BIOF111;GENERAL BIOLOGY TOTAL MARKS: 90 (CLOSED BOOK) Duration: 90min

_____________________________________________________________________________

Q 1. (a) Draw graphs for enzymatic reactions depicting rate of reaction on the y axis and
(i) Temperature (range 30C to 120C) on the X axis for the enzyme Taq polymerase
(ii) pH (range 4 to 12) on the X axis for the enzyme amylase isolated from a bacteria growing in
the alkaline crater lake located at Lonar in Maharashtra where the water pH is around 9.
(iii) Substrate concentration on the X axis for the enzyme caseinase isolated from the garden
soil in our campus.
[6]

(b)

Identify the sequence of the coding strand for the given RNA:
3' GACUCAGACU 5'
3’ GACTCAGACT5’
How would the sequencing gel look like for this coding strand using Sanger’s method with dideoxy
NTPs. Show the diagram of the gel (as in the format given), mentioning the 5’ and the 3’ direction.
[2 + 6]
(c) One family consists of mom, dad and four children.
The parents have two children together, one child is
from the mother’s previous marriage, and the other
child is adopted. Based on the following DNA analysis
data can you identify (i) adopted child, (ii) child from
the mother’s previous marriage, and (iii) their own
children? [6]

(i) Child 1 is adopted, as DNA analysis does not

match both the father and the mother.
(ii) Child 3 is from mothers previous marriage as DNA analysis matches only the mother and not
the father.
(iii) Child 2 and 4 own children as DNA analysis matches both the father and the mother.

Q 2 (a) The two photosystems in plants yield an oxidant capable of cleaving water. How might the
subsequent evolution of cellular respiration have been different if the two photosystems had not
evolved and all photosynthetic organisms were restricted to cyclic photophosphorylation? Explain in
maximum of two sentences. [3]
There would be ATP synthesis through cyclic photophosphorylation, but no NADPH production.
Hence, there would be no splitting of water, and aerobic metabolism would not have evolved due to
absence of oxygen.

(b) E coli bacteria are being grown at 37C and have a plasma membrane comprising majorly of
phospholipids with saturated fatty acids. Shifting this organism to cooler temperature activates the
desaturase enzyme which is responsible for introduction of double bonds in fatty acids. Explain in
maximum two sentences the reason for the same. [3]
At cooler temperatures the presence of saturated fatty acids will result in loss of fluidity of the
membrane. In order to maintain fluidity, the membrane should contain unsaturated fatty acids
which introduce kink in the structure and hence are liquid at room temperature.

(c) Which plants minimize the oxygenase activity of rubisco by fixing CO2 into oxaloacetate?
[2]
C4 and CAM plants
Q 3 a) Name one appropriate polysaccharide found in the following: (i) Cotton fibre (ii) Peeled potato
(iii) Liver
(i)___Cellulose_____________ (ii)___Starch______________ (iii)___Glycogen_________________[3]

(b) Name

A B C

A_Glucose_________________, B__Galactose_________________, and C _____fructose___________

in the following figure. Identify the isomeric relation between them. A & B: _stereoisomer (epimer will
also be considered correct) A & C: ___structural isomer_(functional isomer will also be considered
correct) [5]

(c) Name all the sites/organelles which contain DNA in a plant cell? __Nucleus, Mitochondria,
chloroplast____which among them are believed to have evolved through endosymbiosis? __
Mitochondria, chloroplast___________________ [5]
(d) Name four cellular structures/organelles which are made up of microtubules. [4]
__cytoskeleton, spindle, flagella, cilia, centriole_______

(e) Which of the following is not produced by Golgi apparatus: glycolipids, glycoproteins, peroxisome,
secretory vescicles : ____ peroxisome ___________________________ [2]

Q 4 (a) Arrange the following sequences as per the order that they occur during translation [5]
I. The ribosome forms a peptide bond between the amino acid in the P site to the amino acid in the A
site
II. Translocation occurs
III. A charged tRNA with an anitocodon that matches the codon in the A site enters the ribosome
complex
IV. The release factors cause ribosome to detach from the protein.
V. The tRNA in the E site is ejected
Order: _III, I, II, V, IV______________________________

(b) The codon for methionine is 5’AUG3’, the anticodon is 5’CAU3’ and the DNA code is 5’ATG3’. [3]
(c) Shown below are the chemical structures of folic acid (left) and methotrexate (bottom) that bind to
Dihydrofolatereducatse (converts dihydrofolate to tetrahydrofolate). While folic acid is the natural
substrate for DHFR, methotrexate is an inhibitor and is used in treating cancer. Based on the given
structures, what is the type of enzyme inhibition by methotrexate? What would be the strategy to
overcome this inhibition? [4]

Folic acid
Competitive inhibition, Increase the substrate concentration___________________.

Q5 (a) Imagine yourself as an atom of hydrogen tied up in a molecule of glucose. You are taken up by
the muscle cell of a person who is jogging.
(i) What are the biochemical pathways that you would be part of as you move through the process of
aerobic cellular respiration ultimately contributing towards ATP generation through oxidative
phophorylation. [3]
___Glycolysis, Krebs cycle, Electron transport chain_____________________
(ii) Trace the cellular compartments/organelles that you will travel through [4]
___Cytoplasm- through mitochondrial membranes to mitochondrial matrix- through mitochondrial
inner membrane to inter membrane space- through ATP synthase to mitochondrial
matrix___________________________________________
(iii) What would be your fate if the muscle cell becomes devoid of oxygen. Will the consequence be the
same if the glucose were to be metabolized in the brain cells (devoid of oxygen) [4]
___End up in the molecule of lactate,
No, the brain cell will not be able to carry out anaerobic respiration and will
die___________________________________________________________
(iv) What is the net yield of the following if this glucose molecule were to get arrested at the stage of
Acetyl CoA during metabolism? [5]

_2___NADH (cytosolic); __2_____NADH (mitochondrial)____0_____FADH2; ____2_____ATP =

___10__ATP(net)

(b) In theory, a plant kept in total darkness could still manufacture glucose, if it were supplied with
which molecules?____________________ATP AND NADPH_______________________
[3]

Q 6 (a) Compare and contrast replication and transcription on the following: Cellular location,
template, bases, direction of synthesis, main enzyme, end product
[6]
Replication Transcription
Cellular location Nucleus Nucleus

Template Both strands of the DNA Template DNA strand

Bases involved dATP, dGTP, dCTP, dTTP

ATP, GTP, CTP, UTP
Direction of 5’ to 3’ 5’ to 3’
synthesis
Main enzyme DNA polymerase RNA polymersae

End product Double stranded DNA

Single stranded RNA
(b) (i) How many Amino Acids would the following sequences code for? ___5_______________
5’AUGAAAGCCGAAGAGUAGCGUGGCCCCUGA3’

(ii) What would be the consequence if the 16th base changed from U to C?___stop codon UAG will
change to codon CAG and amino acid synthesis will continue ______________________ (iii) What is
such a mutation known as? __________Point mutation_____________[2+2+2]