0% found this document useful (0 votes)
383 views378 pages

(Series in Computer Science and Data Analysis) Sushmita Mitra-Introduction To Machine Learning and Bioinformatics-CRC Press (2008)

Machine Learning

Uploaded by

Gregort Kloy
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
383 views378 pages

(Series in Computer Science and Data Analysis) Sushmita Mitra-Introduction To Machine Learning and Bioinformatics-CRC Press (2008)

Machine Learning

Uploaded by

Gregort Kloy
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 378

Introduction to Machine

Learning and Bioinformatics

© 2008 by Taylor & Francis Group, LLC


Chapman & Hall/CRC
Computer Science and Data Analysis Series

The interface between the computer and statistical sciences is increasing, as


each discipline seeks to harness the power and resources of the other. This series
aims to foster the integration between the computer sciences and statistical,
numerical, and probabilistic methods by publishing a broad range of reference
works, textbooks, and handbooks.

SERIES EDITORS
David Madigan, Rutgers University
Fionn Murtagh, Royal Holloway, University of London
Padhraic Smyth, University of California, Irvine

Proposals for the series should be sent directly to one of the series editors above,
or submitted to:

Chapman & Hall/CRC


23-25 Blades Court
London SW15 2NU
UK

Published Titles
Bayesian Artificial Intelligence
Kevin B. Korb and Ann E. Nicholson
Computational Statistics Handbook with MATLAB®, Second Edition
Wendy L. Martinez and Angel R. Martinez
Pattern Recognition Algorithms for Data Mining
Sankar K. Pal and Pabitra Mitra
Exploratory Data Analysis with MATLAB®
Wendy L. Martinez and Angel R. Martinez
Clustering for Data Mining: A Data Recovery Approach
Boris Mirkin
Correspondence Analysis and Data Coding with Java and R
Fionn Murtagh
Design and Modeling for Computer Experiments
Kai-Tai Fang, Runze Li, and Agus Sudjianto
Introduction to Machine Learning and Bioinformatics
Sushmita Mitra, Sujay Datta, Theodore Perkins, and George Michailidis
R Graphics
Paul Murrell
Semisupervised Learning for Computational Linguistics
Steven Abney
Statistical Computing with R
Maria L. Rizzo
© 2008 by Taylor & Francis Group, LLC
Introduction to Machine
Learning and Bioinformatics

Sushmita Mitra
Indian Statistical Institute
Kolkata, India

Sujay Datta
Texax A&M University
College Station, TX, U.S.A.

Theodore Perkins
McGill Centre for Bioinformatics
Montreal, Quebec, Canada

George Michailidis
University of Michigan
Ann Arbor, MI, U.S.A.

© 2008 by Taylor & Francis Group, LLC


CRC Press
Taylor & Francis Group
6000 Broken Sound Parkway NW, Suite 300
Boca Raton, FL 33487-2742

© 2008 by Taylor & Francis Group, LLC


CRC Press is an imprint of Taylor & Francis Group, an Informa business

No claim to original U.S. Government works


Version Date: 20110725

International Standard Book Number-13: 978-1-4200-1178-4 (eBook - PDF)

This book contains information obtained from authentic and highly regarded sources. Reasonable efforts
have been made to publish reliable data and information, but the author and publisher cannot assume
responsibility for the validity of all materials or the consequences of their use. The authors and publishers
have attempted to trace the copyright holders of all material reproduced in this publication and apologize to
copyright holders if permission to publish in this form has not been obtained. If any copyright material has
not been acknowledged please write and let us know so we may rectify in any future reprint.

Except as permitted under U.S. Copyright Law, no part of this book may be reprinted, reproduced, transmit-
ted, or utilized in any form by any electronic, mechanical, or other means, now known or hereafter invented,
including photocopying, microfilming, and recording, or in any information storage or retrieval system,
without written permission from the publishers.

For permission to photocopy or use material electronically from this work, please access www.copyright.
com (http://www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC), 222 Rosewood
Drive, Danvers, MA 01923, 978-750-8400. CCC is a not-for-profit organization that provides licenses and
registration for a variety of users. For organizations that have been granted a photocopy license by the CCC,
a separate system of payment has been arranged.

Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used
only for identification and explanation without intent to infringe.
Visit the Taylor & Francis Web site at
http://www.taylorandfrancis.com

and the CRC Press Web site at


http://www.crcpress.com

© 2008 by Taylor & Francis Group, LLC


To my precious daughter Moni, and my beloved late Ma.
S. Mitra

To my ever-inspiring mother, beloved wife and sweet little daughter and to


all those who, even in this pragmatic world, love knowledge for the sake of
knowledge.
S. Datta

To my wife, Doina, for her constant encouragement.


T. Perkins

To the memory of my father Constantine.


G. Michailidis

© 2008 by Taylor & Francis Group, LLC


© 2008 by Taylor & Francis Group, LLC
Preface

Our motivation behind proposing this book was the desire to summarize under
one umbrella the latest developments at the interface between two areas of
tremendous contemporary interest—bioinformatics and machine learning. In
addition, we wanted to provide a thorough introduction to the basic ideas
of each individual area. At present, there is no other book offering such an
informative yet accessible overview of the ways in which these two increasingly
intertwined areas borrow strength or motivation from each other.
There are many different definitions of bioinformatics. Generally speaking, it
is an emerging field of science growing from an application of mathematics,
statistics and information science to the study and analysis of very large bio-
logical datasets with the help of powerful computers. No matter what precise
definition is being used, there seems to be a consensus that bioinformatics is
all about extracting knowledge from the deluge of information (in the form
of huge datasets) produced by modern-day high-throughput biological experi-
ments. And this is precisely the task that machine learning is meant for—it is
supposed to provide innovative tools and techniques enabling us to handle the
information overload that the scientific community is currently experiencing.
So these two areas are destined to be married. From the numerous books that
have been published in these areas in the recent past, most of which tend to fo-
cus on specific aspects of this marriage, one would get a piecemeal impression
of how these two fields have been nourishing each other. There are a couple of
notable exceptions, but even those books suffer from certain drawbacks, such
as being inaccessible to people without a technically sophisticated background
or focusing solely on classical statistical and combinatorial approaches. As a
result, it is not uncommon to find bioinformatics and/or machine learning
courses that are forced to use multiple textbooks or none at all (in which
case, the course material might be a customized collection of research papers
scattered over the internet).
Keeping this in mind, our intention was to attempt a coherent and seamless
integration of the flurry of activities and the plethora of new developments that
had taken place at the interface between these two areas in the last few years.
As more and more people choose to get involved in these fields, the demand
is growing for quality training programs and good textbooks/references. Our
book aims to satisfy this demand. We believe that it will be comprehensive and
self-explanatory enough to be used alone in a course. More and more graduate

© 2008 by Taylor & Francis Group, LLC


and advanced undergraduate courses in bioinformatics or machine learning
these days tend to spend significant amounts of time cross-training students
in the other discipline before even talking about the interface. To facilitate this
process, our book provides sufficient background material in each of the first
five chapters. It describes the main problems in bioinformatics, explains the
fundamental concepts and algorithms of machine learning and provides many
real or realistic examples to demonstrate the capabilities of the key machine
learning techniques. Also, in order to facilitate proper digestion of the subject
matter, each chapter (except chapter 2 and the special applications chapters
7-11) ends with problem sets. Once the groundwork has been done, chapters
7-11 will expose students to quite a few interesting examples where state-
of-the-art machine learning techniques are being applied to bioinformatics
problems. Although the subject matter is highly technical at times, a great
deal of care has been taken to maintain lucidity in the style of exposition
throughout the book, so that it is accessible to a wide audience—not just a
handful of advanced researchers. The abundance of examples will help in this
process.
Bioinformatics and machine learning being two of the hottest areas of contem-
porary research, there are quite a few books on them currently in the market.
They can be broadly classified into the following six categories.

(A) Books that introduce the basic concepts of bioinformatics to readers with
technical or non-technical backgrounds. Some examples are:
1. Basic Bioinformatics by Ignacimuthu, S. (2004, Alpha Science Interna-
tional, Ltd.)
2. Bioinformatics (The Instant Notes Series) by Westhead, D.R., Parish,
J.H. and Twyman, R.M. (2002, BIOS Scientific publishers)
3. Fundamental Concepts of Bioinformatics by Krane, D.E. and Raymer,
M.L. (2002, Benjamin Cummings)
(B) Books that introduce the basic concepts of machine learning to readers
with different levels of technical background. Examples are:
1. Machine Learning by Mitchell, T.M. (1997, McGraw-Hill)
2. Introduction to Machine Learning (Adaptive Computation and Machine
Learning) by Alpaydin, E. (2004, MIT Press)
3. The Elements of Statistical Learning: Data Mining, Inference and Pre-
diction by Hastie, T., Tibshirani, R. and Friedman, J. (2001, Springer)
4. Computational Learning Theory by Kearns, M. and Vazirani, U. (1994,
MIT Press)
(C) Those that focus on some special aspect of bioinformatics (e.g., mi-
croarrays or protein structures) or the application of a special model-
ing/computational technique (e.g., evolutionary computation or hidden
Markov models) in bioinformatics. Examples are:

© 2008 by Taylor & Francis Group, LLC


1. Microarray Bioinformatics by Stekel, D. (2003, Cambridge University
Press)
2. Bioinformatics: Sequence and Genome Analysis by Mount, D.W. (2001,
Cold Spring Harbor Laboratory Press)
3. Protein Bioinformatics: An Algorithmic Approach to Sequence and Struc-
ture Analysis by Eidhammer, I., Jonassen, I. and Taylor, W.R. (2004,
John Wiley and Sons)
4. Evolutionary Computation in Bioinformatics by Fogel, G.B. and Corne,
D.W. (2002, Morgan Kaufmann)
5. Statistical Methods in Bioinformatics by Ewens, W.J. and Grant, G.R.
(2001, Springer-Verlag)
6. Neural Networks and Genome Informatics by Wu, C.H. and McLarty,
J.W. (2000, Elsevier)
7. Hidden Markov Models of Bioinformatics by Koski, T. (2002, Kluwer
Academic Publishers)
(D) Those that focus on some special aspect of machine learning (such as
Bayesian neural networks or support vector machines) or introduce machine
learning as part of a bigger agendum (such as artificial intelligence). Some
examples are:
1. Artificial Intelligence: A Modern Approach by Russel, S. and Norvig, P.
(2003, Prentice-Hall)
2. Pattern Classification by Duda, R., Hart, P. and Stork, D. (2001, Wiley)
3. Neural Networks for Pattern Recognition by Bishop, C.M. (1995, Oxford
University Press)
4. An Introduction to Support Vector Machines and Other Kernel-Based
Learning Methods by Christianini, N. & Shawe-Taylor, J. (2000, Cam-
bridge University Press)
5. Bayesian Learning for Neural Networks by Neal, R.M. (1996, Springer)
(E) Edited volumes consisting of articles contributed by a number of authors
that either provide a general introduction to or deal with advanced topics
in bioinformatics or machine learning. Some examples are:
1. Machine Learning and Its Applications: Advanced Lectures edited by
Paliouras, G. et al. (2001, Springer)
2. Introduction to Bioinformatics: A Theoretical and Practical Approach
edited by Krawetz, S.A. and Womble, D.D. (Humana Press, 2003)
3. Bioinformatics: Sequence, Structure and Databanks: A Practical Ap-
proach edited by Higgins, D. and Taylor, W. (2000, Oxford University
Press)
(F) Books that focus primarily on data mining. Examples are:
1. Data Mining: Concepts and Techniques by Han, J. and Kamber, M.
(2000, Morgan Kaufmann)

© 2008 by Taylor & Francis Group, LLC


2. Data Mining: Multimedia, Soft Computing and Bioinformatics by Mitra,
S. and Acharya, T. (2003, John Wiley and Sons)
3. Machine Learning and Data Mining: Methods and Applications edited
by Michalski. R.S., Bratko, R. and Kubat, M. (1998, John Wiley and
Sons)

Each of these books has its own strengths and limitations. The ones in cat-
egory (A) deal primarily with the basics of bioinformatics and offer very lit-
tle on machine learning. Some of them (such as (A) (II) and (A) (III)) are
essentially guide-books for internet resources. Those in category (B) deal pri-
marily with machine learning, not necessarily in the context of bioinformatics.
An exception is (B) (III) (i.e., Hastie, Tibshirani and Friedman), which has
plenty of examples from bioinformatics and is an excellent textbook. However,
its level of mathematical sophistication makes it inaccessible to a large part
of our target audience. Others (such as B(I) and B(IV)) are a bit outdated
since many years have passed since their publication. Books in category (C)
are clearly narrow in their coverage, each specializing in a particular aspect
of bioinformatics that may or may not have something to do with machine
learning. A similar comment applies to the books in category (D), most of
which specialize in some particular aspect of machine learning that may or
may not be motivated by bioinformatics applications. Some in this category
(such as (D)(I)) have a wider agendum (e.g., artificial intelligence) and de-
vote several introductory chapters to machine learning in that context. But
we believe this is not the kind of introduction that a beginner will find most
helpful when he/she is trying to get into a new and challenging area. The
books in category (E) are actually edited volumes of articles, dealing with
bioinformatics or machine learning (but not both) at various levels. There
are fundamental differences between a book and an edited volume. The latter
often suffers from the cut-and-paste syndrome, that is, thematic incoherence
among the constituent articles or lack of proper organization preventing a
seamless integration of those articles. In our case, we chose not to follow this
path, especially when one of our main objectives was to make our product us-
able as a primary or supplementary textbook. Finally, the books in category
(F) are thematically centered on data mining, which is quite different from
our focus.

So it should be clear that in the long list of books above, there is hardly a single
one that succeeds in achieving exactly what our book tries to accomplish.
While many of them address some needs that students and researchers may
have, none is entirely satisfactory on its own. As a result, none of them can be
projected as a direct substitute for our book. One could use a combination of
several of them in a course (as, we believe, most instructors are forced to do
at present). But as we mentioned earlier, a primary motivation behind writing
this book was to provide instructors and researchers with a better option—-
that of using a single book to learn all about the latest developments at the

© 2008 by Taylor & Francis Group, LLC


interface of bioinformatics and machine learning. To our knowledge, right now
there is only one other book that has a comparable approach: Bioinformatics:
The Machine Learning Approach by Baldi, P. and Brunak, S. (2001, MIT
Press). However, with its abstract mathematical style, it does not enjoy the
reputation of being particularly user-friendly—especially to students with a
bioscience-related background. Also, Baldi and Brunak seem to emphasize the
Bayesian paradigm and thus downplay many other approaches to machine
learning that do not subscribe to this philosophy. In comparison, our book
has a more balanced approach, so that it is less likely to turn off readers who
are interested in the non-Bayesian avenue.
We strongly believe that our book will serve as a valuable source of up-to-date
information for the benefit of Ph.D. students and advanced Masters students
in bioinformatics, machine intelligence, applied statistics, biostatistics, com-
puter science and related areas. Any university or research institution with
a graduate-level program in any of these areas will find it useful. Advanced
undergraduate-level courses offered by reputed universities may also find it
suitable for adoption. In addition to its potential popularity as an informative
reference, the material covered in it has been carefully chosen so that it can
serve as the main textbook (or at least a supplementary textbook) in a variety
of bioinformatics and machine learning courses.
A project like this would never be successful without the unselfish and silent
contributions made by a number of distinguished colleagues who kindly ac-
cepted our invitations to contribute materials for the special applications chap-
ters 7, 8, 10 and 11. We offer them our sincerest gratitude and consider it an
honor to acknowledge all of them by name. They are Frank DiMaio, Ameet
Soni and Jude Shavlik of the University of Wisconsin (Madison), Haider Banka
of the Centre for Soft Computing Research, (India), Zhaohui S. Qin, Peter J.
Ulintz, Ji Zhu and Philip Andrews of the University of Michigan (Ann Arbor),
Bani K. Mallick of the Texas A&M University (College Station), Debashis
Ghosh of the University of Michigan (Ann Arbor) and Malay Ghosh of the
University of Florida (Gainesville).
It has been a real pleasure to work with the editorial and production staff
at Taylor & Francis—right from the initial planning stage to the comple-
tion of the project. Robert Stern was patient, cooperative and encouraging
throughout the duration of the project. Without his editorial experience and
the technical advice of Marsha Pronin, it would be a much more daunting
task for us and we truly appreciate their help. S. Datta would like to thank-
fully acknowledge the support provided by the Department of Statistics, Texas
A&M University, through a National Cancer Institute grant (# CA90301). G.
Michailidis acknowledges support from NIH grant P41-18627.
Collectively and individually, we express our indebtedness to the colleagues,
students and staff at our home institutions. Last but not least, we hereby
lovingly acknowledge the never-ending support and encouragement from our

© 2008 by Taylor & Francis Group, LLC


family members that gave us the strength to go all the way to the finish
line.
S. Mitra
S. Datta
T. J. Perkins
G. Michailidis

© 2008 by Taylor & Francis Group, LLC


Appreciation

To those colleagues who most kindly offered to contribute the material for
Chapters 8 through 12 and shared their expertise and vision at various junc-
tures of writing this book, the authors express their sincerest gratitude and
appreciation. The authors consider it a privilege on their part to mention each
contributor by name:

Philip Andrews Bani K. Mallick


Haider Banka Jude Shavlik
Frank DiMaio Ameet Soni
Debashis Ghosh Zhaohui S. Qin
Malay Ghosh Peter J. Ulintz
Ji Zhu

© 2008 by Taylor & Francis Group, LLC


© 2008 by Taylor & Francis Group, LLC
Contents

1 Introduction 1

2 The Biology of a Living Organism 5


2.1 Cells 5
2.2 DNA and Genes 8
2.3 Proteins 12
2.4 Metabolism 15
2.5 Biological Regulation Systems: When They Go Awry 17
2.6 Measurement Technologies 19

References 24

3 Probabilistic and Model-Based Learning 25


3.1 Introduction: Probabilistic Learning 25
3.2 Basics of Probability 27
3.3 Random Variables and Probability Distributions 40
3.4 Basics of Information Theory 56
3.5 Basics of Stochastic Processes 58
3.6 Hidden Markov Models 62
3.7 Frequentist Statistical Inference 66
3.8 Some Computational Issues 86
3.9 Bayesian Inference 89
3.10 Exercises 97

References 100

© 2008 by Taylor & Francis Group, LLC


4 Classification Techniques 101
4.1 Introduction and Problem Formulation 101
4.2 The Framework 103
4.3 Classification Methods 108
4.4 Applications of Classification Techniques to Bioinformatics
Problems 124
4.5 Exercises 124

References 125

5 Unsupervised Learning Techniques 129


5.1 Introduction 129
5.2 Principal Components Analysis 129
5.3 Multidimensional Scaling 136
5.4 Other Dimension Reduction Techniques 139
5.5 Cluster Analysis Techniques 141
5.6 Exercises 151

References 153

6 Computational Intelligence in Bioinformatics 155


6.1 Introduction 155
6.2 Fuzzy Sets (FS) 156
6.3 Artificial Neural Networks (ANN) 161
6.4 Evolutionary Computing (EC) 167
6.5 Rough Sets (RS) 171
6.6 Hybridization 173
6.7 Application to Bioinformatics 175
6.8 Conclusion 199
6.9 Exercises 200

References 201

© 2008 by Taylor & Francis Group, LLC


7 Connections between Machine Learning and
Bioinformatics 211
7.1 Sequence Analysis 211
7.2 Analysis of High-Throughput Gene Expression Data 218
7.3 Network Inference 223
7.4 Exercises 230

References 231

8 Machine Learning in Structural Biology: Interpreting 3D


Protein Images 237
8.1 Introduction 237
8.2 Background 237
8.3 arp/warp 247
8.4 resolve 252
8.5 textal 258
8.6 acmi 264
8.7 Conclusion 273
8.8 Acknowledgments 275

References 275

9 Soft Computing in Biclustering 277


9.1 Introduction 277
9.2 Biclustering 278
9.3 Multi-Objective Biclustering 283
9.4 Fuzzy Possibilistic Biclustering 287
9.5 Experimental Results 291
9.6 Conclusions and Discussion 297

References 298

© 2008 by Taylor & Francis Group, LLC


10 Bayesian Machine-Learning Methods for Tumor
Classification Using Gene Expression Data 303
10.1 Introduction 303
10.2 Classification Using RKHS 306
10.3 Hierarchical Classification Model 308
10.4 Likelihoods of RKHS Models 310
10.5 The Bayesian Analysis 312
10.6 Prediction and Model Choice 314
10.7 Some Examples 315
10.8 Concluding Remarks 321
10.9 Acknowledgments 322

References 322

11 Modeling and Analysis of Quantitative Proteomics Data


Obtained from iTRAQ Experiments 327
11.1 Introduction 327
11.2 Statistical Modeling of iTRAQ Data 328
11.3 Data Illustration 330
11.4 Discussion and Concluding Remarks 332
11.5 Acknowledgments 334

References 334

12 Statistical Methods for Classifying Mass Spectrometry


Database Search Results 339
12.1 Introduction 339
12.2 Background on Proteomics 341
12.3 Classification Methods 342
12.4 Data and Implementation 347
12.5 Results and Discussion 350
12.6 Conclusions 356
12.7 Acknowledgments 357

References 357

Index 361

© 2008 by Taylor & Francis Group, LLC


CHAPTER 1

Introduction

This book is meant to provide an informative yet accessible overview of the


ways in which the two increasingly intertwined areas of bioinformatics and ma-
chine learning borrow strength or motivation from each other. There are many
different definitions of bioinformatics. Generally speaking, it is an emerging
field of science growing from an application of mathematics, statistics and
information science to the study and analysis of very large biological datasets
with the help of powerful computers. No matter what precise definition is being
used, there seems to be a consensus that bioinformatics is all about extract-
ing knowledge from the deluge of information (in the form of huge datasets)
produced by modern-day high-throughput biological experiments. And this
is precisely the task that machine learning is meant for—it is supposed to
provide innovative tools and techniques enabling us to handle the information
overload that the scientific community is currently experiencing. So these two
areas were destined to be married. In this book, our goal is to shed enough
light on the key aspects of both areas for our readers to understand why this
‘couple’ is ‘made for each other.’

Among the natural sciences, biology is the one that studies highly complex
systems known as living organisms. Before the era of modern technology, it
was primarily a descriptive science that involved careful observation and de-
tailed documentation of various aspects of a living being (e.g., its appearance,
behavior, interaction with the surrounding environment, etc.). These led to a
reasonably accurate classification of all visible forms of life under the sun (the
binomial nomenclature by Carolas Linnaeus) and to a theory of how the life-
forms we see all around us came into being over billions of years (the theory of
evolution by Charles Darwin). However, the technology available in those days
was not good enough for probing the internal mechanisms that made life pos-
sible and sustained it—the complex biochemistry of metabolism, growth and
self-replication. So the biological datasets that were available for statistical
analysis in those days (including clinical and epidemiological data) were rela-
tively small and manageable, and standard classical procedures (such as two-
sample t-tests, ANOVA and linear regression) were adequate to handle them.
But starting from the middle of the twentieth century, key breakthroughs in
the biomedical sciences and rapid technological development changed every-
thing. Not only did they enable us to probe the inner sanctum of a living

© 2008 by Taylor & Francis Group, LLC


2 INTRODUCTION
organism at the molecular and genetic levels, but also brought a sea-change
in our concept of medicine. A series of new discoveries gave us unprecedented
insight into the modus operandi of living systems (the most famous one be-
ing the Franklin-Watson-Creek double helix model for DNA) and the ultimate
goal of medical scientists became personalized medicine. It is a concept dia-
metrically opposite to the way people used to view medicine earlier—a bunch
of so-called experts taking their chances with chemicals they know little about
to cure diseases they know nothing about. All these, together with the advent
of modern computers, forced statisticians and information scientists to come
out of their comfort zone and adapt to the new reality. New experiments pow-
ered by advanced technology were now generating enormous amounts of data
on various features of life and increasingly efficient computing machines were
making it possible to create and query gigantic databases. So statisticians and
information scientists were now inundated with an incredible amount of data
and demand for methods that could handle huge datasets violating some basic
assumptions of classical statistics was high. Enhanced data-storage capabil-
ity meant that there was an abundance of prior information on the unknown
parameters in many applications and the lack of nice analytical solutions mat-
tered little as our number-crunching machines churned out approximate nu-
merical solutions much more quickly. This is the perfect scenario for Bayesians
and, as a result, the Bayesian paradigm is now firmly in the driver’s seat. It
allows much more flexibility for modeling complex phenomena than the clas-
sical (or frequentist) paradigm and the inference that is drawn subsequently is
almost always based on computationally intensive methods known as Markov
chain Monte Carlo. To sum it up all, a modern-day statistician almost invari-
ably finds himself/herself navigating an ocean of information where traditional
statistical methods and their underlying assumptions often seem like flimsy
boats, and yet, the race is on for the quickest way to ‘fish out’ relevant pieces
of information. Unlike the old days, mathematical elegance and technical puri-
tanism are no longer at the centerstage—speed and efficiency are much higher
in the priority list. Perhaps the poet would say: “Data, data everywhere, not
much time to think.”
It is easy to see the similarity between this situation and the circumstances
that motivated the industrial revolution that once occurred during the course
of human civilization. The pressing need for rapid mass-production of com-
modities provided the driving force behind almost all scientific and techno-
logical innovations for a long time thereafter. Gone were the days of hand-
crafted products that boasted of an artiste’s personal touch, because they
were ‘mountains of inefficiency’ and not amenable to mechanized production
in an assembly line. Speed and volume were the buzzwords. Of course, none of
these would be possible without the machines that made mass-manufacturing
a reality. The situation today is quite similar except that it is taking place in
the realm of information. The processes of data-mining and recognizing pat-
terns in search of information, converting the information to knowledge and,
above all, repeating these tasks very rapidly a large number of times are ide-

© 2008 by Taylor & Francis Group, LLC


INTRODUCTION 3
ally suited for machines—not humans. Our learning machines are computers
that are getting smarter and faster at an astonishing rate. The phrase ‘machine
learning’ can be interpreted either as building sophisticated machines that are
capable of ‘learning’ (i.e., capable of being programmed to perform the tasks
mentioned above repeatedly with pre-specified accuracy) or as mechanizing
the process of ‘learning.’ The first interpretation leads to disciplines such as
computer engineering and artificial intelligence, but here we mostly confine
ourselves to the second interpretation. For example, two important tasks that
researchers have tried to mechanize are clustering and classification. The first
one is a form of pattern recognition that falls under the category of unsuper-
vised learning, whereas the second one belongs to the category of supervised
learning. Details can be found in Chapter 4.

Anyone who has watched a human baby grow up will agree that ‘learning’
as we know it is not exactly a mechanical process. It requires the perceptual
and cognitive capabilities that human beings (and, to a lesser extent, the great
apes) have acquired over millions of years through evolution. A computer, such
as a von Neumann machine, is far behind human beings in this respect. It can
outperform us only in tasks that involve substantial amounts of repetitive
computation, such as inverting a large matrix. But when it comes to recogniz-
ing shapes of different sizes and orientations, even in an occluded environment,
we are clearly the winner. In other words, a von Neumann machine is good
for well-structured problems, whereas the human brain is typically better in
solving ill-defined and imprecisely formulated problems of the real world. To
overcome the limitations of the traditional computing paradigm, scientists
have been searching for new computational approaches that can be used to
model—at least partially—the human thought process and the functioning of
our brains. As a result, in the recent past, several novel modes of computation
have emerged. Some of them are collectively known as soft computing. In-
formation processing in a biological system is a complex phenomenon, which
enables a living organism to survive by recognizing its surroundings, making
predictions and planning its future activities. This kind of information pro-
cessing has both a logical and an intuitive aspect. Conventional computing
systems are good for the former but way behind human capabilities in the lat-
ter. As a first step toward accomplishing human-like information processing,
a computing system should be flexible enough to support the following three
characteristics: openness, robustness and real-time processing. Openness of a
system is its ability to adapt or extend itself on its own to cope with changes
encountered in the real world. Robustness of a system means its stability and
tolerance when confronted with distorted, incomplete or imprecise informa-
tion. The real-time processing capability of a system implies that it can react
to an event within a reasonably small amount of time.

The primary concerns of traditional computing have always been precision,


rigor and certainty. We call this hard computing. In contrast, the main prin-
ciple in soft computing is that precision and certainty carry a cost, and that

© 2008 by Taylor & Francis Group, LLC


4 INTRODUCTION
the processes of reasoning and decision-making should exploit (wherever pos-
sible) the tolerance for imprecision, uncertainty, approximate reasoning and
partial truth in order to obtain low-cost solutions. After all, these are what
enable a human being to understand distorted speech, decipher sloppy hand-
writing, comprehend the nuances of natural languages, summarize text, rec-
ognize/classify images and drive safely in congested traffic. Our ability to
make rational decisions in an environment of uncertainty and imprecision has
distinguished us from other life-forms. So in soft computing, the challenge is
to devise methods of computation that lead to an acceptable solution at low
cost. A good example is the problem of parking a car. Generally, a car can be
parked rather easily because, although the boundaries of a parking spot are
marked,the final position of the car is not specified with extreme precision. If
it were specified to within, say, a fraction of a millimeter and a few seconds
of angular arc, it would take hours (if not days) of maneuvering to satisfy
those specifications. This simple example points to the important fact that
in general, high precision carries a high cost and, in many real-life situations,
high precision is unnecessary.
The major components of soft computing, at this juncture, are fuzzy sets
(FS), artificial neural networks (ANN), evolutionary computing (EC), rough
sets (RS) and various hybrids of these. Fuzzy sets primarily deal with impre-
cision and approximate reasoning. Artificial neural networks provide a kind of
machinery for learning. Searching and optimization in large datasets can be
carried out via evolutionary computing. Knowledge extraction and dimension-
ality reduction are possible using rough sets. The different hybrids of these in-
volve a synergistic integration of the individual paradigms so as to incorporate
their generic and application-specific merits for the purpose of designing in-
telligent systems. Soft computing—an emergent technology—currently shows
a lot of promise in bioinformatics mainly because of the imprecise nature of
biological data. The power of soft computing lies in its ability to (i) handle
subjectivity, imprecision and uncertainty in queries, (ii) model relevance as
a gradual (as opposed to a crisp) property, (iii) provide deduction capability
to the search engines, (iv) provide learning capability and (v) deal with the
dynamism, scale and heterogeneity of information.
With this background, we now invite the reader to begin the fascinating jour-
ney.

© 2008 by Taylor & Francis Group, LLC


CHAPTER 2

The Biology of a Living Organism

Understanding the intricate chemistry by which life survives, propagates, re-


sponds and communicates is the overarching goal of molecular biology—a field
which relies increasingly on automated technologies for performing biological
assays and computers for analyzing the results. While the complexity and di-
versity of life on earth is a source of neverending awe, at the molecular level
there are many commonalities between different forms of life. In this chapter,
we briefly review some essential concepts in cellular and molecular biology, in
order to provide the necessary background and motivation for the bioinfor-
matics problems discussed throughout the book. First, we discuss cells and
organelles. Then we consider DNA, the carrier of genes, and protein. Biochem-
ical networks are the topic of the following two sections, focussing in particular
on cell metabolism and the control of proliferation. For more details on these
topics, we refer the reader to any modern textbook on molecular and cellular
biology, such as Alberts et al. [1]. We conclude the chapter with a discussion of
some classical laboratory techniques of molecular biological as well as the new,
automated techniques that create an ever-growing need for bioinformatics and
machine learning.

2.1 Cells

The basic structural and functional unit of a living organism is a cell. Robert
Hooke, a British scientist of the 17th century, made a chance discovery of
them when he looked at a piece of cork under the type of microscope that
was available at that time. Soon it was hypothesized, and ultimately verified,
that every living organism is made of cells. In the three and a half centuries
since their discovery, thanks to increasingly powerful microscopes and other
sophisticated technologies, astonishing details are available about all aspects of
cells, including their internal structure, day-to-day function, proliferation and
death. Primitive organisms such as bacteria (e.g., Proteobacteria that include
dangerous organisms like Escherichia coli and Salmonella, Cyanobacteria that
are capable of converting the Sun’s electromagnetic energy to chemical energy
through photosynthesis or Archaebacteria that survive in extreme environ-
ments, including the deep-ocean hydrothermal vents) are single-cell organisms
known as prokaryotes. They lack an organelle, called a nucleus, that is present

© 2008 by Taylor & Francis Group, LLC


6 THE BIOLOGY OF A LIVING ORGANISM
mitochondrion
lysosome

cytoplasm

nucleus cell membrane

nucleolus
Golgi apparatus

channel
rough endoplasmic reticulum
ribosomes
smooth endoplasmic reticulum

Figure 2.1 Schematic of a Eukaryotic cell, with its various organelles.

in the cells of all higher organisms known as eukaryotes. Eukaryotes, which


include everything from a bath sponge to an elephant, may be uni-cellular or
multi-cellular. In multi-cellular organisms, the cells are organized into tissues
or groups of cells that collectively perform specific tasks, such as transport
of oxygen or absorption of nutrients. Several such tissues collectively form an
organ, such as the leaves of a plant or the lungs in our body. All the different
types of cells in a multi-cellular organism originate from the same “mother
cells” in the embryo, known as stem cells, which are capable of transforming
into various types of specialized cells through a process called differentiation.
This is why embryonic stem cells are considered so promising in the medical
sciences as a possible cure for certain debilitating and degenerative diseases.
The process of differentiation is still not well understood and bioinformatics
may play a key role in helping us understand it.

The human body consists of trillions of eukaryotic cells. There are at least
two hundred different types of cells in our body and they may be as little as
a few thousandths of a millimeter in diameter and up to a meter in length
(for neurons with long axons). Each cell has an outer membrane which en-
closes the cytoplasm and various components called organelles (see Figure
2.1). They include the nucleus, the endoplasmic reticulum, the Golgi appara-
tus, the mitochondria, the ribosomes and the lysosomes. A plant cell also has
large cavities called vacuoles and different types of plastids (chloroplasts con-
taining chlorophyll for photosynthesis, leucoplasts and chromoplasts). Each of
these organelles has some specific role to play in the life of a cell. Because
mitochondria and chloroplasts can multiply within a cell and bear structural
similarity to certain unicellular prokaryotic organisms, it is hypothesized that
long ago some prokaryotic cells started living inside others, forming a symbi-
otic or mutually beneficial relationship with their hosts. This process, called
endosymbiosis, is believed to have led ultimately to the development of eu-
karyotic cells.

© 2008 by Taylor & Francis Group, LLC


CELLS 7
Before discussing the roles of the various organelles further, we introduce the
main types of molecules present within a cell. There are four major classes
of small organic (carbon-containing) molecules in cells: sugars, lipids, amino
acids, and nucleotides. These molecules may exist on their own in the cell, but
may also be bound into macromolecules or polymers, large molecules compris-
ing specific patterns of different types of small organic molecules. For example,
simple sugars, such as glucose, act as a source of energy for the cell and as
a means for storing energy. Glucose can also be assembled into cellulose, a
polymer which plays a structural role by forming the cell walls of plant cells.
Lipids are a crucial component of cellular membranes, including the outer
cell membrane and the membranes of organelles. They are also used for the
storage of energy and act as hormones, transmitting signals between different
cells. Amino acids are the building blocks of proteins, which perform numerous
functions, and are discussed at greater length in Section 2.3. The nucleotide
adenosine triphosphate (ATP) is used to transfer energy for use in a variety
of reactions, while long chains of nucleotides form the deoxyribonucleic acids
(DNA) and ribonucleic acids (RNA) that act as the basis of heredity and cel-
lular control. DNA and RNA are discussed further in Section 2.2. In addition
to these organic molecules, there are a variety of inorganic molecules within
the cell. By mass, the majority of a cell is water. A few other important inor-
ganic compounds include oxygen and carbon monoxide (the latter is usually
considered inorganic, despite containing carbon), various ions (the medium
for transmitting electrical signals in neurons and heart cells), and phosphate
groups (crucial in intracellular signaling).
Returning to the organization of the cell, let us continue our discussion with
organelles other than the nucleus. The cell membrane is primarily made of
phospholipid, with various membrane proteins and other substances embed-
ded in it. A phospholipid molecule has a hydrophobic (water-repelling) end
and a hydrophilic (water-attracting) end. A cell membrane consists of a phos-
pholipid bi-layer, with the hydrophobic “heads” of the molecules tucked inside
and the hydrophilic “tails” forming surfaces that touch water. In addition to
serving as an enclosure for the organelles, the membrane controls the pas-
sage of substances into and out of the cell and various receptors embedded
in it play a crucial role in signal transduction. The endoplasmic reticulum
primarily serves as a transport network and storage area for various cellular
substances. It is continuous with the membrane of the nucleus. Various nu-
clear products (such as the messenger RNA produced by transcription—see
Section 2.2) are transported to places where they are needed through the en-
doplasmic network. This reticulum has smooth surfaces and rough surfaces,
the rough appearance being the result of numerous ribosomes attached to it.
The ribosomes are the cell’s protein-manufacturing plants where the macro-
molecules of proteins are synthesized component by component according to
the instructions in the messenger RNA. The proteins produced by the ribo-
somes are transported to the Golgi apparatus (named after the Italian scientist
Camillo Golgi who first noticed them) where they are further modified if nec-

© 2008 by Taylor & Francis Group, LLC


8 THE BIOLOGY OF A LIVING ORGANISM
essary and then sent off in vesicles (little bubble-like sacks) to other organelles
or to the cell membrane for secretion outside the cell. This apparatus has a
cis end that is nearer to the endoplasmic reticulum and a trans end that is
farther from it. The incoming proteins are received at the cis end and the
outgoing vesicles bud off from the trans end. The lysosomes are the cell’s
scavengers or garbage cleaners. They help in the disintegration of unwanted
or harmful substances in the cell. The mitochondria are the energy-producing
plants where the cell’s energy currency, ATP, is synthesized. A mitochondrion
has a membrane quite similar to that of a prokaryotic bacterium, and in-
side it there are protruded folds of the membrane called christae. The rest
of the space inside a mitochondrion is called its lumen where ATP synthesis
takes place. In a plant cell, a chloroplast also has an outer membrane re-
sembling that of a prokaryotic bacterium, and inside it the lumen containing
stacks of flat disc-like structures called thylakoids. This is where chlorophyll,
a magnesium-containing protein, is found. Chlorophyll plays a central role in
photosynthesis—the plant’s food production process. Chlorophyll is also the
reason why leaves are green. Chromoplasts contain other pigments such as
carotene and xanthophylls instead of chlorophyll. These are the reason behind
the bright display of yellow, orange and brown in the Fall season. The remain-
ing major organelle in a eukaryotic cell is the nucleus. It is roughly spherical
with an outer membrane that has some pores in order to let nuclear products
out into the cytoplasm or let cytoplasmic substances in. The central, denser re-
gion of a nucleus is called the nucleolus. Most important of all, it is the nucleus
that stores an organism’s blueprint of life, the DNA, which is the subject of the
next section.

2.2 DNA and Genes

DNA (Deoxyribonucleic acid) is present in all living organisms and is of cen-


tral importance to regulating cellular function and conveying hereditary in-
formation, largely by virtue of the genes it encodes. As mentioned in the
previous section, DNA is a polymer of nucleotides, conceptually arranged as
a ladder, as shown in Figure 2.2A. The functionally interesting portion of the
nucleotide is its base. There are four different bases: adenine, cytosine, guanine
and thymine, often referred to by their single letter abbreviations: A, C, G
and T. Pairs of bases, one from each strand of the DNA, bind together to form
the steps of the ladder. These base pairs are held in place by two backbones
of sugar (deoxyribose) and phosphate molecules, which form the sides of the
ladder. Complementary base pairing recognizes that each base binds with only
one other kind of base: A and T bind with each other, and G and C bind with
each other.
In reality, DNA molecules are not straight and ladder-shaped, as shown in
Figure 2.2A, but have a complex three-dimensional (3-D) structure. The two
strands of the DNA (sides of the ladder) are twisted into the well-known

© 2008 by Taylor & Francis Group, LLC


DNA AND GENES 9
(B) A G T C G A T

G
T C A G

T
T
DNA T C G A T G

(A) polymerase A G C T A C

A
A G T C

A
T T C G A T G A

C
T C A G C T A

A A G C T A C T (C)
G T T
C U C

T
T
A G C U A C A

C
A

G
G
G A G T C RNA A T G
C T C A G polymerase T A C

C
C
T

G
A

A
C A A

Figure 2.2 (A) Conceptual structure of DNA as a polymer of nucleotides. Note the
complementary base-pairing: A only binds with T, and G only binds with C. (B)
Replication of the DNA by DNA polymerase. (C) Transcription of the DNA into
RNA, by RNA polymerase.

double-helix shape, famously discovered in 1953 by James Watson and Fran-


cis Crick, aided by X-ray crystallographic studies of Rosalind Franklin. At a
larger scale, the DNA double helix is wrapped around barrel-shaped protein
molecules called histones. The DNA and histones are in turn wrapped into
coils and other structures depending on the state of the cell.

In some cells, most or all of the DNA occurs in a single molecule. In prokary-
otes, such as bacteria, most of the DNA resides in a single chromosome, a
long loop of DNA without beginning or end. Bacteria also often contain plas-
mids, much shorter loops of DNA that can be exchanged between bacteria as
a means of sharing beneficial genes. In eukaryotes, the DNA is divided into
multiple chromosomes, each a linear stretch of DNA with a definite beginning
and end. Many eukaryotes are polyploid, carrying more than one copy of each
chromosome. Humans, for example, are diploid, as most human cells carry two
copies of each chromosome—one inherited from each parent. Some plants are
tetraploid, carrying four copies of each chromosome. The total length of DNA
and the number of chromosomes into which it is divided vary by organism.
The single chromosome of the bacterium Escherichia coli has about 4.6 mil-
lion base pairs, while humans have over 3 billion base pairs of DNA divided
into 23 (pairs of) chromosomes. Fruit flies have less than 200 million base
pairs divided into 8 pairs of chromosomes, while rice has roughly 400 million
base pairs divided into 24 pairs of chromosomes.

When a cell divides to form two daughter cells, as during organism growth
or to replace old or damaged tissue, the DNA must be replicated in order to
provide each daughter cell with its own copy. Complementary base-pairing
is key to this process. During replication, a group of proteins including DNA
polymerase travels along the DNA (see Figure 2.2B). The two strands of DNA

© 2008 by Taylor & Francis Group, LLC


10 THE BIOLOGY OF A LIVING ORGANISM
are separated, and complementary base pairs are filled in along both strands,
resulting in the two needed copies.
Less than 5% of the DNA is believed to encode useful information. The other
95%, sometimes called “junk” DNA, has no apparent function. Of the 5% of
functional DNA, the majority specifies genes—regions of the DNA comprising
two parts, a regulatory region or promoter and a coding region. The regulatory
region is partly responsible for specifying the conditions under which the gene
product is produced, or the degree to which it is produced. The coding region
specifies the functional molecular product or products—often a protein, but
sometimes an RNA (ribonucleic acid). Proteins, discussed in more detail in
the next section, are sequences of amino acids. For protein-coding genes, the
coding region specifies the amino-acid sequence of the protein. However, the
protein is not constructed directly from the DNA. Instead, the DNA is tran-
scribed into an RNA intermediate, called messenger RNA (mRNA), which is
then translated into protein. For RNA-coding genes, it is the RNA itself that
serves an important function, and the RNA is not translated into protein.
RNA is composed of a single sequence, or strand, of nucleotides. These nu-
cleotides are similar to the DNA nucleotides, except that the backbone uses
the sugar ribose, and the base uracil (U) is used instead of thymine (T). Tran-
scription, the construction of an RNA chain from the DNA, is similar to DNA
replication (see Figure 2.2C). A group of proteins, collectively called RNA
polymerase(s), open up the DNA at the start of the coding region and move
along the DNA until reaching the end of the coding region. The transcript is
produced one nucleotide at a time by complementary base-pairing—an A, C,
G or T in the DNA is bonded to a U, G, C or A respectively in the RNA. The
RNA molecule does not stay bound to the DNA. As it is constructed, the RNA
nucleotide chain separates from the DNA and the two DNA strands then re-
join, leaving them in the same state as before transcription. The RNA strand
does not form into any neat geometrical shape as the DNA does. Instead, its
nucleotides bind to each other to form a complex 3-D shape unique to each
RNA sequence. For RNA-coding genes, features of this 3-D shape determine
its functional properties—causing it to bind to specific parts of certain pro-
teins, for example. For protein-coding genes, the creation of the RNA is just
the first step in producing a protein.
There are 20 naturally occurring amino acids out of which proteins are com-
posed. The RNA sequence encodes an amino acid sequence in a straightfor-
ward manner. Each triplet of nucleotides, called a codon, specifies one amino
acid. For example, the RNA nucleotide triplet AAA codes for the amino acid
lysine, while the triplet AAC codes for asparagine. There are four nucleotides,
and thus 43 = 64 distinct possible codons. However, as there are only 20 amino
acids, the codon code is redundant. For example, the amino acid leucine is
encoded by six different codons: UUA, UUG, CUA, CUC, CUG and CUU.
The entire transcript does not code for amino acids. A small amount of RNA
at the start and end of the transcript, called untranslated regions or UTRs,

© 2008 by Taylor & Francis Group, LLC


DNA AND GENES 11
are not translated into amino acids. For some genes, especially in eukaryotes,
there are untranslated gaps in the middle called introns. The portions of the
transcript that are translated are exons. In eukaryotes, splicing removes the
introns before the transcript leaves the nucleus for translation. Splicing can
result in the elimination of exons as well, a process called alternative splicing,
resulting in different splice variants of a protein. This allows a cell to produce
different versions of a protein from the same DNA. Ribosomes translate the
RNA transcript into the corresponding amino acid sequence. In prokaryotes,
free floating ribosomes can begin translation as soon as the transcript is cre-
ated, or even while it is being created. In eukaryotes, the transcripts must be
transported outside the nucleus and to a ribosome.

Transcription, splicing and translation are regulated in various ways. Charac-


teristic patterns of nucleotides in the DNA indicate where transcription should
begin and end. For example, in many bacteria, transcription begins just af-
ter a stretch of DNA with the sequence TATAAT. However, some variations
on this sequence are allowed, and conversely, not every occurrence of this se-
quence in the DNA is followed by the coding region of a gene. A different
pattern indicates the end of the coding region. In eukaryotes, there is much
more variation in these patterns. In either case, even when the DNA of an
organism is completely sequenced, there remains uncertainty about the exact
locations and number of the genes. Variations in transcription initiation pat-
terns have evolved in order to control the rate, or frequency, with which the
RNA polymerase binds to the DNA and begin transcription.

Transcription is primarily regulated, however, by transcription factors. These


proteins bind the regulatory region of the gene on the DNA, usually within
a few hundreds or thousands of base pairs of the transcription initiation site,
and influence the frequency or rate of transcription by any number of means:
blocking the binding of RNA polymerase, changing the shape of the DNA to
expose the transcription initiation site and increase RNA polymerase bind-
ing, attracting RNA polymerase to the region of transcription initiation, or
acting as a dock or blocker for other proteins which themselves have similar
effects. Because transcription factors are proteins and thus generated from
genes, conceptually some genes regulate other genes, giving rise to gene regu-
latory networks. Transcription factors bind to the DNA at transcription factor
binding sites by virtue of their 3-D shape. These are typically between 8 and
20 nucleotides long. An organism may have hundreds of different proteins that
act as transcription factors, each of which binds to different characteristic pat-
terns of nucleotides. As with the transcription initiation site, however, there
are variations in these patterns, some of which may serve the purpose of in-
fluencing the frequency or strength with which the transcription factor binds.
Because of the short length of these sites, the variability seen in the patterns,
and the virtual sea of DNA in which they can be found, it is difficult to identify
transcription factor binding sites in the DNA. Further, binding of a transcrip-

© 2008 by Taylor & Francis Group, LLC


12 THE BIOLOGY OF A LIVING ORGANISM
tion factor to a site does not guarantee any influence on transcription. Thus,
identifying functional sites is a further complication.
In eukaryotes, and for a relatively few genes in prokaryotes, splicing and alter-
native splicing follow transcription. The signals that regulate splicing reside
partly in the transcribed RNA sequence itself, though clear signals have not
been identified. RNAs from RNA-coding genes also play a role, especially in
alternative splicing. However, this depends on a complex interplay between
the 3-D structures of the regulatory RNAs, the transcript, and the splicing
machinery, and is not well understood.
Translation is not as heavily regulated as transcription, and its regulation is
better understood. A ribosome assembles the sequence of amino acids spec-
ified by the transcript in order they are encountered. Any of three codons,
UAA, UAG and UGA indicate the end of the protein and that translation
should stop. In eukaryotes, ribosomes bind to the start of the transcript and
move along it until encountering the first AUG codon, where translation be-
gins. Sometimes, the translating machinery will skip over the first or even
second occurrence of AUG and begin at the next occurrence. This skipping
is influenced by the adjacent nucleotides, and is another mechanism by which
different variants of a protein are created from the same DNA coding region.
In bacteria, the ribosomes do not bind to the start of the transcript. Instead,
there is a longer RNA sequence to which they bind (including an AUG codon),
and they can bind to that sequence anywhere it occurs in the transcript and
begin translation. As a result, it is possible for a single transcript to code
for several proteins, each separated by a region that is not translated. Such a
gene is termed an operon, and is a common means by which proteins that have
related functions are co-regulated. For example, the well known lac operon in
Escherichia coli includes three genes, one of which helps to metabolize the
sugar lactose and another of which transports lactose into the cell from the
extracellular environment. Translation of an RNA can be also regulated by
other proteins or RNAs, which can, for example, bind the RNA and block the
translation mechanism.

2.3 Proteins

Proteins are involved in virtually every process in cells, including sensing of


the cell’s environment and communication between cells. Proteins are polymer
chains built from amino acids, which have the chemical form shown in Figure
2.3A. A backbone comprising one nitrogen and two carbon atoms is bound
to various hydrogen and oxygen molecules. The central carbon is also bound
to the unit “R,” which can be a single atom or a group of atoms. The R
unit distinguishes different amino acids. In glycine, R is simply one hydrogen
atom. In methionine, R contains three carbon, seven hydrogen and one sulfur
atoms. The R subunits differ in their chemical properties, most relevantly in

© 2008 by Taylor & Francis Group, LLC


PROTEINS 13
(A) (B)
H H O H H O H O H O H O
N C C N C C N C C ... N C C
N C C H R1 H R2 H R3 H Rn OH

H R OH +H2O +H2O +H2O

Figure 2.3 (A) An amino acid. (B) Amino acids bind into polymer chains, forming
peptides and proteins. The binding of two amino acids releases a water molecule.

size, acidity, and polarity. When amino acids bind together to form polymers,
water molecules are released, and the parts of the amino acids that remain are
called residues (see Figure 2.3B). Shorter amino acid sequences are peptides,
while longer ones are proteins. Proteins are typically hundreds or thousands
of amino acids long.
As a protein is generated by translation from a transcript, it folds into a
complex 3-D shape, which depends on its amino acid sequence as well as
the chemical environment in which it folds. In describing protein structure,
four different levels are considered. The primary structure of a protein is its
amino acid sequence. Secondary and tertiary structure refer to the 3-D, folded
shape of the protein. Tertiary structure is a specification of 3-D coordinates
for every atom in the protein, in an arbitrary coordinate system, as well as
which atoms are chemically bound to each other. Tertiary structures contain
commonly-occurring patterns, such as α-helices and β-sheets (see Chapter 8
for pictures). α-helices are stretches of the protein that wind into a helical
form. A β-sheet is a set of β-strands that align lengthwise and to each other,
forming a sheet-like shape. The secondary structure of a protein assigns each
amino acid to participating in an α-helix, participating in a β-sheet, or neither.
Sometimes, other categories are included, such as bends between α-helices.
Secondary structure thus abstracts components of the tertiary structure. Many
proteins participate in complexes, groups of proteins and other molecules that
are weakly bound together. A complex may contain proteins of different types,
and conversely, one type of protein may participate in different complexes. A
specification of how proteins and other molecules organize into complexes is
quaternary structure.
Proteins play a number of important roles related to DNA and RNA that
we have already mentioned: transcription factors regulate transcription rates,
RNA polymerase creates the transcripts, DNA polymerase replicates the DNA,
histones affect the 3-D structure of the DNA and influence transcription. Pro-
teins are also responsible for repairing damage to DNA, for example caused
by radiation, and for untangling DNA.
Proteins also act as enzymes, molecules that facilitate the occurrence of chem-
ical reactions—often, very specific reactions. For example, the enzyme lactase

© 2008 by Taylor & Francis Group, LLC


14 THE BIOLOGY OF A LIVING ORGANISM
facilitates the transformation of the sugar lactose into two other sugars, glu-
cose and galactose. The DNA- and RNA-related roles of proteins mentioned
above can also be viewed as enzymatic. The specificity of the enzyme to the
reaction or reactions it catalyzes (accelerates) depends on its active sites, por-
tions of the tertiary structure of the protein that bind to particular reactants.
Enzymes are discussed at greater length in Section 2.4.

Cell membranes, such as the outer cell membrane or the nuclear membrane,
are impermeable to many types of molecules. Transmembrane proteins control
the flow of molecules across membranes and convey signals from one side to
the other. These proteins reside within the membrane and project on either
side. Channels allow the transport of molecules, often very specific molecules.
For example, ion channels in heart muscle or neurons permit the flow of ions
such as sodium, potassium, calcium or chlorine. Many of these channels can
close, stopping ion flow, or open, allowing flow, depending on triggers such
as electrical activity. The dynamical properties of these channels opening and
closing, and the resulting changes in ion flows, drive larger-scale electrophys-
iological phenomenon such as the transmission of action potentials down the
axon of a neuron and the beating of the heart. Nuclear pore proteins form
complexes that allow molecules such as transcripts and transcription factors
across the nuclear membrane. Signaling is a related task, but need not in-
volve the transport of a molecule from one side of a membrane to another.
Often, the binding of a specific molecule to the transmembrane protein causes
a structural change to the part of the protein on the other side of the mem-
brane. This structural change then typically sets off a chain of reactions which
convey the signal—about the presence of the molecule on the other side of the
membrane—to wherever that signal needs to go.

Structural proteins provide rigidity to cells and perform various mechanical


functions. The cytoskeleton, for example, is made of long, filamentous pro-
tein complexes and maintains the shape of cells and organelles by forming
a network beneath the cellular or organellar membrane. The cytoskeleton is
also involved in changes to cell shape, as in the formation of pseudopods. Mi-
crotubules, a part of the cytoskeleton, act as conduits or “roads,” directing
the movement of molecules and organelles within the cell. Structural proteins
are also involved in movement at the cellular and whole organism levels. The
flagella of bacteria such as Escherichia coli and of sperm are composed of
microtubules. The movement of myosin protein along actin filaments, part of
the cytoskeleton, generates the contractile force in animal muscle cells.

Proteins and peptides are found in many other locations and processes as
well—as antibodies in the immune system, as hemoglobin in the blood, as
hormones, as neurotransmitters and as sources of energy. In virtually every
cellular and organismal process, the involvement of proteins in some fashion
is the rule rather than the exception.

© 2008 by Taylor & Francis Group, LLC


METABOLISM 15
2.4 Metabolism

The totality of all biochemical reactions that occur in a cell is known as


metabolism. It involves all four types of fundamental biochemical molecules
mentioned in Section 2.1, and includes all the DNA-, RNA- and protein-related
processes described above, as well as many others. Most reactions in the cell
occur at low spontaneous rates and require the cooperative and coordinated
action of various enzymes to catalyze them. In this section, we introduce some
broad concepts and terminology for discussing and categorizing the systems
of chemical reactions that take place in the cell and discuss enzymes in greater
detail.

Sequences of reactions, in which the output of one reaction is the input to


the next, can be conceptually organized into metabolic pathways. A metabolic
pathway is, in some sense, like a roadmap showing the steps in the conversion
process of one biochemical compound to another or one form of energy to
another. Understanding these pathways and the relationships between them
is important for our understanding of the mechanisms behind the effects of
drugs, toxins and diseases. Metabolic pathways can be broadly categorized into
three groups: catabolic, anabolic and central. Catabolism means disassembly
of complex molecules to form simpler products and its main objectives are to
produce energy or provide raw materials to synthesize other molecules. The
energy produced is temporarily stored in high-energy phosphate molecules
(ATP) and high-energy electrons. Anabolism means synthesis of more com-
plex compounds from simpler ingredients and it usually needs the energy
derived from catabolic reactions. Central pathways, such as the citric acid or
Krebs cycle, are usually involved in interconversions of substrates (substances
on which enzymes act) and can be regarded as both catabolic and anabolic.
Catabolic pathways are convergent because through them, a great diversity
of complex molecules is converted to a relatively small number of simpler
molecules and energy-storing molecules. Anabolic pathways are divergent be-
cause through them a small number of simple molecules are used to synthesize
a variety of complex molecules. Another way of classifying metabolic pathways
is to categorize them as linear, branched, looped or cyclic. A linear pathway is
the simplest of all; it is a single sequence of reactions in which a specific initial
input is ultimately converted to a specific end-product, with no possibility of
alternative reactions or digressions in the pathway. This kind of pathway is
not found very often. A more common type is a branched pathway, in which
an intermediate compound can proceed down one branch or another, leading
to possibly different end-products. Typically at each branching point there
are several enzymes competing for the same substrate and the “winner” de-
termines which branch will be followed. A looped pathway is one that involves
many repetitions of a series of similar reactions. A cyclic pathway is one whose
end-product is the same as the initial substance it started with. An example
is the urea synthesis cycle in humans.

© 2008 by Taylor & Francis Group, LLC


16 THE BIOLOGY OF A LIVING ORGANISM
Enzymes are proteins that act as biological catalysts, accelerating the rates of
various reactions, but they themselves are not irreversibly altered during the
reactions. They are usually required in small amounts and have no effect on
the thermodynamics of the reactions they catalyze. They differ from inorganic
(i.e., non-biological) catalysts in that the latter typically speed up reactions
hundreds or thousands of times, whereas enzymes often speed up reactions a
billion or a trillion times. There are other important differences, such as the
high specificity of an enzyme for its substrate, lack of unwanted products or
harmful side-reactions that might possibly interfere with the main reaction,
and ability to function in the physiological environment of an organism’s inte-
rior. To understand how an enzyme accomplishes its task, one needs to know
the different types of forces that are at play in a chemical compound. Inside
a molecule, there are ionic or covalent bonds that hold the atoms together
and between molecules, there are weaker forces such as hydrogen bonds and
Van der Waals forces. During a chemical reaction, existing covalent bonds are
broken and new ones are formed. Breaking covalent bonds requires an energy
input in some form, such as heat, light or radiation. This is known as the ac-
tivation energy of the reaction. This energy excites the electrons participating
in a stable covalent bond and shifts them temporarily to orbitals further from
the atomic nucleus, thereby breaking the bond. These excited electrons then
might adopt a different stable configuration by interacting with electrons from
other atoms and molecules, thereby forming new covalent bonds and releas-
ing energy. This energy output may be exactly the same as, higher than or
lower than the initial activation energy. In the first case, the reaction is called
energetically neutral, in the second case it is called exothermic and in the last
case, endothermic. It is important to know that a reaction usually does not
proceed in one direction only. At least in principle, if two compounds C1 and
C2 can react with each other to form two other compounds C3 and C4, the
products C3 and C4 can also react to form C1 and C2. In practice, starting
with only C1 and C2, first the forward reaction alone will occur producing C3
and C4, but with increasing accumulation of the latter, the reverse reaction
will also start taking place, forming C1 and C2. Continuing in this manner, a
stage will be reached when the rate of the forward reaction will be identical
to that of the reverse reaction. This is known as equilibrium and at this stage,
the ratio of the total amount of C1 and C2 to the total amount of C3 and C4
will be constant for a given temperature. Any addition or removal of any of
the four compounds will temporarily disturb the equilibrium and the reaction
will then proceed to restore it. An enzyme lowers the activation energy of a
reaction and increases the rate at which the reaction comes to equilibrium,
without changing the equilibrium concentrations of the compounds. It does so
primarily in the following four ways: (a) by providing a surface on which the
molecules participating in a reaction can come together in higher concentra-
tions than in a free solution, so that they are more likely to collide and interact;
(b) by providing a microenvironment for the participating molecules that is
different from the free-solution environment (e.g., a non-aqueous environment

© 2008 by Taylor & Francis Group, LLC


BIOLOGICAL REGULATION SYSTEMS: WHEN THEY GO AWRY 17
in a watery solution); (c) by taking up electrons from or donating electrons
to covalent bonds and (d) by subtly changing the shape of the reactants in
a way that encourages the reaction to take place. The interactions between
an enzyme and its substrates depend on reactive groups in the side-chains of
amino acids that are part of the enzyme’s active sites. These reactive side-
chains may be far apart in the primary amino acid sequence of the enzyme
but come closer together when the enzyme molecule folds and assumes its 3-D
shape. This is why the 3-D structure of a protein is important for its func-
tion and is what enables the specificity of an enzyme for its substrate(s). The
interactions between an enzyme and its substrate(s) are usually non-covalent
(i.e., ionic bonds, hydrogen bonds, hydrophobic interactions, etc.), although
occasionally transient covalent bonds may be formed. Some key factors af-
fecting the activity of an enzyme are (a) temperature, (b) the pH (acidity) of
the solution, (c) concentration of the substrate(s) and (d) presence or absence
of inhibitors (e.g., a medical drug or toxic substance that interferes with the
enzyme-substrate interaction). Depending on the type of reaction they cat-
alyze, enzymes can be classified into categories such as hydrolases (involved
in the hydrolysis of covalent bonds), oxido-reductases (involved in oxidation
and reduction), transferases (involved in transferring a reactive group from
one substrate to another) and so forth.

2.5 Biological Regulation Systems: When They Go Awry

In order for a highly complex system such as a living organism to survive and
function properly, it is crucial that the variety of biochemical pathways that
sustain the organism and the countless biomolecules that participate in them
be regulated. Regulation has evolved because without it the highly coordinated
and concerted activities of various groups of biomolecules that is essential for
the viability of a living organism would be impossible. There are many dif-
ferent levels and forms of biological regulation. It can happen at the genetic
level (e.g., transcription regulation via the binding of transcription factors or
translation regulation via the degradation or inactivation of mRNAs) or at
the proteomic or metabolomic level through enzymes, hormones and other
regulatory agents. Also, there can be many different control mechanisms. For
example, control on the quantity of a metabolite can be achieved through a
supply-demand pathway (where two other metabolites serve as its “source”
and “sink” simultaneously) or through feedback inhibition (where a sufficient
concentration of the end-product of a metabolic pathway inhibits the path-
way itself). For a detailed classification of feedback inhibition into sequential
feedback, concerted nested feedback, cumulative nested feedback and so forth
(see [2]). In Section 2.2, we discussed genetic regulation. Here we shed some
light on the regulation of cell proliferation and describe the consequences of
uncontrolled growth.
Cells in almost all parts of our body are constantly proliferating, although

© 2008 by Taylor & Francis Group, LLC


18 THE BIOLOGY OF A LIVING ORGANISM
most of the time it goes unnoticed because it is a slow process and usually
does not result in any visible growth. The primary purpose of this ongoing
proliferation is to replenish the cells lost or damaged through daily wear and
tear. For example, cells in the outermost layer of our skin (epidermis) and
those in the lining (or epithelium) of our intestine are subject to frequent
wear and tear and need replenishment. Another purpose is to respond to a
trauma or injury, where cell proliferation has to accelerate in order to expedite
the healing of a wound. Importantly, as soon as the proliferating cells fill the
incision created by an injury, they stop their growth “overdrive” and return
to the normal “wear and tear” rate of proliferation. Occasionally, the cells in
a wound proliferate a little bit beyond what is needed for complete healing,
thereby creating a hypertrophied keloid (or heaped-up scar), but even this is
considered normal.
Two processes control cell proliferation. One involves substances called growth
factors and growth inhibition factors. Growth factors stimulate cells to grow
and multiply. They are produced all the time for the sake of daily replen-
ishment, but in greater amounts in the case of an injury. It is exactly the
opposite for growth inhibition factors whose production is reduced during a
trauma and goes back to the everyday level once the healing is complete. The
other process is apoptosis or programmed cell-death. It allows individual cells
within a group to die, thereby leaving the group the same size in spite of new
cells produced by proliferation. Some substances enhance apoptosis in certain
kinds of tissues.
When cells do not respond to the body’s built-in control mechanisms for pro-
liferation, they show uncontrolled growth and produce a tumor. Sometimes
they cross the normal boundaries of the tissue to which they originally be-
longed and invade surrounding tissues. Even worse, sometimes they can get
into blood vessels or lymph vessels, travel to parts of the body that are dis-
tant from their place of origin and spread the phenomenon of uncontrolled
growth to those areas. In addition, some of them may produce substances
that interfere with the normal functioning of various systems in the body,
such as the musculo-skeletal system or the nervous system. When they do all
these, we call the resulting condition cancer and the mechanism by which can-
cer spreads from one part of the body to another is called metastasis. Upon
reaching a distant region in the body, a small lump of metastatic cancer cells
break out of the blood-capillary wall, establish themselves there and continue
their uncontrolled growth to produce a new tumor. To crown it all, once the
new tumor has grown to a certain size, it persuades the body to supply more
oxygen and nutrients by growing new blood vessels to it (a process known as
angiogenesis).
There are different varieties of cancer, but as a whole it remains one of the
deadliest diseases in the world. Despite years of intense research, there is
no universal cure for cancer. Some types of cancer can be cured, or at least
temporarily remedied, depending on the stage at which they were diagnosed.

© 2008 by Taylor & Francis Group, LLC


MEASUREMENT TECHNOLOGIES 19
The traditional methods used to combat the disease include radiation therapy
(destroying cancerous cells by irradiating them), chemotherapy (destroying
them by administering a combination of chemicals into the body) and surgery,
but all these induce significant collateral damage (i.e., destruction of nearby
healthy tissue) and have side effects, not to mention the risk of a relapse
(i.e., return of the disease). Recently, more “directed” methods with a higher
precision for destroying cancer-cells and fewer side effects have been developed,
such as proton beam therapy and drug-induced angiogenesis inhibition, but
these are still not widely available.
In cancer research, the central question is why certain cells in an organism defy
the built-in regulatory mechanisms for proliferation and show uncontrolled
growth. Although scientists do not have a complete answer yet, they are closer
to it today than they were before the genomic era. Certain genes have been
identified as oncogenes and tumor suppressor genes that play a key role in
the development of cancer. In many cases, a mutation in one of those genes or
some other kind of damage to it will trigger the uncontrolled growth. There
are a variety of causes (mutagens) for such mutations, including exposure to
radiation and certain types of chemicals. Sometimes, if a cell is subjected to
oxidative stress (i.e., it is exposed to highly reactive free oxygen-radicals due
to an abundance of them in the bloodstream), it will undergo DNA damage. It
has also been observed that chronic inflammation increases the risk of cancer.

