Scribd Logo
Upload

Welcome to Scribd!

  • 246 views

    Breaking The Code

    Uploaded by

    Remoh Noreno
    The document provides instructions for determining the complementary DNA strand, mRNA codons, tRNA anticodons, and amino acid sequence from a given DNA sequence. It includes 4 examples where the DNA sequence is given and the reader is prompted to fill in the complementary DNA strand and resulting mRNA, tRNA, and amino acid sequences.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd

    Breaking The Code

    Uploaded by

    Remoh Noreno
    246 views4 pages
    The document provides instructions for determining the complementary DNA strand, mRNA codons, tRNA anticodons, and amino acid sequence from a given DNA sequence. It includes 4 examples where the DNA sequence is given and the reader is prompted to fill in the complementary DNA strand and resulting mRNA, tRNA, and amino acid sequences.

    Original Title

    BREAKING THE CODE

    Copyright

    © © All Rights Reserved

    Available Formats

    DOCX, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    The document provides instructions for determining the complementary DNA strand, mRNA codons, tRNA anticodons, and amino acid sequence from a given DNA sequence. It includes 4 examples where the DNA sequence is given and the reader is prompted to fill in the complementary DNA strand and resulting mRNA, tRNA, and amino acid sequences.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Download as docx, pdf, or txt
    246 views4 pages

    Breaking The Code

    Uploaded by

    Remoh Noreno
    The document provides instructions for determining the complementary DNA strand, mRNA codons, tRNA anticodons, and amino acid sequence from a given DNA sequence. It includes 4 examples where the DNA sequence is given and the reader is prompted to fill in the complementary DNA strand and resulting mRNA, tRNA, and amino acid sequences.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Download as docx, pdf, or txt
    of 4

    BREAKING THE CODE

    During DNA replication, given the DNA sequence below, write the
    sequence of the complementary strand of DNA.

    DNA molecule: TACCGGATGGCATATCAAATC


    Complementary strand: ______________________________________________________

    For the DNA molecule strand, the DNA polymerase binds at the
    promoter site during Transcription. Write the sequence of messenger
    RNA (mRNA) codons that is synthesized during transcription.

    mRNA: _________________________________________________________________________

    During translation, for each of the mRNA codon sequence above,


    determine the sequence of tRNA anticodons that match it.

    tRNA: ___________________________________________________________________________

    Using the genetic code chart, write the amino acid (polypeptide chain)
    sequence coded for the mRNA strand above.

    Polypeptide: ___________________________________________________________________
    BREAKING THE CODE

    During DNA replication, given the DNA sequence below, write the
    sequence of the complementary strand of DNA.

    DNA molecule: TACGGGGGCGTAACCACAACT


    Complementary strand: ______________________________________________________

    For the DNA molecule strand, the DNA polymerase binds at the
    promoter site during Transcription. Write the sequence of messenger
    RNA (mRNA) codons that is synthesized during transcription.

    mRNA: _________________________________________________________________________

    During translation, for each of the mRNA codon sequence above,


    determine the sequence of tRNA anticodons that match it.

    tRNA: ___________________________________________________________________________

    Using the genetic code chart, write the amino acid (polypeptide chain)
    sequence coded for the mRNA strand above.

    Polypeptide: ___________________________________________________________________
    BREAKING THE CODE

    During DNA replication, given the DNA sequence below, write the
    sequence of the complementary strand of DNA.

    DNA molecule: TACCGGATGGCATGTAAAATC


    Complementary strand: ______________________________________________________

    For the DNA molecule strand, the DNA polymerase binds at the
    promoter site during Transcription. Write the sequence of messenger
    RNA (mRNA) codons that is synthesized during transcription.

    mRNA: _________________________________________________________________________

    During translation, for each of the mRNA codon sequence above,


    determine the sequence of tRNA anticodons that match it.

    tRNA: ___________________________________________________________________________

    Using the genetic code chart, write the amino acid (polypeptide chain)
    sequence coded for the mRNA strand above.

    Polypeptide: ___________________________________________________________________
    BREAKING THE CODE

    During DNA replication, given the DNA sequence below, write the
    sequence of the complementary strand of DNA.

    DNA molecule: TACCTGTTAAGCTACAAAATT


    Complementary strand: ______________________________________________________

    For the DNA molecule strand, the DNA polymerase binds at the
    promoter site during Transcription. Write the sequence of messenger
    RNA (mRNA) codons that is synthesized during transcription.

    mRNA: _________________________________________________________________________

    During translation, for each of the mRNA codon sequence above,


    determine the sequence of tRNA anticodons that match it.

    tRNA: ___________________________________________________________________________

    Using the genetic code chart, write the amino acid (polypeptide chain)
    sequence coded for the mRNA strand above.

    Polypeptide: ___________________________________________________________________

    You might also like