“Occurrence report of shrimp parasite

microsporidian Enterocytozoon
hepatopenaei (EHP) in India”
Submitted in partial fulfillment of the

Requirements for the degree of

Bachelor of Technology

In

Biotechnology

by

Ankit Yadav

(Reg. No. 12BBT0021)

DEPARTMENT OF BIOTECHNOLOGY

SCHOOL OF BIO SCIENCE AND TECHNOLOGY

May 2016

1
 DECLARATION

I hereby declare that the thesis entitled “Occurrence report of shrimp parasite

microsporidian Enterocytozoon hepatopenaei (EHP) in India” submitted by me, for the award of

the degree of B.Tech, in Biotechnology to VIT University, is a record of bonafide research work

carried out by me under the supervision of Prof Sudhakaran.R

I further declare that the work reported in this thesis has not been submitted and will not

be submitted, either in part or full, for the award of any other degree or diploma in this Institute or

of any other Institute or University.

Place: Signature of the Candidate

Date:

2
 CERTIFICATE

This is to certify that the dissertation entitled “Occurrence report of shrimp parasite

microsporidian Enterocytozoon hepatopenaei (EHP) in India” submitted by Ankit Yadav

(12BBT0021) to the VIT University, for the award of the degree of B.Tech, in Biotechnology, is

a record of bonafide work carried out by him under my supervision, as per the VIT code of

academics and research ethics.

The contents of this report have not been submitted and will not be submitted either in

part or in full, for the award of any degree or diploma in this institute or any other institute or

university. The thesis fulfills the requirements and regulations of the University and in my

opinion meets the necessary standards for submission.

Place:

Date: Signature of the Guide(s)

3
 Thesis Approval Form

This thesis, entitled

“Occurrence report of shrimp parasite

And authored by “Ankit Yadav” (12BBT0021), is hereby accepted and approved

External Examiner(s) Head of Department Dean SBST

4
ABSTRACT:

Enterocytozoon hepatopenaei (EHP) is a microsporidian intracellular parasite which is

found to infect the Penaeid shrimps. The infection at small scale doesn’t seem to affect

the growth of the shrimp but when the infection is present widely across the whole

hepatopancreas and muscle cells specially the tail tissue, it leads to retarded growth of the

shrimp. Initially the EHP infection was found in P. Mondonin Vietnam, Malaysia, China

and Brunaei but later the EHP proliferated all across the Asia including the south east

coast of India. In India P. vannamaeii.e the white leg shrimp is the most prominent one

which is grown on large scale for commercial purposes. Recent studies on the samples

from the south east coast of India has shown that P. vannamaeiis being highly infected by

the EHP.

Earlier, the effects of the EHP infection in shrimps were overlooked due to the presence

of other diseases like White Fecal syndrome (WFS) and Acute hepatopancreatic Necrosis

Disease (AHND) but now with the emergence of new techniques due to advancement in

technology, even minute infection of EHP can be detected by highly specific methods

like LAMP-AuNP assays which have a sensitivity upto 0.02 fg of DNA as compared to

the conventional Nested PCR with a sensitivity of 0.2 fg of DNA.

It is very difficult to detect EHP infection in the larval stage of the shrimp as the

infection is not dominant but with the growth of the shrimp, EHP infection proliferates

rapidly inside the Hepatopancreas of the Juvenile Shrimp. EHP plasma membrane

remains in contact with the cytoplasm of the host cell and helps in the taking of nutrients

5
and other essential products for its survival. Being a parasite it stunts the growth of the

shrimp leading to failure of economical feasibility for shrimp culture business.

Our project aims at detecting the EHP Infection in the penaeid shrimp by using the

Polymerase chain reaction (PCR) and nested PCR. After the detection the infection, to

compare the extent of the infection in various stages of the shrimp. To study the effects of

the infection on the growth of the shrimp and finally if time permits to find out the ways

to eradicate the infection by using physical and chemical methods.

We obtained fresh samples of Penaeid shrimp (without infection) from Chennai and

Nellore (Andhra Pradesh) and injected them with the EHP. We did this for both larval

and juvenile stage shrimps. After 4-5 days post injection, we confirmed the infection

using PCR by designing specific primers for the EHP genome specifically for 18s rRNA.

Initially the infection was not observed in the muscle cells but on repetition for 5-6 times

and analyzing the authenticity of the primers, we obtained positive results for both

hepatopancreas and the muscle cells. Than we continued with the histological studies to

study the structure of EHP. Our project needs to be continued as the screening and

eradication of EHP part is yet to be completed which we are planning to do during our

master studies.

6
ACKNOWLEDGEMENT

I would like to express my heartfelt gratitude towards VIT University and our Chancellor

Dr. G. Vishwanathan for providing the best in all facilities that helped us in this project.

We would also like to thank the SBST School for the support and guidance throughout

the project.

I take immense pleasure in thanking Prof. Sudhakaran R (Senior Assistant

Professor) and Karthikeyan (PhD.) SBST, VIT University who has guided me until the

completion of the project. I would also like to thank our dean Dr Ramalingam for

providing me with all the guidance and support. I convey my heartiest regards to our head

of the department

Dr Ramanathan K for providing us with all the facilities. Whether it was technical help

or concerned with providing facilities for using the laboratory implementing and

simulating the ideas of the project. Their willingness to motivate me contributed

tremendously to our project. I also would like to thank him for showing me his work in

this field which gave me an opportunity to learn something beyond our course. His

excessive support has been the motivation to perform our best regarding the project. I am

grateful for this aid and support.I would like to thank all our friends and family members

along with my project partner Kumari Preeti for all their without whose support this

thesis work would have not been possible.

7
CONTENTS

S.NO CONTENT PAGE NO

1. Abstract 5-6

2. Acknowledgement 7

3. Introduction 12-28

4. Review Of Literature 29-57

5. Materials And Methods 59-64

6. Results and Discussion 65-68

7. Conclusion 69

8. Reference 70-72

8
LIST OF FIGURES/EXHIBITS/CHARTS

- Global production of shrimps from 1950 to 2005.

- Comparison of captured, cultivated shrimp produced in Thailand from 1985 to

2005 shrimp major producers (2008 – 2015).

- EHP spores infect the tubules of the hepatopancreas in shrimp, which damages

the ability of the animals to gain nutrition from feed.

- Relative economic loss because of disease caused by various pathogen groups

(such as viruses, fungi, bacteria etc) in 2001 world shrimp industry survey, by

Global Aquaculture Alliance.

- Optimization of LAMP assay for EHP detection.

- Comparison between colloidal AuNP and DNA labelled AuNP probe. Blue line

indicates untreated AuNP probe. Red Line indicates AuNP probe.

- Optimization of the AuNP hybridization assay for the detection of Enterocytozoon

hepatopenaei (EHP).

- Confirmation of LAMP AuNP product which on digestion with the Restriction

enzyme called EaeI gives fragments of 197bp.

- Trasmission electron micrographs (TEM) of early stages of E. hepatopenaei

(EHP) development in hepatopancreatic tubule epithelial cells of P. monodon

- Adult Shrimps obtained from Chennai and Nellore (AP).

- Confirmation of cloned plasmid using restriction enzyme (ECoRI and BamH1).

- Black spots of EHP present in the eye of the adult shrimp.

9
LIST OF TABLES

- Top ten shrimp exporting countries.

- Primers used in AuNP assay.

- First and nested PCR results of post larval samples collected from various

hatcheries at east coast region.

10
SYMBOLS AND NOTATIONS

- EHP: Enterocytozoon hepatopenaei.

- IHHNV: Infectious hypodermal hematopoietic necrosis virus.

- YHV: Yellow head complex virus.

- WSSV: White spot syndrome virus.

- IMNV: Infectious mionecrosis virus.

- TSV: Taura syndrome virus.

- TEM: Transmission electron virus.

- WFS: White faecal syndrome.

- PCR: Polymerase Chain Reaction.

- Ng: Nanogram, fg: Ficogram.

- ISH: Insitu Hybridization.

- LAMP-AuNP: Loop mediated isothermal amplification with gold nanoparticles.

- DIG: Dioxygenin.

