1 Aa Tesis Aravena Roman Maximiliano 2015

Phylogeny, antimicrobial
Classification, susceptibility
antimicrobial andand
susceptibility
virulence factors of Aeromonas species in
virulence factors of Western Australian
Western Australia
By
Max Aravena-Román BScAppSci FASM
This thesis is presented for the degree of Doctor of

Philosophy
School of Pathology and Laboratory Medicine of

Western Australia
2015
TABLE OF CONTENTS
TABLE OF CONTENTS.................................................................................................i
SUMMARY.....................................................................................................................ix
DECLARATION............................................................................................................xi
ACKNOWLEDGEMENTS.........................................................................................xiii
THESIS STRUCTURE.................................................................................................xv
ABBREVIATIONS.......................................................................................................xvi
LIST OF TABLETS......................................................................................................xx
LIST OF FIGURES...................................................................................................xxiii
CHAPTER 1: LITERATURE REVIEW..........................................................1
1.1. GENERAL INTRODUCTION.......................................................................1
1.2. HISTORY........................................................................................................1
1.3. TAXONOMY..................................................................................................2
1.3.1. Early taxonomy..........................................................................................2
1.3.2. Current taxonomy......................................................................................3
1.3.3. Controversial taxonomic issues.................................................................3
1.3.3.1. Aeromonas allosaccharophila..............................................................4
1.3.3.2. Aeromonas spp. HG 11........................................................................8
1.3.3.3. Aeromonas culicicola...........................................................................8
1.4. LABORATORY IDENTIFICATION...........................................................9
1.4.1. Isolation.....................................................................................................9
1.4.2. Identification by phenotypic methods.....................................................12
1.4.3. Identification by commercial systems.....................................................13
1.4.4. Additional phenotypic methods..............................................................15
1.4.5. Semi-automated systems.........................................................................15
1.4.6. Identification by molecular methods.......................................................16
1.4.6.1. Typing methods………………………………………......................16
1.4.6.2. Identificartion based on 16S-23S rRNA gene sequence……………17
1.4.6.3. Identification based on housekeeping gene sequence........................18
1.4.6.4. Specific genes used as identification targets......................................18
1.4.6.5. Restriction enzyme-based methods....................................................19
1.4.6.6. PCR-based methods............................................................................20
1.4.6.7. Disadvantages of molecular methods.................................................20
1.5. SEROTYPING............................................................................................21
1.6. ECOLOGY..................................................................................................22
-i-
1.6.1. Aquatic environments.............................................................................22
1.6.1.1. Distribution in water...............................................................................22
1.6.1.2. Water quality...........................................................................................23
1.6.1.3. Effects of temperature on growth and toxin production.........................24
1.6.1.4. Aeromonas in drinking water..................................................................25
1.6.2. Aeromonas in foods.................................................................................28
1.6.2.1 Distribution of Aeromonas spp. in foods............................................28
1.7. EPIDEMIOLOGY AND PUBLIC HEALTH ISSUES............................30
1.7.1. Water-associated infections.....................................................................31
1.7.2. Foods-associated infections.....................................................................32
1.7.3. Aeromonas and fish infections................................................................32
1.8. BIOREMEDIAL AND BIODEGRADABLE PROPERTIES....................33
1.9. VIRULENCE FACTORS...........................................................................34
1.9.1. Adherence................................................................................................35
1.9.2. Pili............................................................................................................36
1.9.3. Invasins....................................................................................................39
1.9.4. S-layer......................................................................................................40
1.9.4.1. Structural arrangements......................................................................41
1.9.4.2. Binding properties..............................................................................41
1.9.4.3. Genes involved in S-layer synthesis...................................................41
1.9.4.4. S-layer and virulence..........................................................................42
1.9.5. The lipopolysaccharide (LPS).................................................................42
1.9.5.1. Functions of the LPS.........................................................................42
1.9.5.2. Immunological and antigenic properties of the LPS.........................43
1.9.5.3. Genes involved in LPS synthesis.......................................................43
1.9.6. Outer membrane proteins (OMP)............................................................44
1.9.7. Flagella....................................................................................................45
1.9.7.1. Synthesis, regulation and expression of flagella................................45
1.9.7.2. Functions associated with flagella......................................................46
1.9.8. Secretion systems....................................................................................46
1.9.8.1. Type II secretion systems (T2SS).......................................................48
1.9.8.2. Type III secretion systems (T3SS).....................................................48
1.9.8.3. Type IV secretion systems (T4SS).....................................................49
1.9.8.4. Type VI secretion systems (T6SS).....................................................50
1.9.9. Exotoxins................................................................................................51
-ii-
1.9.9.1. Aerolysin...........................................................................................52
1.9.9.1.1. Action on host tissue..................................................................53
1.9.9.1.2. Molecular characteristics and prevalence...................................53
1.9.9.2. Cytotoxic enterotoxin (Act)...............................................................54
1.9.9.3. Haemolysins.......................................................................................55
1.9.9.4. Enterotoxins.......................................................................................56
1.10. Additional extracellular products............................................................59
1.10.1. Proteases.............................................................................................59
1.10.2. Lipases................................................................................................60
1.10.3. Nucleases (DNases)............................................................................61
1.10.4. Chitinases............................................................................................62
1.11. Iron uptake...............................................................................................63
1.12. Quorum sensing (QS)..............................................................................64
1.13. Biofilm formation....................................................................................65
1.14. Additional virulence factors....................................................................66
1.15. INFECTIONS CAUSED BY AEROMONAS SPECIES........................67
1.15.1. Gastroenteritis.....................................................................................68
1.15.1.1. Disease presentation....................................................................68
1.15.1.2. Evidence against Aeromonas as an enteric pathogen..................69
1.15.1.3. Evidence supporting Aeromonas as an enteric pathogen............71
1.15.1.4. Species involved..........................................................................72
1.15.2. Skin and soft-tissue infections (SSTIs)..............................................72
1.15.3. Septicaemia.........................................................................................73
1.15.4 Respiratory tract infections.................................................................76
1.15.5. Urogenital tract infections..................................................................76
1.15.6. Intra-abdominal infections..................................................................77
1.15.7. Infections due to medicial leech therapy............................................78
1.15.8. Meningitis...........................................................................................79
1.15.9. Zoonotic infections.............................................................................79
1.15.10. Burns...................................................................................................80
1.15.11. Eye infections.....................................................................................80
1.15.12. Osteomyelitis and suppuratives arthritis.............................................81
1.16. ANTIMICROBIAL SUSCEPTIBILITIES.............................................81
1.16.1. -Lactamases......................................................................................83
1.16.2. Extended-spectrum (ESBL) -lactamas production...........................86
-iii-
1.16.3. Plasmid-mediated resistance..............................................................88
1.16.4. Quinolones..........................................................................................89
1.16.5. Genes encoding for antimicrobial resistance......................................89
1.16.6. Antimicrobial usage: recommendations............................................90
1.17. CONCLUSIONS.....................................................................................91
CHAPTER 2: MATERIALS AND METHODS..............................................95
2.1. MATERIALS................................................................................................95
2.1.1. Chemical and reagents.............................................................................95
2.1.2. Solutions..................................................................................................95
2.1.2.1. DepC-treated water.............................................................................95
2.1.2.2. Ethidium bromide (10 mg/ml)............................................................95
2.1.2.3. Chemical lysis stock solution.............................................................95
2.1.2.4. HCCA matrix solution........................................................................95
2.1.3. Bacteriological media..............................................................................95
2.1.4. Gas chromatography................................................................................96
2.1.5. Antimicrobials.........................................................................................96
2.1.6. Bacterial strains.......................................................................................96
2.1.7. Primers.....................................................................................................96
2.2. METHODS.................................................................................................115
2.2.1. Bacterial culture methods......................................................................115
2.2.2. Acid production from carbohydrates.....................................................112
2.2.3. Hydrolysis of aesculin...........................................................................115
2.2.4. Alkylsulfatase activity...........................................................................115
2.2.5. Detection of a CAMP-like factor...........................................................116
2.2.6. Catalase activity.....................................................................................116
2.2.7. DNase activity.......................................................................................116
2.2.8. Elastase activity.....................................................................................116
2.2.9. Gas from glucose...................................................................................117
2.2.10. Gelatin hydrolysis..................................................................................117
2.2.11. Oxidation of potassium gluconate.........................................................117
2.2.12. Ability to grow on TCBS medium........................................................117
2.2.13. -Haemolysis activity...........................................................................118
2.2.14. Production of hydrohen sulphide from cysteine...................................118
2.2.15. Production of indole from tryptophan…………...................................118
2.2.15.1. Rapid spot method....................................................................118
-iv-
2.2.15.2. Kovacs’ method........................................................................118
2.2.16. Jordan’s tartrate test..............................................................................118
2.2.17. Lipase activity.......................................................................................119
2.2.18. Utilization of malonate..........................................................................119
2.2.19. Amino acid degradation........................................................................119
2.2.20. Motility..................................................................................................120
2.2.20.1. Wet mount method....................................................................120
2.2.20.2. Motility medium method...........................................................120
2.2.21. ONPG activity.......................................................................................120
2.2.22. Oxidase activity.....................................................................................120
2.2.23. Phenylalanine deaminase activity..........................................................121
2.2.24. Pyrazinamidase activity.........................................................................121
2.2.25. Pyrrolidonyl--naphthylamide activity.................................................121
2.2.26. Salt tolerance.........................................................................................121
2.2.27. Stapholysin activity...............................................................................122
2.2.28. Hydrolysis of starch...............................................................................122
2.2.29. Hydrolysis of tyrosine...........................................................................122
2.2.30. Urease activity.......................................................................................122
2.2.31. Utilization of DL-lactate, acetate and urocanic acid.............................123
2.2.32. Utilization of citrate (Simmon’s method).............................................123
2.2.33. Voges-Proskauer test.............................................................................123
2.3. AMPLIFICATION OF GYRB AND RPOD GENES.................................123
2.3.1 Preparation of template DNA................................................................123
2.3.2. Polymerase chain reaction (PCR)..........................................................124
2.3.3. DNA sequencing....................................................................................124
2.3.4. Detection of virulence gene products by Bioanalyzer...........................125
2.4. METHODS USED IN THE CHARACTERIZATION OF AEROMONAS
AUSTRALIENSIS SP. NOV........................................................................................126
2.4.1. Phenotypic characterization..................................................................126
2.4.2. Antimicrobial susceptibility testing......................................................127
2.4.3. Fatty acid methyl ester (FAME) analysis..............................................127
2.4.3.1. Inoculation of TSBA plates..............................................................128
2.4.3.2. Harvesting.........................................................................................128
2.4.3.3. Saponification...................................................................................128
-v-
2.4.3.4. Methylation.......................................................................................128
2.4.3.5. Extraction..........................................................................................128
2.4.3.6. Washing........................................................................................... 129
2.4.3.7. Interpretation of results.....................................................................129
2.4.4. Protein analysis by MALDI-TOF..........................................................129
2.4.4.1. Sample preparation...........................................................................129
2.4.5. Genotypic characterization....................................................................130
2.4.5.1. PCR and sequence analysis..............................................................130
2.5. ANTIMICROBIAL SUSCEPTIBILITY TESTING..................................131
2.5.1. Agar dilution..........................................................................................131
2.5.2. Disk diffusion........................................................................................132
2.5.3. Minimum inhibitory concentration testing: E-strip method..................132
2.6. ELECTRON MICROSCOPY ANALYSIS................................................133
2.7. STATISTICAL ANALYSIS.......................................................................133
CHAPTER 3: PHENOTYPIC CHARACTERIZATION OF AEROMONAS
SPECIES.......................................................................................................................136
3.1. INTRODUCTION.......................................................................................136
3.2. Bacterial strains.....................................................................................136
3.3. RESULTS....................................................................................................137
3.3.1. Biochemical characteristics of type and reference strains.....................137
3.3.2. Overall classification.............................................................................137
3.3.3. Clinical isolates......................................................................................137
3.3.4. Environmental isolates..........................................................................138
3.3.5. Distribution of Aeromonas spp. in clinical samples..............................138
3.3.6. Distribution of Aeromonas spp. in environmental samples...................138
3.3.7. General phenotypic characteristics........................................................138
3.3.8. Susceptibility to colistin........................................................................154
3.3.9. Production of pyrrolidonyl--naphthylamide........................................154
3.3.10. Susceptibility to deferoxamine (DEF)...................................................154
3.3.11. Production of a CAMP-like factor.........................................................154
3.3.12. Utilization of citrate: Simmon’s vs. Hänninen’s medium.....................155
3.3.13. Susceptibility to the vibriostatic agent O/129........................................155
3.3.14. Growth on thiosulfate salt sucrose agar (TCBS)...................................155
3.4. DISCUSSION.............................................................................................155
-vi-
CHAPTER 4: GENOTYPIC CHARACTERIZATION OF AEROMONAS
SPECIES.......................................................................................................................158
4.1. INTRODUCTION.......................................................................................158
4.3. RESULTS....................................................................................................159
4.3.1. Overall distribution of species following genotypic identification.......159
4.3.2. Distribution of Aeromonas spp. in clinical specimens..........................159
4.3.3. Distribution of Aeromonas spp. in environmental specimens...............159
4.3.4. Phenotypic differentiation of Aeromonas dhakensis from other major
Aeromonas species........................................................................................................174
4.3.5. Intra- and inter-species dissimilarities...................................................174
4.4. DISCUSSION.............................................................................................174
CHAPTER 5: ANTIMICROBIAL SUSCEPTIBILITIES..........................179
5.1. INTRODUCTION.......................................................................................179
5.3. Antimicrobial agents..............................................................................179
5.4. RESULTS...................................................................................................180
5.5. DISCUSSION............................................................................................181
CHAPTER 6: DESCRIPTION OF AEROMONAS AUSTRALIENSIS SP.
NOV..............................................................................................................................187
6.1. INTRODUCTION.......................................................................................187
6.3. RESULTS....................................................................................................188
6.3.1. Phenotypic characteristics.....................................................................188
6.3.2. FAME profiles.......................................................................................189
6.3.3. Protein profile........................................................................................189
6.3.4. Genotypic characteristics.......................................................................189
6.3.5. Antimicrobial susceptibilities................................................................190
6.4. DISCUSSION.............................................................................................213
6.4.1 Formal description of Aeromonas australiensis sp. nov……………..215
CHAPTER 7: VIRULENCE GENES PRESENT IN WESTERN
AUSTRALIAN AEROMONAS SPECIES.................................................................217
7.1. INTRODUCTION.......................................................................................217
7.3. RESULTS....................................................................................................218
-vii-
7.3.1. Overall distribution of virulence genes.................................................218
7.3.2. Distribution of virulence genes in stool specimens...............................218
7.3.3. Distribution of virulence genes in extra-intestinal specimens...............219
7.3.4. Distribution of virulence genes among environmental specimens........219
7.3.5. Additional features................................................................................219
7.3.6. Percentage identity of nucleotide sequences of positive products from
this study compared to sequences deposited in GenBank.....................220
7.4. DISCUSSION..............................................................................................220
CHAPTER 8: GENERAL DISCUSSION......................................................247
REFERENCES............................................................................................................257
ATTACHED CD-ROM...............................................................................................312
-viii-
SUMMARY
Members of the genus Aeromonas are Gram-negative rods globally distributed in

aquatic and soil environments. For over one hundred years they have been associated
with infections in humans, other mammals and cold-blooded species. Infections in fish
and snails have resulted in serious financial losses to the aquaculture and French snail
farming industry.
Before the advent of molecular techniques, classification of Aeromonas was based

solely on the different phenotypic characteristics associated with each individual
species. However, the heterogeneous nature of motile and mesophilic Aeromonas
species has led to an unreliable and unstable taxonomy and schemes designed for the
identification of this group have not always been suitable for the identification of non-
motile, psychrophilic species.
The aims of this research were:
1. To characterize a collection of clinical and environmental Aeromonas isolates

from the state of Western Australia using phenotypic and genotypic methods in
order to determine the prevalence of species in this region.
2. To investigate the taxonomic position of isolates as determined by phylogenetic
trees.
3. To determine the antimicrobial susceptibility patterns of clinical and
environmental Aeromonas spp. to antibacterial agents currently in use in clinical
practice.
4. To assess the presence of virulence factors of Aeromonas species in order to
determine the presence of pathogenic strains currently circulating within the WA
community and its environment.
Aeromonas isolates were collected from rural and metropolitan areas of Western
Australia, the largest state in Australia covering an area of 2.5 million km2, for a period
of over 20 years. Phenotypic characterization of isolates was performed by a
conventional biochemical method that included more than 35 tests and by which
approximately 93% of the isolates were identified to the species level. Aeromonas
hydrophila was by far the most predominant aeromonad isolated from clinical and
-ix-
environmental samples and represented more than 50% of the species. These results
suggested that phenotypic identification was inadequate since 7% of the strains could
not be assigned to any known taxa.
Genotypic identification was based on the molecular sequences of the gyrB and rpoD
housekeeping genes by a PCR-based method. Phylogenetic trees generated from the
nucleotide sequences of the isolates tested indicated that A. dhakensis and not A.
hydrophila was the most frequently isolated aeromonad. Genotypic classification
resulted in the assignation of 99% of the strains to a species suggesting that accurate
identification of Aeromonas must involve a molecular method.
The antimicrobial susceptibility pattern of each isolate was assessed against 26

antimicrobials representing all classes currently in-use in clinical practice. Susceptibility
of each isolate was determined by the agar dilution and E-strip methods. Antibiotic
profiles indicated that the level of antimicrobial resistance in Western Australian
aeromonads is generally very low although antimicrobial susceptibility testing should
be performed in all strains isolated from human clinical material.
Phylogenetic trees derived from the nucleotide sequences of the gyrB and rpoD
housekeeping genes showed that the position of strain 266 isolated from irrigation water
in rural Western Australia did not cluster with any of the current validated Aeromonas
species. Extensive polyphasic testing that included multilocus phylogenetic analysis,
cellular fatty acid, protein profiles and DNA-DNA hybridization confirmed that strain
266 represented a novel Aeromonas species for which the name A. australiensis species
novo was proposed.
The distribution and prevalence of 13 virulence genes and the activity of four
extracellular enzymes was examined among 130 Aeromonas strains comprising 11
different species. Detection of virulence genes was performed by a PCR-based method
while enzyme activity was evaluated by biological assays. Results indicated that clinical
and environmental strains of A. hydrophila and A. dhakensis are more likely to carry
multiple virulence genes compared to strains of A. veronii and A. caviae. However, the
pathogenic potential of Aeromonas may be strain rather than species dependent, thus
under certain conditions which include host predisposition, a range of aeromonads may
be able to cause infection.
-x-
DECLARATION
_______________________________________
All work presented in this thesis was performed by me and contributions made by
others are duly stated. Identification of Aeromonas by phenotypic methods and
antimicrobial susceptibility testing was performed entirely by me. Identification by
molecular methods and detection of virulence genes was performed by me except for
the preparation of gels and sequencing that was performed by staff from the PCR
Laboratory at PathWest, Nedlands. Polyphasic identification of Aeromonas
australiensis was 50% performed by me and 50% by Dr. R. Beaz-Hidalgo, Facultat de
Cience i Medicina de la Salut, University Rovira i Virgili, Reus, Spain.
Electronmicrograph of bacterial cells of A. australiensis was performed by Prof. Maria
Jose Figueras, Facultat de Cience i Medicina de la Salut, University Rovira i Virgili,
Reus, Spain.
This thesis contains a series of published work that has been co-authored. The following
journal articles constitute the individual chapters of this thesis:
Aravena-Román, M., B. J. Chang, T. R. Riley, and T. J. J. Inglis (2011a). Phenotypic

characteristics of human clinical and environmental Aeromonas in Western Australia.
Pathology 43: 350-356 (Chapter 3).
Aravena-Román, M., G. B. Harnett, T. V. Riley, T. J. J. Inglis and B. J. Chang (2011b).

Aeromonas aquariorum is widely distributed in clinical and environmental specimens
and can be misidentified as Aeromonas hydrophila. Journal of Clinical Microbiology
49: 3006-3008 (Chapter 4).
Aravena-Román, M., T. J. J. Inglis, B. Henderson, T. V. Riley, and B. J. Chang (2012).

Antimicrobial susceptibilities of Aeromonas strains isolated from clinical and
environmental sources to 26 antimicrobial agents. Antimicrobial Agents and
Chemotherapy 56: 1110-1112 (Chapter 5).
Aravena-Román, M., R. Beaz-Hidalgo, T. J. J. Inglis, T. V. Riley, A. J. Martínez-

Murcia, B. J. Chang and M. J. Figueras (2013). Aeromonas australiensis sp. nov.
-xi-
isolated from irrigation water in Western Australia. International Journal of
Evolutionary and Systematic Microbiology 63: 2270-2276 (Chapter 6)
Aravena-Román, M., T. J. J. Inglis, T. V. Riley and B. J. Chang (2014). Distribution of

13 virulence genes among clinical and environmental Aeromonas species in Western
Australia European Journal of Clinical Microbiology and Infectious Diseases 33: 1889-
1895 (Chapter 7).
Except for the work performed in the description of the new species A. australiensis
(50% of experimental work), all experimental work (100%) and initial manuscripts
preparation (100%) was performed by me. Editorial advice and guidance for the
manuscripts’ submissions and final corrected versions were provided by my supervisors
Professor Barbara Chang (40% editorial), Professor Timothy Inglis (30% editorial) and
Professor Thomas Riley (30% editorial). Other co-authors provided access to laboratory
equipment and facilities.
Max Aravena-Román
-xii-
ACKNOWLEDGEMENTS
I am indebted to my supervisors B. Chang, T. Inglis and T. Riley for their continuous

support, encouragement and guidance.
I would like to thank the staff of the Microbiology Division at PathWest, Nedlands
campus who provided bacterial isolates and access to equipment and reagents. To Rod
Bowman for making the necessary funds available to finance this project.
Thanks to Dr. Nicky Buller, Bacteriology Laboratory, Agriculture Department of

Western Australia, South Perth; Mr. Steve Munyard, Division of Microbiology and
Infectious Diseases, PathWest, Nedlands campus; Mr. Neil Stingemore, Department of
Microbiology, Fremantle Hospital, PathWest, Fremantle campus; Mr. Peter Campbell,
Department of Microbiology, Princess Margaret Hospital, Subiaco, Perth; Professor
Peter Käempfer, Institut für Angewandte Mikrobiologie, Justus-Liebig Universität,
Giessen, Germany; Professor Silvia Kirov, Department of Pathology, University of
Tasmania, Hobart, Tasmania, Australia; Dr. J. Michael Janda, Microbial Diseases
Laboratory, State of California, USA; and Dr. David Miñana-Galbis, Facultat de
Farmacia, Unitat de Microbiologia, Universitat de Barcelona, Barcelona, Spain for
kindly providing bacterial isolates.
To my colleagues, Glenys Chidlow, Gerry Harnett, Adam Merritt, Nikki Foster, Avram
Levy, and Barbara Henderson for their advice, guidance and support. A special thanks
to Diane Bleasdale for her excellent librarian services, to John Boehm from Excel,
PathWest, for providing me with special media and reagents and to my Spanish
colleagues, Professor María Jose Figueras and Dr. Roxana Beaz-Hidalgo from the
Facultat de Cience and Medicina de la Salut, University of Rovira i Virgili, Reus, Spain
and Dr. Antonio Martínez-Murcia from the Departamento de Produccion Vegetal y
Microbiología, EPSO, Universidad Miguel Hernández, Orihuela Alicante, Spain for
their invaluable training, advice and for their generosity in sharing bacterial isolates.
Thank you to Dr. Eduardo Alvarez from ICBM, Programa de Microbiología y

Micología, Facultad de Medicina, University of Chile, Santiago, Chile who provided
much training in sequence analysis and other computer issues and to Cati Nuñez from
-xiii-
the Facultat de Cience and Medicina de la Salut, University of Rovira i Virgili, Reus,
Spain for her invaluable technical support.
Finally, thanks to my wonderful wife Naomi for her unconditional love and support.
To my beloved Mum Carmen Román Díaz (RIP)
-xiv-
THESIS STRUCTURE
The body of this research is preceded by an extensive review of the literature in Chapter
1 in which historical, taxonomical issues, antimicrobial susceptibility and the relation of
Aeromonas to human disease are presented. All materials and methods described in
Chapters 3 to 7 are outlined in Chapter 2. Chapters 3 to 7 of this thesis are based on
material published by the candidate and peer reviewed.
Chapter 3 describes the characterization of isolates by phenotypic methods followed by

classification by genotypic methods as presented in Chapter 4. The antimicrobial
susceptibility pattern of 193 strains constitutes Chapter 5. The discovery and proposal
of a novel Aeromonas species is described in Chapter 6. In Chapter 7, the virulence
potential based on the detection and distribution of virulence genes and enzyme activity
is examined in a selected group of strains. Final discussion addressing the results and
conclusions obtained from all other chapters is presented in Chapter 8.
-xv-
ABBREVIATIONS
ACN acetonitrile
ADA ampicillin dextrin agar
ADWA Agriculture Department of Western Australia
AFLP amplified fragment length polymorphism
AMX amoxicillin
AMC amoxicillin-clavulanate
AMK amikacin
AMP ampicillin
AnO2 anaerobic
APW alkaline peptone water
Aq. soln. aqueous solution
ATCC American Type Culture Collection
ATM aztreonam
BAA blood ampicillin agar
bv biovar
BOC British Oxygen Company
bp base pair(s)
BSA bovine serum albumin
cm centimetre
C degrees Celsius
CCUG Culture Collection of the University of Göteborg
CFA cellular fatty acid
CFU colony forming unit(s)
CAMP Christie-Atkins-Munch-Peterson
CAPD continuous ambulatory peritoneal dialysis
CAZ ceftazidime
CDC Center for Disease Control
CECT Coleccion Española de Cultivos Tipo
CEF cephalothin
CFZ cefazolin
CHO Chinese hamster ovary
CIN cefsulodin irgasan novobiocin
CIP Collection Bactérienne de l’Institute Pasteur
CIP ciprofloxacin
CLED cysteine lactose electrolyte deficient
CLSI Clinical Laboratory Standard Institute
CNA colistin nalidixic acid
COL colistin
CRO ceftriaxone
CSF cerebral spinal fluid
d day(s)
Da Dalton
DAA Difco ampicillin agar
DEF deferoxamine
DepC diethyl procarbonate
DDH DNA-DNA hybridization
DNA deoxyribonucleic acid
DNAT deoxyribonucleic acid agar plus toluidine blue
-xvi-
DNase deoxyribonuclease
dNTP deoxyribonuclease triphosphate(s)
DOX doxycycline
DSM Deutsche Sammlung von Mikroorganismen und Zelkuturen
ERIC enterobacterial repetitive intergenic consensus
ESBL extended-spectrum -lactamase
FA formic acid
FAME fatty acid methyl ester(s)
FEP cefepime
FH Fremantle hospital
FOX cefoxitin
g gram(s)
g relative centrifugal force
G+C guanine plus cytosine
GC gas chromatograph
GCAT glycerophospholipid-cholesterol acyltransferase
GCF gelatine-cysteine-thiosulfate
GEN gentamicin
GMP guanosine monophosphate
GSP glutamate starch phenol
h hour(s)
HBA horse blood agar
HCCA -cyano-4-hydroxycinnamic acid
HG hybridization group
HIA heart infusion agar
HIB heart infusion broth
HPLC high performance liquid chromatography
HUS haemolytic uraemic syndrome
I intermediate
IM intramuscular
IP intraperitoneal
IBB inositol bile salts brilliant green
kb kilobases(s)
Km2 square kilometre
L litre
LBA Luria Bertoni agar
LDC lysine decarboxylase
LMG Culture Collection of the Laboratorium voor Microbiologie Gent
LPS lipopolysaccharide
LT labile toxin
M molar
M mole(s)
MALDI-TOF matrix assistedlaser-desorption/ionization mass spectrometry time-of
flight
MEM meropenem
mg milligram(s)
MHA Mueller-Hinton agar
MIC minimum inhibitory concentration
MIC50 MIC required to inhibit the growth of 50% of organisms
MIC90 MIC required to inhibit the growth of 90% of organisms
min minute(s)
ml millilitre(s)
-xvii-
MLCK myosin light chain kinase
MLPA multilocus phylogenetic analysis
MLST multilocus sequence analysis
mm millimetre(s)
mM millimole(s)
MTCC Microbial Type Culture Collection and GeneBank
MWA Metropolitan Water Authority
MW molecular weight
MXF moxifloxacin
NaCl sodium chloride
NA nutrient agar
NAL nalidixic acid
N/A not applicable
NaOH sodium hydroxide
NCIMB National Collection of Industrial and Marine Bacteria
NCTC National Collection of Type Cultures
ND not detected
NIT nitrofurantoin
nm nanometre(s)
No. number
NOR norfloxacin
NSW New South Wales
nt nucleotide(s)
O2 oxygen
O/129 2,4-diamino-6,7-diisopropylpteridine
ONPG o-nitrophenyl--D-galactopyranoside
O/F oxidation/fermentation
o/v overnight
PCR polymerase chain reaction
PFGE pulse field gel electrophoresis
pH concentration of hydrogen ions
PMH Princess Margaret Hospital
PPA phenylalanine deaminase
psi pounds per square inch
PYR pyrrolidonyl--naphthylamide
PYZ pyrazinamidase
QE II Queen Elizabeth II
R resistant
RAPD randomly amplified polymorphic DNA
RBC red blood cells
RILs rabbit ileal loops
RNA ribonucleic acid
rpm revolutions per minute
s second(s)
S susceptible
SAA starch ampicillin agar
SBA sheep blood agar
SCGH Sir Charles Gairdner Hospital
SDS sodium dodecyl sulphate
SDH Swan District Hospital
SF summed feature
SI similarity index
-xviii-
spp. species
sp. nov. species novo
ssp. subspecies
SSSD Salmonella Shigella agar plus sodium desoxycholate
ST stable toxin
SXT trimethoprim-sulfamethoxazole
TCBS thiosulfate citrate bile sucrose
TFA trifluoroacetic acid
TGC tigecycline
TIM ticarcillin-clavulanate
TMP trimethoprim
TOB tobramycin
TSA trypticase soy agar
TSB trypticase soy broth
TSBA trypticase soy broth agar
TZP pipercillin-tazobactam
U unit(s)
 micron(s)
g microgram(s)
l microlitre(s)
m micrometre(s)
M micromole(s)
UPW ultrapure water
w/v weight to volume
WA Western Australia
XLDA xylose lysine desoxycholate agar
XDCA sylose desoxycholate citrate agar
+ positive
 negative
-xix-
LIST OF TABLETS
Table 1.1 Current Aeromonas species p. 5
Table 1.2 Examples of media used in the isolation of Aeromonas p. 14

from different sources
Table 1.3 Distribution of Aeromonas in water sourcesfrom different p. 26

locations
Table 1.4 Enumeration of Aeromonas in different foodstuffs p. 29
Table 1.5 Characteristics of pili described in Aeromonas species p. 37
Table 1.6 Selected effector proteins associated with different p. 47

secretion systems
Table 1.7 Toxins secreted by Aeromonas p. 57
Table 1.8 Clinical characteristics of patients with HUS-associated p. 70

Aeromonas
Table 1.9 Major categories of Aeromonas septicaemia disease p. 75

presentation
Table 1.10 -lactamases produced by Aeromonas species p. 84

Table 1.11 ESBL-producing Aeromonas species p. 87
Table 2.1 Chemicals and reagents used in this project p. 97
Table 2.2 Bacteriological media used in this project p. 99
Table 2.3 Antimicrobial agents used in this project p. 101
Table 2.4 Type and reference strains used in this project p. 102
Table 2.5 Type strains used as positive and negative controls p. 105
Table 2.6 Clinical strains used in this project p. 106
Table 2.7 Environmental strains used in this project p. 109
Table 2.8 Primers used in this project p. 111
Table 2.9 Aeromonas strains used in virulence studies p. 113
Table 2.10 Interpretation of disk diffusion results p. 134
Table 2.11 Interpretation of E-strip MIC values p. 135
Table 3.1 Biochemical characteristics of type and reference p. 139
Aeromonas strains
Table 3.2 Biochemical characteristics of Aeromonas isolated from p. 145
human clinical material
Table 3.3 Biochemical characteristics of Aeromonas isolated from p. 149

environmental sources
Table 3.4 Distribution of Aeromonas spp. among clinical and p. 153
-xx-
environmental samples after phenotypic characterization
Table 4.1 Type and reference strains GenBank accession numbers p. 160
Table 4.2 GenBank accession numbers of wild strains for rpoD and p. 162
gyrB gene sequences
Table 4.3 Distribution of Aeromonas spp. among clinical and p. 173

environmental samples following genotypic
characterization
Table 4.4 Biochemical characteristics of Aeromonas after genotypic p. 175

identification
Table 4.5 Evolutionary distances based on the percentage sequence CD-ROM
dissimilarities of all current Aeromonas spp. and 60
isolates identified as A. aquariorum using Clustal_W and
Mega 5 software
Table 5.1 Antimicrobial susceptibilities determined for different p. 182

Aeromonas spp.
Table 5.2 Antibiotic susceptibilities of Aeromonas spp. by source of p. 184
isolation
Table 6.1 Key tests for the phenotypic identification of strain 266T p. 192
from other Aeromonas spp.
Table 6.2 Key tests used to differentiate strain 266T from other D- p. 197
mannitol non-fermentative Aeromonas
Table 6.3 Cellular fatty acid profiles of strain 266T and current p. 198
Aeromonas spp.
Table 6.4 Evolutionary distances based on the percentage sequence CD-ROM

dissimilarities of current Aeromonas and strain 266T using
Clustal_W and Mega 4 software
Table 6.5 DNA-DNA hybridization values between strain 266T and p. 204
closely related Aeromonas spp.
Table 7.1 Distribution of virulence genes among Western Australian p. 221

Aeromonas species
Table 7.2 Distribution of virulence genes in Aeromonas spp. isolated p. 223
from stools

from blood

from wounds
-xxi-
from miscellaneous specimens

from environmental sources
Table 7.7 Additional features p. 234

Table 7.8 Percentage identity of gene product sequences from this p. 235
study compared with sequences deposited in GenBank
Table 7.9 Accession numbers of sequences derived from virulence p. 237

genes and deposited in GenBank
-xxii-
LIST OF FIGURES
Figure 1.1 Unrooted neighbour-joining phylogenetic tree derived from gyrB p. 7
sequences showing subspecies and biovars

sequences showing current Aeromonas species
Figure 1.3 Unrooted neighbour-joining phylogenetic tree derived from rpoD p. 11

sequences showing current Aeromonas species
Figure 4.1 Concatenated neighbour-joining phylogenetic tree showing the p. 169

position of A. dhakensis strains derived from the rpoD and gyrB
sequences

position of A. caviae strains derived from the rpoD and gyrB
genes sequences

position of A. hydrophila strains derived from the rpoD and gyrB
genes sequences
Figure 4.4 Concatenated neighbour-joining phylogenetic tree derived from p. 172

the rpoD and gyrB genes sequences showing the position of A.
veronii bv. sobria and other species including strain 266
Figure 6.1 Electron microscopy images of strain 266T p. 191

Figure 6.2 Protein spectrum of strain 266T p. 203
Figure 6.3 Unrooted neighbour-joining phylogenetic tree derived from the p. 205
16S rRNA gene sequences showing the relationships of strain
266T with all other Aeromonas species
Figure 6.4 Unrooted neighbour-joining phylogenetic tree derived from dnaJ p. 206
sequences showing the relationships of strain 266T with the type
strains of all other Aeromonas species
Figure 6.5 Unrooted neighbour-joining phylogenetic tree derived from dnaX p. 207
Figure 6.6 Unrooted neighbour-joining phylogenetic tree derived from gyrA p. 208
-xxiii-
Figure 6.8 Unrooted neighbour-joining phylogenetic tree derived from recA p. 210
Figure 6.9 Unrooted neighbour-joining phylogenetic tree derived from rpoD p. 211
Figure 6.10 Unrooted neighbour-joining phylogenetic tree derived from the p. 212
MLPA of concatenated sequences of six housekeeping genes
sequences showing the relationships of strain 266T with several
-xxiv-
CHAPTER 1: LITERATURE REVIEW
1.1. GENERAL INTRODUCTION
Aeromonas species are authoctonous inhabitants of aquatic environments that can be

frequently isolated from human clinical material, environmental and food sources
(Janda and Abbott 2010). Infections due to Aeromonas occur in amphibians, reptiles
and snails, where the latter infections are a significant problem for the snail industry in
France (Kodjo et al. 1997). In humans, aeromonads have been associated with serious
infections in both immunocompromised and healthy individuals while infections in fish
represent a serious threat to the aquaculture industry resulting in significant financial
loss.
Once considered organisms of doubtful clinical significance the interest in Aeromonas

has grown considerably over the past three decades as reflected by a sixfold increase in
research publications (Janda and Abbott 2010). In the tsunami that devastated parts of
Asia in 2004 Aeromonas species were the predominant (22.6%) Gram-negative isolated
from wounds of victims (Hiransuthikul et al. 2005). This led to the recommendation
that assessment of wound infections in tsunami survivors, empirical antimicrobial
therapy should always include agents with activity against Aeromonas (Lim 2005).
Similarly, Aeromonas was present in high concentration in water samples following the
hurricane Katrina disaster that affected New Orleans (Presley et al. 2006). This review
discusses current taxonomic classification and identification methods. Secondly,
description of putative virulence factors and their association with Aeromonas
infections is examined. Finally, the response of Aeromonas to antimicrobial agents is
reviewed.
1.2. HISTORY
Infections due to Aeromonas species have been described for more than a hundred years
and several reviews have credited the first reports to the work of Zimmerman and
Sanarelli in the late 1880s (Abeyta et al. 1988; Altwegg and Geiss 1989; Joseph and
Carnahan 1994). These cases were followed by other reports of Aeromonas-like bacteria
including the water-borne bacterium, Bacillus hydrophilus, isolated from water and
diseased frogs (Chester 1901) and Proteus melanovogenes implicated as the cause of
black rot in eggs and also isolated from human faeces (Miles and Halnan 1937).
-- 1 --
According to Joseph and Carnahan (1994), the first report of human infection caused by
aeromonads was by Hill et al. (1954) who described a case of fulminant septicaemia
and metastatic myositis caused by an unknown bacterium. The microorganism that was
recovered from multiple organs and in pure form from cerebral spinal fluid was
considered an undescribed member of the family Pseudomonadaceae, tribe Spirilleae
and genus Vibrio.
The genus Aeromonas was first proposed by Kluyver and van Niel (1936) who
recommended that the species Acetobacter liquefaciens be renamed Aeromonas
liquefaciens, then the only species and type species of the genus. The newly proposed
genus was formally accepted in the seventh edition of Bergey’s Manual of
Determinative Bacteriology (Snieszko 1957). The type species of the genus, A.
hydrophila, was later proposed by Stanier (1943) based on the phenotypic
characteristics of Proteus hydrophilus, a fermentative, polar flagellated bacterium. Since
their discovery, Aeromonas or Aeromonas-like bacteria have been assigned to several
genera including Aerobacter, Bacillus, Pseudomonas, Proteus and Vibrio (Joseph and
Carnahan 1994).
1.3. TAXONOMY
Due to the heterogeneous nature of the genus the taxonomy of Aeromonas has been
considered complex and confusing (Schubert 1974; Popoff and Veron 1976; Joseph and
Carnahan 1994; Wahli et al. 2005). The inability to separate genospecies using
biochemical methods (Altwegg et al. 1990) and the poor correlation that existed
between genotypic and phenotypic methods (Austin et al. 1998; Martínez-Murcia et al.
2000) led to an unstable nomenclature (Popoff and Veron 1976; Abbot et al. 1992; Vila
et al. 2002; Ørmen et al. 2005) resulting in conflicting data (de la Morena et al. 1993;
Huys et al. 1997a; Valera and Esteve 2002; Huys et al. 2005).
1.3.1. Early taxonomy
Prior to the 1980s, classification of Aeromonas was based solely on differential

phenotypic characteristics such as growth temperature and motility (Popoff and Veron
1976). Thus, Aeromonas was classified into two major groups: a large group that
comprised the motile, mesophilic and heterogenous species that also included potential
human pathogens; and a second smaller group of homogenous species represented by A.
salmonicida, a non-motile, psychrophilic species primarily considered fish pathogens
-- 2 --
(McNicol et al. 1980; Janda et al. 1984; Kasai et al. 1998; Pidiyar et al. 2002; Martin-
Carnahan and Joseph 2005).
In 1981, Popoff and colleagues used DNA-DNA hybridization (DDH) to classify 55

motile aeromonads. Results revealed that A. hydrophila, A. caviae and A. sobria were
well differentiated but each species contained more than one hybridization group (HG),
a term used to refer to DNA groups that could not be differentiated phenotypically. As a
consequence, investigators began to use DDH values to determine hybridization groups
(HGs), which were defined as having at least 70% DNA homology with the designated
type strain (Wayne et al. 1987). The use of the term “hybridization group” dropped out
of use over the last decade. The last hybridization group was DNA HG 18 assigned to
A. culicicola (Pidiyar et al. 2002). Instead, the term “genomic species” or “genospecies”
followed by a reference number has been recommended to describe unnamed groups
(Janda and Abbott 2010).
1.3.2. Current taxonomy
The genus Aeromonas resides in the family Aeromonadaceae (Colwell et al. 1986)
within the subclass Gammaproteobacteria (Saavedra et al. 2007). There are currently
27 recognized species and six subspecies (Table 1.1), and two biovars (Fig. 1.1). The
complete genome of all type strains representing all species and selected reference
strains have now been sequenced (Seshadri et al. 2006; Colston et al. 2014).
In recent years, the classification of Aeromonas has been based on the nucleotide
sequences of housekeeping genes which have the ability to reliably discriminate
between all species in the genus (Yañez et al. 2003; Soler et al. 2004; Thompson et al.
2004; Nhung et al. 2007; Adekambi et al. 2008; Miñana-Galbis et al. 2009). As a
consequence, 15 new Aeromonas species have been described since 2000, with the
majority recovered from environmental sources.
1.3.3. Controversial taxonomic issues
Controversial taxonomic issues discussed in previous reviews (Janda and Abbott 2010)
can now be considered partly or completely resolved. Extensive genotypic and
phenotypic evidence confirmed that: A. trota was identical to A. enteropelogenes
(Schubert et al. 1990a; Carnahan et al. 1991a; Carnahan 1993; Collins et al. 1993; Huys
et al. 1996b; 2002b) and A. ichthiosmia should be considered a junior synonym of A.
-- 3 --
veronii (Fanning et al. 1985; Schubert et al. 1990b; Collins et al. 1993; Huys et al.
1996a; 2001). The unnamed Aeromonas group 501 (Hickman-Brenner et al. 1988) has
been reclassified as A. diversa sp. nov. (Miñana-Galbis et al. 2010) and A. hydrophila
ssp. anaerogenes has been included in the species A. caviae (Miñana-Galbis et al.
2013).
Phylogenetic evidence indicated that strains of A. hydrophila ssp. dhakensis belonged to

the species A. aquariorum (Martínez-Murcia et al. 2008; 2009). Previously, the species
A. hydrophila consisted of three subspecies including ssp. hydrophila and ssp. ranae
(Huys et al. 2003). Recently, Beaz-Hidalgo et al. (2013) combined A. hydrophila ssp.
dhakensis (Huys et al. 2002a) and A. aquariorum (Martínez-Murcia et al. 2008) and
proposed the creation of A. dhakensis sp. nov. comb. nov. Due to inconsistent genotypic
and phenotypic feature, “A. sharmana” (Saha and Chakrabarti 2006) has not been
included in the genus (Martínez-Murcia et al. 2007; Lamy et al. 2010).
1.3.3.1. Aeromonas allosaccharophila
This species was proposed by Martínez-Murcia et al. (1992a) based on two strains
recovered from diseased elvers (Anguilla anguilla) and one from human stools.
Evidence against A. allosaccharophila representing a separate species derived from
discrepancies reported in the biochemical profiles of the original strains (Martínez-
Murcia et al. 1992a; Esteve et al. 1995b; Huys et al. 1996a; 2001); amplified fragment
length polymorphism (AFLP) and fluorescent amplified fragment length polymorphism
(FAFLP) patterns identical to those of A. veronii (Huys et al. 1996b; Huys and Swings
1999); the nucleotide sequences of several housekeeping genes showed A.
allosaccharophila in close proximity to A. veronii and not sufficiently distant to
confidently separate the two species (Nhung et al. 2007; Miñana-Galbis et al. 2009;
Lamy et al. 2010). Evidence supporting A. allosaccharophila as a separate species
derived from i) its unique 16S rDNA sequence composition that clearly differentiated
this species from most other members of the genus including A. veronii (Martínez-
Murcia et al. 1992a); ii) the nucleotide sequences of the rpoD and gyrB housekeeping
genes (Yañez et al. 2003; Soler et al. 2004; Saavedra et al. 2006) (Figs. 1.2 and 1.3); iii)
multilocus sequence analysis showed that A. allosaccharophila and A. veronii were
-- 4 --
Table 1.1 Current Aeromonas species
Species HG Source of type strain Reference
A. hydrophila ssp. hydrophila 1 Tin of milk with fishy odour Stanier (1943)
A. salmonicida ssp. achromogenes 3 Fish (Salmo trutta) Smith (1963)
A. salmonicida ssp. salmonicida Salmon (Salmo salar) Schubert (1967b)
A. salmonicida ssp. masoucida Fish blood (Oncorhynchus masou) Kimura (1969)
A. sobria 7 Fish Popoff and Veron (1976)
A. media 5 River water Allen et al. (1983)
A. caviae 4 Guinea-pig Popoff (1984)
A. veronii 8/10 Frog red leg/sputum Hickman-Brenner et al. (1987)
Aeromonas ssp. 11 Ankle suture Hickman-Brenner et al. (1987)
A. schubertii 12 Forehead abscess Hickman-Brenner et al. (1988)
A. eucrenophila 6 Carp Schubert and Hegazi (1988)
A. salmonicida ssp. smithia Fish Austin et al. (1989)
A. trota 14 Human faeces Carnahan et al. (1991a)
A. jandaei 9 Faeces Carnahan et al. (1991c)
A. allosaccharophila 15 Diseased elvers/human faeces Martínez-Murcia et al. (1992a)
A. encheleia 16 European eels Esteve et al. (1995a)
A. bestiarum 2 Infected fish Ali et al. (1996)
-- 5 --
Table 1.1 Continued.
Species HG Source of type strain Reference
A. popoffii 17 Drinking water production plant Huys et al. (1997b)
A. salmonicida ssp. pectinolytica Water from cistern Pavan et al. (2000)
A. hydrophila ssp. ranae Farmed frog Huys et al. (2003)
A. simiae Monkey faeces Harf-Monteil et al. (2004)
A. molluscorum Wedge-shells (Donax trunculus) Miñana-Galbis et al. (2004a)
A. bivalvium Cockles (Cardium spp.) Miñana-Galbis et al. (2007)
A. tecta Stool of a child with diarrhoea Demarta et al. (2008)
A. piscicola Diseased fish Beaz-Hidalgo et al. (2009)
A. fluvialis River water Alperi et al. (2010a)
A. diversaa 13 Human leg wound Miñana-Galbis et al. (2010)
A. sanarellii Human wound Alperi et al. (2010b)
A. taiwanenesis Burn wound Alperi et al. (2010b)
A. rivuli Freshwater Figueras et al. (2011a)
A. australiensis Treated effluent water Aravena-Román et al. (2013)
A. dhakensisb Children with diarrhoea Beaz-Hidalgo et al. (2013)
A. cavernicola Isolated from water brook Martínez-Murcia et al. (2013)
a
previously classified as Aeromonas group 501 (Hickman-Brenner et al. 1988);
b
combined from A. hydrophila ssp. dhakensis (Huys et al. 2002a) and A. aquariorum (Martínez-Murcia et al. 2008)
-- 6 --
A. salmonicida spp. salmonicida (CECT 894T)
A. salmonicida ssp. smithia (CIP 104757)
A. salmonicida spp. masoucida (CECT 896)
100
A. salmonicida spp. pectinolytica (34mel)
A. salmonicida ssp. achromogenes (CECT 895)
97 A. veronii bv. sobria (ATCC 9071)
A. veronii bv. veronii (DSM 7386T)
A. hydrophila spp. dhakensis (LMG 19562T)
A. hydrophila ssp. hydrophila (ATCC 7966T)
84 A. hydrophila spp. ranae (LMG 19707T)
0.005
Figure 1.1 Unrooted neighbour-joining phylogenetic tree derived from gyrB nucleotide
sequences showing subspecies and biovars. The phylogenetic tree was constructed with
530 nt. Numbers at the nodes indicate bootstrap values. Bar, 0.005 estimated
substitutions per site.
-7-
located in different phylogenetic lines and exhibited a high degree of nucleotide
diversity (Martino et al. 2011).
1.3.3.2. Aeromonas spp. HG 11
This unnamed Aeromonas derived from two strains that could not be included in the
original description of A. veronii (Hickman-Brenner et al. 1987). Evidence that
supported the inclusion of Aeromonas HG11 into A. encheleia was based on AFLP
(Huys et al. 1996b) and 16S-23S rDNA-RFLP patterns (Laganowska and Kaznowski
2004); high DDH values (84-87%) between Aeromonas HG11 strains and the type
strain of A. encheleia LMG 16330T (Huys et al. 1997a); and divergent values for gyrB
(2.1-2.2%), rpoD (1.4-1.7%), dnaJ (1.3%), cpn60UT (0.7%) and rpoB (0.9%) (Yañez et
al. 2003; Soler et al. 2004; Nhung et al. 2007; Miñana-Galbis et al. 2009; Lamy et al.
2010). In contrast, phenotypic profiles (Valera and Esteve 2002) and different tRNA
patterns suggested that these two species represent distinct taxa (Laganowska and
Kaznowski 2005). Moreover, the 16S rRNA sequence of A. encheleia and Aeromonas
sp. HG11 differed by eight nucleotides at hypervariable positions 457 to 476 (Martínez-
Murcia 1999), a significant feature considering that in Aeromonas the 16S rRNA gene
similarities range from 96.9 to 100% (Martínez-Murcia 1992a).
1.3.3.3. Aeromonas culicicola
This species originated from strains isolated from the midgut of the mosquito species
Culex quinquefasciatus and Aedes aegyptii (Pidiyar et al. 2002). Evidence that A.
culicicola represents a heterotypic synonym of A. veronii derived from the low
interspecies nucleotide substitution rates for several housekeeping genes (Soler et al.
2004; Nhung et al. 2007; Miñana-Galbis et al. 2009; Lamy et al. 2010); similar
phenotypic and cellular fatty acid profiles (Huys et al. 2005); DDH values well above
70% between A. culicicola MTCC 3249T and A. veronii ATCC 35624T (Huys et al.
2005; Nhung et al. 2007) compared to 44% by the initial report (Pidiyar et al. 2002);
16S rRNA RFLP profiles similar to those of A. veronii (Lamy et al. 2010). In contrast,
16S DNA-RFLP patterns reported by two studies showed that A. culicicola differed
sufficiently from all other members of the genus (Figueras et al. 2005; Kaznowski and
Konecka 2005). Moreover, gyrB gene sequence placed A. culicicola in a separate line of
descent where it differed from A. jandaei by 56 nucleotides (Yañez et al. 2003)
compared to a single nucleotide difference using 16S rDNA (Pidiyar et al. 2003).
-8-
1.4. LABORATORY IDENTIFICATION
Aeromonas species are non-fastidious, catalase and oxidase positive, facultatively

anaerobic Gram-negative fermentative bacilli (Janda 1985). The majority of the species
produce -haemolysis on horse and sheep blood agar and most can produce indole from
tryptophan. Although the optimal temperature for growth is 28C, aeromonads can grow
at temperatures ranging from 1 to 42C (Mateos et al. 1993; Hänninen et al. 1995c) and
can adapt and survive in highly acidic (pH 3.5) environments (Karem et al. 1994).
Traditionally, susceptibility to the vibriostatic agent 2, 4-diamino-6, 7-
diisopropylpteridine (O/129; 150 g disk) and the inability of aeromonads to grow on
thiosulfate citrate bile salts sucrose agar (TCBS) and on 6% NaCl have been used as
preliminary tests to differentiate Aeromonas from closely related Vibrios and
Plesiomonas species. In general, the close phenotypic similarity of aeromonads and
poorly equipped laboratories hampers the identification of aeromonads to species level.
Thus, small laboratories should confine identification to the genus level and significant
clinical or environmental strains should be sent to reference centres for further work
(Abbott et al. 1992).
1.4.1. Isolation
Aeromonas species can grow on most solid media including MacConkey, Hektoen
enteric and xylose lysine desoxycholate (XLDA) agars, although colony size and
plating efficiency differences have been observed (Desmond and Janda 1986; Janda and
Abbott 1999). Plating efficiency appeared to be strain rather than species dependent
(Desmond and Janda 1986). The concentration of salt is critical since Aeromonas do not
usually grow in media containing greater than 3% NaCl (Abbott et al. 2003).
Occasionally, strains of A. trota have been reported to withstand concentrations close to
4% (0.68 M) NaCl (Delamare et al. 2000). An optimal Aeromonas-medium should
contain substrates that do not interfere with the oxidase test (Moulsdale 1983) or include
lactose in its composition as this carbohydrate is highly unsatisfactory for primary
isolation (Millership et al. 1983). The number of Aeromonas species recovered from
different samples has been attributed to variations in technique and media employed to
isolate these organisms (Nazer et al. 1986). A variety of media or variations of well-
established formulae have been developed to isolate and quantify aeromonads from
food, water and human faecal specimens based on biological properties such as
production of amylase and starch activity or the natural tolerance of the majority of
these organisms to ampicillin (Table 1.2).
-9-
85 A. popoffii (CIP 105493T)
A. bestiarum (ATCC 51108T)
A. piscicola (CECT 7443T)
90 A. salmonicida (CECT 894T)
A. molluscorum (DSM 17090T)
A. eucrenophila (ATCC 23309T)
A. encheleia (DSM 11577T)
A. tecta (CECT 7083T)
A. rivuli (CECT 7518T)
A. caviae (ATCC 23212)
99 A. media (ATCC 33907T)
A. bivalvium (CECT 7113T)
79 A. sanarellii (CECT 7402T)
A. cavernicola (CECT 7862T)
73 A. dhakensis (LMG 19562T)

A. hydrophila (ATCC 7966T)
A. jandaei (CECT 4228T)
A. fluvialis (CECT 7401T)
A. sobria (CIP 7433T)
A. veronii (ATCC 9071)
A. australiensis (CECT 8023T)
A. allosaccharophila (DSM 11576T)
A. trota (ATCC 49657T)
A. taiwanensis (CECT 7403T)
A. simiae (DSM 16559T)
96 A. schubertii (ATCC 43700T)

100 A. diversa (CECT 4254T)
0.01
Figure 1.2 Unrooted neighbour-joining phylogenetic tree derived from gyrB sequences
showing current Aeromonas species. The phylogenetic tree was constructed with 530 nt.
Numbers at the nodes indicate bootstrap values. Bar, 0.01 estimated substitutions per
site.
-10-
90 A. taiwanensis (CECT 7403T)
93 A. sanarellii (CECT 7402T)
A. caviae (ATCC 13136T)
A. dhakensis (LMG 7862T)
99 A. hydrophila (ATCC 7966T)
93 A. eucrenophila (ATCC 23309T)

A. tecta (CECT 7082T)
A. media (ATCC 33907T)
A. encheleia (DSM 11577T)
100 A. diversa (CECT 4254T)
100 A. simiae (DSM 16559T)

A. schubertii (CECT 4240T)
A. bivalvium (CECT 7113T)
97 A. molluscorum (DSM 17090T)

100 A. rivuli (CECT 7518T)
A. jandaei (ATCC 49568T)
A. trota (ATCC 49657T)
A. australiensis (CECT 8023T)
A. fluvialis (CECT 7401T)
86
A. veronii (ATCC 9071)
92 A. allosaccharophila (DSM 11576T)
A. sobria (CIP 7433T)
A. cavernicola (CECT 7862T)
A. salmonicida (CECT 894T)
A. popoffii (CIP 105493T)
93
98 A. bestiarum (ATCC 51108T)
A. piscicola (CECT 7443T)
0.02
Figure 1.3 Unrooted neighbour-joining phylogenetic tree derived from rpoD sequences
showing all Aeromonas species. The phylogenetic tree was constructed with 653 nt.
Numbers at the nodes indicate bootstrap values. Bar, 0.02 estimated substitutions per
site.
-11-
Huddleston et al. (2007) recommended that ampicillin should not be used as a selective
agent in isolation medium for Aeromonas when a complete analysis of Aeromonas
diversity and density is desired. These authors argued that media containing ampicillin
was likely to inhibit the growth of ampicillin-susceptible strains resulting in an
underestimation of densities and species diversity.
1.4.2. Identification by phenotypic methods
Identification of Aeromonas by phenotypic methods has been based on the ability of

these bacteria to ferment carbohydrates with vigorous gas production (Kluyver and van
Neil 1936; Stanier 1943; Schubert 1968). However, identification based on biochemical
tests is often unable to accurately identify Aeromonas beyond genus level as phenotypic
features are unstable and vary within the species (Davin-Regli et al. 1998; Martínez-
Murcia et al. 2000; Figueras et al. 2005; Wahli et al. 2005). Moreover, biochemical
analyses depend on the transcription and translation of proteins which in turn are
influenced by environmental factors such as temperature or carbohydrate repression
potentially affecting production of proteins (Knochel 1989; 1990).
Phenotypic identification is also influenced by the number and type of tests and testing
conditions (Valera and Esteve 2002; Esteve et al. 2003; Demarta et al. 2004),
geographical source (Kaznowski et al. 1989) and interpretation of data and
reproducibility of results (Abbott et al. 2003; Ørmen et al. 2005). Inaccurate
identification is further compromised by those species in which only a handful of strains
have been described (Abbott et al. 1992), by the application of schemes designed to
identify clinical isolates to classify strains isolated from environmental and fish sources
(Wakabayashi et al. 1981; Kaznowski et al. 1989; Ashbolt et al. 1995; Borrell et al.
1998; Ørmen et al. 2005). Furthermore, many of the biochemical schemes used in
clinical laboratories predate the description of new taxa leading some authors to
question whether the efficiency of older biochemical schemes are suitable to identify
more recently described species (Edberg et al. 2007).
An identification scheme, the Aerokey II (Carnahan et al. 1991b; Joseph and Carnahan
1994) based on a small subset of highly discriminatory biochemical tests and the
AeroMat-1/AsalMat-1 designed exclusively for the identification of A. salmonicida to
species and subspecies levels, respectively, were developed (Higgins et al. 2007).
-12-
However, Aerokey II has not been generally adopted by laboratories due to the
inconsistent biochemical profiles expressed by some species, costs and long incubation
times required (Abbott et al. 1992; Janda and Abbott 1998). Furthermore, Aerokey II
may be unsuitable for those regions harbouring strains with unique phenotypic profiles
or due to the heterogeneous character of some species (Altwegg et al. 1990) while a
lack of congruence between Aerokey II and genotypic identification has been reported
(Noterdaeme et al. 1996).
Other potential identifying markers proposed to differentiate Aeromonas species

included susceptibility to cephalexin (Janda and Motyl 1985), induced colistin
resistance (Fosse et al. 2003b), production of a CAMP-like factor (Figura and
Guglielmetti 1987) and maximum growth temperature determined with a temperature-
gradient incubator (Havelaar et al. 1992; Hӓnninen 1994). The production of acetic acid
in glucose-containing media is a peculiar characteristic displayed by certain species
whereby some aeromonads become unviable (“the suicide phenomenon”). This test was
designed as an identification marker to separate A. caviae (Namdari and Cabelli 1989).
1.4.3. Identification by commercial systems
A plethora of commercial systems such as Vitek, API, MicroScan Walk/Away, BBL

Crystal Enteric/Non-fermenter, Biolog and the Phoenix 100 ID/AST contain selected
Aeromonas species in their databases (Hӓnninen 1994; Park et al. 2003; Soler et al.
2003b; Huddleston et al. 2006; O’Hara 2006). Unfortunately, identification of
Aeromonas by these systems is inadequate resulting in major errors (Janda and Abbott
2010). Among the major identification problems encountered with these systems are:
misidentification of Aeromonas species as V. cholerae and V. damsela (Abbott et al.
1998), partly attributed to the lower salt concentration (0.45% NaCl) recommended by
the manufacturer in the preparation of the inoculum in the Vitek identification system
(Park et al. 2003); production of acid by the API 20E is temperature-dependent
resulting in false-negative results if the strip is incubated at 37C (Hӓnninen 1994); the
percentage of correct identifications for MicroScan Walk/Away (14.5%) and BBL
Crystal Enteric/Non-fermenter (20.3%) systems is low (Soler et al. 2003b) while the
Phoenix 100 ID/AST identified only 60% of Aeromonas (O’Hara 2006).
-13-
Table 1.2 Examples of media used in the isolation of Aeromonas from different sources
Media Source/purpose Reference
Glutamate starch phenol (GSP); Red agar (Pseudomonas- Foods of animal Ullman et al. (2005); Yucel and
Aeromonas-selective agar) origin/environmental sources Erdogan (2010)
Blood ampicillin agar (BAA); Oxoid Aeromonas agar; Starch Seafood Robinson et al. (1984); Palumbo et
amipicillin agar (SAA) al. (1985); Pin et al. (1994); Tsai
and Chen (1996)
Blood agar containing p-nitrophenol glycerine Faecal samples Burke et al. (1983); Robinson et al.
(1986)
Cary-Blair medium Transport medium Moyer (1987)
Difco Aeromonas agar (DAA); ampicillin blood agar (ABA); Children stools/ carriage rate Wilcox et al. (1992)
xylose desoxycholate citrate agar (XDCA) and alkaline peptone
water (APW)
Ampicillin-Dextrin Agar (ADA) Raw, processed and ready-to- Kingome et al. (2004)
eat foods samples
XDCA, DNA toluidine agar (DNAT); Salmonella-Shigella Faecal carriage rate Millership et al. (1983); von
sodium desoxycholate (SSSD) agar Graevenitz and Zinterhofer (1970);
Wauters (1973); Figura (1985)
inositol-bile-salts-brilliant green (IBB) and cefsulodin-irgasan- Faecal/ability to grow on these Altorfer et al. (1985); Moyer et al.
novobiocin agar (CIN); BAA media (1991)
-14-
1.4.4. Additional phenotypic methods
Many non-biochemical methods have been employed as alternatives to biochemical

identification for typing or identification purposes, or both. Some, such as the use of
core oligosaccharides from the endotoxins have not been readily adopted as routine
identification methods (Shaw and Hodder 1978). Isoenzyme analysis has been used as
both a screening method to investigate the epidemiology of hospital infections and as an
identification tool (Picard and Goullet 1987; Altwegg et al. 1988). Multi-loccus enzyme
electrophoresis (MLEE) has been considered useful as a sole method for species
identification and shows good correlation with taxonomic groupings as determined by
DDH (Altwegg et al. 1991c; Miñana-Galbis et al. 2004b). In contrast, phage typing,
although specific to the genus Aeromonas, may be over-sensitive (Altwegg et al. 1988).
The use of outer membrane protein (OMP) composition as a typing method is
cumbersome and time consuming and OMP profiles are influenced by temperature and
the air-supply available to the bacterial cultures (Küijper et al. 1989a). Methods such as
radiolabelled cell proteins (radioPAGE) profiles are difficult to interpret and prone to
subjective bias (Stephenson et al. 1987) while conflicting data have been reported with
whole-protein fingerprinting (Millership and Want 1993; Alavandi et al. 2001; Szczuka
and Kaznowski 2007).
1.4.5. Semiautomated systems
Two semi-automated systems based on the analysis of cellular fatty acid methyl esters
by gas-liquid chromatography (GLC-FAMEs) and by measuring the differences in
protein mass generated by the matrix-assisted laser-desorption/ionization mass
spectrometry time-of flight (MALDI-MS-TOF) are widely used in identification of
Aeromonas. Both methods are expensive and in the case of GLC-FAME require highly
trained personnel. The systems can be used for the rapid identification of bacteria
(Rahman et al. 2002) or as a typing tool (Osterhout et al. 1991; von Graevenitz et al.
1991; Huys et al. 1994, 1995; Donohue et al. 2006, 2007).
The reproducibility of the GLC-FAMEs system depends greatly on media, temperature

of incubation, sets of strains, GC model used to analyse cellular fatty acid patterns and
previous exposure to antibiotics (Canonica and Pisano 1988; Huys et al. 1994;
Kӓempfer et al. 1994). A high identification rate of Aeromonas to species level has been
reported by MALDI-TOF users making this system the most accurate for identification
-15-
of these bacteria (Lamy et al. 2011). For those laboratories that can afford it, the
MALDI-TOF has largely superseded most automated identification systems. Although
the instrument is expensive, consumables and operational costs are lower than those
incurred by the MIDI system, the most commonly used system used to detect FAME. It
also requires less laboratory space than the MIDI system.
1.4.6. Identification by molecular methods
Practically every known molecular technique, each with its own strengths and
weaknesess, has been used in the classification and typing of aeromonads since Popoff
et al. (1981) placed them into DNA hybridization groups. In Aeromonas, the use of a
single typing method to determine interrelationship between species may not be
adequate as the potential for discrimination increases by combining different molecular
methods (Altwegg et al. 1988; Davin-Regli et al. 1998; Soler et al. 2003a; Morandi et
al. 2005). The application of these methods has been useful in establishing the
epidemiological relationships between aeromonads recovered from very different
sources (Villari et al. 2003). However, a situation similar to phenotypic identification
exists where a lack of congruence between different molecular methods has been
recognized (Hӓnninen and Siitonen 1995; Graf 1999a; Martínez-Murcia 1999; Figueras
et al. 2000b; Yañez et al. 2003; Laganowska and Kasnowski 2005; Saavedra et al.
2006). Methods employed in the characterization and typing of aeromonads included
those based on restriction enzymes used to digest genomic DNA [ribotyping, amplified
fragment length polymorphism (AFLP), fluorescence amplified fragment length
polymorphism (FAFLP), restriction fragment length polymorphism (RFLP)]; PCR-
based methods [randomly amplified polymorphic DNA (RAPD), enterobacterial
repetitive intergenic consensus (ERIC), repetitive extragenic palindromic (REP)] and
PCR followed by DNA sequencing targeting single or multiple genes (MLST/MLSA).
In the case of AFLP and FAFLP, digestion of DNA with restriction enzymes was
followed by PCR. Other methods used included pulse field gel-electrophoresis (PFGE)
and plasmid profiles.
1.4.6.1 Typing methods
Although some of the methods mentioned in the previous section can be used for both
identification and typing purposes some are more suitable as typing methods for the
determination of strain relatedness. The use of plasmid profiles was reported to be
relatively unstable and not useful in genomic typing (Altwegg et al. 1988) while others
-16-
are more suitable for fingerprinting at strain level (Chang and Janda 2005). The poor
discriminatory patterns precluded PFGE to be used as an identification method. Instead,
PFGE offers an effective alternative as a typing method (Bonadonna et al. 2001;
Abdullah et al. 2003). The most satisfactory methods used in Aeromonas typing include
RFLP, RAPD, ERIC and AFLP and can be applied to determine the relatedness of
isolates in recurrent infections, the linkage of infections to environmental sources and
pseudo-outbreaks of disease (Janda and Abbott 2010).
1.4.6.2. Identification based on 16S-23S rRNA gene sequence
The most common target used in bacterial identification in laboratories world-wide is

the 16S rRNA gene (Stackebrandt and Goebels 1994; Petti et al. 2005; Boudewijns et
al. 2006; Janda and Abbott 2007). In aeromonads, 16S rRNA gene sequence signature
regions that differentiate some species from all other members in the genus have been
described (Demarta et al. 1999; Figueras et al. 2000b; Martínez-Murcia et al. 2000). As
a consequence, 16S rRNA-based probes designed to identify individual species directly
from samples have been developed (Ash et al. 1993a/b; Dorsch et al. 1994; Khan and
Cerniglia 1997; Demarta et al. 1999). Genus specific primers based on the 16S-23S
rRNA intergenic spacer region (ISR) have been designed to confirm the identity of
aeromonads following initial morphological and biochemical tests (Kong et al. 1999).
Overall, 16S rRNA sequencing has been found unsuitable to accurately differentiate
Aeromonas species (Martínez-Murcia et al. 2000) as the resolution power of the 16S
rRNA gene is limited when used to differentiate organisms that have identical or similar
sequences (Fox et al. 1992; Martínez-Murcia et al. 1992b; Thompson et al. 2004;
Morandi et al. 2005). For example, the DNA relatedness between A. caviae and A. trota
is 30% although their 16S rRNA sequences differ by only three nucleotides. On the
other hand, A. veronii and A. sobria differ by 14 nucleotides while they are 60 to 65%
related in DNA pairing studies (Martínez-Murcia et al. 1992b).
Secondly, the intragenomic heterogeneity of most Aeromonas based on rrn operon

nucleotide polymorphisms showed values ranging from 0.06 to 1.5%. The latter value
reported in A. veronii, a species known to possess up to six copies of the 16S rRNA
gene (Morandi et al. 2005; Alperi et al. 2008). Roger et al. (2012a) showed that
aeromonads harboured 8 to 11 rrn operons with 10 operons being observed in more than
92% of the strains studied. Although the use of the 16S rRNA gene as an identification
-17-
tool for aeromonads has been found useful by some (Figueras et al. 2005; Al-Benwan et
al. 2007), it should not be the only gene used for Aeromonas species identification and
delineation. This method has now been superseded by the use of housekeeping genes
sequencing (Husslein et al. 1992; Cascón et al. 1996; Khan and Cerniglia 1997; Yañez
et al. 2003; Soler et al. 2004; Nhung et al. 2007; Adekambi et al. 2008; Miñana-Galbis
et al. 2009).
1.4.6.3. Identification based on housekeeping gene sequence
Housekeeping genes are universally distributed among bacterial species and are rarely
predisposed to horizontal transfer as may be the case with 16S rRNA (Yañez et al.
2003; Morandi et al. 2005). The sequence divergence of housekeeping genes is usually
greater than that of 16S rRNA and in some cases the mean substitution rate is four to six
times higher (Yamamoto and Harayama 1996; Yañez et al. 2003; Soler et al. 2004;
Küpfer et al. 2006; Saavedra et al. 2006; Nhung et al. 2007; Beaz-Hidalgo et al. 2009;
Figueras et al. 2011b). Housekeeping genes provide better targets for Aeromonas
delineation (Yañez et al. 2003) with the added advantage that these methods are less
laborious to perform than DDH.
The sequences of the housekeeping genes recA, rpoB, dnaJ and cpn60 UT were
comparable with gyrB and rpoD and superior to 16S rRNA for the differentiation of
Aeromonas species (Küpfer et al. 2006; Nhung et al. 2007; Miñana-Galbis et al. 2009;
Lamy et al. 2010). The combined sequence of several housekeeping genes, multiloccus
sequence typing (MLST) also known as multilocus sequence analysis (MLSA) is a
powerful tool that can be used to determine the microbial diversity and classification of
these organisms (Beaz-Hidalgo et al. 2009; Figueras et al. 2011a; Martino et al. 2011).
1.4.6.4. Specific genes used as identification targets
Primers designed to detect virulence genes that allow the direct identification of specific
species included the aerolysin gene of A. trota (Husslein et al. 1992; Khan et al. 1999),
the lip gene of A. hydrophila (Cascón et al. 1996) and a 421 bp sequence from the 3’
region of the surface array protein (vapA) gene of A. salmonicida (Gustafson et al.
1992). The latter assay doubles as a non-invasive method to monitor A. salmonicida in
carrier fish and as a virulence marker (Gustafson et al. 1992). The glycerophospholipid-
cholesterol acyltransferase (GCAT) gene is universally present in Aeromonas (Chacón
et al. 2002) and has been used as a target to identify aeromonads to the genus level
-18-
(Puthucheary et al. 2012). Multiple-PCR (mPCR) assays capable of identifying up to
98% of Aeromonas species by detecting the presence of virulence genes have been
developed (Sen 2005; Chang et al. 2008). The m-PCR assay based on oligonucleotide
primers directed to the AHCYTOENT gene was designed for the rapid and specific
detection of A. hydrophila in diseased fish including viable but non-culturable cells
(Chu and Lu 2005a). Multiple-PCR assays are less expensive to run than RFLP and
almost complete agreement with identification by biochemical methods has been
reported (Sen 2005).
1.4.6.5. Restriction enzyme-based methods
Several enzyme-based methods such as ribotyping, AFLP and restriction endonuclease

analysis have been used alone, or in combination, as identification and typing tools in
the classification of aeromonads. Of these, ribotyping is a useful method for species
identification. It requires minimal DNA for testing and several strains can be tested
simultaneously (Rautelin et al. 1995b; Martínez-Murcia et al. 2000; Soler et al. 2003a).
Ribotyping has been the method of choice to demonstrate familial transmission and
long-term colonization by A. caviae (Moyer et al. 1992; Rautelin et al. 1995b) and to
determine routes of furunculosis in Finnish salmon caused by A. salmonicida ssp.
salmonicida (Hӓnninen et al. 1995b). Ribotyping was found to be more sensitive than
MLEE (Altwegg et al. 1991b) and superior to PFGE in an epidemiological study of A.
salmonicida ssp. salmonicida (Hӓnninen and Hirvela-Koski 1997). PFGE patterns from
mesophilic aeromonads revealed a high level of genetic heterogeneity (Talon et al.
1996; Hӓnninen and Hirvelӓ-Koski 1997; Villari et al. 2000). In contrast, PFGE patterns
for A. salmonicida ssp. salmonicida confirmed the genetic homogeneity of this species
(Hӓnninen and Hirvelӓ-Koski 1997; Miyata et al. 1995).
Bauab et al. (2003) suggested that ribotyping was a useful epidemiological tool suitable
for the study of Aeromonas infections. However, ribotyping was found to be less
discriminatory than ERIC-PCR (Soler et al. 2003a) and due to the genetically
homogeneous nature of A. salmonicida (Hӓnninen et al. 1995b), unsuitable for typing
these species (Altwegg and Luthi-Hottenstein 1991).
As mentioned in section 1.4.6.1 above, one of the most established molecular methods
used as a typing and identification tool for Aeromonas is RFLP (East and Collins 1993;
Borrell et al. 1997; Nagpal et al. 1998; Graf 1999a; Figueras et al. 2000b; Martínez-
Murcia et al. 2000; Soler et al. 2003a; Laganowska and Kaznowski 2004; Kaznowski
-19-
and Konecka 2005; Ghatak et al. 2007a). On the other hand, patterns generated by
AFLP allow clear differentiation of strains within a given species and correlate well
with DDH data suggesting that AFLP can be used for subtyping of aeromonads (Janssen
et al. 1996). Both AFLP and FAFLP have been proposed for epidemiological and
evolutionary studies (Huys et al. 1996b, 1997a, 2001; Janssen et al. 1996; Huys and
Swings 1999).
1.4.6.6. PCR-based methods
PCR-based methods used in the study of aeromonads include RAPD, AFLP and ERIC.
RAPD requires small amounts of genomic DNA (Miyata et al. 1995) while ERIC-PCR
has generally been used in combination with other methods as a typing or differential
tool (Davin-Regli et al. 1998; Sechi et al. 2002; Soler et al. 2003a; Szczuka and
Kaznowski 2004). Both ERIC and RAPD are considered superior to REP-PCR for
distinguishing Aeromonas species clones and for epidemiological investigation (Davin-
Regli et al. 1998; Szczuka and Kaznowski 2004). As a sole testing method, ERIC-PCR
was found more discriminatory for aeromonads than RFLP and REP (Soler et al.
2003a).
1.4.6.7. Disadvantages of molecular methods
In general, most molecular-based methods are time consuming, expensive and labour
intensive and do not always provide reliable and rapid results (Talon et al. 1996; Davin-
Regli et al. 1998; Figueras et al. 2000b; Sen 2005). Some methods are limited in their
applicability because they require materials not readily available in routine laboratories
while others cannot reliably discriminate between strains (Moyer et al. 1992). Other
methods, due to the type of results produced are more suitable for typing purposes than
for species identification (Taçao et al. 2005b). In addition, ribotyping, RFLP and AFLP
patterns can be difficult to interpret (Martínez-Murcia et al. 2000; Morandi et al. 2005;
Sen 2005) while RFLP is highly dependent on the type and number of endonucleases
used (Huys et al. 1996b; Graf 1999a; Figueras et al. 2000b; Kaznowski and Konecka
2005; Ghatak et al. 2007b). Atypical RFLP patterns have been recognized in clinical
strains (Alperi et al. 2008; Puthucheary et al. 2012) more often than in environmental
isolates (p < 0.01) due to microheterogeneities in the 16S rRNA gene (Alperi et al.
2008). The presence of microheterogeneities compromises accurate identification
(Morandi et al. 2005). The taxonomic value of AFLP as a reliable identification tool has
not yet been demonstrated (Martínez-Murcia 1999). Variations in DNA concentrations
-20-
can affect reproducibility of RAPD (Davin-Regli et al. 1995). This method is also
primer dependent (Oakey et al. 1995; 1996a) while interpretation of RAPD-PCR
fingerprints may be affected by co-migration of DNA fragments due to electrophoretic
resolution (Oakey et al. 1998). Due to a lack of standardization and with the exception
of AFLP and ribotyping, results obtained from most methods are often difficult to
compare (Tindall et al. 2010).
1.5. SEROTYPING
Serotyping was considered a promising tool to rapidly differentiate Aeromonas from

other oxidase-positive bacteria (Joseph and Carnahan 1994; Korbsrisate et al. 2002).
However, the variable typability rate of Aeromonas and antisera availability has
hampered the use of serology as a routine identification method in clinical laboratories
(Havelaar et al. 1992; Millership and Want 1993; Bonadonna et al. 2001). As a
consequence, serotyping of Aeromonas has been confined to a few specialized
laboratories.
No absolute association has been described between serotypes and certain phenotypes
as Aeromonas species are serologically heterogeneous, and no serogroup has been
uniquely associated with a single species (Havelaar et al. 1992; Millership and Want
1993; Bauab et al. 2003). The most dominant serogroups O:11, O:16, O:18, O:34 and
O:83 have been associated with gastroenteritis and septicaemia (Kokka et al. 1991;
Merino et al. 1993; Bauab et al. 2003). These serotypes can be present in up to 50% of
the typable strains isolated from human clinical material (Korbsrisate et al. 2002). The
loss of the O:34 antigen lipopolysaccharide due to mutation of the gne gene can affect
motility despite complete flagellar biogenesis as the absence of O:34 antigen affects
both swarming and swimming motilities (Canals et al. 2006a). Strains with the O:34
antigen have been found to have a high level of adhesion when grown at 20 but not at
37C. Thus, the O:34 antigen acts as an adhesion (Merino et al. 1996a).
Serotypes O:11 and O:34 have the capacity to produce a capsule when grown in
glucose-rich medium (Martínez et al. 1995). Group IIA capsules have been found in A.
hydrophila serotypes O:18 and O:34, while group IIB capsules are found in the O:21
and O:27 serogroups (Zhang et al. 2003). Serotype O:11 strains are known to possess an
S-layer that can confer resistance to the bactericidal activity of normal serum (Kokka et
al. 1991) in addition to being associated with invasive infections in an animal model
-21-
system (Paula et al. 1988). S-layers have also been described in serogroups O:14 and
O:81 of A. hydrophila which possessed S-layer proteins different from A. hydrophila
TF7 and A. salmonicida A450 (Esteve et al. 2004). Clinical strains have been found to
be less amenable to serotyping than environmental isolates (Millership and Want 1993).
A differential serological test that determines the presence of A. salmonicida while
ruling out A. hydrophila as the cause of furunculosis in Californian trout (Oncorhynchus
Mykiss, Walbaum, 1792) was developed by Markovic et al. (2007).
1.6. ECOLOGY
The ubiquitous nature of Aeromonas is reflected by the isolation of these organisms

from every environmental niche capable of sustaining bacterial growth. Although,
compared to other aquatic organisms like Pseudomonas species, Aeromonas are less
able to degrade simple compounds to be used as carbon sources (Schubert 1987). In
earlier ecological studies, laboratory personnel were confronted with isolation
procedures and identification schemes which, at the time, were based on phenotypic
testing only (Schubert 1987).
1.6.1. Aquatic environments
Aeromonas species have been recovered from surface water, fish ponds, brooks, sewage
in various stages of treatment, untreated and treated drinking water, rivers, lakes,
groundwater, wastewater, activated sludge, seawater (estuaries), spring, and stagnant
water (Freij 1984; Ørmen and Østensvik 2001). Despite the ubiquitous nature of these
micro-organisms in aquatic environments, their natural reservoir is still unknown.
Several possible niches have been proposed including the flora of plankton and seawater
(Simidu et al. 1971); as natural inhabitans of chironomid egg masses, a feature also
shared by V. cholerae (Senderovich et al. 2008); as inhabitans of duckweed, a potential
reservoir for infections of humans consuming contaminated fish (Rahman et al. 2007a);
and the ability to survive inside Acanthamoeba and remained viable during the
encystment process while exhibiting high levels of recovery from mature cysts (Yousuf
et al. 2013).
1.6.1.1. Distribution in water
The distribution of Aeromonas in water supplies varies depending on the levels of

pollution, geographical region, methods and media used in the identification of
aeromonads and the type of sample analysed (Araujo et al. 1991; Huys et al. 1995;
-22-
Kühn et al. 1997a/b; Sechi et al. 2002; Pablos et al. 2011). Furthermore, the diversity,
density and overall composition of aeromonads vary depending on the time of the year
(Kühn et al. 1997b; Rahman et al. 2007a). Aeromonads have been found to persist for
prolonged periods of time in different water systems (Kühn et al. 1992, 1997c; Rahman
et al. 2007a). Multiple clones have survived and multiplied in raw surface water after
the treatment process (Kühn et al. 1997b) while phenotypically and genotypically stable
clones could persist in treatment systems over long periods of time. As a result, clones
may have spread from hospitalized children with diarrhoea to fish farmed for human
consumption through the sewage water treatment system (Rahman et al. 2007a).
Bacterial populations can increase from 103 to 106 CFU ml after bottling (Hunter 1993)
to 2.7 x 106 CFU/ml and 1.9 x 106 CFU/ml in sediment sewage water and in duckweed
aquaculture-based hospital sewage water treatment plant, respectively (Rahman et al.
2007a).
The distribution of Aeromonas species varies according to the type of water analysed.
Both A. veronii bv. sobria and A. caviae have been predominant in sediment sewage
water and treated sewage effluents (Ashbolt et al. 1995; Rahman et al. 2007a). The high
incidence of A. caviae in sewage and wastewater suggests that this species may have a
role as a potential indicator of water pollution (Araujo et al. 1991; Ramteke et al. 1993).
In general, data from most studies implicate A. hydrophila as the most prominent
species isolated from water samples. Minor species such as A. culicicola and A. popoffii
have also been recovered from raw and treated waste water (Table 1.3) while A.
eucrenophila was isolated from water and infected fish (Singh and Sanyal 1999;
Figueira et al. 2011).
1.6.1.2. Water quality
The presence of Aeromonas in water depends primarily on the organic material content
of the water, water temperature, the length of time in the distribution network and the
presence of chlorine residues (Seidler et al. 1980; Kaper et al. 1981; Hird et al. 1983;
van der Kooij and Hijnen 1988; Borrell et al. 1998; Korzeniewska et al. 2005). The
survival rate of A. hydrophila in mineral water depended largely on the concentrations
of dissolved solid and organic matter and not on temperature of storage (Korzeniewska
et al. 2005). A significant correlation between organic matter content and total numbers
of mesophilic aeromonads in waters has been reported (Araujo et al. 1989;
-23-
Korzeniewska et al. 2005). In polluted water, a correlation also exists between the
numbers of aeromonads, faecal coliforms and the concentration of organic matter as
measured by biological oxygen demand (Araujo et al. 1991). The isolation of
Aeromonas from chlorinated water suggests a high organic loading as a result of
inadequate chlorination (Abbott et al. 1992). Although polluted waters rich in nutrients
readily support the growth of aeromonads, the presence of low molecular weight fatty
acids, amino acids or carbohydrates in low concentrations can also promote growth of
these organisms in less polluted waters (van der Kooij and Hijnen 1988). Indeed, A.
hydrophila could survive for considerable periods of time in filtered-autoclaved fresh
water or in filtered-autoclaved nutrient-poor water in the absence of natural microflora
(Kersters et al. 1996; Korzeniewska et al. 2005). In some regions, aeromonads have
been found to be more numerous than total coliforms in drinking (Schubert 1987) and
fresh water, and their presence may be an indicator of water quality (Knochel and
Jeppesen 1990).
1.6.1.3. Effects of temperature on growth and toxin production
The incidence of Aeromonas is usually low during winter compared to summer

(Millership and Chattopadhyay 1985; Chauret et al. 2001). The ability of aeromonads to
grow at low temperatures (5C) is a serious public health concern (Callister and Agger
1987; Nishikawa and Kishi 1988; Tsai and Chen 1996; Chang et al. 2008).
Environmental isolates are adapted to competitive growth at lower temperatures than
clinical isolates (Callister and Agger 1987). Toxin production is not necessarily
inhibited at low temperatures (Eley et al. 1993) and enterotoxigenic A. hydrophila
strains have been recovered from oysters stored for 18 months at 72C (Abeyta et al.
1986). Maalej et al. (2004) demonstrated that A. hydrophila enter a viable-but-not-
culturable (VBNC) state when exposed to nutritionally-deficient natural seawater at low
temperatures. Changes in temperature from 5 to 23C allowed multiple biological
activities such as adherence and haemolytic activity to be restored. The ability to enter
this VBNC state may explain the persistence of A. hydrophila in water systems during
winter (Maalej et al. 2004).
The ability of bacteria to enter a VBNC state permits the survival of microorganisms
when confronted with adverse environmental conditions. In this state, bacteria fail to
grow on routine microbiological media although they remain viable and retain virulence
(Fakruddin et al. 2013). Ramamurthy et al. (2014) stated that the VBNC had important
-24-
implication in several fields, including environmental monitoring, food technology, and
infectious disease management. These authors suggested that it was important to
investigate the association of bacterial pathogens under VBNC state and the
water/foodborne outbreaks. Studies have shown that A. hydrophila in a VBNC state
may not be as virulent to goldfish compared to normal culturable bacteria (Rahman et
al. 2001). However, from the public health point of view, culture-negative food,
environmental and clinical samples may not necessarily be an indication of a pathogen-
free status. Moreover, low grade infections may be due to the presence of VBNC in
water and food and in some instances incorrectly attributed to viruses when no bacteria
have been detected (Fakkrudin et al. 2013).
1.6.1.4. Aeromonas in drinking water
The incidence of Aeromonas in drinking water from distribution systems is generally

low (Le Chevalier et al. 1982). However, the affinity of A. hydrophila for low
molecular weight substrates indicates that this organism can readily grow if these
compounds are available in drinking water supplies (van der Kooij and Hijnen 1988). In
Denmark, Aeromonas species constituted 28% of the bacterial load in drinking water
with A. hydrophila as the dominant species (Knochel and Jeppesen 1990). The presence
of these organisms in drinking water is undesirable because Aeromonas strains have
been associated with a broad spectrum of human diseases (Gracey et al. 1982a; Burke et
al.1984b; Villari et al. 2003). The relatively high presence of Aeromonas in public
water systems in the USA was attributed to the inability of these systems to maintain an
adequate concentration of residual chlorine throughout the distribution system (Egorov
et al. 2011). The association of aeromonads in drinking water supplies with human
infections and ability to grow in distribution system biofilms, led to the inclusion of
Aeromonas in the first and second editions of the Contaminant Candidate List (CCL)
issued by the United States Environmental Protection Agency (USEPA 1998) and also
in the list of opportunistic bacterial pathogens among the major pathogens and parasites
of health concern (Bitton 2014). Moreover, the presence of Aeromonas in food and
water represents a vehicle for Aeromonas infections (Ottaviani et al. 2011).
-25-
Table 1.3 Distribution of Aeromonas spp. in water sources from different locations
Species (%) Location Type of water Reference
A. caviae (55%); A. hydrophila (34%); A. sobria (6%); Northern Sewage, river, sea Araujo et al. (1991)
Aeromonas spp. (5%) Spain
A. hydrophila (51%);1 A. caviae (26%);1 A. veronii (11%); Finland Fresh, drinking Hänninen and Siitonen (1995)
Unknown spp. (11%)
A. hydrophila (39%);1 A. caviae (23%); A. sobria (17%) Belgium Drinking, raw/treated Huys et al. (1995)
surface and phreatic
groundwater
A. sobria (14%); A. caviae (11%); A. hydrophila (9.5%) India Metropolitan water Alavandi et al. (1999)
supply, bore, drinking
A. sobria (70%); A. popoffii (30%) Russia Drinking Ivanova et al. (2001)
A. hydrophila (67%); A. salmonicida (26%); A. sobria (11%) Sardinia, Coastal marine waters Sechi et al. (2002)
Italy
-26-
Species (%) Location Type of water Reference
A. hydrophila2; A. veronii (both biovars)2 India River Sharma et al. (2005)
A. culicicola (45%); A. veronii (36%); A. salmonicida (8%); Spain Drinking Figueras et al. (2005)
A. hydrophila (7%)
A. hydrophila (25%) India Surface Bhowmik et al. (2009)
A. media (~67%); A. caviae (33%) Leon, Spain Drinking Pablos et al. (2010)
A. dhakensis3 (55%); A. veronii bv. sobria (27%); Australia Irrigation, reservoir, Aravena-Román et al. (2011b)
A. hydrophila (9%) treated, bore,
chlorinated
1 2 3
Identified as complex; Percentages not given; Previously classified as A. aquariorum.
-27-
1.6.2. Aeromonas in foods
Reports of Aeromonas-associated foodborne outbreaks began to appear frequently from

the late-1970s reaching a peak in the 1980s (Abeyta et al. 1986; Isonhood and Drake
2002). Aeromonas species are not unusually resistant to traditional food processing
techniques but are regularly isolated in variable numbers from vegetables, minced beef,
pork, chicken, seafood, milk, cheese, fish, cream (Callister and Agger 1987; Nishikawa
and Kishi 1988; Palumbo et al. 1989; Knochel and Jeppesen 1990; Kirov et al. 1993;
Szabo et al. 2000; Villari et al. 2000; Castro-Escarpuli et al. 2003). This may explain
the presence of Aeromonas in the stools of healthy humans since this represents
transient colonization probably due to consumption of contaminated foods or drinking
water.
The concentration of aeromonads varies depending on the food analysed and the
location (Table 1.4). The incidence can vary from no aeromonads found in vegetables in
Sweden (Krovacek et al. 1992) to large concentrations detected in raw food samples in
Switzerland (Gobat and Jemmi 1993). Although food industries supplied with
inadequately treated water may allow the spread of highly toxic strains and cause
diarrhoeal illness (Abbott et al. 1992), contamination of food samples does not always
originate from water (Hänninen and Siitonen 1995). A significant higher incidence of
pathogenic aeromonads has been detected in raw food than in processed and ready-to-
eat food samples (Kingome et al. 2004). Furthermore, the ability of aeromonads to grow
in refrigerated grocery store produce, milk and meat implicates these bacteria as
potential food pathogens, and these products may represent an important vehile of
transmission (Kirov et al. 1993). Aeromonads harbouring virulence factors have been
isolated world-wide from a variety of foods (Martins et al. 2002; Awan et al. 2006;
Rodríguez-Calleja et al. 2006; Yucel and Erdogan 2010).
1.6.2.1. Distribution of Aeromonas spp. in foods
Overall, the most frequently isolated species from foods world-wide is A. hydrophila.
This species has been recovered from fish, seafood, raw milk, poultry and red meats
Nishikawa and Kishi 1988; Palumbo et al. 1989; Knochel and Jeppesen 1990; Hudson
and De Lacy 1991; Gobat and Jemmi 1993; Tsai and Chen 1996; Kingome et al. 2004;
Rodríguez-Calleja et al. 2006; Yucel and Erdogan 2010). The frequent isolation of A.
hydrophila from oysters suggests that oysters may offer a better environment for growth
-28-
Table 1.4 Enumeration of Aeromonas spp. in different foodstuffs
Source Incidence Location Reference
Retail grocery store produce1 1 x 102 to 2.3 x 104/g USA Callister and Agger (1987)
Various products2 102 to 104/g New Zeland Hudson and De Lacy (1991)
Vegetables and raw milk Aeromonas no isolated Sweden Krovacek et al. (1992)
Raw food samples 6 x 106 CFU/g Switzerland Gobat and Jemmi (1993)
Lettuce 105 to 107 CFU/g Australia Szabo et al. (2000)
Various products3 104 to 105 CFU/g Italy Villari et al. (2000)
Organic vegetables Not estimated Northern Ireland McMahon and Wilson (2001)
Seafood 104 bacteria/g Germany Ullman et al. (2005)

1
Initial concentration of aeromonads estimated at the time of purchase. Growth increased 10 to 1000 fold after 14 days incubation at 5C.
2
Included ready to eat meat, poultry, shellfish, fish, meats, salads. Enumeration of aeromonads was determined by direct plating out.
3
Products included vegetables, cheeses, meats and ice creams.
-29-
than other seafood (Tsai and Chen 1996). In Spain, A. hydrophila has been found as the
predominant species in rabbit meat in addition to Y. enterocolitica, Listeria spp. and S.
aureus (Rodríguez-Calleja et al. 2006). Potentially pathogenic species such as A. sobria,
A. trota and A. veronii bv. veronii, occasionally associated with gastroenteritis, have
been isolated from a variety of foods (Nishikawa and Kishi 1988; Granum et al 1998;
Merino et al. 1995; Janda and Abbott 1998). In Northern Ireland, A. schubertii (21%)
was the most common aeromonad isolated from organic vegetables (McMahon and
Wilson 2001) while an investigation of frozen fish samples in Mexico reported that A.
salmonicida (67.5%) and A. bestiarum (20.9%) accounted for the majority (88.3%) of
the isolates (Castro-Escarpulli et al. 2003). There is evidence that species such as A.
trota are able to grow in 0.68M NaCl, the concentration used as food preservative
(Delamare et al. 2000).
1.7. EPIDEMIOLOGY AND PUBLIC HEALTH ISSUES
Unlike other recognized pathogens such as N. meningitidis, N. gonorrhoeae, and S.

