Identification of Leaf Spot Causing Pathogen Through ITS Sequencing in Clove and It's Management Using Bioagents, Botanicals and Chemicals
Identification of Leaf Spot Causing Pathogen Through ITS Sequencing in Clove and It's Management Using Bioagents, Botanicals and Chemicals
Identification of Leaf Spot Causing Pathogen Through ITS Sequencing in Clove and It's Management Using Bioagents, Botanicals and Chemicals
ABSTRACT
Clove tree is mostly grown in the hilly tracts of Tamil and can be grown successfully in the red soils of the
Nadu and Kerala. The leaves of clove seedling and midlands of Kerala as well as in the hilly terrain of
grown up trees were frequently infected with leaf spot Western Ghats at higher elevations in Tamil Nadu.
disease. The pathogen inciting leaf spot disease was Leaf spot disease incidence in clove seedlings and
isolated and identified as grown up trees is a serious concern. Black to brown
Colletotrichumgloeosporioides based on ITS1 ITS1-5.8s, water soaked lesions appeared on the leaves with
ITS-22 rDNA sequence analysis. The present study circular yellow halo margin. In advanced stage, these
was concerned with bio agents, fungicides and spots enlarged, coalesced and resulted in bigger
botanicals which were tested against C. patches. Severely affected leaves wither, droop down
gloeosporioides. Among the bio agents, and dry up. In nursery seedlings, die back symptoms
sym
Trichodermaharzianum was found effective with were observed. Twigs were infected as the symptoms
72.22 % growth inhibition. Among the botanicals , extended from the leaves through petioles. The
garlic extract at 5% and 10% concentration levels was affected branches stand without leaves or only with
found to be effective with 56.66 and 62.66 % growth young leaves at tips. The objective of the present
inhibition respectively followed by ginger extract study was i) to isolate and identify the pathogen
48.88 and 49.66 % growth inhibition. Among associated with the leaf spot disease of clove. ii) to
chemicals,propiconazole (0.1% and 0.2%) was found screen potential bio control agents, botanicals and
to be the most effective fungicide in inhibiting 100 % fungicides for the inhibition of the leaf spot causing
growth of C. gloeosporioides followed by pathogen under in vitro condition.
hexaconazole with 87.44 and 88.55 % growth
inhibition at 0.1% and 0.2% respectively. Materials and methods:
Isolation and Identification of leaf spot causing
Keywords: Clove, Colletotrichumgloeosporioides, ITS pathogen.
sequencing, bioo agents, botanicals and fungicides. The infected leaves were collected from five different
locations of farmer’s clove field during survey.
INTRODUCTION Isolation was done in a Laminar-air-flow
Laminar chamber
The clove of commerce is the aromatic, dry, fully under aseptic condition. Infected host tissues were
grown, but un-opened
opened flower buds of the clove tree selected from the advancing
cing margin of the lesion, cut
(Syzygiumaromaticum) (Family: Myrtaceae
Myrtaceae). Clove into small pieces, placed in mercuric chloride (HgCl 2)
grows well in rich loamy soils of the humid tropics solution (0.1 per cent) for 1 min then washed with
Confirmation of Colletotrichumspp based on The Primers used for amplification of ITS region were
molecular techniques
Isolation of total genomic DNA from ITS1 - 5′ TCCGTAGGTGAACCTGCGG 3′ (forward
Colletotrichumspp. primer)
Total genomic DNA was isolated from C.
gloesporioides as described by Lee et al., (1988) for ITS4 - 5′ TCCTCCGCTTATTGATATGC3′ (reverse
fungi with slight modifications. The mycelium was primer)
grown in PDA broth for 2-3 days until the mycelial
growth covers the liquid broth. The mycelium was Sequencing of ITS and identification of
collected and filtered through cheese cloth. Hundred Colletotrichumgloeosporioides species by
mg of the mycelium was immersed in 95% ethanol for bioinformatics analysis.