11
INTRODUCTION

Shrimps

Shrimp farming, an aquaculture business that exists either in a marine or freshwater

environment. About 75% of farmed shrimps are produced in Asia, especially in China

and Thailand. 25% is produced in Latin America, Brazil and Mexico is largest producers.

The largest exporting country is Thailand.

Shrimp is widespread, abundant and are found feeding near seafloor on most coasts and

estuaries, also in rivers and lakes. Some species flip off the seafloor and dive into the

sediment to escape predators. Life span is one to seven years.

There are thousands of species, two or three are major ones Litopenaeus vannamei

(Pacific white shrimp) and Penaeus monodon (giant tiger prawn).

They play a very important role in food chain and are an important food source for larger

animals such as from fish to whales. Muscular tail of many shrimps is edible to humans,

and are widely caught and farmed for human consumption.

Commercial shrimp species supports an industry with worth of 50 billion dollars in one

year and in 2010 total commercial production of shrimp was around 7 million tons.

Shrimp farming blasted off during the 1980s, especially in China; by 2007 the harvest

from shrimp industries exceeded the capture of wild shrimp.

12
There are significant issues with excessive by catch when shrimp are captured in the

wild, and with pollution damage done to estuaries when they are used to support shrimp

farming. Many shrimp species are small as the term shrimp suggests, about 2 cm

(0.79 in) long, but some shrimp exceed 25 cm (9.8 in). Larger shrimp are more likely to

be targeted commercially, and are often referred toas prawns, particularly in Britain.

Shrimp farming has changed from traditional, small-scale businesses in Southeast

Asia into a global industry. Technological advances have led to growing shrimp at ever

higher densities, and brood stock is shipped worldwide

Figure: Global production of shrimps from 1950 to 2005

13
Figure: Comparison of captured, cultivated shrimp produced in Thailand from 1985 to

2005

Virtually all farmed shrimp are of the family Penaeidae and just two species –

Litopenaeus vannamei (Pacific white shrimp) and Penaeus monodon (giant tiger prawn)

– account for roughly 80% of all farmed shrimp.

Shrimps are farmed all over the world and are imported and exported throughout the

world.

Canada India Bangladesh Vietnam Thailand Indonesia Denmark Iceland Honduras and

china are the major and largest producers and exporters of shrimps all over world. The

supply of shrimps has decreased all over world up to 1.6% in last one year. Countries like

14
Canada, Vietnam, Honduras and china has increased their production and they have

increased the export percentage in last one year up to 47% 48% 30% and 5%

respectively. Whereas India, Bangladesh, Thailand, Indonesia, Denmark and Iceland has

decreased their production and export throughout the world and their decreased export

percentage variation is up to 20% 17% 38% 6% 14% 27% respectively.

Whereas the export throughout the world especially in US has decreased in last one year

up to 1.6%.

Table 1:- top ten shrimp exporting countries

15
 Figure: shrimp major producers (2008 – 2015)

Classification

Shrimp are swimming crustaceans with long narrow muscular abdomen and

long antennae. Unlike crabs and lobsters, shrimp have well developed

pleopods (swimmerets) and slender walking legs; they are more adapted for swimming

than walking.

Comparison of shrimp with lobster and crab

Historically, it was the distinction between walking and swimming that formed the

primary taxonomic division into the former suborders natantia and reptantia. Members of

the Natantia (shrimp in the broader sense) were adapted for swimming while the

Reptantia (crabs, lobsters, etc.) were adapted for crawling or walking. Some other groups

16
also have common names that include the word "shrimp"; any small swimming

crustacean resembling a shrimp tends to be called one.

Shrimps are slender with long muscular abdomens. They look somewhat like lobsters, but

not like crabs. The abdomens of crabs are small and short, whereas the abdomens of

lobsters and shrimp are large and long. The lower abdomens of shrimp support pleopods

which are well adapted for swimming. The carapace of crabs is wide and flat, whereas

the carapace of lobsters and shrimp are more cylindrical. The antennae of crabs are short,

whereas the antennae of lobsters and shrimp are usually long, reaching more than twice

the body length in some shrimp species.

Fig. lobster (homarus americanus)

17
Figure: Shrimp

Figure: Crab

18
Anatomy of shrimp in detail

The abdomen section (1-3) is considered as tergum and the bottom half is considered as

pleuron. The pleopods are tucked under the abdomen of the shrimp. Tail section is also

included and tail section includes three parts two of them are called as uropods and one of

them is called as telson. Pleopods (used for swimming) and tail (used as wing to control

direction)

19
Shrimp has nineteen sections. The body of marine or freshwater shrimp is mainly divided

into two parts. The upper part considered as cephalothorax which includes head and the

thorax region or pereon region which is covered by protective plating system, carapace. it

consists of rostrum(nose), eyes, carapace, antennas and antenulles (used as sensory

feelers), pereopods (walking legs 5 sets), maxilipeds (used to rip food), and

mandibles(jaws, where food is crushed and devoured)

Diseases in shrimp

Twenty different types of viruses are well known to infect penaeid shrimp. These are

most important pathogens faced during shrimp farming by industries. Other pathogens

are also very important in shrimp farming such as various infectious bacteria.

20
Shrimp aquaculture has very much contributed into a large income generation among

coastal communities; disease outbreaks led to a great economic losses to the farmers and

country in recent years. These diseases had serious impact on farmers, specifically small-

scale farmers whose main income is only derived from shrimp farming. At least 60% of

our small-scale farmers are thought to become indebted to banks due to loss in production

as a result of diseases caused to shrimps.

(Pornlerd Chanratchakool et al., 2002)

Fungal diseases in cultured shrimps

Almost 500 fungal species are isolated from marine environment out of which very few

are pathogenic to shrimps. Mostly shrimps are affected at larval stage by lagenidium

callinectes and serolpidium spp. fungal spores and mycelia are observed in affected

tissues particularly in gill and appendages.

Fusariosis and black gill disease is caused by Fusarium spp. It may affect all the

developmental stages of penaeid shrimps. These are opportunistic pathogens that lead to

90% mortalities. Disease is caused in ponds where there is poor quality of water

management. Fungal hyphae is detected in affected animal tissue using light microscopy

Fusariumsolani, Fusarium moniliforme and possibly other Fusarium spp. The

phycomycetous fungi Atkinsiella dubia are rare pathogens of penaeids but they have been

associated with gill and cuticular lesions somewhat similar to those caused by Fusarium.

(Karunasagar et al., 2004)

21
Viral diseases in cultured shrimps

Shrimp aquaculture has been dramatically affected by many pathogenic diseases, mainly

caused by five viruses:

IHHNV- The first widespread viral epizootic to seriously affect the commercial penaeid

shrimp industry was IHHNV, viral occurrences are mainly in the cell nuclei from

subcuticular epithelium of the mouth appendage, gill, thoracic ganglion, and nerve fiber

of the walking leg, but can also occur sparsely in the cytoplasm

YHV-one of six known genotypes in the yellow head complex of viruses was the cause

of the second most serious viral epizootic of Penaeid shrimp YHV infection is

characterized by necrosis containing vacuolated cells with hypertrophied nuclei and

basophilic viral inclusions in the cytoplasm of infected cells.

WSSV-a new virus appeared in shrimp farms in northern Taiwan causing massive

mortality. Nowadays, WSSV, a rapidly replicating and extremely virulent pathogen, is

the most serious disease-causing agent in shrimp aquaculture worldwide

IMNV- is the most recently emergent virus that infects Pacific white shrimp typical

clinical signs presented in IMNV-infected shrimp are focal to extensive opaque and

whitish necrotic areas in the skeletal muscles, primarily in distal abdominal segments and

tail fan

TSV-, one of the most important pathogens affecting farm-reared shrimp TSV-infected

shrimps are characterized by lethargy, anorexia, opaque musculature, and reddish

discoloration in the tail

22
fan and pleopods. Histopathological evaluation reveals five main anatomic regions

infected by TSV, including cuticle, gills, appendages, foregut, and hindgut; however,

some individuals can present signs in abdominal muscle tissue.

