0% found this document useful (0 votes)
1K views46 pages

The Needleman Wunsch Algorithm For Sequence Alignment

The Needleman-Wunsch algorithm for sequence alignment - p. / 46 Outline of the talk sequence comparison and sequence alignment. Types of sequence alignment. The scoring scheme, substitution matrices, gaps.

Uploaded by

oguztop10
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
1K views46 pages

The Needleman Wunsch Algorithm For Sequence Alignment

The Needleman-Wunsch algorithm for sequence alignment - p. / 46 Outline of the talk sequence comparison and sequence alignment. Types of sequence alignment. The scoring scheme, substitution matrices, gaps.

Uploaded by

oguztop10
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 46

The Needleman-Wunsch algorithm for

sequence alignment
7th Melbourne Bioinformatics Course
Vladimir Likić, Ph.D.
e-mail: [email protected]

Bio21 Molecular Science and Biotechnology Institute


The University of Melbourne

The Needleman-Wunsch algorithm for sequence alignment – p.1/46


Outline of the talk

Sequence comparison and sequence alignment.

Types of sequence alignment.

The scoring scheme, substitution matrices, gaps.

The Needleman-Wunsch algorithm for global sequence


alignment.

The Needleman-Wunsch algorithm for sequence alignment – p.2/46


Sequence comparison

To observe patterns of conservation (or variability).

To find the common motifs present in both sequences.

To assess whether it is likely that two sequences evolved


from the same sequence.

To find out which sequences from the database are similar


to the sequence at hand.

The Needleman-Wunsch algorithm for sequence alignment – p.3/46


Two routes for sequence comparison

dotplot – visual, qualitative

sequence alignment – exact and quantitative. Involves:


1. Construction of the best alignment between the
sequences.
2. Assessment of the similarity from the alignment.

There are three different types of sequence alignment:


Global alignment
Local alignment
Multiple sequence alignment

The Needleman-Wunsch algorithm for sequence alignment – p.4/46


Global sequence alignment

The best alignment over the entire length of two


sequences

Suitable when the two sequences are of similar length,


with a significant degree of similarity throughout.

Example:
SIMILARITY
PI-LLAR---

The Needleman-Wunsch algorithm for sequence alignment – p.5/46


Local sequence alignment

Involving stretches that are shorter than the entire


sequences, possibly more than one.

Suitable when comparing substantially different sequences,


which possibly differ significantly in length, and have only
a short patches of similarity.

For example, the local alignment of SIMILARITY and


PILLAR:
MILAR
ILLAR

The Needleman-Wunsch algorithm for sequence alignment – p.6/46


Multiple sequence alignment

Simultaneous alignment of more than two sequences.

Suitable when searching for subtle conserved sequence


patterns in a protein family, and when more than two
sequences of the protein family are available.

For example:
SIMILARITY
PI-LLAR---
--MOLARITY

The Needleman-Wunsch algorithm for sequence alignment – p.7/46


Alignment ”by eye”

Consider the ”best” alignment of ATGGCGT and ATGAGT


ATGGCGT
*** !**
ATG-AGT

Intuitively we seek an alignment to maximize the number


of residue-to-residue matches.

The Needleman-Wunsch algorithm for sequence alignment – p.8/46


A mathematical framework

Sequence alignment is the establishment of


residue-to-residue correspondence between two or more
sequences such that the order of residues in each sequence
is preserved.

A gap, which indicates a residue-to-nothing match, may


be introduced in either sequence.

A gap-to-gap match is meaningless and is not allowed.

The Needleman-Wunsch algorithm for sequence alignment – p.9/46


The scoring scheme

Give two sequences we need a number to associate with


each possible alignment (i.e. the alignment score =
goodness of alignment).

The scoring scheme is a set of rules which assigns the


alignment score to any given alignment of two sequences.
1. The scoring scheme is residue based: it consists of residue
substitution scores (i.e. score for each possible residue
alignment), plus penalties for gaps.
2. The alignment score is the sum of substitution scores and
gap penalties.

The Needleman-Wunsch algorithm for sequence alignment – p.10/46


A simple scoring scheme

Use +1 as a reward for a match, -1 as the penalty


for a mismatch, and ignore gaps

The best alignment ”by eye” from before:

ATGGCGT
ATG-AGT score: +1 + 1 + 1 + 0 − 1 + 1 + 1 = 4

An alternative alignment:

ATGGCGT
A-TGAGT score: +1 + 0 − 1 + 1 − 1 + 1 + 1 = 2

The Needleman-Wunsch algorithm for sequence alignment – p.11/46


The substitution matrix

A concise way to express the residue substitution costs can


be achieved with a N × N matrix (N is 4 for DNA and 20
for proteins).

