International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-4, Issue-3, May-Jun- 2019

http://dx.doi.org/10.22161/ijeab/4.3.7 ISSN: 2456-1878

Bioremediation of Textile dyes by Fungal-

Bacterial Biofilms
A. P. Henagamage
Department of Science and Technology, Faculty of Applied Sciences, Uva Wellassa University, Sri Lanka

Abstract— Textile waste pollutants are the most polluting organisms by limiting the light penetration and their
waste water and their treatment is greatly challenging for breakdown products may be toxic to them (Wang et al.,
their safe discard. Microbial communities have potential 2009). Nigrosin disodium and Malachite green are good
ability to decolorize synthetic commercial dyes used for examples which are used in many fields and also have a
textile dyeing. Therefore, this study was aimed to develop wide variety of toxicological effects (Zhang et al., 1995).
potential dye degrading microbial biofilms from Both dyes have been reported for their negative impact on
endophytic fungi and soil bacteria. Endophytic fungi were living cells and organisms (Culp and Beland, 1996).
isolated from the leaves of Eleusine indica (Linn) and Because of the toxicity to major microorganisms, its
bacteria were isolated from soil samples obtained near presence in wastewaters makes difficult the
textile effluent dumping site in Biyagama Industrial zone, biodegradation.
Sri Lanka. Biofilms were developed after screening the Commonly applied treatment methods for the removal of
fungal and bacterial isolates with Malachite green and colored effluents consist of integrated processes involving
Nigrosin disodium dyes separately and the decolorization various combinations of biological, physical and chemical
assay was performed for biofilms along with decolorization methods (Galindo and Kalt, 1999; Azbar et
monocultures to evaluate their ability for dye al., 2004). However, chemical and physical methods for
decolorization. The highest significant (P< 0.05) the treatment of dye wastewater are not widely applied to
decolorization percentages were observed by Tricoderma textile industries because of the costs and disposal
harzianum (F2) and Bacillus subtilis (B1) for both dyes. problems (Yang et al., 2009). The available conventional
All the biofilm combinations showed higher waste water treatment systems are unable to completely
decolorization percentage than that of the monocultures. remove the recalcitrant dyes and other organic residues
Thus, it can be concluded that the biofilms can be used as from such effluents. Therefore, there is an immense effort
an efficient biological tool for textile effluent treatment. to develop a cost-effective and ecofriendly alternative to
Keywords— Biofilms, Textile dyes, Bioremediation, conventional waste treatment methods.
Decolorization. Among all the technologies bioremediation of textile dye
containing effluents using microorganisms which are
I. INTRODUCTION capable of degrading dye, is still seen as an attractive
Environmental pollution has been recognized as one of alternative solution (Shahid et al., 2013). Although,
the major hazards of the modern world. Due to the rapid bacterial, fungal and algal species have the ability to
industrialization and urbanization, various types of adsorb and/or degrade dyes (Stolz, 2001; Don Santoz,
chemicals manufactured and applied in day to day life 2007), the moderate decolorization rate and complexity of
(Moorthi et al.,2007). Among industrial effluents, textile effluents limit the performance of microorganisms
wastewater from textile industries is one of the most in bioremediation (Banat et al., 1996; Elisangela et al.,
difficult to be treated since the dyes used are usually 2009; Wang et al., 2009). Further, it has been observed
synthetic and contain complex aromatic molecular that the biological treatment along with the cu rrent
structures (Padmesh et al., 2005). During manufacturing conventional microbiological treatment processes have
and processing, approximately 10- 15% of the dye is lost not been not proved satisfactory for color elimination
and released directly as wastewater that accumulates in (Robison et al., 2001). Therefore, bioremediation through
the environment (Elisangela et al., 2009). Unfortunately, microbial biofilms is emerging as one of the promising
most of these dyes persist in the environment due to their approaches due to its power of degrading various
high stability to physical factors like light and environmental pollutants, high tolerance towards harsh
temperature (Drumond Chequer et al., 2013). The environment, low-cost and environmentally friendliness
disposal of such reactive dyes into the environment even (Mitra and Mukhopadhyay, 2015). Thus, present study
at very low concentrations causes considerable damage as focused on investigating the potential of fungal bacterial
they intensely affect the photosynthetic activity of aquatic biofilms to decolorize the selected textile dye effluent.

