function twoSum should return indices of the two numbers such
that they add up to the target, where index1 must be less than
index2. Please note that your returned answers (both index1 and
index2) are not zero-based.

You may assume that each input would have exactly one solution and
you may not use the same element twice.

Input: numbers={2, 7, 11, 15}, target=9

Output: index1=1, index2=2

------------------------------
------------------------------
Excel Sheet Column Title
------------------------------
Given a positive integer, return its corresponding column title as
appear in an Excel sheet.

For example:

1 -> A
2 -> B
3 -> C
...
26 -> Z
27 -> AA
28 -> AB

Credits:Special thanks to @ifanchu for adding this problem and

creating all test cases.
------------------------------
------------------------------
Majority Element
------------------------------
Given an array of size n, find the majority element. The majority
element is the element that appears more than &lfloor; n/2 &rfloor;
times.

You may assume that the array is non-empty and the majority element
always exist in the array.

Credits:Special thanks to @ts for adding this problem and creating

all test cases.
------------------------------
------------------------------
------------------------------
Excel Sheet Column Number
------------------------------
Related to question Excel Sheet Column Title
Given a column title as appear in an Excel sheet, return its
corresponding column number.

For example:
A -&gt; 1
B -&gt; 2
C -&gt; 3
...
Z -&gt; 26
AA -&gt; 27
AB -&gt; 28

Credits:Special thanks to @ts for adding this problem and creating

all test cases.
------------------------------
------------------------------
Factorial Trailing Zeroes
------------------------------
Given an integer n, return the number of trailing zeroes in n!.

Note: Your solution should be in logarithmic time complexity.

Credits:Special thanks to @ts for adding this problem and creating

all test cases.
------------------------------
------------------------------
Binary Search Tree Iterator
------------------------------
Implement an iterator over a binary search tree (BST). Your iterator
will be initialized with the root node of a BST.

Calling next() will return the next smallest number in the BST.

Note: next() and hasNext() should run in average O(1) time and uses
O(h) memory, where h is the height of the tree.

Credits:Special thanks to @ts for adding this problem and creating

all test cases.
------------------------------
------------------------------
Dungeon Game
------------------------------

table.dungeon, .dungeon th, .dungeon td {

border:3px solid black;
}
 .dungeon th, .dungeon td {
text-align: center;
height: 70px;
width: 70px;
}

The demons had captured the princess (P) and imprisoned her in the
bottom-right corner of a dungeon. The dungeon consists of M x N
rooms laid out in a 2D grid. Our valiant knight (K) was initially
positioned in the top-left room and must fight his way through the
dungeon to rescue the princess.
The knight has an initial health point represented by a positive
integer. If at any point his health point drops to 0 or below, he
dies immediately.
Some of the rooms are guarded by demons, so the knight loses health
(negative integers) upon entering these rooms;
other rooms are either empty (0's) or contain magic orbs that
increase the knight's health (positive integers).
In order to reach the princess as quickly as possible, the knight
decides to move only rightward or downward in each step.

Write a function to determine the knight's minimum initial health so

that he is able to rescue the princess.
For example, given the dungeon below, the initial health of the
knight must be at least 7 if he follows the optimal path RIGHT->
RIGHT -> DOWN -> DOWN.

-2 (K)
-3
3

-5
-10
1

10
30
-5 (P)

Notes:

The knight's health has no upper bound.

Any room can contain threats or power-ups, even the first room the
knight enters and the bottom-right room where the princess is
imprisoned.

Credits:Special thanks to @stellari for adding this problem and

creating all test cases.
------------------------------
------------------------------
Largest Number
------------------------------
Given a list of non negative integers, arrange them such that they
form the largest number.

For example, given [3, 30, 34, 5, 9], the largest formed number is
9534330.

Note: The result may be very large, so you need to return a string
instead of an integer.

Credits:Special thanks to @ts for adding this problem and creating

all test cases.
------------------------------
------------------------------
------------------------------
Repeated DNA Sequences
------------------------------

All DNA is composed of a series of nucleotides abbreviated as A, C,

G, and T, for example: "ACGAATTCCG". When studying DNA, it is
sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences

(substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

------------------------------
------------------------------
Best Time to Buy and Sell Stock IV
------------------------------
Say you have an array for which the ith element is the price of a
given stock on day i.

Design an algorithm to find the maximum profit. You may complete at

most k transactions.

Note:
You may not engage in multiple transactions at the same time (ie,
you must sell the stock before you buy again).

Credits:Special thanks to @Freezen for adding this problem and

creating all test cases.
------------------------------
------------------------------
Rotate Array
------------------------------
Rotate an array of n elements to the right by k steps.
For example, with n = 7 and k = 3, the array [1,2,3,4,5,6,7] is
rotated to [5,6,7,1,2,3,4].

Note:
Try to come up as many solutions as you can, there are at least 3
different ways to solve this problem.

[show hint]
Hint:
Could you do it in-place with O(1) extra space?

Related problem: Reverse Words in a String II

Credits:Special thanks to @Freezen for adding this problem and

creating all test cases.
------------------------------
------------------------------
Reverse Bits
------------------------------
Reverse bits of a given 32 bits unsigned integer.

For example, given input 43261596 (represented in binary as

00000010100101000001111010011100), return 964176192 (represented in
binary as 00111001011110000010100101000000).

Follow up:
If this function is called many times, how would you optimize it?

Related problem: Reverse Integer

Credits:Special thanks to @ts for adding this problem and creating

all test cases.
------------------------------
------------------------------
Number of 1 Bits
------------------------------
Write a function that takes an unsigned integer and returns the
number of ’1' bits it has (also known as the Hamming weight).

For example, the 32-bit integer ’11' has binary representation

00000000000000000000000000001011, so the function should return 3.
Credits:Special thanks to @ts for adding this problem and creating
all test cases.
------------------------------
------------------------------
House Robber
------------------------------
You are a professional robber planning to rob houses along a street.
Each house has a certain amount of money stashed, the only
constraint stopping you from robbing each of them is that adjacent
houses have security system connected and it will automatically
contact the police if two adjacent houses were broken into on the
same night.

Given a list of non-negative integers representing the amount of

money of each house, determine the maximum amount of money you can
rob tonight without alerting the police.

Credits:Special thanks to @ifanchu for adding this problem and

creating all test cases. Also thanks to @ts for adding additional
test cases.
------------------------------
------------------------------
Binary Tree Right Side View
------------------------------
Given a binary tree, imagine yourself standing on the right side of
it, return the values of the nodes you can see ordered from top to
bottom.

For example:
Given the following binary tree,

1 <---
/ \
2 3 <---
\ \
5 4 <---

You should return [1, 3, 4].

Credits:Special thanks to @amrsaqr for adding this problem and

creating all test cases.
------------------------------
------------------------------
Number of Islands
------------------------------
Given a 2d grid map of '1's (land) and '0's (water), count the
number of islands. An island is surrounded by water and is formed by
connecting adjacent lands horizontally or vertically. You may assume
all four edges of the grid are all surrounded by water.
Example 1:
11110110101100000000
Answer: 1
Example 2:
11000110000010000011
Answer: 3

Credits:Special thanks to @mithmatt for adding this problem and

creating all test cases.
------------------------------
------------------------------
Bitwise AND of Numbers Range
------------------------------
Given a range [m, n] where 0 <= m <= n <= 2147483647, return the
bitwise AND of all numbers in this range, inclusive.

For example, given the range [5, 7], you should return 4.

Credits:Special thanks to @amrsaqr for adding this problem and

creating all test cases.
------------------------------
------------------------------
Happy Number
------------------------------
Write an algorithm to determine if a number is "happy".

A happy number is a number defined by the following process:

Starting with any positive integer, replace the number by the sum of
the squares of its digits, and repeat the process until the number
equals 1 (where it will stay), or it loops endlessly in a cycle
which does not include 1. Those numbers for which this process ends
in 1 are happy numbers.

Example:&nbsp;19 is a happy number

12 + 92 = 82
82 + 22 = 68
62 + 82 = 100
12 + 02 + 02 = 1

Credits:Special thanks to @mithmatt and @ts for adding this problem

and creating all test cases.
------------------------------
------------------------------
Remove Linked List Elements
------------------------------
Remove all elements from a linked list of integers that have value
val.
Example
Given: 1 --> 2 --> 6 --> 3 --> 4 --> 5 --> 6, val = 6
Return: 1 --> 2 --> 3 --> 4 --> 5

Credits:Special thanks to @mithmatt for adding this problem and

creating all test cases.
------------------------------
------------------------------
Count Primes
------------------------------
Description:
Count the number of prime numbers less than a non-negative number,
n.

Credits:Special thanks to @mithmatt for adding this problem and

creating all test cases.

Let's start with a isPrime function. To determine if a number is

prime, we need to check if it is not divisible by any number less
than n. The runtime complexity of isPrime function would be O(n) and
hence counting the total prime numbers up to n would be O(n2). Could
we do better?

As we know the number must not be divisible by any number > n / 2,

we can immediately cut the total iterations half by dividing only up
to n / 2. Could we still do better?

Let's write down all of 12's factors:

2 × 6 = 12
3 × 4 = 12
4 × 3 = 12
6 × 2 = 12

As you can see, calculations of 4 × 3 and 6 × 2 are not necessary.

Therefore, we only need to consider factors up to &radic;n because,
if n is divisible by some number p, then n = p × q and since p &le;
q, we could derive that p &le; &radic;n.

Our total runtime has now improved to O(n1.5), which is slightly

better. Is there a faster approach?

public int countPrimes(int n) {

int count = 0;
for (int i = 1; i < n; i++) {
if (isPrime(i)) count++;
}
return count;
}
private boolean isPrime(int num) {
if (num <= 1) return false;
// Loop's ending condition is i * i <= num instead of i <=
sqrt(num)
// to avoid repeatedly calling an expensive function sqrt().
for (int i = 2; i * i <= num; i++) {
if (num % i == 0) return false;
}
return true;
}

The Sieve of Eratosthenes is one of the most efficient ways to

find all prime numbers up to n. But don't let that name scare you, I
promise that the concept is surprisingly simple.

Sieve of Eratosthenes: algorithm steps for primes below 121. "Sieve

of Eratosthenes Animation" by SKopp is licensed under CC BY 2.0.

We start off with a table of n numbers. Let's look at the first

number, 2. We know all multiples of 2 must not be primes, so we mark
them off as non-primes. Then we look at the next number, 3.
Similarly, all multiples of 3 such as 3 × 2 = 6, 3 × 3 = 9, ... must
not be primes, so we mark them off as well. Now we look at the next
number, 4, which was already marked off. What does this tell you?
Should you mark off all multiples of 4 as well?

4 is not a prime because it is divisible by 2, which means all

multiples of 4 must also be divisible by 2 and were already marked
off. So we can skip 4 immediately and go to the next number, 5. Now,
all multiples of 5 such as 5 × 2 = 10, 5 × 3 = 15, 5 × 4 = 20, 5 × 5
= 25, ... can be marked off. There is a slight optimization here, we
do not need to start from 5 × 2 = 10. Where should we start marking
off?

In fact, we can mark off multiples of 5 starting at 5 × 5 = 25,

because 5 × 2 = 10 was already marked off by multiple of 2,
similarly 5 × 3 = 15 was already marked off by multiple of 3.
Therefore, if the current number is p, we can always mark off
multiples of p starting at p2, then in increments of p: p2 + p, p2 +
2p, ... Now what should be the terminating loop condition?

It is easy to say that the terminating loop condition is p < n,

which is certainly correct but not efficient. Do you still remember
Hint #3?

Yes, the terminating loop condition can be p < &radic;n, as all

non-primes &ge; &radic;n must have already been marked off. When the
loop terminates, all the numbers in the table that are non-marked
are prime.
The Sieve of Eratosthenes uses an extra O(n) memory and its runtime
complexity is O(n log log n). For the more mathematically inclined
readers, you can read more about its algorithm complexity on
Wikipedia.

public int countPrimes(int n) {

boolean[] isPrime = new boolean[n];
for (int i = 2; i < n; i++) {
isPrime[i] = true;
}
// Loop's ending condition is i * i < n instead of i < sqrt(n)
// to avoid repeatedly calling an expensive function sqrt().
for (int i = 2; i * i < n; i++) {
if (!isPrime[i]) continue;
for (int j = i * i; j < n; j += i) {
isPrime[j] = false;
}
}
int count = 0;
for (int i = 2; i < n; i++) {
if (isPrime[i]) count++;
}
return count;
}

------------------------------
------------------------------
Isomorphic Strings
------------------------------
Given two strings s and t, determine if they are isomorphic.

Two strings are isomorphic if the characters in s can be replaced to

get t.

All occurrences of a character must be replaced with another

character while preserving the order of characters. No two
characters may map to the same character but a character may map to
itself.

For example,
Given "egg", "add", return true.

Given "foo", "bar", return false.

Given "paper", "title", return true.

Note:
You may assume both s and t have the same length.
------------------------------
------------------------------
Reverse Linked List
------------------------------
Reverse a singly linked list.

click to show more hints.

Hint:
A linked list can be reversed either iteratively or recursively.
Could you implement both?

------------------------------
------------------------------
Course Schedule
------------------------------

There are a total of n courses you have to take, labeled from 0 to n

- 1.

Some courses may have prerequisites, for example to take course 0

you have to first take course 1, which is expressed as a pair: [0,1]

Given the total number of courses and a list of prerequisite pairs,

is it possible for you to finish all courses?

For example:
2, [[1,0]]
There are a total of 2 courses to take. To take course 1 you should
have finished course 0. So it is possible.

2, [[1,0],[0,1]]
There are a total of 2 courses to take. To take course 1 you should
have finished course 0, and to take course 0 you should also have
finished course 1. So it is impossible.

Note:

The input prerequisites is a graph represented by a list of edges,

not adjacency matrices. Read more about how a graph is represented.
You may assume that there are no duplicate edges in the input
prerequisites.

click to show more hints.

Hints:

This problem is equivalent to finding if a cycle exists in a

directed graph. If a cycle exists, no topological ordering exists
and therefore it will be impossible to take all courses.
Topological Sort via DFS - A great video tutorial (21 minutes) on
Coursera explaining the basic concepts of Topological Sort.
Topological sort could also be done via BFS.
------------------------------
------------------------------
Implement Trie (Prefix Tree)
------------------------------

Implement a trie with insert, search, and startsWith methods.

Note:
You may assume that all inputs are consist of lowercase letters a-z.

------------------------------
------------------------------
Minimum Size Subarray Sum
------------------------------

Given an array of n positive integers and a positive integer s, find

the minimal length of a contiguous subarray of which the sum ≥ s. If
there isn't one, return 0 instead.

For example, given the array [2,3,1,2,4,3] and s = 7,

the subarray [4,3] has the minimal length under the problem
constraint.

click to show more practice.

More practice:

If you have figured out the O(n) solution, try coding another
solution of which the time complexity is O(n log n).

Credits:Special thanks to @Freezen for adding this problem and

creating all test cases.
------------------------------
------------------------------
Course Schedule II
------------------------------

There are a total of n courses you have to take, labeled from 0 to n

- 1.

Some courses may have prerequisites, for example to take course 0

you have to first take course 1, which is expressed as a pair: [0,1]

Given the total number of courses and a list of prerequisite pairs,

return the ordering of courses you should take to finish all
courses.
There may be multiple correct orders, you just need to return one of
them. If it is impossible to finish all courses, return an empty
array.

For example:
2, [[1,0]]
There are a total of 2 courses to take. To take course 1 you should
have finished course 0. So the correct course order is [0,1]

4, [[1,0],[2,0],[3,1],[3,2]]
There are a total of 4 courses to take. To take course 3 you should
have finished both courses 1 and 2. Both courses 1 and 2 should be
taken after you finished course 0. So one correct course order is
[0,1,2,3]. Another correct ordering is[0,2,1,3].

Note:

The input prerequisites is a graph represented by a list of edges,

not adjacency matrices. Read more about how a graph is represented.
You may assume that there are no duplicate edges in the input
prerequisites.

click to show more hints.

Hints:

This problem is equivalent to finding the topological order in a

directed graph. If a cycle exists, no topological ordering exists
and therefore it will be impossible to take all courses.
Topological Sort via DFS - A great video tutorial (21 minutes) on
Coursera explaining the basic concepts of Topological Sort.
Topological sort could also be done via BFS.

------------------------------
------------------------------
Add and Search Word - Data structure design
------------------------------

Design a data structure that supports the following two operations:

void addWord(word)
bool search(word)

search(word) can search a literal word or a regular expression

string containing only letters a-z or .. A . means it can represent
any one letter.
For example:

addWord("bad")
addWord("dad")
addWord("mad")
search("pad") -> false
search("bad") -> true
search(".ad") -> true
search("b..") -> true

Note:
You may assume that all words are consist of lowercase letters a-z.

click to show hint.

You should be familiar with how a Trie works. If not, please work on
this problem: Implement Trie (Prefix Tree) first.

------------------------------
------------------------------
Word Search II
------------------------------

Given a 2D board and a list of words from the dictionary, find all
words in the board.

Each word must be constructed from letters of sequentially adjacent

cell, where "adjacent" cells are those horizontally or vertically
neighboring. The same letter cell may not be used more than once in
a word.

For example,
Given words = ["oath","pea","eat","rain"] and board =

[
['o','a','a','n'],
['e','t','a','e'],
['i','h','k','r'],
['i','f','l','v']
]

Return ["eat","oath"].
Note:
You may assume that all inputs are consist of lowercase letters a-z.

click to show hint.

You would need to optimize your backtracking to pass the larger

test. Could you stop backtracking earlier?

If the current candidate does not exist in all words' prefix, you
could stop backtracking immediately. What kind of data structure
could answer such query efficiently? Does a hash table work? Why or
why not? How about a Trie? If you would like to learn how to
implement a basic trie, please work on this problem: Implement Trie
(Prefix Tree) first.

------------------------------
------------------------------
House Robber II
------------------------------
Note: This is an extension of House Robber.

After robbing those houses on that street, the thief has found
himself a new place for his thievery so that he will not get too
much attention. This time, all houses at this place are arranged in
a circle. That means the first house is the neighbor of the last
one. Meanwhile, the security system for these houses remain the same
as for those in the previous street.

Given a list of non-negative integers representing the amount of

money of each house, determine the maximum amount of money you can
rob tonight without alerting the police.

Credits:Special thanks to @Freezen for adding this problem and

creating all test cases.
------------------------------
------------------------------
Shortest Palindrome
------------------------------

Given a string S, you are allowed to convert it to a palindrome by

adding characters in front of it. Find and return the shortest
palindrome you can find by performing this transformation.

For example:
Given "aacecaaa", return "aaacecaaa".
Given "abcd", return "dcbabcd".

Credits:Special thanks to @ifanchu for adding this problem and

creating all test cases. Thanks to @Freezen for additional test
cases.
------------------------------
------------------------------
Kth Largest Element in an Array
------------------------------
Find the kth largest element in an unsorted array. Note that it is
the kth largest element in the sorted order, not the kth distinct
element.

For example,
Given [3,2,1,5,6,4] and k = 2, return 5.

Note:
You may assume k is always valid, 1 ≤ k ≤ array's length.

Credits:Special thanks to @mithmatt for adding this problem and

creating all test cases.
------------------------------
------------------------------
Combination Sum III
------------------------------

Find all possible combinations of k numbers that add up to a number

n, given that only numbers from 1 to 9 can be used and each
combination should be a unique set of numbers.

Example 1:
Input: k = 3, n = 7
Output:

[[1,2,4]]

Example 2:
Input: k = 3, n = 9
Output:

[[1,2,6], [1,3,5], [2,3,4]]

Credits:Special thanks to @mithmatt for adding this problem and

creating all test cases.
------------------------------
------------------------------
Contains Duplicate
------------------------------

Given an array of integers, find if the array contains any

duplicates. Your function should return true if any value appears at
least twice in the array, and it should return false if every
element is distinct.

------------------------------
------------------------------
The Skyline Problem
------------------------------
A city's skyline is the outer contour of the silhouette formed by
all the buildings in that city when viewed from a distance. Now
suppose you are given the locations and height of all the buildings
as shown on a cityscape photo (Figure A), write a program to output
the skyline formed by these buildings collectively (Figure B).

The geometric information of each building is represented by a

triplet of integers [Li, Ri, Hi], where Li and Ri are the x
coordinates of the left and right edge of the ith building,
respectively, and Hi is its height. It is guaranteed that 0 ≤ Li, Ri
≤ INT_MAX, 0 < Hi ≤ INT_MAX, and Ri - Li > 0. You may assume all
buildings are perfect rectangles grounded on an absolutely flat
surface at height 0.

For instance, the dimensions of all buildings in Figure A are

recorded as: [ [2 9 10], [3 7 15], [5 12 12], [15 20 10], [19 24
8] ] .

The output is a list of "key points" (red dots in Figure B) in the

format of [ [x1,y1], [x2, y2], [x3, y3], ... ] that uniquely defines
a skyline. A key point is the left endpoint of a horizontal line
segment. Note that the last key point, where the rightmost building
ends, is merely used to mark the termination of the skyline, and
always has zero height. Also, the ground in between any two adjacent
buildings should be considered part of the skyline contour.

For instance, the skyline in Figure B should be represented as:[ [2

10], [3 15], [7 12], [12 0], [15 10], [20 8], [24, 0] ].

Notes:

The number of buildings in any input list is guaranteed to be in

the range [0, 10000].
The input list is already sorted in ascending order by the left x
position Li.
The output list must be sorted by the x position.
There must be no consecutive horizontal lines of equal height in
the output skyline. For instance, [...[2 3], [4 5], [7 5], [11 5],
[12 7]...] is not acceptable; the three lines of height 5 should be
merged into one in the final output as such: [...[2 3], [4 5], [12
7], ...]

Credits:Special thanks to @stellari for adding this problem,

creating these two awesome images and all test cases.
------------------------------
------------------------------
Contains Duplicate II
------------------------------

Given an array of integers and an integer k, find out whether there

are two distinct indices i and j in the array such that nums[i] =
nums[j] and the absolute difference between i and j is at most k.

