(Series in Computer Science and Data Analysis) Sushmita Mitra-Introduction To Machine Learning and Bioinformatics-CRC Press (2008)
(Series in Computer Science and Data Analysis) Sushmita Mitra-Introduction To Machine Learning and Bioinformatics-CRC Press (2008)
SERIES EDITORS
David Madigan, Rutgers University
Fionn Murtagh, Royal Holloway, University of London
Padhraic Smyth, University of California, Irvine
Proposals for the series should be sent directly to one of the series editors above,
or submitted to:
Published Titles
Bayesian Artificial Intelligence
Kevin B. Korb and Ann E. Nicholson
Computational Statistics Handbook with MATLAB®, Second Edition
Wendy L. Martinez and Angel R. Martinez
Pattern Recognition Algorithms for Data Mining
Sankar K. Pal and Pabitra Mitra
Exploratory Data Analysis with MATLAB®
Wendy L. Martinez and Angel R. Martinez
Clustering for Data Mining: A Data Recovery Approach
Boris Mirkin
Correspondence Analysis and Data Coding with Java and R
Fionn Murtagh
Design and Modeling for Computer Experiments
Kai-Tai Fang, Runze Li, and Agus Sudjianto
Introduction to Machine Learning and Bioinformatics
Sushmita Mitra, Sujay Datta, Theodore Perkins, and George Michailidis
R Graphics
Paul Murrell
Semisupervised Learning for Computational Linguistics
Steven Abney
Statistical Computing with R
Maria L. Rizzo
© 2008 by Taylor & Francis Group, LLC
Introduction to Machine
Learning and Bioinformatics
Sushmita Mitra
Indian Statistical Institute
Kolkata, India
Sujay Datta
Texax A&M University
College Station, TX, U.S.A.
Theodore Perkins
McGill Centre for Bioinformatics
Montreal, Quebec, Canada
George Michailidis
University of Michigan
Ann Arbor, MI, U.S.A.
This book contains information obtained from authentic and highly regarded sources. Reasonable efforts
have been made to publish reliable data and information, but the author and publisher cannot assume
responsibility for the validity of all materials or the consequences of their use. The authors and publishers
have attempted to trace the copyright holders of all material reproduced in this publication and apologize to
copyright holders if permission to publish in this form has not been obtained. If any copyright material has
not been acknowledged please write and let us know so we may rectify in any future reprint.
Except as permitted under U.S. Copyright Law, no part of this book may be reprinted, reproduced, transmit-
ted, or utilized in any form by any electronic, mechanical, or other means, now known or hereafter invented,
including photocopying, microfilming, and recording, or in any information storage or retrieval system,
without written permission from the publishers.
For permission to photocopy or use material electronically from this work, please access www.copyright.
com (http://www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC), 222 Rosewood
Drive, Danvers, MA 01923, 978-750-8400. CCC is a not-for-profit organization that provides licenses and
registration for a variety of users. For organizations that have been granted a photocopy license by the CCC,
a separate system of payment has been arranged.
Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used
only for identification and explanation without intent to infringe.
Visit the Taylor & Francis Web site at
http://www.taylorandfrancis.com
Our motivation behind proposing this book was the desire to summarize under
one umbrella the latest developments at the interface between two areas of
tremendous contemporary interest—bioinformatics and machine learning. In
addition, we wanted to provide a thorough introduction to the basic ideas
of each individual area. At present, there is no other book offering such an
informative yet accessible overview of the ways in which these two increasingly
intertwined areas borrow strength or motivation from each other.
There are many different definitions of bioinformatics. Generally speaking, it
is an emerging field of science growing from an application of mathematics,
statistics and information science to the study and analysis of very large bio-
logical datasets with the help of powerful computers. No matter what precise
definition is being used, there seems to be a consensus that bioinformatics is
all about extracting knowledge from the deluge of information (in the form
of huge datasets) produced by modern-day high-throughput biological experi-
ments. And this is precisely the task that machine learning is meant for—it is
supposed to provide innovative tools and techniques enabling us to handle the
information overload that the scientific community is currently experiencing.
So these two areas are destined to be married. From the numerous books that
have been published in these areas in the recent past, most of which tend to fo-
cus on specific aspects of this marriage, one would get a piecemeal impression
of how these two fields have been nourishing each other. There are a couple of
notable exceptions, but even those books suffer from certain drawbacks, such
as being inaccessible to people without a technically sophisticated background
or focusing solely on classical statistical and combinatorial approaches. As a
result, it is not uncommon to find bioinformatics and/or machine learning
courses that are forced to use multiple textbooks or none at all (in which
case, the course material might be a customized collection of research papers
scattered over the internet).
Keeping this in mind, our intention was to attempt a coherent and seamless
integration of the flurry of activities and the plethora of new developments that
had taken place at the interface between these two areas in the last few years.
As more and more people choose to get involved in these fields, the demand
is growing for quality training programs and good textbooks/references. Our
book aims to satisfy this demand. We believe that it will be comprehensive and
self-explanatory enough to be used alone in a course. More and more graduate
(A) Books that introduce the basic concepts of bioinformatics to readers with
technical or non-technical backgrounds. Some examples are:
1. Basic Bioinformatics by Ignacimuthu, S. (2004, Alpha Science Interna-
tional, Ltd.)
2. Bioinformatics (The Instant Notes Series) by Westhead, D.R., Parish,
J.H. and Twyman, R.M. (2002, BIOS Scientific publishers)
3. Fundamental Concepts of Bioinformatics by Krane, D.E. and Raymer,
M.L. (2002, Benjamin Cummings)
(B) Books that introduce the basic concepts of machine learning to readers
with different levels of technical background. Examples are:
1. Machine Learning by Mitchell, T.M. (1997, McGraw-Hill)
2. Introduction to Machine Learning (Adaptive Computation and Machine
Learning) by Alpaydin, E. (2004, MIT Press)
3. The Elements of Statistical Learning: Data Mining, Inference and Pre-
diction by Hastie, T., Tibshirani, R. and Friedman, J. (2001, Springer)
4. Computational Learning Theory by Kearns, M. and Vazirani, U. (1994,
MIT Press)
(C) Those that focus on some special aspect of bioinformatics (e.g., mi-
croarrays or protein structures) or the application of a special model-
ing/computational technique (e.g., evolutionary computation or hidden
Markov models) in bioinformatics. Examples are:
Each of these books has its own strengths and limitations. The ones in cat-
egory (A) deal primarily with the basics of bioinformatics and offer very lit-
tle on machine learning. Some of them (such as (A) (II) and (A) (III)) are
essentially guide-books for internet resources. Those in category (B) deal pri-
marily with machine learning, not necessarily in the context of bioinformatics.
An exception is (B) (III) (i.e., Hastie, Tibshirani and Friedman), which has
plenty of examples from bioinformatics and is an excellent textbook. However,
its level of mathematical sophistication makes it inaccessible to a large part
of our target audience. Others (such as B(I) and B(IV)) are a bit outdated
since many years have passed since their publication. Books in category (C)
are clearly narrow in their coverage, each specializing in a particular aspect
of bioinformatics that may or may not have something to do with machine
learning. A similar comment applies to the books in category (D), most of
which specialize in some particular aspect of machine learning that may or
may not be motivated by bioinformatics applications. Some in this category
(such as (D)(I)) have a wider agendum (e.g., artificial intelligence) and de-
vote several introductory chapters to machine learning in that context. But
we believe this is not the kind of introduction that a beginner will find most
helpful when he/she is trying to get into a new and challenging area. The
books in category (E) are actually edited volumes of articles, dealing with
bioinformatics or machine learning (but not both) at various levels. There
are fundamental differences between a book and an edited volume. The latter
often suffers from the cut-and-paste syndrome, that is, thematic incoherence
among the constituent articles or lack of proper organization preventing a
seamless integration of those articles. In our case, we chose not to follow this
path, especially when one of our main objectives was to make our product us-
able as a primary or supplementary textbook. Finally, the books in category
(F) are thematically centered on data mining, which is quite different from
our focus.
So it should be clear that in the long list of books above, there is hardly a single
one that succeeds in achieving exactly what our book tries to accomplish.
While many of them address some needs that students and researchers may
have, none is entirely satisfactory on its own. As a result, none of them can be
projected as a direct substitute for our book. One could use a combination of
several of them in a course (as, we believe, most instructors are forced to do
at present). But as we mentioned earlier, a primary motivation behind writing
this book was to provide instructors and researchers with a better option—-
that of using a single book to learn all about the latest developments at the
To those colleagues who most kindly offered to contribute the material for
Chapters 8 through 12 and shared their expertise and vision at various junc-
tures of writing this book, the authors express their sincerest gratitude and
appreciation. The authors consider it a privilege on their part to mention each
contributor by name:
1 Introduction 1
References 24
References 100
References 125
References 153
References 201
References 231
References 275
References 298
References 322
References 334
References 357
Index 361
Introduction
Among the natural sciences, biology is the one that studies highly complex
systems known as living organisms. Before the era of modern technology, it
was primarily a descriptive science that involved careful observation and de-
tailed documentation of various aspects of a living being (e.g., its appearance,
behavior, interaction with the surrounding environment, etc.). These led to a
reasonably accurate classification of all visible forms of life under the sun (the
binomial nomenclature by Carolas Linnaeus) and to a theory of how the life-
forms we see all around us came into being over billions of years (the theory of
evolution by Charles Darwin). However, the technology available in those days
was not good enough for probing the internal mechanisms that made life pos-
sible and sustained it—the complex biochemistry of metabolism, growth and
self-replication. So the biological datasets that were available for statistical
analysis in those days (including clinical and epidemiological data) were rela-
tively small and manageable, and standard classical procedures (such as two-
sample t-tests, ANOVA and linear regression) were adequate to handle them.
But starting from the middle of the twentieth century, key breakthroughs in
the biomedical sciences and rapid technological development changed every-
thing. Not only did they enable us to probe the inner sanctum of a living
Anyone who has watched a human baby grow up will agree that ‘learning’
as we know it is not exactly a mechanical process. It requires the perceptual
and cognitive capabilities that human beings (and, to a lesser extent, the great
apes) have acquired over millions of years through evolution. A computer, such
as a von Neumann machine, is far behind human beings in this respect. It can
outperform us only in tasks that involve substantial amounts of repetitive
computation, such as inverting a large matrix. But when it comes to recogniz-
ing shapes of different sizes and orientations, even in an occluded environment,
we are clearly the winner. In other words, a von Neumann machine is good
for well-structured problems, whereas the human brain is typically better in
solving ill-defined and imprecisely formulated problems of the real world. To
overcome the limitations of the traditional computing paradigm, scientists
have been searching for new computational approaches that can be used to
model—at least partially—the human thought process and the functioning of
our brains. As a result, in the recent past, several novel modes of computation
have emerged. Some of them are collectively known as soft computing. In-
formation processing in a biological system is a complex phenomenon, which
enables a living organism to survive by recognizing its surroundings, making
predictions and planning its future activities. This kind of information pro-
cessing has both a logical and an intuitive aspect. Conventional computing
systems are good for the former but way behind human capabilities in the lat-
ter. As a first step toward accomplishing human-like information processing,
a computing system should be flexible enough to support the following three
characteristics: openness, robustness and real-time processing. Openness of a
system is its ability to adapt or extend itself on its own to cope with changes
encountered in the real world. Robustness of a system means its stability and
tolerance when confronted with distorted, incomplete or imprecise informa-
tion. The real-time processing capability of a system implies that it can react
to an event within a reasonably small amount of time.
2.1 Cells
The basic structural and functional unit of a living organism is a cell. Robert
Hooke, a British scientist of the 17th century, made a chance discovery of
them when he looked at a piece of cork under the type of microscope that
was available at that time. Soon it was hypothesized, and ultimately verified,
that every living organism is made of cells. In the three and a half centuries
since their discovery, thanks to increasingly powerful microscopes and other
sophisticated technologies, astonishing details are available about all aspects of
cells, including their internal structure, day-to-day function, proliferation and
death. Primitive organisms such as bacteria (e.g., Proteobacteria that include
dangerous organisms like Escherichia coli and Salmonella, Cyanobacteria that
are capable of converting the Sun’s electromagnetic energy to chemical energy
through photosynthesis or Archaebacteria that survive in extreme environ-
ments, including the deep-ocean hydrothermal vents) are single-cell organisms
known as prokaryotes. They lack an organelle, called a nucleus, that is present
cytoplasm
nucleolus
Golgi apparatus
channel
rough endoplasmic reticulum
ribosomes
smooth endoplasmic reticulum
The human body consists of trillions of eukaryotic cells. There are at least
two hundred different types of cells in our body and they may be as little as
a few thousandths of a millimeter in diameter and up to a meter in length
(for neurons with long axons). Each cell has an outer membrane which en-
closes the cytoplasm and various components called organelles (see Figure
2.1). They include the nucleus, the endoplasmic reticulum, the Golgi appara-
tus, the mitochondria, the ribosomes and the lysosomes. A plant cell also has
large cavities called vacuoles and different types of plastids (chloroplasts con-
taining chlorophyll for photosynthesis, leucoplasts and chromoplasts). Each of
these organelles has some specific role to play in the life of a cell. Because
mitochondria and chloroplasts can multiply within a cell and bear structural
similarity to certain unicellular prokaryotic organisms, it is hypothesized that
long ago some prokaryotic cells started living inside others, forming a symbi-
otic or mutually beneficial relationship with their hosts. This process, called
endosymbiosis, is believed to have led ultimately to the development of eu-
karyotic cells.
G
T C A G
T
T
DNA T C G A T G
(A) polymerase A G C T A C
A
A G T C
A
T T C G A T G A
C
T C A G C T A
A A G C T A C T (C)
G T T
C U C
T
T
A G C U A C A
C
A
G
G
G A G T C RNA A T G
C T C A G polymerase T A C
C
C
T
G
A
A
C A A
Figure 2.2 (A) Conceptual structure of DNA as a polymer of nucleotides. Note the
complementary base-pairing: A only binds with T, and G only binds with C. (B)
Replication of the DNA by DNA polymerase. (C) Transcription of the DNA into
RNA, by RNA polymerase.
In some cells, most or all of the DNA occurs in a single molecule. In prokary-
otes, such as bacteria, most of the DNA resides in a single chromosome, a
long loop of DNA without beginning or end. Bacteria also often contain plas-
mids, much shorter loops of DNA that can be exchanged between bacteria as
a means of sharing beneficial genes. In eukaryotes, the DNA is divided into
multiple chromosomes, each a linear stretch of DNA with a definite beginning
and end. Many eukaryotes are polyploid, carrying more than one copy of each
chromosome. Humans, for example, are diploid, as most human cells carry two
copies of each chromosome—one inherited from each parent. Some plants are
tetraploid, carrying four copies of each chromosome. The total length of DNA
and the number of chromosomes into which it is divided vary by organism.
The single chromosome of the bacterium Escherichia coli has about 4.6 mil-
lion base pairs, while humans have over 3 billion base pairs of DNA divided
into 23 (pairs of) chromosomes. Fruit flies have less than 200 million base
pairs divided into 8 pairs of chromosomes, while rice has roughly 400 million
base pairs divided into 24 pairs of chromosomes.
When a cell divides to form two daughter cells, as during organism growth
or to replace old or damaged tissue, the DNA must be replicated in order to
provide each daughter cell with its own copy. Complementary base-pairing
is key to this process. During replication, a group of proteins including DNA
polymerase travels along the DNA (see Figure 2.2B). The two strands of DNA
2.3 Proteins
Figure 2.3 (A) An amino acid. (B) Amino acids bind into polymer chains, forming
peptides and proteins. The binding of two amino acids releases a water molecule.
size, acidity, and polarity. When amino acids bind together to form polymers,
water molecules are released, and the parts of the amino acids that remain are
called residues (see Figure 2.3B). Shorter amino acid sequences are peptides,
while longer ones are proteins. Proteins are typically hundreds or thousands
of amino acids long.
As a protein is generated by translation from a transcript, it folds into a
complex 3-D shape, which depends on its amino acid sequence as well as
the chemical environment in which it folds. In describing protein structure,
four different levels are considered. The primary structure of a protein is its
amino acid sequence. Secondary and tertiary structure refer to the 3-D, folded
shape of the protein. Tertiary structure is a specification of 3-D coordinates
for every atom in the protein, in an arbitrary coordinate system, as well as
which atoms are chemically bound to each other. Tertiary structures contain
commonly-occurring patterns, such as α-helices and β-sheets (see Chapter 8
for pictures). α-helices are stretches of the protein that wind into a helical
form. A β-sheet is a set of β-strands that align lengthwise and to each other,
forming a sheet-like shape. The secondary structure of a protein assigns each
amino acid to participating in an α-helix, participating in a β-sheet, or neither.
Sometimes, other categories are included, such as bends between α-helices.
Secondary structure thus abstracts components of the tertiary structure. Many
proteins participate in complexes, groups of proteins and other molecules that
are weakly bound together. A complex may contain proteins of different types,
and conversely, one type of protein may participate in different complexes. A
specification of how proteins and other molecules organize into complexes is
quaternary structure.
Proteins play a number of important roles related to DNA and RNA that
we have already mentioned: transcription factors regulate transcription rates,
RNA polymerase creates the transcripts, DNA polymerase replicates the DNA,
histones affect the 3-D structure of the DNA and influence transcription. Pro-
teins are also responsible for repairing damage to DNA, for example caused
by radiation, and for untangling DNA.
Proteins also act as enzymes, molecules that facilitate the occurrence of chem-
ical reactions—often, very specific reactions. For example, the enzyme lactase
Cell membranes, such as the outer cell membrane or the nuclear membrane,
are impermeable to many types of molecules. Transmembrane proteins control
the flow of molecules across membranes and convey signals from one side to
the other. These proteins reside within the membrane and project on either
side. Channels allow the transport of molecules, often very specific molecules.
For example, ion channels in heart muscle or neurons permit the flow of ions
such as sodium, potassium, calcium or chlorine. Many of these channels can
close, stopping ion flow, or open, allowing flow, depending on triggers such
as electrical activity. The dynamical properties of these channels opening and
closing, and the resulting changes in ion flows, drive larger-scale electrophys-
iological phenomenon such as the transmission of action potentials down the
axon of a neuron and the beating of the heart. Nuclear pore proteins form
complexes that allow molecules such as transcripts and transcription factors
across the nuclear membrane. Signaling is a related task, but need not in-
volve the transport of a molecule from one side of a membrane to another.
Often, the binding of a specific molecule to the transmembrane protein causes
a structural change to the part of the protein on the other side of the mem-
brane. This structural change then typically sets off a chain of reactions which
convey the signal—about the presence of the molecule on the other side of the
membrane—to wherever that signal needs to go.
Proteins and peptides are found in many other locations and processes as
well—as antibodies in the immune system, as hemoglobin in the blood, as
hormones, as neurotransmitters and as sources of energy. In virtually every
cellular and organismal process, the involvement of proteins in some fashion
is the rule rather than the exception.
In order for a highly complex system such as a living organism to survive and
function properly, it is crucial that the variety of biochemical pathways that
sustain the organism and the countless biomolecules that participate in them
be regulated. Regulation has evolved because without it the highly coordinated
and concerted activities of various groups of biomolecules that is essential for
the viability of a living organism would be impossible. There are many dif-
ferent levels and forms of biological regulation. It can happen at the genetic
level (e.g., transcription regulation via the binding of transcription factors or
translation regulation via the degradation or inactivation of mRNAs) or at
the proteomic or metabolomic level through enzymes, hormones and other
regulatory agents. Also, there can be many different control mechanisms. For
example, control on the quantity of a metabolite can be achieved through a
supply-demand pathway (where two other metabolites serve as its “source”
and “sink” simultaneously) or through feedback inhibition (where a sufficient
concentration of the end-product of a metabolic pathway inhibits the path-
way itself). For a detailed classification of feedback inhibition into sequential
feedback, concerted nested feedback, cumulative nested feedback and so forth
(see [2]). In Section 2.2, we discussed genetic regulation. Here we shed some
light on the regulation of cell proliferation and describe the consequences of
uncontrolled growth.
Cells in almost all parts of our body are constantly proliferating, although
Much of the material we have reviewed in this chapter was learned through tra-
ditional “low-throughput” laboratory techniques. However, one of the driving
forces behind bioinformatics is the advent of “high-throughput” technologies
for detecting and quantifying the abundances of various biomolecules and in-
teractions between them. In this section we describe some of the traditional
low-throughput—but sometimes more accurate—techniques of molecular bi-
ology and along with their more recent, high-throughput brethren.
Perhaps the best-known application area for bioinformatics is in the analysis
of DNA sequences. Traditional methods for sequencing DNA (i.e., determin-
ing the sequence of As, Cs, Gs and Ts comprising a gene, a chromosome or
even the entire genome of an organism) were laborious, hands-on procedures
that could only produce sequences of limited length and at comparatively high
cost. DNA sequencing was revolutionized during the 1980’s and 90’s by the
development of machines or robotic systems that could carry out the labwork
(semi)automatically, along with computers for storing and analyzing the data.
Today, the genomes of many species, including humans, have been completely
sequenced. While this trend continues, the emphasis of sequencing has broad-
ened to include the sequencing of individuals’ genomes, in order to detect
the differences—mostly single-letter changes in the sequence called single nu-
Labeled probes are also used in living or recently-living tissue. In in situ hy-
bridization, labeled probes for DNA or RNA sequences are inserted into cells
and imaged. This reveals the spatial distribution of the target within the cell
or tissue and, if observations are taken over a period of time, the temporal dis-
tribution as well. Immunohistochemistry, or immunostaining, follows the same
idea, but the probes are antibodies and the target molecules are proteins. As
some proteins are markers for—that is, indicative of—specific organelles in a
cell or tissues types in a body, immunostaining is often used to localize such
structures. While one probe can reveal the spatial/temporal distribution of a
single type of molecule, two different probes with different labels are used to
study the differences or similarities in the distributions of different molecules.
This is often used, for example, to determine whether two different proteins
collocate, which could indicate a functional protein-protein interaction, or un-
der which conditions they collocate. It is technically difficult to introduce and
image more than a few different kinds of probes, however, so these techniques
are strongly limited in the number of different types of molecules that can be
studied simultaneously.
References
We begin this chapter by addressing the question: “Why are probabilistic and
model-based learning relevant in the context of biological systems?” This is
a pertinent question because, after all, probability theory deals with uncer-
tainty and probabilistic models are a way of quantifying uncertainty. When
one thinks about the kind of objects that constitute biological data (e.g., nu-
cleotide sequences in the DNA, amino acid sequences in peptides, the molec-
ular components of carbohydrates and lipids, the metabolites participating
in a certain metabolic pathway, etc.), there is a lot of predictability about
them in the sense that one will always find the same nucleotide sequence at a
specific position on a specific chromosome of a specific organism (except for
rarely occurring events called mutations) or the same amino acid sequence
in a specific protein molecule. So, where does the uncertainty come from? In
fact, it primarily results from the inadequacy of our present state of knowl-
edge compared to what remains to be discovered in the future. Many aspects
of a biological system are still partially known and currently known ‘facts’
often turn out to be wrong in the light of newly discovered knowledge. Also,
there is a constant need for extrapolating what we know about a smaller or
simpler organism to a larger and more complex one that is still unexplored. In
other words, researchers in bioinformatics are constantly faced with the need
to use inductive reasoning and to draw inferences. There are three different
concepts of knowledge in this world. The philosopher’s view is that all knowl-
edge is correct and the distinction between right and wrong depends only on
the observer’s viewpoint. The scientist’s view is that all knowledge is wrong
unless it can be experimentally verified by independent observers. To put it
in another way, a scientist such as a physicist or a chemist uses deduction to
add to existing knowledge (i.e., if A implies B and B can be experimentally
shown to be false, then A must be false). On the other hand, the probabilist’s
or statistician’s view of knowledge is based on the principle of induction. It
goes like this: if A implies B and B is observed to happen, A is more likely
to be true. Probability and statistics enable us to quantify, for example, how
much more likely A becomes if B is observed k times (k=1,2,3,. . .). Often, a
25
We live in a world full of uncertainty. We are not sure how the weather will be a
week from now, we cannot predict with certainty whether our favorite football
Having written down the sample space of a random experiment, we now must
link it to the concept of an event. Any subcollection of outcomes listed in
the sample space is called an event. In real life, we are more often interested
in such collections of outcomes than in individual outcomes. In the language
of set theory (the branch of mathematics that deals with the relationships
among, and the properties of, various subcollections of a bigger collection),
the sample space is the universal set and the events are its subsets. So, fol-
lowing set-theoretic notations, events are usually denoted by A, B, C, etc. For
example, in the context of rolling a cubic die (what was the sample space for
it?), A could be the event that an odd number turned up. In other words,
A = {1, 3, 5}. Similarly, B could be the event that a number ≤ 2 turned up,
i.e., B = {1, 2}. In the context of drawing a card from a deck of 52 cards, A
could be the event that the card drawn is an ace, B could be the event that it is
black, C could be the event of it being a face-card and D, the event of it being a
diamond. These are examples of simple events. Given two such simple events,
one can construct
S all sorts of compound
T events using the set-theoretic opera-
tions union ( ), intersection ( ) and complementation. Given two events (or
sets) A and B, their union is defined as the bigger collection containing all the
outcomes in A as well as those in B. So, using the notation “∈” to denote that
Probability axioms:
Axiom 1. 0 ≤ P (A) ≤ 1 for any event A in S;
Axiom 2. P (S) = 1;
Axiom 3. For anyScountable
S Scollection E1 , E2 , E3, . . . of mutually exclusive
events in S, P (E1 E2 E3 . . .) = P (E1 ) + P (E2 ) + P (E3 ) + . . .. In other
S∞ Pk
words, P ( i=1 Ei ) = limk→∞ i=1 P (Ei ).
Any way of defining probabilities of events (objective or subjective) should sat-
isfy these axioms in order to be called consistent. The last of the three axioms
is called countable additivity. Some prefer replacing it by the finite additivity
axiom of De Finetti, but here we stick to the former (actually, countable ad-
ditivity implies finite additivity but not vice versa). In any case, we are now
in a position to compute probabilities of various compound events.
Example 3.2. For the experiment of drawing a card, without looking, from a
(well-shuffled) deck of 52 cards, recall that we defined events A = { the card
drawn is an ace }, B = { the card drawn is black }, C = { The card drawn
is a face card } and D = S { the card drawnT is a diamond T }. Let us compute
T
the probabilities
S (a) P (A B), (b) P (A
S S D), (c) P (BS C), (d) P (B D),
(e) P (A C), (f) P (A∆D), (g) P (A C D). P (A B) is 28/52 or 7/13
by direct counting, since there are 28 cards altogether in the deck that are
either ace or black (or both). It couldTalso be found usingTthe union rule, as
P (A) = 1/13, P (B) = 1/2 and P (A B) = 1/26. P (A D) is 1/52, since
there is only one diamond ace. The answers to (c), (d) and (e) are 3/26,
0 and 4/13 respectively (not counting the aces as face cards). P (A∆D) is
15/52, since P (A − B) = 3/52, P (B − A) = 12/52 = 3/13 and A∆D is
the disjoint union of theseStwo (notice that for two disjointT events E and
F , the union
S formula P (E F ) = P (E) + P (F ) − P (E F ) simply reduces
to P (E S F )S= P (E) + P (F ) since the intersection term vanishes). Finally,
P (P (A C D) is 25/52, by direct counting.
Remark 3.1. The union rule for a three-set Venn diagram is a little more
complicated. Just as a Venn diagram with two overlapping sets
S A and B has
22 = 4 disjoint components A − B, B − A, A B and (A B)c , a Venn
T
This is the so-called long multiplication rule, which in fact generalizes to any
finite number of events. If E1 , E2 , . . . , En are n events, then
n
\
P( Ei ) = P (E1 )P (E2 | E1 )P (E3 | E1 ∩ E2 ) . . . P (En | E1 ∩ . . . ∩ En−1 ).
i=1
(3.2)
Notice that if two events A and B are independent, P (A | B) reduces to P (A)
and, similarly, P (B | A) reduces to P (B). In fact, this can be used as the
definition of independence. Let us now see some more examples of conditional
probabilities.