These are some of the viral diseases which occur in penaeid shpimps. To date, more than

twenty viral diseases have been reported to affect shrimp and prawns, and five viral

pathogens of penaeid shrimp are currently listed by the World Organization for Animal

Health

infectious hypodermal and hematopoietic necrosis virus (IHHNV), yellow head virus

(YHV), Taura syndrome virus (TSV), white spot syndrome virus (WSSV), and infectious

mionecrosis virus (IMNV).

(Chantanachookin et al., 1993) and (Lightner et at., 1983)

Bacterial diseases in penaeid shrimps

Vibriosis

Known in Latin America as the Sea Gull Syndrome due to shrimp swimming at surface

of pond, numerous etiological agents: V. harveyi, V. vulnificus, V. parahaemolyticus, V.

alginolyticus. Wide variety of gram negative motile rods. Most frequently found in

hatcheries, but a big problem for young Post larval in ponds, all shrimp reared under

stressful conditions are susceptible

23
Clinical Signs: high mortalities, in post larval, young juveniles; moribund shrimp appear

hypoxic and often come to the pond surface or edge; sea birds preying on shrimp;

presence of luminescence in tanks.

Necrotizing hepatopancreatitis

Also known as NHP or Texas Pond Mortality Syndrome, for obvious reasons this is a

disease of the midgut gland, not, as with a Vibriosis, the blood Agent: believed to be a

new genus of the Protobacteria (alpha) groupfound from Peru to Texas exists in two

morphological forms (rod-shaped rickettsial-like and flagellated helix Diagnosis-presence

of massive numbers of G- bacteria in HP tubule epithelial cells, atrophy of HP, pallid HP

color; DIG-labeled DNA probe using in situ or dot blot hybridization, TEM of HP cells

showing granulatomous lesions.

Clinical signs: reduced feed intake, empty gut, anorexia, poor l: W ratios, pallid HP

Microsporodians (EHP)

Microsporodians parasites are severely affecting the aquaculture in Asia. Most common

pathology associated with microsporodians is whitish discoloration in muscles due to

spores that can stunt the growth and other types of problems. Enterocytozoon

hepatopenaei is an emerging microsporodian parasite that has been linked to recent losses

caused by white faecal syndrome (WFS) in cultivated giant or black tiger shrimp Penaeus

(Penaeus) monodon and whiteleg Shrimp Penaeus (Litopenaeus) vannamei in Asia

24
Enterocytozoan hepatopenai, a microsporodians parasite (different from other

microsporodians) that leads to the retarded growth of shrimps. Enterocytozoan

hepatopenai are mostly found in Asian countries and in other parts of the world such as

china, Malaysia, Thailand, Indonesia and Vietnam and likely present in India and

possibly in Mexico.

(Tourtip et al., 2009)

EHP only infects the tubules of the hepatopancreas in shrimp and damages the ability of

tubules to gain nutrients from feed. EHP does not lead to mortality of shrimps but it

affects the growth of shrimps severely.

EHP is very difficult to eradicate but the levels of EHP can be controlled. EHP in shrimps

can be detected by doing PCR technique (polymerase chain reaction) at post larval stage

of shrimps. Light microscopy can also be done to detect the infection of EHP.

In our project we are going to collect the samples from Nellore and Chennai and will

grow them in aquarium in our laboratory and we will infect those shrimps with EHP and

at post larval stage we are going to check/detect the infection in shrimps by PCR

(polymerase chain reaction) technique.

Enterocytozoon hepatopenaei is an obligate, intracellular microsporidian parasite in the

family Enterocytozoonidae with ovoid spores of approximately 0_7 9 1_1 lm that show

5–6 internal coils of the polar filament by transmission

(Tangprasittipap et al. 2013)

25
Fig. EHP spores infect the tubules of the hepatopancreas in shrimp, which damages the

ability of the animals to gain nutrition from feed.

How does EHP impact shrimp?

EHP is a spore forming parasite. When a spore finds a suitable host in a shrimp, it

hatches and the parasite begins to usurp some of physical growth of the shrimp. In

general, it reduces the growth rate and increases the size variation in the population.

For example, in Asia a good target is for stocking at a density of 80 shrimp per square

meter. These shrimp normally grow 2 grams per week or more, so that after 100 days

sizes will be in the 16-20 headless category, with some larger and some smaller.

For EHP infected ponds, the harvest might result in five size categories with many

smaller shrimp.

26
One Thai expert told us: “EHP first affected Thailand in 2011, before EMS, and you saw

approximately a 10 percent decline in production from this infection. That I think is fair

to say that this infection will cause a decline of from 10-15 percent when compared to a

time before the disease”. However, there are some mitigating factors.

First and most important is density. The lower the density, the less impact from the

spores. In India, for example, farms that stock at 20/m2 densities have better growth and

larger shrimp than ponds that stock at 50/m2 densities.

Second factor is salinity. Low salinity favors less impact and better growth; high salinity

appears to correlate with poor growth and greater impact.

The severity of EHP impact is directly related to the number of spores in the

hepatopancreas of the shrimp. The higher the number of spores, the greater impact in

stunted growth. The spore count generally increases with the time the shrimp are in the

ponds, so that after 40 days there is a higher parasite load than initially.

If brood stock is infected, the growth in the number of parasites is accelerated.

Due to these various types of diseases the farmers are suffering from major losses all over

the world as shown below:

(Timothy w. Flegel et at., 2005)

27
Figure Relative economic loss because of disease caused by various pathogen groups

(such as viruses, fungi, bacteria etc) in 2001 world shrimp industry survey, by Global

Aquaculture Alliance.

Background of project

We collected the samples from different places such as Chennai (BMR fisheries) and

Nellore. We fed our fishes on time so that they get proper nutrition and achieve their full

growth. We infected our shrimps with EHP (Enterocytozoon hepatopenaei) parasites to

study their effect on the growth of shrimps. EHP’s retard the growth of shrimp. After few

days of infection we detect the presence of EHP in shrimps by extracting DNA from

different organs of shrimp such as muscle tissue, hepatopancreas by DNA extraction

method. Primers are designed for the Enterocytozoon hepatopenaei. If the presence of

EHP is detected and primers are designed then we go for PCR technique (polymerase

chain reaction) and amplify the DNA fragment of EHP found in different organs of

shrimp. Gel electrophoresis was done to identify the presence of EHP in different parts of

shrimp.

28
REVIEW OF LITERATURE

WORLDWIDE SCENARIO

Penaeid shrimp is mostly cultured in the Asian countries including Vietnam, Thailand,

Malaysia, Indonesia, china and southern parts of India. The growth of the shrimp is

largely been affected by a microsporidian parasite called Enterocytozoon hepatopenaei

(EHP). This parasite is mostly found to infect the shrimps in the hepatopancreas and

muscle cells leading to retarded growth of the shrimp. Histological features from the

infected shrimps collected from Vietnam and Brunaei shows the presence of basophilic

inclusion bodies present in the hepatopancreas and muscle cells. The basophilic

inclusions are largely found in the hepatopancreas tubule epithelial cells. The

microsporidian parasite EHP was found out to be present in various developmental stages

in the hepatopancreas ranging from plasmodia to mature spores.

PCR targeting of 18sRNA of the EHP showed 100 percent identification with the

infected samples collected from Vietnam and Brunaei.

(Kathy F.J Tang et al 2015)

INDIAN SCENARIO

Due to large outbreak of EHP infection in Penaeid Shrimps across Asian countries,

samples were collected from the south east coast of India and they were analysed using

electron microscopy, Polymerase Chain Reaction (PCR), histopathology and in-situ

hybridization. Squash preparation of hepatopancreas and white faecal strings of

29
Penaeusvanname showed the presence of microsporidian spores. Out of 137 Juvenile

Penaeusvannamei, 10 were found out to be positive and 77 were found out to be positive

using nested PCR. It was also observed that the parasite causes rapid degeneration of

epithelial tubules of hepatopancreas and enlargement of haemal sinuses resulting in

retardation of growth. The emergence of EHP as one of the deadliest parasites in

Penaeusvannamei was confirmed by using nested PCR and insitu hybridization in India.