------------------------------
------------------------------
Contains Duplicate III
------------------------------

Given an array of integers, find out whether there are two distinct
indices i and j in the array such that the absolute difference
between nums[i] and nums[j] is at most t and the absolute difference
between i and j is at most k.

------------------------------
------------------------------
Maximal Square
------------------------------

Given a 2D binary matrix filled with 0's and 1's, find the largest
square containing only 1's and return its area.

For example, given the following matrix:

1 0 1 0 0
1 0 1 1 1
1 1 1 1 1
1 0 0 1 0

Return 4.

Credits:Special thanks to @Freezen for adding this problem and

creating all test cases.
------------------------------
------------------------------
Count Complete Tree Nodes
------------------------------
Given a complete binary tree, count the number of nodes.
Definition of a complete binary tree from Wikipedia:
In a complete binary tree every level, except possibly the last, is
completely filled, and all nodes in the last level are as far left
as possible. It can have between 1 and 2h nodes inclusive at the
last level h.
------------------------------
------------------------------
Rectangle Area
------------------------------
Find the total area covered by two rectilinear rectangles in a 2D
plane.
Each rectangle is defined by its bottom left corner and top right
corner as shown in the figure.

Assume that the total area is never beyond the maximum possible
value of int.

Credits:Special thanks to @mithmatt for adding this problem,

creating the above image and all test cases.
------------------------------
------------------------------
Basic Calculator
------------------------------
Implement a basic calculator to evaluate a simple expression string.

The expression string may contain open ( and closing parentheses ),

the plus + or minus sign -, non-negative integers and empty
spaces .

You may assume that the given expression is always valid.

Some examples:

"1 + 1" = 2
" 2-1 + 2 " = 3
"(1+(4+5+2)-3)+(6+8)" = 23

Note: Do not use the eval built-in library function.

------------------------------
------------------------------
Implement Stack using Queues
------------------------------

Implement the following operations of a stack using queues.

push(x) -- Push element x onto stack.

pop() -- Removes the element on top of the stack.

top() -- Get the top element.

empty() -- Return whether the stack is empty.

Notes:

You must use only standard operations of a queue -- which means only
push to back, peek/pop from front, size, and is empty operations are
valid.
Depending on your language, queue may not be supported natively. You
may simulate a queue by using a list or deque (double-ended queue),
as long as you use only standard operations of a queue.
You may assume that all operations are valid (for example, no pop or
top operations will be called on an empty stack).

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and all test cases.
------------------------------
------------------------------
Invert Binary Tree
------------------------------
Invert a binary tree.
4
/ \
2 7
/ \ / \
1 3 6 9

to
4
/ \
7 2
/ \ / \
9 6 3 1

Trivia:
This problem was inspired by this original tweet by Max Howell:
Google: 90% of our engineers use the software you wrote (Homebrew),
but you can’t invert a binary tree on a whiteboard so fuck off.
------------------------------
------------------------------
Basic Calculator II
------------------------------
Implement a basic calculator to evaluate a simple expression string.
The expression string contains only non-negative integers, +, -,
*, / operators and empty spaces . The integer division should
truncate toward zero.

You may assume that the given expression is always valid.

Some examples:

"3+2*2" = 7
" 3/2 " = 1
" 3+5 / 2 " = 5

Note: Do not use the eval built-in library function.

Credits:Special thanks to @ts for adding this problem and creating

all test cases.
------------------------------
------------------------------
Summary Ranges
------------------------------

Given a sorted integer array without duplicates, return the summary

of its ranges.

For example, given [0,1,2,4,5,7], return ["0->2","4->5","7"].

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
Majority Element II
------------------------------
Given an integer array of size n, find all elements that appear more
than &lfloor; n/3 &rfloor; times. The algorithm should run in linear
time and in O(1) space.

How many majority elements could it possibly have?

Do you have a better hint? Suggest it!

------------------------------
------------------------------
Kth Smallest Element in a BST
------------------------------
Given a binary search tree, write a function kthSmallest to find the
kth smallest element in it.
Note:
You may assume k is always valid, 1 ≤ k ≤ BST's total elements.

Follow up:
What if the BST is modified (insert/delete operations) often and you
need to find the kth smallest frequently? How would you optimize the
kthSmallest routine?

Try to utilize the property of a BST.

What if you could modify the BST node's structure?
The optimal runtime complexity is O(height of BST).

Credits:Special thanks to @ts for adding this problem and creating

all test cases.
------------------------------
------------------------------
Power of Two
------------------------------

Given an integer, write a function to determine if it is a power of

two.

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
Implement Queue using Stacks
------------------------------

Implement the following operations of a queue using stacks.

push(x) -- Push element x to the back of queue.

pop() -- Removes the element from in front of queue.

peek() -- Get the front element.

empty() -- Return whether the queue is empty.

Notes:

You must use only standard operations of a stack -- which means only
push to top, peek/pop from top, size, and is empty operations are
valid.
Depending on your language, stack may not be supported natively. You
may simulate a stack by using a list or deque (double-ended queue),
as long as you use only standard operations of a stack.
You may assume that all operations are valid (for example, no pop or
peek operations will be called on an empty queue).

------------------------------
------------------------------
Number of Digit One
------------------------------
Given an integer n, count the total number of digit 1 appearing in
all non-negative integers less than or equal to n.

For example:
Given n = 13,
Return 6, because digit 1 occurred in the following numbers: 1, 10,
11, 12, 13.

Beware of overflow.

------------------------------
------------------------------
Palindrome Linked List
------------------------------
Given a singly linked list, determine if it is a palindrome.

Follow up:
Could you do it in O(n) time and O(1) space?
------------------------------
------------------------------
Lowest Common Ancestor of a Binary Search Tree
------------------------------

Given a binary search tree (BST), find the lowest common ancestor
(LCA) of two given nodes in the BST.

According to the definition of LCA on Wikipedia: “The lowest common

ancestor is defined between two nodes v and w as the lowest node in
T that has both v and w as descendants (where we allow a node to be
a descendant of itself).”

_______6______
/ \
___2__ ___8__
/ \ / \
0 _4 7 9
/ \
3 5
For example, the lowest common ancestor (LCA) of nodes 2 and 8 is 6.
Another example is LCA of nodes 2 and 4 is 2, since a node can be a
descendant of itself according to the LCA definition.
------------------------------
------------------------------
Lowest Common Ancestor of a Binary Tree
------------------------------

Given a binary tree, find the lowest common ancestor (LCA) of two
given nodes in the tree.

According to the definition of LCA on Wikipedia: “The lowest common

ancestor is defined between two nodes v and w as the lowest node in
T that has both v and w as descendants (where we allow a node to be
a descendant of itself).”

_______3______
/ \
___5__ ___1__
/ \ / \
6 _2 0 8
/ \
7 4

For example, the lowest common ancestor (LCA) of nodes 5 and 1 is 3.

Another example is LCA of nodes 5 and 4 is 5, since a node can be a
descendant of itself according to the LCA definition.
------------------------------
------------------------------
Delete Node in a Linked List
------------------------------

Write a function to delete a node (except the tail) in a singly

linked list, given only access to that node.

Supposed the linked list is 1 -> 2 -> 3 -> 4 and you are given the
third node with value 3, the linked list should become 1 -> 2 -> 4
after calling your function.

------------------------------
------------------------------
Product of Array Except Self
------------------------------
Given an array of n integers where n > 1, nums, return an array
output such that output[i] is equal to the product of all the
elements of nums except nums[i].

Solve it without division and in O(n).

For example, given [1,2,3,4], return [24,12,8,6].

Follow up:
Could you solve it with constant space complexity? (Note: The output
array does not count as extra space for the purpose of space
complexity analysis.)
------------------------------
------------------------------
Sliding Window Maximum
------------------------------
Given an array nums, there is a sliding window of size k which is
moving from the very left of the array to the very right. You can
only see the k numbers in the window. Each time the sliding window
moves right by one position.

For example,
Given nums = [1,3,-1,-3,5,3,6,7], and k = 3.

Window position Max

--------------- -----
[1 3 -1] -3 5 3 6 7 3
1 [3 -1 -3] 5 3 6 7 3
1 3 [-1 -3 5] 3 6 7 5
1 3 -1 [-3 5 3] 6 7 5
1 3 -1 -3 [5 3 6] 7 6
1 3 -1 -3 5 [3 6 7] 7

Therefore, return the max sliding window as [3,3,5,5,6,7].

Note:
You may assume k is always valid, ie: 1 ≤ k ≤ input array's size for
non-empty array.

Follow up:
Could you solve it in linear time?

How about using a data structure such as deque (double-ended

queue)?
The queue size need not be the same as the window’s size.
Remove redundant elements and the queue should store only elements
that need to be considered.

------------------------------
------------------------------
Search a 2D Matrix II
------------------------------
Write an efficient algorithm that searches for a value in an m x n
matrix. This matrix has the following properties:

Integers in each row are sorted in ascending from left to right.

Integers in each column are sorted in ascending from top to bottom.

For example,

Consider the following matrix:

[
[1, 4, 7, 11, 15],
[2, 5, 8, 12, 19],
[3, 6, 9, 16, 22],
[10, 13, 14, 17, 24],
[18, 21, 23, 26, 30]
]

Given target = 5, return true.

Given target = 20, return false.
------------------------------
------------------------------
Different Ways to Add Parentheses
------------------------------
Given a string of numbers and operators, return all possible results
from computing all the different possible ways to group numbers and
operators. The valid operators are +, - and *.

Example 1
Input: "2-1-1".
((2-1)-1) = 0
(2-(1-1)) = 2
Output: [0, 2]

Example 2
Input: "2*3-4*5"
(2*(3-(4*5))) = -34
((2*3)-(4*5)) = -14
((2*(3-4))*5) = -10
(2*((3-4)*5)) = -10
(((2*3)-4)*5) = 10
Output: [-34, -14, -10, -10, 10]

Credits:Special thanks to @mithmatt for adding this problem and

creating all test cases.
------------------------------
------------------------------
Valid Anagram
------------------------------
Given two strings s and t, write a function to determine if t is an
anagram of s.

For example,
s = "anagram", t = "nagaram", return true.
s = "rat", t = "car", return false.

Note:
You may assume the string contains only lowercase alphabets.

Follow up:
What if the inputs contain unicode characters? How would you adapt
your solution to such case?
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
Binary Tree Paths
------------------------------

Given a binary tree, return all root-to-leaf paths.

For example, given the following binary tree:

1
/ \
2 3
\
5

All root-to-leaf paths are:

["1->2->5", "1->3"]
Credits:Special thanks to @jianchao.li.fighter for adding this
problem and creating all test cases.
------------------------------
------------------------------
Add Digits
------------------------------

Given a non-negative integer num, repeatedly add all its digits

until the result has only one digit.

For example:

Given num = 38, the process is like: 3 + 8 = 11, 1 + 1 = 2. Since 2

has only one digit, return it.

Follow up:
Could you do it without any loop/recursion in O(1) runtime?

A naive implementation of the above process is trivial. Could you

come up with other methods?
What are all the possible results?
How do they occur, periodically or randomly?
You may find this Wikipedia article useful.

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
------------------------------
Single Number III
------------------------------

Given an array of numbers nums, in which exactly two elements appear

only once and all the other elements appear exactly twice. Find the
two elements that appear only once.

For example:

Given nums = [1, 2, 1, 3, 2, 5], return [3, 5].

Note:
The order of the result is not important. So in the above example,
[5, 3] is also correct.
Your algorithm should run in linear runtime complexity. Could you
implement it using only constant space complexity?

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
------------------------------
Ugly Number
------------------------------

Write a program to check whether a given number is an ugly number.

Ugly numbers are positive numbers whose prime factors only include
2, 3, 5. For example, 6, 8 are ugly while 14 is not ugly since it
includes another prime factor 7.

Note that 1 is typically treated as an ugly number.

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
Ugly Number II
------------------------------

Write a program to find the n-th ugly number.

Ugly numbers are positive numbers whose prime factors only include
2, 3, 5. For example, 1, 2, 3, 4, 5, 6, 8, 9, 10, 12 is the sequence
of the first 10 ugly numbers.

Note that 1 is typically treated as an ugly number, and n does not

exceed 1690.

The naive approach is to call isUgly for every number until you
reach the nth one. Most numbers are not ugly. Try to focus your
effort on generating only the ugly ones.
An ugly number must be multiplied by either 2, 3, or 5 from a
smaller ugly number.
The key is how to maintain the order of the ugly numbers. Try a
similar approach of merging from three sorted lists: L1, L2, and L3.
Assume you have Uk, the kth ugly number. Then Uk+1 must be Min(L1
* 2, L2 * 3, L3 * 5).

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
Missing Number
------------------------------

Given an array containing n distinct numbers taken from 0, 1,

2, ..., n, find the one that is missing from the array.

For example,
Given nums = [0, 1, 3] return 2.

Note:
Your algorithm should run in linear runtime complexity. Could you
implement it using only constant extra space complexity?

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
Integer to English Words
------------------------------

Convert a non-negative integer to its english words representation.

Given input is guaranteed to be less than 231 - 1.

For example,

123 -> "One Hundred Twenty Three"

12345 -> "Twelve Thousand Three Hundred Forty Five"
1234567 -> "One Million Two Hundred Thirty Four Thousand Five
Hundred Sixty Seven"

Did you see a pattern in dividing the number into chunk of words?
For example, 123 and 123000.
Group the number by thousands (3 digits). You can write a helper
function that takes a number less than 1000 and convert just that
chunk to words.
There are many edge cases. What are some good test cases? Does
your code work with input such as 0? Or 1000010? (middle chunk is
zero and should not be printed out)

------------------------------
------------------------------
H-Index
------------------------------

Given an array of citations (each citation is a non-negative

integer) of a researcher, write a function to compute the
researcher's h-index.

According to the definition of h-index on Wikipedia: "A scientist

has index h if h of his/her N papers have at least h citations each,
and the other N − h papers have no more than h citations each."

For example, given citations = [3, 0, 6, 1, 5], which means the

researcher has 5 papers in total and each of them had received 3, 0,
6, 1, 5 citations respectively. Since the researcher has 3 papers
with at least 3 citations each and the remaining two with no more
than 3 citations each, his h-index is 3.

Note: If there are several possible values for h, the maximum one is
taken as the h-index.

An easy approach is to sort the array first.

What are the possible values of h-index?
A faster approach is to use extra space.

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
H-Index II
------------------------------

Follow up for H-Index: What if the citations array is sorted in

ascending order? Could you optimize your algorithm?
 Expected runtime complexity is in O(log n) and the input is
sorted.

------------------------------
------------------------------
------------------------------
------------------------------
First Bad Version
------------------------------

You are a product manager and currently leading a team to develop a

new product. Unfortunately, the latest version of your product fails
the quality check. Since each version is developed based on the
previous version, all the versions after a bad version are also bad.

Suppose you have n versions [1, 2, ..., n] and you want to find out
the first bad one, which causes all the following ones to be bad.

You are given an API bool isBadVersion(version) which will return

whether version is bad. Implement a function to find the first bad
version. You should minimize the number of calls to the API.

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
Perfect Squares
------------------------------

Given a positive integer n, find the least number of perfect square

numbers (for example, 1, 4, 9, 16, ...) which sum to n.

For example, given n = 12, return 3 because 12 = 4 + 4 + 4; given n

= 13, return 2 because 13 = 4 + 9.

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
------------------------------
------------------------------
Expression Add Operators
------------------------------

Given a string that contains only digits 0-9 and a target value,
return all possibilities to add binary operators (not unary) +, -,
or * between the digits so they evaluate to the target value.

Examples:
"123", 6 -> ["1+2+3", "1*2*3"]
"232", 8 -> ["2*3+2", "2+3*2"]
"105", 5 -> ["1*0+5","10-5"]
"00", 0 -> ["0+0", "0-0", "0*0"]
"3456237490", 9191 -> []

Credits:Special thanks to @davidtan1890 for adding this problem and

creating all test cases.
------------------------------
------------------------------
Move Zeroes
------------------------------

Given an array nums, write a function to move all 0's to the end of
it while maintaining the relative order of the non-zero elements.

For example, given nums = [0, 1, 0, 3, 12], after calling your

function, nums should be [1, 3, 12, 0, 0].

Note:

You must do this in-place without making a copy of the array.

Minimize the total number of operations.

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
Peeking Iterator
------------------------------
Given an Iterator class interface with methods: next() and
hasNext(), design and implement a PeekingIterator that support the
peek() operation -- it essentially peek() at the element that will
be returned by the next call to next().

Here is an example. Assume that the iterator is initialized to the

beginning of the list: [1, 2, 3].

Call next() gets you 1, the first element in the list.

Now you call peek() and it returns 2, the next element. Calling
next() after that still return 2.

You call next() the final time and it returns 3, the last element.
Calling hasNext() after that should return false.

Think of "looking ahead". You want to cache the next element.

Is one variable sufficient? Why or why not?
Test your design with call order of peek() before next() vs next()
before peek().
For a clean implementation, check out Google's guava library
source code.

Follow up: How would you extend your design to be generic and work
with all types, not just integer?

Credits:Special thanks to @porker2008 for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
------------------------------
Find the Duplicate Number
------------------------------

Given an array nums containing n + 1 integers where each integer is

between 1 and n (inclusive), prove that at least one duplicate
number must exist. Assume that there is only one duplicate number,
find the duplicate one.

Note:

You must not modify the array (assume the array is read only).
You must use only constant, O(1) extra space.
Your runtime complexity should be less than O(n2).
There is only one duplicate number in the array, but it could be
repeated more than once.

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
------------------------------
Game of Life
------------------------------

According to the Wikipedia's article: "The Game of Life, also known

simply as Life, is a cellular automaton devised by the British
mathematician John Horton Conway in 1970."

Given a board with m by n cells, each cell has an initial state live
(1) or dead (0). Each cell interacts with its eight neighbors
(horizontal, vertical, diagonal) using the following four rules
(taken from the above Wikipedia article):

Any live cell with fewer than two live neighbors dies, as if caused
by under-population.
Any live cell with two or three live neighbors lives on to the next
generation.
Any live cell with more than three live neighbors dies, as if by
over-population..
Any dead cell with exactly three live neighbors becomes a live cell,
as if by reproduction.

Write a function to compute the next state (after one update) of the
board given its current state.

Follow up:

Could you solve it in-place? Remember that the board needs to be

updated at the same time: You cannot update some cells first and
then use their updated values to update other cells.
In this question, we represent the board using a 2D array. In
principle, the board is infinite, which would cause problems when
the active area encroaches the border of the array. How would you
address these problems?

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
Word Pattern
------------------------------
Given a pattern and a string str, find if str follows the same
pattern.
Here follow means a full match, such that there is a bijection
between a letter in pattern and a non-empty word in str.

Examples:

pattern = "abba", str = "dog cat cat dog" should return true.
pattern = "abba", str = "dog cat cat fish" should return false.
pattern = "aaaa", str = "dog cat cat dog" should return false.
pattern = "abba", str = "dog dog dog dog" should return false.

Notes:
You may assume pattern contains only lowercase letters, and str
contains lowercase letters separated by a single space.

Credits:Special thanks to @minglotus6 for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
Nim Game
------------------------------

You are playing the following Nim Game with your friend: There is a
heap of stones on the table, each time one of you take turns to
remove 1 to 3 stones. The one who removes the last stone will be the
winner. You will take the first turn to remove the stones.

Both of you are very clever and have optimal strategies for the
game. Write a function to determine whether you can win the game
given the number of stones in the heap.

For example, if there are 4 stones in the heap, then you will never
win the game: no matter 1, 2, or 3 stones you remove, the last stone
will always be removed by your friend.

If there are 5 stones in the heap, could you figure out a way to
remove the stones such that you will always be the winner?

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
------------------------------
------------------------------
Find Median from Data Stream
------------------------------
Median is the middle value in an ordered integer list. If the size
of the list is even, there is no middle value. So the median is the
mean of the two middle value.
Examples:
[2,3,4] , the median is 3
[2,3], the median is (2 + 3) / 2 = 2.5

Design a data structure that supports the following two operations:

void addNum(int num) - Add a integer number from the data stream to
the data structure.
double findMedian() - Return the median of all elements so far.

For example:

addNum(1)
addNum(2)
findMedian() -> 1.5
addNum(3)
findMedian() -> 2

Credits:Special thanks to @Louis1992 for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
Serialize and Deserialize Binary Tree
------------------------------
Serialization is the process of converting a data structure or
object into a sequence of bits so that it can be stored in a file or
memory buffer, or transmitted across a network connection link to be
reconstructed later in the same or another computer environment.

Design an algorithm to serialize and deserialize a binary tree.

There is no restriction on how your serialization/deserialization
algorithm should work. You just need to ensure that a binary tree
can be serialized to a string and this string can be deserialized to
the original tree structure.

For example, you may serialize the following tree

1
/ \
2 3
/ \
4 5

as "[1,2,3,null,null,4,5]", just the same as how LeetCode OJ

serializes a binary tree. You do not necessarily need to follow this
format, so please be creative and come up with different approaches
yourself.
Note: Do not use class member/global/static variables to store
states. Your serialize and deserialize algorithms should be
stateless.

Credits:Special thanks to @Louis1992 for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
Bulls and Cows
------------------------------
You are playing the following Bulls and Cows game with your friend:
You write down a number and ask your friend to guess what the number
is. Each time your friend makes a guess, you provide a hint that
indicates how many digits in said guess match your secret number
exactly in both digit and position (called "bulls") and how many
digits match the secret number but locate in the wrong position
(called "cows"). Your friend will use successive guesses and hints
to eventually derive the secret number.

For example:

Secret number: "1807"

Friend's guess: "7810"

Hint: 1 bull and 3 cows. (The bull is 8, the cows are 0, 1 and 7.)

Write a function to return a hint according to the secret number and

friend's guess, use A to indicate the bulls and B to indicate the
cows. In the above example, your function should return "1A3B".

