See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/301791779

Geographical Distribution of the Cacao Swollen Shoot Virus Molecular Variability

in Ghana

Article  in  Plant Disease · May 2016

DOI: 10.1094/PDIS-01-16-0081-RE

CITATIONS READS
4 130

5 authors, including:

Francis Abrokwah Isaac K. A. Galyuon

University of Cape Coast University of Cape Coast
9 PUBLICATIONS   14 CITATIONS    38 PUBLICATIONS   242 CITATIONS   

SEE PROFILE SEE PROFILE

Ervín Muller
East slovak instituate of cardiovascular diseases
124 PUBLICATIONS   859 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

My PhD student's thesis View project

Microbial load of currency notes and coins View project

All content following this page was uploaded by Isaac K. A. Galyuon on 07 December 2017.

The user has requested enhancement of the downloaded file.

Geographical Distribution of Cacao swollen shoot virus Molecular Variability
in Ghana
Francis Abrokwah, Department of Molecular Biology and Biotechnology, School of Biological Sciences, University of Cape Coast, Ghana;
Henry Dzahini-Obiatey, Plant Pathology Division, Cocoa Research Institute of Ghana; Isaac Galyuon, Department of Molecular Biology and
Biotechnology, School of Biological Sciences; Francis Osae-Awuku, Plant Pathology Division, Cocoa Research Institute of Ghana; and
Emmanuelle Muller, CIRAD, UMR BGPI, 34398 Montpellier, France

Abstract
Abrokwah, F., Dzahini-Obiatey, H., Galyuon, I., Osae-Awuku, F., and Muller, E. 2016. Geographical distribution of cacao swollen shoot virus
molecular variability in Ghana. Plant Dis. 100:2011-2017.

Cacao (Theobroma cacao L.) was introduced into West Africa from growing regions in Ghana revealed the existence of nine CSSV groups, A,
South America during the nineteenth century. However, cacao swollen B, C, E, G, J, K, L and M, with six groups detected for the first time in Ghana.
shoot disease (CSSD) was first observed in Ghana in 1936 and, later, discov- The CSSV groups in Ghana are very divergent and correspond to at least five
ered in Nigeria, Côte d’Ivoire, Togo, and Sierra Leone. The objectives of this different putative species, according to the International Committee on Tax-
work were to assess the genetic diversity and spatial distribution of the Cacao onomy of Viruses recommendations (A, B-C complex, G, E, and M), with
swollen shoot virus (CSSV) in Ghana and investigate the origin and spread of the M species only being detected in the alternate host Ceiba pentandra.
the virus by identifying alternative host plants. Results obtained from poly- The spatial distribution of the different molecular groups in Togo, Côte
merase chain reaction amplifications and phylogenetic relationship analyses d’Ivoire, and Ghana makes it difficult to predict a single origin for CSSV
of infected cacao and alternative host plants collected from the cacao- among the West African cacao-growing countries.