2.6 Measurement Technologies

Much of the material we have reviewed in this chapter was learned through tra-
ditional “low-throughput” laboratory techniques. However, one of the driving
forces behind bioinformatics is the advent of “high-throughput” technologies
for detecting and quantifying the abundances of various biomolecules and in-
teractions between them. In this section we describe some of the traditional
low-throughput—but sometimes more accurate—techniques of molecular bi-
ology and along with their more recent, high-throughput brethren.
Perhaps the best-known application area for bioinformatics is in the analysis
of DNA sequences. Traditional methods for sequencing DNA (i.e., determin-
ing the sequence of As, Cs, Gs and Ts comprising a gene, a chromosome or
even the entire genome of an organism) were laborious, hands-on procedures
that could only produce sequences of limited length and at comparatively high
cost. DNA sequencing was revolutionized during the 1980’s and 90’s by the
development of machines or robotic systems that could carry out the labwork
(semi)automatically, along with computers for storing and analyzing the data.
Today, the genomes of many species, including humans, have been completely
sequenced. While this trend continues, the emphasis of sequencing has broad-
ened to include the sequencing of individuals’ genomes, in order to detect
the differences—mostly single-letter changes in the sequence called single nu-

© 2008 by Taylor & Francis Group, LLC


20 THE BIOLOGY OF A LIVING ORGANISM
cleotide polymorphisms (SNPs)—that are the basis for much of the observable
differences between individuals.
Other techniques focus not on static features of an organism, but rather on
properties that may change over time or that may differ in different parts
of an organism—especially the concentrations of different RNAs or proteins.
Gel electrophoresis is a traditional method for detecting the presence of DNA,
RNA or proteins in tissue samples. In one-dimensional (1-D) electrophoresis
(often called 1-D PAGE after the polyacrylamide gels typically used), a sample
of molecules from a tissue is inserted at one end of a rectangular-shaped
plate of gel. In one variant, an electric field causes the molecules to migrate
towards the other side of the gel. DNA and RNA molecules are naturally
negatively charged, and so are accelerated by the field. Proteins are usually
bound with substances that make them negatively charged. While the field
accelerates the molecules, friction decelerates them. Friction is greater for
larger molecules, and so the molecules separate by size, with the smallest
molecules traveling farthest through the gel. The separated molecules can
be visualized by staining, fluorescence or radiation, and show up as bands
at different lengths along the gel. If the gel is calibrated with molecules of
known sizes, and if the sample contains relatively few kinds of molecules, the
presence or absence of bands can be interpreted as the presence or absence of
particular molecules. This can be used to detect if a particular gene is being
transcribed, for example, by looking for RNAs of the appropriate size, or if
the gene’s protein is present in the sample. Often, several samples are run side
by side in a single gel, to compare the molecules present in each one. If the
molecules cannot be identified, due to lack of calibration or other reasons, they
can be extracted from the gel again to be identified. Another version of gel
electrophoresis for proteins involves a gel with a pH gradient and an electric
field. In this case, the proteins move to a position in the gel corresponding to
their isoelectric point, where the pH balances the protein’s charge.
In 2-D gel electrophoresis (2-D PAGE), usually used with proteins, the sam-
ple is inserted at one corner of the gel and sorted in one direction first (often
by isoelectric point) and then the electric field is shifted 90 degrees and the
proteins are additionally separated by size. After staining, the result is a gel
with spots corresponding to proteins of different isoelectric point and size. By
comparing gels, one can look for proteins that are present under one condition
and absent in another. On the 2-D gels, it is possible to separate hundreds or
even thousands of different kinds of proteins, and so 2-D gel electrophoresis is
considered a high-throughput measurement technology. 1-D or 2-D gel elec-
trophoresis techniques are usually used to determine the presence or absence
of a kind of molecule, rather than to quantify how much is present, although
the darkness or spread of a band or spot can sometimes be interpreted as
reflecting quantity.
The Southern blot, the Northern blot and the Western blot are extensions of
gel electrophoresis that are used to determine the identity of DNA, RNA or

© 2008 by Taylor & Francis Group, LLC


MEASUREMENT TECHNOLOGIES 21
protein molecules in the gel respectively. After running the gel, the molecules
are transferred onto and bound to a film. A solution of labeled probes is washed
over the film. For example, if one were interested in testing for the presence of
single-stranded DNA for a particular gene, the probes could be DNA strands
with basis that are complementary to (that is, binding partners for) some
portion of that gene’s DNA and not complementary to any portion of the
DNA of any other gene. When washed over the film, these probes would bind
only to the DNA from the gene of interest. Complementary DNA probes are
also used to detect specific RNAs. Antibodies are used as probes to detect
specific proteins. After the probes bind to their target molecules, the solution
is washed off to remove unbound probes. The locations of the probes are
determined based on their fluorescent or radioactive labels, which are easily
imaged.
Gene expression microarrays, which have revolutionized the monitoring of
gene expression, are an adaptation of the blotting idea to a massively parallel
scale. Most microarrays measure RNA levels. Microarrays are small glass or
silicon slides with many thousands of spots on them. In each spot are probes
for different genes, so that a single slide can contain probes for virtually every
gene in an organism. There are two main types of microarrays, one-channel
arrays (also called one-color or oligonucleotide arrays) and two-channel ar-
rays (also called two-color or cDNA arrays). In the one-channel arrays, RNAs
are extracted from a tissue sample, bound with biotin, and then washed over
the array, where they bind to the probes—ideally, only to probes correspond-
ing to the same gene. Fluorescent molecules are applied, which bind to the
biotin on the RNAs. The fluorescent molecules are then excited by a laser and
imaged. The more fluorescence coming from a spot, the greater the number
of RNAs bound to it, and therefore the greater the expression of the corre-
sponding gene. For two-channel arrays, RNA is extracted from two different
samples. The RNA from each sample is converted by reverse transcription into
single-stranded complementary DNAs (cDNAs), and labeled with fluorescent
molecules. Each sample is labeled with molecules that fluoresce at different
wavelengths. The labeled cDNAs from the two samples are then mixed and
washed over the microarray, where they bind to probes. The relative fluores-
cence in each wavelength of each spot indicates the relative expression of the
corresponding gene in the two samples.
Another massively parallel means of measuring gene expression is Serial Anal-
ysis of Gene Expression (SAGE). In this technique, RNAs are extracted from
a sample, and a small stretch from one end of each RNA is converted into
cDNA. These cDNAs are then bound together in long chains and sequenced
by a DNA sequencing machine. These sequences can then be examined to
identify and count the source cDNAs, effectively counting the number of RNA
molecules that were so converted.
While microarrays and SAGE are revolutionary in their ability to quantita-
tively measure the expression of thousands of genes simultaneously, they are

© 2008 by Taylor & Francis Group, LLC


22 THE BIOLOGY OF A LIVING ORGANISM
not without their drawbacks. The measurements are notorious for being noisy,
with significant variability in the data due to inevitable variations in the com-
plex measurement procedure as well as differences in experimental conditions,
equipment used and technicians carrying out the experiment. Furthermore,
microarray experiments are expensive. While the expression of thousands of
genes may be measured in each sample, most studies include only a handful
of samples, usually no more than a few tens, or as much as a few 100s for
extremely well-funded studies. The machine learning and statistical issues en-
gendered by such data are significant, and have been a major area of study
ever since the technologies were developed.

Labeled probes are also used in living or recently-living tissue. In in situ hy-
bridization, labeled probes for DNA or RNA sequences are inserted into cells
and imaged. This reveals the spatial distribution of the target within the cell
or tissue and, if observations are taken over a period of time, the temporal dis-
tribution as well. Immunohistochemistry, or immunostaining, follows the same
idea, but the probes are antibodies and the target molecules are proteins. As
some proteins are markers for—that is, indicative of—specific organelles in a
cell or tissues types in a body, immunostaining is often used to localize such
structures. While one probe can reveal the spatial/temporal distribution of a
single type of molecule, two different probes with different labels are used to
study the differences or similarities in the distributions of different molecules.
This is often used, for example, to determine whether two different proteins
collocate, which could indicate a functional protein-protein interaction, or un-
der which conditions they collocate. It is technically difficult to introduce and
image more than a few different kinds of probes, however, so these techniques
are strongly limited in the number of different types of molecules that can be
studied simultaneously.

A common method for detecting and quantifying proteins in a sample is mass


spectrometry. Mass spectrometers separate and quantitate ions with different
mass-to-charge ratios. The principle is similar to that of gel electrophoresis.
Electric or magnetic fields accelerate the ions differentially, until they reach
a detector. Typically, proteins are enzymatically digested into much smaller
fragments, peptides, which are then fed into the mass spectrometer. The re-
sult is a measured distribution of ions of different mass-to-charge ratios. In
some cases, this peptide mass fingerprint is sufficient to identify which pro-
tein or proteins are present in the sample. However, identification is not always
possible. In tandem mass spectrometry, ions traveling through a first mass an-
alyzer, which separates according to mass-to-charge ratio, can be selectively
sent through one or more additional mass analyzers. This allows the succes-
sive selection and measurement of specific ranges of peptides, allowing for
more definite identification. The most recent techniques allow the enzymatic
digestion step to be skipped, instead introducing entire proteins to the first
stage of a tandem mass spectrometer. However, ionizing the proteins without

© 2008 by Taylor & Francis Group, LLC


MEASUREMENT TECHNOLOGIES 23
breaking them down is a much more delicate process than it is for the peptide
fragments, and requires more sophisticated and expensive equipment.
As mentioned in Section 2.3, many proteins act together in complexes. A
traditional technique for determining the complexes in which a given protein
participates, and under which conditions, is co-immunoprecipitation. Immuno-
precipitation extracts a specific protein from a solution by binding it with an
antibody specific to that protein. The antibodies are in turn bound to insoluble
proteins or other constructs, such as agarose beads, which are easily separated
from the solution. If the target protein is in a complex with other proteins,
then they will also be extracted and can be identified by mass spectrometry.
Another method for determining protein-protein interactions is the yeast two-
hybrid screen. This procedure relies on an important feature of eukaryotic
transcriptional regulation: While many transcription factors contain two do-
mains, a DNA binding domain and an activation domain that stimulates tran-
scription, these two domains need not be in a specific position or orientation
with respect to each other. A yeast two-hybrid screen for the interaction of
two proteins, A and B, works by inserting three new genes in a yeast cell. One
gene, which we call A′ , codes for the protein A fused with a transcription fac-
tor binding domain. Another gene, which we call B′ , codes for the protein B
fused with an activation domain. The third gene, C, is a reporter gene, which
has two important features: its regulatory region contains a binding site for
the A′ protein, and its expression is easily measured (perhaps because the C
protein is fluorescent). If proteins A and B interact and form a complex, then
the hope is that A′ and B′ will also interact and form a complex. Further, the
A′ portion of that complex will bind to C’s promoter and the B′ activation
domain will stimulate expression of C. The expression or non-expression of C
is then an indicator of whether A and B do or do not interact.
A variant of immunoprecipitation, chromatin immunoprecipitation, is used to
study where transcription factors bind to the DNA. In a given tissue sample,
depending on the conditions of the experiment, certain transcription factors
will be expressed and will be bound to the DNA at various locations. The
transcription factors are first cross-linked (bound) to proteins comprising the
DNA’s chromatin. The cells are then broken open and the DNA broken into
fragments by sonication, bombardment by sound waves. A chosen transcrip-
tion factor can then be immunoprecipitated, bringing with it the chromatin
to which it is bound and the DNA. Then the DNA is separated from the chro-
matin and the transcription factor, and can be identified. Ideally, this DNA
represents only stretches that were bound by the transcription factor, and no
others. These DNA segments can be identified by traditional low-throughput
means, some of which were discussed in the previous section. Alternatively,
they can be identified in a high-throughput way using a special DNA microar-
ray with probes designed to cover the whole genome of the organism. This
is called ChIP-on-chip or ChIP-chip, the first “ChIP” referring to the chro-
matin immunoprecipitation procedure and the second “chip” referring to the

© 2008 by Taylor & Francis Group, LLC


24 THE BIOLOGY OF A LIVING ORGANISM
microarray. Repeating the procedure for every known transcription factor in
the organism yields an estimate of the entire set of transcription factor bind-
ing sites on the DNA. However, many sites can be missed, as the transcription
factor may not be expressed or may not bind under the conditions of the ex-
periment. Furthermore, transcription factors may bind to many locations on
the DNA without affecting transcription, and such non-functional sites are
not of interest.
These biotechnologies and techniques, and especially methods such as genome
sequencers, 2-D PAGE, gene expression microarrays, SAGE, mass spectrom-
etry, yeast 2-hybrid screens and ChIP-chip, are generating a virtual flood of
data, motivating and indeed necessitating the use of machine learning and
statistical techniques to extract useful information.

References

[1] B. Alberts, A. Johnson, J. Lewis, M. Raff, K. Roberts, and P. Walter. Molecular


Biology of the Cell, Fourth Edition. Garland, 2002.
[2] D. Fell. Understanding the Control of Metabolism. Portland Press, 1997.

© 2008 by Taylor & Francis Group, LLC


CHAPTER 3

Probabilistic and Model-Based


Learning

3.1 Introduction: Probabilistic Learning

We begin this chapter by addressing the question: “Why are probabilistic and
model-based learning relevant in the context of biological systems?” This is
a pertinent question because, after all, probability theory deals with uncer-
tainty and probabilistic models are a way of quantifying uncertainty. When
one thinks about the kind of objects that constitute biological data (e.g., nu-
cleotide sequences in the DNA, amino acid sequences in peptides, the molec-
ular components of carbohydrates and lipids, the metabolites participating
in a certain metabolic pathway, etc.), there is a lot of predictability about
them in the sense that one will always find the same nucleotide sequence at a
specific position on a specific chromosome of a specific organism (except for
rarely occurring events called mutations) or the same amino acid sequence
in a specific protein molecule. So, where does the uncertainty come from? In
fact, it primarily results from the inadequacy of our present state of knowl-
edge compared to what remains to be discovered in the future. Many aspects
of a biological system are still partially known and currently known ‘facts’
often turn out to be wrong in the light of newly discovered knowledge. Also,
there is a constant need for extrapolating what we know about a smaller or
simpler organism to a larger and more complex one that is still unexplored. In
other words, researchers in bioinformatics are constantly faced with the need
to use inductive reasoning and to draw inferences. There are three different
concepts of knowledge in this world. The philosopher’s view is that all knowl-
edge is correct and the distinction between right and wrong depends only on
the observer’s viewpoint. The scientist’s view is that all knowledge is wrong
unless it can be experimentally verified by independent observers. To put it
in another way, a scientist such as a physicist or a chemist uses deduction to
add to existing knowledge (i.e., if A implies B and B can be experimentally
shown to be false, then A must be false). On the other hand, the probabilist’s
or statistician’s view of knowledge is based on the principle of induction. It
goes like this: if A implies B and B is observed to happen, A is more likely
to be true. Probability and statistics enable us to quantify, for example, how
much more likely A becomes if B is observed k times (k=1,2,3,. . .). Often, a

25

© 2008 by Taylor & Francis Group, LLC


26 PROBABILISTIC AND MODEL-BASED LEARNING
classical statistician’s approach is to start with a set of competing hypothesis
about an unknown quantity or object, choose a probability model describing
the relation between the unknown and the observable (i.e., data) and finally,
reach a decision regarding the hypotheses based on the evidence from the data,
along with an assessment of the uncertainty involved in that decision. This is
called hypothesis testing. At other times, he/she would try to find out the most
likely value(s) of the unknown by maximizing the joint probability model for
the data-vector (called the likelihood function) with respect to the unknown.
This is known as maximum likelihood estimation. These two are the central
theme of frequentist inference —there are many variations to these themes.
There is, however, another parallel approach called the Bayesian approach.
A Bayesian would start with some a priori assumptions about the unknown,
usually in the form of a probability distribution (called a prior distribution)
that can be based completely on his/her personal belief or on already exist-
ing information or on some kind of ‘expert opinion.’ The Bayesian would then
combine this prior distribution with a probability model relating the unknown
and the observed data (i.e., the likelihood function) to get a joint distribution
and from it, using the Bayes principle, ultimately derive the conditional dis-
tribution of the unknown given the observed data (the posterior distribution).
To a Bayesian, therefore, acquiring new knowledge basically means updating
the prior information about the unknown in the light of the observed data.
Associated with each of these approaches are some important issues that are
crucial from the viewpoint of implementation and error assessment. For ex-
ample, while estimating an unknown parameter, a probabilistic way of quan-
tifying the error in the estimate is to look at its mean squared error (MSE),
which is nothing but the average (or expected) squared distance between the
unknown parameter and the estimate. Now, it can be easily shown that this
MSE is the sum of the estimate’s variance and squared bias. Some of these
terms will be elaborated on later, but roughly speaking, the bias of an estima-
tor (an estimator being a computational formula used to compute an estimate)
is a measure of how far its probabilistic average value is from the unknown
parameter it is meant to estimate. Similarly, the variance of an estimator is
its average (or expected) squared distance from its own probabilistic average
value. But it often turns out that maximum-likelihood estimates have nonzero
bias and there is no easy way to compute either the bias or the variance. In
such a situation, a technique called bootstrap is often used to estimate those
two things. The underlying principle of bootstrap is that, if one repeatedly
takes random samples from the observed data and computes the value of an
estimator from those, the variation in these computed values will be a rea-
sonably good indicator of the estimator’s variance under certain conditions.
Similarly, the difference between the simple average of these computed values
and the original value of the estimator based on the original set of observed
data will be a reasonably good indicator of the estimator’s bias. Example 3.4
illustrates this bootstrap idea. As far as maximum likelihood estimation is con-
cerned, recall that it involves maximizing the likelihood function with respect

© 2008 by Taylor & Francis Group, LLC


BASICS OF PROBABILITY 27
to the unknown parameter. Often this maximization turns out to be analyti-
cally intractable or becomes difficult because of missing data and some kind of
an iterative numerical solution seems to be the only way out. The expectation-
maximization or EM algorithm is one such method and is described in a later
section. Regarding the Bayesian approach, it is so heavily dependent on nu-
merical computation in order to be useful that the phrases ‘Bayesian statistics’
and ‘Bayesian computation’ have almost become synonymous. Since the final
output of the Bayesian approach is the conditional distribution of the un-
known given the observed data (i.e., the posterior distribution), one needs to
be able to draw sample observations from this distribution in order to answer
more specific questions. Often the posterior distribution is so ‘ugly’ or ‘un-
manageable’ due to the high dimensionality of the unknown parameter-vector
and/or the analytical intractability of the steps involved in its derivation,
the standard methods for drawing random deviates from probability distri-
butions are of little use. So, in such cases, a Bayesian resorts to a Markov
Chain Monte Carlo (MCMC) sampling technique, the idea behind which is
basically the following. Starting from an initial set of ‘guessed’ values for the
unknown parameters, one starts a Markov chain (see definition in Section 5)
whose states are the updated value-vectors of the parameter-vector and which
moves from state to state via some specific mechanism designed to ensure the
chain’s eventual convergence to the targeted posterior distribution. In other
words, the state-to-state propagation mechanism is so chosen that the chain
becomes ergodic (see definition in Section 5) with its stationary distribution
being the targeted posterior distribution. Some widely used iterative propa-
gation mechanisms are Gibbs sampling and Metropolis-Hastings algorithm.
Once the Markov chain is set in motion and left alone to run for while (called
the burn-in period) so that it gets ‘close enough’ to its stationary distribution,
the next several states that the chain visits are used as sample observations
from the desired posterior distribution.
The rest of the chapter is organized as follows. Section 2 provides the ba-
sic concepts of probability theory that are subsequently needed, including the
Bayes theorem. Section 3 introduces discrete and continuous random variables
and their probability distributions. Section 4 deals with the basics of infor-
mation theory. Section 5 summarizes some important definitions and results
from stochastic processes. Section 6 is a snapshot of an important class of
models called hidden Markov models. Section 7 elaborates on frequentist sta-
tistical inference. Section 8 draws attention to some associated computational
aspects. Finally, Section 9 talks about Bayesian statistical inference and the
associated computational issues.

3.2 Basics of Probability

We live in a world full of uncertainty. We are not sure how the weather will be a
week from now, we cannot predict with certainty whether our favorite football

© 2008 by Taylor & Francis Group, LLC


28 PROBABILISTIC AND MODEL-BASED LEARNING
team will win its next game and we are equally unsure about how the stock
market will behave tomorrow! Since avoiding uncertainty is not an option and
surrendering to it helplessly is a bad option, we should try to gain as much
control over it as possible. The first step towards controlling uncertainty is
quantifying it, that is, measuring it numerically. In order to do that, we must
look for any kind of pattern or regularity that uncertainty may exhibit. And
fortunately, it often does exhibit discernible patterns in real life. For example,
if it is cloudy and raining right now at a certain latitude and longitude, exactly
predicting the weather condition at that spot 24 hours from now may not be
possible, but we can at least browse through the extensive weather records
for the past hundred years and find out how the weather has changed (or not
changed) in a 24-hour period at that particular location on rainy days during
the same season. If we see a distinct pattern in the history, it will enable us
to conclude what kind of weather condition is more likely for tomorrow and
what kind is less likely or moderately likely. If we can translate the pattern
that we discovered into a mathematical model, we can be even more precise
in our prediction. For example, we might be able to make statements such as
“Bright, sunny and warm weather is only 30% likely 24 hours from now” or
“A cloudy, windy and chilly condition is 75% likely.” As soon as we do that,
we are entering the realm of probability.
Probability theory, therefore, is a mathematically consistent and coherent way
of putting a numerical value to uncertainty. To understand it, we must learn
to speak the language first. In the context of probability theory, the word ‘ex-
periment’ will mean any kind of activity that produces results or outcomes.
For example, throwing a ball and tossing a coin are experiments; so is eating
dinner or listening to a lecture. There are basically two types of experiments:
those with a perfectly predictable outcome and those with many possible out-
comes so that one is never sure which one is going to occur. Experiments of
the first kind are called deterministic and those of the second kind are random
or stochastic. An illustration of a deterministic experiment is to mix together
an acid and a base (or alkali), because they will invariably produce a specific
salt along with some water. Another example would be to heat a bowl of water
to 100 degrees Celsius (or 212 degrees Fahrenheit) under normal atmospheric
pressure, at which point it will surely start boiling. However, things are not so
predictable when you flip a fair coin. It can either land heads up or tails up.
So this is a random experiment. So is throwing a dart onto a dartboard with
your eyes closed or rolling a cubic die—it is difficult to predict exactly where
the dart will land or exactly what number will turn up on the die. Sometimes
whether an experiment should be classified as deterministic or random de-
pends on the extent of details we are willing to allow in the description of it.
For example, think of holding a glass bottle several feet above the ground in
your hand and then releasing it. If this is how we describe the experiment, it is
deterministic since the bottle will invariably fall towards the ground and the
law of gravity will exactly tell you its acceleration and velocity the moment
it hits the floor (depending on its release-height, of course). However, if we

© 2008 by Taylor & Francis Group, LLC


BASICS OF PROBABILITY 29
describe the experiment as releasing a glass bottle from several feet above the
ground and watching what happens to it as it hits the concrete floor, it be-
comes a random experiment. Because no matter how much physics you know,
it will be impossible to predict with certainty whether the bottle will remain
intact after hitting the ground or break into k pieces (k=2, 3, 4,. . .)

So it should be clear that probability theory deals primarily with a random


experiment because there is some uncertainty associated with its outcomes.
The first step towards quantifying this uncertainty is a complete enumeration
of all the outcomes. Such a complete list of all possible outcomes of a random
experiment is known as its sample space. Depending on the experiment, the
sample space can be finite or countably infinite. For example, when a coin
is flipped, the sample space is S = {Heads up, Tails up} or simply S =
{H, T }. When a regular cubic die is rolled, S = {1, 2, 3, 4, 5, 6}. However, if
our experiment is counting how many flips of a coin was needed to see the
first ‘H,’ then S consists of all positive integers and is infinite. Once again, the
sample space of a random experiment is determined solely by the description
of the experiment. For example, the simple experiment of drawing a card
from a (well-shuffled) deck of 52 cards with our eyes closed can have different
sample spaces depending on the extent of details we allow. If we draw a card,
blindfolded, from a deck of 52 cards and just watch its color, the sample space
is simply {red, black}. However, if we do the same experiment and watch only
the suit it is coming from, S will be {diamonds, spades, hearts, clubs}. Finally,
in the context of the same experiment, if we are interested in all the features
of a card (its color, suit as well as the number or picture on it), then S will
be a list of 52 distinct cards.

Having written down the sample space of a random experiment, we now must
link it to the concept of an event. Any subcollection of outcomes listed in
the sample space is called an event. In real life, we are more often interested
in such collections of outcomes than in individual outcomes. In the language
of set theory (the branch of mathematics that deals with the relationships
among, and the properties of, various subcollections of a bigger collection),
the sample space is the universal set and the events are its subsets. So, fol-
lowing set-theoretic notations, events are usually denoted by A, B, C, etc. For
example, in the context of rolling a cubic die (what was the sample space for
it?), A could be the event that an odd number turned up. In other words,
A = {1, 3, 5}. Similarly, B could be the event that a number ≤ 2 turned up,
i.e., B = {1, 2}. In the context of drawing a card from a deck of 52 cards, A
could be the event that the card drawn is an ace, B could be the event that it is
black, C could be the event of it being a face-card and D, the event of it being a
diamond. These are examples of simple events. Given two such simple events,
one can construct
S all sorts of compound
T events using the set-theoretic opera-
tions union ( ), intersection ( ) and complementation. Given two events (or
sets) A and B, their union is defined as the bigger collection containing all the
outcomes in A as well as those in B. So, using the notation “∈” to denote that

© 2008 by Taylor & Francis Group, LLC


30 PROBABILISTIC AND MODEL-BASED LEARNING
S
an outcome x belongs to an event A, the event A B = {x : x ∈ A or x ∈ B}.
Notice that this “or” is not an exclusive or, i.e., it includes the
T possibility that
an outcome x may belong to both A and B. The event A B is defined as
the subcollection containing only those outcomes that are common to both
A and B. In other words, it is {x : x ∈ A and x ∈ B}. For an event A, its
complement (Ac or Ā) is the collection of all outcomes in the sample space
that do not belong to A, i.e., Ac = {x : x ∈ / A}. Applying the set-theoretic
events such as A B c = {x :
T
operations on these, one can create compound
c
T
x ∈ A and x ∈ / B} (also called A − S B), A B = {x : x ∈ / A and x ∈ B} (also
called B − A), A∆B = (A − B) (B − A) (also called the symmetric differ-
ence), and so on. Let us point out, for future reference, that the operations
of union
S andT intersection
S are T distributive,
S i.e.,
T forS any threeTsets S A, BTand
C, A (B C) = (A B) (A C) and A (B C) = (A B) (A C).
All these can be nicely depicted by a simple diagram called a Venn diagram,
which consists of an outer rectangle representing the universal set (or sample
space) and a circle representing each simple event A, B, . . . inside it. If A and
B have some elements in common, the two circles representing them should
be overlapping. If A and B do not overlap as events (in which case, they are
called mutually exclusive or disjoint), the circles should be drawn as separated
too.
S In the former case, the total area covered by the double T circle represents
A B, the overlap between the two circles represents A B, the crescent-
shaped portion of the circle A that is outside the overlap region stands for
A − B and the corresponding portion of the other circle stands for B − A. If
one covers up the circle A, the rest of the rectangular box that is still visible
represents Ac . Similarly, for B c . Notice that the union of any event and its
complement is the entire rectangular box. Now the question is: what should
we call the ‘outside border’ region of the rectangular S box that is still visible
when we cover up the entire double circle (i.e., A B)? Since, in general,
‘outside’ means ‘complement,’ one correctly concludes that it should be called
(A B)c . But is there another name for it?
S

3.1. (A B)c is the same as Ac B c . Similarly, (A B)c is the same


S T T
Result
as Ac B c .
S
These are the famous De Morgan’s S rules. It is easy to verifyS them. For ex-
ample, if x is an outcome in (A B)c , that means x ∈ / A B, which in turn
means that x is neither in A nor in B. In Tother words, x ∈ Ac and x ∈ B cS. But
c
this is equivalent to
T saying that x ∈ A B c . So every outcome in (A B)c
c c
also belongs to A B . Similarly, by retracing this line of reasoning, one can
conclude that the converse is true too. This shows that the two collections are
identical. The other De Morgan’s rule can be similarly established. But what
are these useful for? Here is an example.

Example 3.1. Suppose that, in a two-set Venn diagram, A − B has 15 out-


comes
T (which is often denoted by n(A−B) = 15 where
T “n” means cardinality),
(A B)c has 43 outcomes, B itself has 20 and Ac B c has 15. Can we find

© 2008 by Taylor & Francis Group, LLC


BASICS OF PROBABILITY 31
S S
S n(A) and n(S)? Notice first of all that A B = (A − B) B, so that
out
A SB in this case
T has 15+20=35 outcomes. Now, by De Morgan’s first rule,
(A B)c = Ac B c , so in this case (A B)c has 15. Also, since the union of
S
any eventS and its complement gives us the whole sample space
T S, n(S)Tmust
be n(A B) + n(A B)c = 35 + 15 = 50. Finally, since A B and (A B)c
S
are complements of each
T other, their union is the whole sample space. So
n(A B) = n(S) − n(A B)c = 50 − 43 = 7. As a result, n(A) will be 22,
T
T the
sum of the cardinalities of its two non-overlapping pieces A − B and A B.
In the above example, we have repeatedly used the cardinality formula n(C)+
n(C c ) = n(S)
S for any event C. AnotherTcardinality formula that is often use-
ful is: n(A B) = n(A) + n(B) − n(A B). It is often called the union rule
and is easy to verify once the Venn diagram is drawn.
Once the concepts of a sample space and compound events are understood,
the next step is to assign a positive fraction to each of the listed outcomes in
a mathematically coherent way that is consistent with reality. This positive
fraction will be called the probability of the associated outcome. In fact, this
is the step where believers in the frequentist or classical notion of probability
differ philosophically from the believers in subjective probability. The former
will define the probability of an outcome as the “long-term” ratio between the
number of times that particular outcome has occurred and the number of trials
(i.e., the number of times the experiment has been repeated). In more mathe-
matical terms, the probability of an outcome x is p(x) = limn→∞ #x n , where n
is the number of trials and #x is the frequency of occurrence of that outcome
in n trials. The existence of this limit is ensured by the so-called strong law
of large numbers (SLLN). On the other hand, a believer in subjective proba-
bility may assign a probability to an outcome that reflects his/her degree of
confidence in its occurrence. For example, suppose somebody is playing a dice
game where each time he/she rolls a “6” with a fair die, he/she wins $ 100. If
a “6” turned up in 5 of the last 10 rolls by chance, he/she may very well think
“I am feeling lucky” and assume that the chances are 50% that the next roll
will also produce a “6.” This is based on perception and has nothing to do
with the long-term proportion of occurrence of the outcome “6” for a fair die,
which is 16 . In this book, we stick to the frequency-based definition of proba-
bility, although there are some problems with it in practice. We simply do not
know how many times a random experiment has to be repeated in order to
be able to determine the “true” probabilities of its outcomes accurately. For
example, if one wants to determine the probability of the outcome “6” in a
die-rolling experiment by repeated trials, usually the quantity #6 n (where n=
number of trials) fluctuates a lot for small or moderate values of n, thereby
producing misleading estimates. This ratio is ultimately guaranteed to sta-
bilize around the ‘true’ probability, but does ‘ultimately’ mean after 10000
trials or 1000000? That is why it is more convenient to “reason out” these
probabilities using mathematical reasoning, based on the precise description
of the experiment. For example, in the experiment of tossing a fair or unbiased
coin, the adjective “fair” or “unbiased” leads us to the logical conclusion that

© 2008 by Taylor & Francis Group, LLC


32 PROBABILISTIC AND MODEL-BASED LEARNING
none of the two outcomes H and T should be more likely than the other. As a
result, each of them should be assigned a probability of 12 , since the total prob-
ability of the entire sample space must always be 1 or 100%. Likewise, in the
case of rolling a perfect or balanced die, those adjectives will lead to the logical
conclusion that each of the six outcomes should receive the same probability,
which must therefore be 61 in order to keep the total 1. However, if a special die
is used whose three sides are marked with the number ‘3,’ another two sides
are marked with ‘2’ and the remaining side with ‘1,’ our logical reasoning will
not lead to assign equal probabilities to the three possible outcomes 1, 2 and
3. Instead we will conclude that ‘2’ should be twice as likely and ‘3’ should be
three times as likely as ‘1,’ which automatically determines the probabilities
to be P (1) = 16 , P (2) = 13 and P (3) = 12 . In this case, the outcomes are un-
equally likely, whereas in the previous two examples, the “fairness” adjectives
made the outcomes equally likely. Probabilities determined in this way are
called theoretical or model-based probabilities. How different these are from
the long-term frequency-based probabilities will depend on how realistic our
models are and/or how correct our logical reasoning is. For instance, if our
random experiment is picking a ball without looking from a box containing
50 balls of identical size and 5 different colors red, black, white, purple and
yellow (10 balls of each color), our logical reasoning will lead us to assign a
probability of 15 to each of the outcomes {R, B, W, P, Y }. This will indeed co-
incide with the long-term frequency of each of the colors because the balls are
otherwise identical. However, if our experiment was to catch a fish (without
looking) using a line and baits from a tank containing 50 fish of 5 different
colors R, B, W, P and S (10 of each color) and releasing it back to the tank,
our logical reasoning might once again lead us to assign the same probability
(1/5) to each color. That is if we continued to think of the fish as colored
balls in a box. But the reality may be different. Some fish may have a bigger
appetite than others or be more aggressive in nature, which makes them more
likely to bite the bait. In this case, the model-based probabilities may differ
from the ones based on long-term frequencies since our model failed to take
into account the full reality. Having said this, we should also point out that
in many practical applications, modeling the fish as identical balls of different
colors will be ‘good enough,’ in the sense that the resulting discrepancy in
the probabilities will hardly matter. That is why we fit probability models to
real-life phenomena, knowing that they are semi-realistic approximations at
best. As George Box, a renowned statistician, once said: “No model is correct;
but some are useful.”

Having assigned nonnegative fractions (or probabilities) to the outcomes in


a sample space in one way or another, now we go on to define probabili-
ties of events.
P The probability P (A) of an event A is formally defined as
P (A) = x:x∈A P (x). However, for experiments with equally likely outcomes,
it reduces to a simple formula: P (A) = n(A)
n(S) . For example, in the experi-
ment of rolling a balanced die, if A is the event that an odd number turns

© 2008 by Taylor & Francis Group, LLC


BASICS OF PROBABILITY 33
up and B is the event of a number ≤ 2 turning up, P (A) = 16 + 16 + 16
= 12 = 36 = n(A) 1 n(B)
n(S) . Similarly, P (B) = 3 = n(S) . But the above formula does
not hold for unequally likely outcomes. Recall the special die with the num-
ber ‘3’ on three sides, ‘2’ on two sides and ‘1’ on one side? For it, if B de-
notes the same event, the correct P (B) is 61 + 13 = 12 , which is different from
n(B) 2
n(S) = 3 . Some direct consequences of this computationally convenient for-
c
mula in the S T = 1 − P (A ) for any event A
equally likely case are (a) P (A)
and (b) S(A B) == P (A) + P (B) − P (A B) for any two events A and B,
which come from the corresponding cardinality formulae mentioned earlier.
Probabilities defined in this way satisfy the following:

Probability axioms:
Axiom 1. 0 ≤ P (A) ≤ 1 for any event A in S;
Axiom 2. P (S) = 1;
Axiom 3. For anyScountable
S Scollection E1 , E2 , E3, . . . of mutually exclusive
events in S, P (E1 E2 E3 . . .) = P (E1 ) + P (E2 ) + P (E3 ) + . . .. In other
S∞ Pk
words, P ( i=1 Ei ) = limk→∞ i=1 P (Ei ).
Any way of defining probabilities of events (objective or subjective) should sat-
isfy these axioms in order to be called consistent. The last of the three axioms
is called countable additivity. Some prefer replacing it by the finite additivity
axiom of De Finetti, but here we stick to the former (actually, countable ad-
ditivity implies finite additivity but not vice versa). In any case, we are now
in a position to compute probabilities of various compound events.

Example 3.2. For the experiment of drawing a card, without looking, from a
(well-shuffled) deck of 52 cards, recall that we defined events A = { the card
drawn is an ace }, B = { the card drawn is black }, C = { The card drawn
is a face card } and D = S { the card drawnT is a diamond T }. Let us compute
T
the probabilities
S (a) P (A B), (b) P (A
S S D), (c) P (BS C), (d) P (B D),
(e) P (A C), (f) P (A∆D), (g) P (A C D). P (A B) is 28/52 or 7/13
by direct counting, since there are 28 cards altogether in the deck that are
either ace or black (or both). It couldTalso be found usingTthe union rule, as
P (A) = 1/13, P (B) = 1/2 and P (A B) = 1/26. P (A D) is 1/52, since
there is only one diamond ace. The answers to (c), (d) and (e) are 3/26,
0 and 4/13 respectively (not counting the aces as face cards). P (A∆D) is
15/52, since P (A − B) = 3/52, P (B − A) = 12/52 = 3/13 and A∆D is
the disjoint union of theseStwo (notice that for two disjointT events E and
F , the union
S formula P (E F ) = P (E) + P (F ) − P (E F ) simply reduces
to P (E S F )S= P (E) + P (F ) since the intersection term vanishes). Finally,
P (P (A C D) is 25/52, by direct counting.

Remark 3.1. The union rule for a three-set Venn diagram is a little more
complicated. Just as a Venn diagram with two overlapping sets
S A and B has
22 = 4 disjoint components A − B, B − A, A B and (A B)c , a Venn
T

© 2008 by Taylor & Francis Group, LLC


34 PROBABILISTIC AND MODEL-BASED LEARNING
diagram with three mutually overlapping sets has 23 = 8 disjoint compo-
nents that can be appropriately named usingSset-theoretic
S symbols. In view
of this, it is not
T too difficultTto see why PT(E1 E2 E 3
T ) = P
T(E1 ) + P (E2 ) +
P (E3 )−P (E1 E2 )−P (E2 E3 )−P (E3 E1 ) +P (E1 E2 E3 ).
Let us now focus our attention on event pairs such asTA and B, A and D or
B and C. Since P (A) = 1/13, P (B) = 1/2 and P (A T B) = 1/26, clearly an
interesting relation holds, namely, P (A)P (B) = P (A B). Similar is the case
for the other two pairs. One might get the impression that it happens all the
time. But what about the event pairs B and D? If we define a new event E
as the card drawn beingT a spade, what about the pair B and E or D and E?
For B and D, P (B D) = 0 6= P (B).P (D). Similar is the case for D and E.
Regarding B and T E, we have P (B)P (E) = (1/2)(1/4) = 1/8 which is differ-
ent from P (B E) = 1/4. So the equation that the pairs {A, B}, {A, D} and
{B, C} satisfy is a special one and when it holds, the event-pair involved is
called an independent pair of events. So the pairs {B, E}, {D, E} and {B, D}
are dependent pairs.

Example 3.3. Suppose our experiment is to choose a whole number randomly


from among 1, 2, . . . , 20. Now, the phrase “choosing randomly” means choos-
ing in such a way that all possible outcomes are equally likely. How would
one carry out the experiment to ensure this? One way could be to write the
numbers 1 through 20 on twenty identical-looking paper chips or plastic to-
kens, put them in a bowl or a hat, mix them well and then draw one without
looking. In any case, if A is the event that the chosen number is odd and B,
the chosen number is a multiple of 3, then A and B are independent (verify
it). If C is the event that the chosen number is ≤ 10 and D is the event that
it is a multiple of 4, then C and D are dependent (verify it too).
Now we will probe into it a little bit farther and try to understand why some
event-pairs are independent and others are not. If we examine the independent
event-pairs in the above examples carefully, we will see that within each pair,
the events do not carry any information regarding one another. For instance,
if your instructor is standing at the lecture podium and drawing a card, with-
out looking, from a (well-shuffled) deck of 52 cards, and you are sitting in
the audience, trying to predict whether the card drawn will be an ace. The
instructor looks at the card drawn but does not tell you what it is. To you, the
chances of it being an ace are 1/13. If, at this point, the instructor changes
his/her mind and reveals that the card drawn is actually black, does it change
the probability of it being an ace in your mind? Earlier, you were thinking
that it would be 1 in 13 since there are 4 aces in the deck of 52 cards. Now, in
view of this additional information about the color, your brain will automat-
ically stop thinking about the 26 red cards that are irrelevant and focus only
on the black cards. But the proportion of aces is still the same—2 out of 26
or 1/13. In other words, the color of a card has no information about the “ace
or non-ace” classification, and vice versa. When you are trying to predict the
color of a card drawn by somebody else, any information about whether it is

© 2008 by Taylor & Francis Group, LLC


BASICS OF PROBABILITY 35
an ace does not affect your chances of making a correct prediction either. This
lack of mutual information is the real explanation behind probabilistic inde-
pendence. The color of a card does not carry any information about whether
it is a face card or a number card, nor does the name of its suit about whether
it is an ace.
If independence is another name for lack of information, a pair of dependent
events must contain some information about each other. The question is: how
much? One way of quantifying the information that an event carries about
another is to measure the amount of change in the latter’s probability, given
the knowledge of the former’s occurrence. In Example 3.3, the ordinary proba-
bility of D is 5/20 or 1/4. But as soon as it is revealed that the chosen number
has turned out to be ≤ 10, our focus shifts to only the outcomes 1, . . . , 10 and
since there are only two multiples of 4 in this range, the new probability of
D is 2 out of 10 or 1/5. So the additional piece of information that C has
occurred has a “shrinking effect” on the denominator of the familiar formula
P (D) = n(D)
n(S) and changes it from the total count of the entire sample space to
T
the count of the “relevant” part of the sample space (i.e., n(C S) or n(C)).
At the same time, the numerator changes from n(D) to the count T of the “rele-
T n(D C)
vant” part of D (i.e., n(D C)). The resulting formula n(C) is called the
D given C and is denoted by P (D | C). It is easy to
conditional probability of T
P (D C)
see that P (D | C) = P (C) ,
which yields the following important equation:
\
P (C D) = P (C)P (D | C). (3.1)

This is the so-called long multiplication rule, which in fact generalizes to any
finite number of events. If E1 , E2 , . . . , En are n events, then
n
\
P( Ei ) = P (E1 )P (E2 | E1 )P (E3 | E1 ∩ E2 ) . . . P (En | E1 ∩ . . . ∩ En−1 ).
i=1
(3.2)
Notice that if two events A and B are independent, P (A | B) reduces to P (A)
and, similarly, P (B | A) reduces to P (B). In fact, this can be used as the
definition of independence. Let us now see some more examples of conditional
probabilities.

Example 3.4. In the context of tossing a fair coin twice, so that S =


{HH, HT, T H, T T } and all four outcomes are equally likely, what is the
conditional probability that both tosses show ‘heads up,’ given that none of
them produces a tail? Since the intersection of the two events has probability
= 1/4 and that for the latter event is 3/4, the desired conditional probability
will be 1/3.

Example 3.5. Suppose our random experiment is rolling a balanced die twice.
The sample space S will have 36 outcomes, each being an ordered pair of whole

© 2008 by Taylor & Francis Group, LLC


36 PROBABILISTIC AND MODEL-BASED LEARNING
numbers (x, y) with 1 ≤ x, y ≤ 6. And they are all equally likely, each having
probability 1/36. What will be the conditional probability of exactly one of
x and y being odd (call this event A), given that x and y are different (call
it B)? Once again, since the probability of their intersection is 18/36 or 1/2
(can be verified by direct counting or reasoned out easily) and the denomina-
tor probability is 30/36 or 5/6 (all but the outcomes (1, 1), (2, 2), . . . , (6, 6)),
the answer is 3/5. Do you think that A and B are independent?

Example 3.5. Suppose you are drawing two cards one by one, without look-
ing, from a (well-shuffled) deck of 52 cards with replacement. The sample space
will have 522 = 2704 ordered pairs of cards, all of which are equally likely.
Now, what is the conditional probability of both being face cards, given that
both are spades? Clearly, the intersection of these events has 32 = 9 outcomes
in it whereas the second event itself has 132 = 169. So the answer is 9/169.

Example 3.6. The file cabinet in your office is locked and you have a bunch
of n keys in a key-ring, exactly one of which will open it. You start trying the
keys one by one and once a key has been tried, it is not tried again. What
are the chances that you succeed at the k th attempt (k ≤ n)? If we define
events E1 , E2 , . . . , Ek−1 as Ei = {failing at the ith attempt} and define Ek as
Tk
“succeeding at the k th attempt,” then the desired event E = i=1 Ei . But by
(3.2),
k−2
\ k−1
\
P (E) = P (E1 )P (E2 | E1 ) . . . P (Ek−1 | Ei )P (Ek | Ei ),
i=1 i=1

which in this case is ( n−1 n−2 n−k+1 1


n )( n−1 ) . . . ( n−k+2 )( n−k+1 ). But this is simply 1/n.
In other words, somewhat counter-intuitively, the chances of succeeding at
any particular attempt are the same.

Example 3.7. Let us assume that in a certain population, 5% of the peo-


ple carry a certain virus (i.e., the virus infection has a prevalence rate of
5%). A clinical diagnostic test that is used to detect the infection will pick
up the infection correctly 99% of the times (i.e., has a false negative rate
of 1%). The test raises a false alarm (i.e., gives a positive result even when
the infection is not there) 2% of the times. If a person walks into the clinic,
takes the test and gets a positive result, what are the chances that he/she
actually has the infection? It is a legitimate question since the test appears
to be slightly imperfect. Now, let us translate this story to symbols. Let A =
{a randomly chosen person from that population actually has the infection}
and B = {a randomly chosen person from that population tests positive}.
Then, in terms of these, what do we know and what is the question? We know
that P (A) = 0.05, P (B | A) = 0.99 and P (BT| Ac ) = 0.02. We are supposed to
P (A B)
find P (A | B). As we know, it is simply P (B) . But, according to (3.1), the
numerator is P (A)P (B | A) = (0.05)(0.99) = 0.0495. What about the denom-

© 2008 by Taylor & Francis Group, LLC


BASICS OF PROBABILITY 37
T T S c T S T c
inator? Notice that B = B S = B (A T A ) = (BT A) (B A ) due to
the distributive property. So P (B) = P (B A)+P (B Ac ). We already know
the first term. The second term can be found similarly as P (Ac )P (B | Ac )
= (1 − 0.05)(0.02) = 0.019. So P (B) = 0.0495 + 0.019 = 0.0685. So the answer
is 0.7226 or 72.26%.
There is something interesting in this last example, namely,
S c the way we com-
puted P (B). Realizing that the sample space S = A A , we decomposed
B into two disjoint pieces (B A and B Ac ) and computed P (B) as the
T T
sum of the probabilities of those pieces. This can be generalized to the follow-
ing scenario. Suppose A1 , A2 , . . . , An are mutually disjoint events such that
S n
i=1 Ai = S. Such a collection of events is called a partition of the sample
space. So, in Example 3.7, A and AcSformed a partition of the sample space.
n
Any event B can be written as B = i=1 B ∩ Ai , which is a disjoint union. So
n
X n
X
P (B) = P (B ∩ Ai ) = P (B | Ai )P (Ai ), due to (3.1). (3.3)
i=1 i=1

This is known as the law of total probability. Using this, any of the “reverse”
conditional probabilities P (Aj | B) can be computed as
P (Aj ∩ B) P (B | Aj ).P (Aj )
P (Aj | B) = = Pn . (3.4)
P (B) i=1 P (B | Ai )P (Ai )

This is known as the Bayes theorem. In this context, the P (Ai )’s are called
the prior probabilities of the partition-cells, the “forward” conditional prob-
abilities P (B | Ai )’s are called the likelihoods and the “reverse” conditional
probabilities P (Ai | B)’s are called the posterior probabilities. This simple
result is so powerful that an entire subfield of statistics is based on this idea.
Bayesian inference now dominates the cutting-edge applications of statistics
in the highly challenging data-analysis problems posed by modern science. We
will see more of it later. For the time being, let us see some examples of the
Bayes theorem in action.

Example 3.8. In the experiment of drawing a card, without looking, from a


(well-shuffled) deck of 52 cards, what are the chances that the card is a dia-
mond, given that it is a face card? Let A1 , A2 , A3 and A4 be the events that
the card drawn belongs to the diamond suit, the spade suit, the heart suit and
the club suit respectively. Together, they form a partition of the sample space.
Let B be the event that the card drawn is a face card. Then the prior proba-
bilities are P (Ai ) = 41 for i = 1, . . . , 4, the likelihoods are P (B | Ai ) = 13
3
and,
(3/13)(1/4) 1
therefore, the posterior probabilities are (4)(3/13)(1/4) or 4 . In other words,
the prior and the posterior probabilities are identical. What does it tell you?
That the event B is independent of the partition cells (we already knew that,
right?).

Example 3.9. If you are trying to buy an air ticket the day before the 4th

© 2008 by Taylor & Francis Group, LLC


38 PROBABILISTIC AND MODEL-BASED LEARNING
of July weekend to fly from Green Bay, Wisconsin, to Chicago, Illinois, there
are several choices: United Airlines (UA), Northwest Airlines (NA), Midwest
Airlines (MA), American Airlines (AA) and Delta ComAir (DCA). They re-
spectively operate 15%, 20%, 25%, 30% and 10% of the flights that depart
from the Green Bay airport daily. The chances of getting a seat on a day like
that are small: 3% on UA, 5% on NA, 3% on MA, 2% on AA and 5% on DCA.
Given that you ultimately managed to fly to Chicago, what are the chances
that you chose American Airlines? Well, the five airlines form a five-cell par-
tition with prior probabilities given by the percentages of the daily flights out
of Green Bay that they operate. Using the likelihoods of getting a seat on
various airlines, The Bayes theorem yields the following posterior probability
of having chosen AA, given that you managed to fly:
(0.3)(0.02) 0.006
= ,
(0.15)(0.03) + (0.2)(0.05) + (0.25)(0.03) + (0.3)(0.02) + (0.1)(0.05) 0.033
which is about 0.182. Notice that in an example like this, the prior probabilities
of the partition cells are more likely to be subjective, because often one’s
choice of a carrier is motivated by lower fares or the desire to earn frequent
flier miles or the quality of in-flight service. The percentages of daily flights
operated by the airlines would indeed be the correct priors if one chose a
carrier randomly, which is seldom the case. In real-life applications of the
Bayes theorem, there is often a lot of controversy regarding the appropriate
choice of prior probabilities, but the theorem works irrespective of how they
are chosen.
Since we compute the probability of an event A as n(A)/n(S) in the ‘equally
likely’ scenario, efficient computation of probabilities depends on our ability
to quickly enumerate sample spaces and events. In the examples discussed so
far, counting the number of outcomes in a sample space or an event has been
a piece of cake, but the degree of difficulty quickly increases with the size of
the set. For example, any counting for experiments such as 5 rolls of a die or
10 tosses of a coin is not so trivial. So we must develop some clever counting
tricks. Here is a motivating example.

Example 3.10. Suppose you are synthesizing proteins in vitro in a laboratory.


Recall from Chapter 2 that the building blocks of proteins are amino acids
(AA) and there are 20 of them. If you decide to synthesize a 10AA oligopeptide
chain consisting of distinct AA’s by randomly choosing from the full collection
of 20, with the restriction that the first AA in the chain must be a methionine,
what are the chances of ending up with the chain methionine-valine-threonine-
glycine-alanine-arginine-leucine-ceistine-proline-isoleucine? To answer this ques-
tion, the first order of business is to find out n(S). What is a typical outcome
here? It is an ordered arrangement of 10 distinct AA’s chosen out of 20 so
that the first one is a methionine. So the best way to find n(S) is to first
find the number of different subcollections of 9 AA’s chosen out of 19 (i.e.,
all but methionine) and then multiply it with the number of different ways in

© 2008 by Taylor & Francis Group, LLC


BASICS OF PROBABILITY 39
which 9 distinct AA’s can be rearranged. In what follows, we first address the
‘subcollections’ question and then the ‘rearrangement’ question.
If you have a bag containing just one item (let it be an apple or A), how
many subcollections of 1 item can you form from it? Just one (i.e., {A}). If
you have two items in your bag instead of one (say, an apple and a banana,
or simply A and B), how many single-item subcollections can you form from
it? Two (i.e., {A} and {B}). How many double-item subcollections can be
formed? Only one (namely, {A, B}). Next, if you have three items in your
bag (say, an apple, a banana and a cucumber, or simply A, B and C), the
numbers of single-item, double-item and triple-item subcollections that can
be formed are 3, 3 and 1 respectively. List them all and verify. If you have
one additional item in the bag so that it now contains four items (say, A, B,
C and D), once again the different single-item, double-item, triple-item and
quadruple-item subcollections that can be obtained from it are easy to list.
Their numbers are 4, 6, 4 and 1 respectively. Now, in order to facilitate the
recognition of a pattern in these counts, let us ask the ‘silly’ question: “How
many empty subcollections can be formed?” in each of the above cases. The
answer is always 1, since an empty subcollection is an empty subcollection—
there is no variety of it. With this, let us write those counts in the following
way:

1 1
1 2 1
1 3 3 1
1 4 6 4 1

The pattern that emerges in this triangular arrangement of numbers (widely


known as a Pascal’s triangle) is that each non-terminal number in it is the
sum of its two nearest neighbors from the preceding row (called its ‘parents’).
The terminal numbers in each row have just one ‘parent’ apiece. So, how
does it help answer our ‘subcollection’ question in general? In order to find
the number of different k-item subcollections that can be formed from a bag
containing n distinct items, we just need to look up the (k + 1)th entry in
the nth row of this table. That entry, usually denoted by n Ck , is nothing but
n!
k!(n−k)! .

Now, to rearrangements. If you just have an apple (or A), the number of
different rearrangements of it is just 1. If, instead, you have two items (A and
B), there are two possible rearrangements (AB and BA). For three items A, B
and C, the number is 6 (ABC, ACB, BAC, BCA, CAB and CBA). For 4 items
A,B,C and D, it is 24. If we still try to list all the 24 rearrangements (we will
quit this habit shortly, once we know the formula), the following is the most
efficient way of doing it. For the moment, ignore D and focus on the remaining
three items A, B and C. From the previous step, we know that they have 6
distinct rearrangements. List them all and add the missing letter D at the end
of each of them. You have generated 6 distinct rearrangements of A,B,C and

© 2008 by Taylor & Francis Group, LLC


40 PROBABILISTIC AND MODEL-BASED LEARNING
D. Next, repeat this process with A,B and D only, ignoring C. You generate 6
more. Ultimately you will generate another 6+6=12 by ignoring B and A one
at a time. That is why the total number is 24. In view of this “ignoring one at
a time” algorithm, the number of different rearrangements of 5 distinct items
will be 24+24+24+24+24=120. In any case, is there a pattern emerging here
too? The numbers of distinct rearrangements of n items were 1 for n = 1,
2=(2)(1) for n = 2, 6=(3)(2)(1) for n = 3, 24=(4)(3)(2)(1) for n = 4, and
so forth. So in general, the number of different rearrangements (also called
permutations) of n distinct items is n(n−1)(n−2) . . . (3)(2)(1), usually denoted
by n!. This simple formula, however, fails if some of the items concerned are
indistinguishable. For example, two identical A’s can be arranged in only one
way, not two. Similarly, two identical A’s and a B can be arranged in just
three ways (AAB, ABA, BAA), not six. If you have n objects, k1 of which
PL
are identical of type 1, . . ., kL of which are identical of type L ( i=1 ki = n),
then the number of different rearrangements drastically reduces from n! to
n!
(k1 !)...(kL !) .

Having said all these, let us go back to our original question of oligopeptide
synthesis. 9 distinct amino acids can be chosen from a “bag” of 19 in 19 C9 =
19!
(9!)(10!) different ways. A set of 9 distinct amino acids can be permuted in
9! different ways. So, the total number of possible 10AA oligopeptide chains
19!
consisting of distinct AA’s and starting with methionine is ( (9!)(10!) )(9!) = 19!
10! .
In general, the number of different ordered permutations of k distinct objects
n!
chosen out of n distinct objects is (n−k)! , which is denoted by n Pk .

Example 3.11. In the experiment of drawing two cards, without looking, from
a (well-shuffled) deck of 52 cards one by one without replacement, what are the
chances that both are hearts? The answer is n(A)/n(S) where n(S) =52 C2
52! 13!
= (2!)(50!) = 1326 and n(A) =13 C2 = (2!)(11!) = 78. So the chances that both
of them are hearts are about 5.88%.

Example 3.12. If you are randomly permuting the four letters of our genetic
alphabet (i.e., the four nucleotides adenine, guanine, thymine and cytosine or
A,G,T and C), what are the chances that the purines and the pyrimidines are
together? For this problem, n(S) is of course 4! = 24. To find n(A), let us look
at it this way. The ‘purine block’ and the ‘pyrimidine block’ can be permuted
in 2! = 2 ways and within each block, the two bases can be permuted in 2! = 2
ways. So n(A) = (2)(2)(2) = 8 and the answer is 1/3.

3.3 Random Variables and Probability Distributions

Now let us play a different ‘game’ with sample spaces, events and probabili-
ties. For many real-life random experiments, the sample space is very large and
the individual outcomes are not of our interest; instead we are interested in

© 2008 by Taylor & Francis Group, LLC


RANDOM VARIABLES AND PROBABILITY DISTRIBUTIONS 41
clusters of outcomes sharing a common feature. So it is enough to summarize
the sample space as a list of those clusters and the corresponding probabili-
ties. Usually, each such cluster corresponds to a unique value of a ‘quantity
of interest’ (called a random variable), so listing the clusters is equivalent to
listing the distinct values of the associated random variable. The resulting
table, with values of the random variable in one row and the corresponding
probabilities in the other, is called a probability mass function table or p.m.f.
table. Here are some examples.

Example 3.13. In the experiment of tossing a fair coin three times, which
has S = { HHH, HHT, HTH, THH, HTT, THT, TTH, TTT} with equally
likely outcomes, if the ‘quantity of interest’ or random variable (call it X) is
simply the number of heads among the three tosses, the p.m.f. table will be

Values 0 1 2 3
1 3 3 1
Probs 8 8 8 8

Example 3.14. In the experiment of rolling a balanced die twice, with S


having 36 equally likely ordered pairs of whole numbers (x, y), 1 ≤ x, y ≤ 6,
if the random variable of interest (call it Y ) is the sum of the two numbers
that turned up, the p.m.f. table will be

Values 2 3 4 5 6 7 8 9 10 11 12
1 2 3 4 5 6 5 4 3 2 1
Probs 36 36 36 36 36 36 36 36 36 36 36

Example 3.15. Suppose ten million tickets of a state lottery have been sold
for a dollar a piece. Only one of them carries a super bumper prize of $ 5000000,
5 of them carry mega-prizes of $ 500000 each, 25 of them carry second prizes
of $ 50000 each, 50 of them carry third prizes of $ 10000 each and another
100 of them carry consolation prizes of $ 1000 each. If you go to a store and
randomly buy a ticket for this lottery, what is the p.m.f. table of your earning
(call it W )? Notice that irrespective of whether you win a prize or not, you al-
ways pay the ticket price. So the p.m.f. table of your earning will be as follows:

Amounts $ 4999999 $ 499999 $ 49999 $ 9999 $ 999 $ -1


1 1 1 1 1 9999819
Probs 10000000 2000000 400000 200000 100000 10000000

In this last example, the important question is what your average (or expected)
earning will be if you repeatedly buy tickets for this lottery. Will it be as high
as the grand prizes this lottery advertises? The expected value Pm or mean of a
random variable W (denoted by E(W ) or µW ) is defined as i=1 wi pi if W

© 2008 by Taylor & Francis Group, LLC


42 PROBABILISTIC AND MODEL-BASED LEARNING
takes the values w1 , . . . , wm with probabilities p1 , . . . , pm respectively. It is
simply a weighted average of its values, with the weights being the probabili-
ties. For this lottery, E(W ) = −0.065. That is, on an average you lose six and
a half cents! This is why the lottery business is profitable to its host.

While the expected value is a useful device for comparing two random variables
X and Y (after all, we cannot compare them value-by-value or probability-
by-probability since their p.m.f. tables may not even be of the same length),
it is by no means the whole story. Two completely different random variables
may end up having the same expected value, so we need some other summary-
measures to capture the other differences. Any p.m.f. table can be pictorially
represented by a stick plot or a probability histogram. In a stick plot, the dis-
tinct values are marked along the horizontal axis and a stick is erected over
each value whose height is the corresponding probability. In a probability his-
togram, the sticks are replaced by rectangular bars of equal width centered
at the values. Various features of this plot such as how ‘fat’ or ‘thin’ its tails
are, how asymmetric it is around its expected value and how peaked or flat-
topped it is, are connected to its moments. The rth raw moment of X for
any real number r is defined as E(X r ), i.e., as the expected value of the ran-
dom variable X r which takes the values xr1 , xr2 , . . . with probabilities p1 , p2 , . . .
(x1 , x2 , . . . being the values of X). The rth central moment of X is defined as
E(X −E(X))r , i.e., as the expected value of the random variable (X −E(X))r
which takes the values (x1 − µX )r , (x2 − µX )r , . . . with probabilities p1 , p2 , . . ..
The 2nd central moment of a random variable is called its variance (denoted
2
by σX ) and it is related to the ‘fatness’ or ‘thinness’ of the histogram tail.
Usually the heavier the tail, the greater the variance. The square root of the
variance is known as the standard deviation (denoted by σX ). The 3rd central
moment is related to the degree of skewness (i.e., lack of symmetry) of the his-
togram and the 4th central moment is related to its degree of peakedness. Two
important properties of expected values are (i) E(X + Y ) = E(X) + E(Y )
for any two random variables X and Y and (ii) E(cX) = cE(X) for any
random variable X and any constant c. Simple algebraic expansions and re-
peated use of the above two properties will show that the raw moments and
2
the central moments are related. For example, σX = E(X 2 ) − (E(X))2 . Also,
E(X − E(X)) = E(X ) − 3E(X)E(X ) + 2(E(X))3 . All the raw moments
3 3 2

of a random variable can be conveniently obtained from its moment generat-


ing function (MGF). Just as a thin popcorn-bag from the supermarket shelf,
when microwaved, swells up and produces lots of delicious popcorns, the MGF
is like a handy storage device that produces raw moments of many different
orders when repeatedly differentiated. Formally, the MGF of X is defined as
MX (t) = E(etX ) for t in some interval around 0 on the real line. So it is the
expected value of the random variable etX that takes the values etx1 , etx2 , . . .
with probabilities p1 , p2 , . . .. Its rth derivative, evaluated at t = 0, is the rth
raw moment of X. An important and useful fact about MGF’s is that there
is a one-to-one correspondence between the form of the MGF and the form of
the associated p.m.f., so it is possible to identify the p.m.f. by looking at the
MGF (call it “MGF fingerprinting” if you will!).

Example 3.16. For the random variable Y in Example 3.14, µY = E(Y ) =


252 2 2 2 1974 2 rd
36 = 7, σX = E(Y ) − (E(Y )) = 36 − 7 = 5.833, the 3 raw mo-

© 2008 by Taylor & Francis Group, LLC


RANDOM VARIABLES AND PROBABILITY DISTRIBUTIONS 43
ment E(Y 3 ) = 16758
36 = 465.5 and the 3rd central moment E(Y − E(Y ))3 =
1974
465.5 − 3(7)( 36 ) + 2(73 ) = 0. The 3rd central moment is 0 for any p.m.f. that
is symmetric with respect to its mean (the converse is not necessarily true,
though). Finally, the MGF of Y is
e2t + e12t + 2(e3t + e11t ) + 3(e4t + e10t ) + 4(e5t + e9t ) + 5(e6t + e8t ) + 6e7t
MY (t) = .
36

Its first derivative of it w.r.t. t, evaluated at t = 0, is E(Y ) = 7, its second


derivative evaluated at t = 0 is E(Y 2 ) = 54.833 and its third derivative
evaluated at t = 0 is E(Y 3 ) = 465.5 (verify these).
Now consider the random experiment of closing your eyes and touching a 6-
inch ruler with a needle-tip. What if we define our random variable X to be
the distance between the point where the needle touched the ruler and the
left end-point (or zero-point) of the ruler? A needle-tip being so sharp and
pointed, X can actually take any value between 0 and 6. That is, the set of
possible values of X is the entire interval [0, 6] and is, therefore, uncountably
infinite. This immediately implies that if we wanted to write down a p.m.f.
table for X or draw its probability histogram, we would fail. Also, despite
the fact that your eyes being closed gives this experiment an ‘equally likely’
flavor, in the sense that intuitively each real number in the interval [0, 6]
should have the same probability, what is that probability? Just as each of
the 6 outcomes in the roll of a balanced die has probability 61 , will it be ∞
1
or 0
in this case? Then we are in the strange situation that each single outcome has
probability 0, yet one of those countless outcomes will definitely occur! This
kind of random variables, which lands us in this bizarre situation, is called
the class of continuous random variables. In contrast, the random variables
with p.m.f. tables that we saw earlier will be called discrete. By the way, from
our examples above, one should not get the wrong impression that all discrete
random variables have finite value-sets (or supports). Examples of discrete
random variables with countably infinite supports are forthcoming.
In any case, getting back to continuous random variables, how does one com-
pute probabilities for them? For example, for the X in the ‘needle and ruler’
experiment, what is P (X ≤ 2) or P (3 ≤ X ≤ 5)? Well, think about the nat-
ural discrete counterpart of this experiment. Since this experiment basically
says: “Pick any real number randomly from within [0, 6],” its natural dis-
crete counterpart would be: “Pick any whole number randomly from among
1,2,3,4,5 and 6”. It should look familiar since it is nothing but the balanced
die-rolling experiment. If for this experiment, we defined X to be the whole
number that turned up, how would we compute P (X ≤ 2) and P (3 ≤ X ≤ 5)?
One way would be to compute them directly from the p.m.f. table of X or
by adding the heights of appropriate sticks in its stick plot, but these are not
relevant to our present situation where there is no p.m.f. table or stick plot.
Another way of computing those probabilities would be by the area method
from the probability histogram of X. The probability histogram of an ‘equally
likely’ experiment such as rolling a balanced die looks like a flat or rectangular

© 2008 by Taylor & Francis Group, LLC


44 PROBABILISTIC AND MODEL-BASED LEARNING
box. To find P (X ≤ 2), we just need to find the total area of the bars in this
histogram that correspond to this event (i.e., the two leftmost bars). Since
each rectangular bar has a base-width of 1 unit and height = 16 , the total
area of those two bars is 31 . Similarly, P (3 ≤ X ≤ 5) = 21 , the sum of the
areas of three such bars. If we now imagine following the same area method to
compute those probabilities in the continuous case, except at a much, much
finer scale with ‘needle-thin’ bars (because there are countless values crammed
together in a small space), we begin to understand how one deals with contin-
uous random variables. We are actually taking the limit of a histogram with n
bars as n → ∞, keeping the base-width of the histogram fixed. As we do this,
the upper contour of the histogram (which would have a rugged broken-line
structure in a discrete histogram) starts to appear like a smooth curve. This
curve, which still encloses a total area of 1 underneath it like the discrete
histograms, will be called the probability density curve of X. The function
f (x) : D → R, whose graph is the probability density curve, will be called the
probability density function (p.d.f.) of X (D being the value-range or support
of X). In general, any nonnegative-valued integrable function defined on the
real line, which encloses a total area of 1, could potentially be the p.d.f. of
some continuous random variable coming from some underlying experiment.

So, in our ‘needle and ruler’ experiment, the density curve is a flat line on the
interval [0, 6] and the p.d.f. is f (x) = 61 I(x ∈ [0, 6]), where I(.) is the indicator
function that takes the value 1 only if the condition in it is satisfied (otherwise
0). This is known as the Uniform p.d.f. P (X ≤ 2) is the area underneath this
flat line between 0 and 2. Similarly, P (3 ≤ X ≤ 5) is the area between 3 and
5. Formally speaking, for any two real numbers a and b,
Z b
P (a ≤ X ≤ b) = f (x)dx. (3.5)
a

This gives us the formal reason why, for a continuous random variable X,
P (X = x) = 0 for any particular value x, because it is simply the integral
in (3.5) with a = b. Now, if we define a function F (t) : R → [0, 1] as F (t) =
Rt
−∞
f (x)dx, then F (t) is nothing but the area underneath the p.d.f. f (x) up
to the point t or, equivalently, P (X ≤ t). This F is called the cumulative
distribution function (c.d.f.) corresponding to the p.d.f. f . In this case, the
Uniform[0,6] c.d.f. is
Z t
1 t
F (t) = 0 if t ≤ 0; dx or if t ∈ (0, 6); 1 if t ≥ 6. (3.6)
0 6 6
By the fundamental theorem of integral calculus, such an F (t) is a continuous
(if fact differentiable) function with F ′ (x) = f (x). Incidentally, we could also
have defined a c.d.f. for a discrete random variable, but those c.d.f.’s would
be step functions, i.e., their graphs could consist of flat line-segments with
jumps in-between (explain to yourself why). But irrespective of discrete or
continuous, all c.d.f.’s have the following properties:

© 2008 by Taylor & Francis Group, LLC


RANDOM VARIABLES AND PROBABILITY DISTRIBUTIONS 45
Result 3.2. The c.d.f. F (.) of any random variable X satisfies
(i) limt→−∞ F (t) = 0 and limt→∞ F (t) = 1;
(ii) F (t) is right-continuous, i.e., limt→s+ F (t) = F (s), where “t → s+” means
that t approaches s from its right side;
(iii) F (a) ≤ F (b) for any a, b ∈ R with a ≤ b.

The density curves of different continuous random variables can have a great
variety of geometric shapes. Here is another example.

Example 3.17. Suppose you touch a 6-inch ruler with a needle with your
eyes closed, and your friend does the same thing independently of you. Let Y1
be the distance between the touching point and the zero-point on the ruler in
your case, and Y2 be that in your friend’s case. If we define Y = Y1 + Y2 , this
Y will have a triangular density on the support [0,12] with p.d.f. f (y) given
by
y 12 − y
f (y) = I(0 ≤ y ≤ 6) + I(6 < y ≤ 12). (3.7)
36 36
How do we know? One way would be to go through the same limiting process
that led us to the Uniform[0,6] density earlier. For this experiment, the natural
discrete counterpart is two persons rolling a balanced die each, independently
of one another. The discrete histogram corresponding to the sum of the two
numbers is essentially triangle-shaped (ignoring the rugged upper contours of
the bars).
Now that we know how continuous random variables behave, all the numerical
summaries we defined for a discrete random variable (i.e., raw and central
moments) can be easily generalized to them. For a continuous X with p.d.f.
f (x) and support D, the rth raw and central moments are defined as
Z Z
r r r
E(X ) = x f (x)dx, E(X − µX ) = (x − µX )r f (x)dx, (3.8)
D D
provided that the integrals exist. Like before, various features of the density
curve (e.g., lightness or heaviness of tails, skewness, flatness, etc.) are con-
nected to its moments and the central moments are expressible in terms of
the raw moments. The MGF of X is also defined analogously as MX (t) =
E(etX ) = D etx f (x)dx if this integral exists on some interval around 0, and
R
the mechanism by which the raw moments are generated from this MGF is
the same as before.

Example 3.18. The MGF of the Uniform[0,6] random variable X mentioned


earlier is Z 6
1 1 e6t − 1
MX (t) = etx dx = for t 6= 0.
0 6 6 t
Remember the definition of two events being independent? It can be easily gen-
eralized to any finite
Tn numberQofn events. The events E1 , . . . , En are independent
if and only if P ( i=1 Ei ) = i=1 P (Ei ). The definition of the independence of

© 2008 by Taylor & Francis Group, LLC


46 PROBABILISTIC AND MODEL-BASED LEARNING
a bunch of random variables is analogous. The random variables X1 , . . . , Xn
with supports D1 , . . . , Dn respectively are said to be independentQn if for any
subsets Ai of Di (i = 1, . . . , n), P (X1 ∈ A1 , . . . , Xn ∈ An ) = i=1 P (Xi ∈
Ai ). An immediate consequence of this definition is that the expected value
of the product of a bunch of independent random variables turns out to be
the product of the individual expected values. We will now focus on some
frequently encountered and useful random variables— both discrete and con-
tinuous.

