ESSENTIALS PROGRAMMING MATHEMATICA Exercises and Solutions PDF
ESSENTIALS PROGRAMMING MATHEMATICA Exercises and Solutions PDF
for
Essentials of Programming in
Mathematica®
PAUL WELLIN
1
Programming with Mathematica
3. Add the two lists, {1, 2, 3, 4, 5} and {2, 4, 6, 8, 10}. Then multiply them element-wise.
Finally, multiply the two lists as vectors (dot product).
4. Generate a list of the first twenty-five integers in five different ways.
5. Add the integers one through one thousand in as many different ways as you can.
6. A 2⨯2 matrix can be created using lists such as {{�, �}, {�, �}}. Define a 2⨯2 numerical
matrix and then find its inverse, determinant, transpose, and trace.
7. Create the following matrix using list notation:
1 1
1 0
Then find the inverse, determinant, and transpose of the matrix. Finally, compute the fifth
matrix power of this matrix (m.m.m.m.m).
1.2 Solutions
1. First, here is a random real number between one and one hundred.
In[1]:= RandomReal[{1, 100}]
Out[1]= 83.1802
2 Essentials of Programming in Mathematica
The dot product can be computed using either a built-in function or traditional mathematical
notation.
In[9]:= Dot[{1, 2, 3, 4, 5}, {2, 4, 6, 8, 10}]
Out[9]= 110
In[11]:= Range[25]
Out[11]= {1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25}
Here are two alternate syntaxes for the Range function, a prefix form and a postfix form:
In[12]:= Range @ 25
Out[12]= {1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25}
In[13]:= 25 // Range
Out[13]= {1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25}
Using Table:
In[14]:= Tablei, i, 1, 25
Out[14]= {1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25}
The coefficients of the linear term in the first 25 rows of the binomial expansion of (1 + x)n :
In[15]:= TableBinomial[n, 1], {n, 1, 25}
Out[15]= {1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25}
A very roundabout (and not terribly efficient) way to do this: get the coefficients of the follow-
ing series.
1
In[16]:= series = Series , {x, 0, 24}
(1 - x)2
Out[16]= 1 + 2 x + 3 x2 + 4 x3 + 5 x4 + 6 x5 + 7 x6 + 8 x7 + 9 x8 + 10 x9 +
11 x10 + 12 x11 + 13 x12 + 14 x13 + 15 x14 + 16 x15 + 17 x16 + 18 x17 +
19 x18 + 20 x19 + 21 x20 + 22 x21 + 23 x22 + 24 x23 + 25 x24 + O[x]25
In[17]:= CoefficientListNormalseries, x
Out[17]= {1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25}
5. Several mathematical functions are built in that will compute the sum directly.
In[18]:= Sumi, i, 103
Out[18]= 500 500
The same sum can be computed using familiar mathematical notation, templates for which are
available from the �������� menu.
4 Essentials of Programming in Mathematica
103
In[19]:= i
i
In fact the sum can be done in parallel (assuming you are working on a multi-core machine) by
using a parallelized version of Sum.
In[20]:= ParallelSumi, i, 103
Out[20]= 500 500
If you are already acquainted with an imperative style of programming, such as is found in
procedural languages like C, Fortran, and Java, then the following looping constructs should
be familiar.
In[21]:= i = 0;
Doi = i + j, j, 103 ;
i
Out[23]= 500 500
In[24]:= res = 0;
i = 0;
Fori = 1, i ≤ 103 , i ++, res = i + res;
res
Out[27]= 500 500
In[28]:= res = 0;
i = 0;
Whilei ≤ 103 , res = i + res; i ++;
res
Out[31]= 500 500
In[35]:= LastAccumulatelis
Out[35]= 500 500
In[36]:= Totallis
Out[36]= 500 500
Other approaches can be considered as well, including a recursive approach (Prolog, Haskell or
Scheme), one using replacement rules, and another using sparse array arithmetic.
In[37]:= s[0] = 0;
s[n_] := s[n ] = s[n - 1] + n
In[39]:= s[1000]
Out[39]= 500 500
One approach to computing the sum of the first n integers is to use the fact (known to Gauss at
n+1
a young age) that the sum is equal to the binomial .
2
In[43]:= n = 103 ;
Binomial[n + 1, 2]
Out[44]= 500 500
Although all of these approaches give the same answer (they had better!), some are more
efficient in terms of memory management and some are faster than others. We don’t expect
that these examples will all make sense to you at this point but after having read this book, you
should be quite comfortable with each of these paradigms so that you can apply them to a wide
variety of problems and choose the best approach for the programming problems you will
encounter.
6. Here is a 2⨯2 matrix filled with numbers.
In[45]:= mat = {{3, 5}, {1, 2}};
And here are the operations on that matrix.
In[46]:= Inverse[mat]
Out[46]= {{2, -5}, {-1, 3}}
In[47]:= Det[mat]
Out[47]= 1
6 Essentials of Programming in Mathematica
In[48]:= Transpose[mat]
Out[48]= {{3, 1}, {5, 2}}
In[49]:= Tr[mat]
Out[49]= 5
7. Here is the list representation of the matrix given in the exercise.
In[50]:= mat = {{1, 1}, {1, 0}};
Here are the inverse, determinant, and transpose.
In[51]:= Inverse[mat]
Out[51]= {{0, 1}, {1, -1}}
In[52]:= Det[mat]
Out[52]= -1
In[53]:= Transpose[mat]
Out[53]= {{1, 1}, {1, 0}}
But that is tedious and wouldn’t be sensible for the 100th power say. Another built-in function
can be used for the matrix power. You should see the Fibonacci numbers lurking in the output,
a fact which is explored in Section 5.4.
In[55]:= MatrixPower[mat, 5]
Out[55]= {{8, 5}, {5, 3}}
In[57]:= Fibonacci[101]
Out[57]= 573 147 844 013 817 084 101
12
In[2]:= FullForm
4
Out[2]//FullForm= 3
8. Modify the code for the one-dimensional random walk in this section to create two-dimen-
sional random walks. In this case the step directions will be the vectors pointing in the com-
pass directions, {0, 1}, {0, -1}, {1, 0}, and {-1, 0}.
2.1 Solutions
1. The functions AtomQ, Head, and FullForm will help answer these questions.
a. The fraction 8 / 5 is atomic with head Rational.
In[1]:= AtomQ[8 / 5], Head[8 / 5]
Out[1]= {True, Rational}
c. The list {{a, b}, {c, d}} is not atomic. It has head List.
In[3]:= AtomQa, b, c, d, Heada, b, c, d
Out[3]= {False, List}
In[7]:= FullForm[expr]
Out[7]//FullForm= Plus[c, Times[b, x], Times[a, Power[x, 2]]]
In[8]:= expr[[2]]
Out[8]= bx
x2 + y z
In[11]:= [[2, 1, 2]]
w
Out[11]= 2
b. From the FullForm of a / b, you can see that the second part is Power[b, -1] and the
second part of that is -1. Note the need for parentheses here as the Part function has higher
precedence than Power. For more information on operator precedence, see the tutorial
Operator Input Forms (WLDC)
In[12]:= FullForma b
Out[12]//FullForm= Times[a, Power[b, -1]]
7. Mathematica evaluates arguments to functions before passing them up to the calling function. So
the fraction first evaluates to 3 and the head of 3 is of course Integer. To get the internal
representation of the expression before it is evaluated, use Defer.
In[17]:= DeferFullForm[12 / 4]
Out[17]= Times[12, Power[4, -1]]
8. The directions are the two-dimensional lists that can be thought of as vectors pointing in the
compass directions north, south, east, and west.
In[18]:= dirs = {{0, 1}, {0, -1}, {1, 0}, {-1, 0}};
This picks a direction at random.
In[19]:= RandomChoicedirs
Out[19]= {1, 0}
Here are the running sums, just like in the one-dimensional case.
In[21]:= Accumulate[%]
Out[21]= {{1, 0}, {1, 1}, {1, 2}, {0, 2}, {0, 1}}
And here is the nested code to create a 25 000-step two-dimensional random walk.
In[22]:= ListLinePlotAccumulateRandomChoicedirs, 25 000, PlotStyle → Thin
-20 20 40 60
-50
Out[22]=
-100
-150
4. Use NumberForm to display an approximate number with exactly four precise digits and three
digits to the right of the decimal. Then use PaddedForm to display the numbers in the following
vector with precisely two digits to the right of the decimal:
In[2]:= ToCharacterCode"A"
Out[2]= {65}
The eight-bit binary representation of 65 is 1000001, so your solution should return that base 2
number for the letter A. Binary representations of letters are used in certain ciphers such as the
XOR cipher discussed in Exercise 5 of Section 7.1.
7. Graphs consist of a set of vertices and edges connecting some subset of those vertices. They are
implemented in Mathematica with Graph, which takes two arguments: a list of vertices and a list
n
of edges. Create a random graph on n vertices by choosing m edges from the possible
2
edges. Such random graphs are commonly specified as G(n, m) and are essentially the model
upon which the built-in RandomGraph is based.
8. Extract the first 5000 digits in the decimal expansion of 1/17 or any other rational number.
Then play them using ListPlay, which emits sound whose amplitude is given by the sequence
of digits. Compare with the first 5000 digits of π.
9. RandomReal by default outputs numbers uniformly distributed on the interval [0, 1].
400
300
Out[4]=
200
100
0
0.2 0.4 0.6 0.8 1.0
Bias the list of random numbers toward the lower end of this interval, giving a histogram
similar to those in Figure 2.1.
12 Essentials of Programming in Mathematica
Figure 2.1. Distributions of random number data biased toward the lower end of the interval [0, 1].
3000
2500 2000
2000 1500
1500
1000
1000
500
500
0 0
0.2 0.4 0.6 0.8 1.0 0.2 0.4 0.6 0.8 1.0
10. Information theory, as conceived by Claude Shannon in the 1940s and 1950s, was originally
interested in maximizing the amount of data that can be stored and retrieved over some
channel such as a telephone line. Shannon devised a measure, now called entropy, that gives the
theoretical maxima for such a signal. Entropy can be thought of as the average uncertainty of a
single random variable and is computed by the following, where p(x) is the probability of event
x over a domain X:
RandomVariateBernoulliDistribution[�], �
2.2 Solutions
1. The expression 2 + π is certainly numeric as both 2 and π are numeric.
In[1]:= NumericQ[2 + π]
Out[1]= True
In[6]:= complexToPolar[3 + 3 ⅈ]
π
Out[6]= 3 2 ,
4
Check against a built-in function (introduced in Mathematica 10.1):
In[7]:= AbsArg[3 + 3 ⅈ]
π
Out[7]= 3 2 ,
4
πⅈ
In[8]:= complexToPolarⅇ 3
π
Out[8]= 1,
3
πⅈ
In[9]:= AbsArgⅇ 3
π
Out[9]= 1,
3
4. Here is an approximation of π to 20-digit precision.
In[10]:= pi = N[π, 20]
Out[10]= 3.1415926535897932385
Display four precise digits with three digits to the right of the decimal point.
In[11]:= NumberFormpi, {4, 3}
Out[11]//NumberForm=
3.142
For the second part of the exercise, here is a vector of machine precision numbers.
In[12]:= vec = RandomReal[{0, 1}, 8]
Out[12]= {0.650946, 0.238017, 0.664332, 0.840782, 0.211514, 0.0455802, 0.612099, 0.228518}
This forces the display to use three digits in total with two digits to the right of the decimal.
In[13]:= PaddedForm[vec, {3, 2}]
Out[13]//PaddedForm=
What is returned is a list with the digits first, followed by the exponent, 1. We are only interested
in the first sublist, so use First.
14 Essentials of Programming in Mathematica
In[15]:= First[%]
Out[15]= {3, 1, 4, 1, 5, 9, 2, 6, 5, 3, 5, 8, 9, 7, 9, 3}
Here then, is a list of the first 100 000 digits of π, suppressing the display of the output using the
semicolon.
In[16]:= pidigs = FirstRealDigitsNπ, 105 ;
This histogram shows that each of the digits zero through nine appear with about the same
frequency. This is referred to as the normality of the digits of π (see Bailey et al. 2012).
In[17]:= Histogrampidigs
10 000
8000
6000
Out[17]=
4000
2000
0
0 2 4 6 8 10
6. First, here are the character codes of the letters in our test string, “Apple”.
In[18]:= ToCharacterCode"Apple"
Out[18]= {65, 112, 112, 108, 101}
Here are the base two representation of each of the above character codes.
In[19]:= IntegerDigits[%, 2]
Out[19]= {{1, 0, 0, 0, 0, 0, 1}, {1, 1, 1, 0, 0, 0, 0},
{1, 1, 1, 0, 0, 0, 0}, {1, 1, 0, 1, 1, 0, 0}, {1, 1, 0, 0, 1, 0, 1}}
Because the numbers are less than 128, the base two representation only have seven bits. To get
the eight-bit representations, use a third argument to IntegerDigits.
In[20]:= IntegerDigitsToCharacterCode"Apple", 2, 8
Out[20]= {{0, 1, 0, 0, 0, 0, 0, 1}, {0, 1, 1, 1, 0, 0, 0, 0},
{0, 1, 1, 1, 0, 0, 0, 0}, {0, 1, 1, 0, 1, 1, 0, 0}, {0, 1, 1, 0, 0, 1, 0, 1}}
7. The built-in Graph function takes two arguments: a list of the vertex indices and a list of the
edges. For a graph with n vertices, the vertex indices are simply the list of the integers one
through n.
In[21]:= n = 5;
vertices = Range[5]
Out[22]= {1, 2, 3, 4, 5}
For the edges, we need a list of all possible edges in a graph with n vertices. CompleteGraph[�]
2.2 Numbers: exercises 15
is a graph with all possible edges on n vertices so we can borrow that list from CompleteGraph.
In[23]:= edgesCG = EdgeListCompleteGraph[n]
Out[23]= {1 2, 1 3, 1 4, 1 5, 2 3, 2 4, 2 5, 3 4, 3 5, 4 5}
To avoid multi-edges, use RandomSample which chooses without replacement. But you will
n
need to keep the desired number of edges, m, smaller than .
2
In[25]:= RandomSampleedgesCG, 8
Out[25]= {1 5, 3 4, 2 3, 1 2, 2 4, 2 5, 1 3, 3 5}
This puts the pieces together and scales it up a bit. Repeated evaluation will cause different
random graphs to be displayed, all with n vertices and m edges.
In[26]:= n = 13;
m = 15;
GraphRange[n], RandomSampleEdgeListCompleteGraph[n], m
Out[28]=
Also note that because we have used CompleteGraph, there are no self-edges, that is, an edge
from a vertex to itself.
16 Essentials of Programming in Mathematica
In[29]:= n = 21;
m = 167;
GraphRange[n], RandomSampleEdgeListCompleteGraph[n], m
Out[31]=
The built-in RandomGraph constructs only simple graphs – no multi-edges and no self loops,
n
hence the total possible number of edges cannot exceed .
2
In[33]:= Binomial[21, 2]
Out[33]= 210
8. First, note that RealDigits returns a list with two elements, the digits and the exponent, in this
case indicating that the first digit starts one place to the right of the decimal point.
In[34]:= RealDigits[N[1 / 17, 20]]
Out[34]= {{5, 8, 8, 2, 3, 5, 2, 9, 4, 1, 1, 7, 6, 4, 7, 0, 5, 8, 8, 2}, -1}
Out[37]=
���� � | ���� ��
2.2 Numbers: exercises 17
9. There are several ways that the random number sequences can be biased. First look at a picture
of unbiased data. The random number generator uses a uniform probability distribution by
default so we expect to see numbers uniformly distributed across the interval [0, 1].
In[38]:= data = RandomReal{0, 1}, 104 ;
One way to bias the numbers toward zero is to transform them in such a way that they bunch
around zero. Since these numbers are all less than one, raising them to a power will make them
smaller.
In[40]:= Histogramdata1.5 , 10, ImageSize → 160, Histogramdata2 , 10, ImageSize → 160
2000 3000
2500
1500
2000
Out[40]= 1000 , 1500
1000
500
500
0 0
0.2 0.4 0.6 0.8 1.0 0.2 0.4 0.6 0.8 1.0
In Chapters 3 and 9 we discuss listability, which will explain why we can raise every element in
a vector to a power using the syntax above.
1.5
In[43]:= a, b, c, d, e
Out[43]= a1.5 , b1.5 , c1.5 , d1.5 , e1.5
10. Run 10 000 trials with a range of probabilities from zero to one in increments of .001. The
table creates pairs consisting of p together with the entropy (in base 2) for each trial.
In[44]:= trials = 10 000;
incr = 0.001;
info = Tablep, Entropy2, RandomVariateBernoulliDistribution[p], trials,
p, 0, 1, incr;
18 Essentials of Programming in Mathematica
Make a plot.
In[47]:= ListPlotinfo, AspectRatio → 1, GridLines → Automatic
1.0
0.8
0.6
Out[47]=
0.4
0.2
In[3]:= f[2]
(1 + x) -1 + (1 + x)2
Out[3]=
x
In[4]:= g[2]
Out[4]= 1 + x + (1 + x)2
7. Write rules for a function log (note lowercase) that encapsulate the following identities:
2
g (x) = - 1 - (x + 2) -2 ≤ x ≤ - 1
1 - x2 x<0
9. The built-in function RotateRight rotates the elements in a list one place to the right, with the
last element swinging around to the front.
2.3 Solutions
1. Note that simply giving the reciprocal on the right-hand side does not work.
In[1]:= reciprocala_ b_ := b a
In[2]:= reciprocal[3 / 4]
4
Out[2]=
3
Look at the internal form to see why the pattern matcher failed to match 3/4 with a_ / b_.
In[3]:= FullForm[3 / 4]
Out[3]//FullForm= Rational[3, 4]
In[10]:= sumInts[100]
Out[10]= 5050
In[11]:= sumInts[1000]
Out[11]= 500 500
2.3 Definitions: exercises 21
We have not been careful to check that the arguments are positive integers here. See Section 4.1
for a discussion of patterns used to perform argument checking on your functions.
3. Once you have a list of the digits in any integer (IntegerDigits), simply total the list.
In[12]:= DigitSum[n_] := TotalIntegerDigits[n ]
In[13]:= DigitSum[10 !]
Out[13]= 27
One rule can cover both parts of this exercise, using a default value of 10 for the base (see
Section 5.4 for a discussion of default values).
In[14]:= DigitSumn_, base_: 10 := TotalIntegerDigitsn , base
The Hamming weight of a number is the number of ones in its binary representation.
In[15]:= DigitSum231 - 1, 2
Out[15]= 31
In[18]:= sumsOfCubes[124]
Out[18]= 73
5. This exercise focuses on the difference between immediate and delayed assignments.
a. This will generate a list of n random numbers.
In[19]:= randLis1[n_] := RandomReal[1, {n }]
In[20]:= randLis1[3]
Out[20]= {0.726437, 0.820623, 0.349356}
b. Since the definition for x is an immediate assignment, its value does not change in Table.
But each time randLis2 is called, a new value is assigned to x.
In[21]:= randLis2[n_] := x = RandomReal[]; Table[x, {n }]
In[22]:= randLis2[3]
Out[22]= {0.974798, 0.974798, 0.974798}
In[23]:= randLis2[3]
Out[23]= {0.621851, 0.621851, 0.621851}
22 Essentials of Programming in Mathematica
c. Because the definition for x is a delayed assignment, the definition for randLis3 is function-
ally equivalent to randLis1.
In[24]:= randLis3[n_] := x := RandomReal[]; Table[x, {n }]
In[25]:= randLis3[3]
Out[25]= {0.412708, 0.253301, 0.361384}
d. In an immediate assignment, the right-hand side of the definition is evaluated first. But in
this case, n does not have a value, so Table is not able to evaluate properly.
In[26]:= randLis4[n_] = TableRandomReal[], {n}
Out[26]= {0.138356, 0.374127, 0.873417, 0.769375, 0.0394529, 0.983081, 0.160601,
0.982007, 0.191435, 0.744383, 0.761298, 0.311281, 0.461935, 0.525905,
0.921668, 0.41622, 0.442365, 0.389952, 0.171867, 0.992726, 0.406445}
In[27]:= Clear[x, n]
6. The definition for f given in the exercise evaluates the sum first (immediate assignment), giving
a symbolic expression for the general sum from 1 to n. When f[2] is evaluated, the argument 2
is then substituted into this expression for n. In the case of g, the value of n is substituted and
then the sum is evaluated. Although the resulting expressions output by these two functions
look different at first, expanding them gives the same result.
In[28]:= f[n_] = Sum(1 + x)j , j, 1, n
(1 + x) (-1 + (1 + x)n )
Out[28]=
x
In[29]:= g[n_] := Sum(1 + x)j , j, 1, n
In[30]:= Expandf[2]
Out[30]= 2 + 3 x + x2
In[31]:= Expand[g[2]]
Out[31]= 2 + 3 x + x2
7. The rules for the logarithm function are as follows. Note, there is no need to program the
division rule separately. Do you see why? (Look at FullForm[x / y].)
In[32]:= loga_ * b_ := log[a ] + logb
In[34]:= logx y2 z3
Out[34]= log[x] + 2 log[y] + 3 log[z]
In[35]:= log[x / y]
Out[35]= log[x] - log[y]
8. Using Piecewise, we have:
2.3 Definitions: exercises 23
0.5
Out[37]=
-2.0 -1.5 -1.0 -0.5
-0.5
-1.0
Here are all the integers less than one million that satisfy this property; most are palindromes
(see Chapter 5 for discussion of Select and also pure functions).
24 Essentials of Programming in Mathematica
In[46]:= IntegerDigits[%]
Out[46]= {{2}, {3}, {5}, {7}, {1, 1}, {1, 3}, {1, 7}, {1, 9}, {2, 3}, {2, 9}}
(As an aside, the above works because IntegerDigits is listable and hence automatically maps
across lists.)
Next, flatten the output from IntegerDigits and turn that list into a number using
FromDigits.
In[47]:= Flatten[%]
Out[47]= {2, 3, 5, 7, 1, 1, 1, 3, 1, 7, 1, 9, 2, 3, 2, 9}
In[48]:= FromDigits[%]
Out[48]= 2 357 111 317 192 329
In[52]:= SmarandacheWellin[1429] // N
Out[52]= 2.357111317192329 × 105718
In[53]:= PrimeQSmarandacheWellin[1429]
Out[53]= True
In Section 7.2 we will look at an alternative approach to constructing these numbers using
string functions.
n(n+1) n+1
Tn = ∑nk=1 k = 1 +2 +3 +⋯ +n = =
2 2
6. Based on the solution to the two previous exercises, create a predicate function
SquareTriangularNumberQ[�] that returns a value of True if n is both a square number and a
triangular number. Then use this predicate to find all square triangular numbers less than one
million.
7. Create a predicate function RealPositiveQ[�] that returns a value of True if x is a positive
real number (“real” in the mathematical sense, i.e., x ∈ ). Add a second rule that accepts
vectors as arguments and returns True if every element of the vector argument is a positive real
number.
8. The built-in function CoprimeQ[�, �] returns True if a and b are relatively prime (share no
common factors other than 1) and returns False otherwise. Use ArrayPlot to visualize pairs
of relatively prime numbers from 1 to 100. Use Boole to convert the table of True/False values
returned by CoPrimeQ to zeros and ones.
26 Essentials of Programming in Mathematica
9. An undirected graph gr is considered dense if the number of edges in gr is close to the maximum
number of edges. The maximum for a graph with n edges occurs when every pair of vertices is
connected by an edge and, assuming no self-loops and no multi-edges, is given by the number
n
of two-element subsets of n objects, . The density of a graph can be defined as
2
E
=
V ( V - 1)
where E is the number of edges and V is the number of vertices (given by EdgeCount and
VertexCount, respectively). A graph with all possible edges has a density of 1 and a graph with
no edges has density 0. Although there are differences of opinion as to where the cutoff is,
assume that a graph is dense if its density is greater than or equal to 0.5.
Define a function DenseGraphQ[��] that returns a value of True if gr is dense in the above
sense and returns a value of False otherwise. As tests, DenseGraphQ should give True for
CompleteGraph[�] for any n and it should return False for
RandomGraph[BernoulliGraphDistribution[�, ��]] for small probabilities pr.
2.4 Solutions
1. There are several ways to define this function, either using the relational operator for less than,
or with the absolute value function.
In[1]:= f[x_] := -1 < x < 1
In[3]:= f[4]
Out[3]= False
In[4]:= f[-0.35]
Out[4]= True
2. The requirements here are that the argument be both a string (StringQ) and have length
(StringLength) one.
In[5]:= StringCharacterQch_ := StringQch && StringLengthch ⩵ 1
In[6]:= StringCharacterQ"v"
Out[6]= True
In[7]:= StringCharacterQ"vi"
Out[7]= False
In[8]:= StringCharacterQ[v]
Out[8]= False
2.4 Predicates and Boolean operations: exercises 27
3. A number n can be considered a natural number if it is both an integer and greater than or equal
to zero. There is some historical precedent for not including zero, but most mathematicians and
computer scientists now include it and so for our purposes, we will adopt the convention that
zero is a natural number.
In[9]:= NaturalQ[n_] := IntegerQ[n ] && n ≥ 0
In[10]:= NaturalQ[0]
Out[10]= True
In[11]:= NaturalQ[-4]
Out[11]= False
4. To check that a number is a perfect square, it is sufficient to see if its square root is an integer.
In[12]:= SquareNumberQ[n_] := IntegerQ n
In[13]:= SquareNumberQ[10]
Out[13]= False
So, T is triangular if and only if 8 T + 1 is an odd perfect square. Here then is the test.
In[16]:= TriangularNumberQ[6]
Out[16]= True
In[17]:= TriangularNumberQ[55]
Out[17]= True
In[18]:= TriangularNumberQ[56]
Out[18]= False
6. Combine the previous two solutions with a conjunction.
In[19]:= SquareTriangularNumberQ[n_] := TriangularNumberQ[n ] && SquareNumberQ[n ]
28 Essentials of Programming in Mathematica
Now, add a rule that checks if a vector consists entirely of numbers that are real and positive.
AllTrue[����, ����] applies the test to each of the elements in expr and returns True if all of
them are true.
In[23]:= RealPositiveQvec_ ? VectorQ := AllTruevec , RealPositiveQ
Actually we can make this code a bit more compact by using the two-argument form of
VectorQ. The second argument is a predicate that tests each element of the vector calling the
one argument form of RealPositiveQ.
In[25]:= ClearRealPositiveQ;
RealPositiveQn_ ? NumericQ := Im[n ] ⩵ 0 && Positive[n ]
Out[28]=
9. Given the definition of graph density in the exercise, here is an implementation that takes a
graph as an argument.
In[29]:= DenseGraphQgr_Graph :=
2 EdgeCount[gr ] (VertexCount[gr ] (VertexCount[gr ] - 1)) ≥ 0.5
2.5 Attributes: exercises 29
Out[30]=
In[31]:= DenseGraphQ[gr]
Out[31]= False
Out[32]=
In[33]:= DenseGraphQ[%]
Out[33]= True
In[35]:= GraphDensity[gr]
9
Out[35]=
19
So an simpler definition would just use that.
In[36]:= DenseGraphQgr_Graph := GraphDensity[gr ] ≥ 0.5
In[2]:= g[2 + 3]
Out[2]= g[5]
Use one of the Hold attributes to give g the property that its argument is not evaluated first.
The resulting output should look like this:
In[3]:= g[2 + 3]
Out[3]= 13
2. Define a function that takes each number, x, in a vector of numbers and returns x if it is within
a certain interval, say -0.5 < x < 0.5, and returns x otherwise. Then make your function
listable so that it can operate on vectors (lists) directly.
3. The definitions used in the solution to Exercise 1 of Section 2.3 for the reciprocal function
failed to properly deal with the special case of zero in the numerator.
In[5]:= reciprocal[0 / 5]
Out[5]= reciprocal[0]
Correct this problem by giving reciprocal the appropriate attribute.
2.5 Solutions
1. First clear any definitions and attributes that might be associated with g.
In[1]:= ClearAll[g]
Then set the HoldAll attribute to prevent initial evaluation of the argument of this function.
In[2]:= SetAttributesg, HoldAll
In[4]:= ga + b
Out[4]= a2 + b2
In[5]:= g[2 + 3]
Out[5]= 13
2. Here is a small list of random numbers to use.
In[6]:= vec = RandomReal[{-1, 1}, 10]
Out[6]= {-0.798986, -0.84542, -0.747004, -0.44054, 0.117601,
-0.243944, -0.227587, 0.994751, -0.107316, 0.692977}
The function could be set up to take two arguments, the number and the bound.
In[11]:= reciprocal[0 / 5]
1
Power::infy : In�nite expression encountered.
0
Out[11]= ComplexInfinity
Give it the HoldAll attribute to prevent fractions such from first evaluating and being reduced.
In[12]:= SetAttributesreciprocal, HoldAll
In[14]:= reciprocal[0 / 5]
1
Power::infy : In�nite expression encountered.
0
Out[14]= ComplexInfinity
We have resolved one problem, but a new one arises. The unevaluated form of 0 / 5 is in fact
not a Rational. It will become Rational once it is evaluated.
In[15]:= FullFormHoldForm[0 / 5]
Out[15]//FullForm= HoldForm[Times[0, Power[5, -1]]]
In[17]:= reciprocal[0 / 5]
1
Power::infy : In�nite expression encountered.
0
Out[17]= ComplexInfinity
In[18]:= reciprocal[2 / 3]
3
Out[18]=
2
In fact, this last rule now handles more complicated rational expressions such as the following.
32 Essentials of Programming in Mathematica
In[1]:= Arrayf, 5
Out[1]= f[1], f[2], f[3], f[4], f[5]
{{1, 2, 3, 4}, {5, 6, 7, 8}, {9, 10, 11, 12}, {13, 14, 15, 16}}
In matrix form, this would be:
1 2 3 4
5 6 7 8
9 10 11 12
13 14 15 16
34 Essentials of Programming in Mathematica
6. Using Table, create a symmetric matrix of the binomial coefficients for any n similar to that in
Table 3.1.
Table 3.1. ��������������������� = 5
1 1 1 1 1
1 2 3 4 5
1 3 6 10 15
1 4 10 20 35
1 5 15 35 70
7. Given an m⨯m square lattice like the grid graph below, color all vertices on the bottom red, and
on the top white. Your solution should be as general as possible, so that changing the size of
the lattice (changing the value of m) will still work to color the lattice.
In[3]:= m = 5;
GridGraph{m, m}, VertexLabels → "Name"
5 10 15 20 25
4 9 14 19 24
3 8 13 18 23
Out[4]=
2 7 12 17 22
1 6 11 16 21
To change the property of select vertices in a graph, use HighlightGraph. For example, the
following colors vertices 1, 13, and 25 red.
In[5]:= HighlightGraph
GridGraph{m, m}, VertexLabels → "Name",
Style{1, 13, 25}, Red, VertexSize → Medium
5 10 15 20 25
4 9 14 19 24
3 8 13 18 23
Out[5]=
2 7 12 17 22
1 6 11 16 21
8. Import six images, resize them to the same dimensions, then display them inside a 3⨯2 grid
using options for Grid to format the output.
9. Construct an integer lattice graphic like in Figure 3.1. Start by creating a list of the pairs of
coordinate points. Then connect the appropriate pairs of coordinates with lines (use
Graphics[Line[…]]). Add points with Graphics[Point[…]]. See Chapter 8 for details
about creating plots from graphics primitives. Consider the function CoordinateBoundsArray
to get the list of integer coordinates.
3.1 Creating and displaying lists: exercises 35
3.1 Solutions
1. Using Table, here are the multiples of 5.
In[1]:= Table5 j, j, 1, 100 / 5
Out[1]= {5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100}
But in fact, a more direct implementation using the statement of the problem, gives the
following:
In[11]:= n = 4;
Tablej + k n, k, 0, n - 1, j, 1, n
Out[12]= {{1, 2, 3, 4}, {5, 6, 7, 8}, {9, 10, 11, 12}, {13, 14, 15, 16}}
In[13]:= MatrixForm[%]
Out[13]//MatrixForm=
1 2 3 4
5 6 7 8
9 10 11 12
13 14 15 16
6. The binomial coefficients can be generated with Binomial. For example here are the coeffi-
cients in the expansion of (1 + x)5 :
In[14]:= TableBinomial5, k, k, 0, 5
Out[14]= {1, 5, 10, 10, 5, 1}
So to get all coefficients for exponent n, as n runs from one to six say, we need a second iterator
for Table. A bit of thought is needed to determine which iterator list comes first and to make j
dependent upon n.
In[16]:= n = 6;
TableBinomialj, i, i, 0, n - 1, j, i, n + i - 1
Out[17]= {{1, 1, 1, 1, 1, 1}, {1, 2, 3, 4, 5, 6}, {1, 3, 6, 10, 15, 21},
{1, 4, 10, 20, 35, 56}, {1, 5, 15, 35, 70, 126}, {1, 6, 21, 56, 126, 252}}
In[18]:= MatrixForm[%]
Out[18]//MatrixForm=
1 1 1 1 1 1
1 2 3 4 5 6
1 3 6 10 15 21
1 4 10 20 35 56
1 5 15 35 70 126
1 6 21 56 126 252
3.1 Creating and displaying lists: exercises 37
5 10 15 20 25
4 9 14 19 24
3 8 13 18 23
Out[20]=
2 7 12 17 22
1 6 11 16 21
Since this is a square grid, the vertex numbers on the top of the lattice are multiples of m up to
m2 .
In[21]:= top = Rangem, m2 , m
Out[21]= {5, 10, 15, 20, 25}
5 10 15 20 25
4 9 14 19 24
3 8 13 18 23
Out[23]=
2 7 12 17 22
1 6 11 16 21
Changing the size of the lattice should not trigger a need to change the code.
38 Essentials of Programming in Mathematica
In[24]:= m = 7;
top = Rangem, m2 , m;
bot = Range1, m2 - m + 1, m;
HighlightGraphGridGraph{m, m}, VertexLabels → "Name",
Stylebot, Red, Styletop, White
7 14 21 28 35 42 49
6 13 20 27 34 41 48
5 12 19 26 33 40 47
4 11 18 25 32 39 46
Out[27]=
3 10 17 24 31 38 45
2 9 16 23 30 37 44
1 8 15 22 29 36 43
In[36]:= Grid
img1, img2, img3,
img4, img5, img6
, Frame → All, Spacings → {1, 1}, ItemSize → {3, 3}
Out[36]=
Join the two sets of lines and then flatten to remove one set of braces.
In[40]:= pairs = Flattenhlines, vlines, 1
Out[40]= {{{-2, -1}, {2, -1}}, {{-2, 0}, {2, 0}},
{{-2, 1}, {2, 1}}, {{-2, -1}, {-2, 1}}, {{-1, -1}, {-1, 1}},
{{0, -1}, {0, 1}}, {{1, -1}, {1, 1}}, {{2, -1}, {2, 1}}}
In[41]:= GraphicsLinepairs
Out[41]=
Actually, this can be done more compactly. First create the coordinate points for a 5 ⨯3 lattice.
In[42]:= coords = Tablei, j, i, 1, 5, j, 1, 3
Out[42]= {{{1, 1}, {1, 2}, {1, 3}}, {{2, 1}, {2, 2}, {2, 3}},
{{3, 1}, {3, 2}, {3, 3}}, {{4, 1}, {4, 2}, {4, 3}}, {{5, 1}, {5, 2}, {5, 3}}}
In[43]:= GraphicsLinecoords
Out[43]=
Transposing the coordinates gives a list that can be used for the horizontal lines. Look carefully
at the structure of coords to understand what exactly is being transposed.
In[44]:= Transpose @ coords
Out[44]= {{{1, 1}, {2, 1}, {3, 1}, {4, 1}, {5, 1}},
{{1, 2}, {2, 2}, {3, 2}, {4, 2}, {5, 2}},
{{1, 3}, {2, 3}, {3, 3}, {4, 3}, {5, 3}}}
Out[45]=
This puts everything together, adding points at each coordinate. Module is a localization
construct, discussed in Section 6.1.
In[46]:= Latticexdim_, ydim_ := Modulecoords,
coords = Tablei, j, i, 1, xdim , j, 1, ydim ;
Graphics
Linecoords, LineTransposecoords,
PointSizeMedium, PointFlattencoords, 1
Out[47]=
In[48]:= ? CoordinateBoundsArray
This gives five triples of coordinates and if you look carefully, these can be used to get the
vertical lines.
In[50]:= Dimensionscoords
Out[50]= {5, 3, 2}
In[51]:= GraphicsLinecoords
Out[51]=
The horizontal lines can be obtained by transposing the coordinates returned by Coordi
nateBoundsArray.
In[52]:= Transposecoords
Out[52]= {{{1, 1}, {2, 1}, {3, 1}, {4, 1}, {5, 1}},
{{1, 2}, {2, 2}, {3, 2}, {4, 2}, {5, 2}},
{{1, 3}, {2, 3}, {3, 3}, {4, 3}, {5, 3}}}
42 Essentials of Programming in Mathematica
Out[53]=
Out[55]=
3.2 Solutions
1. The following list has length four because it has four elements, the four pairs.
In[1]:= lis = a, b, c, d, e, f, g, h;
In[2]:= Lengthlis
Out[2]= 4
Its dimensions are 4⨯2; that is, it has four rows and two columns when thought of as a rectangu-
lar array.