The substitution matrix for the simple scoring scheme:

C T A G
C 1 -1 -1 -1
T -1 1 -1 -1
A -1 -1 1 -1
G -1 -1 -1 1

The Needleman-Wunsch algorithm for sequence alignment – p.12/46


A better substitution matrix

A, G are purines (pyrimidine ring fused to an imidazole


ring), T, C are pyrimidines (one six-membered ring).

Assume we believe that from evolutionary standpoint


purine/pyrimidine mutations are less likely to occur
compared to purine/purine (pyrimidine/pyrimidine)
mutations. Can we capture this in a substitution matrix?

C T A G
C 2 1 -1 -1
T 1 2 -1 -1
A -1 -1 2 1
G -1 -1 1 2
The Needleman-Wunsch algorithm for sequence alignment – p.13/46
Protein substitution matrices

Protein substitution matrices are significantly more


complex than DNA scoring matrices.

Proteins are composed of twenty amino acids, and


physico-chemical properties of individual amino acids vary
considerably.

A protein substitution matrix can be based on any property


of amino acids: size, polarity, charge, hydrophobicity.

In practice the most important are evolutionary


substitution matrices.

The Needleman-Wunsch algorithm for sequence alignment – p.14/46


Evolutionary substitution matrices

PAM (”point accepted mutation”) family


PAM250, PAM120, etc.

BLOSUM (”Blocks substitution matrix”) family


BLOSUM62, BLOSUM50, etc.

The substitution scores of both PAM and BLOSUM


matrices are derived from the analysis of known
alignments of closely related proteins.

The BLOSUM matrices are newer and considered better.

The Needleman-Wunsch algorithm for sequence alignment – p.15/46


BLOSUM62 substitution matrix

The Needleman-Wunsch algorithm for sequence alignment – p.16/46


Gaps

So far we ignored gaps (amounts to gap penalty of 0)

A gap corresponds to an insertion or a deletion of a


residue

A conventional wisdom dictates that the penalty for a gap


must be several times greater than the penalty for a
mutation. That is because a gap/extra residue
Interrupts the entire polymer chain
In DNA shifts the reading frame

The Needleman-Wunsch algorithm for sequence alignment – p.17/46


Gap initiation and extension

The conventional wisdom: the creation of a new gap


should be strongly disfavored.

However, once created insertions/deletions of chunks of


more than one residue should be much less expensive (i.e.
insertion of domains often occurs).

A simple yet effective solution is affine gap penalties:

γ(n) = −o − (n − 1)e

The Needleman-Wunsch algorithm for sequence alignment – p.18/46


Affine gaps: a physical insight

Affine gaps favor the alignment:


ATGTAGTGTATAGTACATGCA
ATGTAG-------TACATGCA
Over the alignment:
ATGTAGTGTATAGTACATGCA
ATGTA--G--TA---CATGCA

Exactly what we want from the biological viewpoint.

The Needleman-Wunsch algorithm for sequence alignment – p.19/46


The alignment score with BLOSUM62

Consider two alternative alignments of ANRGDFS and


ANREFS with the gap opening penalty of 10:
ANRGDFS
ANR-EFS score: 4 + 6 + 5 − 10 + 2 + 6 + 4 = 17
ANRGDFS
ANRE-FS score: 4 + 6 + 5 − 2 − 10 + 6 + 4 = 13

The scoring scheme provides us with the quantitative


measure of how good is some alignment relative to
alternative alignments. However the scoring scheme
does not tell us how to find the best alignment.

The Needleman-Wunsch algorithm for sequence alignment – p.20/46


How do we find the best alignment?

Brute-force approach:
Generate the list all possible alignments between two
sequences, score them
Select the alignment with the best score

The number of possible global alignments between two


sequences of length N is

22N

πN

For two sequences of 250 residues this is ∼ 10149

The Needleman-Wunsch algorithm for sequence alignment – p.21/46


The Needleman-Wunsch algorithm

A smart way to reduce the massive number of possibilities


that need to be considered, yet still guarantees that the
best solution will be found (Saul Needleman and Christian
Wunsch, 1970).

The basic idea is to build up the best alignment by using


optimal alignments of smaller subsequences.

The Needleman-Wunsch algorithm is an example of


dynamic programming, a discipline invented by Richard
Bellman (an American mathematician) in 1953!

The Needleman-Wunsch algorithm for sequence alignment – p.22/46


How does dynamic programming work?

A divide-and-conquer strategy:
Break the problem into smaller subproblems.
Solve the smaller problems optimally.
Use the sub-problem solutions to construct an optimal
solution for the original problem.