Major cacao-growing countries in West Africa, Côte d’Ivoire, infected trees, then, replanted and maintained the farms for a time,
Ghana, Sierra Leone, Nigeria, and Togo have been plagued by viral before returning them to their owners. Another intervention was
diseases affecting the cacao plant for several decades. Chief among the Suhum rehabilitation project funded by the World Bank, in which
these viral diseases is cacao swollen shoot disease (CSSD) caused diseased farms were cut down and replanted in blocks with fast-growing
by the Cacao swollen shoot virus (CSSV). This virus has been iden- and early-yielding cultivars (Owusu 1983). Despite these interventions,
tified in West Africa only, whereas cacao originated from the CSSD is still prevalent in Ghana and is causing economic losses to
Amazon basin (Dzahini-Obiatey et al. 2006). CSSV is a member of cacao production in Ghana and the other West African cacao-growing
the virus family Caulimoviridae, genus Badnavirus and is naturally countries.
transmitted to cacao (Theobroma cacao) in a semipersistent manner Over the years, Ghana’s cocoa production has faced major adverse
by at least 14 species of mealybugs with Formicococcus njalensis, challenges, which have contributed to the country losing her position
Ferrisia virgata, and Planacoccus citri being the most studied (Dongo as the leading producer of cocoa beans in the world (Anim-Kwapong
and Orisajo 2007). CSSD was first observed in Ghana in 1936 at Effi- and Frimpong 2005). CSSD together with other viral and fungal dis-
duase in the New Juabeng District, when a plant pathologist made a eases has been a major factor in the decline of cacao production in
detailed description of a disease reported to him by a cacao farmer Ghana and the other countries. It severely reduces the yields of
(Steven 1936), although the disease was probably present in the an infected cacao tree and kills the tree within 5 years (Posnette
nearby Nankese township of Ghana from 1922 onwards (Paine 1947). Between these two extreme phases (reduced yield and tree
1945). The disease was later discovered in the other West African death), the leaves gradually turn yellow and fall, and then, the
cacao-producing countries, such as Nigeria (1944), Côte d’Ivoire branches dry out from their tips (die back). CSSV infection exhibits
(1946), Togo (1949), and Sierra Leone (1963) (Attafuah et al. myriad symptoms in the cacao plant; these include red vein banding
1963; Mangenot et al. 1946; Thresh 1959). in young leaves, different shades of chlorosis in mature leaves, swell-
Several control strategies have been put in place in Ghana to check ing on stems, chupons, and roots. A large number of isolates have been
the spread of CSSV, including a massive nationwide eradication distinguished by the symptoms they cause in cacao in the different
campaign that began in 1946 and aimed at cutting out diseased cacao countries concerned, and this number would probably be even larger
plants and any other cacao plant in contact with the diseased plants if finer differences in symptom expression were considered.
(Owusu 1983). Some of these strategies included the introduction Most studies on the virus have centered on the description of symp-
of block plantings in the 1950s, in which large areas of infected cacao toms in infected cacao plants and, also, on factors favoring the spread
trees were cleared and replanted in contiguous blocks (Owusu 1983). of the disease by vectors. Molecular studies on the virus started in
The “plant-as-you-cut” scheme was introduced in the 1970s (Thresh 1990, once it was discovered that CSSV possessed nonenveloped
et al. 1988); under this intervention, the government cut down CSSV- bacilliform particles and a double-stranded circular DNA genome
of about 7.5 kb (Lot et al. 1991). Further molecular analyses of
the CSSV genome revealed five putative open reading frames
Corresponding author: E. Muller; E-mail: [email protected] (ORF) located on the plus strand whose biochemical functions were
thoroughly investigated. ORF1 encodes a 16.7-kDa protein, whose
Necleotide sequence data is available under accession numbers KU308644 function is yet to be determined (Hagen et al. 1993). The ORF2 prod-
through KU308739. uct is a 14.4-kDa nucleic acid–binding protein (Jacquot et al. 1996).
ORF3, which is the largest, codes for a polyprotein of 211 kDa,
Accepted for publication 25 April 2016.
which contains from 5¢ to 3¢ consensus sequences characteristic of
a cell-to-cell movement protein, an RNA binding domain of the coat
http://dx.doi.org/10.1094/PDIS-01-16-0081-RE protein, an aspartyl proteinase, a reverse transcription (RT), and a
© 2016 The American Phytopathological Society ribonuclease H (RNase H). ORFX (13 kDa) and ORFY (14 kDa)
Plant Disease / October 2016 2011
overlap ORF3 and encode proteins of unknown functions. Molecular already identified in Ghana and the neighboring West African cacao-
work on CSSV isolates from various areas of West Africa has iden- growing countries (Togo and Côte d’Ivoire). We were able to detect
tified and categorized the different isolates in several distinct groups CSSV groups A, B, C, E, G, J, K, L, and M in the cacao-growing re-
(A, B, C, D, E, F) based on the sequence alignment of the first part of gions of Ghana and at the Cocoa Research Institute of Ghana (CRIG)
ORF3 (Kouakou et al. 2012; Oro et al. 2012). Oro et al. (2012) iden- research station in Tafo, with groups G, J, K, L and M being detected
tified the A, B, and C groups in Togo, and similar work by Kouakou for the first time.
et al. (2012) in Côte d’Ivoire identified the B, D, E, and F groups in
that country. Only groups A, B, and E have been detected in Ghana so Materials and Methods
far (Kouakou et al. 2012; Oro et al. 2012). Additionally, when using the Sample collection. In all, 846 samples were collected from 2013
International Committee on Taxonomy of Viruses recommendations, to 2014, of which 791 were symptomatic leaves from infected cacao
which consider nucleotide diversity in the RT/RNaseH region, four dif- trees. They were harvested and sun-dried between January and
ferent species (A, B-C complex, D, and E) sharing a less than 80% March 2013 and 2014, respectively, in the cacao-growing regions
nucleotide identity threshold could be described. of Ghana (Fig. 1). Young leaves showing red vein banding symp-
Ghana is the country where the disease was first described and toms were preferred; however, in their absence, older leaves showing
where it is currently the most widespread. It was important to study various leaf symptoms were collected. Asymptomatic leaves from
the variability and the distribution of CSSV isolates and species in- trees showing shoot and stem swellings were also collected. In all
volved in CSSD in Ghana as a means to identify the various groups about three to five leaves were collected from each tree. Around 20
present in the country, as has been done in Togo and Côte d’Ivoire. asymptomatic leaf samples were also collected from wild hosts (al-
Considering the vast economic losses in cacao revenues due to ternative host plants) located on or near plots or farms where in-
CSSD, it was additionally appropriate to study the molecular vari- fected cacao leaves were sampled. Ten samples collected in 2010 by
ability and phylogenetic relationship among the different CSSV H. Dzahini-Obiatey at the CRIG research station in Tafo, Ghana, were
groups in Ghana, as this would make it possible to screen cacao va- also included in this study.
rieties for resistance to CSSV with isolates representative of the di- Total DNA extraction. About 20 mg of dried cacao leaf portion
versity present in each area and also help to improve and validate from each sample was ground in microcentrifuge tubes in the pres-
diagnostic tools for CSSV detection. To achieve these goals and also ence of ceramic beads with an MP disrupter (Labtech). DNA was
try to determine whether Ghana could be the origin of CSSV, we car- extracted, using the DNeasy plant mini kit from Qiagen (Hilden, Ger-
ried out molecular characterization of CSSV isolates in the six main many) according to the manufacturer’s protocol. In each case, DNA
cacao-growing regions of Ghana where CSSD has been reported, was eluted in two elutions of 75 ml each, making a total of 150 ml, and
namely Ashanti, Brong-Ahafo, Central, Eastern, Volta, and Western. the concentration of each DNA was estimated using a Thermo Scientific
CSSV was amplified from DNA extracted from leaves of infected ca- spectrophotometer (Labtech), which uses NanoDrop 2000 technology.
cao and wild hosts, using polymerase chain reaction (PCR), and the PCR analysis. Primer pairs ORF3A-F (5¢GTYRTACCRRAYA
resulting amplified fragments were sequenced. Phylogenetic analyses YYATGATGAC3¢) and ORF3A-R (5¢GTYTYCCRTTRSYRGA
of sequenced fragments (5¢ end of ORF3 of the CSSV genome) were YTCYTCCCATAC3¢), together with Badna1 CSSV (5¢CTTTT
then carried out to compare the new sequences to those sequences ATGAATGGTTAGTGATGCCCTTTGG3¢) and Badna4 CSSV