Please note that both secret number and friend's guess may contain
duplicate digits, for example:

Secret number: "1123"

Friend's guess: "0111"

In this case, the 1st 1 in friend's guess is a bull, the 2nd or 3rd
1 is a cow, and your function should return "1A1B".

You may assume that the secret number and your friend's guess only
contain digits, and their lengths are always equal.

Credits:Special thanks to @jeantimex for adding this problem and

creating all test cases.
------------------------------
------------------------------
Longest Increasing Subsequence
------------------------------

Given an unsorted array of integers, find the length of longest

increasing subsequence.

For example,
Given [10, 9, 2, 5, 3, 7, 101, 18],
The longest increasing subsequence is [2, 3, 7, 101], therefore the
length is 4. Note that there may be more than one LIS combination,
it is only necessary for you to return the length.

Your algorithm should run in O(n2) complexity.

Follow up: Could you improve it to O(n log n) time complexity?

Credits:Special thanks to @pbrother for adding this problem and

creating all test cases.
------------------------------
------------------------------
Remove Invalid Parentheses
------------------------------

Remove the minimum number of invalid parentheses in order to make

the input string valid. Return all possible results.

Note: The input string may contain letters other than the
parentheses ( and ).

Examples:

"()())()" -> ["()()()", "(())()"]

"(a)())()" -> ["(a)()()", "(a())()"]
")(" -> [""]

Credits:Special thanks to @hpplayer for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
Range Sum Query - Immutable
------------------------------
Given an integer array nums, find the sum of the elements between
indices i and j (i &le; j), inclusive.

Example:
Given nums = [-2, 0, 3, -5, 2, -1]

sumRange(0, 2) -> 1
sumRange(2, 5) -> -1
sumRange(0, 5) -> -3

Note:

You may assume that the array does not change.

There are many calls to sumRange function.

------------------------------
------------------------------
Range Sum Query 2D - Immutable
------------------------------
Given a 2D matrix matrix, find the sum of the elements inside the
rectangle defined by its upper left corner (row1, col1) and lower
right corner (row2, col2).

The above rectangle (with the red border) is defined by (row1, col1)
= (2, 1) and (row2, col2) = (4, 3), which contains sum = 8.

Example:

Given matrix = [
[3, 0, 1, 4, 2],
[5, 6, 3, 2, 1],
[1, 2, 0, 1, 5],
[4, 1, 0, 1, 7],
[1, 0, 3, 0, 5]
]

sumRegion(2, 1, 4, 3) -> 8
sumRegion(1, 1, 2, 2) -> 11
sumRegion(1, 2, 2, 4) -> 12

Note:

You may assume that the matrix does not change.

There are many calls to sumRegion function.
You may assume that row1 &le; row2 and col1 &le; col2.

------------------------------
------------------------------
------------------------------
Additive Number
------------------------------
Additive number is a string whose digits can form additive sequence.

A valid additive sequence should contain at least three numbers.

Except for the first two numbers, each subsequent number in the
sequence must be the sum of the preceding two.

For example:
"112358" is an additive number because the digits can form an
additive sequence: 1, 1, 2, 3, 5, 8.
1 + 1 = 2, 1 + 2 = 3, 2 + 3 = 5, 3 + 5 = 8
"199100199" is also an additive number, the additive sequence is: 1,
99, 100, 199.
1 + 99 = 100, 99 + 100 = 199

Note: Numbers in the additive sequence cannot have leading zeros, so

sequence 1, 2, 03 or 1, 02, 3 is invalid.

Given a string containing only digits '0'-'9', write a function to

determine if it's an additive number.

Follow up:
How would you handle overflow for very large input integers?

Credits:Special thanks to @jeantimex for adding this problem and

creating all test cases.
------------------------------
------------------------------
Range Sum Query - Mutable
------------------------------
Given an integer array nums, find the sum of the elements between
indices i and j (i &le; j), inclusive.

The update(i, val) function modifies nums by updating the element at

index i to val.

Example:

Given nums = [1, 3, 5]

sumRange(0, 2) -> 9
update(1, 2)
sumRange(0, 2) -> 8

Note:
The array is only modifiable by the update function.
You may assume the number of calls to update and sumRange function
is distributed evenly.

------------------------------
------------------------------
------------------------------
Minimum Height Trees
------------------------------

For a undirected graph with tree characteristics, we can choose

any node as the root. The result graph is then a rooted tree. Among
all possible rooted trees, those with minimum height are called
minimum height trees (MHTs).
Given such a graph, write a function to find all the MHTs and
return a list of their root labels.

Format
The graph contains n nodes which are labeled from 0 to n - 1.
You will be given the number n and a list of undirected edges
(each edge is a pair of labels).

You can assume that no duplicate edges will appear in edges. Since
all edges are
undirected, [0, 1] is the same as [1, 0] and thus will not
appear together in
edges.

Example 1:

Given n = 4, edges = [[1, 0], [1, 2], [1, 3]]

0
|
1
/ \
2 3

return [1]

Example 2:
 Given n = 6, edges = [[0, 3], [1, 3], [2, 3], [4, 3], [5, 4]]

0 1 2
\ | /
3
|
4
|
5

return [3, 4]

How many MHTs can a graph have at most?

Note:

(1) According to the definition

of tree on Wikipedia: “a tree is an undirected graph in which
any two vertices are connected by
exactly one path. In other words, any connected graph without
simple cycles is a tree.”

(2) The height of a rooted tree is the number of edges on the

longest downward path between the root and a
leaf.

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
Burst Balloons
------------------------------

Given n balloons, indexed from 0 to n-1. Each balloon is painted

with a
number on it represented by array nums.

You are asked to burst all the balloons. If the you burst
balloon i you will get nums[left] * nums[i] * nums[right] coins.
Here left
and right are adjacent indices of i. After the burst, the left
and right
then becomes adjacent.
 Find the maximum coins you can collect by bursting the balloons
wisely.

Note:
(1) You may imagine nums[-1] = nums[n] = 1. They are not real
therefore you can not burst them.
(2) 0 &le; n &le; 500, 0 &le; nums[i] &le; 100

Example:

Given [3, 1, 5, 8]

Return 167

nums = [3,1,5,8] --> [3,5,8] --> [3,8] --> [8] --> []

coins = 3*1*5 + 3*5*8 + 1*3*8 + 1*8*1 = 167

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
Super Ugly Number
------------------------------

Write a program to find the nth super ugly number.

Super ugly numbers are positive numbers whose all prime factors
are in the given prime list
primes of size k. For example, [1, 2, 4, 7, 8, 13, 14, 16, 19,
26, 28, 32]
is the sequence of the first 12 super ugly numbers given primes
= [2, 7, 13, 19] of size 4.

Note:
(1) 1 is a super ugly number for any given primes.
(2) The given numbers in primes are in ascending order.
(3) 0 < k &le; 100, 0 < n &le; 106, 0 < primes[i] < 1000.
(4) The nth super ugly number is guaranteed to fit in a 32-bit
signed integer.
Credits:Special thanks to @dietpepsi for adding this problem and
creating all test cases.
------------------------------
------------------------------
------------------------------
Count of Smaller Numbers After Self
------------------------------

You are given an integer array nums and you have to return a new
counts array.
The counts array has the property where counts[i] is
the number of smaller elements to the right of nums[i].

Example:

Given nums = [5, 2, 6, 1]

To the right of 5 there are 2 smaller elements (2 and 1).

To the right of 2 there is only 1 smaller element (1).
To the right of 6 there is 1 smaller element (1).
To the right of 1 there is 0 smaller element.

Return the array [2, 1, 1, 0].

------------------------------
------------------------------
Remove Duplicate Letters
------------------------------

Given a string which contains only lowercase letters, remove

duplicate letters so that every letter appear once and only once.
You must make sure your result is the smallest in lexicographical
order among all possible results.

Example:

Given "bcabc"
Return "abc"

Given "cbacdcbc"
Return "acdb"

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
Maximum Product of Word Lengths
------------------------------

Given a string array words, find the maximum value of

length(word[i]) * length(word[j]) where the two words do not share
common letters.
You may assume that each word will contain only lower case
letters.
If no such two words exist, return 0.

Example 1:

Given ["abcw", "baz", "foo", "bar", "xtfn", "abcdef"]

Return 16
The two words can be "abcw", "xtfn".

Example 2:

Given ["a", "ab", "abc", "d", "cd", "bcd", "abcd"]

Return 4
The two words can be "ab", "cd".

Example 3:

Given ["a", "aa", "aaa", "aaaa"]

Return 0
No such pair of words.

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
Bulb Switcher
------------------------------

There are n bulbs that are initially off. You first turn on all the
bulbs. Then, you turn off every second bulb. On the third round, you
toggle every third bulb (turning on if it's off or turning off if
it's on). For the ith round, you toggle every i bulb. For the nth
round, you only toggle the last bulb.

Find how many bulbs are on after n rounds.

Example:

Given n = 3.
At first, the three bulbs are [off, off, off].
After first round, the three bulbs are [on, on, on].
After second round, the three bulbs are [on, off, on].
After third round, the three bulbs are [on, off, off].
So you should return 1, because there is only one bulb is on.

------------------------------
------------------------------
------------------------------
Create Maximum Number
------------------------------

Given two arrays of length m and n with digits 0-9 representing

two numbers.
Create the maximum number of length k <= m + n from digits of
the two. The relative order of the digits
from the same array must be preserved. Return an array of the k
digits. You should try to optimize your time and space complexity.

Example 1:

nums1 = [3, 4, 6, 5]
nums2 = [9, 1, 2, 5, 8, 3]
k = 5
return [9, 8, 6, 5, 3]

Example 2:

nums1 = [6, 7]
nums2 = [6, 0, 4]
k = 5
return [6, 7, 6, 0, 4]

Example 3:

nums1 = [3, 9]
nums2 = [8, 9]
k = 3
return [9, 8, 9]

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
Coin Change
------------------------------

You are given coins of different denominations and a total amount of

money amount. Write a function to compute the fewest number of coins
that you need to make up that amount. If that amount of money cannot
be made up by any combination of the coins, return -1.

Example 1:
coins = [1, 2, 5], amount = 11
return 3 (11 = 5 + 5 + 1)

Example 2:
coins = [2], amount = 3
return -1.

Note:
You may assume that you have an infinite number of each kind of
coin.

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
------------------------------
Wiggle Sort II
------------------------------

Given an unsorted array nums, reorder it such that

nums[0] < nums[1] > nums[2] < nums[3]....

Example:
(1) Given nums = [1, 5, 1, 1, 6, 4], one possible answer is [1,
4, 1, 5, 1, 6].
(2) Given nums = [1, 3, 2, 2, 3, 1], one possible answer is [2,
3, 1, 3, 1, 2].

Note:
You may assume all input has valid answer.
 Follow Up:
Can you do it in O(n) time and/or in-place with O(1) extra
space?

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
Power of Three
------------------------------

Given an integer, write a function to determine if it is a power

of three.

Follow up:
Could you do it without using any loop / recursion?

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
Count of Range Sum
------------------------------

Given an integer array nums, return the number of range sums

that lie in [lower, upper] inclusive.

Range sum S(i, j) is defined as the sum of the elements in nums

between indices i and
j (i ≤ j), inclusive.

Note:
A naive algorithm of O(n2) is trivial. You MUST do better than
that.

Example:
Given nums = [-2, 5, -1], lower = -2, upper = 2,
Return 3.
The three ranges are : [0, 0], [2, 2], [0, 2] and their
respective sums are: -2, -1, 2.

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
Odd Even Linked List
------------------------------
Given a singly linked list, group all odd nodes together followed by
the even nodes. Please note here we are talking about the node
number and not the value in the nodes.

You should try to do it in place. The program should run in O(1)

space complexity and O(nodes) time complexity.

Example:
Given 1->2->3->4->5->NULL,
return 1->3->5->2->4->NULL.

Note:
The relative order inside both the even and odd groups should remain
as it was in the input.
The first node is considered odd, the second node even and so on ...

Credits:Special thanks to @DjangoUnchained for adding this problem

and creating all test cases.
------------------------------
------------------------------
Longest Increasing Path in a Matrix
------------------------------
Given an integer matrix, find the length of the longest increasing
path.

From each cell, you can either move to four directions: left, right,
up or down. You may NOT move diagonally or move outside of the
boundary (i.e. wrap-around is not allowed).

Example 1:

nums = [
[9,9,4],
[6,6,8],
[2,1,1]
]

Return 4

The longest increasing path is [1, 2, 6, 9].

Example 2:
nums = [
[3,4,5],
[3,2,6],
[2,2,1]
]

Return 4

The longest increasing path is [3, 4, 5, 6]. Moving diagonally is

not allowed.

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
Patching Array
------------------------------
Given a sorted positive integer array nums and an integer n, add/
patch elements to the array such that any number in range [1, n]
inclusive can be formed by the sum of some elements in the array.
Return the minimum number of patches required.

Example 1:
nums = [1, 3], n = 6
Return 1.

Combinations of nums are [1], [3], [1,3], which form possible sums
of: 1, 3, 4.
Now if we add/patch 2 to nums, the combinations are: [1], [2], [3],
[1,3], [2,3], [1,2,3].
Possible sums are 1, 2, 3, 4, 5, 6, which now covers the range [1,
6].
So we only need 1 patch.

Example 2:
nums = [1, 5, 10], n = 20
Return 2.
The two patches can be [2, 4].

Example 3:
nums = [1, 2, 2], n = 5
Return 0.

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
Verify Preorder Serialization of a Binary Tree
------------------------------
One way to serialize a binary tree is to use pre-order traversal.
When we encounter a non-null node, we record the node's value. If it
is a null node, we record using a sentinel value such as #.

_9_
/ \
3 2
/ \ / \
4 1 # 6
/ \ / \ / \
# # # # # #

For example, the above binary tree can be serialized to the string
"9,3,4,#,#,1,#,#,2,#,6,#,#", where # represents a null node.

Given a string of comma separated values, verify whether it is a

correct preorder traversal serialization of a binary tree. Find an
algorithm without reconstructing the tree.

Each comma separated value in the string must be either an integer

or a character '#' representing null pointer.

You may assume that the input format is always valid, for example it
could never contain two consecutive commas such as "1,,3".

Example 1:
"9,3,4,#,#,1,#,#,2,#,6,#,#"
Return true
Example 2:
"1,#"
Return false
Example 3:
"9,#,#,1"
Return false

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
Reconstruct Itinerary
------------------------------
Given a list of airline tickets represented by pairs of departure
and arrival airports [from, to], reconstruct the itinerary in order.
All of the tickets belong to a man who departs from JFK. Thus, the
itinerary must begin with JFK.

Note:

If there are multiple valid itineraries, you should return the

itinerary that has the smallest lexical order when read as a single
string. For example, the itinerary ["JFK", "LGA"] has a smaller
lexical order than ["JFK", "LGB"].
All airports are represented by three capital letters (IATA code).
You may assume all tickets form at least one valid itinerary.

Example 1:
tickets = [["MUC", "LHR"], ["JFK", "MUC"], ["SFO", "SJC"],
["LHR", "SFO"]]
Return ["JFK", "MUC", "LHR", "SFO", "SJC"].

Example 2:
tickets = [["JFK","SFO"],["JFK","ATL"],["SFO","ATL"],
["ATL","JFK"],["ATL","SFO"]]
Return ["JFK","ATL","JFK","SFO","ATL","SFO"].
Another possible reconstruction is
["JFK","SFO","ATL","JFK","ATL","SFO"]. But it is larger in lexical
order.

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
Increasing Triplet Subsequence
------------------------------

Given an unsorted array return whether an increasing subsequence of

length 3 exists or not in the array.

Formally the function should:

Return true if there exists i, j, k
such that arr[i] &lt; arr[j] &lt; arr[k] given 0 &le; i &lt; j &lt;
k &le; n-1
else return false.

Your algorithm should run in O(n) time complexity and O(1) space
complexity.

Examples:
Given [1, 2, 3, 4, 5],
return true.

Given [5, 4, 3, 2, 1],

return false.
Credits:Special thanks to @DjangoUnchained for adding this problem
and creating all test cases.
------------------------------
------------------------------
Self Crossing
------------------------------

You are given an array x of n positive numbers. You start at

point (0,0) and moves x[0] metres to the north, then x[1] metres to
the west,
x[2] metres to the south,
x[3] metres to the east and so on. In other words, after each
move your direction changes
counter-clockwise.

Write a one-pass algorithm with O(1) extra space to determine,

if your path crosses itself, or not.

Example 1:

Given x = [2, 1, 1, 2],

┌───┐
│ │
└───┼──>
│

Return true (self crossing)

Example 2:

Given x = [1, 2, 3, 4],

┌──────┐
│ │
│
│
└────────────>

Return false (not self crossing)

Example 3:

Given x = [1, 1, 1, 1],

┌───┐
│ │
└───┼>

Return true (self crossing)

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
Palindrome Pairs
------------------------------

Given a list of unique words, find all pairs of distinct indices

(i, j) in the given list, so that the concatenation of the two
words, i.e. words[i] + words[j] is a palindrome.

Example 1:
Given words = ["bat", "tab", "cat"]
Return [[0, 1], [1, 0]]
The palindromes are ["battab", "tabbat"]

Example 2:
Given words = ["abcd", "dcba", "lls", "s", "sssll"]
Return [[0, 1], [1, 0], [3, 2], [2, 4]]
The palindromes are ["dcbaabcd", "abcddcba", "slls", "llssssll"]

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
House Robber III
------------------------------

The thief has found himself a new place for his thievery again.
There is only one entrance to this area, called the "root." Besides
the root, each house has one and only one parent house. After a
tour, the smart thief realized that "all houses in this place forms
a binary tree". It will automatically contact the police if two
directly-linked houses were broken into on the same night.

Determine the maximum amount of money the thief can rob tonight
without alerting the police.

Example 1:

3
 / \
2 3
\ \
3 1

Maximum amount of money the thief can rob = 3 + 3 + 1 = 7.

Example 2:

3
/ \
4 5
/ \ \
1 3 1

Maximum amount of money the thief can rob = 4 + 5 = 9.

Credits:Special thanks to @dietpepsi for adding this problem and

creating all test cases.
------------------------------
------------------------------
Counting Bits
------------------------------
Given a non negative integer number num. For every numbers i in the
range 0 &le; i &le; num calculate the number of 1's in their binary
representation and return them as an array.

Example:
For num = 5 you should return [0,1,1,2,1,2].

Follow up:

It is very easy to come up with a solution with run time

O(n*sizeof(integer)). But can you do it in linear time O(n) /
possibly in a single pass?
Space complexity should be O(n).
Can you do it like a boss? Do it without using any builtin function
like __builtin_popcount in c++ or in any other language.

You should make use of what you have produced already.

Divide the numbers in ranges like [2-3], [4-7], [8-15] and so on.
And try to generate new range from previous.
Or does the odd/even status of the number help you in calculating
the number of 1s?

Credits:Special thanks to @ syedee for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
------------------------------
Flatten Nested List Iterator
------------------------------
Given a nested list of integers, implement an iterator to flatten
it.

Each element is either an integer, or a list -- whose elements may

also be integers or other lists.

Example 1:
Given the list [[1,1],2,[1,1]],

By calling next repeatedly until hasNext returns false, the order of

elements returned by next should be: [1,1,2,1,1].

Example 2:
Given the list [1,[4,[6]]],

By calling next repeatedly until hasNext returns false, the order of

elements returned by next should be: [1,4,6].

------------------------------
------------------------------
Power of Four
------------------------------

Given an integer (signed 32 bits), write a function to check whether

it is a power of 4.

Example:
Given num = 16, return true.
Given num = 5, return false.

Follow up: Could you solve it without loops/recursion?

Credits:Special thanks to @yukuairoy for adding this problem and

creating all test cases.
------------------------------
------------------------------
Integer Break
------------------------------

Given a positive integer n, break it into the sum of at least two

positive integers and maximize the product of those integers. Return
the maximum product you can get.
For example, given n = 2, return 1 (2 = 1 + 1); given n = 10, return
36 (10 = 3 + 3 + 4).

Note: You may assume that n is not less than 2 and not larger than
58.

There is a simple O(n) solution to this problem.

You may check the breaking results of n ranging from 7 to 10 to
discover the regularities.

Credits:Special thanks to @jianchao.li.fighter for adding this

problem and creating all test cases.
------------------------------
------------------------------
Reverse String
------------------------------
Write a function that takes a string as input and returns the string
reversed.

Example:
Given s = "hello", return "olleh".

------------------------------
------------------------------
Reverse Vowels of a String
------------------------------
Write a function that takes a string as input and reverse only the
vowels of a string.

Example 1:
Given s = "hello", return "holle".

Example 2:
Given s = "leetcode", return "leotcede".

Note:
The vowels does not include the letter "y".

------------------------------
------------------------------
------------------------------
Top K Frequent Elements
------------------------------

Given a non-empty array of integers, return the k most frequent

elements.

For example,
Given [1,1,1,2,2,3] and k = 2, return [1,2].

Note:

You may assume k is always valid, 1 ≤ k ≤ number of unique elements.

Your algorithm's time complexity must be better than O(n log n),
where n is the array's size.

------------------------------
------------------------------
------------------------------
Intersection of Two Arrays
------------------------------

Given two arrays, write a function to compute their intersection.

Example:
Given nums1 = [1, 2, 2, 1], nums2 = [2, 2], return [2].

Note:

Each element in the result must be unique.

The result can be in any order.

------------------------------
------------------------------
Intersection of Two Arrays II
------------------------------

Given two arrays, write a function to compute their intersection.

Example:
Given nums1 = [1, 2, 2, 1], nums2 = [2, 2], return [2, 2].

Note:

Each element in the result should appear as many times as it shows

in both arrays.
The result can be in any order.
Follow up:

What if the given array is already sorted? How would you optimize
your algorithm?
What if nums1's size is small compared to nums2's size? Which
algorithm is better?
What if elements of nums2 are stored on disk, and the memory is
limited such that you cannot load all elements into the memory at
once?

