Methods in

Molecular Biology 1296

Mathieu Rederstorff Editor

Small
Non-Coding
RNAs
Methods and Protocols
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes:

http://www.springer.com/series/7651
 Small Non-Coding RNAs
Methods and Protocols

Edited by

Mathieu Rederstorff
Université de Lorraine, Biopôle, CNRS UMR 7365, IMoPA, Vandoeuvre-lès-Nancy, France
Editor
Mathieu Rederstorff
Université de Lorraine, Biopôle, CNRS
UMR 7365, IMoPA
Vandoeuvre-lès-Nancy, France

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-4939-2546-9 ISBN 978-1-4939-2547-6 (eBook)
DOI 10.1007/978-1-4939-2547-6

Library of Congress Control Number: 2015934152

Springer New York Heidelberg Dordrecht London

© Springer Science+Business Media New York 2015
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.

Printed on acid-free paper

Humana Press is a brand of Springer

Springer Science+Business Media LLC New York is part of Springer Science+Business Media (www.springer.com)
Preface

The reality of pervasive transcription, or the fact that most if not the whole human genome
is being actively transcribed, is still debated. However, while only about 1.2 % of the human
genome encode for protein coding genes, it is well admitted now that a vast majority of
transcripts corresponds to non-protein coding transcripts, the so-called non-coding RNAs
(ncRNAs). While more and more (very) long non-coding RNAs (lincRNAs) are being
identified, with sizes up to several kilobases, most non-coding RNAs known to date are
rather small, with sizes ranging from 20 or less to 200 nucleotides. The discovery of the
fascinating class of microRNAs (miRNAs) about a decade ago as well as the availabilities of
genome sequences and progresses in next-generation sequencing techniques dramatically
boosted the attention of researchers in the field.
We now know that the many classes of small non-coding RNAs are involved in all bio-
logical pathways, such as RNA processing or modification, gene expression regulation at
the transcriptional or posttranscriptional levels, translation, or even protein secretion.
However, our actual knowledge is only the tip of the iceberg. Many questions are yet to be
answered, especially regarding the implications, direct or indirect, of small non-coding
RNAs with numerous disorders, suggesting more and more their possible and powerful
usage as diagnostic markers and/or therapeutic tools or targets.
Owing to their small sizes, tridimensional structures, low abundances, or differential
expression levels, small non-coding RNAs require customized dedicated protocols for their
identification and study, compared, for instance, to messenger RNAs (mRNAs).
Small Non-coding RNAs: Methods and Protocols is a laboratory protocols book dedi-
cated to biochemists or cellular/molecular biologists, already working in the field of RNA
biology or willing to start studying small non-coding RNAs in their projects. It describes
basic as well as more sophisticated, state-of-the-art methods to tackle all aspects of small
non-coding RNAs biology, from their identification or biogenesis to their use in therapeu-
tics. This survey of technologies will be of valuable help to all those willing to contribute
deciphering the numerous functions of small non-coding RNAs.
I thank all the authors and editors for their outstanding contributions to this volume.

Vandoeuvre-lès-Nancy, France Mathieu Rederstorff

v
Contents

Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

PART I INTRODUCTION TO SMALL NON-CODING RNAS

1 Small Non-Coding RNAs: A Quick Look in the Rearview Mirror . . . . . . . . . . 3
Guillaume Clerget, Yoann Abel, and Mathieu Rederstorff
2 Alcoholic Precipitation of Small Non-Coding RNAs . . . . . . . . . . . . . . . . . . . . 11
Guillaume Clerget, Valérie Bourguignon-Igel, and Mathieu Rederstorff
3 Quantification and Quality Control of a Small Non-Coding
RNA Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
Virginie Marchand and Christiane Branlant
4 Impact of RNA Isolation Protocols on RNA Detection
by Northern Blotting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
Katrin Damm, Simone Bach, Katrin M.H. Müller, Gabriele Klug,
Olga Y. Burenina, Elena A. Kubareva, Arnold Grünweller,
and Roland K. Hartmann

PART II VISUALIZATION AND ANALYSIS OF SMALL NON-CODING RNAS

5 Improved Northern Blot Detection of Small RNAs Using EDC
Crosslinking and DNA/LNA Probes. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
Katrin Damm, Simone Bach, Katrin M.H. Müller, Gabriele Klug,
Olga Y. Burenina, Elena A. Kubareva, Arnold Grünweller,
and Roland K. Hartmann
6 Direct Cloning of Double-Stranded RNAs . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
Manli Shen, Marina Falaleeva, Natalia Korotkova, and Stefan Stamm
7 Detection and Labeling of Small Non-Coding RNAs by Splinted Ligation. . . . 65
Gabrielle Bourgeois, Florian Chardon, Anne-Sophie Tillault,
and Magali Blaud
8 Fluorescence In Situ Hybridization of Small Non-Coding RNAs . . . . . . . . . . . 73
Valentin Vautrot, Christelle Aigueperse, Christiane Branlant,
and Isabelle Behm-Ansmant
9 RT-qPCR-Based Quantification of Small Non-Coding RNAs . . . . . . . . . . . . . 85
Fjoralba Zeka, Pieter Mestdagh, and Jo Vandesompele
10 Stem-Loop RT-PCR Based Quantification of Small Non-Coding RNAs . . . . . 103
Véronique Salone and Mathieu Rederstorff
11 miR-RACE: An Effective Approach to Accurately Determine
the Sequence of Computationally Identified miRNAs . . . . . . . . . . . . . . . . . . . 109
Chen Wang and Jinggui Fang

vii
viii Contents

12 Probing Small Non-Coding RNAs Structures . . . . . . . . . . . . . . . . . . . . . . . . . 119

Jean-Vincent Philippe, Lilia Ayadi, Christiane Branlant,
and Isabelle Behm-Ansmant

PART III HIGH-THROUGHPUT APPROACHES TO STUDY NON-CODING RNAS

13 cDNA Library Generation for the Analysis of Small RNAs
by High-Throughput Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 139
Jennifer Gebetsberger, Roger Fricker, and Norbert Polacek
14 CLIP-Seq to Discover Transcriptome-Wide Imprinting
of RNA Binding Proteins in Living Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 151
Jérôme Saulière and Hervé Le Hir
15 Microarray Analysis of Small Non-Coding RNAs. . . . . . . . . . . . . . . . . . . . . . . 161
Michael Karbiener and Marcel Scheideler

PART IV SMALL NON-CODING RNAS APPLICATIONS

16 RLM-RACE, PPM-RACE, and qRT-PCR: An Integrated Strategy
to Accurately Validate miRNA Target Genes . . . . . . . . . . . . . . . . . . . . . . . . . . 175
Chen Wang and Jinggui Fang
17 Dual Luciferase Gene Reporter Assays to Study miRNA Function . . . . . . . . . . 187
Thomas Clément, Véronique Salone, and Mathieu Rederstorff
18 Gene Expression Knockdown by Transfection of siRNAs
into Mammalian Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
Yoann Abel and Mathieu Rederstorff
19 Efficient and Selective Knockdown of Small Non-Coding RNAs . . . . . . . . . . . 203
Xue-Hai Liang, Wen Shen, and Stanley T. Crooke
20 Cell-SELEX: In Vitro Selection of Synthetic Small Specific Ligands . . . . . . . . . 213
Helena Dickinson, Melanie Lukasser, Günter Mayer,
and Alexander Hüttenhofer
21 Small Non-Coding RNAs and Aptamers in Diagnostics and Therapeutics . . . . 225
Marissa Leonard, Yijuan Zhang, and Xiaoting Zhang

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235
Contributors

YOANN ABEL • CNRS UMR 7365 IMoPA, Université de Lorraine, Vandoeuvre-lès-Nancy,

France
CHRISTELLE AIGUEPERSE • CNRS UMR 7365 IMoPA, Université de Lorraine,
Vandoeuvre-lès-Nancy, France
LILIA AYADI • CNRS UMR 7365 IMoPA, Université de Lorraine, Vandoeuvre-lès-Nancy,
France
SIMONE BACH • Institut für Pharmazeutische Chemie, Philipps-Universität Marburg,
Marburg, Germany
ISABELLE BEHM-ANSMANT • CNRS UMR 7365 IMoPA, Université de Lorraine,
Vandoeuvre-lès-Nancy, France
MAGALI BLAUD • Laboratoire de Cristallographie et RMN Biologiques, CNRS UMR 8015,
Université Paris Descartes, Paris, France
GABRIELLE BOURGEOIS • Laboratoire de Biochimie, CNRS UMR 7654, Ecole Polytechnique,
Palaiseau, France
VALERIE BOURGUIGNON-IGEL • CNRS UMR 7365 IMoPA, Université de Lorraine,
Vandoeuvre-lès-Nancy, France
CHRISTIANE BRANLANT • CNRS UMR 7365 IMoPA, Université de Lorraine,
Vandoeuvre-lès-Nancy, France; Centre Hospitalier Universitaire de Nancy,
Vandoeuvre-lès-Nancy, France
OLGA Y. BURENINA • Chemistry Department and A.N. Belozersky Institute
of Physico-Chemical Biology, M.V. Lomonosov Moscow State University, Moscow, Russia
FLORIAN CHARDON • Laboratoire de Cristallographie et RMN Biologiques, CNRS UMR 8015,
Université Paris Descartes, Paris, France
THOMAS CLÉMENT • CNRS UMR 7365 IMoPA, Université de Lorraine, Vandoeuvre-lès-Nancy,
France
GUILLAUME CLERGET • CNRS UMR 7365 IMoPA, Université de Lorraine,
Vandoeuvre-lès-Nancy, France
STANLEY T. CROOKE • Department of Core Antisense Research, ISIS Pharmaceuticals Inc.,
Carlsbad, CA, USA
KATRIN DAMM • Institut für Pharmazeutische Chemie, Philipps-Universität Marburg,
Marburg, Germany
HELENA DICKINSON • Center of Chemistry & Biomedicine, Innsbruck Medical University,
Innsbruck, Austria
MARINA FALALEEVA • University of Kentucky, Lexington, KY, USA
JINGGUI FANG • College of Horticulture, Nanjing Agricultural University, Nanjing, China
ROGER FRICKER • Department of Chemistry and Biochemistry, Graduate School for Cellular
and Biomedical Sciences, University of Bern, Bern, Switzerland
JENNIFER GEBETSBERGER • Department of Chemistry and Biochemistry, Graduate School
for Cellular and Biomedical Sciences, University of Bern, Bern, Switzerland
ARNOLD GRÜNWELLER • Institut für Pharmazeutische Chemie, Philipps-Universität
Marburg, Marburg, Germany

ix
x Contributors

ROLAND K. HARTMANN • Institut für Pharmazeutische Chemie, Philipps-Universität

Marburg, Marburg, Germany
HERVÉ LE HIR • Ecole Normale Supérieure, Institut de Biologie de l’ENS (IBENS),
Inserm U1024, and CNRS UMR 8197, Paris, France
ALEXANDER HÜTTENHOFER: • Center of Chemistry & Biomedicine, Innsbruck Medical
University, Innsbruck, Austria
MICHAEL KARBIENER • RNA Biology Group, Institute of Molecular Biotechnology,
Graz University of Technology, Graz, Austria
GABRIELE KLUG • Institut für Mikrobiologie und Molekularbiologie,
Justus-Liebig-Universität Gießen, Gießen, Germany
NATALIA KOROTKOVA • University of Kentucky, Lexington, KY, USA
ELENA A. KUBAREVA • Chemistry Department and A.N. Belozersky Institute
of Physico-Chemical Biology, M.V. Lomonosov Moscow State University, Moscow, Russia
MARISSA LEONARD • Department of Cancer Biology, Graduate Program in Cancer
and Cell Biology, Vontz Center for Molecular Studies, University of Cincinnati College
of Medicine, Cincinnati, OH, USA
XUE-HAI LIANG • Department of Core Antisense Research, ISIS Pharmaceuticals Inc.,
Carlsbad, CA, USA
MELANIE LUKASSER • Center of Chemistry & Biomedicine, Innsbruck Medical University,
Innsbruck, Austria
VIRGINIE MARCHAND • Centre Hospitalier Universitaire de Nancy, Nancy, France; CNRS
UMR 7365 IMoPA, Université de Lorraine, Vandoeuvre-lès-Nancy, France
GÜNTER MAYER • Life & Medical Sciences Institute (LIMES), Chemical Biology, University
of Bonn, Bonn, Germany
PIETER MESTDAGH • Center for Medical Genetics, Ghent University, Ghent, Belgium
KATRIN M.H. MÜLLER • Institut für Mikrobiologie und Molekularbiologie,
Justus-Liebig-Universität Gießen, Gießen, Germany
JEAN-VINCENT PHILIPPE • CNRS UMR 7365 IMoP, Université de Lorraine,
Vandoeuvre-lès-Nancy, France
NORBERT POLACEK • Department of Chemistry and Biochemistry, University of Bern, Bern,
Switzerland
MATHIEU REDERSTORFF • Université de Lorraine, Biopôle, CNRS UMR 7365, IMoPA,
Vandoeuvre-lès-Nancy, France
VÉRONIQUE SALONE • CNRS UMR 7365 IMoPA, Université de Lorraine,
Vandoeuvre-lès-Nancy, France
JÉRÔME SAULIÈRE • Ecole Normale Supérieure, Institut de Biologie de l’ENS (IBENS), Inserm
U1024, and CNRS UMR 8197, Paris, France
MARCEL SCHEIDELER • Institute for Diabetes and Cancer (IDC), Helmholtz Zentrum
München, Neuherberg, Germany; German Center for Diabetes Research (DZD),
Neuherberg, Germany
MANLI SHEN • University of Kentucky, Lexington, KY, USA
WEN SHEN • Department of Core Antisense Research, ISIS Pharmaceuticals Inc., Carlsbad,
CA, USA
STEFAN STAMM • University of Kentucky, Lexington, KY, USA
ANNE-SOPHIE TILLAULT • Department of Chemistry and Biochemistry, Alberta RNA
Research and Training Institute, University of Lethbridge, Lethbridge, AB, Canada
JO VANDESOMPELE • Center for Medical Genetics, Ghent University, Ghent, Belgium
 Contributors xi

VALENTIN VAUTROT • CNRS UMR 7365 IMoPA, Université de Lorraine,

Vandoeuvre-lès-Nancy, France
CHEN WANG • College of Horticulture, Nanjing Agricultural University, Nanjing, China
FJORALBA ZEKA • Center for Medical Genetics, Ghent University, Ghent, Belgium
XIAOTING ZHANG • Department of Cancer Biology, Vontz Center for Molecular Studies,
Cincinnati Cancer Center, University of Cincinnati College of Medicine, Cincinnati,
OH, USA
YIJUAN ZHANG • Department of Cancer Biology, University of Cincinnati College
of Medicine, Cincinnati, OH, USA
 Part I

Introduction to Small Non-Coding RNAs

 Chapter 1

Small Non-Coding RNAs: A Quick Look

in the Rearview Mirror
Guillaume Clerget, Yoann Abel, and Mathieu Rederstorff

Abstract
The revolution of miRNA discovery, in the early 2000s, shed a new light in the exciting field of small
non-coding RNAs. Since then, and owing to outstanding breakthroughs in RNomic techniques, novel
small non-coding RNA families have been regularly discovered, e.g., piRNAs, tiRNAs, and many others.
In this review, we provide a very succinct historical and functional overview on most prominent small
non-coding RNA families.

Key words miRNA, snoRNA, piRNA, tRNA, rRNA, tiRNA, snRNA

1 Introduction

1.1 Dawn of Small It has been more than 60 years that the first soluble cytoplasmic
Non-Coding RNAs small non-coding RNA (sncRNA), a yeast alanine transfer RNA
(tRNA), was identified and its primary structure determined [1, 2].
Together with ribosomal RNAs (rRNA), the nucleic acid moieties of
the ribosomes, tRNAs play a central role in protein synthesis, as the
adaptor molecules providing the correct amino acid in response to a
specific codon on the mRNA [3]. Only 20 years later were the first
nuclear RNAs uncovered: uridine-rich RNAs, or U-RNAs, were
observed to be very abundant, nucleus or sometimes even nucleolus
specific, and highly conserved [4, 5]; small nuclear RNAs (snRNA)
U1, U2, U4, U5, and U6 were later shown to be involved in splic-
ing, in association with several proteins within a ribonucleoprotein
particle (RNP) called spliceosome [6]. Base pairing among snRNAs
and between snRNAs and pre-messenger RNA (pre-mRNA) regions
account for the proper conformation of both spliceosome and pre-
mRNA, eventually leading to release of the introns and mature
mRNAs [7]. Interestingly, most small nucleolar RNAs (snoRNAs)
are processed from the released introns [8]. Within snoRNPs,

Author contributed equally with all other contributors.

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_1, © Springer Science+Business Media New York 2015

3
4 Guillaume Clerget et al.

snoRNAs guide posttranscriptional RNA modifications of other

ncRNAs, e.g., rRNAs and snRNAs: 2′-O-methylations for C/D box
snoRNAs and pseudouridylation for H/ACA box snoRNAs. Some
snoRNAs, such as U3 or U8, are instead involved in early cleavages
of pre-rRNA during ribosome biogenesis in the nucleolus [9].
In the late 1990s, pioneering studies aimed at identifying novel
non-coding RNAs using experimental approaches combining
library generation and sequencing identified numerous novel
snoRNAs in various models including human, using material that
was usually discarded: small total RNA in the size range of 50–500
nucleotides [10]. At that time, why would one have looked for
smaller functional RNAs? It would both have been nonsense and a
waste of time. Nonsense? Actually no… antisense!

1.2 miRNAs: In the early 1990s, the lin-14 gene was shown to be involved in
The Revolution! temporal development in the worm C. elegans. The lin-4 gene
product, most probably a polypeptide, was shown to negatively
regulate lin-14 expression by directly acting on the 3′ untranslated
region of its pre-mRNA [11]. In 1993, both Ambros and Ruvkun
labs discovered that the lin-4 gene product actually was a small
non-coding RNA, of 22 nucleotides in length in its mature form,
targeting the 3′ UTR of the lin-14 pre-mRNA several times, owing
to imperfect antisense base pairing [12, 13]. Unfortunately
enough, apparently, the lin-4 small RNA neither had additional
counterparts in worm nor was it found to be conserved in other
species. However, in 2000, Pasquinelli and coworkers identified
that let-7, another 22-nucleotide-long small temporal RNA
(stRNA) involved in C. elegans developmental timing, was con-
served in human and drosophila, anticipating the likely discovery
of many other small regulatory RNAs [14]. Revolution came less
than 1 year later, when Tuschl, Bartel, and Ambros labs reported,
in the same issue of Science, the observation of an abundant class
of novel small regulatory RNAs in worm, human, and drosophila,
termed since microRNAs (miRNAs) [15–17]. Even certain viruses
were next shown to encode their own miRNAs [18, 19].
It was rapidly observed that the miRNA maturation and assem-
bly machinery were the same as the one implicated in the forma-
tion of short interfering RNAs (siRNAs), involved in the RNA
interference (RNAi) pathway described in worm a couple of years
earlier by the 2006 Nobel Prize awardees Andrew Fire and Craig
Mello [20, 21] and even earlier in plants [22]. miRNA/siRNA
maturation, from a double-stranded precursor, is now well under-
stood [23] but still open to surprises; recently it was discovered
that miRNAs could be processed from other types of ncRNAs,
such as snoRNAs [24, 25].
In human, siRNAs, within the RNA-induced silencing complex
(RISC), mediate perfectly complementary mRNA target cleavages
 ncRNAs Overview 5

[26, 27]. On the other hand, miRNAs regulate gene expression by

imperfectly base pairing to the 3′ UTR of the targeted mRNA,
repressing its translation, which eventually leads to the mRNA
decay by different possible mechanisms [28, 29]. miRNAs can act
as regulators of epigenetic modifications as well, via DNA or his-
tone modifications, therefore controlling gene expression at the
transcriptional level [30].

1.3 Small Another sncRNA family, the Piwi-interacting RNAs (piRNA), dis-
Non-Coding RNAs covered about half a decade after miRNAs, also regulates transcrip-
Return! tion [31]. piRNAs are 27–29-nucleotide-long RNAs. They prevent
transposon dissemination in germinal cell lines, owing to an original
“ping-pong” mechanism [32, 33]. The smallest eukaryotic ncRNAs
known to date, the transcription initiation RNAs (tiRNAs), sized
17–18 nucleotides, are generated upon stalling or backtracking of
RNA polymerase II (RNAPII) near the transcription start sites
(TSSs) and might be involved in transcription initiation regulation as
well [34, 35]. TSSs appear to be the source of bunches of small and
long non-coding RNAs (lncRNAs) [36], such as transcription start
site-associated RNAs (TSSa-RNAs) and promoter-associated RNAs
(PASRs) in animals [37] or promoter upstream transcripts
(PROMPTs) [38] and cryptic/Xrn1-sensitive unstable transcripts
(CUTs/XUTs) in yeast [39–41]. While lncRNAs are generally
involved in epigenetic and chromatin modifications [42–44], the
functionality of short transcripts is debated. They might be involved
in maintaining chromatin into a transcriptionally active state or in
maintaining RNAPII available near TSSs [45].

1.4 Small Most if not all the human genome appears to be actively tran-
Non-Coding RNA: scribed [46–48]. Nevertheless, most transcripts rather belong to
Not the End the TUF (transcripts of unknown function) rather than to the
ncRNA family. Progresses in transcriptomics/RNomics enabled
the identification of thousands of short and long transcripts [49–55].
Many of them were attributed a function but it is only the top of
the iceberg. Whether every TUF is indeed functional is debated,
and experimental efforts will be mandatory to answer this
question.
There are no doubts that novel ncRNAs and novel ncRNA
families will still be discovered in the (next) future.

Acknowledgment

This work was supported by the Centre National pour la Recherche

Scientifique, the Université de Lorraine, the Région Lorraine and
La Ligue contre le Cancer.
6 Guillaume Clerget et al.

References
1. Holley RW, Apgar J, Doctor BP (1960) mentarity to lin-14. Cell 75(5):843–854, doi:
Separation of amino acid-specific “soluble”- 0092-8674(93)90529-Y [pii]
fraction ribonucleic acids. Ann N Y Acad Sci 13. Wightman B, Ha I, Ruvkun G (1993)
88:745–751 Posttranscriptional regulation of the heteroch-
2. Holley RW, Apgar J, Everett GA, Madison JT, ronic gene lin-14 by lin-4 mediates temporal
Marquisee M, Merrill SH, Penswick JR, Zamir pattern formation in C. elegans. Cell 75(5):855–
A (1965) Structure of a ribonucleic acid. 862, doi: 0092-8674(93)90530-4 [pii]
Science 147(3664):1462–1465 14. Pasquinelli AE, Reinhart BJ, Slack F,
3. Eddy SR (2001) Non-coding RNA genes and Martindale MQ, Kuroda MI, Maller B,
the modern RNA world. Nat Rev Genet Hayward DC, Ball EE, Degnan B, Muller P,
2(12):919–929. doi:10.1038/35103511, Spring J, Srinivasan A, Fishman M, Finnerty J,
35103511 [pii] Corbo J, Levine M, Leahy P, Davidson E,
4. Busch H, Reddy R, Rothblum L, Choi YC Ruvkun G (2000) Conservation of the
(1982) SnRNAs, SnRNPs, and RNA process- sequence and temporal expression of let-7 het-
ing. Annu Rev Biochem 51:617–654. erochronic regulatory RNA. Nature
doi:10.1146/annurev.bi.51.070182.003153 408(6808):86–89. doi:10.1038/35040556
5. Weinberg RA, Penman S (1968) Small molec- 15. Lagos-Quintana M, Rauhut R, Lendeckel W,
ular weight monodisperse nuclear RNA. J Tuschl T (2001) Identification of novel genes
Mol Biol 38(3):289–304, doi:0022- coding for small expressed RNAs. Science
2836(68)90387-2 [pii] 294(5543):853–858. doi:10.1126/sci-
6. Lerner MR, Steitz JA (1979) Antibodies to ence.1064921, 294/5543/853 [pii]
small nuclear RNAs complexed with proteins 16. Lau NC, Lim LP, Weinstein EG, Bartel DP
are produced by patients with systemic lupus (2001) An abundant class of tiny RNAs with
erythematosus. Proc Natl Acad Sci U S A probable regulatory roles in Caenorhabditis
76(11):5495–5499 elegans. Science 294(5543):858–862.
7. Lerner MR, Boyle JA, Mount SM, Wolin SL, doi:10.1126/science.1065062, 294/5543/
Steitz JA (1980) Are snRNPs involved in splic- 858 [pii]
ing? Nature 283(5743):220–224 17. Lee RC, Ambros V (2001) An extensive class
8. Matera AG, Terns RM, Terns MP (2007) Non- of small RNAs in Caenorhabditis elegans.
coding RNAs: lessons from the small nuclear Science 294(5543):862–864. doi:10.1126/
and small nucleolar RNAs. Nat Rev Mol Cell science.1065329, 294/5543/862 [pii]
Biol 8(3):209–220. doi:10.1038/nrm2124, 18. Nathans R, Chu CY, Serquina AK, Lu CC,
nrm2124 [pii] Cao H, Rana TM (2009) Cellular microRNA
9. Marmier-Gourrier N, Clery A, Schlotter F, and P bodies modulate host-HIV-1 interac-
Senty-Segault V, Branlant C (2011) A second tions. Mol Cell 34(6):696–709. doi:10.1016/j.
base pair interaction between U3 small nucleo- molcel.2009.06.003, S1097-
lar RNA and the 5′-ETS region is required for 2765(09)00394-3 [pii]
early cleavage of the yeast pre-ribosomal 19. Pfeffer S, Zavolan M, Grasser FA, Chien M,
RNA. Nucleic Acids Res 39(22):9731–9745. Russo JJ, Ju J, John B, Enright AJ, Marks D,
doi:10.1093/nar/gkr675, gkr675 [pii] Sander C, Tuschl T (2004) Identification of
10. Huttenhofer A, Kiefmann M, Meier-Ewert S, virus-encoded microRNAs. Science
O′Brien J, Lehrach H, Bachellerie JP, Brosius 304(5671):734–736. doi:10.1126/sci-
J (2001) RNomics: an experimental approach ence.1096781, 304/5671/734 [pii]
that identifies 201 candidates for novel, 20. Fire A, Xu S, Montgomery MK, Kostas SA,
small, non-messenger RNAs in mouse. Driver SE, Mello CC (1998) Potent and spe-
EMBO J 20(11):2943–2953. doi:10.1093/ cific genetic interference by double-stranded
emboj/20.11.2943 RNA in Caenorhabditis elegans. Nature
11. Wightman B, Burglin TR, Gatto J, Arasu P, 391(6669):806–811. doi:10.1038/35888
Ruvkun G (1991) Negative regulatory 21. Hutvagner G, McLachlan J, Pasquinelli AE, Balint
sequences in the lin-14 3′-untranslated region E, Tuschl T, Zamore PD (2001) A cellular func-
are necessary to generate a temporal switch tion for the RNA-interference enzyme Dicer in the
during Caenorhabditis elegans development. maturation of the let-7 small temporal
Genes Dev 5(10):1813–1824 RNA. Science 293(5531):834–838. doi:10.1126/
12. Lee RC, Feinbaum RL, Ambros V (1993) science.1062961, 1062961 [pii]
The C. elegans heterochronic gene lin-4 22. Napoli C, Lemieux C, Jorgensen R (1990)
encodes small RNAs with antisense comple- Introduction of a chimeric chalcone synthase
 ncRNAs Overview 7

gene into petunia results in reversible 33. Siomi MC, Sato K, Pezic D, Aravin AA (2011)
co-suppression of homologous genes in trans. PIWI-interacting small RNAs: the vanguard of
Plant Cell 2(4):279–289. doi:10.1105/ genome defence. Nat Rev Mol Cell Biol
tpc.2.4.279, 2/4/279 [pii] 12(4):246–258. doi:10.1038/nrm3089,
23. Bartel DP (2004) MicroRNAs: genomics, nrm3089 [pii]
biogenesis, mechanism, and function. Cell 34. Taft RJ, Glazov EA, Cloonan N, Simons C,
116(2):281–297, doi: S0092867404000455 Stephen S, Faulkner GJ, Lassmann T, Forrest
[pii] AR, Grimmond SM, Schroder K, Irvine K,
24. Ender C, Krek A, Friedlander MR, Beitzinger Arakawa T, Nakamura M, Kubosaki A,
M, Weinmann L, Chen W, Pfeffer S, Rajewsky Hayashida K, Kawazu C, Murata M, Nishiyori
N, Meister G (2008) A human snoRNA with H, Fukuda S, Kawai J, Daub CO, Hume DA,
microRNA-like functions. Mol Cell 32(4):519– Suzuki H, Orlando V, Carninci P, Hayashizaki
528. doi:10.1016/j.molcel.2008.10.017, Y, Mattick JS (2009) Tiny RNAs associated
S1097-2765(08)00733-8 [pii] with transcription start sites in animals. Nat
25. Rother S, Meister G (2011) Small RNAs Genet 41(5):572–578. doi:10.1038/ng.312,
derived from longer non-coding RNAs. ng.312 [pii]
Biochimie 93(11):1905–1915. doi:10.1016/j. 35. Valen E, Preker P, Andersen PR, Zhao X, Chen
biochi.2011.07.032, S0300-9084(11)00290-2 Y, Ender C, Dueck A, Meister G, Sandelin A,
[pii] Jensen TH (2011) Biogenic mechanisms and
26. Tuschl T, Zamore PD, Lehmann R, Bartel DP, utilization of small RNAs derived from human
Sharp PA (1999) Targeted mRNA degradation protein-coding genes. Nat Struct Mol Biol
by double-stranded RNA in vitro. Genes Dev 18(9):1075–1082. doi:10.1038/nsmb.2091,
13(24):3191–3197 nsmb.2091 [pii]
27. Zamore PD, Tuschl T, Sharp PA, Bartel DP 36. Jacquier A (2009) The complex eukaryotic
(2000) RNAi: double-stranded RNA directs transcriptome: unexpected pervasive transcrip-
the ATP-dependent cleavage of mRNA at 21 tion and novel small RNAs. Nat Rev Genet
to 23 nucleotide intervals. Cell 101(1):25–33. 10(12):833–844. doi:10.1038/nrg2683,
doi: 10.1016/S0092-8674(00)80620-0 , nrg2683 [pii]
S0092-8674(00)80620-0 [pii] 37. Seila AC, Calabrese JM, Levine SS, Yeo GW,
28. Braun JE, Huntzinger E, Izaurralde E (2013) Rahl PB, Flynn RA, Young RA, Sharp PA
The role of GW182 proteins in miRNA- (2008) Divergent transcription from active
mediated gene silencing. Adv Exp Med Biol promoters. Science 322(5909):1849–1851.
768:147–163. doi:10.1007/978-1-4614- doi:10.1126/science.1162253, 1162253 [pii]
5107-5_9 38. Flynn RA, Almada AE, Zamudio JR, Sharp PA
29. Eulalio A, Tritschler F, Izaurralde E (2009) (2011) Antisense RNA polymerase II diver-
The GW182 protein family in animal cells: gent transcripts are P-TEFb dependent and
new insights into domains required for substrates for the RNA exosome. Proc Natl
miRNA-mediated gene silencing. RNA Acad Sci U S A 108(26):10460–10465.
15(8):1433–1442. doi:10.1261/rna.1703809, doi:10.1073/pnas.1106630108, 1106630108
rna.1703809 [pii] [pii]
30. Verdel A, Jia S, Gerber S, Sugiyama T, Gygi S, 39. Neil H, Malabat C, d’ Aubenton-Carafa Y, Xu
Grewal SI, Moazed D (2004) RNAi-mediated Z, Steinmetz LM, Jacquier A (2009)
targeting of heterochromatin by the RITS Widespread bidirectional promoters are the
complex. Science 303(5658):672–676. major source of cryptic transcripts in yeast.
doi:10.1126/science.1093686, 1093686 [pii] Nature 457(7232):1038–1042. doi:10.1038/
nature07747, nature07747 [pii]
31. Aravin A, Gaidatzis D, Pfeffer S, Lagos-
Quintana M, Landgraf P, Iovino N, Morris P, 40. van Dijk EL, Chen CL, d’Aubenton-Carafa Y,
Brownstein MJ, Kuramochi-Miyagawa S, Gourvennec S, Kwapisz M, Roche V, Bertrand
Nakano T, Chien M, Russo JJ, Ju J, Sheridan C, Silvain M, Legoix-Ne P, Loeillet S, Nicolas
R, Sander C, Zavolan M, Tuschl T (2006) A A, Thermes C, Morillon A (2011) XUTs are a
novel class of small RNAs bind to MILI protein class of Xrn1-sensitive antisense regulatory
in mouse testes. Nature 442(7099):203–207. non-coding RNA in yeast. Nature
doi:10.1038/nature04916, nature04916 [pii] 475(7354):114–117. doi:10.1038/
nature10118, nature10118 [pii]
32. Chuma S, Pillai RS (2009) Retrotransposon
silencing by piRNAs: ping-pong players mark 41. Xu Z, Wei W, Gagneur J, Perocchi F, Clauder-
their sub-cellular boundaries. PLoS Genet Munster S, Camblong J, Guffanti E, Stutz F,
5(12):e1000770. doi:10.1371/journal. Huber W, Steinmetz LM (2009) Bidirectional
pgen.1000770 promoters generate pervasive transcription in
8 Guillaume Clerget et al.

yeast. Nature 457(7232):1033–1037. Lowe TM, Wei CL, Ruan Y, Struhl K, Gerstein
doi:10.1038/nature07728, nature07728 [pii] M, Antonarakis SE, Fu Y, Green ED, Karaoz
42. Mercer TR, Dinger ME, Mattick JS (2009) U, Siepel A, Taylor J, Liefer LA, Wetterstrand
Long non-coding RNAs: insights into func- KA, Good PJ, Feingold EA, Guyer MS, Cooper
tions. Nat Rev Genet 10(3):155–159. GM, Asimenos G, Dewey CN, Hou M,
doi:10.1038/nrg2521, nrg2521 [pii] Nikolaev S, Montoya-Burgos JI, Loytynoja A,
43. Ponting CP, Oliver PL, Reik W (2009) Whelan S, Pardi F, Massingham T, Huang H,
Evolution and functions of long noncoding Zhang NR, Holmes I, Mullikin JC, Ureta-
RNAs. Cell 136(4):629–641. doi:10.1016/j. Vidal A, Paten B, Seringhaus M, Church D,
cell.2009.02.006, S0092-8674(09)00142-1 Rosenbloom K, Kent WJ, Stone EA, Batzoglou
[pii] S, Goldman N, Hardison RC, Haussler D,
Miller W, Sidow A, Trinklein ND, Zhang ZD,
44. Yazgan O, Krebs JE (2007) Noncoding but Barrera L, Stuart R, King DC, Ameur A,
nonexpendable: transcriptional regulation by Enroth S, Bieda MC, Kim J, Bhinge AA, Jiang
large noncoding RNA in eukaryotes. Biochem N, Liu J, Yao F, Vega VB, Lee CW, Ng P, Yang
Cell Biol 85(4):484–496. doi:10.1139/O07- A, Moqtaderi Z, Zhu Z, Xu X, Squazzo S,
061, o07-061 [pii] Oberley MJ, Inman D, Singer MA, Richmond
45. Aalto AP, Pasquinelli AE (2012) Small non- TA, Munn KJ, Rada-Iglesias A, Wallerman O,
coding RNAs mount a silent revolution in gene Komorowski J, Fowler JC, Couttet P, Bruce
expression. Curr Opin Cell Biol 24(3):333– AW, Dovey OM, Ellis PD, Langford CF, Nix
340. doi:10.1016/j.ceb.2012.03.006, S0955- DA, Euskirchen G, Hartman S, Urban AE,
0674(12)00037-3 [pii] Kraus P, Van Calcar S, Heintzman N, Kim TH,
46. Birney E, Stamatoyannopoulos JA, Dutta A, Wang K, Qu C, Hon G, Luna R, Glass CK,
Guigo R, Gingeras TR, Margulies EH, Weng Rosenfeld MG, Aldred SF, Cooper SJ, Halees
Z, Snyder M, Dermitzakis ET, Thurman RE, A, Lin JM, Shulha HP, Xu M, Haidar JN, Yu Y,
Kuehn MS, Taylor CM, Neph S, Koch CM, Iyer VR, Green RD, Wadelius C, Farnham PJ,
Asthana S, Malhotra A, Adzhubei I, Greenbaum Ren B, Harte RA, Hinrichs AS, Trumbower H,
JA, Andrews RM, Flicek P, Boyle PJ, Cao H, Clawson H, Hillman-Jackson J, Zweig AS,
Carter NP, Clelland GK, Davis S, Day N, Smith K, Thakkapallayil A, Barber G, Kuhn
Dhami P, Dillon SC, Dorschner MO, Fiegler RM, Karolchik D, Armengol L, Bird CP, de
H, Giresi PG, Goldy J, Hawrylycz M, Haydock Bakker PI, Kern AD, Lopez-Bigas N, Martin
A, Humbert R, James KD, Johnson BE, JD, Stranger BE, Woodroffe A, Davydov E,
Johnson EM, Frum TT, Rosenzweig ER, Dimas A, Eyras E, Hallgrimsdottir IB, Huppert
Karnani N, Lee K, Lefebvre GC, Navas PA, J, Zody MC, Abecasis GR, Estivill X, Bouffard
Neri F, Parker SC, Sabo PJ, Sandstrom R, GG, Guan X, Hansen NF, Idol JR, Maduro
Shafer A, Vetrie D, Weaver M, Wilcox S, Yu M, VV, Maskeri B, McDowell JC, Park M, Thomas
Collins FS, Dekker J, Lieb JD, Tullius TD, PJ, Young AC, Blakesley RW, Muzny DM,
Crawford GE, Sunyaev S, Noble WS, Dunham Sodergren E, Wheeler DA, Worley KC, Jiang
I, Denoeud F, Reymond A, Kapranov P, H, Weinstock GM, Gibbs RA, Graves T, Fulton
Rozowsky J, Zheng D, Castelo R, Frankish A, R, Mardis ER, Wilson RK, Clamp M, Cuff J,
Harrow J, Ghosh S, Sandelin A, Hofacker IL, Gnerre S, Jaffe DB, Chang JL, Lindblad-Toh K,
Baertsch R, Keefe D, Dike S, Cheng J, Hirsch Lander ES, Koriabine M, Nefedov M, Osoegawa
HA, Sekinger EA, Lagarde J, Abril JF, Shahab K, Yoshinaga Y, Zhu B, De Jong PJ (2007)
A, Flamm C, Fried C, Hackermuller J, Hertel Identification and analysis of functional elements
J, Lindemeyer M, Missal K, Tanzer A, Washietl in 1% of the human genome by the ENCODE
S, Korbel J, Emanuelsson O, Pedersen JS, pilot project. Nature 447(7146):799–816.
Holroyd N, Taylor R, Swarbreck D, Matthews doi:10.1038/nature05874
N, Dickson MC, Thomas DJ, Weirauch MT, 47. Clark MB, Amaral PP, Schlesinger FJ, Dinger
Gilbert J, Drenkow J, Bell I, Zhao X, Srinivasan ME, Taft RJ, Rinn JL, Ponting CP, Stadler
KG, Sung WK, Ooi HS, Chiu KP, Foissac S, PF, Morris KV, Morillon A, Rozowsky JS,
Alioto T, Brent M, Pachter L, Tress ML, Gerstein MB, Wahlestedt C, Hayashizaki Y,
Valencia A, Choo SW, Choo CY, Ucla C, Carninci P, Gingeras TR, Mattick JS (2011)
Manzano C, Wyss C, Cheung E, Clark TG, The reality of pervasive transcription. PLoS
Brown JB, Ganesh M, Patel S, Tammana H, Biol 9(7):e1000625. doi:10.1371/journal.
Chrast J, Henrichsen CN, Kai C, Kawai J, pbio.1000625, discussion e1001102,
Nagalakshmi U, Wu J, Lian Z, Lian J, 10-PLBI-PS-8040R3 [pii]
Newburger P, Zhang X, Bickel P, Mattick JS, 48. Clark MB, Choudhary A, Smith MA, Taft RJ,
Carninci P, Hayashizaki Y, Weissman S, Mattick JS (2013) The dark matter rises: the
Hubbard T, Myers RM, Rogers J, Stadler PF, expanding world of regulatory RNAs. Essays
 ncRNAs Overview 9

Biochem 54:1–16. doi:10.1042/bse0540001, Nucleic Acids Res 38(10):e113. doi:10.1093/

bse0540001 [pii] nar/gkq057, gkq057 [pii]
49. Jochl C, Rederstorff M, Hertel J, Stadler PF, 53. Rederstorff M, Huttenhofer A (2011) cDNA
Hofacker IL, Schrettl M, Haas H, Huttenhofer library generation from ribonucleoprotein par-
A (2008) Small ncRNA transcriptome analysis ticles. Nat Protoc 6(2):166–174. doi:10.1038/
from Aspergillus fumigatus suggests a novel nprot.2010.186, nprot.2010.186 [pii]
mechanism for regulation of protein synthesis. 54. Shen M, Eyras E, Wu J, Khanna A, Josiah S,
Nucleic Acids Res 36(8):2677–2689. Rederstorff M, Zhang MQ, Stamm S (2011)
doi:10.1093/nar/gkn123, gkn123 [pii] Direct cloning of double-stranded RNAs from
50. Metzker ML (2010) Sequencing technologies – RNase protection analysis reveals processing
the next generation. Nat Rev Genet 11(1):31– patterns of C/D box snoRNAs and provides
46. doi:10.1038/nrg2626, nrg2626 [pii] evidence for widespread antisense transcript
51. Rederstorff M (2012) Generation of cDNA expression. Nucleic Acids Res 39(22):9720–
libraries from RNP-derived regulatory non- 9730. doi:10.1093/nar/gkr684, gkr684 [pii]
coding RNAs. Methods Mol Biol 925:211– 55. Skreka K, Schafferer S, Nat IR, Zywicki M, Salti
218. doi:10.1007/978-1-62703-011-3_14 A, Apostolova G, Griehl M, Rederstorff M,
52. Rederstorff M, Bernhart SH, Tanzer A, Dechant G, Huttenhofer A (2012) Identification
Zywicki M, Perfler K, Lukasser M, Hofacker of differentially expressed non-coding RNAs in
IL, Huttenhofer A (2010) RNPomics: defining embryonic stem cell neural differentiation.
the ncRNA transcriptome by cDNA library Nucleic Acids Res 40(13):6001–6015.
generation from ribonucleo-protein particles. doi:10.1093/nar/gks311, gks311 [pii]
 Chapter 2

Alcoholic Precipitation of Small Non-Coding RNAs

Guillaume Clerget, Valérie Bourguignon-Igel, and Mathieu Rederstorff

Abstract
Alcoholic precipitation is a critical step to recover RNA of high purity. This chapter describes the principles
of alcoholic precipitation as well as a standard, basic protocol with key advices to observe, but numerous
variations on the theme are discussed. Indeed, several important parameters, such as the choice of salt,
alcohol, or carrier, have to be considered to improve the efficiency of precipitation and the yield of RNA
recovery.

Key words RNA, Precipitation, Alcohol, Salt, Carrier

1 Introduction

Alcoholic precipitation is used to recover, purify, or concentrate

nucleic acids from a total extract. It relies on nucleic acids’ differen-
tial solubility in solution upon addition of alcohol and salts. Nucleic
acids are soluble in water because both nucleic acids and water are
polar molecules that can therefore interact together [1]. The nega-
tively charged phosphate groups (PO3−) of nucleic acids electro-
statically interact with water. Hence, water molecules form a
solvation or hydration shell around each nucleic acid molecule,
isolating them from each other and subsequently dissolving them in
solution. Alcohol and salt enable to disrupt this hydration shell.
In water, salts used for nucleic acid precipitation completely dissoci-
ate into their constituting anions and cations. Cations neutralize
the negative charges of nucleic acids (PO3− groups) while alcohol,
which has a much lower dielectric constant than water, increases the
electrostatic interaction force between the phosphate groups and
the cations. Once neutralized, nucleic acids become less hydrophilic
and thus precipitate out of solution. Additionally, alcohol decreases
the repulsive forces between the inter-helical phosphates so that
nucleic acid molecules aggregate.
Depending on the sample type or the subsequent experi-
ments to be performed, several parameters such as the type of salt

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_2, © Springer Science+Business Media New York 2015

11
12 Guillaume Clerget et al.

or alcohol to be used, the addition of a carrier, the precipitation

temperature, or the centrifugation speed have to be considered to
improve RNA quality and recovery yield and are discussed
(see Notes 1–5).

2 Materials

1. 100 % ethanol.
2. 70 % ethanol.
3. 100 % isopropanol.
4. 3 M sodium acetate, pH 5.2.
5. 5 M ammonium acetate.
6. 8 M lithium chloride.
7. 2 M sodium chloride.
8. Yeast tRNA (10–20 μg/ml).
9. Salmon sperm DNA (10–20 μg/ml).
10. Glycogen (50–150 μg/ml).
11. GlycoBlue (50–150 μg/ml) (Ambion).
12. Linear polyacrylamide (10–20 μg/ml).
13. 1 M MgCl2.
14. RNase-free, DEPC-treated water.
15. 1× TE buffer, pH 8.0: 10 mM Tris–HCl, pH 8.0, 1 mM
EDTA, pH 8.0.

3 Methods

To avoid RNase contaminations when preparing and handling

RNAs, always use appropriate precautions such as RNase-free
water (see Note 6), gloves, and RNase-free tubes and tips.

3.1 Ethanol 1. Adjust sample volume to a minimum of 100 μl (see Note 7).
Precipitation 2. Add sodium acetate to the sample to a final concentration of
0.3 M (about 1/10 of volume) (see Notes 1, 3 and 8).
3. Add 2.5–3 volumes of ice-cold 100 % ethanol (see Note 2).
4. Mix thoroughly by inverting the tube or pipetting up and
down (see Note 9).
5. Incubate on ice for 15 min to 1 h (see Note 4).
6. Centrifuge at 12,000 × g for 30 min at 4 °C (see Note 5).
7. Carefully discard the supernatant without disturbing the pellet.
 RNA Precipitation 13

8. Wash the RNA pellet with 0.5 ml of 70 % ethanol and mix

gently.
9. Centrifuge at 12,000 × g for 15 min at 4 °C.
10. Carefully discard the supernatant without disturbing the pellet
(see Note 10).
11. Air-dry the RNA pellet for 5–10 min at room temperature
(see Note 11).
12. Dissolve the pellet in RNase-free water (see Note 12).

4 Notes

1. Different salts can be used during alcoholic precipitation, the

choice of which depending on the subsequent applications.
Indeed, each salt features specific properties providing differ-
ent advantages and/or drawbacks [1, 2]. Sodium acetate
(0.3 M final concentration, pH 5.2) is the most widely used
salt for alcoholic precipitation [1, 2]. However, if the sample
contains SDS, sodium chloride (0.2 M final concentration)
could be alternatively chosen. In this case, SDS would remain
soluble in ethanol [1, 2], which would allow its separation and
removal from the RNA. Ammonium acetate (2.5 M final con-
centration) is another possible choice. It allows to greatly
reduce coprecipitation of both dNTPs and oligosaccharides.
However, ammonium acetate should not be used if a phos-
phorylation reaction is planned after precipitation since ammo-
nium ions inhibit T4 polynucleotide kinase [1, 2]. Finally, a
last broadly used salt for RNA precipitation is lithium chloride
(0.8 M final concentration). It is very soluble in alcohol and
therefore coprecipitates with RNA to a smaller extent than
others salts [1, 2]. Moreover, DNA, proteins, and carbohy-
drates do not efficiently precipitate with lithium chloride,
which therefore leads to a greater purity of RNAs precipitated
with this salt [3]. Unfortunately, possible loss of small RNAs
has been reported (≈100 nt or less, e.g., miRNAs, tRNAs, sn-
and snoRNAs, or 5S/5.8S rRNAs). Anyway, as small and large
RNAs feature different solubility in high ionic strength solu-
tions, small RNAs remaining soluble while larger ones do not,
this property enables to selectively purify small RNAs with
high concentrations of LiCl (up to 2.5 M) even without alcohol
[1], as small RNAs will remain in solution. Finally, lithium
chloride should not be employed if subsequent reverse tran-
scription or in vitro translation reactions are planned, as the
chloride ions at this concentration inhibit RNA-dependent
DNA polymerase as well as initiation of protein synthesis in
most cell-free systems [1].
14 Guillaume Clerget et al.

2. Alternatively, isopropanol can replace ethanol as a precipitation

alcohol. However, since isopropanol is less polar than ethanol,
RNAs are even less soluble in isopropanol than they are in eth-
anol. Therefore, for a similar precipitation efficiency, a lower
volume of isopropanol is necessary [1, 2]. Isopropanol can
therefore replace ethanol in the case of large sample volume,
using about one volume of isopropanol per volume of sample.
However, as salts are also less soluble in isopropanol, they
coprecipitate and contaminate RNA preparation to a higher
extent [2]. Therefore, washing steps after precipitation with
isopropanol are very important. Finally, isopropanol is less
volatile than ethanol and will require more time for the RNA
pellet to dry [2].
3. If you expect RNA quantity to be very low or if RNAs are very
small in size (<100 nucleotides), you can add a carrier or copre-
cipitant to increase recovery yield before incubation on ice. Also,
if you do not see any pellet after the centrifugation step, it is
possible to proceed again to precipitation (starting from step 5,
Subheading 3.1) after addition of a carrier. Carriers are mole-
cules that trigger precipitation of RNA as they are insoluble in
alcohol and thus precipitate. After centrifugation, the pellet will
consequently be bigger and thus more visible, which will greatly
facilitate removal of the supernatant without affecting the pellet.
Moreover, colored dyes can be covalently linked to carriers,
which additionally facilitates the observation of the pellet.
The choice of the carrier in alcoholic precipitation is
important. As for the choice of the salt to be used, carrier
choice will depend on the subsequent reactions to be per-
formed [2]. The most frequently used carrier molecules are
yeast tRNAs (final concentration of 10–20 μg/ml), glycogen
(final concentration of 50–150 μg/ml), or linear polyacryl-
amide (final concentration of 10–20 μg/ml). Yeast tRNAs are
biologically active RNAs that might interfere with some subse-
quent current molecular biology reactions. For example, tail-
ing reactions or reactions catalyzed by polynucleotide kinases
or terminal transferases are inhibited by large amounts of yeast
tRNAs [4]. In some cases, template-dependent cDNA synthe-
sis is inhibited as well [5]. On the other hand, glycogen is an
inert, DNA/RNA-free molecule. It neither interferes with
subsequent enzymatic reactions (PCR, digestion, ligation,
reverse transcription, labeling, transcription, hybridization,
etc.) nor with electrophoresis or spectrophotometrical mea-
surements [6]. Glycogen even allows improved precipitation
of very small RNA (>8 nt). However, glycogen may prevent
reverse transcription in the case of very large templates, as well
as nucleic acid interactions with proteins [7] in a concentration-
dependent manner [8]. Finally, linear polyacrylamide is another
DNA/RNA-free inert molecule. As glycogen, it neither
 RNA Precipitation 15

interferes with enzymatic reactions such as phosphorylation by

polynucleotide kinase, ligation, cDNA synthesis, in vitro tran-
scription, and digestion by endonucleases nor with electropho-
resis [9]. Linear polyacrylamide does not inhibit nucleic acid
interactions with proteins [10]; however, it does not trigger
coprecipitation of very small RNA (≤20 bases) [7].
4. The incubation step for the alcoholic precipitation of RNAs is
generally performed at very low temperature (−20 °C or
−80 °C) in most protocols. However, although possible
RNases might be less active at lower temperatures, this appears
to be rather counterproductive [1, 2]. Indeed, the lower the
temperature, the higher the viscosity, which decreases RNA
movements and thus aggregation and precipitation.
Additionally, the dielectric constant increases when the tem-
perature diminishes; therefore precipitation efficiency decreases
with the temperature. Finally, salts’ solubility decreases with
the temperature as well, which leads to stronger coprecipita-
tion of salts at lower temperatures [11]. Therefore, incubation
at room temperature or on ice is sufficient and recommended,
provided you work in RNase-free conditions. If you retrieve a
low amount of RNA or if you do not see the pellet, you can
increase the incubation time or add a carrier if not done already.
An average time of about 15 min is generally sufficient.
5. If the amount of RNA is low, if you do not see the pellet, or if
you work with very small RNAs (<100 nucleotides), you can
both increase the speed and time of centrifugation in order to
allow the pellet to more firmly stick to the tube wall [1, 2].
6. Water can be treated with DEPC (diethylpyrocarbonate) to
avoid RNase contaminations.
7. Too small volumes of samples reduce the yield of RNA
recovery.
8. MgCl2 should be added to a final concentration of 10 mM for
small RNAs (<100 nucleotides) [1].
9. Do not vortex. Too vigorous mixing could damage and slice
the RNA.
10. Great care must be taken when discarding the supernatant in
order not to lose the RNA pellet.
11. Do not dry the pellet too much, especially employing a speed
vacuum, as too dry RNA pellets are more difficult to
resolubilize.
12. You can dissolve the pellet in 1× TE buffer, pH 8, instead of
water. Although EDTA chelates divalent cations, thus inhibit-
ing metalloenzymes such as nucleases or proteases, it might
also inhibit polymerases or other enzymes necessary for your
subsequent experiences.
16 Guillaume Clerget et al.

References
1. Sambrook J, Fritsch EF, Maniatis T (1989) 6. Tracy S (1981) Improved rapid methodology
Molecular cloning, a laboratory manual, 2nd for the isolation oh nucleic acids from agarose
edn. Cold Spring Harbor Laboratory Press, gels. Prep Biochem 11:251–268
New York, NY, pp E10–E15 7. Gaillard C, Strauss F (1990) Ethanol precipita-
2. Zumbo P (2012) Ethanol precipitation. tion of dna with linear polyacrylamide as car-
Department of physiology and biophysics, rier. Nucleic Acids Res 18:378
Weill Cornell Medical College 8. Baugh LR et al (2001) Quantitative analysis of
3. Barlow J et al (2001) A simple method for the mRNA amplification by in vitro transcription.
quantitative isolation of undegraded high Nucleic Acids Res 29:E29
molecular weight ribonucleic acid. Biochem 9. Aruffo A, Seed B (1987) Molecular cloning of
Biophys Res Commun 13:61–66 a CD28 cDNA by a high-efficiency COS cell
4. Michelson AM, Orkin SH (1982) expression system. Proc Natl Acad Sci U S A
Characterization of the homopolymer tailing 84:8573–8577
reaction catalyzed by terminal deoxynucleoti- 10. Strauss F, Varshavsky A (1984) A protein binds
dyl transferase. J Biol Chem 257: to a satellite DNA repeat at three specific sites
14773–14782 that would be brought into mutual proximity
5. Wang QT et al (2002) Yeast tRNA as carrier in by DNA folding in the nucleosome. Cell 37:
the isolation of microscale RNA for global 889–901
amplification and expression profiling. 11. Zeugin J, Hartley JL (1985) Ethanol precipita-
Biotechniques 33:788–796 tion of DNA. Focus 7:1–2
 Chapter 3

Quantification and Quality Control of a Small

Non-Coding RNA Preparation
Virginie Marchand and Christiane Branlant

Abstract
Recent advances in high-throughput sequencing have shed some new light on the diversity of small
non-coding RNA (sncRNA) classes and their crucial role in gene regulation and diseases. RNA quantifica-
tion and control of RNA integrity are two key steps in sncRNA profiling. In this chapter, we will describe
different gold standard methods used to achieve both purposes before the use of the RNAs in downstream
applications.

Key words RNA quantification, UV spectroscopy, Fluorescence, Capillary electrophoresis, RNA

quality

1 Introduction

During the recent years, high-throughput sequencing methods

have revealed an unexpected number and a great diversity of small
non-coding RNAs (sncRNAs). Many of them were initially consid-
ered as simple degradation products; however they were found to
have several important functions. The small non-coding RNA
(sncRNA) family can be subdivided into a large number of RNA
subclasses, including miRNAs, piRNAs, snoRNAs, and scaRNAs,
all of which presenting well-established functions. However,
sncRNAs represent one important part of the transcriptome that
has to be characterized for a full understanding of cellular pro-
cesses and regulations. Therefore, the quantification of small RNAs
within an extracted mixture of RNA is an important and necessary
step prior to any further analysis (RT-qPCR or next-generation
sequencing). The most commonly used technique for measuring
nucleic acid sample concentrations is the determination of their
absorbance at 260 nm (A260). While this is a very fast and cheap
method to estimate RNA quantity and its relative purity, this tech-
nique is not very accurate if the sample preparation is contaminated
by DNA, proteins, or other products such as carbohydrates,

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_3, © Springer Science+Business Media New York 2015

17
18 Virginie Marchand and Christiane Branlant

phenol, DTT, or chaotropic salts, which may lead to wrong

quantification estimations. Other methods such as fluorometry
have been developed in order to circumvent these problems.
Fluorometry consists in using fluorescent probes for specific quan-
tification of biomolecule of interest (RNA, DNA, or proteins). The
probes are designed in order that the dyes only emit signals when
the probes are bound to their specific target molecule. This method
is very sensitive, since signals can be detected even at low concen-
trations. Use of fluorescence for RNA quantification is very easy,
rapid, and robust and it tolerates different buffer compositions,
even buffers containing detergents (see Note 1). The contamina-
tion of sncRNA samples by proteins and/or DNA can also be mea-
sured using kits for determination of protein and DNA
concentrations. However, some contaminations, like phenol, for
instance, are not detected by this approach.
RNA quality can be assessed by two main methods: denaturing/
non-denaturing agarose gel electrophoresis or capillary
electrophoresis.
For a long time, RNA quality has been assessed by fraction-
ation on a denaturing agarose gel [1], allowing to check the
28S/18S rRNA ratios. However, this is not an objective and accu-
rate method and it requires large amount of RNA. In addition,
toxic and/or carcinogenic denaturing agents such as formalde-
hyde, formamide, or urea were used in the original approach so
that alternative methods such as native agarose gels have been
developed (see Note 2).
In the more recent years, microfluidics-based technologies
have been developed to quantify and analyze RNA integrity in an
unbiased way. Instruments such as the Agilent 2100 Bioanalyzer or
2200 Tapestation (Agilent Technologies) or the Experion (Bio-
Rad) are the gold standards for measuring RNA quality at the pico-
gram scale. The 28S/18S ratio, which is a good indicator of RNA
integrity when comprised between 1.8 and 2.0, is automatically
generated, and in addition, an algorithm assigns an RNA integrity
number (RIN, Agilent Technologies) from 1 to 10, where 10 rep-
resents a completely intact RNA and 1 a highly degraded RNA
[2, 3]. However, it is quite expensive, and some technical limita-
tions exist as well. For instance, if the RNA preparation does not
contain any rRNAs, it is not possible to conclude whether the RNA
preparation is of good quality as this evaluation relies on rRNA
profiles. Another problem concerns RNA preparations of insect
origin, as the 28S is cut in two parts that migrate around the 18S
upon heat denaturation [4] (Fig. 2a).
This chapter focuses on the most common methods to quan-
tify and estimate the quality of an RNA preparation and provides
several tips to optimize these methods in order to get accurate and
reproducible results.
 Quantity and Quality of Small RNAs 19

2 Materials

Prepare all solutions using RNase-free water. Wear gloves to pre-

vent degradation of RNA samples by RNases.

2.1 RNA 1. UV-visible small-volume spectrophotometer: any kind of UV-

Quantification visible spectrophotometer allowing measurements of 1 μl
samples (e.g., NanoDrop 2000, 2000c, or 8000, Thermo
2.1.1 Using
Scientific). We use a Nanodrop 2000c.
a Spectrophotometer
2. 1.5 ml RNase-free microcentrifuge tubes.
3. RNase-free water.

2.1.2 Using 1. Any kind of fluorometer able to quantify RNA and DNA (and
a Fluorometer proteins) with high sensitivity (e.g., Qubit® 2.0 Fluorometer
(Life Technologies) which is the one we use).
2. Thin-walled polypropylene tubes of 500 μl compatible with
the fluorometer (e.g., Qubit® Assay Tube or Axygen® PCR-
05-C tubes, VWR).
3. RNA assay kit: Qubit® RNA Assay Kit (5–100 ng), Qubit®
RNA BR Assay Kit (20–1,000 ng), and Qubit® microRNA
Assay Kit (1–500 ng).
4. Optional: Qubit® dsDNA HS Assay Kit (0.2–100 ng) and
Qubit® Protein Assay Kit (0.25–5 μg).

2.2 RNA Quality 1. Agarose.

Assessment 2. 10× TBE buffer: 108 mg/ml Tris–HCl, pH 8, 55 mg/ml
2.2.1 Native Agarose Gel boric acid, 9.3 mg/ml EDTA, pH 8.
Electrophoresis 3. Agarose gel electrophoresis chamber.
4. Ethidium bromide (EtBr) or equivalent (e.g., GelRed™,
FluoProbes® or SYBR Safe™ DNA Gel Stain, Invitrogen).
5. 10× DNA loading buffer: 1.9 mM xylene cyanol, 1.5 mM bro-
mophenol blue, 25 % glycerol.

2.2.2 Capillary 1. Agilent 2100 Bioanalyzer (Agilent) or Experion (Bio-Rad).

Electrophoresis Since we use an Agilent 2100 Bioanalyzer, this chapter will
focus on this machine.
2. Agilent RNA 6000 Nano Kit (25–500 ng/μl), Agilent RNA
6000 Pico kit (50–5,000 pg/μl), or Agilent Small RNA kit
(50–2,000 pg/μl) (Agilent) (Table 1).
3. Chip priming station (Agilent).
4. Heating block.
5. RNase-free water.
6. RNase-free 1.5 ml microcentrifuge tubes.
7. Optional: synthetic RNA of 21 nt (Sigma) and yeast tRNA
mixture (Roche).
Table 1
20

Overview of the technical specifications for the Agilent RNA 6000 Nano, RNA 6000 Pico, and Small RNA kits

Agilent RNA 6000 Nano kit Agilent RNA 6000 Pico kit Agilent Small RNA kit

Reagents and consumables included in the kit (stable for 4 months)

Number of chips/kit 25 chips
Electrode cleaner chips 3 chips
RNA dye concentrate 1 vial (blue cap)
RNA marker 4 vials (green cap)
RNA conditioning solution NA 1 vial (white cap)
Gel matrix 2 vials (red cap)
Spin filters 4 spin filters 2 spin filters
Ladder 1 vial (yellow cap)
Safe-Lock Eppendorf PCR tubes 30
Syringe 1
Technical specifications
Virginie Marchand and Christiane Branlant

Samples analyzed/chip 12 11
Analysis range (nt) 20–6,000 6–150
Sample volume 1
Quantitative range 25–500 ng/μl (5–500 ng/μl) 0.2–5 ng/μl (0.05–5 ng/μl) 0.05–2 ng/μl for purified miRNA
(qualitative range) for total RNA for total RNA
25–250 ng/μl (25–250 ng/μl) 0.5–5 ng/μl (0.25–5 ng/μl)
for mRNA for mRNA
Reproducibility of 10 % CV 20 % CV
quantitation
Quantitation accuracy 20 % CV (for ladder as sample) 30 % CV (for ladder as sample) 25 % CV (for ladder as sample)
Buffer compatibility 100 mM Tris or 125 mM NaCl 50 mM Tris or 50 mM NaCl 10 mM Tris and 0.1 mM EDTA
or 15 mM MgCl2
Analysis run time (min) 30
 Quantity and Quality of Small RNAs 21

3 Methods

3.1 RNA Carry out all procedures at room temperature unless otherwise
Quantification specified.

3.1.1 Using 1. Select the “Nucleic Acid” application from the main menu of
a Spectrophotometer the NanoDrop software installed on the PC driving the
spectrophotometer.
2. When the wavelength verification window appears, ensure that
the arm is down and click “OK.”
3. Select the type of sample to measure, in this case “RNA.”
4. Select “overlay spectra” to display multiple spectra at a time.
5. Prepare a blank: the buffer used for your sample but without
any trace of RNAs (e.g., RNase-free water or TE buffer).
6. Load 1 μl of the blank solution to the bottom pedestal, lower
the arm, and click on the “Blank” button.
7. Enter your sample name in the appropriate field, load 1 μl of it
to the bottom pedestal, lower the arm, and click “Measure”
(see Note 3).
8. Wipe the upper and lower pedestals using a dry wipe and pro-
ceed with the next sample.
9. Analyze the data obtained for your different RNA samples.
“Conc” is the concentration of your RNA sample based on the
absorbance at 260 nm. “260/280” is the ratio of the absor-
bances at 260 and 280 nm. This ratio is used to roughly assess
the purity of your RNA preparation. A ratio of 2 is generally
considered as corresponding to “pure” RNA. “260/230” is
the ratio of the absorbances at 260 and 230 nm. This ratio is
also used to assess RNA purity. For “pure” RNAs, it should be
in the range of 1.8–2.2 (see Note 4).

3.1.2 Using 1. Equilibrate all solutions of the appropriate kit at room tem-
a Fluorometer perature for at least 30 min before starting the experiments.
The kit provides the concentrated assay reagent, dilution buf-
fer, and pre-diluted standards (see Note 5).
2. Prepare the dye working solution by diluting the concentrated
assay reagent (200× concentrate in DMSO) 1:200 in dilution
buffer. Prepare 200 μl of working solution for each sample and
the two standards.
3. Prepare the two pre-diluted RNA standards annotated “C”
(0 ng/μl in TE buffer) and “D” (10 ng/μl of RNA in TE buf-
fer) by mixing 10 μl of standard with 190 μl of working
solution.
4. Add the working solution up to 200 μl to 1–20 μl of RNA
sample.
22 Virginie Marchand and Christiane Branlant

5. Vortex the tubes for 2 s and incubate them for 2 min at room
temperature.
6. Insert the tubes into the Qubit® 2.0 Fluorometer and proceed
with measurements: on the home screen of the Qubit® 2.0
Fluorometer, choose the type of assay (e.g., “RNA” or
“microRNA”) for which you want to perform a new
calibration.
7. Press “Yes” to read new standards.
8. When indicated, insert the standard tube and press “Read.”
Standard #1 and #2 correspond to standards “C” and “D,”
respectively.
9. Once the calibration is done, insert each sample and press
“Read” to make the measurements.
10. Check that the values of your samples fall within the assay’s
range, and press “Calculate Stock Conc.”
11. To test if your RNA sample preparation is contaminated by
DNA or proteins, repeat the experiment with the DNA and/
or protein kits (see Note 6).

3.2 RNA Quality 1. Pour a 1 % w/v agarose gel in 1× TBE.

Assessment 2. Heat at least 1 μg of each RNA samples for 2 min at 70 °C and
3.2.1 Native Agarose cool down on ice.
Gel Electrophoresis 3. Mix with 10× DNA loading buffer.
4. Load an RNA ladder or an RNA control on the gel to estimate
RNA quantity and quality.
5. Run the gel at 10 V/cm in 1× TBE running buffer.
6. Stain the gel in a 1× GelRed™ or SYBR Safe DNA Gel stain™
bath for 15 min.
7. Using a UV transilluminator, analyze the quality of the RNAs
on the gel.

