SCHRES-04681; No of Pages 6

Schizophrenia Research xxx (2011) xxx–xxx

Contents lists available at ScienceDirect

Schizophrenia Research
j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / s c h r e s

Lack of association to a NRG1 missense polymorphism in schizophrenia or bipolar

disorder in a Costa Rican population
Emily Moon a, Brandi Rollins a, Andrea Mesén b, Adolfo Sequeira a, Richard M. Myers c, Huda Akil d,
Stanley J. Watson d, Jack Barchas e, Edward G. Jones f, Alan Schatzberg g, William E. Bunney a,
Lynn E. DeLisi h, William Byerley i, Marquis P. Vawter a,⁎
a
Department of Psychiatry and Human Behavior, School of Medicine, University of California, Irvine, CA, USA
b
ACENP of Costa Rica, Center of Neuropsychiatric Studies of Costa Rica, San José, Costa Rica
c
HudsonAlpha Institute for Biotechnology, Huntsville, Alabama, USA
d
Molecular and Behavioral Neuroscience Institute, University of Michigan, Ann Arbor, MI, USA
e
Department of Psychiatry, Cornell University, New York, NY, USA;
f
Neuroscience Center, University of California, Davis, CA, USA
g
Department of Psychiatry, Stanford University, Palo Alto, CA, USA
h
Department of Psychiatry, Boston VA, Brockton, MA, USA
i
Department of Psychiatry, University of California, San Francisco, CA, USA

a r t i c l e i n f o a b s t r a c t

Article history: A missense polymorphism in the NRG1 gene, Val N Leu in exon 11, was reported to increase the risk of
Received 2 March 2011 schizophrenia in selected families from the Central Valley region of Costa Rica (CVCR). The present study
Received in revised form 15 June 2011 investigated the relationship between three NRG1 genetic variants, rs6994992, rs3924999, and Val N Leu
Accepted 20 June 2011
missense polymorphism in exon 11, in cases and selected controls from an isolated population from the CVCR.
Available online xxxx
Isolated populations can have less genetic heterogeneity and increase power to detect risk variants in
Keywords:
candidate genes. Subjects with bipolar disorder (BD, n = 358), schizophrenia (SZ, n = 273), or unrelated
Neuregulin 1 isoform expression controls (CO, n = 479) were genotyped for three NRG1 variants. The NRG1 promoter polymorphism
Schizophrenia (rs6994992) was related to altered expression of NRG1 Type IV in other studies. The expression of NRG1 type
Isolated population IV in the dorsolateral prefrontal cortex (DLPFC) and the effect of the rs6994992 genotype on expression were
Costa Rica explored in a postmortem cohort of BD, SZ, major depressive disorder (MDD) cases, and controls. The
Bipolar disorder missense polymorphism Val N Leu in exon 11 was not significantly associated with schizophrenia as
Major depressive disorder previously reported in a family sample from this population, the minor allele frequency is 4%, thus our sample
Hippocampus
size is not large enough to detect an association. We observed however an association of rs6994992 with
Dorsolateral prefrontal cortex
NRG1 type IV expression in DLPFC and a significantly decreased expression in MDD compared to controls. The
present results while negative do not rule out a genetic association of these SNPs with BD and SZ in CVCR,
perhaps due to small risk effects that we were unable to detect and potential intergenic epistasis. The previous
genetic relationship between expression of a putative brain-specific isoform of NRG1 type IV and SNP
variation was replicated in postmortem samples in our preliminary study.
© 2011 Elsevier B.V. All rights reserved.

1. Introduction the disease, compared to 1% for the general population (Gottesman and
Erlenmeyer-Kimling, 2001). In twin studies, concordance rates of
Schizophrenia (SZ) is a debilitating brain disease characterized by 41%−65% have been seen in monozygotic twins compared to 0%−28%
delusions, hallucinations, decreased emotional affect, paranoia, and in dizygotic schizophrenic twins, suggesting heritability as high as 85%
motor deficiencies (Liddle et al., 1994). Though the exact neurobiology (Tsuang et al., 2001). In light of this evidence, much effort has been
of schizophrenia is not wholly understood, family, twin, and adoption directed toward the discovery of genes that increase the risk of
studies have demonstrated that schizophrenia is a complex disease with schizophrenia.
a significant genetic component. First-degree biological relatives of Schizophrenia linkage to chromosome 8p has been identified in
patients with schizophrenia have an estimated 10% risk of developing multiple studies (Pulver et al., 1995; Levinson et al., 1996; Kaufmann
et al., 1998; Shaw et al., 1998; DeLisi et al., 2002). Neuregulin 1
(NRG1) is located at 8p12 and is involved in neurodevelopment,
⁎ Corresponding author: Tel.: +1 949 824 9014. regulation of glutamate, and synaptic plasticity (Tosato et al., 2005).
E-mail address: [email protected] (M.P. Vawter). Stefansson et al (Stefansson et al., 2002) first reported an association

0920-9964/$ – see front matter © 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.schres.2011.06.024

Please cite this article as: Moon, E., et al., Lack of association to a NRG1 missense polymorphism in schizophrenia or bipolar disorder in a
Costa Rican population, Schizophr. Res. (2011), doi:10.1016/j.schres.2011.06.024
2 E. Moon et al. / Schizophrenia Research xxx (2011) xxx–xxx