Fig. 1. Map of southern Ghana showing regions and locations affected by cacao swollen shoot disease where leaf samples were collected for analysis.

2012 Plant Disease / Vol. 100 No. 10

(5¢TCCACTTACATACGGCCCCCCATCC3¢), were used. The primer and phylogenetic trees were visualized with the Darwin 5 program
pair (ORF3A-F/R) corresponds to a conserved region at the be- (Perrier et al. 2003).
ginning of the ORF3 domain of the CSSV genome. It amplifies
a 534- to 537-bp fragment corresponding to positions 1,848 to Results
2,381 of the complete DNA sequence of the CSSV isolate Agou1 CSSV detection in the six cacao-growing regions of Ghana
(L14546). This primer pair was obtained by aligning the set of and at the CRIG research station. Using the primer pair ORF3A-F/R
CSSV sequences available in 2009, including the CSSV detected on the 846 samples from 76 plots or farms, CSSV was amplified
in Côte d’Ivoire during the outbreaks of CSSD in the center of in 515 of the samples, which translated into a 60.9% rate of detec-
that country and which diverged from the characterized CSSV tion. Of 76 plots or farms, 65 recorded at least one or more CSSV
groups A, B, and C (Kouakou et al. 2012). The primer pair amplification; this translated into an 85.5% detection rate at plot
(Badna1/4 CSSV), corresponding to a conserved region in the level. A total of 332 leaf samples had no CSSV amplification; this
RT/RNaseH region (third part) of ORF3 of the CSSV genome, amounted to 39.2% of the total number of leaf samples collected
was used to amplify CSSV DNA from isolates representative of (Table 1). The Eastern region had the highest percentage of detec-
the different groups. PCR amplifications were performed in tion (85.3%), followed by Brong-Ahafo (64.6%), Central (58.9%),
25 ml of reaction mixture containing 10 ml of plant DNA ( 1/10 di- Western (46.2%), Ashanti (45.9%), and Volta (41.8%) (Table 1). In
lution of original DNA obtained from leaves), each dNTP at a fi- all, five CSSV amplifications were recorded out of the 20 leaf sam-
nal concentration of 0.2 mM, each primer at a final concentration ples collected from alternative host plants located in or near sam-
of 1 mM and 1 U of GoTaq DNA polymerase (Promega) in the re- pled farms; this resulted in a 25% detection rate in the wild host
action buffer supplied by the manufacturer. The two PCR reac- (Table 2).
tions were carried out in a Biometra T personal thermal cycler, Of the 10 cacao leaf samples collected from the CRIG research sta-
using an initial denaturation step at 94°C for 2 min, followed tion, only four tested positive with the primer pair ORF3A-F/R.
by 35 cycles at 94°C for 30 s, 49°C for 30 s, and 72°C for Phylogenetic analyses of CSSV isolates. In this study, 103 partial
1 min, and a final elongation step at 72°C for 10 min. When the ORF3 sequences were obtained; CSSV isolates that shared over 80%
result was negative, another PCR amplification was performed nucleotide sequence identity were grouped together. These gave rise
in a mixture containing another dilution of the plant DNA to sequences that aligned with groups A, B, C, and E, which were
(1 or 5 ml). already known (Fig. 2); other sequences formed clades that were
Sequencing and sequence analysis. Two isolates per farm de- different from the already-known groups and were, thus, designated
tected by the PCR diagnosis (primer pair ORF3AF/R) were chosen as new groups and, subsequently, named G, J, K, L, and M respec-
for sequencing. Direct sequencing of the amplified fragments was tively (Fig. 2). Most of the isolates or sequences obtained were con-
done by Beckman Coulter Genomics (U.K.). Seaview version 4.0 fined to the B and E groups (Fig. 2). Sequences belonging to the B
software was used to analyze the DNA sequences, and nucleotide se- group were very homogeneous, whereas sequences or isolates in
quences were aligned using the Clustal W multiple alignment algo- the E group were very heterogeneous.
rithm (Thompson et al. 1994). Phylogenetic relationships between Sequences in the B group shared over 95% identity with each
CSSV sequences were estimated with PhyML (maximum likelihood other, similar to isolates or sequences in the A and C groups. Groups
method) (Guindon and Gascuel 2003) with 500 bootstrap repeats, B and C shared more than 80% sequence identity and are considered