3.2.2 Capillary 1. Prepare the ladder provided in the kit: spin down the tube and
Electrophoresis transfer 10 μl to an RNase-free tube. Heat for 2 min at
70 °C. Cool down on ice and add 90 μl of RNase-free water.
Prepare 5 μl aliquots using the Safe-Lock PCR tubes provided
in the kit and store them at −70 °C. Before use, thaw one tube
and keep it on ice (Fig. 1a) (see Note 7).
2. Equilibrate all solutions of the kit at room temperature for at
least 30 min before starting the experiments (see Note 5).
3. Place 550 μl (Agilent RNA 6000 Nano or Pico kit) or 650 μl
(Agilent small RNA kit) of the gel matrix (red cap vial) into a
dedicated spin filter. Spin at room temperature for 10 min at
1,500 × g (Agilent RNA 6000 Nano or Pico kit) or for 15 min
at 10,000 × g (Agilent Small RNA kit) (Table 1) (Fig. 1b).
 Quantity and Quality of Small RNAs 23

a e RNA Pico Chip loading

Ladder preparation
1-3 G

4-6 G

7-9 G

Heat for 2 min Cool down 10-11 CS

at 70°C on ice

RNA Pico Chip

10 µl Add 90 µl of H2O Aliquot by 5 µl

ladder (RNase-free) (store at -70°C)

Load 9 µl of Gel-dye mix

G
b
Gel preparation G

CS

Close chip priming station

Centrifuge for Press the plunger of the syringe
Load on
10 min at 13,000 g at RT until it is hold by the clip
a spin filter
spin filter Wait for 30s
Release the clip and
550 µl Aliquot by 65 µl wait for the plunger to go up
gel matrix (store at 4°C) Open the chip priming station

Load 9 µl of Gel-dye mix

c G
Gel-dye mix preparation G

CS

+ 65 µl gel
aliquot
Centrifuge for
10 min at 13,000 g at RT Load 9 µl of Conditioning Solution
G

G
1 µl Gel-dye mix ready
dye concentrate G

CS

d Sample and ladder preparation Load 6 µl of Diluted Ladder

G

G
5 µl ladder G
aliquot Mix by pipetting
CS
up and down
6 µl diluted ladder

1 µl ladder
Load 6 µl of Diluted RNA sample
G

CS
+ + +
12 empty
1.5 ml tubes

Inspect for air bubbles or

liquid spilling in the wells

Heat for 2 min Mix by pipetting Place the chip in the

x µl at 70°C Agilent 2100 Bioanalyzer
1 µl up and down 6 µl diluted sample
(0.5-5 ng/µl) and start the run

Fig. 1 Quick guide for RNA Pico Chip preparation and loading. (a) Ladder preparation, (b) gel preparation, (c)
gel-dye mix preparation, (d) samples and ladder preparation, and (e) RNA Pico Chip loading
24 Virginie Marchand and Christiane Branlant

4. Make 65 μl (Agilent RNA 6000 Nano or Pico kit) or 40 μl

(Agilent small RNA kit) aliquots of the gel and store them at
4 °C for a maximum of 1 month.
5. To avoid contamination of your RNA samples by RNases,
clean the electrodes before and after each experiment by filling
one of the wells of the electrode cleaner with 350 μl of fresh
RNase-free water (see Note 8).
6. Place the electrode cleaner in the Agilent 2100 bioanalyzer
and wait for 5 min before removing it.
7. Wait for 30 min to allow evaporation of the water from the
electrodes (see Note 9).
8. Prepare the gel-dye mix by adding 1 μl (Agilent RNA 6000
Nano or Pico kit) or 2 μl (Agilent small RNA kit) of RNA dye
concentrate (blue cap vial) to a gel aliquot. Mix by pipetting
up and down, and centrifuge for 10 min at 13,000 × g at room
temperature (Fig. 1c).
9. During centrifugation, prepare your samples as follows: dilute
your RNA samples with RNase-free water to be within the
optimal range concentration of the assay (Table 1).
10. Heat the diluted RNA samples for 2 min at 70 °C to prevent
formation of secondary structures and cool them down on ice
(Fig. 1d).
11. Add 1 μl of your diluted RNA samples to 11 (or 12) tubes of
1.5 ml containing 5 μl of RNA marker (green cap vial) (see
Notes 10 and 11) (Table 1). Mix by pipetting up and down
(Fig. 1d).
12. Mix 1 μl of the ladder with 5 μl of RNA marker (green cap vial)
in a 1.5 ml tube (see Note 12) (Table 1). Mix by pipetting up
and down (Fig. 1d).
13. Prepare the chip priming station before loading the gel-dye
mix. Check that the baseplate is adjusted in its default position
(C position) (Fig. 1e).
14. Open a new syringe, slide it into the hole of the lock adapter,
and screw it to the priming station. Adjust the plunger to 1 ml
(Fig. 1e).
15. Adjust the syringe clip to the highest top (Agilent RNA 6000
Nano or Pico kit) or to the lowest top (Agilent Small RNA kit)
position (see Table 1).
16. Once you are ready, load 9 μl of the gel-dye mix in the well
marked with a “G” surrounded by a black circle (see Note 13)
(Fig. 1e).
17. Close properly the chip priming station (see Note 14) and
press the plunger of the syringe until it is held by the clip
(Fig. 1e).
 Quantity and Quality of Small RNAs 25

18. Wait exactly for 30 s (Agilent RNA 6000 Nano or Pico kit) or
60 s (Agilent small RNA kit) and then release the clip.
19. Wait for 5 s until the plunger stops its upward move and pull it
slowly back to the 1 ml position.
20. Open the chip priming station and load 9 μl of gel-dye mix in
the other wells marked with a “G.”
21. Load 9 μl of the conditioning solution (not for the Agilent
RNA 6000 Nano kit) in the well marked “CS” (Fig. 1e).
22. Load 6 μl of the diluted ladder in the well marked with a ladder
(Fig. 1e).
23. Load 6 μl of the diluted RNA samples in the wells marked
1–11 (for Agilent RNA 6000 Pico and Small RNA kit) or 1–12
(for Agilent RNA 6000 Nano kit) (Fig. 1e).
24. Inspect the chip and make sure that no liquid is present on the
edges of the wells. If any, pipette it away (see Note 13).
25. Insert the chip in the Agilent 2100 Bioanalyzer.
26. Carefully close the lid. The electrodes of the cartridge will
enter into the wells of the chip (see Note 14).
27. The 2100 expert software screen shows that you have inserted
a chip by displaying a chip icon on the top-left corner of the
screen.
28. Select the appropriate assay you want to perform (e.g., eukary-
otic total RNA pico series II).
29. Press “Start” to begin the chip run (see Note 15).
30. After the run, immediately remove the chip and clean the elec-
trodes (see Note 8).
31. Analyze the results of the chip (Fig. 2).

4 Notes

1. Several possible contaminants were tested in the concentration

range of 25–500 ng/ml. The data are provided within the
manufacturer’s protocol. For instance, presence of up to
0.01 % SDS, 1 % ethanol, 0.001 % Triton X-100, 5 mM NaCl,
or 1 mM MgCl2 in the RNA sample preparation is tolerated
and does not affect the accuracy of the quantification.
2. For both denaturing and non-denaturing agarose gels, if RNA
degradation is observed, it is difficult to assess whether this is
due to poor quality of the RNA preparation or because RNases
were present on the gel electrophoresis device and degraded
the sample while running. Incorporating chlorine bleach (6 %
sodium hypochlorite) into a standard TAE or TBE agarose gel
helps preventing the latter problem [5].
 A NA
RN al R
al t
tot n to
a ins
t
ec uma
h
Total RNA extracted from human PBMC cells (RIN=8.7)
[FU]
200
100

0 (nt)
25 500 4000 [nt] 4000
Total RNA extracted from insect cells (RIN=NA)
[FU] 2000
500 1000
500
200
0
25
25 500 4000 [nt]
RIN NA 8.7
b
Total RNA extracted from human PBMC cells (RIN=9.3)
[FU]
18S rRNA 28S rRNA re
RN
A xtu
200 mi RNA
otal N A i
m
sRNAs nt t tR ified
100 ma eas r
hu y pu
0
25 500 4000 [nt]
yeast tRNA mixture (RIN=2.6)
[FU]

1000 (nt)
500
4000
0
25 500 4000 [nt] 2000
Synthetic miRNA (RIN=2.6) 1000
[FU]
500
200
25
0 RIN 9.3 2.6 2.6
25 500 4000 [nt]

c Total RNA extracted from human PBMC cells (RIN=9.3)

[FU]
50 miRNA tRNA
re
RN
A xtu
mi RNA
al A
tot N mi
n t tR ified
0 u ma eas u r
h y p
4 20 60 100 150 [nt]
[FU] yeast tRNA mixture (RIN=2.6)

(nt)
0
4 20 60 100 150 [nt] 150
[FU] Synthetic miRNA (RIN=2.6) 100
200
80
100 60
40
0 20
4 20 60 100 150 [nt] 4
miRNA tRNA

Fig. 2 Examples of RNA profiles obtained using the Agilent 2100 Bioanalyzer. (a) High-quality insect or human
total RNA obtained after Trizol extraction analyzed on an RNA Pico Chip. The human total RNA trace profile is
typical of a high-quality RNA since the 28S and 18S rRNA peaks are present and dominant. An RIN (RNA integ-
rity number) of 8.7 was attributed to the RNA sample, which is indicative of good quality. Note the presence of
 Quantity and Quality of Small RNAs 27

3. Make sure the sample is well centered on the bottom pedestal

and avoid air bubbles. Loading of 1.2 μl of RNA could be an
alternative to get more accurate and reproducible results.
4. Using RNase-free water instead of 10 mM Tris–EDTA (TE),
pH 8.0, to dilute your sample may lower the 260/280 ratio
below 2.0 due to the lower pH of water [6]. A 260/280 ratio
of 1.8 for samples diluted in RNase-free water is considered to
correspond to “pure” for RNA.
5. The concentrated assay reagent contains DMSO, which is a
potential mutagen; therefore wear hand and eye protection
and be careful when preparing and handling reagents and sam-
ples. Store this reagent at room temperature, in a desiccator
and protected from light. Store the dilution buffer at room
temperature and the standards at 4 °C. All kit components are
stable for 6 months.
6. In the protein kit, there are three pre-diluted BSA standards
(instead of two in nucleic acid kits). The protein samples
should be incubated for 15 min instead of 2 min only with the
nucleic acid kits.
7. We recommend doing this immediately upon kit arrival to
reduce the number of freeze and thaw events.
8. RNase contamination problems of the electrodes are quite fre-
quent and will affect the RIN of your sample. Therefore, if the
Agilent 2100 Bioanalyzer is also used for DNA assays, it is
strongly recommended to use a dedicated electrode cartridge
for RNA assays. In addition, we recommend for each chip to
load an internal RNA control (total RNA preparation with a
known RIN >9). If you encounter contamination problems,
clean the electrode cartridge into an RNA Zap solution for at
least 10 min, then rinse the electrodes with RNase-free water
and let them dry out for at least 1 night.

Fig. 2 (continued) abundant small RNAs including 5.8S and 5S rRNAs, tRNAs, and other non-coding RNAs
ranging from 25 to 200 nt. The insect total RNA trace profile is also typical of a high-quality RNA sample, even
though it looked like degraded and no RIN could be attributed since the 28S rRNA peak is absent. Indeed, upon
heat denaturation, the insect 28S rRNA is cleaved, leading to fragments migrating with the 18S rRNA. (b) RNA
trace profiles obtained on a Pico RNA chip for a yeast total tRNA mixture and a synthetic miRNA sample (21 nt)
were compared to a human PBMC total RNA preparation. As expected, yeast tRNA mixture and synthetic
miRNA both migrate as the small RNAs of the human total RNA preparation. (c) RNA trace profiles obtained on
a Small RNA chip for a yeast total tRNA preparation and a synthetic miRNAs sample (21 nt) were compared to
a human PBMC total RNA preparation. The human PBMC total RNA preparation leads to three major peaks: one
between 50 and 80 nt, corresponding mainly to tRNAs; one around 90 nt corresponding to snoRNAs; and one
around 140 nt corresponding to the 5.8S rRNA. 5S rRNA corresponds to a small pic at 120 nt. Though miRNAs
are detected in this sample, they represent too small portion of total RNAs and are therefore not visible on the
RNA trace profile. However, using other techniques, such as NGS, we confirmed the presence of miRNAs in our
total RNA preparation
28 Virginie Marchand and Christiane Branlant

9. Water on the electrodes will lead to abnormal RNA profiles.

Make sure any traces of water are evaporated before running
the chip.
10. To avoid RNase contamination problems, we recommend to
label the RNA marker vial currently in use and to split it into
aliquots. If you have any doubt concerning a possible RNase
contamination, trash the current vial and use a novel aliquot.
11. Do not leave any empty well; otherwise the chip will not run
properly. If you do not have enough samples to load, use
RNase-free water instead and proceed as usual.
12. The ladder is quite stable at −70 °C and may be used beyond
4 months.
13. The gel and sample loading steps on the chip are crucial. Insert
the tip of the pipette until the bottom of the well when loading
gel or samples. This will prevent formation of air bubbles.
Placing the pipette at the wall or the edge of the well will lead
to poor results.
14. The chip priming station is properly closed only when you hear
a clear “click” sound.
15. The Agilent 2100 Bioanalyzer is very sensitive to vibrations;
therefore install it on a dedicated bench and make sure that no
vibrations will occur during the run.

Acknowledgments

We are grateful to the EFS (Etablissement Français du Sang) for

providing us blood samples used for our research. We also thank
the FR3209 BMCT and the Next-generation sequencing (NGS)
core facility for providing us access to the Bioanalyzer 2100 and
the Qubit fluorometer.

References

1. Rave N, Crkvenjakov R, Boedtker H (1979) integrity number for assigning integrity values to
Identification of procollagen mRNAs transferred RNA measurements. BMC Mol Biol 7:3
to diazobenzyloxymethyl paper from formalde- 4. Winnebeck EC, Millar CD, Warman GR (2000)
hyde agarose gels. Nucleic Acids Res 6(11): Why does insect RNA look degraded? J Insect
3559–3567 Sci 10:159
2. Becker C, Hammerle-Fickinger A, Riedmaier I, 5. Aranda PS, LaJoie DM, Jorcyk CL (2012)
Pfaffl MW (2010) mRNA and microRNA qual- Bleach gel: a simple agarose gel for analyzing
ity control for RT-qPCR analysis. Methods RNA quality. Electrophoresis 33(2):366–369
50(4):237–243 6. Wilfinger WW, Mackey K, Chomczynski P (1997)
3. Schroeder A, Mueller O, Stocker S, Salowsky R, Effect of pH and ionic strength on the spectro-
Leiber M, Gassmann M, Lightfoot S, Menzel W, photometric assessment of nucleic acid purity.
Granzow M, Ragg T (2006) The RIN: an RNA Biotechniques 22(3):474–476, pp 478–481
 Chapter 4

Impact of RNA Isolation Protocols on RNA Detection

by Northern Blotting
Katrin Damm, Simone Bach, Katrin M.H. Müller, Gabriele Klug,
Olga Y. Burenina, Elena A. Kubareva, Arnold Grünweller,
and Roland K. Hartmann

Abstract
We prepared total RNA from the Gram-positive soil bacterium Bacillus subtilis by different RNA extraction
procedures to compare their suitability for Northern blot detection of tiny RNAs (~14-mers) or RNAs of
intermediate size (100–200 nt) in terms of signal quality, intensity, and reproducibility. Our analysis
included two hot phenol methods and two TRIzol extraction procedures. We found that signal intensity/
detection sensitivity makes the key difference. Total RNAs prepared by the hot phenol method comprise
the length spectrum from tRNAs to large ribosomal RNAs. Larger RNAs are less abundant in TRIzol
preparations which instead enrich for RNAs of tRNA size and smaller. Thus, hot phenol methods are the
choice for the detection of intermediate-sized and longer RNAs, whereas TRIzol extraction procedures are
more suited for the detection of tiny RNAs.

Key words RNA isolation, Tiny RNA, Intermediate-sized RNA, Hot phenol, TRIzol, Northern blot,
EDC crosslinking

1 Introduction

Usually, total cellular RNAs are prepared by phenol extraction

methods, often followed by additional procedures to enrich for
specific RNA subfractions (e.g., poly(A) RNAs, primary transcripts,
RNAs < 200 nt). However, a bias toward longer or smaller RNAs
may already be introduced at the initial phenol extraction step,
which will affect subsequent applications, e.g., RT-qPCR, library
generation for deep sequencing, microarray analysis, or Northern
blotting. Concerning Northern blotting, signal intensity/detection
sensitivity and reproducibility of signal strength are crucial to mon-
itor changes in RNA levels, e.g., between different growth stages
or physiological states. Here we describe the extraction of total
RNAs from Bacillus subtilis PY79 and its derivative strain deleted

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_4, © Springer Science+Business Media New York 2015

29
30 Katrin Damm et al.

of the 6S-1 RNA (bsrA) gene [1] using four different RNA
extraction protocols: two phenol- and two TRIzol-based methods.
We compare the four RNA preparations with respect to Northern
blot detection of three RNA species: the 5S rRNA (115 nt) that is
often used as an RNA loading control, the regulatory 6S-1 RNA
(190 nt long), and a tiny 14-nt transcript, termed “pRNA” for
“product RNA”, synthesized by the B. subtilis housekeeping RNA
polymerase (σA-RNAP) using the 6S-1 RNA as a template, particu-
larly under outgrowth conditions when stationary cells enter a new
exponential growth phase [2]. We conclude that phenol methods
are better suited for the extraction of large RNAs (>100 nt),
whereas TRIzol methods are the methods of choice to enrich tiny
RNAs (~14 nt).

2 Materials

Prepare all solutions with autoclaved ddH2O and analytical grade

reagents for molecular biology use. Prepare reagents at room tem-
perature; store them at room temperature (short-term storage) or
as aliquots at −20 °C (long-term storage), if not stated otherwise.
The procedures described herein have to be performed under
biosafety S1 conditions.

2.1 Bacterial Cell 1. Warm air incubation shaker.

Cultures 2. Water bath shaker.
3. Dewar flask with handle for liquid nitrogen.
4. Centrifuges for 1.5, 15, and 50-ml tubes.
5. LB medium: 10 g/l peptone, 5 g/l yeast extract, 10 g/l NaCl.
Adjust to pH 7.5 with NaOH and autoclave.
6. The following bacterial strains were used in this protocol:
Bacillus subtilis PY79 (wt) and B. subtilis PY79 ΔbsrA (6S-1
RNA deletion strain). Glycerol stocks stored at −80 °C were
used to streak out bacteria on appropriate agar plates, and sin-
gle colonies were picked to inoculate fresh liquid LB media.

2.2 RNA Isolation 1. Extraction buffer: 10 mM NaOAc, 150 mM sucrose, adjusted

to pH 4.8 with acetic acid. Sterilize by filtration.
2. Lysozyme solution: 20 mg/ml in 1× TE buffer. Sterilize by
filtration.
3. 20 % (w/v) SDS solution.
4. Acidic phenol (Roth). Store at 4–10 °C.
5. Chloroform.
6. TRIzol® Reagent (Ambion).
7. Phase Lock Gel™ (5Prime).
 RNA Isolation Methods 31

8. 3 M sodium acetate, pH 5.0. Store at −20 °C.

9. 100 % ethanol. Store at −20 °C.
10. Isopropanol.
11. 75 % ethanol (100 % ethanol diluted with ddH2O (v/v)).

2.3 Control of Total 1. 2× denaturing loading buffer: 0.02 % (w/v) bromophenol

RNA Quality blue, 0.02 % (w/v) xylene cyanol blue, 8 M urea, 50 % (v/v)
formamide, 2× TBE.
2. Denaturing polyacrylamide gel: 1× TBE, polyacrylamide/
bisacrylamide (24:1), 8 M urea. For polymerization, add 0.1 %
(w/v) of 10 % ammonium persulfate (APS) and 0.1 % (v/v) of
(N,N,N′,N′-tetramethylethylenediamine) (TEMED).
3. Ethidium bromide nucleic acid staining solution: 0.5 μg/ml
ethidium bromide, 1× TBE.
4. UV transilluminator.

3 Methods

Carry out all procedures at room temperature unless otherwise

specified. Total RNA was extracted from three pellets of B. subtilis
wt and one pellet of ΔbsrA cells for each extraction method (four
samples per method).

3.1 Bacterial Cell 1. Grow B. subtilis wt and ΔbsrA bacteria in 20 ml LB medium at

Cultures 37 °C in an incubation shaker at 200 rpm overnight.
2. Inoculate 300 ml of fresh medium with an overnight culture to
an OD600 of 0.05.
3. Let the cells grow to stationary phase for about 28 h in a water
bath shaker. Control growth by regularly measuring the OD600.
4. Induce outgrowth by diluting 40 ml stationary culture
(OD600 = 4 to 4.5) with 160 ml fresh prewarmed (37 °C) LB
medium and incubate under shaking (200 rpm).
5. After 3 min, harvest 40 ml of outgrowth culture for each
extraction in a 50-ml tube. Pellet the cells by centrifugation at
8,200 × g for 10 min at 4 °C (approx. 0.43 g wet cell pellet).
6. Quick-freeze cells in liquid nitrogen and store pellets at −80 °C.

3.2 RNA Isolation 1. Resuspend harvested B. subtilis cells from Subheading 3.1 in
1.6 ml extraction buffer on ice, and split the cell suspension
3.2.1 Method 1:
equally into two 2-ml tubes. The following steps refer to 800 μl
Extracting RNA Three
samples.
Times with Hot Phenol
2. Add 75 μl lysozyme solution per reaction tube and incubate
for 10 min.
32 Katrin Damm et al.

3. Add 40 μl of 20 % SDS solution and vortex thoroughly

(see Note 1).
4. For complete lysis of bacteria, put the tubes into a 65 °C water
bath for 90 s.
5. Add 800 μl of acidic phenol preheated to 65 °C and vortex
thoroughly for 15 s.
6. Invert the tube several times and vortex again for 15 s until the
sample is homogenous.
7. Incubate for 4 min at 65 °C in the water bath.
8. Dip the tubes into liquid nitrogen for at least 30 s.
9. Quickly thaw the sample in the 65 °C water bath.
10. Vortex for 5 s and centrifuge at 15,700 × g for 10 min to
separate the aqueous and organic phases.
11. Carefully pipette 3× 192 μl aliquots of the aqueous phase into
a single new tube.
12. Repeat steps 5–10 and pipette 3× 160 μl of the aqueous phase
into a single new tube.
13. Repeat steps 5–10 and finally pipette 2× 171 μl of the aqueous
phase into a single new tube (see Note 2).
14. Add 800 μl of chloroform and vortex thoroughly for 20 s.
Centrifuge at 15,700 × g for 5 min.
15. Carefully remove 2× 128 μl of the aqueous phase without any
withdrawal of interphase and organic phase.
16. For RNA precipitation, add 25.6 μl of precooled 3 M sodium
acetate, pH 5.0 (0.1 vol), and 640 μl ethanol (2.5 vol).
17. Briefly vortex and incubate for 10–20 min at −80 °C or at least
for 2 h at −20 °C.
18. Centrifuge at 15,500 × g for 30 min at 4 °C.
19. Remove and discard the supernatant (see Note 3).
20. Wash the pellet with 200 μl of 75 % ethanol by carefully adding
the ethanol solution until the entire pellet is submerged.
21. Let stand for 5 min at room temperature. Remove the super-
natant and air-dry the pellet for about 5–10 min (see Note 4).
22. Dissolve the RNA pellet in 20 μl ddH2O and store at
−20 °C. Store at −80 °C for longer periods (see Notes 5–8;
Figs. 1 and 2).

3.2.2 Method 2: 1. Resuspend bacterial cells from Subheading 3.1 in 4 ml

Extracting RNA Once extraction buffer at 4 °C.
with Hot and Once 2. Add 360 μl lysozyme solution to lyse bacterial cells and incu-
with Cold Phenol bate for 10 min.
 RNA Isolation Methods 33

Fig. 1 Detection of RNAs (115 nt and 190 nt) by Northern blot analysis using
10 % denaturing PAA gels, followed by membrane transfer and immobilization by
UV crosslinking. For each extraction method, three independent RNA prepara-
tions (a, b, and c) were processed to assess signal fluctuations between individual
RNA preparations. The experiment revealed that extraction of intermediate-sized
RNAs is more efficient with phenol methods 1 and 2 than with the TRIzol meth-
ods 3 and 4. (a) The X-ray film was exposed for 2 min. 6S-1 RNA is detectable
with all four extraction methods, although signals were stronger for RNAs pre-
pared according to methods 1 and 2. However, the 5S rRNA loading control was
hardly visible after 2 min when using the TRIzol methods 3 and 4. (b) After 10 min
of film exposure, 6S-1 RNA and 5S rRNA signals became also visible for the
TRIzol RNA preparations. However, for method 4 compared to method 3, the 5S
rRNA controls showed reduced intensities and stronger fluctuations between
individual samples. The signal above 6S-1 RNA is the 201-nt long 5′-precursor
transcript of 6S-1 RNA [2]

3. Add 200 μl of 20 % SDS solution and vortex thoroughly

(see Note 1).
4. Add 4 ml of acidic phenol preheated to 65 °C.
5. Vortex thoroughly and incubate for 5 min at 65 °C in a water
bath.
6. Incubate for 5 min at 4 °C on ice.
7. Centrifuge at 8,200 × g for 30 min at 4 °C.
8. Transfer as much aqueous phase as possible into a new tube
without any withdrawal of interphase and organic phase.
9. Add 4 ml of 4–10 °C cold acidic phenol.
10. Vortex thoroughly for 30 s and centrifuge at 8,200 × g for
30 min at 4 °C.
34 Katrin Damm et al.

Fig. 2 Northern blot detection of tiny RNAs (~14 nt) after separation on 10 %
native PAA gels (for details, see Chapter 5 in this issue). In general, ~14-mers
were enriched in RNA preparations using TRIzol as extraction reagent. (a) RNA
fixation with EDC crosslinking. Both TRIzol methods gave rise to prominent sig-
nals specific to ~14-meric pRNA transcripts synthesized in vivo by B. subtilis
σA-RNAP using 6S-1 RNA as the template. Specificity was inferred from the loss
of signal in RNA prepared from the 6S-1 RNA knockout strain (ΔbsrA). Method 2
resulted in a fainter and more diffuse signal, whereas only a very faint signal was
seen with RNA prepared by method 1. M, marker: 0.25 ng of a synthetic 6S-1
RNA-specific, 14 nt long pRNA (p146S-1, 5′-pGUU CGG UCA AAA CU-3′). Note that
p146S-1 used marker carried a 5′-monophosphate terminus, and in vivo synthe-
sized pRNAs detected in the other lanes were primary transcripts with 5′-tri-
phosphate ends. (b) RNA fixation with UV crosslinking. The same trends as in
panel A were observed, but the signals had a somewhat reduced intensity and
less distinct appearance

11. Transfer as much aqueous phase as possible into a new tube.

12. Add 4 ml of chloroform and vortex thoroughly for 30 s.
13. Centrifuge at 8,200 × g for 30 min at 4 °C.
14. Remove the aqueous phase by pipetting it into a new 50-ml
tube without any withdrawal of organic phase material.
15. Add 0.1 volume of precooled 3 M sodium acetate (pH 5.0)
and 2.5 volume of 100 % ethanol.
16. Vortex and keep for 10–20 min at −80 °C or at least for 2 h at
−20 °C.
17. Centrifuge at 8,200 × g for 30 min at 4 °C and discard the
supernatant (see Note 3).
18. Wash with 2 ml of 75 % ethanol by carefully adding the ethanol
solution until the entire pellet is submerged.
 RNA Isolation Methods 35

19. Let stand for 5 min at room temperature. Remove the ethanol
solution and air-dry the RNA pellet for about 10–15 min
(see Note 4).
20. Dissolve the RNA pellet in 40 μl of ddH2O and store the
RNA at −20 °C or −80 °C for longer periods (see Notes 5–9;
Figs. 1 and 2).

3.2.3 Method 3: RNA 1. Add 1 ml TRIzol reagent to the bacterial cell pellets from
Extraction Using TRIzol® Subheading 3.1 and resuspend the cells by pipetting up and
down to accelerate lysis (see Note 10).
2. Incubate for 5 min at 4 °C on ice and transfer 1 ml of lysate to
a new 2-ml tube.
3. Add 200 μl of chloroform per 1 ml of TRIzol® used for lysis
and vortex the sample thoroughly. Chill on ice for 15 min.
4. Centrifuge the samples at 15,700 × g for 15 min to separate the
phases (see Note 11).
5. Carefully pipette about 600 μl of aqueous phase into a new
tube (see Note 12).
6. To precipitate the total RNA, add 600 μl of 100 % isopropanol
to the aqueous phase, mix, and keep the sample at least for 1 h
at −20 °C.
7. Centrifuge at 15,500 × g for 15 min at 4 °C.
8. Remove and discard the supernatant (see Note 13).
9. Add 200 μl of precooled 75 % ethanol, vortex gently, and cen-
trifuge at 15,500 × g for 10 min at 4 °C.
10. Discard the supernatant, air-dry the pellet for 5–10 min, and
dissolve the RNA pellet in 20 μl of ddH2O (see Note 4).
11. If not used immediately, store the RNA at −20 °C or −80 °C
for extended periods (see Notes 5, 6, 8, 14, and 15) (Figs. 1
and 2).

3.2.4 Method 4: RNA 1. Centrifuge the 15-ml tubes containing the Phase Lock Gel for
Extraction Using 5 min at 8,200 × g to pellet the gel.
a Combination of TRIzol® 2. Add 1 ml of TRIzol® to the bacterial cell pellet from
and Phase Lock Gel Subheading 3.1 and resuspend the cells by pipetting up and
down several times to accelerate lysis (see Note 10).
3. Incubate for 5 min at 4 °C on ice and pipette 1 ml of the lysate
onto the Phase Lock Gel matrix.
4. Invert the tube several times by hand.
5. Add 200 μl of chloroform per 1 ml of TRIzol® used for lysis
and invert thoroughly several times. Incubate for 15 min at
4 °C on ice.
36 Katrin Damm et al.

6. Centrifuge the sample at 8,200 × g for 15 min to separate the

mixture into three phases (see Note 16).
7. Pipette the upper aqueous phase into a new 2-ml tube and
proceed with isopropanol precipitation as in step 6 of
Subheading 3.2.3 (see Notes 6, 8, 14, and 15) (Figs. 1 and 2).

3.3 Control of Total 1. Add one volume of 2× denaturing loading buffer to 6 μg of

RNA Quality total RNA.
2. Incubate the mixture at 98 °C for 3 min and put on ice
immediately.
3. Load samples onto a 5 % denaturing PAA gel.
4. Run the gel (15 cm wide, 20 cm long, 1 mm thick) in 1× TBE
buffer at 20 mA until the xylene cyanol dye has reached the
second half of the gel.
5. Stain the gel for 5 min with ethidium bromide.
6. Visualize the stained RNA under UV light using a transillumi-
nator (Fig. 3).
7. See Note 8 for general remarks.

Fig. 3 Ethidium bromide staining of total bacterial RNA separated on a 5 % dena-

turing PAA gel. Large RNAs, such as 23S and 16S rRNA, but also 5S rRNAs, are
more abundant in preparations using the phenol methods, whereas smaller RNAs
(roughly tRNAs and shorter RNAs) are enriched with TRIzol-based techniques. In all
four samples, the total RNA is considered largely intact as distinct bands and little
smearing are observed (see Note 8). However, some degradation of 23S rRNA
may have occurred in method 1 and 2 preparations, as 16S rRNA bands were
somewhat more intense than those for 23S rRNA in the corresponding lanes
 RNA Isolation Methods 37

4 Notes

1. Add SDS solution at room temperature as SDS precipitates on

ice.
2. The amount of aqueous phase decreases after each step,
whereas the volume of hot phenol remains constant.
3. After precipitation, a white RNA pellet should be clearly visible
at the wall of the tube.
4. Drying for longer periods may impair RNA dissolubility.
5. We advise to shock-freeze RNA extracts in liquid nitrogen
before storage at −20 °C or −80 °C.
6. We get about tenfold higher amounts of total RNA with the
hot phenol method 1 compared to the TRIzol methods, as
inferred from UV spectroscopy. Note that the phenol methods
1 and 2 include a heating step to 65 °C. Therefore, these
methods should be avoided when analysis of natively folded
RNA is intended.
7. The total RNA yields (as inferred from UV spectroscopy)
obtained with method 1 are about 2–3 times higher than those
obtained with method 2. Furthermore, we observed that the
signal intensity of the loading control (5S rRNA) is more uni-
form/reproducible with method 1 than with method 2.
8. After purification, the quality of the total cellular RNA needs
to be analyzed by electrophoresis under denaturing condi-
tions. We routinely use 5 % PAA gels containing 8 M urea.
Alternatively, denaturing 1.2 % agarose gels containing formal-
dehyde [3] may be used to primarily assess the quality of lon-
ger RNAs. Gels can be stained with ethidium bromide or SYBR
Gold. Bacterial 16S and 23S rRNAs and eukaryotic 18S and
28S rRNAs are the main gel bands (provided the RNA is not
substantially degraded), with the larger rRNA species having
around twice the intensity of the smaller rRNA. Distinct rRNA
bands with little “smearing” in between or below the two
rRNA species are a hallmark of integrity of RNA preparations.
9. If the RNA solution is too viscous, increase the volume with
ddH2O.
10. TRIzol contains the chaotropic reagent guanidinium isothio-
cyanate which inactivates cellular nucleases. This efficiently
protects the RNA from degradation during the isolation
process.
11. In case of insufficient phase separation, repeat vortexing and
centrifuge for another 10 min.
12. Approximately 1/4 of the aqueous phase remains in the TRIzol
extraction tube.
38 Katrin Damm et al.

13. The RNA pellet often has a transparent, gel-like appearance

after centrifugation.
14. A comparison of TRIzol methods with or without Phase Lock
Gel revealed that method 3 extraction is well reproducible as
inferred from 5S rRNA and 6S-1 RNA signals in the three par-
allel RNA samples (Fig. 1). In contrast, more fluctuations and
reduced signal intensities are apparent when involving the Phase
Lock Gel designed to facilitate phase separation (Fig. 1).
15. This method is applicable to extraction of tiny RNAs (Fig. 2).
16. The Phase Lock Gel forms a barrier between the aqueous and
organic phases.

Acknowledgment

This work was supported by the Deutsche Forschungsgemeinschaft

(GK 1384) to R.K.H. and G.K. and the Russian Foundation for
Basic Research (14-04-91336) to O.Y.B. and E.A.K.

References
1. Beckmann BM, Grünweller A, Weber MH, and in vitro analysis of 6S RNA-templated short
Hartmann RK (2010) Northern blot detection transcripts in Bacillus subtilis. RNA Biol 8(5):839–
of endogenous small RNAs (approximately 849. doi:10.4161/rna.8.5.16151, 16151 [pii]
14 nt) in bacterial total RNA extracts. Nucleic 3. Kroczek RA, Siebert E (1990) Optimization of
Acids Res 38(14):e147. doi:10.1093/nar/ northern analysis by vacuum-blotting, RNA-
gkq437, gkq437 [pii] transfer visualization, and ultraviolet fixation.
2. Beckmann BM, Burenina OY, Hoch PG, Kubareva Anal Biochem 184(1):90–95, doi: 0003-2697
EA, Sharma CM, Hartmann RK (2011) In vivo (90)90017-4 [pii]
 Part II

Visualization and Analysis of Small Non-Coding RNAs

 Chapter 5

Improved Northern Blot Detection of Small RNAs Using

EDC Crosslinking and DNA/LNA Probes
Katrin Damm, Simone Bach, Katrin M.H. Müller, Gabriele Klug,
Olga Y. Burenina, Elena A. Kubareva, Arnold Grünweller,
and Roland K. Hartmann

Abstract
Successful detection of very small RNAs (tiny RNA, ~14 nt in length) by Northern blotting is dependent
on improved Northern blot protocols that combine chemical crosslinking of RNA with 1-ethyl-3-(3-
dimethylaminopropyl)-carbodiimide (EDC) to positively charged membranes, the use of native polyacryl-
amide gels, and the development of highly sensitive and specific probes modified with locked nucleic acids
(LNA). In this protocol, we show that Northern blot detection of tiny RNAs with 5′-digoxigenin-labeled
DNA/LNA mixmer probes is a highly sensitive and specific method and, in our hands, more sensitive than
using a corresponding DNA/LNA mixmer probe with a 5′-32P-end label.

Key words Northern blot, EDC crosslinking, UV crosslinking, Digoxigenin, LNA, Native PAGE

1 Introduction

Recent advances in high-throughput sequencing methods and

bioinformatics have led to the identification of new classes of small
regulatory RNAs (sRNA) in pro- and eukaryotes. However,
expression patterns and the proof of functionality of such sRNAs
need to be confirmed with established standard techniques includ-
ing RT-qPCR, microarrays, genetic methods, and, of course,
Northern blotting. The detection of very small RNAs (miRNAs
and shorter ones, termed “tiny RNAs” in the following) poses a
challenge, as it requires highly sensitive and specific methods to
confirm their identity. This prompted the development of a spe-
cialized RT-qPCR technique, the stem-loop primer method, to
quantify individual miRNAs [1]. Nevertheless, Northern blotting
remains indispensable for a direct visualization of cellular RNAs
and their length variants ranging from primary transcripts over
processing intermediates to mature forms. A major problem for

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_5, © Springer Science+Business Media New York 2015

41
42 Katrin Damm et al.

the detection of tiny RNAs by Northern blotting is their limited

interaction surface, thus exacerbating the problem of sterically
hindering probe accessibility upon covalent immobilization on
hybridization membranes. Improved protocols have already been
described to overcome several limitations of conventional
Northern blot procedures [2, 3]. However, these advancements
have turned out to be insufficient for the detection of tiny RNAs
[4, 5]. We have recently described an approach combining native
polyacrylamide gels, RNA immobilization on nylon membranes
by 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC)
crosslinking, and nonradioactive 5′-digoxigenin (DIG)-end-
labeled oligonucleotide probes containing locked nucleic acid
(LNA) modifications for the detection of tiny RNAs with high
sensitivity and specificity [4, 5].
In this protocol, we initially describe denaturing PAGE for the
separation of sRNAs, such as 5S rRNA and 6S-1 RNA, and native
PAGE for the separation of tiny RNAs. Next, we describe the RNA
transfer to nylon membranes, followed by RNA immobilization by
UV (RNAs >50 nt) or EDC (RNAs <20 nt) crosslinking. Finally,
we outline the hybridization procedures utilizing DIG-labeled
oligonucleotide or transcript probes. We also compare the detec-
tion of tiny RNA with 5′-DIG-labeled versus 5′-32P-labeled DNA/
LNA mixmer probes.

2 Materials

Prepare all solutions with autoclaved ddH2O and analytical grade

reagents for use in molecular biology. Prepare reagents at room
temperature; store them at room temperature (short-term storage)
or in aliquots at −20 °C (long-term storage) if not stated
otherwise.

2.1 PAGE 1. 5× TBE electrophoresis buffer: 445 mM Tris base, 445 mM

and Transfer of RNA borate, 10 mM EDTA.
to Nylon Membranes 2. Native polyacrylamide gel: 1× TBE, polyacrylamide/bisacryl-
amide (24:1); for polymerization, add 0.1 % (w/v) of 10 %
ammonium persulfate (APS) and 0.1 % (v/v) of N,N,N′,N′-
tetramethylethylenediamine (TEMED).
3. Denaturing polyacrylamide gel: 1× TBE, polyacrylamide/
bisacrylamide (24:1), 8 M urea. For polymerization, add 0.1 %
(w/v) of 10 % APS and 0.1 % (v/v) of TEMED.
4. 2× native loading buffer: 0.025 % (w/v) bromophenol blue,
0.025 % (w/v) xylene cyanol blue, 20 % (v/v) glycerol.
5. 2× denaturing loading buffer: 0.02 % (w/v) bromophenol
blue, 0.02 % (w/v) xylene cyanol blue, 8 M urea, 50 % (v/v)
formamide, 2× TBE.
 Northern Blotting of Tiny RNAs 43

6. Whatman paper (GE Healthcare), 1.5 mm thickness.

7. Positively charged nylon membrane, 10 × 15 cm (Roche
Diagnostics).
8. Semidry blotter.

2.2 UV and EDC 1. UV crosslinker.

Crosslinking 2. EDC solution: 12.5 M 1-methylimidazole (stock; ACROS),
for Fixation of RNAs 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride
on Membranes (also termed N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide
hydrochloride). Prepare just before use: add 245 μl of 12.5 M
1-methylimidazole to 8 ml ddH2O and adjust the pH to 8.0
with HCl. Add 753 mg 1-ethyl-3-(3-dimethylaminopropyl)-
carbodiimide hydrochloride (Sigma Aldrich) and adjust the
volume to 24 ml with ddH2O.
3. Saran film.

2.3 Probe Generation 1. 10× DIG labeling mix (Roche Diagnostics).

by T7 Transcription 2. T7 RNA polymerase and 10× transcription buffer (Roche
Diagnostics).
3. Bacillus subtilis antisense 5S rRNA (~115 nt). For the tran-
scription of antisense 5S rRNA, a PCR template of ~130 bp
was used.
4. B. subtilis antisense 6S-1 RNA (~190 nt). For the transcription
of antisense 6S-1 RNA, a linearized pUC18 plasmid derivative
was employed.
5. EDTA solution: 200 mM, pH 8.0. Sterilize by filtration and
store at −20 °C.

2.4 Hybridization 1. RNA p146S-1: 5′-GUU CGG UCA AAA CU-3′; HPLC purified
and Detection and desalted, with 5′-OH ends.
Procedures 2. RNA p156S-2, 5′-AAA GGU UAA AAC UUA-3′; RNA p206S-2,
5′-AAA GGU UAA AAC UUA AUU CA-3′; both RNAs HPLC
purified and desalted, with 5′-OH ends.
3. Probe for p146S-1: 5′-DIG-aGt tTt gAc cGa Ac-3′. Probes for
6S-2 pRNAS: 5′-DIG-gTt tTa aCc tTt-3′ or 5′-taa gTt tTa acC
tTt-3′ for 5′-32P-end labeling. DNA residues appear in lower-
and LNA residues in uppercase letters (oligonucleotides obtained
from Exiqon, HPLC purified and desalted).
4. Hybridization solution: DIG Easy Hyb Granules (Roche
Diagnostics) (see Note 1) [4].
5. Hybridization oven.
6. 20× SSC: 3 M NaCl, 0.3 M sodium citrate, pH 7.0.
7. Stringent wash buffer I: 2× SSC, 0.1 % (w/v) SDS.
8. Stringent wash buffer II: 0.1× SSC, 0.1 % (w/v) SDS.
44 Katrin Damm et al.

9. 10× maleic acid buffer (1 M maleic acid, 1.5 M NaCl, pH 7.5;

Roche Diagnostics).
10. 10× blocking solution (Roche Diagnostics). Diluted 1:10 in
1× maleic acid buffer.
11. Antibody solution: 1× blocking solution with Anti-Digoxigenin-
AP Fab fragments (Roche Diagnostics) diluted 1:10,000.
12. 10× wash buffer (Roche Diagnostics).
13. 10× detection buffer (Roche Diagnostics).
14. CDP-Star reagent (Roche Diagnostics).
15. Kodak BioMax Light Film.
16. Transparent plastic (polyethylene) tube film (Rische +
Herfurth); width × thickness: 250 × 0.05 mm.
17. Plastic bag sealer.
18. Phosphorimager: Fuji FLA-3000 R and the software AIDA,
version 3.45 (Fujifilm).

3 Methods

3.1 PAGE 1. Add one volume of 2× denaturing loading buffer to 3 μg of

and Transfer of RNA total RNA.
to Nylon Membranes 2. Incubate the mixture at 98 °C for 3 min and put on ice
3.1.1 Intermediate-Sized immediately.
RNAs (100–200 nt) 3. Load the samples on a 10 % denaturing PAA gel and run the
gel (15 cm wide, 20 cm long, 1 mm thick) in 1× TBE at
20 mA. Stop electrophoresis when the xylene cyanol dye
reaches the bottom of the gel.
4. After electrophoresis, soak the gel in 0.5× TBE for 5 min.
5. To prepare the RNA transfer to a positively charged nylon
membrane using a semidry blotting apparatus, soak a piece of
Whatman paper (gel-sized) in 0.5× TBE and place it on the
anode plate.
6. On top, layer the following items in this order: membrane
(soaked with 0.5× TBE, gel-sized), the gel to be transferred, a
piece of Whatman paper (soaked in 0.5× TBE, gel-sized).
7. After putting the cathode plate on top, run the transfer for 1 h
at 1.15 mA/cm2 or at 0.27 mA/cm2 overnight (see Note 2).

3.1.2 Tiny RNAs (~14 nt) 1. Mix 6 μg of total RNA with one volume of 2× native loading
buffer.
2. Incubate the mixture at 98 °C for 3 min and put on ice
immediately.
 Northern Blotting of Tiny RNAs 45

3. Load the samples on a 10 % native PAA gel and run the gel
(15 cm wide, 20 cm long, 1 mm thick) in 1× TBE at 15 mA
(see Note 3).
4. Stop electrophoresis when bromophenol blue has reached the
second half to two-thirds of the gel.
5. After electrophoresis, soak the gel in 0.5× TBE for 5 min.
6. For transfer, proceed as in steps 5 and 6 of Subheading 3.1.1.
7. After putting the cathode plate on top, run the transfer over-
night at 0.27 mA/cm2 (see Notes 2 and 4).

3.2 UV and EDC 1. Put the membrane on a glass plate with RNA pointing upward.
Crosslinking 2. Fix RNA by UV crosslinking with 120 mJ/cm2.
for Fixation of RNAs
3. Wrap in saran film and store at 4 °C until use.
on Membranes
3.2.1 UV Crosslinking

3.2.2 EDC Chemical 1. Place the membrane on a Whatman paper soaked with EDC
Crosslinking solution (see Note 5).
2. Wrap in saran film and incubate for 2 h at 60 °C.
3. Carefully wash the membrane with ddH2O for 5–10 min.
4. Wrap in saran film and store at 4 °C until use (see Note 6).

3.3 Probe Generation 1. Mix 1 μg of linear plasmid DNA or PCR template, 2 μl of 10×
by T7 Transcription T7 transcription buffer, 2 μl of 10× DIG labeling mix, and
40 U of T7 RNA polymerase.
2. Add ddH2O to 20 μl and incubate at 37 °C.
3. After 1 h, add 2 μl of T7 RNA polymerase and incubate for
another 1 h at 37 °C.
4. Stop the transcription reaction by adding 2 μl of 200 mM
EDTA and store at −20 °C.

3.4 Hybridization 1. Preheat 8 ml of hybridization solution as well as the hybridiza-

and Detection tion tube to 68 °C.
Procedures 2. Insert the membrane into the hybridization tube (see Note 7).
3.4.1 Hybridization Add hybridization solution and pre-hybridize for 2 h at 68 °C
of Intermediate-Sized with slow rotation in a hybridization oven.
RNAs (100–200 nt) 3. As probe, prepare 5 μl of a 1:100 dilution of the T7 transcrip-
tion reaction for the 5S rRNA antisense transcript or 10 μl of
the undiluted T7 transcription reaction for the antisense 6S-1
RNA (see Note 8).
4. Denature the probe at 98 °C for 3 min and put immediately
on ice.
5. Add the denatured probe to 8 ml hybridization solution that
was preheated to 68 °C.
46 Katrin Damm et al.

6. Remove (and discard) the pre-hybridization solution from the

tube. Add the probe-containing hybridization solution from
step 5 to the tube with the membrane.
7. Hybridize at 68 °C overnight.

3.4.2 Hybridization 1. Proceed as described in steps 1 and 2 of Subheading 3.4.1,

of Tiny RNAs (~14 nt) except that the pre-hybridization is performed at 50 °C.
2. Denature 300 pmol of a DIG-LNA/DNA mixmer for 3 min at
98 °C and put immediately on ice (see Note 9).
3. Add the denatured probe to 8 ml hybridization solution that
was preheated to 50 °C. Discard the pre-hybridization solu-
tion and add the hybridization solution to the hybridization
tube with the membrane.
4. Hybridize at 50 °C overnight.

3.4.3 Detection of RNAs Carry out all washing steps under slow shaking at room
Hybridized to Digoxigenin- temperature.
Labeled Probes
1. Wash the membrane twice for 5 min in stringent wash
buffer I.
2. Wash the membrane twice for 15 min in stringent wash buffer II.
3. Wash the membrane for 2–5 min in ddH2O.
4. Incubate the membrane in 1× blocking solution for 30 min.
5. Incubate the membrane in antibody solution for at least
30 min.
6. Wash the membrane twice for 15 min in 1× wash buffer.
7. Incubate the membrane in 1× detection buffer for 5 min.
8. Cut an appropriate piece of plastic tube film; additionally cut
one of the long sides and spread the plastic film as a single layer
on the bench.
9. Put the membrane on the film with RNA pointing upward.
10. Add 5 ml of detection buffer including 2.5 μl of CDP-Star
(see Note 10) until the membrane is homogeneously covered
with solution. Fold back the plastic film to cover the top of
the membrane and seal the plastic bag at the three open edges
(see Note 11).
11. Avoid air bubbles and incubate for 5 min to allow a robust
chemical signal to appear.
12. Place an X-ray film on top of the membrane bag and expose for
5–60 min, depending on the signal. For 5S rRNA and 6S-1
RNA detection, the first film exposition is 10 min, whereas
40–60 min are usually applied to the initial detection of tiny
RNAs. If signals are too weak or overexposed, a different time
is used for a second film exposition (see Note 12) (Fig. 1).
 Northern Blotting of Tiny RNAs 47

Fig. 1 Northern blot analysis. (a) Detection of the 5S rRNA (115 nt) and the 6S-1 RNA (190 nt) using 10 %
denaturing PAA gels, followed by transfer on a nylon membrane and immobilization by UV crosslinking. Total
RNAs from stationary phase cells of B. subtilis PY79 were extracted either by the hot phenol/cold phenol
method or the TRIzol method (see Chapter 4). For each extraction method, three independent RNA preparations
(a, b, and c) were loaded onto the gel. For more details, see Chapter 4. (b) Detection of tiny RNAs (~14 nt) after
separation on a 10 % native PAA gel, transfer to a nylon membrane, and RNA fixation either by EDC or UV
crosslinking. As a control, total RNA from a B. subtilis PY79 mutant strain lacking the gene encoding for the
6S-1 RNA (ΔbsrA) was analyzed in parallel

3.4.4 Dot Blot Analysis 1. Spot 1 μl drops of varying amounts (2 pg–10 ng in ddH2O) of
to Compare Tiny RNA chemically synthesized RNA oligonucleotides carrying 5′-OH
Detection Sensitivity Using ends (p146S-1, p156S-2 or p206S-2) in a defined pattern onto a
5′-DIG- Versus nylon membrane (~10 × 4 cm).
5′-32P-Labeled Probes 2. Air-dry and immobilize the pRNA oligonucleotides by EDC
crosslinking as described in Subheading 3.2.2.
3. Denature 300 pmol of a 5′-DIG-LNA/DNA mixmer probe or
2 × 106 Cherenkov cpm of a 5′-32P-end-labeled DNA/LNA
mixmer probe for 3 min at 98 °C and put immediately on ice.
4. Pre-hybridize and hybridize the membrane as described in
Subheading 3.4.2.
5. In the case of the 5′-DIG-labeled probe, perform detection as
described in Subheading 3.4.3 (see Note 11).
6. For detection using the 5′-32P-labeled probe, proceed to step 7
after the hybridization step.
48 Katrin Damm et al.

Fig. 2 Dot blot analysis using a 5′-DIG-end-labeled or a 5′-32P-end-labeled DNA/

LNA mixmer probe. The chemically synthesized pRNA oligonucleotides mimicking
transcripts of the B. subtilis σA-RNA polymerase using 6S-1 or 6S-2 RNA as tem-
plate [8] are specified in Subheading 2.4. (a) X-ray films for chemiluminescence
detection were exposed for 15 s (top panel) or 1 min (bottom panel). (b) For the
5′-32P-labeled probe, a phosphorimager detection screen was exposed for 6 h.
Small letters in the probe sequences below the panels indicate DNA residues;
uppercase letters indicate LNA residues

7. Wash the membrane twice for 30 s in stringent wash buffer I.

8. Expose an image plate on the membrane for 6 h and visualize
the signals using a phosphorimager (Fig. 2) (see Note 13).

4 Notes

1. Alternatively, one may use a solution containing 50 mM

Na2HPO4/NaH2PO4, pH 7.0, 0.02 % (w/v) SDS, 4 M urea [4].
2. Take care to avoid any air bubbles between the membrane and
the gel.
 Northern Blotting of Tiny RNAs 49

3. Native PAA gels allow detection of complexes consisting of

more than one RNA, enable separation of RNAs of identical
length based on conformational differences, and have the poten-
tial to reveal different conformers of individual RNA species.
We demonstrated that native gels increased the detection sensi-
tivity of tiny RNAs in protocols employing EDC crosslinking
[4, 5]. This was attributed to the presence of urea in denaturing
PAGE, indicating that the amino groups of urea compete with
the amines of the nylon membrane for reaction with the EDC
crosslinker. For the same reason, Tris buffers are better avoided
in EDC crosslinking protocols.
4. To transfer short RNAs from PAA gels to nylon membranes,
we use semidry blotting in 0.5× TBE for at least 6 h.
5. The membrane side with blotted RNA should not get in direct
contact with the EDC solution to avoid detachment of RNA.
6. Several methods are in use to fix RNA on membranes. The
most frequently applied techniques are UV crosslinking or
membrane “baking” at 80 °C. Drawbacks of these methods
include that heterocyclic bases form covalent bonds with the
amine groups of the membrane surface (UV crosslinking) or
that the heterocyclic bases engage in hydrophobic interactions
with aromatic groups of the membrane (baking). This steri-
cally precludes the involved bases from pairing with comple-
mentary probes, leading to a decrease of signal strength,
particularly in the case of short RNAs. Chemical crosslinking
with EDC circumvents this problem, as primarily the 5′-phos-
phate groups react with membrane amines so that internal
bases remain accessible to probe hybridization [2, 6]. Although
EDC crosslinking works most efficiently with 5′-phosphory-
lated RNAs, it also works to some extent with RNAs carrying
5′-OH termini, likely through reaction with internal phospho-
diester groups [5].
7. Make sure that the RNA side of the membrane does not touch
the glass wall but is directed inward.
8. For each RNA to be detected, the amount of probe has to be
determined because of different expression levels.
9. The affinity of oligonucleotide probes for the detection of tiny
RNAs can be improved by incorporation of locked nucleic acid
(LNA) modifications into DNA oligonucleotides. Such DNA/
LNA mixmers allow increased hybridization temperatures [4, 5].
LNA-modified oligonucleotides can be obtained from Exiqon
with a digoxigenin label at the 5′ and/or 3′ end. A double
digoxigenin label will enhance detection sensitivity.
10. We previously reported to use CDP-Star at a dilution of 1:200
[7]; however, the 1:2,000 dilution works as well.
11. Alternatively, homogeneously distribute 1 ml of detection
buffer containing 5 μl of CDP-Star on the membrane.
50 Katrin Damm et al.

Fold back the plastic film to cover the top of the membrane.
When the plastic film contacts the membrane surface, capillarity
leads to the homogeneous spreading of detection buffer/
CDP-Star solution on the membrane. In this case, sealing of
the plastic film is not necessary.
12. Take care that the membrane does not run dry after detection
if subsequent stripping is intended.
13. Comparison of tiny RNA detection using a 5′-DIG- versus an
almost identical 5′-32P-labeled oligonucleotide probe is illus-
trated in Fig. 2. Apart from the additional methodological effort
of the digoxigenin/chemiluminescence detection system, many
laboratories use 32P-labeled probes in Northern blot experi-
ments to be able to quantify signals by phosphorimaging.
Reported advantages of the digoxigenin detection system are
lower background signals and reduced exposure times [7]. Here
we directly compared detection of tiny RNAs by LNA/DNA
mixmer probes that were either 5′-DIG- or 5′-32P-end-labeled.
The results illustrated in Fig. 2 support the good sensitivity and
specificity of the digoxigenin/chemiluminescence system, as
inferred from low background signals obtained with the p146S-1
control RNA oligonucleotide. In our hands, the sensitivity of
tiny RNA detection was reduced when using the 5′-32P-end-
labeled LNA/DNA mixmer probe (Fig. 2b). Note that such
probes should have at least two DNA residues at the 5′ end for
efficient 5′ end-labeling with T4 polynucleotide kinase and
[γ-32P]-ATP. 5′ end-labeling of oligonucleotides with 5′-terminal
LNA residues has been very inefficient in our hands.

Acknowledgment

This work was supported by the Deutsche Forschungsgemeinschaft

(GK 1384) to R.K.H. and G.K. and the Russian Foundation for
Basic Research (14-04-91336) to O.Y.B. and E.A.K.

References
1. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee piRNA by northern blot. Nucleic Acids Res
DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar 35(8):e60. doi:10.1093/nar/gkm112, gkm112
VR, Andersen MR, Lao KQ, Livak KJ, Guegler [pii]
KJ (2005) Real-time quantification of microR- 3. Varallyay E, Burgyan J, Havelda Z (2008)
NAs by stem-loop RT-PCR. Nucleic Acids Res MicroRNA detection by northern blotting
33(20):e179. doi:10.1093/nar/gni178, using locked nucleic acid probes. Nat Protoc
33/20/e179 [pii] 3(2):190–196. doi:10.1038/nprot.2007.528,
2. Pall GS, Codony-Servat C, Byrne J, Ritchie L, nprot.2007.528 [pii]
Hamilton A (2007) Carbodiimide-mediated 4. Beckmann BM, Grünweller A, Hartmann RK
cross-linking of RNA to nylon membranes (2014) Northern blot detection of endogenous
improves the detection of siRNA, miRNA and small RNAs. In: Hartmann RK, Bindereif A,
 Northern Blotting of Tiny RNAs 51

Schön A, Westhof E (eds) Handbook of RNA 7. Grünweller A, Müller PK (1997) Low back-
biochemistry, 2nd edn. Wiley-VCH, Weinheim, ground and short exposure times in mapping of
pp 89–103 DNaseI-hypersensitive sites using digoxigenin-
5. Beckmann BM, Grünweller A, Weber MH, labeled probes. Anal Biochem 247(1):172–175.
Hartmann RK (2010) Northern blot detection of doi:10.1006/abio.1997.2044, S0003-2697(97)
endogenous small RNAs (approximately 14 nt) 92044-3 [pii]
in bacterial total RNA extracts. Nucleic Acids 8. Burenina OY, Hoch PG, Damm K, Salas M,
Res 38(14):e147. doi:10.1093/nar/gkq437, Zatsepin TS, Lechner M, Oretskaya TS,
gkq437 [pii] Kubareva EA, Hartmann RK (2014) Mechanistic
6. Pall GS, Hamilton AJ (2008) Improved northern comparison of Bacillus subtilis 6S–1 and 6S–2
blot method for enhanced detection of small RNAs–commonalities and differences. RNA
RNA. Nat Protoc 3(6):1077–1084. doi:10.1038/ 20(3):348–359. doi:10.1261/rna.042077.113,
nprot.2008.67, nprot.2008.67 [pii] rna.042077.113 [pii]
 Chapter 6

Direct Cloning of Double-Stranded RNAs

Manli Shen, Marina Falaleeva, Natalia Korotkova, and Stefan Stamm

Abstract
Most annotated genomes show a large number of sense–antisense transcripts that can generate double-
stranded RNAs. We describe a method to clone these dsRNAs from total RNA preparations.

Key words Cloning, dsRNA, Sense–antisense pair

1 Introduction

Recent advances in whole-genome sequencing techniques showed

the widespread expression of sense–antisense transcript pairs (SAP)
generated by expression from overlapping loci on opposite DNA
strands (Fig. 1). Bioinformatic predictions based on expressed
sequence tags identified about 3,000 sense–antisense pairs in
humans, corresponding to about 20 % of human transcripts [1].
Global transcript analysis estimated that about 70 % of transcripts
in eukaryotic cells have an antisense partner with either full or par-
tial sense/antisense coverage [2]. SAPs are frequently found
around promoter regions and show substantial variation among
cell lines [3]. SAPs are also found in all kingdoms of life: plants,
yeast, bacteria, and archaea [4–10]. On a molecular level, SAPs will
generate dsRNA molecules through base pairing of the sense and
antisense transcripts.
The best understood function of dsRNAs is RNA interference
where dsRNAs are cleaved into 21–23 nt-long dsRNA fragments.
A single RNA strand is subsequently loaded onto argonaute pro-
teins. The argonaute–RNA complex binds to other RNAs and
influences transcription, cleaves other RNAs, or guides chromatin
modifications [11]. Another well-studied effect of dsRNAs is
interferon-mediated responses, where dsRNAs longer than 30 nt
produced by viruses cause programmed cell death [12]. dsRNAs
are the substrate for adenosine deaminases acting on RNA, which
leads to a conversion of adenosines to inosines in numerous

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_6, © Springer Science+Business Media New York 2015

53
54 Manli Shen et al.

Fig. 1 Overview of a eukaryotic sense–antisense transcript pair. The transcripts

are generated by transcription in the opposite direction at a given locus. The
promoters are indicated by arrows, indicating the direction of transcription. DNA
is depicted as a double strand, RNA as single lines. The area that is boxed with a
dashed line generates both sense and antisense RNA expression and can result
in double-stranded RNA. SAP sense–antisense pair

dsRNAs [13]. Other described functions of SAP transcripts include

changes in alternative splicing and alternative polyadenylation
caused by masking regulatory elements [14, 15] or by recruiting
protein complexes involved in chromatin modifications and remod-
eling [16], leading, for example, to X-chromosome inactivation
[17]. Defects in antisense transcription have been implicated in
cancer development [16, 18] and neurodevelopmental disorders
[19, 20]. The mechanisms of SAP transcripts have been covered in
excellent reviews [6, 21–24].
Despite the importance of dsRNAs, no direct cloning method
to identify dsRNAs has been described. The major obstacle is the
addition of a linker allowing reverse transcription to dsRNAs. We
could circumvent this problem by using adenylated linkers that
efficiently ligate to dsRNAs [25]. Furthermore, the use of a reverse
transcriptase working at higher temperatures helps in generating
cDNAs. Prior to cloning, dsRNAs are isolated from total RNA by
digesting single-stranded RNA regions using a mixture of the
RNases A and T1. The analysis of the cloned fragments showed
that about 60 % of the transcripts isolated from mouse brain were
present in dsRNA forms with an average length of 130 nt.
An overview of the method is shown in Fig. 2. Briefly, single-
stranded RNAs are digested; the remaining double-stranded RNAs
are dephosphorylated and gel purified. An adenylated linker
is added to the 3′ end, and after phosphorylation, a second linker
is added to the 5′ end. Both linkers are in a Y-shaped configuration
that facilitates the subsequent RT-PCR. Prior to cloning, we add a
single-stranded, antisense radiolabeled RNA to the probe, which
allows monitoring of all the cloning steps.
 dsRNA Cloning 55

Fig. 2 Overview of the method. (a) The individual steps are shown. (b) Structure of the cDNA generated through
cloning. The 5′ ends of the former dsRNA are indicated by arrows. Stars indicate a 5-amino C6 modification at
the 5′ end. (c) Mechanism of the ligation reaction using an adenylated (preactivated) oligonucleotide. B the
base at the 3′ end ribose. C first base of linker 1
56 Manli Shen et al.

Fig. 2 (continued)

2 Materials

Use molecular biology grade reagents only. Keep all solutions and
working area ribonuclease-free.

2.1 RNA Antisense 1. DNA template for RNA antisense probe transcription (see
Probe Transcription Note 1).
2. 10× transcription reaction buffer: 500 mM Tris–HCl, pH 7.5,
150 mM MgCl2, 50 mM DTT, 20 mM spermidine.
 dsRNA Cloning 57

3. RNA polymerase (T3, T7, or SP6).

4. NTP mix (ATP, CTP, GTP).
5. [Alpha-32P] UTP for probe labeling (800 Ci/mmol and
10 mCi/ml or greater).
6. TURBO DNase I (Ambion, Life Technologies).
7. 5 M ammonium acetate.
8. 37 °C water bath.
9. Microtube pestles.

32
2.2 RNase Digestion 1. P-labeled RNA antisense probe.
2. Total RNA.
3. Yeast RNA.
4. 5× hybridization stock solution: 200 mM PIPES, pH 6.4, 2 M
NaCl, 5 mM EDTA. Prepare 1× working solution using one
part of stock solution plus four parts of freshly deionized
formamide.
5. RNase T1 (1,000 units/μl) and RNase A (1 mg/ml).
6. RNA digestion buffer: 10 mM Tris–HCl, pH 7.5, 300 mM
NaCl, 5 mM EDTA.
7. Antarctic Phosphatase (New England Biolabs).
8. 20 % SDS (w/v).
9. Proteinase K (20 mg/ml).
10. GlycoBlue (Life Technologies).
11. Phenol/chloroform.
12. Ethanol (70 and 100 %).
13. 42 °C water bath.
14. RNA loading buffer (80 % deionized formamide, 1 mM EDTA,
0.1 % bromophenol blue, 0.1 % xylene cyanol).
15. RNA Decade marker (Life Technologies).
16. Urea.
17. 40 % acrylamide, 2 % bisacrylamide solution.
18. Vertical gel electrophoresis apparatus (20 cm) and power
supply.
19. Saran film wrap.
20. Cassette for film development.
21. X-ray film.

2.3 RNA Cloning 1. Scalpel to cut gel slice.

2. RNA elution buffer: 3 M ammonium acetate, 1 % SDS (W/V),
1 mM EDTA.
3. T4 RNA ligase.
58 Manli Shen et al.

4. T4 polynucleotide kinase.
5. T4 DNA ligase.
6. Linker A: 5′ rAppCTGTAGGCACCATCAAT/3ddC.
7. Linker B: 5′ AmMC6/GCTCCAGAATTCGGACCCGArGr
UrGrCrCrUrArCrArG.
8. MonsterScript reverse transcriptase (Epicentre, Illumina).
9. PCR reaction components: Taq DNA polymerase, MgCl2,
dNTP mix.
10. Primer for RT: 5′ GATTGATGGTGCCTACAG 3′.
11. Forward primer: 5′ GCTCCAGAATTCGGACCCGAGTG 3′.

3 Methods

Carry out the procedures at room temperature unless otherwise

specified.

3.1 RNA Antisense This step generates a radioactive probe in vitro that hybridizes to
Probe Transcription an RNA present in the sample. The protected fragment can be
detected by autoradiography. Any abundant RNA can be targeted.
Figure 3 illustrates a probe against abundant small nucleolar RNAs.
1. For the in vitro transcription reaction, combine the following:
2 μl of 10× transcription buffer (see Note 2); 3 μl of ATP, CTP,
and GTP mixture (3.3 nM each); 5 μl of 32P-UTP; DNA tem-
plate (5–10 pmol); 2 μl RNA polymerase. Bring the total reac-
tion to 20 μl with water.
2. Incubate at 37 °C for 1 h.
3. Add 1 μl TURBO DNase to degrade the remaining DNA
template.
4. To purify the full-length probe (see Note 3), run the in vitro
transcribed RNA on a 10 % acrylamide TBE gel, briefly expose
on X-ray film, and cut out the corresponding gel slice.
5. Purify the gel slice as described in Subheading 3.3.