www.ijeab.com Page | 635

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-4, Issue-3, May-Jun- 2019
http://dx.doi.org/10.22161/ijeab/4.3.7 ISSN: 2456-1878
II. METHOD broths and incubated at room temperature with
2.1 Isolation of endophytic fungi and soil bacteria continuous shaking for five days. The strength of the
Endophytic fungi were isolated from the leaves of attachment of the biofilm was continuously observed
Eleusine indica (Linn), a plant grown near a dumping site under optical microscope model BX43F by staining with
of textile effluents in Biyagama Industrial zone, Sri Methylene blue. Biofilms which had the best attachments
Lanka. The leaves of the Eleusine indica (Linn) were cut (F2B3, F2B2B3, F2B2) and their mono cultures were
into smaller pieces and surface sterilized with 70% selected to analyze their efficiency of heavy metal
ethanol, 1% clorox, and rinsed with sterilized water. The absorption in the liquid media.
PDA plates inoculated with the surface sterilized leaf 2.4 Dye decolorization assay
parts were incubated at 25°C and observed for growth. Ten milliliters of five-day old biofilms and mono cultures
The pure fungal cultures were transferred periodically were inoculated into series of 250mL Erlenmeyer’s flask
onto fresh Potato Dextrose Agar (PDA) plates. Bacteria contained 100ml of Potato Dextrose Broth (PDB) and
were isolated from soil samples obtained from the same Nutrient Broth (NB) mixture added with filter sterilized
location near the textile effluent dumping site. The pure 0.5g/L of Malachite green and Nigrosine disodium dyes
bacterial cultures were transferred periodically onto fresh separately. The inoculated media were incubated on
Nutrient Agar (NA) plates. rotary shaker in 150 rpm speed at room temperature 27°C
2.2 Screening of microbial isolates on dye for 10 days with control contained medium having dye
decolorization without biofilm and monoculture inoculation and all
Malachite green (4-[(4-dimethylaminophenyl) phenyl- assays were performed in triplicate. During the
methyl]-N, N-dimethylaniline) Molecular formula: incubation, 5 ml of samples were withdrawn at two days’
C23H25ClN2 and Nigrosin disodium; 4-amino-3-[(4- time intervals and centrifuged at 5000 rpm at 4o C for 10
nitrophenyl) diazenyl] - 5-oxo-6- (phenylhydrazinylidene) minutes using cooling centrifuge (REMI C-24BL).
naphthalene-2, 7-disulfonate, Molecular formula: Absorbance reading of the cell free s upernatant was
(C22H14N6Na2O9S2), dyes in textile industries were measured using Spectrophotometer at 620 nm for
used to screen the fungal and bacterial isolates for their Malachite green and at 600 nm for Nigrosin disodium
decolorization ability. Fungal and bacterial isolates were dyes and the decolorizing activity was expressed in terms
inoculated into Erlenmeyer flasks containing 100 ml of of percent decolorization using the formula mentioned
nutrient broth and potato dextrose broth supplemented above.
with filter sterilized 0.5g/L of Malachite green and 2.5 Statistical analysis
Nigrosine disodium dyes separately. Dyes containing Values reported in this paper are the means ± Standard
uninoculated medium served as control and all assays Deviation. The decolorization capacity of each isolate
were performed in triplicate. Inoculated medium and was studied by one-way ANOVA followed by post-Hoc
control were incubated at room temperature (250 C) for multiple comparisons by Duncan’s method using
five days on rotary shaker at 150 rpm. Growth and dye Minitab16 software package.
decolorization were noted every day. After incubation, 2.6 Molecular identification of microbial components
samples were withdrawn, centrifuged at 5000 rpm at 4o C in the responsive biofilm for the dye decolorization
for 10 minutes using cooling centrifuge (REMI C-24BL). Genomic DNA of the fungal component of the biofilm
Absorbance reading of the cell free supernatant was was extracted from 5-day old fungi cultures grown on
measured using Spectrophotometer at 620 nm for plates using thermolysis method (Zhang et al., 2010).
Malachite green and at 600 nm for Nigrosin disodium Fungal DNA was amplified using universal primers of
dyes. The decolorizing activity was expressed in terms of fungal DNA ITS1 (5’–TCC GTA GGT GAA CCT GCG
percent decolorization which was determined by using the G-3’) and ITS4 (5’–TCC TCC GCT TAT TGA TAT GC-
following formula; 3’) (White et al., 1990). PCR products were purified and
Percentage of decolorization = {Initial Absorbance - Final were sent for sequencing and obtained sequences were
absorbance/Initial Absorbance} X100 compared with the other related sequences using BLAST
2.3 Formation of the biofilms search in GenBank (NCBI) (Liu et al., 2000).
The screened fungal (F1 and F2) and bacterial (B2, B3 Identification of the bacterial component in the
and B6) isolates having the dye decolorization ability responsive biofilm was done through 16S rDNA sequence
were inoculated into Potato dextrose and Nutrient broths analysis. The genomic DNA of each biofilm-forming
separately and incubated at 29±1 o C for 10 days and at isolate grown in TSB for 24 to 48 hours was extracted
25± 1o C for 3 days respectively. Fungal- bacterial using ZR Fungal/Bacterial DNA Kit™ (Zymo Research
biofilms were developed by combining the fungal and California USA) according to the manufacturer’s
bacterial isolates grown in potato dextrose and nutrient protocol. Polymerase Chain Reaction (PCR) procedure

