Editorial Board: Chief Editor Co-Chief Editors Associate Editors Executive Editors

CHIEF EDITOR
FRANCISC SCHNEIDER
CO-CHIEF EDITORS IOANA SISKA
CARMEN TATU
ASSOCIATE EDITORS MIHAI NECHIFOR
SORIN RIGA
EXECUTIVE EDITORS FLORINA bojin
GABRIELA TANASIE
daciana nistor
cALIN MUNTEAN

EDITORIAL BOARD
ARDELEAN AUREL (Arad) PĂUNESCU VIRGIL (Timişoara)
BADIU GHEORGHE (Constanţa) PETROIU ANA (Timişoara)
BĂDĂRĂU ANCA (Bucureşti) POPESCU LAURENŢIU (Bucureşti)
BENEDEK GYÖRGY (Szeged) RÁCZ OLIVER (Košice)
BENGA GHEORGHE (Cluj) RIGA DAN (Bucureşti)
BUNU CARMEN (Timişoara) RUSU VALERIU (Iaşi)
COCULESCU MIHAI (Bucureşti) SABĂU MARIUS (Tg. Mureş)
CUPARENCU BARBU (Oradea) SIMIONESCU MAIA (Bucureşti)
CONSTANTIN NICOLAE (Bucureşti) SIMON ZENO (Timişoara)
DUMITRU MIRCEA (Los Angeles) SAULEA I. AUREL (Chişinău)
HAULICĂ ION (Iaşi) SWYNGHEDAUW BERNARD (Paris)
MIHALAŞ GEORGETA (Timişoara) TATU FABIAN ROMULUS (Timişoara)
MUREŞAN ADRIANA (Cluj) VLAD AURELIAN (Timişoara)
NESTIANU VALERIU (Craiova) VOICU VICTOR (Bucureşti)
OPREA TUDOR (New Mexico) ZĂGREAN LEON (Bucureşti)
Accredited by CNCSIS - B category - code 240

Publication data: Fiziologia (Physiology) is issued quarterly
1. FOR SUBSCRIPTION ADDRESS
Subscription rates: Subscriptions run a full calendar year. Prices are give per
volume, surface postage included. HVB Bank TIMISOARA
Personal subscription: Romania - 65 RON, Outside RO 21 BACX 0000000218508250
Romania - 35$ (must be in the name of, billed to, and paid by an individual. Order
must be marked “personal subscription”) TIMISOARA – ROMANIA
PENTRU REVISTA
Institutional subscription: 50$ (regular rate)
„FIZIOLOGIA – PHYSIOLOGY”
Single issues and back volumes: Information on availability and prices
can be obtained through the Publisher. 2. CORRESPONDENCE SHOULD BE
Change of address: Both old and new address should be stated and send to ADDRESSED TO THE CHIEF EDITOR
the subscription source.
PROF. DR. FRANCISC SCHNEIDER
Bibliographic indices: We hope this journal will be regularly listed in
PO BOX 135
bibliographic services, including “Current Contents”. 300024 – TIMISOARA – ROMANIA
Book Reviews: Books are accepted for review by special agreement. e-mail: [email protected]
Advertising: Correspondence and rate requests should be addressed to the Editura Eurostampa
Publisher. Tel./fax: 0256-204816
ISSN 1223 – 2076
2009.19.3(63)  Fiziologia - Physiology 1

Instructions to Authors
Submission: Only original papers in English are considered indicate its number, the author’s name, and article title. Colour
and should be sent to: illustration are reproduced at the author’s expense.
Prof. dr. Francisc Schneider References: In the text identify references by Arabic figures,
Chief Editor of “Fiziologia” (in brackets), fonts size 9, Arial Narrow. Material submitted
PO Box 135 for publication but not yet accepted should be noted as
300024, TIMISOARA, ROMANIA “unpublished data” and not be included in the reference list. The
Tel./Fax: 40-256/490507 list of references should include only those publications which
are cited in the text. The references should be numbered and
Manuscripts should be submitted in triplicate sets of illustrations arranged alphabetically by the authors’ names. The surnames
(of which one is an original), typewritten doublespaced on one of the authors followed by initials should be given. There should
side of the paper, with a wide margin. be no punctuation signs other than a comma to separate the
Conditions: All manuscripts are subject to editorial review. authors. When there are more than 3 authors, the names of the
Manuscripts are received with the explicit understanding that 3 only are used, followed by “et al”. abbreviate journal names
they are not under simultaneous consideration by any other according to the Index Medicus system. (also see International
publication. Submission of an article for publication implies the Committee of Medical Journal Editors: Uniform Requirements
transfer of the copyright from the author to the publisher upon for manuscripts submitted to biomedical journals. Ann Intern
acceptance. Accepted papers become the permanent property Med 1982; 96: 766 – 771).
of “Fiziologia” (Physiology) and may not be reproduced by any Examples:
means, in whole or in part, without the written consent of the (a) Papers published in periodicals: Kauffman HF, van
publisher. It is the author’s responsibility to obtain permission to der Heide S, Beaumont F, et al: Class-apecific antibody
reproduce illustrations, tables, etc. from other publications. determination against Aspergillus fumigatus by mean of the
Arrangement: enzyme-linked immunosorbent assay. III. Comparative study:
Title page: The first of each paper should indicate the title (main IgG, IgA, IgM, ELISA titers, precipitating antibodies and IGE
title underlined), the authors’ names, and the institute where biding after fractionation of the antigen. Int Arch Allergy Appl
the work was conducted. A short title for use as running head Immunol 1986; 80: 300 – 306.
is also required. (b) Monographs; Matthews DE, Farewell VT: Using and
Keywords: for indexing purposes, a list of 3-10 keywords in Understanding Medical Statistics. Basel, Karger, 1985.
English and Romanian is essential. (c) Edited books: Hardy WD Jr, Essex M: FeLV-inducted feline
Abstract: Each paper needs abstract and title in Romanian and acquired immune deficiency syndrome: A model for human AIDS; in
English language, fonts size 9, Arial Narrow. Klein E(ed): Acquired Immunodeficiency Syndrome. Prog Allergy,
Bady text: fonts size 10, Arial Narrow. Busel, Karger, 1986, vol 37, 353 – 376.
Small type: Paragraphs which can or must be set in smaller type Full address: The exact postal address complete with postal
(case histories, test methods, etc.) should be indicated with a code of the senior author must be given; if correspondence is
„p” (petit) in the margin on the left-hand side. handled by someone else, indicate this accordingly. Add the
Footnotes: Avoid footnotes. When essential, they are numbered E-mail address if possible.
consecutively and typed at the foot of the appropriate page, fonts Page charges: There is no page charge for papers of 4 or fewer
size 8, Arial Narrow. printed pages (including tables, illustrations and references).
Tables and illustrations: Tables (numbered in Roman Galley proofs: unless indicated otherwise, galley proofs are
numerals) and illustrations (numbered in Arabic numerals) should sent to the first-named author and should be returned with the
be prepared on separate sheets, fonts size 9, Arial Narrow. least possible delay. Alternations made in galley proofs, other
Tables require a heading, and figures a legend, also prepared on than the corrections of printer’s errors, are charged to the author.
a separate sheet. For the reproduction of illustrations, only good No page proofs are supplied.
drawings and original photographs can be accepted; negatives Reprints: Order forms and a price list are sent with the galley
or photocopies cannot be used. When possible, group several proofs. Orders submitted after the issue is printed are subject
illustrations on one block for reproduction (max. size 140x188 to considerably higher prices. Allow five weeks from date of
mm) or provide crop marks. On the back of each illustration publication for delivery of reprints.
2 Fiziologia - Physiology  2009.19.3(63)

CONTENTS
1. Review - New Approaches to Adaptation.........................................................................................................................................................4
Petru Derevenco
2. Mechanisms Involved in Mesenchymal Stem Cells Differentiation towards the Epithelial Lineage. Effects of Chemical Inductors........................7
Gabriela Tanasie, Florina Bojin, C.A. Tatu, Oana Gavriliuc, Carmen Tatu, Daciana Nistor, Hortensia Ionita, Carmen Bunu, V. Paunescu
3. Ontogenetic Changes of Bone Mineral Composition.......................................................................................................................................13
Olga Tagadiuc, V. Gudumac, V. Reva
4. Glutathione Peroxidase Activity Affects Prognosis in non-ST Segment Elevation Acute Coronary Syndrome.....................................................16
Violeta Sapira, Elvira Craiu, Cecilia Adumitresi
5. The Involvement of Oxidative Stress in the Ulcerous Pathology Induced in Rats by Aspirin...............................................................................20
Simona Martura, Doina Daicoviciu, Soimita Suciu, Adriana Muresan, Doinita Crisan , Petru A. Mircea, Simona Valean
6. Variations of some Saliva Markers of the Oxidative Stress in Patients with Orthodontic Appliances..................................................................26
Olteanu C, Muresan A, Daicoviciu D, Tarmure V, Olteanu I
7. Consumption of Calorigenic Foods in Adolescence..........................................................................................................................................30
Oana Suciu, Brigitha Vlaicu
8. Molecular Changes in Precancerous Lesions of the Larynx..............................................................................................................................33
Raluca Horhat, Delia Horhat, Marioara Poenaru, Stan Cotulbea, Nicolae Balica, Valeria Mocanu
9. The Hypolipemiant Effect of High Doses Atorvastatin Therapy in Diabetic Patients with Acute Myocardial Infarction.......................................37
Adriana S Potra, Virgil M Luca, Constantin O Luca
10. Urban Noise Assessment in Timisoara..........................................................................................................................................................40
Ernest Putnoky
CUPRINS
1. Review - Noi abordari in adaptologie..............................................................................................................................................................4
Petru Derevenco
2. Mecanisme implicate in diferentierea celulelor stem mezenchimale spre linia epiteliala. Efectul unor inductori chimici....................................7
Gabriela Tanasie, Florina Bojin, C.A. Tatu, Oana Gavriliuc, Carmen Tatu, Daciana Nistor, Hortensia Ionita, Carmen Bunu, V. Paunescu
3. Modificari ontogenetice in compozitia osoasa minerala.................................................................................................................................13
Olga Tagadiuc, V. Gudumac, V. Reva
4. Activitatea glutation peroxidazei afecteaza prognosticul in sindromul coronarian acut fara supradenivelare de segment ST...........................16
Violeta Sapira, Elvira Craiu, Cecilia Adumitresi
5. Implicarea stresului oxidativ in patologia ulceroasa indusa de aspirina la sobolani.........................................................................................20
Simona Martura, Doina Daicoviciu, Soimita Suciu, Adriana Muresan, Doinita Crisan , Petru A. Mircea, Simona Valean
6. Variaţii ale unor markeri salivari ai stresului oxidativ la pacienţii purtători de aparate ortodontice.................................................................26
Olteanu C., Muresan A., Daicoviciu D., Tarmure V., Olteanu I.
7. Consumul de alimente calorigene în adolescenţă..........................................................................................................................................30
Oana Suciu , Brigitha Vlaicu
8. Alterari Moleculare In Leziunile Precanceroase Laringiene............................................................................................................................33
Raluca Horhat, Delia Horhat, Marioara Poenaru, Stan Cotulbea, Nicolae Balica, Valeria Mocanu
9. Efectul hipolipemiant al dozelor crescute de Atorvastatin la pacientii diabetici cu infarct miocardic acut.........................................................37
Adriana S. Potra, Virgil M. Luca, Constantin O. Luca
10. Evaluarea zgomotului urban in municipiul Timisoara...................................................................................................................................40
Ernest Putnoky

review
NEW APPROACHES TO ADAPTATION

PETRU DEREVENCO
Academy of Medical Sciences, Branch of Cluj, Romania
ABSTRACT
This topic has been widely explored from the adaptation by natural selection (Darwin) to the general adaptation syndrome (Selye). This paper is focused on
nowadays issues of the research on adaptation linked to stress. Allostasis is an oscillatory stabilization which allows the adjustment to various states. “Allostatic
load” is the cumulative cost ongoing to repeated cycles of adaptation by physiological responses to stress and to possible adverse effects. “Psychological resil-
ience”, a component of positive adaptation during stress, represents the capacity to take on a traumatic event leading to disturbances and the subject’s ability
to offer protection against future challenges. Has been proved the importance of “posttraumatic growth and of thriving” – after psycho traumas; it explains
way a large proportion of subjects submitted to adverse events recover fast. “Maladaptation” leads to PTSD and to other stress-syndromes which comprise
psychoneurological, immunological, occupational and endocrine mechanisms. In contrast to the chronic or severe stress, a light or moderate stress named
eustress has positive stimulating issues, related especially to the secretion of endorphins. Is in progress the foundation of adaptology which integrates the
structural, functional and biopsychosocial sides of adaptation. In Romania, adaptology is promoted by several publications. We mention two books: “Human
adaptation” (Badiu & Papari, 1999) and “Stressology, adaptology and mental health” (S. Riga & D. Riga, 2008).
Key words: allostasis, resilience, posttraumatic growth, stress-syndromes, eustress, adaptology
INTRODUCTION Allostasis has a wider implication in the regulator mechanisms of the

The topic of adaptology is very large. organism, such as homeostasis (3) and can be even used instead of the term
The first scientific account belongs to the Lamarckian concept of the inheritance “stress”. Allostatic adaptive systems have much broader boundaries than
of acquired traits. The main crucial advance has been performed by Darwin with his homeostasis. They enable to respond to many physiological states: awake,
theory of evolution by natural selection, developed later by neodarwinism. asleep, standing, exercising, isolation, hunger, extreme temperatures, danger,
Selye’s general adaptation syndrome is a seminal contribution to the links microbial infections (19).
between stress and adaptation. “Allostatic load”is the cumulative cost to cover repeated adaptive cycles of allostasis,
The above mentioned historical steps covered to explore adaptive processes experienced by the body as well as the turning on as shutting off of the neuroendocrine,
can not be detailed in this paper; its aim is to discuss only the present-day directions systemic, and behavioral or by positive or sometimes negative events (22).
dealing with the relationships between adaptation and various aspects of stress. Examples of allostatic loads are the adverse effects of job strain on the
Further on will be underlined six main dimensions of this area of interest. cardiovascular system and the inhibition of cellular immunity resulting from
chronic stress.
“Allostatic support” refers to mechanisms that confer resistance to individuals
ALLOSTASIS making them more robust to various kinds of stress and chronic illness.
The term “allostasis”has been introduced by Sterling & Eyer (28). Its definition The above described theoretical information is illustrated in Figure 1.
and peculiarities have been outlined by Mc Ewen (19-21).
Mc Ewen & Seeman (22) and Sterling (27) published comprehensive papers
dealing with principles of allostasis, pathophysiology, therapeutic aspects and
the links to stress.
Complementary information is given by Mc Ewen & Wingfield (23) and in
Wikipedia (35). Are proposed two forms of allostatic load resulting in different
responses: type 1 allostatic overload found especially among animals when energy
demand exceeds supply, and type 2 when allostatic overload occurs when there is
sufficient or even excess energy consumption accompanied by social conflicts or
dysfunctions; this type present particularly in human society.
Allostasis means maintaining stability through change.This notion has been applied
to the adjustment of the cardiovascular system, but can be used to explain other physi- Fig. 1. The stress response and development of allostatic load (19)
ological processes of the body, such as secretion of cortisol or catecholamine (22).
Received August 2009. Accepted September 2009. Address for correspondence: Prof. Petru Derevenco, Academy of Medical Sciences, Branch of Cluj, Romania

Mc Ewen (13) described four types of physiological response to an allostatic c. Life-philosophy with shifts in an existential perspective.
load: a. normal oscillatory responses over time; b. lack of adaptation with dis- Tedescky et al. (31) have designed a PTG inventory measuring the positive
turbed oscillations; c. prolonged response without recovery; d. inadequate low reactions of traumas. In Romania, Kallay (16, 17) has studied systematically this
responses. topic.
Physiological and pathophysiological effects of allostasis involve the action of Posttraumatic growth explains why large proportion of subjects submitted
glucocorticoids (GC) through intracellular, protoplasmatic steroid receptors and of to adverse events recovers successfully and fast returning to their pre-trauma
catecholamines (CA) via membrane receptors and the second-messenger system. functioning. Most important is the fact that sometimes the initial functional level
As well GC and CA act finally at the cell nucleus. is even raised. The psychological background of these positive reactions implies the
intervention of meaning making. For details see Kallay & Miclea (18).
PSYCHOLOGICAL RESILIENCE
This psychological dimension represents the capacity to take on a traumatic MALADAPTATION AND STRESS-SYNDROMES
event which could lead to functional disturbances and even to psychiatric conditions Maladaptation leads to various stress-syndromes.
and to recover successfully. This topic has been developed in the last decades in several directions.
Resilience implies good outcomes regardless of high-risks status, constant Horowitz (13, 15) has explored systematically the clinical significance of
competition under stress, and efficient coping mechanisms. The negative effects traumatic reactions, designed an event scale and elaborated a theory of traumatic
of adverse life situations depend on the vulnerability of subjects which in stressful reactions based on a social-cognitive approach.
situations can be directed as well to pessimistic as to optimistic behaviors. A comprehensive book is devoted to the treatment of stress response syn-
This dynamic process has been firstly described by Emmy Werner (34) on dromes (14). Other Horowitz’s contributions are reported by Kallay (16).
Taiwanese children, which grew up in very bad conditions. The results showed The neuro-endocrine mechanisms of the stress-syndrome have been studied
that one third of these youngsters did not exhibit destructive behaviors; this fact is extensively by Chrousos (6, 7), the occupational outcomes by Theorell (33), and the
explained by Werner by their resilience. endocrine syndromes by Coculescu (3).
In 1980’s this research topic emerged from observations on children of The other directions of this topic deal with the cardiovascular stress-syndrome
schizophrenic mothers. (for instance Tako-Tsubo syndrome) and with stress-syndromes described in exercise
Later, the resilience concept has been developed by Bonnano (2) in the USA (overtraining, female athlete triad). The literature on the theories, models and
and Cyrulnik (9) in France. Further details can be found in Wikipedia (36). peculiarities of posttraumatic stress reactions is very wide. For details see Kallay
(16) and Derevenco (10-12).
POSTTRAUMATIC GROWTH
The negative reactions to psycho traumas and extreme events (grief, torture, EUSTRESS
natural catastrophes, etc.) have been widely explored and categorized in DSM and In contrast to the familiar terms distress and strain, eustress is less used in
ICD (see also the following section). the stress topic.
The possible/potential responses to trauma are outlined in Figure 2. Eustress, aiming a light or moderate stress with positive stimulating issues, has
been introduced by Selye and mentioned in his later writings (26). His expression
“stress is the salt of life” belongs probably to eustress.
Eustress implies the secretion of endorphins and of other neuromediators
including likely serotonin. The exercise-dependence of some athletes is probably
related to the euphoric state produced by moderate exercise and social environ-
mental factors.
Eustress represents a basis of the stress-inoculation method with preventive
and curative effects.
ADAPTOLOGY
At present is in progress the foundation and promotion of adaptology, a new,
distinct discipline which integrates the structural, functional and biopsychosocial
components of adaptology.
Fig. 2. Potential responses to trauma (O’Leary & Ickovics) (5)
This area of interest deserves to be explored in details elsewhere.
For the time being, we mention some contributions of the Romanian scientists.
An adverse event can induce four main consequences shown in Fig. 2. A pioneer of studies on adaptation is Schneider (25). He organized also a first
The thriving reaction has been studied especially in USA by Carver (5), Calhoun meeting devoted to adaptology – topic of the 15th national Conference of Physiol-
& Tedescky (4), Tedescky & Calhoun (29, 30), who proposed a model of posttrau- ogy, being author/coauthor of 16 works aiming adaptation. Recently, he has been
matic growth (PTG). Tedescky et al. (31) identified three main dimensions of PTG: published 2 comprehensive volumes.
a. Friendly and altruistic interpersonal relationships; The authors of the first book (“Human adaptation”) are Badiu & Papari (1). This
b. Self-perception with better acceptance of limitations of the self; book comprises four parts including 21 chapters. Part I, general adaptology, Part

II, ontogenetic adaptology, Part III, environmental adaptology, Part IV, adaptology Aronson, 1976. (4th ed.) 2001.
and physical exercise. 14. Horowitz M. Treatment of stress response syndromes. Wash-
ington, London American Psychiatric Pub. 2003.
The second valuable volume signed by S. Riga & D. Riga is entitled 15. Horowitz M, Field N, Classen C. Stress response syndrome and
“Stressology, adptology and mental health”(24). The section adaptology comprises their treatment in L. Goldberger, S. Breznitz (eds.). Handbook of
five chapters: 1. adaptation, coping maladaptation, troubles of adaptation; 2. stress (2nd Ed.) New York, The Free Press 1993:753-773.
16. Kallay E. Trauma, trauma theories, and possible posttraumatic
homeostasis, allostasis, vitality and vulnerability; 3. the stress binom: distress and reactions. Cognition, Brain, Behavior 2004; VIII (4):55-74.
eustress; 4. the general syndrome of adaptation; 5. capacity to cope with stress, 17. Kallay E. Posttraumatic growth and meaning making (Abstract)
antistress. S. Riga and D. Riga have also published other four papers on adaptation PhD dissertation. Cluj-Napoca, Babes-Bolyai University 2006.
between 1988 and 2002. 18. Kallay E, Miclea M. The role of meaning in life in adaptation
to life threatening illness. Cognition, Brain, Behavior 2007; XI (1):
153-174.
19. McEwen B. Protective and damaging effects of stress mediators.
CONCLUSION NEJM 1998; 398:171-179.
20. McEwen BS. Allostasis and allostatic load in G. Fink (ed.).
Allostasis, resilience, posttraumatic growth, stress-syndrome, and eustress Encyclopedia of stress vol. 1, San Diego, Academic Press 2000;135-
offer at present and in perspective a roadmap for the development of adaptology 150.
as a new integrative science and for surpassing over simplified and narrow-minded 21. McEwen B. Physiological neurobiology of stress and adaptation.
Central role of the brain. Physiol. Rev. 2007; 37:873-904.
views on stress. 22. Mc Ewen B, Seeman T in John & Caterine Mac Arthur Research
Network on Socioeconomic Status and Health.
23. Mc Ewen BS, Wingfield JK. The concept of allostasis in biology
REFERENCES and biomedicine. Horm. Behave. 2003; 43:2-15.
1. Badiu G, Papari A. Human adaptology. “Andrei Saguna” Founda- 24. Riga S, Riga D. Stressology, adaptology and mental health.
tion Ed., Constanta, 1998. Bucharest, Cartea Universitara, 2008.
2. Bonanno GA. Loss, trauma, and human resilience. How we 25. Schneider F. Introduction in clinical Physiology. Timisoara, Facla
understand the human capacity to thrive after extremely adverse Ed., 1977: 147-149, 152.
events. Amer. Psychologist 2004; 39:20-28. 26. Selye H. Stress without distress, Philadelphia, Lippincott
3. Cannon WB. The wisdom of the body. New York, Norton, 1932. 1974.
4. Calhoun LG, Tedescky RG. Beyond recovery from trauma: impli- 27. Sterling P. Principles of allostasis: optimal design, predictive
cations for clinical practice and research. J. of Social Issues, 1998; regulation, pathophysiology and rational therapeutics in J. Schul-
54:summer. ckin (ed.) Allostasis, homeostasis and the costs of adaptation.
5. Carver CS. Resilience and thriving. Issues, models and linkages. Cambridge, Cambridge Univ. Press 2004; 1-36.
J. of Social Issues 1998; 54:245-266. 28. Sterling P, Eyer J. Allostasis. A new paradigm to explain arousal
6. Chrousos GP. Stress, chronic inflammation, and emotional and pathology in S. Fisher and J. Stearon (Ed.) Handbook of stress,
physical well-being: concurrent effects and chronic squeal. J. Allery cognition and health. New York, J. Wiley 1998.
Clin. Immunol. 2008; 106:S275-S291. 29. Tedescky RG, Calhoun LG. Trauma and transformation. Growing
7. Chrousos G, Gould AD. The concept of stress and stress syn- the aftermath of suffering. Thousand Oaks, Sage 2995.
dromes. JAMA 1992; 269:1242-52. 30. Tedescky RG, Calhoun LG. Posttraumatic growth. Conceptual
8. Coculescu M. Psycoendocrine stress induced syndromes. Rev. foundation and empirical evidence. Psychological Enquiry 2004;
Roum. Physiol. 1989 ; 26 :233-253. 15:1-18.
9. Cyrulnik B, Seron C. La resilience ou comme sensation de ses 31. Tedescky RG, Park C, Calhoun LG. The posttraumatic growth
souffrances. Paris Ed. Fabert 2004. inventory. Measuring the positive enquiry of trauma. J. Traumatic
10. Derevenco P. Aspects of posttraumatic stress in Romania. Stress 1996; 9:455-471.
Cognition, Brain, Behavior V (1);2001;29-34. 32. The 17th National Conference of Physiology. Adaptology. Rom.
11. Derevenco P. Psychological and medical consequences of Holo- Soc. Physiol. Sc. (Abstracts). Arad, Sept. 25-26, 1998 Fiziologia-
caust on its survivors. Cognition, Brain, Behavior VIII (1);2004:79-85. Physiology, 8(3): 1-121.
12. Derevenco P, Baban A, Dumitrascu D et al. PTSD – psychophysi- 33. Theorell T. Stress syndromes. Annals Clinical Research 1987;
ological and medical aspects. Rom. J. Physiol. 1993; 30:194-206. 19:53-61.
13. Horowitz M. Stress response syndrome 1st ed. Northvale, Jason 34. Werner E, Smith RS. Vulnerable but invincible. A study on
resilient children. New York, Mc Graw-Hill, 1982.
NOI ABORDARI IN ADAPTOLOGIE
REZUMAT
Problematica adaptarii, de la teoria evolutionista (Darwin) la sindromul general de adaptare (Selye), a fost larg explorata. Lucrarea puncteaza unele directii
actuale vizand studiul adaptarii si relatiile acestuia cu stresul. Allostaza este stabilirea oscilatorie ce asigura adaptarea la variate stari ale organismului.
“Incarcarea alostatica” este costul cumulativ de a parcurge cicluri repetate de adaptare prin reactii la stres, cu posibile efecte adverse. Rezilienta psihologica,
componenta a adaptarii pozitive la stres, consta in a lua act de un eveniment traumatizant care provoaca disfunctii fiziologice si abilitatea de a oferi protectie
provocarilor viitoare. Intre raspunsurile la evenimente adverse, s-a dovedit importanta cresterii posttraumatice si a reusitei (thriving) care explica de ce o
proportie insemnata de subiecti supusi psihotraumelor se reechilibreaza rapid. Maladaptarea se traduce prin sindromul dereglarilor posttraumatice de stres
si prin alte sindroame care comporta mecanisme pe plan psihoneurologic, im unologic, ocupational, endocrin. Spre deosebre de stresul cronic sau prelungit
(distres), eustresul, deci stresul usor/moderat, are valori pozitive, stimulatoare, legate in special de secretia endorfinelor. In prezent se contureaza adaptologia,
disciplina de integrare a aspectelor structurale, functionale, biopsihosociale ale adaptarii. Adaptologia este promovata in Romania prin mai multe publicatii.
Semnalam cartile “Adaptologia umana” (Badiu, Papari, 1999) si “Stresologie, adaptologie si sanatate mintala” (S. Riga, D. Riga, 2008).
Cuvinte cheie: adaptare, alostaza, rezilienta, crestere posttraumatica, sindroame de stres, eustres, adaptologie

MECHANISMS INVOLVED IN MESENCHYMAL STEM CELLS
DIFFERENTIATION TOWARD EPITHELIAL LINEAGE. THE
EFFECT OF SOME CHEMICAL INDUCTORS
GABRIELA TĂNASIE1,2, FLORINA BOJIN1, C. A. TATU1,2, OANA GAVRILIUC1, CARMEN

TATU1,2, DACIANA NISTOR1,2, VICTOR CIOCOTISAN4, HORTENSIA IONIŢĂ3, CARMEN
BUNU1, V. PĂUNESCU1,2
1
Department of Physiology and Immunology, University of Medicine and Pharmacy Victor Babes, Timisoara
2
Laboratory of Immunology, Clinical County Hospital Timisoara
3
Clinic of hematology, University of Medicine and Pharmacy Victor Babes, Timisoara
4
Department of Physiology, Heidelberg Medical University, Germany
ABSTRACT
Adult mesenchymal stem cells (MSCs) are extremely attractive in order to study the regeneration and reparation features in vari-
ous type of tissues. For maintaining the differentiation potential of MSCs there are used several strategies: the in vitro culture of
mesenchymal cells in media supplemented with specific growth factors, the transfection of MSCs with the genes which are specific
to the differentiated cells, co-culture of MSCs with differentiated cells from the target tissue. In this study we verify the effect of
some chemical inductors to differentiate adult MSCs into epithelial-like cells. We used various cytokines and growth factors, added
in the culture media alone or in combination. The results were analyzed using immunocytokemistry and molecular biology (PCR)
methods. The experiments revealed that MSCs differentiation toward the cells expressing epithelial markers is relatively easily to
obtain using a certain combination of inductors, without genetic manipulation of the cells
Key words: mesenchymal stem cells, epithelial differentiation, epithelial-like cells, chemical induction
INTRODUCTION their self-renewal capacity, passing through intermediary states (mesenchymal