3.2 RNase Digestion In this step, the radioactive-labeled probe is annealed to the target
RNA, generating an RNase-resistant double-stranded RNA while
single-stranded RNAs are digested. In the further cloning steps,
the RNases are removed by proteinase K treatment. To allow liga-
tion of linkers, the RNA is dephosphorylated by shrimp alkaline
phosphatase prior to the proteinase K step.
The remaining double-stranded RNAs are subsequently sepa-
rated on an 8 M urea TBE gel. The urea in the gel denatures the
double-stranded RNAs. Since the two strands have the same size,
they will not be separated by the gel and reanneal in the subsequent
 dsRNA Cloning 59

a b
RNAse RNA cDNA synthesis RT
RNA RNAse + Marker Control
Marker digestion 3’ Linker

1 2 3
1

Fig. 3 Example of addition of linkers to the protected RNA. Total mouse brain RNA
was annealed with a radioactively labeled probe and digested with RNases A and
T1. After dephosphorylation and purification, the 3′ linker was added. Note the
shift in the mobility of the bands. Gel slices 1, 2, and 3 were cut out, and RNA was
isolated using gel soaking method as described. After addition of the 5′ linker,
cDNA was generated from each fraction in the presence of radiolabeled dCTP
and separated on a denaturing 15 % acrylamide gel containing 8 M urea. (a)
Signal from an RNase protection before (left) and after (right) addition of linkers.
(b) Signal of the reverse transcription reaction using radiolabeled dCTP

isolation steps. The purification step is necessary to remove the

2–5 mer oligonucleotides that resist the RNase digestion.
1. For the hybridization of RNAs, mix the probe and the RNA
(see Note 4) and add 1/10th volume of 5 M ammonium ace-
tate and 2.5 volumes of ethanol. Mix thoroughly.
2. Set up two control reactions with equal amounts of labeled
probe and yeast RNA equivalent to the highest amount of
sample RNA.
3. Allow the RNA to precipitate at −80 °C for 30 min.
4. Pellet the RNA by centrifugation at full speed for 15 min at
4 °C.
60 Manli Shen et al.

5. Wash the pellets with 70 % ethanol.

6. Let the pellets dry for 5 min.
7. Resuspend the pellets in 10 μl hybridization buffer and mix
thoroughly.
8. Incubate for 5 min at 95 °C to denature RNA.
9. Remove the hybridization reaction and immediately incubate
overnight at 42 °C to anneal SAPs.
10. Dilute RNase A and RNase T1 into RNase digestion buffer
(see Note 5).
11. Add 350 μl of RNase digestion mixture into each hybridization
reaction except for one of the two control reactions.
12. In the same reaction, add 1× phosphatase buffer to include the
zinc needed and dephosphorylate the RNA using 1 μl alkaline
shrimp phosphatase that also removes 2′3′ cyclophosphates.
13. Incubate at 37 °C for 30 min.
14. Stop the reactions by adding 10 μl of 20 % SDS and 5 μl of
20 mg/ml proteinase K.
15. Incubate at 37 °C for 15 min.
16. Extract RNA with 350 μl of phenol/chloroform.
17. Remove the aqueous phase to a clean microcentrifuge tube.
18. Add 1–2 μl GlycoBlue as a carrier and 800 μl of 100 %
ethanol.
19. Precipitate RNA at −80 °C for 30 min.
20. Resuspend the pellets into 10 μl of RNA loading buffer.
21. Run the samples on a 15 % denaturing gel at 300 V until the bro-
mophenol blue dye has run one-half to two-thirds of the gel.

3.3 RNA Cloning In this step, two linkers (Fig. 2b) are ligated to the dsRNA. We
found that dsRNAs react efficiently with adenylated linkers and T4
RNA ligase. However, in our hands, the ligation with standard
RNA or DNA oligonucleotides is very inefficient. We use a Y-shaped
linker design that has been used in miRNA cloning (Fig. 2b).
The ligation of the second linker is efficient at room temperature.
1. Cut the gel slices (see Note 6).
2. Recover the protected short RNA fragments (or the probe for
Subheading 3.1) by crushing the gel using a pestle that fits in
microtubes or using a disposable pipette (see Note 7).
3. Soak the crushed gel in 400 μl of RNA elution buffer at 37 °C
overnight on a shaker.
4. Remove the gel fragments with centrifugation and ethanol-
precipitate the RNA fragments, adding 1 μl GlycoBlue as a
carrier.
 dsRNA Cloning 61

5. Resuspend pellet in 20 μl TE buffer.

6. Add the 3′ linker A to the recovered RNA fragments using T4
RNA ligase.
7. Ligate at 37 °C for 2 h in 20 μl reaction containing 1× RNA
ligase buffer, 8.3 % (v/v) glycerol, 10 % PEG 5000, and 20 unit
RNA ligase (see Note 8).
8. Precipitate the RNA and resuspend the pellet in 20 μl TE
buffer.
9. Phosphorylate the 5′ end of RNA fragments using T4 poly-
nucleotide kinase.
10. Purify the RNA fragments on a 15 % denaturing polyacryl-
amide gel. This step is necessary to remove excess linkers.
11. Cut the gel slices out, crush the slices, and elute in elution
buffer.
12. Precipitate the RNA fragments with 100 % ethanol and resus-
pend in 20 μl TE buffer.
13. Add the 5′ linker B to the RNA fragments (4 μM).
14. Perform ligation using T4 DNA ligase at 20 °C overnight in
1× ligase buffer containing ATP.
15. Ethanol-precipitate and dissolve RNA in 10 μl TE buffer.
16. Reverse transcribe the RNA fragments with MonsterScript
reverse transcriptase as follows: 95 °C for 3 min, 60 °C for
40 min.
17. Spike one-tenth of the reaction with 2 μl alpha-32P dCTP to
monitor second-strand synthesis.
18. Run an aliquot of this reaction on a 15 % denaturing
polyacrylamide gel.
19. Amplify the RT mixture by PCR using the RT and forward
primers.
20. The PCR products are analyzed by standard deep sequencing.
Typical results of the procedure are shown in Fig. 4.

4 Notes

1. Both PCR product and linearized DNA plasmid can be used as

DNA template for in vitro transcription.
2. Buffer needs to be completely thawed before adding into the
reaction.
3. It is necessary to use the full-length transcripts as RNA antisense
probe for the RNA protection assay.
62 Manli Shen et al.

a cloned dsRNAs

Sense gene, protein coding (Dlgap2) SAP region

Antisense transcripts,
unknown function
b M C F R C F R

Dlgap2 Dlgap2
primer1 primer2

Fig. 4 Identification of double-stranded RNAs in the ADAT1 gene locus. (a) Visualization of the dsRNA data on
the UCSC browser. The dsRNA track contains the dsRNA that was cloned. Each dsRNA is represented by a
vertical line. SAPs are generated through the Dlgap2 transcript and expressed sequence tag Av016332. Note
that experimentally, dsRNAs can be detected outside SAP regions, indicating the presence of non-annotated
antisense RNAs. (b) RT-PCR validation of dsRNAs in the Dlgap2 locus shown in (a) on the left. F and R indicate
the detection of sense and antisense RNAs, respectively. The primers amplify the dsRNA indicated by closed
arrows in the left panel

4. The amounts of antisense probe and sample RNA depend on

the abundance of the targeted RNA. Keep three- to tenfold
molar excess of antisense probe over target RNA in the hybrid-
ization reaction.
5. The amount of RNases needs to be optimized. Start with
1:100 dilution.
6. We usually divide the gel into three different size regions that
are cut out (Fig. 3).
7. Any other way to crush gel slices is fine.
8. The rAppC moiety at the 5′ end of the linker allows its ligation
without ATP to the 3′ hydroxyl end of a nucleic acid. The 3′
end of the primer is blocked by inclusion of ddCTP.

Acknowledgment

This work was supported by GM083187 and P20GM1034865-10

from the NIH and an endowment of the University of Kentucky.
 dsRNA Cloning 63

References
1. Chen J, Sun M, Kent WJ, Huang X, Xie H, pylori. Nature 464(7286):250–255.
Wang W, Zhou G, Shi RZ, Rowley JD doi:10.1038/nature08756
(2004) Over 20 % of human transcripts 8. Nicolas P, Mader U, Dervyn E, Rochat T,
might form sense-antisense pairs. Nucleic Leduc A, Pigeonneau N, Bidnenko E,
Acids Res 32(16):4812–4820. doi:10.1093/ Marchadier E, Hoebeke M, Aymerich S, Becher
nar/gkh818 D, Bisicchia P, Botella E, Delumeau O, Doherty
2. Katayama S, Tomaru Y, Kasukawa T, Waki K, G, Denham EL, Fogg MJ, Fromion V, Goelzer
Nakanishi M, Nakamura M, Nishida H, Yap A, Hansen A, Hartig E, Harwood CR, Homuth
CC, Suzuki M, Kawai J, Suzuki H, Carninci P, G, Jarmer H, Jules M, Klipp E, Le Chat L,
Hayashizaki Y, Wells C, Frith M, Ravasi T, Pang Lecointe F, Lewis P, Liebermeister W, March A,
KC, Hallinan J, Mattick J, Hume DA, Lipovich Mars RA, Nannapaneni P, Noone D, Pohl S,
L, Batalov S, Engstrom PG, Mizuno Y, Faghihi Rinn B, Rugheimer F, Sappa PK, Samson F,
MA, Sandelin A, Chalk AM, Mottagui-Tabar S, Schaffer M, Schwikowski B, Steil L, Stulke J,
Liang Z, Lenhard B, Wahlestedt C (2005) Wiegert T, Devine KM, Wilkinson AJ, van Dijl
Antisense transcription in the mammalian tran- JM, Hecker M, Volker U, Bessieres P, Noirot P
scriptome. Science 309(5740):1564–1566. (2012) Condition-dependent transcriptome
doi:10.1126/science.1112009 reveals high-level regulatory architecture in
3. He Y, Vogelstein B, Velculescu VE, Bacillus subtilis. Science 335(6072):1103–
Papadopoulos N, Kinzler KW (2008) The anti- 1106. doi:10.1126/science.1206848
sense transcriptomes of human cells. Science 9. Mendoza-Vargas A, Olvera L, Olvera M,
322(5909):1855–1857. doi:10.1126/ Grande R, Vega-Alvarado L, Taboada B,
science.1163853 Jimenez-Jacinto V, Salgado H, Juarez K,
4. Steigele S, Nieselt K (2005) Open reading Contreras-Moreira B, Huerta AM, Collado-
frames provide a rich pool of potential natural Vides J, Morett E (2009) Genome-wide iden-
antisense transcripts in fungal genomes. Nucleic tification of transcription start sites, promoters
Acids Res 33(16):5034–5044. doi:10.1093/ and transcription factor binding sites in E. coli.
nar/gki804 PLoS ONE 4(10):e7526. doi:10.1371/jour-
5. Yamada K, Lim J, Dale JM, Chen H, Shinn P, nal.pone.0007526
Palm CJ, Southwick AM, Wu HC, Kim C, 10. Dornenburg JE, Devita AM, Palumbo MJ,
Nguyen M, Pham P, Cheuk R, Karlin- Wade JT (2010) Widespread antisense tran-
Newmann G, Liu SX, Lam B, Sakano H, Wu T, scription in Escherichia coli. MBio 1 (1).
Yu G, Miranda M, Quach HL, Tripp M, Chang doi:10.1128/mBio.00024-10
CH, Lee JM, Toriumi M, Chan MM, Tang 11. O’Carroll D, Schaefer A (2013) General prin-
CC, Onodera CS, Deng JM, Akiyama K, Ansari cipals of miRNA biogenesis and regulation in
Y, Arakawa T, Banh J, Banno F, Bowser L, the brain. Neuropsychopharmacology
Brooks S, Carninci P, Chao Q, Choy N, Enju 38(1):39–54. doi:10.1038/npp.2012.87
A, Goldsmith AD, Gurjal M, Hansen NF, 12. Gantier MP, Williams BR (2007) The response
Hayashizaki Y, Johnson-Hopson C, Hsuan of mammalian cells to double-stranded RNA.
VW, Iida K, Karnes M, Khan S, Koesema E, Cytokine Growth Factor Rev 18(5–6):363–
Ishida J, Jiang PX, Jones T, Kawai J, Kamiya A, 371. doi:10.1016/j.cytogfr.2007.06.016
Meyers C, Nakajima M, Narusaka M, Seki M,
Sakurai T, Satou M, Tamse R, Vaysberg M, 13. Li JB, Church GM (2013) Deciphering the
Wallender EK, Wong C, Yamamura Y, Yuan S, functions and regulation of brain-enriched
Shinozaki K, Davis RW, Theologis A, Ecker JR A-to-I RNA editing. Nat Neurosci
(2003) Empirical analysis of transcriptional 16(11):1518–1522. doi:10.1038/nn.3539
activity in the Arabidopsis genome. Science 14. Lavorgna G, Dahary D, Lehner B, Sorek R,
302(5646):842–846. doi:10.1126/science. Sanderson CM, Casari G (2004) In search of
1088305 antisense. Trends Biochem Sci 29(2):88–94.
6. Lasa I, Toledo-Arana A, Gingeras TR (2012) doi:10.1016/j.tibs.2003.12.002
An effort to make sense of antisense transcrip- 15. Lapidot M, Pilpel Y (2006) Genome-wide nat-
tion in bacteria. RNA Biol 9(8):1039–1044. ural antisense transcription: coupling its regu-
doi:10.4161/rna.21167 lation to its different regulatory mechanisms.
7. Sharma CM, Hoffmann S, Darfeuille F, EMBO Rep 7(12):1216–1222. doi:10.1038/
Reignier J, Findeiss S, Sittka A, Chabas S, sj.embor.7400857
Reiche K, Hackermuller J, Reinhardt R, Stadler 16. Morris KV, Santoso S, Turner AM, Pastori C,
PF, Vogel J (2010) The primary transcriptome Hawkins PG (2008) Bidirectional transcription
of the major human pathogen Helicobacter directs both transcriptional gene activation and
64 Manli Shen et al.

suppression in human cells. PLoS Genet Mol Cell Biol 10(9):637–643. doi:10.1038/
4(11):e1000258. doi:10.1371/journal.pgen. nrm2738
1000258 22. Magistri M, Faghihi MA, St Laurent G 3rd,
17. Froberg JE, Yang L, Lee JT (2013) Guided by Wahlestedt C (2012) Regulation of chroma-
RNAs: X-inactivation as a model for lncRNA tin structure by long noncoding RNAs: focus
function. J Mol Biol 425(19):3698–3706. on natural antisense transcripts. Trends Genet
doi:10.1016/j.jmb.2013.06.031 28(8):389–396. doi:10.1016/j.
18. Yu W, Gius D, Onyango P, Muldoon-Jacobs K, tig.2012.03.013
Karp J, Feinberg AP, Cui H (2008) Epigenetic 23. Kung JT, Colognori D, Lee JT (2013) Long
silencing of tumour suppressor gene p15 by its noncoding RNAs: past, present, and future.
antisense RNA. Nature 451(7175):202–206. Genetics 193(3):651–669. doi:10.1534/
doi:10.1038/nature06468 genetics.112.146704
19. Modarresi F, Faghihi MA, Lopez-Toledano 24. Sesto N, Wurtzel O, Archambaud C, Sorek R,
MA, Fatemi RP, Magistri M, Brothers SP, van Cossart P (2013) The excludon: a new concept
der Brug MP, Wahlestedt C (2012) Inhibition in bacterial antisense RNA-mediated gene reg-
of natural antisense transcripts in vivo results in ulation. Nat Rev Microbiol 11(2):75–82.
gene-specific transcriptional upregulation. Nat doi:10.1038/nrmicro2934
Biotechnol 30(5):453–459. doi:10.1038/ 25. Shen M, Eyras E, Wu J, Khanna A, Josiah S,
nbt.2158 Rederstorff M, Zhang MQ, Stamm S (2011)
20. Batra R, Charizanis K, Swanson MS (2010) Direct cloning of double-stranded RNAs from
Partners in crime: bidirectional transcription in RNase protection analysis reveals processing
unstable microsatellite disease. Hum Mol Genet patterns of C/D box snoRNAs and provides
19(R1):R77–R82. doi:10.1093/hmg/ddq132 evidence for widespread antisense transcript
21. Faghihi MA, Wahlestedt C (2009) Regulatory expression. Nucleic Acids Res 39(22):9720–
roles of natural antisense transcripts. Nat Rev 9730. doi:10.1093/nar/gkr684
 Chapter 7

Detection and Labeling of Small Non-Coding RNAs

by Splinted Ligation
Gabrielle Bourgeois, Florian Chardon, Anne-Sophie Tillault,
and Magali Blaud

Abstract
Discovery and characterization of microRNAs (miRNAs) and other families of small RNAs lead researchers
to study their structures/functions and their expression patterns. The splinted ligation method described
here is based on nucleic acid hybridization. It is optimized for the direct labeling and quantitative detec-
tion of small RNAs. A specific bridge DNA oligonucleotide is used, which is perfectly complementary to
both the target small RNA and a labeled ligation nucleic acid. The target RNA is subsequently labeled by
ligation, detected by analysis in denaturing conditions, and quantified by phosphorimaging. The protocol
doesn’t require any specific material, and the procedure is fast and sensitive.

Key words Small RNA, Ligation, Bridge oligonucleotide

1 Introduction

The splinted ligation technique was first developed by Moore and

Query [1] for joining with T4 DNA ligase two or more RNA frag-
ments by creating RNA:RNA/DNA complexes employing a guide or
bridge DNA oligonucleotide. This approach is useful to generate
RNAs that are larger that can be chemically synthesized or to incorpo-
rate site-specific changes such as RNA modifications, isotopic labels,
or fluorophores in an RNA to facilitate functional and structural stud-
ies [2–5]. This strategy was then used and modified by Maroney et al.
[6–8] for the detection of small RNAs from total RNA extracts.
The splinted ligation protocol for the direct labeling or the
quantitative detection of small RNAs uses a bridge DNA oligonu-
cleotide that base pairs with both the small RNA of interest and the
“ligation” RNA/oligonucleotide (Fig. 1). The first step consists in
labeling the ligation RNA/oligonucleotide. Commercial ones
obtained by chemical synthesis with modifications or fluorophore

*Authors contributed equally with all other contributors.

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_7, © Springer Science+Business Media New York 2015

65
66 Gabrielle Bourgeois et al.

Ligation RNA or oligonucleotide

OH
5’ 3’

Kinase
1 32P
γATP
small RNA
P OH 32P OH
5’ 3’ 5’ 3’

OH

32 P
P OH
5’ 3’
3’ 5’
Bridge oligonucleotide

T4 DNA
ligase
OH
32 P

P OH
5’ 3’
3’ 5’

P OH
32P
5’ 3’
3’ 5’

32P OH
5’ 3’

4 Alkaline DNase
phosphatase

OH
32P
5’ 3’

Fig. 1 Schematic representation of each steps during the protocol of small RNA
detection or labeling using splinted ligation. 1- labeling of the ligation RNA or
oligonucleotide/ 2- Hybridization of the small RNA with the labeled oligonucle-
otide or RNA on a bridge oligonucleotide/ 3- linking using T4 DNA ligase/ 4-
Removal of the labeled phosphate from unligated ligation RNA or oligonucleotide
and optional removal of the bridge oligonucleotide

labeling can be used directly. Next, the small RNA of interest is

annealed together with the ligation RNA/oligonucleotide to the
bridge oligonucleotide, and ligation is performed with T4 DNA
ligase. Finally, excess ligation RNA/oligonucleotide is eliminated
by alkaline phosphatase, and bridge DNA is degraded by DNase I
 Splinted Ligation 67

digestion. Then, the final product of ligation is fractionated on a

denaturing gel and can be visualized by UV shadowing or X-Ray
film/phosphorimaging, if labeled. The RNA can be purified
directly from the gel. The resulting purified RNA can be used for
structural and functional analysis.

2 Materials

2.1 Preparation 1. Ligation oligonucleotide: 5′-CGCTTATGACATTCddC-3′ or

of the Labeled Ligation ligation RNA that can be modified or labeled with a
RNA/Oligonucleotide fluorophore.
2. Bridge oligonucleotide: 5′-GAATGTCATAAGCGXXXXX-3′
corresponds to the complementary sequence of the ligation
oligonucleotide, and the X’s indicate a sequence complemen-
tary to the specific small RNA target (see Notes 1–3).
3. Total RNA preparation obtained as previously described [4]
containing the target small RNA. Store at −80 °C. Or small
RNAs, designed to obtain a long or labeled RNA after ligation,
are produced by in vitro transcription as detailed previously [9]
(see Notes 4–6).
4. TE buffer (1×): 10 mM Tris–HCl, pH 7.5, 1 mM EDTA.
5. RNase-free water.
6. γ32P-ATP (3,000 Ci/mmol, 250 mCi/ml).
7. T4 polynucleotide kinase (PNK, 10 U/μl) including 10× PNK
reaction buffer.
8. Phenol–chloroform (1:1).
9. Quick spin column in Sephadex G-50.
10. RNase-free 70 and 99.8 % ethanol.
11. Glycogen.

2.2 Hybridization 1. T4 DNA ligase including 10× ligation buffer: 500 mM Tris–
and Ligation HCl, pH 7.5, 100 mM MgCl2, 50 mM ATP, 50 mM DTT.
of the Small RNA

2.3 Purification 1. Shrimp alkaline phosphatase (1 U/μl).

of Ligation Products 2. DNase I enzyme.
3. Elution buffer: 10 mM Tris–HCl, pH 7.5, 300 mM NaCl,
1 mM EDTA, 1 % SDS.

2.4 Analysis 1. Tris–Borate–EDTA (TBE) buffer (5×): 0.445 M Tris–HCl,

and Quantification pH 8, 0.445 M boric acid, 0.01 M EDTA. Store at room
of Ligation Products temperature.
2. Denaturing polyacrylamide gel solution 8–12 % (v/v)
(acrylamide/bis) polyacrylamide–bisacrylamide (19:1), 8 M
68 Gabrielle Bourgeois et al.

urea, 1× TBE. Stored at 4 °C. For polymerization, add 0.1 %

(w/v) of ammonium persulfate (APS) and 0.1 % (v/v) of
TEMED (N,N,N′,N′-tetramethylethylenediamine).
3. Formamide loading dye (3×): 95 % formamide, 20 mM EDTA,
0.05 % bromophenol blue, 0.05 % xylene cyanol.

3 Methods

The splinted ligation method described here can be used for the
direct labeling of RNA and quantitative detection of small RNAs
from total RNA extracts. In the first application, the reaction
consists in the ligation of two labeled RNA precursor fragments.
This approach can be applied to join RNA fragments to form long
RNAs that couldn’t otherwise be produced by in vitro transcrip-
tion for their structural and functional studies. In the second appli-
cation, the small RNA of interest present in total RNA extracts is
captured by ligation with a radiolabeled oligonucleotide to the
bridge oligonucleotide. The initial materials are different, but the
protocol is the same for both applications.

3.1 Preparation The ligation RNA can be produced by in vitro transcription or can
of the Labeled Ligation be obtained from a supplier. The first step consists in labeling its 5′
RNA/Oligonucleotide extremity with γ32P-ATP. If an oligonucleotide is used instead,
labeling reaction follows the same protocol.
1. Combine 500 ng of RNA/oligonucleotide, 2 μl of T4 PNK
buffer, 1 μl of T4 PNK, 1 μl of γ32P-ATP and RNase-free water
to a final volume of 20 μl (see Note 7).
2. Incubate the reaction for 1 h at 37 °C.
3. Remove the unincorporated isotope by a step of purification
using a quick spin column in Sephadex G-50. Centrifuge the
column at 750 × g for 2 min to discard the resin storage buffer.
4. Load the sample and centrifuge the column at 750 × g for
1 min to collect the sample. The unincorporated γ32P-ATP is
retained in the resin.
5. Proteins of the sample are removed by addition of 150 μl of
phenol–chloroform. Vortex during 2 min and centrifuge the
sample for 3 min at 10,000 × g. Collect the supernatant con-
taining the labeled RNA or oligonucleotide (see Note 8).
6. Precipitate the supernatant with 3 volumes of 99.8 % of ethanol
for at least 40 min at −80 °C (see Note 9).
7. Centrifuge at 16,000 × g at 4 °C for 30 min. Wash the pellet
with 70 % ethanol and dissolve it in 20 μl RNase-free water.
8. Use 2 μl thereof to spectrophotometrically determine the RNA
concentration.
 Splinted Ligation 69

9. Store the samples at −20 °C if not used immediately and keep

on ice during utilization.
10. Besides, prepare total RNA using your favorite method, such
as guanidine isothiocyanate (TRIzol) and phenol–chloroform
according to standard total RNA isolation protocols.
Resuspend total RNA in TE buffer or RNase-free water and
store at −80 °C.

3.2 Hybridization 1. Thaw all the frozen reagents on ice before utilization.
and Ligation 2. Assemble the reaction for hybridization on ice in a final volume
of the Small RNA of 20 μl by mixing 15 μl total RNA or 400 pmol of the RNA
of interest with 400 pmol of radiolabeled RNA/oligonucle-
otide in the ligation buffer.
3. Gently mix the reaction by pipetting up and down and spin
down briefly.
4. Incubate the reaction at 90 °C for 1 min, at 75 °C for 3 min,
and finally at room temperature for 20 min.
5. Add 40 U of T4 DNA ligase and incubate the mixture at 16 °C
overnight.

3.3 Purification 1. Add 1 μl of shrimp alkaline phosphatase to the sample.

of Ligation Products 2. Gently mix the reaction by pipetting up and down and spin
down briefly.
3. Incubate the reaction at 37 °C for 15 min (see Notes 10 and 11).
4. Add 3 U of DNase I and incubate at 37 °C for 30 min.

3.4 Analysis 1. Analyze the ligation products by electrophoresis on an 8–12 %

and Quantification denaturing acrylamide gel (see Notes 12 and 13).
of Ligation Products 2. Pre-run the gel for 30 min.
3. Mix 20 μl of the reaction with 2 volumes of formamide
loading dye.
4. For analytical purposes, load 2–15 μl of the sample (see Note 14).
5. Run the gel at 35 mA until the bromophenol blue dye front
has migrated to the bottom of the gel.
6. Place the gel on a sheet of Whatman paper and dry it wrapped
in Saran film in a vacuum gel dryer.
7. Exposed the gel to a phosphorimager screen prior to visualiza-
tion and quantification.

3.5 Purification 1. After gel staining, the RNA in the size range of interest is
of Ligation Product excised with a sterile scalpel (see Note 15).
2. Dice the excised gel piece into 5 mm3 cubes with a sterile scalpel,
which will enhance subsequent elution of the RNA from the gel.
70 Gabrielle Bourgeois et al.

3. Carefully transfer the gel pieces into a fresh 1.5 ml tube.

4. Passively elute the RNA into elution buffer at 4 °C with constant
shaking overnight.
5. Remove the supernatant containing the eluted RNA using a
pipette and transfer the solution into a fresh 1.5 ml reaction
tube.
6. Precipitate with 3 volumes of 99.8 % of ethanol for at least
40 min at −80 °C.
7. Centrifuged at 16,000 × g at 4 °C for 30 min and wash the pellet
with 70 % ethanol. Dissolve the pellet in 20 μl RNase-free water
and determine the concentration using a spectrophotometer.

4 Notes

1. The sequence of the bridge oligonucleotide is complementary

to both the ligation oligonucleotide at its 5′ extremity and a
specific small RNA at its 3′ extremity. In the case of ligation of
two RNAs, the sequence at the 5′ extremity is complementary
to the sequence of the second RNA of interest.
2. Resuspend bridge oligonucleotide and ligation RNA/oligonu-
cleotide in TE buffer or RNase-free water to a concentration of
100 μM. Store at −20 °C.
3. The small RNAs of interest and ligation RNA can be generated
in vitro by runoff transcription with T7 RNA polymerase as
previously described [9].
4. Wear gloves at all times to prevent solutions and equipment to
be contaminated by RNases. Clean materials and benches with
ethanol or solutions for RNase decontamination.
5. All solutions should be prepared with RNase-free plastic and
glassware and with RNase-free water. These solutions should
be stored at −20 °C.
6. Thaw all reagents on ice before use and immediately return the
tubes with the unused solutions at −20 °C.
7. Use of γ32P-ATP to radiolabel RNA or DNA requires specific
procedures to protect users from β-radiation and secondary
X-radiation from 32P. These procedures must be respected for
safe handling of this isotope.
8. For the labeling of RNA with ligation of 2 specific RNAs, a
step of DNA digestion can be performed by incubation with
DNase I for 15 min at 30 °C.
9. Glycogen can be added in each sample during ethanol precipi-
tation to increase the recovery of small RNAs.
10. Inactivate the phosphatase treatment by incubation at 75 °C
for 10 min if you wish to make a pause in the protocol at this
 Splinted Ligation 71

step. Store at −20 °C. Otherwise, proceed with DNase I

treatment.
11. The alkaline phosphatase treatment removes the phosphate at
5′ extremities of free radiolabeled RNA/oligonucleotide or
bridge oligonucleotide (Fig. 1). Labeled nucleotide implicated
in the phosphodiester bond linking the two fragments is not
affected. This step is only used when purification of the final
labeled RNA is required.
12. As a negative control for the ligation experiment aimed at detect-
ing a small RNA, one experiment is performed where the RNA
sample is replaced by RNase-free water. In the case of ligation of
two RNAs, the second RNA, which is labeled, can be used as a
control to characterize the size of the final product.
13. Before loading, the wells of the gel have to be thoroughly
flushed to remove urea, acrylamide, and air bubbles.
14. Alternatively, the whole sample can be loaded if gel purification
is required.
15. Always clean the scalpel with ethanol after cutting out a gel
piece with the desired RNA before cutting out the next piece
to avoid RNA cross-contaminations. Note that the gel slices
should neither be squeezed into the reaction tube nor swim in
the elution buffer.

Acknowledgment

This work was supported by CNRS, the University of Paris

Descartes, the RNPGenesis grant from the Agence Nationale de la
Recherche (ANR-JC), the Institut Universitaire de France (to Professor
Nicolas Leulliot), and the project “Nanogears” from “Initiative
d’Excellence of Sorbonne Paris Cité.”

References
1. Moore MJ, Query CC (2000) Joining of RNAs Stepwise protein-mediated RNA folding directs
by splinted ligation. Methods Enzymol 317:109– assembly of telomerase ribonucleoprotein.
123, S0076-6879(00)17009-0 [pii] Nature 446(7134):458–461. doi:10.1038/
2. Cornish PV, Ermolenko DN, Noller HF, Ha T nature05600, nature05600 [pii]
(2008) Spontaneous intersubunit rotation in 5. Zhuang X, Bartley LE, Babcock HP, Russell R,
single ribosomes. Mol Cell 30(5):578–588. Ha T, Herschlag D, Chu S (2000) A single-
doi:10.1016/j.molcel.2008.05.004, molecule study of RNA catalysis and folding.
S1097-2765(08)00334-1 [pii] Science 288(5473):2048–2051, 8590 [pii]
3. Lu K, Miyazaki Y, Summers MF (2010) Isotope 6. Maroney PA, Chamnongpol S, Souret F, Nilsen
labeling strategies for NMR studies of RNA. J TW (2007) A rapid, quantitative assay for
Biomol NMR 46(1):113–125. doi:10.1007/ direct detection of microRNAs and other small
s10858-009-9375-2 RNAs using splinted ligation. RNA 13(6):930–
4. Stone MD, Mihalusova M, O’Connor CM, 936. doi:10.1261/rna.518107, rna.518107
Prathapam R, Collins K, Zhuang X (2007) [pii]
72 Gabrielle Bourgeois et al.

7. Maroney PA, Chamnongpol S, Souret F, Nilsen Struct Mol Biol 13(12):1102–1107.

TW (2008) Direct detection of small RNAs doi:10.1038/nsmb1174, nsmb1174 [pii]
using splinted ligation. Nat Protoc 3(2) 9. Mougin A, Gregoire A, Banroques J, Segault V,
:279–287. doi:10.1038/nprot.2007.530, Fournier R, Brule F, Chevrier-Miller M,
nprot.2007.530 [pii] Branlant C (1996) Secondary structure of the
8. Maroney PA, Yu Y, Fisher J, Nilsen TW (2006) yeast Saccharomyces cerevisiae pre-U3A
Evidence that microRNAs are associated with snoRNA and its implication for splicing effi-
translating messenger RNAs in human cells. Nat ciency. RNA 2(11):1079–1093
 Chapter 8

Fluorescence In Situ Hybridization of Small

Non-Coding RNAs
Valentin Vautrot, Christelle Aigueperse, Christiane Branlant,
and Isabelle Behm-Ansmant

Abstract
RNA FISH is a powerful method to detect specific RNAs in fixed cells. It allows both localization and
quantification of RNA molecules within individual cells and tissues. Refined RNA FISH methods have also
been developed to determine RNA transcription and degradation rates. This chapter describes an RNA FISH
protocol that we developed in order to study the expression and localization of satellite III RNAs. This spe-
cific class of non-coding RNAs is expressed in response to various cellular stresses including heat shock. This
protocol is based on the use of a biotinylated LNA probe subsequently detected by a streptavidin–Alexa
Fluor® 488 conjugate. A protocol allowing efficient coupling of RNA FISH and protein detection by immu-
nofluorescence is also described in this chapter.

Key words RNA FISH, LNA probe, LNA FISH, RNA intracellular localization, Fluorescence

1 Introduction

Fluorescence in situ hybridization (FISH) is a very powerful method

to detect specific nucleic acids in fixed but otherwise intact cells.
Conceptually, FISH is a very straightforward technique based on
direct hybridization of a DNA probe to its complementary sequence
on cells fixed on glass slides. Probes can either be directly labeled by
incorporation of fluorescent nucleotides or indirectly by incorpora-
tion of reporter molecules (such as biotin or digoxigenin) that are
subsequently detected with affinity fluorescent molecules (such as
fluorescent antibody or streptavidin–Alexa Fluor® conjugates).
Probes and targets are then visualized in situ by microscopy analy-
sis. This cytogenic method has been developed in the early 1980s
[1] and was initially mainly used to detect and localize the presence
or absence of specific DNA sequences on chromosomes (DNA
FISH) [2]. Short after, FISH-based methods have been developed
to study RNA expression and intracellular localization (RNA FISH)
[3]. As RNA FISH is quantitative, numerous applications have

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_8, © Springer Science+Business Media New York 2015

73
74 Valentin Vautrot et al.

been developed, such as localization of individual RNA molecules,

quantification of a given RNA species, or transcription and RNA
degradation rates within individual cells and tissues [4, 5].
Currently, a bunch of diverse applications and FISH-based diag-
nostic assays have been proposed in different fields of investigation,
including cytogenetics, karyotyping, cancer diagnostics, toxicol-
ogy, microbial ecology, evolutionary biology, cellular genomics, or
preimplantation genetic screening. RNA FISH became an indis-
pensable tool for rapid and direct single-cell identification of
microbe or bacteria by detecting signature regions in their rRNA
molecules [6, 7]. RNA FISH has also been used to study different
functional aspects of genome organization and nuclear architec-
ture [8–11]. The possibility to use an RNA FISH method for pre-
natal diagnosis of myotonic dystrophy type 1 is even presently
investigated [12]. Furthermore, multicolor miRNA FISH enabling
miRNA visualization in formalin-fixed paraffin-embedded (FFPE)
tissues allows to efficiently discriminate skin tumors showing over-
lapping histologic features despite their distinct cellular origins
[13]. More recently, RNA FISH also played a crucial role in the
discovery and functional characterization of both small and long
non-coding RNAs (ncRNAs) [14–17].
The diversification of the original FISH protocol into the
impressive number of procedures available now has been promoted
by the improvement of the sensitivity, specificity, and resolution of
the technique. These improvements are mainly due to the better
understanding of chemical and physical properties of nucleic acids,
together with advances in the field of fluorescence microscopy and
digital imaging, as well as the growing availability of genomic and
bioinformatic resources. Numerous methods allow improvement of
nucleic acid interaction affinity, the most widely used ones using
backbone- or base-modified probes. Modified bases include C-5
propynyl C or U, 5-Me-C, 2-amino-A, or 7-propynyl-8-aza-7-
deazapurines [18–23]. Although modified bases increase melting
temperatures of duplexes by 0.5–3 °C per substitution, they are
usually very expensive and may not be available in commercially
purchased probes. On the other hand, common modified back-
bones include 2′-O-methyl (2′-O-Me) RNA, 2′-fluoro (2′-F) RNA,
peptide nucleic acid (PNA), locked nucleic acid (LNA), or 2′-O,4′-
aminoethylene bridged nucleic acid (2′4′-BNANC) (Fig. 1) [24–27].
Thermodynamic stability of hybrids formed between nucleic acids
containing different backbones and an RNA molecule increases
according to DNA < RNA < 2′-O-Me RNA < 2′-F RNA < PNA/
LNA ≤ 2′4′-BNANC. The PNA backbone is based on 2-aminoethyl
glycine units replacing the normal ribose-phosphodiester backbone
(Fig. 1). The absence of a charged phosphate group increases the
affinity for nucleic acids, with an increased Tm value of ~1 °C per
base. Additionally, it confers resistance to nucleases, but reinforces
hydrophobicity, which restrains cell delivery. LNA nucleotides are
 RNA-FISH of Small Non-Coding RNAs 75

O B O B O B O B
O O O O

O O OH O OCH3 O F
O P O- O P O- O P O- O P O-

DNA RNA 2’-OMe RNA 2’-F RNA

O B HN O B
O B O
N
O O O
O O N O
NH R’
O P O- O P O-

LNA PNA 2’,4’-BNANC

Fig. 1 Chemical structure of various RNA backbone modifications used for the production of fluorescence in
situ hybridization probes. B: base; R′ = H (2′4′-BNANC(N-H)) or CH3 (2′4′-BNANC(N-Me))

nucleotides of constrained conformation containing a 2′-O,4′-C-

methylene bridge (Fig. 1). LNAs correspond to the first generation
of bridged nucleic acids (BNAs), while 2′4′-BNANCs are already the
third generation of BNAs. The main advantage of 2′4′-BNANCs
over LNAs is their higher resistance to both endo- and exonucle-
ases. Nevertheless, 2′4′-BNANCs are much more expensive, and the
slight increase in the melting temperature they confer rarely justifies
their use over LNAs.
This chapter describes the RNA FISH protocol that we devel-
oped to study the expression of satellite III (sat III) RNAs, expres-
sion of which is induced in response to various cellular stresses such
as heat shock [28]. After transcription, sat III RNAs accumulate
with the protein HSF1 in nuclear stress granules where they recruit
concomitantly with various splicing factors, including SRSF1 [15,
29–32] (Fig. 2). This RNA FISH protocol is based on the use of a
biotinylated LNA probe detected by a streptavidin–Alexa Fluor®
488 conjugate. This approach is fast, sensitive, highly specific, and
relatively cheap to analyze RNA localization. A protocol for paral-
lel protein detection by immunofluorescence is also described.
Results obtained using both methods are illustrated.

2 Materials

2.1 Cell Preparation 1. HeLa S3 cells (see Note 1).

2.1.1 Cell Growth 2. 100 mm tissue culture dishes.
3. DMEM supplemented with 10 % fetal calf serum, 2 mM
L-glutamine, penicillin (100 U/ml), and streptomycin (100 μg/ml).
76 Valentin Vautrot et al.

Fig. 2 Detection of sat III RNAs in HeLa cells by RNA FISH. (a) RNA FISH was performed on HeLa cells using
either the sat III LNA™-enhanced probe or the scramble-ISH LNA™-enhanced probe. The nucleus of the cells
was stained with DAPI. At 37 °C, no staining was observed when using the sat III LNA™-enhanced probe,
while in cells exposed to heat shock (2 h at 42 °C followed by 1 h at 37 °C), several bright nuclear foci cor-
responding to sat III-enriched substructures were detected in each nucleus. These foci were not detected
when using the scramble-ISH probe as a negative control. Image acquisition was performed on a Nikon epi-
fluorescence microscope using the digital camera Nikon DXM1200. (b) Co-detection of sat III RNAs by RNA
FISH (green) and SRSF1 (Santa Cruz, sc-73016) or HSF1 (Thermo Scientific MA5-14632) or SRSF2 (personal
gift from J. Stevenin) by immunofluorescence (red ). The sat III RNA foci match perfectly with the SRSF1 and
HSF1 spots detected within the nuclear stress granules, but not with SRSF2 which is specifically localized in
the nuclear speckles. Scale: 10 μm. Image acquisition was performed on a Leica SP2 confocal microscope
from the PTIBC platform of FR3209

4. 42 °C water bath.
5. Pre-cleaned Superfrost microscope slides.
6. Parafilm.

2.1.2 Cell Fixation 1. Phosphate buffered saline (PBS).

and Permeabilization 2. 4 % paraformaldehyde: prepare freshly at room temperature in
a fume hood (see Note 2).
3. Coplin staining jars.
4. 0.1 M Tris–HCl, pH 7.5.
5. Glycerol.
6. Liquid nitrogen and containers.
7. 70, 90, and 100 % ethanol.

2.2 Probe 1. LNA™ mRNA detection probe (Exiqon) (see Note 3):
Preparation
Sat III probe: 5′-Biosg-ATTCCATTCCATTCCATTCC-3′Bio.
Scramble probe: 5′-Biosg-GTGTAACACGTCTATACGC
CCA-3′.
 RNA-FISH of Small Non-Coding RNAs 77

2. Hybridization buffer (Exiqon): 50 % deionized formamide, 2×

SCC, 50 mM sodium phosphate, pH 7, 10 % dextran sulfate
(see Note 4).
3. Heating block.

2.3 In Situ 1. 22 × 50 mm microscope cover slips.

Hybridization 2. Light-protected humid chamber.
3. Hybridization incubators.
4. 20× SCC stock buffer: 3 M sodium chloride, 300 mM sodium
citrate.
5. Wash solution 1: 2× SCC, 0.1 % Tween 20.
6. Wash solution 2: 0.1× SCC.

2.4 Signal Detection 1. Blocking solution: 3 % (w/v) BSA, 4× SCC, 0.1 % Tween 20.
2. 22 × 50 mm microscope cover slips.
3. Incubators.
4. Streptavidin–Alexa Fluor® 488 conjugate (Molecular Probes,
Invitrogen).
5. Streptavidin–Alexa Fluor® 488 conjugate dilution buffer: 1 %
BSA, 4× SCC, 0.1 % Tween 20.
6. Wash solution 3: 4× SCC, 0.1 % Tween 20.
7. Duolink mounting media (Olink Bioscience).
8. Rubber cement (Artos, Styl’Up).

2.5 Coupling Protein 1. PBS.

Detection with FISH 2. BSA.
3. Antibodies: mouse monoclonal antibodies targeting the pro-
tein of interest, used in combination with Alexa Fluor® 555
fragment of Goat anti-Mouse IgG (H + L) (Molecular Probes,
Invitrogen).

3 Methods

3.1 Cell Preparation Prepare culture plates and microscope slides following proper ster-
ile cell handling protocols.
3.1.1 Cell Growth
1. Place a sterilized microscope slide in each plate (see Note 5).
Make sure that the surface of the slide intended for cell adhe-
sion is facing up.
2. Warm the cell culture medium to 37 °C before use to avoid cell
stress. Add 10 ml of pre-warmed medium in each culture plate.
3. Seed HeLa cells in order to reach about 60–70 % confluence
after 24 h (see Note 6).
78 Valentin Vautrot et al.

4. On the next day, proceed to heat shock on half of the plates

and let the other half (control plates) in the 37 °C incubator:
seal the plates with several layers of parafilm so that they are
completely waterproof (see Note 7).
5. Place the plates in a water bath at 42 °C and maintain them
fully immerged with a weight for 2 h (see Note 8).
6. Wipe and unwrap the plates, and then put them again in the
37 °C incubator for 1 h for the cells to recover (see Note 8).
Note that the heat shock steps (4–6) are facultative steps. They
were performed here as expression of the ncRNAs studied
below is heat shock induced.

3.1.2 Cell Fixation 1. Collect the microscope slides and place them in a Coplin jar
and Permeabilization filled with PBS.
2. Under a fume hood, transfer the freshly prepared 4 % parafor-
maldehyde solution (see Note 2) in a new Coplin jar. Let the
slides in the fixation solution for 10 min at room temperature,
with mild agitation.
3. Wash slides once with PBS in a clean Coplin jar at room tem-
perature (see Note 9).
4. Wash slides with 0.1 M Tris–HCl, pH 7.5, for 5 min at room
temperature.
5. Wash slides with PBS containing 20 % (v/v) glycerol for 1 h
at room temperature (minimum 20 min).
6. Place the slides without drying them in liquid nitrogen for a
few seconds with a clamp and appropriate protection.
7. Thaw the slides for about 1 min and place them again in the
PBS 20 % (v/v) glycerol solution.
8. Repeat the freeze and thaw cycle twice more.
9. Dehydrate the slides by treatment with three increasing etha-
nol concentrations: immerge the slides for 5 min in 70 % etha-
nol in a Coplin jar.
10. Replace the 70 % ethanol with 90 % ethanol and incubate for
5 min.
11. Replace the 90 % ethanol with 100 % ethanol and incubate for
5 min.
12. Dry the slides. At this stage, slides can be stored for about 12 h
at 4 °C before hybridization.

3.2 Probe 1. Before use, dissolve the lyophilized oligonucleotide in water.

Preparation Prepare a 100 μM stock solution and store aliquots at −20 °C
to avoid repeated freeze and thaw cycles.
2. Dilute an aliquot of the 100 μM probe stock solution in
hybridization buffer to a final concentration of 20–40 nM.
 RNA-FISH of Small Non-Coding RNAs 79

3. Incubate the diluted probe for 5 min at 75 °C.

4. Chill on ice for 5 min.

3.3 In Situ 1. Fill a Coplin jar with the wash solution 2 and pre-warm it
Hybridization at 65 °C.
2. Spot 100 μl of the denatured probe solution on each slide and
cover the drop with a 22 × 50 mm microscope cover slip
(see Note 10).
3. Incubate the slides for 30 min in a light-protected humid
chamber placed in the incubator. Hybridization temperature,
47 °C in our case, depends on the Tm of the probe.
4. Remove the cover slip by immersion in wash solution 1 at
room temperature.
5. Wash the slides for 5 min in pre-warmed wash solution 2 at
65 °C in a Coplin jar with mild agitation.
6. Repeat the washing step twice more using solution 2 pre-
warmed at 65 °C.

3.4 Signal Detection 1. Shortly dry the slides, layer them with 100 μl of blocking solu-
tion, and cover with a 22 × 50 mm microscope cover slip.
2. Incubate for 30 min at 37 °C in a light-protected humid
chamber.
3. Dilute the streptavidin–Alexa Fluor® 488 conjugate in the
streptavidin dilution buffer to a final concentration of 2 μg/ml.
4. Remove the cover slip, shortly dry the slides, and add 100 μl of
the diluted solution of streptavidin–Alexa Fluor® 488 conju-
gate. Mount a 22 × 50 mm microscope cover slip over it
(see Note 11).
5. Incubate for 1–2 h at 37 °C in the light-protected humid
chamber.
6. Fill the Coplin jar with wash solution 3 and pre-warm the jar at
45 °C.
7. Remove the cover slip by immersion in the warm wash solu-
tion 3.
8. Wash the slides for 5 min in the warm wash solution 3 in the
Coplin jar, with slow agitation.
9. Repeat this washing step twice more.
10. Dry the slides and mount cover slips with Duolink mounting
media containing antifade and DAPI.
11. Seal the cover slip with nail polish or rubber cement and pro-
ceed with microscope observation (see Note 12).
80 Valentin Vautrot et al.

3.5 Coupling Protein When in situ hybridization is followed by immunofluorescence, do

Detection with FISH not dry the slides after the third wash with wash solution 3
(Subheading 3.4, step 9) and pursue with the following protocol.
1. Wash the slides in the Coplin jar using PBS.
2. Shortly dry the slides and use a standard cover slip to mount a
drop (≈30 μl) of a solution of primary antibody properly
diluted in PBS with 0.1 % BSA.
3. Incubate for 1 h at room temperature in a light-protected
humid chamber.
4. Wash the slides for 5 min with PBS in the Coplin jar with mild
agitation.
5. Discard the wash solution and repeat the washing step twice
more.
6. Shortly dry the slides and use a standard cover slip to mount a
drop (≈30 μl) of a solution of secondary antibody diluted in
PBS with 0.1 % BSA solution.
7. Wash the slides for 5 min with PBS in the Coplin jar with mild
agitation.
8. Repeat the washing step twice more.
9. Dry the slides and mount cover slips with Duolink mounting
media containing antifade and DAPI.
10. Seal the cover slip with nail polish or rubber cement and pro-
ceed with the observation with a microscope (see Note 12).

4 Notes

1. Any cell of interest can be used as well.

2. For optimal fixation, it is critical to use freshly prepared form-
aldehyde solution. 4 % formaldehyde solution has to be pre-
pared in a fume hood. Dilute 16 %, methanol-free, formaldehyde
or solid paraformaldehyde (4 % w/v) in PBS. Formaldehyde-
contaminated wastes must be discarded according to federal,
state, and local environmental rules.
3. The sequence of the probe was custom designed, and the
LNA™-enhanced oligonucleotide was produced using the
Exiqon probe design software. However, the LNA™ spiking
pattern is not made available. The LNA™ scramble-ISH probe
is an Exiqon pre-designed LNA™ probe used as a negative
control probe. It has no hits with more than 70 % homology to
any sequence in any organism in the NCBI database and
no homology with any sequence in the miRBase database.
In order to be sure of the specificity of your FISH probes, you
 RNA-FISH of Small Non-Coding RNAs 81

should always include either positive controls such as the

LNA™-polyT-ISH or the LNA™-Beta-Actin-ISH probes
(Exiqon) or negative controls such as the LNA™ scramble-
ISH probe.
4. Handle formamide in a fume hood. Formamide-contaminated
waste must be discarded in accordance with federal, state, and
local environmental legislation.
5. To ensure sterile culture conditions, non-sterilized microscope
glass slides have to be cleaned with 70 % ethanol prior to use.
6. From now on, avoid pouring any liquid directly on the slide, to
prevent wiping away of the cells.
7. To ensure impermeability of the plates, begin with a first layer
of parafilm around the circumference, and then wrap the lid
with a large piece of parafilm covering the circumference as
well. Proceed the same way with the bottom of the plate and
finally add an additional layer around the plate.
8. Optimal heat shock or cell recovery duration for satellite III
RNA detection may vary depending on the cell line, environ-
ment, and previous stress exposure. The duration of heat shock
can vary from 30 min up to 2 h.
9. From now on, do not allow the slides to dry except when spe-
cifically stated, as this could strengthen the background noise
during fluorescence visualization.
10. Take care to avoid any bubbles when you place the cover slips.
11. From now on, it is recommended to protect slides from light
as much as possible.
12. You can use a syringe to display the rubber cement.

Acknowledgments

V.V. was supported by a graduate fellowship from the French

Ministère Délégué à la Recherche et aux Technologies and a fourth
year PhD fellowship by the Fondation pour la Recherche Médicale
(FRM, FDT20120925471). This work was supported by grants
from the European Alternative Splicing Network of Excellence
(EURASNET, FP6 life sciences, genomics, and biotechnology for
health) and the European Associated Laboratory (LEA) on pre-
mRNA splicing created by Centre National de la Recherche
Scientifique (CNRS), Université de Lorraine (UL), Université de
Montpellier 1 (UM1), Université de Montpellier 2, and Max
Planck Institut. A. Metz and H. Kempf are acknowledged for help-
ful discussions. The PTIBC platform of FR3209 is thanked for the
access to the SP2 confocal microscope.
82 Valentin Vautrot et al.

References
1. Langer-Safer PR, Levine M, Ward DC (1982) prenatal molecular diagnosis of myotonic
Immunological method for mapping genes on dystrophy type I. Clin Chem 52(2):319–322.
Drosophila polytene chromosomes. Proc Natl doi:10.1373/clinchem.2005.056283
Acad Sci U S A 79(14):4381–4385 13. Renwick N, Cekan P, Masry PA, McGeary SE,
2. Manuelidis L, Langer-Safer PR, Ward DC Miller JB, Hafner M, Li Z, Mihailovic A,
(1982) High-resolution mapping of satellite Morozov P, Brown M, Gogakos T, Mobin
DNA using biotin-labeled DNA probes. J Cell MB, Snorrason EL, Feilotter HE, Zhang X,
Biol 95(2 Pt 1):619–625 Perlis CS, Wu H, Suarez-Farinas M, Feng H,
3. DeLong EF, Wickham GS, Pace NR (1989) Shuda M, Moore PS, Tron VA, Chang Y,
Phylogenetic stains: ribosomal RNA-based Tuschl T (2013) Multicolor microRNA FISH
probes for the identification of single cells. effectively differentiates tumor types. J Clin
Science 243(4896):1360–1363 Invest 123(6):2694–2702. doi:10.1172/
4. Brown JM, Buckle VJ (2010) Detection of JCI68760
nascent RNA transcripts by fluorescence in situ 14. Clemson CM, Lawrence JB (1996)
hybridization. Methods Mol Biol 659:33–50. Multifunctional compartments in the nucleus:
doi:10.1007/978-1-60761-789-1_3 insights from DNA and RNA localization.
5. Ronander E, Bengtsson DC, Joergensen L, J Cell Biochem 62(2):181–190. doi:10.1002/
Jensen AT, Arnot DE (2012) Analysis of single- (SICI)1097-4644(199608)62:2<181::AID-
cell gene transcription by RNA fluorescent in JCB6>3.0.CO;2-O
situ hybridization (FISH). J Vis Exp (68). 15. Jolly C, Metz A, Govin J, Vigneron M, Turner
doi:10.3791/4073 BM, Khochbin S, Vourc’h C (2004) Stress-
6. Wagner M, Haider S (2012) New trends in induced transcription of satellite III repeats.
fluorescence in situ hybridization for identifica- J Cell Biol 164(1):25–33. doi:10.1083/
tion and functional analyses of microbes. Curr jcb.200306104
Opin Biotechnol 23(1):96–102. 16. Sierra-Miranda M, Delgadillo DM, Mancio-
doi:10.1016/j.copbio.2011.10.010 Silva L, Vargas M, Villegas-Sepulveda N,
7. Twedt DC, Cullen J, McCord K, Janeczko S, Martinez-Calvillo S, Scherf A, Hernandez-Rivas
Dudak J, Simpson K (2014) Evaluation of flu- R (2012) Two long non-coding RNAs gener-
orescence in situ hybridization for the detec- ated from subtelomeric regions accumulate in a
tion of bacteria in feline inflammatory liver novel perinuclear compartment in Plasmodium
disease. J Feline Med Surg 16(2):109–117. doi falciparum. Mol Biochem Parasitol 185(1):36–
:10.1177/1098612X13498249 47. doi:10.1016/j.molbiopara.2012.06.005
8. Gribnau J, Diderich K, Pruzina S, Calzolari R, 17. Bertozzi D, Iurlaro R, Sordet O, Marinello J,
Fraser P (2000) Intergenic transcription and Zaffaroni N, Capranico G (2011)
developmental remodeling of chromatin sub- Characterization of novel antisense HIF-1alpha
domains in the human beta-globin locus. Mol transcripts in human cancers. Cell Cycle
Cell 5(2):377–386 10(18):3189–3197
9. van de Corput MP, Grosveld FG (2001) 18. Froehler BC, Wadwani S, Terhorst T, Gerrard S
Fluorescence in situ hybridization analysis of (1992) Oligodeoxynucleotides containing C-5
transcript dynamics in cells. Methods 25(1):111– propyne analogs of 2′-deoxyuridine and 2′-deox-
118. doi:10.1006/meth.2001.1220 ycytidine. Tetrahedron Lett 33:5307–5310
10. Bridger JM, Kalla C, Wodrich H, Weitz S, King 19. Barnes TW 3rd, Turner DH (2001) Long-
JA, Khazaie K, Krausslich HG, Lichter P range cooperativity in molecular recognition of
(2005) Nuclear RNAs confined to a reticular RNA by oligodeoxynucleotides with multiple
compartment between chromosome territo- C5-(1-propynyl) pyrimidines. J Am Chem Soc
ries. Exp Cell Res 302(2):180–193. 123(18):4107–4118
doi:10.1016/j.yexcr.2004.07.038 20. Prosnyak MI, Veselovskaya SI, Myasnikov VA,
11. Hutchinson JN, Ensminger AW, Clemson CM, Efremova EJ, Potapov VK, Limborska SA,
Lynch CR, Lawrence JB, Chess A (2007) A Sverdlov ED (1994) Substitution of
screen for nuclear transcripts identifies two 2-aminoadenine and 5-methylcytosine for ade-
linked noncoding RNAs associated with SC35 nine and cytosine in hybridization probes
splicing domains. BMC Genomics 8:39. increases the sensitivity of DNA fingerprinting.
doi:10.1186/1471-2164-8-39 Genomics 21(3):490–494. doi:10.1006/
12. Bonifazi E, Gullotta F, Vallo L, Iraci R, Nardone geno.1994.1306
AM, Brunetti E, Botta A, Novelli G (2006) Use 21. Xodo LE, Manzini G, Quadrifoglio F, van der
of RNA fluorescence in situ hybridization in the Marel GA, van Boom JH (1991) Effect of
 RNA-FISH of Small Non-Coding RNAs 83

5-methylcytosine on the stability of triple- analogue with excellent hybridizing and nucle-
stranded DNA–a thermodynamic study. ase resistance profiles. Nucleosides Nucleotides
Nucleic Acids Res 19(20):5625–5631 Nucleic Acids 26(10–12):1625–1628.
22. Lebedev Y, Akopyants N, Azhikina T, doi:10.1080/15257770701548980
Shevchenko Y, Potapov V, Stecenko D, Berg 28. Biamonti G, Vourc’h C (2010) Nuclear stress
D, Sverdlov E (1996) Oligonucleotides con- bodies. Cold Spring Harb Perspect Biol
taining 2-aminoadenine and 5-methylcytosine 2(6):a000695. doi:10.1101/cshperspect.
are more effective as primers for PCR amplifi- a000695
cation than their nonmodified counterparts. 29. Metz A, Soret J, Vourc’h C, Tazi J, Jolly C
Gene Anal 13(1):15–21 (2004) A key role for stress-induced satellite
23. He J, Seela F (2002) Propynyl groups in duplex III transcripts in the relocalization of splicing
DNA: stability of base pairs incorporating factors into nuclear stress granules. J Cell Sci
7-substituted 8-aza-7-deazapurines or 117(Pt 19):4551–4558. doi:10.1242/
5-substituted pyrimidines. Nucleic Acids Res jcs.01329
30(24):5485–5496 30. Denegri M, Chiodi I, Corioni M, Cobianchi F,
24. Kawasaki AM, Casper MD, Freier SM, Lesnik Riva S, Biamonti G (2001) Stress-induced
EA, Zounes MC, Cummins LL, Gonzalez C, nuclear bodies are sites of accumulation of pre-
Cook PD (1993) Uniformly modified mRNA processing factors. Mol Biol Cell
2′-deoxy-2′-fluoro phosphorothioate oligonu- 12(11):3502–3514
cleotides as nuclease-resistant antisense com- 31. Rizzi N, Denegri M, Chiodi I, Corioni M,
pounds with high affinity and specificity for Valgardsdottir R, Cobianchi F, Riva S, Biamonti
RNA targets. J Med Chem 36(7):831–841 G (2004) Transcriptional activation of a consti-
25. Silverman AP, Kool ET (2007) Oligonucleotide tutive heterochromatic domain of the human
probes for RNA-targeted fluorescence in situ genome in response to heat shock. Mol Biol
hybridization. Adv Clin Chem 43:79–115 Cell 15(2):543–551. doi:10.1091/mbc.
26. Petersen M, Wengel J (2003) LNA: a versatile E03-07-0487
tool for therapeutics and genomics. Trends 32. Valgardsdottir R, Chiodi I, Giordano M, Rossi
Biotechnol 21(2):74–81. doi:10.1016/S0167- A, Bazzini S, Ghigna C, Riva S, Biamonti G
7799(02)00038-0 (2008) Transcription of Satellite III non-
27. Rahman SM, Seki S, Utsuki K, Obika S, coding RNAs is a general stress response in
Miyashita K, Imanishi T (2007) human cells. Nucleic Acids Res 36(2):423–
2′,4′-BNA(NC): a novel bridged nucleic acid 434. doi:10.1093/nar/gkm1056
 Chapter 9

RT-qPCR-Based Quantification of Small Non-Coding RNAs

Fjoralba Zeka, Pieter Mestdagh, and Jo Vandesompele

Abstract
MicroRNAs (miRNAs) are small non-coding RNA molecules that negatively regulate messenger RNA
(mRNA) translation into protein. MiRNAs play a key role in gene expression regulation, and their involve-
ment in disease biology is well documented. This has fueled the development of numerous tools for the
quantification of miRNA expression levels. These tools are based on three technologies: (microarray)
probe hybridization, RNA sequencing, and reverse transcription quantitative polymerase chain reaction
(RT-qPCR). In this chapter, we describe a quantification system based on RT-qPCR technology, which is
currently considered as the most sensitive, flexible, and accurate method for quantification of not only
miRNA but also RNA expression in general. To this purpose, we have divided the protocol in three sec-
tions: reverse transcription (RT) reaction, optional preamplification (PA), and finally qPCR. Three quality-
control (QC) steps are implemented in this workflow for assessment of RNA extraction efficiency, sample
purity (e.g., absence of inhibitors), and inter-run variations, by examining the detection level of different
spike-in synthetic miRNAs. We conclude by demonstrating raw data preprocessing and normalization
using expression data obtained from high-throughput miRNA profiling of human RNA samples.

Key words MicroRNA, Reverse transcription reaction, Preamplification, qPCR, miScript,

Quality control

1 Introduction

MicroRNAs are short non-coding RNA molecules that enable

posttranscriptional gene silencing by interacting with the 3′UTR
region of a mRNA target sequence [1]. One miRNA may target
multiple mRNAs, and one mRNA may be targeted by several
miRNAs. With over 2,500 human mature miRNAs described
(miRBase release 21), miRNAs constitute one of the largest classes
of gene expression regulators [2]. MiRNA-mediated gene expres-
sion modulation is an important and vital biological process. This
is reflected in the high conservation level of miRNA sequences
throughout vertebrates [3]. Since their discovery in 1993, miRNAs
have been extensively studied in order to unravel their molecular
methods of action and were found to be implicated in almost all

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_9, © Springer Science+Business Media New York 2015

85
86 Fjoralba Zeka et al.

physiological processes such as cell cycle progression, metastasis,

embryogenesis, hematopoiesis, or immune response. Therefore, it
was not surprising that aberrantly expressed miRNAs play a role in
various diseases such as cancer, neurodevelopmental or cardiovas-
cular diseases, obesity, etc. [4].
The rapidly growing insights in miRNA regulation mecha-
nisms and their implication in health and disease have triggered the
development of numerous quantitative miRNA expression plat-
forms. Furthermore, the current popularity of personalized medi-
cine and the search for genetic (cancer) biomarkers in both solid
tissue and body fluids have significantly contributed to this devel-
opment [5, 6].
Most currently used miRNA quantification methods were
recently described in a comprehensive miRNA quality-control
(miRQC) study published by Mestdagh et al., where 12 commer-
cially available platforms were compared in terms of reproducibil-
ity, sensitivity, accuracy, specificity, and concordance of differential
expression [7]. Two miRNA sequencing platforms, three miRNA
hybridization platforms, and seven RT-qPCR platforms were
included in the assessment.
The method described in this book chapter, the miScript PCR
System, was also included in the miRQC study, without the optional
cDNA preamplification step though. This miRNA expression plat-
form, together with many other qPCR platforms, is characterized
by an overall high sensitivity, especially prominent when working
with samples with low RNA quantity, which is of particular impor-
tance when miRNA expression is studied in body fluids. Other
advantages of the miScript platform are the large availability of
2,405 validated human miRNA assays, which cover approximately
93 % of the current miRBase content, and the flexibility to study
any subset of these miRNAs using custom miRNA assay plates.
The miScript PCR technology uses a universal reverse tran-
scription step based on polyadenylation, followed by anchored
oligodT priming (Fig. 1). Universal RT is less expensive, quicker,
and more straightforward than target-specific multiplex RT alter-
natives. The most important advantage is the flexibility offered by
a single RT reaction for the whole miRNome, in contrast to a mul-
tiplex reaction where the utility of the RT product is confined to
the number of multiplexed assays. cDNA from a universal RT pro-
cedure can be reused if the miRNAs under evaluation change
throughout the course of the study.
Another key attribute of the miScript PCR platform is the use
of internal synthetic controls that are added in the RT Mix (miRTC,
miRNA reverse transcription control) or dispensed on pre-spotted
qPCR arrays (PPC, positive PCR control). These controls allow
evaluation of reverse transcription efficiency, qPCR inhibition, and
technical reproducibility.
 RT-qPCR 87

Fig. 1 Selective conversion of mature miRNAs into cDNA in miScript HiSpec Buffer. In a reverse transcription
reaction with miScript HiSpec Buffer, mature miRNAs are polyadenylated by a poly-A polymerase and con-
verted into cDNA by a reverse transcriptase with oligodT priming. The cDNA is then used for qPCR quantifica-
tion of mature miRNA expression

Here, we present a three-step workflow with a quality check-

point after each step: (1) reverse transcription (RT) and quality
control of the RT product by evaluation of miRTC levels, (2)
(optional) preamplification (PA) and evaluation of the preampli-
fied miRTC product, and (3) qPCR assessment of spike-in controls
miRTC and PPC, together with the endogenous miRNAs of inter-
est. The spike-in controls are evaluated in terms of inter-sample
variability and in terms of abundance difference relative to a con-
trol sample. Raw data preprocessing, including data filtering and
normalization, is demonstrated by using expression data obtained
from high-throughput miScript miRNA profiling on human RNA
samples. Here, we applied the global mean normalization proce-
dure [8, 9], introduced by Mestdagh et al. and later modified by
88 Fjoralba Zeka et al.

D’haene et al. This method was proven to be superior to normal-

ization using a single or even multiple endogenous small RNAs
(such as sn(o)RNAs). In Subheading 4, important considerations
with respect to RNA quantity are discussed, not only because this
influences data quality but also because it affects specific steps dur-
ing the RT-qPCR workflow.

2 Materials

RNase-free water should be used to prepare all solutions. All PCR

preparation steps should be performed in an RNase-free area, sepa-
rated from the post-PCR product manipulation area. RNase-free
tubes and filter tips are required throughout the entire pre-PCR
workflow.