between NRG1 and schizophrenia in an Icelandic population via a In addition to schizophrenia and control subjects, we have included
haplotype (HAPICE) consisting of five SNPs (SNP8NRG221132, bipolar subjects in the genotyping and brain gene expression as well.
SNP8NRG221533, SNP8NRG241930, SNP8NRG243177, and Bipolar disorder (BD) illness affects approximately 0.8–1.6% of the
SNP8NRG433E1006) and two microsatellite markers (478B14-848 population (Kessler et al., 1997) and is characterized by cyclical episodes
and 420M91395) located at the 5′ end of the gene that doubled the of mania and depression, with a return to normal state between
risk for the disorder. Since this initial report, confirmatory studies of episodes (Berns and Nemeroff, 2003). There is a significant genetic
NRG1 association have been reported in different populations in component to BD based upon twin studies; BD has an estimated
Scotland (Stefansson et al., 2003), China (Li et al., 2004), Hungary heritability as high as 93% (Kieseppa et al., 2004). Though schizophrenia
(Keri et al., 2009), Japan (Fukui et al., 2006), Sweden (Alaerts et al., and bipolar disorder have been historically categorized as divergent
2009), and a second Scottish cohort (Thomson et al., 2007), though psychopathologies, there is a growing body of evidence suggesting that
the associated haplotype varies between studies. Negative studies of causative commonalities exist between the two disorders (Badner and
association have also been reported in Japan (Iwata et al., 2004; Ikeda Gershon, 2002; Berrettini, 2003). To date, multiple studies have shown
et al., 2008), Ireland (Thiselton et al., 2004), Denmark (Ingason et al., schizophrenia implicated loci and genes having a positive association to
2006), Spain (Rosa et al., 2007), and the United States (Crowley et al., BD (Harrison and Weinberger, 2005; Craddock et al., 2006), including
2008). 8p12 (Park et al., 2004) and NRG1 (Green et al., 2005; Prata et al., 2009).
Variation in NRG1 has been found to be associated with various NRG1 in particular has also been shown to possibly play a role in bipolar
biological indices that are known to underlie schizophrenia. For psychopathology, pointing to a common involvement of this cell–cell
example, brain imaging measurements of the anterior cingulate interaction and growth involved protein in both bipolar disorder and
(Wang et al., 2009), prefrontal functioning (Mechelli et al., 2008; schizophrenia (Thomson et al., 2007; Georgieva et al., 2008).
Mechelli et al., 2009), overall white matter integrity (Zuliani et al., A population sample from the central valley of Costa Rica was
2011), excitatory synapse development (Ting et al., 2011), GABA chosen for this study due to its geographical isolation and genetic
interneuron dysfunction (Ting et al., 2011), and immune system homogeneity. The Costa Rican genome is comprised of largely
dysregulation (Marballi et al., 2010; Shibuya et al., 2010) have been European and Amerindian ancestry (Morera et al., 2003), as a result
linked to genetic variation in NRG1. These observations contribute to of six waves of Spanish colonization and admixture with the
the validity of the association of NRG1 with schizophrenia and its indigenous Amerindians (DeLisi et al., 2001). It is estimated that
likeliness to contribute to the underlining basis for the development fewer than 1000 families gave rise to the three million residents of the
of this illness. CVCR (Mathews et al., 2004), and due to mountainous boundaries and
A novel missense mutation present in NRG1 (ValN Leu in exon 11) dense lowland jungle, the CVCR population has remained isolated
that increased the risk of schizophrenia in individuals from Costa Rica from immigration and emigration for 500 years. Consequently, the
was reported in a family based association analysis (Walss-Bass et al., CVCR region presents a homogenous population perfect for studying
2006a). Our research group has been independently studying the genes underlying complex genetic disorders. Chromosomal areas of
genetics of schizophrenia in families and unrelated individuals from the interest have already been identified in this cohort for both
same region of the Central Valley of Costa Rica (CVCR) (DeLisi et al., schizophrenia (DeLisi et al., 2002; Cooper-Casey et al., 2005; Walss-
2002; Cooper-Casey et al., 2005; Bertisch et al., 2009); therefore we Bass et al., 2006b) and bipolar disorder (Freimer et al., 1996).
attempted to replicate the missense association with the Val N Leu While large association studies have shown the relative value of
polymorphism in exon 11 in this study. We do not believe that we have identifying common variants that contribute statistically significant
any overlap in samples with those reported in (Walss-Bass et al., 2006a), associations, there are usually small relative risks for disease attributable
although we have not made a formal comparison due to potential IRB to an individual SNP (e.g. (Purcell et al., 2009; Ruderfer et al., 2011).
ramifications. We also selected rs3924999 for analysis as it has been However, family based studies in relatively isolated populations can
linked to lower prepulse inhibition, an endophenotype of schizophrenia offer knowledge about regions of interest that might contain rare
(Hong et al., 2008), and for its association with schizophrenia in a variants in pathways that have etiological relevance to schizophrenia.
Chinese Han cohort (Zhang et al., 2009). In addition rs6994992 was Thus, the CVCR collection offers a resource for exploring the effects of
selected based on its inclusion in the HAPICE risk haplotype (Stefansson genes that have been largely implicated in multiple studies, and perhaps
et al., 2002), and based on evidence that the T/T genotype is associated can increase the association signal by increased genetic homogeneity
with decreased activation of frontal and temporal lobe regions and that is lacking in larger association studies. Thus, as sample sizes for
increased risk of psychosis (Hall et al., 2006). This SNP was also selected schizophrenia and bipolar disorder are projected to be larger in the
for investigation for its function in promoting expression of the NRG1 future, the relative risks attributable to a single variant will most likely
type IV transcript in postmortem tissue (Law et al., 2006);(Shamir and be decreasing due to genetic heterogeneity. With a modest sample size
Buonanno, 2010). Therefore, we studied the expression of NRG1 type IV pursued in the present study, there is adequate power in pursuing
in postmortem brain sample and association with genotypes of biologically based genes on an a priori basis. The purpose of this study is
rs6994992. Though there is NRG1 intragenic epistasis between 5′ and to examine NRG1 SNPs previously associated with SZ in a geographically
3′ markers (Nicodemus et al., 2010) in functional imaging studies, our isolated, relatively homogenous population from the CVCR.
group selected the present markers to attempt replication of implicated
SNPs that were also functionally relevant to the CVCR collection. The 2. Materials and methods
SNPs chosen for this study were selected primarily based on conclusions
published in the literature when designing the study. As associations 2.1. Sample collection
between schizophrenia and the HAPICEhaplotype have been both
supported and refuted across varying populations, we were interested Subjects were recruited with the approval of the Ministry of Health of
in adding the CVCR results to the pool of association data. rs6994992 Costa Rica and the ethics committee for the Hospital Nacional Psiquiatrico
was also selected based on reports of its function in promoting and by the Institutional Review Board at the University of California at
expression of the NRG1 type IV transcript in postmortem tissue. Finally, Irvine. Unrelated individuals with diagnoses of schizophrenia (n=273)
cost of the materials needed to test a wider range of markers was also a and bipolar disorder (n =358) whose four grandparents were of Spanish
factor in determining which SNPs to investigate. As this was a descent were obtained by screening patients admitted to the National
preliminary association study to test our samples with these three Psychiatric Hospital of Costa Rica as previously described(DeLisi et al.,
implicated SNPs, the present data can be added to meta-analysis using 2001; DeLisi et al., 2002). Control subjects (n =479) with the same
SNPs in NRG1. ancestral criteria were recruited from large companies via questionnaires