A vast majority of real-life random experiments producing discrete random


variables can be modeled by the following:
(i) the number of heads in n independent tosses of a (possibly biased) coin
whose P (head) = p in a single toss;
(ii) the number of independent tosses of a (possibly biased) coin with P (head) =
p that are needed to get the k th head;
(iii) the number of black sheep in a random sample of n sheep drawn without
replacement from a population of N (≥ n) sheep containing r black sheep;
(iv) the (limiting) number of heads in a very large number (n) of independent
tosses of a highly biased coin with a very small P (head) = p so that np is
moderate.
We will briefly describe the resulting random variable and its properties in
each of these cases.

If X is the number of heads in n independent tosses of a coin whose P (head)


in each toss is p ∈ (0, 1), the p.m.f. of X is given by
P (X = x) =n Cx px (1 − p)n−x , for x = 0, 1, . . . , n. (3.9)
This can be easily derived using the independence between tosses and the
fact that there are n Cx different permutations of x identical H’s and (n − x)
identical T ’s that give rise to the same value of X. This is known as the
Binomial(n, p) p.m.f., which is also called a Bernoulli trial for n = 1. For this
2
X, µX = E(X) = np, σX = np(1 − p) and MX (t) = (1 − p + pet )n .

If X is the number of independent tosses of a coin with P (head) = p that are


needed to see the first head, the p.m.f. of X is given by
P (X = x) = p(1 − p)x−1 , for x = 1, 2, . . . . (3.10)
This is once again easy to derive using the independence between tosses. This
is known as the Geometric(p) p.m.f., which has mean µX = p1 , variance σX2
=
t
1−p pe
p2 and MGF MX (t) = 1−(1−p)e t . An interesting and useful feature of this

distribution is its memoryless property. Given that no head has appeared until
the k th toss, the conditional probability that there will be no head until the
(k + m)th toss is the same as the (unconditional) probability of seeing no
head in the first m tosses, for any two positive integers k and m. That is,
P (X > k + m | X > k) = P (X > m) = (1 − p)m .

© 2008 by Taylor & Francis Group, LLC


RANDOM VARIABLES AND PROBABILITY DISTRIBUTIONS 47
If X is the number of independent tosses of a coin with P (head) = p that are
needed to see the rth head (r ≥ 1), the p.m.f. of X is given by
P (X = x) =x−1 Cr−1 pr (1 − p)x−r , for x = r, r + 1, . . . . (3.11)
This is equally easy to derive using the independence between tosses and
the fact that the first r − 1 heads could occur anywhere among the first
x − 1 tosses. This is known as the Negative Binomial(r, p) p.m.f., with mean
pet
µX = pr , variance σX
2
= r(1−p)
p2 and MGF MX (t) = ( 1−(1−p)e r
t ) . It is related

to the Geometric(p) p.m.f. in the sense that if Y1 , . . . , Yr are independent and


identically
Pr distributed (i.i.d.) random variables each having a Geometric(p)
p.m.f., i=1 Yi will have a Negative Binomial(r, p) distribution.
Suppose a population of N sheep consists of r black sheep and N − r white
sheep. If a random sample of n (≤ r) is drawn without replacement from this
population and X is the number of black sheep in this sample, then X has
the p.m.f.
P (X = x) = (r Cx )(N −r Cn−x )/N Cn , for x = 0, 1, . . . , n. (3.12)
This is not difficult to see, in view of the Pascal’s triangle and the associated
formula for finding the number of different subcollections. This is known as
the Hypergeometric (N, r, n) p.m.f., with mean µX = nr 2
N and variance σX =
nr(N −r)(N −n)
N 2 (N −1) . The MGF does not simplify to a convenient expression, but
can still be written down as a summation.
If X counts how many heads there are in a very large number n of independent
tosses of a highly biased coin with P (head) = p very small such that np is
moderate (call it λ), then the binomial p.m.f. of X can be well-approximated
by the following p.m.f.:
e−λ λx
P (X = x) = , for x = 0, 1, . . . . (3.13)
x!
This can be shown formally by taking the double limit of a Binomial(n, p)
p.m.f. as n → ∞ and p → 0 in such a way that np remains a constant λ.
2
This is called the Poisson(λ) p.m.f., with mean µX = λ, variance σX = λ
λ(et −1)
and MGF MX (t) = e . This is a widely used probability model for
random experiments producing count data, except that it is only suitable for
datasets with the mean approximately equal to the variance. However, there
are ways to modify this p.m.f. so that it can accommodate datasets with
the variance higher or lower than the mean (see, for example, Shmueli et al.,
Applied Statistics (2005)). Also, the Poisson(λ) p.m.f. has the reproductive
property that if X1 and X2 are independent random variables with Xi ∼
Poisson(λi ), then X1 + X2 ∼ Poisson(λ1 + λ2 ).
Now, the continuous case. A vast majority of real-life random experiments
that produce continuous random variables can be modeled by the following
probability density functions, in addition to the Uniform[a, b] p.d.f. discussed
(b−a)2
a short while ago (with mean a+b 2 and variance 12 ).

© 2008 by Taylor & Francis Group, LLC


48 PROBABILISTIC AND MODEL-BASED LEARNING
A random variable X is said to have a Normal (or Gaussian, after Carl
2
Friedrich Gauss) p.d.f. with mean µX ∈ R and variance σX (σX > 0) if
its p.d.f. is given by
1 2 2
f (x) = 2 0.5
e−(x−µ) /2σ , for x ∈ (−∞, ∞), (3.14)
(2πσ )
where we have omitted the subscript X to reduce clutter. The MGF of X
2 2
is MX (t) = etµX +t σX /2 . The special case with mean 0 and variance 1 is
called a standard normal p.d.f. and the associated random variable is usually
2
denoted by Z. The N (µX , σX ) p.d.f. has the linearity property, that is, X ∼
N (µX , σX ) =⇒ aX + b ∼ N (aµX + b, a2 σX
2 2
). This can be shown by first deriv-
ing the MGF of aX + b from that of X and then using “MGF fingerprinting.”
As a result, X ∼ N (µX , σX 2
) =⇒ X−µ σX
X
∼ N (0, 1) or standard normal. The
X−µX
ratio σX is usually called the z-score of X. Another celebrated result that
plays a fundamental role in probability and statistics is the central limit theo-
rem (CLT). In its most simplified form, it basically says that if {X1 , . . . , Xn } is
a random sample from some p.m.f. or p.d.f. having mean µX and standard de-
viation σX (i.e., if X1 , . . . , Xn are i.i.d. random variables from the same p.m.f.
or p.d.f.), then the p.d.f. of ( n1 ni=1 Xi − µX )/(σX /n 2 ) approaches that of
P 1

N (0, 1) in the limit as n → ∞. PnIn other words, for n sufficiently large, the
p.d.f. of the z-score of X̄ = n1 i=1 Xi can be well-approximated by a stan-
dard normal p.d.f. This has far-reaching consequences, one of which is the
large-sample normal approximation to discrete p.m.f.’s. A normal p.d.f. also
2
has the reproductive property Pnthat if Xi ∼ N (µ Pin, σi ) for
Pin = 1, . . . , n and they
are independent, the sum i=1 Xi has a N ( i=1 µi , i=1 σi2 ). Since proba-
bility computation using a normal p.d.f. is not possible analytically, extensive
tables are available for ready reference.
A random variable X is said to have an Exponential(β) p.d.f. if the p.d.f. is
given by
1 x
f (x) = e− β , for x ∈ (0, ∞) and β > 0. (3.15)
β
This p.d.f. has mean β, variance β 2 and MGF (1 − βt)−1 for t < β1 . The
t
c.d.f. is F (t) = 1 − e− β . Two interesting and useful facts about this p.m.f.
are (a) its memoryless property and (b) its relation to the geometric p.m.f. s
mentioned earlier. The fact that P (X > t + s | X > t) = P (X > s) = e− β
for any positive t and s is known as the memoryless property (verify it).
If Y is defined as the largest integer ≤ X (also called the “floor” of X),
1
then Y + 1 has a Geometric(p) p.m.f. with p = 1 − e− β . This is because
1 1
P (Y + 1 = y + 1) = P (Y = y) = P (y ≤ X < y + 1) = (1 − e− β )e− β y .
Sometimes the exponential p.m.f. is reparametrized by setting λ = β −1 , so
the p.d.f. looks like f (x) = λe−λx I(x > 0) with mean λ−1 and variance λ−2 .
If X1 , . . . , Xn are i.i.d. random variables having the p.d.f. in (3.15),
Pn then the
minimum of {Xi }ni=1 also has an exponential p.d.f. and the sum i=1 Xi has
a Gamma((n, β)) p.d.f.

© 2008 by Taylor & Francis Group, LLC


RANDOM VARIABLES AND PROBABILITY DISTRIBUTIONS 49
A random variable X is said to have a Gamma(α, β) p.d.f. if the p.d.f. is given
by
1 x

α
e− β xα−1 for x > 0, α > 0 and β > 0, (3.16)
Γ(α)β
R∞
where Γ(α) = 0 e−y y α−1 dy is the gamma function with the property that
Γ(ν + 1) = νΓ(ν). This, in particular, implies that Γ(n + 1) = n! for any
nonnegative integer n. The parameter α is called the shape parameter as the
density curve has different shapes for its different values. Its mean is αβ,
variance is αβ 2 and MGF is (1 − βt)−α for t < β1 . Clearly, an exponential
p.d.f. is a special case of (3.16) with β = 1. Also, for α = n2 and β = 2, it
is called a chi-squared (χ2 ) p.d.f. with n degrees of freedom, which is widely
useful because of the connection that Z ∼ N (0, 1) =⇒ z 2 ∼ χ2 with 1 degree
of freedom. The Gamma(α, β) p.d.f. has the reproductive property in the sense
Pn if Xi ∼ Gamma(α
that Pn i , β) for i = 1, . . . , n and they are independent, then
i=1 X i ∼ Gamma( i=1 αi , β).

A random variable X is said to have a Beta(a, b) p.d.f. if the p.d.f. looks like
Γ(a + b) a−1
f (x) = x (1 − x)b−1 , for x ∈ (0, 1), a > 0 and b > 0. (3.17)
Γ(a)Γ(b)
a
This p.d.f. has mean a+b and variance (a+b)2ab
(a+b+1) . Notice that for a = b = 1,
this is nothing but the Uniform[0,1] p.d.f. It also has a connection with the
Gamma(α, β) p.d.f. To be precise, if X ∼ Gamma(α1 , β), Y ∼ Gamma(α2 , β)
X
and X and Y are independent, the ratio X+Y will have a Beta(a, b) p.d.f.
with a = α1 and b = α2 . More generally, if X1 , . . . , Xk , Xk+1 , . . . , Xm are
independent random variables with Xi ∼ Gamma(αi , β) (β > 0 and αi >
Pk Pm
0 for i = 1, . . . , n), then the p.d.f. of i=1 Xi / i=1 Xi is Beta(a, b) with
Pk Pm
a = i=1 αi and b = i=k+1 αi .
So far we have dealt with individual random variables. We now move on to
the case where we have a bunch of them at once. If X and Y are two discrete
random variables, then the joint p.m.f. of the random vector (X, Y ) is given
by P ({X = x} ∩ {Y = y}) for all value-pairs (x, y). It can be imagined as a
two-dimensional table with the values of X and Y being listed along the left
margin and top margin respectively and the joint probabilities being displayed
in various cells. So each row of this table corresponds to a particular value of
X and each column corresponds to a particular value of Y . If we collapse this
table column-wise, i.e., add all the probabilities displayed in each row, thereby
ending up with a single column of probabilities for the values of X, this single
column of probabilities gives us the marginal p.m.f. of X. Similarly, by col-
lapsing the table row-wise (i.e., summing all the probabilities in each column),
we get the marginal p.m.f. of Y . Now, for each fixed value xi of X, the condi-
P (Y =yj and X=xi ) m
tional p.m.f. of Y given that X = xi is nothing but { P (X=xi ) }j=1 ,
assuming that Y takes the values y1 , . . . , ym . Similarly, for each fixed value yi
of Y , the conditional p.m.f. of X given that Y = yi can be defined. The raw

© 2008 by Taylor & Francis Group, LLC


50 PROBABILISTIC AND MODEL-BASED LEARNING
and central moments and the MGF of X computed using such a conditional
p.m.f. will be called its conditional moments and conditional MGF. Similar is
the terminology for Y .
All these concepts can be easily generalized to the case of an n × 1 ran-
dom vector (X1 , . . . , Xn ). The joint p.m.f.Tof these can be imagined as an
n
n-dimensional table, whose cells contain P { i=1 (Xi = xi )} for various values
xi of Xi (i = 1, . . . , n).We can now talk about several types of marginal and
conditional p.m.f.’s, such as the joint marginal p.m.f. of Xi1 , . . . , Xik which is
obtained by collapsing the n-dimensional table w.r.t. all other indices except
i1 , . . . , ik , or the joint conditional p.m.f. of Xi1 , . . . , Xik given Xj1 , . . . , Xjl for
two disjoint subsets of indices {i1 , . . . , ik } and {j1 , . . . , jl } which is obtained
by dividing the joint marginal p.m.f. of Xi1 , . . . , Xik , Xj1 , . . . , Xjl with that of
Xj1 , . . . , Xjl . We can also talk about joint moments (marginal or conditional).
For example, the (j1 , . . . , jk )th order joint raw moment of Xi1 , . . . , Xik is de-
Qk
fined as E( s=1 Xijss ), where the expected value is based on the joint marginal
p.m.f. of Xi1 , . . . , Xik . In the case of a conditional joint moment, this expected
value would be based on the conditional joint p.m.f. of Xi1 , . . . , Xik given an-
other disjoint set of variables.
In a situation where we have a bivariate random vector (X, Y ), the numerical
summary that describes the nature (i.e., direction) of the joint variability of X
and Y is called the covariance (denoted by COV(X, Y ) or σXY ). It is defined
as
COV (X, Y ) = E{(X − µX )(Y − µY )} = E(XY ) − µX µY . (3.18)
A positive value of it indicates a synergistic or direct relation between X and
Y , i.e., in general X increases if Y does so. A negative covariance, on the other
hand, shows an antagonistic or inverse relation whereby an increase in X will
be associated with a decrease in Y in general. In order to measure the strength
of the linear association between X and Y (which is difficult to assess from
the covariance since it is an absolute measure, not a relative one), we convert
the covariance to correlation (denoted by ρXY ). It is defined as
σXY
ρXY = , (3.19)
σX σY
where σX and σY are the marginal standard deviations of X and Y . It is
bounded below and above by −1 and 1 respectively (which is easy to see by
1 1
the Cauchy-Schwarz inequality that says: E | U V |≤ (E(U 2 )) 2 (E(V 2 )) 2 for
any random variables U and V ), so that any value close to its boundaries is
considered evidence of a strong linear association between X and Y . Values
close to the center of this range testify to a relatively weak linear association.
In the case where we have an n × 1 random vector, there are n C2 = n(n−1) 2
pairwise covariances to talk about. If we construct an n × n matrix Σ whose
(i, j)th entry is COV (Xi , Xj ) = σij (say), then it will be a symmetric matrix
with the ith diagonal entry being the variance of Xi or σi2 (i = 1, . . . , n).
This matrix is referred to as the variance-covariance matrix or the dispersion

© 2008 by Taylor & Francis Group, LLC


RANDOM VARIABLES AND PROBABILITY DISTRIBUTIONS 51
matrix of the random vector. Sometimes it is more convenient to work with the
matrix obtained by dividing the (i, j)th entry of Σ with σi σj (i.e., the product
of the standard deviations of Xi and Xj ). This symmetric n × n matrix with
all diagonal entries = 1 is called the correlation matrix of (X1 , . . . , Xn ) due to
obvious reasons. In case the dispersion matrix Σ has an inverse (an n×n matrix
W is said to be the inverse of another n × n matrix W ∗ if W W ∗ = W ∗ W = I,
the n × n identity matrix with all diagonal entries = 1 and all off-diagonal
entries = 0), the inverse is called the precision matrix. Here are some examples.

Example 3.19. Suppose the joint p.m.f. of (X, Y ) is given by the table

5 10 15 20
1 1 1 1
0 48 48 12 8
1 1 1 1
1 12 12 6 6
1 1 1 1
2 8 12 48 48

Here, the marginal p.m.f. of X is actually Binomial(2, 21 ) and that of Y is

value 5 10 15 20
11 9 13 15
prob 48 48 48 48

So X has mean=(2)(1/2)=1 and variance=(2)(1/2)(1-1/2)=1/2, and those for


Y are 13.33 and respectively. The conditional p.m.f. of X given that Y = 15
4 8
is P (X = 0 | Y = 15) = 13 , P (X = 1 | Y = 15) = 13 and P (X = 2 | Y =
1
15) = 13 .
Example 3.20. An agency that conducts nationwide opinion polls has decided
to take a random sample (with replacement) of 1000 people from the entire
U.S. population and ask each sampled individual about the effectiveness of the
Kyoto protocol to control global warming. Each individual can say “effective”
or “not effective” or “no opinion” (let us classify answers such as “Don’t even
know what the Kyoto protocol is!” as “no opinion” for the sake of simplicity).
If the true (but unknown) percentage of people in the U.S. who think that
the Kyoto protocol would be effective is 25%, that of those who consider
it ineffective is 35% and the rest are in the third category, what are the
chances that in a sample of size 1000, half will have no opinion (including
those who are unaware of the whole issue) and an equal number of people
will consider the protocol effective or ineffective? Let X and Y be the number
of sampled individuals in the “effective” and “ineffective” groups respectively.
Then the answer will come from the joint p.m.f. of (X, Y ). What is it? Since we
are dealing with randomly sampled individuals from a huge population, it is
reasonable to assume that each person’s opinion is independent of everybody

© 2008 by Taylor & Francis Group, LLC


52 PROBABILISTIC AND MODEL-BASED LEARNING
else’s. Since there are three possible answers, asking each individual about the
Kyoto protocol is like tossing an unbalanced “three-sided coin” for which, the
probabilities associated with the three sides are 0.25, 0.35 and 0.4. Also, since
it is sampling without replacement, these probabilities remain unchanged from
“toss” to “toss.” So, just as the probability of k heads in n tosses of a regular
(i.e., two-sided) coin with P (head) = p is n Ck pk (1 − p)n−k (see 3.9), where
the coefficient n Ck is nothing but the number of different rearrangements of
k identical H’s and n − k identical T ’s, the answer in the present case will be
1000!
P (X = 250,Y = 250) = (0.25)250 (0.35)250 (1−0.25−0.35)500,
(250!)(250!)(500!)
where the coefficient in front is the number of different rearrangements of
250 identical “yes” answers, 250 identical “no” answers and 500 identical “no
opinion” answers. In general, when the sample-size is n, P (X = k1 and Y =
k2 ) has the same expression with 250 and 250 replaced by k1 and k2 for any k1
and k2 that add up to something ≤ n. This is known as the Trinomial(n, p1 , p2 )
p.m.f. (here n = 1000, p1 = 0.25 and p2 = 0.35). It can be easily extended
to the situation where the question has m(> 3) possible answers and the
true (but unknown) population-proportions
Pm associated with those answers are
p1 , . . . , pm respectively ( i=1 pi = 1). If Xi counts the number of sampled
individuals that gave the ith answer (i = 1, . . . , m − 1), then the joint p.m.f.
of the Xi ’s looks like
m−1
! Pm−1
n! Y
xi n− xi
P (x1 , . . . , xm−1 ) = Pm−1 pi pm i=1 ,
(x1 !) . . . (xm−1 !)((n − i=1 xi )!) i=1
Pm−1
for any nonnegative integers x1 , . . . , xm−1 with i=1 xi ≤ n. This is called
the Multinomial(n, p1 , . . . , pm−1 ) p.m.f. Marginally, each Xi is Binomial(n, pi ),
so that its mean is npi and variance is npi (1 − pi ). The covariance between Xi
and Xj (i 6= j) is −npi pj , which intuitively makes sense since a large value of
Xi will force Xj to be small in order to keep the sum constant (= n).
For continuous random variables, the analogous concepts are defined as fol-
lows. The joint p.d.f. f (x1 , . . . , xn ) of the continuous random variables X1 , . . . ,
Xn is a nonnegative-valued function defined on a subset D of Rn such that
its n-fold integral over D is 1. The subset D, which is the Cartesian prod-
uct of the value-ranges of the individual Xi ’s, is called the support of this
joint p.d.f. The marginal joint p.d.f. of the random variables Xi1 , . . . , Xik is
obtained by integrating the joint p.d.f. with respect to all the other variables
over their full ranges. The conditional joint p.d.f. of a subcollection of random
variables {Xi1 , . . . , Xik } given another disjoint subcollection {Xj1 , . . . , Xjl }
is obtained by dividing the marginal joint p.d.f. of the combined collection
Xi1 , . . . , Xik , Xj1 , . . . , Xjl by that of {Xj1 , . . . , Xjl } only. The marginal and
conditional joint moments are the expected values of products of random vari-
ables computed using their marginal and conditional joint p.m.f.’s respectively.
Pairwise covariances and correlations are defined in the same way as in (3.18)

© 2008 by Taylor & Francis Group, LLC


RANDOM VARIABLES AND PROBABILITY DISTRIBUTIONS 53
and (3.19). Here is an example.

Example 3.21. A random vector X = (X1 , X2 ) is said to have a bivari-


ate normal joint p.d.f. with mean vector µ = (µ1 , µ2 ) and dispersion matrix
σ12

ρσ1 σ2
Σ= for some σ1 > 0, σ2 > 0 and ρ ∈ (−1, 1) if its joint
ρσ1 σ2 σ22
p.d.f. looks like
1
e− 2 (X−µ)Σ (X−µ) ,
1 −1 t
f (x1 , x2 ) = 2 1/2
2πσ1 σ2 (1 − ρ )
the superscript “t” meaning “transpose.” The exponent − 12 (X − µ)Σ−1 (X −
µ)t
" 2  2 #
1 x1 − µ1 (x1 − µ1 )(x2 − µ2 ) x2 − µ2
=− − 2ρ +
2(1 − ρ2 ) σ1 σ1 σ2 σ2
is a quadratic form in x1 and x2 . It can be shown by integrating this joint
p.d.f. with respect to x2 over its full range (−∞, ∞) that the marginal p.d.f.
of X1 is Normal(µ1 , σ12 ). Similarly, integrating out the variable x1 will yield
the marginal p.d.f. of X2 , which is Normal(µ2 , σ22 ). From the structure of the
dispersion matrix, it should be clear that the correlation between X1 and X2
is ρ. Also, the conditional p.d.f. of X2 given X1 = x1 is normal with mean
and variance
σ2
E(X2 | X1 = x1 ) = µ2 + ρ (x1 − µ1 ); Var(X2 | X1 = x1 ) = σ22 (1 − ρ2 ).
σ1
The above formula for E(X2 | X1 = x1 ) is called the regression of X2 on X1 .
Likewise, the conditional p.d.f. of X1 given X2 = x2 will be normal with mean
E(X1 | X2 = x2 ) = µ1 + ρ σσ12 (x2 − µ2 ) and variance Var(X1 | X2 = x2 ) =
σ12 (1−ρ2 ). All these can be generalized to an n×1 random vector (X1 , . . . , Xn )
whose joint p.d.f. will be called multivariate normal (MVN) with mean vector
µ = (µ1 , . . . , µn ) and dispersion matrix Σn×n . The (i, j)th and (j, i)th entries
of Σ would both be ρij σi σj , where ρij is the correlation between Xi and Xj .
Once again, the marginal p.d.f.’s and the conditional p.d.f.’s will all be normal.
The MVN(µ, Σ) joint p.d.f. looks like
1
e− 2 (X−µ)Σ (X−µ)t
1 −1
f (x1 , . . . , xn ) = ,
(2π)n/2 (| Σ |)1/2
where | Σ | denotes the determinant of Σ (see, for example, Leon (1998) for
the general definition of the determinant of a n × n matrix).
This MVN(µ, Σ) p.d.f. and its univariate version (3.14) are members of a much
more general class that includes many other familiar p.d.f.’s and p.m.f.’s such
as (3.13), (3.15) and (3.16). It is called the exponential family of distributions.
An n × 1 random vector X is said to have a distribution in the exponential
family if its p.d.f. (or p.m.f.) has the form
Pk
f (x) = c(θ)d(x)e i=1 πi (θ)ti (x) (3.20)

© 2008 by Taylor & Francis Group, LLC


54 PROBABILISTIC AND MODEL-BASED LEARNING
for some (possibly vector) parameter θ and some functions π1 , . . . , πk , t1 , . . . , tk ,
c and d. The vector (π1 (θ), . . . , πk (θ)) is called the natural parameters for
(3.20). Often (3.20) is written in a slightly different way as:
( k )
X
f (x) = exp πi (θ)ti (x) + C(θ) + D(x) , (3.21)
i=1

where C(θ) = ln c(θ) and D(x) = ln d(x). This is known as the canonical
form of the exponential family. Can you identify the natural parameters θ
and the functions C(.), D(.), πi (.) and ti (.) (i = 1, . . . , n) for the p.m.f.’s and
p.d.f.’s in (3.13)-(3.16)?
Two quick notes before we close our discussion of multivariate random vectors.
From the definition of covariance, it should be clear that two independent
random variables have zero covariance (and hence, zero correlation). So, if
the components of a random vector {X1 , . . . , Xn } are independent random
variables, their dispersion matrix Σ is diagonal (i.e., has zeroes in all off-
diagonal positions). However, the converse is not necessarily true. There exist
random vectors with dependent components that have diagonal dispersion
matrices (can you construct such an example?). Also, for a random vector
with independent components, the joint p.m.f. (or p.d.f.) turns out to be the
product of the individual p.m.f.’s (or p.d.f.’s). And in general, the joint p.d.f.
f (x1 , . . . , xn ) of a continuous random vector (X1 , . . . , Xn ) can be written as
f (x1 )f (x2 | X1 = x1 )f (x3 | X1 = x1 &X2 = x2 ) . . . f (xn | X1 = x1 , . . . , Xn−1
(3.22)
= xn−1 ), which is analogous to (3.2).
Next we turn to the relation between the p.m.f.’s (or p.d.f.’s) of two ran-
dom variables that are functionally related. We will explore some methods of
deriving the p.m.f. (or p.d.f.) of a function of a random variable that has a fa-
miliar p.m.f. or p.d.f. If we were only interested in computing expected values,
this would not be essential, since for a discrete random variable X with val-
ues x1 , x2 , . . . and correspondingPprobabilities p1 , p2 , . . ., the expected value of
Y = g(X) is simply E(g(X)) = i g(xi )pi . Likewise, for a continuous R random
variable X with support D and p.d.f. f (x), we have E(g(X)) = D g(x)f (x)dx.
But sometimes we do need to know the exact p.m.f. or p.d.f. of g(X) and there
are three main methods to derive it from that of X: (a) the c.d.f. method, (b)
the Jacobian method and (c) the MGF method. We illustrate each of these
by means of an example.

Example 3.22. Let X have an Exponential(β) p.d.f. Suppose we want to


derive the p.d.f. of Y = aX + b for some a > 0 and b ∈ R. Let us start with
its c.d.f. G(t) (say). G(t) = P (Y ≤ t) = P (aX + b ≤ t) = P (X ≤ t−ba ) =
(t−b)/a (t−b)
1 − e− β . So the p.d.f. of Y will be G′ (t) = aβ 1 − aβ
e . This is sometimes
called the negative exponential p.d.f. with location parameter b and scale pa-
rameter aβ.

© 2008 by Taylor & Francis Group, LLC


RANDOM VARIABLES AND PROBABILITY DISTRIBUTIONS 55
Example 3.23. We will once again derive the p.d.f. of Y = aX +b where X ∼
Exponential(β), but by a different method this time. If we call the mapping
X −→ aX + b = Y the forward transformation, the inverse transformation
will be Y −→ Y a−b = X. The Jacobian of this inverse transformation is the
d y−b 1
quantity | dy a |, which is simply a here. Now, if we write the p.d.f. of X
y−b
having replaced all the x’s in it by a and then multiply it with the Jacobian
(y−b)/a

obtained above, we get ( β1 e β )( a1 ). This is precisely the p.d.f. we got in
Example 3.22.

Example 3.24. It was mentioned earlier that moment generating functions


have a one-to-one correspondence with p.m.f.’s (or p.d.f.’s), so that “MGF fin-
2 2
gerprinting” is possible. For instance, an MGF of the form M (t) = etµ+t σ /2
2 2
corresponds only to a Normal(µ, σ ) p.d.f. So, if X ∼ Normal(µ, σ ), what is
the p.d.f. of Y = aX + b for some a > 0 and b ∈ R? Let us first find its MGF.
MY (t) = E(etY ) = E(et(aX+b) ) = E(etaX etb ) = etb E(etaX ), the last equality
following from the linearity property of expected values mentioned earlier in
this section. But E(etaX ) is nothing but the MGF of X evaluated at “ta,” i.e.,
2 2 2 2 2 2 2 2 2
it is MX (ta) = etaµ+t a σ /2 . So MY (t) = etb etaµ+t a σ /2 = et(aµ+b)+t a σ /2 .
This corresponds only to a Normal(aµ+b, a2σ 2 ) p.d.f., which must be the p.d.f.
of Y .

Example 3.25. Let X be a continuous random variable with a p.d.f. f (x)


and a (strictly monotonically increasing) c.d.f. F (t). What will be the p.d.f.
of Y = F (X)? Let us derive it via the c.d.f. method. The c.d.f. of Y is
G(t) = P (Y ≤ t) = P (F (X) ≤ t). Take some t ∈ (0, 1). If F −1 is the inverse
function of F (two functions h(x) and k(x) are called inverses of one another
if h(k(x)) = x for all x in the domain of k and k(h(x)) = x for all x in the do-
main of h), then P (F (X) ≤ t) = P (F −1 (F (X)) ≤ F −1 (t)) = P (X ≤ F −1 (t)).
But this is, by definition, F (F −1 (t)), which is nothing but t. In other words,
G(t) = t for all t ∈ (0, 1). Also, obviously, G(t) = 0 for t ≤ 0 and G(t) = 1
for t ≥ 1. Can you identify this c.d.f.? It should be clear from (3.6) that G(t)
is the Uniform(0,1) c.d.f. (verify it through differentiation). In other words,
F (X) has a Uniform(0,1) p.d.f. The transformation X −→ F (X) is known
as the probability integral transform. Turning it around, let us now start with
an X ∼ Uniform(0,1) and let Y = F −1 (X). What distribution will it have?
Its c.d.f. is P (Y ≤ t) = P (F −1 (X) ≤ t) = P (F (F −1 (X)) ≤ F (t)) = P (X ≤
F (t)) = F (t), the last equality following from the nature of the Uniform(0,1)
c.d.f. Hence we conclude that Y has the c.d.f. F (t).
This last example is particularly important in the context of statistical simu-
lation studies, since it enables one to generate random samples from various
probability distributions that have closed-form expressions for their c.d.f.’s. In
order to generate n i.i.d. random variables X1 , . . . , Xn from the Exponential(β)
p.d.f., simply generate n i.i.d. Uniform(0,1) random variables U1 , . . . , Un (which
computers can readily do) and set Xi = F −1 (Ui ) (i = 1, . . . , n), where

© 2008 by Taylor & Francis Group, LLC


56 PROBABILISTIC AND MODEL-BASED LEARNING
F (t) = 1 − e−x/β . Even if the c.d.f. is not strictly monotonically increasing (so
that its inverse does not exist), as is the case for discrete random variables,
the above technique can be slightly modified to serve the purpose.
We conclude this section by listing a number of useful probability inequalities
that are relevant to our book. The second one is a generalization of the Cauchy-
Schwarz inequality mentioned earlier.

Result 3.3. Let X and Y be random variables such that E(| X |r ) and
E(| Y |r ) are both finite for some r > 0. Then E(| X + Y |r ) is also finite
and E(| X + Y |r ) ≤ cr (E(| X |r ) + E(| Y |r )), where cr = 1 if 0 < r ≤ 1 or
cr = 2r−1 if r > 1. This is often called the cr inequality.

Result 3.4. Let p > 1 and q > 1 be such that 1p + 1q = 1. Then E(| XY |)
≤ (E(| X |p ))1/p (E(| Y |q ))1/q . This is well known as the Holder inequality.
Clearly, taking p = q = 2, we get the Cauchy-Schwarz inequality.

Result 3.5. For any number p ≥ 1, (E(| X + Y |p ))1/p ≤ (E(| X |p ))1/p +


(E(| Y |p ))1/p . This is popularly known as the Minkowski inequality.
r
Result 3.6. P (| X |≥ ε) ≤ E(|X| εr
)
for any ε > 0 and r > 0 such that
r
E(| X | ) is finite. This is known as Markov’s inequality. If Y is a random
variable with mean µ and standard deviation σ, then letting Y − µ and cσ
play the roles of X and ε respectively in the above inequality with r = 2, we
get: P (| Y − µ |≥ cσ) ≤ c12 . This is called the Chebyshev-Bienayme inequality
(or simply Chebyshev’s inequality).

3.4 Basics of Information Theory

Let X be a discrete random variable with values x1 , x2 , . . . and corresponding


probabilities p1 , p2 , . . . Then the entropy H of this p.m.f. (call it P ) is defined
as X
H(P ) = − pi log(pi ), (3.23)
i
where “log” denotes natural logarithm (although logarithm with base 2 is
used in some applications). It is easy to see that H(P ) is 0 when the p.m.f.
is degenerate (i.e., takes a single value with probability 1). It can also be
verified that the entropy is the maximum for an ‘equally likely’ p.m.f. where
all the pi ’s are the same. This indicates that H(P ) measures the “extent of
information” in a p.m.f. by assessing the “unevenness” in the probabilities.
The more “uneven” they are, the more “specialized information” we get about
the uncertainty in the associated random variable X. Notice that H(P ) is not
measuring the variability in the values of X as it does not involve the values
at all.

© 2008 by Taylor & Francis Group, LLC


BASICS OF INFORMATION THEORY 57
If we have two discrete random variables X and Y with the same support or
value-set {z1 , z2 , . . .} but different probabilities ({p1 , p2 , . . .} and {p∗1 , p∗2 , . . .}
respectively), we can define the relative entropy of one w.r.t. the other. De-
noting these two p.m.f.’s by PX and PY respectively, the two possible relative
entropies are defined as
X pi X p∗
HXkY (PX , PY ) = pi log ∗ , HY kX (PX , PY ) = p∗i log i . (3.24)
i
pi i
pi
These are also known as the Kullback-Leibler divergences between PX and PY .
HXkY and HY kX are not equal in general, and that is one of the reasons why
it is not a proper metric (or distance measure) between two p.m.f.’s, the other
reason being its failure to satisfy the triangle inequality. In any case, it is good
enough as a measure of the ‘dissimilarity’ between two p.m.f.’s, since it is 0
if and only if the two p.m.f.’s are identical. The fact that it is > 0 otherwise
2 3
1
can be verified using the power-series expansion log 1−x = x + x2 + x3 + . . .
for | x |< 1, which in particular implies that −log(1 − x) ≥ x.
The continuous counterparts of the entropy and the relative entropy are de-
fined analogously. For a continuous randomR variable X with support D and
p.d.f. f (x), the entropy is H(f ) = − D f (x)logf (x)dx. For two continuous
random variables X and Y with common support D and p.d.f.’s f (x) and g(x)
respectively, the two relative entropies are HXkY (f, g) = D f (x)log fg(x)
(x)
R
dx and
R g(x)
HY kX (g, f ) = D g(x)log f (x) dx.

Example 3.26. (Schervish (1996)). Let f (x) be the standard normal p.d.f.
and g(y) be the bilateral exponential or Laplace p.d.f. with parameters 0
and 1 (i.e., g(y) = 12 e−|y|) on R. Suppose X ∼ f (x) and Y ∼ g(y). Then
it can be shown that E(X 2 ) = 1, E(| X |) = ( π2 )1/2 , E(Y 2 ) = 2 and
E(| Y |) = 1. Since log fg(x) (x)
= 12 log π2 − 21 x2 + | x |, it turns out that
HXkY (f, g) = 21 log π2 − 12 + ( π2 )1/2 = 0.07209 and HY kX (g, f ) = − 21 log π2 =
0.22579. In other words, if our data actually come from a bilateral exponential
p.d.f., it is easier to figure out that they did not come from a standard normal
p.d.f. than the other way around.
Suppose, now, that X ∼ f (x) where f (x) involves an m-dimensional parame-
ter θ in some parameter space Θ. To emphasize this, we will write it as f (x; θ).
Suppose also that for each i (i = 1, . . . , m), the partial derivative of f (x; θ)
w.r.t. θi exists and the conditions necessary for interchanging the operations
Rof differentiation and integration are satisfied while takingththe derivative of
f (x; θ)dx w.r.t. each θi . Then m × m matrix whose (i, j) entry is the co-
variance between the partial derivatives of logf (x; θ) w.r.t. θi and θj is called
the Fisher information matrix (FIM) for θ based on X. The m × 1 random
vector whose ith coordinate is the partial derivative of logf (x; θ) w.r.t. θi is
often called the score function. So the FIM is simply the variance-covariance
matrix of the score function.

© 2008 by Taylor & Francis Group, LLC


58 PROBABILISTIC AND MODEL-BASED LEARNING
Example 3.27. Let X ∼ Binomial(n, p). Then its p.m.f. looks like P (X =
x) = n Cx px (1 − p)n−x and the log of it is log n Cx + xlogp + (n − x)log(1 − p).
d x−np
So dp log(p.m.f.) = xp − n−x
1−p = p(1−p) . So the Fisher information in this case is
n
p(1−p) . Since p ∈ (0, 1), the largest value of p(1 − p) is 0.25, which corresponds
to the minimum Fisher information. The closer p is to 0 or 1, the higher is
the information.

3.5 Basics of Stochastic Processes

Suppose you are a meteorologist at a local radio station and you read your
weather bulletin every half hour around the clock everyday, which includes a
report on current weather conditions. The weather condition that you report
at a particular time of the day (say, 7:00 A.M.) is, in some sense, a ‘random
variable’ because it can be different on different days (sunny, foggy, rainy,
muggy, clear but cool, etc.). Perhaps today it is sunny at that early morning
hour, but 24 hours from now, it will be raining at 7:00 A.M. In other words,
there may be a transition from one state of weather to another in the 24-
hour period. A similar transition may occur between tomorrow and the day
after tomorrow. So your life-long collection of weather reports at 7:00 A.M.
for that radio station (assuming that you did not get a better job!) is nothing
but a sequence of random variables, each of which takes ‘values’ in the same
‘value-set’ and successive random variables in this sequence may have different
‘values.’ Also, the weather condition at 7:00 A.M. today may be influenced
by how the weather was 24 hours ago or 48 hours ago, but it is unlikely to
be affected by the morning weather condition a fortnight ago or a month
ago. In other words, it is reasonable to assume that the ‘value’ of any random
variable in your sequence is dependent on a limited number of adjacent random
variables in the recent past, but not on the entire “history.”
More formally, a sequence of random variables {X1 , X2 , X3 , . . .} with the same
support or value-set (say, V = {v1 , v2 , v3 , . . .}) is called a stochastic process. V
is called its state space. The index i = 1, 2, 3, . . . usually refers to time. Many
stochastic processes have the property that for any indices i and j, the condi-
tional probability of Xi = vj given the entire past history (i.e., X1 , . . . , Xi−1 )
is only a function of Xi−1 , . . . , Xi−m for some fixed m. If m = 1, the stochas-
tic process is called a Markov chain (after the famous Russian mathematician
A.A. Markov). For a Markov chain, the conditional probabilities of state-to-
(i)
state transitions, i.e., P (Xi = vj | Xi−1 = vk ) = pkj (say) are often assumed
to be independent of the time-index i so we can drop the superscript “(i).”
In that case, it is called a time-homogeneous Markov chain. For such a chain,
these pkj ’s can be arranged in a matrix A whose (k, j)th entry is pkj . This A is
called the one-step transition matrix. Each row of A sums up to 1, since there
will definitely be a transition to some state from the current state. Such a ma-
trix is called a row stochastic matrix. For some Markov chains, the columns
of A also add up to 1 (i.e., a transition is guaranteed to each state from some

© 2008 by Taylor & Francis Group, LLC


BASICS OF STOCHASTIC PROCESSES 59
other state). In that case, it is called a doubly stochastic matrix. Notice that,
although the current state of a Markov chain only has a direct influence on
where the chain will be at the very next time-point, it is possible to com-
pute probabilities of future transitions (e.g., 2-step or 3-step transitions) by
th
multiplying the
P matrix A with itself repeatedly. For example, the (k, j) en-
2
try of A is i pki pij and this is nothing but P (Xn+2 = vj | Xn = vk ). To
understand why, write it as
P
P (Xn+2 = vj & Xn = vk ) P {(Xn+2 = vj ) ∩ (Xn+1 = vi ) ∩ (Xn = vk )}
= i
P (Xn = vk ) P (Xn = vk )
and notice that the latter quantity is nothing but
X
P {Xn+2 = vj | (Xn+1 = vi ) ∩ (Xn = vk )}P (Xn+1 = vi | Xn = vk ),
i
P
P property, is i P (Xn+2 = vj | Xn+1 = vi )P (Xn+1 =
which, by the Markov
vi | Xn = vk ) = i pij pki . Similarly, it can be shown that P (Xn+m = vj |
Xn = vk ) is the (j, k)th entry of Am . Now we will see some examples.

Example 3.28. In a laboratory, a certain kind of bacteria are grown in a


nutrient-rich medium and monitored every half hour around the clock. The
bacteria can either be in a dormant state (call it state 1) or a vegetative growth
state (state 2) or a rapid cell division state (state 3), or it can be dead (state
4). Suppose it is reasonable to assume that the observed state of the bacteria
colony at any particular inspection time is determined solely by its state at
the previous inspection time. If the colony is in state 1 now, there is a 60%
chance that it will move to state 2 in the next half hour, a 30% chance that it
will move to state 3 and a 10% chance that it will move to state 4. If it is in
state 2 at the moment, the chances of it moving to state 1, state 3 and state
4 in the next half hour are 70%, 25% and 5% respectively. If it is in state 3
at present, the chances of it moving to state 1, state 2 and state 4 are 20%,
78% and 2% respectively. However, once it gets to state 4, there is no moving
back to any other state (such a state is known as an absorbing barrier). So
the one-step transition probability matrix for this Markov chain is
0 0.6 0.3 0.1
 
 0.7 0 0.25 0.05 
A=
 
 0.2 0.78 0 0.02 

0 0 0 1
Notice that the above transition scheme does not allow any “self-loop” for the
states 1, 2 and 3, but it would if the first three diagonal entries were positive.
In any case, the two-step transition probabilities will be given by A2 which is
    
0 0.6 0.3 0.1 0 0.6 0.3 0.1 0.48 0.234 0.15 0.136
 0.7 0 0.25 0.05  0.7 0 0.25 0.05 = 0.05 0.615 0.21 0.125 
0.2 0.78 0 0.02 0.2 0.78 0 0.02 0.546 0.12 0.255 0.079
    
0 0 0 1 0 0 0 1 0 0 0 1

© 2008 by Taylor & Francis Group, LLC


60 PROBABILISTIC AND MODEL-BASED LEARNING
Example 3.29. Here is a Markov chain with a countably infinite state space.
Suppose an ant is crawling on an infinite sheet of graphing paper that has an
one-inch grid (i.e., has horizontal and vertical lines printed on it with each
two consecutive horizontal or vertical lines being 1 inch apart). Starting from
the origin at time 0, the ant crawls at a speed of an inch a minute and at
each grid-point (i.e., the intersection of a vertical and a horizontal line), it
randomly chooses a direction from the set { left, right, vertically up, vertically
down }. If we observe the ant at one-minute intervals and denote its position
after i minutes by Xi , then {X1 , X2 , . . .} is a Markov chain with state space
{(j, k) : j ∈ Z, k ∈ Z}, where Z is the set of all integers. Given that it is
currently at the grid-point (j ∗ , k ∗ ), the one-step transition probability to any
of its four nearest neighbor grid-points is 41 and the rest are all zeroes. This
is known as a two-dimensional random walk.
The k-step transition probability matrix (k ≥ 1) of a Markov chain is filled
with the conditional probabilities of moving from one state to another in
k steps, but what about the unconditional probabilities of being in various
states after k steps? To get those, we need an initial distribution for the chain
which specifies the probabilities of it being in various states at time 0. In
our bacteria colony example, suppose the probability that the colony is in a
dormant state at time 0 is π0 (1) = 0.7, that it is in a vegetative growth state
is π0 (2) = 0.2 and that it is in a rapid cell-division state is π0 (3) = 0.1 (π0 (4)
being zero). Let us write it as π = (0.7, 0.2, 0.1, 0). Then the (unconditional)
probability that the chain will be in a dormant state (state 1) at time 1 is
P4
i=1 P (state 1 at time 1 & state i at time 0)
4
X
= P (state 1 at time 1 | state i at time 0)P (state i at time 0), (3.25)
i=1
P4
which is nothing but i=1 ai1 π0 (i) or the first entry of the 4 × 1 vector πA. In
this case, it is 0.16. Similarly, the (unconditional) probability that the chain
will be in state j (j = 2, 3, 4) is the j th entry of πA. It should be clear from
(3.25) that the (unconditional) probabilities of being in various states at time
k are given by πAk .
A Markov chain with a finite state-space is said to be regular if the matrix Ak
has all nonzero entries for some k ≥ 1. One can prove the following important
result about regular Markov chains (see, for example, Bhat (1984)):

Result 3.7. Let {X1 , X2 , . . .} be a regular Markov chain with an m × m one-


step transition probability matrix A. Then there exists an m × m matrix A∗
with identical rows and nonzero entries such that limk→∞ Ak = A∗ .
The entries in any row of this limiting matrix (with identical rows) are called
the steady-state transition probabilities of the chain. Let us denote the (i, j)th
entry a∗ij of this matrix simply by a∗j , since it does not vary with the row-
index i. The vector (a∗1 , . . . , a∗m ) represents a p.m.f. on the state space, since

© 2008 by Taylor & Francis Group, LLC


BASICS OF STOCHASTIC PROCESSES 61
Pm ∗
j=1 aj = 1. It is called the steady state distribution (let us denote it by Π).
If k is large enough so that Ak is equal to or very close to A∗ , multiplying
Ak with A will yield A∗ again because Ak A = Ak+1 will also be exactly or
approximately equal to A∗ . Since the rows of A∗ are nothing but Π, this ex-
plains the following result:

Result 3.8. Let {X1 , X2 , . . .} be a regular Markov chain with one-step tran-
sition matrix A. Its steady-state distribution Π can be obtained by solving
the system of equations: ΠA = Π, Π1t = 1 (where 1t is the m × 1 column
vector of all ones).
 
0.6 0.4
Example 3.29. Consider a two-state Markov chain with A = .
0.2 0.8
In order to find its steady-state distribution, we need to solve the equations
0.6a∗1 + 0.2a∗2 = a∗1 , 0.4a∗1 + 0.8a∗2 = a∗2 and a∗1 + a∗2 = 1. The solutions are
a∗1 = 31 and a∗2 = 23 .

We conclude our discussion of Markov chains by stating a few more results


and introducing a few more concepts.

Result 3.9. Let {X1 , X2 , . . .} be a regular Markov chain with steady-state


distribution Π = (a∗1 , . . . , a∗m ). If τi denotes the time taken by the chain to
return to state i, given that it is in state i right now, then E(τi ) = a1∗ for
i
i = 1, . . . , m.

Result 3.10. Recall from Example 3.28 that a state i is called an absorbing
barrier if the (i, i)th entry in the one-step transition probability matrix A is 1.
Let B be the set of all absorbing barriers in the (finite) state space of a Markov
chain. Assume that there is a path from every state outside B to at least one
state in B (a path being a sequence of states i1 i2 . . . iL such that pij ij+1 > 0
for 1 ≤ j ≤ L − 1). Then, letting νs denote the time needed by the chain to go
P (k)
from a state s outside B to some state in B, we have: P (νs ≤ k) = r∈B pir ,
(k)
where pir is the (i, r)th element of Ak . This νs is often called the time to
absorption of a non-absorbing state s.

For any state s in the state space of a Markov chain {X1 , X2 , . . .}, define
(0) (k) (k−1) (k)
Ts = 0 and Ts = inf{n > Ts : Xn = s} for k ≥ 1. This Ts is usually
(1)
known as the time of the k th return to s. Let ηrs = P (Ts < ∞ | X0 = r).
(k) (k−1)
Then intuitively it should be clear that P (Ts < ∞ | X0 = r) = ηrs ηss .
In other words, if we start at r and want to make k visits to s, we first need
to go to s from r and then return k − 1 times to s. A state s is said to be
recurrent if ηss = 1. If ηss < 1, it is called transient. A subset ∆ of the state
space is called irreducible if r ∈ ∆ and s ∈ ∆ =⇒ ηrs > 0. A subset ∆∗ of the
state space is called closed if r ∈ ∆∗ and ηrs > 0 =⇒ s ∈ ∆∗ .

© 2008 by Taylor & Francis Group, LLC


62 PROBABILISTIC AND MODEL-BASED LEARNING
Result 3.11. (Contagious nature of recurrence). If r is a recurrent state and
ηrs > 0, then s is recurrent as well and ηsr = 1.

Result 3.12. (Decomposition of the recurrent states). If R = {r : ηrr = 1} is


the collection of recurrent states in a state space, then R can be written as a
disjoint union ∪i Ri where each Ri is irreducible and closed.
A stochastic process {X0 , X1 , X2 , . . .} is called stationary if for any two non-
negative integers k and n, the joint distributions of the random vectors (X0 , . . . ,
Xn ) and (Xk , . . . , Xk+n ) are the same. Let {X0 , X1 , X2 , . . .} be a Markov
chain with steady-state distribution Π = (a∗1 , a∗2 , . . .). If the initial distribu-
tion (i.e., the distribution of X0 ) is also Π, then the chain will be stationary.
This, incidentally, is the reason why the steady-state distribution is also often
called the stationary distribution.
Suppose a Markov chain {X1 , X2 , . . .} has a stationary distribution Π =
(a∗1 , a∗2 , . . .) such that a∗i > 0 for all i. It can be shown that all its states
will be recurrent and we will have a decomposition of the state space as sug-
gested in Result 3.11. If, in that decomposition, there is only one component
(i.e., if the entire sample space is irreducible), the chain is called ergodic. Ac-
tually, the definition of ergodicity is much more general and under the above
conditions, the irreducibility and the ergodicity of a Markov chain are equiv-
alent. Since the full generality is beyond the scope of this book, we use this
equivalence to define ergodicity.

3.6 Hidden Markov Models

Let us now stretch our imagination a little bit more and think of a scenario
where {X1 , X2 , . . .} is a Markov chain but is no longer directly observable.
Instead, when the event {Xi = s} occurs for any state s, we only get to
see a ‘manifestation’ of it. The question that immediately comes to mind is
how accurately one can guess (or ‘estimate’) the true state of the underlying
Markov chain. Going back to your daily job as a meteorologist at the local
radio station, suppose a person is not directly listening to your 7:00 A.M.
weather report (perhaps he/she does not have a radio in his/her room or
is too lazy to get off the bed and turn it on). Instead, he/she is trying to
guess the content of your report by watching his/her family members’ reac-
tions. For example, if the person hears his/her spouse calling her/his office
to announce a late arrival plan this morning, it may be because a torrential
downpour is going on and the rush-hour traffic will be a mess. Or it may
be because a wonderful, sunny morning has inspired his/her spouse to spend
a few hours at the local golf course before reporting to work today. More
formally, when the underlying chain visits the state s, an observable manifes-
tation Mi is chosen according to a p.m.f. on the set of possible manifestations
M = {M1 , . . . , ML }. This is actually a conditional p.m.f. given s. So there

© 2008 by Taylor & Francis Group, LLC


HIDDEN MARKOV MODELS 63
are five items to keep in mind here: the state space {s1 , s2 , . . . , sm } of the
underlying Markov chain, its one-step transition probability matrix A, the set
of manifestations M (also sometimes called an alphabet of emitted letters), the
conditional p.m.f. Pi = (pi (M1 ), . . . , pi (ML )) on M given the true underlying
state si and the initial distribution π = (π1 , . . . , πm ).

Example 3.30. Suppose you are playing a dice game with a partner who
occasionally cheats. The rule of the game is that you earn $ 100 from your
partner if you roll a 4, 5 or 6 and you pay him/her $ 100 if any of the other
three numbers turn up. If played with a ‘perfect’ or ‘balanced’ die, it is a
fair game, which is easy to see once you write down the p.m.f. table for
your earning and compute the expected value. But your partner, who sup-
plies the die, is occasionally dishonest and secretly switches to an unbalanced
die from time to time. The unbalanced die has P (1) = P (2) = P (3) = 41
1
and P (4) = P (5) = P (6) = 12 . If the latest roll has been with the balanced
die, he/she will switch to the unbalanced one for the next roll with proba-
bility 0.05 (i.e., stay with the balanced one with probability 0.95). On the
other hand, the chances of his/her switching back from the unbalanced one
to the balanced one is 0.9. Here, if Yi denotes the outcome of your ith roll,
then {Y1 , Y2 , . . .} follows a hidden Markov model (HMM) with an underlying
Markov chain {X1 , X2 , . . .} whose state spaceis { balanced,unbalanced } and
0.95 0.05
one-step transition probability matrix is A = . The alphabet of
0.9 0.1
emitted letters here is {1, 2, 3, 4, 5, 6} and the conditional p.m.f. on it switches
between { 61 , 16 , 16 , 16 , 16 , 16 } and { 41 , 14 , 14 , 12
1 1
, 12 1
, 12 }, depending on the true na-
ture of the die used. If the chances are very high (say, 99%) that your partner
will not begin the game by cheating, the initial distribution for the underlying
chain will be (π1 = 0.99, π2 = 0.01).

For an HMM like this, there are three main questions: (a) Given A, P and
π = (π1 , . . . , πm ), how to efficiently compute the likelihood (or joint probabil-
ity) of the observed manifestations {Y1 , Y2 , . . . , YK }? (b) Given {Y1 , Y2 , . . .},
how to efficiently estimate the true state-sequence {x1 , x2 , . . .} of the under-
lying Markov chain with reasonable accuracy? (c) Given the ‘connectivity’
or ‘network structure’ of the state space of the underlying chain (i.e., which
entries of A will be positive and which ones will be 0), how to efficiently find
the values of A, P and π that maximize the observed likelihood mentioned in
(a)? Here we will briefly outline the algorithms designed to do all these. More
details can be found, for example, in Ewens and Grant (2001).

The forward and backward algorithms: The goal is to efficiently compute


the likelihood of the observed Yi ’s given A, P and π. We begin by computing
(k)
γi = P (Y1 = y1 , . . . , Yk = yk and Xk = si ) for 1 ≤ i ≤ m and 1 ≤ k ≤ K,
Pm (K) (1)
because the desired likelihood is nothing but i=1 γi . The first one, γi ,

© 2008 by Taylor & Francis Group, LLC


64 PROBABILISTIC AND MODEL-BASED LEARNING
is clearly πi pi (y1 ). Then, realizing that
m
(k+1)
X
γi = P (Y1 = y1 , . . . , Yk+1 = yk+1 , Xk = sj and Xk+1 = si ),
j=1

(k+1) Pm (k)
we immediately get the induction relation: γi = j=1 γj pji pi (yk+1 )
(k+1)
where pji is the (j, i)th entry of A. This is an expression for γi in terms
(k) (1)
of {γj ; j = 1, . . . , m}. So, first we compute γi for i = 1, . . . , m and then,
(2)
using the induction formula, compute γi for all i’s which will subsequently
(3)
produce the values of γi ’s through the induction formula again. Continuing
(K)
in this manner, we will get the γi ’s for all i’s and then we are done. This is
called the forward algorithm because of the forward induction it uses.
(k)
For the backward algorithm, our aim is to compute δi = P (Yk = yk , . . . YK =
yK | Xk = si ) for i = 1, . . . , m and 1 ≤ k ≤ K − 1. We initialize the process by
(K) (k−1) Pm (k)
setting δj = 1 for all j’s. Then we notice that δi = j=1 pij pj (yk−1 )δj ,
due to the conditional independence of the Yj ’s given the state of the under-
lying chain. Using this backward induction formula, we gradually compute
(K−1) (K−2) (0)
δi for 1 ≤ i ≤ m, δi for 1 ≤ i ≤ m, and so forth. Once we get δi
for all i’s, we multiply each of them by the corresponding initial probability
πi to obtain P (Y1 = y1 , . . . , YK = yK and X1 = si ). The desired likelihood is
nothing but the sum of this quantity over i from 1 to m.

The Viterbi algorithm. Given an observed sequence of manifestations y1 , . . . ,


yK , our goal is to efficiently estimate the state-sequence x1 , . . . , xK of the un-
derlying chain that has the highest conditional probability of occurring. The
Viterbi algorithm first computes
maxx1 ,...,xK P (X1 = x1 , . . . , XK = xk | Y1 = y1 , . . . , YK = yK ) (3.26)
and then traces down a vector (x1 , . . . , xK ) that gives rise to this maximum.
We begin by defining
(k)
ξi = maxxj :1≤j≤k−1 P (X1 = x1 , . . . , Xk−1 = xk−1 ,
Xk = si , Y1 = y1 , . . . , Yk = yk )
for some k (1 ≤ k ≤ K) and some i (1 ≤ i ≤ m). For k = 1, it is sim-
ply P (X1 = si and Y1 = y1 ). Then it is not difficult to see that (3.26) is
(K)
simply maxi ξi divided by P (Y1 = y1 , . . . , YK = yK ). So the sequence
of states (x1 , . . . , xK ) that maximizes the conditional probability in (3.26)
(K) (k)
will also correspond to maxi ξi . So we focus on the ξi ’s and compute
(1) (k)
them using forward induction. Clearly, ξi = πi pi (y1 ) for all i. Then, ξi =
(k−1)
max1≤j≤m ξj pji pi (yk ) for k ∈ {2, . . . , K} and i ∈ {1, . . . , m}. Now suppose
(K) (K)
that ξi1 = max1≤i≤m ξi . Then we put XK = si1 . Next, if i2 is the index
(K−1)
for which ξi pii1 is the largest, we put XK−1 = si2 . Proceeding in this

© 2008 by Taylor & Francis Group, LLC


HIDDEN MARKOV MODELS 65
manner, we get all the remaining states. This algorithm does not produce all
the state sequences of the underlying chain that give rise to the maximum in
(3.26)—just one of them.

The Baum-Welch algorithm. Here the goal is to efficiently estimate the


unknown parameters πi ’s, pij ’s and pi (Mj )’s using the observed manifesta-
tions y1 , . . . , yK . Actually, the data we need will be a collection of observed
(t) (t)
sequences {y1 , . . . , yK }t=1,2,... . We will denote the corresponding true-state
(t) (t)
sequences for the underlying chain by {x1 , . . . , xK }t=1,2,.... The first step
will be to initialize all the parameters at some values chosen arbitrarily from
the respective parameter spaces or chosen to reflect any a priori knowledge
about them. Using these initial values, we compute πˆi = the expected propor-
tion of times in the state si at the first time-point, given the observed data,
(t) (t) (t) (t)
E(Uij |y1 ,...,yK ) E(Ui (Mj )|y1 ,...,yK )
pˆij = (t) (t) and pˆi (Mj ) = (t) (t) , where Uij is the ran-
E(Ui |y1 ,...,yK ) E(Ui |y1 ,...,yK )
(t) (t)
dom variable counting how often Xr = si and Xr+1 = sj for some t and r,
(t)
Ui is the random variable counting how often Xr = si for some t and r, and
(t)
Ui (Mj ) is the random variable counting how often the events {Xr = si } and
(t)
{Yr = Mj } jointly occur for some t and r. Once these are computed, we set
these to be the updated values of the parameters. It can be shown that by do-
ing so, we increase the likelihood function of the observed data {Y1 , . . . , YK }.
As a result, if we continue this process until the likelihood function reaches a
local maximum or the increment between successive iterations is very small,
we will get the maximum likelihood estimates of the parameters. So we now
(t)
focus on the computations of the above quantities. Let us define ζr (i, j) as
(t) (t) (t) (t)
(t) (t) (t) P (Xr = si , Xr+1 = sj , y1 , . . . , yK )
P (Xr(t) = si , Xr+1 = sj | y1 , . . . , yK ) = (t) (t)
.
P (y1 , . . . , yK )
(3.27)
Notice that both the numerator and the denominator of (3.27) can be effi-
ciently computed using the forward and backward algorithms. For example,
one can write the numerator as
(t) (t) (t) (r) (t) (r+1)
P (Xr(t) = si , Xr+1 = sj & y1 , . . . , yK ) = γi pij pj (yr+1 )δj .
(t) (t) (t)
We then define indicators Ir (i) as Ir (i) = 1 only if Xr = si (and zero oth-
P P (t)
erwise). It is easy to see that t r Ir (i) is the number of times the under-
P P (t) (t) (t)
lying Markov chain visits the state si , whereas t r E(Ir (i) | y1 , . . . , yK )
is the conditional expectation of the number of times the state si is visited
(t) (t)
by the underlying chain given {y1 , . . . , yK }. This conditional expectation is
P P Pm (t)
actually = t r j=1 ζr (i, j), since
m
(t) (t) (t) (t)
X
E(Ir(t) (i) | y1 , . . . , yK ) = P (Xr(t) = si | y1 , . . . , yK = ζr(t) (i, j).
j=1

© 2008 by Taylor & Francis Group, LLC


66 PROBABILISTIC AND MODEL-BASED LEARNING
P P (t)
Likewise, t r ζr (i, j) can be shown to be the expected number of tran-
sitions from si to sj given the observed manifestations. Finally, defining in-
(t) (t) (t)
dicators Jr (i, Ms ) as Jr (i, Ms ) = 1 only if the events {Xr = si } and
(t) (t)
{Yr = Ms } jointly occur (and zero otherwise), we realize that E(Jr (i, Ms ) |
(t) (t)
y1 , . . . , yK ) is the (conditional) expected number of times the tth under-
(t) (t)
lying process {X1 , X2 , . . .} is in the state si at time r and the corre-
(t) (t)
sponding manifestation is Ms , given the observed data {y1 , . . . , yK }. So,
(t) (t)
the E(Ui (Ms ) | y1 , . . . , yK ) from the previous page is nothing but
m
(t) (t)
XX XX X X
E(Jr(t) (i, Ms ) | y 1 , . . . , yK ) = ζr(t) (i, j).
t r t r (t)
(t,r):yr =Ms j=1

This concludes our discussion of hidden Markov models.

3.7 Frequentist Statistical Inference

We now turn to various methods of learning about, or drawing inferences


regarding, unknown parameters from data without assuming any prior knowl-
edge about them. Usually this is done by either estimating the parameters or
testing the plausibility of statements/assertions made about them (called hy-
potheses). Sometimes our goal is just to identify the dataset (among a bunch
of datasets) associated with the largest or smallest parameter-value, which is
known as a selection problem. But here we focus primarily on estimation and
hypothesis-testing. As indicated in Section 1, the link between the unknown
quantities (i.e., the parameters) and the observed data is a probability model
which is assumed to have generated the data. Under the simplest setup, the
data {X1 , X2 , . . . , Xn } are considered to be an i.i.d. sample from the assumed
probability model. In other words, the Xi ’s are considered independent and
identically distributed, each following that probability model. In case the data
are discrete (i.e., the values are on a countable grid such as whole numbers),
the Xi ’s will have a common p.m.f.. In the continuous case, they will have
a common p.d.f. This p.m.f. or p.d.f. will depend on the unknown param-
eter(s). We will denote both a p.m.f. and a p.d.f. by f (x; θ), where θ is a
vector of parameters. As defined in an earlier section, the likelihood function
of the observed
Qn data is the joint p.m.f. or p.d.f. of (X1 , . . . , Xn ), which boils
down to i=1 f (xi ; θ) due to independence. The n × n dispersion matrix of
(X1 , . . . , Xn ) is In×n . Under this setup, we first talk about estimation.
The raw and central moments of f (x; θ) will involve one or more of the pa-
rameters. If we have k parameters, sometimes equating the formula for the
rth raw moment of f (x; θ) to the corresponding raw moment of the sample
(r = 1, . . . , k) gives us a system of k equations and solving this system, we get
the method of moments (MM) estimates of the parameters. Notice that, for an
i.i.d. sample from a univariate p.m.f. or p.d.f. f (x; θ), if we define a function

© 2008 by Taylor & Francis Group, LLC


FREQUENTIST STATISTICAL INFERENCE 67
F̂n (t) : R → [0, 1] as F̂n (t) = #Xi that
n
are ≤t , this function satisfies all the
properties of a c.d.f. in Result 3.2. This is known as the empirical c.d.f. of the
data and the moments corresponding to it are called sample moments. Pn For
instance, the first raw sample moment is P the sample mean X̄ = n1 i=1 Xi . In
n
general, the rth raw sample moment is n1P i=1 Xir . The second central sample
1 n
moment is the sample variance s = n i=1 (Xi − X̄)2 . For reasons that will
2

be clear shortly, some people use n − 1 instead of n in the sample


Pn 2 variance
Pn de-
n Xi −( Xi )2
nominator, which then becomes algebraically the same as i
n(n−1)
i=1
.
Here are some examples of MM estimates.

Example 3.31. Let X1 , . . . , Xn be i.i.d. from a Poisson(λ) p.m.f. Then E(Xi )


= λ and equating it to the first raw sample moment, we get λ̂MM = n1 ni=1 Xi .
P

Example 3.32. Let X1 , . . . , Xn be i.i.d. from a Gamma(α, β) p.d.f. Then the


mean E(Xi ) = αβ and the variance E(Xi − E(Xi ))2 = αβ 2 . So, equating
these two to the corresponding sample moments, we get:

n n
1X 1 X
αβ = Xi = X̄; αβ 2 = (Xi − E(Xi ))2 = s2 .
n i=1 n − 1 i=1

Solving these, we get β̂MM = s2 /X̄ and α̂MM = X̄ 2 /s2 .

In our discussion of the Viterbi algorithm for hidden Markov models, we saw
how to find the true underlying state-sequence that maximizes the probability
of joint occurrence of the observed manifestations. If we apply the same prin-
ciple here and try to find those values of the parameter(s) θ that maximize
the joint probability of occurrence (or the likelihood function) of the observed
data x1 , . . . , xn , they will be called the maximum likelihood (ML) estimate(s)
of the parameter(s). Usually, once the likelihood is written down as a function
of the parameter(s) (treating the observed data as fixed numbers), setting
its partial derivative w.r.t. each parameter equal to zero gives us a system
of equations. Solving it, we get the critical points of the likelihood surface.
Some of these will correspond to local maxima, others to local minima and
still others will be saddle points. Using standard detection techniques for local
maxima and finding the one for which, the likelihood surface is the highest, we
can get ML estimates of the parameter(s). Often the above procedure is ap-
plied to the natural logarithm of the likelihood function, which still produces
the correct answers because the logarithmic transformation is monotone (i.e.,
preserves “increasingness” or “decreasingness”). Clearly, the ML estimate of a
parameter is not necessarily unique. It will be so if the likelihood surface is, for
example, unimodal or log-concave. Here are some examples of ML estimation.

Example 3.33. Let X1 , . . . , Xn be i.i.d. Poisson(λ). Then the likelihood func-

© 2008 by Taylor & Francis Group, LLC


68 PROBABILISTIC AND MODEL-BASED LEARNING
Pn Qn
tion is L(λ; x1 , . . . , xn ) = e−nλ λ 1 xi / 1 xi !. So,
Pn n
d xi 1X
logL(λ; x1 , . . . , xn ) = −n + i=1 =0⇒λ= Xi ,
dλ λ n i=1
which indeed corresponds to the global maximum of the log-likelihood func-
d2
tion (and hence, of the likelihood function) since dλ 2 logL(λ; x1 , . . . , xn ) =
n
−λ−2 i=1 Xi is negative for all λ ∈ (0, ∞). So, at least in this case, the MM
P
estimator of λ coincided with its ML estimator. But this is not true in general.

Example 3.34. Let Xi ’s be i.i.d. Gamma(1, β), that is, Exponential(β). Then
P n
xi
the log-likelihood function is logL(β; x1 , . . . , xn ) = −nlogβ − i=1
β , so that
d 1
Pn
dβ logL(β; x1 , . . . , xn ) = 0 ⇒ β̂ = n i=1 xi .