Dynamic programming can be applied only to problems


exhibiting the properties of overlapping subproblems.
Examples include
Trevelling salesman problem
Finding the best chess move

The Needleman-Wunsch algorithm for sequence alignment – p.23/46


The mathematics

A matrix D(i, j) indexed by residues of each sequence is


built recursively, such that

 D(i − 1, j − 1) + s(xi , yj )

D(i, j) = max D(i − 1, j) + g

 D(i, j − 1) + g

subject to a boundary conditions. s(i, j) is the substitution


score for residues i and j, and g is the gap penalty.

The Needleman-Wunsch algorithm for sequence alignment – p.24/46


A walk-through: an overview

We consider all possible pairs of residue from two


sequences (this gives rise to a 2D matrix representation).

We will have two matrices: the score matrix and traceback


matrix.

The Needleman-Wunsch algorithm consists of three steps:


1. Initialisation of the score matrix
2. Calculation of scores and filling the traceback matrix
3. Deducing the alignment from the traceback matrix

The Needleman-Wunsch algorithm for sequence alignment – p.25/46


Consider the simple example

The alignment of two sequences SEND and AND with the


BLOSUM62 substitution matrix and gap opening penalty
of 10 (no gap extension):

SEND
-AND score: +1
A-ND score: +3 ← the best
AN-D score: -3
AND- score: -8

The Needleman-Wunsch algorithm for sequence alignment – p.26/46


A

D
N
                                         

                              

                                         

                              

                                         

                              

                                         
                              

                                         

                              

          

          

          
S
          

          

          

          

          
E

          

          

          

          

          
N

          

          

          

          

          
D

          

C(4,1) C(4,2) C(4,3) C(4,4) C(4,5)


C(3,1) C(3,2) C(3,3) C(3,4) C(3,5)
C(2,1) C(2,2) C(2,3) C(2,4) C(2,5)
C(1,1) C(1,2) C(1,3) C(1,4) C(1,5)

          
i = 1, 2, ..., N and j = 1, 2, ..., M
S
E
N
The score and traceback matrices

The cells of the score matrix are labelled C(i, j) where

The Needleman-Wunsch algorithm for sequence alignment – p.27/46


Initialization

The first row and the first column of the score and
traceback matrices are filled during the initialization.

S E N D S E N D

0 −10 −20 −30 −40 done left left left left

A −10 up

N −20 up

D −30 up

The Needleman-Wunsch algorithm for sequence alignment – p.28/46


Scoring

The score matrix cells are filled by row starting from the
cell C(2, 2)

The score of any cell C(i, j) is the maximum of:

qdiag = C(i − 1, j − 1) + S(i, j)


qup = C(i − 1, j) + g
qlef t = C(i, j − 1) + g

where S(i, j) is the substitution score for letters i and j,


and g is the gap penalty.

The Needleman-Wunsch algorithm for sequence alignment – p.29/46


Scoring– a pictorial representation

The value of the cell C(i, j) depends only on the values of


the immediately adjacent northwest diagonal, up, and left
cells:

C(i−1,j−1) C(i−1,j)




















C(i,j−1) C(i,j)
































The Needleman-Wunsch algorithm for sequence alignment – p.30/46


The Needleman-Wunsch progression

The first step is to calculate the value of C(2, 2):

S E N D S E N D

0 −10 −20 −30 −40 done left left left left

A −10 ? up ?

N −20 up

D −30 up

The Needleman-Wunsch algorithm for sequence alignment – p.31/46


The value of C(2, 2)

The calculation for the cell C(2, 2):

qdiag = C(1, 1) + S(S, A) = 0 + 1 = 1


qup = C(1, 2) + g = −10 + (−10) = −20
qlef t = C(2, 1) + g = −10 + (−10) = −20

Where C(1, 1), C(1, 2), and C(2, 1) are read from the
score matrix, and S(S, A) is the score for the S ↔ A
taken from the BLOSUM62 matrix.

The Needleman-Wunsch algorithm for sequence alignment – p.32/46


Filling the score and traceback matrices

For the score matrix C(2, 2) = qdiag which is 1. The


corresponding cell of the traceback matrix is ”diag”:

S E N D S E N D

0 −10 −20 −30 −40 done left left left left

A −10 1 up diag

N −20 up

D −30 up

The Needleman-Wunsch algorithm for sequence alignment – p.33/46


The progression is recursive

The next step is to calculate C(2, 3):

S E N D S E N D

0 −10 −20 −30 −40 done left left left left

A −10 1 ? up diag ?