Please cite this article as: Moon, E., et al., Lack of association to a NRG1 missense polymorphism in schizophrenia or bipolar disorder in a
Costa Rican population, Schizophr. Res. (2011), doi:10.1016/j.schres.2011.06.024
 E. Moon et al. / Schizophrenia Research xxx (2011) xxx–xxx 3

administered by the companies' health services department. Controls Table 1

were selected if no family history of schizophrenia, bipolar disorder, The number of subjects for expression of NRG1 type IV isoform by genotype shown in
Fig. 1. There were no subjects with SZ that are homozygous for the T allele, so those
suicide or hospitalization for psychiatric reasons were present, and if self- subjects were not included in the analysis.
reports of psychosis, diagnosis of schizophrenia, bipolar disorder, use of
medications for depression or psychiatric conditions, and suicide Diagnosis * rs69949992 genotype C/C C/T T/T Total

attempts were negative. Interviews of affected subjects were conducted BP 2 5 3 10

with the Diagnostic Interview for Genetic Studies (Nurnberger et al., Control 8 11 3 22
MD 4 6 3 13
1994) using a translated Spanish DIGS 2 (DeLisi et al., 2001) and
Total 14 22 9 45
diagnoses were based upon DSM-IV criteria (Association, 1994) by a
consensus of two independent local psychiatrists. A third independent
psychiatrist made a final diagnosis, based on family history, medical described (Tomita et al., 2004; Vawter et al., 2006). The human
records, and a summary of personal interviews. All participants gave brain dissection and freezing protocol were performed as previously
written informed consent for participation. described (Jones et al., 1992; Vawter et al., 2006) and brains were
stored in − 80 °C freezers until further dissected. RNA was extracted
2.2. DNA extraction from 100 mg samples of dissected brain using a standard Trizol (Life
Technologies, Carlsbad, California) procedure. Integrity of total RNA
Blood samples were collected from participants in Costa Rica and was evaluated via 18S and 28S ratios and RNA integrity numbers
sent to the laboratory at UC Irvine. DNA was isolated from these samples (RIN) using the 2100 Agilent Bioanalyzer (Agilent Technologies, Santa
via 10% SDS and Proteinase K digestion, phenol–chloroform extraction, Clara, CA). Only samples with pH values higher than 6.5 were included
followed by a sodium acetate precipitation (Bell et al., 1981). Purity and in the analysis. cDNA was synthesized with oligo dT primers using the
concentration were assessed by 260 nm and 280 nm absorbances on the Superscript procedure (Invitrogen, Carlsbad CA). Expression levels of
SpectraMax Plus spectrophotometer (Molecular Devices, Sunnyvale, NRG1 IV were interrogated by TaqMan expression assay (ABI) using
CA) and aliquots were diluted to a working concentration of 2.5 ng/μl. the same primer and probe sequence provided in the Law et al. study
in which differences in gene expression for this subtype were
2.3. Genotyping observed (Law et al., 2006): forward 5′GCTCCGGCAGCAGCAT3′;
reverse 5′GAACCTGCAGCCGATTCCT3′; internal Probe 5′ FAM ACCA-
DNA samples were genotyped for NRG1 SNPs rs3994992 and CAGCCTTGCCT-MGB-3′. Since the NRG1 E187 exon has high homol-
rs6994992 using pre-validated TaqMan 5′-allele discrimination assays ogy with other genes (Steinthorsdottir et al., 2004), a TaqMan probe
(Applied Biosystems, Foster City, CA). The third polymorphism G/T in provided specificity for amplification of the NRG1 gene as the probe
exon 11 (Val N Leu) was genotyped with a custom TaqMan assay using spanned the junction of the E187–Ig1 exons (Law et al., 2006).
the following reference sequence in the Walss-Bass study (Walss-Bass After amplification, the PCR product was run on a 2% agarose gel,
et al., 2006a): GAACATGGACAATGTCATGCAGCATGCCCACTGTTTGGTTG- the amplicon's specificity was confirmed by sequencing using the
TAGTCAGTCCTGGCAAGTGGAAGTGACCTGTGATGACATCTGCTCT- same primers used in the TaqMan assay. We compared the NRG1 type
CATCCCTTTCCAGAGGCGGAGGAGCTGTACCAGAAGAAGTGCTGACCA- IV TaqMan expression assay results for diagnoses groups (Table 1) to
TAACCGGCATCTGCATCGCCCTCCTTGTGGTCGGCATCATGTGT[G/T] controls by an analysis of covariance taking into account age, sex, and
TGGTGGCCTACTGCAAAACCAAGTAAACCTTCTTTCTC- RNA quality. The TaqMan expression was normalized with GAPDH.
CATGCCTTTCTCTCTCCTTCATGCAGAGACAGCTTAGATGGCCAGGGCTTTG- Brain gene expression levels were compared in bipolar disorder
CAGAATCTGAGCTCCACAGCCTAGTCTTGGGG. The Walss-Bass assay was (n = 10), control (n = 22), MDD (n = 13) for a total of 45 postmortem
performed on an ABI Prism 7000 Sequence Detection system, in a total subjects that had genotypes for NRG1rs69949992.
reaction of 25 μl (4 μl DNA, 12.5 μl TaqMan Universal PCR Master Mix, No
AmpErase UNG, 1.25 μl 40× TaqMan assay, 7.25 μl H2O) using the
following amplification conditions: denaturation at 95 °C for 10 min, 3. Results
followed by 40 cycles at 95 °C for 15 s and at 55 °C for 1 min. Individual
PCR reactions for rs3924999 and rs6994992 were carried out on an ABI 3.1. Association testing of polymorphisms
Prism 7900 Sequence Detection system in a total reaction of 12 μl (4 μl
DNA, 5 μl TaqMan Universal PCR Master Mix, No AmpErase UNG, 0.5 μl The genotype counts for each SNP are shown in Table 2. The
40× TaqMan assay, 2.5 μl H2O) using the following amplification recessive and dominant association tests for three NRG1 SNPs
protocol: denaturation at 95 °C for 10 min, followed by 50 cycles at
92 °C for 15 s and at 58 °C for 1.5 min. The genotype of each sample was Table 2
determined by measuring allelic-specific fluorescence using SDS 2.3 Genotype frequencies for three SNPs in association study of CVCR subjects with bipolar
disorder (BD) and schizophrenia (SZ).
software for allelic discrimination (Applied Biosystems).
Genotype and allelic statistical analyses were performed using NRG1 Exon 11 (Val N Leu) BD SZ Control Total
Yates corrected χ 2 for continuity and Fisher's Exact Test for analyses G/G 327 256 446 1029
that contained low cell numbers. Deviation from Hardy–Weinberg G/T 28 17 33 78
equilibrium (HWE) was tested using on line calculator (http://ihg.gsf. T/T 3 0 0 3
de/cgi-bin/hw/hwa1.pl). Total 358 273 479 1110

rs6994992
2.4. Brain gene expression C/C 149 116 201 466
C/T 159 119 218 496
Brain samples were obtained at the UC Irvine/UC Davis Brain T/T 50 38 60 148
Total 358 273 479 1110
Repository through a uniform process approved by the Institutional
Review Board. Postmortem diagnoses were made through an rs3924999
extensive review of multiple sources of information including the A/A 40 27 62 129
medical examiner's conclusions, coroner's investigation, medical and A/G 159 132 209 500
psychiatric records, toxicology results, interviews of the decedents' G/G 159 114 208 481
Total 358 273 479 1110
next-of-kin and a neuropathological examination as previously