Example 3.35. Let Xi ’s be i.i.d. Normal(µ, σ 2 ). Then the


Plog-likelihood func-
n
(xi −µ)2
tion is logL(µ, σ 2 ; x1 , . . . , xn ) = − n2 log(2π) − n2 logσ 2 − i=12σ2 . We can
certainly take its partial derivatives w.r.t. µ and σ 2 and equate them to zero,
thereby getting a system of two equations. But in this case, we can play a
different trick. For each fixed value of σ 2 , we can maximize the log-likelihood
w.r.t. µ and then, having plugged in whatever value of µ maximizes it, we can
treat it as a function of σ 2 alone and find the maximizing value of σ 2 . The
first step is easy, once we observe that
n
X n
X n
X n
X
(xi − µ)2 = (xi − x̄ + x̄ − µ)2 = (xi − x̄)2 + (x̄ − µ)2 ,
i=1 i=1 i=1 i=1
Pn
the last equality following from the fact that i=1 (xi − x̄)(x̄ − µ) = 0. So
it is clear that µ̂ML = x̄. Now, having replaced µ with x̄ in the original
2
log-likelihood
Pn function,2we maximize it via differentiation w.r.t. σ and get
2 1
σML = n i=1 (xi − x̄) .
Two quick points about ML estimators before we move on. The ML estimator
of a one-to-one function of a parameter θ is the same one-to-one function
of θ̂ML . This is an advantage over method-of-moments estimators, since the
2
latter do not have this property. Also, as we see in the case of σ̂ML in Example
3.35, the ML estimator of a parameter is not necessarily unbiased (an unbiased
estimator being defined as one whose expected value equals the parameter it
2 n−1 2
is estimating). It can be shown that E(σML Pn) = n σ ,2 so that an unbiased
2 2 n 2 1
estimator of σ is σ̂U = n−1 σ̂ML = n−1 i=1 (xi − x̄) . This is the reason
why the commonly used sample variance formula has n − 1 instead of n in the
denominator.
But is ‘unbiasedness’ a desirable criterion for deciding whether an estimator
is ‘good’ or ‘bad’ ? Are there other criteria? Before we get to these ques-
tions, let us talk about another frequently used estimation technique called
the least squares method. In real life, often we have multivariate data where

© 2008 by Taylor & Francis Group, LLC


FREQUENTIST STATISTICAL INFERENCE 69
each observation is a k × 1 vector of measurements on k variables. Some of
these variables are our primary focus, in the sense that we want to study how
they vary (or whether they significantly vary at all) in response to changes in
the underlying experimental conditions and want to identify all the sources
contributing to their variability. These are usually called response variables.
The other variables in the observation-vector may represent the experimen-
tal conditions themselves or the factors contributing to the variability in the
responses. These are usually called the explanatory variables or design vari-
ables. Sometimes there is no underlying experiment and all the variables are
measurements on different characteristics of an individual or an object. In
that case, our primary concern is to determine the nature of association (if
any) between the responses and the explanatory variables. For example, we
may have bivariate measurements (Xi , Yi ) where the response Yi is the yield
per acre of a certain crop and Xi is the amount of rainfall or the amount of
fertilizer used. Or Xi could simply be a categorical variable having values 1,2
and 3 (1=heavily irrigated, 2=moderately irrigated, 3=no irrigation). In all
these cases, we are primarily interested in the “conditional” behavior of the
Y ’s given the X’s. In particular, we want to find out what kind of a func-
tional relationship exists between X and E(Y | X). In case X is a continuous
measurement (i.e., not an indicator of categories), we may want to investigate
whether a linear function such as E(Y | X) = γ + βX is adequate to describe
the relation between X and Y (if not, we will think of nonlinear equations
such as polynomial or exponential). Such an equation is called the regression
of Y on X and the adequacy of a linear equation is measured by the correla-
tion between them. In case X is a categorical variable with values 1, . . . , m, we
may investigate if a linear equation such as E(Y | X = i) = µ + αi is adequate
to explain most of the variability in Y (if not, we will bring in the indica-
tor(s) of some other relevant factor(s) or perhaps some additional continuous
variables). Such an equation is called a general linear model. In case all the
X’s are categorical, we carry out an analysis of variance (ANOVA) for this
model. If some X’s are categorical and others are continuous (called covari-
ates), we perform an analysis of covariance (ANCOVA) on this model. If such
a linear model seems inadequate even after including all the relevant factors
and covariates, the conditional expectation of Y may be related to them in a
nonlinear fashion. Perhaps a suitable nonlinear transformation (such as log,
arcsine or square-root) of E(Y | X) will be related to X in a linear fashion.
This latter modeling approach is known as a generalized linear model and the
nonlinear transformation is called a link function.
In all these cases, the coefficients β, γ, µ and αi are to be estimated from the
data. In the regression scenario with response Y and explanatory variables
X1 , . . . , Xk , we write the conditional model for Y given X as
(i) (i)
Yi = γ + β1 X1 + . . . + βk Xk + ǫi for i = 1, . . . , n, (3.28)
where the ǫi ’s are zero-mean random variables representing random fluctua-
tions of the individual Yi ’s around E(Y | X1 , . . . , Xk ). In the ANOVA scenario

© 2008 by Taylor & Francis Group, LLC


70 PROBABILISTIC AND MODEL-BASED LEARNING
with one categorical factor (having k levels or categories), we write the con-
ditional model
k
!
X
Yij = µ + αi + ǫij for 1 ≤ i ≤ k and 1 ≤ j ≤ ni ni = n (3.29)
i=1

and in the ANCOVA scenario with a categorical factor X and a continuous


covariate Z, we write the conditional model
k
!
X
Yij = µ + αi + βZij + ǫij for 1 ≤ i ≤ k and 1 ≤ j ≤ ni ni = n . (3.30)
i=1

In the simplest case, the ǫi ’s are assumed to be i.i.d. having a Normal(0, σ 2 )


p.d.f. But more complicated models may assume correlated ǫi ’s with unequal
variances and/or a non-normal p.d.f. (which may even be unknown). In these
latter cases, maximum likelihood estimation of the coefficients is analytically
intractable and numerically a daunting task as well. So we resort to the fol-
lowing approach. In the regression case, we look at the sum of squared errors
n n
(i) (i)
X X
(Yi − γ − β1 X1 − . . . − βk Xk )2 = ǫ2i (3.31)
i=1 i=1

and try to minimize it w.r.t. γ and the βi ’s. It can be done in the usual way,
by equating the partial derivatives of (3.31) w.r.t. each of those parameters to
zero and solving the resulting system of equations. The solution turns out to
be (Xt V−1 X)−1 Xt V−1 Y, where σ 2 V is the variance-covariance matrix of the
ǫi ’s. This is known as the least-squares estimator. In case the ǫi ’s are assumed
to be normal, the MLE’s of the parameters γ, β1 , . . . , βk actually coincide with
their least-squares estimators. In almost all real-life scenarios, the matrix V
will be unknown and will, therefore, have to be estimated. In the special case
where V is simply In×n , the least-squares estimator of (γ, β1 , . . . , βk ) takes
the more familiar form (Xt X)−1 Xt Y.

Example 3.36. In order to verify if a heavily advertised brand of oatmeal


indeed affects the blood cholesterol levels of its consumers, it was given to a
randomly selected group of 30 volunteers twice a day for a few days. Different
volunteers tried it for different numbers of days. Once each volunteer stopped
eating the oatmeal, the change in his/her blood cholesterol level (compared
to when he/she started this routine) was recorded. If Xi denotes the num-
ber of days for which the ith volunteer ate the oatmeal and Yi denotes the
change in his/her blood cholesterol level, the following are the (Xi , Yi ) pairs for
the 20 volunteers: (7,1.6), (15,3.1), (5,0.4), (18,3.1), (6,1.2), (10,3.9), (12,3.0),
(21,3.9), (8,2.0), (25, 5.2), (14,4.1), (4,0.0), (20,4.5), (11,3.5), (16,5.0), (3,0.6),
(21,4.4), (2,0.0), (23,5.5), (13,2.8). First of all, the correlation between X and
Y is 0.908, which is an indication of the strong linear association between
them. If we write the regression model of Y on X in the matrix notation
Y = Xβ + ǫ, the response vector Y will consist of the 20 cholesterol levels,
the design matrix X will look like
h i
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
7 15 5 18 6 10 12 21 8 25 14 4 20 11 16 3 21 2 23 13

© 2008 by Taylor & Francis Group, LLC


FREQUENTIST STATISTICAL INFERENCE 71
and the least-squares estimate of β will be (Xt X)−1 Xt Y = (0.0165, 0.22626).
So the regression equation of Y on X is Y = 0.0165 + 0.22626X, which indi-
cates that for a one-unit change in X, our best estimate for the change in Y
(in the ‘least squares’ sense) is 0.22626. This equation also gives us our best
prediction for Y corresponding to a hitherto-unseen value of X. Notice that
all of the variability in Y cannot be explained by X, since Y will even vary a
little bit for individuals with the same value of X. For example, look at the
8th and the 17th volunteers in the dataset above. The proportion of the overall
variability in Y that can be explained by X alone is called the coefficient of
determination and, in this simple model, it equals the square of the correlation
(i.e., 82.45% ).
There are other methods of finding estimators, such as the minimum chi-
squared method and the minimum l∞ distance method. But they have their
own drawbacks, such as failing to use the full information in a continuous
dataset (due to ad hoc discretization of the value-range of a continuous ran-
dom variable) or being analytically intractable. For more details on them,
see Cramer (1946), Rao (1965) or Mood et al. (1974). But we now move on
to another important aspect of these estimators—their own random behav-
ior. After all, an estimator is nothing but a formula involving the random
sample {X1 , . . . , Xn } and so it is a random variable itself. Its value will vary
from one random sample to another. What p.d.f. will it have? One way of
getting an idea about this p.d.f. is to look at a histogram of many, many
different values of it (based on many, many different random samples) and
try to capture the “limiting” shape of this histogram as the number of bars
in it goes to infinity. The p.d.f. of an estimator obtained in this way will be
called its sampling distribution. For instance, the sampling distribution of the
MM estimator in Example 3.31 approaches the shape of a normal (or Gaus-
sian) distribution. Similar is the case for the MLE’s in Examples 3.33, 3.34
and 3.35 (for the parameter µ). Is it a mere coincidence that the sampling
distributions of so many estimators look Gaussian in the limit? Also, if the
limiting distribution is Gaussian, what are its mean and variance? The answer
to this latter question is easier, since in all the examples
Pn mentioned above, the
1
estimator concerned is the sample mean X̄ = P n n i=1 X i . Due
Pnto the linear-
ity property of expected values, E(X̄) = n1 E( i=1 Xi ) = n1 i=1 E(Xi ), so
that the mean of the sampling distribution of X̄ is the same as the mean
of each Xi . If Σ denotes the variance-covariance matrix of the random vector
X= (X1 , . . . , Xn ), it can be shown that the variance of any linear combination
at X
P= a1 X1 +P . . . + an Xn is nothing but at Σa. In particular, the variance
n n Pn P
of i=1 Xi is i=1 VAR(Xi ) + i=1 j6=i COV(Xi , Xj ), which reduces to
just ni=1 VAR(Xi ) if the Xi ’s are i.i.d. (i.e., the covariances are zero). Since
P
VAR(cY ) = c2 VAR(Y ) for Pany random variable Y and any constant c, it
n
easily follows that VAR( n1 i=1 Xi ) = n1 VAR(Xi ) for i.i.d. Xi ’s. Now, to the
question of the sampling distribution being Gaussian.
It turns out that the sampling distributions of the estimators in Examples

© 2008 by Taylor & Francis Group, LLC


72 PROBABILISTIC AND MODEL-BASED LEARNING
3.31, 3.33, 3.34 and 3.35 (for µ) were not Gaussian by coincidence. If Xi ’s
are i.i.d. from a p.m.f. or p.d.f. with finite mean µ and finite variance σ 2 , the
sampling distribution of n1/2 (X̄ − µ)/σ will always be standard normal (i.e.,
N (0, 1)) in the limit as n → ∞. This is the gist of the so-called central limit
theorem (CLT) proved by Abraham DeMoivre and Pierre-Simon Laplace. It is
one of the most celebrated results in probability theory, with far-reaching con-
sequences in classical statistical inference. Along with its multivariate coun-
terpart for i.i.d. random vectors, this result opens up the possibility of another
kind of estimation, called interval estimation in the case of a scalar param-
eter or confidence-set estimation in the case of a parameter-vector. The idea
is the following. If θ is the mean of a p.d.f. f (x; θ, σ 2 ) having variance σ 2 ,
and X1 , . . . , Xn are i.i.d. observations from this p.d.f., then according to the
CLT, P (−zα/2 ≤ n1/2 (X̄ − θ)/σ ≤ zα/2 ) will be approximately 1 − α for a
‘sufficiently large’ sample size n, where zα/2 is the 100(1 − α/2)th percentile
of the N (0, 1) p.d.f. (i.e., the point beyond which the tail-area of a N (0, 1)
p.d.f. is α/2). In other words,
zα/2 σ zα/2 σ
P (X̄ − 1/2 ≤ θ ≤ X̄ + 1/2 ) = 1 − α,
n n
z σ z σ
and the interval (X̄ − α/2
n1/2
, X̄ + α/2
n1/2
) is called a 100(1 − α) % confidence
interval for θ. However, the variance σ 2 will typically be unknown, rendering
the computation of the two end-points of this confidence interval impossible.
Fortunately, it can be shown that the distribution of n1/2 (X̄P− θ)/s is also
1 n
approximately N (0, 1) for large values of n, where s2 = n−1 i=1 (Xi − X̄)
2

is the sample variance. As a result, we get the approximate 100(1 − α) %


confidence interval zα/2 s zα/2 s
(X̄ − 1/2 , X̄ + 1/2 ) (3.32)
n n
for θ.
Actually, it can be shown using the multivariate version of the ‘Jacobian of in-
U
verse transformation’ technique (see Example 3.23) that the p.d.f. of (V /ν) 1/2 ,

where U and V are two independent random variables following N (0, 1) and
χ2 (ν) respectively, is Student’s t with ν degrees of freedom. It is a p.d.f. for
which extensive tables of percentiles are available. So, in case the sample size n
is not large, we should replace zα/2 in the above confidence interval formula by
tα/2 (ν), provided that the data came from a normal distribution. This is be-
cause if {X1 , . . . , Xn } is a random sample from a N (θ, σ 2 ) distribution, it can
be shown using a technique called Helmert’s orthogonal transformation (see
Rohatgi and Saleh (2001), p 342) that X̄ and (n − 1)S 2 /σ 2 are independent
and, of course, n1/2 (X̄ − θ)/σ ∼ N (0, 1) and (n − 1)S 2 /σ 2 ∼ χ2 (n − 1).
Next we look at some criteria for picking the ‘best’ estimator (if there is
one) from a bunch of competing estimators. One criterion (unbiasedness) has
already been mentioned. But there are others that may be more desirable
or justifiable than unbiasedness under different circumstances. One example
is concentration. Let X1 , . . . , Xn be a random sample from a p.d.f. or p.m.f.

© 2008 by Taylor & Francis Group, LLC


FREQUENTIST STATISTICAL INFERENCE 73
f (x; θ) and suppose that we are estimating η = η(θ), a certain function of θ.
An estimator T = T (X1 , . . . , Xn ) is said to be a more concentrated estimator
of η than another estimator T ∗ if
Pθ (η(θ) − δ < T ≤ η(θ) + δ ≥ Pθ (η(θ) − δ < T ∗ ≤ η(θ) + δ)
for all δ > 0 and all values of θ. If there is an estimator T ∗∗ that is more
concentrated than any other, it will be called the most concentrated estimator.
A slightly different but related criterion is Pitman closeness (after E.G.J.
Pitman). An estimator T of η(θ) is called Pitman-closer to η than another
estimator T ∗ if
1
Pθ (| T − η |<| T ∗ − η |) ≥
2
for all values of θ. Once again, if there exists a T ∗∗ that is Pitman-closer to η
than all its competitors, it will be called the Pitman-closest. However, while
they are both intuitively desirable, the trouble is that they do not define a total
order on the set of all possible estimators of η, in the sense that given any two
estimators T1 and T2 , one is not necessarily more concentrated (or Pitman-
closer) than the other. As a result, a ‘champion’ (i.e., a most concentrated or
Pitman-closest estimator) seldom exists.
Another popular criterion is minimum mean-squared-error, which tries to
pick a ‘winner’ on the basis of how close an estimator is to its ‘target’ on
the average. In other words, the mean squared error (MSE) of an estimator
T = T (X1 , . . . , Xn ) for η(θ) is Eθ (T − η)2 , and an estimator is preferable to
another if it has a smaller MSE than its competitor. This criterion also fails
to induce a total order on the set of all possible estimators, since typically a
plot of MSE(θ) versus θ for two estimators T1 and T2 will show a crisscrossing
pattern (i.e., T1 is preferable for some values of θ and T2 , for others). Also,
according to this criterion, the ‘champion’ will be the ‘impossible’ estimator
T (X1 , . . . , Xn ) ≡ η(θ) that always correctly estimates η(θ) regardless of the
sample observations. A generalization of the concept of MSE is to assess the
‘goodness’ of an estimator T by computing its average distance from its ‘tar-
get’ η with respect to any valid distance measure—not necessarily (T − η)2 .
Such a general distance measure is called a loss function and its average value
(computed using the p.d.f. or p.m.f. that is indexed by θ) is called the corre-
sponding risk function. The word ‘function’ emphasizes the fact that these are
indeed functions of the underlying parameter θ. Some examples of loss func-
tions are the absolute error loss | T − η |, the polynomial loss ζ | T − η |r with
ζ(θ) a nonnegative function of θ and r a positive constant, and the exponential
loss e|T −η| . Based on this generalization, another criterion is introduced for
comparing estimators—that of admissibility. An estimator T1 is inadmissible
if there is another estimator T2 such that RT2 (θ) ≤ RT1 (θ) for all θ, with a
strict inequality for at least one value of θ (RTi being the risk associated with
Ti , i = 1, 2). An estimator T will, therefore, be called admissible if there is no
other competitor to render it inadmissible. Once again, admissibility fails to
induce a total order on the set of all estimators, due to their crisscrossing risk

© 2008 by Taylor & Francis Group, LLC


74 PROBABILISTIC AND MODEL-BASED LEARNING
functions. This lack of a total order, common to all the criteria discussed so
far, is the motivation behind exploring new avenues for comparing estimators.
One avenue is to summarize the risk function in some way and just compare
two such summaries corresponding to two estimators. Another avenue is to
try to apply the comparison criteria described above to a restricted subset of
the set of all estimators. These two ideas are briefly discussed below. A third
avenue would be to somehow ‘average out’ θ, but further discussion on it is
postponed until the next section. Incidentally, the branch of statistics that
deals with the choice of an optimal decision rule (a general name for estima-
tors and other functions of the sample observations) by minimizing the risk
associated with various loss functions is formally known as statistical decision
theory.
The first idea mentioned above leads to the concept of a minimax estimator.
An estimator T is said to be a minimax estimator if
supθ RT (θ) ≤ supθ RT ′ (θ)

for all other estimators T . In other words, loosely speaking, the highest point
or ‘peak’ of the risk function is being used as its summary. The second idea
leads to a uniformly minimum variance unbiased estimator (UMVUE). It is
the ‘winner’ (according to the MSE criterion) in the restricted class of all un-
biased estimators. As has been mentioned earlier, the MSE of an estimator is
the sum of its variance and squared bias; hence it reduces to just the variance
for an unbiased estimator. So in this restricted subset, the search for an es-
timator with the smallest MSE boils down to that for the minimum-variance
estimator and, fortunately, it can be found on many occasions. Another re-
stricted subset that is often used for this purpose is the subset of all consistent
estimators. Let Tn = T (X1 , . . . , Xn ) be an estimator of η(θ). It is said to be
weakly consistent for η(θ) if, for every ε > 0,
lim Pθ (| Tn − η(θ) |< ε) = 1
n→∞

for each value of θ. A slightly stronger concept is that of a mean-squared-error


consistent estimator. Tn will be called MSE-consistent for η(θ) if limn→∞ Eθ (Tn
−η(θ))2 = 0 for every value of θ. It is stronger in the sense that it im-
plies weak consistency, but the reverse implication is not necessarily true. In
any case, since an MSE-consistent estimator must be asymptotically unbi-
ased (i.e., the bias must vanish in the limit as n → ∞), one might search
for the minimum-variance estimator in the MSE-consistent class. Sometimes
that search is restricted to an even narrower subcollection—that of consistent
and asymptotically normal estimators (i.e., consistent estimators whose dis-
tributions converge to a normal distribution as n → ∞). Such an estimator,
if existent, will be called consistent asymptotically normal efficient (CANE).
We conclude our discussion of comparison criteria by answering an important
question. We have defined a UMVUE above, but how does one find such
an estimator? If we knew the smallest variance that an unbiased estimator

© 2008 by Taylor & Francis Group, LLC


FREQUENTIST STATISTICAL INFERENCE 75
could achieve, an already familiar unbiased estimator might luckily turn out
to have that variance or could be slightly modified to have that variance. Or,
starting with any unbiased estimator, if we knew the technique of producing
another one with smaller variance, then repeating this technique several times
might ultimately lead us to a UMVUE. Fortunately, none of these is wishful
thinking—we just need to introduce a couple of new concepts. The first one
is sufficiency. When we have a random sample X1 , . . . , Xn from a p.d.f. or
p.m.f. f (x; θ), a statistic S = S(X1 , . . . , Xn ) is said to be sufficient for θ if
the conditional joint distribution of X1 , . . . , Xn given that S = s does not
involve θ. In other words, the sufficient statistic S contains all the ‘juice’ (i.e.,
relevant information about θ) in the data. An equivalent definition, which is
more convenient in practice, says that a statistic S(X1 , . . . , Xn ) is sufficient for
θ if the conditional distribution of any arbitrary statistic T (X1 , . . . , Xn ) given
S = s is free from θ. A nice way to visualize a sufficient statistic is through the
partition it induces in the sample space of all possible data-vectors. Suppose
that S is the value-set of S. Then the induced partition consists of the cells
{(X1 , . . . , Xn ) : S(X1 , . . . , Xn ) = s} for s ∈ S. Given that we are in any
particular cell, the conditional joint distribution of the sample observations
(or the conditional distribution of any statistic based on them) is free from θ.
Three important points are worth noting before we move on. First, sufficient
statistics are usually not unique. If S is sufficient for θ, then so is any one-
to-one function of it, since it will induce exactly the same partition in the
sample space. Secondly, if θ is a vector of parameters, we may have a vector
of statistics (S1 , . . . , Sm ) that are jointly sufficient for them. Finally, a quick
way of finding sufficient statistics is obtained from the following result, widely
known as the Fisher-Neyman factorization theorem:
Result 3.13. A set of statistics S1 (X1 , . . . , Xn ), . . . , Sm (X1 , . . . , Xn ) is jointly
sufficient for θ (possibly a parameter-vector) if and only if the joint p.d.f. (or
p.m.f.) of X1 , . . . , Xn can be factored as
n
Y
f (xi ; θ) = h1 (s1 (x1 , . . . , xn ), . . . , sm (x1 , . . . , xn ); θ)h2 (x1 , . . . , xn ),
i=1

where h1 is a nonnegative function depending on the data only through


{si (x1 , . . . , xn )}m
i=1 and h2 is a nonnegative function free from θ.

If two statistics S and S ∗ are both sufficient for θ and S ∗ is a function of


S (not necessarily a one-to-one function), how do the two induced partitions
compare? Well, the one induced by S ∗ will have fewer cells, because each of
its cells will be the union of several cells from the other partition. If s1 , . . . , sk
are the values of S for which S ∗ (si ) = s∗ , i = 1, . . . , k, the partition-cell
Sk
corresponsing to S ∗ = s∗ will be i=1 {(X1 , . . . , Xn ) : S(X1 , . . . , Xn ) = si }.
We say that S ∗ induces a coarser partition than S. From the viewpoint of
data-condensation or dimension reduction, S ∗ is preferable, since it provides
a more concise summary of the data while preserving all the relevant ‘juice’
regarding θ. What if another sufficient statistic S ∗∗ is available that is a

© 2008 by Taylor & Francis Group, LLC


76 PROBABILISTIC AND MODEL-BASED LEARNING
function of S ∗ ? It is even better in terms of data condensation. Continuing
in this manner, we will ultimately get a sufficient statistic that is a function
of every other sufficient statistic and induces the coarsest partition. It will
be called a minimal sufficient statistic for θ. One way of quickly arriving
at a minimal sufficient statistic is to look for a sufficient statistic S whose
distribution belongs to a family with a special property. R Suppose that the
family of p.d.f.’s or p.m.f.’s {g(s; θ)} has the property: ψ(s)g(s; θ)ds = 0 for
all θ =⇒ ψ(s) ≡ 0. Then S will actually be a minimal sufficient statistic. The
special property of the distribution-family of S mentioned above is known as
completeness. So, in summary, a complete and sufficient statistic is a minimal
sufficient statistic (although the converse is not necessarily true—it is possible
sometimes to find a minimal sufficient statistic that is not complete).
Now we are in a position to go back to the question of how to ‘hunt down’ a
UMVUE. First, how low can the variance of an unbiased estimator be? The
answer is provided by the famous Cramér-Rao inequality (named after Harald
Cramér and C.R. Rao):

Result 3.14. Suppose that X1 , . . . , Xn are i.i.d. observations from a p.d.f. (or
p.m.f.) f (x; θ) and T (X1 , . . . , Xn ) is an unbiased estimator of η(θ). Suppose
also that d η(θ) = η ′ (θ) exists and f (x; θ) satisfies the following regularity

conditions:

(i) logf (x; θ) exists for all x and all θ;
∂θ


(ii) 0 < Eθ [( logf (X; θ))2 ] < ∞ for all values of θ;
∂θ


R R Qn R R ∂ Qn
(iii) ... i=1 f (xi ; θ)dx1 . . . dxn = ... i=1 f (xi ; θ)dx1 . . . dxn ;
∂θ ∂θ


R R Qn
(iv) ∂ θR
. . . T (x1 , . . . , xn ) i=1 f (xi ; θ)dx1 . . . dxn
Qn
. . . T (x1 , . . . , xn ) ∂∂θ i=1 f (xi ; θ)dx1 . . . dxn ,
R
=
where the multiple integrals in (iii) and (iv) are to be replaced by multiple
sums in case f (x; θ) is a discrete p.m.f. Then we must have
(η ′ (θ))2
varθ (T ) ≥ . (3.33)
nEθ [( ∂ logf (X; θ))2 ]
∂θ

The expression on the right-hand side is known as the Cramér-Rao lower


bound. Regarding the issue of starting with an arbitrary unbiased estimator
and creating a new unbiased estimator from it with smaller variance, we have
two famous results that are summarized below:

Result 3.15. Let X1 , . . . , Xn be i.i.d. observations from a p.d.f. or p.m.f.


f (x; θ) and suppose that the statistics S1 (X1 , . . . , Xn ), . . . , Sm (X1 , . . . , Xn )
are jointly sufficient for θ. If T (X1 , . . . , Xn ) is an unbiased estimator of η(θ)
and we define a new statistic T ′ as T ′ (S1 , . . . , Sm ) = E(T | S1 , . . . , Sm ), then

© 2008 by Taylor & Francis Group, LLC


FREQUENTIST STATISTICAL INFERENCE 77
T ′ is also unbiased for η(θ) and varθ (T ′ ) ≤ varθ (T ) for all values of θ, with
a strict inequality for at least one value of θ (unless T and T ′ are identical).
The above technique is popularly known as Rao-Blackwellization (after C.R.
Rao and David Blackwell).

Result 3.16. Let X1 , . . . , Xn be i.i.d. observations from a p.d.f. or p.m.f.


f (x; θ) and suppose that S1 (X1 , . . . , Xn ) is a complete and sufficient statistic
for θ. If T (S(X1 , . . . , Xn )), a function of S, is also an unbiased estimator of
η(θ), then T must be a UMVUE of η(θ).
This is often called the Lehmann-Scheffé theorem and tells us precisely what
to do in order to get a UMVUE of η(θ). Just get hold of a complete, sufficient
statistic S for θ and an unbiased estimator T of η(θ). Then define T ′ = E(T |
S) and T ′ will be a UMVUE of η(θ). Now we will see a series of examples
illustrating all these techniques and concepts.

Example 3.37. Let X1 , . . . , Xn bePi.i.d. observations from a N (µ, σ 2 ) p.d.f.


1 n 2 2
Denoting the sample variance n−1 i=1 (Xi − X̄) by S , we know that (n −
2 2 2
1)S /σ ∼ χ (n−1). From our discussion about a Gamma p.d.f. in Section 3.3,
we also know that E[(n−1)S 2 /σ 2 ] = (n−1) and var[(n−1)S 2 /σ 2 ] = 2(n−1).
2σ4
In other words, E(S 2 ) = σ 2 and var(S 2 ) = n−1 . So it follows by Chebyshev’s
inequality (Result 3.6) that
var(S 2 ) 2σ 4
P (| S 2 − σ 2 |> ε) ≤ 2
= −→ 0 as n −→ ∞,
ε (n − 1)ε2
which implies that S 2 is weakly consistent for σ 2 . Actually, this can be gen-
eralized to any statistic Tn = T (X1 , . . . , Xn ) with asymptotically vanishing
variance when {X1 , X2 , . . .} is a random sample from a p.d.f. or p.m.f. f (x; θ).
If limn→∞ Eθ (Tn ) = η(θ) and limn→∞ var(Tn ) = 0, then an application of
Chebyshev’s inequality along with the fact that MSE = variance + bias2 will
ensure the weak consistency of Tn for η(θ). However, in the special case involv-
ing S 2 and σ 2 , a stronger result can be obtained: S 2 is in fact MSE-consistent
for σ 2 . That is because E[(S 2 − σ 2 )2 ] = var(S 2 ) = n1 (µ4 − n−3 4
n−1 σ ), which
goes to 0 as n → ∞. In fact, if a1 , a2 , . . . is any sequence P
of positive numbers
n
such that limn→∞ nan = 1, then the estimator S 2∗ = an i=1 (Xi − X̄)2 will
2
be MSE-consistent, and hence weakly consistent, for σ (can you explain to
yourself why?).

Example 3.38. Let {X1 , . . . , Xn } be a random sample from the Pnp.d.f. f (x; θ) =
θx (1 − θ)1−x for x ∈ {0, 1} and θ ∈ (0, 1). The statistic Y = i=1 Xi has the
p.d.f. fY (y; θ) =n Cy θy (1 − θ)n−y for y = 0, 1, . . . , n. The conditional proba-
bility P (X1 = x1 , . . . , Xn = xn | Y = y) is
Qn Pn Pn
xi 1−xi xi n− xi
i=1 θ (1 − θ) θ 1 (1 − θ) 1 1
y (1 − θ)n−y
= y (1 − θ)n−y
= ,
C
n y θ C
n y θ C
n y

which is free from θ and, therefore, implies that Y is sufficient for θ.

© 2008 by Taylor & Francis Group, LLC


78 PROBABILISTIC AND MODEL-BASED LEARNING
Example 3.39. If X P1n, . . . , Xn is a random sample from a Gamma(α, θ) p.d.f.,
we know that Y = i=1 Xi has a Gamma(nα, θ). The conditional joint p.d.f.
x1 ...xn
of X1 , . . . , Xn given Y = y is [Γ(nα)/(Γ(α))n ] (x1 +...+x n)
nα−1 . This being free

from θ, Y is sufficient for θ if α is known. But if α is unknown, Y is not


sufficient for the parameter vector (α, θ).

Example 3.40. Let X1 , . . . , Xn be i.i.d. observations from a N (µ, σ 2 ) density.


Let θ = (µ, σ). The joint density of X1 , . . . , Xn can be factored as
n n n
Y 1 (xi − µ)2 1 1 X 2 X
√ exp[− 2
] = √ n exp[− 2
( x i − 2µ xi + nµ2 )],
i=1
2πσ 2σ 2π σ n 2σ 1 1
Pn Pn 2
so that according to Result 3.13, the statistics 1 Xi and 1 Xi are jointly
sufficient for θ = (µ, σ). Here (2π)1n/2 plays the role of the function h2 (x1 , . . . , xn ).
Pn Pn
Note that the mapping 1 Xi , 1 Xi2 −→ X̄, S 2 is one-to-one, so that X̄ and
S 2 are also jointly sufficient for θ = (µ, σ). Also note that if theP parameter µ
is known, the factorization theorem tells us that the vector ( n1 Xi , n1 Xi2 )
P
is still jointly
Pn sufficient for σ. But is it minimally sufficient for σ? No, the
statistic 1 (Xi − µ)2 is.

Example 3.41. Suppose that X1 , . . . , Xn areQi.i.d. observations from a Uni-


n
form [θ1 , θ2 ] density. Then their joint p.d.f. is 1 (θ2 − θ1 )−1 I[θ1 ,θ2 ] (xi ), where
I[a,b] (x) = 1 if x ∈ [a, b] and is 0 otherwise. So the joint p.d.f. can be
written as (θ2 − θ1 )−n I[θ1 ,θ2 ] (mini xi )I[θ1 ,θ2 ] (maxi xi ). So, by the factorization
theorem (Result 3.13), (mini xi , maxi xi ) is sufficient for θ = (θ1 , θ2 ), with
h2 (x1 , . . . , xn ) ≡ 1.

Example 3.42. Recall the definition of the exponential family of densities


or p.m.f.s from (3.20)-(3.21). If X = (X1 , . . . , Xn ) has the p.d.f. or p.m.f.
in (3.20) or (3.21), the factorization theorem immediately implies that the
statistics t1 (X1 , . . . , Xn ), . . . , tk (X1 , . . . , Xn ) are jointly sufficient for θ. It can
actually be shown that they are complete and, therefore, are minimally suffi-
cient for θ.

Example 3.43. Here is an example of a statistic that is not sufficient. Let


X1 , X2 be i.i.d. observations from a Poisson(λ) p.m.f. and look at the statistic
X1 + 2X2 . Is the conditional joint p.m.f. of X1 and X2 given X1 + 2X2 free
from λ? No. For example,
P (X1 = 0, X2 = 1)
P (X1 = 0, X2 = 1 | X1 +2X2 = 2) =
P (X1 = 0, X2 = 1) + P (X1 = 2, X2 = 0)
1
and this ratio is 1+λ/2 , not free from λ.

Example 3.44. Let X1 , . .P


. , Xn be i.i.d. Bernoulli(θ) random variables. Then,
n
clearly, the statistic T = 1 Xi is sufficient for θ. Notice also that T has a

© 2008 by Taylor & Francis Group, LLC


FREQUENTIST STATISTICAL INFERENCE 79
Binomial(n, θ) p.m.f. and the family of p.m.f.s {Binomial(n, θ) : θ ∈ (0, 1)} is
complete. This is because
n n
X X θ t
Eθ ψ(T ) = ψ(t)n Ct θt (1 − θ)n−t = 0 =⇒ (1 − θ)n ψ(t)n Ct ( ) =0
t=0 t=0
1−θ

for all θ. But the last sum above is a polynomial in θ/(1 − θ), so it being zero
for all θ must imply that the coefficients are all zero. In other words, ψ(t) = 0
for t = 0, 1, . . . , n. Hence, T is minimal sufficient for θ.

Example 3.45. Let {X1 , . . . , Xn } be a random sample from a N P(µ, σ 2 ) den-


n 2
sity with µ known. Then by the factorization theorem, T = 1 (Xi − µ)
is sufficient for σ. But it is also complete, because as was mentioned in the
context
Pn of the Gamma p.d.f. in (3.16), (Xi − µ)2 /σ 2 ∼ χ21 for each i and
2 2 2
1 (Xi − µ) /σ ∼ χn . So,
Z ∞
1 2
Eσ ψ(T ) = 0 for all σ > 0 =⇒ ψ(t) 2 n/2
e−t/(2σ ) t(n/2)−1 dt = 0
0 Γ(n/2)(2σ )
R∞ 2
for all σ > 0, which can happen if and only if 0 ψ(t)t(n/2)−1 e−t/(2σ ) dt = 0
for all σ > 0. However, by the uniqueness property of Laplace transforms (the
Laplace transform of a function g(t) at s is defined as g(t)e−ts ds), only the
R
function identically equal to zero can have a Laplace transform that is iden-
tically zero. So ψ(t) ≡ 0. Hence, the statistic T is minimally sufficient for σ.

Example 3.46. Suppose that X1 , . . . , Xn are i.i.d. observationsPfrom aPN (µ, µ2 )


n n
density. Clearly, by the factorization theorem, T = (T1 , T2 ) = ( 1 Xi , 1 Xi2 )
is sufficient for µ. But is T complete? No, because ψ(t) = ψ(t1 , t2 ) = 2t21 −
(n + 1)t2 is a function of t that is not identically zero, yet Eµ ψ(T ) = 0 for all
µ ∈ R.

Example 3.47. Let {X1 , . . . , Xn } be a random sample from a Poisson(λ)


p.m.f. We will derive the Cramér-Rao lower bound for an unbiased estimator
of η(λ) = e−λ = P (X = 0) and that of η(λ) = λ. It can be shown that the
regularity conditions of Result 3.14 are satisfied, but we omit the details. Since
∂ ∂ e−λ λx x
logf (x; λ) = log = −1 + ,
∂λ ∂λ x! λ
so we have
∂ 1 λ 1
Eλ [ logf (X; λ)]2 = Eλ [(X/λ) − 1]2 = 2 Eλ (X − λ)2 = 2 = .
∂λ λ λ λ
So the denominator of the Cramér-Rao lower bound (3.33) is n/λ. For η(λ) =
e−λ , the numerator of (3.33) will be e−2λ . So the lower bound is λe−2λ /n.
−λ
For instance, an unbiased estimator Pnof η(λ) = e is the sample propor-
−1
tion of zeroes, that is, η̂(λ) = n I
i=1 {0} (X i ). Since each Xi will either
Pn
be zero or nonzero and P (Xi = 0) = e−λ , clearly i=1 I{0} (Xi ) follows a

© 2008 by Taylor & Francis Group, LLC


80 PROBABILISTIC AND MODEL-BASED LEARNING
Binomial(n,P e−λ ) p.m.f. and its variance is ne−λ (1 − e−λ ). So the variance of
−1 n −λ
η̂(λ) = n i=1 I{0} (Xi ) is e (1−e−λ)/n, which is ≥ the Cramér-Rao lower
bound (verify it for yourself). Next, if η(λ) = λ itself, the Cramér-Rao lower
1
bound will be n/λ = nλ . An unbiased estimator of λ is, of course, the sample
−1
Pn 2 λ
mean n i=1 Xi . Its variance is nλ/n = n . So it is indeed a UMVUE of λ.

Example 3.48. Consider the Poisson(λ) example again. We will now derive
a UMVUE for η(λ) = e−λ following the prescription in Result 3.16. For this
purpose, we can start with any unbiased estimator of e−λ . One such estima-
Pn
tor is I{0} (X1 ), which is a Bernoulli(e−λ ) random variable. Clearly, 1 Xi
is sufficient for λ, by the factorization theorem. It is actually minimal suf-
ficient, since its p.m.f. belongs to the exponential family (see the remark at
the end of Example
Pn 3.42). So, according to the Lehmann-Scheffe theorem,
E(I{0} (X1 ) | 1 Xi ) will be a UMVUE of λ. P To see what this conditional
n
expectation actually is, notice that P (X1 = 0 | 1 Xi = r) is equal to
Pn
P (X1 = 0 and 2 Xi = r) e−λ e−(n−1)λ ((n − 1)λ)r /r!
Pn = ,
P ( 1 Xi = r) e−nλ (nλ)r /r!
−1 r
Pn simplifies to (1 − n )P. nIn this derivation, we have used the fact that
which
1 X i ∼ Poisson(nλ) and 2 Xi ∼ Poisson((n −P 1)λ). In any case, since
n −1 r
I{0} (X1 ) takes the values 0 and 1 only, E(I{0} (X1 ) | P 1 Xi = r) = (1−n ) .
Pn −1 Xi
In other words, E(I{0} (X1 ) | 1 Xi ) = (1 − n ) , which must be a
−λ
UMVUE of e .
We conclude this section with testing of hypotheses. It is closely related to
interval estimation or confidence-set estimation, mentioned in the previous
section. Simply speaking, a hypothesis is a claim, assertion or conjecture about
the parameter θ of the p.d.f. or p.m.f. generating the data. Most often these
claims or assertions will be made by somebody who has something to gain
if they are true—perhaps a manufacturer of light-bulbs claiming the superi-
ority of his/her product over other brands in terms of average lifetime (the
parameter θ) or a drug company claiming its hypertension-lowering drug to
be better than the existing brands in terms of the average duration of effect
(θ) or a genomics researcher conjecturing that certain genes will be ‘differen-
tially expressed’ (i.e., will have different average expression-values) under two
different experimental conditions (‘treatments’). Such a claim or assertion is
often called the research hypothesis or the hypothesis of interest. A statisti-
cian’s job is to confirm or refute it on the basis of the ‘evidence’ in the data
{X1 , . . . , Xn }. In order to understand how this is accomplished, we first need
to formalize the setup and introduce some notations.
The research hypothesis is commonly denoted by H1 (sometimes Ha , because
another name for it is ‘alternative hypothesis’). Faced with such an H1 , the
statistician does not fall for it and keeps an open mind regarding the oppo-
site statement or assertion (i.e., the one which negates or nullifies H1 ). This
opposite statement is usually called the null hypothesis and denoted by H0 .

© 2008 by Taylor & Francis Group, LLC


FREQUENTIST STATISTICAL INFERENCE 81
In other words, the statistician views the whole process as a contest between
H1 and H0 —whichever is supported by more ‘substantial’ evidence (from the
data) wins. At the end of the day, the verdict is announced as “There are
strong reasons to believe H1 (i.e., to reject H0 )” or “H1 lacks strong enough
evidence, so H0 cannot be rejected.” The question that naturally comes to
mind is: What exactly is ‘substantial evidence’ or ‘strong reasons’ ? Before
addressing this question, we point out another important aspect of this pro-
cedure. Conventionally, while performing a hypothesis test, a statistician has
always started out by being skeptical about H1 and temporarily assuming
that H0 is true. Only if this initial assumption is ‘blown away’ by a ‘mountain
of evidence’ to the contrary does he/she change his/her mind. This initial
bias toward H0 is a ‘traditional hangover,’ in the sense that it dates back to
the time when hypothesis testing was primarily used for drug screening or
comparing commercial products. For example, if a drug company comes up
with a new hypertension-lowering drug and claims that it is more effective
than the existing drug in some way (which will be H1 ), an initial bias toward
the existing one may be justified. It is simply a matter of being cautious. The
existing drug is familiar, popular and time-tested and any official indication
of its inferiority from a trusted authority (such as the Food and Drug Ad-
ministration) may cause confusion, sudden shift of customer loyalty and loss
of business for its manufacturer. If, by chance, the declaration of its inferior-
ity was mistaken, it would have more serious health-related consequences. So
there is some wisdom in one’s initial bias toward the ‘status quo’ unless the
new invention or new product is superior beyond any reasonable doubt. But
not so if testing of hypotheses is being used as a tool for discovery—discovery
of hitherto-unknown genes that are differentially expressed in cancer patients
(compared to normal people) or of potentially beneficial chemicals that may
someday become the cure for hitherto-invincible diseases. In these cases, being
extra-conservative against the research hypothesis may result in one’s failure
to recognize talent or potential. However, in our brief treatment of the topic,
we stick to the conventional philosophy.
Now, to the question of what exactly ‘strong evidence’ means. Notice that,
if the verdict of a hypothesis-test is wrong, the mistake can be of two types.
Either H1 is indeed incorrect but the data somehow give us the opposite
impression (i.e., make us believe that H0 should be rejected in favor of H1 ).
Or it is the other way around. In the first case, we call it a type I error and
in the second case, a type II error. Since our final verdict is based solely on
the data {X1 , . . . , Xn } and we do not know the true value of the parameter
θ, there is always a chance that we are making either a type I or a type II
error whenever a hypothesis-test is performed. The probability of making a
type I error is traditionally denoted by α and is called the significance level (or
α-level) of the test. Similarly, P(a type II error) is denoted by β and (1 − β) is
called the power of the test. We can hope to carry out the test in such a way as
minimizes both α and β. However, as will be clear from the examples below, it
is difficult to achieve. In order to keep α low, one has to be ultra-conservative

© 2008 by Taylor & Francis Group, LLC


82 PROBABILISTIC AND MODEL-BASED LEARNING
against H1 , which will inflate β. Similarly, being ultra-liberal in favor of H1
to get a small β will increase α. So, we have to choose one of them and make
sure that it is small, hoping for the best regarding the other one. As explained
earlier, the tradition is to guard against high values of α. In any hypothesis-
testing problem, therefore, α will be pre-specified (typical values are 0.1, 0.05
and 0.01). The art of hypothesis-testing is to devise procedures that obey the
α restriction and, at the same time, minimize β (i.e., maximize the power) as
much as possible.

Formally, a research hypothesis is written as H1 : θ ∈ Θ1 and the corre-


sponding null hypothesis, as H0 : θ ∈ Θ0 . Here Θ1 and Θ0 are subsets of the
parameter-space Θ. Often Θ1 = Θc0 , but not always. It depends on the context
of the problem. For example, if the research hypothesis comes from a light-
bulb manufacturer who claims that the average lifetime (θ) of his/her bulbs
exceeds 2500 hours, then Θ = (0, ∞), Θ1 = (2500, ∞) and Θ0 = (0, 2500].
On the other hand, H1 may come from a consumers’ group claiming that the
low-carb soft drinks produced by a certain company have 25% more sugar per
bottle on an average than is indicated on the label. If the label says 40 grams,
then Θ1 = {50} and Θ0 may very well be {40} (if H1 and H0 are interpreted
respectively as “the consumers’ group is right” and “the producer is right”).
Or Θ1 may be {θ > 0 : θ 6= 50}, and Θ0 = {50}, if the producer takes the
initiative and his/her primary interest lies in ‘proving’ the consumers’ group
wrong. In case it is H1 : θ = {50} versus H0 : θ = {40}, we call it a ‘simple
null versus simple alternative’ situation. If it is H1 : θ ∈ {θ > 0 : θ 6= 50}
versus H0 : θ = {50}, we say that it is a ‘simple null versus composite al-
ternative’ scenario. The previous example involving light-bulbs, however, has
both a composite null and a composite alternative hypotheses.

In any of these cases, having observed the data X = {X1 , . . . , Xn }, our task
is to come up with a decision rule δ(X) (often called a test function) that is
the indicator function of a region in Rn and H0 will be rejected in favor of
H1 if and only if δ(X) = 1. The region in Rn associated with δ is usually
called the rejection region or the critical region of the test. Of course, given
α, we have to find a δ that satisfies: Eθ δ(X) ≤ α for all θ ∈ Θ0 . This is often
referred to as the size requirement of the test. Let us denote the collection of
all test functions δ with size α by ∆α . The quantity Eθ δ(X) = Pθ [δ(X) = 1]
is a function of θ for a fixed δ (denote it by βδ (θ)). For θ ∈ Θ1 , it is called
the power function of δ. For a particular θ ∈ Θ1 , if there is a test function
δ0 ∈ ∆α such that βδ0 (θ) ≥ βδ (θ) for all δ ∈ ∆α , we call it the most powerful
(MP) size-α test at that θ. If we are fortunate enough to find a test function
δ ∗ ∈ ∆α which is MP at every single θ ∈ Θ1 , it will be called a uniformly
most powerful (UMP) size-α test. Two important remarks before we see some
examples: (1) The actual definition of a test function δ is more general; it can
be any integrable function from Rn −→ [0, 1]. But here we restrict ourselves
to indicator functions only. (2) Often the test function will depend on the data
only through a sufficient statistic which has a lower dimension. In that case, δ

© 2008 by Taylor & Francis Group, LLC


FREQUENTIST STATISTICAL INFERENCE 83
will be the indicator function of a region in a lower dimensional subspace of Rn .

Example 3.49. Let {X1 , . . . , Xn } be i.i.d. N (µ, 1) random variables where the
mean µ is unknown and suppose we are testing H0 : µ = µ0 vs. H1 : µ = µ1 ,
with µ1 > µ0 and α = 0.05. A possible test function δ would be the indicator

function of the interval (µ0 + √ n , ∞), that is, a test with critical region
1.645
(µ0 + √n , ∞). It clearly satisfies the size requirement, since under H0 ,

X̄ ∼ N (µ0 , n1 ), so that n(X̄ −µ0 ) is a standard normal random√variable. The
power of this test at µ = µ1 is Pµ1 [X̄ ∈ (µ0 + 1.645

n , ∞)] =√Pµ1 [ n(X̄ − µ1 ) >

n(µ0 − µ1 ) + 1.645], which is the tail-area to the right of n(µ0 − µ1 ) + 1.645
under a standard normal curve. Is this test “best” in some sense? We will
return to that question.

Example 3.50. Suppose X is a single observation from a Binomial (4, θ)


distribution and we want to test H0 : θ = 21 vs. H1 : θ = 54 at a significance
1
level of α = 16 = 0.0625. In other words, we are looking for a critical region
1
C of size α = 16 . One choice for C would be {x = 0}, since the chances of
1
seeing no ‘head’ in 4 tosses of a fair coin is 16 . Another is {x = 4}. There is
no third choice. If we choose {x = 0}, the power of the test at θ = 54 will be
(1/5)4 = 1/625. This is not desirable, since the test will have a much smaller
chance of rejecting H0 when H1 is indeed true than when H0 is true. The
requirement that PH1 (rejecting H0 ) be at least as large as PH0 (rejecting H0 )
is known as unbiasedness. Let us see what happens if we choose {x = 4}. Then
256
the power at θ = 45 is 625 , which is significantly larger than the size. So the
test corresponding to {x = 4} is the most powerful unbiased (MPU) test of size
1
16 (as long as we are restricting ourselves to test functions δ that are indicator
functions). Notice that in this problem, the MPU test is obtained by including
in the critical region all those values x of X where the ratio f1 (x)/f0 (x) is the
largest (fi being the p.m.f. of X under the hypothesis Hi , i = 1, 2). Is this a
mere coincidence? Next we address this question.

The fact that the most powerful test in the above example had a critical region
that corresponded to the highest values of the ratio f1 (x)/f0 (x) (the likelihood
ratio) is just an illustration of the following well-known result in hypothesis
testing:

Neyman-Pearson Theorem: Let {X1 , . . . , Xn } be a random sample from a


p.d.f.
Qn(or p.m.f.) f (x; θ), so that their joint p.d.f. (or p.m.f.) is L(θ; x1 , . . . , xn )
= i=1 f (xi ; θ). Let θ0 and θ1 be distinct values of θ and a be a positive
number. If C is a subset of the sample space such that

(1) PH0 [(X1 , . . . , Xn ) ∈ C] = α,


L(θ0 ;x1 ,...,xn )
(2) L(θ 1 ;x1 ,...,xn )
≤ a for each (x1 , . . . , xn ) ∈ C, and
L(θ0 ;x1 ,...,xn )
(3) L(θ1 ;x1 ,...,xn ) ≥ a for each (x′1 , . . . , x′n ) ∈
/ C,

© 2008 by Taylor & Francis Group, LLC


84 PROBABILISTIC AND MODEL-BASED LEARNING
then C is a most powerful critical region (i.e., the test using C ∗ as the critical
region is a most powerful test) of size α for testing H0 : θ = θ0 vs. H1 : θ = θ1 .
Intuitively, this result says that a most powerful test rejects H0 at sample-
points where it is more likely that the sample came from L(θ1 ; x1 , . . . , xn ) than
L(θ0 ; x1 , . . . , xn ) (i.e., where the latter is ‘small’ compared to the former). Al-
though the three conditions listed above are sufficient conditions (i.e., the
result is true if they are satisfied), it can also be shown that they are neces-
sary conditions (i.e., the result is no longer true if any of them is violated). In
a real application, C may be defined as all sample points {x1 , . . . , xn } such
that conditions (2) and (3) hold. Often such a definition boils down to either
u∗ (θ0 , θ1 , x1 , . . . , xn ) ≤ a∗ or u∗∗ (θ0 , θ1 , x1 , . . . , xn ) ≥ a∗∗ for some convenient
functions u∗ and u∗∗ and appropriate constants a∗ and a∗∗ , as will be evident
in the examples below.

Example 3.51. Suppose that X1 , . . . , Xn are i.i.d. observations from the


p.d.f. f (x; θ) = θe−θx on (0, ∞), which is a reparameterized version of the
Exponential (θ) p.d.f. in (3.15). Suppose that we are testing H0 : θ = θ0
vs. H1 : θ = θ1 for somePknown, fixed values θ0 and θ1 (θ1 P > θ0 ). Here,
n n
L(θ0 ; x1 , . . . , xn ) = θ0n e−θ0 1 xi and L(θ1 ; x1 , . . . , xn ) = θ1n e−θ1 1 xi . Let us
denote their ratio by λ. The Neyman-Pearson theorem says that a most pow-
erful test will have the form: Reject H0 if the likelihood-ratio λ ≤ a for some
constant a, which boils down to
n n
θ0 n X X 1
( ) exp[−(θ0 − θ1 ) xi ] ≤ a ⇐⇒ xi ≤ loge {a(θ1 /θ0 )n }.
θ1 1 1
θ 1 − θ 0

If we now denote the quantity on the right-hand side of the last Pinequality
n
by a∗ , the critical region of a most powerful testPtakes the form: 1 xi ≤ a∗ .
n ∗
Pn level of such a test will be Pθ0 ( 1 Xi ≤ a ). In this case, we
The significance
know that 1 Xi ∼ Gamma(n, θ), so for a pre-specified α, the appropriate
choice for a∗ can be determined from the integral equation
Z a∗
1 n n−1 −xθ0
θ0 x e dx = α.
0 Γ(n)
In other words, a∗ will have to be the αth percentile of a Gamma(n, θ0 ) p.d.f.

Example 3.52. Let X1 , . . . , Xn be i.i.d. observations from a N (θ, 1) p.d.f.


and suppose that we want to test H√ 0 : θ = 0 vs. P H1 : θ = 1. In this case,
n n 2
the sample likelihood
√ n under
Pn H 0 is (1/ 2π) exp[−( 1 xi )/2] and that under
2
H1 is (1/ 2π) exp[−{Pn 1 (x i − 1) }/2], so the likelihood-ratio λ ultimately
n
reduces to exp(− 1 xi + P ).
2 n Hence, a most powerful test will have a critical
n
region
Pn of the form: exp(− 1 X i + 2 ) ≤ a, which is the
Pn same as saying that
n ∗∗
1 X i ≥ 2 − loge a = a (say). Since under H 0 , 1 X i ∼ N (0, n), the
appropriate choice for a∗∗ for a given significance level α is simply the (1−α)th
percentile of a N (0, n) density. Equivalently, the most powerful critical region

© 2008 by Taylor & Francis Group, LLC


FREQUENTIST STATISTICAL INFERENCE 85
n
can be expressed in terms of X̄ = n1 1 Xi as: Reject H0 if X̄ ≥ a∗∗ /n. In
P
that case, using the fact that X̄ ∼ N (0, n1 ), a∗∗ can be chosen as n times the
(1 − α)th percentile of a N (0, n1 ) density. What about the power of this test
at θ = 1? It is Pθ=1 [X̄ ≥ a∗∗ /n] or the right-hand tail-area of a∗∗ /n under a
N (1, n1 ) density curve.

Example 3.53. Let {X1 , . . . , Xn } be a random sample from a Bernoulli(θ)


p.m.f. and suppose that we are testing H0 : θ = θ0 vs. H1 : θ = Pθ1 with n
xi
θ0 < θ1 . The samplePnlikelihoods under H and H1 are respectively θ0 1 (1 −
Pn x
Pn 0
θ0 )n− 1 xi and θ1 1 (1 − θ1 )n− 1 xi . So the likelihood-ratio λ is less than
i

some constant a if and only if


 P n x i  n n
θ0 (1 − θ1 ) 1 1 − θ0 X
≤ a ⇐⇒ xi ≥ a∗∗ ,
(1 − θ0 )θ1 1 − θ1 1
where a∗∗ is obtained from a by taking the natural logarithm of both sides
of the first inequality. Do you see why the ≤ changes to a ≥ in the second
inequality above? Notice that loge {(θ0 (1 − θ1 ))((1 − θ0 )θ1 )} is negative since
θ0 < θ1 . In any case,
Pn a most powerful test will have a critical region of the
form: Reject H0 if 1 Xi ≥ a∗∗ . For a given significance level α, the choice of
a∗∗ will come from a Binomial(n, θ0 ) p.m.f. table. Since it is a discrete p.m.f.,
a significance level of α may not be exactly achievable. This is an example
where, in order to achieve an α-level exactly, one must use a test function that
is not an indicator function. But we choose not to get into the details and,
instead, move on to composite hypotheses.
If we are testing H0 : θ ∈ Θ0 against H1 : θ ∈ Θ1 with at least one of Θ0 and
Θ1 not singleton, the Neyman-Pearson likelihood-ratio technique described
above is not directly applicable. The modified version of it for composite hy-
potheses is known as the generalized likelihood ratio (GLR) method. Of course,
the optimality criterion for a test will also change in this case. Since there are
many possible values of θ in Θ1 , we now have to talk about a uniformly most
powerful (UMP) test over Θ1 (i.e., a test which is most powerful at every
θ ∈ Θ1 ). Unfortunately, the GLR method will not always yield a UMP test,
but sometimes it will. However, as will be clear from its description, the GLR
method makes good intuitive sense.
As before, L(θ; x1 , . . . , xn ) will denote the sample likelihood function. The
GLR method says that we must reject H0 if the largest value of L(θ; x1 , . . . , xn )
over Θ0 is “quite small” compared to its largest value over the entire parame-
ter space Θ0 ∪ Θ1 , because the ratio of these two largest values is an indicator
of the chances that θ indeed came from Θ0 . In other words, the GLR method
says:
supθ ∈Θ0 L(θ; x1 , . . . , xn )
Reject H0 if λ∗ = ≤c
supθ ∈Θ0 ∪ Θ1 L(θ; x1 , . . . , xn )
for an appropriately chosen positive fraction c. Notice that the denominator

© 2008 by Taylor & Francis Group, LLC


86 PROBABILISTIC AND MODEL-BASED LEARNING
of λ∗ is nothing but the sample likelihood function evaluated at the MLE of
θ. Clearly λ∗ ∈ [0, 1], but how “small” should c be chosen for a pre-specified
α? To answer this, we need to know the distribution of λ∗ under H0 , which
unfortunately is often difficult to derive. However, for a large sample-size n,
the distribution of −2loge λ∗ can be well approximated by a χ2 distribution
with r degrees of freedom (where r is the dimension of Θ0 ). This enables us
to derive a GLR test with an approximate significance level α.

Example 3.54. Suppose, as in Example 3.51, that X1 , . . . , Xn are i.i.d. obser-


vations from the Exponential (θ) p.d.f. f (x; θ) = θe−θx , so that the parameter
space Θ is (0, ∞). Let us test H0 : θ ≤ θ0 against H1 : θ > θ0 . So Θ0 = (0, θ0 ]
and Θ1 = (θ0 , ∞). Hence,
n
X n
sup L(θ; x1 , . . . , xn ) = sup {θn exp(−θ xi )} = ( Pn )n e−n .
θ∈Θ θ∈(0,∞) 1 1 xi

At the same time,


n
X n n
sup L(θ; x1 , . . . , xn ) = sup {θn exp(−θ xi )} = ( Pn )n if Pn ≤ θ0 ,
θ∈Θ0 θ∈(0,θ0 ] 1
e 1 xi 1 xi
Pn
whereas it is θ0n exp(−θ0 1 xi ) if Pn
n > θ0 . So the generalized likelihood-
xi
1
ratio is
Pn
∗ n θ0n exp(−θ0 1 xi )
∗ n
λ = 1 if Pn ≤ θ0 , λ = Pn n −n
if Pn > θ0 .
1 xi (n/ 1 xi ) e 1 xi

So a GLR test would be to reject Pn H0 if λ ≤ c forn some c ∈ (0, 1). This
translates to rejecting H0 if (n/ 1 xi ) > θ0 and (θ0 x̄) e−n(θ0 x̄−1) ≤ c. Notice
that the largest value of (θ0 x̄)n e−n(θ0 x̄−1) is 1 and it occurs when θ0 x̄ = 1. So,
as long as we have θ0 x̄ < 1 (i.e., as long as we are to the left of that maximum
value), it is easy to see that (θ0 x̄)n e−n(θ0 x̄−1) ≤ c ⇐⇒ θ0 x̄ ≤ c∗ for some
appropriate constant c∗ ∈ (0, 1). Therefore, that is what the GLR test boils
down to.

3.8 Some Computational Issues

We now know that in order to find the maximum-likelihood estimators of


parameters or to derive a GLR test for composite hypotheses, we need to
maximize the sample likelihood function L(θ; x1 , . . . , xn ) or its natural loga-
rithm. This maximization is analytically possible for samples coming from a
handful of distributions (e.g., normal, exponential, etc.). But in general, it is
necessary to carry out this maximization numerically via some iterative al-
gorithm. Two such algorithms are the Newton-Raphson method (Press et al.,
1986) and the expectation-maximization algorithm (Dempster et al.,1977). We
describe them briefly below.

© 2008 by Taylor & Francis Group, LLC


SOME COMPUTATIONAL ISSUES 87
The Newton-Raphson method (or its multidimensional generalization for vec-
tor parameters) is based on a Taylor series expansion of the derivative of the
log-likelihood function:

L′ (θ0 ; x1 , . . . , xn ) = L′ (θ; x1 , . . . , xn )+(θ0 −θ)L′′ (θ; x1 , . . . , xn )+higher-order

terms, where θ is a generic parameter-vector and θ0 is the true (unknown)


parameter-vector. Ignoring the higher-order terms and setting the expression
in the above equation to zero, we get

L′ (θ; x1 , . . . , xn )
θ0 = θ − , (3.34)
L′′ (θ; x1 , . . . , xn )

which gives us an iterative algorithm starting with an initial ‘guess’ θ. No-


tice that L′ (θ; x1 , . . . , xn ) is a vector of first derivatives (called the gradient
vector) and L′′ (θ; x1 , . . . , xn ) is a matrix of second derivatives (also known
as the Hessian matrix). Usually the iterations are terminated when the up-
dated parameter-vector θ differs very little from its previous value (in terms of
their Euclidean distance, say). In practice, this method is quick and efficient
for parameter-vectors of dimension 3 or less. But for higher dimensions, the
increasing size of the Hessian matrix causes some computational inefficiency
and, also, the iterations can become quite unstable (in the sense of produc-
ing updates of the parameter-vector that are further away from the desired
maximum than their predecessors).

An alternative to the above method that does not suffer from these drawbacks
is the EM algorithm. It was originally devised for problems with missing data
(e.g., due to censoring or truncating). So it is particularly suitable for problems
where some ‘latent’ or ‘hypothetical’ data (that are unknowable and, hence,
missing) have been introduced for analytical or computational convenience.
The following is an example of this algorithm in use.

Example 3.55. Suppose we have a bimodal dataset and would like to fit a
mixture of two normal distributions to it. In other words, we are assuming that
X1 , . . . , Xn are i.i.d., with each of them coming from either a N (µ1 , σ12 ) or from
a N (µ2 , σ22 ) p.d.f. Of course, it is unknown which Xi belongs to which normal
p.d.f., but the probability that it comes from N (µ1 , σ12 ) is p ∈ (0, 1) and that it
comes from N (µ2 , σ22 ) is 1 − p. Although this is not a missing-data problem as
such, do you see how it can be interpreted as one? We could introduce a bunch
of i.i.d. Bernoulli(p) random variables Z1 , . . . , Zn , with Zi = 1 indicating that
Xi came from N (µ1 , σ12 ) and Zi = 0 indicating that Xi came from N (µ2 , σ22 ).
These Zi ’s would then be latent or unobserved ‘data’. If we knew the values
of Z1 , . . . , Zn , the ‘success’ parameter p would be estimated simply by their
average. Even if we do not know them, a simple application of the Bayes
theorem yields the following expression for the conditional expectation of Zi

© 2008 by Taylor & Francis Group, LLC


88 PROBABILISTIC AND MODEL-BASED LEARNING
given Xi for i = 1, . . . , n:
pf (Xi ; µ1 , σ12 )
E(Zi | Xi ) = P [Xi from f (.; µ1 , σ12 )] = .
pf (Xi ; µ1 , σ12 ) + (1 − p)f (Xi ; µ2 , σ22 )
(3.35)
2
This is actually the posterior probability of Xi coming from N (.; µ1 , σ1 ) given
Xi . Starting with some initial ‘guess’ for each parameter involved, once we
compute this posterior probability for each i = 1, . . . , n, the mixing param-
eter p can be updated as their average. These computations constitute the
‘expectation’ part of the EM algorithm. The subsequent step is ‘maximiza-
tion,’ which is nothing but maximum-likelihood estimation using the values
obtained from the ‘E’ step. In other words,
n n
1 X 1 X
µ̂1 = Xi E(Zi | Xi ) , µ̂2 = Xi [1 − E(Zi | Xi )] (3.36)
np 1 n(1 − p) 1

and
n n
1 X 1 X
σ̂12 = (Xi −µ̂1 )2 E(Zi | Xi ) , σ̂22 = (Xi −µ̂2 )2 [1−E(Zi | Xi )].
np 1 n(1 − p) 1
(3.37)
Once these MLEs are obtained, they will be used in the ’expectation’ step of
the next iteration.
Although estimators and testing methods such as the MLE and the GLR
are widely used, it is often difficult to derive analytic expressions for some
of their important features such as bias, variance or power. If the underlying
sample-size is large, asymptotic approximations can be made to those quanti-
ties, but most real-life problems have moderate or small sample-sizes. There is
another computer-intensive alternative—a resampling procedure called boot-
strap (Efron 1979). The idea behind it has some similarity with the method-of-
moments estimation technique described earlier. In order to get the method-
of-moments estimators of parameters, we equate the population moments (in-
volving those parameters) with the corresponding sample moments. In the
case of bootstrap, we estimate functionals of the true (unknown) distribu-
tion function (e.g., moments, quantiles, etc.) with the corresponding func-
tionals of the empirical distribution function of our sample data. Recall that
the empirical c.d.f. of the sample observations X1 , . . . , Xn is a step-function
with a ‘jump’ of n1 at each Xi . How can we compute its quantiles and other
functionals? By drawing a random sample (of size m ≤ n) from it, which
amounts to sampling from the sample data we already have. Hence the term
resampling. This resampling is typically done many, many times and it can
be carried out with replacement or without replacement. Since the empirical
c.d.f. of the original sample gives equal weight n1 to each data-point, each
of them is equally likely to be selected during the resampling process. How-
ever, there is a procedure called weighted bootstrap where the data-points in

© 2008 by Taylor & Francis Group, LLC


BAYESIAN INFERENCE 89
the original sample receive unequal weights. In any case, suppose we want a
100(1 − α) % confidence interval for a parameter (say, the median) of the pop-
ulation distribution from where our sample data came. We can draw N (say,
N = 5000 or 10000) bootstrap-samples from the original sample (denote them
by B1 , . . . , BN ) and from each of them, compute the sample-median. Thus we
will have N bootstrapped sample-median values (call them M1b , . . . , MNb
). De-
noting their simple average by M̄ and their standard deviation by sbM , we
b

get the desired 100(1√ − α) % confidence √ interval for the population median as
(M̄ b − zα/2 sbM / N, M̄ b + zα/2 sbM / N ). There is an extensive literature on
bootstrap discussing conditions under which bootstrapped estimators asymp-
totically converge to their target parameters, but those are beyond the scope
of our present discussion.