Example 3.5. Suppose our random experiment is rolling a balanced die twice.
The sample space S will have 36 outcomes, each being an ordered pair of whole
Example 3.5. Suppose you are drawing two cards one by one, without look-
ing, from a (well-shuffled) deck of 52 cards with replacement. The sample space
will have 522 = 2704 ordered pairs of cards, all of which are equally likely.
Now, what is the conditional probability of both being face cards, given that
both are spades? Clearly, the intersection of these events has 32 = 9 outcomes
in it whereas the second event itself has 132 = 169. So the answer is 9/169.
Example 3.6. The file cabinet in your office is locked and you have a bunch
of n keys in a key-ring, exactly one of which will open it. You start trying the
keys one by one and once a key has been tried, it is not tried again. What
are the chances that you succeed at the k th attempt (k ≤ n)? If we define
events E1 , E2 , . . . , Ek−1 as Ei = {failing at the ith attempt} and define Ek as
Tk
“succeeding at the k th attempt,” then the desired event E = i=1 Ei . But by
(3.2),
k−2
\ k−1
\
P (E) = P (E1 )P (E2 | E1 ) . . . P (Ek−1 | Ei )P (Ek | Ei ),
i=1 i=1
This is known as the law of total probability. Using this, any of the “reverse”
conditional probabilities P (Aj | B) can be computed as
P (Aj ∩ B) P (B | Aj ).P (Aj )
P (Aj | B) = = Pn . (3.4)
P (B) i=1 P (B | Ai )P (Ai )
This is known as the Bayes theorem. In this context, the P (Ai )’s are called
the prior probabilities of the partition-cells, the “forward” conditional prob-
abilities P (B | Ai )’s are called the likelihoods and the “reverse” conditional
probabilities P (Ai | B)’s are called the posterior probabilities. This simple
result is so powerful that an entire subfield of statistics is based on this idea.
Bayesian inference now dominates the cutting-edge applications of statistics
in the highly challenging data-analysis problems posed by modern science. We
will see more of it later. For the time being, let us see some examples of the
Bayes theorem in action.
Example 3.9. If you are trying to buy an air ticket the day before the 4th
1 1
1 2 1
1 3 3 1
1 4 6 4 1
Now, to rearrangements. If you just have an apple (or A), the number of
different rearrangements of it is just 1. If, instead, you have two items (A and
B), there are two possible rearrangements (AB and BA). For three items A, B
and C, the number is 6 (ABC, ACB, BAC, BCA, CAB and CBA). For 4 items
A,B,C and D, it is 24. If we still try to list all the 24 rearrangements (we will
quit this habit shortly, once we know the formula), the following is the most
efficient way of doing it. For the moment, ignore D and focus on the remaining
three items A, B and C. From the previous step, we know that they have 6
distinct rearrangements. List them all and add the missing letter D at the end
of each of them. You have generated 6 distinct rearrangements of A,B,C and
Having said all these, let us go back to our original question of oligopeptide
synthesis. 9 distinct amino acids can be chosen from a “bag” of 19 in 19 C9 =
19!
(9!)(10!) different ways. A set of 9 distinct amino acids can be permuted in
9! different ways. So, the total number of possible 10AA oligopeptide chains
19!
consisting of distinct AA’s and starting with methionine is ( (9!)(10!) )(9!) = 19!
10! .
In general, the number of different ordered permutations of k distinct objects
n!
chosen out of n distinct objects is (n−k)! , which is denoted by n Pk .
Example 3.11. In the experiment of drawing two cards, without looking, from
a (well-shuffled) deck of 52 cards one by one without replacement, what are the
chances that both are hearts? The answer is n(A)/n(S) where n(S) =52 C2
52! 13!
= (2!)(50!) = 1326 and n(A) =13 C2 = (2!)(11!) = 78. So the chances that both
of them are hearts are about 5.88%.
Example 3.12. If you are randomly permuting the four letters of our genetic
alphabet (i.e., the four nucleotides adenine, guanine, thymine and cytosine or
A,G,T and C), what are the chances that the purines and the pyrimidines are
together? For this problem, n(S) is of course 4! = 24. To find n(A), let us look
at it this way. The ‘purine block’ and the ‘pyrimidine block’ can be permuted
in 2! = 2 ways and within each block, the two bases can be permuted in 2! = 2
ways. So n(A) = (2)(2)(2) = 8 and the answer is 1/3.
Now let us play a different ‘game’ with sample spaces, events and probabili-
ties. For many real-life random experiments, the sample space is very large and
the individual outcomes are not of our interest; instead we are interested in
Example 3.13. In the experiment of tossing a fair coin three times, which
has S = { HHH, HHT, HTH, THH, HTT, THT, TTH, TTT} with equally
likely outcomes, if the ‘quantity of interest’ or random variable (call it X) is
simply the number of heads among the three tosses, the p.m.f. table will be
Values 0 1 2 3
1 3 3 1
Probs 8 8 8 8
Values 2 3 4 5 6 7 8 9 10 11 12
1 2 3 4 5 6 5 4 3 2 1
Probs 36 36 36 36 36 36 36 36 36 36 36
Example 3.15. Suppose ten million tickets of a state lottery have been sold
for a dollar a piece. Only one of them carries a super bumper prize of $ 5000000,
5 of them carry mega-prizes of $ 500000 each, 25 of them carry second prizes
of $ 50000 each, 50 of them carry third prizes of $ 10000 each and another
100 of them carry consolation prizes of $ 1000 each. If you go to a store and
randomly buy a ticket for this lottery, what is the p.m.f. table of your earning
(call it W )? Notice that irrespective of whether you win a prize or not, you al-
ways pay the ticket price. So the p.m.f. table of your earning will be as follows:
In this last example, the important question is what your average (or expected)
earning will be if you repeatedly buy tickets for this lottery. Will it be as high
as the grand prizes this lottery advertises? The expected value Pm or mean of a
random variable W (denoted by E(W ) or µW ) is defined as i=1 wi pi if W
While the expected value is a useful device for comparing two random variables
X and Y (after all, we cannot compare them value-by-value or probability-
by-probability since their p.m.f. tables may not even be of the same length),
it is by no means the whole story. Two completely different random variables
may end up having the same expected value, so we need some other summary-
measures to capture the other differences. Any p.m.f. table can be pictorially
represented by a stick plot or a probability histogram. In a stick plot, the dis-
tinct values are marked along the horizontal axis and a stick is erected over
each value whose height is the corresponding probability. In a probability his-
togram, the sticks are replaced by rectangular bars of equal width centered
at the values. Various features of this plot such as how ‘fat’ or ‘thin’ its tails
are, how asymmetric it is around its expected value and how peaked or flat-
topped it is, are connected to its moments. The rth raw moment of X for
any real number r is defined as E(X r ), i.e., as the expected value of the ran-
dom variable X r which takes the values xr1 , xr2 , . . . with probabilities p1 , p2 , . . .
(x1 , x2 , . . . being the values of X). The rth central moment of X is defined as
E(X −E(X))r , i.e., as the expected value of the random variable (X −E(X))r
which takes the values (x1 − µX )r , (x2 − µX )r , . . . with probabilities p1 , p2 , . . ..
The 2nd central moment of a random variable is called its variance (denoted
2
by σX ) and it is related to the ‘fatness’ or ‘thinness’ of the histogram tail.
Usually the heavier the tail, the greater the variance. The square root of the
variance is known as the standard deviation (denoted by σX ). The 3rd central
moment is related to the degree of skewness (i.e., lack of symmetry) of the his-
togram and the 4th central moment is related to its degree of peakedness. Two
important properties of expected values are (i) E(X + Y ) = E(X) + E(Y )
for any two random variables X and Y and (ii) E(cX) = cE(X) for any
random variable X and any constant c. Simple algebraic expansions and re-
peated use of the above two properties will show that the raw moments and
2
the central moments are related. For example, σX = E(X 2 ) − (E(X))2 . Also,
E(X − E(X)) = E(X ) − 3E(X)E(X ) + 2(E(X))3 . All the raw moments
3 3 2
So, in our ‘needle and ruler’ experiment, the density curve is a flat line on the
interval [0, 6] and the p.d.f. is f (x) = 61 I(x ∈ [0, 6]), where I(.) is the indicator
function that takes the value 1 only if the condition in it is satisfied (otherwise
0). This is known as the Uniform p.d.f. P (X ≤ 2) is the area underneath this
flat line between 0 and 2. Similarly, P (3 ≤ X ≤ 5) is the area between 3 and
5. Formally speaking, for any two real numbers a and b,
Z b
P (a ≤ X ≤ b) = f (x)dx. (3.5)
a
This gives us the formal reason why, for a continuous random variable X,
P (X = x) = 0 for any particular value x, because it is simply the integral
in (3.5) with a = b. Now, if we define a function F (t) : R → [0, 1] as F (t) =
Rt
−∞
f (x)dx, then F (t) is nothing but the area underneath the p.d.f. f (x) up
to the point t or, equivalently, P (X ≤ t). This F is called the cumulative
distribution function (c.d.f.) corresponding to the p.d.f. f . In this case, the
Uniform[0,6] c.d.f. is
Z t
1 t
F (t) = 0 if t ≤ 0; dx or if t ∈ (0, 6); 1 if t ≥ 6. (3.6)
0 6 6
By the fundamental theorem of integral calculus, such an F (t) is a continuous
(if fact differentiable) function with F ′ (x) = f (x). Incidentally, we could also
have defined a c.d.f. for a discrete random variable, but those c.d.f.’s would
be step functions, i.e., their graphs could consist of flat line-segments with
jumps in-between (explain to yourself why). But irrespective of discrete or
continuous, all c.d.f.’s have the following properties:
The density curves of different continuous random variables can have a great
variety of geometric shapes. Here is another example.
Example 3.17. Suppose you touch a 6-inch ruler with a needle with your
eyes closed, and your friend does the same thing independently of you. Let Y1
be the distance between the touching point and the zero-point on the ruler in
your case, and Y2 be that in your friend’s case. If we define Y = Y1 + Y2 , this
Y will have a triangular density on the support [0,12] with p.d.f. f (y) given
by
y 12 − y
f (y) = I(0 ≤ y ≤ 6) + I(6 < y ≤ 12). (3.7)
36 36
How do we know? One way would be to go through the same limiting process
that led us to the Uniform[0,6] density earlier. For this experiment, the natural
discrete counterpart is two persons rolling a balanced die each, independently
of one another. The discrete histogram corresponding to the sum of the two
numbers is essentially triangle-shaped (ignoring the rugged upper contours of
the bars).
Now that we know how continuous random variables behave, all the numerical
summaries we defined for a discrete random variable (i.e., raw and central
moments) can be easily generalized to them. For a continuous X with p.d.f.
f (x) and support D, the rth raw and central moments are defined as
Z Z
r r r
E(X ) = x f (x)dx, E(X − µX ) = (x − µX )r f (x)dx, (3.8)
D D
provided that the integrals exist. Like before, various features of the density
curve (e.g., lightness or heaviness of tails, skewness, flatness, etc.) are con-
nected to its moments and the central moments are expressible in terms of
the raw moments. The MGF of X is also defined analogously as MX (t) =
E(etX ) = D etx f (x)dx if this integral exists on some interval around 0, and
R
the mechanism by which the raw moments are generated from this MGF is
the same as before.
distribution is its memoryless property. Given that no head has appeared until
the k th toss, the conditional probability that there will be no head until the
(k + m)th toss is the same as the (unconditional) probability of seeing no
head in the first m tosses, for any two positive integers k and m. That is,
P (X > k + m | X > k) = P (X > m) = (1 − p)m .
N (0, 1) in the limit as n → ∞. PnIn other words, for n sufficiently large, the
p.d.f. of the z-score of X̄ = n1 i=1 Xi can be well-approximated by a stan-
dard normal p.d.f. This has far-reaching consequences, one of which is the
large-sample normal approximation to discrete p.m.f.’s. A normal p.d.f. also
2
has the reproductive property Pnthat if Xi ∼ N (µ Pin, σi ) for
Pin = 1, . . . , n and they
are independent, the sum i=1 Xi has a N ( i=1 µi , i=1 σi2 ). Since proba-
bility computation using a normal p.d.f. is not possible analytically, extensive
tables are available for ready reference.
A random variable X is said to have an Exponential(β) p.d.f. if the p.d.f. is
given by
1 x
f (x) = e− β , for x ∈ (0, ∞) and β > 0. (3.15)
β
This p.d.f. has mean β, variance β 2 and MGF (1 − βt)−1 for t < β1 . The
t
c.d.f. is F (t) = 1 − e− β . Two interesting and useful facts about this p.m.f.
are (a) its memoryless property and (b) its relation to the geometric p.m.f. s
mentioned earlier. The fact that P (X > t + s | X > t) = P (X > s) = e− β
for any positive t and s is known as the memoryless property (verify it).
If Y is defined as the largest integer ≤ X (also called the “floor” of X),
1
then Y + 1 has a Geometric(p) p.m.f. with p = 1 − e− β . This is because
1 1
P (Y + 1 = y + 1) = P (Y = y) = P (y ≤ X < y + 1) = (1 − e− β )e− β y .
Sometimes the exponential p.m.f. is reparametrized by setting λ = β −1 , so
the p.d.f. looks like f (x) = λe−λx I(x > 0) with mean λ−1 and variance λ−2 .
If X1 , . . . , Xn are i.i.d. random variables having the p.d.f. in (3.15),
Pn then the
minimum of {Xi }ni=1 also has an exponential p.d.f. and the sum i=1 Xi has
a Gamma((n, β)) p.d.f.
α
e− β xα−1 for x > 0, α > 0 and β > 0, (3.16)
Γ(α)β
R∞
where Γ(α) = 0 e−y y α−1 dy is the gamma function with the property that
Γ(ν + 1) = νΓ(ν). This, in particular, implies that Γ(n + 1) = n! for any
nonnegative integer n. The parameter α is called the shape parameter as the
density curve has different shapes for its different values. Its mean is αβ,
variance is αβ 2 and MGF is (1 − βt)−α for t < β1 . Clearly, an exponential
p.d.f. is a special case of (3.16) with β = 1. Also, for α = n2 and β = 2, it
is called a chi-squared (χ2 ) p.d.f. with n degrees of freedom, which is widely
useful because of the connection that Z ∼ N (0, 1) =⇒ z 2 ∼ χ2 with 1 degree
of freedom. The Gamma(α, β) p.d.f. has the reproductive property in the sense
Pn if Xi ∼ Gamma(α
that Pn i , β) for i = 1, . . . , n and they are independent, then
i=1 X i ∼ Gamma( i=1 αi , β).
A random variable X is said to have a Beta(a, b) p.d.f. if the p.d.f. looks like
Γ(a + b) a−1
f (x) = x (1 − x)b−1 , for x ∈ (0, 1), a > 0 and b > 0. (3.17)
Γ(a)Γ(b)
a
This p.d.f. has mean a+b and variance (a+b)2ab
(a+b+1) . Notice that for a = b = 1,
this is nothing but the Uniform[0,1] p.d.f. It also has a connection with the
Gamma(α, β) p.d.f. To be precise, if X ∼ Gamma(α1 , β), Y ∼ Gamma(α2 , β)
X
and X and Y are independent, the ratio X+Y will have a Beta(a, b) p.d.f.
with a = α1 and b = α2 . More generally, if X1 , . . . , Xk , Xk+1 , . . . , Xm are
independent random variables with Xi ∼ Gamma(αi , β) (β > 0 and αi >
Pk Pm
0 for i = 1, . . . , n), then the p.d.f. of i=1 Xi / i=1 Xi is Beta(a, b) with
Pk Pm
a = i=1 αi and b = i=k+1 αi .
So far we have dealt with individual random variables. We now move on to
the case where we have a bunch of them at once. If X and Y are two discrete
random variables, then the joint p.m.f. of the random vector (X, Y ) is given
by P ({X = x} ∩ {Y = y}) for all value-pairs (x, y). It can be imagined as a
two-dimensional table with the values of X and Y being listed along the left
margin and top margin respectively and the joint probabilities being displayed
in various cells. So each row of this table corresponds to a particular value of
X and each column corresponds to a particular value of Y . If we collapse this
table column-wise, i.e., add all the probabilities displayed in each row, thereby
ending up with a single column of probabilities for the values of X, this single
column of probabilities gives us the marginal p.m.f. of X. Similarly, by col-
lapsing the table row-wise (i.e., summing all the probabilities in each column),
we get the marginal p.m.f. of Y . Now, for each fixed value xi of X, the condi-
P (Y =yj and X=xi ) m
tional p.m.f. of Y given that X = xi is nothing but { P (X=xi ) }j=1 ,
assuming that Y takes the values y1 , . . . , ym . Similarly, for each fixed value yi
of Y , the conditional p.m.f. of X given that Y = yi can be defined. The raw
Example 3.19. Suppose the joint p.m.f. of (X, Y ) is given by the table
5 10 15 20
1 1 1 1
0 48 48 12 8
1 1 1 1
1 12 12 6 6
1 1 1 1
2 8 12 48 48
value 5 10 15 20
11 9 13 15
prob 48 48 48 48
where C(θ) = ln c(θ) and D(x) = ln d(x). This is known as the canonical
form of the exponential family. Can you identify the natural parameters θ
and the functions C(.), D(.), πi (.) and ti (.) (i = 1, . . . , n) for the p.m.f.’s and
p.d.f.’s in (3.13)-(3.16)?
Two quick notes before we close our discussion of multivariate random vectors.
From the definition of covariance, it should be clear that two independent
random variables have zero covariance (and hence, zero correlation). So, if
the components of a random vector {X1 , . . . , Xn } are independent random
variables, their dispersion matrix Σ is diagonal (i.e., has zeroes in all off-
diagonal positions). However, the converse is not necessarily true. There exist
random vectors with dependent components that have diagonal dispersion
matrices (can you construct such an example?). Also, for a random vector
with independent components, the joint p.m.f. (or p.d.f.) turns out to be the
product of the individual p.m.f.’s (or p.d.f.’s). And in general, the joint p.d.f.
f (x1 , . . . , xn ) of a continuous random vector (X1 , . . . , Xn ) can be written as
f (x1 )f (x2 | X1 = x1 )f (x3 | X1 = x1 &X2 = x2 ) . . . f (xn | X1 = x1 , . . . , Xn−1
(3.22)
= xn−1 ), which is analogous to (3.2).
Next we turn to the relation between the p.m.f.’s (or p.d.f.’s) of two ran-
dom variables that are functionally related. We will explore some methods of
deriving the p.m.f. (or p.d.f.) of a function of a random variable that has a fa-
miliar p.m.f. or p.d.f. If we were only interested in computing expected values,
this would not be essential, since for a discrete random variable X with val-
ues x1 , x2 , . . . and correspondingPprobabilities p1 , p2 , . . ., the expected value of
Y = g(X) is simply E(g(X)) = i g(xi )pi . Likewise, for a continuous R random
variable X with support D and p.d.f. f (x), we have E(g(X)) = D g(x)f (x)dx.
But sometimes we do need to know the exact p.m.f. or p.d.f. of g(X) and there
are three main methods to derive it from that of X: (a) the c.d.f. method, (b)
the Jacobian method and (c) the MGF method. We illustrate each of these
by means of an example.
Result 3.3. Let X and Y be random variables such that E(| X |r ) and
E(| Y |r ) are both finite for some r > 0. Then E(| X + Y |r ) is also finite
and E(| X + Y |r ) ≤ cr (E(| X |r ) + E(| Y |r )), where cr = 1 if 0 < r ≤ 1 or
cr = 2r−1 if r > 1. This is often called the cr inequality.
Result 3.4. Let p > 1 and q > 1 be such that 1p + 1q = 1. Then E(| XY |)
≤ (E(| X |p ))1/p (E(| Y |q ))1/q . This is well known as the Holder inequality.
Clearly, taking p = q = 2, we get the Cauchy-Schwarz inequality.
Example 3.26. (Schervish (1996)). Let f (x) be the standard normal p.d.f.
and g(y) be the bilateral exponential or Laplace p.d.f. with parameters 0
and 1 (i.e., g(y) = 12 e−|y|) on R. Suppose X ∼ f (x) and Y ∼ g(y). Then
it can be shown that E(X 2 ) = 1, E(| X |) = ( π2 )1/2 , E(Y 2 ) = 2 and
E(| Y |) = 1. Since log fg(x) (x)
= 12 log π2 − 21 x2 + | x |, it turns out that
HXkY (f, g) = 21 log π2 − 12 + ( π2 )1/2 = 0.07209 and HY kX (g, f ) = − 21 log π2 =
0.22579. In other words, if our data actually come from a bilateral exponential
p.d.f., it is easier to figure out that they did not come from a standard normal
p.d.f. than the other way around.
Suppose, now, that X ∼ f (x) where f (x) involves an m-dimensional parame-
ter θ in some parameter space Θ. To emphasize this, we will write it as f (x; θ).
Suppose also that for each i (i = 1, . . . , m), the partial derivative of f (x; θ)
w.r.t. θi exists and the conditions necessary for interchanging the operations
Rof differentiation and integration are satisfied while takingththe derivative of
f (x; θ)dx w.r.t. each θi . Then m × m matrix whose (i, j) entry is the co-
variance between the partial derivatives of logf (x; θ) w.r.t. θi and θj is called
the Fisher information matrix (FIM) for θ based on X. The m × 1 random
vector whose ith coordinate is the partial derivative of logf (x; θ) w.r.t. θi is
often called the score function. So the FIM is simply the variance-covariance
matrix of the score function.
Suppose you are a meteorologist at a local radio station and you read your
weather bulletin every half hour around the clock everyday, which includes a
report on current weather conditions. The weather condition that you report
at a particular time of the day (say, 7:00 A.M.) is, in some sense, a ‘random
variable’ because it can be different on different days (sunny, foggy, rainy,
muggy, clear but cool, etc.). Perhaps today it is sunny at that early morning
hour, but 24 hours from now, it will be raining at 7:00 A.M. In other words,
there may be a transition from one state of weather to another in the 24-
hour period. A similar transition may occur between tomorrow and the day
after tomorrow. So your life-long collection of weather reports at 7:00 A.M.
for that radio station (assuming that you did not get a better job!) is nothing
but a sequence of random variables, each of which takes ‘values’ in the same
‘value-set’ and successive random variables in this sequence may have different
‘values.’ Also, the weather condition at 7:00 A.M. today may be influenced
by how the weather was 24 hours ago or 48 hours ago, but it is unlikely to
be affected by the morning weather condition a fortnight ago or a month
ago. In other words, it is reasonable to assume that the ‘value’ of any random
variable in your sequence is dependent on a limited number of adjacent random
variables in the recent past, but not on the entire “history.”
More formally, a sequence of random variables {X1 , X2 , X3 , . . .} with the same
support or value-set (say, V = {v1 , v2 , v3 , . . .}) is called a stochastic process. V
is called its state space. The index i = 1, 2, 3, . . . usually refers to time. Many
stochastic processes have the property that for any indices i and j, the condi-
tional probability of Xi = vj given the entire past history (i.e., X1 , . . . , Xi−1 )
is only a function of Xi−1 , . . . , Xi−m for some fixed m. If m = 1, the stochas-
tic process is called a Markov chain (after the famous Russian mathematician
A.A. Markov). For a Markov chain, the conditional probabilities of state-to-
(i)
state transitions, i.e., P (Xi = vj | Xi−1 = vk ) = pkj (say) are often assumed
to be independent of the time-index i so we can drop the superscript “(i).”
In that case, it is called a time-homogeneous Markov chain. For such a chain,
these pkj ’s can be arranged in a matrix A whose (k, j)th entry is pkj . This A is
called the one-step transition matrix. Each row of A sums up to 1, since there
will definitely be a transition to some state from the current state. Such a ma-
trix is called a row stochastic matrix. For some Markov chains, the columns
of A also add up to 1 (i.e., a transition is guaranteed to each state from some
0 0 0 1
Notice that the above transition scheme does not allow any “self-loop” for the
states 1, 2 and 3, but it would if the first three diagonal entries were positive.
In any case, the two-step transition probabilities will be given by A2 which is
0 0.6 0.3 0.1 0 0.6 0.3 0.1 0.48 0.234 0.15 0.136
0.7 0 0.25 0.05 0.7 0 0.25 0.05 = 0.05 0.615 0.21 0.125
0.2 0.78 0 0.02 0.2 0.78 0 0.02 0.546 0.12 0.255 0.079
0 0 0 1 0 0 0 1 0 0 0 1
Result 3.8. Let {X1 , X2 , . . .} be a regular Markov chain with one-step tran-
sition matrix A. Its steady-state distribution Π can be obtained by solving
the system of equations: ΠA = Π, Π1t = 1 (where 1t is the m × 1 column
vector of all ones).
0.6 0.4
Example 3.29. Consider a two-state Markov chain with A = .
0.2 0.8
In order to find its steady-state distribution, we need to solve the equations
0.6a∗1 + 0.2a∗2 = a∗1 , 0.4a∗1 + 0.8a∗2 = a∗2 and a∗1 + a∗2 = 1. The solutions are
a∗1 = 31 and a∗2 = 23 .
Result 3.10. Recall from Example 3.28 that a state i is called an absorbing
barrier if the (i, i)th entry in the one-step transition probability matrix A is 1.
Let B be the set of all absorbing barriers in the (finite) state space of a Markov
chain. Assume that there is a path from every state outside B to at least one
state in B (a path being a sequence of states i1 i2 . . . iL such that pij ij+1 > 0
for 1 ≤ j ≤ L − 1). Then, letting νs denote the time needed by the chain to go
P (k)
from a state s outside B to some state in B, we have: P (νs ≤ k) = r∈B pir ,
(k)
where pir is the (i, r)th element of Ak . This νs is often called the time to
absorption of a non-absorbing state s.
For any state s in the state space of a Markov chain {X1 , X2 , . . .}, define
(0) (k) (k−1) (k)
Ts = 0 and Ts = inf{n > Ts : Xn = s} for k ≥ 1. This Ts is usually
(1)
known as the time of the k th return to s. Let ηrs = P (Ts < ∞ | X0 = r).
(k) (k−1)
Then intuitively it should be clear that P (Ts < ∞ | X0 = r) = ηrs ηss .
In other words, if we start at r and want to make k visits to s, we first need
to go to s from r and then return k − 1 times to s. A state s is said to be
recurrent if ηss = 1. If ηss < 1, it is called transient. A subset ∆ of the state
space is called irreducible if r ∈ ∆ and s ∈ ∆ =⇒ ηrs > 0. A subset ∆∗ of the
state space is called closed if r ∈ ∆∗ and ηrs > 0 =⇒ s ∈ ∆∗ .
Let us now stretch our imagination a little bit more and think of a scenario
where {X1 , X2 , . . .} is a Markov chain but is no longer directly observable.