Please cite this article as: Moon, E., et al., Lack of association to a NRG1 missense polymorphism in schizophrenia or bipolar disorder in a
Costa Rican population, Schizophr. Res. (2011), doi:10.1016/j.schres.2011.06.024
4 E. Moon et al. / Schizophrenia Research xxx (2011) xxx–xxx

genotyped were not significant with either BD or SZ (Table 3). There

was a trend for SNP (Val N Leu exon 11) in BD cases only to not be in
Hardy–Weinberg equilibrium (nominal p = 0.043).

3.2. Expression of NRG1 Type IV in brain

Two brain regions (hippocampus and DLPFC) were analyzed for

expression differences of NRG1 Type IV. For the hippocampus results,
there were no statistically significant differences in expression for SZ,
BD, or MDD cases compared to controls; however, in the DLPFC, the
MDD cases (n = 12) showed decreased expression (p = 0.004)
compared to controls (n = 22) when pH, age, RIN, and gender are
included in the ANCOVA model. The RIN factor was significant
(p = 0.05). The hippocampus showed very low levels of amplification
indicating low expression of intact poly-adenylated mRNA.
We next investigated the rs6994992 genotype effect on NRG1 type
IV expression in hippocampus and DLPFC. The genotype effect was Fig. 1. The delta Ct values for NRG1 type IV expression in DLPFC by genotype and
diagnosis were analyzed with an ANCOVA. The Diagnosis main effect was significant
significant (p = 0.040) only in DLPFC; however there were no
(p = 0.0015), Diagnosis × Genotype was not significant (p-value = 0.68). The Diagnosis
homozygous T carriers in the SZ group. We did confirm that NRG1 main effect was largely due to a decrease in MDD DLPFC NRG1Type IV expression
type IV expression was increased in the TT compared to the CC group reduction of 33.5 fold compared to controls (p = 0.002) while BD was not changed
in the DLPFC and that the effect was significant in the direction significantly in DLPFC (p = 0.51). The Genotype effect was significant (p = 0.040). The
TT genotype showed a significantly increased expression (p = 0.024) of 15.3 fold
previously reported as the TT genotype showed a significantly
compared to CC genotype. Since schizophrenia subjects did not have any TT genotypes,
increased expression (p = 0.024) of 15.3 fold compared to CC they were omitted from this analysis. The LS Mean (y-axis) is the delta Ct values
genotype (Fig. 1). The CT group also showed a significant difference adjusted for age, RIN, and sex. The bar graph is an inverse to the relative amount of the
compared to the TT group (p = 0.023); again, the direction supported NRG1 type IV expression, higher bar indicates lower expression since the figure uses Ct
the dominant effect of the T allele increasing expression of the NRG1 values. The levels have been normalized to the endogenous reference gene GAPDH.

type IV expression. The CT group did not show a significant difference

from the CC group (p = 0.83). Interestingly, the MDD subjects showed
a decreased expression compared to controls for both the CC and CT et al., 2007) with risk ratio of ≥1.37, it was not adequately powered for
genotype group comparisons (p = 0.009, p = 0.018), the TT genotypes the rarer exon 11 missense SNP. This minor allele frequency requires a
were not different comparing expression of NRG1 type IV between larger sample to definitively test for association. Though there are
MDD and controls (p = 0.21). positive reports for NRG1 as both a schizophrenia and bipolar
susceptibility gene for one or more of these SNPs, this hypothesis has
4. Discussion not been consistently proven in the literature as shown in the
introduction. Although we tested the same missense mutation
Within the isolated CVCR population, this study failed to find an previously associated in a family sample in CVCR (Walss-Bass et al.,
association with schizophrenia or bipolar disorder testing three NRG1 2006a), we did not replicate these findings in a larger case – control
SNPs. Thus while our study had 80%–86% power for SZ and BD, analysis from the same CVCR population, perhaps due to this rare SNP
respectively to find association for two of the more common SNPs (Skol frequency of 4%.
Additionally, we confirmed a prior report of an association
between higher expression of NRG1 type IV and the rs6994992 T/T
Table 3 genotype in the DLPFC as previously reported (Law et al., 2006)
The NRG1association results for BD and SZ were not significant for the study of CVCR (Shamir and Buonanno, 2010). We also report the preliminary finding
subjects. of decreased NRG1 type IV expression in MDD in the DLPFC. Although
Model SNP Disorder previous studies have not found an association between NRG1 SNPs
NRG1 BD SZ
and MDD in a large sample of European ancestry (Schosser et al.,
Exon 11 2010), there was decreased NRG1-alpha protein in MDD and SZ in the
prefrontal cortex (Bertram et al., 2007). Since NRG1 has strong
Recessive Yates Chi- Pearson Chi- Yates Chi- Pearson Chi-
Square/p Square/p Square/p Square/p pleiotropic effects related to growth factor signaling in the brain, the
0.68/0.40 0.91/0.34 0.04/0.84 0.12/0.72 findings of decreased NRG1 expression in prefrontal cortex could lend
Dominant Fisher Fisher support to the overall growth factor hypothesis of depression (Evans
exact p exact p
et al., 2004).
0.077 1
Two caveats to the postmortem findings are that we cannot rule
rs6994992 out the effect of antidepressant medications without animal studies as
Recessive Yates Chi- Pearson Chi- Yates Chi- Pearson Chi- a potential cause of this decrease in MDD. The decreased expression in
Square/p Square/p Square/p Square/p DLPFC of NRG1 type IV in MDD requires additional postmortem
0/1 0.01/0.92 0/1 0.02/0.88
studies in part based upon small sample size, for validation, but is
Dominant Yates Chi- Pearson Chi- Yates Chi- Pearson Chi-
Square/p Square/p Square/p Square/p consistent with a reported decrease of NRG1 protein in MDD frontal
.26/.61 .37/.54 .19/.66 .3/.58 cortex. In conclusion, while the present findings do not support
association of the NRG1 variants in the CVCR population with
rs3924999 schizophrenia or bipolar disorder, the tested SNPs might have some
Recessive Yates Chi- Pearson Chi- Yates Chi- Pearson Chi-
Square/p Square/p Square/p Square/p
intergenic epistasis or be of a smaller effect size that we do not have
.45/.50 .6/.43 1.28/0.25 1.55/0.21 power to detect. The present findings continue to show that there is a
Dominant Yates Chi- Pearson Chi- Yates Chi- Pearson Chi- robust effect of genetic variation on NRG1 type IV expression which is
Square/p Square/p Square/p Square/p thought to be brain-specific and with multiple impacts on brain
0.05/.82 .08/.77 .13/.71 .2/.65
function.