------------------------------
------------------------------
------------------------------
Data Stream as Disjoint Intervals
------------------------------
Given a data stream input of non-negative integers a1, a2, ...,
an, ..., summarize the numbers seen so far as a list of disjoint
intervals.

For example, suppose the integers from the data stream are 1, 3, 7,
2, 6, ..., then the summary will be:

[1, 1]
[1, 1], [3, 3]
[1, 1], [3, 3], [7, 7]
[1, 3], [7, 7]
[1, 3], [6, 7]

Follow up:
What if there are lots of merges and the number of disjoint
intervals are small compared to the data stream's size?

Credits:Special thanks to @yunhong for adding this problem and

creating most of the test cases.
------------------------------
------------------------------
------------------------------
Russian Doll Envelopes
------------------------------
You have a number of envelopes with widths and heights given as a
pair of integers (w, h). One envelope can fit into another if and
only if both the width and height of one envelope is greater than
the width and height of the other envelope.

What is the maximum number of envelopes can you Russian doll? (put
one inside other)

Example:
Given envelopes = [[5,4],[6,4],[6,7],[2,3]], the maximum number of
envelopes you can Russian doll is 3 ([2,3] => [5,4] => [6,7]).

------------------------------
------------------------------
Design Twitter
------------------------------
Design a simplified version of Twitter where users can post tweets,
follow/unfollow another user and is able to see the 10 most recent
tweets in the user's news feed. Your design should support the
following methods:

postTweet(userId, tweetId): Compose a new tweet.

getNewsFeed(userId): Retrieve the 10 most recent tweet ids in the
user's news feed. Each item in the news feed must be posted by users
who the user followed or by the user herself. Tweets must be ordered
from most recent to least recent.
follow(followerId, followeeId): Follower follows a followee.
unfollow(followerId, followeeId): Follower unfollows a followee.

Example:

Twitter twitter = new Twitter();

// User 1 posts a new tweet (id = 5).

twitter.postTweet(1, 5);

// User 1's news feed should return a list with 1 tweet id -> [5].
twitter.getNewsFeed(1);

// User 1 follows user 2.

twitter.follow(1, 2);

// User 2 posts a new tweet (id = 6).

twitter.postTweet(2, 6);

// User 1's news feed should return a list with 2 tweet ids -> [6,
5].
// Tweet id 6 should precede tweet id 5 because it is posted after
tweet id 5.
twitter.getNewsFeed(1);

// User 1 unfollows user 2.

twitter.unfollow(1, 2);

// User 1's news feed should return a list with 1 tweet id -> [5],
// since user 1 is no longer following user 2.
twitter.getNewsFeed(1);
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
------------------------------
Max Sum of Rectangle No Larger Than K
------------------------------
Given a non-empty 2D matrix matrix and an integer k, find the max
sum of a rectangle in the matrix such that its sum is no larger than
k.

Example:
Given matrix = [
[1, 0, 1],
[0, -2, 3]
]
k = 2

The answer is 2. Because the sum of rectangle [[0, 1], [-2, 3]] is 2
and 2 is the max number no larger than k (k = 2).

Note:

The rectangle inside the matrix must have an area > 0.

What if the number of rows is much larger than the number of
columns?

Credits:Special thanks to @fujiaozhu for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
Water and Jug Problem
------------------------------
You are given two jugs with capacities x and y litres. There is an
infinite amount of water supply available.
You need to determine whether it is possible to measure exactly z
litres using these two jugs.

If z liters of water is measurable, you must have z liters of water

contained within one or both buckets by the end.

Operations allowed:

Fill any of the jugs completely with water.

Empty any of the jugs.
Pour water from one jug into another till the other jug is
completely full or the first jug itself is empty.

Example 1: (From the famous "Die Hard" example)

Input: x = 3, y = 5, z = 4
Output: True

Example 2:

Input: x = 2, y = 6, z = 5
Output: False

Credits:Special thanks to @vinod23 for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
Valid Perfect Square
------------------------------
Given a positive integer num, write a function which returns True if
num is a perfect square else False.

Note: Do not use any built-in library function such as sqrt.

Example 1:

Input: 16
Returns: True

Example 2:

Input: 14
Returns: False

Credits:Special thanks to @elmirap for adding this problem and

creating all test cases.
------------------------------
------------------------------
Largest Divisible Subset
------------------------------
Given a set of distinct positive integers, find the largest subset
such that every pair (Si, Sj) of elements in this subset satisfies:
Si % Sj = 0 or Sj % Si = 0.

If there are multiple solutions, return any subset is fine.

Example 1:

nums: [1,2,3]

Result: [1,2] (of course, [1,3] will also be ok)

Example 2:

nums: [1,2,4,8]

Result: [1,2,4,8]

Credits:Special thanks to @Stomach_ache for adding this problem and

creating all test cases.
------------------------------
------------------------------
------------------------------
------------------------------
Sum of Two Integers
------------------------------
Calculate the sum of two integers a and b, but you are not allowed
to use the operator + and -.

Example:
Given a = 1 and b = 2, return 3.

Credits:Special thanks to @fujiaozhu for adding this problem and

creating all test cases.
------------------------------
------------------------------
Super Pow
------------------------------

Your task is to calculate ab mod 1337 where a is a positive integer

and b is an extremely large positive integer given in the form of an
array.

Example1:

a = 2
b = [3]

Result: 8

Example2:

a = 2
b = [1,0]

Result: 1024

Credits:Special thanks to @Stomach_ache for adding this problem and

creating all test cases.
------------------------------
------------------------------
Find K Pairs with Smallest Sums
------------------------------

You are given two integer arrays nums1 and nums2 sorted in ascending
order and an integer k.

Define a pair (u,v) which consists of one element from the first
array and one element from the second array.

Find the k pairs (u1,v1),(u2,v2) ...(uk,vk) with the smallest sums.

Example 1:

Given nums1 = [1,7,11], nums2 = [2,4,6], k = 3

Return: [1,2],[1,4],[1,6]

The first 3 pairs are returned from the sequence:

[1,2],[1,4],[1,6],[7,2],[7,4],[11,2],[7,6],[11,4],[11,6]

Example 2:

Given nums1 = [1,1,2], nums2 = [1,2,3], k = 2

Return: [1,1],[1,1]

The first 2 pairs are returned from the sequence:

[1,1],[1,1],[1,2],[2,1],[1,2],[2,2],[1,3],[1,3],[2,3]
Example 3:

Given nums1 = [1,2], nums2 = [3], k = 3

Return: [1,3],[2,3]

All possible pairs are returned from the sequence:

[1,3],[2,3]

Credits:Special thanks to @elmirap and @StefanPochmann for adding

this problem and creating all test cases.
------------------------------
------------------------------
Guess Number Higher or Lower
------------------------------
We are playing the Guess Game. The game is as follows:

I pick a number from 1 to n. You have to guess which number I

picked.

Every time you guess wrong, I'll tell you whether the number is
higher or lower.

You call a pre-defined API guess(int num) which returns 3 possible

results (-1, 1, or 0):

-1 : My number is lower
1 : My number is higher
0 : Congrats! You got it!

Example:

n = 10, I pick 6.

Return 6.

------------------------------
------------------------------
Guess Number Higher or Lower II
------------------------------
We are playing the Guess Game. The game is as follows:

I pick a number from 1 to n. You have to guess which number I

picked.

Every time you guess wrong, I'll tell you whether the number I
picked is higher or lower.

However, when you guess a particular number x, and you guess wrong,
you pay $x. You win the game when you guess the number I picked.
Example:

n = 10, I pick 8.

First round: You guess 5, I tell you that it's higher. You pay $5.
Second round: You guess 7, I tell you that it's higher. You pay $7.
Third round: You guess 9, I tell you that it's lower. You pay $9.

Game over. 8 is the number I picked.

You end up paying $5 + $7 + $9 = $21.

Given a particular n &ge; 1, find out how much money you need to
have to guarantee a win.

The best strategy to play the game is to minimize the maximum

loss you could possibly face. Another strategy is to minimize the
expected loss. Here, we are interested in the first scenario.
Take a small example (n = 3). What do you end up paying in the
worst case?
Check out this article if you're still stuck.
The purely recursive implementation of minimax would be worthless
for even a small n. You MUST use dynamic programming.
As a follow-up, how would you modify your code to solve the problem
of minimizing the expected loss, instead of the worst-case loss?

Credits:Special thanks to @agave and @StefanPochmann for adding this

problem and creating all test cases.
------------------------------
------------------------------
Wiggle Subsequence
------------------------------
A sequence of numbers is called a wiggle sequence if the differences
between successive numbers strictly alternate between positive and
negative. The first difference (if one exists) may be either
positive or negative. A sequence with fewer than two elements is
trivially a wiggle sequence.

For example, [1,7,4,9,2,5] is a wiggle sequence because the

differences (6,-3,5,-7,3) are alternately positive and negative. In
contrast, [1,4,7,2,5] and [1,7,4,5,5] are not wiggle sequences, the
first because its first two differences are positive and the second
because its last difference is zero.

Given a sequence of integers, return the length of the longest

subsequence that is a wiggle sequence. A subsequence is obtained by
deleting some number of elements (eventually, also zero) from the
original sequence, leaving the remaining elements in their original
order.

Examples:

Input: [1,7,4,9,2,5]
Output: 6
The entire sequence is a wiggle sequence.

Input: [1,17,5,10,13,15,10,5,16,8]
Output: 7
There are several subsequences that achieve this length. One is
[1,17,10,13,10,16,8].

Input: [1,2,3,4,5,6,7,8,9]
Output: 2

Follow up:
Can you do it in O(n) time?

Credits:Special thanks to @agave and @StefanPochmann for adding this

problem and creating all test cases.
------------------------------
------------------------------
Combination Sum IV
------------------------------
Given an integer array with all positive numbers and no duplicates,
find the number of possible combinations that add up to a positive
integer target.

Example:

nums = [1, 2, 3]
target = 4

The possible combination ways are:

(1, 1, 1, 1)
(1, 1, 2)
(1, 2, 1)
(1, 3)
(2, 1, 1)
(2, 2)
(3, 1)

Note that different sequences are counted as different combinations.

Therefore the output is 7.

Follow up:
What if negative numbers are allowed in the given array?
How does it change the problem?
What limitation we need to add to the question to allow negative
numbers?

Credits:Special thanks to @pbrother for adding this problem and

creating all test cases.
------------------------------
------------------------------
Kth Smallest Element in a Sorted Matrix
------------------------------
Given a n x n matrix where each of the rows and columns are sorted
in ascending order, find the kth smallest element in the matrix.

Note that it is the kth smallest element in the sorted order, not
the kth distinct element.

Example:

matrix = [
[ 1, 5, 9],
[10, 11, 13],
[12, 13, 15]
],
k = 8,

return 13.

Note:
You may assume k is always valid, 1 ≤ k ≤ n2.
------------------------------
------------------------------
------------------------------
Insert Delete GetRandom O(1)
------------------------------
Design a data structure that supports all following operations in
average O(1) time.

insert(val): Inserts an item val to the set if not already present.

remove(val): Removes an item val from the set if present.
getRandom: Returns a random element from current set of elements.
Each element must have the same probability of being returned.

Example:

// Init an empty set.

RandomizedSet randomSet = new RandomizedSet();
// Inserts 1 to the set. Returns true as 1 was inserted
successfully.
randomSet.insert(1);

// Returns false as 2 does not exist in the set.

randomSet.remove(2);

// Inserts 2 to the set, returns true. Set now contains [1,2].

randomSet.insert(2);

// getRandom should return either 1 or 2 randomly.

randomSet.getRandom();

// Removes 1 from the set, returns true. Set now contains [2].
randomSet.remove(1);

// 2 was already in the set, so return false.

randomSet.insert(2);

// Since 2 is the only number in the set, getRandom always return 2.

randomSet.getRandom();

------------------------------
------------------------------
Insert Delete GetRandom O(1) - Duplicates allowed
------------------------------
Design a data structure that supports all following operations in
average O(1) time.
Note: Duplicate elements are allowed.

insert(val): Inserts an item val to the collection.

remove(val): Removes an item val from the collection if present.
getRandom: Returns a random element from current collection of
elements. The probability of each element being returned is linearly
related to the number of same value the collection contains.

Example:

// Init an empty collection.

RandomizedCollection collection = new RandomizedCollection();

// Inserts 1 to the collection. Returns true as the collection did

not contain 1.
collection.insert(1);

// Inserts another 1 to the collection. Returns false as the

collection contained 1. Collection now contains [1,1].
collection.insert(1);
// Inserts 2 to the collection, returns true. Collection now
contains [1,1,2].
collection.insert(2);

// getRandom should return 1 with the probability 2/3, and returns 2

with the probability 1/3.
collection.getRandom();

// Removes 1 from the collection, returns true. Collection now

contains [1,2].
collection.remove(1);

// getRandom should return 1 and 2 both equally likely.

collection.getRandom();

------------------------------
------------------------------
Linked List Random Node
------------------------------
Given a singly linked list, return a random node's value from the
linked list. Each node must have the same probability of being
chosen.

Follow up:
What if the linked list is extremely large and its length is unknown
to you? Could you solve this efficiently without using extra space?

Example:

// Init a singly linked list [1,2,3].

ListNode head = new ListNode(1);
head.next = new ListNode(2);
head.next.next = new ListNode(3);
Solution solution = new Solution(head);

// getRandom() should return either 1, 2, or 3 randomly. Each

element should have equal probability of returning.
solution.getRandom();

------------------------------
------------------------------
Ransom Note
------------------------------

Given an arbitrary ransom note string and another string containing

letters from all the magazines, write a function that will return
true if the ransom
note can be constructed from the magazines ; otherwise, it will
return false.
Each letter in the magazine string can only be used once in your
ransom note.

Note:
You may assume that both strings contain only lowercase letters.

canConstruct("a", "b") -> false

canConstruct("aa", "ab") -> false
canConstruct("aa", "aab") -> true

------------------------------
------------------------------
Shuffle an Array
------------------------------
Shuffle a set of numbers without duplicates.

Example:

// Init an array with set 1, 2, and 3.

int[] nums = {1,2,3};
Solution solution = new Solution(nums);

// Shuffle the array [1,2,3] and return its result. Any permutation
of [1,2,3] must equally likely to be returned.
solution.shuffle();

// Resets the array back to its original configuration [1,2,3].

solution.reset();

// Returns the random shuffling of array [1,2,3].

solution.shuffle();

------------------------------
------------------------------
Mini Parser
------------------------------
Given a nested list of integers represented as a string, implement a
parser to deserialize it.

Each element is either an integer, or a list -- whose elements may

also be integers or other lists.

Note:
You may assume that the string is well-formed:

String is non-empty.
String does not contain white spaces.
String contains only digits 0-9, [, - ,, ].
Example 1:

Given s = "324",

You should return a NestedInteger object which contains a single

integer 324.

Example 2:

Given s = "[123,[456,[789]]]",

Return a NestedInteger object containing a nested list with 2

elements:

1. An integer containing value 123.

2. A nested list containing two elements:
i. An integer containing value 456.
ii. A nested list with one element:
a. An integer containing value 789.

------------------------------
------------------------------
Lexicographical Numbers
------------------------------

Given an integer n, return 1 - n in lexicographical order.

For example, given 13, return: [1,10,11,12,13,2,3,4,5,6,7,8,9].

Please optimize your algorithm to use less time and space. The input
size may be as large as 5,000,000.

------------------------------
------------------------------
First Unique Character in a String
------------------------------

Given a string, find the first non-repeating character in it and

return it's index. If it doesn't exist, return -1.

Examples:

s = "leetcode"
return 0.
s = "loveleetcode",
return 2.

Note: You may assume the string contain only lowercase letters.

------------------------------
------------------------------
Longest Absolute File Path
------------------------------
Suppose we abstract our file system by a string in the following
manner:

The string "dir\n\tsubdir1\n\tsubdir2\n\t\tfile.ext" represents:

dir
subdir1
subdir2
file.ext

The directory dir contains an empty sub-directory subdir1 and a sub-

directory subdir2 containing a file file.ext.

The string
"dir\n\tsubdir1\n\t\tfile1.ext\n\t\tsubsubdir1\n\tsubdir2\n\t\tsubsu
bdir2\n\t\t\tfile2.ext" represents:

dir
subdir1
file1.ext
subsubdir1
subdir2
subsubdir2
file2.ext

The directory dir contains two sub-directories subdir1 and subdir2.

subdir1 contains a file file1.ext and an empty second-level sub-
directory subsubdir1. subdir2 contains a second-level sub-directory
subsubdir2 containing a file file2.ext.

We are interested in finding the longest (number of characters)

absolute path to a file within our file system. For example, in the
second example above, the longest absolute path is "dir/subdir2/
subsubdir2/file2.ext", and its length is 32 (not including the
double quotes).

Given a string representing the file system in the above format,

return the length of the longest absolute path to file in the
abstracted file system. If there is no file in the system, return 0.
Note:

The name of a file contains at least a . and an extension.

The name of a directory or sub-directory will not contain a ..

Time complexity required: O(n) where n is the size of the input

string.

Notice that a/aa/aaa/file1.txt is not the longest file path, if

there is another path aaaaaaaaaaaaaaaaaaaaa/sth.png.
------------------------------
------------------------------
Find the Difference
------------------------------

Given two strings s and t which consist of only lowercase letters.

String t is generated by random shuffling string s and then add one

more letter at a random position.

Find the letter that was added in t.

Example:

Input:
s = "abcd"
t = "abcde"

Output:
e

Explanation:
'e' is the letter that was added.

------------------------------
------------------------------
Elimination Game
------------------------------

There is a list of sorted integers from 1 to n. Starting from left

to right, remove the first number and every other number afterward
until you reach the end of the list.

Repeat the previous step again, but this time from right to left,
remove the right most number and every other number from the
remaining numbers.

We keep repeating the steps again, alternating left to right and

right to left, until a single number remains.

Find the last number that remains starting with a list of length n.
Example:

Input:
n = 9,
1 2 3 4 5 6 7 8 9
2 4 6 8
2 6
6

Output:
6

------------------------------
------------------------------
Perfect Rectangle
------------------------------

Given N axis-aligned rectangles where N > 0, determine if they all

together form an exact cover of a rectangular region.

Each rectangle is represented as a bottom-left point and a top-right

point. For example, a unit square is represented as [1,1,2,2].
(coordinate of bottom-left point is (1, 1) and top-right point is
(2, 2)).

Example 1:

rectangles = [
[1,1,3,3],
[3,1,4,2],
[3,2,4,4],
[1,3,2,4],
[2,3,3,4]
]

Return true. All 5 rectangles together form an exact cover of a

rectangular region.

Example 2:

rectangles = [
[1,1,2,3],
[1,3,2,4],
 [3,1,4,2],
[3,2,4,4]
]

Return false. Because there is a gap between the two rectangular

regions.

Example 3:

rectangles = [
[1,1,3,3],
[3,1,4,2],
[1,3,2,4],
[3,2,4,4]
]

Return false. Because there is a gap in the top center.

Example 4:

rectangles = [
[1,1,3,3],
[3,1,4,2],
[1,3,2,4],
[2,2,4,4]
]

Return false. Because two of the rectangles overlap with each other.

------------------------------
------------------------------
Is Subsequence
------------------------------

Given a string s and a string t, check if s is subsequence of t.

You may assume that there is only lower case English letters in both
s and t. t is potentially a very long (length ~= 500,000) string,
and s is a short string (<=100).
A subsequence of a string is a new string which is formed from the
original string by deleting some (can be none) of the characters
without disturbing the relative positions of the remaining
characters. (ie, "ace" is a subsequence of "abcde" while "aec" is
not).

Example 1:
s = "abc", t = "ahbgdc"

Return true.

Example 2:
s = "axc", t = "ahbgdc"

Return false.

Follow up:
If there are lots of incoming S, say S1, S2, ... , Sk where k >= 1B,
and you want to check one by one to see if T has its subsequence. In
this scenario, how would you change your code?

Credits:Special thanks to @pbrother for adding this problem and

creating all test cases.
------------------------------
------------------------------
UTF-8 Validation
------------------------------
A character in UTF8 can be from 1 to 4 bytes long, subjected to the
following rules:

For 1-byte character, the first bit is a 0, followed by its unicode

code.
For n-bytes character, the first n-bits are all one's, the n+1 bit
is 0, followed by n-1 bytes with most significant 2 bits being 10.

This is how the UTF-8 encoding would work:

Char. number range | UTF-8 octet sequence

(hexadecimal) | (binary)
--------------------
+---------------------------------------------
0000 0000-0000 007F | 0xxxxxxx
0000 0080-0000 07FF | 110xxxxx 10xxxxxx
0000 0800-0000 FFFF | 1110xxxx 10xxxxxx 10xxxxxx
0001 0000-0010 FFFF | 11110xxx 10xxxxxx 10xxxxxx 10xxxxxx
Given an array of integers representing the data, return whether it
is a valid utf-8 encoding.

Note:
The input is an array of integers. Only the least significant 8 bits
of each integer is used to store the data. This means each integer
represents only 1 byte of data.

Example 1:

data = [197, 130, 1], which represents the octet sequence: 11000101
10000010 00000001.

Return true.
It is a valid utf-8 encoding for a 2-bytes character followed by a
1-byte character.

Example 2:

data = [235, 140, 4], which represented the octet sequence: 11101011
10001100 00000100.

Return false.
The first 3 bits are all one's and the 4th bit is 0 means it is a 3-
bytes character.
The next byte is a continuation byte which starts with 10 and that's
correct.
But the second continuation byte does not start with 10, so it is
invalid.

------------------------------
------------------------------
Decode String
------------------------------

Given an encoded string, return it's decoded string.

The encoding rule is: k[encoded_string], where the encoded_string

inside the square brackets is being repeated exactly k times. Note
that k is guaranteed to be a positive integer.

You may assume that the input string is always valid; No extra white
spaces, square brackets are well-formed, etc.
Furthermore, you may assume that the original data does not contain
any digits and that digits are only for those repeat numbers, k. For
example, there won't be input like 3a or 2[4].