Typhi, Aeromonas is not a reportable organism. In the United Kingdom (UK)
Aeromonas bacteraemia is a voluntarily reportable condition while in the state of
California, USA, the practice of reporting infections with aeromonads was discontinued
(Janda and Abbott 2010). The incidence of aeromonads in healthy humans has been
estimated to vary between 1 and 3.5% compared to 10.8% in faeces from diarrhoeic
patients (von Graevenitz and Mench 1968; Goodwin et al. 1983; Edberg et al. 2007;
Rahman et al. 2007a; Suarez et al. 2008). The combined incidence of Aeromonas
septicaemia in the USA and the UK has been estimated to be 1.5 per million (Janda and
Abbott 2010). Colonization of humans with aeromonads begins very early in life. A
survey of 52 cesarean-borne Peruvian children showed that 23% of the infants
harboured Aeromonas during the first week of life without developing clinical
symptons. Colonization of the infants was attributed to the hospital water (Pazzaglia et
al. 1990a).
Although Aeromonas are present in most foods and aquatic environments, the global
incidence of infections caused by these microbes is unknown (Hӓnninen and Siitonen
1995). Asymptomatic human carriers could serve as vectors for the organism, in
particular, individuals working as food handlers (Abeyta and Wekell 1988). The
presence of virulence factors in water isolates of A. hydrophila (Bondi et al. 2000)
reinforces the notion that from the public health perspective, the isolation of
-30-
aeromonads from water and foods is associated with intestinal and extraintestinal
infections. Episodes of diarrhoea in children and adults after consumption of
contaminated food and drinking water have been described (Freij 1984; Lehane &
Rawlin 2000). This is particularly important in developing countries such as India
where river water contaminated with aeromonads species is used for drinking and
recreational activities (Sharma et al. 2005). Indeed, accidents in water-related
recreational activities have resulted in serious infections with these organisms (Bossi-
Küpfer et al. 2007). Less commonly, infections with aeromonads due to animal bites
have been reported. These infections have been attributed to the disruption of the natural
environment of animals due to expansion of urban areas into rural regions (Angel et al.
2002; Kunimoto et al. 2004).
1.7.1. Water-associated infections
The presence of multiple virulence factors in Aeromonas isolated from water including
chlorinated water represents a serious public health concern (Alavandi et al. 1999;
Figueras et al. 2005; Snowden et al. 2006; Rahman et al. 2007a; Bhowmik et al. 2009).
The proportion of aeromonads strains carrying putative virulence factors varies from 36
to 71% (Seidler et al. 1980; Kaper et al. 1981; Kühn et al. 1997b). In humans,
gastrointestinal and soft tissue infections are the result of exposure to or ingestion of
contaminated water supplies (von Graevenitz and Mench 1968; Washington 1972;
Joseph et al. 1979; Seidler et al. 1980). Experiments on mice have shown that the
ability to cause damage by Aeromonas isolated from clinical and water sources is
comparable to toxigenic V. cholerae (Bhowmik et al. 2009).
Raw waters prepared for human consumption from sewage-polluted surface waters
loaded with pathogenic Aeromonas represent a potentially greater health risk to the
human population than the use of underground water (Schubert 1991a). Polluted waters
represent a health hazard to the human population in general but to the military,
commercial divers and people involved in aquatic sports in particular (Berg et al. 2011).
Several Aeromonas species possessing a variety of cytotoxins and other virulence
factors have been isolated from drinking, river, sea and fresh water (Ashbolt et al. 1995;
Ivanova et al. 2001; Balaji et al. 2004; Sharma et al. 2005; Khan et al. 2008; Berg et al.
2011). Evidence for the water-borne origin of infections caused by Aeromonas in
humans derived from several studies (Picard and Goullet 1987; Khajanchi et al. 2010;
Pablos et al. 2010; Lye 2011). In drinking and mineral water, Aeromonas can persist for
-31-
a long time due to biofilm formation (Dorsh et al. 1994; Kühn et al. 1997b; Chauret et
al. 2001; Villari et al. 2003). Thus, Aeromonas counts have been proposed as an
additional indicator of water quality in the United States (US) and other countries
(Villari et al. 2003). In addition, the US Environmental Protection Agency’s
Contaminant Candidate List has included A. hydrophila as an emerging pathogen in
drinking water (Borchardt et al. 2003). Surprinsingly, a 2011 study recommended that
Aeromonas should not be included in further editions of the CCL concluding that these
microbes do not represent a significant public health hazard (Egorov et al. 2011).
1.7.2. Food-associated infections
Like water, contaminated fish, meats and poultry also represent a health hazard to
humans as these products are an integral food source of the human diet (Kirov 1993;
Hӓnninen and Siitonen 1995; Rahman et al. 2007a). However, despite that most foods
can be contaminated with aeromonads as described in section 1.5.2, only a few reports
have implicated aeromonads as the cause of food-poisoning outbreaks (Abeyta et al.
1986; Todd et al. 1989; Kirov 1997). The most compelling evidence to date derived
from the consumption of ready-to-eat shrimp cocktail by a 38 year-old man who
developed gastroenteritis. Ribotyping patterns revealed that the patient’s stools and the
shrimp contained identical Aeromonas spp. (Altwegg et al. 1991a). In Sweden, 24
people developed food-poisoning symptoms including severe acute diarrhoea,
abdominal pain, headache, fever, and vomiting after consuming food contaminated with
a highly virulent A. hydrophila strain (Krovacek et al. 1995). Consumers are regularly
exposed to toxin-producing strains without registering signs of malaise although
theoretically, food-poisoning could result from colonization and less likely, by
intoxication due to the elaboration of preformed toxins (Knochel and Jeppesen 1990;
Kirov 1993; Villari et al. 2000). In humans, food poisoning due to consumption of
contaminated fish can lead to septicaemia (Ketover et al. 1973) or contact with fish can
cause serious infections particularly in immunocompromised individuals (Lehane and
Rawlin 2000). Thus, recommendations designed to control and limit the growth of these
and other potentially pathogenic bacteria have been proposed (Szabo et al. 2000).
1.7.3. Aeromonas and fish infections
-32-
Aeromonas species are part of the normal microbial flora of fishes and other aquatic
animals and plants (Simidu et al. 1971; Trust and Sparrow 1974). Among freshwater
fish, Aeromonas and Vibrio species predominate (Trust and Sparrow 1974).
Aeromonas-related disease in fish is of high economic significance and has become a
major problem to fish aquaculture (Austin and Austin 1987; Nash et al. 2006; In-
Young-and Joh 2007; Zmyslowska et al. 2009; Pridgeon et al. 2011). In order to control
aeromonasis, aquaculture farmers rely primarily on the use of antimicrobials. However,
this practice is expensive and a potential risk to the environment and human health
(Harikhrishnan et al. 2010a). Recent studies have proposed the bacteriolytic properties
of the predator bacterium Bdellovibrio and the antibacterial properties of the
extracellular products of Bacillus amyloliquefaciens for the control of pathogenic A.
hydrophila (Cao et al. 2011, Cao et al. 2012). The latter is considered a promising
probiotic for the biocontrol of A. hydrophila infections in the eel A. anguilla (Cao et al.
2011) while Bdellovibrio strain F16 significantly reduced the cell density of A.
hydrophila exhibiting 100% lysis activity against this pathogen (Cao et al. 2012). A
recent method that increases the effectiveness of solar disinfection via a thin-film fixed
bed reactor has been developed for the solar photocatalytic inactivation of A. hydrophila
(Khan et al. 2012).
The species most often associated with fish infections are A. salmonicida, A. hydrophila
and A. veronii although re-identification of a group of aeromonads isolated from
diseased fish revealed that other species including A. sobria, A. salmonicida, A.
bestiarum, A. hydrophila, A. piscicola and a strain of A. tecta prevailed (Beaz-Hidalgo
et al. 2009). Furunculosis in fish is typically caused by A. salmonicida while A.
hydrophila, the primary aetiological agent in red-sore disease (Hazen 1979), can also
cause furunculosis and septicaemia in various fish species leading to severe losses in
farm production (Wakabayashi et al. 1981; Nash et al. 2006). Usually, infection by
these bacteria is manifested as an acute form involving septicaemia and episodes of
haemorrhage at the bases of the fins, loss of appetite and melanosis. Subacute to chronic
forms of the disease are usually observed in older fish accompanied by lethargy, slight
exophthalmia and haemorrhaging muscle and internal organs (Joseph and Carnahan
1994; Austin and Adams 1996).
1.8. BIOREMEDIAL AND BIODEGRADABLE PROPERTIES
-33-
Aeromonas may play significant environmental roles or express unsual properties
including the detoxification or removal of environmental toxins in groundwaters,
industrial affluents and contaminated soils; maintaining the balance of carbon and
nitrogen elements in the aquatic biosphere by virtue of their chitinolytic activity; the
ability of some strains to generate electricity; the degradation of polypectate by A.
salmonicida ssp. pectinolytica; the removal of pesticides (Pavan et al. 2000; Pham et al.
2003; López et al. 2005; Lan et al. 2008).
Bioremedial properties associated with Aeromonas include the removal of selenite from
contaminated groundwaters (Hunter and Kuykendall 2006); assimilation of seleniferous
compounds present in agricultural drainage (Rael and Frankenberger 1996); reduction
of arsenate to arsenite (Anderson and Cook 2004); production of a biosurfactant (Ilori et
al. 2005) and the ability to decolorize triarylmethane dyes (Ogugbue and Sawidis 2011).
These properties can have a significant impact on the environment, as triarylmethane
dyes can exert toxic effects in plants and their disposal on land, may have a direct
impact on soil fertility and possibly agricultural productivity (Ogugbue and Sawidis
2011). Surfactants have important bioremedial properties with environmental and
biotechnological applications that can be applied in the food and pharmaceutical
industries (Ilori et al. 2005). On the negative side, the ability of Aeromonas to reduce
sulphite to H2S, ferric to ferrous iron and oxidise cathodic hydrogen are properties
strongly associated with microbial influenced corrosion, one of the most destructive
modes of metal corrosion (McLeod et al. 1998).
1.9. VIRULENCE FACTORS
Assessing virulence in Aeromonas has been difficult due to the variety of hosts that
different species appear to infect and differences in growth requirements (Froquet et al.
2007). Virulence in Aeromonas has been investigated primarily through animal lethality
studies (Daily et al. 1981; Wong et al. 1996), using immunocompromised or septic
mice (Lye et al. 2007; Khajanchi et al. 2011) and healthy animals (Janda et al. 1985).
Other models proposed include the tropical fish blue gourami (Fock et al. 2001) and
zebrafish (Rodríguez et al. 2008); the free-living protozoan Tetrahymena (Pang et al.
2012) and the unicellular amoebae Dictyostelium (Froquet et al. 2007). The worm
Caenorhabditis elegans has also served has a model after infection with A. hydrophila
and the production of toxic symptoms (Couillault and Eubank 2002). A mouse model
-34-
was also developed to determine the gastrointestinal colonization rate among
environmental Aeromonas isolates (Lye 2009).
However, the medicinal leech model of Graf (2000) has been recognized as a promising
model to assess virulence in Aeromonas (Janda and Abbott 2010). Several genes
involved in a multitude of activities have been identified in Aeromonas residing in the
leech digestive tract (Silver et al. 2007a). Moreover, the potential for discovering other
genes and their products makes the medicinal leech an exciting model to determine the
virulence of Aeromonas strains. A recent study used comparative genomic and
functional analyses of virulence genes to assess virulence of two A. hydrophila strains
isolated from a human wound (Grim et al. 2013). This is probably the most promising
method to date, it can be easily reproduced and a library of well-characterized
Aeromonas pathotypes can be created.
1.9.1. Adherence
The attachment of bacteria to host cells allows a close interaction with tissue and body
fluids and for maximal effect of any toxins that aeromonads may produce (Atkinson and
Trust 1980, Atkinson et al. 1987). Adhesion may be mediated by pili, flagella,
filamentous networks and possibly the lipopolysaccharide (LPS) O-antigen. Non-
filamentous adhesins in the form of a polysaccharide capsule or outer membrane
proteins may also be involved (Atkinson and Trust 1980; Carrello et al. 1988; Hokama
and Iwanaga 1991; Merino et al. 1996a; Gryllos et al. 2001; Zhang et al. 2003; Fang et
al. 2004). Adhesion to cell lines has been used as a model for intestinal infection which
has been correlated with enteropathogenicity (Kirov et al. 1995a). The ability of
aeromonads to adhere to cell lines may depend significantly on the temperature, source
of isolation, species, and the type of cell line (Neves et al. 1994; Kirov et al. 1995a;
Snowden et al. 2006). Further, probiotic bacteria inhibit the ability of Aeromonas to
adhere to human epithelium and traslocate due to competition for adhesion sites (Hatje
et al. 2011).
Several mechanisms that recognise different binding sites on erythrocytes, buccal

epithelium and other cells have been described in A. hydrophila (Atkinson and Trust
1980; Ascensio et al. 1991). Studies have shown that A. hydrophila can bind to sialic
acid-rich glycoproteins, lactoferrin, collagen and laminin via a lectin-like mechanism
(Ascensio et al. 1991) while the interaction of A. caviae, A. hydrophila and A. sobria
-35-
with mucins has also been investigated (Ascension et al. 1998). In A. caviae, the
ability to attach to inert surfaces such as glass has been associated with hyperpiliation of
the cells through the presence of type IV pili (Béchet and Blondeau 2003).
1.9.2. Pili
Pili are cell associated structures often involved in adhesion and some of which act as
haemagglutinins (Carrello et al. 1988; Hokama and Iwanaga 1991; Kirov et al. 1995b).
Type IV pili have been purified from A. veronii bv. sobria (Carrello et al. 1988;
Hokama and Iwanaga 1991, 1992; Iwagana and Hokama 1992; Kirov and Sanderson
1996), A. hydrophila (Atkinson and Trust 1980; Carrello et al. 1988; Hokama et al.
1990; Honma and Nakasone 1990; Ho et al. 1990), A. caviae (Carrello et al. 1988;
Kirov et al. 1998) and A. trota (Nakasone et al. 1996). Morphologically, pili appear as a
thin, long flexible structure, usually present in small numbers (type-L) and a more
numerous, shorter, thicker and straight pilus (S-pili). Occasionally, Aeromonas pili can
form rope-like bundles also known as bundle-forming pili (Bfp) that are usually present
in 5 to 10% of cells (Kirov and Sanderson 1996). The molecular masses of the subunit
proteins range from 4 to 23 kDa and despite similar morphology pili from different
strains can be biochemically and immunologically unrelated (Ho et al. 1990; Hokama
and Iwanaga 1991; Iwanaga and Hokama 1992; Kirov and Sanderson 1996) (Table 1.5).
Expression of pili depends on the culture medium and temperature of incubation.

Growth in liquid medium favours the production of both pilus types particularly at
lower (22ºC) temperatures (Carrello et al. 1988; Hokama and Iwanaga 1991; Kirov et
al. 1995b; Kirov and Sanderson 1996). The S-type pili can be expressed under different
conditions of growth although in purified form the haemagglutinating function may be
lost (Ho et al. 1990). Genes involved in pilus biogenesis have been characterized in A.
hydrophila and A veronii bv. sobria. There are at least two distinct families of type IV
pilus, Tap and Bfp (Barnett et al. 1997). In A. hydrophila, a type IV pilin subunit is
encoded by the tapA gene, one of four genes comprising the tap cluster (Pepe et al.
1996). The remaining genes tapB and tapC also have a role in pilus biogenesis while the
tapD gene has been associated with the production of a type IV leader peptidase/N-
methyltransferase involved in extracellular secretion of aerolysin and protease. The
proteins encoded by these four genes are closely related to the products of the pilABCD
gene cluster described in P. aeruginosa (Pepe et al. 1996). The tap cluster is also
expressed by A. veronii bv. sobria and other Aeromonas species although differences in
-36-
Table 1.5 Characteristics of pili described in Aeromonas species
Species/strain Pilus type Agglutination of Adhere to: MW Diamete Source Reference

erythrocytes (kDa) r
(nm)
A. hydrophila A6 Not described Human Gr O Buccal   Faecal Atkinson & Trust
epithelium (1980)
A. hydrophila/caviae/sobria L-pili Human Gr O HEp-2 cells  2.5 Faecal, Carrello et al. (1988)
(flexible) water
A. hydrophila/caviae/sobria S-pili (straight) Human Gr O Hep-2 cells  5 Faecal, Carrello et al. (1988)
water
A. hydrophila Ae6 W W-pili Human, rabbit Human/rabbit 21.0 7 Faecal Hokama et al. (1990)
(flexible) intestine
A. hydrophila Ae6 R-pili No agglutination Failed to 18.0 9 Faecal Honma & Nakasone
(straight) human/GP adhere (1990)
A. hydrophila AH26 Straight No agglutination  17.0 7 to 9 Faecal Ho et al. (1990)
human/GP
A. sobria Ae1 Flexible Human/GP/ovine/  4.0 7 to 9 Faecal Ho et al. (1990)
bovine/avian
-37-
Species/Strain Pilus type Agglutination of Adhere to: MW Diameter Source Reference

erythrocytes (kDa) (nm)5
A. sobria Ae1 Flexible Human Gr A Human/rabbit 23.0 7 Faecal Hokama & Iwanaga
/rabbit intestine (1991)
A. sobria TAP13 Flexible No agglutination Rabbit intestine 23.0 7 Faecal Iwanaga & Hokama
human/rabbit/sheep (1992)
A. sobria Ae24 Flexible/ Human/rabbit Rabbit intestine 19.0 7 Faecal Hokama & Iwanaga
wavy (1992)
A. veronii bv. sobria Flexible/ No agglutination  21.0  Bloody Kirov and Sanderson
bundles human Gr O stools (1996)
A. trota Flexible No agglutination Rabbit intestine 20.0 7 Surface Nakasone et al. (1996)
human/rabbit water
A. caviae Flexible/  HEp-2 23.0  Faecal Kirov et al. (1998)
bundles
GP, Guinea pig; , not determined; Gr, group
-38-
the predicted N-terminal amino acid sequence between the cloned TapA pilins and
purified Bfp pilin have been observed (Barnett et al. 1997; Kirov et al. 1998, 2000).
Recently, a 22-kb locus comprising 17 pilus-related genes similar to the mannose-
sensitive hemagglutinin of Vibrio cholerae and responsible for encoding the bundle-
forming pilus was characterized in A. veronii bv. sobria (Hadi et al. 2012).
Bfp plays an important role in the pathogenesis of gastrointestinal infection caused by

Aeromonas by promoting colonization and forming bacterium-to-bacterium linkages
(Kirov et al. 1999). The removal of Bfp can decrease adhesion by up to 80% (Kirov et
al. 1999) while mutation of the major Bfp pilin gene mshA greatly reduces the
bacterium's ability to adhere and form biofilms (Hadi et al. 2012). By contrast,
mutagenesis experiments showed that inactivation of tapA had no effect on bacterial
adherence to Hep-2, Henle 407 and human intestinal cells suggesting that the Tap pili
may not be as significant as Bfp pili for Aeromonas intestinal colonization (Kirov et al.
2000).
1.9.3. Invasins
Studies on invasins are sparse in Aeromonas considering that invasion is a recognized

virulence factor (Chu and Lu 2005b). Although not as invasive as some E. coli strains
which have invasion in vitro levels 200 times greater than most Aeromonas, the ability
of Aeromonas to penetrate and replicate may have significant clinical implications as
dysenteric symptoms have been associated with invasive species (Lawson et al. 1985;
Watson et al. 1985; Gray et al. 1990; Nishikawa et al. 1994). Several studies have
shown that A. hydrophila, A. caviae and A. sobria strains isolated from human and non-
human sources were able to invade HEp-2 and Caco-2 cells (Lawson et al. 1985;
Watson et al. 1985; Nishikawa et al. 1994; Shaw et al. 1995). On the other hand, strains
of A. hydrophila and A. sobria isolated from fish and hare showed greater ability to
invade HEp-2 cells compared to environmental aeromonads (Krovacek et al. 1991).
The mechanism of invasion involves components of both bacterium and host cells
including bacterial outer membrane proteins, cell membrane receptors, signal
transductions and cytoskeletal rearrangement (Chu and Lu 2005b). Extracellular
products may play a very minor role in the morphological changes that occur during the
invasion process (Leung et al. 1996). Brush border and microvilli disruption have been
associated with adhesion and invasion of Caco-2 cells but no actin accumulation that is
-39-
associated with the attaching and effacing process in enteropathogenic E. coli
(Nishikawa et al. 1994).
The invasive ability of A. hydrophila has been investigated using different fish cell lines
and virulent and avirulent isolates. Only virulent strains were able to multiply and cause
cytopathic changes within the affected cells (Leung et al. 1996; Low et al. 1998). Low
et al. (1998) showed that cytopathic changes occurred concomitantly with
rearrangements of microfilaments (MFs) in a process involving three stages of
infection. In stage I, cells detach and elongate; in stage II, cells connect to neighbouring
cells by tubular cytoplasmic extensions resulting in less confluent monolayers with a
satellite-like organization; in stage III, bacteria are abundantly present in cells and
vacuoles resulting in eventual detachment and lysis. Moreover, the F-actin
rearrangement process involves the formation of an actin cloud immediately after the
bacterium becomes in contact with the cell (first phase) followed by reorganization
(depolymerisation) of actin fibres (second phase).
Chu and Lu (2005b) showed that polymerization of MFs was inhibited by cytochalasin
in a dose dependent manner, resulting in inhibition of invasion by A. hydrophila Ahj-1
into epithelioma papillosum cells of carp (EPC). By contrast, pretreatment of EPC cells
with colchicines and nocodazole, inhibitors of microtubule (MT) formation, had no
effect on the process of invasion. Thus, MFs but not MTs are required for the
internalization of A. hydrophila into EPC cells (Low et al. 1998; Chu and Lu 2005b).
These results indicate that actin polymerization is involved in the invasion process of
Aeromonas. Invasion by Aeromonas can lead to mucosal damage similar to that
produced by Shigella species as shown in a rabbit model although some strains may still
invade without causing extensive destruction. This divergence has been attributed to the
different routes of entry employed by bacterial cells such as Peyer’s patches of the
ileum, lymphatics and passage through the mucosa via other mechanisms (Pazzaglia et
al. 1990b). Gavin et al. (2003) showed that the introduction of lafA into lafA mutants
enhanced invasion of HEp-2 cells and biofilm formation in vitro.
1.9.4. S-layer
In Aeromonas, the S-layer (originally called the A-layer), is considered a primary

virulence factor due to its extraordinary binding capabilities (Kay et al. 1981; Trust et
al. 1983; Chu et al. 1991). S-layer has been described in A. salmonicida, A. hydrophila
-40-
and A. sobria. Isolates carrying the O:11 somatic antigen and a S-layer have been
implicated mostly in invasive rather than localized infections in humans (Janda et al.
1987b; Paula et al. 1988; Merino et al. 1995; Kirov 1997). S-layers conferred protection
to the bacterium from the serum killing activity of the host and from proteases by acting
as a physical barrier to the lytic complement components (Munn et al. 1982) and by
facilitating the entry into macrophages (Trust et al. 1983).
1.9.4.1. Structural arrangements
S-layers are regular, two-dimensional assemblies of protein monomers that often

constitute the outermost layer of the cell envelope of many bacteria (Sletyr and Messner
1983). The spatial arrangements of the S-layer in Aeromonas vary from hexagonal,
tetragonal to linear oblique arrays with a lattice constant of 12.0-12.5 nm (Dooley et al.
1989). The S-layer of A. salmonicida consists of regular, two-dimensional protein
monomers with MWs between 49.0 and 52.0 kDa (Belland and Trust 1987; Chu et al.
1991). The S-layer contributes to the physical properties of the A. salmonicida cell
envelope. Loss of the S-layer can lead to changes in the physical properties allowing the
organism to grow at higher than usual temperature (Ishiguro et al. 1981).
1.9.4.2. Binding properties
S-layer can bind to host basement membranes molecules such as fibronectin, laminin
and collagen-IV (Kay and Trust 1991). The S-layer of A. salmonicida can specifically
bind to porphyrins, other heme analogues (Kay et al. 1985), and immunoglobulins
(Phipps and Kay 1988) allowing the organism to survive in vivo by avoiding
phagocytosis (Kay et al. 1985; Dooley and Trust 1988).
1.9.4.3. Genes involved in S-layer synthesis
At the genetic level, little or no homology exists between the S-layer gene of A.
salmonicida (vapA) and that of A. hydrophila (ashA) (Belland and Trust 1987).
Although the gene is always present in A. salmonicida, the failure of a strain to produce
S-layer is probably due to either deletion or rearrangement of the entire gene or parts of
it or alterations in the expression of vapA (Gustafson et al. 1992). Secretion of the AhsA
protein in A. hydrophila (Thomas and Trust 1995b) is mediated by the spsD gene while
-41-
a protein encoded by the apsE gene of A. salmonicida may provide the necessary energy
to the secretory apparatus (Noonan and Trust 1995). Loss of expression of the S-layer
due to growth at 30°C results in genetic rearrangement in which N-terminal sequences
of the A protein are lost by gene deletion (Belland and Trust 1987).
1.9.4.4. S-layer and virulence
Because of the different types of diseases caused by A. salmonicida and A. hydrophila

each organism may use its S-layer in a different manner despite morphological
similarity (Dooley and Trust 1988; Murray et al. 1988). In A. hydrophila the S-layer
may not be the principal virulence factor in fish as it is in A. salmonicida (Thomas et al.
1997). In contrast, mutagenesis experiments have shown that in A. salmonicida S-layer
deficient mutants virulence can decrease up to >105 fold when the organism is incubated
at higher than normal temperatures (Ishiguro et al. 1981) or that binding of the S-layer
to IgG can only take effect when the A-protein is intact (Phipps and Kay 1988).
1.9.5. The lipopolysaccharide (LPS)
The endotoxin component of LPS produced by Aeromonas is similar to that of other

Gram-negative bacteria. A combination of hexose and heptose monosaccharide residues
constitutes the core region of the LPS in motile aeromonads (Shaw and Hodder 1978).
1.9.5.1. Functions of the LPS
The LPS confers protection to the bacterium against the bactericidal effects of normal
serum. The loss of the O-antigenic polysaccharide chains allows access of complement
components to their target producing bactericidal effects. The LPS also acts as an
adhesin in human epithelial and HEp-2 cells (Gryllos et al. 2001; Vilches et al. 2007),
particularly in strains from serogroup O:34 (Merino et al. 1996a). The ability of A.
sobria to adhere to HEp-2 cells was found to correlate with the level of LPS expression
and growth phase (Paula et al. 1988; Francki and Chang 1994). Other functions include
a role in the assembly and maintenance of the S-layer of A. salmonicida and excretion
of exotoxins. Strains lacking the O-antigen (rough strains) excrete less toxin than those
strains with abundant O-antigen LPS (smooth strains) (Chart et al. 1984).
-42-
Temperature plays a significant role in the production of smooth and rough LPS.
Smooth LPS is produced when strains are grown at 20C which correlates with the
ability of O:34 to colonize the germfree chicken gut at this temperature but not at 37C
(Merino et al. 1992; 1996a/b). In addition, mutagenesis experiments revealed that
smooth strains are more virulent when grown at lower temperatures (Gryllos et al.
2001). The type of LPS produced is also influenced by salt concentration. At high
osmolarity, smooth LPS is produced despite incubation at 37C. By contrast, cells
cultivated at low osmolarity produced rough LPS (Aguilar et al. 1997). Aguilar et al.
(1997) showed that cells grown at high osmolarity were more virulent for fish and mice,
had increased extracellular activities, enhanced adhesion to HEp-2 cells and were
resistant to the bactericidal activity of non-immune serum.
1.9.5.2. Immunological and antigenic properties of LPS
In A. salmonicida strains, the O-polysaccharide chains are very homogeneous with

respect to cell length, strongly immunogenic and antigenically cross-reactive (Chart et
al. 1984). The O-polysaccharide chains can traverse the surface protein array of virulent
strains of A. salmonicida becoming exposed on the cell surface. These properties and
the considerable antigenic conservation of A. salmonicida have been proposed as a
potential target in the design of an effective vaccine (Chart et al. 1984). Antiserum
raised against A. hydrophila LPS decreased the mortality of suckling mice from 100 to
30% (Wong et al. 1996). LPS with similar properties to those described by Chart et al.
(1984) for A. salmonicida were reported in two A. hydrophila strains, although A.
hydrophila can produce a LPS with O-polysaccharide chains of heterogeneous as well
as homogeneous lengths (Dooley et al. 1985).
1.9.5.3. Genes involved in LPS synthesis
The gaIU gene encodes GaIU, a UDP-glucose pyrophosphorylase responsible for the
synthesis of UDP-glucose from glucose-1-phosphate (Vilches et al. 2007). The gaIU
gene is distributed in all mesophilic aeromonads. Mutations of the gene may affect the
survival of Aeromonas in serum, decrease adhesion ability and reduce virulence of O:34
strains as shown by a septicaemic model with fish and mice (Vilches et al. 2007).
Mutations in the galU gene of A. hydrophila AH-3 (O:34) result in the production of
two bands compared to one in the wild type which corresponds to two types of LPS
-43-
(Vilches et al. 2007). The flm cluster (consisting of five different genes flmA, flmB,
flmD, neuA and nueB) of A. caviae Sch3N is involved in LPS O-antigen biosynthesis
and possibly in flagellum assembly (Gryllos et al. 2001).
1.9.6. Outer membrane proteins (OMP)
Outer membrane proteins have been associated with the transport of ions and molecules
across the outer membrane, cell architecture allowing the passage of toxins (Howard
and Buckley 1985), and ability to act as an adhesin (Atkinson and Trust 1980).
Haemagglutination has been shown to correlate with the presence of a 43 kDa OMP
(Atkinson and Trust 1980) while the carbohydrate-reactive-OMP (CROMP) of A.
hydrophila A6 may act as an adhesin able to attach to erythrocytes or intestinal
epithelium via a fucose site (Quinn et al. 1993). The outer surface of A. hydrophila is
carbohydrate-reactive and the ability to adhere to human red cells and human colonic
cancer cells depends on ligands expressed on its external surfaces (Quinn et al. 1994).
However, these carbohydrate-reactive proteins may not be uniformly distributed among
all Aeromonas species (Küijper et al. 1989a).
The gene encoding for the 43 kDa OMP of A. hydrophila has been cloned and
expressed in E. coli resulting in a recombinant adhesin with the ability to confer up to
87.5% protection in blue gourami against homologous A. hydrophila challenge (Fang et
al. 2004). Results suggested that the 43 kDa OMP is a conserved protein found in A.
hydrophila and A. sobria and may share similar antigenic characteristics with V.
anguillarum and E. tarda (Fang et al. 2004). Jeanteur et al. (1992) showed that A.
hydrophila Ah65 shares similar N-terminal sequences and channel-forming properties
with other Gram-negative species particularly E. coli. Further, different porin types have
been described in various A. hydrophila strains including protein VI, which shares the
same molecular mass and almost identical amino terminus with the OmpW of V.
cholerae (Jeanteur et al. 1992; Quinn et al. 1994).
A vaccine based on the antigenic properties of OMPs was developed to control A.

hydrophila in fish. The survival of the vaccinated fish improved 50% compared to
unvaccinated controls (Thangaviji et al. 2012). Another vaccine candidate, based on the
recombinant A. hydrophila OMP48, increased the survival of fish immunized when
challenged with virulent A. hydrophila and Edwarsiella tarda. The gene coding OMP48
-44-
had high similarity to LamB porin genes of A. hydrophila, A. salmonicida and V.
parahaemolyticus (Khushiramani et al. 2012).
1.9.7. Flagella
Flagella are complex bacterial organelles associated with multiple roles in bacteria-host
interactions. Two distinct flagellar systems are expressed in Aeromonas, a polar
flagellum (Fla) for swimming in liquid media and multiple lateral flagella (Laf) for
swarming on solid surfaces or viscous conditions (Rabaan et al. 2001; Gavin et al.
2002, 2003; Kirov et al. 2004). Basically, flagella are helical propellers that consist of a
filament made up of polymerized protein subunits, attached by a hook structure to the
basal body (Macnab and DeRossier 1988).
1.9.7.1. Synthesis, regulation and expression of flagella
Synthesis of flagella represents a high metabolic cost for the bacterium in terms of
resources and energy. Expression of both flagella is highly regulated by environmental
factors and other regulators (Kirov 2003; Merino et al. 2006). Lateral flagella are
usually present on 50 to 60% of the bacterial cells when the bacterium is grown in high
viscosity medium but are absent in liquid medium (Kirov et al. 2002; Wilhems et al.
2011). Synthesis of lateral flagella is under the control of the polar flagellar system
although mutations in the polar fla genes do not prevent expression of the lateral
flagella (Gavin et al. 2002; Santos et al. 2010).
Regulation of flagellum biogenesis involves a combination of transcriptional,

translational, and post-translational regulation (Aldridge and Hughes 2002; Soutourina
and Bertin 2003). These genes have been divided in three categories: early genes
encoding regulatory proteins, middle genes encoding structural units and the late genes
involved in the chemo-sensor machinery (Aldridge and Hughes 2002). The polar and
lateral flagellar systems of A. hydrophila AH-3 consist of more than 55 and 38 genes
distributed in five regions, and a single chromosomal region, respectively (Canals et al.
2006a/b). In A. caviae, several polar flagella genes responsible for encoding different
components of the flagella machinery have been identified (Rabaan et al. 2001; Gavin
et al. 2002; Kirov et al. 2002). In A. hydrophila, expression of polar flagellum appears
to be organized in four transcriptional levels (classes I to IV), where each level serves as
the activator for the next transcriptional level. Thus, transcription of polar flagellum
-45-
genes in this organism operates in a hierarchichal sequence similar, but not identical, to
the transcriptional hierarchies of V. cholerae and P. aeruginosa (Wilhems et al. 2011).
The alternative sigma factor 54 (rpoN) of AH-3 is another important flagellar
regulatory protein essential for transcription of both polar and lateral flagellar gene
systems (Canals et al. 2006b). The Fla genes, flaA and flab are widely distributed in
mesophilic Aeromonas (Rabaan et al. 2001). The percentage of the Laf genes lafA1 and
lafA2 range between 60 and 100% (Gavin et al. 2002, 2003; Kirov et al. 2004). In
aeromonads associated with diarrhoeal illness, Laf genes are usually present in 50 to
60% of the strains (Kirov et al. 2002; Aguilera-Arreola et al. 2007). The flmA and flmB
of the flm gene cluster also involved in lateral flagella synthesis are found in all
mesophilic Aeromonas (Gryllos et al. 2001).
1.9.7.2. Functions associated with flagella
In addition to providing a means of locomotion to the bacterium, flagella have multi-

functional roles in pathogenesis. Mutations of some or most of the genes encoding both
flagellar types can result in complete loss of motility, LPS O-antigen and flagellin
expression leading to reduction in adherence, invasion of epithelial cells and biofilm
formation (Whitby et al. 1992; Merino et al. 1997; Gryllos et al. 2001; Rabaan et al.
2001; Gavin et al. 2002, 2003; Kirov et al. 2002, 2004; Canals et al. 2006ab; Santos et
al. 2010). Moreover, the presence of lateral and polar flagella in combination with other
virulence factors such as a T3SS-like apparatus and secretion of enterotoxins is strongly
associated with virulence (Kirov 2003; Sen and Lye 2007).
1.9.8. Secretion systems
Gram-negative bacteria possess systems that secrete and inject pathogenic proteins into
the cytosol of eukaryotic cells via needle-like structures disrupting cell function and
arquitecture (Table 1.6) (Burr et al. 2003; Sha et al. 2005; Bingle et al. 2008). There are
currently six types of secretion transport systems recognized (types I to VI) and all
utilize adenosine triphosphate (ATP) as the energy source to drive transport of
macromolecules (Christie 2001). Of these, types II to IV are large multi-protein
complexes that can span the entire cell envelope (Bingle et al. 2008). In Aeromonas,
four (II, III, IV and VI) secretion systems have been described.
-46-
Table 1.6 Selected effector proteins associated with different secretion systems
Protein Putative function Secrected References

by:
Act Cytotoxic enterotoxin T2SS Chopra et al. (2000)
AexT Cytolytic enterotoxin T3SS Braun et al. (2002)
AopP Inhibits the NF-B signalling pathway T3SS Fehr et al. (2006)
AopH Aeromonas outer protein T3SS Dacanay et al. (2006)
AopO Aeromonas outer protein T3SS Dacanay et al. (2006)
AscC Outer membrane pore of T3SS T3SS Dacanay et al. (2006)
AopB Formation of the T3SS translocon T3SS Sha et al. (2005)
AexU ADP-ribosyltransferase T3SS Sha et al. (2007)
AcTra Several roles including pilus assembly T4SS Rangrez et al. (2006)
and core components
Hcp Inhibits phagocytosis T6SS Suarez et al. (2010a)
VgrG1 Actin ADP-ribosylating activity T6SS Suarez et al. (2010b)
-47-
1.9.8.1. Type II Secretion System (T2SS)
The T2SS of Aeromonas is highly homologous to systems found in other Gram-

negative bacteria such as V. cholerae and P. aeruginosa (Schoenhofen et al. 1998).
Important proteins are secreted by Aeromonas through the T2SS including the lipolytic
enzyme GCAT (Brumlik et al. 1997), the cytotoxic enterotoxin Act (Chopra et al. 2000)
and proaerolysin, the inactive precursor of the channel-forming toxin aerolysin (Howard
and Buckley 1986; Jiang and Howard 1992). Proaerolysin concentrates in the periplasm
then passess through it on its way out of the cell (Burr et al. 2001). In A. hydrophila, an
85 kDa complex containing the ExeA and ExeB proteins is involved in the secretion of
aerolysin (Schoenhofen et al. 1998). The genes exeC-N and exeAB encode a T2SS in A.
hydrophila (Jiang and Howard 1992; Pepe et al. 1996).
1.9.8.2. Type III Secretion System (T3SS)
The cytotoxic effect of Aeromonas towards cell lines is dependent upon a functional
T3SS (Chacón et al. 2003, 2004) which plays an important role in the virulence of
several species (Burr et al. 2001, 2003; Yu et al. 2004; Sha et al. 2005, 2007; Dacanay
et al. 2006; Sierra et al. 2007; Du and Galan 2009). T3SSs have been identified in A.
hydrophila and A. salmonicida strains isolated from clinical and fish sources,
respectively (Burr et al. 2003; Sha et al. 2007) while the T3SS of a pathogenic A. sobria
strain was associated with causing disease in farmed perch (Perca fluviatilis) (Wahli et
al. 2005). Expression of T3SS is affected by environmental factors, particularly calcium
depletion and a high Mg2+ concentration. Recent evidence suggests that a complex
interconnection between the expression of the T3SS and other virulence factors such as
the LPS, the PhoPQ two-component system and the ahyIR quorum sensing system exist
(Vilches et al. 2009). The T3SS has been found in approximately 50% of Aeromonas
strains world wide (Chacón et al. 2004) and in one study, genes encoding the T3SS
were higher in clinical (56%) than in environmental (26%) strains (Vilches et al. 2004).
In A. hydrophila, the genetic organization of the T3SS shares great similarity to the
T3SS of both Yersinia species and P. aeruginosa (Yu et al. 2004). T3SS-encoding
genes can be located on the chromosome, as in A. hydrophila AH-1 (Yu et al. 2004) or
spread on plasmids and the chromosome, as in A. salmonicida ssp. salmonicida (Burr et
al. 2002; Stuber et al. 2003; Fehr et al. 2006). The distribution of T3SS-encoding genes
varies within the species. In A. caviae the incidence is usually low compared to the high
-48-
frequency found in extraintestinal isolates of A. veronii and A. hydrophila (Chacón et al.
2004).
T3SS mediates translocation of cytotoxins to host cells affecting several biological

functions (Burr et al. 2003; Sierra et al. 2007). Deletions or mutations of T3SS genes
encoding effector proteins result in reduction of cytotoxicity (Burr et al. 2003; Vilches
et al. 2004; Yu et al. 2004), inflammatory cytokines and chemokines levels (Fadl et al.
2006) and phagocytosis (Vilches et al. 2004; Yu et al. 2004). Many effector and
putative proteins with diverse biological activities have been associated with T3SSs
(Vilches et al. 2004). The most common and well-characterized T3SS effector proteins
included AexT, AopP, AopH and AopO of A. salmonicida (Burr et al. 2002, Dacanay et
al. 2006, Fehr et al. 2006) and the AexU protein of A. hydrophila (Sha et al. 2007)
(Table 1.6). Most effector proteins present in aeromonads are the equivalent of effector
proteins found in other pathogenic bacteria. The AexT toxin, an extracellular ADP-
ribosyltransferase found in A. salmonicida ssp. salmonicida is highly similar to the
ExoS and ExoT toxins secreted by the T3SS of P. aeruginosa (Braun et al. 2002). The
AopP potein found equally in typical and atypical A. salmonicida strains, shares
sequence homology with the YopJ protein of Y. enterocolitica (Fehr et al. 2006).
Although the biological activity of most effector proteins may differ, the final outcome
usually results in cell changes and lysis. Morphological changes and cell lysis caused by
the AexT toxin of A. salmonicida ssp. salmonicida requires contact with host cells
(Braun et al. 2002); AopP inhibits the NF-B signalling pathway blocking cytokine
production promoting apoptosis in host cells (Fehr et al. 2006); the full-length and NH2-
terminal domain of the protein AexU causes changes in cell morphology due to actin
filament organization (Sierra et al. 2007). Sha et al. (2005) reported a positive
correlation between T3SS, the cytotoxic enterotoxin (Act) and quorum sensing (QS).
1.9.8.3. Type IV Secretion System (T4SS)
T4SSs are macromolecular transfer systems present in Gram negative and Gram
positive bacteria that translocate proteins and nucleoprotein complexes (Cao and Saier
2001; Schröder and Lanka 2005). The T4SS of Agrobacterium tumefaciens has been
used as a model to predict the structure and function of this secretory system (Cao and
Saier 2001; Christie and Cascales 2005). Moreover, the sequences and structure of
T4SSs are homologous to those of conjugative transfer systems of naturally occurring
-49-
plasmids (Ding et al. 2003). The structural constituent of the secretory apparatus is
provided by VirB2-VirB11, a group of proteins which may also play a direct role in
translocation (Cao and Saier 2001; Schröder and Lanka 2005). T4SS has been described
in A. culicicola (Rangrez et al. 2006) and in an A. caviae strain isolated from a hospital
effluent (Rhodes et al. 2004). The T4SS of A. culicicola resembles that of plasmids
RP721, pAc3249A and pKM101 of E. coli, the VirB-D4 systems of A. tumefaciens, B.
henselae, A. caviae and the Ptl system of B. pertussis. Furthermore, the high homology
observed between the A. culicicola and pAc3249A suggests that A. culicicola may have
acquired the plasmid through lateral transfer while residing in the mosquito gut, the site
of isolation of A. culicicola (Rangrez et al. 2006). The plasmid pRA1 was found in an
A. hydrophila strain pathogenic to fish. The sequence of pRA1, a member of the IncA/C
family, featured a T4-like conjugative plasmid transfer system that carried multidrug
resistance genes and a hipAB-related gene cluster. In addition to drug resistance, hipAB
a toxin-antitoxin module may be involved in biofilm formation (Fricke et al. 2009).
Rangrez et al. (2010) described three ATPases from a new T4SS of Aeromonas veronii
plasmid pAC3249A and showed that these ATPases could bind and hydrolyze ATP.
1.9.8.4. Type VI Secretion System (T6SS)
The T6SS is widely spread in nature and has been reported in many pathogenic and
non-pathogenic bacteria where it is involved in a variety of roles (Williams et al. 1996;
Suarez et al. 2008; Bingle et al. 2008; Pukatzki et al. 2009). The T6SS is independent
of the T3SS and the flagellar secretion system (Suarez et al. 2008). In A. hydrophila
SSU the T6SS gene cluster is located in the chromosome which is regulated by the σ54
activator encoded by the vasH gene (Suarez et al. 2008). Two main classes of proteins
are secreted by T6SS, the haemolysin coregulated protein (Hcp) and the valine-glycine
repeat G (VgrG). Hcp is secreted by all bacteria with a functional T6SS, plays a role in
the transport of proteins out of the bacterial cell and into the cytosol of infected host
cells or into the extracellular space (Pukatzki et al. 2009). Hcp binds to macrophages
inducing the production of IL-10 and transforming growth factor (TGF)-, affecting the
activation and maturation of macrophages and recruitment of other cellular immune
components. Expression and translocation of the hcp gene are associated with the vasH
and vasK genes (Suarez et al. 2008; 2010a). Deletion of vasH in A. hydrophila SSU
impaired expression of hcp while deletion of vasK allowed expression and translocation
of Hcp, but not its secretion into the extracellular milieu (Suarez et al. 2008). As a
-50-
consequence, SSU mutants were readily phagocytosed by murine macrophages
suggesting that the secreted form of Hcp played a role in the evasion of the host
immune system by inhibiting phagocytosis and promoting the spread of the bacterium
in the host (Suarez et al. 2010a).
VgrG shares structural features with the cell-puncturing device of T4 bacteriophage

(Kanamaru et al. 2002). In addition, the C-terminal extensions of some VgrG carry
functional domains that may serve as effector-domains or “evolved VgrGs” (Pukatzki et
al. 2007). Pathogenic bacteria may have up to 10 VgrGs of which three paralogues are
present in A. hydrophila (Pukatzki et al. 2009). The T6SS-associated proteins have been
implicated in a variety of biological functions including cross-linking of host actin,
degradation of the peptidoglycan layer, ADP-ribosylation of host proteins inducing
apoptosis and inhibiting phagocytic activity in macrophages (Pukatzki et al. 2009;
Suarez et al. 2010b). Both, Hcp and VgrG play dual roles as structural components and
effector proteins of T6SS (Cascales 2008). Recently, mutagenesis experiments showed
that paralogues of Hcp and VgrG also influenced bacterial motility, protease production
and biofilm formation. Moreover, these paralogues were required for optimal bacterial
virulence and dissemination to mouse peripheral organs (Sha et al. 2013).
1.9.9. Exotoxins
Aeromonas species produce a wide range of extracellular toxins and enzymes that are
associated with cytotoxicity, haemolytic and enterotoxic effects in host tissue
(Wadström et al. 1976; Janda 1985; Shotts et al. 1985; Vadivelu et al. 1991; Mateos et
al. 1993; Pemberton et al. 1997; Chopra et al. 2000; Kirov et al. 2002; Krzyminska et
al. 2006). Many distinct and unrelated exotoxins have been described in these bacteria
over the years reflecting the diversity that exists among Aeromonas strains (Table 1.7)
(Notermans et al. 1986; Todd et al. 1989; Vadivelu et al. 1991; Granum et al. 1998).
The production of exotoxins in vitro is influenced by the type of media, culture
conditions, growth temperature and variations in osmotic stress (Ljungh and Kronevi
1982; Asao et al. 1986; Mateos et al. 1993; Granum et al. 1998).
Under iron limitation, there is a pronounced increase in toxin production which is

repressed in the presence of glucose (Thornley et al. 1997). Although production of
exotoxins has been reported equally in both, non-enteric and enteric isolates, the
production of enterotoxin and a cholera-toxin factor have been more prominent among
-51-
enteric isolates (Vadivelu et al. 1991). Thus, enterotoxins appear to play an essential
role in Aeromonas-associated gastroenteritis (Krzyminska et al. 2006). Exotoxins can
induce cytoplasmic vacuolation and cell death in different cell lines including those
derived from the intestinal mucosa (Barer et al. 1986; Vadivelu et al. 1991; Di Pietro et
al. 2005; Ghatak et al. 2006). However, the use of tissue cultures as a rapid assay has
not always been found suitable as a screening test (Chakraborty et al. 1984).
1.9.9.1. Aerolysin
Aerolysin is one of the most studied toxins produced by Aeromonas. Also referred to as
-haemolysin, cytotoxic enterotoxin or cytolytic enterotoxin, aerolysin has generated
enormous interest for the last 40 years (Bernheimer and Avigad 1974). Intially purified
by Buckley et al. (1982), the action of aerolysin on various cell lines and rabbit ileal
loop test to demonstrate cytotoxic and enterotoxic activity, respectively, is well
documented (Asao et al. 1986; Chopra et al. 1993; Ljungh and Wadström 1983;
Scheffer et al. 1988; Ferguson et al. 1997). Although aerolysin can be expressed in E.
coli differences in the mechanisms involved in secretion and excretion between E. coli
and A. trota have been observed (Khan et al. 1998). Various mechanisms involved in
the secretion of aerolysin have been described. The notion that a 23 kDa peptide signal
sequence was involved in the translocation of the pro-aerolysin followed by proteolytic
cleavage activation by serine protease was proposed but not universally accepted
(Howard and Buckley 1986; Husslein et al. 1991; Chopra et al. 1993). Pepe et al.
(1996) showed that the tapD gene of A. hydrophila encodes a type IV leader
peptidase/N-methyltransferase essential for extracellular secretion of aerolysin and
protease. Another mechanism of secretion involved the binding of pro-aerolysin to
glycosylphosphatidylinositol-anchored proteins on target cells to integrate into the
plasma membrane (Brodsky et al. 1999).
Salient features of aerolysin include resistance to proteases, lack of inhibition by lipids

or inactivation by gangliosides and reducing agents. The toxin readily binds to
erythrocytes at 37, but not at 4C (Ferguson et al. 1997). Variation in haemolytic
activity has been associated with different receptor affinities of the aerolysin molecule
for a particular erythrocyte type (Husslein et al. 1991; Ferguson et al. 1997).
Similarities between the physical and biological properties of aerolysin with the
exotoxin of P. aeruginosa and a haemolysin secreted by V. parahaemolyticus,
respectively, have been reported (Ljungh et al. 1981; Ljungh and Wadström 1983).
-52-
1.9.9.1.1. Action on host tissue
Aerolysin can form weakly ion-permeable channels similar to those produced by the α-
toxin of S. aureus (Chakraborty et al. 1990). Aerolysin causes changes in the membrane
permeability leading to osmotic lysis in erythrocytes (Bernheimer and Avigad 1974; Di
Pietro et al. 2005) and cross-reacts with cholera toxin (Chopra et al. 1993; Thornley et
al. 1997). The toxin can be lethal to mice at low (0.1 μg) concentrations (Bernheimer &
Avigad 1974; Chakraborty et al. 1987; Chopra et al. 1993). The action of aerolysin on
the epithelial barrier has been described in several studies using a variety of cell lines
(Abrami et al. 2003; Epple et al. 2004; Bücker et al. 2011). Bücker et al. (2011) used
human colonic epithelial cells (HT-29/B6 cells) to describe the mechanisms involved in
epithelial barrier dysfunction caused by aerolysin during Aeromonas infection. The
action of aerolysin on HT-29/B6 cells resulted in transcellular and paracellular
resistance by inducing chloride secretion and tight junction redistribution, respectively.
Therefore, diarrhoea caused by aeromonads appears to be mediated by two mechanisms,
transcellular secretion and paracellular leak flux (Bücker et al. 2011). The impairement
of epithelial integrity may also affect wound closure contributing to the necrotizing
process observed in wound infections and intestinal epithelial lesions.
1.9.9.1.2. Molecular characteristics and prevalence
The complete nucleotide sequences of the aerolysin toxin in A. hydrophila and A. trota
have been described. In the case of A. hydrophila the sequences were independently
described revealing inconsistent results (Chakraborty et al. 1986; Howard et al. 1987;
Husslein et al. 1988; Khan et al. 1998). Similarly, a phylogenetic tree based on the
deduced amino acid sequences of the aerolysin genes from several Aeromonas species
revealed the presence of three groups of genes (Khan et al. 1998). Aerolysin shares
sequence similarities with the α-toxin of S. aureus. Both are very hydrophilic and
contain an almost identical string of 10 amino acids (Howard et al. 1987; Murray et al.
1988). Although aerolysin is unique to the genus Aeromonas and it is present in most
species (Husslein et al. 1991, 1992; Ørmen and Østensvik 2001; Ottaviani et al. 2011)
the prevalence of the encoding gene varies greatly depending on the geographical region
and source of isolation (Chacón et al. 2003).
-53-
1.9.9.2. Cytotoxic enterotoxin (Act)
The differentiation of the cytotoxic enterotoxin Act as a separate protein from aerolysin
has been controversial. Aerolysin and Act share similar amino acid sequence and most
biological properties (Buckley and Howard 1999). Despite the degree of homology
(93% amino acid identity) that exists between these two proteins (Chopra et al. 1993),
Act can now be distinguished from aerolysin by monoclonal antibodies neutralization
and receptor specificity (Ferguson et al. 1997; Chopra and Houston 1999a). In order to
avoid further confusion, Act is here described as a different toxin from aerolysin.
The properties of Act have been the source of many studies and a multitude of
biological activities have been described for this protein (Chopra et al. 2000; Ribardo et
al. 2002; Galindo et al. 2004). Basically, the Act protein acts as an early signaling
molecule by rapidly releasing calcium from intracellular stores leading to the production
of prostaglandin (PGE2) and tumor necrosis factor alpha (TNFα) while at the same time
down-regulating activation transcription factor NF-κB (Chopra et al. 2000; Ribardo et
al. 2002). In murine macrophages and human intestinal epithelial cells, Act activates the
kinase cascade increasing reduction/oxidative stress factors and production of reactive
oxygen species. Act can lyse erythrocytes, destroy tissue culture cell lines, induce a
fluid secretory response in ligated intestinal loop models and is lethal to mice (Chopra
and Houston 1999b; Chopra et al. 2000). These effects can lead to an extensive
inflammatory response and intestinal tissue damage including Act-induced apoptosis
leading to cell death (Xu et al. 1998; Chopra et al. 2000; Ribardo et al. 2002; Galindo et
al. 2004). Act is an essential contributor to Aeromonas-mediated gastroenteritis
followed by Alt and Ast, respectively (Xu et al. 1998; Sha et al. 2002).
At the genetic level, the multiple biological activities of the Act toxin may be the
function of different molecular regions. The Act protein is encoded by the act gene
(Albert et al. 2000) which in A. hydrophila is optimally expressed at 37C and at a pH
7.0. The act promoter is repressed by glucose and in A. hydrophila the activity of the act
gene increases in the presence of Ca2+ while expression of the act gene is regulated by
iron (Sha et al. 2001). Microarray analyses show that Act can induce many genes
including those involved in apoptosis of T84 cells, caspase-3-cleavage, immune-related
genes, transcription factors, phosphorylation or activation of signaling molecules,
adhesion molecules, Ca2+ mobilization and cytokines (Galindo et al. 2003; 2005). The
functional domain of the cytolytic enterotoxin produced by A. hydrophila SSU shared
-54-
some amino acid homology with Clostridium perfringens type A enterotoxin and the
listeriolysin produced by Listeria monocytogenes suggesting that the genes may have
derived from a common ancestor (Chopra et al. 1993).
1.9.9.3. Haemolysins
The haemolysin toxin is different from the aerolysin protein and although both toxins
are activated by trypsin, the export pathway and haemolytic activity of these two
proteins are different (Asao et al. 1986; Hirono and Aoki 1991; Hirono et al. 1992). The
term hlyA was proposed to differentiate the haemolysin gene from aerA to denote
aerolysin (Wong et al. 1998). The haemolytic activity of Aeromonas has been closely
related to cytotoxicity (Honda et al. 1985; Kozaki et al. 1987; Wang et al. 1996, 2003)
and haemolysins are considered one of the important virulence factors produced by
Aeromonas. In A. hydrophila, the interaction of haemolysin with erythrocyte
membranes is influenced by temperature and growth (Ljungh et al. 1981; Asao et al.
1984, 1986; Titball and Munn 1985; Kosazi et al. 1987; Knochel 1989). Many
haemolysins with different MWs and biological functions have been purified and
characterized in Aeromonas (Table 1.7). The haemolysin protein is probably bound
intracellularly as an inactive precursor that is formed during the late logarithmic phase
of growth and released by lysis. Haemolysin can cause diarrhoea by induction of HCO
ion via the cystic fibrosis transmembrane conductance regulator (Takahashi et al. 2006).
The gene hlyA is widely dispersed among Aeromonas species (Hirono and Aoki 1991)
and it is possible that haemolysin genes evolved from a single ancestral gene (Hirono et
al. 1992). The amino acid composition of haemolysins produced by some strains varies
compared to the amino acid composition of aerolysin (Wong et al. 1998) suggesting
that the origin of the haemolysin genes may be different from that of aerolysin (Hirono
and Aoki 1991, 1993). Aeromonas haemolysins have been reported to contain regions
homologous to the Vibrio vulnificus and Vibrio cholerae cytolysin-haemolysin (Hirono
and Aoki 1993) while a high level of homology (96%) has been reported between
different aeromonad strains (Erova et al. 2007). Among the major Aeromonas species,
hlyA has been detected in A. caviae (Wang et al. 1996; Heuzenroeder et al. 1999; Pablos
et al. 2010) and it is practically ubiquitous in A. hydrophila (Heuzenroeder et al. 1999;
Wu et al. 2007). In A. veronii the prevalence of hlyA ranges from 0 to 77% (Wang et al.
1996; 2003; Wu et al. 2007; Pablos et al. 2010). Recently, a diarrhogenic strain of A.
trota 701 was found to produce both haemolysin and protease (Takahashi et al. 2014).
-55-
1.9.9.4. Enterotoxins
Enterotoxins may play significant roles in the pathology of Aeromonas-induced

gastrointestinal disease. The two more frequently studied cytotonic enterotoxins are the
heat-labile (Alt) and the heat-stable (Ast) toxins although other enterotoxins have been
described in Aeromonas (Table 1.7). These enterotoxins are biologically and genetically
unrelated to the LT and ST of E. coli and the cholera-toxin (CT) (Kaper et al. 1981)
although using synthetic oligonucleotide DNA probes, Schultz and McCardell (1988)
demonstrated that regions of A. hydrophila DNA were homologous with the CT probes.
Most cytotonic enterotoxins share common mechanisms of action including elongation
of Chinese hampster ovarian (CHO) cells, increasing levels of cAMP or PGE2 in tissue
culture cells, changes in adrenal YI cells, fluid accumulation in the rabbit ligated
intestinal loops without mucosal injury and accumulation of intestinal fluid in infant
mice (Ljungh and Wadström 1979, 1983; Chakraborty et al. 1984, 1987; Chopra et al.
1992b, 1996; McCardell et al. 1995).
Alt and Ast are encoded by the alt and ast gene, respectively (James et al. 1982; Chopra
et al. 1996; Albert et al. 2000; Krzyminska et al. 2003). Mutagenesis experiments
showed that Alt and Ast in combination with Act can induce gastroenteritis in a mouse
model (Sha et al. 2002). In gastrointestinal infection, production of more than one toxin
appears to correlate with the type of stools and severity of the diarrhoeal episode. The
presence of both alt and ast has been associated with severe watery diarrhoea in A.
hydrophila-induced infection while isolates positive for alt have only been associated
with loose stools (Albet et al. 2000). Unlike the cytotoxic enterotoxin that causes
extensive damage to epithelium, the cytotonic enterotoxins do not cause degeneration of
crypts and villi of the small intestine (Chopra and Houston 1999b). The alt and ast
genes have been detected in clinical and environmental isolates world-wide. However,
the prevalence of these genes varies considerably depending on the source, species,
geographical location and the number of isolates tested (Potomski et al. 1987b; Borrell
et al. 1998; Trower et al. 2000; Sen and Rodgers 2004; Aguilera-Arreola et al. 2007;
Wu et al. 2007; Pablos et al. 2010).
-56-
Table 1.7 Toxins secreted by Aeromonas
Gene/protein Organism (source) MW % Identity with Reference
(kDa) other proteins
Haemolysin A. hydrophila B3646   Wretlind and Heden (1973)

Aerolysin A. hydrophila 38 (human isolate?) 50-53  Bernheimer & Avigad (1974)
-Haemolysin (aerolysin) A. hydrophila K140/K144 (human diarrhoeal isolates) 65  Ljungh et al. (1981)
-Haemolysin A. hydrophila K140/K144 (human diarrhoeal isolates) 50  Ljungh et al. (1981)
Enterotoxin A. hydrophila K140/K144 (human diarrhoeal isolates) 15  Ljungh et al. (1981)
Enterotoxin A. hydrophila AH2 and AH1133 (human diarrhoeal   Chakraborty et al. (1984)
isolates)
Haemolysin A. hydrophila AH-1 (human diarrhoeal isolate) 48-50  Asao et al. (1984)
CT-toxin related factor A. hydrophila/A. sobria (human diarrhoeal isolates)   Honda et al. (1985)
Haemolysin (H-lysin) A. salmonicida (fish isolate) 25.9  Titball & Munn (1985)
Haemolysin A. hydrophila (human and drinking water isolates)   Notermans et al. (1986)
Haemolysin A. hydrophila CA-11 (environmental isolate) 50  Asao et al. (1986)
Aerolysin A. hydrophila (rainbow trout) 53.8 Original aerolysin Howard et al. (1987)
aerA A. trota AB3 (human diarrhoeal isolate) 54.4 77% with aerolysin Husslein et al. (1988)
-57-
Gene/protein Organism (source) MW % Identity with other Reference
(kDa) proteins
Haemolysin A. sobria 33 (human isolate) 49  Kozaki et al. (1989)

AHH1 A. hydrophila ATCC 7966 (tinned milk isolate) 63.6 50% with V. cholerae HlyA Hirono & Aoki (1991)
AHH3 A. hydrophila 28SA (eel isolate) 54.7 94% with aerolysin Hirono et al. (1992)
AHH5 A. hydrophila AH-1 (human isolate) 53.7 92% with aerolysin Hirono et al. (1992)
ASA1 A. sobria 33 (human isolate) 53.9 66% with aerolysin Hirono et al. (1992)
ASH3 A. salmonicida 17-2 (fish isolate) 54.2 66% with aerolysin Hirono & Aoki (1993)
ASH4 A. salmonicida 17-2 (fish isolate) 63.4 45% with V. cholerae HlyA Hirono & Aoki (1993)
Cytolytic enterotoxin (Act) A. hydrophila SSU (human diarrhoeal isolate) 54.5 93% with aerolysin Chopra et al. (1993)
Cytotonic enterotoxin (Ast) A. hydrophila SSU (human diarrhoeal isolate) 35  Chopra et al. (1994)
Cytotonic enterotoxin (Alt) A. hydrophila SSU (human diarrhoeal isolate) 44 45-51% with Chopra et al. (1996)
phospholipase/lipase
HlyA A. hydrophila A6 (human diarrhoeal isolate) 69 51% with V. cholerae HlyA Wong et al. (1998)
Cytotoxic enterotoxin A. veronii bv. sobria (isolated from lamb kidney) 40  Trower et al. (2000)
hlyA A. hydrophila SSU (human diarrhoeal isolate) 49 96% with A. hydrophila Erova et al. (2007)
ATCC 7966 haemolysin
-58-
1.10. Additional extracellular products
Aeromonas species can secrete a plethora of degradative enzymes with the ability to
hydrolyse a wide range of substrates (Shotts et al. 1985). In the past, the
characterization of extracellular products (ECP) was based on the purification of
individual proteins from selected Aeromonas strains. The new approach involves the
construction of extracellular proteome maps which determine the major extracellular
products involved in the virulence of A. hydrophila AH-1 (Yu et al. 2007).
1.10.1. Proteases
Proteases may play a critical role in the early stages of infection by protecting the
bacterial cell against complement-mediated killing, causing tissue damage and by
protecting the bacterium from host defences while providing nutrients for cell
proliferation (Shieh 1987; Leung and Stevenson 1988a/b; Pemberton et al. 1997; Khan
et al. 2008). Protease production is temperature-dependent as production can decrease
significantly at 37C (Mateos et al. 1993; Swift et al. 1999b; Yu et al. 2007). In A.
sobria, the concentration of salt was found to influence the production of serine
protease into the milieu (Khan et al. 2007).
The genes encoding for serine protease are highly conserved in Aeromonas species
(Chacón et al. 2003). Extracellular secretion of protease has been linked with the tapD
gene (Pepe et al. 1996). Despite the competitive advantage that production of serine
proteases confers to aeromonads, deletion mutation has shown that in A. salmonicida
and A. hydrophila proteases are not essential for the virulence of these species in the
models used (Vipond et al. 1998; Cascón et al. 2000a). However, Liu et al. (2010)
showed that a purified protease was lethal to rainbow trout while the combined effects
of proteases and haemolysins have been detrimental to fish (Fyfe et al. 1988; Rodríguez
et al. 1992).
The most common proteases are serine and metallopreoteases. Serine proteases with
different MWs have been described in A. hydrophila (Cho et al. 2003), A. sobria
(Kobayashi et al. 2006), A. trota (Husslein et al. 1991), A. caviae (Nakasone et al.
2004) and A. salmonicida (Gudmundsdottir et al. 2003). Serine proteases participate in
the activation of aerolysin (Abrami et al. 1998), the extracellular toxin GCAT,
haemolysin and possibly other ECPs (Lee and Ellis 1990; Eggset et al. 1994; Vipond et
-59-
al. 1998; Yu et al. 2007). The metallo-protease TagA identified in A. hydrophila SSU is
widely distributed in Aeromonas species and has been reported in isolates from patients
with wound infections and gastroenteritis (Pillai et al. 2006). TagA has been associated
with haemolytic-uraemic syndrome where it potentiates the activity of C1-INH
inhibiting the classical complement-mediated lysis of erythrocytes and increasing serum
resistance (Pillai et al. 2006).
Proteases with affinity for specific substrates such as elastin, casein and gelatin have
been identified (Cascón et al. 2000ab; Esteve and Birkbeck 2004; Han et al. 2008;
Meng et al. 2009; Zacaria et al. 2010). Others proteases can induce intense vacuolation
in Vero cells including cellular death by apoptosis (Martins et al. 2007). A kexin-like
serine protease in A. sobria 288 (ASP) possesses a unique occluding region which may
serve as a potential target for antisepsis drugs (Kobayashi et al. 2009a/b). ASP acts by
enhancing vascular permeability in rat skin supporting the notion that a correlation
between ASP production and soft-tissue lesions exists (Yokoyama et al. 2002). Other
features associated with ASP include reduction of blood pressure by activating the
kallikrein/kinin system (Imamura et al. 2006), promoting human plasma coagulation
through activation of prothrombin (Nitta et al. 2007) and the formation of pus and
oedema through the action of anaphylatoxin C5a (Nitta et al. 2008). All these
observations have led to the conclusion that ASP mediates the induction of
disseminated intravascular coagulation through -thrombin production, a common and
lethal consequence of sepsis (Nitta et al. 2007).
1.10.2. Lipases
Lipases, like proteases, are important for bacterial nutrition (Pemberton et al. 1997) and
several roles in microbe metabolism have been associated with these compounds
(Anguita et al. 1993). The most studied lipase to date is GCAT which is present in all
members of the Vibrionaceae with the exception of Plesiomonas shigelloides
(MacIntyre et al. 1979). GCAT can use cholesterol as an acyl acceptor, has a molecular
mass of approximately 25 kDa and possesses haemolysin, leukocytolysin and cytotoxic
activities (Eggset et al. 1994; Nerland 1996; Vipond et al. 1998). GCAT shares many
properties with the mammalian lecithin:cholesterol acyltransferase enzyme (Thorton et
al. 1988). When combined with the LPS (the GCAT-LPS complex, MW = 2000 kDa),
the specific haemolytic activity and lethal toxicity of GCAT-LPS is stronger than the
native GCAT resulting in complete lysis of erythrocytes (Lee and Ellis 1990; Hirono
-60-
and Aoki 1993; Eggset et al. 1994; Nerland 1996; Bricknell et al. 1997; Thornley et al.
1997). Differences in MWs between GCAT produced by A. hydrophila and A.
salmonicida have been reported (Thornton et al. 1988), while polyclonal antibody
prepared against A. salmonicida GCAT does not cross-react with A. hydrophila GCAT
despite the similar amino acid termini of these proteins. Norwhistanding the pathology
associated with GCAT, its role as a virulence factor in humans is still controversial
(Chopra and Houston 1999b). The virulence of GCAT and serine protease mutants was
shown to be similar to the effects caused by wild strains of A. salmonicida after IP
injection of Atlantic salmon smots (Vipond et al. (1998).
Although some similarities exist between other lipases produced by A. hydrophila, they
are not identical. Some lipases are membrane-bound while others are present in the
periplasmic space (Anguita et al. 1993; Chuang et al. 1997). The characteristics of some
lipases depend on the encoding genes which are distributed in all Aeromonas species
(Chacón et al. 2003). Those encoded by the lip and lipH3 genes have esterase but not
phospholipase activities (Anguita et al. 1993; Chuang et al. 1997); the apl-1 gene
encode a non-haemolytic lipase with phospholipase C activity (Ingham and Pemberton
1995) while the pla gene encodes a non-haemolytic, non-cytotoxic and non-enterotoxic
lipoprotein with phospholipase A1 activity (Merino et al. 1999). Other significant
differences include the number of amino acid residues, optimal temperature and pH,
thermal stability and substrate specificity (Anguita et al. 1993; Ingham and Pemberton
1995; Chuang et al. 1997; Merino et al. 1999). At the amino acid level, sequence
similarities have been reported between the lip, lipH3, apl-1, pla and alt gene products
(Chopra et al. 1996; Merino et al. 1999) while the putative lipase substrate-binding
domain V-H-F-L-G-H-S-L-G-A is shared by several species particularly those
belonging to serogroups O:11, O:16 and O:34 (Watanabe et al. 2004). Lipases may act
by altering the plasma membrane of host cells affecting permeability and raising
accessibility to toxins (Soler et al. 2002; Mendes-Marquez et al. 2012).
1.10.3. Nucleases
The role of extracellular nucleases as a virulence factor contributing to disease has not
been supported by experimental work. The most probable roles of nucleases are
primarily nutritional, due to their ability to degrade nucleic acids, and protective, as
nucleases provide a barrier to the entry of foreign DNA into the host (Pemberton et al.
1997). Few genes encoding these enzymes have been cloned (Dodd and Pemberton
-61-
1996; Pemberton et al. 1997; Nam et al. 2004) and, of those examined, DNAse genes
have been found more frequently in clinical than in environmental isolates (Chacón et
al. 2003). Genes encoding DNases with different MWs have been identified in various
A. hydrophila strains. The dns gene of strain CHC-1 encodes a 25 kDa protein (Chang
et al. 1992) while dnsH and nucH present in strain JMP636 encode proteins of
approximately 27.4 and 114 kDa, respectively (Dodd and Pemberton 1996, 1999).
The deduced amino acid sequence of Dns is highly homologous with the DNase
produced by V. cholerae (Chang et al. 1992). By contrast, the NucH has no known
homologue on the basis of its nucleotide or predicted protein sequence (Dodd and
Pemberton 1996). DnsH and Dns are identical in size (210 amino acids) and contain
92% similarity and 89% amino acid identity, respectively (Dodd and Pemberton 1999).
Dns is an extracellular enzyme (Chang et al. 1992) that accumulates equally in both the
periplamic and cytoplasmic space suggesting that DnsH is not secreted (Dodd and
Pemberton 1999). A 25 kDa protein with endo- and exonuclease activity was identified
in A. hydrophila ATCC 14715. The nuclease was capable of complete (100%)
degradation of double-stranded DNA but only partial (70%) degradation of single-
stranded DNA. The ability to possess endo- and exonuclease activity by an intracellular
nuclease is considered rare among prokaryotes (Nam et al. 2004).
1.10.4. Chitinases
Chitin is one of the most abundant biopolymers present in the aquatic biosphere. It is
found in the exoskeleton of insects, molluscs, crustaceans and the cell wall of fungi.
Chitin is a source of food for Aeromonas and provides access to carbon, nitrogen and
energy supplies (Pemberton et al. 1997), thus, contributing to the survival of chitin-
hydrolyzing organisms (Roffey and Pemberton 1990). The degradation of chitin occurs
in two successive steps mediated by different chitinolytic enzymes (Lan et al. 2004).
More specifically, chitinases catalize the hydrolysis of the -1-4 linkage of N-acetyl-D-
glucosamine polymers of chitin (Chen et al. 1991). Several genes encoding for -N-
acetylglucosaminidases have been identified in A. hydrophila resulting in the expression
of proteins with different MWs and distinct biological and kinetic properties (Lan et al.
2004, 2006, 2008). Chitin-degrading enzymes with distinct MWs and biological
properties have also been described in other Aeromonas species (Yabuki et al. 1986;
Roffey and Pemberton 1990; Ueda and Arain 1992; Sitrit et al. 1995; Ueda et al. 1995;
-62-
Hiraga et al. 1997; Lin et al. 1997; Wu et al. 2001; Lan et al. 2004). Mehmood et al.
(2010) described four chitinases from A. caviae CB101 which were encoded by a single
gene chi1. The location of the enzyme in the cell, whether present in the periplasmic or
cytoplasmic space, appears to influence its role in chitin metabolism (Lan et al. 2008).
1.11. Iron uptake
Siderophores, a virulence factor in pathogenic bacteria, provide bacteria with iron from
the host during infection (Byers et al. 1991; Chopra and Houston 1999b). Two types of
siderophores are produced by Aeromonas, enterobactins and amonabactins. Aeromonas-
producing amonabactins can obtain iron from host transferrin and lactoferrin
(Barghouthi et al. 1989, 1991; Byers et al. 1991; Stintzi and Raymond 2000). In
contrast, enterobactin producers do not utilise transferrin in serum but rely exclusively
on host heme iron (Byers et al. 1991). Statistically, amonabactin producers are more
resistant to complement lysis than enterobactin-producing strains (Massad et al. 1991).
Two biologically active forms of amonobactin were described in A. hydrophila 495A2,
amonabactin T which contains lysine, glycine or tryptophan, and amonabactin P which
contains phenylalanine (Barghouthi et al. 1989).
In A. hydrophila, amonobactin is encoded by the amo gene which resembles the entC
gene of E. coli. The nucleotide sequences of amoA and entC suggest that these genes
may share a common ancestor. The biosynthesis of enterobactin involves several genes,
aebA, B, C and E, also functionally related to the E. coli genes. In Aeromonas, synthesis
of 2, 3-dihydroxybenzoic acid (2, 3-DHB) is encoded by the gene amo, in the
aminobactin-producers and by aeb, found among enterobactin-producers (Massad et al.
1994). Suppression of the amoA gene impaired excretion of 2, 3-DHB and amonabactin
resulting in mutants that were more sensitive to growth inhibition by iron restriction
compared to the wild strain (Barghouthi et al. 1991). The iron siderophore receptor gene
fstA of A. salmonicida is homologous with the fstA of other pathogenic Gram-negative
species suggesting that this gene is widely dispersed in these bacteria (Pemberton et al.
1997). Although siderophore production is a common trait in Aeromonas not all strains
are able to produce siderophores (Barghouthi et al. 1989; Zywno et al. 1992; Santos et
al. 1999). Through a siderophore-independent process, most isolates can also use
various heme compounds as sole iron sources (Massad et al. 1991). The combination of
siderophores and phenotypic characteristics was proposed as a taxonomic criterion to
-63-
separate between different genospecies and to evaluate the pathogenic potential of some
species (Zywno et al. 1992).
1.12. Quorum Sensing (QS)
Quorum sensing (QS) is a chemical signalling system that regulates gene expression
when bacteria reach a critical cell population density (Swift et al. 1997). Many Gram-
negative bacteria utilize acyl-homoserine lactone (AHL) which are low-molecular-mass
signalling molecules of different chain-lengths (Swift et al. 1999b; Jangid et al. 2007).
A-layer, protease, lipase and pigment production, cytotoxicity of ECP cells and a low
LD50 in A. salmonicida are regulated by quorum sensing (Rasch et al. 2007; Schwenteit
et al. 2010). However, production of virulence factors does not always correlate with
the production and accumulation of AHLs which are encoded by the luxRI (AI-1system)
genes that are universally present in Aeromonas (Jangid et al. 2007). From the
taxonomic view point, sequence analysis of luxRI shows that the genus Aeromonas
forms a distinct lineage from other genera in the class Proteobacteria (Jangid et al.
2007). The close homology of luxRI with the iciA gene of E. coli suggests that in
Aeromonas an association between QS and cell division may exist as iciA is involved in
chromosomal replication (Swift et al. 1997; Chopra and Houston 1999b). Mutations of
these genes can lead to alteration or inactivation of several activities including
exoenzyme activity (Swift et al. 1999a; Bi et al. 2007), biofilm formation (Lynch et al.
2002), changes in the OMP profiles and biochemical characteristics, reduction of
butanediol fermentation, protease activity, adherence, attenuation of cytotoxicity on
epithelial carp cells and LD50 and inability to produce a detectable S-layer (Swift et al.
1999b; Vivas et al. 2004; Bi et al. 2007; Van Houdt et al. 2007). Mutation in the luxS
gene in SSU impaired the secretion of effector proteins of the T6SS but not of T3SS
(Khajanchi et al. 2009). However, mutations in the ahyI and ahyR genes have not
always resulted in alterations in the virulence potential of aeromonads (Defoirdt et al.
2005).
Two other quorum sensing systems including a LuxS-based (AI-2) and the QseBC (AI-
3) two-component system have been described in A. hydrophila SSU (Kozlova et al.
2008; Khajanchi et al. 2009; 2012). The AI-1 and AI-2 QS sytems are positive and
negative regulators of virulence, respectively, while deletion of A1-3 in SSU was shown
to affect attenuation of A. hydrophila in a septicaemic mouse model of infection,
-64-
bacterial motility and biofilm formation (Khajanchi et al. 2012; Kozlova and Pekala
2012). It is also possible that the QseBC (A1-3) system may be linked to AI-1 and AI-2
QS systems in modulating bacterial virulence possibly through the cyclic diguanosine
monophosphate (Khajanchi et al. 2012).
Sulphur-containing AHLs act as QS inhibitors reducing protease production.