2.1 Reverse 1. Total RNA extract (see Notes 1–3).

Transcription (RT) 2. RNase-free water.
Reaction
3. Carrier RNA (tRNA, MS2 phage RNA) (see Note 4).
4. Reverse Transcriptase Mix from miScript II RT Kit (Qiagen).
5. 5x miScript Buffer from miScript II RT Kit (Qiagen): HiSpec
Buffer if preamplification reaction is performed or HiFlex
Buffer if no PA reaction is performed (see Note 5).
6. 10x Nucleics Mix from miScript II RT Kit (Qiagen) (see Note 6).
7. Thermal cycler.

2.2 qPCR for Quality 1. Diluted RT product.

Control of the RT 2. RNase-free water.
Reaction
3. 2× QuantiTect SYBR Green PCR Master Mix from miScript
SYBR Green PCR Kit (Qiagen).
4. 10× miScript Universal Primer from miScript SYBR Green
PCR Kit (Qiagen).
5. 10× miRTC miScript Primer Assay (Qiagen).
6. qPCR instrument (see Note 7).
7. 384-well qPCR plate (see Note 8).

2.3 Preamplification 1. Diluted RT product.

Reaction 2. RNase-free water.
3. 5× miScript PreAMP Buffer from miScript PreAMP PCR Kit
(Qiagen).
4. HotStarTaq DNA Polymerase from miScript PreAMP PCR
Kit (Qiagen).
5. miScript PreAMP Universal Primer from miScript PreAMP
PCR Kit (Qiagen).
 RT-qPCR 89

6. miScript PreAMP Primer Mix (see Note 9) (Qiagen).

7. Thermal cycler.

2.4 qPCR for Quality 1. Diluted PA product.

Control 2. RNase-free water.
of the Preamplification
3. 2× QuantiTect SYBR Green PCR Master Mix from miScript
Reaction
SYBR Green PCR Kit (Qiagen).
4. 10× miScript Universal Primer from miScript SYBR Green
PCR Kit (Qiagen).
5. 10× miRTC miScript Primer Assay (Qiagen).
6. qPCR instrument (see Note 7).
7. 384-well qPCR plate (see Note 8).

2.5 qPCR Reaction 1. Diluted preamplified cDNA.

2. RNase-free water.
3. 2× QuantiTect SYBR Green PCR Master Mix from miScript
SYBR Green PCR Kit (Qiagen).
4. 10× miScript Universal Primer from miScript SYBR Green
PCR Kit (Qiagen).
5. Pre-spotted assay multi-well plates (96-well or 384-well plates)
or individual assay tubes (see Note 10).
6. Robotic liquid handler or multichannel pipettes and repetition
pipette combined with repetitive pipette syringes.
7. qPCR instrument (see Note 7).

3 Methods

3.1 Reverse 1. If RNA isolation has not yet been performed, please carefully
Transcription (RT) read Notes 1–3. If RNA is available, measure RNA concentra-
Reaction tion by spectrophotometry or fluorometry for samples with
low RNA concentration (<5 ng/μl).
2. If the total RNA concentration is high (>100 ng/μl), dilute the
samples to the minimum concentration (see Notes 11 and 12)
and continue with the RT reaction (step 5).
3. If total RNA concentration is low (<100 ng/μl), closely evalu-
ate the quality of the samples with the lowest concentrations
(<5 ng/μl). Consider their exclusion from the study and avoid
equalization of RNA concentrations for the other samples to a
suboptimally low concentration (see Notes 11 and 12). Dilute
the samples to the minimum concentration and continue with
the RT reaction (step 5).
4. If all samples have an RNA concentration varying around 5 ng/
μl or if RNA concentration cannot be reliably assessed (e.g.,
90 Fjoralba Zeka et al.

Table 1
Reverse transcription reaction mix components

Mix components Volume per reaction (μl) 10 reactions (μl) 10 % excess (μl)
Reverse Transcriptase Mix 1 10 11
5× miScript RT Buffer 2 20 22
10× Nucleics Mix 1 10 11
RNase-free water Variable Variable Variable
RNA sample Variable
Total volume per reaction 10

from low-volume body fluids), use 1.5 μl of undiluted RNA

and continue with the RT reaction (see Notes 11 and 12).
5. Perform the following steps on ice. Prepare a negative control
sample with 10 μl of RNase-free water. If a spike-in control was
used during RNA isolation, add the carrier RNA and the spike-in
control to the control water sample. If not, continue to step 8.
6. Dilute carrier RNA in RNase-free water. The concentration of
carrier RNA in the negative control sample should be in the same
range as the RNA concentration of the biological samples.
7. Add the spike-in control solution to the carrier solution in
order to obtain the same spike-in concentration as present in
the RNA isolates.
8. Prepare one RT Mix for all reactions according to Table 1 (typ-
ically one reaction per sample). If needed, RT replicates can be
useful to monitor RT variability (see Notes 5, 13 and 14).
9. Mix well by gently pipetting up and down and distribute the
RT Mix in separate reaction tubes (see Note 15).
10. Mix the RNA sample by gently pipetting up and down to
homogenize the RNA solution and add the RNA sample to
each RT tube (see Note 15).
11. Run the RT reactions on the thermal cycler (Table 2).
12. Spin the RT product briefly to collect the condensed fraction
and mix gently by pipetting up and down (see Note 15).
13. Make one 3 μl aliquot for the RT quality-control step and
another 7 μl aliquot for the remaining downstream steps (PA
and qPCR) (see Notes 16 and 17).

3.2 qPCR for Quality 1. Dilute 2 μl of the RT product (also for the negative control
Control of the RT sample) in 20 μl of RNase-free water (see Note 17).
Reaction 2. Prepare one qPCR mix for all samples to be measured as shown
in Table 3. Prepare a second qPCR mix besides the miRTC
 RT-qPCR 91

Table 2
Reverse transcription run protocol

Step Duration (min) Temperature (°C)

Reverse-strand synthesis 60 37
Enzyme denaturation 5 95
Cool down 1 4

Table 3
qPCR mix components

Volume per 10 × 2 10 %
Mix components reaction (μl) reactions (μl) excess (μl)
2× QuantiTect SYBR Green 5 100 110
PCR Master Mix
10× miScript Universal Primer 1 20 22
10× miScript Primer Assay 1 20 22
RNase-free water 1 20 22
Diluted RT product 2
Total volume per reaction 10

Table 4
qPCR run protocol

Step Duration Temperature

PCR activation step 15 min 95 °C
40 cycles of:
Denaturation 15 s 94 °C
Annealing 30 s 55 °C
Extension 30 s 70 °C

qPCR mix for the RNA isolation spike-in control if one was
used during RNA isolation. Prepare sufficient mix to perform
all reactions in duplicate (see Note 18).
3. Mix gently by pipetting up and down and distribute the qPCR
mix in a 384-well qPCR plate (see Note 15).
4. Mix the diluted RT sample by gently pipetting up and down
and add 2 μl of the product to the qPCR mix (see Note 15).
5. Run the qPCR protocol (Table 4).
92 Fjoralba Zeka et al.

Table 5
Preamplification reaction mix components

Mix components Volume per reaction (μl) 10 reactions (μl) 10 % excess (μl)
5× miScript PreAMP Buffer 5 50 55
HotStarTaq DNA Polymerase 2 20 22
miScript PreAMP Primer Mix 5 50 55
RNase-free water 7 70 77
miScript PreAMP Universal Primer 1 10 11
Diluted RT product 5
Total volume 25

6. Export raw miRTC Cq data and calculate the Cq difference

between each RNA sample and the water negative control
sample.
7. Exclude samples that show a Cq difference larger than 1 as this
likely refers to inefficient RT reaction, RT or PCR inhibition,
or technical error during RNA isolation (see Note 19).

3.3 Preamplification 1. Dilute the 7 μl RT aliquot from the samples and the negative
Reaction (Optional, control sample in 28 μl water to obtain a fivefold dilution (see
Recommended Notes 16 and 17).
for Highest Sensitivity) 2. Prepare one PA mix for all reactions (one reaction per sample
and per primer pool) (Table 5).
3. Mix well by gently pipetting up and down (see Note 15) and
distribute 20 μl in separate reaction tubes.
4. Gently mix the diluted (1:5) RT product by pipetting up and
down (see Note 15) and add 5 μl to each PA reaction tube to
obtain a final volume of 25 μl.
5. If multiple PA primer pools are available (e.g., 7 pools for miR-
Base v.20), multiple PA reactions should be prepared for each
sample (see Note 9).
6. Run the PA protocol on the thermal cycler (Table 6).
7. Centrifuge the PA product briefly to collect the condensed
fraction and mix gently by pipetting up and down.
8. If multiple PA reactions per sample were performed, pool the
PA reactions prior to dilution.
9. Dilute the pooled PA product five times into the PA reaction
to obtain a 1:5 dilution per ng cDNA (see Note 20).
10. Make a 2 μl aliquot of the diluted PA product for the quality-
control step.
 RT-qPCR 93

Table 6
Preamplification reaction run protocols

For preamplification of ≤ 96 assaysa For preamplification of ≥ 96 assaysa

Step Duration Temperature Step Duration Temperature

PCR activation step 15 min 95 °C PCR activation step 15 min 95 °C
12 cycles of: 2 cycles of:
Denaturation 30 s 94 °C Denaturation 30 s 94 °C
Annealing/extension 3 min 60 °C Annealing 60 s 55 °C
Extension 60 s 70 °C
10 cycles of:
Denaturation 30 s 94 °C
Annealing/extension 3 min 60 °C
a
Different run protocols are used depending on the number of primer assays in the miScript PreAMP Primer Mix

3.4 qPCR for Quality 1. Prepare one qPCR mix for all samples (see Table 3). Prepare a
Control second qPCR mix besides the miRTC qPCR mix for the RNA
of the Preamplification isolation spike-in control if one was used during RNA isola-
Reaction tion. Prepare sufficient mix to perform all reactions in dupli-
cate (see Note 18).
2. Mix gently by pipetting up and down and distribute the mix in
a 384-well qPCR plate (see Note 15).
3. Mix the diluted PA sample by gently pipetting up and down
and add 2 μl of the product to the qPCR mix (see Note 15).
4. Run the qPCR experiment (Table 4).
5. Export raw miRTC Cq data and calculate the Cq difference
between each RNA sample and the water negative control
sample.
6. Exclude samples that show a Cq difference larger than 1 as this
likely reflects inefficient PA reaction, qPCR inhibition, or tech-
nical failure (see Note 19).

3.5 qPCR 1. Continue with the samples that passed the quality-control
steps after RT reaction and PA reaction.
2. Prepare one qPCR mix per sample and distribute in 384-well
plates (Table 7).
3. Run the samples on a qPCR instrument (Table 4).
4. Export raw Cq values from the qPCR experiment.
5. Evaluate PPC variations across samples (see Note 21).
6. Calculate the global mean miRNA Cq value per sample and
evaluate this value together with the Cq values for miRTC and
PPC across samples to check for possible occurrence of batch
effects during the experiment (see Note 22).
94 Fjoralba Zeka et al.

Table 7
Mix components for 384-well platea qPCR reactions

1 plate + 10 % 5 plates + 10 %
Mix components 1 plate (µl) excess (µl) excess (µl)
2× QuanTitect SYBR Green PCR Master Mix 2,050 2,255 11,275
10× miScript Universal Primer 410 451 2,255
RNase-free water 1,540 1,694 8,470
Template cDNA 100 110 550
Total volume 4,100 4,510 22,550
a
In this table, mix components are shown for plates pre-spotted with PCR Primer Assays. If non-spotted plates are used
then 10× miScript Primer Assay should be added to the PCR Mix (mix composition as shown in Table 3)

7. Determine an upper Cq detection cutoff and remove all values

above the cutoff (see Note 23).
8. Normalize the data by the modified global mean method
(see Note 24).

4 Notes

1. There is no need to isolate pure small RNAs. We recommend

total RNA isolation (including small RNAs) which can be used
to quantify small RNAs using various methods.
2. The quantity of RNA can have a drastic impact on the repro-
ducibility and reliability of RT-qPCR data. If RNA concentra-
tion is sufficiently high (>100 ng/μl), then each sample can
easily be diluted to an equal concentration before starting the
RT reaction. It is important to perform this step carefully since
a variable RNA input contributes to variability in gene expres-
sion levels and thus masks true gene expression differences
between samples. If the majority of samples have a concentra-
tion lower than 5 ng/μl, accurate measurement of RNA con-
centration by spectrophotometric methods and dilution to
equal concentrations before RT reaction is difficult or impos-
sible (as is the case for cell-free body fluids like serum, plasma,
sputum, spinal fluid, etc.). The following adjustments can be
made to the RNA isolation protocol in order to increase RNA
yield and standardize RNA input for the RT reaction.
Invest sufficient time in choosing an RNA isolation method
that is adapted to the starting material type. Different kits have
been optimized to increase yield and purity of RNA extracted
from specific biomaterials. For example, miRNeasy total RNA
isolation Kits (Qiagen) are provided in different formats.
 RT-qPCR 95

MiRNeasy FFPE Kit is optimized for formalin-fixed paraffin-

embedded (FFPE) samples, miRNeasy Serum/Plasma Kit for
serum and plasma samples, miRNeasy Micro Kit for low cell
numbers, etc. A higher RNA concentration is obtained if the
miRNeasy Micro Kit is used for isolation of serum RNA instead
of the miRNeasy Mini Kit (elution of the RNA extract in 14 μl
water instead of 30 μl water) (Fig. 2).
Start from an equal amount of biomaterial if possible. For
example, when working with body fluids, start from equal vol-
umes of the fluid. When working with solid tissue, weigh the
tissue or count cells if possible.
Use a spike-in RNA control during RNA isolation in
biofluids. The miRNeasy Serum/Plasma Kit provides miR-
Neasy Serum/Plasma Spike-In Control (cel-miR-39-3p
mimic), a synthetic miRNA from C. elegans. This will allow
you to evaluate RNA isolation efficiency and RNA isolation
variability across all samples. Note that it is important to add
the spike-in RNA only after lysis (this is after addition of lysis
reagent, sample mixing, and incubation at room temperature
for 5 min). Synthetic spike-in RNA molecules are sensitive to
RNases present in body fluids or tissues. Lysis will cause protein
denaturation and inactivation of RNases. As a result, the quan-
tity of the spike-in control RNA will remain stable across sam-
ples when added after lysis.

50

40

30
RNA
concentration
(ng/µl)
20

10

miRNeasy miRNeasy
mini kit micro kit

Fig. 2 Purified RNA concentration in serum from healthy individuals measured by

NanoDrop 1000, obtained from miRNeasy mini kit (left, 30 μl eluate) and miR-
Neasy micro kit (right, 14 μl eluate) (n = 18; box plot showing median, first and
third quartile, whiskers denote 25th and 75th percentile) (see Notes 11 and 12)
96 Fjoralba Zeka et al.

A last recommendation is to collect an equal volume of the

upper aqueous phase for each sample, even if this is less than
the maximum volume you could possibly recover. It might
decrease the total RNA yield, but it will contribute to recovery
of equal amounts of pure RNA across the sample set.
3. Besides RNA quantity, another important aspect to consider
before pursuing with the reverse transcription reaction is RNA
quality. Quality is both defined by RNA integrity (i.e., non-
degraded) and purity. Impure RNA can inhibit enzymatic reac-
tions such as reverse transcription or PCR. Contaminations
can originate from the RNA isolation procedure (ethanol, gua-
nidine salts, contaminating proteins, etc.). In this workflow,
miRTC (miRNA reverse transcription control) and PPC (posi-
tive PCR control) are used to detect inhibition of RT and/or
qPCR reaction. Amplification of these control RNAs in the
presence of the RNA extract is compared to its amplification in
a negative control sample (e.g., pure water with carrier RNA). If
delayed amplification is observed in the RNA isolate (higher Cq
values) in comparison to the water sample, inhibitory activity
during RT or PCR can be assumed, and the RNA sample should
be excluded from downstream experiments (see Note 17).
4. Higher reproducibility of qPCR measurements is described in
literature when carrier RNA is included to RNA samples [10].
Therefore, carrier RNA is used to prepare the RT control sam-
ple to which spike-in miRNA is added. This will ensure repro-
ducible data to be obtained for the control sample.
5. The miScript RT Kit provides two types of buffers depending
on whether you want to perform cDNA preamplification or
not. HiSpec Buffer facilitates the selective conversion of mature
miRNAs into cDNA, while HiFlex Buffer promotes conver-
sion of all RNA species (mature miRNA, precursor miRNA,
non-coding RNA, and mRNA) into cDNA. Using HiSpec
Buffer, the conversion of long RNAs, such as mRNAs, is sup-
pressed. As a result, background signals potentially contributed
by long RNAs are nonexistent making HiSpec Buffer highly
suitable for miRNA expression profiling. HiSpec Buffer is
required when preamplification reactions are performed.
HiFlex Buffer or miScript HiSpec buffer may be used if no
preamplification reactions are performed.
6. The miScript Nucleics Mix contains the synthetic RNA control
miRTC.
7. It is important to use the same qPCR instrument and data
analysis settings during the entire experiment. Differences in
Cq values can be observed if samples are run on different
instruments, and this can lead to increased variability. Ideally,
all samples that need to be compared should be analyzed in the
same run/plate, corresponding to Hellemans sample maximi-
 RT-qPCR 97

zation strategy [11]. However, in a screening mode, it is often

more convenient to measure one sample per set of assay plates.
Using the same instrument and software data analysis settings
and including controls (such as the PPC) will greatly help to
reduce technical variance.
8. We typically use 384-well plates, but 96-well format, rotor-disc
format, and individual tubes work as well, as long as mix com-
position and volume proportions are respected.
9. The composition of the miScript PreAMP Primer Mix is fully
customized. Primer mixes can be ordered for whole miRNome
profiling (2,405 miRNAs, v.20 miRBase content) or for a
selection of miRNAs. If targets of interest are unknown, whole
miRNome profiling can be performed on a reduced number of
representative samples. This will allow selection of a set of
interesting miRNAs and profiling of only the selected set across
a larger sample cohort in a second screening step.
10. We typically use multi-well plates pre-spotted with qPCR
primer assays. Since the primer assays are not manually added
to the qPCR Mix, this will speed up the preparation and help
decrease technical variability. Alternatively, qPCR primer assays
can be ordered individually.
11. Make sure to dilute the RNA solution to a concentration and
volume within the range of the RT Kit. In this protocol, the
recommended RNA input for mature miRNA profiling ranges
between 10 ng and 2 μg for a 20 μl RT reaction. In case of
preamplification, 10 ng to 100 ng RNA input is recommended
in a 10 μl RT reaction. If RNA concentration is unknown (e.g.,
in the case of body fluids), 1.5 μl of the undiluted RNA input
is recommended for a 10 μl RT reaction.
12. The unreliable detection range depends on the RNA concen-
tration measurement device. Spectrophotometry (e.g.,
NanoDrop 1000) is the commonly used method for RNA
concentration measurement. An optimal determination range
between 500 and 5 ng/μl was reported for the NanoDrop
1000 [12]. The lowest detection limit is 2 ng/μl, and the pre-
cision of the measurement decreases below 5 ng/μl [12].
Therefore, RNA concentration values below 5 ng/μl should
be interpreted with caution. Samples with concentration below
5 ng/μl should preferably be excluded, rather than diluting the
other samples to the same low concentration.
The suggested 5 ng/μl cutoff does not apply if methods
with lower detection limits are used to measure RNA concen-
tration (e.g., fluorescence-based quantification).
13. The volume of the RT reaction described in the Qiagen miS-
cript handbook differs when preamplification is included in
the workflow. In case of preamplification, RT reaction is per-
formed in 10 μl. If preamplification is not included in the
workflow, the RT reaction is performed in 20 μl. In our
98 Fjoralba Zeka et al.

workflow, we routinely perform 10 μl RT reactions. RT reac-

tion volumes of 20 or 10 μl did not show any discrepancies on
the Cq values for cel-miR-39-3p and miRTC.
14. miScript Primer Assays are designed using a proprietary
algorithm that promotes efficient and specific detection and
amplification of mature miRNA. In addition, the algorithm has
been extensively challenged with wet bench data using miRNA
families to ensure that primers can distinguish closely related
miRNA sequences. Candidate miScript Primer Assays are sub-
jected to a series of wet-lab validation tests with predefined
metrics that ensure miRNA-specific amplification. These tests
include three background signal tests including a no template
control (NTC) real-time PCR reaction, a “water only” reverse
transcription reaction, and a poly-A polymerase-minus reverse
transcription reaction performed on species-specific universal
total RNA. These tests ensure that miScript Primer Assays are
not amplifying molecules other than miRNAs. For example, in
a poly-A polymerase-minus reaction, a positive real-time PCR
signal would indicate that the primer is not specifically amplify-
ing cDNA synthesized from miRNAs, since miRNAs are not
naturally polyadenylated. miScript Primer Assays are also tested
using a species-specific universal total RNA sample spiked with
a synthetic miRNA standard. For this series of tests, each assay
must have a Cq within an acceptable range and feature a
smooth and sigmoidal amplification curve, single peak dissocia-
tion curves, and dissociation curve temperatures indicative of a
mature miRNA PCR amplicon. If a miScript Primer Assay fails
any of these wet-lab tests, the assay is redesigned and retested.
15. According to miScript qPCR protocols from Qiagen, miScript
cDNA samples and mixes should not be mixed on a vortex
device. Gentle flicking or pipetting up and down is advised
instead. When pipetting up and down, it is important to use a
large pipet tip that allows aspiration of at least half of the total
mixture volume. Only then will sufficient turbulence be cre-
ated to allow effective homogenization of the viscous PCR
reagents. If not done properly, sample-to-sample variability
may be introduced in your data.
16. In this workflow, the RT product is differently diluted depending
on whether the RT reaction is followed by a PA reaction or not.
If you plan to perform preamplification, divide the RT product
in different aliquots, one for QC RT (which is performed directly
after RT) and one for the PA reaction. Dilute each of the aliquots
accordingly as described in the “Methods” section above.
17. If no PA is performed after the RT reaction, a minimum
11-fold dilution is advised for the RT product, to avoid qPCR
inhibition and minimize nonspecific product formation. If the
RT reaction is followed by a PA reaction, then a minimum
fivefold dilution of the RT product is recommended.
 RT-qPCR 99

100
92.7
86.2

Cumulative
fraction 50
(%) <1 <2

ΔCq miRTC

ΔCq cel-miR-39-3p

0
ΔCq

Fig. 3 ∆Cq cumulative density for miRTC and cel-miR-39-3p measured in 289 serum samples (∆Cq = Cq RNA
sample − Cq negative control sample). 86.2 % of the samples show a miRTC ∆Cq smaller than 1, and 92.7 %
of the samples show a miRTC ∆Cq value smaller than 2

18. For each QC qPCR step, the samples are measured in the same
plate according to the sample maximization principle [11]; so
run all samples on one plate for as many assays as possible and
divide assays over different plates only if needed. If working with
a large number of samples (that cannot fit on a single plate),
multiple runs per target are required, and inter-run calibration
should be performed to avoid technical inter-plate variation.
19. Cumulative density plot for miRTC ∆Cq values obtained from
289 serum samples is shown in Fig. 3. Samples showing a
miRTC ∆Cq value larger than one (13.8 %) were not used in
the downstream analyses. A larger variation for spike-in ∆Cq
(cel-miR-39-3p) was observed. In this study, no sample exclu-
sion was performed based on this criterion, except for one
sample where the spike-in was not detected.
20. In this workflow, the minimum dilution factor for preamplified
cDNA is fivefold (miRNome arrays and custom arrays for 96–384
assays). If cDNA concentration is known, the dilution factor equals
the amount of input cDNA (ng) in the PA reaction multiplied by
5. For example, if 2 ng cDNAs were added to the PA reaction, a
tenfold (2 × 5) dilution should be performed after the PA reaction.
If cDNA concentration is unknown (e.g., body fluids), perform a
fivefold dilution and prepare an additional QC qPCR test to evalu-
ate the Cq values for some miRNAs (the miScript PreAMP
Handbook recommends evaluation of miR-16 or SNORD95). If
other miScript array formats are being used (pathway-focused
arrays and custom arrays), carefully consult the miScript PreAMP
Handbook to determine the optimal dilution factor.
100 Fjoralba Zeka et al.

100

Cumulative
fraction 50
(%) 96.0
%

18.3 19.3

Cq PPC

Fig. 4 Cumulative density of PPC (positive PCR control) Cq values measured in

251 serum samples. 96.0 % of the samples are detected within one Cq value
around the median value of 18.8

21. Assessments of PPC Cq values will allow monitoring of inter-

run variation, batch effect, and technical failures. In Fig. 4, a
cumulative density plot is shown for PPC Cq values for 251
RNA samples isolated from human serum. A very tight distri-
bution of PPC Cq values is observed. Approximately 5 % of the
samples differ by more than one cycle from the median Cq
(18.8).
22. Batch effect refers to a shift in global miRNA expression level
that is not caused by the biological effect under evaluation.
Batch effects can be explained by effects caused by different
RNA isolation batches, RT reaction batches, and PA batches.
They can also result from the sample origin, sample transport
conditions, tissue type, etc. Global mean, miRTC, PPC, RNA
isolation spike-in values, and their trend across the entire sample
set can reveal very useful information with respect to the source
of global expression shifts (if any are present). If the research
objective is to compare two or more sample sets (e.g., treatment
groups, survival groups, etc.), it is very important to check
whether the differences coincide with a certain sample batch.
23. A robust method to determine the Cq detection cutoff was
recently described in the miRQC study [7]. This method is based
on the evaluation of single positive signals obtained from replicate
miRNA expression data. A single positive is a miRNA for which
amplification was obtained in only one of the sample replicates.
 RT-qPCR 101

The detection cutoff is defined as the Cq value at which the single

positive fraction is reduced by 95 %.
24. The modified global mean normalization is a very effective way
to eliminate technical variability [9]. The method is imple-
mented in the second version of Biogazelle’s qbase + software
and is particularly useful in high-throughput miRNA profiling
experiments (evaluation of >100 miRNAs). Briefly, this method
attributes equal weight to each miRNA by mean centering the
miRNA expression values. The arithmetic mean Cq value for
one miRNA is calculated across all samples and subtracted from
each individual Cq value for that same miRNA prior to calculat-
ing the global mean expression value per sample. This value, the
normalization factor, is then subtracted from each individual
Cq value per sample to obtain normalized miRNA expression
values. If only a few miRNAs are being studied, normalization
by multiple endogenous small RNAs, such as sno or snRNAs,
or by stably expressed miRNAs can be applied [11, 13].

Acknowledgment

Evaluation of this workflow was supported by Fournier-Majoie

Foundation.

References
1. Krol J, Loedige I, Filipowicz W (2010) The J, Grimley C, Lader E, Lee KY, Luo S,
widespread regulation of microRNA biogenesis, Mouritzen P, Narayanan A, Patel S, Peiffer S,
function and decay. Nat Rev Genet 11:597–610 Rüberg S, Schroth G, Schuster D, Shaffer JM,
2. Kozomara A, Griffiths-Jones S (2013) miR- Shelton EJ, Silveria S, Ulmanella U,
Base: annotating high confidence microRNAs Veeramachaneni V, Staedtler F, Peters T,
using deep sequencing data. Nucleic Acids Res Guettouche T, Wong L, Vandesompele J
42:D68–D73 (2014) Evaluation of quantitative miRNA
3. Berezikov E (2011) Evolution of microRNA expression platforms in the microRNA quality
diversity and regulation in animals. Nat Rev control (miRQC) study. Nat Methods
Genet 12:846–860 11:809–815
8. Mestdagh P, Van Vlierberghe P, De Weer A,
4. Soifer HS, Rossi JJ, Sætrom P (2007)
Muth D, Westermann F, Speleman F,
MicroRNAs in disease and potential therapeu-
Vandesompele J (2009) A novel and universal
tic applications. Mol Ther 15:2070–2079
method for microRNA RT-qPCR data normal-
5. Lesko LJ (2007) Personalized medicine: elu- ization. Genome Biol 10:R64
sive dream or imminent reality? Clin Pharmacol 9. D’haene B, Mestdagh P, Hellemans J,
Ther 81:807–816 Vandesompele J (2012) MiRNA expression
6. Schwarzenbach H, Hoon DSB, Pantel K profiling: from reference genes to global mean
(2011) Cell-free nucleic acids as biomarkers in normalization. Methods Mol Biol 822:
cancer patients. Nat Cell Biol 11:426–437 261–272
7. Mestdagh P, Hartmann N, Baeriswyl L, 10. Ståhlberg A, Håkansson J, Xian X, Semb H,
Andreasen D, Bernard N, Chen C, Cheo D, Kubista M (2004) Properties of the reverse
D’Andrade P, DeMayo M, Dennis L, Derveaux transcription reaction in mRNA quantification.
S, Feng Y, Fulmer SS, Gerstmayer B, Gouffon Clin Chem 50:509–515
102 Fjoralba Zeka et al.

11. Hellemans J, Mortier G, De Paepe A, evaluation of RNA quantification methods.

Speleman F, Vandesompele J (2007) qBase Anal Biochem 387:122–127
relative quantification framework and software 13. Vandesompele J, De Preter K, Pattyn F, Poppe
for management and automated analysis of B, Van Roy N, De Paepe A, Speleman F (2002)
real-time quantitative PCR data. Genome Biol Accurate normalization of real-time
8:R19 quantitative RT-PCR data by geometric aver-
12. Aranda R, Dineen SM, Craig RL, Guerrieri aging of multiple internal control genes.
RA, Robertson JM (2009) Comparison and Genome Biol 3 research0034.1–1333
 Chapter 10

Stem-Loop RT-PCR Based Quantification of Small

Non-Coding RNAs
Véronique Salone and Mathieu Rederstorff

Abstract
Stem-loop qRT-PCR is one of the most commonly used real-time PCR approach to quantify small
non-coding RNAs such as microRNAs. The quantification method is divided in two steps. First, RNA is
reverse-transcribed using a specific stem-loop primer, and the resulting RT product is subsequently used as
a template for quantitative real-time PCR. This fast and simple method provides quantitative data with
high sensitivity and specificity to study miRNAs and their functions.

Key words microRNA, Small non-coding RNA, Real-time PCR quantification, Stem-loop primers

1 Introduction

Low-abundance miRNAs are difficult to detect using technologies

such as cloning, northern blotting, or microarrays. On the other
hand, quantitative real-time PCR (qPCR), which is the gold stan-
dard for nucleic acid quantification due to the specificity and sen-
sitivity of the PCR process is challenging for small non-coding
RNAs because of their small size, sequence similarity with their
own precursors, and expression levels that can vary a lot among
species and tissues.
Recently, successful real-time RT-PCR technologies have been
developed to amplify and quantify very small non-coding RNAs
such as mature microRNAs. In the present chapter, we describe a
fast and simple method using stem-loop reverse transcription
followed by TaqMan PCR analysis to analyze miRNAs (Fig. 1).
We also describe how to use stem-loop RT primers in multiplex RT
reactions using precious, low-abundance RNA samples. Stem-loop
primers are designed to have a short single-stranded region that is
complementary to the known 3′ end of the small non-coding RNA,
a double-stranded stem and a loop containing the universal primer-
binding sequence. The utilization of stem-loop primers during the
RT step presents several advantages. First, the hairpin structure of

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_10, © Springer Science+Business Media New York 2015

103
104 Véronique Salone and Mathieu Rederstorff

Mature microRNA

Stem-loop primer

1. Stem-loop RT

2. Real-time PCR

Forward Primer

Reverse Primer
TaqMan probe

Fig. 1 RNA is reverse-transcribed into cDNA using a stem-loop primer that binds
the 3′ end of the small non-coding RNA. Then, the RT product is quantified using
TaqMan probes in a qPCR employing specific primers

the primer prevents hybridization to miRNA precursors or longer

RNAs. Second, annealing of a short RT primer to the 3′ extremity
of a small non-coding RNA has a better specificity to discriminate
among small non-coding RNAs of the same family. Finally, utiliza-
tion of stem-loop primers introduces additional downstream
nucleotides after the RT step. The size of the resulting RT product
is therefore more compatible with current PCR amplification sizes.
We show that TaqMan assays for microRNA give high-quality
quantitative data, with high sensitivity and high specificity.

2 Materials

1. Total RNA (see Notes 1 and 2).

2. MicroRNA detection TaqMan™ kit or custom TaqMan™ kit
designed for small non-coding RNA detection. Each kit
contains both the RT primer and of the TaqMan probe (Life
Technologies).
3. TaqMan™ microRNA Reverse Transcription Kit (Life
Technologies).
4. TaqMan™ 2× Universal PCR Master Mix, No AmpErase®UNG
(Life Technologies).
 Stem-Loop qRT-PCR 105

5. Thermocyclers.
6. Applied Biosystems Step One Plus™ Real-Time PCR system
(Life Technologies™) or any equivalent Real-Time PCR
system.
7. Speed vacuum.
8. Centrifuges.
9. ABI PRISM® 96-Well Optical Reaction Plates with Barcodes.
10. 96-well plate adhesive film.
11. PCR strips and caps.
12. Nuclease-free pipette tips with filters.
13. Positive displacement, air displacement, or multichannel
pipettors.
14. Polypropylene tubes.
15. RNase-free, sterile water.

3 Methods

3.1 Reverse 1. Thaw all TaqMan MicroRNA RT Kit reagents on ice.

Transcription Reaction 2. For one reaction, combine following kits’ reagents in a reaction
3.1.1 Individual Assay tube: 0.15 μl of 100 mM dNTPs, 1 μl of MultiScribe™ Reverse
Reverse Transcription Transcriptase (50 U/μl), 1.5 μl of 10× RT buffer, 0.19 μl of
Reaction RNAse inhibitor (20 U/μl), RNAse-free water up to 7 μl
(see Note 3).
3. Mix gently by inverting the tube. Short spin and keep on ice.
4. Add 5 μl of diluted total RNA.
5. Add 3 μl of 250 nM RT primer. Seal the tube and short spin
briefly. Keep tubes on ice.
6. Set the thermocycler and perform reverse transcription as fol-
lows: 16 °C for 30 min; 42 °C for 30 min; 85 °C for 5 min.
Cool down at 4 °C (see Note 4).
7. Dilute RT products before real-time PCR quantification step
(see Note 5).

3.1.2 Multiplex Reverse 1. Combine 25 μl of each individual 5× RT primer into a 1.5 ml

Transcription Reaction cap tube (see Note 6).
2. Evaporate in a speed vacuum at 50 °C for 1 h.
3. Resuspend primers in 100 μl of nuclease-free water to obtain a
multiplex RT primer pool. Each primer is now at 62.5 nM.
4. Keep on ice.
5. Mix 4 μl of multiplex RT primers with 20 ng of total RNA,
0.4 μl of 100 mM dNTPs, 100 U of MultiScribe™ Reverse
106 Véronique Salone and Mathieu Rederstorff

Transcriptase, 2 μl of 10× RT buffer, 0.25 μl of RNase inhibitor,

and nuclease-free water up to 20 μl.
6. Mix gently by inverting the tube and spin briefly.
7. Incubate on ice for 5 min.
8. Set the thermocycler and perform reverse transcription as
follows: 16 °C for 30 min; 42 °C for 30 min; 85 °C for 5 min.
Cool down at 4 °C.
9. Add 180 μl of water to dilute the RT product.

3.2 Real-Time PCR 1. Thaw all components on ice. Protect fluorescent probes from
(See Notes 7 and 8) light.
2. Combine following in a PCR tube: 10 μl of 2× TaqMan
Universal PCR Master Mix, No AmpErase UNG and 7.67 μl
nuclease-free water (see Note 9).
3. Mix gently by pipetting up and down. Spin down briefly.
4. Add 1.0 μl of 20× TaqMan MicroRNA Assay mix.
5. Add 1.33 μl of the diluted RT product.
6. Mix gently.
7. Seal the tube or the PCR plate and spin down quickly.
8. Keep on ice until PCR reaction is performed.
9. Set the real-time PCR thermocycler. We use an Applied
Biosystems Step One Plus™ with following program parame-
ters: initial enzyme activation at 95 °C, for 10 min; 40 cycles:
denaturation at 95 °C for 10 s; hybridization/elongation at
60 °C for 60 s. Use default values for temperature auto incre-
ment, ramp rate and data collection.
10. Load the reaction tubes or plate into the thermocycler and
start the run (see Notes 10 and 11).

4 Notes

1. Prior to RT, the RNA should be extracted using one of the

commercially available kits compatible with small RNA extrac-
tion and PCR methods. Some RNA extraction kits contain col-
umns with exclusion size that are not compatible with small
RNA (<200 nucleotides) extraction. RNA concentration needs
to be adjusted with nuclease-free water or PCR-compatible
buffer to 1–3 ng/μl. RNA samples have to be free of any inhib-
itors of subsequent reverse transcription and PCR reactions,
free of RNase activity and non-denatured. RNA concentration
and purity may be estimated by classical spectrophotometer
measurements using absorbance ratios 260/280 and 260/230.
Moreover, analysis of small RNA fragments present in the
 Stem-Loop qRT-PCR 107

RNA extract may be performed on an Agilent 2100 bioanalyzer

with the Small RNA Assay kit according to the manufacturers’
instructions.
2. Stem-loop RT is not affected by genomic DNA contamination.
Therefore, DNAse treatment of total RNA samples is not nec-
essary. Nevertheless, if you want to use your RNA for another
application such as qRT-PCR quantification of small non-coding
RNA, precursors, or mRNAs, it might be useful to proceed to
an efficient elimination of DNA from your total RNA prepara-
tion prior to RT.
3. Prepare a master mix for all reaction plus 10 % to account for
pipetting loss.
4. Many RT protocols start with an initial heat denaturation step.
This step must be avoided for RT using stem-loop primers to
preserve primer structure.
5. Minimum dilution should be of 1/15. The appropriate dilu-
tion factor has to be optimized for each RNA source.
6. Up to 48 individual 5× RT primer can be pooled to perform all
RT reaction at the same time on a single sample.
7. PCR assays require special laboratory practices to avoid false
positive amplifications [1]. The high throughput and repeti-
tion of these assays can lead to amplification of a single DNA
molecule [2]. Follow the general PCR practices to prevent
contamination such as maintaining separate areas for sample
preparation, PCR setup and amplification and do not bring
amplified PCR products into the PCR setup area. Wear a clean
lab coat and gloves when preparing samples for PCR amplifica-
tion. Open and close all sample tubes and reaction plates care-
fully. Try not to splash or spray PCR samples. Use filter tips on
the pipettes. Clean lab benches and equipment periodically
with appropriate solution, such as RNAse Away solution
(Biopolis Supply Centre).
8. For any quantification by real-time PCR, it is recommended to
perform at least three PCR replicates per RT reaction.
9. Prepare a master mix by scaling the volumes to the desired
number of RT reactions plus 10 % to account for pipetting
loss. Then dispense 17.67 μl of the PCR master mix into PCR
tubes or plate wells.
10. It is recommended to run the real-time PCR reaction in tripli-
cate or quadruplicate and use the averages, discarding any out-
lier (>2 standard deviations), to perform subsequent analyses.
Both comparative CT and absolute (standard curve) can be
used to quantify real-time PCR data. One of the most com-
monly used methods is the 2−ΔΔCT method described by Livak
and Schmittgen [3]. Therefore, an appropriate constitutively
108 Véronique Salone and Mathieu Rederstorff

expressed endogenous control must be selected to normalize

the expression levels of target genes by correcting the differ-
ences in the amount of cDNA loaded into each PCR reaction.
The choice of an appropriate endogenous control must be
validated for each individual sample (see Note 11).
11. RT-qPCR data analysis requires to select an appropriate, con-
stitutively expressed, endogenous control. Common internal
controls consist in protein-coding reference genes, also termed
“housekeeping” genes. Nevertheless, application of “house-
keeping” genes as a reference in small non-coding RNA RT-
PCR quantification is questionable. A better strategy may be
to choose as a reference a constitutively expressed small non-
coding RNA [4, 5]. Different free software may be used to
select the most suitable small non-coding RNA internal con-
trol (e.g., geNORM, NormFinder, BestKeeper [6–8]).

Acknowledgment

This work was supported by the Centre National pour la Recherche

Scientifique, the Université de Lorraine, the Région Lorraine
and the Ligue nationale pour la recherche contre le cancer (comités
54 et 57).

References
1. Kwok S, Higuchi R (1989) Avoiding false posi- Vandesompele J (2009) A novel and universal
tives with PCR. Nature 339(6221):237–238. method for microRNA RT-qPCR data normal-
doi:10.1038/339237a0 ization. Genome Biol 10(6):R64. doi:10.1186/
2. Mullis KB, Faloona FA (1987) Specific synthesis gb-2009-10-6-r64, gb-2009-10-6-r64 [pii]
of DNA in vitro via a polymerase-catalyzed chain 6. Pfaffl MW, Tichopad A, Prgomet C, Neuvians
reaction. Methods Enzymol 155:335–350. TP (2004) Determination of stable housekeep-
doi:10.1016/0076-6879(87)55023-6 [pii] ing genes, differentially regulated target genes
3. Livak KJ, Schmittgen TD (2001) Analysis of rela- and sample integrity: BestKeeper–Excel-based
tive gene expression data using real-time quantita- tool using pair-wise correlations. Biotechnol
tive PCR and the 2(-Delta Delta C(T)) Method. Lett 26(6):509–515
Methods 25(4):402–408. doi:10.1006/ 7. Wei CH, Kao HY (2011) Cross-species gene
meth.2001.1262, S1046-2023(01)91262-9 [pii] normalization by species inference. BMC
4. Galiveti CR, Rozhdestvensky TS, Brosius J, Bioinform 12(Suppl 8):S5. doi:10.1186/1471-
Lehrach H, Konthur Z (2010) Application of 2105-12-S8-S5, 1471-2105-12-S8-S5 [pii]
housekeeping npcRNAs for quantitative expres- 8. Andersen CL, Jensen JL, Ørntoft T (2004)
sion analysis of human transcriptome by real- Normalization of real-time quantitative RT-PCR
time PCR. RNA 16(2):450–461. doi:10.1261/ data: a model based variance estimation approach
rna.1755810, rna.1755810 [pii] to identify genes suited for normalization - applied
5. Mestdagh P, Van Vlierberghe P, De Weer A, to bladder- and colon-cancer data-sets. Cancer
Muth D, Westermann F, Speleman F, Res 64:5245–5250
 Chapter 11

miR-RACE: An Effective Approach to Accurately Determine

the Sequence of Computationally Identified miRNAs
Chen Wang and Jinggui Fang

Abstract
Computational prediction of microRNAs (miRNAs) is one of the most important approaches in microRNA
studies. While validation of the predicted microRNAs’ precise sequences is essential for further studies on
their biogenesis, evolution, and functions, computational miRNA prediction methods, however, often fail
to predict the accurate sequence of the mature miRNA within the precursor at the nucleotide precision
level. Here, we depict a highly efficient method for determining the precise sequences of computationally
predicted miRNAs. The method combines the generation of miRNA-enriched libraries, with 5′- and 3′-end
adaptors being linked to the miRNA molecules, the reverse transcription of small RNAs with an oligo-d(T)
anchor primer, two specific 5′- and 3′-miRNA-RACE (miR-RACE) PCR reactions and sequence-directed
cloning. The efficiency of this method was demonstrated by the precise sequence validation of computation-
ally predicted miRNAs in citrus, apple, and other fruit crops. Our ongoing research indicates that miR-
RACE is also very useful to verify the sequences of putative miRNAs obtained by deep sequencing of small
RNA libraries. The protocol of miR-RACE is rapid and can be completed within 2–3 days. miR-RACE
should make the bioinformatic prediction of miRNAs more powerful and accurate.

Key words Small RNA library, miRNA, Sequence, miR-RACE, PCR

1 Introduction

MicroRNAs (miRNAs) are a newly identified class of tiny endog-

enous non-protein-coding RNA molecules that play very impor-
tant roles in posttranscriptional gene regulation through
degradation of target mRNAs or by translational repression of tar-
geted genes in various organisms [1–5]. In plants, microRNAs are
produced from partially complementary dsRNA precursor mole-
cules [6, 7]. These plant miRNAs are the best-characterized small
RNAs, and the pathways by which they are generated and their
roles in gene regulation have been well documented [6, 8, 9].
Several hundreds of miRNA genes have been experimentally
identified in plants by the traditional Sanger sequencing method,
and increasingly more are predicted by numerous computational

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_11, © Springer Science+Business Media New York 2015

109
110 Chen Wang and Jinggui Fang

methods. These methods mainly use secondary structure information

to search for miRNAs in expressed sequence tags (ESTs) and to
mine the repository of available genomic sequences [10–15].
These methods have many advantages, including the quick predic-
tion of a large number of miRNAs, low costs or the prediction of
novel, low-abundance miRNAs that are usually difficult to clone
directly. However, miRNA prediction algorithms often cannot
determine the accurate location of the mature miRNA within a
precursor at the nucleotide precision level [16]. Even though false-
positive predictions have been minimized using various scores and
rank cutoffs, the precise sequences usually cannot be determined,
and several miRNA orthologs or paralogues candidates might be
predicted for a specific miRNA. Determination of mature miRNAs
precise sequences, including their ends, is essential for downstream
research applications in various organisms, such as miRNA target
prediction and further studies on miRNA evolution, regulatory
roles, or biogenesis.
In general, a combination of computational predictions and
experimental verifications was used to identify miRNAs.
Experimental validation was mainly based on determination of the
expression pattern of the miRNAs by the robust techniques of
northern-blotting and/or RT-PCR [17–20]. Notably, these two
techniques can only confirm the existence and size, but not the full
precise sequence, of a computationally predicted miRNA. With the
increasing number of new potential miRNAs predicted by bioinfor-
matics approaches and deposited in the miRBase Sequence Database
(http://microrna.sanger.ac.uk/sequences/), the precise sequences
of the homologs and/or orthologs of the miRNAs cloned from
model organisms need to be determined before initiating any fur-
ther studies on their functions and biogenesis.
To our knowledge, no reports have employed a comprehensive
strategy to determine the precise sequences of computationally
predicted miRNAs. We developed an integrative approach com-
bining miRNA-enriched libraries preparation, 5′- and 3′-RACE
reactions and sequence directed cloning. The miR-RACE proce-
dure comprises following main steps: (1) miRNA-enriched library
preparation; (2) 5′ miR-RACE and 3′ miR-RACE for accurate
amplification of the 5′ and 3′ ends of a miRNA; (3) PCR product
cloning and sequencing; (4) Cloning and sequencing of the
RT-PCR products. A schematic flowchart of this strategy for pre-
cise miRNA sequence determination is shown in Fig. 1. The inno-
vative core steps in our method are the two PCR reactions
amplifying the 5′ and 3′ ends of the miRNA, in which two specific
primers cover both parts of the candidate miRNA and adaptor.
These two PCR reactions are denoted as 5′- and 3′-miR-RACE,
based on their similarity to the rapid amplification of cDNA ends
(RACE) technique. miR-RACE made it even possible to determine
the sequences of low-abundance miRNAs that are generally
difficult to clone directly.
 Sequencing miRNAs 111

a RNA isolation and miRNA fractionation

miRNAs 5’ 3’
Poly(A) polymerase polyadenylation
Poly (A)-tailed miRNAs 5’ AAAA(A)n 3’
5’RNA adaptor 5’ 3’ T4 RNA ligase

5’ AAAA(A)n 3’
TTTT(T)n 5’
Reverse transcription dT(30) RT primer
First strand cDNA 3’ TTTT(T)n 5’

First strand cDNA 3’ TTTT(T)n 5’

b 5’RACE
3’RACE
mirRacer 3’Primer mirRacer 5’Primer

3’ TTTT(T)n 5’ 3’ TTTT(T)n 5’
5’ AAAA(A)n 3’ 5’ AAAA(A)n 3’
TTTT(T)10
Forward GSP2
Perform PCR with MirRacer Perform PCR with MirRacer Reverse GSP1
3’ primer and GSP2 5’ primer and GSP1

3’ TTTT(T)n 5’ 3’ TTTT(T)30 5’
5’ AAAA(A)n 3’ 5’ AAAA(A)30 3’

Cloning and sequencing of mir-RACE PCR products

3’ mir-RACE PCR product sequence 5’ mir-RACE PCR product sequence

Precise miRNA spliced

Alignment with precursor sequence for confirmation

Fig. 1 Flowchart of the miR-RACE method

2 Materials

Diethylpyrocarbonate (DEPC)-treated RNase-free water should be

used to prepare all solutions as well as to dissolve RNA pellets after
ethanol precipitation. To prepare DEPC-treated RNase-free water,
mix double-distilled water with 0.01 % (v/v) DEPC in RNase-free
bottles. Let stand overnight and autoclave. RNase-free water can be
stored at room temperature (20 °C) for several months.
Additionally all reagent bottles, tubes and tips should be
RNAse-free.

2.1 Small RNA 1. SDS lysis buffer: 50 mM Tris–HCl, pH 8 (see Note 1), 140 mM
Preparation NaCl, 10 mM EDTA, 4 % SDS (Sodium Dodecyl Sulfate), 3 %
PVP (polyvinylpyrrolidone K30), 3 % ß-mercaptoethanol (add
just before use) (see Note 2). Store at 4 °C.
2. 3 M NaAC, pH 5.2 (see Note 3).
112 Chen Wang and Jinggui Fang

3. Ethanol, Chloroform, Phenol–Chloroform (1:1), Isopropanol,

DEPC water.
4. DNA Eraser (TaKaRa, Clontech), including DNA eraser buf-
fer: 40 mM Tris–HCl, pH 7.5, 80 mM MgCl2, 50 mM DTT.
5. RNase Inhibitor (see Note 4).
6. 10 M LiCl (see Note 5).

2.2 Construction 1. Poly (A) polymerase (Ambion).

of the cDNA Library 2. 25 mM MnCl2, 1 mM ATP.
of Small RNA
3. T4 RNA ligase.
2.2.1 Polyadenylation 4. 5′ adaptor primer sequence:
and 5′-Adaptor Ligation
5′-CGACUGGAGCACAGGACACUGACAUGGACU
GAAGGAGUAGAAA-3′

2.2.2 Reverse 1. Oligo(dT)30 primer:

Transcription 5′-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30-3′
2. Superscript™ III Reverse Transcriptase (Invitrogen™, Life
Technologies).
3. 10 mM dNTPs.

2.3 miR-RACE 1. mirRacer 5′ primer:

5′-GGACACTGACATGGACTGAAGGAGTA-3′
2. mGSP1 (miRNA-gene-specific reverse primers)
3. mirRacer 3′ primer:
5′-ATTCTAGAGGCCGAGGCGGCCGAC ATG-3′
4. mGSP1 (miRNA-gene-specific forward primers).
5. Hercules Hot-Start polymerase buffer (Stratagene).
6. 2.5 mM dNTPs.
7. Ex Taq™ Hot Start Version (Takara, Clontech) (see Note 6).
8. TOPO TA cloning Kit (Invitrogen).
9. pMD™ 19-T Vector Cloning Kit (TaKaRa, Clontech).
10. E. coli DH5α competent cells.
11. TE buffer: 10 mM Tris–HCl, pH 7.5, 1 mM EDTA, pH 8.0.
12. Agarose Gel DNA Extraction Kit (Roche).
13. 50-bp DNA ladder (Invitrogen).

3 Methods

Carry out all procedures at room temperature unless otherwise

specified.
 Sequencing miRNAs 113

3.1 Small RNA 1. Preheat 1.2 ml extraction buffer at 65 °C in a 2 ml tube.

Preparation 2. In a liquid-nitrogen-filled mortar, grind about 100 mg tissue
sample into a fine powder (see Note 7), and quickly add the
ground tissue to the tube. Mix completely by inverting the
tube.
3. Shake the mixture for 30 s then incubate at 65 °C for
30–45 min, inverting the tube 3–4 times during incubation.
4. Add 800 μl of chloroform. Shake the mixture for 30 s and then
place at 4 °C for 5 min.
5. Centrifuge the mixture at 12,000 × g for 20 min at 4 °C.
6. Transfer the supernatant (1,000 μl) to a new tube (see Note 8).
7. Add 1,000 μl of phenol–chloroform (1:1), shake for 30 s, and
centrifuge to separate phases.
8. Transfer the supernatant (800 μl) to a new tube and add an
equal volume of chloroform. Shake the mixture for 30 s and
centrifuge at 12,000 × g for 15 min at 4 °C.
9. Transfer the final supernatant (600 μl) to a new 1.5 ml tube.
Add 1/20 volume of 3 M NaAC, pH 5.2 and 1/10 volume of
ethanol 100 % to the supernatant and mix. Store at −20 °C for
30–60 min.
10. Centrifuge the samples at 12,000 × g for 20 min at 4 °C. Transfer
the supernatant to a new 1.5 ml tube. Add an equal volume of
isopropanol to the supernatant and mix. Precipitate at −20 °C
for at least 4 h.
11. Centrifuge the samples at 12,000 × g for 20 min at 4 °C to
pellet RNA.
12. Wash pellets with 75 and 100 % ethanol (see Note 9).
13. Air-dry and dissolve RNA in 30 μl DEPC-treated water
(see Note 10).
14. Add DEPC-treated water to the total RNA to a total volume
of 300 μl and add 200 μl of 10 M LiCl (see Note 11). Mix
well.
15. Precipitate at 4 °C overnight or at −20 °C for at least 60 min
(see Note 12).
16. Centrifuge the samples at 12,000 × g for 20 min at 4 °C. Transfer
the upper phase in a new 1.5 ml RNAse-free tube. Add 1/10
volume of 3 M NaAC, pH 5.2 and 2.5 volumes of ethanol
100 %. Precipitate at −20 °C for at least 4 h (see Note 13).
17. Centrifuge the samples at 12,000 × g for 20 min at 4 °C to pel-
let the small RNA.
18. Wash the pellets with 75 and 100 % ethanol, air-dry and then
dissolve RNA in 20 μl DEPC-treated water.
114 Chen Wang and Jinggui Fang

3.2 Construction 1. Combine the following reagents in a RNase-free microtube:

of the cDNA Library 3 μl RNA, 10 μl of 5× Ligation Buffer, 5 μl MgCl2 (25 mM),
of Small RNA 0.5 μl ATP (1 mM), 2 μl PAP (2 U/μl), DEPC-treated water
up to 50 μl.
3.2.1 Polyadenylation
and 5′-Adaptor Ligation 2. Mix and incubate at 37 °C for 1 h.
3. Add 450 μl DEPC-treated water and 500 μl phenol–chloroform
to the reaction mixture. Mix and centrifuge at 13,000 × g for
20 min at 4 °C.
4. Transfer the supernatant to a new 1.5 ml RNase-free tube.
5. Precipitate Poly (A)-tailed small RNA by adding 1/10 volume
of 3 M NaAC, pH 5.2 and 2.5 volumes of ethanol 100 % and
store at −20 °C for at least 4 h (see Note 13).
6. Spin precipitated Poly (A)-tailed small RNA at 13,000 × g for
20 min.
7. Carefully remove the supernatant and add 1 ml of 80 % ethanol
to wash the pellet. Spin at 12,000 × g at 4 °C for 10 min.
8. Carefully remove all the liquid, avoiding touching the pellet.
Air-dry the pellet at room temperature.
9. Dissolve the dry pellet in 10 μl DEPC-water.
10. For ligation of 5′ adaptor to Poly (A)-tailed small RNA, com-
bine the following reagents in a RNase-free microtube tube:
3 μl Poly (A)-tailed small RNA, 100 μM 5′ adaptor, 1 μl 10×
Ligation Buffer, 1 μl ATP (4 mM), 1 μl T4 RNA Ligase (20 U/
μl), RNase-free water up to 40 μl.
11. Mix and incubate the reaction mixture at 37 °C for 1 h.
12. Add 450 μl of RNase-free water and 500 μl of phenol–chloroform
to the reaction mixture. Mix and spin at 13,000 × g at 4 °C for
15 min.
13. Collect the aqueous phase in a new 1.5 ml RNase-free tube
and add 1/10 volume of 3 M NaAC, pH 5.2 and 2.5 volumes
of ethanol 100 %.
14. Precipitate RNA for at least 4 h at −20 °C (see Note 13).
15. Spin RNA at 13,000 × g for 20 min.
16. Carefully remove the supernatant and add 1 ml of 80 % ethanol
to wash the pellet.
17. Spin at 12,000 × g at 4 °C for 10 min.
18. Carefully remove all the liquid, avoiding touching the pellet.
Air-dry the pellet at room temperature.
19. Dissolve the dried pellet in 10 μl DEPC-water.

3.2.2 Reverse 1. Combine the following reagents in a 0.2 ml RNase-free tube:

Transcription 3 μl 5′-adaptor-ligated polyadenylated RNA, 1 μl Oligo(dT)30
primer (50 μM), 1 μl dNTP (10 mM), 1 μl of RNase H, 5 μl
of RNase-free water.
 Sequencing miRNAs 115

2. Mix and incubate at 65 °C for 5 min, then place samples in

melting ice for 2 min.
3. Add the following components in this order: 3 μl of 10× RT buf-
fer, 4 μl MgCl2 (25 mM), 1 μl DTT (0.1 M), 1 μl RNaseOUT™
(40 U/μl), 1 μl SuperScript™ III RT (200 U/μl).
4. Mix gently and spin down briefly (see Note 14).
5. Incubate the mixture for 1 h at 42 °C and next for 10 min at
50 °C.
6. Inactivate the reverse transcriptase by incubating the mixture
for 15 min at 70 °C, then immediately chill on ice (see Note 15).
Store at −80 °C.

3.3 miR-RACE Perform 5′ miR-RACE reactions with the mirRacer 5′ primer and
miRNA-gene-specific forward primers (mGSP1), and carry out 3′
miR-RACE reactions with the mirRacer 3′ primer and miRNA-
gene-specific reverse primers (mGSP2) (see Note 16).

3.3.1 First Round 1. In a sterile microtube, mix the following reagents for each
Amplification experimental and control sample: 3 μl Hercules Hot-Start
polymerase buffer, 4 μl dNTP mix (2.5 mM), 2.5 U Ex Taq™
Hot-Start DNA polymerase Version 4, 2 μl of template cDNA,
25 pmol of mirRacer 3′ primer or mirRacer 5′ primer. Set up a
control experiment without template.
2. Mix and heat in a DNA thermocycler for 5 min at 98 °C to
denaturate the first strand product and to activate the
polymerase.
3. Perform PCR using following reaction parameters: initial
denaturation step at 94 °C for 3 min; 25 cycles: Denaturation
at 94 °C for 10 s, Annealing at 65 °C for 10 s, Elongation at
72 °C for 1 min; Final extension at 72 °C for 10 min. Store
PCR products at 4 °C.

3.3.2 Second Round 1. Dilute an aliquot of the first round amplification to the 1:20 in
Amplification TE buffer.
2. In a sterile, 0.2 ml microtube, mix the following reagents on
ice: 3 μl Hercules Hot-Start polymerase buffer, 4 μl dNTP mix
(2.5 mM), 2.5 U Ex Taq™ Hot Start DNA polymerase Version
4, 2 μl of the diluted first round amplification product and
25 pmol of each primers mGSP2 and mGSP1. Set up a control
experiment without template.
3. Mix and heat in a DNA thermocycler for 5 min at 98 °C to
denaturate the first-strand product and to activate the
polymerase.
4. Perform PCR using following reaction parameters: initial
denaturation step at 94 °C for 3 min; 25 cycles: Denaturation
at 94 °C for 10 s, Annealing at 65 °C for 10 s, Elongation at
116 Chen Wang and Jinggui Fang

Fig. 2 The products of 3′-miR-RACE (a) and 5′-miR-RACE (b) for eight miRNAs

72 °C for 1 min; Final extension at 72 °C for 10 min. Store PCR

products at 4 °C.
5. After amplification, separate the 3′- and 5′-PCR products on a
3.0 % agarose gel and stain with ethidium bromide (EtBr)
(Fig. 2).
6. Cut out the slices containing DNA with a size of about 56 bp
(5′ end product) and 87 bp (3′ end product) and purify the
DNA using an agarose gel DNA purification kit, according to
the manufacturer’s instructions.

3.3.3 miR-RACE Directly clone the DNA fragment purified with the TOPO TA
Products Cloning cloning Kit (Invitrogen).
and Sequencing
1. Add 4.5 μl of purified DNA, 0.5 μl pMD™ 19-T Vector, 5.0 μl
Solution I into a 0.2 ml sterile microtube. Mix and quickly spin
down.
2. Incubate at 16 °C for 1 h.
3. Transform E. coli DH5α competent cells with the ligation
product and plate on solid LB medium containing ampicillin.
Incubate overnight at 37 °C.
4. Pick positive clones and perform colony-PCR using the PCR-
specific primer pairs and PCR program as in Subheading 3.3.2.
5. Sequence positive clones PCR-products (see Note 17).
 Sequencing miRNAs 117

4 Notes

1. DEPC is unstable in Tris buffer. Tris buffer should therefore

be prepared with DEPC-treated water rather than directly
treated with DEPC.
2. Add ß-mercaptoethanol just before use.
3. High Concentration acetic acid (10 M) can be used at first to
narrow the gap from the starting to the required pH. Next,
use dilutions (e.g., 5 and 1 M) with lower ionic strengths to
avoid a sudden drop in pH below the required one.
4. Employing RNAse inhibitors throughout the procedure sig-
nificantly reduces RNA degradation, especially during long
incubation periods.
5. Dissolution of lithium chloride in water is highly exothermic
and should therefore be performed on ice.
6. Use a high-fidelity enzyme to avoid too many errors.
7. Tissue samples need to be ground as finely as possible to
increase extraction yield.
8. Throughout the protocol, during phenol–chloroform extrac-
tion phases, gently pipette the supernatant to avoid cross-
contaminations of phases.
9. Pellets should be extremely gently washed to avoid washing
out of RNAs.
10. Too dry pellets are more difficult to be dissolved.
11. Too long precipitation time will lead small RNAs to precipitate
as well.
12. The aim of this step is to retrieve small miRNAs from the
supernatant by precipitating long RNAs only, using 4 M
LiCl.
13. Increasing precipitation time will ensure a better yield of RNA
precipitation.
14. Always collect all drops in the bottom of the tube and avoid
solutions sticking on the tube walls.
15. Rapidly terminate the first strand synthesis reaction to avoid
nonspecific background.
16. mGSP1 and mGSP2 sequences contain ten nucleotides of
Poly(T) or ten nucleotides of the adaptor sequence, respec-
tively, as well as 17 nucleotides complementary to the
miRNA.
17. The 5′ end and 3′ end PCR-products of positive clones are
about 56 bp and 87 bp in length, respectively.
118 Chen Wang and Jinggui Fang

Acknowledgements

This work was supported by the Natural Science Foundation of

China (NSFC) (No. 31301759), the Priority Academic Program
Development of Jiangsu Higher Education Institutions (PAPD),
the National Science Foundation of China (No. 60901053), and
the Nanjing Agricultural University Youth Science and Technology
Innovation Fund (KJ2013013).

References
1. Bartel B, Bartel DP (2003) MicroRNAs: at the Vitulo N, Jubin C et al (2007) The grapevine
root of plant development? Plant Physiol genome sequence suggests ancestral hexa-
13:709–717 ploidization in major angiosperm phyla. Nature
2. Bartel DP (2004) MicroRNAs: genomics, 449:463–467
biogenesis, mechanism, and function. Cell 13. Griffiths-Jones S, Saini HK, van Dongen S,
116:281–297 Enright AJ (2008) miRBase: tools for microRNA
3. Mallory AC, Vaucheret H (2004) MicroRNAs: genomics. Nucleic Acids Res 36:D154–D158
something important between the genes. Curr 14. Meyers BC, Axtell MJ, Bartel B, Bartel DP,
Opin Plant Biol 7:120–125 Baulcombe D et al (2008) Criteria for annota-
4. Carrington JC, Ambros V (2003) Role of tion of plant microRNAs. Plant Cell 20:
microRNAs in plant and animal development. 3186–3190
Science 301:336–338 15. Sunkar R, Jagadeeswaran G (2008) In silico
5. Hunter C, Poethig RS (2003) Missing links: identification of conserved microRNAs in large
miRNAs and plant development. Curr Opin number of diverse plant species. BMC Plant
Genet Dev 13:372–378 Biol 8:37
6. Jones-Rhoades MW, Bartel DP, Bartel B 16. Wang C, Shangguan LF, Nicholas KK, Wang
(2006) MicroRNAs and their regulatory roles XC, Han J, Song CN, Fang JG (2011)
in plants. Annu Rev Plant Biol 57:19–53 Characterization of microRNAs identified in a
7. Mallory AC, Bouche N (2008) MicroRNA- table grapevine cultivar with validation of com-
directed regulation to cleave or not to cleave. putationally predicted grapevine miRNAs by
Trends Plant Sci 13:359–367 miRRACE. PLoS One 6:e21259
8. Carthew RW, Sontheimer EJ (2009) Origins 17. Carra A, Mica E, Gambino G, Pindo M, Moser
and mechanisms of miRNAs and siRNAs. Cell C, Pè ME, Schubert A (2009) Cloning and
136:642–655 characterization of small non-coding RNAs
9. Brodersen P, Sakvarelidze-Achard L, Bruun- from grapevine. Plant J 59:750–763
Rasmussen M, Dunoyer P, Yamamoto YY, 18. Jung JH, Park CM (2007) MIR166/165
Sieburth L, Voinnet O (2008) Widespread genes exhibit dynamic expression patterns in
translational inhibition by plant miRNAs and regulating shoot apical meristem and floral
siRNAs. Science 320:1185–1190 development in Arabidopsis. Planta 225:
10. Zhang BH, Pan XP, Cannon CH, Cobb GP, 1327–1338
Anderson TA (2006) Conservation and diver- 19. Yamaguchi A, Wu MR, Yang L, Wu G, Poethig
gence of plant microRNA genes. Plant J 46: RS et al (2009) The microRNA-regulated
243–259 SBP-Box transcription factor SPL3 is a direct
11. Zhang BH, Pan XP, Wang QL, Cobb GP, upstream activator of LEAFY, FRUITFULL,
Anderson TA (2006) Computational identifi- and APETALA1. Cell 17:268–278
cation of microRNAs and their targets. Comput 20. Yin Z, Li CH, Han XL, Shen FF (2008)
Biol Chem 30:395–407 Identification of conserved microRNAs and
12. Jaillon O, Aury JM, Noel B, Policriti A, Clepet their target genes in tomato (Lycopersicon
C, Casagrande A, Choisne N, Aubourg S, esculentum). Gene 414:60–66
 Chapter 12

Probing Small Non-Coding RNAs Structures

Jean-Vincent Philippe, Lilia Ayadi, Christiane Branlant,
and Isabelle Behm-Ansmant

Abstract
The diverse roles of RNAs depend on their ability to fold so as to form biologically functional structures.
Thus, understanding the function of a given RNA molecule often requires experimental analysis of its
secondary structure by in vitro RNA probing, which is more accurate than using prediction programs only.
This chapter presents in vitro RNA probing protocols that we routinely use, from RNA transcript production
and purification to RNA structure determination using enzymatic (RNases T1, T2, and V1) and chemical
(DMS, CMCT, kethoxal, and Pb2+) probing performed on both unlabeled and end-labeled RNAs.

