Name; 4 INA Structure Biology I: Unit 2 (A DNA Mastery Unit) - Worksheet 1, What do the letters DNA stand for? . ~ DNA i les = = — Molecule: 2. Two scientistsare given credit for discovering the structure TWO of DNA. What is the name of those two scientists. Views 3. DNA Isa polymer, which means that is made up of many wom repeating single units (monomers). What are the monomers called? . le dn es oa 4, The "backbone" of the DNA molecule is made up of two on ee components, what are these? c ridese Seger) a Phd phave 5, There are four different variations of these monomers (four different bases), what are the names of those bases? a, hele Me formes b, ve. « Cyfes we 3 Pyro non es da 6. These bases are of two different types of molecules: purines and pyrimides. Purines have two ring(s) in their structure, and pyrimidines have__ OVE ring(s) in thelr structure, ”. The two bases that are purines are: a Aeleame b, aU ME 8 The wo bases that are pyrimidines are: a ly fosmc9, Chargoff's rule states that the DNA of any species contains equal amounts of Adken ine and Tleyntdee and also equal amounts of Clean ¢ nd_Gvenme , 10, Based on this information, scientist could predict that the base _AcCews4-e pairs with ae andthedase Cytezree piri Grvans Me inthe formation of INA molecule. ‘This is called complementary base pairs. Thus one strand of DNA Is complementary to the other Taer ] ‘11, The bases are paired by es bonds along the axis of the molecule, E i hgleraea 1CEG at 12, Wilkins and Franklin studied the structure of DNA using X-fay cr; ‘chnique to examine ‘molecules, and helped Watson and Crick determined that the shape of the molectle was a cevble He [Me 13. Draw the basic structure of a aia with its three me Or aa ihe 14. Write the complementary sequence to following DNA strand: AATTCGCCGGTATTAGACGT Prrbrt tt tb bre bet tb bet tet TTA AARCAGCCATAATEC TG oe 15. Use the image at the right to complete the follow: Circle a nucleotide. Label the sugar and phosphate. Label the bases that are not already labeled phone — SugarDNA Structure and Replication Review Label each part of the DNA below. Write a short description of each. ry 4] é : =e. tea ° Deares Pengitrs| Nove ketol| Phosphate- of sugare ghrag hei ogee se Sug vis eae spl agl lckbrae Bead qf haves, ‘Nucleotide- Lousisps of sugar phagelat a. “ c/ase here Double Helix- ——As A Covalent Bonds- St ad ete “Eoin berhsean Foner sacl dope Jock 43 wel Nitrogenous Bases- , hatte. i te elie / : pyrimidine, PO (Core Hydroger Bonde A eer a Label each part Replication below. Write a short description of each. Chromoseme uc Leste V Fo bytes ac, New DNA ie fe g Helicase ~ “ices stalk vp seat eee pve" Replication Fork — } “where tee belease 5 = DDNA Model Discussion — Interview group members on the aspects of their model. Record their responses. Name- 1. What is holding it together? 2. What are they using for: © Nitrogenous bases. © Sugars — © Phosphates — © Hydrogen Bonds ~ 3. What does the key have on it? 4, How is it holding its helical shape? 5. How are the sugars and bases bonded? Name — 1. What is holding it together? 2. What are they using for: © Nitrogenous bases- © Sugars — © Phosphates © Hydrogen Bonds ~ 3. What does the key have on it? 4, How is it holding its helical shape? 5. How are the sugars and bases bonded? Name — 1. What is holding it together? 2. What are they using for: ‘0 Nitrogenous bases- © Sugars ~ © Phosphates — © Hydrogen Bonds 3. What does the key have on it? 4, How is it holding its helical shape? 5. How are the sugars and bases bonded?