3.9 Bayesian Inference

As was indicated in Section 1, while “learning” to some of us means estimating


or testing hypotheses about unknown quantities or parameters (assumed to be
fixed) from the data (a random sample from the population concerned), other
people interpret the word as updating our existing knowledge about unknown
parameters (assumed to be random variables) from the data (considered fixed
in the sense that we are only interested in the conditional behavior of the
parameters given the data). This is the Bayesian approach. Recall the Bayes
theorem from Section 2. There were two main ingredients: a likelihood and a
bunch of prior probabilities, ultimately yielding a bunch of posterior probabil-
ities. Following the same principle, we will now have a dataset {X1 , . . . , Xn }
which, given the parameter θ = (θ1 , . . . , θp ), will be conditionally i.i.d. having
theQcommon p.d.f. or p.m.f. f (x | θ). So their conditional likelihood given θ
is ni=1 f (xi | θ). The prior knowledge about θ will be in the form of a prior
p.d.f. or p.m.f. π(θ). Depending on the Q situation, the θi ’s can be assumed to
p
be independent a priori, so that π(θ) = i=1 πi (θi ) where θi ∼ πi . Or the θi ’s
can be dependent, in which case, π(θ) = π1 (θ1 )π2 (θ2 | θ1 ) . . . πp (θp | θj , j < p).
In what follows, we will assume this latter form with the understanding that
πi (θi | θj , j < i) = πi (θi ) in the case of independence. In any case, by (3.22),
the joint distribution of {X1 , . . . , Xn , θ1 , . . . , θp } is
n
!
Y
L(x1 , . . . , xn | θ)π(θ) = f (xi | θ) π1 (θ1 )π2 (θ2 | θ1 ) . . . πp (θp | θj , j < p).
i=1
(3.38)
For the denominator of the Bayes formula, we need the marginal joint p.d.f.
or p.m.f. of the Xi ’s. To get it from (3.32), we need to integrate it (or sum it)
w.r.t. the θi ’s over their full ranges. Finally, the posterior joint p.d.f. or p.m.f.
of θ1 , . . . , θp will be
Qn
( f (xi | θ)) π1 (θ1 )π2 (θ2 | θ1 ) . . . πp (θp | θj , j < p)
R R Qni=1 .
θ1
. . . θp ( i=1 f (xi | θ)) π1 (θ1 )π2 (θ2 | θ1 ) . . . πp (θp | θj , j < p)dθp . . . dθ1
(3.39)

© 2008 by Taylor & Francis Group, LLC


90 PROBABILISTIC AND MODEL-BASED LEARNING
Let us denote it by πθ |X (θ). Once this is obtained, we could estimate the
θi ’s by the values that correspond to one of the posterior modes (i.e., high-
est points of the posterior surface). Or we could use the set {(θ1 , . . . , θp ) :
πθ|X (θ) ≥ 0.95} as a 95% confidence region for θ (called a highest-posterior-
density credible region or HPDCR). However, due to the high dimensions of
the parameter-vectors in real-life problems, computing (3.39) is usually an up-
hill task—especially the high-dimensional integral in the denominator. Over
the years, a number of remedies have been suggested for this. One of them
involves being “clever” with your choice of the prior p.d.f. (or p.m.f.) so that
its functional form “matches” with that of the data-likelihood and as a result,
the product of these two (the joint distribution (3.38)) has a familiar form.
Then the denominator of (3.39) does not actually have to be computed, be-
cause it will simply be the ‘normalizing constant’ of a multivariate p.d.f. or
p.m.f. This is the so-called conjugacy trick. When this cannot be done, there
are some useful analytical or numerical approximations to high-dimensional
integrals (such as the LaPlace approximation) which enables us to approxi-
mate the posterior. When none of these works, we can resort to Markov chain
Monte Carlo (MCMC) techniques. See Section 1 for the basic idea behind it.
There are many variants of it, such as the Gibbs sampler, the Metropolis (or
Metropolis-Hastings) algorithm and so on.
Recall that in Section 3.7, we mentioned statistical decision theory and one of
its main principles (i.e., the minimax principle) in the context of our search
for a “good” estimator. Another fundamental one is the Bayes principle. If δ
is a decision rule (e.g., an estimator, a test function, a classification rule, etc.)
and Rδ (θ) is the associated risk function with respect to some loss function
L(θ, δ), the Bayes risk of δ under the prior distribution π(θ) is defined as
r(π, δ) = Eπ [Rδ (θ). According to the Bayes principle, we should prefer the
decision rule δ1 to a competing decision rule δ2 if r(π, δ1 ) < r(π, δ2 ). If we can
find a decision rule δπ that minimizes r(π, δ) over all decision rules, we call it
the Bayes rule. The associated Bayes risk r(π, δπ ) is often simply called the
Bayes risk of π.
For a decision rule δ, a measure of initial precision is a quantity computed
by averaging over all possible datasets that might be observed. Such a mea-
sure can be computed even before observing any data. Examples are the risk
Rδ (θ), the Bayes risk r(π, δ), the MSE of an estimator, the type I and type II
error-probabilities of a test, and so on. On the other hand, a measure of final
precision is something that can be computed only after observing the data.
Therefore, final precision is a measure conditional on the data. In Bayesian
learning, final precision is considered the most appropriate way to assess the
optimality of a decision rule. To a Bayesian, datasets that might have been
(but were not) observed are not relevant to the inference-drawing activity.
The only relevant dataset is the one actually observed. Does it mean that the
underlying philosophy of Bayesian learning is incompatible with the Bayes
principle itself? To resolve this apparent contradiction, we need to distinguish

© 2008 by Taylor & Francis Group, LLC


BAYESIAN INFERENCE 91
between the normal and the extensive forms of a Bayes rule. The normal
method of finding a Bayes rule is the one discussed above. The extensive
method is based on R the fact that the Bayes risk r(π, δ) for a continuous pa-
rameter θ ∈ Θ is Θ Rδ (θ)π(θ)dθ
Z Z Z Z
= [ L(θ, δ(x))f (x | θ)dx]π(θ)dθ = [ L(θ, δ(x))f (x | θ)π(θ)dθ]dx,
Θ X X θ
where the conditions for switching the order of integration are assumed to be
satisfied and X denotes the sample space. So, in order to minimize r(π, δ), all
we need to do is find a decision rule that minimizes the integrand (inside square
brackets) in the last expression above. If we now denote the denominator of
(3.39) by m(x), where x = {x1 , . . . , xn }, it is easy to
h see that i a decision rule
R f (x|θ )
will minimize r(π, δ) if it minimizes Θ L(θ, δ(x)) m(x) π(θ)dθ. But this
R
last quantity is nothing but Θ L(θ, δ(x))πθ |x (θ)dθ, which is usually called
the Bayes posterior risk of the decision rule δ. In other words, a Bayesian al-
ways seeks a decision rule that minimizes the Bayes posterior risk (a measure
of final precision) and this does not violate the Bayes principle. Next we see
some examples.

Example 3.56 Let X be a single observation from a Binomial(n, θ) popula-


tion, so its p.m.f. is f (x | θ) = n Cx θx (1 − θ)n−x . If π(θ) is the prior p.d.f. of
θ, its posterior p.d.f. will be
θx (1 − θ)n−x π(θ)
πθ|x (θ) = R 1 .
0 sx (1 − s)n−x π(s)ds
As was mentioned earlier, often it will be good enough to know that πθ|x (θ) ∝
θx (1 − θ)n−x π(θ). In any case, the integral in the denominator of πθ|x (θ) turns
out to be difficult to calculate analytically even for some simple priors π(θ).
But one particular choice for π(θ) renders analytical calculation unnecessary
and it is π(θ) = (1/B(a, b))θa−1 (1−θ)b−1 , the Beta(a, b) p.d.f. Then πθ|x (θ) ∝
θx+a−1 (1−θ)n−x+b−1 and clearly it is a Beta(x+a, n−x+b) p.d.f. So, based on
the observed data, Bayesian learning in this case would simply mean updating
the prior p.d.f. parameters from (a, b) to (x + a, n − x + b). This is the so-
called ‘conjugacy trick.’ The Beta family of prior p.d.f.s is a conjugate family
for binomial data. But are we restricting our choice for a prior p.d.f. heavily
for the sake of convenience? The answer is ‘no,’ because the Beta family of
densities provides quite a bit of flexibility in modeling the prior knowledge
about θ as the parameters a > 0 and b > 0 vary.
Once the posterior p.d.f. is obtained, how do we use it to draw inference on the
parameter θ? Intuitively, a reasonable estimate of θ seems to be the posterior
mode. Since the mode of a Beta(s1 , s2 ) density is s1s+s
1 −1
2 −2
(provided that s1 >
x+a−1
1 and s2 > 1), the posterior mode in the beta-binomial scenario is n+a+b−2
as long as n > 1 and 0 < x < n. If in addition, both the prior parameters
a−1
a and b are larger than 1, we can talk about the prior mode a+b−2 . Recall

© 2008 by Taylor & Francis Group, LLC


92 PROBABILISTIC AND MODEL-BASED LEARNING
from Section 3.7 that, based on a single observation from Binomial(n, θ), the
MLE (as well as UMVUE) of θ is X n . It may be interesting to observe that
the posterior estimate of θ (i.e., the posterior mode) is a weighted average of
the prior mode and the MLE. In other words,
    
n X n a−1
posterior mode = + 1− .
n+a+b−2 n n+a+b−2 a+b−2
(3.40)
This is not the end of the story. If, instead of just deciding to use the posterior
mode as the estimator, we take a decision-theoretic approach and try to find
the ‘best’ estimator θ̂ under the squared error loss (in the sense of minimizing
R1
the Bayes posterior risk 0 (θ̂ − θ)2 πθ|x (θ)dθ), the answer is the posterior mean
R1 x+a
0 xπθ|x (θ)dθ. In the beta-binomial scenario, the posterior mean is n+a+b .
Observe once again that
    
x+a n X n a
= + 1− , (3.41)
n+a+b n+a+b n n+a+b a+b
where X/n is the data mean (also the MLE and the UMVUE) and a/(a + b)
is the prior mean. These are examples of what we often see in a Bayesian
inference problem: (1) A Bayesian point estimate is a weighted average of
a commonly used frequentist estimate and an estimate based only on the
prior distribution and (2) the weight allocated to the common frequentist
estimate increases to 1 as the sample-size n −→ ∞. It is often said that the
Bayesian point estimate shrinks the common frequentist estimate towards the
exclusively prior-based estimate.
Another method of inference-drawing based on the posterior distribution is to
construct a credible region for θ. A 100(1−α) % credible region for θ is a subset
C of the parameter space Θ such that P (θ ∈ C | X = x) ≥ 1−α. As is the case
for frequentist confidence intervals, usually there will be many candidates for
C. An ‘optimal’ 100(1 − α) % credible region should have the smallest volume
among them (or, equivalently, we should have πθ|x (θ) ≥ πθ|x (θ′ ) for every
θ ∈ C and every θ′ ∈ / C). This leads us to the concept of a highest posterior
density credible region (HPDCR). The 100(1 − α) % HPDCR for θ is a subset
C ∗ of Θ such that C ∗ = {θ ∈ Θ : πθ|x (θ) ≥ kα }, where kα is the largest real
number satisfying P (θ ∈ C ∗ | X = x) ≥ 1 − α.
If there are Bayesian analogs of classical (or frequentist) point estimation
and confidence-set estimation, you would expect a Bayesian analog of classi-
cal hypothesis testing too. Suppose, as in Section 3.7, that we want to test
H0 : θ ∈ Θ0 against H1 : θ ∈ Θ1 , where Θ0 and Θ1 constitutes a partition of
the parameter space Θ. If we denote P (θ ∈ Θ0 | X = x) by γ, the posterior
γ
odds ratio is defined as 1−γ . Notice that this is a measure of final precision. If
π0 and 1 − π0 denote respectively the prior probabilities of θ being in Θ0 and
π0
Θ1 , the prior odds ratio would be 1−π 0
. The Bayes factor is defined as the
γ(1−π0 )
ratio of these two odds ratios. In other words, it is (1−γ)π0 . If the Bayes factor

© 2008 by Taylor & Francis Group, LLC


BAYESIAN INFERENCE 93
is smaller than 1, our degree of posterior belief in H0 is smaller than that in
H1 . Before we move to the next example, here is an interesting observation
about the Bayes factor. If both Θ0 and Θ1 are singleton (i.e., we are under
the Neyman-Pearson theorem setup), the Bayes factor indeed reduces to the
likelihood-ratio used for finding the MP test in the Neyman-Pearson theorem.

Example 3.57. Let X = {X1 , . . . , Xn } be a random sample from a N (µ, σ 2 )


p.d.f., where µ is unknown but σ 2 is known. Suppose that we choose a N (µ0 , σ02 )
prior density for µ. Then the posterior density πµ|X (µ) will be proportional
to  " n
  !#
1 2 1 X 2
exp − 2 (µ − µ0 ) exp − 2 (xi − µ) ,
2σ0 2σ 1
which in turn is proportional to
   h
1 2
 n i
exp − 2 (µ − 2µµ0 ) exp − 2 (µ2 − 2µx̄) .
2σ0 2σ
After completing the square in the exponent, one can see that the posterior
density of µ is proportional to
x̄ + µ0 (σ 2 /nσ02 )
   
1 2 1 1 n
exp − 2 (µ − µn ) , where µn = and 2 = + 2 .
2σn 1 + σ 2 /nσ02 σn σ02 σ
(3.42)
It should now be clear that the posterior density is N (µn , σn2 ). In other words,
the normal family of priors is a conjugate family for the mean of normal data.
As before, the mode (which coincides with the mean) of this density can be
used as a point estimate of µ. Once again, notice that this point estimate is a
weighted average of the sample mean x̄ and the prior mean µ0 .
Next we shed a little bit of light on the controversial issue of choosing a prior.
The primary concerns that guide our choice of a prior p.d.f. (or p.m.f.) are (a)
its ability to adequately represent the extent and nature of the prior informa-
tion available and (b) computational convenience. There are three main ways
of choosing a prior p.d.f. or p.m.f.: (a) subjective, (b) objective (informative)
and (c) noninformative. A subjective choice is the most controversial, since it
exclusively reflects the degree of one’s personal belief about θ. For example,
often in a real-life scientific experiment, expert’s opinion may be available re-
garding the unknown parameters involved from people who are highly trained
or experienced in that field. The problem with eliciting a prior from this kind
of opinion is that often experts don’t agree and put forward conflicting or
contradictory opinions. Objective and informative priors are less controversial
since they are based on either historical records about the parameter-values
themselves or data from previous experiments that contain information about
the parameters. In the latter case, the posterior densities or p.m.f.s obtained
from such older datasets can be used as priors for the current problem at
hand. Or one could possibly combine the older datasets with that for the
current problem and enjoy a much bigger sample-size. The question that nat-

© 2008 by Taylor & Francis Group, LLC


94 PROBABILISTIC AND MODEL-BASED LEARNING
urally comes to mind is when (if at all) these two approaches will yield the
same posterior distributions for the parameters in the current study. It will
happen only if the older datasets and the current dataset can be considered
statistically independent (to be more precise, conditionally independent given
the parameters). A noninformative prior is so called because it is supposed
to reflect the extent of ignorance about the parameter(s). Such a prior is also
sometimes called a diffuse prior or a vague prior or a reference prior. This con-
cept may be confusing at times, since, for example, a flat prior (i.e., one that
is constant over the parameter space) is not necessarily noninformative just
because it is flat. In general, a noninformative prior is one that is ‘dominated’
by the likelihood function in the sense that it does not change much over the
region in which the likelihood is reasonably large, and also does not take large
values outside that region. Such a prior has also been given the name locally
uniform. Often we feel that the best reflection of our ignorance about θ is
a constant prior density over an infinite parameter space or a nonconstant
one that is so heavy-tailed that it does not integrate to 1. A prior density of
this sort is called an improper prior. Such a prior density is not automatically
disallowed as invalid, because it may still lead to a proper posterior density
that integrates to 1. In many complicated real-life problems, Bayesians re-
sort to hierarchical modeling. Such models often provide better insights into
the dependence structure of the observed data (that may consist of response
variables, covariates, etc.) and the unknown parameters and also help break
down the overall variability into different layers. For instance, in Example
3.57, assuming both µ and σ 2 to be unknown, we could choose a N (µ0 , σ02 )
prior for µ and a Gamma(α, β) prior (independently of µ) for 1/σ 2 . If there
is uncertainty in our mind about the parameters µ0 , σ02 , α and β, we can cap-
ture this uncertainty by imposing prior densities on them (e.g., a normal prior
on µ0 , uniform priors on σ02 , α and β). These will be called hyperpriors and
their parameters, hyperparameters. We may be reasonably certain about the
hyperparameters, or sometimes they are estimated from the observed data
(an approach known as empirical Bayes). We conclude this discussion with an
example of a special noninformative prior that is widely used.

Example 3.58. Suppose that θ = (θ1 , . . . , θm ). Recall the definition of a


Fisher information matrix (FIM) from Section 3.4. Let us denote
h 2 it by I(θ).
∂ logf (X|θ )
i
th
It can be shown that the (i, j) entry of the m × m FIM is −E ∂θi ∂θj .
The prior density π(θ) ∝ det(I(θ))0.5 is known as the Jeffreys’ prior (where
‘det’ stands for the determinant of a matrix). When our data come from a
n
Binomial(n, θ) distribution, the FIM is just a scalar (= θ(1−θ) ). So the Jeffreys’
prior in this case will be ∝ [θ(1 − θ)] −0.5
, which is nothing but a Beta( 21 , 12 )
density. When our data {X1 , . . . , Xn } come from a Normal(θ1 , θ22 ) p.d.f., the
FIM is a diagonal matrix with diagonal entries n/θ22 and 2n/θ22 . So the Jef-
freys’ prior will be π(θ1 , θ2 ) ∝ θ12 on the upper half of the two-dimensional
2
plane.

© 2008 by Taylor & Francis Group, LLC


BAYESIAN INFERENCE 95
We conclude with a brief discussion of Bayesian computation. As indicated
earlier, MCMC algorithms play a central role in Bayesian inference. Before we
take a closer look at them, let us try to understand the Monte Carlo principle.
The idea of Monte Carlo (MC) simulation is to draw a set of i.i.d. observations
{xi }ni=1 from a target p.d.f. f (x) on a high-dimensional space X . This sample
of size n can be used to approximate Pn the target density with the empirical
point-mass function fn (x) = n1 1 δxi (x), where δxi (x) denotes Dirac’s delta
function that takes the value 1 if Rx = xi and 0 otherwise. As a result, one
can approximate integrals such as X g(x)f (x)dx with sums like n1 n1 g(xi ),
P
because the latter is an unbiased estimator of the former and is strongly
consistent for it as well (by the strong law of large numbers). In addition,
the central limit theorem (CLT) gives us asymptotic normality of the MC
approximation error. For example, if f (x) and g(x) are univariate functions
(i.e., X is some subset of R) such that
R the variance of g with respect to f is
finite [i.e., σg2 = X g 2 (x)f (x)dx − ( X g(x)f (x)dx)2 < ∞], then according to
R

the CLT,
( n )
√ 1X
Z
n g(xi ) − g(x)f (x)dx =⇒ N (0, σg2 )
n 1 X

as n −→ ∞, where =⇒ means convergence in distribution. So it should be


clear that in order to take advantage of the MC principle, we must be able
to sample from a p.d.f. If it is a standard p.d.f. (e.g., normal, exponential or
something else whose CDF has a closed-form expression), there are straight-
forward procedures for sampling from it. However, if it is non-standard (e.g.,
one with an ugly, irregular shape and no closed-form CDF) or is known only
upto a proportionality-constant, sampling from it will be tricky and we need
some special technique. One of them is rejection sampling, where we sam-
ple from a proposal density f ∗ (x) that is easy to sample from and satisfies:
f (x) ≤ Kf ∗ (x) for some K < ∞. Having sampled an observation x∗i from f ∗ ,
we use the following acceptance-rejection scheme: Generate a random variable
U ∼ Uniform[0, 1] and accept x∗i if U < f (x∗i )/[Kf ∗ (x∗i )]; otherwise reject it
and sample another observation from f ∗ to repeat this procedure. If we con-
tinue this process until we have n acceptances, it can be easily shown that the
resulting sample of size n is from f (x). Although it is an easy-to-implement
scheme, it has serious drawbacks in the sense that it is often impossible to
bound f (x)/f ∗ (x) from above by a finite constant K uniformly over the entire
space X . Even if such a K can be found, often it is so large that the acceptance
probability at each step is very low and the process therefore becomes ineffi-
cient. So an alternative procedure has been tried. It is known as importance
sampling. Here we once R again introduce a proposal density f ∗ (x) and real-
ize that the integral X g(x)f (x)dx can be rewritten as X g(x)w(x)f ∗ (x)dx,
R

where w(x) = f (x)/f ∗ (x) is usually called the importance weight. As a re-
sult, all we need to do is to draw n i.i.d. observations x∗1 , . . . , x∗n from f ∗ and
evaluate w(x∗i ) for each Rof them. Then, following
Pn the MC principle, we will ap-
proximate the integral X g(x)f (x)dx by 1 g(x∗i )w(x∗i ). This is once again

© 2008 by Taylor & Francis Group, LLC


96 PROBABILISTIC AND MODEL-BASED LEARNING
an unbiased estimator and, under fairly general conditions on f and f ∗ , is
strongly consistent as well. Like rejection sampling, this procedure is easy to
implement, but choosing an appropriate proposal density may be tricky. Often
the criterion that is used
Pfor this choice is the minimization of the variance of
n
the resulting estimator 1 g(x∗i )w(x∗i ). That variance, computed with respect
to the proposal density f ∗ , is given by
Z Z 2
2 2 ∗ ∗
varf ∗ (g(x)w(x)) = g (x)w (x)f (x)dx − g(x)w(x)f (x)dx .
X X

Clearly, minimizing this with respect to f is equivalent to minimizing just
the first term on the right-hand side. We can apply Jensen’s inequality (which
says that E(h(Y )) ≥ h(E(Y )) for any nonnegative random variable Y and any
convex function h such that E(Y ) and E(h(Y )) are finite)
R to get the lower
bound ( X | g(x) | w(x)f ∗ (x)dx)2 , which is nothing but ( X | g(x) | f (x)dx)2 .
R

So in order to achieve Rthis lower bound, we must use the proposal density
f ∗ (x) =| g(x) | f (x)/[ X | g(x) | f (x)dx]. Sometimes it is easy to sample
from this proposal density, but more often it is difficult. In those cases, one
may have to resort to a Markov chain Monte Carlo (MCMC) sampling scheme
such as the Metropolis-Hastings (MH) algorithm or the Gibbs sampler (GS).
We first describe the MH algorithm, since GS can be viewed as a special case
of it.
The MH algorithm is named after N. Metropolis who first published it in
1953 in the context of the Boltzmann distribution, and W. K. Hastings who
generalized it in 1970. Suppose we want to sample from the density f (x).
This algorithm generates a Markov chain {x1 , x2 , . . .} in which each xi de-
pends only on the immediately preceding one (i.e., xi−1 ). Assume that the
current state of the chain is xt . To move to the next state, the algorithm
uses a proposal density f ∗ (x; xt ) which depends only on the current state and
is easy to sample from. Once a new observation x∗ is drawn from the pro-
posal density and a random variable U is generated from the Uniform[0,1]
density, x∗ is accepted to be the next state of the chain (i.e., we declare
xt+1 = x∗ ) if U < min{1 , f (x∗ )f ∗ (xt ; x∗ )/[f (xt )f ∗ (x∗ ; xt )]}. Otherwise we
declare xt+1 = xt . One commonly used proposal density is the normal den-
sity centered at xt and having some known variance σ 2 (or known variance-
covariance matrix σ 2 I in the multivariate case). This proposal density will
generate new sample-observations that are centered around the current state
xt with a variance σ 2 . Incidentally, this choice for f ∗ would be allowed under
the original Metropolis algorithm too, which required the proposal density to
be symmetric (i.e., f ∗ (xt ; x∗ ) = f ∗ (x∗ ; xt )). The generalization by Hastings
removed this ‘symmetry’ constraint and even allowed proposal densities to be
just a function of xt (i.e., to be free from x∗ ). In this latter case, the algorithm
is called independence chain Metropolis-Hastings (as opposed to random walk
Metropolis-Hastings when the proposal density is a function of both xt and
x∗ ). While the ‘independence chain’ version can potentially offer higher accu-
racy than the ‘random walk’ version with suitably chosen proposal densities,

© 2008 by Taylor & Francis Group, LLC


EXERCISES 97
it requires some a priori knowledge of the target density. In any case, once the
Markov chain is initialized by a starting value x0 , it is left running for a long
time (the ‘burn-in’ period) to ensure that it gets ‘sufficiently close’ to the tar-
get density. During the burn-in period, often some parameters of the proposal
density (e.g., the variance(s) in the case of a normal proposal density) have
to be ‘fine-tuned’ in order to keep the acceptance rate moderate (i.e., slightly
higher than 50%). This is because the acceptance rate is intimately related
to the size of the proposal-steps. Large proposal-steps would result in very
low acceptance rates and the chain will not move much. Small proposal-steps
would lead to very high acceptance rates and the chain will move around too
much and converge slowly to the target density (in which case, it is said to be
slowly mixing).
Now suppose that we have a p-dimensional density f (x1 , . . . , xp ) = f (x) as our
target. Also suppose that for each i (1 ≤ i ≤ p), the univariate conditional den-
sity of xi given all the other variables (call it fi (xi | x1 , . . . , xi−1 , xi+1 , . . . , xp ))
is easy to sample from. In this case, it is a good idea to choose the proposal
density: f ∗ (x∗ ; xt ) = fj (x∗j | x−j,t ) if x∗−j = x−j,t and = 0 otherwise. Here
x−j,t means the current state xt with its j th coordinate removed and x∗−j
means the newly drawn sample-observation x∗ with its j th coordinate re-
moved. A simple calculation shows that, under this choice, the acceptance
probability will be 1. In other words, after initializing the Markov chain by
setting xi = xi,0 for 1 ≤ i ≤ p, this is how we move from the current state xt
to the next state xt+1 : First sample x1,t+1 from f1 (x1 | x2,t , . . . , xp,t ); next
sample x2,t+1 from f2 (x2 | x1,t+1 , x3,t , . . . , xp,t ); . . .; finally sample xp,t+1 from
fp (xp | x1,t+1 , . . . , xp−1,t+1 ). This is known as the deterministic scan Gibbs
sampler. Since it is a special case of the MH algorithm described above, we
can actually insert MH steps within a Gibbs sampler without disrupting the
properties of the underlying Markov chain. As long as the univariate condi-
tional densities (often collectively called the full conditionals) are familiar or
easy to sample from, we will follow the Gibbs sampling scheme, but if one of
them is a bit problematic, we will deal with it using the MH technique and
then get back to the Gibbs sampling scheme for the other ones.

3.10 Exercises

1. Prove Boole’s inequality: For any two sets A and B, P (Ac ∩ B c ) ≥ 1 −


(P (A) + P (B)).

2. Suppose you are drawing two cards (with your eyes closed) one by one with-
out replacement from a well-shuffled deck of 52 cards. How many outcomes
are there in the sample space? What are the chances that the two cards are
of different colors? That they belong to different suites? Given that the first
card turned out to be black, what are the chances that the second card will

© 2008 by Taylor & Francis Group, LLC


98 PROBABILISTIC AND MODEL-BASED LEARNING
be the queen of clubs?

3. If your company has a twelve-member management team with a third of


them being women, what are the chances that a committee of four people
randomly chosen from them will have no woman at all? Will have at least one
man? Will have all women?

4. How many distinct ten-digit phone numbers are possible if the first digit of
the area code, as well as the first digit of the three-digit exchange number, is
not allowed to be zero? If you are randomly choosing such a phone number,
what are the chances that it will have an area code of Chicago (i.e., 312)?

5. Suppose you are randomly permuting the letters of the alphabet. What are
the chances that the vowels are together in the correct order AEIOU? That
the vowels are together (in any order)? That the positions of the vowels are
multiples of 5 (i.e., 5th , 10th , . . . , 25th )?

6. Two points are chosen at random on a line-segment of unit length. Find


the probability that each of the three parts thus formed will have length > 51 .

7. In a group of 23 randomly selected people, what are the chances that at


least two will share a birthday? Answer the same question for a group of 35
people.

8. You learn from the local newspaper that there have been 5 automobile
accidents in your town in the last 7 days. What are the chances that they all
happened on the same day? That they happened on 5 different days? That at
least two of them happened on the same day?

9. In a manufacturing plant, each product undergoes four independent inspec-


tions. The probability that a defective product is detected at each inspection
is 0.9. What are the chances that a defective product escapes detection by all
four inspections? That it is detected only by the very last inspection?

10. A fair coin is tossed repeatedly. How many tosses must be made so that
the chances of at least one TAIL occurring is more than 90% ?

11. Show that if two different coins (both with the same P (H) = p) are be-
ing repeatedly tossed independently of one another and Xi is the number of
tosses needed for the ith coin (i = 1, 2) to produce the first HEAD, the p.m.f.
of Y = X1 + X2 is the same as it would be if Y counted the number of tosses

© 2008 by Taylor & Francis Group, LLC


EXERCISES 99
of a fair coin needed to see the second head.

12. Write down P (X = k) where X has a Binomial(n, p) p.m.f. Then take its
limit as n → ∞ and p → 0 with np remaining constant. Show that you get a
Poisson p.m.f. as a result.

13. Show that each of the following functions is a legitimate p.d.f. on the real
line and find its mean if you can: (a) f (x) = 21 e−|x| , (b) f (x) = π(1+x
1
2 ) . [Note:

The first one is actually known as a bilateral exponential or Laplace p.d.f. and
the second one is known as a Cauchy p.d.f.]

14. Suppose X1 , . . . , Xn are i.i.d. continuous random variables having a com-


mon p.d.f. f (x) and c.d.f. F (t). Let Y = max1≤i≤n Xi and Y ∗ = min1≤i≤n Xi .
Find the c.d.f. of Y and that of Y ∗ . From these, find their p.d.f.’s. Inciden-
tally, Y and Y ∗ are respectively known as the largest and the smallest order
statistic associated with the sample {X1 , . . . , Xn }.

15. Let X1 , . . . , Xn be i.i.d. having an Exponential(β) p.d.f. Find the p.d.f.


and the rth raw moment of their smallest order statistic.

16. Let Y1 and Y2 be i.i.d. Poisson(λ) random variables and X = max(Y1 , Y2 ).


Show that (i) E(X) is between λ and 2λ; (ii) E(X) is between λ + e−λ − e−2λ
and 2(λ + e−λ ) − 1 − e−2λ .

17. If X has a Normal(0,1) p.d.f., find that p.d.f. of Y =| X |. This is known


as the folded normal p.d.f. Compute the relative entropy of this p.d.f. with
respect to an Exponential(1) p.d.f. and vice versa.

18. For X ∼ Normal(µ, σ 2 ), find the Fisher information matrix for its two
parameters.

19. Let {X1 , . . . , Xn } be an i.i.d. sample from the Gamma(α, β) p.d.f. Can
you find the maximum likelihood estimates of its two parameters?

20. Suppose {X1 , . . . , Xn } are i.i.d. having a zero-inflated Poisson p.m.f. with
parameters ω ∈ (0, 1) and λ > 0, that is, P (Xi = 0) = ωI(Xi = 0)+(1−ω)e−λ
and P (Xi = k) = (1 − ω)e−λ λk /k! for k = 1, 2, . . .. Find the method-of-
moments estimators for its two parameters.

21. Suppose an insect is laying its eggs on tree-leaves. The number of eggs (X)

© 2008 by Taylor & Francis Group, LLC


100 PROBABILISTIC AND MODEL-BASED LEARNING
it lays on a leaf has a Poisson(λ) p.m.f. Given X = x, the number of eggs (Y )
among them that will ultimately hatch has a Binomial(x, p) conditional p.m.f.
If we have just one observation-pair x1 and y1 , assume conjugate priors on
the two parameters and find their posteriors. If we only had observation(s) on
Y , can you choose a conjugate prior to keep the posterior computation simple?

22. Suppose X1 , . . . , Xn are i.i.d. observations from a Normal(µ, σ 2 ) p.d.f. As-


sume a Gamma(α, β) prior density on 1/σ 2 and given σ 2 , assume a Normal(µ0 ,
τ σ 2 ) prior on µ for some known τ > 0. Find out the posterior densities for
the parameters.

23. Suppose X1 , . . . , Xn are i.i.d. observations from a Poisson(λ) p.m.f. Find


out the Jeffreys’ prior for λ. What family of prior densities is the conjugate
family in this case? Assume a conjugate prior on λ and find out the posterior
density.

References

[1] Bhat, U.N. (1984) Elements of Applied Stochastic Processes. New York: Wiley.
[2] Cramér, H. (1946) Mathematical Methods of Statistics. Princeton University
Press.
[3] Dempster, A.P., Laird, N.M. and Rubin, D.B. (1977) Maximum Likelihood
from Incomplete Data via the EM Algorithm. In Journal of the Royal Statistical
Society. Series B (Methodological) 39:1, pp. 1–38.
[4] Efron, B. (1979) Bootstrap Methods: Another Look at the Jackknife. In The
Annals of Statistics 7:1, pp. 1–26.
[5] Ewens, W.J. and Grant, G. (2001) Statistical Methods in Bioinformatics: An
Introduction. New York: Springer-Verlag.
[6] Leon, S.J. (1998) Linear Algebra with Applications. Prentice-Hall.
[7] Mood, A.M.F., Graybill, F.A. and Boes, D.C. (1974) Introduction to the Theory
of Statistics. McGraw-Hill; Kogakusha.
[8] Press, W.H., Teukolsky, S.A., Vetterling, W.T. and Flannery, B.P. (1986) Nu-
merical Recipes: The Art of Scientific Computing. Cambridge University Press.
[9] Rao, C.R. (1965) Linear Statistical Inference and its Applications. New York:
Wiley.
[10] Rohatgi, V.K. and Saleh, A.K.M.E. (2001) An Introduction to Probability and
Statistics. New York: Wiley.
[11] Schervish, M.J. (1996) Theory of Statistics. Springer.
[12] Shmueli, G., Minka, T.P., Kadane, J.B., Borle, S. and Boatwright, P. (2005)
A useful distribution for fitting discrete data: revival of the Conway-Maxwell-
Poisson distribution. In Journal of the Royal Statistical Society Series C (Applied
Statistics). 54:1, pp. 127–142.

© 2008 by Taylor & Francis Group, LLC


CHAPTER 4

Classification Techniques

4.1 Introduction and Problem Formulation

The area of classification also known as pattern recognition and supervised


learning has grown substantially over the last twenty years, primarily due to
the availability of increased computing power, necessary for executing sophis-
ticated algorithms. The need for classification arises in most scientific fields,
ranging from disease diagnosis, to classifying galaxies by shape, to text and
image classification, to applications in the financial industry, such as decid-
ing which customers are good credit risks or constructing efficient portfolios,
just to name a few. In bioinformatics, examples of classification tasks include
classification of samples to different diseases based on gene and or protein
expression data, prediction of protein secondary structure and identification
and assignment of spectra to peptides and proteins obtained from mass spec-
trometry. It should be noted that the emergence of genomic and proteomic
technologies, such as cDNA microarrays and high density oligonucleotide chips
and antibody arrays, gave a big impetus to the field, but also introduced a
number of technical challenges, since the availability of more features (vari-
ables) than samples represented a shift in the classical paradigm.
The field of classification originated with the work of Fisher [15] and experi-
enced fast growth in the subsequent 40 years with the introduction of flexible
classification techniques, such as nearest neighbor classifiers, the perceptron
and neural networks. More recently, more computationally flexible classifiers
were proposed in the literature, such as classification trees, support vector
machines, as well as regularized versions of more classical classifiers. Finally,
over the last ten years ensemble methods emerged such as bagging and boost-
ing, based in PAC learning theory [41] which established that classifiers whose
performance is slightly better than random guessing when appropriately com-
bined can exhibit a superior performance.
On the theoretical front, some of the major developments include the develop-
ment of a general statistical decision framework for classification (see below)
and the connection of the problem to learning theory. The objective of learning
theory is to study mathematical properties of learning machines. Such prop-
erties are usually expressed as those of the function class that the learning
machine can implement (see below).

101

© 2008 by Taylor & Francis Group, LLC


102 CLASSIFICATION TECHNIQUES

Figure 4.1 Parallel coordinates plot for the iris data.

The classification problem in layman’s terms is as follows: given a number of


measurements on a particular object, assign the object to one of a prespec-
ified fixed number of classes (groups). The following examples provide some
motivation about the task at hand.
Example 1: The goal is to assign an iris plant to one of the following three
classes, setosa, virginica, versicolor, using information on the length and width
of its petals and sepals. In order to achieve this goal, data on 150 plants were
collected. Figure 4.1 shows the profiles (in a parallel coordinates plot) of 150
plants, 50 from each class [15]. It can be immediately seen that petal length
(PL) and width (PW) separate the three classes well enough. The scatterplot
of these variables given in Figure 4.2 shows a fairly clean separation of the
three classes.
Example 2: This example comes from forensic testing of glass used by Evett
and Spiehler from the Central Research Establishment, Home Office Foren-
sic Science Service. The variables are the refractive index and weight percent
of the following oxides: sodium, magnesium, aluminum, silicon, potassium,
calcium, barium and iron. The six possible classes are: A=Building windows
(float processed) (Green), B=Building windows (nonfloat processed) (Red),
C=Vehicle windows (Yellow), D=Containers (Blue), E=Tableware (Pink),
and F=Headlamps (Orange). Figure 4.3 shows the profiles (in a parallel coor-
dinates plot) of 214 cases; 70 from A, 76 from B, 17 from C, 13 from D, 9 from
E and 29 from F. Some discrimination between glass types is apparent even
from single attributes. For example class F is high on barium and aluminum
and low on magnesium, while class A is high on magnesium. Nevertheless, the
goal of assigning objects to their appropriate classes seems more difficult in
this case than in the iris dataset.

© 2008 by Taylor & Francis Group, LLC


THE FRAMEWORK 103

Figure 4.2 Scatterplot of petal length and petal width for the iris data.

Figure 4.3 Parallel coordinates plot for the glass data.

4.2 The Framework

Suppose we have collected data on N objects. Each object is characterized


by an attribute, or feature, vector x comprised of p elements, belonging to a
suitable space (e.g., a subset of Rp or Zp ). Each object needs to be classified
into (assigned to) one of K prespecified classes (groups, types). In order to
achieve this goal we need to design a decision rule (ĉ) that would assign
object i with attribute vector xi to class ck , k = 1, ..., K
ck ← ĉ(xi ). (4.1)

© 2008 by Taylor & Francis Group, LLC


104 CLASSIFICATION TECHNIQUES
A good classification rule would be one that minimizes “inaccuracy.”

4.2.1 A decision theoretic framework

Let C denote the class label of a random feature vector x ∈ Rp . Assume


that the prior probability in the population is given by πk = P (C = k), k =
1, · · · , K. Let ĉ(x) : Rp → {1, · · · , K, D} be a decision or classification rule,
with D denoting the in doubt option.
In order to determine whether a classification rule is ‘good’ or not, we need a
loss function that measures its quality. In classification, the most commonly
used loss function is the 0/1 loss; i.e., L(ℓ, k) = 1, if the rule assigns the object
to class ℓ but the true class is k, and 0 otherwise. Further, we assume that
L(ℓ, D) = d for all classes k (see [33]). Finally, assume that the observations
from class k have a class conditional distribution function denoted by pk (x).
The risk function for classifier ĉ is the expected loss as a function of the
unknown class k:
R(ĉ, C = k) = Ex [L(ĉ, k)|C = k]
K
X
= L(ℓ, k)P (ĉ = ℓ|C = k) + L(D, k)P (ĉ = D|C = k)
ℓ=1
where the expectation is taken with respect to the distribution of the feature
vector x.
The total risk is the total expected loss, viewing both the class C and the
vector x as random:
K
X K
X
R(ĉ) = Ek,x R(ĉ, C) = πk P (ĉ(x) 6= k|C = k)+d πk P (ĉ(x) = D|C = k).
k=1 k=1

This gives the overall misclassification probability plus d times the overall
doubt probability.
πk p(k|x)
Let p(k|x) = P (C = k|x = x) = PK be the posterior probability of
πℓ p(ℓ|x)
ℓ=1
class k given a feature vector x = x.

Proposition: Suppose that both the prior probabilities πk , k = 1, · · · , K and


the class conditional densities p(k|x) are known. Then, the classification rule
which minimizes the total risk under the 0/1 loss function is given by

k if p(k|x) = max1≤ℓ≤K p(ℓ|x) and exceeds 1 − d
c(x) =
D if each p(k|x) ≤ 1 − d.

Proof: We have that


Z
R(ĉ) = Ex [Ek [L(ĉ(x), C)|x = x]] = E[L(ĉ(x, C))|x = x]p(x)dx

© 2008 by Taylor & Francis Group, LLC


THE FRAMEWORK 105
PK
where p(x) = ℓ=1 πℓ pℓ (x) is the marginal density for x. It suffices to mini-
mize the conditional expectation for each x separately, which can be written
as
XK
L(c, ℓ)p(ℓ|x)
ℓ=1
with respect to c for each x. For c = D we have that
K
X
L(ℓ, D)p(ℓ|x) = d.
ℓ=1
Under our loss function, it is easy to see that the minimum is given by
1 − p(1|x), 1 − p(2|x), ..., 1 − p(K|x), d
for ĉ = 1, 2, ..., K, D, respectively. So, the solution is given by the
max{max1≤ℓ≤K p(k|x), 1 − d}.
Under the 0/1 loss function, another way to write the optimal classification
rule is to choose the class with the highest πk p(k|x), provided that it exceeds
(1 − d)p(x).
The optimal classification rule is referred to in the literature as the Bayes rule
[33]. When two or more classes attain the maximal posterior probability, the tie
can in principle be broken in an arbitrary fashion. The value R(c) of the total
risk for the Bayes rule is called the Bayes risk. This value is the best one can
achieve if both the prior probabilities πk and the class conditional distributions
pk (x) are a priori known; hence, it provides a theoretical benchmark for all
other procedures.
Some algebra shows that without the in doubt option, for a two class problem
the Bayes risk is given by E min{p(1|x), p(2|x)}, while for K classes by E[1 −
maxk p(k|x)].

Example: In order to illustrate the decision theoretic framework, we look


at an example involving two normal populations with common covariance
matrix (the one-dimensional case is illustrated in Figure 4.4). Assume that
pk (x) ∼ N (µk , Σ), k = 1, · · · , K and disregard the doubt option. Then, an
observation with feature vector x = x is allocated to the class k with smallest
value of δ(x, µk ) − 2 log πk (by calculating the posterior probability), where
δ(x, µk ) = [(x − µk )′ Σ−1 (x − µk )]1/2 ,
the Mahalanobis distance between the mean µk of class k and the observa-
tion x. Notice that the quadratic term x′ Σ−1 x is common to all classes and
therefore the optimal rule can be written as
minimize − 2µ′k Σ−1 x + µ′k Σ−1 µk − 2 log πk , over k = 1, · · · , K.
If all classes are equally likely, then an observation with feature vector x is
classified to the nearest population in the sense of having the smallest Maha-
lanobis distance to its mean.

© 2008 by Taylor & Francis Group, LLC


106 CLASSIFICATION TECHNIQUES

Figure 4.4 Demonstration of decision boundary in the case of two normal populations
with equal variances.

4.2.2 Learning a classification rule c(x)

Notice that the theoretical framework previously defined assumes perfect


knowledge of the prior distribution over classes and in particular of the class
conditional distributions (or densities).
In order to make this decisions theoretical framework operational, a training
data set T = {ci , xi }N
i=1 will be used to “learn” a classification rule ĉ(x|T ), by
estimating p̂(k|x, T ). Notice that under very mild conditions, the frequency of
Nk /N in T (i.e., the number of observations of class k in the training data over
the total size of the training data) is a consistent estimate of πk . Two widely
used approaches for learning c(x) are: (i) parametric and (ii) nonparametric
methods. In parametric methods, the class conditional densities are explicitly
specified (e.g., multivariate normal or t distribution) and the goal becomes to
learn their parameters from the training data. In nonparametric methods, the
class conditional densities themselves are estimated from the training data.
In what follows, we review these approaches, together with some more recent
developments for estimating the decision rule.

4.2.3 Assessing the performance of classification rules

The performance of the classification rule c(x) is usually assessed by calculat-


ing the misclassification error rate; i.e., the probability of making an incorrect
classification for a future randomly sampled observation. The apparent error
rate is the proportion of mistakes made, when classifying either a training or
an independent test data set. If the training set is used, the error rate will

© 2008 by Taylor & Francis Group, LLC


THE FRAMEWORK 107
usually be biased downwards, since the training data set was used both for
constructing the classifier and also assessing its performance. Hence, an in-
dependent test data set is preferable for performance assessment purposes.
The error rate is calculated by classifying each observation in the test data,
counting the errors and dividing by the size of the test data set. This measure
is clearly unbiased, but can be highly variable. Further, the use of an inde-
pendent test set wastes data that could have been used for training purposes,
especially in cases where labeled examples are expensive to acquire, which is
often the case in biological applications. In order to overcome this difficulty,
the idea of cross-validation proves useful. Suppose that the training data T
are partitioned into M pieces. Then, one part can be used as the test set and
the remaining M − 1 pieces for training purposes and this exercise can be re-
peated M times. Each estimate of the error rate is unbiased and by averaging
over the M estimates the variability is reduced. The extreme version of this
strategy is to take M = N , the so called leave-one-out cross validation [31].
However, this is computationally the most demanding strategy. Further, ex-
cluding one observation leads to assessment of the classifier through O(1/N )
perturbations from T .√But the variability in the parameter estimates is usu-
ally of the order O(1/ N ), which implies that for large sample sizes they are
calculated from smaller perturbations. Thus, cross validated estimates in this
case can be rather variable; on the other hand, a smaller M may lead to larger
bias, but smaller variance and consequently mean squared error.

4.2.4 Connection to statistical learning theory

In Section 2.1, a decision theoretic framework was introduced for deriving


optimal classification rules. It was shown that an optimal rule minimizes the
Bayes risk. In practice, since the true distribution of the data is unknown and
has to be estimated, one is interested in minimizing the empirical counterpart
of the Bayes risk, defined as:
1X
Rn (c) = I(c(xi ) 6= yi ), (4.2)
n
i∈T

where I(·) denotes the indicator function and yi the label of observation i in the
training data set T . The empirical Bayes risk corresponds to misclassification
error rate in T ; i.e., the average number of misclassifications in the training
data.
Since the risk R(c) can not be computed directly, but only approximated by
Rn (c), it is not reasonable to look at classifiers (functions) that minimize Rn (c)
among all possible functions. The reason is that one can always construct such
a function that performs perfectly on the training data and always misclassifies
new observations. Hence, avoiding over-fitting the training data becomes an
important consideration. This can be achieved in two ways: (i) restrict the
class of functions (classification rules) over which the minimization takes place

© 2008 by Taylor & Francis Group, LLC


108 CLASSIFICATION TECHNIQUES
and (ii) modify the optimization criterion; for example, by adding a term that
penalizes ‘complicated’ functions, or in other words regularize the problem
under consideration.
A classification rule trained on n observations (cn (x)) is designed to map in-
puts (variables x) to outputs (class labels). Its risk is a random variable R(cn )
(since it depends on the data) and can not be computed directly. Statistical
learning theory is interested in producing bounds for the following quantities:
• Error bound for the estimation of the risk from an empirical quantity.
• Error bound for the rule given the functional class it is assumed to belong
to.
• Error bound relative to the Bayes risk.
These questions have attracted a lot of attention over the last decade; a good
overview is given in Vapnik’s book [43], in Scholkopf et al. book [35] and in
the review paper by Bousquet et al. [4].

4.3 Classification Methods

In this section, we discuss a number of widely used in practice classification


methods.

4.3.1 Classification rules via probability models

Linear and Quadratic Discriminant Analysis

The objects in class k are assumed to be normally distributed with mean vector
µk and covariance matrix Σk . Then, the Bayes rule decision rule chooses for
each observation with feature vector x the class k that minimizes
Qk (x) = −2 log(p(x|k)−2 log(πk ) = (x−µk )′ Σ−1
k (x−µk )+log |Σk |−2 log(πk ).
(4.3)
The first term of (4.3) corresponds to the Mahalanobis distance of object i
from the center of class k. This rule is known in the literature as quadratic
discriminant analysis.
The expression in (4.3) simplifies if one is willing to assume equal covariance
matrices amongst the K groups; i.e., Σ1 = · · · = ΣK ≡ Σ. In that case the
rule minimizes,
Qk (x) = −2 log(p(x|k) − 2 log(πk ) = µk Σ−1 x + µ′k Σ−1
k µk − 2 log(πk ). (4.4)

Therefore, the rule becomes linear in the data x. For a 2-class problem, it
corresponds to Fisher’s linear discriminant that was derived based on a differ-
ent criterion. The above rule is known in the literature as linear discriminant
analysis.

© 2008 by Taylor & Francis Group, LLC


CLASSIFICATION METHODS 109
In practice, the following quantities need to be estimated from the training
data set T by their sample counterparts: µk and Σk . The maximum likelihood
estimatesP are given by µ̂k = X̄k (the multivariate mean for each class k and
Σ̂k = n1k nj=1
k
(xj − µ̂k )(xj − µ̂k )′ . For linear discriminant analysis, the pooled
PK
covariance estimate Σ̂ = k=1 nk /N Σ̂k is used. Often the bias-corrected es-
timator of Σ with divisor N − K is used, but makes very little difference to
the linear rule (and none if the class prior probabilities πk are the same).

It should be noted that in linear discriminant analysis Kp + p(p + 1)/2 param-


eters need to be estimated from the training data, while Kp + Kp(p + 1)/2
for quadratic discriminant analysis. This suggests that unless there are suffi-
cient training data for each class, parameter estimates can be rather volatile,
which in turn implies that the quadratic rule can be well outperformed by
the linear one for moderate sample sizes. For this reason, in practice a di-
agonal version of quadratic discriminant analysis is often employed, where
Σk = diag(σjk ), j = 1, · · · , p.

Another multivariate distribution used for classification purposes is the multi-


variate t with a moderate number of degrees of freedom, that exhibits heavier
tails than the multivariate normal. It can be thought of as a flexible model
for distributions with elliptical densities with heavy tails. The density for a
p-variate vector x with ν > 2 degrees of freedom is given by
Γ( 21 (ν + p)) 1 −1/2(ν+p)
p(x|k) = |Σ|−1/2 1 + (x − µk )′ Σ−1
k (x − µk ) . (4.5)
(νπ)p/2 Γ(ν/2) nu
The optimal classifier minimizes
ν +p 1  1
Qk (x) = log 1 + (x − µk )′ Σ−1
k (x − µk ) + log |Σk | − log(πk ). (4.6)
2 ν 2
If the covariance matrix is common to all classes, a linear rule is once again
obtained. The effect of the heavier tails of the t distribution is to down-weigh
observations which are far from the class mean.

An illustration of the quadratic type of decision boundaries produced by lin-


ear and quadratic discriminant analysis is given in Figures 4.5-4.6. It can be
seen that the linear discriminant analysis misclassifies four observations, while
the more flexible boundary of quadratic discriminant analysis results in three
misclassifications.

Parametric models can be used in more complex situations, where for example
the data exhibit clear multi-modality. In that case, one can employ a finite
mixture of multivariate normal distributions as the conditional class density.
However, the problem of estimating all the parameters involved (means, co-
variances and mixing coefficients) is not a trivial one and care should be taken
regarding identifiability issues (see [44]).

© 2008 by Taylor & Francis Group, LLC


110 CLASSIFICATION TECHNIQUES

Figure 4.5 Decision boundaries for linear discriminant analysis for the Iris data set.

Logistic Discrimination

This model arises when one wants to model the posterior probabilities of the
K classes through linear functions of x. As a motivating example, consider the
normal model for the K classes with common covariance matrix. By comparing
the ratio of the class k posterior probability to that of class 1, we obtain
p(k|x)
log( ) = (x − µk )′ Σ−1 (x − µk ) − (x − µ1 )′ Σ−1 (x − µ1 ) + log(πk /π1 ) =
p(1|x)

(µk − µ1 )′ Σ−1 x − (µk + µ1 )′ Σ−1 (µk − µ1 ) + log(πk /π1 ) = αk + βk′ x,


a linear model in x.

© 2008 by Taylor & Francis Group, LLC


CLASSIFICATION METHODS 111

Figure 4.6 Decision boundaries for quadratic discriminant analysis for the Iris data
set.

In general, we can model log(p(k|x)) − log(p(1|x)) by


exp(βk′ x)
p(class = k|x) = PK , (4.7)

k=1 exp(βk x)

thus modeling the log-odds by a linear function. This model implies that
odds increase multiplicatively by eβkh for every unit increase in the value of
the attribute xh . This procedure can be generalized to allow modeling of the
log-odds by more general functions.

The logistic regression model given in (4.7) is estimated by maximum like-


lihood methods. Since the resulting score equations are nonlinear in the pa-
rameter βk , an iterative algorithm like Newton-Raphson needs to be employed
(for more details, see [21]).

© 2008 by Taylor & Francis Group, LLC


112 CLASSIFICATION TECHNIQUES
4.3.2 Nonparametric methods

In case one is not willing to assume that the underlying populations are nor-
mally distributed, we need to resort to nonparametric methods for estimating
p(x|k) and its sample counterpart p(x|k, T ). The naive estimate of the un-
derlying density is the sample histogram of the training dataset T . The main
problem with this estimate is its lack of “smoothness.” A possible solution is
the use of kernel methods to smooth it. The estimate then takes the following
form
nk
1 X 1 x − xi
p(x|k, T ) = K( ), (4.8)
nk i=1 h h
R
where h is the bandwidth and K the kernel that satisfies sample space K(x)dx =
1.
The choice of h (a scalar parameter) controls the “smoothness” of the resulting
estimate. For small values of h we get more wiggly estimates, while for large
values of h fairly smooth ones. Possible choices of the kernel function K include
the Gaussian, the rectangular, the triangular, the Epanechnikov, etc. [36].
There are various automatic approaches for choosing the bandwidth that have
been proposed in the literature (for a discussion see [36]). In high dimensions
most of the underlying sample space is empty of objects. The latter fact implies
that one needs to choose either a very large value of h, or use a product
estimate of p(x|k, T ).
The product estimate of p(x|k, T ) leads to the naive Bayes classifier, that has
remained popular over the years. Specifically, it is assumed that conditional
on the class C = k, the features are independent; i.e.,
K
Y
p(x|k, T ) = pj (xj |k, T ).
j=1

The individual class-conditional densities pj (xj |k, T ) can be estimated using


one dimensional kernel density estimates. The latter is a generalization of
the original implementation of naive Bayes classifiers that relied on the extra
assumption of normality for the individual class conditional densities. The
popularity of the naive Bayes classifier stems from its capability to exhibit a
very good performance in many applications. A theoretical justification of its
performance, in the case where there are more variables than observations in
the training data, is given in [3].

Nearest Neighbor Methods

One simple adaptive kernel method is to choose a uniform kernel K, which


takes a constant value over the nearest r objects and is zero elsewhere. As
mentioned in [33] this does not in fact define a density as the estimate of p(x|k),
since its integral is infinite but we can nevertheless estimate the posterior

© 2008 by Taylor & Francis Group, LLC


CLASSIFICATION METHODS 113
distribution as the proportions of the classes amongst the nearest r objects.
The resulting classification rule is known as the nearest neighbor rule and
dates back to Fix and Hodges [16].
The basic steps to classify a new object with attribute vector x0 are:

• Step 1: Determine the r nearest neighbors (usually with respect to the


Euclidean distance) of the new object in T .
• Step 2: Classify the new object to the class that contains the majority of
the r nearest neighbors.

The version with r = 1 corresponds to dividing the data space into the cells of
the Dirichlet tessellation of the data points, and every new observation is clas-
sified according to the label of the cell it falls in. The behavior of the 1-nearest
neighbor classification can be characterized asymptotically. Specifically, let E ∗
denote the error rate of the Bayes rule in a K-class problem. Then the error
rate of the 1-nearest neighbor rule averaged over training sets converges to
a value E1 which is bounded above by E ∗ (2 − K/(K − 1)E ∗ ) (see [11] ). In
another development, Stone [38] showed that if the number of neighbors used
r → ∞, while r/N → 0, the risk for the r-nearest neighbor rule converges
in probability to the Bayes risk (not averaged over training data sets). How-
ever, these results are asymptotic in nature and do not necessarily apply to
finite samples. In particular, these results are independent of the metric used
for defining the nearest neighbor (e.g., Euclidean). Experience shows that the
choice of metric can be important.
The flexible boundaries produced by nearest neighbor classifiers are illustrated
in Figure 4.7, where the value r = 3 was chosen. It can be seen that one
observation from the Viriginica class is classified as Versicolor and vice versa,
thus exhibiting a slightly better apparent misclassification error rate than
linear discriminant analysis.

Classification Trees

The goal of classification trees is to partition the feature space into hypercubes
and assign a class to every hypercube.
We illustrate their use by an example. In Figure 4.8 the classification bound-
aries for the three classes in the iris data are shown, corresponding to the tree
shown in the right panel. It can be seen that if the objects’ petal length is less
than 24.5 then they are assigned to class Setosa, while if it is larger than 24.5
to some other class. Then, if petal width is larger than 17.5 and petal length
less than 49.5 the objects are classified to class Virginica, and so on. In Figure
4.9 the constructed tree is shown with the misclassifications in the terminal
nodes also included; for example, all the observations in the Setosa class are
correctly classified, while 5 observations in the Viriginica class are classified as
Versicolor, etc. This is an example of a binary tree, where each node splits into

© 2008 by Taylor & Francis Group, LLC


114 CLASSIFICATION TECHNIQUES

Figure 4.7 Decision boundaries produced by r = 3 nearest neighbor classifier.

two branches. The number of possible binary splits is m(N − 1) provided that
the variables are real-valued without any repeated values. The main advan-
tage of binary splits is their inherent simplicity: numerical variables are split
according to whether their values are above or below some threshold value τ ,
and the same holds for ordinal variables; nominal variables with L levels can
be split in 2L−1 − 1 possible ways.

Classification trees are rooted ones, with the root corresponding to the top
node. Observations are passed down the tree along the branches, with decisions
being made at each node until a terminal node, also called leaf node, is reached.
Each nonterminal node contains a question on which a split is based, while
each leaf contains the label of a classified observation.

© 2008 by Taylor & Francis Group, LLC


CLASSIFICATION METHODS 115

Figure 4.8 Classification boundaries for the Iris data.

It can be seen that the goal of the classification tree is to split the feature
space in such a way that most members belonging to a particular class fall
in the same hypercube. However, nothing prevents the tree to grow in such a
way so that there is a single object only in each hypercube. The main issues
then become on how the tree should be constructed and also pruned, in order
to avoid the one object per hypercube phenomenon.
Almost all current tree-construction methods use a one-step look-ahead ap-
proach. That is, they choose the next split (which variable to use in the next
split) in an optimal way with respect to this greedy strategy, without at-
tempting to optimize the performance of the whole tree. Common measures
for choosing the splits are the Gini index and the cross-entropy (also called
deviance) [5]. At each node ν of a tree we have a probability distribution pνk
over the classes. By conditioning on the observed attributes xi of the objects

© 2008 by Taylor & Francis Group, LLC


116 CLASSIFICATION TECHNIQUES

Figure 4.9 Corresponding classification tree.

in the training dataset T we learn the numbers nν assigned to every node of


the tree. The Gini index is defined for node ν as
K
X
G(ν) = pνk (1 − pνk ),
k=1

whereas the cross-entropy by


K
X
E(ν) = pνk log(pνk ).
k=1
P P
For the tree as a whole we have G = ν G(ν) and E = ν E(ν). Now consider
splitting a particular node ν into nodes ν1 and ν2 . The split that maximizes
the reduction in the Gini index or cross-entropy Dν − Dν1 − Dν2 is the one
that is chosen.
With noisy data there is always the danger of over-fitting the training dataset
T . The established methodology to avoid this problem is to “prune” the tree.
For any tree TR, define R(TR) to be the error rate (i.e., the number of mis-

© 2008 by Taylor & Francis Group, LLC


CLASSIFICATION METHODS 117
classifications) in T . Define an error-complexity measure
Cα (TR) = R(TR) + αSize(TR), (4.9)
which we are interested in minimizing over all trees. Notice that for α = 0
we are only interested in minimizing R(TR) while for α → ∞ we are only
interested in constructing the simplest possible tree. Note that by choosing a
particular value of α appropriately we can strike a good compromise between
the two objectives; namely minimizing the number of misclassifications vs the
size of the tree. The value of α = 2(K − 1) corresponds to the tree with
minimum Akaike information criterion value, a measure of trading off the fit
of particular model against its complexity in terms of number of parameters
that need to be estimated.

Support Vector Machines

Support vector machines and kernel methods have proven to be powerful tools
in numerous applications and have thus gained widespread popularity, e.g., in
machine learning and bioinformatics. In order to motivate the idea behind
the technique we start our exposition with the simplest case, that of two sep-
arable classes by a linear boundary. The data in the training set T are the
pairs (yi , xi ), i = 1, · · · , N with the response taking values in the set {−1, 1}
(positive and negative examples) and xi ∈ Rp . Suppose there exists a hyper-
plane that separates the positive from the negative examples. The points x
that lie on the hyperplane satisfy < w, x > +b = 0, where w is a vector nor-
mal (orthogonal) to the hyperplane and b/||w|| is the perpendicular distance
from the hyperplane to the origin, with ||w|| denoting the Euclidean norm of
w and < ·, · > the inner product operator. Let m+ and m− be the shortest
distance from the separating hyperplane to the closest positive and negative
example, respectively. The quantities m+ and m− are called the margin of a
separating hyperplane for the two types of examples. For the linearly separa-
ble case, the support vector algorithm searches for the separating hyperplane
with the largest margin. To rigorously formulate such an algorithm, notice
that in the current setting all the training data satisfy: < w, xi > +b ≥ +1
for y1 = +1 and < w, xi > +b ≤ −1 for yi = −1. Consider the positive and
negative examples for which these relations hold with equality. The positive
examples lie on a hyperplane h+ :< w, xi>+b=1 with a normal vector w and
perpendicular distance from the origin |1 − b|/||w||, while the negative exam-
ples on another hyperplane h− :< w, xi > +b = −1, with the same normal
vector w and perpendicular distance to the origin | − 1 − b|/||w||. Therefore,
m+ = m− = 1/||w|| and the margin is given by 2/||w||. As shown in Figure
4.10, h+ and h− are parallel hyperplanes, since they have the same normal
vector and no training points fall between them. Hence, we can find the pair
of hyperplanes that gives the maximum margin by minimizing
min ||w||2 subject to yi (< w, xi > +b) − 1 ≥ 0, all i ∈ T . (4.10)

© 2008 by Taylor & Francis Group, LLC


118 CLASSIFICATION TECHNIQUES

Positive examples

Origin

Negative examples

Figure 4.10 Illustration of linear separating hyperplanes for the separable case.

This is a convex optimization problem with a quadratic criterion and linear


constraints, whose solution can be found by first switching to a Lagrangian
unconstrained formulation and then exploring its corresponding dual problem.
The above formulation and the resulting quadratic programming algorithm,
when applied to nonseparable data, will find no feasible solution. A relaxation
of the constraints on h+ and h− is required, which can be achieved by the
introduction of slack variables ξi ≥ 0 for all i. The defining hyperplanes are
then given by h+ :< w, xi > +b ≥ 1 − ξi for yi = +1 and h− :< w, xi >
+b ≥ −1 + ξi for yi = −1. Hence,P when mistakes occur, the corresponding ξi
must be larger than one and so i ξi serves as an upper bound on the number
of training errors. A natural way to assign costs for errors is Pto change the
objective function to be minimized from ||w||2 to ||w||2 + a( i ξ), with a
being a tuning parameter that controls the assigned penalty in the presence
of mistakes. This leads once again to a quadratic programming problem (for
more details on the Lagrangian formulation of the dual, see [21]).
The resulting classifier is given by:
c(x) = sign < w, x > +b, (4.11)
P
where w = i∈S αi yi xi , αi are obtained from the solution of the dual problem
and S denotes the set of examples that define the support vectors h+ and h− .

© 2008 by Taylor & Francis Group, LLC


CLASSIFICATION METHODS 119
In most real life examples, the two classes are not going to be approximately
linearly separable and that is where the so-called ’kernel trick’ comes into
play. The main idea is that separation of the classes by a hyperplane may
be easier in higher dimensions. The construction depends on inner products
that have to be evaluated in the variables’ space; the latter task may become
computationally intractable, if the dimensionality of that space is too large.
Kernel (generalized covariance) functions that are defined in lower dimensional
space, but behave like inner products in higher (possibly infinite) dimensional
space will accomplish this goal, as originally observed by Boser et al. [2].
Suppose that the data are mapped to some other Euclidean space Q through:
Φ : Rp −→ Q, (4.12)
where Q may be infinite dimensional. Notice that the training algorithm would
depend on the data through inner products of the form < Φ(xℓ , Φ(xj ) > in Q
space. The challenge is to find a bivariate function K such that K(xℓ , xj ) =<
Φ(xℓ , Φ(xj ) >; this would require only knowledge of K in the computations.
Examples of K include γ-degree polynomials of the form K(xℓ , xj )(1+ <
xℓ , xj >)γ , radial basis functions K(xℓ , xj ) = exp(−||xℓ − xj ||2 /u) and neural
network functions K(xℓ , xj ) = tanh(η1 < xℓ , xj > +η2 ). The classifier for a
new point x is given by
X
c(x) = αi yi K(x, xi ). (4.13)
i∈S

Remark 1: An extensive treatment of the theory of support vector machines,


together with learning with kernels, is given in the book by Scolkopf and Smola
[35]. Another fairly extensive presentation and connections to a regularization
framework is given in [21].
Remark 2: Support vector machines have proved particularly successful in a
variety of applications. Lin [27] investigated their empirical success and argued
that they implement the Bayes classifier in an efficient manner. Specifically,
as discussed above, the Bayes rule minimizes the misclassification error rate,
given by P(y = +1|x) − 1/2 for the positive examples class. It was also shown
in [27] that the support vector machines solution targets directly this rate
without estimating the posterior probability of the positive (or negative) class.
The classical support vector machine paradigm presented above primarily
deals with binary (2-class) classification problems and has a nice geometric
interpretation. The most common strategy adopted to solve multi-category
classification problems is to treat them as a series of binary problems, with
the positive examples corresponding to class k and the negative examples to all
the remaining classes. Dietterich and Bakiri [14] discuss a general scheme for
carrying out this task and Allwein et al. [1] proposed a unifying framework for
it. More direct formulations of the multi-category problem for support vector
machines are given in [12, 26].
The flexible decision boundaries produced by support vector machines are

© 2008 by Taylor & Francis Group, LLC


120 CLASSIFICATION TECHNIQUES

Figure 4.11 Classification boundary produced by the Support Vector Machine classi-
fier using a radial basis kernel.

shown in Figure 4.11. It can be seen that five observations from the training
data set are misclassified. It should be noted that in the presence of only
two variables, support vector machines can not take full advantage of their
flexibility.

Ensemble Methods: Bagging and Boosting

In this section, we discuss some techniques that do not produce a single clas-
sification rule, but an ensemble of classifiers. We focus on bagging and its
extension random forests and on boosting.

Bagging:
The main idea is to generate perturbed versions of the training data of the

© 2008 by Taylor & Francis Group, LLC


CLASSIFICATION METHODS 121
same size as the original set T , train a classifier on each perturbed version and
aggregate the results by majority voting. The perturbed versions are obtained
by bootstrapping observations from T . The bootstrap aggregation or bagging
algorithm introduced in [6] is described next:
1. Create B bootstrapped training data sets T1 , · · · , TB
2. Train a classifier cb (x) on each bootstrapped training data set Tb
3. Output: for a new observation x, classify it to the majority class predicted
by the B classifiers
Since the final result is based on averaging a number of predictions, it can be
shown that bagging reduces the variance of the classification procedure, but
does not affect its bias. Further, empirical evidence suggests that high variance
classifiers (those with the tendency to overfit the data, such as classification
trees) primarily benefit from bagging. Unlike techniques that produce a single
classification rule, bagging produces an ensemble of rules that although may
exhibit superior performance in terms of misclassification error rate, they are
nevertheless hard to interpret as a ‘model.’ A variation of bagging based on
creating convex pseudo-sets of training data was proposed in [7]. The idea is
to generate a new training set where the observations are linear combinations
of two observations selected at random from the original training set T . This
procedure is repeated B times, so that the desired classifier can be trained
on B perturbed training data sets and its results averaged through majority
voting as in bagging.
Empirical evidence showed that bagging improved performance in practice
but not by a wide margin. A variation of bagging specifically designed for
classification trees as the base classifier was introduced in [8]. The main steps
of the algorithm, called Random Forests, are described next:
1. Create B bootstrapped training data sets T1 , · · · , TB . The observations not
included in the bootstrapped sample Tb form an out-of-bag sample
2. Train a classification tree on each bootstrapped training data set Tb as
follows:
at every node, consider only a random set of variables for the next split
Note that trees are recommended to be grown to maximum size and not
pruned
3. Output: for a new observation x, classify it to the majority class predicted
by the B classifiers
Empirical evidence suggest that over-fitting due to growing the tree to max-
imum size is not an issue. Further, selection of a small number of variables
at every node works well and the performance of random forests seems to be
insensitive to it. Finally, the algorithm provides a mechanism for estimating
the importance of each variable in the ensemble.
The variable importance estimate is obtained as follows: After each tree is

© 2008 by Taylor & Francis Group, LLC


122 CLASSIFICATION TECHNIQUES
constructed, the values of each variable in the out-of-sample sample are ran-
domly permuted and the out-of-bag sample is run down the tree and therefore
a classification for each observation is obtained. Thus, p misclassification error
rates are obtained and the output is the percent increase in misclassification
rate as compared to the out-of-sample rate with all variables intact.

Boosting:
Boosting has proved to be an effective method to improve the performance of
base classifiers, both theoretically and empirically. The underlying idea is to
combine simple classification rules (the base classifiers) to form an ensemble,
whose performance is significantly improved. The origins of boosting lie in
PAC learning theory [41], which established that learners that exhibit a per-
formance slightly better than random guessing when appropriately combined
can perform very well. A provably polynomial complexity boosting algorithm
was derived in [34], whereas the Adaptive Boosting (AdaBoost) algorithm in
various varieties [19, 20] proved to be a practical implementation of the boost-
ing ensemble method. The basic steps of the AdaBoost algorithm are described
next for a binary classifier. Let c(x) be the classifier under consideration and
(yi , xi ), i = 1, · · · , N the data in the training set T . Then,

1. Initialize weights wi = 1/N


2. for m = 1 to M do
3. fit y = cm (x) as the base weighted classifier using weights wi
PN
4. let Wcm = i=1 wi I(yi cm (xi ) = −1) and αm = log[(1 − W− (h))]/W−
5. wi = wi exp{αm I(yi 6= cm (xi ))} scaled to sum to one
6. end for
7. Output: ĉ(x) = sign( M
P
m=1 αm cm (x))

The popular intuition behind the success of the algorithm is that hard to
classify observations receive higher weights αi at later iterations; thus, the
algorithm concentrates more on these cases and hence manages to drive the
misclassification error rate on the training data to zero.
Remark 1: Friedman et al. [17] established connections between the AdaBoost
algorithm and statistical concepts such as loss functions, additive models and
logistic regression. Specifically, it was shown that this algorithm fits a stage-
wise additive logistic regression model that minimizes the expectation of the
exponential loss function exp(−yc(x)). A good discussion is also included in
[21]. For some interesting observations on boosting see also [28].
Remark 2: It can be seen that this algorithm produces as output the new
observation’s predicted class. Proposals for the algorithm to produce as output
the class probability estimates include the RealBoost and the GentleBoost
algorithms [17].

© 2008 by Taylor & Francis Group, LLC


CLASSIFICATION METHODS 123
Remark 3: The boosting algorithm performs a gradient descent for minimiz-
ing the underlying exponential loss function and consequently determine the
weights and the classifier at each iteration. However, this is a greedy strategy,
since the solution pays attention to reducing the misclassification error rate
on the training data. A variant of the algorithm that focuses more on the
misclassification error rate for future observations along with a regularized
version (Stochastic Gradient Boosting) are discussed in [18].