The mesenchymal stem cells (MSCs) role in the adult human body is the progenitors) and finally acquiring the characteristic phenotype of specialized cells.
generation of mesenchymal cell lines and afterwards, through mesenchymal The alternative model, which is more confirmed by experimental studies sustained
progenitors is involved in development, maintaining and restoration of connective that the major determinant of pluripotency is the MSCs heterogeneity a property
and muscular tissue. Having these outstanding properties MSCs represents the identified even in a single cell derived colonies. From the entire population of adher-
best alternative for cell therapy applications; they have self renewal, great plasticity ent cells only 30% are having a tri-differentiation potential (adipocytes/osteoblasts/
with differentiation potential in functional cell lines. Their efficiency was proven in chondrocytes) and the others having only a double osteo/chondrogenic or a unique
numerous therapeutic protocols: bone marrow recovery, osteogenesis imperfecta, osteogenic potential (3). A possible explanation is that in bone marrow reside
bone regeneration. Another advantage seems to be the fact that MSCs could be primitive pluripotent MSC with limited capacity of self renewal which generates
obtained from autologous sources (bone marrow) eliminated thus the complication mesenchymal progenitors in various differentiation studies.
of allogeneic transplantation. In past years were developed many researches in The concept of plasticity means the property of stem cells to differentiate
the field of MSC and now we have lot of information regarding plasticity, homing in a distinct cell line apart from the originated tissue. The in vitro differentiation
and differentiation potential in vivo, but less known are the intrinsic mechanisms techniques are based on using a differentiation agent, co culture with specific cells
which allow the self-renewal and differentiation. The understanding of these or structures and modification in some gene expression. In vivo the differentiation
mechanisms at the molecular level is still a challenge for the medical community process can be followed by marked SC transplantation in experimental animals or
and the elucidation of mechanisms could offer a supplementary safety to cell CS transplantation in genetic modified animals (with deficiency on some cellular
therapies and make possible a large scale application of these methods (1,2). The lines). The differentiation methods used for the MSCs plasticity studies included
MSCs capacity to differentiate in various cell lines was extensively studied beginning MSCs transplant, chemical stimulation in culture and culture in special conditions.
with the 1960. The results confirm the possibility to obtain specialized cells in vitro Till now there are cited successful differentiation processes through the cell lines
and in vivo. MSCs pluripotency is explained based on two theoretical models. The belonging to all the embrionary layers. By MSC transplantation was obtained
first one considering all of MSCs as pluripotent cells and differentiation could be differentiation in: astrocytes (4); neurons; epithelial cells from skin, digestive and
induced by various environment factors. In the differentiation process MSCs loose respiratory tract (5), cardiomyocites, (6), chondrocytes, adipocytes and marrow
Received July 2009. Accepted September 2009. Address for correspondence: Dr. Gabriela Tanasie, MD, PhD, Physiology Department, University of Medicine and Pharmacy “Victor Babes”
Timisoara, 2A Eftimie Murgu Square, 300041, Romania, e-mail: [email protected]

stromal cells (7). After chemical stimulation MSC was differentiate in: adipocytes The induction medium was supplemented with 200 μ M indomethacin
(1-metil 3izobutilxantine, dexametasone, insulin and indhometacin), chondrocytes (Sigma), 1 μg/mL rosiglitasone, 1 mM dexamethasone, 0.5 mM isobutylmeth-
(without bovine serum and stimulation with TGF β), osteoblasts (dexametasone, ylxanthine (IBMX). (8)
β-glicerophosphate and ascorbate), neurons and astrocytes (EGF and BDNF or 2. Osteogenic differentiation
media for
β-mercaptoetanol), skeletal muscle fibers and cardiomyocites 21 days, with mediaThechanges
(5-azacitidine). of 3 was
medium culture times a week.
replaced with osteoinductor medium, containing
1. Adipocytic differentiation
After prolonged cultures and co culture with another cell lines was obtained the 50µg/ml ascorbic acid 2-phosphate (Sigma), 10nM dexamethasone (Sigma) and
MSC differentiation into neurons. The induction medium was 10mMsupplemented
ß-glycerol phosphate with 200 (9)
(Sigma). ȝ M indomethacin (Sigma), 1 ȝg/mL rosi
mM dexamethasone,
In our study we proposed to evaluate the differentiation of human adult bone 0.5 mM isobutylmethylxanthine
3. Chondrogenic differentiation (IBMX). (8)
2. Osteogenic differentiation
marrow derived mesenchymal stem cells in to epithelial like cells by stimulation The chondrogenic media consisted of 30 µg/ml ascorbate-2-phophate, ITS
with some chemical inductors: growth factors and cytokines. The medium culture premixwas (BD replaced with
Biosciences) and osteoinductor
10ng/ml TGF-β1 (R&D Systems)medium, (10). containing 50µg/ml as
2-phosphate (Sigma), 10nM dexamethasone (Sigma) and 10mM ß-glycerol
To evaluate the occurrence of differentiation, at the end of this period the phosphate
cells (Sigma)
3. Chondrogenic differentiation were fixed with 10% formalin for 10 minutes and stained with specific antibodies. To
MATERIAL AND METHODS The chondrogenicmonitor media consisted
adipogenic ofan antiFAB4
differentiation, 30 µg/ml antibody ascorbate-2-phophate,
was used (R&D Systems), ITS pr
Biosciences) and 10ng/mlasTGF-ȕ1 (R&D Systems) (10).
osteogenic marker was used antiosteocalcin antibody (DAKO) and for evidentia-
The experiment was developed after obtaining the agreement of Ethics Com-
To evaluate the occurrence
tion of chondrogenicof differentiation,
induction the choice at wasthe end of this
the antiaggrecan period
antibody (R&Dthe cells were
mittee of the University of Medicine and Pharmacy Victor Babes Timisoara. The
10% formalin for 10 minutes Systems). For further confirmation of differentiation, RNA extraction and RT-PCRadipogenic diff
and stained with specific antibodies. To monitor
bone marrow samples (2-4 ml) was harvest from 5 patients (4 females, 1 male;
an antiFAB4 antibody wasanalysis usedof(R&D Systems), as osteogenic marker was used antiosteocalc
gene expression have also been performed. For RNA extraction the Gen
medium age 45+/-2) suffering by different forms of anemia. In accordance with
(DAKO) and for evidentiation of chondrogenic induction the choice was the antiaggrecan antib
Elute Mammalian Total RNA Miniprep Kit (Sigma) was used in accordance with
the working protocol previously established, the written consent was obtained
Systems). For further confirmation of differentiation, RNA extraction and RT-PCR analy
from patients. The sternal punction maneuvers were performed using specific the manufacturer instructions. The RNA quality and concentration was determined
expression have also been performed. For RNA extraction the Gen Elute Mammalian T
instruments, in conditions of perfect safety and sterility, with minimum invasive using a spectrophotometer (Nanodrop 2000C, ThermoScientific) and measuring the
Miniprep Kit (Sigma) was used in accordance with the manufacturer instructions. The RNA
procedure for the patients. absorption at 260 and 280 nm. For reverse-transcription the One Step RT-PCR kit
concentration was determined using a spectrophotometer (Nanodrop 2000C, ThermoScie
(Quiagene) was used and the thermal conditions were specific for each primer pair.
measuring the absorption at 260 and 280 nm. For reverse-transcription the One Step R
Isolation and culture of mesenchymal stem cells The primer sequences used were found in literature (11) or were custom designed
(Quiagene) was used and the thermal conditions were specific for each primer pair. The prime
The procedure used for mesenchymal stem cells isolation was based on according to Gene Bank data (Table I).
used were found in literature (11) or were custom designed according to Gene Bank data (Tabl
plastic adherence, following a protocol described elsewhere. Briefly, the procedure
Table I. Primers used for RT-PCR
steps are: Table I. Primers used for RT-PCR
- The mononuclear cells (MNCs) were separated from the whole bone mar- Primer sequence
row cells by density gradient centrifugation using Ficoll-Paque plus (Amersham PPARȖ2 S: 5'GCTGTTATGGGTGAAACTCTG 3'
Biosciences Inc.) AS: 5'ATAAGGTGGAGATGCAGGCTC 3'
Lipoprotein S: 5'GAGATTTCTCTGTATGGCACC 3'
- the MNCs were seeded on a cell concentration of 50,000 cells/cm2 in 25 cm2 lipase AS: 5'CTGCAAATGAGACACTTTCTC 3'
plastic T flasks in on IMDM media (Invitrogene) supplemented with 10% fetal bovine FAB 4 (AP2) S: 5'-GTACCTGGAAACTTGTCTCC 3’
serum (Sigma), 2 ng/ml Fibroblast Growth Factor (R&D Systems). AS: 5'-GTTCAATGCGAACTTCAGTCC 3’
GAPDH S: 5’GGGCTGCTTTTAACTCTGGT 3’
- Complete medium change was done at day 1 to 3 after the initiation of AS: 5’TGGCAGGTTTTTCTAGACGG 3’
culture. Alkaline S: 5'TGGAGCTTCAGAAGCTCAACACCA 3'
- The cultures were maintained at 37℃in a humidified atmosphere with 5% phosphatase AS: 5'ATCTCGTTGTCTGAGTACCAGTCC 3'
Osteocalcin 5'ATGAGAGCCCTCACACTCCTC 3'
CO2. 5' GCCGTAGAAGCGCCGATAGGC 3'
- The medium was replaced one to two times every week, every third to CBFA-1 S : 5’CCACAGAACCACAAGTGCGG 3’
fourth day. (Runx2) AS : 5’ACGGAGCACAGGAAGTTGGG 3’
Osterix S : 5'-CAGCTGCCATCTTAGATGTGC 3’
- When layers were subconfluent (70-75% confluence), cells were treated with AS : 5'-CCATTCCACAATGTTCTCTCC 3’
0.25% (v/v) trypsin/1 mM EDTA (Sigma) and replated at 1000 cells/cm2. Agreccan 5'GCCTTGAGCAGTTCACCTTC 3'
- for determination of cell concentration the standard procedure of cell cont 5'CTCTTCTACGGGGACAGCAG 3'
Collagen type 5'CCCTTTTTGCTGCTAGTATCC 3'
in Neubauer counting chamber (hemocytometer) was followed X 5'CTGTTGTCCAGGTTTTCCTGGCAC 3'
The cells were examined daily using an inverted microscope (Olympus) in Collagen type 5'GAACATCACCTACCACTGCAAG 3'
order to detect morphological changes and the initiation of confluence. The cell II 5'GCAGAGTCCTAGAGTGACTGAG 3'
viability was determined both in the moment of isolation and placement in culture
medium (day 0 of each passage), as well as at differentInduction of epithelial-like
time intervals, during cells
Induction of epithelial-like cells
For this 200
their evolution, using small amounts of cellular suspension (approximately study MSCsForatthispassage
study MSCs at3passage
were3 wereused. used.InIn aafirstfirst
set of set of experiments,
experiments, the the
µl). We used Trypan Blue microscopic method: deadsupplemented with one ofmedia
cells, having lysis of cellular thewas cytokines
supplementedand with growth factors:
one of the cytokines and epidermal growth factor (EGF
growth factors: epidermal
membrane, would be stained in blue, while viable cells,keratinocyte growth factorgrowth
having intact membrane, (KGF) factor10 ng/ml,
(EGF) 20 ng/ml,bone morphogenic
keratinocyte growth factor protein
(KGF) 104ng/ml,
(BMP4)
bone 10 ng/ml, tu
would not be colored. factor beta 1 (TGF beta1) morphogenic20 ng/ml,protein tumor growth
4 (BMP4) factor
10 ng/ml, tumorbeta
growth3 factor
(TGF betabeta3) 25 ng/ml, hepatoc
1 (TGF beta1)
factor (HGF)
Confirmation of differentiation potential characteristic 10 ng/ml, beta
for mesenchymal cellulin
20 ng/ml, 100 ng/ml,
tumor growth factor betanicotinamide 25 ng/ml,
3 (TGF beta3) 25 ng/ml, hepatocytefibroblast
growth growth fac
stem cells 10 ng/ml, insulin like growth factorfactor
(HGF) 10II (IGF2)
ng/ml, 50 ng/ml.
beta cellulin 100 ng/ml, All reagents
nicotinamide 25 were purchased from R@
ng/ml, fibroblast
For this study MSCs at 3rd passage were used. TheAlso,
cultures an experiment
subsequently were with growth
a combination
factor (FGF1) 10ofng/ml,
fibroblast
insulin likegrowth
growth factor factor (FGF)
II (IGF2) 10Allng/ml, EGF 20
50 ng/ml.
KGFof 310
maintained in this media for 21 days, with media changes ng/ml
times a week.was carriedreagents
out. were purchased
. from R@D Systems. Also, an experiment with a combina-
1. Adipocytic differentiation In a second set of tion ofexperiments, the (FGF)
fibroblast growth factor effect of different
10 ng/ml, EGF 20 ng/ml and combination
KGF 10 ng/ml of this indu
evaluated. Four groups of experiments were used and the exact composition of the media i
8 figure 1. Fiziologia - Physiology  2009.19.3(63)
Fig.2. MSCs, day 5, ob.20x
Confirmation of differentiation potential characteristic for mesenchymal stem cells

The differentiation studies occurred in MSCs at passage 2. The cells were able to differentia
all three lines (adipocytic, osteogenic and chondrogenic) which are characteristic
stromal/mesenchymal progenitors. The characteristic markers for those three lineages were express
the gene level and were evidenced by RT-PCR reaction (Figure 3). The presence of some markers a
protein expression level could be evidenced also, using immunocytochemistry staining (Figures 4, 5,
was carried out. .
ROUP 1 GROUP
In a second GROUP
set of 2experiments, the effect GROUP 4
of different3 combination of this
DMEM + inductors were
•DMEM evaluated.
+ Four groups of experiments
•DMEMwere + used and the exact•DMEM +
composition of the media is shown in figure 1.
10% FCS •10% FCS •10% FCS •10% FCS
GROUP 1 GROUP 2 GROUP 3 GROUP 4
FGF 10 ng/ml •IGF2 50 ng/ml •IGF2 60 ng/ml •HGF 10 ng/ml
•DMEM + •DMEM + •DMEM + •DMEM +
GF2 50 ng/ml •10% FCS •KGF 10•10%
ng/ml
FCS •KGF 10 ng/ml
•10% FCS •10% FCS •BMP4 10 ng/ml
•FGF 10 ng/ml •IGF2 50 ng/ml •IGF2 60 ng/ml •HGF 10 ng/ml
KGF 10 ng/ml •EGF 30•KGF
•IGF2 50 ng/ml
ng/ml
10 ng/ml
•EGF 20 ng/ml
•KGF 10 ng/ml
•KGF 10 ng/ml
•BMP4 10 ng/ml
Fig.3. RT-PCR for MSCs afterRT-PCR
Fig.3. 2 weeks in adipocytic
for MSCs after 2 weeks (A), osteogenic
in adipocytic (O) and
(A), osteogenic (O)chondrogenic (C) media
EGF 20 ng/ml •BMP4 10
•KGF 10 ng/ml •EGFng/ml
30 ng/ml •KGF 10 ng/ml •EGF 10 ng/ml
•HGF 10 ng/ml
•EGF 20 ng/ml
and chondrogenic (C) media
•EGF 20 ng/ml •BMP4 10 ng/ml •HGF 10 ng/ml •EGF 10 ng/ml
Fig.1. The composition of media for epithelial induction on each group
Fig.1. The composition of media for epithelial induction on each group
Induction of epithelial-like cells
The results of RT-PCR expression of cytokeratin 19 is shown in figure 7. The
the presence Toofevaluate
some characteristic
the presence markers
of some characteristic markers forfor undifferentiated
undifferentiated MSCs respectively
cytokeratin expression was enhanced by media supplementation with EGF, KGF,
e at the dayMSCs
14 respectively
the cells werelineage
for epithelial fixed at thewith 10%
day 14 the formalin
cells were fixed with 10%for 10 BMP4,
minutes
IGF2 and and
HGF. Thestained
addition of a with
mixture containing EGF, KGF and FGF seems
anti-vimentin (Beckton
formalin for Dickinson)
10 minutes and stained and anti-vimentin
with specific antibodies: anti-pancytokeratin
(Beckton (R&D
to decrease Systems).
the cytokeratin For
expression. The effect is possible to be generated by FGF
Dickinson) and anti-pancytokeratin (R&D Systems). For further confirmation of
n of differentiation, RNA extraction and RT-PCR analysis of gene expression haveFGF as supplement the cytokeratin
addition because in experiments using only
differentiation, RNA extraction and RT-PCR analysis of gene expression have also
d. The primers used were
been performed. forusedcytokeratin
The primers were for cytokeratin19 (R&D
19 (R&D Systems)Systems)
and for and for E-cadherin (R&D
E-cadherin (R&D Systems)
RESULTS
Isolation and culture of mesenchymal stem cells
re of mesenchymal From all thestem cells
bone marrow samples were obtained primary cultures of adher-
bone marrow samplescellswere
ent, spindle-shape (Figure obtained
2). The cells had aprimary cultures
good proliferation capacity andof adherent, spindle-shape cells
lls had a good
are able proliferation
to survive in our lab for 5capacity
to 6 passages. Theand are onable
cell viability to survive in our lab for 5 to 6
each passage
was around 90-95%.
iability on each passage was around 90-95%.
Fig.4.
Fig.4.MSCs
MSCsin adipocytic
inFig.4.
adipocytic media.
MSCs in adipocytic media.IHC FAB4.
forob.FAB4.
IHC for FAB4. 10x ob. 10x
ob. 10x
Fig.2. MSCs, dayday5,5, ob.

Fig. 2. MSCs, ob.20x
20x
fferentiation potential
Confirmation characteristic for mesenchymal
of differentiation potential characteristic for mes-stem cells
Fig.5. MSCsin in osteogenic media.media. IHC forosteocalcin
osteocalcin ob. 20x
ntiation studies stem cells in MSCs at passage 2. The cellsFig.5.
occurred
enchymal wereMSCs able toosteogenic
Fig.5. MSCs in media.
differentiate
osteogenic
inIHC for osteocalcin ob. 20x
IHC for ob. 20x
(adipocytic, Theosteogenic
differentiation studies occurred in MSCs at passage 2. The cells were able to
and chondrogenic) which are characteristic for
differentiate in all three lines (adipocytic, osteogenic and chondrogenic) which are expression was also very weak (Figure 7).
mal progenitors. Thefor characteristic
characteristic markers
stromal/mesenchymal progenitors. for those
The characteristic markersthree
for lineages were expressed at
Regarding the second set of experiments, in all studied groups some modifica-
were evidenced by RT-PCR reaction (Figure 3). The
those three lineages were expressed at the gene level and were evidenced by RT-PCR presence of some markers
tions of cell morphology were noticed.at
Thethe
proliferation rate seems to be slower, cells
evel could be evidenced
reaction also, ofusing
(Figure 3). The presence immunocytochemistry
some markers at the protein expression level staining (Figures
became polygonal 4,for5,the6).
and, mainly cells from group 3 was noticed a tendency of
could be evidenced also, using immunocytochemistry staining (Figures 4, 5, 6). multilayered culture (figure 8). A specific marker for MSCs, vimentin, had a weaker
expression in the epithelial inducing media in comparison with undifferentiated
Fig.6. MSCs in chondrogenic media. IHC for aggrecan ob. 20x

Fig.5. MSCs in osteogenic media. IHC for osteocalcin ob. 20x
Fig.5. MSCs in osteogenic media. IHC for osteocalcin ob. 20x

Fig.10. Pancitokeratin expression in MSCs placed in undifferentiated media (left) and in epithelial inducing media (right)
Fig.11. RT-PCR
Fig.11. for Citokeratin
RT-PCR for Citokeratin19and
19and E-cadherin
E-cadherin ininexperimental
experimental groups
groups
Fig.6. MSCs in chondrogenic media. IHC for aggrecan ob. 20x
1 the expression of E-cadherin and cytokeratin was not detectable, suggesting a

possible role of FGF in inhibition of epithelial lineage.
of epithelial-like cells
e results of RT-PCR expression of cytokeratin 19 is shown in figure 7. The cytokeratin
Fig.6. MSCs in chondrogenic
n was enhanced by media Fig.6. supplementation
media.media.
MSCs in chondrogenic IHC forfor
withIHC EGF,
aggrecan
aggrecan KGF,
ob. 20x BMP4,ob. 20x IGF2 and HGF. The
f a mixture containing EGF, KGF and FGF seems to decrease the cytokeratin DISSCUSION
expression. The
MSCs (figure 9). In parallel, the expression of pancytokeratin is stronger in the
ossible to be generated by FGF addition because in experiments using only FGFTheasprocesses supplementof MSCs differentiation in the cells belonging to all the em-
cultures supplemented with epithelial-induction cocktail (figure 10).The best results
elial-like
ratin
or the expression
cells from cells was
group alsonoticed
3 was
were obtained
very weak (Figure
in group 3.a tendency
Regarding the
7).
of multilayered culture (figure 8). A specific marker for
detection of expression of cytokeratin 19
bryonic layers are poorly understood. Although exist a theoretical model which
try to explain the process sat the molecular and genetic level (12). According to
sMSCs,
of
for the RT-PCR
vimentin,
for the cells fromhad
cells
undifferentiated
MSCs, from group
MSCs
vimentin,
expression
groupa 3 weaker
was noticed
32awas noticed of cytokeratin
expression
a tendencyinofthe
a 5tendency in of
multilayered
themultilayered
19
epithelialculture
culture is(figure
inducing
shown
(figure
media
in marker
8). A specific
8). Acomparison
specificfigure
in comparison
in marker
7. The cytokeratin
for with
for
1had(figure 39). In
weaker parallel,
4expression 6the expression
7 8 9of pancytokeratin
epithelial inducing
10 11 12 media 13isinstronger the with
thiscultures
model the differentiation process have to distinct phases. In the first step, Go/
nhanced
MSCs,
undifferentiated
upplemented by
vimentin, media
had a(figure
withMSCs supplementation
weaker 9). Inexpression
epithelial-induction parallel,
cocktail thein(figure
expression with
the epithelial EGF,
inducing
of pancytokeratin
10).The best results KGF,
media
is were BMP4,
inobtained
stronger comparison
in the cultures IGF2
with 3. and HGF. The
inG1group
MSC suffer transcriptional modifications and generate mesenchymal progeni-
undifferentiated
supplemented
Regarding MSCs
with
the detection (figure 9). In parallel,
epithelial-induction
of expression ofcocktail the(figure
cytokeratin expression
19 andof E-cadherin
10).The pancytokeratin
best resultsby were is stronger in
in the
obtained(figure
RT-PCR groupcultures
11); 3.these
ure containing
supplemented
Regarding
markers with
the EGF,
detection of KGF
epithelial-induction
expression and
cocktail
of FGF
cytokeratin(figure 19 seems
10).The
and to
best
E-cadherin decrease
results
by were
RT-PCR the
obtained
(figurecytokeratin
in
11); tors
group
thesebut3.withoutexpression. The or self-renewal. The result is a cell
any alteration of phenotype
PCR forare very well 19
cytokeratin expressed
inofMSCs incultured
group 2,in3 media and 4 without
supplemented notablewith differences
TGF betweenTGF
beta1(1), groups. In cells
beta3(2), beta-cellulin
o(4),
rombe generated
markers
Regarding
group
EGF(5),
from
are
1the
groupvery
very
the
FGF(6),
wellby
detection
Fig.7.
1 thewell
FGF
expressed
RT-PCR
expression inaddition
expression group
forE-cadherin
of
nicotinamide
expression
cytokeratin 19 2,
of
(7), HGF(8),
of E-cadherin
3 and
MSCs
and because
incytokeratin 4 without
cultured in19media
cytokeratin
KGF(9)
and in
notable experiments
differences
E-cadherin
supplemented
was not
IGF2(10),
withby
detectable, between
TGF RT-PCR
beta1(1),
EGF+KGF+FGF(11),
TGFusing
suggestinggroups.
(figurea only
In
11);cells
these
identical
possible FGF
with
role
undifferentiated as
the supplement
mother
MSCs cell and a mesenchymal pluripotent progenitor with
ofmarkers
FGF in areinhibition of expressed
beta3(2), in (3),
beta-cellulin
epithelial group
lineage. 2,and
BMP4(4), cytokeratin
3EGF(5),
and 4 without
FGF(6), was not(7),
notable
nicotinamide detectable,
differences
HGF(8), suggesting
KGF(9) betweena groups.
IGF2(10), possible role
In cells
ression
of FGF
from groupinwas also
inhibition very
of epithelial
1 the expression weak
lineage. (Figure
of E-cadherin
EGF+KGF+FGF(11),
(12), negative
and cytokeratin
undifferentiated 7).(12),
control
MSCs
(13)
wasnegative
not detectable,
control (13) suggesting a possible role
restricted differentiation potential but phonotypical similar. After that the pluripotent
of FGF in inhibition of epithelial lineage. progenitor cells generate by division tri and bipotent progenitors which differ only
garding the second set of experiments, in all studied groups some modifications at the transcriptionalof level.
cellThe differentiation potential is restricted to osteogenic
1 2 3 4 5 6 7 8
gy were noticed. The proliferation rate seems to 9be slower,
10 11 12 13
cells became polygonal and,/ mainly
/ chondrogenic adypogenic for tripotent progenitors and to muscle/tendon for
the bipotent progenitors. In the second step bi and tripotent progenitors generate
unipotent specific progenitors for each line, with the phenotype modification and
ytokeratin 19 in MSCs cultured in media supplemented with TGF beta1(1), TGF beta3(2), beta-cellulin
becoming finally adult cells with the specific specialized structures. The microar-
5), FGF(6), nicotinamide (7), HGF(8), KGF(9) IGF2(10), EGF+KGF+FGF(11), undifferentiated MSCs
ray analysis of global gene expression identified the genes which are involved in
(12), negative control (13)
the MSCs differentiation process. The genes which trigger the progression toward
Fig.8. MSCsMSCs in epithelial inducing
inducingmedia
media(group 3), day
day20,
20,obob20x 20x
Fig.8.Fig.8. in epithelial
MSCs in epithelial inducing media (group
(group3),3), day 20, ob 20x a specialized cell line were evidenced by analyzing the transcriptional profiles
the second set Fig.8. of MSCsexperiments,
in epithelial inducingin media all(group studied
3), day 20, ob groups
20x someof three modifications
cell lines: osteoblasts,of cell undifferentiated MSC. For analyses
chondrocytes,
noticed. The proliferation rate seems to be slower, cells becamewaspolygonal and,genome
used Affymetrix human mainly U133 array set (13). The genes with strong
expression in the differentiation process was identified and divided into three
categories depending on the cell type. There was identified eight genes expressed
in the differentiation process toward all three cell lines, which suggest that they
are major determinants of the differentiation process: period homolog1 (PER1),
nebulette (NEBL), neuronal cell adhesion molecule (NRCAM), FK506 binding
Fig.9. Vimentin expression in MSCs placed in undifferentiated media (left) and in epithelial inducing media (right)protein 5 (FKBP5), interleukin 1 type II receptor (IL1R2), zinc finger protein 145
Fig.9. Vimentin expression in MSCs

Fig.9. Vimentin placedininMSCs
expression undifferentiated media (left)
placed in undifferentiated mediaand in and
(left) epithelial (ZNF145), tissue inhibitor of metalloproteinase 4 (TIMP4), serum amyloid A2. The
inducing media (right)
in epithelial
Fig.9. Vimentin expression in MSCs placed in undifferentiated media (left) and in epithelial inducing media (right)
inducing media (right) functions of these gene address to the large spectrum of biological processes: cell
adhesion, the tertiary structural protein organization, the citoskeletal organization
and inflammatory response. The genes involved in final steps of differentiation
process were not identified.
The cell plasticity is a hallmark of embrionary development. Although was
demonstrated that MSCs can differentiate in vitro in a raw of cell types with the
Fig.10. Pancitokeratin expression in MSCs placed in undifferentiated media (left) and in epithelial inducing media (right) possibility to use them for therapeutic purposes in organ and tissues reconstruction.
The molecular mechanisms involved in MSCs plasticity and in MSCs transdifferen-
Fig.10. Pancitokeratin expression in MSCs placed in undifferentiated media (left) and in epithelial inducing media
Fig.10. Pancitokeratin expression in MSCs placed in undifferentiated media (left) and in epithelial inducing media (right)
tiation are still unclear. The cells have a heterogeneous genetic pattern suggesting
(right)
Fig.10. Pancitokeratin expression in MSCs placed in undifferentiated media (left) and in epithelial that they are in a permanent „standby stat” in which lot of genes is expressed at
inducing media (right)
the minimal level making possible the changing of the cell fate. Some researchers
showed that this remarkable plasticity appear mainly in the cells isolated from
and E-cadherin by RT-PCR (figure 11); these markers are very well expressed in bone marrow which could under adequate circumstances differentiate into any
group 2, 3 and 4 without notable differences between groups. In cells from group cells belonging to the embryonic layers. (14) Is still controversially if in some cases
Fig.11. RT-PCR for Citokeratin 19and E-cadherin in experimental groups

Fig.11.RT-PCR
Fig.11. RT-PCR for
for Citokeratin 19and
19and E-cadherin
E-cadherinininexperimental
experimentalgroups
groups
is involved a fusion process with the differentiated cells likes epithelial, Purkinje or REFERENCES
muscular cells. The bone marrow derived stromal cells can differentiate in renal 1. Zipori D. The Stem State: Plasticity Is Essential, Whereas Self-Re-
epithelial and non epithelial cells. The evidence of this fact appears when the newal and Hierarchy Are Optional. Stem Cells 2005, 23:719-726.
2. Bianco P, Gehron Robey P. Marrow stromal stem cells. JCI 2000,
female kidney is transplanted into the male and in the transplanted kidney could 105: 1663-1668.
be identified the epithelial cells positive for Y chromosome (15). There are many 3. Muraglia A, Cancedda R, Quarto R. Clonal mesenchymal progeni-
experiments in animals which demonstrate that the cells from bone marrow can tors from human bone marrow differentiate in vitro according to
form bronchiolar epithelium and type 2 pneumocytes. Kotton et al. demonstrate a hierarchical model. J. Cell Sci 2000, 113:1161-1166.
4. Kopen GC, Prockop DJ, Phinney DG. Marrow stromal cells migrate
in an experiment in which the MSCs were injected in mice with bleomycin induced throughout forebrain and cerebellum, and they differentiate into
pulmonary lesions that the injected cells differentiate in type 1 pneumocytes (16) astrocytes after injection into neonatal mouse brains. Proc. Natl.
MSCs can differentiate in vivo in gastrointestinal epithelial cells like esophageal and Acad. Sci. U. S. A. 1999; 96:10711-16.
5. Jiang Y, Jahagirdar BN, Reinhard RL, Schwartz RE, Keenek CD,
gut epithelium (17); it was noticed that the administration of the bone marrow Ortiz-Gonzalezk XR, Reyes M, Lenvik T, Lund T, Blackstad M, Du
derived mesenchymal progenitors leads to the differentiation in the crypt cells J, Aldrich S, Lisberg A, Lowk WC, Largaespada DA, Verfaillie CM.
which represent the proliferative compartment from the tissue. Regarding the Pluripotency of mesenchymal stem cells derived from adult mar-
row, Nature 2002;418:41-49.
MSCs differentiation in epidermal cells, Herzog et al. showed that MSC can reach 6. Toma C, Pittenger MF, Cahill KS, Byrne BJ, Kessler PD. Human Mes-
at the cutaneous lesion site and differentiate in proliferative keratinocytes which enchymal Stem Cells Differentiate to a Cardiomyocyte Phenotype
later are integrated in the scar tissue. (18) For maintaining of MSCs differentiation in the Adult Murine Heart. Circulation. 2000;105:93-98.
potential lot strategies are mentioned, like cell culture in the presence of specific 7. Liechty KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AB,
Deans R, Marshak DR, Flake AW. Human mesenchymal stem cells
growth factors, enrichment of the number of undifferentiated cells prior the addition engraft and demonstrate site-specific differentiation after in utero
of differentiation factors or even co culture of MSCs with the cells belonging to the transplantation in sheep. Nat. Med. 2000;6:1282-86.
specific tissue. On the other hand the analysis of the in vitro MSCs differentiation 8. Hwang JH, Shim SS, Seok OS, Lee HY, Woo SK, Kim BH, Song HR, Lee
JK, Park YK. Comparison of cytokine expression in mesenchymal
in the conditions mimicking the in vivo cell microenvironment could omit some stem cells from human placenta, cord blood, and bone marrow, J
essential factors for MSCs commitment toward a certain cell line. These factors are Korean Med Sci. 2009 Aug;24(4):547-54.
soluble molecules and their receptors (TGFbeta), molecules of the extracellular 9. Eslaminejad MB, Yazdi PE. Mesenchymal Stem Cells: In Vitro
matrices (collagen, proteoglycans), cytoskeletal actine, transcription factors (Cbfa1/ Differentiation among Bone and Cartilage Cell lineages. Yakhteh
Medical Journal 2007; 9(3): 158-169.
Runx2, PPARgamma, Sox9, MEF 2). Multiple protein interactions (focal adhesion, 10. Malladi P, Xu Y, Chiou M, Giaccia AJ, Longaker MT. The effect
cytoskeleton) allow the cells to generate complex signals which lead to various in of reduced oxygen tension on hondrogenesis and osteogenesis
vitro cells behaviors. The initiation of cell adhesion integrin mediated has a great in adipose-derived mesenchymal cells. Am J Physiol Cell Physiol,
2005 Apr;290(4):C1139-46.
impact on cell proliferation. The integrins can regulate in a cooperative manner the 11. Schutze N, Noth U, Schneidereit J, Hendrich C, Jakob F. Differential
members of cycline family and interfere in the cell cycle progression (19). Establish- expression of CCN-family members in primary human bone
ment of specific stimuli integrin-extracellular matrices can induce an increased marrow-derived mesenchymal stem cells during osteogenic,
expression of the genes involved in the differentiation processes. chondrogenic and adipogenic differentiation. Cell Commun Signal.
2005, 17;3(1):5.
12. Baksh D, Song L, Tuan RS. Adult mesenchymal stem cells:
characterization, differentiation, and application in cell and gene
CONCLUSIONS therapy. J. Cell. Mol. Med. 2004;8(3):301-316.
13. Song L, Tuan RS. Transdifferentiation potential of human
From the anterior presentation we can conclude that adult MSC are extremely mesenchymal stem cells derived from bone marrow, FASEB J.
attractive for the researchers involved in the study of the various tissues regeneration- 2004;18:980-982.
restoration processes. In the scientific literature can found references to the plastic 14. Alison MR, Poulsom R, Otto WR, Vig P, Brittan M, Direkze
NC, Lovell M, Fang TC, Preston SL, Wright NA. Recipes for adult
potential of MSC to the mesodermal cell lines: bone, cartilage, adipocytes. There stem cell plasticity: fusion cuisine or ready made? JClinPathol
are data about the differentiation inducing agents and about the molecular events 2004;57:113-120.
which can induce the cell switching from stem cell state able of self renewal in a 15. Poulsom R, Forbes SJ, Hodivla, Dilke K et al. Bone marrow
commitment state toward a specific cell lineage. Concerning the capacity of MSC contributes to renal parenchymal turnover and regeneration.
JPathol. 2001;195:93.
to differentiate in the cells belonging to the other embrionary layers there are lot 16. Kotton DN, Ma BY, Cardoso WV, et al. Bone marrow-derived
of studies regarding in vivo and in vitro generation of the cell with neuronal char- cells as progenitors of lung alveolar epithelium. Development
acteristics; also a lot of interests was noticed regarding the possibility of obtaining 2001;128:5181-88.
17. Păunescu V, Deak E, Herman D, Siska IR, Tănasie G, Bunu
the insulin secretory cells by manipulating the MSC. Concerning the differentiation C, Anghel S, Tatu CA, Oprea TI, Henschler R, Rüster B, Bistrian R,
in the epithelial lineage there are very few studies and the existing ones are about Seifried E. In Vitro Differentiation of Human Mesenchymal Stem
the murine MSC or referring to the in vivo experiments. Our study demonstrated Cells to Epithelial Lineage. J Cell Mol Med 2007;11:1-8.
that MSCs differentiation toward the cells expressing epithelial markers is relatively 18. Herzog E, Chai L, Krause D. Plasticity of bone-marrow derived
stem cells. Blood 2003; 102:3483-93.
easily to obtain using a certain combination of inductors, without genic manipula- 19. Docheva D, Popov C, Mutschler W, Schieker M. Human
tion of the cells. mesenchymal stem cells in contact with their environment:
surface characteristics and the integrin system. J.Cell.Mol.Med.
2007;11(1):21-38.
AKNOWLEDGEMENTS: The work within this paper was financial
supported by a national PNCD-II grant, IDEI 198/2007 (financing agency CNCSIS)