(K.V Rajendran et al 2016)

PCR AMPLIFICATION

EHP specific primers were used to analyse the samples obtained from the south east coast

of India for the presence of EHP in infected Penaeus vannamei and the 951bp sequence

obtained showed 100% similarity with the EHP infected Penaeid shrimps from Vietnam,

Malaysia, Thailand and china. The 18sRNA sequence was the target for the EHP

infection.

100% similarity confirmed that EHP infection in shrimps is not a local scenario but a

global one which is contributing a lot in the economical deficiency in the shrimp culture

business.

(K.V Rajendran et al 2016)

Primers for EHP-510F/R from the 18S rRNA gene of the EHP genome were selected

and PCR was performed with DNA extracted from EHP-infected shrimp. The results

clearly depicted that this PCR can easily detect EHP-infected P. vannamei ( obtained

from Vietnam in 2014 and 2015, Fig. 2, lanes 1 & 2; from Thailand in 2014, lane 3) and

30
the feces and water samples which were collected from infected shrimp tanks were also

found out to be infected with EHP microsporidian (Fig. 2 lanes 4 & 5). There was no

cross reaction of these EHP primers with the Pleistophora-like microsporidium which are

associated with cotton shrimp disease(CSD) (Fig. 2, lane 6) and also not to the infected

shrimp gill disease caused by an amoeba (Fig. 2, lane 7). There was no reaction between

the 18S rRNA gene primers and the genomic DNA of P. vannamei (Fig. 2, lane 8), P.

monodon, P. indicus, P. stylirostri and M. rosenbergii (data not shown). Polychaetes,

squids and Artemia biomass are usually added to the shrimp diets during the broodstock

maturation and these organisms are also the suspects for being carriers of EHP and were

frequently tested for the presence of EHP microporadian. There was no reaction between

the EHP-primers and the genomic DNA of polychaetes, squidsand Artemia biomass

which was confirmed by using PCR. Crabs from the same ponds where shrimps were

cultured were also tested for any cross reaction between the EHP specific primers and the

Crabs genomes and the results were found out to be negative showing the highly specific

character of EHP primers.4 out of 9 samples of frozen Artemia Biomass which is the

chief constituent of shrimps diet was detected with EHP (Fig. 2, lane 9, a representative

sample). The EHP infected Artemia was also used to obtain 18S rRNA gene fragment

which was further amplified and sequenced. This sequence of 1.1kb showed 99.9%

similarity (different in just 2nucleotides) to the of EHP from Vietnam, suggesting the

EHP present in Artemia biomass may have its origin in SE Asia. All the 4 EHP-positive

Artemia biomass samples came from one individual provider, and it is possible that they

were all harvested from the same location. Concerns of EHP infections in farmed shrimp

populations are likely to continue, creating a need to reduce risk through the

31
establishment of effective means to control and monitor this parasite. In this regard, the

use of specific and sensitive molecular methods for the detection of EHP in shrimp, live

feeds, and the pond environments will likely prove to be very important. EHP-infected

shrimp cannot be determined by simple visual inspection; there are no obvious clinical

signs of infection. This inability to detect EHP-infected individuals can result in the rapid

spread of this parasite throughout the shrimp stocks. Diagnostic protocols, based on ISH

and PCR, developed in the present study have proven to be both specific and sensitive,

thus providing valuable tools for routine diagnosis and monitoring of shrimp stocks, pond

environments and aquaculture commodities.

Figure 2

(K.F.J Tang et al 2015)

32
INSITU HYBRIDIZATION

Insitu hybridization done with EHP specific DIG labelled probes showed the presence of

EHP in various developmental stages in the infected hepatopancreas tissues. When a

comparison was done between normal growing and slow growing shrimps, it was found

out that the slow growing shrimps have low prevalence (58.5 %) than the fast growing

shrimps (96.4 %).

It was also found out that the slow growing shrimps are also infected by EHP but not at

large scale. The samples collected with White faeces Syndrome (WFS) showed high

amount of EHP infection as compared to the normal ones. WFS plays a crucial role and

helps in the proliferation of EHP in the hepatopancreas tissues of the Penaeid Shrimp.

(K.V Rajendran et al 2016)

The three major families of Penaeid shrimp including P. vannamei, P. stylirostrisand P.

monodon, were found out to be infected with EHP both by insitu hybridization and nested

PCR (Tourtip et al., 2009). ISH was found out to be more sensitive for detecting the

causative agents as cells infected with EHP doesn’t showed any visible signs of infection

or the presence of microsporidian while ISH confirmed the presence of EHP in all the

three samples. For ISH cloned 18S rRNA gene fragment labeled with digoxigenin was

taken and it was used as a probe for ISH for the infected P. vannamei samples. Intensive

reaction between the probe and the basophilic

33
Inclusion within cytoplasm took place (Fig. 1B). P. stylirostris samples which were

collected from Brunei in 2006 also depicted the presence of microsporidium spores inside

the hepatopancreas tissue (Fig. 1C), where the positive reaction took place with the

tubule epithelial cells by ISH (Fig. 1D). In both cases, the hepatopancreas was found out

to be the only tissue that reacted to the EHP probe during the ISH, and the Insitu

hybridization results were deteceted by H&E histology and were found out to be

associated with lesions. These results are similar to those described by (Tangprasittipap et

al. 2013) with samples of EHP-infected P. vannamei. The diagnosis of EHP across the

samples obtained from Brunei showed the presence of EHP in the shrimps at least since

2006 in Asia. The probe used was highly specific. No other reaction was observed in any

of the tissues which were prepared from the SPF shrimp. Another test was done to check

the presence of EHP in P. monodon affected with cotton shrimp disease using the EHP

probe and it was found out that the tail muscle cells were severly infected with the

Pleistophora microporidian and the spores appeared to be more eosinophilic (Fig.

1E).The EHP specific probe didn’t reacted with the P.monodon samples (Fig. 1F). The

shrimp infected with cotton shrimp disease was used to clone a 1.1 kb fragment of

18srRNA gene and this fragment was labelled with diagoxigenin for ISH. This probe

reacted to the cotton shrimp disease P.monodon (shown in Fig. 1F). The sequence of this

18S rRNA gene fragment had a 94% similarity with a member of genus Pleistophora,

which appears distant from Enterocytozoon spp. based on the SSU rRNA gene-phylogeny

(Stentiford et al., 2013). This also explains why the EHP probe did not cross react to the

microsporidium of cotton shrimp disease.

34
 FIGURE 1

(K.F.J tang et al 2015)

35
NESTED PCR

Nested PCR was also performed with the samples collected from the south east coast of

India and out of 137 juvenile samples 77 showed positive results and confirmed the

presence of EHP infection in the hepatopancreas tissue.

(K.V Rajendran et al 2016)

LOOP MEDIATED ISOTHERMAL AMPLIFICATION FOR

DETECTION OF EHP

In order to detect the SSU rRNA gene of EHP, a set of six specific primers were

designed. The detection of EHP was done by LAMP reaction at 65°C for 45 minutes and

the visual detection of the product was done using hybridization with ssDNA labelled

nanogold probe at 65°C for 5 minutes followed by salt induced AuNP aggregation. Total

assay time tends to be 50 minutes approx. The results obtained by this method were

similar to LAMP followed by electrophoresis or using spectrophotometry for detection

but this method was more sensitive as compared to conventional nested PCR. The

LAMP-AuNP provided specific results for EHP and showed negative results when used

for samples infected with other pathogens. The new LAMP-AuNP assay is not only time

effective and easy to perform but it also doesn’t compromise with the selectivity and

specificity in the detection of EHP infection. This new LAMP method also uses simple

experimental tools that are easily available at the small field laboratories.

(R.Suebsing et al 2013)

36
LAMP-AuNP ASSAY

In accordance with the sequence published at genbank for the SSU rRNA from P.

monodon with accession id FJ496356, LAMP primers for EHP were designed with the

help of Primer Explorer version 4 software (Eiken Chemical, Tokyo, Japan). Primers

details are provided in the table 1. Optimization for both temperature and time was also

carried out at 60, 63 or 65°C for 10, 20, 30, 45 or 60 min. The influences of Mg2+,

betaine and dNTPs were also tested. LAMP reactions were performed in 25 µl of total

reaction mixture containing 2 µmol per litre each of FIP and BIP, 0.2 µmol per litre each

of F3 and B3, 2 µmol per litre of LF and LB primers, 1×thermopol-supplied reaction

buffer, with 0.2–1.0 mol per litre betaine (USB Corporation, Cleveland, OH, USA), 2–10

mmol per litre MgSO4 (Sigma-Aldrich, St. Louis, MO, USA), 1–2.0 mmol per

litredNTPs mix (Promega, Madison, WI, USA), 8 U of Bst DNA polymerase (large

fragment; New England Biolabs, Ipswich, MA, USA) and 2 µl of 100 ng DNA template.