Instead, when the event {Xi = s} occurs for any state s, we only get to
see a ‘manifestation’ of it. The question that immediately comes to mind is
how accurately one can guess (or ‘estimate’) the true state of the underlying
Markov chain. Going back to your daily job as a meteorologist at the local
radio station, suppose a person is not directly listening to your 7:00 A.M.
weather report (perhaps he/she does not have a radio in his/her room or
is too lazy to get off the bed and turn it on). Instead, he/she is trying to
guess the content of your report by watching his/her family members’ reac-
tions. For example, if the person hears his/her spouse calling her/his office
to announce a late arrival plan this morning, it may be because a torrential
downpour is going on and the rush-hour traffic will be a mess. Or it may
be because a wonderful, sunny morning has inspired his/her spouse to spend
a few hours at the local golf course before reporting to work today. More
formally, when the underlying chain visits the state s, an observable manifes-
tation Mi is chosen according to a p.m.f. on the set of possible manifestations
M = {M1 , . . . , ML }. This is actually a conditional p.m.f. given s. So there
Example 3.30. Suppose you are playing a dice game with a partner who
occasionally cheats. The rule of the game is that you earn $ 100 from your
partner if you roll a 4, 5 or 6 and you pay him/her $ 100 if any of the other
three numbers turn up. If played with a ‘perfect’ or ‘balanced’ die, it is a
fair game, which is easy to see once you write down the p.m.f. table for
your earning and compute the expected value. But your partner, who sup-
plies the die, is occasionally dishonest and secretly switches to an unbalanced
die from time to time. The unbalanced die has P (1) = P (2) = P (3) = 41
1
and P (4) = P (5) = P (6) = 12 . If the latest roll has been with the balanced
die, he/she will switch to the unbalanced one for the next roll with proba-
bility 0.05 (i.e., stay with the balanced one with probability 0.95). On the
other hand, the chances of his/her switching back from the unbalanced one
to the balanced one is 0.9. Here, if Yi denotes the outcome of your ith roll,
then {Y1 , Y2 , . . .} follows a hidden Markov model (HMM) with an underlying
Markov chain {X1 , X2 , . . .} whose state spaceis { balanced,unbalanced } and
0.95 0.05
one-step transition probability matrix is A = . The alphabet of
0.9 0.1
emitted letters here is {1, 2, 3, 4, 5, 6} and the conditional p.m.f. on it switches
between { 61 , 16 , 16 , 16 , 16 , 16 } and { 41 , 14 , 14 , 12
1 1
, 12 1
, 12 }, depending on the true na-
ture of the die used. If the chances are very high (say, 99%) that your partner
will not begin the game by cheating, the initial distribution for the underlying
chain will be (π1 = 0.99, π2 = 0.01).
For an HMM like this, there are three main questions: (a) Given A, P and
π = (π1 , . . . , πm ), how to efficiently compute the likelihood (or joint probabil-
ity) of the observed manifestations {Y1 , Y2 , . . . , YK }? (b) Given {Y1 , Y2 , . . .},
how to efficiently estimate the true state-sequence {x1 , x2 , . . .} of the under-
lying Markov chain with reasonable accuracy? (c) Given the ‘connectivity’
or ‘network structure’ of the state space of the underlying chain (i.e., which
entries of A will be positive and which ones will be 0), how to efficiently find
the values of A, P and π that maximize the observed likelihood mentioned in
(a)? Here we will briefly outline the algorithms designed to do all these. More
details can be found, for example, in Ewens and Grant (2001).
(k+1) Pm (k)
we immediately get the induction relation: γi = j=1 γj pji pi (yk+1 )
(k+1)
where pji is the (j, i)th entry of A. This is an expression for γi in terms
(k) (1)
of {γj ; j = 1, . . . , m}. So, first we compute γi for i = 1, . . . , m and then,
(2)
using the induction formula, compute γi for all i’s which will subsequently
(3)
produce the values of γi ’s through the induction formula again. Continuing
(K)
in this manner, we will get the γi ’s for all i’s and then we are done. This is
called the forward algorithm because of the forward induction it uses.
(k)
For the backward algorithm, our aim is to compute δi = P (Yk = yk , . . . YK =
yK | Xk = si ) for i = 1, . . . , m and 1 ≤ k ≤ K − 1. We initialize the process by
(K) (k−1) Pm (k)
setting δj = 1 for all j’s. Then we notice that δi = j=1 pij pj (yk−1 )δj ,
due to the conditional independence of the Yj ’s given the state of the under-
lying chain. Using this backward induction formula, we gradually compute
(K−1) (K−2) (0)
δi for 1 ≤ i ≤ m, δi for 1 ≤ i ≤ m, and so forth. Once we get δi
for all i’s, we multiply each of them by the corresponding initial probability
πi to obtain P (Y1 = y1 , . . . , YK = yK and X1 = si ). The desired likelihood is
nothing but the sum of this quantity over i from 1 to m.
n n
1X 1 X
αβ = Xi = X̄; αβ 2 = (Xi − E(Xi ))2 = s2 .
n i=1 n − 1 i=1
In our discussion of the Viterbi algorithm for hidden Markov models, we saw
how to find the true underlying state-sequence that maximizes the probability
of joint occurrence of the observed manifestations. If we apply the same prin-
ciple here and try to find those values of the parameter(s) θ that maximize
the joint probability of occurrence (or the likelihood function) of the observed
data x1 , . . . , xn , they will be called the maximum likelihood (ML) estimate(s)
of the parameter(s). Usually, once the likelihood is written down as a function
of the parameter(s) (treating the observed data as fixed numbers), setting
its partial derivative w.r.t. each parameter equal to zero gives us a system
of equations. Solving it, we get the critical points of the likelihood surface.
Some of these will correspond to local maxima, others to local minima and
still others will be saddle points. Using standard detection techniques for local
maxima and finding the one for which, the likelihood surface is the highest, we
can get ML estimates of the parameter(s). Often the above procedure is ap-
plied to the natural logarithm of the likelihood function, which still produces
the correct answers because the logarithmic transformation is monotone (i.e.,
preserves “increasingness” or “decreasingness”). Clearly, the ML estimate of a
parameter is not necessarily unique. It will be so if the likelihood surface is, for
example, unimodal or log-concave. Here are some examples of ML estimation.
Example 3.34. Let Xi ’s be i.i.d. Gamma(1, β), that is, Exponential(β). Then
P n
xi
the log-likelihood function is logL(β; x1 , . . . , xn ) = −nlogβ − i=1
β , so that
d 1
Pn
dβ logL(β; x1 , . . . , xn ) = 0 ⇒ β̂ = n i=1 xi .
and try to minimize it w.r.t. γ and the βi ’s. It can be done in the usual way,
by equating the partial derivatives of (3.31) w.r.t. each of those parameters to
zero and solving the resulting system of equations. The solution turns out to
be (Xt V−1 X)−1 Xt V−1 Y, where σ 2 V is the variance-covariance matrix of the
ǫi ’s. This is known as the least-squares estimator. In case the ǫi ’s are assumed
to be normal, the MLE’s of the parameters γ, β1 , . . . , βk actually coincide with
their least-squares estimators. In almost all real-life scenarios, the matrix V
will be unknown and will, therefore, have to be estimated. In the special case
where V is simply In×n , the least-squares estimator of (γ, β1 , . . . , βk ) takes
the more familiar form (Xt X)−1 Xt Y.
where U and V are two independent random variables following N (0, 1) and
χ2 (ν) respectively, is Student’s t with ν degrees of freedom. It is a p.d.f. for
which extensive tables of percentiles are available. So, in case the sample size n
is not large, we should replace zα/2 in the above confidence interval formula by
tα/2 (ν), provided that the data came from a normal distribution. This is be-
cause if {X1 , . . . , Xn } is a random sample from a N (θ, σ 2 ) distribution, it can
be shown using a technique called Helmert’s orthogonal transformation (see
Rohatgi and Saleh (2001), p 342) that X̄ and (n − 1)S 2 /σ 2 are independent
and, of course, n1/2 (X̄ − θ)/σ ∼ N (0, 1) and (n − 1)S 2 /σ 2 ∼ χ2 (n − 1).
Next we look at some criteria for picking the ‘best’ estimator (if there is
one) from a bunch of competing estimators. One criterion (unbiasedness) has
already been mentioned. But there are others that may be more desirable
or justifiable than unbiasedness under different circumstances. One example
is concentration. Let X1 , . . . , Xn be a random sample from a p.d.f. or p.m.f.
Result 3.14. Suppose that X1 , . . . , Xn are i.i.d. observations from a p.d.f. (or
p.m.f.) f (x; θ) and T (X1 , . . . , Xn ) is an unbiased estimator of η(θ). Suppose
also that d η(θ) = η ′ (θ) exists and f (x; θ) satisfies the following regularity
dθ
conditions:
∂
(i) logf (x; θ) exists for all x and all θ;
∂θ
∂
(ii) 0 < Eθ [( logf (X; θ))2 ] < ∞ for all values of θ;
∂θ
∂
R R Qn R R ∂ Qn
(iii) ... i=1 f (xi ; θ)dx1 . . . dxn = ... i=1 f (xi ; θ)dx1 . . . dxn ;
∂θ ∂θ
∂
R R Qn
(iv) ∂ θR
. . . T (x1 , . . . , xn ) i=1 f (xi ; θ)dx1 . . . dxn
Qn
. . . T (x1 , . . . , xn ) ∂∂θ i=1 f (xi ; θ)dx1 . . . dxn ,
R
=
where the multiple integrals in (iii) and (iv) are to be replaced by multiple
sums in case f (x; θ) is a discrete p.m.f. Then we must have
(η ′ (θ))2
varθ (T ) ≥ . (3.33)
nEθ [( ∂ logf (X; θ))2 ]
∂θ
Example 3.38. Let {X1 , . . . , Xn } be a random sample from the Pnp.d.f. f (x; θ) =
θx (1 − θ)1−x for x ∈ {0, 1} and θ ∈ (0, 1). The statistic Y = i=1 Xi has the
p.d.f. fY (y; θ) =n Cy θy (1 − θ)n−y for y = 0, 1, . . . , n. The conditional proba-
bility P (X1 = x1 , . . . , Xn = xn | Y = y) is
Qn Pn Pn
xi 1−xi xi n− xi
i=1 θ (1 − θ) θ 1 (1 − θ) 1 1
y (1 − θ)n−y
= y (1 − θ)n−y
= ,
C
n y θ C
n y θ C
n y
for all θ. But the last sum above is a polynomial in θ/(1 − θ), so it being zero
for all θ must imply that the coefficients are all zero. In other words, ψ(t) = 0
for t = 0, 1, . . . , n. Hence, T is minimal sufficient for θ.
Example 3.48. Consider the Poisson(λ) example again. We will now derive
a UMVUE for η(λ) = e−λ following the prescription in Result 3.16. For this
purpose, we can start with any unbiased estimator of e−λ . One such estima-
Pn
tor is I{0} (X1 ), which is a Bernoulli(e−λ ) random variable. Clearly, 1 Xi
is sufficient for λ, by the factorization theorem. It is actually minimal suf-
ficient, since its p.m.f. belongs to the exponential family (see the remark at
the end of Example
Pn 3.42). So, according to the Lehmann-Scheffe theorem,
E(I{0} (X1 ) | 1 Xi ) will be a UMVUE of λ. P To see what this conditional
n
expectation actually is, notice that P (X1 = 0 | 1 Xi = r) is equal to
Pn
P (X1 = 0 and 2 Xi = r) e−λ e−(n−1)λ ((n − 1)λ)r /r!
Pn = ,
P ( 1 Xi = r) e−nλ (nλ)r /r!
−1 r
Pn simplifies to (1 − n )P. nIn this derivation, we have used the fact that
which
1 X i ∼ Poisson(nλ) and 2 Xi ∼ Poisson((n −P 1)λ). In any case, since
n −1 r
I{0} (X1 ) takes the values 0 and 1 only, E(I{0} (X1 ) | P 1 Xi = r) = (1−n ) .
Pn −1 Xi
In other words, E(I{0} (X1 ) | 1 Xi ) = (1 − n ) , which must be a
−λ
UMVUE of e .
We conclude this section with testing of hypotheses. It is closely related to
interval estimation or confidence-set estimation, mentioned in the previous
section. Simply speaking, a hypothesis is a claim, assertion or conjecture about
the parameter θ of the p.d.f. or p.m.f. generating the data. Most often these
claims or assertions will be made by somebody who has something to gain
if they are true—perhaps a manufacturer of light-bulbs claiming the superi-
ority of his/her product over other brands in terms of average lifetime (the
parameter θ) or a drug company claiming its hypertension-lowering drug to
be better than the existing brands in terms of the average duration of effect
(θ) or a genomics researcher conjecturing that certain genes will be ‘differen-
tially expressed’ (i.e., will have different average expression-values) under two
different experimental conditions (‘treatments’). Such a claim or assertion is
often called the research hypothesis or the hypothesis of interest. A statisti-
cian’s job is to confirm or refute it on the basis of the ‘evidence’ in the data
{X1 , . . . , Xn }. In order to understand how this is accomplished, we first need
to formalize the setup and introduce some notations.
The research hypothesis is commonly denoted by H1 (sometimes Ha , because
another name for it is ‘alternative hypothesis’). Faced with such an H1 , the
statistician does not fall for it and keeps an open mind regarding the oppo-
site statement or assertion (i.e., the one which negates or nullifies H1 ). This
opposite statement is usually called the null hypothesis and denoted by H0 .
In any of these cases, having observed the data X = {X1 , . . . , Xn }, our task
is to come up with a decision rule δ(X) (often called a test function) that is
the indicator function of a region in Rn and H0 will be rejected in favor of
H1 if and only if δ(X) = 1. The region in Rn associated with δ is usually
called the rejection region or the critical region of the test. Of course, given
α, we have to find a δ that satisfies: Eθ δ(X) ≤ α for all θ ∈ Θ0 . This is often
referred to as the size requirement of the test. Let us denote the collection of
all test functions δ with size α by ∆α . The quantity Eθ δ(X) = Pθ [δ(X) = 1]
is a function of θ for a fixed δ (denote it by βδ (θ)). For θ ∈ Θ1 , it is called
the power function of δ. For a particular θ ∈ Θ1 , if there is a test function
δ0 ∈ ∆α such that βδ0 (θ) ≥ βδ (θ) for all δ ∈ ∆α , we call it the most powerful
(MP) size-α test at that θ. If we are fortunate enough to find a test function
δ ∗ ∈ ∆α which is MP at every single θ ∈ Θ1 , it will be called a uniformly
most powerful (UMP) size-α test. Two important remarks before we see some
examples: (1) The actual definition of a test function δ is more general; it can
be any integrable function from Rn −→ [0, 1]. But here we restrict ourselves
to indicator functions only. (2) Often the test function will depend on the data
only through a sufficient statistic which has a lower dimension. In that case, δ
Example 3.49. Let {X1 , . . . , Xn } be i.i.d. N (µ, 1) random variables where the
mean µ is unknown and suppose we are testing H0 : µ = µ0 vs. H1 : µ = µ1 ,
with µ1 > µ0 and α = 0.05. A possible test function δ would be the indicator
zα
function of the interval (µ0 + √ n , ∞), that is, a test with critical region
1.645
(µ0 + √n , ∞). It clearly satisfies the size requirement, since under H0 ,
√
X̄ ∼ N (µ0 , n1 ), so that n(X̄ −µ0 ) is a standard normal random√variable. The
power of this test at µ = µ1 is Pµ1 [X̄ ∈ (µ0 + 1.645
√
n , ∞)] =√Pµ1 [ n(X̄ − µ1 ) >
√
n(µ0 − µ1 ) + 1.645], which is the tail-area to the right of n(µ0 − µ1 ) + 1.645
under a standard normal curve. Is this test “best” in some sense? We will
return to that question.
The fact that the most powerful test in the above example had a critical region
that corresponded to the highest values of the ratio f1 (x)/f0 (x) (the likelihood
ratio) is just an illustration of the following well-known result in hypothesis
testing:
If we now denote the quantity on the right-hand side of the last Pinequality
n
by a∗ , the critical region of a most powerful testPtakes the form: 1 xi ≤ a∗ .
n ∗
Pn level of such a test will be Pθ0 ( 1 Xi ≤ a ). In this case, we
The significance
know that 1 Xi ∼ Gamma(n, θ), so for a pre-specified α, the appropriate
choice for a∗ can be determined from the integral equation
Z a∗
1 n n−1 −xθ0
θ0 x e dx = α.
0 Γ(n)
In other words, a∗ will have to be the αth percentile of a Gamma(n, θ0 ) p.d.f.
L′ (θ; x1 , . . . , xn )
θ0 = θ − , (3.34)
L′′ (θ; x1 , . . . , xn )
An alternative to the above method that does not suffer from these drawbacks
is the EM algorithm. It was originally devised for problems with missing data
(e.g., due to censoring or truncating). So it is particularly suitable for problems
where some ‘latent’ or ‘hypothetical’ data (that are unknowable and, hence,
missing) have been introduced for analytical or computational convenience.
The following is an example of this algorithm in use.
Example 3.55. Suppose we have a bimodal dataset and would like to fit a
mixture of two normal distributions to it. In other words, we are assuming that
X1 , . . . , Xn are i.i.d., with each of them coming from either a N (µ1 , σ12 ) or from
a N (µ2 , σ22 ) p.d.f. Of course, it is unknown which Xi belongs to which normal
p.d.f., but the probability that it comes from N (µ1 , σ12 ) is p ∈ (0, 1) and that it
comes from N (µ2 , σ22 ) is 1 − p. Although this is not a missing-data problem as
such, do you see how it can be interpreted as one? We could introduce a bunch
of i.i.d. Bernoulli(p) random variables Z1 , . . . , Zn , with Zi = 1 indicating that
Xi came from N (µ1 , σ12 ) and Zi = 0 indicating that Xi came from N (µ2 , σ22 ).
These Zi ’s would then be latent or unobserved ‘data’. If we knew the values
of Z1 , . . . , Zn , the ‘success’ parameter p would be estimated simply by their
average. Even if we do not know them, a simple application of the Bayes
theorem yields the following expression for the conditional expectation of Zi
and
n n
1 X 1 X
σ̂12 = (Xi −µ̂1 )2 E(Zi | Xi ) , σ̂22 = (Xi −µ̂2 )2 [1−E(Zi | Xi )].
np 1 n(1 − p) 1
(3.37)
Once these MLEs are obtained, they will be used in the ’expectation’ step of
the next iteration.
Although estimators and testing methods such as the MLE and the GLR
are widely used, it is often difficult to derive analytic expressions for some
of their important features such as bias, variance or power. If the underlying
sample-size is large, asymptotic approximations can be made to those quanti-
ties, but most real-life problems have moderate or small sample-sizes. There is
another computer-intensive alternative—a resampling procedure called boot-
strap (Efron 1979). The idea behind it has some similarity with the method-of-
moments estimation technique described earlier. In order to get the method-
of-moments estimators of parameters, we equate the population moments (in-
volving those parameters) with the corresponding sample moments. In the
case of bootstrap, we estimate functionals of the true (unknown) distribu-
tion function (e.g., moments, quantiles, etc.) with the corresponding func-
tionals of the empirical distribution function of our sample data. Recall that
the empirical c.d.f. of the sample observations X1 , . . . , Xn is a step-function
with a ‘jump’ of n1 at each Xi . How can we compute its quantiles and other
functionals? By drawing a random sample (of size m ≤ n) from it, which
amounts to sampling from the sample data we already have. Hence the term
resampling. This resampling is typically done many, many times and it can
be carried out with replacement or without replacement. Since the empirical
c.d.f. of the original sample gives equal weight n1 to each data-point, each
of them is equally likely to be selected during the resampling process. How-
ever, there is a procedure called weighted bootstrap where the data-points in
get the desired 100(1√ − α) % confidence √ interval for the population median as
(M̄ b − zα/2 sbM / N, M̄ b + zα/2 sbM / N ). There is an extensive literature on
bootstrap discussing conditions under which bootstrapped estimators asymp-
totically converge to their target parameters, but those are beyond the scope
of our present discussion.
the CLT,
( n )
√ 1X
Z
n g(xi ) − g(x)f (x)dx =⇒ N (0, σg2 )
n 1 X
where w(x) = f (x)/f ∗ (x) is usually called the importance weight. As a re-
sult, all we need to do is to draw n i.i.d. observations x∗1 , . . . , x∗n from f ∗ and
evaluate w(x∗i ) for each Rof them. Then, following
Pn the MC principle, we will ap-
proximate the integral X g(x)f (x)dx by 1 g(x∗i )w(x∗i ). This is once again
So in order to achieve Rthis lower bound, we must use the proposal density
f ∗ (x) =| g(x) | f (x)/[ X | g(x) | f (x)dx]. Sometimes it is easy to sample
from this proposal density, but more often it is difficult. In those cases, one
may have to resort to a Markov chain Monte Carlo (MCMC) sampling scheme
such as the Metropolis-Hastings (MH) algorithm or the Gibbs sampler (GS).
We first describe the MH algorithm, since GS can be viewed as a special case
of it.
The MH algorithm is named after N. Metropolis who first published it in
1953 in the context of the Boltzmann distribution, and W. K. Hastings who
generalized it in 1970. Suppose we want to sample from the density f (x).
This algorithm generates a Markov chain {x1 , x2 , . . .} in which each xi de-
pends only on the immediately preceding one (i.e., xi−1 ). Assume that the
current state of the chain is xt . To move to the next state, the algorithm
uses a proposal density f ∗ (x; xt ) which depends only on the current state and
is easy to sample from. Once a new observation x∗ is drawn from the pro-
posal density and a random variable U is generated from the Uniform[0,1]
density, x∗ is accepted to be the next state of the chain (i.e., we declare
xt+1 = x∗ ) if U < min{1 , f (x∗ )f ∗ (xt ; x∗ )/[f (xt )f ∗ (x∗ ; xt )]}. Otherwise we
declare xt+1 = xt . One commonly used proposal density is the normal den-
sity centered at xt and having some known variance σ 2 (or known variance-
covariance matrix σ 2 I in the multivariate case). This proposal density will
generate new sample-observations that are centered around the current state
xt with a variance σ 2 . Incidentally, this choice for f ∗ would be allowed under
the original Metropolis algorithm too, which required the proposal density to
be symmetric (i.e., f ∗ (xt ; x∗ ) = f ∗ (x∗ ; xt )). The generalization by Hastings
removed this ‘symmetry’ constraint and even allowed proposal densities to be
just a function of xt (i.e., to be free from x∗ ). In this latter case, the algorithm
is called independence chain Metropolis-Hastings (as opposed to random walk
Metropolis-Hastings when the proposal density is a function of both xt and
x∗ ). While the ‘independence chain’ version can potentially offer higher accu-
racy than the ‘random walk’ version with suitably chosen proposal densities,
3.10 Exercises
2. Suppose you are drawing two cards (with your eyes closed) one by one with-
out replacement from a well-shuffled deck of 52 cards. How many outcomes
are there in the sample space? What are the chances that the two cards are
of different colors? That they belong to different suites? Given that the first
card turned out to be black, what are the chances that the second card will
4. How many distinct ten-digit phone numbers are possible if the first digit of
the area code, as well as the first digit of the three-digit exchange number, is
not allowed to be zero? If you are randomly choosing such a phone number,
what are the chances that it will have an area code of Chicago (i.e., 312)?
5. Suppose you are randomly permuting the letters of the alphabet. What are
the chances that the vowels are together in the correct order AEIOU? That
the vowels are together (in any order)? That the positions of the vowels are
multiples of 5 (i.e., 5th , 10th , . . . , 25th )?
8. You learn from the local newspaper that there have been 5 automobile
accidents in your town in the last 7 days. What are the chances that they all
happened on the same day? That they happened on 5 different days? That at
least two of them happened on the same day?
10. A fair coin is tossed repeatedly. How many tosses must be made so that
the chances of at least one TAIL occurring is more than 90% ?
11. Show that if two different coins (both with the same P (H) = p) are be-
ing repeatedly tossed independently of one another and Xi is the number of
tosses needed for the ith coin (i = 1, 2) to produce the first HEAD, the p.m.f.
of Y = X1 + X2 is the same as it would be if Y counted the number of tosses
12. Write down P (X = k) where X has a Binomial(n, p) p.m.f. Then take its
limit as n → ∞ and p → 0 with np remaining constant. Show that you get a
Poisson p.m.f. as a result.
13. Show that each of the following functions is a legitimate p.d.f. on the real
line and find its mean if you can: (a) f (x) = 21 e−|x| , (b) f (x) = π(1+x
1
2 ) . [Note:
The first one is actually known as a bilateral exponential or Laplace p.d.f. and
the second one is known as a Cauchy p.d.f.]
18. For X ∼ Normal(µ, σ 2 ), find the Fisher information matrix for its two
parameters.
19. Let {X1 , . . . , Xn } be an i.i.d. sample from the Gamma(α, β) p.d.f. Can
you find the maximum likelihood estimates of its two parameters?
20. Suppose {X1 , . . . , Xn } are i.i.d. having a zero-inflated Poisson p.m.f. with
parameters ω ∈ (0, 1) and λ > 0, that is, P (Xi = 0) = ωI(Xi = 0)+(1−ω)e−λ
and P (Xi = k) = (1 − ω)e−λ λk /k! for k = 1, 2, . . .. Find the method-of-
moments estimators for its two parameters.
21. Suppose an insect is laying its eggs on tree-leaves. The number of eggs (X)
References
[1] Bhat, U.N. (1984) Elements of Applied Stochastic Processes. New York: Wiley.
[2] Cramér, H. (1946) Mathematical Methods of Statistics. Princeton University
Press.
[3] Dempster, A.P., Laird, N.M. and Rubin, D.B. (1977) Maximum Likelihood
from Incomplete Data via the EM Algorithm. In Journal of the Royal Statistical
Society. Series B (Methodological) 39:1, pp. 1–38.
[4] Efron, B. (1979) Bootstrap Methods: Another Look at the Jackknife. In The
Annals of Statistics 7:1, pp. 1–26.
[5] Ewens, W.J. and Grant, G. (2001) Statistical Methods in Bioinformatics: An
Introduction. New York: Springer-Verlag.
[6] Leon, S.J. (1998) Linear Algebra with Applications. Prentice-Hall.
[7] Mood, A.M.F., Graybill, F.A. and Boes, D.C. (1974) Introduction to the Theory
of Statistics. McGraw-Hill; Kogakusha.
[8] Press, W.H., Teukolsky, S.A., Vetterling, W.T. and Flannery, B.P. (1986) Nu-
merical Recipes: The Art of Scientific Computing. Cambridge University Press.
[9] Rao, C.R. (1965) Linear Statistical Inference and its Applications. New York:
Wiley.
[10] Rohatgi, V.K. and Saleh, A.K.M.E. (2001) An Introduction to Probability and
Statistics. New York: Wiley.
[11] Schervish, M.J. (1996) Theory of Statistics. Springer.
[12] Shmueli, G., Minka, T.P., Kadane, J.B., Borle, S. and Boatwright, P. (2005)
A useful distribution for fitting discrete data: revival of the Conway-Maxwell-
Poisson distribution. In Journal of the Royal Statistical Society Series C (Applied
Statistics). 54:1, pp. 127–142.
Classification Techniques
101
Figure 4.2 Scatterplot of petal length and petal width for the iris data.
This gives the overall misclassification probability plus d times the overall
doubt probability.
πk p(k|x)
Let p(k|x) = P (C = k|x = x) = PK be the posterior probability of
πℓ p(ℓ|x)
ℓ=1
class k given a feature vector x = x.
Figure 4.4 Demonstration of decision boundary in the case of two normal populations
with equal variances.
where I(·) denotes the indicator function and yi the label of observation i in the
training data set T . The empirical Bayes risk corresponds to misclassification
error rate in T ; i.e., the average number of misclassifications in the training
data.
Since the risk R(c) can not be computed directly, but only approximated by
Rn (c), it is not reasonable to look at classifiers (functions) that minimize Rn (c)
among all possible functions. The reason is that one can always construct such
a function that performs perfectly on the training data and always misclassifies
new observations. Hence, avoiding over-fitting the training data becomes an
important consideration. This can be achieved in two ways: (i) restrict the
class of functions (classification rules) over which the minimization takes place
The objects in class k are assumed to be normally distributed with mean vector
µk and covariance matrix Σk . Then, the Bayes rule decision rule chooses for
each observation with feature vector x the class k that minimizes
Qk (x) = −2 log(p(x|k)−2 log(πk ) = (x−µk )′ Σ−1
k (x−µk )+log |Σk |−2 log(πk ).
(4.3)
The first term of (4.3) corresponds to the Mahalanobis distance of object i
from the center of class k. This rule is known in the literature as quadratic
discriminant analysis.
The expression in (4.3) simplifies if one is willing to assume equal covariance
matrices amongst the K groups; i.e., Σ1 = · · · = ΣK ≡ Σ. In that case the
rule minimizes,
Qk (x) = −2 log(p(x|k) − 2 log(πk ) = µk Σ−1 x + µ′k Σ−1
k µk − 2 log(πk ). (4.4)
Therefore, the rule becomes linear in the data x. For a 2-class problem, it
corresponds to Fisher’s linear discriminant that was derived based on a differ-
ent criterion. The above rule is known in the literature as linear discriminant
analysis.