www.ijeab.com Page | 636

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-4, Issue-3, May-Jun- 2019
http://dx.doi.org/10.22161/ijeab/4.3.7 ISSN: 2456-1878
was done using primers 11F compared with those stored in the Genbank databases of
(5’GTTTGATCMTGGCTCAG 3’) and 1492R the National Center for Biotechnology Information
(5’TACGGCTACCTTGTTACGACTT3’) with 1 µL of available on-line using pairwise alignment or BLAST
undiluted genomic DNA extract as template. Agarose gel algorithm.
electrophoresis was employed to detect amplification of
the 16S rDNA of the biofilm-forming isolates. The III. RESULTS
amplified products were sequenced at the Macrogen 3.1 Screening of fungal and bacterial isolates on dye
Sequencing facility in Korea and sequences were decolorization

Fig. 1- a decolorization ability of different fungal isolates on malachite green and nigrosin disodium dyes. b. decolorization
ability of different bacterial isolates on malachite green and nigrosin disodium dyes. M- malachite green and N- nigrosin
disodium. columns with the same letter are not significantly different at 5% probability level. vertical bars show standard
deviations.
All the fungal isolates showed decolorization of both highest significant (P< 0.05) decolorization percentage
Malachite green and Nigrosin disodium dyes (Fig.1a). for both Malachite green (47± 0.762) and Nigrosin
The results revealed that fungal isolate F2 and F3 showed disodium (33 ± 0.845) was observed from F2 fungal
higher decolorization percentage for both dyes than that isolate. All the bacterial isolates showed decolorization of
of the other fungal isolates. Out of all fungal isolates, the both dyes except B5 and B6 (Fig.1b). Further, bacterial