4.3.3 Variable selection

Variable selection is an important topic in classification, especially in appli-


cations where the number of variables exceeds the number of available obser-
vations in the training data set T (p >> n). Two domains where p >> n
are text classification and gene/protein microarray data. The goal of variable
selection is to improve the predictive performance of the classifier, to reduce
its computational cost and finally to provide a more interpretable rule. ¿From
the description of the most commonly used techniques to train classifiers, it
can be seen that some algorithms have a built-in variable selection mechanism;
examples include classification trees, random forests. On the other hand, lo-
gistic discrimination, support vector machines and especially nearest neighbor
methods do not offer such mechanisms.
Various approaches have been proposed in the literature to deal with this
topic. We briefly outline two popular approaches: (i) regularization and (ii)
dimension reduction. The idea behind regularization is to modify the objec-
tive function that is being optimized by adding a penalty term that penalizes
complex models - in this setting, models that include a large number of vari-
ables. This applies directly to logistic, support vector machines and linear
and quadratic discriminant analysis. The ideal penalty would be an ℓ0 norm
that would eliminate “unnecessary” variables. However, it generally leads to a
nonconvex optimization problem which in turn is hard to solve. Hence, the ℓ1
norm has become a very popular alternative, since it shrinks the coefficients
of variables to zero, thus effectively performing variable selection, while at
the same time keeping the underlying optimization problem convex. Another
popular penalty is the ℓ2 norm that shrinks the coefficients of the variables,
but not all the way to zero. This penalty is best suited for reducing the mean
squared error of the estimated model, but does not eliminate variables. An-
other approach is based on the idea of reducing the dimensionality of the
variable space. Possible techniques include principal components analysis and
clustering. Principal components analysis creates new variables that are linear
combinations of the original ones, which can then be used as inputs to the
various classification techniques. Clustering of variables replaces a group of
‘similar’ variables by a representative one, that can be their weighted average.
A more ad hoc method is variable ranking, which is attractive because of its
simplicity and scalability. A classification rule is used with a single variable

© 2008 by Taylor & Francis Group, LLC


124 CLASSIFICATION TECHNIQUES
and the final output is a ranking of all variables according to their predictive
ability. This procedure is not necessarily designed to produce a good final
model, but to discard the most ‘uninformative’ variables.

4.4 Applications of Classification Techniques to Bioinformatics


Problems

Applications of classification techniques to problems in bioinformatics abound.


One of the most active areas has been the class prediction problem (e.g.,
different stage of cancer of patients) using primarily gene but more recently
protein microarray data. Actually, the availability of data for a significantly
larger number of genes (in the thousands) than observations (less than 100)–
the so called large p, small n paradigm–has led researchers to incorporate
variable selection in many classifiers and in addition develop variants of the
methods surveyed in this chapter (see for example [25, 45]). The number of
application papers is in the 100s and it is hard to do justice to all of them.
Therefore, we give selected references that give a starting point to the reader.
One of the earliest papers that introduced the class prediction problem in the
context of microarray data is by Golub et al. [22]. Other application papers
include Khan et al. [20], van’t Veer et al. [42], Tibshirani et al. [39], Zhang et
al. [46], just to name a few. A comprehensive comparison of the performance
of various classifiers using gene microarray data is given in [13, 37].
Another interesting area of applications deals with peptide and protein identi-
fication in mass spectrometry, where variations of logistic discrimination have
been used for this purpose (see Zhang et al. [47], Nesvizhskii and Aebersold,
[32], Ulintz et al. [40]). Other applications in the proteomics domain include
functional classification of proteins (Keck and Wetter [23], Lau and Chasman
[25], Cheng et al. [10]), and prediction of protein-protein interactions [9].

4.5 Exercises

1. Consider the following two univariate populations. The first one is normally
distributed with mean µ1 and variance σ12 and the second one is normally dis-
tributed with mean µ2 and variance σ22 . Further assume that the prior prob-
abilities are given by π1 6= π2 . Derive the optimal Bayes decision rule and
calculate the misclassification error rate.

How does the optimal Bayes rule look if population 1 is exponentially dis-
tributed with parameter θ1 and population 2 is also exponentially distributed
with parameter θ2 ? Calculate the misclassification error rate.

2. Suppose there are three classes in a population with equal prior probabil-
ities; i.e., π1 = π2 = π3 = 1/3. The data in class k are Poisson distributed

© 2008 by Taylor & Francis Group, LLC


REFERENCES 125
with parameter λK , where λ1 = 5, λ2 = 7.5 and λ3 = 10. Derive the Bayes
rule; i.e., identify the class boundaries. Also, calculate the overall misclassi-
fication error rate. How does the Bayes rule and the misclassification error
rate change, if two independent measurements are obtained; i.e., X1 , X2 are
Poisson distributed with parameters λk ?

3. Suppose there are two classes in the population C1 and C2 . Further, as-
sume that a p-variate observation x comes from one of these two populations
with probability π1 and π2 , respectively. Observations from class C1 follow a
multivariate normal distribution N (µ1 , Σ), while those from C2 follow another
multivariate normal distribution N (µ2 , Σ). Assuming that the cost of misclas-
sifying an observation is equal for the two classes, calculate the Bayes rule
for assigning x to C1 or C2 . Also calculate the corresponding misclassification
probabilities.

References

[1] Allwein, E.L., Schapire, R.E. and Singer, Y. (2000), Reducing multi-class to
binary: A unifying approach for margin classifiers, Journal of Machine Learning
Research, 113-141
[2] Boser, B.E., Guyon, I.M. and Vapnik, V. (1992), A training algorithm for optimal
margin classifiers, in Proceedings of ACM Workshop on Computational Learning
Theory, 144-152, Pittsburgh, PA
[3] Bickel, P.J. and Levina, E. (2004), Some theory for Fisher’s Linear Discrimi-
nant function, “naive Bayes,” and some alternatives when there are many more
variables than observations, Bernoulli, 10, 989-1010
[4] Bousquet, O., Boucheron, S. and Lugosi, G. (2004), Introduction to Statisti-
cal Learning Theory, Advanced Lectures on Machine Learning Lecture Notes in
Artificial Intelligence 3176, 169-207. (Eds.) Bousquet, O., von Luxburg, U. and
Ratsch, R. Springer, Heidelberg, Germany
[5] Breiman, L., Friedman, J.H., Olshen, R. and Stone, C. (1984), Classification and
Regression Trees, CRC Press, Boca Raton, FL
[6] Breiman, L. (1996), Bagging predictors, Machine Learning, 24, 123-140
[7] Breiman, L. (1998), Arcing classifiers, Annals of Statistics, 26, 801-849
[8] Breiman, L. (2001), Random forests, Machine Learning, 45, 5-32
[9] Chen, X.W. and Liu, M. (2005), Prediction of proteinprotein interactions using
random decision forest framework, Bioinformatics, 21, 4394-4400
[10] Cheng B.Y., Carbonell J.G., Klein-Seetharaman J. (2005), Protein classification
based on text classification techniques, Proteins, 58, 955-970
[11] Cover, T. and Hart, P. (1967), Nearest neighbor pattern classification, IEEE
Transactions on Information Theory, 13, 21-27
[12] Crammer, K. and Singer, Y. (2001), On the algorithmic implementation of
multi-class kernel-based vector machines, Journal of Machine Learning Research,
2, 265-292
[13] Dudoit, S., Fridlyand, J. and Speed, T.P. (2002), Comparison of discrimination

© 2008 by Taylor & Francis Group, LLC


126 CLASSIFICATION TECHNIQUES
methods for the classification of tumors using gene expression data, Journal of
the American Statistical Association, 97, 77-87
[14] Dietterich, T.G. and Bakiri, G. (1995), Solving multi-class learning problems
via error correcting output codes, Journal of Artificial Intelligence Research, 2,
263-286
[15] Fisher, R.A. (1936), The use of multiple measurements in taxonomic problems,
Annals of Eugenics, 7, 179-188
[16] Fix, E. and Hodges, J.L. (1951), Discriminatory Analysis. Nonparametric Dis-
crimination; Consistency Properties, Report Number 4, USAF School of Aviation
Medicine, Randolph Field, TX
[17] Friedman, J.H., Hastie, T. and Tibshirani, R. (1998), Additive logistic regres-
sion: A statistical view of boosting, Annals of Statistics, 28, 337-407 (with dis-
cussion)
[18] Friedman, J.H. (2002), Stochastic gradient boosting, Computational Statistics
and Data Analysis, 38, 367-378
[19] Freund, Y. and Schapire, R.E. (1997), Experiments with a new boosting al-
gorithm, In Proceedings of the International Conference on Machine Learning,
148-156.
[20] Freund, Y. and Schapire, R.E. (1997), A decision-theoretic generalization of on-
line learning and an application to boosting, Journal of Computer and System
Sciences, 55, 119-139
[21] Hastie, T., Tibshirani, R. and Friedman, J. (2001), The Elements of Statistical
Learning: Data Mining, Inference and Prediction, Springer, NY
[22] Golub, T.R., Slonim, D.K, Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov,
J.P., Coller, H., Loh, M.L, Downing, J.R., Caligiuri, M.A, Bloomfield, C.D. and
Lander, E.S. (1999), Molecular classification of cancer: Class discovery and class
prediction by gene expression monitoring, Science, 286, 531-537
[23] Keck, H.P. and Wetter, T. (2003), Functional classification of proteins using a
nearest neighbour algorithm, In Silico Biology, 3, 23
[24] Khan, J., Wei, J.S., Ringner, M., Saal, L.H., Ladanyi, M., Westermann, F.,
Berthold, F., Schwab, M., Antonescu, C.R., Peterson, C., and Meltzer, P.S.
(2001), Classification and diagnostic prediction of cancers using gene expression
profiling and artificial neural networks, Nature Medicine, 7, 673-679
[25] Lau, A.Y. and Chasman, D.I. (2004), Functional classification of proteins and
protein variants, Proceedings of the National Academies of Science USA, 101,
6576-6581
[26] Lee, Y., Lin, Y. and Wahba, G. (2004), Multi-category support vector machines,
theory and application to the classification of microarray data and satellite ra-
diance data, Journal of American Statistical Association, 99, 67-81
[27] Lin, Y. (2002), Support vector machines and the Bayes rule in classification,
Data Mining and Knowledge Discovery, 6, 259-275
[28] Mease, D. and Wyner, A. (2008), Evidence contrary to the statistical view of
boosting, Journal of Machine Learning Research, 9, 131-156
[29] Michailidis, G. and Shedden, K. (2003), The application of rule-based methods
to class prediction problems in genomics, Journal of Computational Biology, 10,
689-698
[30] Middendorf, M., Ziv, E. and Wiggins, C.H. (2005), Inferring network mecha-
nisms: The Drosophila melanogaster protein interaction network, Proceedings of
the National Academies of Science USA, 102, 3192-3197

© 2008 by Taylor & Francis Group, LLC


REFERENCES 127
[31] Mosteller, F. and Wallace, D.L. (1963), Inference in an authorship problem,
Journal of the American Statistical Association, 58, 275-309
[32] Nesvizhskii A.I., Aebersold R. (2005), Interpretation of shotgun proteomic data:
The protein inference problem, Molecular & Cellular Proteomics, 4, 1419-1440
[33] Ripley, B.D. (1996), Pattern Recognition and Neural Networks, Cambridge Uni-
versity Press, Cambridge, UK
[34] Schapire, R. (1990), The strength of weak learnability, Machine Learning, 5,
197-227
[35] Scholkopf, B. and Smola, A.J. (2002), Learning with Kernels, MIT Press, Cam-
bridge, MA
[36] Scott, D.W. (1992), Multivariate Density Estimation: Theory, Practice, and
Visualization, John Wiley, New York.
[37] Statnikov, A., Aliferis, C.F., Tsamardinos, I., Hardini, D. and Levy, S. (2005), A
comprehensive evaluation of multicategory classification methods for microarray
gene expression cancer diagnosis, Bioinformatics, 21, 631 - 643.
[38] Stone, C. (1977), Consistent nonparametric regression, Annals of Statistics, 5,
595-620
[39] Tibshirani, R., Hastie, T., Narasimhan, B. and Chu, G. (2002), Diagnosis of
multiple cancer types by shrunken centroids of gene expression, Proceedings of
the National Academies of Science USA, 99, 6567-6572
[40] Ulintz, P.J., Zhu, J., Qin, Z.S. and Andrews, P.C. (2006), Improved classifica-
tion of mass spectrometry database search results using newer machine learning
approaches, Molecular and Cellular Proteomics, 5, 497-509
[41] Valiant, L.G. (1984), A theory of the learnable, Communications of the ACM,
1134-1142
[42] van’t Veer, L.J., Dai, H., van de Vijver, M.J., He, Y.D., Hart, A.A., Mao, M.,
Peterse, H.L., van der Kooy, K., Marton, M.J., Witteveen, A.T., et al. (2002),
Gene expression profiling predicts clinical outcome of breast cancer, Nature, 415,
530-536
[43] Vapnik, V. (1998), Statistical Learning Theory, Wiley, NY
[44] Venables, W. and Ripley, B. (1994), Modern Applied Statistics with S-Plus,
Springer, New York
[45] Wang, S. and Zhu, J. (2007) Improved centroids estimation for the nearest
shrunken centroid classifier, Bioinformatics, 23, 972-979
[46] Zhang, H., Yu, C.Y. and Singer, B. (2003), Cell and tumor classification us-
ing gene expression data: construction of forests, Proceedings of the National
Academies of Science USA, 100, 673-679
[47] Zhang, N., Aebersold, R. and Schwikowski, B. (2002), ProbID: A probabilistic
algorithm to identify peptides through sequence database searching using tandem
mass spectral data, Proteomics, 2, 1406-1412

© 2008 by Taylor & Francis Group, LLC


CHAPTER 5

Unsupervised Learning Techniques

5.1 Introduction

Technological advances have permitted scientists to monitor simultaneously


thousands of genes and proteins under different experimental conditions or
across different tissue types. This offers the opportunity for a systematic
genome- and proteome-wide approach to understand function and regulatory
mechanisms in cellular signaling pathways, or gain insight in diverse disease
mechanisms.
For example, consider microarray data comprised of thousands of genes (fea-
tures/variables) and dozens of samples. In this setting, one may be interested
in reducing the dimensionality of the ‘gene space,’ by constructing ‘super-
genes’ that simplify the underlying structure of the data. This strategy has
proved useful in classification [20]. Dimension reduction aids also in visualizing
the structure of the data set to uncover interesting patterns. In this case, one
seeks an efficient representation of high-dimensional data in a 2-3 dimensional
space. The main techniques we consider for dimension reduction are principal
components analysis and multidimensional scaling.
In cluster analysis, one is interested in partitioning the data into groups, so
that the objects (samples and/or variables) in a group are more ‘similar’ to
each other than objects in different groups. Cluster analysis techniques have
proved useful in identifying biologically relevant groups of both genes and
samples and have also provided insight into gene function and regulation.

5.2 Principal Components Analysis

Principal components analysis (PCA) belongs to the class of projection meth-


ods. Such methods choose one or more linear combinations of the original vari-
ables (features, attributes) to maximize some measure of “interestingness.” In
PCA the goal is to reduce the dimensionality of a data set comprised of a
large number of interrelated variables, while retaining as much as possible of
the variation present in the data. PCA also has considerable theoretical im-
portance because of its relationship to elliptical distributions and to standard
distance.

129

© 2008 by Taylor & Francis Group, LLC


130 UNSUPERVISED LEARNING TECHNIQUES
We briefly give an intuitive introduction to the technique through a toy ex-
ample. Consider a 2-dimensional data set shown in the left panel of Figure
5.1. We are interested in projecting the data along the direction that captures
most of the variability, which is also shown on the plot. One could continue
along this line and request for a second direction that captures the remain-
ing variability in the data set, which in addition is orthogonal to the first
one. These directions that are obviously linear combinations of the original
variables are called principal components. The projected data set onto the
space spanned by the first two principal components is shown in the right
panel of Figure 5.1. It should be noted that this exercise is most useful, when
few principal components suffice to capture most of the variation in the data
and consequently reduce its effective dimensionality. We formalize these ideas
below.

Figure 5.1 Left panel: a two-dimensional synthetic data set and the direction of maxi-
mum variability captured by the first principal component. Right panel: the projection
of the data set onto the principal components space.

5.2.1 Derivation of principal components

Let x be a vector of p real random variables and let Σ denote their covariance
matrix; i.e., Σ = E(x − µ)(x − µ)′ . Without loss of generality, we set µ = ~0;
otherwise, the mean of the random variables can always be subtracted.
The covariance matrix summarizes all the linear bivariate associations in this
set of random variables. In PCA, we are interested in reducing the dimension-
ality p of the original variables, by considering linear combinations of them
and retaining the “most important” of these new variables.

© 2008 by Taylor & Francis Group, LLC


PRINCIPAL COMPONENTS ANALYSIS 131
Define a new variable
p
X
y1 = β1′ x = βj1 xj , (5.1)
j=1
that is a linear combination of the x’s with coefficients {βj1 }.
The question is how to choose the weights β1 . The choice depends on the
measure of “interestingness” that we are going to use. For PCA as was shown
with the toy example, the measure of interestingness that we want to maximize
is the variance of the new variable y1 .
Pp  ′
Criterion: maxy1 Var (y1 ) = maxβj1 Var j=1 βj1 xj = maxβ1 β1 Σβ1 .

A moment of reflection shows that the maximum would be achieved for an


infinite β1 ; thus, a normalization constraint must be imposed. The standard
constraint employed is ||β1 || = 1. Hence, the problem becomes
max β1′ Σβ1 s.t ||β1 || = 1. (5.2)
β1

The Rayleigh-Rietz theorem indicates that the solution is given by the eigen-
vector corresponding to the largest eigenvalue λ1 of Σ.
If a second linear combination y2 = β2′ x is desired, we require in addition to be
orthogonal to the first one; i.e., formally, < y1 , y2 >= 0, where < ·, · > denotes
the inner product of two real-valued vectors. Then the problem becomes
max β2′ Σβ2 s.t ||β2 || = 1 and < β1 , β2 >= 0. (5.3)
β2

In general, we can construct p linear combinations y = B ′ x, B being a p × p


matrix whose k-th column corresponds to βk .
The optimal set of weights is given by the eigenvectors of Σ;
Σ = BΛB ′ .
Notice that the Principal Components y are by construction an orthonormal
linear transformation of x.
We discuss next the main properties of Principal Components.
(1) E(y) = E(B ′ x) = B ′ E(x) = 0, ex hypothesis.
(2) Cov(y) ≡ Σy = B ′ ΣB = B ′ (BΛ) = Λ. Hence, the principal components
are uncorrelated and Var(yj ) = λj .
(3) Correlations of the original random variables x with the principal compo-
nents y.
We have that Cov(x, y) = Cov(x, B ′ x) = ΣB = BΛ. This shows p that for a
fixed yj we have Cov(yj , x) = λj βj . Hence, Corr(xi , yj ) = λj βji / λj . The
p
quantities λj βj are called factor loadings.
(4) Proportion of variance explained by the principal components.
Notice that trace(Σ) = trace(BΛB ′ ) = trace(ΛB ′ B) = trace(Λ). Thus,

© 2008 by Taylor & Francis Group, LLC


132 UNSUPERVISED LEARNING TECHNIQUES
each principal component “explains” λj /( pj=1 λj ) proportion of the total
P
variance.
(5) Consider the set of p-dimensional ellipsoids of the form
x′ Σ−1 x = c,
Then, the principal components define the principal axes of these ellipsoids.
The set of principal components is given by y = B ′ x. Because of the fact that
B is orthogonal, we get x = By. Plugging this in we obtain
x′ Σ−1 x = y′ B ′ Σ−1 By = c.
But the eigenvalue decomposition of Σ−1 gives
Σ−1 = BΛ−1 B ′ ,
i.e., the inverse of the covariance matrix has the same set of eigenvectors as
the covariance matrix and the reciprocals of its eigenvalues (provided that Σ
is strictly positive definite). Some algebra shows that B ′ Σ−1 B = Λ−1 and
therefore y′ Λ−1 y = c. The last expression corresponds to the equation of an
ellipsoid referred to its principal axes. It also implies that the half lengths of
1/2
the principal axes are proportional to λj .
Remark: Principal Components based on the correlation matrix
Let x̃ = (xj /σj ), where σj2 is the variance of xj . We can define the principal
components of x̃ as before; namely,
ỹ = B̃ ′ x̃, (5.4)
where B̃ contains the eigenvectors of the correlation matrix of the x̃j ’s.
It is worth noting that the principal components derived from the covariance
and the correlation matrix are not related, except in very special circum-
stances. This is because the principal components are invariant under orthog-
onal transformations of x but not under other transformations. However, the
transformation from x to x̃ is not orthogonal. In practice, the main advantage
using the correlation matrix in PCA is that the results are not sensitive to
the units of measurement for x.

5.2.2 Sample principal components

We turn our attention to PCA applied to data. Let X be an n × p data ma-


trix. Further, assume that the observations are independent replicates from
the p-dimensional random vector x. We will denote the columns (variables) of
the data matrix by X1 , X2 . · · · , Xn . Without loss of generality assume that
Mean(Xi )=0r; in practice the data matrix X is always centered, by subtract-
ing the sample mean of each variable. Then, the sample covariance matrix is
given by S = X ′ X/(n − 1).

© 2008 by Taylor & Francis Group, LLC


PRINCIPAL COMPONENTS ANALYSIS 133
Let S = BΛB ′ be the eigenvalue decomposition of the sample covariance
matrix. Then, the sample principal components are defined by
Y = XB, (5.5)
where Y is a n × p matrix containing PC scores, and B a p × p orthonormal
matrix containing the weights. In direct analogy to the population version of
PCA the elements of the p × p diagonal matrix Λ are the variances of the p
principal components; i.e., Var(Yj ) = λj , j = 1, · · · , p.
Remark: The properties derived in Section 2.1 carry over, with the sample
covariance matrix S replacing the population covariance matrix Σ. One small
difference arises in property (5). The ellipsoids x′ S −1 x = c do not represent
contours of constant probability; rather, they correspond to contours of equal
Mahalanobis distance from the sample mean, which it is assumed to be 0 (the
data have been centered). In the literature, the following interpretation of
PCA appears; namely, PCA finds successive orthogonal directions for which
the Mahalanobis distance from the data set to a hypersphere enclosing all the
data is minimized.
The next geometric property of sample principal components gives another
interpretation of PCA. In fact, it is a generalization of an idea used by Karl
Pearson back in 1901 to define PCA for 2-dimensional data.
Consider n observations denoted by X(i, ·) (X(i, ·) being a p-dimensional col-
umn vector). Let C be an orthogonal p × q matrix and let Y (i, ·) = C ′ X(i, ·)
be the projection of the data onto a q-dimensional subspace. A goodness-of-
fit measure of this q-dimensional subspace to X(1, ·), · · · , X(n, ·) is given by
the sum of squared perpendicular distances of the X(i, ·)’s from the subspace.
This measure is minimized when C = Bq which contains the first q columns of
the coefficient matrix B. The plot in Figure 5.2 schematically illustrates this
property.

5.2.3 Illustration of PCA

In this example, we illustrate PCA with a gene expression data set from a
cancer study [20] that deals with small, round blue-cell tumors of childhood.
There are four types of tumors: neuroblastomas (NB), rhabdomyosarcomas
(RMS), Burkitt lymphomas (BL) and the Ewing family of tumors (EWS).
The data were filtered and contain 2308 genes (see [20]) and 63 samples (12
NB, 20 RMS, 8 BL and 23 EWS). The projection of the data onto the first
two principal components that capture about 55% of the total variance is
shown in Figure 5.3. It can be seen that the classes are not well separated;
however, the BL class of tumors is fairly well separated from the RMS along
the first principal component and to a lesser extent from the NB one. A look
at the component loadings (not shown here) indicates that the first principal
component can be interpreted as an overall average of gene expression, which

© 2008 by Taylor & Francis Group, LLC


134 UNSUPERVISED LEARNING TECHNIQUES

Figure 5.2 Geometry of principal components, where the direction (line) minimizes
the orthogonal projections of the data to it.

in turn suggests that the expression level of the BL tumors is clearly different
and opposite than the majority of the RMS ones. Further, the analysis reveals
the presence of a RMS sample at the bottom of the plot, which strongly
indicates that it is an outlier.
For further illustration purposes, we concentrated on the two largest tumor
classes, EWS and RMS. In addition, the 83 most discriminating genes between
these two classes were selected through t-tests. The projection of the data onto
the first two principal components is shown in Figure 5.4. As expected, a very
strong separation of the two classes occurs along the first principal component,
which again can be interpreted as an overall average of gene expression.

5.2.4 PCA and the Singular Value Decomposition (SVD)

Given an n × p centered data matrix X of full column rank we can apply the
Singular Value Decomposition and obtain
X = U LB ′ , (5.6)

where U and B are n × p and p × p orthonormal matrices and L a p × p


diagonal matrix.
Some straightforward algebra shows that
(n − 1)S = X ′ X = BLU ′ U LB ′ = BL2 B ′ . (5.7)

Hence, the matrix B contains the eigenvectors of the sample covariance matrix,
while a rescaled version of L its eigenvalues. Specifically Var(yi ) = ℓ2i /(n − 1).

© 2008 by Taylor & Francis Group, LLC


PRINCIPAL COMPONENTS ANALYSIS 135

Figure 5.3 Projection of the cancer microarray data set onto the first two principal
components. The NB samples are represented by ◦, the RMS by ⋄, the BL by ⋆ and
the EWS by .

Further, notice that the PC scores Z = XB are given by Z = XB = U LB ′ B =


U L.
It is also of interest the fact that XX ′ = U LB ′ BLU ′ = U L2 U ; i.e., the
matrix, U contains the eigenvectors of XX ′ . This result comes in handy in
some applications where the role of ‘variables’ and ‘observations’ is reversed.
The main interest in the SVD is that in addition to providing a computation-
ally efficient way to do PCA, it also gives additional insight into the technique.
For example, let X̃q = Uq Lq Bq′ be the n × q matrix formed by retaining the
q largest in terms of variance principal components. Then, the Householder-
Young theorem implies that X̃q gives the best q-rank approximation of the
data in the Frobenius norm; i.e., argminQ ||X − Q||F = X̃q .
Biplots: The SVD also provides an efficient way of visualizing together objects
(observations) and variables. The emphasis of the PCA of the city crime data
was on cities (objects). However, a graphical representation of the data that
contains some information about the variables is particularly useful. One such
representation is given by the biplot, introduced by Gabriel in 1971, shown for

© 2008 by Taylor & Francis Group, LLC


136 UNSUPERVISED LEARNING TECHNIQUES

Figure 5.4 Projection of the RMS (⋄) and EWS () tumor classes set onto the first
two principal components based on a subset of 83 genes.

the gene expression data set comprised of the RMS and EWS tumor samples in
Figure 5.5. The arrows on the biplot indicate where one can find samples with
high values on a particular gene (variable). The angles between the arrows,
which represent the variables, capture the correlation between them provided
that the total amount of variance explained by the first two PCs is reasonably
high. The biplot is constructed as follows: from the SVD of the centered data
matrix X we get that X = U LV ′ . Define Lα and L1−α for any α ∈ [0, 1].
Let G = U Lα and H ′ = L1−α V ′ . Notice that for α = 1 we get G = Y the
PC scores. A biplot is a plot of the first k (usually k = 2 or 3) columns of G
and H.

5.3 Multidimensional Scaling

Multidimensional scaling (MDS) is a method that represents measurements of


similarity or dissimilarity among pairs of objects as distances between points
in a low-dimensional space [7].

© 2008 by Taylor & Francis Group, LLC


MULTIDIMENSIONAL SCALING 137

Figure 5.5 Biplot of the gene expression data set containing only the RMS and EWS
tumor samples.

Historically, MDS was developed as a method for analyzing proximity data


that arise in the social sciences (similarity ratings for pairs of stimuli such
as tastes, colors, etc), classification problems, archeology (similarity in the
features of artifacts). Another early use of MDS has been dimension reduc-
tion (Kruskal-Shepard MDS). The idea is to compute the pairwise distances
between the objects in a high dimensional space, and attempt to find an ar-
rangement of the objects in a low dimensional space so that their distances
approximate as close as possible the original distances.

5.3.1 Metric scaling

The setting is as follows: given an N × p data matrix (N observations, p


variables) X calculate the corresponding dissimilarity matrix D. If one is
interested in the samples (observations), then D is a N × N matrix, while if
one is interested in the variables then D is a p × p matrix.
A dissimilarity dij between observations i and j is a distance-like measure
that satisfies the following properties:

© 2008 by Taylor & Francis Group, LLC


138 UNSUPERVISED LEARNING TECHNIQUES
1. Nonnegativity property: dij ≥ 0 for all i and j, with dii = 0.
2. Symmetry property: dij = dji for all i, j.

If, in addition, dij satisfies the triangle inequality (dij ≤ dik + dkj for any k)
then it is a proper distance. Euclidean, Mahalanobis and Manhattan distances
are commonly used in data analysis.
The objective of MDS is to approximate dissimilarities (distances) calculated
from the data in p-dimensional space by Euclidean distances defined in a
q << p dimensional space. In practice, q is usually chosen equal to two or
three, since one is interested in visualizing the structure of the data. Let Z
be a N × q matrix that contains the coordinates of the objects in the low
dimensional space. The quality of the approximation is measured by a loss
function. Common loss functions include:
N X
X N
Stress(Z) = (dij (Z) − dij )2 , (5.8)
i=1 j=i+1

which is invariant under rotations and translations, but not invariant to stretch-
ing and shrinking. This implies that the value of Stress is scale dependent and
a better criterion is given by
s
Stress(Z)
P 2 . (5.9)
i<j dij (Z)

A more general form of the Stress function incorporates weights wij that
reflect variability, measurement error or missing data:
N X
X N
WStress(X) = wij (dij (Z) − dij )2 . (5.10)
i=1 j=i+1

If the weights are chosen so that wij = d−1


ij , we then recover the Sammon
mapping. One reason for using weights is to reduce the effect of outliers on
the low dimensional configuration, which can distort the results [7].
Finding the optimal configuration Z of the observations in q-dimensional space
is not a trivial problem, since the loss function is nonconvex. Iterative algo-
rithms are discussed in [7].
An application of MDS to the gene expression data of the tumor samples is
shown in Figure 5.6. Manhattan distances were calculated between the samples
and a 2-dimensional representation based on the Stress loss function obtained.
It can be seen that a different view of the data compared to that of PCA is
obtained, although some features, such as the grouping of the BL samples
and their separation from the RMS and the NB samples, are still preserved.
In Figure 5.7, the MDS representation of the gene expression data for the
RMS and EWS samples based on Manhattan distances is shown. In this case

© 2008 by Taylor & Francis Group, LLC


OTHER DIMENSION REDUCTION TECHNIQUES 139
a clear separation of the two groups of tumors is observed, as was the case
with the principal components analysis.

Figure 5.6 MDS representation of the gene expression data based on Manhattan
distances. The NB samples are represented by ◦, the RMS by ⋄, the BL by ⋆ and the
EWS by .

5.4 Other Dimension Reduction Techniques

We briefly outline extensions of principal components analysis and multidi-


mensional scaling that have proved useful in various data analytic tasks. All
of these approaches attempt to deal with the presence of strong nonlinearities
in the data. Finally, in the presence of categorical data a somewhat different
approach is required (for a comprehensive review see [25]).
Local PCA: If one would like to retain the conceptual simplicity of PCA,
together with its algorithmic efficiency in the presence of nonlinearities in the
data, one could resort to applying PCA locally. One possibility is to perform
a cluster analysis, and then apply different principal components analyses to
the various clusters [8]. Some recent advances on this topic are discussed in
[24].

© 2008 by Taylor & Francis Group, LLC


140 UNSUPERVISED LEARNING TECHNIQUES

Figure 5.7 MDS representation of the gene expression data of the RMS (⋄) and EWS
() samples, based on Manhattan distances.

Kernel PCA: The idea behind kernel PCA [29] is that nonlinear patterns
present in low dimensional spaces can be linearized by projecting the data
into high dimensional spaces, at which point classical PCA becomes effective.
Although this concept is contrary to the idea of using PCA for data reduction
purposes, it has proved successful in some application areas like hand-written
digit recognition. In order to make this idea computationally tractable, kernels
(for a brief discussion see the chapter on Classification Techniques) are used
that essentially calculate inner products of the original variables.
Manifold learning methods: These methods assume that the data have a
nonlinear structure that is captured by a smooth connected manifold. These
techniques such as Local Linear Embedding (LLE) [27], Hessian LLE [10],
Laplacian Eigenmaps [5] and Isomap [31] construct a low dimensional data
representation using a cost function that retains local properties of the data.
For example, the Isomap technique constructs a dissimilarity matrix for only
locally neighboring points and then uses multidimensional scaling for deriving

© 2008 by Taylor & Francis Group, LLC


CLUSTER ANALYSIS TECHNIQUES 141
the final configuration. On the other hand, LLE uses local linear approxi-
mations of the manifold and then pieces them together; it can be viewed as
defining a graph-based kernel to be used in conjunction with kernel PCA. For
a comprehensive review of these methods, see also [28].

5.5 Cluster Analysis Techniques

5.5.1 Problem formulation and algorithms

The main idea behind cluster analysis is to investigate relationships between


the objects in order to establish whether or not the data can validly be sum-
marized by a small number of groups (clusters) of similar objects. A good
outcome manages to assign the N objects in the dataset into a small number
of groups in such a way that members in the same group are as ‘similar’ as
possible, while members of different groups are as ‘dissimilar’ as possible.
Formally we have: let O = {o1 , o2 , . . . , oN } be a set of N objects and let C =
{C1 , ..., CK } be collection of subsets of O; i.e., Ck ⊂ O for all k = 1, · · · , K.
Each subset is called a cluster, and C is a clustering solution.
The input data for a clustering problem is typically given in one of two forms:

- Profile data matrix XN ×p , where each object oi is associated with a real-


valued vector, called its profile, which contains measurements on p vari-
ables, e.g., gene expression levels at different experimental conditions.
- Dissimilarity matrix ∆N ×N , that contains the pairwise dissimilarities (or
similarities) that are usually computed from the profile data.

When dealing with a cluster analysis problem the following issues need to be
studied [15]:

• what is the criterion used (e.g., homogeneity vs separation).


• what type of clustering should be considered.
• how difficult it is to perform the clustering (issue of complexity).
• how should the clustering be done (issue of algorithmic design).
• is the resulting clustering meaningful (i.e., how should the results be inter-
preted).

Remark:
In most clustering problems few assumptions, usually posed in set-theoretic
terms, are made. However, in some cases the problem is posed as one where the
clusters correspond to mixtures of distributions whose number and parameters
need to be estimated (learned) from the data [26].

© 2008 by Taylor & Francis Group, LLC


142 UNSUPERVISED LEARNING TECHNIQUES
We examine next some of the most popular algorithmic approaches for clus-
ter analysis. Primarily they can be categorized into two groups: (i) partition
methods and (ii) tree-type methods.
Partition methods create a family of clusters where each object belongs to just
a single member of the partition. Formally, we require Ci ∩ Cj = ∅ for clusters
i and j with i 6= j and ∪k Ck = O. To generate such partitions the requirement
is that distances between pairs of objects belonging to the same cluster are
smaller than distances between pairs of objects in different clusters. Formally,
suppose that objects i and j belong to cluster A, while object k belongs to
cluster B. We then require that dij < dik and dij < djk .
Tree methods build a tree of clusters that includes all the objects and for which
any two clusters are either disjoint or one cluster is a superset of the other.
In tree methods it is usually required that the distance be an ultrametric;
i.e., dij ≤ max{dik , djk }. Equivalently we have that for every triple of objects
(i, j, k) we have that the 2 largest values in the set {dij , djk , dik } are equal.
Partition methods:
Points are assigned to clusters with the objective of optimizing some criterion.
We can decompose the variation as
T = W + B, (5.11)

where X
T = (xi − x̄)(xi − x̄)′ (5.12)
all objectsi

and X
W = nk (xi − x̄k )(xi − x̄k )′ (5.13)
all clustersk

where nk is the number of objects in cluster k, x̄ is the overall mean of the data
and x̄k is the mean of cluster k. It is worth noting that the above definitions
are identical to the ones in MANOVA. The only difference is that we don’t
know a priori which group an object belongs to.
Given that T is fixed a good clustering algorithm seeks to minimize some
measure of W (the within groups variation) and hence maximize some measure
of B (the between groups variation). Criteria that have been suggested in the
literature include:

1. Minimize trace(W ) (not invariant to changes in scale).


2. Minimize det(W ).
3. Maximize the sum of the eigenvalues of W −1 B.

Remark: This optimization problem is a hard one from a computational point


of view. Just notice that there are 1030 ways to allocate 100 objects to 2 groups.
Hence, exhaustive search is not a viable option. Therefore, various heuristic

© 2008 by Taylor & Francis Group, LLC


CLUSTER ANALYSIS TECHNIQUES 143
methods have been proposed in the literature to deal with the problem at
hand. One of the most popular ones is the K-means clustering algorithm.
The K-means algorithm:
The K-means algorithm optimizes the following objective function
K
X X
H(K) = ||Xk − mi ||2 , (5.14)
i=1 Xk ∈Ci

where mi are the centroids or means of the clusters Ci , and || · || denotes


the Euclidean norm. The algorithm proceeds by partitioning N objects into
K nonempty subsets. Note that the value of K is determined by the user.
During each partition, the centroids or means of the clusters are computed.
The main steps of the K-means algorithm are as follows:

1. Assign initial means mi to each of the K clusters.


2. Assign each data object oj with profile Xj to the cluster Ci for the closest
mean.
3. Compute new mean for each cluster using
P
Xk
mi = Xk ∈Ci , (5.15)
|Ci |
where |Ci | is the number of objects in cluster Ci .
4. Iterate until criterion function converges, i.e., there are no more new as-
signments.

The K-means algorithm is simple and has been widely used in the analysis of
microarray data. Typically, the algorithm converges fairly fast to a solution.
However, it requires as input parameters the cluster number K and initial
centroids. Randomly chosen initial centroids may lead to poor results. Further,
due to its nature the algorithm favors spherically shaped clusters.

Model based clustering:


In this approach, we try to turn the problem into a density estimation one
based on statistical mixture models. They provide a probabilistic alternative
to deterministic partition algorithms. The idea is that the objects are indepen-
dent samples from an unknown number of group populations, but the group
labels have been lost. If we knew that the vector α gave the group labels, and
each group had class-conditional probability density functions fαk (xk ; θ) then
the likelihood would be given by
Πk fαk (xk ; θ). (5.16)
Since the labels are unknown, these are regarded as parameters, and hence
we need to maximize the likelihood function over (θ, α). For arbitrary densi-
ties fαk (xk ; θ) the problem is almost computationally intractable. However,

© 2008 by Taylor & Francis Group, LLC


144 UNSUPERVISED LEARNING TECHNIQUES
for normal densities the expectation-maximization algorithm allows one to
estimate the parameters of interest.
In case we choose the conditional probability density functions to be N (µk , σ 2 I)
(different means, common covariance matrix), then this procedure is equiv-
alent to K-means. Other possibilities allow clusters of different sizes, shapes
and orientations, by imposing constraints on the covariance matrix.
In [4], a general framework was proposed based on parameterizing covariance
matrices through the eigenvalue decomposition as follows:
Σk = λk Dk Ak Dk′ , k = 1, . . . , K, (5.17)

where Dk is the orthonormal matrix of eigenvectors, Ak is a diagonal matrix


whose elements are proportional to the eigenvalues and λk is an associated
constant of proportionality. Dk governs the orientation of the kth cluster, Ak
its shape and λk its volume, which is proportional to λk det(Ak ). For example,
if the largest eigenvalue of Σk is much larger in magnitude than the remaining
ones, then the k-th cluster will be concentrated close to a line, which will
correspond to the first PC of the k-th group. If the first two eigenvalues are
much larger than the rest, then the k-th cluster will be concentrated close to
a plane. If finally all the eigenvalues of the k-th group are about the same,
then the k-th cluster will be roughly spherical.
One of the advantages of the model based clustering formulation is that it pro-
vides a principled mechanism to determine the number of clusters and compare
the parameterizations of different models (volume, orientation, shape). Given
the likelihood formulation in (5.16) one can use the Bayesian Information Cri-
terion (BIC) for model selection purposes in terms of number of clusters and
parameterizations.
A review of model based clustering together with extensions of the frame-
work that incorporates more complex parameterizations with applications to
genomic data are discussed in [17, 18].

Self-Organizing Maps:
The self-organizing map (SOM) is a neural network algorithm that has been
used in a wide variety of applications (for microarray data, see [14]). For a
comprehensive treatment of the topic consult Kohonen’s book [22].
This particular algorithm is motivated by ideas in competitive learning (see
[3, 22]), that can be described as the adaptive process in which neurons in
a neural network gradually become more sensitive to different input samples
(data). ‘A kind of division of labor emerges in the network when different
neurons specialize to represent different types of input’ [19]. The specialization
is enforced by competition among the neurons: when a new input x arrives
(e.g., a new data point), the neuron that is best able to represent it wins the
competition and is allowed to learn it even better.

© 2008 by Taylor & Francis Group, LLC


CLUSTER ANALYSIS TECHNIQUES 145
If there exists an ordering between the neurons, e.g., the neurons are located
on a discrete lattice, then a competitive learning algorithm can be generalized
to allow not only for the winning neuron, but also for its closest neighbors
to learn. Thus, neighboring neurons will eventually specialize to represent
similar inputs, and the resulting representation will become ordered on the
map lattice. We formulate these heuristic ideas next.
Consider the self-organizing network given in Figure 5.8. Let M input signals
be simultaneously incident on each of an N × N array of neurons. The output
of the ith neuron is defined as
" #
T
X
ηi (t) = σ [mi (t)] x(t) + wki ηk (t − △t) , (5.18)
k∈Si

where x is the M -dimensional input vector incident on it along the connection


weight vector mi , k belongs to the subset Si of neurons having interconnec-
tions with the ith neuron, wki denotes the fixed feedback coupling between
the kth and ith neurons, σ[.] is a suitable sigmoidal output function, t denotes
a discrete time index and T stands for the transpose.
Input points that are close in p-dimensional space are also mapped closely on
the q-dimensional lattice. Each lattice cell is represented by a neuron that has a
p-dimensional adaptable weight vector associated with it. With every input the
match with each weight vector is computed. Then the best matching weight
vector and some of its topological neighbors are adjusted to match the input
points a little better. Initially, the process starts with a large neighborhood;
with passage of time (iteration), the neighborhood size is reduced gradually.
At a given time instant, within the neighborhood, the weight vector associated
with each neuron is not updated equally. The strength of interaction between
the winner and a neighboring node is inversely related to the distance (on the
lattice) between them.
Initially the components of mi are set to small random values lying in the
range [0, 0.5]. If the best match between vectors mi and x occurs at neuron
c, then we have

kx − mc k = min kx − mi k, i = 1, 2, . . . , N 2 , (5.19)
i

where k.k indicates the Euclidean norm.


The weight updating is given as [22]

mi (t) + α(t) (x(t) − mi (t)) for i ∈ Nc
mi (t + 1) = (5.20)
mi (t) otherwise,

where α(t) is a positive constant that decays with time and Nc defines a topo-
logical neighborhood around the maximally responding neuron c, such that
it also decreases with time. Different parts of the network become selectively

© 2008 by Taylor & Francis Group, LLC


146 UNSUPERVISED LEARNING TECHNIQUES

Figure 5.8 Depiction of Kohonen’s neural network.

sensitized to different inputs in an ordered fashion so as to form a continuous


map of the signal space. After a number of sweeps through the training data,
with weight updating at each iteration obeying Eq. (5.20), the asymptotic
values of mi cause the output space to attain proper topological ordering.
This is basically a variation of unsupervised learning.
Vector quantization can be seen as a mapping from an n-dimensional Eu-
clidean space into a finite set of prototypes. Based on this principle, Kohonen
proposed an unsupervised learning algorithm, which is a special case of SOFM
and is known as LVQ [22]. In LVQ, only the weight vector associated with the
winner node is updated with every data point by Eq. (5.20). The topological
neighborhood is not updated here. Such a learning scheme, where all nodes
compete to become the winner, is termed competitive learning. It is essentially
a clustering network that does not care about preserving the topological order.
Its main uses are for clustering, classification and image data compression.
There exists a family of LVQs, termed LVQ1 and LVQ2 [22]. These algorithms
are supervised learning schemes, essentially used as classifiers. The basic idea
behind LVQ1 is as follows. If the winner prototype mi has the same class
label as that of the data point x, then bring mi closer to x; otherwise, move
mi away from x. Nonwinner nodes are not updated. LVQ2, a modified form
of LVQ1, is designed to make the learning scheme comply better with Bayes’
decision-making philosophy. This algorithm considers the winner along with
the runner-up (second winner).

Agglomerative Hierarchical Algorithms:


In general hierarchical methods create an iterated partition. The clustering
solution is represented by a dendrogram, which is a rooted weighted tree

© 2008 by Taylor & Francis Group, LLC


CLUSTER ANALYSIS TECHNIQUES 147
T , with leaves corresponding to the objects. A tree satisfies the following
conditions:
(i) O ∈ T , (ii) ∅ 6∈ T . (iii) oi ∈ T all i ∈ O (5.21)
(iv) if A, B ∈ T , then A ∩ B ∈ {∅, A, B}. (5.22)

Each edge defines the cluster of objects contained in the subtree below that
particular edge. The edge’s length (or weight) reflects the dissimilarity between
that cluster and the remaining clusters.

Although hierarchical clustering of objects determines a set of ultrametric


distances, practitioners rarely make use of the values themselves. Attention
is most often paid only in the ordering of the lengths. More specifically, such
methods start with one object per cluster and merge them to form progres-
sively larger groups. Since groups are merged to form larger groups we need
a definition of distance between groups. The three most common possibilities
are:

Single linkage: The dissimilarity between two clusters is defined by


d(Ci , Cj ) = min{d(s, t)|os ∈ Ci , ot ∈ Cj }. (5.23)
s,t

Complete linkage: In this case, the dissimilarity is defined by


d(Ci , Cj ) = max{d(s, t)|os ∈ Ci , ot ∈ Cj }. (5.24)
s,t

Average linkage: In this case, the dissimilarity is defined by


P P
s∈Ci t∈Cj d(i, j)
d(Ci , Cj ) = . (5.25)
ni nj

Other possibilities to perform the join operation include:


P
1. Ward’s method that merges clusters that minimize all clusters (SS about
the mean in cluster).
2. The weighted average linkage.

We illustrate next the complete linkage algorithm by using it on the complete


gene expression data set for tumors and that based on the RMS and EWS
samples only. In the first case, dissimilarities were computed based on all
2308 genes using the Manhattan metric, while in the latter, they were based
on 83 selected genes. The results are shown in Figure 5.9. In both cases, the
clustering algorithm reveals some substructure of the samples, with some of
them being very similar. Further, for the second data set, a clear clustering
pattern emerges, as expected.

© 2008 by Taylor & Francis Group, LLC


148 UNSUPERVISED LEARNING TECHNIQUES

Figure 5.9 Left panel: Complete linkage based clustering of tumor samples based on
2308 genes. Right panel: Complete linkage based clustering of RMS and EWS tumor
samples based on 83 selected genes.

5.5.2 Some practical considerations

Cluster analysis is based on the distance between points, so variables need


to be scaled appropriately. If we decide to standardize all variables it implies
that we deem all variables to be equally important. On the other hand if we
scale only some of the variables, it implies that we consider some of them more
important than others. As data analysts you should be aware that scaling will
affect the results of many clustering algorithms, since they are not robust to
scale changes.
Another important issue is which variables to use in cluster analysis. You
would notice that the various clustering techniques do not have built-in vari-
able selection mechanisms. Moreover, more variables are not necessarily bet-
ter. A good idea is to run a PCA in order to assess the importance of variables
before applying cluster analysis.

5.5.3 Biclustering

Although cluster analysis techniques have a long history in statistics and com-
puter science, biclustering algorithms originated in bioinformatics problems,
especially in trying to find structure in gene expression data. To make things
concrete consider a gene expression matrix X with rows corresponding to
genes and columns corresponding to samples (e.g., experimental conditions,
different a priori defined classes, etc). Cluster analysis techniques can be ap-
plied separately either on the genes, or on the samples, with the goal being
to discover homogeneous groups of the former or the latter (e.g., groups of
co-regulated groups, groups of similarly behaving patients, etc). As already
seen in this section, clustering algorithms usually partition the genes/samples

© 2008 by Taylor & Francis Group, LLC


CLUSTER ANALYSIS TECHNIQUES 149

Figure 5.10 Illustration of biclusters

into disjoint sets. However, in many situations overlapping clusters of genes


and samples may be appropriate, thus requiring a more flexible framework.
A bicluster is defined as a submatrix containing a set of genes and a set of sam-
ples, as shown in Figure 5.10. It is important to note that in principle, there
are no a priori constraints in the organization of biclusters, which can be
overlapping, with the same genes/samples being members of multiple ones.
The downside of this flexibility is over-fitting, which needs to be countered
by a statistical model or scoring method that identifies significant biclusters.
Finally, since the most active area of applications of biclustering is gene ex-
pression data that are inherently noisy, the resulting algorithms must exhibit
a fairly high level of robustness to noise.
Biclustering algorithms have been successfully applied to problems in ge-
nomics, but also to clinical studies. In the former case, the objective is to
understand the functions of genes as members of a biological system. By
collecting gene expression data on the genes under a number of biological
conditions and subsequently identifying joint patterns, one can characterize
transcriptional programs and assign gene function [12, 16]. Similarly in clinical
studies, by collecting gene expression profiles on a large number of patients,
one can identify subsets of patients associated with specific clinical conditions
and/or treatment outcomes [1]. Biclustering allows the assignment of patients
to multiple clinical groups.
We discuss next some of the proposed biclustering algorithms in the literature.
The set of rows (genes) in the expression matrix X would be denoted by G
and the set of columns (samples) by S.
Cheng and Church Algorithm:
This was the first paper [9] to consider biclustering in the context of gene
P of genes G̃ ⊂ G and a subset of samples
expression data. Define for a subset
S̃ ⊂ S, the grand mean X̄·,· = i∈G̃,j∈S̃ Xi,j /(|G̃||S̃|), the row mean X̄i,· =

© 2008 by Taylor & Francis Group, LLC


150 UNSUPERVISED LEARNING TECHNIQUES
P P
j∈S̃ Xi,j /|S̃| and the column mean X̄·,j = i∈G̃ Xi,j /|G̃|. The residual of
each element of submatrix XG̃,S̃ is then defined as eij = Xi,j + X̄·,· − X̄·,j − X̄i,·
and the mean squared residual by M (G̃, S̃) = i∈G̃,j∈S̃ e2i,j /(|G̃||S̃|). It can be
P
seen that any submatrix that can be written as the sum of mean and column
effects in analysis of variance parlance would have a mean squared residual
equal to zero.
The biclustering problem is defined as identifying a bicluster of maximum size
amongst all biclusters with mean squared residual not exceeding a prespeci-
fied threshold δ. The size may correspond to the number of elements or the
number of columns plus the number of rows. A greedy search algorithm was in-
troduced in [9] that guarantees convergence to a local maximum and discovers
a single bicluster. In order to discover multiple biclusters, repeated application
of the algorithm is suggested on modified matrices that are obtained through
randomization of the entries in the values of previously discovered biclusters.
Spectral Biclustering:
Spectral biclustering is based on the singular value decomposition of the ex-
pression matrix X = U ΛV ′ , with Λ being a diagonal matrix. It is best suited
for matrices with a ’checkerboard’ structure, which in turn would be reflected
in the stepwise structure of the singular vectors in U and V (namely, the eigen-
vectors of X ′ X and XX ′ , respectively). For each pair of left and right singular
vectors (columns in U and V , respectively) corresponding to the same singu-
lar value Λi , one checks whether they can be approximated by a piecewise
constant vector [21].
Plaid Models:
The main idea is to represent the expression matrix as s superposition of
biclusters, where entries in each bicluster take a particular set of values [23].
Formally, the expression matrix X can be represented as
K
X
Xij = µ0 + θijk aik bjk ,
k=1

where µ0 captures the uniform background and θijk = µk + αik + βjk describe
mean, row and column effects of each bicluster. The parameters aik , bjk ∈
{0, 1} are gene/sample bicluster membership indicator variables. Hence, simi-
lar to the Cheng-Church algorithm, a bicluster is assumed to be the sum of a
mean background level plus row and column specific effects. The biclustering
problem is formulated as estimating the parameters of interest so that the
following sum of squares criterion is minimized:
X K
X
[Xij − (µ0 + θijk ]aik bjk ,
i∈G,j∈S k=1
P P
subject to the identifiability constraints ∈∈G aik αik = 0 or ∈∈G bik βik = 0.
An iterative algorithm and a stopping criterion are discussed in [23].

© 2008 by Taylor & Francis Group, LLC


EXERCISES 151
The Statistical-Algorithmic Method for Bicluster Analysis Algorithm:
This algorithm uses a combination of probabilistic modeling of the data and
graph theoretic techniques to identify biclusters [30]. The expression data
are represented as a bipartite graph, whose two disjoint vertex (node) sets
correspond to the set of genes and the set of samples, respectively. Edges
between genes and samples capture significant changes in expression levels,
whose weights are assigned according to a probabilistic model, so that highly
weighted subgraphs correspond to the biclusters with high probability. The
proposed algorithm in [30] is a heuristic one, motivated by a combinatorial
algorithm for finding highly weighted bicliques.
Some Other Algorithms:
Other proposals in the literature include the coupled two-way clustering al-
gorithm [13] and the iterative signature algorithm [6]. The former iterates
between clustering the genes and clustering the samples in identifying sta-
ble biclusters. This algorithm requires that the one-way clustering algorithms
used on the genes and the samples are capable of identifying significant (stable)
clusters; hence, popular clustering algorithms, such as k-means or agglomera-
tive algorithms, can not be directly used as plug-ins. The iterative signature
algorithm tries to identify a subset of genes and samples that exhibit the fol-
lowing property: the average expression profile over samples and the average
expression profiles of genes in the bicluster should be ‘significantly’ high or
low (over- or under-expressed, respectively).

5.6 Exercises

1. (a) Let X be a n × p data matrix in which each row corresponds to a p-


variate measurement on one of n individuals. Assuming that the p variates are
numerical variables, describe three possible measures of dissimilarity of pairs
of individuals. Comment on their relative advantages and disadvantages.
(b) What are the properties that a dissimilarity function must satisfy? What
about a distance function?
(c) The values of four binary variables are measured for each of four individ-
uals as follows:

Individual Variable
V1 V2 V3 V4
===================
1 1 1 1 0
2 0 0 1 1
3 1 1 1 1
4 0 1 0 1

© 2008 by Taylor & Francis Group, LLC


152 UNSUPERVISED LEARNING TECHNIQUES
Construct a dissimilarity matrix for the four individuals using two appropriate
dissimilarity measures. Show your work.
(d) Six subjects were tested on a number of standardized tests. The scores
for each subject were recorded and the Euclidean distances between each pair
of subjects were calculated as follows:

Subject
A B C D E F
A 0
B 4.2 0
C 5.9 7.6 0
D 1.2 7.0 10.3 0
E 6.1 2.6 5.4 7.8 0
F 1.3 3.6 4.5 3.2 8.2 0

Using single linkage clustering, cluster the six subjects. Sketch the dendro-
gram and interpret the results. How would your dendrogram change if you
used a complete linkage clustering algorithm?

2. Let xi = (x1i , x2i , · · · , xpi ) denote the vector containing the p measurements
for the i-th observation. A measure of heterogeneity of a cluster C of size nC
is given by
XnC
HC = d2 (xi , x̄C ),
i=1
where the index i runs over the observations in the cluster, d(ui , uj ) de-
notes the Euclidean distance between observations ui and uj and x̄C the
p-dimensional multivariate mean of cluster C. Show that when two clusters
C1 and C2 are merged, the heterogeneity of the merged cluster, denoted by
HC1 +C2 , is increased. Provide an expression for the increase relative to the
sum of the heterogeneity measures of the two original clusters. Can you sug-
gest a clustering algorithm?

3. For the clustering of objects with p binary variables, a possible dissimilarity


measure between two observations is based on the following contingency table:

with δ1 (i, j) = (b + c)/p.


A researcher proposes an alternative dissimilarity measure δ2 (i, j) = 2(b +
c)/(a + d + 2(b + c)); i.e., it doubles the weight of the mismatch.
(a) Show that for observations i, j, k, ℓ if
δ1 (i, j) ≥ δ1 (k, ℓ) =⇒ δ2 (i, j) ≥ δ2 (k, ℓ).

© 2008 by Taylor & Francis Group, LLC


REFERENCES 153
Object j
1 0 Sum
1 a b a+b
Object i
0 c d c+d
Sum a+c b+d p

(b) Two researchers decided to use single-linkage hierarchical clustering to


cluster a data set comprised of binary variables. The first researcher decides
to use δ1 as the dissimilarity measure, while the second one δ2 . What can you
say about the results that the two researchers will get? Explain.

References

[1] Alizadeh, A.A. et al. (2000), Distinct types of diffuse large B-cell lymphoma
identified by gene expression profiling, Nature, 403, 503-511
[2] Alon, U., Barkai, N., Notterman, D.A., Gish, K., Ybarra, S., Mack, D. and
Levine, A.J. (1999), Broad patterns of gene expression revealed by clustering
analysis of tumor and normal colon tissues probed by oligonucleotide array, Pro-
ceedings of the National Academies of Science USA, 96, 6745-6750
[3] Amari, S.I, (1991), Dualistic geometry of the manifold of higher-order neurons,
Neural Networks, 4, 443-451
[4] Banfield, J.D. and Raftery, A.E. (1993), Model based Gaussian and non-Gaussian
clustering, Biometrics, 49, 803-821
[5] Belkin, M. and Nyogi, P. (2003), Laplacian eigenmaps for dimensionality reduc-
tion and data representation, Neural Computation, 15, 1373-1396
[6] Bergmann, S., Ihmels, J. and Barkai, N. (2003), Iterative signature algorithm for
the analysis of large-scale gene expression data, Physical Review E, 67, 201-218
[7] Borg, I. and Groenen, P. (1997), Modern Multidimensional Scaling: Theory and
Applications, Springer, NY
[8] Bregler, C. and Omohundro, M. (1994), Surface learning with applications to
lipreading, in Cowan et al. (eds), Advances in Neural Information Processing
Systems, Morgan Kaufman, San Mateo, CA
[9] Church, G.M. and Cheng, Y. (2000), Biclustering of expression data, in Proceed-
ings of ISMB 2000, 93-103, AAAI Press
[10] Donoho, D.L. and Grimes, C. (2003), Hessian eigenmaps: locally linear em-
bedding techniques for high-dimensional data, Proceedings of the National
Academies, USA, 100, 5591-5596
[11] Eisen, M.B., Spellman, P.T., Brown, P.O. and Botstein, D. (1998), Cluster anal-
ysis and display of genome-wide expression patterns, Proceedings of the National
Academies of Science USA, 95, 14863-14868
[12] Gasch, A.P. et al. (2001), Genomic expression responses to DNA-damaging
agents and the regulatory role of the yeast ATR homolog mec1p, Molecular
Biology of the Cell, 12, 2987-3003

© 2008 by Taylor & Francis Group, LLC


154 UNSUPERVISED LEARNING TECHNIQUES
[13] Getz, G., Levine, E., Domany, E. and Zhang, M.Q. (2000), Super-paramagnetic
clustering of yeast gene expression profiles, Physica A, 279, 457
[14] Golub, T.R., Slonim, D.K, Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov,
J.P., Coller, H., Loh, M.L, Downing, J.R., Caligiuri, M.A, Bloomfield, C.D. and
Lander, E.S. (1999), Molecular classification of cancer: Class discovery and class
prediction by gene expression monitoring, Science, 286, 531-537
[15] Hansen, P. and Jaumard, B. (1997), Cluster analysis and mathematical pro-
gramming, Mathematical Programming, 79, 191-215
[16] Hughes, J.D., Estep, P.E., Tavazoie, S. and Church, G.M. (2000), Computa-
tional identification of cis-regulatory elements associated with groups of func-
tionally related genes in Saccharomyces Cerevisiae, Journal of Molecular Biology,
296, 1205-1214
[17] Jornsten, R. (2007), Simultaneous subset selection via rate distortion theory,
submitted to Journal of Computational and Graphical Statistics
[18] Jornsten, R. and Keles, S. (2008), Mixture models with multiple levels, with
application to the analysis of multifactor gene expression data, to appear in
Biostatistics
[19] Kaski, S. (1997), Data exploration using self-organizing maps, Acta Polytechnica
Scandinavica, Mathematics, Computing and Management in Engineering Series
No. 82
[20] Khan, J., Wei, J.S., Ringnér, M., Saal, L.H., Ladanyi, M., Westermann, F.,
Berthold, F., Schwab, M., Antonescu, C.R., Peterson, C. and Meltzer, P.S.
(2001), Classification and diagnostic prediction of cancers using gene expression
profiling and artificial neural networks, Nature Medicine, 7, 673-679.
[21] Kluger, Y., Barsi, R., Cheng, J.T. and Gerstein, M (2003), Spectral biclustering
of microarray data: co-clustering genes and conditions, Genome Research, 13,
703-716
[22] Kohonen, T. (2001), Self-organizing Maps, Springer, Berlin
[23] Lazzeroni, L. and Owen, A. (2002), Plaid models for gene expression data,
Statistica Sinica, 12, 61-86
[24] Liu, Z.Y. and Xu, L. (2003), Topological local principal components analysis,
Neurocomputing, 55, 739-745
[25] Michailidis, G. and de Leeuw, J. (1998), The Gifi system of descriptive multi-
variate analysis, Statistical Science, 13, 307-336
[26] Mirkin, B. (1996), Mathematical Classification and Clustering, Kluwer Aca-
demic Publishers, Dordrecht, The Netherlands
[27] Roweis, S.T. and Saul, L.K. (2000), Nonlinear dimensionality reduction by lo-
cally linear embedding, Science, 290, 2323-2326
[28] Saul, L.K. and Roweis, S.T. (2003), Think globally, fit locally: unsupervised
learning of low dimensional manifolds, Journal of Machine Learning Research,
4, 119-155
[29] Scholkopf, B., Smola, A. and Muller, K.R. (1998), Nonlinear component analysis
as a kernel eigenvalue problem, Neural Computation, 4, 1299-1309
[30] Tanay, A., Sharan, R., Kupiec, M. and Shamir, R. (2004), Revealing modularity
and organization in the yeast molecular network by integrated analysis of highly
heterogeneous genome-wide data, Proceedings of the National Academies of the
USA, 101, 2981-2986
[31] Tenenbaum, J.B., de Silva, V. and Langford, J.C. (2000), A global geometric
framework for nonlinear dimensionality reduction, Science, 290, 2319-2323

© 2008 by Taylor & Francis Group, LLC


CHAPTER 6

Computational Intelligence in
Bioinformatics

6.1 Introduction

In addition to the machine learning and probabilistic approaches, computa-


tional intelligence (or soft computing) is gradually opening up several pos-
sibilities in Bioinformatics – especially by generating low-cost, low-precision,
good solutions. This is a consortium of methodologies that works synergisti-
cally and provides flexible information processing capability for handling real
life ambiguous situations [1].
In this chapter we introduce the different soft computing paradigms, like fuzzy
sets, artificial neural networks (ANNs), evolutionary computation and rough
sets, and outline their role along this direction. Each of them contributes a
distinct methodology for addressing problems in its domain, in a cooperative
rather than a competitive manner. The result is a more intelligent and robust
system providing a human-interpretable, low-cost, approximate solution, as
compared to traditional techniques.
The term soft computing had its origin in the concept of fuzzy sets, and per-
tained to the inherent elasticity associated with the membership functions.
Most biological systems behave in a fuzzy manner, with the interaction and
activity of various genes attaining different levels. A single gene may be in-
volved in different biological processes. For example, fuzzy clustering allows
genes to simultaneously (softly) belong to multiple clusters and participate
in multiple pathways. This is a more natural reflection of the biological real-
ity of cellular metabolism. It is unlike the hard categorization of objects into
crisp, nonoverlapping sets. Rough sets, unlike crisp sets, also provide a suit-
able representation for manipulation of the uncertainty prevalent in everyday
life.
Artificial neural networks constitute another nature-inspired architecture, that
mimics the learning or adaptivity of the biological nervous system in an at-
tempt to incorporate intelligence. It is this pliability to adapt towards changes
in environment and the capacity to correct itself from errors in judgement, that
allows us to categorize the ANN under soft computing.
Genetic algorithms employ evolution-inspired operators like crossover, muta-

155

© 2008 by Taylor & Francis Group, LLC


156 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
tion and selection on a population of “chromosomes.” The efficient search
strategy represents a solution in terms of a string, which is analogically called
a chromosome. It may be noted that this is not the chromosome that encom-
passes the DNA in biological literature. This adaptive algorithm optimizes a
fitness function, based on the survival-of-the-fittest principle, while evolving
towards its goal by generating the best set of chromosomes. It is the inherent
softness that lets it adaptively direct the search under environmental influence.
Hybridization [2] exploiting the characteristics of the paradigms includes neuro-
fuzzy, rough-fuzzy, neuro-genetic, fuzzy-genetic, neuro-rough, rough-neuro-fuzzy,
evolutionary-rough-neuro-fuzzy approaches, to mention a few. However, among
these, neuro-fuzzy computing is the oldest and most visible.
The major pattern recognition and data mining tasks considered here are
clustering, classification, feature selection and rule mining. While classifica-
tion pertains to supervised learning, in the presence of known targets, cluster-
ing corresponds to unsupervised self-organization into homologous partitions.
Feature selection techniques aim at reducing the number of irrelevant and re-
dundant variables in the dataset. Rule mining enables efficient extraction and
representation of mined knowledge in human-understandable form.
Genomic sequence, protein structure, gene expression microarrays and gene
regulatory networks are some of the application areas described. Since the
work entails processing huge amounts of incomplete or ambiguous biologi-
cal data, we can utilize the learning and generalization capability of artificial
neural networks for adapting, uncertainty handling capacity of fuzzy sets and
rough sets for modeling ambiguity, and the searching potential of genetic al-
gorithms for efficiently traversing large search spaces [3].
This chapter provides an overview of the available literature on Bioinformatics,
in the soft computing framework [4]. Introduction to fuzzy sets (FS), artifi-
cial neural networks (ANNs), evolutionary computing (EC) [including GAs],
rough sets (RS), and their hybridizations, are provided in Sections 6.2-6.6.
We describe in Section 6.7 the role of these paradigms and their hybridiza-
tions, in different application domains of Bioinformatics. It may be mentioned
that there is no universally best technique; choosing particular soft computing
tool(s) or some combination with traditional methods is entirely dependent
on the particular application, and it requires human interaction to decide on
the suitability of an approach. Finally, Section 6.8 concludes the chapter.

6.2 Fuzzy Sets (FS)

Typically, real-life data must not only be cleaned of errors and redundancy, but
must also be organized in a fashion that makes sense to the problem. There can
exist imperfections in raw input data needed for knowledge acquisition, mainly
due to uncertainty, vagueness and incompleteness. While incompleteness arises

© 2008 by Taylor & Francis Group, LLC


FUZZY SETS (FS) 157
due to missing or unknown data, uncertainty (or vagueness) can be caused by
errors in physical measurements due to incorrect measuring devices or by a
mixture of noisy and pure signals.
Fuzzy sets were introduced by Zadeh [5] in 1965 as a new way of represent-
ing vagueness in everyday life. They constitute the earliest and most widely
reported constituent of soft computing. The theory provides an approximate
and yet effective means for describing the characteristics of a system that is
too complex or ill-defined to admit precise mathematical analysis [6]. Much
of the logic behind human reasoning is not the traditional two-valued or even
multivalued logic, but logic with fuzzy truths, fuzzy connectives and fuzzy
rules of inference.
Fuzzy sets are able to handle, to a reasonable extent, uncertainties (aris-
ing from deficiencies of information) in various applications particularly in
decision-making models under different kinds of risks, subjective judgment,
vagueness and ambiguity. Since this theory is a generalization of the classical
set theory, it has greater flexibility to capture various aspects of incomplete-
ness or imperfection in information about a situation. The use of linguistic
variables may be viewed as a form of data compression, which can be termed
granulation [1]. The same effect can also be achieved by conventional quanti-
zation. However, in the case of quantization the values are intervals, whereas
in the case of granulation the values are overlapping fuzzy sets.
The uncertainty in classification or clustering of patterns may arise from the
overlapping nature of the various classes. This may be due to fuzziness or
randomness. In the conventional classification technique, it is usually assumed
that a pattern belongs to only one class. However, this is not necessarily
realistic – either physically or mathematically. A pattern can have degrees of
membership in more than one class, and both supervised and unsupervised
learning should be able to accommodate this.
A fuzzy set A in a space of points R = {r} is a class of events with a continuum
of grades of membership, and it is characterized by a membership function
µA (r) that associates with each element in R a real number in the interval
[0, 1] with the value of µA (r) at r representing the grade of membership of r
in A. Formally, a fuzzy set A with its finite number of supports r1 , r2 , . . . , rn
is defined as a collection of ordered pairs
A = {(µA (ri ), ri ), i = 1, 2, . . . , n}
= {( µAr(r
i
i)
), i = 1, 2, . . . , n},
where the support of A is an ordinary subset of R and is defined as
Supp(A) = {r|r ∈ R and µA (r) > 0}.
Here µi , the grade of membership of ri in A, denotes the degree to which an
event ri may be a member of A or belong to A. Note that µi = 1 indicates
the strict containment of the event ri in A. If, on the other hand, ri does not
belong to A, then µi = 0.