Examples:

s = "3[a]2[bc]", return "aaabcbc".

s = "3[a2[c]]", return "accaccacc".
s = "2[abc]3[cd]ef", return "abcabccdcdcdef".

------------------------------
------------------------------
Longest Substring with At Least K Repeating Characters
------------------------------

Find the length of the longest substring T of a given string

(consists of lowercase letters only) such that every character in T
appears no less than k times.

Example 1:

Input:
s = "aaabb", k = 3

Output:
3

The longest substring is "aaa", as 'a' is repeated 3 times.

Example 2:

Input:
s = "ababbc", k = 2

Output:
5

The longest substring is "ababb", as 'a' is repeated 2 times and 'b'

is repeated 3 times.

------------------------------
------------------------------
Rotate Function
------------------------------

Given an array of integers A and let n to be its length.

Assume Bk to be an array obtained by rotating the array A k
positions clock-wise, we define a "rotation function" F on A as
follow:

F(k) = 0 * Bk[0] + 1 * Bk[1] + ... + (n-1) * Bk[n-1].

Calculate the maximum value of F(0), F(1), ..., F(n-1).

Note:
n is guaranteed to be less than 105.

Example:

A = [4, 3, 2, 6]

F(0) = (0 * 4) + (1 * 3) + (2 * 2) + (3 * 6) = 0 + 3 + 4 + 18 = 25
F(1) = (0 * 6) + (1 * 4) + (2 * 3) + (3 * 2) = 0 + 4 + 6 + 6 = 16
F(2) = (0 * 2) + (1 * 6) + (2 * 4) + (3 * 3) = 0 + 6 + 8 + 9 = 23
F(3) = (0 * 3) + (1 * 2) + (2 * 6) + (3 * 4) = 0 + 2 + 12 + 12 = 26

So the maximum value of F(0), F(1), F(2), F(3) is F(3) = 26.

------------------------------
------------------------------
Integer Replacement
------------------------------

Given a positive integer n and you can do operations as follow:

If n is even, replace n with n/2.

If n is odd, you can replace n with either n + 1 or n - 1.

What is the minimum number of replacements needed for n to become 1?

Example 1:

Input:
8
Output:
3

Explanation:
8 -> 4 -> 2 -> 1

Example 2:

Input:
7

Output:
4

Explanation:
7 -> 8 -> 4 -> 2 -> 1
or
7 -> 6 -> 3 -> 2 -> 1

------------------------------
------------------------------
Random Pick Index
------------------------------

Given an array of integers with possible duplicates, randomly output

the index of a given target number. You can assume that the given
target number must exist in the array.

Note:
The array size can be very large. Solution that uses too much extra
space will not pass the judge.

Example:

int[] nums = new int[] {1,2,3,3,3};

Solution solution = new Solution(nums);

// pick(3) should return either index 2, 3, or 4 randomly. Each

index should have equal probability of returning.
solution.pick(3);

// pick(1) should return 0. Since in the array only nums[0] is equal

to 1.
solution.pick(1);

------------------------------
------------------------------
Evaluate Division
------------------------------

Equations are given in the format A / B = k, where A and B are

variables represented as strings, and k is a real number (floating
point number). Given some queries, return the answers. If the answer
does not exist, return -1.0.

Example:
Given a / b = 2.0, b / c = 3.0. queries are: a / c = ?, b / a
= ?, a / e = ?, a / a = ?, x / x = ? . return [6.0, 0.5, -1.0,
1.0, -1.0 ].

The input is: vector&lt;pair&lt;string, string&gt;&gt; equations,

vector&lt;double&gt;&amp; values, vector&lt;pair&lt;string,
string&gt;&gt; queries , where equations.size() == values.size(),
and the values are positive. This represents the equations. Return
vector&lt;double&gt;.

According to the example above:

equations = [ ["a", "b"], ["b", "c"] ],
values = [2.0, 3.0],
queries = [ ["a", "c"], ["b", "a"], ["a", "e"], ["a", "a"], ["x",
"x"] ].

The input is always valid. You may assume that evaluating the
queries will result in no division by zero and there is no
contradiction.

------------------------------
------------------------------
Nth Digit
------------------------------
Find the nth digit of the infinite integer sequence 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, ...

Note:
n is positive and will fit within the range of a 32-bit signed
integer (n < 231).

Example 1:

Input:
3

Output:
3
Example 2:

Input:
11

Output:
0

Explanation:
The 11th digit of the sequence 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, ... is a 0, which is part of the number 10.

------------------------------
------------------------------
Binary Watch
------------------------------
A binary watch has 4 LEDs on the top which represent the hours
(0-11), and the 6 LEDs on the bottom represent the minutes (0-59).
Each LED represents a zero or one, with the least significant bit on
the right.

For example, the above binary watch reads "3:25".

Given a non-negative integer n which represents the number of LEDs

that are currently on, return all possible times the watch could
represent.

Example:
Input: n = 1Return: ["1:00", "2:00", "4:00", "8:00", "0:01", "0:02",
"0:04", "0:08", "0:16", "0:32"]

Note:

The order of output does not matter.

The hour must not contain a leading zero, for example "01:00" is not
valid, it should be "1:00".
The minute must be consist of two digits and may contain a leading
zero, for example "10:2" is not valid, it should be "10:02".

------------------------------
------------------------------
Remove K Digits
------------------------------
Given a non-negative integer num represented as a string, remove k
digits from the number so that the new number is the smallest
possible.

Note:
The length of num is less than 10002 and will be &ge; k.
The given num does not contain any leading zero.

Example 1:

Input: num = "1432219", k = 3

Output: "1219"
Explanation: Remove the three digits 4, 3, and 2 to form the new
number 1219 which is the smallest.

Example 2:

Input: num = "10200", k = 1

Output: "200"
Explanation: Remove the leading 1 and the number is 200. Note that
the output must not contain leading zeroes.

Example 3:

Input: num = "10", k = 2

Output: "0"
Explanation: Remove all the digits from the number and it is left
with nothing which is 0.

------------------------------
------------------------------
Frog Jump
------------------------------
A frog is crossing a river. The river is divided into x units and at
each unit there may or may not exist a stone. The frog can jump on a
stone, but it must not jump into the water.

Given a list of stones' positions (in units) in sorted ascending

order, determine if the frog is able to cross the river by landing
on the last stone. Initially, the frog is on the first stone and
assume the first jump must be 1 unit.

If the frog's last jump was k units, then its next jump must be
either k - 1, k, or k + 1 units. Note that the frog can only jump in
the forward direction.

Note:

The number of stones is &ge; 2 and is < 1,100.

Each stone's position will be a non-negative integer < 231.
The first stone's position is always 0.

Example 1:

[0,1,3,5,6,8,12,17]

There are a total of 8 stones.

The first stone at the 0th unit, second stone at the 1st unit,
third stone at the 3rd unit, and so on...
The last stone at the 17th unit.

Return true. The frog can jump to the last stone by jumping
1 unit to the 2nd stone, then 2 units to the 3rd stone, then
2 units to the 4th stone, then 3 units to the 6th stone,
4 units to the 7th stone, and 5 units to the 8th stone.

Example 2:

[0,1,2,3,4,8,9,11]

Return false. There is no way to jump to the last stone as

the gap between the 5th and 6th stone is too large.

------------------------------
------------------------------
Sum of Left Leaves
------------------------------
Find the sum of all left leaves in a given binary tree.

Example:

3
/ \
9 20
/ \
15 7

There are two left leaves in the binary tree, with values 9 and 15
respectively. Return 24.

------------------------------
------------------------------
Convert a Number to Hexadecimal
------------------------------

Given an integer, write an algorithm to convert it to hexadecimal.

For negative integer, two’s complement method is used.
Note:

All letters in hexadecimal (a-f) must be in lowercase.

The hexadecimal string must not contain extra leading 0s. If the
number is zero, it is represented by a single zero character '0';
otherwise, the first character in the hexadecimal string will not be
the zero character.
The given number is guaranteed to fit within the range of a 32-bit
signed integer.
You must not use any method provided by the library which converts/
formats the number to hex directly.

Example 1:

Input:
26

Output:
"1a"

Example 2:

Input:
-1

Output:
"ffffffff"

------------------------------
------------------------------
Queue Reconstruction by Height
------------------------------
Suppose you have a random list of people standing in a queue. Each
person is described by a pair of integers (h, k), where h is the
height of the person and k is the number of people in front of this
person who have a height greater than or equal to h. Write an
algorithm to reconstruct the queue.

Note:
The number of people is less than 1,100.

Example

Input:
[[7,0], [4,4], [7,1], [5,0], [6,1], [5,2]]
Output:
[[5,0], [7,0], [5,2], [6,1], [4,4], [7,1]]

------------------------------
------------------------------
Trapping Rain Water II
------------------------------
Given an m x n matrix of positive integers representing the height
of each unit cell in a 2D elevation map, compute the volume of water
it is able to trap after raining.

Note:
Both m and n are less than 110. The height of each unit cell is
greater than 0 and is less than 20,000.

Example:

Given the following 3x6 height map:

[
[1,4,3,1,3,2],
[3,2,1,3,2,4],
[2,3,3,2,3,1]
]

Return 4.

The above image represents the elevation map [[1,4,3,1,3,2],

[3,2,1,3,2,4],[2,3,3,2,3,1]] before the rain.

After the rain, water are trapped between the blocks. The total
volume of water trapped is 4.

------------------------------
------------------------------
------------------------------
Longest Palindrome
------------------------------
Given a string which consists of lowercase or uppercase letters,
find the length of the longest palindromes that can be built with
those letters.

This is case sensitive, for example "Aa" is not considered a

palindrome here.
Note:
Assume the length of given string will not exceed 1,010.

Example:

Input:
"abccccdd"

Output:
7

Explanation:
One longest palindrome that can be built is "dccaccd", whose length
is 7.

------------------------------
------------------------------
Split Array Largest Sum
------------------------------
Given an array which consists of non-negative integers and an
integer m, you can split the array into m non-empty continuous
subarrays. Write an algorithm to minimize the largest sum among
these m subarrays.

Note:
If n is the length of array, assume the following constraints are
satisfied:

1 &le; n &le; 1000

1 &le; m &le; min(50, n)

Examples:

Input:
nums = [7,2,5,10,8]
m = 2

Output:
18

Explanation:
There are four ways to split nums into two subarrays.
The best way is to split it into [7,2,5] and [10,8],
where the largest sum among the two subarrays is only 18.

------------------------------
------------------------------
------------------------------
Fizz Buzz
------------------------------
Write a program that outputs the string representation of numbers
from 1 to n.

But for multiples of three it should output “Fizz” instead of the

number and for the multiples of five output “Buzz”. For numbers
which are multiples of both three and five output “FizzBuzz”.

Example:

n = 15,

Return:
[
"1",
"2",
"Fizz",
"4",
"Buzz",
"Fizz",
"7",
"8",
"Fizz",
"Buzz",
"11",
"Fizz",
"13",
"14",
"FizzBuzz"
]

------------------------------
------------------------------
Arithmetic Slices
------------------------------
A sequence of number is called arithmetic if it consists of at least
three elements and if the difference between any two consecutive
elements is the same.

For example, these are arithmetic sequence:

1, 3, 5, 7, 9
7, 7, 7, 7
3, -1, -5, -9

The following sequence is not arithmetic. 1, 1, 2, 5, 7

A zero-indexed array A consisting of N numbers is given. A slice of

that array is any pair of integers (P, Q) such that 0 <= P < Q < N.

A slice (P, Q) of array A is called arithmetic if the sequence:

A[P], A[p + 1], ..., A[Q - 1], A[Q] is arithmetic. In
particular, this means that P + 1 < Q.

The function should return the number of arithmetic slices in the

array A.

Example:

A = [1, 2, 3, 4]

return: 3, for 3 arithmetic slices in A: [1, 2, 3], [2, 3, 4] and

[1, 2, 3, 4] itself.

------------------------------
------------------------------
Third Maximum Number
------------------------------
Given a non-empty array of integers, return the third maximum number
in this array. If it does not exist, return the maximum number. The
time complexity must be in O(n).

Example 1:

Input: [3, 2, 1]

Output: 1

Explanation: The third maximum is 1.

Example 2:

Input: [1, 2]

Output: 2

Explanation: The third maximum does not exist, so the maximum (2) is
returned instead.

Example 3:

Input: [2, 2, 3, 1]

Output: 1

Explanation: Note that the third maximum here means the third
maximum distinct number.
Both numbers with value 2 are both considered as second maximum.

------------------------------
------------------------------
Add Strings
------------------------------
Given two non-negative integers num1 and num2 represented as string,
return the sum of num1 and num2.

Note:

The length of both num1 and num2 is < 5100.

Both num1 and num2 contains only digits 0-9.
Both num1 and num2 does not contain any leading zero.
You must not use any built-in BigInteger library or convert the
inputs to integer directly.

------------------------------
------------------------------
Partition Equal Subset Sum
------------------------------
Given a non-empty array containing only positive integers, find if
the array can be partitioned into two subsets such that the sum of
elements in both subsets is equal.

Note:

Each of the array element will not exceed 100.

The array size will not exceed 200.

Example 1:

Input: [1, 5, 11, 5]

Output: true

Explanation: The array can be partitioned as [1, 5, 5] and [11].

Example 2:

Input: [1, 2, 3, 5]

Output: false

Explanation: The array cannot be partitioned into equal sum subsets.

------------------------------
------------------------------
Pacific Atlantic Water Flow
------------------------------
Given an m x n matrix of non-negative integers representing the
height of each unit cell in a continent, the "Pacific ocean" touches
the left and top edges of the matrix and the "Atlantic ocean"
touches the right and bottom edges.

Water can only flow in four directions (up, down, left, or right)
from a cell to another one with height equal or lower.

Find the list of grid coordinates where water can flow to both the
Pacific and Atlantic ocean.

Note:

The order of returned grid coordinates does not matter.

Both m and n are less than 150.

Example:

Given the following 5x5 matrix:

Pacific ~ ~ ~ ~ ~
~ 1 2 2 3 (5) *
~ 3 2 3 (4) (4) *
~ 2 4 (5) 3 1 *
~ (6) (7) 1 4 5 *
~ (5) 1 1 2 4 *
* * * * * Atlantic

Return:

[[0, 4], [1, 3], [1, 4], [2, 2], [3, 0], [3, 1], [4, 0]] (positions
with parentheses in above matrix).

------------------------------
------------------------------
------------------------------
Battleships in a Board
------------------------------
Given an 2D board, count how many battleships are in it. The
battleships are represented with 'X's, empty slots are represented
with '.'s. You may assume the following rules:

You receive a valid board, made of only battleships or empty slots.

Battleships can only be placed horizontally or vertically. In other
words, they can only be made of the shape 1xN (1 row, N columns) or
Nx1 (N rows, 1 column), where N can be of any size.
At least one horizontal or vertical cell separates between two
battleships - there are no adjacent battleships.

Example:
X..X
...X
...X

In the above board there are 2 battleships.

Invalid Example:
...X
XXXX
...X

This is an invalid board that you will not receive - as battleships

will always have a cell separating between them.

Follow up:Could you do it in one-pass, using only O(1) extra memory

and without modifying the value of the board?
------------------------------
------------------------------
Strong Password Checker
------------------------------
A password is considered strong if below conditions are all met:

It has at least 6 characters and at most 20 characters.

It must contain at least one lowercase letter, at least one
uppercase letter, and at least one digit.
It must NOT contain three repeating characters in a row
("...aaa..." is weak, but "...aa...a..." is strong, assuming other
conditions are met).

Write a function strongPasswordChecker(s), that takes a string s as

input, and return the MINIMUM change required to make s a strong
password. If s is already strong, return 0.

Insertion, deletion or replace of any one character are all

considered as one change.
------------------------------
------------------------------
Maximum XOR of Two Numbers in an Array
------------------------------
Given a non-empty array of numbers, a0, a1, a2, … , an-1, where 0
&le; ai < 231.

Find the maximum result of ai XOR aj, where 0 &le; i, j &lt; n.

Could you do this in O(n) runtime?

Example:

Input: [3, 10, 5, 25, 2, 8]

Output: 28
Explanation: The maximum result is 5 ^ 25 = 28.

------------------------------
------------------------------
------------------------------
Reconstruct Original Digits from English
------------------------------
Given a non-empty string containing an out-of-order English
representation of digits 0-9, output the digits in ascending order.

Note:

Input contains only lowercase English letters.

Input is guaranteed to be valid and can be transformed to its
original digits. That means invalid inputs such as "abc" or "zerone"
are not permitted.
Input length is less than 50,000.

Example 1:

Input: "owoztneoer"

Output: "012"

Example 2:

Input: "fviefuro"

Output: "45"

------------------------------
------------------------------
Longest Repeating Character Replacement
------------------------------
Given a string that consists of only uppercase English letters, you
can replace any letter in the string with another letter at most k
times. Find the length of a longest substring containing all
repeating letters you can get after performing the above operations.

Note:
Both the string's length and k will not exceed 104.

Example 1:

Input:
s = "ABAB", k = 2
Output:
4

Explanation:
Replace the two 'A's with two 'B's or vice versa.

Example 2:

Input:
s = "AABABBA", k = 1

Output:
4

Explanation:
Replace the one 'A' in the middle with 'B' and form "AABBBBA".
The substring "BBBB" has the longest repeating letters, which is 4.

------------------------------
------------------------------
------------------------------
All O`one Data Structure
------------------------------
Implement a data structure supporting the following operations:

Inc(Key) - Inserts a new key with value 1. Or increments an

existing key by 1. Key is guaranteed to be a non-empty string.
Dec(Key) - If Key's value is 1, remove it from the data structure.
Otherwise decrements an existing key by 1. If the key does not
exist, this function does nothing. Key is guaranteed to be a non-
empty string.
GetMaxKey() - Returns one of the keys with maximal value. If no
element exists, return an empty string "".
GetMinKey() - Returns one of the keys with minimal value. If no
element exists, return an empty string "".

Challenge: Perform all these in O(1) time complexity.

------------------------------
------------------------------
Number of Segments in a String
------------------------------
Count the number of segments in a string, where a segment is defined
to be a contiguous sequence of non-space characters.
Please note that the string does not contain any non-printable
characters.

Example:

Input: "Hello, my name is John"

Output: 5

------------------------------
------------------------------
Non-overlapping Intervals
------------------------------

Given a collection of intervals, find the minimum number of

intervals you need to remove to make the rest of the intervals non-
overlapping.

Note:

You may assume the interval's end point is always bigger than its
start point.
Intervals like [1,2] and [2,3] have borders "touching" but they
don't overlap each other.

Example 1:

Input: [ [1,2], [2,3], [3,4], [1,3] ]

Output: 1

Explanation: [1,3] can be removed and the rest of intervals are non-
overlapping.

Example 2:

Input: [ [1,2], [1,2], [1,2] ]

Output: 2

Explanation: You need to remove two [1,2] to make the rest of

intervals non-overlapping.

Example 3:

Input: [ [1,2], [2,3] ]

Output: 0

Explanation: You don't need to remove any of the intervals since

they're already non-overlapping.

------------------------------
------------------------------
Find Right Interval
------------------------------

Given a set of intervals, for each of the interval i, check if there

exists an interval j whose start point is bigger than or equal to
the end point of the interval i, which can be called that j is on
the "right" of i.

For any interval i, you need to store the minimum interval j's
index, which means that the interval j has the minimum start point
to build the "right" relationship for interval i. If the interval j
doesn't exist, store -1 for the interval i. Finally, you need output
the stored value of each interval as an array.

Note:

You may assume the interval's end point is always bigger than its
start point.
You may assume none of these intervals have the same start point.

Example 1:

Input: [ [1,2] ]

Output: [-1]

Explanation: There is only one interval in the collection, so it

outputs -1.

Example 2:

Input: [ [3,4], [2,3], [1,2] ]

Output: [-1, 0, 1]

Explanation: There is no satisfied "right" interval for [3,4].

For [2,3], the interval [3,4] has minimum-"right" start point;
For [1,2], the interval [2,3] has minimum-"right" start point.
Example 3:

Input: [ [1,4], [2,3], [3,4] ]

Output: [-1, 2, -1]

Explanation: There is no satisfied "right" interval for [1,4] and

[3,4].
For [2,3], the interval [3,4] has minimum-"right" start point.

------------------------------
------------------------------
Path Sum III
------------------------------
You are given a binary tree in which each node contains an integer
value.

Find the number of paths that sum to a given value.

The path does not need to start or end at the root or a leaf, but it
must go downwards
(traveling only from parent nodes to child nodes).

The tree has no more than 1,000 nodes and the values are in the
range -1,000,000 to 1,000,000.

Example:

root = [10,5,-3,3,2,null,11,3,-2,null,1], sum = 8

10
/ \
5 -3
/ \ \
3 2 11
/ \ \
3 -2 1

Return 3. The paths that sum to 8 are:

1. 5 -> 3
2. 5 -> 2 -> 1
3. -3 -> 11

------------------------------
------------------------------
Find All Anagrams in a String
------------------------------
Given a string s and a non-empty string p, find all the start
indices of p's anagrams in s.

Strings consists of lowercase English letters only and the length of

both strings s and p will not be larger than 20,100.

The order of output does not matter.

Example 1:

Input:
s: "cbaebabacd" p: "abc"

Output:
[0, 6]

Explanation:
The substring with start index = 0 is "cba", which is an anagram of
"abc".
The substring with start index = 6 is "bac", which is an anagram of
"abc".

Example 2:

Input:
s: "abab" p: "ab"

Output:
[0, 1, 2]

Explanation:
The substring with start index = 0 is "ab", which is an anagram of
"ab".
The substring with start index = 1 is "ba", which is an anagram of
"ab".
The substring with start index = 2 is "ab", which is an anagram of
"ab".

------------------------------
------------------------------
------------------------------
K-th Smallest in Lexicographical Order
------------------------------
Given integers n and k, find the lexicographically k-th smallest
integer in the range from 1 to n.

Note: 1 &le; k &le; n &le; 109.