www.ijeab.com Page | 637

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-4, Issue-3, May-Jun- 2019
http://dx.doi.org/10.22161/ijeab/4.3.7 ISSN: 2456-1878
isolates B1 and B2 showed higher decolorization Table 1- Strength of attachment of different monocultures
percentage for both dyes than that of the other bacterial during the formation biofilms
isolates. The highest significant (P< 0.05) decolorization Microbial combination Strength of the attachment
percentage for Malachite green (22.3± 0.435) and the
highest decolorization percentage for Nigrosin disodium F2B1 (FBB1) ********
(23.7 ± 0.612) was observed from B1 bacterial isolate. F2B2 (FBB2) *****
Decolorization was not recorded from B6 isolate for both F2B2B1 (FBB3) ****
dyes. It was observed that all the fungal isolates F3B1 (FBB4) *
decolorized more Malachite green dye than Nigrosine F3B2 (FBB5) **
disodium dye whereas all the bacterial isolates F3B1B2 (FBB6) -
decolorized more Nigrosine disodium dye than Malachite
green dye. 3.3 Dye decolorization assay
All the biofilm combinations showed higher
3.2 Biofilm formation decolorization percentage than that of the monocultures at
Microscopical observation revealed that except the every time intervals from day 2 to day 12 for both dyes
microbial combinations FBB6, all other combinations (Fig.2). Although, a sharp increment was observed in the
showed a biofilm formation and the strength of the dye decolorization percentage up to day 6 by the fungal
attachment varied depending on the microbial isolate F2 and biofilm combinations FBB2 and FBB3 for
composition. Out of all combinations, the highest strength both dyes, the rate of increment was gradually decreased
of attachment was observed in FBB1. Biofilm with the time until day 12. After day 6, it was clear that
combinations FBB2 and FBB3 also showed higher the dye decolorization rate by the bacterial isolates
attachment compared to other biofilm combinations. became constant. However, this pattern was not observed
Therefore, the biofilm combinations (FBB1-FBB3) from the biofilm combination FBB1 where the rate
showed the higher attachments under microscope, were showed continuous increment even after day 6 until day
considered for the decolorization assay. 12 and the increment rate showed high compared to other
biofilms. Out of all the biofilms, FBB1 showed the
highest decolorization percentage values for both dyes at
every time intervals until 12. Further, all the bacterial
isolates (B1 and B2) showed the least dye decolorization
percentage values at every time intervals from day 2 to
day 12.

www.ijeab.com Page | 638

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-4, Issue-3, May-Jun- 2019
http://dx.doi.org/10.22161/ijeab/4.3.7 ISSN: 2456-1878

Fig. 2- a Decolorization ability of different biofilm combinations and their monocultures on malachite green dye with the
time. b. Decolorization ability of different biofilm combinations and their monocultures on malachite green dye with the time

It was observed that the biofilm combinations showed all the microbial treatments, the highest significant (P<
higher dye decolorization percentage than that of the 0.05) dye decolorization percentage was observed by the
monocultures for both dyes (Fig. 3). Out of the two dyes biofilm combination FBB1 for both dyes. Further,
all the biofilm combinations and the fungal isolate, F2 molecular identification confirmed the composition of the
decolorized more Malachite green dye than Nigrosin highest responsive biofilm FBB1 as Tricoderma
disodium whereas bacterial isolates decolorized more harzianum, Bacillus subtilis and Pseudomonas
Nigrosine disodium dye than Malachite green dye. Out of fluorescens.

Fig.3- Decolorization ability of different biofilm combinations and their monocultures on malachite green and nigrosin
disodium dyes. Columns with the same letter are not significantly different at 5% probability level . Vertical bars show
standard deviations.