Table 1. Total number of cacao leaf samples collected from each region, percentage of detection, Cacao swollen shoot virus (CSSV) groups identified, and
number of leaves labeled as suspects
No. of positive samples/ Farms with positive No. of suspected CSSV groups identified
Region total no. of samples Detection (%) samples (%)a samplesb after sequencing
Ashanti 40/87 45.9 63.3 (7/11) 20 A and B
Brong-Ahafo 93/144 64.6 76.9 (10/13) 15 E and B
Central 82/139 58.9 100 (9/9) 15 B and L
Eastern 180/211 85.3 100 (14/14) − B
Volta 23/55 41.8 63.6 (7/11) 5 A, B, and C
Western 97/210 46.2 100 (18/18) − B, E, J, K, and A
Total 515/846 60.9 85.5 (65/76) 55 A, B, C, E, J, K, and L
a In parentheses: number of farms containing positive samples/total number of farms.
b Leaves collected from plants showing shoot and stem swellings (asymptomatic leaves) CSSV symptoms and from plants with indistinct leaf symptoms
(colorations).

Table 2. Sampling region, type, and number of alternative host plants analyzed
No. of No. of CSSV CSSV isolate
Location Type of wild hosts wild hosts positive samples groups identified
Western region Ceiba pentandra 5 2 C
Sterculia tragacantha 4 − −
Cola gigantea 1 − −
Eastern region Sterculia tragacantha 1 − −
Ceiba pentandra 1 1 M
Brong Ahafo region Ceiba pentandra 3 1 nda
CRIG (CSSV museum)b Cola chlamydantha 1 − −
Ceiba pentandra 1 − −
Adansonia digitata 1 − −
Sterculia tragacantha 1 1 nd
a nd indicates the sequence is not determined.
b CRIG = Cocoa Research Institute of Ghana; CSSV = Cacao swollen shoot virus.

Plant Disease / October 2016 2013

as a single group, B-C. Isolates in the E group shared varying degrees When isolates from groups A, B-C, E, G, and M were amplified
of sequence similarities within the group; however, all isolates in this using the primer pair Badna1/4 CSSV in the third part of ORF3, cor-
group shared a minimum of 80% identity in their nucleotide se- responding to the RNase H/RTase region, the sequences also shared
quences. Sequences from groups A, B-C, E, G, J, K, L, and M taken less than 80% sequence identity. However, after sequencing of the
in pairs shared less than 80% sequence identity. same region for isolates representative of groups E, J, K, and L, these

Fig. 2. Maximum likelihood phylogenetic tree of cacao swollen shoot disease (Cacao swollen shoot virus [CSSV]) sequences based on alignment of the 5¢ end of open reading
frame 3. Numbers on the branches represent percent bootstrap values (500 replicates) over 70. The names of the CSSV groups A, B, C, E, J, K, L, and M are indicated. Other
CSSV sequences representative of groups D, G, and B groups were used in comparison along with the Citrus mosaic virus sequence (CiYMV) (AF347695) used as the outgroup.
The names of sequences include the abbreviation of the country (CI for Côte d’Ivoire, G for Ghana, To for Togo), the abbreviation of the locality name or a sampling number, and the
year of sampling (1993 to 2014 coded as 93 to 14). The scale bar shows the number of substitutions per base.