Interference with AHL-mediated quorum sensing is considered a promising target for
the development of a new generation of antimicrobial therapeutics and may represent an
important tool as a bacterial disease control measure in the aquaculture industry
(Defoirdt et al. 2005; Rasch et al. 2007; Khajanchi et al. 2009; Schwenteit et al. 2010).
Recently, a thermostable N-acyl homoserine lactonase derived from Bacillus strain
AI96 successufully attenuated A. hydrophila infection reducing zebrafish mortality (Cao
et al. 2012).
1.14. Biofilm formation
Aeromonas are efficient colonisers of surfaces and are an important constituent of

bacterial biofilms in both water distribution systems and food processing environments
(Chauret et al. 2001). The control of biofilm formation is of significant interest to the
industrial, public health and medical sectors. The ability of Aeromonas to form biofilms
may contribute to the persistence of these organisms in environmental reservoirs where
they exhibit increased resistance to normal bactericidal treatments (Lynch et al. 2002;
Rahman et al. 2007b). This is particularly significant in the food industry and
individuals residing along rivers where the presence of biofilm producing Aeromonas
spp. poses a serious danger to public health (Van Houdt and Michiels 2010; Odeyemi et al.
2012). Biofilm formation in food-processing environments has the potential to act as a
persistent source of microbial contamination leading to food spoilage or transmission of
disease (Chavant et al. 2007; Van Houdt and Michiels 2010). As a result, some studies
have been designed to demonstrate biofilm formation by Aeromonas on food produce
(Elhariry 2011) while others aimed to find products that can eliminate microbial
biofilms and their effective control in food industries (Farias Millezi et al. 2013).
Furthermore, the biofilm forming potential of these bacteria may pose a challenge
during treatment of infections associated with antimicrobial-resistant Aeromonas
species (Igbinosa et al. 2014).
-65-
As mentioned in Section 1.13, biofilm formation is one of several virulence factors
regulated by quorum sensing in particular by the C4-HSL QS molecules (Lynch et al.
2002; Defoirdt et al. 2005). In addition to quorum sensing, biofilm formation has been
associated with hyperpiliation of the cells involving the type IV pili in A. caviae (Bechet
and Blodeau 2003), with the bundle-forming pilus in A. veronii bv. sobria (Hadi et al.
2012) and with the presence of both polar and lateral (the flaA+/lafA+ genotype) flagella
(Kirov 2003; Santos et al. 2010). Rahman et al. (2007b) showed that in A. veronii bv.
sobria the signalling molecule c-di-GMP is influenced by the GGDEF and EAL domain
proteins AdrA and YhjH, respectively. The GGDEF domain protein AdrA also
influenced the level of the C4-HSL QS molecule. Alterations in the c-di-GMP levels by
the GGDEF domain protein AdrA regulate the multicellular behaviour, biofilm
formation and adherence to plant and animal surfaces. Overproduction of c-di-GMP was
shown to modulate transcriptional levels of genes involved in biofilm formation and
motility phenotype in A. hydrophila SSU in a QS-dependent manner, involving both AI-
1 and AI-2 systems (Kozlova et al. 2012). A recent finding suggests that the T6SS
effector protein VgrG, discussed in section 1.8.8.4, is essential for biofilm formation in
A. hydrophila (Sha et al. 2013).
1.14. Additional virulence factors
A plethora of other virulence factors which may or may not contribute to the
pathogenesis of Aeromonas have been described in these organisms. Immunophilin-like
proteins encoded by the ilpA and fkpA genes in A. hydrophila have no known functions
and express proteins with no obvious virulent effects as shown in an animal model
(Wong et al. 1997). By contrast, over-expression of the dam gene in A. hydrophila SSU
influences the virulence of this organism by altering the expression of T3SS and T2SS-
associated Act protein, as well as affecting motility and proteinase production (Erova et
al. 2006). The sodA and sodB genes in A. hydrophila ATCC 7966T code for a Mn-SOD
(superoxide dismutase) and a Fe-SOD, respectively. Fe-SOD is essential for the aerobic
viability of the organism and prevents damage to DNA while Mn-SOD protects the
bacterial cells against environmental superoxide (Leclère et al. 2004). The collagenase
gene acg enhances the adhesive, invasive and cytotoxic ability of A. veronii RY001 on
ECP cells (Han et al. 2008). The glycolytic enzyme enolase identified in the diarrhoeal
strain A. hydrophila SSU was associated with its surface expression and its ability to
bind plasminogen. Moreover, the enolase gene could play a potentially important role in
-66-
the viability of SSU (Sha et al. 2003, 2009). The synthesis of heat shock proteins is a
mechanism by which Aeromonas respond to thermal stress and confers protection to
aeromonads present in foods and food processing environments (Osman et al. 2011).
Although Aeromonas are generally considered non-capsulated organisms, the presence

of a capsule has been demonstrated in A. salmonicida and A. hydrophila serotypes O:11
and O:34 when grown in a glucose-rich medium (Martínez et al. 1995) and a capsule
gene cluster was identified in the whole genome of A. hydrophila PPD134/91 (Yu et al.
2005). The presence of group II capsules in A. hydrophila strongly correlates with the
serum and phagocytic survival activities of the organism in a fish model of infection
(Zhang et al. 2003). Finally, the role of cathepsin K in goldfish following A. hydrophila
infections has yet to be elucidated (Harikrishnan et al. 2010).
1.15. INFECTIONS CAUSED BY AEROMONAS SPP.
Human infections caused by Aeromonas species have been reported with increasing
frequency for the past 40 years although the exact prevalence of Aeromonas infections
on a global scale is unknown (Figueras 2005; Senderovich et al. 2012). The presence of
Aeromonas in the midgut of mosquitoes and the common housefly (Musca domestica)
represents a possible source of infection in cases where there is no exposure to
contaminated water, soil or foods (Nayduch 2001, 2002; Pidiyar et al. 2002). Although
gastroenteritis is the main condition associated with these organisms, many cases of
extraintestinal infections involving aeromonads have been described (Figueras 2005;
Parker and Shaw 2011). The rate of monomicrobial infections involving aeromonads
varies from 16 to 50% (Kelly et al. 1993; Tena et al. 2007). However, it has been
difficult to assess the role played by aeromonads in polymicrobial infections particularly
in cases where other recognized pathogens are concomitantly isolated.
Infections caused by Aeromonas can be serious and occasionally fatal in

immunocompromised patients (Harris et al. 1985; González-Barca et al. 1997).
Aeromonas-induced infections have been divided into four categories: (i) cellulitis or
wound infections associated with exposure to water or soil; (ii) septicaemia, usually
associated with hepatic, biliary or pancreatic disease or with malignancy; (iii) acute-
onset diarrheal disease of short duration; (iv) miscellaneous infections not associated
with any discernible physiological condition or environmental event (von Graevenitz
and Mensch 1968). The most important form of Aeromonas infection is sepsis as
-67-
reflected by the large number of publications compiled on Aeromonas septicaemia
(Janda and Abbott 2010).
1.15.1. Gastroenteritis
The most common infection associated with Aeromonas species in humans is

gastroenteritis. The isolation rate for Aeromonas varies from <2 to 6.9% (von
Graevenitz and Mensch 1968; Rautelin et al. 1995b; Chan and Ng 2004; Pokhrel and
Thapa 2004). In tropical environments, the intestinal carriage can reach up to 30%
(Pitarangsi et al. 1982). During diarrhoeal disease the intestinal tract may be colonised
simultaneously with different Aeromonas strains (Kuijper et al. 1989b; Moyer et al.
1992).
After surviving the acid environment of the stomach and the small intestine (Karem et
al. 1994) Aeromonas must compete with the normal flora and survive the by-products
of metabolism and other compounds (Janda and Abbott 2010). Attachment to intestinal
epithelium is essential and bacterial flagella and pili play important roles in this step.
After attachment, the pathology involved depends on the elaboration of enterotoxins
causing enteritis, and dysentery or colitis if invasion of the gastrointestinal epithelium
has occurred (Janda and Abbott 2010). The diarrhoeal episode that follows is due to
exposure to the enterotoxins produced by Aeromonas, described in Section 1.9.9.4.
1.15.1.1. Disease presentation
The most common presentation observed in Aeromonas-induced intestinal infection is

watery diarrhoea (Figueras 2005). Patients experience fever, vomiting, abdominal
cramps/pain, dehydration and blood in the stools (Janda et al. 1983a). In 50% of the
cases, diarrhoea persists for more than 10 days and up to 30% require hospitalization.
Rarely, the clinical presentation is suggestive of ulcerative colitis (Gracey et al.
1982ab). Dysentery-like syndrome associated with Aeromonas has been sporadically
reported and often requires hospitalization (Rahman and Willoughby 1980; Vila et al.
2003). Abdominal cramps and pain, mucus and blood in the stools are common
symptoms of dysentery-like enteritis (Janda and Duffey 1988).
Much rarer is a cholera-like disease linked to Aeromonas (Shimada et al. 1984; Sawle et
al. 1986; Janda and Duffey 1988). The most compelling case of a cholera-like disease
involving aeromonads was described by Champsaur et al. (1982) in a Thai woman
-68-
admitted to a Paris hospital. Among the clinical features observed included lethargy,
thirst, vomiting, dry mucous membranes, muscle cramps and rice-water diarrhoea. The
culpable organism, a strain of A. sobria (possibly A. veronii according to current
taxonomy), produced enterotoxin, cytolysin, proteolysin, haemolysin, and a cell-
rounding factor (Champsaur et al. 1982). Recently, A. caviae was recovered from the
stools of a 2 year old girl with a cholera-like illness in India (Jagadish Kumar and
Vijaya Kumar 2013).
Aeromonas is one of several micro-organisms implicated in travellers’ diarrhoea (TD), a

common health problem affecting travellers after visiting developing countries (Vila et
al. 2003; Gascón 2006). TD occurs globally and affects children as well as adults
(Gracey et al. 1984; Gascón et al. 1993; Hӓnninen et al. 1995a; Rautelin et al. 1995a;
Vila et al. 2003). In rare occasions, TD can be fatal (Sawle et al. 1986). Symptoms
associated with TD include watery and inflammatory diarrhoea, abdominal cramps and
fever (Vila et al. 2003). Severe atypical presentations following Aeromonas-induced
infection have been described including ulcerative and segmental colitis, ileal
ulceration, intra-mural intestinal haemorrhage with small bowel obstruction and
refractory inflammatory disease (Janda and Abbott 2010).
Haemolytic uraemic syndrome (HUS), a serious disease characterized by haemolytic

anaemia, acute kidney failure and thrombocytopaenia has been associated with
Aeromonas-induced enteritis (Bogdanović et al. 1991; Figueras et al. 2007a). Only a
few cases have been reported to date (Table 1.8). Clinical evidence indicates that
Aeromonas-related HUS is more responsive to treatment with antimicrobials compared
to HUS induced by enterohaemorrhagic E. coli EHEC (Fang et al. 1999). There are
reports that Aeromonas may contain Shiga toxin genes, typical of EHEC (Haque et al.
1996; Alperi and Figueras 2010).
1.15.1.2. Evidence against Aeromonas as an enteric pathogen
Despite the overwhelming data accumulated in the last 40 years, Aeromonas has yet to
be universally accepted as a bona fide enteric pathogen (Chu et al. 2006). The evidence
associating aeromonads with diarrhoea is circumstantial (Nishikawa and Kishi 1988;
Szabo et al. 2000). Aeromonas can be isolated from human faecal material in the
absence of diarrhoeal symptoms unlike other enteric pathogens (Küijper et al. 1987);
-69-
Table 1.8 Clinical characteristics of patients with HUS-associated Aeromonas
Age/Sex Diarrhoea Species Site of Source of Treatment Outcome References
prodrome/blood isolation isolation
NS NS A. sobria Faeces NS NS Survival San Joaquin and Pickett

(1988)
23 m/F 6d/yesa A. hydrophila Faeces NS Peritoneal dialysis, Survival Bogdanovic et al.

antihypertensive drugs, packed (1991)
red cell transfusions
NS NS A. hydrophila Faeces NS NS NS Robson et al. (1992)
6 m/F 7 d/yesb A. sobria Faeces aquarium Haemodialysis, renal transplant Survival Filler et al. (2000)
water
36 y/M 2 mths/yesb A. hydrophila Blood seafood Regular haemodialysis, Survival Fang et al. (1999)
antihypertensive drugs,
ceftizoxime
40 y/F 8 d/no A. veronii bv. Faeces NS Corticosteroids, fresh frozen Survival Figueras et al. (2007a)
sobria plasma, ciprofloxacin
Modified from Figueras et al. (2007a); a Watery diarrhoea became bloody on day 7; b Watery diarrhoea finally became bloody; NS, not specified.
-70-
there is no animal model for Aeromonas gastroenteritis and attempts to induce diarrhoea
in human volunteers and primates have, so far, been unsuccessful or inconclusive
(Pitarangsi et al. 1982; Morgan et al. 1985; Kirov 1993); the Henle-Koch postulates
have not been fulfilled including molecular postulates (Evans 1976; Falkow 2004); in
one study, no significant difference in the prevalence of virulence factors between
strains from diarrhoeic patients and controls were observed (Figura et al. 1986).
1.15.1.3. Evidence supporting Aeromonas as an enteric pathogen
Epidemiological evidence is strongly indicative that aeromonads are capable of causing

gastroenteritis. Aeromonas species have been recovered from diarrhoeal stools more
frequently than from control subjects (Holmberg and Farmer 1984; Agger et al. 1985;
Nishikawa and Kishi 1988; Deodhar et al. 1991; Rautelin et al. 1995b; Bravo et al.
2012). Enterotoxigenic strains have been isolated from children with diarrhoea (10.2%)
more often than those without (0.6%) diarrhoeal symptoms (Gracey et al. 1982b).
Isolation rates for aeromonads from diarrhoeic patients have been reported to be similar
to those of Salmonella enterica (Senderovich et al. 2012).
Despite assertions often made that there are no documented outbreaks due to
aeromonads (Nishikawa and Kishi 1988; Szabo et al. 2000), outbreaks involving
Aeromonas have been reported from several locations including enteritis due to A.
hydrophila in a neonatal intensive care unit in Germany (cited in Agger 1986), in a
pediatric hematology-oncology unit in Northen India involving A. sobria (Taneja et al.
2004), several Aeromonas species were associated with diarrhoeal disease in two
Brazilian studies (Guerra et al. 2007; Mendez-Marquez et al. 2012), a food poisoning
outbreak due to A. hydrophila in Sweden (Krovacek et al. 1995) and a small outbreak of
diarrhoeal infections occurred in Scotland (Nathwani et al. 1991) plus two outbreaks in
day care centres in the USA (de la Morena et al. 1993).
An immunological response from a healthy patient after severe Aeromonas-induced

diarrhoea strongly suggests that Aeromonas can behave as an enteric pathogen
(Palfreeman et al. 1983). The minimum inoculum necessary to induce diarrhoea by
Aeromonas was estimated at 104 cells ranking third behind Shigella (10-100) and
Campylobacter species (500-1000), respectively (Gascón 2006). The most likely
-71-
scenario to date is that acute enteritis caused by aeromonads is strain-dependent (von
Graevenitz 2007).
1.15.1.4. Species involved
The most frequently isolated species from human faecal material are A. hydrophila, A.
caviae, and A. veronii (both biovars). Of these, A. caviae has been the most predominant
species reported by a number of studies (Altwegg 1985; Travis and Washington 1985;
Mégraud 1986; Kuijper et al. 1987; Wilcox et al. 1992; de la Morena et al. 1993;
Rautelin et al. 1995b; Bravo et al. 2012; Senderovich et al. 2012). Other species
including A. bestiarum, A. jandaei, A. media, A. schubertii, A. taiwanensis and A. trota
are sporadically isolated (Hӓnninen and Siitonen 1995; Pablos et al. 2010; Bravo et al.
2012; Senderovich et al. 2012). However, the enterotoxigenic potential of Aeromonas is
not species-specific (Singh and Sanyal 1992a) and Aeromonas-induced gastroenteritis is
not confined to a single genomospecies or biotype/genotype within a single taxon
(Albert et al. 2000).
1.15.2. Skin and soft-tissue infections (SSTIs)
Skin, soft tissue, muscle, and bone infections represent the second most common type
of infections caused by Aeromonas species (Janda and Abbott 2010). A high percentage
(60%) of infections involving aeromonads is polymicrobial (McCraken and Barkley
1972; Smith 1980a; Gold and Salit 1993) and although rare, infections involving more
than one Aeromonas species have been documented (Joseph et al. 1979, 1991). In many
cases, A. hydrophila is usually the most prevalent species (Gold and Salit 1993; Wu et
al. 2011; Chao et al. 2013). A recent study found that the clinical presentation between
patients with monomicrobial infection differed markedly from those with polymicrobial
SSTIs (Chao et al. 2013). Previously, Harris et al. (1985) reported no significant
differences between the clinical presentation, severity of disease, or outcome of patients
with either monomicrobial or polymicrobial infections. Usually, SSTIs are the result of
exposure to contaminated water or soil (von Gravenitz and Mensch 1968; Vally et al.
2004) and can affect both immunocompromised and healthy individuals (McCraken and
Barkley 1972; Smith 1980a; Lynch et al. 1981; Heckerling et al. 1983). Most
documented cases are the result of community-acquired infection, but nosocomially-
acquired infections particularly after surgery do occur (Lynch et al. 1981; Gold and
Salit 1993).
-72-
Gold and Salit (1993) reported 11 cases of SSTIs caused by A. hydrophila and reviewed
the literature covering a period of 20 years (1973-1993). The clinical spectrum of
infections due to this organism included several forms of cellulitis, myonecrosis,
ecthyma gangrenosum, furunculosis, localized soft-tissue abscesses and skin nodules
suggesting that SSTIs involving Aeromonas can manifest in a wide range of clinical
presentations. Although wound infections caused by Aeromonas are not always fatal
(Gold and Salit 1993), in some cases, infection has resulted in serious complications
including death or amputation of affected limbs (Blatz 1979; Vally et al. 2004;
Abuhammour et al. 2006). Necrotizing fasciitis due to Aeromonas is rarely seen in
healthy individuals but has been reported in individuals with liver disease or
malignancy (Cui et al. 2007; Lee et al. 2008) and in patients with no prior contact with
aquatic animals or contaminated water (Ko et al. 2000).
1.15.3. Septicaemia
The most important form of Aeromonas infection is sepsis (Davis et al. 1978). Although
most infections caused by aeromonads are the result of exposure or ingestion of
contaminated soil, water, or food, in many cases the source of infection is unknown
(Harris et al. 1985; Roberts et al. 2006; Morinaga et al. 2011). A rare and severe case of
sepsis caused by A. hydrophila was reported in a patient with arthritis being treated with
the anti-arthritic agent tocilizumab (Okumura et al. 2011). The clinical manifestations
of Aeromonas septicaemia are similar to other Gram-negative bacilli including Vibrios
(Sirinavin et al. 1984; Park et al. 2011). Ko et al. (2005) compared the pathogenicity of
two bactaraemic isolates and showed that a strain of A. hydrophila Ah-2743 was more
pathogenic than Klebsiella pneumoniae p-129. The occurrence and 30-d fatality rate of
Aeromonas in patients with severe underlying conditions resembled those of P.
aeruginosa (Llopis et al. 2004). The mortality rate associated with Aeromonas
septicaemia in children and adults with and without underlying malignancies varied
from 55 to 75% (Ketover et al. 1973; Sirinavin et al. 1984; Janda and Duffy 1988).
Polymicrobial infections can range from 24 to 56% (Ko and Chuang 1995; Llopis et al.
2004; Tsai et al. 2006).
Janda and Abott (2010) categorized Aeromonas septicaemia into four groups (Table
1.9). Invariably in the majority of the cases patients have an underlying condition
involving the hepatobiliary system or malignancy (Janda and Brenden 1987; Ko and
-73-
Chuang 1995; Janda and Abbott 1998; Llopis et al. 2004). In a retrospective study
involving 41 Taiwanese patients, the predominant haematological malignancies
associated with Aeromonas bacteraemia were acute myelogenous leukaemia (37.8%),
myelodysplastic syndrome (26.7%) and non-Hodgkin lymphoma (17.8%). Most patients
experienced fever (88.9%), septic shock (40%) and altered consciousness (26.7%). On
average, a fatal outcome was observed less than four days between the collection of
blood samples and death (Tsai et al. 2006).
Community-acquired Aeromonas septicaemia constitutes the majority of the cases

compared to nosocomial infection (Ko et al. 2000). Nosocomial infections can occur in
patients with no history of water exposure or cross-contamination by hospital
environment and health care workers (Ko et al. 2000). In most cases, the suspected
source is the patient’s own gastrointestinal tract (Harris et al. 1985; Roberts et al. 2006),
probably from injury due to antineoplastic chemotherapies or gastrointestinal
colonization (Sherlock et al. 1987; DePauw and Verweij 2005). In patients with
cirrhosis of the liver, spontaneous bacterial peritonitis, hypotension, diabetes mellitus
and high Pugh scores usually predict a fatal outcome (Ko and Chuang 1995). Patients
with a concomitant infectious focus and a high severity score at onset tend to perform
poorly and have a worse prognosis (Ko et al. 2000). In general, males tend to be more
affected than females and children (Sirinavin et al. 1984; Janda and Brenden 1987; Ko
et al. 2000; Llopis et al. 2004; Chuang et al. 2011).
The most predominant species recovered from blood are A. hydrophila, A. veronii bv.
sobria and A. caviae (Ketover et al. 1973; Sirinavin et al. 1984; Janda and Brenden
1987; Ko and Chuang 1995; Ko et al. 2000; Llopis et al. 2004). This is consistent with a
seven year retrospective Taiwanese study were 56% of the isolates belonged to A.
hydrophila, 29% to A. veronii bv. sobria and 14% to A. caviae. Furthermore, mortality
rates and acute physiology and chronic health evaluation II (APACHE II) scores
suggested that A. veronii bv. sobria and A. hydrophila bacteraemia was more severe
than bacteraemia due to A. caviae (Chuang et al. 2011).
-74-
Table 1.9 Major categories of Aeromonas septicaemia disease presentation
Category Group Underlying risk Precipitating events Portal of entry Mortality

factors (%)
I Immunocompromised Hepatobiliary Recent antineoplastic Gastrointestinal tract, soft 32-55

persons disease, malignancy chemotherapy, neutropoenia tissue, intra-abdominal route,
contaminanted indwelling
devices
II Trauma patients Can vary from none Crush injury, penetrating Cutaneous-subcutaneous 60
to multiple injuries, near-drowning tissues, respiratory tract
conditions, including events, burns
diabetes
III Healthy persons None apparent at None noted Unknown <20
time of presentation
IV Reconstruction Malignancy, Medicinal leech therapy Tissue flap <5

surgery patients traumatic injury
resulting in
amputation
Modified from Janda and Abbott (2010).
-75-
1.15.4. Respiratory tract infections
Respiratory infections caused by Aeromonas are rare and the isolation of these bacteria
from the respiratory tract is usually considered a transient occurrence (Gonçalves et al.
1992; Takano et al. 1996; Janda and Abbott 1998; Bravo et al. 2003; Kao et al. 2003).
As in most infections associated with aeromonads, there is often a predisposing
underlying condition (Reines and Cook 1981; Baddour and Baselski 1988; Takano et al.
1996; Bravo et al. 2003). However, although rare, fulminant pneumonia has been
reported in healthy individuals as young as five-years old with no history of exposure or
consumption of water (Scott et al. 1978; Gonçalves et al. 1992; Kao et al. 2003; Nagata
et al. 2011). Haemoptysis is present in one half of cases (Scott et al. 1978; Reines and
Cook 1981; Gonçalves et al. 1992; Takano et al. 1996; Miyake et al. 2000). Infections
can be monomicrobial or polymicrobial and may be community or nosocomially-
acquired (Baddour and Baselski 1988). The mortality rate associated with aeromonads
has been estimated between 50 to 83% (Takano et al. 1996; Janda and Abbott 2010).
Many cases of Aeromonas-induced pneumonia were preceded by near-drowning events

(Reines and Cook 1981; Ender and Dolan 1997; Miyake et al. 2000; Mukhopadyay et
al. 2003; Bossi-Küpfer et al. 2007). Mortality rates as high as 60% have been reported
for aeromonad-related pneumonia in these cases (Ender and Dolan 1997). Both A.
veronii bv. sobria and A. hydrophila have been isolated from fatal cases (Mellersh et al.
1984; Miyake et al. 2000; Bossi-Küpfer et al. 2007). The latter species was isolated
from 19 specimens including 14 respiratory tract specimens at a hospital in Sheffield,
England (Mellersh et al. 1984) and also in pure culture from the pharyngeal exudate of a
59 year-old diabetic female with anaemia and pharyngitis (Tena et al. 2007). More
recently, a multiresistant strain of A. caviae was thought to be the caused of severe
pneumonia in a cancer patient (Yu et al. 2010).
1.15.5. Urogenital tract infections
Aeromonas species are rarely associated with urinary tract infections (UTIs) and very
few cases have been described (Filler et al. 2000; Hua et al. 2004; Al-Benwan et al.
2007; Figueras et al. 2007a). To date, the most cited cases of Aeromonas-induced UTIs
have involved young children. Both A. hydrophila and A. popoffii were isolated from a
neonate (Bartolome et al. 1989) and a 13 year-old boy suffering from spina bifida,
respectively (Hua et al. 2004). A serious case was described in a six-month old girl with
-76-
diarrhoea who developed acute renal failure requiring dialysis and subsequently a renal
transplant. The source of the culpable bacterium, a haemolytic and cytotoxic A. sobria
strain was probably aquarium water or the bathtub (Filler et al. 2000). In adults, A.
caviae was isolated at 105 cells/ ml of urine in a 39 year-old male with symptoms of
cystitis and a history of frequency, dysuria, haematuria, and weight loss (Al-Benwan et
al. 2007). A 69 year-old diabetic male with chronic hepatitis and an indwelling device
developed UTI with A. veronii bv. sobria and bacteraemia with A. veronii bv. veronii.
After successful treatment with IV ceftriaxone the patient was discharged but re-
admitted a few weeks later with necrotizing fasciitis due to A. veronii bv. veronii
(Hsueh et al. 1998).
1.15.6. Intra-abdominal infections
Intra-abdominal infection is a broad term used to describe many different types of

infections such as peritonitis, pancreatitis, acute cholangitis and hepatic abscesses
(Janda and Abbott 2010). The majority of cases are community-acquired and males are
usually more affected than females (2:1 ratio) (Clark and Chenoweth 2003). In serious
Aeromonas infections such as liver abscesses the prognosis is usually poor in
immunocompromised individuals as a result of the underlying conditions (Colaco 1982;
Clark and Chenoweth 2003).
Peritonitis in adults is not uncommon and many cases have been reported for the last 30
years (Freij 1985; Khardori and Fainstein 1988; Muñoz et al. 1994; Ruíz de González et
al. 1994; Elcuaz et al. 1995; Ko and Chuang 1995). Peritonitis is usually a secondary
sequela to primary Aeromonas infection and in 75% of the cases has been associated
with bacteraemia (Muñoz et al. 1994; Ruíz de González et al. 1994; Elcuaz et al. 1995;
Ko and Chuang 1995). Cases of peritonitis have been described in children including
those with ruptured appendixes (Freij 1985; Khardori and Fainstein 1988) and in
patients undergoing continuous ambulatory peritoneal dialysis (Solaro and Michael
1986; Chang et al. 2005; Yang et al. 2008). The presence of Aeromonas as a cause of
peritonitis or liver abscess should alert clinicians to the potential presence of underlying
malignancies that may otherwise not been detected, a situation similar to the isolation of
Streptococcus bovis group and Clostridium septicum from blood as these organisms are
strongly associated with bowel malignancy (Bailey and Scott 1994).
-77-
Huang et al. (2006) reviewed 49 cases of primary and secondary Aeromonas peritonitis
in a nine year period. Data from this study indicated that primary peritonitis occurred
more often in individuals (97%) with liver disease in which half of the cases were
accompanied by bacteraemia. In secondary peritonitis, 44% of the cases were health-
care associated infections. Most peritoneal cultures (85%) were polymicrobial in nature
usually involving members of the Enterobacteriaceae (Huang et al. 2006). The
mortality rates attributed to primary and secondary peritonitis in this series were 23 and
15%, respectively (Huang et al. 2006). These values differed from the 60% overall
mortality rate for aeromonad peritonitis reported by Muñoz et al. (1994). The gross
mortality rate for spontaneous bacterial peritonitis caused by A. hydrophila or A. veronii
was estimated at 56% (Wu et al. 2009).
A review of 39 cases indicated that hepatobiliary infections occurred in 71% of the

patients with cholangitis and 22% with cholecystitis. Complications in the latter group
included empyema or gangrene of the gallbladder while nine (22%) patients developed
liver abscesses (Clark and Chenoweth 2003). The overall mortality (24%) of this series
was higher than the 10% overall mortality reported by others (Chan et al. 2000).
Immunosuppression, malignancy and bile duct stones are the major predisposing
underlying conditions of intra-abodominal infections (Chan et al. 2000; Clark and
Chenoweth 2003). The consumption of freshwater fish and transmural migration from
the gastrointestinal tract has been identified as possible sources of infection (Solaro and
Michael 1986; Yang et al. 2008). The three major species A. hydrophila, A. caviae and
A. veronii have been frequently isolated while A. salmonicida was identified in a patient
with peritonitis undergoing continuous ambulatory peritoneal dialysis (Yang et al.
2008).
1.15.7. Infections due to medicinal leech therapy
Medicinal leeches (Hirudo medicinalis) are used to relieve venous congestion after
plastic and reconstructive surgery. Wound discharge is a common feature and most
infections respond to either antimicrobial therapy and/or debridement (Mercer et al.
1987). A retrospective study of 47 cases in Belgium showed that soft-tissue infections
after medicinal leech therapy were largely polymicrobial (Bauters et al. 2007).
Aeromonas hydrophila has frequently been isolated from wound samples following
leech therapy (Whitlock et al. 1983; Dickson et al. 1984; Mercer et al. 1987; Snower et
al. 1989; Fenollar et al. 1999), although cases involving A. caviae (Bauters et al. 2007)
-78-
and A. sobria (Fenollar et al. 1999) have been described. Graf (1999b) used
biochemical and molecular methods to characterize Aeromonas isolated from the gut of
the leech revealing that A. veronii bv. sobria was the main bacterium present in the
digestive tract of the parasite. In a recent study, Laufer et al. (2008) isolated two distinct
Aeromonas species in Hirudo orientalis, namely, A. veronii and A. jandaei. The study
also revealed that these species could colonize the species Hirudo verbena.
The presence of bacteria other than aeromonas has been attributed to the leech being fed
contaminated blood or the failure to properly decontaminate the surface of the parasite
(Graf 1999b). Prophylactic therapy with an appropriate antimicrobial to protect patients
from infections caused by Aeromonas should be considered for individuals undergoing
medicinal leech treatment, in particular, immunocompromised patients (Bauters et al.
2007).
1.15.8. Meningitis
Cases of meningitis caused by Aeromonas species are very rare (Seetha et al. 2004).
Although most patients have a predisposing condition, meninigitis due to cranial
surgery (Qadri et al. 1976), as complication of medicinal leech therapy (Ouderkirk et
al. 2004) and cranial injury have been described (Pampín et al. 2012). However, in
some meninigits cases no obvious predisposing condition has been reported (Sirinavin
et al. 1984; Seetha et al. 2004). Most cases have been attributed to A. hydrophila
followed by A. veronii bv. sobria and in the majority of cases the organism was
recovered in cerebral spinal fluid. A fatal outcome was observed in 33% of the patients
(Parras et al. 1993).
1.15.9. Zoonotic infections
Aeromonas infections due to animal bites are an infrequent event. Most infections are
polymicrobial in nature and the contribution of aeromonads to these infections is not
totally clear (Janda and Abbott 2010). Aeromonas form part of the oropharyngeal flora
of reptiles and have been recovered from the mouth, fangs and venom of snakes (Jorge
et al. 1998; Janda and Abbott 2010). To date, A. hydrophila has been the species most
commonly isolated alone or in combination with other bacteria, from animal-related
infections including snake bites (Jorge et al. 1998), bear attack (Kunimoto et al. 2004),
-79-
catfish (Murphy et al. 1992), alligator and crocodile bites (Raynor et al. 1983, Flandry
et al. 1989, Mekisic and Wardill 1992) and infections after shark attacks (Royle et al.
1997). Unusual cases of zoonotic infection include the isolation of A. hydrophila and
Peptostreptococcus species from a wound on the foot of an 11 year-old boy after
stepping on a stingray in a muddy river in Argentina (Pollack et al. 1998); abundant
growth of A. hydrophila was recovered from the wound of a 17 year old boy with cyclic
neutropoenia after being bitten by his pet piranha (Revord et al. 1988).
1.15.10. Burns
Aeromonas species are occasionally the cause of bacteraemia in burn patients and more
than 20 cases of Aeromonas infection following burn accidents have been recorded
since the 1980s including monomicrobial and polymicrobial infections (Ampel and
Peter 1981; Barillo et al. 1996; Purdue and Hunt 1996; Kienzle et al. 2000; Wilcox et
al. 2000; Chim and Song 2007; Lai et al. 2007). Burn injury may predispose to
immunosuppression making the host more susceptible to Aeromonas infections (Barillo
et al. 1996). Possible sources of contamination include extinction of a fire with dirty
water or by rolling on dirt (Purdue and Hunt 1996) and by immersion in water
immediately post burn (Kienzle et al. 2000). Exposure to water, however, has not
always been the source of these infections (Barillo et al. 1996). Infection with
Aeromonas following an electrical burn was described by Wilcox et al. (2000). All three
major species, A. hydrophila, A. caviae and A. veronii bv. sobria have been recovered
from burn patients. Infections harbouring more than one Aeromonas species have been
described (Kienzle et al. 2000). Irrespective of the species isolated, the mortality rate
associated with Aeromonas bacteraemia in burn patients is high (Lai et al. 2007).
1.15.11. Eye infections
Eye infections are extremely rare and usually occur as a result of injury or trauma
(Smith 1980ab, Cohen et al. 1983; Washington 1972, 1973) and to a lesser extent, by
wearing contaminated soft contact lenses (Pinna et al. 2004; Hondur et al. 2008). The
clinical manifestations associated with these infections include corneal ulceration,
endophthalmitis, conjunctivitis and keratitis (Feaster et al. 1978; Cohen et al. 1983; Puri
et al. 2003; Pinna et al. 2004; Khan et al. 2007; Sohn et al. 2007). Although Aeromonas
species have been involved in serious eye infections, the isolation of these organisms
-80-
from eye specimens does not always indicate infection and may represent colonization.
Conjunctival colonization with A. hydrophila and H. influenzae without any evidence of
infection was reported in a 7 year-old boy after sustaining a penetrating injury to his eye
with a safety pin (Smith 1980ab). To date, all cases of endophthalmitis involving
aeromonads have been polymicrobial. Both A. hydrophila and P. shigelloides were
isolated from the anterior chamber fluid of an 8 year-old boy following a penetrating
injury by a fish hook (Cohen et al. 1983). In another case, A. hydrophila was isolated
with C. perfringens, Bacillus species, and coryneform bacteria after perforation of the
eye as a result of a dynamite explosion (Washington 1972).
1.15.12. Osteomyelitis and suppurative arthritis
Although rare, oesteomyelitis and suppurative arthritis involving Aeromonas have been
reported in both immunocompromised (López et al. 1968; Chmel and Armstrong 1976)
and healthy individuals (Blatz 1979; Karam et al. 1983). In immunocompromised
patients, the outcome of these infections can be fatal despite appropriate antimicrobial
therapy (Dean and Post 1967).
1.16. ANTIMICROBIAL SUSCEPTIBILITIES
Data on the antimicrobial susceptibility of Aeromonas has derived primarily from A.

hydrophila, A. caviae and A. veronii isolates (Ko et al. 1996; González-Barca et al.
1997). More recently, the antimicrobial susceptibility of less frequently isolated species
such as0 A. allosaccharophila, A. jandaei, A. schubertii, A. trota, A. popoffii and A.
veronii bv. veronii has been determined (Overman and Janda 1999; Soler et al. 2002;
Fosse et al. 2003a; Girlich et al. 2010). The agar dilution test has been the preferred
method and a good correlation between agar dilution and disk diffusion has been
reported (Koehler and Ashdown 1993). Previously, interpretative criteria for Aeromonas
were based on guidelines established for Pseudomonas, Acinetobacter or
Enterobacteriaceae (Koehler and Ashdown 1993; Overman and Janda 1999; Lupiola-
Gomez et al. 2003). New guidelines and interpretative criteria for Aeromonas are now
available for a handful of species (CLSI 2006; Jorgensen and Hindler 2007).
The antimicrobial susceptibility of Aeromonas species is predictable in most parts of the

world (Jones and Wilcox 1995). However, assessing the susceptibility patterns of
clinically significant isolates is highly recommended. Antimicrobial resistance may be
-81-
strain-dependent and fatal outcomes have been associated with resistant strains
(González-Barca et al. 1997). Moreover, antimicrobials to which aeromonads are
intrinsically resistant have been administered in up to 20% of infections involving these
bacteria (Scott et al. 1978; Vila et al. 2002; Bravo et al. 2003; Figueras 2005).
Consequently, empirical antimicrobial therapy is usually inappropriate and
recrudescence of infections due to ineffective early treatment compromises or delays
patient’s recovery (Mellersh et al. 1984; Revord et al. 1988; Kelly et al. 1993; Al-
Benwan et al. 2007).
The isolation of multi-resistant strains from food, aquaculture, and other environs is of
clinical concern since these are potential sources of Aeromonas-induced infections
(Goñi-Urriza et al. 2000; Rhodes et al. 2000; Nawaz et al. 2010). Resistance patterns
have been reported in Aeromonas isolated from intestinal specimens, vegetables and
water sources (Pokhrel and Thapa 2004; Palu et al. 2006). Resistance observed in
environmental aeromonads may be related to the amount of pollution associated with
these environments since heavily polluted waters may contain multiple resistance
plasmids (Huddleston et al. 2006). In clinical isolates, antibiotic resistance has been
associated with heavily populated areas probably reflecting local antibiotic usage (Goñi-
Urriza et al. 2002).
Aeromonas can rapidly become resistant to multiple antibiotics, particularly to -

lactams, when exposed to substrates that allow for selection of mutant strains (Bakken
et al. 1988). With the exception of Asian isolates, world-wide resistance to tetracycline
and chloramphenicol in clinical isolates has been consistently low (Reinhard and
George 1985; Gosling 1986; Burgos et al. 1990; Koehler and Ashdown 1993). Asian
strains also tend to be less susceptible to cefamandole, cotrimoxazole, pipercillin,
imipenem and third generation cephalosporins (Chang and Bolton 1987; Ko and
Chuang 1995; Ko et al. 1996, 2000; Chan et al. 2000).
Aeromonas are universally resistant to penicillin, carbenicillin, erythromycin,

streptomycin and clindamycin (Jones and Wilcox 1995). Except for A. trota,
Aeromonas are intrinsically resistant to ampicillin although ampicillin-susceptible
strains belonging to species other than A. trota have been reported (Carnahan et al.
1991a; Abbott et al. 2003; Chan and Ng 2004; Huddleston et al. 2007; Figueira et al.
2011; Aravena-Román et al. 2012). Resistance to the aminoglycosides is low and while
most isolates are susceptible to gentamicin and amikacin tolerance to tobramycin has
-82-
been increasingly recognized (Singh and Sanyal 1992a; Koehler and Ashdown 1993;
Kirov et al. 1995a; Ko et al. 1996; Overman and Janda 1999; Goñi-Urriza et al. 2000;
Vila et al. 2002; Aravena-Román et al. 2012).
1.16.1. -lactamases
Production of -lactamases is the most common mechanism of antimicrobial resistance

in Aeromonas. The secretion of multiple -lactamases by some strains is not unusual
(Zemelman et al. 1984; Bakken et al. 1988; Iaconis and Sanders 1990; Walsh et al.
1997; Fosse et al. 2004). Inducible chromosomally-mediated -lactamases with action
against penicillins, cephalosporins and carbapenems (Ambler class B, C and D) are
produced by Aeromonas (Table 1.10) (Iaconis and Sanders 1990; Segatore et al. 1993;
Rasmussen et al. 1994; Walsh et al. 1996; Yang and Bush 1996; Zhiyong et al. 2002;
Fosse et al. 2003a). For the most part, the biochemical, genetic and enzymatic
properties of Aeromonas-induced -lactamases derived from cloning experiments using
E. coli as a recipient (Hedges et al. 1985; Rasmussen et al. 1994; Rossolini et al. 1996;
Marchandin et al. 2003; Neuwirth et al. 2007). Significantly, conventional in vitro
susceptibility tests may sometimes fail to detect these β-lactamases compromising
therapeutic challenge (Chen et al. 2012).
-lactamases produced by Aeromonas can be susceptible to potassium clavulanate

although the combination of this inhibitor and ampicillin does not always result in lower
MICs to ampicillin. This is probably due to the intrinsic resistance of aeromonads to
ampicillin (Zemelman et al. 1984; Bakken et al. 1988). Further, exposure to ampicillin-
clavulanate has been associated with overproduction of chromosomal cephalosporinase
and imipenem resistance suggesting that the combination may induce multiresistance
(Sánchez-Céspedes et al. 2009). Changes in peptidoglycan composition (Tayler et al.
2010) and single point mutations alter -lactamase expression or induction in A.
hydrophila while derepression can lead to overexpression of multiple enzymes (Walsh
et al. 1997). Aeromonas species are considered the natural reservoir of class C
cephalosporinases and transposition genes that could be readily transfered to members
of the Enterobacteriaceae (Fosse et al. 2003c).
Metallo--lactamases (MBLs) are -lactamases active against carbapenems (Rasmussen
and Bush 1997). The first carbapenemase was detected in A. hydrophila (Shannon et al.
1986) and later found in A. veronii (both biovars) (Bakken et al. 1988).
-83-
Table 1.10 -lactamases produced by Aeromonas species
Group Classification1 Family Name Location Species Reference
SBL A Carbenicillase AER-1 C A. hydrophila Hedges et al. (1985)
C Cephalosporinase A1 C A. hydrophila, A. sobria Iaconis and Sanders (1990)
C AmpC AsbA1 C A. jandaei2 Rasmussen et al. (1994)
D OXA AsbB1 C A. jandaei2 Rasmussen et al. (1994)
D Penicillinase AmpH, AmpS C A. caviae, A. veronii bv. sobria, Fosse et al. (2003a)
A. hydrophila
C AmpC (FOX-1) CAV1 C A. caviae Fosse et al. (2003c)
C AmpC CepS, CepH C A. caviae, A. veronii bv. sobria, Fosse et al. (2003a)
A. hydrophila
A TEM TEM-1-like, P A. hydrophila, A. caviae Fosse et al. (2004)
TEM-24 Marchandin et al. (2003)
A C/P A. hydrophila, A. caviae Wu et al. (2011)
-84-
Group Classification1 Family Name Location Species Reference
MBL B Carbapenamases A2h, A2s C A. hydrophila, A. sobria Iaconis and Sanders (1990)
B Carbapenamases AsbM1 C A. jandaei Rasmussen et al. (1994)
B Carbapenamases CphA C A. hydrophila, A. veronii (both Fosse et al. (2003a)

biovars), A. jandaei
B Carbapenamases ImiS C A. veronii bv. sobria Walsh et al. (1998)
B IMP IMP-19 P A. caviae Neuwirth et al. (2007)
B VIM VIM I A. hydrophila Libisch et al. (2008)
1
Ambler class; 2 Previously named as A. sobria; C, chromosomal; P, plasmid; I, integron; Asb, Aeromonas sobria -lactamases; CAV, found in A.
caviae; Cep, chromosomal cephalosporinase; CphA, carbapenem hydrolyzing A. hydrophila; ImiS, imipenemase from A. veronii bv. sobria; IMP,
active on imipenem; TEM, named for patient Temoneira; VIM, verona integron-encoded metallo--lactamase; SBL, Serine -lactamases; MBL,
Metallo--lactamases; Modified from Janda and Abbott (2010).
-85-
MBLs have now been described in A. dhakensis, A. caviae, A. hydrophila, A. jandaei, A.
sobria and A. salmonicida (Rasmussen and Bush 1997; Wu et al. 2012). The most
common MBL found in aeromonads is CphA (Wu et al. 2012). Production of MBLs in
A. caviae is rare even in derepressed mutants suggesting that imipenem, aztreonam and
ceftazidime can be administered as an alternative therapy for infections caused by this
species (Walsh et al. 1997; Lupiola-Gómez et al. 2003). Imipenem resistance has been
reported in several Aeromonas species (González-Barca et al. 1997; Tena et al. 2007;
Wu et al. 2012) particularly A. jandaei and A. veronii (Overman and Janda 1999;
Sánchez-Céspedes et al. 2009; Figueira et al. 2011). Carbapenemase-producing strains
can only be detected when the inoculum size is increased since most isolates will be
susceptible to imipenem if a conventional inoculum is used (Shannon et al. 1986:
Rossolini et al. 1995; Wu et al. 2012). Although meropenem is largely more active than
imipenem against aeromonads (Clark 1992), the latter is recommended against
infections caused by strains overexpressing group-1 -lactamases (Lupiola-Gómez et al.
2003).
1.16.2. Extended-spectrum -lactamase (ESBL) production
The incidence of ESBLs in Aeromonas species is low. The first ESBL was described in
an A. caviae strain isolated from the diarrhoeaic stools of a 76 year-old man with
intestinal ischaemia in France (Marchandin et al. 2003). Fosse et al. (2004) described
the isolation of A. hydrophila recovered from the wound of an 87 year-old female with
necrotizing fasciitis that simultaneously produced class A, B, C and D -lactamases.
Surprinsingly, in both cases, the aeromonads were concomitantly isolated with an E.
aerogenes strain that harboured a 180 kb TEM-24 plasmid. ESBLs were also detected
in A. hydrophila isolated from the blood of a three year-old boy with bacteraemia and
diarrhoea (Rodríguez et al. 2005) and from A. caviae recovered from the sputum of a 68
year-old male with oesophageal cancer (Ye et al. 2010).
ESBL-producing aeromonads have been recovered from clinical, environmental and

mussel isolates with one fatal case reported among those isolated from human clinical
material. Nosocomially-acquired infection was diagnosed in four patients, two from the
community while the source of the remaining two was unknown. The majority of the
patients had an underlying malignancy (Table 1.11). The isolation of ESBL-producer
aeromonads from blood represents a serious clinical concern and the presence of these
-86-
Table 1.11 ESBL-producing Aeromonas species
Clinical
Species Specimen Gender/age (years) Clinical diagnosis Reference
A. caviae Stool M/78 Intestinal ischaemia Marchandin et al. (2003)

A. hydrophila Wound F/87 Necrtizing fasciitis Fosse et al. (2004)
A. hydrophila Blood M/3 Bacteraemia, pneumonia Rodriguez et al. (2005)
A. caviae Sputum M/68 Oesophageal cancer Ye et al. (2010)
A. hydrophila Blood F/70 Bacteraemia, hand phlebitis Wu et al. (2011)
A. caviae Blood M/55 Primary bacteraemia Wu et al. (2011)
A. caviae Blood M/52 Primary bacteraemia Wu et al. (2011)
A. caviae Blood F/65 Bacteraemia, hand phlebitis Wu et al. (2011)
Environmental/Other
A. media Active sludge Found in: Switzerland Picäo et al. (2008)
A. allosaccharophila River water France Girlich et al. (2010)
A. hydrophila River sediment China Lu et al. (2010)
A. hydrophila/A. caviae Mussel Croatia Maravić et al. (2013)
Modified from Wu et al. (2011); M, male; F, female.
-87-
enzymes should be excluded from isolates with a cefotaxime-resistant profile (Wu et al.
2011). ESBL-encoding genes were recently detected in 21 (14%) (13 A. caviae and
eight A. hydrophila) isolates, with bla (CTX-M-15) identified in 19 and bla (SHV-12) in
12 isolates in Aeromonas isolated from wild-growing Mediterranean mussel (Mytilus
galloprovincialis) in the eastern coast of the Adriatic Sea, Croatia. Of these, bla (CTX-
M-15) was located on conjugative IncFIB-type plasmids in A. caviae isolates (Maravić
et al. 2013).
The detection of ESBLs in Aeromonas prompted examination of environmental sources

resulting in the screening for multi-drug resistance bacteria in different water
environments. These findings suggest that Aeromonas can act as either recipient or
vectors of resistant elements from other Gram-negative bacteria particularly from the
Enterobacteriaceae (Fosse et al. 2003c). The current procedure used to detect the
presence ESBLs is based on the clavulanate-based synergy (double-disk) technique
usually applied to the Enterobacteriaceae (Fosse et al. 2004; Rodríguez et al. 2005).
Genotypic confirmation of the presence of ESBLs can also be determined by PCR or
ESBL sequencing (Maravić et al. 2013).
1.16.3. Plasmid-mediated resistance
Although antimicrobial resistance in Aeromonas is largely chromosomally mediated

(Ianconis and Sanders 1990; Lupiola-Gomez et al. 2003), plasmids harbouring
resistance genes have been described in several species (Rhodes et al. 2000, 2004;
Cattoir et al. 2008). Plasmids of variable MWs with the ability to confer resistance to
both antimicrobials and metals have been recovered from Aeromonas isolated from
water, food and human sources (Huddlestone et al. 2006; Palu et al. 2006). Plasmids
encoding resistance genes can be disseminated between different bacterial species under
natural conditions (Rhodes et al. 2000). Class I and 2 integrons have been reported in
strains associated with beef cattle in Australia. Thus, it is possible that the environment
is likely to act as reservoir and disseminator of integron-containing bacteria in beef
(Barlow and Gobiuos 2009). Class I integrons have been detected in A. veronii isolated
from catfish suggesting that this species may act as the reservoir for integrons and
putative pathogenic genes (Nawaz et al. 2010). Class 1 integrons have also been
detected in environmental members of the Enterobacteriaceae. Quinolone resistance
due to plasmid-mediated genes found in the Enterobacteriaceae have been identified in
-88-
Aeromonas isolated from environmental and clinical sources (Cattoir et al. 2008;
Sánchez-Céspedes et al. 2008).
1.16.4. Quinolones
Quinolones are among the most effective antimicrobial agents used against Aeromonas
infections and fluoroquinolones have shown excellent in vitro activity against most
species (Reinhard and George 1985; Ko et al. 1996, 2003). Among the
fluoroquinolones, ciprofloxacin proved to be the most effective against murine A.
hydrophila infections (Ko et al. 2003). Resistance to quinolones has been linked with
mutations of the gyrA gene and is associated with reduced susceptibility to nalidixic
acid (Chang and Bolton 1987; Goñi-Urriza et al. 2002; Vila et al. 2002). Rhodes et al.
(2000) showed that resistance to nalidixic acid was source-dependent. Human-derived
strains were more resistant than aquaculture strains while in waste water isolates
resistance was nearly five times more prevalent than surface water isolates. Ozonation
of water may reduce quinolone resistance and increase production of metallo--
lactamase (Figueira et al. 2011).
Elevated MIC values due to quinolone resistance in A. hydrophila, A. caviae and A.

sobria have been associated with mutations in type II toposisomerases of gyrA, gyrB,
parC and parE genes which contain a quinolone resistance-determining region (Goñi-
Urriza et al. 2002; Sinha et al. 2004). Mutations in these genes are attributed to double-
or single-amino acid substitutions conferring a high resistance to fluoroquinolones
(Sinha et al. 2004). Other quinolone-resistant mechanisms described in Aeromonas
include a reduction on the level of uptake or an active efflux system (Poole 2000).
1.16.5. Genes encoding for antimicrobial resistance
The distribution of resistance genes in Aeromonas varies among the species. The cepS
gene is almost universally present in A. veronii, A. hydrophila and A. caviae while the
frequency of the amps gene appears to be strain-dependent (Walsh et al. 1997). The
asbA1 and asbB1 genes which encode class C and D -lactamases, respectively, have
been detected in A. jandaei (Rasmussen et al. 1994). CphA is encoded by cphA and has
been detected in A. dhakensis, A. veronii (both biovars), A. hydrophila, A. jandaei and
A. salmonicida (ssp. salmonicida and achromogenes) but not in A. caviae, A. trota or A.
schubertii (Rossolini et al. 1996; Walsh et al. 1997; Wu et al. 2012). Despite
-89-
harbouring the cphA gene, some species are unable to express MBL activity suggesting
that genetic modifications capable of silencing the gene exist (Rossolini et al. 1995; Wu
et al. 2012). Two integron-borne MBLs have been identified in Aeromonas isolated
from stools in France and Hungary. The genes blaIMP-19 gene and blaVIM-4 encoding for
IMP-19 and VIM were detected in A. caviae and A. hydrophila, respectively (Neuwirth
et al. 2007; Libisch et al. 2008). VIM which confers resistance to all -lactam
antibiotics except aztreonam could not be detected by the MBL Etest and only disks
with and without EDTA or PCR would demonstrate the presence of the enzyme and
gene respectively (Libisch et al. 2008).
ESBLs encoded by the blaTEM , blaPER , blaCTX-M, and blaSHV genes can be found in both
chromosomes or plasmids. Of these, blaPER-3, which is rarely described in Aeromonas,
has been detected in three strains (Picȁo et al. 2008; Girlich et al. 2010; Wu et al. 2011)
and in a single isolate also harbouring the blaCTX-M-15 gene in mussel (Maravić et al.
2013). Quinolone resistance is mediated by the qnrS2 gene and has been detected in A.
punctata (A. caviae) and A. veronii strains isolated from water and clinical sources,
respectively (Cattoir et al. 2008; Sánchez-Céspedes et al. 2008). QnrS2 can be
transferred from Aeromonas species to E. coli TPO10 with the consequent increase of
MICs of quinolones and fluoroquinolones (Cattoir et al. 2008).
1.16.6. Antimicrobial usage: recommendations
Several recommendations regarding the usage or testing of antimicrobials directed

against aeromonads have been proposed. Fluoroquinolones should not be used in
treating paediatrics patients (Overman and Janda 1999) or in infections caused by
Aeromonas resistant to nalidixic acid (Vila et al. 2002). Tobramycin, imipenem and
cefoxitin should be omitted as alternative therapies due to the high resistance shown by
certain species to these antimicrobials (Overman and Janda 1999). A lack of clinical
usefulness precludes testing susceptibility to ampicillin, carbenicillin and cephalothin
(Overman and Seabolt 1983). Aeromonas species carrying carbapenemase-encoding
genes should be considered resistant to this antimicrobial class until confirmation is
performed (Rossolini et al. 1996; Wu et al. 2012). Multi-resistant A. hydrophila strains
isolated from children with acute diarrhoea were reported from India. However, these
results were misleading as some antibiotics tested (vancomycin, bacitracin, methicillin
and novobiocin) are not those usually used to treat Aeromonas in routine clinical
-90-
settings (Subashkumar et al. 2006). Finally, resistance to quinolones is possibly due to
over-prescription of this antimicrobial class in some locations (Sinha et al. 2004).
1.17. CONCLUSIONS
With the advent of molecular methods, the taxonomy of aeromonads has progressed
considerably in the last two decades. The nomenclature issues, a conflict that has
besieged bacteriologists for some time, could be simply resolved by acknowledging
both senior and junior nomenclature in final reports. For example, any isolate identified
as A. caviae or A. trota should be reported as A. punctata (jun. syn. A. caviae), and A.
enteropelogenes (jun. syn. A. trota), respectively. In this way, all nomenclatures would
be simultaneously recognized without compromising clinical information. More than
100 cases of Aeromonas infections involving both immunocompromised and
immunocompetent individuals of all age groups have been published since 1999
(Chopra and Houston 1999b; Figueras 2005). This continuously growing evidence
supports the notion that Aeromonas can no longer be considered merely opportunistic
pathogens despite the failure to reproduce disease in an animal model.
Despite these drawbacks, evidence strongly suggests that infections caused by

Aeromonas may be strain dependent and that some species may contain more virulent
strains than others. This is perhaps the most important concept associated with
Aeromonas pathogenicity in the long history of the genus. Thus, unlike other recognized
and well-established pathogens such as S. pyogenes or S. Typhi where every strain can
cause infection and a disease state, in Aeromonas only certain strains appear to do so.
This is particularly evident in A. caviae and its association with infant gastroenteritis,
which suggests that this species should be considered a human pathogen. Figueras
(2005) stated that the use of commercial identification systems incorrectly contributed
to the establishment of A. hydrophila as the cause of most cases of infections involving
Aeromonas. This is consistent with data from recent studies which reveal that A.
hydrophila is not one of the most predominant species when identification of isolates is
based on molecular methods, and that the prevalence of other species is beginning to
emerge (Aravena-Román et al. 2011b; Puthucheary et al. 2012). Data from future
surveys will determine more accurately the real prevalence of pathogenic species, and
Aeromonas species in general, if genotypic methods are used in the identification of
these organisms. In contrast, in the aquaculture industry, Aeromonas species are
-91-
recognized bona fide pathogens of many fish species, as supported by the blue gourami
and zebrafish models of infection and every effort is made to prevent or decrease the
impact of these organisms by the fish industry.
Definitive identification of these organisms should be confined to those isolates deemed

to be significant or the source of an outbreak, while isolates not fitting these criteria
should be reported to genus level only (Abbott et al. 2003; Figueras 2005). Genotypic
identification allows detection of infrequently isolated Aeromonas species and
molecular sequences of several housekeeping genes of strains representing all type and
many reference strains have been deposited in GenBank. The case described by Fontes
et al. (2010) provided the perfect example of how an Aeromonas species that had not
been isolated since its original description was found within five years of its discovery.
In 2004, Harf-Monteil et al. proposed A. simiae based on two strains isolated from the
faeces of healthy monkeys. Fontes et al. (2010) isolated this species from a pig sample
while determining the prevalence of Aeromonas in pig slaughterhouses in Portugal. The
isolate was identified on the basis of 16s rRNA, gyrB and rpoD sequencing.
Janda and Duffey (1988) recommended that identification of mesophilic aeromonads

must become more standardised before meaningful comparisons can be made between
studies carried out at a various locations throughout the world. This remains an
important recommendation and ideally, a set of guidelines that include selected
phenotypic and genotypic tests, standard incubation conditions and media should be
globally adopted. Moreover, primers and testing conditions should be adhered to
eliminate or keep laboratory variations to a minimum (Ørmen et al. 2005).
Thornley et al. (1997) stated that from a diagnostic point of view, it would be highly
desirable to be able to recognize pathogenic strains of Aeromonas from non-pathogenic
ones, an idealistic concept that, at the present time, is not yet feasible. This statement is
supported by a recommendation to establish a collection of well-defined strains
representing all known clinically relevant Aeromonas species including strains of
known pathogenicity in different animal models (Janda and Abbott 2010). This
recommendation merits consideration and should be supported.
Finally, the ubiquitous nature of aeromonads, the widespread presence of virulence

factors and antimicrobial resistance genes, and the potential for severe symptoms to
occur, reinforce the notion that aeromonads recovered from human clinical material
-92-
should be treated as potential pathogens. This is particularly relevant in
immunocompromised individuals and those at extreme ages. At the present time, the
significance of Aeromonas species isolated from human specimens can only be assessed
on clinical grounds.
-93-
-94-
CHAPTER 2: MATERIALS AND METHODS
2.1. MATERIALS
2.1.1. Chemicals and reagents
All standard laboratory chemicals and reagents and their suppliers are listed in Table
2.1.
2.1.2. Solutions
Sterile distilled water and physiological saline (0.85% NaCl) solutions were obtained
from Excel (Perth, Australia). Ultrapure distilled water used in the preparation of PCR
master mixtures was obtained from Fisher-Biotec (Perth, Australia). Deionized water
was prepared in-house by the Hepatitis Laboratory, PathWest, Nedlands, using a MilliQ
filter system (Millipore ®, Australia).
2.1.2.1. DepC-treated water

Four hundred microlitres of a 0.1 % (v/v) diethyl pyrocarbonate (depC) solution was
added to 400 ml high purity water, stirred and incubated o/v at 37C. The mixture was
then autoclaved at 15 psi for 60 min.
2.1.2.2. Ethidium bromide (10 mg/ml)

One gram of ethidium bromide was added to 100 ml of water and stir for several hours
until dissolved. The bottle containing the solution was wrapped in aluminium foil and
kept in stored at 2 to 8C.
2.1.2.3. Chemical lysis stock solution

This solution was used to extract DNA and was prepared in-house by staff from the
PCR Laboratory (PathWest, Nedlands). The solution consisted of 50 ml 0.5M NaOH;
12.5 ml 10% SDS and 437.5 ml high pure water and was stored in 50 l aliquots at
room temperature.
2.1.2.4. HCCA matrix solution

The HCCA solution was prepared fresh by mixing 475 l of UPW, 500 l ACN and 25
l of 100% TFA in an Eppendorf tube and thoroughly vortex to produce a volume of 1
ml.
2.1.3. Bacteriological media
-95-
Bacteriological media used in this study were manufactured by Excel, Perth (Australia)
and are listed in Table 2.2.
2.1.4. Gas chromatography

All gases used in the detection of FAMEs were obtained from BOC (Victoria,
Australia) and included instrumental air, and ultra high purity (99.999% purity)
hydrogen and nitrogen.
2.1.5. Antimicrobials
Antimicrobial used in this study and their suppliers are listed in Table 2.3.
2.1.6. Bacterial strains

Reference and type strains including culture collection designation and provider are
listed in Table 2.4. Strains used as positive and negative controls in biochemical tests
are listed in Table 2.5. Clinical and environmental isolates used in this research
including location and source of isolation are listed in Tables 2.6 and 2.7, respectively.
Clinical isolates were collected from 1988 to 2008 while environmental isolates were
collected from 1998 to 2008 from rural and metropolitan regions of Western Australia,
the largest state in Australia covering an area of 2.5 Km2.
Isolates used in virulence studies were collected between 2002 and 2008 and were
isolated from rural and metropolitan areas of Western Australia. Clinical isolates were
collected from 46 males and 43 females while the gender of 9 patients was not
available. The age of the patients ranged from 5 months to 89 years. Isolates used in
virulence studies were randomly selected which were previously identified by extensive
conventional biochemical testing and a selection of genotypic targets namely 16S rRNA
and housekeeping genes sequences.
2.1.7. Primers
Primers used in this research are listed in Table 2.8. All primers were manufactured by
Fisher Biotec (Perth, Australia).
-96-
Table 2.1 Chemicals and reagents used in this project
Chemical/Reagent Supplier
Acetonitrile Bruker Daltonik

Adonitol Sigma
Agarose Scientifix
Amygdalin Sigma
Andrade’s indicator Sigma
L-arabinose Sigma
Bovine serum albumin Sigma
PE buffer II Applied Biosystems
Cellobiose Sigma
Clinitest tablet Bayer Diagnostics
p- dimethylaminocinnamaldehyde Sigma-Aldrich
Deoxynucleoside triphosphate Applied Biosystems
Diethyl pyrocarbonate Sigma
Ethanol (HPLC grade) BDH
Ethidium bromide Sigma-Aldrich
10% Ferric chloride aq. soln. Excel
Ferrous ammonium sulphate (1% w/v aq. soln.) Excel
Formic acid Bruker
Glucose Sigma
Glucose-1-phosphate Sigma
Glucose-6-phosphate Sigma
Glycerol Sigma
Hydrochloric acid (HCl) (6N) Mallinkrodt
Hexane (HPLC grade) Merck
Hydrogen peroxide Ajax Finechem
m-Inositol Sigma
Indole (Spot) Excel
Indole (Kovacs’) Excel
DL-lactate Excel
Lactose Sigma
Lactulose Sigma
-97-
Chemical/Reagent Supplier
Lugol’s iodine Amber Scientific

Magnesium chloride (MgCl2) Applied Biosystems
Maltose Sigma
D-mannitol Sigma
D-mannose Sigma
Melibiose Sigma
Methanol (HPLC grade) Merck
-Methyl-D-glucoside Sigma
Methyl-tert butyl ether (HPLC grade) Mallinkrodt
-Nitrophenyl--D-galactopyranoside Rosco
Pyrrolidonyl--naphthalimadase Remel
Raffinose Sigma
L-rhamnose Sigma
Salicin Sigma
Sodium dodecyl sulfate Bio-Rad
Sodium hydroxide pellets (NaOH) (ACS grade) Merck
Sodium hydroxide (bacterial lysis solution) Thermal Fisher
D-sorbitol Sigma
Sucrose Sigma
Taq polymerase Applied Biosystems
Tetramethyl-p-phenylenediamine dihydrochloride Becton Dickinson
Trifluoroacetic acid Bruker Daltonik
Voges-Proskauer reagent1 Excel
Voges-Proskauer reagent2 Excel
-98-
Table 2.2 Bacteriological media used in this project
Media Supplier
acetate slant Excel

aesculin Excel
arginine broth Excel
citrate (Simmon’s) Excel
citrate (Hänninen’s) Excel
CLED agar Excel
CNA agar Excel
enriched lauryl sulphate agar (50 mm) Excel
DNA agar Excel
gelatine cysteine thiosulfate Excel
gelatine Excel
gluconate Excel
heart infusion agar Excel
heart infusion broth Excel
horse blood agar Excel
Jordan’s tartrate Excel
DL-lactate Excel
lipase Excel
lysine broth Excel
malonate Excel
motility medium Excel
Mueller-Hinton agar Excel
nutrient agar Excel
nutrient agar plus heat-killed S. aureus cells Excel
nutrient agar plus 0.2 % NaCl and 0.1% SDS Excel
nutrient agar plus 0.33% w/v elastin Excel
NaCl broth (0 and 3%) Excel
ornithine broth Excel
peptone water Excel
peptone water (¼ strength) Excel
-99-
Media Supplier
phenylalanine deaminase Excel

pyrazinamidase slants Excel
sheep blood agar Excel
sterile distilled water Excel
sterile saline (0.85% NaCl) Excel
starch agar Excel
trypicase soy broth Excel
TSBA agar Excel
tyrosine Excel
urea (Christensen’s) Excel
urocanic acid Excel
VP medium Excel
-100-
Table 2.3 Antimicrobial agents used in this project
Antimicrobial Supplier
amikacin Sigma
amoxicillin GlaxoSmithKline
amoxicillin-clavulanate GlaxoSmithKline
ampicillin (E-strip) BioMérieux
aztreonam Bristol-Myers Squibb
cefazolin Sigma
cefepime OmegaPharm
cefoxitin Sigma
ceftazidime Sigma
ceftriaxone Sigma
cephalothin Sigma
ciprofloxacin MP Biomedicals
colistin sulphate (polymyxin E) Fluka
colistin sulphate (polymyxin E) (E-strip) BioMérieux
deferoxamine Rosco
2,4-diamino-6,7-diisopropylpteridine Oxoid
doxycycline AB Biodisk
gentamicin Pfizer
meropenem (E-strip) BioMérieux
meropenem AstraZeneca
moxifloxacin Bayer
nalidixic acid Fluka
nitrofurantoin Sigma
norfloxacin Sigma
pipercillin-tazobactam Sigma
tetracycline MP Biomedicals
ticarcillin-clavulanate GlaxoSmithKline
tigecycline (E-strip) BioMérieux
tobramycin MP Biomedicals
trimethoprim MP Biomedicals
sulfamethoxazole Sigma
-101-
Table 2.4 Type and reference strains used in this project
Species Strain no. Other designation(s)
A. allosaccharophila ATCC 51208T CECT 4199T, LMG 14059T, CCUG 31218T

A. dhakensis* CECT 7289T DSM 18362T
A. australiensis CECT 8023T LMG 26707T
A. bestiarum ATCC 51108T CDC 9533-76T, CECT 4227T, LMG 13444T, Popoff 218T
A. bivalvium CECT 7113T LMG 23376T
A. caviae ATCC 15468T CECT 838T, LMG 3775T, Popoff 545T
A. caviae ATCC 13136T CECT 4226T, Popoff 267T
A. culicicola CECT 5761T MTCC 3249T, DSM 17676T, CIP 107763T
A. diversa CECT 4254T ATCC 43946T, CDC 2478-85T; LMG 17321T
A. encheleia DSM 11577T CECT 4342T, ATCC 51929T, NCIMB 13442T, LMG 16330T
A. eucrenophila ATCC 23309T CECT 4224T, LMG 3774T, NCIMB 74T, Popoff 546T
A. fluvialis CECT 7401T LMG 24681T
*Previously classified as A. aquariorum
-102-
A. hydrophila subsp. hydrophila ATCC7966T CECT 839T, DSM 30187T, Popoff 543T
A. hydrophila subsp. dhakensis LMG 19562T CCUG 45377T, DSM 17689T
A. hydrophila subsp. ranae LMG 19707T CCUG 46211T, DSM 17695T
A. jandaei ATCC 49568T CECT 4228T, A1642T, LMG 12221T
A. media ATCC 33907T CECT 4232T, LMG 9073T, NCIMB 2237T
A. molluscorum DSM 17090T CECT 5864T, LMG 22214T
A. piscicola CECT 7443T LMG 24783T
A. popoffii CIP 105493T CECT 5176T, LMG 17541T, CCUG 39350T, ATCC BAA-243
A. rivuli CECT 7518T DSM 22539T
A. salmonicida spp. salmonicida CECT 894T ATCC 33658T, CIP 103209T, LMG 3780T
A. salmonicida ssp. achromogenes CECT 895T ATCC 33659T, LMG 14900T, NCIMB 1110T
A. salmonicida ssp. masoucida CECT 896T ATCC 27013T, CIP 103210T, LMG 3782T
A. salmonicida ssp. pectinolytica DSM 12609T 34 melT
-103-
T
A. salmonicida ssp. smithia CIP 104757NCIM ATCC 49393T, CECT 5179T
A. sanarellii CECT 7402T CIP 110203T, LMG 24682T
A. schubertii ATCC 43700T CECT 4240T, LMG 9074T, CDC 2446-81T
A. simiae DSM 16559T CIP 107798T, CCUG 47378T
A. sobria CIP 7433T CECT 4245T, Popoff 208T, ATCC 43979T, LMG 3783T, CDC 9538-76T
A. sobria CDC 9540-76 LMG 13469
T
A. taiwanensis CECT 7403 LMG 24683T
A. tecta CECT 7082T DSM 17300T
A. trota ATCC 49657T CECT 4255T, A1646T, LMG 12223T
A. veronii biovar sobria ATCC 9071 CECT 4246, NCIMB 37, LMG 3785
A. veronii biovar veronii DSM 7386T ATCC 35624T, CECT 4257T
Aeromonas spp. HG11 CECT 4253 ATCC 35941, NCIMB 13014
-104-
Table 2.5 Type and reference strains used as positive and negative controls
Species Designation
Aeromonas hydrophila ATCC 7966T

Bacillus subtilis ATCC 6633
Moraxella catarrhalis ATCC 25238T
Corynebacterium xerosis ATCC 9016
Enterococcus faecalis ATCC 29212
Escherichia coli ATCC 25922
Escherichia coli K12
Klebsiella pneumoniae ATCC 700603
Proteus mirabilis ATCC 12453
Proteus vulgaris NCTC 4635
Pseudomonas aeruginosa PA01
Pseudomonas aeruginosa ATCC 27853
Salmonella paratyphi ATCC 9150
Staphylococcus aureus ATCC 25923
Streptococcus agalactiae ATCC 12386
Vibrio parahaemolyticus ATCC 43996
Yersinia enterocolitica ATCC 27729
-105-
Table 2.6 Clinical strains used in this project
Strain Source Location Strain Source Location Strain Source Location
21 Unknown PMH 75 Blood SCGH 102 Stool SCGH

23 Wound PMH 77 Wound Rockingham 103 Stool Carnarvon
24 Wound PMH 78 CAPD fluid SCGH 104 Wound Derby
25 Shunt PMH 79 Wound Albany 105 Stool SCGH
26 Unknown PMH 80 Blood Rockingham 106 Blood SDH
27 Appendix PMH 81 Blood SCGH 107 Wound Carnarvon
28 Stool SCHG 83 Sputum SCGH 108 Stool Armadale
47 Sputum SCHG 84 Blood SDH 109 Blood Armadale
56 Bone chips Mandurah 85 Blood SCGH 110 Blood SCGH
57 Blood SCGH 86 Wound Pinjarra 111 Blood SCGH
58 Blood SCGH 87 Blood Kalgoorlie 112 Wound SCGH
59 Blood SCGH 88 Wound SCGH 113 Drain fluid SCGH
60 Blood SDH 89 Bile SCGH 114 Stool Armadale
61 Biliary stent SCGH 90 Wound SCGH 115 Stool Albany
62 T-tube tip SCGH 91 Wound Geraldton 116 Wound Armadale
65 Blood SCGH 92 Cyst SCGH 117 Wound Armadale
66 Wound SCGH 93 Urine Newman 118 Sputum SCGH
67 Wound Armadale 94 Stool Narrogin 120 Stool Armadale
68 Blood SCGH 95 Wound SDH 121 Wound SDH
-106-
Table 2.6 Continue.
69 Wound Busselton 96 Blood SCGH 123 Abscess SCGH

70 Blood Armadale 97 Stool SCGH 124 Wound Geraldton
71 Wound Collie 98 Pus Armadale 125 Blood Port Hedland
72 Blood Bunbury 99 Stool SCGH 126 Wound Kununurra
73 Wound SCGH 100 Stool SDH 127 Wound Collie
74 Wound SCGH 101 Ulcer Collie 128 Wound Byford
129 Wound Geraldton 156 Stool PMH 187 Stool Margaret River
130 Wound Armadale 158 Stool Denmark 188 Bile SCGH
131 Blood Armadale 159 Wound Exmouth 189 Stool Halls Creek
133 Mortuary SCGH 163 Wound Busselton 190 Wound Manjimup
134 Ear Newman 164 Sputum SCGH 200 Blood PMH
135 Blood Carnarvon 165 Unknown Norseman 211 Ear Bridgetown
136 Stool Busselton 166 Stool Bassendean 212 Wound Newman
137 Stool SCGH 167 Wound Busselton 213 Wound Boddington
138 Trachea SCGH 168 Wound SCGH 214 Faeces Northam
139 Stool SDH 169 Stool Stirling 215 Faeces Swan View
-107-
140 Peritoneal fluid SCGH 171 Sputum SCGH 216 Faeces Katanning
141 Toe nail Exmouth 172 Urine Newman 217 Faeces Osborne Park
142 Stool PMH 174 Wound Exmouth 218 Blood PMH
143 Burn PMH 175 Stool Armadale 219 Faeces Watheroo
144 Blister FH 176 Wound SCGH 220 Wound P. Hedland
145 Blood FH 177 Wound SCGH 221 Blood SCGH
146 Wound FH 178 Bile SCGH 269 Blood SCGH
147 Burn PMH 179 Stool Unknown 270 Wound Tom Price
148 Ulcer FH 180 Stool Manjimup 278 Wound Derby
149 Blood FH 181 Stool SCGH 279 Wound Derby
150 Tissue FH 182 Wound Collie
151 Blood FH 183 Stool Boddington
152 Blood FH 184 Stool SDH
153 Stool Collie 185 Wound SCGH
154 Blood Collie 186 Wound Derby
-108-
Table 2.7 Environmental strains used in this project
Strain Source Location Strain Source Location
29 Mullet fish PathWest 241 Water Unknown

30 Barramundi ADWA 242 Water Unknown
31 Gourami ADWA 243 Water Unknown
32 Fish ADWA 244 Water Unknown
33 Koi ADWA 245 Water Unknown
34 Fish ADWA 246 Water Unknown
35 Fish lesion ADWA 247 Water Unknown
199 Crab Carnarvon 250 Water Unknown
222 Chorinated water Serpentine supply MWA 251 Water Unknown
223 Water Unknown 252 Water Unknown
224 Borewater Wanneroo 253 Water Unknown
225 Reservoir raw South Dandalup 254 Water Unknown
226 Water Nollamusa 255 Water Unknown
227 Reservoir raw North Dandalup 256 Water Unknown
-109-
Strain Source Location Strain Source Location
228 Treated water Salter Point 257 Water Unknown

229 Treated water Applecross 258 Irrigation water Unknown
230 Water MWA John Walliston 259 Water Unknown
231 Scheme water City of Melville 260 Water Unknown
232 Water Thompson reservoir 261 Irrigation water Unknown
233 Water Unknown 262 Water Unknown
234 Reticulation Mundijong 263 Irrigation water Unknown
235 Water Unknown 264 Irrigation water Unknown
237 Water Unknown 266 Irrigation water Dalwallinu
238 Water Unknown 267 Irrigation Water Unknown
240 Water Unknown
-110-
Table 2.8 Primers used in this project
Gene Primer sequence (5’ → 3’) Product size Reference
(bp)
gyrB 7F: GGGGTCTACTGCTTCACCAA 960 - 1100 Yañez et al. (2003)

14R: TTGTCCGGGTTGTACTCGTC
rpoD 70Fs: ACGACTGACCCGGTACGCATGTA 820 Soler et al. (2004)

70Rs: ATAGAAATAACCAGACGTAAGTT
aerA/haem F: CCTATGGCCTGAGCGAGAAG 431 Soler et al. (2002)

R: CCAGTTCCAGTCCCACCACT
aexT F: GGCGCTTGGGCTCTACAC 535 Braun et al. (2002)

R: GAGCCCGCGCATCTTCAG
alt F: AAAGCGTCTGACAGCGAAGT 320 Aguilera-Arreola et al. (2005)

R: AGCGCATAGGCGTTCTCTT
ascV F: ATGGACGGCGCCATGAAGTT 710 Chacón et al. (2004)

R: TATTCGCCTTCACCCATCCC
aspA F: CACCGAAGTATTGGGTCAGG 350 Soler et al. (2002)

R: GGCTCATGCGTAACTCTGGT
ast F: ATCGTCAGCGACAGCTTCTT 504 Aguilera-Arreola et al. (2005)

R: CTCATCCCTTGGCTTGTTGT
-111-
Gene Primer sequence (5’ → 3’) Product size Reference
(bp)
BfpA F: CCGCAGGTGTGATGTTTTAC 251 Sechi et al. (2002)

R: TGCGGTGTTATTGTTTGCT
BfpG F: ATGCCAAAGCTGACTGGTCT 233 Sechi et al. (2002)

R: GACATGATTCCCGTTATAAA
flaA F: TCCAACCGTYTGACCTC 608 Sen and Rodgers (2004)

R: GMYTGGTTGCGRATGGT
lafA F: CCAACTT(T/C)GC(C/T)TC(T/C)(C/A)TGACC 737 Aguilera-Arreola et al.