www.ijeab.com Page | 639

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-4, Issue-3, May-Jun- 2019
http://dx.doi.org/10.22161/ijeab/4.3.7 ISSN: 2456-1878
IV. DISCUSSION molecules in 15 days (Knapp & Newby, 1995). Similar
On the basis of the observations of the current study, it results have been reported by another study that
was found that the endophytic fungal isolates performed immobilized bacterial consortium of the three bacterial
better in decolorizing targeted dyes than bacterial isolates. species (Sphingomonas paucimobilis, Rhizobium
A previous study reported that fungi have more tolerant to radiobacter, and Bacillus subtilis) had the ability to
high concentrations of polluting chemicals than bacteria decolorize azo dyes more efficient than free bacterial cells
(Casieri et al., 2008). Fungi produce various extracellular of single culture (Allam, 2017). Mahmood et al. (2015)
enzymes, resulting in enhanced bioremediation rates for found that, the consortium of 6 bacterial isolates was able
most of the pollutes (Kaushik and Malik, 2009). Further, to decolorize 84% of 200 ppm of red, green, black,
fungi have a greater physical contact with the yellow, and mixed dyes within 24 hours while individual
environment due to the presence of increased cell-to- strain required 72 hours.
surface ratio. Therefore, fungal systems appear to be most
appropriate in the treatment of textile dyes (Ezeronye and V. CONCLUSION
Okerentugba, 1999) and also, they had shown better dye Malachite green and Nigrosin disodium dyes are highly
reduction potential over the bacteria (Fu and degradable with fungal bacterial biofilms in comparison
Viraraghavan, 2002). It has been reported that the white with their mono cultures. Biofilm combination
rot fungus Phanerochaete chrysosporium, grown under Tricoderma harzianum, Bacillus subtilis and
ligninolytic conditions, had shown to metabolize crystal Pseudomonas fluorescens showed the highest dye
violet by sequential N demethylation of the parent reduction ability for both Malachite green and Nigrosin
compound, which had catalyzed by lignin peroxidase disodium dyes. Therefore, it can be concluded that the
(Cha et al., 2001). In a previous report it was biofilms can be used as an efficient biological tool for
demonstrated that supernatants from Fomes textile effluent treatment.
sclerodermeus with laccase activity were able to degrade
malachite green dye (Papinutti et al., 2006). VI. ACKNOWLEDGEMENT
Decolorization studies with Trichoderma virens showed University Grants Commission is acknowledged for
high decolorization ability (99.6%) for brilliant blue dye funding the research (Grant No.
(Sweety et al., 2017). The current study also showed the UGC/VC/ DRIC/PG/2013SP/UWA/01).
ability of the reduction of both dyes by the bacterial
isolates. The reason for effective and faster decolorization REFERENCES
of the textile dye by bacteria might be associated with the [1] Ali, L., Alhassani, H., Karuvantevida, N., Rauf,
metabolic activities and interactions of the strains M.A. and Ashraf, S.S. (2014). Efficient aerobic
(McMullan et al., 2001; Phugare et al., 2011). It has been degradation of various azo dyes by a Sphingomonas
reported in a previous study that the significant ability of sp. isolated from petroleum sludge. Journal of
dye reduction by bacterial species, Bacillus sp. and Bioremediation and Biodegradation 5 (3): 1-10.
Pseudomonas sp. isolated from textile dye effluent [2] Allam, N.G. (2017). Bioremediation Efficiency of
contaminated soil (Sriram et al., 2013). Further, the Heavy Metals and Azo Dyes by Individual or
efficacy of Bacillus subtilis in decolorization of azo dyes Consortium Bacterial Species Either as Free or
have been previously reported (Cheria et al., 2012; Ali et Immobilized Cells: A Comparative Study. Egyptian
al., 2014). Journal of Botany, 57 (3):555 – 564.
The current study clearly showed that biofilms has high [3] Azbar, N, Yonar, T, Kestioglu, K .(2004).
decolorization ability than their monocultures. It has been Comparison of various advanced oxidation
reported that different microbial species present in processes and chemicaltreatment methods for COD
consortia of biofilms each with different metabolic and color removal from a polyester and acetate fibre
degradation pathway are capable of degrading several dyeing effluent. Chemosphere. 55:35-43.
pollutants including dyes and heavy metals either [4] Banat, I.M., Nigam, P., Singh, D., Marchant, R.
individually or collectively (Gieg et al., 2014: Mitra and (1996). Microbial decolorization of textile-dye
Mukhopadhyay, 2015). Decolorization of synthetic dyes containing effluents: A review. Bioresource
using consortia offers advantages over the use of single Technology 58:217-227.
microbial strains (Sudha et al., 2014) due to higher [5] Casieri, L., Varese, G.C., Anastasi, A., Prigione, V.,
degrees of biodegradation resulted from synergistic Svobodova, K., Marchisio, V.F., Novotny, C.
metabolic activities of the microbial community (Allam, (2008). Decolorization and detixication of reactive
2017). It has been reported that mixed bacterial cultures industrial dyes by immobilized fungi Tramet
from different habitats showed high decolorization of dye