2014 Plant Disease / Vol. 100 No. 10

groups were found to be very close to each other (less than 10% region). This group has also been detected in the Litimé region of
nucleotide divergence). Togo; however, it was also detected in samples from the CRIG mu-
Geographical distribution and structuring of CSSV isolates seum in 2000 (SS365B/Ghana 30 isolate) (Oro et al. 2012). This iso-
in Ghana. CSSV sequences obtained from this work belonged to late was collected in the Eastern region. The B group was detected in
nine molecular groups (A, B, C, E, G, J, K, L, and M) (Fig. 3). all six regions studied in this work and has also been detected in
The total number of CSSV molecular groups detected in Ghana neighboring countries where CSSV is prevalent, notably Togo
proved to be well above the number of CSSV groups detected in (Oro et al. 2012) and Côte d’Ivoire (Kouakou et al. 2012). The ubiq-
Togo (three) and Côte d’Ivoire (four). Group B was detected in all uitous nature of the B group may mean it is readily transmitted by
the regions sampled and seemed to be the most widespread in Ghana mealybugs, probably because of higher concentrations in the cacao
(Fig. 3), whereas isolates belonging to group A were only detected on phloem than the other groups (Posnette 1980). This group tends to
farms or plots located in the Western, Volta, and Ashanti regions of induce more easily the typical red vein banding symptom seen in
Ghana, the majority of which were amplified in samples from the young or flush leaves of infected cacao plants, since most of the sam-
Volta region. Isolates belonging to group C were detected in the ples collected in the Eastern region, whether young or mature, had the
Volta region only; it is the first time this group of isolates has been conspicuous red vein banding or vein clearing symptom.
detected in Ghana, but it had been detected in Togo. Another group, designated E, was detected in a very large propor-
Isolates belonging to group E were mostly from the Western and tion of the samples in this work; an isolate (Punekrom/Ghana 26)
Brong Ahafo regions of Ghana, with the majority from the Western belonging to this group was once detected in the CRIG museum
region (Fig. 3). These isolates exhibited varying subtle CSSD symp- by Kouakou et al. (2012). This group was predominantly detected
toms, mostly including swelling on shoots or stems, various forms of in the Western and Brong-Ahafo regions. The large-scale detection
leaf mosaic, and only sometimes, red vein banding in young flush of the E group in the Western region was expected in a way, but in
leaves. Group G was only detected at the CRIG research station. another way, it was surprising and interesting, as this region is now
In most cases, sequences from the same farm or plot always regarded as the region with the highest level of CSSV infection in
belonged to the same group, but there were some instances where iso- Ghana (Domfeh et al. 2010; Dzahini-Obiatey et al. 2010). Current
lates belonging to two different groups were identified on the same levels of the disease in parts of this region (the northern part) have
plot or farm (Table 3). For two farms in the Volta region, one was led to the designation of an area of about 29,000 hectares in Essam
infected by the A and C isolates, while the other farm was infected district as an area of mass infection (AMI) (CSSDCU 2007). Other
by both the A and B isolates. For the three farms in the Western re- parts of the same region, such as Sefwi Bekwai, Enchi, Juabeso, and
gion, one had isolates belonging to groups E and J. The second farm Sefwi Buako have also been reported to have high levels of CSSV
had CSSV isolates belonging to the A and B groups. The third farm in infection (Domfeh et al. 2010). The high incidence of the disease in
the Western region was infected by isolates belonging to the B and E the Western region is partly due to opposition from farmers against
groups. A single farm in the Ashanti region also had cacao trees the cutting down of infected cacao trees and also the lack of diag-
infected with isolates belonging to groups A and B. A single farm nostic leaf symptoms in infected cacao trees contrasting with in-
in the Eastern region had isolates belonging to the B and M groups fected cacao trees in the Eastern region and other parts of the
(Table 3). country. Samples belonging to the E group exhibited unrecogniz-
able symptoms until advanced stages of the disease, when stem
Discussion swellings and die-back were observed. The other regions in which
Detection and amplification rates. The detection rates (Table 1) CSSD is reported have cacao trees showing distinctive symptoms
were very similar to the results obtained by Kouakou et al. (2012) in a such as red vein banding and vein clearing, which is absent in some
study on the molecular variability of CSSV in Côte d’Ivoire using the parts of the Western region (Domfeh et al. 2011).
same primer pair (ORF3A-F/R). They recorded 63.5% as the overall Five other groups (G, J, K, L, and M) were also detected for the
rate of detection and 80% as the detection rate for farms or plots that first time in Ghana in this work. The J and K groups were detected
had one or more CSSV amplification. A total of 39.2% of our sam- in the Western region, whereas the L and M groups were detected
ples went undetected or had no CSSV amplification; this may be due in the Central and Eastern regions, respectively. The G group was re-
to the fact that some of our samples were old or matured leaves, as it stricted to the CRIG research station, Tafo in the Eastern region, and
was found in studies by Muller et al. (2001) that CSSV concentration the CRIG museum (unpublished results). Using the 80% nucleotide
decreases or becomes low and unavailable as leaves age or mature. It identity threshold in the RT/RNase H domain for discriminating bad-
has been proven experimentally that CSSV concentration varies navirus species, isolates from groups A, B-C, E, G, and M could be
within the same leaf showing symptoms of CSSD infection (Dzahini- considered as five different putative species, G and M being new.
Obiatey and Fox 2010). Misidentification of CSSD symptoms could Samples from the E, J, K, and L groups showed less than 10% nu-
also be a possible cause of failure to detect CSSV in leaves that were cleotide divergence in their RT/RNaseH region, when amplified with
not infected but might have been collected during sampling. These fac- the primer pair Badna1/4 CSSV, whereas the sequences identified for
tors might have accounted for our samples that went undetected. Also, these isolates in the first part of ORF3 showed more than 20% diver-