Parametric models can be used in more complex situations, where for example
the data exhibit clear multi-modality. In that case, one can employ a finite
mixture of multivariate normal distributions as the conditional class density.
However, the problem of estimating all the parameters involved (means, co-
variances and mixing coefficients) is not a trivial one and care should be taken
regarding identifiability issues (see [44]).
Figure 4.5 Decision boundaries for linear discriminant analysis for the Iris data set.
Logistic Discrimination
This model arises when one wants to model the posterior probabilities of the
K classes through linear functions of x. As a motivating example, consider the
normal model for the K classes with common covariance matrix. By comparing
the ratio of the class k posterior probability to that of class 1, we obtain
p(k|x)
log( ) = (x − µk )′ Σ−1 (x − µk ) − (x − µ1 )′ Σ−1 (x − µ1 ) + log(πk /π1 ) =
p(1|x)
Figure 4.6 Decision boundaries for quadratic discriminant analysis for the Iris data
set.
thus modeling the log-odds by a linear function. This model implies that
odds increase multiplicatively by eβkh for every unit increase in the value of
the attribute xh . This procedure can be generalized to allow modeling of the
log-odds by more general functions.
In case one is not willing to assume that the underlying populations are nor-
mally distributed, we need to resort to nonparametric methods for estimating
p(x|k) and its sample counterpart p(x|k, T ). The naive estimate of the un-
derlying density is the sample histogram of the training dataset T . The main
problem with this estimate is its lack of “smoothness.” A possible solution is
the use of kernel methods to smooth it. The estimate then takes the following
form
nk
1 X 1 x − xi
p(x|k, T ) = K( ), (4.8)
nk i=1 h h
R
where h is the bandwidth and K the kernel that satisfies sample space K(x)dx =
1.
The choice of h (a scalar parameter) controls the “smoothness” of the resulting
estimate. For small values of h we get more wiggly estimates, while for large
values of h fairly smooth ones. Possible choices of the kernel function K include
the Gaussian, the rectangular, the triangular, the Epanechnikov, etc. [36].
There are various automatic approaches for choosing the bandwidth that have
been proposed in the literature (for a discussion see [36]). In high dimensions
most of the underlying sample space is empty of objects. The latter fact implies
that one needs to choose either a very large value of h, or use a product
estimate of p(x|k, T ).
The product estimate of p(x|k, T ) leads to the naive Bayes classifier, that has
remained popular over the years. Specifically, it is assumed that conditional
on the class C = k, the features are independent; i.e.,
K
Y
p(x|k, T ) = pj (xj |k, T ).
j=1
The version with r = 1 corresponds to dividing the data space into the cells of
the Dirichlet tessellation of the data points, and every new observation is clas-
sified according to the label of the cell it falls in. The behavior of the 1-nearest
neighbor classification can be characterized asymptotically. Specifically, let E ∗
denote the error rate of the Bayes rule in a K-class problem. Then the error
rate of the 1-nearest neighbor rule averaged over training sets converges to
a value E1 which is bounded above by E ∗ (2 − K/(K − 1)E ∗ ) (see [11] ). In
another development, Stone [38] showed that if the number of neighbors used
r → ∞, while r/N → 0, the risk for the r-nearest neighbor rule converges
in probability to the Bayes risk (not averaged over training data sets). How-
ever, these results are asymptotic in nature and do not necessarily apply to
finite samples. In particular, these results are independent of the metric used
for defining the nearest neighbor (e.g., Euclidean). Experience shows that the
choice of metric can be important.
The flexible boundaries produced by nearest neighbor classifiers are illustrated
in Figure 4.7, where the value r = 3 was chosen. It can be seen that one
observation from the Viriginica class is classified as Versicolor and vice versa,
thus exhibiting a slightly better apparent misclassification error rate than
linear discriminant analysis.
Classification Trees
The goal of classification trees is to partition the feature space into hypercubes
and assign a class to every hypercube.
We illustrate their use by an example. In Figure 4.8 the classification bound-
aries for the three classes in the iris data are shown, corresponding to the tree
shown in the right panel. It can be seen that if the objects’ petal length is less
than 24.5 then they are assigned to class Setosa, while if it is larger than 24.5
to some other class. Then, if petal width is larger than 17.5 and petal length
less than 49.5 the objects are classified to class Virginica, and so on. In Figure
4.9 the constructed tree is shown with the misclassifications in the terminal
nodes also included; for example, all the observations in the Setosa class are
correctly classified, while 5 observations in the Viriginica class are classified as
Versicolor, etc. This is an example of a binary tree, where each node splits into
two branches. The number of possible binary splits is m(N − 1) provided that
the variables are real-valued without any repeated values. The main advan-
tage of binary splits is their inherent simplicity: numerical variables are split
according to whether their values are above or below some threshold value τ ,
and the same holds for ordinal variables; nominal variables with L levels can
be split in 2L−1 − 1 possible ways.
Classification trees are rooted ones, with the root corresponding to the top
node. Observations are passed down the tree along the branches, with decisions
being made at each node until a terminal node, also called leaf node, is reached.
Each nonterminal node contains a question on which a split is based, while
each leaf contains the label of a classified observation.
It can be seen that the goal of the classification tree is to split the feature
space in such a way that most members belonging to a particular class fall
in the same hypercube. However, nothing prevents the tree to grow in such a
way so that there is a single object only in each hypercube. The main issues
then become on how the tree should be constructed and also pruned, in order
to avoid the one object per hypercube phenomenon.
Almost all current tree-construction methods use a one-step look-ahead ap-
proach. That is, they choose the next split (which variable to use in the next
split) in an optimal way with respect to this greedy strategy, without at-
tempting to optimize the performance of the whole tree. Common measures
for choosing the splits are the Gini index and the cross-entropy (also called
deviance) [5]. At each node ν of a tree we have a probability distribution pνk
over the classes. By conditioning on the observed attributes xi of the objects
Support vector machines and kernel methods have proven to be powerful tools
in numerous applications and have thus gained widespread popularity, e.g., in
machine learning and bioinformatics. In order to motivate the idea behind
the technique we start our exposition with the simplest case, that of two sep-
arable classes by a linear boundary. The data in the training set T are the
pairs (yi , xi ), i = 1, · · · , N with the response taking values in the set {−1, 1}
(positive and negative examples) and xi ∈ Rp . Suppose there exists a hyper-
plane that separates the positive from the negative examples. The points x
that lie on the hyperplane satisfy < w, x > +b = 0, where w is a vector nor-
mal (orthogonal) to the hyperplane and b/||w|| is the perpendicular distance
from the hyperplane to the origin, with ||w|| denoting the Euclidean norm of
w and < ·, · > the inner product operator. Let m+ and m− be the shortest
distance from the separating hyperplane to the closest positive and negative
example, respectively. The quantities m+ and m− are called the margin of a
separating hyperplane for the two types of examples. For the linearly separa-
ble case, the support vector algorithm searches for the separating hyperplane
with the largest margin. To rigorously formulate such an algorithm, notice
that in the current setting all the training data satisfy: < w, xi > +b ≥ +1
for y1 = +1 and < w, xi > +b ≤ −1 for yi = −1. Consider the positive and
negative examples for which these relations hold with equality. The positive
examples lie on a hyperplane h+ :< w, xi>+b=1 with a normal vector w and
perpendicular distance from the origin |1 − b|/||w||, while the negative exam-
ples on another hyperplane h− :< w, xi > +b = −1, with the same normal
vector w and perpendicular distance to the origin | − 1 − b|/||w||. Therefore,
m+ = m− = 1/||w|| and the margin is given by 2/||w||. As shown in Figure
4.10, h+ and h− are parallel hyperplanes, since they have the same normal
vector and no training points fall between them. Hence, we can find the pair
of hyperplanes that gives the maximum margin by minimizing
min ||w||2 subject to yi (< w, xi > +b) − 1 ≥ 0, all i ∈ T . (4.10)
Positive examples
Origin
Negative examples
Figure 4.10 Illustration of linear separating hyperplanes for the separable case.
Figure 4.11 Classification boundary produced by the Support Vector Machine classi-
fier using a radial basis kernel.
shown in Figure 4.11. It can be seen that five observations from the training
data set are misclassified. It should be noted that in the presence of only
two variables, support vector machines can not take full advantage of their
flexibility.
In this section, we discuss some techniques that do not produce a single clas-
sification rule, but an ensemble of classifiers. We focus on bagging and its
extension random forests and on boosting.
Bagging:
The main idea is to generate perturbed versions of the training data of the
Boosting:
Boosting has proved to be an effective method to improve the performance of
base classifiers, both theoretically and empirically. The underlying idea is to
combine simple classification rules (the base classifiers) to form an ensemble,
whose performance is significantly improved. The origins of boosting lie in
PAC learning theory [41], which established that learners that exhibit a per-
formance slightly better than random guessing when appropriately combined
can perform very well. A provably polynomial complexity boosting algorithm
was derived in [34], whereas the Adaptive Boosting (AdaBoost) algorithm in
various varieties [19, 20] proved to be a practical implementation of the boost-
ing ensemble method. The basic steps of the AdaBoost algorithm are described
next for a binary classifier. Let c(x) be the classifier under consideration and
(yi , xi ), i = 1, · · · , N the data in the training set T . Then,
The popular intuition behind the success of the algorithm is that hard to
classify observations receive higher weights αi at later iterations; thus, the
algorithm concentrates more on these cases and hence manages to drive the
misclassification error rate on the training data to zero.
Remark 1: Friedman et al. [17] established connections between the AdaBoost
algorithm and statistical concepts such as loss functions, additive models and
logistic regression. Specifically, it was shown that this algorithm fits a stage-
wise additive logistic regression model that minimizes the expectation of the
exponential loss function exp(−yc(x)). A good discussion is also included in
[21]. For some interesting observations on boosting see also [28].
Remark 2: It can be seen that this algorithm produces as output the new
observation’s predicted class. Proposals for the algorithm to produce as output
the class probability estimates include the RealBoost and the GentleBoost
algorithms [17].
4.5 Exercises
1. Consider the following two univariate populations. The first one is normally
distributed with mean µ1 and variance σ12 and the second one is normally dis-
tributed with mean µ2 and variance σ22 . Further assume that the prior prob-
abilities are given by π1 6= π2 . Derive the optimal Bayes decision rule and
calculate the misclassification error rate.
How does the optimal Bayes rule look if population 1 is exponentially dis-
tributed with parameter θ1 and population 2 is also exponentially distributed
with parameter θ2 ? Calculate the misclassification error rate.
2. Suppose there are three classes in a population with equal prior probabil-
ities; i.e., π1 = π2 = π3 = 1/3. The data in class k are Poisson distributed
3. Suppose there are two classes in the population C1 and C2 . Further, as-
sume that a p-variate observation x comes from one of these two populations
with probability π1 and π2 , respectively. Observations from class C1 follow a
multivariate normal distribution N (µ1 , Σ), while those from C2 follow another
multivariate normal distribution N (µ2 , Σ). Assuming that the cost of misclas-
sifying an observation is equal for the two classes, calculate the Bayes rule
for assigning x to C1 or C2 . Also calculate the corresponding misclassification
probabilities.
References
[1] Allwein, E.L., Schapire, R.E. and Singer, Y. (2000), Reducing multi-class to
binary: A unifying approach for margin classifiers, Journal of Machine Learning
Research, 113-141
[2] Boser, B.E., Guyon, I.M. and Vapnik, V. (1992), A training algorithm for optimal
margin classifiers, in Proceedings of ACM Workshop on Computational Learning
Theory, 144-152, Pittsburgh, PA
[3] Bickel, P.J. and Levina, E. (2004), Some theory for Fisher’s Linear Discrimi-
nant function, “naive Bayes,” and some alternatives when there are many more
variables than observations, Bernoulli, 10, 989-1010
[4] Bousquet, O., Boucheron, S. and Lugosi, G. (2004), Introduction to Statisti-
cal Learning Theory, Advanced Lectures on Machine Learning Lecture Notes in
Artificial Intelligence 3176, 169-207. (Eds.) Bousquet, O., von Luxburg, U. and
Ratsch, R. Springer, Heidelberg, Germany
[5] Breiman, L., Friedman, J.H., Olshen, R. and Stone, C. (1984), Classification and
Regression Trees, CRC Press, Boca Raton, FL
[6] Breiman, L. (1996), Bagging predictors, Machine Learning, 24, 123-140
[7] Breiman, L. (1998), Arcing classifiers, Annals of Statistics, 26, 801-849
[8] Breiman, L. (2001), Random forests, Machine Learning, 45, 5-32
[9] Chen, X.W. and Liu, M. (2005), Prediction of proteinprotein interactions using
random decision forest framework, Bioinformatics, 21, 4394-4400
[10] Cheng B.Y., Carbonell J.G., Klein-Seetharaman J. (2005), Protein classification
based on text classification techniques, Proteins, 58, 955-970
[11] Cover, T. and Hart, P. (1967), Nearest neighbor pattern classification, IEEE
Transactions on Information Theory, 13, 21-27
[12] Crammer, K. and Singer, Y. (2001), On the algorithmic implementation of
multi-class kernel-based vector machines, Journal of Machine Learning Research,
2, 265-292
[13] Dudoit, S., Fridlyand, J. and Speed, T.P. (2002), Comparison of discrimination
5.1 Introduction
129
Figure 5.1 Left panel: a two-dimensional synthetic data set and the direction of maxi-
mum variability captured by the first principal component. Right panel: the projection
of the data set onto the principal components space.
Let x be a vector of p real random variables and let Σ denote their covariance
matrix; i.e., Σ = E(x − µ)(x − µ)′ . Without loss of generality, we set µ = ~0;
otherwise, the mean of the random variables can always be subtracted.
The covariance matrix summarizes all the linear bivariate associations in this
set of random variables. In PCA, we are interested in reducing the dimension-
ality p of the original variables, by considering linear combinations of them
and retaining the “most important” of these new variables.
The Rayleigh-Rietz theorem indicates that the solution is given by the eigen-
vector corresponding to the largest eigenvalue λ1 of Σ.
If a second linear combination y2 = β2′ x is desired, we require in addition to be
orthogonal to the first one; i.e., formally, < y1 , y2 >= 0, where < ·, · > denotes
the inner product of two real-valued vectors. Then the problem becomes
max β2′ Σβ2 s.t ||β2 || = 1 and < β1 , β2 >= 0. (5.3)
β2
In this example, we illustrate PCA with a gene expression data set from a
cancer study [20] that deals with small, round blue-cell tumors of childhood.
There are four types of tumors: neuroblastomas (NB), rhabdomyosarcomas
(RMS), Burkitt lymphomas (BL) and the Ewing family of tumors (EWS).
The data were filtered and contain 2308 genes (see [20]) and 63 samples (12
NB, 20 RMS, 8 BL and 23 EWS). The projection of the data onto the first
two principal components that capture about 55% of the total variance is
shown in Figure 5.3. It can be seen that the classes are not well separated;
however, the BL class of tumors is fairly well separated from the RMS along
the first principal component and to a lesser extent from the NB one. A look
at the component loadings (not shown here) indicates that the first principal
component can be interpreted as an overall average of gene expression, which
Figure 5.2 Geometry of principal components, where the direction (line) minimizes
the orthogonal projections of the data to it.
in turn suggests that the expression level of the BL tumors is clearly different
and opposite than the majority of the RMS ones. Further, the analysis reveals
the presence of a RMS sample at the bottom of the plot, which strongly
indicates that it is an outlier.
For further illustration purposes, we concentrated on the two largest tumor
classes, EWS and RMS. In addition, the 83 most discriminating genes between
these two classes were selected through t-tests. The projection of the data onto
the first two principal components is shown in Figure 5.4. As expected, a very
strong separation of the two classes occurs along the first principal component,
which again can be interpreted as an overall average of gene expression.
Given an n × p centered data matrix X of full column rank we can apply the
Singular Value Decomposition and obtain
X = U LB ′ , (5.6)
Hence, the matrix B contains the eigenvectors of the sample covariance matrix,
while a rescaled version of L its eigenvalues. Specifically Var(yi ) = ℓ2i /(n − 1).
Figure 5.3 Projection of the cancer microarray data set onto the first two principal
components. The NB samples are represented by ◦, the RMS by ⋄, the BL by ⋆ and
the EWS by .
Figure 5.4 Projection of the RMS (⋄) and EWS () tumor classes set onto the first
two principal components based on a subset of 83 genes.
the gene expression data set comprised of the RMS and EWS tumor samples in
Figure 5.5. The arrows on the biplot indicate where one can find samples with
high values on a particular gene (variable). The angles between the arrows,
which represent the variables, capture the correlation between them provided
that the total amount of variance explained by the first two PCs is reasonably
high. The biplot is constructed as follows: from the SVD of the centered data
matrix X we get that X = U LV ′ . Define Lα and L1−α for any α ∈ [0, 1].
Let G = U Lα and H ′ = L1−α V ′ . Notice that for α = 1 we get G = Y the
PC scores. A biplot is a plot of the first k (usually k = 2 or 3) columns of G
and H.
Figure 5.5 Biplot of the gene expression data set containing only the RMS and EWS
tumor samples.
If, in addition, dij satisfies the triangle inequality (dij ≤ dik + dkj for any k)
then it is a proper distance. Euclidean, Mahalanobis and Manhattan distances
are commonly used in data analysis.
The objective of MDS is to approximate dissimilarities (distances) calculated
from the data in p-dimensional space by Euclidean distances defined in a
q << p dimensional space. In practice, q is usually chosen equal to two or
three, since one is interested in visualizing the structure of the data. Let Z
be a N × q matrix that contains the coordinates of the objects in the low
dimensional space. The quality of the approximation is measured by a loss
function. Common loss functions include:
N X
X N
Stress(Z) = (dij (Z) − dij )2 , (5.8)
i=1 j=i+1
which is invariant under rotations and translations, but not invariant to stretch-
ing and shrinking. This implies that the value of Stress is scale dependent and
a better criterion is given by
s
Stress(Z)
P 2 . (5.9)
i<j dij (Z)
A more general form of the Stress function incorporates weights wij that
reflect variability, measurement error or missing data:
N X
X N
WStress(X) = wij (dij (Z) − dij )2 . (5.10)
i=1 j=i+1
Figure 5.6 MDS representation of the gene expression data based on Manhattan
distances. The NB samples are represented by ◦, the RMS by ⋄, the BL by ⋆ and the
EWS by .
Figure 5.7 MDS representation of the gene expression data of the RMS (⋄) and EWS
() samples, based on Manhattan distances.
Kernel PCA: The idea behind kernel PCA [29] is that nonlinear patterns
present in low dimensional spaces can be linearized by projecting the data
into high dimensional spaces, at which point classical PCA becomes effective.
Although this concept is contrary to the idea of using PCA for data reduction
purposes, it has proved successful in some application areas like hand-written
digit recognition. In order to make this idea computationally tractable, kernels
(for a brief discussion see the chapter on Classification Techniques) are used
that essentially calculate inner products of the original variables.
Manifold learning methods: These methods assume that the data have a
nonlinear structure that is captured by a smooth connected manifold. These
techniques such as Local Linear Embedding (LLE) [27], Hessian LLE [10],
Laplacian Eigenmaps [5] and Isomap [31] construct a low dimensional data
representation using a cost function that retains local properties of the data.
For example, the Isomap technique constructs a dissimilarity matrix for only
locally neighboring points and then uses multidimensional scaling for deriving
When dealing with a cluster analysis problem the following issues need to be
studied [15]:
Remark:
In most clustering problems few assumptions, usually posed in set-theoretic
terms, are made. However, in some cases the problem is posed as one where the
clusters correspond to mixtures of distributions whose number and parameters
need to be estimated (learned) from the data [26].
where X
T = (xi − x̄)(xi − x̄)′ (5.12)
all objectsi
and X
W = nk (xi − x̄k )(xi − x̄k )′ (5.13)
all clustersk
where nk is the number of objects in cluster k, x̄ is the overall mean of the data
and x̄k is the mean of cluster k. It is worth noting that the above definitions
are identical to the ones in MANOVA. The only difference is that we don’t
know a priori which group an object belongs to.
Given that T is fixed a good clustering algorithm seeks to minimize some
measure of W (the within groups variation) and hence maximize some measure
of B (the between groups variation). Criteria that have been suggested in the
literature include:
The K-means algorithm is simple and has been widely used in the analysis of
microarray data. Typically, the algorithm converges fairly fast to a solution.
However, it requires as input parameters the cluster number K and initial
centroids. Randomly chosen initial centroids may lead to poor results. Further,
due to its nature the algorithm favors spherically shaped clusters.
Self-Organizing Maps:
The self-organizing map (SOM) is a neural network algorithm that has been
used in a wide variety of applications (for microarray data, see [14]). For a
comprehensive treatment of the topic consult Kohonen’s book [22].
This particular algorithm is motivated by ideas in competitive learning (see
[3, 22]), that can be described as the adaptive process in which neurons in
a neural network gradually become more sensitive to different input samples
(data). ‘A kind of division of labor emerges in the network when different
neurons specialize to represent different types of input’ [19]. The specialization
is enforced by competition among the neurons: when a new input x arrives
(e.g., a new data point), the neuron that is best able to represent it wins the
competition and is allowed to learn it even better.
kx − mc k = min kx − mi k, i = 1, 2, . . . , N 2 , (5.19)
i
where α(t) is a positive constant that decays with time and Nc defines a topo-
logical neighborhood around the maximally responding neuron c, such that
it also decreases with time. Different parts of the network become selectively
Each edge defines the cluster of objects contained in the subtree below that
particular edge. The edge’s length (or weight) reflects the dissimilarity between
that cluster and the remaining clusters.
Figure 5.9 Left panel: Complete linkage based clustering of tumor samples based on
2308 genes. Right panel: Complete linkage based clustering of RMS and EWS tumor
samples based on 83 selected genes.
5.5.3 Biclustering
Although cluster analysis techniques have a long history in statistics and com-
puter science, biclustering algorithms originated in bioinformatics problems,
especially in trying to find structure in gene expression data. To make things
concrete consider a gene expression matrix X with rows corresponding to
genes and columns corresponding to samples (e.g., experimental conditions,
different a priori defined classes, etc). Cluster analysis techniques can be ap-
plied separately either on the genes, or on the samples, with the goal being
to discover homogeneous groups of the former or the latter (e.g., groups of
co-regulated groups, groups of similarly behaving patients, etc). As already
seen in this section, clustering algorithms usually partition the genes/samples
where µ0 captures the uniform background and θijk = µk + αik + βjk describe
mean, row and column effects of each bicluster. The parameters aik , bjk ∈
{0, 1} are gene/sample bicluster membership indicator variables. Hence, simi-
lar to the Cheng-Church algorithm, a bicluster is assumed to be the sum of a
mean background level plus row and column specific effects. The biclustering
problem is formulated as estimating the parameters of interest so that the
following sum of squares criterion is minimized:
X K
X
[Xij − (µ0 + θijk ]aik bjk ,
i∈G,j∈S k=1
P P
subject to the identifiability constraints ∈∈G aik αik = 0 or ∈∈G bik βik = 0.
An iterative algorithm and a stopping criterion are discussed in [23].
5.6 Exercises
Individual Variable
V1 V2 V3 V4
===================
1 1 1 1 0
2 0 0 1 1
3 1 1 1 1
4 0 1 0 1
Subject
A B C D E F
A 0
B 4.2 0
C 5.9 7.6 0
D 1.2 7.0 10.3 0
E 6.1 2.6 5.4 7.8 0
F 1.3 3.6 4.5 3.2 8.2 0
Using single linkage clustering, cluster the six subjects. Sketch the dendro-
gram and interpret the results. How would your dendrogram change if you
used a complete linkage clustering algorithm?
2. Let xi = (x1i , x2i , · · · , xpi ) denote the vector containing the p measurements
for the i-th observation. A measure of heterogeneity of a cluster C of size nC
is given by
XnC
HC = d2 (xi , x̄C ),
i=1
where the index i runs over the observations in the cluster, d(ui , uj ) de-
notes the Euclidean distance between observations ui and uj and x̄C the
p-dimensional multivariate mean of cluster C. Show that when two clusters
C1 and C2 are merged, the heterogeneity of the merged cluster, denoted by
HC1 +C2 , is increased. Provide an expression for the increase relative to the
sum of the heterogeneity measures of the two original clusters. Can you sug-
gest a clustering algorithm?
References
[1] Alizadeh, A.A. et al. (2000), Distinct types of diffuse large B-cell lymphoma
identified by gene expression profiling, Nature, 403, 503-511
[2] Alon, U., Barkai, N., Notterman, D.A., Gish, K., Ybarra, S., Mack, D. and
Levine, A.J. (1999), Broad patterns of gene expression revealed by clustering
analysis of tumor and normal colon tissues probed by oligonucleotide array, Pro-
ceedings of the National Academies of Science USA, 96, 6745-6750
[3] Amari, S.I, (1991), Dualistic geometry of the manifold of higher-order neurons,
Neural Networks, 4, 443-451
[4] Banfield, J.D. and Raftery, A.E. (1993), Model based Gaussian and non-Gaussian
clustering, Biometrics, 49, 803-821
[5] Belkin, M. and Nyogi, P. (2003), Laplacian eigenmaps for dimensionality reduc-
tion and data representation, Neural Computation, 15, 1373-1396
[6] Bergmann, S., Ihmels, J. and Barkai, N. (2003), Iterative signature algorithm for
the analysis of large-scale gene expression data, Physical Review E, 67, 201-218
[7] Borg, I. and Groenen, P. (1997), Modern Multidimensional Scaling: Theory and
Applications, Springer, NY
[8] Bregler, C. and Omohundro, M. (1994), Surface learning with applications to
lipreading, in Cowan et al. (eds), Advances in Neural Information Processing
Systems, Morgan Kaufman, San Mateo, CA
[9] Church, G.M. and Cheng, Y. (2000), Biclustering of expression data, in Proceed-
ings of ISMB 2000, 93-103, AAAI Press
[10] Donoho, D.L. and Grimes, C. (2003), Hessian eigenmaps: locally linear em-
bedding techniques for high-dimensional data, Proceedings of the National
Academies, USA, 100, 5591-5596
[11] Eisen, M.B., Spellman, P.T., Brown, P.O. and Botstein, D. (1998), Cluster anal-
ysis and display of genome-wide expression patterns, Proceedings of the National
Academies of Science USA, 95, 14863-14868
[12] Gasch, A.P. et al. (2001), Genomic expression responses to DNA-damaging
agents and the regulatory role of the yeast ATR homolog mec1p, Molecular
Biology of the Cell, 12, 2987-3003
Computational Intelligence in
Bioinformatics
6.1 Introduction
155
Typically, real-life data must not only be cleaned of errors and redundancy, but
must also be organized in a fashion that makes sense to the problem. There can
exist imperfections in raw input data needed for knowledge acquisition, mainly
due to uncertainty, vagueness and incompleteness. While incompleteness arises
Let us consider an example of the crisp set of ages of a group of people, defined
as
Ac = {5, 10, 20, 30, 40, 50, 60, 70, 80}.
Let the membership grades µyoung of these elements (people) in the fuzzy set
young Ayoung be given by
{1, 1, .8, .5, .2, .1, 0, 0, 0}. We express
with
1 1 .8 .5 .2 .1
Ayoung = + + + + + .
5 10 20 30 40 50
Fuzzy logic is based on the theory of fuzzy sets and, unlike classical logic, aims
at modeling the imprecise (or inexact) modes of reasoning and thought pro-
cesses (with linguistic variables) that play an essential role in the remarkable
human ability to make rational decisions in an environment of uncertainty
and imprecision. This ability depends on our ability to infer an approximate
answer to a question based on a store of knowledge that is inexact, incomplete,
or not totally reliable. In fuzzy logic, everything, including truth, is a matter
of degree [8]. Zadeh has developed a theory of approximate reasoning based
on fuzzy set theory.
Most biological systems behave in a fuzzy manner, with the interaction and ac-
tivity of various genes attaining different levels. A single gene may be involved
in different biological processes. Fuzzy clustering allows genes to simultane-
ously belong to multiple clusters and participate in multiple pathways. This
is a more natural reflection of the biological reality of cellular metabolism.