Key words RNA, Secondary structure, Enzymatic probing, Chemical probing, SHAPE, RNase
digestion, Primer extension, In vitro transcription, RNA labeling, Gel electrophoresis, Structure
prediction

1 Introduction

Small-non coding RNAs are multifunctional molecules able to

adopt highly specific conformations responsible for their ability to
carry out highly specialized functions in different cellular processes
[1–4]. Deciphering the function of a novel RNA usually implies to
first look for known structural motifs in its sequence using folding
program such as Mfold, RNAfold, or RNAstructure [5]. The pre-
dicted structures must then be experimentally validated, which will
open new working hypotheses. RNA structure probing is a straight-
forward approach for this validation step.
For in vitro structural probing, the RNA of interest is tran-
scribed in vitro and folded in solution before being subjected to
different enzymes or chemicals, which are listed in Table 1 [6, 7].
These can be divided in four categories according to the structural
information they provide: (1) base-specific reagents such as DMS,
CMCT, kethoxal, or RNases give information on the single-
stranded versus double-stranded status of each nucleotide, (2)
backbone-specific reagents such as hydroxyl radicals or lead acetate

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_12, © Springer Science+Business Media New York 2015

119
Table 1
Commonly used RNA structure probing reagents and their specificities

Structural
Modification reagent Specificity information
DMS (dimethyl sulfate) Methylation at the N7-G, N1-A, and N3-C Pairing status
positions
CMCT (1-cyclohexyl-(2- Alkylation at the N3-U and possibly N1-G Pairing status
morpholinoethyl) carbodiimide positions
metho-p-toluene sulphonate)
Kethoxal Modification at the N1-G and N2-G positions Pairing status
DEPC (diethylpyrocarbonate) Carbethoxylation at the N7-A position Pairing status
ENU (ethylnitrosourea) Alkylation of phosphates Pairing status
Mung bean nuclease Cleavage at any single-stranded residue Pairing status
RNase A Cleavage at single-stranded C and U Pairing status
RNase CL3 Cleavage at single-stranded C Pairing status
RNase I Cleavage at any single-stranded residue Pairing status
RNase Phy M Cleavage at single-stranded A and U Pairing status
RNase T1 Cleavage of the phosphodiester bond 3′ to Pairing status
single-stranded G
RNase T2 Cleavage of the phosphodiester bond 5′ to Pairing status
any single-stranded residue
RNase U2 Cleavage of the phosphodiester bonds of Pairing status
single-stranded A
RNase V1 Cleavage of the phosphodiester bonds in Pairing status
double-strands or stacked regions
S1 nuclease Cleavage at any single-stranded residue Pairing status
Hydroxyl radicals Backbone cleavage at RNA positions Solvent accessibility
accessible to solvent
Lead acetate (Pb2+) Cleavage of phosphodiester bonds of Solvent accessibility
single-stranded residues
NMIA (N-methylisatoic Modification of 2′ OH of single-stranded Local nucleotide
anhydride) nucleotides flexibility
1 M7 (1-methyl-7-nitroisatoic Modification of 2′ OH of single-stranded Local nucleotide
anhydride) nucleotides flexibility
UV (254 nm) Cross-linking Spatial proximity
6sG (6-thioguanosine) Short range (3 Å) photo-cross-linking of Spatial proximity
molecules
4sU (4-thiouridine) Short range (3 Å) photo-cross-linking of Spatial proximity
molecules
APA (azidophenacyl) Long range (9–10 Å) photo-cross-linking of Spatial proximity
molecules
The name of the reagent is indicated in the first column, whereas the second column indicates the specificity of the
reagent and the third one the structural information given by the use of the reagent
 Structural Probing of Small Non-Coding RNAs 121

(Pb2+) that provide information on accessibility to solvent, (3)

backbone-specific reagents such as NMIA or 1M7 used for SHAPE
(selective 2′-hydroxyl acylation analyzed by primer extension) that
provide information on local nucleotide dynamics, and (iv) cross-
linking and bifunctional reagents such as UV, 6-thioguanosine
(6sG), 4-thiouridine (4sU), or azidophenacyl (APA) that provide
through space information (Table 1) [7]. Base-specific chemical
reagents and enzymes provide complementary data and are there-
fore frequently combinedly used to provide structural information.
Nevertheless, chemicals are generally more frequently used because
they are much smaller in size than enzymes, and thus encounter
less steric hindrance and are able to react on a larger number of
bases in a folded RNA.
Location of chemical modifications and nuclease cleavages
on the probed RNA can be determined using either 3′- or 5′ end-
labeled RNA or by primer extension of unlabeled RNA. End-
labeled RNAs are preferentially used for structural probing of RNA
species which size does not exceed 150 nt. Enzymes and chemical
reagents inducing cleavages can be used to probe such end-labeled
RNAs since cleavages can next be directly mapped by gel electro-
phoresis without any reverse transcription step. On the other hand,
primer extension of unlabeled RNAs is used for structural probing
of RNA species of larger sizes than 150 nt. Both RNA modifica-
tions and cleavages lead to the reverse transcriptase to stop during
primer extension and can be used to determine the structure of
unlabeled RNAs. The RNA length that can be examined using one
defined primer ranges between 100 and 200 nt, and thus, different
primers have to be used to cover the entire molecule if longer. The
location of both cleavages and modifications is determined by anal-
ysis of the migration pattern of the obtained cDNA fragments.
Furthermore, the intensity of the bands can be quantified using
image-processing tools, such as the semi-automated footprinting
analysis (SAFA) program [8, 9].
In the recent years, gel electrophoresis has been in part substi-
tuted by capillary electrophoresis, enabling one nucleotide resolu-
tion of sequences of up to 1,000 nt, and by high-throughput
sequencing technologies [10–13]. In the case of capillary electro-
phoresis, dedicated software packages such as CAFA (Capillary
Automated Footprinting Analysis) [10] and ShapeFinder [14]
have been developed to facilitate probing data analysis. Once the
probing data are collected, the most significant ones can be used as
constraints in the Mfold program [15] to determine the RNA
structure. The predicted models with the lowest free energy and
the least discrepancies with overall probing data are selected.
Complementary in vitro probing experiments on isolated RNA
domains or RNA variants are next performed in order to deter-
mine the most adapted model among the proposed models.
Biological relevance of the in vitro probing data may also be tested
122 Jean-Vincent Philippe et al.

in vivo using some of the chemical reagents mentioned above, such

as dimethylsulfate (DMS), hydroxyl radicals, or SHAPE reagents
[16, 13, 17–19]. Note that some of the widely used probes for
RNA secondary structure investigations such as CMCT cannot be
used in assays performed on cellular extracts because they react or
are trapped by components of the extract other than RNA. As only
a limited number of probing enzymes/chemicals can be used
in vivo, we recommend to perform a thorough analysis of the RNA
structure in vitro, and then using DMS in vivo, to verify that data
are in good agreement.
This chapter presents in vitro RNA probing protocols that we
routinely use, from RNA transcript production and purification to
RNA structure modeling through enzymatic probing using RNases
T1, T2, and V1 and chemical probing using DMS, CMCT, keth-
oxal, and Pb2+ on both unlabeled and end-labeled RNAs.

2 Materials

2.1 RNA Transcripts 1. 5× T7 RNA polymerase buffer: 0.4 M HEPES–KOH, pH 7.5,

Preparation 120 mM MgCl2, 10 mM spermidine, 0.2 M DTT.
and Renaturation 2. DNA template: usually 0.5–2 pmol of a linearized plasmid or
2.1.1 Production PCR product.
of Unlabeled RNAs by 3. RNasin 40 U/μl.
In Vitro Transcription 4. T7 RNA polymerase 20 U/μl.
5. Milli-Q water.
6. 25 mM NTPs (mix containing 25 mM of each NTP).
7. 37 °C heating block or PCR machine.
8. DNase RQ1 1 U/μl.

2.1.2 RNA Purification 1. RNA denaturing polyacrylamide gel solution: 25 % acrylamide–

on Acrylamide Gel bisacrylamide (19:1), 8 M Urea.
2. 1× TBE buffer : 100 mM Tris–HCl, pH 8.3, 90 mM boric
acid, 2.5 mM EDTA, pH 8.
3. Ammonium persulfate 25 % (w/v).
4. Temed.
5. Electrophoresis equipment.
6. Gel loading buffer: 90 % Formamide, 20 mM EDTA, 0.03 %
(w/v) xylene cyanol, 0.03 % (w/v) bromophenol blue.
7. Heating block.
8. 1× elution buffer: 10 mM Tris–HCl, pH 7.5, 100 mM NaCl,
1 mM EDTA, pH 8, 1 % SDS (w/v).
9. UV shadowing system: UV lamp (254 nm) and fluor-coated
TLC plate.
10. Phenol–chloroform–isoamyl alcohol (25:24:1).
 Structural Probing of Small Non-Coding RNAs 123

11. 96 % EtOH.
12. Glycogen (10 mg/ml).
13. 70 % EtOH.
14. Refrigerated centrifuge adapted for 1.5 ml microtubes.
15. Milli-Q water.

2.1.3 Production 1. Unlabeled transcript (10–100 pmoles).

of End-Labeled RNAs 2. Calf intestine or shrimp alkaline phosphatase (1 U/μl).
3. 10× calf intestine or shrimp alkaline phosphatase buffer.
4. Heating block.
5. [γ-32P]-ATP (3,000 Ci/mmol).
6. T4 polynucleotide kinase.
7. 10× T4 PNK buffer.
8. Phenol–chloroform–isoamyl alcohol (25:24:1).
9. 96 % EtOH.
10. Glycogen (10 mg/ml).
11. 70 % EtOH.
12. Refrigerated centrifuge adapted for 1.5 ml microtubes.
13. Milli-Q water.
14. [32P]-pCp (3,000 Ci/mmol).
15. T4 RNA ligase (5 U/μl).
16. 10× T4 RNA ligase buffer.

2.1.4 RNA Transcripts 1. 1× Buffer D: 20 mM HEPES–KOH, pH 7.9, 0.1 M KCl, 20 %

Renaturation glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, pH 8, 0.5 mM DTT.
2. 65 °C water bath.
3. Plastic tray.
4. Thermometer.
5. 1 M MgCl2.

2.2 Enzymatic 1. RNase T1 500 U/μl (Roche Diagnostics).

Probing of RNA 2. RNase T2 2.5 U/μl (MoBiTec).
Transcripts
3. RNase V1 10−2 U/μl (Kemotech).
4. 1× Tris buffer: 50 mM Tris–HCl, pH 7.6, 100 mM KCl,
2.5 mM MgCl2.
5. Yeast total tRNA (20 mg/ml).
6. Milli-Q water.
7. 1 M MgCl2.
8. 10× buffer D: 200 mM HEPES–KOH pH 7.9, 1 M KCl,
15 mM MgCl2, 2 mM EDTA.
124 Jean-Vincent Philippe et al.

9. Heating block.
10. 0.1 M EDTA, pH 8.0.
11. Phenol–chloroform–isoamyl alcohol (25:24:1).
12. 96 % EtOH.
13. Glycogen (10 mg/ml).
14. 3 M NaOAc.
15. 70 % EtOH.
16. 25 mM potassium borate, pH 7.0 (see Note 1).

2.3 Chemical 1. Heating blocks.

Probing of RNA 2. Kethoxal (Amersham).
Transcripts
3. DMS (dimethylsulfate) (Sigma Aldrich).
4. CMCT (1-cyclohexyl-3(2-morpholinoethyl) carbodiimide
metho-p-toluene sulfonate) (Fluka).
5. Lead(II) acetate 3-hydrate (Merck).
6. 10× buffer D: 200 mM HEPES–KOH, pH 7.9, 1 M KCl,
15 mM MgCl2, 2 mM EDTA, pH 8.
7. Yeast total tRNA (20 mg/ml).
8. 10× DMS/kethoxal buffer: 500 mM sodium cacodylate, pH
7.5, 1 M KCl, 25 mM MgCl2. Stored at −20 °C.
9. 10× CMCT buffer: 500 mM sodium borate, pH 8.0, 1 M KCl,
25 mM MgCl2 (see Note 2).
10. DMS stop buffer: 1 M Tris–acetate, pH 7.5, 1.5 M sodium
acetate, 0.1 mM EDTA, 7 % β-mercaptoethanol.
11. 0.3 M NaOAc.
12. 0.5 M and 25 mM potassium borate, pH 7.0 (see Note 1).
13. 0.1 M EDTA, pH 8.0.
14. Phenol–chloroform–isoamyl alcohol (25:24:1).
15. 96 % EtOH.
16. Glycogen (10 mg/ml).
17. 70 % EtOH.
18. Milli-Q water.
19. Vortex.

2.4 Primer Extension 1. Primer (100 ng/μl).

Analysis 2. AMV Reverse Transcriptase (20 U/μl) (MP Biomedicals).
3. 10× AMV buffer: 500 mM Tris–HCl, pH 8.3, 60 mM MgCl2,
400 mM KCl.
4. 10× hybridization buffer: 500 mM Tris–HCl, pH 8.3, 400 mM
KCl (see Note 3).
5. T4 polynucleotide kinase (10 U/μl).
 Structural Probing of Small Non-Coding RNAs 125

6. 10× PNK buffer A.

7. [γ-32P]-ATP (3,000 Ci/mmol).
8. Heating block.
9. Quick spin oligo column (Roche diagnostics).
10. 42 and 65 °C water baths.
11. 5 mM dNTPs.
12. 0.5 mM ddNTPs.
13. Gel loading buffer: 90 % formamide, 20 mM EDTA, pH 8,
0.03 % (w/v) xylene cyanol, 0.03 % (w/v) bromophenol blue.

2.5 Gel Fractionation 1. 25 % acrylamide–bisacrylamide (19:1), 8 M urea.

2. 8 M urea.
3. 1× TBE buffer : 100 mM Tris–HCl, pH 8.3, 90 mM boric
acid, 2.5 mM EDTA, pH 8.
4. Ammonium persulfate 25 % (w/v).
5. Temed.
6. Heating block.
7. 100 mM NaHCO3, pH 9.2.
8. Yeast total tRNA (2 mg/ml).
9. 1× citrate buffer: 20 mM sodium citrate, pH 5.1, 1 mM EDTA,
pH 8, 7 M Urea, 0.03 % (w/v) xylene cyanol, 0.03 % (w/v)
bromophenol blue.
10. Gel loading buffer: 90 % formamide, 20 mM EDTA, pH 8,
0.03 % xylene cyanol, 0.03 % (w/v) bromophenol blue.
11. RNase T1 500 U/μl (Roche Diagnostics).
12. 3 MM paper.
13. Gel dryer.
14. X-Ray films and X-ray film developer or PhosphorImager
equipment.

2.6 Gel Analysis 1. SAFA software.

and Structure 2. Mfold software.
Modeling

3 Methods

3.1 RNA Transcripts 1. Settle the transcription reaction in a final volume of 50 μl by

Preparation mixing at room temperature the components listed below in
and Renaturation the following order: 10 μl of 5× T7 RNA polymerase buffer,
15 μl of 25 mM rNTP, 19 μl of the DNA template in water,
3.1.1 Production
1 μl of RNasin, and 5 μl of T7 RNA polymerase.
of Unlabeled RNAs by
In Vitro Transcription
126 Jean-Vincent Philippe et al.

2. Incubate at 37 °C for 2–12 h depending on transcription

efficiency (see Note 4).
3. After transcription, digest the DNA template by addition of
2 U of DNase RQ1. Incubate for 30 min at 37 °C.

3.1.2 RNA Purification 1. Add 30 μl of gel loading buffer to the transcription reaction.
on Denaturing Acrylamide 2. Heat at 96 °C for 2 min to denature secondary structures,
Gel then place immediately on ice to prevent renaturation
(see Note 5).
3. Purify the RNA transcript on a polyacrylamide–urea gel elec-
trophoresis (PAGE) in 1× TBE buffer (see Note 6).
4. After migration, visualize the RNA transcript by UV shadow-
ing and cut it out from the gel (see Note 7).
5. Add 100–200 μl of 1× elution buffer to the gel slice in a 1.5 ml
microtube and incubate for 30 min at 37 °C.
6. Transfer the supernatant containing the eluted RNA in a new
microtube and repeat the elution procedure (see Note 8).
7. Pool the two elution fractions and proceed with phenol–
chloroform extraction.
8. Precipitate the RNA transcript by addition of three volumes of
96 % EtOH and in the presence of 5 μg of glycogen. Incubate
for 15 min at −80 °C and centrifuge for 15 min at 15,000 × g
at 4 °C.
9. After centrifugation, the RNA pellet is washed with 70 %
EtOH, dried, and dissolved in Milli-Q water.

3.1.3 Production 1. For 5′end-labeling, first 5′-dephosphorylate the RNA tran-

of End-Labeled RNAs script (10–100 pmoles) with 1 U of calf intestine or shrimp
alkaline phosphatase, 1 μl of 10× phosphatase buffer in a 10 μl
reaction for 1 h at 37 °C.
2. Adjust the volume of the reaction to 200 μl with sterile water
and proceed with phenol–chloroform extraction.
3. Ethanol-precipitate the RNA transcript by addition of three
volumes of 96 % EtOH in the presence of 5 μg of glycogen and
0.3 M NaOAc. Incubate for 15 min at −80 °C and centrifuge
for 15 min at 13,000 rpm at 4 °C.
4. Resuspend the RNA pellet in 7 μl of sterile water.
5. Next, label the dephosphorylated RNA transcript with 1 μl of
[γ-32P]-ATP, 1 μl of 10 x T4 PNK buffer and 10 U of T4
polynucleotide kinase. Incubate for 45 min at 37 °C [20]
(see Note 9).
6. For 3′end-labeling, ligate [32P]-pCp to the RNA transcript by
incubating the RNA (50–100 pmoles) with equimolar amount
 Structural Probing of Small Non-Coding RNAs 127

(50–100 pmoles) of [32P]-pCp, 2 μl of 10× T4 RNA ligase

buffer, and 10 U of T4 RNA ligase overnight at 4 °C [21].
7. Purify the labeled RNA transcripts on a denaturing PAGE and
elute RNAs as described in Subheading 3.1.2.

3.1.4 RNA Transcripts 1. Dilute the RNA transcript in 1× buffer D.

Renaturation 2. Incubate for 10 min at 65 °C in a water bath and then slowly
cool samples down to room temperature (see Note 10).
3. Add Mg2+ ions at a concentration between 1.5 and 10 mM to
favor RNA 2D and 3D structure formation and stabilization
during the probing experiment (see Notes 11 and 12).

3.2 Enzymatic 1. Prepare RNase T1 dilutions in 1× Tris Buffer at 0.25, 0.5, and
Probing of RNA 1 U/μl starting from the stock solution at 500 U/μl. Store the
Transcripts dilutions at 4 °C.
3.2.1 Enzymes 2. Prepare RNase T2 dilutions in 1× Tris Buffer at 0.5, 1, and
Preparation 2 U/μl starting from the stock solution at 2.5 U/μl.
3. Prepare RNase V1 dilutions in 1× Tris Buffer at 10−4, 5.10−4,
and 10−3 U/μl starting from the stock solution at 10−2 U/μl.

3.2.2 Enzymatic Probing 1. For one enzymatic probing reaction, mix on ice 0.2–2 pmoles
of Unlabeled RNA of renatured unlabeled RNA transcript with 2 μg of total yeast
Transcripts tRNA and 1 μl of 10× buffer D. Adjust the final volume with
water to 9 μl (see Note 13).
2. Add 1 μl of diluted RNase T1, T2, or V1.
3. Incubate each assay for 6 min at 20 °C (see Note 14).
4. Stop RNase digestions by addition of 4 μl of 0.1 M EDTA, 1 μl
of yeast tRNAs (2 μg/μl), and 100 μl H2O and proceed with
phenol extraction.
5. Ethanol-precipitate the digestion products in the presence of
0.15 M NaoAc and 0.5 μg of glycogen. Wash samples with
70 % ethanol, dry them, and dissolve them in 3 μl of 25 mM
potassium borate.

3.2.3 Enzymatic Probing 1. For one probing reaction, mix 25,000–50,000 cpm of labeled
of End-Labeled RNA RNA with 1 μl of 10× buffer D, 1 μl of tRNAs (2 μg/μl), and
Transcripts Milli-Q water to a final volume of 9 μl.
2. Incubate this RNA mixture for 10 min at 65 °C and slowly
cool down to room temperature for renaturation.
3. Add 1 μl of diluted RNase T1, T2, or V1, or 1 μl of 1× Tris
buffer for the control reaction.
4. Incubate each assay exactly 6 min at 20 °C (see Note 14).
5. Stop RNase digestions by the addition of 4 μl of 0.1 M EDTA,
pH 8.0, 1 μl of yeast tRNAs (20 μg/μl), and 100 μl of H2O
and proceed with phenol–chloroform extraction.
128 Jean-Vincent Philippe et al.

6. Ethanol-precipitate in the presence of 0.15 M NaoAc and

0.5 μg of glycogen. Wash the samples with 70 % (v/v) ethanol,
dry them, and dissolve them in gel loading buffer to get a final
concentration of about 2,500 cpm/μl.

3.3 Chemical 1. Prepare the kethoxal solution by diluting 37 mg of liquid

Probing of RNA kethoxal in 1 ml of H2O. Mix by vortexing (see Note 15).
Transcripts 2. Prepare extemporaneously the DMS solution by diluting
3.3.1 Chemicals 4 times (v/v) DMS in ethanol 96 % (see Note 16).
Preparation 3. Prepare extemporaneously the CMCT solution (168 mg/ml)
in 1× CMCT buffer and heat a few second at 96 °C before
vortexing.
4. Prepare extemporaneously a stock solution of 400 mM lead
(II) acetate and the adequate dilutions (25–200 mM) using
Milli-Q water (see Note 17).

3.3.2 Chemical 1. For one chemical probing reaction, mix on ice 0.2–2 pmoles of
Modifications of Unlabeled renatured unlabeled RNA transcript with 2 μg of total yeast
RNA Transcripts tRNA (2 μg/μl) and 1 μl of 10× buffer D. Adjust the final
volume with water up to 9 μl (see Note 13).
2. Add 4 μl of 10× DMS/ke buffer (for DMS and kethoxal
modifications) or 10× CMCT buffer (for CMCT modifications)
and 26 μl of H2O to the reaction.
3. Incubate for 20 min at 20 °C (or for 10 min at 4 °C for Pb2+
reactions).
4. Add 1 μl of diluted DMS/EtOH solution, 20 μl of CMCT
solution, 4 μl of kethoxal solution or 1 μl of lead (II) acetate
and mix.
5. Incubate for exactly 6 min at 20 °C for DMS, CMCT, and keth-
oxal modifications and for 5 min for lead cleavages (see Note 14).

3.3.3 Stopping Reactions 1. Stop DMS modifications by adding 10 μl of DMS stop buffer
and 100 μl of 0.3 M sodium acetate. Proceed with phenol–
chloroform extraction and precipitate with 96 % EtOH in the
presence of 5 μg of glycogen.
2. Stop kethoxal modifications by adding 10 μl of 0.5 M potas-
sium borate, which stabilizes the kethoxal–guanine adduct.
Add 100 μl of 0.3 M sodium acetate and perform phenol–
chloroform extraction. Precipitate with 96 % EtOH in the
presence of 5 μg of glycogen.
3. Stop CMCT modifications by adding 100 μl of 0.3 M sodium
acetate and immediately proceed with phenol–chloroform
extraction followed by 96 % ethanol precipitation in the
presence of 5 μg of glycogen.
4. Stop lead cleavages by adding 5 μl of 0.1 M EDTA, pH 8.0
and 100 μl of 96 % EtOH. Incubate for 30 min at −80 °C and
 Structural Probing of Small Non-Coding RNAs 129

centrifuge at 13,000 rpm for 20 min at 4 °C (see Note 18).

Then, add 1 μl of yeast tRNA and 99 μl of H20 to the RNA
pellet. Proceed with phenol–chloroform extraction and pre-
cipitation with 750 μl of 96 % EtOH, 0.3 M NaOAc, and 5 μg
of glycogen.
5. Centrifuge at 13,000 rpm for 15 min at 4 °C.
6. Wash pellets with 70 % ethanol, dry them, and dissolve them in
3 μl of 25 mM potassium borate, pH 7.0 (see Note 19).

3.4 Primer Extension 1. Label the primer (50–100 ng) by phosphorylation at the 5′
Analysis terminus in a mixture containing 1 μl of [γ-32P]-ATP, 1 μl of
T4 Polynucleotide kinase, and 1 μl of 10× T4 PNK buffer in a
3.4.1 Primer Labeling
10 μl total reaction. Incubate for 45 min at 37 °C.
2. Add 15 μl of Milli-Q water and separate the labeled primer from
the unincorporated [γ-32P] ATP by gel filtration on a Quick Spin
Column according to the manufacturer’s instructions.
3. Adjust the volume of the purified labeled primer with Milli-Q
water to a concentration of about 100,000–150,000 cpm/μl.

3.4.2 Annealing 1. Mix 1 μl of the unlabeled RNA sample previously subjected to

either enzymatic or chemical modifications with 0.25 μl of 10×
Hybridization buffer and 1 μl of the 5′-end labeled primer
(100,000 cpm) in a total volume of 2.5 μl.
2. Incubate the mixture for 10 min at 65 °C.
3. Quickly chill on ice and incubate for 10 min at 4 °C.

3.4.3 Primer Extension 1. Mix following to prepare the elongation mixture: 0.1 μl of
5 mM dNTPs, 0.25 μl of 10× AMV Reverse Transcriptase buf-
fer, 0.25 μl of AMV Reverse Transcriptase (2 U/μl dilution
freshly prepared before use), and 1.9 μl of H2O (see Note 20).
2. Add 2.5 μl of this elongation mix to the hybridization mix
from Subheading 3.4.2.
3. Perform first strand synthesis reaction by incubating the tubes
for 30 min at 42 °C. During this step, each modification or
cleaved position within the RNA matrix will stop the elongation
by AMV reverse transcriptase.
4. After the incubation at 42 °C, briefly spin the samples at room
temperature to collect droplets from the lid.
5. Stop the primer extension by adding 3 μl of the gel loading
buffer and store on ice.

3.4.4 Sequencing Ladder 1. Produce a sequencing ladder with the unmodified RNA and
Preparation the corresponding labeled primer: as four lanes (A, C, G and T)
are required, prepare a hybridization mixture containing 0.8–8
pmoles of renatured unlabeled RNA transcript, 1 μl of 10×
130 Jean-Vincent Philippe et al.

Hybridization buffer, and 4 μl of the 5′-end labeled primer

(100,000 cpm) in a total volume of 10 μl (see Note 21).
2. Incubate the mixture for 10 min at 65 °C.
3. Quickly chill on ice and incubate for 10 min at 4 °C.
4. During this time prepare four sequencing tubes labeled A, C,
G, and T containing 0.5 μl of the appropriate ddNTP at
0.5 mM concentration (see Note 22).
5. Mix 2.5 μl of the elongation mix prepared in Subheading 3.4.3
and 2.3 μl of the hybridization mix in the sequencing tubes.
6. Briefly spin the samples and incubate for 30 min at 42 °C.
7. Briefly spin the samples at room temperature to collect any
condensation.
8. Stop the primer extension by adding 3 μl of the gel loading
buffer. Place on ice.

3.5 Gel Fractionation 1. Pour a 7–10 % polyacrylamide, 8 M urea sequencing gel in 1×

and Exposure TBE buffer (see Note 6).
3.5.1 Gel Fractionation 2. Pre-run the gel at 100 W until its temperature reaches 37 °C.
and Exposure of Samples 3. Denature both sequencing ladder and synthesized cDNAs for
Subjected to Primer 2 min at 96 °C.
Extension 4. Chill quickly on ice.
5. Load 2 μl of each sample on the pre-warmed sequencing gel.
6. Run the gel for 2 h at 100 W (see Note 23).
7. Transfer the gel onto 3 MM chromatography paper and cover
it with cling wrap.
8. Dry the gel using a dryer at 80 °C for 30 min.
9. Expose the gel to an X-ray film at −80 °C or in a PhosphorImager
cassette at room temperature for 12 h or more depending on
the intensity of the bands.

3.5.2 Gel Fractionation 1. Pour a 7–10 % polyacrylamide, 8 M urea sequencing gel in 1×

and Exposure of End- TBE buffer (see Note 6).
Labeled Samples 2. Pre-run the gel at 100 W until the temperature reaches 37 °C.
3. Prepare a reference ladder by statistical alkaline hydrolysis of
the labeled RNA (10,000–50,000 cpm) with 50 mM sodium
bicarbonate (pH 9.2) for 2 min at 96 °C. Chill on ice and
adjust the volume with gel loading buffer to get a final concen-
tration of about 5,000 cpm/μl.
4. Prepare a reference ladder by T1 RNase digestion of the
RNA in denaturing conditions. Mix the labeled RNA (10,000–
50,000 cpm) with 2 μg of total yeast tRNA (2 μg/μl) and 6 μl
of citrate buffer. Incubate for 10 min at 65 °C, add 2 μl of T1
RNase (2 U/μl) and incubate again for 10 min at 65 °C. Chill
on ice.
 Structural Probing of Small Non-Coding RNAs 131

5. Load 2 μl of each sample (corresponding to 5,000 cpm for

enzymatically modified RNA samples, 10,000 cpm for alkaline
ladder and 1,000–5,000 cpm for denatured T1 ladder) on the
pre-warmed sequencing gel (see Note 23).
6. Run the gel for 2 h at 100 W (see Note 24).
7. Transfer the gel onto 3 MM paper, cover it with cling wrap,
and dry it in a gel dryer at 80 °C for 30 min.
8. Expose the gel to an X-ray film at −80 °C or in a PhosphorImager
cassette at room temperature for 12 h or more depending on
the intensity of the bands (Fig. 1).

3.6 Gel Analysis 1. Analyze the gel either by manual reading or using the Semi-
and Structure Automated Footprinting Analysis (SAFA) software [8, 9].
Modeling 2. Generate a list of nucleotides recognized as single-stranded or
double-stranded nucleotides using the RNAse T1 ladder or the
sequencing ladder as sequence references (see Note 25). If using
SAFA, you can precisely quantify the intensity of each band on
the gel and normalize each band’s intensity to the respective
average lane intensity.
3. Use the most significant probing data as constraints in an
M-Fold search [15] for the RNA structure.
4. Choose among the proposed models the ones with the lowest
free energies (see Note 26) and the least discrepancies between
the different probing data (Fig. 1).

4 Notes

1. To prepare the potassium borate solution at pH 7.0, dissolve

boric acid in sterile water and adjust the pH of the solution
using a 1 M KOH solution. Filter the solution (0.2 μm filter)
and store up to several weeks in a glass bottle at 4 °C.
2. To prepare the sodium borate solution at pH 8.0, dissolve boric
acid in sterile water and adjust the pH of the solution using a
1 M NaOH solution. Filter the solution (0.2 μm filter), and
store up to several weeks in a glass bottle at 4 °C.
3. The hybridization buffer is identical to the RT buffer except
that it does not contain MgCl2. This improves primer hybrid-
ization on the RNA of interest and is most especially important
for highly structured RNA molecules.
4. The formation of a pyrophosphate precipitate in your tran-
scription reaction usually indicates that your transcription has
been efficient. Efficiency of transcription is usually higher for
T7 RNA polymerase than for SP6 RNA polymerase. However,
efficient transcription with T7 RNA polymerase requires
the presence of at least one G residue at the initiation site.
132 Jean-Vincent Philippe et al.

a b
DMS CMCT Keth T1 T2
UGCA U G C A-

1750 -
SL II

1775 -

SL III

1800 -

Progerin
1825 - 5’SS

SL IV

1850 -

SL V

Fig. 1 Structural probing of the Lamin A (LMNA) pre-mRNA in the region containing the exon 11 alternative 5′
splice site. RNAs of 638 nt bearing the 1824C>U mutation responsible for the Hutchinson Gilford Progeria
Syndrome (HGPS) were used to determine the structure around the exon 11 of LMNA alternative 5′ splice site
(5′SS), leading to a non-functional LMNA protein called progerin. These RNAs contain the exons 11 and 12 and
the intron 11. Chemical modifications by DMS, CMCT, and kethoxal and digestions with RNases T1 and T2 were
carried out as described in this chapter. Panel a shows the primer extension analyses. For each of the chemical
probes (gel on the left), the first lane corresponds to a control experiment performed in the absence of the probe,
whereas the two other lanes correspond to increasing amounts of the probe. Lanes U, G, C, and A correspond to
the sequencing ladder. For RNases digestions (gel on the right), a control experiment corresponding to undi-
gested RNA was fractionated (lane -) and increasing amounts of RNases T1 and T2 were used. The primer used
to perform primer extension allows the analysis of the secondary structure from positions 1750–1870 of the
LMNA RNA (see panel b). Splice Site (SS) and Stem Loop structures (SL) identified as in the structure model in
panel b are indicated on the side of the gels. Positions in the LMNA RNA are indicated on the left side of the gel.
Panel b shows the secondary structure model proposed based on thermodynamic considerations and on the
results of chemical and enzymatic probing shown for the most part in panel a. V1, T1, and T2 RNases cleavages
are represented by squares, diamonds, and circles, respectively. Nucleotides modified by DMS, CMCT, or Ke are
circled. The colors (red, orange, and green) and number of symbols indicate high, medium, or low extent of
cleavage, respectively. The position of the progerin 5′ splice site is indicated. The different predicted stem loop
structures are numbered II–IV

The presence of a GGG, GAG or GGA sequence therefore

strongly enhances transcription yield. However, addition of
these residues at the 5′ extremity of the RNA may alter its
secondary structure.
 Structural Probing of Small Non-Coding RNAs 133

Moreover, it is not easy to get small RNA transcripts

(<50 nt) in high amounts. For the synthesis of small RNAs, we
recommend the use of the MEGAscript® or MEGAshortscriptTM
kit provided by Ambion. Several factors affecting the transcrip-
tion yield must also be taken into account, such as the quantity
of DNA template (generally 0.5–2 pmol), the incubation time
(2–12 h), the Mg2+/NTP ratio (usually 1/1.75), the pH of
NTP stocks, the preparation of the transcription reaction mix-
ture in a defined order and at room temperature. In the case of
long incubation times at 37 °C, we recommend to perform the
transcription reaction in a PCR tube and to incubate it in a
PCR machine with heated lid instead of using a heating block
so as to avoid evaporation.
5. Secondary structure will cause some or all of the RNAs to
migrate aberrantly through the gel leading to a smeary pattern,
multiple bands, or bands of aberrant sizes.
6. The choice of the gel percentage is a compromise between
speed and resolution. Higher concentrations of polyacrylamide
decrease the average pore size of the gel, slowing migration
but increasing separation resolution of the sample molecules.
7. UV shadowing is a technique for visualizing nucleic acids
(e.g., separated in a gel) using shortwave UV light (254 nm)
and a fluor-coated TLC plate. The limit of sensitivity of this
method is about 0.4 μg of RNA in a single band.
8. These two elution steps usually allow recovery of about 75 %
of the transcript. If transcription efficiency is very low, a third
elution step can be performed overnight at 4 °C. In this case,
as the 1 x elution buffer contains 1 % SDS, a white precipitate
will be observed in your tube. Don’t forget to incubate the
tube at 37 °C for 10 min before transfer of the supernatant to
solubilize the SDS precipitate.
9. While it is possible to perform phosphate-exchange reactions,
T4 PNK labeling is more efficient when the 5′ end of the target
molecule has been dephosphorylated.
10. To slowly cool down the transcript to room temperature we
recommend taking off water from the 65 °C water bath into a
small tray, to transfer the transcript tubes into the tray and to
wait for about 1 h. The temperature of the water can be fol-
lowed using a thermometer.
11. The renaturation process is required to produce a homoge-
neous population of RNA molecules in terms of RNA secondary
structures.
12. To favor RNA 2D and 3D structure formation and stabilization
probing experiments, a final Mg2+ concentration comprised
between 1.5 and 10 mM is required. As buffer D only con-
tains 1.5 mM MgCl2, you can at this stage adjust MgCl2 final
concentration to 5 or 10 mM.
134 Jean-Vincent Philippe et al.

13. Modification and enzymatic digestion conditions should be

selected in order that less than one modification or cleavage
occurs per RNA molecule. That is the reason why a defined
amount of yeast total tRNA is added to the reactions in order
to limit the efficiency of cleavage or modification. This amount
of yeast total tRNA can be adjusted depending on the effi-
ciency of cleavage or modification of your RNA of interest.
Moreover, as each primer used for primer extension analysis
has its own efficiency for reverse priming, preliminary assays
should be performed for each primer to define the exact
amount of RNA that is suitable for the analysis.
14. We recommend to start the reactions at 30 s of interval to
strictly respect the 6 min incubation times.
15. The kethoxal solution at 37 mg/ml is stable and can be stored
at −20 °C.
16. DMS is a potential carcinogen and special care should be taken
for its handling. DMS should be manipulated under a fume
hood. Cones and supernatants must be placed in a 1 N NaOH
solution to neutralize instantly all traces of DMS.
17. To prevent the formation of precipitates in presence of Pb2+,
avoid any trace of Cl- ions during the course of the
experiments.
18. This first precipitation without salt in the presence of EDTA is
performed to eliminate Pb2+ ions.
19. Pellets could be dissolved in Milli-Q water except for the
kethoxal-modified RNAs because this modification is revers-
ible and should be stabilized by borate.
20. Prepare enough of the elongation mixture for all modified
samples to be elongated and the four sequencing samples, plus
10 % to avoid pipetting errors. In addition, because all RNAs
contain sites where reverse transcriptase pauses in the course of
extension even in the absence of chemical modification or
enzymatic digestion, a control reverse transcription assay
should always be performed on the untreated RNA, in order to
distinguish the natural pauses of reverse transcriptase from
cleavage and modification sites.
21. A sequencing ladder is produced and fractionated in parallel to
the samples on the sequencing gel in order to identify posi-
tions of cleavages and modifications on the RNA.
22. The preparation of the sequencing ladder requires a single-
stranded RNA template, a labeled primer, the AMV reverse
transcriptase, dNTPs and ddNTPs, the latter ones triggering
termination of cDNA synthesis. These chain-terminating
nucleotides lack a 3′-OH group required for the formation of
the next phosphodiester bond. The DNA sample is divided
into four separate sequencing reactions, containing all dNTPs
 Structural Probing of Small Non-Coding RNAs 135

and the reverse transcriptase and only one of each ddNTPs.

In our protocol, the dNTP/ddNTP ratio is about 2:1 but to
improve the quality of the sequencing or the length of read,
this ratio can be adjusted to 4:1 or even 6:1.
23. Both the alkaline and denaturing T1 ladders are necessary to
get a sequence reference. The alkaline ladder allows determina-
tion of the position of each nucleotide in the sequence, while
the T1 denaturing ladder allows the specific detection of G
residues and enables the assignment of each band.
24. The temperature of the gel should not exceed 48 °C. To avoid
breaking of sequencing gel plates, we recommend using a
power supply enabling automatic voltage, current and power
regulation depending on the gel temperature. The optional
temperature probe maintains a constant temperature during
the run by adapting the settings to the temperature.
25. When analyzing probing data generated by primer extension on
chemically modified or enzymatically digested unlabeled tran-
scripts, keep in mind that extension stops occur one nucleotide
before the modification sites and at the cleavage sites. Depending
on whether the RNase cleaves at the 5′ or 3′ extremity of the
nucleotide, the corresponding dNTP will or will not be incorpo-
rated, respectively.
26. The structure with the lowest free energy is expected to be the
most represented conformation at equilibrium.

Acknowledgments

J.V.P. was supported by a graduate fellowship from the french

Ministère Délégué à la Recherche et aux Technologies. This work
was supported by grants from the Agence Nationale pour la
Recherche contre le Sida (ANRS), the European Alternative
Splicing Network of Excellence (EURASNET, FP6 life sciences,
genomics and biotechnology for health) and the European
Associated Laboratory (LEA) on pre-mRNA splicing created by
CNRS, UL, UM1, UM2 and Max Planck Institut. V. Vautrot is
acknowledged for providing materials for illustration of the enzy-
matic probing experiment.

References
1. Warf MB, Berglund JA (2010) Role of RNA 3. Weinberg Z, Perreault J, Meyer MM, Breaker
structure in regulating pre-mRNA splicing. RR (2009) Exceptional structured noncoding
Trends Biochem Sci 35(3):169–178. RNAs revealed by bacterial metagenome analy-
doi:10.1016/j.tibs.2009.10.004 sis. Nature 462(7273):656–659. doi:10.1038/
2. Breaker RR (2012) Riboswitches and the RNA nature08586
world. Cold Spring Harb Perspect Biol 4(2). 4. Prusa J, Missak J, Kittrell J, Evans JJ, Tapprich
doi:10.1101/cshperspect.a003566 WE (2014) Major alteration in coxsackievirus
136 Jean-Vincent Philippe et al.

B3 genomic RNA structure distinguishes a 13. Aviran S, Pachter L (2014) Rational experi-
virulent strain from an avirulent strain. Nucleic ment design for sequencing-based RNA
Acids Res 42(15):10112–10121. doi:10.1093/ structure mapping. RNA 20:1864–1877.
nar/gku706 doi:10.1261/rna.043844.113
5. Ray SS, Pal SK (2013) RNA secondary struc- 14. Vasa SM, Guex N, Wilkinson KA, Weeks KM,
ture prediction using soft computing. IEEE/ Giddings MC (2008) ShapeFinder: a software
ACM Trans Comput Biol Bioinform 10(1):2– system for high-throughput quantitative anal-
17. doi:10.1109/TCBB.2012.159 ysis of nucleic acid reactivity information
6. Ehresmann C, Baudin F, Mougel M, Romby P, resolved by capillary electrophoresis. RNA
Ebel JP, Ehresmann B (1987) Probing the 14(10):1979–1990. doi:10.1261/rna.
structure of RNAs in solution. Nucleic Acids 1166808
Res 15(22):9109–9128 15. Zuker M (2003) Mfold web server for nucleic
7. Weeks KM (2010) Advances in RNA structure acid folding and hybridization prediction.
analysis by chemical probing. Curr Opin Nucleic Acids Res 31(13):3406–3415
Struct Biol 20(3):295–304. doi:10.1016/j. 16. Mereau A, Fournier R, Gregoire A, Mougin A,
sbi.2010.04.001 Fabrizio P, Luhrmann R, Branlant C (1997)
8. Das R, Laederach A, Pearlman SM, Herschlag An in vivo and in vitro structure-function anal-
D, Altman RB (2005) SAFA: semi-automated ysis of the Saccharomyces cerevisiae U3A
footprinting analysis software for high- snoRNP: protein-RNA contacts and base-pair
throughput quantification of nucleic acid foot- interaction with the pre-ribosomal RNA.
printing experiments. RNA 11(3):344–354. J Mol Biol 273(3):552–571. doi:10.1006/
doi:10.1261/rna.7214405 jmbi.1997.1320
9. Simmons K, Martin JS, Shcherbakova I, 17. Talkish J, May G, Lin Y, Woolford JL Jr,
Laederach A (2009) Rapid quantification and McManus CJ (2014) Mod-seq: high-
analysis of kinetic *OH radical footprinting throughput sequencing for chemical probing
data using SAFA. Methods Enzymol 468:47– of RNA structure. RNA 20(5):713–720.
66. doi:10.1016/S0076-6879(09)68003-4 doi:10.1261/rna.042218.113
10. Mitra S, Shcherbakova IV, Altman RB, Brenowitz 18. Kielpinski LJ, Vinther J (2014) Massive
M, Laederach A (2008) High-throughput single- parallel-sequencing-based hydroxyl radical
nucleotide structural mapping by capillary auto- probing of RNA accessibility. Nucleic Acids
mated footprinting analysis. Nucleic Acids Res Res 42(8):e70. doi:10.1093/nar/gku167
36(11):e63. doi:10.1093/nar/gkn267 19. Balzer M, Wagner R (1998) A chemical modi-
11. Mortimer SA, Trapnell C, Aviran S, Pachter L, fication method for the structural analysis of
Lucks JB (2012) SHAPE-Seq: high-throughput RNA and RNA-protein complexes within liv-
RNA structure analysis. Curr Protoc Chem Biol ing cells. Anal Biochem 256(2):240–242.
4(4):275–297. doi:10.1002/9780470559277. doi:10.1006/abio.1997.2499
ch120019 20. Silberklang M, Gillum AM, RajBhandary UL
12. Loughrey D, Watters KE, Settle AH, Lucks JB (1979) Use of in vitro 32P labeling in the
(2014) SHAPE-Seq 2.0: systematic optimiza- sequence analysis of nonradioactive tRNAs.
tion and extension of high-throughput chemi- Methods Enzymol 59:58–109
cal probing of RNA secondary structure with 21. England TE, Uhlenbeck OC (1978) 3′-terminal
next generation sequencing. Nucleic Acids Res labelling of RNA with T4 RNA ligase. Nature
42(21). doi:10.1093/nar/gku909 275(5680):560–561
 Part III

High-Throughput Approaches to Study Non-Coding RNAs

 Chapter 13

cDNA Library Generation for the Analysis of Small RNAs

by High-Throughput Sequencing
Jennifer Gebetsberger, Roger Fricker, and Norbert Polacek

Abstract
The RNome of a cell is highly diverse and consists besides messenger RNAs (mRNAs), transfer RNAs
(tRNAs), and ribosomal RNAs (rRNAs) also of other small and long transcript entities without apparent
coding potential. This class of molecules, commonly referred to as non-protein-coding RNAs (ncRNAs),
is involved in regulating numerous biological processes and thought to contribute to cellular complexity.
Therefore, much effort is put into their identification and further functional characterization. Here we
provide a cost-effective and reliable method for cDNA library construction of small RNAs in the size range
of 20–500 residues. The effectiveness of the described method is demonstrated by the analysis of ribosome-
associated small RNAs in the eukaryotic model organism Trypanosoma brucei.

Key words cDNA library, Reverse transcription, Small RNA, Non-coding RNA

1 Introduction

Applications of high-throughput sequencing technologies are

tremendously raising and allow deep insights into many aspects of
cellular biology. Therefore, it is not surprising that reverse transcrip-
tion of RNA into cDNA is one of the most frequently used applica-
tions in molecular biology. Although many methods for cDNA
library construction are commercially available, they are either rather
laborious or expensive. Furthermore, many of these protocols were
primarily established for mRNAs only, demanding alternatives for
the investigation of other RNA entities, such as primary transcripts
and small ncRNAs. There is accumulating evidence that such small
ncRNAs derive from diverse transcript classes and possess indispens-
able functions (reviewed in refs. 1, 2). It appears that we have thus
far only scratched the tip of the ncRNA iceberg, emphasizing the
need for alternative approaches that allow the detection of yet over-
looked ncRNA regulators. Therefore, the method described herein
is amenable to construct high quality cDNA libraries of such small
RNAs in a straightforward and cost-effective manner.

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_13, © Springer Science+Business Media New York 2015

139
140 Jennifer Gebetsberger et al.

A noteworthy advantage of the herein described method is

that any kind of RNA starting material can be used for successful
cDNA library generation. Therefore, it not only was applied for
the investigation of ncRNA transcriptomes [3] and RNomes of
specific cellular compartments [4] but also allowed the detection
of a so far undescribed population of ribosome-associated ncRNAs
[5–8]. To this end, specialized cDNA libraries from ribosome-
bound small RNAs were generated from organisms spanning all
domains of life, including Staphylococcus aureus, the archaeon
Haloferax volcanii [5], the unicellular parasite Trypanosoma brucei,
and Saccharomyces cerevisiae [7]. Besides already known ribosome-
associated RNAs, such as mRNAs, transfer RNAs (tRNAs), the
signal recognition particle RNA, these cDNA libraries revealed
hundreds of putative novel ncRNAs that target the ribosome and
thereby potentially regulate protein biosynthesis (as an example see
Fig. 1. for T. brucei deep sequencing results).
Although the described method for cDNA library construc-
tion is highly reliable and straightforward, attention has to be given
to the quantitative interpretation of sequencing results, since (1)
more structured or posttranscriptionally modified RNAs might be
less easily reverse-transcribed and therefore underrepresented in
the sequencing data, (2) due to the requirement of PCR amplifica-
tion (Fig. 2.) smaller RNA species will be more abundant than
longer ones, (3) the anchored primers used for first strand cDNA
synthesis will anneal not only to the synthetic 3′ C-tail (Fig. 2.) but
also to naturally occurring internal C-stretches of RNAs (a prob-
lem especially relevant for organisms with a high GC content), and
(4) biases of the used enzymes (e.g., TAP, T4 RNA ligase, reverse
transcriptase) cannot be excluded (also discussed in ref. 9).

2 Materials

2.1 RNA Preparation 1. Phenol–chloroform–isoamyl alcohol (P/C/I) (25:24:1)

solution (see Note 1).
2. TBE 10×: 890 mM Tris–HCl, pH 8, 890 mM boric acid,
20 mM EDTA (see Notes 2 and 3). Store at RT.
3. Running buffer (1× TBE).
4. Denaturing polyacrylamide gel solution: 8 % (v/v) polyacryl-
amide–bisacrylamide (29:1), 7 M urea, 1× TBE. Store at
4 °C. For polymerization, add 0.1 % (w/v) of ammonium
persulfate (APS) and 0.1 % (v/v) of TEMED (N,N,N′,N′-
tetramethylethylenediamine).
5. RNA loading dye (2×): 95 % formamide, 0.5 mM EDTA, 0.03 %
(w/v) bromophenol blue, 0.03 % (w/v) Xylene cyanol.
6. Gel staining solution: 1× TBE, 0.4 μg/ml ethidium bromide.
7. Elution buffer: 0.3 M NaOAc, pH 5.4, 1 mM EDTA.
 cDNA Library of Small RNAs 141

Fig. 1 Pie chart of deep sequencing results. A specialized cDNA library was con-
structed for small ribosome-associated RNAs in Trypanosoma brucei. The cDNA
library was deep-sequenced using the Illumina platform for single end reads at
a maximum read length of 100 base pairs. Sequence reads were grouped
according to their genomic origin (snoRNA for small nucleolar RNA, ncRNA for
non-coding RNA, rRNA for ribosomal RNA, tRNA for transfer RNA, and SRP RNA
for signal recognition particle RNA). The relative distribution is indicated in reads
per million (RPM). Sequencing results of ribosome-bound small RNAs extracted
from (a) exponentially growing cultures are shown and compared to (b) RNAs
extracted from heat stressed T. brucei cells. According to these results, different
conditions led to a different ribosome-bound small RNome

2.2 cDNA Library 1. Poly(A) Polymerase kit (Epicentre, Illumina), including 10×
Generation reaction buffer: 0.5 M Tris–HCl, pH 8.0, 2.5 M NaCl,
100 mM MgCl2.
2. Tobacco Acid Pyrophosphatase (Epicentre, Illumina), including
10× reaction buffer: 500 mM NaOAc, pH 6.0, 10 mM EDTA,
1 % (v/v) β-mercaptoethanol, 0.1 % (v/v) Triton X-100.
3. T4 RNA Ligase, including 10× reaction buffer: 500 mM Tris–
HCl, pH 7.5, 100 mM MgCl2, 100 mM DTT, 10 mM ATP.
4. Superscript™ II Reverse Transcriptase (Invitrogen™, Life
Technologies), including 5× First strand buffer: 250 mM Tris–
HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2.
142 Jennifer Gebetsberger et al.

Fig. 2 Flowchart of the cDNA library construction method reported. As starting material for cDNA library prepa-
ration, any RNA entity can be used. In the presented case, ribosomes were isolated from Trypanosoma brucei
via density gradient centrifugation yielding non-translating subunits and monosomes (40S, 60S, 80S) as well
as actively translating polyribosomes. RNA that co-purified with these fractions was used for cDNA library
construction, allowing the analysis of the small RNA interactome of T. brucei ribosomal particles. In a first step
RNA is size-separated by polyacrylamide gel electrophoresis (PAGE) in order to enrich for small RNAs (black).
Size-selected RNA is 3′ C-tailed and 5′ adaptor ligated prior to reverse transcription. The resulting cDNA is
amplified by PCR reaction and purified via native PAGE before sequencing. In order to check the quality of the
cDNA library, diagnostic Sanger sequencing can be performed prior to high-throughput sequencing. Whereas
the type of working material is listed on the left side of the figure, the different steps of cDNA library construc-
tion are given on the right together with the corresponding method section

5. Taq-DNA polymerase, including 10× PCR buffer: 100 mM

Tris–HCl, pH 9.5, 200 mM (NH4)2SO4, 15 mM MgCl2,
10 mM DTT, 0.05 % (v/v) Nonidet P-40 [10].
6. 5ʹ adapter primer sequence: 5ʹ-GTCAGCAATCCCTAA
CGAGtaguA-3ʹ
DNA primer harbors three RNA nucleosides at the 3′ end
(underlined letters). Lower case letters are depicting the four
 cDNA Library of Small RNAs 143

letter barcode to discriminate between RNAs originating from

different conditions (see Note 4).
7. Anchored oligo(dG) primer sequence: 5′-AGGACGCATC
GTATGTCGGGGGGH-3′
H = equal mix of T, C, A.
8. PCR primer sequences: forward primer: 5′-GTCAGCAAT
CCCTAACGAG-3′
reverse primer: 5′-AGGACGCATCGTATGTCG-3′.
9. Native polyacrylamide gel solution: 8 % (v/v) polyacrylamide–
bisacrylamide (29:1), 1× TBE. Store at 4 °C. For polymeriza-
tion, add 0.1 % (w/v) of ammonium persulfate (APS) and 0.1 %
(v/v) of TEMED (N,N,N′,N′-tetramethylethylenediamine).
10. DNA loading dye (6×): 60 % (v/v) glycerol, 60 mM EDTA,
0.25 % (w/v) bromophenol blue, 0.25 % (w/v) xylene cyanol.

2.3 Sequencing 1. pGEM®-T Easy Vector System (Promega), including 2× Rapid

ligation buffer: 60 mM Tris–HCl, pH 7.8, 20 mM MgCl2,
20 mM DTT, 2 mM ATP, 10 % polyethylene glycol (PEG
8000).
2. LB medium: 1 % (w/v) tryptone, 1 % (w/v) NaCl, 0.5 % (w/v)
yeast extract. Autoclave and store at 4 °C.
3. LB agar: 1 % (w/v) tryptone, 1 % (w/v) NaCl, 0.5 % (w/v)
yeast extract, 1.5 % (w/v) agar. After autoclaving add required
supplements: 0.065 mg/ml X-gal, 0.1 mg/ml ampicillin,
0.6 μM IPTG.
4. One Shot® TOP10 Electrocomp™ E. coli cells (Invitrogen™,
Life Technologies).
5. M13 forward primer: 5′-CCCAGTCACGACGTTGTAA
AACG-3′
M13 reverse primer: 5′-AGCGGATAACAATTTCACA
CAGG-3′
6. BigDye terminator cycle sequencing reaction kit (Applied
Biosystems®, Life Technologies).

3 Methods

The herein described method allows the construction of a cDNA

library from all kinds of RNA templates (see Note 5). Based on our
interest in small RNAs, a size-separation step via denaturing poly-
acrylamide gel electrophoresis (PAGE) is included at the begin-
ning of the protocol (Fig. 2.). This step allows the exclusion of
longer RNAs, such as rRNAs and mRNAs and therefore enriches
smaller RNA molecules. Since many small regulatory RNAs are
commonly processing products of longer precursors [1, 2, 5, 6, 11]
144 Jennifer Gebetsberger et al.

we usually attempt to retain the natural ends of RNA molecules for

downstream bioinformatic analyses. Therefore, the 3′ ends of the
RNAs are extended by poly(C)-tailing using the poly(A) poly-
merase [12]. For 5' adaptor ligation, the T4 RNA ligase requires
monophosphorylated RNA termini. In order to remove 5′ triphos-
phate groups from primary transcripts (or eukaryal methylguanosine-
cap structures), a tobacco acid pyrophosphatase (TAP) treatment is
included in the protocol, generating RNAs with 5′-monophos-
phorylated termini (Fig. 2.). The subsequent 5′ adaptor ligation by
T4 RNA ligase aims to introduce a specific sequence for final PCR
amplification of the cDNA and additionally offers the opportunity
of barcode insertion. This enables parallel sequencing of samples
originating from different RNA preparations in one deep-sequencing
run. The 3′ C-tailed and 5′ adaptor-ligated RNA is reverse-
transcribed into cDNA using oligo(dG) anchored primers.
The cDNA is finally amplified via PCR and purified performing
native PAGE.

3.1 RNA Preparation 1. For RNA extraction from a total extract (tissue or cultured
cells), add 1 volume of P/C/I (see Note 1) and vortex for
1 min.
2. Centrifuge for 1 min at 16,000 × g and transfer upper phase
into a new precooled 1.5 ml reaction tube.
3. Add 1 volume of chloroform, vortex for 1 min, and centrifuge
again for 1 min at 16,000 × g.
4. Transfer upper phase again into a new precooled 1.5 ml reac-
tion tube.
5. Add 2.5 volumes of precooled (−20 °C) absolute EtOH and
300 mM NaOAc, pH 5.4, invert several times, and put the
samples for 20 min at −80 °C for precipitation.
6. Centrifuge for 20 min at 16,000 × g at 4 °C and wash pellet
with precooled (−20 °C) 70 % EtOH.
7. Remove EtOH and let the pellet dry for 10 min on ice.
8. The RNA (5–200 μg are recommended) is mixed with RNA
loading dye and loaded in a single slot of a denaturing 8 %
polyacrylamide gel containing 7 M urea (gel thickness 2 mm).
Also load an RNA molecular weight marker, enabling the cor-
rect size detection of the RNA of interest.
9. Run the gel with 200 V for 2.5 h.
10. Stain the gel with EtBr in 1× TBE buffer for 10 min.
11. After gel staining, excise the RNA in the size-range of interest
from the gel by cutting it out with a sterile scalpel (see Note 6).
12. Dice the excised gel piece into 1 mm3 cubes with a sterile
scalpel, which will enhance subsequent elution of the RNA
from the gel.
 cDNA Library of Small RNAs 145

13. Carefully transfer the gel pieces into a fresh 1.5 ml reaction
tube.
14. Add elution buffer until all gel slices are submerged and incu-
bate overnight with constant shaking at 4 °C for the RNA to
passively elute (see Note 7).
15. Remove the supernatant using a pipette and transfer the solu-
tion into a fresh 1.5 ml reaction tube.
16. Centrifuge the sample at 2,300 × g at 4 °C for 5 min to pellet
potential gel pieces.
17. Transfer the elution buffer containing the eluted RNA into a
clean reaction tube (see Notes 7 and 8).
18. Precipitate the eluate with 2.5 volumes of absolute ethanol for
at least 20 min at −80 °C (see Note 9).
19. Centrifuge RNA at 16,000 × g in a tabletop centrifuge at 4 °C
for 30 min.
20. Wash the pellet with 70 % ethanol and subsequently dissolve it
in 11 μl water.
21. Use 1 μl of dissolved RNA to spectrophotometrically determine
its concentration.

3.2 cDNA Library 1. Pre-incubate 1–5 μg of size-separated RNA at 65 °C for 5 min

Generation to denature RNA secondary structures.
3.2.1 3′ C Tailing 2. Tail the pre-incubated RNA in a final volume of 50 μl of 1×
of the RNA reaction buffer, in the presence of 2 mM MgCl2, 2 mM CTP
(see Note 10), 40 U of ribonuclease inhibitor.
3. Pre-incubate at 37 °C for 5 min and add 6.25 U of poly(A)
polymerase (PAP) for 1.5 h at 37 °C.
4. Extract the 3′ tailed RNA with P/C/I and precipitate with
ethanol (see Subheading 3.1, step 1).
5. Dissolve pellet in 7 μl (if proceeding with Subheading 3.2.2)
or 10 μl (if proceeding with Subheading 3.2.3) of water.

3.2.2 Decapping This reaction is required to remove 5′ triphosphate groups from

of the RNA primary transcripts or 5′ methylguanosine-cap structures prior
to 5′ adaptor ligation. Otherwise continue directly with
Subheading 3.2.3.
1. Incubate the whole amount of 3′ tailed RNA with 10 U of
Tobacco Acid Pyrophosphatase (TAP) (see Note 11) at 37 °C
for 1 h in a total volume of 10 μl containing 1× reaction buffer
and 40 U of ribonuclease inhibitor.
2. P/C/I-extract TAP-treated C-tailed RNA, precipitate with
ethanol (see Subheading 3.1, steps 1–7), and resuspend RNA
in 10 μl water (see Note 12).
146 Jennifer Gebetsberger et al.

3.2.3 5′ Adaptor Ligation The aim of the 5′ adaptor ligation is the introduction of a specific
sequence allowing subsequent PCR amplification. Furthermore,
barcodes (see Note 13) for different conditions can be integrated
at this step, enabling sequence assignment after deep sequencing.
Since T4 RNA ligase can only join RNA ends, chimeric DNA/
RNA oligonucleotides, carrying three RNA nucleosides at their 3′
end, are used as 5′ adaptors (see Subheading 2 and Note 4).
1. Perform the ligation reaction in a final volume of 20 μl, con-
taining 1× reaction buffer and 20 μM 5′ adaptor.
2. Pre-incubate at 65 °C for 5 min and add 40 U of ribonuclease
inhibitor and 10 U of T4 RNA ligase. Incubate at 4 °C
overnight.
3. After overnight incubation, add 10 U of T4 RNA ligase and
incubate for an additional hour on ice.
4. P/C/I-extract the 5′ adaptor-ligated RNA, ethanol-precipitate
(see Subheading 3.1, steps 1–7), and resuspend in 10 μl water.

3.2.4 Reverse In this step, the 5′ adaptor-ligated and 3′ C-tailed RNA is reverse-
Transcription transcribed into cDNA employing anchored oligo(dG) primers.
1. Pre-incubate 10 μl of RNA from Subheading 3.2.3 in the pres-
ence of 5 μM anchored primer and 2 mM dNTPs at 65 °C for
5 min.
2. Immediately chill on ice.
3. Add 4 μl of 5× first strand buffer, 10 mM DTT, and 40 U of
ribonuclease inhibitor.
4. Incubate the reaction at 42 °C for 2 min.
5. Add 200 U of reverse transcriptase and incubate the reaction
at 42 °C for 1 h.

3.2.5 PCR Amplification 1. Perform the PCR reaction in a 50 μl reaction volume containing
of the cDNA 4 μl of cDNA from Subheading 3.2.4, 1 μM of both forward
and reverse primer (see Note 14), 0.1 mM dNTPs and 2 U of
Taq-DNA polymerase in 1× PCR buffer.
2. Use following cycles for the PCR reaction: Denaturation step
for 2 min at 94 °C; 20 cycles: 1 min at 94 °C, 1 min at 54 °C,
1 min 72 °C; Final elongation step for 5 min at 72 °C.

3.2.6 Purification of PCR 1. Mix 50 μl of PCR reaction with 6× DNA loading dye and run
Product via Native PAGE on an 8 % polyacrylamide gel.
2. Stain the gel with 0.4 μg/ml EtBr in 1× TBE buffer for 10 min
and excise the cDNA (see Note 15).
3. Elute in elution buffer overnight with constant shaking at
4 °C.
4. Spin at 2,300 × g at 4 °C for 5 min and transfer the eluate into
a fresh reaction tube.
 cDNA Library of Small RNAs 147

5. Precipitate with 2.5 volumes of absolute ethanol for 20 min

at −80 °C.
6. Centrifuge ethanol precipitated cDNA at 16,000 × g at 4 °C
for 30 min and wash with 70 % ethanol.
7. Dissolve pellet in 20 μl of water.

3.3 Sequencing In order to check the cDNA quality, including correct adaptor
ligation and sufficient insert lengths, diagnostic Sanger-sequencing
3.3.1 Diagnostic Sanger
of ~50–100 clones is recommended.
Sequencing
1. Ligate cDNA into pGEM-T vectors and transform into electro-
competent E. coli cells (see Note 16).
2. Perform colony-PCR and purification of the resulting PCR
products.
3. Sequence purified PCR-products for example by using the
BigyDye terminator cycle sequencing reaction kit (PE Applied
Biosystems).

3.3.2 Preparation 1. Add adaptors required for deep-sequencing via PCR (see
for Deep-Sequencing Note 17). Contact the deep-sequencing platform of your
choice for appropriate primer design.
2. PAGE-purify amplified cDNA carrying the attached sequenc-
ing adaptors and precipitate with ethanol (as described in
Subheading 3.2.6).
3. Measure cDNA concentration spectrophotometrically and
dilute according to the company’s requirements.

4 Notes

1. The pH of the P/C/I mixture used for the first RNA extraction
should be acidic (optimal pH 4.5–5) in order to denature DNA
that otherwise could possibly be present as a contamination.
At pH 7, RNA and DNA will be in the water phase. At pH 5,
DNA is partly denatured and will be directed to the organic
phase, while RNA remains in the water phase.
2. All solutions should be prepared in deionized water.
3. Store buffers at −20 °C if not otherwise mentioned.
4. T4 RNA ligase uses two RNA strands as substrate. Therefore,
the last three nucleotides at the 3′ end of the 5′ adaptor oligo-
nucleotide should be ribonucleotides to ensure efficient
ligation.
5. In order to increase the biological relevance of the starting
material and to avoid amplification of putative cellular degra-
dation products, isolation of ncRNA–protein complexes via
density gradients [13] or affinity purification [7] is highly
recommended.
148 Jennifer Gebetsberger et al.

6. Always clean the scalpel with ethanol after cutting out a gel
piece with the desired RNA before cutting out the next piece
to avoid RNA cross-contaminations. Note that the gel slices
should neither be squeezed into the reaction tube nor be
allowed to swim in the elution buffer.
7. Take care that no gel slice is taken along with the elution buffer.
8. If a second round of elution is desired, freeze the gel slices at
−20 °C before adding elution buffer. Freezing and thawing
will enhance the amount of eluted RNA.
9. Since the amount of precipitated RNA can be little, GlycoBlue
(Ambion) can be used as nucleic acid co-precipitant. This
increases the pellet visibility.
10. The CTP concentration depends on the amount and length of
size-separated RNA. In general 75 pmol of CTP per picomole
of RNA is recommended.
11. 1 U of TAP per picomole of RNA is recommended.
12. Spectroscopic determination of RNA concentration at this step
is not recommended due to the presence of unincorporated
CTP from the C-tailing step.
13. Barcodes can be introduced at the 3′ end of the 5′ adaptor.
Due to possible deep sequencing errors, a minimum of four
nucleotides is recommended.
14. Alternatively, specific primers for subsequent deep-sequencing
can be used. Since they should be compatible with the chosen
sequencing platform, contact the sequencing facility for optimal
primer design.
15. Consider that the size-range of the cDNA corresponds to the
length of size-selected RNA of Subheading 3.1 plus the length
of the 5′ and 3′ adaptors.
16. Here it is advantageous to use cells carrying a lacZ deletion
mutant (e.g., One Shot® TOP10 Electrocomp™ E. coli provided
by Invitrogen), facilitating rapid and convenient detection of
recombinant cells via blue white screening.
17. To skip the second PCR step, the use of appropriate deep-
sequencing adaptors at Subheading 3.2.5 is recommended.