© 2008 by Taylor & Francis Group, LLC


158 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
If the support of a fuzzy set is only a single point r1 ∈ R, then A = µr11 is
called a fuzzy singleton. A fuzzy set A, with its finite number of supports
r1 , r2 , . . . , rn , can also be expressed in the union form of its constituent sin-
gletons as
µ1 µ2 µn
A= + + ···+ , (6.1)
r1 r2 rn
where the + sign denotes the union.

Let us consider an example of the crisp set of ages of a group of people, defined
as
Ac = {5, 10, 20, 30, 40, 50, 60, 70, 80}.
Let the membership grades µyoung of these elements (people) in the fuzzy set
young Ayoung be given by
{1, 1, .8, .5, .2, .1, 0, 0, 0}. We express

Supp(Ayoung ) = {5, 10, 20, 30, 40, 50},

with
 
1 1 .8 .5 .2 .1
Ayoung = + + + + + .
5 10 20 30 40 50

Fuzzy logic is based on the theory of fuzzy sets and, unlike classical logic, aims
at modeling the imprecise (or inexact) modes of reasoning and thought pro-
cesses (with linguistic variables) that play an essential role in the remarkable
human ability to make rational decisions in an environment of uncertainty
and imprecision. This ability depends on our ability to infer an approximate
answer to a question based on a store of knowledge that is inexact, incomplete,
or not totally reliable. In fuzzy logic, everything, including truth, is a matter
of degree [8]. Zadeh has developed a theory of approximate reasoning based
on fuzzy set theory.

Most biological systems behave in a fuzzy manner, with the interaction and ac-
tivity of various genes attaining different levels. A single gene may be involved
in different biological processes. Fuzzy clustering allows genes to simultane-
ously belong to multiple clusters and participate in multiple pathways. This
is a more natural reflection of the biological reality of cellular metabolism.

Information integration from multiple sources is utilized to generate biologi-


cally meaningful results. Fuzzy systems enable incorporation of user-friendly
domain knowledge about some genes, in the form of linguistic If-Then rules,
into the network. Fuzzy aggregation may be used to combine this information
from databases of genes and their products, along with their interactions, in a
natural framework. Fuzzy measures can be employed to compute the similarity
between gene products annotated with GO terms.

© 2008 by Taylor & Francis Group, LLC


FUZZY SETS (FS) 159
S

1.0

0.5

0
c r
Figure 6.1 Standard S function.

6.2.1 Membership functions

Assignment of membership functions of a fuzzy subset is subjective in na-


ture and reflects the context in which the problem is viewed. Note that fuzzy
membership function and probability density function are conceptually differ-
ent. It is often convenient to employ standardized functions with adjustable
parameters (e.g., the S and π functions) which are defined in the following
equations (see also Fig. 6.1):
S(r; α, c) = 0 for r≤α
= 2( r−α
c−α )
2
for α≤r≤β
r−c 2 (6.2)
= 1 − 2( c−α ) for β≤r≤c
= 1 for r ≥ c.

π(r; c, λ) = S(r; c − λ, c − λ2 , c) for r ≤ c


(6.3)
= 1 − S(r; c, c + λ2 , c + λ) for r ≥ c.
In eqn. (6.2) we have β = (α + c)/2 as the crossover point, that is, the value
of r at which S takes the value 0.5. In π(r; c, λ), λ is the bandwidth, that is,
the distance between the crossover points of π, while c is the central point at
which π is unity.
Let us consider the linguistic variable age (x). Here the linguistic values young
and old play the role of primary fuzzy sets which have a specified meaning,
for example,
µyoung = 1 − S(20, 40), (6.4)
µold = S(50, 70), (6.5)
where the S and π functions are defined by Eqs. (6.2) and (6.3), and µyoung
and µold denote the membership functions of young and old, respectively.

© 2008 by Taylor & Francis Group, LLC


160 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS

0.5

c r

Figure 6.2 π function.

In pattern recognition problems we often need to represent a class with fuzzy


boundary in terms of a π function. It is also expressed as
  2
|r−c|
 2 1− λ

 , for λ2 ≤ |r − c| ≤ λ
2
π(r; c, λ) = (6.6)

|r−c|

 1 − 2 λ , for 0 ≤ |r − c| ≤ λ2

0, otherwise.
This is shown in Fig. 6.2. Note that the membership value is maximum when
r = c, that is, π(c; c, λ) = 1. The membership value is 0.5, at the crossover
point, where |r − c| = λ/2.

6.2.2 Some basic operations

Basic operations related to fuzzy subsets A and B of R having membership


values µA (r) and µB (r), r ∈ R respectively, are summarized here [10].

1. A is equal to B (i.e., A = B) ⇒ µA (r) = µB (r), for all r ∈ R.


2. A is a complement of B (i.e., A = B) ⇒ µA (r) = µB (r) = 1 − µB (r) for all
r ∈ R.
3. A is contained in B (A ⊆ B) ⇒ µA (r) ≤ µB (r) for all r ∈ R.
4. The union of A and B (A ∪ B) ⇒ µA∪B (r) = ∨(µA (r), µB (r)) for all r ∈ R,
where ∨ denotes maximum.
5. The intersection of A and B (A ∩ B) ⇒ µA∩B (r) = ∧(µA (r), µB (r)) for all
r ∈ R, where ∧ denotes minimum.

We also have the modifiers very and more or less. These are expressed as
µvery young = (µyoung )2 , (6.7)

µmore or less young = (µyoung )0.5 . (6.8)

© 2008 by Taylor & Francis Group, LLC


ARTIFICIAL NEURAL NETWORKS (ANN) 161
6.2.3 Clustering

The Fuzzy c-means (FCM) algorithm is a fuzzification of the c-means algo-


rithm, and was proposed by Bezdek [138]. It allows a pattern to be assigned
to more than one partition depending on its membership value.
The algorithm partitions a set of N patterns {Xk } into c clusters by minimiz-
ing the objective function
N X
X c

J= (µik )m ||Xk − mi ||2 , (6.9)
k=1 i=1

where 1 ≤ m′ < ∞ is the fuzzifier, mi is the ith cluster center, µik ∈ [0, 1] is
the membership of the kth pattern to it and ||.|| is the distance norm, such
that PN m′
k=1 (µik ) Xk
m i = PN (6.10)
m′
k=1 (µik )
and
1
µik =   2 , (6.11)
Pc dik m′ −1
j=1 djk
Pc PN
∀i, with dik = ||Xk − mi ||2 , subject to i=1 µik = 1, ∀k, and 0 < k=1 µik <
N , ∀i. The algorithm proceeds as follows.

1. Pick the initial means mi , i = 1, . . . , c. Choose values for fuzzifier m′ and


threshold ǫ. Set the iteration counter t = 1.
2. Repeat Steps 3-4, by incrementing t, until |µik (t) − µik (t − 1)| > ǫ.
3. Compute µik by eqn. (6.11) for c clusters and N data objects.
4. Update means mi by eqn. (6.10).

Note that for µik ∈ [0, 1] the objective function of eqn. (6.9) boils down to the
hard c-means case, whereby a winner-take-all strategy is applied in place of
membership values in eqn. (6.10).

6.3 Artificial Neural Networks (ANN)

ANNs [14, 16, 17] are signal processing systems that form a massively parallel
interconnection of simple (usually adaptive) processing elements, and interact
with objects of the real world in a manner similar to biological systems. The
origin of ANNs can be traced to the work of Hebb [20], where a local learning
rule was proposed. This rule assumed that correlations between the states of
two neurons determined the strength of the coupling between them. Subse-
quently, a synaptic connection that was very active grew in strength and vice
versa.

© 2008 by Taylor & Francis Group, LLC


162 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
ANNs can typically perform tasks like pattern classification, clustering or cat-
egorization, function approximation, prediction or forecasting, optimization,
retrieval by content and control. They can be viewed as weighted directed
graphs in which artificial neurons are nodes and directed edges (with weights)
are connections between neuron outputs and neuron inputs. On the basis of the
connection pattern (architecture), ANNs can be grouped as (i) feedforward, in
which graphs have no loops – like single-layer perceptron, multilayer percep-
tron (MLP), radial basis function (RBF) networks, Kohonen self-organizing
map (SOM), and (ii) recurrent (or feedback), in which loops occur because
of feedback connections – like Hopfield network, adaptive resonance theory
(ART) models.
The adaptability of a neural network comes from its capability of learning from
“environments.” Broadly, there are three paradigms of learning: supervised,
unsupervised (or self-organized) and reinforcement. Sometimes, reinforcement
is viewed as a special case of supervised learning. Under each category there
are many algorithms. In supervised learning, adaptation is done on the basis of
direct comparison of the network output with known correct or desired answer.
Unsupervised learning tunes the network to the statistical regularities of the
input data to form categories (or partitions) by optimizing, with respect to the
free parameters of the network, some task-independent measure of quality of
the representation. The reinforcement learning, on the other hand, attempts
to learn the input–output mapping through trial and error with a view to
maximizing a performance index called reinforcement signal. Here the system
only knows whether the output is correct, but not what the correct output is.
ANNs are natural classifiers having resistance to noise, tolerance to distorted
images or patterns (ability to generalize), ability to recognize partially oc-
cluded or degraded images or overlapping pattern classes or classes with highly
nonlinear boundaries and potential for parallel processing. They use nonpara-
metric adaptive learning procedures, learn from examples and discover impor-
tant underlying regularities in the task domain.
There has been widespread activity aimed at extracting the embedded knowl-
edge in trained ANNs in the form of symbolic rules [22, 23]. This serves to
identify the attributes that, either individually or in a combination, are the
most significant determinants of the decision or classification. Since all infor-
mation is stored in a distributed manner among the neurons and their con-
nectivity, any individual unit cannot essentially be associated with a single
concept or feature of the problem domain.
Generally ANNs consider a fixed topology of neurons connected by links in a
predefined manner. These connection weights are usually initialized by small
random values. Knowledge-based networks [24, 25] constitute a special class of
ANNs that consider crude domain knowledge to generate the initial network
architecture, which is later refined in the presence of training data. The use
of knowledge-based nets helps in reducing the searching space and time while
the network traces the optimal solution.

© 2008 by Taylor & Francis Group, LLC


ARTIFICIAL NEURAL NETWORKS (ANN) 163
6.3.1 Single-layer perceptron

The perceptron [26, 27] was one of the most exciting developments during
the early days of pattern recognition. It consists of a single neuron with ad-
justable weights, wj , j = 1, 2, . . . , n, and threshold θ. Given an input vector
x = [x1 , x2 , . . . , xn ]T , the net input to the neuron is
n
X
v= wj xj − θ. (6.12)
j=1

The output y of the perceptron is +1 if v > 0 and is 0 otherwise. In a two-class


classification problem, the perceptron assigns an input pattern
Pn to one class if
y = 1 and to the other class if y = 0. The linear equation j=1 wj xj − θ = 0
defines the decision boundary (a hyperplane in the n-dimensional input space)
that halves the space. Rosenblatt proved that when training patterns are
drawn from two linearly separable classes, the perceptron learning procedure
converges after a finite number of iterations. Here learning occurs only when
the perceptron makes an error. The perceptron learning algorithm is outlined
as follows:

1. Initialize the weights and threshold to small random numbers.


2. Present a pattern vector [x1 , x2 , . . . , xn ]T and evaluate the output of the
neuron.
3. Update the weights according to
wj (t + 1) = wj (t) + ε(d − y)xj , (6.13)
where d is the desired output, t is the iteration number and ε (0.0 < ε < 1.0)
is the learning rate (step size).

However if the pattern space is not linearly separable, then the perceptron fails
[28]. A single-layer perceptron is thus inadequate for situations with multiple
classes and nonlinear separating boundaries.

6.3.2 Multilayer perceptron (MLP) using backpropagation of error

The multilayer perceptron (MLP) [16] consists of multiple layers of simple,


two-state, sigmoid processing elements (nodes) or neurons that interact using
weighted connections. There exist one or more intermediate hidden layers,
between the input and output layers. Typically all neurons in a layer are fully
connected to the neurons in the adjacent layers.
In a standard classification task, the number of units in the output layer H
corresponds to the number of output classes. During training, the appropriate
output node is clamped to state 1 while the others are clamped to state 0.

© 2008 by Taylor & Francis Group, LLC


164 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
Output

Layer H

Layer h+1 j xh+1


j

wh
ji

yh
i
Layer h i
xh
i

Layer 0

Input

Figure 6.3 MLP with two hidden layers.

Let us consider the network given in Fig. 6.3. The total input xh+1
j received
by neuron j in layer h+1 is defined as
X
xh+1
j = yih wji
h
− θjh+1 , (6.14)
i

where yih h
is the state of the ith neuron in the preceding hth layer, wji is the
weight of the connection from the ith neuron in layer h to the jth neuron in
layer h + 1 and θjh+1 is the threshold of the jth neuron in layer h + 1.
The output of a neuron in any layer other than the input layer (h > 0) is
expressed as
1
yjh = h . (6.15)
1 + e−xj
For nodes in the input layer yj0 = x0j , where x0j is the jth component of the
input vector clamped at the input layer. Learning consists of minimizing the
error by updating the weights in a very large parameter space.
The least mean square (LMS) error in output vectors, for a given network
weight vector w, is defined as
1 X H
E = (y − dj,p )2 , (6.16)
2 j,p j,p
H
where yj,p is the state obtained for output node j in layer H for input–output
pattern p and dj,p is its desired state specified by the teacher. One method
for minimization of E is to apply the method of gradient descent by starting

© 2008 by Taylor & Francis Group, LLC


ARTIFICIAL NEURAL NETWORKS (ANN) 165
with any set of weights and repeatedly updating each weight by an amount
h ∂E h
∆wji (t) = −ε + α∆wji (t−1), (6.17)
∂wji
where the positive constant ε controls the descent, 0 ≤ α ≤ 1 is the damping
coefficient or momentum and t denotes the number of the iteration currently
in progress. Generally ε and α are set at constant values, but there exist
h
approaches that vary these parameters. Initially the connection weights wji
between each pair of neurons i in layer h and j in layer h + 1 are set to small
random values lying in the range [−0.5, 0.5].
¿From Eqs. (6.14)–(6.16), we have
∂E ∂E dyj ∂xj ∂E h
= = y (1 − yjh ) yih−1 . (6.18)
∂wji ∂yj dxj ∂wji ∂yj j
For the output layer (h = H), we substitute in Eq. (6.18)
∂E
= yjH − dj . (6.19)
∂yj
For the other layers, using Eq. (6.14), we substitute in Eq. (6.18)
∂E X ∂E dyk ∂xk X ∂E dyk
= = wh , (6.20)
∂yj ∂yk dxk ∂yj ∂yk dxk kj
k k

where units j and k lie in layers h and h + 1, respectively.


During training, each pattern of the training set is used in succession to clamp
the input and output layers of the network. After a number of iterations over
the training data, the error E in Eq. (6.16) may be minimized. At this stage
the network is supposed to have discovered (learned) the relationship between
the input and output vectors in the training samples.
In the testing phase the neural net is expected to be able to utilize the informa-
tion encoded in its connection weights to assign the correct output labels for
the test vectors that are now clamped only at the input layer. Determination
of the optimal number of hidden layers and/or nodes is another interesting
problem.

6.3.3 Radial basis function network (RBF)

A radial basis function (RBF) network [29, 30] consists of two layers as shown
in Fig. 6.4. Let the connection weight vectors of the input and output layers
be denoted as m and w, respectively. The basis (or kernel) functions in the
hidden layer produce a localized response to the input stimulus. The output
nodes form a weighted linear combination of the basis functions computed by
the hidden nodes.
Let x = (x1 , . . . , xi , . . . , xn ) ∈ Rn and y = (y1 , . . . , yi , . . . , yl ) ∈ Rl be the

© 2008 by Taylor & Francis Group, LLC


166 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
Output

1 Classes

m clusters

n features

Input

Figure 6.4 Radial basis function network.

input and output, respectively, and let m be the number of hidden nodes.
Here the hidden nodes represent the number of clusters (specified by the user)
that partition the input space.
The output uj of the jth hidden node, using the Gaussian kernel function as
a basis, is given by
" #
(x − mj )T (x − µj )
uj = exp − , j = 1, 2, . . . , m, (6.21)
2σ2j

where x is the input pattern, µj is its input weight vector (i.e., the center
of the Gaussian for node j) and σ 2j is its width, such that 0 ≤ uj ≤ 1 (the
closer the input is to the center of the Gaussian, the larger the response of
the node).
The output yj of the jth output node is
yj = w Tj u, j = 1, 2, . . . , l, (6.22)
where wj is the weight vector for this node, and u is the vector of outputs from
the hidden layer. The network performs a linear combination of the nonlinear
basis functions of Eq. (6.21).
The problem is to minimize the error
N l
1X X
E= (yj,p − dj,p )2 , (6.23)
2 p=1 j=1

where dj,p and yj,p are desired and computed output at the jth node for the
pth pattern, N is the size of the data set and l is the number of output nodes.
Learning in the hidden layer, typically, uses the c-means clustering algorithm.
Let the cluster centers be denoted as µj , j = 1, . . . , m. The parameter σj rep-
resents a measure of the spread of data associated with each node. Learning in

© 2008 by Taylor & Francis Group, LLC


EVOLUTIONARY COMPUTING (EC) 167
the output layer is performed after the parameters of the basis functions have
been determined. The weights are typically trained online, from the presented
patterns, using the LMS algorithm. It is given by
∆w j = −ε(yj − dj )u, (6.24)
where ε is the learning rate.

6.4 Evolutionary Computing (EC)

The term evolutionary computing encompasses genetic algorithms (single-


objective and multi-objective), evolutionary algorithms and genetic program-
ming. It provides efficient search techniques for nonlinear optimization in fairly
large and arbitrary solution spaces. In this section we provide an introduction
to some of these evolutionary strategies.

6.4.1 Genetic algorithms (GAs)

Genetic algorithms (GAs) [31, 32] are adaptive and robust computational
search procedures that employ evolution-inspired operators like selection,
crossover and mutation while being controlled by a fitness function. The com-
ponents of a GA consist of a population of individuals represented as chro-
mosomes, their encoding or decoding mechanism, probabilities to perform the
genetic operations, a replacement technique for the pool of possible solutions
and the termination conditions.
Let us consider, as an example, the optimization of a function
y = f (x1 , x2 , . . . , xp ).
A binary vector is used as a chromosome to represent real values of the vari-
ables xi , with the length of the vector constraining the allowed precision in
bits. A population is a set of individuals (chromosomes) representing the con-
catenated parameter set x1 , x2 , . . . , xp , where each member refers to a coded
possible solution. For example, a sample chromosome
00001|01000| . . . |11001
could correspond to x1 = 00001, x2 = 01000 and xp = 11001. The Schema
theorem provides a complete guidance on the feasible solutions in the search
space.
The chromosomes can be of fixed or variable size. Selection obeys the Dar-
winian survival of the fittest strategy, with the objective function playing
the role of Nature or environment. Variation is introduced in the population
through the genetic operations like recombination (crossover) and mutation.
Normally the initial population is chosen randomly.

© 2008 by Taylor & Francis Group, LLC


168 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
Encoding is used to convert parameter values into chromosomal representa-
tion. In case of continuous-valued parameters, a decimal-to-binary conversion
is used. For example, using a 5-bit representation, 13 is encoded as 01101. In
case of parameters having categorical values, a particular bit position in the
chromosomal representation is set to 1 if it comes from a certain category. For
example, the gender of a person can have values from {male, female}, such
that male/female is represented by the bit 1/0. These bits or strings (repre-
senting the parameters of a problem) are then concatenated, and termed a
chromosome.
Decoding is the reverse of encoding. For a continuous-valued parameter the
binary representation is converted to a continuous value by the expression
Pbits used−1
biti ∗ 2i
lower bound + i=0bits used ∗ (upper bound − lower bound).
2 −1
Hence 01101 in five bits (bits used) is decoded back to 13, using lower bound =
0 and upper bound = 31. In case of categorical parameters, the value is found
by referring to the original mapping.
The fitness function provides a measure on the performance of the chromo-
some. Selection gives more chance to better-fitted individuals, thereby mim-
icking the natural selection procedure. Some of the popular selection tech-
niques include roulette wheel selection, stochastic universal sampling, linear
normalization selection, and tournament selection. The roulette wheel selec-
tion procedure initially sums the fitness values (fi s) of all the N chromosomes
in the population, and it stores them in slots sized accordingly. Let this sum be
given by total f itness. The probability of selection pi for the ith chromosome
is expressed as
fi
pi = , (6.25)
total f itness
while the cumulative probability qi after inclusion of the ith chromosome is
given by qi = ij=1 pj . Selection is made by spinning the roulette wheel N
P
times, on each occasion generating a random number nr in [0, total f itness].
In rule form, we have
IF nr < q1 THEN select the first chromosome,
ELSE select the ith chromosome such that qi−1 < nr ≤ qi .

Crossover is modeled by choosing mating pairs from the selected chromosomes,


with the crossover probability pc determining whether or not a pair should
be crossed over such that the corresponding chromosome segments are inter-
changed. A random number nrc is generated in the range [0, 1]. If nrc < pc ,
the corresponding chromosome pair is selected for crossover. Again, crossover
can be one point, two point, multi-point or uniform. Let us consider, as an
example, two parent chromosomes xyxyxyxy and abababab where x, y, a, b are
binary. In one-point crossover at the 4th bit involving the parent chromosomes
xyx|yxyxy

© 2008 by Taylor & Francis Group, LLC


EVOLUTIONARY COMPUTING (EC) 169
aba|babab,
one generates the children
xyx|babab
aba|yxyxy.
Here the segment involving bits 4 to 8 is interchanged between the parents.
In case of two-point crossover at the 4th and 6th bits, involving parent chro-
mosomes
xyx|yx|yxy
aba|ba|bab,
we obtain the children chromosomes
xyx|ba|yxy
aba|yx|bab.
Here the segment constituting bits 4 to 5 is swapped between the parents to
generate the pair of offsprings.
The mutation operator is used to introduce diversity in the population, with
the mutation probability pm determining whether or not a bit should be mu-
tated such that the corresponding location is flipped. For example, a mutation
at the 4th bit would transform the chromosome 001|0|00 to 001|1|00. Prob-
abilities pc and pm can be fixed or variable, and they typically have values
ranging between 0.6 to 0.9, and 0.001 to 0.01, respectively.
The replacement techniques can be

1. Generational, where all the n individuals are replaced at a time by the n


children created by reproduction. Elitism is often introduced to retain the
best solution obtained so far.
2. Steady state, where m < n members are replaced at a time by the m
children reproduced.

The terminating criterion for the algorithm can be on the basis of (i) execution
for a fixed number of generations or iterations, (ii) a bound on the fitness value
of the generated solution or (iii) acquiring of a certain degree of homogeneity
by the population.
Let us consider a simple example to illustrate the working principle of GAs. It
is related to minimizing the surface area A of a solid cylinder, given radius r
and height h. Here the fitness function can be expressed as A = 2πrh + 2πr2 .
We need to encode the parameters r and h in a chromosome. Using a 3-bit
representation, we demonstrate encoding, crossover and mutation. For r1 =
3, h1 = 4 and r2 = 4, h2 = 3, we generate parent chromosomes 011|100
and 100|011 with A1 = 132, A2 = 176, respectively. Let there be one-point
crossover at bit 4, producing the children chromosomes 011|011 and 100|100.
This is decoded as r1c = 3, h1c = 3 and r2c = 4, h2c = 4, with A1c = 16.16

© 2008 by Taylor & Francis Group, LLC


170 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
and A2c = 28.72, respectively. Now, let there be mutation at bit 5 of the first
child. This generates the chromosome 0110|0|1, for r1cm = 3 and h1cm = 1,
with A1cm = 10.77. This is the minimum value of fitness obtained thus far.
Consecutive applications of the genetic operations of selection, crossover and
mutation, up to termination, enable the minimization (optimization) of the
chosen fitness function.
GAs have been applied in diverse problems including optimization, pattern
recognition, image processing, data mining and bioinformatics. Note that,
unlike GAs, evolutionary algorithms [33] rely only on mutation and do not
perform crossover. Applications pertaining to bioinformatics involve sequence
alignment, protein tertiary structure prediction, docking, microarray cluster-
ing and genetic network extraction.
In protein structure prediction and folding, GAs try to generate a set of native-
like conformations of a protein based on a force field, while minimizing a fitness
function. The choice of the fitness function is governed by factors such as
interatomic bond lengths, bond angles, electrostatic forces, potential energy–
and poses challenging applications to the pharmaceutical industry in drug
design.
Often classification or gene regulatory effects depend on the influence of a
combination of genes. This leads to an enhancement in the potential search
space, as the number of such possible combinations increases. Here lies the
utility of intelligent search techniques like GAs. An optimal set of biclusters
cannot be guaranteed, since it is an NP-hard problem. Therefore, the quality
of biclustering is often considered to be more important than the computation
time required to generate it. Hence GAs provide an alternative efficient search
technique in a large solution space, based on the theory of evolution.

6.4.2 Multi-objective GA (MOGA)

Unlike single-objective optimization problems, the multiple-objective GA tries


to optimize two or more conflicting characteristics represented by fitness func-
tions. Modeling this situation with a single-objective GA would amount to a
heuristic determination of a number of parameters involved in expressing such
a scalar-combination-type fitness function. MOGA, on the other hand, gener-
ates a set of Pareto-optimal solutions [34] which simultaneously optimize the
conflicting requirements of the multiple fitness functions.
In order to maintain diversity in the population, a measure called crowding
distance is used. The multi-objective algorithm NSGA-II is characterized as
follows.

1. Initialize the population randomly.


2. Calculate the multi-objective fitness function.

© 2008 by Taylor & Francis Group, LLC


ROUGH SETS (RS) 171
3. Rank the population using the criterion of dominance and crowding dis-
tance.
4. Do selection, using crowding selection operator, followed by crossover and
mutation (as in conventional GA) to generate children population.
5. Combine parent and children population.
6. Replace the parent population by the best members of the combined pop-
ulation. Initially, members of lower fronts replace the parent population.
When it is not possible to accommodate all the members of a particular
front, then that front is sorted according to the crowding distance. Selec-
tion of individuals is done on the basis of higher crowding distance. The
number selected is that required to make the new parent population size
the same as the size of the old one.

6.4.3 Other evolutionary strategies

Another evolutionary scheme, often used in Bioinformatics, is Genetic pro-


gramming (GP). This invokes exertion of evolutionary pressure on a program
to make it evolve, thereby discovering optimal computer programs resulting
in innovative solutions to problems [36]. The principle of operation is similar
to GAs, with the focus shifting to evolving programs rather than candidate
solutions. GP solutions are computer programs represented as tree structures,
that are probabilistically selected according to their fitness in solving the can-
didate problem. These are then modified with genetic operators (crossover
and mutation) to generate new solutions.

6.5 Rough Sets (RS)

Rough sets provide another formalism to handle existing uncertainty in the


domain of discourse. These are also found to be useful in tasks like dimen-
sionality reduction, and present considerable promise in the mining of high
dimensional microarray data for extracting meaningful knowledge. The con-
cept of reducts, from rough set theory, enables extraction of the minimal set of
attributes. We present here some requisite preliminaries of rough set theory,
in terms of formal definitions.
Definition 1 An Information System A = (U, A) consists of a nonempty,
finite set U of objects (cases, observations, etc.) and a nonempty, finite set
A of attributes a (features, variables), such that a : U → Va , where Va is a
value set. We shall deal with information systems called decision tables, in
which the attribute set has two parts (A = C ∪ D) consisting of the condition
and decision attributes (in the subsets C, D of A respectively). In particular,
the decision tables we take will have a single decision attribute d, and will be
consistent, i.e., whenever objects x, y are such that for each condition attribute
a, a(x) = a(y), then d(x) = d(y).

© 2008 by Taylor & Francis Group, LLC


172 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS

upper
approximation

Set X

lower approximation

Figure 6.5 Lower and upper approximations in a rough set.

Definition 2 Let B ⊂ A. Then a B-indiscernibility relation IN D(B) is de-


fined as
IN D(B) = {(x, y) ∈ U : a(x) = a(y), ∀a ∈ B}. (6.26)

It is clear that IN D(B) partitions the universe U into equivalence classes


[xi ]B = {xj ∈ U : (xi , xj ) ∈ IN D(B)}, xi ∈ U. (6.27)

Definition 3 The B-lower and B-upper approximations of a given set X(⊆


U ) are defined, respectively, as follows:
BX = {x ∈ U : [x]B ⊆ X},
BX = {x ∈ U : [x]B ∩ X 6= φ}.
The B-boundary region is given by BNB (X) = BX \ BX.

Figure 6.5 provides a schematic diagram of a rough set in the F1 -F2 feature
space. The effectiveness of RS has been investigated in the domains of artificial
intelligence and cognitive sciences, especially for representation of and reason-
ing with vague and/or imprecise knowledge, data classification and analysis,
machine learning, and knowledge discovery [37].

6.5.1 Reducts

In a decision table A = (U, C ∪ D), one is interested in eliminating redundant


condition attributes, and actually relative (D)-reducts are computed.

S B ⊆ C, and consider the B-positive region of D, viz., P OSB (D) =


Let
[x]D B[x]D . An attribute b ∈ B(⊆ C) is D-dispensable in B if P OSB (D) =
P OSB\{b} (D), otherwise b is D-indispensable in B. Here B is said to be D-
independent in A, if every attribute from B is D-indispensable in B.

© 2008 by Taylor & Francis Group, LLC


HYBRIDIZATION 173
Definition 4 B(⊆ C) is called a D-reduct in A, if B is D-independent in A
and P OSC (D) = P OSB (D).

Notice that, as decision tables with a single decision attribute d are taken to
be consistent, U = P OSC (d) = P OSB (D), for any d-reduct B.

6.5.2 Discernibility matrix

D-reducts can be computed with the help of D-discernibility matrices [38]. Let
U = {x1 , · · · , xm }. A D-discernibility matrix MD (A) is defined as an m × m
matrix of the information system A with the (i, j)th entry cij given by
cij = {a ∈ C : a(xi ) 6= a(xj ), and (xi , xj ) 6∈ IN D(D)}, i, j ∈ {1, · · · , m}.
(6.28)
A variant of the discernibility matrix, viz., distinction table [39] is often used
to enable faster computation.
2
Definition 5 A distinction table is a binary matrix with dimensions (m 2−m) ×
N , where N is the number of attributes in A. An entry b((k, j), i) of the matrix
corresponds to the attribute ai and pair of objects (xk , xj ), and is given by

1 if ai (xk ) 6= ai (xj ),
b((k, j), i) = (6.29)
0 if ai (xk ) = ai (xj ).
The presence of a ‘1’ signifies the ability of the attribute ai to discern (or
distinguish) between the pair of objects (xk , xj ).

6.5.3 Clustering

In the rough c-means clustering algorithm, the concept of c-means is extended


by viewing each cluster as an interval or rough set [166]. A rough set Y is
characterized by its lower and upper approximations BY and BY respectively.
This permits overlaps between clusters. Here an object Xk can be part of at
most one lower approximation. If Xk ∈ BY of cluster Y , then simultaneously
Xk ∈ BY . If Xk is not a part of any lower approximation, then it belongs to
two or more upper approximations.

6.6 Hybridization

There has been a lot of research on the hybridization aspect of the different
soft computing paradigms. Of these, neuro-fuzzy (NF) computing is the oldest
and most widely reported in literature.
The concept of ANNs was inspired by biological neural networks, which are in-
herently nonlinear, adaptive, highly parallel, robust and fault tolerant. Fuzzy

© 2008 by Taylor & Francis Group, LLC


174 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
logic, on the other hand, is capable of modeling vagueness, handling uncer-
tainty and supporting human-type reasoning. These are integrated in the NF
framework, by augmenting each other to generate a more intelligent informa-
tion system [2, 40, 41]. The integration of neural and fuzzy systems leads to
a symbiotic relationship, in which fuzzy systems provide a powerful linguistic
framework for expert knowledge representation, while neural networks provide
learning capabilities and suitability for computationally efficient hardware im-
plementations.
It has been proved [42] that (i) any rule-based fuzzy system may be approx-
imated by a neural net, and (ii) any neural net (feedforward, multilayered)
may be approximated by a rule-based fuzzy system. Jang and Sun [43] have
shown that fuzzy systems are functionally equivalent to a class of RBF net-
works, based on the similarity between the local receptive fields of the network
and the membership functions of the fuzzy system. Extraction of rules from
neural nets enables humans to understand their prediction process in a better
manner. This is because rules are a form of knowledge that human experts can
easily verify, transmit and expand. Representing rules in natural form aids in
enhancing their comprehensibility for humans. This aspect is suitably handled
using fuzzy set-based representations.
Neuro-fuzzy hybridization [2] is done broadly in two ways: a neural network
equipped with the capability of handling fuzzy information [termed fuzzy–
neural network (FNN)], and a fuzzy system augmented by neural networks
to enhance some of its characteristics like flexibility, speed and adaptability
[termed neural–fuzzy system (NFS)].
In an FNN either the input signals and/or connection weights and/or the
outputs are fuzzy subsets or a set of membership values to fuzzy sets (e.g.,
Refs. [44, 45, 46]). Usually, (i) linguistic values (such as low, medium and high)
or (ii) fuzzy numbers or (iii) intervals are used to model these. A neural–fuzzy
system (NFS), on the other hand, is designed to realize the process of fuzzy rea-
soning, where the connection weights of the network correspond to the param-
eters of fuzzy reasoning (e.g., Refs. [47, 48]). Using the backpropagation-type
learning algorithms, the NFS can identify fuzzy rules and learn membership
functions of the fuzzy reasoning. Typically, the NFS architecture has distinct
nodes for antecedent clauses, conjunction operators and consequent clauses.
The state of the art for the different techniques of judiciously combining neuro-
fuzzy concepts involves synthesis at various levels.
1. Incorporating fuzziness into the neural net framework: fuzzifying the input
data, assigning fuzzy labels to the training samples, fuzzifying the learning
procedure and obtaining neural network outputs in terms of fuzzy sets
[46, 49, 45].
2. Designing neural networks guided by fuzzy logic formalism: designing neu-
ral networks to implement fuzzy logic and fuzzy decision-making, and to
realize membership functions representing fuzzy sets [50, 47, 48].

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 175
3. Changing the basic characteristics of the neurons: neurons are designed to
perform various operations used in fuzzy set theory (like fuzzy union, inter-
section, aggregation) instead of the standard multiplication and addition
operations [51, 52, 53].

4. Using measures of fuzziness as the error or instability of a network: the


fuzziness or uncertainty measures of a fuzzy set are used to model the error
or energy function of the neural network-based system [54].

5. Making the individual neurons fuzzy: the input and output of the neurons
are fuzzy sets and the activity of the networks, involving the fuzzy neurons,
is also a fuzzy process [44].

Fusion of fuzzy systems and GAs can be done, under fuzzy–genetic hybridiza-
tion, for tuning of fuzzy sets [55]. For example, this can be for membership
function selection and tuning. While integrating neural networks with EC, the
two components may interact in many ways [56]. For example, GAs can help
to avoid the tedious backpropagation algorithm for an MLP, thereby over-
coming some limitations of ANNs [57]. The optimal topology of an ANN can
also be evolved using GAs [58, 59, 60]. Such an integrated approach may be
termed genetic–neural. We can have approaches that exploit the benefits of
fuzzy sets, ANNs and GAs. Such systems may be termed neuro-fuzzy–genetic
(NFG) [61, 62, 63]. For example, a fuzzy reasoning system may be imple-
mented using a multilayer network, where the free parameters of the system
may be learned using GAs. Similarly, the parameters of an FNN may also be
learned using GAs.

Hybridizations, exploiting the characteristics of rough sets, include the rough–


fuzzy [64, 65] and rough–neuro-fuzzy [66, 67] approaches. The primary role of
rough sets here is in managing uncertainty and extracting domain knowledge.
Other recent investigations concern the modular evolutionary–rough–neuro-
fuzzy integration [68, 69] for classification and rule mining. Here the use of
EC helps in generating an optimal NF architecture, that is initially encoded
using RS for extracting crude domain knowledge from data.

6.7 Application to Bioinformatics

In this section we highlight the role of different soft computing paradigms [3,
4, 70, 71, 72] like fuzzy sets, ANNs, GAs, rough sets and their hybridizations,
in different areas of Bioinformatics. The major problems covered here include
primary genomic sequence, protein structure, microarray and gene regulatory
networks. We categorize the applications based on the different paradigms
used.

© 2008 by Taylor & Francis Group, LLC


176 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
6.7.1 Primary genomic sequence

Eukaryotic genes are typically organized as exons (coding regions) and in-
trons (noncoding regions). Hence the main task of gene identification, from
the primary genomic sequence, involves coding region recognition and splice
junction detection. Sequence data are typically dynamic and order dependent.
A protein sequence motif is a signature or consensus pattern that is embed-
ded within sequences of the same protein family. Identification of the motif
leads to classification of an unknown sequence into a protein family for further
biological analysis.
Sequence motif discovery algorithms can follow (i) string alignment, (ii) ex-
haustive enumeration and (iii) heuristic methods. String alignment algorithms
detect sequence motifs by minimizing a cost function which is related to the
edit distance between the sequences. Multiple alignment of sequences is an
NP-hard problem, with its computational complexity increasing exponentially
with sequence size. Local search algorithms may lead to local optima instead
of the best motif. Exhaustive enumeration algorithms, though guaranteed to
find the optimal motif, are computationally too expensive. Here lies the utility
of using soft computing techniques for faster convergence.

FS

Imprecise knowledge of a nucleic acid or a protein sequence of length N has


been modeled by a fuzzy biopolymer [73]. This is a fuzzy subset of kN ele-
ments, with k = 4 bases for nucleic acids and k = 20 amino acids for proteins.
Profiles considered in the study were a class of biopolymers generated by multi-
ple alignment of a group of related sequences based on matrices of frequencies.
A sequence is represented as a vector in a unit hypercube (corresponding to
a fuzzy set) that assigns to each position-monomer pair the possibility with
which the monomer (base or amino acid) appears in this position. The mid-
point of a pair of fuzzy biopolymers of the same length is interpreted as an
average of the knowledge of the sequences represented by them.
A systematic verification and improvement of underlying profiles has been un-
dertaken [74], using fuzzy c-means clustering for contextual analysis. Here the
authors investigate the recognition of potential transcription factor binding
sites in genomic sequences.

ANN

The popularity of ANNs in genomic sequence analysis is mainly due to the


involvement of high dimensional space with complex characteristics, which is
difficult to model satisfactorily using parameterized approaches. We describe
here the role of different models, like self-organizing map (SOM), multilayer

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 177
perceptron (MLP), recurrent network, counterpropagation, radial basis func-
tion network (RBF) and adaptive resonance theory (ART), in gene identifica-
tion.
Perceptron
Perceptrons were used to predict coding regions in fixed-length windows [75]
with various input encoding methods, including binary encoding of codon and
dicodon frequency, and the performance was found to be superior to Bayesian
statistical prediction. Perceptrons have also been employed to identify cleav-
age sites in protein sequences [76], with the physicochemical features (of 12
amino acid residues) like hydrophobicity, hydrophilicity, polarity and volume
serving as the input. However, single-layer perceptrons are limited to linearly
separable classification problems.
MLP
The MLP has been employed for both classification as well as rule generation.
Classification.
An MLP, with backpropagation learning, was used to identify exons in DNA
sequences in GRAIL [77]. Thirteen input features used include sequence length,
exon GC composition, Markov scores, splice site (donor/acceptor) strength,
surrounding intron character, etc., calculated within a fixed 99-nucleotide se-
quence window and scaled to lie between 0 and 1. A single output indicated
whether a specific base, central to the said window, was either coding or non-
coding.
A three-layered MLP, with binary encoding at input, was employed to predict
acceptor and donor site positions in splice junctions of human genomic DNA
sequences [78]. A joint assignment, combining coding confidence level with
splice site strength, was found to reduce the number of false positives.
Prediction of the exact location of transcription initiation site has been inves-
tigated [79] in mammalian promoter regions, using MLP with different window
sizes of input sequence. MLPs were also employed to predict the translation
initiation sites [80], with better results being generated for bigger windows on
the input sequence. Again, some of the limitations of MLPs, like convergence
time and local minima, need to be appropriately handled in all these cases.
Protein classification into 137 to 178 superfamilies with a modular architecture
involving multiple independent MLPs [81] included 400 to 1356 input features
like counts of amino acid pairs, counts of exchange group pairs and triplets,
and other encoded combinations using singular value decomposition. Multiple
network modules run in parallel to scale up the system. This sort of divide-
and-conquer strategy facilitates convergence.
Rule generation
Identification of important binding sites, in a peptide involved in pain and de-
pression, has been attempted [82] using feedforward ANNs. Rules in M -of-N

© 2008 by Taylor & Francis Group, LLC


178 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
form are extracted by detecting positions in the DNA sequence where changes
in the stereochemistry give rise to significant differences in the biological ac-
tivity. Browne et al. also predict splice site junctions in human DNA sequences
that has a crucial impact on the performance of gene finding programs. Donor
sites are nearly always located immediately preceding a GT sequence, while
acceptor sites immediately follow an AG sequence. Hence GT and AG pairs
within a DNA sequence are markers for potential splice junction sites, and the
objective is to identify which of these sites correspond to real sites followed
by prediction of likely genes and gene products. The resulting rules are shown
to be reasonably accurate and roughly comparable to those obtained by an
equivalent C5 decision tree∗ , while being simpler at the same time.
Rules were also generated from a pruned MLP [83], using a penalty function
for weight elimination, to distinguish donor and acceptor sites in the splice
junctions from the remaining part of the input sequence. The pruned network
consisted of only 16 connection weights. A smaller network leads to better
generalization capability as well as easier extraction of simpler rules. Ten rules
were finally obtained in terms of AG and GT pairs.
SOM
Kohonen’s SOM has been used for the analysis of protein sequences [84],
involving identification of protein families, aligned sequences and segments of
similar secondary structure, with interactive visualization. Other applications
of SOM include prediction of cleavage sites in proteins [85], prediction of beta-
turns [86], classification of structural motifs [87] and feature extraction [88].
Clustering of human protein sequences into families were investigated [89] with
a 15 × 15 SOM, and the performance was shown to be better than that using
statistical nonhierarchical clustering. The study demonstrated that hidden
biological information contained in sequence protein databases can be well
organized using SOMs.
The Self-Organizing Tree Algorithm (SOTA) is a dynamic binary tree that
combines the characteristics of SOMs and divisive hierarchical clustering.
SOTA has been employed for clustering protein sequences [90] and amino
acids [91]. However, if the available training data are too small to be ade-
quately representative of the actual dataset then the performance of the SOM
is likely to get affected.
An unsupervised growing self-organizing ANN [92] has been developed for the
phylogenetic analysis of a large number of sequences. The network expands it-
self following the taxonomic relationships existing among the sequences being
classified. The binary tree topology of this model enables efficient classifi-
cation of the sequences. The growing characteristic of this procedure allows
termination at the desired taxonomic level, thereby overcoming the necessity
of waiting for the generation of a complete phylogenetic tree. The time for
∗ http://www.spss.com/spssbi/clementine

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 179
convergence is approximately a linear function of the number of sequences
being modeled.
RBF
A novel extension to the RBF is designed by using the concept of biological
similarity between amino acid sequences [93]. Since most amino acid sequences
have preserved local motifs for specific biological functions, the numerical
radial basis functions are replaced here by certain such nonnumerical (bio-)
basis functions. The neural network leads to reduced computational cost along
with improved prediction accuracy. Applications are provided on prediction
of cleavage sites as well as the characterization of site activity in the Human
Immunodeficiency Virus (HIV) protease. The knowledge of these sites can be
used to search for inhibitors (antiviral drugs) that block the cleavage ability
of the enzyme. The prediction accuracy is reported to be 93.4%.
ART
Multiple layers of adaptive resonance theory 2 (ART2) network have been
used to categorize DNA fragments [94] at different resolution levels, similar
to a phylogenetic (evolutionary) analysis. The ART network trains fast, and
incrementally adapts to new data without needing to review old instances.
However, the ability to generalize is limited by the lack of a hidden layer.
Integration with other techniques
Benefits often accrue from using a combination of different learning strate-
gies. A modified counter-propagation network, with supervised learning vec-
tor quantization (LVQ) performing nearest-neighbor classification, was used
for molecular sequence classification [95].
Dynamic programming has been combined with MLP in GeneParser [96] to
predict gene structure. Sequence information is weighted by the MLP to ap-
proximate the log-likelihood that each subinterval exactly represents an intron
or exon. Dynamic programming is then applied to determine the combination
of introns and exons that maximizes the likelihood function. Input to the
network consists of the differences for each statistic between the correct and
incorrect solutions, and the difference in the number of predicted sequence
types. The output maximizes the difference between correct and incorrect
solutions.
Extreme Learning Machine (ELM), a new machine learning paradigm with
sigmoidal activation function and Gaussian RBF kernel for single hidden layer
feedforward neural network, has been used to classify protein sequences from
ten classes of superfamilies [97]. The classification accuracy is reported to be
better, along with a shorter training time, as compared to that of an MLP
of similar size using backpropagation. Since the ELM does not involve any
control parameters like learning rate, learning epochs, stopping criteria, that
require to be tuned as in MLP, this promises an added advantage.

© 2008 by Taylor & Francis Group, LLC


180 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
EC

Investigations with GAs and GP have been made on primary genomic se-
quences for functions involving their alignment, reconstruction and detection.
These are described below.
GA
The simultaneous alignment of many amino acid sequences is one of the ma-
jor research areas of Bioinformatics. Given a set of homologous sequences,
multiple alignments can help predict secondary or tertiary structures of new
sequences. GAs have been used for this purpose [98]. Fitness is measured by
globally scoring each alignment according to a chosen objective function, with
better alignments generating a higher fitness. The cost of multiple alignment
Ac is expressed as
N
X −1 X
N
Ac = Wi,j cost(Ai , Aj ), (6.30)
i=1 j=1
where N is the number of sequences, Ai is the aligned sequence i, cost(Ai , Aj )
is the alignment score between two aligned sequences Ai and Aj , and Wi,j is
the weight associated with that pair of sequences. The cost function includes
the sum of the substitution costs, as given by a substitution matrix, and
the cost of insertions/deletions using a model with affine gap (gap-opening
and gap-extension) penalties. Roulette wheel selection is carried out among
the population of possible alignments, and insertion/deletion events in the
sequences are modeled using a gap insertion mutation operator.
Given N aligned sequences A1 . . . AN in a multiple alignment, with Ai,j being
the pairwise projection of sequences Ai and Aj , length(Ai,j ) the number of
ungapped columns in this alignment, score(Ai,j ) the overall consistency be-

tween Ai,j and the corresponding pairwise alignment in the library, and Wi,j
the weight associated with this pairwise alignment, the fitness function was
modified [99] to
PN −1 PN ′
i=1 j=1 Wi,j ∗ score(Ai,j )
F = PN −1 PN . (6.31)

i=1 j=1 Wi,j ∗ length(Ai,j )

The main difference with eqn. (6.30) is the use of a library that replaces the
substitution matrix and provides position-dependent means of evaluation.
The generation of accurate DNA sequence is a challenging and time-consuming
problem in genomics. A widely used technique in this direction is hybridiza-
tion, which detects all oligonucleotides—short sequences of the four nucleotide
bases, A, C, T , G, of a given length k—that make up the corresponding DNA
fragment. (This terminology is different from the hybridization of soft com-
puting paradigms, which we elucidate in this chapter.) The oligonucleotide
library is very large, containing 4k elements, with microarray chip technology
being often used in its implementation. However, the hybridization experiment

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 181
introduces both negative (missing oligonucleotides) and positive (erroneous
oligonucleotide) errors in the spectrum of elements. The reconstruction of the
DNA sequence, from these errors, is an NP-hard combinatorial problem. GAs
have been successfully applied to difficult instances of sequence reconstruction
[72], with a fitness function maximizing the number of elements chosen from
the spectrum (subject to a restriction on the maximum length n) of the se-
quence of nucleotides. The representation of a candidate solution is in terms
of a permutation of indices of oligonucleotides from the spectrum.

Phylogenetic inference has been attempted using GA [100] and parallel GA


[101]. An individual in a population is a hypothesis consisting of the tree,
branch lengths and parameters values for the model of sequence evolution,
while the fitness is the likelihood score of the hypothesis. In the parallel version
[101] each individual in a population is handled by one processor or node which
computes its corresponding likelihood. This operation being extremely time
consuming, the parallelization at this level causes a nearly linear order search
time improvement for large data. The number of processors used is equal
to the size of the evolving population, plus an additional processor for the
control of operations. Selection is accomplished on the maximum-likelihood
score, migration and recombination is permitted between subpopulations, and
mutation can be branch-length based or topological. Results are provided on
228 taxa of DNA sequence data.

GP

Finite State Automata (FSA) has been combined with GP, to discover can-
didate promoter sequences in primary sequence data [102]. FSAs are directed
graphs that can represent grammars in the Chomsky hierarchy and Turing
machines. In the GP-Automata, a GP tree structure is associated with each
state of the FSA. The method is able to take large base pair jumps, thereby
being able to handle very long genomic sequences in order to discover gene
specific cis-acting sites as well as genes which are regulated together. It is to be
noted that an aim of drug discovery is to identify cis-acting sites responsible
for co-regulating different genes.

The training dataset† consists of known promoter regions, while nonpromoter


examples constitute samples from the coding or intron sequences. The objec-
tive of the GP-tree structure, in each state of the GP-Automata, is to find
motifs within the promoter and nonpromoter regions. The terminal set in-
cludes A, C, T and G. The method automatically discovers motifs of various
lengths in automata states, and combines motif matches using logical func-
tions to arrive at a cis-acting region identification decision.

† http://www.fruitfly.org/

© 2008 by Taylor & Francis Group, LLC


182 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
Hybridization

Extraction of motif from a group of related protein sequences has been in-
vestigated in a neuro-fuzzy framework [103], using data from PROSITE. A
statistical method is first used to detect short patterns occurring with high fre-
quency. Fuzzy logic enables the design of approximate membership functions
and rules about protein motifs, as obtained from domain experts. A radial ba-
sis function (RBF) neural network is employed to optimize the classification
by tuning the membership functions.
Evolving ANNs for discriminating between functional elements associated
with coding nucleotides (exons) and noncoding sequences of DNA (introns
and intragenic spacer) has been reported [72] in the genetic–neural frame-
work. The connection weights of a fixed MLP architecture are evolved for
classification, using evolutionary computation, with practical application to
gene detection. Performance of the evolved network is compared to that of
GRAIL [77] and GeneParser [96].

6.7.2 Protein structure

Protein structure prediction typically uses experimental information stored in


protein structural databases, like the Brookhaven National Laboratory Pro-
tein Data Bank (PDB) [104]. A common approach is based on sequence align-
ment with structurally known proteins. The experimental approach involving
X-ray crystallographic analysis and nuclear magnetic resonance (NMR) being
expensive and time-consuming, soft computing techniques offer an innovative
way to overcome some of these problems.

FS

A contact map is a concise representation of a protein’s native 3D structure. It


is expressed as a binary matrix, where each entry is a ‘1’ if the corresponding
protein residue pair are in “contact” (with Euclidean distance being within a
threshold). When represented graphically, each contact between two residues
corresponds to an edge. An alignment between two contact maps is an assign-
ment of residues in one to those of the equivalent other. A pair of contacts
is equivalent when the pairs of residues that define their end-points are also
equivalent. The number of such equivalent contacts determine the overlap of
the contact maps for a pair of proteins, with a higher overlap indicating in-
creased similarity between them. A generalization of the maximum contact
map overlap has been developed [105] using one or more fuzzy thresholds and
membership functions. This enables a more biological formulation of the op-
timization problem. Investigations are reported on three datasets from the
PDB. Clustering of protein structures is done to validate the results.

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 183
ANN

A step on the way to a prediction of the full 3D structure of protein is pre-


dicting the local conformation of the polypeptide chain, called the secondary
structure. The whole framework was pioneered by Chou and Fasmann [106].
They used a statistical method, with the likelihood of each amino acid being
one of the three (alpha, beta, coil) secondary structures estimated from known
proteins.
In this section we highlight the enhancement in prediction performance of
ANNs, with the use of ensembles and the incorporation of alignment profiles.
The data consist of proteins obtained from the PDB. A fixed size window
constitutes the input to the feedforward ANN. The network predicts the sec-
ondary structure corresponding to the centrally located amino acid of the se-
quence within the window. The contextual information about the rest of the
sequence, in the window, is also considered during network training. A com-
parative study of performance of different approaches, for secondary structure
prediction on this data, is provided in Table 6.1.
MLP
Around 1988 the first attempts were made by Qian and Sejnowski [107], to
use MLP with backpropagation to predict protein secondary structure. Three
output nodes correspond to the three secondary structures. Performance is
measured in terms of overall correct classification Q (64.3%) and Matthews
Correlation Coefficient (MCC). We have
l
X C
Q= wi Qi = (6.32)
i=1
N

for an l-class problem, with Qi indicating the accuracy for the ith class, wi
being the corresponding normalizing factor, N representing the total number
of samples and C being the total number of correct classifications.
(T P ∗ T N ) − (F P ∗ F N )
M CC = p , (6.33)
(T P + F P )(T P + F N )(T N + F P )(T N + F N )
where T P , T N , F P and F N correspond to the number of true positive, true
negative, false positive and false negative classifications, respectively. Here
N = T P + T N + F P + F N and C = T P + T N , and −1 ≤ M CC ≤ +1 with
+1 (-1) corresponding to a perfect (wrong) prediction. The values for M CC
for the α-helix, β-strand and random coil were found to be 0.41, 0.31, 0.41,
respectively.
The performance of this method was improved by Rost and Sander [108, 109],
by using a cascaded three-level network with multiple-sequence alignment. The
three levels correspond to a sequence-to-structure net, a structure-to-structure
net and a jury (combined output) decision, respectively. Correct classification

© 2008 by Taylor & Francis Group, LLC


184 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
increased to 70.8%, with the M CC being 0.60, 0.52, 0.51, respectively, for the
three secondary classes.
Supersecondary structures (folding units), like αα- and ββ-hairpins, and αβ-
and βα-arches, serve as important building blocks for protein tertiary struc-
ture. Prediction of supersecondary structures was made from protein sequences
[110] using MLP. The size of the input vector was the same as the length of
the sequence window. There were 11 networks, each with one output, for clas-
sifying one of the 11 types of frequently occurring motifs. A test sequence
was assigned to the motif category of the winning network, having the largest
output value. Results demonstrated more than 70% accuracy.
Protein structure comparison is often used to identify set of residue equivalen-
cies between proteins based on their 3D coordinates, and has a wide impact
on the understanding of protein sequence, structure, function and evolution.
This is because it can identify more distantly related proteins, as compared to
sequence comparison, since protein structures are more conserved than amino
acid sequences over evolution.
The determination of an optimal 3D conformation of a protein corresponds to
folding, and has manifold implications to drug design. An active site structure
determines the functionality of a protein. A ligand (enzyme or drug) docks
into an active site of a protein. Many automated docking approaches have
been developed, and can be categorized as (i) rigid docking: both ligand and
protein are rigid, (ii) flexible-ligand docking: ligand flexible and protein rigid
and (iii) flexible-protein docking: both ligand and protein are flexible (only
a limited model of protein variation allowed, such as side-chain flexibility or
small motions of loops in the binding site).
One of the earliest ANN-based protein tertiary structure prediction in the
backbone [111] used MLP, with binary encoding for a 61-amino acid window
at the input. There were 33 output nodes corresponding to the three secondary
structures, along with distance constraints between the central amino acid and
its 30 preceding residues. A large scale ANN was employed to learn protein
tertiary structures from the PDB [112]. The sequence-structure mapping en-
coded the entire protein sequence (66-129 residues) into 140 input units. The
amino acid residue was represented by its hydrophobicity scale, normalized
between -1 and +1. The network produced good prediction of distance ma-
trices from homologous sequences, but suffered from a limited generalization
capability due to the relatively small size of the training set.
Interatomic C α distances between amino acid pairs, at a given sequence sep-
aration, were predicted [113] to be above (or below) a given threshold cor-
responding to contact (or noncontact). The input consisted of two sequence
windows, each with 9 or 15 amino acids separated by different lengths of se-
quence, and a single output indicated the contact (or noncontact) between
the central amino acids of the two sequence windows.
Instead of using protein sequence at input, a protein structure represented by

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 185
a side-chain-side-chain contact map was employed at the input of an ANN to
evaluate side-chain packing [114]. Contact maps of globular protein structures
in the PDB were scanned using 7 × 7 windows, and converted to 49 binary
numbers for the input. One output unit was used to determine whether the
contact pattern is prevalent in the structure database.
Information obtained from secondary structure prediction is incorporated to
improve structural class prediction using MLP [115]. The 26 input nodes
include the 20-amino acid composition, sequence length and five secondary
structure characteristics of the protein. Four outputs correspond to four ter-
tiary super classes. Prediction of 83 folding classes in proteins has been at-
tempted [116] using multiple two-class MLPs. The input was represented in
terms of major physicochemical amino acid attributes, like relative hydropho-
bicity (hydrophobic, neutral or polar), predicted secondary structure, pre-
dicted solvent accessibility (buried or exposed), along with certain global de-
scriptors like composition, transition and distribution of different amino acid
properties along the protein sequence.
A single layer feedforward ANN, trained with scaled conjugate gradient algo-
rithm, is used to identify catalytic residues found in enzymes [117] based on an
analysis of the structure and sequence. Structural parameters like the solvent
accessibility, type of secondary structure, depth and cleft that the residue lies
in, along with the conservation score and residue type, are used as inputs for
the ANN. Performance is measured in terms of the M CC. The network out-
put is spatially clustered to determine the highly scoring residues, and thereby
predict the location of most likely active sites.
RBF
Radial basis function (RBF) network, a supervised feedforward ANN, has been
employed [118] to optimally predict the free energy contributions of proteins
due to hydrogen bonds, hydrophobic interactions and the unfolded state, with
simple input measures.
Ensemble networks
Prediction of protein secondary structure has been further developed by Riis
and Krogh [119], with ensembles of combining networks, for greater accuracy
in prediction. The Softmax method is used to provide simultaneous classifica-
tion of an input pattern into multiple classes. A normalizing function at the
output layer ensures that the three outputs always sum to one. A logarith-
mic likelihood cost function is minimized, instead of the usual squared error.
An adaptive weight encoding of the input amino acid residues reduces the
overfitting problem. A window is selected from all the single structure net-
works in the ensemble. The output is determined for the central residue, with
the prediction being chosen as the largest of the three outputs normalized by
Softmax.
The use of ensembles of small, customized subnetworks is found to improve

© 2008 by Taylor & Francis Group, LLC


186 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS

c
ensembles ensembles ensembles

Figure 6.6 Secondary protein structure prediction using ensemble of ANNs.

predictive accuracy. Customization involves incorporation of domain knowl-


edge into the subnetwork structure for improved performance and faster con-
vergence. For example, the helix-network has a built-in period of three residues
in its connections in order to capture the characteristic periodic structure of
helices. Fig. 6.6 provides the schematic network structure. Overall accuracy
increased to 71.3%, with the M CC becoming 0.59, 0.50, 0.41, respectively, for
the three secondary classes.
Use of alignment profile
The alignment profile generated by Psi-BLAST has been incorporated by
Jones [120] to design a set of cascaded ANNs. These profiles enable finding
more distant sequences, use a more rigorous statistical approach for computing
the probability of each residue at a specific position and properly weigh each
sequence with respect to the amount of information it carries.
Prediction of segments in protein sequences containing aromatic-backbone NH
interactions has been attempted [121]. (An NH interaction is a nonconven-
tional hydrogen bonding interaction involving side-chain aromatic ring and
backbone NH group.) Such interactions help in the stabilization of protein
secondary and tertiary structures as well as folding, on the basis of their
spatial distribution. Incorporation of evolutionary information in the form
of multiple alignment, by Psi-BLAST, enhances the performance in terms of
M CC. Two consecutive three-layered feedforward sequence-to-structure and
structure-to-structure networks, trained by backpropagation, are employed. It
is observed that a segment (window) of seven residues provides sufficient in-
put information for prediction of these aromatic-NH interactions. The actual

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 187
position of donor aromatic residue within the potential predicted fragment
is also identified, using a separate sequence-to-structure neural network. The
implementation was made on a nonredundant dataset of 2298 protein chains
extracted from the Protein Data Bank (PDB).

Ensembles of bidirectional recurrent neural network architectures are used


in conjunction with profiles generated by Psi-BLAST to predict protein sec-
ondary structure for a given amino acid sequence [122]. The classification
decision is determined by three component networks. In addition to the stan-
dard central component associated with a local window at location t of the
current prediction (as in feedforward ANNs), there exist contribution by two
similar recurrent networks corresponding to the left and right contexts (like
wheels rolling from the two ends of the polypeptide sequence). An ensemble
of 11 networks are trained, using backpropagation. Two output categoriza-
tions are followed, viz., (i) three classes (α helix, β-strand, random coil), as
in SSpro, and (ii) eight classes as in DSSP‡ programs. The output error is
the relative entropy between the output and target probability distributions.
At the alignment level the use of Psi-BLAST, with the ability to produce
profiles that include increasingly remote homologs, enhances performance as
compared to that employing only BLAST [123]. The system was implemented
on proteins from the PDB, which are at least 30 amino acids long, have no
chain breaks, produce a DSSP output and are obtained by X-ray diffraction
methods with high resolution. The accuracy of secondary structure prediction
is thereby enhanced to about 75%.

Table 6.1 Comparative performance for protein secondary structure prediction.

Approach Reported Reported MCC


overall
per-residue
accuracy (%)
MLP [107] 64.3 0.41, 0.31, 0.41
MLP + multiple sequence 70.8 0.60, 0.52, 0.51
alignment [109]
MLP ensemble + Softmax [119] 71.3 0.59, 0.50, 0.41
Recurrent network ensemble about 75 –
+ Psi-BLAST [122]

‡ http://www.cmbi.kun.nl/gv/dssp/

© 2008 by Taylor & Francis Group, LLC


188 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
EC

GAs have been mainly applied to tertiary protein structure prediction, fold-
ing, docking and side-chain packing problems. Structure alignment has been
attempted in proteins using GAs [124], by first aligning equivalent secondary
structure element (SSE) vectors while optimizing an elastic similarity score S.
This is expressed as
  
 PL PL dA
ij −dij
B 2
i=1 j=1 θ − e−(d̄ij /a) , i 6= j,
S= d̄ij (6.34)
θ, i = j,

where dA B
ij and dij are the distances between equivalent positions i and j in
proteins A and B respectively, d¯ij is the average of dA B
ij and dij , and θ and a are
constant parameters, with the logic implying that equivalent positions in two
proteins should have similar distances to other equivalent positions. Secondly,
amino acid positions are optimally aligned within the SSEs. This is followed
by superposition of protein backbones, based on the position equivalencies
already determined. Finally, additional equivalent positions are searched in
the non-SSE regions.
Tertiary protein structure prediction and folding, using GAs, has been re-
ported in Ref. [125, 72, 126, 127]. The objective is to generate a set of native-
like conformations of a protein based on a force field, while minimizing a fit-
ness function depending on its potential energy. Proteins can be represented
in terms of (a) three-dimensional Cartesian coordinates of its atoms and (b)
the torsional angle Rotamers, which are encoded as bit strings for the GA.
The Cartesian coordinates representation has the advantage of being easily
convertible to and from the 3D conformation of a protein. Bond lengths, b,
are specified in these terms. In the torsional angles representation, the protein
is described by a set of angles under the assumption of constant standard
binding geometries. The different angles involved are the (i) bond angle θ, (ii)
torsional angle φ, between N (amine group) and Cα , (iii) angle ψ, between
Cα and C ′ (carboxyl group), (iv) peptide bond angle ω, between C ′ and N
and (v) side-chain dihedral angle χ.
The potential energy U (r1 , . P . . , rN ) between NPatoms is minimized, P being
expressed as U (r1 , . . . , rN ) = i Kb (bi − bi0 )2 + i Kθ (θi − θ0i )2 + i Kφ [1 −
 12  6
P q q P σij σij
cos(nφi −δ)]+ i,j 4πε0iεrj rij + i,j ε rij − 2 rij . Here the first three
harmonic terms on the right-hand side involve the bond length, bond angle
and torsional angle of covalent connectivity, with bi0 and θ0i indicating the
down-state (low energy) bond length and bond angle respectively, for the ith
atom. The effects of hydrogen bonding and that of solvents (for nonbonded
atom pairs i, j, separated by at least four atoms) are taken care of by the
electrostatic Coulomb interaction and Van der Waals’ interaction, modeled
by the last two terms of the expression. Here Kb , Kθ , Kφ , σij and δ are

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 189
constants, qi and qj are the charges of atoms i and j, separated by distance rij ,
and ε indicates the dielectric constant. Two commercially available software
packages, containing variations of the potential energy function, are Chemistry
at HARvard Molecular Mechanics (CHARMm) and Assisted Model Building
with Energy Refinement (AMBER).
Additionally, a protein acquires a folded conformation favorable to the solvent
present. The calculation of the entropy difference between a folded and un-
folded state is based on the interactions between a protein and solvent pair.
Since it is not yet possible to routinely calculate an accurate model of these
interactions, an ad hoc pseudo-entropic term Epe is added to drive the protein
to a globular state. Epe is a function of its actual diameter, which is defined to
be the largest distance between a pair of Cα carbon atoms in a conformation.
We have
Epe = 4(actual diameter−expected diameter) kcal/mol, (6.35)
p
where expected diameter/m = 8 ∗ len/m is the diameter in its native con-
3

formation and len indicates the number of residues. This penalty term ensures
that extended conformations have larger energy (or lower fitness) values than
globular conformations. It constitutes the conformational entropy constituent
of potential energy, in addition to the factors involved in the expression for
U.
Genetic Optimization for Ligand Docking (GOLD) [128] is an automated
flexible-ligand docking program, employing steady-state GA involving the is-
land model (which evolves several small, distinct populations, instead of one
large population). It evaluates nonmatching bonds while minimizing the po-
tential energy (fitness function), defined in terms of Van der Waals’ internal
and external (or ligand-site) energy, torsional (or dihedral) energy and hy-
drogen bonds. However, (i) an enforced requirement that the ligand must be
hydrogen-bonded to the binding site and (ii) an underestimation of the hy-
drophobic contribution to binding sometimes lead to failures in docking in
certain cases over here.
Each chromosome in GOLD encodes the internal coordinates of both the lig-
and and active protein site, and a mapping between the hydrogen-bonding
sites. Reproduction operators include crossover, mutation and a migration
operator to share genetic material between populations. The output is the
ligand and protein conformations associated with the fittest chromosome in
the population, when the GA terminates. The files handled are the Cam-
bridge Crystallographic Database, Brookhaven PDB and the Rotamer library
(providing the relationship between side-chain dihedral angles and backbone
conformation).
AutoDock [129] works on a genome composed of a string of real-valued genes
encoding the 3D coordinates and different angles. Mutation of the real-valued
parameters is accomplished through the addition of a Cauchy-distributed ran-
dom variable. Both conventional as well as Lamarckian GAs are used, along

© 2008 by Taylor & Francis Group, LLC


190 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
with elitism. (Lamarckian GAs employ a local search, with replacement on
a small fraction of the population within each generation. In the Baldwinian
approach, unlike in Lamarckian, the original population is not updated by the
solution found in the local search.)
A Generic Evolutionary Method for Molecular Docking (GEMDOCK) [130]
has been developed for flexible-ligand docking. The potential energy func-
tion, involving numerous atomic interactions, is often computationally too ex-
pensive to implement using evolutionary strategies. Hence rapid recognition
of potential ligands is emphasized using a robust, simpler scoring function,
encountering fewer local minima. Discrete and continuous search techniques
are combined with local search to speed up convergence. The energy func-
tion encompasses electrostatic, steric and hydrogen bonding potentials of the
molecules. A new rotamer-based mutation operator helps reduce the search
space of ligand structure conformations. GEMDOCK is an automatic system
that generates all related docking variables, like atom formal charge, atom
type and the ligand binding site of a protein. A major problem in GOLD,
viz., its sensitiveness to docking hydrophobic ligands, is reduced in GEM-
DOCK [130]. However, its empirical scoring function is yet to incorporate
important functional group interactions between ligands and proteins as in
GOLD.
In a slightly different approach, the prediction of the conserved or displaced
status of water molecules in the binding site, upon ligand binding, was made
[131] by using a k-nearest-neighbors classifier. GAs determine the optimal
feature-weight values for the classifier. Fitness is based on the percentage of
correct predictions made.
The side-chain packing problem deals with the prediction of side-chain confor-
mations. This is a crucial aspect of protein folding, since it determines feasible
backbone conformations. GAs have been used in prediction of side-chain pack-
ing [132] to search for low-energy hydrophobic core sequences and structures,
using a custom Rotamer library as input. Each core position is allocated a
set of bits in the chromosome, to encode a specific residue type and a set of
torsional angles as specified in the library.
Evolutionary programming has been employed for faster finding of deep min-
ima in the energy landscape of protein folding [133]. One folding step of the
protein molecule involves (i) calculation of molecular motion of the structure,
i.e., rotation around one bond, and (ii) computation of free energy of the new
conformation, which is discarded if it increases after the molecular motion.
This process is simultaneously repeated to simulate a large set of folding op-
erations, each using a different expanded starting structure for the protein.
The program then determines those simulations yielding structures with the
lowest free energies. It uses a lattice model of proteins to speed up the simu-
lation, allowing only bond angle changes (0o , ±45o , ±90o ) between adjacent
amino acid residues along one or two of the three planes.