In[3]:= Dimensionslis
Out[3]= {4, 2}
In[4]:= MatrixFormlis
a b
c d
Out[4]//MatrixForm=
e f
g h
The element g is in the fourth row first column.
In[5]:= Positionlis, g
Out[5]= {{4, 1}}
2. Each time your evaluate the following input you will get a different list of 10 000 zeros and
ones. Seeding the random number generator will give repeatable results.
In[6]:= SeedRandom[1];
lis = RandomChoice[{.0001, .9999} → {0, 1}, {10 000}];
On the computer on which this was run, this seed gives some zeros in the list.
In[8]:= FreeQlis, 0
Out[8]= False
In[9]:= Countlis, 0
Out[9]= 2
3. Here is the list of integers to use.
In[10]:= ints = RandomInteger[{-5, 5}, 30]
Out[10]= {0, 2, 5, -4, 3, -2, 5, -4, 1, -5, -5, 3, -3, -3,
-4, -2, -2, -4, 2, -5, -2, -5, 1, 4, 4, -4, 1, 0, -2, 2}
Extract and Position work well together. The positions given by Position can be given
directly to Extract to get those elements in ints that are specified by the positions in
Position.
In[17]:= Extractints, pos
Out[17]= {4 302 407 713}
In[18]:= PrimeQ[%]
Out[18]= {True}
2. Use the Part function to extract the elements of a list that are in the even-indexed positions. So
in the list below, the even-indexed elements are {3, 8, 3, 4, 2, 13}. Then extract all those ele-
ments in the odd-indexed positions.
8. Make a histogram of the frequencies of the leading digit in the first 10 000 Fibonacci numbers.
The resulting distribution is an instance of Benford’s law, which concerns the frequency of the
leading digits in many kinds of data. The phenomenon, whereby a 1 occurs about 30% of the
time, a 2 occurs about 17.6% of the time, and so on, has been shown to occur in well-known
numerical sequences, population counts, death rates, Fibonacci numbers, and has even been
used to detect corporate and tax fraud.
46 Essentials of Programming in Mathematica
9. Given a matrix, use list component assignment to swap any two rows.
10. Create a function AddColumn[���, ���, ���] that inserts a column vector col into the matrix
mat at the column position given by pos. For example:
+ + =
3.3 Solutions
1. This is a straightforward use of the Transpose function.
In[1]:= Transpose[{{x1 , y1 }, {x2 , y2 }, {x3 , y3 }, {x4 , y4 }, {x5 , y5 }}]
Out[1]= {{x1 , x2 , x3 , x4 , x5 }, {y1 , y2 , y3 , y4 , y5 }}
2. The most direct way to extract the even (or odd) indexed elements is to use the Span function as
a second argument to Part.
In[2]:= lis = {5, 3, 3, 8, 17, 3, 3, 4, 20, 2, 11, 13};
In[3]:= Partlis, 2 ;; -1 ;; 2
Out[3]= {3, 8, 3, 4, 2, 13}
48 Essentials of Programming in Mathematica
Sorting gives:
In[7]:= Sort[nums]
Out[7]= {-100, -98, -97, -86, -82, -68, -67, -66, -60, -55,
-45, -24, -21, -13, -13, -11, 7, 9, 10, 23, 25, 36, 38, 70, 88}
In[11]:= TakeSmallest[nums, 5]
Out[11]= {-100, -98, -97, -86, -82}
4. There are several ways to create the matrix. One way is to use Table with two iterators.
In[12]:= mat = Tablei j, i, 1, 4, j, 1, 4
Out[12]= {{1, 2, 3, 4}, {2, 4, 6, 8}, {3, 6, 9, 12}, {4, 8, 12, 16}}
3.3 Operations on lists: exercises 49
In[13]:= MatrixForm[mat]
Out[13]//MatrixForm=
1 2 3 4
2 4 6 8
3 6 9 12
4 8 12 16
Another way is to use Outer (discussed in Section 5.1).
In[14]:= OuterTimes, Range[4], Range[4]
Out[14]= {{1, 2, 3, 4}, {2, 4, 6, 8}, {3, 6, 9, 12}, {4, 8, 12, 16}}
To add only those elements on or above the diagonal in mat, the following will pick out only
those elements.
In[15]:= Tablemati, j, i, 1, 4, j, 1, i
Out[15]= {{1}, {2, 4}, {3, 6, 9}, {4, 8, 12, 16}}
In[19]:= p = Partitionlis, 5
Out[19]= {{1, 2, 3, 4, 5}, {6, 7, 8, 9, 10}}
Once you are familiar with the Apply function (Chapter 5), this is done more compactly as
follows:
In[21]:= ApplyRiffle, p
Out[21]= {1, 6, 2, 7, 3, 8, 4, 9, 5, 10}
6. First, note that PrimePi[�] returns the number of primes less than n.
50 Essentials of Programming in Mathematica
In[22]:= PrimePi[100]
Out[22]= 25
So to list all the primes less than 100, we want the first PrimePi[100] = 25 primes.
In[23]:= TablePrime[n], n, PrimePi[100]
Out[23]= {2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31,
37, 41, 43, 47, 53, 59, 61, 67, 71, 73, 79, 83, 89, 97}
7. An n⨯n grid with rows of length n will have n2 elements in total. Starting with the list of integers
one through n2 , partition it into sublists of length n. For example, for n = 4:
In[24]:= n = 4;
lis = PartitionRangen2 , n
Out[25]= {{1, 2, 3, 4}, {5, 6, 7, 8}, {9, 10, 11, 12}, {13, 14, 15, 16}}
In[29]:= Clear[n]
8. To extract the leading digit of any number, use IntegerDigits to generate a list of the digits in
a number, and then take the first element in that list. For example, here are the digits in the 50th
Fibonacci number.
In[30]:= IntegerDigitsFibonacci[50]
Out[30]= {1, 2, 5, 8, 6, 2, 6, 9, 0, 2, 5}
To do this for the first 100 000 Fibonacci numbers, use Table.
3.3 Operations on lists: exercises 51
In[33]:= Histogramdigits
3000
2500
2000
Out[33]= 1500
1000
500
0
2 4 6 8 10
Alternatively, you could create a centering matrix which, when multiplied by the original
matrix, centers it.
In[53]:= CenteringMatrix[n_] := IdentityMatrix[n ] - ConstantArray[1 / n , {n , n }]
In[54]:= CenteringMatrix[3].mat
5 2 4 4 1 2
Out[54]= - , -3, - , , 0, , , 3, -
3 3 3 3 3 3
3.3 Operations on lists: exercises 53
In[60]:= Transpose[mat]
Out[60]= {{8, 3, 1, 0}, {2, 7, 2, 2}, {2, 9, 7, 6}, {9, 7, 9, 5}}
Now insert the column vector at the desired position. Then transpose back.
In[61]:= InsertTranspose[mat], a, b, c, d, 3 // MatrixForm
Out[61]//MatrixForm=
8 3 1 0
2 7 2 2
a b c d
2 9 7 6
9 7 9 5
For the second part of this exercise, the function Riffle is perfect for this task.
In[67]:= Riffle{1, 2, 3, 4}, a, b, c, d
Out[67]= {1, a, 2, b, 3, c, 4, d}
This can also be done in two steps by first transposing the two lists and then flattening.
In[68]:= Transpose{1, 2, 3, 4}, a, b, c, d
Out[68]= {{1, a}, {2, b}, {3, c}, {4, d}}
In[69]:= Flatten[%]
Out[69]= {1, a, 2, b, 3, c, 4, d}
14. One way to do this is to take the list and simply pick out elements at random locations. The
right-most location in the list is given by Length[���], using Part and RandomInteger.
In[70]:= randomChoicelis_, n_ := lis RandomInteger1, Lengthlis , {n }
In[74]:= ComplementA ⋃ B, A ⋂ B
Out[74]= c, d, e, f
large output show less show more show all set size limit...
First, partition the list of words into pairs with overlap one.
In[78]:= par = Partitionwords, 2, 1
large output show less show more show all set size limit...
Then tally them and sort by the frequency count, given by the last element in each sublist.
Finally, take the last twenty expressions, those bigrams occurring the most frequently.
In[79]:= tally = SortByTally[par], Last;
Taketally, -20
Out[80]= {{has, been}, 190}, {{each, other}, 192}, species, of, 201,
of, life, 227, {{with, the}, 230}, {{natural, selection}, 234},
{{it, is}, 237}, {{and, the}, 238}, {{by, the}, 242}, from, the, 256,
{{in, a}, 256}, {{to, be}, 267}, of, a, 268, {{have, been}, 432},
{{that, the}, 434}, {{on, the}, 498}, {{to, the}, 582},
{{the, same}, 715}, {{in, the}, 1024}, of, the, 1993
This can be done in one step using WordCounts (new in Mathematica 10.1) with a second argu-
56 Essentials of Programming in Mathematica
large output show less show more show all set size limit...
The idea in these two examples is to convert a string to a list of characters, operate on that list
using list manipulation functions like Join, Take, and Drop, then convert back to a string. More
efficient approaches use string manipulation functions directly (see Chapter 7).
19. First, here is how we might write our own StringJoin.
3.3 Operations on lists: exercises 57
In[91]:= FromCharacterCodeJoin
ToCharacterCode"To be, ", ToCharacterCode"or not to be"
Out[91]= To be, or not to be
Another way of looking at the computation is that we are squaring each of the first n numbers
and then adding those squares together. Think dot product of the list of the first n integers with
itself.
In[97]:= Range[10].Range[10]
Out[97]= 385
Or, more directly, square each of the integers one through ten, then add them up.
In[99]:= TotalRange[10]2
Out[99]= 385
58 Essentials of Programming in Mathematica
In[1]:= MakeRefhamming1950
���������������� (����)
������������������������������������������
������//�����������/�������/������-�-���
3.4 Solutions
1. Here is a small association consisting of information on three albums.
In[1]:= alb1 = Association
"SongTitle" → "Desvairada",
"AlbumArtist" → "Paulo Bellinati",
"AlbumTitle" → "The Guitar Works of Garoto",
"Year" → "1991",
"Cover" →
;
"Cover" →
;
3.4 Associations: exercises 59
"Cover" →
;
Out[4]= , ,
2. It is first necessary to modify the MakeRef function so that newline characters do not appear
between all items. We want the author text to be followed by the date and then a newline. So
instead of using a default separator in Row, we will manually put them where we want them.
In[5]:= makeAuthorref_ := Styleref "Author", "TR"
In[8]:= makeDateref_ :=
RowStyle" (", "TR", Styleref "Year", "TB", Style")", "TR"
In[11]:= MakeRef[art1]
������������������� (����)
������������������������������������������
������//�����������/�������/������-�-���
4
Patterns and rules
8. Create a function swapTwo[���] that returns lis with only its first two elements interchanged;
for example, the input swapTwo[{a, b, c, d, e}] should return {b, a, c, d, e}. If lis has
fewer than two elements, swapTwo just returns lis. Write swapTwo using three clauses: one for
the empty list, one for one-element lists, and one for all other lists. Then write it using two
clauses: one for lists of length zero or one and another for all longer lists.
9. Explain the different results from the following three pattern matches:
Out[5]= False
In[7]:= Needs"EPM`RandomWalks`"
-20
Out[9]= -30
-40
-50
-60
50
Out[11]=
200 400 600 800 1000
-50
11. Given a set of data like that in Figure 4.1, remove all outliers, defined here by being greater than
two standard deviations from the mean of the data.
Figure 4.1. Scatter plots of original data and data with outliers removed.
Raw data Filtered data
6 6
4 4
2 2
-4 -4
-6 -6
4.1 Solutions
1. Look at the internal representation of the complex number.
In[1]:= FullForm[3 + 4 I]
Out[1]//FullForm= Complex[3, 4]
Although giving different information, you could also check that the expression is a number.
In[3]:= MatchQ3 + 4 I, _ ? NumberQ
Out[3]= True
2. Start by creating a list of integers with which to work.
In[4]:= lis = RandomInteger[1000, {20}]
Out[4]= {270, 885, 466, 194, 374, 237, 249, 228, 184,
704, 636, 922, 10, 619, 806, 497, 290, 329, 463, 168}
IntegerQ is a predicate; it returns True or False, so we need to use the logical OR to separate
clauses here.
In[5]:= Caseslis, n_ /; IntegerQ[n / 2] || IntegerQ[n / 3] || IntegerQ[n / 5]
Out[5]= {270, 885, 466, 194, 374, 237, 249, 228, 184, 704, 636, 922, 10, 806, 290, 168}
Once you are familiar with pure functions (Section 5.5), you can also do this with Select.
64 Essentials of Programming in Mathematica
In[19]:= Collatz[24.0]
Out[19]= Collatz[24.]
6. Here again is the Collatz function, but this time using a condition on the right-hand side of the
definition.
In[20]:= ClearCollatz
In[24]:= Collatz[-3]
Out[24]= Collatz[-3]
You could also put the conditions inside the pattern on the left-hand side if you prefer.
In[26]:= ClearCollatz
In[33]:= swapTwo[{}] := {}
swapTwo[{x_}] := {x }
Now, we use the triple-blank to indicate that r could be a sequence of zero or more elements.
In[35]:= swapTwo[{x_, y_, r___}] := {y , x , r }
In[36]:= swapTwo[{}]
Out[36]= {}
In[37]:= swapTwo[{a}]
Out[37]= {a}
Notice in this second definition for swapTwo that the second clause covers both the situation
where the argument is the empty list and when it contains only one element.
In[39]:= swapTwo2[{x_, y_, r___}] := {y , x , r }
swapTwo2[x_] := x
In[41]:= swapTwo[{}]
Out[41]= {}
In[42]:= swapTwo[{a}]
Out[42]= {a}
In[45]:= Needs"EPM`RandomWalks`"
4.1 Patterns: exercises 67
50
40
30
Out[47]=
20
10
The case of multiple walks is a bit trickier. First note the structure of a list of multiple one-
dimensional random walks. Here we have 25 ten-step walks.
In[48]:= walks = TableRandomWalk10, Dimension → 1, {25};
Dimensionswalks
Out[49]= {25, 10}
In situations where you are not sure what the pattern needs to be to match a complicated
expression, it oftentimes helps to look at some representative examples.
In[50]:= ShortTakewalks, 5, 2
Out[50]//Short= {{-1, -2, -1, -2, -3, -4, -3, -4, -5, -4},
3, {-1, -2, -3, -2, -3, -2, -3, -4, -5, -4}}
40
20
Out[53]=
200 400 600 800 1000
-20
-40
-60
68 Essentials of Programming in Mathematica
11. The mean and standard deviation of the data can be obtained with built-in functions.
In[54]:= data = RandomVariateNormalDistribution[0, 2], {200};
This extracts all those elements of data that are within one standard deviation of the mean.
In[56]:= filtered = Casesdata, p_ /; Abs[μ - p ] < σ;
len = Lengthfiltered
Out[57]= 132
Out[58]=
50 100 150 200
-2
-4
In[5]:= unNest[{{α, α, α}, {α}, {{β, β, β}, {β, β}}, {α, α}}]
Out[5]= {α, α, α, α, β, β, β, β, β, α, α}
5. Define a function using pattern matching and repeated replacement to sum the elements of a
list such as that produced by Range[100].
6. Using the built-in function ReplaceList, write a function cartesianProduct that takes two
lists as input and returns the Cartesian product of these lists.
In[7]:= MultiplyCountt5
Out[7]= 4
In[8]:= MultiplyCount[a x y t]
Out[8]= 3
In[9]:= MultiplyCounta x y t4 + w t
Out[9]= 7
8. Create six graphical objects, one each to represent the faces of a standard six-sided die.
Dice[�] should display the face of the appropriate die, as below. Then use the Dice function
to create a function RollDice[] that “rolls” two dice and displays them side-by-side. Create an
additional rule, RollDice[�], that rolls a pair of dice n times and displays the result in a list or
row.
70 Essentials of Programming in Mathematica
Out[10]= , , , , ,
One way to approach this problem is to think of a die face as a grid of nine elements, some of
which are turned on (white) and some turned off (blue above). Then create one set of rules for
each of the six die faces. Once your rules are defined, you could use something like the follow-
ing graphics code (a bit incomplete as written here) to create your images:
Dice[n_] := GraphicsGrid
MapGraphics, Partition[Range[9], 3] /. rules [[n ]], {2}
9. Make a scatter plot of the points used to construct the polygons in a torus, which is given
parametrically as follows:
Out[11]=
4.2 Solutions
1. The problem here is that the pattern is too general and has been matched by the entire expres-
sion, which has the form {x_, y_}, where x is matched by {a, b} and y is matched by {c, d}.
To fix this, use patterns to restrict the expressions that match.
In[1]:= a, b, c, d /. x_Symbol , y_Symbol ⧴ {y , x }
Out[1]= {{b, a}, {d, c}}
The pattern needs to match an expression consisting of a list with a rule inside where the value
on the right-hand side of the rule should pass the Negative test.
In[8]:= Casessoln, x_ → _ ? Negative
Out[8]= {{x → -2.80961}, {x → -0.376453}}
In[12]:= unNest{a, a, a}, {a}, b, b, b, b, b, {a, a}
Out[12]= {a, a, a, a, b, b, b, b, b, a, a}
72 Essentials of Programming in Mathematica
5. Note the need to put y in a list on the right-hand side of the rule. Also, an immediate rule is
required here.
In[13]:= sumListlis_ := Firstlis //.{x_, y___} → x + {y}
In[17]:= Clearx, y, z, a, b, c, d
In[19]:= cartesianProduct[{}]
Out[19]= {}
7. For an expression of the form Power[�, �], the number of multiplies is b - 1.
In[20]:= Cases[{x ^ 4}, Power[_, exp_] ⧴ exp - 1]
Out[20]= {3}
For an expression of the form Times[�, �, �, …], the number of multiplications is given by
one less then the number of arguments.
In[21]:= Casesa b c d e, fac_Times ⧴ Lengthfac - 1
Out[21]= {4}
For a mix of terms of these two cases, we will need to total up the counts from the respective
terms. Here is a function that puts this all together. Use Infinity as a third argument to Cases
to make sure the search goes all the way down the expression tree.
In[22]:= MultiplyCount[expr_] :=
Total @ Cases{expr }, Power[_, exp_] ⧴ exp - 1, Infinity +
Total @ Cases{expr }, fac_Times ⧴ Lengthfac - 1, Infinity
In[23]:= MultiplyCounta b2 c d5
Out[23]= 8
In[25]:= MultiplyCountpoly
Out[25]= 28
Ideally we should check that the expression passed to this function is a polynomial first. That is
addressed in Exercise 5, Section 6.2.
8. First, we create a grid of the nine locations on the die.
In[26]:= lis = Partition[Range[9], 3];
Gridlis
1 2 3
Out[27]= 4 5 6
7 8 9
Next, use graphics primitives to indicate if a location on the grid is colored (on) or not (off).
In[28]:= off = Red, Disk[];
on = White, Disk[];
Here are the rules for a five.
In[30]:= GraphicsGridMapGraphics,
lis /. 1 → on, 2 → off, 3 → on, 4 → off, 5 → on, 6 → off, 7 → on, 8 → off, 9 → on,
{2}, Background → Red, Spacings → 10, ImageSize → 40
Out[30]=
The five other rules are straightforward. Here then is a function that wraps up the code. Note
the use of the Background option to GraphicsGrid to pick up the color from the value of off.
In[31]:= Dice[n_] := Modulerules, off = Darker @ Blue, Disk[], on = White, Disk[],
rules =
1 → off, 2 → off, 3 → off, 4 → off, 5 → on, 6 → off, 7 → off, 8 → off, 9 → off,
1 → off, 2 → off, 3 → on, 4 → off, 5 → off, 6 → off, 7 → on, 8 → off, 9 → off,
1 → off, 2 → off, 3 → on, 4 → off, 5 → on, 6 → off, 7 → on, 8 → off, 9 → off,
1 → on, 2 → off, 3 → on, 4 → off, 5 → off, 6 → off, 7 → on, 8 → off, 9 → on,
1 → on, 2 → off, 3 → on, 4 → off, 5 → on, 6 → off, 7 → on, 8 → off, 9 → on,
1 → on, 2 → off, 3 → on, 4 → on, 5 → off, 6 → on, 7 → on, 8 → off, 9 → on
;
GraphicsGridMapGraphics,
Partition[Range[9], 3] /. rules[[n ]],
{2}, Background → Firstoff, Spacings → 10, ImageSize → 40
74 Essentials of Programming in Mathematica
Out[32]= , , , , ,
This can be done a bit more compactly by using a 3⨯3 matrix of zeros and ones.
In[33]:= Dicen_, OptionsPattern[] := Modulerules, color, grid,
color = OptionValueColor;
rules = 0 → color, Disk[], 1 → White, Disk[];
grid = {
{0, 0, 0, 0, 1, 0, 0, 0, 0},
{0, 0, 1, 0, 0, 0, 1, 0, 0},
{0, 0, 1, 0, 1, 0, 1, 0, 0},
{1, 0, 1, 0, 0, 0, 1, 0, 1},
{1, 0, 1, 0, 1, 0, 1, 0, 1},
{1, 0, 1, 1, 0, 1, 1, 0, 1}
};
GraphicsGridMapGraphics, Partitiongrid[[n ]], 3 /. rules, {2},
Background → color, Spacings → 10, ImageSize → 40
Using Array, we create a list of the six dice.
In[34]:= ArrayDice, {6}
Out[34]= , , , , ,
In[36]:= RollDice[]
Out[36]=
And here is the rule for rolling the pair of dice � times.
In[37]:= RollDice[n_] := TableRollDice[], {n }
4.2 Transformation rules: exercises 75
In[38]:= RollDice[4]
Out[38]= , ,
,
Out[39]=
The internal form of the graphic shows the form we are looking for.
In[40]:= Short[InputForm[torus], 5]
Graphics3DGraphicsComplex
1.3464 × 10-6 , 2.999999999999597, 4.48799 × 10-7 , {<< 3 >>}, << 2296 >>,
Out[40]//Short=
{-2.0674956344646818, 2.067494242630337, -0.38268379517170614},
<< 2 >>, {<< 9 >>}
Mirroring what was done in the plot example in this section, here is the expression to extract
only coordinate triples.
76 Essentials of Programming in Mathematica
large output show less show more show all set size limit...
Out[42]=
5. Given a graphic produced by Plot, use a transformation rule to halve the y-coordinate of each
point used to construct the plot, then display the result.
6. Extend the counting coins example to take images of coins as the argument to the function.
In[4]:= CountChange , , , ,
Out[4]= 0.42
7. Create a function FindSubsequence[������, ������] to find the positions of a subsequence
subseq within a sequence of numbers given by digits. Assume both digits and subseq are lists of
numbers. Your function should return a list of the starting and ending positions where the
subsequence occurs in the sequence, similar to what Position returns. For example, here are
the first 50 digits of π:
In[7]:= SeedRandom[6];
n = RandomInteger10200
Out[8]= 38 962 167 906 640 602 500 170 931 211 955 779 575 023 497 774 170 227 858 878 429 522 794 529
744 062 342 783 143 699 902 237 900 976 316 871 609 846 545 097 431 390 396 795 087 845 924
977 005 230 435 025 177 652 637 766 538 981 421 277 296 525 589 205 107 229 653
2 2 2
x1 y1 1 y1 z1 1 z1 x1 1
1
A△ = 2
x2 y2 1 + y2 z2 1 + z2 x2 1
x3 y3 1 y3 z3 1 z3 x3 1
10. Using historical global surface temperatures, make a plot showing the difference in °C from the
1950–1980 average for each year. Data is available from numerous sources, including NASA’s
Goddard Institute for Space Studies (NASA 2015). After importing the data you will need to
remove header and footer information before pouring the pairs {����, ������_����} into
TimeSeries. Make the plot using DateListPlot and include a smoothed five-year moving
average together with the plot of the raw data.
11. Sunspots are caused by magnetic fields which in turn are caused by the current generated by
the motion of hot plasma inside the sun. In regions where the induced magnetic field is most
intense, the increased pressure causes the region to rise to the surface causing darker regions –
sunspots – where the temperature is lower. The mean magnetic field of the sun has been
recorded since 1975 and is available from the Wilcox Solar Observatory at Stanford University:
In[12]:= DateList
"1975:05:18_20h", "Year", ":", "Month", ":", "Day", "_", "Hour", "h"
Out[12]= {1975, 5, 18, 20, 0, 0.}
4.3 Solutions
1. First, the argument is checked to see if it has head Integer and if it is greater than one.
In[1]:= compositeQ[n_Integer /; n > 1] := NotPrimeQ[n ]
Check a few numbers for compositeness.
In[2]:= compositeQ[16]
Out[2]= True
In[3]:= compositeQ231 - 1
Out[3]= False
0.8
0.6
Out[5]= 0.4
0.2
-6 -4 -2 2 4 6
-0.2
This replacement rule replaces each pair of numbers {x, y} with the pair {x, -y}, giving a
reflection in the y-axis. Note the need to modify the plot range here.
80 Essentials of Programming in Mathematica
-6 -4 -2 2 4 6
-0.2
Out[6]= -0.4
-0.6
-0.8
-1.0
The argument checking (_?NumberQ) is necessary here so that pairs of arbitrary expressions
embedded somewhere in the graphics expression are not pattern matched. We only want to
interchange pairs of numbers, not pairs of options or other expressions that might be present in
the underlying expression representing the graphic.
3. First, here is the data with which we will work.
0.9034 "NAN" 0.7163 0.8588 0.1228
0.3031 0.5827 0.2699 0.8063 "NAN"
In[7]:= array = 0.0418 0.8426 "NAN" 0.8634 0.9682 ;
0.9163 0.8913 0.0662 0.8432 0.0547
0.7937 0.6905 0.9105 0.5589 0.8993
Get only the numeric values from the second column.
In[8]:= col2 = arrayAll, 2;
Casescol2, _ ? NumberQ
Out[9]= {0.5827, 0.8426, 0.8913, 0.6905}
0.5
Out[20]=
1 2 3 4 5 6
-0.5
-1.0
This rule replaces each pair {x, y} with the pair {x, y/2}.
In[21]:= plot /. x_ ? NumericQ, y_ ? NumericQ ⧴ {x , y / 2}
0.5
-0.5
-1.0
Because the plot range is simply inherited from the original plot we lose some information
after the transformation. To adjust the plot range, wrap the expression in Show and give an
explicit plot range.
4.3 Examples: exercises 83
In[22]:= Show
plot /. x_ ? NumericQ, y_ ? NumericQ ⧴ {x , y / 2},
PlotRange → {{0, 2 π}, {-1, 1}}
1.0
0.5
Out[22]=
1 2 3 4 5 6
-0.5
-1.0
6. For U.S. coins, you can import images from the U.S. Mint (www.usmint.gov); adjust accord-
ingly for different currencies.
In[23]:= q, d, n, p = , , , ;
Out[24]= , , , , ,
, , , ,
→ .25
In[29]:= CountChange , , , , ,
, , , ,
Out[29]= 1.04
7. To prototype, we will only work with a small number of digits so we can easily check on our
progress. Here are the first 50 digits of π, starting from the right of the decimal point.
In[30]:= pidigs = FirstRealDigits[π, 10, 50]
Out[30]= {3, 1, 4, 1, 5, 9, 2, 6, 5, 3, 5, 8, 9, 7, 9, 3, 2, 3, 8, 4, 6, 2, 6, 4, 3,
3, 8, 3, 2, 7, 9, 5, 0, 2, 8, 8, 4, 1, 9, 7, 1, 6, 9, 3, 9, 9, 3, 7, 5, 1}
Now we are ready for the pattern match. From the list p above, we are looking for the positions
of any sublist that matches {3, 2, 3, 8}. The subsequence 3238 occurs starting at the sixteenth
digit in pidigs (fifteen digits to the right of the decimal point).
In[33]:= pos = Positionp, subseq
Out[33]= {{16}}
To mirror the default output of Position, we give the starting and ending positions of this
match.
In[34]:= pos /. num_ ? IntegerQ ⧴ num , num + Lengthsubseq - 1
Out[34]= {{16, 19}}
Finally, let us turn this into a function and test it on a much larger example. Note that we use
the pattern _List on both arguments, digits and subseq, so that FindSubsequence will only
match arguments that have head List.
In[35]:= FindSubsequencedigits_List , subseq_List :=
PositionPartitiondigits , Lengthsubseq , 1, subseq /.
num_ ? IntegerQ ⧴ num , num + Lengthsubseq - 1
Store the first 10 000 000 digits of π in the symbol pidigs.
In[36]:= pidigs = FirstRealDigitsπ, 10, 107 , -1;
The subsequence 314159 occurs seven times in the first 10 000 000 digits of π, starting with the
176 451st digit.
In[37]:= FindSubsequencepidigs, {3, 1, 4, 1, 5, 9} // Timing
Out[37]= {10.2297, {{176 451, 176 456},
{1 259 351, 1 259 356}, {1 761 051, 1 761 056}, {6 467 324, 6 467 329},
{6 518 294, 6 518 299}, {9 753 731, 9 753 736}, {9 973 760, 9 973 765}}}
In Section 7.2 we will see a different approach to this problem, one using string-processing
functions that gives a substantial speedup compared to the computation above.
86 Essentials of Programming in Mathematica
8. This creates another rule associated with FindSubsequence that simply takes each integer
argument, converts it to a list of integer digits, and then passes that off to the rule above.
In[38]:= FindSubsequencen_Integer , subseq_Integer :=
FindSubsequenceIntegerDigits[n ], IntegerDigitssubseq
Create the list of the first 100 000 digits of π.
In[39]:= pi = FromDigitsFirst @ RealDigitsNPi, 105 - 3;
The subsequence 1415 occurs seven times at the following locations in this digit expansion of π.
In[40]:= FindSubsequencepi, 1415
Out[40]= {{1, 4}, {6955, 6958}, {29 136, 29 139}, {45 234, 45 237},
{79 687, 79 690}, {85 880, 85 883}, {88 009, 88 012}}
9. This is a direct translation of the formula given in the exercise using a transformation rule to
embed the two-dimensional vectors in three-space. It is important to get the pattern on the left-
hand side of this definition correct so it matches a list consisting of three expressions (the three
points).
In[41]:= areaTriangle[pts : {_, _, _}] :=
1
2
Detpts All, {2, 3} /. a_, b_ ⧴ a , b , 12 +
2
Detpts All, {3, 1} /. a_, b_ ⧴ a , b , 1 +
2
Detpts All, {1, 2} /. a_, b_ ⧴ a , b , 1
In[43]:= AreaTriangle[pts]
13
Out[43]= 5
2
In[44]:= areaTriangle[pts]
13
Out[44]= 5
2
10. First, import data from NASA’s Goddard Institute for Space Studies.
In[45]:= data = Import"http://data.giss.nasa.gov/gistemp/tabledata_v3/GLB.Ts+dSST.txt",
"Table", "Data";
We need to strip out the header and footer information and just deal with the raw data: inspec-
tion of the data (not shown here) indicates the header info is in the first eight rows and footer
info is in the last twelve rows.
4.3 Examples: exercises 87
0.6
0.4
-0.4
In[51]:= Clearx, y, z, f, g, p, q, d, n, a, b, c, d, e
11. This imports the data from the Wilcox Observatory:
88 Essentials of Programming in Mathematica
large output show less show more show all set size limit...
The data is of the form {����, �� } where date is a string and the magnetic field measurement
an integer giving the mean magnetic field measurement in μ T (micro-Teslas).
In[53]:= data[[2]] // InputForm
Out[53]//InputForm= {�����������_��������}
Using the suggestion in the exercise, create a function to convert the string to a date object.
In[54]:= dateConvertstr_String :=
DateListstr , "Year", ":", "Month", ":", "Day", "_", "Hour", "h"
Then, using a rule, convert all the dates:
In[55]:= data2 = Rest @ data /. date_String , val_ ⧴ dateConvertdate , val
{{1975, 5, 16, 20, 0, 0.}, 29}, {{1975, 5, 17, 20, 0, 0.}, 22},
{{1975, 5, 18, 20, 0, 0.}, 24}, ⋯ 14 319 ⋯ , {{2014, 8, 1, 20, 0, 0.}, 69},
Out[55]= {{2014, 8, 2, 20, 0, 0.}, 34}, {{2014, 8, 3, 20, 0, 0.}, 6}
large output show less show more show all set size limit...
Next, we need to deal with missing data. In the data set, they are indicated by the string “XXXX”.
In[56]:= data2[[8]] // InputForm
Out[56]//InputForm= {{����������������������}��������}
The next rule converts this string to Missing[] which the time series functions can deal with
better.
4.3 Examples: exercises 89
{{1975, 5, 16, 20, 0, 0.}, 29}, {{1975, 5, 17, 20, 0, 0.}, 22},
{{1975, 5, 18, 20, 0, 0.}, 24}, ⋯ 14 319 ⋯ , {{2014, 8, 1, 20, 0, 0.}, 69},
Out[57]= {{2014, 8, 2, 20, 0, 0.}, 34}, {{2014, 8, 3, 20, 0, 0.}, 6}
large output show less show more show all set size limit...
300
200
100
Out[59]=
0
-100
-200
An alternative approach could use the DateStringFormat option to Import to put the dates in
the proper form for the time series, but it is a bit slower to do the processing during import.
In[60]:= data = Rest @ Import"http://wso.stanford.edu/meanfld/MF_timeseries.txt",
"Table", "DateStringFormat" →
"Year", ":", "Month", ":", "Day", "_", "Hour", "h"
��� �� ��� ���� , 29, ��� �� ��� ���� , 22, ��� �� ��� ���� , 24, ��� �� ��� ���� , 24,
Out[60]= ⋯ 14 317 ⋯ , ��� �� ��� ���� , 87, ��� � ��� ���� , 69, ��� � ��� ���� , 34, ��� � ��� ���� , 6
large output show less show more show all set size limit...
300
200
100
Out[62]=
0
-100
-200
A= s (s - a) s - b (s - c)
where a, b, and c are the lengths of the three sides of the triangle and s is the semiperimeter of
the triangle, defined by s = a + b + c2. Compute the area of any triangle using Heron’s
formula. You can check your result against the built-in Area function.
92 Essentials of Programming in Mathematica
In[3]:= pt1 = {0, 0}; pt2 = {5, 2}; pt3 = {3, 4};
GraphicsTriangle[{pt1, pt2, pt3}], Axes → Automatic
4
2
Out[4]=
1 2 3 4 5
In[7]:= aa = "A", "R", "N", "D", "C", "E", "Q", "G", "H", "I", "L", "K", "M", "F",
"P", "O", "U", "S", "T", "W", "Y", "V";
5.1 Functions for manipulating expressions: exercises 93
9. Create a function LeadingDigit[�] that takes an integer n as an argument and returns the
leading digit of n (see Exercise 7, Section 3.3). Set up your function so that it returns the leading
digits of a list of numbers such as the first 10 000 Fibonacci numbers.
10. Given a set of points in the plane, find the bounding rectangle that fully encloses the points. For
three-dimensional sets of points, find the bounding rectangular box. (See Figure 5.1.)
Figure 5.1. Bounding boxes (dashed lines) for points in two and three dimensions.
10
-10 -5 5 10
-5
-10
11. Given a set of points in the plane (or 3-space), find the maximum distance between any pair of
these points. This is often called the diameter of the point set. If your definition is general
enough it should be able to handle points in any dimension.
12. Create a graphic that consists of n randomly colored circles in the plane with random centers
and random radii. Consider using Thread or MapThread to thread Circle[…] across the lists
of centers and radii.
13. While matrices can easily be added using Plus, matrix multiplication is a bit more involved.
The Dot function, written as a single period, is used.
2 5
1
Out[11]=
4 3
Compute the total number of edges for each vertex in both the adjacency matrix and graph
representations. For example, you should get the following edge counts for the five vertices
represented in the above graph. Note: self-loops count as two edges each.
{5, 7, 7, 5, 8}
15. Create a function ToEdges[���] that takes a list of pairs of elements and transforms it into a list
of directed edges suitable for a graph. For example:
In[13]:= ToEdgeslis
Out[13]= {1 4, 1 5, 1 7, 1 9, 8 0, 3 1, 9 2, 6 2, 3 4, 4 4, 7 6, 2 8}
Make sure that your function also works in the case where its argument is a single list of a pair
of elements.
In[16]:= PrimeFactorForm[12]
Out[16]= 22 · 31
19. The Vandermonde matrix arises in Lagrange interpolation and in reconstructing statistical
distributions from their moments. Construct the Vandermonde matrix of order n:
5.1 Functions for manipulating expressions: exercises 95
1 x1 x21 ⋯ xn-1
1
1 x2 x22 ⋯ xn-1
2
⋮ ⋮ ⋮ ⋱ ⋮
1 xn x2n n-1
⋯ xn
20. Using Inner, write a function div[����, ����] that computes the divergence of an n-dimen-
sional vector field, vecs = {�1 , �2 , …, �� }, dependent upon n variables,
vars = {�1 , �2 , …, �� }. The divergence is given by the sum of the pairwise partial
derivatives.