Acknowledgement

This research was partly supported by the NCCR “RNA & Disease”
funded by the Swiss National Science Foundation. Additional grant
support derives from the Swiss National Science Foundation
(31003A_143388/1) and the Austrian Science Fund FWF (project
number: Y315) to N.P.
 cDNA Library of Small RNAs 149

References
1. Tuck AC, Tollervey D (2011) RNA in pieces. from ribosome-associated small RNAs by deep-
Trends Genet 27:422–432 sequencing data analysis. Nucleic Acids Res
2. Gebetsberger J, Polacek N (2013) Slicing 40:4013–4024
tRNAs to boost functional ncRNA diversity. 8. Pircher A, Gebetsberger J, Polacek N (2015)
RNA Biol 10:1798–1806 Ribosome-associated ncRNAs: An emerging
3. Madej MJ, Alfonzo JD, Huttenhofer A (2007) class of translation regulators. RNA Biol 11, in
Small ncRNA transcriptome analysis from press
kinetoplast mitochondria of Leishmania taren- 9. Huttenhofer A, Vogel J (2006) Experimental
tolae. Nucleic Acids Res 35:1544–1554 approaches to identify non-coding RNAs.
4. Lung B, Zemann A, Madej MJ, Schuelke M, Nucleic Acids Res 34:635–646
Techritz S, Ruf S, Bock R, Huttenhofer A 10. Erlacher MD, Chirkova A, Voegele P, Polacek
(2006) Identification of small non-coding N (2011) Generation of chemically engi-
RNAs from mitochondria and chloroplasts. neered ribosomes for atomic mutagenesis
Nucleic Acids Res 34:3842–3852 studies on protein biosynthesis. Nat Protoc 6:
5. Gebetsberger J, Zywicki M, Kunzi A, Polacek N 580–592
(2012) tRNA-derived fragments target the ribo- 11. Mattick JS, Makunin IV (2006) Non-coding
some and function as regulatory non-coding RNA. Human Mol Genet 15(Spec No 1):
RNA in Haloferax volcanii. Archaea 2012:260909 R17–29
6. Pircher A, Bakowska-Zywicka K, Schneider L, 12. Martin G, Keller W (1998) Tailing and 3’-end
Zywicki M, Polacek N (2014) An mRNA- labeling of RNA with yeast poly(A) polymerase
derived noncoding RNA targets and regulates and various nucleotides. RNA 4:226–230
the ribosome. Mol Cell 54:147–155 13. Rederstorff M, Huttenhofer A (2011) cDNA
7. Zywicki M, Bakowska-Zywicka K, Polacek N library generation from ribonucleoprotein par-
(2012) Revealing stable processing products ticles. Nat Protoc 6:166–174
 Chapter 14

CLIP-Seq to Discover Transcriptome-Wide Imprinting

of RNA Binding Proteins in Living Cells
Jérôme Saulière and Hervé Le Hir

Abstract
UV cross-linking and immunoprecipitation coupled to high-throughput sequencing (CLIP-seq) is used to
characterize RNA targets of RNA binding proteins (RBP) in a large scale manner. This powerful method
allows the stringent purification of direct RNA binding sites of RBPs in living cells. Here, we describe in
detail the protocol we employed to identify RNA targets of the human RNA helicase eIF4AIII.

Key words Ribonucleoproteins, Exon Junction Complex, Cross-linking and Immunoprecipitation

(CLIP), Illumina DNA library, High-throughput sequencing

1 Introduction

The cellular fate of mRNAs is dictated by the dynamic binding of

specific proteins that form messenger ribonucleoproteins (mRNPs)
[1, 2]. Within mRNPs, the multiprotein Exon Junction Complex
(EJC) is bound to spliced junctions of mRNAs [3, 4]. EJC is orga-
nized around a core complex constituted of four proteins, eIF4AIII,
MLN51, and the heterodimer Magoh/Y14 [5, 6]. This core com-
plex interacts with peripheral factors to communicate with differ-
ent cellular machineries. These interactions modulate the fate of
mRNAs during their journey from the nucleus to the cytoplasm.
EJC is thus involved in key steps of mRNA processing including
splicing, export, localization, translation, and decay [7–10].
To better understand the assembly and the different functions
of the EJC, it was important to identify all the EJC binding sites in
living cells. We recently performed CLIP-seq of the human RNA
helicase eIF4AIII, the factor that directly binds mRNA within the
EJC core [11]. CLIP strategy requires cross-linking of RNPs
in vivo by UV treatment [12, 13]. After cell lysis and RNAse treat-
ment, RNA/protein complexes are immunopurified, loaded on
denaturing PAGE and transferred to nitrocellulose membrane. This
step allows stringent purification by eliminating free contaminant

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_14, © Springer Science+Business Media New York 2015

151
152 Jérôme Saulière and Hervé Le Hir

RNAs that pass through the membrane and by retaining the

protein-associated RNAs. Moreover, UV irradiation forms cross-
linked RNA/protein adducts allowing stringent washing condi-
tions with high salt and chaotropic agent-containing buffers. This
method allows isolating RNA targets with high specificity but with
a very low efficiency. In this chapter, we detail the protocol that we
used to isolate RNA targets of eIF4AIII in human cells. This pro-
tocol is based on the original method described by Darnell and
colleagues in the past years [12–15].

2 Materials

For RNA experiments, you must wear gloves and work on ice. To
avoid RNA degradation, all the buffers are also ice-cold except for
running buffers or buffers used for enzymatic reactions.

2.1 Cell Culture 1. High glucose DMEM.

and UV Cross-Linking 2. Fetal Bovine Serum.
3. Penicillin/Streptomycin (100×).
4. Dulbecco’s PBS (DPBS) without Ca2+ and Mg2+.
5. UV cross-linker.
6. Tabletop centrifuge.

2.2 Conjugation 1. Protein A Dynabeads (Life Technologies).

of Antibodies 2. DynaMag-2 Magnet (Life Technologies).
to Magnetic Protein
3. BSA.
A Beads
4. NaPO4-N buffer: 0.1 M NaPO4, pH 8, 0.01 % NP40.

2.3 Cell Lysate 1. PXL lysis buffer: 1× DPBS, 0.1 % SDS, 0.5 % NP40, 0.5 %
Preparation sodium deoxycholate.
and RNAse Treatment 2. Protease inhibitor.
3. RQ1 RNase-free DNase (Promega).
4. RNasin (Promega).
5. RNase T1.
6. Thermomixer.

2.4 Immunopre- 1. RIPA-S buffer: 50 mM Tris–HCl, pH 7.5, 0.1 % SDS, 0.5 %

cipitation and NP40, 1 % sodium deoxycholate, 5 mM EDTA, 1 M NaCl,
Recovery of 2 M Urea.
Cross-Linked 2. PNK buffer: 50 mM Tris–HCl, pH 7.5, 0.5 % NP40, 5 mM
Ribonucleoproteins MgCl2.
3. T4 PNK enzyme and buffer B (Fermentas).
 CLIP-Seq 153

4. γ-P32 ATP (10 mCi/ml, 6,000 Ci/mmol).

5. Thermomixer.
6. NuPAGE LDS Sample Buffer 4× (Life Technologies).

2.5 SDS-PAGE 1. NuPAGE 4–12 % Bis-Tris gel (Life Technologies).

and Transfer of RNA/ 2. PageRuler Prestained Protein Ladder (Fermentas).
Protein Complexes
3. Xcell SureLock Mini System (Life Technologies).
onto Nitrocellulose
Membrane 4. MOPS SDS Running Buffer 20× (Life Technologies).
5. iBlot Gel Transfer Stacks Nitrocellulose Mini (Life
Technologies).
6. iBlot Gel Transfer Device (Life Technologies).
7. Typhoon FLA 9500 apparatus (GE Healthcare Life Sciences).

2.6 RNA Recovery 1. Proteinase K.

and Purification 2. Proteinase K buffer 1: 0.1 M Tris–HCl, pH 7.5, 10 mM
EDTA, 50 mM NaCl.
3. Proteinase K buffer 2: 0.1 M Tris–HCl, pH 7.5, 10 mM
EDTA, 50 mM NaCl, 7 M Urea.
4. Acid phenol–chloroform.
5. Tabletop centrifuge.
6. GlycoBlue 15 mg/ml (Life Technologies).
7. DEPC-treated water.

2.7 Illumina DNA 1. NEB Next Multiplex Small RNA Library Prep Set for Illumina
Library (NEB).
2. 10 % TBE gel.
3. TBE Running buffer.
4. SYBR Gold nucleic acid gel stain (Life Technologies).
5. Costar Spin-X column (Sigma).

3 Methods

The procedure below describes the purification of RNA targets to

the human RNA helicase eIF4AIII, the component of EJC core
that directly contacts RNA.

3.1 Cell Culture 1. Grow HeLa cells (37 °C, 5 % CO2) until complete confluence
and UV Cross-Linking in 15 cm dishes in DMEM supplemented with 10 % FBS and
100 U/ml penicillin and 100 μg/ml streptomycin.
2. Take off medium and add 4 ml of 1× DPBS.
3. Places dishes lid off on ice in a tray.
154 Jérôme Saulière and Hervé Le Hir

4. Irradiate cells with UV (UV-C, 254 nm, 400 mj/cm2).

5. Collect cells using a cell scraper, transfer them in a 15 ml
Falcon tube and centrifuge for 5 min at 600 × g at 4 °C. Take
off supernatant.
6. Store cell pellets at −80 °C until further use.

3.2 Conjugation To remove the supernatants/buffers, a magnetic tube holder is

of Antibodies used in the following steps.
to Magnetic Protein
1. Wash 40 μl of magnetic protein A with 400 μl NaPO4-N by
A Beads gentle pipetting up and down (see Note 1).
2. Add 15 μg of anti-eIF4AIII antibody in a final volume of
250 μl NaPO4-N (see Notes 2 and 3) to magnetic protein A
beads.
3. Rotate for 1 h at 4 °C.
4. Wash twice with 400 μl NaPO4-N supplemented with 100 μg/
ml BSA by gentle pipetting up and down (see Note 4).
5. Wash 3 times with 400 μl NaPO4-N.
6. Keep antibodies-conjugated beads in 100 μl NaPO4-N at 4 °C
not longer than overnight.

3.3 Cell Lysate 1. Resuspend UV-treated HeLa cells (1 × 15 cm dish pellet) in

Preparation 650 μl PXL lysis buffer supplemented with protease inhibitor
and RNAse Treatment (1:100), RQ1 DNase (1:50) and RNasin (1:200).
2. Thaw cell pellets on ice and break pellets by pipetting up and
down.
3. Add 2 U of RNAse T1 to cell lysate (see Note 5).
4. Incubate for 5 min at 37 °C at 800 rpm in a Thermomixer.
5. Transfer crude RNase-treated cell extract to a 15 ml Falcon
tube.
6. Add 4 volumes of PXL (2.6 ml) and centrifuge for 5 min at
3,000 × g at 4 °C (see Note 6).
7. Transfer the diluted lysate to a new 15 ml Falcon tube and
immediately proceed to immunoprecipitation of RNA/pro-
tein complexes.

3.4 Immunopre- 1. Discard NaPO4-N buffer from antibodies-conjugated beads

cipitation (Subheading 3.2, step 6).
and Recovery 2. Add the cell lysate (Subheading 3.3, step 7) to antibodies-
of Cross-Linked conjugated beads.
Ribonucleoproteins
3. Incubate overnight at 4 °C on a rotating wheel (see Note 7).
4. Resuspend the beads in 500 μl RIPA-S buffer and transfer to a
new 1.5 ml microtube (see Note 8).
 CLIP-Seq 155

5. Wash four times with 500 μl RIPA-S by gentle pipetting up

and down.
6. Wash twice with 500 μl PNK buffer by gentle pipetting up and
down.
7. Resuspend beads in 16.5 μl of PNK buffer and add 10 U of T4
PNK, 2 μl of 10× reaction buffer B and 0.5 μl γ-P32ATP.
8. Incubate for 15 min at 37 °C at 800 rpm in a Thermomixer.
9. Wash the beads three times with 500 μl RIPA-S.
10. Wash twice with 500 μl PNK buffer.
11. Elute RNA/protein complexes from beads with 12 μl
NuPAGE LDS 1× diluted in PNK buffer.
12. Incubate for 10 min at 75 °C at 1,000 rpm in a Thermomixer.
13. Short spin and recover the eluted RNA/protein complexes.
14. Load immediately or keep at −20 °C until further use.

3.5 SDS-PAGE 1. Denature RNA/protein complexes for 5 min at 75 °C before

and Transfer of RNA/ loading if they were frozen at −20 °C.
Protein Complexes 2. Load the samples (12 μl) on a 4–12 % gradient Novex NuPAGE
onto Nitrocellulose (see Note 9) in parallel with 3 μl of Protein Ladder.
Membrane
3. Run at 100 V in 1× MOPS buffer until blue dye reaches the
bottom of the gel (see Note 10).
4. Transfer RNA/protein complexes from the gel to a nitrocel-
lulose membrane using an iBlot apparatus with the program 2
set to 10 min (see Note 11).
5. Place the nitrocellulose membrane on a Whatman paper sheet
and wrap it in a plastic film.
6. Expose under a phosphor imager screen overnight at −20 °C.
7. Scan the screen with a Typhoon FLA 9500 apparatus.

3.6 RNA Recovery 1. Cut nitrocellulose membrane above the size of the free protein
and Purification to purify the small gel-shifted RNA with a clean scalpel
(see Note 12).
2. Chop it in tiny pieces (2–3 mm2) with a scalpel and place them
in a 1.5 ml microtube.
3. Add 200 μl of a preheated to 37 °C solution of proteinase K
(2 mg/ml in buffer 1).
4. Incubate for 30 min at 60 °C at 800 rpm.
5. Add 200 μl of a preheated to 37 °C solution of proteinase K
(2 mg/ml in buffer 2).
6. Incubate for 30 min at 60 °C at 800 rpm.
7. Short spin and cool down to room temperature.
156 Jérôme Saulière and Hervé Le Hir

8. Add 400 μl of acid phenol–chloroform and mix well by

vortexing at least for 1 min.
9. Centrifuge for 5 min at full speed at 4 °C in a tabletop
centrifuge.
10. Collect aqueous phase and precipitate RNA by adding 5 μg of
GlycoBlue, 0.3 M sodium acetate, pH 5.2 and 500 μl of 100 %
EtOH–isopropanol (1:1).
11. Store overnight at −20 °C.
12. Centrifuge for 30 min at full speed at 4 °C in a tabletop
centrifuge.
13. Wash twice the RNA pellet with 500 μl of 70 % EtOH.
14. Resuspend the pellet in 10 μl of DEPC-treated water.
15. Incubate for 10 min at 30 °C at 800 rpm.
16. Precipitate once again by adding 0.3 M sodium acetate and
500 μl of 100 % EtOH (see Note 13).
17. Keep for 2 h at −20 °C.
18. Centrifuge for 30 min at full speed at 4 °C.
19. Wash twice the RNA pellet with 500 μl of 70 % EtOH.
20. Resuspend the pellet in 20 μl of DEPC-treated water.
21. Incubate for 10 min at 30 °C at 800 rpm.
22. Concentrate by evaporation until the final volume reaches 6 μl.
23. Transfer to a 0.2 ml PCR tube and start the synthesis of the
Illumina DNA library.

3.7 Illumina DNA The synthesis of Illumina DNA libraries from small RNA is per-
Library formed with the NEBNext Multiplex Small RNA kit compatible
with Illumina high-throughput sequencing. We carefully follow
the manufacturer’s instructions. All the reactions are performed in
0.2 ml PCR tubes in a ThermoCycler.
1. Add 1 μl of 3′SR adaptor to the 6 μl small RNAs purified by
CLIP (see Note 14).
2. Incubate in a preheated ThermoCycler for 2 min at 70 °C. Chill
on ice.
3. Add 10 μl of 3′ Ligation Reaction Buffer and 3 μl of 3′ Ligation
Enzyme Mix. Total volume should be of 20 μl.
4. Incubate for 1 h at 25 °C.
5. Add 4.5 μl of Nuclease-free water and 1 μl of Multiplex SR RT
Primer.
6. Incubate for 5 min at 75 °C, 15 min at 37 °C and 15 min at
25 °C.
7. Denature 1 μl of 5′SR adaptor for 2 min at 70 °C in a pre-
heated ThermoCycler. Chill on ice.
 CLIP-Seq 157

8. Add the denatured 5′SR adaptor to the previous mixture, 1 μl

of 5′ Ligation reaction Buffer and 2.5 μl of Ligase Enzyme
Mix. Total volume should be of 30 μl.
9. Incubate for 1 h at 25 °C.
10. Add 8 μl of First Strand Synthesis Reaction Buffer, 1 μl Murine
RNase inhibitor and 1 μl of ProtoScript II Reverse Tran-
scriptase. Total volume should be 40 μl.
11. Incubate for 1 h at 50 °C.
12. Perform PCR amplification by adding 50 μl of LongAmp Taq
Master Mix, 2.5 μl of SR Primer, 2.5 μl of Index Primer and
5 μl of Nuclease-free water (see Note 15). Total volume should
be 100 μl.
13. Perform PCR as following: 1 cycle for 30 s at 94 °C, 16 cycles
for 15 s at 94 °C, 30 s at 62 °C, 15 s at 70 °C and finally 1
cycle for 5 min at 70 °C (see Note 16).
14. Precipitate PCR product by adding 1 μl of linear acrylamide,
0.3 M sodium acetate, and 350 μl of 100 % EtOH.
15. Keep for 2 h at −20 °C.
16. Centrifuge for 30 min at full speed at 4 °C.
17. Wash once with 750 μl of 70 % EtOH.
18. Resuspend DNA pellet in 20 μl of Nuclease-free water.
19. Incubate for 10 min at 30 °C at 1,000 rpm.
20. Add 10 μl of Gel loading dye.
21. Load 15 μl of DNA per lane (2 lanes) on a 10 % TBE gel in
parallel with 1 μl of Quick-Load pBR322 MspI-DNA Digest
Ladder.
22. Run for 90 min at 120 V until blue dye reaches the bottom of
the gel and 20 min at 150 V in 1× TBE Running Buffer.
23. Stain the gel for 5 min with SYBR Gold nucleic acid gel stain.
24. Visualize PCR products using a UV transilluminator.
25. Cut the acrylamide gel around the smear, from 145 to 185 bp
roughly (see Note 17) (Fig. 1).
26. Transfer the acrylamide piece in a perforated 0.5 ml tube
placed in a 2 ml microtube and spin in a tabletop centrifuge
(see Note 18).
27. Add 200 μl of elution buffer and mix overnight at 1,000 rpm
at 30 °C.
28. Pass through a SpinX column by centrifugation for 5 min at
10,000 × g at room temperature to recover the purified PCR
product.
29. Precipitate by adding 1 μl of linear acrylamide, 0.3 M sodium
acetate, and 750 μl of 100 % EtOH.
158 Jérôme Saulière and Hervé Le Hir

Synth RNA Sample 1 Sample 2

(bp)
190
160 Illumina DNA library
147
123 adaptors dimer

PCR primers

Fig. 1 Illumina DNA library on 10 % PAGE. Synth. RNA: DNA library prepared with a synthetic RNA of 40 nt
serving as a positive control (see Note 14). Samples 1 and 2: biological small RNA purified from the CLIP
experiment of eIF4AIII were used for the Illumina DNA library synthesis. Rectangles indicate the portion of the
gel from which PCR products were extracted and purified

30. Keep for 1 h at −20 °C.

31. Centrifuge for 20 min at full speed at 4 °C.
32. Wash with 750 μl of 70 % EtOH.
33. Air-dry pellet and resuspend in 12 μl of TE buffer.
34. Incubate for 10 min at 30 °C at 1,000 rpm (see Note 19).

4 Notes

1. Magnetic protein G beads can be used instead of protein

A. Change it according to the IgG isotypes of the antibodies.
Magnetic protein G can also decrease the radioactive back-
ground/signal ratio on the nitrocellulose membrane and can
increase the immunoprecipitation (IP) efficiency.
2. The amount of antibody must be adapted for each targeted
protein. Therefore, it is important to perform an immunode-
pletion assay before the CLIP to determine the optimum
amount of antibody needed for the complete depletion of
your RBP of interest from the cell lysate.
3. The volume needed to take x μg of antibody (in our case
15 μg) is different for each antibody. Adjust the volume of
NaPO4-N used to get a final volume of 250 μl.
4. Addition of BSA allows pre-blocking of Dynabeads to reduce
the capture of unspecific biological material.
 CLIP-Seq 159

5. The amount of RNase T1 must be optimized for the RBP of

interest. To do so, several quantities of the RNAse should be
tested to determine when radioactive gel shift is observed.
Generally, increasing amount of RNAse leads to collapsing of
the radioactive signal near the size of the free protein. The best
conditions are the one where shifted protein/RNA complexes
are observed. Other RNases can be used alternatively (RNase
I, RNase A, MNase).
6. This dilution step is done to further decrease the radioactive
background on the nitrocellulose membrane. Generally, it
does not affect the IP efficiency. Centrifugation allows clearing
the supernatant by pelleting cell debris.
7. This step allows IP of RNA/protein complexes of interest.
The time of IP can be shorter. It has to be optimized for each
RBP studied.
8. The transfer to a new tube serves to eliminate unspecific mol-
ecules bound to the tube wall. This decreases the radioactive
background on the nitrocellulose membrane.
9. The use of Novex NuPAGE is mandatory to keep a constant
pH during migration to avoid alkaline degradation of the
RNAs during the run.
10. This protocol is used for eIF4AIII (molecular weight = 45 kDa)
but the running time must be adapted according to the size of
the targeted protein. Indeed, it is easier to visualize RNA/
protein complexes if they are in the middle of the polyacryl-
amide gel (i.e., for big proteins the running time is longer,
while for small proteins the running time is shorter).
11. The program and the time of transfer can be adapted for the
RBP of interest. We found that the quality of the nitrocellu-
lose membrane and the transfer buffer are really heteroge-
neous after the expiration date. In consequence, we really
avoid using expired materials.
12. We cut the nitrocellulose membrane to get 20–60 nt long
RNAs. Therefore, cutting the membrane 5–10 to 20 kDa
above the size of the free protein should theoretically allow
isolation of RNA fragments of this size range.
13. This second precipitation step is done to eliminate traces of
phenol that can interfere with subsequent ligation steps dur-
ing the synthesis of the Illumina DNA library.
14. Generally, in parallel to the synthesis of the Illumina DNA
library from small RNA purified from the CLIP experiment,
we also generate a library with 1 ng of a synthetic RNA
(NNNNNNGAUGUUAUGCGACCGACAACCAUUG
UUANNNNNN), which serves as a positive control and a size
marker (Fig. 1).
160 Jérôme Saulière and Hervé Le Hir

15. Index Primers allow the multiplexing of samples during

sequencing. Use one index primer per PCR product. High-
throughput sequencing was performed on an Illumina
HiSeq1000 apparatus in our case.
16. The number of PCR cycles can be adjusted if clear and distinct
bands are not observed in the gel. Decreasing the number of
PCR cycles (12–15 cycles) can also decrease the number of
PCR duplicates.
17. Theoretically, this size corresponds to about 20–60 nt long
inserts given that the size of the adaptor dimer without insert
is of 125 nt.
18. This step allows crushing acrylamide gel into tiny pieces in
order to increase elution efficiency.
19. PCR products are ready for Illumina high-throughput sequenc-
ing. Keep the PCR product at −20 °C until further use.

References
1. Lee SR, Lykke-Andersen J (2013) Emerging eIF3 and activates translation. Proc Natl Acad
roles for ribonucleoprotein modification and Sci U S A 110:5903–5908
remodeling in controlling RNA fate. Trends 9. Le Hir H, Gatfield D, Izaurralde E, Moore MJ
Cell Biol 23:504–510 (2001) The exon-exon junction complex pro-
2. Moore MJ, Proudfoot NJ (2009) Pre-mRNA vides a binding platform for factors involved in
processing reaches back to transcription and mRNA export and nonsense-mediated mRNA
ahead to translation. Cell 136:688–700 decay. EMBO J 20:4987–4997
3. Le Hir H, Izaurralde E, Maquat LE, Moore 10. Roignant JY, Treisman JE (2010) Exon junc-
MJ (2000) The spliceosome deposits multiple tion complex subunits are required to splice
proteins 20-24 nucleotides upstream of mRNA Drosophila MAP kinase, a large heterochro-
exon-exon junctions. EMBO J 19:6860–6869 matic gene. Cell 143:238–250
4. Tange TO, Nott A, Moore MJ (2004) The 11. Sauliere J, Murigneux V, Wang Z, Marquenet
ever-increasing complexities of the exon junc- E, Barbosa I, Le Tonqueze O, Audic Y, Paillard
tion complex. Curr Opin Cell Biol L, Roest Crollius H, Le Hir H (2012) CLIP-
16:279–284 seq of eIF4AIII reveals transcriptome-wide
5. Andersen CB, Ballut L, Johansen JS, Chamieh mapping of the human exon junction com-
H, Nielsen KH, Oliveira CL, Pedersen JS, plex. Nat Struct Mol Biol 19:1124–1131
Seraphin B, Le Hir H, Andersen GR (2006) 12. Ule J, Jensen K, Mele A, Darnell RB (2005)
Structure of the exon junction core complex CLIP: a method for identifying protein-RNA
with a trapped DEAD-box ATPase bound to interaction sites in living cells. Methods
RNA. Science 313:1968–1972 37:376–386
6. Le Hir H, Andersen GR (2008) Structural 13. Ule J, Jensen KB, Ruggiu M, Mele A, Ule A,
insights into the exon junction complex. Curr Darnell RB (2003) CLIP identifies Nova-
Opin Struct Biol 18:112–119 regulated RNA networks in the brain. Science
7. Ashton-Beaucage D, Udell CM, Lavoie H, 302:1212–1215
Baril C, Lefrancois M, Chagnon P, Gendron P, 14. Darnell RB (2010) HITS-CLIP: panoramic
Caron-Lizotte O, Bonneil E, Thibault P, views of protein-RNA regulation in living cells.
Therrien M (2010) The exon junction com- Wiley Interdiscip Rev RNA 1:266–286
plex controls the splicing of MAPK and other 15. Licatalosi DD, Mele A, Fak JJ, Ule J, Kayikci
long intron-containing transcripts in M, Chi SW, Clark TA, Schweitzer AC, Blume
Drosophila. Cell 143:251–262 JE, Wang X, Darnell JC, Darnell RB (2008)
8. Chazal PE, Daguenet E, Wendling C, Ulryck HITS-CLIP yields genome-wide insights into
N, Tomasetto C, Sargueil B, Le Hir H (2013) brain alternative RNA processing. Nature
EJC core component MLN51 interacts with 456:464–469
 Chapter 15

Microarray Analysis of Small Non-Coding RNAs

Michael Karbiener and Marcel Scheideler

Abstract
Microarray technology has evolved to efficiently profile the expression of RNAs. However, analysis of small
non-coding RNAs (ncRNAs) is challenging due to their short length and highly divergent sequences with
large variation in GC content leading to very different hybridization properties. To overcome these chal-
lenges, LNA-modified oligonucleotides have been used to enhance and normalize the melting tempera-
ture (Tm) of capture probes, which allows sensitive profiling of small ncRNAs regardless of their sequence.
Here, we describe the isolation and labeling of small non-coding RNAs, as well as their hybridization to
microarrays with LNA-modified oligonucleotide probes using a semi-automated hybridization device.

Key words Small non-coding RNA, microRNA, Microarray, LNA, RNA isolation, Labeling,
Hybridization

1 Introduction

The discovery of microRNAs and the growing appreciation of

their importance in the regulation of gene expression in biological
processes and human disease are driving increasing interest in the
study of their expression profiles. However, several factors such as
the small size of microRNAs and their varying GC content make
the evaluation of their expression tricky [1]. Here we describe a
microarray-based protocol to study small RNAs, comprising RNA
extraction using TRIzol reagent, a two-steps labeling of the RNAs
and a two samples hybridization procedure on an LNA microarray.
Each sample is labeled with its own fluorophore in order to allow
normalization and comparison of spot intensities within a single
microarray. This kind of microRNA profiling protocol has been
used in numerous studies in molecular biomedicine [2–8].

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_15, © Springer Science+Business Media New York 2015

161
162 Michael Karbiener and Marcel Scheideler

2 Materials

2.1 RNA Isolation 1. Fume cupboard.

2. Centrifuge and rotor capable of reaching up to 12,000 × g.
3. Water bath or heat block (55–60 °C).
4. TRIzol reagent (Life Technologies).
5. Chloroform ultrapure.
6. Isopropyl alcohol.
7. 75 % ethanol (mixed with RNase-free water).
8. RNase-free water or 0.5 % SDS.
9. RNase-free pipette tips.
10. Polypropylene microcentrifuge tubes.

2.2 MicroRNA 1. Thermocycler.

Labeling 2. miRCURY LNA microRNA Hi-Power Labeling Kit (Exiqon).
3. Dimethylsulfoxide (DMSO).
4. Polymerase Chain Reaction (PCR) tubes (0.2 ml, RNase free).
5. RNase-free pipette tips.

2.3 Microarray 1. Heat block (50 °C).

Hybridization 2. Hybridization station Tecan HS400.
3. Hybridization chambers (20 × 57 mm) for a hybridization vol-
ume of 90 μl.
4. 4 × 1,000 ml screw cap bottles per Tecan HS400 station
module.
5. Nitrogen high-pressure bottle (including tubes and valves to
adjust pressure).
6. MicroRNA microarray based on epoxy coated glass slides.
7. Pressurized air duster or clean in-house pressurized air source.
8. Ultrasonic bath.
9. miRCURY LNA Array, 2× hybridization buffer (Exiqon). To
prepare 1× hybridization buffer, dilute in RNAse free water.
Preheat at 50 °C.
10. 20× Saline Sodium Citrate (SSC): 3 M NaCl, 300 mM triso-
dium citrate, pH 7.0 (HCl).
11. 1 l 0.22 μm cellulose acetate filter system.
12. Prehybridization buffer: 5× SSC, 0.1 % SDS, 1 % BSA. Preheat
at 50 °C.
13. Wash buffer I: 2× SSC, 0.2 % SDS. Preheat in the hybridiza-
tion station.
 Microarray Analysis of Small Non-Coding RNAs 163

14. Wash buffer II: 1× SSC.

15. Wash buffer III: 0.2× SSC.
16. Wash buffer X: 0.2 % SDS. Preheat in the hybridization station
(see Note 1).

3 Methods

Always use the appropriate precautions to avoid RNase contamina-

tion when preparing and handling RNA.

3.1 RNA Isolation A crucial step in microarray analysis of small ncRNAs is the RNA
isolation. Although a number of convenient membrane/column-
based RNA preparation kits are currently available from several man-
ufacturers, it should be stressed that most of these systems come
along with a loss of RNAs smaller than 100 bp in length. Thus,
checking the compatibility of a particular product with small RNA
analysis is of fundamental importance. In contrast to membrane/
column-based RNA isolation approaches, procedures that include
an acidic phenol chloroform extraction are generally recognized to
preserve small RNAs. In particular, TRIzol reagent is a monophasic
solution of phenol and guanidine isothiocyanate that allows isolation
of most RNA species, regardless of molecular size [9, 10]. Thus, as
phenol/chloroform extraction requires only a little more hands-on
time than membrane/column-based systems, while being more
cost-effective, our workflow for microarray analysis of ncRNAs com-
prises RNA extraction using TRIzol reagent (Fig. 1).

3.1.1 Sample Harvesting 1. Homogenize and lyse biological material in TRIzol reagent
and RNA Extraction [11]. For tissue samples, use 1 ml TRIzol reagent per
50–100 mg of tissue (see Note 2). For adherent cells grown in
monolayer cell culture, use 1 ml TRIzol reagent per 10 cm2 of
culture area. For suspension cells grown in cell culture, use
1 ml TRIzol reagent per 5–10 × 106 cells.
2. Transfer the lysates to appropriate tubes (see Note 3).
3. Incubate the lysates at room temperature for at least 5 min,
which enables a complete dissociation of nucleoprotein
complexes.
4. Add 0.2 ml chloroform per ml of TRIzol reagent used. Cap
and vigorously shake the tubes by hand for at least 15 s to
allow RNA extraction into the aqueous phase.
5. Incubate the samples at room temperature for 3 min.
6. Centrifuge the samples at 12,000 × g at 4 °C for 15 min to
separate the organic phase from the aqueous phase.
7. Pipet the upper, colorless, aqueous phase into a fresh tube
(see Note 4).
164 Michael Karbiener and Marcel Scheideler

Fig. 1 Overview of the microarray analysis workflow

3.1.2 RNA Precipitation 1. Add 0.5 ml of 100 % isopropanol to the aqueous phase per ml
of TRIzol reagent used for homogenization. Shortly vortex
tubes to mix (see Note 5).
2. Incubate at room temperature for 10 min to allow RNA to
precipitate.
3. Centrifuge samples at 12,000 × g at 4 °C for 10 min
(see Note 6).
 Microarray Analysis of Small Non-Coding RNAs 165

3.1.3 RNA Wash 1. Remove the supernatant from the tube, leaving only the RNA
pellet.
2. Wash the pellet with 1 ml of 75 % ethanol per ml of TRIzol
reagent used in the initial homogenization (see Note 7).
3. Centrifuge the tube at 7,500 × g for 5 min at 4 °C. Discard the
wash.
4. Vacuum or air-dry the RNA pellet for 5–10 min. Do not dry
the pellet by vacuum centrifuge (see Note 8).

3.1.4 RNA Resuspension 1. Resuspend the RNA pellet in RNase-free water (20–50 μl) by
passing the solution up and down several times through a
pipette tip.
2. Incubate in a water bath or heat block set at 55–60 °C for
10–15 min to completely dissolve the RNA.
3. Determine the concentration of each RNA sample. For subse-
quent analysis, prepare 0.25–1 μg total RNA in 3 μl (see Notes
9 and 10).

3.2 MicroRNA The Exiqon miRCURY LNA microRNA Hi-Power labeling kit
Labeling allows labeling of small to medium-sized RNA molecules with a
single fluorophore per molecule in a two-step process which does
not require any enrichment for small RNAs. The first step includes
a Calf Intestinal Alkaline Phosphatase step to remove 5′-phos-
phates of microRNAs. In the second step, a fluorescent label is
attached to the 3′-end of the small RNAs in the total RNA sample.
This is followed by an enzyme inactivation after which the sample
is ready for hybridization.
1. Place all kit components except enzymes on ice and thaw for
15–20 min [12].
2. Mix thoroughly by vortexing followed by brief centrifugation.
Do not thaw or vortex the enzyme. For enzymes, flick the
tubes and centrifuge briefly.
3. Combine following reagents in an RNAse-free microcentri-
fuge tube: 3 μl total RNA (as prepared in Subheading 3.1.4),
1 μl spike-in miRNA kit v2, 0.5 μl CIP buffer, 0.5 μl CIP
enzyme.
4. Mix thoroughly by pipetting up and down to ensure that all
reagents are mixed (see Note 11).
5. Incubate for 30 min at 37 °C, using a PCR cycler with heated
lid.
6. Stop the enzyme reaction and denature the RNA by incuba-
tion at 95 °C for 5 min followed by snap cooling on ice.
7. Leave the reaction on ice for at least 2 min and up to 15 min.
Briefly spin the tube after incubation on ice.
166 Michael Karbiener and Marcel Scheideler

8. Dissolve Cy5 and Cy3 fluorophores by adding 29 μl of

nuclease-free water to each lyophilized dye. Always protect
fluorophores from light.
9. Pipet up and down several times and incubate on ice for
30 min. Subsequently, vortex and spin down tubes. Dye solu-
tions may either be used immediately or stored at −70 °C for
several months (see Note 12).
10. Combine following components in a microtube: 5 μl CIP reac-
tion from step 5 (see Note 11), 3 μl Hi-Power labeling buffer,
1.5 μl fluorescent label, 2 μl DMSO, 1 μl Hi-Power labeling
enzyme.
11. Mix by gentle vortexing or pipetting up and down to ensure
that all reagents are mixed thoroughly.
12. Incubate at 16 °C for 2 h, using a PCR cycler with heated lid.
Protect the reaction from light.
13. Stop the reaction by incubation at 65 °C for 15 min. After
stopping the labeling procedure, briefly spin the reaction and
leave it at 4 °C. Labeled samples are now ready for hybridiza-
tion on the microarray. Hybridization should preferably occur
within the next 1–2 h.

3.3 Microarray The labeled samples can be hybridized on a microRNA chip spot-
Hybridization ted with locked nucleic acid (LNA)-modified oligonucleotides
with normalized melting temperature and GC content. LNA resi-
3.3.1 Hybridization
dues feature a bicyclic furanose unit locked in an RNA-mimicking
Station Preparation
sugar conformation [13]. This conformational restriction enables
unprecedented hybridization affinity for complementary single-
stranded RNA molecules, which makes LNA-modified oligonucle-
otides ideal for analysis and targeting of microRNAs [14].
1. Switch on the TECAN hybridization station.
2. Start the HS control manager software for the TECAN hybrid-
ization station.
3. Connect the hybridization station with the HS control man-
ager software by clicking on the plug button in the software.
4. Empty the waste bottles (usually big bottles behind the hybrid-
ization station).
5. Connect the high-pressure gas cylinder filled with nitrogen to
the hybridization station in order to fill the pipes of the hybrid-
ization station with pressure. Open the valve next to the bottle
first (totally) and then adjust the pressure at the second valve
to approximately 2.8–2.9 bar (see Note 13).
6. Slowly and carefully open the hybridization chambers of the
TECAN station.
 Microarray Analysis of Small Non-Coding RNAs 167

7. Check the seals and the hybridization chambers. If the seal is

not appropriately located in the holder, correct it. If the holder
is not in the correct position, correct it. In case of older (not
fragile) seals you can soak the whole block (with seal) in MilliQ
water for 1 or 2 days to refresh seal tightness.
8. Clean and dry the hybridization chambers and the slide holder
with compressed air.
9. Insert dummy slides in every hybridization chamber.
10. Make sure that each slide is appropriately fixed in the slide
holder.
11. Carefully close the lid of the TECAN station in order to close
the hybridization chambers.
12. Rinse the TECAN hybridization station. Take about 1.2 l of
MilliQ water for the station and supply all channels. Start the
rinse process by pressing the “R” button and enable “system
drying” (check box in the software).
13. Hybridization protocol should be as follows: wash at 23 °C for
1 min (channel 1, 1 run), inject probe (prehybridization) at
39 °C, hybridize at 39 °C for 20 min with high agitation, wash
at 39 °C for 1 min (channel 2, 1 run), inject probe (sample
hybridization) at 64 °C for 16 h with medium agitation, wash
at 64 °C for 1 min (channel 2, 2 runs) and 1 min soak time,
wash at 23 °C for 1 min (channel 5, 2 runs) and 1 min soak
time, wash at 23 °C for 1 min (channel 6, 2 runs) and 1 min
soak time, wash at 23 °C for 30 s (channel 6, 2 runs) and 30 s
soak time, dry the slide at 30 °C for 5 min.
14. Place wash buffers 1 and X on the hotplate of the Tecan sta-
tion and prewarm the buffers by switching the heating on
(see Note 14).
15. Verify that the wash buffers are connected to the appropriate
liquid channels by comparison with the written hybridization
program. Select “ddH2O” for unused channels.

3.3.2 Microarray 1. Prime the TECAN hybridization station and follow the HS
Prehybridization control manager instructions. Prime the first reagent used in
the loaded protocol (see step 13).
2. Insert the microarrays in the hybridization chambers you will
use. Note the barcodes, the used chamber position, and the
used TECAN hybridization station (in case several stations are
available).
3. Place a dummy slide in all unused hybridization chambers.
4. Mark all used hybridization chambers in the software
(see Note 15).
168 Michael Karbiener and Marcel Scheideler

5. Start the uploaded hybridization protocol (*.hpr) with the

“GO” button at the same time you start the microRNA
labeling final step (Subheading 3.2, step 13).
6. Centrifuge the preheated prehybridization buffer
(see Subheading 3.3.1, step 14).
7. Wait for the software to request “SAMPLE INJECTION” and
follow the software instructions.
8. Use reversed pipetting (see Note 16) for the injection of 90 μl
preheated prehybridization buffer per slide (see Note 17).

3.3.3 Microarray After the last step of the microRNA labeling protocol
Hybridization (Subheading 3.2, step 13), samples are ready for hybridization.
These samples will be requested for the second sample injection
step in the hybridization protocol (Subheading 3.3.1, step 13)
(see Note 18).
1. Combine the two labeling reactions by pipetting Cy3 into Cy5
labeling reaction (see Note 19).
2. Flush the empty tube (red labeled sample) with 25 μl of 2×
preheated hybridization buffer (50 °C).
3. Add the flushing buffer to the collecting tube. The combined
labeling reaction should have a volume of 45–50 μl.
4. Wait for the software request “SAMPLE INJECTION” and
follow the software instructions.
5. Incubate the ready-for-hybridization labeled sample for 3 min
at 90 °C for denaturation.
6. Centrifuge the ready-for-hybridization labeled sample for
1 min at 6,000 × g and constantly protect it from light.
7. Open the first closure for injection.
8. Inject 50 μl of 1× preheated hybridization buffer (50 °C) using
reversed pipetting.
9. Inject 45 μl of the ready-for-hybridization labeled sample.
Take care not to inject any air bubbles (see Note 20).
10. Inject 10 μl of 1× preheated hybridization buffer (50 °C) using
reversed pipetting.
11. Confirm software requests and repeat the injection for all
chambers.
12. After 16 h hybridization, carefully open the hybridization
chambers and take out the hybridized microRNA chips, which
are ready for scanning. Protect microarrays from light and
store at room temperature.

3.3.4 Hybridization 1. Clean the hybridization chambers and the slide holder with
Station Cleaning compressed air.
2. Insert dummy slides in all chamber positions.
 Microarray Analysis of Small Non-Coding RNAs 169

3. Make sure that all slides are appropriately fixed in the slide
holder.
4. Carefully close the lid of the hybridization station in order to
close the hybridization chambers.
5. Set the “RINSE” protocol to “DRYING BEFORE
FINISHING”.
6. Rinse the hybridization station and follow the HS control
manager instructions.
7. Proceed with the next hybridization or switch the device off.

4 Notes

1. Buffers should be stored at room temperature to avoid SDS or

salts to precipitate. Sonicate the wash buffers for approximately
10 min and make sure that the buffers are clear (not contami-
nated) and without flakes. Control the buffers in terms of vol-
ume. You will need about 100 ml wash buffers per slide but be
aware of fluid levels and dead volumes in the TECAN hybrid-
ization station to consume some additional buffer during the
whole hybridization (16 h).
2. When the starting material contains high amounts of fat, pro-
teins, polysaccharides, or extracellular material (e.g., adipose
tissue or muscle tissue), centrifuge TRIzol lysates at 12,000 × g
for 10 min at 4 °C. This results in a pellet containing extracel-
lular membranes, polysaccharides, and high molecular weight
DNA. In the case of adipose tissue, an additional lipid phase
occurs on top of the TRIzol phase. Carefully transfer the
TRIzol phase into a fresh tube and proceed with chloroform
extraction.
3. Biological samples may be stored in TRIzol reagent for months to
years at −20 to −80 °C before proceeding with RNA extraction.
4. Be careful when pipetting the aqueous phase (containing
RNA) into a fresh tube. Even small contaminations with inter-
phase or organic phase (containing DNA and proteins) might
result in insufficient RNA quality or cause problems in down-
stream applications (e.g., estimation of RNA concentration or
RNA labeling).
5. When precipitating RNA from small sample quantities (<106
cells or <10 mg tissue), add 5–10 μg RNase-free glycogen as a
carrier to the aqueous phase.
6. The RNA is often invisible prior to centrifugation and forms a
gel-like pellet on the side and bottom of the tube.
7. The RNA can be stored in 75 % ethanol at least for 1 year at
−20 °C or at least for 1 week at 4 °C.
170 Michael Karbiener and Marcel Scheideler

8. Do not allow the RNA to dry completely to facilitate subse-

quent dissolution. Partially dissolved RNA samples have an
A260/280 ratio <1.6. If the RNA pellet is surrounded by a small
volume of ethanol, it is also possible to remove the ethanol by
careful pipetting or capillarity with a small pipette tip.
9. If RNA concentration is insufficient to prepare 0.25–1 μg in
3 μl, RNA samples may be concentrated using a vacuum con-
centrator. If RNA samples have been dried completely, incuba-
tion at 60 °C for 15 min is recommended to redissolve RNA
before proceeding with subsequent steps. In order to minimize
labeling variations between samples it is recommended to pre-
pare a master mix for the CIP reaction.
10. Optionally, RNA samples may also be stored at −70 °C for
months to years.
11. In order to minimize labeling variations between samples it is
recommended to prepare a master mix for the labeling reaction.
12. Avoid repeated freeze–thaw cycles.
13. Keep in mind that pressure cannot be decreased; hence slowly
increase pressure in order not to go beyond the requested
value.
14. It takes about 15 min to heat the buffer bottles on the TECAN
hybridization station.
15. Only those hybridization chambers that are marked in the soft-
ware will be used for the hybridization and washing procedures.
16. Reversed pipetting means setting the pipette to 90 μl and press
the pipette beyond the pressure point to suck into the pipette
a little more than 90 μl. Hence, during the injection, the 90 μl
should be injected without any final air bubbles.
17. At this step, sample corresponds to preheated prehybridization
buffer to prime the slides.
18. The procedure described here for the preparation of the
hybridization of the labeled microRNA samples corresponds
to a two-color hybridization.
19. The Cy5 label is less stable than the Cy3 label and therefore
usually of weaker intensity on the microarray.
20. You can use reversed pipetting but pay particular attention as
the sample volume is little.

Acknowledgments

This work was supported by the GEN-AU project “non-coding

RNAs” (no. 820982), the Austrian Science Fund (FWF,
P25729-B19), and by the EU FP7 project DIABAT (HEALTH-
F2-2011-278373).
 Microarray Analysis of Small Non-Coding RNAs 171

References
1. Davison TS, Johnson CD, Andruss BF (2006) MicroRNA-26 family is required for human
Analyzing micro-RNA expression using micro- adipogenesis and drives characteristics of brown
arrays. Methods Enzymol 411:14–34 adipocytes. Stem Cells 32(6):1578–1590
2. Castoldi M, Benes V, Hentze MW, 8. Pichler M, Ress AL, Winter E, Stiegelbauer V,
Muckenthaler MU (2007) miChip: a microar- Karbiener M, Schwarzenbacher D et al (2014)
ray platform for expression profiling of microR- MiR-200a regulates epithelial to mesenchymal
NAs based on locked nucleic acid (LNA) transition-related gene expression and deter-
oligonucleotide capture probes. Methods mines prognosis in colorectal cancer patients.
43(2):146–152 Br J Cancer 110(6):1614–1621
3. Karbiener M, Fischer C, Nowitsch S, Opriessnig 9. Chomczynski P, Sacchi N (1987) Single-step
P, Papak C, Ailhaud G et al (2009) microRNA method of RNA isolation by acid guanidinium
miR-27b impairs human adipocyte differentia- thiocyanate-phenol-chloroform extraction.
tion and targets PPARgamma. Biochem Anal Biochem 162(1):156–159
Biophys Res Commun 390(2):247–251 10. Chomczynski P (1993) A reagent for the
4. Eduati F, di Camillo B, Karbiener M, Scheideler single-step simultaneous isolation of RNA,
M, Corà D, Caselle M et al (2012) Dynamic DNA and proteins from cell and tissue samples.
modeling of miRNA-mediated feed-forward Biotechniques 15(3):532–534, 536–537
loops. J Comput Biol 19(2):188–199 11. TRIzol Reagent Manual [Internet]. http://
5. Bach D, Fuereder J, Karbiener M, Scheideler tools.lifetechnologies.com/content/sfs/man-
M, Ress AL, Neureiter D et al (2013) uals/trizol_reagent.pdf
Comprehensive analysis of alterations in the 12. miRCURY LNA microRNA Array Hi-Power
miRNome in response to photodynamic treat- Labeling Kit [Internet]. http://www.exiqon.
ment. J Photochem Photobiol B 120:74–81 com/ls/Documents/Scientific/Hi-Power-
6. Karbiener M, Neuhold C, Opriessnig P, Labeling-kit-manual.pdf
Prokesch A, Bogner-Strauss JG (2011) 13. Vester B, Wengel J (2004) LNA (locked nucleic
MicroRNA-30c promotes human adipocyte acid): high-affinity targeting of complementary
differentiation and co-represses PAI-1 and RNA and DNA. Biochemistry (Mosc)
ALK2. RNA Biol [Internet] 8(5). http:// 43(42):13233–13241
www.es.landesbioscience.com/journals/rnabi- 14. Kauppinen S, Vester B, Wengel J (2006)
ology/article/16153/. Accessed 20 Jul 2011 Locked nucleic acid: high-affinity targeting of
7. Karbiener M, Pisani DF, Frontini A, Oberreiter complementary RNA for RNomics. Handb
LM, Lang E, Vegiopoulos A, et al (2014) Exp Pharmacol 173:405–422
 Part IV

Small Non-Coding RNAs Applications

 Chapter 16

RLM-RACE, PPM-RACE, and qRT-PCR: An Integrated

Strategy to Accurately Validate miRNA Target Genes
Chen Wang and Jinggui Fang

Abstract
MicroRNAs (miRNAs) are important regulators involved in most biological processes in eukarya. They
play critical roles in growth, development, signal transduction, or stress response by controlling gene
expression at the posttranscriptional level. Identification and characterization of miRNA-targeted mRNAs
is essential for the analysis of miRNA functions. In plants, the perfect complementarity between most
miRNAs and their targets enables the accurate predictions of their targets, while slicing of the targeted
mRNAs facilitates target validation through RNA Ligase-Mediated (RLM)-Rapid Amplification of cDNA
Ends (RACE) method. However, this method only determines the 5′-end of the cleavage product. To
more accurately validate the predicted target genes of miRNAs and exactly determine the cleavage sites
within the targets, an integrated strategy comprising RLM-RACE, Poly(A) Polymerase-Mediated (PPM)-
RACE, and qRT-PCR was developed. The efficiency of this method is illustrated by the precise sequence
validation of predicted target mRNAs of miRNAs in grapevine, citrus, peach, and other fruit crops. Our
on-going research indicates that RLM-RACE, PPM-RACE, and qRT-PCR are very effective in the verifi-
cation of sequences of miRNA targets obtained by Degradome sequencing. The protocol for RLM-RACE,
PPM-RACE, and qRT-PCR is rapid, effective, cheap, and can be completed within 2–3 days.

Key words miRNA, Target gene, RLM-RACE, PPM-RACE, qRT-PCR

1 Introduction

MicroRNAs (miRNAs) are a class of 19–24 nucleotides (nt) long

small non-coding RNAs, which play very important regulatory
roles in posttranscriptional gene expression. MiRNAs mediate tar-
get mRNAs cleavage or translational repression in most eukaryotes
[1–5]. An increasing number of studies confirmed that plant miR-
NAs controlled plant growth processes such as leaves morphogen-
esis and polarity [6–9], floral differentiation [10], boundary
formation, organ separation [11, 12], hormone (e.g. auxin) signal-
ing [13], biotic and abiotic stress response [14–17], and miRNA
biogenesis [18] by negatively regulating the expression of the cor-
responding target genes [2, 19]. Consequently, identification and

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_16, © Springer Science+Business Media New York 2015

175
176 Chen Wang and Jinggui Fang

characterization of target mRNAs of different miRNAs in plants is

essential for the analysis of miRNAs functions.
Currently, approaches for validation of plant miRNA targets
mainly include bioinformatics predictions, qRT-PCR, northern
blotting, luciferase reporter assays, 5′-rapid amplification of cDNA
ends (5′-RACE) [20], Degradome Sequencing [21, 22] or Parallel
Analysis of RNA Ends (PARE) [23]. The power and validity of
bioinformatics prediction methods can to some extent be hindered
by the simplified rules used to represent miRNA/targets interac-
tions. Some predictions may thus be wrong while genuine ones
might be missed [24]. On the other hand, experimental approaches
used to validate target genes, such as qRT-PCR, luciferase reporter
assays, or northern blotting fail distinguishing direct versus sec-
ondary mRNA targets. Additionally, northern blotting might not
be sensitive enough to detect low abundant miRNAs targets and is
also time-consuming if many targets have to be tested; luciferase
reporter assays are time-consuming as well, depend on the region
cloned and on methodological choices such as transfection reagents
or promoters used [25–27]. Finally, 5′-RACE, Degradome
Sequencing, and PARE can be used to detect target cleavage prod-
ucts and precisely identify the targets ends generated. Degradome
Sequencing, employing next-generation sequencing technologies,
is sensitive, yet the necessary expertise required and the time and
costs required are considerable. 5′-RACE is also a useful and clas-
sical method to identify miRNA target genes and corresponding
cleavage sites, but accurate detection of targeted mRNAs cleavage
products is not always possible. Based on the advantages and draw-
backs of the various approaches above, we developed a strategy
integrating modified RLM-RACE, PPM-RACE, and qRT-PCR of
cleavage products (Fig. 1), which can identify 3′- and 5′-ends of
miRNA targets cleavage products, as well as determine their abun-
dance in various tissues at different stages of growth and develop-
ment. Using our newly developed approach can be an ideal choice
for accurate verification of miRNA targets predicted by bioinfor-
matics. Validation of the approach is illustrated by our work on
grapevine.

2 Materials

Diethylpyrocarbonate (DEPC)-treated RNase-free water should

be used to prepare all solutions as well as to dissolve RNA pellets
after ethanol precipitation. To prepare DEPC-treated RNase-free
water, mix double-distilled water with 0.01 % (v/v) DEPC in
RNase free bottles. Let stand overnight and autoclave. RNase-free
water and all reagents can be stored at room temperature (20 °C)
for several months unless otherwise indicated.
 Validation of miRNAs Target Genes 177

m7G AAAA(A)N3’
Ploy(A) RNA cap
5’miRNA
3’
miRNA-directed cleavge
m7G
cap 3’ 5’P AAAA(A)N3’

Poly(A) Polymerase polyadenylation 5’

5’RNAadaptor 3’ T4 RN Aligase
m7G
cap AAAA(A)N 5’ AAAA(A)N3’
Reverse transcription
Data analysis Reverse transcription
m7G
AAAA(A)N3’ 5’ AAAA(A)N3’
cap
TTTT(T)n TTTT(T)n
oligo dIT)RTPrimer oligo d(T) Primer
First strand cDNA
First strand cDNA 5’ 5’
3’ 3’
PPM-RACE GenRacer 3’ Primer GenRacer 5’ Primer
RLM-RACE
3’ 5’ 5’
3’
5’ 3’ 5’ 3’

Forward GSP2 qRT-PCR qRT-PCR Reverse GSP2

3’ 5’ 3’ 5’
5’ 3’ 5’ 3’

Cloning and sequencing of PCR products

The site splite Data analysis

Alignment with target sequence for confirmation

Fig. 1 The flow chart of PPM-RACE and RLM-RACE technology

2.1 Total RNA 1. SDS lysis buffer: 50 mM Tris–HCl, pH 8 (see Note 1), 140 mM
Extraction NaCl, 10 mM EDTA, 4 % SDS (Sodium Dodecyl Sulfate), 3 %
PVP (polyvinylpyrrolidinone K30), 3 % ß-mercaptoethanol
(add just before use) (see Note 2). Store at 4 °C.
2. 3 M NaAC, pH 5.2 (see Note 3).
3. Ethanol, Isopropanol.
4. DNA Eraser (TaKaRa, Clontech), including DNA eraser buf-
fer: 40 mM Tris–HCl, pH 7.5, 80 mM MgCl2, 50 mM DTT.
5. RNase Inhibitor (see Note 4).

2.2 mRNA 1. PolyATtract mRNA Isolation System (Promega).

Purification 2. 50 pmol/μl Biotinylated Oligo(dT) Probe.
3. 20× SSC buffer.
4. Streptavidin MagneSphere Paramagnetic Particles (Promega)
(see Note 5).

2.3 Ligation 1. Poly(A) polymerase (Ambion), including 1× PAP Buffer,

of 5′-Adaptor and 2.5 mM MnCl2, 1 mM ATP.
3′-Polyadenylation 2. Phenol/chloroform, ethanol.
178 Chen Wang and Jinggui Fang

3. T4 RNA ligase (Promega), including ligase buffer: 50 mM

Tris–HCl, pH 7.8, 10 mM MgCl2, 10 mM DTT, 1 mg/ml
BSA, 10 mM ATP.
4. 5′ adapter primer sequence: 5′-CGACUGGAGCACAGGAC
ACUGACAUGGACUGAAGGAGUAGAAA-3′.

2.4 Reverse 1. Oligo(dT)30 primer: 5′-ATTCTAGAGGCCGAGGCGGCCG

Transcription ACATG-d(T)30-3′.
2. SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA).
3. 10 mM dNTP.
4. RNase Inhibitor (see Note 4).

2.5 RLM-RACE 1. GeneRacer 5′ primer: 5′-AGGACACTGACATGGACTGAA

and PPM-RACE GGAGTAG-3′.
2. GeneRacer 3′ primer: 5′-ATTCTAGAGGCCGAGGCGGCC
GACATG-3′.
3. Gene-specific primers.
4. Universal primers: 5′-ATTCTAGAGGCCGAGGCGGCCG
ACATG-3′, 5′-AGGACACTGACATGGACTGAAGGAGT
AG-3′.
5. Ex Taq™ Hot Start Version (Takara, Clontech) (see Note 6).
6. TOPO TA cloning Kit (Invitrogen).
7. pMD™ 19-T Vector Cloning Kit (TaKaRa, Clontech).
8. E. coli DH5alpha competent cells.
9. TE buffer: 10 mM Tris–HCl, pH 7.5, 1 mM EDTA, pH 8.0.
10. Agarose Gel DNA Extraction Kit (Roche).
11. 50-bp DNA ladder (Invitrogen).

2.6 qRT-PCR 1. Rotor-Gene 3000 (Corbett Robotics) and software version 6.1.
of 3′- and 5′-End 2. SYBR® Green qRT-PCR Master Mix (Toyobo).
Cleavage Products
3. Specific forward and reverse primers.

3 Methods

Carry out all procedures at room temperature unless otherwise

specified. Particular care must be taken to prevent contamination
when opening and closing tubes. Wear gloves all the time.

3.1 Total RNA 1. Preheat 1.2 ml extraction buffer at 65 °C in a 2 ml tube and

Extraction mix by inversion from time to time.
2. In a liquid-nitrogen-filled mortar, grind about 100 mg tissue
sample into a fine powder (see Note 7), and quickly add the
 Validation of miRNAs Target Genes 179

ground tissue to the tube. Mix completely by inverting the

tube.
3. Shake the mixture for 30 s then incubate at 65 °C for
30–45 min, inverting the tube 3–4 times during incubation.
4. Add 800 μl of chloroform. Shake the mixture for 30 s, and
then place at 4 °C for 5 min.
5. Centrifuge the mixture at 12,000 × g for 20 min at 4 °C.
6. Transfer the supernatant (1,000 μl) to a new tube (see Note 8).
7. Add 1,000 μl of phenol:chloroform (1:1), shake for 30 s and
centrifuge to separate phases.
8. Transfer the supernatant (800 μl) to a new tube and add an
equal volume of chloroform. Shake the mixture for 30 s and
centrifuge at 12,000 × g for 15 min at 4 °C.
9. Transfer the final supernatant (600 μl) to a new 1.5 ml tube.
Add 1/20 volume of 3 M NaAC, pH 5.2 and 1/10 volume of
ethanol 100 % to the supernatant and mix. Store at −20 °C for
30–60 min.
10. Centrifuge the samples at 12,000 × g for 20 min at 4 °C. Transfer
the supernatant to a new 1.5 ml tube. Add an equal volume of
isopropanol to the supernatant and mix. Precipitate at −20 °C
for at least 4 h.
11. Centrifuge the samples at 12,000 × g for 20 min at 4 °C to
pellet RNA.
12. Wash pellets with 75 and 100 % ethanol (see Note 9).
13. Air-dry and dissolve RNA in 30 μl DEPC-treated water
(see Note 10).

3.2 mRNA 1. In a sterile, RNase-free 3 ml tube, combine 1–5 mg of total

Purification RNA and RNase-free water to a final volume of 2.43.
3.2.1 Annealing 2. Heat at 65 °C in a heating block for 10 min.
3. Add 10 μl of biotinylated-oligo(dT) probe and 60 μl of 20×
SSC.
4. Mix gently and incubate at room temperature until completely
cooled (see Note 11).

3.2.2 Preparation 1. Resuspend one tube of SA-PMPs per isolation by gently flick-
of Streptavidin ing the bottom of the tube (see Note 11).
Paramagnetic Particles 2. Capture the SA-PMPs by placing the tube on the magnetic
(SA-PMPs) stand (see Note 12).
3. Carefully remove the supernatant (see Note 13).
4. Wash the SA-PMPs three times with 1.5 ml of 0.5× SSC per
wash. Following each wash, capture the SA-PMPs using the
magnetic stand and carefully remove the supernatant.
180 Chen Wang and Jinggui Fang

5. Resuspend the washed SA-PMPs in 0.5 ml of 0.5× SSC.

6. Add the entire content of the annealing reaction to the tube
containing the washed SA-PMPs.
7. Incubate at room temperature for 10 min. Gently mix by
inversion every 1–2 min.
8. Capture the SA-PMPs using the magnetic stand and carefully
remove the supernatant.
9. Wash the particles four times with 1.5 ml of 0.1× SSC per wash
by gently flicking the bottom of the tube until all particles are
in suspension. After the final wash, remove as much of the
supernatant as possible.

3.2.3 Elution of mRNA 1. Resuspend the final SA-PMP pellet in 1 ml of RNase-free water
and gently mix the particles by flicking the tube.
2. Magnetically capture the SA-PMPs and transfer the eluted
mRNA to a 2 ml microtube. Do not discard the particles
(see Note 14).

3.3 Ligation 1. Combine the following reagents in a RNase-free microtube:

of 5′-Adaptor and 3 μl mRNA, 100 μM of 5′-adaptor, 1 μl of 10× ligation buffer,
3′-Polyadenylation 1 μl ATP (4 mM), 1 μl T4 RNA Ligase (20 U/μl), RNase-free
water up to 40 μl.
2. Mix and incubate the reaction mixture at 37 °C for 1 h.
3. Add 450 μl RNase-free water and 500 μl phenol-chloroform
to the reaction mixture.
4. Mix and spin at 13,000 × g at 4 °C for 15 min.
5. Collect the aqueous phase in a new 1.5 ml RNase-free tube
6. Add 1/10 volume of 3 M NaAC, pH 5.2 and 2.5 volumes of
ethanol 100 %.
7. Precipitate 5′-adapter ligated mRNA for at least 4 h at −20 °C
(see Note 15).
8. Centrifuge at 13,000 × g for 20 min at 4 °C.
9. Carefully remove the supernatant and add 1 ml of 80 % ethanol
to wash the pellet (see Note 16).
10. Spin at 12,000 × g at 4 °C for 10 min.
11. Carefully remove all the liquid, avoiding touching the pellet.
12. Air-dry the pellet at room temperature (see Note 17).
13. Dissolve the dried pellet in 10 μl DEPC-water.
14. Combine the following reagents in a RNase-free microtube:
3 μl mRNA, 10 μl of 5× ligation buffer, 5 μl of MgCl2 (25 mM),
0.5 μl ATP (100 nM/μl), 2 μl PAP (2 U/μl), DEPC-treated
water up to 50 μl.
 Validation of miRNAs Target Genes 181

15. Mix and incubate at 37 °C for 1 h.

16. Add 450 μl of DEPC-treated water and 500 μl of phenol-
chloroform to the reaction mixture. Mix and spin at 19,000 × g
for 20 min at 4 °C.
17. Collect the aqueous phase in a new 1.5 ml RNase-free tube,
add 1/10 volume of 3 M NaAC, pH 5.2 and 2.5 volumes of
ethanol 100 %.
18. Precipitate RNA for at least 4 h at −20 °C (see Note 15).
19. Spin RNA at 13,000 × g for 20 min.
20. Carefully remove the supernatant and add 1 ml of 80 % ethanol
to wash the pellet (see Note 16).
21. Spin at 12,000 × g at 4 °C for 10 min.
22. Carefully remove all the liquid, avoiding touching the pellet.
Air–dry the pellet at room temperature (see Notes 16, 17).
23. Dissolve the dried pellet in 10 μl DEPC-water.

3.4 Reverse 1. Combine the following reagents in a 0.2 ml RNase-free tube:

Transcription 3 μl 5′-adaptor ligated-mRNA or PolyA-tailed mRNA, 1 μl
Oligo(dT)30 RT primer(50 μM), 1 μl dNTP (10 mM), 1 μl of
RNase H, 5 μl of RNase-free water.
2. Mix and incubate at 65 °C for 5 min, then place samples in
melting ice for 2 min.
3. Add the following component in this order: 3 μl of 10× RT buf-
fer, 4 μl MgCl2 (25 mM), 1 μl DTT (0.1 M), 1 μl RNaseOUTTM
(40 U/μl), 1 μl SuperScriptTM III RT (200 U/μl).
4. Mix gently and centrifuge briefly.
5. Incubate the mixture for 1 h at 42 °C and next for 10 min
at 50 °C.
6. Inactivate the reverse transcriptase by incubating the mixture for
15 min at 70 °C, then immediately chill on ice (see Note 18).
7. Store at −80 °C.

3.5 RLM-RACE Perform RLM-RACE reactions with the mirRacer 5′ primer and
and PPM-RACE gene-specific reverse primer (GSP1), and carry out PPM-RACE
reactions with the mirRacer 3′ primer and gene-specific forward
primer (GSP2) (see Note 19).

3.5.1 First Round In a sterile microtube, mix the following reagents for each sample:
Amplification 3 μl Hercules Hot-Start polymerase buffer, 4 μl dNTP mix
(2.5 mM), 2.5 units Ex Taq™ Hot-Start Version 4, 2 μl of template
cDNA derived from the 5′-adaptor ligated or from the PolyA-
tailed cleavage products, 25 pmol mirRacer 5′ primer or mirRacer
182 Chen Wang and Jinggui Fang

3′ primer and the corresponding universal primer. Set up a control

experiment without template as well.
1. Mix and heat in a DNA thermocycler for 5 min at 98 °C to
denaturate the first strand product and to activate the
polymerase.
2. Perform PCR using following reaction parameters: initial
denaturation step at 94 °C for 3 min; 25 cycles: Denaturation
at 94 °C for 10 s, Annealing at 65 °C for 10 s, Elongation at
72 °C for 1 min; Final extension at 72 °C for 10 min. Store
PCR products at 4 °C.

3.5.2 Second Round 1. Dilute an aliquot of the first round amplification to the 1:20 in
Amplification TE buffer.
2. In a sterile, 0.2 ml microtube, mix the following reagents on
ice: 3 μl Hercules Hot-Start polymerase buffer, 4 μl dNTP mix
(2.5 mM), 2.5 units Ex Taq™ Hot Start DNA polymerase
Version 4, 2 μl of the diluted first round amplification product
and 25 pmol of each primers mGSP2 and mGSP1. Set up a
control experiment without template.
3. Mix and heat in a DNA thermocycler for 5 min at 98 °C to
denaturate the first strand product and to activate the
polymerase.
4. Perform PCR using following reaction parameters: initial
denaturation step at 94 °C for 3 min; 25 cycles: Denaturation
at 94 °C for 10 s, Annealing at 65 °C for 10 s, Elongation at
72 °C for 1 min; Final extension at 72 °C for 10 min. Store
PCR products at 4 °C.
5. After amplification, separate the 3′- and 5′-PCR products on a
2.0 % agarose gel and stain with ethidium bromide (EtBr)
(Fig. 2) (see Note 20).
6. Cut the gel slices containing the distinct bands of the predicted
size and purify the DNA fragments using an agarose gel DNA
purification kit, according to the manufacturer’s instructions.