Example:

Input:
n: 13 k: 2
Output:
10

Explanation:
The lexicographical order is [1, 10, 11, 12, 13, 2, 3, 4, 5, 6, 7,
8, 9], so the second smallest number is 10.

------------------------------
------------------------------
Arranging Coins
------------------------------
You have a total of n coins that you want to form in a staircase
shape, where every k-th row must have exactly k coins.

Given n, find the total number of full staircase rows that can be
formed.

n is a non-negative integer and fits within the range of a 32-bit

signed integer.

Example 1:

n = 5

The coins can form the following rows:

¤
¤ ¤
¤ ¤

Because the 3rd row is incomplete, we return 2.

Example 2:

n = 8

The coins can form the following rows:

¤
¤ ¤
¤ ¤ ¤
¤ ¤

Because the 4th row is incomplete, we return 3.

------------------------------
------------------------------
Find All Duplicates in an Array
------------------------------
Given an array of integers, 1 &le; a[i] &le; n (n = size of array),
some elements appear twice and others appear once.
Find all the elements that appear twice in this array.

Could you do it without extra space and in O(n) runtime?

Example:

Input:
[4,3,2,7,8,2,3,1]

Output:
[2,3]

------------------------------
------------------------------
------------------------------
Add Two Numbers II
------------------------------
You are given two non-empty linked lists representing two non-
negative integers. The most significant digit comes first and each
of their nodes contain a single digit. Add the two numbers and
return it as a linked list.

You may assume the two numbers do not contain any leading zero,
except the number 0 itself.

Follow up:
What if you cannot modify the input lists? In other words, reversing
the lists is not allowed.

Example:

Input: (7 -> 2 -> 4 -> 3) + (5 -> 6 -> 4)

Output: 7 -> 8 -> 0 -> 7

------------------------------
------------------------------
Arithmetic Slices II - Subsequence
------------------------------
A sequence of numbers is called arithmetic if it consists of at
least three elements and if the difference between any two
consecutive elements is the same.

For example, these are arithmetic sequences:

1, 3, 5, 7, 9
7, 7, 7, 7
3, -1, -5, -9

The following sequence is not arithmetic. 1, 1, 2, 5, 7

A zero-indexed array A consisting of N numbers is given. A
subsequence slice of that array is any sequence of integers (P0,
P1, ..., Pk) such that 0 &le; P0 < P1 < ... < Pk < N.

A subsequence slice (P0, P1, ..., Pk) of array A is called

arithmetic if the sequence A[P0], A[P1], ..., A[Pk-1], A[Pk] is
arithmetic. In particular, this means that k &ge; 2.

The function should return the number of arithmetic subsequence

slices in the array A.

The input contains N integers. Every integer is in the range of -231

and 231-1 and 0 &le; N &le; 1000. The output is guaranteed to be
less than 231-1.

Example:

Input: [2, 4, 6, 8, 10]

Output: 7

Explanation:
All arithmetic subsequence slices are:
[2,4,6]
[4,6,8]
[6,8,10]
[2,4,6,8]
[4,6,8,10]
[2,4,6,8,10]
[2,6,10]

------------------------------
------------------------------
Number of Boomerangs
------------------------------
Given n points in the plane that are all pairwise distinct, a
"boomerang" is a tuple of points (i, j, k) such that the distance
between i and j equals the distance between i and k (the order of
the tuple matters).

Find the number of boomerangs. You may assume that n will be at most
500 and coordinates of points are all in the range [-10000, 10000]
(inclusive).

Example:

Input:
[[0,0],[1,0],[2,0]]

Output:
2
Explanation:
The two boomerangs are [[1,0],[0,0],[2,0]] and [[1,0],[2,0],[0,0]]

------------------------------
------------------------------
Find All Numbers Disappeared in an Array
------------------------------
Given an array of integers where 1 ≤ a[i] ≤ n (n = size of array),
some elements appear twice and others appear once.

Find all the elements of [1, n] inclusive that do not appear in this
array.

Could you do it without extra space and in O(n) runtime? You may
assume the returned list does not count as extra space.

Example:

Input:
[4,3,2,7,8,2,3,1]

Output:
[5,6]

------------------------------
------------------------------
Serialize and Deserialize BST
------------------------------
Serialization is the process of converting a data structure or
object into a sequence of bits so that it can be stored in a file or
memory buffer, or transmitted across a network connection link to be
reconstructed later in the same or another computer environment.

Design an algorithm to serialize and deserialize a binary search

tree. There is no restriction on how your serialization/
deserialization algorithm should work. You just need to ensure that
a binary search tree can be serialized to a string and this string
can be deserialized to the original tree structure.

The encoded string should be as compact as possible.

Note: Do not use class member/global/static variables to store

states. Your serialize and deserialize algorithms should be
stateless.

------------------------------
------------------------------
Delete Node in a BST
------------------------------
Given a root node reference of a BST and a key, delete the node with
the given key in the BST. Return the root node reference (possibly
updated) of the BST.

Basically, the deletion can be divided into two stages:

Search for a node to remove.

If the node is found, delete the node.

Note: Time complexity should be O(height of tree).

Example:

root = [5,3,6,2,4,null,7]
key = 3

5
/ \
3 6
/ \ \
2 4 7

Given key to delete is 3. So we find the node with value 3 and

delete it.

One valid answer is [5,4,6,2,null,null,7], shown in the following

BST.

5
/ \
4 6
/ \
2 7

Another valid answer is [5,2,6,null,4,null,7].

5
/ \
2 6
\ \
4 7

------------------------------
------------------------------
Sort Characters By Frequency
------------------------------
Given a string, sort it in decreasing order based on the frequency
of characters.

Example 1:
Input:
"tree"

Output:
"eert"

Explanation:
'e' appears twice while 'r' and 't' both appear once.
So 'e' must appear before both 'r' and 't'. Therefore "eetr" is also
a valid answer.

Example 2:

Input:
"cccaaa"

Output:
"cccaaa"

Explanation:
Both 'c' and 'a' appear three times, so "aaaccc" is also a valid
answer.
Note that "cacaca" is incorrect, as the same characters must be
together.

Example 3:

Input:
"Aabb"

Output:
"bbAa"

Explanation:
"bbaA" is also a valid answer, but "Aabb" is incorrect.
Note that 'A' and 'a' are treated as two different characters.

------------------------------
------------------------------
Minimum Moves to Equal Array Elements
------------------------------
Given a non-empty integer array of size n, find the minimum number
of moves required to make all array elements equal, where a move is
incrementing n - 1 elements by 1.

Example:

Input:
[1,2,3]
Output:
3

Explanation:
Only three moves are needed (remember each move increments two
elements):

[1,2,3] => [2,3,3] => [3,4,3] => [4,4,4]

------------------------------
------------------------------
4Sum II
------------------------------
Given four lists A, B, C, D of integer values, compute how many
tuples (i, j, k, l) there are such that A[i] + B[j] + C[k] + D[l] is
zero.

To make problem a bit easier, all A, B, C, D have same length of N

where 0 &le; N &le; 500. All integers are in the range of -228 to
228 - 1 and the result is guaranteed to be at most 231 - 1.

Example:

Input:
A = [ 1, 2]
B = [-2,-1]
C = [-1, 2]
D = [ 0, 2]

Output:
2

Explanation:
The two tuples are:
1. (0, 0, 0, 1) -> A[0] + B[0] + C[0] + D[1] = 1 + (-2) + (-1) + 2 =
0
2. (1, 1, 0, 0) -> A[1] + B[1] + C[0] + D[0] = 2 + (-1) + (-1) + 0 =
0

------------------------------
------------------------------
Assign Cookies
------------------------------

Assume you are an awesome parent and want to give your children some
cookies. But, you should give each child at most one cookie. Each
child i has a greed factor gi, which is the minimum size of a cookie
that the child will be content with; and each cookie j has a size
sj. If sj >= gi, we can assign the cookie j to the child i, and the
child i will be content. Your goal is to maximize the number of your
content children and output the maximum number.
Note:
You may assume the greed factor is always positive.
You cannot assign more than one cookie to one child.

Example 1:

Input: [1,2,3], [1,1]

Output: 1

Explanation: You have 3 children and 2 cookies. The greed factors of

3 children are 1, 2, 3.
And even though you have 2 cookies, since their size is both 1, you
could only make the child whose greed factor is 1 content.
You need to output 1.

Example 2:

Input: [1,2], [1,2,3]

Output: 2

Explanation: You have 2 children and 3 cookies. The greed factors of

2 children are 1, 2.
You have 3 cookies and their sizes are big enough to gratify all of
the children,
You need to output 2.

------------------------------
------------------------------
132 Pattern
------------------------------

Given a sequence of n integers a1, a2, ..., an, a 132 pattern is a

subsequence ai, aj, ak such
that i < j < k and ai < ak < aj. Design an algorithm that takes a
list of n numbers as input and checks whether there is a 132 pattern
in the list.

Note: n will be less than 15,000.

Example 1:

Input: [1, 2, 3, 4]

Output: False

Explanation: There is no 132 pattern in the sequence.

Example 2:

Input: [3, 1, 4, 2]

Output: True

Explanation: There is a 132 pattern in the sequence: [1, 4, 2].

Example 3:

Input: [-1, 3, 2, 0]

Output: True

Explanation: There are three 132 patterns in the sequence: [-1, 3,

2], [-1, 3, 0] and [-1, 2, 0].

------------------------------
------------------------------
Repeated Substring Pattern
------------------------------
Given a non-empty string check if it can be constructed by taking a
substring of it and appending multiple copies of the substring
together. You may assume the given string consists of lowercase
English letters only and its length will not exceed 10000.

Example 1:

Input: "abab"

Output: True

Explanation: It's the substring "ab" twice.

Example 2:

Input: "aba"

Output: False

Example 3:

Input: "abcabcabcabc"
Output: True

Explanation: It's the substring "abc" four times. (And the substring
"abcabc" twice.)

------------------------------
------------------------------
LFU Cache
------------------------------
Design and implement a data structure for Least Frequently Used
(LFU) cache. It should support the following operations: get and
put.

get(key) - Get the value (will always be positive) of the key if the
key exists in the cache, otherwise return -1.
put(key, value) - Set or insert the value if the key is not already
present. When the cache reaches its capacity, it should invalidate
the least frequently used item before inserting a new item. For the
purpose of this problem, when there is a tie (i.e., two or more keys
that have the same frequency), the least recently used key would be
evicted.

Follow up:
Could you do both operations in O(1) time complexity?

Example:

LFUCache cache = new LFUCache( 2 /* capacity */ );

cache.put(1, 1);
cache.put(2, 2);
cache.get(1); // returns 1
cache.put(3, 3); // evicts key 2
cache.get(2); // returns -1 (not found)
cache.get(3); // returns 3.
cache.put(4, 4); // evicts key 1.
cache.get(1); // returns -1 (not found)
cache.get(3); // returns 3
cache.get(4); // returns 4

------------------------------
------------------------------
Hamming Distance
------------------------------
The Hamming distance between two integers is the number of positions
at which the corresponding bits are different.

Given two integers x and y, calculate the Hamming distance.

Note:
0 &le; x, y &lt; 231.

Example:

Input: x = 1, y = 4

Output: 2

Explanation:
1 (0 0 0 1)
4 (0 1 0 0)
↑ ↑

The above arrows point to positions where the corresponding bits are
different.

------------------------------
------------------------------
Minimum Moves to Equal Array Elements II
------------------------------
Given a non-empty integer array, find the minimum number of moves
required to make all array elements equal, where a move is
incrementing a selected element by 1 or decrementing a selected
element by 1.

You may assume the array's length is at most 10,000.

Example:

Input:
[1,2,3]

Output:
2

Explanation:
Only two moves are needed (remember each move increments or
decrements one element):

[1,2,3] => [2,2,3] => [2,2,2]

------------------------------
------------------------------
Island Perimeter
------------------------------
You are given a map in form of a two-dimensional integer grid where
1 represents land and 0 represents water. Grid cells are connected
horizontally/vertically (not diagonally). The grid is completely
surrounded by water, and there is exactly one island (i.e., one or
more connected land cells). The island doesn't have "lakes" (water
inside that isn't connected to the water around the island). One
cell is a square with side length 1. The grid is rectangular, width
and height don't exceed 100. Determine the perimeter of the island.

Example:

[[0,1,0,0],
[1,1,1,0],
[0,1,0,0],
[1,1,0,0]]

Answer: 16
Explanation: The perimeter is the 16 yellow stripes in the image
below:

------------------------------
------------------------------
Can I Win
------------------------------
In the "100 game," two players take turns adding, to a running
total, any integer from 1..10. The player who first causes the
running total to reach or exceed 100 wins.

What if we change the game so that players cannot re-use integers?

For example, two players might take turns drawing from a common pool
of numbers of 1..15 without replacement until they reach a total >=
100.

Given an integer maxChoosableInteger and another integer

desiredTotal, determine if the first player to move can force a win,
assuming both players play optimally.

You can always assume that maxChoosableInteger will not be larger

than 20 and desiredTotal will not be larger than 300.

Example

Input:
maxChoosableInteger = 10
desiredTotal = 11

Output:
false

Explanation:
No matter which integer the first player choose, the first player
will lose.
The first player can choose an integer from 1 up to 10.
If the first player choose 1, the second player can only choose
integers from 2 up to 10.
The second player will win by choosing 10 and get a total = 11,
which is >= desiredTotal.
Same with other integers chosen by the first player, the second
player will always win.

------------------------------
------------------------------
------------------------------
Count The Repetitions
------------------------------
Define S = [s,n] as the string S which consists of n connected
strings s. For example, ["abc", 3] ="abcabcabc".
On the other hand, we define that string s1 can be obtained from
string s2 if we can remove some characters from s2 such that it
becomes s1. For example, “abc” can be obtained from “abdbec” based
on our definition, but it can not be obtained from “acbbe”.
You are given two non-empty strings s1 and s2 (each at most 100
characters long) and two integers 0 &le; n1 &le; 106 and 1 &le; n2
&le; 106. Now consider the strings S1 and S2, where S1=[s1,n1] and
S2=[s2,n2]. Find the maximum integer M such that [S2,M] can be
obtained from S1.

Example:

Input:
s1="acb", n1=4
s2="ab", n2=2

Return:
2

------------------------------
------------------------------
Unique Substrings in Wraparound String
------------------------------
Consider the string s to be the infinite wraparound string of
"abcdefghijklmnopqrstuvwxyz", so s will look like this:
"...zabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcd....".

Now we have another string p. Your job is to find out how many
unique non-empty substrings of p are present in s. In particular,
your input is the string p and you need to output the number of
different non-empty substrings of p in the string s.

Note: p consists of only lowercase English letters and the size of p

might be over 10000.

Example 1:

Input: "a"
Output: 1
Explanation: Only the substring "a" of string "a" is in the string
s.

Example 2:

Input: "cac"
Output: 2
Explanation: There are two substrings "a", "c" of string "cac" in
the string s.

Example 3:

Input: "zab"
Output: 6
Explanation: There are six substrings "z", "a", "b", "za", "ab",
"zab" of string "zab" in the string s.

------------------------------
------------------------------
Validate IP Address
------------------------------

Write a function to check whether an input string is a valid IPv4

address or IPv6 address or neither.

IPv4 addresses are canonically represented in dot-decimal notation,

which consists of four decimal numbers, each ranging from 0 to 255,
separated by dots ("."), e.g.,172.16.254.1;

Besides, leading zeros in the IPv4 is invalid. For example, the

address 172.16.254.01 is invalid.

IPv6 addresses are represented as eight groups of four hexadecimal

digits, each group representing 16 bits. The groups are separated by
colons (":"). For example, the address
2001:0db8:85a3:0000:0000:8a2e:0370:7334 is a valid one. Also, we
could omit some leading zeros among four hexadecimal digits and some
low-case characters in the address to upper-case ones, so
2001:db8:85a3:0:0:8A2E:0370:7334 is also a valid IPv6 address(Omit
leading zeros and using upper cases).
However, we don't replace a consecutive group of zero value with a
single empty group using two consecutive colons (::) to pursue
simplicity. For example, 2001:0db8:85a3::8A2E:0370:7334 is an
invalid IPv6 address.

Besides, extra leading zeros in the IPv6 is also invalid. For

example, the address 02001:0db8:85a3:0000:0000:8a2e:0370:7334 is
invalid.

Note:
You may assume there is no extra space or special characters in the
input string.

Example 1:

Input: "172.16.254.1"

Output: "IPv4"

Explanation: This is a valid IPv4 address, return "IPv4".

Example 2:

Input: "2001:0db8:85a3:0:0:8A2E:0370:7334"

Output: "IPv6"

Explanation: This is a valid IPv6 address, return "IPv6".

Example 3:

Input: "256.256.256.256"

Output: "Neither"

Explanation: This is neither a IPv4 address nor a IPv6 address.

------------------------------
------------------------------
------------------------------
------------------------------
Concatenated Words
------------------------------
Given a list of words (without duplicates), please write a program
that returns all concatenated words in the given list of words.
A concatenated word is defined as a string that is comprised
entirely of at least two shorter words in the given array.

Example:

Input:
["cat","cats","catsdogcats","dog","dogcatsdog","hippopotamuses","rat
","ratcatdogcat"]

Output: ["catsdogcats","dogcatsdog","ratcatdogcat"]

Explanation: "catsdogcats" can be concatenated by "cats", "dog" and

"cats"; "dogcatsdog" can be concatenated by "dog", "cats" and
"dog"; "ratcatdogcat" can be concatenated by "rat", "cat", "dog" and
"cat".

Note:

The number of elements of the given array will not exceed 10,000
The length sum of elements in the given array will not exceed
600,000.
All the input string will only include lower case letters.
The returned elements order does not matter.

------------------------------
------------------------------
Matchsticks to Square
------------------------------
Remember the story of Little Match Girl? By now, you know exactly
what matchsticks the little match girl has, please find out a way
you can make one square by using up all those matchsticks. You
should not break any stick, but you can link them up, and each
matchstick must be used exactly one time.

Your input will be several matchsticks the girl has, represented

with their stick length. Your output will either be true or false,
to represent whether you could make one square using all the
matchsticks the little match girl has.

Example 1:

Input: [1,1,2,2,2]
Output: true

Explanation: You can form a square with length 2, one side of the
square came two sticks with length 1.
Example 2:

Input: [3,3,3,3,4]
Output: false

Explanation: You cannot find a way to form a square with all the
matchsticks.

Note:

The length sum of the given matchsticks is in the range of 0 to

10^9.
The length of the given matchstick array will not exceed 15.

------------------------------
------------------------------
Ones and Zeroes
------------------------------
In the computer world, use restricted resource you have to generate
maximum benefit is what we always want to pursue.
For now, suppose you are a dominator of m 0s and n 1s respectively.
On the other hand, there is an array with strings consisting of only
0s and 1s.

Now your task is to find the maximum number of strings that you can
form with given m 0s and n 1s. Each 0 and 1 can be used at most
once.

Note:

The given numbers of 0s and 1s will both not exceed 100

The size of given string array won't exceed 600.

Example 1:

Input: Array = {"10", "0001", "111001", "1", "0"}, m = 5, n = 3

Output: 4

Explanation: This are totally 4 strings can be formed by the using

of 5 0s and 3 1s, which are “10,”0001”,”1”,”0”

Example 2:
Input: Array = {"10", "0", "1"}, m = 1, n = 1
Output: 2

Explanation: You could form "10", but then you'd have nothing left.
Better form "0" and "1".

------------------------------
------------------------------
Heaters
------------------------------
Winter is coming! Your first job during the contest is to design a
standard heater with fixed warm radius to warm all the houses.

Now, you are given positions of houses and heaters on a horizontal

line, find out minimum radius of heaters so that all houses could be
covered by those heaters.

So, your input will be the positions of houses and heaters

seperately, and your expected output will be the minimum radius
standard of heaters.

Note:

Numbers of houses and heaters you are given are non-negative and
will not exceed 25000.
Positions of houses and heaters you are given are non-negative and
will not exceed 10^9.
As long as a house is in the heaters' warm radius range, it can be
warmed.
All the heaters follow your radius standard and the warm radius will
the same.

Example 1:

Input: [1,2,3],[2]
Output: 1
Explanation: The only heater was placed in the position 2, and if we
use the radius 1 standard, then all the houses can be warmed.

Example 2:

Input: [1,2,3,4],[1,4]
Output: 1
Explanation: The two heater was placed in the position 1 and 4. We
need to use radius 1 standard, then all the houses can be warmed.

------------------------------
------------------------------
Number Complement
------------------------------
Given a positive integer, output its complement number. The
complement strategy is to flip the bits of its binary
representation.

Note:

The given integer is guaranteed to fit within the range of a 32-bit

signed integer.
You could assume no leading zero bit in the integer’s binary
representation.

Example 1:

Input: 5
Output: 2
Explanation: The binary representation of 5 is 101 (no leading zero
bits), and its complement is 010. So you need to output 2.

Example 2:

Input: 1
Output: 0
Explanation: The binary representation of 1 is 1 (no leading zero
bits), and its complement is 0. So you need to output 0.

------------------------------
------------------------------
Total Hamming Distance
------------------------------
The Hamming distance between two integers is the number of positions
at which the corresponding bits are different.

Now your job is to find the total Hamming distance between all pairs
of the given numbers.

Example:

Input: 4, 14, 2

Output: 6

Explanation: In binary representation, the 4 is 0100, 14 is 1110,

and 2 is 0010 (just
showing the four bits relevant in this case). So the answer will be:
HammingDistance(4, 14) + HammingDistance(4, 2) + HammingDistance(14,
2) = 2 + 2 + 2 = 6.
Note:

Elements of the given array are in the range of 0 to 10^9

Length of the array will not exceed 10^4.

------------------------------
------------------------------
Sliding Window Median
------------------------------
Median is the middle value in an ordered integer list. If the size
of the list is even, there is no middle value. So the median is the
mean of the two middle value.
Examples:
[2,3,4] , the median is 3
[2,3], the median is (2 + 3) / 2 = 2.5

Given an array nums, there is a sliding window of size k which is

moving from the very left of the array to the very right. You can
only see the k numbers in the window. Each time the sliding window
moves right by one position. Your job is to output the median array
for each window in the original array.