5 min. The mycelium was squeezed and dried to The obtained DNA sequences were trimmed at 5’and
remove the excess ethanol and was ground using 3’ region where the sequencing chromatogram was
sterile pestle and mortar with a small pinch of not clear. Then DNA sequence, in which clear
sterilized sand. Then 0.75 ml of 2X CTAB buffer was chromatogram obtained was made in Fasta format.
added and mixed well. The 750 µl mixture was This was used as input sequence (Query sequence) in
transferred to sterile 2 ml centrifuge tubes and nucleotide blast analysis program at NCBI database.
incubated at 65°C for 25-30 min. To this mixture 750 The output data retrieved from the bioinformatics
µl of chloroform was added, vortexed and incubated were analysed and, the organism showing major score
for 5 min. The contents were centrifuged at 14,000 was considered as the closely related species to the
rpm for 15 min. The supernatant aqueous solution was test fungus used in the study.
collected and transferred to a new 1.5 ml tube and
equal amount of iso-propanol was added to the Effect of the growth of C.gloeosporioides– Dual
aqueous solution and incubated at -20 °C for 1 hour or culture technique (Fleming et al., 1975).
overnight for precipitation of DNA. The sample was The antagonistic effect of Pseudomonas sp. and
centrifuged at 14,000 rpm for 15 min to pellet the Bacillus sp. was tested against the C.gloeosporioides.
nucleic acids. The supernatant was discarded and Nine mm PDA culture disc of the pathogen was cut
pellet was washed 2 times with 70% ice cold ethanol individually from seven day old culture. This was
and dried or kept in water bath for 5 min at 37°C. placed at one side on the sterilized PDA previously
Finally, the isolated DNA was resuspended in 50 μl of plated in sterilized Petri dish. The pathogen was
distilled water or 1X TE buffer and stored at -20°C allowed to grow for three days. Actively growing
for further use. To verify the quality of isolated DNA, Pseudomonas sp. and Bacillus sp. cultures were
2.5µl of total DNA solution was resolved in the 1% separately streaked on the opposite side of the
agarose gel electrophoresis. pathogen after three days. Culture disc of
@ IJTSRD | Available Online @ www.ijtsrd.com | Volume – 2 | Issue – 5 | Jul-Aug 2018 Page: 518
International Journal of Trend in Scientific Research and Development (IJTSRD) ISSN: 2456-6470
Trichoderma spp. were placed on the opposite side of in each treatment over control was calculated using
the plates. Three replications for each treatment and the formula (Vincent, 1947) as described above.
suitable controls were maintained. The plates were
incubated at room temperature (28 ± 2ºC) for seven Results:
day. The mean diameter of the mycelial growth was Isolation and Identification of the pathogen
measured and the results were expressed in terms of Colletotrichumsp by molecular technique
per cent inhibition of the mycelium over control The pathogen was isolated from the infected portion
(Vincent, 1947). of the clove leaf collected from five different places
using potato dextrose agar (PDA) medium. The
C-T pathogen was sub cultured by single hyphal tip
I =x 100Where, I = Per cent inhibition over control, method. Initially the colour of the mycelium was
C found to be white, later changed to black. The
C= Growth in control, T= Growth in treatment. pathogen was taken 7- 10 days to cover the entire
Petri dish.
Effect of botanicals on the growth of
C.gloeosporioides– poisoned food technique The virulent isolate Cg3 was identified by
The botanical extract solutions were mixed with PDA morphological and culture characters at genus level
medium to obtain 5 and 10 per cent concentrations. and finally confirmed by molecular technique. ITS
Nine mm actively growing PDA culture disc of sequence analysis is one of the commonly used
C.gloeosporioides was cut by means of a sterilized molecular methods for the identification of fungi at
cork borer and placed at the centre of the medium. species level. DNA from Colletotrichumspp was
The plates were incubated at room temperature (28 ± isolated using CTAB method. Single band of intact
2ºC). PDA without botanical extract served as control. genomic DNA was visualised on the agarosegel. ITS
Three replications were maintained for individual region of C. gloeosporioides was amplified with
treatment. The radial growth of the mycelium was primers ITS 1 and ITS 4 using a thermo cycler and the
measured in treatments on 10th day after inoculation products produced were visualised as a single band in
when the fungus was fully grown (9 cm) in the control agarose gel strained with Ethidium bromide. The size
plate. The mean diameter of the mycelial growth of of the PCR fragments was approximately 550 bp
the pathogens was recorded and the results were length. (Fig.1)
expressed in terms of per cent inhibition of mycelium
over control. DNA sequence analysis of ITS region
ITS products of the C. gloeosporioides obtained by
In vitro efficacy of fungicides against the pathogens PCR were cleaned with PCR cleanup kit to remove
– Poisoned food technique the residual primers, polymerase and salts in the PCR
Under in vitro condition, different fungicides viz., product according to the protocol mentioned in the
Hexaconazole 5 % EC(Contaf), Propiconozole 25% manufacturer kit. Cleaned up PCR product was
EC (Tilt ), Metalaxyl 4 % + Mancozeb 64 % WG sequenced at Euro fins genomic Pvt, Ltd. The full
(Ridomil) , Mancozeb 75% WP (Indo Fil M-45), length of ITS sequences obtained for C.