MECANISME IMPLICATE ÎN DIFERENŢIEREA CELULELOR STEM
MEZENCHIMALE SPRE LINIA EPITELIALĂ. EFECTUL UNOR
INDUCTORI CHIMICI
REZUMAT
Celulele stem mezenchimale adulte (CSM) sunt extreme de attractive pentru studiul proceselor de reparatie si regenerare in diferite tipuri de tesuturi. Pentru
mentinerea potentialului de diferentiere al CSM au fost utilizate o serie de strategii: cultivarea celulelor in vitro in mediu suplimentat cu factori de crestere
specifici, transfectia MSC cu genele specifice celuelor differentiate, cu-cultivarea MSC cu cellule differentiate din tesutul tinta. In experimental nostrum am
utilizat diferiti factori de crestere si cytokine adaugati in mediul de cultura singuri sau in combinatii. Rezultatele au fost evaluate prin imunocitochimie si
metode de biologie moleculara (PCR). Studiul a demonstrat ca diferentierea CSM la celule ce exprima markeri de tip epitelial este relativ usor de realizat
utilizand anumite combinatii de agenti inductori, fara a fi necesara manipularea genelor celulare.
Cuvinte cheie: celule stem mezenchimale, diferentiere epiteliala, celule epitelial-like, inductie chimica

ONTOGENETIC changes OF bone MINERAL Composition
OLGA TAGADIUC1, V. GUDUMAC1, V. REVA2
1
State University of Medicine and Pharmacy "N. Testemitanu"
2
State University, Republic of Moldova
ABSTRACT
The goal of the study was to assess the dynamic of the bone mineral content at different ontogenetic stages. In the study were involved 80 rats that were divided
in 4 groups by age – young, adult, old and senile. The dynamics of the calcium and phosphate quantities in the bone were similar – the maximal amounts
were revealed in adult rats and their concentrations decreased gradually in old and senile animals. The highest mean concentrations of magnesium, chloride,
potassium and copper were revealed in young animals (1.46 ± 0.21, 3.53 ± 0.28, 0.02 and 0129 ± 2.97 ± 0.18 mM/g tissue). The amounts of copper and
sodium changed from one age group to another – moderate decreased in the adult compared with young (by 33% and 51%, p < 0.0001), increased in the
old compared with those adults (by 13% and 62%, p < 0.05) and subsequently decreased again in the bone of senile rats (by 18% and 73%, p < 0.005). The
amount of zinc was virtually identical in the bone of young, adult and old rats and varied between 0.017 and 0.0183 mM/g bone tissue while the sulphates
concentration increased significantly in adult animals versus the young (14 times) and decreased gradually with age in the subsequent groups.
Our results revealed divers and significant quantitative changes of the mineral compound's content in the bone at different ontogenetic stages, their knowledge
being important in the evaluation of bone status in different physiological and pathological conditions.
Keywords: bone, mineral composition, ontogenetic changes
INTRODUCTION metabolism of bone at different ontogenetic stages of development, to determine

Along with increasing life expectancy and changing age structure of popula- the parameters and characteristics of each age, to create database that would
tion, diseases of the osteo-articular system have grown in importance. Thus, investi- differentiate the age-related physiological changes from the pathological one
gations were directed to a greater extent to bone metabolism and the most common determinated by various osteo-articular conditions or bone diseases.
bone disease – osteoporosis. Particularly intense were studied bone composition Research goal was to determine the peculiarities of the bone mineral composi-
and metabolism in persons during risk periods –postmenopause and senile. tion at different ontogenetic stages of development in experiment.
Strategies for prevention and treatment methods developed and implemented,
also were targeted at older people, aimed at halting the decrease bone mineral
MATERIAL AND METHODS
density and recovery of lost bone.
However, it was acumulated a significant amount of information on the The experiences were performed on 80 rats of different age:
parentage in childhood and adolescence of many factors that determine the qual- • group I - young rats until sexual maturation (2 months);
ity of bone tissue and predispose to osteoporosis (1) .Osteopenia and osteoporosis • group II - adult rats in reproducible period (6 months);
are not an exclusively adults and elderly issue, there are a lot of evidence of direct • group III - old rats in postmenopause period (18 months);
correlation between mineral density in elderly bone and bone mass accumulated • gloup IV - senile rats (24 months).
in the first two decades of life and increased risk of osteoporosis if the accumulated Rats were sacrificed under light narcosis with diethyl ether. Femoral bones
peak bone mass was less than optimal (5). were extracted, stripped of adjacent soft tissues and released of the bone marrow
Most studies have focused on the evaluation of specific markers of bone by repeated washing with glacial solution of 0.9% NaCl. Subsequently femoral
remodeling that can be assessed in blood or urine (2) in various primary and bones were triturate in liquid nitrogen to the state of powder.
secondary osteo-articular diseases (6), on establishing correlations between bone In the femoral bone powder was determined the amount of some bone mineral
mineral density and the dynamics of bone tissue markers in normal and pathological compounds. The calcium, phosphorus, magnesium, copper and chlorine contents
conditions (4), the analisys of drugs and osteotrope remedies influence on bone were assessed with standard kits Elitech Diagnostic (France), according to the
remodeling (3), etc. instructions attached. The amount of sodium, potassium and zinc was assessed with
However, there is no sufficient scientific data about the detailed bone composi- standard kits Centronic GmbH (Germany), according to the instructions attached. The
tion and the dynamic of individual compounds in various diseases at different ages, amount of sulfates was determined turbidimetric with barium chloride.
necessary to build a scientific based diagnosis and differential, coherent prevention The results were evaluated statistically according to Student t-criterion,
and therapy strategies. neparametric Mann-Whitney criterion and the correlation coefficient r (Statistica
It is obviously necessary to study the particularities of composition and 6.0, Stat Soft Inc.., 2002).
The research was approved by the Ethics of biomedical research Board of
Received August 2009. Accepted September 2009. Address for correspondence: Dr. Tagadiuc Olga, B.P.Hasdeu Street 14/2, Mun. Chişinău, Republica Moldova, Postal code 2005, e-mail:
[email protected]

the State University of Medicine and Pharmacy "N. Testemitanu" from Republic old compared with those adults (13%, p<0.05) and subsequently decreased again
of Moldova. in the bone of senile rats (18%, p<0.005). Similar changes but less pronounced
in magnitude of sodium content had been revealed in bone tissue of experimental
rats (Figure 1).
RESULTS AND DISCUSSION
It was established that the contents of calcium and phosphate in bone tissue Fig.1.Age depend
3,5 and copper conte
of rats are subjected to similar changes, but of different magnitudes (Table I). The 2,97±0,2 3,04±0,2
3 (mM/g bone tissu
results show the highest average concentrations of calcium and phosphate in adult
2,5
animals. The content of calcium increased significantly in adult rats compared with 2,00±0,1 1,86±0,1
mM/g bone
2
2,27±0,1
young (12%, p <0005) and decreases gradually thereafter, the differences being 1,5
2,34±0,5
statistical conclusive between the concentrations detected in the adult animals and 1
in the senile one (8%, p <0.05). The content of phosphates in the bone of adult 0,5
1,15±0,1
0,803±0,1
rats is higher than in the young by 6% (p <0.05), in the old – by 8% (p <0.01) 0
and the senile rats – by 5%. Thus, the total amount of phosphates in bone tissue of Group I Group II Group III Group IV
rats is changing less pronounced than that of calcium, the contents of these mineral Sodium Copper
elements are correlated between them. Strong positive correlation were revealed in
Note.
Fig.a)1.
theAge
content of sodium
depending dynamicsand copper
of sodium andiscooper
expressed
contentsasin mM/g bone
bone tissue tissue;
of rats
young (r = 0.79, p <0.0001) and old rats (r = 0.91, p <0.0001). b) figure includes M ± m.
(mM/g bone tissue)
Note: a) the content of sodium and cooper is expressed as mM/g bone tissue;
Table I. The concentrations of calcium and phosphate in bone tissue of rats of different ages b) figure includes M±m.
Table I. The concentrations of calcium and phosphate in bone tissue of rats of different ages
mM/g
Group Calcium Phosphate
The amount of zinc was virtually identical in the bone of young, adult and old
6
5,45+0,2
5,41+0,4
5
4,86+0,1
I 4.86 ± 0.10 3,44 ± 0,09

5,02+0,1
4 I
rats and varied between 0.017 and 0.0183 mM/g bone tissue (Figure 2). Only in
3,51+0,2
3,44+0,1
3,64+0,1
5.45 ± II
3,35+0,4
3
II 3.64 ± 0.08*I III
0.18***I
**II
2
1
IV
senile animals was detected a significantly higher amount of zinc in bone tissue –
III 5.41 ± 0.40 3.35 ± 0.42
5.02 ±
0
Ca Pi
0.0287 mM/g bone tissue (p < 0.0001). The average content of sulphates in the
IV 3.51 ± 0.17
0.09*II,IV
Note a) table includes M ± m; b) the concentrations of calcium and phosphate are expressed as mM/g bone tissue; c) the
bone tissue of young rats was 21 times less (p <0.0001) compared to adult and
reliability of differences caused by age: * - p < 0.05, ** - p < 0.01, *** - p < 0.005, **** - p < 0.001; the number indicates the
Note a) table includes M±m; b) the concentrations of calcium and phosphate are expressed as
group that the comparisont was carried out with.
old animals. In senile rats were detected in comparisone with adult and old animals
mM/g bone tissue; c) the reliability of differences caused by age: *-p<0.05, **-p<0.01, ***-p<0.005, moderate decreased concentrations of sulfates (24%, p < 0.05 in both cases).
****-p<0.001; the number indicates the group that the comparisont was carried out with
a) b)
Zink
The highest average concentrations of magnesium, chlorine, potassium and
0,0287±0,001
copper in the bone tissue were attested in young animals, respectively, – 1.46 ±
0,03 2,5
0.21, 3.53 ± 0.28, 0.02 and 0129 ± 2.97 ± 0.18 mM/g tissue (Table II). In adult
0,03 0,0183±0,001 0,0181±0,001 0,017±0,003
rats decreases the amount of magnesium compared with young animals (69%, p 2
0,02
< 0001) and no significant changes were established in the following age groups. 1,5
mM/g bone
0,02
Same dynamic was characteristic for the potassium level – the highest concentration 1
0,01
was detected in young animals, and then it decreased by about 50% (p < 0005)
0,5
and remains virtually at the same level in the bone of adult, old and decrepit rats 0,01
(0.068 – 0.080 mM/g tissue). The level of chlorine in bone was moderate decreased 0,00
Group I Group II Group III Group IV
0
Gro
in the adult rats compartiv with young (27%, p < 0.0005) and more marked in
old animals compared with adult (with 93%, p < 0.0001) and young one (95%,
a) In group IV (senile rats) the chlorine content significantly increased
p < 0.0001). b)Fig.2. Age depending dynamics of the zinc (a) and sulphates (b) con
ontogenetic stages
comparative to the levels found in old animals (by
Zink 255%, p <0.0001), but not to
Note. a) the concentrations of zinc and sulphates are expressed in mM
Sulfates (mM/g bone)
the specific quantities of mature or young one were detected. 0,0287±0,001

b) figure includes M ± m.
0,03 of magnesium and chlorine in the bone tissue of rats of different ages 2,5
Table II. The contents
Table II. The contents of magnesium and chlorine in the bone tissue of rats of different ages
0,0183±0,001
0,03 0,0181±0,001 0,017±0,003 Chloride 2 2,353±0,18 2,302±0,28
Group Magnezium Potasium
I 0,02 ± 0.21
1.460 0.115 ± 0.02 3.53 ± 0.28
MODIFICARILE
1,5
ONTOGENETICE1,754±0,08
ALE COMPOZITIEI
mM/g bone
II 0.655 ± 0.03****I 0.068 ± 0.002****I 2.24 ± 0.09****I

0,02
****I
III 0.660 ± 0.06 0.073 ± 0.007 0.162 ± 0.02****I,II 1
IV 0,01 ± 0.03
0.645 0.080 ± 0.004****I; ***II 0.58 ± 0.04****I,II,III
REZUMAT0,5
Note. a) the table includes the M ± m; b) the contents of magnesium, chloride and potassium are expressed as mM/g bone
0,01
tissue; c) the reliability of differences caused by age: * - p < 0.05, ** - p < 0.01, *** - p < 0.005; **** - p < 0.001; the number
0,115±0,02
Note. a) the table includes the M ± m; b) the contents of magnesium, chloride and potassium are Obiectivul cercetării a fost evaluarea compoziĠiei minerale osoase
indicates the group that the comparison was carried out with
0,00 0
expressed as mM/g bone tissue; c)Group
the Ireliability ofGroup
differences caused by IIIage: * - p <Group
0.05,IV** - p <
II Group
0.01, *** - p < 0.005; **** - p < 0.001; the number indicates the group that the comparison was
ExperienĠele au fostGroup I efectuate Group II pe 80 úobolani
Group III GroupdivizaĠi
IV în 4 loturi – tiner
carried out with S-au depistatt modificări de acelaúi sens ale cantităĠilor de calciu úi f
Fig.2. Age depending dynamics of the zinc (a) and sulphates (b) contents in the bone(a) andtissue
sulphatesof rats atin thedifferent
adulte úiFig.în2.următoarele
ontogenetic stages
Age depending dynamics
grupe
of the zinc
de vîrstă diminuează
(b) contents
treptat. ConcentraĠ
bone tissue of
rats at different ontogenetic stages
The amount of copper changed from one age group to another-moderate úi cupru în Ġesutul osos se atestă la animalele tinere (respectiv, 1.46
Note. a) the concentrations of zinc and sulphates are expressed Note. a) the in mM/gofbone
concentrations zinc and tissue;
sulphates are expressed in mM/g bone tissue;
decreased in the adult compared with young (33%, p<0.0001), increased in the 0.18 mM/g b) Ġesut).
figure includes M ±ConcentraĠiile
m. de cupru úi sodiu alternează de la
b) figure includes M ± m.
comparativ cu cei tineri (cu 33% úi 51%, p < 0,0001), creúte la cei băt
14 p < 0,05) úi ulterior Fiziologia iarăúi descreúte - Physiology la úobolanii
 2009.19.3(63) senili comparativ
ConĠinutul de zinc este practic identic la úobolanii tineri, adulĠi úi bătrî
MODIFICARILE ONTOGENETICE ALE COMPOZITIEI MINERALE OSOASE
osos, pe cînd concentraĠia sulfaĠilor în os creúte semnificativ la anim
ori), odată cu înaintarea în vîrstă înregistrîndu-se descreúterea treptată
REZUMAT Studiul efectuat denotă modificări semnificative cantitative úi variat
Obiectivul cercetării a fost evaluarea compoziĠiei minerale osoase la diferite etape ontogenetice de dezvoltare.
Table III. Correlations between the contents of the mineral compounds REFERENCES
of the bone tissue of rats of different ages
Table III. Correlations between the contents of the mineral compounds of the bone tissue of rats of different ages. 1. Bailey DA, McKay HA, Mirwald RL et. al. A six-year longitudinal
Young Adult Old Senile study of the relationship of physical activity to bone mineral ac-
Ca Mg Na Pi Cl Ca Mg Na Pi Cl Ca Mg Na Pi Cl crual in growing children: the university of Saskatchewan bone
Ca 0.79 0.57 0.8 0.54 0.61
Mg 0,79 0.75 0.68 0.52 1.0 0.8 0.68
mineral accrual study. J Bone Miner Res 1999; 14: 1672-1679.
Na 0,57 0.75 0.72 0.65 -051 053 1.0 0.8 0.68 2. Cremers S, Bilezikian JP, Garnero P, Bone markers – new aspects.
Pi 0,8 0.68 0.72 0.6 0.52 -0.51 -0.58 0.88 0.8 0.8 0.77 Clin Lab 2008; 54 (11–12): 461-471.
Cl 0,54 0.61 0.65 0.6 0.6 0.53 -0.58 0.68 0.68 0.77 3. Garnero P, Biomarkers for osteoporosis management: utility in
Note a) table includes the values of correlation coefficient r; diagnosis, fracture risk prediction and therapy monitoring. Mol
b) in all cases p < 0.05.
Note a) table includes the values of correlation coefficient r, Diagn Ther 2008; 12(3): 157-170.
b) in all cases p<0.05. 1. 4. Honig St, Treatment Strategies for Patients with Low Bone Mass
(The Younger Postmenopausal Female). Bulletin of the NYU Hos-
pital for Joint Diseases 2008; 66(3): 240-243.
Many correlations between the quantities of mineral compounds in bone tissue 5. Saggese G, Barancelli GI, Bertelloni S, Osteoporosis in children
were found. These correlations vary in number, power and related substances in and adolescents: diagnosis, risk factors and prevention. J Pediatr
animalsof different age (Table III). Endocrinol Metab 2001; 14: 833-859.
6. Singer FR, Eyre DR, Using biochemical markers of bone turnover
The greatest number of singifcant positive correlations of medium and strong in clinical practice. Cleve Clin J Med 2008; 75(10): 739 -750
intensity with r between 0.54 – 0.80 (p < 0.05) were attested in young and senile
rats. In adult rats a moderate number of medium intensity correlations both positive
and negative were found. The strongest positive (r between 0.71 and 0.89, p <0.05)
correlations were established in old animals.
CONCLUSIONS
Research data attested statistically significant changes, but at moderate scale
of the calcium and phosphate content – cardinal constituent elements of bone
mineral phase, in animals of different age.
2. Quantities of magnesium, chlorine, copper, sodium, potassium, zinc and
sulphates undergo significant age-dependent changes in the bone tissue of rats.
3. Correlations between the quantities of the mineral elements of the bone
tissue of rats vary in number, intensity and type of the related substances in animals
of different age.
MODIFICARILE ONTOGENETICE ALE COMPOZITIEI MINERALE

OSOASE
REZUMAT
Obiectivul cercetării a fost evaluarea compoziţiei minerale osoase la diferite etape ontogenetice de dezvoltare. Experienţele au fost efectuate pe 80 şobolani
divizaţi în 4 loturi – tineri, adulţi, bătrîni şi senili.
S-au depistatt modificări de acelaşi sens ale cantităţilor de calciu şi fosfaţi, care ating valori maxime la animalele adulte şi în următoarele grupe de vîrstă
diminuează treptat. Concentraţiile medii maxime de magneziu, clor, potasiu şi cupru în ţesutul osos se atestă la animalele tinere (respectiv, 1.46 ± 0.21, 3.53
± 0.28, 0.02 and 0129 ± 2.97 ± 0.18 mM/g ţesut). Concentraţiile de cupru şi sodiu alternează de la o grupă de vîrstă la alta – scade la cei adulţi comparativ
cu cei tineri (cu 33% şi 51%, p < 0,0001), creşte la cei bătrîni comparativ cu cei adulţi (cu 13% şi 62%, p < 0,05) şi ulterior iarăşi descreşte la şobolanii senili
comparativ cu cei bătrîni (cu 18% şi 73%, p < 0,005). Conţinutul de zinc este practic identic la şobolanii tineri, adulţi şi bătrîni şi variază între 0,017 şi 0,0183
mM/g ţesut osos, pe cînd concentraţia sulfaţilor în os creşte semnificativ la animalele adulte comparativ cu cele tinere (de 14 ori), odată cu înaintarea în vîrstă
înregistrîndu-se descreşterea treptată a cantităţii lor.
Studiul efectuat denotă modificări semnificative cantitative şi variate ca direcţie ale concentraţiilor substanţelor minerale în ţesutul osos al şobolanilor la
diferite etape ontogenetice de dezvoltare, cunoaşterea căreea este necesară pentru evaluarea stării ţesutului osos în diverse condiţii fiziologice şi patologii
Cuvinte cheie: ţesut osos, compoziţie minerală, modificări ontogenetice

GLUTATHIONE PEROXIDASE ACTIVITY AFFECTS
PROGNOSIS IN NON-ST SEGMENT ELEVATION ACUTE
CORONARY SINDROM
VIOLETA SAPIRA1, ELVIRA CRAIU2, CECILIA ADUMITRESI3
University of Medicine, Constanta, Romania
1
Department of Neurology
2
Department of Cardiology
3
Department of Physiology and Pathophysiology
ABSTRACT
Introduction: Cellular antioxidant enzymes such as glutathione peroxidase play a central role in the control of reactive oxygen species. In vitro, data and
studies on animal models suggest that these enzymes may protect against atherosclerosis, but few are known for their relevance to human disease.
Aim: We have examined the association between redox status and the prognosis of non ST elevated acute coronary syndrome.
Methods: We have evaluated 55 patients, age under 75, consequently hospitalized in the Cardiology Clinic of Emergency Clinic Hospital of Constanta,
during May 2008 – May 2009, diagnosed with non ST elevated acute coronary syndrome and 19 healthy volunteers (without cardiovascular affections,
hypercholesterolemia, diabetes and non-smoking). The patients were divided in two groups: the first group - patients with unstable angina (37 patients, out
of which 10 were readmission in the following 6 months) and the second group – patients with non-Q wave myocardial infarction (18 patients, out of which
6 were readmission in the first 6 months after the heart attack). Glutathione peroxidase (GPx) activity was measured over a fixed time: T1 – the first 24 hours
after hospital admission, T2 – at 48 hours and T3 – at discharge. After discharge, the patients were monitored and the following data was recorded: months
of follow-up, death due cardiovascular cause and onset of major cardiovascular events.
Results: This prospective study of patients admitted with non-ST-segment elevation acute coronary syndrome (unstable angina and non-Q wave myocardial
infection) showed a direct association between baseline GPx and the onset of major acute coronary events in the group with unstable angina and inversely
associated with future fatal and non-fatal cardiovascular events in the group with non-Q wave myocardial infarction.
Conclusion: In the case of the patients with non-ST-segment elevation acute coronary syndrome, the antioxidative enzyme GPx seems to protect against
adverse oxidative effects. The analysis of GPx activity provides superior information on cardiovascular risk assessment compared with the measurement of
traditional risk factors alone.
Key words: acute coronary syndrome, biological markers/blood, glutathione peroxidase, oxidation-reduction, oxidative stress
INTRODUCTION Glutathione peroxidase 1, the ubiquitous intracellular form and key antioxidant
Controversial data existing concerning the relation between the activities of enzyme within most of the cells, including those of endothelium, uses glutathione
scavenger antioxidant enzymes and coronary heart disease (CHD) risk. to reduce hydrogen peroxide to water and lipid peroxides to their respective alcohols
Oxidative stress may be defined as an imbalance between the production and (6,9), and it also acts as a peroxynitrite reductase (17).
degradation of reactive oxygen species such as super oxide anion, hydrogen peroxide, On the basis of the experimental evidence, we addressed the hypothesis that
lipid peroxides and peroxynitrite. Aerobic organisms possess antioxidant defense enhanced activity of cellular glutathione peroxidase 1 would be protective against
systems that deal with reactive oxygen species (ROS) produced as consequence of cardiovascular events in patients with coronary artery disease.
aerobic respiration and substrate oxidation. Low levels of ROS are indispensable
in many biochemical processes, including intracellular signaling, defense against
METHODS
microorganisms and cell function. In contrast, high dose and/or inadequate removal
of ROS, results in “oxidative stress”, which has been implicated in the pathogenesis We have evaluated 55 patients, age under 75, consequently hospitalized in the
of many cardiovascular diseases, including hypercholesterolemia, atherosclerosis, Cardiology Clinic of Emergency Clinic Hospital of Constanta, during May 2008 – May
hypertension, diabetes, and heart failure. Enzymatic inactivation of reactive oxygen 2009, diagnosed with non ST elevated acute coronary syndrome and 19 healthy
species is achieved mainly by glutathione peroxidase, superoxide dismutase, and volunteers (without cardiovascular affections, hypercholesterolemia, diabetes and
catalase (7, 8). In mammalian cells, glutathione and the glutathione peroxidases non-smoking) – control group.
are the principal antioxidant defense system (13, 20). The patients were informed about the study protocol and a written consent
There are at least four different glutathione peroxidases, all of them containing was obtained from each patient. All the patients were evaluated within the same
selenocysteine at their active sites (2). clinical and paraclinical protocol: medical history, physical examination, 12-lead
electrocardiography, biochemical analysis.
Received June 2009. Accepted July 2009. Address for correspondence: Dr. Violeta Sapira, Neurology Department, University of Medicine Constanta, Romania, e-mail:
[email protected]

35.2±40.84, pT=0.0219), and of the leucocytes number (7.96±2.16 vs 9.71±2.31, pT=0.0119) at the
patients with non-Q wave myocardial infarction.
The patients were divided in two groups: group I - patients with unstable . Table I. Base-line characteristics of the study patients
Table I. Base-line characteristics of the study patients
angina (37 patients, out of which 10 were readmission in the following 6 months
patients with patients with non-
– group IA and 27 without being re-hospitalized – group IB) and group II – pa- unstable angina Q infarction p value
67.25 % (N = 37) 32.73 % (N = 18) NS
tients with non-Q wave myocardial infarction (18 patients, out of which 6 were Characteristics
readmission in the first 6 months after the heart attack – group IIA and 12 with mean age
sex women
60.86±10.49
19
65±9.57
9
0.0036
NS
good evolution, without being re-hospitalized – group IIB). male 18 9 NS
body-mass index 26.8±3.4 26.4±4.1 NS
Glutathione peroxidase activity was measured over a fixed time: T1 – in the diabetes (%) 18.92 (7) 27.78 (5) NS
history of
first 24 hours after hospital admission, T2 – at 48 hours and T3 – at discharge. miocardial 16.21 (6) 33.33 (6) NS
infarction (%)
After discharge, the patients were monitored by means of a telephone survey, a hypertension (%) 35.14 (13) 66.67 (12) NS
personal interview, a chart consultation or any other combination of these methods. lipid variables
cholesterol (mg/dl) 230±61.48 226± 74.28 NS
The following data was recorded: months of follow-up, death due cardiovascular LDL- cholesterol (mg/dl) 130±33.98 129 ± 31.46 NS
HDL- cholesterol (mg/dl) 67±16.97 62±16.46 NS
cause and onset of major cardiovascular events (MACEs defined as cardiovascular triglycerides (mg/dl) 156±64.55 180±60.71 NS
inflammatory
death, readmission with acute coronary syndrome or the need for coronary variables
ESR (mm/h) 22±17.64 30±25.73 NS
revascularization). fibrinogen (mg/dl) 535±163.22 646±193.23 0.043
Glutathione peroxidase (GPx) in whole blood quantitative determination is Total CK 128±76.21 639±680.34 0.0055
CK – MB 12±16.65 27.25±24.78 NS
based on Paglia and Valentine method. GPx catalyse the oxidation of gluthatione TnI 0.409±0.39 35.2±40.84 0.0219
CBC RBC (10^6/mm3) 4.4±0.5 4.51±0.63 NS
(GSH) by Cumene Hydroperoxide. In the presence of gluthatione reductase (GR) HGB (g%) 13.29±1.65 13.51±1.85 NS
and NADPH the oxidized glutathione (GSSG) is immediately converted to the HCT (%)
WBC (10^3/mm3)
40.39±4.62
7.96±2.16
41.18±5.37
9.71±2.31
NS
0.0119
reduced form with a simultaneous oxidation of NADPH to NADP+. The decreased PLT (10^3/mm3) 215.49±62.24 263.22±102.57 NS
in absorbance at 340nm is measured. Continuous numerical