Please cite this article as: Moon, E., et al., Lack of association to a NRG1 missense polymorphism in schizophrenia or bipolar disorder in a
Costa Rican population, Schizophr. Res. (2011), doi:10.1016/j.schres.2011.06.024
 E. Moon et al. / Schizophrenia Research xxx (2011) xxx–xxx 5

Role of the funding source Fukui, N., Muratake, T., Kaneko, N., Amagane, H., Someya, T., 2006. Supportive evidence
The authors are members of the Pritzker Neuropsychiatric Disorders Research for neuregulin 1 as a susceptibility gene for schizophrenia in a Japanese population.
Neurosci Lett 396 (2), 117–120.
Consortium, which is supported by the Pritzker Neuropsychiatric Disorders Research
Georgieva, L., Dimitrova, A., Ivanov, D., Nikolov, I., Williams, N.M., Grozeva, D.,
Fund L.L.C. A shared intellectual property agreement exists between this philanthropic
Zaharieva, I., Toncheva, D., Owen, M.J., Kirov, G., O'Donovan, M.C., 2008. Support for
fund and the University of Michigan, Stanford University, the Weill Medical College of neuregulin 1 as a susceptibility gene for bipolar disorder and schizophrenia. Biol
Cornell University, HudsonAlpha Institute of Biotechnology, the Universities of Psychiatry 64 (5), 419–427.
California at Davis, and at Irvine, to encourage the development of appropriate Gottesman, I.I., Erlenmeyer-Kimling, L., 2001. Family and twin strategies as a head start
findings for research and clinical applications. in defining prodromes and endophenotypes for hypothetical early-interventions in
schizophrenia. Schizophr Res 51 (1), 93–102.
Green, E.K., Raybould, R., Macgregor, S., Gordon-Smith, K., Heron, J., Hyde, S., Grozeva,
Contributors D., Hamshere, M., Williams, N., Owen, M.J., O'Donovan, M.C., Jones, L., Jones, I.,
Authors EM, BR, WEB, LED, WB, and MPV conceived and designed the study. EM, Kirov, G., Craddock, N., 2005. Operation of the schizophrenia susceptibility gene,
BR, LED, WB, and MPV carried out the computational analyses and candidate gene neuregulin 1, across traditional diagnostic boundaries to increase risk for bipolar
selection. EM, BR, AM, LED conducted subject screening. EM, BR, carried out the disorder. Arch Genet Psychiatry 62 (6), 642–648.
genotyping. EM and MPV performed the statistical analysis of the genotyping and Hall, J., Whalley, H.C., Job, D.E., Baig, B.J., McIntosh, A.M., Evans, K.L., Thomson, P.A.,
expression data. RMM, HA, SJW, JB, EGJ, AS, WEB provided the guidance and additional Porteous, D.J., Cunningham-Owens, D.G., Johnstone, E.C., Lawrie, S.M., 2006. A
support on this project. EM, BR, WEB, LED, WB, and MPV wrote the first draft of the neuregulin 1 variant associated with abnormal cortical function and psychotic
paper, all authors revised the current paper. LED, AM, and WB recruited, diagnosed, and symptoms. Nat Neurosci 9 (12), 1477–1478.
Harrison, P.J., Weinberger, D.R., 2005. Schizophrenia genes, gene expression, and neuropa-
gathered patients and controls. BR, EM, LED, AM, WB, MPV contributed to the collection
thology: on the matter of their convergence. Mol Psychiatry 10 (1), 40–68 image 5.
and preparation of control DNA samples.
Hong, L.E., Wonodi, I., Stine, O.C., Mitchell, B.D., Thaker, G.K., 2008. Evidence of missense
mutations on the neuregulin 1 gene affecting function of prepulse inhibition. Biol
Psychiatry 63 (1), 17–23.
Conflict of interest
Ikeda, M., Takahashi, N., Saito, S., Aleksic, B., Watanabe, Y., Nunokawa, A., Yamanouchi,
All authors have no conflicts of interest to declare.
Y., Kitajima, T., Kinoshita, Y., Kishi, T., Kawashima, K., Hashimoto, R., Ujike, H., Inada,
T., Someya, T., Takeda, M., Ozaki, N., Iwata, N., 2008. Failure to replicate the
association between NRG1 and schizophrenia using Japanese large sample.
Acknowledgments
Schizophr Res 101 (1–3), 1–8.
Support was received from the William Lion Penzner Foundation, Pritzker Ingason, A., Soeby, K., Timm, S., Wang, A.G., Jakobsen, K.D., Fink-Jensen, A.,
Neuropsychiatric Disorders Research Consortium for support of the collection and Hemmingsen, R., Berg Rasmussen, H., Werge, T., 2006. No significant association
genotyping of the Costa Rica samples and the NIMH Conte Center funding P50 of the 5′ end of neuregulin 1 and schizophrenia in a large Danish sample. Schizophr
MH60398 for brain sample collection. We appreciate the UC Irvine Davis staff for Res 83 (1), 1–5.
contributions to brain tissue acquisition, and the Costa Rica staff for subject Iwata, N., Suzuki, T., Ikeda, M., Kitajima, T., Yamanouchi, Y., Inada, T., Ozaki, N., 2004. No
ascertainment. association with the neuregulin 1 haplotype to Japanese schizophrenia. Mol
Psychiatry 9 (2), 126–127.
Jones, E.G., Hendry, S.H., Liu, X.B., Hodgins, S., Potkin, S.G., Tourtellotte, W.W., 1992. A method
References for fixation of previously fresh-frozen human adult and fetal brains that preserves
histological quality and immunoreactivity. J Neurosci Methods 44 (2–3), 133–144.
Alaerts, M., Ceulemans, S., Forero, D., Moens, L.N., De Zutter, S., Heyrman, L., Lenaerts, Kaufmann, C.A., Suarez, B., Malaspina, D., Pepple, J., Svrakic, D., Markel, P.D., Meyer, J.,
A.S., Norrback, K.F., De Rijk, P., Nilsson, L.G., Goossens, D., Adolfsson, R., Del-Favero, Zambuto, C.T., Schmitt, K., Matise, T.C., Harkavy Friedman, J.M., Hampe, C., Lee, H.,
J., 2009. Support for NRG1 as a susceptibility factor for schizophrenia in a northern Shore, D., Wynne, D., Faraone, S.V., Tsuang, M.T., Cloninger, C.R., 1998. NIMH
Swedish isolated population. Arch Genet Psychiatry 66 (8), 828–837. Genetics Initiative Millenium Schizophrenia Consortium: linkage analysis of
Association, A.P., 1994. Diagnostic and Statistical Manual of Mental Disorders: DSM-IV. African-American pedigrees. Am J Med Genet 81 (4), 282–289.
American Psychiatric Association, Washington DC. Keri, S., Kiss, I., Kelemen, O., 2009. Effects of a neuregulin 1 variant on conversion to
Badner, J.A., Gershon, E.S., 2002. Meta-analysis of whole-genome linkage scans of schizophrenia and schizophreniform disorder in people at high risk for psychosis.