Fig. 2 Products of RLM-RACE and PPM-RACE for Vv-miR319e on Vv-EC934132.

M marker; 1 and 2 RLM-RACE and PPM-RACE products, respectively
 Validation of miRNAs Target Genes 183

3.5.3 RLM-RACE Directly clone the DNA fragment purified with the TOPO TA
and PPM-RACE Products cloning Kit (Invitrogen).
Cloning and Sequencing
1. Add 4.5 μl of purified DNA, 0.5 μl pMD™ 19-T Vector, 5.0 μl
Solution I into a 0.2 ml sterile microtube. Mix and quickly spin
down.
2. Incubate at 16 °C for 1 h.
3. Transform E. coli DH5alpha competent cells with the ligation
product and plate on solid LB medium containing ampicillin.
Incubate overnight at 37 °C.
4. Pick positive clones and perform colony-PCR using the PCR-
specific primer pairs and PCR program as in step 2,
Subheading 3.5.
5. Sequence positive clones PCR-products.
6. Compare sequencing results with the predicted target genes
and identify the cleavage sites (Fig. 3).

a b
15.00 45.00
5⬘Vv-CB920070 5⬘Vv-EV228459
12.00 3⬘Vv-CB920070 36.00
3⬘Vv-EV228459
Relative expression
Relative expression

9.00 27.00
r=0.9668
6.00 18.00 r=0.9946

3.00 9.00

0.00 0.00
YL ML ST TE IN FL YB LB YL ML ST TE IN FL YB LB

c d 25.00
15.00
5⬘Vv-EC958215 5⬘Vv-EC934132
3⬘Vv-EC958215 20.00 3⬘Vv-EC934132
12.00
Relative expression
Relative expression

15.00
9.00

r=0.9892 10.00 r=0.9979

6.00

3.00 5.00

0.00 0.00
YL ML ST TE IN FL YB LB YL ML ST TE IN FL YB LB

Fig. 3 Products of RLM-RACE and PPM-RACE for miRNAs on their target genes. Line and columns denote the
products of RLM-RACE and PPM-RACE, respectively. YL, ML, ST, TE, IN, FL, YB, LB denote young leaf, mature
leaf, stem, tendril, inflorescence, flower, young berry, large berry; X position presents the diverse development
stages of grapevine; (a) and (b) represent the cleavage products of miR-159a and miR-159b on their corre-
sponding target genes respectively; (c) and (d) denote those of miR-319e on the two target genes. Line graphs
denote the 3′-end cleavage products of miRNAs on their target genes, bar diagrams represent the 5′-end
cleavage products. The size of 3′- and 5′-end cleavage products in (a)–(d) charts are 191,116; 158, 137; 187,
112; 163,114 respectively
184 Chen Wang and Jinggui Fang

3.6 qRT-PCR 1. In a sterile microtube, mix following reagents: 10 μl 2× SYBR

of 3′- and 5′-End green reaction mix, 2 μl of diluted cDNA from the 5′-adapter
Cleavage Products ligated or 3′-polyA-tailed cleavage products, 5 pmol of each spe-
cific primers (see Note 21), double-distilled water up to 20 μl.
2. Perform PCR using following reaction parameters: polymerase
activation at 95 °C for 1 min; initial denaturation step at 95 °C
for 1 min; 50 cycles: Denaturation at 95 °C for 15 s, Annealing
at 60 °C for 20 s, Elongation at 72 °C for 20 s.
3. Use Actin gene as a reference gene for the qPCR detection of
cleavage products. Analyze the data with the method of Livak
(2-ΔΔCt).

4 Notes

1. DEPC is unstable in Tris buffer. Tris buffer should therefore

be prepared with DEPC-treated water rather than directly
treated with DEPC.
2. Add ß-mercaptoethanol just before use.
3. High-concentration acetic acid (10 M) can be used at first to
narrow the gap from the starting to the required pH. Next, use
dilutions (e.g. 5 M and 1 M) with lower ionic strengths to
avoid a sudden drop in pH below the required one.
4. Employing RNAse inhibitors throughout the procedure sig-
nificantly reduces RNA degradation, especially during long
incubation periods.
5. Do not freeze the Streptavidin MagneSphere® Particles, as this
will reduce their performance.
6. Use a high-fidelity enzyme to avoid too many errors.
7. Tissue samples need to be ground as finely as possible to
increase extraction yield.
8. Throughout the protocol, during phenol-chloroform extrac-
tion phases, gently pipette the supernatant to avoid cross-
contaminations of phases.
9. Pellets should be extremely gently washed to avoid washing
out of RNAs.
10. Too dry pellets are more difficult to be dissolved.
11. Gently invert the tubes 2–3 times, do not vortex.
12. Do not collect particles by centrifugation.
13. Do not touch the SA-PMPs to avoid mechanical loss of
miRNAs.
14. If some particles are transferred with the supernatant, place the
new tube again on the magnetic stand and proceed again with
step 2, Subheading 3.2.3.
 Validation of miRNAs Target Genes 185

15. Increasing precipitation time will ensure a better yield of RNA

precipitation.
16. Always collect all drops in the bottom of the tube and avoid
solutions sticking on the tube walls.
17. Too dry pellets are more difficult to be dissolved.
18. Rapidly terminate the first strand synthesis reaction to avoid
nonspecific background.
19. GSP1 and GSP2 need to be located upstream/downstream of
the miRNA targeted region on the mRNA.
20. Adapt agarose gel percentage depending on PCR products
expected size.
21. The forward- and the reverse-specific primers should be located
at 100–150 bp upstream/downstream from the miRNA
targeted region on the mRNA.

Acknowledgements

This work was supported by the Natural Science Foundation of

China (NSFC) (No. 31301759), the Priority Academic Program
Development of Jiangsu Higher Education Institutions (PAPD),
the National Science Foundation of China (No. 60901053), and
the Nanjing Agricultural University Youth Science and Technology
Innovation Fund (KJ2013013).

References
1. Bartel B, Bartel DP (2003) MicroRNAs: at the 8. Mallory AC, Dugas DV, Bartel DP et al (2004)
root of plant development? Plant Physiol 13: MicroRNA regulation of NAC-domain targets
709–717 is required for proper formation and separation
2. Bartel DP (2004) MicroRNAs: genomics, bio- of adjacent embryonic, vegetative, and floral
genesis, mechanism, and function. Cell 116: organs. Curr Biol 14:1035–1046
281–297 9. Mallory AC, Reinhart BJ, Jones-Rhoades MW
3. Mallory AC, Vaucheret H (2004) MicroRNAs: et al (2004) MicroRNA control of
something important between the genes. Curr PHABULOSA in leaf development, impor-
Opin Plant Biol 7:120–125 tance of pairing to the micro RNA 5′ region.
4. Carrington JC, Ambros V (2003) Role of EMBO J 23:3356–3364
microRNAs in plant and animal development. 10. Aukerman MJ, Sakai H (2003) Regulation of
Science 301:336–338 flowering time and floral organ identity by a
5. Hunter C, Poethig RS (2003) Missing links: microRNA and its APETALA2-like target
miRNAs and plant development. Curr Opin genes. Plant Cell 15:2730–2741
Genet Dev 13:372–378 11. Kasschau KD, Xie Z, Allen E et al (2003)
6. Emery JF, Floyd SK, Alvarez J et al (2003) P1/HC-Pro, a viral suppressor of RNA
Radial patterning of Arabidopsis shoots by silencing, interferes with Arabidopsis devel-
Class III HD-ZIP and KANADI Genes. Curr opment and miRNA function. Dev Cell
Biol 13:1768–1774 4:205–217
7. Juarez MT, Kui JS, Thomas J et al (2004) 12. Sunkar R, Zhu JK (2004) Novel and stress-
MicroRNA-mediated repression of rolled leaf regulated microRNAs and other small RNAs
specifies maize leaf polarity. Nature 428:84–88 from Arabidopsis. Plant Cell 16:2001–2019
186 Chen Wang and Jinggui Fang

13. Mallory AC, Bartel DP, Bartel B (2005) targets identified by sequencing of the
MicroRNA-directed regulation of Arabidopsis Arabidopsis degradome. Curr Biol 18:
AUXIN RESPONSE FACTOR17 Is essential 758–762
for proper development and modulates expres- 22. Pantaleo V, Szittya G, Moxon S et al (2010)
sion of early auxin response genes. Plant Cell Identification of grapevine microRNAs and
17:1360–1375 their targets using high-throughput sequenc-
14. Allen E, Xie Z, Gustafson AM et al (2005) ing and degradome analysis. Plant J 62:
microRNA-directed phasing during transact- 960–976
ing siRNA biogenesis in plants. Cell 121:2071 23. German MA, Pillay M, Jeong DH et al (2008)
15. Chen X (2005) MicroRNA biogenesis and Global identification of microRNA-target
function in plants. FEBS Lett 579:5923–5931 RNA pairs by parallel analysis of RNA ends.
16. Berezikov E, Cuppen E, Plasterk RH (2006) Nat Biotechnol 26:941–946
Approaches to microRNA discovery. Nat 24. Thomson DW, Bracken CP, Goodal GJ (2011)
Genet 38:S2 Experimental strategies for microRNA target
17. Carthew RW, Sontheimer EJ (2009) Origins identification. Nucleic Acids Res 39(16):
and mechanisms of miRNAs and siRNAs. Cell 6845–6853
136:642–655 25. Lytle JR, Yario TA, Steitz JA (2007) Target
mRNAs are repressed as efficiently by
18. Kurihara Y, Watanabe Y (2004) Arabidopsis
microRNA-binding sites in the 5′-UTR as in
micro-RNA biogenesis through Dicer-like 1
the 3′-UTR. Proc Natl Acad Sci U S A 104:
protein functions. Proc Natl Acad Sci U S A
9667–9672
101:12753–12758
26. Kong YW, Cannell IG, de Moor CH et al
19. Jones-Rhoades MW, Bartel DP, Bartel B
(2008) The mechanism of micro-RNA-
(2006) MicroRNAs and their regulatory roles
mediated translation repression is determined
in plants. Annu Rev Plant Biol 57:19–53
by the promoter of the target gene. Proc Natl
20. Allen RS, Li JY, Alonso-Peral MM et al (2010) Acad Sci U S A 105:8866–8871
MicroR159 regulation of most conserved tar- 27. Hendrickson DG, Hogan DJ, McCullough
gets in Arabidopsis has negligible phenotypic HL et al (2009) Concordant regulation of
effects. Silence 1:18 translation and mRNA abundance for hun-
21. Addo-Quaye C, Eshoo TW, Bartel DP et al dreds of targets of a human microRNA. PLoS
(2008) Endogenous siRNA and miRNA Biol 7:e1000238
 Chapter 17

Dual Luciferase Gene Reporter Assays to Study

miRNA Function
Thomas Clément, Véronique Salone, and Mathieu Rederstorff

Abstract
This chapter describes one of the most reliable quantitative assays to test the silencing of a possible target
gene by a specific miRNA using a luciferase reporter gene. The experimental procedure first consists in
cloning both the wild-type and mutated forms of the 3′UTR of the miRNA predicted mRNA target down-
stream of a firefly luciferase reporter. Next, each construct is co-transfected together with the miRNA into
HeLa cells, and the reporter expression is monitored. Changes in luciferase levels will indicate whether or
not a miRNA can bind to the UTR and regulate its expression.

Key words MicroRNA, Luciferase gene reporter assay, microRNA function, microRNA regulatory
element, microRNA targeting sequence, Target validation

1 Introduction

Metazoan microRNA (miRNA) are posttranscriptional regulators

of gene expression that bind with imperfect complementarity to a
mRNA sequence (MRE for MicroRNA Regulatory Element), typ-
ically located in the 3′untranslated region (3′UTR).
The first step to define a specific miRNA function often con-
sists in bioinformatics searches for its putative biological targets.
Currently, different open-access prediction programs are available.
The most popular ones are MiRanda (http://www.microrna.org)
[1], MicroCosm (http://www.mirbase.org) [1], TargetScan (http://
www.targetscan.org) [2], or PicTar (http://pictar.mdc-berlin.de)
[3]. These target prediction programs feature several similarities in
their algorithms such as: identification of sites in the 3′UTR of
mRNA matching the miRNA seed; conservation of miRNA and
putative targets sequences among species; presence of multiple
miRNA target sites, thermodynamic stability of the miRNA–mRNA
duplex and of the 3′UTR secondary structures [4]. However,
comparing the results of different target prediction programs
generally increases reliability of the predictions when they overlap.

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_17, © Springer Science+Business Media New York 2015

187
188 Thomas Clément et al.

The development of the novel database miRWalk (http://mirwalk.

uni-hd.de) [5] has greatly facilitated these comparison approaches,
owing to new features such as search for miRNA target sites on the
whole gene sequence (including promoter, 5′ UTR, and CDS),
association of the predicted miRNA binding sites with information
on genes, pathways, organs, diseases, and transcription factors, and
automatic search in PubMed for validated miRNA targets.
Despite the availability of diverse algorithms, target prediction
is still challenging and generates numerous false positives.
Therefore, it is important to experimentally validate the functional
relevance of predicted miRNA-mRNA target pairs. One of the
easiest and most commonly used strategies consists in a luciferase
gene reporter assay, for which numerous expression vectors/sys-
tems have been developed. The predicted target site or the full
length 3′UTR (see Note 1) and a mutated version are subcloned
downstream of the luciferase gene and transfected together with a
specific miRNA expressing vector or chemically synthesized
miRNA analogs. Silencing of luciferase activity with the wild-type
UTR and not with the mutated version (Fig. 1) indicates that the
miRNA expressed can specifically bind to its target and negatively
regulate gene expression. In this chapter, we present a simple
workflow to experimentally validate a predicted miRNA/mRNA
target pair, illustrated by our work on hsa-miR-29b and the 3′UTR
of the COL2A1 mRNA. This approach is fast, simple, and relatively
cheap to test miRNA-dependent gene expression regulation.
Nevertheless, the choice of appropriate controls and inherent
limits of the approach are discussed in detail as well in Subheading 4.

2 Materials

2.1 Expression 1. pGL3 vector (Promega). pGL3 vector is used as a Firefly lucif-
Vector Preparation erase reporter vector. 3′ UTR fragments to test are cloned
downstream of the Firefly luciferase gene.
2.1.1 PCR Amplification
of Target and Pre-miRNA 2. pRL-SV40 vector (Promega). pRL-SV40 vector is used as a
Sequence Renilla luciferase control reporter vector. Both pGL3 and
pRL-SV40 vectors are co-transfected in cells and Renilla lucif-
erase activity is used to normalize transfection efficiency.
3. pCDNA3.1 vector (Life Technologies). pCDNA3.1 vector is
used to overexpress a gene of interest in mammalian cells (see
Note 2). In our case, pCDNA3.1, containing the full-length
sequence of the pre-miRNA of interest, leads to the overexpres-
sion of the corresponding miRNA in HeLa cells (see Note 3).
4. Oligonucleotides for the 3′UTR amplification:
Sense: 5′-GACTCTAGAGGACCCAAGTACTTTCCA-3′.
Antisense: 5′-GGCCGTCTAGATGTACTTTCCAATAATCT-3′.
 Luciferase Reporter Assays 189

Fig. 1 Experimental design to test the interaction between hsa-miRNA-29b and its predicted target site in the
3′-UTR of the COL2A1 mRNA

The two oligonucleotides were designed to amplify the

300 bp fragment from the 3′-UTR of the COL2A1 mRNA
containing the hsa-miR-29b targeting site (see Notes 1 and 4).
We designed sense and antisense oligonucleotides with XbaI
restriction site (in bold) at their extremities and additional
nucleotides (in italic) to enhance digestion efficiency of the
PCR product.
190 Thomas Clément et al.

5. Oligonucleotides for the pre-miRNA amplification:

Sense hsa-pre-miR-29b: 5′-GACGGTACCCTTCAGGAAGC
TGGT-3′.
Antisense hsa-pre-miR-29b: 5′-GACGGATCCCCCCCAAG
AACACTG-3′.
Sense hsa-pre-miR-199a: 5′-GACGGTACCGCCAACCCAG
TGTT-3′.
Antisense hsa-pre-miR-199a: 5′-GACGGATCCGCCTAACC
AATGT-3′.
The two pairs of oligonucleotides were designed to amplify
hsa-pre-miR-29b and hsa-pre-miR-199a (miRNA sequences
are available on miRbase: www.mirbase.org). Sense and anti-
sense oligonucleotides were synthesized with a KpnI and a
BamHI (in bold) restriction site at their 5′ ends, respectively,
and 4 nucleotides were added (in italic) to enhance digestion
efficiency of PCR products.
6. Human genomic DNA isolated from HeLa cells culture with
Trizol® (Life Techonologies) according to the manufacturer’s
recommendations.
7. Phusion® hot start Taq DNA polymerase (Promega), includ-
ing 5× Phusion GC buffer and 3 % DMSO.
8. 100 mM dNTPs.
9. Thermocycler.

2.1.2 PCR Fragment 1. XbaI, KpnI, BamHI restriction enzymes.

Digestion, Plasmid 2. Alkaline phosphatase.
Linearization

2.1.3 Agarose Gel 1. Electrophoresis equipment.

Electrophoresis 2. 10× TBE buffer: 108 g/l Tris–HCl, pH 8, 55 g/l boric acid,
9.3 g/l EDTA.
3. Gel red.
4. Agarose.
5. DNA ladders.
6. 6× gel loading dye: 50 mM EDTA, 0.2 % SDS, 50 % glycerol,
0.05 % w/v bromophenol blue.
7. GeneJET™ gel extraction kit.
8. NanoDrop 2000c spectrophotometer.

2.1.4 Ligation 1. T4 DNA ligase including reaction Buffer.

and Bacterial Cell 2. Escherichia coli competent cells.
Transformation
3. LB liquid medium with ampicillin: 10 g/l Bacto Peptone,
5 g/l yeast extract, 5 g/l NaCl. Adjust pH to 7.5 with 10 N
NaOH. After autoclaving, add ampicillin to a final concentration
 Luciferase Reporter Assays 191

of 100 mg/l. To prepare LB agar plates, add 17 g/l of agar

before autoclaving.
4. Incubator shaker.
5. Plasmid preparation kit.

2.1.5 miRNA Target Site 1. Mutagenesis oligonucleotides:

Mutagenesis Sense: 5′- CTGTGTGTGTCCTACACTTACCACGATTTCTG
TGTCAAACACCTCT-3′.
Antisense: 5′-AGAGGTGTTTGACACAGAAATCGTGGTAA
GTGTAGGACACACA-CAG-3′.
The two oligonucleotides were designed to replace the
sequence of the COL2A1 3′-UTR targeted by hsa-miR-29b by
its reverse sequence, as a negative control. The two oligonucle-
otides were designed to overlap to perform the mutagenesis.
2. DpnI enzyme.

2.2 Co-transfection 1. HeLa cells or any comparable human cell lines depending on
of Plasmids into the experimental design (see Note 3).
Mammalian Cells 2. Dulbecco’s Modified Eagle Medium supplemented with 10 %
fetal bovine serum, 2.9 mg/ml glutamine and 10 U/ml
Penicillin-Streptomycin.
3. 12-well plates for cell culture.
4. 1× PBS buffer: 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4,
1.8 mM KH2PO4.
5. JetPEI® Polyplus™ transfection reagent (see Note 5).

2.3 Dual-Luciferase 1. Dual-luciferase Reporter Assay Kit including PLB lysis buffer,
Reporter Assay LARII reaction buffer, and Stop&Glo buffer (Promega). Any
other comparable Dual-luciferase reporter assay kit allowing an
optimized system for the sequential assay of Firefly and Renilla
luciferase activities can be used.
2. GloMax®-96 Microplate Luminometer (Promega) featuring
a double automatic injector or any other comparable
luminometer.
3. Microwell Plates.

3 Methods

3.1 Expression 1. Mix the following in a PCR reaction tube: 20 ng of HeLa

Vector Preparation genomic DNA, 10 μM of each primer, 1 U of Phusion® Taq
DNA polymerase, 3 % (v/v) of DMSO, 10 μl of 5× GC Buffer
3.1.1 PCR Amplification
and dH2O up to 50 μl.
of Target and Pre-miRNA
Sequence 2. Perform amplification as follows: initial denaturation step at
95 °C for 5 min; 30 cycles: denaturation at 95 °C for 30 s,
192 Thomas Clément et al.

annealing at a temperature depending on primers Tm for 30 s,

elongation at 72 °C for a time depending on the amplicon’s
size; final elongation step at 72 °C for 5 min.

3.1.2 PCR Fragment 1. For the 3′UTR fragment digestion, incubate 1 μg of purified
Digestion, Plasmid PCR product for 1 h at 37 °C with 1 U of XbaI enzyme and
Linearization 1 μl of 10× digestion buffer in a final volume 10 μl.
2. Inactivate the enzyme by heating the mixture at 95 °C for
3 min.
3. For the pre-miRNA fragment digestion, incubate 1 μg of puri-
fied PCR product for 1 h at 37 °C with 1 U of KpnI and 1 U
of BamHI enzymes and 1 μl of 10× digestion buffer in a final
volume of 10 μl.
4. Inactivate the enzymes by heating the mixture at 95 °C for
3 min.
5. Digest and dephosphorylate simultaneously the pGL3-Con-
trol vector by XbaI and alkaline phosphatase. Incubate 1 μg of
pGL3 plasmid with 1 U of XbaI, 1 U of alkaline phosphatase,
and 1 μl of 10× digestion buffer in a final volume of 10 μl at
37 °C for 10 min.
6. Incubate the mixture at 95 °C for 3 min to inactivate the
enzymes.
7. Digest and dephosphorylate simultaneously the pCDNA 3.1
vector by KpnI, BamHI and alkaline phosphatase. Incubate
1 μg of pCDNA3.1 plasmid with 1 U of KpnI, 1 U of BamHI,
1 U of alkaline phosphatase, and 1 μl of 10× digestion buffer
in a final volume of 10 μl at 37 °C for 10 min.
8. Incubate the mixture at 95 °C for 3 min to inactivate the
enzymes.

3.1.3 Agarose Gel 1. Add 6× loading dye to the digested products and load them on
Electrophoresis a 2 % agarose gel.
2. Run the gel at 100 V for 35 min in 1× TBE buffer.
3. Following electrophoresis, stain the gel with Gel Red.
4. Cut the gel slice containing the DNA fragment of interest from
the agarose gel with a clean and sharp scalpel blade.
5. Retrieve and purify both linearized vectors and digested inserts
DNA fragments.
6. Quantify the DNA concentration using a NanoDrop spectro-
photometer (see Note 6).

3.1.4 Ligation 1. Combine the dephosphorylated vectors with the appropri-

and Bacterial Cell ate purified insert. Vector and insert ratio should be 1:10
Transformation (see Note 7). In our case, we cloned the KpnI/BamHI digested
 Luciferase Reporter Assays 193

PCR product, corresponding to pre-miRNA of interest, into

linearized pCDNA3.1 and the XbaI digested PCR product,
corresponding to 3′UTR fragment of interest, into linearized
pGL3-Control.
2. Add 1 μl of T4 DNA ligase and 1 μl of 10× T4 DNA ligase
buffer in a total volume of 10 μl.
3. Centrifuge briefly and incubate at 37 °C for 1 h.
4. Chill on ice. The sample is now ready for transformation or can
be stored at −20 °C.
5. Thaw 50 μl per transformation of One Shot® TOP10 chemi-
cally competent cells for 10 min on ice.
6. Add 2–5 μl of ligation product to 50 μl of bacterial competent
cells and mix gently.
7. Incubate the cells on ice for 30 min.
8. Incubate the cells for 45 s at 42 °C without shaking.
9. Immediately chill on ice for 5 min.
10. Add 250 μl of pre-warmed sterile LB medium to each sample.
11. Incubate the transformed cells at 37 °C for 1 h with mild shak-
ing and plate the cells on LB agar plates with 100 μg/ml of
ampicillin.
12. Incubate the plates overnight at 37 °C.
13. Inoculate LB medium with 100 μg/ml ampicillin with isolated
clones and incubate overnight at 37 °C with shaking.
14. Proceed with plasmid DNA purification using the plasmid
preparation kit, according to the manufacturer’s instructions
(see Note 8).
15. Check the plasmid DNA size on a 0.8 % agarose gel. Sequence
all the final vectors (see Note 9).

3.1.5 miRNA Target Site 1. Incubate 200 ng of pGL3-3′-UTR-COL2A1 plasmid DNA

Mutagenesis with 10 μM of each complementary mutagenesis primers, 1 U
of Phusion DNA polymerase, 1.5 μl of 3 % DMSO, 10 μl of 5×
GC buffer, and dH2O up to 50 μl to generate a 3′-UTR
miRNA target site mutant.
2. The mutagenesis is performed with the following PCR pro-
gram: initial denaturation step at 95 °C for 5 min; 18 cycles:
denaturation at 95 °C for 30 s, annealing at a temperature
depending on primers Tm for 30 s, elongation at 72 °C for a
time depending on the amplicon’s size; final elongation step at
72 °C for 10 min.
3. Add 1 μl of 6× loading dye to 5 μl of PCR product. Load on a
0.8 % agarose gel.
194 Thomas Clément et al.

4. Run the gel at 100 V for 35 min in order to check the DNA
amplification.
5. The PCR product is cleaned from matrix DNA using DpnI
enzyme, which degrades only methylated DNA. Incubate
10 μl of PCR product with 5 μl of DpnI and 2.5 μl of 10× buf-
fer in a final volume of 25 μl for 60 min at 37 °C.
6. Competent bacterial cells are transformed with 5 μl of DpnI
digestion product as described in Subheading 3.1.4.

3.2 Co-transfection 1. One day prior transfection, seed 1.105 HeLa cells in DMEM
of Plasmids into medium in 12-well plates. Fill as many wells as reactions, assays,
Mammalian Cells and controls to be performed. Incubate cells at 37 °C with 5 %
CO2 overnight.
2. For each transfection, combine 1 μg of pGL3 plasmid, 1 μg of
pCDNA3.1 plasmid and 5 ng of pRL-SV40 vector with 37 μl
of 150 mM NaCl in a final volume of 40 μl. We tested hsa-
miR-29b targeting the 3′UTR of COL2A1 mRNA and the
following combinations were used in our experimental design
(Fig. 1):
(a) pGL3-COL2A1 + pCDNA Ø + pRL SV40 (positive lucif-
erase activity control).
(b) pGL3-COL2A1 + pCDNA-pre-29b + pRL SV40 (assay).
(c) pGL3-Mutant + pCDNA-pre-29b + pRL SV40 (negative
control).
(d) pGL3-COL2A1 + pCDNA-pre-199a + pRL SV40 (nega-
tive control).
3. In parallel, combine 5 μl of JetPEI® transfection reagent with
35 μl of 150 mM NaCl (see Notes 5, 10, and 11).
4. Add the JetPEI® mixture on the plasmids mixture and vortex
thoroughly (see Note 12).
5. Incubate at room temperature for 20 min.
6. Add the 80 μl transfection mixture drop by drop to the cells
and incubate for 2–3 h at 37 °C with 5 % CO2.
7. To avoid JetPEI® toxicity on cells, change the culture medium
with DMEM pre-warmed to 37 °C.
8. Incubate cells overnight at 37 °C with 5 % CO2 (see Note 13).

4 Dual-Luciferase Reporter Assay

1. After 24 h, discard the culture medium and wash cells with

1 ml of 1× PBS buffer.
2. Dispense 250 μl of 1× Passive Lysis Buffer in each well.
Gently shake the 12-well plates at room temperature for
15 min (see Note 14).
 Luciferase Reporter Assays 195

3. Dispense 20 μl of each cells lysate in a 96-well microplate.

Store the microplate at 4 °C until the assay is performed.
4. Prepare buffers for the luciferase activity assay. For each sam-
ple, combine 100 μl of LARII Buffer (Firefly luciferase sub-
strate) and 100 μl of Stop&Glo buffer (Firefly luciferase
inhibitor and Renilla luciferase substrate) (see Note 15).
5. Set the assay program of the luminometer to first measure the
Firefly luciferase activity and next the Renilla luciferase activity,
according to the following steps: LARII Buffer injection →
incubation of 3 s → measurement of Firefly luciferase activity
for 10 s → Stop&Glo Buffer injection → incubation of 3 s →
measurement of Renilla luciferase activity for 10 s.
6. For each experiment, calculate the ratio of Firefly luciferase
activity/Renilla luciferase activity to normalize luciferase activity.
The control luciferase activity (condition (a), Subheading 3.2)
was defined as 100 % of activity (see Notes 16 and 17). Perform
at least all combinations (a–d) in triplicate (see Notes 18 and 19).
Figure 2 presents an example of data that was obtained
(see Note 20).

5 Notes

1. Luciferase constructs containing the full length 3′-UTR of

many human genes can be easily obtained from various com-
mercial sources. However, complete 3′-UTRs may contain tar-
get sequences of several miRNAs and numerous other
regulatory elements, which could influence reporter mRNA
stability and luciferase expression by attenuating the putative
effect of the studied miRNA. Therefore, data interpretation
obtained using a full length 3′-UTR may be difficult.
However, target site recognition depends on both 3′-UTR
sequence and structural environment [6]. Restricting the
sequence downstream of the luciferase reporter gene to the
MRE may therefore alter targeting efficiency.
Additionally, another point to take into account is that a
3′-UTR often contains multiple target sites for the same
miRNA, and all of them should actually be tested.
Finally, one could choose to subclone multiple copies of
the MRE downstream of the luciferase gene. Indeed, some
authors have demonstrated the existence of a nonlinear rela-
tionship between the number of miRNA target sites and the
magnitude of repression [7].
Consequently, many points have to be taken into account
to determine the nature of the 3′-UTR fragment to be tested
downstream of the luciferase gene, and a specific and well-
thought design is needed for each experiment.
196 Thomas Clément et al.

Fig. 2 Regulation of COL2A mRNA by hsa-miRNA-29b. Luciferase activity in HeLa

cells co-transfected with (1) pGL3-Luc::COL2A1 or pGL3-Luc::COL2A1-mutant,
(2) pCDNA3.1-pre-miR29b, pCDNA3.1-pre-miR199a or a negative control
(pcDNA3.1 empty), and (3) the internal control plasmid encoding Renilla lucifer-
ase (RLuc). Results are shown as the relative luciferase activity, where luciferase
activity in HeLa cells transfected by the empty version of pcDNA3.1 is defined as
100 %. In all experiments, bars show the mean ± SEM of at least three indepen-
dent experiments, each being run in triplicate. The analysis of variance (ANOVA),
followed by Fisher’s t post-hoc test using the Statview™ 5.0 software (SAS
Institute Inc), were performed (** = P < 0.01; ns not significant)

2. Testing the function of a miRNA on a reporter target can be

done in a cell line endogenously expressing the corresponding
miRNA. If this is not the case or if the miRNA amounts are too
low, cells have to be co-transfected with a vector such as
pCDNA3.1, enabling the expression of the miRNA or directly
with mature synthetic miRNA duplexes. The advantage of co-
transfecting the miRNA is that the effect on luciferase activity
may be quantified. Nevertheless, this quantification requires
the endogenous miRNA and target gene endogenous expres-
sion to be low in the chosen cell line (see Note 3).
3. Protocols for HeLa cells culture and transfection are routinely
used in most laboratories. Many other cell lines can also be used.
Nevertheless, as miRNA biogenesis and target gene expression
 Luciferase Reporter Assays 197

are under control of many factors, to accurately assess whether

miRNA/mRNA regulation occurs, experiments should be
performed in a cell type where all these factors are expressed.
Moreover, a low expression of the endogenous miRNA and
target gene is necessary if quantification is required, as men-
tioned above. Consequently, several aspects have to be consid-
ered for the cell line choice as well.
4. Most miRNA target sites are located in the 3′-UTR of a
mRNA. Nevertheless, several miRNA target sites have been
found in the 5′-UTR or the CDS. The method described in
this chapter can also be used to test such miRNA targets.
5. Several other RNA transfection reagents are available. They
may be tried if results are not satisfactory.
6. Any other method of quantification of your convenience is
employable as well (e.g., Qubit, Life Technologies).
7. The vector–insert ratio may be adjusted for a better efficiency
depending on vector and insert sizes.
8. As the DNA will be transformed into HeLa cells, use a prepa-
ration kit that enables elimination of endotoxins.
9. For cloning into pGL3-vector, since the insert fragment is
digested with XbaI at both extremities, ligation may occur in
both orientations. Therefore, prior to sequencing positive
clones, insert orientation should be checked by PCR, using an
oligonucleotide hybridizing in the insert, and another oligo-
nucleotide hybridizing in the vector.
10. A master mix can be prepared.
11. One critical parameter for repression is the ratio between the
miRNA and the target plasmid. Several experiments are required
for optimization. The conditions we present here were, in our
hands, the best ones for our experimental purposes.
12. Do not reverse order.
13. Transient transfection parameters (e.g., incubation time) gen-
erally need to be optimized, particularly depending on the cell
lines that are used.
14. If cell debris appears, spin the lysate and keep the supernatant.
15. As we use a GloMax luminometer with automatic injectors, we
prepare a tube for each buffer containing 100× N reactions
μl + 10 % to avoid pipetting errors and + 1 ml of dead volume to
initiate pumps.
16. A negative control is mandatory to verify that the Firefly lucif-
erase expression responds specifically to the miRNA of interest.
One possibility is to use a mutated 3′-UTR target site (our
condition c) or an unrelated miRNA (our condition d), as
described in this chapter. Other strategies are possible and
198 Thomas Clément et al.

were described elsewhere, e.g., deletion/mutation of the seed

region of the miRNA itself.
17. Another possibility to test specificity is to use commercial
antagomiRs [8] (antisense to miRNAs oligonucleotides) to
silence the miRNA of interest.
18. A minimum of three replicates is mandatory. Indeed, miRNAs
and target genes expressions may be spatially and temporally
differentially regulated. Cell type, differentiation state, stress
are as many factors influencing miRNA/target interaction.
19. Despite all replicates and controls performed in one series of
experiment, false negative or false positive results may still be
observed. Luciferase reporter assay is therefore a convenient
approach to get information on a miRNA function, but addi-
tional data must be grabbed by other means and should be
accompanied by physiological observations as well.
20. miRNA negatively regulates gene expression by either transla-
tional repression or degradation of the targeted mRNA. The
method presented here enables to determine the mode of
repression, as a change in the reporter mRNA level (in the case
of degradation) is easy to monitor.

Acknowledgment

This work was supported by the Centre National pour la

Recherche Scientifique, the Université de Lorraine, the Région
Lorraine and the Ligue nationale pour la recherche contre le cancer
(comités 54 et 57).

References
1. Witkos TM, Koscianska E, Krzyzosiak WJ measurement of RNA secondary structure in
(2011) Practical Aspects of microRNA yeast. Nature 467:103–107
Target Prediction. Curr Mol Med 11: 5. Dweep H, Sticht C, Pandey P (2011) Gretz N:
93–109 miRWalk–database: prediction of possible
2. Lewis BP, Burge CB, Bartel DP (2005) miRNA binding sites by “walking” the genes of
Conserved seed pairing, often flanked by three genomes. J Biomed Inform 44:839–847
adenosines, indicates that thousands of 6. Doench JG, Petersen CP (2003) Sharp PA: siR-
human genes are microRNA targets. Cell NAs can function as miRNAs. Genes Dev 17:
120:15–20 438–442
3. Krek A, Grün D, Poy MN, Wolf R, Rosenberg 7. Ameres SL, Martinez J, Schroeder R (2007)
L, Epstein EJ, MacMenamin P, da Piedade I, Molecular basis for target RNA recognition and
Gunsalus KC, Stoffel M, Rajewsky N (2005) cleavage by human RISC. Cell 130:101–112
Combinatorial microRNA target predictions. 8. Krützfeldt J, Rajewsky N, Braich R, Rajeev KG,
Nat Genet 37:495–500 Tuschl T, Manoharan M, Stoffel M (2005)
4. Kertesz M, Wan Y, Mazor E, Rinn JL, Nutter Silencing of microRNAs in vivo with
RC, Chang HY, Segal E (2010) Genome-wide “antagomirs”. Nature 438:685–689
 Chapter 18

Gene Expression Knockdown by Transfection

of siRNAs into Mammalian Cells
Yoann Abel and Mathieu Rederstorff

Abstract
SiRNA induced gene silencing or RNA interference is a powerful tool to knock down gene expression and
perform gene function studies. In this chapter, we describe a basic method to silence gene expression by
transfecting a specific synthetic siRNA into mammalian HeLa cells.

Key words RNAi, siRNA, Transfection, Knockdown

1 Introduction

The discovery of the RNA interference mechanisms opened the

way to easily and efficiently knock down gene expression in mam-
malian cells [1]. Small interfering RNAs or siRNA are small double-
stranded RNAs of ≈21–23 nucleotides long able to target and
cleave complementary mRNAs (Fig. 1). SiRNAs can be synthesized
and then directly transfected into the cell or produced from a short
hairpin RNA precursor (shRNA). Once in the cytoplasm, the
mature siRNA (guide strand) is loaded in the RNA Induced
Silencing Complex (RISC). The RISC complex is a multi-protein
particle. One of its constituent, the protein Argonaute 2 (Ago 2),
possesses an RNase H-like domain involved in mRNA cleavage
which occurs at a position of 10 or 11 nucleotides from the 5′ end
of the complementary siRNA [2]. SiRNA knockdown is transitory
and generally not 100 % efficient, but is generally sufficient to
observe the consequences of the targeted gene knockdown while
transfected cells survive the treatment, even if an essential gene is
targeted. In this chapter, we present a simple method using siRNAs
to knock down the expression of a gene of interest in HeLa cells.

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_18, © Springer Science+Business Media New York 2015

199
200 Yoann Abel and Mathieu Rederstorff

Fig. 1 siRNA induced gene silencing. After transfection, the guide strand of the double-stranded siRNA is
loaded into the RISC complex, while the passenger strand is degraded. The loaded RISC targets a specific
mRNA which will be cleaved by Argonaute 2

2 Materials

2.1 Mammalian Cells 1. HeLa cells (ATCC) (see Note 1).

Culture 2. DMEM (Dulbecco’s Modified Eagle Medium) cell culture
medium, supplemented with 10 % of fetal bovine serum,
2.9 mg/ml of glutamine, and 10 units/ml of Penicillin-
Streptomycin.
3. 6 wells plates.

2.2 SiRNA 1. Chemically synthesized siRNAs (ON-Target, Dharmacon):

Transfection resuspend the siRNAs in H2O to a working concentration of
100 μM (see Note 2).
2. 0.1× TE: 100 mM Tris–HCl, pH 8, 50 mM EDTA.
3. 2 M CaCl2.
4. 2× HBS buffer: 50 mM HEPES, pH 7.5, 0.28 M NaCl,
10 mM KCl, 1.5 mM Na2HPO4 (see Note 3).

3 Methods

3.1 Mammalian Cells 1. One day prior transfection, seed between 1 and 2 × 105 HeLa
Culture cells in DMEM medium in 6 wells plates. Incubate cells at
37 °C with 5 % CO2 overnight.
2. 1–5 h before transfection, change HeLa cells medium and add
3 ml of fresh DMEM medium.
 siRNA Induced Gene Knockdown 201

3.2 SiRNA 1. Dilute each siRNA in RNAse-free H2O to a final concentra-

Transfection tion of 10 μM (see Note 4).
2. For each individual transfection, combine in this order 5 μl of
diluted siRNA, 31.8 μl of 0.1× TE, 5.2 μl of 2 M CaCl2, and
42 μl of 2× HBS. Do not vortex (see Note 5 and 6).
3. Mix by pipetting up and down about 15 times (see Note 7).
4. Incubate for 20 min at room temperature.
5. Add the transfection mixture (84 μl) drop by drop in each well.
6. Incubate the cells at 37 °C with 5 % CO2 for 24–96 h, but
change the culture medium to remove the calcium-phosphate
precipitate 12 h post-transfection.

4 Notes

1. HeLa cells are routinely used in most laboratories but numer-

ous other cell lines can easily be transfected as well.
2. Different manufacturers offer siRNA solution, but we found
the ON-TARGET siRNA (set of 4) from Dharmacon the
most efficient ones in our hands.
3. Different transfection reagents and solutions are available on
the market, but in our hands, calcium-phosphate transfection
was the most efficient one regarding transfection of siRNAs.
4. Every siRNA should be tested to find out the best experimen-
tal conditions to get a maximal silencing efficiency. If the effect
of a siRNA is too weak, you can increase its concentration or
proceed with a second transfection after 24–48 h. Second
transfection also enables to prolong the siRNA effect. Attention
must be paid as multiple transfections and/or siRNA pro-
longed effects might lead to toxic effects for the cells. Generally,
cells should be split (1/5) prior to second transfection.
5. A master mix can be assembled if multiple transfections of the
same siRNAs have to be performed.
6. Synthetic siRNAs are fragile and should not be vortexed.
7. Pipetting also enables to inject air bubbles into the transfec-
tion mixture, which enhances formation of the fine transfec-
tion precipitate.

Acknowledgment

This work was supported by the Centre National pour la Recherche

Scientifique, the Université de Lorraine, the Région Lorraine and
the Ligue nationale pour la recherche contre le cancer (comités 54
et 57).
202 Yoann Abel and Mathieu Rederstorff

References

1. Fire A, Xu SQ, Montgomery MK, Kostas SA, 2. Sontheimer EJ (2005) Assembly and function
Driver SE, Mello CC (1998) Potent and spe- of RNA silencing complexes. Nat Rev Mol Cell
cific genetic interference by double-stranded Biol 6:127–138
RNA in Caenorhabditis elegans. Nature 391:
806–811
 Chapter 19

Efficient and Selective Knockdown of Small

Non-Coding RNAs
Xue-Hai Liang, Wen Shen, and Stanley T. Crooke

Abstract
Small non-coding RNAs (ncRNAs), less than 200 nucleotides in length, play important roles in various
biological processes, such as pre-mRNA splicing, pre-rRNA processing and modification, and gene expres-
sion regulation. However, characterization of small ncRNAs remains difficult mainly due to methodological
obstacles in selective reduction of these RNAs. Here we describe an approach to deplete small ncRNAs, in
principle any types of RNAs, using second generation antisense oligonucleotide-directed RNase H cleavage
pathway in human cells. This protocol includes oligonucleotide design, transfection, RNA preparation, and
target RNA detection.

Key words Knockdown, Oligonucleotides, ncRNA, RNase H, Transfection

1 Introduction

Recent studies have shown that the majority of human genome is

transcribed as non-protein-coding RNAs, or ncRNAs [1]. These
RNAs, including long ncRNAs (longer than 200 nucleotides) and
small ncRNAs (shorter than 200 nt), can play important roles in
various cellular processes especially in different steps of gene
expression, from transcription to translation [2, 3]. To characterize
the roles of ncRNAs, it is important to develop methods to specifi-
cally reduce the levels of these RNAs.
Small ncRNAs, including recently identified promoter-
associated RNAs, enhancer RNAs, as well as miRNAs, piRNAs,
small nuclear RNAs (snRNAs), and small nucleolar RNAs (snoR-
NAs) are abundant and stable relative to most of the long ncRNAs
[2, 4]. Depletion of some small ncRNAs is especially difficult due
to the fact that most of the small ncRNAs associate with RNP
proteins, are highly structured, and are often nuclear localized
[5–7]. This is particularly the case for snoRNAs and snRNAs
(Fig. 1). It appears that snoRNAs cannot be depleted by siRNAs
in mammalian cells [8, 9]. To overcome this methodological

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_19, © Springer Science+Business Media New York 2015

203
204 Xue-Hai Liang et al.

Fig. 1 Many small ncRNAs are highly structured and associate with RNP proteins. (a) C/D box snoRNPs. (b) H/ACA
box snoRNPs. (c) U1 snRNP. The proteins of different RNPs are depicted with circles, whereas RNAs are depicted
using lines. The dashed lines indicate the cellular RNAs that can base-pair with the small RNAs. The thick lines
represent the small RNA regions that can be potentially targeted by ASOs

obstacle, we developed an approach to deplete small ncRNAs

using oligonucleotide-directed RNase H cleavage mechanism [8].
In addition to being used as research tools, RNase H-dependent
oligonucleotides have been developed as drugs to reduce the
expression of disease-causing genes [10]. In this approach, an
antisense oligonucleotide (ASO) complementary to the target
RNA is introduced into cells. The most active ASO sequence is
determined by experimental screening of ASOs targeting different
regions of the target RNAs. Structurally, the ASO is designed as a
5-10-5 gapmer that contains a 10-nt DNA portion flanked by five
ribonucleotides at both ends. The ASO base-pairs with the target
RNA to form a DNA/RNA chimeric duplex that is recognized by
endogenous RNase H1, leading to cleavage of the target RNA
[11] (Fig. 2). To enable efficient reduction of small ncRNAs, the
ASOs are deliberately designed and extensively modified. The
modifications include phosphorothioate backbone that enhances
ASO stability and 2′-O modification at the flanking ribonucleo-
tide portion that increases the affinity of ASOs with substrate
RNAs [12]. These chemical modifications are critical for efficient
reduction of small ncRNAs. The 2′-O modification described here
is a 2′-O-(2-methoxyethyl) (MOE) that was developed and used
in second generation ASOs (Fig. 2). Detailed below is the proto-
col exemplified using HeLa cells.

2 Materials

Antisense oligonucleotides (ASOs) of 5-10-5 gapmer are designed

based on the sequence of the target RNAs. The ASOs contain a
phosphorothioate backbone, with ten deoxyribonucleotides in the
 Knockdown of sncRNAs 205

Fig. 2 ASOs utilize RNase H1 mechanism to degrade target RNAs. The structure indicates a phosphorothioate-
backbone. 5-10-5 gapmer ASO containing five 2′-O-MOE modified ribonucleotides at each end and ten deoxy-
ribonucleotides in the middle. The RNA substrate and RNase H1 protein are depicted. The structures of the
modified nucleotides are shown

middle, flanked at both ends with five ribonucleotides containing

2′-O-MOE modification (Fig. 2). The ASOs are purified by
standard desalting (see Notes 1 and 2).

2.1 Transfection 1. Transfection reagent: Lipofectamine 2000, 1 μg/μl stock (Life

Technologies) (see Note 4).
2. Growth Medium: DMEM supplemented with 10 % FBS,
0.1 μg/ml streptomycin; 100 units/ml penicillin.
3. Transfection medium: Opti-MEM (Life Technologies).
4. 1× Dulbeccoo’s PBS (DPBS).

2.2 RNA Preparation 1. Tri-Reagent (Sigma).

and Analysis 2. Isopropanol.
3. Ethanol.
4. 8 % acrylamide.
5. 10 % ammonium persulfate (APS).
6. T4 PNK.
7. γ-[P32]-ATP.
8. GeneScreen Plus hybridization transfer membrane
(PerkinElmer).
9. Hybridization buffer: Rapid-hyb buffer (GE Healthcare).
206 Xue-Hai Liang et al.

10. 1× TBE buffer: 100 mM Tris–HCl, pH 8, 90 mM boric acid,

1 mM EDTA.
11. RNA loading buffer: 95 % (v/v) formamide, 18 mM EDTA,
0.025 % SDS, 0.025 % xylene cyanol, 0.025 % bromophenol
blue.
12. 2× SSC: 300 mM NaCl, 30 mM sodium citrate.
13. 10 % sodium dodecyl sulfate (SDS).
14. Wash buffer: 2× SSC, 0.1 % SDS.

3 Methods

3.1 Transfection 1. Trypsinize HeLa cells and count cell number.

2. Seed 750,000 cells per 10 cm dishes in growth medium without
antibiotics (see Note 5).
3. Incubate overnight at 37 °C with 5 % CO2 until cells reach
50–70 % confluence.
4. Remove medium from the dishes.
5. Wash cells once with 1× DPBS.
6. Completely remove DPBS from the dishes.
7. Add 4 ml pre-warmed Opti-MEM medium to each dish and
incubate at 37 °C while preparing transfection mixture.
8. Calculate the amount of ASO based on stock concentration
and final concentration needed (see Note 3). The final volume
of medium is 5 ml for a 10 cm dish.
9. Take two sterilized 1.5 ml tubes and add 500 μl Opti-MEM
medium in each.
10. Add the desired amount of ASO in one tube and vortex briefly.
11. Add 20 μl Lipofectamine 2000 into the other tube and vortex
briefly. The final concentration of Lipofectamine 2000 is
40 μg/ml.
12. Incubate at room temperature for 5 min.
13. Combine the ASO and Lipofectamine mix into one tube as
transfection mixture and vortex briefly.
14. Incubate at RT for 15 min to form transfection particles.
15. As a negative control, add 1 ml Opti-MEM and 20 μl
Lipofectamine 2000 in a sterilized tube, vortex and incubate at
RT for 15 min.
16. Add the transfection mixture to cells in a dish containing 4 ml
medium, drop by drop, and gently sway to mix with medium.
17. Similarly, add the mock transfection mixture to a control dish.
18. Incubate in a 37 °C incubator with 5 % CO2 for 4–5 h.
 Knockdown of sncRNAs 207

19. Replace the transfection medium with 10 ml pre-warmed

growth medium.
20. Pursue incubation at 37 °C for desired time (see Note 6).

3.2 RNA Preparation 1. Remove medium from dishes containing the ASO treated cells
and Analysis and control cells and wash once with 1× DPBS.
2. Add 1 ml tri-reagent per dish and collect cell lysate using a
scraper.
3. Transfer to an microtube and prepare total RNA based on the
manufacturer’s protocol using Tri-Reagent.
4. Dissolve total RNA in DEPC water. Measure RNA
concentration.
5. Prepare an 8 % polyacrylamide—7 M urea gel with 1× TBE.
6. Take 5–10 μg total RNA in 10 μl DEPC water, add 5 μl 6×
RNA loading buffer, and mix.
7. Boil the samples at 94 °C for 2 min and immediately chill on
ice for 2 min.
8. Load the RNA samples on the 8 % polyacrylamide—7 M Urea
gel. Run the gel with 1× TBE buffer to separate RNAs.
9. After electrophoresis, soak the gel in 200 ml double distilled
water containing 100 μg ethidium bromide. Gently shake at
RT for 5 min to stain RNAs.
10. Take a picture for the RNA pattern to check the loading and
RNA quality.
11. Transfer RNA to a GeneScreen Plus hybridization transfer
membrane, using a semidry gel-transfer apparatus (10 V,
30 min for small ncRNAs other than miRNAs).
12. Block the membrane using 5–10 ml Rapid-Hyb buffer for
15 min at 42 °C (for oligonucleotide probes) in a hybridiza-
tion oven.
13. Meanwhile, to label the hybridization oligonucleotide probes
using T4 PNK, combine the following in a sterilized micro-
tube: 2 μl of 10 μM oligonucleotide probe, 2 μl of 10× T4
PNK buffer, 1 μl γ[P32]-ATP (150 μCi), 1 μl T4 PNK, and
water up to 20 μl.
14. Incubate the total 20 μl reaction mixture at 37 °C for 1 h.
15. Stop the reaction by heating for 2 min at 95 °C. Keep the
probe on ice.
16. Add 10 μl of labeled probe to the hybridization tube and
hybridize at 42 °C for 0.5–4 h, based on the abundance of the
target RNA.
17. Discard the hybridization buffer to a radioactive waste container.
Wash the membrane with 50 ml wash buffer at 42 °C for 20 min.
208 Xue-Hai Liang et al.

Fig. 3 An example of ASO-mediated snoRNA reduction detected by northern

hybridization. HeLa cells were transfected with 30 nM ASO targeting U16 snoRNA
for different incubation times. Total RNA was prepared and subjected to northern
hybridization. U18 snoRNAs were detected and served as a control for loading

18. Change the wash buffer and wash for an additional 20 min at
42 °C.
19. Discard the wash buffer and transfer the membrane to a tray
containing water.
20. Wash at room temperature for 15 min with shaking.
21. Detect the signal by autoradiography using either X-ray film or
PhosphorImager. An example of snoRNA knockdown is shown
in Fig. 3 (see Notes 7 and 8).

4 Notes

1. In addition to the phosphorothioate backbone modification

that stabilizes ASOs, the 2′ modification in the flanking ribo-
nucleotides is also critical for ASO activity, as it can signifi-
cantly affect the affinity of ASOs with its substrate RNAs. In
general, increasing the affinity of ASOs can lead to higher
potency, although off-target effect may potentially increase. In
addition to 2′-O-MOE described here, other 2′ modifications
that increase ASO affinity may also be used, such as locked
nucleic acid (LNA) or constrained ethyl (cEt). Finally, shorter
ribonucleotide wings, such as 3-10-3 or 4-10-4 gapmer ASOs,
may also be tested for these 2′ modifications to obtain maximum
potency.
2. As the RNA structure or protein binding can significantly
affect the accessibility of the ASOs, it is important to identify
the open regions for ASO to base-pair. Knowledge about the
protein binding sites and computer-based analyses of RNA
structures may help to predict the accessible regions, however,
 Knockdown of sncRNAs 209

experimental screening for the most potent ASOs is strongly

recommended. As depicted in Fig. 1, potential accessible
regions include the sequences immediately upstream to the D
or D′ boxes for C/D box snoRNAs. For H/ACA snoRNAs,
the terminal (top) loop regions are often good choices.
3. Reduction of the target RNAs is ASO concentration-
dependent. For different RNA targets or different sequences
for the same RNA, the ASO concentration required for effi-
cient knockdown can vary significantly. Thus it is important to
determine the best concentration experimentally. Significant
reduction may not be achieved if the dose is too low, however,
some side effects including off-target effects may occur if the
dose is too high. We recommend a 5–75 nM range for final
ASO concentration.
4. Although we recommend Lipofectamine 2000 for ASO transfec-
tion, other transfection reagents may also be used. Several
reagents, including Lipofectamine RNAiMax and Oligofectamine
have been successfully used to knock down ncRNAs [8].
5. We recommend a 50–70 % cell confluency at the time of trans-
fection, as higher confluency can lead to less efficient transfec-
tion and thus less target reduction.
Normally maintained cells should not overgrow, since
transfection of overgrown cells, even after overnight incuba-
tion and seeding at proper confluency may cause severe cell
death. For overgrown cells, we recommend to split cells in an
1:8 ratio for at least 4 passages before performing transfection
experiments.
6. We noticed that in many cases, maximum reduction of target
RNAs can be achieved within 4–6 h after ASO transfection. Thus
it is possible to determine the target knockdown at early time
points. However, for functional analysis, the ASO treatment
should be long enough to exhibit phenotypes, based on the
properties of ncRNAs and their potential function. We usually
treat cells for 48 h in the case of snoRNA knockdown to deter-
mine level changes of nucleotide modifications in rRNA that are
guided by snoRNAs, as the rRNA half-life is around 72 h.
Significant RNA reduction in ASO treated cells can last for at
least 100 h, as determined for snoRNAs [8].
7. Polyacrylamide gel electrophoresis is commonly used to detect
RNAs and is suitable to separate RNAs shorter than 1,000
nucleotides, including miRNAs that are ~21–24 nucleotides in
size [13]. We use 1.5 mm mini-gel system and the electrophoresis
is performed using 150 V for 40 min to 1.5 h, depending on
the size of the target RNA.
The transfer time using the semidry system also depends
on the size of the target RNAs. For miRNAs, it is important to
210 Xue-Hai Liang et al.

reduce the transfer time to 15–20 min to avoid loss of miRNAs

beyond the membrane. For larger RNAs, the transfer time can
be increased to 45 min.
The hybridization temperature depends on the probes
used. For example, when using random labeled DNA probes,
temperature should be increased to 55–60 °C to reduce cross-
hybridization. Oligonucleotide probes are recommended as
these can reduce background hybridization.
8. We use northern analysis in this protocol to detect small
ncRNAs, mainly due to the fact that many small ncRNAs are
short and designing primer probe sets for real-time PCR (RT-
PCR) may be difficult. ASOs might also interfere with qRT-
PCR reaction. However, qRT-PCR can be applied in many
cases, especially for ncRNAs that are long enough to design
primer-probe sets outside the regions targeted by ASOs. If the
primer probe sets spans the RNA region complementary to the
ASOs, it is important to confirm qRT-PCR results for RNA
level changes using other methods, such as northern hybrid-
ization, as base-pairing of ASO to target RNA may inhibit
qRT-PCR reaction.

Acknowledgement

This work was funded by an internal funding from ISIS

Pharmaceuticals.

References

1. Jacquier A (2009) The complex eukaryotic 6. Maxwell ES, Fournier MJ (1995) The small
transcriptome: unexpected pervasive transcrip- nucleolar RNAs. Annu Rev Biochem 64:
tion and novel small RNAs. Nat Rev Genet 897–934
10:833–844 7. Will CL, Luhrmann R (2001) Spliceosomal U
2. Mattick JS, Makunin IV (2006) Non-coding snRNP biogenesis, structure and function.
RNA. Hum Mol Genet 15(Spec No 1): Curr Opin Cell Biol 13:290–301
R17–R29 8. Liang XH, Vickers TA, Guo S, Crooke ST
3. Liang XH, Vickers TA, Crooke ST (2012) (2011) Efficient and specific knockdown of
Antisense-mediated reduction of eukaryotic small non-coding RNAs in mammalian cells
noncoding RNAs. In: Erdmann A, Barciszewski and in mice. Nucleic Acids Res 39(e13):
J (eds) From nucleic acid sequences to molecu- 1–17
lar medicine. Springer, New York, NY, pp 9. Ploner A, Ploner C, Lukasser M, Niederegger
p191–p214 H, Huttenhofer A (2009) Methodological
4. Chen LL, Carmichael GG (2010) Decoding obstacles in knocking down small noncoding
the function of nuclear long non-coding RNAs. RNAs. RNA 15:1797–1804
Curr Opin Cell Biol 22:357–364 10. Toth PP (2013) Emerging LDL therapies:
5. Bachellerie JP, Cavaille J, Huttenhofer A mipomersen-antisense oligonucleotide therapy
(2002) The expanding snoRNA world. in the management of hypercholesterolemia.
Biochimie 84:775–790 J Clin Lipidol 7:S6–S10
 Knockdown of sncRNAs 211

11. Crooke ST, Vickers T, Lima W, Wu H-J (ed) Antisense drug technology - principles,
(2006) Mechanisms of antisense drug action, strategies, and applications. CRC Press, Boca
an introduction. In: Crooke ST (ed) Antisense Raton, FL, pp 143–182
drug technology - principles, strategies, and 13. Liang XH, Hart CE, Crooke ST (2013)
application. CRC Press, Boca Raton, FL, Transfection of siRNAs can alter miRNA levels
pp 3–46 and trigger non-specific protein degradation in
12. Swayze EE, Bhat B (2006) The medicinal mammalian cells. Biochim Biophys Acta
chemistry of oligonucleotides. In: Crooke ST 1829:455–468
 Chapter 20

Cell-SELEX: In Vitro Selection of Synthetic Small Specific

Ligands
Helena Dickinson, Melanie Lukasser, Günter Mayer,
and Alexander Hüttenhofer

Abstract
Systematic Evolution of Ligands by Exponential Enrichment (SELEX) is an in vitro process enabling selec-
tion of nucleic acid molecules binding to target ligands with high binding affinity and specificity. The
selection process involves several rounds of two successive steps: (1) binding of the oligonucleotides to the
target under stringent conditions and (2) amplification of the target-bound nucleic acids by polymerase
chain reaction. Using this strategy, RNA or DNA aptamers are selected upon recognition and binding to
specific surface structures of the target. Aptamers generated during the final rounds of selection can be
notably used in applications dedicated to diagnosis of diseases or therapeutic approaches.

Key words Aptamers, SELEX (systematic evolution of ligands by exponential enrichment), Specific
binding interaction, Amplification

1 Introduction

SELEX technology (Systematic Evolution of Ligands by

Exponential Enrichment) was first described in 1990 by Craig
Tuerk and Larry Gold [1] and Andrew D. Ellington and Jack
W. Szostak [2]. The term aptamer is derived from the Latin “aptus”
(fitting) and the Greek “meros” (particle). Aptamers are short
single-stranded nucleic acid molecules that fold into complex
three-dimensional shapes [3–5] such as loops, stems, bulges, hair-
pins, pseudoknots, triplexes, or quadruplexes. Aptamers can form
binding pockets or clefts for the specific recognition and tight
binding of any given molecular target [6–8] by the way of second-
ary or tertiary structures. Metal ions [9], small organic compounds
[10], biological cofactors [11, 12], metabolites [13], proteins
[14–16], and whole organisms such as virus [17], bacteria [18],
yeast [19], or mammalian cells [8] are a few examples of common
aptamer targets. Aptamers are selected in vitro from vast
combinatorial libraries that comprise randomly generated sequences

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_20, © Springer Science+Business Media New York 2015

213
214 Helena Dickinson et al.

of a defined length flanked by constant 5′ and 3′ ends. During the

SELEX reaction, the library is first incubated with the target mol-
ecule. Next, unbound oligonucleotides are discarded and the
target-bound DNA or RNA is eluted by denaturing methods such
as heat treatment [20], urea, SDS, or EDTA [21] and strand dis-
placement takes place. Strands can next be separated by adding a
biotin molecule to a single strand and subsequently separating
both strands by gel electrophoresis or using streptavidin-coated
beads [22]. Fluorophore modified primers can also be employed
[20], so as to identify the labeled strand by UV light. Generation
of RNA and DNA aptamers differs significantly. While single-
stranded DNA aptamers just have to be amplified by PCR, RNA
oligonucleotides need to be reverse transcribed prior to
PCR. Afterwards, the cDNA is amplified using an oligonucleotide
adding a T7 promoter at the 5′-end and T7 transcription is finally
performed. The cycle of incubation, strand displacement, elution,
and amplification is repeated 6–15 times with increasing strin-
gency, which is achieved by increased washing times and volumes
[23]. The final and intermediate pools of selected aptamers are
cloned and sequenced. After the analysis of individual aptamer
sequences, relevant secondary structures are predicted with the
mfold program [24]. The binding specificity and affinity of the
aptamers can also be examined with binding studies, and determi-
nation of the dissociation constant KD indicates the affinity of the
aptamer for the target. A small KD value is indicative of a high affin-
ity of the aptamer for its target. As aptamers represent nucleic acid
species, they display a long shelf life and can be employed for vari-
ous applications ranging from diagnostic to therapeutic assay for-
mats [25]. Aptamers are thus extraordinary versatile tools. They
can be used for the functional characterization of biomolecules,
their detection, therapeutic intervention and the development of
small molecules that serve as pharmaceutical compounds [25]. The
first aptamer described with a therapeutic function was Pegaptanib,
an anti-VEGF (vascular endothelial growth factor) aptamer used to
prevent macular degeneration [26, 27].

2 Materials

Prepare all solutions using dH2O and analytical grade reagents.

Prepare stock solutions and store at room temperature. Prepare
fresh SELEX buffers each time.

2.1 Cell-SELEX 1. Sephadex G25 column.

Procedure 2. Centrifuge Filter Column.
3. Tabletop thermomixer.
4. Tabletop centrifuge.
 Cell-SELEX 215

5. NanoDrop 2000c spectrophotometer.

6. Water bath.
7. Laminar flow.
8. Appropriate cell line for Cell-SELEX procedure.
9. Cell culture incubator.
10. 10 cm culture dish.
11. 6-well culture plate.
12. Cell scraper.
13. Trypsin.
14. Cell culture growth medium.
15. Salmon sperm DNA 0.5 μg/μl.
16. 1 mM CaCl2.
17. 1 mM MgCl2.
18. PBS buffer.
19. BSA 0.5 μg/μl.
20. Phenol–chloroform–isoamyl alcohol.
21. Chloroform.
22. 100 % ethanol.
23. 3 M sodium acetate.
24. Constant region forward and reverse oligonucleotide
(see Notes 1 and 2):
5′-GCTGTGTGACTCCTGCAA–random region 30–40 nt-
GCAGCTGTATCTTGTCTCC-3′.

2.2 Amplification 1. Pfu DNA polymerase.

Steps 2. 10× Pfu DNA polymerase buffer.
2.2.1 Amplification 3. Taq DNA polymerase.
of the Selected Pool 4. 10× Taq DNA polymerase buffer.
of Aptamers
5. 25 mM dNTP mix.
6. dH2O.
7. PCR strips.
8. Thermocycler.
9. Sense oligonucleotide: 5′-FAM-GCTGTGTGACTCCTGC
AA-3′.
FAM (6-carboxyfluorescein) label at 5′-end enables detec-
tion by UV light.
10. Antisense Oligonucleotide: 5′-GGGCGATCGTAAGATCGCCC-
Spacer C18 (HEG)-GGAGACAAGATACAGCTGC-3′.
Spacer C18 (HEG) adds a hairpin to facilitate separation by
polyacrylamide gel electrophoresis (see Note 3).
216 Helena Dickinson et al.

11. Electrophoresis equipment.

12. 10× TBE buffer: 108 g/l Tris–HCl, pH 8, 55 g/l boric acid,
9.3 g/l EDTA.
13. Ethidium bromide.
14. Agarose.
15. DNA Ladder.
16. 6× gel loading dye: 50 mM EDTA, 0.2 % SDS, 50 % glycerol,
0.05 % w/v bromophenol blue.
17. Gel imaging system.

2.2.2 Denaturing 1. Electrophoresis equipment.

Polyacrylamide (PAA) Gel 2. Denaturing polyacrylamide gel solution: 375 mM Tris–HCl,
Electrophoresis pH 8.8, 8 % (v/v) polyacrylamide–bisacrylamide (29:1), 8 M
urea, 0. 1 % SDS. For polymerization, add 0.1 % (w/v) of
ammonium persulfate (APS) and 0.1 % (v/v) of TEMED
(N,N,N′,N′-tetramethylethylenediamine).
3. 10× TBE buffer: 108 g/l Tris–HCl, pH 8, 55 g/l boric acid,
9.3 g/l EDTA.
4. 2× RNA loading dye: 95 % formamide, 0.025 % (w/v) bromo-
phenol blue, 0.025 (w/v) xylene cyanol, 5 mM EDTA, pH
8.0, 0.025 % (w/v) SDS.
5. Low Range ssRNA Ladder.

2.3 Sanger 1. Sense oligonucleotide: 5′-GCTGTGTGACTCCTGCAA-3′.

Sequencing 2. Antisenseoligonucleotide:5′-GGAGACAAGATACAGCTGC-3′.
2.3.1 PCR, Ligation, 3. CloneJET PCR Cloning Kit (Fermentas) (see Note 4).
and Transformation 4. Escherichia coli competent cells.
5. LB liquid medium: 10 g/l Bacto Peptone, 5 g/l yeast extract,
5 g/l NaCl. Adjust pH to 7.5 with 10 N NaOH. After auto-
claving, add ampicillin to a final concentration of 100 mg/l. To
prepare LB-agar plates, add 17 g/l of agar before autoclaving.