Continuous numerical datadata
werewere
expressed as mean as
expressed ± std.dev.;
mean ±NS,std.dev.;
not significant;
NS, ESR,
not erythrocyte
significant; ESR,
The main reaction is: erythrocyte sedimentation
sedimentation rate; total-CK,
rate; total-CK, total
total creatine creatine
kinase; kinase;I; TnI,
TnI, troponin troponin
RBC, red I; RBC,
blood cell; red blood cell;
HGB, hemoglo-
HGB, hemoglobin; HCT, hematocrit; WBC, white blood cell; PLT, platelets
GPX bin; HCT, hematocrit; WBC, white blood cell; PLT, platelets
2GSH + ROOH 
→ ROH + GSSG + H2O At the patients with unstable angina (UA) and good evolution (group IB) we can see a significant
G
R decrease GPx at the time of hospitalization toward the witness lot, but also toward the group with
GSSG + NADPH + H+ → NADP+ + 2GSH At the patients with unstable angina (UA) and good evolution (group IB)
unstable angina and unfavorable evolution (group IA), followed by a significant grow within 48 hours,
and at the discharge the GPx values returning to normal (Fig. 1). Unlike the patients with unstable angina
Glutathione peroxidase concentration was calculated using the following we can see a significant decrease GPx at the time of hospitalization toward the
and good evolution, at the patients with unstable angina who have been re-hospitalized in the following 6
months, it is noticeable a precocious grow of GPx, grow that is still available after 48 hours, the returning
formula: U/l whole blood = 8412 x ∆A 340 nm/min and expressed in U/l. witness lot, but also toward the group with unstable angina and unfavorable
to normal values being slower that in the cases of patients with favorable evolution within 6 months of
Through routine methods we have determined: the complete blood count evolution (group IA), followed by a significant grow within 48 hours, and at the
surveillance (Table II). No significant difference is noticeable of the GPx activity within 48 hours and at
externalization between the two lots (IA and IB) of patients with unstable angina.
(CBC) and the lipidic profile of the patients (high cholesterol, LDL - cholesterol, discharge the GPx values returning to normal (Fig. 1). Unlike the patients with
Table II. The variations of glutathione peroxidase at the patients with unstable angina (UA)
HDL – cholesterol and triglyceride) unstable angina and good evolution, at the patients with unstable angina who
The presence of diabetes at baseline was defined as fasting plasma glucose Pacientshave
with been re-hospitalized in the following 6 months, it is48
Admission noticeable a precocious
hours Discharge
unstable angina (T1) (T2) (T3)
>110 mg/dl or use of oral hypoglycemia agents or insulin (19). A surrogate marker grow of GPx, grow that is still available age
after
u/l
48 hours,
u/gHb
the
u/l
returning
u/gHb
to normal
u/l u/gHb
for obesity content is the body mass index (BMI), which is determined by weigh values being slower that in the cases of patients with favorable evolution within 6
(kilos), divided by the square of the height in meters. In clinical terms, a BMI of months of surveillance (Table II). No significant difference is noticeable of the GPx
25-29 kg/m2 is called overweight; higher BMI (30 kg/m2) are called obesity. The activity within 48 hours and at externalization between the two lots (IA and IB) of
waist circumference was measured on admission, midway between the last rib and patients with unstable angina.
iliac crest and the average of 2 measured was recorded (12).
All data is presented as the mean and standard deviation. Continuous data Table II. The variations of glutathione peroxidase at the patients with unstable angina (UA)
Table II. The variations of glutathione peroxidase at the patients with unstable angina (UA)
analyzed using Student test for independent samples. The hazard ration and their 48
95 percent confidence intervals are reported. The p-value is two-sides; a p-value Pacients with
unstable angina
Admission
(T1)
hours
(T2)
Discharge
(T3)
age u/l u/gHb u/l u/gHb u/l u/gHb
of less was considered to indicate statistical significances. Control group average 198.444 1.491
std.dev. 16.964 0.303
UA with
cardiovascular
event average 63.70 256.900 1.956 272.500 1.969 207.100 1.550
RESULTS AND DISCUSSION Group I A std.dev.

pT (group IA vs control
9.44 55.551 0.412 48.415 0.508 33.351 0.367
group) 0.009 0.001 0.458
The study’s results are presented as tables and graphs. pT (T1 vs T2 and T3)
pT (T2 vs T3)
0.512 0.026
0.002
Table I offers the base-line characteristics of the 55 study participants. It can UA without
cardiovascular
event average 59.81 178.741 1.354 274.296 1.980 197.222 1.465
be noticed that there are no important differences between the two study groups Group I B std.dev. 10.83 45.191 0.399 80.513 0.653 52.491 0.368
pT (grup IB vs control
as far as it concerns the clinic characteristics of the patients. Also, there are no sig- group) 0.047 < 0.001 0.911
pT (T1 vs T2 and T3) < 0.001 0.172
nificant variations of the incidence of cardiovascular risk factors (diabetes, obesity, pT (T2 vs T3) 0.000
pT (IA vs IB) 0.001 0.935 0.505
dyslipidemia). The age of the patients hospitalized with non-Q wave infarction is
significantly bigger than the age of the patients with unstable angina (65+/-9.57 At the patients with myocardial infarction (MI) non-Q that were re-hospitalized
GPx (U/L)
in the first 6 months after the discharge it is noticeable o quick, significant grow
300
vs 60.86+/-10.49, pT=0.0036). In table I it is also shown a significant grow of 250
the fibrinogen (535±163.22 vs 646±193.23, pT=0.043), total creatine kinase of GPx toward the witness lot but also toward the patients with IM non-Q with
200
(128±76.21 vs 639±680.34, pT=0.0055), troponin I (0.409±0.39 vs 35.2±40.84, good evolution after 6 months (317.667 vs 198.44 vs 142.917, pT<0.05) (Table
150
pT=0.0219), and of the leucocytes number (7.96±2.16 vs 9.71±2.31, pT=0.0119) III). Afterwards, the GPx values are significantly decreasing and remain decreased
100
at the patients with non-Q wave myocardial infarction. until the discharge, unlike the patients with good evolution, the significance of the
50
0
UA with cardiovascular event UA without cardiovascular event
control group 198.44 198.44
T1 256.90 178.74
272.50 274.29
2009.19.3(63)  Fiziologia - Physiology

T2
T3 207.10
Fig. 1 The average variations of GPx at the patients with unstable angina (UA)
197.22
17
variations being statistical (T<0.05) (Fig.2) The enzymes in the GPx family scavenge ROS in the vascular and protect
the bioavailability of NO, thereby maintaining normal endothelial function and
antithrombotic vascular milieu. The cellular isoform of GPx (GPx-1) has impaired
endothelium-dependent vasodilatator function (7), and decreased levels of GPx-1
GPx (U/L)
300
in humans have been recently associated with coronary heart disease in a dose-
dependent manner (11).
250 This prospective study of patients admitted with non-ST-segment elevation
acute coronary syndrome (unstable angina and non-Q wave myocardial infarction)
200
showed a direct association between baseline GPx and the onset of MACEs in the
150
group with unstable angina and inversely associated with future fatal and non-fatal
cardiovascular events in the group with non-Q wave myocardial infarction.
100 Although the association between oxidative stress and the development of
both endothelial dysfunction and coronary arteriosclerosis has been studied before
50
(18,21,22,23), the prognostic role of markers of oxidative damage had comparatively
0
received less attention and the results so far are not clear. Indeed, in the particular
UA with cardiovascular event UA without cardiovascular event
control group 198.44 198.44 case of GPx, only 3 reports (4,10,15) have examined its association with the onset
T1
T2
256.90
272.50
178.74
274.29 cardiovascular events and the results (an inverse association between higher GPx
T3 207.10 197.22
and the rate of adverse event during follow-up) were partly in disagreement with
those of our study. Admittedly, those study populations comprised mostly persons
Fig. 1 The average variations of GPx at the patients with unstable angina (UA) with stable ischemic heart disease, whereas in our study all patients were admitted
with on-ST-segment elevation acute coronary syndrome. Another factor that must
be taken into consideration is that the method by which we have determined the
GPx was different from the one used in the earlier studies, which might also yield
GPx (U/L)
350 different results.

Most prognostic studies have analyzed the onset of cardiovascular events in
300
relation to systemic oxidative status (1,3,5,13,15,23) whereas the role of antioxidant
250 status has received less attention, perhaps because its action was assumed to be
200
protective against cardiovascular events during follow-up. Our study show that,
GPx (U/L)
350
in the event of unstable angina, higher GPx probably reflects greater antioxidant
150 300
250
response due to greater oxidative status, and that this response, at least during the
100 200
acute phase, is not associated with a better prognosis but with a worse one. In
150 opposition, at the patients with non-Q wave myocardial infarction, the decreased
50
100
level of GPx at externalization is associated with the growth of the risk of future
0
50
MI 0nonQ with cardiovascular event MI nonQ without cardiovascular event

cardio-vascular complications (cardiovascular death, readmission with acute
coronary syndrome or the need for coronary revascularization).
MI nonQ with cardiovascular event MI nonQ without cardiovascular event
control group control group 198.44 198.44 198.44 198.44
T1 317.67 142.92
T1 T2
317.67 179.67 207.17
142.92
T2 T3
179.67 180.17 210.58
207.17
T3 Fig. 2 The average variations
180.17 of GPx at the patients with non-Q wave
210.58myocardial infarction
At the patients with myocardial infarction (MI) non-Q that were re-hospitalized in the first 6
months after the discharge it is noticeable o quick, significant grow of GPx toward the witness lot but also CONCLUSIONS
toward Fig. 2 The with
the patients average
IM variations
non-Q withof GPx
goodatevolution
the patients with6 months
after non-Q wave myocardial
(317.667 infarction
vs 198.44 vs 142.917,
pT<0.05) (Table III). Afterwards, the GPx values are significantly decreasing and remain decreased until • The coronary acute syndromes are associated with the alternation of the
the discharge, unlike the patients with good evolution, the significance of the variations being statistical
(T<0.05) (Fig.2) Table III. The variations of glutathione peroxidase at the patients balance between the oxidant and anti-oxidant systems.
with non-Q wave myocardial infarction
Table III. The variations of glutathione peroxidase at the patients with non-Q wave myocardial infarction • GPx is an essential component of the enzymatic system of anti-oxidant
48 defense of the body.
Pacients with Admission hours Discharge
MI nonQ (T1) (T2) (T3) • At the patients with non-Q wave myocardial infarction who have been
age u/l u/gHb u/l u/gHb u/l u/gHb
Control group average 198.444 1.491 readmission, the GPx values have precocious increased (at 24 hours from hospital-
std.dev. 16.964 0.303
MI nonQ with ization). Afterwards, the values have decreased, remaining under the values of the
cardiovascular
event average 67.00 317.667 2.398 179.667 1.539 180.167 1.430 control group also at externalization.
Group II A std.dev. 7.18 89.415 0.595 11.776 0.438 35.114 0.449
pT (grup IIA vs
control group) 0.023 0.062 0.322
• At the patients with unstable angina with unfavorable evolution, after 24
pT (T1 vs T2 and
T3) 0.009 0.006
hours from hospitalization, the GPx values were bigger that at the patients with
MI nonQ
pT (T2 vs T3) 0.937 unstable angina with good evolution.
without
cardiovascular
• Taking into consideration the anti-oxidant mechanism’s dynamic related
event average 64.00 142.917 1.066 207.167 1.484 210.583 1.571
Group II B std.dev. 10.73 37.049 0.296 33.701 0.233 26.294 0.347
to the evolution of the patients with non-ST-segment elevation acute coronary
pT (grup IIB vs
control group) 0.000 0.736 0.666 syndrome, the anti-oxidant therapy could be a good method to improve the
pT (T1 vs T2 and
T3) 0.003 0.030 prognostic (25)
pT (T2 vs T3) 0.824
pT (IIA vs IIB) 0.004 0.023 0.049
The enzymes in the GPx family scavenge ROS in the vascular and protect the bioavailability of
NO, thereby maintaining normal endothelial function and antithrombotic vascular milieu. The cellular
isoform of GPx (GPx-1) has impaired endothelium-dependent vasodilatator function (7), and decreased
REFERENCES 13. Raes M, Michiels C, Remacle J. Comparative study of the en-
1. Armstrong EJ, Morrow DA, Sabatine MS. Inflammatory bio- zymatic defense systems against oxygen-derived free radicals:
markers in acute coronary syndromes: part III: biomarkers of the key role of glutathione peroxidase. Free Radic Biol Med, 1987;
oxidative stress and angiogenic growth factors. Circulation, 2006; 3:3-7.
113(8):e289–92. 14. Saraiva RM, Minhas KM, Raju SV, Barouch LA, Pitz E, Schuleri
2. Arthur JR. The glutathione peroxidases. Cell Mol Life Sci, 2000; KH, et al. Deficiency of neuronal nitric oxide synthesis increases
57:1825-35. mortality and cardiac remodeling after myocardial infarction: role
3. Berg K, Wiseth R, Bjerve K, Brurok H, Gunnes S, Skarra S, et al. Oxi- of nitroso-redox equilibrium. Circulation, 2005; 112(22):3415–22.
dative stress and myocardial damage during elective percutaneous 15. Schnabel R, Lackner KJ, Rupprecht HJ, Espinola-Klein C, Torze-
coronary interventions and coronary angiography. A comparison wski M, Lubos E, et al. Glutathione peroxidase-1 and homocysteine
of blood-borne isoprostane and troponin release. Free Radic Res, for cardiovascular risk prediction: results from the AtheroGene
2004;38(5):517–25. study. J Am Coll Cardiol, 2005; 45(10): 1631–7.
4. Blankenberg S, Rupprecht HJ, Bickel C, Torzewski M, Hafner G, 16. Shiomi T, Tsutsui H, Matsusaka H, Murakami K, Hayashidani S,
Tiret L, et al.; AtheroGene Investigators. Glutathione peroxidase 1 Ikeuchi M, et al. Overexpression of glutathione peroxidase prevents
activity and cardiovascular events in patients with coronary artery left ventricular remodeling and failure after myocardial infarction
disease. N Engl J Med, 2003; 349 (17):1605–13. in mice. Circulation, 2004;109(4): 544–9.
5. Elesber AA, Best PJ, Lennon RJ, Mathew V, Rihal CS, Lerman LO, 17. Sies H. Glutathione and its role in cellular functions. Free Radic
Lerman A. Plasma 8-iso-prostaglandin F2alpha, a marker of oxida- Biol Med, 1999;27: 916-21.
tive stress, is increased in patients with acute myocardial infarction. 18. Stephens JW, Gable DR, Hurel SJ, Miller GJ, Cooper JA, Hum-
Free Radic Res, 2006; 40(4):385–91. phries SE. Increased plasma markers of oxidative stress are associ-
6. Flohe L. Glutathione peroxidase. Basic Life Sci, 1988; 49:663-8. ated with coronary heart disease in males with diabetes mellitus
7. Forsberg L, de Faire U, Morgenstern R. Oxidative stress, hu- and with 10-year risk in a prospective sample of males. Clin Chem,
man genetic variation, and disease. Arch Biochem Biophys, 2001; 2006;52 (3):446–52.
389:84-93. 19. The Expert Committee On The Diagnosis And Classificationof
8. Forgione MA, Cap A, Liao R, et al. Heterozygous cellular glu- Diabetes Mellitus. Follow-up report on the diagnosis of diabetes
tathione peroxidase deficiency in the mouse: abnormalities in mellitus, Diabetes Care, 2003; 26:3160-3167
vascular and cardiac function and structure. Circulation, 2002; 20. Ursini F, Maiorino M, Brigelius-Flohe R, et al. Diversity of gluta-
106:1154-8. 11. thione peroxidases. Methods Enzymol, 995;252:38 - 53.
9. Fukai T, Folz RJ, Landmesser U, Harrison DG. Extracellular su- 21. Vassalle C, Botto N, Andreassi MG, Berti S, Biagini A. Evidence
peroxide dismutase and cardiovascular disease. Cardiovasc Res, for enhanced 8-isoprostane plasma levels, as index of oxidative
2002; 55:239-49. stress in vivo, in patients with coronary artery disease. Coron Artery
10. José Manuel García-Pinilla, Julio Gálvez, Fernando Cabrera- Dis, 2003;14(3):213–8.
Bueno, Manuel Jiménez-Navarro, Juan José Gómez-Doblas, 22. Vassalle C, Petrozzi L, Botto N, Andreassi MG, Zucchelli GC.
Milagros Galisteo et al. Baseline glutathione peroxidase activity Oxidative stress and its association with coronary artery dis-
affects prognosis after acute coronary syndromes. Tex Heart Inst ease and different atherogenic risk factors. J Intern Med 200,
J., 2008; 35(3): 262–267. 256(4):308–15.
11. Massafra C, Gioia D, De Felice C, Muscettola M, Longini M, 23. Vassalle C, Boni C, Di Cecco P, Landi P. Elevated hydroperoxide
Buonocore G. Genderrelated differences in erythrocyte glutathi- levels as a prognostic predictor of mortality in a cohort of patients
one peroxidase activity in healthy subjects. Clin Endocrinol (Oxf ), with cardiovascular disease. Int J Cardiol, 2006; 110(3):415–6.
2002;57:663-7. 24. Vasilyev N, Williams T, Brennan ML, Unzek S, Zhou X, Heinecke
12. Poirier P, Giles TD, Bray GA et al. Obesity and cardiovascular JW, et al. Myeloperoxidase-generated oxidants modulate left ven-
disease: pathophysiology, evaluation and effect of weight loss an tricular remodeling but not infarct size after myocardial infarction.
update of the 1997 American Heart Association Scientific state- Circulation, 2005;112(18):2812–20.
ment on obesity and heart disease from the obesity committee 25. Violi F, Loffredo L, Musella L, Marcoccia A. Should antioxidant
of the council on nutrition, physical activity and metabolism, status be considered in interventional trials with antioxidants?
Circulation, 2006; 113:898-918 Heart, 2004;90(6):598–602.
ACTIVITATEA GLUTATION PEROXIDAZEI AFECTEAZA

PROGNOSTICUL IN SINDROMUL CORONARIAN ACUT FARA
SUPRADENIVELARE DE SEGMENT ST
REZUMAT
Enzimele celulare antioxidante, ca glutation peroxidaza detin un rol central in controlul speciilor reactive de oxigen. In vitro, datele si studiile efectuate pe animale
sugereaza ca aceste enzime au rol protector impotriva aterosclerozei, dar sunt putine date relevante la om. Scopul studiului a fost determinarea asocierii dintre
statusul redox si prognosticul pacientilor cu sindrom coronarian acut fara supradenivelare de segment ST (angina instabila si infarct miocardic fara unda Q). Metoda:
Au fost evaluati 55 de pacienti, cu varsta sub 75 ani internati consecutiv in Clinica de Cardiologie a Spitalului Clinic de Urgenta Constanta in perioada mai 2008 – mai
2009 cu diagnosticul de sindrom coronarian acut fara supradenivelare de segment ST si 19 persoane voluntare (fara afectiuni cardiovasculare, hipercolesterolemie,
diabet zaharat si nefumatoare). Pacientii au fost impartiti in doua grupuri: grup I – pacientii cu angina instabila (37 pacienti, din care 10 au necesitat reinternare in
urmatoarele 6 luni) si grup II – pacientii cu infarct miocardic acut fara unda Q (18 pacienti, din care 6 pacienti au suferit reinternare in primele 6 luni post-infract).
Activitatea glutation peroxidazei (GPx) a fost determinata la perioade fixe: T1 – primele 24 de ore de la internare, T2 – la 48 ore de la internare si T3 – la externare.
Dupa externare pacientii au fost monitorizati si s-au notat urmatoarele date: perioada de urmarire, decesul de cauza cardiovasculara si incidenta evenimentelor
cardiovasculare majore. Rezultate: Studiul demonstreaza o asociere directa intre nivelul GPx si incidenta evenimentelor coronariene majore in grupul cu angina
instabila si o asociere inversa cu evenimentele cardiovasculare fatale sau non-fatale in grupul pacientilor diagnosticati cu infarct miocardic fara unda Q. Concluzii:
La pacientii cu sindrom coronarian acut fara supradenivelare de segment ST enzima antioxidanta GPx pare a avea un rol protector impotriva efectelor oxidative
adverse. Analiza activitatii GPx poate oferi informatii superioare in evaluarea riscului cardiovascular comparativ cu masurarea doar a factorilor de risc traditionali.
Cuvinte cheie: sindrom coronarian acut, markeri biologici/sange, glutation peroxidaza, oxidare-reducere, stress oxidativ

THE INVOLVEMENT OF OXIDATIVE STRESS IN THE
ULCEROUS PATHOLOGY INDUCED IN THE RATS BY ASPIRIN
SIMONA MARTURA1, DOINA DAICOVICIU2, SOIMITA SUCIU2, ADRIANA MURESAN2, DOINITA
CRISAN3, PETRU A. MIRCEA1, SIMONA VALEAN1, OANA DAMIAN4
1
Medical Clinic I
2
Physiology Department
3
Pathological Anatomy Department
University of Medicine and Pharmacy "Iuliu Hatieganu" Cluj-Napoca, Romania
4
"Heinrich Braun Krankenhaus" Zwickau, Germany
ABSTRACT
Various studies show that reactive oxygen species (ROS) are involved in ulcerous disease. This has multiple etiopathogenetic factors, among which the ad-
ministration of NSAIDs plays an important role. The digestive lesions may be prevented by the association of proton pump inhibitors (PPI), and there are also
data that indicate the advantages of the therapeutic supplementation of potentially antioxidant potions.The aim of the study was to evidence the growth
of the oxidative stress level due to the administration of aspirin, and its decrease following the association of the antiulcerous protection, the antioxidant.
There are considerable variations of the oxidant-antioxidant balance among the study groups. The aspirin treatment alters considerably the serum oxidative
stress parameters and the gastric tissue in favor of prooxidants. The preventive administration of PPI considerably improves the status of serum antioxidants.
PPI therapy decreases the level of tissue antioxidants (probably due to excessive consumption), but pathomorphologically improves the gastric mucous
membrane. The association with antioxidants decreases the level of reactive oxygen species (ROS) and improves the anatomo-pathological aspect of the
gastric mucous membrane.
Key words: oxidative stress, NSAIDs, peptic ulcer
INTRODUCTION oxidative lesions which probably play an important role in the pathophysiology of
Peptic ulcer and gastritis have multiple etiopathogenetic factors, and one of digestive ulcerations induced by NSAIDs (5,10). NSAIDs inhibit the cyclooxigenase
the major factors of aggression is the formation of a reactive oxygen species (ROS). isoforms and decrease the level of prostaglandin E2 in the gastric mucous membrane,
The involvement of free radicals derived from oxygen, such as the superoxide anion, causing ulceration, and it delays the cure of ulcer by the reduction of the level of
hydrogen peroxide and hydroxyl radical, is demonstrated in the pathogenesis of the prostaglandins and the prevention of angiogenesis mediated by these. In addi-
ischemic lesions of the gastro-intestinal mucous membrane, as well as in other tion to this, NSAIDs decrease the gastric production of mucus, which may lead to
types of its lesions that are induced by NSAIDs, ethanol, food diet and Helicobacter hemorrhagic ulcer. So, the drugs that prevent the progression of ulcer by antioxidant
pylori (23). The reactive oxygen species generated by the metabolism of arachidonic action and also promote the secretion of PGE2, gastric mucus and increase factors,
acid, blood platelets, macrophages and cells of smooth brawn may contribute may accelerate the cure of gastric ulcer (4). The proton pump inhibitors (PPI) are
to the formation of gastric mucous membrane lesions. Therefore, through the currently used in the treatment and prevention of gastroduodenal lesions induced
scavenger action against free radicals, the reactive oxygen metabolites may be by NSAIDs, their efficiency being related to the inhibition of gastric acid secretion.
useful by protecting the gastric mucous membrane from oxidative lesions or by The gastric protection provided by pantoprazol is also given by its ability to interfere
the acceleration of the healing of gastric ulcers (19).Gastric ulcerations associated with NSAIDs secondary oxidative and inflammatory lesions. Pantoprazol acts with
with NSAIDs appear in 30% of the patients which require to be hospitalized and are the help of direct and indirect antioxidant mechanisms, protects the gastric mucous
associated with a high mortality rate (13). NSAIDs are frequently prescribed due to membrane against the oxidative injuries caused by focal ischemia and the activation
their efficiency in fighting pain, inflammation and fever. Their use is associated with of neutrophils induced by NSAIDs (10). Vitamin C is a hydrosoluble antioxidant that
the appearance of some digestive side effects, such as erosions of the gastric mucous eliminates the reactive oxygen species (ROS), among which: superoxide radical,
membrane, ulcerations, bleeding, perforation, as well as the high risk of hemorrhage hydroxyl radical, hydrogen peroxide, singlet oxygen and hypochlorous acid; it plays
from the preexisting peptic ulcers. The pathogenesis of gastrointestinal lesions the role of antioxidant of vitamin E, by reducing the radical of vitamin E at the level of
induced by NSAIDs may depend on the independent processes of prostaglandins, liquid / water. It prevents the burn of neutrophils in the endothelium by its scavenger
such as oxidative phosphorylation, the decrease of the proliferation of the mucous action on the derived ROS at the level of the activated neutrophils. Vitamin E is a
membrane cells and the activation of the neutrophils, followed by the increase of liposoluble antioxidant and plays the role of destroying the bonds in the peroxidation
endothelial adhesion. Finally, they produce the decrease of microvascularization process of the cell membrane lipids. At the same time, it is a scavanger of ROS, such
and the hyperproduction of reactive oxygen metabolites, able to induce tissue as superoxide radical, hydroxyl radical and singlet oxygen. Vitamin E exerts an anti-
Received March 2009. Accepted June 2009. Address for correspondence: Dr. Simona Martura, Medical Clinic I, University of Medicine and Pharmacy "Iuliu Hatieganu" Cluj-Napoca, Romania

inflammatory action by inhibiting the O2 production - in the activated neutrophils, contained: selenium 50 μgrams, provitamin A (beta-carotene) 10 mg, vitamin C
the adhesion of neutrophils to endothelial cells and the transendothelial migration (ascorbic acid) 100 mg and vitamin E (DL-tocopherol acetate) 40 mg (11).
of neutrophils (17). The action of vitamin E is enhanced by selenium and protects After the last dose received by gavage, the animals were not given food for 24
other liposoluble antioxidants; it protects especially the lipids of the membranes hours before they were sacrificed. The animals included in the study were individually
(11). Selenium is part of the composition of a primordial enzyme that fights ROS weighed both at the start and at the end of the experiment.
(glutathione peroxidase- through selenomethionine and selenocysteine). Vitamin
A presents precursors of vegetal origin (carotenoids) which may be used as very
strong antiradicals; the most common are beta-carotene, lycopene and lutein (9). Biological sampling
It is well known that in the case of chronic peptic ulcers and gastroduodenitis, the Blood samples were taken from the internal angle level of the eye – the venous
routine of applying the neutralizing or protective therapy, or agents that decrease orbital sinus – with the help of a capillary tube (approximately 1 ml/experimental
gastric secretion, not only produces the reduction of the symptoms and the remission animal). The blood was immediately centrifuged for 5 minutes at 3500 rotations/
of the inflammatory changes, but also has an inhibitory effect on the engendering min. After the plasma was obtained, it was immediately frozen and kept at a
of free oxygen radicals. The results of the researches of other authors emphasize temperature of -800 C until it was processed. After blood sampling, the animals
the favorable effect of vitamin C supplementation in patients with chronic recurrent were euthanized by cervical dislocation, the necropsy was performed. The abdomen
gastroduodenitis, and a decrease in the risk of development of gastric cancer is was cut open along the white line, the peritoneal cavity was examined and the
also suggested for these patients. Even though the benefits of antioxidant vitamin stomach was exposed. The stomach was harvested in isotonic solution of KCI, on
supplementation are demonstrated in the treatment of some gastric diseases (for ice, and subsequently it was cut along the great curvature so that the macroscopic
example for vitamin C), there are still not sufficient studies available to formulate examination could be done. During the evaluation, the samples were kept on ice.
specific therapeutic recommendations (3). After the completion of the process of counting the lesions, parts of the gastric
periulcerous zone were excised and frozen for the histopathological examination
and in order to determine the oxidative stress markers. The samples were kept at a
MATERIAL AND METHODS temperature of -800 C until they were processed.
The experimental study that we performed was one of prospective longitudinal
type, and the collection of the data was the exposed – non-exposed type. The macroscopic examination of the gastric lesions
The major objective of this study was to monitor the variation of oxidative stress The lesions were categorized as follows:
parameters as a result of aspirin administration; in parallel, the secondary objectives - score 0 – no ulcerations or up to 3 punctiform ulcerations
were to monitor the changes in the general state and the pathomorphological state - score 1 – more than 3 punctiform ulcerations
at the level of gastric tissue. - score 2 – between 1 and 5 small-size ulcers (<2 mm)
The purpose of this study was to demonstrate the increase of oxidative stress - score 3 – more than 5 small ulcers with a diameter smaller than 2 mm
(OS) after the administration of aspirin and the decrease of OS as a result of the - score 4 – one or more gigantic ulcers, with a diameter of more than 2 mm (12,13).
anti-ulcer protection, antioxidant therapy, respectively. The indicators which were determined from the blood and from the gastric
tissue were:
- prooxidants: malondialdehyde (MDA) and the carbonilated proteins (CP)
Conditions - antioxidants: the hydrogen donor capacity (HD) and the thiol group
The researches were conducted on white male Wistar rats, aged approxima- (sulfhydryl) (SH)
tively 10 weeks old, with a weight between 170 – 250 g. The animals were kept in
the biobase of the Physiology Department of ”Iuliu Haţieganu”UMPh Cluj-Napoca,
under standard laboratory conditions, at a temperature of 23 +/- 0C, with a duration Methods to determine the oxidative
of 12 hours of exposure to light and 12 hours exposure to darkness, with water and stress indicators
food ad libitum. The animals had a period of 1 week to adapt themselves before Malondialdehyde (MDA) was determined through the method of fluorescein
the experiment started. dosage, according to Conti. The concentration values were expressed in nmol/ml,
for the serum and in nmol/mg protein, for the gastric tissue (14).The carbonylated
proteins (CP) were dosed using Rezsnick’s method. The results were expressed in
Groups nmol/ml, for the serum and in nmol/mg protein, for the gastric tissue (15).The
4 groups of 10 male Wistar rats, aged approximatively 10 weeks old, with a determination of the hydrogen donor capacity (HD) was made using a dosage
weight between 170 – 250 g, were included in the study. method elaborated by Janaszewska. The results were expressed both in the serum
- group I (control) –received distilled water by gavage for 7 days; and in the gastric tissue, as the inhibition percentage of the free radical (i%) (16).
- group II –received by daily gavage aspirin suspended in carboxymethylcel- The determination of the content of the total thiol group (sulfhydryl) (SH) was made
lulose, in a dose of 200 mg/Kg body weight for 7 days; according to the dosage method of Hu. The values were expressed in μmol/ml in
- group III –received by daily gavage aspirin suspended in carboxymethylcel- the serum and in nmol/mg protein, for the gastric tissue (17).
lulose, in a body dose associated with PPI (pantoprazol in a dose of 60 μmol/Kg
body weight) for the 7 days (4) The statistical study of results
- group IV –received by daily gavage aspirin suspended in carboxymethylcel- It was performed using the SPSS 13 program. For the detection of the sig-
lulose, in a dose of 200 mg/Kg body weight associated with PPI (pantoprazol in a
nificance of the statistical difference from the average, the „t” Student test (for two
dose of 60 μmol/Kg bodyweight) and a prepared antioxidant, each capsule of which

groups) and ANOVA (for three or more groups) were used. Two aspects were studied
in the „t” Student test: the descriptive analysis of the data and the analysis of the
significance of the difference between the average values; a 95% confidence interval
was used; the results in which p < 0.05 were considered to be eloquent.
RESULTS
Evolution of the oxidative stress markers
Serum MDA had the following variations: an insignificant increase of the values
in group II compared to the control group; an insignificant decrease in group II Fig. 3. Variation of serum hydrogen donor capacity
compared to the first two groups; a significant decrease of the values of group IV
compared to those of the control group and group II, with an insignificant variation
compared to group III (Fig. 1).No significant variations in serum CP values were
detected (Fig. 2).Serum HD presented the following alterations: they decreased
significantly in group II compared to the control group; they increased significantly
in group III compared to group II; otherwise, the variations of the values between
the groups were insignificant (Fig. 3). For the serum thiol groups, the following were
noticed: they decreased significantly in group IV compared to group II; they increased
significantly compared to group III; they did not vary significantly compared to the
control group (Fig. 4). Malondialdehyde at gastric tissue level presented: a significant
decrease in group II compared to the control group; a significant decrease in group
IV compared to the first two groups, with insignificant variations compared to the
control group (Fig.5). The levels of carbonylated proteins (CP) in the gastric tissue Fig. 4. Variation of serum sulfhydryl groups
did not undergo significant alterations between the rat groups under observation
(Fig. 6). The level of hydrogen donors (HD) in the gastric tissue presented differences
between the groups: they decreased significantly in group II compared to the control
and in group IV compared to group II, the rest of the variations between the groups
were insignificant (Fig. 7).Except one insignificant difference between groups II and
III, the thiol groups (SH) varied as follows: they decreased significantly in the last
three groups compared to the control group, meaning that they were situated at a
lower level in group IV compared to the rest of the groups (Fig.8).
Fig. 5. Variation of malondialdehyde in the gastric tissue
Fig. 1. Variation of serum malondialdehyde
Fig. 6. Variation of carbonylated proteins in the gastric tissue
Evolution
No significant changes were identified in the general state or in the evolution
of individual weight. Mortality was less than 5%, and was most probably caused
Fig. 2.Variation of serum carbonylated proteins by individual sensitivity.