www.ijeab.com Page | 640

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-4, Issue-3, May-Jun- 2019
http://dx.doi.org/10.22161/ijeab/4.3.7 ISSN: 2456-1878
spubescens and Pleurotuso streatus. Folia [18] Knapp, J.S., Newby, P.S. (1995). The
Microbiologica 53(1):44-52. microbiological decolorization of an industrial
[6] Cha, C.J., Doerge, D.R., Cerniglia, C.E. (2001). effluent containing a diazo-linked chromophore.
Biotransformation of Malachite Green by the Water Research. 29(7):1807-1809
Fungus Cunninghamella elegans. Applied and [19] Liu, S., Ren, H., Gao, Q., Roach, D.J., Loder Jr.,
Environmental Microbiology 67(9): 4358–4360. R.T., Armstrong, T.M., Mao, Q., Blaga, I., Barker,
[7] Chang-jun, C.H.A., Daniel, R., Doerge, Carl, E. D.L., and Jovanovich, S.B. (2000). Automated
(2001). Biotransformation of Malachite Green by parallel DNA sequencing on multiple channel
the Fungus Cunninghamella elegans . Applied and microchips. Proceedings of the National Academy of
Environmental Microbiology. 67(9): 4358-4360. Science of the Unites States of America. 97: 5369-
[8] Cheriaa, J., Khaireddine, M., Roubhia, M., 5374.
Bakhrouf, A. (2012). Removal of triphenymethane [20] Mahmood, R., Sharif, F., Ali, S. and Umar Hayyat,
dyes by bacterial consortium. Scientific World M. (2015). Enhancing the decolorizing and
Journal doi:10.1100/2012/ 5112454 degradation ability of bacterial consortium isolated
[9] Culp, S. J., and Beland, F. A. (1996). Malachite from textile effluent affected area and its application
green: a toxicological review. Journal of the on seed germination. The Scientific World Journal
American College of Toxicology. 15:219–238 62: 81-95.
[10] Dos Santos, A.B., Cervantes, F.J., Van Lier, J.B. [21] McMullan, G., et al. (2007). Microbial
(2007). Review paper on current technologies for decolourisation and degradation of textile dyes.
decolourisation of textile wastewaters: perspective Applied Microbiology and Biotechnology. 56:81-87.
for anaerobic biotechnology. Bioresource [22] Mitra, A. and Mukhopadhyay, S. (2015). Biofilm
Technology. 98: 2369-2385. mediated decontamination of pollutants from the
[11] Drumond Chequer, F.M., de Oliveira, G.A.R., environment. AIMS Bioengineering, 3(1): 44-59.
Ferraz, E.R.A., Cardoso, J.C., Zanoni, M.V.B., de [23] Moorthi, P.S., Selvam, S., Sasikalaveni, A.,
Oliveira, D.P. (2013). Textile Dyes: Dyeing Process Murugesan, K., Kalaichelvan P.T (2007).
and Environmental Impact. INTECH, 151-176. “Decolorization of textile dyes and their effluent
[12] Elisangela, F., Andrea, Z., Fabio, D.G., Cristiano, using white rot fungi”. African journal of
R.M., Regina, D.L., Artur, C.P. (2009). Biotechnoloy. 6(4): 424429
Biodegradation of textile azo dyes by a facultative [24] Padmesh T.V.N., Vijayaraghavan, K., Sekaran, G.,
Staphylococcus arlettae strain VN-11 using a Velan, M. (2005). “Batch and column studies on
sequential microaerophilic/aerobic process. biosorption of acid dyes on fresh water macro alga
International Biodeterioration and Biodegradation Azollafiliculoide.,” Journal of Hazardous
63:280-288. Materials.125(3):121– 129.
[13] Ezeronye, O. U., Okerentugba, P.O. (1999). [25] Papinutti, L., Mouso N., Forchiassin, F. (2006).
Performance and efficiency of a yeast biofilter for Removal and degradation of the fungicide dye
the treatment of a Nigerian fertilizer plant effluent. malachite green from aqueous solution using the
World Journal of Microbiology and Biotechnology system wheat bran- Fomes sclerodermeus. Enzyme
15:515-516. and Microbial Technology. 39:848-853.
[14] Fu, Y., Viraraghavan, T. (2002). Removal of Congo [26] Phugare, S. S., Kalyani, D.C., Surwas e, S. N.,
red from an aqueous solution by fungus Aspergillus Jadhav, J. P. (2011). Ecofriendly degradation,
niger. Advances in Environmental Research 7:239- decolorization and detoxification of textile effluent
247. by a developed bacterial consortium. Ecotoxicology
[15] Galindo, C., Kalt, T. (1999). UV/H2O oxidation of and. Environmental Safety 74: 1288–96.
azo dyes in aqueous media: evidence of a structure - [27] Robinson, T., McMullan, G., Marchant, R., Nigam,
degradability relationship. Dyes and Pigments P. (2001). Remediation of dyes in Textile effluent:
42:199-207. A critical review on current treatment technologies
[16] Gieg, L.M., Fowler, S.J., Berdugo-Clavijo, C. with a proposed alternative. Bioresource Technology
(2014). Syntrophic biodegradation of hydrocarbon 77:247-255.
contaminants. Current Opinion in Biotechnology 27: [28] Shahid, A., Singh, J., Bisht, S., Teotia, P., Kumar,
21–29. V. (2013). Biodegradation of textile dyes by fungi
[17] Kaushik, P., Malik, A. (2009). Fungal dye isolated from North Indian field soil. Environment
decolorization: recent advances and future potential. Asia 6(2):51-57.
Environment International 35:127-141.