1.0
0.5
0
c r
Figure 6.1 Standard S function.
0.5
c r
We also have the modifiers very and more or less. These are expressed as
µvery young = (µyoung )2 , (6.7)
where 1 ≤ m′ < ∞ is the fuzzifier, mi is the ith cluster center, µik ∈ [0, 1] is
the membership of the kth pattern to it and ||.|| is the distance norm, such
that PN m′
k=1 (µik ) Xk
m i = PN (6.10)
m′
k=1 (µik )
and
1
µik = 2 , (6.11)
Pc dik m′ −1
j=1 djk
Pc PN
∀i, with dik = ||Xk − mi ||2 , subject to i=1 µik = 1, ∀k, and 0 < k=1 µik <
N , ∀i. The algorithm proceeds as follows.
Note that for µik ∈ [0, 1] the objective function of eqn. (6.9) boils down to the
hard c-means case, whereby a winner-take-all strategy is applied in place of
membership values in eqn. (6.10).
ANNs [14, 16, 17] are signal processing systems that form a massively parallel
interconnection of simple (usually adaptive) processing elements, and interact
with objects of the real world in a manner similar to biological systems. The
origin of ANNs can be traced to the work of Hebb [20], where a local learning
rule was proposed. This rule assumed that correlations between the states of
two neurons determined the strength of the coupling between them. Subse-
quently, a synaptic connection that was very active grew in strength and vice
versa.
The perceptron [26, 27] was one of the most exciting developments during
the early days of pattern recognition. It consists of a single neuron with ad-
justable weights, wj , j = 1, 2, . . . , n, and threshold θ. Given an input vector
x = [x1 , x2 , . . . , xn ]T , the net input to the neuron is
n
X
v= wj xj − θ. (6.12)
j=1
However if the pattern space is not linearly separable, then the perceptron fails
[28]. A single-layer perceptron is thus inadequate for situations with multiple
classes and nonlinear separating boundaries.
Layer H
wh
ji
yh
i
Layer h i
xh
i
Layer 0
Input
Let us consider the network given in Fig. 6.3. The total input xh+1
j received
by neuron j in layer h+1 is defined as
X
xh+1
j = yih wji
h
− θjh+1 , (6.14)
i
where yih h
is the state of the ith neuron in the preceding hth layer, wji is the
weight of the connection from the ith neuron in layer h to the jth neuron in
layer h + 1 and θjh+1 is the threshold of the jth neuron in layer h + 1.
The output of a neuron in any layer other than the input layer (h > 0) is
expressed as
1
yjh = h . (6.15)
1 + e−xj
For nodes in the input layer yj0 = x0j , where x0j is the jth component of the
input vector clamped at the input layer. Learning consists of minimizing the
error by updating the weights in a very large parameter space.
The least mean square (LMS) error in output vectors, for a given network
weight vector w, is defined as
1 X H
E = (y − dj,p )2 , (6.16)
2 j,p j,p
H
where yj,p is the state obtained for output node j in layer H for input–output
pattern p and dj,p is its desired state specified by the teacher. One method
for minimization of E is to apply the method of gradient descent by starting
A radial basis function (RBF) network [29, 30] consists of two layers as shown
in Fig. 6.4. Let the connection weight vectors of the input and output layers
be denoted as m and w, respectively. The basis (or kernel) functions in the
hidden layer produce a localized response to the input stimulus. The output
nodes form a weighted linear combination of the basis functions computed by
the hidden nodes.
Let x = (x1 , . . . , xi , . . . , xn ) ∈ Rn and y = (y1 , . . . , yi , . . . , yl ) ∈ Rl be the
1 Classes
m clusters
n features
Input
input and output, respectively, and let m be the number of hidden nodes.
Here the hidden nodes represent the number of clusters (specified by the user)
that partition the input space.
The output uj of the jth hidden node, using the Gaussian kernel function as
a basis, is given by
" #
(x − mj )T (x − µj )
uj = exp − , j = 1, 2, . . . , m, (6.21)
2σ2j
where x is the input pattern, µj is its input weight vector (i.e., the center
of the Gaussian for node j) and σ 2j is its width, such that 0 ≤ uj ≤ 1 (the
closer the input is to the center of the Gaussian, the larger the response of
the node).
The output yj of the jth output node is
yj = w Tj u, j = 1, 2, . . . , l, (6.22)
where wj is the weight vector for this node, and u is the vector of outputs from
the hidden layer. The network performs a linear combination of the nonlinear
basis functions of Eq. (6.21).
The problem is to minimize the error
N l
1X X
E= (yj,p − dj,p )2 , (6.23)
2 p=1 j=1
where dj,p and yj,p are desired and computed output at the jth node for the
pth pattern, N is the size of the data set and l is the number of output nodes.
Learning in the hidden layer, typically, uses the c-means clustering algorithm.
Let the cluster centers be denoted as µj , j = 1, . . . , m. The parameter σj rep-
resents a measure of the spread of data associated with each node. Learning in
Genetic algorithms (GAs) [31, 32] are adaptive and robust computational
search procedures that employ evolution-inspired operators like selection,
crossover and mutation while being controlled by a fitness function. The com-
ponents of a GA consist of a population of individuals represented as chro-
mosomes, their encoding or decoding mechanism, probabilities to perform the
genetic operations, a replacement technique for the pool of possible solutions
and the termination conditions.
Let us consider, as an example, the optimization of a function
y = f (x1 , x2 , . . . , xp ).
A binary vector is used as a chromosome to represent real values of the vari-
ables xi , with the length of the vector constraining the allowed precision in
bits. A population is a set of individuals (chromosomes) representing the con-
catenated parameter set x1 , x2 , . . . , xp , where each member refers to a coded
possible solution. For example, a sample chromosome
00001|01000| . . . |11001
could correspond to x1 = 00001, x2 = 01000 and xp = 11001. The Schema
theorem provides a complete guidance on the feasible solutions in the search
space.
The chromosomes can be of fixed or variable size. Selection obeys the Dar-
winian survival of the fittest strategy, with the objective function playing
the role of Nature or environment. Variation is introduced in the population
through the genetic operations like recombination (crossover) and mutation.
Normally the initial population is chosen randomly.
The terminating criterion for the algorithm can be on the basis of (i) execution
for a fixed number of generations or iterations, (ii) a bound on the fitness value
of the generated solution or (iii) acquiring of a certain degree of homogeneity
by the population.
Let us consider a simple example to illustrate the working principle of GAs. It
is related to minimizing the surface area A of a solid cylinder, given radius r
and height h. Here the fitness function can be expressed as A = 2πrh + 2πr2 .
We need to encode the parameters r and h in a chromosome. Using a 3-bit
representation, we demonstrate encoding, crossover and mutation. For r1 =
3, h1 = 4 and r2 = 4, h2 = 3, we generate parent chromosomes 011|100
and 100|011 with A1 = 132, A2 = 176, respectively. Let there be one-point
crossover at bit 4, producing the children chromosomes 011|011 and 100|100.
This is decoded as r1c = 3, h1c = 3 and r2c = 4, h2c = 4, with A1c = 16.16
upper
approximation
Set X
lower approximation
Figure 6.5 provides a schematic diagram of a rough set in the F1 -F2 feature
space. The effectiveness of RS has been investigated in the domains of artificial
intelligence and cognitive sciences, especially for representation of and reason-
ing with vague and/or imprecise knowledge, data classification and analysis,
machine learning, and knowledge discovery [37].
6.5.1 Reducts
Notice that, as decision tables with a single decision attribute d are taken to
be consistent, U = P OSC (d) = P OSB (D), for any d-reduct B.
D-reducts can be computed with the help of D-discernibility matrices [38]. Let
U = {x1 , · · · , xm }. A D-discernibility matrix MD (A) is defined as an m × m
matrix of the information system A with the (i, j)th entry cij given by
cij = {a ∈ C : a(xi ) 6= a(xj ), and (xi , xj ) 6∈ IN D(D)}, i, j ∈ {1, · · · , m}.
(6.28)
A variant of the discernibility matrix, viz., distinction table [39] is often used
to enable faster computation.
2
Definition 5 A distinction table is a binary matrix with dimensions (m 2−m) ×
N , where N is the number of attributes in A. An entry b((k, j), i) of the matrix
corresponds to the attribute ai and pair of objects (xk , xj ), and is given by
1 if ai (xk ) 6= ai (xj ),
b((k, j), i) = (6.29)
0 if ai (xk ) = ai (xj ).
The presence of a ‘1’ signifies the ability of the attribute ai to discern (or
distinguish) between the pair of objects (xk , xj ).
6.5.3 Clustering
6.6 Hybridization
There has been a lot of research on the hybridization aspect of the different
soft computing paradigms. Of these, neuro-fuzzy (NF) computing is the oldest
and most widely reported in literature.
The concept of ANNs was inspired by biological neural networks, which are in-
herently nonlinear, adaptive, highly parallel, robust and fault tolerant. Fuzzy
5. Making the individual neurons fuzzy: the input and output of the neurons
are fuzzy sets and the activity of the networks, involving the fuzzy neurons,
is also a fuzzy process [44].
Fusion of fuzzy systems and GAs can be done, under fuzzy–genetic hybridiza-
tion, for tuning of fuzzy sets [55]. For example, this can be for membership
function selection and tuning. While integrating neural networks with EC, the
two components may interact in many ways [56]. For example, GAs can help
to avoid the tedious backpropagation algorithm for an MLP, thereby over-
coming some limitations of ANNs [57]. The optimal topology of an ANN can
also be evolved using GAs [58, 59, 60]. Such an integrated approach may be
termed genetic–neural. We can have approaches that exploit the benefits of
fuzzy sets, ANNs and GAs. Such systems may be termed neuro-fuzzy–genetic
(NFG) [61, 62, 63]. For example, a fuzzy reasoning system may be imple-
mented using a multilayer network, where the free parameters of the system
may be learned using GAs. Similarly, the parameters of an FNN may also be
learned using GAs.
In this section we highlight the role of different soft computing paradigms [3,
4, 70, 71, 72] like fuzzy sets, ANNs, GAs, rough sets and their hybridizations,
in different areas of Bioinformatics. The major problems covered here include
primary genomic sequence, protein structure, microarray and gene regulatory
networks. We categorize the applications based on the different paradigms
used.
Eukaryotic genes are typically organized as exons (coding regions) and in-
trons (noncoding regions). Hence the main task of gene identification, from
the primary genomic sequence, involves coding region recognition and splice
junction detection. Sequence data are typically dynamic and order dependent.
A protein sequence motif is a signature or consensus pattern that is embed-
ded within sequences of the same protein family. Identification of the motif
leads to classification of an unknown sequence into a protein family for further
biological analysis.
Sequence motif discovery algorithms can follow (i) string alignment, (ii) ex-
haustive enumeration and (iii) heuristic methods. String alignment algorithms
detect sequence motifs by minimizing a cost function which is related to the
edit distance between the sequences. Multiple alignment of sequences is an
NP-hard problem, with its computational complexity increasing exponentially
with sequence size. Local search algorithms may lead to local optima instead
of the best motif. Exhaustive enumeration algorithms, though guaranteed to
find the optimal motif, are computationally too expensive. Here lies the utility
of using soft computing techniques for faster convergence.
FS
ANN
Investigations with GAs and GP have been made on primary genomic se-
quences for functions involving their alignment, reconstruction and detection.
These are described below.
GA
The simultaneous alignment of many amino acid sequences is one of the ma-
jor research areas of Bioinformatics. Given a set of homologous sequences,
multiple alignments can help predict secondary or tertiary structures of new
sequences. GAs have been used for this purpose [98]. Fitness is measured by
globally scoring each alignment according to a chosen objective function, with
better alignments generating a higher fitness. The cost of multiple alignment
Ac is expressed as
N
X −1 X
N
Ac = Wi,j cost(Ai , Aj ), (6.30)
i=1 j=1
where N is the number of sequences, Ai is the aligned sequence i, cost(Ai , Aj )
is the alignment score between two aligned sequences Ai and Aj , and Wi,j is
the weight associated with that pair of sequences. The cost function includes
the sum of the substitution costs, as given by a substitution matrix, and
the cost of insertions/deletions using a model with affine gap (gap-opening
and gap-extension) penalties. Roulette wheel selection is carried out among
the population of possible alignments, and insertion/deletion events in the
sequences are modeled using a gap insertion mutation operator.
Given N aligned sequences A1 . . . AN in a multiple alignment, with Ai,j being
the pairwise projection of sequences Ai and Aj , length(Ai,j ) the number of
ungapped columns in this alignment, score(Ai,j ) the overall consistency be-
′
tween Ai,j and the corresponding pairwise alignment in the library, and Wi,j
the weight associated with this pairwise alignment, the fitness function was
modified [99] to
PN −1 PN ′
i=1 j=1 Wi,j ∗ score(Ai,j )
F = PN −1 PN . (6.31)
′
i=1 j=1 Wi,j ∗ length(Ai,j )
The main difference with eqn. (6.30) is the use of a library that replaces the
substitution matrix and provides position-dependent means of evaluation.
The generation of accurate DNA sequence is a challenging and time-consuming
problem in genomics. A widely used technique in this direction is hybridiza-
tion, which detects all oligonucleotides—short sequences of the four nucleotide
bases, A, C, T , G, of a given length k—that make up the corresponding DNA
fragment. (This terminology is different from the hybridization of soft com-
puting paradigms, which we elucidate in this chapter.) The oligonucleotide
library is very large, containing 4k elements, with microarray chip technology
being often used in its implementation. However, the hybridization experiment
GP
Finite State Automata (FSA) has been combined with GP, to discover can-
didate promoter sequences in primary sequence data [102]. FSAs are directed
graphs that can represent grammars in the Chomsky hierarchy and Turing
machines. In the GP-Automata, a GP tree structure is associated with each
state of the FSA. The method is able to take large base pair jumps, thereby
being able to handle very long genomic sequences in order to discover gene
specific cis-acting sites as well as genes which are regulated together. It is to be
noted that an aim of drug discovery is to identify cis-acting sites responsible
for co-regulating different genes.
† http://www.fruitfly.org/
Extraction of motif from a group of related protein sequences has been in-
vestigated in a neuro-fuzzy framework [103], using data from PROSITE. A
statistical method is first used to detect short patterns occurring with high fre-
quency. Fuzzy logic enables the design of approximate membership functions
and rules about protein motifs, as obtained from domain experts. A radial ba-
sis function (RBF) neural network is employed to optimize the classification
by tuning the membership functions.
Evolving ANNs for discriminating between functional elements associated
with coding nucleotides (exons) and noncoding sequences of DNA (introns
and intragenic spacer) has been reported [72] in the genetic–neural frame-
work. The connection weights of a fixed MLP architecture are evolved for
classification, using evolutionary computation, with practical application to
gene detection. Performance of the evolved network is compared to that of
GRAIL [77] and GeneParser [96].
FS
for an l-class problem, with Qi indicating the accuracy for the ith class, wi
being the corresponding normalizing factor, N representing the total number
of samples and C being the total number of correct classifications.
(T P ∗ T N ) − (F P ∗ F N )
M CC = p , (6.33)
(T P + F P )(T P + F N )(T N + F P )(T N + F N )
where T P , T N , F P and F N correspond to the number of true positive, true
negative, false positive and false negative classifications, respectively. Here
N = T P + T N + F P + F N and C = T P + T N , and −1 ≤ M CC ≤ +1 with
+1 (-1) corresponding to a perfect (wrong) prediction. The values for M CC
for the α-helix, β-strand and random coil were found to be 0.41, 0.31, 0.41,
respectively.
The performance of this method was improved by Rost and Sander [108, 109],
by using a cascaded three-level network with multiple-sequence alignment. The
three levels correspond to a sequence-to-structure net, a structure-to-structure
net and a jury (combined output) decision, respectively. Correct classification
c
ensembles ensembles ensembles
‡ http://www.cmbi.kun.nl/gv/dssp/
GAs have been mainly applied to tertiary protein structure prediction, fold-
ing, docking and side-chain packing problems. Structure alignment has been
attempted in proteins using GAs [124], by first aligning equivalent secondary
structure element (SSE) vectors while optimizing an elastic similarity score S.
This is expressed as
PL PL dA
ij −dij
B 2
i=1 j=1 θ − e−(d̄ij /a) , i 6= j,
S= d̄ij (6.34)
θ, i = j,
where dA B
ij and dij are the distances between equivalent positions i and j in
proteins A and B respectively, d¯ij is the average of dA B
ij and dij , and θ and a are
constant parameters, with the logic implying that equivalent positions in two
proteins should have similar distances to other equivalent positions. Secondly,
amino acid positions are optimally aligned within the SSEs. This is followed
by superposition of protein backbones, based on the position equivalencies
already determined. Finally, additional equivalent positions are searched in
the non-SSE regions.
Tertiary protein structure prediction and folding, using GAs, has been re-
ported in Ref. [125, 72, 126, 127]. The objective is to generate a set of native-
like conformations of a protein based on a force field, while minimizing a fit-
ness function depending on its potential energy. Proteins can be represented
in terms of (a) three-dimensional Cartesian coordinates of its atoms and (b)
the torsional angle Rotamers, which are encoded as bit strings for the GA.
The Cartesian coordinates representation has the advantage of being easily
convertible to and from the 3D conformation of a protein. Bond lengths, b,
are specified in these terms. In the torsional angles representation, the protein
is described by a set of angles under the assumption of constant standard
binding geometries. The different angles involved are the (i) bond angle θ, (ii)
torsional angle φ, between N (amine group) and Cα , (iii) angle ψ, between
Cα and C ′ (carboxyl group), (iv) peptide bond angle ω, between C ′ and N
and (v) side-chain dihedral angle χ.
The potential energy U (r1 , . P . . , rN ) between NPatoms is minimized, P being
expressed as U (r1 , . . . , rN ) = i Kb (bi − bi0 )2 + i Kθ (θi − θ0i )2 + i Kφ [1 −
12 6
P q q P σij σij
cos(nφi −δ)]+ i,j 4πε0iεrj rij + i,j ε rij − 2 rij . Here the first three
harmonic terms on the right-hand side involve the bond length, bond angle
and torsional angle of covalent connectivity, with bi0 and θ0i indicating the
down-state (low energy) bond length and bond angle respectively, for the ith
atom. The effects of hydrogen bonding and that of solvents (for nonbonded
atom pairs i, j, separated by at least four atoms) are taken care of by the
electrostatic Coulomb interaction and Van der Waals’ interaction, modeled
by the last two terms of the expression. Here Kb , Kθ , Kφ , σij and δ are
formation and len indicates the number of residues. This penalty term ensures
that extended conformations have larger energy (or lower fitness) values than
globular conformations. It constitutes the conformational entropy constituent
of potential energy, in addition to the factors involved in the expression for
U.
Genetic Optimization for Ligand Docking (GOLD) [128] is an automated
flexible-ligand docking program, employing steady-state GA involving the is-
land model (which evolves several small, distinct populations, instead of one
large population). It evaluates nonmatching bonds while minimizing the po-
tential energy (fitness function), defined in terms of Van der Waals’ internal
and external (or ligand-site) energy, torsional (or dihedral) energy and hy-
drogen bonds. However, (i) an enforced requirement that the ligand must be
hydrogen-bonded to the binding site and (ii) an underestimation of the hy-
drophobic contribution to binding sometimes lead to failures in docking in
certain cases over here.
Each chromosome in GOLD encodes the internal coordinates of both the lig-
and and active protein site, and a mapping between the hydrogen-bonding
sites. Reproduction operators include crossover, mutation and a migration
operator to share genetic material between populations. The output is the
ligand and protein conformations associated with the fittest chromosome in
the population, when the GA terminates. The files handled are the Cam-
bridge Crystallographic Database, Brookhaven PDB and the Rotamer library
(providing the relationship between side-chain dihedral angles and backbone
conformation).
AutoDock [129] works on a genome composed of a string of real-valued genes
encoding the 3D coordinates and different angles. Mutation of the real-valued
parameters is accomplished through the addition of a Cauchy-distributed ran-
dom variable. Both conventional as well as Lamarckian GAs are used, along
Hybridization
6.7.3 Microarray
Each DNA array contains the measures of the level of expression of many
genes. Various distances and/or correlations can be computed from pairwise
comparison of these patterns. Let genej (ej1 , . . . , ejn ) denote the expression
pattern for the jth gene for i = 1, . . . , n samples. The Euclidean distance
between the jth and kth genes, computed as
sX
dj,k = (eji − eki )2 , (6.36)
i
FS
ANN
The two major mining tasks, modeled here, are clustering and classification.
While unsupervised learning is self-organized, supervised learning helps in-
corporate known biological functions of genes into the knowledge discovery
process of gene expression pattern analysis for gene discovery and prediction.
Kohonen’s SOM has been applied to the clustering of gene expression data
[143, 144, 145]. It generates a robust and accurate clustering of large and noisy
data, while providing effective visualization. SOMs require the winning neuron
or node in the gene expression space (along with its neighbors) to be rotated
in the direction of a selected gene expression profile (pattern). However, the
predefinition of a two-dimensional topology of nodes can often be a problem
considering its biological relevance.
SOTA has also been applied to gene expression clustering [146]. As in SOMs
the gene expression profiles are sequentially and iteratively presented at the
terminal nodes, and the mapping of the node that is closest (along with its
neighboring nodes) is appropriately updated. Upon convergence the node con-
taining the most variable (measured in terms of distance) population of ex-
pression profiles is split into sister nodes, causing a growth of a binary tree
§ http://www.genome.wi.mit.edu/MPR
¶ http://microarray.princeton.edu/oncology
The identification of gene subsets for classifying two-class disease samples has
been modeled as a multi-objective evolutionary optimization problem [151],
involving minimization of gene subset size to achieve reliable and accurate clas-
sification based on their expression levels. NSGA-II, a multi-objective GA, is
used for the purpose. This employs elitist selection and an explicit diversity
preserving mechanism, and emphasizes the nondominated solutions. Results
are provided on three cancer samples, viz., Leukemia, Lymphoma and Colon.
An l-bit binary string, where l is the number of selected (filtered) genes in
the disease samples, represents a solution. The major difficulties faced in solv-
ing the optimization problem include the availability of only a few samples
as compared to the number of genes in each sample, and the resultant huge
search space of solutions. Moreover many of the genes are redundant to the
classification decision, and hence need to be eliminated. The three objectives
simultaneously minimized are (i) the gene subset size, (ii) number of misclas-
sifications in training and (iii) number of misclassifications in test samples.
The grouping GA (GGA) [152] is a modified GA, developed to suit the partic-
ular structure of grouping problems like clustering. GGA has also been applied
to the clustering of microarray data [72]. The clusters of expression profiles
are directly encoded in the chromosomes, based on their ordinal numbers, and
the fitness function is defined on this set of groupings. The composition of the
groups controls the value of the objective function.
GAs have also been used to correctly classify the SRBCT dataset with a se-
lection of 12 genes [153]. There are four classes of tumors, from 88 samples
described by 2308 genes. Simulated annealing (SA) [154] is employed to gener-
ate a robust clustering of temporal gene expression profiles [155]. An iterative
scheme quantitatively evaluates the optimal number of clusters, while simul-
taneously optimizing the distribution of genes within them. The ith profile is
represented by a vector {ei1 , . . . , ein }, with expression component eit corre-
sponding to the normalized expression level of gene i at time t in the range
[0, 1]. The distribution of profiles is optimized for c clusters by minimizing the
within-cluster distance between them, using
c
1 XX X
E(c) = di,j , (6.37)
c
k=1 i∈Uk j∈Uk
where di,j is the Euclidean distance [eqn. (6.36)] between profiles belonging
to cluster Uk .
Biclustering or simultaneous clustering of both genes and conditions have gen-
erated considerable interest over the past few decades, particularly related to
the analysis of high-dimensional gene expression data in information retrieval,
knowledge discovery and data mining. The objective is to find sub-matrices,
i.e., maximal subgroups of genes and subgroups of conditions where the genes
RS
Hybridization
We begin with the neuro-fuzzy models. Fuzzy adaptive resonance theory (ART)
network [161] has been employed for clustering the time series expression data
related to the sporulation of budding yeast [162].
An evolving modular fuzzy neural network, involving dynamic structure grow-
ing (and shrinking), adaptive online learning and knowledge discovery in rule
form, has been applied to the Leukemia and Colon cancer gene expression
data [163]. Feature selection improves classification by reducing irrelevant at-
tributes that do not change their expression between classes. The Pearson
For a decision table A with N condition attributes and a single decision at-
tribute d, the problem of finding a d-reduct is equivalent to finding a minimal
subset of columns R(⊆ {1, 2, · · · , N }) in the distinction table [cf. Definition
5, eqn. (6.29)], satisfying
∀(k, j)∃i ∈ R : b((k, j), i) = 1, whenever d(xk ) 6= d(xj ).
So, in effect, we may consider the distinction table to consist of N columns, and
rows corresponding to only those object pairs (xk , xj ) such that d(xk ) 6= d(xj ).
Let us call this shortened distinction table, a d-distinction table. Note that, as
A is taken to be consistent, there is no row with all 0 entries in a d-distinction
table.
Let the number of objects initially in the two classes be m1 and m2 respec-
tively. Then the number of rows in the d-distinction table becomes (m1 ∗m2 ) <
m∗(m−1)
2 , where m1 + m2 = m. Two fitness functions f1 and f2 are considered
for each individual. We have
N − L~ν
f1 (~ν ) = (6.38)
N
and
C~ν
f2 (~ν ) = , (6.39)
(m2 − m)/2
where ~ν is the reduct candidate, L~ν represents the number of 1’s in ~ν , m is
the number of objects and C~ν indicates the number of object combinations
~ν can discern between. The fitness function f1 gives the candidate credit for
containing less attributes (fewer 1’s), while the function f2 determines the
extent to which the candidate can discern among objects.
Recurrent neural network has been used to model the dynamics of gene ex-
pression [169]. The significance of the regulatory effect of one gene product
on the expression of other genes of the system is defined by a weight matrix.
Multigenic regulation, involving positive and/or negative feedback, is consid-
ered. The process of gene expression is described by a single network, along
with a pair of linked networks independently modeling the transcription and
translation schemes. Bayesian networks with Bayesian learning were employed
[170], in a reverse engineering approach, to infer gene regulatory interactions
from simulated gene expression data.
Adaptive Double Self-Organizing Map (ADSOM) [171] provides a clustering
strategy for identifying coregulated regions of interest. These are utilized for
extracting gene regulatory networks. The model has a flexible topology, and al-
lows simultaneous visualization of clusters. DSOM combines features of SOM
with two-dimensional position vectors, to provide a visualization tool for de-
ciding on the required number of clusters. However, its free parameters are
difficult to control to guarantee proper convergence. ADSOM updates these
free parameters during training, and allows convergence of its position vectors
to a fairly consistent number of clusters (provided its initial number of nodes
is greater than the expected number of clusters). The effectiveness of AD-
SOM in identifying the number of clusters is proven by applying it to publicly
available gene expression data from multiple biological systems such as yeast,
human and mouse.
EC
Use of GAs for reconstructing genetic networks has been reported in literature
[172, 173]. Typically the GA searches for the most likely genetic networks that
best fit the data, considering the set of genes to be included in the network
along with the strength of their interactions.
Hybridization
Ritchie et al. [174] optimized the back propagation neural network architec-
ture, using genetic programming, in order to improve upon the ability of ANNs
to model, identify, characterize and detect nonlinear gene-gene interactions in
studies of common human diseases. The performance is reported to be supe-
rior in terms of predictive ability and power to detect gene-gene interactions
when nonfunctional polymorphisms are present.
Identification of protein-DNA interactions in the promoter region, in terms
of DNA motifs that characterize the regulatory factors operating in the tran-
scription of a gene, is important for recognizing genes that participate in a
regulation process. This enables determination of their interconnection in a
6.8 Conclusion
6.9 Exercises
4. (a) What are the different kinds of learning in artificial neural networks?
(c) Study the effect of varying the mutation probability on the performance
of GAs.
6. Five strings have fitness function values of 2, 4, 6, 10, 16, respectively. Write
a program for roulette wheel selection to find the expected number of copies
of each string in the mating pool, given that a constant population size of five
is maintained.