R: TCTTGGTCAT(G/A)TTGGTGCT(C/T) (2005)
stx-1 F: ATAAATTGCCATTCGTTGACTAC 180 Paton and Paton (1998)

R: AGAACGCCCACTGAGATCATC
stx-2 F: GGCACTGCTTGAAACTGCTCC 255 Paton and Paton (1998)

R: TCGCCAGTTATCTGACATTCTG
vasH F: CTCTAGACCGGTGAACCCATCAAGCGCGTCCACT 1652 Suarez et al. (2008)

R: TCCCCCCGGGCTGGTGGCCAGCAGCAGAGGCAATA
-112-
Table 2.9 Aeromonas strains used in virulence studies
Species No. of Source Strain number

strains
A. allosaccharophila 1 Stool 100
A. dhakensis 31 Wound 67, 71, 73, 79, 91, 95, 104, 107, 141,
176, 220, 279
Blood 60, 70, 154
Stool 169, 180, 183,
Sputum 47
Fish 31, 32
Bone chips 56
Urine 93
Water 223, 229, 230, 235, 241, 242, 256, 257
A. australiensis 1 Irrigation water 266
A. bestiarum 1 Blood 68
A. caviae 27 Wound 143, 163, 270
Blood 57, 58, 65, 75, 80, 96, 106, 109, 110, 200
T-tube tip 62
Stool 94, 102, 103, 156, 158, 187, 216
CAPD fluid 78
Bile 178, 188
Peritoneal fluid 140
Water 264
Fish 30
A. hydrophila 29 Wound 23, 69, 90, 98, 101, 112, 117, 126, 128,
148
Blood 59, 84, 149, 151, 152
Stool 133
Biliary stent 61
Fish 34
Sputum 83, 118
Drain fluid 113
Bile 89
Tissue 150
Water 231, 243, 245, 260, 261,
Pancreas cyst 92
A. jandaei 3 Fish 35
Water 253, 262
- 113 -
Species No. of Source Strain number

strains
A. media 2 Blood 85
Stool 179
A. salmonicida 2 Wound 190

Crab 199
A. schubertii 1 Wound 186
A. veronii bv. sobria 31 Wound 24, 66, 129, 147, 174,
Blood 72, 81, 111, 125, 131, 218, 221, 269
Stool 99, 137, 166, 184, 189, 215, 219
Shunt 25
Appendix 27
Sputum 171
Fish 33
Water 224, 237, 247, 254, 259, 265, 268
Total 129
-- 114 --
2.2. METHODS
2.2.1. Bacterial culture methods
All isolates were stored at 70C in 5% serum-glycerol medium. Working cultures for
identification purposes were subcultured onto HBA and incubated at 35C in air.
Isolates were subcultured three times before they were used for biochemical testing.
Working cultures for antimicrobial susceptibility testing and detection of virulence
genes were subcultured onto HBA only once and incubated at 35C. Broth cultures
were prepared by inoculating one single colony into a 10 ml TSB or HIB tube followed
by o/v at 35C without shaking.
2.2.2. Acid production from carbohydrates
Carbohydrates used in this project are listed in Table 2.1. Carbohydrate fermentation
reactions were performed in a peptone water base (Oxoid, Basingstoke, UK) containing
1% (w/v) of the desired sugar and 1% (v/v) Andrade’s indicator. Sugars were obtained
from Sigma (St. Louis, Mo. USA). Carbohydrate-containing broths were inoculated
with a drop from an overnight culture and incubated at 35C in air for up to seven days.
A change in the colour of the broth from blue to yellow denoted acid production
2.2.3. Hydrolysis of aesculin
Aesculin hydrolysis was determined by inoculating a broth containing aesculin that was
incubated at 35C for up to seven days in air. A blackening of the broth was considered
a positive reaction (Cowan and Steel 1993).
Positive control: Enterococcus faecalis ATCC 29212
Negative control: Streptococcus agalactiae ATCC 12386
2.2.4. Alkylsulfatase activity
Alkylsulfatase activity was determined by spot inoculating a nutrient agar plate

containing 0.2% NaCl and 0.1% SDS with an overnight culture. The plate was
incubated in air at 35ºC for up to seven days. A turbid halo surrounding the growth was
indicative of alkylsulfatase activity (Abbott et al. 2003).
-- 115 --
2.2.5. Detection of a CAMP-like factor
Detection of a CAMP-like factor was determined by inoculating two sheep blood agar
plates with a single, diametric streak of S. aureus ATCC 25923 (-toxin-producing
strain). Tests strains were streak-inoculated at right-angles to but not touching the
staphylococcal inoculum. The plates were incubated aerobically and anaerobically at
35C overnight. A positive result was indicated by production and diffusion of a
completely clear area shaped like an arrow head in the zone of discolouration caused by
the -toxin (Figura and Guglielmetti 1987).
Positive control: Streptococcus agalactiae ATCC 12386
Negative control: Enterococcus faecalis ATCC 29212
2.2.6. Catalase activity
Catalase activity was determined by emulsifying a 24 colony grown in nutrient agar, in

3% hydrogen peroxide on a glass slide and observing for gas production (MacFaddin
1976). Immediate bubbling was considered a positive reaction (Cowan and Steel 1993).
Positive control: Staphylococcus aureus ATCC 25923
Negative control: Streptococcus pyogenes ATCC 19615
2.2.7. DNase activity
DNase activity was determined by inoculating a plate containing 0.2% DNA and 0.01%
Toluidine Blue O with an overnight culture that was incubated at 35ºC for up to 7 days.
A clear pink zone around the inoculum indicated the production of extracellular
deoxyribonuclease (Schreier 1969).
Positive control: Moraxella catarrhalis ATCC 25238
Negative control: Escherichia coli ATCC 25922
2.2.8. Elastase activity
Elastase activity was determined by spot inoculating a plate containing 0.33% (w/v)
elastin with an overnight culture that was incubated in air at 35ºC for two days. If no
clear zone was detected after 48 h incubation which indicated a positive reaction, the
-- 116 --
plates were further incubated at room temperature for up to seven days (Rust et al.
1994).
Negative Control: Escherichia coli K12
Positive Control: Pseudomonas aeruginosa PAO1
2.2.9. Gas from glucose
A broth containing 1% glucose and fitted with a Durham tube was inoculated with a
drop from an overnight broth culture and incubated in air at 35ºC for 24 h. When gas
was produced it was trapped at the top of the Durham tube forming a bubble. Glucose
was fermented when the broth turned from green to yellow after overnight incubation
2.2.10. Gelatin hydrolysis
Gelatin hydrolysis was determined by inoculating tubes containing gelatin with a heavy
inoculum from an overnight culture. Tubes were incubated at 35C in air for up to seven
days. Gelatin hydrolysis was indicated by the development of a pink to red colour
(Pickett et al. 1991).
2.2.11. Oxidation of potassium gluconate
Oxidation of potassium gluconate was determined by inoculating a tube containing

gluconic acid with a drop from an overnight culture. Tubes were incubated at 35C for
48 h. After the incubation period a Clinitest tablet (Bayer Diagnostics, Bridgend, UK)
was added. A positive reaction was denoted by a light-green to rusty-yellow colour. A
negative reaction was indicated by a deep blue colour (Pickett and Pedersen 1970).
2.2.12. Ability to grow on TCBS medium
A TCBS plate was inoculated with a drop from a HIB broth and incubated in air at 35C
for 24 h (Bailey and Scott’s 1994). Any growth was considered a positive result.
Positive control: V. parahaemolyticus ATCC 43996
-- 117 --
2.2.13. -Haemolysis activity
-haemolytic activity was determined by streaking a portion of a 5% (v/v) sheep blood

agar plate and incubating at 35ºC overnight in air. Clearing around the inoculum was
evidence of red cell haemolysis (Bailey and Scott’s 1994).
2.2.14. Production of hydrogen sulfide from cysteine
The medium designed by Veron and Gasser (1963) was used to detect the production of
hydrogen sulfide from cysteine. Tubes were inoculated from an 18-24 h TSA culture
and then incubate at 35ºC for up to seven days in air. A positive reaction was indicated
by a diffuse blackening of the medium radiating from the stab line.
2.2.15. Production of indole from tryptophan
2.2.15.1. Rapid spot indole method

A portion of a colony was spread onto a filter impregnated with p-
dimethylaminocinnamaldehyde and incubated at room temperature for 2 min. A blue
colour indicated a positive result (MacFaddin 1976).
2.2.15.2. Kovacs’method
A peptone water broth was inoculated with a drop from an overnight culture and
incubated at 35C for 48 h. A drop of Kovacs’ reagent was added and the tube shaked
slightly. The development of a red colour denoted a positive reaction (Cowan and Steel
1993).
Positive control: Escherichia coli ATCC 25922
Negative control: Klebsiella pneumoniae ATCC 700603
2.2.16. Jordan’s Tartrate test
A well-isolated colony from a pure, 18-24 h culture growing on HBA was stabbed
deeply to about one-fourth inch from the bottom of the tube. Tubes were incubated
aerobically, with caps loosened, at 35ºC for up to 72 h in air (Edwards and Ewing
1972). A positive result occurred when a yellow colour developed in the lower portion
-- 118 --
of the tube while the surface zone remained red. Negative test: no colour change; the
medium remained alkaline with a red colour throughout the tube.
Positive Control: Escherichia coli ATCC 25922
Negative Control: Salmonella paratyphi ATCC 9150
2.2.17. Lipase activity
Lipase activity was determined by using corn oil as substrate based on the recipe by
Hugo and Beveridge (1962). Using a young agar HIA slant culture as a source of
inoculum, a line of inoculation was made from the bottom to the top of the slant. The
tubes were incubated at 35ºC in air and observed daily for seven days. Positive reactions
were indicated by the development of a dark blue colour in the medium, in the growth
or both.
2.2.18. Utilization of malonate
Utilization of malonate was determined by inoculating a broth containing malonate with

an overnight culture that was incubated at 35C in air for up to two days. A blue colour
indicated a positive reaction (Cowan and Steel 1993).
Positive control: Klebsiella pneumoniae ATCC 700603
2.2.19. Amino acid degradation
The Moeller’s method was used to determine lysine and ornithine decarboxylase and
arginine dehydrolase activity. Tubes containing these amino acids and a control tube
without any amino acid were inoculated with an overnight broth culture grown at 35C
without shaking, sealed with paraffin oil and incubated for up to four days before
discarding. The media first became yellow due to acid production from the glucose;
later, if decarboxylation or dehydroxylation occurred, the medium became purple
indicating a positive reaction. The control tube remained yellow (Cowan and Steel
1993).
Negative control: Proteus vulgaris NCTC 4635
Positive control: Aeromonas hydrophila ATCC 7699
-- 119 --
2.2.20. Motility
2.2.20.1. Wet mount method

A drop from a trypticase soy broth incubated o/v at 35C was placed onto a clean glass
slide, covered and observed under phase contrast. Displacement of the bacterial cells in
the medium was considered a positive reaction (Cowan and Steel 1993).
2.2.20.2. Motility medium method

Motility was determined by inoculating motility medium by slightly stabbing the
surface of the agar to a depth no greater than 5 –7 mm. The tube was incubated for up to
seven days before discarding. Growth radiating away from the site of inoculum and
spreading throughout the tube was indicative of motility (Cowan and Steel 1993).
Positive control: Pseudomonas aeruginosa ATCC 27853
Negative control: Klebsiella pneumoniae ATCC 700603
2.2.21. ONPG activity
Detection of the enzyme -nitrophenyl--D-galactopyranoside was determined by

preparing a dense bacterial suspension (4 MacFarland) in 0.25 ml sterile saline. A
tablet containing the substrate (Rosco Diagnostics, Taastrup, Denmark) was added and
the tube sealed. After 4 h incubation at 35C in air, a positive reaction was indicated by
the development of a deep yellow colour as per manufacturer’s instructions (Rosco,
Taastrup, Denmark).
Positive control: Escherichia coli ATCC 25922
Negative control: Proteus mirabilis ATCC 12453
2.2.22. Oxidase activity
Oxidase activity was determined by rubbing a 24 colony onto the surface of a filter
paper impregnated with fresh tetramethyl-p-phenylenediamine dihydrochloride. The
appearance of a purple colour within 5 seconds denoted a positive reaction (Isenberg
1992).
Positive control: Pseudomonas aeruginosa ATCC 27853
-- 120 --
2.2.23. Phenylalanine deaminase activity
A slant containing the amino acid phenylalanine was inoculated with a colony from an
overnight culture and incubated at 35C for 24 h in air. After o/v incubation a few
drops of 0.2 ml 10% (aq. soln.) ferric chloride were added. A strong green colour that
developed within one minute was considered a positive reaction (Cowan and Steel
1993).
Positive control: Proteus mirabilis ATCC 12453
2.2.24. Pyrazinamidase activity
Tubes containing pyrazinamide were inoculated from an overnight culture and

incubated at 35ºC for two days in air. The slopes were flooded with freshly made 1%
(w/v) aqueous ferrous ammonium sulfate and examined for the presence of pyrazoic
acid. Positive pyrazinamidase activity was indicated by a pinkish rusty colour. Lack of
activity resulted in a colourless reaction after 15 minutes (Carnahan et al. 1990).
Negative control: Yersinia enterocolitica ATCC 27729
Positive control: Corynebacterium xerosis ATCC 9016
2.2.25. Pyrrolidonyl--naphthylamide activity
Commercially obtained filter paper discs were impregnated with L-pyrrolidonyl--

naphthylamide (Remel, Lenexa, KS, USA) which served as a substrate for the detection
of pyrrolidonyl arylamidase. A large colony from an 18-24 h culture was rubbed onto a
moisten disk with a sterile loop and allowed to incubate at room temperature for 2 min
before one drop of colour developer was added. A positive result was indicated by the
development of a pink to red colour within one minute of adding the colour developer.
Negative result showed cream, yellow, or no colour within one minute of adding colour
developer (Facklam et al. 1982).
Negative control: Streptococcus agalactiae ATCC 12386
Positive control: Enterococcus faecalis ATCC 29212
2.2.26. Salt tolerance
-- 121 --
Growth in 0 and 3% NaCl broths was determined by inoculating the tubes with a drop
from an o/v culture followed by incubation at 35ºC in air for up to seven days. A change
from clear to turbid indicated growth (Abbott et al. 2003).
2.2.27. Stapholysin activity
Bacteriolytic activity was determined by spot inoculating a plate containing heat-killed

cells of S. aureus ATCC 25923 with tests strains that were incubated for five days at
35ºC. A positive reaction was denoted as a clearing (lysis) of the opaque medium
around the inoculated aeromonads (Satta et al. 1977).
2.2.28. Hydrolysis of starch
Starch agar plates were spot inoculated with an o/v culture and incubated at 30C for
five days. Plates were flooded with Lugol’s iodine solution at the end of the incubation
period. A clear colourless zone around the inoculum indicated that starch was
hydrolysed (Cowan and Steel 1993).
Positive control: Bacillus subtilis ATCC 6633
2.2.29. Hydrolysis of tyrosine
Hydrolysis of tyrosine was determined by spot inoculating a plate containing 0.5% L-

tyrosine crystals in brain heart infusion agar. Plates were incubated at 35ºC in air for up
to seven days. Clearing around the zone of inoculum indicated that tyrosine was
hydrolysed (Abbott et al. 2003).
2.2.30. Urease activity
A urea agar slant (Christensen’s medium) was heavily inoculated with an overnight
culture and incubated at 35C for up to 7 days. Hydrolysis of urea was indicated by the
development of a pink to red colour (Cowan and Steel 1993).
Positive control: Proteus mirabilis ATCC 12453
-- 122 --
2.2.31. Utilization of DL-lactate, acetate and urocanic acid
The slants of tubes containing the appropriate substrate were inoculated with a heavy
inoculum from an o/v HBA with sterile loop. Growth and a bright blue colour indicated
a positive reaction. Tubes were incubated for four days before discarding (Hänninen
1994).
2.2.32. Utilization of citrate (Simmon’s method)
A plate containing citrate was spot inoculated from an o/v culture and incubated at 35C
in air and examined daily for seven days for growth and colour change. Growth and a
bright blue colour indicated a positive reaction (Cowan and Steel 1993).
2.2.33. Voges-Proskauer test
Acetylmethylcarbinol production (VP test) was determined by inoculating a semi-solid

medium with an o/v culture and incubated for three days at 35C in air. A positive
reaction indicating production of acetylmethylcarbinol was denoted by the development
of a red colour after addition of VP1 and VP2 reagents (Cowan and Steel 1993).
2.3. AMPLIFICATION OF gyrB AND rpoD GENES
2.3.1. Preparation of template DNA
DNA was extracted by the method of Coenye and LiPuma (2002) and used to amplify
genes involved in identification and virulence. Three to four large isolated colonies
grown from an overnight culture on HBA were suspended in 50 l of bacterial lysing
solution prepared in-house by the PCR Laboratory, PathWest (Nedlands) and heated at
100C for 15 min in a dry heating block. The suspension was then diluted with 950 l
of depC water and vortex followed by centrifugation for 5 min at 15000 g to pellet solid
material. This stock solution was kept at 70C. Working solution was prepared by
-- 123 --
diluting 20 l of the stock solution with 180 l of UPW (1:10) and kept at 4C during
testing.
2.3.2. Polymerase chain reaction (PCR)
Primers were diluted to a concentration of 500 M with UPW. Amplification of DNA

was performed by using 20 l of a PCR mixture containing 8 l of template DNA, 2 l
of 10x PE buffer II (Applied Biosystems, Calif. USA), 0.1 l of 2% BSA (0.01% final
concentration; Sigma, NSW, Australia), 2 l of a 25 mM MgCl2 solution (2.5 mM final
concentration; Applied Biosystems, California. USA), 0.16 l deoxynucleoside
triphosphate at 25 mM each (0.2 mM final concentration; (Applied Biosystems, Calif.
USA), 0.1 l of PE TaqGold at 5 U/l (0.75 U final concentration; Applied Biosystems,
Calif. USA); 0.008 l of a 500 mM solution of each primer (0.2 mM final
concentration; Fisher Biotec, Australia) and 7.624 l of UPW to make the final volume
of 12 l. The PCR mixture was prepared in a large volume to produce 200 tubes
(virulence genes) and 400 (gyrB and rpoD genes) tubes of 12 l each under a sterile,
class II bio-safety cabinet. Tubes containing all of the ingredients except the template
DNA were stored at 20C.
Amplification was carried out on a Gene Amp® PCR System 2720 thermal cycler
(Applied Biosystems). The protocol used for the gyrB and rpoD genes consisted of 1
cycle at 95C for 10 min (denaturation); 45 cycles of 94C for 30 s (melting); 55C for
30 s (annealing) and 72C for 1 min (elongation) and a final extension round at 72C for
7 min followed by cooling at 4C. The protocol for amplication of virulence genes was
similar except that the annealing temperature ranged from 50 to 65C appropriate for
each primer pair as reported by other researchers (Table 2.8) and a shorter elongation
time (72C for 45 s). Separation of amplicons and sequencing of the gyrB and rpoD
genes was performed by the staff of the PCR Laboratory (PathWest Nedlands). The
PCR amplicons were separated by electrophoresis using 2% agarose and visualized
using ethidium bromide.
2.3.3. DNA Sequencing
Purification of the PCR product preceded sequencing and was performed using
ExoSAP-IT (USB Corporation, Cleveland, USA) according to the manufacturer’s
-- 124 --
instructions, to remove excess dNTPs and oligonucleotide primers. The nucleotide
sequences on both strands of the DNA were determined with template-specific primers
using fluorescence-based cycle sequencing reactions (BigDye Terminator v3.1 Cycle
Sequencing Kit, AB, Foster City, USA). Cost-saving modifications to the
manufacturer’s protocol included reducing the reaction premix volume by 25% and
adding extra BigDye sequencing buffer to maintain volume. All incubation steps were
completed in thermal cyclers (AB2720 thermal cycler, AB, Foster City, USA).
Unincorporated dye terminators were removed from sequencing reactions using gel-
filtration following the manufacturer’s protocol (DyeEx 2.0 Spin Kit, Qiagen, GmbH,
Germany). The final product was heated for 5 mins at 94°C with 2× volume of
formamide (Hi-Di formamide, AB, Foster City, USA). Capillary electrophoresis was
performed on a 16-capillary genetic analyzer (3130xl Genetic Analyzer, AB, Foster
City, USA) using POP-6 separation matrix (AB, Foster City, USA).
The ChromasPro V1.41 was used to edit the sequence data. Forward and reverse
sequences of gyrB and rpoD genes were independently aligned using the Clustal_X
version 1.8 as described by Thompson et al. (1997) and accessed via BioEdit Sequence
Aligment Editor V7.0.5.2. Genetic distances were obtained using Kimura’s (1980) two-
parameter model and concatenated trees were constructed by the neighbour-joining
method of Saitou and Nei (1987) with the MEGA version 2 program devised by Kumar
et al. (2001). The Basic Local Alignment Search Tool (BLAST) was used to analyze
DNA homologies via the National Center for Biotechnology Information (NCBI) server
at the National Library of Medicine (Bethesda, MD, USA).
Evolutionary distances and sequence dissimilarity percentages were calculated using the
Clustal_W (Thompson et al. 1994) and MEGA version 5.05 software (Tamura et al.
2011). The rpoD and gyrB nucleotide sequences of type, reference and wild strains were
deposited in GenBank and accession numbers are listed in Tables 4.1 and 4.2,
respectively.
2.3.4. Detection of virulence gene products by Bioanalyzer
Following amplification, the PCR amplicons were separated by loading the tubes
containing the 20 l mixture in a QIAxcel analyzer (Qiagen, Hilden, Germany) using a
DNA Screening cartridge (Qiagen). A 4 l of an appropriate molecular size marker (QX
-- 125 --
Size Markers 50-800 bp or 15 to 2.5 kb, Qiagen) diluted with six l of QX DNA
dilution buffer (Qiagen) and a row of 12 tubes containing 15 l of a 15bp to 1Kb
alignment marker (Qiagen) sealed with one drop of paraffin oil was included in each
run. Detection of positive products was visualized as per the Qiagen program and
manual (Qiagen). Selected strains showing a product with a size expected for each gene
were sequenced as described in 2.3.3 and their sequences compared with those
deposited in GenBank using the Basic Local Alignment Search Tool (BLAST)
(Altschul et al. 1990).
2.4. METHODS USED IN THE CHARACTERIZATION OF AEROMONAS

AUSTRALIENSIS SP. NOV.
Strain 266T was isolated from an enriched lauryl sulphate agar (50 mm) plate after water
from a treated effluent used for irrigation at a sports-ground in the South-West of WA
was tested for total coliform count by membrane filtration. Initial phenotypic and
genotypic (rpoD and gyrB gene sequences) analyses, CFA profiles and MALDI-TOF
spectra determined from strain 266 were performed by the author. Cell size,
morphology and the presence of flagella were determined by electron microscopy
following procedures described previously (Collado et al. 2009). Electron micrographs
for strain 266 were prepared by Professor M. J. Figueras (Unitat de Microbilogia,
Department de Ciènces Mèdiques Básiques, Facultat de Medicina i Ciènces de la Salut,
IISPV, Universitat Rovira i Virgili, Reus Spain).
2.4.1. Phenotypic characterization
Biochemical and physiological tests used for the characterization of strain 266 T were
performed at 30 and 35C. All strains of type species belonging to the genus Aeromonas
were tested in parallel under identical conditions in laboratories in Australia by the
author and in Spain by Dr. R. Beaz-Hidalgo (Unitat de Microbilogia, Department de
Ciènces Mèdiques Básiques, Facultat de Medicina i Ciènces de la Salut, IISPV,
Universitat Rovira i Virgili, Reus Spain). A total of 36 phenotypic tests were selected
from those performed by Abbott et al. (2003) outlined in section 2.2 following the
procedure described by Alperi et al. (2010b). Strain 266T was tested for citrate
utilization by the method of Hänninen (1994) and Simmon’s (Cowan and Steel 1993);
oxidation of potassium gluconate, production of lipase, urease, Jordan’s tartrate,
-- 126 --
malonate utilization, phenylalanine deaminase (PPA) activity, nitrate reduction
(MacFaddin 1976) and bacteriolytic activity (expression of stapholysin) (Satta et al.
1977).
Acid production from carbohydrate was performed in broth at a final concentration of

1% (w/v) of the desired sugar and 1% (v/v) Andrade’s indicator (Excel, Perth,
Australia) as well as by the method described in Alperi et al. (2010b). The following
carbohydrates were used: adonitol, amygdalin, L-arabinose, cellobiose, dulcitol,
fructose, galactose, glucose, glucose-1-phosphate, glucose-6-phosphate, glycerol, myo-
inositol, lactose, lactulose, maltose, mannose, D-mannitol, melibiose, -methyl-D-
glucoside, raffinose, L-rhamnose, ribose, salicin, D-sorbitol, saccharose (sucrose), and
trehalose. Additional carbohydrate fermentation was investigated with the API 20E and
API CH50 systems (bioMérieux, Marcy l’Etoile, France).
Ability to grow at different temperatures was assayed on TSA supplemented with sheep
blood at 4, 25, 30, 35 and 44C. Acid production from carbohydrates, hydrolysis of
aesculin, urea, DNA and production of hydrogen sulphide from cysteine were observed
for seven days. Other tests were read as described by Abbott et al. (2003). Appropriate
positive and negative controls were included.
2.4.2. Antimicrobial susceptibility testing
The antimicrobial susceptibility of strain 266T was determined by the agar dilution
method according to CLSI standards (CLSI 2011). Antimicrobial agents used in this
project included the following: amikacin, amoxicillin, amoxicillin-clavulanate,
aztreonam, cephalothin, cefazolin, cefepime, cefoxitin, ceftazidime, ceftriaxone,
ciprofloxacin, colistin, gentamicin, meropenem, moxifloxacin, nalidixic acid,
nitrofurantoin, norfloxacin, pipercillin-tazobactam, tetracycline, ticarcillin-clavulanate,
tobramycin, trimethoprim, and trimethoprim-sulfamethozaxole. Interpretative criteria
were in accordance with the CLSI (CLSI 2006).
2.4.3 Fatty acid methyl ester (FAME) analysis
Determination and identification of CFA composition was performed by the protocol

described in the Sherlock® version 6.0 Microbial Identification System software
-- 127 --
package (MIDI-Inc, Newark, Delaware). Bacterial cultures, preparation of reagents and
extraction procedures were according to the MIDI-Inc instructions manual (Paisley
1999). CFAs were analysed by fine capillary column GC chromatography using a
Hewett-Packard GC model 6890 as described by Osterhout et al. (1991).
2.4.3.1. Inoculation of TSBA plates
TSBA plates were prepared by Excel (Perth, WA) according to the guidelines provided
by the MIDI-Inc manual. Inoculation was performed by streaking the plates into four
quadrants with a sterile loop from an HBA from an o/v culture. Plates were incubated at
28C for 48h.
2.4.3.2. Harvesting
A bacterial mass of approximately 20 mg was harvested from the third quadrant of the
TSBA plate with a sterile, disposable bacteriology loop and smeared around the lower 2
cm of a borosilicate Wheaton tube (MIDI-Inc, Del. USA). All cultures had similar
physiological age when they were harvested and CFA analyses were performed in
triplicate.
2.4.3.3. Saponification
Bacteria were saponified by adding 1 ml of Reagent 1 at 100C, vortex after 5 min for
20s followed by further 25 min incubation in a waterbath (Grant Instruments,
Cambridge, UK). Reagent 1 consisted of 45 g of NaOH (ACS grade) dissolved in 150
ml methanol (HPLC grade) and 150 ml of sterile distilled water.
2.4.3.4. Methylation
Methylation was performed by adding 2 ml of Reagent 2 to each tube, vortex for 5 to

10s and transferring the tubes to an 80C waterbath (Grant Instruments, Cambridge,
UK) for 10 min, followed by rapid cooling. Reagent 2 was prepared by mixing 275 ml
of ethanol (HPLC grade) with 325 6N HCl.
2.4.3.5. Extraction
-- 128 --
1.5 ml of Reagent 3 were added to each suspension and inverted for 10 min followed by
removal of the bottom phase. Reagent 3 consisted of 200 ml hexane (HPLC grade) and
200 ml methyl-tert butyl ether (HPLC grade).
2.4.3.6. Washing
Three ml of Reagent 4 were added to each suspension and mixed by inversion for five
min. The top third of the organic phase was removed and place in a testing vial. Reagent
4 consisted of 10.8 g NaOH pellets (ACS grade) dissolved in 900 ml of sterile distilled
water. Extracted FAME preparations were run in batches with a calibration control
immediately after extraction.
2.4.3.7. Interpretation of results
FAMEs analyses were interpreted according to Huys et al. (1994). Results were
automatically issued by the system and included a chromatograph with the identification
of the organism associated with a similarity index (SI). Any SI value > 0.500 indicated a
good identification provided the difference with a second organism was > 0.100; SI
values of 0.300 and 0.500 suggested that if the difference between the organism named
first was > 0.100 from the second organism, the identification was good but it
represented an atypical strain; SI values < 0.300 indicated that the organism may not be
in the database (Paisley 1999).
2.4.4. Protein analysis by MALDI-TOF
The protein analysis of strain 266T was performed using a Bruker Microflex LT
MALDI-TOF mass spectrometer (Bruker Daltonik, GmhH, Germany). Sample
preparation using formic acid extraction method was performed as per manufacturer’s
instructions (Eisentraut, TechNote FormicAcidMethod.doc, version 1.0; 2009 Bruker
Daltonik). All strains were tested six times.
2.4.4.1. Sample preparation
The contents of a 1l loopful from an HBA o/v culture were transfered into an
Eppendorf tube containing 300 l deionized water. The mixture was vortex for one
-- 129 --
minute to generate a homogeneous suspension. To this suspension, 900 l of pure
ethanol were added and vortex for one min. The suspension was twice centrifuged for 2
min at 13000 rpm and the supernatant discarded to completely remove all residual
ethanol. To the pellet, 50 l of 70% aqueous FA (prepared by mixing 30 l water and
70 l 100% FA) were added and vigorously mixed by pipetting up and down followed
by vortexing. A further 50 l ACN were added and mixed as before followed by
centrifugation for 2 min at 13000 rpm. One l of the microorganism extract supernatant
was placed on a clean MALDI target, dried in a laminar airflow cabinet followed by
addition of 1 l HCCA matrix solution. The MALDI target was then inserted into the
MALDI-TOF mass specetrometer. Identification of isolates and interpretation of
spectral patterns were as per manufacturer’s instructions (Bruker Daltonik).
2.4.5. Genotypic characterization
The initial taxonomic position of strain 266T was determined from the nucleotide
sequences of the gyrB and rpoD genes by the author. Further multilococcus
phylogenetic analysis based on the molecular sequences of the 16S rRNA, gyrB, rpoD,
recA, dnaJ, gyrA and dnaX genes and DDH studies were performed by Dr. R. Beaz-
Hidalgo (Unitat de Microbilogia, Department de Ciènces Mèdiques Básiques, Facultat
de Medicina i Ciènces de la Salut, IISPV, Universitat Rovira i Virgili, Reus Spain).
2.4.5.1. PCR and sequence analysis
DNA extraction and conditions for amplifying the 16S rRNA, gyrB, rpoD, recA, dnaJ,
gyrA and dnaX genes were performed as described by Martínez-Murcia et al. (1992b,
2011). DNA extraction for PCR and DDH studies was performed using the Easy DNA
(Invitrogen) kit. Purified PCR products were prepared for sequencing by using the
BigDye Terminator V.1.1 cycle sequencing kit (Applied Biosystems) and sequencing
was performed with an ABI PRISM 310 and ABI 3130XL genetic analyser (Applied
Biosystems). Using the Clustal_X program, version 1.8 (Thompson et al. 1997), the
sequences obtained were independently aligned with sequences of the type and
reference strains of all members of the genus Aeromonas taken from in-house data base
(Martínez-Murcia et al. 2011) and some 16S rRNA sequences retrieved from the
GenBank.
-- 130 --
Genetic distance and clustering were determined using Kimura’s two parameter model
method (Kimura 1980) and evolutionary trees were constructed by the neighbour-
joining method (Saitou and Nei 1987) using the Mega4 program (Tamura et al. 2007).
Stability of the relationship was assessed by the bootstrap method (1000 replications).
DDH experiments were conducted using the methods described by Ziemke et al. (1998)
and Urdiain et al. (2008). Re-association was performed under optimal conditions at
70C, single- and double-stranded DNA molecules were separated by the use of
hydroxyapatite. Colour development was measured at 405 nm using a Biotek Power
Wave XS2 microplate reader (Biotek® Instrument Inc.). Reported mean DNA-DNA
relatedness values (%) and standard deviations were based on a minimum of three
hybridizations for both, direct and reciprocal reactions. DDH studies were performed
between strain 266T and the type strains of A. veronii (CECT 4257T), A.
allosaccharophila (CECT 4199T) and A. fluvialis (CECT 7401T) as these were the
phylogenetically closest species both in the 16S rRNA gene and the MLPA.
2.5. ANTIMICROBIAL SUSCEPTIBILITY TESTING
Antimicrobial susceptibility testing was performed by the agar dilution breakpoint and
disk diffusion methods as described by the CLSI (2006). The E-strip method was used
to determine the MIC for ampicillin, colistin, doxycycline and tigecycline.
2.5.1. Agar dilution
Plates used in agar dilution testing were obtained from Excel (Perth, WA). Plates
containing amoxicillin-clavulanate, timentin and pipercillin-tazobactam were used
within 24 h after preparation. All plates were pre-dried with lids off for 30 min at 35ºC
before inoculation. A TSB tube was inoculated with three to four individual colonies
from a HBA plate incubated o/v at 35 ºC and shaken for 2 h at the same temperature to
achieve log phase. Each log phase broth was standardised to the equivalent of 0.5
McFarland with sterile saline. This suspension was further diluted 1 in 10 with ¼
strength peptone water (Excel, Perth) which was used to inoculate wells in the replica
tray (Mast Laboratories Ltd. England). Plates were inoculated within 15 min of filling
the wells and incubated in air at 35ºC for 24 h.
-- 131 --
A CLED and CNA plates were included at the beginning and at the end of each run to
check for Gram-positive contaminants and cross contamination of wells. The following
reference strains were included in each run Klebsiella pneumoniae ATCC 700603,
Escherichia coli ATCC 25922, Escherichia coli ATCC 35218, Pseudomonas
aeruginosa ATCC 27853, and Enterococcus faecalis ATCC 29212. Susceptibility was
defined as absence of growth on solid medium after 24 h incubation. Presence of growth
indicated non-susceptibility.
2.5.2. Disk diffusion
A 0.5 McFarland suspension was prepared in sterile saline from bacteria cultured on
HBA after incubation o/v at 35ºC. Mueller-Hinton plates were lawn-inoculated with this
suspension and appropriate antimicrobial disks placed on the surface of the agar. Plates
with AMP, CEF and O/129 disks were incubated at 35ºC those with DEF disks were
incubated at 30ºC. After 24 h incubation, zone sizes were measured and interpreted
according to the following; values for O129 were obtained from the Oxoid Manual
(1998); DEF values as per coagulase negative staphylococci from the Rosco Manual
(2000); AMP and CEF from CLSI (2006). Interpretation of results is given in Table
2.10.
2.5.3. Minimum inhibitory concentration testing: E-strip method
E-strips stored at 20C were allowed to equilibrate to room temperature for 20 min
before opening. A 0.5 McFarland suspension was prepared in sterile saline from
bacteria cultured on HBA after incubation o/v at 35ºC. The suspension was dispensed
with a sterile pipette to cover the entire surface of a Mueller-Hinton plate and allowed to
dry for 10 min. An E-strip containing a gradient of the appropriate antimicrobial was
placed onto the plate and incubated at 35C for 24 h.
MICs were read and recorded independently by two individuals. Interpretative criteria
for tigecycline and ampicillin were derived from those described for the
Enterobacteriaceae by the Food and Drug Administration (bioMérieux 2010) and those
for doxycycline were derived from the CLSI (2011) document as outlined in Table 1 of
the E-strip pacakage insert. MIC values for colistin were obtained from Fosse et al.
(2003b) and shown in Table 2.11. Escherichia coli ATCC 25922 was used as a quality
control.
-- 132 --
2.6. ELECTRON MICROSCOPY ANALYSIS
Cell size, morphology and the presence of flagella were determined by electron
microscopy following procedures previously described by Collado et al. (2009).
2.7. STATISTICAL ANALYSIS
Chapters 3, 5 and 7
Statistical analyses were conducted with Fisher’s exact method of contingency table
analysis using statistical software (Prism version 5.0; GraphPad, Inc., San Diego, CA).
Chapter 6
Statistical analyses were based on the 2Yc with Yates Corrections for relative small
numbers (Yates 1934).
-- 133 --
Table 2.10 Interpretation of disk diffusion results (zones sizes in mm)
Category Antimicrobials (concentration in g)
O/129 (150) AMP (10) CEF (30) DEF (250)
R No Zone  13 > 18  14
I  14-16 15-17 
S Any zone  17  14  16
R, resistant; I, intermediate; S, susceptible; AMP, ampicillin; CEF, cephalexin;

DEF, deferoxamine.
-- 134 --
Table 2.11 Interpretation of E-strip MIC values
Category MIC (concentration in g/ml)
AMP COL DOX TGC
R  32 2  16 8
I 16  8 4
S 8 <2 4 2
R, resistant; I, intermediate; S, susceptible; AMP, ampicillin; COL, colistin;

DOX, doxycycline; TGC, tigercillin.
-- 135 --
CHAPTER 3: PHENOTYPIC CHARACTERIZATION OF
AEROMONAS SPECIES
3.1. INTRODUCTION
The genus Aeromonas comprises facultatively anaerobic, glucose fermenting, oxidase

positive, Gram-negative rods found globally in water and soil environments (Janda and
Abbott 1998). The need for accurately identifying Aeromonas is based on the notion
that only a few species are considered pathogenic to humans (Carnahan et al. 1991b).
However, the taxonomy of Aeromonas has been described as difficult and confusing
(Harris et al. 1985). This has been partly due to a lack of definitive phenotypic markers,
different testing methodologies and an increasing number of new species (Miñana-
Galbis et al. 2002). Indeed, several new species have been proposed in the last decade in
addition to the 17 DNA hybridization groups described in the most recent edition of
Bergey’s Manual of Systematic Bacteriology (Martin-Carnahan and Joseph 2005).
Previously, classification of Aeromonas species was primarily based on two

characteristics: motility and growth temperature. Psychrophylic and non-motile species
were represented by A. salmonicida while mesophilic and motile species included all
the remaining aeromonads. The vigorous metabolic activity of most Aeromonas species
particularly those of the mesophilic group, formed the basis for the classification of
these organisms (Schubert 1968). The ability to ferment many carbohydrates and other
substrates has been utilized by several authors in the quest to find suitable differential
characteristics (George et al. 1986; Käempfer and Altwegg 1992; Valera and Esteve
2002).
The aim of this Chapter was to characterize a collection of clinical and environmental
Aeromonas based on the scheme designed by Abbott et al. (2003). Minor modifications
from the original scheme included the omission of production of pectinase and ability to
grow in potassium cyanide medium. The former test allowed differentiation between
subsets of A. salmonicida, a species that was not considered in the study while the latter
was omitted due to the hazardous nature of the substrate. Furthermore, to complement
Abbott’s scheme, several novel tests were introduced while previously described
phenotypic tests were revisited in order to find new phenotypic markers.
3.2. Bacterial strains
-- 136 --
Bacterial isolates used in this study are listed in Tables 2.4, 2.6 and 2.7. Organisms used
as positive and negative control are listed in Table 2.5. Clinical isolates were collected
from intestinal and extra-intestinal sites over a period of 20 years (1988 to 2008). Of
these, 46 (32%) were recovered from human clinical material from patients residing
outside the Perth metropolitan area. Environmental and animal isolates were collected
over a 10 year period (1998 to 2008) from all regions of Western Australia, the largest
state of Australia covering an area of approximately 2.5 million square kilometres. All
isolates were considered mesophilic in nature.
3.3. RESULTS
3.3.1. Biochemical characteristics of type and reference strains
The biochemical characteristics of 15 reference strains were in agreement with those

described by Abbott et al. (2003). In contrast to the original descriptions, biochemical
differences were observed for the following type strains; A. bivalvium CECT 7113T
produced acid from salicin (Miñana-Galbis et al. 2007); A. molluscorum DSM 17090T
produced acid from D-lactose and hydrolysed aesculin (Miñana-Galbis et al. 2004a); A.
simiae DSM 16559T produced gas from glucose, -haemolysis on SBA and acid from
D-lactose and salicin (Harf-Monteil et al. 2004) (Table 3.1).
3.3.2. Overall classification
Overall, 185 (92.9%) isolates were identified to species level. Of these, eight (4%)
resembled members of the A. hydrophila complex and six (3%) could not be assigned to
any taxon due to conflicting biochemical profiles. Members of the A. hydrophila
complex included A. hydrophila, A.bestiarum and A. salmonicida.
3.3.3. Clinical isolates
Eighty (54.8%) isolates were identified as A. hydrophila; 36 (24.7%) as A. caviae and

18 (12.3%) as A. veronii bv. sobria. Three isolates were identified as A. eucrenophila A.
jandaei and A. schubertii each constituting 0.7% of the total respectively. Four isolates
(2.7%) could not be assigned to any taxon and five (3.4%) were identified as members
of the A. hydrophila complex (Table 3.2).
-- 137 --
3.3.4. Environmental isolates
Twenty-four isolates (45.27%) were identified as A. hydrophila; 13 (24.5%) as A.

veronii bv. sobria; seven (13.2%) as A. bestiarum; two (3.7%) as A. caviae; two (3.7%)
as A.jandaei and one (1.9%) strain each as A. salmonicida and A. schubertii. In addition,
two (3.7%) could not be identified to species level and three (5.6%) were classified as
members of the A. hydrophila complex (Table 3.3).
3.3.5. Distribution of Aeromonas spp. in clinical samples
Aeromonas hydrophila was the most prevalent aeromonad in wound (69.0%), sterile
sites (45.5%), blood (45.5%) and stool specimens (41.2%) followed by A. caviae wound
(12.1%), sterile sites (36.4%), blood (36.4) and stools (35.3%). Isolates identified as A.
veronii bv. sobria were present in wound (10.3%), sterile sites (18.1%), blood (12.1%)
and stool specimens (11.8%). Aeromonas hydrophila (60%) and A. veronii bv. sobria
(40%) were the only species isolated from sputum samples (Table 3.4).
3.3.6. Distribution of Aeromonas spp. in environmental samples
In water samples, A. hydrophila (46.7%) was the most frequently recovered species
followed by A. veronii bv. sobria (22.2%) and A. bestiarum (15.6%), respectively. Other
species isolated from water included, A. hydrophila complex (6.7%) and single (2.2%)
strains were identified as A. jandaei and A. schubertii. Aeromonas hydrophila (42.9%)
and A. caviae (28.6%) were predominant in fish samples followed by one strain (14.3%)
each of A. jandaei and A. veronii bv. sobria. Two (4.4%) unidentified isolates were
isolated from water and a single isolate from crab was identified as A. salmonicida
(Table 3.4).
3.3.7. General phenotypic characteristics
Overall, the majority of the strains were positive for the following tests: motility,
oxidase, catalase, ONPG, arginine dehydrolase, gelatinase, DNase and lipase activity,
acid production from glycerol, maltose, D-mannitol, mannose glucose-1-phosphate and
glucose-6-phosphate, hydrogen sulphide from cysteine, growth in 0 and 3% NaCl broth.
-- 138 --
Table 3.1 Biochemical characteristics of type and reference Aeromonas strains
Character A. allosaccharophila A. bestiarum A. bivalvium A. caviae A. culicicola A. encheleia
ATCC 51208T ATCC 14715T CECT 7113T ATCC 15468T CECT 5761T DSM 1577T
Indole + + + + + +
Citrate   + + + 
Acetate   +   
Malonate      
VP  +   + 
LDC + + +  + 
PPA   +  + 
Gas from glucose + +   + 
Acid production from:
L-arabinose + + + +  
Cellobiose +   +  
Lactose    +  
Melibiose      
-methyl-D-glucoside      
L-rhamnose + +    +
Salicin + +    
Sucrose + + + + + +
Aesculin hydrolysis + + + +  
H2S from cysteine + + +  + +
- 139 -
Character A. allosaccharophila A. bestiarum A. bivalvium A. caviae A. culicicola A. encheleia
ATCC 51208T ATCC 14715T CECT 7113T ATCC 15468T CECT 5761T DSM 1577T
Gluconate     + 
DL-lactate   +   
Urocanic acid + + + +  
Jordan’s tartrate   +   
PZA +  + +  +
-haemolysis  +   + 
Alkylsulfatase   +   
Elastase  +    
Tyrosine +  +   
AmpicillinR R R R R R R
CephalothinR S R S R S S
Starch  + + +  
PYR +  +   
DeferoxamineR S R R R R R
O/129R R R R R R R
Growth in TCBS     + 
CAMP (aerobic)  +  +  +
CAMP (anaerobic)  +    
ColistinR S R S R R S
-- 140 --
Character A. eucrenophila A. hydrophila A. jandaei A. media A. molluscorum A. popoffii
ATCC 23309T ATCC 7966T ATCC 49568T ATCC 33907T DSM 17090T CIP 105493T
Indole + + + +  
Citrate   +   +
Acetate      
Malonate      +
VP  + +   +
LDC  + +   
PPA +  +  + 
Gas from glucose  + +   +
L-arabinose + +  + + +
Cellobiose +   + + 
Lactose +   +  
Melibiose   +   
-methyl-D-glucoside  +    +
L-rhamnose      
Salicin +     
Sucrose + +  + + 
Aesculin hydrolysis + +  +  
H2S from cysteine  +    +
-- 141 --
Character A. eucrenophila A. hydrophila A. jandaei A. media A. molluscorum A. popoffii
ATCC 23309T ATCC 7966T ATCC 49568T ATCC 33907T DSM 17090T CIP 105493T
Gluconate  +    
DL-lactate +     
Urocanic acid   + +  
Jordan’s tartrate +   +  
PYZ + +  + + 
-haemolysis   + +  
Alkylsulfatase +  +   
Elastase  +    
Tyrosine +   + + 
AmpicillinR R R R S R R
CephalothinR R R I R S R
Starch + + +   
PYR   +   
DeferoxamineR R R R R R R
O/129R R R R R R S
Growth in TCBS  + +   
CAMP (aerobic) +  + +  
CAMP (anaerobic) + + +  + 
ColistinR S S R S S S
-- 142 --
Character A. schubertii A. simiae A. sobria A. trota A. veronii A. veronii
ATCC 43700T DSM 16559T CIP 7433T ATCC 49657T bv. sobria bv. veronii
ATCC 9071T DSM 7386T
Indole   + + + +
Citrate   +   +
Acetate +    + 
Malonate      
VP +    + +
LDC  + + + + +
PPA      
Gas from glucose  +  + + +
L-arabinose   +  + 
Cellobiose  + + +  +
Lactose  +    +
Melibiose      
-methyl-D-glucoside   +   +
L-rhamnose      
Salicin  +    +
Sucrose  + +  + +
Aesculin hydrolysis  +  +  +
H2S from cysteine     + +
-- 143 --
Character A. schubertii A. simiae A. sobria A. trota A. veronii A. veronii
ATCC 43700T DSM 16559T CIP 7433T ATCC 49657T bv. sobria bv. veronii
ATCC 9071T DSM 7386T
Gluconate     + +
DL-lactate +   +  
Urocanic acid +    + +
Jordan’s tartrate     + +
PYZ      
-haemolysis + +  + + +
Alkylsulfatase    +  +
Elastase      
Tyrosine      
AmpicillinR R R S S R R
CephalothinR R S S R S S
Starch + + +   
PYR   +   
DeferoxamineR R R S R R R
O/129R S R R S R R
Growth in TCBS + +   + +
CAMP (aerobic)     + 
CAMP (anaerobic)      
ColistinR S S S S R R
-- 144 --
Table 3.2 Biochemical characteristics of Aeromonas isolated from human clinical material (% positive)
Character A. hydrophila complex A. hydrophila A. caviae A. bestiarum A. veronii bv. sobria
n=8 n = 104 n = 38 n=7 n = 29
Indole 75 99 95 86 100
Citrate 63 72 77 57 93
Acetate 100 90 79 29 93
Malonate 38 36 16 14 45
VP 75 97 0 71 90
LDC 88 98 0 100 100
PPA 13 22 21 29 41
Gas from glucose 75 93 0 86 90
L-arabinose 38 37 100 43 0
Cellobiose 38 15 87 0 24
Lactose 25 12 95 0 41
Melibiose 13 1 0 0 10
-methyl-D-glucoside 88 85 0 71 17
Raffinose 0 1 24 0 7
L-rhamnose 0 6 0 0 0
Salicin 88 88 97 86 3
D-sorbitol 25 0 3 0 0
Sucrose 100 93 100 100 97
Aesculin hydrolysis 100 98 97 100 0
H2S from cysteine 100 96 21 71 97
- 145 -
Character A. hydrophila complex A. hydrophila A. caviae A. bestiarum A. veronii bv. sobria
n=8 n = 104 n = 38 n=7 n = 29
Gluconate 38 73 0 14 93
DL-lactate 63 69 74 0 0
Urocanic acid 100 83 79 86 76
Jordan’s tartrate 13 19 34 29 21
PYZ 50 37 89 29 41
-haemolysis 88 85 24 57 86
Stapholysin 38 75 0 43 0
Alkylsulfatase 38 42 3 14 24
Elastase 75 85 0 42 0
Tyrosine 88 61 18 0 28
AmpicillinR 100 100 100 86 97
CephalothinR 63 82 97 29 14
Starch 50 16 84 57 38
PYR 13 0 0 0 0
DeferoxamineR 88 99 100 100 97
O/129R 88 95 100 86 86
Growth in TCBS 50 51 84 29 66
CAMP (aerobic) 50 66 0 71 34
CAMP (anaerobic) 63 75 0 71 17
ColistinR 50 75 13 0 59
-- 146 --
Character Aeromonas spp. A. jandaei A. eucrenophila A. salmonicida A. schubertii

n=6 n=3 n=1 n=1 n=2
Indole 33 100 100 100 100
Citrate 0 100 0 100 0
Acetate 66 100 100 100 100
Malonate 0 33 0 0 50
VP 16 100 0 100 100
LDC 66 100 0 0 100
PPA 50 66 0 100 0
L-arabinose 50 0 100 100 0
Lactose 33 0 100 100 0
-methyl-D-glucoside 33 33 0 100 0
Raffinose 50 0 0 0 0
L-rhamnose 16 0 0 0 0
Salicin 33 0 100 100 0
D-sorbitol 0 0 0 100 0
Sucrose 100 0 100 100 0
-- 147 --
Character Aeromonas spp. A. jandaei A. eucrenophila A. salmonicida A. schubertii
n=6 n=3 n=1 n=1 n=2
Gluconate 50 100 0 100 50
DL-lactate 16 0 0 0 50
Urocanic acid 66 100 0 0 100
PYZ 50 0 100 0 0
-haemolysis 50 100 100 100 100
Elastase 0 0 0 100 0
Tyrosine 16 66 0 0 0
AmpicillinR 100 100 100 100 100
Starch 50 33 0 0 50
PYR 50 66 0 0 0
DeferoxamineR 83 100 100 100 100
O129R 83 100 100 100 50
CAMP (aerobic) 0 0 0 0 50
CAMP (anaerobic) 0 33 0 100 0
ColistinR 50 100 0 0 50
-- 148 --
Table 3.3 Biochemical characteristics of Aeromonas isolated from environmental sources (% positive)
Characteristics A. hydrophila A. veronii bv. sobria A. bestiarum A. caviae A. jandaei
n = 24 n = 11 n=7 n=2 n=2
Indole 96 100 86 100 100
Citrate 92 91 57 50 100
Acetate 96 82 29 100 100
Malonate 4 0 14 0 0
VP 92 91 71 0 100
LDC 96 100 100 0 100
PPA 33 36 28 0 50
L-Arabinose 13 0 43 100 0
Lactose 0 27 0 100 0
-Methyl-D-glucoside 88 18 71 0 50
Raffinose 0 0 0 0 0
L-Rhamnose 4 0 0 0 0
Salicin 88 0 86 100 0
D-Sorbitol 0 0 0 0 0
Sucrose 100 92 100 100 0
-- 149 --
Characteristics A. hydrophila A. veronii bv. sobria A. bestiarum A. caviae A. jandaei
n = 24 n = 11 n=7 n=2 n=2
Gluconate 25 91 14 0 100
DL-Lactate 75 0 0 0 0
PYZ 54 9 29 100 0
-Haemolysis 96 91 57 0 100
Elastase 100 0 43 0 0
Tyrosine 13 27 0 0 50
AmpicillinR 100 91 86 100 100
Starch 17 64 57 100 50
PYR 0 0 0 0 100
DeferoxamineR 100 100 100 100 100
O129R 100 54 86 100 100
CAMP O 88 18 71 0 0
CAMP AnO 96 18 71 0 0
ColistinR 63 33 0 100 100
-- 150 --
Characteristics Aeromonas spp. A. hydrophila complex A. salmonicida A. schubertii
n=2 n=3 n=1 n=1
Indole 0 33 100 100
Citrate 0 100 100 0
Acetate 50 100 100 100
Malonate 0 0 0 0
VP 0 33 100 100
LDC 100 100 0 100
PPA 100 0 100 0
Gas from glucose 100 100 100 0
L-Arabinose 0 33 100 0
Cellobiose 50 0 100 0
Lactose 0 0 100 0
Melibiose 50 0 0 0
-Methyl-D-glucoside 100 67 100 0
Raffinose 50 0 0 0
L-Rhamnose 100 0 0 0
Salicin 0 100 100 0
D-Sorbitol 0 0 100 0
Sucrose 100 100 100 100
Aesculin hydrolysis 0 100 100 0
-- 151 --
Characteristics Aeromonas spp. A. hydrophila complex A. salmonicida A. schubertii
n=2 n=3 n=1 n=1
H2S from cysteine 100 100 100 0
Gluconate 100 33 100 100
DL-Lactate 0 100 0 0
Urocanic acid 50 100 0 100
Jordan’s tartrate 50 0 0 0
PYZ 50 33 0 0
-Haemolysis 100 100 100 100
Stapholysin 0 67 100 0
Alkylsulfatase 50 67 0 0
Elastase 0 100 100 0
Tyrosine 50 100 0 0
AmpicillinR 100 100 100 100
CephalothinR 0 67 100 0
Starch 100 67 0 100
PYR 50 0 0 0
DeferoxamineR 100 100 100 100
O129R 100 100 100 0
Growth in TCBS 50 33 100 100
CAMP O 0 100 0 0
CAMP AnO 0 100 100 0
ColistinR 50 67 0 0
-- 152 --
Table 3.4 Distribution of Aeromonas spp. among clinical and environmental samples after phenotypic characterization
Clinical Environmental
Species No. isolated Wound Sputum Sterile Blood Urine Stool Unknown Water Fish Crab
/ (%) site
Aeromonas spp. 6 (3.0) 1 (1.7) 2 (5.9) 1 (33.3) 2 (4.4)
A. bestiarum 7 (3.5) 7 (15.6)
A. caviae 38 (19.0) 7 (12.1) 4 (36.4) 12 (36.4) 12 (35.3) 1 (33.3) 2 (28.6)
A. eucrenophila 1 (0.5) 1 (2.9)
A. hydrophila 104 (52.2) 40 (69.0) 3 (60.0) 5 (45.5) 15 (45.5) 2 14 (41.2) 1 (33.3) 21 (46.7) 3 (42.9)
A. hydrophila 8 (4.0) 3 (5.2) 1 (3.0) 1 (2.9) 3 (6.7)
complex
A. jandaei 3 (1.5) 1 (3.0) 1 (2.2) 1 (14.3)
A. salmonicida 1 (0.5) 1
A. schubertii 2 (1.0) 1 (1.7) 1 (2.2)
A. veronii bv. 29 (14.5) 6 (10.3) 2 (40.0) 2 (18.1) 4 (12.1) 4 (11.8) 10 (22.2) 1 (14.3)
sobria
Total 199 58 5 11 33 2 34 3 45 7 1
- 153 -
Most strains were uniformly negative for ornithine decarboxylase, acid production from
adonitol, amygdalin and m-inositol and production of a diffusible brown pigment. Weak
urease activity was detected in three clinical isolates only identified as A. hydrophila, A.
caviae and A. veronii bv. sobria. The remaining isolates were negative for this test.
3.3.8. Susceptibility to colistin
Resistance to colistin was observed in A. hydrophila (75%), A. veronii bv. sobria (59%);
A. hydrophila complex (50%) and A. jandaei (100%) and less frequently in A. caviae
(13.9%). Among the colistin resistant species, strains identified as A. jandaei produced
much higher MIC values than the other resistant species (results not shown).
3.3.9. Production of pyrrolidonyl--naphthylamide
PYR activity was detected in seven (3.5%) strains comprising four (2.7%) clinical and
three (5.7%) environmental isolates and in the type strains of A. sobria CIP 7433T, A.
bivalvium CECT 7113T, A. allosaccharophila ATCC 51208T and A. jandaei ATCC
49568T. No PYR activity was detected on the remaining isolates. Clinical isolates
showing PYR activity were identified as A. hydrophila complex (strain 221),
Aeromonas spp. (strains 100 and 114) and A. hydrophila (strain 189). PYR+
environmental strains belonged to A. jandaei (strains 35 and 262) and Aeromonas spp.
(strain 265).
3.3.10. Susceptibility to deferoxamine (DEF)
Most isolates were resistant to DEF except for four (2.7%) clinical isolates and the type
strains of A. allosaccharophila ATCC 51208T and A. sobria CIP 7433T. Isolates
susceptible to DEF were identified as A. hydrophila complex (strain 221), A. hydrophila
(strain 184), A. veronii bv. sobria (strain 211) and Aeromonas spp. (strain 100).
3.3.11. Production of a CAMP-like factor
The production of a CAMP-like factor, under aerobic and anaerobic conditions was
observed in the following species: A. bestiarum (71% O2; 71% AnO2); A. hydrophila
(66% O2; 75% AnO2); A. hydrophila complex (50% O2; 63% AnO2) and A. veronii bv.
- 154 -
sobria (34% O2; 17% AnO2). CAMP-like factor was detected under aerobic conditions
in one strain (50%) of A. schubertii and under anaerobic conditions in single strains of
A. jandaei (33%) and A. salmonicida (100%).
3.3.12. Utilization of citrate: Simmon’s vs Hänninen’s medium
Fifty-seven (28.6%) strains were able to utilize citrate using Simmon’s medium but not
Hänninen’s. Seven (4.6%) were positive in Hänninen’s medium alone; 52 (26.1%)
produced a positive result in both media, while 36 (23.7%) strains failed to utilized this
substrate.
3.3.13. Susceptibility to the vibriostatic agent O/129
Susceptibility to O/129 was observed in 16 (8%) strains from different species and
included eight (5.5%) clinical and eight (15.1%) environmental strains.
3.3.14. Growth on thiosulfate salt bile sucrose agar (TCBS)
The ability to grow on TCBS agar was observed in 116 (58.3%) strains which included
16 (30.2%) environmental and 100 (68.5%) clinical isolates.
3.4. DISCUSSION
A conventional biochemical scheme was employed to identify a collection of

Aeromonas strains recovered from clinical and environmental sources in Western
Australia. Data from this study showed that A. hydrophila, A. caviae and A. veronii bv.
sobria were the most frequently isolated species (92.9%) a result consistent with
previous studies (Altwegg and Geiss 1989; Hänninen and Siitonen 1995; Abbott et al.
2003). In contrast to other reports, no significant differences between the biochemical
profiles of clinical and environmental Aeromonas were found (Aguilera-Arreola et al.
2005; Ørmen et al. 2005). This may be partly attributed to the low number of
environmental strains tested. However, phenotypic differences were observed between
strains examined in this study with those reported elsewhere (Hänninen 1994; Valera
and Esteve 2002; Abbott et al. 2003).
-- 155 --
Biochemically, strains of A. hydrophila were less likely to produce acid from L-
arabinose (37%) compared to previous reports where >80% of strains were positive for
this test (Käempfer and Altwegg 1992; Abbott et al. 2003). Utilization of urocanic acid
and hydrolysis of tyrosine was observed in 83 and 61% of A. hydrophila strains,
respectively. In contrast, Abbott et al. (2003) reported that only a handful of strains
(12%) utilized urocanic acid while no strain hydrolysed tyrosine. These results
concurred with previous observations which highlight the heterogeneity of A.
hydrophila (Kirov 1993; Hänninen 1994; Abbott et al. 2003), probably reflecting
geographical differences between the strains (Altwegg et al. 1990). Other differences
were observed in A. caviae strains were the majority were able to produce acid from
salicin (98.5%) and lactose (95.0%). In contrast, Valera and Esteve (2002) reported that
only 33% of the A. caviae strains produced acid from salicin while Käempfer and
Altwegg (1992) found that 64% of A. caviae strains produced acid from lactose.
The ability of A. veronii bv. sobria to produce a CAMP-like factor under aerobic and
anaerobic conditions was consistent with the observations by Carnahan et al. (1991b)
and Altwegg et al. (1990) but not with those of Figura and Guglielmetti (1987). The
biochemical profiles of A. veronii bv. sobria were consistent with the study by Ashbolt
et al. (1995). Phenotypically, this species appeared more stable than A. hydrophila and
A. caviae, although Esteve et al. (2003) suggested that A. veronii bv. sobria constituted
a heterogenous taxon that required further revision. Variations in phenotype may have
clinical significance as an association between biotype and enterotoxin production has
been suggested (Turnbull et al. 1984) but not universally supported (George et al.
1986). Traditionally, Aeromonas are considered resistant to the vibriostatic agent O/129
and should not grow on TCBS agar, characteristics that allow members of this genus to
be differentiated from Plesiomonas and Vibrios (Cowan and Steel 1993; Esteve et al.
2003). However, results from the present study indicate that these tests are no longer
reliable suggesting that the ability to grow on this selective medium and resistance to
O/129 is strain dependent.
Assigning strains to a particularly taxon proved to be difficult in cases where: (i) the
range allocated for a positive result varied from 16 to 84%; (ii) the percentage positive
for a test was no greater than 60 or 70%; (iii) the end points for positive reactions could
not be reliably determined for tests such as Jordan’s tartrate, production of
phenylalanine deaminase and pyrazinamidase, despite the use of positive and negative
controls. The inclusion of tests with a positive rate of nearly 100% [-galactoside
-- 156 --
production (ONPG), gelatin hydrolysis or nearly 100% negative (hydrolysis of urea,
inability to produce acid from m-inositol, adonitol and amygdalin) did not contribute to
the overall differentiation of aeromonads.
The choice of media and methods used to determine phenotypic traits can affect the
biochemical identification of Aeromonas (Carnahan et al. 1991b; Esteve et al. 2003).
For example, significantly (p = 0.0004) more strains were able to utilize citrate as a
carbon source when Simmons’ medium was used than with the medium described by
Hänninen (1994). Similarly, the use of Kovacs medium to determine indole production
was significantly (p = 0.0001) more sensitive than the spot indole test. The quest to find
new phenotypic markers to reliably identify Aeromonas to species level continues to be
a difficult task. Previously described and novel tests introduced in this study did not
improve the discriminatory power of the scheme and did not contribute to the
phenotypic classification of these organisms. The PYR+ activity detected in less
frequently isolated species such as A. allosaccharophila, A. bivalvium, A. jandaei and A.
sobria is a promising phenotypic marker that can be used to rapidly and reliably
differentiate these organims from PYR species but more strains need to be tested to
confirm the validity of this test.
In this Chapter we have described the phenotypic characteristics of 199 Aeromonas

isolates and determined the current distribution of species among clinical and
environmental sources in Western Australia. Despite the unreliable nature of phenotypic
identification, biochemical differentiation is still the only identification method
available in some laboratories. Furthermore, biochemical differentiation remains a
requisite when describing novel species. Janda and Duffey (1988) suggested that
identification of mesophilic Aeromonas species must become more standardised before
more meaningful comparisons can be made between studies carried out at various
regions throughout the world, a suggestion supported by this study. Results from this
study indicate that accurate identification of Aeromonas must involve the use of
molecular methods and the nucleotide sequences of several housekeeping genes have
been proposed for this purpose (Soler et al. 2004; Nhung et al. 2007) and this is
presented in the next chapter.
-- 157 --
CHAPTER 4: GENOTYPIC CHARACTERIZATION OF
AEROMONAS SPECIES
4.1. INTRODUCTION
The genus Aeromonas has long been recognized to contain strains that are difficult to
differentiate from one another, particularly when identification is based on phenotypic
methods alone (Abbott et al. 2003). However, advances in molecular methods and the
development of novel molecular targets have significantly improved the discrimination
of bacteria not usually amenable to identification by conventional biochemical methods
(Yamamoto and Harayama 1996).
In the last decade, the nucleotide sequences of several housekeeping genes have been
used to characterize members of the genus Aeromonas (Yañez et al. 2003; Soler et al.
2004; Küpfer et al. 2006; Nhung et al. 2007; Miñana-Galbis et al. 2009; Lamy et al.
2010). Housekeeping genes perform essential functions in bacteria and, unlike the 16S
rRNA gene, are single-copy genes where horizontal transfer seldom occurs (Yañez et al.
2003; Soler et al. 2004).
The primary aim of this Chapter was to re-classify Aeromonas strains previously
characterized by phenotypic methods as described in Chapter 3, inferred by the rpoD
and gyrB genes. The rpoD gene encodes one of the sigma (σ70) factors that confer
promoter-specific transcription initiation on RNA polymerase while gyrB encodes the
B-subunit of the DNA gyrase, a type II DNA topoisomerase (Yañez et al. 2003; Soler et
al. 2004). Both genes have similar substitution rates (<2%) and a similar number of
variable positions (34% for rpoD and 32% for gyrB). These genes have, individually or
simultaneously, been used for the analysis of Aeromonas (Yañez et al. 2003; Soler et al.
2004). When combined, rpoD and gyrB have shown to be a reliable tool in the
differentiation of these bacteria. Individually, gyrB allows the differentiation of closely
related taxa such as Aeromonas sp. HG 11/A. encheleia and A. veronii/A. culicicola/A.
allosaccharophila whereas rpoD differentiates A. salmonicida from A. bestiarum (Soler
et al. 2004).
A second aim was to show how classification by a molecular method affects the
distribution of species within clinical and environmental sources.
-- 158 --
Bacterial strains used in this Chapter are listed in Tables 2.4, 2.6 and 2.7. Clinical
samples were isolated from wound (54 samples), stool (33 samples), blood (33
samples), and 23 from miscellaneous specimens. Environmental specimens were
collected from water (44 samples), fish (7 samples), and crab (1 sample). The nucleotide
sequences of the gyrB and rpoD genes obtained from wild and reference strains used in
this study were deposited in GenBank/EMBL and accession numbers are listed in
Tables 4.1 and 4.2.
4.3. RESULTS
4.3.1 Overall distribution of species following genetic identification

Sixty (30.7%) isolates clustered around the type strain of A. dhakensis LMG 19562T
(Fig. 4.1), 36 (18.4%) around A. caviae ATCC 13136T (Fig. 4.2), 38 (19.4%) around A.
hydrophila ATCC 7966T (Fig. 4.3) and 49 (25.1%) around A. veronii bv. sobria ATCC
9071T (Fig. 4.4).
4.3.2. Distribution of Aeromonas spp. in clinical specimens

The most prevalent species was A. veronii bv. sobria (25.1%) followed by A. dhakensis
and A. caviae (both at 23.8%) and A. hydrophila (23.0%). The prevalence of A.
dhakensis was wounds (40.7%), faeces (12.1%) and blood (9.0%). Most isolates
recovered from blood samples were identified as A. caviae (32.2%) and A. veronii bv.
sobria (30.3%) followed by A. hydrophila (21.2%). Other species isolated from human
clinical material included: A. allosaccharophila (strain 100 from stool); A. bestiarum
(strain 68 from blood); A. media (strains 85 from blood and 179 from stool); A.
salmonicida (strain 190 from wound) and A. schubertii (strain 186 from wound) (Table
4.3).
4.3.3. Distribution of Aeromonas spp. in environmental specimens
Overall, A. dhakensis (50.0%) was the most frequently identified species followed by A.
veronii bv. sobria (25.0%). Both species were the most frequently identified Aeromonas
in water samples 54.5 and 27.2%, respectively while six different species were
identified in fish samples (Table 4.3).
-- 159 --
Table 4.1 Type and reference strains Genbank accession numbers
Species Culture collection no. rpoD gyrB
A. allosaccharophila DSM 11576 FN773342 FN813470

A. aquariorum (reclassified as A. dhakensis) CECT 7289 FN773316 FN691767
A. australiensis CECT 8023 FN773335 FN691773
A. bestiarum ATCC 51108 FN773317 FN706556
A. bivalvium CECT 7113 FN773318 FN691768
A. cavernicola CECT 7862 HQ442702
A. caviae ATCC 13136 FN773319 FN691769
A. culicicola CECT 5761 FR872757 FN691769
A. diversa CECT 4254 AY169345 AY101806
A. encheleia DSM 11577 FN773320 FN796740
A. eucrenophila ATCC 23309 FN773321 FN706557
A. fluvialis CECT 7401 FJ603453 FJ603455
A. hydrophila ssp. hydrophila ATCC 7966 FN773322 FN706558
A. hydrophila ssp. dhakensis LMG 19562 HQ442800 HQ442711
A. hydrophila ssp. ranae LMG 19707 HE965669
A. jandaei ATCC 49568 FN773323 FN706559
A. media ATCC 33907 FN773324 FN706560
A. molluscorum DSM 7090 FN773325 FN706561
-160-
Species Culture collection no. rpoD gyrB
A. piscicola CECT 7443 FM999969 FM999963

A. popoffii CIP 105493 FN773336 FN706562
A. rivuli CECT 7518 FJ969433 FJ969434
A. salmonicida ssp. salmonicida CECT 894 AY169327 AY101773
A. salmonicida ssp. achromogenes CECT 895 AY169329 AY101784
A. salmonicida ssp. masoucida CECT 896 AY169330 AY101790
A. salmonicida ssp. pectinolytica DSM 12609 AY169324 AY101785
A. salmonicida ssp. smithia CIP 104757 AM262159
A. sanarelli CECT 7402 FJ472929 FJ607277
A. schubertii CECT 4240 AY169336 AY101772
A. simiae DSM 16559 DQ41159 FN706563
A. sobria CDC 9540-76 FN773345 FN706564
A. taiwanensis CECT 7403 FJ474928 FJ807272
A. tecta CECT 7082 FN773337 FN796745
A. trota ATCC 49657 FN773339 FN796746
A. veronii bv. sobria ATCC 9071 FN773340 FN796747
A. veronii bv. veronii DSM 7386 FN773341 FN796748
Aeromonas spp. HG11 CECT 4253 AY169343 AJ964951
-161-
Table 4.2 GenBank accession numbers of wild strains for rpoD and gyrB gene sequences
A. dhakensis (previously classified as A. aquariorum)
Strain no. Source rpoD gyrB Strain no. Source rpoD gyrB
31 Fish FN773334 FN691766 107 Wound FR675838 FR675869
32 Fish FN796726 FN706555 121 Wound FR675839 FR675870
47 Sputum FR675826 FR865966 123 Wound FR675841 FR675871
56 Bone chips FN773333 FN796734 124 Wound FR675840 FR675872
60 Blood FR675827 FR675858 139 Stool FR675842 FR676941
67 Wound FR675828 FR675859 141 Wound FR675843 FR676942
70 Blood FN796724 FN796735 154 Blood FR675844 FN796752
71 Wound FR675829 FR675860 165 Unknown FR675845 FR676943
74 Wound FR675831 FR675862 169 Stool FR675847 FR676945
79 Wound FR675832 FR675863 172 Urine FR675886 FR676946
93 Urine FR675835 FR675866 182 Wound FR675889 FR676949
-162-
A. dhakensis (previously classified as A. aquariorum)
Strain no. Source rpoD gyrB Strain no. Source rpoD gyrB
213 Wound FR675892 FR676952 240 Water FR675853 FR681577
220 Wound FN808215 FR676953 241 Water FR675854 FR681578
222 Water FR682782 FR676954 242 Water FR675855 FR681579
223 Water FN808216 FR676955 244 Water FR675856 FR681580
229 Water FN796725 FN796736 255 Water FR681592 FR681584
230 Water FN808217 FR676959 256 Water FN796728 FN796738
232 Water FR675849 FR676960 257 Water FN796733 FN796739
235 Water FN796727 FN796737 263 Water FR681594 FR681586
236 Water FR675851 FR681575 278 Wound FR681595 FR681587
239 Water FR675852 FR681576 279 Wound FR681596 FR681588
- 163 -
A. hydrophila
Strain No. Source rpoD gyrB Strain No. Source rpoD gyrB
23 Wound FR681805 FR681597 118 Sputum FR681875 FR681744
34 Fish FR681806 FR681598 126 Wound FR681876 FR681745
59 Blood FR681807 FR681599 127 Wound FR681877 FR681746
61 Biliary stent FN795730 FN796741 128 Wound FR681878 FR681747
77 Wound FR681809 FR681601 133 Mortuary FR681880 FR681749
83 Sputum FR681810 FR681602 144 Wound FR681881 FR681750
84 Blood FR681811 FR681603 145 Blood FR681882 FR681751
89 Bile FR681865 FR681605 148 Wound FR681883 FR681752
90 Wound FR681866 FR681606 149 Blood FR681884 FR681753
98 Blood FR681867 FR681736 150 Tissue FR681885 FR681754
105 Stool FR681869 FR681738 152 Blood FR681887 FR681756
113 Drain fluid FR681871 FR681740 231 Water FR681889 FR681758
115 Stool FR681872 FR681741 243 Water FR681890 FR681759
-- 164 --
A. caviae
21 Unknown FR681906 FR682025 109 Blood FR681923 FR682039
26 Unknown FR681907 FR682026 110 Blood FR681924 FR682132
30 Fish FR681908 FR682027 140 Peritoneal fluid FR681925 FR682133
62 T-tube tip FR681911 FR682030 153 Stool FR682011 FR682043
78 CAPD fluid FR681914 FR682032 163 Wound FR682014 FR865964
87 Blood FR681916 FR682034 178 Bile FR682016 FR682136
94 Stool FR681917 FR682035 187 Stool FR682017 FR682137
96 Blood FR681918 FR682504 188 Bile FR682018 FR682138
102 Stool FR681919 FR682036 200 Blood FR682019 FR682139
106 Blood FR681921 FR682038 217 Stool FN796729 FR682505
108 Stool FR681922 FR682131 270 Wound FR682021 FR682507
-- 165 --
A. veronii bv. sobria
27 Appendix FR682573 FN796749 135 Blood FR682767 FR682524
33 Fish FR682575 FR682511 147 Wound FR682769 FR682527
66 Blood FN796731 FR682512 159 Wound FR682770 FR682528
72 Blood FR682576 FR682513 164 Sputum FR682771 FR682529
97 Stool FR682578 FR682515 171 Sputum FR682773 FR682531
-- 166 --
218 Blood FR682781 FR682540 252 Water FR682791 FR682549
221 Blood FR682784 FR682542 259 Water FR682793 FR682551
225 Water FR682786 FR682544 267 Water FN796732 FN796750
237 Water FR682788 FR682546 269 Blood FR682797 FR682554
238 Water FR682789 FR682547
-- 167 --
Miscellaneous species
Species Strain no. Source rpoD gyrB
A. jandaei 35 Fish lesion FR682798 FN796742
253 Water FN773326 FR682555
262 Water FN773327 FN796743
A. salmonicida 190 Wound FN773330 FR682801
199 Crab FN773331 FN796744
A. media 29 Fish FN773332 FN691772
85 Blood FR682799 FR682802
179 Stool FR682800 FR682803
A, schubertii 186 Wound FR865967 FN691774
A. bestiarum 68 Blood FN773343 FN691771
A. allosaccharophila 100 Stool FN773344 FN691770
A. australiensis strain 266T Isolated from water dnaJ HE611954
dnaX HE611951 gyrA HE611952
gyrB FN691773 recA HE611953
rpoD FN773335 16S rRNA HE611955
-- 168 --
Isolates (93 172)
Isolates (222 257)
Isolate 213
Isolate 258
Isolate 226
Isolates (235 250)
Isolate 71
Isolate 107
Isolate 31
Isolate 227
Isolate 228
Isolate 241
Isolate 255
Isolate 141
Isolate 67
Isolates (73 74)
Isolate 176
Isolate 256
Isolate 242
Isolate 279
Isolates (47 95 139 165)
Isolate 183
Isolate 32
Isolates (230 236 249)
Isolate 263
Isolate 121
T
A. dhakensis (LMG 19562 ))
Isolates (223 232 240)
85 Isolate 168
71 Isolate 278
Isolate 182
Isolate 180
100 Isolate 104
Isolates (56 220)
85 Isolate 239
72 Isolate 60
Isolate 79
Isolate 91
Isolates (123 124)
Isolates (229 234)
100
Isolate 251
Isolate 154
Isolate 212
70
78 Isolate 70
Isolate 88
Isolate 169
Isolate 244
T
A. hydrophila (ATCC 7966 )
T
96 A. taiwanensis (CECT 7403 )
T
A. sanarellii (CECT 7402 )
T
A. jandaei (ATCC 49568 )
T
A. trota (ATCC 49657 )
A. sobria (CDC 9540-76)
T
A. fluvialis (CECT 7401 )
88 T
97 A. allosaccharophila (DSM 11576 )
T
A. bestiarum (ATCC 51108 )
T
75 A. popoffii (CIP 105493 ))
99 A. piscicola (CECT 7443 )
T
T
A. salmonicida (CECT 894 )
T
100 A. molluscorum (DSM 17090 )
T
98 A. rivuli (CECT 7518 )
T
A. bivalvium (CECT 7113 )
T
A. media (ATCC 39907 )
T
A. eucrenophila (ATCC 23309 )
75 T
A. tecta (CECT 7082 )
T
A. encheleia (DSM 11577 )
100 Aeromonas spp. HG 11 (CECT 4253)
T
A. simiae (DSM 16559 )
T
100 A. diversa (CECT 4254 )
T
100 A. schubertii (ATCC 43700 )
0.02
Figure 4.1 Concatenated neighbour-joining phylogenetic tree showing the position of

A. dhakensis strains derived from the rpoD and gyrB sequences (1339 nt).
- 169 -
Isolate 58
Isolate 156
Isolate 80
Isolate 87
Isolate 75
Isolate 110
80 Isolate 108
Isolates (146 163 167)
Isolate 62
Isolate 103
Isolate 102
Isolate 158
Isolate 78
Isolate 216
Isolate 21
Isolate 30
Isolate 142
98 Isolate 140
Isolate 96
Isolates (57 270)
Isolate 153
Isolate 106
Isolate 65
Isolate 26
99 Isolate 264
Isolate 188
Isolate 143
Isolate 178
Isolate 109
99 Isolate 217
Isolate 94
99 Isolate 187
97
Isolate 200
T
A. taiwanensis (CECT 7403 )
T
T
T
A. dhakensis (CECT 7289 )
99 T
A. hydrophila (ATCC 7966 )
T
T
73
T
94 A. fluvialis (CECT 7401 ))
T
T
99 A. encheleia (DSM 11577 )
81 Aeromonas spp. HG11 (CECT 4253)
T
T
T
87 T
A. rivuli (CECT 7518 )
T
T
T
T
97 A. bestiarum (ATCC 51108 )
T
A. popoffii (CIP 105493 )
T
T
99 T
A. schubertii (ATCC 43700 )
0.02

A. caviae strains derived from the rpoD and gyrB genes sequences (1330 nt).
-- 170 --
Isolate 34
Isolate 77
Isolate 59
Isolate 146
Isolates (90 115)
Isolate 130
Isolate 89
Isolate 127
99 Isolate 86
Isolate 116
Isolates (117 118 260)
Isolate 83
Isolate 61
Isolate 113
Isolate 98
Isolate 185
Isolate 23
Isolate 84
Isolate 243
Isolate 69
Isolate 133
Isolates (144 145 148 150 151 152)

T
84 A. hydrophila (ATCC 7966
99
Isolate 112
Isolate 101
72
Isolates (126 245)
99 99 Isolate 128
Isolate 105
Isolate 231
Isolate 261
T
T
T
A. piscicola (CECT 7443 )
99
T
T
A. popoffii (CIP 105493 )
T
T

T
71
T

T
T
98 A. sanarellii (CECT 7402 )

T
T
T
T
T
Aeromonas spp. HG11 (CECT 4253)

T
T
T
T
T
0.02

A. hydrophila strains derived from the rpoD and gyrB genes sequences (1331 nt).
-- 171 --
Isolate 111
Isolate 114
Isolate 159
97 Isolate 174
Isolate 177
Isolate 259
Isolate 269
Isolates (28 166)
Isolate 211
Isolate 125
Isolate 134
Isolates (224 225)
Isolates (164 171)
Isolates (24 25)
Isolate 136
Isolate 268
Isolates (131 135)
Isolates (247 252)
Isolate 265
Isolate 129
Isolate 33
Isolate 97
92 Isolates (99 120)
Isolate 72
Isolates (175 233)
Isolate 184
Isolate 237
99 Isolate 238
Isolate 254
A. veronii bv. sobria (ATCC 9071)
Isolate 27
Isolate 66
Isolate 218
79 Isolate 147
Isolate 214
99 Isolate 215
79 Isolates (81 219)
Isolate 221
Isolate 267
Isolate 100
T
Isolate 266
T
Isolate 253
96 99 Isolate 262
Isolate 35
T
83 A. jandaei (ATCC 49568 )
T
Isolate 199
T
99 A. salmonicida (CECT 894 )
Isolate 190
T
99 A. popoffii (CIP 105493 )
T
Isolate 68
T
T
T
99 A. hydrophila (ATCC 7966 )
99 Isolate 85
Isolate 179
99 Isolate 29
T
T
Aeromonas spp.HG 11 (CECT 4253)
T
74 A. eucrenophila (ATCC 23309 )
T
70 A. tecta (CECT 7082 )
T
99 A. caviae (ATCC 13136)
T
T
T
T
T
T
99 Isolate 186
T
0.02
Figure 4.4 Concatenated neighbour-joining phylogenetic tree derived from the rpoD
and gyrB genes sequences (1341 nt) showing the position of A. veronii bv. sobria and
other species including strain 266.
-- 172 --
Table 4.3 Distribution of Aeromonas spp. among clinical and environmental samples following genotypic characterization
Clinical Environmental
Species No. isolated Wound Stool Blood Miscellaneous Total Water Fish Crab Total
(%)
A. allosaccharophila 1 (0.5) 1 (3.0) 1 (0.6)
A. dhakensis 60 (30.7) 22 (40.7) 4 (12.1) 3 (9.0) 5 (27.1) 34 (23.8) 24 (54.5) 2 (28.5) 26 (50.0)
A. bestiarum 1 (0.5) 1 (3.0) 1 (0.6)
A. caviae 36 (18.4) 5 (9.2) 11 (33.3) 11 (32.2) 7 (30.4) 34 (23.8) 1 (2.2) 1 (14.2) 2 (3.8)
A. hydrophila 38 (19.4) 16 (29.6) 2 (6.0) 7 (21.2) 8 (34.7) 33 (23.0) 4 (9.0) 1 (14.2) 5 (9.6)
A. jandaei 3 (1.5) 2 (4.5) 1 (14.2) 3 (5.7)
A. media 3 (1.5) 1 (3.0) 1 (3.0) 2 (1.3) 1 (14.2) 1 (1.9)
A. salmonicida 2 (1.0) 1 (1.8) 1 (0.6) 1 1(1.9)
A. schubertii 1 (0.5) 1 (1.8) 1 (0.6)
A. veronii bv. sobria 49 (25.1) 9 (16.7) 14 (42.4) 10 (30.3) 3 (13.0) 36 (25.1) 12 (27.2) 1 (14.2) 13 (25.0)
Aeromonas spp. 1 (0.5) 1 (2.2) 1 (1.9)
Total 195 54 33 33 23 143 44 7 1 52
- 173 -
4.3.4. Phenotypic differentiation of Aeromonas dhakensis from other major spp.
Biochemically, A. dhakensis could be differentiated from A. hydrophila by its inability

to produce acid from L-arabinose, ability to utilize citrate (93%) and produce
alkylsulfatase (73%). In contrast, all A. hydrophila strains produced acid from L-
arabinose but were less likely to utilize citrate (26%) as a carbon source or produced
alkylsulfatase (3%); from A. caviae by a positive Vogues-Proskauer reaction (95%
positive), production of elastase (93%), stapholysin (82%) and LDC (95%) while A.
caviae was usually negative in all these tests; from A. veronii bv. sobria by its ability to
utilize DL-lactate (78 versus 2%) and production of stapholysin (82 versus 0%) (Table
4.4).
4.3.5. Intra- and inter-species dissimilarities
The intra-species dissimilarity derived from the combination of the rpoD and gyrB
(approximately 1,294 bp) ranged from 0.4 to 3.5% between the type species and the
wild strains identified as A. dhakensis. Interspecies dissimilarity ranged from 19.1%
between A. molluscorum and A. diversa to 1.4% between A. encheleia and Aeromonas
spp. HG11 (Table 4.5 in the CD ROM attached).
4.4. DISCUSSION
The distribution of A. dhakensis strains in clinical and water samples found in the
present study contradicts the long-standing notion that A. caviae, A. hydrophila, and A.
veronii bv. sobria represent the most frequently isolated aeromonads (Altwegg and
Geiss 1989; Janda and Abbott 1998; Ørmen et al. 2005). The number of A. hydrophila
strains reclassified into several different species after genotypic characterization
indicates that accurate identification of aeromonads requires molecular methods.
Furthermore, these results concurred with those of Soler et al. (2004) who suggested
that the combined analysis of more than one target improved the resolving power and
the ability to differentiate between closely related species.
- 174 -
Table 4.4 Biochemical characteristics of Aeromonas after genotypic identification (% positive)
Adh Ahy Aca Avs Ame Aja Asa Aal Abe Asc
No. of strains
Characteristics 60 38 36 49 3 3 2 1 1 1
Indole 95 100 92 96 100 100 100 + + 
Citrate 93 26 78 84 0 100 100   
VP 95 100 0 90 0 67 100   +
LDC 95 100 3 100 0 100 50 + + +
Gas from glucose 90 95 3 88 0 100 50 + + 
Acid from:
L-Arabinose 0 100 100 4 100 0 100  + 
Cellobiose 0 13 81 40 100 0 100 +  
Lactose 3 16 92 30 100 0 100   
Mannitol 100 100 100 98 100 100 100 + + 
-M-D-glucoside 93 82 0 38 0 33 100   
Salicin 95 95 97 20 100 0 100   
Sucrose 100 82 100 98 100 0 100 + + 
G-1-P/G-6-P 98 100 8 100 100 100 100 + + +
Aesculin hydrolysis 97 100 97 42 100 0 100 + + 
Gluconate 60 74 0 75 0 100 50   
-Haemolysis 95 66 31 92 33 100 100  + +
- 175 -
Adh Ahy Aca Avs Ame Aja Asa Aal Abe Asc
No. of strains
Characteristics 60 38 36 49 3 3 2 1 1 1
Utilization of:
DL Lactate 78 76 72 0 0 0 0   +
Urocanic 83 87 78 78 33 100 50 +  +
PZA 43 32 94 16 67 0 0   
Stapholysin 82 89 0 2 0 0 50   
Alkylsulfatase 73 3 3 26 0 33 0 +  +
Elastase 93 100 0 0 0 0 100  + 
Tyrosine 53 66 19 40 33 67 50   +
CephalothinR 93 95 92 86 100 67 100 R S R
PYR 0 0 0 8 0 67 0 +  
DeferoxamineR 100 100 100 94 100 100 100 S R R
O129R 98 92 100 78 100 100 100 + + +
Growth in TCBS 57 39 89 62 0 33 50   
CAMP aerobic 88 55 0 22 0 0 50   +
CAMP anaerobic 90 68 0 24 0 0 100   
ColistinR 77 76 17 64 0 100 100 R S S
Adh, A. dhakensis; Ahy, A. hydrophila; Aca, A. caviae; Avs, A. veronii bv. sobria; Ame, A. media; Aja, A. jandaei; Asa, A. salmonicida; Aal,
A. allosaccharophila; Abe, A. bestiarum; Asc, A. schubertii; PZA, pyrazinamidase activity; PYR, pyrrolidonyl--naphthylamide activity;
TCBS, thiosulphate citrate bile sucrose agar.
-- 176 --
The results presented in this chapter revealed that, when used independently, sequences
of both genes led to comparable identification, suggesting that gyrB and rpoD were
equivalent markers for the taxonomic discrimination of Aeromonas spp. Phylogenetic
trees generated from the rpoD and gyrB sequences (Figs. 4.1 to 4.4) were comparable to
the one derived from a partial rpoB gene sequence (Lamy et al. 2010) except that the
former sequences consistently placed A. molluscorum well within the centre of the trees,
while it was placed in a more distant position when the tree was constructed from the
rpoB sequences alone.
Data presented here may also help to explain the biochemical and genotypic
heterogeneity previously observed in A. hydrophila (Miyata et al. 1995; Janda and
Abbott 1998). Results from this study suggest that a lack of congruence between
phenotypic and genotypic identification exists consistent with a previous study (Beaz-
Hidalgo et al. 2010). Correct identification occurred in only 35 (33.6%) out of 104
strains phenotypically identified as A. hydrophila, while the remaining strains were re-
identified as A. dhakensis (54 strains, 51.9%), A. veronii bv. sobria (14, 13.4%), and A.
bestiarum (one strain, 1.2%) by molecular analysis.
There are several reasons for this to occur. Firstly, the usefulness of many tests used in
here and also observed by others (Abbott et al. 2003) reveals that Aeromonas lack
reliable biochemical markers. Secondly, the discriminatory value of some tests ranging
from 16 to 75% is not optimal. Thirdly, the true phenotypic profiles of the minor or less
frequently isolated species remains unknown. This situation may eventually be
resolved, at least for the major species, by determining the phenotypic characteristics of
genotypically identified strains. For example, production of elastase was observed only
in strains of A. hydrophila (100%), A. salmonicida (100%) and A. dhakensis (93%).
Similarly, DL lactate was utilized by A. hydrophila (76%), A. dhakensis (78%) and A.
caviae (72%) while stapholysin production was observed mainly in A. hydrophila
(89%), A. salmonicida (50%) and A. dhakensis (82%). Also among the major species,
acid from L-arabinose was produced by all A. hydrophila, A. caviae and A. salmonicida
but not by A. dhakensis (0%) strains. Similarly, acid production from cellobiose was
observed in the majority of A. caviae (81%) and all A. salmonicida (100%) but not in A.
dhakensis (0%) and rarely in A. hydrophila (4%) strains. These results suggest that these
phenotypic characteristics may be considered validated in genetically identified
aeromonads.
-177-
The interspecies dissimilarity values obtained between A. encheleia and Aeromonas sp.
HG11, confirms the close relationship that exists between these species (Table 4.5 CD-
ROM). The sequence divergence of specific isolates ranged from 0.4% for strains 223,
232 and 240 to 3.5% for strain 213. This result is consistent with the positions of these
isolates as shown in Fig. 4.1 suggesting also that the taxonomic position of strain 213
requires further investigation. Similarly, the position of isolate 266 indicates that this
strain forms a separate line of descent from other species in the genus with A.
allosaccharophila DSM 11576T and A. fluvialis CECT 7401T as its closest relatives and
requires further investigation (Fig. 4.4).
In this chapter, WA clinical and environmental Aeromonas isolates previously classified

by a phenotypic scheme were re-identified by determining the sequences of the gyrB
and rpoD housesekeeping genes. Thus, results in this chapter revealed that accurate
identification of these bacteria is compromised when only a phenotypic method is used.
Hence, distribution of the species is also compromised and in the case of A. dhakensis
(formerly A. aquariorum) the study shows that this species is globally distributed and
can be misidentified as A. hydrophila consistent with previous observations (Figueras et
al. 2009).
-178-
CHAPTER 5: ANTIMICROBIAL SUSCEPTIBILITIES
5.1. INTRODUCTION
Antimicrobial resistance in these organisms is usually chromosomally mediated, but -

lactamases produced by aeromonads may occasionally be encoded by plasmids (Fosse
et al. 2004; Sánchez-Céspedes et al. 2008) or integrons (Barlow and Gobius 2009).
These enzymes have activity against most -lactam antimicrobial agents, including
cefepime and other extended-spectrum cephalosporins. Antimicrobial susceptibility
reporting for Aeromonas generally followed guidelines for the Enterobacteriaceae until
the Clinical and Laboratory Standards Institute (CLSI) recently published
recommendations (CLSI 2011).
The objective of this chapter was to determine the antimicrobial susceptibility profiles
of a collection of Aeromonas strains against 26 antimicrobial agents by the agar dilution
breakpoint and E-strip methods. The strains were previously characterized by extensive
phenotypic and genotypic methods and were isolated from clinical, fish, and
environmental sources.
Bacterial strains used in this project are listed in Tables 2.6 and 2.7. A total of 193
strains were examined, of these 144 were isolated from clinical specimens including 54
from wound, 33 from blood, 34 from stools and 23 from miscellaneous sources (Table
2.6). Environmental isolates included a total of 49 strains comprising 43 from water,
five from fish and one from crab meat (Table 2.7). All strains were previously
characterized by extensive biochemical testing (Aravena-Román et al. 2011a) and their
identities confirmed genotypically from their gyrB and rpoD gene sequences (Aravena-
Román et al. 2011b). Ten Aeromonas spp. were represented including A. dhakensis (58
strains); A. veronii bv. sobria (49 strains); A. hydrophila (39 strains); A. caviae (36
strains); A. jandaei (three strains); A. media (three strains); A. salmonicida (two strains),
and one strain each of A. allosaccharophila, A. bestiarum and A. schubertii.
5.3. Antimicrobial agents
-179-
Antimicrobial agents tested included amikacin, amoxicillin, amoxicillin-clavulanate,
cephalothin, cefazolin, cefepime, cefoxitin, ceftadizime, ceftriaxone, ciprofloxacin,
gentamicin, meropenem, moxifloxacin, nalidixic acid, nitrofurantoin, norfloxacin,
pipercillin-tazobactam, tetracycline, ticarcillin-clavulanate, tobramycin, trimethoprim,
and trimethoprim-sulfamethoxazole. E-strips containing doxycycline (AB Biodisk,
Solna, Sweden), ampicillin, tigecycline, meropenem and colistin (BioMérieux,
Marcyl’Etoile, France) were used to determine MICs.
Interpretative criteria for tigecycline, meropenem and ampicillin were derived from
those described for the Enterobacteriaceae by the Food and Drug Administration
(BioMérieux 2010), and those for doxycycline were derived from guidelines described
by the CLSI (2011), as outlined in Table 1 of the E-strip package insert. Interpretative
criteria for colistin were from Fosse et al. (2003b) (Table 2.9). Interpretative criteria for
the reminding antimicrobials were in accordance with the CLSI (CLSI 2006).
5.4. RESULTS
All isolates were inhibited by amikacin, cefepime (8 g/ml), ciprofloxacin, meropenem,

norfloxacin, and tigecycline. Three (1.6%) strains were inhibited by amoxicillin as
shown by the agar dilution and confirmed by the E-strip method. The MIC values were
8 g/ml for all three isolates which included one clinical and one environmental A.
veronii bv. sobria and one environmental A. dhakensis isolate (Table 5.1). Thirty-two
isolates (16.5%) failed to grow in the presence of amoxicillin-clavulanate, while 17
(8.8%) were non-susceptible to ticarcillin-clavulanate (16/2 g/ml). Of these, eight
(4.4%) were also non-susceptible to the higher concentration of ticarcillin-clavulanate
(64/2 g/ml).
Susceptibility to cephalothin and cefazolin was observed in 53 (27.4%) and 40 (20.7%)

isolates, respectively. A moderate level of susceptibility was detected with cefoxitin
(126 isolates, 65.2%) and colistin (86 isolates, 44.5%). The majority of the isolates were
susceptible to the remaining antimicrobial agents. The MICs for doxycycline ranged
from 0.064 to 24.0 g/ml, those for tigecycline ranged from 0.064 to 3.0 g/ml, and
those for colistin ranged from 0.094 to >256 g/ml. Susceptibility to doxycycline and
tigecycline was high in clinical strains, at 97.2 and 100%, respectively.
-180-
There was no statistically significant difference in antimicrobial susceptibility between
clinical and environmental isolates of A. dhakensis. In contrast, clinical isolates of A.
veronii bv. sobria were less susceptible than environmental strains (p = 0.0226). Other
statistically significant differences were observed for amoxicillin-clavulanate between
A. dhakensis and A. hydrophila (p = 0.0036) (A. dhakensis was less susceptible than A.
hydrophila) and between A. dhakensis and A. veronii bv. sobria (p = 0.0053) (A. veronii
bv. sobria was less susceptible than A. dhakensis) but not between A. dhakensis and A.
caviae. Further, susceptibility to cephalothin was significantly higher in A. veronii bv.
sobria than in A. dhakensis, A. caviae, and A. hydrophila (p = 0.0001) (Table 5.1).
Nine clinical isolates (6.2%) were able to grow in agar plates containing 4 g/ml of
tobramycin, including seven (14.2%) A. veronii bv. sobria, one (2.7%) A. caviae, and
one (33.3%) A. media isolate. Multidrug non-susceptible patterns were observed in
three (1.5%) isolates. Of these, A. caviae strain 138 was less susceptible to most -
lactams, including aztreonam. A. veronii bv. sobria strain 189 was the only isolate to
grow in the presence of both gentamicin and tobramycin. Among the minor species, the
single A. allosaccharophila strain exhibited a multidrug resistance profile including
resistance to both fluoroquinolones and trimethoprim/sulfamethoxazole (Table 5.1).
Susceptibility to colistin was recorded in 57 (39.05%) clinical and 29 (59.1%)

environmental isolates. Aeromonas caviae was the most susceptible species (83.7%),
next to A. dhakensis (31.0%). Most environmental isolates were susceptible to
tetracycline (81.6%) and nalidixic acid (93.8%). Moderate susceptibility was observed
with amoxicillin-clavulanate (46.9%), cephalothin (46.9%), and cefoxitin (63.2%),
while only five (10.2%) isolates were susceptible to cefazolin (Table 5.2).
5.5. DISCUSSION
In general, growth of Aeromonas was inhibited by most antimicrobial agents, with few
isolates showing a multidrug non-susceptible profile. Susceptibility to tetracycline was
high (94.3%), consistent with previous reports from Australia and the United States
(Koehler and Ashdown 1993). In contrast, tetracycline resistance in up to 49% of
isolates has been reported in studies from the Asian region (Chang and Bolton 1987; Ko
et al. 1996).
-181-
Table 5.1 Antimicrobial susceptibilities determined for different Aeromonas spp. (percentage/number of strains susceptible)
(n = 3)
(n = 3)
(n = 2)
(n = 1)
(n = 1)
(n = 1)
(g/ml)
(n = 36)
(n = 58)
(n = 38)
(n = 49)
Antimicrobial agent
A. media
A. caviae
A. jandaei
A. dhakensis
A. bestiarum
A. schubertii
A. hydrophila
Breakpoint(s)
A. salmonicida