Tebuconazole 50% + trifloxystrobin 25% (Nativo), gloeosporioides were BLAST searched in the
Azoxystrobin 23 % EC ( Amistar ), Carbendazim 12 database of National Centre for Biotechnology
% + Mancozeb 63% WP (SAAF ) and Carbendazim information (NCBI). When the ITS sequence of the C.
75% WP (Bavistin) were tested against the gloeosporioides was BLAST searched in the NCBI
C.gloeosporioides. The desired concentrations were data base, the output data showed matching sequences
obtained by adding appropriate amount of stock of C. gloeosporioides. Thus the virulent C.
solution of fungicides to potato dextrose agar taken in gloeosporioides isolate used in the present study was
conical flask and then transferred to petriplates and confirmed as C. gloeosporioides.
repeated thrice for each treatment. Potato dextrose
agar without fungicides served as control. Each plate In vitro evaluation of bio control agents against
was inoculated with a 9 mm mycelial disc of the C.gloeosporioides- (Dual culture technique)
pathogen taken from 7 day old culture. The inoculated There were significant differences among the two
plates were incubated at room temperature. The fungal bio agents. T.harzianum recorded the
colony diameter was recorded and per cent inhibition maximum fungal growth inhibition (72.22 %)
@ IJTSRD | Available Online @ www.ijtsrd.com | Volume – 2 | Issue – 5 | Jul-Aug 2018 Page: 519
International Journal of Trend in Scientific Research and Development (IJTSRD) ISSN: 2456-6470
followed by T.viride(67.44%). Among the bacterial C.gloeosporioides as far as the present study is
bio agents, Bacillus sp. (55.22 %) was found superior concerned .In this present study T. viride and T.
followed by P. fluorescens1 (40.77 %). Bacillussp, harzianum isolates were found to be effective in
was found to be more effective in mycelial growth inhibiting the mycelial growth of C. gloeosporioides
inhibition than P. fluorescens 1. Fungal bioagents T. while T. asperellum showed low inhibition followed
viride, T. harzianum isolates were found superior than by Bacillus cereus (52.52.4 %). Significant myco-
bacterial bio control agents. (Table 1) parasitism between T. viride, T. harzianum and T.
asperellum and anthracnose fungus leading to lysis of
Efficacy of botanicals on the growth of pathogen hyphae was also observed in vitro. This is
C.gloeosporioides in vitroat5 % and 10 % agreement with the findings of Mandhare et
Concentrations al.,(1996); Prashanth et al., (2008) ; Devamma et al.,
Among the ten plant extracts tested at 5 per cent (2012) and Pandey et al., (2012). Saju et al., (2012)
concentration, maximum percent inhibition of reported that Pseudomonassp was the most effective
mycelial growth (56.66 %) was recorded in garlic antagonist to inhibit mycelial growth of C.
bulb extract which was significantly superior to all gloeosporioides. In this present study, bulb extract of
other treatments, followed by ginger rhizome extract garlic was found effective against C. gloeosporioides
(48.88 %).The neem leaf extractrecordedminimal followed by rhizome extract of ginger. Three plant
mycelial growth inhibition(7.11%) of C. extracts namely Nagadhale, Simarouba and Lantana
gloeosporioides. At 10 per cent concentration of plant leaf extract showed more than 60 per cent inhibition
extracts, maximum inhibition (62.66 %) of mycelial of mycelial growth at 20% concentration.
growth was recorded in garlic bulb extract followed Effectiveness of Neem , Tulsi , Lantana and
by ginger rhizome extract (49.66 %). The least Pongamia leaf extract against C. gloeosporioides was
mycelial inhibition (12.66 %) was found in neem leaf also studied by many authoursviz., Jadhav et al.,
extract. (Table 2 ) (2008) ; Vinod et al., (2009) ; Watve et al., (2009) ;
Mukherjee et al., (2011) and Ademe et al., (2013).