∂e1 ∂e2 ∂en
+ +⋯+
∂v1 ∂v2 ∂vn
21. Using Outer, create a function JacobianMatrix[���, ����] that returns the Jacobian of the
vector vec in the variables given by the list vars. Then use JacobianMatrix to compute the
volume of the hypersphere in two (circle) and three (sphere) dimensions by integrating the
absolute value of the determinant of the Jacobian.
22. The example in this section on Select and Pick found Mersenne numbers 2n - 1 that are
prime for exponents n from 1 to 100. Modify that example to only use prime exponents – a
basic theorem in number theory states that a Mersenne number with composite exponent
must be composite (Crandall and Pomerance 2005).
5.1 Solutions
1. If we are doing a 2-term moving average, then partition into 2-element lists.
In[1]:= Cleara, b, c, d, e, f, g, h, i
The first argument to Inner is a function that will be threaded over the following lists. After-
wards, the fourth argument to Inner will be applied to the result. So we use Equal as that first
function.
In[12]:= InnerEqual, {x, y, z}, a, b, c, List
Out[12]= {x ⩵ a, y ⩵ b, z ⩵ c}
4. Given three points that define a triangle, we need the distances between every pair of points,
that is, the length of the sides of the triangles.
In[13]:= pt1 = {0, 0};
pt2 = {5, 2};
pt3 = {3, 5};
First, make a list of the possible pairs of points.
In[16]:= pairs = Subsets[{pt1, pt2, pt3}, {2}]
Out[16]= {{{0, 0}, {5, 2}}, {{0, 0}, {3, 5}}, {{5, 2}, {3, 5}}}
Then apply EuclideanDistance at level one to get the distance between each pair.
In[17]:= a, b, c = ApplyEuclideanDistance, pairs, {1}
Out[17]= 29 , 34 , 13
In[18]:= s = a + b + c 2
1
Out[18]= 13 + 29 + 34
2
And finally, the area computation given by Heron’s formula:
In[19]:= s (s - a) s - b (s - c) // Simplify
19
Out[19]=
2
Check:
In[20]:= AreaTriangle[{pt1, pt2, pt3}]
19
Out[20]=
2
In[21]:= Cleara, b, c, s
5. Here is the definition of SquareNumberQ from Exercise 4 in Section 2.4.
In[22]:= SquareNumberQ[n_Integer ] := IntegerQ n
First, create the numbers that contain each of the digits using FromDigits.
In[23]:= FromDigits[{1, 2, 3, 4, 5, 6, 7, 8, 9}]
Out[23]= 123 456 789
123 456 789, 123 456 798, 123 456 879, 123 456 897,
123 456 978, 123 456 987, 123 457 689, 123 457 698, 123 457 869,
⋯ 362 862 ⋯ , 987 653 241, 987 653 412, 987 653 421, 987 654 123,
Out[24]=
987 654 132, 987 654 213, 987 654 231, 987 654 312, 987 654 321
large output show less show more show all set size limit...
And here are those numbers from nums that are square.
In[25]:= Selectnums, SquareNumberQ
Out[25]= {139 854 276, 152 843 769, 157 326 849, 215 384 976, 245 893 761, 254 817 369,
326 597 184, 361 874 529, 375 468 129, 382 945 761, 385 297 641, 412 739 856,
523 814 769, 529 874 361, 537 219 684, 549 386 721, 587 432 169, 589 324 176,
597 362 481, 615 387 249, 627 953 481, 653 927 184, 672 935 481, 697 435 281,
714 653 289, 735 982 641, 743 816 529, 842 973 156, 847 159 236, 923 187 456}
98 Essentials of Programming in Mathematica
In[26]:= %
Out[26]= {11 826, 12 363, 12 543, 14 676, 15 681, 15 963, 18 072, 19 023, 19 377, 19 569,
19 629, 20 316, 22 887, 23 019, 23 178, 23 439, 24 237, 24 276, 24 441, 24 807,
25 059, 25 572, 25 941, 26 409, 26 733, 27 129, 27 273, 29 034, 29 106, 30 384}
What would happen if you first found all 9-digit square numbers and then determined which of
those contained only the digits one through nine? A bit of thought should convince you that
that approach would be quite time and resource intensive as the first step would require
checking every number below 109 to see if it was a square.
6. Here is the definition of PerfectQ.
In[27]:= PerfectQ[n_] := TotalDivisors[n ] ⩵ 2 n
To find all perfect numbers less than n, use Select on the list given by Range[�], using
PerfectQ as the test.
In[28]:= PerfectSearch[n_] := SelectRange[n ], PerfectQ
This finds the four perfect numbers less than one million.
In[29]:= PerfectSearch106 // Timing
Out[29]= {9.25325, {6, 28, 496, 8128}}
This is quite compute-intensive. You can speed things up by using a built-in function that is
designed specifically for this task, DivisorSigma.
In[30]:= PerfectQ[n_] := DivisorSigma[1, n ] ⩵ 2 n
In[33]:= PrimesLessThan[100]
Out[33]= {2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31,
37, 41, 43, 47, 53, 59, 61, 67, 71, 73, 79, 83, 89, 97}
8. Since we are interested in all possible two-letter combinations of the list of nucleotides, the
function that should come to mind is Outer. The only question is what function to thread
across the lists? A moment’s thought should convince you that StringJoin is what is needed.
In[34]:= lis = OuterStringJoin, "A", "C", "T", "G", "A", "C", "T", "G"
Out[34]= {{AA, AC, AT, AG}, {CA, CC, CT, CG}, {TA, TC, TT, TG}, {GA, GC, GT, GG}}
You can see what is happening by using a symbolic function sj instead of StringJoin:
5.1 Functions for manipulating expressions: exercises 99
In[35]:= Outersj, "A", "C", "T", "G", "A", "C", "T", "G"
Out[35]= {{sj[A, A], sj[A, C], sj[A, T], sj[A, G]},
{sj[C, A], sj[C, C], sj[C, T], sj[C, G]},
{sj[T, A], sj[T, C], sj[T, T], sj[T, G]},
{sj[G, A], sj[G, C], sj[G, T], sj[G, G]}}
Generalizing is a bit tricky. Here is what we would need to do for words of length three.
In[37]:= OuterStringJoin, "A", "C", "T", "G", "A", "C", "T", "G",
"A", "C", "T", "G" // Flatten
Out[37]= {AAA, AAC, AAT, AAG, ACA, ACC, ACT, ACG, ATA, ATC, ATT, ATG, AGA, AGC, AGT, AGG, CAA,
CAC, CAT, CAG, CCA, CCC, CCT, CCG, CTA, CTC, CTT, CTG, CGA, CGC, CGT, CGG, TAA,
TAC, TAT, TAG, TCA, TCC, TCT, TCG, TTA, TTC, TTT, TTG, TGA, TGC, TGT, TGG, GAA,
GAC, GAT, GAG, GCA, GCC, GCT, GCG, GTA, GTC, GTT, GTG, GGA, GGC, GGT, GGG}
But what about words of length four or fourteen? Surely we can’t manually keep adding the list
of nucleotides inside Outer. Well, for words of length four say, we want a sequence of four copies
of the list {"A", "C", "T", "G"}. We can use Table to generate that but then we have too
many nested lists to pass to Outer.
In[38]:= Table"A", "C", "T", "G", {4}
Out[38]= {{A, C, T, G}, {A, C, T, G}, {A, C, T, G}, {A, C, T, G}}
In[39]:= OuterStringJoin, %
Out[39]= {{A, C, T, G}, {A, C, T, G}, {A, C, T, G}, {A, C, T, G}}
The key here is to pass a sequence of these four lists. There is a function designed specifically for
this situation: Sequence. We will apply it to the result of Table above and then give that
sequence as the second argument to Outer.
In[40]:= ApplySequence, Table"A", "C", "T", "G", {4}
Out[40]= Sequence[{A, C, T, G}, {A, C, T, G}, {A, C, T, G}, {A, C, T, G}]
100 Essentials of Programming in Mathematica
Here then is a function that generalizes this process. We have included some pattern matching
of the arguments to insure that the alphabet is a list of one or more strings and that the word
length n is a positive integer.
In[42]:= Clear[NGrams]
Here is a list of all possible words of length two from the alphabet of amino acids.
In[45]:= alphabet = "K", "P", "W", "G", "E", "V", "Y", "L", "M", "Q", "R", "S",
"F", "D", "H", "I", "C", "T", "N", "A";
5.1 Functions for manipulating expressions: exercises 101
In[46]:= NGramsalphabet, 2
Out[46]= {KK, KP, KW, KG, KE, KV, KY, KL, KM, KQ, KR, KS, KF, KD, KH, KI, KC, KT, KN, KA, PK,
PP, PW, PG, PE, PV, PY, PL, PM, PQ, PR, PS, PF, PD, PH, PI, PC, PT, PN, PA, WK,
WP, WW, WG, WE, WV, WY, WL, WM, WQ, WR, WS, WF, WD, WH, WI, WC, WT, WN, WA, GK,
GP, GW, GG, GE, GV, GY, GL, GM, GQ, GR, GS, GF, GD, GH, GI, GC, GT, GN, GA, EK,
EP, EW, EG, EE, EV, EY, EL, EM, EQ, ER, ES, EF, ED, EH, EI, EC, ET, EN, EA, VK,
VP, VW, VG, VE, VV, VY, VL, VM, VQ, VR, VS, VF, VD, VH, VI, VC, VT, VN, VA, YK,
YP, YW, YG, YE, YV, YY, YL, YM, YQ, YR, YS, YF, YD, YH, YI, YC, YT, YN, YA, LK,
LP, LW, LG, LE, LV, LY, LL, LM, LQ, LR, LS, LF, LD, LH, LI, LC, LT, LN, LA, MK,
MP, MW, MG, ME, MV, MY, ML, MM, MQ, MR, MS, MF, MD, MH, MI, MC, MT, MN, MA, QK,
QP, QW, QG, QE, QV, QY, QL, QM, QQ, QR, QS, QF, QD, QH, QI, QC, QT, QN, QA, RK,
RP, RW, RG, RE, RV, RY, RL, RM, RQ, RR, RS, RF, RD, RH, RI, RC, RT, RN, RA, SK,
SP, SW, SG, SE, SV, SY, SL, SM, SQ, SR, SS, SF, SD, SH, SI, SC, ST, SN, SA, FK,
FP, FW, FG, FE, FV, FY, FL, FM, FQ, FR, FS, FF, FD, FH, FI, FC, FT, FN, FA, DK,
DP, DW, DG, DE, DV, DY, DL, DM, DQ, DR, DS, DF, DD, DH, DI, DC, DT, DN, DA, HK,
HP, HW, HG, HE, HV, HY, HL, HM, HQ, HR, HS, HF, HD, HH, HI, HC, HT, HN, HA, IK,
IP, IW, IG, IE, IV, IY, IL, IM, IQ, IR, IS, IF, ID, IH, II, IC, IT, IN, IA, CK,
CP, CW, CG, CE, CV, CY, CL, CM, CQ, CR, CS, CF, CD, CH, CI, CC, CT, CN, CA, TK,
TP, TW, TG, TE, TV, TY, TL, TM, TQ, TR, TS, TF, TD, TH, TI, TC, TT, TN, TA, NK,
NP, NW, NG, NE, NV, NY, NL, NM, NQ, NR, NS, NF, ND, NH, NI, NC, NT, NN, NA, AK,
AP, AW, AG, AE, AV, AY, AL, AM, AQ, AR, AS, AF, AD, AH, AI, AC, AT, AN, AA}
9. IntegerDigits[�] gives a list of the digits in n. First returns the first element in that list. Here
then is the function definition.
In[47]:= LeadingDigit[n_Integer ] := FirstIntegerDigits[n ]
We could map the function across lists, but instead we will give it the attribute that causes it to
automatically map across lists. Set the function to have the Listable attribute.
In[50]:= SetAttributesLeadingDigit, Listable
Now, create a table of the first 10 000 Fibonacci numbers.
In[51]:= fibs = TableFibonaccii, i, 10 000;
Because LeadingDigit is now a listable function, it automatically maps across the list fibs.
Here then is a histogram of the leading digits of the first 10 000 Fibonacci digits.
102 Essentials of Programming in Mathematica
In[52]:= HistogramLeadingDigitfibs
3000
2500
2000
Out[52]= 1500
1000
500
0
2 4 6 8 10
10
Out[54]=
-20 -15 -10 -5 5 10 15
-10
-20
Transposing the data gives a list all the x-coordinates, followed by a list of all the y-coordinates.
In[56]:= Transpose[{{x1 , y1 }, {x2 , y2 }, {x3 , y3 }}]
Out[56]= {{x1 , x2 , x3 }, {y1 , y2 , y3 }}
Here then are the computations for our data. Notice the parallel assignments saving some
typing.
In[58]:= xmin, ymin = MapMin, Transposedata
Out[58]= {-19.4808, -19.9974}
5.1 Functions for manipulating expressions: exercises 103
As it turns out, a built-in function is available for this task. MinMax operates on vectors of
numbers. So we will map it across the transposed data. Note the form of the data that is
returned: first a list of the min and max x-coordinates and then likewise for the y-coordinates. A
bit of rearranging is needed for Rectangle.
In[60]:= xmin, xmax, ymin, ymax = MapMinMax, Transposedata
Out[60]= {{-19.4808, 18.7094}, {-19.9974, 19.5983}}
10
Out[61]=
-20 -15 -10 -5 5 10 15
-10
-20
In[64]:= Graphics3D
Pointdata3d,
Blue, Opacity[.5], Cuboidxmin, ymin, zmin, {xmax, ymax, zmax}
, Boxed → False
Out[64]=
In[70]:= PointsetDiameter[pts]
Out[70]= 1.27562
To get the coordinate points that give this maximum distance, use MaximalBy:
In[71]:= MaximalBypairs, ApplyEuclideanDistance, # &
Out[71]= {{{0.94701, 0.0541054}, {0.0448236, 0.95592}}}
A quick check:
In[72]:= ApplyEuclideanDistance, %, {1}
Out[72]= {1.27562}
In[74]:= PointsetDiameter[pts3D]
Out[74]= 1.00684
Because of the use of Subsets, this computation will not scale well. Computing subsets has
computational complexity On2 and so the time to compute subsets is quadratic in the size of
the set.
In[75]:= TimingSubsets[Range[1000], {2}];
Out[75]= {0.07042, Null}
Exercise 5, Section 9.1 explores another approach – one that involves the convex hull – to speed
up the computation.
12. First, create the random centers and radii.
In[77]:= n = 12;
centers = RandomReal[{-1, 1}, {n, 2}]
Out[78]= {{-0.391653, 0.830624}, {-0.747273, -0.460966}, {0.656809, -0.910538},
{-0.187957, -0.421397}, {0.574283, 0.718045}, {-0.620718, -0.831547},
{-0.548517, -0.791468}, {-0.578859, -0.448743}, {0.330763, 0.848178},
{-0.948835, -0.268074}, {0.911755, 0.460441}, {0.146787, 0.898121}}
MapThread is perfect for the task of grabbing one center, one radii, and wrapping Circle
around them.
In[80]:= circles = MapThreadCircle, centers, radii;
In[81]:= Graphicscircles
Out[81]=
And here is a rule to transform each circle into a scoped list that includes Thick and
RandomColor. Note the need for the delayed rule (⧴); try it with an immediate rule to under-
stand why.
In[82]:= Graphicscircles /. Circle[x__] ⧴ Thick, RandomColor[], Circle[x ]
Out[82]=
106 Essentials of Programming in Mathematica
13. This can be done either in two steps, or by using the Inner function.
In[83]:= Transpose[{{1, 2}, {3, 4}}] {x, y}
Out[83]= {{x, 3 x}, {2 y, 4 y}}
In[84]:= Total[%]
Out[84]= {x + 2 y, 3 x + 4 y}
Using graphs you can accomplish the same thing directly using VertexDegree.
In[89]:= gr = AdjacencyGraphmat, VertexLabels → "Name"
2 3
5
Out[89]=
4 1
In[90]:= VertexDegree[gr]
Out[90]= {4, 3, 4, 3, 4}
15. Applying DirectedEdge at level one will do the trick.
5.1 Functions for manipulating expressions: exercises 107
This rule fails for the case when the argument is a single flat list of a pair of elements.
In[94]:= ToEdges[{3, 6}]
Out[94]= ToEdges[{3, 6}]
In[101]:= FactorInteger[295 232 799 039 604 140 847 618 609 643 520 000 000]
Out[101]= {{2, 32}, {3, 15}, {5, 7}, {7, 4}, {11, 3},
{13, 2}, {17, 2}, {19, 1}, {23, 1}, {29, 1}, {31, 1}}
In[102]:= ExpandFactors[%]
Out[102]= 295 232 799 039 604 140 847 618 609 643 520 000 000
17. Here is a factorization we can use to work through this problem.
In[103]:= facs = FactorInteger[3 628 800]
Out[103]= {{2, 8}, {3, 4}, {5, 2}, {7, 1}}
Another approach uses Transpose to separate the bases from their exponents, then uses Inner
to put things back together.
108 Essentials of Programming in Mathematica
Since Tranpose returns a list of two lists in this example, we need to strip the outer list. This is
done by applying Sequence.
In[106]:= ExpandFactors2lis_ := InnerPower, Sequence @@ Transposelis , Times
In[107]:= ExpandFactors2facs
Out[107]= 3 628 800
18. First, here is the prime factorization of a test integer:
In[108]:= lis = FactorInteger[10 !]
Out[108]= {{2, 8}, {3, 4}, {5, 2}, {7, 1}}
Put it all together (using shorthand notation for Apply) and Apply at level one.
In[111]:= PrimeFactorForm[p_] := CenterDot @@ Superscript @@@ FactorInteger[p ]
In[112]:= PrimeFactorForm[20 !]
Out[112]= 218 · 38 · 54 · 72 · 111 · 131 · 171 · 191
Unfortunately, this rule fails for numbers that have only one prime factor.
In[113]:= PrimeFactorForm[9]
Out[113]= CenterDot32
In[115]:= PrimeFactorForm[9]
Out[115]= 32
A subtle point is that Mathematica has automatically ordered these two rules, putting the one
involving prime powers first.
5.1 Functions for manipulating expressions: exercises 109
In[116]:= ? PrimeFactorForm
Global`PrimeFactorForm
PrimeFactorForm[p_ ? PrimePowerQ] :=
First[Apply[Superscript, FactorInteger[p], {1}]]
PrimeFactorForm[p_] :=
CenterDot @@ Apply[Superscript, FactorInteger[p], {1}]
This reordering (we evaluated the rules in a different order) is essential for this function to work
properly. If the general rule was checked first, it would apply to arguments that happen to be
prime powers and it would give wrong answers.
One final point: the expressions returned by PrimeFactorForm will not evaluate like ordinary
expressions due to the use of CenterDot which has no evaluation rules associated with it. You
could add an “interpretation” to such expressions by using Interpretation[����, ����] as
follows.
In[117]:= PrimeFactorForm[p_Integer ] := Withfp = FactorInteger[p ],
Interpretation
CenterDot @@ Superscript @@@ fp,
Times @@ Power @@@ fp
Now the output of the following expression can be evaluated directly to get an interpreted
result.
In[118]:= PrimeFactorForm[12 !]
Out[118]= 210 · 35 · 52 · 71 · 111
19. This is a straightforward application of the Outer function.
In[119]:= VandermondeMatrix[n_, x_] :=
OuterPower, Tablexi , i, 1, n , Range[0, n - 1]
1 x1 x21 x31
1 x2 x22 x32
1 x3 x23 x33
1 x4 x24 x34
20. If we first look at a symbolic result, we should be able to see how to construct our function.
For three vectors and three variables, here is the divergence (think of d as the derivative
operator).
110 Essentials of Programming in Mathematica
3 x2 3 y2 3 z2 3
Out[123]= - - - +
2 5/2 2 5/2 2 5/2 3/2
x2 + y2 + z x2 + y2 + z x2 + y2 + z x2 + y2 + z2
In[124]:= Simplify[%]
Out[124]= 0
Finally, we should note that this definition of divergence is a bit delicate as we are doing no
argument checking at this point. For example, it would be sensible to insure that the length of
the vector list is the same as the length of the variable list before starting the computation. Refer
to Chapter 4 for a discussion of how to use pattern matching to deal with this issue.
21. The Jacobian is given by the following outer product:
In[125]:= JacobianMatrixvec_List , vars_List := Outer[D, vec , vars ]
Add a condition that the dimensions of vec and vars are the same.
In[126]:= JacobianMatrixvec_List , vars_List :=
Outer[D, vec , vars ] /; Dimensions[vec ] ⩵ Dimensions[vars ]
To compute the volume of the hypersphere in dimension two, start with a point in 2
expressed in polar coordinates:
In[127]:= x = ρ Cos[θ];
y = ρ Sin[θ];
Then compute the determinant of the Jacobian.
In[129]:= JacobianMatrix[{x, y}, {ρ, θ}] // MatrixForm
Out[129]//MatrixForm=
Cos[θ] -ρ Sin[θ]
Sin[θ] ρ Cos[θ]
The volume of the hypersphere is obtained by integrating the determinant of the Jacobian over
ρ and θ:
5.2 Iterating functions: exercises 111
In[131]:= IntegrateAbs @ DetJacobianMatrix[{x, y}, {ρ, θ}], {ρ, 0, r}, {θ, 0, 2 π},
Assumptions → r > 0
Out[131]= π r2
3. Following on the example in this section iterating rotations of a triangle, use Translate to
iterate the translation of a square or other polygon.
4. Using Fold, create a function fac[�] that takes an integer n as argument and returns the
factorial of n, that is, n(n - 1) (n - 2) ⋯ 3·2·1.
5. The naive way to multiply x22 would be to repeatedly multiply x by itself, performing 21
multiplications. But going as far back as about 200 bc in the Hindu classic Chandah-sutra,
another method has been known that significantly reduces the total number of multiplications
in performing such exponentiation. The idea is to first express the exponent in base 2.
In[1]:= IntegerDigits[22, 2]
Out[1]= {1, 0, 1, 1, 0}
Then, starting with the second bit from the left, interpret a 1 to mean square the existing
expression and multiply by x, and a 0 to mean multiply just by x. Implement this algorithm
using FoldList.
6. The Sierpiński triangle is a classic iteration example. It can be constructed by starting with an
equilateral triangle and removing the inner triangle formed by connecting the midpoints of
each side of the original triangle.
The process is iterated by repeating the same computation on each of the resulting smaller
triangles (other types of iteration can be used).
⟶ ⟶ … ⟶ …
One approach is to take the starting equilateral triangle and, at each iteration, perform the
appropriate transformations using Scale and Translate, then iterate. Implement this algo-
rithm, but be careful about nesting large symbolic graphics structures too deeply.
5.2 Solutions
1. Here is the code with FixedPointList. The iteration stops when the distance of the iterates to
the origin exceeds 4.0.
In[1]:= Clearf, z, julia
And here it is using NestWhileList. Iteration continues so long as the distance of the iterates to
the origin is less than 4.0.
In[4]:= NestWhileListjulia, -0.5 + 1.5 I, Abs[# ] < 4.0 &
Out[4]= {-0.5 + 1.5 ⅈ, {-0.5 + 1.5 ⅈ, -2.8 - 1.656 ⅈ, 4.29766 + 9.1176 ⅈ}}
2. For a given number, first we need to get its digits and then add their cubes.
In[5]:= IntegerDigits[64]
Out[5]= {6, 4}
In[6]:= IntegerDigits[64]3
Out[6]= {216, 64}
In[7]:= TotalIntegerDigits[64]3
Out[7]= 280
3 1 3 1
Out[12]= Triangle , - , {0, 1}, - , -
2 2 2 2
We will display with opacity turned on so that overlapping triangles will show through.
In[13]:= GraphicsOpacity[.35], EdgeFormBlack, tri
Out[13]=
114 Essentials of Programming in Mathematica
Translate[��, ����] takes a graphics object gr, and translates it according to the vectors vecs.
So for example, here are some translation vectors; the first vector translates by 1/2 unit to the
right, the second vector translates up and to the right.
1 1 3
In[14]:= vecs = , 0, , ;
2 4 4
This translates the triangle using the first translation vector.
In[15]:= Translatetri, {1 / 2, 0}
3 1 3 1 1
Out[15]= TranslateTriangle , - , {0, 1}, - , - , , 0
2 2 2 2 2
The following translation function creates two objects translated by the vectors vecs.
In[16]:= translation[gr_] := Translate[gr , vecs]
3 1 3 1
Out[17]= Triangle , - , {0, 1}, - , - , Translate
2 2 2 2
31 3 1 1 1 3
Triangle , - , {0, 1}, - , - , , 0, ,
2 2 2 2 2 4 4
Here are the translated objects along with a red version of the original triangle.
In[18]:= GraphicsOpacity[.35], EdgeFormBlack, Thin,
tranTri, Red, tri
Out[18]=
4. Starting with 1, fold the Times function across the first n integers.
In[19]:= fac[n_] := FoldTimes, 1, Range[n ]
In[20]:= fac[10]
Out[20]= 3 628 800
5. To compute x25 say, start by expressing the exponent in base 2.
In[21]:= IntegerDigits[25, 2]
Out[21]= {1, 1, 0, 0, 1}
Now starting with the second bit from the left (use Rest), interpret a one to mean square the
5.2 Iterating functions: exercises 115
existing expression and multiply by x, and a zero to mean multiply the existing expression by x.
In[22]:= Clearf, a, b, x
Once you are familiar with pure functions (Section 5.5), this is done directly (without the need
to first define an auxiliary function f) as follows:
In[25]:= FoldList[#1 ^ 2 x ^ #2 &, x, Rest[{1, 1, 0, 0, 1}]]
Out[25]= x, x3 , x6 , x12 , x25
Or you can start with the first bit but you will have to adjust the initial value accordingly.
In[26]:= FoldList[#1 ^ 2 x ^ #2 &, 1, {1, 1, 0, 0, 1}]
Out[26]= 1, x, x3 , x6 , x12 , x25
Here is the set of transformations of the triangle described by vertices, scaled by 0.5, and
translated according to the translation vectors.
116 Essentials of Programming in Mathematica
Out[33]=
Out[34]=
Once you have been through the rest of this chapter, you should be able to turn this into a
reusable function, scoping local variables, using pure functions, and adding options.
In[37]:= SierpinskiTriangleiter_, opts : OptionsPatternGraphics :=
Modulevertices, vecs,
vertices = N[{{0, 0}, {1, 0}, {1 / 2, 1}}];
vecs = 0.5 vertices;
GraphicsBlue, NestBlue, TranslateScale[# , 0.5, {0., 0.}], vecs &,
Polygonvertices, iter , opts
5.3 Recursive functions: exercises 117
In[36]:= SierpinskiTriangle[9]
Out[36]=
Create a recursive function TowerOfHanoi[�] that computes the minimal number of moves
for a stack of n disks over three pegs. Results for n = 1, 2, …, 10 are as follows:
{1, 3, 7, 15, 31, 63, 127, 255, 511, 1023}
Legend has it that the priests in the Indian temple Kashi Vishwanath have a room with a stack
of 64 disks and three pegs and that when they complete moving the stack to a new peg, the
world will end. If they move one disk per second, compute how long until the “end of the
world.”
4. For each of the following sequences of numbers, see if you can deduce the pattern and write a
function to compute the general term:
2, 3, 6, 18, 108, 1944, 209 952, …
a.
A1 A2 A3 A4 A5 A6 A7 …
118 Essentials of Programming in Mathematica
F-n = (-1)n-1 Fn
The first few terms are
0 1 -1 2 -3 5 -8 13 -21 …
F0 F-1 F-2 F-3 F-4 F-5 F-6 F-7 F-8 …
Write the definitions for Fibonacci numbers with negative integer arguments.
6. Create a recursive function to reverse the elements in a flat list.
7. Create a recursive function to transpose the elements of two lists. Write an additional rule to
transpose the elements of three lists.
8. Using dynamic programming is one way to speed up the computation of Fibonacci numbers,
but another is to use different algorithms. A more efficient algorithm is based on the following
identities:
F1 = 1
F2 = 1
F2n = 2Fn-1 Fn + F2n , for n ≥ 1
2 + F2 ,
F2n+1 = Fn+1 for n ≥ 1
n
n n-1 n-1
= k + 1 + n - k , for n > 0,
k k k-1
0 1 k=0
=
k 0 k ≠ 0.
Create a function EulerianNumber[�, �]. You can check your work against Table 5.1, which
displays the first few Eulerian numbers.
Table 5.1. ������������������������
n n n n n n n n n
� 0 1 2 3 4 5 6 7 8
0 1
1 1 0
2 1 1 0
3 1 4 1 0
4 1 11 11 1 0
5 1 26 66 26 1 0
6 1 57 302 302 57 1 0
7 1 120 1191 2416 1191 120 1 0
8 1 247 4293 15 619 15 619 4293 247 1 0
Because of the triple recursion, you will find it necessary to use a dynamic programming
implementation to compute any Eulerian numbers of even modest size.
Hint: Although the above formulas will compute it, you can add the following rule to simplify
some of the computation (Graham, Knuth, and Patashnik 1994):
n
= 0, for k ≥ n
k
11. The Collatz sequence is generated as follows: starting with a number n, if it is even, then output
n/2; if it is odd, then output 3 n + 1. Iterate this process while the value of the iterate is not equal
to one. Using recursion and dynamic programming, create the function collatz[�, �], which
computes the ith iterate of the Collatz sequence starting with integer n. Compare its speed with
that of the procedural approach in Exercise 10 of Section 5.4.
5.3 Solutions
1. Thinking about the powers of two recursively, we have 2n = 2 × 2n-1 . The base case is 20 = 1.
In[1]:= powersOf2[0] = 1;
Check that the rule is not called for nonintegers or negative numbers.
In[7]:= fact[3.6]
Out[7]= fact[3.6]
In[8]:= fact[-4]
Out[8]= fact[-4]
3. For the base case, it only takes one move to move a disk from one peg to another.
In[9]:= hanoi[1] = 1;
To move a stack of n disks, move the top n - 1 disks, then move the bottom disk, then move the
n - 1 disks again. Here is the recursion.
In[10]:= hanoi[n_] := 2 hanoi[n - 1] + 1
And here are the number of moves for puzzles with one through ten disks.
In[11]:= Tablehanoii, i, 10
Out[11]= {1, 3, 7, 15, 31, 63, 127, 255, 511, 1023}
In[14]:= a[1] := 2
a[2] := 3
ai_ := ai - 1 ai - 2
5.3 Recursive functions: exercises 121
b. The sequence is obtained by taking the difference of the previous two values.
In[18]:= b[1] := 0
b[2] := 1
bi_ := bi - 2 - bi - 1
In[28]:= f[0] = 0;
f[-1] = 1;
In[30]:= Tablefi, i, 0, -8, -1
Out[30]= {0, 1, -1, 2, -3, 5, -8, 13, -21}
6. This is similar to the length function in the text – recursion is on the tail. The base case is a list
consisting of a single element.
In[31]:= reverse[{x_, y__}] := Join[reverse[{y }], {x }]
In[32]:= reverse[{x_}] := {x }
In[37]:= transpose[%]
Out[37]= {{x1 , x2 }, {y1 , y2 }}
8. This implementation uses the identities given in the exercise together with some pattern
matching for the even and odd cases.
In[38]:= F[1] := 1
F[2] := 1
n n n 2
In[40]:= Fn_ ? EvenQ := 2 F - 1 F + F
2 2 2
n -1 2 n -1 2
Fn_ ? OddQ := F + 1 + F
2 2
In[42]:= Map[F, Range[10]]
Out[42]= {1, 1, 2, 3, 5, 8, 13, 21, 34, 55}
This is fairly fast, even compared with the built-in Fibonacci which uses a method based on
the binary digits of n.
In[50]:= TimingFibonacci105 ;
Out[50]= {0.000171, Null}
10. Here are the rules translated directly from the formulas given in the exercise.
In[51]:= EulerianNumber0, k_ = 0;
EulerianNumber[n_Integer , 0] = 1;
EulerianNumbern_Integer , k_Integer /; k ≥ n = 0;
This is a good candidate for dynamic programming. In the following implementation we have
temporarily reset the value of $RecursionLimit using Block.
In[57]:= ClearEulerianNumber;
collatzn , i - 1
In[66]:= collatzn_, i_ := collatzn , i = /; EvenQcollatzn , i - 1
2
In[68]:= collatz[27, 5]
Out[68]= 31
Here is the Collatz sequence for 27. This sequence takes a while to settle down to the cycle 4, 2, 1.
In[69]:= Tablecollatz27, i, i, 0, 114
Out[69]= {27, 82, 41, 124, 62, 31, 94, 47, 142, 71, 214, 107, 322, 161, 484, 242, 121, 364,
182, 91, 274, 137, 412, 206, 103, 310, 155, 466, 233, 700, 350, 175, 526, 263, 790,
395, 1186, 593, 1780, 890, 445, 1336, 668, 334, 167, 502, 251, 754, 377, 1132,
566, 283, 850, 425, 1276, 638, 319, 958, 479, 1438, 719, 2158, 1079, 3238, 1619,
4858, 2429, 7288, 3644, 1822, 911, 2734, 1367, 4102, 2051, 6154, 3077, 9232,
4616, 2308, 1154, 577, 1732, 866, 433, 1300, 650, 325, 976, 488, 244, 122, 61,
184, 92, 46, 23, 70, 35, 106, 53, 160, 80, 40, 20, 10, 5, 16, 8, 4, 2, 1, 4, 2, 1}
In[3]:= abs[3 + 4 I]
GreaterEqual::nord : Invalid comparison with 3 + 4 ⅈ attempted.
Out[3]= abs[3 + 4 ⅈ]
Rewrite abs to include a specific rule for the case where its argument is complex.
5.4 Loops and flow control: exercises 125
5. One of the fastest methods for computing Fibonacci numbers (Section 5.3) involves iterating
multiplication of the matrix {{0, 1}, {1, 1}} and pulling off the appropriate part. For example, the
last element in the output of mat9 is the tenth Fibonacci number.
In[6]:= Fibonacci[10]
Out[6]= 55
Without using MatrixPower, create a function FibMat[�] that iterates the matrix multiplica-
tion and then pulls off the correct element from the resulting matrix to give the nth Fibonacci
number. Check the speed of your implementation against both MatrixPower and the built-in
Fibonacci.
6. Using an If control structure, create a function median[���] that computes the median (the
middle value) of a one-dimensional list. You will need to consider the case when the length of
the list is odd and the case when it is even. In the latter case, the median is given by the average
of the middle two elements of the sorted list.
7. Given a set of data representing a sine wave, perform a clipping operation where values greater
than 0.5 are clipped to 0.5, values less than -0.5 are clipped to -0.5, and all other values are left
unchanged (Figure 5.3).
Figure 5.3. Discrete data of sine wave together with data clipped at amplitude 0.5.
Original data Clipped data
1.0 1.0
0.5 0.5
1 2 3 4 5 6 1 2 3 4 5 6
-0.5 -0.5
-1.0 -1.0
8. Rewrite the WhatAmI function from this section so that it properly deals with expressions such
as π and ⅇ that are numerical but not explicit numbers.
9. The bibliography example in Section 3.4 is unable to properly handle a key that has a missing
value. For example, the following association has no value for both the "Issue" key and the
"Pages" key:
126 Essentials of Programming in Mathematica
In[8]:= art2 = Association"Author" → "Hathaway, David H.", "Title" → "The solar cycle",
"Journal" → "Living Reviews in Solar Physics", "Year" → 2010,
"Volume" → 7, "Issue" → "", "Pages" → "",
"Url" → "http://dx.doi.org/10.12942/lrsp-2010-1";
In[9]:= art2"Issue"
Out[9]=
Suppose you were interested in creating a formatted bibliographic reference that displayed
volume 7, issue 4 as 7(4). But if the issue value is missing, it should display the volume value
only. Create a function that takes the volume and issue values and displays the correct informa-
tion regardless of whether or not the issue number is present.
In[10]:= volIss[art2]
Out[10]= �
10. In Exercise 11, Section 5.3 we introduced Collatz numbers using recursion. Write a procedural
implementation, CollatzSequence[�], that produces the Collatz sequence for any positive
integer n. Consider using NestWhileList. Here is the Collatz sequence for initial value 22:
In[11]:= CollatzSequence[22]
Out[11]= {22, 11, 34, 17, 52, 26, 13, 40, 20, 10, 5, 16, 8, 4, 2, 1}
11. Write a version of the Manipulate example visualizing interpolation order that used Which to
instead use Switch.
12. Compute the square root of two using Nest (see Section 5.2) and compare with the versions in
this section using a Do loop.
13. Do is closely related to Table, the main difference being that Do does not return any value,
whereas Table does. Use Table instead of Do to rewrite one of the findRoot functions given in
this section. Compare the efficiency of the two approaches.
14. Compute Fibonacci numbers iteratively. The first few values in the Fibonacci sequence are 1, 1,
2, 3, 5, 8, 13, …, where, after the first two 1s, each number is the sum of the previous two num-
bers in the sequence. You will need two variables, say this and prev, giving the two most
recent Fibonacci numbers, so that after the ith iteration, this and prev have the values Fi and
Fi-1 , respectively.