abundant in the areas of discontinuity of the mucous membrane, deep chorion and submuco
the muscularis of the mucous membrane). Group III presented an undamaged surface epit
chorion contained a mixed inflammatory lymphoplasmacytic and neutrophilic infi
inflammatory cells were more abundant in the deep region of the mucous membrane and at
the muscularis of the mucous membrane.Group IV also presented an undamaged surface epith
no erosions or ulcerations, but it had a reduced inflammatory lymphoplasmacytic infiltrate, lo
level of the deep chorion. Some lymphocytes in the muscularis of the mucous membran
observed, but with absent polymorphonuclear neutrophils (Fig.9).
Fig. 7. Variation of the hydrogen donor capacity in the gastric tissue
Fig. 9. Histopathological appearance of the gastric mucosa in the studied groups

Fig. 9. Histopathological
MDAappearance of CP
the gastric mucosa
HD in the studied
SH groups
Table I. The alterations
serum of the
tissue
indicatorsserum tissue serumbalance
of the oxidant/antioxidant tissue serumgroups tissue
in the studied
MDA CP HD SH
Average 1.350 0.167 0.921 0.970 26.090 23.130 0.175 0.242
Group I serum tissue serum tissue serum tissue serum tissue
Standard MDA CP HD SH
Average0.2361.350 0.071 0.167 0.445
0.921 0.450
0.970 9.182
26.090 23.1306.2640.175 0.2270.242 0.081
Fig. 8. Variation of sulfhydryl groups in the gastric tissue deviation
Group I serum tissue serum tissue serum tissue serum tissue
AverageStandard1.3800.236 0.101 0.071 0.926
0.445 0.850
0.450 16.4106.26424.830
9.182 0.227 0.2210.081 0.099
deviation
Average 1.350 0.167 0.921 0.970 26.090 23.130 0.175 0.242
Group II
Table I. The alterations of the indicators of0.372
Standard
Group I Average the
0.926 oxidant/antioxidant
Standard0.3521.380 0.037
0.8500.101
0.392 16.410 balance
7.11424.8304.523
0.221 0.172in the0.218
0.099 studied groups
deviation
Group II Standard
deviation
0.236 0.071 0.445 0.450 9.182 6.264 0.227 0.081
0.352 0.037 0.372 0.392 7.114 4.523 0.172 0.218
The macroscopic examination of the gastric lesions Group Averagedeviation
Average1.0351.380 0.062
Group II Average
0.101 0.860
1.037 16.410
0.926
0.850 24.370 24.8309.790 0.221 0.156 0.099 0.105
Standard 1.035 0.0620.860 1.037 24.370 9.790 0.156 0.105
0.352 0.0370.372 0.392 7.114 4.523 0.172 0.218
The macroscopic examination of the gastric mucous membrane, after the stomach III Group
Standarddeviation
III Standard0.658
deviation
0.023 0.157 0.420 6.468 3.593 0.033 0.051
Average 0.658
1.035 0.023
0.0620.157
0.860 0.420
1.037 6.468
24.370 3.593
9.790 0.033
0.156 0.051
0.105
deviation
was sectioned along the great curvature, showed that the animals in the control group Group
Average Standard0.0200.020 0.180 0.910 1.005 16.220 16.22018.530 18.530
III Average 0.658 0.180
0.0230.910
0.157 1.005
0.420 6.468 3.593 0.196 0.196
0.033 0.065
0.051
0.065
did not present any pathological alterations.The second group showed lesions of the Group IV
Group
IV
Standard
deviation
Standard
Average0.4420.442 0.059
0.020 0.059
0.1800.321
0.321
0.910 0.305
0.305
1.005 6.623
6.623
16.220 4.334
18.530 4.3340.025
0.196 0.0250.262
0.065 0.262
gastric mucous membrane categorized according to the score presented before: 40% IV
Group
Standard
deviation
deviation
0.442 0.059 0.321 0.305 6.623 4.334 0.025 0.262
score 1, 60% score 4.The third group presented lesions with a smaller degree of sever-Table II. The statistical significance (p) of the difference in the
TableTable
II. The II. The
statistical statistical
significance
deviation significance
(p) of the (p) of
difference inthe
the difference
indicators ofin the
the indicators of
oxidant/antioxidantthe oxidant/antioxi-
balance between different
indicators of the oxidant/antioxidant balance between different
groups
ity compared to group II, 40% presented score 1 lesions, and 60% presented score 0 dant balance between
Table II. The statistical significance (p) of the difference ingroups
different
theOxidative
indicatorsstress
groups
of theindicators
oxidant/antioxidant balance between different
groups
Oxidative stress indicators
lesions.The forth group presented score 0 lesions of the mucous membrane , meaning Comparison between
MDA Oxidative stress indicators
CP DHD SH
the groups:
that the mucous membrane was affected comparably to the control group and less Comparison between
Comparison between
the groups:
MDAMDA
serum tissue
CP
serum CP tissue
DHD
serumDHD tissue serumSH tissue
SH
the groups:
severely compared to the animals of group II, group III, respectively (Fig. 2). 0.832
serum
I-II serum
tissue tissue
serum
0.010 serum
tissue
0.974 tissue
serum
0.510 serum 0.570 tissue 3.10
tissue
0.002 serum tissue serum
0.0007 tissue
0.832
I-II
I-III 0.8320.080 0.010
0.0003 0.974
0.680 0.510
0.720 0.002
0.630 0.570
0.00002 3.10
0.120 0.0007
0.0002
Histopathological examination I-II 0.010 0.974 0.510 0.002 0.570 3.10 0.0007
I-III 0.080 0.0003 0.680 0.720 0.630 0.00002 0.120 0.0002
No pathological changes were found at the level of the gastric mucous membrane I-III
I-IV
0.080
0.020 0.660
0.0003
0.950
0.680
0.830
0.720
0.320
0.630
0.07
0.00002
0.065 0.000
0.120 0.0002
I-IV 0.020 0.660 0.950 0.830 0.320 0.07 0.065 0.000
of the control group. The gastric mucous membrane of the rats of group II presented: II-III 0.088 0.040 0.572 0.350 0.009 3.140 4.35 0.777
I-IV 0.020 0.660 0.950 0.830 0.320 0.07 0.065 0.000
focal erosions and profound areas of ulcerations, superficial chorion with small hem- II-III
II-IV 0.088
0.030 0.040
0.002 0.572
0.920 0.350
0.340 0.009
0.950 3.140
0.004 4.35
0.010 0.777
0.040
orrhagic foci, an inflammatory neutrophilic infiltrate more abundant in the areas of II-III II-IV
III-IV
0.0880.960
0.030 0.040
0.002
0.0004
0.572
0.920
0.724
0.350
0.340
0.870
0.009 0.004
0.950
0.004 0.001
3.1400.010
0.040
4.35
0.040
0.057
0.777
discontinuity of the mucous membrane, deep chorion and submucosa (close to the II-IV III-IV
0.030 0.960 0.002 0.0004 0.724
0.920 0.870
0.340 0.004 0.950 0.001 0.0040.040 0.010
Table III. Distribution and categorization of the gastric lesions observed by macroscopic examination
0.057
0.040
muscularis of the mucous membrane). Group III presented an undamaged surface Table III.
Score Distribution
Group I
and
Group II
categorization of the gastric
Group III
lesions observed by
Group IV
macroscopic examination
III-IV 0.9600 0.0004 100% 0.724 - 0.870 Group 60%0.004
Table III. Distribution and categorization of the gastric lesions observed
100%
0.001 0.040 0.057
epithelium; the chorion contained a mixed inflammatory lymphoplasmacytic and neu- Score 1
Score 20
Score
Group
- I
100%
-
Group
40% II
--
40%III
60%-
Group- IV
100% -
trophilic infiltrate. The inflammatory cells were more abundant in the deep region of the Score 31
Score by macroscopic examination
-- 40%- 40%- --
Table III. Distribution
Score 42
Score and categorization
-- of- the gastric lesions
60% -- observed by- -macroscopic examination
Score 3 Group-I Group- II -
Group III - Group IV
mucous membrane and at the level of the muscularis of the mucous membrane.Group Score 0 Score 4
100% - 60%
- 60% -
100% -
IV also presented an undamaged surface epithelium, with no erosions or ulcerations, DISCUSSIONS Score 1 - 40% 40% -
ThereScorewere2 significant differences
- in the- oxidant-antioxidant
- balance between - the study
DISCUSSIONS
but it had a reduced inflammatory lymphoplasmacytic infiltrate, located at the level groups.The
Thereresults
Scorewere3 ofsignificant
the researches- over the
differences in past years suggest -that free
the- oxidant-antioxidant oxygen
balance radicals
- the are
between co-
study
responsible, in
groups.The Score addition to the etiologic
results4 of the researches factor, for
- over the past the lesions of the
60%years suggest thatmucous
- membrane of
- the digestive
of the deep chorion. Some lymphocytes in the muscularis of the mucous membrane tract and for the initiation of the inflammatory process. The
free oxygen radicals
inflammation, which is a defense
responsible, in addition to the etiologic factor, for the lesions of the mucous membrane of the digestive
are co-
reaction
from
tract the
and body,
for theisinitiation
at the same time a cause of process.
tissue damage. During the which
respiratory explosion of the
could be observed, but with absent polymorphonuclear neutrophils (Fig.9). phagocytes of the
from the body,
of the
is atinflammatory
inflammatory
the same timecells, almost
a cause
The inflammation,
3.2 million
of tissue damage.superoxide
During theanion
is a defense
radicals,
respiratory
reaction
and also
explosion 3.6
of the
DISCUSSIONS
phagocytes of the inflammatory cells, almost 3.2 million superoxide anion radicals, and also 3.6
There were significant differences in the oxidant-antioxidant balance between the study
groups.The results of the researches over the past years suggest that free oxygen radicals are co-
responsible, in addition to the etiologic factor, for the lesions of the mucous membrane of the digestive
tract and for the initiation of the inflammatory process. The inflammation, which is a defense reaction
from the body, is at the same time a cause of tissue damage. During the respiratory explosion of the
phagocytes of the inflammatory cells, almost 3.2 million superoxide anion radicals, and also 3.6

DISCUSSIONS REFERENCES
There were significant differences in the oxidant-antioxidant balance between 1. Al-Moutairy AR, Tariq M. Effect of vitamin E and selenium on
hypothermic restraint stress and chemically-induced ulcers. Dig
the study groups.The results of the researches over the past years suggest that free Dis Sci. 1996 Jun; 41(6):1165-71.
oxygen radicals are co-responsible, in addition to the etiologic factor, for the lesions 2. Augusto AC, Miguel F, Mendonca S, et al. Oxidative stress expres-
of the mucous membrane of the digestive tract and for the initiation of the inflam- sion status associated to Helicobacter pylori virulence in gastric
diseases. Clinical Biochemistry 2007 (40);615-622.
matory process. The inflammation, which is a defense reaction from the body, is 3. Bala G, Czerwionka-Szaflarska M, Drewa G, et al. An evaluation
at the same time a cause of tissue damage. During the respiratory explosion of the of the impact of supplementation with antioxidants vitamins on
phagocytes of the inflammatory cells, almost 3.2 million superoxide anion radicals, oxidation stress parameters in children with chronic recurrent
and also 3.6 millionperoxide hydrogen molecules are generated in one second. The gastroduidenitis. Med Sci Monit 2002; 8(1):14-18.
4. Banerjee D, Maity B, Nag SK, et al. Healing Potential of Picrorhiza
stimulated phagocytes represent one of the main sources of free oxygen radicals kurroa (Scrofulariaceae) rhizomes against indomethacin-induced
in the body (3).Our study has demonstrated that the administration of aspirin gastric ulceration: a mechanistic exploration. BMC Complementary
significantly alters serum and tissue oxidative stress parameters (meaning that it and Alternative Medicine 2008; 8(3):1-14.
5. Blandizzi C, Fornai M, Colucci R, et al. Lansoprazole prevents
alters the oxidant-antioxidant balance in favor of the first). The rats that were given experimental gastric injury induced by non-steroidal anti-inflam-
aspirin alone presented the appearance of necrotic areas of the mucous membrane, matory drugs through a reduction of mucosal oxidative damage.
associated with extensive polymorphonuclear cell infiltrate. The results of our re- World J. Gastroenterol 2005; 11(26): 4052-60.
search are correlated with evidence showing that NSAIDs, acting through local and 6. Cioli V, Silvestrini B, Dordoni F. Evaluation of the potential of gas-
tric ulceration after administration of certain drogs. Experimental
systemic mechanisms, lead to ischemic and inflammatory changes which result in and molecular pathology 1967;6:68-83.
gastric neutrophil infiltration, the release of oxygen metabolites and the peroxida- 7. Conti M, Morand PC, Levillain P et al. Improved Fluorometric
tion of the cellular mucous membranes. In particular, focal ischemia produced by Determination of Malonaldehyde. Clin. Chem. 1991;37(7):1273-
1275.
the adhesion of neutrophils to the vascular endothelium, the capillary connection 8. Demir S, Yilmaz M, Koseoglu M, et al: Role of free radicals in peptic
and the intravascular deposit of fibrin were recognized as an early event in the ulcer and gastritis. Turk J. Gastroenterol. 2003;14(1):39-43.
pathogenesis of gastric oxidative injuries produced by NSAIDs. These alterations 9. Favier A. Le stress oxidant- Interet conceptual et experimental
dans la comprehension des mecanismes des maladies et poten-
are further amplified by subsequent tissue infiltrations of polymorphonuclear cells, tial therapeutique. http://www.maomusique.com/uploaded/ Joylulu/
activation due to which a massive release of oxygen radicals and other inflamma- Favier.pdf
tory mediators responsible for epithelial lesions is produced (10). The preventive 10. Fornai M, Natale G, Colluci R et al. Mechanisms of protection
administration of PPI has significantly improved the serum antioxidant status. There by pantoprazole against NSAID- induced gastric mucosal damage.
Naunyn-Schimiedeberg”s Arch Pharmacol 2005;372(1):79-87.
are studies that prove that they alone have antioxidant properties (2,7,10,21). Lo- 11. Hauret MC. Les antioxydants http://www.chateaudavanton.
cally, the administration of PPI partially prevents gastric lesions or, at least, reduces com/blog/index.php?2007/02/16/17-les-antioxydants
their severity. In parallel, a reduction of tissue antioxidants was noticed, probably 12. Hu ML. Methods in Enzymology, 1994;233:380-384.
13. Jainu M, Vijai Mohan K, Shyamala Devi CS: Gastroprotective
due to excessive consumption which contributes to local defense. The addition of effect of Cissus quadrangularis extract in rats with experimentally
antioxidants further decreases the oxidative excess and improves the macroscopic induced ulcer. Indian J. Med. Res. 2006;(123):799-806.
and anatomo-pathological aspect of the gastric mucous membrane. These aspects 14. Janaszewska A, Bartosz G: Assay of total antioxidant capacity:
are to be found in other studies supporting that the addition of vitamin E to diet comparison of four methods as applied to human blood plasma.
Scand. J. Clin. Invest.2002;62:231-236.
is able to protect the cellular mucous membrane against the alterations produced 15. Mozsik G, Javor T, Toth G, et al. Interrelationships between
in the case of ischemia-reperfusion lesions induced in rats, by the inhibition of the gastric cytoprotective effects of vitamin a and beta-carotene
lipid peroxidation and the interference with neutrophilic infiltrates (16). Another and the gastric mucosal superoxid dismutase activity in rats. Acta
Physiol Hung.1984;64 (3-4):315-8.
experimental study of gastric lesions produced by ethanol or HCl showed that 16. Naito Y, Yoshikawa T, Matsuyama K et al. Effect of vitamin E in
vitamin A and beta-carotene are able to significantly prevent the number and the gastric mucosal injury induced by ischaemia-reperfusion in nitric
severity of the lesions of the gastric mucous membrane, but these agents fail to oxide-depleted rats. Aliment Pharmacol Ther 1999;13:553-559.
compensate the decrease of the SOD activity of the mucous membrane diminished 17. Ohta Y, Kobayashi T, Imai Y, et al. Effect of Oral Vitamin E Ad-
ministration on Acute Gastric Mucosal Lesion Progression in Rats
by the administration of HCl (15). We obtained the same findings regarding the Treated with Compound 48/80, a Mast Cell Degranulator. Biol.
local antioxidant capacity in the study above. Another experimental study dem- Pharm. Bull.2006;29(4):675-683.
onstrated that selenium and vitamin E treatment in rats with stress induced ulcers 18. Passoni CR, Coelho CA. Ascorbic acid supplementation has a
cytoprotective effect on secondary billiary cirrhosis: experimental
significantly reduced the acid base gastric secretion, their combination producing a study in young rats. J Pediatr (Rio J). 2008;84(6):522-8.
better inhibition of gastric acid secretion compared to their individual effects (1). In 19. Repetto MG, Llesuy SF. Antioxidant properties of natural
conclusion, we may state that the parallel administration of drugs that decrease acid compounds used in popular medicine for gastric ulcers. Brazilian
gastric secretion (PPI) significantly reduces the risk and size of lesions produced by J Medical & Biological Research 2002;35:523-534.
20. Reznick AZ, Packer L. Oxidative damage to proteins: spectro-
aspirin administration. At the same time, the association in treatment of products photometric method for carbonyl assay. Methods Enzymol. 1994;
with an antioxidant potential, further improves the defense of the gastric mucous 233:347-357.
membrane through the growth of the antioxidant status, and results in an obvious 21. Suzuki M, Suzuki H and Hibi T. Proton Pump Inhibitors and
Gastritis. J. Clin. Biochem. Nutr.2008;42:71-75.
decrease of tissue lesions. 22. Tajuddin, Ahmad S, Latif A, et al. Effect of 50% ethanolic extract
of Syzygium aromaticum (L.) Merr. &Perry. (clove) on sexual behav-
iour of normal male rats. BMC Complement Altern Med. 2003;3:6

IMPLICAREA STRESULUI OXIDATIV IN PATOLOGIA ULCEROASA
INDUSA DE ASPIRINA LA SOBOLANI
REZUMAT
Numeroase studii arata faptul ca speciile reactive ale oxigenului (SRO) sunt implicate in boala ulceroasa. Aceasta recunoaste factori etiopatogenetici multipli,
intre care un loc important il ocupa administrarea de AINS. Leziunile digestive pot fi prevenite prin asocierea inhibitorilor pompei de protoni (IPP), existand si
date care indica avantajele suplimentarii terapeutice aditionale cu preparate cu potential antioxidant. Scopul studiului a fost de a demonstra cresterea nivelului
stresului oxidativ consecutiv administrarii de aspirina si, respectiv, scaderea acestuia secundar asocierii terapiei de protectie antiulceroasa, respectiv antioxi-
danta. Am constatat ca intre loturile din studiu exista variatii semnificative ale balantei oxidanti-antioxidanti. Tratamentul cu aspirina modifica semnificativ
parametrii de stres oxidativ serici si din tesutul gastric in favoarea prooxidantilor. Administrarea preventiva de IPP imbunatateste semnificativ statusul seric
antioxidant. Terapia cu IPP scade nivelul de antioxidanti tisulari (probabil datorita consumului in exces), insa imbunatateste morfopatologic tesutul gastric.
Asocierea de antioxidanti scade nivelul speciilor reactive ale oxigenului (ROS) si amelioreaza aspectul anatomo-patologic al mucoasei gastrice.
Cuvinte cheie: stres oxidativ, AINS, ulcer peptic.

VARIATIONS OF SOME SALIVA MARKERS OF THE OXIDATIVE
STRESS IN PATIENTS WITH ORTHODONTIC APPLIANCES
OLTEANU C1, MURESAN A2, DAICOVICIU D2, TARMURE V1, OLTEANU I3,
KEULARTS MLW IRENE4
1
Department of Orthodontics, „Iuliu Hatieganu” University of Medicine and Pharmacy, Cluj-Napoca
2
Department of Physiology, „Iuliu Hatieganu” University of Medicine and Pharmacy, Cluj-Napoca
3
Department of Biochemistry, „Iuliu Hatieganu” University of Medicine and Pharmacy, Cluj-Napoca
4
Department of Clinical Genetics, Maastricht University, Holland
ABSTRACT
The use of orthodontic appliances in the treatment of the various dento-maxillar anomalies most frequently presume the application of high intensity forces,
non-physiological, which always will produce an inflammatory response localised around the tooth or the teeth subjected to displacement. The presence of
an inflammatory process at this level will produce an increased synthesis of free radicals, secondary followed by the oxidative stress.
In order to asses the level of the oxidative stress, a series of its markers are used, including the reactive species of oxygen and nitrogen, and the oxidation
products in particular, such as lipid peroxides and oxidized proteins respectively.
Thus, the objective of the present study is to determine and compare the levels of some oxidative stress markers (malondialdehyde, ceruloplasmine, hydrogen
donors) in saliva of patients with orthodontic appliances, before and after the initiation of the treatment.
The patients included in this study were 7 girls and 4 boys, with the average age of 9.9 years, in which orthodontic biomechanical appliances were applied,
in the purpose of treatment of some dento-maxillar anomalies. Saliva has been collected before the initiation of the orthodontic treatment, at 1 hour, at 24
hours, and at 7 days from from the orthodontic appliance application.
The variations in the concentrations of the saliva markers of the oxidative stress reached a maximum at 24 hours from the debut of the treatment for cerulo-
plasmine and malondialdehyde, and at one hour for the hydrogen donors respectively, while at 7 days from the device application the concentrations were
close to the initial values.
The health condition at the level of the oral cavity in the patients taken into study did not change during the research. These results demonstrate that the
utilization of an orthodontic appliance changes the levels of the saliva markers of oxidative stress, but these variations, even statistically significant, do not
determine the appearance of certain pathological processes at the level of the oral cavity.
Key words: ceruloplasmine, malondialdehyde, hydrogen donors, saliva, orthodontic appliances
INTRODUCTION cellular components, such as DNA, proteins, lipids and fatty acids. These reactions
Free radicals, such as the reactive species of oxygen, result in a high diversity are finally followed by damages in the DNA molecules, mitochondrial malfunctions,
of biochemical reactions produced during the progress of the cellular functions alteration of plasma membrane and eventually the cell death.
(e.g. the mitochondrial metabolism). The formation of these free radicals (pro- A high variety of biological processes, such as the anti-microbial defence,
oxidants) in physiological conditions is balanced through their consumption by inflammation, carcinogenesis, and the aging as well imply the involvement of the
the antioxidants. free radicals (3, 4), leading thus to oxidative stress. The DNA alteration, the cellular
The oxidative stress is produced as a consequence of an unbalance between the malfunctions, and other pathological processes mediated by these free radicals
synthesis and the neutralization of the pro-oxidants. A high number of pathological represented in time sources of interest for biochemists and physicians.
processes in the human organism can affect this balance by the increasing of the The main free radicals are represented by the reactive species of oxygen (ROS)
free radicals production related to the existing antioxidants. and nitrogen (RNS).
Formation of pro-oxidants and their effect upon the cellular functions (which The settlement of a certain causative relation between the oxidative stress and
can finally lead to apoptosis) have the name of oxidative stress. Sies H., in his paper: the physiological or pathological processes in which is involved, is achieved by the
„Oxidative stress: from basic research to clinical application”, published in 1991 (1), assessment of the oxidative stress markers in different fluids of the human body.
stated the first definition of the oxidative stress – „an unbalance in the balance The biomarkers are defined as characteristics which can be objective measured,
pro-oxidants / antioxidants behalf pro-oxidants, with possible repercussions on and evaluated as indicators of the normal biological processes, of the pathological
the organism”. processes, or of the pharmacological responses after a therapeutic intervention
The oxidative stress involves the adverse effects of oxygen and of other free (5).
radicals on the living tissues (2). The free radicals are unstable molecules, with A series of markers of the oxidative stress are used, including the reactive species
increased reactivity, because they have a free electron, which combines with various of oxygen and nitrogen, but most of them have a limited value because of a reduced
Received July 2009. Accepted August 2009. Address for correspondence: Dr. Cristian Olteanu, Department of Orthodontics, „Iuliu Hatieganu” University of Medicine and Pharmacy, Cluj-Napoca,
e-mail: [email protected]

method with 2-tiobarbituric acid, and reading the extinction at 530 nm.
The assessment of ability of hydrogen donor is based on the reduction of the stable radical 1, 1-
diphenil-2-picrilhydrazil by a series of antioxidant compounds, pursued by the colour change from violet
to wan yellow, monitorised by the modification of absorbance at 520 nm.
Ceruloplasmine is an alpha-2 globulin, which in vitro displays properties of phenoloxidase, and
catalyzes the oxidation of p-phenylendiamine to a compound with a violet colour having a maximum
absorbance at 530 nm.
sensibility or specificity, or because they need invasive methods of collection. phenoloxidase,
Concerning and catalyzes
the statistical the inoxidation
analysis, order toof p-phenylendiamine
compare the mean values to a compound
Student t-test was
As ROS/RNS are unstable products, these reactive species were quantified by with a violet colour having a maximum absorbance at 530 nm.
the evaluation of their stable metabolites, such as nitrates or nitrites, as well asperformed, because the values
Concerning have displaied
the statistical analysis, ina order
normalto compare
distribution. The values
the mean statistical analysis was
Student
by the measurement of the oxidized products’ concentration: lipid peroxides andaccomplished withwastheperformed,
t-test Statistical Package
because for
the Social
valuesSciences (SPSS),a normal
have displaied and withdistribution.
the statisticalThesoftware of
oxidized proteins respectively. Microsoft Office.
statistical analysis was accomplished with the Statistical Package for Social Sciences
Malondialdehyde (MDA) is an aldehyde produced by the peroxidative (SPSS), and with the statistical software of Microsoft Office.
degradation of the unsaturated lipids. The MDA excess secondary arisen after the
RESULTS
lipid peroxidation is combined with the free amino groups in the protein structure,
leading to the appearance of proteins with modified structure. TheRESULTS
average level of the oxidative stress markers in the saliva from the patients taken into study,
Ceruloplasmine, which is the major copper transporter within the organism,at the time intervals The mentioned before
average level of theis oxidative
presentedstress
in Table I. in the saliva from the patients
markers
displays an increased level in the acute and chronic inflammations, thus representing taken into study, at the time intervals mentioned before is presented in Table I.
an acute phase reactant. Table I. The mean concentration of the oxidative stress saliva markers in the patients taken into study
The using of the orthodontic appliances in order to treat various dento-maxillar Table I. The mean concentration of the oxidative stress saliva markers in the patients taken into study
anomalies presumes most frequently the application of some forces of increased MOMENT
intensity, non-physiological, which always will generate an inflammatory answer zero 1 hour 24 hours 7 days
localized around the tooth or teeth which need to be displaced. And, as was already Ceruloplasmine 2.277 3.627 4.881 2.768
mentioned, any inflammatory process stimulates a higher synthesis of free radicals, ( mg%)
resulting in oxidative stress. Malondialdehyde 0.263 0.309 0.536 0.309
In these conditions, the objective of this study is represented by the quanti- (nm/ml)
fication of the levels of some markers of the oxidative stress (malondialdehyde, H+ donors 20.127 14.581 16.109 19.472
ceruloplasmine, hydrogen donors) in the saliva of patients carrying orthodontic (inhib. %)
appliances, before, and after 1 hour, 24 hours, and 7 days from the beginning of
Changes in the concentrations of ceruloplasmine (mg%), malondialdehyde (nm/
the orthodontic treatment. Changes in the concentrations of ceruloplasmine (mg%), malondialdehyde (nm/ml), and
ml), and hydrogen donors (inhib. %) in saliva are presented in Figures 1, 2 and
SUBJECTS AND METHOD
hydrogen donors
3. (inhib. %) in saliva are presented in Figures 1, 2 and 3.
The written consent of the parents of the child patients taken into this study
5
was obtained after a previous description of the study’s protocol. In order to asses 5
4,5
the saliva levels of the oxidative stress markers, 11 patients were taken into study,
4 4,5
in which 142 measurements were made. The 11 patients, 7 girls and 4 boys
(between 8 and 12 years, average age 9.9 years), displayed the following criteria
3,5 4
3
for including in study: 2,5 3,5
• Well general status, without known affections; 2 3 Ceruloplasmine
• Lack of antibiotic therapy within the last 6 months; 1,5
• Absence of anti-inflammatory drugs administration in the month before 1
2,5
the study; 0,5 2 Ceruloplasmine
• Healthy periodontal tissues and appropriate oral hygiene. 0 1,5
In each patient a brief instruction for teeth brushing and oral hygiene was made zero 1 hour 24 7 days
before the beginning of the orthodontic treatment. The orthodontic treatment for all
1 hours
11 patients was performed using biomechanical orthodontic appliances. 0,5
Fig.1. Changes in the ceruloplasmine concentration in saliva during the study (mg%)
The samples of saliva were collected as follows: 0
• Moment 0 – before the initiation of the orthodontic treatment; zero 1hour 24 7days
• Moment 1 – at 1 hour from the device application;
• Moment 2 – at 24 hours from the device application; 0,6 hours
• Moment 3 – at 7 days from the device application. 0,5
In order to perform the study, unstimulated saliva was collected, by the Fig.1.
0,4 Changes in the ceruloplasmine concentration in saliva during the study (mg%)
expectoration method, for 2 minutes. The test tubes with saliva were then kept at
0,3
-80°C until the measurements were performed.
Malondialdehyde
Malondialdehyde was dosed, after the previous protein precipitation, by the 0,2
spectrophotometric method with 2-tiobarbituric acid, and reading the extinction 0,1
at 530 nm.
0
The assessment of ability of hydrogen donor is based on the reduction of the zero 1 hour 24 7 days
stable radical 1, 1-diphenil-2-picrilhydrazil by a series of antioxidant compounds, hours
pursued by the colour change from violet to wan yellow, monitorised by the
modification of absorbance at 520 nm. Fig. 2. Changes in the malondialdehyde concentration in saliva during the study (nm/ml)
Ceruloplasmine is an alpha-2 globulin, which in vitro displays properties of