www.ijeab.com Page | 641

International Journal of Environment, Agriculture and Biotechnology (IJEAB) Vol-4, Issue-3, May-Jun- 2019
http://dx.doi.org/10.22161/ijeab/4.3.7 ISSN: 2456-1878
[29] Sriram, N., Reetha, D., Saranraj, P. (2013).
Biological Degradation of Reactive Dyes by Using
Bacteria Isolated from Dye Effluent Contaminated
Soil. Middle-East Journal of Scientific Research 17
(12): 1695–1700.
[30] Stolz, A. (2001). Basic and applied aspects in the
microbial degradation of azo dyes. Applied
Microbiology and Biotechnology. 56(1-2):69-80.
[31] Sudha, M., Saranya, A., Selvakumar, G. and
Sivakumar, N. (2014). Microbial degradation of azo
dyes: a review. International Journal of Current
Microbiology and Applied Science 3(2): 670-690.
[32] Sweety, Vats, S., Kumar, M., Sharma, S., Kumar,
V., Garg, S. (2017). Mycoremediation of Textile
Dyes: Application of Novel Autochthonous Fungal
Isolates. Environment Asia. 10 (2), 147-161.
[33] Wang, H., Su J.Q., Zheng, X.W., Tian, Y., Xiong,
X.J., Zheng, T. L. (2009). Bacterial decolorization
and degradation of the reactive dye Reactive Red
180 by Citrobacter sp. CK3. International
Biodeterioration and Biodegradation 63:395-399.
[34] Yang, X.Q., Zhao, X.X., Liu, C.Y., Zheng, Y., Qian,
S.J. (2009). Decolorization of azo, triphenylmethane
and anthraquinone dyes by a newly isolated
Trametes sp. SQ01 and its laccase. Process
Biochemistry 4:1185-1189.
[35] Zhang, G., Guo, G., Hu, X. (2010). Deep RNA
sequencing at single base- pair resolution reveals
high complexity of the rice transcriptome. Genome
Research 20: 646-654.
[36] Zhang, H., Rogiers, P., Preiser, J. C., Spapen, H.,
Manikis, P., Metz, G., Vincent J. L. (1995). “Effects
of methylene blue on oxygen availability and
regional blood flow during endotoxic shock,”
Critical Care Medicine, 10: 1711-1721.

www.ijeab.com Page | 642