15. As mentioned in the discussion of Newton’s method for root finding, one type of difficulty that
can arise occurs when the derivative of the function in question is either difficult or impossible
to compute. As a very simple example, consider the function x + 3 , which has a root at
x = -3. Both the built-in function FindRoot and our user-defined findRoot will fail with this
function, since a symbolic derivative cannot be computed.
One way around such problems is to use a numerical derivative (as opposed to an analytic
derivative). The secant method approximates f ′ (xk ) using the difference quotient:
fxk -fxk-1
xk -xk-1
Implement a version of findRoot using the secant method by creating a rule that takes two
initial values: findRoot[� , {���, �, �}].
16. Using a While loop, write a function gcd[�, �] that computes the greatest common divisor
(gcd) of m and n. The Euclidean algorithm for computing the gcd of two positive integers m and
n, sets m = n and n = m mod n. It iterates this process until n = 0, at which point the gcd of m and
n is left in the value of m.
17. Write the function gcd[�, �] implementing the Euclidean algorithm using an If function.
18. A permutation of the elements of a list is a reordering of the elements such that the original list
and the reordered list are in one-to-one correspondence. For example, the permutations of the
list a, b, c are a, b, c, a, c, b, b, a, c, b, c, a, c, a, b, c, b, a.
One way to create a permutation of the elements of a list lis is to start by randomly selecting
one element from lis and putting it in a temporary list, lis2 say. Then select one element from
the complement of lis and lis2 and repeat the process. Using a Do loop, create a function
randomPermutation that implements this procedure.
19. Create a program InversePermutation[�] that takes a list �, that is a permutation of the
numbers one through n, and returns the inverse permutation ip. The inverse permutation ip is
such that �〚��〚�〛〛 = ��〚�〚�〛〛 = �. Check you answer against the built-in Ordering function.
See Sedgewick and Wayne (2007) for a discussion of inverse permutations.
20. Create a procedural definition for each of the following functions. For each function, create a
definition using a Do loop and another using Table.
For example, the following function first creates an array consisting of zeros of the same
dimension as mat. Then inside the Do loop it assigns the element in position {j, k} in mat to
position {k, j} in matA, effectively performing a transpose operation. Finally, it returns matA,
since the Do loop itself does not return a value.
In[13]:= transposeDo[mat_] :=
ModulematA, rows = Length[mat ], cols = Length[mat [[1]]], j, k,
matA = ConstantArray0, rows, cols;
DomatAj, k = mat k, j,
j, 1, rows,
k, 1, cols;
matA
128 Essentials of Programming in Mathematica
In[16]:= MatrixForm[transposeDo[mat1]]
Out[16]//MatrixForm=
a d g
b e h
c f i
This same computation could be performed with a structured iteration using Table.
5.4 Solutions
1. If, for element aij , i is bigger than j, then we are below the diagonal and should insert 0, other-
wise insert a 1.
In[1]:= UpperTriangularMatrix[{m_, n_}] := TableIfi ≥ j, 0, 1, i, m , j, n
A default value can be given for an optional argument that specifies the elements above the
diagonal.
In[2]:= UpperTriangularMatrix{m_, n_}, val_: 1 :=
TableIfi ≥ j, 0, val , i, m , j, n
In[22]:= abs[-3]
Out[22]= 3
The condition itself can appear on the left-hand side of the function definition, as part of the
pattern match. Here is a slight variation on the abs definition.
In[23]:= Clearabs
abs[x_] := If[x ≥ 0, x , -x ]
absx_ /; x ∈ Complexes := SqrtRe[x ]2 + Im[x ]2
In[26]:= abs[3 + 4 I]
Out[26]= 5
In[27]:= abs[-3]
Out[27]= 3
5. The iteration can be done with a Do loop. First, initialize the matrix tempmat to {{0, 1}, {1, 1}}.
Then multiply tempmat by the original matrix and reset tempmat to this new value. Repeat n - 2
times and then pull off the second element in the second row.
In[28]:= FibMat[n_] := Module[{tempmat = {{0, 1}, {1, 1}}},
Do[tempmat = tempmat.{{0, 1}, {1, 1}}, {n - 2}];
Part[tempmat, 2, 2]
]
5.4 Loops and flow control: exercises 131
In[29]:= TimingFibMat[201]
Out[29]= {0.004827, 453 973 694 165 307 953 197 296 969 697 410 619 233 826}
In[30]:= TimingFibonacci[201]
Out[30]= {0.000019, 453 973 694 165 307 953 197 296 969 697 410 619 233 826}
6. If the number of elements in the list is odd, then the median is the middle element of the sorted
list. Divide the length in two and take the next greater integer using Ceiling to get the position
of the middle element.
In[31]:= lis = {5, 7, 2, 13, 1};
CeilingLengthlis 2
Out[32]= 3
If the length of the list is even, we take the average of the middle two elements of the sorted list.
In[34]:= lis = {65, 2, 78, 5};
In[37]:= Mean[%]
Out[37]= 35
Here then is the function using If to branch when the length of the list is odd or even. The
pattern lis : {__} is matched by a list with one or more elements. We name the pattern lis
so that we can refer to it on the right-hand side of the definition.
In[38]:= medianPlis : {__} := Modulelen = Lengthlis ,
IfOddQlen,
PartSortlis , Ceilinglen 2,
Mean @ PartSortlis , len 2 ;; len 2 + 1
Here are some test data.
In[39]:= dataO = RandomInteger[10 000, 100 001];
dataE = RandomInteger[10 000, 100 000];
This compares our function with the built-in Median function.
132 Essentials of Programming in Mathematica
In[47]:=
ListPlotdata, PlotLabel → "Original data",
ListPlotclipped, PlotLabel → "Clipped data", PlotRange → {-1, 1}
Original data Clipped data
1.0
1.0
0.5 0.5
Out[47]= ,
1 2 3 4 5 6 1 2 3 4 5 6
-0.5 -0.5
-1.0
-1.0
8. An additional clause is need in the Which expression, one that handles expressions that are
numeric but not explicit numbers.
In[48]:= WhatAmI[expr_] := Switchexpr ,
_Integer, "I am an integer",
_Rational, "I am rational",
_Real, "I am real",
_Complex, "I am complex",
_ ? NumericQ, "I am numeric",
_, "I am not a number"
In[49]:= WhatAmI[π]
Out[49]= I am numeric
9. Here is the function to extract and format the volume information. Here we make the volume
number format in bold.
In[51]:= getVolumeref_ := Styleref "Volume", "TR", FontWeight → "Bold"
In[54]:= art2 = Association"Author" → "Hathaway, David H.", "Title" → "The solar cycle",
"Journal" → "Living Reviews in Solar Physics", "Year" → 2010,
"Volume" → 7, "Issue" → "", "Pages" → "",
"Url" → "http://dx.doi.org/10.12942/lrsp-2010-1";
In[55]:= volIss[art2]
Out[55]= �
10. First, define the auxiliary function using conditional statements.
n
In[56]:= collatz[n_] := /; EvenQ[n ]
2
In[57]:= collatz[n_] := 3 n + 1 /; OddQ[n ]
Alternatively, use If.
In[58]:= collatzn_Integer ? Positive := If[EvenQ[n ], n / 2, 3 n + 1]
Then iterate Collatz, starting with n, and continue while n is not equal to 1.
In[59]:= CollatzSequence[n_] := NestWhileListcollatz, n , # ≠ 1 &
In[60]:= CollatzSequence[17]
Out[60]= {17, 52, 26, 13, 40, 20, 10, 5, 16, 8, 4, 2, 1}
11. Here is the version of the Manipulate example using Switch instead of Which.
In[61]:= data3D = TableSin[x y], {x, 0, 4, 0.5}, {y, 0, 4, 0.5};
134 Essentials of Programming in Mathematica
In[62]:= Manipulate
ListPlot3Ddata3D, InterpolationOrder → order,
PlotLabel →
Switchorder,
"None", "Linear",
0, "Voronoi cells",
1, "Baricentric",
2, "Natural neighbor",
order, "None", "Interpolation order", "None", 0, 1, 2,
SaveDefinitions → True
Out[62]=
12. To compute the square root of a number r, iterate the following expression.
In[63]:= fun[x_] := x 2 - r;
fun[x]
Simplifyx -
fun '[x]
r + x2
Out[64]=
2x
This can be written as a pure function, with a second argument giving the initial guess. Here we
iterate ten times, starting with a high-precision initial value, 2.0 to 30-digit precision.
r + #2
In[65]:= nestSqrtr_, init_ := Nest &, init , 10
2#
In[66]:= nestSqrt[2, N[2, 30]]
Out[66]= 1.41421356237309504880168872
13. Here is a first basic attempt to replace the Do loop with Table.
In[67]:= f[x_] := x 2 - 2
5.4 Loops and flow control: exercises 135
In[68]:= a = 2;
f[a]
Tablea = Na - , {10}
f′ [a]
Out[69]= {1.5, 1.41667, 1.41422, 1.41421, 1.41421,
1.41421, 1.41421, 1.41421, 1.41421, 1.41421}
Both of these implementations are quite fast and avoid the deep recursion of the classical
definition.
136 Essentials of Programming in Mathematica
You can avoid the need for the temporary variable tmpa by performing a parallel assignment as
in the following function. In addition, some argument checking insures that m and n are
integers.
In[84]:= gcd[m_Integer , n_Integer ] := Modulea = m , b = n ,
Whileb > 0,
a, b = b, Moda, b;
a
The idea is to choose a position within the list at random and remove the element in that
position and put it into a new list lis2.
In[90]:= x = RandomChoicelis
Out[90]= 4
We then repeat the above process on the remaining elements of the list. Note that lis is
assigned the value of this new list, thus overwriting the previous value.
In[93]:= lis = Complementlis, {x}
Out[93]= {1, 2, 3, 5, 6, 7, 8, 9, 10}
In[94]:= x = RandomChoicelis
lis2 = Appendlis2, x
lis = Complementlis, lis2
Out[94]= 8
Out[95]= {4, 8}
In this example we know explicitly how many iterations to perform in our Do loop: n iterations,
where n is the length of the list, lis.
In[97]:= Clearlis, lis2, x;
Now we just put the pieces of the previous computations together in one input.
138 Essentials of Programming in Mathematica
And here is a random permutation of the lowercase letters of the English alphabet.
In[107]:= alphabet = CharacterRange"a", "z"
Out[107]= a, b, c, d, e, f, g, h, i, j, k, l, m, n, o, p, q, r, s, t, u, v, w, x, y, z
In[108]:= randomPermutationalphabet
Out[108]= b, j, s, k, q, v, u, n, h, m, e, d, c, p, x, z, f, y, r, o, i, t, a, g, w, l
In[112]:= p = RandomSample[Range[10]]
Out[112]= {1, 8, 3, 2, 6, 10, 5, 7, 9, 4}
Initialize the inverse permutation to a list of the same length as p but filled with zeros to start.
In[113]:= ip = Table0, i, Length[p]
Out[113]= {0, 0, 0, 0, 0, 0, 0, 0, 0, 0}
b. The key to this problem is to use the Mod operator to compute the target address for any
item from vec. That is, the element vec[�] must move to, roughly speaking, position n + i
mod Length[vec]. The “roughly speaking” is due to the fact that the Mod operator returns
values in the range 0 to Length[vec] - 1, whereas vectors are indexed by values 1 up to
Length[vec]. This causes a little trickiness in this problem.
In[123]:= rotateRight[vec_, n_] := ModulevecA, len = Length[vec ],
vecA = ConstantArray0, len;
DovecA1 + Modn + i - 1, len = vec i, i, 1, len;
vecA
In[129]:= digitRoot[7763]
Out[129]= 5
Looking ahead to Chapter 6 where localization is discussed, you could also accomplish this
with an iteration using a While loop.
In[130]:= digitRoot2n_Integer ? Positive := Modulelocn = n , lis,
While
Lengthlis = IntegerDigits @ locn > 1,
locn = Totallis;
locn
5.4 Loops and flow control: exercises 141
In[131]:= digitRoot2[7763]
Out[131]= 5
22. This is a direct implementation using Piecewise.
In[132]:= Piecewise[{{0, x ⩵ 0 && y ⩵ 0}, {-1, y ⩵ 0}, {-2, x ⩵ 0}, {1, x > 0 && y > 0},
{2, x < 0 && y > 0}, {3, x < 0 && y < 0}}, 4]
0 x ⩵ 0 && y ⩵ 0
-1 y ⩵ 0
-2 x ⩵ 0
Out[132]= 1 x > 0 && y > 0
2 x < 0 && y > 0
3 x < 0 && y < 0
4 True
In[138]:= tallylis
Out[138]= {{a, 10}, {b, 6}, {c, 4}}
Here is another implementation. Here we are creating rules for each unique element
(counter[#]) and then incrementing the values for those rules each time the counter comes
across an element.
In[140]:= tally2lis_ := Moduleulist = Unionlis , counter,
counter[_] = 0;
Mapcounter[# ] ++ &, lis ;
Map{# , counter[# ]} &, ulist
In[141]:= tally2lis
Out[141]= {{a, 10}, {b, 6}, {c, 4}}
In[143]:= Timingtallydata
Out[143]= {0.975904, {{0, 5078}, {1, 5041}, {2, 4928}, {3, 4973},
{4, 4969}, {5, 5037}, {6, 4875}, {7, 5040}, {8, 5014}, {9, 5045}}}
In[144]:= Timingtally2data
Out[144]= {0.180405, {{0, 5078}, {1, 5041}, {2, 4928}, {3, 4973},
{4, 4969}, {5, 5037}, {6, 4875}, {7, 5040}, {8, 5014}, {9, 5045}}}
In[145]:= TimingTallydata
Out[145]= {0.000122, {{2, 4928}, {8, 5014}, {5, 5037}, {4, 4969},
{3, 4973}, {9, 5045}, {6, 4875}, {7, 5040}, {0, 5078}, {1, 5041}}}
6. Rewrite the example from Section 5.2 in which NestList was used to perform several rota-
tions of a triangle to instead use pure functions and dispense with the auxiliary function
rotation used to specify the rotation angles.
7. Given a set of numerical data, extract all those data points that are within one standard devia-
tion of the mean of the data.
In[3]:= MultiplyCounta x3 + b x2 + c x + d
Out[3]= 6
In[5]:= Binomial[n + 1, 2]
1
Out[5]= n (1 + n)
2
144 Essentials of Programming in Mathematica
This, of course, grows quadratically with n, whereas Horner’s method grows linearly. Create a
function HornerPolynomial[���, ���] that gives a representation of a polynomial in Horner
form. Here is some sample output that your function should generate:
In[7]:= Expand[%]
Out[7]= d + c x + b x2 + a x3
13. Find all words in the dictionary that start with the letter q and are of length five. The following
gets all the words in the dictionary that comes with Mathematica and displays a random sample:
Out[11]=
Finally, create a set of lines from the origin to each of the points on the circle and display using
code similar to the following:
Out[12]=
5.5 Pure functions: exercises 145
15. Use FoldList to compute an exponential moving average of a list {�1 , �2 , �3 }. You can check
your result against the built-in ExponentialMovingAverage.
In[13]:= ExponentialMovingAverage[{x1 , x2 , x3 }, α]
Out[13]= {x1 , -(-1 + α) x1 + α x2 , -(-1 + α) (-(-1 + α) x1 + α x2 ) + α x3 }
16. A well-known programming exercise in many languages is to generate Hamming numbers,
sometimes referred to as regular numbers. These are numbers that divide powers of 60 (the
choice of that number goes back to the Babylonians, who used 60 as a number base). Generate
a sorted sequence of all Hamming numbers less than 1000. The key observation is that these
numbers have only 2, 3, and 5 as prime factors.
17. In the text, we developed FunctionsWithAttributes to find all built-in functions with a
particular attribute. Create a new function to find all built-in functions with a given option. For
example:
In[14]:= FunctionsWithOptionStepMonitor
Out[14]= {FindArgMax, FindArgMin, FindFit, FindMaximum, FindMaxValue,
FindMinimum, FindMinValue, FindRoot, NArgMax, NArgMin, NDSolve,
NDSolveValue, NMaximize, NMaxValue, NMinimize, NMinValue,
NonlinearModelFit, NRoots, ParametricNDSolve, ParametricNDSolveValue}
Several changes from FunctionsWithAttributes will be necessary: Options does not take a
string as an argument; and options are often given as nested lists of rules, requiring mapping at
the appropriate level. You might also want to delete all functions beginning with $, such as
$Context, to help speed the computation.
18. Graphs that are not too dense are often represented using adjacency structures which consist
of a list for each vertex vi that includes those other vertices that vi is connected to. Create an
adjacency structure for any graph, directed or undirected. For example, consider the graph gr
below.
�
� �
Out[15]=
�
�
�
Start by creating an adjacency list for any given vertex; that is, a list of those vertices to which
the given vertex is connected. The adjacency list for vertex 4 in the above graph would be
{1, 8, 2, 3}.
The adjacency structure is then the list of adjacency lists for every vertex in that graph. It is
common to prepend each adjacency list with its vertex; typically the adjacency structure takes
146 Essentials of Programming in Mathematica
the following form where this syntax indicates that vertex 1 is connected to vertices 4, 5, and 8;
vertex 2 is connected to vertices 3, 4, 7, and 8; and so on.
{{1, {4, 5, 8}}, {2, {3, 4, 7, 8}}, {3, {2, 4, 7}}, {4, {1, 2, 3, 8}},
{5, {1, 6, 7}}, {6, {5}}, {7, {2, 3, 5}}, {8, {1, 2, 4}}}
19. One common use of graphs is to analyze the relationships of the objects under study. For
example, if you were interested in finding all objects a certain distance from a given object, you
could use NeighborhoodGraph.
Here is a grid graph on which we can start prototyping:
7 14 21 28 35 42 49
6 13 20 27 34 41 48
5 12 19 26 33 40 47
4 11 18 25 32 39 46
Out[17]=
3 10 17 24 31 38 45
2 9 16 23 30 37 44
1 8 15 22 29 36 43
But suppose you were interested in all those vertices precisely distance two from vertex 25.
Implement this using two different approaches: one in which you use NeighborhoodGraph
and another using a two-argument form of VertexList in which the second argument is a
pattern.
20. Create a “composition” using the digits of π to represent notes on the C scale, where a digit n is
interpreted as a note n semitones from middle C. For example, the first few digits 1, 4, 1, 5 would
give the notes one, four, one, and five semitones from middle C.
You can generate tones using Sound and SoundNote. For example, this emits a tone five
semitones above middle C of duration one second:
acyclic graphs is available via GraphData["Acyclic"]. See McKay et al. (2004) for informa-
tion about acyclic graphs and the eigenvalues of their adjacency matrices.
Out[20]=
In[21]:= AcyclicGraphQ[gr]
Out[21]= True
5.5 Solutions
1. The pure function is Sin[#] / # &.
In[1]:= MapSin[# ] # &, {0, π / 6, π / 4, π / 3, π / 2}
1
Power::infy : In�nite expression encountered.
0
In�nity::indet : Indeterminate expression 0 ComplexIn�nity encountered.
3 2 2 3 3 2
Out[1]= Indeterminate, , , ,
π π 2π π
Since Sinc is listable, it automatically maps across lists.
In[2]:= Sinc[{0, π / 6, π / 4, π / 3, π / 2}]
3 2 2 3 3 2
Out[2]= 1, , , ,
π π 2π π
Use a piecewise function to properly deal with the point at zero.
3 2 2 3 3 2
Out[3]= 1, , , ,
π π 2π π
2. One test for a number to be a square number is that its square root is an integer.
In[4]:= SelectRange[1000], IntegerQ # &
Out[4]= {1, 4, 9, 16, 25, 36, 49, 64, 81, 100, 121, 144, 169, 196, 225, 256, 289,
324, 361, 400, 441, 484, 529, 576, 625, 676, 729, 784, 841, 900, 961}
148 Essentials of Programming in Mathematica
3. To compute the distance between two points, use either EuclideanDistance or Norm.
In[5]:= pts = RandomReal[1, {4, 2}]
Out[5]= {{0.578624, 0.852785}, {0.917576, 0.509619},
{0.187069, 0.755342}, {0.879409, 0.277697}}
Now we need the distance between every pair of points. So we first create the set of pairs.
In[8]:= pairs = Subsets[pts, {2}]
Out[8]= {{{0.578624, 0.852785}, {0.917576, 0.509619}},
{{0.578624, 0.852785}, {0.187069, 0.755342}},
{{0.578624, 0.852785}, {0.879409, 0.277697}},
{{0.917576, 0.509619}, {0.187069, 0.755342}},
{{0.917576, 0.509619}, {0.879409, 0.277697}},
{{0.187069, 0.755342}, {0.879409, 0.277697}}}
Then we compute the distance between each pair and take the Max.
In[9]:= ApplyNorm[#1 - #2 ] &, pairs, {1}
Out[9]= {0.482339, 0.403498, 0.648998, 0.770727, 0.235042, 0.841118}
In[10]:= Max[%]
Out[10]= 0.841118
Or, use Outer on the set of points directly, but note the need to get the level correct.
In[11]:= Max @ Outer[Norm[#1 - #2 ] &, pts, pts, 1]
Out[11]= 0.841118
Now put it all together using a pure function in place of the distance function. The diameter
function operates on lists of pairs of numbers, so we need to specify them in our pure function
as #1 and #2.
In[12]:= diameterlis_ := MaxApplyNorm[#1 - #2 ] &, Subsetslis , {2}, {1}
In[13]:= diameter[pts]
Out[13]= 0.841118
EuclideanDistance is a bit faster here, but for large data sets, the difference is more
pronounced.
5.5 Pure functions: exercises 149
In[22]:= RepUnit[7]
Out[22]= 1 111 111
This can also be done in a functional style by first creating a list of the appropriate number of
ones using ConstantArray, then converting that to an integer with FromDigits.
In[24]:= RepUnit[n_] := FromDigits[ConstantArray[1, {n }]]
In[25]:= RepUnit[11]
Out[25]= 11 111 111 111
6. First, here is the triangle.
In[26]:= vertices = {0, 0}, {1, 0}, 1 / 2, 3 2;
150 Essentials of Programming in Mathematica
Out[28]=
Out[30]=
In[32]:= μ = Meandata;
σ = StandardDeviationdata;
len = Lengthdata;
ListPlotdata,
Epilog → Dashed, Red,
Line{0, μ + σ}, len, μ + σ,
Line{0, μ - σ}, len, μ - σ
-1
-2
-3
Select those data elements whose distance to the mean is less than one standard deviation.
In[36]:= filtered = Selectdata, Abs[(# - μ)] < σ &;
Here is a quick check that we get about the value we might expect (we would expect about 68%
for normally distributed data).
Lengthfiltered
In[37]:= N
Lengthdata
Out[37]= 0.68
0.5
Out[38]=
50 100 150 200 250 300
-0.5
-1.0
152 Essentials of Programming in Mathematica
8. This function uses a default value of 2 for the base. (Try replacing Fold with FoldList to see
more clearly what this function is doing.)
In[39]:= convertdigits_List , base_ : 2 := Foldbase #1 + #2 &, 0, digits
Here are the digits for 9 in base 2:
In[40]:= IntegerDigits[9, 2]
Out[40]= {1, 0, 0, 1}
In[44]:= Expand[%]
Out[44]= e + d x + c x2 + b x3 + a x4
9. Using the list of step increments in the north, south, east, and west directions, this ten-step walk
starts at the origin.
In[45]:= SeedRandom[0];
NSEW = {{1, 0}, {-1, 0}, {0, 1}, {0, -1}};
NestList#1 + RandomChoice[NSEW] &, {0, 0}, 10
Out[47]= {{0, 0}, {0, 1}, {0, 2}, {-1, 2}, {-1, 1},
{0, 1}, {1, 1}, {1, 2}, {2, 2}, {3, 2}, {3, 3}}
Except for the initial value, you can get the same result with Accumulate which generates
cumulative sums.
In[48]:= SeedRandom[0];
AccumulateRandomChoice[NSEW, 10]
Out[49]= {{0, 1}, {0, 2}, {-1, 2}, {-1, 1}, {0, 1}, {1, 1}, {1, 2}, {2, 2}, {3, 2}, {3, 3}}
10. The key here is to take any expression of the form ��� ⩵ ��� and extract the appropriate
function whose root you will compute using the previous implementations of findRoot.
Looking at the internal form of an equation, some thought should convince you that ��� - ���
is the expression whose root we want.
5.5 Pure functions: exercises 153
In[50]:= expr = x2 ⩵ 2;
FullForm[expr]
Out[51]//FullForm= Equal[Power[x, 2], 2]
And here is the pure function that we will use with NestWhile.
In[52]:= var = x;
expr /. Equala_, b_ ⧴ FunctionEvaluate @ var, a - b
Out[53]= Functionx, x2 - 2
In[54]:= ClearfindRoot;
findRootexpr_Equal , var_, init_, ϵ_: 0.0001 := Moduleresult, fun,
fun = expr /. Equala_, b_ ⧴ FunctionEvaluate @ var , a - b ;
fun[# ]
result = NestWhile# - &, init , Absfun[# ] > ϵ &;
fun '[# ]
var → result
Alternatively, you could use Reap and Sow. Be careful where you place the closing bracket for
Sow.
154 Essentials of Programming in Mathematica
In[62]:= ClearfindRootList;
findRootListexpr_, var_, init_, ϵ_: 0.0001 :=
Moduleresult, fun = FunctionEvaluate[var ], expr ,
fun[# ]
Reap @ NestWhileSow# - &, Ninit , Absfun[# ] > ϵ &
fun '[# ]
In[64]:= findRootListCos[x], {x, .5}, 10-15
Out[64]= {1.5708, {{2.33049, 1.38062, 1.57312, 1.5708, 1.5708}}}
12. Using Fold, this pure function requires two arguments. The key is to start with an initial value
of zero.
In[65]:= HornerPolynomiallist_List , var_ := Foldvar #1 + #2 &, 0, list
In[67]:= Expand[%]
Out[67]= e + d x + c x2 + b x3 + a x4
13. Here are the words from the built-in Mathematica dictionary.
In[68]:= words = DictionaryLookup[];
Here are those words that start with the letter q.
In[69]:= DictionaryLookup"q" ~~ __;
RandomSample[%, 20]
Out[70]= quadruples, quaffs, quark, quarantining, quahogs, quaff, quickie,
quadrupled, quires, quit, quell, quints, quizzes, quadriplegia,
quotation, quacking, quilter, queered, quintuple, quarterfinals
And here are those words that start with the letter q and are of length five. Note the need for
StringLength, not Length.
In[71]:= SelectDictionaryLookup"q" ~~ __, StringLength[# ] ⩵ 5 &
Out[71]= quack, quads, quaff, quail, quake, quaky, qualm, quark, quart,
quash, quasi, quays, queen, queer, quell, quern, query, quest, queue,
quick, quids, quiet, quiff, quill, quilt, quins, quint, quips, quire,
quirk, quirt, quite, quits, quoin, quoit, quota, quote, quoth
14. First, create a set of angles between zero and 2 π.
In[72]:= angles = RandomReal[{0, 2 π}, 6];
To turn these angles into points on the unit circle, note that the cosine of the angle gives the x-
coordinate, and sine of the angle gives the y-coordinate. So the following creates a list of the
form {Cos[θ], Sin[θ]} for each angle θ.
5.5 Pure functions: exercises 155
Out[74]=
Line takes a list of two points. One of those points will be the origin for each of our coordinate
pairs. Here is the code to create the pairs of points that will be passed to Line.
In[75]:= lines = Map[{# , {0, 0}} &, pts]
Out[75]= {{{0.760612, 0.649207}, {0, 0}}, {{-0.505615, -0.862759}, {0, 0}},
{{-0.915506, 0.402304}, {0, 0}}, {{-0.813205, -0.581977}, {0, 0}},
{{0.5826, -0.812759}, {0, 0}}, {{-0.959663, -0.281152}, {0, 0}}}
Out[76]=
This can also be done more directly with AngleVectors which takes a polar angle as argument
and returns a point on the unit circle with that polar angle.
In[77]:= pts = MapAngleVector, angles
Out[77]= {{0.760612, 0.649207}, {-0.505615, -0.862759}, {-0.915506, 0.402304},
{-0.813205, -0.581977}, {0.5826, -0.812759}, {-0.959663, -0.281152}}
156 Essentials of Programming in Mathematica
In[78]:= Graphics
Circle[],
Point[pts],
MapLine[{{0, 0}, # }] &, pts
Out[78]=
15. The key to solving this problem is thinking carefully about the initial value for FoldList.
In[79]:= FoldList[#1 + α (#2 - #1) &, x1 , {x2 , x3 }]
Out[79]= {x1 , x1 + α (-x1 + x2 ), x1 + α (-x1 + x2 ) + α (-x1 - α (-x1 + x2 ) + x3 )}
If you were defining your own function, you would need to extract the first element of the
(data) list as the initial value of FoldList.
In[80]:= expMovingAveragelis_, α_ := FoldList#1 + α (#2 - #1) &, Firstlis , Restlis
In[83]:= Simplify[%% ⩵ %]
Out[83]= True
16. A first, naive implementation will use the fact that the prime factors are all less than 6. Here
are the factors for a single integer.
In[84]:= facs = FactorInteger[126]
Out[84]= {{2, 1}, {3, 2}, {7, 1}}
Putting these pieces together, here are the Hamming numbers less than 1000.
In[87]:= SelectRange[1000], MaxMapFirst, FactorInteger[# ] < 6 &
Out[87]= {1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 15, 16, 18, 20, 24, 25, 27, 30, 32, 36, 40, 45, 48,
50, 54, 60, 64, 72, 75, 80, 81, 90, 96, 100, 108, 120, 125, 128, 135, 144, 150,
160, 162, 180, 192, 200, 216, 225, 240, 243, 250, 256, 270, 288, 300, 320,
324, 360, 375, 384, 400, 405, 432, 450, 480, 486, 500, 512, 540, 576, 600,
625, 640, 648, 675, 720, 729, 750, 768, 800, 810, 864, 900, 960, 972, 1000}
Factoring is slow for large integers and so this implementation does not scale well. This finds
the 507 Hamming numbers less than 106 .
In[88]:= Withn = 106 ,
SelectRange[n], MaxMapFirst, FactorInteger[# ] < 6 &
; // Timing
Out[88]= {5.24049, Null}
See Dijkstra (1981) for a different implementation that starts with � = {1}, then builds lists 2 h,
3 h, 5 h, merges these lists, and iterates.
In[91]:= HammingNumberList[20]
Out[91]= {1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 15, 16, 18, 20, 24, 25, 27, 30, 32, 36}
In[94]:= Options"Integrate"
Out[94]= {}
The second issue is that options are given as a list of rules which is a more deeply nested
expression structure than the list of attributes.
In[96]:= MemberQOptions[Integrate], Assumptions
Out[96]= False
The tree structure shows that the option names occur down at level two.
In[97]:= TreeFormOptions[Integrate]
List
The optional third argument to MemberQ can be used to specify the level at which the pattern
match should take place. In this case, at level two.
In[98]:= MemberQOptions[Integrate], Assumptions, 2
Out[98]= True
Next, note that many built-in symbols have no options, as indicated by the empty list returned.
In[99]:= OptionsRound
Out[99]= {}
Rather than search through these functions, let’s remove them from the search as well as any
function that starts with “$” such as $RecursionLimit.
Here then is the function:
In[100]:= FunctionsWithOptionopt_Symbol := Modulenames, lis,
names = ComplementNames"System`*", Names"System`$*";
lis = DeleteCasesnames, f_ /; OptionsSymbolf === {};
Selectlis, MemberQOptionsSymbol[# ], opt , 2 &
5.5 Pure functions: exercises 159
With a little analysis you should see that we reduced the large list of functions to search from
over 5000 to a little more than 1200 (check the length of lis). The function would be quite a bit
slower otherwise.
In[102]:= LengthNames"System`*"
Out[102]= 5491
18. First, create a prototype graph to work with.
In[103]:= SeedRandom[16];
gr = RandomGraph{10, 15}, VertexLabels → "Name"
10
2 9
6
7 4
Out[104]=
5
1
8
3
In[106]:= VertexList[gr]
Out[106]= {1, 2, 3, 4, 5, 6, 7, 8, 9, 10}
Below are those edges from vertex 3 to any other vertex. In other words, this gives the adja-
cency list for vertex 3.
In[107]:= With{u = 3},
SelectVertexList[gr], EdgeQgr, UndirectedEdge[u, # ] &
Out[107]= {4}
The case for directed graphs is similar. Here then is a function that returns the adjacency list for
160 Essentials of Programming in Mathematica
In[112]:= AdjacencyStructure[gr]
Out[112]= {{1, {5, 8, 9}}, {2, {5, 7, 9}}, {3, {4}},
{4, {3, 5, 7, 9, 10}}, {5, {1, 2, 4, 8}}, {6, {7}},
{7, {2, 4, 6, 8}}, {8, {1, 5, 7}}, {9, {1, 2, 4, 10}}, {10, {4, 9}}}
3 4
Out[113]=
In[114]:= AdjacencyStructure[gr2]
Out[114]= {{1, {2, 3, 4}}, {2, {1, 3, 4}}, {3, {1, 2}}, {4, {1, 2}}}
19. To start, here is a 7⨯7 grid graph.
5.5 Pure functions: exercises 161
7 14 21 28 35 42 49
6 13 20 27 34 41 48
5 12 19 26 33 40 47
4 11 18 25 32 39 46
Out[115]=
3 10 17 24 31 38 45
2 9 16 23 30 37 44
1 8 15 22 29 36 43
A somewhat brute force way to solve this problem is to find all vertices within distance three of
vertex 25 and subtract out the vertices within distance two of vertex 25.
In[116]:= ComplementVertexList @ NeighborhoodGraph[gr, 25, 3],
VertexList @ NeighborhoodGraph[gr, 25, 2]
Out[116]= {4, 10, 12, 16, 20, 22, 28, 30, 34, 38, 40, 46}
In[117]:= HighlightGraph[gr, %]
7 14 21 28 35 42 49
6 13 20 27 34 41 48
5 12 19 26 33 40 47
4 11 18 25 32 39 46
Out[117]=
3 10 17 24 31 38 45
2 9 16 23 30 37 44
1 8 15 22 29 36 43
Alternatively, create a function VertexNeighbors that takes a graph gr, a vertex v, and a
distance dist, and, using GraphDistance, finds all those vertices in gr that are distance dist from v.
In[118]:= VertexNeighborsgr_, v_, dist_ :=
VertexListgr , _ ? GraphDistance[gr , v , # ] ⩵ dist &
162 Essentials of Programming in Mathematica
7 14 21 28 35 42 49
6 13 20 27 34 41 48
5 12 19 26 33 40 47
4 11 18 25 32 39 46
Out[119]=
3 10 17 24 31 38 45
2 9 16 23 30 37 44
1 8 15 22 29 36 43
Out[124]=
Out[125]=
Here then is a function that checks if the eigenvalues of a matrix are all zero. Note the use of
logical or (||) to check for both exact and approximate zero.
In[129]:= NilpotentMatrixQmat_ ? SquareMatrixQ :=
AllTrueEigenvalues[mat ], (# == 0 || # == 0.0) &
In[130]:= NilpotentMatrixQ[mat]
Out[130]= True
3. Rewrite the median function from Exercise 6, Section 5.4 so that instead of using an If control
structure, you create two separate rules: one rule for the case when the list has an odd number
of elements and another rule for the case when the length of the list is even.
4. Extend the survivor function developed in this section to a function of two arguments, so that
survivor[�, �] returns the survivor starting from a list of n people and executing every mth
person.
5. In Section 4.3 we created a function CountChange[���] that took a list of coins and, using
transformation rules, returned the monetary value of that list of coins. Rewrite CountChange to
use a purely functional approach. Consider using Dot, or Inner, or Tally.
6. Create a function Regular2Graph[�] that outputs an n-sided regular graph where every vertex
has degree two.
In[1]:= Regular2Graph[5]
Out[1]=
7. Extend the visualization of PPI networks from this section by coloring vertices according to the
biological process in which they are involved. The built-in ProteinData contains this informa-
tion, for example:
10. Random graphs have a rich and deep history in spite of the fact that they were only first
defined in the mid-twentieth century in a paper by Erdős and Rényi (1959). They have since
been used to study areas as diverse as percolation, telecommunications, social networks, and
many more.
Perhaps the simplest random graph model is one in which both the number of vertices and the
number of edges are fixed. In this model, G(n, m), the m edges are placed at random among all
n
possible edges. This is the model that the built-in function RandomGraph is based upon. In
2
an alternate model, commonly referred to as G(n, p), the probability of an edge between any
two of the n vertices is fixed. As as result, the number of edges can vary from none, for exam-
n
ple when p = 0, to when p = 1. In this exercise you are asked to create a simplified model of
2
the G(n, p) random graph.
Starting with a set of edges, assign a probability to each. The edges can be taken from a com-
plete graph, a graph in which there is an edge between every pair of vertices.