given the variability that was observed in populations of CSSV in coun- gence, which results in a distortion between the phylogenetic trees
tries like Togo (Oro et al. 2012) and Côte d’Ivoire (Kouakou et al. 2012), constructed from the two genomic parts. This distortion means that
it was likely that similar or greater variations were to be expected in recombination took place between the first and third part of ORF3
Ghana, hence, the primers used in this work may not have been polyva- among isolates from these groups and one or more other unknown
lent enough to amplify CSSV DNA from all the samples. isolates. Mixed infections by closely related viruses (as observed in
Geographical differentiation and biodiversity of CSSV in
Ghana. The C group was predominant in the Volta region of Ghana, Table 3. Farms with Cacao swollen shoot virus (CSSV) isolates belonging to
a region that shares a border with Togo (Fig. 1). This group was de- two different CSSV groups
tected on three plots or farms in the same location (Akpafu Adokor in
Farm
Hohoe district). The detection of this group was quite interesting, number Region Location Type of isolates
since it has only been detected until now in Togo in the Kloto region
(Oro et al. 2012) close to the Volta region, illustrating the fact that 1 Volta Akpafu Adorkor (Hohoe) A and C
this viral group has spread only locally. The A group was detected 11 Volta Dzindzinso (Jasikan) A and B
in three regions (Volta, Ashanti, and Western); this group has also 8 Ashanti Betriako (Tepa) A and B
been detected in Togo. In the Volta region, it was detected in two sep- 5 Western Aprompe (Sefwi and Buako) E and J
16 Western Kaase Tema (Bia and Essam) A and B
arate locations (Akpafu Adokor and Dzindziso). Dzindziso is a small
17 Western Asuoti (Enchi) B and E
village situated near the Ghana and Togo border and is noted for hav-
13 Eastern Akyem Tontro (Tafo) B and M
ing long stretches of cacao farms extending into Togo (the Litimé
Plant Disease / October 2016 2015
some instances) (Table 3) open up the possibility for recombination identified or detected in Côte d’Ivoire. This distribution may reflect dif-
and reassortment, which can lead to the emergence or origination of ferences in cacao crop-planting dates in the regions of these countries
new viral species (Elena et al. 2014). Another possibility is that These observations, again, make it difficult to predict a single origin
mixed infection by distinct viral isolates is being detected in individ- for CSSV in West Africa among the cacao-growing neighboring coun-
ual plants (Sagemann et al. 1985). There is now a need to obtain full tries and we can, therefore, make the assumption that the different puta-
sequences for these isolates to confirm recombination and try to iden- tive CSSV species emerged from different sources at different times.
tify their parental sequences. The possibility of recombinant sequences The roles played by alternative host plants (wild host) in all of this
further increases the variability of viral sequences responsible for caus- cannot be over-emphasized, since CSSV is not present in the Ama-
ing a disease, hence the difficulties in fighting the disease. zon basin, where the cacao tree originated. The exact role played
Possible origin of CSSD in Ghana. Given the fact that three of the by these wild hosts in the epidemiology of CSSV is, today, difficult
CSSV groups (A, B, and C) identified in Ghana are the only groups to investigate, because the prevalence of CSSD is greater in cacao
identified in Togo (Oro et al. 2012), it should be easy to say that trees than in these alternative host plants. Cacao-to-cacao transmis-
groups A, B, and C probably originated in or emerged from Ghana, sion of CSSV is easier and very likely when compared with cacao-
since CSSD was first detected in Ghana in 1936. However, until this to-alternate host plant transmission or vice versa. An additional
study, the CSSV C group had never been detected in Ghana (nor was difficulty is that studies on the role of alternative hosts would require
it detected in the collection at the CRIG museum); this makes it dif- the use of vectors, because CSSV is not easily transmitted mechanically.
ficult to conclude that CSSV (all groups) emerged from Ghana, since It is considered a phloem virus and its mealybug vectors are phloem
group C was detected earlier in Togo. Likewise for the spatial distri- feeders (Entwistle and Longworth 1963; Esau 1961). According to
bution of CSSV groups in Togo; the C group is shown to be restricted Posnette (1980), the less pathogenic strains seem to be in lower con-
to the Kloto area, which is located close to the border between Ghana centrations in cacao than the more virulent ones and, in most wild
and Togo (Oro et al. 2012). Hohoe district is not very far from the host plants, even the strains that are virulent in cacao attain only
border with Togo and there is, therefore, the possibility of farmers ex- low concentrations in the chronic phase and, probably, the virus is
changing planting materials in the form of seedlings or infected pods often localized in only certain parts of the plant. The occurrence of
between these regions. Mealybugs feeding on cacao trees close to the infected specimens of Cola chlamydantha at locations where CSSD
borders of these countries can also transmit the virus from one loca- is unknown strongly suggests that CSSV infection of C. chlamydan-
tion to the other. Since the A and B groups have already been de- tha antedates that of cacao (Todd 1951). This also supports the asser-
tected and documented in these two countries, it could be that they tion that CSSV was probably transmitted to cacao by the infected
emerged from one of the two countries and infected the other or they wild host plants and that new wild host plants (located near infected
emerged differently at different times in these two countries. On the cacao trees) became infected by the infected cacao trees, with these
other hand, when CSSV groups identified in Ghana are compared newly infected alternative host plants then acting as or remaining
with those found in Côte d’Ivoire, only groups B and E are common as sources of inoculum for fresh outbreaks on new cacao farms after
to both countries. In addition to these two groups, Côte d’Ivoire has the destruction of previously infected cacao farms.
other groups (D and F) that have not been detected in Ghana up to now The fact that CSSV was amplified from alternative host plants
and Ghana also has groups A, C, G, J, K, L, and M, which have not been (Table 2) in this work makes it more interesting, since all the amplified