bipolar disorder and schizophrenia. Mol Psychiatry 7 (4), 405–411. Mol Psychiatry 14 (2), 118–119.
Bell, G.I., Karam, J.H., Rutter, W.J., 1981. Polymorphic DNA region adjacent to the 5′ end Kessler, R.C., Rubinow, D.R., Holmes, C., Abelson, J.M., Zhao, S., 1997. The epidemiology
of the human insulin gene. Proc Natl Acad Sci U S A 78 (9), 5759–5763. of DSM-III-R bipolar I disorder in a general population survey. Psychol Med 27 (5),
Berns, G.S., Nemeroff, C.B., 2003. The neurobiology of bipolar disorder. Am J Med Genet 1079–1089.
C Semin Med Genet 123C (1), 76–84. Kieseppa, T., Partonen, T., Haukka, J., Kaprio, J., Lonnqvist, J., 2004. High concordance of
Berrettini, W., 2003. Evidence for shared susceptibility in bipolar disorder and bipolar I disorder in a nationwide sample of twins. Am J Psychiatry 161 (10),
schizophrenia. Am J Med Genet C Semin Med Genet 123C (1), 59–64. 1814–1821.
Bertisch, H., Mesen-Fainardi, A., Martin, M.V., Perez-Vargas, V., Vargas-Rodriguez, T., Law, A.J., Lipska, B.K., Weickert, C.S., Hyde, T.M., Straub, R.E., Hashimoto, R., Harrison, P.J.,
Delgado, G., Delgado, C., Llach, M., LaPrade, B., Byerley, W., Bunney, W.E., Vawter, Kleinman, J.E., Weinberger, D.R., 2006. Neuregulin 1 transcripts are differentially
M.P., DeLisi, L.E., 2009. Neuropsychological performance as endophenotypes in expressed in schizophrenia and regulated by 5′ SNPs associated with the disease. Proc
extended schizophrenia families from the Central Valley of Costa Rica. Psychiatr Natl Acad Sci U S A 103 (17), 6747–6752.
Genet 19 (1), 45–52. Levinson, D.F., Mowry, B.J., Sharpe, L., Endicott, J., 1996. Penetrance of schizophrenia-
Bertram, I., Bernstein, H.G., Lendeckel, U., Bukowska, A., Dobrowolny, H., Keilhoff, G., related disorders in multiplex families after correction for ascertainment. Genet
Kanakis, D., Mawrin, C., Bielau, H., Falkai, P., Bogerts, B., 2007. Immunohistochemical Epidemiol 13 (1), 11–21.
evidence for impaired neuregulin-1 signaling in the prefrontal cortex in schizophrenia Li, T., Stefansson, H., Gudfinnsson, E., Cai, G., Liu, X., Murray, R.M., Steinthorsdottir, V.,
and in unipolar depression. Ann N Y Acad Sci 1096, 147–156. Januel, D., Gudnadottir, V.G., Petursson, H., Ingason, A., Gulcher, J.R., Stefansson, K.,
Cooper-Casey, K., Mesen-Fainardi, A., Galke-Rollins, B., Llach, M., Laprade, B., Rodriguez, Collier, D.A., 2004. Identification of a novel neuregulin 1 at-risk haplotype in Han
C., Riondet, S., Bertheau, A., Byerley, W., 2005. Suggestive linkage of schizophrenia schizophrenia Chinese patients, but no association with the Icelandic/Scottish risk
to 5p13 in Costa Rica. Mol Psychiatry 10 (7), 651–656. haplotype. Mol Psychiatry 9 (7), 698–704.
Craddock, N., O'Donovan, M.C., Owen, M.J., 2006. Genes for schizophrenia and bipolar Liddle, P., Carpenter, W.T., Crow, T., 1994. Syndromes of schizophrenia. Classic
disorder? Implications for psychiatric nosology. Schizophr Bull 32 (1), 9–16. literature. Br J Psychiatry 165 (6), 721–727.
Crowley, J.J., Keefe, R.S., Perkins, D.O., Stroup, T.S., Lieberman, J.A., Sullivan, P.F., 2008. Marballi, K., Quinones, M.P., Jimenez, F., Escamilla, M.A., Raventos, H., Soto-Bernardini, M.C.,
The neuregulin 1 promoter polymorphism rs6994992 is not associated with Ahuja, S.S., Walss-Bass, C., 2010. In vivo and in vitro genetic evidence of involvement of
chronic schizophrenia or neurocognition. Am J Med Genet B Neuropsychiatr Genet neuregulin 1 in immune system dysregulation. J Mol Med 88 (11), 1133–1141.
147B (7), 1298–1300. Mathews, C.A., Reus, V.I., Bejarano, J., Escamilla, M.A., Fournier, E., Herrera, L.D., Lowe,
DeLisi, L.E., Mesen, A., Rodriguez, C., Bertheau, A., LaPrade, B., Llach, M., Riondet, S., Razi, T.L., McInnes, L.A., Molina, J., Ophoff, R.A., Raventos, H., Sandkuijl, L.A., Service, S.K.,
K., 2001. Clinical characteristics of schizophrenia in multiply affected Spanish origin Spesny, M., Leon, P.E., Freimer, N.B., 2004. Genetic studies of neuropsychiatric
families from Costa Rica. Psychiatr Genet 11 (3), 145–152. disorders in Costa Rica: a model for the use of isolated populations. Psychiatr Genet
DeLisi, L.E., Mesen, A., Rodriguez, C., Bertheau, A., LaPrade, B., Llach, M., Riondet, S., Razi, 14 (1), 13–23.
K., Relja, M., Byerley, W., Sherrington, R., 2002. Genome-wide scan for linkage to Mechelli, A., Prata, D.P., Fu, C.H., Picchioni, M., Kane, F., Kalidindi, S., McDonald, C.,
schizophrenia in a Spanish-origin cohort from Costa Rica. Am J Med Genet 114 (5), Demjaha, A., Kravariti, E., Toulopoulou, T., Murray, R., Collier, D.A., McGuire, P.K.,
497–508. 2008. The effects of neuregulin1 on brain function in controls and patients with
Evans, S.J., Choudary, P.V., Neal, C.R., Li, J.Z., Vawter, M.P., Tomita, H., Lopez, J.F., schizophrenia and bipolar disorder. NeuroImage 42 (2), 817–826.
Thompson, R.C., Meng, F., Stead, J.D., Walsh, D.M., Myers, R.M., Bunney, W.E., Mechelli, A., Viding, E., Pettersson-Yeo, W., Tognin, S., McGuire, P.K., 2009. Genetic
Watson, S.J., Jones, E.G., Akil, H., 2004. Dysregulation of the fibroblast growth factor variation in neuregulin1 is associated with differences in prefrontal engagement in
system in major depression. Proc Natl Acad Sci U S A 101 (43), 15506–15511. children. Hum Brain Mapp 30 (12), 3934–3943.
Freimer, N.B., Reus, V.I., Escamilla, M., Spesny, M., Smith, L., Service, S., Gallegos, A., Morera, B., Barrantes, R., Marin-Rojas, R., 2003. Gene admixture in the Costa Rican
Meza, L., Batki, S., Vinogradov, S., Leon, P., Sandkuijl, L.A., 1996. An approach to population. Ann Hum Genet 67 (Pt 1), 71–80.
investigating linkage for bipolar disorder using large Costa Rican pedigrees. Am J Nicodemus, K.K., Law, A.J., Radulescu, E., Luna, A., Kolachana, B., Vakkalanka, R., Rujescu,
Med Genet 67 (3), 254–263. D., Giegling, I., Straub, R.E., McGee, K., Gold, B., Dean, M., Muglia, P., Callicott, J.H.,