In[3]:= n = 7;
cg = CompleteGraph[n];
EdgeRules[cg]
Out[5]= {1 → 2, 1 → 3, 1 → 4, 1 → 5, 1 → 6, 1 → 7, 2 → 3, 2 → 4, 2 → 5, 2 → 6,
2 → 7, 3 → 4, 3 → 5, 3 → 6, 3 → 7, 4 → 5, 4 → 6, 4 → 7, 5 → 6, 5 → 7, 6 → 7}
Next choose an edge with probability p. An edge being chosen is a binary choice: either it is
chosen or it isn’t. This is essentially a coin toss distribution which, in Mathematica, is repre-
sented by BernoulliDistribution. We create a list of probabilities the same length as the
number of edges in the complete graph.
In[6]:= p = 0.45;
probs = RandomVariateBernoulliDistribution[p], EdgeCount[cg]
Out[7]= {1, 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 1, 1, 1, 1, 0, 1, 0, 0, 0, 1}
Finally, use Pick to include only edges whose corresponding probability is less than the
threshold value p and display the resulting graph with Graph.
11. Extend the grid example from Exercise 5, Section 3.1 to color the prime grid elements (Figure
5.4).
166 Essentials of Programming in Mathematica
12. Using Grid, create a truth table for a logical expression such as A B ⇒ C (Figure 5.5).
13. Create a function RandomNote[�] that plays a random sequence of n notes taken from the
twelve-tone scale. The twelve tones in C major can be generated using Sound and SoundNote to
create the sound objects; use EmitSound to play them through the speakers of your computer.
1.0
0.5
-0.5
-1.0
17. Given a set of n points in the plane, find a tour that visits each of them once, returning to the
first point visited: choose a point v1 from the set at random; then find the point that is closest to
v1 , call it v2 ; of the points not chosen so far, find the point that is closest to v2 ; call it v3 . In this
way create a running list {v1 , v2 , …, vn , v1 } that gives the points to visit in order, returning to the
first point visited. This is essentially a nearest-neighbor algorithm for solving the traveling
salesman problem. It is known that this solution is sub-optimal but it will give you a good
feeling for these kinds of problems. See Section 8.4 for some variations on traveling salesman-
type problems.
18. Starting with a set of n random points in the unit square, find the proportion that are also in the
square’s inscribed disk (Figure 5.7). As n increases, this proportion (slowly!) approaches the
value π/4.
1.0
0.8
0.6
0.4
0.2
In Exercise 5, Section 9.2 this computation is run numerous times as a Monte Carlo simulation
to get better and better approximations to the value of π.
5.6 Solutions
1. Here are two small sample lists.
168 Essentials of Programming in Mathematica
Here is the conditional pattern that matches any pair where the two elements are not identical.
The Hamming distance is the number of such nonidentical pairs.
In[4]:= Countll, {p_, q_} /; p ≠ q
Out[4]= 3
The running times of this version of HammingDistance are quite a bit slower than those where
we used bit operators. This is due to additional computation (Transpose) and the use of pattern
matching and comparisons at every step.
In[7]:= HammingDistance2lis1_, lis2_ := TotalBitXorlis1, lis2
The two rules given here should be more careful about the input, using pattern matching to
insure that these rules only apply to one-dimensional lists. The following modifications handle
that more robustly.
In[25]:= Clearmedian
4. Just one change is needed here: add a second argument to RotateLeft that specifies the number
of positions to rotate. We have used NestList to display the intermediate steps.
In[28]:= survivor[n_, m_] := NestListRestRotateLeft[# , m - 1] &, Range[n ], n - 1
In[29]:= survivor[11, 3]
Out[29]= {{1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11}, {4, 5, 6, 7, 8, 9, 10, 11, 1, 2},
{7, 8, 9, 10, 11, 1, 2, 4, 5}, {10, 11, 1, 2, 4, 5, 7, 8}, {2, 4, 5, 7, 8, 10, 11},
{7, 8, 10, 11, 2, 4}, {11, 2, 4, 7, 8}, {7, 8, 11, 2}, {2, 7, 8}, {2, 7}, {7}}
5. Here is a list of coins (modify for other currencies).
In[30]:= coins = p, p, q, n, d, d, p, q, q, p;
First count the occurrences of each.
In[31]:= MapCountcoins, # &, p, n, d, q
Out[31]= {4, 1, 2, 3}
Then a dot product of this count vector with a value vector does the trick.
In[32]:= %.{.01, .05, .10, .25}
Out[32]= 1.04
In[33]:= CountChangelis_ :=
DotMapCountlis , # &, p, n, d, q, {.01, .05, .10, .25}
In[34]:= CountChangecoins
Out[34]= {16 + 2 d + 3 q, 44 + 2 d + 3 q, 24 + 2 d + 3 q, 20 + 2 d + 3 q, 36 + 2 d + 3 q,
52 + 2 d + 3 q, 32 + 2 d + 3 q, 40 + 2 d + 3 q, 48 + 2 d + 3 q, 28 + 2 d + 3 q}
In[35]:= CountChange2lis_ :=
InnerTimes, MapCountlis , # &, p, n, d, q, {.01, .05, .10, .25}, Plus
In[36]:= CountChange2coins
Out[36]= 1.04
In[40]:= CountChange3coins
Out[40]= 1.04
6. If you think of the vertex indices as one through n, then each vertex needs to be connected to
the vertex with index one less and also one more.
Create the pairs using Partition with overlap one and set to cycle from the last to the first
element.
In[41]:= Partition[Range[5], 2, 1, 1]
Out[41]= {{1, 2}, {2, 3}, {3, 4}, {4, 5}, {5, 1}}
This bundles up the code, using the shorthand notation for Apply at level one, @@@.
In[43]:= Regular2Graph[n_] := GraphUndirectedEdge @@@ Partition[Range[n ], 2, 1, 1]
Out[44]= , , ,
7. (* solution to appear *)
8. Column 4 of this matrix contains several different nonnumeric values.
In[45]:= mat3 = 0.796495, "N/A", 0.070125, "nan", 0.806554,
"nn", -0.100365, 0.992736, -0.320560, -0.0805351,
{0.473571, 0.460741, 0.030060, -0.412400, 0.788522},
{0.614974, -0.503201, 0.615744, 0.966053, -0.011776},
-0.828415, 0.035514, 0.8911617, "N/A", -0.453926;
MatrixFormcol4 = mat3All, 4
Out[46]//MatrixForm=
nan
-0.32056
-0.4124
0.966053
N/A
To pattern match on either "N/A" or "nan", use Alternatives (|).
172 Essentials of Programming in Mathematica
Here is a third set of definitions, including a new rule for ReplaceElement where the second
argument is a list of strings. And another rule for ReplaceElement accommodates the new
argument structure of colMean.
In[49]:= colMeancol_, strings___String :=
col /. ApplyAlternatives, strings → MeanCasescol , _ ? NumberQ
In[50]:= ReplaceElementmat_, strings__ :=
TransposeMapcolMean# , strings &, Transpose[mat ]
Out[52]=
The transition probability matrix assigns the value 1 / VertexDegree in position {i, j} if there is
an edge between vertex i and vertex j and zero otherwise. Here is the pure function that does
this.
In[58]:= = TransitionMatrix[gr]
1 1 1 1
1 1
Out[58]= 0, , , 0,
, , 0, 0, , ,
3 3 3 3 3 3
1 1 1 1 1 1 1 1 1 1
, 0, 0, , , 0, , , 0, , , , , , 0
3 3 3 3 3 3 4 4 4 4
To see how to use to create a random walk using Markov processes, first create some starting
probabilities for each vertex.
In[59]:= Π = ConstantArray[1 / VertexCount[gr], {VertexCount[gr]}]
1 1 1 1 1
Out[59]= , , , ,
5 5 5 5 5
174 Essentials of Programming in Mathematica
Here is the Markov process using the initial probabilities and the transition matrix.
In[60]:= = DiscreteMarkovProcess[Π, ];
Create ten steps in the process.
In[61]:= data = RandomFunction[, {0, 10}]
Time: 0 to 10
Out[61]= TemporalData
Data points: 11 Paths: 1
Turn the successive vertices into edges and highlight them with the original graph.
In[63]:= walk = UndirectedEdge @@@ Partitiondata"Values", 2, 1
Out[63]= {1 2, 2 4, 4 5, 5 1, 1 2, 2 5, 5 1, 1 5, 5 2, 2 4}
Out[64]=
10. Starting with a set of edges, we assign a probability to each. The edges are taken from a
complete graph, a graph in which there is an edge between every pair of vertices. Then, using
Pick, we include only edges whose corresponding probability is less than some threshold
value, p.
In[65]:= n = 7;
cg = CompleteGraph[n]
Out[66]=
5.6 Examples: exercises 175
We want to choose an edge with probability p. An edge being chosen is a binary choice: either it
is chosen or it isn’t. This is essentially a coin toss distribution which, in Mathematica is repre-
sented by BernoulliDistribution.
In[68]:= p = 0.45;
probs = RandomVariateBernoulliDistribution[p], EdgeCount[cg]
Out[69]= {0, 1, 1, 1, 1, 0, 1, 0, 0, 1, 0, 0, 1, 1, 0, 0, 1, 1, 0, 0, 0}
We will use a three-argument form of Pick to choose the edges that meet our criteria.
Pick[���, ���, ����] returns those elements in lis for which the corresponding element of sel
matches the pattern patt. In our case, we choose edges if the corresponding Bernoulli distribu-
tion returns a value of one.
In[70]:= includedEdges = PickEdgeRules[cg], probs, 1
Out[70]= {1 → 3, 1 → 4, 1 → 5, 1 → 6, 2 → 3, 2 → 6, 3 → 5, 3 → 6, 4 → 6, 4 → 7}
Out[71]=
Gather all these pieces and scale up the size of the graph.
In[72]:= n = 50; p = .12;
cg = CompleteGraph[n];
probs = RandomVariateBernoulliDistribution[p], EdgeCount[cg];
gr = GraphPickEdgeRules[cg], probs, 1, DirectedEdges → False
Out[74]=
A quick check that 50 vertices are returned and that the ratio of edges to possible edges is
approximately equal to the probability we specified.
176 Essentials of Programming in Mathematica
Several exercises in Chapter 6 ask you to bundle up the code here and turn it into a reusable
function inheriting options from Graph.
As an aside, the above functionality is built into BernoulliGraphDistribution[�, ��] which
constructs an n-vertex graph, starting with an edge connecting every pair of vertices and then
selects edges independently via a Bernoulli trial with probability pr.
In[76]:= RandomGraphBernoulliGraphDistribution[50, 0.12]
Out[76]=
Map a rule of the form �������� → Pink across the positions of the prime numbers.
In[88]:= expr = (A || B) ⇒ C;
Next, create a list of rules, associating each of the triples of truth values with a triple of variables.
In[91]:= rules = MapThread[vars → # ] &, tuples
Out[91]= {{A → True, B → True, C → True}, {A → True, B → True, C → False},
{A → True, B → False, C → True}, {A → True, B → False, C → False},
{A → False, B → True, C → True}, {A → False, B → True, C → False},
{A → False, B → False, C → True}, {A → False, B → False, C → False}}
Put these last values at the end of each “row” of the tuples.
178 Essentials of Programming in Mathematica
13. A simple “melody” with no correlation can be generated by randomly selecting notes from a
scale. First we generate the frequencies of the 12 semitones from a C major scale. This is just a
chromatic scale beginning with middle C.
In[99]:= cmajor = TableSoundNotei, i, 0, 11
Out[99]= {SoundNote[0], SoundNote[1], SoundNote[2], SoundNote[3],
SoundNote[4], SoundNote[5], SoundNote[6], SoundNote[7],
SoundNote[8], SoundNote[9], SoundNote[10], SoundNote[11]}
Here is a list of ten notes randomly selected from the C major scale.
In[100]:= SoundRandomChoicecmajor, 10
Out[100]=
�� �
Add some rests and randomize the durations of each note. The symbol None is interpreted by
Sound as a rest.
In[101]:= notes = Join[{None}, Range[0, 11]]
Out[101]= {None, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11}
In[104]:= Sound[%]
Out[104]=
��� �
Here then is a function that takes the number of notes and the instrument as arguments.
In[105]:= RandomNotesn_Integer , instrument_ : "Piano" :=
1 1
Withnotes = Join[{None}, Range[0, 11]], durations = Range , 1, ,
8 8
Soundinstrument , MapThreadSoundNote[#1, #2 ] &,
RandomChoice[notes, n ], RandomChoicedurations, n
Out[106]=
���� �
0.5
Out[113]=
-1.0 -0.5 0.5 1.0
-0.5
-1.0
To find the distance from each centroid to the point in its cluster farthest away, we want the
max of the set of distances between the cluster and the points in that cluster.
In[116]:= distances = Table
Max @ MapEuclideanDistancecentroidsi, # &, clustersi,
i, 1, Lengthclusters
Out[116]= {0.429688, 0.479782, 0.516458, 0.435077, 0.355637, 0.411775, 0.364234, 0.30396}
1.0
0.5
Out[118]=
-1.0 -0.5 0.5 1.0
-0.5
-1.0
17. First create a set of points with which to prototype. Choose a small set to make it easier to
inspect the progress.
In[119]:= SeedRandom[6];
pts = RandomInteger[40, {10, 2}]
Out[120]= {{16, 18}, {28, 12}, {25, 35}, {10, 13},
{26, 12}, {24, 15}, {30, 34}, {5, 0}, {16, 38}, {1, 6}}
Next, create a list of all those points with this base points deleted, resetting pts to this new
value.
In[123]:= pts = Complementpts, path
Out[123]= {{1, 6}, {5, 0}, {10, 13}, {16, 18},
{24, 15}, {25, 35}, {26, 12}, {28, 12}, {30, 34}}
Find the point nearest this list of points. Call it the new base point.
In[124]:= base = First @ Nearestpts, path
Out[124]= {{25, 35}}
Add this new base point to existing list path and reset the value of path:
5.6 Examples: exercises 183
Iterate:
In[126]:= SeedRandom[6];
pts = RandomInteger[40, {10, 2}];
base = RandomChoice[pts];
path = base;
Do
pts = Complementpts, path;
base = First @ Nearestpts, path;
path = Joinpath, base,
Length[pts] - 1;
path
Out[131]= {{16, 38}, {25, 35}, {30, 34}, {16, 18},
{24, 15}, {10, 13}, {26, 12}, {28, 12}, {1, 6}, {5, 0}}
Find the length of the path, connecting the last point to the first to make a closed loop.
In[132]:= ArcLengthLinepath /. a_, b__ ⧴ a , b , a // N
Out[132]= 150.993
Compare the built-in function for finding shortest tours. The first element in the returned list is
the length of the tour and the second element is the ordering on the positions of the points in
the tour.
In[133]:= SeedRandom[6];
pts = RandomInteger[40, {10, 2}];
FindShortestTour[pts]
Out[135]= 27 + 3 10 + 2 13 + 26 + 61 + 3 65 + 130 + 397 ,
{1, 4, 10, 8, 5, 2, 6, 7, 3, 9, 1}
In[136]:= N[%[[1]]]
Out[136]= 112.121
18. First, create 1000 points in the unit square.
In[137]:= pts = RandomReal[{-1, 1}, {1000, 2}];
Next create regions that represent the unit disk and unit square.
In[138]:= = Disk[{0, 0}, 1];
= Polygon[{{-1, -1}, {1, -1}, {1, 1}, {-1, 1}, {-1, -1}}];
184 Essentials of Programming in Mathematica
Now select those point that are members of the disk region. You could use Select or Count.
In[140]:= Length @ Selectpts, RegionMember[, # ] &
Out[140]= 782
have the function output all perfect numbers between those inputs. For example,
PerfectSearch[�, �] will return a list of all perfect numbers in the range from a to b.
7. A number n is k-perfect if the sum of its proper divisors equals k n. Redefine PerfectSearch
from the previous exercise so that it accepts as input two numbers a and b, a positive integer k,
and computes all k-perfect numbers in the range from a to b. Use your rule to find the only
three 4-perfect numbers less than 2 200 000.
8. Often in processing files you are presented with expressions that need to be converted into a
format that can be more easily manipulated. For example, a file may contain dates in the form
20160702 to represent July 2, 2016. Mathematica represents its dates as a list in the following
form:
6.1 Solutions
1. Let us start with the 3⨯3 Hilbert matrix.
In[1]:= mat = HilbertMatrix[3]
1 1 1 1 1 1 1 1
Out[1]= 1, , , , , , , ,
2 3 2 3 4 3 4 5
Here are its singular values:
In[2]:= sv = SingularValueList[mat]
Out[2]= Root-1 + 138 537 #1 - 9 323 424 #12 + 4 665 600 #13 &, 3,
Root-1 + 138 537 #1 - 9 323 424 #12 + 4 665 600 #13 &, 2,
Root-1 + 138 537 #1 - 9 323 424 #12 + 4 665 600 #13 &, 1
6.1 Scoping constructs: exercises 187
Actually, SingularValueList returns the singular values ordered from greatest to smallest. So
we can speed up the computation by only pulling off those positions rather than computing
maximum and minimum values.
Here is the function definition. We use Module to localize a variable sv that is used in the body
of the function. Also, the definition given in the exercise is good for square matrices so we do
some argument checking on the left-hand side of the definition.
In[5]:= ConditionNumbermat_ ? SquareMatrixQ := Modulesv = SingularValueList[mat ],
First[sv] Last[sv]
Here are the condition numbers for the first five Hilbert matrices
In[6]:= TableConditionNumberHilbertMatrixi, i, 1, 5 // N
Out[6]= {1., 19.2815, 524.057, 15 513.7, 476 607.}
And this tests with a known pathological example of a 4⨯4 matrix (Rump 1991).
In[7]:= mat = {{-5 046 135 670 319 638, -3 871 391 041 510 136, -5 206 336 348 183 639,
-6 745 986 988 231 149}, {-640 032 173 419 322, 8 694 411 469 684 959,
-564 323 984 386 760, -2 807 912 511 823 001},
{-16 935 782 447 203 334, -18 752 427 538 303 772, -8 188 807 358 110 413,
-14 820 968 618 548 534}, {-1 069 537 498 856 711, -14 079 150 289 610 606,
7 074 216 604 373 039, 7 257 960 283 978 710}};
In[8]:= ConditionNumber[mat] // N
Out[8]= 6.41354 × 1064
2. Here are the code fragments from Exercise 10 in Section 5.6.
In[9]:= With{n = 25, p = .2},
cg = CompleteGraph[n];
probs = RandomVariateBernoulliDistribution[p], EdgeCount[cg];
GraphPickEdgeRules[cg], probs, 1, DirectedEdges → False
Out[9]=
188 Essentials of Programming in Mathematica
Out[11]=
1 3
Out[13]= Triangle{0, 0}, {1, 0}, ,
2 2
To measure the lengths of the sides, create all possible pairs of the points and apply
EuclideanDistance (at level one).
In[14]:= ApplyEuclideanDistance, Subsets[pts, {2}], {1}
Out[14]= {1, 1, 1}
Out[17]=
Out[22]=
In[23]:= EquilateralTriangleQtri
Out[23]= False
This function does not guard against the user supplying “bad” inputs. For example, if the user
starts with an odd number, then this version of PerfectSearch will check every other odd
number, and, since it is known that there are no odd perfect numbers below at least 10300 , none
is reported.
In[35]:= PerfectSearch[1, 10 000]
Out[35]= {}
You can fix this situation by using the (as yet unproved) assumption that there are no odd
perfect numbers. This next version first checks that the first argument is an even number.
In[36]:= ClearPerfectSearch
The string is necessary otherwise DateList will interpret the integer as an absolute time (from
Jan 1 1900).
In[44]:= DateList[20 151 015]
Out[44]= {1900, 8, 22, 5, 30, 15.}
With a bit more manual work, you could also do this with StringTake.
In[49]:= convertToDate2n_Integer /; LengthIntegerDigits[n ] ⩵ 8 :=
Modulestr = ToString[n ],
StringTake[str, 4], StringTake[str, {5, 6}], StringTake[str, -2]
You could avoid working with strings by making use of FromDigits. This uses With to create a
local constant d, as this expression never changes throughout the body of the function.
In[51]:= convertToDate3[num_] := Withd = IntegerDigits[num ],
FromDigitsTaked, 4,
FromDigitsTaked, {5, 6},
FromDigitsTaked, {7, 8}
Out[62]= -8 -6 -4 -2 2 4 6
-2
-4
-6
194 Essentials of Programming in Mathematica
100
80
60
Out[63]=
40
20
-100 -50 50
-20
A bit of thought is needed to come up with the eight directions in the three-dimensional integer
lattice.
In[64]:= dirs3 = {{1, 0, 0}, {0, 1, 0}, {0, 0, 1}, {-1, 0, 0}, {0, -1, 0}, {0, 0, -1}};
Here then is the three-dimensional walk function.
In[65]:= walk3D[t_] := AccumulateRandomChoicedirs3, t
And here is a 2500-step walk on the three-dimensional integer lattice.
In[66]:= Graphics3DLinewalk3D[2500]
Out[66]=
6.2 Solutions
1. First, set up the options inherited from Graph.
In[1]:= OptionsRandomGraphGnp = OptionsGraph;
Out[4]=
2. The message will slot in the values of the row indices being passed to the function switchRows,
as well as the length of the matrix, that is, the number of matrix rows.
In[5]:= switchRows::badargs =
"The absolute value of the row indices `1` and `2` in switchRows[mat,`1`,`2`]
must be between 1 and `3`, the size of the matrix.";
The message is issued if either of the row indices have absolute value greater than the length of
the matrix or if either of these indices is equal to zero.
In[6]:= switchRows[mat_, {r1_Integer , r2_Integer }] :=
Modulelmat = mat , len = Length[mat ],
IfAbs[r1] > len || Abs[r2 ] > len || r1 r2 ⩵ 0,
MessageswitchRows::badargs, r1, r2 , len,
lmat[[{r1, r2 }]] = lmat[[{r2 , r1}]];
lmat
In[15]:= StemPlot[4]
StemPlot::badarg : The �rst argument to StemPlot must be a list of numbers.
3
Out[17]=
2
1 2 3 4 5
In[22]:= ToEdgespairs
Out[22]= {1 2, 2 3, 3 4, 4 5}
In[27]:= MultiplyCounta x4 + b x + 1, x
Out[27]= 5
4. Given a list of expressions, lis, create a function NearTo[���, ����, {�}}] that returns all
elements of lis that are exactly n positions away from elem, which is assumed to be a member of
lis. For example:
Out[5]=
Turn the above code into a function BondPercolation[{�, �}, ����, ����] that outputs a
graph like that above. Include a check on the arguments m and n, returning an appropriate
message if they are not positive integers. Finally, have your function inherit options from
Graph and pass them into the GridGraph function.
8. Create a function ColorResidues[���] that takes an amino acid sequence seq and returns a
visualization like that below where the amino acids are colored according to a scheme such as
Amino, where more polar residues are brighter and more nonpolar residues are colored darker.
In addition to a ColorScheme option, add options to control the frame around each residue.
Out[8]= M V Q R W L L L S C C G A L L S A G L A N T S
Y T S P G L Q R L K D S P Q T A P D K G Q C S T W G
A G H F S T F D H H V Y D F S G T C N Y I F A A T C
6.3 Solutions
1. Here is the message text that will be issued when the first argument to RandomWalk is not a
positive integer.
In[1]:= RandomWalk::rwn = "Argument `1` is not a positive integer.";
And here is the message for the Dimensions option.
6.3 Examples: exercises 201
In[2]:= RandomWalk::baddim =
"The value `1` of the option Dimension is not a positive integer.";
Because we now have several conditions to trap for (non positive integer first argument, bad
value for Dimension option), it is best to use Which to catch the various conditions and set
appropriate actions.
In[3]:= latticeWalksteps_, dim_ := Module{w, mat},
mat = JoinIdentityMatrixdim , -IdentityMatrixdim ;
w = AccumulateRandomChoice[mat, steps ];
Ifdim ⩵ 1, Flatten[w], w
To simplify the code it is useful to have an auxiliary predicate that tests if its argument is a
positive integer.
In[4]:= PositiveIntegerQ[n_] := IntegerQ[n ] && Positive[n ]
On the first iteration, drop every third number, that is, drop 5, 11, 17, and so on.
In[12]:= p = ints[[2]];
ints = Dropints, p ;; -1 ;; p
Out[13]= {1, 3, 7, 9, 13, 15, 19, 21, 25, 27, 31, 33, 37, 39, 43, 45, 49,
51, 55, 57, 61, 63, 67, 69, 73, 75, 79, 81, 85, 87, 91, 93, 97, 99}
Get the next number, 7, in the list ints; then drop every seventh number.
In[14]:= p = ints[[3]];
ints = Dropints, p ;; -1 ;; p
Out[15]= {1, 3, 7, 9, 13, 15, 21, 25, 27, 31, 33, 37, 43, 45,
49, 51, 55, 57, 63, 67, 69, 73, 75, 79, 85, 87, 91, 93, 97, 99}
Iterate. You will need to be careful about the upper limit of the iterator i.
In[16]:= ints = Range[1, 1000, 2];
Do
p = intsi;
ints = Dropints, p ;; -1 ;; p,
i, 2, 32
ints
Out[18]= {1, 3, 7, 9, 13, 15, 21, 25, 31, 33, 37, 43, 49, 51, 63, 67, 69, 73, 75, 79,
87, 93, 99, 105, 111, 115, 127, 129, 133, 135, 141, 151, 159, 163, 169,
171, 189, 193, 195, 201, 205, 211, 219, 223, 231, 235, 237, 241, 259,
261, 267, 273, 283, 285, 289, 297, 303, 307, 319, 321, 327, 331, 339, 349,
357, 361, 367, 385, 391, 393, 399, 409, 415, 421, 427, 429, 433, 451, 463,
475, 477, 483, 487, 489, 495, 511, 517, 519, 529, 535, 537, 541, 553, 559,
577, 579, 583, 591, 601, 613, 615, 619, 621, 631, 639, 643, 645, 651, 655,
673, 679, 685, 693, 699, 717, 723, 727, 729, 735, 739, 741, 745, 769, 777,
781, 787, 801, 805, 819, 823, 831, 841, 855, 867, 873, 883, 885, 895, 897,
903, 925, 927, 931, 933, 937, 957, 961, 975, 979, 981, 991, 993, 997}
It would be more efficient if you did not need to manually determine the upper limit of the
iteration. A While loop is better for this task. The test checks that the value of the iterator has
not gone past the length of the successively shortened lists.
6.3 Examples: exercises 203
In[20]:= LuckyNumbers[1000]
Out[20]= {1, 3, 7, 9, 13, 15, 21, 25, 31, 33, 37, 43, 49, 51, 63, 67, 69, 73, 75, 79,
87, 93, 99, 105, 111, 115, 127, 129, 133, 135, 141, 151, 159, 163, 169,
171, 189, 193, 195, 201, 205, 211, 219, 223, 231, 235, 237, 241, 259,
261, 267, 273, 283, 285, 289, 297, 303, 307, 319, 321, 327, 331, 339, 349,
357, 361, 367, 385, 391, 393, 399, 409, 415, 421, 427, 429, 433, 451, 463,
475, 477, 483, 487, 489, 495, 511, 517, 519, 529, 535, 537, 541, 553, 559,
577, 579, 583, 591, 601, 613, 615, 619, 621, 631, 639, 643, 645, 651, 655,
673, 679, 685, 693, 699, 717, 723, 727, 729, 735, 739, 741, 745, 769, 777,
781, 787, 801, 805, 819, 823, 831, 841, 855, 867, 873, 883, 885, 895, 897,
903, 925, 927, 931, 933, 937, 957, 961, 975, 979, 981, 991, 993, 997}
This latter approach is also reasonably fast. Here is the time it takes to compute all lucky
numbers less than one million; there are 71 918 of them.
In[21]:= LengthLuckyNumbers106 // Timing
Out[21]= {0.302607, 71 918}
3. Start with a prototype logical expression.
In[22]:= Clear[A, B]
In[23]:= expr = (A || B) ⇒ C;
Next, create a list of rules, associating each of the triples of truth values with a triple of variables.
In[26]:= rules = MapThread[vars → # ] &, tuples
Out[26]= {{A → True, B → True, C → True}, {A → True, B → True, C → False},
{A → True, B → False, C → True}, {A → True, B → False, C → False},
{A → False, B → True, C → True}, {A → False, B → True, C → False},
{A → False, B → False, C → True}, {A → False, B → False, C → False}}
Put these last values at the end of each “row” of the tuples.
In[28]:= table = Transpose @ JoinTransposetuples, expr /. rules
Out[28]= {{True, True, True, True}, {True, True, False, False},
{True, False, True, True}, {True, False, False, False},
{False, True, True, True}, {False, True, False, False},
{False, False, True, True}, {False, False, False, True}}
4. Position[���, ����] returns a list of positions at which elem occurs in lis. Extract[���, ���]
returns those elements whose positions are specified by Position.
In[38]:= NearTolis_List , elem_, {n_} :=
Modulepos = Positionlis , elem , Extractlis , {pos - n , pos + n }
The key to writing the distance function is to observe that it must be a function of two variables
and return a numeric value (the distance metric). We are finding the difference of the positions
of a target element in the list with the element in question, y and x, respectively in the pure
function. The use of [[1, 1]] is to strip off extra braces returned by Position.
In[43]:= NearToNlis_, elem_, n_ :=
Nearestlis , elem , {2 n + 1, n },
DistanceFunction →
Function{x , y }, AbsPositionlis , y - Positionlis , x 〚1, 1〛
In[48]:= Transposelis
Out[48]= {{2, 3, 71}, {2, 1, 1}}
Check that it equals the sum of the digits of the original number:
In[51]:= TotalIntegerDigits[852]
Out[51]= 15
As an interesting aside, you can also generate Smith numbers using rep units (see Exercise 5 in
Section 5.5). For example, multiply any prime repunit by a suitable factor, e.g., 1540. For details
of the relationship between repunits and Smith numbers, see Hoffman (1999).
In[56]:= PrimeQRepUnit[19]
Out[56]= True
6. In the one-dimensional case, steps of unit length give the lattice walk described above. For our
off-lattice walk, we will take step directions chosen to be any real number between -1 and 1. Of
course, this means that for this case, steps are not of length one.
In[58]:= walk1DOffLattice[t_] := AccumulateRandomReal[{-1, 1}, t ]
In the two-dimensional case, we essentially compute polar points and so the directions are
polar angles between 0 and 2 π; the coordinates of the points are given by the pair (cos θ, sin θ),
which gives steps of unit length.
In[59]:= walk2DOffLattice[t_] :=
AccumulateMapCos[# ], Sin[# ] &, RandomReal[{0, 2 π}, t ]
Let us quickly check that each step is of length one.
In[60]:= walk2D = walk2DOffLattice[4]
Out[60]= {{-0.856498, -0.51615}, {-0.330181, -1.36644},
{-1.32972, -1.33606}, {-0.945803, -2.25943}}
In[61]:= Partitionwalk2D, 2, 1
Out[61]= {{{-0.856498, -0.51615}, {-0.330181, -1.36644}},
{{-0.330181, -1.36644}, {-1.32972, -1.33606}},
{{-1.32972, -1.33606}, {-0.945803, -2.25943}}}
In[62]:= ApplyEuclideanDistance, %, 1
Out[62]= {1., 1., 1.}
There are several different ways to approach the three-dimensional off-lattice walk. Using a
spherical coordinate system, a point uniformly distributed on the sphere can be obtained from
the following equations (Marsaglia 1972):
x = cos(θ) 1 - u2 ,
y = sin(θ) 1 - u2 ,
z = u.
We need to produce pairs of random numbers θ and u with θ in the interval [0, 2 π) and u in the
interval [-1, 1]. Here then is the function to generate t steps of an off-lattice random walk in
three dimensions.
In[63]:= walk3DOffLattice[t_] :=
Accumulate
We now use the common elements to simplify our code, similarly to what we did earlier with
the lattice walk code. The only difference amongst these three cases is the function that we are
accumulating. We will use Which to slot in the appropriate function to Accumulate, based on
the value of the dimension argument, dim.
10
-10
-20
210 Essentials of Programming in Mathematica
20
10
-20
-30
-40
-50
Out[69]=
7. Here is the function for running bond percolation simulations taken from the exercise. Options
are inherited from GridGraph.
In[70]:= ClearBondPercolation;
Out[73]=
6.3 Examples: exercises 211
Add a check on the arguments m and n and issue a message if they are not positive integers.
In[74]:= PositiveIntegerQ[n_] := IntegerQ[n ] && Positive[n ]
In[75]:= BondPercolation::badargs =
"The parameters `1` and `2` must be positive integers.";
In[76]:= ClearBondPercolation;
BondPercolationm_, n_, prob_, opts : OptionsPattern[] := Module{gg, gr},
IfAllTrue{m , n }, PositiveIntegerQ,
gg = GridGraph[{m , n }, opts ];
gr =
GraphPickEdgeList[gg], RandomVariateBernoulliDistributionprob ,
EdgeCount[gg], 1;
HighlightGraphgg, gr, GraphHighlightStyle → "DehighlightFade",
MessageBondPercolation::badargs, m , n
Out[78]=
8. Start with the color scheme. This is the Amino scheme used in RasMol. The color swatches can
be entered as RGB values and then the swatch can be copied and pasted.
In[80]:= ��������[{���/��������/��������/���}]
Out[80]=
a unique option to select different color schemes. Amino will be the default scheme.
In[82]:= OptionsColorResidues = JoinColorScheme → Amino, OptionsFramed;
Write a usage message for ColorResidues.
In[83]:= ColorResidues::usage =
"ColorResidues[���] displays a sequence of amino acids from the
protein sequence ���.";
This creates an auxiliary function that turns the color scheme into a list of rules that will be
applied in the ColorResidues function below.
In[84]:= makeAAboxscheme_, opts : OptionsPattern[] := Moduleaa, col,
aa, col = Transposescheme ;
MapThread#1 ⧴ Framed#1, opts , Background → #2 , FrameStyle → #2 &, aa, col
In[85]:= makeAAboxAmino
Out[85]= P ⧴ P , W ⧴ W , L ⧴ L , V ⧴ V , I ⧴ I , N ⧴ N ,
Q⧴ Q , S⧴ S , T⧴ T , C⧴ C , M⧴ M , H⧴ H , A⧴ A ,
G⧴ G , F⧴ F , Y⧴ Y , K⧴ K , R⧴ R , D⧴ D , E⧴ E
Finally, here is the function with the first 100 residues of the protein MUC6 as argument.
In[86]:= ColorResiduesstr_String , opts : OptionsPattern[] :=
Modulecs = OptionValueColorScheme,
RowCharacters[str ] /. makeAAboxcs, FilterRules{opts }, OptionsFramed
Out[89]= M V Q R W L L L S C C G A L L S A G L A N T S Y T S P G L Q R L K D
S P Q T A P D K G Q C S T W G A G H F S T F D H H V Y D F S G T C
N Y I F A A T C K D A F P T F S V Q L R R G P D G S I S R I I V E
7
Strings
5. A somewhat simplistic cipher, known as the XOR cipher, uses binary eight-bit keys to encode
strings. The idea is to first convert each letter in a plaintext string to their character code in
eight-bit binary. So the letter A, whose character code is 65, is converted into 1000001. A key
string, say the letter K, is similarly converted to an eight-bit binary representation. Then each
letter in the plaintext is encoded by performing a bit XOR operation on the plaintext letter and
the key, both using their eight-bit binary representation. The resulting ciphertext could remain
in binary or it could be converted back from character codes to encoded text, the ciphertext.
214 Essentials of Programming in Mathematica
Create an XOR cipher and encode a plaintext string to produce a ciphertext. See Exercise 6,
Section 2.2 for information on converting a string to its binary representation. As an aside, the
XOR cipher is a terribly insecure cipher as simply reversing the encoding operations makes it
easy to recover the key (Churchhouse 2001) .
7.1 Solutions
1. Here is a test string we will use for this exercise.
In[1]:= str = "this is a test string"
Out[1]= this is a test string
For each lowercase letter of the English alphabet, subtracting 32 gives the corresponding
uppercase character.
In[4]:= % - 32
Out[4]= {84}
You can do this more efficiently using ToUpperCase and StringTake. This approach is more
general in that it does not assume that the first character in your string is lower case.
7.1 Structure and syntax: exercises 215
This can be done most directly with Capitalize which automatically handles many of the
issues discussed above.
In[11]:= Capitalize[str]
Out[11]= This is a test string
2. One approach converts the string to character codes.
In[12]:= ToCharacterCode"10495"
Out[12]= {49, 48, 52, 57, 53}
In[13]:= % - 48
Out[13]= {1, 0, 4, 9, 5}
In[15]:= %.%%
Out[15]= 10 495
This is a good place to use Fold. Using FoldList, you can see how the expression is built up.
In[16]:= FoldList#2 + 10 #1 &, 0, ToCharacterCode"10495" - 48
Out[16]= {0, 1, 10, 104, 1049, 10 495}
In[20]:= UnionCharacters[str]
Out[20]= {i, M, p, s}
In[24]:= UniqueCharactersprotein
Out[24]= {M, K, S, E, L, Q, C, F, A, G, R, T, P, N, I, W, H, V, Y}
The first letters on the keys on the phone pad are the following. We have input them here all
uppercase as the names from our database are in that format. You may have to make adjust-
ments to the case (ToUpperCase, ToLowerCase) depending upon your sources.