Therefore, the oxidative stress markers in saliva display a series of variations
25 along the study, but which do not lead to the appearance of some pathological
processes in the oral cavity of the patient with orthodontic appliance. The study
20 proved that the highest variation in the levels of oxidative stress markers in the
15
saliva of the patient with an orthodontic appliance is measured at 24 hours from
its application for ceruloplasmine and malondialdehyde, and at 1 hour in the case
10 H+ donors of the hydrogen donors respectively, and at 7 days the values being close to the
initial ones. These variations will be repeated after each activation of the device.
5 Variations of the oxidative stress markers in saliva are statistically significant, but
0 they do not change the health status of the oral cavity, which denotes that even
zero 1 hour 24 7 days these markers undergo important variations, these do not prove the appearance
hours of a pathologic process in the oral cavity in patients with orthodontic appliances.
Fig. 3. Changes of the hydrogen donor ability in saliva during the study (inh.%)
CONCLUSIONS
• The application of an orthodontic appliance modifies the saliva markers of
DISCUSSIONS the oxidative stress, but these variations, even statistically significant, do not change
At the moment 0, before the application of the orthodontic appliance, the the health status at the level of the oral cavity.
saliva levels of ceruloplasmine and malondialdehyde were ranging in normal limits • Even if the application of an orthodontic appliance is followed by the ap-
(average: 2.27 mg% for ceruloplasmine, and 0.26 nmols/ml for malondialdehyde pearance of an inflammatory process localized around the tooth which needs to
respectively). be displaced (otherwise strictly necessary to achieve the dental displacements),
At 1 hour from the beginning of the force action, the saliva concentrations and consecutively the appearance of the oxidative stress at this level, this does not
of ceruloplasmine and malondialdehyde display a slight increasing, statistically manifest generally at the level of whole oral cavity.
significant (p<0.01), but without implications on the pathology of the oral cavity • This is due to the fact that the inflammatory process is a localized one, and
(3.62 mg%, and 0.30 nmols/ml respectively). the markers of the oxidative stress are diluting in the oral cavity, thus their variations,
At 24 hour from the device application, the levels of ceruloplasmine and malon- even statistically significant in the saliva of the patient carrying an orthodontic ap-
dialdehyde in saliva have a maximum of 4.88 mg%, and 0.54 nmols/ml respectively, pliance, do not produce the appearance of pathological changes at this level.
values which are statistically significant increased (p<0.01), but again without the • The application of an orthodontic appliance does not produce pathological
appearance of certain pathological changes at the level of the oral cavity. changes in the oral cavity of the patient to be treated, in the conditions in which the
At 7 days from the beginning of force action, the saliva levels of the two forces which act on the tooth to be displaced are close to the physiological forces.
markers decrease, coming close to the values recorded before the application of
the orthodontic appliance.
Before the beginning of the orthodontic treatment, the ability of hydrogen
REFERENCES
donor in saliva has the mean value of 20.13 inhibition %. At 1 hour from the force
application, the minimum of level is reached, respectively a mean value of 14.58 1. Sies H. Oxidative stress: from basic research to clinical ap-
plication. Am J Med. 1991 Sep 30; 91(3C): 31S-38S
inhib.% decrease which is statistically significant (p<0.01). At 24 hours from the
2. Pugliese PT. The skin, free radicals, and oxidative stress.
force application, the value increases at an average of 16.11 inhib. %, while at 7 Dermatol Nurs 1995 Dec; 7(6): 361-9
days from the debut of the orthodontic treatment, the level returns to values close 3. Sies H. Biochemistry of oxidative stress. Angew Chem Int Ed
to those evaluated at the moment 0, respectively an average of 19.48 inhib.%. All Engl 1986; 25: 1058-71
these variations in the ability of hydrogen donor are statistically significant, but 4. Halliwell B, Gutteridge JMC. Free radicals in biology and
without implications on the oral pathology. medicine. 2nd ed Oxford UK: Clarendon Press, 1989
A series of studies have proven increases of the plasma concentrations of 5. Dalle-Donne I, Rossi R, Colombo R, Giustarini D, Milzani a.
malondialdehyde and ceruloplasmine in patients with rheumatoid arthritis (6,7), as Biomarkers of oxidative damage in human disease. Clin Chem
well as of the saliva level of these markers of the oxidative stress in the same disease 2006 Feb 16; 52: 601-23
6. Kiziltunc A, Cogalgil S, Cerrahoglu L. Carnitine and anti-
(8), in which one of the articulations of interest is the temporo-mandibular joint.
oxidant levels in patients with rheumatoid arthritis. Scand J
Because the use of the orthodontic appliances for the treatment of the various Rheumatol 1998; 27: 441–5.
dental anomalies will produce an inflammatory response, localized around the tooth 7. Ozturk HS, Cimen MY, Cimen OB, Kacmaz M, Durak I. Oxidant/
or the teeth to be displaced, the results of this study are in correspondence with the antioxidant status of plasma samples from patients with rheu-
data reported in the literature. matoid arthritis. Rheumatol Int 1999; 19: 35–7.
Taking into account there is not known literature data to mention the variation 8. Nagler RM, Salameh F, Reznick AZ, Livshits V, Nahir AM.
of the hydrogen donors in the context of our study, a possible explanation for the Salivary gland involvement in rheumatoid arthritis and its rela-
reach of their minimal level at 1 hour from the beginning of the treatment could tionship to induced oxidative stress. Rheumatology (Oxford).
be the direct mechanism of annihilation of the oxygen free radicals by hydrogen, 2003 Oct; 42(10): 1234-41.
with water formation.

VARIAŢII ALE UNOR MARKERI SALIVARI AI STRESULUI OXIDATIV
LA PACIENŢII PURTĂTORI DE APARATE ORTODONTICE
REZUMAT
Utilizarea aparatelor ortodontice pentru tratarea diverselor anomalii dento-maxilare presupune cel mai frecvent aplicarea unor forţe de intensitate crescută,
nefiziologice care întotdeauna vor determina apariţia unui răspuns inflamator localizat în jurul dintelui sau dinţilor care urmează a fi deplasaţi. Prezenţa unui
proces inflamator la acest nivel va produce o sinteză crescută de radicali liberi, cu apariţia secundară a stresului oxidativ.
Pentru determinarea nivelului stresului oxidativ, sunt utilizaţi o serie de markeri ai acestuia, incluzând aici speciile reactive ale oxigenului şi azotului, dar mai
ales produşii care sunt oxidaţi, respectiv peroxizii lipidici şi proteinele oxidate.
Astfel, obiectivul lucrării îl constituie determinarea nivelului unor markeri ai stresului oxidativ (malondialdehida, ceruloplasmina, donorii de hidrogen) în
saliva pacienţilor purtători de aparate ortodontice, înainte şi după debutul tratamentului.
Pacienţii cuprinşi în studiu au fost 7 fete şi 4 băieţi, cu vârsta medie 9,9 ani, la care s-au aplicat aparate ortodontice mobilizabile, în scopul tratării unor anomalii
dento-maxilare. Saliva a fost recoltată înainte de debutul tratamentului, la 1 oră, 24 ore şi 7 zile de la aplicarea aparatului ortodontic.
Variaţiile concentraţiilor markerilor salivari ai stresului oxidativ prezintă un maxim la 24 ore de la debutul tratamentului pentru ceruloplasmină şi
malondialdehidă, respectiv la o oră pentru donorii de hidrogen, la 7 zile de la aplicarea aparatului, concentraţiile apropiindu-se de valorile iniţiale.
Pe tot parcursul desfăşurării cercetării, starea de sănătate de la nivelul cavităţii orale a pacienţilor luaţi în studiu nu s-a modificat. Aceste rezultate demonstrează
că aplicarea unui aparat ortodontic modifică markerii salivari ai stresului oxidativ, dar aceste variaţii deşi sunt semnificative statistic, nu determină apariţia
unor procese patologice la nivelul cavităţii orale.
Cuvinte cheie: ceruloplasmina, malondialdehida, donori de hidrogen, saliva, aparate ortodontice

CONSUMPTION OF CALORIGENIC FOODS IN ADOLESCENCE
OANA SUCIU 1, BRIGITHA VLAICU 1,2
1
“Victor Babes” University of Medicine and Pharmacy Timisoara, Romania
2
Institut of Public Health “Prof.Dr. L. Georgescu”, Timisoara, Romania
ABSTRACT
Daily consumption of cereals and derivates contributes to covering ¾ of the glucide requirements, ½ of the energetic needs and up to ½ of the protein
necessities of the organism. Fast-food products are rich in fats, sugar and salt, and they are included into the lifestyle of adolescents and they often replace
traditional nutrient sources. The working method was a transversal populational study, by use of the CORT 2004 questionnaire for the investigation of some
health risk behaviours in young subjects, on a representative population of adolescents in Timiș County, including 2908 pupils. We found that 96.4% of the
adolescents consume bread daily, ¾ of the girls eat 2-7 slices of bread a day, while ½ of the boys consume at least 8 slices daily. The consumption of pasta,
rice, cereals is present daily in 10.5% of the young subjects, with a 1.3/1 ratio between boys and girls. Chips and snacks were consumed by 20.5% of the
adolescents, hamburgers and pizza by 10.2% and fried potatoes by 15.5%. The results may corelate mainly with an energetic intake replacing basic foods
and with a deficit of high biological value proteins.
Key words: adolescents, alimentation, fast-food
INTRODUCTION mETHODS
Cereals represent an important source of vegetal proteins, with a content The study was performed on a representative population of adolescents in high-
of 7-16 g%, represented in proportion of 430-40% by gliadin and gluteins, and schools, postgraduate and apprentice schools in Timiș county, in urban areas, and it
by low quantities of albumins, nucleoalbumins and globulins (1). Regarding the included a total of 2908 pupils aged between 14 and 25 years (99% for the group of
biological value, they do not signify a qualitative fulfilment of the food portion adolescents aged between 15-19 years), 51.5% girls and 48.5% boys (9).
The work method was a transversal populational study, by use of the group and
because proteins in cereals and in dry vegetables contain all essential aminoacids
anonimous CORT 2004 questionnaire for investigating some health risk behaviours
but not in optimal proportions for the organism (2). in young subjects, designed by a CNCSIS accredited research team, by adaptation of
Among glucids, starch has the highest proportion, at an average of 80-90% in some international questionnaires (ESPAD, YRBSS) to the reality of Romanian life,
cereals and 50-55% in dry vegetables, and this cathegory of foods is an important in the period 2003-2005 (10).
source of B group vitamins, vitamin E and minerals, especially phosphorus (200-
400 mg%), potasium (100-350 mg%) and magnezium (50-150 mg%) and they
lack vitamin C (3). RESULTS AND DISCUSSIONS
The requirement of cereals and cereal derivates in adolescence: 300-450 g bread/ 1. Bread consumption (Figure 1)
day (6-11 slices of 40 g); 60 g cereal derivates/zi (1 porion of 60 g). Reported to the The cereal intake in the daily portion of most young people, 96.4%, was covered
caloric value of the portion, these foods will cover, on average, 50% of the needs, by consumption of bread, and only 3.6% of the adolescents did not consume this ali-
meaning 70-80% of the necessary glucides and 45-50% of the protein needs (4). ment. Among the young bread consumers, 36.0% reported a 2-4 slices a day intake
In the great fast-food era, good home-learned practices are replaced by some (around 80-160 g), 27.8% of them consumed 5-7 slices daily (around 200-280 g),
not very advisable feeding trends. There is a tendency to rapidly eating spicy foods, and 32.6% of them ate more than 8 slices of bread a day (over 320 g).
sandwiches, conserved food, steaks, pasta, avoiding vegetables, fruits, bread (5).
% 60
Consumption of fast-food products causes the dramatical increase in the 50.5
number of obese individuals. Obesity is no longer an American problem and it is 50

spreading throughout the world at an increasing rate (6). 40
Many snacks have a very high level of fats, sugar or salt, ingredients which 27.3
28.4 28.2 Boys
30 Girls
should be restricted to a small part of foods (7). Eating a healthy diet does not mean 20.7 21.7
complete elimination of favourite foods, but young people must be selective and 20
limit the total of fats, saturated fats, cholesterol or sodium. Consumer organiza- 9.6 6.4
10 5.1
tions worldwide released the code which bans promotion of junk food among 2.1
children. The code is meant as a strategy against obesity and diseases occuring as 0
consume
More than 10
8-10 slices
2-4 slices
5-7 slices
Did not
slices daily
daily
daily
a consequence of uncontrolled diets, because statistics show that, worldwide, over

daily
177 million children are threatened by obesity. The code addresses the marketing
system for foods with high caloric value, rich in fats, sugar and salt.
Fig.1. Percentual distribution of boys and girls according to the frequency
of bread consumption during one week
Fig.1. Percentual distribution of boys and girls according to the frequency of bread consumption during one week
Received March 2009. Accepted June 2009. Address for correspondence: Dr. Oana Suciu, „Victor Babes” University
70 of Medicine and Pharmacy Timisoara, 2A Eftimie Murgu Square, 300041,
63.7 69.8
Timisoara, Romania, phone/fax: 0256220479 %
60
50
30 40
Fiziologia - Physiology  2009.19.3(63)
Boys
30 Girls
20 13.5 10.9
8.0 7.4 10.5 10.4
10 4.0
1.9
0
e
re
es
es
ily
ek
ek
er
ot
Between the frequencies of bread consumption depending on gender, there are differences between genders are not statistically significant. Thus, 48.0% of boys
50 48.0 46.2
statistically significant differences, with a χ2 value of 459.7 and a probability cutoff and 45
% 46.2% of girls, consumed 1-3 times a week, and 19.3% of boys and 21.7% of
% 60 differences in favour of boys who recorded a daily bread consumption
p<0.001, girls,40had a daily intake of chips and snaks. Only 16.9% of boys and 16.6% of girls
50.5
of over5010 slices (around 400g or more). Half of the girls, 50.5%, and 20.7% of the did not
35 consume these foods.
boys consumed between 2-4 slices of bread a day, and the percent of those who do 30 Boys
not eat40bread is double for girls, 5.1% as compared to only 2.1% in boys. 25
3.2. Consumption of hamburgers15.7 and pizza
16.9(Figure 4) Girls
27.3
28.4 28.2 Boys 20 15.5 16.6
30 An important percent
15
of the sample,
12.2 57.5%, reported hamburger consump-
Girls 7.7 9.5 11.6
2. Consumption of pasta, rice,
20.7 21.7 cereals (Figure 2) tion10
with a frequency of 1-3 times a week, which represents a higher proportion
20sample, most young subjects, 66.9%, consumed cereal derivates, others
Per as compared
5 to chips and snaks consumers, 10.2% consuming at least once a day,
than bread, with a frequency of 1-3 times a week. The 4-69.6 6.4
times a week consumption 0
and 24.8% of the young subjects never consuming these foods.
10
consume
2 or more
4-6 times
1-3 times
Once daily
per week
per week
times per
Did not
5.1
was recorded2.1in 12.0% of the adolescents, 10.5% of them reporting an intake of at As for hamburgers and pizza consumption, there is a statistically significant
day
0 a day, and 10.6% did not eat food from this cathegory.
least once difference between consumption frequencies in boys and girls, with χ2 of 39.6 and
consume
More than 10
8-10 slices
2-4 slices
5-7 slices
Did not
Differences between percentual distribution in girls and boys, depending on a probability cutoff p<0.001. An increased proportion persists in boys, 59.2% and
slices daily
daily
daily
daily
the frequency of cereal derivates consumption are statistically significant, with a girls, 55.8%, who consumed hamburgers and pizza 1-3 times a week, and 12.3%
χ2 value of 19.5 and a probability cutoff p=0.001, and they are in favourFig.3.ofPercentual
boys. of boys and
distribution 8.2%and
of boys of girls
girlsconsumed
accordingthese
to thefoods at leastofonce
frequency a day.
chips and snaks consumption during one
Thus, 12.0% of boys and 9.3% of girls consumed this type of food at least once a
day. The percent of boys, 13.5%, who had an intake of cereal derivates 4-6 times a 60 59.2 55.8
%
Fig.1. Percentualweek is higher of
distribution than
boysin girls, 10.5%.
and girls according to the frequency of bread consumption during one 50 week
70 40
63.7 69.8 Boys
% 29.2
60 30 Girls
20.2
50 20
7.7 8.3 6.7
40 Boys
10 4.6 5.6
Girls 2.6
30
0
consume
2 or more
4-6 times
1-3 times
Once daily
per week
per week
times per
20
Did not
13.5 10.9
day
8.0 7.4 10.5 10.4

10 4.0
1.9
0
consume
2 or more
4-6 times
1-3 times
Once daily
per week
per week
times per
Did not
Fig.4. Percentual distribution of boys and girls according to the frequency

day
Fig.4. Percentual distribution of boys and girls according

of hamburgers and pizzatoconsumption
the frequency of hamburgers
during one week and pizza consumption durin
week
Fig.2. Percentual distribution of boys and girls according to the frequency 3.3. Fried potatoes consumption (Figure 5)
.2. Percentual distribution of boys andofgirls
pasta,according
rice, cereals consumption during oneofweek
to the frequency In theone
pasta, rice, cereals consumption during caseweek
of fried potatoes, 56.4% of the adolescents consumed them at least
3. Consumption of fast-food 1-3 times a week, and to these subjects a 21.1% is added represented by young
3.1. Consumption of chips and snacks (Figure 3) subjects who consumed this food 4-6 times a week, and only 7.0% of them did
Regarding the consumption of chips and snacks, most young subjects, 47.0%, not eat this aliment.
reported consumption 1-3 times a week, and the proportion of adolescents who Like in the case of chips, snaks, hamburgers and pizza, fried potatoes were
consumed these ”unhealthy” foods, at least once a day, is rather important, 20.5%. also more frequently eaten by boys. Gender differences, regarding fried potatoes
Among the two genders, the hierarchy of consumption frequency of chips and
snaks is identical and similar to consumption frequencies for the entire sample, and 60 55.1 57.6
%
50 48.0 46.2 50
% 45
40 40
35 Boys
30
30 Boys
23.2
19.1 Girls
25 20
15.7 16.9 Girls
20 12.2 15.5 16.6 10.2 9.2
6.8 8.7
15 9.5 11.6 10 5.4
7.7 4.1
10
5 0
consume
times per day
4-6 times per
1-3 times per

Once daily
Did not
0
2 or more
consume
2 or more
4-6 times
1-3 times
Once daily
per week
per week
times per
week
week
Did not
day
Fig.3. Percentual distribution of boys and girls according to the frequency Fig.5. Percentual distribution of boys and girls according to the frequency
of chips and snaks consumption during one week of fried potatoes consumption during one week
g.3. Percentual distribution of boys and girls according to the frequency of chips and Fig.5.
snaks Percentual distribution
consumption during oneof week
boys and girls according to the frequency of fried potatoes consumption during one w

60 59.2 55.8
%
50
40
Boys
29.2
30 Girls
CONSUMUL DE ALIMENTE CALORIGENE ÎN ADOLESCENğĂ
consumption, is statistically significant, with χ2 of 31.20 and a probability cutoff olds and 10.7% in 19 year old subjects.
p<0.001 and it is in favour of boys. Thus, 78.3% of the boys and 76.7% of the girls High/excessive consumption of fast-food type aliments increases the risk of
consumed this type of food 1-6 times a week, and 17.0% of the boys and 14.1% obesity, diabetes, depressive moods (7).
of the girls consumed fried potatoes at least once a day. Only 4.7% of the boys and
a double percent, 9.2% of the girls did not consume it. REFERENCES
1. Boutelle K, Fulkerson J, Neumark-Sztainer D, et al., Fast food for
family meals: relationships with parent and adolescent food intake,
CONCLUSIONS home food availability and weight status. Public Health Nutrition,
2007, 10(1):16-23
Daily consumption of cereals and derivates contributes to covering ¾ of the 2. De Garine I, Socio-cultural aspects of alimentary behavior. At-
glucidic needs, ½ of the energetical needs provided by glucides, and especially by tempted classification of food prohibitions. Aspects socio-culturels
des comportements alimentaires. Essai de classification des interdits
starch, and up to ½ of the proteic needs. alimentaires. Journal Article Maroc Medical, 1989, 47(508):764-73
Daily intake of bread is present in 96.4% of the teen-agers, 4/3 of the girls 3. Gosnell BA, Mitchell JE, Lancaster KL, et al., Food presentation
and energy intake in a feeding laboratory study of subjects with
consume 2-7 slices of bread daily, whereas ½ of the boys eat at least 8 slices/day binge eating disorder. International Journal of Eating Disorders,
and 1/3 of the boys consume more than 10 slices/day. By age groups, consumption 2001, 30(4):441-6
differences are not significant. 4. Isnard-Mugnier P, Vila G, Nollet-Clemencon C, et al., Etude
controlee des conduites alimentaires et des manifestations emo-
The consumption of cereal derivates, other than bread, (pasta, rice, cereals) tionnelles dans une population d'adolescentes obeses. Archives
is present daily in 10.5% of the adolescents, with a boys/girls consumer ratio of Francaises de Pediatrie, 1993, 50(6):479-84
5. Jeffery RW, French SA, Epidemic obesity in the United States: are
1.3/1. The most frequent consumption is 1-3 times/week throughout the entire fast foods and television viewing contributing? American Journal
sample and in all age groups. of Public Health, 1998, 88:277—280
The obtained results may corelate with an energetic intake replacing deficien- 6. Negrişanu G, Treaty nutrition, Brumar Publishing, Timişoara,
2005, 259-277
cies found in meat, milk and eggs intake, but also with a deficit in high biological 7. Sjoberg A, Hallberg L, Hoglund D, et al., Meal pattern, food
value proteins obtained from animal foods. choice, nutrient intake and lifestyle factors in The Goteborg Ado-
lescence Study. Eur J Clin Nutr., 2003, 57(12):1569-78
Fast food aliments are rich in fats, sugar and salt and are included into the 8. Strain GW, Nutrition, brain function and behavior. Journal Article,
lifestyle of adolescents. They often replace traditional nutritional sources, such as Research Support, U.S. Gov't, P.H.S., Psychiatric Clinics of North
cereal derivates, dry and fresh vegetables, fruits (11). America, 2001, 4(2):253-68
9. Yamamoto J.A., Yamamoto J.B., Yamamoto B.E., et al., Adolescent
Daily consumption of chips and snaks has been reported by 20.5% of the fast food and restaurant ordering behavior with and without
adolescents, and the boys/girls consumer ratio was 1/1.2. Reported to age groups, calorie and fat content menu information. Journal of Adolescent
Health, 2005, 37(5):397-402
the daily consumption was 25.3% in 15 year olds and 12.7% in 19 year olds. 10. ***, United States Department of Agriculture, Dietary Guide-
Daily consumption of hamburgers and pizza is declared by 10.2% of the lines for Americans. U.S. Department of Health and Human Ser-
adolescents, and with a boys/girls consumer ratio of 1.5/1. In 15 year old subjects vices, 2005, www.healthierus.gov/dietaryguidelines
11. ***, Grant A CNCSIS code 1167, 2003-2005, Assessing the size
the consumer percent was 11.7% and in 19 year olds it was 9.3%. of risk behaviors in high school and young people in secondary
Daily consumption of fried potatoes was reported by 15.5% of the adolescents, education, post, professional and academic Timis County, 2004.
with a boys/girls consumer ratio of 1.1/1 and with 15.8% consumption in 15 year
CONSUMUL DE ALIMENTE CALORIGENE ÎN ADOLESCENŢĂ
Rezumat
Consumul zilnic de cereale şi derivate de cereale contribuie la acoperirea a 3/4 din necesarul de glucide, 1/2 din necesarul energetic şi până la 1/2 din necesarul
de proteine. Alimentele de tip fast-food sunt bogate în grăsimi, zahăr şi sare, sunt incluse în stilul de viaţă al adolescenţilor şi înlocuiesc frecvent sursele
tradiţionale de nutrienţi. Metoda de lucru a fost studiul populaţional transversal, prin aplicarea chestionarului CORT 2004 de investigare a unor comporta-
mente cu risc pentru sănătate la tineri, pe o populaţie reprezentativă de adolescenţi din judeţul Timiş, totalizând 2908 elevi. S-a constatat că, 96,4% dintre
adolescenţi consumă zilnic pâine, respectiv, 3/4 dintre fete consumă 2-7 felii de pâine/zi, în timp ce 1/2 dintre băieţi consumă cel puţin 8 felii/zi. Consumul
de paste făinoase, orez, cereale, este prezent zilnic la 10,5% dintre tineri, cu un raport al consumatorilor băieţi/fete de 1,3/1. Chips-urile şi snacks-urile au fost
consumate de 20,5% dintre adolescenţi, hamburgerii şi pizza de 10,2% dintre ei, iar cartofii prăjiţi de 15,5% dintre tineri. Rezultatele obţinute se pot corela,
în principal, cu un aport energetic care înlocuieşte alimentele de bază şi cu un deficit de proteine de valoare biologică superioară.
Cuvinte cheie: adolescenţi, alimentaţie, fast-food

MOLECULAR CHANGES IN PRECANCEROUS LESIONS OF
THE LARYNX
RALUCA HORHAT, DELIA HORHAT, MARIOARA POENARU, STAN COTULBEA, NICOLAE
BALICA, VALERIA MOCANU
ENT Clinic Timisoara
UMFT “Victor Babes”Timisoara
Abstract
Precancerous lesions of the larynx are imtermediary states between the hpysiological mucosa and cancer.
Recent molecular pathology studies in head and neck cancer support a carcinogenesis model in which the development of a field with genetically altered
cells plays a central role. Information from the genetic analysis of laryngeal cancer has grown enormously in the last 20 years.
There are two classes of genes implicated in the progress of malignancy: the oncogenes and the tumor supressor genes.
The molecular biology techniques have identified mutations at the level of chromosomes 9p, 3p, 17p, 11q and also the accumulation of nuclear proteins as
Ki-67 and PCNA. These genetic alterations are represented by the inactivation of tumor suppressor genes- p16, p53, FHIT- and by the activation of oncogenes-
cyclin D1.
Advances in the understanding of the molecular basis of the laryngeal carcinogenesis will help in the identification of new molecular markers that could be
used for a more accurate diagnosis and assessment of prognosis and may open the way for novel approaches to treatment and prevention.
Keywords: benign scuamous hyperplasia, dysplasia, carcinoma in situ, oncogenes, tumor supressor genes, nuclear proteins
INTRODUCTION The aim of this article is to review and highlight some of the recent advances
The same year Watson and Crick published their article on the tridimensional in the molecular biology of the laryngeal carcinogenesis with particular clinical
structure of the DNA 50 years ago, Slaughter et all, described for the first time the relevance for the diagnosis, management and prognosis of the precancerous lesions
phenomenon of “field cancerization”, hypothesizing that there are alterations at the of the larynx and laryngeal carcinoma.
level of the entire mucosa determined by carcinogens in patients with cancer of the
upper aero-digestive tract. The authors examined pathology slides from 783 patients
A GENETIC MODEL FOR THE LARYNGEAL
with head and neck cancers in an effort to identify alterations of the epithelium
that surrounds tumors and to explain its clinical behaviour. 11% of the patients CARCINOGENESIS
presented histologic alterations independent of the tumor area. At the time there The transition from the normal epithelium to the scuamocellular carcinoma of
was no molecular basis for their observations, but the term has been used to describe the larynx is a long, complex and multistage process, with the accumulation of
three phenomena: (1) wide field of aero-digestive mucosa tends to be affected by genetic alterations- between 6 and 10- that translate initially by the presence of
the premalignant disease; (2) frequent occurrence of multiple primary tumors in precancerous conditions (benign squamous hyperplasia, dysplasia, carcinoma in
the epithelial areas affected by widespread premalignant disease and (3) possible situ) and which can suffer malignant transformation (Braakhuis B et al., 2004)(2).
distant related primary tumors in the upper aero-digestive tract. The number of genetic alterations grows with the malignity level established by
In 1990, Fearon and Vogelstein proposed the first model for the molecular the histologic examination (see Figure 1)(Califano et al., 1996)(5).
progression of the colorectal cancer stipulating that tumors progress by the activation
of the oncogenes and the inactivation of the tumor suppressor genes, each producing
growth advantage for a clonal population of cell. Generally there are specific genetic
events in a distinct order, but the order in which they are produced isn’t necessarily
the same for a certain type of tumor. Genetic events summation determines the
progression of the tumor (Ha and Califano, 2003)(13). Fig. 1. Genetic model for the laryngeal carcinogenesis (Califano et al., 1996)(5)
Laryngeal carcinogenesis is a multistage process, initiated by various carcino-
gens (tobacco, alcohol, gastro-esophageal reflux, the human papillomavirus, etc.) There are two classes of genes involved in the progress of malignancy: the on-
which induce genetic alterations and if they remain undetected by the DNA repairing cogenes and the tumor supressor genes. The activation of the oncogenes induces the
mechanisms, they confer growing advantage with increased cellular proliferation initiation and progression of the tumor while the inactvation of the tumor suppressor
(Monier R et al., 2008)(20). genes contributes to the progression of cancer (Crissman J et al., 2004)(7).
Received March 2009. Accepted June 2009. Address for correspondence: Dr. Raluca Horhat, ENT Clinic, ”Victor Babes” University of Medicine and Pharmacy Timisoara, 2A Eftimie Murgu Square,
300041, Timisoara, Romania, phone/fax: 0256220479