9. Simulate the c-means, fuzzy c-means and rough c-means clustering algo-
rithms on a microarray gene expression dataset of your choice. Comment on
their relative merits and demerits.
References
[1] L. A. Zadeh, “Fuzzy logic, neural networks, and soft computing,” Communica-
tions of the ACM, vol. 37, pp. 77–84, 1994.
[2] S. K. Pal and S. Mitra, Neuro-fuzzy Pattern Recognition: Methods in Soft Com-
puting. New York: John Wiley, 1999.
[3] S. Mitra and T. Acharya, Data Mining: Multimedia, Soft Computing, and Bioin-
formatics. New York: John Wiley, 2003.
[4] S. Mitra and Y. Hayashi, “Bioinformatics with soft computing,” IEEE Trans-
actions on Systems, Man, and Cybernetics, Part C: Applications and Reviews,
vol. 36, pp. 616–635, 2006.
[5] L. A. Zadeh, “Fuzzy sets,” Information and Control, vol. 8, pp. 338–353, 1965.
[6] L. A. Zadeh, “The concept of a linguistic variable and its application to approxi-
mate reasoning: Part 1, 2, and 3,” Information Sciences, vol. 8, 8, 9, pp. 199–249,
301–357, 43–80, 1975.
[7] L. A. Zadeh, “Fuzzy sets as a basis for a theory of possibility,” Fuzzy Sets and
Systems, vol. 1, pp. 3–28, 1978.
[8] L. A. Zadeh, “The role of fuzzy logic in the management of uncertainty in expert
systems,” Fuzzy Sets and Systems, vol. 11, pp. 199–227, 1983.
[9] H. J. Zimmermann, Fuzzy Sets, Decision Making and Expert Systems. Boston,
MA: Kluwer Academic Publishers, 1987.
[10] G. J. Klir and B. Yuan, Fuzzy Sets and Fuzzy Logic: Theory and Applications.
NJ: Prentice Hall, 1995.
[11] E. H. Mamdani and S. Assilian, “An experiment in linguistic synthesis with a
fuzzy logic controller,” International Journal of Man Machine Studies, vol. 7,
pp. 1–13, 1975.
Perhaps the area most brought to mind by the term bioinformatics is sequence
analysis, including problems such as sequence alignment, gene-finding, iden-
tifying intron-exon boundaries, protein structure prediction and identifying
transcription factor binding sites. Techniques for solving these problems date
back to the 1970’s, and many were developed from ideas of string processing
in computer science. However, there are strong mathematical connections be-
tween standard sequence analysis algorithms and ideas in machine learning
and statistics. Methods for probabilistic modeling of discrete data are espe-
cially prevalent, including Hidden Markov Models (HMMs), as emphasized
by Durbin et al. [21]. We discuss some of these connections in this section,
focussing on two paradigmatic problems: sequence alignment and the identi-
fication of transcription factor binding sites. Protein structure prediction is
discussed at greater length in Chapters 6 and 8. For material on gene- and
exon-finding see, for example, [15, 14, 48].
211
(A) TGTTGTGTTGAGGTCACGTGCTATTAGCGCTGG
TGTATCTACTCACAGCAGATAGGCTCTGC
TGTGTCGGACTCATTGGGGCCGCCGG
TTGTCGGAGTTACCTGAAGTAGCACGG
Figure 7.1 Different types of sequence alignment. (A) Four DNA strings generated
by subjecting a common ancestor string (not shown) to 10 random point mutations,
insertions and delections. (B) A global pairwise alignment of the first two strings.
Characters connected by a vertical line are said to be aligned. (C) A local pairwise
alignment of the first two strings. (D) A global multiple alignment of all four strings.
(E) A local multiple alignment of all four strings. All alignments shown are optimal
with respect to the scoring function S(a, b) defined by three rules: S(a, b) = +5 if
a = b; S(a, b) = −5 for pairs (A,G), (G,A), (C,T) and (T,C); S(a, b) = −7 for all
other pairs. The gap penalty function is linear, γ(i) = −10i.
One potential problem is that when there are relatively few experimentally
determined TFBSs, some entries of the matrix M may be zero. (M ′ or M ′′
would have −∞ entries.) If Mi,j = 0, then the model predicts that the tran-
scription factor would never bind to a DNA sequence with nucleotide i in
position j. While this may be correct in some cases, the general observation
is that transcription factor binding is not so strict, and zeros in the PWM
can result in serious false negatives. One solution to this problem is to replace
the maximum likelihood parameter estimates with Bayesian parameter esti-
Problems related to sequence analysis and their solutions grew slowly in com-
plexity and sophistication over the course of several decades, as more sequence
data became available and as our scientific understanding of that data grew.
By contrast, the production of quantitative gene expression data was revo-
lutionized in the mid-1990s by the invention of high-throughput expression
assays, especially RNA expression microarrays and SAGE. These technolo-
gies offer great promise for understanding system-wide phenomena as well
as hunting down genes associated with different cellular response or diseases.
Once the expression data matrix is obtained (we assume rows correspond to
genes and columns correspond to samples), subsequent analysis depends on
the questions the researcher wants to answer. A common starting point is to
plot or visualize the data. Clustering and dimensionality-reduction techniques
are useful in this regard—and may be useful as preprocessing for further anal-
ysis. It has become almost obligatory for publications involving microarray
data to include a heat map of the data matrix with the rows of the matrix or-
ganized according to a hierarchical clustering, typically constructed by single-
or average-linkage agglomerative clustering. (For an example based on the
yeast cell cycle data of Spellman et al. [53], see Figure 7.2A.) A dendrogram
(A) (B)
Figure 7.2 (A) Heatmap and dendrogram for hiearchical clustering of microarray
data [53]. Rows correspond to 800 genes estimated to be cell-cycle regulated. Columns
correspond to 73 experimental conditions, corresponding to four time series in which
the yeast cells progressed through the cell cycle. The clustering is an average-link
agglomerative clustering based on Euclidean distance between expression profiles of
genes (rows of the data matrix). (B) Plots of each time series projected on to the first
two principal components (computed based on all the data). Dots represent samples
and lines connect the time series. A large dot marks the start of each time series and
an ‘X’ marks the end of each time series. The title of each plot refers to the means
used to synchronize the cells at the same stage of the cell cycle.
alongside the matrix indicates the structure of the hierarchical clustering, and
the branch heights indicate the dissimilarity of the clusters joined. If the sam-
ples are not naturally ordered—for example, they correspond to independent
samples and not a time series—then the columns are often clustered as well.
Dimensionality reduction can be used to reduce either the number of rows or
the number of columns in the data matrix. In the former case, which is the
more common of the two, we construct a new coordinate basis for representing
different samples. When the basis has two or three dimensions, the samples
can be plotted in that space, giving a visual sense of similarity between the
samples and the distribution of the data. For example, when the time series
comprising the Spellman et al. data [53] are plotted in two dimensions, the
series’ samples trace out one or two cycles around the origin. More medically
relevant applications include, for example, using principal components anal-
ysis to visualize similarities between different kinds of stem cells [39], and
using self-organizing maps to classify cancerous tumors [19]. Dimensionality
reduction and clustering, especially partitional clustering, can also be use-
ful preprocessing steps for solving prediction or network inference problems.
By reducing the number of independent variables, one reduces the chance of
overfitting and can avoid situations in which the learning problem is under-
constrained.
Another approach to understanding microarray data is to test for the differen-
tial expression of genes between two or more conditions. If there are multiple
replicates from each of a pair of conditions, then simple t-tests, applied to
each gene, can determine which genes show a statistically significantly differ-
ent mean expression level. A slightly more sophisticated approach that has
been widely adopted is Significance Analysis of Microarrays (SAM) [58]. It
modifies the t-statistic slightly by including a correction to the sample stan-
dard deviation that accounts for greater variability in measurements of genes
expression at a low level. Permutation tests can be used to estimate the false
discovery rate. Other elaborations are aimed at the situation of very few repli-
cates (e.g., [5, 12]). The ANOVA can be used to detect significant changes in
differential expression among three or more conditions [31]. These approaches
generate lists of genes which appear to be differentially expressed, providing
a starting point for further biological investigation.
When lists of differentially expressed genes are very large—say, hundreds of
genes—extracting useful information is challenging. One approach is gene en-
One of the ultimate aims of molecular biology is to identify all the chemi-
cal entities involved in life and how they relate or interact. In particular, the
problem of genetic network inference is to identify regulatory relationships be-
tween genes, often mediated by transcription factors, that control so much of
cellular function. Techniques in sequence analysis, especially for the discovery
of transcription factor binding sites, are one avenue for solving this problem.
In this section, we describe a variety of further techniques. First, we con-
sider techniques based on expression data alone. Then we describe techniques
that integrate different types of data (e.g., sequence and expression data) to
estimate regulatory relationships, as well as mentioning a few approaches for
inferring other types of networks, such as protein-protein interaction networks.
(A) Colonies
COLL
ALP
OPN
BSP
OCN
FGFR1
PDGFRα
PTH1R
PTHrP
(B) (C)
OPN PDGFRα PTHrP COLL ALP
Figure 7.4 (A) A binary gene expression matrix concerning nine genes (rows) in
a set of independent cultures of osteoblasts (patterned after Figure 2 of Madras et
al. [34]). Shaded boxes indicate genes that were expressed in each colonies; white
boxes indicate genes that were not expressed. (B) Fisher’s exact test, a pairwise
test of association, with a stringent p-value suggests pairs of genes whose expression
is correlated more than would be expected by chance [34]. Several genes have no
associations. OPN, for example, becomes expressed before the other genes and is
turned on in every colony, so there is no statistical basis for associating it to the
other genes. (C) A Bayesian network analysis of four of the genes with the strongest
pairwise associations, COLL, ALP, BSP and OCN, suggests a different and more
specific relationship among them, with COLL and ALP regulating BSP and BSP
regulating OCN [37]. There is insufficient evidence for regulation between COLL
and ALP, as suggested by the pairwise tests. More importantly, the COLL-OCN
and ALP-OCN correlations in the pairwise model are attributed to indirect effects,
through BSP, in the Bayesian network model.
be used to quantify degree of association, and p-values for the observed degree
of association under the null hypothesis of no assocation can be derived in a
number of ways. For discretized expression data, tests such as the chi-square,
Fisher’s exact test or a test based on mutual information are all possibilities.
(See Figure 7.4 for an example, and Nagarajan et al. [37] for more detailed
analyses.) The first two tests directly produce a p-value for the hypothesis of no
association between the variables. The mutual information between two ran-
dom variables, estimated based on the observed samples, measures strength
of association but not significance. Typically, a permutation test is used to
assess significance of the mutual information score.
The advantages of pairwise tests are their simplicity and computational effi-
ciency. They can be applied to microarray data, for example, to test for asso-
ciations between every pair of genes in an organism, even though the number
of pairs can easily be in the tens of millions. Only the mutual information test,
The prediction formulation of the problem has also been popular for theoret-
ical analysis, where one of the main questions has been how much data are
needed to infer network structure and/or parameters. Often, many simplifying
assumptions on the form of the data and the inference procedure are made for
the sake of the analysis. For example, Liang et al. [33] proposed the REVEAL
algorithm for the case that the expression matrix is binary and noiseless, in
which, for every gene i, the smallest set of other genes is sought such that
the entropy of i’s expression conditioned on the entropy of the other genes’
expression is zero. The expected number of samples needed to successfully
infer the network structure has been studied under a variety of assumptions
on the form of the data, including randomly sampled data [2, 40, 30], time
series data [41, 40] and knock-out or overexpression data [1, 28]. However,
these algorithms assume noiseless data and have not been applied directly in
practice.
There are limitations to what can be deduced from expression data alone, due
to factors such as: unobserved variables, noise, inaccuracy in the formulation
of the model and even inherent nonidentifiability. Conversely, there are many
other sources of information that are useful modeling networks, especially
in deducing network structure. Possibilities include: the genome sequence of
the organism and related organisms, especially the sequences of promoter
regions where transcription factors bind; localization data, such as from chip-
chip experiments; chromatin modification data; and, of course, the wealth of
knowledge already published in the biological literature. From this situation
arose the philosophy of integrative biology—the search for methods that can
somehow combine evidence about network structure or function from two or
more qualitatively different types of data.
One body of work that exemplifies this idea is the search for evidence of
co-regulation among genes that are empirically co-expressed. Recent large-
scale studies lend support to the idea that co-expressed genes tend to share
regulators (e.g., [3]). However, algorithms for finding potential regulatory el-
ements common to the promoter sequences of a given set of genes stretch
back decades. (See [54] for a recent review.) When the set of genes is based
on high-throughput expression data, a common approach is to begin by find-
ing a partitional clustering of the genes. Each gene in a cluster thus shares
similarities in expression pattern, which may be due to shared regulators.
The promoter regions of the genes in the cluster are analyzed for signatures of
shared regulation. These nucleotide signatures may be as simple as a consensus
sequence [60], a consensus sequence with wildcard or “don’t care” characters
[46, 11], or position weight matrices (perhaps representing a TFBS) [4, 47, 56].
In one formulation of the problem, we seek maximally specific patterns that
are common to all or a specified fraction of the promoters in the gene clus-
ter. Maximally specific may refer to the length of a consensus pattern, for
example, or the entropy of a position weight matrix (which should be low).
In another formulation of the problem, we seek patterns that are common to
the promoters in the gene cluster but absent, mostly absent or unlikely in a
7.4 Exercises
3. Suppose that a set of binding sites for a transcription factor has been exper-
imental determined, having the sequences: GGATTT, GGATTA, GCATTA,
CGAATA, GCAATA, GGTTTA and GCACTA. (a) Determine a consensus
sequence for these binding sites by identifying the most commonly occurring
nucleotide in each position. (b) Assume a null hypothesis in which a genome
4. Obtain the Spellman et al. [53] yeast cell cycle data. Compute the princi-
pal components of the whole data set, not just those based on the 800 genes
estimated to be cell cycle regulated. Plot each time series along the first two
principal components. How do your plots compare to those in Figure 7.2B?
X3
X1
X4 X6
X2
X5
(a) Use a pairwise dependency test, such as Fisher’s exact test or a mutual
information-based test, to detect statistically significant associations between
the variables. Which dependencies are correctly identified, which are missed
and which are falsely asserted? How do the answers to these questions depend
on n and p?
(b) Use a Bayesian network structure learning procedure to learn the re-
lationships between the variables. Again, which dependencies are correctly
identified, which are missed and which are falsely asserted, and how do the
answers to these questions depend on n and p?
References
8.1 Introduction
8.2 Background
237
Proteins (also called polypeptides) are constructed from a set of building blocks
called amino acids. Each of the twenty naturally-occurring amino acids con-
sists of an amino group and a carboxylic acid group on one end, and a variable
chain on the other. When forming a protein, adjacent amino groups and car-
boxylic acid groups condense to form a repeating backbone (or mainchain),
while the variable regions become dangling sidechains. The atom at the inter-
face between the sidechain and the backbone is known as the alpha carbon,
or Cα for short (see Figure 8.1). The linear list of amino acids composing a
protein is often referred to as the protein’s primary structure (see Figure 8.2a).
A protein’s secondary structure (see Figure 8.2b) refers to commonly occur-
ring three-dimensional structural motifs taken by continuous segments in the
protein. There are two such motifs: α-helices, in which the peptide chain folds
in a corkscrew, and β-strands, where the chain stretches out linearly. In most
proteins, several β-strands run parallel or antiparallel to one another. These
regular structural motifs are connected by less-regular structures, called loops
(or turns). A protein’s secondary structure can be predicted somewhat accu-
rately from its amino-acid sequence [1].
Finally, a protein’s three-dimensional conformation – also called its tertiary
structure (see Figure 8.2c) – is uniquely determined from its amino acid se-
quence (with some exceptions). No existing computer algorithm can accurately
OH H3C CH3 SH
Sidechains CH2 CH CH2
H H H
Backbone H N C C N C C N C C OH
H O H O H O
Amino end Alpha Peptide Carboxyl end
(N-terminus) carbon bond (C-terminus)
Figure 8.1 Proteins are constructed by joining chains of amino acids in peptide
bonds. A chain of three amino acid residues is illustrated.
(a) MET−SER−SER−SER−SER−SER−VAL−PRO−ALA−TYR−LEU−GLY−ALA−
LEU−GLY−TYR−MET−ALA−MET−VAL−PHE−ALA−CYS−...
(c)
(b) MET−SER−SER−SER−SER−SER−VAL−PRO−ALA−TYR−LEU−GLY−ALA−
LEU−GLY−TYR−MET−ALA−MET−VAL−PHE−ALA−CYS−...
Figure 8.2 An illustration of: (a) a protein’s primary structure, the linear amino-
acid sequence of the protein, (b) a protein’s secondary structure, which describes local
structural motifs such as alpha helices and beta sheets, and (c) a protein’s tertiary
structure, the global three-dimensional conformation of the protein.
electron density map. Unfortunately, the experiment can only measure the
intensities of these (complex-valued) structure factors; the phases are lost.
Determining these missing phases is known as the phase problem in crystallog-
raphy, and can be solved to a reasonable approximation using computational
or experimental techniques [2]. Only after estimating the phases can one com-
pute the electron-density map (which we will refer to as a “density map” or
simply “map” for short).
The electron density map is defined on a 3D lattice of points covering the
unit cell, the basic repeating unit in the protein crystal. The crystal’s unit cell
may contain multiple copies of the protein related by crystallographic sym-
metry, one of the 65 regular ways a protein can pack into the unit cell. Rota-
tion/translation operators relate one region in the unit cell (the asymmetric
unit) to all other symmetric copies. Furthermore, the protein may form a mul-
timeric complex (e.g., a dimer, tetramer, etc.) within the asymmetric unit. In
all these cases it is up to the crystallographer to isolate and interpret a single
copy of the protein.
Figure 8.4 shows a sample fragment from an electron density map, and the
corresponding interpretation of that fragment. The amino-acid (primary) se-
quence of the protein is typically known by the crystallographer before inter-
preting the map. In a high-quality map, every single (nonhydrogen) atom in
the protein can be placed in the map (Figure 8.4b). In a poor-quality map
it may only be possible to determine the general locations of each residue.
This is known as a Cα trace (Figure 8.4c). This information - though not as
comprehensive as an all-atom model - is still valuable to biologists.
The quality of experimental maps as well as the sheer number of atoms in
a protein makes interpretation difficult. Certain protein crystals produce a
very narrow diffraction pattern, resulting in a poor-quality, “smoothed” den-
sity map. This is quantified as the resolution of a density map, a numeric
value which refers to the minimum distance at which two peaks in the density
Figure 8.4 An overview of electron density map interpretation. Given the amino-
acid sequence of the protein and a density map (a), the crystallographer’s goal is to
find the positions of all the protein’s atoms (b). Alternatively, a backbone trace (c),
represents each residue by its Cα location.
Figure 8.5 Electron density map quality at various resolutions. The “sticks” show
the position of the atoms generating the map.
map can be resolved. Figure 8.5 shows a simple density map at a variety of
resolutions.
Experimentally determined phases are often very inaccurate, and make inter-
pretation difficult as well. As the model is built, these phases are iteratively
improved [3], producing a better quality map, which may require resolving
large portions of the map. Figure 8.6 illustrates the effect poor phasing has on
density-map quality. In addition, noise in diffraction-pattern data collection
also introduces errors into the resulting density map.
Finally, the density map produced from x-ray crystallography is not an “im-
age” of a single molecule, but rather an average over an ensemble of all the
molecules contained within a single crystal. Flexible regions in the protein are
not visible at all, as they are averaged out.
For most proteins, this interpretation is done by an experienced crystallogra-
pher, who can, with high-quality data, fit about 100 residues per day. How-
Figure 8.6 Electron density map quality as noise is added to the computed phases.
The “sticks” show the position of the atoms generating the map.
The R-factor measures how well the proposed 3D structure explains the ob-
served electron-density data. Crystallographers usually strive to get R-factors
under 0.2 (or lower, depending on map resolution), while also building a
physically-feasible (i.e., valid bond distances, torsion angles, etc.) protein
model without adding too many water molecules. One can always reduce the
R-factor by placing extra water molecules in the density map; these reductions
are a result of overfitting the model to the data, and don’t correspond to a
physically feasible interpretation.
Another commonly used measure is free R-factor, or Rf ree . Here, 5-10% of
reflections are randomly held out as a test set before refinement. Rf ree is the
R-factor for these held-aside reflections. Using Rf ree tends to avoid overfitting
the protein’s atoms to the reflection data.
Probabilistic models
Above, the sums are over all possible outcomes of events B and C. The
marginal distribution is important because it provides information about the
distribution of some variables (A above) in the full joint distribution, with-
out requiring one to explicitly compute the (possibly intractable) full joint
distribution.
Finally, Bayes’ rule allows one to reverse the direction of a conditional:
P (B|A)P (A)
P (A|B) = . (8.4)
P (B)
Bayes’ rule is useful for computing a conditional P (A|B) when direct esti-
mation (using frequencies from a training set) is difficult, but when P (B|A)
can be estimated accurately. Often, one drops the denominator, and instead
computes the relative likelihood of two outcomes, for example, P (A = a1 |B)
versus P (A = a2 |B). If a1 and a2 are the only possible outcomes for A, then
exact probabilities can be determined by normalization; there is no need to
compute the prior P (B).
Case-based reasoning
Then, the k neighbors “vote” on the query instance’s label: usually the ma-
jority class label (for classification) or average label (for regression) of the k
neighbors is used. One variant of kNN weights each neighbor’s vote by its
! !
similarity to the query. Another variant learns weights for each dimension, to
be used when computing the distance between two instances.
Neural networks
8.3 arp/warp
Figure 8.8 A 3.5A resolution electron density map – containing two copies of a
95-amino-acid protein – and its crystallographer-determined solution. This map, at
various resolutions, will be used as a running example throughout the section.
For small molecules, arp’s next step is refining the free-atom model; that is,
iteratively moving atoms to better explain the density map. Free-atom refine-
ment ignores stereochemical information, and moves each atom independently
to produce a complete structure. Arp’s free-atom refinement, in addition to
moving atoms, considers adding or removing atoms from the model. Multiple
randomized initial structures are used to improve robustness. Further details
are available from Perrakis et al. [7].
However, with molecules as large as proteins, free-atom refinement alone is
insufficient to produce an accurate model. Performing free-atom refinement
with tens of thousands of atoms leads to overfitting, producing a model that is
not physically feasible. For determining protein structures, arp/warp makes
use of connectivity information in its refinement, using free-atom placement as
a starting point. The procedure warpntrace adds connectivity information
to the free atom model.
Given a free-atom model of a protein, one can form a crude backbone trace
by looking for pairs of free atoms the proper distance apart. Warpntrace
formalizes this procedure, called autotracing, using a heuristic method. The
method is outlined in Algorithm 8.1. Warpntrace assigns a score – based
on density values – to each free atom. The highest scoring atom pairs 3.8 ±
0.5A apart become candidate Cα ’s. The algorithm verifies candidate pairs by
overlaying them with a peptide template. If the template matches the map,
warpntrace saves the candidate pair.
After computing a list of Cα pairs, warpntrace constructs the backbone
using a database of known backbone conformations (taken from solved protein
structures). Given a chain of candidate Cα pairs, warpntrace considers all
!$#
!"#
!%#
Figure 8.10 Intermediate steps in arp/warp’s structure determination: (a) the free
atom model, where waters are placed in the map, (b) the hybrid model, after some
connections are determined and (c) the final determined structure.
8.3.3 Discussion
8.4 resolve
Figure 8.12 The averaged helix (left) and strand (right) fragment used in resolve’s
initial matching step.
electron density for each at 3A resolution, and averages the density across
all examples. The “average” models used by resolve are illustrated in Fig-
ure 8.12.
Given these model fragments, resolve considers placing them at each position
in the map. At each position it considers all possible rotations (at a 30◦ or 40◦
discretization) of the fragment, and computes a standardized squared-density
difference between the fragment’s electron density and the map:
X 1
t(~x) = ǫf (~y ) ρ′f (~y ) − ρ(~y − ~x) − ρ̄(~x) . (8.7)
σf (~x)
y
~
Above, ρ(~x) is the map in which we are searching, ρ′f (~x) is the standardized
fragment electron density, ǫf (~x) is a masking function that is nonzero only
for points near the fragment and ρ̄(~x) and σf (~x) standardize the map in the
masked region ǫf centered at ~x:
P
y )ρ(~y − ~x)
y ǫf (~
~
ρ̄(~x) = P
y ǫf (~
~ y)
P 2
2 ~ y ) ρ(~y − ~x) − ρ̄(~x)
y ǫf (~
σf (~x) = P . (8.8)
y ǫf (~
~ y)
Resolve computes the matching function t(~x) quickly over the entire unit
cell using fffear’s FFT-based convolution [11].
After matching the two model fragments using a coarse rotational step-size,
the method generates a list of best-matching translations and orientations of
each fragment (shown in Figure 8.13a). Processing these matches in order,
Resolve refines each fragment’s position and rotation to maximize the real-
space correlation coefficient (RSCC) between template and map:
hρf · ρi − hρf ihρi
RSCC(ρf , ρ) = q p . (8.9)
2
hρf i − hρf i2 hρ2 i − hρi2
Here, hρi indicates the map mean over a fragment mask. Resolve only con-
siders refined matches with an RSCC above some threshold.
!"#
!%#
!$#
At this point, resolve has a set of putative helix and strand locations in
the density map. The next phase of the algorithm extends these using a much
larger library of fragments, producing a model like that in Figure 8.13b. Specif-
ically, resolve makes use of four such libraries for fragment extension:
Resolve learns these fragment libraries from a set of previously solved protein
structures. It constructs the two tripeptide libraries by clustering a larger
dataset of tripeptides.
For each potential model’s placement in the map, resolve considers extend-
ing it using each fragment in either set (a), if the model fragment is a helix, or
set (b), if the model fragment is a strand. For each fragment, resolve chooses
the longest segment of the fragment such that every atom in the fragment has
a density value above some threshold.
To facilitate comparison between these 17 segments of varying length (one
for each√fragment in the library), each matching segment is given a score
Q = hρi N , with hρi the mean atom density, and N the number of atoms.
The algorithm computes a Z-score:
Q − hQi
Z= . (8.10)
σ(Q)
Resolve only considers segments with Z > 0.5. Notice there may be a large
number of overlapping segments in the model at this point.
For each segment in the model, resolve attempts to extend the segment
in both the N-terminal and C-terminal direction using the tripeptide library.
Resolve tests each tripeptide in the library by superimposing the first residue
of the tripeptide on the last residue of the current model segment. It then tests
the top scoring “first-level” fragments for overlap (steric clashes) with the
current model segment. For those with no overlap, a lookahead step considers
this first-level extension as a starting point for a second extension. The score
for each first-level extension is:
scorefirst-level = hρfirst-level i + max hρsecond-leveli. (8.11)
second-level
Above, hρfirst-level i denotes the average map density at the atoms of the first-
level extension.
Resolve accepts the best first-level extension – taking the lookahead term
into account – only if the average density is above some threshold density
value. If the density is too low, and the algorithm rejects the best fragment,
several “backup procedures” consider additional first-level fragments, or step-
ping back one step in the model segment. If these backup procedures fail,
resolve rejects further extensions.
Given this set of candidate model segments, resolve’s next step is assem-
bling a continuous chain. To do so, it uses an iterative method, illustrated in
Algorithm 8.2. The outermost loop repeats until no more candidate segments
Resolve’s final step is, given a set of Cα positions in some density map, to
identify the corresponding residue type, and to trace all the sidechain atoms
[14]. This sidechain tracing is the first time that resolve makes use of the
analyzed protein’s sequence. Resolve’s sidechain tracing uses a probabilistic
method, finding the most likely layout conditioned on the input sequence.
Resolve’s sidechain tracing procedure is outlined in Algorithm 8.3.
Resolve’s sidechain tracing relies on a rotamer library. This library consists
of a set of low-energy conformations – or rotamers – that characterizes each
amino-acid type. Resolve builds a rotamer library from the sidechains in 574
protein structures. Clustering produces 503 different low-energy side-chain
conformations. For each cluster member, the algorithm computes a density
map; each cluster’s representative map is the average of its members.