2.3.2 Sanger Sequencing 1. QIAquick PCR Purification Kit (Qiagen).

of PCR Products 2. 10 ng of purified PCR.
3. 10 pmol of adequate sequencing oligonucleotide.
4. Big Dye Terminator (Life Technologies).
5. 5× sequencing buffer (Life Technologies).
6. Sequencing plates (96 × 0.2 ml).
7. ABI Prism 3100-Sequencer (Life Technologies).

2.4 In Vitro 1. Sense oligonucleotide: 5′-GCTGTGTGACTCCTGCAA-3′.

Binding Assay 2. Antisense oligonucleotide: 5′-GGGCGATCGTAAGATCGCCC-
Spacer C18 (HEG)-GGAGACAAGATACAGCTGC-3′.
 Cell-SELEX 217

3. 10 pmol oligonucleotide.
4. 10 pmol initial library.
5. 10 pmol scrambled oligonucleotide.
6. 10× T4 PNK buffer.
7. T4 PNK.
8. γ-32P-ATP.
9. Sephadex G25 column.
10. Scintillation cups.

3 Methods

3.1 Cell-SELEX 1. Boil the commercially obtained initial oligonucleotide library

Procedure (1 nmol) (see Note 1) for 5 min at 95 °C in 1 ml of SELEX
buffer and cool for 10 min on ice.
2. Choose an appropriate cell line to detect cell target by Cell-
SELEX and cultivate it according to SOP.
3. Wash cells twice with 2 ml of pre-warmed PBS (see Note 5).
4. Incubate the cooled library with the cells for 30 min at 37 °C
(see Note 6).
5. Remove the library solution from the cells and wash the cells
once in SELEX washing buffer. The volume and the number
of washing steps increase in each cycle of the SELEX proce-
dure, which thereby increases stringency (see Table 1).

Table 1
Cycle specific modifications

in × μl Washing in × μl
Cycle Library/pool SELEX buffer steps washing buffer PCR
1 1 nmol 1× 1. PCR
1 ml volume, 16 cycles
Re-PCR
3 ml volume, 5 cycles
2 500 pmol 1,000 1× 1,000 2. PCR
3 ml volume, 16 cycles
3 166 pmol 1,000 2× 1,000 3. PCR
3 ml volume, 16 cycles
4 166 pmol 1,000 3× 2,000 See above (3. PCR)
5 83 pmol 500 3× 2,000 See above (3. PCR)
6–7 83 pmol 500 4× 2,000 See above (3. PCR)
8–12 41.5 pmol 500 4× 2,000 See above (3. PCR)
13–14 41.5 pmol 500 4× 2,000 See above (3. PCR)
218 Helena Dickinson et al.

6. Add 500 μl of pre-warmed trypsin and incubate the cells for

5 min.
7. Carefully transfer them to a new reaction tube.
8. Boil this suspension for 5 min at 95 °C to elute the bound
aptamers from the cells.
9. Extract the bound aptamers by adding one volume of phenol–
chloroform–isoamyl alcohol.
10. Vortex the mixture vigorously and centrifuge for 5 min at
13,000 × g.
11. Transfer the upper phase to a new reaction tube and slowly
add one volume of chloroform.
12. Vortex the mixture vigorously and centrifuge for 5 min at
13,000 × g.
13. Carefully transfer the upper phase to a new reaction tube.
14. Purify the sample by passing it through a Sephadex G25
column.
15. Add one-tenth volume of 3 M sodium acetate and 2 volumes
of 100 % ethanol. Incubate at−80 °C for 20 min.
16. Pellet the precipitated nucleic acids by centrifugating for
30 min at 13,000 × g.
17. Wash the pellet in 70 % ethanol.
18. Completely air-dry the pellet to remove any traces of ethanol
and resuspend in 100 μl of dH2O.

3.2 Amplification The first polymerase chain reaction after the first SELEX cycle is
Steps prepared in a reaction volume of 1 mm. All following PCRs are
prepared in a 3 mm reaction volume.
3.2.1 Amplification
of the Selected Pool 1. Prepare 3 ml of PCR master mix. Combine 30 μl of FAM labeled
of Aptamers oligonucleotide (100 pmol stock), 30 μl of Spacer C18 (HEG)
oligonucleotide (100 pmol stock), 30 μl of dNTP mixture
(25 mM stock), 30 μl of Pfu DNA polymerase (2.5 U/μl), 300 μl
of 10× Pfu DNA polymerase buffer and 2,420 μl of dH2O.
2. Aliquot 50 μl of master mix as a negative control.
3. Add 100 μl of the SELEX cycle template (from step 17,
Subheading 3.1).
4. Aliquot 50 μl of the PCR mixture into PCR strips.
5. Amplification is realized with the following PCR program: ini-
tial denaturing step at 95 °C for 5 min; 16 cycles: denaturation
at 95 °C for 1 min, annealing at 64 °C for 1 min, elongation
at 72 °C for 1.5 min; final elongation step at 72 °C for 7 min.
6. Save 50 μl out of the total PCR product as a template for the
PCR aimed for cloning and sequencing and for the PCR for
the binding assay.
 Cell-SELEX 219

7. The PCR product is analyzed by agarose gel electrophoresis.

Therefore, add 6× loading dye to an aliquot of the PCR prod-
uct and load it on a 2.5 % agarose gel.
8. Run the gel for 25 min at 100 V in 1× TBE buffer.
9. If the PCR was successful, extract the nucleic acids with phe-
nol–chloroform–isoamyl alcohol and precipitate with ethanol
(as in step 14, Subheading 3.1).
10. If the PCR was not satisfactory, run 2–5 additional PCR cycles
and proceed with extraction.
11. Air-dry the pellet and dissolve it in 35 μl of dH2O.

3.2.2 Denaturing 1. Add 35 μl of 2× RNA loading dye to the sample and boil at
Polyacrylamide (PAA) Gel 95 °C for 5 min.
Electrophoresis 2. Load the sample on a denaturing polyacrylamide gel.
3. Run the gel for 2 h at 375 V.
4. The sense strand, labeled with FAM, is visualized by UV light
The C18-Spacer (HEG) is added to the antisense strand and
enables separation from the sense strand which is thus lighter.
5. Carefully cut the gel piece and transfer it to a new 2 ml reac-
tion tube.
6. Add 0.3 M sodium acetate (NaOAc) and incubated over night
at 4 °C to elute the RNA.
7. Afterwards, place the tube on a tabletop thermomixer and vig-
orously shack for 2 h at 65 °C.
8. Filter the eluate and precipitate the nucleic acids with two vol-
umes of 100 % ethanol at −80 °C for 20 min. Centrifuge for
20 min at 13,000 × g.
9. Wash the pellet with 70 %.
10. Dry the pellet thoroughly to remove all traces of ethanol.
11. Resuspend the pellet in 35 μl of dH2O and measure the con-
centration (see Note 7).
12. Continue with the next SELEX cycle according to Table 1 and
Subheading 3.1.

3.3 Sanger 1. Prepare the following PCR mix: 1.5 μl of each unmodified oli-
Sequencing gonucleotide (10 pmol/μl), 2.5 U of Pfu DNA polymerase,
10 μl of 10× Pfu DNA polymerase buffer, 0.3 μl dNTP mix
3.3.1 PCR, Ligation,
(25 mM), and 10 μl of template from Subheading 3.2.1, step 6.
and Transformation
2. Add dH2O to a final volume of 100 μl.
3. The amplification is realized with the following PCR program:
initial denaturation step at 95 °C for 5 min; 30 cycles: dena-
turation at 95 °C for 1 min, annealing at a temperature
depending on primers Tm for 1 min, elongation at 72 °C for
1 min; final elongation step at 72 °C for 7 min.
220 Helena Dickinson et al.

4. Mix 10 μl of 2× reaction buffer, 1 μl of non-purified PCR

product or 0.15 pmol of purified PCR product, 1 μl of
pJET1.2/blunt cloning vector, 1 μl of T4 DNA Ligase (5 U/
μl), and dH2O to a final volume of 20 μl.
5. Centrifuge briefly and incubate for 5 min at room
temperature.
6. Chill on ice. The sample is now ready for transformation or
can be stored at −20 °C.
7. Thaw 50 μl of chemically competent cells per transformation
for 10 min on ice.
8. Add 2–5 μl of ligation product and mix gently.
9. Incubate the cells on ice for 30 min.
10. Incubate the cells for 45 s at 42 °C without shaking.
11. Immediately chill on ice for 5 min.
12. Add 250 μl of pre-warmed sterile LB medium to each sample.
13. Incubate the transformed cells for 1 h at 37 °C with mild shak-
ing and plate the cells on LB agar plates with 100 μg/ml
ampicillin.
14. Incubate the plates overnight at 37 °C.
15. Select isolated clones for colony PCR.
16. Prepare the following PCR mix: 1.5 μl of each oligonucleotide
(10 pmol/μl), 2.5 U of Taq DNA polymerase, 10 μl of 10×
Taq DNA polymerase buffer, 0.3 μl dNTP mix (25 mM), and
dH2O to a final volume of 100 μl. Pipet the reaction mixture
into PCR tubes.
17. Take up a colony from the plate with a yellow tip and vigor-
ously stir it in a separate PCR tube.
18. The amplification is realized with the following PCR program:
initial denaturation step at 95 °C for 5 min; 35 cycles: dena-
turation at 95 °C for 1 min, annealing at a temperature
depending on primers Tm for 1 min, elongation at 72 °C for
1 min; final elongation step at 72 °C for 7 min.
19. Check the size of the PCR products on a 2 % agarose gel and
proceed with sequencing (Subheading 3.3.2).

3.3.2 Sanger Sequencing 1. Fill the positive PCR products tubes with dH2O up to 100 μl.
of PCR Products 2. Purify the PCR products using the QIAquick PCR Purification
Kit or equivalent following the manufacturer’s instructions.
3. Set up the sequencing PCR as following: 10 ng of purified
PCR product, 1 μl of sequencing oligonucleotide (10 pmol/
μl), 1 μl of Big Dye terminator, 2 μl of 5× sequencing buffer,
and dH2O to a final volume of 10 μl. Pipet the reactions in a
sequencing PCR plate. The amplification is realized with the
 Cell-SELEX 221

following PCR program: initial denaturation step at 95 °C for

2 min; 25 cycles: denaturation at 95 °C for 10 s, annealing at
a temperature depending on primers Tm for 5 s, elongation at
60 °C for 4 min.
4. Add 30 μl of dH2O and 60 μl of 100 % ethanol to the samples
to precipitate the sequenced product.
5. Cover the sequencing plate with aluminum tape. Mix by care-
fully inverting the plate several times.
6. Incubate at room temperature for 15 min.
7. Spin at 2,000 × g for 45 min.
8. Carefully remove the supernatant by inverting the plate.
9. Centrifuge the inverted plate at 700 × g. Once the speed is
reached stop the centrifuge.
10. Air-dry the pellet for 10 min. Protect from light.
11. Perform sequencing on an ABI Prism 3100-Sequencer.
12. Analyze the sequences and determine the aptamers structures,
for example with mfold (see Notes 8 and 9).

3.4 In Vitro 1. Prepare the following PCR mix: 1 μl of each oligonucleotide

Binding Assay (10 pmol/μl; sense oligonucleotide unmodified, antisense oligo-
nucleotide with Spacer C18 (HEG)), 2.5 U of Pfu DNA poly-
merase, 10 μl of 10 x Pfu DNA polymerase buffer, 0.3 μl dNTP
mix (25 mM), and 10 μl of template from Subheading 3.2.1,
step 6.
2. Add dH2O to a final volume of 100 μl.
3. The amplification is realized with the following PCR program:
initial denaturation step at 95 °C for 5 min; 25 cycles: dena-
turation at 95 °C for 1 min, annealing at a temperature
depending on primers Tm for 1 min, elongation at 72 °C for
1 min; final elongation step at 72 °C for 7 min.
4. Add 6 x loading dye to an aliquot of the PCR product and
load it on a 2.5 % agarose gel.
5. Run the gel at 100 V for 25 min in 1× TBE buffer.
6. Extract the nucleic acids by adding phenol–chloroform–isoamyl
alcohol and precipitate with ethanol and 3 M sodium acetate.
7. Air-dry the pellet and dissolve it in 35 μl of dH2O.
8. Separate the DNA strands on a denaturing PAA gel electro-
phoresis and purify as in Subheading 3.2.2.
9. Examine the binding efficiency of single aptamers compared
to each other. Examine the initial library as well to evaluate the
enrichment brought by the SELEX procedure (see Notes 10
and 11). In addition to the initial library, the binding capacity
of selected aptamers can also be compared to scrambled oligo-
nucleotides (see Note 12).
222 Helena Dickinson et al.

10. Incubate 10 pmol of a pool or of a single aptamer with 10 U

of T4 PNK, 1 μl of 10× T4 PNK buffer, 1 μl of γ-32P-ATP, and
dH2O to a final volume of 10 μl.
11. Incubate for 60 min at 37 °C. Label 10 pmol of the initial
library in the same way.
12. Add another 10 μl of dH2O to the reaction mixture and purify
on a Sephadex G25 column.
13. Boil the labeled eluate for 5 min at 95 °C in 1 ml of SELEX
buffer and cool for 10 min on ice.
14. Wash cells twice with 2 ml of pre-warmed PBS.
15. Incubate the cooled labeled eluate with the cells for 30 min at
37 °C.
16. Transfer the supernatant, which contains the unbound aptam-
ers, in a scintillation cup.
17. Wash cells twice in 2 ml of SELEX washing buffer. Transfer
the supernatant, which contains loosely binding aptamers, in
another scintillation cup.
18. Add 300 μl of pre-warmed Trypsin to the cells and incubate
for 5 min at 37 °C.
19. Scrape cells off with a scraper and transfer them to another
scintillation cup. These cells feature the bound aptamers.
20. Determine the binding capacity of the aptamers using a scintil-
lation counter (see Note 13).

4 Notes

1. Choose a company to synthesize the initial oligonucleotide

library and all other oligonucleotides. The library consists of a
random central sequence flanked by two known sequences of
about 20 nucleotides. The flanking regions are needed for
PCR amplification. A key requirement is that the random
sequence covers as much sequences as possible to increase the
population of selectable aptamers of high affinity and specific-
ity. For all oligonucleotides choose the best purity offered
(i.e., HPLC or PAGE purified).
2. A forward primer with an upstream T7 RNA polymerase pro-
moter is used to generate an RNA library by in vitro transcrip-
tion. Complete the binding and washing as described and
elute the selected RNA aptamers. A reverse transcription is
performed and the obtained cDNA is amplified by PCR. Strands
do not need to be separated. The PCR product can be in vitro
transcribed and reintroduced into the next SELEX step.
3. The forward oligonucleotide can be biotinylated and sepa-
rated owing to the extremely high affinity between biotin and
streptavidin.
 Cell-SELEX 223

4. Any other cloning system can be chosen.

5. Culture cells according to SOP. The amount of cells seeded in
each well has to be identical.
6. In case a pre-selection is performed, first incubate the library
SELEX buffer solution with the non-target cells for 30 min at
37 °C, then transfer the library SELEX buffer solution to the
target cells. Incubate for 30 min at 37 °C.
7. A DNA base roughly corresponds to 330 g/mol for single-
stranded DNA.
8. The sequences obtained can be analyzed by multiple sequence
alignment with the program ClustalW2 [28, 29]. The align-
ments can be edited with Jalview 2.6. Sequence motives can
be identified by applying the software MEME 4.4.0 (Multiple
Em for Motif Elicitation) and Weblogo [30, 31].
9. Mfold is a free program enabling to predict secondary struc-
tures of single-stranded nucleic acids [24].
10. Other methods to determine the binding capacity, e.g., Surface
Plasmon Resonance (SPR) can also be applied.
11. Single aptamers can be ordered by companies synthesizing
oligonucleotides.
12. The scrambled oligonucleotide contains the flanking regions
of the initial library. Make sure the variable region differs from
the aptamer that is intended to be examined.
13. The binding capacity is calculated by dividing the counts mea-
sured by Čerenkov radiation of bound cells by the sum
obtained by adding unbound, wash, and bound counts.

References
1. Tuerk C, Gold L (1990) Systematic evolution 7. Mosing RK, Mendonsa SD, Bowser MT
of ligands by exponential enrichment: RNA (2005) Capillary electrophoresis-SELEX selec-
ligands to bacteriophage T4 DNA polymerase. tion of aptamers with affinity for HIV-1 reverse
Science 249:505–510 transcriptase. Anal Chem 77:6107–6112
2. Ellington AD, Szostak JW (1990) In vitro 8. Chen F, Hu Y, Li D et al (2009) CS-SELEX
selection of RNA molecules that bind specific generates high-affinity ssDNA aptamers as
ligands. Nature 346:818–822 molecular probes for hepatitis C virus envelope
3. Patel DJ (1997) Structural analysis of nucleic glycoprotein E2. PLoS One 4:e8142
acid aptamers. Curr Opin Chem Biol 1:32–46 9. Kawakami J, Imanaka H, Yokota Y et al (2000)
4. Hermann T, Patel DJ (2000) Adaptive recog- In vitro selection of aptamers that act with
nition by nucleic acid aptamers. Science Zn2+. J Inorg Biochem 82:197–206
287:820–825 10. Mann D, Reinemann C, Stoltenburg R et al
5. Patel DJ, Suri AK (2000) Structure, recognition (2005) In vitro selection of DNA aptamers
and discrimination in RNA aptamer complexes binding ethanolamine. Biochem Biophys Res
with cofactors, amino acids, drugs and amino- Commun 338:1928–1934
glycoside antibiotics. J Biotechnol 74:39–60 11. Lauhon CT, Szostak JW (1995) RNA aptam-
6. Schneider DJ, Feigon J, Hostomsky Z et al ers that bind flavin and nicotinamide redox
(1995) High-affinity ssDNA inhibitors of the cofactors. J Am Chem Soc 117:1246–1257
reverse transcriptase of type 1 human immuno- 12. Holland CA, Henry AT, Whinna HC et al
deficiency virus. Biochemistry 34:9599–9610 (2000) Effect of oligodeoxynucleotide
224 Helena Dickinson et al.

thrombin aptamer on thrombin inhibition by 21. Bianchini M, Radrizzani M, Brocardo MG

heparin cofactor II and antithrombin. FEBS et al (2001) Specific oligobodies against
Lett 484:87–91 ERK-2 that recognize both the native and the
13. Bruno JG, Carrillo MP, Phillips T et al (2008) denatured state of the protein. J Immunol
Competitive FRET-aptamer-based detection Methods 252:191–197
of methylphosphonic acid, a common nerve 22. Fitzwater T, Polisky B (1996) A SELEX
agent metabolite. J Fluoresc 18:867–876 primer. Methods Enzymol 267:275–301
14. Ruckman J, Green LS, Beeson J et al (1998) 23. Schutze T, Wilhelm B, Greiner N et al (2011)
2′-Fluoropyrimidine RNA-based aptamers to Probing the SELEX process with next-
the 165-amino acid form of vascular endothe- generation sequencing. PLoS One 6:e29604
lial growth factor (VEGF165). Inhibition of 24. Zuker M (2003) Mfold web server for nucleic
receptor binding and VEGF-induced vascular acid folding and hybridization prediction.
permeability through interactions requiring Nucleic Acids Res 31:3406–3415
the exon 7-encoded domain. J Biol Chem 25. Famulok M, Hartig JS, Mayer G (2007)
273:20556–20567 Functional aptamers and aptazymes in bio-
15. White R, Rusconi C, Scardino E et al (2001) technology, diagnostics, and therapy. Chem
Generation of species cross-reactive aptam- Rev 107:3715–3743
ers using “toggle” SELEX. Mol Ther 4: 26. Tucker CE, Chen LS, Judkins MB et al (1999)
567–573 Detection and plasma pharmacokinetics of an
16. Savla R, Taratula O, Garbuzenko O et al anti-vascular endothelial growth factor
(2011) Tumor targeted quantum dot-mucin 1 oligonucleotide-aptamer (NX1838) in rhesus
aptamer-doxorubicin conjugate for imaging monkeys. J Chromatogr B Biomed Sci Appl
and treatment of cancer. J Control Release 732:203–212
153:16–22 27. Ng EW, Shima DT, Calias P et al (2006)
17. Tang Z, Parekh P, Turner P et al (2009) Pegaptanib, a targeted anti-VEGF aptamer for
Generating aptamers for recognition of virus- ocular vascular disease. Nat Rev Drug Discov
infected cells. Clin Chem 55:813–822 5:123–132
18. Hamula CL, Le XC, Li XF (2011) DNA 28. Higgins DG, Thompson JD, Gibson TJ (1996)
aptamers binding to multiple prevalent Using CLUSTAL for multiple sequence align-
M-types of Streptococcus pyogenes. Anal ments. Methods Enzymol 266:383–402
Chem 83:3640–3647 29. Larkin MA, Blackshields G, Brown NP et al
19. Kolesnikova O, Kazakova H, Comte C et al (2007) Clustal W and Clustal X version 2.0.
(2010) Selection of RNA aptamers imported Bioinformatics 23:2947–2948
into yeast and human mitochondria. RNA 30. Schneider TD, Stephens RM (1990) Sequence
16:926–941 logos: a new way to display consensus
20. Stoltenburg R, Reinemann C, Strehlitz B sequences. Nucleic Acids Res 18:6097–6100
(2005) FluMag-SELEX as an advantageous 31. Crooks GE, Hon G, Chandonia JM et al
method for DNA aptamer selection. Anal (2004) WebLogo: a sequence logo generator.
Bioanal Chem 383:83–91 Genome Res 14:1188–1190
 Chapter 21

Small Non-Coding RNAs and Aptamers in Diagnostics

and Therapeutics
Marissa Leonard, Yijuan Zhang, and Xiaoting Zhang

Abstract
Small non-coding RNAs (sncRNAs) such as small interfering RNAs (siRNAs), microRNAs (miRNAs) and
RNA aptamers have recently emerged as highly versatile and valuable tools in disease diagnostics and thera-
peutics, largely due to their key regulatory functions in many human diseases including cancer, viral infec-
tions, genetic disorders, etc. Recent technological advancements as described in the previous chapters have
greatly aided the discovery of sncRNAs and their applications for disease detection and therapy. Here, we
describe the advantages of using sncRNAs as diagnostic and therapeutic tools, followed by some of the
most recent examples of their use and a vision for the future perspectives.

Key words Small non-coding RNA, siRNA, miRNA, RNA aptamers, RNA nanotechnology,
Diagnostics and therapeutics

1 Introduction

The biological understanding of RNA function has dramatically

expanded within the past 30 years with evidences supporting its
key roles in protein synthesis, and more recently in gene expression
regulation [1]. The latter can, in part, be attributed to small non-
coding RNAs (sncRNAs) such as small interfering RNAs (siRNAs)
and micro RNAs (miRNAs) [2, 3]. siRNAs are double stranded
RNAs consisting of approximately 21 base pairs that have the abil-
ity to interfere with the expression of target genes by eliciting the
RNA interference (RNAi) pathway. miRNAs are small single
stranded RNAs of similar length that can recognize target mRNA
transcripts to inhibit their translation into proteins. RNA aptamers
are also considered sncRNAs because they are composed of single
strands of RNA of various lengths but often less than 100–200
nucleotides. RNA aptamers are commonly selected through a pro-
cess called SELEX for their ability to bind to a desired target, which
can include proteins, cells, and other moieties with high affinity
and specificity to regulate their function [4]. The abundance of

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6_21, © Springer Science+Business Media New York 2015

225
226 Marissa Leonard et al.

regulatory functions of small ncRNAs and aptamers in health and

disease makes them especially valuable tools in diagnostics and
therapeutics in clinical settings. In this chapter, we will discuss the
advantages of using sncRNAs as therapeutic and diagnostic agents,
followed by some of the most recent examples of their use in thera-
peutics and diagnostics and also a future perspective.

2 Advantages of Using RNA in Therapeutics and Diagnostics

There are multiple advantages to using small non-coding RNAs

and RNA aptamers as therapeutic and diagnostic agents over other
molecules commonly used in biomedicine like antibodies and pep-
tides. First, these non-coding RNAs are known to elicit little to no
immunogenic effects, thus overcoming the most common major
obstacle of current monoclonal antibody and peptide therapies
[5]. Secondly, small non-coding RNAs and RNA aptamers can be
easily generated in high quantities and purity through controlled
synthesis [6–8]. In contrast, antibody preparation can be a very
laborious and costly process that is often accompanied with low
yields. Additionally, the thermodynamic stability of RNA is higher
than that of peptides or antibodies, especially with the recent
advancement of chemical (2′O-Me, 2′F, 2′deoxy, 2′NH3) modifi-
cations that enable it to resist ribonuclease shearing and degrada-
tion in vivo. Along with increasing thermodynamic stability, these
chemical modifications can also enhance their pharmacokinetic
and pharmacodynamic characteristics [9]. From a structural stand-
point, the single-stranded nature of RNA not only makes it easier
to enter cells than DNA of the same nucleotide length but also
allows for more specific and tighter binding to desired targets
because of its smaller size and distinct tertiary folding structure.
Furthermore, RNA can be conveniently conjugated to other func-
tional molecules like ribozymes to create “riboswitches” or
nanoparticles for tissue-specific and targeted delivery [9]. The
advantages addressed here highlight the versatility and capability of
non-coding RNAs and RNA aptamers as tools in disease diagnos-
tics and therapeutics, as evidenced by the most recent advance-
ments made and examples described below.

3 sncRNAs and RNA Aptamers in Disease Diagnostics

Traditionally, antibodies have been the primary diagnostic tool

because of their ability to specifically target and bind to desired cell
markers. With recent advancements in RNA nanotechnology, small
non-coding RNAs have evolved to be a novel, advantageous alter-
native. This section focuses on the diagnostic and prognostic appli-
cations of various small non-coding RNAs in human disease as
imaging tools, disease cell detection devices, biomarkers, etc.
 sncRNAs in Diagnostics and Therapeutics 227

3.1 miRNAs microRNAs (miRNAs) have recently emerged as highly promising

as Diagnostic Tools biomarkers in the field of diagnostics as studies have demonstrated
that relatively few miRNAs are able to provide large amounts of
diagnostic and prognostic information detailing the specific disease
and its progression [10, 11]. For example, one study identified
four miRNAs (hsa-miR-15b, hsa-miR-181b, hsa-miR-191, and
hsa-miR-200c) that are significantly overexpressed in colorectal
tumor samples in comparison to normal colorectal tissue, helping
to support the use of miRNAs for early detection, screening, and
surveillance in colorectal and other occult cancers [12, 13].
Moreover, a six-miRNA-based classifier using the LASSO Cox
regression model has been used to effectively classify patients with
stage II colon cancer into groups at low and high risk of disease
recurrence, thereby adding prognostic value to the traditional clin-
icopathological risk factors [11]. miRNAs can be further used as
biomarkers for identifying tissue origin in metastatic tumors [13, 14].
By measuring miRNA expression levels in 22 different tumor tis-
sues and metastases, one group was able to classify the origins of
two thirds of the samples with high confidence and greater than
90 % accuracy [14]. Excitingly, a panel of diagnostic miRNA bio-
markers, like those mentioned here, are offered to clinicians to
help identify primary origins of tumor metastases where origins are
unclear, helping to exemplify the true potential of miRNA diag-
nostics in clinical settings [15].
Circulating miRNA profiles from patient plasma and serum
have also proven to be of important prognostic value. For example,
miR-141, a microRNA highly overexpressed in prostate cancer, is
readily measured in serum, and can be used to identify prostate
cancer patients from non-cancer controls [16]. More recently, it
was reported that four miRNAs (hsa-miR-148b, hsa-miR-376c,
hsa-miR-409-3p, and hsa-miR-801) were significantly upregulated
in the plasma of early stage breast cancer patients, implicating these
miRNAs as potential biomarkers for early detection of breast cancer
[17]. In addition, miRNAs can be found in urine and saliva samples.
It was observed that miR-125a and miR-200a reside in lower levels
in patients’ saliva with oral cancer than healthy individuals’ saliva,
thus highlighting the diagnostic potentials of miRNAs in cancer
and disease detection through noninvasive approaches [18]. In all,
these circulating miRNA biomarkers represent a way for noninva-
sive clinical detection of cancer and therefore may make future diag-
nostic procedures less strenuous for both patients and clinicians.

3.2 RNA Aptamers As mentioned previously, RNA aptamers can recognize and bind to
as Diagnostic Tools a desired target with high affinity and specificity, making aptamers
ideal imaging tools for disease diagnosis. One such example includes
a radiolabeled aptamer that can target and be quickly taken up by
desired tumors. Tenascin C is an extracellular matrix protein that is
over-expressed in multiple tumor types, including breast, lung,
colon, prostate and lymphoma. A radiolabeled anti tenascin-C
228 Marissa Leonard et al.

aptamer (TTA1-99mTc) has been used to target such cell types, with
efficient uptake due to rapid blood clearance and tumor penetra-
tion rates with a half-life of less than 2 min [19]. As an advantage
of this rapid uptake of aptamers by tumors, the bloodstream is
quickly cleared of any unconsumed radioactive substances. In addi-
tion to high-quality tumor imaging, this method also limits toxic-
ity that typically accompanies the use of radioactively labeled
antibodies in response to their inability to be cleared quickly from
the body [20]. Another example of such application in tumor
imaging is the A10 aptamer that binds specifically to PMSA, a
prominent prostate cancer marker. When conjugated to quantum
dots and a low-toxicity contrast agent typically used in MRI imag-
ing known as TCL-SPION (thermally cross-linked supraparamag-
netic iron oxide nanoparticle), the TCL-SPION-A10 aptamer
allows for efficient imaging and recognition of prostate cancer
tumors [21, 22]. Additional examples of RNA aptamers character-
ized with diagnostic attributes include RNA aptamers that target
EGFR (Epidermal Growth Factor Receptor), a receptor tyrosine
kinase strongly overexpressed in more than half of Glioblastoma
multiforme (GMB) tumors, CD30 of Hodgkin’s Lymphoma, p68
RNA Helicase of intrahepatic CT26 tumors and colorectal tumor
cells, and hVEGF165 that is expressed in a variety of different cancer
cell types [4]. Utilization of these aptamers not only addresses
early detection difficulties that arise in many cancer patients but
also provides a novel surgical verification method to confirm that
local tissue margins of removed tumors are indeed disease free.

4 sncRNAs and RNA Aptamers in Therapeutics

Due to their ability to target almost any given intracellular and

extracellular components of key signaling pathways involved in
human diseases, sncRNAs and RNA aptamers have started to
become highly attractive new-generation therapeutic agents to tar-
get these signaling pathways for the treatment of cancer, viral infec-
tions and other diseases [4, 23]. Here, we briefly overview the
current advancements and provide several examples of applying
small ncRNAs and RNA aptamers for targeted therapy. With the
exciting FDA approval of an RNA aptamer-based therapy and, most
recently, RNA antisense oligonucleotide-based therapeutics for
clinical use, we expect this area of research will gain huge momen-
tum with many more sncRNA- and RNA aptamer-based applica-
tions emerging in disease therapeutics in the very near future.

4.1 RNA Aptamers One of most significant therapeutic developments in the RNA
in Therapeutics aptamer field is the approval of Pegaptanib (Macugen, Eyetech
Pharmaceutics/Pfizer) by the US Food and Drug Administration
(FDA) for the treatment of age-related macular degeneration
 sncRNAs in Diagnostics and Therapeutics 229

(AMD) in 2004 [24, 25]. Pegaptanib is an RNA aptamer against

Vascular Endothelial Growth Factor isoform 165 (VEGF165), an
important protein known to function in angiogenesis and neovascu-
larization in age-related macular degeneration (AMD) and diabetic
macular edema (DME) [24, 25]. Significantly, this particular RNA
aptamer, Pegaptanib, has exhibited superior ability to bind and
block extracellular VEGF165’s mitogenic function and vascular per-
meability enhancing ability. Remarkably, it elicits no toxic side effects
and has a very long half-life with one study showing that it can
remain biologically active in the eye for as long as 28 days [24, 25].
Following the arrival of an FDA-approved and clinically admin-
istered RNA aptamer-based drug, researchers began extensively
seeking out other aptamers with high therapeutic potential, espe-
cially for cancer treatments. One group identified RNA aptamer
E07 that has high binding affinity and specificity for EGFR. They
found aptamer E07 can be readily taken up by EGFR-expressing
cancer cells, indicating its potential as an EGFR-targeted therapeu-
tic vehicle to escort other anticancer moieties into specific target
cells [26]. Another group conjugated an anti-prostate specific
membrane antigen (PSMA) aptamer, A9, previously shown to
tightly bind prostate tumor cells, with siRNAs targeting lamin
A/C or GAPDH [27]. This aptamer–siRNA conjugate showed
successful knockdown of target gene expression in PSMA express-
ing cells but not in negative controls [27]. Similar results were seen
when RNA aptamer A10, also known to specifically target PSMA,
was conjugated to siRNAs against polio-like kinase 1 (PLK1) and
B-cell lymphoma 2 (BCL2) [28]. These aptamer–siRNA conju-
gates have been further tested both in vitro and in vivo in animal
models with very exciting data showing successful siRNA-mediated
depletion of target proteins and death of prostate cancer cells [28].
Additionally, a siRNA-RNA aptamer conjugate is currently
under development for therapies against infections of Human
Immunodeficiency Virus type 1 (HIV-1). For the HIV-1 virus to
replicate, it uses glycoprotein gp120 to recognize cell surface
receptor CD4 in host cells to initiate membrane fusion for the
delivery of viral material. By linking an anti-gp120 aptamer with
anti-HIV tat/rev siRNAs, it was found that this siRNA-RNA
aptamer conjugate can be efficiently and specifically taken up by
gp120-expressing cells [29]. The linked anti-tat/rev siRNA was
then processed by endoribonuclease Dicer, which led to successful
inhibition of HIV replication while eliciting no immune response
[29]. These advancements highlight a promising future for siRNA-
RNA aptamer conjugates not only as therapeutic reagents for can-
cer, but also for the treatment of viral infection and other diseases.

4.2 miRNAs, siRNAs, In a similar fashion to RNA aptamers, sncRNAs like miRNAs, siR-
and ASOs in NAs, and antisense oligonucleotides (ASOs) have proven to be
Therapeutics successful in the field of disease therapeutics. Indeed, an antisense
230 Marissa Leonard et al.

oligonucleotide-based therapy (Kynamro) has recently gained

FDA approval for the treatment of high cholesterol, a major con-
tributor to Coronary Heart Disease (CDH). Kynamro is a so-
called “second generation” antisense oligonucleotide with
aforementioned chemical modifications including 2′ methoxyethyl
substitutions at the 5′ and 3′ ends of the oligonucleotides and the
addition of phosphorothioates at each internucleotide linkage that
greatly increase the efficacy and stability of the moieties in serum
[15]. Once injected, these oligonucleotides can target apolipopro-
tein B100 mRNA transcripts for degradation and thus inhibit cho-
lesterol production in the liver [15]. The success of Kynamro
highlights how chemical modification, like those made to RNA
aptamers, to sncRNAs can provide for stable and successful in vivo
targeted therapies for human disease.
In addition to RNA aptamers and ASOs, siRNAs and miRNAs
have shown strong potential in the field of disease therapeutics.
There are numerous siRNA-based therapies currently in preclinical
development, with some of such siRNAs in early-stage clinical trials
for treatment of diseases including pachyonchyia congenita, meno-
pausal osteoporosis, and pancreatic and other advanced cancers.
As previously described for aptamers and other small ncRNAs, suc-
cessful delivery is the key for the effectiveness of siRNA-mediated
downregulation of specific target genes. Recent progress has been
made to increase the potential for successful siRNA-delivery by uti-
lizing modified lipid-like carriers, siRNA conjugates, as well as tar-
geted nanoparticles that can stabilize and aid in the specific targeted
delivery of siRNAs [30, 31]. One such example is the Triantennary
GalNAc- siRNA conjugate, which has three GalNAc molecules
attached to the 3′ terminus of the siRNA through a triantennary
spacer [32]. The most advanced GalNAc-siRNA is the ALN-TTRsc,
which silences transthyretin (TTR) in attempt to treat TTR-
amyloidosis, has recently entered phase 1 clinical trials with high
potential for success [32]. Another example of siRNA demonstrat-
ing successful therapeutic potential is a lipid nanoparticle-siRNA
conjugate targeting VEGF and kinesin spindle protein (KSP) for
cancer treatment [33]. In recent in-human trials, this siRNA conju-
gate produced a multitude of desired effects, among them the com-
plete regression of liver metastases in endometrial cancer [33]. With
the continued optimization of siRNA delivery methods, siRNA-
based therapeutics will continue to expand in the field of disease
therapeutics, with a continued trend in clinical trial entrance and
approval for clinical use expected in the near future [34, 35].
miRNAs have the unique characteristic to serve as both thera-
peutic agents and therapeutic targets for disease treatments [9].
The latter is characterized in part by the use of modified antisense-
miRNA oligonucleotides, termed “anti-miRs” [15]. For example,
Miravirsen is a modified oligonucleotide designed to inhibit miR-
122, a miRNA which is necessary for functional infection of the
Hepatitis C Virus (HCV). Presently, Miravirsen has completed two
 sncRNAs in Diagnostics and Therapeutics 231

phase I clinical trials and is currently enrolled in a phase IIa clinical

trial showing promising results in significantly lower levels of HCV
RNA in HCV patients [15]. As therapeutic agents, reexpression of
miRNAs has also provided multiple preclinical evidences of being
successful for disease therapy. For example, Chronic Lymphocytic
Leukemia (CLL) is a prominent human leukemia characterized by
malignant B cells that overexpress apoptotic BCL2 protein, while
microRNAs miR-15a and miR-16-1 levels have shown to be
inversely correlated with BCL2 in CLL tumor growth [36]. It was
found that reintroduction of miR-15a and miR-16-1 expression
could lead to reduced levels of BCL2 and suppression of tumor
growth. In another example, miR-4423 was known to be down-
regulated in most lung tumors and its ectopic expression has been
shown to significantly inhibit the lung tumor growth [37].
Currently, there are increasing examples of preclinical miRNAs
with the therapeutic potential similar to what we have outlined
above [9]. With the development of efficient approaches to deliver
miRNA mimics and anti-miRs, and additional in vivo and clinical
testing, we expect they will likely have important impacts on the
treatment of many diseases.

5 Conclusion and Future Perspective

In this chapter, we have discussed the characteristics of sncRNAs

and how they can be used as advantageous diagnostic and therapeu-
tic agents. We have also provided some success stories and future
examples of the use of sncRNAs as novel therapeutics for human
diseases, biomarkers and early detectors of cancer types, identifiers
of metastatic tumor tissue origins, inhibitors of viral transmission,
etc. As discussed in the preceding chapters of this book, recent
advancements in technologies such as next-generation sequencing,
zinc-mediated RNA fragmentation, RNase protection assays, and
new in vitro and in vivo cell and tissue-based SELEX procedures
have aided in the identification of sncRNAs. Once identified,
sncRNAs can be further visualized and analyzed using a number of
different procedures, including in situ hybridization, microarray,
and NGS. We expect these new technical advancements will greatly
increase the repertoire of sncRNAs and broaden their applications
in the diagnosis and therapy of human diseases. With the FDA
approval of the first RNA aptamer-based drug therapy almost a
decade ago and the most recent second-generation antisense RNA
treatment last year, there is no doubt that this field will gain sus-
tained momentum with an explosion in the discovery of new
sncRNAs for novel diagnostic and therapeutic applications.
Combined with the many advantages that sncRNAs have over other
traditional reagents such as antibodies, we have a plethora of reasons
to be fully optimistic about the future of sncRNAs as a mainstay of
next-generation medicine in disease diagnostics and therapeutics.
232 Marissa Leonard et al.

Acknowledgments

We thank members of X. Zhang laboratories for valuable com-

ments and suggestions. This study was supported by Department
of Defense Idea Award, Susan G. Komen for the Cure Foundation’s
Career Catalyst Grant, and American Cancer Society Research
Scholar Award to X. Z.

References
1. Eddy SR (2001) Non-coding RNA genes and 15. Hydbring P, Gayane BV (2013) Clinical appli-
the modern RNA world. Nat Rev Genet cations of microRNAs. F1000Research 2, 1.
2:919–929 16. Mitchell PS et al (2008) Circulating microR-
2. He L, Hannon GJ (2004) MicroRNAs: small NAs as stable blood-based markers for cancer
RNAs with a big role in gene regulation. Nat detection. Proc Natl Acad Sci U S A
Rev Genet 5:522–531 105:10513–10518
3. Wu L, Belasco JG (2008) Let me count the 17. Cuk K et al (2013) Circulating microRNAs in
ways: mechanisms of gene regulation by miR- plasma as early detection markers for breast
NAs and siRNAs. Mol Cell 29:1–7 cancer. Int J Cancer 132:1602–1612
4. Germer K, Leonard M, Zhang X (2013) RNA 18. Park NJ et al (2009) Salivary microRNA: dis-
aptamers and their therapeutic and diagnostic covery, characterization, and clinical utility for
applications. Int J Biochem Mol Biol 4:27–40 oral cancer detection. Clin Cancer Res
5. Pendley C, Schantz A, Wagner C (2003) 15:5473–5477
Immunogenicity of therapeutic monoclonal 19. Hicke BJ et al (2006) Tumor targeting by an
antibodies. Curr Opin Mol Ther 5:172–179 aptamer. J Nucl Med 47:668–678
6. Ellington AD, Szostak JW (1990) In vitro 20. Pieve CD, Perkins AC, Missailidis S (2009) Anti-
selection of RNA molecules that bind specific MUC1 aptamers: radiolabelling with (99 m)Tc
ligands. Nature 346:818–822 and biodistribution in MCF-7 tumour-bearing
7. Tuerk C, Gold L (1990) Systematic evolution mice. Nucl Med Biol 36:703–710
of ligands by exponential enrichment: RNA 21. Dua P, Kim S, Lee DK (2011) Nucleic acid
ligands to bacteriophage T4 DNA polymerase. aptamers targeting cell-surface proteins.
Science 249:505–510 Methods 54:215–225
8. Cox JC, Rudolph P, Ellington AD (1998) 22. Wang AZ et al (2008) Superparamagnetic iron
Automated RNA selection. Biotechnol Prog oxide nanoparticle-aptamer bioconjugates for
14:845–850 combined prostate cancer imaging and ther-
9. Burnett JC, Rossi JJ (2012) RNA-based thera- apy. ChemMedChem 3:1311–1315
peutics: current progress and future prospects. 23. Lu PY, Woodle MC (2008) Delivering small
Chem Biol 19:60–71 interfering RNA for novel therapeutics.
10. Lu J et al (2005) MicroRNA expression pro- Methods Mol Biol 437:93–107
files classify human cancers. Nature 435: 24. Gragoudas ES et al (2004) Pegaptanib for
834–838 neovascular age-related macular degeneration.
11. Zhang JX et al (2013) Prognostic and predic- N Engl J Med 351:2805–2816
tive value of a microRNA signature in stage II 25. Ng EW, Adamis AP (2006) Anti-VEGF
colon cancer: a microRNA expression analysis. aptamer (pegaptanib) therapy for ocular vascu-
Lancet Oncol 14:1295–1306 lar diseases. Ann N Y Acad Sci 1082:151–171
12. Aslam MI et al (2009) MicroRNAs are novel 26. Li N et al (2011) Inhibition of cell prolifera-
biomarkers of colorectal cancer. Br J Surg tion by an anti-EGFR aptamer. PLoS One
96:702–710 6:e20299
13. Taft RJ et al (2010) Non-coding RNAs: regu- 27. Chu TC et al (2006) Aptamer mediated siRNA
lators of disease. J Pathol 220:126–139 delivery. Nucleic Acids Res 34:e73
14. Rosenfeld N et al (2008) MicroRNAs accu- 28. McNamara JO 2nd et al (2006) Cell type-
rately identify cancer tissue origin. Nat specific delivery of siRNAs with aptamer-siRNA
Biotechnol 26:462–469 chimeras. Nat Biotechnol 24:1005–1015
 sncRNAs in Diagnostics and Therapeutics 233

29. Zhou J et al (2008) Novel dual inhibitory VEGF and KSP in cancer patients with liver
function aptamer-siRNA delivery system for involvement. Cancer Discov 3:406–417
HIV-1 therapy. Mol Ther 16:1481–1489 34. Akinc A et al (2009) Development of lipidoid-
30. Dassie JP et al (2009) Systemic administration siRNA formulations for systemic delivery to
of optimized aptamer-siRNA chimeras pro- the liver. Mol Ther 17:872–879
motes regression of PSMA-expressing tumors. 35. Gavrilov K, Saltzman WM (2012) Therapeutic
Nat Biotechnol 27:839–849 siRNA: principles, challenges, and strategies.
31. Davis ME et al (2010) Evidence of RNAi Yale J Biol Med 85:187–200
in humans from systemically administered 36. Cimmino A et al (2005) miR-15 and miR-16
siRNA via targeted nanoparticles. Nature 464: induce apoptosis by targeting BCL2. Proc
1067–1070 Natl Acad Sci U S A 102:13944–13949
32. Kanasty R et al (2013) Delivery materials for 37. Perdomo C et al (2013) MicroRNA 4423 is a
siRNA therapeutics. Nat Mater 12:967–977 primate-specific regulator of airway epithelial
33. Tabernero J et al (2013) First-in-humans trial cell differentiation and lung carcinogenesis.
of an RNA interference therapeutic targeting Proc Natl Acad Sci U S A 110:18946–18951
 INDEX

A Cloning........................................................ 53–62, 103, 110,

112, 116, 117, 147, 176, 178, 183, 188, 192–193, 195,
Absorbance ........................................................... 17, 21, 106 197, 214, 218, 220, 223
Acrylamide ................................................ 57–59, 67–69, 71, Complementary DNA (cDNA) ...................... 14–15, 54, 55,
122–123, 125, 126, 157, 160, 205 59, 73, 86, 87, 89, 92, 94, 96, 98, 99, 104, 108, 110,
Adaptor ....................................................... 3, 110, 112, 114, 115, 121, 134, 139, 140, 142, 144, 146, 147, 176, 181,
117, 144–148, 156–160, 177–178, 180–182 184, 188, 192–194, 196, 214, 222
Agarose .................................................18, 19, 22, 25–26, 37, Concentration........................................................ 11–15, 17,
112, 116, 178, 182, 185, 190, 192, 193, 216, 219–221 18, 20, 21, 24, 25, 27, 68, 70, 78, 79, 89–90, 94, 95,
Ammonium acetate .......................................... 12, 13, 57, 59 97, 99, 106, 117, 127–130, 133, 145, 147, 148, 156,
Amplification .............................................. 96–98, 100–101, 165, 169, 170, 184, 190, 192, 200, 201, 206, 207, 209,
104, 107, 110, 115–116, 140, 144, 146, 147, 157, 176, 216, 219
181–182, 188–192, 194, 214–216, 218–222 Crosslink .......................................................... 33, 34, 41–50
Antibody.......................................................... 44, 46, 73, 77, Cross-linking and immunoprecipitation
80, 152, 154, 158, 226, 228, 231 (CLIP) seq ....................................................151–160
Antisense .................................... 4, 43, 45, 53, 54, 56–58, 61, 1-cyclohexyl-(2-morpholinoethyl) carbodiimide
62, 188–191, 198, 204, 215, 216, 219, 221, 228–231 metho-p-toluene sulphonate (CMCT) ....... 119, 122,
Antisense oligonucleotide (ASO) ............................ 189, 190, 124, 128, 132
204–210, 215, 216, 221, 228–231
Aptamer ....................213–216, 218–219, 221–223, 225–231 D
B Decapping ........................................................................145
Deep sequencing. See High throughput sequencing
Bacteria.......................... 30–32, 35–37, 53, 74, 190–194, 213 Degradation..................................................... 17, 19, 25, 36,
Binding .......................................53, 103, 104, 151–160, 187, 37, 74, 109, 117, 147, 152, 159, 184, 198, 226, 230
88, 208–209, 213, 214, 216–218, 221–223, 225–229 Denaturation ........................................18, 26–27, 91, 93, 95,
Bioanalyzer ....................................... 18, 19, 24–28, 106–107 106, 107, 115, 146, 168, 182, 184, 191–193, 218–221
Blank ..................................................................................21 Deoxyribonucleic acid (DNA)........................... 5, 12, 17, 42,
53, 65, 73, 88, 107, 112, 122, 142, 153, 169, 177, 190,
C
204, 214, 226
Caenorhabditis elegans ...................................................... 4, 95 Detection ........................................18, 26, 27, 29–38, 41–50,
Capillary electrophoresis........................... 18–20, 22–25, 121 58, 62, 65–71, 73–77, 79–81, 94, 96, 97, 99–101, 103,
Carbodiimide ....................................................... 42, 43, 124 104, 135, 139, 140, 144, 148, 176, 184, 208–210, 214,
Carrier 215, 217, 226–228, 231
glycogen ............... 12, 14–15, 70, 123–124, 126–129, 169 Diagnostic ..................................................... 43, 44, 74, 123,
linear polyacrylamide ........................................12, 14–15 125, 142, 147, 214, 225–231
yeast tRNA ............................12, 14, 20, 26–27, 127–130 Diethylpyrocarbonate (DEPC) ................... 12, 15, 111–114,
cDNA library.................................... 112, 114–115, 139–148 117, 120, 153, 156, 176, 179–181, 184, 207
Cell ..................................5, 13, 30, 31, 35, 53, 74–78, 80–81, Digestion .......................... 14–15, 54, 57–60, 66–67, 70, 126,
86, 94, 95, 151, 153–154, 158, 159, 163, 190–193, 127, 130, 132, 134, 135, 157, 189, 190, 192–194, 197
196–201, 206, 207, 209, 215, 217, 226–229, 231 Digoxigenin .....................................42, 44, 46–47, 49, 50, 73
Cell culture .............. 30, 31, 77, 152–154, 163, 191, 200, 215 Dimethylsulfate (DMS) .................................. 119, 120, 122,
Cell SELEX .............................................................213–223 124, 128, 132, 134, 162, 166, 190, 191, 193
Chemical probing ............................. 122, 124, 128–129, 132 Disease ................................ 86, 148, 161, 188, 204, 226–231
Chloroform............................... 30, 32, 34, 35, 57, 60, 67–69, Dot blot ........................................................................47, 48
112–114, 117, 122–124, 126–129, 140, 144, 153, Double stranded RNA (dsRNA) ...........53–62, 109, 199, 225
156, 162, 163, 177, 179, 180, 184, 215, 218, 219, 221 Drosophila ............................................................................4

Mathieu Rederstorff (ed.), Small Non-Coding RNAs: Methods and Protocols, Methods in Molecular Biology, vol. 1296,
DOI 10.1007/978-1-4939-2547-6, © Springer Science+Business Media New York 2015

235
 SMALL NON-CODING RNAS: METHODS AND PROTOCOLS
236 Index

E L
Electrophoresis Labeling ....................... 14, 28, 42, 43, 45–50, 57–59, 65–71,
agarose .......................................18, 19, 22, 190, 192, 219 73, 121–123, 126–130, 134, 135, 161, 162, 165–166,
capillary .............................................. 18, 19, 22–25, 121 168–170, 207, 210, 214, 215, 218, 222, 228
native ......................................................................19, 22 Lead ................................................... 3, 5, 13, 15, 18, 26–28,
polyacrylamide .....................126, 143, 209, 215, 216, 219 49–50, 53, 54, 96, 107, 117, 119, 121, 124, 128, 132,
Enzymatic probing ....................122–124, 127–128, 132, 135 159, 188, 201, 204, 208, 209, 231
Ethanol ...................................................... 12–14, 25, 31, 32, Library ............................................4, 29, 110, 112, 139–148,
34, 35, 37, 59–61, 67–68, 70, 71, 76, 78, 80, 81, 96, 153, 156–159, 213–214, 217, 221–223
111–114, 117, 124, 126–129, 141, 145–148, 162, Ligand ......................................................................213–223
165, 169, 170, 176, 177, 179–181, 184, 205, 215, Ligation ...................... 14–15, 54, 55, 58, 60–62, 65–71, 112,
218, 219, 221 114, 116, 126, 142–147, 156, 157, 159, 177–178,
Ethidium bromide (EtBr) ................................19, 31, 36, 37, 180–181, 183, 184, 190–193, 197, 216, 219–220
116, 140, 144, 146, 182, 207, 216 Linear polyacrylamide ............................................12, 14–15
Extraction ................................. 11, 17, 26, 29–38, 47, 60, 65, Lithium chloride (LiCl) ............................... 12, 13, 113, 117
68, 85, 88, 94–96, 106–107, 112, 113, 117, 122, Locked nucleic acid (LNA) ............................. 41–50, 74–76,
126–129, 141, 143–147, 154, 158, 161, 163–164, 80–81, 161, 162, 165, 166, 208, 230
169, 177–179, 184, 190, 216, 218, 219, 221 Luciferase ......................................................... 176, 187–198

F M
Fluorescence in situ hybridization (FISH) ...................73–81 Magnesium chloride (MgCl2) ............................... 12, 15, 25,
Fluorometer ............................................................19, 21–22 56, 58, 67, 112, 114, 115, 122–124, 131, 133,
Fluorometry..................................................................18, 89 141–143, 145, 152, 177, 178, 180, 181, 215
Membrane ............................................. 33, 42–50, 151–153,
G 155, 158, 159, 163, 169, 205, 207, 208, 210, 229
Genome ............................................................ 5, 53, 74, 203 Messenger RNA (mRNA) .................................. 3–5, 76, 85,
Glycogen ................... 12, 14–15, 70, 123–124, 126–129, 169 107, 132, 139, 140, 143, 151, 175–181, 185,
187–189, 194–200, 225, 230
H Microarray .....................................29, 41, 103, 161–170, 231
MicroRNA (miRNA)........................................ 4, 13, 17, 41,
High throughput sequencing............................... 17, 41, 121,
60, 74, 85, 103, 109, 165, 175, 187, 203, 207, 225
139–148, 156, 160
Mutagenesis...................................................... 191, 193–194
Human ...............................................4, 5, 26–27, 53, 85, 87,
100, 151–153, 161, 190, 191, 195, 203, 226, 228–231
N
Hybridization .......................................14, 42–49, 57–60, 62,
66, 67, 69, 73–81, 86, 104, 106, 124, 129–131, Nanodrop .................................. 19, 21, 95, 97, 190, 192, 215
161–163, 165–170, 197, 205, 207, 208, 210, 231 Native electrophoresis...................................................19, 22
Northern blot ............................29–38, 41–50, 103, 110, 176
I Nucleic acid
Immunoprecipitation ........................................ 152–155, 158 DNA..................................... 5, 12, 17, 42, 53, 65, 73, 88,
In situ hybridization ....................................... 77, 79, 80, 231 107, 112, 122, 142, 153, 169, 177, 190, 204, 214, 226
Introns ...................................................................... 3–4, 132 LNA .................................................... 41–50, 74–76, 80,
In vitro transcription ..................................15, 58, 61, 67, 68, 81, 161, 162, 165, 166, 208
122, 125–126, 222 RNA ........................3, 12, 17, 29, 41, 53, 65, 73, 86, 103,
Isolation ................................................11, 29–38, 54, 59, 69, 109, 119, 139, 151, 161, 176, 197, 199, 203, 214, 225
89–96, 100, 111, 121, 142, 147, 152, 159, 162–165, Nucleotide ..........................................4, 5, 14, 15, 71, 73–75,
177, 179, 190, 193, 220 104, 106, 110, 117, 119, 121, 131, 132, 134, 135, 147,
Isopropanol.........................................12, 14, 31, 35, 36, 112, 148, 175, 189, 190, 199, 203, 205, 209, 222, 225, 226
113, 156, 164, 177, 179, 205
O
K
Oligonucleotide ......................................... 42, 43, 47–50, 55,
Kethoxal ....................................119, 122, 124, 128, 132, 134 59, 60, 65–71, 78, 80, 146, 147, 166, 188–191, 197,
Knockdown ...................................... 199–201, 203–210, 229 198, 204, 207, 210, 214–223, 228–230
 SMALL NON-CODING RNAS: METHODS AND PROTOCOLS
Index
237

P Reporter assay................................................... 176, 187–198

Reverse transcriptase ....................................... 54, 58, 61, 87,
PAGE. See Polyacrylamide gel electrophoresis (PAGE) 88, 105, 112, 115, 121, 124, 129, 134–135, 140, 141,
PCR. See Polymerase chain reaction (PCR) 146, 157, 178, 181
Phenol ..................................................17–18, 29–37, 42, 45, Reverse transcription (RT) ...............................13, 14, 58, 61,
47, 57, 60, 67–69, 112–114, 117, 122–124, 126–129, 86–92, 94–98, 100, 103–107, 131, 139–142, 156,
140, 143, 153, 156, 159, 163, 177, 179–181, 184, 190, 181, 206, 207, 222
206, 215, 216, 218, 219, 221 Reverse transcription quantitative polymerase chain reaction
Piwi-interacting RNA (piRNA)............................. 5, 17, 203 (RT-qPCR) ...........................17, 29, 41, 85–101, 108
Polyacrylamide gel electrophoresis (PAGE) ................ 42–45, Ribonucleic acid (RNA)
49, 126, 127, 142–144, 146–147, 151, 153, 155, 158, double stranded RNA ..................... 53–62, 109, 199, 225
209, 215, 222 isolation ..................................................... 29–38, 54, 59,
Polyadenylation ............................................... 54, 86, 87, 98, 69, 89–96, 100, 121, 152, 159, 162, 163
112, 114, 177–178, 180–181 small RNA ............................................. 41, 42, 156, 158,
Polymerase chain reaction (PCR) .....................14, 19, 43, 54, 159, 161, 163, 165, 204
86, 103, 110, 122, 140, 156, 162, 182, 188, 210, 214 total RNA .....................................3, 4, 12–14, 20, 25–27,
Poly(A) polymerase-mediated (PPM)-RACE 29, 31, 35–37, 44, 47, 54, 57, 65, 67–69, 88, 89,
(PPM-RACE) ..............................................175–185 94–96, 98, 104–107, 113, 123–125, 127–129, 134,
Precipitation ...................................11–15, 32, 35–37, 59–61, 140, 141, 165, 177–179, 207, 208
68, 70, 111, 113, 114, 117, 126–129, 131, 133, 134, Ribonucleoprotein particle (RNP) ....................... 3, 151, 204
144–148, 152–159, 164, 169, 176, 179–181, 185, Ribosomal RNAs (rRNA) ................................... 3, 4, 13, 18,
201, 218, 219, 221 26–27, 30, 33, 36–38, 43, 45–47, 74, 141, 143, 209
Prediction .................................................. 53, 109, 110, 119, RNA binding protein ...............................................151–160
121, 132, 176, 182, 183, 187–189, 208, 214, 223 RNA extraction
Primer extension .............................................. 121, 124–125, from bacteria...........................................................31–36
129–130, 132, 134, 135 from human cells ..........................................................26
Probing ...............18, 42, 54, 73, 104, 119, 167, 177, 187, 207 from plants..........................................................178–179
Protein .......................3, 13–15, 17–19, 22, 27, 53, 54, 68, 75, from trypanosome...............................................141, 142
77, 80, 95, 96, 108, 109, 132, 140, 147, 151–160, 169, from yeast ....................................... 26, 30, 190–191, 216
199, 203–205, 208, 213, 225, 227, 229–231 RNA FISH. See Fluorescence in situ hybridization (FISH)
Purification ...............................................37, 59, 67–71, 116, RNA-induced silencing complex (RISC) ......... 4–5, 199, 200
122–123, 126, 146–147, 151, 153, 155–156, 177, RNA ligase-mediated (RLM)-RACE
179–180, 182, 193, 216, 220 (RLM-RACE) .............................................175–185
Purity................................... 13, 17, 21, 94, 96, 106, 222, 226 RNase
T1 .......................................................54, 57, 59, 60, 122,
Q
123, 125, 127, 130–132, 152, 154, 159
Quality ......................... 12, 18–20, 22–27, 31, 36, 37, 86–89, T2 ....................................................... 122, 123, 127, 132
96, 104, 135, 139, 142, 147, 159, 169, 207, 228 V1 ....................................................... 122, 123, 127, 132
Quality control ................................................. 17–28, 86–93 RNAse-free .................................. 12, 15, 19, 22, 67, 70, 105,
Quantification ................................................. 17–28, 67–69, 111, 113, 114, 152, 162, 165, 169, 176, 179–181, 201
74, 85–101, 103–107, 121, 196, 197 RNase-free water ..................................12, 13, 19, 20, 24, 27,
Quantitative polymerase chain reaction 28, 67–71, 88–90, 111, 114, 162, 165, 176, 179, 180
(qPCR) .................................86–94, 96–98, 103, 184. RNP. See Ribonucleoprotein particle (RNP)
See also Reverse transcription quantitative polymerase rRNA. See Ribosomal RNAs (rRNA)
chain reaction (RT-qPCR) RT. See Reverse transcription (RT)
Qubit® ............................................................ 19, 22, 28, 197 RT-qPCR. See Reverse transcription quantitative
polymerase chain reaction (RT-qPCR)
R
S
Rapid amplification of cDNA ends (RACE)-PCR
(RACE-PCR) ......................................................111 Salt
Real time PCR (RT-PCR). See Quantitative polymerase ammonium acetate...................................... 12, 13, 57, 59
chain reaction (qPCR) LiCl ........................................................ 12, 13, 113, 117
Renaturation ..................................... 122–123, 125–127, 133 MgCl2 ...... 12, 15, 25, 56, 58, 67, 112, 114, 115, 122–124,
Reporter ..................................................... 73, 176, 187–198 131, 133, 141–143, 145, 152, 177, 178, 180, 181, 215
 SMALL NON-CODING RNAS: METHODS AND PROTOCOLS
238 Index

Salt (cont.) T
NaCl .....................................................12, 13, 25, 30, 43,
44, 57, 67, 77, 111, 122, 141, 143, 152, 153, 162, 177, Taq DNA polymerase.......... 58, 142, 146, 190, 191, 215, 220
190, 191, 194, 200, 206, 216 Target ............................................. 4, 18, 58, 67, 73, 85, 109,
NaOAc .........................................12, 13, 30–32, 34, 124, 133, 140, 152, 166, 175, 187, 199, 204, 213, 225
126–129, 140, 141, 144, 156, 157, 215, 218, 219, 221 Therapeutic ...................................................... 214, 225–231
scaRNA ..............................................................................17 tiRNAs. See Transcription initiation RNAs (tiRNAs)
SDS PAGE. See Polyacrylamide gel electrophoresis (PAGE) T4 PNK. See T4 polynucleotide kinase (T4 PNK)
Selection ...................................................21, 25, 87, 97, 108, T4 polynucleotide kinase (T4 PNK) ..................... 13, 50, 58,
121, 134, 142, 148, 167, 203–210, 213–223, 225 61, 67, 68, 123, 124, 126, 129, 133, 152, 205, 207,
Sequencing ........................... 4, 11, 17, 29, 41, 53, 67, 73, 85, 217, 222
103, 109, 119, 139, 156, 165, 176, 187, 204, 213, 231 Transcription .................................. 13, 17, 29, 41, 53, 67, 74,
Short interfering RNAs (siRNAs)........4, 199–201, 203, 225, 86, 103, 112, 121, 139, 157, 178, 188, 203, 214, 225
229–231 Transcription initiation RNAs (tiRNAs)..............................5
siRNAs. See Short interfering RNAs (siRNAs) Transcriptome ............................................ 17, 140, 151–160
Small non-coding RNA (sncRNA) Transfection ..............................................134, 176, 188, 191,
microRNA ............................ 4, 19, 22, 85, 103–106, 109, 196, 197, 199–201, 205–207, 209
110, 161, 162, 165, 166, 168, 170, 175, 181, 227, 231 Transfer ...................................... 3, 14, 22, 33–35, 42–45, 47,
piRNA .............................................................. 5, 17, 203 49, 70, 78, 113, 114, 126, 130, 131, 133, 140, 141,
rRNA............................................................. 3, 4, 13, 18, 144–146, 151, 153–157, 159, 163, 169, 179, 180,
26–27, 30, 33, 36–38, 43, 45–47, 74, 141, 143, 209 184, 205, 207–210, 218, 219, 222, 223
scaRNA ........................................................................17 Transfer RNA (tRNA) .............................3, 4, 12–14, 26–27,
siRNAs ............................4, 199–201, 203, 225, 229–231 36, 88, 123–125, 127–130, 134, 140, 141, 155, 207
snoRNA........................... 3–4, 13, 17, 141, 203, 208, 209 Transformation ................................. 190–193, 216, 219–220
snRNA ....................................................... 3, 4, 101, 203 Translation....................... 5, 13, 109, 151, 175, 198, 203, 225
tiRNA.............................................................................5 Tris ......................................12, 19, 42, 49, 56, 57, 67, 76, 78,
tRNA ....................................................... 3, 4, 12–14, 20, 111, 112, 117, 122–125, 127, 140–143, 152, 153,
26–27, 36, 88, 123–125, 127–130, 134, 140, 141 162, 177, 178, 184, 190, 200, 206, 216
Small nuclear RNAs (snRNA) ......................... 3, 4, 101, 203 Tris–Borate–EDTA (TBE) buffer......................... 19, 22, 25,
Small nucleolar RNAs (snoRNAs) ...................... 3–4, 13, 17, 31, 36, 42, 44, 45, 58, 59, 67, 68, 122, 125, 126, 130,
141, 203, 208, 209 140, 143, 144, 146, 153, 157, 190, 192, 206, 207, 216,
sncRNA. See Small non-coding RNA (sncRNA) 219, 221
Sodium acetate (NaOAc) ...................12, 13, 30–32, 34, 124, Tris–EDTA (TE) buffer .............................12, 15, 21, 27, 30,
126–129, 140, 141, 144, 156, 157, 215, 218, 219, 221 61, 67, 69, 70, 112, 115, 158, 178, 182, 183, 200, 201
Sodium chloride (NaCl) ...................................12, 13, 25, 30, TRIzol®....................... 26, 30, 33–38, 69, 161–165, 169, 190
43, 44, 57, 67, 77, 111, 122, 141, 143, 152, 153, 162, tRNA. See Transfer RNA (tRNA)
177, 190, 191, 194, 200, 206, 216 T7 RNA polymerase ............... 43, 45, 70, 122, 125, 131, 222
Spectrophotometer .....................................14, 19, 21, 68, 70, U
89, 94, 97, 106, 147, 190, 192, 215
Splicing..................................................... 3, 54, 75, 132, 151 Ultraviolet (UV) ...............................................19, 22, 31, 36,
Splinted ligation ...........................................................65–71 37, 42, 43, 45, 47, 49, 67, 121, 122, 126, 133,
Stem-loop ......................................................... 103–108, 132 151–154, 157, 214, 215, 219
Structural probing .................................... 119, 121, 123, 132 UV cross linking .......................................................152–154
Structure ...............................................3, 24, 55, 75, 76, 103,
Y
107, 110, 119–135, 140, 144, 145, 187, 203–205,
208, 214, 221, 223, 226, 2132 Yeast ....................................... 3, 5, 12, 14, 20, 26–27, 30, 53,
Systematic evolution of ligands by exponential enrichment 57, 59, 123–125, 127–130, 134, 143, 190, 213, 216
(SELEX) ...................................... 213–223, 225, 231 Yeast tRNA .................................12, 14, 20, 26–27, 127–130