A reaction mixture without template was included as a negative control. LAMP products

were analysed by 2% agarose gel electrophoresis.

(R.Suebsing et al 2013)

TABLE 2

37
PREPARATION OF GOLD NANOPARTICLES (AuNP)

Initially before AuNP preparation, all glassware need to be treated with aqua regia

(Sigma-Aldrich), as AuNP is very sticky in nature and easily gets attached to the surface

of the vials leading to the decrease of the effective concentration. By the modification of

Liu and Lu (2006) method an AuNP colloid is prepared which comprises of 13nm

diameter particles. Briefly, 1 mmol per litre hydrogen tretrachloroaurate trihydrate

(Sigma-Aldrich) was stir mixed in 250 ml distilled water and boiled vigorously and then

rapid addition of 38.8 mmol per litresodium citrate tribasic dihydrate (Sigma-Aldrich) is

done. Than the solution was left to cool down to room temperature during that time the

solution turned from yellow to clear, to black, to purple and then to ruby red (in

approximately 15 min). UV–visible spectral analysis was used to measure the optical

spectrum of the colloid gold (lambda max ~ 525 nm) (Thermo Fisher Scientific, Madison,

WI, USA) and it is than stored at 4°C.

Figure 2

(R.Suebsing et al 2013)

38
The above figure depicts the schematic representation of the colorimetric assay. As the

initial step includes the addition of the AuNP hybridization probe to specifically detect

loop-mediated isothermal amplification (LAMP) amplicons. The method is unique and it

consists of visual comparison of the test solutions in this case three test solutions before

and after the addition of salts to the hybridization solution. The Blank consists of AuNP

probe alone , Positive control contain the sample in the presence of LAMP amplicon

containing a sequence complementary to the AuNP probe DNA, the negative control

consists of sample in the presence of non-complementary DNA targets. When the salt is

added both blank and negative samples turn color from red to blue which is the result of

unprotected AuNP probe aggregation, whereas positive samples remain red due to AuNP

protection against aggregation resulting from specific LAMP amplicon hybridization with

complementary DNA attached to the AuNP.

LAMP CONDITIONS

FIGURE 3: Optimization of LAMP assay for EHP detection.

LAMP amplification was conducted at 60–65°C using 100 pg of total DNA present after

the extraction. LAMP amplicons were visualized as multiple bands of different sizes on

2% agarose gels only at 65°C (Fig. 3a). For LAMP reactions which were performed at

39
65°C for 10–60 min, LAMP amplicons were visualized initially after 20 min and then

more clearly view was obtained at 45 and 60 min respectively (Fig. 3b). Hence reaction

time of around 45 min was selected as the optimal time for the LAMP conditions in the

study. Intensity of the LAMP amplicons was found out to be dependent on the

concentration of MgSO4, betaine and dNTPs. The influence of various concentrations of

MgSO4 in the LAMP reactions with 100 pg of DNA template was prominent. When the

concentration of MgSO4 was increased from 2 to 10 mmol per litre, the intensity of the

LAMP amplicons also increased from 4 to 8 mmol per litre but at 10 mmol per litre of

MgSO4 concentration, inhibition was also observed (Fig. 4a). The optimal MgSO4

concentration was found out to be 4 mmol per litre. In the presence of the optimal

MgSO4 concentration, LAMP reactions seem unaffected by different concentrations of

either betaine (0.2– 1.0 mol per litre) or dNTPs (1–2 mmol per litre) (Fig. 3b,c). Hence

the optimal concentrations obtained for betaine and dNTPs were found out to be 0.2 mol

per litre and 1.0 mmol per litre respectively.

The figure depicts the effects of MgSO4, betaine and dNTPs concentrations on loop-

40
mediated isothermal amplification reactions (LAMP) using 100 pg total DNA extracted

from shrimp infected with Enterocytozoon hepatopenaei (EHP).

(a) Figure (a) depicts the effect of various concentrations of MgSO4

(b) lane M: 2-log DNA marker

(c) lanes 1–5: MgSO4 concentrations of 2, 4, 6, 8 and 10 mmol per litre respectively

(d) N: negative control.

(e) Figure (b) depicts the effects of betaine at various concentrations

(f) lane M: 2-log DNA marker

(g) lanes 1–5: betaine concentrations of 0.2, 0.4, 0.6, 0.8 and 1.0 molper litre

respectively

(h) N: negative control.

(i) Figure(c) depicts the effects of dNTPs at various concentrations

(j) lane M: 100-bp DNA marker

(k) lanes 1–6: dNTPs mix at 1, 12, 14, 16, 18 and 20 mmol per litre respectively

(l) N: negative control.

(R.Suebsing et al 2013)

41
AuNP SYNTHESIS AND AuNP PROBE HYBRIDIZATION FOR

DETECTION OF LAMP AMPLICON

AuNP which were synthesized successfully gave one peak at the wavelength of 595nm in

UV- Visible spectrum successfully (Fig. 5).

On the other hand ssDNA labelled AuNP gave one peak at the wavelength of 530 nm

(Fig. 5). This shift in the wavelength indicates that the preparation of AuNP contained

some monodispersed AuNPs too.

The effect of AuNP probe concentration on hybridization with LAMP amplicons was

studied cat 2 and 5 nmol per litre AuNP with various ratios of LAMP amplicons.

With 2 nmol per litre AuNP probe at ratio of 9:1–1:9µl with amplicons followed by salt

addition (final concentration, 30 mmol per litreMgSO4), the ratios between 9:1 and 7:3µl

showed significant colour changes between the original red (positive result) and purple

(negative result), while ratios between 6:4 and 1:9 µl gave false negative results (Fig. 6a;

Lane 2).

With the 5 nmol per litre AuNP probe, the best colour intensity was seen at ratios

between 9 : 1 and 6 : 4 µl, while ratios between 5 : 5 and 1 : 9 µl gave false negative

results (Fig. 6b; Lane 2). Therefore, 5 nmol per litre AuNP probe and a ratio 6:4 µl were

chosen as the optimal hybridization conditions in this study.

The effect of salt concentration on aggregation was tested by addition of MgSO4 at

various concentrations (5, 10, 20, 30, 40, 50 and 100 mmol per litre final concentration).

Colour changes were compared between LAMP amplicons from EHP target DNA (red,

42
positive control; lane 1), distilled water (blue, negative control; lane 2) and non-

complementary target DNA (lane 3) (Fig. 6c). A final concentration of 30 mmol per litre

MgSO4 gave the expected positive and negative results.

By contrast, addition of 5–20 mmol per litre MgSO4 to mixtures containing no template

(Lane 2) or non-target DNA (Lane 3) did not give the expected change from red to blue

(i.e. they gave instead false positive results), while concentrations of 40–100 mmol per

litre with mixtures containing EHP amplicons did not remain red as expected but gave a

change to blue (i.e. they gave false negative results). Thus, the optimal salt concentration

chosen in this study was 30 mmol per litre.

(R.Suebsing et al 2013)

FIGURE 5

(R.Suebsing et al 2013)

This figure depicts the comparison between colloidal AuNP and DNA labelled AuNP

probe. Blue line indicates untreated AuNP probe. Red Line indicates AuNP probe.

43
 FIGURE 6

(R.Suebsing et al 2013)

This figure depicts the optimization of the AuNP hybridization assay for the detection of

Enterocytozoon hepatopenaei (EHP).

Effects of ratio of (LAMP) amplicon to

(a) 2-nmol per litre AuNP probe and

(b) 5-nmol per litre AuNP probe in tubes contained either

(1) E. hepatopenaei LAMP amplicon or

(2) PemoNPV LAMP amplicon (non-complementary DNA target).