A. allosaccharophila
Amoxicillin 8 0 1.7 (1) 0 4.0 (2) 0 0 0 R R R

Amoxicillin-clavulanate 8/4 13.9 (5) 24.1 (14) 2.6 (1) 16.3 (8) 66.7 (2) 0 0 R S S
Norfloxacin 4 100 100 100 100 100 100 100 R S S
Ciprofloxacin 1 100 100 100 100 100 100 100 R S S
Nitrofurantoin 32 97.2 (35) 100 100 100 100 100 100 S S S
Trimethoprim 8 86.1 (31) 96.5 (56) 94.7 (36) 97.9 (1) 100 100 100 R S S
Cephalothin 8 8.3 (3) 22.4 (13) 5.2 (2) 77.5 (38) 0 0 0 R R S
Meropenem 0.25 97.2 (35) 100 97.3 (37) 95.9 (47) 100 100 100 R S S
1 97.2 (35) 100 97.3 (37) 100 100 100 100 S S S
4 100 100 97.3 (37) 100 100 100 100 S S S
Gentamicin 4 100 100 100 97.9 (48) 100 100 100 S S S
Tobramycin 4 94.4 (34) 100 100 87.7 (43) 100 66.7 (2) 100 S S S
Amikacin 16 100 100 100 100 100 100 100 S S S
Ceftriaxone 1 97.2 (35) 96.5 (56) 94.7 (36) 100 100 100 100 S S S
Ceftazidime 0.5 94.4 (34) 98.2 (57) 94.7 (36) 100 100 66.7 (2) 100 R S S
4 97.2 (35) 100 100 100 100 100 100 S S S
Aztreonam 4 100 100 100 100 100 100 100 S S S
-182-
(n = 3)
(n = 3)
(n = 2)
(n = 1)
(n = 1)
(n = 1)
(g/ml)
(n = 36)
(n = 58)
(n = 38)
(n = 49)
Antimicrobial agent
A. media
A. caviae
A. jandaei
A. dhakensis
A. bestiarum
A. schubertii
A. hydrophila
Breakpoint(s)
A. samonicida

Ticarcillin-clavulanate 16/2 94.4 (34) 96.5 (56) 86.8 (33) 87.7 (43) 100 33.3 (1) 100 R S S
64/2 100 98.2 (57) 97.3 (37) 93.8 (46) 100 66.7 (2) 100 S S S
Trimeth/sulfamethoxazole 2/38 94.4 (34) 100 100 100 100 100 100 R S S
Cefepime 0.5 97.2 (35) 98.2 (57) 100 100 100 100 100 S S S
8 100 100 100 100 100 100 100 S S S
Nalidixic acid 16 97.2 (35) 94.2 (55) 100 95.9 (47) 100 100 100 R S S
Cefoxitin 8 69.4 (25) 20.6 (12) 86.8 (33) 97.9 (48) 100 66.7 (2) 100 R R S
Pipercillin-tazobactam 16/4 97.2 (35) 98.2 (57) 97.3 (37) 95.9 (47) 100 100 100 S S S
64/4 97.2 (35) 100 100 95.9 (47) 100 100 100 S S S
Moxifloxacin 1 97.2 (35) 98.2 (57) 100 100 100 100 100 S S S
Tetracycline 4 91.6 (33) 93.1 (54) 97.3 (37) 97.9 (48) 100 100 100 R S S
Cefazolin 2 0* 0 3.2 (1)** 5.5 (2)^ 0 0# 0 R NT R
Doxycycline S, 4; I, 8; R,16 86.1 (31) 93.1 (54) 94.7 (36) 97.9 (48) 100 100 100 S S S
Tigecycline S, 2; I, 4; R,8 100 100 100 100 100 100 100 S S S
Colistin S, <2 91.6 (33) 24.1 (14) 28.9 (11) 87.7 (43) 0 100 100 S R S
*15 strains tested; **31 strains tested; ^36 strains tested; #only one strain tested; NT, not tested; R, resistant; S, susceptible; I, intermediate
-183-
Table 5.2 Antimicrobial susceptibilities of Aeromonas spp. by source of isolation
MIC Percentage (no. of strains susceptible)
Antimicrobial agent Breakpoint(s) All isolates Clinical Environmental

(g/ml) (n = 193) (n = 144) (n = 49)
Amoxicillin 8 1.6 (3) 0.7 (1) 4.0 (2)

Amoxicillin-clavulanate 8/4 16.5 (32) 6.25 (9) 46.9 (23)
Norfloxacin 4 100 100 100
Ciprofloxacin 1 100 100 100
Nitrofurantoin 32 99.5 (192) 99.3 (143) 100
Trimethoprim 8 92.7 (179) 91.0 (131) 97.9 (48)
Cephalothin 8 27.4 (53) 20.8 (30) 46.9 (23)
Meropenem 0.25 100 100 100
1 100 100 100
4 100 100 100
Gentamicin 4 99.5 (192) 99.3 (143) 100
Tobramycin 4 95.3 (184) 93.8 (135) 100
Amikacin 16 100 100 100
Ceftriaxone 1 96.9 (187) 95.8 (138) 100
Ceftazidime 0.5 97.4 (188) 96.5 (139) 100
4 99.5 (192) 99.3 (143) 100
Aztreonam 4 99.5 (192) 99.3 (143) 100
Ticarcillin-clavulanate 16/2 91.2 (176) 88.9 (128) 97.9 (48)
64/2 95.9 (185) 95.1 (137) 97.9 (48)
Trimethoprim- 2/38 98.9 (191) 98.6 (142) 100
sulfamethoxazole
Cefepime 0.5 98.9 (191) 98.6 (142) 100
8 100 100 100
Nalidixic acid 16 96.9 (187) 97.9 (141) 93.8 (46)
Cefoxitin 8 65.2 (126) 65.9 (95) 63.2 (31)
Pipercillin-tazobactam 16/4 97.4 (188) 96.5 (139) 100
64/4 98.9 (191) 98.6 (142) 100
Moxifloxacin 1 98.9 (191) 99.3 (143) 97.9 (48)
Tetracycline 4 94.3 (182) 95.1 (137) 81.6 (40)
Cefazolin 2 20.7 (40) 8.2 (9)a 10.2 (5)
Doxycycline S, 4; I, 8; R,16 97.9 (189) 97.2 (140) 100
Tigecycline S, 2; I, 4; R,8 100 100 100
Colistin S, <2 44.5 (86) 39.5 (57) 59.1 (29)
a
109 strains tested; MIC, minimum inhibitory concentration; S, susceptible; R, resistant; I,
intermediate
-184-
The three amoxicillin-susceptible isolates described here confirm that amoxicillin-
susceptible strains other than A. trota (Carnahan et al. 1991a) occur, as previously
reported (Abbott et al. 2003; Huddlestone et al. 2007), and that their growth may be
suppressed by amoxicillin-containing media. Susceptibility to cepalothin was high in A.
veronii bv. sobria, a feature that has been reported by others and used as a phenotypic
marker to differentiate this species from other aeromonads (Koehler and Ashdown
1993). Similarly, susceptibility to colistin was proposed as an identifying marker for
Aeromonas (Fosse et al. 2003b). Results for colistin were consistent with those obtained
by Fosse et al. (2003b) for A. hydrophila (61.7% resistance in this research, versus
85.8%) and A. jandaei (100% resistance in both studies). However, MIC results
presented here differed from the previous study for A. veronii bv. sobria (61.7% versus
2.5%) and for A. caviae (16.2% versus 2.1%).
The number of isolates susceptible to pipercillin-tazobactam (97.4 and 98.9%) and

ticarcillin-clavulanate (91.2 and 95.9%) were much higher than those susceptible to
amoxicillin-clavulanate (16.5%), suggesting that the former two antimicrobials could be
considered for the treatment of infections caused by Aeromonas. Zemelman et al.
(1984) reported that, depending on the strain, the MIC to amoxicillin decreased from
two to eight fold in combination with clavulanate, thus increasing the activity of this
agent. However, prolonged use of amoxicillin-clavulanate to treat infections caused by
A. veronii bv. sobria has resulted in overexpression of carbapenemases and
cephalosporinases (Sánchez-Céspedes et al. 2009).
All isolates were susceptible to meropenem. A single A. hydrophila isolate that grew in
all three agar dilution concentrations was susceptible by the E-strip method using two
different inocula, 1.5 x 108 CFU/ml and 3.0 x 108 CFU/ml. A large inoculum (3.0 x 108
CFU/ml) has been recommended to detect carbapenemase production before antibiotic
therapy using carbapenems is considered as conventional in vitro susceptibility testing
may fail to detect the presence of carbapenemases in otherwise carbapenemase-
susceptible phenotypes (Rossolini et al. 1996).
Differences in antimicrobial susceptibility between clinical and environmental strains

have been previously described. The resistance observed in environmental aeromonads
has been associated with heavily polluted waters as the source of multiple resistance
plasmids (Huddlestone et al. 2006). In contrast, data from this study suggest that (i)
environmental strains are not the principal source of resistance but that antibiotic
-185-
resistance in clinical isolates may be due to the selective pressure to which these
organisms may have been exposed, (ii) water sources are less polluted in Western
Australia than other regions, and (iii) environmental strains may have acquired
resistance determinants from clinical strains.
Empirical treatment in some cases does not include cover for Aeromonas species
particularly in infections where the antimicrobials employed are directed toward
microorganims such as staphylococci and streptococci. Inappropriate antimicrobial
therapy has been administered in 20% of infections involving aeromonads (Scott et al.
1978; Vila et al. 2002; Bravo et al. 2003; Figueras 2005) with the potential to increase
morbidity and mortality of affected individuals.
No visible resistance patterns were detected among the major species with the exception
of a few tobramycin-resistant A. caviae and A. veronii bv. sobria strains while most
isolates were highly susceptible to the fluoroquinolones, aminoglycosides,
trimethoprim/sulfamethoxazole, meropenem and third and fourth generation
cephalosporins.
In this chapter, the antimicrobial susceptibility patterns of 193 WA clinical and

environmental Aeromonas isolates were tested against 26 antimicrobial agents. Results
showed that the number of multidrug non-susceptible Aeromonas species in WA
remains low thus, providing clinicians with a wide choice of antimicrobial agents to
treat infections with these bacteria, consistent with other reports (Ko et al. 1996;
Zhiyong et al. 2002). However, antimicrobial susceptibility testing for clinically
significant strains is highly recommended, as resistance to antibacterial agents may be
strain dependent.
-186-
CHAPTER 6: DESCRIPTION OF AEROMONAS
AUSTRALIENSIS SP. NOV.
6.1. INTRODUCTION
Currently, the genus Aeromonas consists of 27 validated species, seven subspecies and
two biovars. However, some represent synonyms of other species as is the case for A.
trota (Carnahan et al. 1991a), junior synonym of A. enteropelogenes while A.
ichthiosmia (Schubert et al. 1990a) is a junior synonym of A. veronii (Huys et al. 2001).
The position of Aeromonas group HG11 is still uncertain while A. aquariorum and A.
hydrophila ssp. dhakensis have been combined to form A. dhakensis comb. nov. sp. nov
(Beaz-Hidalgo et al. 2013). Further, A. hydrophila ssp. anaerogenes has been
reclassified as A. caviae (Miñana-Galbis et al. 2013) while the validity of A. culicicola
(Pidiyar et al. 2002) and the recognition of A. punctata (Schubert 1967ab) as a senior
synonym of A. caviae have been a source of controversy among microbiologists.
In recent years, the use of 16S rRNA gene sequence to differentiate between Aeromonas
species has been superseded by the use of single-copy genes (Yañez et al. 2003; Soler et
al. 2004; Küpfer et al. 2006; Nhung et al. 2007; Sepe et al. 2008; Miñana-Galbis et al.
2009). Sequences derived from rpoD and gyrB were used for the first time in the
definition of the species A. tecta and A. dhakensis (previously A. aquariorum) by
Demarta et al. 2008 and Martínez-Murcia et al. 2008, respectively, while four
housekeeping genes were used in the description of A. piscicola and A. diversa (Beaz-
Hidalgo et al. 2009; Miñana-Galbis et al. 2010).
During the course of this study, a Gram-negative, facultatively anaerobic bacillus,

designated strain 266T was isolated from an irrigation water sample collected in the
South-West of Western Australia. Initial phenotypic and genotypic testing suggested
that strain 266 may represent a novel Aeromonas spp. The purpose of this chapter was
to use a polyphasic approach to investigate the true taxonomic position of strain 266T.
Bacterial strains used here are listed in Table 2.4. GenBank accession numbers
deposited for strain 266T are listed in Table 4.2.
-187-
6.3. RESULTS
6.3.1. Phenotypic characteristics
Strain 266T consisted of motile rods with the presence of a polar flagellum. Cells stained
Gram-negative, showing straight, non-spore forming and non-encapsulated rods, 0.6-0.9
m wide and 1.8-2.7 m long (Fig. 6.1), oxidase and catalase positive, reduced nitrate
to nitrite and were susceptible to O/129 (150 g). Colonies on TSA plus sheep blood
were 1.5 to 2.0 mm in diameter, glossy, circular and beige in colour after 24 h at 35C.
No brown diffusible pigment was produced on TSA at 35C. Growth occurred at 25, 30
and 35C, but not at 4 or 44C after 24 h on TSA plus sheep blood. -haemolysis was
observed on sheep (5%) blood agar. Strain 266T grew on MacConkey and TCBS agars
and on nutrient broth in 0 and 3% NaCl but not in 6% NaCl broth. Indole was produced
from tryptophan. The ONPG reaction was positive when tested by disk (Rosco,
Taastrup, Denmark) but not with the API 20E strip (BioMérieux).
Strain 266T did not utilize citrate (Simmon’s and Hänninen’s methods), malonate or
produced gas from glucose but a positive citrate reaction was observed with the API
20E strip. DL-lactate was utilized at 30 but not at 35C. Hydrogen sulphide, urease and
elastase were not produced and aesculin was not hydrolysed. Clearing of tyrosine-
containing medium was not observed but starch was hydrolysed after five days
incubation. DNase and lipase activity were detected and potassium gluconate was
oxidised. Strain 266T utilized acetate, and arginine was dehydrolased, lysine was
decarboxylated but not ornithine. A positive reaction was observed for VP, gelatin and
urocanic acid. No activity was detected for stapholysin, phenylalanine deaminase,
alkylsulfatase, pyrazynamidase and Jordan’s tartrate was negative.
Acid was produced from the following carbohydrates: fructose, galactose, glucose,
glycerol, glucose-1-phosphate, glucose-6-phosphate, maltose, mannose, N-acetyl-
glucosamine, ribose, saccharose and trehalose but not from adonitol, amygdalin, L-
arabinose, cellobiose, dulcitol, myo-inositol, lactose, lactulose, D-mannitol, melibiose,
-methyl-D-glucoside, raffinose, L-rhamnose, salicin and D-sorbitol. Acid production
was observed for the following carbohydrates with the API 50C strip (BioMérieux):
glycerol, D-ribose, D-galactose, D-glucose, D-fructose, D-mannose, N-acetyl-
glucosamine, D-maltose, D-saccharose, D-trehalose, starch, glycogen and potassium
-188-
gluconate was oxidized. Key biochemical characteristics used to differentiate strain
266T from all other Aeromonas spp.are presented in Table 6.1. Phenotypically, Strain
266T can be differentiated from other D-mannitol negative species by several
biochemical and physiological tests (Table 6.2).
6.3.2. FAME profile
The CFA composition of strain 266T contained 28.7% sum in Feature 3 (C16:1 w7c or C16:1
w6c), 11.4% sum in Feature 8 (C18:1 w7c or C18:1 w6c), 11.3% C16:0, 7.2% C16:1 w7c alcohol,
6.0% C12:0, 5.6% sum in Feature 2 (C12:0 aldehyde? or C16:1 iso I or C14:0 3OH), 3.7% sum in
Feature 9 (C16:0 10 methyl or C17:1 iso w9c), 3.5% iso-C15:0, 3.3% C17:1 w8c, 3.2% iso-C17:0,
2.5% C14:0 and 1.7% C16:0 N alcohol (Table 6.3).
6.3.3. Protein profile
The mass spectra of strain 266T ranged from 2000 to 11300 Da and differed from the
closes related species A. allosaccharophila, A. fluvialis and A. veronii (Fig. 6.2).
6.3.4. Genotypic characteristics
Analysis of the 16S rRNA gene (1503 bp) confirmed that strain 266T belonged to the
genus Aeromonas and showed the highest 16S rRNA gene sequence similarity with the
type strains of A. fluvialis (99.6%) followed by A. allosaccharophila and A. veronii both
with a similarity of 99.5%, these also being the closest neighbours in the phylogenetic
tree (Fig. 6.3). Strain 266T showed the minimum interspecies similarity with A. veronii
(3.2%), which was higher than those obtained between A. piscicola and A. bestiarum
(approximately 2.1%) or A. allosacchorophila and A. veronii (approximately 2.9%) as
reported by Martínez-Murcia et al. (2011) and shown in Table 6.4 in the CD ROM
attached. The DDH results between strain 266T and the type strains of A.
allosacccharophila, A. veronii and A. fluvialis were 65.3, 63.7 and 52.2%, respectively,
all below the 70% limit for species delineation (Wayne et al. 1987; Stackebrandt and
Goebel 1994) (Table 6.5). Analysis of gyrB and rpoD genes suggested that strain 266T
formed a phylogenetic line independent of other species in the genus. The sequences of
six housekeeping genes (gyrB, rpoD, recA, danJ, gyrA, and dnaX) were aligned with
those of strain 266 culminating with a concatenated tree (MLPA) derived from all six
-189-
genes confiming that genetically, strain 266 formed a separate line of descent and that
A. veronii and A. allosaccharophila were the nearest relatives (Figs 6.4 to 6.10).
6.3.5. Antimicrobial susceptibilities
Strain 266T was resistant to amoxicillin and cefazolin and was susceptible to amikacin,
amoxicillin-clavulanate, aztreonam, cephalothin, cefepime, cefoxitin, ceftazidime,
ceftriaxone, ciprofloxacin, colistin, gentamicin, meropenem, moxifloxacin, nalidixic
acid, nitrofurantoin, norfloxacin, pipercillin-tazobactam, tetracycline, ticarcillin-
clavulanate, tobramycin, trimethoprim and trimethoprim-sulfamethoxazole.
-190-
A
Figure 6.1 Electron microscopy images of strain 266T. A. Scanning electron

microscope (Bar 4 μm). B. Transmission electron microscope, negative stain (Bar 500
nm).
-191-
Table 6.1 Key tests for the phenotypic identification of strain 266T from other Aeromonas spp.
Characteristics
Strain 266T
A. dhakensis§
A. bestiarum
A. bivalvium‡
A. caviae
A. diversaΦ
A. encheleia
-haemolysis + V() n(+) +(+)  () V() +(+) V(+)

Vogues Proskauer reaction +  () +(+) V(+)  ()  () V(+)  ()
LDC + +(+) +(+) V(+) +(+)  ()  ()  ()
Glucose (gas)  +(+) +(+) V(+)  ()  ()  () V(+)
Aesculin hydrolysis  V(+) +(+) V(+) +(+) V(+)  () V(+)
Acid from:
L-arabinose  V(+)  () +(+) +(+) +(+)  ()  ()
Salicin   () +(+) V(+) +(+) V(+)  ()  (+)
D-mannitol  +(+) +(+) +(+) +(+) +(+)  () +(+)
Utilization of:
Citrate  V() nd(+)  () +(+) +(+) nd()  ()
DL-lactate ++  ()  ()  () +(+) +() nd()  ()
-192-
Strain 266T
A. eucrenophila
A. fluvialis#
A. hydrophila
A. jandaei
A. media
A. molluscorum†
Characteristics
-haemolysis + +(+)  () +(+) +(+) V() V()
Vogues Proskauer reaction +  ()  () +(+) +(+)  ()  ()
LDC +  ()  () +(+) +(+)  ()  ()
Glucose (gas)  V(+) +(+) +(+) +(+)  ()  ()
Aesculin hydrolysis  V(+)  () +(+)  () V(+) +(+)
Acid from:
L-arabinose  V(+)  () V(+)  () +(+) +(+)
Salicin  V() +(+) V()  () V(+) nd(+)
D-mannitol  +(+) n(+) +(+) +(+) +(+) +(+)
Utilization of:
Citrate   () +(+) +(+) +(+) V(+) +(+)
DL-lactate ++  () nd() V()  () V(+) V()
-193-
Strain 266T
A. popoffii
A. piscicola¦
A. rivuliØ
A. salmonicida
A. sanarellii¥
A. schubertii
A. simiae*
Characteristics
-haemolysis +  () +(+) +(+) V(+)  () V(+)  ()
Vogues Proskauer reaction + +(+) +(+) V(+) V()  () V(+)  ()
LDC +  () +(+)  () V(+)  () V(+) +(+)
Glucose (gas)  +(+) +(+)  () V()  ()  ()  ()
Aesculin hydrolysis   () +(+)  () +(+) +(+)  () V()
Acid from:
L-arabinose  V(+)  ()  () +(+) +(+)  ()  ()
Salicin   () +(+)  () V() +(+)  ()  ()
D-mannitol  +(+) +(+)  () +(+) +(+)  ()  ()
Utilization of:
Citrate  +(+) nd nd() +()  () V(+) nd()
DL-lactate ++ V(+)  () nd()  () nd(+) V(++) nd(++)
-194-
Strain 266T
A. sobria
A. taiwanensis¥
A. tecta¶
A. trota
A. veronii bv.
sobria
A. veronii bv.
veronii
Characteristics
-haemolysis + V(+)  () +(+) V(+) +(+) +(+)
Vogues Proskauer reaction + +()  () V(+)  () +(+) V()
LDC + +(+)  () V(+) +(+)  () +(+)
Glucose (gas)  +()  () +(+) V(+) +(+) +(+)
Aesculin hydrolysis  V() +(+) V(+)  ()  () +(+)
Acid from:
L-arabinose  V() +(+)  ()  ()  (+)  ()
Salicin  V() +(+) V()  ()  () +(+)
D-mannitol  +(+) +(+) +(+) +(+) +(+) +(+)
Utilization of:
Citrate  +(+) +(+)  (+) +(+) V() +(+)
DL-lactate ++  () nd(+)  () +(+)  (+)  (+)
-195-
Abbreviations: +, 85-100% of strains positive; , 0 to 15% of strains positive; V, 16-84% of strains positive. All tests have been
performed for type strains of the different species and results are expressed as in brackets as (+) or (); nd, no data available. Tests for
strain 266T were performed at 30 and 35ºC. Data from species 1-15 were obtained from Abbott et al. (2003) with the exception of tests
indicated as nd, these authors performed tests at 35ºC with the exception of A. popoffii and A. sobria which were tested at 25ºC. Other
tests were performed as follows: *Harf-Monteil et al. (2004) (30ºC); †Miñana-Galbis et al. (2004a) (25ºC); ‡Miñana-Galbis et al. (2007)
(30ºC); §Martínez Murcia et al. (2008) ( 25ºC); ¶Demarta et al. (2008) (30ºC); #Alperi et al. (2010a) (30ºC); ¦Beaz-Hidalgo et al. (2009)
(25ºC); ¥Alperi et al. (2010b) ( 30ºC); ØFigueras et al. (2011a) (30ºC); ΦMiñana-Galbis et al. (2010) (30ºC). +Positive at 30C but not at
35C.
-196-
Table 6.2 Key tests used to differentiate strain 266T from other D-mannitol non-fermentative Aeromonas spp.
Test Strain 266T A. schubertii A. simiae A. diversa
-haemolysis + +  +
Indole +   +
VP + +  +
LDC + + + 
Glucose (gas)    
Hydrolysis of:
Aesculin   + 
Starch* + + + +
Acid from:
D-saccharose +  + 
L-arabinose    
salicin    
Utilization of:
citrate  +  
DL-lactate * + + + 
*Starch hydrolysis and utilization of DL-lactate tube were incubated at 30C. All other tests were performed at 35C
-197-
Table 6.3 Cellular fatty acid profiles of strain 266T and current Aeromonas spp.
Cellular fatty acid (%)
Species 12:0 13:0 i 13:0 14:0 SF1 15:0 i 16:1 w7c SF2 16:0 N
alcohol alcohol
Strain 266T 8.88 1.28 t 3.01 t 3.38 5.80 9.44 1.03
T
A. allosaccharophila DSM 11576 5.77 t t 2.72 t 1.53 5.18 8.14 1.21
T
A. dhakensis CECT 7289 5.72 t t 6.30 1.09 1.53 3.91 12.35 1.04
T
A. bestiarum ATCC 51108 6.62 t t 4.11 t 1.25 6.52 9.05 1.11
T
A. bivalvium CECT 7113 7.41 1.20 t 2.79 ND 1.88 ND 10.90 ND
T
A. caviae ATCC 13136 7.48 t t 4.18 ND 1.59 4.99 9.81 1.31
T
A. culicicola CECT 5761 6.56 1.67 t 3.94 ND 2.84 6.18 8.30 t
T
A. diversa CECT 4254 7.07 1.21 t 4.71 t 1.34 5.81 9.14 2.42
T
A. encheleia DSM 11577 6.81 t ND 3.08 ND 2.34 ND 9.67 ND
A. eucrenophila ATCC 23309T 7.61 2.11 t 3.05 ND 6.38 ND 8.54 ND
T
A. fluvialis CECT 7401 7.37 2.66 t 3.21 ND 3.06 2.56 9.29 1.94
T
A. hydrophila ATCC 7966 6.67 t t 5.60 ND 1.58 5.02 9.74 1.67
T
A. jandaei ATCC 49658 4.90 t 1.09 5.63 t 2.64 4.52 5.69 2.65
T
A. media ATCC 33907 6.84 1.09 ND 2.34 ND 1.94 ND 7.87 ND
T
A. molluscorum DSM 17090 6.50 t t 3.39 t 1.27 t 12.21 t
- 198 -
Species 12:0 13:0 i 13:0 14:0 SF1 15:0 i 16:1 w7c SF2 16:0 N
alcohol alcohol
Strain 266T 8.88 1.28 t 3.01 t 3.38 5.80 9.44 1.03
T
A. piscicola CECT 7443 7.34 1.04 t 3.17 ND 2.98 4.10 9.03 t
T
A. popoffii CIP 105493 7.46 1.18 t 3.51 ND 1.99 6.28 10.46 1.62
T
A. rivuli CECT 7518 8.55 t t 3.36 ND 1.84 t 13.34 ND
T
A. salmonicida CECT 894 11.64 ND 1.14 1.70 2.51 ND t 19.80 t
T
A. sanarellii CECT 7402 8.33 2.09 t 2.62 ND 2.95 ND 10.14 ND
T
A. schubertii ATCC 43700 8.33 2.10 1.90 4.26 1.43 2.63 1.43 9.76 3.02
T
A. simiae DSM 16559 4.98 t t 4.33 ND 2.89 ND 10.08 ND
A. sobria CIP 7433T 5.66 1.10 3.60 4.44 3.16 2.49 2.45 8.23 2.16
T
A. taiwanensis CECT 7403 10.39 1.57 t 3.44 ND 2.80 ND 12.06 ND
T
A. tecta CECT 7082 8.60 1.13 t 3.23 ND 3.29 ND 16.68 ND
T
A. trota ATCC 49657 5.52 1.55 t 3.91 ND 3.40 1.44 7.43 1.00
T
A. veronii bv. sobria ATCC 9071 6.57 2.09 t 3.80 t 3.85 5.54 8.35 1.11
T
A. veronii bv. veronii DSM 7386 5.16 t t 3,32 t 1.52 6.00 7.69 1.02
-- 199 --
Species 16:0 i SF3 16:0 15:0 i SF9 17:0 i 17:1 17:0 SF8
3OH 8wc
Strain 266T t 32.37 7.55 4.82 3.55 1.68 1.98 t 7.70
T
A. allosaccharophila DSM 11576 t 38.11 17.34 2.34 2.35 1.91 t t 8.25
T
A. dhakensis CECT 7289 t 32.76 15.33 2.14 1.26 1.05 1.49 t 7.59
T
A. bestiarum ATCC 51108 t 39.20 14.96 1.33 1.13 t 1.17 t 7.58
T
A. bivalvium CECT 7113 t 36.80 16.99 3.20 2.57 2.49 1.15 t 8.47
A. caviae ATCC 13136T t 40.67 16.25 1.99 1.72 1.09 t t 8.49
T
A. culicicola CECT 5761 t 34.02 12.06 3.46 3.06 1.86 1.23 t 8.69
T
A. diversa CECT 4254 t 34.28 16.64 1.73 1.35 t t t 8.19
T
A. encheleia DSM 11577 t 43.99 17.28 3.04 2.28 2.17 t t 6.85
T
A. eucrenophila ATCC 23309 t 37.94 13.51 5.21 5.13 2.83 t t 5.45
T
A. fluvialis CECT 7401 1.15 27.30 9.66 6.95 3.67 4.08 1.45 t 10.34
T
A. hydrophila ATCC 7966 t 36.55 18.28 1.10 1.40 t t t 7.61
T
A. jandaei ATCC 49658 t 27.29 10.99 1.69 2.75 1.45 2.76 1.36 7.95
T
A. media ATCC 33907 t 38.42 17.36 2.67 4.55 4.22 t t 10.61
T
A. molluscorum DSM 17090 t 37.83 13.80 3.43 2.05 2.30 1.27 t 8.40
-- 200 --
Species 16:0 i SF3 16:0 15:0 i SF9 17:0 i 17:1 17:0 SF8
3OH 8wc
Strain 266T t 32.37 7.55 4.82 3.55 1.68 1.98 t 7.70
T
A. piscicola CECT 7443 3.16 36.44 13.94 3.04 3.48 2.84 t t 4.35
T
A. popoffii CIP 105493 t 40.55 13.68 3.40 2.10 1.75 t t 5.10
T
A. rivuli CECT 7518 t 39.04 17.14 2.80 1.28 1.84 t t 4.58
T
A. salmonicida CECT 894 t 31.31 14.51 t t t 2.88 2.14 7.14
T
A. sanarellii CECT 7402 t 32.93 16.93 4.48 3.33 3.05 t t 9.61
T
A. schubertii ATCC 43700 t 29.19 10.78 3.38 2.11 1.25 1.86 t 5.72
T
A. simiae DSM 16559 t 33.50 17.04 2.52 5.16 4.27 t t 12.74
A. sobria CIP 7433T t 31.19 10.75 2.68 2.09 1.78 5.95 2.77 6.02
T
A. taiwanensis CECT 7403 t 35.50 16.09 3.48 2.17 1.31 t t 8.60
T
A. tecta CECT 7082 ND 38.80 11.22 7.98 2.29 1.48 t ND 4.01
T
A. trota ATCC 49657 t 33.92 15.45 3.80 4.83 3.16 1.06 t 9.16
T
A. veronii bv. sobria ATCC 9071 t 29.90 12.28 4.40 5.97 3.65 1.42 t 6.54
T
A. veronii bv. veronii DSM 7386 t 34.20 14.29 2.10 2.39 1.53 2.54 1.22 11.29
-- 201 --
Abbreviations. *Sum in Features (SF) contained cellular fatty acids that cannot be separated by this system;
SF1 (C15:1 iso H/13:0 3OH or C13:0 3OH/15:1 iso H);
SF2 (C12:0 aldehyde? or C16:1 iso I or C14:0 3OH);
SF3 (C16:1 w7c or C16:1 w6c);
SF8 (C18:1 w7c or C18:1 w6c);
SF 9 (C16:0 10-methyl or C17:1 iso w9c);
SF7 (C19:1w7c or 19:1 w6c) detected in A. rivuli (2.4%);
14:0 iso 3OH was detected in A. piscicola (1.25%);
15:0 3OH (1.20%) and 17:1 w6c (1.02%) were detected in A. sobria
ND, not detected; i, iso; t, trace (values < 1% not shown)
-- 202 --
Figure 6.2 Protein spectrum for strain 266T (Bruker microflex LT MALDI-TOF mass spectrometer, Bruker Daltonik, GmbH, Germany).
-- 203 --
Table 6.5 DNA-DNA hybridization values between strain 266T and closely related Aeromonas species
(Results are expressed as the mean of three determinations. Standard deviations are included in parenthesis)
Labelled DNA
Strain 266T A. fluvialis A. veronii A. allosaccharophila

CECT 7401T CECT 4257T CECT 4199T
266T 100 56.8 (9.2) 47.6 (9.2) 65.0 (0.5)
A. fluvialis CECT 7401T 62.6 (3.2) 100  

A. veronii CECT 4257T 65.8 (3.2)  100 
T
A. allosaccharophila CECT 4199 65.5 (0.5)   100
-- 204 --
T
92 A. salmonicida NCIMB1102 (X60405)
70 A. bestiarum CECT 4227T (NR 026089)
A. piscicola CECT7 443T (FM999971)
A. molluscorum CECT 5864T (AY532691)
A. encheleia CECT 4342T (AJ224309)
A. tecta CECT 7082T (AJ458403)
59 A.eucrenophila ATCC 23309T (X74675)
A. bivalvium CECT7113T (DQ504429)
39
66 A. popoffii LMG 317541T(AJ224308)
A. rivuli DSM 22539T (FJ976900)
A. sobria NCIMB 12065T (X60412)
98 A. media ATCC 33907T (X74679)

A. hydrophila ATCC 7966T (X60404)
A. sanarellii CECT 7402T (FJ230076)
43
A. taiwanensis CECT 7403T (A2-50) (FJ230077)
99 T
63 A. aquariorum CECT 7289 (MDC47T) (EU085557)
47
A. hydrophila dhakensis LMG 19562T (AJ508765)
58 A. trota ATCC 49657T (X60415)
T
62 A. caviae NCIMB 13016 (X60408)
T
A. allosaccharophila CECT 4199 (S39232)
48
A. fluvialis CECT 7401T (FJ230078)
T
85 266
A. jandaei ATCC 49568T (X60413)
A. veronii ATCC 35624T (X60414)
A. simiae IBSS6874T (AJ536821)
94
A. diversa CECT 4254T (GQ365710)
88 A. schubertii ATCC 43700T (X60416)
0.002
Figure 6.3 Unrooted neighbour-joining phylogenetic tree derived from the 16S rRNA
gene sequences showing the relationships of strain 266T with all other Aeromonas
species. The phylogenetic tree was constructed with 1322 nt. Numbers at the nodes
indicate bootstrap values. Bar, 0.002 estimated substitutions per site.
45 A. allosaccharophila CECT 4199T (HQ443058)
97 A. veronii CECT 4257 T (HQ443060)
51 266T (HE611954)
70
A. fluvialis 717T (FJ603454)
90
A. jandaei CECT 4228T (HQ443074)
55 A. sobria CECT 4245T (HQ443076)
A. hydrophila CECT 839T (HQ443048)
68 76 A. dhakensis CECT 7289T (HQ443050)
84 A. trota CECT 4255T (HQ443038)
A. bivalvium CECT 7113T (HQ443036)
A. salmonicida CECT 894T (HQ442979)
67 64
93 A. popoffii CECT 5176T (HQ442995)
85 A. piscicola CECT 7443T (HQ442992)
95 A. bestiarum CECT 4227T (HQ442988)
64
A. molluscorum CECT 5864T (HQ443000)
99 A. rivuli DSM 22539T (FJ969432)
T
A. media CECT 4232 (HQ443012)
49 A. encheleia CECT 4342T (HQ443025)
88 A. eucrenophila CECT 4224T (HQ443015)
75 A. tecta CECT 7082T (HQ443020)
A. taiwanensis A2-50T (FJ807270)
56 A. caviae CECT 838T (HQ443008)
77 A. sanarellii A2-67T (FJ807279)
A. simiae CIP 107798T (HQ443081)
100 A. schubertii CECT 4240T (HQ443088)
99 A. diversa CECT 4254T (HQ443084)
0.02
Figure 6.4 Unrooted neighbour-joining phylogenetic tree derived from dnaJ sequences
showing the relationships of strain 266T with the type strains of all other Aeromonas
-- 206 --
53 A. veronii CECT 4257T (HQ442469)
48 A. fluvialis CECT 7401T (HQ442464)
T
266 (HE611951)
74
A. allosaccharophila CECT 4199T (HQ442457)
61
56 A. dhakensis CECT 7289T (HQ442483)
A. trota CECT 4255T (HQ442490)
53
92 A. taiwanensis CECT 7403T (HQ442491)
73
A. popoffii CECT 5176T (HQ442437)
95 A. molluscorum CECT 5864T (HQ442519)
92 A. rivuli DSM 22539T (HQ442524)
A. eucrenophila CECT 4224T (HQ442509)
A. tecta CECT 7082T (HQ442502)
A. caviae CECT 838T (HQ442422
A. sanarellii CECT 7402T (HQ442508)
25
A. media CECT 4232T (HQ442507)
A. schubertii CECT 4240T (HQ442533)
0.01
Figure 6.5 Unrooted neighbour-joining phylogenetic tree derived from dnaX sequences showing
the relationships of strain 266T with the type strains of all other Aeromonas species.
The phylogenetic tree was constructed with 493 nt. Numbers at the nodes indicate
bootstrap values. Bar, 0.01 estimated substitutions per site.
-- 207 --
66 266T (HE611952)
45 A. jandaei CECT 4228T (HQ443185)
35
A. rivuli DSM 22539T (FJ969436)
99 43 A. salmonicida CECT 894T (HQ443089)
97
A. popoffii CECT 5176T (HQ443108)
44 A. media CECT 4232T (HQ443134)
A. encheleia CECT 4342T (HQ443139)
42 A. bivalvium CECT 7113T (HQ443141)
38
A. sanarellii A2-67T (FJ807276)
95 A. taiwanensis A2-50T (FJ807274)
A. diversa CECT 4254T (HQ443194)
0.01
Figure 6.6 Unrooted neighbour-joining phylogenetic tree derived from gyrA sequences
-- 208 --
A. piscicola CECT 7443T (HQ442690)
86 A. salmonicida CECT 894T (HQ442680)
A. eucrenophila CECT 4224T (HQ442657)
72 43 A. tecta CECT 7082T (HQ442662)
A. molluscorum CECT 5864T (HQ442671)
40 A. rivuli DSM 22539T (FJ969434)
38
31
38 A. hydrophila CECT 839T (HQ442746)
A. dhakensis CECT 7289T (HQ442712)
26
47 61 A. allosaccharophila CECT 4199T (HQ442733)
266T (FN691773)
A. taiwanensis A2-50T (FJ807272)
0.01
Figure 6.7 Unrooted neighbour-joining phylogenetic tree derived from gyrB sequences
-- 209 --
56 A. salmonicida CECT 894T (HQ442955)
A. popoffii CECT 5176T (HQ442941
80 66 A. sobria CECT 4245T (HQ442940)
55
47 266T (HE611953)
36
A. caviae CECT 838T (HQ442921)
53 A. jandaei CECT 4228T (HQ442915)
A. sanarellii A2-67T (FJ807278)
79 A. rivuli DSM 22539T (FJ969435)
0.01
Figure 6.8 Unrooted neighbour-joining phylogenetic tree derived from recA sequences
-- 210 --
94 A. allosaccharophila CECT 4199T (HQ442825)
86 A. fluvialis 717T (FJ603453)
54
266T (FN773335)
A. sobria CECT 4245T (HQ442867)
48
100 A. hydrophila CECT 839T (HQ442791)
A. dhakensis CECT 7289T (HQ442798)
33 99 A. piscicola CECT 7443T (HQ442859)
A. caviae CECT 838T (HQ442790)
40 35 A. media CECT 4232T (HQ442785)
A. encheleia CECT 4342T (HQ442778)
96 A. tecta CECT 7082T (HQ442762)
100 A. rivuli DSM 22539T (FJ969433)
0.02
Figure 6.9 Unrooted neighbour-joining phylogenetic tree derived from rpoD sequences
-- 211 --
81 A. veronii CECT 5761T
89 A. australiensis 266T
98 A. allosaccharophila CECT 4199T
99
A. fluvialis CECT 7401T
69
A. sobria CECT 5254T
A. jandaei CECT 4228T
59
A. hydrophila CECT 839T
100 A. dhakensis CECT 7289T
A. trota CECT 4255T
A. taiwanensis CECT 7402T
100 A. caviae CECT 838T

71 A. sanarellii CECT 7403T
95 A. eucrenophila CECT 4224T

93 A. tecta CECT 7082T
85 A. encheleia CECT 4342T
A. media CECT 4232T
100 A. molluscorum CECT 5864T

99 A. rivuli DSM 22539T
A. bivalvium CECT 7113T
A. salmonicida CECT 894T
A. popoffii CECT 5176T
100
100 A. piscicola CECT 7443T
99 A. bestiarum CECT 4227T
A. simiae CIP 107798T
100 A. diversa CECT 4254T

100 A. schubertii CECT 4240T
0.01
Figure 6.10 Unrooted neighbour-joining phylogenetic tree derived from the MLPA of
concatenated sequences of six housekeeping genes (gyrB, rpoD, recA, dnaJ, gyrA and
dnaX) sequences showing the relationships of strain 266T with several strains of all
other Aeromonas species. The phylogenetic tree was constructed with 4204 nt. Numbers
at the nodes indicate bootstrap values. Accession numbers for all Aeromonas strains are
provided in Martínez-Murcia et al. (2011). Bar, 0.01 estimated substitutions per site.
-- 212 --
6.4. DISCUSSION
The phenotypic and genotypic characteristics of strain 266T were investigated using a
polyphasic approach in order to determine its taxonomic position as initial classification
inferred by the nucleotide sequences of the rpoD and gyrB genes suggested that strain
266T occupied a phylogenetic branch separate from all current Aeromonas species. A
small zone of inhibition (~10.8 mm in diameter) with a 150 g disk containing the
vibriostatic agent O/129 was observed after o/v incubation on blood agar. Susceptibility
to O/129 is uncommon in the genus and was previously reported for two strains of A.
eucrenophila and one of A. veronii by Abbott et al. (2003), and recently for the newly
proposed species A. cavernicola (Martínez-Murcia et al. 2013).
The inability of strain 266T to produce acid from D-mannitol is a significant phenotypic
marker as the majority of the species in the genus can produce acid from this
carbohydrate with the exception of A. schubertii, A. simiae, A. diversa, and some strains
of A. trota. Strain 266T can be differentiated from A. schubertii by producing indole
from tryptophan and acid from D-saccharose; from A. simiae by being haemolytic
(strain 266T exhibited -haemolysis while A. simiae did not) and positive for VP and
indole reactions; from A. diversa by its ability to decarboxylate lysine and produce acid
from D-saccharose and from A. trota by being positive for VP but negative for the
utilization of citrate.
The CFA composition of strain 266T suggested that subtle differences exist between
strain 266T and other D-mannitol negative Aeromonas (Table 6.2). Moreover, based on
CFAs profiles, Aeromonas species can be divided into two groups, those that produce
C16:1 w7c alcohol and C16:0 N alcohols, and those that do not. However, identification of
bacteria by analysis of their FAMEs is more suitable for slow-growing bacteria such as
non-fermenters (Osterhout et al. 1991) and, in agreement with the comments by
Käempfer et al. (1994), fatty acid patterns show a limited resolution to split Aeromonas
species. The Similarity Index (SI) values obtained for strain 266T varied between 0.200
and <0.300 and in most instances, named A. schubertii as a possible match. According
to this system, SI values of <0.300 may represent an atypical strain of the species named
first in the chromatogram. This identification was consistent with the fact that A.
schubertii shared similar biochemical features with strain 266T. The FAME
compositions of the Aeromonas strains analysed in this project differed significantly
from previous reports (Lambert et al. 1983; Huys et al. 1994; Käempfer et al. 1994).
-213-
Consistent with previous observations, variations in FAME data can be attributed to
differences in culture conditions, sets of strains used, the type of media and equipment
employed to analyse results (Huys et al. 1994).
At the genotypic level, strain 266T showed a separate line of descent from all other
Aeromonas species as depicted in phylogenetic trees constructed with nucleotide
sequences of six individual housekeeping genes (Figs. 6.4 to 6.9) and the concatenated
tree derived from the MLPA (Fig. 6.10). According to the ad hoc committee for the re-
evaluation of the species definition in bacteriology, a minimum of five housekeeping
genes are recommended to define a species (Stackebrandt et al. 2002). The species A.
fluvialis, A. taiwanensis, A. sanarellii and A. rivuli have all been defined with the
concatenated sequences of five genes (rpoD, gyrB, dnaJ, recA and gyrA) (Alperi et al.
2010a/b; Figueras et al. 2011a).
Recently, a MLPA of the genus Aeromonas based on the information derived from
seven concatenated genes (rpoD, gyrB, dnaJ, recA, gyrA, dnaX, and atpD)
demonstrated concordance with the species delineation based on the DDH results
(Martínez-Murcia et al. 2011). Almost the same phylogenetic conclusions were recently
inferred by Roger et al. (2012b) using MLPA based also on seven housekeeping genes
(dnaK, gltA, gyrB, radA, rpoB, tsf and zipA) of which six were different from the ones
employed by Martínez-Murcia et al. (2011).
According to Käempfer and Glaeser (2012) and Martínez-Murcia et al. (2011), a critical
comparison of the different tree topologies based on single genes is important to
determine genes that may be affected by lateral gene transfer or subsequent
recombination events. The trees constructed with the six individual genes showed that
in all of them strain 266T formed a clear distinctive branch but always clustered near the
species A. veronii, A. fluvialis and A. allosaccharophila. This finding is further
supported by the DNA relatedness values below the 70% limit for species delineation
determined between strain 266T and the type strains of A. allosacccharophila, A. veronii
and A. fluvialis (Wayne et al. 1987; Stackebrandt and Goebel 1994). The MLPA
showed once more a perfect agreement with DDH results, because both demonstrated
that strain 266T represents a new Aeromonas species.
-214-
6.4.1. Formal description of Aeromonas australiensis sp. nov.
Motile rods with polar flagella (Figure 6.1b). Cells are Gram-negative, straight, non-
spore-forming and non-encapsulated rods, 0.6-0.9 μm wide and 1.8-2.7 μm long,
oxidase- and catalase-positive, reduce nitrate to nitrite and are susceptible to the
vibriostatic agent O/129 (150 μg). Colonies on TSA plus sheep blood are 1.5-2.0 mm in
diameter, glossy, circular and beige in clolour after 24 h at 35C. No brown diffusible
pigment is produced on TSA at 35C. Growth occurs at 25, 30 and 35C, but not at 4 or
44C after 24 h on TSA plus sheep blood. -Haemolysis is observed on sheep (5%)
blood agar. Grows on MacConkey (Difco) and thiosulfate-citrate-bile-sucrose agar
(Difco) and in nutrient broth in 0 and 3% NaCl, but not at 6% NaCl. Indole is produced
from tryptophan. The ONPG reaction is positive when tested by disc (Rosco) but not in
the API 20E strip. Does not utilize citrate (Simmon’s and Hänninen’s methods) or
malonate or produce gas from glucose, but a positive citrate reaction is observed with
the API 20E strip. DL-Lactate is utilized at 30C but not at 35C.
Hydrogen sulphide, urease and elastase are not produced and it does not hydrolyse
aesculin. No clearing of tyrosine-containing medium, but starch hydrolysis is positive
after 5 days. Produces DNase and lipase and oxidizes potassium gluconate.
Dehydrolyses arginine and lysine is decarboxylated, but not ornithine. Utilizes acetate
and urocanic acid and it is positive for the Voges-Proskauer reaction and hydrolysis of
gelatin. No bacteriolytic activity (stapholysin) is detected. Negative for phenylalanine
deaminase, alkylsulfatase, pyrazinamidase and Jordan’s tartrate.
Acid is produced from the following carbohydrates: fructose, galactose, glucose,

glycerol, glycogen, glucose-1-phosphate, glucose-6-phosphate, maltose, mannose, N-
acetylglucosamine, ribose, sucrose and trehalose, but not from adonitol, amygdalin, L-
arabinose, cellobiose, dulcitol, myo-inositol, lactose, lactulose, D-mannitol, melibiose,
methyl--D-glucoside, raffinose, L-rhamnose, salicin or D-sorbitol. Acid production is
observed for the following carbohydrates with the API 50CH strip: glycerol, D-ribose,
D-galactose, D-glucose, D-fructose, D-mannose, N-acetylglucosamine, maltose,
sucrose, trehalose, starch, glycogen and potassium gluconate. The type strain is 266T
(=CECT 8023T = LMG 26707T), isolated from treated effluent in the south-west region
of Western Australia.
-215-
In this chapter, the taxonomic position of a previously unknown Aeromonas isolate has
been determined using extensive phenotypic and genotypic testing which confirmed that
strain 266T represents a novel Aeromonas species for which the name Aeromonas
australiensis (aus.tra.li.en’sis. N. L. fem. Adj. australiensis, of or belonging to
Australia) sp. nov. has been proposed.
-216-
CHAPTER 7: VIRULENCE GENES PRESENT IN
WESTERN AUSTRALIAN AEROMONAS SPP.
7.1. INTRODUCTION
Aeromonas species are ubiquitous Gram-negative bacilli found in aquatic environments,

many types of foods and in vertebrate and invertebrate organisms. In humans,
Aeromonas species have been isolated practically from every body site and are the
aetiological agents of serious human infections including bacteraemia and meningitis.
Aeromonas sepsis, frequently fatal in humans, is usually associated with malignancies
or other chronic underlying illnesses although infections are occasionally reported in
immunocompetent individuals (Janda and Abbott 2010). Although the genus
Aeromonas currently comprises 27 species only a few are considered pathogenic to
humans. Of these, A. hydrophila, A. veronii bv. sobria and A. caviae are of clinical
significance (Janda and Abbott 2010). However, by virtue of its previous isolation from
human clinical material either as A. aquariorum or A. hydrophila ssp. dhakensis, the
newly combined species A. dhakensis sp. nov. comb. nov. (Beaz-Hidalgo et al. 2013;
Puah et al. 2013) should be considered one of the major Aeromonas species.
Many putative virulence factors have been identified in these organisms including
exotoxins, surface structures and secretory systems (Yu et al. 2004; Sen and Lye 2007;
Chopra et al. 2009). The detection of virulence genes is considered a practical method
of screening a large number of Aeromonas isolates for potential virulence (Sen and
Rodgers 2004). Attempts to reproduce disease with aeromonads in laboratory animals
and human volunteers have failed to build a robust case for causality based on Koch’s
postulates (Janda and Abbott 2010). As a consequence, a plethora of alternative models
of infection including the unicellular amoeba Dictyostelium and the medicinal leech
Hirudo medicinalis among others have been proposed to assess the virulence potential
of aeromonads (Janda and Abbott 2010). One of the drawbacks of these models is that
the complex patho-physiology of the in-vivo infection may not be fully reproducible in
non-mammalian models.
The aim of this chapter was to determine the presence of 13 virulence genes among
genotypically-characterized clinical and environmental strains as described in Chapter
4. A PCR-based method was used to detect the genes coding for aerolysin/haemolysin
(aerA/haem), serine protease (aspA), heat-labile (alt) and heat-stable (ast) cytotoxins,
-217-
components of the type 3 (aexT and ascV) and type 6 (vasH) secretion systems, lateral
(lafA) and polar (flaA) flagella, bundle-forming pilus (BfpA and BfpG) and a Shiga-like
toxin (stx-1 and stx-2). This is the first study of this kind in Australia.
Bacterial strains used in this investigation and their source of isolation are listed in
Table 2.9. Primers used in this study are listed in Table 2.8.
7.3. RESULTS
7.3.1. Overall distribution of virulence genes
The overall distribution of nine virulence genes in all Aeromonas isolates tested is
shown in Table 7.1. The most prevalent genes were aerA/haem 77% (100/129), alt 53%
(69/129) and lafA 51% (67/129) while ascV 16% (16/129) and aexT 13% (13/129) were
the least frequently detected. The genes coding for a bundle-forming pilus (BfpA and
BfpG) and a Shiga-like toxin (stx-1 and stx-2) could not be detected in any isolate
(results not shown). Virulence genes more prevalent in environmental than in clinical
isolates were aexT (26 vs. 9%); (p = 0.0295), ascV (39 vs. 8%) (p = 0.0004), aspA (61
vs. 19%) (p = 0.0001), and vasH (48 vs. 19%) (p = 0.0023), respectively. By contrast,
lafA (59 vs. 29%) (p < 0.0040) was present more often in clinical than in environmental
strains. Among the major species, the most prevalent virulence genes were: A. caviae,
lafA 55% (15/27) and aerA/haem 52% (14/27); A. dhakensis, alt 81% (25/31),
aerA/haem 74% (23/31), flaA and lafA both 64% (20/31) and vasH 61% (19/31); A.
hydrophila, ast 93% (27/29), alt 86% (25/29), aerA/haem 79% (23/29), lafA 69%
(20/29) and aspA 52% (15/31); A. veronii bv. sobria, aerA/haem 100% (31/31), ascV
32% (10/31) and 26% (8/31) for both alt and aexT.
7. 3.2. Distribution of virulence genes in stool isolates
The prevalence of virulence genes in stool specimens is shown in Table 7.2. The
aerA/haem and lafA genes were equally distributed in 55% (11/20) of the total isolates
followed by ast 45% (9/20) and alt 40% (8/20). The flaA+/lafA+ genotype was present in
20% (4/20) of total isolates while 35% (7/35) had both alt and ast. Ten% (2/20) of the
strains harboured more than five virulence genes.
-218-
7.3.3. Distribution of virulence genes in extra-intestinal isolates
The prevalence of virulence genes in extra-intestinal specimens is shown in Table 7.3

(blood), Table 7.4 (wounds) and Table 7.5 (miscellaneous specimens). Overall,
aerA/haem, lafA and alt were the most prevalent genes in these specimens. The
distribution of these genes in blood was 86% (24/28), 46% (13/28), 46% (13/28); in
wounds 91% (29/32), 69% (22/32) and 56% (18/32), and in miscellaneous specimens
83% (15/18), 67% (12/18) and 56% (10/18), respectively. Five or more virulence genes
were detected in 28% (9/32) wound isolates, 25% (7/28) in blood, and 22% (4/18)
miscellaneous specimens. The flaA+/lafA+ genotype was present in 28% (9/32) wound,
17% (3/18) miscellaneous specimen and 7% (2/28) blood isolates. Both alt and ast were
present in 33% (6/18) miscellaneous specimens, 29% (8/28) blood and 25% (8/32)
wound isolates.
7.3.4. Distribution of virulence genes among environmental isolates
The prevalence of virulence genes in Aeromonas isolated from environmental samples

is shown in Table 7.6. The most prevalent genes were aerA/haem 68% (21/31), alt 61%
(19/31), aspA 61% (19/31) and vasH 48% (15/31). The flaA+/lafA+ genotype was
present in 9.6% (3/31) of total isolates while 29% (9/31) harboured both alt and ast
genes. Individually, flaA was distributed in 39% (12/31); lafA in 29% (9/31), alt in 61%
(19/31) and ast in 39% (12/31) of total isolates.
7.3.5. Additional features
Overall, 27% (35/129) of the total isolates harboured five or more virulence genes
including 22% (22/98) in clinical and 42% (13/31) in environmental isolates. Five or
more virulence genes were detected in 100% (3/3) A. jandaei, 48% (14/29) A.
hydrophila, 42% (13/31), A. dhakensis, 19% (6/31) A. veronii bv. sobria and the single
strains of A. allosaccharophila and A. australiensis but not in A. bestiarum, A. caviae,
A. media, A. salmonicida and A. schubertii. Among the major species, the average
number of virulence genes detected was: A. dhakensis 4.3, A. hydrophila 4.3, A. veronii
bv. sobria 2.7 and A. caviae 1.7. The flaA+lafA+ genotype was present in 39% (12/31) A.
-219-
dhakensis, 21% (6/29) A. hydrophila, 4% (1/25) A. caviae, 3% (1/31) A. veronii bv.
sobria and in both A. media isolates (Tables 7.7).
7.3.6. Percentage identity of nucleotide sequences of positive products from

this study compared to sequences deposited in GenBank
The nucleotide sequences of gene products from selected strains were compared with
sequences deposited in GenBank and shown in Table 7.8. Accesion numbers for these
sequences are shown in Table 7.9. Unspecific amplification products were detected for
the vasH gene. The percentage of nucleotide identity for aerA/haem ranged from 71.2 to
96.5% over a 323 bp length; alt 90.9 to 93.8% over 244 bp; ast 94.7% over 265 bp;
aexT 88.0 to 94.1% over 510 bp; ascV 83.8% over 500 bp; aspA 71.2 to 93.7% over 306
bp; flaA 71.0 to 90.5% over 326 to 328 bp; lafA 69.3 to 83.0% over 555 to 580 bp and
vasH 86.0% over 572 bp. These results were not included in the original publication.
7.4. DISCUSSION
The distribution of 13 virulence genes assayed among 129 Aeromonas isolates was
determined in order to evaluate the pathogenic potential of these bacteria. The majority
(96%; 124/129) of the strains contained at least one virulence gene. The frequency of alt
and ast in stool isolates was 40% and 45%, respectively. In other studies, the frequency
for alt ranged from 16 to 35% and for ast 6 to 97% (Albert et al. 2000; Aguilera-
Arreola et al. 2005, 2007; Senderovich et al. 2012). In A. hydrophila, ast has been
detected between 30 and 91% of the isolates tested while has been absent in A. caviae
and A. veronii (Sen and Rodgers 2004; Aguilera-Arreola et al. 2007). In another study,
alt was almost exclusively detected in diarrhoeic isolates (Aguilera-Arreola et al. 2005).
The wide variations in the distribution of enterotoxin genes lend support to the
observations by Chopra et al. (2009) who stated that the prevalence of virulence genes
may depend on the strains examined at the time of testing.
The aerA/haem gene was detected in 77% of the total isolates consistent with other
reports where the prevalence of this gene ranged from 72 to 89% (Aguilera-Arreola et
al. 2007; Chacón et al. 2003; Puthucheary et al. 2012).
-220-
Table 7.1 Distribution of virulence genes among Western Australian Aeromonas species
Gene frequency (%)
Species No. tested aerA/haem aexT alt ascV aspA ast flaA lafA vasH
A. allosaccharophila 1c +   + + +  + 
A. australiensis 1e +  + + +    
A. bestiarum 1c +  +  +    
A. caviae 25c 14 (56) 1(4) 4 (16)   5 (20) 3 (12) 15 (60) 2 (8)
2e   1 (50)  1 (50)    
Total 27 14 (52) 1 (4) 5 (18)  1 (4) 5 (18) 3 (11) 15 (55) 2 (7)
A. dhakensis 21c 17 (81) 1 (5) 15 (71) 2 (9) 3 (14) 5 (34) 13 (62) 17 (81) 11 (52)
10e 6 (60) 5 (50) 10 (100) 3 (30) 6 (60) 4 (40) 7 (70) 3 (30) 8 (80)
Total 31 23 (74) 6 (19) 25 (81) 5 (16) 9 (29) 9 (29) 20 (64) 20 (64) 19 (61)
A. hydrophila 23c 20 (87) 1 (4) 20 (87)  10 (43) 21 (91) 6 (26) 16 (69) 3 (13)
6e 3 (50  5 (83)  5 (83) 6 (100) 3 (50) 4 (67) 2 (33)
Total 29 23 (79) 1 (3) 25 (86)  15 (52) 27 (93) 9 (31) 20 (69) 5 (17)
A. jandaei 3e 2 (67  2 (67) 2 (67) 2 (67) 1 (33)  2 (67) 2 (67)
-221-
Gene frequency (%)
Species No. tested aerA/haem aexT alt ascV aspA ast flaA lafA vasH
A. media 2c 1 (50) 1 (50) 1 (50)   1 (50) 2 (100) 2 (100) 
A. salmonicida 1c +  +  +  +  
1e +   + +  +  
A. schubertii 1c +       + 
A. veronii bv. sobria 23c 23 (100) 5 (22) 7 (30) 6 (26) 3 (13) 5 (22) 3 (13) 6 (26) 3 (13)
8e 8 (100) 3 (37) 1 (12) 4 (50) 2 (25) 1 (12) 1 (12)  3 (37)
Total 31 31 (100) 8 (26) 8 (26) 10 (32) 5 (16) 6 (19) 4 (13) 6 (19) 6 (19)
a b c d e f g h
Total clinical 98 79 (81) 9 (9) 49 (50) 9 (9) 19 (19) 38 (39) 29 (29) 58 (59) 19 (19)i
Total environmental 31 21 (68)a 8 (26)b 20 (64)c 12 (39)d 19 (61)e 12 (39)f 12 (39)g 9 (29)h 15 (48)i
Grand total 129 100 (77) 17 (13) 69 (53) 21 (16) 38 (29) 50 (39) 41 (32) 67 (51) 34 (26)
a b c d e f
, not detected; +, detected; c, clinical; e, environmental; p = 0.1453; p = 0.0295; p = 0.2152; p = 0.0004; p < 0.0001; p = 1.0000; g p
= 0.3797; hp = 0.0040; ip = 0.0023
-222-
Table 7.2 Distribution of virulence genes in Aeromonas spp. isolated from stools (n = 20)
Genes detected
Species Strain a/h alt ast lafA flaA ascV aexT aspA vasH Clinical data
Age
no.
Stool1
Gender
A. allosaccharophila 100 + + + + + 74 FCampylobacter
jejuni also isolated2
A. dhakensis 169 + + + + L 35 M Infected Chrons2
180 + + + + W 80 F Persistent
diarrhoea;
diverticulitis
183 + + + + L 63 F Diarrhoea
A. caviae 94 + + L 74 M N/D
102 + W 71 F Diarrhoea post
chemotherapy2
103 + + + + L 57 F Diarrhoea for 2
weeks
156 + + + + L 5m F Recent travel
158 + W 63 M Recent travel
187 + + L 44 F Prem menopause
216 + + + SF 74 F N/D
1
N/D, no data; Stool consistency, A. allosaccharophila was isolated from a colostomy specimen; L, loose, W, watery, SF, semi-formed;
2
leucocytes detected in stools; a/h, aerA/haem; M, male; F, female.
-223-
Genes detected
Species Strain a/h alt ast lafA flaA ascV aexT aspA vasH Clinical data
no.
Age
Stool1
Gender
A. hydrophila 133 + + + + + 31 M Post/mortem
specimen
A. media 179 + + + + L 74 M Prolonged
intravenous
antibiotics
A. veronii bv sobria 99 + W 78 F N/D2
137 + + W 33 M N/D
166 + + + L 70 F Diarrhoea
184 + W 78 M N/D2
189 + + W 67 F Diarrhoea,
maelena,
Trichomonas
hominis +
215 + + + SF 89 F N/D
219 + W 61 F Diarrhoea for 1
week2
Total no. 11 8 9 11 7 1 1 3 5
% 55 40 45 55 35 5 5 15 25
-224-
Table 7.3 Distribution of virulence genes in Aeromonas spp. isolated from blood (n = 28)
Genes detected
Species Strain a/h alt ast flaA lafA aspA aexT ascV vasH Clinical data
Age
no.
Gender
A. dhakensis 60 + + + 75 M Acute renal failure
70 + + 70 M Abdominal sepsis
154 + + + + + N/D N/D N/D
A. bestiarum 68 + + + + 46 F N/D; polymicrobial
A. caviae 57 + + 48 M N/D
58 83 F N/D
65 + 82 M Cholangeo carcinoma;
polymicrobial
75 + 53 F Hickman catheter
collected blood; N/D
80 + 80 F N/D
96 + + 72 M N/D
106 72 M Septic
109 + + 70 F Epigastric pain;
polymicrobial
110 + + 50 M N/D; polymicrobial
200 + + N/D N/D N/D
-225-
Genes detected
Age
no.
Gender
A. hydrophila 59 + + + + + 65 M Febrile neutropenic
84 + + + + + 81 F N/D; Staphylococcus aureus also
isolated
149 + + + + + 68 M N/D
151 + + + + 73 M N/D
152 + + + 73 M N/D
A. media 85 + + + + 17 F Prolonged viral-like illness;
polymicrobial
A. veronii bv sobria 72 + 56 M Cancer/pancreas; polymicrobial
81 + + 89 F Septic shock
111 + + + 88 F Liver cancer; polymicrobial
125 + + + + + 88 F Vomiting
131 + + + 69 M Leukaemia; On chemotherapy
218 + + + + + <1 N/D N/D
5
221 + + 47 F Fever; breast cancer;
polymicrobial
269 + + + + + + 81 M Fever; AML
Total no. 24 13 8 7 13 5 5 3 2
% 86 46 29 25 46 18 18 11 7
a/h, aerA/haem; AML, acute myeloblastic leukaemia; N/D, no data; M, male; F, female
-226-
Table 7.4 Distribution of virulence genes in Aeromonas spp. isolated from wounds (n = 32)
Genes detected
Age
no.
Gender
A. dhakensis 67 + + + + + 20 M Cellulitis
71 + + + + + + 16 F Infected laceration of foot (river water)
73 + + + + 28 M Appendicitis
79 + + + 60 M Infected finger
91 + + + 78 F Leg wound
95 + + + + + 50 M Wound infected post elbow surgery; on
keflex
104 + + + + 60 F Non-healing shin; on flucloxicillin
107 + + + + + 39 M Septic wound right-hand; on flucoxicillin
141 + + + + N/D U N/D
176 + + + + 26 M Purulent wound ooze right-leg
220 + + + + + + N/D U Ulcer
279 + + + 14 M Osteomyelitis left thumb; Staphylococcus
aureus also isolated.
-227-
Age
no.
Gender
A. caviae 143 + + + N/D U N/D
163 50 M Hand wound
270 + + + 37 F Infected wound; Staphylococcus
aureus also isolated
A. hydrophila 23 + + N/D U N/D
69 + + + + + 18 M Infected subungual haematoma;
polymicrobial
90 + + + 36 F Ulcer; Staphylococcus aureus and
anaerobes also isolated
98 + + + + 35 M Infected left hand
101 + + + + 76 F Multiple ulcers
112 + + + + + + 66 F Post/laparatomy and wound
breakdown; polymicrobial
117 + + + + + 54 F N/D; polymicrobial
126 + 22 M Dirty purulent aquatic wound
128 + + + + 13 M Staphylococcus aureus also isolated
148 + + + 73 M N/D
-228-
Genes detected
Age
no.
Gender
A. salmonicida 190 + + + + 65 M Offensive smelly purulent
discharge of left-point finger
A. schubertii 186 + + 42 M Pus from infected wound in foot
A. veronii bv. sobria 24 + <15 U N/D
66 + + + + + 47 F Right-lower leg
129 + + + 48 M Infected wound right-ankle
147 + + + <15 M N/D
174 + + 71 M Infected thumb nail; Mixed
anaerobes also isolated
Total no. 29 18 13 10 22 6 3 3 11
% 91 56 41 31 69 19 9 9 34
N/D, no data; M, male, F, female, U, unknown; a/h, aerA/haem.
-229-
Table 7.5 Distribution of virulence genes in Aeromonas spp. isolated from miscellaneous specimens (n = 18)
Genes detected
Species Strain a/h alt ast flaA lafA aspA ascV vasH Age Gender Source Clinica data
no.
A. dhakensis 47 + + + 81 M sputum Leu 3+;Abundant
growth; N/D
56 + + + 35 M bone chips Infected fracture
93 + + + 35 M urine Urinary tract
infection
A. caviae 62 + + 47 M catheters Liver transplant;
polymicrobial
78 + 75 M dialysis Peritonitis
fluid
140 57 F dialysis Peritoneal dialysis;
fluid polymicrobial
178 + + 34 F bile Biliary obstruction;
polymicrobial
188 + + 68 F bile Acute cholecystitis;
polymicrobial
A. hydrophila 61 + + + + 62 M catheters Biliary sepsis;
polymicrobial
83 + + + + 53 F sputum Leu 3+; N/D;
89 + + + + 46 F bile Cholangitis;
polymicrobial
-230-
Genes detected
Species Strain a/h alt ast flaA lafA aspA ascV vasH Age Gender Source Clinical data
no.
A. hydrophila 92 + + + + + 66 F tissue Pancreatic
necrosis;
polymicrobial
113 + + + + + + + 35 M drain fluid N/D; polymicrobial
118 + + + + + 30 F sputum Exacerbation of
CF; polymicrobial;
150 + + + 73 M tissue Foot infection
A. veronii bv sobria 25 + <15 N/D catheters N/D
27 + + + + + <15 N/D tissue N/D
171 + 83 F sputum Aspiration
pneumonia;
polymicrobial
Total no. 15 10 7 3 12 5 2 1
% 83 56 39 17 67 28 11 6
M, male; F, female; N/D, no data; a/h, aerA/haem; CF, cytisc fibrosis; Leu 3+, many leucocytes seen on microscopy.
-231-
Table 7.6 Distribution of virulence genes among Aeromonas spp. isolated from environmental sources (n = 31)
Genes detected
Species Strain a/h alt ast flaA lafA aspA aexT ascV vasH Source Location
no.
A. australiensis 266 + + + + + IW Rural

A. dhakensis 31 + + + Fish ADWA
32 + + + + Fish ADWA
223 + + + + + + + Unknown Unknown
229 + + + + + + TW Unknown
230 + + + + Water Metropolitan
235 + + + + + Water Unknown
242 + + + + Water Unknown
256 + + + + + + Water Unknown
257 + + + + + + + Water Unknown
A. caviae 30 Fish ADWA
264 + + IW Unknown
A. hydrophila 34 + + + + Fish ADWA
231 + + + + SW Metropolitan
-232-
Genes detected
Species Strain a/h alt ast flaA lafA aspA aexT ascV vasH Source Location
no.
A. hydrophila 245 + + + + Water Unknown
261 + + + + + + IW Unknown
A. jandaei 35 + + + + + Fish lesion ADWA
A. salmonicida 199 + + + + Crab Rural
A. veronii bv. sobria 33 + + + + Fish ADWA
224 + + BW Metropolitan
247 + + + Water Unknown
254 + Water Unknown
265 + + IW Unknown
268 + + IW Unknown
Total no. 21 19 12 12 9 19 8 12 15
% 68 61 39 39 29 61 26 39 48
a/h, aerA/haem; IW, irrigation water; TW, treated water; BW, bore water; ADWA, Agriculture Department of Western Australia
-233-
Table 7.7 Additional features
Species (no. strains) Average no. genes per strain flaA+lafA+ genotype (%) >5 virulence genes (%)
Clin Env Total Clin Env Total Clin Env Total
A. caviae (27) 1.8 1.0 1.7 4 0 ~4 0 0 0
a a c c
A. dhakensis (31) 4.0 5.1 4.3 48 20 39 33 60 42
b b d d
A. hydrophila (29) 4.2 4.6 4.3 22 17 21 48 50 48
A. veronii bv. sobria (31) 2.6 2.8 2.7 3 0 4 22e 12e 19
Total 3.1 3.4 3.2 19 9 17 26 30 27
A. allosaccharophila (1) 5 0 100
A. australiensis (1) 4 0 100
A. bestiarum (1) 4 0 0
A. jandaei (3) 5 0 100
A. media (2) 4 100 0
A. salmonicida (2) 4 4 4 0 0 0 0 0 0
A. schubertii (1) 2 0 0
a
Percentage differences are statistically significant (p < 0.0001); bPercentage differences are not statistically significant (p = 0.475);
c
Percentage differences are statistically significant (p = 0.0002); d Percentage differences are not statistically significant (p = 0.887);
e
Percentage differences are not statistically significant (p = 0.8892); Clin, clinical isolates; Env, environmental isolates.
-234-
Table 7.8 Percentage identity of gene product sequences from this study compared with sequences deposited in GenBank
Gene Species/strain no. % Length (bp) Species Accesion no.
aerA/haem A. dhakensis 60,73, 256, 257, 279 71.2 323
A. australiensis 266 90.4 323 A. veronii bv. sobria AB109093
A. bestiarum 68 78.3 323 A. hydrophila AY611033
A. caviae 270 96.5 323 A. hydrophila AF410466
A. jandaei 35 90.4 323
A. veronii bv. sobria 125, 215, 221, 237, 259, 269 93.4 323
A. veronii bv. sobria 125, 215, 221, 237, 259, 269 93.1 323 A. salmonicida X65048
alt A. dhakensis 31, 32, 60, 67, 180, 183, 223, 229, 235, 241, 242, 256 90.9 244
A. australiensis 266 96.3 244 A. hydrophila JBN1302
A. caviae 103, 188, 200, 264 93.0 244 A. hydrophila JQ003197
A. hydrophila 34, 59, 61 94.2 244 A. hydrophila L77573
A. jandaei 253, 262 94.7 244 A. hydrophila JX489379
A. veronii bv. sobria 111, 218, 247, 269 93.8 244
ast A. dhakensis 154, 169, 183
A. caviae 103, 143, 156 94.7 265 A. hydrophila JQ003211
A. hydrophila 23, 34, 59, 83, 113, 117, 243, 261
A. media 179; A. veronii bv. sobria 27, 66, 125, 269
aexT A. dhakensis 31, 32, 220, 230; A.media 85 94.1 510 A. veronii EF026079
- 235 -
Gene Species/strain no. % Length (bp) Species Accesion no.
aexT A. veronii bv. sobria 33, 66, 218, 224, 269;
A. dhakensis 31, 32, 220, 230; A.media 85 88.0 510 A. salmonicida AF288366
A. veronii bv. sobria 33, 66, 218, 224, 269;
ascV A. allosaccharophila 100; A. dhakensis 47, 220; 83.8 500 A. veronii bv. veronii HM584587
A. australiensis 266; A. veronii bv. sobria 66, 218, 221, 269
aspA A. australiensis 266 85.6 306 A. hydrophila AF126213
A. australiensis 266 86.2 306 A. sobria AF253471
A. hydrophila 34, 69, 84, 92, 149, 261 71.2 306 A. hydrophila AF126213
A. jandaei 262 92.4 306 A. sobria AF253471
A. veroniii bv. sobria 27 93.7 306 A. sobria AF253471
A. salmonicida 199 90.1 306 A. salmonicida X67043
flaA A. dhakensis 60, 67, 176, 183, 229 84.6 326 A. hydrophila JQ003217
A. dhakensis 60, 67, 176, 183, 229 90.5 327 A. hydrophila AY424358
A. hydrophila 92, 151, 261 78.8 327 A. salmonicida EU410342
A. bestiarum 68 71.0 328 A. salmonicida EU410342
lafA A. hydrophila 133 83.0 555 A. hydrophila DQ124694
A. hydrophila 260 78.9 580 A. hydrophila DQ124694
A. media 179 72.7 580 A. punctata AF348135
A. dhakensis 95 74.3 580 A. punctata AF348135
A. dhakensis 95 69.3 580 A. jandaei AY228331
vasH A. dhakensis 31 86.0 572 A. hydrophila GQ359779
-- 236 --
Table 7.9 Accession numbers of sequences derived from virulence genes and deposited in GenBank
Gene Species Strain no. Accession no. Species Strain no. Accession no.
aerA/haem A. australiensis 266 HG977017 A. bestiarum 68 HG977018

A. dhakensis 73 HG977019 A. dhakensis 279 HG977020
A. hydrophila 59 HG977021 A. hydrophila 148 HG977022
A. jandaei 35 HG977023 A. veronii bv. sobria 215 HG977024
A. veronii bv. sobria 237 HG977025 A. veronii bv. sobria 125 HG977026
A. caviae 270 HG977029 A. jandaei 253 HG977030
A. hydrophila 151 HG977031 A. dhakensis 60 HG977032
A. veronii bv. sobria 259 HG977035
aexT A. dhakensis 220 HG977036 A. veronii bv. sobria 269 HG977037
-- 237 --
aexT A. veronii bv. sobria 224 HG977042 A. dhakensis 31 HG977043

A. media 85 HG977046 A. veronii bv. sobria 237 HG977047
alt A. australiensis 266 HG977048 A. caviae 103 HG977049
A. caviae 188 HG977050 A. caviae 264 HG977051
A. caviae 200 HG977052 A. dhakensis 31 HG977053
A. dhakensis 242 HG977064 A. hydrophila 34 HG977065
-- 238 --
alt A. jandaei 253 HG977068 A. jandaei 262 HG977069

ascV A. allosaccharophila 100 HG977074 A. australiensis 266 HG977075
A. dhakensis 220 HG977078 A. veronii bv. sobria 27 HG977079
ast A. hydrophila 23 HG977082 A. hydrophila 149 HG977083
A. hydrophila 243 HG977084 A. veronii bv. sobria 27 HG977085
A. caviae 270 HG977088 A. media 179 HG977089
A. jandaei 262 HG977090 A. veronii bv. sobria 269 HG977091
-- 239 --
flaA A. bestiarum 68 HG977093 A. dhakensis 60 HG977094

A. hydrophila 231 HG977103 A. caviae 96 HG977104
lafA A. dhakensis 95 HG977107 A. dhakensis 104 HG977108
A. dhakensis 220 HG977109 A. media 179 HG977110
A. veronii bv. sobria 66 HG977113 A. caviae 158 HG977114
-- 240 --
lafA A. hydrophila 101 HG977117 A. hydrophila 34 HG977118

aspA A. australiensis 266 HG977121 A. dhakensis 56 HG977122
A. jandaei 262 HG977131 A. salmonicida 199 HG977132
vasH A. dhakensis 31 HG977136 A. dhakensis 154 HG977137
A. jandaei 35 HG977140 A. jandaei 253 HG977141
-- 241 --
The primers used in the detection of aerA/haem can amplify several related genes which
encode toxins with a variety of names including aerolysin, aerolysin-haemolysin,
haemolysin-aerolysin, haemolysin, and cytolytic enterotoxin, hence the generic term
aerolysin-haemolysin genes (Soler et al. 2002). The prevalence of aerA/haem in A.
veronii bv. sobria detected in all (100%) isolates tested was also reported by Aguilera-
Arreola et al. (2007).
The prevalence of the ascV (16%) and aexT (13%) genes was low, consistent with other
reports (Aguilera-Arreola et al. 2005; Puthucheary et al. 2012; Senderovich et al. 2012).
In this study, these genes were more often detected in environmental than in clinical
isolates (ascV (39 vs. 8%; p < 0.0004; aexT 26 vs. 9%; p < 0.0295). Braun et al. (2002),
exclusively detected aexT in A. salmonicida ssp. salmonicida but not in other
Aeromonas spp. while Chacón et al. (2004) detected ascV and aexT in all intestinal and
extra-intestinal A. hydrophila and A. veronii isolates but only in a few extra-intestinal A.
caviae isolates. Based on these results, it appears that the distribution patterns of the
T3SS genes are strain and source dependent. The prevalence of the aspA gene (29%)
was low compared with the high frequency (75 to 77%), reported by Chacón et al.
(2003) and Puthucheary et al. (2012) who evaluated the distribution of virulence genes
and molecular characterization of Aeromonas species from Spain and Malaysia,
respectively. However, the prevalence of aspA in A. hydrophila (52%) isolates was
similar (58%) to the study by Aguilera-Arreola et al. (2005).
Lateral flagella (lafA) play an important role in cell adherence, invasion and biofilm
formation (Gavin et al. 2003). The presence of both genes (the flaA+lafA+ genotype) has
been associated with intense biofilm formation (Santos et al. 2010), a characteristic
feature of persistent infections. The frequency of the lafA gene (51%) was similar to the
overall frequency (60%) reported in mesophilic aeromonads by Gavin et al. (2003). In
other studies (Aguilera-Arreola et al. 2005, 2007; Senderovich et al. 2012), the
frequency of the lafA gene ranged from 37 to 41% although in one study (Aguilera-
Arreola et al. 2005), lafA was detected in 84% of A. hydrophila isolates. On the other
hand, the prevalence of the flaA (32%) gene was low compared to the range 59 to 74%
reported by others (Sen and Rodgers 2004; Puthucheary et al. 2012; Senderovich et al.
2012). In a recent study, flaA (94%) and lafA (71%) were highly prevalent in A. caviae
isolated from water, food and human faeces (Santos et al. 2010).
- 242 -
No amplification products were detected for the virulence genes BfpA, BfpG, stx-1, and
stx-2. These virulence genes are rarely investigated and their prevalence among
Aeromonas from other locations needs to be evaluated. Sechi et al. (2002) detected the
BfpG gene in four out of 46 A. hydrophila isolates collected from water samples in
Sardinia, Italy. By contrast, BfpA was not detected in any isolate, consistent with results
from this study. There have been few reports of Aeromonas strains producing a Shiga-
like toxin or carrying the encoding genes (Haque et al. 1996; Alperi and Figueras 2010).
One such gene, stx-l, is plasmid-mediated and it is possible that in this study, strains
carrying the stx-1 may have been lost during storage. It is also possible that due to the
fact that primer design is based on the nucleotide sequence of one species, species-
specific variations in the gene sequences of the species evaluated resulted in failure to
amplify providing false negative results.
The vasH (Sigma 54-dependent transcriptional regulator) gene is a relatively recent

addition to the arsenal of virulence factors described in Aeromonas spp. Together with
vasK the gene is a component and/or is essential for expression of the T6SS. These
genes were found in the T6SS of the diarrhoeal isolate A. hydrophila SSU and in A.
hydrophila ATCC 7966T (Suarez et al. 2008). In the present study, vasH was detected
primarily among environmental (48%, 15/31) rather than in clinical (19%, 19/98)
strains.
Results from this study reveal that among the major species, A. hydrophila and A.
dhakensis contain more strains that possess multiple virulence genes compared to other
clinically relevant species like A. caviae and A. veronii bv. sobria. On the other hand,
strains from A. allosaccharophila and A. jandaei also harbour many virulence genes
suggesting that in Aeromonas the pathogenic potential may be strain rather than species
related. In the present study not many virulence genes were detected in A. caviae.
However, other studies suggest that this species should be considered an enteric
pathogen capable of harbouring several virulence determinants including the production
of a cholera-like and a Shiga-like toxin (Haque et al. 1996; Mokracka et al. 2001;
Alperi and Figueras 2010). It is also possible that variations in gene sequences are
responsible for lack of amplification in A. caviae.
This raises the question of how many and what virulence genes are essential for an
Aeromonas strain to cause infection. In general, pathogens should possess the necessary
virulence genes to gain entry, adhere, colonize, causing damage in host tissue while
-- 243 --
evading the host defence mechanisms, and in some cases spread, leading to systemic
infection. In Aeromonas, multiple virulence factors most likely work in concert (Yu et
al. 2005) where the product of one gene may facilitate the action of other genes or act
synergistically (Albert et al. 2000). Some authors observed that combinations or subsets
of virulence factors can be found among different isolates responsible for a wide range
of infections (Sen and Rodgers 2004; Puthucheary et al. 2012). Virulence genes such as
aerA, hlyA, alt, ast, act are thought to contribute to enteritis-related virulence (Janda and
Abbott 2010) while the severity of the diarrhoea has been associated with the number
and type of enterotoxin genes present (Albert et al. 2000; Chopra et al. 2009).
Enterotoxigenic aeromonads possessing both the alt and ast genes may represent true
diarrhoeal pathogens (Albert et al. 2000) although this hypothesis has not been
supported by others (Aguilera-Arreola et al. 2007) who suggested that aerolysin-
haemolysin may be sufficient to cause diarrhoea particularly in patients colonized with
A. caviae or A. veronii. The latter would explain the production of diarrhoea found
among patients from the present study infected with these species and lacking either alt
or ast. Moreover, aerA/haem and lafA are among the most predominant virulence genes
present in isolates from intestinal specimens suggesting that these genes may play an
essential role in the pathogenesis of aeromonads isolated from these sites. In this study,
with the exception of two cases, Aeromonas was the only recognized enteric pathogen
and no parasitic or mixed infections were recorded (Table 7.2).
The variable percentage identity found between the sequences of selected strains
compared to sequences deposited in GenBank for the nine genes has been previously
reported by others. The ASA1 protein secreted by the A. sobria 33, a human isolate and
the ASH3 produced by the fish isolate A. salmonicida 17-2 were found to be 66%
identical with aerolysin (Table 1.8) (Hirono et al. 1992; Hirono & Aoki 1993). On the
other hand, the cytotonic enterotoxin (Alt) produced by the human diarrhoeal isolate A.
hydrophila SSU showed 45 to 51% identity with phospholipase/lipase (Chopra et al.
1996). These results suggest that Aeromonas can produce a variety of extracellular
products that may be unique to specific strains. This is not surprinsing considering that
some Aeromonas strains can produce several enzymes with different biological
properties (Wretlind and Heden 1973; Honda et al. 1985; Howard and Buckley 1985;
Kozaki et al. 1987).
-- 244 --
The virulence genes investigated in this study represent a subset of the many virulence
factors described in Aeromonas, and the roles of only some of these genes have been
defined in the pathogenesis of aeromonads (Chopra et al. 2009). In this study, the only
gene found to be significantly more common in clinical than in environmental isolates
was lafA. Recently, Grim et al. (2013) used a combination of whole genome-sequence
and phenotypic assays to compare the virulence potential between two A. hydrophila
strains isolated from a patient with a polymicrobial wound infection. The more virulent
isolate harboured genes encoding for act, T3SS, flagella, haemolysins, capsule and a
homolog of exotoxin A found in Pseudomonas aeruginosa. The isolate was also lethal
to mice injected with a dose of 1 x 107 CFU. Thus a virulent pathotype of A. hydrophila
has now been identified and further genomic analysis is likely to reveal more distinct
pathotypes within the genus.
In this Chapter, 129 genotypically-characterized WA Aeromonas isolates of clinical and

environmental origin were examined for 13 putative virulence determinants to add to
the current body of knowledge on virulence-associated characteristics of Aeromonas.
This is the first study of this kind in Australia. Results from this study showed that the
distribution of these genes varies from strain to strain irrespective of the species and
source of isolation. Furthermore, this study reinforces the clinical relevance previously
attributed to A. dhakensis (as A. aquariorum or A. hydrophila ssp. dhakensis), a species
known to possess many virulence genes (Figueras et al. 2009; Sedláček, et al. 2012;
Puthucheary et al. 2012). Moreover, although clinical isolates belonging to A.
hydrophila and A. dhakensis can harbour many virulence genes, not all strains do so.
Genomic comparisons combined with phenotypic studies appear to be a suitable and
practical approach for the identification of virulent pathotypes in Aeromonas.
-- 245 --
-- 246 --
CHAPTER 8: GENERAL DISCUSSION
This thesis consists of several peer-reviewed publications in which the phenotypic,

genotypic, antimicrobial susceptibility profiles and the presence of several virulence
factors were investigated in a collection of Aeromonas isolated from human clinical
material, various water sources and fish samples. In addition, the taxonomic position of
an isolate recovered from irrigation water was investigated by extensive phenotypic and
genotypic testing leading to the proposal of a novel Aeromonas species.
Despite the ubiquitous nature of Aeromonas, a genus that has been associated with
infections in warm and cold-blooded animals including humans for more than a hundred
years, the lack of an animal model of infection has undermined the significance of this
genus as a true human pathogen. The failure of aeromonads to fulfil Koch’s postulates
has led bacteriologists to consider these bacteria opportunistic microorganisms rather
than recognized bona fide pathogens. This is highly surprising considering the
devastating impact that infection with these bacteria has caused to the aquaculture and
other related industries resulting in enormous financial loss (Kodjo et al. 1997; Nash et
al. 2006). In the past, the complex taxonomy of the genus undermined an understanding
of the potential pathogenic significance of Aeromonas, and their distribution. However,
the introduction of molecular methods has facilitated a more accurate differentiation of
the species. As a consequence, the real distribution of Aeromonas in all environments is
starting to emerge.
Therefore, the aims of this thesis were:
1. To determine the identity and distribution of local clinical and environmental