Please cite this article as: Moon, E., et al., Lack of association to a NRG1 missense polymorphism in schizophrenia or bipolar disorder in a
Costa Rican population, Schizophr. Res. (2011), doi:10.1016/j.schres.2011.06.024
6 E. Moon et al. / Schizophrenia Research xxx (2011) xxx–xxx

Tan, H.Y., Weinberger, D.R., 2010. Biological validation of increased schizophrenia Stefansson, H., Sarginson, J., Kong, A., Yates, P., Steinthorsdottir, V., Gudfinnsson, E.,
risk with NRG1, ERBB4, and AKT1 epistasis via functional neuroimaging in healthy Gunnarsdottir, S., Walker, N., Petursson, H., Crombie, C., Ingason, A., Gulcher, J.R.,
controls. Arch Genet Psychiatry 67 (10), 991–1001. Stefansson, K., St Clair, D., 2003. Association of neuregulin 1 with schizophrenia
Nurnberger Jr., J.I., Blehar, M.C., Kaufmann, C.A., York-Cooler, C., Simpson, S.G., Harkavy- confirmed in a Scottish population. Am J Hum Genet 72 (1), 83–87.
Friedman, J., Severe, J.B., Malaspina, D., Reich, T., 1994. Diagnostic interview for Steinthorsdottir, V., Stefansson, H., Ghosh, S., Birgisdottir, B., Bjornsdottir, S., Fasquel,
genetic studies. Rationale, unique features, and training. NIMH Genetics Initiative. A.C., Olafsson, O., Stefansson, K., Gulcher, J.R., 2004. Multiple novel transcription
Arch Genet Psychiatry 51 (11), 849–859 discussion 863–4. initiation sites for NRG1. Gene 342 (1), 97–105.
Park, N., Juo, S.H., Cheng, R., Liu, J., Loth, J.E., Lilliston, B., Nee, J., Grunn, A., Kanyas, K., Thiselton, D.L., Webb, B.T., Neale, B.M., Ribble, R.C., O'Neill, F.A., Walsh, D., Riley, B.P.,
Lerer, B., Endicott, J., Gilliam, T.C., Baron, M., 2004. Linkage analysis of psychosis in Kendler, K.S., 2004. No evidence for linkage or association of neuregulin-1 (NRG1)
bipolar pedigrees suggests novel putative loci for bipolar disorder and shared with disease in the Irish study of high-density schizophrenia families (ISHDSF). Mol
susceptibility with schizophrenia. Mol Psychiatry 9 (12), 1091–1099. Psychiatry 9 (8), 777–783 image 729.
Prata, D.P., Breen, G., Osborne, S., Munro, J., St Clair, D., Collier, D.A., 2009. An association Thomson, P.A., Christoforou, A., Morris, S.W., Adie, E., Pickard, B.S., Porteous, D.J., Muir,
study of the neuregulin 1 gene, bipolar affective disorder and psychosis. Psychiatr W.J., Blackwood, D.H., Evans, K.L., 2007. Association of Neuregulin 1 with
Genet 19 (3), 113–116. schizophrenia and bipolar disorder in a second cohort from the Scottish population.
Pulver, A.E., Lasseter, V.K., Kasch, L., Wolyniec, P., Nestadt, G., Blouin, J.L., Kimberland, Mol Psychiatry 12 (1), 94–104.
M., Babb, R., Vourlis, S., Chen, H., et al., 1995. Schizophrenia: a genome scan targets Ting, A.K., Chen, Y., Wen, L., Yin, D.M., Shen, C., Tao, Y., Liu, X., Xiong, W.C., Mei, L., 2011.
chromosomes 3p and 8p as potential sites of susceptibility genes. Am J Med Genet Neuregulin 1 promotes excitatory synapse development and function in GABAergic
60 (3), 252–260. interneurons. J Neurosci 31 (1), 15–25.
Purcell, S.M., Wray, N.R., Stone, J.L., Visscher, P.M., O'Donovan, M.C., Sullivan, P.F., Sklar, Tomita, H., Vawter, M.P., Walsh, D.M., Evans, S.J., Choudary, P.V., Li, J., Overman, K.M.,
P., 2009. Common polygenic variation contributes to risk of schizophrenia and Atz, M.E., Myers, R.M., Jones, E.G., Watson, S.J., Akil, H., Bunney Jr., W.E., 2004. Effect
bipolar disorder. Nature 460 (7256), 748–752. of agonal and postmortem factors on gene expression profile: quality control in
Rosa, A., Gardner, M., Cuesta, M.J., Peralta, V., Fatjo-Vilas, M., Miret, S., Navarro, M.E., microarray analyses of postmortem human brain. Biol Psychiatry 55 (4), 346–352.
Comas, D., Fananas, L., 2007. Family-based association study of neuregulin-1 gene Tosato, S., Dazzan, P., Collier, D., 2005. Association between the neuregulin 1 gene and
and psychosis in a Spanish sample. Am J Med Genet B Neuropsychiatr Genet 144B schizophrenia: a systematic review. Schizophr Bull 31 (3), 613–617.
(7), 954–957. Tsuang, M.T., Stone, W.S., Faraone, S.V., 2001. Genes, environment and schizophrenia.