Fig. 3. Regional map of southern Ghana showing the distribution of Cacao swollen shoot virus (CSSV) isolates detected. Group G was only detected at the Cocoa Research
Institute of Ghana research station, not in the fields. Pie charts in each region show proportions of the CSSV isolate groups present (described by a corresponding letter and
color as presented in lettered boxes).

2016 Plant Disease / Vol. 100 No. 10

 CSSV isolates from the wild host Ceiba pentandra always belonged Entwistle, P. F., and Longworth, J. F. 1963. The relationship between cacao viruses
to different groups than those amplified from the infected cacao trees and their vectors: The feeding behavior of three mealybug species (Homoptera:
Pseudoconvexe). Ann. Appl. Biol. 52:387-391.
of the same plot. For instance, on one farm in the Eastern region
Esau, K. 1961:Page 110 in: Plant viruses and insects. Harvard University Press,
(Akyem Tontro), the CSSV isolate M was amplified from an alterna- Cambridge, MA, U.S.A.
tive host plant, whereas CSSV isolates belonging to group B were Guindon, S., and Gascuel, O. 2003. A simple, fast, and accurate algorithm to
amplified from the infected cacao trees of the same farm and plot. estimate large phylogenies by maximum likelihood. Syst. Biol. 52:696-704.
There were two instances in the Western region (Kaase Yankwa) Hagen, L. S., Jacquemond, M., Lepingle, A., Lot, H., and Temper, M. 1993.
in which the detected CSSV isolates from alternative host plants Nucleotide sequence and genomic organization of cacao swollen shoot virus.
Virology 196:619-628.
belonged to group C, whereas the isolates detected from the infected
Jacquot, E., Hagen, L. S., Jacquemond, M., and Yot, P. 1996. The open reading
cacao belonged to group B. Even though it has been demonstrated frame 2 product of cacao swollen shoot badnavirus is a nucleic acid-binding
that CSSV can be transmitted to these wild hosts and vice versa protein. Virology 225:191-195.
(Tinsley and Wharton 1958), CSSV is now established in cacao trees Kouakou, K., Kébé, B. I., Kouassi, N., Aké, S., Cilas, C., and Muller, E. 2012.
to the extent that its spread from cacao to cacao is more common and Geographical distribution of cacao swollen shoot virus molecular variability
more possible than the other way round. However, CSSV viral spe- in Côte DʹIvoire. Plant Dis. 96:1445-1450.
Lot, H., Djiekpor, E., and Jacquuemond, M. 1991. Characterization of the genome
cies M has not yet emerged on cacao trees and could, potentially, cre-
of cacao swollen shoot virus. J. Gen. Virol. 72:1735-1739.
ate new outbreaks in this region. Such observations will support the Mangenot, G., Alibert, H., and Basset, A. 1946. Sur les caractères du swollen shoot
hypothesis of the origin of the disease in alternative hosts. en Côte d’Ivoire. Rev. Int. Bot. Appl. 283:13.
Muller, E., Jacquot, E., and Yot, P. 2001. Early detection of cacao swollen shoot
Acknowledgments virus using the polymerase chain reaction. J. Virol. Methods 93:15-22.
The authors are grateful to CIRAD, UMR BGPI, 34398 Montpellier, France and Oro, F., Mississo, E., Okassa, M., Guilhaumon, C., Fenouillet, C., Cilas, C., and
the Cocoa Research Institute of Ghana (CRIG), Tafo for providing their laboratory, Muller, E. 2012. Geographical differentiation of the molecular diversity of
staff, and funds for the research. We are also grateful to the University of Cape cacao swollen shoot virus in Togo. Arch. Virol. 157:509-514.
Coast, Ghana for granting the lead author study leave to enable him to carry out Owusu, G. K. 1983. The cocoa swollen shoot disease problem in Ghana. Pages
the research both in Ghana and France. 73-83 in: Plant Viral Epidemiology. R. T. Plumb, and J. M. Thresh, eds. Blackwell
Scientific, Oxford.