44
Amplicons were mixed with the probe at ratio of 9:1–1:9 µl followed by addition of 30

mmol per litre MgSO4. The positive control (G) consisted of untreated AuNP probe.

(c) Effects of salt concentration. Tubes contained 5 µl of either

(1) E. hepatopenaei LAMP amplicon or

(2) PemoNPV LAMP amplicon (non-complementary DNA target) or

(3) E. hepatopenaei LAMP premix without DNA target (negative control) were mixed

with 5 µl of 5 nmol per litre AuNP probe followed by addition of MgSO4 (5 µl fixed

volume) at final concentrations between 5 and 100 mmol per litre.

The positive control (G) consisted of untreated AuNP probe.

(R.Suebsing et al 2013)

CONFIRMATION OF LAMP AuNP AMPLICONS

LAMP amplicons obtained were expected to get digested with an enzyme called EaeI and

the fragments obtained after digestion were of around 197bp.

The LAMP product obtained is confirmed by the absence of ladder like structure which is

a typical characteristic of LAMP amplicon mixture. (Fig 7)

(R.Suebsing et al 2013)

45
 FIGURE 7

This figure depicts the confirmation of LAMP AuNP product which on digestion with the

Restriction enzyme called EaeI gives fragments of 197bp.

Lane M: 2-log DNA marker

Lane N: negative control

Lane U: uncut LAMP amplified product (absence of EaeI restriction enzyme)

Lane C: EaeI enzyme-digested fragment of 197 bp.

(R.Suebsing et al 2013)

EaeI is one of the specific restriction enzymes which are capable of cleaving the LAMP

AuNP product at specific locations. After the Cleavage various fragments are obtained

and out of these fragments the most prominent one which is present in excess is of 197bp

46
which is clearly shown in the figure. In order to identify the 197bp product the 2-log

DNA marker is used.

Lane U contains the LAMP AuNP product without the restriction enzyme while Lane N

depicts the negative control i.e it only contains the restriction enzyme and doesn’t have

the LAMP AuNP product and hence no digestion is seen in the negative control.

SPECIFICITY OF LAMP AuNP DETECTION

In order to check the specificity of the LAMP AuNP assay, one test was conducted to

observe weather cross amplification was present or not. Amplification was done using

PCR with shrimp DNA template having other diseases and shrimps infected with

pathogens other than EHP using the primers designed for SSU rRNA sequence from

EHP. The other prominent pathogens which infects the shrimps are as follows -

PemoNPV, PmDNV, IHHNV, LSNV,V. harveyi, and P. aeruginosa and a currently

unclassified gregarine. The test gave negative results indicating that the LAMP-AuNP

assay was specific to E. hepatopenaei (Fig. 8a,b, lanes 5–10). In addition to this test the

results were rechecked and confirmed using BLASTN for the whole GenBank sequences.

Apart from that ClustalW was also used to compare the target region of LAMP method

with the matching regions of SSU rRNA sequences of microsporidians present in the

database and specifically those in the genus Enterocytozoon and in A. penaei (the only

other microsporidian previously reported for P. monodon and P. vannamei in Asia). The

results depicted no forms of binding.

(R.Suebsing et al 2013)

47
 FIGURE 8

Figure (a) depicts the Colorimetric results for the sensitivity and specificity of (LAMP)-

AuNP detection of Enterocytozoon hepatopenaei (EHP).

Lanes 1–4: Depicts tenfold dilutions of DNA extracted from shrimp with E. hepatopenaei

infection (20 to 0.02 fg).

48
Lane 5: PemoNPV infection

Lane 6: PmDNV infection

Lane 7: Infectious hypodermal hematopoietic necrosis virus (IHHNV) infection

Lane 8: Laem–Singh virus (LSNV) infected sample.

Lane 9: Vibrio harveyi infected sample.

Lane 10: Psuedomonas aeruginosa infected sample.

Lane 11: Unclassified gregarine infected sample.

Lane N: Negative control (without any infection present).

(b) The sensitivity and specificity of LAMP followed by gel electrophoresis

corresponding to individual tubes in Fig. 8a.

(c) The sensitivity of nested PCR for the detection of E. hepatopenaei (EHP).

Lane M: 2-log DNA marker required for size determination.

Lanes 1–4: DNA extracted from shrimp infected with E. hepatopenaei (EHP) diluted 10

folds (20 to 0.02 fg)

Lane N: Negative control.

(d) Visible spectra corresponding to individual tubes in Fig. 8a measured after salt

addition.

49
20 fg, 2 fg, 0 .2 fg, 0 .02 fg, PemoNPV, IHHNV, PmDNV, LSNV,V. harveyi, P.

aeruginosa, Unclassified gregarine, Negative control.

(R.Suebsing et al 2013).

IMPORTANCE OF LAMP – AuNP ASSAY

Within the past decade, lots of substitutes for the expensive thermocycler machines

which are used in the PCR for the detection of EHP infection are found out and the most

important among the substitutes is the isothermal amplification assays in order to detect

target nucleic acid templates. (Savan et al. 2005).

There were some reports recently which described similar methods than agarose gel

electrophoresis in order to visualize amplicons from the LAMP reactions. (Notomi et al.

2000; Kiatpathomchai et al. 2008). The new trending assays that are coming across these

days includes the use of nanoparticles for the DNA detection. These are termed as

Nanoparticle-based assays. (Baptista et al. 2006; Eaton et al. 2007).

Among the nanoparticles gold nanoparticles are the most widely used ones as they have

possess unique optical properties which makes them apt for designing the labelled AuNP

probes. The AuNP probes have an edge over other assays as they are cheap and possess

good visual detection properties as compared to the most conventional methods widely

used such as fluorescence or radioactivity-based assays (Storhoff et al. 2004; Xu and

Craig 2005). The combination of LAMP amplification and AuNP probe detection has

been successfully developed and used for the detection of various shrimp viral pathogens

50
specially the yellow head virus. (Jaroenram et al. 2012) and white spot syndrome virus

(Seetang-Nun et al. 2013).

In accordance with recent studies, the sensitivity of LAMP-AuNP assay was found out to

be comparable to that of commercially nested PCR which was widely used since long

back and it also corresponds to the sensitivity of E. hepatopenaei (EHP) LAMP-AuNP

method, in the present studies took all across the globe.

In the study which was performed, the LAMP AuNP assay in combination with the

AuNP hybridization used for the detection of EHP was found out to be simple and very

effective in the detection of the SSU rRNA gene of EHPunder the optimal conditions at

65°C for 45 min. The concentrations of MgSO4, betaine and dNTPs were also optimized

as these can influence LAMP reactions (Notomi et al. 2000).

It was observed that at least 4 mmol per litre MgSO4 was required in the LAMP reaction

but that can result in inhibition if high concentration of MgSO4 is present because at high

concentration of MgSO4 the Bst DNA polymerase activity gets highly reduced and the

DNA helix also gets destabilized.(Notomi et al. 2000). The minimal concentrations of

Betaine and dNTP mix was found out to be 0.2 mol per litre and 1.0 mmol per litre

respectively under the optimal MgSO4 concentration.

Betaine doesn’t affect or influence the amplification of the short target fragment (<300

bp) and hence reduces the amount of nonspecific amplification (Baskaran et al. 1996).

Close aggregate formation is prevented due to the formation of a three dimensional

polymeric network of cross-linked AuNP after hybridization of LAMP amplicons with

51
AuNP and keeps them apart so they maintain their red colour in the presence of added

salt.

By contrast, unprotected AuNP do aggregate (come closer together) in the presence of

added salt in the blank and negative control containing non complementary DNA, and

this leads to a quantum shift in their absorbance spectrum visualized as a change from red

to blue (Baptista et al. 2005, 2006).

The ratio between LAMP amplicon and AuNP probe was found out to be critical for

successful and reproducible detection of hybridization between LAMP amplicons and

AuNP probes in optimization tests. The optimal ratio was found out to be 6:4 µl. Also the

critical concentration of salt promoting aggregation after the hybridization step was found

out to be 30 mmol per litre MgSO4 (Levy et al. 2004).The LAMP amplicons are

confirmed not only by hybridization reaction but it can also be achieved by their

digestion with the restriction enzyme called EaeI and the product obtained after digestion

is short fragments of around 197bp (ladder like pattern gets transformed into single band

of 197bp). The 190bp fragments were identified using agarose gel electrophoresis.