Ruderfer, D.M., Kirov, G., Chambert, K., Moran, J.L., Owen, M.J., O'Donovan, M.C., Sklar, P., Br J Psychiatry Suppl 40, s18–s24.
Purcell, S.M., 2011. A family-based study of common polygenic variation and risk of Vawter, M.P., Tomita, H., Meng, F., Bolstad, B., Li, J., Evans, S., Choudary, P., Atz, M., Shao,
schizophrenia. Mol Psychiatry. L., Neal, C., Walsh, D.M., Burmeister, M., Speed, T., Myers, R., Jones, E.G., Watson, S.J.,
Schosser, A., Cohen-Woods, S., Gaysina, D., Chow, P.C., Martucci, L., Farmer, A., Korszun, A., Akil, H., Bunney, W.E., 2006. Mitochondrial-related gene expression changes are
Gunashinghe, C., Gray, J., Jones, L., Craddock, N., Owen, M.J., Craig, I.W., McGuffin, P., sensitive to agonal-pH state: implications for brain disorders. Mol Psychiatry 615
2010. NRG1 gene in recurrent major depression: no association in a large-scale case– (7), 663–679.
control association study. Am J Med Genet B Neuropsychiatr Genet 153B (1), 141–147. Walss-Bass, C., Liu, W., Lew, D.F., Villegas, R., Montero, P., Dassori, A., Leach, R.J., Almasy,
Shamir, A., Buonanno, A., 2010. Molecular and cellular characterization of neuregulin-1 L., Escamilla, M., Raventos, H., 2006a. A novel missense mutation in the
type IV isoforms. J Neurochem 113 (5), 1163–1176. transmembrane domain of neuregulin 1 is associated with schizophrenia. Biol
Shaw, S.H., Kelly, M., Smith, A.B., Shields, G., Hopkins, P.J., Loftus, J., Laval, S.H., Vita, A., De Psychiatry 60 (6), 548–553.
Hert, M., Cardon, L.R., Crow, T.J., Sherrington, R., DeLisi, L.E., 1998. A genome-wide Walss-Bass, C., Montero, A.P., Armas, R., Dassori, A., Contreras, S.A., Liu, W., Medina, R.,
search for schizophrenia susceptibility genes. Am J Med Genet 81 (5), 364–376. Levinson, D., Pereira, M., Atmella, I., NeSmith, L., Leach, R., Almasy, L., Raventos, H.,
Shibuya, M., Komi, E., Wang, R., Kato, T., Watanabe, Y., Sakai, M., Ozaki, M., Someya, T., Nawa, Escamilla, M.A., 2006b. Linkage disequilibrium analyses in the Costa Rican
H., 2010. Measurement and comparison of serum neuregulin 1 immunoreactivity in population suggests discrete gene loci for schizophrenia at 8p23.1 and 8q13.3.
control subjects and patients with schizophrenia: an influence of its genetic Psychiatr Genet 16 (4), 159–168.
polymorphism. J Neural Transm 117 (7), 887–895. Wang, F., Jiang, T., Sun, Z., Teng, S.L., Luo, X., Zhu, Z., Zang, Y., Zhang, H., Yue, W., Qu, M.,
Skol, A.D., Scott, L.J., Abecasis, G.R., Boehnke, M., 2007. Optimal designs for two-stage Lu, T., Hong, N., Huang, H., Blumberg, H.P., Zhang, D., 2009. Neuregulin 1 genetic
genome-wide association studies. Genet Epidemiol 31 (7), 776–788. variation and anterior cingulum integrity in patients with schizophrenia and
Stefansson, H., Sigurdsson, E., Steinthorsdottir, V., Bjornsdottir, S., Sigmundsson, T., healthy controls. J Psychiatry Neurosci 34 (3), 181–186.
Ghosh, S., Brynjolfsson, J., Gunnarsdottir, S., Ivarsson, O., Chou, T.T., Hjaltason, O., Zhang, H.X., Li, W.Q., Zhang, Y., Zhao, J.P., Lv, L.X., Yang, G., 2009. Association analysis of
Birgisdottir, B., Jonsson, H., Gudnadottir, V.G., Gudmundsdottir, E., Bjornsson, A., neuregulin 1 gene polymorphism with schizophrenia in Chinese Han population.
Ingvarsson, B., Ingason, A., Sigfusson, S., Hardardottir, H., Harvey, R.P., Lai, D., Zhou, Zhonghua Yi Xue Yi Chuan Xue Za Zhi 26 (1), 16–20.
M., Brunner, D., Mutel, V., Gonzalo, A., Lemke, G., Sainz, J., Johannesson, G., Zuliani, R., Moorhead, T.W., Bastin, M.E., Johnstone, E.C., Lawrie, S.M., Brambilla, P.,
Andresson, T., Gudbjartsson, D., Manolescu, A., Frigge, M.L., Gurney, M.E., Kong, A., O'Donovan, M.C., Owen, M.J., Hall, J., McIntosh, A.M., 2011. Genetic variants in the
Gulcher, J.R., Petursson, H., Stefansson, K., 2002. Neuregulin 1 and susceptibility to ErbB4 gene are associated with white matter integrity. Psychiatry Res 191 (2),
schizophrenia. Am J Hum Genet 71 (4), 877–892. 133–137.

Please cite this article as: Moon, E., et al., Lack of association to a NRG1 missense polymorphism in schizophrenia or bipolar disorder in a
Costa Rican population, Schizophr. Res. (2011), doi:10.1016/j.schres.2011.06.024