For each Cα , resolve computes a probability distribution of the correspond-
ing residue type. Probability computation begins by first finding the corre-
lation coefficient (see Equation 8.9) between the map and each rotamer. For
each rotamer j, the correlation coefficient at the kth Cα is given by ccjk . A
Z-score is computed, based on rotamer j’s correlation at every other Cα :
rot ccjk − hccj i
Zjk = . (8.12)
σj
The algorithm only keeps a single best-matching rotamer of each residue type.
8.4.5 Discussion
8.5 textal
Algorithm 8.4: Textal’s capra subroutine for calculating the initial back-
bone trace
Given: electron density map M
Find: putative backbone trace X = {~xi }
M′ ← normalize(M)
pseudoAtoms ← skeletonize(M′)
for pi ∈ pseudoAtoms do
F ← rotation invariant-features in a neighborhood around pi
distance-to-Cα ← neuralN etwork(F)
end
X ← construct chain using predicted distances-to-Cα
After capra returns its predicted backbone trace, textal must next identify
the residue type associated with each Cα . This identification is performed by a
subroutine lookup. Algorithm 8.5 shows a pseudocode overview of lookup.
Essentially, the subroutine compares the density around each Cα to a database
of solved maps to identify the residue type. Lookup uses textal’s rotation
invariant features, and builds a database of feature vectors corresponding to
Cα ’s in solved maps. To determine the residue type of an unknown region of
!$#
!"#
!%#
Figure 8.15 Textal’s intermediate steps: (a) the skeletonized density map, which
crudely approximates the protein backbone, (b) a backbone trace, which textal builds
by determining Cα ’s from the skeleton points, and (c) the final determined structure.
density, lookup finds the nearest neighbors in the database, using weighted
Euclidian distance:
hX 2 i1/2
D(ρ1 ||ρ2 ) = λi · Fi (ρ1 ) − Fi (ρ2 ) . (8.16)
i
Above, Fi refers to the ith feature in the vector, while ρ1 and ρ2 are two
regions of density. Feature weights λi are optimized to maximize similarity
between matching regions and minimize between nonmatching regions, where
ground truth is the optimally-aligned RSCC (Equation 8.9). Textal sets
weights using the slider algorithm [20] which considers features pairwise to
determine a good set of weights.
Since information is lost when representing a region as a rotation invariant fea-
ture vector, the nearest neighbor in the database does not always correspond to
the best-matching region. Therefore, lookup keeps the top k regions – those
with the lowest Euclidean distance – and considers these for a more time-
consuming RSCC computation (see Equation 8.9). Ideally, lookup wants
to find the rotation and translation of each of the k regions to maximize
Since each residue’s atoms are copied from previous examples and glued to-
gether in the density map, the model produced by lookup may contain some
physically infeasible bond lengths, bond angles or φ − ψ torsion angles. Tex-
tal’s final step is improving the model using a few simple post-processing
heuristics. First, lookup often reverses the backbone direction of a residue;
textal’s post-processing makes sure that all chains are oriented in a consis-
tent direction. Refinement, like that of arp/warp, corrects improper bond
lengths and bond angles, iteratively moving individual atoms to fit the density
map better. Finally, textal takes into account the target protein’s sequence
to fix mismatched residues.
8.6 acmi
The local matching component of acmi is provided the density map and the
protein’s amino acid sequence. It computes, for each residue in the protein,
a probability distribution Pi (w
~ i ) over all locations w
~ i in the unit cell. This
/!"#$%&' ,&(!"
Given some 5-amino-acid sequence, acmi uses the Protein Data Bank (PDB),
a repository of solved protein structures, to find all the instances of this se-
quence. If there are fewer than fifty such instances, acmi considers “near-
Figure 8.17 An overview of the 5-mer template matching process. Given a cluster
of 5-mers for residue i, acmi performs a 6D search for the fragment in the density
map. Acmi also matches the fragment to a tuning set of known structures, using
Bayes’ rule to determine a probability distribution from the match scores t(w).
~
Given each residue’s independent probability distribution over the unit cell,
Pi (~xi ), acmi accounts for global constraints (enforced by physical feasibility)
of a conformation by modeling the protein using a pairwise Markov field. A
pairwise Markov field defines the joint probability distribution over a set of
variables as a product of potential functions defined over vertices and edges
in an undirected graph (see Figure 8.19).
!"#
!%#
&'()* +'+,*
!$#
&'()* +'+,*
Figure 8.18 Intermediate steps in acmi’s structure determination: (a) the matching
probability distributions Pi (~
xi ) on two residues, GLU20 and ALA60 , contoured at
p = 10−4 , (b) the marginal probability distributions over the same two residues and
(c) the final (backbone-only) model, each residue shaded by likelihood (darker is more
likely).
Figure 8.19 Acmi’s protein backbone model. The joint probability of a conformation
of residues is the product of an observation potential psii at each node, (b) an ad-
jacency potential between adjacent residues and (c) an occupancy potential between
all pairs of nonadjacent residues.
map, is:
Y
P (W|M) ∝ ψadj (w
~ i, w
~j )
(w
~ i ,w
~ j )∈W,|i−j|=1
Y
× ψocc (w
~ i, w
~j )
(w
~ i ,w
~ j )∈W,|i−j|>1
Y
× ψi (w
~ i , M). (8.19)
w
~ i ∈W
Adjacency potentials
Occupancy potentials
Occupancy potentials ensure that two residues do not occupy the same loca-
tion in space. They are defined independently of orientation, and are merely
a step function that constrains two (nonadjacent) Cα ’s be at least 3A apart.
It is in this structural potential function that acmi deals with crystallo-
graphic symmetry, by ensuring that all crystallographic copies are at least
3A apart:
min
1 symmetric ||xi − K(xj )|| ≥ 3.0A
ψocc (w
~i, w
~j) = transf orms K . (8.21)
0 otherwise.
Multiple chains in the asymmetric unit are also handled by acmi: edges en-
forcing occupancy constraints fully connect separate chains.
Above, the belief b̂ni at iteration n is the best estimate of residue i’s marginal
distribution,
X X X X
b̂ni (w
~i) ≈ ... ... P (W, M). (8.23)
w
~0 w
~ i−1 w
~ i+1 w
~N
else
mnj→i (w
R
~ i ) ← w~ j ψocc (w ~ j ) × b̂j (w
~ i, w ~ j )dw
~j
end
// aggregate messages
b̂i (w ~ i ) × mnj→i (w
~ i ) ← b̂i (w ~i)
end
end
until (b̂i ’s converge)
Computing the message from j to i uses all the messages going into node j
except the message from node i. When using BP in graphs with loops, such as
acmi’s protein model, there are no guarantees of convergence or correctness;
however, empirical results show that loopy BP often produces a good approx-
imation to the true marginal [22]. On the example protein, acmi computes
the marginal distributions shown in Figure 8.18b.
To represent belief and messages, acmi uses a Fourier-series probability den-
sity estimate. That is, in the Cartesian coordinates ~xi , marginal distributions
are represented as a set of 3-dimensional Fourier coefficients fk , where, given
an upper-frequency limit, (H, K, L):
H,K,L
X
bni (~xi ) = fhkl × e−2πi(~xi hh,k,li) . (8.25)
h,k,l=0
In rotational parameters, acmi divides the unit cell into sections, and in each
That is, acmi computes occupancy messages using all incoming messages to
node j including the message from node i. All outgoing occupancy messages
from node j, then, use
Q the same estimate. Acmi caches the product of all
occupancy messages i mi→∗ . This reduces the running time of each iteration
in a protein with n amino acids from O(n2 ) to O(n).
Additionally, acmi quickly computes all occupancy messages using FFTs:
h Y i
F mnj→i (w mn−1
~ i ) = F ψocc (w ~j ) × F
~ i, w j→i (w
~ i) . (8.28)
8.6.3 Discussion
8.7 Conclusion
8.8 Acknowledgments
This work supported by NLM grant 1R01 LM008796-01 and NLM Grant 1T15
LM007359-01. The authors would also like to thank George Phillips and Tom
Ioerger for assistance in writing this chapter.
References
[1] B. Rost and C. Sander (1993). Prediction of protein secondary structure at better
than 70% accuracy. J Mol Biol.
[2] G. Rhodes (2000). Crystallography Made Crystal Clear. Academic Press.
[3] J. Abrahams and R. De Graaff (1998). New developments in phase refinement.
Curr Opin Struct Biol.
[4] S. Russell and P. Norvig (1995). Artificial Intelligence: A Modern Approach.
Prentice Hall.
[5] T. Mitchell (1997). Machine Learning. McGraw-Hill.
[6] V. Lamzin and K. Wilson (1993). Automated refinement of protein models. Acta
Cryst.
[7] A. Perrakis, T. Sixma, K. Wilson, and V. Lamzin (1997). wARP: Improvement
and extension of crystallographic phases by weighted averaging of multiple re-
fined dummy atomic models. Acta Cryst.
[8] R. Morris, A. Perrakis, and V. Lamzin (2002). ARP/wARP’s model-building
algorithms: the main chain. Acta Cryst.
[9] J. Greer (1974). Three-dimensional pattern recognition. J Mol Biol.
[10] L. Leherte, J. Glasgow, K. Baxter, E. Steeg, and S. Fortier (1997). Analysis of
three-dimensional protein images. JAIR.
[11] K. Cowtan (2001). Fast Fourier feature recognition. Acta Cryst.
[12] T. Oldfield (2001). A number of real-space torsion-angle refinement techniques
for proteins, nucleic acids, ligands and solvent. Acta Cryst.
[13] T. Terwilliger (2002). Automated main-chain model-building by template-
matching and iterative fragment extension. Acta Cryst.
[14] T. Terwilliger (2002). Automated side-chain model-building and sequence as-
signment by template-matching. Acta Cryst.
9.1 Introduction
277
The rest of the chapter is organized as follows. Section 9.2 introduces the basic
concepts of the biclustering problem with a state-of-the-art review. The use
of multi-objective GA (MOGA) and fuzzy possibilistic sets are investigated
in the soft computing framework. These are presented in Sections 9.3 and
9.4. The experimental results and their comparative study, along with some
biological validation in terms of gene ontology, are provided in Section 9.5.
Finally, Section 9.6 concludes the chapter.
9.2 Biclustering
Here
1 X
eic = eij , (9.3)
|c| j∈c
1 X
egj = eij (9.4)
|g| i∈g
are the mean row and column expression values for (g, c) and
1 X
egc = eij (9.5)
|g| × |c| i∈g,j∈c
is the mean expression value over all cells contained in the bicluster (g, c).
A user-defined threshold δ represents the maximum allowable dissimilarity
within the bicluster. In other words, the residue quantifies the difference be-
tween the actual value of an element eij and its expected value as predicted
from the corresponding row mean, column mean and bicluster mean. A set of
genes whose expression levels change in accordance to each other over a set
of conditions can thus form a perfect bicluster even if the actual values lie far
apart. For a good bicluster, we have G(g, c) < δ for some δ ≥ 0.
• Iterative row and column clustering combination [17]: Apply clustering al-
gorithms to the rows and columns of the data matrix, separately, and then
combine the results using some iterative procedure.
• Divide and conquer [18]: Break the problem into smaller sub-problems,
solve them recursively, and combine the solutions to solve the original prob-
lem.
• Greedy iterative search [6, 19]: Make a locally optimal choice, in the hope
that this will lead to a globally good solution.
• Exhaustive biclustering enumeration [20]: The best biclusters are identified,
using an exhaustive enumeration of all possible biclusters existent in the
data, in exponential time.
• Distribution parameter identification [21]: Identify best-fitting parameters,
by minimizing a criterion through an iterative approach.
There exist a number of investigations dealing with time-series data [33, 34].
A polynomial-time algorithm based on the Monte-Carlo method for finding
coclusters is described in Ref. [35]. Basic linear algebra and arithmetic tools
are used in the time domain [36] to search biclusters having constant values
on rows and columns, as well as those with coherent expressions.
A linear time continuous columns algorithm has been designed [37]. This re-
ports all relevant biclusters, extracted in linear time corresponding to the size
of the data matrix. The complexity is reduced after discretizing the expression
values into up, down and no change symbols, followed by the generation of a
suffix tree along with string processing. The performance is demonstrated on
synthetic and real world data.
To overcome some of the existing limitations, an attempt has been made [8] to
identify time lagged gene clusters based on the changing tendency of genes over
time. The slope of the discretized expression matrix is converted into symbols
0, -1, 1. Finally identification of time lagged subgroups of genes with similar
patterns is possible over consecutive time points. A binary reference model
Bimax [38] provides an interesting comparative evaluation of biclustering.
Soft computing tools like fuzzy sets and evolutionary algorithms have also
been used for biclustering. A possibilistic fuzzy approach has been investigated
[39] to find one bicluster at a time by assigning membership to each gene
and condition of the bicluster while minimizing the mean squared residue
and maximizing the size. After convergence, the membership is defuzzified.
However this methodology is found to be over sensitive to parameter tuning.
Section 9.4 presents the algorithm in greater detail.
GAs have been employed incorporating local search strategy for identifying
biclusters in gene expression data [14, 15]. Sequential evolutionary bicluster-
ing (SEBI) [40] detects high quality overlapped biclusters by introducing the
9.3.1 Representation
Genes Condition
Since the initial biclusters are generated randomly, it may happen that some
irrelevant genes and/or conditions get included in spite of their expression val-
ues lying far apart in the feature space. An analogous situation may also arise
(a) Compute eic , egj , egc and G(g, c) of the bicluster by eqns. (9.2)-(9.5).
(b) Remove all genes i ∈ g satisfying
1 X
(eij − eic − egj + egc )2 > α × G(g, c). (9.7)
|c| i∈g
(a) Recompute eic , egj , egc and G(g, c) of the modified bicluster by Step 1.
(b) Remove the node with largest mean squared residue (done for both gene
and condition), one at a time, until the mean squared residue drops
below δ.
(a) Recompute eic , egj , egc and G(g, c) of the modified bicluster of Step 2.
(b) Add all genes i ∈
/ g satisfying
1 X
(eij − eic − egj + egc )2 ≤ G(g, c). (9.9)
|c| i∈g
9.3.4 Algorithm
In Ref. [47] the objective function consists of two terms, the first being the
objective function of conventional c-means [48] while the second is a penalty
(regularization) term considering the entropy of clusters as well as their overall
membership values. It is defined as
s X
r s r
X X 1 X
Jm (U, Y ) = upq Epq + (upq log upq − upq ), (9.17)
p=1 q=1
β
p=1 p q=1
2
where Epq = kxq − yp k is the squared Euclidean distance, and the parameter
βp (scale) depends on the average size of the p-th cluster that must be assigned
before the clustering procedure. Thanks to the regularizing term, points with
a high degree of typicality have high upq values while those points not very
representative have low upq values in all the clusters. Note that if we take
βp → ∞ ∀p (i.e., the second term of Jm (U, Y ) is omitted), we obtain a
trivial solution of the minimization of the remaining cost function (i.e., upq =
0 ∀p, q), as no probabilistic constraint is assumed.
The pair (U, Y ) minimizes Jm , under the constraints (9.14)–(9.16), only if [47]
upq = e−Epq /βp ∀p, q, (9.18)
and
Pr
q=1 xq upq
yp = Pr ∀p. (9.19)
q=1 upq
These two equations may be interpreted as formulae for recalculating the mem-
bership functions and the cluster centers [49] following the Picard iteration
technique.
Note that the lack of probabilistic constraints makes the PCM approach equiv-
alent to a set of s independent estimation problems [50]
" r r
#
^ X 1 X
(upq , y) = arg upq Epq + (upq log upq − upq ) ∀p, (9.20)
u ,y q=1
βp q=1
pq
A fuzzy formulation of the problem can help to better model the bicluster
and also to improve the optimization process. Now we allow membership uij ,
ai and bj to lie in the interval [0, 1]. The membership uij of a point to the
bicluster is obtained by the average of row and column membership as [39]
ai + b j
uij = . (9.23)
2
The fuzzy cardinality of the bicluster is again defined as the sum of the mem-
berships uij for all i and j from eqn. (9.22). In the gene expression framework
we can now generalize eqns. (9.2)–(9.5)
XX
G= uij d2ij (9.24)
i j
where
2
(eij + egc − eic − egj )
d2ij = (9.25)
n
P
j ij eij
u
eic = P (9.26)
j uij
P
i uij eij
egj = P (9.27)
i uij
P P
i j uij eij
egc = P P . (9.28)
i j uij
X X ai + b j X X
JB = d2ij +λ (ai ln(ai )−ai )+µ (bj ln(bj )−bj ). (9.29)
i j
2 i j
The parameters λ and µ control the size of the bicluster by penalizing the
small values of the memberships. Their values can be estimated by simple
statistics over the training set, and then hand-tuned to incorporate possible
a priori knowledge while obtaining desired results.
Setting the derivatives of JB with respect to the memberships ai and bj to
zero, we have
∂J X d2ij
= + λ ln(ai ) = 0, (9.30)
∂ai j
2
∂J X d2ij
= + µ ln(bj ) = 0. (9.31)
∂bj i
2
These lead to the solutions
!
d2ij
P
j
ai = exp − , (9.32)
2λ
!
d2ij
P
bj = exp − i . (9.33)
2µ
As in the case of standard PCM, the necessary conditions for the minimization
of JB together with the definition of d2ij [eqn. (9.25)] can be used by the
Possibilistic Biclustering (PBC) algorithm to find a numerical solution for the
optimization problem (Picard iteration).
PBC Algorithm
The two soft computing based biclustering algorithms described in Section 9.3
and 9.4.2 were implemented on the benchmark gene expression Yeast data. As
the problem suggests, the size of an extracted bicluster should be as large as
possible while satisfying a homogeneity criterion. The threshold δ was selected
as 300 for Yeast data in Refs. [6, 51, 31, 19, 14, 29]. There being no definite
guidelines available in literature for the choice of δ, and with a view to pro-
viding a fair comparison with existing methods, we have often used the same
parameter settings for δ and α; viz., δ = 300 with α = 1.2. We have also made
a detailed study on the variation of these parameters. The crossover and mu-
tation probabilities of 0.75 and 0.03 were selected after several experiments
with random seeds. However it was noticed that the crossover and mutation
parameters had insignificant effect on the results, as compared to that of δ and
α. Due to memory constraints, we restricted the population size to 50. Addi-
tionally, we investigated the effect of lower δ values in order to demonstrate
the biological relevance of the extracted smaller biclusters.
The Yeast cell cycle data∗ is a collection of 2884 genes (attributes) under 17
conditions (time points), having 34 null entries with −1 indicating the missing
values. All entries are integers lying in the range of 0 to 600. The missing values
are replaced by random number between 0 to 800, as in [6].
Table 9.1 Best biclusters for Yeast data after 50 generations with δ = 300
Table 9.1 summarizes the best biclusters for Yeast data after 50 generations,
∗ http://arep.med.harvard.edu/biclustering
0.032
0.03
0.028
0.026
0.024
0.022
0.02
0.018
1.9
1.8
1.7
1.6
260 1.5
280 1.4 Alpha
300 1.3
320 1.2
Delta 340 1.1
Bicluster Size
18000
16000
14000
12000
10000
8000
6000
1.9
1.8
1.7
1.6
260 1.5
280 1.4 Alpha
300 1.3
320 1.2
Delta 340 1.1
Figure 9.3 Plot of bicluster size for different choices of α and δ on Yeast data.
with δ = 300, for different values of α. The population size is chosen to be 50.
The largest sized bicluster is found at α = 1.8 for each δ, with coherence index
CI being minimal and indicating the goodness of the discovered partitions. The
minimum value of CI is 0.019 when δ = 300 and α = 1.8, with a corresponding
bicluster size of 14,828 being the best in the table. As explained earlier, a low
mean squared residue indicates a high coherence of the discovered biclusters.
It may also include some trivial biclusters containing insignificant fluctuations
in their expression values, and are not of interest to our study. Hence δ is used
as an upper limit on the allowable dissimilarity among genes and conditions.
However, a higher δ is indicative of diminishing homogeneity.
Figs. 9.2 and 9.3 depict the 3D plots of CI and bicluster size, against the
variations of parameters δ and α. It is observed that with increasing α and δ,
the bicluster size also increases while CI proportionately decreases.
where f is the total number of genes within a category and g is the total
number of genes within the genome [52]. The p-values are calculated for each
functional category in each cluster. Statistical significance is evaluated for
the genes in each bicluster by computing p-values, that signify how well they
match with the different GO categories. Note that a smaller p-value, closer to
zero, is indicative of a better match.
Table 9.2 shows the significant shared GO terms (or parent of GO terms) used
to describe the set of genes (12 and 18) in each small bicluster (generated by
tuning λ and µ ), for the process, function and component ontologies. Only
the three significant common terms with increasing order of p-value (i.e.,
decreasing order of significance) are displayed. For the first cluster, the genes
(TRM82, TRM112) are particularly involved in the process of tRNA and
RNA methaylation, tRNA modification; while genes (GBP2, AGE1, TOM20,
VPS21, PRS4, SSK22, NHP10, SOK1, etc.) are employed in cellular process,
intracellular transport, etc. The values within parentheses after each GO term
in columns 2–4 of the table, such as (2, 0.00024) in the first row, indicate that
out of twelve genes in the first cluster two belong to this process and their
statistical significance is provided by a p-value of 0.00024. Note that the genes
in the cluster share other GO terms also, but with a lower significance (i.e.,
have higher p-value).
From the table we notice that each extracted bicluster is distinct along each
category. For example, the most significant processes in the second cluster
are cell organization and biogenesis (genes LSM2, RRP7, NHP10, TOM20,
ECM9, EMG1, SEC65), rRNA processing (genes LSM2, RRP7, EMG1) and
† http://db.yeastgenome.org/cgi-bin/GO/goTermFinder
‡ The p-value of a statistical significance test represents the probability of obtaining values
of the test statistic that are equal to or greater in magnitude than the observed test
statistic
Table 9.2 Significant Shared GO Terms (Process, Function, Component) of the se-
lected 12, 18 genes for Yeast data
15000
10000
n
5000
0
105
100
0.36
mu 95 0.34
0.32
90 0.30
0.28 a
0.26 lambd
Table 9.3 provides a set of biclusters along with the homogeneity G of eqn.
Table 9.3 Best biclusters for Yeast data, with respect to the parameters λ and µ.
The biclusters discovered in Ref. [51] from Yeast data are of sizes (124 × 8),
(124 × 9), (19 × 8), (19 × 9), (63 × 9), (23 × 9), (20 × 8) and (20 × 9), with
the two entries within the parentheses corresponding to the numbers of genes
and conditions, respectively.
GA has also been used with local search [14], to generate overlapped biclusters.
An initial deterministic selection of biclusters, having similar size, is made for
a uniform distribution of chromosomes in the population. Thereafter GA is
used with minimization of a fitness function, defined as
( 1
f (g,c) if G(g, c) ≤ δ
F (g, c) = G(g,c)
(9.35)
δ otherwise.
The best bicluster generated from Yeast data is reported as 12,350, with an
average size of 8,600.
The simulated annealing based algorithm [44] is able to find significant biclus-
ters of size 18,460 with δ = 300, but it suffers from the “random interference”
problem. The results are also data dependent.
References
Bani K. Mallick
Texas A & M University
Debashis Ghosh
University of Michigan
Malay Ghosh
University of Florida
10.1 Introduction
303
For our problem, we have binary responses as yi = 1 indicates that the tumor
sample i is from class 1 and yi = 0 (or −1) indicates that it belongs to class
2, for i = 1, . . . , n. Gene expression data on p genes for n tumor samples
are summarized in the form of an n × p matrix; its (i, j)th entry xij is the
measurement of the expression level of the jth gene for the ith sample (i =
1, . . . , n; j = 1, . . . , p). It is assumed that the expression levels xij represent
rigorously processed data that have undergone image processing as well as
within- and between-slide normalization.
as the c(·) cancels from the expression. We will take Q(z) as the product of
independent normal pdf’s with means f (xi ) and common variance σ 2 . This
method will be referred to as the Bayesian support vector machine (BSVM)
classification.
The above procedure, analogous to that in Sollich [40], makes the Bayesian
analysis somewhat similar to the usual SVM analysis, but the prior on z seems
rather artificial, intended mainly to cancel out a normalizing constant. The
other option is to use a Bayesian approach to this problem by evaluating
the normalizing constant properly and using it in the likelihood. Then the
probability model (cf. Sollich [40]) is
(
{1 + exp(−2yi zi )}−1 for |zi | ≤ 1,
p(yi |zi ) = (10.11)
[1 + exp{−yi (zi + sgn(zi ))}]−1 otherwise,
For classification problems with binary data and logistic likelihood, conjugate
priors do not exist for the regression coefficients. Hence, without the tailored
proposal densities needed for the implementation of the Metropolis−Hastings
accept-reject algorithm, mixing in the MCMC sampler can be poor as updates
are rarely accepted. The construction of good proposals depends on both the
model and the data. Introducing latent variables zi simplifies computation
[23], as we will now show.
From the Bayes Theorem,
p(β, θ, z, σ 2 , λ|y) ∝ p(y|z, β, θ, σ 2 , λ)p(β, z, θ, λ, σ 2 ). (10.12)
This distribution is complex, and implementation of the Bayesian procedure
requires MCMC sampling techniques, and in particular, Gibbs sampling [15]
and Metropolis−Hastings algorithms [30]. The Gibbs sampler generates pos-
terior samples using conditional densities of the model parameters which we
describe below.
First, we note again that conditional on z, all other parameters are inde-
pendent of y and furthermore the distributions follow from standard results
for the Bayesian linear model. This allows us to adopt conjugate priors for
(β, σ 2 ) and hence perform simulations as well as marginalize over some of the
parameter space.
The prior distributions given in (6) and (7) of Section 2 are conjugate for β and
σ 2 , whose posterior density conditional on z, θ, λ is Normal-Inverse-Gamma,
p(β, σ 2 |z, θ, λ) = Nn+1 (β|m̃, σ 2 Ṽ)IG(σ 2 |γ˜1 , γ˜2 ), (10.13)
′ −1 ′ ′ −1
where m̃ = (K0 K0 + D) (K0 z), Ṽ = (K0 K0 + D) , γ˜1 = γ1 + n/2 and
γ˜2 = γ2 + 21 (z′ z − m̃′ Ṽm̃). Here K0 ′ = (K1 , · · · , Kn ), where we recall that
Ki = [K(xi , x1 ), . . . , K(xi , xn )]′ .
The conditional distribution for the precision parameter λi given the coeffi-
cient βi is Gamma and given by
1 1
p(λi |βi ) = Gamma m + , c + 2 βi 2 , i = 2, . . . , n + 1. (10.14)
2 2σ
We make use of the distributions given in Sections 10.4 and 10.5 through
a Gibbs sampler that iterates through the following steps: (i) update z; (ii)
update K, β, σ 2 ; (iii) update λ.
For the update to z, we propose to update each zi in turn conditional on the
rest. That is, we update zi |z−i , y, K, σ 2 , β (i = 1, . . . , n), where z−i indicates
the z vector with the ith element removed.
The conditional distribution of zi does not have an explicit form; we thus
resort to the Metropolis−Hastings procedure with a proposal density T (zi∗ |zi )
that generates moves from the current state zi to a new state zi∗ . The proposed
updates are then accepted with probabilities
p(yi |zi∗ )p(zi∗ |z−i , K)T (zi |zi∗ )
α = min 1, ; (10.15)
p(yi |zi )p(zi |z−i , K)T (zi∗ |zi )
otherwise the current state is retained.
We obtain p(yi |zi ) from (10.9) and
p(zi |z−i , K) ∝ exp{−(zi − K i β)2 /(2σ 2 )}.
It is convenient to take the proposal distribution T (zi∗ |zi ) to be a symmet-
ric distribution (say Gaussian) with mean equal to the old value zi and a
prespecified standard deviation.
An update of K is equivalent to that of θ and we need a Metropolis−Hastings
algorithm to perform it. Now we need the marginal distribution of θ condi-
tional on z. We can write
p(θ|z) ∝ p(z|θ)p(θ).