In vitro evaluation of fungicides against
C.gloeosporioidesat0.1 % and 0.2 % concentrations In this present study, hexaconazole and propiconazole
(Poison food technique) even at 0.1% concentration were found effective
Totally eight fungicides were tested at 0.1 and 0.2 per against C.gloeosporioides. Most of the fungicides viz.,
cent concentrations against the mycelial growth of C. Hexaconazole, Propiconazole, Penconazole,
gloeosporioides under in vitro. Maximum inhibition Tebuconazole, Carbendazim, Azoxystrobin,
of pathogen growth was observed in plates Difenoconazole, Thifluzamide, Trifluoxystrobin
incorporated with propiconazole( 100%) and inhibited maximum mycelial growth at 0.2% but
hexaconazole (87.4% and 88.5%) at 0.1and 0.2 per decreased with reduced concentration such as 0.05
cent concentrations and were significantly superior to and 0.1 per cent. (Patel (2009) ; Vinod et al., (2009) ;
other fungicides and followed by Carbendazim 12 % Devamma et al., (2012) ; Pandey et al., (2012) and
+ Mancozeb 63% WP (86.6% and 87.4%).The least Saju et al., (2012).
per cent inhibition of fungus was recorded in
Carbendazim 50 % WP ( 4.11% and 4.44%). (Table References:
3) 1. Fleming, H., Etchells, J., & Costilow, R. (1975).
Microbial inhibition by an isolate of Pediococcus
Discussion: from cucumber brines. Applied Microbiology,
The isolate of the pathogen was brought from the 30(6), 1040-1042.
locality and maintained as pure culture. Based on
morphological, cultural characters and pathogen city 2. Vincent, J. (1947). Distortion of fungal hyphae in
the pathogen was identified as C. gloeosporioides. the presence of certain inhibitors. Nature,
Similar studies were conducted byPrashanth (2007). 159(4051), 850.
3. Mandhare, V., Pawar, B., & Kulkarni, S. (1996).
The bio control agent, T.harzianumisolate was best in Efficacy of fungicides against fruit spot of
inhibiting the mycelial growth of C. gloeosporioides pomegranate. Pestology, 20(2), 19-20.
followed by T. viridew here as P. fluorescens
exhibited the lowest inhibition against 4. Ademe, A., Ayalew, A., &Woldetsadik, K.
(2013). Evaluation of antifungal activity of plant
@ IJTSRD | Available Online @ www.ijtsrd.com | Volume – 2 | Issue – 5 | Jul-Aug 2018 Page: 520
International Journal of Trend in Scientific Research and Development (IJTSRD) ISSN: 2456-6470
extracts against papaya anthracnose 14. Watve, Y., Diwakar, M., &Kadam, J. (2009). An
(Colletotrichumgloeosporioides).Journal of Plant evaluation of some bio agents and plant extracts
Pathology & Microbiology, 4(10), 1. against leaf spot of Jatropha caused by
Colletotrichumgloeosporioides Penz. Journal of
5. Devamma, M. N., Rajkumari, J. P., & Devi, P. S.
Plant Disease Sciences, 4(1), 95-98.
(2012).Fungicide compatible potential biocontrol
agents against Colletotrichumgloeosporioides Fig.1 Isolation of gDNA and amplification ITS
Penz. causing mango anthracnose. Current region from Colletotrichum sp.
Biotica, 5(4), 454-464.
1 2
6. Jadhav, S., Diwakar, M., Sawant, U., &Kadam, J.
(2008). Management of leaf spot disease of
Kokum (Garciniaindica) incited by
Colletotrichumgloeosporioides Penz. Journal of
Plant Disease Sciences, 3(2), 193-196. 12.0 kb gDNA
@ IJTSRD | Available Online @ www.ijtsrd.com | Volume – 2 | Issue – 5 | Jul-Aug 2018 Page: 521
International Journal of Trend in Scientific Research and Development (IJTSRD) ISSN: 2456-6470
2456
Table1. In vitro evaluation of biocontrol agents against C.gloeosporioides- (Dual culture technique)
The treatment means are compared using Duncan Multiple Range Test (DMRT).
In a column, means followed by a common letter (s) are not significantly different (P=0.05).
The treatment means are compared using Duncan Multiple Range Test (DMRT).
In a column, means followed by a common letter (s) are not significantly different (P=0.05).
@ IJTSRD | Available Online @ www.ijtsrd.com | Volume – 2 | Issue – 5 | Jul-Aug 2018 Page: 523