For example,
Given nums = [1,3,-1,-3,5,3,6,7], and k = 3.

Window position Median

--------------- -----
[1 3 -1] -3 5 3 6 7 1
1 [3 -1 -3] 5 3 6 7 -1
1 3 [-1 -3 5] 3 6 7 -1
1 3 -1 [-3 5 3] 6 7 3
1 3 -1 -3 [5 3 6] 7 5
1 3 -1 -3 5 [3 6 7] 6

Therefore, return the median sliding window as [1,-1,-1,3,5,6].

Note:
You may assume k is always valid, ie: 1 ≤ k ≤ input array's size for
non-empty array.
------------------------------
------------------------------
Magical String
------------------------------

A magical string S consists of only '1' and '2' and obeys the
following rules:
The string S is magical because concatenating the number of
contiguous occurrences of characters '1' and '2' generates the
string S itself.

The first few elements of string S is the following:

S = "1221121221221121122……"

If we group the consecutive '1's and '2's in S, it will be:

1 22 11 2 1 22 1 22 11 2 11 22 ......

and the occurrences of '1's or '2's in each group are:

1 2 2 1 1 2 1 2 2 1 2 2 ......

You can see that the occurrence sequence above is the S itself.

Given an integer N as input, return the number of '1's in the first

N number in the magical string S.

Note:
N will not exceed 100,000.

Example 1:

Input: 6
Output: 3
Explanation: The first 6 elements of magical string S is "12211" and
it contains three 1's, so return 3.

------------------------------
------------------------------
License Key Formatting
------------------------------
Now you are given a string S, which represents a software license
key which we would like to format. The string S is composed of
alphanumerical characters and dashes. The dashes split the
alphanumerical characters within the string into groups. (i.e. if
there are M dashes, the string is split into M+1 groups). The dashes
in the given string are possibly misplaced.

We want each group of characters to be of length K (except for

possibly the first group, which could be shorter, but still must
contain at least one character). To satisfy this requirement, we
will reinsert dashes. Additionally, all the lower case letters in
the string must be converted to upper case.

So, you are given a non-empty string S, representing a license key

to format, and an integer K. And you need to return the license key
formatted according to the description above.

Example 1:

Input: S = "2-4A0r7-4k", K = 4

Output: "24A0-R74K"

Explanation: The string S has been split into two parts, each part
has 4 characters.

Example 2:

Input: S = "2-4A0r7-4k", K = 3

Output: "24-A0R-74K"

Explanation: The string S has been split into three parts, each part
has 3 characters except the first part as it could be shorter as
said above.

Note:

The length of string S will not exceed 12,000, and K is a positive

integer.
String S consists only of alphanumerical characters (a-z and/or A-Z
and/or 0-9) and dashes(-).
String S is non-empty.

------------------------------
------------------------------
Smallest Good Base
------------------------------
For an integer n, we call k>=2 a good base of n, if all digits of n
base k are 1.
Now given a string representing n, you should return the smallest
good base of n in string format.
Example 1:

Input: "13"
Output: "3"
Explanation: 13 base 3 is 111.

Example 2:

Input: "4681"
Output: "8"
Explanation: 4681 base 8 is 11111.

Example 3:

Input: "1000000000000000000"
Output: "999999999999999999"
Explanation: 1000000000000000000 base 999999999999999999 is 11.

Note:

The range of n is [3, 10^18].

The string representing n is always valid and will not have leading
zeros.

------------------------------
------------------------------
------------------------------
Max Consecutive Ones
------------------------------
Given a binary array, find the maximum number of consecutive 1s in
this array.

Example 1:

Input: [1,1,0,1,1,1]
Output: 3
Explanation: The first two digits or the last three digits are
consecutive 1s.
The maximum number of consecutive 1s is 3.

Note:

The input array will only contain 0 and 1.

The length of input array is a positive integer and will not exceed
10,000

------------------------------
------------------------------
Predict the Winner
------------------------------
Given an array of scores that are non-negative integers. Player 1
picks one of the numbers from either end of the array followed by
the player 2 and then player 1 and so on. Each time a player picks a
number, that number will not be available for the next player. This
continues until all the scores have been chosen. The player with the
maximum score wins.

Given an array of scores, predict whether player 1 is the winner.

You can assume each player plays to maximize his score.

Example 1:

Input: [1, 5, 2]
Output: False
Explanation: Initially, player 1 can choose between 1 and 2. If he
chooses 2 (or 1), then player 2 can choose from 1 (or 2) and 5. If
player 2 chooses 5, then player 1 will be left with 1 (or 2). So,
final score of player 1 is 1 + 2 = 3, and player 2 is 5. Hence,
player 1 will never be the winner and you need to return False.

Example 2:

Input: [1, 5, 233, 7]

Output: True
Explanation: Player 1 first chooses 1. Then player 2 have to choose
between 5 and 7. No matter which number player 2 choose, player 1
can choose 233.Finally, player 1 has more score (234) than player 2
(12), so you need to return True representing player1 can win.

Note:

1 <= length of the array <= 20.

Any scores in the given array are non-negative integers and will not
exceed 10,000,000.
If the scores of both players are equal, then player 1 is still the
winner.

------------------------------
------------------------------
------------------------------
Zuma Game
------------------------------
Think about Zuma Game. You have a row of balls on the table, colored
red(R), yellow(Y), blue(B), green(G), and white(W). You also have
several balls in your hand.

Each time, you may choose a ball in your hand, and insert it into
the row (including the leftmost place and rightmost place). Then, if
there is a group of 3 or more balls in the same color touching,
remove these balls. Keep doing this until no more balls can be
removed.

Find the minimal balls you have to insert to remove all the balls on
the table. If you cannot remove all the balls, output -1.

Examples:
Input: "WRRBBW", "RB"
Output: -1
Explanation: WRRBBW -> WRR[R]BBW -> WBBW -> WBB[B]W -> WW

Input: "WWRRBBWW", "WRBRW"

Output: 2
Explanation: WWRRBBWW -> WWRR[R]BBWW -> WWBBWW -> WWBB[B]WW -> WWWW
-> empty

Input:"G", "GGGGG"
Output: 2
Explanation: G -> G[G] -> GG[G] -> empty

Input: "RBYYBBRRB", "YRBGB"

Output: 3
Explanation: RBYYBBRRB -> RBYY[Y]BBRRB -> RBBBRRB -> RRRB -> B ->
B[B] -> BB[B] -> empty

Note:

You may assume that the initial row of balls on the table won’t have
any 3 or more consecutive balls with the same color.
The number of balls on the table won't exceed 20, and the string
represents these balls is called "board" in the input.
The number of balls in your hand won't exceed 5, and the string
represents these balls is called "hand" in the input.
Both input strings will be non-empty and only contain characters
'R','Y','B','G','W'.

------------------------------
------------------------------
------------------------------
Increasing Subsequences
------------------------------

Given an integer array, your task is to find all the different

possible increasing subsequences of the given array, and the length
of an increasing subsequence should be at least 2 .

Example:

Input: [4, 6, 7, 7]
Output: [[4, 6], [4, 7], [4, 6, 7], [4, 6, 7, 7], [6, 7], [6, 7, 7],
[7,7], [4,7,7]]

Note:

The length of the given array will not exceed 15.

The range of integer in the given array is [-100,100].
The given array may contain duplicates, and two equal integers
should also be considered as a special case of increasing sequence.

------------------------------
------------------------------
Construct the Rectangle
------------------------------

For a web developer, it is very important to know how to design a

web page's size. So, given a specific rectangular web page’s area,
your job by now is to design a rectangular web page, whose length L
and width W satisfy the following requirements:
1. The area of the rectangular web page you designed must equal to
the given target area.
2. The width W should not be larger than the length L, which means L
>= W.
3. The difference between length L and width W should be as small as
possible.

You need to output the length L and the width W of the web page you
designed in sequence.

Example:

Input: 4
Output: [2, 2]
Explanation: The target area is 4, and all the possible ways to
construct it are [1,4], [2,2], [4,1].
But according to requirement 2, [1,4] is illegal; according to
requirement 3, [4,1] is not optimal compared to [2,2]. So the
length L is 2, and the width W is 2.

Note:
The given area won't exceed 10,000,000 and is a positive integer
The web page's width and length you designed must be positive
integers.

------------------------------
------------------------------
Reverse Pairs
------------------------------
Given an array nums, we call (i, j) an important reverse pair if i
&lt; j and nums[i] &gt; 2*nums[j].

You need to return the number of important reverse pairs in the

given array.

Example1:

Input: [1,3,2,3,1]
Output: 2

Example2:

Input: [2,4,3,5,1]
Output: 3

Note:

The length of the given array will not exceed 50,000.

All the numbers in the input array are in the range of 32-bit
integer.

------------------------------
------------------------------
Target Sum
------------------------------

You are given a list of non-negative integers, a1, a2, ..., an, and
a target, S. Now you have 2 symbols + and -. For each integer, you
should choose one from + and - as its new symbol.

Find out how many ways to assign symbols to make sum of integers
equal to target S.

Example 1:

Input: nums is [1, 1, 1, 1, 1], S is 3.

Output: 5
Explanation:
-1+1+1+1+1 = 3
+1-1+1+1+1 = 3
+1+1-1+1+1 = 3
+1+1+1-1+1 = 3
+1+1+1+1-1 = 3

There are 5 ways to assign symbols to make the sum of nums be target
3.

Note:

The length of the given array is positive and will not exceed 20.
The sum of elements in the given array will not exceed 1000.
Your output answer is guaranteed to be fitted in a 32-bit integer.

------------------------------
------------------------------
Teemo Attacking
------------------------------

In LLP world, there is a hero called Teemo and his attacking can
make his enemy Ashe be in poisoned condition. Now, given the Teemo's
attacking ascending time series towards Ashe and the poisoning time
duration per Teemo's attacking, you need to output the total time
that Ashe is in poisoned condition.

You may assume that Teemo attacks at the very beginning of a

specific time point, and makes Ashe be in poisoned condition
immediately.

Example 1:

Input: [1,4], 2
Output: 4
Explanation: At time point 1, Teemo starts attacking Ashe and makes
Ashe be poisoned immediately. This poisoned status will last 2
seconds until the end of time point 2. And at time point 4, Teemo
attacks Ashe again, and causes Ashe to be in poisoned status for
another 2 seconds. So you finally need to output 4.

Example 2:

Input: [1,2], 2
Output: 3
Explanation: At time point 1, Teemo starts attacking Ashe and makes
Ashe be poisoned. This poisoned status will last 2 seconds until the
end of time point 2. However, at the beginning of time point 2,
Teemo attacks Ashe again who is already in poisoned status. Since
the poisoned status won't add up together, though the second
poisoning attack will still work at time point 2, it will stop at
the end of time point 3. So you finally need to output 3.

Note:

You may assume the length of given time series array won't exceed
10000.
You may assume the numbers in the Teemo's attacking time series and
his poisoning time duration per attacking are non-negative integers,
which won't exceed 10,000,000.

------------------------------
------------------------------
Next Greater Element I
------------------------------

You are given two arrays (without duplicates) nums1 and nums2 where
nums1’s elements are subset of nums2. Find all the next greater
numbers for nums1's elements in the corresponding places of nums2.

The Next Greater Number of a number x in nums1 is the first greater

number to its right in nums2. If it does not exist, output -1 for
this number.

Example 1:

Input: nums1 = [4,1,2], nums2 = [1,3,4,2].

Output: [-1,3,-1]
Explanation:
For number 4 in the first array, you cannot find the next
greater number for it in the second array, so output -1.
For number 1 in the first array, the next greater number for it
in the second array is 3.
For number 2 in the first array, there is no next greater number
for it in the second array, so output -1.

Example 2:

Input: nums1 = [2,4], nums2 = [1,2,3,4].

Output: [3,-1]
Explanation:
For number 2 in the first array, the next greater number for it
in the second array is 3.
For number 4 in the first array, there is no next greater number
for it in the second array, so output -1.

Note:

All elements in nums1 and nums2 are unique.

The length of both nums1 and nums2 would not exceed 1000.

------------------------------
------------------------------
Diagonal Traverse
------------------------------

Given a matrix of M x N elements (M rows, N columns), return all

elements of the matrix in diagonal order as shown in the below
image.

Example:

Input:
[
[ 1, 2, 3 ],
[ 4, 5, 6 ],
[ 7, 8, 9 ]
]
Output: [1,2,4,7,5,3,6,8,9]
Explanation:

Note:

The total number of elements of the given matrix will not exceed
10,000.

------------------------------
------------------------------
------------------------------
Keyboard Row
------------------------------
Given a List of words, return the words that can be typed using
letters of alphabet on only one row's of American keyboard like the
image below.
Example 1:

Input: ["Hello", "Alaska", "Dad", "Peace"]

Output: ["Alaska", "Dad"]

Note:

You may use one character in the keyboard more than once.
You may assume the input string will only contain letters of
alphabet.

------------------------------
------------------------------
Find Mode in Binary Search Tree
------------------------------
Given a binary search tree (BST) with duplicates, find all the
mode(s) (the most frequently occurred element) in the given BST.

Assume a BST is defined as follows:

The left subtree of a node contains only nodes with keys less than
or equal to the node's key.
The right subtree of a node contains only nodes with keys greater
than or equal to the node's key.
Both the left and right subtrees must also be binary search trees.

For example:
Given BST [1,null,2,2],

1
\
2
/
2

return [2].

Note:
If a tree has more than one mode, you can return them in any order.
Follow up:
Could you do that without using any extra space? (Assume that the
implicit stack space incurred due to recursion does not count).

------------------------------
------------------------------
IPO
------------------------------

Suppose LeetCode will start its IPO soon. In order to sell a good
price of its shares to Venture Capital, LeetCode would like to work
on some projects to increase its capital before the IPO. Since it
has limited resources, it can only finish at most k distinct
projects before the IPO. Help LeetCode design the best way to
maximize its total capital after finishing at most k distinct
projects.

You are given several projects. For each project i, it has a pure
profit Pi and a minimum capital of Ci is needed to start the
corresponding project. Initially, you have W capital. When you
finish a project, you will obtain its pure profit and the profit
will be added to your total capital.

To sum up, pick a list of at most k distinct projects from given

projects to maximize your final capital, and output your final
maximized capital.

Example 1:

Input: k=2, W=0, Profits=[1,2,3], Capital=[0,1,1].

Output: 4

Explanation: Since your initial capital is 0, you can only start the
project indexed 0.
After finishing it you will obtain profit 1 and your
capital becomes 1.
With capital 1, you can either start the project
indexed 1 or the project indexed 2.
Since you can choose at most 2 projects, you need to
finish the project indexed 2 to get the maximum capital.
Therefore, output the final maximized capital, which is
0 + 1 + 3 = 4.

Note:
You may assume all numbers in the input are non-negative integers.
The length of Profits array and Capital array will not exceed
50,000.
The answer is guaranteed to fit in a 32-bit signed integer.

------------------------------
------------------------------
Next Greater Element II
------------------------------

Given a circular array (the next element of the last element is the
first element of the array), print the Next Greater Number for every
element. The Next Greater Number of a number x is the first greater
number to its traversing-order next in the array, which means you
could search circularly to find its next greater number. If it
doesn't exist, output -1 for this number.

Example 1:

Input: [1,2,1]
Output: [2,-1,2]
Explanation: The first 1's next greater number is 2; The number 2
can't find next greater number; The second 1's next greater number
needs to search circularly, which is also 2.

Note:
The length of given array won't exceed 10000.

------------------------------
------------------------------
Base 7
------------------------------
Given an integer, return its base 7 string representation.

Example 1:

Input: 100
Output: "202"

Example 2:

Input: -7
Output: "-10"

Note:
The input will be in range of [-1e7, 1e7].
------------------------------
------------------------------
------------------------------
Relative Ranks
------------------------------

Given scores of N athletes, find their relative ranks and the people
with the top three highest scores, who will be awarded medals: "Gold
Medal", "Silver Medal" and "Bronze Medal".

Example 1:

Input: [5, 4, 3, 2, 1]
Output: ["Gold Medal", "Silver Medal", "Bronze Medal", "4", "5"]
Explanation: The first three athletes got the top three highest
scores, so they got "Gold Medal", "Silver Medal" and "Bronze Medal".
For the left two athletes, you just need to output their relative
ranks according to their scores.

Note:

N is a positive integer and won't exceed 10,000.

All the scores of athletes are guaranteed to be unique.

------------------------------
------------------------------
Perfect Number
------------------------------
We define the Perfect Number is a positive integer that is equal to
the sum of all its positive divisors except itself.

Now, given an integer n, write a function that returns true when it

is a perfect number and false when it is not.

Example:

Input: 28
Output: True
Explanation: 28 = 1 + 2 + 4 + 7 + 14

Note:
The input number n will not exceed 100,000,000. (1e8)

------------------------------
------------------------------
Most Frequent Subtree Sum
------------------------------
Given the root of a tree, you are asked to find the most frequent
subtree sum. The subtree sum of a node is defined as the sum of all
the node values formed by the subtree rooted at that node (including
the node itself). So what is the most frequent subtree sum value? If
there is a tie, return all the values with the highest frequency in
any order.

Examples 1
Input:

5
/ \
2 -3

return [2, -3, 4], since all the values happen only once, return all
of them in any order.

Examples 2
Input:

5
/ \
2 -5

return [2], since 2 happens twice, however -5 only occur once.

Note:
You may assume the sum of values in any subtree is in the range of
32-bit signed integer.

------------------------------
------------------------------
Find Bottom Left Tree Value
------------------------------

Given a binary tree, find the leftmost value in the last row of the
tree.

Example 1:

Input:

2
/ \
1 3

Output:
1
 Example 2:

Input:

1
/ \
2 3
/ / \
4 5 6
/
7

Output:
7

Note:
You may assume the tree (i.e., the given root node) is not NULL.

------------------------------
------------------------------
Freedom Trail
------------------------------

In the video game Fallout 4, the quest "Road to Freedom" requires

players to reach a metal dial called the "Freedom Trail Ring", and
use the dial to spell a specific keyword in order to open the door.

Given a string ring, which represents the code engraved on the outer
ring and another string key, which represents the keyword needs to
be spelled. You need to find the minimum number of steps in order to
spell all the characters in the keyword.

Initially, the first character of the ring is aligned at 12:00

direction. You need to spell all the characters in the string key
one by one by rotating the ring clockwise or anticlockwise to make
each character of the string key aligned at 12:00 direction and then
by pressing the center button.

At the stage of rotating the ring to spell the key character key[i]:

You can rotate the ring clockwise or anticlockwise one place, which
counts as 1 step. The final purpose of the rotation is to align one
of the string ring's characters at the 12:00 direction, where this
character must equal to the character key[i].

If the character key[i] has been aligned at the 12:00 direction, you
need to press the center button to spell, which also counts as 1
step. After the pressing, you could begin to spell the next
character in the key (next stage), otherwise, you've finished all
the spelling.

Example:

Input: ring = "godding", key = "gd"

Output: 4
Explanation: For the first key character 'g', since it is already in
place, we just need 1 step to spell this character. For the second
key character 'd', we need to rotate the ring "godding"
anticlockwise by two steps to make it become "ddinggo". Also, we
need 1 more step for spelling. So the final output is 4.

Note:

Length of both ring and key will be in range 1 to 100.

There are only lowercase letters in both strings and might be some
duplcate characters in both strings.
It's guaranteed that string key could always be spelled by rotating
the string ring.

------------------------------
------------------------------
Find Largest Value in Each Tree Row
------------------------------
You need to find the largest value in each row of a binary tree.

Example:

Input:

1
/ \
3 2
/ \ \
5 3 9

Output: [1, 3, 9]

------------------------------
------------------------------
Longest Palindromic Subsequence
------------------------------

Given a string s, find the longest palindromic subsequence's length

in s. You may assume that the maximum length of s is 1000.

Example 1:
Input:

"bbbab"

Output:

One possible longest palindromic subsequence is "bbbb".

Example 2:
Input:

"cbbd"

Output:

One possible longest palindromic subsequence is "bb".

------------------------------
------------------------------
Super Washing Machines
------------------------------
You have n super washing machines on a line. Initially, each washing
machine has some dresses or is empty.

For each move, you could choose any m (1 ≤ m ≤ n) washing machines,

and pass one dress of each washing machine to one of its adjacent
washing machines at the same time .

Given an integer array representing the number of dresses in each

washing machine from left to right on the line, you should find the
minimum number of moves to make all the washing machines have the
same number of dresses. If it is not possible to do it, return -1.

Example1

Input: [1,0,5]

Output: 3

Explanation:
1st move: 1 0 <-- 5 => 1 1 4
2nd move: 1 <-- 1 <-- 4 => 2 1 3
3rd move: 2 1 <-- 3 => 2 2 2

Example2

Input: [0,3,0]

Output: 2

Explanation:
1st move: 0 <-- 3 0 => 1 2 0
2nd move: 1 2 --> 0 => 1 1 1

Example3

Input: [0,2,0]

Output: -1

Explanation:
It's impossible to make all the three washing machines have the same
number of dresses.

Note:

The range of n is [1, 10000].

The range of dresses number in a super washing machine is [0, 1e5].

------------------------------
------------------------------
Detect Capital
------------------------------

Given a word, you need to judge whether the usage of capitals in it

is right or not.

We define the usage of capitals in a word to be right when one of

the following cases holds:

All letters in this word are capitals, like "USA".

All letters in this word are not capitals, like "leetcode".
Only the first letter in this word is capital if it has more than
one letter, like "Google".

Otherwise, we define that this word doesn't use capitals in a right

way.
Example 1:

Input: "USA"
Output: True

Example 2:

Input: "FlaG"
Output: False

Note:
The input will be a non-empty word consisting of uppercase and
lowercase latin letters.

------------------------------
------------------------------
------------------------------
Longest Uncommon Subsequence II
------------------------------

Given a list of strings, you need to find the longest uncommon

subsequence among them. The longest uncommon subsequence is defined
as the longest subsequence of one of these strings and this
subsequence should not be any subsequence of the other strings.