In[29]:= firstLetters = "A", "D", "G", "J", "M", "P", "T", "W";
Here are the letters in one of the names in the database.
7.1 Structure and syntax: exercises 217
This list of letters is a subset of the first letters from the phone pad.
In[31]:= SubsetQfirstLetters, nChars
Out[31]= True
Here then is a predicate that checks if a name consists of letters that are a subset of the phone
pad first letters.
In[32]:= PhoneNameQname_String :=
ModulenChars, firstLetters = "A", "D", "G", "J", "M", "P", "T", "W",
nChars = Characters[name ];
SubsetQfirstLetters, nChars
In[33]:= PhoneNameQ"PAT"
Out[33]= True
In[34]:= Length[names]
Out[34]= 4275
Now we need an 8-bit key to do the encoding. It could be a random sequence of bits or it might
be a letter in binary Ascii. For this example, our key will be the binary Ascii code for the letter K.
In[37]:= key = First @ IntegerDigitsToCharacterCode"K", 2, 8
Out[37]= {0, 1, 0, 0, 1, 0, 1, 1}
Map the BitXor operator with this key across each of the binary representations of the letters in
text.
In[38]:= lis = MapBitXor# , key &, text
Out[38]= {{0, 0, 0, 0, 0, 1, 0, 0}, {0, 0, 1, 1, 1, 0, 0, 1}, {0, 0, 1, 0, 1, 0, 1, 0},
{0, 0, 1, 0, 0, 1, 0, 1}, {0, 0, 1, 0, 1, 1, 0, 0}, {0, 0, 1, 0, 1, 1, 1, 0}}
Convert from character codes to Ascii letters. Although only five characters appear to be in the
ciphertext below, there are in fact six characters; the first character is a nonprintable Ascii
character with character code 4.
In[40]:= ciphertext = FromCharacterCode[%]
Out[40]= \.049*%,.
5. Create a function StringPermutations[���] that returns all permutations of the string str. For
example:
In[4]:= MakeVarList[x, 8]
Out[4]= {x1, x2, x3, x4, x5, x6, x7, x8}
In[7]:= StringTally"One fish, two fish, red fish, blue fish", IgnoreCase → True
Out[7]= {o, 2}, {n, 1}, {e, 3}, { , 7}, f, 4, {i, 4}, {s, 4}, {h, 4},
{,, 3}, {t, 1}, {w, 1}, {r, 1}, {d, 1}, {b, 1}, {l, 1}, {u, 1}
When done, import a sample text and do a frequency analysis on the letters in that text. Letter
frequency analysis can be used to spot transposition ciphers in encoded messages as the
frequency of the letters is unchanged in such simple encoding schemes.
Exercise 9 in Section 7.4 asks you to extend this function to include an option to specify if
punctuation and digits should be included.
9. Generalize the Caesar cipher so that it encodes by shifting n places to the right. Include the
space character in the alphabet.
10. A mixed-alphabet cipher is created by first writing a keyword followed by the remaining letters
of the alphabet and then using this key to encode the text. For example, if the keyword is
django, the encoding alphabet would be
220 Essentials of Programming in Mathematica
djangobcefhiklmpqrstuvwxyz
So, a is replaced with d, b is replaced with j, c is replaced with a, and so on. As an example, the
text
the sheik of araby
would be encoded as
tcg scgeh mo drdjy
Implement this cipher and go one step further to output the ciphertext in blocks of length five,
omitting spaces and punctuation.
11. Modify the alphabet permutation cipher so that, instead of being based on single letters, it is
based on adjacent pairs of letters. The single letter cipher has 26! permutations:
26! = 403 291 461 126 605 635 584 000 000
The adjacent pairs cipher will have 262 ! = 1.883707684133810×101621 permutations.
12. Create a function StringPad[���, {�}] that pads the end of a string with n whitespace
characters. Then create a second rule StringPad[���, �] that pads the string out to length n. If
the input string has length greater than n, issue a warning message. Finally, mirroring the
argument structure for the built-in PadLeft, create a third rule StringPad[���, �, �] that
pads with n whitespaces at the front and m whitespaces at the end of the string.
13. Fibonacci words are formed in a similar manner as Fibonacci numbers except, instead of
adding the previous two elements, Fibonacci words concatenate the previous two elements
(Knuth 1997). Starting with the two strings “0” and “01,” create a function FibonacciWord[�]
to generate the nth Fibonacci word. This can be generalized to start with any two strings, say
“a” and “b.” Fibonacci words are examples of a well-known object from combinatorics, Stur-
mian words.
14. In Exercise 8, Section 5.1 a function was created to generate n-grams from a given alphabet. For
example, that function could be used to create all bigrams (words of length two) from the
nucleotide alphabet {" G ", " C ", " A ", " T "}.
Import a nucleotide sequence such as the human mitochondrial genome hsMito below and
then create a histogram (as in Figure 7.2) showing the frequency of each of the sixteen possible
bigrams AA, AC, AT, etc.
Figure 7.2. Distribution of nucleotide words of length two in Homo sapiens mitochondria genome.
0.10
0.08
0.06
0.04
0.02
�� �� �� �� �� �� �� �� �� �� �� �� �� �� �� ��
0.00
7.2 Solutions
1. Here is the function that checks if a string is a palindrome.
In[1]:= PalindromeQstr_String := StringReverse[str ] == str
In[2]:= PalindromeQ"mood"
Out[2]= False
In[3]:= PalindromeQ"PoP"
Out[3]= True
An argument that is a number can be converted to a string and then the previous rule is called.
In[6]:= PalindromeQ[num_Integer ] := PalindromeQToString[num ]
In[13]:= ClearStringTranspose;
StringTranspose[str1_, str2_] :=
StringJoinTransposeCharacters[{str1, str2 }]
Transpose will, helpfully, return an error message if the two strings are of unequal length.
In[16]:= StringTranspose"abcd", "efg"
Transpose::nmtx : The �rst two levels of {{a, b, c, d}, {e, f, g}} cannot be transposed.
StringJoin::string :
String expected at position 1 in StringJoinTranspose{{a, b, c, d}, {e, f, g}}.
In[24]:= StringPermutations"ACGT"
Out[24]= {ACGT, ACTG, AGCT, AGTC, ATCG, ATGC, CAGT, CATG, CGAT, CGTA, CTAG, CTGA,
GACT, GATC, GCAT, GCTA, GTAC, GTCA, TACG, TAGC, TCAG, TCGA, TGAC, TGCA}
6. The approach here, in comparison with that in Exercise 10 in Section 2.3, is to convert the
integers to strings and operate on the strings. When done, we convert the string back to an
integer. To start, here are the first few primes.
In[25]:= Prime[Range[10]]
Out[25]= {2, 3, 5, 7, 11, 13, 17, 19, 23, 29}
In[29]:= Prime[Range[12]]
Out[29]= {2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37}
In[32]:= SmarandacheWellin2[10]
Out[32]= 2 357 111 317 192 329
Compared with the solution from Section 2.3, the string-based solution is a bit faster, even with
all the conversion from numbers to strings and back.
In[33]:= SmarandacheWellinn_Integer ? Positive :=
FromDigitsFlattenIntegerDigits @ TablePrimei, i, n
One potential limitation of Unique is that it uses the first unused symbol of a particular form. It
does this to avoid overwriting existing symbols.
In[38]:= TableUnique"x", {8}
Out[38]= {x63, x64, x65, x66, x67, x68, x69, x70}
However, if you want to explicitly create a list of indexed symbols with a set of specific indices,
it is useful to create a different function. First, note that a string can be converted to a symbol
using ToExpression or by wrapping the string in Symbol.
In[39]:= Head"x1"
Out[39]= String
StringJoin is used to concatenate strings. So, let us concatenate the variable with the index,
first with one number and then with a range of numbers.
7.2 Operations on strings: exercises 225
Note that we have not been too careful about argument checking.
In[47]:= MakeVarList[tmp, {-2, 2}]
Out[47]= {-2 + tmp, -1 + tmp, tmp0, tmp1, tmp2}
Using a negative index is a problem when the string is converted using ToExpression.
In[48]:= Clear[x]
In[56]:= Tally[%]
Out[56]= {{m, 1}, {i, 4}, {s, 4}, {p, 2}}
Let’s sort on the characters, the first element in each sublist; then take the twenty-six pairs that
give the Ascii letter tallies.
In[60]:= counts = TakeSortStringTallyalice, -29 ;; -3
Out[60]= {a, 10 191}, {b, 1806}, {c, 3114}, {d, 5678}, {e, 15 877}, f, 2446,
{g, 3029}, {h, 8102}, {i, 8949}, {j, 238}, {k, 1314}, {l, 5456}, {m, 2546},
{n, 8358}, {o, 9775}, {p, 2051}, {q, 237}, {r, 6881}, {s, 7498}, {t, 12 637},
{u, 4134}, ù, 1, {v, 1000}, {w, 3049}, {x, 185}, {y, 2672}, {z, 79}
15 000
10 000
Out[61]=
5000
0
a b c d e f g h i j k l m n o p q r s t u ù v w x y z
9. This is a simple modification of the code given in the text. But first we add the space character to
the alphabet.
7.2 Operations on strings: exercises 227
Giving coderules an argument n will allow you to shift an arbitrary number of places. We give n
a default value of 1 so that omitting the argument will default to the value n = 1.
In[64]:= coderules[n_: 1] := Threadalphabet → RotateRightalphabet, n
In[69]:= decode[%, 5]
Out[69]= squeamish ossifrage
10. First, here is the list of characters from the plaintext alphabet.
In[70]:= PlainAlphabet = CharacterRange"a", "z"
Out[70]= a, b, c, d, e, f, g, h, i, j, k, l, m, n, o, p, q, r, s, t, u, v, w, x, y, z
Omit spaces and punctuation and output in blocks of length 5 (using stringPartition from
Section 7.5).
In[77]:= stringPartitionstr_String , seq__ :=
MapStringJoin, PartitionCharacters[str ], seq
codeRules =
ThreadCharacterRange"a", "z" → Characters @ CipherAlphabetkey ;
s1 = StringJoinCharacters[str ] /. codeRules;
s2 = StringSplits1, RegularExpression"\\W+";
s3 = stringPartitionStringJoin[s2], blocksize , blocksize , 1, "";
StringJoinRiffles3, " "
For the second rule, first create a message that will be issued if the string is longer than the pad
length, n.
7.2 Operations on strings: exercises 229
In[85]:= StringPad::badlen =
"Pad length `1` must be greater than the length of string `2`.";
In[86]:= StringPadstr_String , n_ :=
Withlen = StringLength[str ],
Iflen > n , MessageStringPad::badlen, n , str , StringPadstr , n - len
In[88]:= StringPad"ciao", 3
StringPad::badlen : Pad length 3 must be greater than the length of string ciao.
Finally, here is a rule for padding at the beginning and end of the string.
In[89]:= StringPadstr_String , n_, m_ :=
StringJoinTable" ", {n }, str , Table" ", {m }
In[97]:= FibonacciWord[12]
Out[97]= 0100101001001010010100100101001001010010100100101001010010010100100101001010010
0101001001010010100100101001010010010100100101001010010010100101001001010010
0101001010010010100100101001010010010100101001001010010010100101001001010010
01
There lots of interesting things that you can discover regarding Fibonacci words.
In[98]:= TableStringCountFibonacciWordi, "1", i, 1, 15
Out[98]= {0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, 233, 377}
230 Essentials of Programming in Mathematica
If you were generating very large Fibonacci words, it would be advisable to use dynamic
programming as described in Section 5.3 to reduce the scope of the recursion.
14. Start by importing the example FASTA file containing the mitochondrial human genome
sequence.
In[99]:= hsMito = First @ Import"ExampleData/mitochondrion.fa.gz";
Here is the NGrams function:
In[100]:= NGramsalphabet : __String, n_Integer ? Positive :=
FlattenOuterStringJoin, ApplySequence, Tablealphabet , {n }
This gives all possible bigrams from the DNA alphabet.
In[101]:= bigrams = NGrams"A", "T", "G", "C", 2
Out[101]= {AA, AT, AG, AC, TA, TT, TG, TC, GA, GT, GG, GC, CA, CT, CG, CC}
0.10
0.08
0.06
Out[104]=
0.04
0.02
�� �� �� �� �� �� �� �� �� �� �� �� �� �� �� ��
0.00
3. Modify the listSort function from Section 4.3 by creating another rule that can be used to
sort lists of string characters.
4. Find the number of unique words in a body of text such as Alice in Wonderland. This text can be
imported from ExampleData:
0.25
0.20
���������
0.15
0.10
0.05
0.00
5 10 15
���� ������
Then compare the word-length distribution for several different text sources such as those
available in ExampleData[" Text "] or on gutenberg.org.
6. Repeat Exercise 5 but use sentence length instead of word length as the measure.
7. Semordnilaps (“palindromes” spelled backwards) are words that, when reversed, also spell a
word. For example, live and stressed are semordnilaps because reversed, they still spell words: evil
and desserts. Find all semordnilaps in the dictionary.
232 Essentials of Programming in Mathematica
7.3 Solutions
1. We will work with a small sample of words from the dictionary.
In[1]:= SeedRandom[0];
words = DictionaryLookup[];
sample = RandomSamplewords, 12
Out[3]= unaccustomed, Godhead, Jutland, dilated, observe, matchplay,
wintergreen, clans, hobgoblin, rampantly, disinheriting, performances
StringReplace operates on any words that match the pattern and leave those that do not
match unchanged.
In[4]:= StringReplacesample, f_ ? UpperCaseQ ~~ r___ ⧴ ToLowerCasef ~~ r
Out[4]= unaccustomed, godhead, jutland, dilated, observe, matchplay,
wintergreen, clans, hobgoblin, rampantly, disinheriting, performances
In[6]:= Decapitalizesample
Out[6]= unaccustomed, godhead, jutland, dilated, observe, matchplay,
wintergreen, clans, hobgoblin, rampantly, disinheriting, performances
2. You can do a dictionary lookup with a pattern that tests whether the word is palindromic. Then
find all palindromic words of a given length. Note the need for BlankSequence (__) as the
simple pattern _ would only find words consisting of one character.
In[7]:= Palindromeslen_Integer :=
DictionaryLookupw__ /; w == StringReverse[w ] && StringLength[w ] ⩵ len
We also add a rule to return all palindromes of any length.
In[8]:= Palindromes[] := DictionaryLookupw__ /; w == StringReverse[w ]
In[9]:= Palindromes[7]
Out[9]= deified, repaper, reviver
In[10]:= Palindromes[]
Out[10]= a, aha, aka, bib, bob, boob, bub, CFC, civic, dad, deed, deified, did, dud, DVD,
eke, ere, eve, ewe, eye, gag, gig, huh, I, kayak, kook, level, ma'am, madam, mam,
MGM, minim, mom, mum, nan, non, noon, nun, oho, pap, peep, pep, pip, poop, pop,
pup, radar, redder, refer, repaper, reviver, rotor, sagas, sees, seres, sexes,
shahs, sis, solos, SOS, stats, stets, tat, tenet, TNT, toot, tot, tut, wow, WWW
7.3 String patterns: exercises 233
3. A simple change to the rule from Section 4.3 will allow for lists of string characters. Here we just
add a rule to the original rule for sorting lists of numbers. As written, this only works for lists of
lowercase letters.
In[11]:= listSort =
x___, a_ ? StringQ, b_ ? StringQ, y___ ⧴
x , b , a , y /; FirstToCharacterCodeb < FirstToCharacterCode[a ],
x___, a_ ? NumericQ, b_ ? NumericQ, y___ ⧴ x , b , a , y /; b < a
;
In[12]:= {82, 5, 29, 98, 98, 43, 90, 11, 52, 46, 38, 48} //. listSort
Out[12]= {5, 11, 29, 38, 43, 46, 48, 52, 82, 90, 98, 98}
In[14]:= strList = "i", "w", "z", "p", "a", "s", "n", "l", "h", "q", "r", "d", "c",
"f", "o", "y", "j", "u", "x", "t", "m", "b", "g", "e", "k", "v";
In fact, splitting words using a list of characters as we have done here is not terribly robust. A
better approach uses regular expressions (introduced in Section 7.4):
In[23]:= words = StringSplittext, RegularExpression"\\W+";
Lengthwords
Out[24]= 9969
Using TextWords, this can be done directly, although the count is a bit different due to slightly
different assumptions between what we used in StringSplit and what TextWords assumes.
In[27]:= words = DeleteDuplicates @ ToLowerCaseTextWords[text];
Lengthwords
Out[28]= 1549
5. We will work with the following text: A Portrait of the Artist as a Young Man, by James Joyce
(available at Project Gutenberg). We use TextWords to get a list of the words and then use
StringLength on these words to get the distribution of word lengths.
Some postprocessing with Stringtake is needed to remove metadata at the beginning and at
the end of the file.
In[29]:= joyce = StringTakeImport"http://www.gutenberg.org/cache/epub/4217/pg4217.txt",
"Text", 688 ;; -18 843;
StringTakejoyce, {74, 164}
Out[30]= as animum dimittit in artes."
Ovid, Metamorphoses, VIII., 18._
</p>
Chapter 1
Once upon
7.3 String patterns: exercises 235
0.20
Frequency
0.15
Out[32]= 0.10
0.05
0.00
5 10 15 20
Word length
6. Here we use TextSentences to split the text into discrete sentences and then map WordCount
over the list of sentences.
In[33]:= sentences = TextSentencesjoyce;
0.04
0.03
Frequency
0.02
Out[34]=
0.01
0.00
0 20 40 60 80 100 120 140
Sentence length
Finally, here are all those reversed words that are in the dictionary.
236 Essentials of Programming in Mathematica
A word of warning: if you tried to do this by comparing every word in the dictionary with every
reversed word in the dictionary, the number of comparisons would be extremely large and bog
down the computation.
7.4 Regular expressions: exercises 237
In[39]:= TimeConstrained
DictionaryLookupword__ /; MemberQwords, StringReverseword ,
20
Out[39]= $Aborted
following transcription of a lecture from the University of Warwick, Centre for Applied
Linguistics (Base Corpus) contains quite a few fragments that should be removed, including
newline characters, parenthetical remarks, and nonwords. Use StringReplace with the
appropriate rules to clean this text and then apply your code to a larger corpus.
In[7]:= text =
"okay well er today we're er going to be carrying on with the er French
\nRevolution you may have noticed i was sort of getting rather er
enthusiastic \nand carried away at the end of the last one i was sort
of almost er like i sort \nof started at the beginning about someone
standing on a coffee table and s-, \nshouting to arms citizens as if i
was going to sort of leap up on the desk and \nsay to arms let's storm
the Rootes Social Building [laughter] or er let's go \nout arm in arm
singing the Marseillaise or something er like that";
9. Modify the solution to Exercise 8 in Section 7.2 so that StringTally includes an option
IncludeCharacters that, by default, has value LetterCharacters, which should mean that
StringTally only tallies letters; that is, excludes non-letter characters from the tally. Other
values for IncludeCharacters could be All (include all characters in the tally),
WordCharacters (include only word characters), PunctuationOnly (include only
punctuation).
10. In web searches and certain problems in natural language processing, it is often useful to filter
out certain words prior to performing a search or processing of text to help with the perfor-
mance of the algorithms. Words such as and, the, and is are commonly referred to as stop words
for this purpose. Lists of stop words are almost always created manually based on the con-
straints of a particular application. Sample lists of stop words are also commonly available
across the Internet. For our purposes here, we will use one such list included with the materials
for this book.
7.4 Solutions
1. Here is the short piece of text.
In[1]:= text = "How many vowels do I have?";
The regular expression [aeiou] is matched by any of the vowels.
In[2]:= StringCounttext, RegularExpression"[aeiou]"
Out[2]= 7
2. First, get a list of the words in the text Alice in Wonderland.
In[3]:= words = TextWordsExampleData"Text", "AliceInWonderland";
The regular expression ".+q.+" is matched by strings starting with some number (possibly
zero) of characters, followed by an explicit q, followed by some number of characters. Flatten is
needed to remove the empty lists that are returned for each nonmatch of the pattern.
In[4]:= Flatten @ StringCaseswords, RegularExpression".*q.*"
Out[4]= {quite, quite, quite, queer, question, inquisitively, Conqueror,
quiver, quite, quiet, quite, quite, quite, queer-looking, question,
quite, Conqueror, conquest, question, question, quite, question, quite,
quicker, quite, quite, quite, squeaking, quite, question, quietly,
quite, croquet, croquet, question, quite, croquet, queer-shaped,
quite, quietly, croquet, croquet, question, croquet-ground, croquet,
quarrelling, quarrel, croqueting, croquet-ground, quarreling, quite, quite}
Simply replacing q with the alternative (q Q) gets all occurrences of q either lowercase or
uppercase.
In[5]:= Flatten @ StringCaseswords, RegularExpression".*(q|Q).*"
Out[5]= {quite, quite, quite, queer, question, inquisitively, Conqueror, quiver, quite,
quiet, quite, quite, quite, queer-looking, question, quite, Conqueror,
conquest, question, question, quite, question, quite, quicker, Quick,
quite, quite, quite, squeaking, quite, question, quietly, quite, Queen,
croquet, Queen, croquet, question, quite, croquet, Queen, queer-shaped,
quite, quietly, croquet, Queen, QUEEN'S, CROQUET, Queen, Queen, Queen,
Queen, Queens, QUEEN, Queen, croquet, Queen, question, Queen, Queen's,
Queen, croquet-ground, croquet, quarrelling, Queen, quarrel, Queen,
croqueting, Queen, Queen, Queen, croquet-ground, Queen, quarreling, Queen,
Queen, quite, Queen, Queen, quite, Queen, Queen, Queen, Queen, Queen}
3. The pattern used earlier in the chapter was "AA" ~~ _ ~~ "T". In a regular expression, we want
the character A repeated exactly once. Use the expression "A{2,2}" for this. The regular
expression "." stands for any character.
In[6]:= gene = GenomeData"IGHV357";
240 Essentials of Programming in Mathematica
In[11]:= DictionaryLookup"a" "e" "i" "o" "u" "y" .., IgnoreCase → True
Out[11]= {a, aye, eye, I, IOU, oi, ya, ye, yea, yo, you}
6. This one is a bit tricky and requires the use of named string patterns. So in the following, \\n
refers to the immediately preceding pattern (.). It is important to name each pattern differently
so they can be matched by different characters.
In[12]:= words = DictionaryLookup[];
See the built-in tutorial Regular Expressions for more information on named string patterns.
7. Here is the short list of words with which we will work.
In[14]:= words = "building", "finch", "fix", "ratio", "envy", "boy", "baby",
"faculty", "honorarium";
Using regular expressions, these rules encapsulate those given in the exercise.
7.4 Regular expressions: exercises 241
In[15]:= rules =
RegularExpression"(\\w+)x" ⧴ "$1" ~~ "x" ~~ "es",
RegularExpression"(\\w+)(ch)" ⧴ "$1" ~~ "$2" ~~ "es",
RegularExpression"(\\w+)([aeiou])(y)" ⧴ "$1" ~~ "$2" ~~ "$3" ~~ "s",
RegularExpression"(\\w+)(y)" ⧴ "$1" ~~ "ies",
RegularExpression"(\\w+)(i)um" ⧴ "$1" ~~ "$2" ~~ "a",
RegularExpression"(\\w+)(.)" ⧴ "$1" ~~ "$2" ~~ "s"
;
Out[18]= buildings, finches, fixes, ratios, envies, boys, babies, faculties, honorarium
8. We use a combination of string patterns and regular expressions to remove the various frag-
ments. The regular expression "\[.+\] " matches strings that start with [, followed by an
arbitrary number of characters, followed by ], followed by a space. Because brackets are used in
regular expressions to denote sequences of characters, you need to escape them to refer to the
explicit characters [ or ].
In[19]:= text =
"okay well er today we're er going to be carrying on with the er
French \nRevolution you may have noticed i was sort of getting
rather er enthusiastic \nand carried away at the end of the
last one i was sort of almost er like i sort \nof started at
the beginning about someone standing on a coffee table and s-,
\nshouting to arms citizens as if i was going to sort of leap
up on the desk and \nsay to arms let's storm the Rootes Social
Building [laughter] or er let's go \nout arm in arm singing
the Marseillaise or something er like that";
242 Essentials of Programming in Mathematica
In[20]:= StringReplacetext, "\n" → "", " er" → "", " s-" → "",
RegularExpression"\[.+\] " → ""
Out[20]= okay well today we're going to be carrying on with the French Revolution you
may have noticed i was sort of getting rather enthusiastic and carried
away at the end of the last one i was sort of almost like i sort of
started at the beginning about someone standing on a coffee table
and, shouting to arms citizens as if i was going to sort of leap up
on the desk and say to arms let's storm the Rootes Social Building or
let's go out arm in arm singing the Marseillaise or something like that
9. Start by setting the options framework.
In[21]:= ClearStringTally
Note the need for WordBoundary in what follows; otherwise, ocean would be split leaving oce
because an is a stop word.
In[31]:= StringSplittmp, WordBoundary ~~ ApplyAlternatives, stopwords ~~ WordBoundary,
IgnoreCase → True // Flatten
Out[31]= {deep, ocean}
2. Generalize the RandomString function to allow for a Weights option so that you can provide a
weight for each character in the generated string. Include a rule to generate a message if the
number of weights does not match the number of characters or if the sum of the weights does
not equal one. For example:
In[1]:= RandomString"A", "T", "C", "G", 30, Weights → {.1, .2, .3, .4}
Out[1]= GTCCTGTGATTCGGTTCCAGTAGCCCGCTT
In[2]:= RandomString"A", "T", "C", "G", {5, 10}, Weights → {.1, .4, .4, .1}
Out[2]= {CCTATCCTAG, CACCTCACCC, CCTCACTTCG, CCCTCCCCAC, TCCCTCTGTT}
In[3]:= RandomString"A", "T", "C", "G", {5, 10}, Weights → {.1, .4}
RandomString::badwt :
The length of the list of weights must be the same as the length of the list of characters.
3. Rewrite the function Anagrams developed in Section 7.2 without resorting to the use of
Permutations. Consider using the Sort function to sort the characters. Note the difference in
speed of the two approaches: one involving string functions and the other list functions that
operate on lists of characters. Increase the efficiency of your search by only searching for words
of the same length as your source word.
4. Create a function that searches the built-in dictionary for words containing a specified sub-
string. Set up an option to your function whose value specifies where in the string the sub-
string occurs: start, middle, end, anywhere. For example:
8. Word collocation refers to expressions of two or more words that create a familiar phrase,
such as black coffee or sharp as a tack. They are important in many linguistic applications: natural
language translation and corpus research involving social phenomena, for example. In this
exercise you will create functions for extracting pairs of words of a predetermined form
involving parts of speech such as {adjective, noun}.
Start by creating some functions to preprocess your text: split the text into pairs of words and,
for simplicity, convert all words to lowercase. Next, filter out words that are not contained in
the dictionary. Then, find all remaining pairs that are of a certain form involving the parts of
speech. This information is contained in WordData:
In[6]:= sentence =
"Alice was beginning to get very tired of sitting by her sister on
the bank, and of having nothing to do. Once or twice she had
peeped into the book her sister was reading, but ";
In[7]:= PreProcessString[sentence]
Out[7]= {was, beginning}, {beginning, to}, {to, get}, {get, very},
{very, tired}, tired, of, of, sitting, {sitting, by}, {by, her},
{her, sister}, {sister, on}, {on, the}, {the, bank}, {bank, and},
and, of, of, having, {having, nothing}, {nothing, to}, {to, do},
{do, once}, {once, or}, {or, twice}, {twice, she}, {she, had},
{had, peeped}, {peeped, into}, {into, the}, {the, book}, {book, her},
{her, sister}, {sister, was}, {was, reading}, {reading, but}
letter. Then use that code to rewrite FunctionsWithOption (Exercise 17 in Section 5.5) so it
only checks this smaller list of functions for options.
7.5 Solutions
1. Here is the gcRatio function as written in the text.
In[1]:= gcRatioseq_String := Module{gc, at},
gc = StringCountseq , "G" "C";
at = StringCountseq , "A" "T";
N[gc / (gc + at)]
Instead of computing the occurrences of A or T, note that the denominator of the ratio is really
the length of the entire string since DNA contains only G, C, A, and T. So instead, use
StringLength[seq] there. This will make the code a bit shorter and slightly faster.
In[2]:= gcRatioseq_String := Module{gc},
gc = StringCountseq , "G" "C";
Ngc StringLength[seq ]
In[4]:= gcRatio[seq]
Out[4]= 0.65
2. One rule is needed for one-dimensional output and another for multi-dimensional output.
In[5]:= ClearAllRandomString
In[7]:= RandomString::badwt =
"The length of the list of weights must be the same as the length
of the list of characters.";
In[8]:= RandomStringc__String , n_Integer: 1, OptionsPattern[] :=
Modulewts = OptionValueWeights,
Which
Length[wts] ⩵ 0, StringJoinRandomChoice[{c }, n ],
Length[wts] ⩵ Length[{c }], StringJoinRandomChoice[wts → {c }, n ],
True, MessageRandomString::badwt
248 Essentials of Programming in Mathematica
In[13]:= RandomString"A", "C", "T", {4, 10}, Weights → {.2, .7, .1}
Out[13]= {CCCCACCCCA, TACCCCTCCA, CACCCCATAC, CACTCCCACC}
3. Two words are anagrams if they contain the same letters but in a different order. This function
is fairly slow as it sorts and compares every word in the dictionary with the sorted characters of
the input word.
In[15]:= Anagrams2word_String :=
Modulechars = SortCharactersword ,
DictionaryLookupx__ /; SortCharacters[x ] ⩵ chars
You can speed things up a bit by only working with those words in the dictionary of the same
length as the source word.
In[17]:= Anagrams3word_String := Modulelen = StringLengthword , words,
words = DictionaryLookupw__ /; StringLength[w ] ⩵ len;
Selectwords, SortCharacters[# ] ⩵ SortCharactersword &
7.5 Examples: exercises 249
In fact, you can speed this up a bit further by using regular expressions even though the con-
struction of the regular expression in this case is a bit clumsy looking. The lesson here is that
conditional string patterns tend to be slower.
In[19]:= Anagrams4word_String := Modulelen = StringLengthword , words,
words = DictionaryLookupRegularExpression"\\w{" <> ToStringlen <> "}";
Selectwords, SortCharacters[# ] ⩵ SortCharactersword &
And this gives all words that have cite somewhere in them, at the beginning, middle, or end.
In[25]:= DictionaryLookup___ ~~ "cite" ~~ ___
Out[25]= {anthracite, calcite, cite, cited, cites, elicited, excite, excited, excitedly,
excitement, excitements, exciter, exciters, excites, incite, incited,
incitement, incitements, inciter, inciters, incites, Lucite, Lucites,
overexcite, overexcited, overexcites, plebiscite, plebiscites, recite,
recited, reciter, reciters, recites, solicited, unexcited, unsolicited}
250 Essentials of Programming in Mathematica
Using the double blank gives words that have cite in them but not beginning or ending with cite.
In[27]:= DictionaryLookup__ ~~ "cite" ~~ __
Out[27]= {elicited, excited, excitedly, excitement, excitements, exciter,
exciters, excites, incited, incitement, incitements, inciter, inciters,
incites, Lucites, overexcited, overexcites, plebiscites, recited,
reciter, reciters, recites, solicited, unexcited, unsolicited}
Let us put these pieces together in a reusable function FindWordsContaining. We will include
one option, WordPosition that identifies where in the word the substring is expected to occur.
In[28]:= OptionsFindWordsContaining = WordPosition → "Start";
Depending upon the value of the option WordPosition, Which directs which expression will be
evaluated.
In[29]:= FindWordsContainingstr_String , OptionsPattern[] :=
Modulewp = OptionValueWordPosition,
Which
wp == "Start", DictionaryLookup[str ~~ ___],
wp == "Middle", DictionaryLookup[__ ~~ str ~~ __],
wp == "End", DictionaryLookup[___ ~~ str ],
wp ⩵ "Anywhere", DictionaryLookup[___ ~~ str ~~ ___]
This could also be done with regular expressions. The pattern "\\bcite.*\\b" matches any
string starting with a word boundary followed by the string cite, followed by characters
repeated one or more times, followed by a word boundary.
In[30]:= DictionaryLookupRegularExpression"\\bcite.*\\b"
Out[30]= {cite, cited, cites}
With suitable modifications to the above for the target string occurring in the middle, end, or
anywhere, here is the rewritten function. Note the need for StringJoin here to properly pass
the argument str, as a string, into the body of the regular expression.
In[31]:= OptionsFindWordsContaining = WordPosition → "Start";
7.5 Examples: exercises 251
In[33]:= FindWordsContaining"cite"
Out[33]= {cite, cited, cites}
In[40]:= StringCasesblocks[[1]],
RegularExpression"[^A-z|0-9|\\s]"
Out[40]= {,, ,, ., ,, ,, ., ", ., ,, ", ,, ", ?, ", ., ., ", ,, ", ;,
", ., ,, ., ", ., ., ", ?, ", ., ", ,, ., ", ., ", ,, ,, ,, ., ;}
Now perform the same computation over all blocks and then compute the mean.
In[42]:= counts = MapStringCount# , RegularExpression"[^A-z|0-9|\\s]" &, blocks;
In[43]:= N[Mean[counts]]
Out[43]= 34.3021
Try out some of the argument structures commonly used with Partition. For example, this
partitions the string into blocks of length 3 with offset 1, with no padding.
In[52]:= stringPartition[str, 3, 3, 1, {}]
Out[52]= {CCC, TTA, GTT, TTT, AAT, TAT, CC}
7. Start by creating a substitution cipher by simply shifting the alphabet three characters to the left.
7.5 Examples: exercises 253
In[53]:= keyRL3 =
TransposeCharacterRange"a", "z", RotateLeftCharacterRange"a", "z", 3
Out[53]= {a, d}, {b, e}, c, f, {d, g}, {e, h}, f, i, {g, j}, {h, k},
{i, l}, {j, m}, {k, n}, {l, o}, {m, p}, {n, q}, {o, r}, {p, s}, {q, t},
{r, u}, {s, v}, {t, w}, {u, x}, {v, y}, {w, z}, {x, a}, {y, b}, {z, c}
Finally, here is the encoding function. Recall the "$1" on the right-hand side of the rule refers to
the first (and only in this case) regular expression on the left that is enclosed in parentheses.
In[56]:= encodestr_String , key_List :=
StringReplacestr , RegularExpression"([a-z])" ⧴ encodeChar"$1", key
The decoding uses the same key, but reverses the pairs.
In[57]:= decodestr_String , key_List := encodestr , MapReverse, key
You might want to modify the encoding rule to deal with uppercase letters. One solution is
simply to convert them to lowercase.
In[60]:= encodestr_String , key_List :=
StringReplaceToLowerCase[str ],
RegularExpression"([a-z])" ⧴ encodeChar"$1", key
In[64]:= Clear[NGrams]
9. To find symbols in the list of built-in functions that start with a capital letter, use the following
regular expression: RegularExpression["^[[:upper:]]\\w+"]. This will be matched by a
string that starts with one of the letters A through Z, followed by any sequence of characters.
The caret ^ is used to denote the beginning of the string. We will use StringCases on the full
list of built-in symbols with this regular expression as the pattern to match against.
In[72]:= StringCasesNames"System`*", RegularExpression"^[[:upper:]]\\w+";
This list will need to be flattened to delete the empty lists where a match did not occur. Here
then is the rewritten function from Exercise 17, Section 5.5.
In[73]:= FunctionsWithOptionopt_Symbol := Modulenames, lis,
names = Flatten @ StringCasesNames"System`*",
RegularExpression"^[[:upper:]]\\w+";
lis = DeleteCasesnames, f_ /; OptionsSymbolf === {};
Selectlis, MemberQOptionsSymbol[# ], opt , 2 &
In[74]:= FunctionsWithOptionStepMonitor
Out[74]= {FindArgMax, FindArgMin, FindFit, FindMaximum, FindMaxValue,
FindMinimum, FindMinValue, FindRoot, NArgMax, NArgMin, NDSolve,
NDSolveValue, NMaximize, NMaxValue, NMinimize, NMinValue,
NonlinearModelFit, NRoots, ParametricNDSolve, ParametricNDSolveValue}
8
Graphics and visualization
8. Create a graphic that represents the solution to the following algebraic problem that appeared
in the Calculus&Mathematica courseware (Porta, Davis, and Uhl 1994). Find the positive numbers
r such that the following system has exactly one solution in x and y:
(x - 1)2 + (y - 1)2 = 2
(x + 3)2 + (y - 4)2 = r2
Once you have found the right number r, plot the resulting circles on the same axes, plotting
the first circle with solid lines and the two solutions with dashed lines.
9. Create a graphic of the sine function over the interval (0, 2 π) that displays vertical lines at each
point calculated by the Plot function to produce the curve.
10. Bundle up the code fragments for the visualization of the triangle centroid into a function
CentroidPlot that takes a Triangle graphics primitive as its argument and returns a graphic
similar to that in this section. Set up your function to inherit options from Graphics.
Add a check to CentroidPlot to return a message if the three vertices of the triangle are
collinear.