Normal cells present protooncogenes that turn into oncogenes when activated tumoral cell proliferation (Kim M. and Califano J, 2004)(18).
by different carcinogens, radiations or viruses. This activation is produced by chromo-
somal translocation, gene amplification, point mutations or deletions. Oncogenes Chromosome 17p
activity is expressed by the level of the growing factors and of their receptors, the At the level of the 17p13.1 chromosome there is located the p53 tumor supres-
signal transducer systems and the nuclear proteins. sor gene, one of the most involved genes in carcinogenesis. It was initially thought
The tumor suppressor genes, active in normal cells, suffer mutations or to be an oncogene, as there was aberrant overexpression of mutated forms of TP53,
deletions under the action of the same agents, which leads to their inactivation but it was subsequently shown that these forms were not functional (Oliver et al.,
and consecutive disregulation of the pathways that control cellular growth and 2002)(21). It is constituted of 11 exons that encode a nuclear phosphoprotein with
differentiation. functions in the regulation of gene transcription, DNA synthesis and reparation, cell
Studies have demonstrated that patterns of genetic alterations can be used to cycle coordination and reparation, cell cycle coordination and apoptosis. Thus, the
predict the behavior and tumorigenetic potential of pre-malignant laringeal lesions. loss of function of the p53 gene determines genomic instability and accumulation
In a retrospective study, it has been demonstrated that loss of chromosomes 9p21 of genetic alterations.
and 3p14 were more frequent in patients whose premalignant disease eventually Most frequently, mutations involve guanine, including G:C to T:A transver-
developed into scuamous cell carcinoma (Chang S et al., 2008)(6). sions and G:C to A:T translocations at the level of non GpC sites. These changes are
frequently associated with benzo(α)pyren, nitrosamines and oxygen reactive species
Cromosome 9p from tobacco smoke (Fan CY, 2001)(8). These selective mutations seem to be caused
The 9p21-22 deletion is the most frequent genetic alteration in laryngeal by the formation of specific compounds between DNA and the carcinogens men-
carcinogenesis, occuring in about 70% cases (Kim et al., 2004)(18). At this level tioned above and usually affect the codons 238-248 (Hardisson D, 2003)(15).
p16/p14ARF gene, responsible of tumor supressor activity is located. This alteration The product of the mutant p53 gene, characterized by conformational changes,
is found in 20% of the benign squamous hyperplasias and in 57% of the dysplasias has a prolonged half-life and stability, and can be detected at nuclear level by IHC
of the larynx (Califano et al., 1996)(5). staining. Molecular assessment of surgical margins for the TP53 mutations observed
Gene p16 encodes a 16kDa protein, part of the cyclin dependent kinase inhibi- in primary laryngeal carcinoma have shown that if the margins are positive for the
tors (CDKIs), among p15WAF/CIP1 and p27KIP1. The product of the p16 (CDKN2A/ clonal genetic alteration, there is an increased risk of local recurrence (Ueno T. et
MTS1) gene binds to CDK4 and CDK6, inhibiting their association with the cyclinD1. al., 2003)(25).
The inhibition of cyclin D1/CDK4/6 complex activity prevents the Rb phosphoryla- Califano et al. Found p53 mutations in 11% of the benign squamous cell
tion and the release of E2F, thus preventing the G1-S transition in the cell cycle. hyperplasia of the larynx, in 33% of the dysplastic lesions and 47% of the car-
The genetic alterations that inactivate p16 gene offer growth advantage to the cell, cinoma in situ.
contributing in the carcinogenesis process (Hardisson D, 2003)(15).
Gene p14ARF inhibits the association between p53 and its inhibitor, MDM2, Chromosome 11q
resulting an antiproliferative effect (Ha P et al., 2008)(14). On the 11q13 chromosome there are located the bcl-1, int-2, hst-1 and cyclin
The p16/p14ARF genes can be inactivated by an alternative mechanism by D1/ PRAD1 genes. The function of the cyclin D1 protooncogene, also known as
the promoters hypermethylation (Fan, 2004)(8). This is an epigenetic phenomenon PRAD1 and CCND1, is the Rb activation by phosphorilation, forming complexes with
consisting in the abolishment of the gene expression without mutations in the the cyclin dependent kinase cdk 4 and cdk 6, facilitating the progression from the
sequence of the genetic code. The methylation of the cytosine residues at the G1 phase to the S phase of the cell cycle (Kim m. et al., 2004)(18).
level of the CpG regions of the promoters is responsible of the reduced expression The cyclin D1 supraexpression shortens the G1 interval and reduces the mitogen
(Baylin and Herman, 2000)(1). Thus, in a significant number of cases the inactiva- dependence for the cellular proliferation.
tion of the p16 gene can occur in the absence of homozygous deletions. Loss of Alterations in the cyclin D1 expression are found according to Califano et al. in
gene function due to promoter hypermethylation has several characteristics that 6% of the benign squamous hyperplasia, 29% of the dysplasia lesions and 40%
bear striking similarity to loss of the tumor suppressor gene function by somatic of the carcinoma in situ.
mutation. First, promoter methylation in one allele is frequently accompanied by Amplification of the cyclin D1 gene may also have prognostic significance. In a
deletion of the opposite allele, resulting in loss of heterozygosity of the gene. Second, homogenous cohort of 51 patients with laryngeal carcinoma treated surgically with
gene inactivation in association with promoter hypermathylation is fully heritable. or without postoperative radiotherapy, Belacosa et al. demonstrated independent
Finally, loss of gene function due to epigenetic alterations leads to selective growth prognostic values for both tumor stage and cyclin D1 gene amplification in predicting
advantage in a manner identical to loss of tumor suppressor gene function due to poor overall survival (Jeannon J.P. et al., 2004)(17).
somatic mutation (Herman and Baylin, 2000)(16).
Beside the activation of the oncogenes and the inactivation of the tumor sup-
Chromosome 3p pressor genes, laryngeal carcinogenesis is also characterized by the supraexpression
Another genetic alteration that occurs early in the laryngeal carcinogenesis of proteins as result of gene amplification and the increased DNA transcription and
process is the deletion at 3p14.2, present in 16% of the laryngeal squamous benign translation.
hyperplasias, 52% of the dysplasias and 60% of the carcinoma in situ (Califano et
al., 1996)(5). The epidermal growth factor receptor (EGFR)
At this level is located the FHIT (fragile histidine triad), member of the histidine The EGFR gene is located on the chromosome 7p12 and it has 110kb. It is a
triad superfamily. It seems to work as a preapoptotic tumor supressor gene, that, transmembranar receptor, regulator of growth. Its structure consists of a glycopro-
when affected by deletions, can induce multiple epithelial tumors. The low level tein of 170 kDa, that influences cell division, migration, adhesion, differentiation
of protein expression of the FHIT associates low rates of apoptosis and increased and apoptosis, acting on the tyrosine kinase pathway, activating STATs through

phosphorilation (Pomerantz R.G. and Grandis G.R., 2004)(23). 4. Brown J, Xu H, Nishitani J, Mohammed H, Osborne R, Tekle-
The EGFR overexpression is an early event in laryngeal carcinogenesis. Its level haimanot S, Gill G, Liu X. potential biomarkers for head and neck
squamous cell carcinoma. Laringoscope 2003;113:393-400.
increases with the degree of the epithelial lesions (Gale N.et al., 2008)(11). The 5. Califano J, van der Riet P, Westra W, Nawroz H, Clayman G, Pianta-
retinoic acid, used in the treatment of the laryngeal precancerous lesions, decreases dosi S, Corio R, Lee D, Greenberg B, Koch W, Sidransky D. Genetic
the level of the EGFR mRNA by low gene transcription. progression model for head and neck cancer: implications for field
cancerization. Cancer Research 1996;56:2488-92.
6. Chang S, Califano J. Current status of biomarkers in head and
Ki-67 neck cancer. J Surg Oncol 2008;97:640-643.
Ki-67 is a nuclear protein expressed only in cells actively going through cell 7. Crissman J, Visscher D, Sarcar F. Premalignant lesions of the upper
cycle and it can be used to appreciate the proportion of proliferating cells in a aero-digestive tract: biomarkers of genetic alterations, proliferation
and differentiation. J Cell Bioch 2004;53:192-198.
population. It can be determined by IHC techniques and quantitated by determining 8. Fan CY. Epigenetic alterations in head and neck cancer: preva-
the percent of nuclei that stain (Brown J et al., 2003)(4). lence, clinical significance and implications. Current Oncology
As a marker of cell activity, Ki-67 can be useful in the prognosis of laryngeal Reports 2004;6:152-161.
9. Fearon ER, Vogelstein B. A genetic model for colorectal tumori-
precancerous lesions. The researchers at Fox Chase Center in Philadelphia observed genesis. Cell 1990;61:759-767.
that Ki-67 is nine fold more increased in the basal layer of the dysplastic lesions 10. Gale N, Zidar N, Kambic V, Poljak M, Cor A. Epidermal growth fac-
compared to normal mucosa and more increased in the superficial layers in high tor receptor, c-erb-2 and p53 overexpressions in epithelial hyper-
plastic lesions of the larynx. Acta Otolaryngol 1997;527:105-110.
grade dysplasia compared to low grade ones (Koch W., 1999)(19). 11. Gale N, Michaels L, Luzar B, Poljak M, Zidar N, Fischinger
In another report, 9 of 10 low grade preneoplastic laryngeal lesions that J, Cardesa A. current review on squamous intraepithelial le-
eventually progressed to invasive scuamous cell carcinomas, had detectable Ki-67 sions of the larynx. Histopathology 2008 DOI: 10.1111/j.1365-
staining. In contrast only 2 of 22 lesions that did not progress expressed Ki-67. Thus, 2559.2008.03111.x
12. Gallo O, Vincentis M, Rocca C, Moi R, Simonelli L, Minni A,
as a marker of biologic agressiveness in premalignant lesions, the sensitivity and Shaha A. Evolution of precancerous laryngeal lesions. Head and
specificity of Ki-67 approached 90% (Pignataro L. et al., 1998)(22). Neck 2000;23:42-47.
13. Ha P, Califano J. The molecular biology of mucosal field cance-
risation of the head and neck. Crit Rev Oral Biol Med 2003;14:363-
The proliferating cell nuclear antigen (PCNA) 369.
PCNA is a nuclear protein as Ki-67 that appears late in the G1 phase, increases 14. Ha P, Chang S, Glazer C, Califano J, Sidransky D. molecular
in S phase and decreases through G2 and M phases of the cell cycle. It is involved techniques and genetic alterations in head and neck cancer. Oral
in the regulation of DNA synthesis and cell proliferation. It can be detected by IHC Oncology 2008.
15. Hardisson D. molecular pathogenesis of head and neck
techniques with PC10 antibody (Sarac S. et al.)24. squamous cell carcinoma. Eur Arch Otorhinolaryngol 2003;260:502-
508.
16. Herman JG, Baylin SB. Promoter-region hypermethylation and
CONCLUSIONS gene silencing in human cancer. DNA Methylation and cancer. Ed-
ited by Jones PA, Vogt PK. New York: Springer Verlag, 2000:35-50.
The term “field cancerization” reunites today more concepts that its initial use 17. Jeannon JP, Soames JV, Aston V, Stafford FW, Wilson JA. Mo-
50 years ago. What at the beginning was only the description of histologic changes lecular markers in dysplasia of the larynx: expression of cyclin-
dependent kinase inhibitors p21, p27 and p53 tumour suppressor
includes today the molecular bases of the transformation of the normal epithelium gene in predicting cancer risk. Clin Otol 2004;29:698-704.
in premalignancy and cancer. 18. Kim M, Califano J. Molecular pathology of head and neck cancer.
Precancerous lesions of the larynx are intermediary states between the physi- Int J Cancer 2004;112:545-553.
ological mucosa and cancer. The development of molecular techniques promises 19. Koch W. Clinical implications of biomarkers in head and neck
cancer. Current Oncology Reports 1999; 1:129-137.
to facilitate early diagnosis, the creation of screening protocols for population at 20. Monier R, Tubiana M. cancerogenese. Accroissement des
risk and a better surveilance for cancer treated patients. The creation of a molecular connaissances et evolution des concepts. Oncologie 2008;10:319-
profile of the lesions will facilitate the analysis of surgical margins, the prediction 347.
21. Oliver M, Eeles R, Hollstein M, Khan MA, Harris CC, Hainaut P.
of the behavior of precancerous lesions and laryngeal malignancy and the therapy The IARC TP53 database: new online mutation analysis and recom-
response. mendations to users. Hum Mutat 2002;19:607-614.
The use of adenoviral vectors to restore p53 expression, demethylating agents 22. Pignataro L, Capaccio P, Pruneri G. the predictive value
to re-express p16, anti-EGFR immunotherapy and small molecule kinase inhibitors of p53, MDM2, cyclin D1 and Ki-67 in the progression of low
grade dysplasia towards carcinoma of the larynx. J Laringol Otol
are in various stages of testing and clinical trials. 1998;112:455-459.
23. Pomerantz RG, Grandis GR. The epidermal growth factor re-
ceptor signaling network in head and neck carcinogenesis and
REFERENCES implications for targeted therapy. Semin Oncol 2004;31:734-443.
24. Sarac S, Ayhan A, Hosal AS. Prognostic significance of PCNA
1. Baylin SB, Herman JG. DNA hypermetilation in tumorigenesis:
expression in laryngeal cancer. Arch Otolaryngol Head Neck Surg
epigenetics joins genetics. Trends Genet 2000; 16:168-174.
1998;124:1321-1324.
2. Braakhuis B, Leemans R, Brakenhoff R. A genetic progression
25. Ueno T, Hoshii Y, Cui D, Kawano, Gondo T, Takahashi M, Ishihara
model of oral cancer: current evidence and clinical implications. J
T. Immunohistochemical study of cytokeratins in amyloid deposits
Oral Pathol Med 2004;33:317-322.
associated with squamous cell carcinoma and dysplasia in the oral
3. Braakhuis B, Leemans R, Brakenhoff R. Expanding fields of ge-
cavity, pharynx and larynx. Pathol Int 2003;53:265-269.
netically altered cells in head and neck squamous carcinogenesis.
Seminars in cancer biology 2005;15:113-120.

ALTERARI MOLECULARE IN LEZIUNILE PRECANCEROASE
LARINGIENE
Rezumat
Leziunile precanceroase ale laringelui sunt stari intermediare intre mucoasa fiziologica si cancer.
Studiile recente de biologie moleculara in cancerele capului si gatului au scos in evidenta un model al carcinogenezei in care rolul central este jucat de campul
de celule alterate genetic. In ultimii 20 de ani s-a obtinut o cantitate enorma de informatii din analiza gentica a cancerului laringian.
In progresia malignitatilor sunt implicate doua clase de gene: oncogenele si genele supresoare tumorale.
Tehnicile de biologie moleculara au identificat mutatii la nivelul cromozomilor 9p, 3p, 17p, 11q si acumularea de proteine nucleare precum Ki-67 si PCNA.
Aceste alterari genetice sunt reprezentate de inactivarea unor gene supresoare- p16, p53, FHIT-si de activarea oncogenelor-ciclina D1.
Progresele in intelegerea bazei moleculare a carcinogenezei laringiene vor ajuta la identificarea de noi markeri moleculari care ar putea fi folositi pentru un
diagnostic mai exact si pentru stabilirea prognosticului si ar putea deschide calea unor noi protocoale terapeutice si de preventie.
Keywords: hiperplazie scuamoasa benigna, displazie, carcinoma in situ, oncogene, gene supresoare tumorale, proteine nucleare

THE HYPOLIPEMIANT EFFECT OF HIGH DOSES
ATORVASTATIN THERAPY IN DIABETIC PATIENTS
WITH ACUTE MYOCARDIAL INFARCTION
ADRIANA S. POTRA, VIRGIL M. LUCA, CONSTANTIN O. LUCA
Institute of Cardiovascular Disease Timisoara
“Victor Babes” University of Medicine and Pharmacy, Timisoara, Romania
ABSTRACT
In cardiovascular patients, the presence of diabetes mellitus is a major cardiovascular risk, according to all the clinical evidences in the present. However,
there is a lack of information on the acute coronary patients with diabetes mellitus witch arrived late at specific medical cardiovascular assistance, because
of the distance.
This trial evaluates the long term hypolipemiant effect of the early therapy with high doses Atorvastatin 80 mg in diabetic coronary patients hospitalized in
The Cardiology Department of The Cardiology Institute in Timisoara.
We studied 352 acute coronary patients, only 81 being with diabetes mellitus type 2. The period from the first symptomatic evidence to the hospitalisation
was late, 8-12 hours. The present observational study is undertaken in accordance with all valid ethical principles, all the patients included benefited from
pharmaceutical therapy conformable with the current therapeutic guides. Written informed conscience was obtained from all patients. We had two groups
of patients: the control group (A) and the group of patients who received the early therapy with high doses of Atorvastatin 80 mg (B).
At the baseline, the level of seric lipids was similar for both lots of patients with an average level of the LDL cholesterol of 124 mg/dl, triglycerides 184 mg/dl
and HDL 46 mg/dl. At 6 months the reduction of the level of total cholesterol, of the LDL and of the triglycerides was complete in the lot of patients with high
dose of Atorvastatin; this fact maintained at 12 months and at 24 months. By the end of the study, after 24 months treatment, the diabetic coronary patients
treated with 80 mg Atorvastatin had mean reduction of LDL cholesterol of 61%, approximately 90% of the maximum reduction in plasma LDL cholesterol
levels was achieved by the end of the first 2 weeks.
Patients treated with 80 mg Atorvastatin had reductions in total cholesterol of 46% and reductions of Apo B of 50%, respectively. Atorvastatin 80 mg reduced
plasma triglycerides concentrations in 24 months with 25%. There was no consistent pattern in the percent changes from baseline for HDL cholesterol, apo
A-I and LP (a).
The present observational study is undertaken in accordance with all valid ethical principles, all the patients included benefited from pharmaceutical therapy
conformable with the current therapeutic guides. Written informed consent was obtained from all patients.
The results of our trial confirm and sustain all the present medical evidences, that the early therapy with high doses of statin has a lot of benefits in short and
long term evolution of coronary patients.
Key words: acute myocardial infarction, Atorvastatin, hypolipemiant, triglycerides, cardiovascular risk
INTRODUCTION coronary by pass undertaken in the last 3 months, PTCA in the last 6 months, severe
Diabetes has been shown to increase the cardiovascular risk in all populations anaemia (HGB < 8mg%), dialysis patients (IRC stadium IV), insulin-dependent
studied. However, there is a lack of information on the acute coronary patients with diabetes, pregnancy and nursing.
diabetes mellitus witch arrived late at specific medical cardiovascular assistance, The present observational study is undertaken in accordance with all valid
because of the distance. The objective of this analysis was to evaluate the long ethical principles, all the patients included benefited from pharmaceutical therapy
term evolution of these type of patients with high doses of Atorvastatin therapy conformable with the current therapeutic guides. Written informed consent was
80 mg. obtained from all patients. The hospitalized patients, with acute myocardial infarct
(with or without pre-hospital thrombolysis) and severe unstable angina, were
treated and monitored adequately during the hospitalization period and received
MATERIAL AND METHOD high doses of Atorvastatin (80mg/day) after which they were attentively monitored
The present observational study is undertaken on acute coronary patients with both clinically and biologically at 6 months, 12 months and 24 months. All the
diabetes mellitus non insulin-dependents, adults (above 18 years), that hospitalized patients received recommendations for hygiene-dietetic regime, conformable with
relatively tardy, 8-12 hours after the onset of the myocardial infarct, regardless of the current therapeutic guides.
the presence or absence of dyslipidemia. After 24-96 hours of hospitalization, the acute coronary patients received
We excluded the coronary patients that were scheduled for revascularization Atorvastatin in maximum dose of 80mg/day; the clinical and paraclincal monitoring
interventions, the myocardial infarct patients with Q wave in the last 4 weeks, of the patients has been duly undertaken, both during the hospitalization period
Received March 2009. Accepted June 2009. Address for correspondence: Dr. Adriana Potra, Institute of Cardiovascular Disease, ”Victor Babes” University of Medicine and Pharmacy Timisoara, 2A
Eftimie Murgu Square, 300041, Timisoara, Romania, phone/fax: 0256220479

en informed consent was obtained from all patients. The hospitalized patients, with acute
nfarct (with or without pre-hospital thrombolysis) and severe unstable angina, were treated
d adequately during the hospitalization period and received high doses of Atorvastatin
and after the hospitalization at 6, 12 and 24 months. The clinical and paraclinical At the baseline, the level of seric lipids was similar for both lots of patients
fter which they were attentively monitored both clinically and biologically at 6 months, 12
evolution of these patients was compared with hospitalized patients with similar with an average level of the LDL cholesterol of 124 mg/dl, triglycerides 184 mg/dl
24 months. All the patients received recommendations for hygiene-dietetic regime,
characteristics who received usual pathology specific treatment, except the maxi- and HDL 46 mg/dl. At 6 months the reduction of the level of total cholesterol, of
with the current therapeutic guides.
mum Atorvastatin dose administered just after admission in the study. Preliminary the LDL and of the triglycerides was complete in the lot of patients with high dose
24-96 hoursanalyses
of hospitalization,
of the results at 2 weeks, 3the acute
months, 6 months,coronary
12 months andpatients
24 months received Atorvastatin
of Atorvastatin; in at 12 months and at 24 months (Table I).
this fact maintained
se of 80mg/day; the clinical and paraclincal monitoring
from the hospitalization of acute myocardial infarct patients were effectuated. of the patients has been duly
By the end of the study, after 24 months treatment, the diabetic coronary
oth during the hospitalization
Upon entering the baseline period phaseand after the
and continuing hospitalization
throughout the therapy at 6,patients
12 and treated24with
months.
80 mg atorvastatin had mean reduction of LDL cholesterol
and paraclinical evolution of these patients was compared
phase of the study, patients were counselled on to use of the National Institutes of with hospitalized patients
of 61%, approximately 90% withof the maximum reduction in plasma LDL cholesterol
cteristics who Health
received usual pathology specific treatment, except
(NIH) NCEP Diet. This diet limits dietary cholesterol to <300 mg/d and total the maximum Atorvastatin
levels was achieved by the end of the first 2 weeks.
tered just after
fats toadmission in thewithstudy.
<30% of total calories, <10% ofPreliminary analyses
total calories from saturated of the results
fats, 10% at 2 treated
Atorvastatin weeks, 3 had dose-related reductions from baseline in total
patients
nths, 12 months and 24 months
from polysaturated fromfrom
fats and 10-15% themonosaturated
hospitalization fats. of acute myocardial infarct and
plasma cholesterol patients
Apo B (Table I). Patients treated with 80 mg Atorvastatin had
ted. reductions in total cholesterol of 46% and reductions of Apo B of 50%, respectively.
entering the baseline
STATISTICAL phase ANALYSIS
and continuing throughout the therapy phase Atorvastatinof80 mg
thereduced
study,plasma triglycerides concentrations in 24 months with
counselled on toTheuse of the
sample size ofNational
the study wasInstitutes of aHealth
chosen to detect significant(NIH)
linear doseNCEP Diet. This
25%. There was diet limits
no consistent pattern in the percent changes from baseline for HDL
sterol to <300effect
mg/d for aand total fats
25% difference to <30%
between the meanof total
percent calories,
changes of controlwith
and the<10% of total calories
cholesterol, apo A-I and from
LP (a).
10% from polysaturated fats and
highest dose of Atorvastatin. 10-15%
Statistical analysesfrom monosaturated
were performed fats.
with SAS statistical
package. Analyses included data from all patients with at least one baseline and one SAFETY
AL ANALYSIS double blind measurement of the parameter of interest regardless of the patient No serious adverse effects appeared in more than 1% of the patients. Increased
ample size of the study was chosen to detect a significant linear dose effect
compliance protocol. ANOVA was used to evaluate the effect of Atorvastastin on the hepatic for a(three
transaminases 25% times the normal value) appeared in 8 patients (4.5%),
tween the mean percent changes of control and the highest dose of Atorvastatin. StatisticalAtorvastatin was stopped and who where excluded
percent change from the baseline in LDL cholesterol, the primary efficacy parameter. for whom the treatment with
e performed withBaselineSASwas define as the meanpackage.
statistical of each patient’s LDL cholesterol
Analyses values at start,
included data fromfrom
allthepatients
study. No case
withof documented
at myositis was registered.
with the analysis of percent change from the baseline being performed
eline and one double blind measurement of the parameter of interest regardless of the patient at the last
rotocol. ANOVA visit of the study.used
was On thetobasisevaluate
of this model,the a sequential,
effect“stepof down” trend test
Atorvastastin on theDISCUSSIONS
percent change
was performed to determine the significance of the duff
line in LDL cholesterol, the primary efficacy parameter. Baseline was define effect. Dunnett’s test was Atorvastatin
as thehasmeana rapid onset
of of action; approximately 90% of LDL-cholesterol
LDL cholesterol values at start, with the analysis of percent change from the baseline being within the first 2 weeks of treatment. Reduction
used to compare each group when the percent change was not monotonic across reduction from baseline occurred
the last visit the
of dose
thelevels. All analyses
study. On werethe done
basis usingofa two-sided
this model,significance level of 5%.
a sequential, of LDLdown”
“step cholesteroltrend
was 61% testin Atorvastatin 80 mg group of patients, after 24
The same analysis was performed for secondary efficacy parameters
d to determine the significance of the duff effect. Dunnett’s test was used to compare each except that months. In addition to LDL cholesterol, apo B, the major protein component of
the baseline value for Apo-I, apo-B and Lp (a) was the mean of the measurements Ldl cholesterol, was reduced from baseline with 51% after 24 months. There were
he percent change was not monotonic across the dose levels. All analyses were done using a
during the study. no clinically important changes in HDL cholesterol, Apo A-I or LP (a). Triglycerides
nificance level of 5%. The same analysis was performed for secondary efficacy parameters
were reduced from baseline with 32% after 24 months of treatment with 80 mg
e baseline value for Apo-I, apo-B and Lp (a) was the mean of the measurements during the
RESULTS Atorvastatin.
From a total of 584 acute coronary patients, we included 352 patients with Atorvastatin was well tolerated in this study. No serious adverse effects ap-
acute myocardial infarction and severe unstable angina in the study, and only 81 peared in more than 1% of the patients. Increased hepatic transaminases (three
patients with diabetes mellitus, in accordance with the preset inclusion criteria, the times the normal value) appeared in 8 patients (4,5%), for whom the treatment
a total of 584 acute
period coronary
of the inclusion patients,
of the patients being weFebruaryincluded
2004-December 3522005. patients
The with
withacute myocardial
Atorvastatin was stopped and who where excluded from the study. No case
d severe unstable angina in the study, and only 81
moment of the admission of the patients to the study overlapped with the moment patients with diabetes
of documented myositis wasin
mellitus, registered.
with the presetofinclusion criteria,
their hospitalization. the period
The maximum daily doseof the inclusion
of Atorvastatin (80mg/day) ofwasthe patientsThisbeing February
study suggests that 80 mg Atorvastatin is very effective in precocious
ber 2005. Theadministered
momentto aoflot the of 179admission
patients, the restofof the thepatients
patients receivedtothethe
usualstudy overlapped with
treatment of diabetic thewith acute myocardial infarction.
patients
eir hospitalization.
treatmentTheaccordingmaximum daily dose
to the valid therapeutic guides of Atorvastatin
(other (80mg/day) was administered
statins in usual doses),
79 patients, the
meaningrest of the
the control patients
lot was composed ofreceived
173 patients.the usual
The clinical treatment according
and paraclinical to the valid
CONCLUSIONS
uides (other statins
monitoringinofusual doses),
all the patients meaningat 6,the
was undertaken control
12 and 24 months lotfrom
was thecomposedThe ofpresent
173study
patients.
proves that the early administration of 80mg/day Atorvas-
and paraclinical monitoring
inclusion to the study. The ofclinical
all the patients was
and demographical data ofundertaken
the patients fromat the 6, 12 and
tatin in24 months
diabetic patientsfrom
with acute myocardial infarction late hospitalised, with
to the study. two
Thegroups
clinical andatdemographical
were similar the moment of the inclusion datato of the (Table
the study patientsI). from the two STgroups
or without segment were
depression, is necessary immediately after the ischemic
moment of the inclusion to the study (Table I). event and in the long run, because it reduces the recurrence of the ischemic events
Table I. Adjusted mean percent changes from baseline in lipid and apolipoprotein in long term evolution and especially the ischemic cardiovascular recurrences that
Adjusted mean percent changes from values baseline in lipid
at 24 months therapyand apolipoprotein values at 24require months therapy
hospitalization.
Percent (%) change Control Atorvastatin 80 mg The aggressive decrease of the values of the serum lipids at the administra-
LDL Cholesterol 7.6 -61.0* tion of Atorvastatin in maximum dose of 80mg/day is very effective in short time,
Total cholesterol 4.8 -45.7* approximately 90% of LDL-cholesterol reduction from baseline occurred within
HDL cholesterol -2.5 3.5*
the first 2 weeks of treatment.
Triglycerides -0.7 -27.2
Apo A-I -3.5 0.8 Atorvastatin was generally well tolerated in this patient population. There
Apo B 5.8 -50.3* were no documented cases of myositis, witch is the most serious adverse effect of
Lp (a) 7.1 -14.2* statins. Levels of serum transaminases exceeding 3 times the ULN were detected
in 8 patients, but these patients were excluded.
* Significant different than control by sequential, step-down, trend test, p<0.05
In conclusion, the results of this trial indicate that the treatment with high doses

Atorvastatin 80 mg may provide adequate therapy for diabetic patients with acute trial of cholesterol lowering in 4444 patients with coronary heart
myocardial infarction late hospitalised. disease: the Scandinavian Simvastatin Survival Study (4S). Lancet.
1994;344:1383-1389
10. Sacks FM, Pfeifer MA, Moye LA, et al. The effect of pravastatin
REFERENCES on coronary events after myocardial infarction in patients with
1. Seehusen S, Dean A, Aspleend, Chad A, Johnson, Dawn R, Horde, average cholesterol levels. N. ENgl. J Med. 1996;335:1001-1009
Kevin A. Primary evaluation and management of statin therapy 11. The long term intervention with pravastatin in Ischemic Dis-
complications. Southern Medical Journal, 1 March 2006:2:113- ease (LIPID) Study Group. Prevention of cardiovascular events
156. and death with pravastatin in patients with coronary heart dis-
2. Effectiveness and efficiency of different guidelines on statin ease and broad range of initial cholesterol levels. N. Engl. J Med.
treatment for preventing deaths from coronary heart disease: 1998;339:1349-1357
modelling study. Douglas G Manuel, Kelvin Knowing, Peter Da- 12. Fragmin and Fast Revascularization During Instability in
nuseputro, Jenny Lim, Cameron A Mustard, Geofrey M Anderson, Coronary Artery Disease (FRISC II) Investigators. Invasive com-
Sten Ardal, David A Alter. BMJ 2006, 332:1419 (17 June). pared with non-invasive treatment in unstable coronary-artery
3. Fluster V, Moreno PR, Fayad ZA, Corti R, Badimon JJ. Athero- disease: FRISC II prospective randomized multicentre study. Lancet
thrombosis and high-risk plaque: part I: evolving concepts. Am J 1999;354:708-715
Cardiol.2005; 46(6):937-954. 13. Gotto AM, Whitney E, Stein EA. Et al. Relation between baseline
4. Miller KL, Pollack CV Jr, Petterson Ed. Moving from evidence to and on-treatment lipid parameters and first acute major coronary
practice in the care of patients who have acute coronary syndrome. events in the Air Force/Texas Coronary Atherosclerosis Prevention
Cardiol Clin. 2006; 24(1): 87-102. Study (AFCAPS/TexCAPS). Circulation. 2000;101:477-484
5. Fletcher GF, Bufalino V, Costa F, et al. Efficacy of druf therapy in 14. Knatterud GL, Rosenberg Y, Campeau L, et al, for the Post
the secondary prevention of cardiovascular disease and stroke. CABG Investigators. Long Term effects on clinical outcomes of
Am J Cardiol.2007; 99(6C):1E-35E. aggressive lowering of low density lipoprotein cholesterol levels
6. Vessely MR, Kellmen MD, et al. Cardiac risk assessment: matching and low-dose anticoagulation in the Post Coronary Artery Bypass
intensity of therapy to risk. Cardiol Clin. 2000; 24(1): 67-78. Graft Trial. Circulation. 2000;102:157-165
7. Bavry AA, Kumbhani DJ, Helcon TJ, Borek PP, Mood GR, Bhatt 15. Laufs U, Endres M, Huang Z, et al. Atrovastatin upregulates type
DL. Late thrombosis of drug-eluting stents: a meta-analysis of III nitric oxide syntheses in trombocytes, decreases platelets activa-
randomized clinical trials. Am J Med. 2006; 119(12): 1056-1061. tion and protects from cerebral ischemia in normocholesterolemic
8. The Expert Panel. Report of The National Cholesterol Education mice. Stroke. 2000;31:2437-2449
Program Expert Panel on detection , evaluation and treatment of 16 Guyant G, Jaeschke R, Heddle N, Cook D, Shannon H, Walter S,
high blood cholesterol in adults. Arch Intern Med. 1988:148:36- et al. Interpreting study results: confidence intervals. Basic statistics
69. for clinicians. 1995; 152:169-173
9. European Atherosclerosis Society. Prevention of coronary heart 17. G.G. Schwats, A.Olsson, M.Ezekowitz et all. Effects of atorvas-
disease: scientific background and new clinical guidelines. Nutr tatin on the early recurrent ischemic events in acute coronary
Metab Cardiovasc Dis. 1992;2:113-156. syndromes. Jama.2001;285;1711-1718.
3 Scandinavian Simvastatin Survival Study Group. Randomized
EFECTUL HIPOLIPEMIANT AL DOZELOR CRESCUTE DE