Let θ ∗ denote the proposed change to the parameter. Then we accept this
change with acceptance probability
p(z|θ∗ )
α = min 1, . (10.16)
p(z|θ)
The ratio of the marginal likelihoods is given by
γ˜
p(z | θ∗ ) |Ṽ∗ |1/2 γ̃2 1
= , (10.17)
p(z | θ) |Ṽ|1/2 γ̃2∗
For a new sample with gene expression xnew , the posterior predictive proba-
bility that its tissue type, denoted by ynew , is cancerous is
Z
p(ynew |xnew , y) = p(ynew = 1|xnew , φ, y)p(φ|y)dφ, (10.18)
where φ is the vector of all the model parameters. Assuming conditional in-
dependence of the responses, this integral reduces to
Z
p(ynew = 1|xnew , φ)p(φ|y)dφ. (10.19)
We now illustrate the methodology by means of several examples. For all ex-
amples, six models were fit: (i) logistic regression with a single penalty param-
eter; (ii) logistic regression with multiple penalty parameters; (iii) Bayesian
support vector (BSVM) classification with a single penalty parameter; (iv)
Bayesian support vector (BSVM) classification with multiple penalty param-
eters; (v) complete likelihood Bayesian support vector (CSVM) classification
with a single penalty parameter; and (vi) complete likelihood support vec-
tor (CSVM) classification with multiple penalty parameters. We have used
the SVM matlab toolbox to obtain the classical SVM (SVM*) results (see
http://eewww.eng.ohio-state.edu/∼maj/osu svm/). The tuning parameters are
chosen using an iterative solving method for the quadratic programming for-
mulation of the support vector machines known as the Sequential Minimiza-
tion Optimization (SMO). We obtained the RVM [42] matlab code from
http://research.microsoft.com/mlp/RVM/relevance.htm.
Throughout the examples, we selected γ1 and γ2 to give a tight inverse gamma
prior for σ 2 with mean 0.1. For λ we chose m and c so that the mean of the
gamma distribution is small, say 10−3 , but with a large variance; aq1 and aq2 ,
the prior parameters of θ, are chosen using the x in such a way that computa-
tion of the kernel function does not over- or underflow. We performed the data
analysis with both the Gaussian and polynomial kernels K as introduced in
Section 10.3, and the results showed very little difference. The results reported
here are based on Gaussian kernels.
In all the examples we used a burn-in of 5,000 samples, after which every 100th
sample was retained in the next 50,000 samples. The convergence and mixing
of the chain were checked using two independent chains and the methods
described in Gelman [17].
Table 10.1 Modal classification error rates and 95% credible intervals for bench-
mark datasets. Logistic: Logistic regression; BSVM: Bayesian support vector ma-
chine; CSVM: Complete likelihood Bayesian support vector machine; RVM: Rele-
vance vector machine; VRVM: Variational relevance vector machine; Jeff: Analysis
with Jeffreys prior; SVM∗ : Classical support vector machine.
1. The first two data sets are Pima Indians diabetes and Leptograpsus crabs
[35]. The third one is Wisconsin breast cancer data which contains ten basic
features to classify two types of cancers, malignant and benign. We split the
data randomly into training/testing partitions of sizes 300 and 269, and report
average results over ten partitions.
In addition to the methods listed at the beginning of Section 10.7, we have
performed analyses with variational relevance vector machines (VRVM) [6],
Bayesian neural networks [51] and the analysis using Jeffreys’ prior as de-
scribed in Figueiredo [13]. The results are given in Table 10.1. All our multiple
shrinkage models perform nearly as well as the best available alternatives.
The leukemia dataset was described in Golub et al. [19]. Bone marrow or pe-
ripheral blood samples are taken from 72 patients with either myeloid leukemia
(AML) or acute lymphoblastic leukemia (ALL). Following the experimental
setup of the original paper, the data are split into training and test sets.
The former consists of 38 samples, of which 27 are ALL and 11 are AML;
the latter consists of 34 samples, 20 ALL and 14 AML. The dataset contains
expression levels for 7129 human genes produced by Affymetrix high-density
oligonucleotide microarrays.
Table 10.2 Modal classification error rates and 95% credible intervals for Leukemia
data. Logistic: Logistic regression; BSVM: Bayesian support vector machine; CSVM:
Complete likelihood Bayesian support vector machine; RVM: Relevance vector ma-
chine; SVM∗ : Classical support vector machine.
Golub et al. [19] constructed a predictor using their weighted voting scheme
on the training samples, and classify correctly on all samples for which a pre-
diction is made, 29 of the 34, declining to predict for the other five. We have
provided our results in Table 10.2 with the modal or most frequent num-
ber of misclassification errors (the modal values) as well as the error bounds
(maximum and minimum number of misclassifications).
Table 10.2 shows that the results produced by the multiple shrinkage models
are superior to the single precision models as well as the classical SVM models.
Though all the multiple shrinkage models performed well, the best performer
among these appears to be the Bayesian support vector machine model.
The use of RKHS leads to a reduction in the dimension of the model, but the
dimension can still be as high as the sample size. In the Bayesian hierarchical
modeling framework, due to shrinkage priors, we obtain sparsity automatically
[42]. The effective number of parameters is the degrees of freedom (DF) of the
′ −1 ′
model, which can be calculated as the trace of K(K K + D−1 ) K ([20], p.
52). Due to the presence of the unknown parameter θ in the expression of K,
this θ induces a posterior distribution for DF (rather than a fixed value). The
posterior distributions of DF for all the three multiple shrinkage models were
very similar. There is a complaint against classical support vector machines
due to lack of sparsity in the classifier but Bayesian version of it can obtain
similar sparse classifier through the shrinkage priors.
Table 10.3 Modal classification error rates and 95% credible intervals for breast can-
cer data.
Hedenfalk et al. [21] studied gene expression in hereditary and sporadic breast
cancers. Studying such cancers will allow physicians to understand the differ-
ence between the cancers from mutations in the BRCA1 and the BRCA2
breast cancer genes. In the study, Hedenfalk et al. examined 22 breast tumor
samples from 21 breast cancer patients, and all the patients except one were
women and fifteen of women had hereditary breast cancer, 7 tumors with
BRCA1, 8 tumors with BRCA2. In the analysis of cDNA microarray, 3226
genes were used for each breast tumor sample. We use our methods to clas-
sify BRCA1 versus the other (BRCA2 and sporadic). As a test data set is
not available, we have used full hold-one-out cross-validation test and use the
number of misclassifications to compare different approaches. We present our
results in Table 10.3.
We have compared our cross-validation results with other popular classifica-
tion algorithms including feedforward neural networks [51], k-nearest neigh-
bors (kNN) [14], classical support vector machines (SVM) [45], perceptrons
[36] and probabilistic neural networks [41] in Table 10.2. All these methods
have used expression values of only 51 genes as used in the paper of Hedenfalk
et al. [21]. All the multiple shrinkage models have performed better than any
other methods, with SVM performing the best. The average DF for the multi-
ple shrinkage models are: logistic (10), support vector (12), complete support
vector (13).
the 2000 with the highest minimal intensity across the tissues are selected
for classification purposes and these scores are publicly available. Each score
represents a gene intensity derived in a process described in Alon et al. [2].
We randomly split the data into two parts: 42 data points are used to train
the model and other 20 data points are used as test set. We have provided the
misclassification error results of the test set in Table 4.
Again from the results our conclusions remained the same: the multiple shrink-
age models perform better than single shrinkage models and classical SVM in
terms of misclassification error. The Bayesian SVM performs slightly better
than the other two. The posterior mean DF for support vector and complete
support vector are 14.45 and 12.26, respectively, which is lower than 21.74 for
the logistic model.
The points misclassified by these methods usually lie at the classification
boundary, and are thus difficult to identify properly. An advantage of the
Bayesian approach is that one of its outputs is the quantification of uncer-
tainty of the misclassified predictions. For demonstration purposes, we plotted
the histogram of the posterior misclassification probability of a misclassified
test sample using the logistic model. We observed that the majority of the
mass of the posterior distribution is concentrated on [0.5,0.6]. This suggests
that the sample is hard to classify.
Table 10.5 Simulated data: The average number of misclassifications in the test data
of size 34.
Generation Model
Model Logistic CSVM
Logistic 2.5 3.8
BSVM 2.7 2.2
CSVM 3.2 2.1
sets of simulations to generate the responses Y , one using the logistic model
and the other using the complete support vector model. We replicate each of
the simulations 25 times, generating 25 different data sets. Then we analyze
these training data sets using logistic, BSVM and CSVM models and obtain
the average misclassifications in the test data for the three models. The aver-
age misclassifications should be lowest if we use the true model, but we want
to see how the other models perform in this situation.
When the data are actually generated from a logistic model, the average num-
ber of misclassifications in the test data by using the logistic, BSVM and
CSVM models are respectively 2.5, 2.7, 3.2. Similarly, when the data are
actually generated from a logistic CSVM model, the average number of mis-
classifications in the test data by using the logistic, BSVM and CSVM models
are respectively 3.8, 2.2, 2.1. Though none of the data is originally generated
from the BSVM model (as it has no normalized distribution), in both cases,
it is very near the correct (best) model in terms of average misclassification
error.
The results are given in Table 10.5.
Table 10.6 Analysis with Jeffreys’ prior: Average number of misclassifications and
DF (within parentheses) is reported.
Data sets
Model Leukemia Breast cancer
Logistic 2 (6.1) 3 (7.2)
BSVM 2 (5.2) 2 (5.9)
CSVM 3 (5.6) 3 (6.4)
10.9 Acknowledgments
The first author’s research was partially supported by the National Science
Foundation grant DMS-0203215, National Cancer Institute Grant CA-57030.
The second author’s research was partially supported by MUNN Idea Grant,
Prostate SPORE Seed Grant from the University of Michigan and a Grant
from the National Science Foundation and National Institute of General Medi-
cal Sciences, 1R01GM72007-01. The third author’s research was partially sup-
ported by NIH Grant R01-85414. The authors are indebted to Randy Eubank
for many constructive suggestions that led to a much improved exposition.
The authors are grateful to Emanuel Parzen and Raymond Carroll for helpful
conversations.
References
[1] Albert, J. and Chib, S. (1993) Bayesian analysis of binary and polychotomous
response data. J. Am. Statist. Ass., 88, 669−679.
[2] Alon, U., Barkai, N., Notterman, D.A., Gish, K., Ybarra, S., Mack, D., and
Levine, A.J. (1999) Broad patterns of gene expression revealed by clustering
analysis of tumor and normal colon tissues probed by oligonucleotide arrays.
Proc. Nat. Acad. Sci., 96, 6745−6750.
11.1 Introduction
The advent of high throughput technologies over the last two decades (e.g.,
DNA sequencing, gene microarrays, etc) have led to fundamental insights
into the workings of various biological processes. In addition they have pro-
vided inferences about protein interactions and regulation. However, they have
limitations compared to the direct observations of protein expression levels.
High throughput technologies that facilitate this task would enable researchers
to build more accurate and comprehensive protein pathways. However, until
recently most methods used for inferring protein expression levels, such as
Western blots, 2D gel electrophoresis and more recently antibody protein mi-
croarrays, are inherently low-throughput.
The recent development of mass spectrometry based techniques for assessing
the relative abundances of proteins in samples has provided a high-throughput
alternative to these traditional techniques. For example, isotope-coded affin-
ity tags (iCAT) relies on mass-difference labeling, but is limited to ‘duplex
experiments’ (two samples/experimental conditions), and so is the case with
stable isotope labeling of amino acids in culture (SILAC) [11, 15, 20]. In both
technologies, protein quantification is achieved by comparing the mass spec-
trum intensity of the peptides (protein fragments) derived from two samples.
On the other hand, the recent development of the isobaric tagging reagent
(iTRAQ) [27] allows one to compare up to four samples, thus expanding the
range of potentially interesting experiments. Further, a new iTRAQ reagent
that allows the simultaneous processing of up to eight samples would further
expand its range of applications.
In this paper, we present statistical methodology for analyzing quantitative
data obtained from iTRAQ experiments in order to infer differential expression
327
Figure 11.1 Quantile-quantile plot of peak areas of the two tagged samples.
corresponding to two standard errors are shown in Figure 11.2. All the ratios
are very close to their expected level of one. The different lengths of the error
bars reflect the inherent variability in the quantification of the relative protein
expression in the two samples, which is due to two factors: the number of pep-
tides associated with each protein and the number of spectra associated with
In the second experiment, much more material was loaded in order to achieve
the desired ratios between the samples. This led to obtain 673 spectra that
produced identifications. In total, 17 proteins were identified from 63 unique
peptides. However, one protein was identified from a single spectrum and was
removed from any further analysis. The protein ratios together with error bars
are shown in Figure 11.3. It can be seen that to a large extent the protein
ratios are close to their expected levels, which illustrates the potential of the
iTRAQ technology.
The so-called shotgun proteomic methods [2], coupled with isobaric tagging,
enable high throughput proteomic analysis. The iTRAQ technology has been
applied to date to a number of diverse areas. For example, a number of studies
have looked at cancer biomarkers [16, 8, 6, 14, 26]. Scaling up the technology
to deal with large clinical studies remains an issue, although the recent devel-
opment of an iTRAQ reagent comprised of 8 tags (the four original together
Figure 11.3 Protein ratios with error bars. Top panel, corresponding to the samples
in a 4:1 ratio; bottom panel, samples with a 2:1 ratio.
11.5 Acknowledgments
References
[1] Abdi, F., Quinn, J.F., Jankovic, J., McIntosh, M., Leverenz, J.B., Peskind, E.,
Nixon, R., Nutt, J., Chung, K., Zabetian, C., Samii, A., Lin, M., Hattan, S., Pan,
C., Wang, Y., Jin, J., Zhu, D., Li, G.J., Liu, Y., Waichunas, D., Montine, T.J. and
Zhang, J. (2006) Detection of biomarkers with a multiplex quantitative proteomic
platform in cerebrospinal fluid of patients with neurodegenerative disorders. J.
Alzheimers Dis., 9, 293–348.
[2] Aebersold, R. and Mann, M. (2003) Mass spectrometry based proteomics. Nature,
422, 198–207.
[3] Aggarwal, K., Choe, L.H., and Lee, K.H. (2006) Shotgun proteomics using the
iTRAQ isobaric tags. Proteomics, 5, 2297.
[4] Bantscheff, M., Eberhard, D., Abraham, Y., Bastuck, S., Boesche, M., Hobson,
S., Mathieson, T., Perrin, J., Raida, M., Rau, C., Reader, V., Sweetman, G.,
Bauer, A., Bouwmeester, T., Hopf, C., Kruse, U., Neubauer, G., Ramsden, N.,
Rick, J., Kuster, B. and Drewes, G. (2007) Quantitative chemical proteomics
12.1 Introduction
Proteomics, the large scale analysis of proteins, holds great promise to enhance
our understanding of cellular biological process in normal and disease tissue
[32]. The proteome is defined as the complete set of proteins expressed by a
cell, tissue or organism. Transcript level analysis, as typically measured by
DNA microarray technologies [35, 26], does not provide complete information
on the proteome in that the DNA transcriptional template of an organism is
static, whereas the proteome is constantly changing in response to environ-
mental signals and stress. Recent studies have been unable to establish a con-
sistent relationship between the transcriptome and proteome [3, 30]. The main
reason is that transcript profiles do not provide any information on posttrans-
lational modifications of proteins (such as phosphorylation and glycosylation)
that are crucial for protein transport, localization and function. Studies have
shown that the correlation between mRNA levels and protein abundance was
poor for low expression proteins [17]. Posttranslational modifications such as
glycosylation, phosphorylation, ubiquitination and proteolysis produce further
modifications, which lead to changes in protein abundance.
The ultimate goal of proteomics is to identify and characterize all proteins ex-
pressed in cells collected from a variety of conditions to facilitate comparisons
[30, 1]. Although transcriptome data such as those from microarray stud-
ies reflect the genome’s objectives for protein synthesis, they do not provide
information about the final results of such objectives. Proteomics analysis
provides a more accurate view of biological porcesses, thus offering a better
understanding of the physiologic and pathologic states of an organism, and
serving as an important step in the development and validation of diagnostic
and therapeutics.
339
analyzing it. In Sections 12.5 and 12.6, we close with concluding remarks and
discussions.
Figure 12.2 Example of Sequest search result (*.out file): A Sequest report resulting
from the search of an MS/MS peaklist against a sequence database. In addition to
search parameter information and some background statistics of the search (the top
portion of the report), a ranked list of matching peptides is provided. Each row in this
list is a potential identification of a peptide that explains the mass spectrum, the top
match being the peptide that the algorithm believes is the best match. Various scores
or attributes are provided for each potential “hit”: Sp, XCorr, deltCn, etc. These
attributes, or additional attributes calculated based on the information provided for
each hit, are the primary data being used in this work.
and delta Cn values at least 0.1 [41]; these thresholds are typically published
as the criteria for which correctness is defined. Other efforts have focused on
establishing statistical methods for inferring the likelihood that a given hit is a
random event. A well known example of this is the significance threshold cal-
culated by the Mascot search algorithm, which by default displays a threshold
indicating the predicted probability of an assignment being greater than 5%
likely to be a false positive based on the size of the database. Use of a reverse
database search to provide a measure of false positive rate is another method
frequently used [28, 31]. More formally, Sadygov and Yates [34] model the fre-
quency of fragment ion matches from a peptide sequence database matching
a spectrum as a hypergeometric distribution, a model also incorporated into
the openly available X!Tandem algorithm [9, 13]; while Geer et al. model this
distribution as a Poisson distribution [16].
Several of these approaches have been implemented directly in the scoring
calculation of new search algorithms [9, 16, 12]. Alternatively, external algo-
rithms may be developed that process the output of the more standard search
platforms such as Mascot or Sequest, classifying results as either correct or
incorrect with an associated probability. Examples of the latter type include
Among all the methods that have been proposed in the literature for the pep-
tide identification problem, the mixture model approach implemented in the
PeptideProphet algorithm [23] is perhaps the best known. In this method, a
discriminant score function F (x1 , x2 , . . . , xS ) = c0 +c1 x1 +· · ·+cS xS is defined
Boosting
The boosting idea, first introduced by Freund and Schapire with their Ad-
aBoost algorithm [14], is one of the most powerful learning techniques intro-
duced during the past decade. It is a procedure that combines many “weak”
classifiers to achieve a final powerful classifier. Here we give a concise descrip-
tion of boosting in the two-class classification setting. Suppose we have a set of
training samples, where xi is a vector of input variables (in this case, various
scores and features of an individual MS database search result produced from
an algorithm such as Sequest—see Figure 12.2) and yi is the output variable
coded as −1 or 1, indicating whether the sample is an incorrect or correct as-
signment of a database peptide to a spectrum. Assume we have an algorithm
that can build a classifier T (x) using weighted training samples so that, when
given a new input x, T (x) produces a prediction taking one of the two values
−1, 1. Then boosting proceeds as follows: start with equal weighted training
samples and build a classifier T1 (x); if a training sample is misclassified, i.e.,
an incorrect peptide is assigned to the spectrum, the weight of that sample
is increased (boosted). A second classifier T2 (x) is then built with the train-
ing samples, but using the new weights, no longer equal. Again, misclassified
samples have their weights boosted and the procedure is repeated M times.
Typically, one may build hundreds or thousands of classifiers this way. A final
score is then assigned to any input x, defined to be a linear (weighted) com-
bination of the classifiers, where w indicates the relative importance of each
classifier. A high score indicates that the sample is most likely a correctly
assigned protein with a low score indicating that it is most likely an incorrect
hit. By choosing a particular value of the score as a threshold, one can select
a desired specificity or a desired ratio of correct to incorrect assignments. In
this work, we use decision trees with 40 leaves for the ‘weak’ classifier, and fix
M equal to 1000.
Random Forests
Similar to boosting, the random forest [6] is also an ensemble method that
combines many decision trees. However, there are three primary differences
in how the trees are grown: 1. Instead of assigning different weights to the
training samples, the method randomly selects, with replacement, n samples
from the original training data; 2. Instead of considering all input variables
at each split of the decision tree, a small group of input variables on which
to split are randomly selected; 3. Each tree is grown to the largest extent
The attributes extracted from SEQUEST assignments are listed in Table 12.2.
Attributes include typical scores generated by the SEQUEST algorithm (pre-
liminary score (Sp), Sp rank, deltaCn, XCorr), as well as other statistics in-
cluded in a SEQUEST report (total intensity, number of matching peaks,
fragment ions ratio). Number of tryptic termini (NTT) is a useful measure
for search results obtained by specifying no proteolytic enzyme, and is used
extensively in Keller et al. [23]. Other parameters include features readily ob-
tainable from the candidate peptide sequence: C-term residue (K=‘1’, R=‘2’,
others=‘0’), number of prolines and number of arginines. A new statistic, the
Mobile Proton Factor (MPF), is calculated, which attempts to provide a sim-
ple measure of the mobility of protons in a peptide; it is a theoretical measure
of the ease of which a peptide may be fragmented in the gas phase [42, 22, 38].
Table 12.2 SEQUEST attribute descriptions. Attribute names in bold are treated as
discrete categorical variables.
Attribute Group Attribute Name SEQUEST Name Description
PeptideProphet (I)
Delta MH+ (M+H)+ Parent ion mass error between observed and
theoretical
Sp Rank Rank/Sp Initial peptide rank based on preliminary score
Delta Cn deltCn 1 - Cn: difference in normalized correlation scores
between next-best and best hits
XCorr XCorr Cross-correlation score between experimental and
theoretical spectra
Length Inferred from Peptide Length of the peptide sequence
NTT (II)
NTT Inferred from Peptide Measures whether the peptide is fully tryptic (2),
partially tryptic (1), or non-tryptic (0)
Additional (III)
Parent Charge (+1), (+2), (+3) Charge of the parent ion
Total Intensity total inten Normalized summed intensity of peaks
DB peptides within # matched peptides Number of database peptides matching the parent
mass window peak mass within the specified mass tolerance
Sp Sp Preliminary score for a peptide match
Ion Ratio Ions Fraction of theoretical peaks matched in the
preliminary score
C-term Residue Inferred from Peptide Amino acid residue at the C-term of the peptide
(1 = R, 2 = ‘K’, 0 = ‘other’)
Number of Prolines Inferred from Peptide Number of prolines in the peptide
Number of Arginines Inferred from Peptide Number of arginines in the peptide
Calculated (IV)
Proton Mobility Factor calculated A measure of the ratio of basic amino acids to free
protons for a peptide
We include MPF and the other derived parameters to demonstrate the ease of
accommodation of additional information into the classification algorithms.
12.4.3 Implementation
Each mass spectrometry database search result can be sorted based on the
resulting scoring statistics, from most confident to least confident. For Peptide-
Prophet, the samples are ordered highest to lowest on the basis of a posterior
probability as described in Keller et al. [23]. In the case of the machine learn-
ing algorithms discussed here, in addition to a correct or incorrect label, the
algorithms also return an additional “fitness” term. For random forest, the
fitness term can be interpreted as a probability of the identification being cor-
rect. A probability score can be generated from the boosting fitness measure
as well using a simple transformation. The SVM returns a classification and a
measure of the distance to a distinguishing hyperplane in attribute space that
∗ http://www.csie.ntu.tw/∼cjin/libsvm/
Panels 1B and 1C compare the performance of the boosting and random for-
est methods using different sets of input attributes, as shown in Table 12.2.
The panels contain the results of these algorithms using three combinations
of features: 1) attribute groups I and II: the six attributes used by the Pep-
tideProphet algorithm (SEQUEST XCorr, Delta Cn, SpRank, Delta Parent
Mass, Length and NTT); 2) attribute groups I, III and IV (all attributes ex-
cept NTT); and 3) attribute group I-IV (all fifteen variables shown in Table
12.2). Overall, it can be seen that both machine learning approaches provide
improvement over the scoring thresholds described in the literature. The best
performance was obtained by including all fifteen variables, indicating that
accommodation of additional information is beneficial. The random forest ap-
pears to be slightly more sensitive to the presence of the NTT variable than
boosting. Of note is the fact that effective classification is attained by the
boosting and random forest tools even in the explicit absence of the NTT
variable, as demonstrated by feature combination 2), despite the fact that the
ESI dataset was generated using the no enzyme feature of Sequest. No enzyme
Figure 12.3 Performance of boosting and random forest methods on the ESI-
SEQUEST dataset. A. The top two plots are ROC plots of classification of the test set
by PeptideProphet, SVM boosting, and random forest methods using attribute groups
I and II. The plot on the right is a blowup of the upper left region of the figure on
the left. Also displayed are points corresponding to several sets of SEQUEST scoring
statistics used as linear threshold values in published studies. The following criteria
were applied for choosing correct hits, the +1, +2, +3 numbers indicating peptide
charge: a) +1: XCorr ≥ 1.5, N T T = 2; +2, +3: XCorr ≥ 2.0, N T T = 2; b)
∆Cn > 0.1, +1: XCorr ≥ 1.9, N T T = 2; +2: XCorr ≥ 3 OR 2.2 ≤ XCorr ≤ 3.0,
N T T ≥ 1; +3: XCorr ≥ 3.75, N T T ≥ 1; c) ∆Cn ≥ 0.08, +1: XCorr ≥ 1.8; +2:
XCorr ≥ 2.5; +3: XCorr ≥ 3.5; d) ∆Cn ≥ 0.1, +1: XCorr ≥ 1.9, N T T = 2;
+2: XCorr ≥ 2.2, N T T ≥ 1; +3: XCorr ≥ 3.75, N T T ≥ 1; e) ∆Cn ≥ 0.1, Sp
Rank ≤ 50, N T T ≥ 1, +1: not included; +2: XCorr ≥ 2.0; +3: XCorr ≥ 2.5. It
can be seen that all machine learning approaches provide a significant improvement
over linear scoring thresholds. B. The middle two plots show results of the random
forest method using various sets of attributes. The black line represents the result
of the random forest using six attributes defined in Table 12.2 as groups I and II:
the SEQUEST XCorr, Sp Rank, ∆Cn, Delta Parent Mass, Length and Number of
Tryptic Termini (NTT). The lighter gray line is the result using fourteen attributes,
groups I, III, and IV (no NTT). The darker gray line represents the result using all
attribute groups I-IV, all fifteen variables. C. The bottom two plots are ROC plots
of the boosting method using attribute groups I and II (black); I, III, and IV (lighter
gray); and I-IV (darker gray).
Figure 12.4 Relative importance of data attributes used for classification by boosting
and random forest methods. The top figure shows SEQUEST attribute importance
from boosting and random forest classification using attribute groups I and II. The
middle figure shows SEQUEST attribute importance using attribute groups I, III and
IV. The bottom figure shows SEQUEST attribute importance using all attributes in
random forest and boosting methods.
In general, there are two primary classes of algorithms for addressing the
pattern recognition problem, the rule-based approach and the model-based
approach. Algorithms such as boosting and RFs are rule-based (see Vapnik
[40] for a general description). Rule-based approaches are characterized by
choosing one particular classification rule out of a set of rules that minimizes
the number of mistakes on the training data. Model-based approaches are
based on estimation of distributions for each of the classes being modeled,
and use these distributions to calculate the probability that a data point be-
longs to each class. PeptideProphet is an example of this latter type, modeling
correct identifications as a Gaussian distribution and incorrect identifications
as a Gamma distribution. If the distributions describing the different classes
in the problem accurately reflect the physical processes by which the data
are generated, the modeling approach works well even for a small amount of
training data. On the other hand, if the data diverge from the modeled dis-
tributions in a significant way, classification errors proportional to the degree
of divergence result. Rule-based approaches are a less risky option if there is
little knowledge of the distributions of classes of the data, and become increas-
ingly safe, approaching optimality, as data size increases. Keller et al. [23] and
12.6 Conclusions
12.7 Acknowledgments
We thank Dr. Philip Andrews and colleagues in National Resources for Pro-
teomics and Pathways for fruitful discussion on proteomics research and Ms.
Rhiannon Popa for editorial assistance.
References