11. The centroid of a triangle is only one kind of triangle center. The circumcenter is located at the
intersection of the perpendicular bisectors of the sides of the triangle and is also the center of
the circle passing through the vertices of the triangle, the circumcircle. The incenter is located at
the intersection of the angle bisectors and is the center of the largest circle inside the triangle.
The orthocenter is located at the intersection of the altitudes of the triangle (Kimberling 1994).
Create a graphic for each of these centers similar to that created for the centroid and the
medians.
12. Using options to the Plot function, create a plot showing the probability density function
(PDF) of a normal distribution together with vertical lines at the first and second standard
deviations. Your plot should look something like that in Figure 8.2 for a normal distribution
with μ = 0 and σ = 1.
8.1 The graphics language: exercises 259
0.3
0.2
0.1
-2σ -σ μ σ 2σ
8.1 Solutions
1. The color wheel can be generated by mapping the Hue directive over successive sectors of a disk.
Note that the argument to Hue must be scaled so that it falls within the range zero to one.
In[1]:= colorWheel[n_] :=
GraphicsHueRescale[# , {0, 2 π}], Disk[{0, 0}, 1, {# , # + n }] & /@
Range[0, 2 π, n ], ImageSize → Small
Here is a color wheel created from 256 separate sectors (hues).
π
In[2]:= colorWheel
256
Out[2]=
Out[9]=
Out[10]=
Below is a list of six cuboids and the resulting graphic. Notice the large amount of overlap of the
cubes. You can reduce the large overlap by specifying minimum and maximum values of the
cuboid.
In[12]:= cubes = MapCuboid, RandomReal[1, {6, 3}];
Out[13]=
4. Start by creating a unit cube centered on the origin. An opacity directive adds transparency.
8.1 The graphics language: exercises 261
Out[14]=
Next rotate 45°. Note the third argument of Rotate used to specify the axis about which the
rotation should occur.
In[15]:= Graphics3DOpacity[.25], Cuboid[{-.5, -.5, -.5}],
RotateCuboid[{-.5, -.5, -.5}], 45 °, {0, 0, 1}
Out[15]=
Here is the dynamic version. The angle θ is the parameter that is manipulated here. The explicit
PlotRange option is necessary to prevent its re-computation for every new angle of rotation.
In[16]:= Manipulate
Graphics3DRotateCuboid[{-.5, -.5, -.5}], θ, {0, 0, 1}, PlotRange → 1,
{θ, 0, 2 π}
Out[16]=
262 Essentials of Programming in Mathematica
Out[18]=
n
To add a label to the plot, use StringForm to slot some values into the string. The binomial
2
gives the number of pairs of points.
In[19]:= Graphics3D
Opacity[.3], LineSubsets[pts, {2}],
Red, PointSizeMedium, Point[pts],
PlotLabel → StringForm"`1` vertices, `2` edges", Length[pts],
BinomialLength[pts], 2
Out[19]=
6. First we create the Point graphics primitives using a normal distribution with mean zero and
standard deviation one.
In[20]:= randomcoords := PointRandomVariateNormalDistribution[0, 1], {1, 2}
This creates the point sizes according to the specification given in the statement of the problem.
In[21]:= randomsize := PointSizeRandomReal[{.01, .1}]
This creates a random color that will be used for each primitive.
In[22]:= randomcolor := RandomColorColorSpace → "Hue"
8.1 The graphics language: exercises 263
Here then are 500 points. (You may find it instructive to look at just one of these points.)
In[23]:= pts = Tablerandomcolor, randomsize, randomcoords, {500};
And here is the graphic.
In[24]:= Graphics[pts]
Out[24]=
Out[25]=
7. Here are the binary digits of π. First is used to get only the digits from RealDigits.
In[26]:= FirstRealDigitsNPi, 12, 2
Out[26]= {1, 1, 0, 0, 1, 0, 0, 1, 0, 0, 0, 0, 1, 1, 1, 1, 1, 1,
0, 1, 1, 0, 1, 0, 1, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0, 0, 0, 1, 0}
In[28]:= ListLinePlot
Withdigits = 50 000,
Accumulate2 FirstRealDigitsNPi, digits, 2 - 1
400
300
200
Out[28]=
100
-100
For the two-dimensional case, use Partition to pair up the binary digits, then a transformation
rule to convert them to compass directions.
In[29]:= Withdigs = FirstRealDigitsNPi, 50 000, 2,
ListLinePlot
AccumulatePartitiondigs, 2, 2 /. {{0, 0} → {-1, 0}, {1, 1} → {0, -1}},
AspectRatio → Automatic
-50 50 100
-100
Out[29]=
-200
-300
8. The algebraic solution is given by the following steps. First solve the equations for x and y.
In[30]:= Clear[x, y, r]
In[32]:= Solve
x /. soln〚1〛 ⩵ x /. soln〚2〛,
y /. soln〚1〛 ⩵ y /. soln〚2〛,
r
Out[32]= r → -5 - 2 , r → 5 - 2 , r → -5 + 2 , r → 5 + 2
Out[33]= r → 5 - 2 , r → 5 + 2
To display the solution, we will plot the first circle with solid lines and the two solutions with
dashed lines together in one graphic. Here is the first circle centered at (1, 1).
Here are the circles that represent the solution to the problem.
In[35]:= r1 = 5 - 2;
r2 = 5 + 2;
In[37]:= Graphicscirc, Circle[{-3, 4}, r1], Circle[{-3, 4}, r2], Axes → Automatic
10
Out[37]= 4
-8 -6 -4 -2 2
-2
We wanted to display the solutions (two circles) using dashed lines. The graphics directive
Dashing[{�, �}] directs all subsequent lines to be plotted as dashed, alternating the dash x
units and the space y units. We use it as a graphics directive on the two circles c1 and c2. The
circles inherit only those directives in whose scope they appear.
In[38]:= dashc1 = Red, Dashing[{.025, .025}], Circle[{-3, 4}, r1];
dashc2 = Red, Dashing[{.05, .05}], Circle[{-3, 4}, r2];
266 Essentials of Programming in Mathematica
In[40]:= Graphics
Thick, circ,
dashc1, dashc2, Axes → Automatic
10
Out[40]= 4
-8 -6 -4 -2 2
-2
0.5
Out[41]=
1 2 3 4 5 6
-0.5
-1.0
Using pattern matching, here are the coordinates that were used to construct the curve.
In[42]:= Shortcoords = Casessinplot, Line[{x__}] ⧴ x , Infinity, 2
Out[42]//Short= 1.28228 × 10-7 , 1.28228 × 10-7 , {22, 21}, 427, {1}, {1}
0.5
Out[44]=
1 2 3 4 5 6
-0.5
-1.0
10. First, here is the code for the triangle medians from Section 5.5.
In[45]:= TriangleMediansTriangle[{p1_, p2_, p3_}] := Modulemidpts,
midpts = (#1 + #2 ) / 2 & @@@ Subsets[{p1, p2 , p3 }, {2}];
MapThreadLine[{#1, #2 }] &, {p3 , p2 , p1}, midpts
Second, this bundles up the code fragments from Section 8.1 into a reusable function. We have
added options inherited from Graphics.
In[46]:= CentroidPlotTriangle[{p1_, p2_, p3_}], opts : OptionsPatternGraphics :=
Graphics
LightBlue, EdgeFormBlue, Triangle[{p1, p2 , p3 }],
Blue, PointSizeMedium, Point[{p1, p2 , p3 }],
Red, PointSizeMedium, Point @ RegionCentroidTriangle[{p1, p2 , p3 }],
Gray, TriangleMediansTriangle[{p1, p2 , p3 }], PointSizeMedium,
Point(#1 + #2 ) / 2 & @@@ Subsets[{p1, p2 , p3 }, {2}]
, opts
In[47]:= SeedRandom[15];
TableCentroidPlotTriangleRandomInteger[{-5, 5}, {3, 2}], {3}
Out[48]= , ,
To deal with the pathological situation where the points are collinear, first create a message that
will be issued under these conditions.
In[49]:= CentroidPlot::collinpts =
"The points `1` are collinear, giving a degenerate triangle.";
268 Essentials of Programming in Mathematica
Three points are collinear if and only if the area of the triangle determined by those points is
zero. The built-in Area function returns an error message in this situation:
In[50]:= pts = {{0, 0}, {1, 1}, {2, 2}};
AreaTriangle[pts]
Area::reg : Triangle{{0, 0}, {1, 1}, {2, 2}} is not a correctly speci�ed region.
We could trap for a non-numeric value returned by Area, but we will take another, more direct
approach. The area of the triangle determined by three points is given by the following
determinant:
x1 y1 1
x2 y2 1
x3 y3 1
In fact, we have already implemented this in the function SignedArea from Section 4.3.
In[52]:= SignedAreaTriangle[{v1_, v2_, v3_}] :=
1
Det[{v1, v2 , v3 } /.{x_, y_} ⧴ {x , y , 1}]
2
In[53]:= SignedAreaTriangle[pts]
Out[53]= 0
Graphics
LightBlue, EdgeFormBlue, Triangle[{p1, p2 , p3 }],
Blue, PointSizeMedium, Point[{p1, p2 , p3 }],
Red, PointSizeMedium, Point @ RegionCentroidTriangle[{p1, p2 , p3 }],
Gray, TriangleMediansTriangle[{p1, p2 , p3 }], PointSizeMedium,
Point(#1 + #2 ) / 2 & @@@ Subsets[{p1, p2 , p3 }, {2}]
, opts
In[55]:= CentroidPlotTriangle[pts]
CentroidPlot::collinpts :
The points {{0, 0}, {1, 1}, {2, 2}} are collinear, giving a degenerate triangle.
8.1 The graphics language: exercises 269
Out[56]=
In[57]:=
11. Start with the circumcenter which is the center of the circumscribing circle. It is located at the
intersection of the perpendicular bisectors of the sides. To find the line from the center,
perpendicular to a side, use RegionNearest and InfiniteLine. First, get the center.
In[58]:= {p1, p2, p3} = {{-1, 0}, {0, 2}, {1, 0}};
center = First @ Circumsphere[{p1, p2, p3}]
3
Out[59]= 0,
4
Here are the lines through each pair of vertices:
In[60]:= lines = InfiniteLine /@ Subsets[{p1, p2, p3}, {2}]
Out[60]= InfiniteLine[{{-1, 0}, {0, 2}}],
InfiniteLine[{{-1, 0}, {1, 0}}], InfiniteLine[{{0, 2}, {1, 0}}]
And this gives the point on each line closest to the center.
In[61]:= pbs = MapRegionNearest[# , center] &, lines
1 1
Out[61]= - , 1, {0, 0}, , 1
2 2
Finally, we want a line from each of these points to the center.
In[62]:= perpLines = MapLine[{center, # }] &, MapRegionNearest[# , center] &, lines
3 1 3 3 1
Out[62]= Line0, , - , 1, Line0, , {0, 0}, Line0, , , 1
4 2 4 4 2
270 Essentials of Programming in Mathematica
In[63]:= Graphics
Blue, PointSizeMedium, Point[{p1, p2, p3}],
EdgeForm[Gray], LightBlue, Triangle[{p1, p2, p3}],
Blue, Circumsphere[{p1, p2, p3}],
Blue, PointSize[Large], Point @ center,
Purple, perpLines, PointSize[Large], Point @ pbs
Out[63]=
Next, compute the orthocenter. Using InfiniteLine will make it so that we can draw on the
computational geometry machinery to do our computations.
In[64]:= {p1, p2, p3} = {{-1, 0}, {0, 2}, {1, 0}};
The altitude is the line drawn from a vertex to the opposite side, perpendicular to that side.
Note that we need to reverse the list {p1, p2, p3} so that the proper line is paired with the
proper point.
In[66]:= altPts = MapThreadRegionNearest[#1, #2 ] &, lines, Reverse[{p1, p2, p3}]
3 4 3 4
Out[66]= - , , {0, 0}, ,
5 5 5 5
We need lines from each vertex to the corresponding point in altPts.
In[67]:= altLines = MapThreadLine[{#1, #2 }] &, Reverse @ {p1, p2, p3}, altPts
3 4 3 4
Out[67]= Line{1, 0}, - , , Line[{{0, 2}, {0, 0}}], Line{-1, 0}, ,
5 5 5 5
Here then is the graphic showing the triangle in gray, its vertices in blue, and the altitude lines
and points in purple.
8.1 The graphics language: exercises 271
In[68]:= Graphics
Blue, PointSizeMedium, Point[{p1, p2, p3}],
EdgeForm[Gray], LightBlue, Triangle[{p1, p2, p3}],
Purple, PointSize[Large], Point @ altPts, altLines
Out[68]=
Finally, the incenter, the center of which is the largest circle that fits entirely inside the triangle.
For the formula for the incenter, we will need a function to compute the perimeter of the
triangle. This one comes essentially from Section 4.3.
In[69]:= PerimeterTriangle[pts : {p1_, p2_, p3_}] :=
RegionMeasureLine[pts /. {p_, pn__} ⧴ {p1, pn , p1}]
In[72]:= {p1, p2, p3} = {{-1, 0}, {0, 2}, {1, 0}};
pts = {p1, p2, p3};
Graphics
EdgeForm[Gray], LightBlue, Triangle[pts],
PointSize[Large], Point[pts],
Red, CircleinCenter @ pts, inRadius[pts], PointSize[Large],
PointinCenter @ pts,
MapLineinCenter @ pts, # &, pts
, Axes → True
2.0
1.5
1.0
Out[74]=
0.5
12. First set the distribution and compute the mean and standard deviation.
In[75]:= = NormalDistribution[0, 1];
σ = StandardDeviation[];
μ = Mean[];
Next we manually construct four vertical lines at the standard deviations going from the
horizontal axis to the pdf curve.
8.1 The graphics language: exercises 273
0.3
Out[78]= 0.2
0.1
-2σ -σ μ σ 2σ
And here is a little utility function to make the code a bit more readable and easier to use.
In[79]:= sdLine[_, μ_, σ_] :=
Line[{{{μ + σ , 0}, {σ + μ, PDF[ , μ + σ ]}},
{{μ - σ , 0}, {-σ + μ, PDF[ , μ - σ ]}}}]
In[80]:= PlotPDF[, x], {x, -4, 4},
Filling → Axis,
Epilog → Gray, Thickness[.0035], sdLine[, μ, σ], sdLine[, μ, 2 σ],
AxesOrigin → {-4, 0},
Ticks → -2 σ, "-2σ", -σ, "-σ", μ, "μ", σ, "σ", 2 σ, "2σ",
Automatic,
AspectRatio → 0.4,
PlotLabel → StringForm"Normal distribution: μ=`1`, σ=`2` ", μ, σ
Normal distribution: μ=0, σ=1
0.4
0.3
Out[80]= 0.2
0.1
-2σ -σ μ σ 2σ
274 Essentials of Programming in Mathematica
f= a2 - b2 ;
Graphics
Circle{0, 0}, a, b,
Pointf, 0, Point-f, 0
, Axes → Automatic
3
Out[1]=
-4 -2 2 4
-1
-2
-3
Turn this into a dynamic graphic by making the semi-major and semi-minor axes lengths a
and b dynamic which, upon updating, will cause the ellipse to change shape. Some thought
will be needed to properly deal with the situation b > a.
4. Create a dynamic interface that displays various structure diagrams and space-filling plots of
the amino acids. A list of the amino acids is given by
In[2]:= ChemicalData"AminoAcids"
Out[2]= ������� , ��������� , �������� , ��������� , �������� , ����������� , ���������� , ������������ ,
The diagrams and plots that should be included are built into ChemicalData:
8.2 Dynamic graphics: exercises 275
1.0
1.0
0.5 0.5
-0.5 -0.5
-1.0
-1.0
8. Take one of the two-dimensional random walk programs developed elsewhere in this book
(Sections 6.3 and 10.3) and create an animation displaying successive steps of the random walk.
9. Looking forward to Chapter 10, where we develop a full application for computing and visualiz-
ing random walks, create a dynamic interface that displays random walks, adding controls to
select the number of steps from a pulldown menu, the dimension from a setter bar, and a
checkbox to turn on and off lattice walks.
10. Create a visualization of two-dimensional vector addition (Figure 8.4). The interface should
include either a 2d slider for two vectors in the plane or locators to change the position of each
vector; the display should show the two vectors as well as their vector sum. Extend the solution
to three dimensions. (The solution of this vector interface is due to Harry Calkins of Wolfram
Research.)
276 Essentials of Programming in Mathematica
red vector 4
-6 -4 -2 2 4 6
-2
blue vector -4
-6
11. Create a dynamic interface consisting of a locator constrained to the unit circle. Check the
documentation on Locator for information on constraining the movement of locators.
12. Create a dynamic interface that displays twenty random points in the unit square whose
locations are randomized each time you click your mouse on the graphic. Add a checkbox to
toggle the display of the shortest path (FindShortestTour) through the points (look up
EventHandler and MouseClicked in the documentation).
A suggested addition would be to add a control to change the number of points that are used
but take care to keep the total number of points manageable (see the note on Traveling
Salesman problems at the end of the chapter).
8.2 Solutions
1. Giving the parameter list in the form {�����, {���1 , ���2 , ���3 }} automatically causes
Manipulate to use a setter bar as the control type.
In[1]:= Manipulate
Plotf[x], {x, 0, 2 π},
f, Sin, Cos, Tan
1.0
Out[1]=
0.5
1 2 3 4 5 6
-0.5
-1.0
In[2]:= Manipulate
Plotf[x], {x, 0, 2 π},
f, Sin, Cos, Tan, ControlType → PopupMenu
f Sin
1.0
Out[2]=
0.5
1 2 3 4 5 6
-0.5
-1.0
3. If the parameter b is greater than a, you will need to switch the foci to the vertical axis. This is
done inside the If statement before the graphics are given.
In[3]:= Manipulate
Out[3]=
278 Essentials of Programming in Mathematica
4. We will put this together in two parts: first create a function to display any amino acid using
one of the various diagrams; then pour it into a Manipulate. Note, this function is dependent
upon ChemicalData to create the displays. ChemicalData returns an Entity, hence the two
rules, one for the chemical name as a string and the other as an Entity. Alternatively, you could
modify it to use your own visualizations, such as the space-filling plots in Section 8.4.
In[4]:= AminoAcidPlotaa_String , diagram_: "ColorStructureDiagram" :=
LabeledFramedChemicalDataaa , diagram , ImageSize → All,
ChemicalDataaa , "Name", LabelStyle → Directive"Menu", 9
In[6]:= AminoAcidPlot"Glycine"
H
Out[6]= O
N
H H
�������
H
Out[7]= O
N
H H
�������
8.2 Dynamic graphics: exercises 279
In[8]:= Manipulate
AminoAcidPlotaminoacid, diagram,
aminoacid, "LAlanine", "Amino acid", aa,
diagram, "StructureDiagram", "CHColorStructureDiagram",
"CHStructureDiagram", "ColorStructureDiagram", "MoleculePlot",
"SpaceFillingMoleculePlot",
Initialization ⧴ aa = ChemicalData"AminoAcids", SynchronousUpdating → False,
SaveDefinitions → True
diagram ColorStructureDiagram
Out[8]=
O
O
H H
O
O N
H H
�-�������� ����
5. Borrowing the CentroidPlot from Exercise 10 from Section 8.1, here is the Manipulate.
In[9]:= ManipulateCentroidPlotTriangle[pts], PlotRange → {-0.2, 2.2},
{{pts, {{-1, 0}, {0, 2}, {1, 0}}}, Locator}, SaveDefinitions → True
Out[9]=
280 Essentials of Programming in Mathematica
6. Modify the radii and the centers to get different effects. Try using transparent disks instead of
circles.
In[10]:= Manipulate
Graphics
TableCircler / 4 Cos[t], Sin[t], 1.1 - r, {r, .2, 1, .05},
PlotRange → 1,
{t, 0, 2 π, .1}
Out[10]=
7. Putting the two graphics pieces (Graphics[…] and Plot[…]) in a grid gives you finer control
over their placement and formatting.
In[11]:= Manipulate
Grid
GraphicsCircle[], Blue, PointSize[.04], PointCos[θ], Sin[θ],
Axes → True, PlotSin[x], {x, 0, 2 π},
Epilog → Blue, Line{θ, 0}, θ, Sin[θ], PointSize[.025],
Pointθ, Sin[θ], Frame → All, {θ, 0, 2 π}
1.0
1.0
0.5
Out[11]= 0.5
-0.5
-0.5
-1.0
-1.0
8. First load the package that contains the random walk code. You could use you own implementa-
tion as well.
In[12]:= << EPM`RandomWalks`
8.2 Dynamic graphics: exercises 281
Out[14]=
The output above suffers from the fact that the display jumps around a lot as Mathematica tries
to figure out a sensible plot range for each frame. Instead, we should fix the plot range for all
frames to avoid this jumpiness. This is done in the definitions for xran and yran in the
Initialization below.
In[15]:= Manipulate
GraphicsLineTake[rw, n], PlotRange → {xran, yran},
n, 2, Length[rw], 1,
Initialization ⧴
rw = RandomWalk1000, Dimension → 2, LatticeWalk → True;
{xran, yran} = MapMin[#1], Max[#1] &, Transpose[rw],
SaveDefinitions → True
Out[15]=
282 Essentials of Programming in Mathematica
9. Using the programs developed in Section 10.3, here is the code, including a pulldown menu for
the steps parameter, a setter bar for the dimension parameter, and a checkbox for the lattice
parameter.
In[16]:= Manipulate
ShowWalk @ RandomWalksteps, Dimension → dim, LatticeWalk → latticeQ,
{steps, {100, 250, 500, 750, 1000, 10 000}},
dim, 1, "Dimension", {1, 2, 3},
latticeQ, True, "Lattice walk", True, False,
Initialization ⧴ Needs"EPM`RandomWalks`", SaveDefinitions → True
steps 750
Dimension 1 2 3
Lattice walk
Out[16]=
10. Here is the solution using Slider2D. Using Locator instead is left for the reader.
8.2 Dynamic graphics: exercises 283
In[17]:= Manipulate
Graphics
Red, Arrow[{{0, 0}, pt1}],
Blue, Arrow[{{0, 0}, pt2}],
Green, Arrow[{{0, 0}, pt1 + pt2}],
Dashed, Orange, Line[{pt1, pt1 + pt2, pt2}],
PlotRange → 6, Axes → True, GridLines → Automatic,
pt1, {1, 4}, "Red vector", {-5, -5}, {5, 5},
pt2, {3, 1}, "Blue vector", {-5, -5}, {5, 5},
ControlPlacement → Left
6
Red vector
4
2
Out[17]=
-6 -4 -2 2 4 6
-2
-4
Blue vector
-6
11. The key here is to use a two-argument form of Dynamic, where the second argument gives the
constraint on the parameter.
In[18]:= DynamicModule{pt = {0, .5}},
Graphics
LightBlue, Rectangle[{-1, -1}, {1, 1}],
Pink, Circle[], Thick, Circle[{0, 0}, .5],
LocatorDynamicpt, pt = .5 Normalize[# ] &
, PlotRange → 1.25
Out[18]=
12. First, create a static version of the problem; we use GraphicsComplex to display the points
and the tour.
In[19]:= pts = RandomReal[1, {25, 2}];
284 Essentials of Programming in Mathematica
0.8
0.6
Out[20]=
0.4
0.8
0.6
Out[22]=
0.4
Here is the dynamic interface using EventHandler to choose a new set of random points with
each mouse click.
8.3 Efficient structures: exercises 285
In[23]:= Manipulate
DynamicModulepts = RandomReal[1, {20, 2}], tour,
tour = DynamicLastFindShortestTour[pts];
EventHandler
Dynamic
GraphicsGraphicsComplexpts,
IfNotshowtour, Point @ RangeLength[pts],
Line[tour], Red, PointSizeMedium, Point[tour],
Axes → Automatic,
"MouseClicked" ⧴ pts = RandomReal[1, {20, 2}]
,
showtour, False, "Show tour", True, False,
ContentSize → All
Show tour
1.0
0.8
Out[23]=
0.6
0.4
2. Take the example visualizing a 500 000-step random walk at the beginning of this section and
replicate the output using GraphicsComplex instead of ListLinePlot. Compare the running
times for each as the number of steps increases.
3. The ShowWalk function discussed in Section 4.1 for displaying random walks uses
ListLinePlot to display the data. As mentioned in this section, ListLinePlot will get bogged
down for large numbers of points. Using the solution to the previous exercise, create a new
version for both the two- and three-dimensional cases of ShowWalk that uses
GraphicsComplex instead; then test the new implementation against the one developed in
Chapter 4.
4. Create a graphic consisting of a three-dimensional lattice, that is, lines passing through the
integer coordinates in 3-space (Figure 8.6). Compare approaches that use multi-lines as
opposed to those that do not.
Out[2]=
The zero-dimensional objects in the mesh are points and the one-dimensional objects are lines
(two-dimensional objects would be polygons). These are the points and lines on the convex
hull.
8.3 Efficient structures: exercises 287
0.8
0.6
Out[7]= 0.4
0.2
6. Modify ConvexHullPlot from Exercise 5 to accept an option Dimension. With default value of
two, ConvexHullPlot should produce output like that in Exercise 5. For Dimension → 3, it
should generate the convex hull together with large red points at each vertex of the hull
(Figure 8.7).
7. Extend Exercise 7 from Section 8.1 to random walks on the base-n digits of π. For example, in
base 3, a 1 corresponds to an angle of 120° from the current position, 2 corresponds to 240°, and
0 to 360°. In base 4 the step angles will be multiples of 90° and in general, for base n, the step
angles will be multiples of 360 °/n. Use GraphicsComplex to visualize the walks. Include a
color function that depends on the length of the walk.
8.3 Solutions
1. Here is the implementation using TranslationTransform.
In[1]:= Clearvertices, n, α
288 Essentials of Programming in Mathematica
2πα 2πα
In[2]:= vertices[n_] := TableCos , Sin , {α, 0, n }
n n
In[3]:= hexagon = Polygonvertices[6];
GraphicsEdgeForm[Gray], LightGray, hexagon
Out[3]=
In[4]:= Graphics
EdgeForm[Gray], LightGray,
TableGeometricTransformationhexagon,
3 3 j
TranslationTransform3 i + (-1)j + 1,
4 2
, i, 5, j, 8
Out[4]=
Out[5]=
Now use multi-polygons. The following version of hexagon is defined so that it can take a pair
of translation coordinates. Note also the need to flatten the table of vertices so that Polygon can
be applied to the correct list structure.
In[7]:= Clearhexagon;
2πi 2πi
hexagon[{x_, y_}] := TableCos + x , Sin + y , i, 1, 6
6 6
In[9]:= gr2 =
GraphicsEdgeForm[Gray], LightGray,
3 3 j
PolygonFlattenTablehexagon3 i + (-1)j + 1, , i, 5, j, 8,
4 2
1
Out[9]=
The first argument to GraphicsComplex is a list of coordinate points, such as the output from
RandomWalk. The second argument is a set of graphics primitives indexed by the positions of
the points in the list of coordinates. The walk itself gives the coordinates that will be used as the
first argument to GraphicsComplex.
In[12]:= walk = RandomWalk5 × 105 ;
In[13]:= Shortwalk, 2
Out[13]//Short= {{0, 1}, {0, 2}, {0, 3}, {0, 2}, 499 992,
{-447, 892}, {-446, 892}, {-445, 892}, {-445, 891}}
The second argument a list of primitives with the coordinate indices as arguments. We want to
connect the first point to the second, to the third, etc., with a line. That would look like
Line[{1, 2, 3, …}]. The length of the list is given by Length[walk].
290 Essentials of Programming in Mathematica
In[14]:= GraphicsGraphicsComplexwalk,
Line @ RangeLengthwalk
Out[14]=
You could add axes and some directives and options to modify the plot.
In[15]:= GraphicsGraphicsComplexwalk,
RGBColor[.6, .4, .5], ThicknessTiny, Line @ RangeLengthwalk
, Axes → Automatic // Timing
800
600
200
The time to compute (and display) this object is several orders of magnitude faster than that
with ListLinePlot. So why is ListLinePlot so slow with data of this size? It is designed to be
as general as possible and to deal with many extraordinary situations. This generality comes at
a cost. It is very fast for moderately sized data sets, but for large sets, another approach is
preferable.
3. First, using the same argument structure as that in ShowWalk (Chapter 10), we give
GraphicsComplex the list of coordinates followed by Line wrapped around a list of the point
indices 1 through n (the length of the walk).
In[16]:= ShowWalkGCcoords : {{_, _} ..} := Graphics
GraphicsComplexcoords , LineRangeLengthcoords
8.3 Efficient structures: exercises 291
Out[17]=
50
40
30
Out[19]=
20
10
10 20 30
Out[21]=
Finally, some timing comparisons between this implementation with GraphicsComplex and
292 Essentials of Programming in Mathematica
the versions that used basic graphics primitives and built-in functions.
In[22]:= walk = RandomWalk[250 000];
TimingShowWalkwalk, AspectRatio → Automatic
-100
-200
Out[23]= 4.28677,
-300
-400
-500
In[24]:= TimingShowWalkGCwalk
-100
-200
Out[24]= 0.017871,
-300
-400
-500
4. One approach to creating the lattice is to manually specify the coordinates for the lines and
then map the Line primitive across these coordinates. We will work with a small lattice.
In[25]:= xmin = 0; xmax = 3;
ymin = 0; ymax = 3;
zmin = 0; zmax = 3;
Tablex, ymin, zmin, x, ymax, zmin, x, xmin, xmax
Out[28]= {{{0, 0, 0}, {0, 3, 0}}, {{1, 0, 0}, {1, 3, 0}},
{{2, 0, 0}, {2, 3, 0}}, {{3, 0, 0}, {3, 3, 0}}}
Out[32]=
Out[34]=
In[37]:= ℛ = ConvexHullMesh[pts]
Out[37]=
Quite a bit of information is embedded in the this BoundaryMeshRegion. For example, it is easy
to extract the points on the boundary. They are mesh primitives of dimension zero.
In[38]:= Head[ℛ]
Out[38]= BoundaryMeshRegion
In[39]:= MeshPrimitives[ℛ, 0]
Out[39]= {Point[{0.643154, 0.220953}],
Point[{0.357669, 0.997291}], Point[{0.0543152, 0.400786}],
Point[{0.120583, 0.881017}], Point[{0.892886, 0.146246}]}
So the pieces of the mesh that we want to show are the region itself (bounded polygon, the
original points, and the points on the boundary. We will highlight the points on the boundary
by making them large and red. And we will pass options from Graphics on to the function.
In[42]:= ConvexHullPlotpts_, opts : OptionsPatternGraphics :=
Module{ℛ}, ℛ = ConvexHullMesh[pts ];
Showℛ, GraphicsPoint[pts ], Red, PointSizeMedium, MeshPrimitives[ℛ, 0],
opts
Try it out with a larger point set.
8.3 Efficient structures: exercises 295
50
Out[44]=
-50 50 100
-50
Out[49]=
Giving a bad value for the Dimension option should produce an error message.
In[50]:= ConvexHullPlotpts, Dimension → 4
ConvexHullPlot::baddim : The value 4 of the Dimension option should be either 2 or 3
7. Here is the random walk on the digits of π in bases given by the second argument.
In[51]:= RandomWalkPid_, base_ /; base > 2 := Moduledigits, angles, rules,
digits = FirstRealDigitsNπ, d , base ;
angles = Rest @ Range0., 2 π, 2 π base ;
rules = MapThread#1 → #2 &, Range0, base - 1, angles;
AccumulateMapCos[# ], Sin[# ] &, digits /. rules
Using ListPlot, here is a quick visualization on base 5 digits:
In[52]:= ListLinePlotRandomWalkPi[10 000, 5], AspectRatio → Automatic
120
100
80
60
Out[52]=
40
20
-100 -50
-20
Out[55]=
And here it is with color mapped to the distance from the origin.
In[56]:= GraphicsGraphicsComplexwalk,
# 〚1〛
MapHue , AbsoluteThickness[.25], Line[# ] &,
len
PartitionRange2, len, 2, 1, AspectRatio → Automatic
Out[56]=
5. Create a new rule for VennDiagram that takes a logical expression as its first argument instead
of a logical function. For example, your function should be able to handle input such as the
following:
A B
Out[1]=
AB
6. Extend the previous exercise to a Venn diagram on three sets, using logical expressions as the
first argument.
A B
Out[2]=
(A B C) ¬ (A B C)
7. Modify the dynamic Venn diagram created in this section to also display a truth table like that
in Figure 8.8. Include the truth table side-by-side with the Venn diagram. TruthTable was
developed in Exercise 3 in Section 6.3.
8.4 Examples: exercises 299
AB
A B
� � ��
� � �
� � �
� � �
� � �
8. The DotPlot function developed in this section uses a fixed window size, meaning that it only
colors a dot black if a string of length one matches a string of length one in the two sequences
under comparison. Add a WindowSize option to DotPlot that allows you to set the length of
the sequences to match – you will likely need stringPartition developed in Section 7.5.
Finally, set up DotPlot to inherit the options from ArrayPlot.
Out[3]=
DQ232610.1
9. When making dot plots like in the previous exercise, if you knew you were always working
with FASTA files, you could automate both the extraction of the frame labels from the FASTA
accession ids and their insertion in the FrameLabel option of ArrayPlot.
DQ023146 .1
Out[8]=
DQ232610.1
10. Modify the Manipulate expression animating the hypocycloid so that the plot range deals with
the case where the radius of the inner circle is larger than the radius of the outer circle.
11. An epicycloid is a curve generated by tracing out a fixed point on a circle rolling around the
outside of a second circle. The parametric formula for an epicycloid is similar to that for the
hypocycloid:
a+b
x = a + b cos(θ) - b cos b
θ,
a+b
y = a + b sin(θ) - b sin b θ.
Create a dynamic animation of the epicycloid similar to that for the hypocycloid in this
section.
12. Modify PathPlot so that it inherits options from Graphics as well as having its own option,
PathClosed, that can take on values of True or False and closes the path accordingly by
appending the first point to the end of the list of coordinate points.
13. Modify SimplePath so that the point with the smallest x-coordinate of the list of data is chosen
as the base point; repeat but with the largest y-coordinate; then try ordering the points about
the polar angle each makes with the centroid of the set of points.
14. There are conditions under which the program SimplePath will occasionally fail (think
collinear points). Experiment by repeatedly computing SimplePath for a set of ten integer-
valued points until you see the failure. Determine the conditions that must be imposed for the
program to work consistently.
15. Modify the ChemicalSpaceFillingPlot function to add legends that give identifying informa-
tion for each atomic element in the plot (Figure 8.9). Consider using Legended and
SwatchLegend.
8.4 Examples: exercises 301
������
��������
������
��������
16. Create a dynamic interface similar to the triangle circumcenter example in this section but
instead compute the orthocenter, which is located at the intersection of the three altitudes of the
triangle (Figure 8.10). The altitude of a triangle is a line through a vertex perpendicular to the
opposite side.
17. Leonhard Euler in 1765 showed that for any triangle, the centroid, circumcenter, and orthocen-
ter are collinear. In fact, the line that passes through these triangle centers also passes through
several other notable points such as the incenter, the nine-point center, the de Longchamps
point, and others. And, remarkably, when you change the shape of the triangle, the relative
distances between the centers is unchanged.
Construct an interface to display a triangle with dynamic vertices together with the triangle’s
centroid, circumcenter, orthocenter, and the Euler line. Give distinct colors to each of the four
sets: incenter and angle bisectors, medians and centroid, perpendicular bisectors and circum-
center and circumcircle, altitudes and orthocenter. Add a legend that identifies the objects by
color.
18. One way to get a sense of the extent of data, such as a two-dimensional random walk, is to
superimpose the eigenvectors of a certain tensor over a line plot of the walk. This tensor, called
the radius of gyration tensor , is discussed in Section 6.3. For a given walk, the eigenvectors of
point in the direction of the greatest and smallest spans of the walk, while the eigenvalues of
give a measure of how elongated the walk is in the directions pointed by the corresponding
eigenvectors.
Create a function EigenvectorPlot[����, , ����] that takes a two-dimensional list walk,
the radius of gyration tensor of that walk, and generates a visualization of the walk using
302 Essentials of Programming in Mathematica
8.4 Solutions
1. The function ComplexListPlot plots a list of numbers in the complex plane – the real part is
identified with the horizontal axis and the imaginary part is identified with the vertical axis.
Start by setting the options for ComplexListPlot to inherit those for ListPlot.
In[1]:= OptionsComplexListPlot = OptionsListPlot;
���
��
Out[3]= -��� -��� ��� ��� ��� ���
-���
-���
-���
-���
2. The function ComplexRootPlot takes a polynomial, solves for its roots, and then uses
ComplexListPlot from the previous exercise to plot these roots in the complex plane.
In[4]:= ComplexRootPlotpoly_, z_, opts : OptionsPattern[] :=
ComplexListPlotz /. NSolvepoly == 0, z , opts , AspectRatio → Automatic
���
Out[5]=
��
-��� -��� ���
-���
-���
3. Use PlotStyle to highlight the two different surfaces and MeshStyle and Mesh to highlight
their intersection.