N −20 up

D −30 up

The Needleman-Wunsch algorithm for sequence alignment – p.34/46


The value of C(2, 3)

The calculation for the cell C(2, 3)

qdiag = C(1, 2) + S(E, A) = −10 + −1 = −11


qup = C(1, 3) + g = −20 + (−10) = −30
qlef t = C(2, 2) + g = 1 + (−10) = −9

Thus C(2, 3) = −9 and the corresponding cell of the


traceback matrix is ”left”.

The Needleman-Wunsch algorithm for sequence alignment – p.35/46


The final score and traceback matrices

After all cells are filled, the score and traceback matrices
are:

S E N D S E N D

0 −10 −20 −30 −40 done left left left left

A −10 1 −9 −19 −29 up diag left left left

N −20 −9 −1 −3 −13 up diag diag diag left

D −30 −19 −11 2 3 up up diag diag diag

The Needleman-Wunsch algorithm for sequence alignment – p.36/46


The traceback

Traceback = the process of deduction of the best


alignment from the traceback matrix.

The traceback always begins with the last cell to be filled


with the score, i.e. the bottom right cell.

One moves according to the traceback value written in the


cell.

There are three possible moves: diagonally (toward the


top-left corner of the matrix), up, or left.

The traceback is completed when the first, top-left cell of


the matrix is reached (”done” cell).
The Needleman-Wunsch algorithm for sequence alignment – p.37/46
The traceback path
The traceback performed on the completed traceback
matrix:
S E N D
done left left left left

A up diag left left left

N up diag diag diag left





Traceback





D


up up diag diag diag


starts here
















The Needleman-Wunsch algorithm for sequence alignment – p.38/46


The best alignment

The alignment is deduced from the values of cells along


the traceback path, by taking into account the values of
the cell in the traceback matrix:

diag – the letters from two sequences are aligned


left – a gap is introduced in the left sequence
up – a gap is introduced in the top sequence

Sequences are aligned backwards.

The Needleman-Wunsch algorithm for sequence alignment – p.39/46


The traceback step-by-step (1)

The first cell from the traceback path is ”diag” implying


that the corresponding letters are aligned:
D
D
S E N D
done left left left left

A up diag left left left

N up diag diag diag left





Traceback





D


up up diag diag diag


starts here














The Needleman-Wunsch algorithm for sequence alignment – p.40/46
The traceback step-by-step (2)

The second cell from the traceback path is also ”diag”


implying that the corresponding letters are aligned:
ND
ND
S E N D
done left left left left

A up diag left left left

N up diag diag diag left





Traceback





D


up up diag diag diag


starts here














The Needleman-Wunsch algorithm for sequence alignment – p.41/46
The traceback step-by-step (3)

The third cell from the traceback path is ”left” implying


the gap in the left sequence (i.e. we stay on the letter A
from the left sequence):
END
-ND
S E N D
done left left left left

A up diag left left left

N up diag diag diag left





Traceback





D


up up diag diag diag


starts here














The Needleman-Wunsch algorithm for sequence alignment – p.42/46
The traceback step-by-step (4)

The fourth cell from the traceback path is also ”diag”


implying that the corresponding letters are aligned. We
consider the letter A again, this time it is aligned with S:
SEND
A-ND
S E N D
done left left left left

A up diag left left left

N up diag diag diag left





Traceback





D


up up diag diag diag


starts here














The Needleman-Wunsch algorithm for sequence alignment – p.43/46
Compare with the exhaustive search

The best alignment via the Needleman-Wunsch algorithm:

SEND
A-ND

The exhaustive search:


SEND
-AND score: +1
A-ND score: +3 ← the best
AN-D score: -3
AND- score: -8

The Needleman-Wunsch algorithm for sequence alignment – p.44/46


A few observations

It was much easier to align SEND and AND by the


exhaustive search!

As we consider longer sequences the situation quickly


turns against the exhaustive search:
Two 12 residue sequences would require considering
∼ 1 million alignments.
Two 150 residue sequences would require considering
∼ 1088 alignments (∼ 1078 is the estimated number of
atoms in the Universe).

For two 150 residue sequences the Needleman-Wunsch


algorithm requires filling a 150 × 150 matrix.
The Needleman-Wunsch algorithm for sequence alignment – p.45/46
The summary

The alignment is over the entire length of two sequences:


the traceback starts from the lower right corner of the
traceback matrix, and completes in the upper left cell of
the matrix.

The Needleman-Wunsch algorithm works in the same way


regardless of the length or complexity of sequences, and
guarantees to find the best alignment.

The Needleman-Wunsch algorithm is appropriate for


finding the best alignment of two sequences which are (i)
of the similar length; (ii) similar across their entire lengths.

The Needleman-Wunsch algorithm for sequence alignment – p.46/46

You might also like