Aeromonas isolates by phenotypic and genotypic methods.
2. To introduce novel phenotypic methods and revisit older ones with the aim
to find new biochemical markers.
3. To examine the antimicrobial susceptibilities of local clinical and
environmental isolates.
4. To identify isolates with uncertain taxonomic positions
5. To investigate the presence of selected virulence genes among local clinical
and environmental isolates.
-- 247 --
Classification of Aeromonas isolates
This study began with the phenotypic classification of 199 Aeromonas isolates from
various clinical and environmental sources. Identification was based on a scheme
comprising more than 60 biochemical and physiological assays (Abbott et al. 2003).
Novel tests were introduced to find additional biochemical markers for an improved
identification. Overall, most isolates (93%) were identified to species level. Among the
clinical isolates, A. hydrophila (52.2%), A. caviae (19.0%) and A. veronii bv. sobria
(14.5%) accounted for 92% of the total isolates. This is in accordance with other studies
where together these species usually account for > 85% of the clinical isolates for this
genus (Altwegg and Geiss 1989; Abbott et al. 2003). Among water isolates, A.
hydrophila (46%) was the most common species followed by A. veronii bv. sobria
(22%). The high frequency of isolation of A. hydrophila supports the notion that the
frequency with which various species occur in clinical and environmental specimens,
are probably due to differences in the virulence potential of the strains (Janda et al.
1984; Barer et al. 1986; Kuijper et al. 1989b). It may also explain the reason why this
species has been the most studied aeromonad (Figueras 2005).
Earlier studies used numerical taxonomic techniques in combination with a large

number of biochemical characters to identify Aeromonas. However, no study was able
to characterize every isolate tested (Bryant et al. 1986a; Renaud et al. 1988; Kaznowski
et al. 1989; Käempfer and Altwegg 1992) reflecting the phenotypic homogeneity within
the genus. Nevertheless, in some studies, phenotypic identification in combination with
numerical taxonomy was able to produce discrete phenotypic clusters allowing the
recognition of two novel species (Miñana-Galbis et al. 2004, 2007). In this study,
identification of Aeromonas to the species level using biochemical methods was fraught
with difficulties including the low positivity rate of some tests, interpretation of end-
points, and the low number of strains representing environmental and infrequently
isolated species. Moreover, the introduction of novel tests in this study failed to provide
useful phenotypic markers further confirming that the identification of Aeromonas by
phenotypic methods is unreliable and some isolates are likely to be misidentified or
cannot be assigned to any definitive taxon (Figueras et al. 2007b; Ghatak et al. 2007b).
Following phenotypic classification, the genetic relationships of all isolates were

determined from gyrB and rpoD gene sequences. As a result, 99.5% of the strains re-
identified were placed in a taxon compared to 93% by the previous method. The new
-- 248 --
distribution indicated that in WA A. caviae, A. dhakensis, A. hydrophila and A. veronii
bv. sobria were the most prevalent species in clinical specimens accounting for 96% of
the total isolates. Moreover, the frequency of these species among human clinical
material was very similar with A. veronii bv. sobria (25%) slightly more prevalent than
A. caviae and A. dhakensis (both at 23.8%) and A. hydrophila (23%), respectively.
Thus, the difference in the frequency of isolation of A. hydrophila from clinical and
environmental specimens fell significantly from 52 to 19% (p < 0.0001) after genotypic
identification. These results provide strong evidence that the distribution of Aeromonas
species largely correlates with the identification method employed. The high prevalence
of A. dhakensis in this study has been reported in recent studies suggesting that this
species is globally distributed in clinical specimens (Figueras 2005; Puthucheary et al.
2012; Wu et al. 2012).
Misidentification of isolates may also explain the phenotypic heterogeneity previously

associated with A. hydrophila, A. caviae and A. veronii (Miyata et al. 1995; Graf 1999a;
Korbsrisate et al. 2002; Abbott et al. 2003). It is also possible that among Aeromonas
species different ecotypes capable of exploiting a specific ecological niche exist.
Ecotypes have been described among strain that exhibit higher than 99% average
nucleotide identity (ANI) although the gene content of strains of the same species can
vary up to 30%. This difference begs the question of whether these strains should
belong to the same species (Konstantinidis and Tiedje 2005). Future studies designed to
compare the gene content between clinical and environmental isolates using ANI as a
tool may be forthcoming. Thus, this study contributes to an important knowledge about
the frequency of Aeromonas species in WA indicating that a more accurate distribution
of the genus is beginning to emerge.
The description of Aeromonas australiensis sp. nov.
In Chapter 4, the position of strain 266 inferred from the gyrB and rpoD gene sequences
showed that this isolate formed a separate line of descent from all other species in the
genus. Furthermore, the inability of the strain to produce acid from D-mannitol was
significant as most species in the genus do so. Subsequent extensive phenotypic and
genotypic testing confirmed that strain 266T indeed represented a novel Aeromonas
species (Aravena-Román et al. 2013). Proposing new species based on a single strain
has been a source of controversy among bacteriologists. This situation has led some
authors to recommend that the Bacteriological Code be revised and that a minimum
-- 249 --
number of standard tests and strains should be included in the description of new
species (Christensen et al. 2001; Janda and Abbott 2002) of which genotypic methods
should be mandatory (Figueras et al. 2006). However, there are a few drawbacks with
these recommendations. Firstly, it may take a very long time to collect the minimum
number of strains recommended from geographically and epidemiologically unrelated
areas. Secondly, strains may be lost in storage or simply forgotten in culture collections.
Thirdly, sequences from nearly every bacterial species have been placed on GenBank
and are readily available for comparison. The latter point is reinforced by the recent
isolation of A. simiae following a survey to determine the prevalence of Aeromonas in
slaughterhouses in northern Portugal. The strain was isolated among 703 isolates and
was identified on the basis of 16S rDNA, gyrB and rpoD sequencing (Fontes et al.
2010). Aeromonas simiae was first described on the basis of two strains isolated from
faeces of healthy monkeys (M. fascicularis) from Mauritius (Harf-Monteil et al. 2004).
A second study recently reported that A. taiwanensis constituted 6% of the Aeromonas
species isolated from diarrhoeal stools in Israel. In this study, identification of the
isolates was based on the sequences of the rpoD gene (Senderovich et al. 2012). The
original description of A. taiwanensis was based in a single strain recovered from an
infected burn wound of a 40 year-old male from Taiwan (Alperi et al. 2010b).
These findings suggest that A. australiensis may be isolated by others in future studies.
Isolation of A. australiensis outside Australia would indicate a global distribution of the
species while isolation within Australia would suggest that the species is indigenous to
this region only. The discovery of A. australiensis from irrigation water is a significant
contribution to the understanding of the global distribution of this genus and adds to the
list of new aeromonads described in the last 14 years. This increasing number of new
Aeromonas species also coincided with the rapid increase of new bacterial species
described over the same period of time (Janda and Abbott 2010). Furthermore, the
recognition of a novel species reinforces the notion that accurate identification of these
bacteria must include a molecular approach.
Antimicrobial susceptibility
The antimicrobial susceptibility patterns of Aeromonas determined in this study indicate

that the number of multi-drug resistance strains found locally is extremely low. In
contrast to other reports, no Aeromonas strain isolated in WA was found to carry
resistance mechanisms such as ESBLs or the presence of MBLs (Rasmussen and Bush
-- 250 --
1997; Neuwirth et al. 2007; Libisch et al. 2008; Wu et al. 2012). All isolates tested in
this study were exquisitely susceptible to the fluoroquinolones ciprofloxacin and
norfloxacin (100%) while resistance to nalidixic acid was very low (3.1%). The latter
result is in sharp contrast with the high rates of resistance to nalidixic acid reported by
Rhodes et al. (2000) who observed resistance to nalidixic acid in 94% of human derived
and 52% of aquaculture aeromonads. Similarly, Figueira et al. (2011) reported
resistance to this antimicrobial agent in 90.6% of waste water and 17.6% of surface
water isolates. In Taiwan, resistant to fluoroquinolones is emerging where up to 14% of
Aeromonas showed tolerance to this antimicrobial class (Wu et al. 2007). On the other
hand, resistance to tetracycline in WA aeromonads is low (<6%) whereas reports from
Asia suggest that up to 49% of the isolates can be resistant to this antimicrobial class
(Chang and Bolton 1987; Ko et al. 1996).
Based on the low antimicrobial resistance exhibited by environmental aeromonads

consisting primarily of strains isolated from water samples it is safe to suggest that
water is not an ecological niche for resistance mechanisms in WA. By contrast, reports
from several locations reveal that multi-resistant Aeromonas strains can be found among
water and foods sources (Goñi-Urriza et al. 2000; Rhodes et al. 2000; Nawaz et al.
2010; Esteve et al. 2012). In one study, consumption of contaminated water was
implicated in serious infections caused by ESBL-producing Aeromonas (Rodríguez et
al. 2005). Furthermore, the high susceptibility nature of environmental strains to most
antimicrobial classes reported in this study suggests that clinical strains may act as a
potential reservoir for resistance mechanisms. This is consistent with previous
observations that suggested that resistant strains isolated from clinical samples may
release compounds into the environment and provide a source of constant selection that
maintains pressure for populations of resistant strains (Davies and Davies 2010). Thus,
results from this and other studies confirm that variations in the antimicrobial profiles
exist in Aeromonas strains isolated from different locations.
From the clinical point of view, the presence of aeromonads in human clinical material
may impact patient management as incorrect empirically therapy has been administered
in a significant number of cases involving Aeromonas (Scott et al. 1978; Vila et al.
2002; Bravo et al. 2003; Figueras 2005). The overall susceptibility profile of
Aeromonas was deemed to be stable during the decade mid-1980s to mid-1990s (Janda
-- 251 --
and Abbott 2010), a trend that appears to continue in this region as indicated by this
study.
There were 11 isolates with a multi-resistant profile. One was isolated from water, two
from diseased fish and the rest from human clinical material. Of these, only one
exhibited resistance to the aminoglycosides, 3rd generation chephalosporins, lower
concentration cefepime but was susceptible to meropenem, fluoroquinolones, amikacin
and high concentration of cefepime. The remaining resistant isolates were invariably
susceptible to the fluoroquinolones while the majority were also susceptible to the
aminoglycosides, meropenem and 3rd and 4th generation cephalosporins. From the
clinical point of view, clinicians still have more than one choice of antimicrobials at
their disposal to treat these resistant isolates. In conclusion, this research provides
significant information about the antimicrobial resistance patterns of local clinical
Aeromonas species and may guide clinicians to implement correct antimicrobial
therapy. That is, if Aeromonas spp. are suspected or proven, then antimicrobials such as
fluoroquinolones, aminoglycosides, carbapenems, 3rd and 4th generation cephalosporins
can be safely administered.
Distribution and significance of virulence genes
In this study, the pathogenic potential of 129 genotypically-characterized isolates

comprising 11 Aeromonas species was evaluated by detecting the presence of 13
virulence genes using a PCR-based method. Of these, 98 isolates were of clinical origin
and 31 derived primarily from water and fish samples. Aeromonas was the sole
aetiological agent in 60% of the cases while the remining 40% were isolated with
another pathogen or as part of a polymicrobial bacterial population. The majority (17,
85%) of the isolates recovered from stools were from symptomatic patients who had
watery diarrhoea or loose faeces and in some cases blood and leucocytes were present in
the specimen. These parameters are usually associated with gastroenteritis. Although no
clinical data was obtained in 31% of the clinical cases, Aeromonas was the only
microorganism isolated in most (26, 84%) while 5 (16%) cases were polymicrobial.
Strains isolated from fish derived mainly from diseased animals.
Overall, the majority of the isolates (96%) harboured at least one virulence gene
compared to 65% of the total isolates from another study (Kingome et al. 1999). The
number of virulence genes found in multidrug resistant isolates ranged from 1 to 4 with
-- 252 --
one isolate not included in the virulence study. These isolates were no more pathogenic,
in terms of virulence genes detected, than others in the study. Therefore, there was not a
relation between the most virulent strains and their antibiotic profile found. Results
from this and other studies from locations as diverse as Mexico, Spain, Bangladesh,
Italy, USA and Israel (Albert et al. 2000; Sechi et al. 2002; Sen and Rodgers 2004;
Aguilera-Arreola et al. 2007; Senderovich et al. 2012) indicate that the distribution of
virulence genes among the species is highly variable. Comparison between studies is
difficult due to the number of isolates tested, source of isolation, identification method
used to characterize isolates and choice of virulence genes (Sechi et al. 2002; Chacón et
al. 2003; Wu et al. 2007). Some studies were designed to evaluate the virulence
potential of different strains of the same species (Soler et al. 2002; Yu et al. 2005) while
others targeted the detection of a single virulence gene from several species (Chacón et
al. 2003; Yu et al. 2004). A recent study from Malaysia evaluated the pathogenic
potential of 94 genotypically-characterized clinical isolates comprising five species by
detecting the prevalence of 10 virulence genes (Puthucheary et al. 2012). Of these, only
six (aerA, alt, ast, flaA, aspA and aexT) virulence genes were common with those used
in this study. The prevalence of aerA and alt within the major species was remarkable
similar with the present study while the prevalence of the remaining four genes differed
significantly depending on the gene and the species.
In this study, aerA/haem was highly prevalent in WA isolates while the remaining
virulence genes were randomly distributed among the species. And although many
isolates harboured multiple virulence genes, not a single strain carried the full
complement of the 13 virulence genes. Several virulence genes including alt, aspA,
vasH, ascV and aexT were more prevalent in environmental rather than in clinical
isolates. These differences were statistically significant and suggested that
environmental isolates may represent a reservoir of potentially pathogenic strains. Any
discernible virulence pattern present is tenuous and evidence from this study does not
support that each species carried distinct sets of genes as reported by others (Kirov et al.
2002; Aguilera-Arreola et al. 2007; Puthucheary et al. 2012). In addition to A.
dhakensis and A. hydrophila, strains from A. allosaccharophila and A. jandaei also
harboured multiple virulence genes. The presence of multiple virulence genes or other
virulence factors in less frequently isolated species suggest that strains from these
species are potentially pathogen (Soler et al. 2002; Chacón et al. 2003; Senderovich et
al. 2012).
-- 253 --
Although no single or combination of virulence factors has been unequivocally
correlated to virulence in Aeromonas (Aguilera-Arreola et al. 2007), the presence of
T3SS and toxin genes in clinical strains would elevate Aeromonas to the same category
as the primary pathogens Y. enterocolitica, Salmonella enterica, enteropathogenic E.
coli and Shigella flexnery (Chacón et al. 2004). The high prevalence of aerA/haem
(81%) in clinical isolates suggests that strains possessing this virulence gene are
potentially pathogenic and may be diarrhoeagenic in vivo (Janda and Abbott 2010) as
both aerA and hlyA are considered virulence markers for Aeromonas (Heuzenroeder et
al. 1999; González-Serrano et al. 2002). Thus, despite the low number of virulence
genes detected among A. veronii bv. sobria isolates, the pathogenic potential previously
attributed to this species (Daily et al. 1981; Janda et al. 1985; Janda and Kokka 1991;
Kirov and Hayward 1993; Lye et al. 2007) should be maintained as every strain (100%)
harboured the aerA/haem gene. It is also possible that the action of this toxin alone may
account for the infectious process associated with strains harbouring aerA/haem in this
study. Similarly, while the frequency of isolation and clinical relevance previously
attributed to A. hydrophila has been overestimated (Figueras et al. 2009), isolation of
this species from serious human infections continuous to grow. In a recent report, A.
hydrophila was recovered from a posttraumatic brain abscess following a head injury
and was described as an aggressive pathogen (Mahabeer et al. 2014). Unfortunately, the
isolate was identified by a commercial system without further confirmation by a
molecular method. Nevertheless, this case reinforces the pathogenic potential attributed
to this species in particular and to Aeromonas in general.
The low number of virulence genes detected in A. caviae was consistent with previous
reports and has been one of the main reasons to consider this species less pathogenic
than A. veronii and A. hydrophila (Honda et al. 1985; Kirov et al. 1986; Majeed et al.
1990; Eley et al 1993; Martins et al. 2002). A lack of virulence genes is contrary to the
notion that the presence of high number of virulence genes is associated with a high
pathogenic potential among Aeromonas strains (Nawaz et al. 2010). However, growing
evidence suggests that A. caviae should be considered a bona fide pathogen. Firstly, A.
caviae strains can possess virulence factors considered to be significant in the
pathogenesis of Aeromonas-associated infections (Callister and Agger 1987; Gray et al.
1990; Namdari and Bottone 1990b; Deodhar et al. 1991; Singh and Sanyal 1992b;
Kirov and Hayward 1993; Shaw et al. 1995; Wang et al. 1996; Mokracka et al. 2001;
Ghatak et al. 2006; Krzymińska et al. 2003, 2011). Secondly, the pathogenic potential
-- 254 --
of A. caviae is enhanced by animal passage suggesting that expression of virulence
genes may be reactivated in genes that were previously repressed (Singh and Sanyal
1992c; Krzymińska et al. 2003). Thirdly, the predominance of A. caviae in diarrhoeal
stools from neonates and children with gastroenteritis is further evidence that A. caviae
should be considered a true enteric pathogen (Altwegg and Geiss 1989; Namdari and
Bottone 1990b; Pazzaglia et al. 1990a; Moyer et al. 1991; Wilcox et al. 1992; Albert et
al. 2000; Rabaan et al. 2001; Bravo et al. 2012; Senderovich et al. 2012). Evidence now
exists for water-to-human transmission by members of the A. caviae-A. media group
(Khajanchi et al. 2010). Fourthly, A. caviae has been implicated in serious human
infections affecting immunocompetent individuals (Kumar et al. 2012). This would also
support the notion that to date, there is no consensus as to which virulence factor(s) is
the most critical for human infections (Chakraborty et al. 1987) and that a hierarchical
classification of virulence factors for Aeromonas does not exist or cannot, at this stage,
be established (Aguilera-Arreola et al. 2007).
Predicting virulence of Aeromonas isolates based on changes in transcription of c-jun

and c-fos in human tissue culture cells has been recently proposed (Hayes et al. 2009)
and although detection of virulence genes can be used to determine the pathogenic
potential of Aeromonas, this method only demonstrates that some virulence genes are
present in some strains but not in others. Instead, the study by Grim et al. (2013)
demonstrated that genotypic differences correlated with functional virulence factor
assays and allowed to identify a virulent pathotype of A. hydrophila capable of causing
wound infections in humans. This study offers several advantages over the detection of
virulence genes or the detection of virulence products by bioassays alone. Taken
together, these observations suggest that the combinations of methods used by Grim et
al. (2013) should be considered the standard method to evaluate the pathogenic
potential of Aeromonas species and that a library of truly pathogenic strains should be
created as previously proposed (Janda and Abbott et al. 2010).
CONCLUSIONS
The characterization of a large collection of clinical and environmental isolates indicate

that in Western Australia the species A. veronii bv. sobria, A. dhakensis, A. caviae and
A. hydrophila are the most prevalent. Characterization of isolates by genotypic methods
is also likely to identify less frequently isolated species including A. allosaccharophila,
-- 255 --
A. salmonicida, A. bestiarum, A. jandaei, A.media, A. schubertii and uncover potentially
novel species. From the clinical point of view, the antimicrobial susceptibilities
determined in this study provide clinicians with several choices of antimicrobials to
empirically initiate therapy if Aeromonas are suspected to be present. The detection of
clinical and environmental isolates harbouring multiple virulence genes among several
Aeromonas species contributes to the current knowledge on the virulence of these
bacteria. Finally, data from this and other studies suggest that the pathogenic potential
in Aeromonas is probably strain- rather than species-dependent.
-- 256 --
REFERENCES
Abbott, S. L., W. K. W. Cheung and J. M. Janda (2003). "The genus Aeromonas:

biochemical characteristics, atypical reactions, and phenotypic identification
schemes." Journal of Clinical Microbiology 41(6): 2348-2357.
Abbott, S. L., W. K. W. Cheung, S. Kroske-Bystrom, et al. (1992). "Identification of
Aeromonas strains to the genospecies level in the clinical laboratory." Journal
of Clinical Microbiology 30(5): 1262-1266.
Abbott, S. L., L. S. Seli, M. Catino Jr, et al. (1998). "Misidentification of unusual
Aeromonas species as members of the genus Vibrio: a continuing problem."
Journal of Clinical Microbiology 36(4): 1103-1104.
Abdullah, A., C. A. Hart and C. Winstanley (2003). "Molecular characterization and
distribution of virulence-associated genes amongst Aeromonas isolated from
Libya." Journal of Applied Microbiology 95: 1001-1007.
Abeyta Jr., C. and M. M. Wekell (1988). "Potential sources of Aeromonas hydrophila."
Journal of Food Safety 9: 11-22.
Abeyta Jr., C., C. A. Kaysner, M. M. Wekell, et al. (1986). "Recovery of Aeromonas
hydrophila from oysters implicated in an outbreak of foodborne illness."
Journal of Food Protection 49(8): 643-646.
Abrami, L., M. Fivaz, E. Decroly, et al. (1998). "The pore forming toxin aerolysin is
activated by furin." Journal of Biological Chemistry 271: 32656-32661.
Abrami, L., M. Fivaz, P. E. Glauser, et al. (2003). "Sensitivity of polarized epithelial
cells to the pore-forming toxin aerolysin." Infection and Immunity 71: 739-746.
Abuhammour, W., R. A. Hasan and D. Rogers (2006). "Necrotizing fasciitis caused by
Aeromonas hydrophila in an immnucompetent child." Pediatrics and
Emergency Care 22(1): 48-51.
Adekambi, T., T. M. Shinnick, D. Raoult, et al. (2008). "Ccomplete rpoB gene
sequencing as a suitable supplement to DNA-DNA hybridization for bacterial
species and genus delineation." International Journal of Systematic and
Evolutionary Microbiology 58: 1807-1814.
Agger, W. A. (1986). "Diarrhoea associated with Aeromonas hydrophila." Pediatric
Infectious Disease 5(1): S106-S108.
Agger, W. A., J. D. McCormick and M. J. Gurwith (1985). "Clinical and
microbiological features of Aeromonas hydrophila-associated diarrhoea."
Aguilar, A., S. Merino, X. Rubires, et al. (1997). "Influence of osmolarity on
lipopolyaccharides and virulence of Aeromonas hydrophila serotype O:34
strains grown at 37C." Infection and Immunity 65(4): 1245-1250.
Aguilera-Arreola, M. G., G. Hernandez-Rodríguez, G. Zuñiga, et al. (2005).
"Aeromonas hydrophila clinical and environmental ecotypes as revealed by
genetic diversity and virulence genes." FEMS Microbiology Letters 242: 231-
240.
Aguilera-Arreola, M. G., C. Hernadez-Rodríguez, G. Zuñiga, et al. (2007). "Virulence
potential and genetic diversity of Aeromonas caviae, Aeromonas veronii, and
Aeromonas hydrophila clinical isolates from Mexico and Spain: a comparative
study." Canadian Journal of Microbiology 53: 877-887.
Alavandi, S. V., M. S. Subashini and S. Ananthan (1999). "Occurrence of haemolytic
and cytotoxic Aeromonas species in domestic water supplies in Chennai."
Indian Journal of Medical Research 110: 50-55.
Alavandi, S. V., S. Ananthan and N. P. Pramod (2001). "Typing of Aeromonas isolates
from children with diarrhoea and water samples by randomly amplified
-- 257 --
polymorphic DNA polymerase chain reaction and whole cell protein
fingerprinting." Indian Journal of Medical Research 113: 85-97.
Al-Benwan, K., A. Abbott, J. M. Janda, et al. (2007). "Cystitis caused by Aeromonas
caviae." Journal of Clinical Microbiology 45(7): 2348-2350.
Albert, M. J., M. Ansaruzzaman, K. A. Talukder, et al. (2000). "Prevalence of
enterotoxin genes in Aeromonas spp. isolated from children with diarrhea,
healthy controls, and the environment." Journal of Clinical Microbiology
8(10): 3785-3790.
Aldridge, P. and K. T. Hughes (2002). "Regulation of flagellar assembly." Current
Opinions in Microbiology 5: 160-165.
Ali, A., A. M. Carnahan, M. Altwegg, et al. (1996). “Aeromonas bestiarum sp. nov.
(formerly genomospecies DNA group 2 A. hydrophila), a new species isolated
from non-human sources.” Medical Microbiology Letters 5: 156-165.
Allen, D. A., B. Austin and R. R. Colwell (1983). "Aeromonas media, a new species
isolated from river water." International Journal of Systematic Bacteriology
33(3): 599-604.
Alperi, A., A. J. Martínez-Murcia, A. Monera, et al. (2010a). "Aeromonas fluvialis sp.
nov., isolated from a Spanish river." International Journal of Systematic and
Alperi, A., A. J. Martínez-Murcia, W. C. Ko, et al. (2010b). "Aeromonas taiwanensis
sp. nov. and Aeromonas sanarelli sp. nov. two new clinical species from
Taiwan." International Journal of Systematic and Evolutionary Microbiology
60(9): 2048-2055.
Alperi, A., M. J. Figueras, I. Inza, et al. (2008). "Analysis of 16S rRNA gene mutations
in a subset of Aeromonas strains and their impact in species delineation."
International Microbiology 11: 185-194.
Alperi, A. and M. J. Figueras (2010).“Human isolates of Aeromonas possess Shiga
toxin genes (stx1 and stx2) highly similar to the most virulent gene variants of
Escherichia coli.” Clinical Microbiology Infections 16: 1563-1567.
Altorfer, R., M. Altwegg, J. Zollinger-Iten, et al. (1985). "Growth of Aeromonas spp. on
cefsulodin-irgasan-novobiocin agar selective for Yersinia enterocolitica."
Altschul, S. F., W. Gish, W. Miller, et al. (1990). "Basic local alignment search tool."
Journal of Molecular Biology 215: 403-410.
Altwegg, M. (1985). "Aeromonas caviae: an enteric pathogen?." Infection 13(5): 228-
230.
Altwegg, M. and J. Luthi-Hottesntein (1991). "Methods for the identification of DNA
hybridization groups in the genus Aeromonas." Experientia 47: 403-406.
Altwegg, M. and and H. K. Geiss (1989). "Aeromonas as a human pathogen." Critical
Reviews in Microbiology 16(4): 253-286.
Altwegg, M., G. Martinetti-Lucchini, J. Luthy-Hottenstein, et al. (1991a). "Aeromonas-
associated gastroenteritis after consumption of contaminated shrimp."
European Journal of Clinical Microbiology and Infectious Diseases 10(1): 44-
45.
Altwegg, M., M. W. Reeves, R. Altwegg-Bissig, et al. (1991b). "Multilocus enzyme
analysis of the genus Aeromonas and its use for species identification."
Zentralblatt Bakteriologie und Hygiene 275: 28-45.
Altwegg, M., R. Altwegg-Bissig, A. Demarta, et al. (1988). "Comparison of four typing
methods for Aeromonas species " Journal of Diarrhoeal Disease Research
6(2): 88-94.
-- 258 --
Altwegg, M., A. G. Steigerwalt, R. Altwegg-Bissig, et al. (1990). "Biochemical
identification of Aeromonas genospecies isolated from humans." Journal of
Clinical Microbiology 28(2): 258-264.
Ampel, N. and G. Peter (1981). "Aeromonas bacteraemia in a burn patient." Lancet 318:
987.
Anderson, C. R. and G. M. Cook (2004). "Isolation and characterization of arsenate-
reducing bacteria from arsenic-contaminated sites in New Zealand." Current
Microbiology 48: 341-347.
Angel, M. F., F. Zhang, M. Jones, et al. (2002). "Necrotizing fasciitis of the upper
extremity resulting from a water moccasin bite." Southern Medical Journal 95:
1090-1094.
Anguita, J., L. B. Rodríguez Aparicio and G. Naharrro (1993). "Purification, gene
cloning, amino acid sequence analysis, and expression of an extracellular lipase
from an Aeromonas hydrophila isolate." Applied and Environmental
Microbiology 59(8): 2411-2417.
Araujo, R. M., R. M. Arribas and R. Pares (1991). "Distribution of Aeromonas species
in waters with different levels of pollution." Journal of Applied Bacteriology
71: 182-186.
Araujo, R. M., R. M. Arribas, F. Lucena, et al. (1989). "Relation between Aeromonas
and faecal coliforms in fresh waters." Journal of Applied Bacteriology 67: 213-
217.
Aravena-Román, M., G. B. Harnett, T. V. Riley, et al. (2011b). "Aeromonas
aquariorum is widely distributed in clinical and environmental specimens and
can be misidentified as Aeromonas hydrophila." Journal of Clinical
Aravena-Román, M., T. T. J. Inglis, B. Henderson, et al. (2012). "Antimicrobial
susceptibilities of Aeromonas strains isolated from clinical and environmental
sources to 26 antimicrobial agents." Antimicrobial Agents and Chemotherapy
56 (2): 1110-1112.
Aravena-Román, M., T.V. Riley, T. J. J. Inglis, et al. (2011a). "Phenotypic
characteristics of human clinical and environmental Aeromonas in Western
Australia." Pathology 43(4): 350-356.
Aravena-Román, M., R. Beaz-Hidalgo, T.J. J. Inglis, et al. (2013). "Aeromonas
australiensis sp. nov., isolated from irrigation water." International Journal of
Systematic and Evolutionary Microbiology 63: 2270-2276.
Aravena-Román, M., T. J. J. Inglis, T. V. Riley (2014). “Distribution of 13 virulence
genes among clinical and environmental Aeromonas spp. in Western
Australia.” European Journal of Clinical Microbiology and Infectious Diseases
33(11): 1889-1895.
Asao, T., S. Kozaki, K. Kato, et al. (1986). "Purification and characterisation of an
Aeromonas hydrophila haemolysin." Journal of Clinical Microbiology 24(2):
228-232.
Asao, T., Y. Kinoshita, S. Kosaki, et al. (1984). "Purification and some properties of
Aeromonas hydrophila haemolysin." Infection and Immunity 46(1): 122-127.
Ascencio, F., W. Martínez-Arias, M. J. Romero, et al. (1998). "Analysis of the
interaction of Aeromonas caviae, A. hydrophila and A. sobria with mucins."
FEMS Immumology and Medical Microbiology 20: 219-229.
Ascensio, F., A. Ljungh and T. Wadström (1991). "New lectins an other putative
adhesins in Aeromonas hydrophila." Experientia 47: 414-416.
Ash, C., A. J. Martínez-Murcia and M. D. Collins (1993a). "Identification of
Aeromonas schubertii and Aeromonas jandaei by using a polymerase chain
reaction-probe test." FEMS Microbiology Letters 108: 151-156.
-- 259 --
Ash, C., A. J. Martínez-Murcia and M. D. Collins (1993b). "Molecular identification of
Aeromonas sobria by using a polymerase chain reaction-probe test." Medical
Microbiology Letters 2 80-86.
Ashbolt, N. J., A. Ball, M. Dorsch, et al. (1995). "The identification of human health
significance of environmental aeromonads." Water Science Technology 31(5-
6): 263-269.
Atkinson, H. M. and T. J. Trust (1980). "Haemagglutination properties and adherence
ability of Aeromonas hydrophila." Infection and Immunity 27(3): 938-946.
Atkinson, H. M., D. Adams, R. S. Savvas, et al. (1987). "Aeromonas adhesin antigen."
Experientia 43: 372-374.
Austin, B. and C. Adams (1996). "Fish pathogens." In B. Austin, M. Altwegg, P. J.
Gosling and S. Joseph (ed), The genus Aeromonas, John Wiley & Sons Ltd.,
West Sussex, England: 197-243.
Austin, B. and D. A. Austin (1987). "Disease in farmed and wild fish." In Laird:
Bacterial Fish Pathogens: Ellis Horwood Limited, Chichester, England 111-
195.
Austin, B., D. A. Austin, I. Dalsgaard, et al. (1998). "Characterization of atypical
Aeromonas salmonicida by different methods." Systematic and Applied
Austin, D. A., D. McIntosh and B. Austin (1989). “Taxonomy of fish associated
Aeromonas spp., with the description of Aeromonas salmonicida subsp. smithia
subsp. nov.” Systematic and Applied Microbiology 11, 277-290.
Awan, M. B., M. M. Ahmed, A. Bari, et al. (2006). "Putative virulence factors of the
Aeromonas spp. isolated from food and enviroment in Abu Dhabi, United Arab
Emirates." Journal of Food Protection 69(7): 1713-1716.
Baddour, L. M., and V. S. Baselski (1988). "Pneumonia due to Aeromonas hydrophila-
complex: epidemiologic, clinical, and microbiologic features." Southern
Medical Journal 81(4): 461-463.
Bakken, J. S., C. C. Sanders, R. B. Clark, et al. (1988). "B-lactam resistance in
Aeromonas spp. caused by inducible B-lactamases active against penicillins,
cephalosporins, and carbapenems." Antimicrobial Agents and Chemotherapy
32(9): 1314-1319.
Balaji, V., M. V. Jesudason and G. Sridharan (2004). "Cytotoxin testing of
environmental Aeromonas spp. in Vero cell culture." Indian Journal of
Medical Research 119(5): 186-189.
Barer, M. R., S. E. Millership and S. Tabaqchali (1986). "Relationship of toxin
production to species in the genus Aeromonas " Journal of Medical
Barghouthi, S., R. Young, M. O. J. Olson, et al. (1989). "Amonabactin, a novel
trytophan- or phenylalanine-containing phenolate siderophore in Aeromonas
hydrophila." Journal of Bacteriology 171(4): 1811-1816.
Barghouthi, S., S. M. Payne, J. E. L. Arcenaux, et al. (1991). "Cloning, mutagenesis,
and nucleotide sequence of a siderophore biosynthetic gene (amoA) from
Aeromonas hydrophila." Journal of Bacteriology 173(16): 5121-5128.
Barillo, D. J., A. T. McManus, W. G. Cioffi, et al. (1996). "Aeromonas bacteraemia in
burn patients." Burns 22: 48-52.
Barlow, R. and K. Gobius (2009). "Environmental reservoirs of integrons: the
contribution of production environments to the presence of integrons in beef
cattle." Poster P20-01, p.139 Annual Meeting of the Australian Society for
Microbiology. Perth, Western Australia.
Barnett, T. C., S. M. Kirov, M. S. Ström, et al. (1997). "Aeromonas spp. possess at least
two distinct type IV pilus families." Microbial Pathogens 23: 241-247.
-- 260 --
Bailey and Scott (1994). "Vibrios and related species, Aeromonas, Plesionomonas,
Campylobacter, Helicobacter, and others." Diagnostic Microbiology, Ch. 31,
p.429-444. Baron, J. E., L. R. Peterson and S. M. Finegold, editors, Mosby-
Year Boon Inc. St. Louis, Missouri.
Bartolome, R. M., A. Andreu, M. Xercavins, et al. (1989). "Urinary tract infection by
Aeromonas hydrophila in a neonate." Infection 17: 172-173.
Bauab, T. M., C. E. Levy, J. Rodrigues, et al. (2003). "Niche-specific association of
Aeromonas ribotypes from human and environmental origin." Microbiology
and Immunology 47(1): 7-16.
Bauters, T. G. M., F. M. A. Buyle, G. Verschraegen, et al. (2007). "Infection risk
related to the use of medicinal leeches." Pharmacy World and Science 29: 122-
125.
Beaz-Hidalgo, R., A. Alperi, M. J. Figueras, et al. (2009). "Aeromonas piscicola sp.
nov., isolated from diseased fish." Systematic and Applied Microbiology 32:
471-479.
Beaz-Hidalgo, R., A. Alperi, N. Bujan, et al. (2010). "Comparison of phenotypical and
genetic identification of Aeromonas strains isolated from diseased fish."
Systematic and Applied Microbiology doi:10.1016/j.syapm.1010.02.002.
Beaz-Hidalgo, R., A. Martínez-Murcia, M. J. Figueras (2013). "Reclassification of
Aeromonas hydrophila subsp. dhakensis Huys et al. 2002 and
Aeromonas aquariorum Martínez-Murcia et al. 2008 as Aeromonas dhakensis
sp. nov. comb nov. and emendation of the species Aeromonas hydrophila."
Systematic and Applied Microbiology 36: 171-176.
Beaz-Hidalgo, R., and M. J. Figueras (2013). "Aeromonas spp. whole genomes and
virulence factors implicated in fish disease." Journal of Fish Diseases
doi:10.1111/jfd.12025.
Bechet, M. and R. Blondeau (2003). "Factors associated with the adherence and biofilm
formation by Aeromonas caviae on glass surfaces." Journal of Applied
Belland, R. J. and T. J. Trust (1987). "Cloning of the gene for the surface array protein
of Aeromonas salmonicida and evidence linking loss of expression with
genetic deletion." Journal of Bacteriology 169(9): 4086-4091.
Berg, K. A., C. Lyra, R. Maarit Niemi, et al. (2011). "Virulence genes of Aeromonas
isolates, bacterial endotoxins and cyanobacterial toxins from recreational water
samples associated with human health symptons." Journal of Water and Health
94: 670-679.
Bernheimer, A. W. and L. S. Avigad (1974). "Partial characterization of aerolysin, a
lytic toxin from Aeromonas hydrophila." Infection and Immunity 9(6): 1016-
1021.
Bhowmik, P., P. K. Bag, T. K. Hajra, et al. (2009). "Pathogenic potential of Aeromonas
hydrophila isolated from surface waters in Kolkata, India." Journal of Medical
Bi, Z. X., Y. J. Liu and C. P. Lu (2007). "Contribution of AhyR to virulence of
Aeromonas hydrophila J-1." Research in Veterinary Science 83: 150-156.
Bingle, L. E. H., C. M. Bailey and M. J. Pallen (2008). "Type VI secretion: a beginner's
guide." Current Opinions in Microbiology 11: 3-8.
BioMérieux (2010). "E-test antimicrobial susceptibility testing for in-vitro diagnostic
use." BioMérieux, Marcy-l'Etoile, France.
Bitton, G. (2014). “Microbiology of drinking water: production and distribution.” John
Wiley and Sons Inc. Hoboken, New Jersey.
Blatz, D. J. (1979). "Open fracture of the tibia and fibula complicated by infection with
Aeromonas hydrophila." Journal of Bone and Joint Surgery 61(A): 790-791.
-- 261 --
Bogdanovic, R., M. Cobeljic, M. Markovic, et al. (1991). "Haemolytic-uraemic
syndrome associated with Aeromonas hydrophila enterocolitis " Pediatric
Nephrology 5: 293-295.
Bonadonna, L., R. Briancesco, M. Ciccozzi, et al. (2001). "Biotyping, serotyping and
genotyping of aeromonads from environmental and clinical samples." World
Journal of Microbiology and Biotechnology 17: 673-676.
Bondi, M., P. Messi, E. Guerriere, et al. (2000). "Virulence profiles and other biological
characters in water isolated Aeromonas hydrophila." Microbiological Reviews
23: 347-356.
Borchardt, M. A., M. E. Stemper and J. H. Standridge (2003). "Aeromonas isolates from
human diarrhoeic stool and groundwater compared by pulse-field gel
electrophoresis." Emerging Infectious Diseases 9(2): 224-228.
Borrell, N., M. J. Figueras and J. Guarro (1998). "Phenotypic identification of
Aeromonas genomospecies from clinical and environmental sources."
Canadian Journal of Microbiology 44: 103-108.
Borrell, N., S. G. Acinas, M. J. Figueras, et al. (1997). "Identification of Aeromonas
clinical isolates by restriction fragment length polymorphism of PCR-amplified
16S rRNA genes." Journal of Clinical Microbiology 35(7): 1671-1674.
Bossi-Küpfer, M., A. Genini, R. Peduzzi, et al. (2007). "Tracheobronchitis caused by
Aeromonas veronii biovar sobria after near-drowning." Journal of Medical
Boudewijns, M., J. M. Bakkers, P. D. Sturm, et al. (2006). "16s rRNA gene sequencing
and the routine microbiology laboratory: a perfect marriage?" Journal of
Braun, M., K. Stüber, Y. Schlatter, et al. (2002). "Characterisation of an ADP-
ribosyltransferase toxin (AexT) from Aeromonas salmonicida subsp.
salmonicida." Journal of Bacteriology 184(7): 1851-1858.
Bravo, L., A. Fernandez, F. A. Nuñez, et al. (2012). "Aeromonas spp. asociada a
enfermedad diarreica aguda en Cuba: estudios de casos y controles."
Microbiologia 29(1): 44-48.
Bravo, L., L. Morier, N. Castañeda, et al. (2003). "Aeromonas: an emerging pathogen
associated with extraintestinal infection in Cuba." Revista Cubana de Medicina
Tropical 55(3): 208-209.
Bricknell, I. R., T. J. Bowden, J. Lomax, et al. (1997). "Antibody response and
protection of Atlantic salmon (Salmo salar) immunised with an extracellular
polysaccharide of Aeromonas salmonicida." Fish and Shellfish Immunology 7:
1-16.
Brodsky, R. A., G. L. Mukhina, K. L. Nelson, et al. (1999). "Resistance of paroxysmal
nocturnal haemoglobinuria cell to the glycosylphosphatidylinositol-binding
toxin aerolysin." Blood 93: 1749-1756.
Brumlik, M. J., F. G. van der Goot, K. R. Wong, et al. (1997). "The disulfide bond in
the Aeromonas hydrophila lipase/acyltransferase stabilizes the structure but is
not required for secretion or activity." Journal of Bacteriology 179: 3116-
3121.
Bryant, T. N., J. V. Lee, P. A. West, et al. (1986)."Numerical classification of species of
Vibrio and related genera." Journal of Applied Bacteriology 61: 437-467.
Bücker, R., S. M. Krug, R. Rosenthal, et al. (2011). "Aerolysin from Aeromonas
hydrophila perturbs tight junction integrity and cell lesion repair in intestinal
epithelial HT-29/B6 cells." Journal of Infectious Diseases 204: 1283-1292.
Buckley, J. T. and S. P. Howard (1999). "The cytotoxic enterotoxin of Aeromonas
hydrophila is aerolysin." Infection and Immunity 67(1): 466-467.
-- 262 --
Buckley, J. T., L. N. Halasa and S. McIntyre (1982). "Purification and partial
characterization of a bacterial phospholipid:colesterol acyltransferase " Journal
of Biological Chemistry 255: 3320-3325.
Burgos, A., G. Quindos, R. Martínez, et al. (1990). "In vitro susceptibility of
Aeromonas caviae, Aeromonas hydrophila and Aeromonas sobria to fifteen
antibacterial agents." European Journal of Clinical Microbiology and
Infectious Diseases 9: 413-417.
Burke, V., J. Robinson, M. Gracey, et al. (1984). "Isolation of Aeromonas hydrophila
from a metropolitan water supply: seasonal correlation with clinical isolates."
Applied and Environmental Microbiology 48: 361-366.
Burke, V., M. Gracey, J. Robinson, et al. (1983). "The microbiology of childhood
gastroenteritis: Aeromonas species and other infective agents." Journal of
Infectious Diseases 148(1): 68-74.
Burr, S. E., D. B. Diep and J. T. Buckley (2001). "Type II secretion by Aeromonas
salmonicida: evidence for two periplasmic pools of proaerolysin." Journal of
Bacteriology 183(20): 5956-5963.
Burr, S. E., K. Stüber and J. Frey (2003). "The ADP-ribosylating toxin, AexT, from
Aeromonas salmonicida subsp. salmonicida is translocated via a type III
secretion pathway." Journal of Bacteriology 185(22): 6583-6591.
Burr, S. E., K. Stüber, T. Wahli, et al. (2002). "Evidence for a type III secretion system
in Aeromonas salmonicida subsp salmonicida." Journal of Bacteriology 184:
5966-5970.
Byers, B. R., G. Massad, S. Barghouthi, et al. (1991). "Iron acquisition and virulence in
the motile aeromonads: Siderophore-dependent an -independent systems."
Callister, S. M. and W. A. Agger (1987). "Enumeration and characterization of
Aeromonas hydrophila and Aeromonas caviae isolated from grocery store
produce." Applied and Environmental Microbiology 53(2): 249-253.
Canals, R., M. Altarriba, S. Vilches, et al. (2006b). "Analysis of the lateral flagellar
gene system of Aeromonas hydrophila AH-3." Journal of Bacteriology 188(3):
852-862.
Canals, R., S. Ramírez, S. Vilches, et al. (2006a). "Polar flagellum biogenesis in
Canonica, F. P. and M. A. Pisano (1988). "Gas-liquid chromatography analysis of fatty
acid methyl esters of Aeromonas hydrophila, Aeromonas sobria, and
Aeromonas caviae." Journal of Clinical Microbiology 26(4): 681-685.
Cao, H., S. He, R. H. Wang, et al. (2012). "Bdellovibrios, potential biocontrol bacteria
against pathogenic Aeromonas hydrophila. " Veterinary Microbiology 154:
413-418.
Cao, H., S. He, R. Wei, et al. (2011). "Bacillus amyloliquefaciens G1: a potential
antagonistic bacterium against eel-pathogenic Aeromonas hydrophila."
Evidence-Based Complementary and Alternative Medicine Vol. 2011,
doi:10.1155/824104.
Cao, T. B., and M. H. Saier Jr (2001). "Conjugal type IV macromolecular transfer
systems of Gram-negative bacteria: organismal distribution, structural
constraints and evolutionary conclusions." Microbiology 147: 3201-3214.
Cao, Y., S. He, Z. Zhou, et al. (2012). “Orally administered thermostable N-acyl
homoserine lactonase from Bacillus sp. strain A196 attenuates Aeromonas
hydrophila infection in zebrafish.” Applied and Environmental Microbiology
78:1899-1908.
-- 263 --
Carnahan, A., L. Hammontree, L. Bourgeois, et al. (1990). "Pyrazinamidase activity as
a phenotypic marker for several Aeromonas spp. isolated from clinical
specimens." Journal of Clinical Microbiology 28(2): 391-392.
Carnahan, A. M. (1993). "Aeromonas taxonomy: a sea of change." Medical
Microbiology Letters 2: 206-211.
Carnahan, A. M., T. Chakraborty, G. R. Fanning, et al. (1991a). "Aeromonas trota sp.
nov., an ampicillin-susceptible species isolated from clinical specimens."
Carnahan, A. M., S. Behram and S. W. Joseph (1991b). "Aerokey II: a flexible key for
identifying clinical Aeromonas species." Journal of Clinical Microbiology
29(12): 2843-2849.
Carnahan, A., G. R. Fanning and S. W. Joseph (1991c). "Aeromonas jandaei (formerly
genospecies DNA group 9 A. sobria), a new sucrose-negative species isolated
from clinical specimens." Journal of Clinical Microbiology 29(3): 560-564.
Carrello, A., K. A. Silburn, J. R. Budden, et al. (1988). "Adhesion of clinical and
environmental Aeromonas isolates to HEp-2 cells." Journal of Medical
Cascales, E. (2008). "The type VI secretion toolkit." European Molecular Biology
Organization Reports 9: 735-741.
Cascón, A., J. Anguita, C. Hernanz, et al. (1996). "Identification of Aeromonas
hydrophila hybridization group 1 by PCR assays." Applied and Environmental
Cascón, A., J. Fregeneda, M. Aller, et al. (2000a). "Cloning, characterization, and
insertional inactivation of a major extracellular serine protease gene with
elastolytic activity from Aeromonas hydrophila." Journal of Fish Diseases 23:
49-59.
Cascón, A., J. Yugueros, A. Temprano, et al. (2000b). "A major secreted elastase is
essential for pathogenicity of Aeromonas hydrophila." Infection and Immunity
68(6): 3233-3241.
Castro-Escarpulli, G., J. M. Figueras, M. G. Aguilera-Arreola, et al. (2003).
"Characterisation of Aeromonas spp. isolated from frozen fish intended for
human consumption in Mexico." International Journal of Food Microbiology
84: 41-49.
Cattoir, V., L. Poirel, C. Aubert, et al. (2008). "Unexpected occurrence of plasmid-
mediated quinolone resistance determinants in environmental Aeromonas spp."
Emerging Infectious Diseases 14(2): 231-237.
Chacón, M. R., G. Castro-Escarpulli, L. Soler, et al. (2002). "A DNA probe specific for
Aeromonas colonies." Diagnostic Microbiology and Infectious Disease 44:
221-225.
Chacón, M. R., L. Soler, E. A. Groisman, et al. (2004). "Type III secretion systems in
clinical Aeromonas isolates." Journal of Clinical Microbiology 42(3): 1285-
1287.
Chacón, M. R., M. J. Figueras, G. Castro-Escarpulli, et al. (2003). "Distribution of
virulence genes in clinical and environmental isolates of Aeromonas spp."
Antonie van Leeuwenhoek 84: 269-278.
Chakraborty, T., A. Schmid, S. Notermans, et al. (1990). "Aerolysin of Aeromonas
sobria: evidence for formation of ion-permeable channels and comparison with
alpha-toxin of Staphylococcus aureus." Infection and Immunity 58(7): 2127-
2132.
Chakraborty, T., B. Hubble, H. Bergbauer, et al. (1986). "Cloning, expression, and
mapping of the Aeromonas hydrophila aerolysin gene determinant in
Escherichia coli K-12." Journal of Bacteriology 167: 368-374.
-- 264 --
Chakraborty, T., B. Huhle, H. Hof, et al. (1987). "Marker exchange mutagenesis of the
aerolysin determinant in Aeromonas hydrophila demonstrates the role of
aerolysin in A. hydrophila -associated systemic infections." Infection and
Immunity 55(9): 2274-2280.
Chakraborty, T., M. A. Montenegro, S. C. Sanyal, et al. (1984). "Cloning of the
enterotoxin gene from Aeromonas hydrophila provides conclusive evidence of
production of a cytotonic enterotoxin." Infection and Immunity 46(2): 435-441.
Champsaur, H., A. Andremont, D. Mathieu, et al. (1982). "Cholera-like illness due to
Aeromonas sobria." Journal of Infectious Diseases 145(2): 248-254.
Chan, F. K. L., J. Y. L. Ching, T. K. W. Ling, et al. (2000). "Aeromonas infection in
acute suppurative cholangitis: review of 30 cases." Journal of Infection 40: 69-
73.
Chan, S. S. W. and K. C. Ng (2004). "Aeromonas spp. and infectious diarrhea, Hong
Kong." Emerging Infectious Diseases 10(8): 1506-1507.
Chang, B. J. and S. M. Bolton (1987). "Plasmids and resistance to antimicrobial agents
in Aeromonas sobria and Aeromonas hydrophila clinical isolates."
Antimicrobial Agents and Chemotherapy 31(8): 1281-1282.
Chang, C. F., T. L. Chen, T. W. Chen, et al. (2005). "Recurrent dialysis-associated
Aeromonas hydrophila peritonitis: reports of two cases and review of the
literature." Peritoneal Dialysis International 25: 496-499.
Chang, M. C., S. Y. Chang, S. L. Chen, et al. (1992). "Cloning and expression in
Escherichia coli of the gene encoding an extracellular deoxyribonuclease
(DNase) from Aeromonas hydrophila." Gene 122: 174-180.
Chang, B. J. and J. M. Janda (2005). “Chapter 59, Aeromonas”, p. 1524-1540. In S. P.
Borriello, P. R. Murray, and G. Funke (ed.), Topley & Wilson’s microbiology
and microbial infections, 10th ed., vol. 2. Hoder Arnold, London, United
Kingdom.
Chang, Y. C., J. Y. Wang, A. Selvam, et al. (2008). "Multiplex PCR detection of
enterotoxin genes in Aeromonas spp. from suspected food samples in Northern
Taiwan." Journal of Food Protection 71(10): 2094-2099.
Chao, C. M., C. C. Lai, H. G. Tang, et al. (2013). “Skin and soft tissue infections caused
by Aeromonas species.” European Journal of Clinical Microbiology and
Infectious Diseases 32(4): 543-547.
Chart, H., D. H. Shaw, E. E. Ishiguro, et al. (1984). "Structural and immunochemical
homogeneity of Aeromonas salmonicida lipopolysaccharide." Journal of
Bacteriology 158(1): 16-22.
Chauret, C., C. Volk, R. Creason, et al. (2001). "Detection of Aeromomas hydrophila in
a drinking-water distribution system: a field and pilot study." Canadian
Journal of Microbiology 47(8): 782-768.
Chen, J. P., F. Nagayama and M. C. Chang (1991). "Cloning and expression of a
chitinase gene from Aeromonas hydrophila in Escherichia coli." Applied and
Environmental Microbiology 57(8): 2426-2428.
Chen, P. L., W. C. Ko and C. J. Wu (2012). "Complexity of β-lactamases among
clinical Aeromonas isolates and its clinical implications." Journal of
Microbiology, Immunology and Infection 45(6): 398-403
Chester, F. D. (1901). "The classification of bacteria." In: The Manual of Determinative
Bacteriology p.234. The MacMillan Company, New York.
Chim, H. and C. Song (2007). "Aeromonas in critically ill patients." Burns 33: 756-759.
Chmel, H. and D. Armstrong (1976). "Acute arthritis caused by Aeromonas hydrophila:
clinical and therapeutic aspects." Arthritis and Rheumatism 19: 169-172.
-- 265 --
Cho, S., J. Park, S. J. Park, et al. (2003). "Purification and characterization of
extracellular temperature-stable serine protease from Aeromonas hydrophila."
Journal of Microbiology 41: 207-211.
Chopra, A. K., C. W. Houston, J. W. Peterson, et al. (1992a). "Cloning, expression, and
sequence analysis of a cytolytic enterotoxin gene from Aeromonas hydrophila."
Chopra, A. K., T. N. Vo and C. W. Houston (1992b). "Mechanism of action of a
cytotonic enterotoxin produced by Aeromonas hydrophila." FEMS
Chopra, A. K., R. Pham and C. W. Houston (1994). "Cloning and expression of putative
cytotonic enterotoxin-encoding genes from Aeromonas hydrophila." Gene 139:
87-91.
Chopra, A. K. and C. W. Houston (1999a). "Authors' reply." Infection and Immunity
67(1): 466-467.
Chopra, A. K. and C. W. Houston (1999b). "Enterotoxins in Aeromonas-associated
gastroenteritis." Microbes and Infection 1: 1129-1137.
Chopra, A. K., C. W. Houston, J. W. Peterson, et al. (1993). "Cloning, expression, and
sequence analysis of a cytolytic enterotoxin gene from Aeromonas hydrophila.
" Canadian Journal of Microbiology 39: 513-523.
Chopra, A. K., J. W. Peterson, X. J. Xu, et al. (1996). "Molecular and biochemical
characterization of a heat-labile cytotonic enterotoxin from Aeromonas
hydrophila." Microbial Pathogens 21: 357-377.
Chopra, A. K., X. J. Xu, R. D. Gonzalez, et al. (2000). "The cytotoxic enterotoxin of
Aeromonas hydrophila induces proinflammatory cytokine production and
activates arachidonic acid metabolism in macrophages." Infection and
Immunity 68: 2808-2818.
Chopra, A. K., J. Graf, A. J. Horneman, et al. (2009). "Virulence factor-activity
relationships (VFAR) with specific emphasis on Aeromonas species." Journal
of Water and Health 7 Suppl 1: 529-554.
Christensen, H., M. Bisgaard, W. Frederiksen, et al. (2001). "Is characterization of a
single isolate sufficient for valid publication of a new genus or species?
Proposal to modify Recommendation 30b of the Bacterilogical Code (1990
Revision)." International Journal of Systematic and Evolutionary Microbiology
51: 2221-2225.
Christie, P. J. (2001). "Type IV secretion: intercellular transfer of macromolecules by
systems ancestrally related to conjugation machines." Molecular Microbiology
40(2): 294-305.
Christie, P. J. and E. Cascales (2005). "Structural and dynamic properties of bacterial
type IV secretion systems (Review)." Molecular Membrane Biology 22(1-2):
51-61.
Chu, S., S. Cavaignac, J. Feutrier, et al. (1991). "Structure of the tetragonal surface
virulence array protein and gene of Aeromonas salmonicida." Journal of
Biological Chemistry 266(23): 15258-15265.
Chu, W. H. and C. P. Lu (2005a). "Multiplex PCR assay for the detection of pathogenic
Aeromonas hydrophila." Journal of Fish Diseases 28: 437-441.
Chu, W. H. and C. P. Lu (2005b). "Role of microfilaments and microtubules in the
invasion of EPC cells by Aeromonas hydrophila " Journal of Veterinary
Medicine B 52: 180-182.
Chu, Y. W., C. H. Wong, G. K. L. Tsang, et al. (2006). "Lack of association between
presentation of diarrhoeal symptoms and faecal isolation of Aeromonas spp.
amongst outpatients in Hong Kong." Journal of Medical Microbiology 55(3):
349-351.
-- 266 --
Chuang, H. C., Y. H. Ho, C. J. Lay, et al. (2011). "Different clinical characteristics
among Aeromonas hydrophila, Aeromonas veronii biovar sobria and
Aeromonas caviae monomicrobial bacteraemia." Journal of Korean Medicine
26(1415-1420).
Chuang, Y. C., S. F. Chiou, J. H. Su, et al. (1997). "Molecular analysis and expression
of the extracellular lipase of Aeromonas hydrophila MCC-2." Microbiology
143: 803-812.
Clark, N. M. and C. E. Chenoweth (2003). "Aeromonas infection of the hepatobiliary
system: report of 15 cases and review of the literature." Clinical Infectious
Diseases 37: 506-513.
Clark, R. B. (1992). "Antibiotic susceptibilities of the Vibrionaceae to meropenem and
other antimicrobial agents." Diagnostic Microbiology and Infectious Disease
15(5): 453-455.
Clinical and Laboratory Standards Institute (2006). "Methods for the antimicrobial
dilution and disk susceptibility testing of infrequently isolated or fastidious
bacteria." 2nd ed, M45-A2, vol. 30, no. 18. Clinical and Laboratory Standards
Institute. Wayne, PA.
Clinical and Laboratory Standards Institute (2011). "Performance standards for
antimicrobial susceptibility testing: 21st informational supplement." M100-
S21, vol. 31, no. 1. Clinical and Laboratory Standards Institute. Wayne, PA.
Coenye, T. and J. J. LiPuma (2002). "Use of the gyrB gene for the identification of
Pandoraea species." FEMS Microbiology Letters 208: 15-19.
Cohen, K. L., P. R. Holyk, L. R. McCarthy, et al. (1983). "Aeromonas hydrophila and
Plesiomonas shigelloides endophthalmitis." American Journal of
Ophthalmology 96: 403-404.
Colaco, C. B. (1982). "Aeromonas hydrophila liver abscess." The Lancet 1(8273): 680.
Collado, L., I. Cleenwerck, S. Van Trappen, et al. (2009). "Arcobacter mytili sp. nov.,
an indoxyl acetate hydrolysis negative bacterium isolated from mussels."
International Journal of Systematic and Evolutionary Microbiology 59: 1391-
1396.
Collins, M. D., A. J. Martínez-Murcia and J. Cai (1993). "Aeromonas enteropelogenes
and Aeromonas ichtiosmia are identical to Aeromonas trota and Aeromonas
veronii, respectively, as revealed by small-subunit rRNA sequence analysis."
International Journal of Systematic Bacteriology 43(4): 855-856.
Colston, S. M., M. S. Fullmer, L. Beka, et al. (2014). “Bioinformatic genome
comparisons for taxonomic and phylogenetic assignments using Aeromonas as
a test case.” mBio 5(6): 1-13.
Colwell, R. R., M. T. MacDonell and J. De Ley (1986). "Proposal to recognize the
family Aeromonadaceae fam. nov." International Journal of Systematic
Couillault, C. and J. J. Eubank (2002). "Diverse bacteria are pathogens of
Caenorhabditis elegans." Infection and Immunity 70: 4705-4707.
Cowan, S. T. and K. J. Steel (1993). "Manual for the identification of medical bacteria."
3rd ed. Cambridge University Press, London.
Cui, H., S. Hao and E. Arous (2007). "A distinct cause of necrotizing fasciitis:
Aeromonas veronii bv. sobria." Surgical Infections 8: 523-528.
Dacanay, A., L. Knickle, K. S. Solansky, et al. (2006). "Contribution of the type III
secretion system (TTSS) to virulence of Aeromonas salmonicida subsp.
salmonicida." Microbiology 152: 1847-1856.
Daily, O. P., S. W. Joseph, J. C. Coolbaugh, et al. (1981). "Association of Aeromonas
sobria with human infection." Journal of Clinical Microbiology 13(4): 769-
777.
-- 267 --
Davin-Regli, A., C. Bollet, E. Chamorey, et al. (1998). "A cluster of cases of infections
due to Aeromonas hydrophila revealed by combined RAPD and ERIC-PCR."
Journal of Medical Microbiology 47: 499-504.
Davin-Regli, A., Y. Abed, R. N. Charrel, et al. (1995). "Variations in DNA
concentrations significantly affect the reproducibility of RAPD fingerprint
patterns." Research in Microbiology 146: 561-568.
Davis II, W. A., J. G. Kane and V. F. Garagusi (1978). "Human Aeromonas infections:
a review of the literature and a case report of endocarditis " Medicine Baltimore
57(3): 267-277.
Davies, J. and D. Davies (2010). "Origins and evolution of antibiotic resistance."
Microbiology and Molecular Biology Reviews 74(3): 417-433.
de la Morena, M., R. Van, K. Singh, et al. (1993). "Diarrhea associated with Aeromonas
species in children in day care centers." Journal of Infectious Diseases 168:
215-218.
Dean, H. M. and R. M. Post (1967). "Fatal infection with Aeromonas hydrophila in a
patient with acute myelogenous leukaemia." Annals of Internal Medicine 66:
1177-1179.
Defoirdt, T., P. Bossier, P. Sorgeloos, et al. (2005). "The impact of mutations in the
quorum sensing systems of Aeromonas hydrophila, Vibrio anguillarum and
Vibrio harveyi on their virulence towards gnotobiotically cultured Artemia
franciscana." Environmental Microbiology 7(8): 1239-1247.
Delamare, A. P. L., S. O. P. Costa, M. M. Da Silveira, et al. (2000). "Growth of
Aeromonas species on increasing concentrations of sodium chloride." Letters in
Applied Microbiology 30: 57-60.
Demarta, A., M. Tonolla, A. P. Caminada, et al. (1999). "Signature region within the
16S rDNA sequences of Aeromonas popoffii." FEMS Microbiology Letters
172: 239-246.
Demarta, A., G. Huys, M. Tonolla, et al. (2004). "Polyphasic taxonomic study of
"Aeromonas eucrenophila-like" isolates from clinical and environmental
sources." Systematic and Applied Microbiology 27: 343-349.
Demarta, D., M. Küpfer, P. Riegel, et al. (2008). "Aeromonas tecta sp. nov., isolated
from clinical and environmental sources." Systematic and Applied
Deodhar, L. P., K. Saraswathi and A. Varudkar (1991). "Aeromonas spp. and their
association with human diarrheal disease." Journal of Clinical Microbiology
29(5): 853-856.
DePauw, B. E. and P. E. Verweij, Ed. (2005). "Infections in patients with haematologic
malignancies." In: Principles and Practice of Infectious Diseases. G. L. Mandel,
J. E. Bennet and R. Dolin eds. 6th Ed. Philadelphia, PA. 3432-3441.
Desmond, E. and J. M. Janda (1986). "Growth of Aeromonas species in enteric agar."
Di Pietro, A., G. Picerno, C. Chirico, et al. (2005). "Aeromonas hydrophila exotoxin
induces cytoplasmic vacuolation and cell death in VERO cells." The New
Microbiologica 28: 251-259.
Dickson, W. A., P. Boothman and K. Have (1984). "An unusual source of hospital
wound infection." British Medical Journal 289: 1727-1728.
Ding, Z., K. Atmakuri, P. J. Christie (2003). "The outs and ins of bacterial type IV
secretion substrates." Trends in Microbiology 11(11): 527-535.
Dodd, H. N. and J. M. Pemberton (1996). "Cloning, sequencing, and characterization of
the nucH gene encoding an extracellular nuclease from Aeromonas hydrophila
JMP636." Journal of Bacteriology 178(13): 3926-3933.
-- 268 --
Dodd, H. N. and J. M. Pemberton (1999). "The gene encoding a periplasmic
deaoxyribonuclease from Aeromonas hydrophila." FEMS Microbiology Letters
173: 41-46.
Dooley, J. S. G. and T. J. Trust (1988). "Surface protein composition of Aeromonas
hydrophila strains virulent for fish: identification of a surface array protein."
Journal of Bacteriology 170(2): 499-506.
Dooley, J. S. G., H. Engelhardt, W. Baumeister, et al. (1989). "Three dimensional
structure of the surface layer from the fish pathogen Aeromonas salmonicida."
Journal of Bacteriology 171: 190-197.
Dooley, J. S. G., R. Lallier, D. H. Shaw, et al. (1985). "Electrophoretic and
immunochemical analyses of the lipopolysaccharides from various strains of
Donohue, M. J., A. W. Smallgood, S. Pfaller, et al. (2006). "The development of a
matrix-assisted laser desorption/ionization mass spectrometry-based method
for the protein fingerprinting and identification of Aermonas species using
whole cells." Journal of Microbiology Methods 65: 380-389.
Donohue, M. J., J. M. Best, A. W. Smallgood, et al. (2007). "Differentiation of
Aeromonas isolated from drinking water distribution systems using matix-
assited laser desorption/ionization-mass spectrometry." Annals of Chemistry
79: 1939-1946.
Dorsch, M., N. J. Ashbolt, P. T. Cox, et al. (1994). "Rapid identification of Aeromonas
species using 16S rDNA targeted oligonucleotide primers: a molecular
approach based on screening of environmental isolates." Journal of Applied
Bacteriology 77: 722-726.
Du, F. and J. E. Galan (2009). "Selective inhibition of type III secretion activated
signalling by the Salmonella effector AvrA." PloS Pathogens 5(9): 1-12.
East, A. K. and M. D. Collins (1993). "Molecular characterization of DNA encoding
23S rRNA and 16S-23S rRNA intergenic spacer regions of Aeromonas
hydrophila." FEMS Microbiology Letters 106: 129-134.
Edberg, S. C., F. A. Browne and M. Allen (2007). "Issues for microbial regulation:
Aeromonas as a model." Critical Reviews in Microbiology 33: 89-100.
Edwards, P. R. and W. H. Ewing (1972). "Identification of Enterobacteriaceae." 3rd
Ed. Burgess Publishing Company, Minneapolis, MN USA.
Eggset, G., R. Bjornsdottir, R. Mcqueen Leifson, et al. (1994). "Extracellular
glycerophospholipid:cholesterol acyltransferase from Aeromonas salmonicida:
activation by serine protease." Journal of Fish Diseases 17: 17-29.
Egorov, A. I., J. M. Birkenhauer, C. P. Frebis, et al. (2011). "Occurrence of Aeromonas
spp. in a random sample of drinking water distribution systems in the USA."
Journal of Water and Health 09.4: 785-796.
Elcuaz, R., J. del Pino, A. Fernandez, et al. (1995). "Peritonitis caused by Aeromonas
caviae in a patient undergoing peritoneal dialysis." Clinical Microbiology
Newsletters 17: 5-6.
Eley, A., I. Geary and M. H. Wilcox (1993). "Growth of Aeromonas spp. at 4 degree C
and related toxin production " Letters in Applied Microbiology 16: 36-39.
Elhariry, H. M. (2011). “Biofilm formation by Aeromonas hydrophila on green-leafy
vegetables: cabbage and lettuce.”Foodborne Pathogens and Disease 8(1): 125-
131.
Ender, P. T. and M. J. Dolan (1997). "Pneumonia associated with near-drowning "
Clinical Infectious Diseases 25: 896-907.
Epple, H. J., J. Mankertz, R. Ignatius, et al. (2004). "Aeromonas hydrophila beta-
haemolysis induces active chloride secretion in colon epithelial cells (HT-
29/B6)." Infection and Immunity 72: 4848-4858.
-- 269 --
Erova, T. E., J. Sha, A. J. Horneman, et al. (2007). "Identification of a new hemolysin
from diarrheal isolate SSU of Aeromonas hydrophila." FEMS Microbiology
Letters 275: 301-311.
Erova, T. E., L. Pillai, A. A. Fadl, et al. (2006). "DNA adenine methyltransferase
influences the virulence of Aeromonas hydrophila." Infection and Immunity
74(1): 410-424.
Esteve, C., M. C. Gutierrez and A. Ventosa (1995a). "Aeromonas encheleia sp. nov.,
isolated from european eels." International Journal of Systematic Bacteriology
45(3): 462-466.
Esteve, C., M. C. Gutierrez and A. Ventosa (1995b). "DNA relatedness among
Aeromonas allosaccharophila strains and DNA hybridization groups of the
genus Aeromonas." International Journal of Systematic Bacteriology 45(2):
390-391.
Esteve, C. and T. H. Birkbeck (2004). "Secretion of haemolysins and proteases by
Aeromonas hydrophila EO63: separation and characterization of the serine
protease (caseinase) and the metalloprotease (elastase)." Journal of Applied
Esteve, C., E. Alcaide, R. Canals, et al. (2004). "Pathogenic Aeromonas hydrophila
serogroup O:14 and O:81 strains with an S layer." Applied and Environmental
Microbiology 70(10): 5898-5904.
Esteve, C., L. Valera, C. Gutierrez, et al. (2003). "Taxonomic study of sucrose-positive
Aeromonas jandaei-like isolates from faeces, water and eels: emendation of A.
jandaei Carnahan et al. 1992." International Journal of Systematic and
Esteve, C., E. Alcaide and M. D. Blasco (2012). "Aeromonas hydrophila ssp. dhakensis
isolated from faeces, water and fish in mediterranean Spain." Microbes and
Environments 27(4): 367-273.
Evans, A. S. (1976). "Causation and disease: the Henle-Koch postulates revisited." Yale
Journal of Biology and Medicine 49: 175-195.
Facklam, R. R., L. G. Thacker, B. Fox, et al. (1982). "Presumptive identification of
streptococci with a new test system." Journal of Clinical Microbiology 15(6):
987-990.
Fadl, A. A., C. L. Galindo, J. Sha, et al. (2006). "Deletion of the genes encoding the
type III secretion system and cytotoxic enterotoxin alters host responses to
Aeromonas hydrophila infection." Microbial Pathogens 40: 198-210.
Fakruddin, M., K. S. Bin Mannan and S. Andrews (2013). “Viable but Nonculturable
Bacteria: Food Safety and Public Health Perspective.” International Scholarly
Research Notices Microbiology Vol. 2013; Article ID 703813
doi.org/10.1155/2013/703813.
Falkow, S. (2004). "Molecular Koch's postulates applied to bacterial pathogenicity - a
personal recollection 15 years later." Nature Reviews Microbiology 2: 1-6.
Fang, H. M., R. Ge and Y. M. Sin (2004). "Cloning, characterisation and expression of
Aeromonas hydrophila major adhesin." Fish and Shellfish Immunology 16:
645-658.
Fang, J. S., J. B. Chen, W. J. Chen, et al. (1999). "Haemolytic-uraemic syndrome in an
adult male with Aeromonas hydrophila enterocolitis " Nephrology Dialysis
Transplantion 14: 439-440.
Fanning, G. R., F. W. Hickman-Brenner, J. J. Farmer III, et al. (1985). "DNA
relatedness and phenotypic analysis of the genus Aeromonas." Abstracts of the
Annual Meeting of the American Society for Microbiology, Abstr. C 116, p.
319.
-- 270 --
Farias Millezi, A., M. Cardoso, E. Alves, et al. (2013). “Reduction of Aeromonas
hydrophila biofilm on stainless still surface by essential oils.” Brazilian
Journal of Microbiology 44(1) doi.org/10.1590/S1517-8382201300500001.
Fehr, D., C. Casanova, A. Liverman, et al. (2006). "AopP, a type III effector protein of
Aeromonas salmonicida, inhibits the NF-kB signalling pathway." Microbiology
152: 2809-2818.
Fenollar, F., P. E. Fournier and R. Legre (1999). "Unusual case of A. sobria cellulitis
associated with the use of leeches." European Journal of Clinical
Microbiology and Infectious Diseases 18: 72-73.
Ferguson, M. R., X. J. Xu, C. W. Houston, et al. (1997). "Hyperproduction, purification,
and mechanism of action of the cytotoxic enterotoxin produced by Aeromonas
hydrophila." Infection and Immunity 65(10): 4299-4308.
Figueira, V., I. Vaz-Moreira, M. Silva, et al. (2011). "Diversity and antibiotic resistance
of Aeromonas spp. in drinking and waste water treatment plants." Water
Research 45: 5599-5611.
Figueras, M. J. (2005). "Clinical relevance of Aeromonas sM503." Reviews in Medical
Figueras, M. J., A. Alperi, M. J., Saavedra, et al. (2009). "Clinical relevance of the
recently described species Aeromonas aquariorum." Journal of Clinical
Microbiology 47(11): 3742-3746.
Figueras, M. J., A. Suarez-Franquet, M. R. Chacón, et al. (2005). "First record of the
rare species Aeromonas culicicola from a drinking water supply." Applied and
Figueras, M. J., L. Soler, M. R. Chacón, et al. (2000b). "Extended method for
discrimination of Aeromonas spp. by 16S rDNA RFLP analysis." International
Journal of Systematic and Evolutionary Microbiology 50: 2069-2073.
Figueras, M. J., J. Guarro and A. Martinez-Murcia (2000a). “Clinically relevant
Aeromonas species”. Clinical Infectious Diseases 30: 988-989.
Figueras, M. J., M. J. Aldea, N. Fernandez, et al. (2007a). "Aeromonas haemolytic
uremic syndrome. A case and a review of the literature." Diagnostic
Microbiology and Infectious Disease 58: 231-234.
Figueras, M. J., A. Alperi and J. Guarro (2007b). "On the identification of clinical
Aeromonas by a new restriction fragment length polymorphism of 16S rRNA
method." Letters in Applied Microbiology 45: 692-693.
Figueras, M. J., R. Beaz-Hidalgo, L. Collado, et al. (2011b). "Recommendations for a
new bacterial species description based on analysis of the unrelated genera
Aeromonas and Arcobacter. " The Bulletin of Bergey's International Society for
Microbial Systematics 2(1): 1-16.
Figueras, M. J., A. Alperi, R. Beaz-Hidalgo, et al. (2011a). "Aeromonas rivuli sp. nov.,
isolated from the upstream region of a karst water rivulet in Germany."
248.
Figueras, M. J., A. Alperi, J. Guarro, et al. (2006). "Genotyping of isolates included in
the description of a novel species should be mandatory." International Journal
of Systematic and Evolutionary Microbiology 56: 1183.
Figura, N. (1985). "A comparison of various media in the detection of Aeromonas spp.
from stool samples" Boll Ist Sieroter Milan 64: 167-169.
Figura, N., L. Marri, S. Verdiani, et al. (1986). "Prevalence, species differentiation, and
toxigenicity of Aeromonas strains in cases of childhood gastroenteritis and in
controls." Journal of Clinical Microbiology 23(3): 595-599.
-- 271 --
Figura, N. and P. Guglielmetti (1987). "Differentiation of motile and mesophilic
Aeromonas strains into species by testing for a CAMP-like factor." Journal of
Filler, G., J. H. H. Ehrich, E. Strauch, et al. (2000). "Acute renal failure in an infant
associated with cytotoxic Aeromonas sobria isolated from patient's stool and
from aquarium water as suspected source of infection." Journal of Clinical
Flandry, F., E. J. Lisecki, G. J. Domingue, et al. (1989). "Initial antibiotic therapy for
alligator bites: characterization of the oral flora of Alligator mississippiensis."
Southern Medical Journal 82: 262-266.
Fock, W. L., C. L. Chen, T. J. Lam, et al. (2001). "Roles of an endogenous serum lectin
in the immune protection of the blue gourami Trichogaster trichopterus
(Pallus) against Aeromonas hydrophila." Fish and Shellfish Immunology 11:
101-113.
Fontes, M. C., M. J. Saavedra, A. Monera, et al. (2010). "Phylogenetic identification of
Aeromonas simiae from a pig, first isolate since species description."
Veterinary Microbiology 142:313-316.
Fosse, T., C. Giraud-Morin and I. Madinier (2003a). "B-lactam-resistance phenotypes in
the genus Aeromonas." Pathologie Biologie 51: 290-296.
Fosse, T., C. Giraud-Morin and I. Madinier (2003b). "Induced colistin resistance as an
identifying marker for Aeromonas phenospecies groups." Letters in Applied
Fosse, T., C. Giraud-Morin, I. Madinier, et al. (2003c). "Sequence analysis and
biochemical characterisation of chromosomal CAV-1 (Aeromonas caviae), the
parental cephalosporinase of plasmid-mediated AmpC "FOX" cluster." FEMS
Fosse, T., I. Madinier, F. Mantoux, et al. (2004). "Aeromonas hydrophila with plasmid-
borne class A extended-spectrum Beta-lactamase TEM-24 and three
chromosomal class B,C, and D Beta-lactamases, isolated from a patient with
necrotizing fasciitis." Antimicrobial Agents and Chemotherapy 48(6): 2342-
2343.
Fox, G. E., J. D. Wisotzkey and P. Jurtshuk Jr. (1992). "How close is close: 16S rRNA
sequence identity may not be sufficient to guarantee species identity."
International Journal of Systematic Bacteriology 42: 166-170.
Francki, K. T. and B. J. Chang (1994). "Variable expression of O-antigen and the role of
lipopolysaccharide as an adhesin in Aeromonas sobria." FEMS Microbiology
Letters 122: 97-102.
Freij, B. J. (1984). "Aeromonas: biology of the organism and diseases in children."
Pediatric Infectious Disease 3(2): 164-174.
Freij, B. J. (1985). "The spectrum of Aeromonas infections." Clinical Reviews in
Pediatric Infectious Diseases 143-155.
Fricke, W. F., T. J. Welch, P. F. McDermott, et al. (2009). “Comparative genomics of
the IncA/C multidrug resistance plasmid family.” Journal of Bacteriology
191(15): 4750-4757.
Froquet, R., N. Cherix, S. E. Burr, et al. (2007). "Alternative host model to evaluate
Aeromonas virulence." Applied and Environmental Microbiology 73(17):
5657-5659.
Fyfe, L., G. Coleman and A. L. S. Munro (1988). "The combined effect of isolated
Aeromonas salmonicida protease and haemolysin on Atlantic salmon, Salmo
salar L., compared with that of a total extracellular products preparation."
Journal of Fish Diseases 11: 101-104.
-- 272 --
Galindo, C. L., A. A. Fadl, J. Sha, et al. (2005). "Microarray and proteomics analyses of
human intestinal epithelial cells treated with the Aeromonas hydrophila
cytotoxic enterotoxin." Infection and Immunity 73(5): 2628-2643.
Galindo, C. L., A. A. Fadl, J. Sha, et al. (2004). "Aeromonas hydrophila cytotoxic
enterotoxin activates mitogen-activated protein kinases and induces apoptosis
in murine macrophages and human intestinal epithelial cells." Journal of
Biological Chemistry 279(36): 37597-37612.
Galindo, C. L., J. Sha, A. A. Fadl, et al. (2006). "Host immune responses to Aeromonas
virulence factors." Current Immunological Reviews 2: 13-26.
Galindo, C. L., J. Sha, D. A. Ribardo, et al. (2003). "Identification of Aeromonas
hydrophila cytotoxic enterotoxin-induced genes in macrophages using
microaarrays." Journal of Biological Chemistry 278(41): 40198-40212.
Gascón, J. (2006). "Epidemiology, etiology and pathophysiology of traveler's diarrhea."
Digestion 73((suppl 1)): 102-108.
Gascón, J., L. Ruiz, J. Canela, et al. (1993). "Epidemiologia de la diarrea del viajero
turistas españoles a paises en desarrollo." Medicina Clinica 100: 365-367.
Gavin, R., A. A. Rabaan, S. Merino, et al. (2002). "Lateral flagella of Aeromonas
species are essential for epithelial cell adherence and biofilm formation."
Molecular Microbiology 43(2): 383-397.
Gavin, R., S. Merino, M. Altarriba, et al. (2003). "Lateral flagella are required for
increased cell adherence, invasion and biofilm formation by Aeromonas spp."
FEMS Microbiology Letters 224: 77-83.
George, W. L., M. J. Jones and M. M. Nakata (1986). "Phenotypic characteristics of
Aeromonas species isolated from adult humans." Journal of Clinical
Ghatak, S., R. K. Agarwal and K. N. Bhilegaonkar (2006). "Comparative study of
cytotoxicity of Aeromonas spp. on four different cell lines." Comparative
Immunology and Microbiological Infectious Diseases 29: 232-240.
Ghatak, S., R. K. Agarwal and K. N. Bhilegaonkar (2007a). "Species identification of
clinically important Aeromonas spp. by restriction fragment length
polymorphism of 16S rDNA." Letters in Applied Microbiology 44: 550-554.
Ghatak, S., R. K. Agarwal and K. N. Bhilegaonkar (2007b). " Reply." Letters in Applied
Microbiology 45: 694.
Girlich, D., L. Poirel and P. Nordmann (2010). "PER-6, an extended-spectrum B-
lactamase from Aeromonas allosaccharophila." Antimicrobial Agents and
Chemotherapy 54: 1619-1622.
Gobat, P. F. and T. Jemmi (1993). "Distribution of mesophilic Aeromonas species in
raw and ready-to-eat fish and meat products in Switzerland." International
Journal of Food Microbiology 20: 117-120.
Gold, W. L. and I. E. Salit (1993). "Aeromonas hydrophila infections of skin and soft
tissue: report of 11 cases and review." Clinical Infectious Diseases 16: 69-74.
Gonçalves, J. R., G. Brum, A. Fernandes, et al. (1992). "Aeromonas hydrophila
fulminant pneumonia in a fit young man." Thorax 47: 482.
Goñi-Urriza, M., C. Arpin, M. Capdepuy, et al. (2002). "Type II topoisomerase
quinolone resistance-determining regions of Aeromonas caviae, A. hydrophila,
and A. sobria complexes and mutations associated with quinolone resistance."
Goñi-Urriza, M., L. Pineau, M. Capdepuy, et al. (2000). "Antimicrobial resistance of
mesophilic Aeromonas spp. isolated from two European rivers." Journal of
Antimicrobial Chemotherapy 46: 297-301.
-- 273 --
González-Barca, E., C. Ardanuy, J. Carratala, et al. (1997). "Fatal myofascial necrosis
due to imipenem-resistant Aeromonas hydrohila." Scandinavian Journal of
González-Serrano, C. J., J. A. Santos, M. L. García-López, et al. (2002). "Virulence
markers in Aeromonas hydrophila and Aeromonas veronii biovar sobria
isolates from freshwater fish and from a diarrhoea case." Journal of Applied
Microbiology 93: 414–419.
Goodwin, C. S., W. E. S. Harper, J. K. Stewart, et al. (1983). "Enterotoxigenic
Aeromonas hydrophila and diarrhea in adults " Medical Journal of Australia 1:
25-26.
Gosling, P. J. (1986). "Biochemical characteristics, enterotoxigenicity and susceptibility
to antimicrobial agents of clinical isolates of Aeromonas species encountered in
the western region of Saudi Arabia." Journal of Medical Microbiology 22: 51-
55.
Gracey, M., V. Burke and J. Robinson (1982b). "Aeromonas-associated gastroenteritis."
The Lancet ii(8311): 1304-1306.
Gracey, M., V. Burke, J. Robinson, et al. (1984). "Aeromonas spp. in travellers'
diarrhoea." British Medical Journal 289: 658.
Gracey, M., V. Burke, R. C. Rockhill, et al. (1982a). "Aeromonas species as enteric
pathogens." The Lancet 1(8265): 223-224.
Graf, J. (1999a). "Diverse restriction fragment length polymorphism patterns of the
PCR-amplified 16S rRNA genes in Aeromonas veronii strains and possible
misidentification of Aeromonas species." Journal of Clinical Microbiology
37(10): 3194-3197.
Graf, J. (1999b). "Symbiosis of Aeromonas veronii biovar sobria and Hirudo
medicinalis, the medicinal leech: a novel model for digestive tract
associations." Infection and Immunity 67(1): 1-7.
Graf, J. (2000). "Symbiosis of Aeromonas and Hirudo medicinalis, the medicinal leech
" ASM News 66: 147-153.
Granum, P. E., K. O'Sullivan, J. M. Tomas, et al. (1998). "Possible virulence factors of
Aeromonas spp. from food and water." FEMS Immunology and Medical
Gray, S. J., D. J. Stickler and T. N. Bryant (1990). "The incidence of virulence factors in
mesophilic Aeromonas species isolated from farm animals and their
environment." Epidemiology and Infection 105: 277-294.
Grim, C. J., E. V. Kozlova, J. Sha, et al. (2013). "Characterization of Aeromonas
hydrophila wound pathotypes by comparative genomic and functional analyses
of virulence genes." Molecular Biology 4(2): e00064-13.
Gryllos, I., J. G. Shaw, R. Gavin, et al. (2001). "Role of flm locus in mesophilic
Aeromonas species adherence." Infection and Immunity 69(1): 65-74.
Gudmunsdottir, B. K., I. Hvanndal, B. Bjornsdottir, et al. (2003). "Analysis of
exotoxins produced by atypical isolates of A. salmonicida, by enzymatic and
serological methods." Journal of Fish Diseases 26: 15-29.
Guerra, I. M. F., R. Fadanelli, M. Figueiró, et al. (2007). "Aeromonas associated
diarrhoeal disease in south Brazil: prevalence, virulence factors and
antimicrobial resistance." Brazilian Journal of Microbiology 38: 638-643.
Gustafson, C. E., C. J. Thomas and T. J. Trust (1992). "Detection of Aeromonas
salmonicida from fish by using polymerase chain reaction amplification of the
virulence surface array protein gene." Applied and Environmental
Microbiology 58(12): 3816-3825.
Hadi, N., Q. Yang, T. C. Barnett, et al. (2012). "Bundle-forming pilus locus of A.
veronii bv. sobria." Infection and Immunity 80(4): 1351-1360.
-- 274 --
Han, H. J., T. Taki, H. Kondo, et al. (2008). "Pathogenic potential of a collagenase gene
from Aeromonas veronii." Canadian Journal of Microbiology 54: 1-10.
Hänninen, M. L. (1994). "Phenotypic characteristics of the three hybridization groups of
Aeromonas hydrophila complex isolated from different sources." Journal of
Applied Bacteriology 76: 455-462.
Hänninen, M. L. and A. Siitonen (1995). "Distribution of Aeromonas hydrophila
phenospecies and genospecies among strains isolated from water, foods or
from human clinical samples." Epidemiology and Infection 115: 39-50.
Hänninen, M. L. and V. Hirvela-Koski (1997). "Pulse-field gel electrophoresis in the
study of mesophilic and psychrophilic Aeromonas spp." Journal of Applied
Hänninen, M. L., J. Ridell and V. Hirvela-Koski (1995b). "Phenotypic and molecular
characteristics of Aeromonas salmonicida subsp. salmonicida isolated in
southern and northern Finland." Journal of Applied Bacteriology 79: 12-21.
Hänninen, M. L., S. Salmi and A. Siitonen (1995c). "Maximum growth temperature
ranges of Aeromonas spp. isolated from clinical and environmental sources."
Microbial Ecology 29: 259-267.
Hänninen, M. L., S. Salmi, L. Mattila, et al. (1995a). "Association of Aeromonas spp.
with traveller's diarrhoea in Finland." Journal of Medical Microbiology 42: 26-
31.
Haque, Q. M., A. Sugiyama, Y. Iwade, et al. (1996). "Diarrhoeal and environmental
isolates of Aeromonas spp. produce a toxin similar to Shiga-like toxin I."
Current Microbiology 32: 239-245.
Hatje, E., H. E. Neuman and and M. Katouli (2011). "Pathogenesis of Aeromonas
strains and the impact of probiotics using a human gut epithelium cell line."
Australian Society for Microbiology Annual General Meeting. Hobart,
Tasmania. Abstract 121: 132.
Harf-Monteil, C., A. Le Fleche, P. Riegel, et al. (2004). "Aeromonas simiae sp. nov.,
isolated from monkey faeces." International Journal of Systematic and
Harikhrishnan, R., C. Balasundaram and M. Heo (2010a). "Effects of probiotics
enriched diet on Paralychthis olivaceus infected with lymphocystis disease
virus (LCDV). " Fish and Shellfish Immunology 29: 868-874.
Harikrishnan, R., M. C. Kim, J. S. Kim, et al. (2010b). "Immune response and
expression analysis of cathepsin K in goldfish during Aeromonas hydrophila
infection." Fish and Shellfish Immunology 28: 511-516.
Harris, R. L., V. Fainstein, L. Elting, et al. (1985). "Bacteremia caused by Aeromonas
species in hospitalised cancer patients." Reviews of Infectious Diseases 7(3):
314-320.
Havelaar, A. H., F. M. Schets, A. van Silfhout, et al. (1992). "Typing of Aeromonas
strains from patients with diarrhoea and from drinking water." Journal of
Hayes, S. L., M. Waltmann, M. Donohue, et al. (2009). "Predicting virulence of
Aeromonas isolates based on changes in transcription of c-jun and c-fos in
human tissue culture cells." Journal of Applied Microbiology 107: 964-969.
Hazen, T. C. (1979). "Ecology of Aeromonas hydrophila in a South Carolina cooling
reservoir." Microbial Ecology 5: 179-195.
Heckerling, P. S., T. M. Stine, J. C. Pottage Jr., et al. (1983). "Aeromonas hydrophila
myonecrosis and gas gangrene in a nonimmunocompromised host." Archives of
Internal Medicine 143: 2005-2006.
Hedges, R. W., A. A. Medeiros, M. Cohenford, et al. (1985). "Genetic and biochemical
properties of AER-1, a novel carbenicillin-hydrolysing beta-lactamase from
-- 275 --
Aeromonas hydrophila." Antimicrobial Agents and Chemotherapy 27(4): 479-
484.
Heuzenroeder, M. W., C. Y. F. Wong and R. L. P. Flower (1999). "Distribution of two
haemolytic toxin genes in clinical and environmental isolates of Aeromonas
spp.: correlation with virulence in a suckling mouse model." FEMS
Hickman-Brenner, F. W., K. L. MacDonald, A. G. Steigerwalt, et al. (1987).
"Aeromonas veronii, a new ornithine decarboxylase-positive species that may
cause diarrhoea." Journal of Clinical Microbiology 25(5): 900-906.
Hickman-Brenner, F. W., G. R. Fanning, M. J. Arduino, et al. (1988). "Aeromonas
schuberti, a new mannitol-negative species found in human clinical
specimens." Journal of Clinical Microbiology 26(8): 1561-1564.
Higgins, M., J. Carson and N. Gudkovs (2007). "Development of an improved
identification matrix for Aeromonas salmonicida." World Association of
Veterinary Laboratory Diagnosticians. 13th International Symposium,
Melbourne, Australia. Concurrent Session 2.2.
Hill, K. R., F. H. Caselitz and L. M. Moody (1954)."A case of acute, metastatic,
myositis caused by a new organism of the family: Pseudomonadaceae."
Wisconsin Medical Journal 3: 9-11.
Hiraga, K., L. Shou, M. Kitazawa, et al. (1997). "Isolation and characterization of
chitinase from a flake-chitin degrading marine bacterium, Aeromonas
hydrophila H2330." Bioscience Biotechnology and Biochemistry 61: 174-176.
Hiransuthikul, N., W. Tantisiriwat, K. Lertutsahakul, et al. (2005). "Skin and soft tissue
infections among tsunami survivors in southern Thailand." Clinical Infectious
Diseases 41: e93-e96.
Hird, D. W., S. L. Diesch, R. G. McKinnell, et al. (1983). "Enterobacteriaceae and
Aeromonas hydrophila in Minnesota frogs and tadpoles (Rana pipiens)."
Applied and Environmental Microbiology 46(6): 1423-1425.
Hirono, I. and T. Aoki (1991). "Nucleotide sequence and expression of an extracellular
hemolysin gene of Aeromonas hydrophila." Microbial Pathogens 11: 189-197.
Hirono, I. and T. Aoki (1993). "Cloning and characterisation of the three haemolysin
genes of Aeromonas salmonicida." Microbial Pathogens 15: 269-282.
Hirono, I., T. Aoki, T. Asao, et al. (1992). "Nucleotide sequences and characterization
of haemolysin genes from Aeromonas hydrophila and Aeromonas sobria."
Microbial Pathogens 13: 433-446.
Ho, A. S. Y., T. A. Mietzner, A. J. Smith, et al. (1990). "The pili of Aeromonas
hydrophila: identification of an environmentlly regulated "mini pilin"." Journal
of Experimental Medicine 172: 795-806.
Hokama, A. and M. Iwanaga (1991). "Purification and characterization of Aeromonas
sobria pili, a possible colonization factor." Infection and Immunity 59(10):
3478-3483.
Hokama, A. and M. Iwanaga (1992). "Purification and characterization of Aeromonas
sobria Ae24 pili: a possible new colonization factor." Microbial Pathogens 13:
325-334.
Hokama, A., Y. Honma and N. Nakasone (1990). "Pili of an Aeromonas hydrophila
strain as a possible colonization factor." Microbiology and Immunology 34(11):
901-915.
Holmberg, S. D. and J. J. Farmer III (1984). "Aeromonas hydrophila and Plesiomonas
shigelloides as causes of intestinal infections." Review of Infectious Diseases 6:
633-639.
-- 276 --
Honda, T., M. Sato, T. Nishimura, et al. (1985). "Demonstration of cholera toxin-related
factor in cultures of Aeromonas species by Enzyme-Linked Immunosorbent
Assay." Infection and Immunity 50(1): 322-323.
Hondur, A. K., K. Bilgihan, M. Y. Clark, et al. (2008). "Microbiologic study of soft
contact lenses after laser subepithelial keratectomy for myopia." Eye Contact
Lens 34: 24-27.
Honma, Y. and N. Nakasone (1990). "Pili of Aeromonas hydrophila: purification,
characterization and biological role." Microbiology and Immunology 34(2): 83-
98.
Howard, S. P. and J. T. Buckley (1985). "Protein export by a Gram-negative bacterium:
production of aerolysin by Aeromonas hydrophila." Journal of Bacteriology
161: 1118-1124.
Howard, S. P. and J. T. Buckley (1986). "Molecular cloning and expression in
Escherichia coli of the structural gene for the haemolytic toxin aerolysin from
Aeromonas hydrophila." Molecular Genetics and Genomics 204: 289-295.
Howard, S. P., W. J. Garland, M. J. Green, et al. (1987). "Nucleotide sequence of the
gene for the hole-forming toxin aerolysin of Aeromonas hydrophila." Journal
of Bacteriology 169(6): 2869-2871.
Hsueh, P. R., L. J. Teng, N. Lee, et al. (1998). "Indwelling device-related and recurrent
infections due to Aeromonas species." Clinical Infectious Diseases 26: 651-
658.
Hua, H. T., C. Bollet, S. Tercian, et al. (2004). "Aeromonas popoffii urinary tract
infection." Journal of Clinical Microbiology 42(11): 5427-5428.
Huang, L. J., H. P. Chen, T. L. Chen, et al. (2006). "Secondary Aeromonas peritonitis is
associated with polymicrobial ascites culture and absence of liver cirrhosis
compared to primary Aeromonas peritonitis." Acta Pathologica Microbiologica
et Immunologica Scandinavica 114: 772-778.
Huddleston, J. R., J. C. Zak and R. M. Jeter (2006). "Antimicrobial susceptibilities of
Aeromonas spp. isolated from environmental sources." Applied and
Huddleston, J. R., J. C. Zak and R. M. Jeter (2007). "Sampling bias created by
ampicillin in isolation media for Aeromonas. " Canadian Journal of
Huddleston, J. R., J. M. Brokaw, J. C. Zak, et al. (2013). "Natural transformation as a
mechanism of horizontal gene transfer among environmental Aeromonas spp."
Systematic and Applied Microbiology 36(4): 224-234.
Hudson, J. A., and K. M. De Lacy (1991). "Incidence of motile aeromonads in New
Zeland retail foods." Journal of Food Protection 54(9): 696-699.
Hugo, W. B., and E. G. Beveridge (1962). "A quantitative and qualitative study of the
lipolytic activity of single strains of seven bacterial species." Journal of
Hunter, P. R. (1993). "The microbiology of bottled natural mineral waters." Journal of
Hunter, W. J. and L. D. Kuykendall (2006). "Identification and characterisation of an
Aeromonas salmonicida (syn Haemophilus piscium) strain that reduces selenite
to elemental red selenium." Current Microbiology 52: 305-309.
Husslein, V., B. Huhle, T. Jarchau, et al. (1988). "Nucleotide sequence and
transcriptional analysis of the aerCaerA region of Aeromonas sobria encoding
aerolysin and its regulatory region." Molecular Microbiology 2(4): 507-517.
Husslein, V., H. Bergbauer and T. Chakraborty (1991). "Studies on aerolysin and a
serine protease from Aeromonas trota sp. nov." Experientia 47: 420-421.
-- 277 --
Husslein, V., T. Chakraborty, A. Carnahan, et al. (1992). "Molecular studies on the
aerolysin gene of Aeromonas species and discovery of a species-specific probe
for Aeromonas trota species nova." Clinical Infectious Diseases 14: 1061-
1068.
Huys, G., M. Vancanneyt, R. Coopman, et al. (1994). "Cellular fatty acid composition
as a chemotaxonomic marker for the differentiation of phenospecies and
hybridization groups in the genus Aeromonas." International Journal of
Systematic Bacteriology 44(4): 651-658.
Huys, G. and J. Swings (1999). "Evaluation of a fluorescent amplified fragment length
polymorphism (FAFLP) methodology for the genotypic discrimination of
Aeromonas taxa." FEMS Microbiology Letters 177: 83-92.
Huys, G., I. Kersters, M. Vancanneyt, et al. (1995). "Diversity of Aeromonas sp. in
Flemish drinking water production plants as determined by gas-liquid
chromatographic analysis of cellular fatty acid methyl esters (FAMEs)."
Journal of Applied Bacteriology 78: 445-455.
Huys, G., P. Käempfer, M. JohnAlbert, et al. (2002a). "Aeromonas hydrophila subsp.
dhakensis subsp. nov., isolated from children with diarrhoea in Bangladesh,
and extended description of Aeromonas hydrophila subsp. hydrophila (Chester
1901) Stanier 1943 (approved lists 1980)." International Journal of Systematic
and Evolutionary Microbiology 52: 705-712.
Huys, G., R. Denys and J. Swings (2002b). "DNA-DNA reassociation and phenotypic
data indicate synonymy between Aeromonas enteropelogenes Schubert et al.
1990 and Aeromonas trota Carnahan et al. 1991." International Journal of
Huys, G., M. Cnockaert and J. Swings (2005). "Aeromonas culicicola Pidiyar et al.
2002 is a later subjective synonym of Aeromonas veronii Hickman-Brenner et
al. 1987." Systematic and Applied Microbiology 28: 604-609.
Huys, G., P. Käempfer and J. Swings (2001). "New DNA-DNA hybridization and
phenotypic data on the species Aeromonas ichthiosmia and Aeromonas
allosaccharophila: A. ichthiosmia Schubert et al. 1990 is a later synonym of A.
veronii Hickman-Brenner et al. 1987." Systematic and Applied Microbiology
24: 177-182.
Huys, G., M. Pearson, P. Käempfer, et al. (2003). "Aeromonas hydrophila subsp. ranae
subsp. nov., isolated from septicaemic frogs in Thailand." International
Huys, G., P. Käempfer, M. Altwegg, et al. (1997a). "Inclusion of Aeromonas DNA
hybridization group 11 in Aeromonas encheleia and extended descriptions of
the species Aeromonas eucrenophila and A. encheleia." International Journal
of Systematic Bacteriology 47(4): 1157-1164.
Huys, G., P. Käempfer, M. Altwegg, et al. (1997b). "Aeromonas popoffii sp. nov., a
mesophilic bacterium isolated from drinking water production plants and
reservoirs." International Journal of Systematic Bacteriology 47(4): 1165-
1171.
Huys, G., M. Altwegg, M. L. Hänninen, et al. (1996a). "Genotypic and
chemotaxonomic description of two subgroups in the species Aeromonas
eucrenophila and their affiliation to A. encheleia and Aeromonas DA
hybridization group 11." Systematic and Applied Microbiology 19: 616-623.
Huys, G., R. Coopman, P. Janssen, et al. (1996b). "High-resolution genotypic analysis
of the genus Aeromonas by AFLP fingerprinting." International Journal of
Systematic Bacteriology 46(2): 572-580.
-- 278 --
Iaconis, J. P. and C. C. Sanders (1990). "Purification and characterization on inducible
B-lactamses in Aeromonas spp."Antimicrobial Agents and Chemotherapy
34(1): 44-51.
Igbinosa, I. H., E. O. Igbinosa and A.I. Okoh (2014). “Virulence gene markers and
biofilm formation of Aeromonas species recovered from cow faeces.”Journal
of Clinical and Cell Immunology 5(5) 184.
Ilori, M. O., C. J. Amobi and A. C. Odocha (2005). "Factors affecting biosurfactant
production by oil degrading Aeromonas spp. isolated from a tropical
environment."Chemosphere 61: 985-992.
Imamura, T., H. Kobayashi, R. Khan, et al. (2006). "Induction of vascular leakage and
blood pressure lowering through kinin release by a serine protease from
Aeromonas sobria." Journal of Immunology 177: 8723-8729.
Ingham, A. B. and J. M. Pemberton (1995). "A lipase of Aeromonas hydrophila
showing nonhaemolytic phospholipase C activity." Current Microbiology 31:
28-33.
In-Young, N. and K. Joh (2007). “Rapid detection of virulence factors of Aeromonas
isolated from a trout farm by hexaplex-PCR.” Journal of Microbiology 45(4):
297-304.
Isenberg, H. D. (1992)."Clinical Microbiology Procedures Handbook." American
Society for Microbiology 2: 16-17. Massachusetts Av. N. W. Washington DC.
Ishiguro, E. E., W. W. Kay, T. Ainsworth, et al. (1981). "Loss of virulence during
culture of Aeromonas salmonicida at high temperature." Journal of
Isonhood, J. H. and M. Drake (2002). "Aeromonas species in foods." Journal of Food
Protection 65(3): 575-582.
Ivanova, E. P., N. V. Zhukova, N. M. Gorskova, et al. (2001). "Characterization of
Aeromonas and Vibrio isolated from a drinking water reservoir." Journal of
Iwanaga, M. and A. Hokama (1992). "Characterization of Aeromonas sobria TAP13
pili: a possible new colonization factor." Journal of General Microbiology 138:
1913-1919.
Jagadish Kumar, K. and G. S. Vijaya Kumar (2013). “Cholera-like illness due to
Aeromonas caviae.” Indian Pediatrics 50(10): 969-970.
James, C., M. Dibley, V. Burke, et al. (1982). "Immunological cross-reactivity of
enterotoxins of Aeromonas hydrophila and cholera toxin." Clinical and
Experimental Immunology 47: 34-42.
Janda, J. M. (1985). "Biochemical and exoenzymatic properties of Aeromonas species."
Diagnostic Microbiology and Infectious Disease 3: 223-232.
Janda, J. M., R. B. Clark and R. Brenden (1985). "Virulence of Aeromonas species as
assessed through mouse lethality studies." Current Microbiology 12: 163-168.
Janda, J. M. and M. R. Motyl (1985). "Cephalothin susceptibility as a potential marker
for the Aeromonas sobria group." Journal of Clinical Microbiology 22(5): 854-
855.
Janda, J. M. and P. S. Duffey (1988). "Mesophilic aeromonads in human disease:
current taxonomy, laboratory identification and infectious disease spectrum."
Review of Infectious Diseases 10(5): 980-997.
Janda, J. M. and R. Brenden (1987). "Importance of Aeromonas sobria in Aeromonas
bacteremia." Journal of Infectious Diseases 155(3): 589-591.
Janda, J. M. and R. P. Kokka (1991). "The pathogenicity of Aeromonas strains relative
to genospecies and phenospecies identification." FEMS Microbiology Letters
90: 29-34.
-- 279 --
Janda, J. M. and S. L. Abbott (2007). "16S rRNA gene sequencing for bacterial
identification in the diagnostic laboratory: pluses, perils, and pitfalls." Journal
of Clinical Microbiology 45: 2761-2764.
Janda, J. M. and S. L. Abbott (2010). "The genus Aeromonas: taxonomy, pathogenicity,
and infection " Clinical Microbiology Reviews 23(1): 35-73.
Janda, J. M. and S. L. Abbott (1999). "Unusual food-borne pathogens." Food-Borne
Diseases 19: 553-582.
Janda, J. M. and S. L. Abbott (1998). "Evolving concepts regarding the genus
Aeromonas: an expanding panorama of species, disease presentations, and
unanswered questions." Clinical Infectious Diseases 27: 332-344.
Janda, J. M., E. J. Bottone and M. Reitano (1983). "Aeromonas species in clinical
microbiology:significance, epidemiology, and speciation." Diagnostic
Microbiology and Infectious Disease 1: 221-228.
Janda, J. M., L. S. Oshiro, S. L. Abbott, et al. (1987). "Virulence markers of mesophilic
aeromonads: association of the autoagglutination phenomenon with mouse
pathogenicity and the presence of a peripheral cell-associated layer." Infection
and Immunity 55(12): 3070-3077.
Janda, J. M., M. Reitano, and E. J. Bottone (1984). "Biotyping of Aeromonas isolates as
a correlate to delineating a species-associated disease spectrum." Journal of
Janda, J. M. and S. L. Abbott (2002). “Bacterial identification for publication: when is
enough enough?.” Journal of Clinical Microbiology 40(6): 1887-1891.
Jangid, K., R. Kong, M. Patole, et al. (2007). "luxRI homologs are universally present
in the genus Aeromonas " BioMed Central Microbiology 7:93.
Janssen, P., R. Coopman, G. Huys, et al. (1996). "Evaluation of the DNA fingerprinting
method AFLP as a new tool in bacterial taxonomy." Microbiology 142: 1881-
1893.
Jeanteur, D., N. Gletsu, F. Pattus, et al. (1992). "Purification of Aeromonas hydrophila
major outer-membrane proteins: N-terminal sequence analysis and channel-
forming properties." Molecular Microbiology 6(22): 3355-3363.
Jiang, B. and S. P. Howard (1992). "The Aeromonas hydrophila exeE gene, required
both for protein secretion and normal outer membrane biogenesis, is a member
of a general secretion pathway." Molecular Microbiology 6(10): 1351-1361.
Jones, B. L. and M. H. Wilcox (1995). "Aeromonas infections and their treatment."
Journal of Antimicrobial Chemotherapy 35: 453-461.
Jorge, M. T., S. de A. Nishioka, R. B. de Oliveira, et al. (1998). "Aeromonas hydrophila
soft tissue infection as a complication of snake bite: report of three cases."
Annals of Tropical Medicine and Parasitology 92(2): 213-217.
Jorgensen, J. H. and J. F. Hindler (2007). "New consensus guidelines from the Clinical
and Laboratory Standards Institute for antimicrobial susceptibility testing of
infrequently isolated or fastidious bacteria." Clinical Infectious Diseases 44:
280-286.
Joseph, S. W., A. M. Carnahan, P. R. Brayton, et al. (1991). "Aeromonas jandaei and
Aeromonas veronii dual infection of a human wound following aquatic
exposure." Journal of Clinical Microbiology 29(3): 565-569.
Joseph, S. W. and A. Carnahan (1994). "The isolation, identification, and systematics of
the motile Aeromonas species." Annual Review of Fish Diseases 4: 315-343.
Joseph, S. W., O. P. Daily, W. S. Hunt, et al. (1979). "Aeromonas primary wound
infection of a diver in polluted waters." Journal of Clinical Microbiology
10(1): 46-49.
Käempfer, P. and M. Altwegg (1992). "Numerical classification and identification of
Aeromonas genospecies." Journal of Applied Bacteriology 72: 341-351.
-- 280 --
Käempfer, P., K. Blasczyk and G. Auling (1994). "Characterization of Aeromonas
genomic species by using quinone, polyamine and fatty acid patterns."
Käempfer, P. and S. P. Glaeser (2012). "Prokaryotic taxonomy in the sequencing era-the
polyphasic approach revisited." Environmental Microbiology 14: 291-317.
Kanamaru, S., P. G. Leiman, V. A. Kostyuchenko, et al. (2002). "Structure of the cell-
puncturing device of bacteriophage T4." Nature 415: 553-557.
Kao, H. T., Y. C. Huang and T. Y. lien (2003). "Fatal bacteraemic pneumonia caused by
Aeromonas hydrophila in a previously healthy child." Journal of Microbiology,
Immunology and Infection 36: 209-211.
Kaper, J. B., H. Lockman and R. R. Colwell (1981). "Aeromonas hydrophila: ecology
and toxigenicity of isolates from an estuary." Journal of Applied Bacteriology
50: 359-377.
Karam, G. H., A. M. Ackley and W. E. Dismukes (1983). "Posttraumatic Aeromonas
hydrophila osteomyelitis." Archives of Internal Medicine 143: 2073-2074.
Karem, K. L., J. W. Foster and A. K. Bej (1994). "Adaptive acid tolerance response
(ATR) in Aeromonas hydrophila. " Microbiology 140: 1731-1736.
Kasai, H., K. Watanabe, E. Gasteiger, et al. (1998). "Construction of the gyrB database
for the identification and classification of bacteria." Genome Informatics 9: 13-
21.
Kay, W. W. and T. J. Trust (1991). "Form and function of the regular surface array (S-
layer) of Aeromonas salmonicida." Experientia 47: 412-414.
Kay, W. W., B. M. Phipps, E. E. Ishiguro, et al. (1985). "Porphyrin binding by the
surface array virulence protein of Aeromonas salmonicida." Journal of
Bacteriology 164(3): 1332-1336.
Kay, W. W., J. T. Buckley, E. E. Ishiguro, et al. (1981). "Purification and disposition of
a surface protein associated with virulence of A. salmonicida." Journal of
Kaznowski, A., K. Wlodarczak and H. Paetz (1989). "A numerical taxonomy of
Vibrionaceae isolated from water, sewage, water-oil emulsion and fishes."
Kaznowski, A. and E. Konecka (2005). "Identification of Aeromonas culicicola by 16S
rDNA RFLP." Polish Journal of Microbiology 54(4): 335-338.
Kelly, K. A., J. M. Koehler and L. R. Ashdown (1993). "Spectrum of extraintestinal
disease due to Aeromonas species in tropical Queensland, Australia." Clinical
Kersters, I., G. Huys, H. Van Duffel, et al. (1996). "Survival potential of Aeromonas
hydrophila in freshwaters and nutrient-poor waters in comparison with other
bacteria." Journal of Applied Bacteriology 80: 266-276.
Ketover, B. P., L. S. Young and D. Armstrong (1973). "Septicaemia due to Aeromonas
hydrophila: clinical and immunologic aspects." Journal of Infectious Diseases
127(3): 284-290.
Khajanchi, B. K., J. Sha, E. V. Kozlova, et al. (2009). "N-Acylhomoserine lactones
involved in quorum sensing control the type VI secretion system, biofilm
formation, protease production, and in vivo virulence in a clinical isolate of
Aeromonas hydrophila." Microbiology 155: 3518-3531.
Khajanchi, B. J., A. A. Fadl, M. A. Borchardt, et al. (2010). "Distribution of virulence
factors and molecular fingerprinting of Aeromonas species isolates from water
and clinical samples: suggestive evidence of water-to-human transmissionV?."
Khajanchi, B. J., M. L. Kirtley, S. M. Brackman, et al. (2011). "Immunomodulatory
and protective roles of quorum-sensing signaling molecules N-acyl Homoserine
-- 281 --
lactones during infection of mice with Aeromonas hydrophila." Infection and
Immunity 79(7): 2646-2657.
Khajanchi, B. J., E. V. Kozlova, J. Sha, et al. (2012). "The two-component QseBC
signaling system regulates in vitro and in vivo virulence of Aeromonas
hydrophila." Microbiology 158: 259-271.
Khan, A. A. and C. E. Cerniglia (1997). "Rapid and sensitive method for the detection
of Aeromonas caviae and Aeromonas trota by polymerase chain reaction."
Letters in Applied Microbiology 24: 233-239.
Khan, A. A., E. Kim and C. E. Cerniglia (1998). "Molecular cloning, nucleotide
sequence, and expression in Escherichia coli of a haemolytic toxin (aerolysin)
gene from Aeromonas trota." Applied and Environmental Microbiology 64(7):
2473-2478.
Khan, A. A., M. S. Nawaz, S. A. Khan, et al. (1999). "Identification of Aeromonas trota
(hybridization group 13) by amplification of the aerolysin gene using
polymerase chain reaction." Molecular and Cellular Probes 13: 93-98.
Khan, R., E. Takahashi, H. Nakura, et al. (2008). "Toxin production by Aeromonas
sobria in natural environments: river vs seawater." Acta Medica Okayama
62(6): 363-371.
Khan, R., E. Takahashi, T. Ramamurthy, et al. (2007). "Salt in surroundings influences
the production of serine protease into milieu by Aeromonas sobria."
Microbiology and Immunology 51(10): 963-976.
Khan, M. L., G. Walters and T. Metcalfe (2007). “Bilateral endogenous endophthalmitis
caused by Aeromonas hydrophila.” Eye 21: 1244-1245.
Khan, S. J., R. H. Reed and M. G. Rasul (2012). "Thin-film fixed-bed reactor (TFFBR)
for solar photocatalytic inactivation of aquaculture pathogen Aeromonas
hydrophila." Microbiology 12(5): 1-11.
Khardori, N. and V. Fainstein (1988). "Aeromonas and Plesiomonas as etiological
agents." Annual Review of Microbiology 42: 395-419.
Kienzle, N., M. Muller and S. Pegg (2000). "Aeromonas wound infections in burns."
Burns 26: 478-482.
Kimura, T. (1969). “A new subspecies of Aeromonas salmonicida as an etiological
agent of furunculosis on "Sakuramasu" (Oncorhynchus masou) and Pink
Salmon (O. gorbuscha) rearing for maturity.” Part 2. On the serological
properties. Fish Pathology (Tokyo) 3, 45-52.
Kimura, M. (1980). "A simple method for estimating evolutionary rates of base
substitutions through comparative studies of nucleotide sequences." Journal of
Molecular Evolution 16: 111-120.
Kingombe, C. I., G. Huys, D. Howald, et al. (2004). "The usefulness of molecular
techniques to assess the presence of Aeromonas spp. harboring virulence
markers in foods." International Journal of Food Microbiology 94: 113-121.
Kingombe, C. I., G. Huys, M. Tonolla, et al. (1999). "PCR detection, characterization,
and distribution of virulence genes in Aeromonas spp." Applied and
Kirov, S. M. (1993). "The public health significance of Aeromonas spp. in foods."
International Journal of Food Microbiology 20: 179-198.
Kirov, S. M. (1997). "Aeromonas and Plesiomonas". In: Food Microbiology:
Fundamentals and Frontiers. eds. M. Doyle, L. Beuchat and T. Montville. ASM
Press Washington DC: 265-286.
Kirov, S. M. (2003). "Bacteria that express lateral flagella enable dissection of the
multifunctional roles of flagella in pathogenesis." FEMS Microbiology Letters
224: 151-159.
-- 282 --
Kirov, S. M. and K. Sanderson (1996). "Characterization of a type IV bundle-forming
pilus (SFP) from a gastroenteritis-associated strain of A. veronii biovar sobria."
Kirov, S. M. and L. J. Hayward (1993). "Virulence traits of Aeromonas in relation to
species and geographic region." Australian Journal of Medical Science 14: 54-
58.
Kirov, S. M., B. C. Tassell, A. B. T. Semmler, et al. (2002). "Lateral flagella and
swarming motility in Aeromonas species." Journal of Bacteriology 184(2):
547-555.
Kirov, S. M., B. Rees, R. C. Wellock, et al. (1986). "Virulence characteristics of
Aeromonas spp. in relation to source and biotype." Journal of Clinical
Kirov, S. M., D. S. Hui and L. J. Hayward (1993). "Milk as a potential source of
Aeromonas gastrointestinal infection." Journal of Food Protection 56: 306-
312.
Kirov, S. M., I. Jacobs, L. J. Hayward, et al. (1995b). "Electron microscopy
examination of factors influencing the expression of filamentous surface
structures on clinical and environmental isolates of Aeromonas veronii biotype
sobria." Microbiology and Immunology 39: 329-338.
Kirov, S. M., K. Sanderson and T. C. Dickson (1998). "Characterization of a type IV
pilus produced by Aeromonas caviae." Journal of Medical Microbiology 47:
527-531.
Kirov, S. M., L. A. O'Donovan and K. Sanderson (1999). "Functional characterization
of type IV pili expressed on diarrhoea-associated isolates of Aeromonas
species." Infection and Immunity 67(10): 5447-5454.
Kirov, S. M., L. J. Hayward and M. N. Nerrie (1995a). "Adhesion of Aeromonas sp. to
cell lines used as models for intestinal adhesion." Epidemiology and Infection
115: 465-473.
Kirov, S. M., M. Castrisios and J. G. Shaw (2004). "Aeromonas flagella (polar and
lateral) are enterocyte adhesins that contribute to biofilm formation on
surfaces." Infection and Immunity 72(4): 1939-1945.
Kirov, S. M., T. C. Barnett, C. M. Pepe, et al. (2000). "Investigations of the role of type
IV Aeromonas pilus (Tap) in the pathogenesis of Aeromonas gastrointestinal
infection." Infection and Immunity 68: 4040-4048.
Küijper, E. J., L. van Alphen, E. Leenders, et al. (1989). “Typing of Aeromonas strains
by DNA restriction endonuclease analysis and polyacrylamide gel
electrophoresis of cell envelopes.” Journal of Clinical Microbiology 27: 1280-
1285.
Kluyver, A. J. and C. B. van Neil (1936). "Prospects for a natural system of
classification of bacteria." Zentralblatt Bakteriologie II Orig. 94: 369-403.
Knochel, S. (1989). "Effect of temperature on hemolysin production in Aeromonas spp.
isolated from warm and cold environments." International Journal of Food
Knochel, S. (1990). "Growth characteristics of motile Aeromonas spp. isolated from
different environments." International Journal of Food Microbiology 10: 235-
244.
Knochel, S. and C. Jeppesen (1990). "Distribution and characteristics of Aeromonas in
food and drinking water in Denmark." International Journal of Food
Ko, W. C. and Y. C. Chuang (1995). "Aeromonas bacteremia: review of 59 episodes."
-- 283 --
Ko, W. C., H. C. Lee, Y. C. Chuang, et al. (2000). "Clinical features and therapeutic
implications of 104 episodes of monomicrobial Aeromonas bacteraemia."
Journal of Infection 40: 267-273.
Ko, W. C., K. W. Yu, C. Y. Liu, et al. (1996). "Increasing antibiotic resistance in
clinical isolates of Aeromonas strains in Taiwan." Antimicrobial Agents and
Chemotherapy 40(5): 1260-1262.
Ko, W. C., S. R. Chiang, H. C. Lee, et al. (2003). "In vitro and in vivo activities of
fluoroquinolones against Aeromonas hydrophila." Antimicrobial Agents and
Chemotherapy 47(7): 2217-2222.
Ko, W. C., S. R. Chiang, J. J. Yan, et al. (2005). "Comparative pathogenicity of
bacteraemic isolates of Aeromonas hydrophila and Klebsiella pneumoniae."
Clinical Microbiology and Infection 11: 553-558.
Kobayashi, H., A. Tateishi, H. Tsuge, et al. (2009b). "The carboxyl-terminal tail of
Aeromonas sobria serine protease is associated with the chaperone."
Microbiology and Immunology 53: 647-657.
Kobayashi, H., E. Takahashi, K. Oguma, et al. (2006). "Cleavage specificity of the
serine protease of Aeromonas sobria, a member of the kexin family of
subtilases." FEMS Medical Letters 256: 165-170.
Kobayashi, H., H. Utsunomiya, H. Yamanaka, et al. (2009a). "Structural basis for the
kexin-like serine protease from Aeromonas sobria as sepsis-causing factor."
Journal of Biological Chemistry 284(40): 27655-27663.
Kodjo, A., F. Haond and Y. Richard (1997). "Molecular and phenotypic features of
Aeromonas isolated from snails (Helix aspersa) affected with a new summer
disease." Journal of Veterinary Medicine B 44: 245-252.
Koehler, J. M. and L. R. Ashdown (1993). "In vitro susceptibilities of tropical strains of
Aeromonas species from Queesnsland, Australia, to 22 antimicrobial agents."
Kokka, R. P., J. M. Janda, L. S. Oshiro, et al. (1991). "Biochemical and genetic
characterization of autoagglutinating phenotypes of Aeromonas species
associated with invasive and noninvasive disease." Journal of Infectious
Diseases 163: 890-894.
Kong, R., A. Pelling, C. So, et al. (1999). "Identification of oligonucleotide primers
targeted at the 16S-23S rRNA intergenic spacer for genus and species-specific
detection of aeromonads." Marine Pollution Bulletin 38: 802-808.
Konstantinidis, K. T. and J. M. Tiedje (2005). “Genomic insights that advance the
species definition for prokaryotes.” Preceedings of the National Academy of
Science 102 (7): 2567-2572.
Korbsrisate, S., S. Dumnin, R. Chawengkirttkul, et al. (2002). "Distribution of
Aeromonas hydrophila serogroups in different clinical samples and the
development of polyclonal antibodies for rapid identification of the genus
Aeromonas by direct agglutination." Microbiology and Immunology 46(12):
875-879.
Korzeniewska, E., Z. Filipkowska, D. Zarnoch, et al. (2005). "Survival of Escherichia
coli and Aeromonas hydrophila in non-carbonated mineral water." Polish
Kozaki, S., K. Kato, T. Asao, et al. (1987). "Activities of Aeromonas hydrophila
haemolysins and their interaction with erythrocyte membranes." Infection and
Immunity 55(7): 1594-1599.
Kozaki, S., T. Asao, Y. Kamata, et al. (1989). "Characterization of Aeromonas sobria
haemolysin by use of monoclonal antibodies against Aeromonas hydrophila
haemolysins." Journal of Clinical Microbiology 27(8): 1782-1786.
-- 284 --
Kozinska, A. and A. Pekala (2012). "Characteristics of disease spectrum in relation to
species, serogroups, and adhesion ability of motile aeromonads in fish."
Science World Journal 2012: 1-9.
Kozlova, E. V., V. L. Popov, J. Sha, et al. (2008). "Mutation in the S-
ribosylhomocysteinase (luxS) gene involved in quorum sensing affects biofilm
formation and virulence in a clinical isolate of Aeromonas hydrophila."
Microbial Pathogenesis 45: 343-354.
Kozlova, E. V., B. K. Khajanchi, J. Sha, et al. (2011). "Quorum sensing and c-di-
GMPdependent alterations in gene transcripts and virulence-associated
phenotypes in a clinical isolate of Aeromonas hydrophila." Microbial
Pathogenesis 50: 213-223.
Krovacek, K., A. Faris and I. Mansson (1991). "In vitro invasion of Aeromonas spp. to
HEp-2 tissue culture cells." Acta Veterinaria Scandinavica 32: 139-143.
Krovacek, K., A. Faris, S. B. Baloda, et al. (1992). "Prevalence and characterization of
Aeromonas spp. isolated from foods in Uppsala, Sweden." Food Microbiology
9: 29-36.
Krovacek, K., S. Dumontet, E. Eriksson, et al. (1995). "Isolation and virulence profiles
of Aeromonas hydrophila implicated in an outbreak of food poisoning in
Sweden." Microbiology and Immunology 39(9): 655-661.
Krzymińska, S., A. Kaznowski and H. Spychala (2006). "Purification and
characterization of cytolytic toxins produced by Aeromonas hydrophila."
Polish Journal of Microbiology 55(1): 37-42.
Krzymińska, S., A. Kaznowski, K. Lindner, et al. (2003). "Enteropathogenic activity
and invasion of HEp-2 cells by Aeromonas caviae clinical isolates." Acta
Microbiologica Polonica 52(3): 277-283.
Krzymińska, S., A. Tanska and A. Kaznowski. (2011). "Aeromonas spp. induce
apoptosis of epithelial cells through an oxidant-dependent activation of the
mitochondrial pathway." Journal of Medical Microbiology 60: 889-898.
Kuhn, I., G. Allestam, G. Huys, et al. (1997b). "Diversity, persistence and virulence of
Aeromonas strains isolated from drinking water distribution systems in
Sweden." Applied and Environmental Microbiology 63(7): 2708-2715.
Kuhn, I., G. Huys, P. Janssen, et al. (1997c). "Diversity and stability of coliforms and
Aeromonas in water from a well, studied over four years of time " Canadian
Kuhn, I., M. J. Albert, M. Ansaruzzaman, et al. (1997a). "Characterisation of
Aeromonas spp. isolated from humans with diarrhoea, from healthy controls
and from surface water in Bangladesh." Journal of Clinical Microbiology
35(2): 369-373.
Kuhn, I., T. Lindberg, K. Olsson, et al. (1992). "Biochemical fingerprinting for typing
of Aeromonas strains from food and water." Letters in Applied Microbiology
15: 261-265.
Küijper, E. J., A. G. Steigerwalt, B. S. Schoenmakers, et al. (1989b). "Phenotypic
characterization and DNA relatedness in human fecal isolates of Aeromonas
spp." Journal of Clinical Microbiology 27(1): 132-138.
Küijper, E. J., H. C. Zanen and M. F. Peters (1987). "Aeromonas-associated diarrhea in
the Netherlands." Annals of Internal Medicine 106(4): 640-641.
Küijper, E. J., L. van Alphen, E. Leenders, and et al. (1989a). "Typing of Aeromonas
strains by DNA restriction endonuclease analysis and polyacrylamide gel
electrophoresis of cell envelopes." Journal of Clinical Microbiology 27(6):
1280-1285.
Kumar, S., K. Tamura, I. B. Jakobsen, et al. (2001). "MEGA2: molecular volutionary
genetics analysis software." Bioinformatics 17(12): 1244-1245.
-- 285 --
Kumar, S., P. Mukhopadhyay, M. Chatterjee, et al. (2012). “Necrotizing fasciitis
caused by Aeromonas caviae.” Avicenna Journal of Medicine 2(4): 94-96.
Kunimoto, D., R. Rennie, D. M. Citron, et al. (2004). "Bacteriology of a bear bite
wound to a human: case report." Journal of Clinical Microbiology 42: 3374-
3376.
Küpfer, M., P. Kuhnert, B. M. Korczak, et al. (2006). "Genetic relationships of
Aeromonas strains inferred from 16S rRNA, gyrB and rpoD gene sequences."
International Journal of Systematic and Evolutionar Microbiology 56: 2743-
2751.
Kushiramani, R. M., B. Maiti, M. Shekar, et al. (2012). "Recombinant Aeromonas
hydrophila outer membrane protein 48 (Omp48) induces a protective immune
response against Aeromonas hydrophila and Edwarsiella tarda." Research in
Laganowska, M. and A. Kasnowski (2005). "Polymorphism of Aeromonas spp. tRNA
intergenic spacers." Systematic and Applied Microbiology 28: 222-229.
Laganowska, M. and A. Kasnowski (2004). "Restriction fragment length polymorphism
of 16S-23S rDNA intergenic spacer of Aeromonas spp." Systematic and
Lai, C. C., C. C. Shiao, G. D. Lu, et al. (2007). "Aeromonas hydrophila and Aeromonas
sobria bacteremia: rare pathogens of infection in a burn patient." Burns 33:
255-257.
Lambert, M. A., F. W. Hickman-Brenner, J. J. Farmer III, et al. (1983). "Differenciation
of Vibrionaceae species by their cellular fatty acids components." International
Journal of Systematic Bacteriology 33: 777-792.
Lamy, B., F. Laurent and A. Kodjo (2010). "Validation of a partial rpoB gene sequence
as a tool for phylogenetic identification of aeromonads isolated from
environmental sources." Canadian Journal of Microbiology 56: 217-228.
Lamy, B., A. Kodjo, F. Laurent, et al. (2011). "Identification of Aeromonas isolates by
matrix-assisted laser desorption ionization time-of-flight mass spectrometry."
Diagnostic Microbiology and Infectious Disease 71: 1-5.
Lan, X., N. Ozawa, N. Nishiwaki, et al. (2004). "Purification, cloning, and sequence
analysis of Beta-N-acetylglucosaminidase from the chitinolytic bacterium
Aeromonas hydrophila SUWA-9." Bioscience, Biotechnology and
Biochemistry 68(5): 1082-1090.
Lan, X., X. Zhang, J. Hu, et al. (2006). "Cloning, expression, and characterization of a
chitinase from the chitinolytic bacterium Aeromonas hydrophila strain SUWA-
9." Bioscience, Biotechnology and Biochemistry 70: 2437-2442.
Lan, X., X. Zhang, R. Kodaira, et al. (2008). "Gene cloning, expression, and
characterization of a second B-N-Acetylglucosaminidase from the chitinolytic
bacterium Aeromonas hydrophila strain SUWA-9." Bioscience, Biotechnology
and Biochemistry 72(2): 492-498.
Laufer, A. S., M. E. Siddall and J. Graf (2008). "Characterization of the digestive-tract
microbiota of Hirudo orientalis, a European medicinal leech." Applied and
Environmental Microbiology 74: 6151-6154.
Lawson, M. A., V. Burke and B. J. Chang (1985). "Invasion of HEPp-2 cells by faecal
isolates of Aeromonas hydrophila." Infection and Immunity 47(3): 680-683.
Le Chevalier, M. W., T. M. Evans, R. J. Seidler, et al. (1982). "Aeromonas sobria in
chlorinated drinking water supplies." Microbial Ecology 8: 325-333.
Leclere, V., M. Bechet and R. Blondeau (2004). "Functional significance of a
periplasmic Mn-superoxide dismutase from Aeromonas hydrophila." Journal
of Applied Microbiology 96: 828-833.
-- 286 --
Lee, C. C., C. H. Chi, N. Y. Lee, et al. (2008). "Necrotizing fasciitis in patients with
liver cirrhosis: predominance of monomicrobial Gram-negative bacillary
infections." Diagnostic Microbiology and Infectious Disease 62: 219-225.
Lee, K. K. and A. E. Ellis (1990). "Glycerophospholipid:cholesterol acyltransferase
complexed with lipopolysaccharide (LPS) is a major lethal exotoxin and
cytolysin of Aeromonas salmonicida: LPS stabilizes and enhances toxicity of
the enzyme." Journal of Bacteriology 172(9): 5382-5393.
Lehane, L. and G. T. Rawlin (2000). "Topically acquired bacterial zoonoses from fish: a
review." Medical Journal of Australia 173: 256-259.
Leung, K. Y. and R. M. Stevenson (1988b). "Characteristics and distribution of
extracellular proteases from Aeromonas hydrophila.." Journal of General
Leung, K. Y. and R. M. Stevenson (1988a). “Tn5-induced protease-deficient strains of
Aeromonas hydrophila with reduced virulence for fish.” Infection and
Immunity 56(10): 2639-2644.
Leung, K. Y., T. M. Lim, T. J. Lam, et al. (1996). "Morphological changes in carp
epithelial cells infected with Aeromonas hydrophila." Journal of Fish Diseases
19: 167-174.
Libisch, B., C. G. Giske, B. Kovacs, et al. (2008). "Identification of the first VIM
metallo-B-lactamase-producing multiresistant Aeromonas hydrophila strain."
Journal of Clinical Microbiology 46: 1878-1880.
Lim, P. L. (2005). "Wound infections in tsunami survivors: a commentary." Annals of
the Academy of Medicine of Singapore 3: 582-585.
Lin, C. S., H. C. Chen and F. P. Lin (1997). "Expression and characterization of the
recombinant gene encoding chitinase from Aeromonas caviae. " Enzyme
Microbial Technology 21: 472-478.
Liu, C. L., W. H. Chuang, C. C. Tu, et al. (2010). "Purification of a toxic cysteine
protease produced by pathogenic Aeromonas hydrophila isolated from rainbow
trout." Journal of Basic Microbiology 50: 1-10.
Ljungh, A. and T. Kronevi (1982). "Aeromonas hydrophila toxins-intestinal fluid
accumulation and mucosal injury in animal models." Toxicon 20: 397-407.
Ljungh A., B. Wretlind and R. Mollby. (1981). "Separation and characterization of
enterotoxin and two haemolysins from Aeromonas hydrophila. " Acta
Pathologica and Microbiologica Scandinavica 89: 387-397.
Ljungh, A. L. and T. Wadström (1979). “Aeromonas hydrophila enterotoxin.” Abstract
15th joint conference on cholera. U. S. – Japan Cooperative Medical Science
Program. p. 71.
Ljungh, A. L. and T. Wadström (1983). "Toxins of Vibrio parahaemolyticus and
Aeromonas hydrophila." Journal of Toxicology and Toxin Reviews 1: 257-307.
Llopis, F., J. Grau, F. Tubau, et al. (2004). "Epidemiological and clinical characteristics
of bacteraemia caused by Aeromonas spp. as compared with Escherichia coli
and Pseudomonas aeruginosa." Scandinavian Journal of Infectious Diseases
36: 335-341.
Lopez, J. F., J. Quesada and A. Saied (1968). "Bacteraemia and osteomyelitis due to
Aeromonas hydrophila : a complication during the treatment of acute
leukaemia." American Journal of Clinical Pathology 50: 587-591.
Lopez, L., C. Pozo, B. Rodelas, et al. (2005). "Identification of bacteria isolated from an
oligotropic lake with pesticide removal capacities." Ecotoxicology 14: 299-312.
Low, K. W., S. G. Goh, T. M. Lim, et al. (1998). "Actin rearrangements accompanying
Aeromonas hydrophila entry into cultured fish cells." Journal of Fish Diseases
21: 55-65.
-- 287 --
Lu, S. Y., Y. L. Zhang, S. N. Geng, et al. (2010). "High diversity of extended-spectrum
B-lactamase-producing bacteria in an urban river sediment habitat." Applied
and Environmental Microbiology 76: 5972-5976.
Lupiola-Gomez, P. A., Z. Gonzalez-Lama, M. T. Tejedor-Junco, et al. (2003). "Group
1 beta-lactamases of Aeromonas caviae and their resistance to beta-lactam
antibiotics." Canadian Journal of Microbiology 49: 207-215.
Lye, D. J. (2011). "Gastrointestinal colonization rates for human clinical isolates of
Aeromonas veronii using a mouse model." Current Microbiology 63: 332-336.
Lye, D. J., M. R. Rodgers, G. Stelma, et al. (2007). "Characterization of Aeromonas
virulence using an immunocompromised mouse model." Current Microbiology
54: 195-198.
Lye, D. J. (2009). "A mouse model for characterization of gastrointestinal colonization
rates among environmental Aeromonas isolates." Current Microbiology 58:
454-458.
Lynch, J. M., W. R. Tilson, G. R. Hodges, et al. (1981). "Nosocomial Aeromonas
hydrophila cellulitis and bacteremia in a nonimmunocompromised patient."
Southern Medical Journal 74(7): 901-902.
Lynch, M. J., A. Swift, D. F. Kirke, et al. (2002). "The regulation of biofilm
development by quorum sensing in Aeromonas hydrophila." Environmental
Maalej, S., R. Gdoura, S. Dukan, et al. (2004). "Maintenance of pathogenicity during
entry into and resuscitation from viable but nonculturable state in Aeromonas
hydrophila exposed to natural seawater at low temperature." Journal of Applied
MacFaddin, J. (1976). "Biochemical tests for the identification of medical bacteria." 2nd
edition, The Williams and Wilkins Company, Baltimore.
MacIntyre, S., T. J. Trust and J. T. Buckley (1979). "Distribution of
glycerophospholipid-cholesterol acyltransferase in selected bacterial species."
Journal of Bacteriology 139(1): 132-136.
Macnab, R. M. and D. J. DeRossier (1988). "Bacterial flagellar structure and function. "
Mahabeer, Y., A. Khumalo, E. Kiratu, et al. (2014). “Posttraumatic brain abscess
caused by Aeromonas hydrophila.” Journal of Clinical Microbiology 52(5):
doi: 10.1128/JCM.00267-1.
Majeed, K. N., A. F. Egan and I. C. MacRae (1990). "Production of exotoxins by
Aeromonas spp. at 5 degrees C." Journal of Applied Bacteriology 69: 332-337.
Maravić, A., M. Skočibušić, I. Samanić, et al. (2013). “Aeromonas spp. simultaneously
harbouring blaCTX-M-15, blaSHV-12, blaPER-1 and blaFOX-2, in wild-
growing Mediterranean mussel (Mytilus galloprovincialis) from Adriatic Sea,
Croatia.” International Journal of Food Microbiology 166(2): 301-308.
Marchandin, H., S. Godreuil, H. Darbas, et al. (2003). "Extended-spectrum B-lactamase
TEM-24 in an Aeromonas clinical strain: acquisition from the prevalent
Enterobacter aerogenes clone in France." Antimicrobial Agents and
Chemotherapy 47(12): 3994-3995.
Markovic, M., V. Djikanovic, P. Cakic, et al. (2007). "Aeromonas Salmonicida in
Californian trout (Oncorhynchus Mykiss, Walbaum, 1792 ) and some
biochemical characteristics of this bacteria." The International Journal of
Microbiology ISSN: 1937-8289 3(1).
Martin-Carnahan, A. and S. W. Joseph (2005). "Order XII. Aeromonadales ord. nov." 2:
556, part B, 2nd ed. Bergey's Manual of Systematic Bacteriology, eds, D. J.
Brenner, N. R. Krieg, J. T. Staley and G. M. Garrity, Springer, New York.
-- 288 --
Martínez-Murcia, A. J. (1999). "Phylogenetic positions of Aeromonas encheleia,
Aeromonas popoffii, Aeromonas DNA hybridization Group 11 and Aeromonas
Group 501." International Journal of Systematic and Evolutionary
Martínez-Murcia, A. J., N. Borrel and M. J. Figueras (2000). "Typing of clinical and
environmental Aeromonas veronii strains based on the 16S-23S rDNA
spacers." FEMS Immunology and Medical Microbiology 28: 225-232.
Martínez-Murcia, A. J., S. Benlloch and M. D. Collins (1992b). "Phylogenetic
interrelationships of members of the genera Aeromonas and Plesiomonas as
determined by 16S ribosomal DNA sequencing: lack of congruence with
results of DNA-DNA hybridizations." International Journal of Systematic
Martínez-Murcia, A. J., C. Esteve, E. Garay, et al. (1992a). "Aeromonas
allosaccharophila sp. nov., a new mesophilic member of the genus
Aeromonas." FEMS Microbiology Letters 91: 199-206.
Martínez-Murcia, A. J., M. J. Figueras, M. J. Saavedra, et al. (2007). "The recently
proposed species Aeromonas sharmana sp. nov., isolate GPTSA-6T, is not a
member of the genus Aeromonas." International Microbiology 10: 61-64.
Martínez-Murcia, A., M. J. Saavedra, V. R. Mota, et al. (2008). "Aeromonas
aquariorum sp. nov., isolated from aquaria of ornamental fish." International
Martínez-Murcia, A. J., J. Monera, A. Alperi, et al. (2009). "Phylogenetic evidence
suggests that strains of Aeromonas hydrophila subsp. dhakensis belong to the
species Aeromonas aquariorum sp. nov." Current Microbiology 58: 76-80.
Martínez-Murcia, A. J., A. Monera, M. J. Saavedra, et al. (2011)." Multilocus
phylogenetic analysis of the genus Aeromonas." Systematic and Applied
Martínez-Murcia, A. J., R. Beaz-Hidalgo, P. Svec, et al. (2013). "Aeromonas
cavernicola sp. nov. isolated from fresh water of a brook in a cavern." Current
Microbiology doi:10.1007/s00284-012-0253-x.
Martínez, M. J., D. Simon-Pujol, F. Congregado, et al. (1995). "The presence of
capsular polysaccharide in mesophilic Aeromonas hydrophila serotypes O:11
and O:34." FEMS Microbiology Letters 128: 69-74.
Martino, M. E., L. Fasolato, F. Montemurro, et al. (2011). "Determination of microbial
diversity of Aeromonas strains on the basis of multiloccus sequence typing,
phenotype, and presence of putive virulence genes " Applied Environmental
Microbiology 77(14): 4986-5000.
Martins, L. M., C. Ferreira Catani, R. Marquez Falcon, et al. (2007). "Induction of
apoptosis in Vero cells by Aeromonas veronii biovar sobria vacuolating
cytotoxic factor." FEMS Immunology and Medical Microbiology 49: 197-204.
Martins, L. M., R. Falcon Marquez and T. Yano (2002). "Incidence of toxic Aeromonas
isolated from food and human infection." FEMS Immunology and Medical
Massad, G., J. E. L. Arcenaux and B. R. Byers (1991). "Diversity of siderophore genes
encoding biosynthesis of 2,3-dihydroxybenzoic acid inAeromonas spp." Biom
etals 7: 227-236.
Massad, G., J. E. L. Arcenaux and B. R. Byers (1994). "Acquisition of iron from host
sources by mesophilic Aeromonas species." Journal of General Microbiology
137: 237-241.
Mateos, D., J. Anguita, G. Naharro, et al. (1993). "Influence of growth temperature on
the production of extracellular virulence factors and pathogenicity of
-- 289 --
environmental and human strains of Aeromonas hydrophila." Journal of
McCardell, B. A., J. M. Madden, M. H. Kothary, et al. (1995). "Purification and
characterisation of a CHO cell-elongating toxin produced by Aeromonas
McCleod, E. S., Z. Dadwood, R. MacDonald, et al. (1998). "Isolation and identification
of sulphite and iron reducing hydrogenase positive facultative anaerobes from
cooling water systems." Systematic and Applied Microbiology 21: 297-305.
McCracken, A. W. and R. Barkley (1972). "Isolation of Aeromonas species from
clinical sources." Journal of Clinical Pathology 25: 970-975.
McMahon, M. A. S. and I. G. Wilson (2001). "The occurrence of enteric pathogens and
Aeromonas species in organic vegetables." International Journal of Food
Megraud, F. (1986). "Incidence and virulence of Aeromonas species in feces of children
with diarrhea." European Journal of Clinical Microbiology 5(3): 311-316.
Mekisic, A. P. and J. R. Wardill (1992). "Crocodile attacks in the Northern Territory of
Australia." Medical Journal of Australia 157: 751-754.
Mellersh, A. R., P. Norman and G. H. Smith (1984). "Aeromonas hydrophila: and
outbreak of hospital infection." Journal of Hospital Infections 5: 425-430.
Mehmood, M. A., Y. Gai, Q. Zhuang, et al. (2010). “Aeromonas caviae CB101 contains
four chitinases encoded by a single gene chi1.” Molecular Biotechnology 44:
231-220.
Mendes-Marquez, C. L., L. Melo do Nascimento, G. Nazareth Diogo, et al. (2012).
"Molecular characterization of Aeromonas spp. and Vibrio cholerae O1 isolated
during a diarrhoeal outbreak." Revista do Instituto de Medicina Tropical de So
Paulo 54(6): 299-304.
Meng, X., Y. Liu and C. Lu (2009). "Expression, purification and molecular
characterization of elastase from Aeromonas hydrophila strain J-1." Acta
Microbiologica Sinica 49(12): 1613-1620.
Mercer, N. S. G., D. M. Beere, A. J. Bornemisza, et al. (1987). "Medical leeches as
sources of wound infection." British Medical Journal 294: 937.
Merino, S., A. Aguilar, M. M. Nogueras, et al. (1999). "Cloning, sequencing, and role
in virulence of two phospholipases (A1 and C) from mesophilic Aeromonas sp.
serogroup O:34. " Infection and Immunity 67(8): 4008-4013.
Merino, S., J. G. Shaw and J. M. Tomas (2006). "Bacterial lateral flagella:an inducible
flagella system." FEMS Microbiology Letters 263: 127-135.
Merino, S., S. Camprubi and J. M. Tomas (1992). "Effect of the growth temperature on
outer membrane components and virulence of Aeromonas hydrophila strains of
serotype O:34." Infection and Immunity 60: 43434-43439.
Merino, S., S. Camprubi and J. M. Tomas (1993). "Incidence of Aeromonas spp.
serotypes O:34 and O:11 among clinical isolates." Medical Microbiology
Letters 2: 48-55.
Merino, S., X. Rubires, A. Aguilar, et al. (1997). "The role of flagella and motility in
the adherence and invasion to fish cell lines by Aeromonas hydrophila
serogroup O:34 strains." FEMS Microbiology Letters 151: 213-217.
Merino, S., X. Rubires, A. Aguilar, et al. (1996a). “The O:34-antigen
lipopolysaccharide as an adhesin in Aeromonas hydrophila.” FEMS
Merino, S., X. Rubires, A. Aguilar, et al. (1996b). "The role of the O-antigen
lipopolysaccharide on the colonization in vivo of the germfree chicken gut by
Aeromonas hydrophila serogroup O:34." Microbial Pathogens 20: 325-333.
-- 290 --
Merino, S., X. Rubires, S. Knochel, et al. (1995). "Emerging pathogens: Aeromonas
spp. ." International Journal of Food Microbiology 28: 157-168.
Miles, A. A. and E. T. Halnan (1937). "A new species of micro-organism (Proteus
melanovogenes) causing black rot in eggs." Journal of Hygiene 37: 79-97.
Millership, S. E., and B. Chattopadyay (1985). "Aeromonas hydrophila in chlorinated
water supplies." Journal of Hospital Infections 6: 75-80.
Millership, S. E. and S. V. Want (1993). "Characterisation of strains of Aeromonas spp.
by phenotype and whole-cell protein fingerprinting." Journal of Medical
Millership, S. E., S. R. Curnow and B. Chattopadhyay (1983). "Faecal carriage rate of
Aeromonas hydrophila." Journal of Clinical Pathology 36: 920-923.
Miñana-Galbis, D., A. Urbizu-Serrano, M. Farfán, et al. (2009). "Phylogenetic analysis
and identification of Aeromonas species based on sequencing of the cnp60
universal target." International Journal of Systematic and Evolutionary
Miñana-Galbis, D., M. Farfán, M. C. Fuste, et al. (2007). "Aeromonas bivalvium sp.
nov., isolated from bivalve molluscs." International Journal of Systematic and
Miñana-Galbis, D., M. Farfán, J. G. Loren, et al. (2010). "Proposal to assign Aeromonas
diversa sp. nov. as a novel species designation for Aeromonas group 501."
Miñana-Galbis, D., M. Farfán, M. C. Fuste, et al. (2004a). "Aeromonas molluscorum sp.
nov., isolated from bivalve molluscs." International Journal of Systematic and
Miñana-Galbis, D., M. Farfán, M. C. Fuste, et al. (2004b). "Genetic diversity and
population structure of Aeromonas hydrophila, Aer. bestiarum, Aer.
salmonicida and Aer. popoffii by multilococus enzyme electrophoresis
(MLEE)." Environmental Microbiology 6(3): 198-208.
Miñana-Galbis, D., M. Farfán, J. G. Loren, et al. (2002). "Biochemical identification
and numerical taxonomy of Aeromonas spp. isolated from environmental and
clinical samples in Spain." Journal of Applied Microbiology 93: 420-430.
Miñana-Galbis, D., M. Farfán, V. Albarral, et al. (2013). "Reclassification of
Aeromonas hydrophila subspecies anaerogenes." Systematic and Applied
Miyake, M., K. Iga, C. Izumi, et al. (2000). "Rapidly progressive pneumonia due to
Aeromonas hydrophila shortly after near-drowning." Internal Medicine 39(12):
1128-1130.
Miyata, M. T. A., V. Inglis, T. Yoshida, et al. (1995). "RAPD analysis of Aeromonas
salmonicida and Aeromonas hydrophila." Journal of Applied Bacteriology 79:
181-185.
Mockracka, J., S. Krzyminska and E. Szcuka (2001). "Virulence factors of clinical
isolates of Aeromonas caviae." Folia Microbiologica 46(4): 321-326.
Morandi, A., O. Zhaxybayeva, J. P. Gogarten, et al. (2005). "Evolutionary and
diagnostic implications of intragenomic heterogeneity in the 16S rRNA gene in
Aeromonas strains." Journal of Bacteriology 187(18): 6561-6564.
Morgan, D. R., P. C. Johnson, H. L. DuPont, et al. (1985). "Lack of correlation between
known virulence properties of Aeromonas hydrophila and enteropathogenicity
for humans." Infection and Immunity 50(1): 62-65.
Morinaga, Y., K. Yanagihara, N. Araki, et al. (2011). "Clinical characteristics of seven
patients with Aeromonas septicaemia in a Japanese hospital." Tohoku Journal
of Experimental Medicine 225: 81-84.
Mousdale, M. T. (1983). "Isolation of Aeromonas from faeces." The Lancet 1: 351.
-- 291 --
Moyer, N. P., G. Martinetti, J. Luthy-Hottenstein, et al. (1992). "Value of rRNA gene
restriction patterns of Aeromonas spp. for epidemiological investigations. "
Current Microbiology 24: 15-21.
Moyer, N. P., H. K. Geiss, M. Marinescu, et al. (1991). "Media and methods for
isolation of aeromonads from fecal specimens. A multilaboratory study."
Moyer, N. P. (1987). "Clinical significance of Aeromonas species isolated from patients
with diarrhoea." Journal of Clinical Microbiology 25(11): 2044-2048.
Mukhopadyay, C., A. Bhargava and A. Ayyagri (2003). "Aeromonas hydrophila and
aspiration pneumonia: a diverse presentation." Yonsei Medical Journal 44:
1087-1090.
Munn, C. B., E. E. Ishiguro, W. W. Kay, et al. (1982). "Role of surface components in
serum resistance of virulent Aeromonas hydrophila." Infection and Immunity
36(3): 1069-1075.
Muñoz, P., V. Fernandez-Baca, T. Pelaez, et al. (1994). "Aeromonas peritonitis."
Murphy, D. K., E. J. Septimus and D. C. Waagner (1992). "Catfish-related injury and
infection: report of two cases and review of the literature." Clinical Infectious
Diseases 14: 689-693.
Murray, R. G. E., J. S. G. Dooley, P. W. Whippey, et al. (1988). "Structure of an S-layer
on a pathogenic strain of Aeromonas hydrophila." Journal of Bacteriology
170(6): 2625-2630.
Nagata, K., Y. Takeshima, K. Tomii, et al. (2011). "Fulminant fatal bacteraemic
pneumonia due to Aeromonas hydrophila in a non-immunocompromised
woman." Internal Medicine 50: 63-65.
Nagpal, M. L., K. F. Fox and A. Fox (1998). "Utility of 16S-23S rRNA spacer region
methodology: how similar are interspace regions within a genome and between
strains for closely related organisms." Journal of Microbiological Methods 33:
211-219.
Nakasone, N., C. Toma, T. Song, et al. (2004). "Purification and characterization of a
novel metalloprotease isolated from Aeromonas caviae." FEMS Microbiology
Letters 237: 127-132.
Nakasone, N., M. Iwanaga, T. Yamashiro, et al. (1996). "Aeromons trota strains, which
agglutinate with Vibrio cholerae O139 Bengal antiserum, possess a
serologically distinct fimbrial colonization factor." Microbiology 142: 309-313.
Nam, I. Y., H. Myung and K. Joh (2004). "Molecular cloning, purification, and
characterization of an extracellular nuclease from Aeromonas hydrophila
ATCC 14715." Journal of Microbiology and Biotechnology 14(1): 178-181.
Namdari, H. and V. J. Cabelli (1989). "The suicide phenomenon in aeromonads."
Namdari, H. and E. J. Bottone (1990). "Microbiologic and clinical evidence supporting
the role of Aeromonas caviae as a pediatric pathogen." Journal of Clinical
Nash, J. H. E., W. A. Findlay, C. C. Luebbert, et al. (2006). "Comparative genomics
profiling of clinical isolates of Aeromonas salmonicida using DNA
microarrays." BioMed Central Genomics 7(43): 1-15.
Nathwani, D., R. B. S. Laing, G. Harvey and C. C. Smith (1991).“Treatment of
symptomatic enteric Aeromonas hydrophila infection with ciprofloxacin.”
Scandinavian Journal of Infectious Diseases 23: 653-654.
Nawaz, M., S. A. Khan, A. A. Khan, et al. (2010). "Detection and characterization of
virulence genes and integrons in Aeromonas veronii isolated from catfish."
Food Microbiology 27: 327-331.
-- 292 --
Nayduch, D., A. Honko, G. P. Noblet, et al. (2001). "Detection of Aeromonas caviae in
the common housefly Musca domestica by culture and polymerase chain
reaction." Epidemiology and Infection 127: 561-566.
Nayduch, D., G. P. Noblet and F. J. Stutzenberger (2002). "Vector potential of
houseflies for the bacterium Aeromonas caviae." Medical and Veterinary
Entomology 16: 193-198.
Nazer, H., E. H. Price, G. H. Hunt, et al. (1986). "Clinical associations of Aeromonas
spp. in fecal specimens from children." Clinical Pediatrics 25(10): 516-519.
Nerland, A. H. (1996). "The nucleotide sequence of the gene encoding GCAT from
Aeromonas salmonicida ssp. salmonicida." Journal of Fish Diseases 19: 145-
150.
Neuwirth, C., E. Siebor, F. Robin, et al. (2007). "First occurrence of an IMP metallo-B-
lactamase in Aeromonas caviae: IMP-19 in an isolate from France."
Neves, M. S., M. P. Nuñes and A. M. Milhomem (1994). "Aeromonas species exhibit
aggregative adherence to HEp-2 cells." Journal of Clinical Microbiology 32(4):
1130-1131.
Nhung, P. H., H. Hata, K. Ohkusu, et al. (2007). "Use of the novel phylogenetic marker
dnaJ and DNA-DNA hybridization to clarify interrelationships within the
genus Aeromonas." International Journal of Systematic and Evolutionary
Microbiology 57(1232-1237).
Nishikawa, Y., A. Hase, J. Ogawasara, et al. (1994). "Adhesion to and invasion of
human colon carcinoma Caco-2 cells by Aeromonas strains." Journal of
Medical Microbiology 40: 55-61.
Nishikawa, Y. and T. Kishi (1988). "Isolation and characterization of motile Aeromonas
from humans, food and environmental specimens." Epidemiology and Infection
101: 213-223.
Nitta, H., H. Kobayashi, A. Irie, et al. (2007). "Activation of prothrombin by ASP, a
serine protease released from Aeromonas sobria." FEBS Letters 581: 5935-
5939.
Nitta, H., T. Imamura, Y. Wada, et al. (2008). "Production of C5a by ASP, a serine
protease released from Aeromonas sobria. " Journal of Immunology 181: 3602-
3608.
Noonan, B. and T. J. Trust (1995). "Molecular analysis of an A-protein secretion mutant
of Aeromonas salmonicida reveals a surface layer-specific protein secretion
pathway. " Journal of Molecular Biology 248: 316-327.
Noterdaeme, L., S. Bigawa, A. G. Steigerwalt, et al. (1996). "Numerical taxonomy and
biochemical identification of fish associated motile Aeromonas spp."
Notermans, S., A. Havelaar, W. Jansen, et al. (1986). "Production of "Asao Toxin" by
Aeromonas strains isolated from feces and drinking water." Journal of Clinical
Oakey, H. J., J. T. Ellis and L. F. Gibson (1995). "Can RAPD-PCR be used to
discriminate between the hybridisation groups of Aeromonas?." Medical
Oakey, H. J., J. T. Ellis and L. F. Gibson (1996). "Differentiation of Aeromonas
genomospecies using random amplified polymorphic DNA polymerase chain
reaction (RAPD-PCR)." Journal of Applied Bacteriology 80: 402-410.
Oakey, H. J., L. F. Gibson and A. M. George (1998). "Co-migration of RAPD-PCR
amplicons from Aeromonas hydrophila." FEMS Microbiology Letters 164: 35-
38.
-- 293 --
Odeyemi, O. A., A. Asmat and G. Usup (2012). “Antibiotic resistance and putative
virulence factors of Aeromonas hydrophila isolated from estuary.” Journal of
Microbiology, Biotechnology and Food Science 1(6): 1339-1357.
Ogugbue, C. J. and T. Sawidis (2011). "Bioremediation and detoxification of synthetic
wastewater containing triarylmethane dyes by Aeromonas hydrophila isolated
from industrial effluent." Biotechnology Research International
doi:10.4061/2011/967925.
O'Hara, C. (2006). "Evaluation of the Phoenix 100 ID/AST system and NID panel for
identification of Enterobacteriaceae, Vibrionaceae, and commonly isolated
nonenteric Gram-negative bacilli." Journal of Clinical Microbiology 44(3):
928-933.
Okamoto, K., T. Nomura, M. Hamada, et al. (2000). "Production of serine protease of
Aeromonas sobria is controlled by the protein encoded by the gene lying
adjacent to 3' and the protease gene." Microbiology and Immunology 9: 787-
798.
Okumura, K., F. Shoji, M. Yoshida, et al. (2011). "Severe sepsis caused by Aeromonas
hydrophila in a patient using tocilizumab: a case report." Journal of Medical
Case Reports 5(499): 1-3.
Ørmen, Ø. and Ø. Øestensvik (2001). "The occurrence of aerolysin-positive Aeromonas
spp. and their cytotoxicity in Norwegian water sources." Journal of Applied
Ørmen, Ø., P. E. Granum, J. Lassen, et al. (2005). "Lack of agreement between
biochemical and genetic identification of Aeromonas spp." Acta Pathologica,
Microbiologica et Immunologica Scandinavica 113: 203-207.
Osman, K. M., Z. M. S. Amin, M. A. K. Aly, et al. (2011). "SDS-PAGE heat shock
protein profiles of environmental Aeromonas strains." Polish Journal of
Osterhout, G. J., V. H. Shull and J. D. Dick (1991)."Identification of clinical isolates of
Gram-negative nonfermentative bacteria by an automated cellular fatty acid
identification system." Journal of Clinical Microbiology 29(9): 1822-1830.
Ottaviani, D., C. Parlani, B. Citterio, et al. (2011). "Putative virulence properties of
Aeromonas strains isolated from food, environmental and clinical sources in
Italy." International Journal of Food Microbiology 144: 538-545.
Ouderkirk, J. P., D. Bekhor, G. S. Turett, et al. (2004). "Aeromonas meninigitis
complicating medicinal leech therapy." Clinical Infectious Diseases 38: e36-
e37.
Overman, T. L. and J. M. Janda (1999). "Antimicrobial susceptibility patterns of
Aeromonas jandaei, A. schubertii, A. trota, and A. veronii biotype veronii."
Overman, T. L. and J. P. Seabolt (1983). "Minimal inhibitory concentrations of
antimicrobial agents against Aeromonas hydrophila determined with the
Autobac MTS." Journal of Clinical Microbiology 17(6): 1175-1176.
Oxoid Manual (1998).”Compiled by E. Y. Bridson, 8th Edition.” Published by OXOID
Limited, Hampshire, England.
Pablos, M., G. Huys, M. Cnockaert, et al. (2011). "Identification and epidemiological
relationships of Aeromonas isolates from patients with diarrhoea, drinking
water and foods." International Journal of Food Microbiology 147: 203-210.
Pablos, M., M. A. Remacha, J. M. Rodríguez-Calleja, et al. (2010). "Identity, virulence
genes, and clonal relatedness of Aeromonas isolates from patients with
diarrhoea and drinking water." European Journal of Clinical Microbiology and
-- 294 --
Paisley, R. (1999). "Training Manual: MIS Whole Cell Fatty Acid Analysis by Gas
Chromatography." Newark, MIDI-Inc. Del, USA.
Palfreeman, S. J., L. K. Waters and M. Norris (1983). "Aeromonas hydrophila
gastroenteritis." Australian and New Zealand Journal of Medicine 13: 524-
525.
Palu, A. P., L. Martins G., M. A. Lemos M., et al. (2006). "Antimicrobial resistance in
food and clinical Aeromonas isolates." Food Microbiology 23: 504-509.
Palumbo, S. A., M. M. Bencivengo, F. Del Corral, et al. (1989). "Characterisation of the
Aeromonas hydrophila group isolated from retail foods of animal origin."
Palumbo, S. A., F. Maxino, A. C. Williams, et al. (1985). "Starch-ampicillin agar for the
quentitative detection of Aeromonas hydrophila." Applied and Environmental
Pampin, F., G. Bou, R. Galeiras, et al. (2012). "Aeromonas and meningitis: an unusual
presentation." Neurocirugía 23(5): 200-202.
Pang, M. D., X. Q. Lin, M. Hu, et al. (2012). "Tetrahymena: an alternative model host
for evaluating virulence of Aeromonas strains." PLoS ONE 7(11): e48922.
Park, T. S., S. H. Oh, E. Y. Lee, et al. (2003). "Misidentification of Aeromonas veronii
biovar sobria as Vibrio alginolyticus by the Vitek system." Letters in Applied
Park, S. Y., H. Min Nam, K. Park, et al. (2011). "Aeromonas hydrophila sepsis
mimicking Vibrio vulnificus infection." Annals of Dermatology 23(S1): S25-
S27.
Parker, J. L. and J. G. Shaw (2011). "Aeromonas spp. clinical microbiology and
disease." Journal of Infection 62: 109-118.
Parras, F., M. D. Díaz, J. Reina, et al. (1993). "Meningitis due to Aeromonas species:
case report and review." Clinical Infectious Diseases 17: 1058-1060.
Paton, A. W. and J. C. Paton (1998). "Detection and characterization of Shiga toxigenic
Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA,
enterohaemorrhagic E. coli hlyA, rfb0111 and rf0157." Journal of Clinical
Paula, S. J., P. S. Duffey, S. L. Abbott, et al. (1988). "Surface properties of
autoagglutinating mesophilic aeromonads." Infection and Immunity 56(10):
2658-2665.
Pavan, M. E., S. L. Abbott, J. Zorzopulos, et al. (2000). "Aeromonas salmonicida ssp.
pectinolytica ssp. nov., a new pectinase-positive subspecies isolated from a
heavily polluted river." International Journal of Systematic and Evolutionary
Pazzaglia, G., J. R. Escalante, R. B. Sack, et al. (1990a). "Transient intestinal
colonization by multiple phenotypes of Aeromonas species during the first
week of life." Journal of Clinical Microbiology 28(8): 1842-1846.
Pazzaglia G., R. B. Sack, A. L. Bourgeois, et al. (1990b). "Diarrhoea and intestinal
invasiveness of Aeromonas strains in the removable intestinal tie rabbit model."
Infection and Immunity 58(6): 1924-1931.
Pemberton, J. M., S. P. Kidd and R. Schmidt (1997). "Secreted enzymes of
Aeromonas." FEMS Microbiology Letters 152: 1-10.
Pepe, C. M., M. W. Eklund and M. S. Ström (1996). "Cloning of an Aeromonas
hydrophila type IV pilus biogenesis gene cluster: complementation of pilus
assembly functions and characterisation of a type IV leader peptidase/N-
methyltransferase required for extracellular protein secretion." Molecular
-- 295 --
Petti, C. A., C. R. Polage and P. Schreckenberger (2005). "The role of 16S rRNA gene
sequencing in identification of microorganisms misidentified by conventional
methods." Journal of Clinical Microbiology 43(12): 6123-6125.
Pham, C. A., S. J. Jung, N. T. Phung, et al. (2003). "A novel electrochemically active
and Fe(III)-reducing bacterium phylogenetically related to Aeromonas
hydrophila, isolated from a microbial fuel cell." FEMS Microbiology Letters
223: 129-134.
Phipps, B. M. and W. W. Kay (1988). "Immunoglobulin binding by the regular surface
array of Aeromonas salmonicida." Journal of Biological Chemistry 263(19):
9298-9303.
Picȁo, R. C., L. Poirel, A. Demarta, et al. (2008). "Extended-spectrum B-lactamase
PER-1 in an environmental Aeromonas media isolated from Switzerland."
Picard, B. and P. Goullet (1987). "Epidemiological complexity of hospital aeromonas
infections revealed by electrophoretic typing of esterases " Epidemiology and
Infection 95: 5-14.
Pickett, M. J., J. R. Greenwood and S. M. Harvey (1991). "Tests for detecting
degradation of gelatin: comparison of five methods." Journal of Clinical
Pickett, M. J. and M. M. Pedersen (1970). "Characterization of saccharolytic
nonfermentative bacteria associated with man." Canadian Journal of
Pidiyar, V., A. Kasnowski, N. Badri Narayan, et al. (2002). "Aeromonas culicicola sp.
nov., from the midgut of Culex quinquefasciatus." International Journal of
Pidiyar, V., K. Jangid, K. M. Dayananda, et al. (2003). "Phylogenetic affiliation of
Aeromonas culicicola MTCC 3249T based on gyrB gene sequence and PCR-
amplicon sequence analysis of cytolytic enterotoxin gene." Systematic and
Pillai, L., J. Sha, T. E. Erova, et al. (2006). "Molecular and functional characterisation
of a ToxR-regulated lipoprotein from a clinical isolate of Aeromonas
hydrophila." Infection and Immunity 74(7): 3742-3755.
Pin, C., M. L. Marin, M. L. García, et al. (1994). "Comparison of different media for the
isolation and enumeration of Aeromonas spp. in foods." Letters in Applied
Pinna, A., L. A. Sechi, S. Zannetti, et al. (2004). "Aeromonas caviae keratitis associated
with contact lens wear." Ophthalmology 111: 348-351.
Pitarangsi, C., P. Echeverria, R. Whitmire, et al. (1982). "Enteropathogenicity of
Aeromonas hydrophila and Plesiomonas shigelloides: prevalence among
individuals with and without diarrhoea in Thailand." South East Asian Journal
of Tropical Medicine and Public Health 13(3): 491-492.
Pokhrel, B. M. and N. Thapa (2004). "Prevalence of Aeromonas in different clinical and
water samples with special reference to gastroenteritis." Nepal Medical College
Journal 6(2): 139-143.
Pollack, F. P., M. Coluccio, R. Ruttimann, et al. (1998). "Infected stingray injury."
Pediatric Infectious Diseases Journal 17: 349-360.
Poole, K. (2000). "Efflux-mediated resistance to fluoroquinolones in gram-negative
bacteria." Antimicrobial Agents and Chemotherapy 44: 2233-2241.
Popoff, M. (1984). "Aeromonas."In: Bergey's Manual of Systematic Bacteriology Vol.
1, ed. N. R. Krieg. Williams and Wilkins, Baltimore, USA.
Popoff, M. and M. Veron (1976). "A taxonomic study of the Aeromonas hydrophila-
Aeromonas punctata group." Journal of General Microbiology 94: 11-22.
-- 296 --
Popoff, M. Y., C. Coynault, M. Kiredjian, et al. (1981). "Polynucleotide sequence
relatedness among motile Aeromonas species." Current Microbiology 5: 109-
114.
Potomski, J., V. Burke, I. Watson, et al. (1987). "Purification of cytotoxic enterotoxin
of Aeromonas sobria by use of monoclonal antibodies." Journal of Medical
Presley, S. M., T. R. Rainwater, G. P. Austin, et al. (2006). "Assessment of pathogens
and toxicans in New Orleans, LA following hurricane Katrina." Environmental
Science and Technology 40: 468-474.
Pridgeon, J. W., P. H. Klesius, X. Mu, et al. (2011). "Identification of unique DNA
sequences present in highly virulent 2009 Alabama isolates of Aeromonas
hydrophila." Veterinary Microbiology 152: 117-125.
Puah, S. M., S. D. Puthucheary, F. Y. Liew, et al. (2013). "Aeromonas aquariorum
clinical isolates: antimicrobial profiles, plasmids and genetic determinants."
International Journal of Antimicrobial Agents 41(3): 281-284.
Pukatzki, S., A. T. Ma, A. T. Revel, et al. (2007). "Type VI secretion system
translocates a phage tail spike-like protein into target cells where it cross-links
actin." Proceedings of the National Academy of Sciences USA 104: 15508-
15513.
Pukatzki, S., S. B. McAuley and S. T. Miyata (2009). "The type VI secretion system:
translocation of effectors and effector-domains." Current Opinions in
Purdue, G. H. and J. L. Hunt (1996). "Aeromonas hydrophila infection in burn patients."
Burns 14: 220-221.
Puthucheary, S. D., S. Moi Puah and K. Heng Chua (2012). "Molecular characterization
of clinical isolates of Aeromonas species from Malaysia." PloS One 7(2).
Qadri, S. M., L. P. Gordon, R. D. Wende, et al. (1976). "Meningitis due to Aeromonas
hydrophila." Journal of Clinical Microbiology 3: 102-104.
Quinn, D. M., C. Y. F. Wong, H. M. Atkinson, et al. (1993). "Isolation of
carbohydrate-reactive outer membrane proteins of Aeromonas hydrophila."
Quinn, D. M., H. M. Atkinson, A. H. Bretag, et al. (1994). "Carbohydrate-reactive,
pore-forming outer membrane proteins of Aeromonas hydrophila." Infection
and Immunity 62(9): 4054-4058.
Rabaan, A. A., I. Gryllos, J. M.Tomas, et al. (2001). "Motility and the polar flagellum
are required for Aeromonas caviae adherence to Hep-2 cells." Infection and
Immunity 69(7): 4257-4267.
Rael, R. M. and W. T. Frankenberger Jr (1996). "Influence of pH, salinity, and selenium
on the growth of Aeromonas veronii in evaporation agricultural drainage
water." Water Research 30(2): 422-430.
Rahman, A. F. M. S. and J. M. T. Willoughby (1980). "Dysentery-like syndrome
associated with Aeromonas hydrophila." British Medical Journal 281: 976.
Rahman, M., G. Huys, M. Rahman, et al. (2007a). "Persistence, transmission, and
virulence characteristics of Aeromonas strains in a duckweed aquaculture-
based hospital sewage water recycling plant in Bangladesh." Applied and
Rahman, M. H., S. Suzuki and K. Kawai (2001). “Formation of viable but non-
culturable state (VBNC) of Aeromonas hydrophila and its virulence in
goldfish, Carassius auratus.” Microbiology Research 156(1): 103-106.
Rahman, M., P. Colque-Navarro, I. Kuhn, et al. (2002). "Identification and
characterization of pathogenic Aeromonas veronii biovar sobria associated
-- 297 --
with epizootic ulcerative syndrome in fish in Bangladesh." Applied and
Rahman, M., R. Simm, A. Kader, et al. (2007b). "The role of c-di-GMP signaling in an
Aeromonas veronii biovar sobria strain." FEMS Microbiology Letters 273:
172-179.
Ramamurthy, T., A. Ghosh, G. P. Pazhani and S. Shinoda (2014). “Current
perspectives on viable but non-culturable (VBNC) pathogenic bacteria.”
Frontiers in Public Health doi: 10.3389/fpubh.2014.00103.
Ramteke, P. W., S. P. Pathak, A. R. Gautam, et al. (1993). "Association of Aeromonas
caviae with sewage pollution." Journal of Environmental Science and Health
A28(4): 859-870.
Rangrez, A. Y., K. M. Dayananda, S. Atanur, et al. (2006). "Detection of conjugation
related type IV secretion machinery in Aeromonas culicicola." PloS One 1(1):
1-5.
Rangrez, A. Y., M. Y. Abajy, W. Keller, et al. (2010). “Biochemical characterization of
three putative ATPases from a new type IV secretion system of Aeromonas
veronii plasmid pAC3249A.” BMC Biochemistry 11:10 doi:10.1186/1471-
2091-11-10.
Rasch, M., V. Gaedt Kastbjerg, J. Bartholin Bruhn, et al. (2007). "Quorum sensing
signals are produced by Aeromonas salmonicida and quorum sensing inhibitors
can reduce production of a potential virulence factor." Diseases of Aquatic
Organisms 78: 105-113.
Rasmussen, B. and K. Bush (1997). "Carbapenem-hydrolyzing B-lactamases "
Antimicrobial Agents and Chemotherapy 41: 223-232.
Rasmussen, B. A., D. Keeney, Y. Yang, et al. (1994). "Cloning and expression of a
cloxacillin-hydrolysing enzyme and a cephalosporinase from Aeromonas
sobria AER 14M in Escherichia coli: requirement for an E. coli chromosomal
mutation for efficient expression of the class D enzyme." Antimicrobial Agents
and Chemotherapy 38(9): 2078-2085.
Rautelin, H., A. Sivonen, A. Kuikka, et al. (1995b). "Role of Aeromonas isolated from
feces of Finnish patients." Scandinavian Journal of Infectious Diseases 27:
207-210.
Rautelin, H., M. L. Hänninen, A. Sivonen, et al. (1995a). "Chronic diarrhea due to a
single strain of Aeromonas caviae." European Journal of Clinical
Microbiology and Infectious Diseases 14(1): 51-53.
Raynor, A. C., H. G. Bingham, H. H. Caffee, et al. (1983). "Alligator bites and related
infections." Journal of the Florida Medical Association 70: 107-110.
Reines, H. D. and F. V. Cook (1981). "Pneumonia and bacteremia due to Aeromonas
hydrophila." Chest 80(3): 264-267.
Reinhard, J. F. and W. L. George (1985). "Comparative in vitro activities of selected
antimicrobial agents against Aeromonas species and Plesiomonas shigelloides."
Renaud, F., J. Freney, J. M. Boeufgras, et al. (1988). "Carbon substrate assimilation
patterns of clinical and environmental strains of A. hydrophila, Aeromonas
sobria and A. caviae observed with a micromethod." Zentralblatt für
Bakteriologie, Mikrobiologie und Hygiene A269: 323-330.
Revord, M. E., J. Goldfarb and S. B. Shurin (1988). "Aeromonas hydrophila wound
infection in a patient with cyclic neutropaenia following a piranha bite."
Pediatric Infectious Disease Journal 7(1): 70-71.
Rhodes, G., G. Huys, J. Swings, et al. (2000). "Distribution of oxytetracycline
resistance plasmids between aeromonads in hospital and aquaculture
environments: implication of Tn1721 in dissemination of the tetarcycline
-- 298 --
resistance determinant Tet A." Applied and Environmental Microbiology 66(9):
3883-3890.
Rhodes, G., J. Parkhill, C. Bird, et al. (2004). "Complete nucleotide sequence of the
conjugative tetracycline resistance plasmid pFBAOT6, a member of a group of
IncU plasmids with global ubiquity." Applied and Environmental Microbiology
70(12): 7497-7510.
Ribardo, D. A., K. R. Kuhl, I. Boldogh, et al. (2002). "Early cell signalling by the
cytotoxic enterotoxin of Aeromonas hydrophila in macrophages." Microbial
Pathogens 32: 149-163.
Roberts, M. T. M., D. A. Enoch, K. A. Harris, et al. (2006). "Aeromonas veronii biovar
sobria bacteraemia with septic arthritis confirmed by 16S rDNA PCR in an
immunocompetent adult." Journal of Medical Microbiology 55: 241-243.
Robinson, J., V. Burke, P. J. Worthy, et al. (1984)." Media for isolation of Aeromonas
spp. from faeces." Journal of Medical Microbiology 18: 405-411.
Robinson, J., J. Beaman, L. Wagener, et al. (1986)."Comparison of direct plating with
the use of enrichment culture for isolation of Aeromonas spp. from faeces."
Robson, W. L. M., A. K. C. Leung and C. L. Trevenen (1992). "Haemolytic-uraemic
syndrome associated with Aeromonas hydrophila enterocolitis." Pediatric
Nephrology 6: 221-222.
Rodríguez-Calleja, J. M., M. L. García-Lopez, J. A. Santos, et al. (2006). "Rabbit meat
as a source of bacterial foodborne pathogens." Journal of Food Protection
69(5): 1106-1112.
Rodríguez, C. N., B. Novoa and A. Figueras (2008). "Immune response of zebrafish
(Danio rerio) against a newly isolated bacterial pathogen Aeromonas
hydrophila." Fish and Shellfish Immunology 25: 239-249.
Rodríguez, C. N., R. Campos, B. Pastran, et al. (2005). "Sepsis due to extended-
spectrum B-lactamase-producing Aeromonas hydrophila in a pediatric patient
with diarrhoea and pneumonia." Clinical Infectious Diseases 41(3): 421-422.
Rodríguez, L. A., A. E. Ellis and T. P. Nieto (1992). "Purification and characterization
of an extracellular metalloprotease, serine protease and haemolysin of
Aeromonas hydrophila strain B32: are lethal for fish." Microbial Pathogenesis
13: 17-24.
Roffey, P. E., and J. M. Pemberton (1990). "Cloning and expression of an Aeromonas
hydrophila chitinase gene in Escherichia coli. " Current Microbiology 21: 329-
337.
Roger, F., B. Lamy, E. Jumas-Bilak, et al. (2012a). "Ribosomal multi-operon diversity:
an original perspective on the genus Aeromonas." PLos One 7: e46268.
Roger, F., H. Marchandin, E. Jumas-Bilak, et al. (2012b). "Multiloccus genetics to
reconstruct aeromonad evolution." BioMedCentral Microbiology 12: 62.
Rosco Diatabs Manual (2000). 5th edition. Taastrup, Denmark
Rossolini, G. M., A. Zanchi, A. Chiesurin, et al. (1995). "Distribution of cphA or related
carbapenemase-encoding genes and production of carbapenemases activity in
members of the genus Aeromonas. " Antimicrobial Agents and Chemotherapy
39: 346-349.
Rossolini, G. M., T. Walsh and G. Amicosante (1996). "The Aeromonas metallo-B-
lactamases: genetics, enzymology, and contribution to drug resistance."
Microbial Drug Resistance 2(2): 245-252.
Royle, J. A., D. Isaacs, G. Eagles, D. Cass, N. Gilroy, S. Chen, D. Malouf and C.
Griffiths (1997). "Infections after shark attacks in Australia." Pediatric
-- 299 --
Ruíz de Gonzalez, P., C. Escolano, J. C. Rodríguez, et al. (1994). "Aeromonas sobria
spontaneous bacterial peritonitis and bacteraemia." American Journal of
Gastroenterology 89: 290-291.
Rust, L., C. R. Messing and B. H. Iglewski (1994). "Elastase assays." Methods in
Enzymology 235: 554-562.
Saavedra, M. J., V. Perea, M. C. Fontes, et al. (2007). "Phylogenetic identification of
Aeromonas strains isolated from carcasses of pig as new members of the
species Aeromonas allosaccharophila." Antonie van Leeuwenhoek 91: 159-
167.
Saavedra, M. J., M. J. Figueras and A. J. Martínez-Murcia (2006). "Updated phylogeny
of the genus Aeromonas." International Journal of Systematic and
Saha, P. and T. Chakrabarti (2006). "Aeromonas sharmana sp. nov., isolated from a
warm spring." International Journal of Systematic and Evolutionary
Saitou, N. and M. Nei (1987). "The neighbour-joining method: a new method for
reconstructing phylogenetic trees." Molecular Biology and Evolution 4(4): 406-
425.
San Joaquín, V. H. and D. A. Pickett (1988). "Aeromonas-associated gastroenteritis in
children." Pediatric Infectious Diseases 7: 53-57.
Sánchez-Céspedes, J., M. D. Blasco, S. Marti, et al. (2008). "Plasmid-mediated QnrS2
determinant from a clinical Aeromonas veronii isolate." Antimicrobial Agents
and Chemotherapy 52(8): 2990-2991.
Sánchez-Céspedes, J., M. J. Figueras, C. Aspiroz, et al. (2009). "Development of
imipenem resistance in an Aeromonas veronii biovar sobria clinical isolate
recovered from a patient with cholangitis." Journal of Medical Microbiology
58: 451-455.
Santos, J. A., C. J. Gonzalez, A. Otero, et al. (1999). "Haemolytic activity and
siderophore production in different Aeromonas species isolated from fish."
Santos, P. G., P. A. Santos, A. R. Bello, et al. (2010). "Association of Aeromonas
caviae polar and lateral flagella with biofilm formation." Letters in Applied
Satta, G., P. E. Varaldo, G. Grazi, et al. (1977). "Bacteriolytic activity in
staphylococci." Infection and Immunity 16(1): 37-42.
Sawle, G. V., B. C. Das, P. R. Acland, et al. (1986). "Fatal infection with Aeromonas
sobria and Plesiomonas shigelloides." British Medical Journal 292: 525-526.
Schaefer, A. L., D. L. Val, B. L. Hanzelka, et al. (1996). “Generation of cell-to-cell
signals in quorum-sensing: acyl homoserine lactone synthase activity of a
purified Vibrio fischeri LuxI protein.” Proceeding of the National Academy of
Sciences of the United States of America 93(18): 9505-9509.
Scheffer, J., W. Konig, V. Braun, et al. (1988). "Comparison of four haemolysin-
producing organisms (Escherichia coli, Serratia marcescens, Aeromonas
hydrophila and Listeria monocytogenes) for release of inflammatory mediators
from various cells." Journal of Clinical Microbiology 26(3): 544-551.
Schoenhofen, I., C. C. Stratilo and S. P. Howard (1998). "An ExeAB complex in the
type II secretion pathway of Aeromonas hydrophila: effect of ATP-binding
cassette mutations on complex formation and function." Molecular
Schreier, J. C. (1969). "Modification of DNase test medium for rapid identification of
Serratia marcescens." American Journal of Clinical Pathology 51: 711-716.
-- 300 --
Schröder, G. and E. Lanka (2005). "The mating pair formation system of conjugative
plasmids - a versatile secretion machinery for transfes of proteins and DNA."
Plasmid 54: 1-25.
Schubert, R. H. W. (1967a). "The taxonomy and nomenclature of the genus Aeromonas
Kluyver and van Niel 1936. Part I. Suggestions on the taxonomy and
nomenclature of the aerogenic Aeromonas species." International Journal of
Systematic Bacteriology 17: 23.
Schubert, R. H. W. (1967b). "The taxonomy and nomenclature of the genus Aeromonas
Kluyver and van Niel 1936. Part II. Suggestions on the taxonomy and
nomenclature of the anaerogenic Aeromonas species." International Journal of
Systematic Bacteriology 17: 273.
Schubert, R. H. W. (1987). "Ecology of aeromonads and isolation from environmental
samples." Experientia 43: 351-354.
Schubert, R. H. W. (1968). "The taxonomy and nomenclature of the genus Aeromonas
Kluyver and Van Niel 1936." International Journal of Systematic Bacteriology
18(1): 1-7.
Schubert, R. H. W. and M. Hegazi (1988). "Aeromonas eucrenophila species nova
Aeromonas caviae a later and illegitimate synonym of Aeromonas punctata."
Zentrablatt Bakteriologie Hygiene A268: 34-39.
Schubert, R. H. W., M. Hegazi and W. Wahlig (1990a). "Aeromonas ichtiosmia species
nova." Hygiene and Medicine 15: 477-479.
Schubert, R. H. W., M. Hegazi and W. Wahlig (1990b). "Aeromonas enteropelogenes
species nova." Hygiene and Medicine 15: 471-472.
Schubert, R. H. W. (1974). "Genus II. Aeromonas.” In Buchanan and Gibbons (Editors),
Bergey’s Manual of Determinative Bacteriology, 8th Ed., The Williams and
Wilkins Co., Baltimore, 345-348.
Schubert, R. H. W. (1991). "Aeromonads and their significance as potential pathogens
in water." Journal of Applied Bacteriology Sym. Supp. 70: 131S-135S.
Schultz, A. J. and B. A. McCardell (1988). "DNA homology and immunological cross-
reactivity between Aeromonas hydrophila cytotonic toxin and cholera toxin."
Journal of Clinical Microbiology 26: 57-61.
Schwenteit, J., L. Gram, K. F. Nielsen, et al. (2010). "Quorum sensing in Aeromonas
salmonicida subsp. achromogenes and the effect of the autoinducer synthase
AsaI on bacterial virulence." Veterinary Microbiology 147: 389-397.
Scott, E. G., C. M. Russell, K. T. Noell, et al. (1978). "Aeromonas hydrophila sepsis in
a previously healthy man." Journal of the American Medical Association
239(17): 1742.
Sechi, L. A., A. Deriu, M. P. Falchi, et al. (2002). "Distribution of virulence genes in
Aeromonas spp. isolated from Sardinian waters and from patients with
diarrhoea." Journal of Applied Microbiology 92: 221-227.
Sedláček, I., E. Krejčí, A. Andělová, et al. (2012). "Aeromonas hydrophila subsp.
dhakensis a causative agent of gastroenteritis imported into the Czech
Republic." Annals of Agriculture and Environmental Medicine 19(3): 409-
413.
Seetha, K. S., B. T. Jose and A. Jasthi (2004). "Meningitis due to Aeromonas
hydrophila." Indian Journal of Medical Microbiology 22(3): 191-192.
Segatore, B., O. Massidda, G. Satta, et al. (1993). "High specificity of cphA-encoded
metallo-B-lactamase from Aeromonas hydrophila AE036 for carbapenems and
its contribution to B-lactam resistance." Antimicrobial Agents and
Chemotherapy 37: 1324-1328.
-- 301 --
Seidler, R. J., D. A. Allen, H. Lockman, et al. (1980). "Isolation, enumeration, and
characterization of Aeromonas from polluted waters encountered in diving
operations." Applied and Environmental Microbiology 39(5): 1010-1018.
Sen, K. and M. Rodgers (2004). “Distribution of six virulence factors in Aeromonas
species isolated from US drinking water utilitiies: a PCR identification.”
Journal of Applied Microbiology 97:1077-1086.
Sen, K. (2005). "Development of a rapid identification method for Aeromonas species
by multiplex-PCR." Canadian Journal of Microbiology 51(11): 957-966.
Sen, K. and D. Lye (2007). "Importance of flagella and enterotoxins for Aeromonas
virulence in a mouse model." Canadian Journal of Microbiology 53: 261-269.
Senderovich, Y., S. Ken-Dror, I. Vainblat, et al. (2012). "A molecular study on the
prevalenece and virulence potential of Aeromonas spp. recovered from patients
suffering from diarrhoea in Israel." PloS One 7(2): 1-6.
Senderovich, Y., Y. Gershtein, E. Halewa, et al. (2008). "Vibrio cholerae and
Aeromonas: do they share a mutual host." International Society for Microbial
Ecology 2: 276-283.
Sepe, A., P. Barbieri, R. Peduzzi, et al. (2008). "Evaluation of recA sequencing for the
classification of Aeromonas strains at the genotype level." Letters in Applied
Seshadri, K., S. W. Joseph, A. K. Chopra, et al. (2006). "Genome sequence of
Aeromonas hydrophila ATCC 7966: the jack of all trades." Journal of
Bacteriology 188(23): 8272-8282.
Sha, J., C. L. Galindo, V. Pancholi, et al. (2003). "Differential expression of the enolase
gene under in vivo versus in vitro growth conditions of Aeromonas
Sha, J., E. V. Kozlova and A. K. Chopra (2002). "Role of various enterotoxins in
Aeromonas hydrophila-induced gastroenteritis: generation of enterotoxin gene-
deficient mutans and evaluation of their enterotoxin activity." Infection and
Immunity 70(4): 1924-1935.
Sha, J., L. Pillai, A. A. Fadl, et al. (2005). "The type III secretion system and cytotoxic
enterotoxin alter the virulence of Aeromonas hydrophila " Infection and
Immunity 73(10): 6446-6457.
Sha, J., M. Lu and A. K. Chopra (2001). "Regulation of the cytotoxic enterotoxin gene
in Aeromonas hydrophila characterisation of an iron uptake regulator."
Sha, J., S. F. Wang, G. Suarez, et al. (2007). "Further characterization of a type III
secretion system (T3SS) and of a new effector protein froma clinical isolate of
Aeromonas hydrophila - Part I." Microbial Pathogens 43: 127-146.
Sha, J., T. E. Erova, R. A. Alyea, et al. (2009). "Surface-expressed enolase contributes
to the pathogenesis of clinical isolate SSU of Aeromonas hydrophila." Journal
of Bacteriology 191(9): 3095-3107.
Sha, J., J. A. Rosenzweig, E. V. Kozlova, et al. (2013). "Evaluation of the roles played
by Hcp and VgrG type 6 secretion system effectors in Aeromonas hydrophila
SSU pathogenesis.” Microbiology 159(6): 1120–1135.
Shannon, K., A. King and I. Phillips (1986). "Beta-lactamases with high activity against
imipenem and Sch 34343 from Aeromonas hydrophila." Journal of
Antimicrobial Therapy 17: 45-50.
Sharma, A., N. Dubey and B. Sharan (2005). "Characterization of aeromonads isolated
from the river Narmada, India." International Journal of Hygiene and
Environmental Health 208: 425-433.
-- 302 --
Shaw, D. H. and H. J. Hodder (1978). "Lipopolysaccharides of the motile aeromonads;
core oligosaccharide analysis as an aid to taxonomic classification." Canadian
Shaw, J. G., J. P. Thornley, I. Palmer, et al. (1995). "Invasion of tissue culture cells by
A. caviae." Medical Microbiology Letters 4: 324-331.
Sherlock, C. H., D. R. Burdge and J. A. Smith (1987). "Does Aeromonas hydrophila
preferentially colonized the bowels of patients with haematologic
malignancies?." Diagnostic Microbiology and Infectious Disease 7: 63-68.
Shieh, H. S. (1987). "Protection of Atlantic salmon against motile aeromonad
septicaemia with Aeromonas hydrophila protease." Microbiology Letters 36:
133-138.
Shimada, T., R. Sakazaki, K. Horigome et al. (1984). "Production of cholera-like
enterotoxin by Aeromonas hydrophila." Japanese Journal of Medical Science
and Biology 37: 141-144.
Shotts, E. B., T. C. Hsu and W. D. Waltman (1985). "Extracellular proteolytic activity
of Aeromonas hydrophila complex." Fish Pathogens 20(1): 37-44.
Sierra, J. C., G. Suarez, J. Sha, et al. (2007). "Biological characterization of a new type
III secretion system effector from a clinical isolate of Aeromonas hydrophila -
Part II." Microbial Pathogens 43: 147-160.
Silver, A. C., N. M. Rabinowitz, S. Küffer, et al. (2007). "Identification of Aeromonas
veronii genes required for colonization by the medicinal leech, Hirudo
verbana." Journal of Bacteriology 189: 6763-6772.
Simidu, U., K. Ashino and E. Kaneko (1971). "Bacterial flora of phyto-and zoo-
plankton in the inshore water of Japan." Canadian Journal of Microbiology 17:
1157-1160.
Singh, D. V. and S. C. Sanyal (1992a). "Enterotoxicity of clinical and environmental
isolates of Aeromonas spp." Journal of Medical Microbiology 36: 269-272.
Singh, D. V. and S. C. Sanyal (1992b). "Haemolysin and enterotoxin production by
Aeromonas caviae isolated from diarrhoeal patients, fish and environment."
Journal of Diarrhoeal Disease Research 10(1): 16-20.
Singh, D. V. and S. C. Sanyal (1992c). "Production of haemolysis and its correlation
with enterotoxicity in Aeromonas spp." Journal of Medical Microbiology 37:
262-267.
Singh, D. V. and S. C. Sanyal (1999). "Virulence patterns of Aeromonas eucrenophila
isolated from water and infected fish." Journal of Diarrhoeal Disease Research
17(1): 37-42.
Sinha, S., S. Chattopadhyay, S. K. Bhattacharya, et al. (2004). "An unusually high level
of quinolone resistance associated with type II topoisomerase mutations in
quinolone resistance-determining regions of Aeromonas caviae isolated from
diarrhoeal patients." Research in Microbiology 155: 827-829.
Sirinavin, S., S. Likitnukul and S. Lolekha (1984). "Aeromonas septicaemia in infants
and children." Pediatric Infectious Diseases 3(2): 122-124.
Sitrit, Y., C. E. Vorgias, I. Chet, et al. (1995). "Cloning and primary structure of the
chiA gene from Aeromonas caviae." Journal of Bacteriology 177(14): 4187-
4189.
Sletyr, U. B. and P. Messner (1983). "Crystalline surface layers on bacteria." Annual
Reviews in Microbiology 37: 311-319.
Smith, I. W. (1963). "The classification of Bacterium salmonicida." Journal of General
Microbiology 33: 263.
Smith, J. A. (1980a). "Aeromonas hydrophila: analysis of 11 cases." Canadian Medical
Association Journal 122: 1270-1272.
-- 303 --
Smith, J. A. (1980b). "Ocular Aeromonas hydrophila " American Journal of
Sniezko, S. F. (1957). "The genus Aeromonas Kluyver and Van Neil 1936." In: R. S.
Breed, E. G. D. Murray, and N. R. Smith (eds.), Bergey's Manual of
Determinative Bacteriology p. 189-193. Williams and Wilkins Co. Baltimore,
MD.
Snowden, L., L. Wernbacher, D. Stenzel, et al. (2006). "Prevalence of environmental
Aeromonas in South East Queensland, Australia: a study of their interactions
with human monolayer Caco-2 cells." Journal of Applied Microbiology 101:
964-975.
Snower, D. P., C. Ruef, A. P. Kuritza, et al. (1989). "Aeromonas hydrophila infection
associated with the use of medicinal leeches." Journal of Clinical Microbiology
27(6): 1421-1422.
Sohn, H. J., D. N. Nam, Y. S. Kim, et al. (2007). "Endogenous Aeromonas hydrophila
endophthalmitis in an immunocompromised patient." Korean Journal of
Solaro, L. and J. Michael (1986). "Aeromonas hydrophila peritonitis in a renal
transplant recipient." Journal of Infection 13(3): 300-301.
Soler, L., M. A. Yañez, M. R. Chacón, et al. (2004). "Phylogenetic analysis of the genus
Aeromonas based on two housekeeping genes." International Journal of
Soler, L., M. J. Figueras, M. R. Chacón, et al. (2003a). "Comparison of three molecular
methods for typing Aeromonas popoffii isolates." Antonie van Leeuwenhoek
83: 341-349.
Soler, L., F. Marco, J. Vila, et al. (2003b). “Evaluation of two miniaturized systems,
MicroScan W/A and BBL Crystal E/NF, for the identification of clinical isolates
of Aeromonas spp.” Journal of Clinical Microbiology 41: 1511-1519.
Soler, L., M. J. Figueras, M. R. Chacón, et al. (2002). "Potential virulence and
antimicrobial susceptibility of Aeromonas popoffii recovered from freshwater
and seawater." FEMS Immunology and Medical Microbiology 32: 243-247.
Soutourina, O. A. and P. N. Bertin (2003). "regulation cascade of flagellar expression in
Gram-negative bacteria." FEMS Microbiology Reviews 27(4): 505-523.
Stackebrandt, E. and B. M. Goebel (1994). "Taxonomic note: a place for DNA-DNA
reassociation and 16S rRNA sequence analysis in the present species definition
in Bacteriology." International Journal of Systematic Bacteriology 44(4): 846-
849.
Stackebrandt, E., W. Fredericksen, G. M. Garrity, et al. (2002). "Report of the ad hoc
committee for the re-evaluation of the species definition in bacteriology."
1047.
Stanier, R. Y. (1943). "A note of the taxonomy of Proteus hydrophilus." Journal of
Stephenson, J. R., S. E. Millership and S. Tabaqchali (1987). "Typing of Aeromonas
species by polyacrilamide-gel electrophoresis of radiolabelled cell proteins."
Stintzi, A. and K. N. Raymond (2000). "Amonobactin-mediated iron acquisition from
transferrin and lactoferrin by Aeromonas hydrophila: direct measurement of
individual of microscopic rate constants." Journal of Biological Inorganic
Chemistry 5: 57-66.
Stuber, K., S. E. Burr, M. Braun, et al. (2003). "Type III secretion genes in Aeromonas
salmonicida subsp. salmonicida are located on a large thermolabile virulence
plasmid." Journal of Clinical Microbiology 41(8): 3854-3856.
-- 304 --
Suarez, G., J. C. Sierra, J. M. L. Kirtley, et al. (2010a). "Role of Hcp, a type 6 secretion
system effector, of Aeromonas hydrophila in modulating activation of host
immune cells." Microbiology 156: 3678-3688.
Suarez, G., J. C. Sierra, J. Sha, et al. (2008). "Molecular characterization of a functional
type VI secretion system from a clinical isolate of Aeromonas hydrophila."
Suarez, G., J. C. Sierra, T. E. Erova, et al. (2010b). "A type VI secretion system effector
protein, VgrG1, from Aeromonas hydrophila that induces host cell toxicity by
ADP ribosylation of actin." Journal of Bacteriology 192(1): 155-168.
Subashkumar, R., T. Thayumanavan, G. Vivekanandhan, et al. (2006). "Occurrence of
Aeromonas hydrophila in acute gastroenteritis among children." Indian Journal
of Medical Research 123: 61-66.
Swift, S., A.V. Karlyshex, L. Fish, et al. (1997). "Quorum sensing in Aeromonas
hydrophila and Aeromonas salmonicida: identification of the LuxRI homologs
AhyRI and AsaRI and their cognate N-acylhomoserine lactone signal
molecules." Journal of Bacteriology 179(17): 5271-5281.
Swift, S., M. J. Lynch, L. Fish, et al. (1999b). "Quorum sensing-dependent regulation
and blockade of exoprotease production in Aeromonas hydrophila." Infection
and Immunity 67: 5192-5199.
Swift, S., P. Williams and G. S. A. B. Stewart Ed. (1999a). "N-Acylhomoserine lactones
and quorum sensing in proteobacteria:" In Cell-cell signalling in Bacteria. eds,
G. M. Dunny and S. C. Winans, (eds). Washington, DC: American Society for
Microbiology Press, pp. 291-314.
Szabo, E. A., K. J. Scurrah and J. M. Burrows (2000). "Survey for psychotrophic
bacterial pathogens in minimally processed lettuce." Letters in Applied
Szczuka, E. and A. Kaznowski (2004). "Typing of clinical and environmental
Aeromonas sp. strains by Ramdom Amplified Polymorphic DNA PCR,
Repetitive Extragenic Palindromic PCR, and Enterobacterial Repetitive
Intergenic Consensus Sequence PCR." Journal of Clinical Microbiology 42(1):
220-228.
Szczuka, E. and A. Kaznowski (2007). "Characterization of Aeromonas caviae and A.
veronii by standardized cellular protein electrophoresis patterns." Folia
Microbiologica 52(1): 65-69.
Takahashi, A., M. Nakano, K. Okamoto, et al. (2006). "Aeromonas sobria haemolysin
causes diarrhoea by increasing secretion of HCO3-." FEMS Microbiology
Letters 258: 92-95.
Takahashi, E., H. Ozaki, Y. Fujii, et al. (2014). “Properties of hemolysin and protease
produced by Aeromonas trota.” Plos One DOI: 10.1371/journal.pone.0091149.
Takano, Y., Y. Asao, Y. Kohri, et al. (1996). "Fulminant pneumonia and sepsis due to
Aeromonas hydrophila in an alcohol abuser." Internal Medicine 35(5): 410-
412.
Talon, D., M. J. Dupont, J. Lesne, et al. (1996). "Pulse-field gel electrophoresis as an
epidemiological tool for clonal identification of Aeromonas hydrophila."
Journal of Applied Bacteriology 80: 277-280.
Tamura, K., J. Dudley, M. Nei, et al. (2007)."MEGA4: molecular evolutionary genetics
analysis (MEGA) software version 4.0." Molecular Biology and Evolution 24:
1596-1599.
Tamura, K., D. Peterson, N. Peterson, et al. (2011). "MEGA5: Molecular Evolutionary
Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and
Maximum Parsimony Methods." Molecular Biology and Evolution 28: 2731-
2739.
-- 305 --
Taneja, N., S. Khurana, A. Trehan, et al. (2004). “An outbreak of hospital acquired
diarrhoea due to Aeromonas sobria.” Indian Pediatrics 41(9): 912-916.
Tayler, A. E., J. A. Ayala, P. Niumsup, et al. (2010). "Induction of B-lactamase
production in Aeromonas hydrophila is responsive to B-lactam-mediated
changes in peptidoglycan composition." Microbiology 156: 2327-2335.
Tena, D., A. Gonzalez-Praetorius, C. Gimeno, et al. (2007). "Infeccion extraintestinal
por Aeromonas spp.: revision de 38 casos." Enfermedades Infecciosas en
Microbiología Clinica 25(4): 235-241.
Thangaviji, V., M. Michaelbabu, S. Balakrishnan Anand, et al. (2012). "Immunization
with the Aeromonas OMP provides protection against Aeromonas hydrophila
in goldfish (Carassius auratus)." Journal of Microbial & Biochemical
Technology 4: 045-049.
Thomas, S. R. and T. J. Trust (1995). "Tyrosine phosphorylation of the tetragonal
paracrystalline array of Aeromonas hydrophila: molecular cloning and high-
level expression of the S-layer protein gene." Journal of Molecular Biology
245: 568-581.
Thomas, S. R., P. Lutwyche and T. J. Trust (1997). "S-layer and homogeneous length
lipopolysaccharide O-polysaccharide chains contribute to the ability of
Aeromonas hydrophila to produce lethal disease in rainbow trout." FEMS
Microbiology Letters 154(1): 1-7.
Thompson, J. D., D. G. Higgins and T. J. Gibson (1994). "CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice." Nucleic
Acids Research 22: 4673-4680.
Thompson, J. D., T. J. Gibson, F. Plewniak, et al. (1997). "The CLUSTAL_X windows
interface: flexible strategies for multiple sequence alignment aided by quality
analysis tools." Nucleic Acids Research 25(24): 4876-4882.
Thompson, C. C., F. L. Thompson, K.Vandemeulebroecke, et al. (2004). "Use of recA
as an alternative phylogenetic marker in the family Vibrionaceae."
929.
Thornley, J. P., J. G. Shaw, I. A. Gryllos, et al. (1997). "Virulence properties of
clinically significant Aeromonas species: evidence for pathogenicity." Reviews
in Medical Microbiology 8(2): 61-72.
Thornton, J., S. P. Howard and J. T. Buckley (1988). "Molecular cloning of a
phospholipd-cholesterol acyltransferase from Aeromonas hydrophila. Sequence
homologies with lecithin-cholesterol acyltransferase and other lipases."
Biochimica et Biophysica Acta 959: 153-159.
Tindall, B. J., R. Rosselló-Mora, H. J. Busse, et al. (2010). "Notes on the
characterization of prokaryote strains for taxonomic purposes." International
Titball, R. W. and C. B. Munn (1985). "The purification and some properties of H-lysin
from Aeromonas salmonicida." Journal of General Microbiology 131: 1603-
1609.
Todd, L. S., J. C. Hardy, M. F. Stringer, et al. (1989). "Toxin production by strains of
Aeromonas hydrophila grown in laboratory media and prawn puree."
International Journal of Food Microbiology 9: 145-156.
Travis, L. B. and J. A. Washington (1985). "The clinical significance of stool isolates of
Aeromonas." American Journal of Clinical Pathology 85: 330-336.
Trower, C. J., S. Abo, K. N. Majeed, et al. (2000). "Production of an enterotoxin by a
gastroenteritis-associated Aeromonas strain." Journal of Medical Microbiology
49: 121-126.
-- 306 --
Trust, T. J. and R. A. H. Sparrow (1974). "The bacterial flora in the alimentary tract of
freshwater salmonid fishes." Canadian Journal of Microbiology 20: 1219-
1228.
Trust, T. J., W. W. Kay and E. E. Ishiguro (1983). "Cell surface hydrophobicity and
macrophage association of Aeromonas salmonicida." Current Microbiology 9:
315-318.
Tsai, G. J. and T. H. Chen (1996). "Incidence and toxigenicity of Aeromonas hydrophila
in seafood." International Journal of Food Microbiology 31: 121-131.
Tsai, M. S., C. Y. Kuo, M. C. Wang, et al. (2006). "Clinical features and risk factors for
mortality in Aeromonas bacteremic adults with haemotologic malignancies."
Journal of Microbiology, Immunology and Infection 39: 150-154.
Turnbull, P. C. B., J. V. Lee, M. D. Miliotis, et al. (1984). "Enterotoxin production in
relation to taxonomic groupings and source of isolation of Aeromonas species."
Ueda, M., A. Fujiwara, T. Kawaguchi, et al. (1995). "Purification and some properties
of six chitinases from Aeromonas sp. No. 10S-24." Bioscience, Biotechnology
and Biochemistry 59: 2162-2164.
Ueda, M. and M. Arain (1992). "Purification and some properties of B-N-
acetylglucosaminidase from Aeromonas sp. 10S-24." Bioscience,
Biotechnology and Biochemistry 56: 1204-1297.
Ullmann, D., G. Krause, D. Knabner, et al. (2005). "Isolation and characterization of
potentially human pathogenic, cytotoxin-producing Aeromonas strains from
retailed seafood in Berlin, Germany." Journal of Veterinary Medicine B 52: 82-
87.
United States Environmental Protection Agency USEPA (1998). Guidelines for
ecological risk assessment. Announcement of the drinking water contaminant
candidate list. Federal Register: 63(03): 10247-10287.
Urdiain, M., A. López-López, C. Gonzalo, et al. (2008). "Reclassification of
Rhodobium marinum and Rhodobium pfenningii asAfifella marina gen. nov.
comb. nov. and Afifella pfenningii comb.nov., a new genus of
photoheterotrophic Alphaproteobacteria and emended descriptions of
Rhodobium, Rhodobium orientis and Rhodobium gokarnense." Systematic and
Vadivelu, J., S. D. Puthucheary and P. Navaratnam (1991). "Exotoxin profiles of
clinical isolates of Aeromonas hydrophila." Journal of Medical Microbiology
35: 363-367.
Valera, L. and C. Esteve (2002). "Phenotypic study by numerical taxonomy of strains
belonging to the genus Aeromonas." Journal of Applied Microbiology 93: 77-
95.
Vally, H., A. Whittle, S. Cameron, et al. (2004). "Outbreak of Aeromonas hydrophila
wound infections associated with mud football." Clinical Infectious Diseases
38: 1084-1089.
Van der Kooij, D. and W. A. M. Hijnen (1988). "Nutritional versatility and growth
kinetics of an Aeromonas hydrophila strain isolated from drinking water."
Van Houdt, R., A. Aertsen and C. W. Michiels (2007). "Quorum-sensing-dependent
switch to butanediol fermentation prevents lethal medium acidification in
Aeromonas hydrophila AH-IN." Research in Microbiology 158: 379-385.
Van Houdt, R. and C. W. Michiels (2010). “Biofilm formation and the food industry, a
focus on the bacterial outer surface.” Journal of Applied Microbiology p 1-15
doi:10.1111/j.1365-2672.2010.04756.x.
-- 307 --
Veron, M. and F. Gasser (1963)."Sur la detection de l'hydrogene sulfure produit par
certaines enterobacteriacees dans les milieux dits de diagnostic rapide." Annals
of the Institute Pasteur 105: 524-534.
Vila, J., F. Marco, L. Soler, et al. (2002). "In vitro antimicrobial susceptibility of
clinical isolates of Aeromonas caviae, A. hydrophila and Aeromonas veronii
biotype sobria." Journal of Antimicrobial Chemotherapy 49: 697-702.
Vila, J., J. Ruíz, F. Gallardo, et al. (2003). "Aeromonas spp. and traveler's diarrhea:
clinical features and antimicrobial resistance." Emerging Infectious Diseases
9(5): 552-555.
Vilches, S., C. Urgell, S. Merino, et al. (2004). "Complete type III secretion system of a
mesophilic Aeromonas hydrophila strain." Applied and Environmental
Microbiology 70(11): 6914-6919.
Vilches, S., N. Jimenez, J. M. Tomas, et al. (2009). "Aeromonas hydrophila AH-3 type
III secretion system expression and regulatory network." Applied and
Vilches, S., R. Canals, M. Wilhems, et al. (2007). "Mesophilic Aeromonas UDP-
glucose pyrophosphorylase (GaIU) mutants show two types of
lipopolysaccharide structures and reduced virulence." Microbiology 153: 2393-
2404.
Villari, P., M. Crispino, P. Montuori, et al. (2003). "Molecular typing of Aeromonas
isolates in natural mineral waters." Applied and Environmental Microbiology
69 (1): 697-701.
Villari, P., M. Crispino, P. Montuori, et al. (2000). "Prevalence and molecular
characterization of Aeromonas spp. in ready-to-eat foods in Italy." Journal of
Food Protection 63(12): 1754-1757.
Vipond, R., I. R. Bricknell, E. Durant, et al. (1998). "Defined deletion mutans
demonstrate that the major secreted toxins are not essential for the virulence of
Aeromonas salmonicida." Infection and Immunity 66: 1990-1998.
Vivas, J., B. E. Razquin, P. Lopez-Fierro, et al. (2004). "Correlation between
production of acyl homoserine lactones and proteases in an Aeromonas
hydrophila aroA live vaccine." Veterinary Microbiology 101: 167-176.
von Graevenitz, A. (2007). "The role of Aeromonas in diarrhoea: a review." Infection
35(2): 59-64.
von Graevenitz, A., G. J. Osterhout and J. D. Dick (1991). "Grouping of some clinically
relevant Gram-positive rods by automated fatty acid analysis." Acta
Pathologica, Microbiologica et Immunologica Scandinavica 99: 147-154.
von Graevenitz, A., and L. Zinterhofer (1970). "The detection of Aeromonas hydrophila
in stool specimens." Health Laboratory Science 7: 124-127.
von Graevenitz, A., and A. H. Mensch (1968). "The genus Aeromonas in human
bacteriology." New England Journal of Medicine 278(3): 245-249.
Wadström, T., A. Ljungh and B. Wretlind (1976). "Enterotoxin, haemolysin and
cytotoxic protein in Aeromonas hydrophila from human infections." Acta
Pathologica, Microbiologica Scandinavica Sect. B, 84: 112-114.
Wahli, T., S. E. Burr, D. Pugovkin, et al. (2005). "Aeromonas sobria, a causative agent
of disease in farmed perch, Perca fluviatilis L." Journal of Fish Diseases 28:
141-150.
Wakabayashi, H., K. Kanai, T. C. Hsu, et al. (1981). "Pathogenic activities of
Aeromonas hydrophila biovar hydrophila (Chester) Popoff and Veron, 1976 to
fishes." Fish Pathogens 15(3/4): 319-325.
Walsh, T. R., R. A. Stunt, J. A. Nabi, et al. (1997). "Distribution and expression of B-
lactamase genes among Aeromonas spp." Journal of Antimicrobial Therapy 40:
171-178.
-- 308 --
Walsh, T. R., S. Gamblin, D. C. Emery, et al. (1996). "Enzyme kinetics and
biochemical analysis of ImiS, the metallo-B-lactamase from Aeromonas sobria
163a." Journal of Antimicrobial Chemotherapy 37: 423-431.
Walsh, T. R., W. A. Neville, M. H. Hara, et al. (1998). "Nucleotide and amino acid
sequences of the metallo-B-lactamase, ImiS, from Aeromonas veronii bv.
sobria." Antimicrobial Agents and Chemotherapy 42: 436-439.
Wang, G., C. G. Clark, C. Liu, et al. (2003). "Detection and characterization of the
haemolysin genes in Aeromonas hydrophila and Aeromonas sobria by
multiplex PCR." Journal of Clinical Microbiology 41(3): 1048-1054.
Wang, G., K. D. Tyler, C. K. Munro, et al. (1996). "Characterization of cytotoxic,
haemolytic Aeromonas caviae clinical isolates and their identification by
determining presence of a unique haemolysis gene." Journal of Clinical
Microbiology 34(12): 3203-3205.
Washington, J. A. (1972). "Aeromonas hydrophila in clinical bacteriologic specimens."
Annals of Internal Medicine 76: 611-614.
Washington, J. A. I. (1973). "The role of Aeromonas hydrophila in clinical infection."
Infectious Diseases Reviews 2: 75-86.
Watanabe, N., K. Morita, T. Furukawa, et al. (2004). "Sequence analysis of amplified
DNA fragments containing the region encoding the putative lipase substrate-
binding domain and genotyping of Aeromonas hydrophila." Applied and
Watson, I. M., J. O. Robinson, V. Burke, et al. (1985). "Invasiveness of Aeromonas spp.
in relation to biotype, virulence factors, and clinical features." Journal of
Wauters, G. (1973). "Improve methods for the isolation and recognition of Yersinia
enterocolitica." Control Microbiology and Immunology 2: 68-70.
Wayne, L. G., D, J, Brenner, R. R. Colwell, et al. (1987)." International committee on
systematic bacteriology. Report of the ad hoc committee on reconciliation of
approaches to bacterial systematics." International Journal of Systematic
Whitby, P. W., M. Landon and G. Coleman (1992). "The cloning and nucleotide
sequence of the serine protease gene (aspA) of Aeromonas salmonicida ssp.
salmonicida." FEMS Microbiology Letters 99: 65-72.
Whitlock, M. R., P. M. O'Hare, R.Sanders, et al. (1983). "The medicinal leech and its
use in plastic surgery: a possible cause for infection." British Journal of Plastic
Surgery 36: 240-244.
Wilcox, M. H., A. M. Cook, A. Eley, et al. (1992). "Aeromonas sp. as a potential cause
of diarrhoea in children." Journal of Clinical Pathology 45: 959-963.
Wilcox, R. A., G. K. Chin and M. Segasothy (2000). "Aeromonas hydrophila infection
secondary to an electrical burn." Medical Journal of Australia 173: 219-220.
Wilhelms, M., R. Molero, J. G. Shaw, et al. (2011). "Transcriptional hierarchy of
Aeromonas hydrophila polar-flagellum genes." Journal of Bacteriology
193(19): 5179-5190.
Williams, S. G., L. T. Varcoe, S. R. Attridge, et al. (1996). "Vibrio cholerae Hcp, a
secreted protein coregulated with HlyA." Infection and Immunity 64: 238-289.
Wong, C. Y. F., G. Mayrhofer, M. W. Heuzenroeder, et al. (1996). "Measurement of
virulence of aeromonads using a suckling mouse model of infection." FEMS
Immunology and Medical Microbiology 15: 233-241.
Wong, C. Y. F., M. W. Heuzenroeder, D. M. Quinn, et al. (1997). "Cloning and
characterization of two immunophilin-like genes ilpA and fkpA, on a single 3.9-
kilobase fragment of Aeromonas hydrophila genomic DNA." Journal of
Bacteriology 179(11): 3397-3403.
-- 309 --
Wong, C. Y. F., M. W. Heuzenroeder and R. L. P. Flower (1998). "Inactivation of two
haemolytic toxin genes in Aeromonas hydrophila attenuates virulence in a
suckling mouse model." Microbiology 144: 291-298.
Wretlind, B. and L. Heden (1973). "Formation of extracellular haemolysin by
Aeromonas hydrophila in relation to protease and staphylolytic enzyme."
Journal of General Microbiology 78: 57-65.
Wu, C. J., H. C. Lee, T. T. Chang, et al. (2009). "Aeromonas spontaneous bacterial
peritonitis: a highly fatal infectious disease in patients with advanced lliver
cirrhosis." Journal of the Formosa Medical Association 108: 293-300.
Wu, C. J., J. J. Wu, J. J. Yan, et al. (2007). "Clinical significance and distribution of
putative virulence markers of 116 consecutive clinical Aeromonas isolates in
southern Taiwan." Journal of Infection 54: 151-158.
Wu, C. J., P. L. Chen, J. J. Wu, et al. (2012). "Distribution and phenotypic and
genotypic detection of a metallo-B-lactamase, CphA, among bacteraemic
Aeromonas isolates." Journal of Medical Microbiology 61: 712-719.
Wu, C. J., Y. C. Chuang, M. F. Lee, et al. (2011). "Bacteraemia due to extended-
spectrum-B-lactamase-producing Aeromonas species at a medical centre in
Southern Taiwan." Antimicrobial Agents and Chemotherapy 55(12): 5813-
5818.
Wu, M. L., Y. C. Chuang, J. P. Chen, et al. (2001). "Identification and characterization
of the three chitin-binding domains within the multidomain chitinase chi92
from Aeromonas hydrophila JP101." Applied and Environmental Microbiology
67: 5100-5106.
Xu, X. J., M. R. Ferguson, V. L. Popov, et al. (1998). "Role of a cytotoxic enterotoxin
in Aeromonas-mediated infections: development of transposon and isogenic
mutants." Infection and Immunity 66(8): 3501-3509.
Yabuki, M., K. Mizushina, T. Amatasu, et al. (1986). "Purification and characterization
of chitinase and chitobiase produced by Aeromonas hydrophila subsp.
anaerogenes A52." Journal of General and Applied Microbiology 32: 25-38.
Yamamoto, S. and S. Harayama (1996). "Phylogenetic analysis of Acinetobacter strains
based on the nucleotide sequences of gyrB genes and on the amino acod
sequences of their products." International Journal of Systematic Bacteriology
46: 506-511.
Yamamoto, S. and S. Harayama (1998). "Phylogenetic relationships of Pseudomonas
putida strains deduced from the nucleotide sequences of gyrB, rpoD and 16S
rRNA genes." International Journal of Systematic Bacteriology 48: 813-819.
Yates, F. (1934). "Contingency table involving small numbers and the χ2 test."
Supplement to the Journal of the Royal Statistical Society 1(2): 217-235.
Yañez, M. A., V. Catalan, D. Apraiz, et al. (2003). "Phylogenetic analysis of members
of the genus Aeromonas based on gyrB gene sequences." International Journal
of Systematic and Evolutionary Microbiology 53: 875-883.
Yang, I. and K. Bush (1996). "Biochemical characterization of the carbapenem-
hydrolyzing B-lactamase AsbM1 from Aeromonas sobria AER 14M: a
member of a novel subgroup of metallo-B-lactamases." FEMS Microbiology
Letters 137: 193-200.
Yang, X., Q. Q. Yang, Q. Y. Guo, et al. (2008). "Aeromonas salmonicida peritonitis
after eating fish in a patient undergoing CAPD." Peritoneal Dialysis
International 28(3): 316-317.
Ye, Y., X. H. Xu and J. B. Li (2010). "Emergence of CTX-M-3, TEM-1 and a new
plasmid-mediated MOX-4 AmpC in a multiresistant Aeromonas caviae
isolated from a patient with pneumoniae." Journal of Medical Microbiology 59:
843-847.
-- 310 --
Yokoyama, R., Y. Fujii, Y. Noguchi, et al. (2002). "Physicochemical and biological
properties of an extracellular serine protease of Aeromonas sobria."
Microbiology and Immunology 46: 383-390.
Yousuf, F. A., R. Siddiqui and N. A. Khan (2013). "Acanthamoeba castellanii of the
T4 genotype is a potential environmental host for Enterobacter aerogenes
and Aeromonas hydrophila." Parasites and Vectors 6: 169
doi:10.1186/1756-3305-6-169.
Yu, H. B., P. S. Srinivasa Rao, H. C. Lee, et al. (2004). "A type III secretion system is
required for Aeromonas hydrophila AH-1 pathogenesis." Infection and
Immunity 72(3): 1248-1256.
Yu, H. B., R. Kaur, S. Lim, et al. (2007). "Characterization of extracellular proteins
produced by Aeromonas hydrophila AH-1." Proteomics 7: 436-449.
Yu, H. B., Y. L. Zhang, Y. L. Lau, et al. (2005). "Identification and characterisation of
putative genes and gene clusters in Aeromonas hydrophila PPD134/91."
Yu, Y., X. H. Xu, J. B. Li (2010). “Emergence of CTX-M-3, TEM-1 and a new
plasmid-mediated MOX-4 AmpC in a multiresistant Aeromonas caviae isolate
from a patient with pneumonia.” Journal of Medical Microbiology 59(7): 843-
847.
Yucel, N. and S. Erdogan (2010). "Virulence properties and characterization of
aeromonads isolated from foods of animal origin and environmental sources."
Journal of Food Protection 73(5): 855-860.
Zacaria, J., A. P. L. Delamare, S. O. P. Costa, et al. (2010). "Diversity of extracellular
proteases among Aeromonas determined by zymogram analysis." Journal of
Zemelman, R., C. Gonzalez, M. A. Mondaca, et al. (1984). "Resistance of Aeromonas
hydrophila to B-lactams antibiotics." Journal of Antimicrobial Chemotherapy
14: 575-579.
Zhang, Y. L., Y. L. Lau, E. Arakawa, et al. (2003). "Detection and genetic analysis of
group II capsules in Aeromonas hydrophila." Microbiology 149: 1051-1060.
Zhiyong, Z., L. Xiaoju and G. Yanyu (2002). "Aeromonas hydrophila infection: clinical
aspects and therapeutic options " Reviews in Medical Microbiology 13(4): 151-
162.
Ziemke, F., M. G. Höfle, J. Lalucat, et al. (1998). "Reclassificcation of Shewanella
putrefaciens Owen's genomic group II as Shewwanella baltica sp. nov."
International Journal of Systematic Bacteriology 48: 179-186.
Zmyslowska, I., K. Korzekwa and J. Szarek (2009). "Aeromonas hydrophila in fish
aquaculture " Journal of Comparative Pathology 141(1): 313.
Zywno, S. R., J. Arceneaux, M. Altwegg, et al. (1992). "Siderophore production and
DNA hybridization groups of Aeromonas spp." Journal of Clinical
-- 311 --
Evolutionary distances based on the percentage sequence dissimilarities of all current Aeromonas species and 60 isolates identified as A. dhakensis (A. aquariorum) using Clustal W and Mega 5 software (combined gyrB and rpoD dissimilarities). Numbers in brackets indicate strains with similar nucleotide sequences.
A. allosaccharophila (DSM 11576)