8.4 Examples: exercises 303
In[6]:= Clearf, x, y, g
Out[9]=
4. We can display both the circle regions as wells as the logical regions using RegionPlot. Three
changes are needed to the function definition given in the text: the first argument to
RegionPlot should now be a list with the regions (the two circles) added; a PlotStyle options
should be given that specifies the circle interiors in white and the region colored blue; the text
identifying the sets/circles needs to be added using the Epilog option. Also note that we have
added the MaxRecursion option to RegionPlot to increase the resolution a bit to avoid some
jaggedness at the intersection of the two circles (try reducing it to see the problem otherwise).
In[10]:= ClearVennDiagram
A B
Out[12]=
304 Essentials of Programming in Mathematica
5. The key to turning the logical expression into a function that can be applied to the regions for
RegionPlot is to create a pure function. Here is a prototype expression and set of variables.
In[13]:= expr = a b && ¬ a b;
vars = a, b;
This substitutes the threaded rules into the expression where a is replaced with #1, and b is
replaced with #2.
expr /. Thread[vars → {#1, #2 }] &
Here then is the function.
In[15]:= ClearVennDiagram
a b
Out[17]=
(a b) ¬ (a b)
6. To start, here are the centers and the regions for three circles (sets).
In[18]:= {c1, c2, c3} = {-1 / 2, 0}, {1 / 2, 0}, 0, 3 2;
2 2
regions = (x - #1) + (y - #2 ) < 1 & @@@ {c1, c2, c3}
2
1 2 1 2 3
Out[18]= +x + y2 < 1, - +x + y2 < 1, x2 + - +y < 1
2 2 2
8.4 Examples: exercises 305
A B
Out[19]=
We repeat what was done in the previous exercise but instead use an expression in three
variables.
In[20]:= expr = a b c && ¬ a b c;
vars = a, b, c;
This substitutes the threaded rules into the expression where a is replaced with #1, b is replaced
with #2, and so on.
expr /. Thread[vars → {#1, #2 , #3 }] &
Here then is the function. It has the same name as above but will only be called if the variable
list is of length three.
In[22]:= VennDiagramexpr_, vars : {__} /; Length[vars ] ⩵ 3 :=
Modulec1, c2, c3, regions, x, y, f,
{c1, c2, c3} = {-1 / 2, 0}, {1 / 2, 0}, 0, 3 2;
2 2
regions = (x - #1) + (y - #2 ) < 1 & @@@ {c1, c2, c3};
f = expr /. Thread[vars → {#1, #2 , #3 }] &;
RegionPlotregions, f @@ regions, {x, -2, 2}, {y, -3 / 2, 5 / 2},
AspectRatio → Automatic, FrameTicks → None,
FrameLabel → TraditionalForm[expr ],
PlotStyle → White, White, White, LightBlue, BoundaryStyle → GrayLevel[.65],
Epilog → {Text[vars [[1]], {-1 / 2, -.75}], Text[vars [[2]], {1 / 2, -.75}],
Text[vars [[3]], {0, 1.6}]}
306 Essentials of Programming in Mathematica
Out[23]=
a b
(a b c) ¬ (a b c)
7. We will use the code for the TruthTable function from Exercise 3 in Section 6.3 together with
the VennDiagram function from this section, using Row.
In[24]:= ManipulateRow
TruthTablef[A, B], {A, B},
VennDiagramA B, {A, B}
, f, Xor, "Logical function", And, Or, Xor, Implies, Nand, Nor,
SaveDefinitions → True
Out[24]= � � �� A B
� � �
� � �
� � �
� � �
AB
First set up DotPlot to inherit options from ArrayPlot and to have one new option,
WindowSize with a default value of one.
In[29]:= OptionsDotPlot = JoinWindowSize → 1, OptionsArrayPlot;
The rest of the code is similar to what was developed in the chapter but instead of passing the
two sequences whole to ArrayPlot, we pass the two partitioned sequences. We have also set
the option Frame to True, which can be overridden by setting that option explicitly when you
use DotPlot.
In[30]:= DotPlotp1_, p2_, opts : OptionsPattern[] :=
Modulew = OptionValueWindowSize,
ArrayPlotOuterBoole[#1 == #2 ] &, stringPartition[p1, w, 1, 1, {}],
stringPartition[p2 , w, 1, 1, {}],
FilterRules{opts }, Options @ ArrayPlot, Frame → True
The noise in the earlier plots when we were comparing every nucleotide with every other
across the two sequences is clearly cleaned up.
In[31]:= DotPlotseq2, seq1, WindowSize → 4, FrameLabel → "DQ023146", "DQ232610",
ColorRules → 1 → Black, 0 → LightYellow, ImageSize → Small
DQ023146
Out[31]=
DQ232610
9. We just need to add a few lines grabbing the sequences and the accession numbers.
308 Essentials of Programming in Mathematica
Out[33]=
DQ232610.1
10. The problem with the two radii is really only one of getting the plot range correct for the two
situations. This can be done most simply with an If statement as the value of the PlotRange
option.
In[34]:= Hypocycloida_, b_, θ_ :=
a -b a -b
a - b Cos[θ ] + b Cosθ , a - b Sin[θ ] - b Sinθ
b b
In[35]:= HypocycloidPlot[R_, r_, θ_] := Module{center},
centerth_, R1_, r2_ := (R1 - r2 ) Costh , Sinth ;
Show
ParametricPlotHypocycloid[{R , r }, t], {t, 0, θ }, PlotStyle → Red,
Axes → None,
Out[36]=
11. Just a few modifications to the code for the hypocycloid are needed: use the formula for the
epicycloid; change the center of the rotating circle so that its radius is R + r, not R - r; and
modify the plot range.
In[37]:= EpicycloidPlot[R_, r_, θ_] := Moduleepicycloid, center,
epicycloida_, b_, t_ :=
a +b a +b
a + b Cos[t ] - b Cost , a + b Sin[t ] + b Sint ;
b b
centerth_, R1_, r2_ := (R1 + r2 ) Costh , Sinth ;
Show
ParametricPlotepicycloid[{R , r }, t], {t, 0, θ }, PlotStyle → Red,
Axes → None, ImageSize → Small,
Graphics
Blue, Thick, Circle[{0, 0}, R ],
Circle[center[θ , R , r ], r ],
PointSize[.015], Point[center[θ , R , r ]],
Thick, Linecenter[θ , R , r ], epicycloid[{R , r }, θ ],
Red, PointSize[.015], Pointepicycloid[{R , r }, θ ]
, PlotRange → 1.5 (R + r ), GridLines → Automatic
In[38]:= EpicycloidPlot[3, 1, 2 π]
Out[38]=
R 3 4 5 6 7 8
r 1 2 3 4 5
Out[39]=
In[42]:= SeedRandom[424];
coords = RandomReal[1, {10, 2}];
In[44]:= PathPlotcoords, ClosedPath → True, GridLines → Automatic
Out[44]=
13. A simple change to the program SimplePath chooses the base point with the largest y-
coordinate.
In[45]:= SimplePath3lis_ := Modulebase, angle, sorted,
base = LastSortBylis , Last;
anglea_, b_ := ArcTan @@ b - a ;
sorted = SortComplementlis , base, anglebase, #1 ≤ anglebase, #2 &;
Joinbase, sorted
In[47]:= PathPlotSimplePath3[pts]
Out[47]=
14. Choosing a base point randomly and then sorting according to the arc tangent could cause a
number of things to go wrong with the algorithm. The default branch cut for ArcTan gives
values between -π /2 and π/2 (think about why this could occasionally cause the algorithm in
the text to fail). By choosing the base point so that it lies at some extreme of the diameter of
the set of points, the polar angle algorithm given in the text will work consistently. If you
choose the base point so that it is lowest and left-most, then all the angles will be in the range
(0, π].
312 Essentials of Programming in Mathematica
In[50]:= PathPlotSimplePath1[pts]
Out[50]=
And here is a solution based on ordering the points according to the polar angle each makes
with the centroid of the set of points.
In[51]:= SimplePathCMlis_ := Modulecentroid, angle,
centroid = RegionCentroidPolygon @ lis ;
anglea_, b_ := ApplyArcTan, b - a ;
Sortlis , anglecentroid, #1 ≤ anglecentroid, #2 &
In[52]:= PathPlotSimplePathCM[pts]
Out[52]=
15. Using Legended and SwatchLegend, you can add identifying information for each atomic
element.
8.4 Examples: exercises 313
In[53]:= ChemicalSpaceFillingPlotfile_String :=
Moduleelements, pos, radii, names, colors, labels,
pos, elements =
First /@ Importfile , "VertexCoordinates", "VertexTypes";
labels = DeleteDuplicateselements;
names = ElementData# , "StandardName" & /@ labels;
colors = labels /. ColorData"Atoms", "ColorRules";
Legended
Graphics3DSpecularityWhite, 50,
MapThreadColorData"Atoms", #1, Sphere[#2 , #3 ] &,
elements, pos, radii
, Lighting → "Neutral",
SwatchLegendcolors, names, LegendMarkers → "SphereBubble",
LabelStyle → DirectiveFontSize → 7.5
In[54]:= ChemicalSpaceFillingPlot"5hydroxytryptamine.sdf"
������
��������
Out[54]=
������
��������
16. First, here is a static image of the triangle with orthocenter and altitudes.
314 Essentials of Programming in Mathematica
In[55]:= {p1, p2, p3} = {{-1, 0}, {1, 2}, {2, 0}};
lines = InfiniteLine /@ Subsets[{p1, p2, p3}, {2}];
altPts = MapThreadRegionNearest[#1, #2 ] &, lines, Reverse[{p1, p2, p3}];
altLines = MapThreadLine[{#1, #2 }] &, altPts, Reverse[{p1, p2, p3}];
iLines = ApplyInfiniteLine, altLines, {1};
center = {x, y} /. FirstSolve({x, y} ∈ #1 &) /@ iLines, {x, y};
GraphicsLightBlue, EdgeForm[Gray], Triangle[{p1, p2, p3}],
Blue, PointSizeMedium, Point[{p1, p2, p3}], PointaltPts,
PointSize[Large], Point[center], Gray, iLines, PlotLabel → "Orthocenter"
Orthocenter
Out[60]=
And here is the dynamic version. Note the orthocenter will be located outside the triangle if the
triangle is not acute.
In[61]:= DynamicModule{pts = 5 {{-1, 0}, {1, 2}, {2, 0}}},
LocatorPaneDynamicpts, Appearance → Tiny,
DynamicGraphicsEdgeForm[Gray], LightBlue, Triangle[pts],
Gray, InfiniteLine /@ Subsets[pts, {2}],
PointMapThreadRegionNearest[#1, #2 ] &,
InfiniteLine /@ Subsets[pts, {2}], Reverse[pts],
MapThreadInfiniteLine[{#1, #2 }] &,
MapThreadRegionNearest[#1, #2 ] &,
InfiniteLine /@ Subsets[pts, {2}], Reverse[pts],
Reverse[pts]
Out[61]=
The eigenvectors of the radius of gyration tensor, , point in the directions of greatest and
smallest spans of the walk. The eigenvalues give a measure of how elongated the walk is in
these directions. This can be seen by creating lines along each eigenvector of a length propor-
tional to the corresponding eigenvalues. In the computation below, the slope of the line is given
by the y-coordinate of the eigenvector divided by the corresponding x-coordinate.
In[66]:= {λ1, λ2} = Eigenvalues[]
Out[66]= {3073.63, 111.809}
v1y
In[69]:= ev1 = (x - cmx) + cmy // Expand
v1x
Out[69]= 3.05005 + 0.936665 x
v2y
In[70]:= ev2 = (x - cmx) + cmy // Expand
v2x
Out[70]= -71.0292 - 1.06762 x
Putting all these pieces together, we create the function EigenvectorPlot that returns a plot of
the original data set together with plots of the orthogonal lines and puts a large red point at
their intersection, the center of mass.
In[71]:= EigenvectorPlotdata : {{_, _} ..}, tensor_,
opts : OptionsPatternListLinePlot :=
Module{T = tensor , cmx, cmy, λ1, λ2, v1x, v1y, v2x, v2y},
{λ1, λ2} = Eigenvalues[T];
{cmx, cmy} = Meandata ;
{{v1x, v1y}, {v2x, v2y}} = Eigenvectors[T];
ShowListLinePlotdata , opts , PlotStyle → Thin,
v1y λ1 v1y λ1
GraphicsLinecmx - λ1, cmy - , cmx + λ1, cmy + ,
v1x v1x
v2y λ2 v2y λ2
Linecmx - λ2, cmy - , cmx + λ2, cmy +
,
v2x v2x
PointSize[Large], Red, PointMeandata , AspectRatio → Automatic
316 Essentials of Programming in Mathematica
In[73]:= SeedRandom[4];
walk = RandomWalk10 000, Dimension → 2, LatticeWalk → False;
= RadiusOfGyrationTensorwalk
Out[75]= {{1977.94, -67.2011}, {-67.2011, 761.669}}
In[76]:= EigenvectorPlotwalk,
80
60
40
Out[76]=
20
-20
9
Program optimization
3. Recall the Anagrams function in Section 7.2 that used Select to find words in the dictionary
consisting of a permutation of the letters of a given word. Here is another implementation,
converting the word to a list of characters, getting all permutations of that list of characters,
joining the characters in each sublist, and then checking against actual words in the dictionary.
In[2]:= TimingAnagrams1"alerts"
Out[2]= {16.3502, {alerts, alters, salter, staler}}
And here is an implementation that uses Alternatives instead of the conditional pattern
above:
In[4]:= TimingAnagrams2"alerts"
Out[4]= {0.940914, {alerts, alters, salter, staler}}
The following implementation from Chapter 7 uses regular expressions and Select but only
checks words in the dictionary of the same length as the test word:
In[6]:= TimingAnagrams3"alerts"
Out[6]= {0.052693, {alerts, alters, salter, staler}}
Determine what is causing the sharp differences in timing between these three implementa-
tions.
4. Several different implementations of the Hamming distance computation were given in
Section 5.6; some run much faster than others. For example, the version with bit operators runs
about one-and-a-half orders of magnitude faster than the version using Count and MapThread.
Determine what is causing these differences.
5. Consider the computation of the diameter of a set of points in d-dimensional space, d , as was
done in Exercise 11, Section 5.1.
In[13]:= PointsetDiameterpts_List :=
MaxApplyEuclideanDistance, Subsets[pts , {2}], {1}
This function suffers from the fact that computing subsets is computationally expensive.
Computing pairs of subsets typically is O(n2 ) and so the time to do this computation will grow
quadratically with the size of the point set. Beyond about 10 000 points, the time is substantial.
9.1 Solutions
1. First, we set things up so that AverageTiming has the HoldAll attribute. This way its argument,
the expression to be measured, does not evaluate before it is used inside the body of the
AverageTiming function itself.
In[1]:= SetAttributesAverageTiming, HoldAll
And for five trials, the average time is given by the following.
In[5]:= AverageTiming[Inverse[mat], 5]
Out[5]= 0.0421236
For a compound expression, you could either enclose the subexpressions in a list or separate
them with semicolons.
In[6]:= AverageTiming[{
mat.mat,
Inverse[mat],
Det[mat]
}, 5]
Out[6]= 0.0694276
9.1 Efficient programs: exercises 321
In[7]:= AverageTiming[
mat.mat;
Inverse[mat];
Det[mat];,
5]
Out[7]= 0.068383
Collect the results of the Table and pull out the parts needed – the timings and the result.
In[8]:= SetAttributesAverageTiming, HoldAll
In[13]:= TimingTriangularNumber107
Out[13]= {0.067392, 50 000 005 000 000}
A second approach uses iteration. As might be expected, this is the slowest of the approaches
here.
In[14]:= TriangularNumber2[n_] := Fold[#1 + #2 &, 0, Range[n ]]
In[15]:= TimingTriangularNumber2107
Out[15]= {1.40948, 50 000 005 000 000}
This is a situation where a little mathematical knowledge goes a long way. The nth triangular
n+1
numbers is just the following binomial coefficient: .
2
In[17]:= TimingTriangularNumber3107
Out[17]= {0.000015, 50 000 005 000 000}
3. Here are the three anagrams functions from the exercise.
In[18]:= Anagrams1word_String := Modulechars = Charactersword , words,
words = MapStringJoin, Permutationschars;
DictionaryLookupx__ /; MemberQwords, x
Anagrams2, by comparison is much faster as every word in the dictionary is not being com-
pared with the list words.
In[23]:= TimingDictionaryLookupAlternatives @@ words;
Out[23]= {1.11167, Null}
But Anagrams3 is the fastest. First, it is only checking words of the same length as the test word
“alerts”. That list is nine times smaller than the entire list of words in the dictionary. But the
biggest speed improvement comes from the fact that it is not using the pattern matcher so
intensively but instead is sorting lists of characters, which, for short lists, is quite fast.
In[24]:= TimingAnagrams3"alerts";
Out[24]= {0.048765, Null}
9.1 Efficient programs: exercises 323
In[26]:= LengthDictionaryLookup[]
Out[26]= 92 518
4. The first implementation essentially performs a transpose of the two lists, wrapping SameQ
around each corresponding pair of numbers. It then does a pattern match (Count) to determine
which expressions of the form SameQ[����1 , ����2 ] return False.
In[27]:= HammingDistance1lis1_, lis2_ :=
CountMapThreadSameQ, lis1, lis2 , False
The reason the threading is expensive can be seen by turning on the packing message as
discussed in this section.
In[33]:= On"Packing"
The other factors contributing to the significant timing differences have to do with the fact that
BitXor has the Listable attribute. MapThread does not. And so, BitXor can take advantage of
specialized (compiled) codes internally to speed up its computations.
In[35]:= AttributesBitXor
Out[35]= {Flat, Listable, OneIdentity, Orderless, Protected}
In[36]:= AttributesMapThread
Out[36]= {Protected}
And finally, compute the number of ones using Total which is extremely fast at adding lists of
numbers.
In[38]:= TimingTotal[temp];
Out[38]= {0.002223, Null}
Out[41]=
So, instead of taking the subsets of the entire set of points, only take subsets from this list of
mesh coordinates. Here then is the function from Exercise 11, Section 5.1, with this modification.
In[43]:= PointsetDiameterCH[pts_] := Module{ℛ},
ℛ = ConvexHullMesh[pts ];
Max @ ApplyEuclideanDistance, SubsetsMeshCoordinates[ℛ], {2}, {1}
For timing comparisons, let’s take a large point set.
In[44]:= pts = RandomReal[1, {2500, 3}];
9.1 Efficient programs: exercises 325
In[46]:= TimingPointsetDiameter[pts]
Out[46]= {3.41869, 1.62249}
PointsetDiameterCH is substantially faster than the approach above using all subsets.
In[47]:= TimingPointsetDiameterCH[pts]
Out[47]= {0.041134, 1.62249}
The one disadvantage to this approach is that the computation of the convex hull mesh is only
valid for dimensions one through three.
6. One way to analyze the difference in this problem is to check how long it takes each of these
predicates to pick out numbers from one to one million.
In[48]:= CountRange106 , p_ ? PalindromeQ // Timing
Out[48]= {0.37367, 0}
Clearly SquareNumberQ is slow relative to PalindromeQ for checking the same number of
integers, so making it only check 1998 numbers rather than one million is what helps.
7. The mystery here is not clear until you look turn on the packed array messaging as described in
the text.
In[50]:= On"Packing"
Apply at level one (@@@), unpacks packed arrays and this step causes the significant slowdown
in this computation.
Reset the system option.
In[55]:= Off"Packing";
326 Essentials of Programming in Mathematica
1.0
0.5
Out[3]=
50 100 150 200 250
-0.5
-1.0
Example smoothers to consider include moving averages with different numbers of terms and
weights, a convolution with a Gaussian kernel, a lowpass filter, and any others you might be
familiar with (wavelets, for example).
2. The search for perfect numbers programmed in Exercise 6 in Section 5.1 gets bogged down for
searches of more than one million numbers. Try to speed it up by considering the range of
numbers searched, the built-in functions used, and the possibility of doing the computation in
parallel.
3. In the eighteenth century, Leonhard Euler proved that all even perfect numbers must be of the
form 2p-1 (2p - 1) for 2p - 1 prime and p a prime number. (No one has yet proved that any odd
perfect numbers exist.) Use this fact to find all even perfect numbers for p < 104 .
4. A common task in many areas of computational linguistics is comparing certain features of a
text across a broad corpus. One such comparison is counting the occurrence of a certain word
across numerous texts. This is a good problem for parallel computation. Use the parallel tools
to import and count the occurrence of a word, say history, across four different texts. Guten-
berg.org is a good source for importing entire texts, but any available source could be used.
5. Monte Carlo simulations are computations that use random sampling to approximate a
numerical result. One of the classical examples is the approximation to π. The idea is to
generate a large number of random numbers in a square and compute the proportion that lie
within the inscribed circle (Figure 9.2). The approximation to π is four times this proportion.
This method converges quite slowly, so a large number of points and averaging many trials is
needed to get better approximations.
9.2 Parallel processing: exercises 327
0.5
-0.5
-1.0
Use RandomReal to create points in a square, then count points inside the inscribed disk using
two different implementations – one with a Do loop and another using the computational
geometry machinery (RegionMember in particular). Compare the efficiency of these two
implementations.
6. The following code can be used to create a plot of the Mandelbrot set. It uses Table to compute
the value for each point in the complex plane on a small grid. We have deliberately chosen a
relatively coarse grid (n = 100) as this is an intensive and time-consuming computation. The
last argument to NestWhileList, 250 here, sets a limit on the number of iterations that can be
performed for each input. Increase the resolution of the graphic by running the computation
of the table of points in parallel.
Out[6]=
9.2 Solutions
1. Here is a noisy signal to work with.
In[1]:= signal = TableSin[t] + RandomReal[{-.25, .25}], t, 0, 4 Pi, 0.025;
Here is an eight-term moving average.
328 Essentials of Programming in Mathematica
1.0
0.5
Out[3]=
100 200 300 400 500
-0.5
-1.0
In[8]:= ParallelTable
ListLinePlotsignal, comp,
ImageSize → Tiny,
PlotStyle → Automatic, Red, Thickness[.005],
comp,
MovingAveragesignal, {1, -2, 6, 8, 6, 2, 1} / 8,
MovingAveragesignal, {1, 1, 2, 1, 1} / 6,
LowpassFiltersignal, .5, 31,
k2
Exp- n2 n n
kerneln_ ? OddQ := Table , k, -Floor , Floor ;
2π 2 2
ListConvolvekernel[17] 6, signal
1.0 1.0
0.5 0.5
Out[8]= , ,
100 200 300 400 500 100 200 300 400 500
-0.5 -0.5
-1.0 -1.0
1.0 1.0
0.5 0.5
,
100 200 300 400 500 100 200 300 400 500
-0.5 -0.5
-1.0 -1.0
We can give a speed boost by using DivisorSigma[1, �] which gives the sum of the divisors
of k.
In[11]:= PerfectSearch2[n_] := ModuleperfectQ,
perfectQk_ := DivisorSigma1, k ⩵ 2 k ;
SelectRange[n ], perfectQ
Reduce the number of sheer computations by using the, as yet, unproven conjecture that there
330 Essentials of Programming in Mathematica
are no odd perfect numbers (confirmed for n < 10300 ). Also use a pure function for the predicate
test.
In[13]:= PerfectSearch3[n_] := SelectRange[2, n , 2], DivisorSigma[1, # ] ⩵ 2 # &
In[15]:= PerfectSearchParallel[n_] :=
ParallelizeSelectRange[2, n , 2], DivisorSigma[1, # ] ⩵ 2 # &
So for each of the above values of the list primes, 2p-1 (2p - 1) will be even perfect numbers
(thanks to Euler).
In[18]:= perfectLis = Map2#-1 2# - 1 &, primes;
And finally, a check.
In[19]:= perfectQj_ := TotalDivisorsj ⩵ 2 j ;
In[22]:= CloseKernels[]
Out[22]= KernelObject[1, local, <defunct>], KernelObject[2, local, <defunct>],
KernelObject[3, local, <defunct>], KernelObject[4, local, <defunct>]
4. Start by importing four texts, James Joyce’s Ulysses, Hermann Hesse’s Siddhartha, Emily Brontë’s
Wuthering Heights, and Virginia Woolf’s Jacob’s Room:
In[23]:= joyce = Import"http://www.gutenberg.org/ebooks/4300.txt.utf-8", "Text";
And here is the computation across all four texts done in parallel.
In[28]:= LaunchKernels[];
In[30]:= CloseKernels[];
5. First, here is the implementation using a Do loop.
In[31]:= PiApproxtrials_ := Modulein = 0, pt, pi, error,
pt := RandomReal[1, {2}];
DoIfTotalpt2 ≤ 1, in ++, trials ;
pi = N4 in trials ;
error = Absπ - pi;
pi, error
Here is an image.
In[41]:= Graphics
Opacity[.25], EdgeFormThickness[.01], Gray, , ,
PointSizeTiny, Red, Pointin, Blue, Point[out]
, Axes → True, ImageSize → Small
1.0
0.8
0.6
Out[41]=
0.4
0.2
In[44]:= TimingPiMonteCarlo104
Out[44]= {2.10258, 3.113600000000000}
But we can speed up this second implementation by using a one-argument form of RegionMem
ber to create a RegionMemberFunction object as described in Section 9.1.
9.2 Parallel processing: exercises 333
In[47]:= DistributeDefinitionsPiMonteCarlo2
Out[47]= {PiMonteCarlo2, , , pts, in}
In[49]:= Mean[%]
Out[49]= {3.141223833333333, 0.001413221132483}
As an aside, you could try parallelizing the implementation with the Do loop by using
ParallelDo or Parallelize, but you will need to share the variable in across subkernels using
SetSharedVariable. The cost of communication between kernels to keep track of and incre-
ment this counter is quite expensive and hence any gains in running this function in parallel
will be erased.
In[50]:= CloseKernels[];
6. Only two changes are required to run this in parallel – distribute the definition for Mandelbrot
and change Table to ParallelTable. To increase the resolution the grid now has many more
divisions in each direction (n = 400).
334 Essentials of Programming in Mathematica
In[52]:= LaunchKernels[]
Out[52]= {KernelObject[13, local], KernelObject[14, local],
KernelObject[15, local], KernelObject[16, local]}
In[53]:= DistributeDefinitionsMandelbrot
Out[53]= {Mandelbrot}
1
In[54]:= data = With{n = 400}, ParallelTableMandelbrot[x + ⅈ y], y, -1.3, 1.3, ,
n
1
x, -2, 0.6, ;
n
In[55]:= ArrayPlotdata, ColorFunction → "CMYKColors"
Out[55]=
In[56]:= CloseKernels[];
Create a compiled function that computes the above expression for x a real number and then
evaluate a range of values from zero to two and make a discrete plot of the differences between
9.3 Compiling: exercises 335
z4 + z3 /(z - 1) + z2 /(z3 + 4 z2 + 5) + c.
For these functions, you will have to adjust the test to determine if a point is unbounded upon
iteration. Try (Abs[Im[#]] > 50 &).
9.3 Solutions
1. First, create a test point with which to work.
In[1]:= pt = RandomReal[1, {2}]
Out[1]= {0.380097, 0.592515}
The following does not quite work because the default pattern is expected to be a flat
expression.
In[2]:= distReal = Compilep , _Real , SqrtFirst[p ]2 + Last[p ]2 ,
RuntimeAttributes → Listable, Parallelization → True
Compile::part :
Part speci�cation p〚1〛 cannot be compiled since the argument is not a tensor of suf�cient
rank. Evaluation will use the uncompiled function.
Compile::part :
Part speci�cation p〚-1〛 cannot be compiled since the argument is not a tensor of
suf�cient rank. Evaluation will use the uncompiled function.
Argument count: 1
Out[2]= CompiledFunction
Argument types: {_Real}
Give a third argument to the pattern specification to deal with this: {p, _Real, 1}.
In[3]:= ArrayDepth[pt]
Out[3]= 1
Argument count: 1
Out[4]= CompiledFunction
Argument types: {{_Real, 1}}
In[5]:= distReal[pt]
Out[5]= 0.703951
336 Essentials of Programming in Mathematica
In[8]:= distReal[pts]
Out[8]= {1.00739, 0.878974, 0.372417}
Norm does not have the Listable attribute so it must be mapped over the list.
In[9]:= Map[Norm, pts]
Out[9]= {1.00739, 0.878974, 0.372417}
Now scale up the size of the list of points and check efficiency.
In[11]:= pts = RandomReal1, 106 , 2;
In[12]:= AbsoluteTimingdistReal[pts];
Out[12]= {0.050415, Null}
Compiling to C (assuming you have a C compiler installed), speeds things up even more.
In[15]:= distReal = Compilep , _Real , 1, SqrtFirst[p ]2 + Last[p ]2 ,
RuntimeAttributes → Listable, Parallelization → True, CompilationTarget → "C"
Compile::nogen : A library could not be generated from the compiled function.
Argument count: 1
Out[15]= CompiledFunction
Argument types: {{_Real, 1}}
You can squeeze a little more speed out of these functions by using Part instead of First and
Last.
9.3 Compiling: exercises 337
Argument count: 1
Out[16]= CompiledFunction
Argument types: {{_Real, 1}}
In[17]:= AbsoluteTimingdistReal2[pts];
Out[17]= {0.07329, Null}
As an aside, the mean distance to the origin for random points in the unit square approaches
the following, asymptotically.
Out[18]= 0.765196
Argument count: 1
Out[20]= CompiledFunction
Argument types: {_Complex}
In[22]:= distComplex[pts]
Out[22]= {0.707041, 0.0774789, 0.366904}
Create a compiled function that computes the above expression for x a real number and then
evaluates a range of values from 0 to 2 and makes a discrete plot of the differences between the
approximated values and Log[1 + x].
11 x3
x + x2 + 60
In[25]:= logC = Compilex , _Real ,
3x 3 x2 x3
1+ 2
+ 5
+ 20
Argument count: 1
Out[25]= CompiledFunction
Argument types: {_Real}
2.5 × 10-6
2. × 10-6
1. × 10-6
5. × 10-7
Here is a higher order approximant. Note the need to evaluate PadeApproximant before the
compilation.
In[27]:= logC = Compilex , _Real , EvaluatePadeApproximant[Log[1 + x ], {x , 0, 5}]
Argument count: 1
Out[27]= CompiledFunction
Argument types: {_Real}
9.3 Compiling: exercises 339
2.5 × 10-6
2. × 10-6
1. × 10-6
5. × 10-7
4. Here is the computation for the iteration function c sin(z) using c = 1 +0.4 ⅈ.
In[29]:= cJulia2 = Compilez , _Complex , c , _Complex , Module{cnt = 1},
FixedPointcnt ++;
c Sin[# ] &, z , 100, SameTest → Abs[Im[#2 ]] > 50 &;
cnt, CompilationTarget → "C", RuntimeAttributes → Listable,
Parallelization → True, "RuntimeOptions" → "Speed"
Compile::nogen : A library could not be generated from the compiled function.
Argument count: 2
Out[29]= CompiledFunction
Argument types: {_Complex, _Complex}
In[30]:= LaunchKernels[]
Out[30]= {KernelObject[17, local], KernelObject[18, local],
KernelObject[19, local], KernelObject[20, local]}
Out[31]=
In[32]:= CloseKernels[];
340 Essentials of Programming in Mathematica
10
Packages
In[1]:= CollatzSequence[7]
Out[1]= {7, 22, 11, 34, 17, 52, 26, 13, 40, 20, 10, 5, 16, 8, 4, 2, 1}
b. Create a usage message for CollatzSequence and warning messages for each of the
following situations:
noint: the argument to CollatzSequence is not a positive integer
argx: CollatzSequence was called with the wrong number of arguments.
c. Modify the definition of CollatzSequence that you created in part a. above so that it does
some error trapping and issues the appropriate warning message that you created in part b.
d. Finally, put all the pieces together and write a package Collatz` that includes the appropri-
ate BeginPackage and Begin statements, usage messages, warning messages, and function
definitions. Make CollatzSequence a public function and collatz a private function. Put
your package in a directory where Mathematica can find it on its search path and then test it
to see that it returns correct output such as in the examples below.
In[2]:= Quit[];
342 Essentials of Programming in Mathematica
In[2]:= ? CollatzSequence
In[3]:= CollatzSequence[-5]
CollatzSequence::notint : The argument, -5, to CollatzSequence must be a positive integer.
In[5]:= CollatzSequence[27]
Out[5]= {27, 82, 41, 124, 62, 31, 94, 47, 142, 71, 214, 107, 322, 161, 484, 242, 121, 364,
182, 91, 274, 137, 412, 206, 103, 310, 155, 466, 233, 700, 350, 175, 526, 263,
790, 395, 1186, 593, 1780, 890, 445, 1336, 668, 334, 167, 502, 251, 754, 377,
1132, 566, 283, 850, 425, 1276, 638, 319, 958, 479, 1438, 719, 2158, 1079, 3238,
1619, 4858, 2429, 7288, 3644, 1822, 911, 2734, 1367, 4102, 2051, 6154, 3077,
9232, 4616, 2308, 1154, 577, 1732, 866, 433, 1300, 650, 325, 976, 488, 244, 122,
61, 184, 92, 46, 23, 70, 35, 106, 53, 160, 80, 40, 20, 10, 5, 16, 8, 4, 2, 1}
2. Take the StemPlot function developed in Section 6.2 and create a package around it. Include a
usage message and appropriate warning messages that are issued when bad input is supplied.
10.3 Solutions
1. Here are the definitions for the auxiliary collatz function.
In[1]:= collatzn_ ? EvenQ := n / 2
a. This is essentially the definition given in the solution to Exercise 5 from Section 6.2.
In[3]:= CollatzSequence[n_] := NestWhileListcollatz, n , # ≠ 1 &
In[4]:= CollatzSequence[7]
Out[4]= {7, 22, 11, 34, 17, 52, 26, 13, 40, 20, 10, 5, 16, 8, 4, 2, 1}
b. First we write the usage message for CollatzSequence, our public function. Notice that we
write no usage message for the private collatz function.
10.3 Working with packages: exercises 343
In[5]:= CollatzSequence::usage =
"CollatzSequence[n] computes the sequence of Collatz iterates
starting with initial value n. The sequence terminates as soon
as it reaches the value 1.";
Here is the warning message that will be issued whenever CollatzSequence is passed an
argument that is not a positive integer.
In[6]:= CollatzSequence::notint =
"First argument, `1`, to CollatzSequence must be a positive integer.";
c. Here is the modified definition which now issues the warning message created above
whenever the argument n is not a positive integer.
In[7]:= CollatzSequence[n_] := IfIntegerQ[n ] && n ≥ 0, NestWhileListcollatz, n , # ≠ 1 &,
MessageCollatzSequence::notint, n
The following case covers the situation when CollatzSequence is passed two or more argu-
ments. Note that it uses the built-in argx message, which is issued whenever built-in functions
are passed the wrong number of arguments.
In[8]:= CollatzSequence[_, args__] /;
MessageCollatzSequence::argx, CollatzSequence, Length[{args }] + 1 :=
Null
d. The package begins by giving usage messages for every exported function. The functions to
be exported are mentioned here – before the subcontext Private` is entered – so that the
symbol CollatzSequence has context Collatz`. Notice that collatz is not mentioned
here and hence will not be accessible to the user of this package.
In[9]:= Quit[]
In[1]:= BeginPackage"EPM`Collatz`";
In[2]:= CollatzSequence::usage =
"CollatzSequence[n] computes the sequence of Collatz iterates
starting with initial value n. The sequence terminates as soon
as it reaches the value 1.";
In[3]:= CollatzSequence::notint =
"First argument, `1`, to CollatzSequence must be a positive integer.";
A new context EPM`Collatz`Private` is then begun within EPM`Collatz. All the definitions
of this package are given within this new context. The context
EPM`Collatz`CollatzSequence is defined within the System` context. The context of
collatz, on the other hand, is EPM`Collatz`Private`.
In[4]:= Begin"`Private`";
In[10]:= EndPackage[]
After the End[] and EndPackage[] functions are evaluated, $Context and $ContextPath
revert to whatever they were before, except that EPM`Collatz` is added to $ContextPath.
Users can refer to CollatzSequence using its short name, but they can only refer to the auxil-
iary function collatz by its full name. The intent is to discourage clients from using collatz at
all, and doing so should definitely be avoided, since the author of the package may change or
remove auxiliary definitions at a later time.
2. Here is the code for the StemPlots package.
In[11]:= BeginPackage"EPM`StemPlots`"
Out[11]= EPM`StemPlots`
In[12]:= StemPlot::usage =
"StemPlot[����] returns a stem plot of the discrete data, ����.";
In[13]:= StemPlot::badarg = "The first argument to StemPlot must be a list of numbers.";
In[15]:= Begin"`Private`"
Out[15]= EPM`StemPlots`Private`
In[17]:= End[]
Out[17]= EPM`StemPlots`Private`
In[18]:= EndPackage[]
After saving in an appropriate location, this loads the package:
In[19]:= << EPM`StemPlots`
Check the usage message:
10.3 Working with packages: exercises 345
In[20]:= ? StemPlot
Out[22]=
2
2 4 6 8 10 12
-2
-4
In[23]:= StemPlotdata,
PlotStyle → DirectivePointSizeMedium, FillingStyle → Red
Out[23]=
2
2 4 6 8 10 12
-2
-4