Literature Cited Paine, J. 1945. Report of agronomy division. West African Cacao Research
Institute CRIG, Tafo, Ghana.
Anim-Kwapong, G. J., and Frimpong, E. B. 2005. Vulnerability of agriculture to
Perrier, X., Flori, A., and Bonnot, F. 2003. Data analysis methods. Pages 43-76 in:
climate change—Impact of climate change on cocoa production. Cocoa
Genetic diversity of cultivated tropical plants. P. Hamon, M. Seguin, X.
Research Institute of Ghana, New-Tafo Akim, Ghana.
Perrier, and J. C. Glaszmann, eds. Enfield Science Publishers, Montpellier,
Attafuah, A., Blencowe, J., and Brunt, A. A. 1963. Swollen shoot disease of cacao
in Sierra Leone. Trop. Agric. Trinidad. 40:229-232. NH, U.S.A.
CSSDCU. 2007. Pages 1-3 in: Project Proposal for the control of mass outbreak of Posnette, A. F. 1947. Virus diseases of cacao in West Africa, cacao viruses 1A, 1B,
cacao swollen shoot virus disease at Essam District of Western region. Cacao 1C and 1D. Ann. Appl. Biol. 34:388-402.
Swollen Shoot Virus Disease Control Unit, Tafo, Ghana. Posnette, A. F. 1980. The role of wild host in cacao swollen shoot virus disease.
Domfeh, O., Dzahini-Obiatey, H., and Adjei, E. K. 2010. The cacao swollen shoot Pages 71-78 in: Pests Pathogens and Vegetation. J. M. Thresh, ed. Pitman,
virus disease situation in the Western region of Ghana. Pages 1195-1200 in: London.
Proceedings of the 16th International Cacao Research Conference, Cocoa Sagemann, W., Lesemann, D. E., Paul, H. L., Adomako, D., and Owusu, G. K.
Producer’s Alliance, Lagos, Nigeria. 1985. Detection and comparison of some Ghanaian isolates of cacao swollen
Domfeh, O., Dzahini-Obiatey, H., Ameyaw, G. A., Abaka-Ewusie, K., and Opoku, shoot virus (CSSV) by enzyme-linked immunosorbent assay (ELISA) and
G. 2011. Cacao swollen shoot virus disease situation in Ghana: A review of immunoelectron microscopy (IEM) using an antiserum to CSSV strain 1A.
current trends. Afr. J. Agric. Res. 6:5033-5039. Phytopath. Zeitsc. 114:79-89.
Dongo, N. L., and Orisajo, S. B. 2007. Status of cacao swollen shoot virus disease Steven, W. F. 1936. Swollen shoot and die-back—A new disease of cacao. Gold
in Nigeria. African J. Biotechnol. 6:2054-2061. Coast Farm 5:122-144.
Dzahini-Obiatey, H., Akumfi-Ameyaw, G., and Ollennu, L. A. 2006. Control of Thompson, J. D., Higgins, D. G., and Gibson, T. J. 1994. CLUSTAL W:
cacao swollen shoot virus disease by eradicating infected trees in Ghana: A Improving the sensitivity of progressive multiple sequence alignment through
survey of treated and replanted areas. Crop Prot. 25:647-652. sequence weighting, position-specific gap penalties and weight matrix choice.
Dzahini-Obiatey, H., Domfeh, O., and Amoah, F. M. 2010. Over seventy years of a Nucleic Acids Res. 22:4673-4680.
viral disease of cacao in Ghana: From researchers’ perspective. Afr. J. Agric. Thresh, J. M. 1959. The control of cacao swollen shoot diseases in Nigeria. Trop.
Res. 5:476-485. Agric. Trinidad 36:35-44.
Dzahini-Obiatey, H., and Fox, R. T. V. 2010. Early signs of infection in cacao Thresh, J. M., Owusu, G. K., and Ollennu, L. A. 1988. Cocoa swollen shoot: An
swollen shoot virus (CSSV) inoculated cacao seeds and the discovery of the archetypal crowd disease. Z.Pflanzenk. Pflanzen. 95:428-446.
cotyledons of the resultant plants as rich sources of CSSV. African J. Biotechnol. Tinsley, T. W., and Wharton, A. L. 1958. Studies on the host range of viruses from
9:593-603. Theobroma cacao L. Ann. Appl. Biol. 46:1-6.
Elena, S. F., Fraile, A., and Garcia-Arena, F. 2014. Evolution and emergence of Todd, J. M. 1951. An indigenous source of swollen shoot disease of cacao. Nat.
plant viruses. Adv. Virus Res. 88:161-91. Lond. 167:952-953.

Plant Disease / October 2016 2017

View publication stats