A. aquariorum (CECT 7289) 9.8
A. bestiarum (ATCC 51108) 10.0 9.2
A. bivalvium (CECT 7113) 12.8 11.2 11.4
A. caviae (ATCC 13136) 10.6 8.7 11.1 11.1
A. encheleia (DSM 11577) 11.3 10.0 9.9 10.7 9.6
A. eucrenophila (ATCC 23309) 10.8 8.5 10.4 11.0 9.0 7.0
A. hydrophila (ATCC 7966) 9.4 4.6 9.2 12.7 8.8 10.0 8.9
A. jandaei (ATCC 49568) 7.2 7.9 9.8 11.4 9.6 9.3 8.4 9.3
A. media (ATCC 39907) 8.7 9.2 8.3 10.1 7.5 6.9 6.5 8.8 8.7
A. molluscorum (DSM 17090) 15.3 12.8 12.7 10.8 13.4 11.0 11.7 13.5 13.6 12.0
A. popoffii (CIP 105493) 10.7 9.5 4.3 11.5 12.6 10.8 10.2 10.4 10.5 10.1 11.7
A. simiae (DSM 16559) 17.1 15.9 16.2 17.6 16.0 16.0 16.6 16.1 14.7 16.0 17.4 17.1
A. sobria (CDC 9540-76) 8.2 10.2 10.7 13.2 11.4 12.0 11.2 10.1 8.8 11.0 13.5 11.4 17.7
A. tecta (CECT 7082) 10.6 9.9 9.6 11.5 9.4 7.0 5.7 9.8 9.4 7.0 12.3 10.7 16.1 10.5
A. trota (ATCC 49657) 8.9 10.2 10.6 12.2 9.4 11.8 10.4 10.3 8.9 10.0 13.6 11.4 16.0 10.6 11.0
A. veronii bv. sobria (ATCC 9071) 3.5 10.3 10.6 12.5 10.2 10.2 10.7 9.8 7.4 9.5 14.6 11.3 17.0 8.4 10.3 8.6
A. salmonicida ssp. salmonicida (CEC 10.6 10.4 6.9 11.8 11.7 10.3 10.0 10.0 10.7 10.2 12.5 8.0 17.7 10.5 9.6 11.5 10.5
Aeromonas spp. HG11 (CECT 4253) 10.8 9.6 8.9 10.2 9.2 1.4 6.4 9.6 8.8 6.5 11.2 10.1 15.9 11.1 6.2 11.2 10.2 9.8
A. piscicola (CECT 7443) 10.7 10.0 4.5 12.8 11.7 10.1 10.7 10.1 10.8 10.0 12.6 5.2 17.7 11.6 10.4 10.8 11.7 6.3 9.8
A. rivuli (CECT 7518) 14.6 12.3 11.6 10.3 12.2 10.2 10.7 13.0 13.3 11.0 5.4 11.4 18.1 12.5 11.5 13.2 14.1 13.3 10.4 12.3
A. fluvialis (CECT 7401) 5.3 9.5 10.3 12.8 11.0 10.6 11.1 9.8 8.4 10.3 15.0 11.5 17.6 7.7 10.6 9.4 5.5 11.3 10.4 11.8 13.6
A. taiwanensis (CECT 7403) 11.6 10.8 12.8 11.5 6.6 10.6 9.9 10.6 10.8 8.5 13.6 12.8 16.7 12.4 10.8 10.3 11.3 13.2 10.2 13.4 13.0 12.3
A. sanarellii (CECT 7402) 11.6 9.5 11.8 10.8 5.7 10.8 10.2 9.9 10.6 7.7 14.4 12.8 16.9 12.9 11.1 11.1 10.4 13.3 10.8 12.6 12.7 11.5 7.0
A. diversa (CECT 2478) 16.6 16.0 16.9 18.0 15.5 16.4 16.7 15.5 16.6 15.5 19.1 18.5 11.1 18.1 17.4 17.4 17.7 17.6 15.9 18.0 18.3 17.6 15.9 16.8
Isolate 31 9.6 1.4 9.3 11.2 8.8 10.2 8.6 5.0 8.0 9.3 12.9 9.9 16.0 10.0 10.1 9.8 10.2 10.5 9.6 10.6 12.0 9.6 11.3 10.0 16.4
Isolate 32 9.9 1.2 9.3 11.0 8.5 9.4 8.7 5.0 8.7 8.7 13.0 9.8 16.1 10.3 10.0 10.2 10.4 10.1 9.3 10.0 12.0 9.6 10.4 9.5 16.3 1.6
Isolates (47 95 139 165) 10.5 1.8 9.5 11.7 9.3 10.3 8.3 6.1 8.5 9.4 12.4 9.6 16.0 10.7 9.6 10.3 11.1 10.4 9.5 10.0 12.4 10.5 10.8 10.5 16.8 2.0 2.0
Isolates (56 220) 9.5 1.8 9.2 11.5 8.7 9.9 8.6 4.4 8.4 9.1 13.2 10.2 16.8 10.1 9.8 10.2 10.2 10.3 9.6 9.8 12.0 9.4 10.7 9.8 16.6 2.0 1.8 2.6
Isolate 60 9.2 1.2 9.4 11.0 8.3 10.2 8.2 4.4 8.2 8.9 13.0 10.0 16.2 9.6 9.4 9.9 10.0 10.1 9.9 10.2 11.8 9.4 10.3 9.4 16.1 1.7 1.6 2.3 1.1
Isolate 67 9.9 1.1 9.8 11.7 8.3 10.4 8.4 4.5 8.6 9.3 13.6 10.3 16.0 10.4 9.6 10.0 10.6 10.5 10.0 10.3 12.6 9.9 10.6 9.5 16.1 1.6 1.5 2.4 1.8 1.1
Isolate 70 10.6 1.7 10.1 11.9 9.4 10.5 9.4 4.9 9.1 9.6 13.9 10.8 16.8 10.8 10.5 10.8 10.8 11.0 10.5 10.8 12.9 10.4 11.5 10.1 17.0 2.3 1.7 2.8 1.7 1.7 1.8
Isolate 71 9.3 1.6 9.3 11.6 8.9 10.5 8.6 5.2 8.4 9.5 13.2 9.9 16.1 10.3 10.1 10.4 10.4 11.0 9.9 10.5 12.3 9.4 11.4 10.2 16.6 1.0 2.0 2.2 1.8 1.7 1.4 2.3
Isolates (73 74) 9.9 1.1 9.6 11.6 8.7 10.3 8.7 4.7 8.5 9.3 13.7 10.2 16.3 10.5 9.9 10.3 10.6 10.4 10.2 10.2 12.5 9.9 11.0 9.9 16.4 1.6 1.1 2.4 1.4 1.1 0.6 1.4 1.6
Isolate 79 9.3 1.3 9.5 11.2 8.4 10.3 8.3 4.5 8.3 9.0 13.3 10.1 16.3 10.0 9.5 9.8 10.1 10.2 10.0 10.3 12.0 9.5 10.4 9.5 16.2 1.6 1.7 2.4 1.2 0.3 1.2 2.0 1.8 1.2
Isolate 88 11.0 2.0 10.4 12.0 9.4 11.1 8.9 5.2 9.4 9.5 14.3 11.2 17.0 11.0 10.4 11.0 11.4 11.7 10.8 11.4 13.0 10.7 11.7 9.9 17.4 2.6 2.4 3.1 2.4 2.0 1.9 0.9 2.6 2.1 2.1
Isolate 91 9.4 1.2 9.2 11.1 8.3 10.4 8.2 4.4 8.2 8.9 13.2 9.8 16.0 10.1 9.4 9.6 10.2 10.3 9.9 10.2 11.7 9.4 10.3 9.4 15.9 1.7 1.6 2.1 1.1 0.4 1.1 1.9 1.7 1.1 0.5 2.2
Isolates (93 172) 9.9 2.0 9.6 11.7 9.4 10.3 8.9 5.2 8.7 10.1 12.7 10.2 16.8 10.8 10.2 10.7 10.6 10.7 9.6 10.3 12.3 9.8 11.9 10.5 16.8 2.0 2.6 2.5 1.6 1.9 2.4 2.3 1.4 2.4 2.0 2.6 1.9
Isolate 104 10.0 1.7 9.3 11.7 8.7 10.3 8.6 4.7 8.4 9.5 13.2 10.1 16.3 10.4 10.0 10.4 10.3 10.7 9.5 10.1 12.3 9.9 10.8 9.9 16.3 2.3 2.5 2.5 0.9 1.6 1.9 2.4 1.9 2.1 1.7 2.7 1.4 1.5
Isolate 107 9.8 1.7 9.5 11.8 8.9 10.7 8.4 5.3 8.6 9.8 13.4 10.1 16.3 10.6 10.1 10.1 10.6 11.1 9.9 10.6 12.3 9.6 11.3 10.2 16.4 1.3 2.1 2.1 1.9 1.8 1.3 2.4 0.5 1.7 1.7 2.5 1.6 1.5 1.8
Isolate 121 10.0 1.3 9.8 11.6 9.0 10.3 8.9 4.8 8.8 9.5 13.4 10.1 16.8 10.3 10.3 10.4 10.5 10.7 10.2 10.6 12.6 9.8 10.7 10.1 16.4 1.7 1.7 2.7 2.1 1.7 1.6 2.2 1.9 1.6 1.6 2.1 1.7 2.9 2.4 2.2
Isolates (123 124) 9.5 1.1 9.5 11.2 8.5 10.3 8.3 4.7 8.3 9.4 13.0 9.9 16.1 10.2 9.8 10.3 10.3 10.2 10.0 10.1 12.3 9.5 10.8 9.6 16.2 2.0 1.9 2.2 1.4 0.7 1.2 2.2 2.0 1.4 0.8 2.3 0.7 1.6 1.5 1.9 2.0
Isolate 141 9.6 1.1 9.5 11.4 8.7 10.3 8.4 4.7 8.2 9.3 13.2 10.1 16.1 10.3 9.9 10.2 10.4 10.3 10.0 10.1 12.3 9.6 11.0 9.9 16.2 1.0 1.1 1.8 1.2 1.1 1.0 1.4 1.0 0.6 1.2 2.1 1.1 1.8 1.9 1.1 1.6 1.4
Isolate 154 10.1 1.8 9.8 11.5 8.8 10.6 8.7 4.6 8.8 9.4 13.3 10.5 16.4 10.2 10.1 10.2 10.5 11.0 10.1 10.8 12.2 9.9 11.1 9.9 16.3 2.3 2.2 2.9 1.4 1.0 1.5 1.3 2.1 1.9 1.3 1.4 1.2 1.8 1.7 2.1 2.2 1.3 1.9
Isolate 168 10.2 1.3 9.5 11.7 8.9 9.6 8.6 4.9 8.3 9.4 12.8 10.1 15.8 10.6 10.0 10.8 10.6 10.8 9.2 10.3 12.2 10.2 10.3 10.2 16.0 1.9 1.9 2.3 1.9 2.0 1.9 2.2 2.3 1.9 2.1 2.5 1.8 2.1 1.6 2.2 2.0 1.9 1.9 2.3
Isolate 169 10.4 1.3 9.6 11.7 9.4 10.5 9.0 4.9 8.7 9.6 13.3 10.2 15.9 10.6 10.3 10.4 10.8 11.0 10.1 10.6 12.5 10.4 11.3 10.3 16.3 2.3 2.1 2.4 2.1 1.7 1.8 0.8 2.3 1.8 2.0 1.1 1.7 1.9 1.8 2.2 2.2 1.8 1.8 1.3 1.6
Isolate 176 9.4 0.7 9.3 11.3 8.2 10.2 8.4 4.3 8.2 9.1 13.4 9.9 15.8 10.0 9.6 10.1 10.2 10.3 9.8 10.1 12.2 9.4 10.4 9.4 15.9 1.2 1.1 2.0 1.4 0.7 0.4 1.4 1.0 0.6 0.8 1.7 0.7 2.0 1.5 1.1 1.2 1.0 0.6 1.3 1.5 1.4
Isolate 180 9.9 1.0 9.2 11.8 9.0 9.5 8.7 4.6 8.0 9.6 13.0 10.0 16.3 10.4 9.9 10.5 10.5 10.6 9.1 9.8 12.2 9.8 11.1 10.1 16.4 1.6 1.8 2.2 1.0 1.7 1.6 1.9 1.6 1.6 1.8 2.2 1.7 1.4 0.9 1.7 1.9 1.6 1.4 2.0 1.1 1.5 1.2
Isolate 182 10.5 1.8 10.0 12.2 8.9 10.5 8.7 4.8 9.3 9.4 13.0 10.7 16.1 10.8 10.1 10.3 11.2 11.1 10.0 10.7 12.4 10.4 10.5 10.0 16.0 2.2 2.2 2.8 1.8 1.9 1.6 2.3 2.0 2.0 2.0 2.6 1.7 2.4 1.7 1.9 2.1 2.2 2.0 2.0 1.3 2.1 1.4 1.8
Isolate 183 10.1 1.0 9.6 11.4 9.1 10.6 8.5 5.2 8.4 9.6 13.3 10.0 16.2 10.4 10.2 10.3 10.5 10.5 9.9 10.3 12.5 10.0 11.1 9.9 16.6 1.4 1.6 1.8 2.0 1.7 1.4 2.1 1.8 1.6 1.6 2.2 1.5 2.0 1.7 1.5 1.7 1.4 1.4 2.2 1.3 1.7 1.2 1.2 2.0
Isolate 212 10.1 1.3 9.8 11.8 8.9 10.3 8.8 4.5 8.6 9.3 13.6 10.5 16.4 10.2 10.0 10.3 10.5 10.7 9.8 10.7 12.6 10.1 10.8 10.0 16.3 1.9 1.7 2.6 1.7 1.1 1.2 0.8 1.7 1.4 1.4 1.1 1.5 1.9 1.8 1.8 1.8 1.8 1.4 0.7 1.8 0.8 0.8 1.5 1.7 1.9
Isolate 213 11.9 3.5 11.6 14.1 11.0 12.4 10.5 7.0 10.7 11.8 15.0 12.4 18.7 12.7 12.0 12.2 12.7 12.9 11.6 12.5 14.2 11.8 13.5 11.9 18.5 3.3 3.9 4.2 3.5 3.8 3.1 3.6 2.5 3.5 3.9 3.7 3.8 2.5 3.6 2.4 4.2 3.9 3.1 3.3 3.8 3.6 3.1 3.1 3.7 3.5 3.0
Isolates (222 257) 10.3 2.1 10.1 12.3 9.6 10.7 9.1 5.3 9.1 10.3 13.4 10.6 17.1 11.1 10.4 10.8 11.1 11.3 10.1 11.1 12.7 10.2 11.9 10.5 17.4 1.7 2.5 2.8 2.1 2.4 2.3 2.2 1.1 2.3 2.5 2.3 2.4 1.1 2.4 1.4 2.0 2.7 1.7 2.2 2.4 2.2 1.9 1.7 2.5 2.3 1.8 2.2
Isolates (223 232 240) 9.5 0.4 9.2 11.2 8.7 9.8 8.5 4.6 7.9 9.2 13.0 9.5 16.0 10.0 9.9 10.2 10.1 10.2 9.4 10.0 12.5 9.3 10.8 9.8 16.0 1.4 1.2 1.8 1.8 1.2 1.1 1.7 1.6 1.1 1.3 2.0 1.2 1.8 1.7 1.7 1.1 0.9 1.1 1.8 1.3 1.3 0.7 1.2 1.8 1.0 1.3 3.7 2.3
Isolate 226 10.0 1.9 9.5 12.0 8.7 10.4 9.0 4.9 8.6 9.8 13.4 10.5 16.4 10.6 10.2 10.7 10.5 11.0 9.6 10.5 12.6 9.6 11.7 9.9 16.4 1.7 2.3 2.5 1.7 2.0 1.7 2.2 0.7 1.9 2.1 2.5 2.0 1.3 1.4 0.8 2.4 2.3 1.3 2.1 2.2 2.2 1.3 1.5 1.9 2.1 1.6 2.4 1.2 1.9
Isolate 227 10.0 1.2 9.6 11.3 8.8 10.7 8.0 4.8 8.6 8.9 13.3 10.3 16.6 10.4 10.3 10.2 10.5 11.0 10.4 10.7 12.4 9.6 11.1 9.3 16.3 1.4 1.6 2.2 2.0 1.4 1.3 2.1 1.6 1.5 1.5 1.8 1.4 2.2 2.3 1.5 1.7 1.5 1.1 1.8 2.1 2.1 1.1 2.0 2.0 1.6 1.7 3.5 2.3 1.2 1.9
Isolate 228 10.2 1.4 10.0 11.7 8.6 10.7 8.5 4.6 8.8 9.4 13.3 10.5 16.3 10.6 10.3 9.5 10.7 10.8 10.4 10.7 12.6 10.0 10.6 9.9 16.1 1.4 1.8 2.4 2.2 1.6 1.3 2.3 1.8 1.7 1.5 2.4 1.6 2.4 2.5 1.5 1.9 1.7 1.3 2.0 2.3 2.3 1.3 2.2 2.0 1.8 1.9 3.7 2.5 1.4 2.1 1.0
Isolates (229 234) 9.3 1.2 9.2 11.1 8.2 10.2 8.2 4.4 8.2 9.1 13.2 9.8 16.2 9.9 9.6 10.0 10.0 10.4 9.9 10.1 11.7 9.2 10.5 9.3 16.1 1.6 1.6 2.2 0.8 0.5 1.0 1.9 1.4 1.2 0.6 2.0 0.5 1.6 1.3 1.3 1.7 0.6 1.2 1.0 1.9 1.9 0.8 1.4 1.8 1.4 1.5 3.3 2.1 1.2 1.7 1.2 1.4
Isolates (230 236 249) 9.6 0.7 9.2 11.5 8.8 10.4 8.4 4.9 8.2 8.9 13.3 9.5 16.0 10.0 10.3 10.4 10.5 10.5 10.0 10.3 12.6 9.8 11.0 9.8 16.3 1.3 1.5 2.3 2.1 1.5 1.2 2.0 1.3 1.4 1.6 2.3 1.5 2.5 2.0 1.8 1.4 1.6 1.4 1.8 1.8 1.8 0.8 1.7 1.9 1.5 1.4 3.6 2.2 0.9 2.0 1.5 1.7 1.5
Isolates (235 250) 9.3 1.5 9.3 11.6 8.7 10.3 8.6 4.9 8.2 9.5 13.2 10.1 16.3 10.3 9.9 10.4 10.4 10.6 9.8 10.2 12.3 9.2 11.4 9.9 16.4 1.3 1.9 2.0 1.7 1.6 1.5 2.2 0.5 1.5 1.7 2.5 1.6 1.3 2.0 0.6 2.0 1.9 0.9 2.3 2.2 2.2 1.1 1.5 2.1 1.7 1.8 2.6 1.2 1.5 0.6 1.5 1.7 1.3 1.8
Isolate 239 9.3 1.5 8.9 11.3 8.5 9.9 8.4 4.1 8.2 9.1 12.9 9.9 16.6 9.9 9.5 10.0 10.0 10.3 9.4 9.6 11.8 9.2 10.5 9.5 16.3 1.7 1.9 2.5 0.3 1.0 1.5 1.8 1.5 1.5 1.1 2.1 1.0 1.3 0.6 1.6 1.8 1.3 1.3 1.3 1.6 1.8 1.1 0.7 1.5 1.7 1.4 3.2 1.8 1.5 1.4 1.7 1.9 0.7 1.8 1.4
Isolate 241 9.9 1.6 9.8 11.5 8.6 10.6 8.0 4.8 8.5 9.2 13.5 10.3 16.4 10.6 10.0 10.3 10.7 10.7 10.1 10.4 12.4 10.0 11.1 9.5 16.6 1.4 2.0 2.1 1.8 1.7 1.4 2.3 1.2 1.6 1.8 2.0 1.7 2.0 2.1 1.3 2.1 2.0 1.0 2.4 2.3 2.3 1.2 1.6 2.2 1.8 1.9 3.3 1.9 1.6 1.5 1.2 1.4 1.4 1.9 0.9 1.5
Isolate 242 10.0 1.4 9.8 11.3 8.6 10.8 8.0 4.8 8.4 9.4 13.3 9.8 16.8 10.4 9.6 9.9 10.5 10.6 10.3 10.7 12.3 9.6 10.8 9.6 16.9 1.8 1.8 2.6 2.0 1.6 1.3 2.1 1.8 1.5 1.7 2.0 1.4 2.6 2.3 1.7 1.7 1.5 1.3 2.0 2.3 2.1 1.1 1.8 2.2 1.6 1.7 3.7 2.3 1.4 2.1 1.6 1.8 1.4 1.7 1.7 1.7 1.6
Isolate 244 10.3 1.1 9.8 11.8 9.2 10.3 8.6 4.7 8.4 9.3 13.4 10.3 16.2 10.5 10.0 10.3 10.7 10.7 9.6 10.7 12.6 10.3 11.0 10.2 16.3 2.1 1.9 2.2 1.9 1.3 1.6 1.0 2.1 1.6 1.6 1.3 1.5 1.7 1.6 2.0 2.0 1.6 1.6 1.1 1.4 0.4 1.2 1.3 1.9 1.5 0.4 3.4 2.0 1.1 2.0 1.9 2.1 1.7 1.6 2.0 1.6 2.1 1.9
Isolate 251 9.8 1.2 9.0 11.2 8.6 10.6 8.3 4.5 8.6 8.8 13.3 9.5 16.4 10.2 9.9 9.9 10.3 10.4 10.1 10.2 12.0 9.5 10.6 9.6 16.2 1.8 1.6 2.4 1.6 1.0 1.3 2.1 2.0 1.5 0.9 2.0 0.8 2.2 1.7 1.7 1.5 1.1 1.5 1.4 1.9 1.9 1.1 2.0 1.8 1.2 1.7 3.9 2.7 1.2 2.3 1.1 1.4 0.8 1.5 1.9 1.3 2.0 1.6 1.7
Isolate 255 9.8 0.9 9.2 11.4 8.5 10.2 8.4 4.5 8.3 9.3 12.7 9.8 16.0 10.3 9.6 9.8 10.4 10.2 9.6 9.9 12.3 9.6 10.7 9.9 16.0 0.9 1.5 1.7 1.7 1.4 1.1 2.0 1.1 1.3 1.5 2.3 1.4 1.9 2.0 1.2 1.6 1.7 0.7 2.1 1.8 2.0 0.9 1.3 1.7 1.3 1.6 3.2 1.8 1.1 1.4 1.1 0.9 1.3 1.4 1.0 1.4 0.7 1.5 1.8 1.5
Isolate 256 9.9 1.5 9.4 11.6 8.5 10.6 9.0 5.1 8.3 9.9 13.9 10.2 15.9 10.3 10.0 10.6 10.2 11.1 10.2 10.5 12.7 9.8 11.0 9.6 16.6 1.7 1.9 2.5 1.7 1.6 1.3 1.8 1.3 1.5 1.7 2.1 1.6 2.3 1.4 1.4 2.0 1.9 1.3 2.1 2.2 1.8 0.9 1.5 2.1 1.7 1.6 3.4 2.2 1.5 1.2 1.9 2.1 1.3 1.6 1.4 1.4 1.5 1.7 2.0 1.9 1.4
Isolate 258 10.1 2.2 10.1 12.4 9.4 11.1 9.1 5.6 8.9 10.3 13.8 10.8 17.1 11.0 10.4 11.0 11.2 11.4 10.5 11.0 12.9 10.0 12.2 10.6 17.3 2.0 2.6 2.7 2.4 2.3 2.0 2.9 1.2 2.0 2.4 3.2 2.3 2.0 2.7 1.3 2.7 2.6 1.6 3.0 2.9 2.9 1.8 2.2 2.8 2.4 2.5 2.1 1.9 2.2 1.3 2.2 2.4 2.0 2.5 0.7 2.1 1.6 2.4 2.7 2.6 1.7 2.1
Isolate 263 9.9 1.3 9.4 11.6 8.7 10.3 8.7 4.7 8.5 9.1 13.2 10.0 15.5 10.3 10.2 10.0 10.6 10.7 10.1 10.5 12.5 9.9 10.7 10.0 16.2 1.1 1.7 2.3 2.3 1.7 1.2 1.8 1.1 1.6 1.8 2.1 1.7 2.5 2.4 1.6 1.6 2.0 1.2 2.0 2.2 1.8 1.0 2.1 1.9 1.9 1.6 3.6 2.2 1.3 1.8 1.3 1.1 1.7 1.0 1.6 2.0 1.3 1.9 2.0 1.7 0.8 1.4 2.3
Isolate 278 10.2 1.5 9.8 11.7 8.9 9.5 8.8 4.9 8.7 9.3 13.2 10.5 16.4 10.6 10.2 10.8 10.6 10.6 9.5 10.3 12.2 10.1 10.5 10.2 16.4 1.7 1.3 2.7 1.3 1.8 1.7 1.6 2.1 1.3 1.9 2.3 1.8 2.3 2.0 2.2 1.8 2.1 1.3 2.1 0.6 2.0 1.3 1.3 1.3 1.7 1.6 3.6 2.2 1.5 2.0 1.9 2.1 1.7 1.8 2.0 1.4 2.1 2.1 1.8 1.9 1.6 2.0 2.7 2.0
Isolate 279 10.0 1.4 9.6 11.5 8.6 11.0 8.3 4.8 8.5 9.4 13.7 10.0 16.6 10.6 9.8 10.0 10.5 10.6 10.2 10.6 12.5 10.0 10.8 9.8 16.7 1.5 1.8 2.3 1.9 1.4 1.3 2.1 1.7 1.3 1.1 2.0 1.0 2.5 1.8 1.4 1.5 1.7 1.1 2.2 2.0 1.9 0.9 1.7 2.1 1.3 1.7 3.8 2.2 1.4 1.8 1.8 1.8 1.5 1.7 1.6 1.6 1.5 1.0 1.7 1.4 1.4 1.4 2.3 1.9 2.0
A. schubertii (ATCC 43700) 16.7 15.5 16.4 17.1 15.8 16.6 16.4 15.4 15.6 15.4 19.3 17.6 11.2 18.1 17.0 17.0 17.7 17.5 15.8 17.4 18.2 17.5 15.5 16.8 3.6 16.0 15.9 16.3 16.3 15.6 15.6 16.7 16.1 16.0 15.8 17.0 15.4 16.6 16.1 16.0 16.2 15.5 15.8 16.1 15.8 16.0 15.4 16.2 15.5 16.1 16.1 18.4 17.0 15.8 16.2 15.9 15.4 15.6 15.9 16.0 16.1 15.9 16.2 16.1 15.8 15.3 16.0 16.8 15.4 16.2 16.2
Evolutionary distances based on the percentage sequence dissimilarities of current Aeromonas and strain 266T using Clustal_W and Mega 4 software (combined gyrB and rpoD dissimilarities)
A. piscicola (CECT_7443)
A. rivuli (CECT 7518) 12.0
A. bestiarum (ATCC 51108) 4.3 11.5
A. popoffii (CIP 105493) 4.9 11.6 4.1
A_salmonicida ssp. salmonicida (CECT 894) 6.1 13.0 6.6 7.6
A. molluscorum (DSM 17090) 12.4 5.4 12.4 11.8 12.4
A. media (ATCC 39907) 10.3 11.0 8.6 10.3 10.2 11.9
A. encheleia (DSM 11577) 10.0 10.1 9.7 10.9 10.0 10.9 6.7
A. eucrenophila (ATCC 23309) 10.8 11.0 10.4 10.4 9.5 11.8 6.3 6.8
A. trota (ATCC 49657) 11.0 13.0 10.5 11.2 11.2 13.5 10.0 11.8 10.4
A. sobria (CDC 9540-76) 11.2 12.4 10.3 11.2 10.2 13.2 10.8 12.0 11.4 10.3
A. jandaei (ATCC 49568) 10.7 13.1 9.5 10.4 10.7 13.3 8.4 9.4 8.3 8.7 9.0
A. allosaccharophila (DSM 11576) 10.5 14.3 9.5 10.2 10.1 14.8 8.2 11.2 10.4 8.8 7.6 6.8
A. caviae (ATCC 13136) 12.2 12.2 11.5 12.9 11.9 13.2 7.7 9.6 9.0 9.5 11.2 9.4 10.3
A. schubertii (ATCC 43700) 17.7 18.3 16.7 18.2 17.7 19.3 15.8 17.1 16.8 16.7 18.7 16.1 16.6 16.2
A. simiae (DSM 16559) 17.9 18.0 16.6 17.3 17.9 17.1 16.1 16.1 16.6 15.8 18.2 15.0 16.8 16.1 11.7
A. tecta (CECT 7082) 10.3 11.4 9.5 10.7 9.2 12.4 6.5 6.9 5.3 11.1 10.1 9.0 9.9 9.1 17.2 15.8
A. bivalvium (CECT 7113) 12.4 9.9 11.1 11.2 11.2 10.3 9.7 10.5 10.7 11.6 13.1 11.1 12.3 10.7 16.9 17.4 11.1
A. hydrophila (ATCC 7966) 10.1 12.9 9.2 10.3 9.6 13.1 8.8 10.2 9.0 10.4 10.1 9.2 9.4 8.8 15.6 16.3 9.5 12.5
A. dhakensis (A. aquariorum) (CECT 7289) 10.1 12.4 9.3 9.6 10.2 12.8 9.4 10.2 8.7 10.2 10.4 7.9 9.7 8.8 15.7 16.2 9.9 11.1 4.8
A. veronii bv. sobria (ATCC 9071) 11.6 13.7 10.2 10.8 10.3 14.4 9.1 10.3 10.3 8.7 7.8 7.2 3.3 9.9 17.7 16.7 10.0 12.2 9.7 10.3
A. veronii bv.veronii (DSM 7386) 10.9 13.9 10.1 10.2 10.0 14.5 8.5 9.9 9.9 8.5 7.7 6.7 3.1 10.2 17.6 17.2 9.3 12.0 9.3 9.6 1.7
A. taiwanensis (CECT 7403) 13.5 12.9 13.0 12.9 13.1 13.3 8.5 10.5 9.5 10.2 11.9 10.5 11.2 6.4 15.7 16.6 10.4 11.1 10.4 10.8 11.1 10.9
A. sanarellii (CECT 7402) 12.6 12.4 11.8 12.8 13.2 13.9 7.5 10.8 9.9 11.2 12.8 10.4 11.5 5.5 17.1 17.1 10.4 10.3 10.1 9.9 10.2 10.8 6.9
Strain 266 11.7 14.2 11.0 11.9 11.0 15.0 9.9 11.9 10.4 8.4 8.8 8.7 5.6 10.8 17.9 17.7 11.1 13.1 10.4 11.1 5.5 5.4 11.1 11.7
A. diversa (CECT 4254) 13.1 12.8 11.7 13.2 12.2 13.9 8.5 5.5 9.6 12.6 13.1 10.7 12.0 10.8 12.8 16.5 9.2 12.4 11.0 11.2 12.0 11.9 11.5 12.3 13.2
A. fluvialis (CECT 7401) 11.6 13.3 10.0 11.1 10.9 14.5 10.0 10.7 10.8 9.6 7.3 8.2 5.4 10.8 17.6 17.4 10.0 12.4 9.9 9.6 5.4 5.0 12.2 11.6 7.5 12.5
Aeromonas spp. HG11 (CECT 4253) 9.6 10.3 8.7 10.1 9.4 11.1 6.3 1.5 6.2 11.1 11.0 8.8 10.8 9.2 16.2 16.0 6.1 10.0 9.9 9.9 10.3 9.9 10.1 10.8 11.9 4.2 10.4
A. culicicola (CECT 5761) 11.4 13.8 10.5 11.1 10.2 14.8 9.2 10.7 10.2 9.2 8.1 7.2 3.7 10.2 18.0 17.7 10.3 13.2 10.0 10.8 1.7 2.3 11.5 10.8 5.1 12.4 5.6 10.7

1 Aa Tesis Aravena Roman Maximiliano 2015

Uploaded by

Copyright:

Available Formats

1 Aa Tesis Aravena Roman Maximiliano 2015

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

1 Aa Tesis Aravena Roman Maximiliano 2015

Uploaded by

Copyright:

Available Formats

Phylogeny, antimicrobial

Max Aravena-Román BScAppSci FASM

This thesis is presented for the degree of Doctor of

School of Pathology and Laboratory Medicine of

Members of the genus Aeromonas are Gram-negative rods globally distributed in

Before the advent of molecular techniques, classification of Aeromonas was based

The aims of this research were:

1. To characterize a collection of clinical and environmental Aeromonas isolates

The antimicrobial susceptibility pattern of each isolate was assessed against 26

Aravena-Román, M., B. J. Chang, T. R. Riley, and T. J. J. Inglis (2011a). Phenotypic

Aravena-Román, M., G. B. Harnett, T. V. Riley, T. J. J. Inglis and B. J. Chang (2011b).

Aravena-Román, M., T. J. J. Inglis, B. Henderson, T. V. Riley, and B. J. Chang (2012).

Aravena-Román, M., R. Beaz-Hidalgo, T. J. J. Inglis, T. V. Riley, A. J. Martínez-

Aravena-Román, M., T. J. J. Inglis, T. V. Riley and B. J. Chang (2014). Distribution of

I am indebted to my supervisors B. Chang, T. Inglis and T. Riley for their continuous

Thanks to Dr. Nicky Buller, Bacteriology Laboratory, Agriculture Department of

Thank you to Dr. Eduardo Alvarez from ICBM, Programa de Microbiología y

To my beloved Mum Carmen Román Díaz (RIP)

Chapter 3 describes the characterization of isolates by phenotypic methods followed by

Table 1.2 Examples of media used in the isolation of Aeromonas p. 14

Table 1.3 Distribution of Aeromonas in water sourcesfrom different p. 26

Table 1.4 Enumeration of Aeromonas in different foodstuffs p. 29

Table 1.5 Characteristics of pili described in Aeromonas species p. 37

Table 1.6 Selected effector proteins associated with different p. 47

Table 1.8 Clinical characteristics of patients with HUS-associated p. 70

Table 1.9 Major categories of Aeromonas septicaemia disease p. 75

Table 1.10 -lactamases produced by Aeromonas species p. 84

Table 3.3 Biochemical characteristics of Aeromonas isolated from p. 149

Table 3.4 Distribution of Aeromonas spp. among clinical and p. 153

Table 4.3 Distribution of Aeromonas spp. among clinical and p. 173

Table 4.4 Biochemical characteristics of Aeromonas after genotypic p. 175

Table 5.1 Antimicrobial susceptibilities determined for different p. 182

Table 6.4 Evolutionary distances based on the percentage sequence CD-ROM

Table 7.1 Distribution of virulence genes among Western Australian p. 221

Table 7.3 Distribution of virulence genes in Aeromonas spp. isolated p. 225

Table 7.4 Distribution of virulence genes in Aeromonas spp. isolated p. 227

Table 7.5 Distribution of virulence genes in Aeromonas spp. isolated p. 230

Table 7.6 Distribution of virulence genes in Aeromonas spp. isolated p. 232

Table 7.7 Additional features p. 234

Table 7.9 Accession numbers of sequences derived from virulence p. 237

Figure 1.2 Unrooted neighbour-joining phylogenetic tree derived from gyrB p. 10

Figure 1.3 Unrooted neighbour-joining phylogenetic tree derived from rpoD p. 11

Figure 4.1 Concatenated neighbour-joining phylogenetic tree showing the p. 169

Figure 4.2 Concatenated neighbour-joining phylogenetic tree showing the p. 170

Figure 4.3 Concatenated neighbour-joining phylogenetic tree showing the p. 171

Figure 4.4 Concatenated neighbour-joining phylogenetic tree derived from p. 172

Figure 6.1 Electron microscopy images of strain 266T p. 191

1.1. GENERAL INTRODUCTION

Aeromonas species are authoctonous inhabitants of aquatic environments that can be

Once considered organisms of doubtful clinical significance the interest in Aeromonas

1.3.1. Early taxonomy

Prior to the 1980s, classification of Aeromonas was based solely on differential

In 1981, Popoff and colleagues used DNA-DNA hybridization (DDH) to classify 55

1.3.2. Current taxonomy

1.3.3. Controversial taxonomic issues

Phylogenetic evidence indicated that strains of A. hydrophila ssp. dhakensis belonged to

1.3.3.1. Aeromonas allosaccharophila

1.3.3.2. Aeromonas spp. HG 11

1.3.3.3. Aeromonas culicicola

Aeromonas species are non-fastidious, catalase and oxidase positive, facultatively