The LAMP-AuNP method was able to detect E.hepatopenaei in as little as 0.02 fg total

DNA extracted from infected shrimp when compared to 0.2 fg total DNA by nested PCR.

This property shows that the LAMP AuNP method is highly sensitive as compared to

nested PCR. Absence of cross amplification with other pathogens infecting the shrimp

shows the specificity of the method for the detection of EHP.

The applicability of the LAMP-AuNP assay was assessed with field samples, and the

results were compared with those obtained using a nested PCR method. The results

52
showed that the detection rate decreased when using nested PCR, indicating the LAMP-

AuNP assay would be more suitable than the nested PCR assay for field diagnosis and/or

surveillance programs for E. hepatopenaei

(EHP). Moreover, the time required for the LAMP-AuNP method was approximately 50

min only (45 min for LAMP, 5 min for hybridization and less than 1 min for the salt

induction step). By contrast, 3–4 h was required for the nested PCR followed by gel

electrophoresis. In summary, a simple, inexpensive, rapid, and sensitive and specific

method for the detection of E. hepatopenaei in shrimp and other potential carriers has

been devised. The low cost of the equipment and materials for the method makes it easy

for adoption even by small field laboratories associated with shrimp farms. Application of

the new test will be useful in assessing the prevalence and impact of E. hepatopenaei

infections on the production of P. monodon and P. vannamei cultured in Asia. It will also

be useful in identifying potential reservoir carriers that may be the source of infections

and may pose a biosecurity risk to broodstock and post larvae in the hatchery and to

juvenile shrimp in rearing ponds.

(R.Suebsing et al 2013).

HISTOPATHOLOGY AND ULTRASTRUCTURE OF EHP

EHP mainly affects the hepatopancreatic tissue and more specifically the epithelial tubule

cells of hepatopancreatic tissue. Most prominent infection of EHP is found in the

hepatopancreas and hence in order to obtain a clear view of the structure of EHP, smear

of the hepatopancreatic tissue is being made and it was viewed under light microscopy.
53
Under the light microscopy the presence of microsporidian spores was confirmed in the

cytoplasm of hepatopancreatic tubule epithelial cells. (Figure 9)

TEM also reviled the presence of microsporidian spores in the epithelial tubule cells of

hepatopancreas.

FIGURE 9

Photomicrographs of Enterocytozoon hepatopenaei tubule epithelial cells of the

hepatopancreas of Penaeusmonodon.

54
(A) H&E-stained smear of hepatopancreatic tissue showing numerous microsporidian

spores (arrows depicting the specific location).

(B) Fresh preparation of microsporidian spores from a Percoll gradient.

(C and D) Hepatopancreatic tissue sections showing acidophilic, granular inclusions in

the cytoplasm of tubule epithelial cells (depicted by arrows).

(E) Semi-thin section of hepatopancreatic tissue showing early and late plasmodia (inset

a) and mature spores (inset b) in the cytoplasm of tubule epithelial cells. Some spores

show unstained spots that represent their concave surfaces at one end (inset b).

A implies haematoxylin stain in the figure.

C depictstrichrome stain in the figure.

D, H&E stain are also present in the figure.

E, depicts Toluidine blue stain in the figure.

ePm implies early plasmodium and lPm implies late plasmodium.

(SomjintanaTourtip et al 2009)

55
 FIGURE 10

Trasmission electron micrographs (TEM) of early stages of E. hepatopenaei (EHP)

development in hepatopancreatic tubule epithelial cells of P. monodon.

(A) Early plasmodium stage with two nuclei.

(B) Early plasmodium stage with multiple nuclei.

(C) A group of plasmodia surrounded by a vacuole within the cytoplasm of the host-cell

and showing nuclear division (inset, arrowhead). Mv stands for microvilli and V stands

for vacuole.

(SomjintanaTourtip et al 2009)

56
Transmission electron microscopy (TEM) was used to reveal the perfect and clear view

of the EHP structure. Various stages of the microsporidian parasite were found out to be

present in the cytoplasm of the epithelial tubule cells.

Very Early Meront stages of the EHP was not at all observed while the early and late

Plasmodia Stage was found out to be very frequent and was present in abundance.

The plasmodia were found out to have multiple nuclei and sporogony was also present

which the dominant characteristic of the family Enterocytozoonidae.

There was contact between the plasma membrane of plasmodia and the host cell

cytoplasm and in some cases many plasmodia are found out to be surrounded by the

cytoplasmic vacuoles.

Sporogonal plasmodia were characterized by the appearance of round vesicles (100–

200nm) with electron-dense, surrounding membranes and short polar filament precursors

within the plasmodial cytoplasm (Fig. 10A, inset a). Circular disks with outer electron

dense layers and inner electron-lucent cores were also observed (Fig. 10A, inset b). The

tubules and the circular disks were presumably precursors of the polar filaments of the

spore. As plasmodia matured, the tubules and the disks appeared to increase in number,

concomitant with a decrease in the number of vesicles.

The plasmodial plasma membrane which was found out to be in direct contact with the

host cell cytoplasm had a microvillus appearance with characteristic blebs.

57
OBJECTIVES:

Sample collection and DNA extraction

Primer designing and Polymerase Chain Reaction with Infected animal DNA

Different organ screening

Microscopic Examination of infected tissue sample

Cloning

58
MATERIALS AND METHODS:

Materials required:

Fresh uninfected samples of penaeid shrimp in juvenile and adult stage (obtained from

BMR fisheries Chennai) and Nellore (Andhra Pradesh).

Figure: Adult Shrimps obtained from Chennai and Nellore (AP).

Healthy shrimp were brought from the two places.

They were kept in the sea water conditions with proper buffering and salt concentrations.

EHP samples.

PCR kit and DNA extraction Kit.

59
PCR Kit Contains:

Standard PCR was carried out in a 20 µL reaction mixture consisting of 1X PCR buffer

(50 mMKCl, 10 mMTris-Cl, pH 8.3), 200 µM each of dATP, dTTP, dCTP and dGTP, 10

mM MgCl2, 5 pmol of each primer, 1 unit of Taq DNA polymerase (Finnzymes, Espoo,

Finland) and 10 ng of DNA extracted. The resultant PCR product was used as template

for the nested PCR reaction.

DNA extraction kit contains:

Guanine Hcl

Centrifugation machine.

Sample tissues from various parts of the shrimp like gut, leg, heart, hepatopancreas, eyes,

gills and tail.

Ethanol and PCR water.

Artemia Salina as shrimp’s food (larval stage).

Artemia obtained as food was not contaminated with EHP.

Designed primers for EHP amplification.

60
METHODS

DNA extraction:

DNA of the infected Shrimp in extracted using the following protocol:

Post larval stage shrimps samples are taken from hepatopancreas as well as muscles cells.

(Samples pooled from 3-4 shrimps).

Samples added with Guanine HCL and kept for incubation for 30 minutes at room

temperature.

Centrifuged at 5000 rpm for 5 minutes.

Supernatant is taken and added with equal volumes of 100 percent ethanol

Incubated for 5 minutes at Room Temperature and centrifuged at 14000 rpm for 20

minutes at 25 degree Celsius.

Supernatant is discarded and to the pellet 200µl of 95 percent ethanol is added.

Centrifuged at 14000 rpm for 10 minutes at 25 degree Celsius.

To the pellet add 200µl of 70 % ethanol and kept for 5 mins incubation at room

temperature

Centrifuge at 14000 rpm for 10 minutes and discard the supernatant.

Air dry the pellet and add 40µl of PCR water and use it as the PCR template.

61
DESIGNING OF PRIMERS:

Primers for the EHP amplification during PCR was done.

Primer Sequence 5’ 3’ Size

Name of

base

pairs

Microspo- TTGACGTGAAGCAATTGGAG 465

Ex F
AAGCAGCACAATCCACTCCT

Microspo-

Ex R

Microspo- GGTGGGCAAAGAATGAAATC 223

InF
CGAGCGTACTATCCCCAGAG

Microspo-

InR

62
Following characteristics of the ideal primer was taken into consideration:

It should 18-22 nucleotides long. GC content should be 50-55 %

Should have a GC lock on the 3´ end and melting temp between 50-55℃

No polybase regions should be present.