A subsequence is a sequence that can be derived from one sequence by

deleting some characters without changing the order of the remaining
elements. Trivially, any string is a subsequence of itself and an
empty string is a subsequence of any string.

The input will be a list of strings, and the output needs to be the
length of the longest uncommon subsequence. If the longest uncommon
subsequence doesn't exist, return -1.

Example 1:

Input: "aba", "cdc", "eae"

Output: 3

Note:
All the given strings' lengths will not exceed 10.
The length of the given list will be in the range of [2, 50].

------------------------------
------------------------------
Continuous Subarray Sum
------------------------------

Given a list of non-negative numbers and a target integer k, write a

function to check if the array has a continuous subarray of size at
least 2 that sums up to the multiple of k, that is, sums up to n*k
where n is also an integer.

Example 1:

Input: [23, 2, 4, 6, 7], k=6

Output: True
Explanation: Because [2, 4] is a continuous subarray of size 2 and
sums up to 6.

Example 2:

Input: [23, 2, 6, 4, 7], k=6

Output: True
Explanation: Because [23, 2, 6, 4, 7] is an continuous subarray of
size 5 and sums up to 42.

Note:

The length of the array won't exceed 10,000.

You may assume the sum of all the numbers is in the range of a
signed 32-bit integer.

------------------------------
------------------------------
Longest Word in Dictionary through Deleting
------------------------------

Given a string and a string dictionary, find the longest string in

the dictionary that can be formed by deleting some characters of the
given string. If there are more than one possible results, return
the longest word with the smallest lexicographical order. If there
is no possible result, return the empty string.
Example 1:

Input:
s = "abpcplea", d = ["ale","apple","monkey","plea"]

Output:
"apple"

Example 2:

Input:
s = "abpcplea", d = ["a","b","c"]

Output:
"a"

Note:

All the strings in the input will only contain lower-case letters.
The size of the dictionary won't exceed 1,000.
The length of all the strings in the input won't exceed 1,000.

------------------------------
------------------------------
Contiguous Array
------------------------------
Given a binary array, find the maximum length of a contiguous
subarray with equal number of 0 and 1.

Example 1:

Input: [0,1]
Output: 2
Explanation: [0, 1] is the longest contiguous subarray with equal
number of 0 and 1.

Example 2:

Input: [0,1,0]
Output: 2
Explanation: [0, 1] (or [1, 0]) is a longest contiguous subarray
with equal number of 0 and 1.
Note:
The length of the given binary array will not exceed 50,000.

------------------------------
------------------------------
Beautiful Arrangement
------------------------------

Suppose you have N integers from 1 to N. We define a beautiful

arrangement as an array that is constructed by these N numbers
successfully if one of the following is true for the ith position (1
≤ i ≤ N) in this array:

The number at the ith position is divisible by i.

i is divisible by the number at the ith position.

Now given N, how many beautiful arrangements can you construct?

Example 1:

Input: 2
Output: 2
Explanation:
The first beautiful arrangement is [1, 2]:
Number at the 1st position (i=1) is 1, and 1 is divisible by i
(i=1).
Number at the 2nd position (i=2) is 2, and 2 is divisible by i
(i=2).
The second beautiful arrangement is [2, 1]:
Number at the 1st position (i=1) is 2, and 2 is divisible by i
(i=1).
Number at the 2nd position (i=2) is 1, and i (i=2) is divisible by
1.

Note:

N is a positive integer and will not exceed 15.

------------------------------
------------------------------
------------------------------
Minesweeper
------------------------------
Let's play the minesweeper game (Wikipedia, online game)!

You are given a 2D char matrix representing the game board. 'M'
represents an unrevealed mine, 'E' represents an unrevealed empty
square, 'B' represents a revealed blank square that has no adjacent
(above, below, left, right, and all 4 diagonals) mines, digit ('1'
to '8') represents how many mines are adjacent to this revealed
square, and finally 'X' represents a revealed mine.

Now given the next click position (row and column indices) among all
the unrevealed squares ('M' or 'E'), return the board after
revealing this position according to the following rules:

If a mine ('M') is revealed, then the game is over - change it to

'X'.
If an empty square ('E') with no adjacent mines is revealed, then
change it to revealed blank ('B') and all of its adjacent unrevealed
squares should be revealed recursively.
If an empty square ('E') with at least one adjacent mine is
revealed, then change it to a digit ('1' to '8') representing the
number of adjacent mines.
Return the board when no more squares will be revealed.

Example 1:

Input:

[['E', 'E', 'E', 'E', 'E'],

['E', 'E', 'M', 'E', 'E'],
['E', 'E', 'E', 'E', 'E'],
['E', 'E', 'E', 'E', 'E']]

Click : [3,0]

Output:

[['B', '1', 'E', '1', 'B'],

['B', '1', 'M', '1', 'B'],
['B', '1', '1', '1', 'B'],
['B', 'B', 'B', 'B', 'B']]

Explanation:

Example 2:

Input:

[['B', '1', 'E', '1', 'B'],

['B', '1', 'M', '1', 'B'],
['B', '1', '1', '1', 'B'],
['B', 'B', 'B', 'B', 'B']]
Click : [1,2]

Output:

[['B', '1', 'E', '1', 'B'],

['B', '1', 'X', '1', 'B'],
['B', '1', '1', '1', 'B'],
['B', 'B', 'B', 'B', 'B']]

Explanation:

Note:

The range of the input matrix's height and width is [1,50].

The click position will only be an unrevealed square ('M' or 'E'),
which also means the input board contains at least one clickable
square.
The input board won't be a stage when game is over (some mines have
been revealed).
For simplicity, not mentioned rules should be ignored in this
problem. For example, you don't need to reveal all the unrevealed
mines when the game is over, consider any cases that you will win
the game or flag any squares.

------------------------------
------------------------------
Minimum Absolute Difference in BST
------------------------------
Given a binary search tree with non-negative values, find the
minimum absolute difference between values of any two nodes.

Example:

Input:

1
\
3
/
2

Output:
1

Explanation:
The minimum absolute difference is 1, which is the difference
between 2 and 1 (or between 2 and 3).

Note:
There are at least two nodes in this BST.

------------------------------
------------------------------
------------------------------
K-diff Pairs in an Array
------------------------------

Given an array of integers and an integer k, you need to find the

number of unique k-diff pairs in the array. Here a k-diff pair is
defined as an integer pair (i, j), where i and j are both numbers in
the array and their absolute difference is k.

Example 1:

Input: [3, 1, 4, 1, 5], k = 2

Output: 2
Explanation: There are two 2-diff pairs in the array, (1, 3) and (3,
5).Although we have two 1s in the input, we should only return the
number of unique pairs.

Example 2:

Input:[1, 2, 3, 4, 5], k = 1
Output: 4
Explanation: There are four 1-diff pairs in the array, (1, 2), (2,
3), (3, 4) and (4, 5).

Example 3:

Input: [1, 3, 1, 5, 4], k = 0

Output: 1
Explanation: There is one 0-diff pair in the array, (1, 1).

Note:

The pairs (i, j) and (j, i) count as the same pair.

The length of the array won't exceed 10,000.
All the integers in the given input belong to the range: [-1e7,
1e7].
------------------------------
------------------------------
------------------------------
Encode and Decode TinyURL
------------------------------
Note: This is a companion problem to the System Design problem:
Design TinyURL.

TinyURL is a URL shortening service where you enter a URL such as

https://leetcode.com/problems/design-tinyurl and it returns a short
URL such as http://tinyurl.com/4e9iAk.

Design the encode and decode methods for the TinyURL service. There
is no restriction on how your encode/decode algorithm should work.
You just need to ensure that a URL can be encoded to a tiny URL and
the tiny URL can be decoded to the original URL.
------------------------------
------------------------------
------------------------------
Complex Number Multiplication
------------------------------

Given two strings representing two complex numbers.

You need to return a string representing their multiplication. Note

i2 = -1 according to the definition.

Example 1:

Input: "1+1i", "1+1i"

Output: "0+2i"
Explanation: (1 + i) * (1 + i) = 1 + i2 + 2 * i = 2i, and you need
convert it to the form of 0+2i.

Example 2:

Input: "1+-1i", "1+-1i"

Output: "0+-2i"
Explanation: (1 - i) * (1 - i) = 1 + i2 - 2 * i = -2i, and you need
convert it to the form of 0+-2i.

Note:

The input strings will not have extra blank.

The input strings will be given in the form of a+bi, where the
integer a and b will both belong to the range of [-100, 100]. And
the output should be also in this form.

------------------------------
------------------------------
Convert BST to Greater Tree
------------------------------
Given a Binary Search Tree (BST), convert it to a Greater Tree such
that every key of the original BST is changed to the original key
plus sum of all keys greater than the original key in BST.

Example:

Input: The root of a Binary Search Tree like this:

5
/ \
2 13

Output: The root of a Greater Tree like this:

18
/ \
20 13

------------------------------
------------------------------
Minimum Time Difference
------------------------------
Given a list of 24-hour clock time points in "Hour:Minutes" format,
find the minimum minutes difference between any two time points in
the list.

Example 1:

Input: ["23:59","00:00"]
Output: 1

Note:

The number of time points in the given list is at least 2 and won't
exceed 20000.
The input time is legal and ranges from 00:00 to 23:59.

------------------------------
------------------------------
Reverse String II
------------------------------

Given a string and an integer k, you need to reverse the first k

characters for every 2k characters counting from the start of the
string. If there are less than k characters left, reverse all of
them. If there are less than 2k but greater than or equal to k
characters, then reverse the first k characters and left the other
as original.

Example:

Input: s = "abcdefg", k = 2
Output: "bacdfeg"

Restrictions:

The string consists of lower English letters only.

Length of the given string and k will in the range [1, 10000]

------------------------------
------------------------------
01 Matrix
------------------------------

Given a matrix consists of 0 and 1, find the distance of the nearest

0 for each cell.

The distance between two adjacent cells is 1.

Example 1:
Input:

0 0 0
0 1 0
0 0 0

Output:

0 0 0
0 1 0
0 0 0

Example 2:
Input:

0 0 0
0 1 0
1 1 1

Output:

0 0 0
0 1 0
1 2 1

Note:

The number of elements of the given matrix will not exceed 10,000.
There are at least one 0 in the given matrix.
The cells are adjacent in only four directions: up, down, left and
right.

------------------------------
------------------------------
Diameter of Binary Tree
------------------------------

Given a binary tree, you need to compute the length of the diameter
of the tree. The diameter of a binary tree is the length of the
longest path between any two nodes in a tree. This path may or may
not pass through the root.

Example:
Given a binary tree

1
/ \
2 3
/ \
4 5

Return 3, which is the length of the path [4,2,1,3] or [5,2,1,3].

Note:
The length of path between two nodes is represented by the number of
edges between them.

------------------------------
------------------------------
------------------------------
------------------------------
Remove Boxes
------------------------------
Given several boxes with different colors represented by different
positive numbers.
You may experience several rounds to remove boxes until there is no
box left. Each time you can choose some continuous boxes with the
same color (composed of k boxes, k >= 1), remove them and get k*k
points.
Find the maximum points you can get.

Example 1:
Input:

[1, 3, 2, 2, 2, 3, 4, 3, 1]

Output:

23

Explanation:

[1, 3, 2, 2, 2, 3, 4, 3, 1]
----> [1, 3, 3, 4, 3, 1] (3*3=9 points)
----> [1, 3, 3, 3, 1] (1*1=1 points)
----> [1, 1] (3*3=9 points)
----> [] (2*2=4 points)

Note:
The number of boxes n would not exceed 100.

------------------------------
------------------------------
Friend Circles
------------------------------

There are N students in a class. Some of them are friends, while

some are not. Their friendship is transitive in nature. For example,
if A is a direct friend of B, and B is a direct friend of C, then A
is an indirect friend of C. And we defined a friend circle is a
group of students who are direct or indirect friends.

Given a N*N matrix M representing the friend relationship between

students in the class. If M[i][j] = 1, then the ith and jth students
are direct friends with each other, otherwise not. And you have to
output the total number of friend circles among all the students.

Example 1:

Input:
[[1,1,0],
[1,1,0],
[0,0,1]]
Output: 2
Explanation:The 0th and 1st students are direct friends, so they are
in a friend circle. The 2nd student himself is in a friend circle.
So return 2.
Example 2:

Input:
[[1,1,0],
[1,1,1],
[0,1,1]]
Output: 1
Explanation:The 0th and 1st students are direct friends, the 1st and
2nd students are direct friends, so the 0th and 2nd students are
indirect friends. All of them are in the same friend circle, so
return 1.

Note:

N is in range [1,200].
M[i][i] = 1 for all students.
If M[i][j] = 1, then M[j][i] = 1.

------------------------------
------------------------------
------------------------------
Design TinyURL
------------------------------
Note: For the coding companion problem, please see: Encode and
Decode TinyURL.

How would you design a URL shortening service that is similar to

TinyURL?

Background:
TinyURL is a URL shortening service where you enter a URL such as
https://leetcode.com/problems/design-tinyurl and it returns a short
URL such as http://tinyurl.com/4e9iAk.

Requirements:

For instance, "http://tinyurl.com/4e9iAk" is the tiny url for the

page "https://leetcode.com/problems/design-tinyurl". The identifier
(the highlighted part) can be any string with 6 alphanumeric
characters containing 0-9, a-z, A-Z.

Each shortened URL must be unique; that is, no two different URLs
can be shortened to the same URL.
Note about Questions:Below are just a small subset of questions to
get you started. In real world, there could be many follow ups and
questions possible and the discussion is open-ended (No one true or
correct way to solve a problem). If you have more ideas or
questions, please ask in Discuss and we may compile it here!

Questions:

How many unique identifiers possible? Will you run out of unique
URLs?
Should the identifier be increment or not? Which is easier to
design? Pros and cons?
Mapping an identifier to an URL and its reversal - Does this problem
ring a bell to you?
How do you store the URLs? Does a simple flat file database work?
What is the bottleneck of the system? Is it read-heavy or write-
heavy?
Estimate the maximum number of URLs a single machine can store.
Estimate the maximum number of queries per second (QPS) for decoding
a shortened URL in a single machine.
How would you scale the service? For example, a viral link which is
shared in social media could result in a peak QPS at a moment's
notice.
How could you handle redundancy? i,e, if a server is down, how could
you ensure the service is still operational?
Keep URLs forever or prune, pros/cons? How we do pruning?
(Contributed by @alex_svetkin)
What API would you provide to a third-party developer? (Contributed
by @alex_svetkin)
If you can enable caching, what would you cache and what's the
expiry time? (Contributed by @Humandroid)

.hilight {
color: #d14;
background-color: #f7f7f9;
padding: 1px 3px;
border: 1px solid #e1e1e8"
}

------------------------------
------------------------------
License Key Formatting
------------------------------
Now you are given a string S, which represents a software license
key which we would like to format. The string S is composed of
alphanumerical characters and dashes. The dashes split the
alphanumerical characters within the string into groups. (i.e. if
there are M dashes, the string is split into M+1 groups). The dashes
in the given string are possibly misplaced.

We want each group of characters to be of length K (except for

possibly the first group, which could be shorter, but still must
contain at least one character). To satisfy this requirement, we
will reinsert dashes. Additionally, all the lower case letters in
the string must be converted to upper case.

So, you are given a non-empty string S, representing a license key

to format, and an integer K. And you need to return the license key
formatted according to the description above.

Example 1:

Input: S = "2-4A0r7-4k", K = 4

Output: "24A0-R74K"

Explanation: The string S has been split into two parts, each part
has 4 characters.

Example 2:

Input: S = "2-4A0r7-4k", K = 3

Output: "24-A0R-74K"

Explanation: The string S has been split into three parts, each part
has 3 characters except the first part as it could be shorter as
said above.

Note:

The length of string S will not exceed 12,000, and K is a positive

integer.
String S consists only of alphanumerical characters (a-z and/or A-Z
and/or 0-9) and dashes(-).
String S is non-empty.

------------------------------
------------------------------
Longest Absolute File Path
------------------------------
Suppose we abstract our file system by a string in the following
manner:

The string "dir\n\tsubdir1\n\tsubdir2\n\t\tfile.ext" represents:

dir
subdir1
 subdir2
file.ext

The directory dir contains an empty sub-directory subdir1 and a sub-

directory subdir2 containing a file file.ext.

The string
"dir\n\tsubdir1\n\t\tfile1.ext\n\t\tsubsubdir1\n\tsubdir2\n\t\tsubsu
bdir2\n\t\t\tfile2.ext" represents:

dir
subdir1
file1.ext
subsubdir1
subdir2
subsubdir2
file2.ext

The directory dir contains two sub-directories subdir1 and subdir2.

subdir1 contains a file file1.ext and an empty second-level sub-
directory subsubdir1. subdir2 contains a second-level sub-directory
subsubdir2 containing a file file2.ext.

We are interested in finding the longest (number of characters)

absolute path to a file within our file system. For example, in the
second example above, the longest absolute path is "dir/subdir2/
subsubdir2/file2.ext", and its length is 32 (not including the
double quotes).

Given a string representing the file system in the above format,

return the length of the longest absolute path to file in the
abstracted file system. If there is no file in the system, return 0.

Note:

The name of a file contains at least a . and an extension.

The name of a directory or sub-directory will not contain a ..

Time complexity required: O(n) where n is the size of the input

string.

Notice that a/aa/aaa/file1.txt is not the longest file path, if

there is another path aaaaaaaaaaaaaaaaaaaaa/sth.png.
------------------------------
------------------------------
Encode and Decode TinyURL
------------------------------
Note: This is a companion problem to the System Design problem:
Design TinyURL.
TinyURL is a URL shortening service where you enter a URL such as
https://leetcode.com/problems/design-tinyurl and it returns a short
URL such as http://tinyurl.com/4e9iAk.

Design the encode and decode methods for the TinyURL service. There
is no restriction on how your encode/decode algorithm should work.
You just need to ensure that a URL can be encoded to a tiny URL and
the tiny URL can be decoded to the original URL.
------------------------------
------------------------------
Coin Change 2
------------------------------

You are given coins of different denominations and a total amount of

money. Write a function to compute the number of combinations that
make up that amount. You may assume that you have infinite number of
each kind of coin.

Note:
You can assume that

0 <= amount <= 5000

1 <= coin <= 5000
the number of coins is less than 500
the answer is guaranteed to fit into signed 32-bit integer

Example 1:

Input: amount = 5, coins = [1, 2, 5]

Output: 4
Explanation: there are four ways to make up the amount:
5=5
5=2+2+1
5=2+1+1+1
5=1+1+1+1+1

Example 2:

Input: amount = 3, coins = [2]

Output: 0
Explanation: the amount of 3 cannot be made up just with coins of 2.

Example 3:

Input: amount = 10, coins = [10]

Output: 1

------------------------------
------------------------------
Poor Pigs
------------------------------

There are 1000 buckets, one and only one of them contains poison,
the rest are filled with water. They all look the same. If a pig
drinks that poison it will die within 15 minutes. What is the
minimum amount of pigs you need to figure out which bucket contains
the poison within one hour.

Answer this question, and write an algorithm for the follow-up

general case.

Follow-up:

If there are n buckets and a pig drinking poison will die within m
minutes, how many pigs (x) you need to figure out the "poison"
bucket within p minutes? There is exact one bucket with poison.

------------------------------
------------------------------
Minimum Genetic Mutation
------------------------------
A gene string can be represented by an 8-character long string, with
choices from "A", "C", "G", "T".

Suppose we need to investigate about a mutation (mutation from

"start" to "end"), where ONE mutation is defined as ONE single
character changed in the gene string.

For example, "AACCGGTT" -> "AACCGGTA" is 1 mutation.

Also, there is a given gene "bank", which records all the valid gene
mutations. A gene must be in the bank to make it a valid gene
string.

Now, given 3 things - start, end, bank, your task is to determine

what is the minimum number of mutations needed to mutate from
"start" to "end". If there is no such a mutation, return -1.

Note:

Starting point is assumed to be valid, so it might not be included

in the bank.
If multiple mutations are needed, all mutations during in the
sequence must be valid.
You may assume start and end string is not the same.
Example 1:

start: "AACCGGTT"
end: "AACCGGTA"
bank: ["AACCGGTA"]

return: 1

Example 2:

start: "AACCGGTT"
end: "AAACGGTA"
bank: ["AACCGGTA", "AACCGCTA", "AAACGGTA"]

return: 2

Example 3:

start: "AAAAACCC"
end: "AACCCCCC"
bank: ["AAAACCCC", "AAACCCCC", "AACCCCCC"]

return: 3

------------------------------
------------------------------
LFU Cache
------------------------------
Design and implement a data structure for Least Frequently Used
(LFU) cache. It should support the following operations: get and
put.

get(key) - Get the value (will always be positive) of the key if the
key exists in the cache, otherwise return -1.
put(key, value) - Set or insert the value if the key is not already
present. When the cache reaches its capacity, it should invalidate
the least frequently used item before inserting a new item. For the
purpose of this problem, when there is a tie (i.e., two or more keys
that have the same frequency), the least recently used key would be
evicted.

Follow up:
Could you do both operations in O(1) time complexity?

Example:
LFUCache cache = new LFUCache( 2 /* capacity */ );

cache.put(1, 1);
cache.put(2, 2);
cache.get(1); // returns 1
cache.put(3, 3); // evicts key 2
cache.get(2); // returns -1 (not found)
cache.get(3); // returns 3.
cache.put(4, 4); // evicts key 1.
cache.get(1); // returns -1 (not found)
cache.get(3); // returns 3
cache.get(4); // returns 4

------------------------------
------------------------------
------------------------------
Longest Palindromic Subsequence
------------------------------

Given a string s, find the longest palindromic subsequence's length

in s. You may assume that the maximum length of s is 1000.

Example 1:
Input:

"bbbab"

Output:

One possible longest palindromic subsequence is "bbbb".

Example 2:
Input:

"cbbd"

Output:

One possible longest palindromic subsequence is "bb".