Phylogenetics PDF
Phylogenetics PDF
Phylogenetics - WHY?
Eukaryote tree
Eubacteria tree
AAGA(A/G)T(C/ T)
The progressive multiple alignment of a group of Most phylogenetic methods assume that each
sequences, first aligns the most similar pair. position in a sequence can change
Then it adds the more distant pairs. independently from the other positions.
The alignment is influenced by the “most Gaps in alignments represent mutations in
similar” pairs and arranged accordingly, but….it sequences such as: insertion, deletion, genetic
does not always correctly represent the rearrangments.
evolutionary history of the occured changes. Gaps are treated in various ways by the
Not all phylogenetic methods work this way. phylogenetic methods. Most of them ignore
gaps.
Relationships of Phylogenetic
Analysis and Sequences Analysis What is a phylogenetic tree?
9 NOTE: The amount of evolutionary time that ♠Terminal nodes - represent the data (e.g
passed from the separation of the 2 sequences
is not known. The phylogenetic analysis can only
sequences) under comparison
estimate the # of changes that occurred from the (A,B,C,D,E), also known as OTUs,
time of separation. (Operational Taxonomic Units).
9 After the branching event, one taxon (sequence)
can undergo more mutations then the other ♠Internal nodes - represent inferred
taxon.
ancestral units (usually without empirical
data), also known as HTUs, (Hypothetical
9 Topology of a tree is the branching pattern of a Taxonomic Units).
tree.
Slide taken from Dr. Itai Yanai
The Molecular Clock Hypothesis
Different kinds of trees can be used to
depict different aspects of evolutionary history
All the mutations occur in the same rate in all
1. Cladogram: the tree branches.
simply shows relative recency of common ancestry
The rate of the mutations is the same for all
positions along the sequence.
7 2. Additive trees:
2 a cladogram with branch lengths,
The Molecular Clock Hypothesis is most suitable for
3 4
3 also called phylograms and metric trees
1 5
1
3
closely related species.
1
3 1
3. Ultrametric trees:
(dendograms) special kind of additive tree in which the
1
3 tips of the trees are all equidistant from the root
2
1 1 1 1
Choose set of related seqs Given a multiple alignment, how do we construct the tree?
Obtain MultipleAlignment
(DNA or Proteins
Gibbon
Gibbon Gibbon
Gorilla
Orang-utan Chimpanzee Gorilla
Orang-utan Orang-utan
2. Upon the original tree we superimpose bootstrap values:
Chimpanzee Human
41
In 41 of the 100 trees, Gibbon
chimp and gorilla are
split from the rest. In 100 of the 100 trees,
Gorilla 100
gibbon and orang-utan
Orang-utan are split from the rest.
All Character Based Methods assume that Q: How do you find the minimum # of changes
each character substitution is independent needed to explain the data in a given tree?
of its neighbors.
A: The answer will be to construct a set of possible
ways to get from one set to the other, and choose
Maximum Parsimony (minimum evolution) the "best". (for example: Maximum Parsimony)
- in this method one tree will be given
CCGCCACGA
(built) with the fewest changes required to P P R
explain (tree) the differences observed in CGGCCACGA
the data. R P R
Character Based Methods - Maximum
Parsimony
Basic idea of Maximum Likelihood method is Maximum Likelihood method – using a tree
building a tree based on mathemaical model. model for nucleotide substitutions, it will try to
This method find a tree based on probability find the most likely tree (out of all the trees of
calculations that best accounts for the large the given dataset).
amount of variations of the data (sequences)
set. The Maximum Likelihood methods are very slow
and cpu consuming.
Maximum Likelihood method (like the Maximum
Parsimony method) performs its analysis on Maximum Likelihood methods can be found in
each position of the multiple alignment. phylip, paup or puzzle.
This is why this method is very heavy on CPU.
Maximum Likelihood method Character Based Methods
Distance methods assume a molecular clock, Distance - the number of substitutions per site per
meaning that all mutations are neutral and time period.
therefore they happen at a random clocklike Evolutionary distance are calculated based on one
rate. of DNA evolutionary models.
This assumption is not true for several reasons:
Different environmental conditions affect mutation Neighbors – pairs of sequences that have the
rates. smallest number of substitutions between them.
This assumption ignores selection issues which are On a phylogenetic tree, neighbors are joined by a
different with different time periods.
node (common ancestor).
Distances Matrix Methods Distance method steps
Original Sequence
Mutations - Substitutions
A
C
T
G Q: What do we measure by sequence alignment?
A
A
A: Substitutions in the aligned sequences.
C
G
A
T
A
The rate of substitution in regions that
A
C C > A Single Substitution evolve under no constraints are assumed
T T
G G
to be equal to the mutation rate.
Multiple A>C>T A
Substitution A A
coincidental Substitution
C>G C>A
G Parallel Substitution G
T>A T>A
Mutations - Substitutions Mutations
ACCTA
5 AGGCAA CTGGTCTTAT deletion accta Transversion - a change between purines
(A,G) to pyrimidines (T,C).
6 AGGCAAACCTACTAAAGCGGTCTTAT insertion aagcg
* Rooted trees should be plotted using the For PROTEINS the differences lie with
DRAWTREE program (phylip), or similar. the scoring (substitution) matrices used.
For more distant sequences you should
use BLOSUM with lower # (i.e., for
* On a PC use the TreeView program
distant proteins use blosum45 and for
similar proteins use blosum60).
Order of the input data (sequences) - The definition of "best tree" is ambiguous.
The order of the input sequences effects the tree It might mean the most likely tree, or a tree with
construction. You can "correct" this effect in some the fewest changes, or a tree best fit to a known
of the programs (like phylip), using the Jumble model, etc..
option. (J in phylip set to 10).