Forward and reverse primers should not be complementary to each other.

Primers were checked using Sequence Manipulation Suite (SMS).

PCR AMPLIFICATION:

The following PCR conditions were used to amplify the EHP genome present in the

infected shrimp’s samples. (EHP specific primers were designed and used)

Preheating temperature: 95°C for 5 mins.

Denaturation : 95°C for 1 min

Annealing : 50°C for 1 min 35 cycles

Extension : 72°C for 1 min

Post cycle extension at 72°C for 10 minutes.

Holding at 4°C.

63
Standard PCR was carried out in a 20 µL reaction mixture consisting of 1X PCR buffer

(50 mMKCl, 10 mMTris-Cl, pH 8.3), 200 µM each of dATP, dTTP, dCTP and dGTP, 10

mM MgCl2, 5 pmol of each primer, 1 unit of Taq DNA polymerase (Finnzymes, Espoo,

Finland) and 10 ng of DNA extracted. The resultant PCR product was used as template

for the nested PCR reaction.

NESTED PCR:

It is a type of modification of standard PCR. It is done to reduce the amount of

contamination in the amplified product. Major contamination in the product used to be

fragments amplified due to non-specific binding of the primers which happens due to

competition between the binding sites. This contamination is reduced by using nested

PCR in which a large fragment of the genome is amplified containing the required small

fragment of the genome. This is done by using two primer pairs.

One primer pair for the amplification of the larger fragment while the other primer pair

for the amplification of the smaller fragment.

Position of the primers plays an important role. The forward primer should be upstream

to the inner forward primer which should be present upstream to the inner reverse primer

and finally inner reverse primer should be present upstream to the reverse primer.

Melting temperatures are also changed for obtaining more precise and accurate results.

GEL ELECTROPHORESIS:

Gel electrophoresis with the PCR sample is done to identify the presence of EHP.

64
RESULTS AND DISCUSSION:

The presence of EHP infection in the hepatopancreas and muscles cells of penaeid shrimp

is confirmed using the PCR. The effect of EHP infection in the shrimps is studied. It is

found out that the EHP basically infects the shrimp in the hepatopancreas.

Adult shrimp different organs screening to check EHP infection.

M 1 2 3 4 5 6 7 8 9 10 11

2=gut
3=HP
4=mus
5=gill
6=heart
7=eye
8=tail
9=leg

65
Confirmatory PCR was done to establish the fact that the EHP infects the Penaeid Shrimp

mainly in the hepatopancreas.

Figure: Confirmation of cloned plasmid using restriction enzyme (ECoRI and BamH1)

as shown above.

66
Histopathological Study in the shrimp showed high amount of EHP infection in the

hepatopancreas and eyes too.

The study was conducted using Automated Stereo Microscopy and images were obtained

showing the areas in which EHP infection is proliferated.

Figure: The figure shows the black spots of EHP present in the eye of the adult shrimp

EHP infection was confirmed in the Hepatopancreas of the shrimp using nested PCR.

67
EHP infection in the hepatopancreas was confirmed using Hematoxylin and Eosin

Staining.

Figure: a) Control post larval.

b) Positive post larval.

FUTURE PERSPECTIVE:

To find out the screening methods for the eradication of EHP infection from shrimp.

68
CONCLUSION

EHP infection in the shrimp was confirmed using nested PCR and histopathological study

was also carried out showing high amount of EHP infection in the Penaeid shrimp.

My project concludes that EHP is one of the prominent parasite microsporidian which

infects the penaeid shrimp all across India along various coastlines. The infection is

majorly found in the hepatopancreas and is also detected in various other organs of the

shrimp. Infected shrimp are found to have retarded growth patterns resulting in poor

income generation in the shrimp culture business. The infection is not so prominent in the

larval stage but it’s highly populated in the hepatopancreas of the Juvenile and Adult

shrimp.

Further study is required in order to find out the eradication methods for the EHP

infection in the shrimp. Both physical and chemical methods need to be tried and a proper

solution is needed to be found out.

The literature study also depicts that the EHP infection spreads through contaminated

Artemia and hence properly sterilized Artemia should be used for feeding the larval

shrimp.

As the infection is overlooked due to other diseases like Necrosis Disease, highly

efficient and sensitive method for the EHP infection detection has been found out during

the project.

69
REFERENCES:

Kathy F.J. Tanga, Carlos R. Pantojaa, Rita M. Redmana, JeeEun Hana, Loc H. Tranb,

Donald V. Lightnera. Development of in situ hybridization and PCR assays for the

detection of Enterocytozoon hepatopenaei (EHP), amicrosporidian parasite infecting

Penaeid shrimp.

Journal of Invertebrate Pathology 130 (2015) 37-41

SomjintanaTourtipa, Somjai Wongtripopb, GrantD. Stentifordc, Kelly S.Batemanc,

SiripornSriurairatanad,Jittipan Chavadeja, Kallaya Sritunyalucksanad, Boonsirm

Withyachumnarnkula, Enterocytozoon hepatopenaei sp. nov. (Microsporida:

Enterocytozoonidae), a parasite of the black tiger shrimp Penaeusmonodon (Decapoda:

Penaeidae): Fine structure and phylogenetic relationships.

Journal of Invertebrate Pathology 102 (2009) 21–29

Chanratchakool, P., and M.J. Phillips. 2002. Social and economic impacts and

management of shrimp disease among small-scale farmers in Thailand and Vietnam. p.

177-189. In: J.R. Arthur, M.J. Phillips, R.P. Subasinghe, M.B. Reantaso and I.H.

MacRae. (eds.) Primary Aquatic Animal Health Care in Rural, Small-scale, Aquaculture

Development. FAO Fish. Tech. Pap. No. 406.

70
Shrimp Disease Control: Past, Present and Future TIMOTHY W. FLEGEL1, DONALD

V. LIGHTNER2, CHU FANG LO3 and LEIGH OWENS4 1Center of Excellence for

Shrimp Molecular Biology and Biotechnology (Centex Shrimp), Faculty of Science,

Mahidol University, Rama VI Road, Bangkok 10400, Thailand 2Department of

Veterinary Science & Microbiology, University of Arizona, Tucson, AZ 85721, USA.

National Taiwan University, Rm 1216, Life Science Building, Taipei, Taiwan

Department of Biomedical and Tropical Veterinary Sciences, James Cook University of

North Queensland, Townsville, Queensland 4811, Australia

http://enaca.org/publications/health/disease-cards/ehp-disease-card-2015.pdf by Prof.

Timothy W. Flegel, Centex Shrimp Bangkok, Thailand.

Kallaya Sritunyalucksana1,2,3, Piyachat Sanguanrut1, Paul Vinu Salachan1,5, Siripong

Thitamadee1,2 and Timothy W. Flegel1,4

Science, Mahidol University, Rama VI Rd., Bangkok, 10400.

Engineering and Biotechnology (BIOTEC), Yothi office, Rama VI Rd. Bangkok,

10400, Thailand
5
VIT University, Vellore, Tamil Nadu, 632014, India

71
A review on fungal diseases of algae, marine fishes, shrimps and corals, by N ramaiah,

biological oceanography division, national institute of oceanography doan paula, Goa

403 004, India (email: [email protected]) received 10 july 2006, revised 23 october

2006.

Lightner, D.V.; Redman, R.M.; Bell, T.A. (1983). Infectious hypodermal and

hematopoietic necrosis, a newly recognized virus disease of penaeid shrimp. J. Invertebr.

Pathol. 42, 62-70

Chantanachookin, C.; Boonyaratpalin, S.; Kasornchandra, J.; Direkbusarakom, S.;

Ekpanithanpong, U.; Supamataya, K.; Sriurairatana, S.; Flegel, T.W. (1993). Histology and

ultrastructure reveal a new granulosis-like virus in Penaeus rnonodon affected by yellow-head

virus. Dis. Aquat. Org. 17, 145-157.

72