ATORVASTATIN IN TERAPIA PACIENTILOR DIABETICI CU
INFARCT MIOCARDIC ACUT
REZUMAT
Diabetul zaharat este un factor de risc major suplimentar la patientii cardiaci, cu atat mai mult la pacientii coronarieni acuti, conform tuturos evidentelor clinice
actuale. Totusi, exista o lipsa de evidente clinice effectuate la pacienti diabetici coronarieni acuti care sunt spitalizati tardiv pentru asistenta medicala de specia-
litate, datorita distantei. Prezentul studiu evalueaza efectul hipolipemiant al terapiei precoce cu atorvastatin in doza maxima, la pacientii diabetici coronarieni
acuti, spitalizati tardiv pentru acordarea asistentei medicale de specialitate in Clinica de Cardiologie a Institutului de Boli Cardiovasculare Timisoara.
Din totalul de 352 pacienti coronarieni acuti monitorizati, 81 pacienti au fost diabetici. La 8-12 ore de la debutul bolii. Terapia administrata a fost conform
ghidurilor terapeutice in vigoare, in lotul A (lot control), iar in lotul B (lotul cu atorvastatin) s-a administrat tuturor pacientilor, imediat de la internare (pre-
coce) doza maxima de atorvastatin 80 mg/zi, cu monitorizare la 6, 1 si 24 luni. La debut, valorile serice lipidice au fost similare in cele doua loturi de pacienti:
LDL_colesterol 124 mg/dl, triglyceride 184 mg/dl, HDL 46 mg/dl. Dupa 24 luni de tratament, s-au inregistrat diferente semnificative din punct de vedere
statistic intre cele doua loturi: LDL-colesterol a scazut cu 61%, colesterolul total a inregistrat o scadere cu 45,7%, cresterea HDL-colesterolului cu 3,5%, iar
Apo B a inregistrat o scadere cu 50,3%, comparative cu lotul control, in care s-a inregistrat o crestere cu 7,6% a LDL-colestrol, cu 4,8% a valorilor colesterolului
total, scaderea HDL-colesterol cu 2,5% si cresterea Apo B cu 5,8%. De mentionat ca complianta pacientilor la trtament a fost similara in cele doua loturi,
inclusive aparitia efectelor adverse secundare.
Rezultatele acestui studiu, confirma si sutin evidentele clinice effectuate pana in present, terapia precoce cu doze maxime de statine aducand numeroase
beneficii pe termen mediu si lung in evolutia pacientilor coronarieni.
Cuvinte cheie: infarct miocardic acut, Atorvastatin, hipolipemiant, triglyceride, risc cardiovascular

URBAN NOISE ASSESSMENT IN TIMISOARA
ERNEST PUTNOKY
Ministry of Environment IB Timisoara
ABSTRACT
Noise is a modern plague of the urban society. In an effort made to asses the noise level of the urban area of Timisoara, a number of 103 noise level mea-
surements, each 8 hours long were performed in the daytime. The measurements show that the urban noise in generated mainly by road traffic, affecting
significantly residential, recreational and medical treatment areas.
Keywords: urban noise, daytime noise measurements, road traffic
INTRODUCTION Traffic area measurements were made at the edge of the pathway (25m from
Noise consists of all unwanted sound - sound that is loud, unpleasant or the axis in the railways case), industrial and medical treatment area measurements
unexpected. It has been increasing in urban areas to the point where it has become were made along the specific perimeter, recreational area measurements were made
a matter of public concern. inside the area, as central as possible and in the residential area measurement were
The effects of noise can vary from one individual to another. However, a WHO conducted at a distance of 3m form the façade of the buildings, facing the noise
report entitled "Community Noise - Environmental Health Criteria", published in sources, according to Romanian measurement standards (6).
1996, and highlights such effects as disturbance of sleep, auditory or physiological The measuring instrument chosen was a Bruel&Kjaer 2238 Mediator (Class
effects (basically cardio-vascular) and interference with communication. 1 Integrating Sound Level Meter with logging software) fitted with an outdoor
Initially, action to reduce noise was not considered an environmental priority kit (free-field microphone with windscreen, cable preamplifier extension and
- unlike action to reduce air pollution, for example. The effects of noise are unspec- tripod)
tacular, and the decline in quality of life was accepted by the general public as being The microphone was set at a height of 1.3 m form the ground level, according
an inevitable consequence of technological progress and urbanization (1). to Romanian noise measurement standards (6).
However it has been estimated that around 20 percent of the European Union's A 100 ms sampling rate was selected in order to maximize the amount of
population or close to 80 million people suffer from noise levels that scientists and recorded data (288,000 samples/measurement) for statistical purposes and for
health experts consider to be unacceptable, where most people become annoyed, further analysis.
where sleep is disturbed and where adverse health effects are to be feared. An Before each measurement the SLM was recalibrated using a class 1 acoustic
additional 170 million citizens are living in so-called 'grey areas' where the noise calibrator.
levels are such to cause serious annoyance during the daytime (2). Measurement data included LAeq (A-weighted equivalent noise level) L90
(background noise) and L10 (maximum noise). Lowest sound pressure levels and
MATERIALS AND METHODS peak levels were also recorded. The measurement unit was the dBA (A-weighted
In 2008, a number of 103 8h-daytime measurements were conducted in decibel) (5).
randomly selected measurement points in the urban area of Timisoara. The measure-
ment points were later classified by the function of the selected urban area:
RESULTS
• Traffic area (roads, public transportation paths & railways) Road traffic measurement conducted on the main roads at the city limits
• Industrial area area indicated higher noise levels due to higher vehicle speed and increased traffic
• Residential area density. It is known that at speeds above 50 km/h tire noise becomes significant in
• Recreational area (playgrounds & parks) the overall noise emission of a vehicle. The equivalent noise level was in all cases
• Medical treatment & care area above 60 dBA, although the background noise was in some 3rd category roads under
45 dBA indicating that the flux of vehicles was not constant (7). However, in 2nd
category roads, the background noise was permanently over 55 dBA (Table I).
Received March 2009. Accepted April 2009. Address for correspondence: Ernest Putnoky, Ministry of Environment – IB Timisoara, Romania

c measurement conducted Roadon the themain
Area use roads at LA
theeqmotors,
of electric city limits area indicated
compressors, higherchillers, sawing mills, dryers an
ventilators,
higher vehicle speed and increased (dBA)
traffic density. It is an
known thatconstant
at speeds aboveThese
50 areas were characterized by a
1 inGiroc equipment generating almost noise.
comes significant the–overall
Centru noise emission of 62.6
a vehicle. The equivalent noise level
bove 60 dBA, 2although
Halta Semenic noise, above 50 dBA,
the background noise was 60.2
and occasionally with high peak levels during loading/unloading
in some 3rd category roads under 45
hat the flux of3 vehicles was notconstruction
Calea Girocului 113 (UM)
constant operations.
(7). 70.8
However, Ininall2ndcases measurements
category roads, theresults were influenced by the n
4 Calea Girocului – generated
Maldini noise (Table
70.9 IV).
was permanently over 55 dBA (Table I).
5 Calea Girocului – Vile Braytim 64.5
6 Calea Girocului -Albac
Table I. Road 67.6
Area Measurements
Table I. Road Area Measurements Table IV.Table IV. Industrial Area Measurements
Industrial Area Measurements
7 DN6 - Vama Timisoara 71.4
LAeq
Nr. LAeq
8 Versului Road Area 66.0
(dBA) Industrial Area
91 Uranus crt.
68.4 (dBA)
Giroc – Centru 62.6
10
2 Padurice
Halta Semenic
1 Prelucrare lemn, Dragalina
67.5
60.2
54.8
11
3 Sirius
Calea Girocului 113 (UM) 2 Spalatorie auto, Eroilor
65.9
70.8 55.7
12
4 Brancoveanu
Calea - Snagov
Girocului – Maldini 3 Centrala, Piata Victoriei
69.5
70.9 66.9
13
5 Aradului – Vile Braytim
Calea Girocului 4 Prelucrari metalice, Dragalina
72.1
64.5 59.7
6
14 Calea Girocului
Amurgului -Albac 5 67.6
73.5
Tinichigerie, Titulescu 50.0
7
15 DN6 -Sagului
Calea Vama Timisoara 6 71.4
72.4
Depozit,Take Ionescu 67.1
8 Versului 66.0
7 Fabrica mobilier, Brediceanu 65.0
transportation,9 in Uranus
the case of trams, generates a 68.4
high level of noise.
8 At an average
Chiller, Aries 5 58.8
10 Padurice 67.5
passage, with 11a peak of
Sirius 85-97 dBA, on canyon-like
65.9 streets (Gheorghe
9 Doja), tram
Service auto, Eroii de la Paulis 59.9
uld be a serious
12 issue, especially
Brancoveanu at high speeds and
- Snagov poorly maintained
69.5 rails andCaprioarei
10 Brutarie, cars. A 51.8
s at the Drubeta – Eneas junction where the improper maintenance
13 Calea Aradului 72.1 11 ofBenzinarie,
the curved Lidiarails 65.0
14 Amurgului 73.5
5.9 dBA, the distance between the rails and the façade of the residential buildings in Buziasului
the
12 Fabrica boltari, 52.4
15 Calea Sagului 72.4
n 3 meters (Table II). 13 Fabrica electrice, Orion 50.8
transportation,
TableinII.the case of trams, generates
Table II. Public Transportation – Trams Measurements
Public Transportation a high level oflong
– Trams Measurements noise.
intervalAt anbetween
of time average 5 permits the 8 hours value of
the passages
passage, with a peak Public of 85-97 dBA, onResidential
Transportation - canyon-like LAareas had isa(Gheorghe
streets LAeq
wide rangeDoja),
to settle between
of noise
58 dBA tramlevels
and 68
recorded, noise generated a
dBA. In some sectors railway noise
eq combined with road traffic noise leading to increased noise levels. Studies
uld be a serious issue, especially Trams at
road high speeds
traffic, and
mainly poorly
(dBA)becausemaintained
ofhave
theshown rails
sizethat,and and
paving cars.
psychologically, ofAthe
people tendstreets and railway
to support easier becausenoise of the cont
s at the Drubeta – Eneas
1 Rebreanu junction where the
of vehicle traffic62.6 improper maintenance
(4). There are areas
than road of the
trafficwith curved rails
lowwhenbackground
noise even railway noise levelsnoise and
are higher thanaroad
passage of fe
5.9 dBA, the distance
2 Drubeta between
- Eneasthe rails and the façade 85.9 of the residential buildings
traffic noise levels (3) (Table III).in the
n 3 meters (Table
3 II).Gheorghe Doja
Codrului Street, 75.0 LAeq 47.1 dBA,Noiseand in theareas
industrialwith
area, LAeq almost continuous
ranging between 50 dBA andnoise
67 dBA, levels of 72
4 Piata Resita Aradului. Romanian 59.8 standards recommend a maximum accepted outdoor level of
was mainly generated by the use of electric motors, compressors, ventilators,
chillers, sawing mills, dryers and other stationary equipment generating an
Table
5 II.Iosif
Public equivalent
Transportation
Nemoianu – Tramsnoise level for residential
Measurements
68.2 areas.
almost constant noise.This limit
These areas wereischaracterized
surpassed in the
by a high majority of case
background
6 PiataPublic
MariaTransportation - LA
67.5eq noise, above 50 dBA, and occasionally with high peak levels during loading/
7 Gara Nord Trams (dBA)
69.8 unloading, maintenance and construction operations. In all cases measure-
1 Rebreanu 62.6 ments results were influenced by the nearby road traffic generated noise
2The public
Drubeta - Eneas
transportation, 85.9level of
in the case of trams, generates a high (Table IV).
ys crossing noise.
the3 Attown have
anGheorghe
average an per
Doja
5 minutes impact onwith
car passage, a asmall percentage
peak of 75.0
85-97 dBA, of the population.
Residential areas had a wideTrain
range of noise levels recorded, noise gener-
high peak levels,
on 4 but Piatathe
canyon-like streets relatively long interval of
(Gheorghe
Resita Doja), tram generated noise time between
could
59.8 be a the passages
ated almost entirely by road permits
traffic, mainly because of the size and paving of
serious
5 issue,Iosif
especially at high speeds and poorly maintained rails
Nemoianu and cars.
68.2 the streets and because of the continuity and amount of vehicle traffic (4).
of LAeq toA particular
settle between
case was at the 58 dBA
Drubeta – Eneasand 68where
junction dBA. the In some sectors
improper railway noise is
6 Piata Maria 67.5 There are areas with low background noise and a passage of few cars/hour, like
maintenance of the curved rails led to a LAeq of 85.9 dBA, the distance be- Codrului Street, LAeq 47.1 dBA, and areas with almost continuous noise levels
7 Gara Nord 69.8
tween the rails and the façade of the residential buildings in the area being of 72 dBA, like Calea Aradului. Romanian standards recommend a maximum
road trafficlessnoise leading
than 3 meters (Table II). to increased noise levels. Studies have shown that,
accepted outdoor level of 50 dBA daytime equivalent noise level for residential
people tend to
ys crossing support
theThetown easierthe
have
railways crossing anrailwayhave an noise
impact
town on aonthan
impact asmall road traffic
percentage
small percentage of noise
of even
areas.the
This iswhen
surpassedrailway
population.
limit Train
in the majority of cases (Table V).
gher
high than
peakroad
the traffic
levels, butnoise
population. Train levels (3)long
the relatively
passages generate (Table
high peak III). of time betweenNoise
interval
levels, but the relatively thelevels
passages permits
in the recreational areas (parks and playgrounds) are relatively
of LAeq to settle between 58 dBA and 68 dBA. In some sectors
Table III. Railway Measurements
railway
high due to the vicinity of noise is roads. Especially for playgrounds
the city’s main
that were built beside busy roads, for easy access, this positioning leads to an
Table III. Railway Measurements
exposure of children to high levels of noise and air pollutants. Nevertheless
LAeq
Railway Area there are still parks relatively calm during daytime like the Roses Park with a
(dBA) LAeq of only 49.7 dBA and a background noise of 43.3 dBA (Table VI).
1 Spitalul Nou 67.7 Unfortunately a large number of medical treatment units and care facilities
2 DAB staĠia Meteo 63.7 are built near major roads, traffic noise having a significant impact upon this
3 Gheorghe Lazăr 67.0 kind of area. From 14 hospitals and other units investigated none was measured
4 Halta Semenic 58.2 with a daytime outdoor LAeq smaller than 55 dBA which is with 10 dBA more
than the maximum limit set for medical areas (Table VII and VIII).
5 Gara Sud 68.4
e industrial 2009.19.3(63)
area, LAeq ranging between
Fiziologia 50 dBA and 67 dBA, was mainly generated by
- Physiology 41
c motors, compressors, ventilators, chillers, sawing mills, dryers and other stationary
ting an almost constant noise. These areas were characterized by a high background
BA, and occasionally with high peak levels during loading/unloading, maintenance and
LAeq
Residential Area (dB
A)
1 Barbu Iscovescu 55.9
2 Aleea Ripensia 26 60.3
3 Piata Mărăúti 71.0
4 investigated none
Calea Martirilor – Lidiainvestigated none
66.5was measured
was measured with
with aa daytime
daytime outdoor outdoor LAeq LAeq smallersmaller thanthan 55
55 dBA
dBA ww
5 Calea Martirilor 37 dBA dBA more more than
than the
the maximum limit
67.7maximum limit set
set for
for medical
medical areas areas (Table
(Table VII VII andand VIII).
VIII).
6 CodruluiTable V. Residential Area Measurements 47.1 Table VII. Recreational Area – Playgrounds Measurements
7 Table V. Residential
Aurelianus Area Measurements 56.6 Table VII.
Table VII. Recreational
Recreational Area Area –– Playgrounds
PlaygroundsMeasurements
Measurements
8 Mihai Viteazul LA
68.5eq LAeqeq
LA
Recrational Area
Recrational Area -- Playgrounds
Playgrounds
Residential Area (dB (dBA)
(dBA)
9 Calea Martirilor – Siemens 66.6
A) 11 PiaĠa
PiaĠa Eforie
Eforie 53.5
53.5
10
1 Brediceanu 14
Barbu Iscovescu 70.7
55.9 2 Calea Aradului – MoĠul 67.1
2 Calea Aradului – MoĠul 67.1
11
2 EroilorRipensia 26
Aleea 60.4
60.3 33 Calea Aradului – Sever
Calea Aradului – Sever Bocu Bocu 65.6
65.6
12
3 Nicolae
Piata Titulescu - Dragalina
Mărăúti 68.6
71.0 44 Bucovinei
Bucovinei 49.4
49.4
13
4 PiaĠa Traian
Calea Martirilor – Lidia 55.2
66.5 55 PiaĠa Dacia
PiaĠa Dacia 1 1 53.6
53.6
14
5 PiaĠa Romanilor
Calea Martirilor 37 58.2
67.7 66 PiaĠa Dacia
PiaĠa Dacia 2 2 57.6
57.6
6
15 Codrului
Calea Aradului 18 47.1
72.8 77 Eroilor
Eroilor –– Parcul
Parcul Constructorilor
Constructorilor 58.8
58.8
7
16 Aurelianus
Take Ionescu 56.6
69.0 Table VIII. Medical Treatment and Care Area Measurements
8 Mihai Viteazul 68.5 Table VIII.
Table VIII. Medical
Medical Treatment
Treatment and and Care
CareAreaAreaMeasurements
Measurements
17 Mures 33 67.2
9 Calea Martirilor – Siemens 66.6 LAeqeq
LA
18 Piata Unirii 58.6 Medical Treatment
Medical Treatment & & Care
CareArea Area
10 Brediceanu 14 70.7 (dBA)
(dBA)
19 Piata Concordia 70.5 11 Maternitatea Bega
Maternitatea Bega -- VictorVictor Babeú
Babeú12 12 67.9
67.9
11 Eroilor 60.4
20 Piata Dr Russel 5 72.4 22 Clinicile Noi
Clinicile Noi -- PiaĠa Mărăúti
PiaĠa Mărăúti 71.8
71.8
12 Nicolae Titulescu - Dragalina 68.6
21
13 Tudor Vladimirescu
PiaĠa Traian – Mangalia 65.6
55.2 33 Spitalul Militar
Spitalul Militar -- Gheorghe
Gheorghe Dima Dima 69.1
69.1
22 CaleaRomanilor
Sagului 37 69.7 44 Clinica
Clinica Oftalmologie
Oftalmologie -- 1
1 Mai
Mai 33 70.4
70.4
14 PiaĠa 58.2
23 VictorAradului
Babes - Cluj 77.0 55 Spitalul
Spitalul Copii
Copii 3
3 Hematologie
Hematologie --
15 Calea 18 72.8 Republicii 68.0
Republicii 68.0
24
16 Iepurelui –
Take IonescuPiata Varful cu Dor 71.1
69.0 66 Spitalul Copii
Spitalul Copii 33 Ortopedie
Ortopedie -- Iosif Iosif
25
17 Simion33
Mures Barnutiu 4 63.0
67.2 Nemoianu
Nemoianu 65.8
65.8
26
18 MuresUnirii
Piata 33 69.6
58.6 77 Spitalul 5 Maternitate - 16
Spitalul 5 Maternitate - 16 Decembrie Decembrie
19
27 Piata
IancuConcordia
Vacarescu 8 70.5
59.5 24
24 71.5
71.5
20
28 Piata Dr
Lidia 100Russel 5 72.4
64.2 88 Spitalul
Spitalul Psihiatrie
Psihiatrie -- Iancu
Iancu Văcărescu
Văcărescu
21 Tudor Vladimirescu 23
23 55.9
55.9
29 Brancoveanu 52A – Mangalia 65.6
69.2
22 Calea Sagului 37 69.7 99 Spitalul CFR
Spitalul CFR -- Tudor
Tudor Vladimirescu
Vladimirescu 62.7
62.7
30 Piata Aurel Vlaicu – str. Anton Pann 63.7 10 Spitalul
10 Spitalul Clinic
Clinic 11 JudeĠean
JudeĠean –– Dr. Dr.
23 Victor Babes - Cluj 77.0
31 Liviu Rebreanu 70.5 Stanca
Stanca 59.7
59.7
24 Iepurelui – Piata Varful cu Dor 71.1
32
25 Splaiul Galati
Simion Barnutiu 46 67.8
63.0
11 Spitalul
11 Spitalul 11 Ortopedie
Ortopedie -- Aleea Aleea SănătăĠii
SănătăĠii 55.2
55.2
33 Roma 33 54.5 12 Clinica
12 Clinica 11 Pediatrie
Pediatrie -- Păltiniú
Păltiniú 61.1
61.1
26 Mures 69.6
13
13 Clinica de
Clinica de Cardiologie
Cardiologie -- Spitalul
Spitalul Nou
Nou
27 Iancu Vacarescu 8 59.5 13
13 70.1
70.1
els in the recreational areas (parks and playgrounds) are relatively
28 Lidia 100 64.2 14 Casa
14 highAustria
Casa due ––toIosif
Austria IosiftheBulbuca
Bulbuca 69.2
69.2
29 Brancoveanu 52A 69.2
y’s main roads. Especially for playgrounds that were built beside busy roads, for easy
30 Piata Aurel Vlaicu – str. Anton Pann 63.7
ioning leads 31 to anLiviu
exposure
Rebreanuof children to high levels 70.5 of noiseCONCLUSIONS and air pollutants.
e are still parks32relatively
Splaiul Galati
CONCLUSIONS
calm6during daytime like the 67.8Roses Park withByatheLAeq
Observer’sof pointonlyof view, the crushing majority of the urban noise
By the Observer’s point
sources of
of
in view,
view,
Timisoara the
the
during crushing
crushing
daytime majority
majority
are represented of
by the road the
the Inurban
oftraffic. 96% of noise
urban noise source
sourc
ackground noise 33 ofRoma
43.3 dBA (Table VI). 54.5
during daytime are represented by the by the
cases, the road
noise road traffic.
was traffic. In
generated by the In 96%96% of
traffic of cars, of the
vans,the cases,
cases, noise
trams, noise was
motorcycles and was generate
generat
Table VI. Recreational Area –of
Parkcars, vans, trams, motorcycles
Measurements lorries. Thisand
motorcycles type oflorries.
and noise affectsThis
lorries. This type
all studiedtypeareasofin anoise
of noise affects
significant affects all
degree, leadingalltostudied
studied areas
areas
els in the recreational areas (parks
Table VI. Recreational Areaand – Park
degree,playgrounds)
Measurements
leading to the areproposal
relatively that high a newdue
aa new sort to
of the should
noise
the proposal
that that new sort
sortof noise noise source
of source should
be introduced
source should be
be introduced
introduced in
in the regulations, in the
th
y’s main roads. Especially for playgrounds be that were
considered LA
as built
a
eq beside
separate busy
to category
be considered roads,
as a
from separatefor
fixed easy
category andfrom
category from fixed and mobile sources: the traffic noisefixed
mobileand mobile sources:
sources: the traffic
the traffic noise
Recreational Area - Parks
ioning leads to an exposure of children to high (dBA)
phenomenon. levels of noise noise as and airphenomenon.
a collective pollutants.
e are still parks1 relatively calm during daytime
Parc Pârvan like the
60.6 Roses Park with
Road
Road noise increasesRoadproportionally
noise
proportionallya LAeq
increases of only
proportionally
with
with speed
with speed for all categories of vehicles.
speed for for all
all categories
categories of vehicles.
material, pavement design, road maintenance and timing of the traffic lights of vehicles.
ackground noise 2 of Parc
43.3Corneliu
dBA (Table CoposuVI). pavement design, 56.6road maintenance and timing of the traffic lights
maintenance
contribute as well and to thetiming
noise levelof the traffic
generated traffic. contribute as
by the roadlights contribute as well
well to to
3 Parcul UniversităĠii generated by the54.7 road traffic. Although high values of noise were measured, railway noise in Timisoara is
4
Table Parc Doina
VI. Recreational Although62.4
Area – Park Measurements high valueslimitedof tonoise
a narrowwere
noise path andmeasured,
were measured, railway
railway
affects a small percentage noise
noise
of the in
population.in Timisoara
Timisoara isis limi lim
5 Parcul Rozelor
Recreational Area - Parks path and affects 49.7
LAa small
eq percentage Stationaryof the
percentage of the population.
noise population.
sources in the industrial area represent only 4% of the total
6 Parc Padurice Stationary(dBA)
48.6noise sources in
sources
cases. With inthethe
the industrialof the cityarea
industrial
enlargement represent
areaindustrial
limits, represent areas tendonlyto move4%
only outsideof
4% of the
the total
total c
17 Parc Pârvan
Parcul Copiilor - Beethoven 60.6
53.2
enlargement of the city limits, industrial
the industrial areas
town, therefore the areas tend
pressure tend to
on the to move
move outside
residential and outside the
protected area the town,
town, therefore
diminishes therefore
28 Parc Corneliu
Parcul Coposu – Eroilor
Constructorilor 56.6
59.0protected significantly
the residential and area
area diminishes
with the passage
diminishes significantly
of time.
significantly with
with the
the passage
passage of
of time.
time.
3 Parcul UniversităĠii 54.7 Noise levels in(recreational
protected areas (recreational and medicaltreatment)
treatment) is high
9 Parcul Zona Soarelui Noise levels58.6 in protected
protected areas
areas (recreational and
and medical
medical treatment) isis high
high in
in the
the
4 Parc Doina 62.4 in the daytime, in the majority of cases being generated by the road traffic due to
5 Parcul Rozelor
majority of cases49.7
being generated
generated by
by the
the road
road traffic
traffic due
due to
to the
the fact
fact that
that Timisoara’s
Timisoara’s mm
tely a large number
6 of medical
Parc Padurice treatment areas and
units medical
and facilities
care
48.6 are
facilities located
are
located built near
near nearvery
very majorbusy
busy roads.
roads.
e having a significant
7 impact
Parcul Copiilorupon this kind of area.53.2
- Beethoven From 14 hospitals and other units
8 Parcul Constructorilor – Eroilor 59.0
9 Parcul Zona Soarelui 58.6
tely a large number of medical treatment units and care facilities are built near major
the fact that Timisoara’s main recreational areas and medical facilities are located pean Centre For Environment And Health: Noise Guidelines For
near very busy roads. Europe, 1999
4. Drăgănescu G: Vibraţii şi zgomote, Ed. Politehnica, Timişoara,
2000
REFERENCES 5. STAS 10009-88: Acustica urbană. Limite admisibile ale nivelului
1.The European Commission: The Green Paper on Future Noise de zgomot urban.
Policy (COM(96) 540), Bruxelles 1996 6. STAS 6161/3-82: Acustica urbană. Metode de determinare a
2. The European Parliament and Council: Directive 2002/49/EC - nivelului de zgomot în localităţile urbane.
Assessment and Management of Environmental Noise, Bruxelles 7. STAS 10144/3-91: Elemente geometrice ale străzilor. Prescripţii
2002 de proiectare.
3. World Health Organization, Regional Office For Europe Euro-
EVALUAREA ZGOMOTULUI URBAN IN MUNICIPIUL TIMISOARA
REZUMAT
Zgomotul este o problema a societatii urbane moderne. Intr-o incercare de a evalua nivelul de zgomot urban in municipiul Timisoara, au fost efectuate 103
masuratori ale nivelului de zgomot, pe timp de zi, cu o durata de 8 ore pentru fiecare masuratoare. Masuratorile au indicat faptul ca zgomotul urban este
generat in mare masura de catre traficul rutier si afecteaza semnificativ zonele rezidentiale, recreationale si de tratament medical din oras.
Cuvinte cheie: zgomot urban, masuratori pe timp de zi ale nivelului de zgomot, trafic rutier


Editorial Board: Chief Editor Co-Chief Editors Associate Editors Executive Editors

Uploaded by

Copyright:

Available Formats

Editorial Board: Chief Editor Co-Chief Editors Associate Editors Executive Editors

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Editorial Board: Chief Editor Co-Chief Editors Associate Editors Executive Editors

Uploaded by

Copyright:

Available Formats

CHIEF EDITOR

Accredited by CNCSIS - B category - code 240

2009.19.3(63)  Fiziologia - Physiology 1

2 Fiziologia - Physiology  2009.19.3(63)

2009.19.3(63)  Fiziologia - Physiology 3

NEW APPROACHES TO ADAPTATION

INTRODUCTION Allostasis has a wider implication in the regulator mechanisms of the

4 Fiziologia - Physiology  2009.19.3(63)

2009.19.3(63)  Fiziologia - Physiology 5

NOI ABORDARI IN ADAPTOLOGIE

6 Fiziologia - Physiology  2009.19.3(63)

GABRIELA TĂNASIE1,2, FLORINA BOJIN1, C. A. TATU1,2, OANA GAVRILIUC1, CARMEN

INTRODUCTION their self-renewal capacity, passing through intermediary states (mesenchymal

2009.19.3(63)  Fiziologia - Physiology 7

Confirmation of differentiation potential characteristic for mesenchymal stem cells

Fig.2. MSCs, dayday5,5, ob.

2009.19.3(63)  Fiziologia - Physiology 9

Fig.6. MSCs in chondrogenic media. IHC for aggrecan ob. 20x

Fig.5. MSCs in osteogenic media. IHC for osteocalcin ob. 20x

1 the expression of E-cadherin and cytokeratin was not detectable, suggesting a

Fig.9. Vimentin expression in MSCs

Fig.11. RT-PCR for Citokeratin 19and E-cadherin in experimental groups

2009.19.3(63)  Fiziologia - Physiology 11

12 Fiziologia - Physiology  2009.19.3(63)

INTRODUCTION metabolism of bone at different ontogenetic stages of development, to determine

2009.19.3(63)  Fiziologia - Physiology 13

I 4.86 ± 0.10 3,44 ± 0,09

the specific quantities of mature or young one were detected. 0,0287±0,001

II 0.655 ± 0.03****I 0.068 ± 0.002****I 2.24 ± 0.09****I

MODIFICARILE ONTOGENETICE ALE COMPOZITIEI MINERALE

2009.19.3(63)  Fiziologia - Physiology 15

16 Fiziologia - Physiology  2009.19.3(63)

in absorbance at 340nm is measured. Continuous numerical

RESULTS AND DISCUSSION Group I A std.dev.

group) 0.009 0.001 0.458

vs 60.86+/-10.49, pT=0.0036). In table I it is also shown a significant grow of 250

2009.19.3(63)  Fiziologia - Physiology

350 different results.

MI 0nonQ with cardiovascular event MI nonQ without cardiovascular event

ACTIVITATEA GLUTATION PEROXIDAZEI AFECTEAZA

2009.19.3(63)  Fiziologia - Physiology 19

20 Fiziologia - Physiology  2009.19.3(63)

2009.19.3(63)  Fiziologia - Physiology 21

Fig. 5. Variation of malondialdehyde in the gastric tissue

Fig. 1. Variation of serum malondialdehyde

Fig. 6. Variation of carbonylated proteins in the gastric tissue

22 Fiziologia - Physiology  2009.19.3(63)

Fig. 7. Variation of the hydrogen donor capacity in the gastric tissue

Fig. 9. Histopathological appearance of the gastric mucosa in the studied groups

2009.19.3(63)  Fiziologia - Physiology 23

24 Fiziologia - Physiology  2009.19.3(63)

2009.19.3(63)  Fiziologia - Physiology 25

26 Fiziologia - Physiology  2009.19.3(63)

2009.19.3(63)  Fiziologia - Physiology 27

28 Fiziologia - Physiology  2009.19.3(63)

2009.19.3(63)  Fiziologia - Physiology 29

number of obese individuals. Obesity is no longer an American problem and it is 50

a consequence of uncontrolled diets, because statistics show that, worldwide, over

8.0 7.4 10.5 10.4

II 0.655 ± 0.03I 0.068 ± 0.002I 2.24 ± 0.09I