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 191
Mutations of the program were created by using different types or magnitudes
of molecular motions, or different positions of bonds around which rotations
are performed, or different sequences of these motions. Positive mutants, i.e.,
those which performed better than the original program, were used for further
mutations. Negative program mutants, i.e., those which did not find a deeper
energy minimum within a certain period of time, were discarded. It is observed
that only 20 evolution steps yielded a more than 10-fold increase in speed of
finding deep minima in the energy landscape of two 64-residue proteins.

Hybridization

Hybrid approaches to applications related to protein secondary structure also


exist in literature. A knowledge-based approach was employed to extract infer-
ence rules about a biological problem that were then used to configure ANNs
[134]. Integration with GAs was attempted to generate an optimal ANN topol-
ogy [135], and its performance on secondary structure prediction was found
to be comparable to that of Qian and Sejnowski [107].

6.7.3 Microarray

Each DNA array contains the measures of the level of expression of many
genes. Various distances and/or correlations can be computed from pairwise
comparison of these patterns. Let genej (ej1 , . . . , ejn ) denote the expression
pattern for the jth gene for i = 1, . . . , n samples. The Euclidean distance
between the jth and kth genes, computed as
sX
dj,k = (eji − eki )2 , (6.36)
i

is suitable when the objective is to cluster genes displaying similar levels of


expression. There exists considerable literature on the applications of different
soft computing paradigms in the area of gene expression data.

FS

Fuzzy c-means [138] is a well-known fuzzy partitive algorithm employed for


clustering overlapping data. Use of fuzzy clustering enables genes to simul-
taneously belong to multiple groups, thereby revealing distinctive features of
their function and regulation. Fuzzy c-means algorithm has been applied to
cluster microarray data [139]. The value of the fuzzifier m is appropriately
tuned for gene selection, based on resultant distribution of distances between
genes. The selected genes exhibit tight association to the clusters.
Many proteins serve different functions depending on the demands of the
organism, such that a corresponding set of genes is often coexpressed with

© 2008 by Taylor & Francis Group, LLC


192 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
multiple, distinct groups of genes under different conditions. This type of
conditional coregulation of genes is modeled using a heuristically modified
version of fuzzy c-means clustering [140], to identify overlapping partitions of
genes based on the response of yeast cells to environmental changes.
The temporal order and varying length of sampling intervals are some of the
important factors for clustering time-series microarray data into biologically
meaningful partitions. However, the shortness and unequal sampling of gene
expression time-series data limits the use of conventional modeling in these
cases. The fuzzy short time-series algorithm [141] clusters profiles based on the
similarity of their relative change in expression level and the corresponding
temporal information. Here the short time-series distance measure is incor-
porated in the fuzzy c-means framework. The performance, on the transcrip-
tional data of sporulation in budding yeast, is evaluated in terms of Dunn’s
clustering validity index [136].
An interesting image processing application was developed at the preprocess-
ing stage, for the fuzzy filtering of noise from cDNA microarray color images in
the two-channel Red-Green space [142]. This sort of reduction in noise impair-
ment facilitated subsequent analysis of the cDNA images. The two-component
adaptive vector filter integrates concepts from fuzzy sets, nonlinear filtering,
multidimensional scaling and robust order statistics. Robust noise removal is
achieved by tuning a membership function, which utilizes distance criteria
based on a novel color-ratio model, on cDNA vectorial inputs at each image
location.

ANN

The two major mining tasks, modeled here, are clustering and classification.
While unsupervised learning is self-organized, supervised learning helps in-
corporate known biological functions of genes into the knowledge discovery
process of gene expression pattern analysis for gene discovery and prediction.
Kohonen’s SOM has been applied to the clustering of gene expression data
[143, 144, 145]. It generates a robust and accurate clustering of large and noisy
data, while providing effective visualization. SOMs require the winning neuron
or node in the gene expression space (along with its neighbors) to be rotated
in the direction of a selected gene expression profile (pattern). However, the
predefinition of a two-dimensional topology of nodes can often be a problem
considering its biological relevance.
SOTA has also been applied to gene expression clustering [146]. As in SOMs
the gene expression profiles are sequentially and iteratively presented at the
terminal nodes, and the mapping of the node that is closest (along with its
neighboring nodes) is appropriately updated. Upon convergence the node con-
taining the most variable (measured in terms of distance) population of ex-
pression profiles is split into sister nodes, causing a growth of a binary tree

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 193
structure. Unlike conventional hierarchical clustering, SOTA is linear in com-
plexity to the number of profiles. The number of clusters need not be known in
advance as in c-means clustering. The algorithm starts from the node having
the most heterogeneous population of associated input gene profiles. A sta-
tistical procedure is followed for terminating the growing of the tree, thereby
eliminating the need for an arbitrary choice of cutting level as in hierarchical
models. However, no validation is provided to establish the biological rele-
vance.
A binary tree-structured vector quantization [147] uses (i) self-organizing map
(SOM) for visualization, and (ii) partitive c-means clustering for grouping the
similar component planes of SOMs and organizing them. Results are provided
on cDNA microarray lung cancer data.
Classification of acute leukemia, having highly similar appearance in gene ex-
pression data, has been made by combining a pair of classifiers trained with
mutually exclusive features [148]. Gene expression profiles were constructed
from 72 patients having acute lymphoblastic leukemia (ALL) or acute myeloid
leukemia (AML), each constituting one sample of the DNA microarray§. Each
pattern consists of 7129 gene expressions. A neural network combines the out-
puts of the multiple classifiers. Feature selection with nonoverlapping correla-
tion (such as Pearson and Spearman correlation coefficients) encourages the
classifier ensemble to learn different aspects of the training data in a wide solu-
tion space. The recognition accuracy and generalization capacity are reported
to be higher than those involving SOM, decision tree, k-nearest neighbors
classifier and support vector machine.
An autoassociative neural network has been used for simultaneous pattern
identification, feature extraction and classification of gene expression data
[149]. The network output approximates a reconstructed version of the in-
put vector. Backpropagation is used to adjust the connection weights. The
analysis of the network structure and strength of connections allows the (i)
identification of specific phenotype markers, (ii) extraction of peculiar associ-
ations among genes and physiological states and (iii) assignment to multiple
classes, like different pathological conditions or tissue samples. Results are
demonstrated on Leukemia and Colon cancer¶ datasets.
Bayesian regularized neural network has been employed [150] to classify mul-
tiple gene expression temporal patterns, with sequential time points under
different experimental conditions. The Bayesian setting, along with the reg-
ularization, helps overcome experimental as well as biological noise or uncer-
tainty. A feedforward architecture is used, with the input neurons correspond-
ing to the number of time points or experimental conditions in the microarray
experiment. Results are provided on the yeast data.

§ http://www.genome.wi.mit.edu/MPR
¶ http://microarray.princeton.edu/oncology

© 2008 by Taylor & Francis Group, LLC


194 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
EC

The identification of gene subsets for classifying two-class disease samples has
been modeled as a multi-objective evolutionary optimization problem [151],
involving minimization of gene subset size to achieve reliable and accurate clas-
sification based on their expression levels. NSGA-II, a multi-objective GA, is
used for the purpose. This employs elitist selection and an explicit diversity
preserving mechanism, and emphasizes the nondominated solutions. Results
are provided on three cancer samples, viz., Leukemia, Lymphoma and Colon.
An l-bit binary string, where l is the number of selected (filtered) genes in
the disease samples, represents a solution. The major difficulties faced in solv-
ing the optimization problem include the availability of only a few samples
as compared to the number of genes in each sample, and the resultant huge
search space of solutions. Moreover many of the genes are redundant to the
classification decision, and hence need to be eliminated. The three objectives
simultaneously minimized are (i) the gene subset size, (ii) number of misclas-
sifications in training and (iii) number of misclassifications in test samples.
The grouping GA (GGA) [152] is a modified GA, developed to suit the partic-
ular structure of grouping problems like clustering. GGA has also been applied
to the clustering of microarray data [72]. The clusters of expression profiles
are directly encoded in the chromosomes, based on their ordinal numbers, and
the fitness function is defined on this set of groupings. The composition of the
groups controls the value of the objective function.
GAs have also been used to correctly classify the SRBCT dataset with a se-
lection of 12 genes [153]. There are four classes of tumors, from 88 samples
described by 2308 genes. Simulated annealing (SA) [154] is employed to gener-
ate a robust clustering of temporal gene expression profiles [155]. An iterative
scheme quantitatively evaluates the optimal number of clusters, while simul-
taneously optimizing the distribution of genes within them. The ith profile is
represented by a vector {ei1 , . . . , ein }, with expression component eit corre-
sponding to the normalized expression level of gene i at time t in the range
[0, 1]. The distribution of profiles is optimized for c clusters by minimizing the
within-cluster distance between them, using
 
c
1 XX X
E(c) = di,j  , (6.37)
c
k=1 i∈Uk j∈Uk

where di,j is the Euclidean distance [eqn. (6.36)] between profiles belonging
to cluster Uk .
Biclustering or simultaneous clustering of both genes and conditions have gen-
erated considerable interest over the past few decades, particularly related to
the analysis of high-dimensional gene expression data in information retrieval,
knowledge discovery and data mining. The objective is to find sub-matrices,
i.e., maximal subgroups of genes and subgroups of conditions where the genes

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 195
exhibit highly correlated activities over a range of conditions, thereby bet-
ter reflecting the biological reality. GAs are employed [156], by integrating a
greedy algorithm as a local search in order to improve the quality of biclus-
tering.
Optimization being done with respect to the mutually conflicting goals of
homogeneity and size, they become suitable candidates for multi-objective
modeling. A novel multi-objective evolutionary biclustering framework is de-
veloped in Ref. [157] by incorporating local search strategies. A new quanti-
tative measure to evaluate the goodness of the biclusters has been presented.
The experimental results on benchmark datasets demonstrate better perfor-
mance as compared to existing algorithms available in literature. Evolutionary
segmentation of the yeast genome has also been attempted in literature [158].

RS

A basic issue related to many practical applications of knowledge databases


is whether the whole set of attributes in a given information system is always
necessary to define a given partition of the universe. Many of the attributes
are superfluous, i.e., we can have ‘optimal’ subsets of attributes which define
the same partition as the whole set of attributes. These subsets are called the
reducts in rough set theory [159], and correspond to the minimal feature set
that are sufficient to represent a decision. Such dimensionality reduction has
considerable impact on subsequent decision-making.
Classification rules (in If–Then form) have been extracted from microarray
data [160], using rough sets with supervised learning. The underlying assump-
tion is that the associated genes are organized in an ontology, involving super-
and sub-classes. This biological knowledge is utilized while generating rules
in terms of the minimal characteristic features (reducts) of temporal gene
expression profiles. A rule is said to cover a gene if the gene satisfies the con-
ditional part, expressed as a conjunction of attribute-value pairs. The rules
do not discriminate between the super-and sub-classes of the ontology, while
retaining as much detail about the predictions without losing precision.

Hybridization

We begin with the neuro-fuzzy models. Fuzzy adaptive resonance theory (ART)
network [161] has been employed for clustering the time series expression data
related to the sporulation of budding yeast [162].
An evolving modular fuzzy neural network, involving dynamic structure grow-
ing (and shrinking), adaptive online learning and knowledge discovery in rule
form, has been applied to the Leukemia and Colon cancer gene expression
data [163]. Feature selection improves classification by reducing irrelevant at-
tributes that do not change their expression between classes. The Pearson

© 2008 by Taylor & Francis Group, LLC


196 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
correlation coefficient is used to select genes that are highly correlated with
the tissue classes. Rule generation provides physicians, on whom the final
responsibility for any decision in the course of treatment rests, with a justi-
fication regarding how a classifier arrived at a judgement. Fuzzy logic rules,
extracted from the trained network, handle the inherent noise in microarray
data while offering the knowledge in a human-understandable linguistic form.
These rules point to genes (or their combinations) that are strongly associated
with specific types of cancer, and may be used for the development of new
tests and treatment discoveries.
A dynamic fuzzy neural network, involving self-generation, parameter opti-
mization and rulebase simplification, is used [164] for the classification of can-
cer data such as Lymphomak , small round blue cell tumor (SRBCT)∗∗ , and
liver cancer†† . Initial feature selection is done in terms of t-tests. It is observed
that a small number of important genes (5 out of 4026, 8 out of 2308, 24 out
of 1648 features, in the three datasets respectively) succeed in attaining 100%
classification.
Gastric tumor classification in microarray data is made using rough set based
learning [165], implemented with ROSETTA involving genetic algorithms and
dynamic reducts [39]. The fitness function incorporates measures involving the
classification performance (discernibility) along with the size of the reduct.
Thereby precedence is provided to solutions having less number of attributes.
A major problem with microarray data being the smaller number of objects
with a comparatively larger number of attributes, a preprocessing stage of
feature selection based on bootstrapping is made. The dataset consists of
2504 human genes corresponding to the conditional attributes, while the 17
tumor types are clubbed as six different clinical parameters or the decision
attributes.
An evolutionary rough c-means clustering algorithm has been applied to mi-
croarray gene expression data [167]. Rough sets are used to model the clusters
in terms of upper and lower approximations. GAs are used to tune the thresh-
old, and relative importance of upper and lower approximation parameters
of the sets. The Davies-Bouldin clustering validity index [136] is used as the
fitness function of the GA, that is minimized while arriving at an optimal
partitioning. The algorithm performs particularly well over the Colon cancer
gene expression data, involving a collection of 62 measurements from colon
biopsy samples with 2000 genes (features).
A multi-objective evolutionary-rough feature selection algorithm [168] has
been used for classifying microarray gene expression patterns. Since the data
typically consist of a large number of redundant features, an initial redundancy
reduction of the attributes is done to enable faster convergence. Thereafter
k http://llmpp.nih.gov/lymphoma/data/figure1/figure1.cdt
∗∗ http://research.nhgri.nih.gov/microarray/Supplement/
†† http://genome-www.stanford.edu/hcc/

© 2008 by Taylor & Francis Group, LLC


APPLICATION TO BIOINFORMATICS 197
rough set theory is employed to generate reducts, which represent the mini-
mal sets of nonredundant features capable of discerning between all objects,
in a multi-objective framework.

For a decision table A with N condition attributes and a single decision at-
tribute d, the problem of finding a d-reduct is equivalent to finding a minimal
subset of columns R(⊆ {1, 2, · · · , N }) in the distinction table [cf. Definition
5, eqn. (6.29)], satisfying
∀(k, j)∃i ∈ R : b((k, j), i) = 1, whenever d(xk ) 6= d(xj ).
So, in effect, we may consider the distinction table to consist of N columns, and
rows corresponding to only those object pairs (xk , xj ) such that d(xk ) 6= d(xj ).
Let us call this shortened distinction table, a d-distinction table. Note that, as
A is taken to be consistent, there is no row with all 0 entries in a d-distinction
table.

Let the number of objects initially in the two classes be m1 and m2 respec-
tively. Then the number of rows in the d-distinction table becomes (m1 ∗m2 ) <
m∗(m−1)
2 , where m1 + m2 = m. Two fitness functions f1 and f2 are considered
for each individual. We have
N − L~ν
f1 (~ν ) = (6.38)
N
and
C~ν
f2 (~ν ) = , (6.39)
(m2 − m)/2
where ~ν is the reduct candidate, L~ν represents the number of 1’s in ~ν , m is
the number of objects and C~ν indicates the number of object combinations
~ν can discern between. The fitness function f1 gives the candidate credit for
containing less attributes (fewer 1’s), while the function f2 determines the
extent to which the candidate can discern among objects.

The effectiveness of the algorithm is demonstrated on three cancer datasets,


viz., Colon, Lymphoma and Leukemia. In case of Leukemia data a two-genes
set is selected, whereas the Colon data results in a eight-genes reduct size.

6.7.4 Gene regulatory network

Understanding of regulatory networks is crucial to the understanding of fun-


damental cellular processes involving growth, development, hormone secretion
and cellular communication. Determination of transcriptional factors that con-
trol gene expression can offer further insight into the misregulated expressions
common in many human diseases. In this section we outline some of the recent
literature on the use of soft computing in the area of gene regulatory networks.

© 2008 by Taylor & Francis Group, LLC


198 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
ANN

Recurrent neural network has been used to model the dynamics of gene ex-
pression [169]. The significance of the regulatory effect of one gene product
on the expression of other genes of the system is defined by a weight matrix.
Multigenic regulation, involving positive and/or negative feedback, is consid-
ered. The process of gene expression is described by a single network, along
with a pair of linked networks independently modeling the transcription and
translation schemes. Bayesian networks with Bayesian learning were employed
[170], in a reverse engineering approach, to infer gene regulatory interactions
from simulated gene expression data.
Adaptive Double Self-Organizing Map (ADSOM) [171] provides a clustering
strategy for identifying coregulated regions of interest. These are utilized for
extracting gene regulatory networks. The model has a flexible topology, and al-
lows simultaneous visualization of clusters. DSOM combines features of SOM
with two-dimensional position vectors, to provide a visualization tool for de-
ciding on the required number of clusters. However, its free parameters are
difficult to control to guarantee proper convergence. ADSOM updates these
free parameters during training, and allows convergence of its position vectors
to a fairly consistent number of clusters (provided its initial number of nodes
is greater than the expected number of clusters). The effectiveness of AD-
SOM in identifying the number of clusters is proven by applying it to publicly
available gene expression data from multiple biological systems such as yeast,
human and mouse.

EC

Use of GAs for reconstructing genetic networks has been reported in literature
[172, 173]. Typically the GA searches for the most likely genetic networks that
best fit the data, considering the set of genes to be included in the network
along with the strength of their interactions.

Hybridization

Ritchie et al. [174] optimized the back propagation neural network architec-
ture, using genetic programming, in order to improve upon the ability of ANNs
to model, identify, characterize and detect nonlinear gene-gene interactions in
studies of common human diseases. The performance is reported to be supe-
rior in terms of predictive ability and power to detect gene-gene interactions
when nonfunctional polymorphisms are present.
Identification of protein-DNA interactions in the promoter region, in terms
of DNA motifs that characterize the regulatory factors operating in the tran-
scription of a gene, is important for recognizing genes that participate in a
regulation process. This enables determination of their interconnection in a

© 2008 by Taylor & Francis Group, LLC


CONCLUSION 199
gene regulatory network. A hybrid methodology for this purpose has been
developed [175] by combining ANN, fuzzy sets and multi-objective GAs. A
time-delayed neural network (TDNN) learns compound binding site motifs
from nonspecific DNA sequences by decomposing it into modules correspond-
ing to submotifs. The MCC of eqn. (6.33) is used to discriminate between
promoters and nonpromoters. The system can handle multiplicity of RNA
polymerase targets and multiple functional binding sites in closely located
regulatory regions, along with the associated uncertainty of the motifs.

6.8 Conclusion

Bioinformatics is a new area of science where a combination of statistics,


molecular biology and computational methods is used for analyzing and pro-
cessing biological information like gene, DNA, RNA and proteins. Improper
folding of protein structure is responsible for causing many diseases. There-
fore, accurate structure prediction of proteins is a major goal of study. With
the availability of huge volume of high-dimensional data, there exists a lot
of possibilities for the emergent field of biological data mining. Hybrid ap-
proaches, combining powerful algorithms and interactive visualization tools
with the strengths of fast processors, hold promise for enhanced performance
in the near future.
Soft computing, involving paradigms like FS, ANNs, EC and RS, has been
used for analyzing the different protein sequences, structures and folds, mi-
croarrays as well as regulatory networks. Since this permits approximate, good
solutions, instead of the high precision, globally optimum solution, it allows
one to arrive at a low cost goal faster.
We have provided, in this chapter, a detailed review on the role of soft comput-
ing paradigms and their hybridizations in different aspects of Bioinformatics,
mainly involving pattern recognition and data mining tasks. It is categorized
based on the domain of operation, the function modeled, and the tool used.
The major tasks covered include classification, clustering, feature selection
and rule mining. Gene regulatory networks, a relatively new area of study,
have also been surveyed.
Fuzzy sets, which constitute the oldest component of soft computing, are
suitable for handling the issues related to understandability of patterns, in-
complete or noisy data and human interaction, and can provide approximate
solutions faster. The characteristics of adaptivity and learning help ANNs to
minimize error and self-organize in data-rich environments. The low precision,
approximate reasoning of fuzzy sets allows faster convergence. Exhaustive enu-
meration and evaluation of all gene combinations being NP-hard, EC uses in-
telligent, goal-directed search while optimizing a fitness function determined
by the knowledge about the environment. Rough sets allow dimensionality
reduction for high-dimensional data, and are found suitable in mining mi-

© 2008 by Taylor & Francis Group, LLC


200 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
croarray gene expressions. Different types of hybridizations incorporate the
generic and application specific merits of the constituent paradigms.

Knowledge about the domain is often found to be useful in improving perfor-


mance of a system. For example, the incorporation of the alignment profile
generated by Psi-BLAST was found to be advantageous in protein secondary
structure determination by ANNs. This is evident from the comparative study
projected in Table 6.1. Similarly, the use of prior knowledge about the sec-
ondary structure at the input enhances the performance for tertiary structure
determination.

Metabolism is the chemical engine that drives a living process. By means of


utilization of a vast repertoire of enzymatic reactions and transport processes,
organisms process and convert thousands of organic compounds into various
biomolecules necessary to support their existence. The cells as well as the
organism direct the distribution and processing of metabolites throughout an
extensive map of pathways. While we seek to develop strategies to effectively
eliminate metabolic pathways due to microorganisms through antibiotics in
order to curb bacterial infection, we also strive to enhance the performance
of certain other pathways or introduce novel routes for the production of
biochemicals of commercial interest. The domain of metabolic pathways and
gene regulatory networks open up significant challenges for research involving
application of soft computing techniques.

6.9 Exercises

1. Distinguish between fuzziness and randomness. Explain how we need fuzzy


sets in everyday life.
x −x
2. (a) Draw M1 (x) = 1+5(x−2) 2 and M2 (x) = 2 , for x lying in the interval
x = [0, 5] of real numbers.

(b) Determine graphically the membership functions M 1 , M 2 , M1 ⊔M2 , M1 ⊓


M2 .

3. Write a computer program to implement the backpropagation algorithm for


training a multilayer perceptron to learn a 4-input 1-output parity problem.
(Odd number of ones implies a ‘one’ output, and vice versa.)

4. (a) What are the different kinds of learning in artificial neural networks?

(b) What do you understand by overlearning and generalization?

5. (a) Create a computer program for a crossover function that selects a


crossing site in a pair of binary strings, performs single-point crossover with
probability pc and generates a pair of offsprings.

© 2008 by Taylor & Francis Group, LLC


REFERENCES 201
(b) Insert a mutation function in your program to toggle a bit value at a
particular location, with mutation probability pm .

(c) Study the effect of varying the mutation probability on the performance
of GAs.

6. Five strings have fitness function values of 2, 4, 6, 10, 16, respectively. Write
a program for roulette wheel selection to find the expected number of copies
of each string in the mating pool, given that a constant population size of five
is maintained.

7. Distinguish between fuzzy membership and rough approximations.

8. Write a program for protein secondary structure prediction, using a feedfor-


ward neural network with a window on the amino acid sequence at its input.

9. Simulate the c-means, fuzzy c-means and rough c-means clustering algo-
rithms on a microarray gene expression dataset of your choice. Comment on
their relative merits and demerits.

References

[1] L. A. Zadeh, “Fuzzy logic, neural networks, and soft computing,” Communica-
tions of the ACM, vol. 37, pp. 77–84, 1994.
[2] S. K. Pal and S. Mitra, Neuro-fuzzy Pattern Recognition: Methods in Soft Com-
puting. New York: John Wiley, 1999.
[3] S. Mitra and T. Acharya, Data Mining: Multimedia, Soft Computing, and Bioin-
formatics. New York: John Wiley, 2003.
[4] S. Mitra and Y. Hayashi, “Bioinformatics with soft computing,” IEEE Trans-
actions on Systems, Man, and Cybernetics, Part C: Applications and Reviews,
vol. 36, pp. 616–635, 2006.
[5] L. A. Zadeh, “Fuzzy sets,” Information and Control, vol. 8, pp. 338–353, 1965.
[6] L. A. Zadeh, “The concept of a linguistic variable and its application to approxi-
mate reasoning: Part 1, 2, and 3,” Information Sciences, vol. 8, 8, 9, pp. 199–249,
301–357, 43–80, 1975.
[7] L. A. Zadeh, “Fuzzy sets as a basis for a theory of possibility,” Fuzzy Sets and
Systems, vol. 1, pp. 3–28, 1978.
[8] L. A. Zadeh, “The role of fuzzy logic in the management of uncertainty in expert
systems,” Fuzzy Sets and Systems, vol. 11, pp. 199–227, 1983.
[9] H. J. Zimmermann, Fuzzy Sets, Decision Making and Expert Systems. Boston,
MA: Kluwer Academic Publishers, 1987.
[10] G. J. Klir and B. Yuan, Fuzzy Sets and Fuzzy Logic: Theory and Applications.
NJ: Prentice Hall, 1995.
[11] E. H. Mamdani and S. Assilian, “An experiment in linguistic synthesis with a
fuzzy logic controller,” International Journal of Man Machine Studies, vol. 7,
pp. 1–13, 1975.

© 2008 by Taylor & Francis Group, LLC


202 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
[12] T. Takagi and M. Sugeno, “Fuzzy identification of systems and its application to
modeling and control,” IEEE Transactions on Systems, Man, and Cybernetics,
vol. 15, pp. 116–132, 1985.
[13] J. J. Buckley and T. Feuring, Fuzzy and Neural: Interactions and Applications.
Studies in Fuzziness and Soft Computing, Heidelberg: Physica-Verlag, 1999.
[14] S. Haykin, Neural Networks: A Comprehensive Foundation. New York: Macmil-
lan College Publishing Co. Inc., 1994.
[15] J. Hertz, A. Krogh, and R. G. Palmer, Introduction to the Theory of Neural
Computation. Reading, MA: Addison-Wesley, 1994.
[16] D. E. Rumelhart and J. L. McClelland, eds., Parallel Distributed Processing:
Explorations in the Microstructures of Cognition, vol. 1. Cambridge, MA: MIT
Press, 1986.
[17] T. Kohonen, Self-Organization and Associative Memory. Berlin: Springer-
Verlag, 1989.
[18] J. M. Zurada, Introduction to Artificial Neural Systems. New York: West Pub-
lishing Company, 1992.
[19] D. R. Hush and B. G. Horne, “Progress in supervised neural networks,” IEEE
Signal Processing Magazine, pp. 8–39, January 1993.
[20] D. O. Hebb, The Organization of Behaviour. New York: Wiley, 1949.
[21] W. S. McCulloch and W. Pitts, “A logical calculus of the idea immanent
in nervous activity,” Bulletin of Mathematical Biophysics, vol. 5, pp. 115–133,
1943.
[22] A. B. Tickle, R. Andrews, M. Golea, and J. Diederich, “The truth will come to
light: Directions and challenges in extracting the knowledge embedded within
trained artificial neural networks,” IEEE Transactions on Neural Networks,
vol. 9, pp. 1057–1068, 1998.
[23] S. Mitra and Y. Hayashi, “Neuro-fuzzy rule generation: Survey in soft computing
framework,” IEEE Transactions on Neural Networks, vol. 11, pp. 748–768, 2000.
[24] L. M. Fu, “Knowledge-based connectionism for revising domain theories,” IEEE
Transactions on Systems, Man, and Cybernetics, vol. 23, pp. 173–182, 1993.
[25] G. G. Towell and J. W. Shavlik, “Knowledge-based artificial neural networks,”
Artificial Intelligence, vol. 70, pp. 119–165, 1994.
[26] F. Rosenblatt, “The perceptron: A probabilistic model for information storage
and organization in the brain,” Psychological Review, vol. 65, pp. 386–408, 1958.
[27] F. Rosenblatt, Principles of Neurodynamics, Perceptrons and the Theory of
Brain Mechanisms. Washington: Spartan Books, 1961.
[28] M. Minsky and S. Papert, Perceptrons: An Introduction to Computational Ge-
ometry. Cambridge, MA: MIT Press, 1969.
[29] J. Moody and C. J. Darken, “Fast learning in networks of locally-tuned pro-
cessing units,” Neural Computation, vol. 1, pp. 281–294, 1989.
[30] D. R. Hush, B. Horne, and J. M. Salas, “Error surfaces for multilayer percep-
trons,” IEEE Transactions on Systems, Man, and Cybernetics, vol. 22, pp. 1152–
1161, 1993.
[31] D. E. Goldberg, Genetic Algorithms in Search, Optimization and Machine
Learning. Reading, MA: Addison-Wesley, 1989.
[32] Z. Michalewicz, Genetic Algorithms + Data Structures = Evolutionary Pro-
grams. Berlin: Springer-Verlag, 1994.
[33] D. B. Fogel, L. J. Fogel, and V. W. Porto, “Evolving neural networks,” Biological
Cybernetics, vol. 63, pp. 487–493, 1990.

© 2008 by Taylor & Francis Group, LLC


REFERENCES 203
[34] K. Deb, Multi-Objective Optimization using Evolutionary Algorithms. London:
John Wiley, 2001.
[35] K. Deb, S. Agarwal, A. Pratap, and T. Meyarivan, “A fast and elitist multi-
objective genetic algorithm : NSGA-II,” IEEE Transactions on Evolutionary
Computation, vol. 6, pp. 182–197, 2002.
[36] J. R. Koza, Genetic Programming: On the Programming of Computers by Means
of Natural Selection. Cambridge, MA: MIT Press, 1992.
[37] R. Slowiński, ed., Intelligent Decision Support, Handbook of Applications and
Advances of the Rough Sets Theory. Dordrecht: Kluwer Academic, 1992.
[38] A. Skowron and C. Rauszer, “The discernibility matrices and functions in infor-
mation systems,” in Intelligent Decision Support, Handbook of Applications and
Advances of the Rough Sets Theory (R. Slowiński, ed.), pp. 331–362, Dordrecht:
Kluwer Academic, 1992.
[39] J. Wroblewski, “Finding minimal reducts using genetic algorithms,” Tech. Rep.
16/95, Warsaw Institute of Technology - Institute of Computer Science, Poland,
1995.
[40] C. T. Lin and C. S. George Lee, Neural Fuzzy Systems - A Neuro-Fuzzy Syner-
gism to Intelligent Systems. New Jersey: Prentice Hall, 1996.
[41] W. Pedrycz, Computational Intelligence: An Introduction. Boca Raton, FL:
CRC Press, 1998.
[42] Y. Hayashi and J. J. Buckley, “Approximations between fuzzy expert systems
and neural networks,” International Journal of Approximate Reasoning, vol. 10,
pp. 63–73, 1994.
[43] J. S. R. Jang and C. T. Sun, “Functional equivalence between radial basis
function networks and fuzzy inference systems,” IEEE Transactions on Neural
Networks, vol. 4, pp. 156–159, 1993.
[44] S. C. Lee and E. T. Lee, “Fuzzy neural networks,” Mathematical Biosciences,
vol. 23, pp. 151–177, 1975.
[45] S. K. Pal and S. Mitra, “Multi-layer perceptron, fuzzy sets and classification,”
IEEE Transactions on Neural Networks, vol. 3, pp. 683–697, 1992.
[46] J. K. Keller and D. J. Hunt, “Incorporating fuzzy membership functions into
the perceptron algorithm,” IEEE Transactions on Pattern Analysis and Machine
Intelligence, vol. 7, pp. 693–699, 1985.
[47] J. M. Keller, R. R. Yager, and H. Tahani, “Neural network implementation of
fuzzy logic,” Fuzzy Sets and Systems, vol. 45, pp. 1–12, 1992.
[48] J. S. R. Jang, C. T. Sun, and E. Mizutani, Neuro-Fuzzy and Soft Computing.
Englewood Cliffs, NJ: Prentice Hall, 1997.
[49] S. Mitra, “Fuzzy MLP based expert system for medical diagnosis,” Fuzzy Sets
and Systems, vol. 65, pp. 285–296, 1994.
[50] D. Nauck, F. Klawonn, and R. Kruse, Foundations of Neuro-Fuzzy Systems.
Chichester, England: John Wiley & Sons, 1997.
[51] J. M. Keller, R. Krishnapuram, and F. C. -H. Rhee, “Evidence aggregation net-
works for fuzzy logic inference,” IEEE Transactions on Neural Networks, vol. 3,
pp. 761–769, 1992.
[52] S. Mitra and S. K. Pal, “Logical operation based fuzzy MLP for classification
and rule generation,” Neural Networks, vol. 7, pp. 353–373, 1994.
[53] G. A. Carpenter, S. Grossberg, N. Markuzon, J. H. Reynolds, and D. B. Rosen,
“Fuzzy ARTMAP: a neural network architecture for incremental supervised
learning of analog multidimensional maps,” IEEE Transactions on Neural Net-

© 2008 by Taylor & Francis Group, LLC


204 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
works, vol. 3, pp. 698–713, 1992.
[54] A. Ghosh, N. R. Pal, and S. K. Pal, “Self-organization for object extraction
using multilayer neural network and fuzziness measures,” IEEE Transactions on
Fuzzy Systems, vol. 1, pp. 54–68, 1993.
[55] W. Pedrycz, ed., Fuzzy Evolutionary Computation. Boston: Kluwer Academic,
1997.
[56] X. Yao, “A review of evolutionary artificial neural networks,” International
Journal of Intelligent Systems, vol. 8, pp. 539–567, 1993.
[57] H. Muhlenbein, “Limitations of multi-layer perceptron networks - step towards
genetic neural networks,” Parallel Computing, vol. 14, pp. 249–260, 1990.
[58] S. Bornholdt and D. Graudenz, “General asymmetric neural networks and struc-
ture design by genetic algorithms,” Neural Networks, vol. 5, pp. 327–334, 1992.
[59] V. Maniezzo, “Genetic evolution of the topology and weight distribution of
neural networks,” IEEE Transactions on Neural Networks, vol. 5, pp. 39–53,
1994.
[60] B. A. Whitehead and T. D. Choate, “Cooperative-Competitive genetic evolution
of radial basis function centers and widths for time series prediction,” IEEE
Transactions on Neural Networks, vol. 7, pp. 869–880, 1996.
[61] S. K. Pal and D. Bhandari, “Genetic algorithms with fuzzy fitness function
for object extraction using cellular neural networks,” Fuzzy Sets and Systems,
vol. 65, pp. 129–139, 1994.
[62] H. Ishibuchi, M. Nii, and T. Murata, “Linguistic rule extraction from neural
networks and genetic-algorithm-based rule selection,” in Proceedings of IEEE
International Conference on Neural Networks, (Houston, USA), pp. 2390–2395,
1997.
[63] R. J. Machado and A. F. da Rocha, “Evolutive fuzzy neural networks,” in
Proceedings of 1st IEEE International Conference on Fuzzy Systems (San Diego,
USA), pp. 493–500, 1992.
[64] M. Banerjee and S. K. Pal, “Roughness of a fuzzy set,” Information Sciences
(Informatics & Computer Science), vol. 93, pp. 235–246, 1996.
[65] S. K. Pal and A. Skowron, eds., Rough Fuzzy Hybridization: A New Trend in
Decision Making. Singapore: Springer-Verlag, 1999.
[66] S. Mitra, M. Banerjee, and S. K. Pal, “Rough knowledge-based network, fuzzi-
ness and classification,” Neural Computing and Applications, vol. 7, pp. 17–25,
1998.
[67] M. Banerjee, S. Mitra, and S. K. Pal, “Rough fuzzy MLP: Knowledge encoding
and classification,” IEEE Transactions on Neural Networks, vol. 9, pp. 1203–
1216, 1998.
[68] S. Mitra, P. Mitra, and S. K. Pal, “Evolutionary modular design of rough
knowledge-based network using fuzzy attributes,” Neurocomputing, vol. 36,
pp. 45–66, 2001.
[69] S. K. Pal, S. Mitra, and P. Mitra, “Rough Fuzzy MLP: Modular evolution,
rule generation and evaluation,” IEEE Transactions on Knowledge and Data
Engineering, vol. 15, pp. 14–25, 2003.
[70] C. H. Wu and J. W. McLarty, Neural Networks and Genome Informatics, vol. 1
of Methods in Computational Biology and Biochemistry. Amsterdam: Elsevier,
2000.
[71] L. P. Wang and X. Fu, Data Mining with Computational Intelligence. Berlin:
Springer, 2005.

© 2008 by Taylor & Francis Group, LLC


REFERENCES 205
[72] G. Fogel and D. Corne, eds., Evolutionary Computation in Bioinformatics. San
Francisco: Morgan Kaufmann, 2002.
[73] J. Casasnovas and F. Rosselló, “Averaging fuzzy biopolymers,” Fuzzy Sets and
Systems, vol. 152, pp. 139–158, 2005.
[74] L. Pickert, I. Reuter, F. Klawonn, and E. Wingender, “Transcription regula-
tory region analysis using signal detection and fuzzy clustering,” Bioinformatics,
vol. 14, pp. 244–251, 1998.
[75] R. Farber, A. Lapedes, and K. Sirotkin, “Determination of eukaryotic protein
coding regions using neural networks and information theory,” Journal of Molec-
ular Biology, vol. 226, pp. 471–479, 1992.
[76] G. Schneider, S. Rohlk, and P. Wrede, “Analysis of cleavage-site patterns in
protein precursor sequences with a perceptron-type neural network,” Biochem
Biophys Res Commun, vol. 194, pp. 951–959, 1993.
[77] E. C. Uberbacher, Y. Xu, and R. J. Mural, “Discovering and understand-
ing genes in human DNA sequence using GRAIL,” Methods Enzymol, vol. 266,
pp. 259–281, 1996.
[78] S. Brunak, J. Engelbrecht, and S. Knudsen, “Prediction of human mRNA
donor and acceptor sites from the DNA sequence,” Journal of Molecular Biology,
vol. 220, pp. 49–65, 1991.
[79] N. I. Larsen, J. Engelbrecht, and S. Brunak, “Analysis of eukaryotic promoter se-
quences reveals a systematically occurring CT-signal,” Nucleic Acids Res, vol. 23,
pp. 1223–1230, 1995.
[80] A. G. Pedersen and H. Nielsen, “Neural network prediction of translation ini-
tiation sites in eukaryotes: Perspectives for EST and genome analysis,” ISMB,
vol. 5, pp. 226–233, 1997.
[81] C. H. Wu, M. Berry, S. Shivakumar, and J. McLarty, “Neural networks for
full-scale protein sequence classification: Sequence encoding with singular value
decomposition,” Machine Learning, vol. 21, pp. 177–193, 1995.
[82] A. Browne, B. D. Hudson, D. C. Whitley, M. G. Ford, and P. Picton, “Biological
data mining with neural networks: Implementation and application of a flexible
decision tree extraction algorithm to genomic problem domains,” Neurocomput-
ing, vol. 57, pp. 275–293, 2004.
[83] R. Setiono, “Extracting rules from neural networks by pruning and hidden-unit
splitting,” Neural Computation, vol. 9, pp. 205–225, 1997.
[84] J. Hanke and J. G. Reich, “Kohonen map as a visualization tool for the analysis
of protein sequences: Multiple alignments, domains and segments of secondary
structures,” Comput Applic Biosci, vol. 6, pp. 447–454, 1996.
[85] Y. D. Cai, H. Yu, and K. C. Chou, “Artificial neural network method for predict-
ing HIV protease cleavage sites in protein,” J. Protein Chem, vol. 17, pp. 607–615,
1998.
[86] Y. D. Cai, H. Yu, and K. C. Chou, “Prediction of beta-turns,” J. Protein Chem,
vol. 17, pp. 363–376, 1998.
[87] J. Schuchhardt, G. Schneider, J. Reichelt, D. Schomberg, and P. Wrede, “Local
structural motifs of protein backbones are classified by self-organizing neural
networks,” Protein Eng, vol. 9, pp. 833–842, 1996.
[88] P. Arrigo, F. Giuliano, F. Scalia, A. Rapallo, and G. Damiani, “Identification of
a new motif on nucleic acid sequence data using Kohonen’s self organizing map,”
Comput Appl Biosci, vol. 7, pp. 353–357, 1991.

© 2008 by Taylor & Francis Group, LLC


206 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
[89] E. A. Ferran, B. Pflugfelder, and P. Ferrara, “Self-organized neural maps of
human protein sequences,” Protein Sci, vol. 3, pp. 507–521, 1994.
[90] H. C. Wang, J. Dopazo, L. G. de la Fraga, Y. P. Zhu, and J. M. Carazo,
“Self-organizing tree-growing network for the classification of protein sequences,”
Protein Sci, vol. 7, pp. 2613–2622, 1998.
[91] H. C. Wang, J. Dopazo, and J. M. Carazo, “Self-organizing tree-growing network
for classifying amino acids,” Bioinformatics, vol. 14, pp. 376–377, 1998.
[92] J. Dopazo and J. M. Carazo, “Phylogenetic reconstruction using an unsuper-
vised growing neural network that adopts the topology of a phylogenetic tree,”
Journal of Molecular Evolution, vol. 44, pp. 226–233, 1997.
[93] R. Thomson, T. C. Hodgman, Z. R. Yang, and A. K. Doyle, “Characteriz-
ing proteolytic cleavage site activity using bio-basis function neural networks,”
Bioinformatics, vol. 19, pp. 1741–1747, 2003.
[94] C. LeBlanc, C. R. Katholi, T. R. Unnasch, and S. I. Hruska, “DNA sequence
analysis using hierarchical ART-based classification networks,” ISMB, vol. 2,
pp. 253–260, 1994.
[95] C. H. Wu, H. L. Chen, and S. C. Chen, “Counter-propagation neural networks
for molecular sequence classification: Supervised LVQ and dynamic node alloca-
tion,” Applied Intelligence, vol. 7, pp. 27–38, 1997.
[96] E. E. Snyder and G. D. Stormo, “Identification of protein coding regions in
genomic DNA,” Journal of Molecular Biology, vol. 248, pp. 1–18, 1995.
[97] D. Wang and G. B. Huang, “Protein sequence classification using extreme learn-
ing machine,” in Proceedings of the International Joint Conference on Neural
Networks (IJCNN’05), (Montreal, Canada), August 2005.
[98] C. Notredame and D. G. Higgins, “SAGA: Sequence alignment by genetic al-
gorithm,” Nucleic Acids Research, vol. 24, pp. 1515–1524, 1996.
[99] C. Notredame, L. Holm, and D. G. Higgins, “COFFEE: An objective function
for multiple sequence alignments,” Bioinformatics, vol. 14, pp. 407–422, 1998.
[100] P. O. Lewis, “A genetic algorithm for maximum-likelihood phylogeny infer-
ence using nucleotide sequence data,” Molecular Biology and Evolution, vol. 15,
pp. 277–283, 1998.
[101] M. J. Brauer, M. T. Holder, L. A. Dries, D. J. Zwickl, P. O. Lewis, and D. M.
Hillis, “Genetic algorithms and parallel processing in maximum-likelihood phy-
logeny inference,” Molecular Biology and Evolution, vol. 19, pp. 1717–1726, 2002.
[102] D. Howard and K. Benson, “Evolutionary computation method for pattern
recognition of cis-acting sites,” BioSystems, vol. 72, pp. 19–27, 2003.
[103] B. C. H. Chang and S. K. Halgamuge, “Protein motif extraction with neuro-
fuzzy optimization,” Bioinformatics, vol. 18, pp. 1084–1090, 2002.
[104] H. Berman, J. Westbrook, Z. Feng, G. Gilliland, T. Bhat, H. Weissing,
I. Shindyalov, and P. Bourne, “The Protein Data Bank,” Nucleic Acids Research,
vol. 28, pp. 235–242, 2000.
[105] D. Pelta, N. Krasnogor, C. Bousono-Calzon, J. L. Verdegay, J. Hirst, and
E. Burke, “A fuzzy sets based generalization of contact maps for the overlap of
protein structures,” Fuzzy Sets and Systems, vol. 152, pp. 103–123, 2005.
[106] P. Chou and G. Fasmann, “Prediction of the secondary structure of proteins
from their amino acid sequence,” Advances in Enzymology, vol. 47, pp. 45–148,
1978.
[107] N. Qian and T. Sejnowski, “Predicting the secondary structure of globular
proteins using neural network models,” Journal of Molecular Biology, vol. 202,

© 2008 by Taylor & Francis Group, LLC


REFERENCES 207
pp. 865–884, 1988.
[108] B. Rost and C. Sander, “Prediction of protein secondary structure at better
than 70% accuracy,” Journal of Molecular Biology, vol. 232, pp. 584–599, 1993.
[109] B. Rost, “PHD: Predicting one-dimensional protein structure by profile-based
neural networks,” Methods in Enzymology, vol. 266, pp. 525–539, 1996.
[110] Z. Sun, X. Rao, L. Peng, and D. Xu, “Prediction of protein supersecondary
structures based on the artificial neural network method,” Protein Eng, vol. 10,
pp. 763–769, 1997.
[111] H. Bohr, J. Bohr, S. Brunak, R. M. J. Cotterill, and H. Fredholm, “A novel
approach to prediction of the 3-dimensional structures of protein backbones by
neural networks,” FEBS Letters, vol. 261, pp. 43–46, 1990.
[112] G. L. Wilcox, M. O. Poliac, and M. N. Liebman, “Neural network analysis of
protein tertiary structure,” Tetrahedron Comp Meth, vol. 3, pp. 191–211, 1991.
[113] O. Lund, K. Frimand, J. Gorodkin, H. Bohr, J. Bohr, J. Hansen, and S. Brunak,
“Protein distance constraints predicted by neural networks and probability dis-
tance functions,” Protein Eng, vol. 10, pp. 1241–1248, 1997.
[114] M. Milik, A. Kolinski, and J. Skolnick, “Neural network system for the evalua-
tion of side-chain packing in protein structures,” Protein Eng, vol. 8, pp. 225–236,
1995.
[115] J. M. Chandonia and M. Karplus, “Neural networks for secondary structure
and structural class predictions,” Protein Sci, vol. 4, pp. 275–285, 1995.
[116] I. Dubchak, I. Muchnik, S. R. Holbrook, and S. H. Kim, “Prediction of protein
folding class using global description of amino acid sequence,” Proceedings of
National Academy of Sciences USA, vol. 92, pp. 8700–8704, 1995.
[117] A. Gutteridge, G. J. Bartlett, and J. M. Thornton, “Using a neural network
and spatial clustering to predict the location of active sites in enzymes,” Journal
of Molecular Biology, vol. 330, pp. 719–734, 2003.
[118] R. Casadio, M. Compiani, P. Fariselli, and F. Vivarelli, “Predicting free en-
ergy contributions to the conformational stability of folded proteins,” Intelligent
Systems for Molecular Biology, vol. 3, pp. 81–88, 1995.
[119] S. K. Riis and A. Krogh, “Improving prediction of protein secondary structure
using structured neural networks and multiple sequence alignments,” Journal of
Computational Biology, vol. 3, pp. 163–183, 1996.
[120] D. T. Jones, “Protein secondary structure prediction based on position-specific
scoring matrices,” Journal of Molecular Biology, vol. 292, pp. 195–202, 1999.
[121] H. Kaur and G. P. S. Raghava, “Role of evolutionary information in predic-
tion of aromatic-backbone NH interactions in proteins,” FEBS Letters, vol. 564,
pp. 47–57, 2004.
[122] G. Pollastri, D. Przybylski, B. Rost, and P. Baldi, “Improving the prediction
of protein secondary structure in three and eight classes using recurrent neu-
ral networks and profiles,” Proteins: Structure, Function, and Genetics, vol. 47,
pp. 228–235, 2002.
[123] P. Baldi, S. Brunak, P. Frasconi, G. Pollastri, and G. Soda, “Exploiting the
past and the future in protein secondary structure prediction,” Bioinformatics,
vol. 15, pp. 937–946, 1999.
[124] J. D. Szustakowski and Z. Weng, “Protein structure alignment using a genetic
algorithm,” Proteins, vol. 38, pp. 428–440, 2000.
[125] S. Schulze-Kremer, “Genetic algorithms for protein tertiary structure predic-
tion,” in Parallel Problem Solving from Nature II (R. Männer and B. Manderick,

© 2008 by Taylor & Francis Group, LLC


208 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
eds.), pp. 391–400, Amsterdam: North Holland, 1992.
[126] R. König and T. Dandekar, “Improving genetic algorithms for protein folding
simulations by systematic crossover,” BioSystems, vol. 50, pp. 17–25, 1999.
[127] J. Pedersen and J. Moult, “Protein folding simulations with genetic algorithms
and a detailed molecular description,” Journal of Molecular Biology, vol. 269,
pp. 240–259, 1997.
[128] G. Jones, P. Willett, R. C. Glen, A. R. Leach, and R. Taylor, “Development
and validation of a genetic algorithm for flexible docking,” Journal of Molecular
Biology, vol. 267, pp. 727–748, 1997.
[129] G. Morris, D. Goodsell, R. Halliday, R. Huey, W. Hart, R. Belew, and A. Ol-
son, “Automated docking using Lamarckian genetic algorithm and an empiri-
cal binding free energy function,” Journal of Computational Chemistry, vol. 19,
pp. 1639–1662, 1998.
[130] J. M. Yang and C. C. Chen, “GEMDOCK: A generic evolutionary method for
molecular docking,” Proteins: Structure, Function, and Bioinformatics, vol. 55,
pp. 288–304, 2004.
[131] M. Raymer, P. Sanschagrin, W. Punch, S. Venkataraman, E. Goodman, and
L. Kuhn, “Predicting conserved water-mediated and polar ligand interactions in
proteins using a k-nearest neighbors genetic algorithm,” Journal of Molecular
Biology, vol. 265, pp. 445–464, 1997.
[132] J. Desjarlais and T. Handel, “De novo design of the hydrophobic cores of
proteins,” Protein Sci, vol. 4, pp. 2006–2018, 1995.
[133] B. Noelting, D. Juelich, W. Vonau, and K. Andert, “Evolutionary computer
programming of protein folding and structure predictions,” Journal of Theoretical
Biology, 2004.
[134] R. Maclin and J. W. Shavlik, “Using knowledge-based neural network to im-
prove algorithms: Refining Chou-Fasman algorithm for protein folding,” Machine
Learning, vol. 11, pp. 195–215, 1993.
[135] F. Vivarelli, G. Giusti, M. Villani, R. Campanini, P. Fariselli, M. Compiani, and
R. Casadio, “LGANN: A parallel system combining a local genetic algorithm and
neural networks for the prediction of secondary structure of proteins,” Comput
Appl Biosci, vol. 11, pp. 253–260, 1995.
[136] A. K. Jain and R. C. Dubes, Algorithms for Clustering Data. NJ: Prentice
Hall, 1988.
[137] K. Y. Yeung, C. Fraley, A. Murua, A. E. Raftery, and W. L. Ruzzo, “Model-
based clustering and data transformations for gene expression data,” Bioinfor-
matics, vol. 17, pp. 977–987, 2001.
[138] J. C. Bezdek, Pattern Recognition with Fuzzy Objective Function Algorithms.
New York: Plenum Press, 1981.
[139] D. Dembele and P. Kastner, “Fuzzy c-means method for clustering microarray
data,” Bioinformatics, vol. 19, pp. 973–980, 2003.
[140] A. P. Gasch and M. B. Eisen, “Exploring the conditional coregulation of yeast
gene expression through fuzzy k-means clustering,” Genome Biology, vol. 3,
pp. research0059.1–0059.22, 2002.
[141] C. S. Möller-Levet, F. Klawonn, K. H. Cho, H. Yin, and O. Wolkenhauer,
“Clustering of unevenly sampled gene expression time-series data,” Fuzzy Sets
and Systems, vol. 152, pp. 49–66, 2005.
[142] R. Lukac, K. N. Plataniotis, B. Smolka, and A. N. Venetsanopoulos, “cDNA
microarray image processing fuzzy vector filtering framework,” Fuzzy Sets and

© 2008 by Taylor & Francis Group, LLC


REFERENCES 209
Systems, vol. 152, pp. 17–35, 2005.
[143] K. Torkkola, R. M. Gardner, T. Kaysser-Kranich, and C. Ma, “Self-organizing
maps in mining gene expression data,” Information Sciences, vol. 139, pp. 79–96,
2001.
[144] P. Tamayo, D. Slonim, J. Mesirov, Q. Zhu, S. Kitareewan, E. Smitrovsky, E. S.
Lander, and T. R. Golub, “Interpreting patterns of gene expression with self-
organizing maps: Methods and applications to hematopoietic differentiation,”
Proceedings of National Academy of Sciences USA, vol. 96, pp. 2907–2912, 1999.
[145] P. Törönen, M. Kolehmainen, G. Wong, and E. Castrén, “Analysis of gene
expression data using self-organizing maps,” FEBS Letters, vol. 451, pp. 142–
146, 1999.
[146] J. Herrero, A. Valencia, and J. Dopazo, “A hierarchical unsupervised growing
neural network for clustering gene expression patterns,” Bioinformatics, vol. 17,
pp. 126–136, 2001.
[147] M. Sultan, D. A. Wigle, C. A. Cumbaa, M. Maziarz, J. Glasgow, M. S. Tsao,
and I. Jurisica, “Binary tree-structured vector quantization approach to cluster-
ing and visualizing microarray data,” Bioinformatics, vol. 18 Suppl. 1, pp. S111–
S119, 2002.
[148] S. B. Cho and J. Ryu, “Classifying gene expression data of cancer using classi-
fier ensemble with mutually exclusive features,” Proceedings of the IEEE, vol. 90,
pp. 1744–1753, 2002.
[149] S. Bicciato, M. Pandin, G. Didonè, and C. Di Bello, “Pattern identification
and classification in gene expression data using an autoassociative neural network
model,” Biotechnology and Bioengineering, vol. 81, pp. 594–606, 2003.
[150] A. Kelemen and Y. Liang, “Bayesian regularized neural network for multiple
gene expression pattern classification,” in Proceedings of the International Joint
Conference on Neural Networks, pp. 1:654–1:659, July 2003.
[151] K. Deb and A. Raji Reddy, “Reliable classification of two-class cancer data
using evolutionary algorithms,” BioSystems, vol. 72, pp. 111–129, 2003.
[152] E. Falkenauer, Genetic Algorithms and Grouping Problems. Chichester: John
Wiley, 1998.
[153] J. M. Deutsch, “Evolutionary algorithms for finding optimal gene sets in mi-
croarray prediction,” Bioinformatics, vol. 19, pp. 45–52, 2003.
[154] S. Kirkpatrick, C. D. Gelatt Jr., and M. P. Vecchi, “Optimization by simulated
annealing,” Science, vol. 220, pp. 671–680, 1983.
[155] A. V. Lukashin and R. Fuchs, “Analysis of temporal gene expression profiles:
Clustering by simulated annealing and determining the optimal number of clus-
ters,” Bioinformatics, vol. 17, pp. 405–414, 2001.
[156] S. Bleuler, A. Prelić, and E. Zitzler, “An EA framework for biclustering of
gene expression data,” in Proceedings of Congress on Evolutionary Computation,
pp. 166–173, 2004.
[157] S. Mitra and H. Banka, “Multi-objective evolutionary biclustering of gene ex-
pression data,” Pattern Recognition, 2006.
[158] D. Mateos, J. C. Riquelme, and J. S. Aguilar-Ruiz, “Evolutionary segmentation
of yeast genome,” in Proceedings of the ACM Symposium on Applied Computing,
pp. 1026–1027, March 2004.
[159] Z. Pawlak, Rough Sets, Theoretical Aspects of Reasoning about Data. Dor-
drecht: Kluwer Academic, 1991.
[160] H. Midelfart, A. Lægreid, and J. Komorowski, Classification of gene expression

© 2008 by Taylor & Francis Group, LLC


210 COMPUTATIONAL INTELLIGENCE IN BIOINFORMATICS
data in an ontology, vol. 2199 of Lecture Notes in Computer Science, pp. 186–194.
Berlin: Springer-Verlag, 2001.
[161] G. A. Carpenter, S. Grossberg, and D. B. Rosen, “Fuzzy ART: fast stable
learning and categorization of analog patterns by an adaptive resonance system,”
Neural Networks, vol. 4, pp. 759–771, 1991.
[162] S. Tomida, T. Hanai, H. Honda, and T. Kobayashi, “Analysis of expression
profile using fuzzy adaptive resonance theory,” Bioinformatics, vol. 18, pp. 1073–
1083, 2002.
[163] M. E. Futschik, A. Reeve, and N. Kasabov, “Evolving connectionist systems
for knowledge discovery from gene expression data of cancer tissue,” Artificial
Intelligence in Medicine, vol. 28, pp. 165–189, 2003.
[164] F. Chu, W. Xie, and L. Wang, “Gene selection and cancer classification using
a fuzzy neural network,” in Proceedings of 2004 Annual Meeting of the North
American Fuzzy Information Processing Society (NAFIPS 2004), vol. 2, pp. 555–
559, 2004.
[165] H. Midelfart, J. Komorowski, K. Nørsett, F. Yadetie, A. K. Sandvik, and
A. Lægreid, “Learning rough set classifiers from gene expressions and clinical
data,” Fundamenta Informaticae, vol. 53, pp. 155–183, 2002.
[166] P. Lingras and C. West, “Interval set clustering of Web users with rough k-
means,” Technical Report No. 2002-002, Dept. of Mathematics and Computer
Science, St. Mary’s University, Halifax, Canada, 2002.
[167] S. Mitra, “An evolutionary rough partitive clustering,” Pattern Recognition
Letters, vol. 25, pp. 1439–1449, 2004.
[168] M. Banerjee, S. Mitra, and H. Banka, “Evolutionary-rough feature selection in
gene expression data,” IEEE Transactions on Systems, Man, and Cybernetics,
Part C: Applications and Reviews, 2007.
[169] J. Vohradsky, “Neural network model of gene expression,” FASEB Journal,
vol. 15, pp. 846–854, 2001.
[170] D. Husmeier, “Sensitivity and specificity of inferring genetic regulatory inter-
actions from microarray experiments with dynamic bayesian networks,” Bioin-
formatics, vol. 19, pp. 2271–2282, 2003.
[171] H. Ressom, D. Wang, and P. Natarajan, “Clustering gene expression data
using adaptive double self-organizing map,” Physiol. Genomics, vol. 14, pp. 35–
46, 2003.
[172] S. Kikuchi, D. Tominaga, M. Arita, K. Takahashi, and M. Tomita, “Dynamic
modeling of genetic networks using genetic algorithm and S-system,” Bioinfor-
matics, vol. 19, pp. 643–650, 2003.
[173] M. Xiong, J. Li, and X. Fang, “Identification of genetic networks,” Genetics,
vol. 166, pp. 1037–1052, 2004.
[174] M. D. Ritchie, B. C. White, J. S. Parker, L. Hahn, and J. H. Moore, “Op-
timization of neural network architecture using genetic programming improves
detection and modeling of gene-gene interactions in studies of human diseases,”
BMC Bioinformatics, vol. 4, pp. 28–36, 2003.
[175] V. Cotik, R. Romero Zaliz, and I. Zwir, “A hybrid promoter analysis method-
ology for prokaryotic genomes,” Fuzzy Sets and Systems, vol. 152, pp. 83–102,
2005.

© 2008 by Taylor & Francis Group, LLC


CHAPTER 7

Connections between Machine


Learning and Bioinformatics

In the previous chapters, we have described a number of machine learning


techniques relevant to bioinformatics and mentioned particular applications.
In this chapter, we describe connections between bioinformatics and machine
learning from a different perspective—we describe several broad problem ar-
eas within bioinformatics and methods for solving problems in these areas. In
some cases, especially for sequence analysis, we consider algorithms that were
developed independent of the machine learning community. Nevertheless, we
describe how these relate to similar ideas in machine learning. In other cases,
we find direct applications of standard machine learning algorithms or spe-
cializations of them to particular contexts. We focus on three problem areas:
DNA and amino acid sequence analysis, gene expression analysis and network
inference.

7.1 Sequence Analysis

Perhaps the area most brought to mind by the term bioinformatics is sequence
analysis, including problems such as sequence alignment, gene-finding, iden-
tifying intron-exon boundaries, protein structure prediction and identifying
transcription factor binding sites. Techniques for solving these problems date
back to the 1970’s, and many were developed from ideas of string processing
in computer science. However, there are strong mathematical connections be-
tween standard sequence analysis algorithms and ideas in machine learning
and statistics. Methods for probabilistic modeling of discrete data are espe-
cially prevalent, including Hidden Markov Models (HMMs), as emphasized
by Durbin et al. [21]. We discuss some of these connections in this section,
focussing on two paradigmatic problems: sequence alignment and the identi-
fication of transcription factor binding sites. Protein structure prediction is
discussed at greater length in Chapters 6 and 8. For material on gene- and
exon-finding see, for example, [15, 14, 48].

211

© 2008 by Taylor & Francis Group, LLC


212 CONNECTIONS

(A) TGTTGTGTTGAGGTCACGTGCTATTAGCGCTGG
TGTATCTACTCACAGCAGATAGGCTCTGC
TGTGTCGGACTCATTGGGGCCGCCGG
TTGTCGGAGTTACCTGAAGTAGCACGG

(B) TGTTGTGTTGAGGTCACGTGCTATTAGCGCTGG (C) TGTTGTGTTGAGGTCACGTGCTATTAGCGCTGG


| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
T-T-GT-CGGAG-TTACCTGA-AGTAGCAC-GG TTGTCGGAGTTACCTGA-AGTAGCACGG

(D) TGTTGTGTTGAGGTCACGTGCTATTAGCGCTGG (E) TGTTGTGTTGAGGTCACGTGCTATTAGCGCTGG


| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
TGTA-TCT--AC-TCACAGCAGATAGGCTCTGC TGTATCTACTCACAGCAGATAGGCTCTGC
| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
TGT-GTC-GGAC-TCAT-TGGGGCC-GC-C-GG TGTGTCGGACTCATTGGGGCCGCCGG
| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
T-T-GTC-GGA-GTTACCTGAAGT-AGCAC-GG TTGTCGGAGTTACCTGAAGTAGCACGG

Figure 7.1 Different types of sequence alignment. (A) Four DNA strings generated
by subjecting a common ancestor string (not shown) to 10 random point mutations,
insertions and delections. (B) A global pairwise alignment of the first two strings.
Characters connected by a vertical line are said to be aligned. (C) A local pairwise
alignment of the first two strings. (D) A global multiple alignment of all four strings.
(E) A local multiple alignment of all four strings. All alignments shown are optimal
with respect to the scoring function S(a, b) defined by three rules: S(a, b) = +5 if
a = b; S(a, b) = −5 for pairs (A,G), (G,A), (C,T) and (T,C); S(a, b) = −7 for all
other pairs. The gap penalty function is linear, γ(i) = −10i.

7.1.1 Pairwise sequence alignment

We discuss four variants of the sequence alignment problem, depending on


whether a global or local alignment is sought, and depending on whether a
single pair of sequences or multiple sequences (three or more) are to be aligned.
Figure 7.1 gives examples of these four different types of alignment. Intuitively,
the goal of alignment is to put into correspondence parts of the strings that
are “similar.” Why is this relevant to biology? Imagine two species that are
evolutionarily related, so that at some time in the past there was a single
species that was their common ancestor. Consider a gene in that ancestor
that is passed on to each of the descendent species. As generations pass, each
species’ copy of that gene may change. Common ways in which DNA sequences
changes over time are point mutations, in which single nucleotides are replace
by different ones, insertions, in which one or more nucleotides are added to
the middle of the sequence, and deletions, in which one or more nucleotides
disappear from the middle of the sequence. Such changes are especially likely
to occur in parts of the sequence that are not functional, such as introns,
parts of the regulatory region between transcription factor binding sites or
even, for protein-coding genes, bases in the coding region whose alteration
does not change the amino acid sequence of the protein. By aligning the DNA
for the two genes, we identify those parts that have not been changed by evo-
lution or that have changed less than other parts. These are good candidates
for functional sequence, which helps us identifying the meaningful parts of
the gene. This reasoning assumes that changes to functional sequence are on

© 2008 by Taylor & Francis Group, LLC


SEQUENCE ANALYSIS 213
average deleterious to an organism’s fitness, which appears to be generally
true. Such sequence is said to be under negative selection. There are, how-
ever, a few known cases of positive selection, in which DNA sequences appear
to be evolving even faster than nonfunctional sequence, whose accumulated
mutations over time are said to follow neutral drift.
In the global pairwise sequence alignment problem we are given two sequences
x = x1 x2 . . . xn and y = y1 y2 . . . ym from a finite alphabet Σ. In DNA sequence
alignment, the alphabet would be
ΣDN A = {A, C, G, T } ,
whereas in amino acid sequence alignment (that is, peptide or protein) align-
ment, the alphabet would be the standard 1-letter codes for amino acids
ΣAA = {A, R, N, D, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V } .
Formally, an alignment is a pair of sequences x′ = x′1 x′2 . . . x′p and y ′ =
y1′ y2′ . . . yp′ that can be obtained by inserting zero or more gap characters,
‘−’, between each letter of x and y respectively, as well as at the start and
end of either sequence. Figure 7.1B shows an example. Observe that two let-
ters can be aligned without being identical. Figure 7.1B, for example, includes
a T from the first string aligned with a C from the second string, a T aligned
with a G, a C aligned with a T, and so on. A gap in either x′ or y ′ is a sequence
of one or more consecutive gap characters. Observe that while x and y may
be of different lengths, x′ and y ′ must be of the same length.
Alignments are scored based on two factors: a scoring or substitution matrix
S : Σ × Σ → ℜ and a gap penalty function γ : {1, 2, 3, . . .} → ℜ. S(a, b)
gives a score, which may be positive or negative, for aligning a character a
from sequence x with a character b from sequence y. This component of the
alignment’s score is summed over all characters that are not in correspondence
with a gap:
p 
X S(x′i , yi′ ) if x′i ∈ Σ and yi′ ∈ Σ
(7.1)
0 otherwise
i=1
The gap penalty function gives a negative score for each gap, depending on its
length. The overall score of an alignment is then the sum of its S-component
(Equation 7.1) and the penalty for each gap appearing in either x′ or y ′ .
A local pairwise alignment of x and y is a (global) alignment of a consecutive
subsequence x′′ = xi . . . xj of x with a consecutive subsequence y ′′ = yk . . . yl
of y. Figure 7.1C shows an example. Local alignments are scored the same as
global alignments, except that the score is computed only over the portions
aligned.
In this formulation, the scoring matrix S and the gap penalty function can
be arbitrary. In practice, these scores often reflect biological beliefs about
the relative frequency of different types of evolutionary events. Suppose, for
example, that the two sequences to be aligned are separated by 1 million

© 2008 by Taylor & Francis Group, LLC


214 CONNECTIONS
years of evolution. For a, b ∈ Σ, S(a, b) could be chosen to represent the log
probability that a common ancestral position evolves to the character a in one
lineage and b in the other lineage. If there were no gaps in an alignment, x′
and y ′ , then the score of the alignment would simply be the sum of scores for
aligned letters. This corresponds to the log probability that the entire string
x and string y evolved from the same common ancestral sequence over the
course of the intervening 1 million years. Alternatively, the score S(a, b) could
represent the log probability of evolving a and b from a common ancestor
minus the log probability of seeing an a and a b in unrelated positions. The
score of the alignment would then be a log-odds ratio for the hypothesis of
common ancestry versus the hypothesis of unrelatedness. The presence of
gaps in the alignment makes interpreting the score of an alignment more
complicated. For aligning amino acid sequences, the PAM and more recent
BLOSUM substitution matrices are standard choices. There is less agreement
on DNA subtitution matrices and how to estimate them. See Gu and Li [24]
for discussion.

Optimal pairwise sequence alignments can be computed by simple dynamic


programming algorithms—the Needleman-Wunsch algorithm for global align-
ments [38] and the Smith-Waterman algorithm for local alignments [52]. For
simplicity, we restrict attention to the case that the gap penalty function is
linear: γ(i) = −ci for some c > 0. An affine gap penalty, γ(i) = −c0 i − c1
for c0 , c1 > 0, is more common in practice and can be handled with a simple
extension. The general Needleman-Wunsch and Smith-Waterman algorithms
allow for arbitrary concave gap penalty functions.

The Needleman-Wunsch algorithm computes the scores of optimal alignments


of every prefix of x with every prefix of y. Let Hi,j be the score of the optimal
alignment of x1 x2 . . . xi with y1 y2 . . . yj . We include the special cases of H0,0 ,
meaning an alignment between two empty sequences, Hi,0 denoting an align-
ment of the first i characters of x with an empty sequence, and H0,j denoting
an alignment of an empty sequence with the first j characters of y. The scores
of the special cases are trivially computed as
H0,0 = 0 Hi,0 = −ci H0,j = −cj

For i, j ≥ 1, the optimal alignment of x1 x2 . . . xi with y1 y2 . . . yj either ends


with xi aligned to yj , xi aligned with a gap character, or yj aligned with a
gap character. By maximizing over these three possibilities, the score for the
optimal alignment of those prefixes can be written recursively as
Hi,j = max(Hi−1,j−1 + S(xi , yj ), Hi−1,j + c, Hi,j−1 + c) .
This recursive formula can be used in a straightforward dynamic program
to compute all the Hi,j . By additionally keeping track of which of the three
possibilities resulted in the maximum value for each Hi,j , the optimal global
alignment can be reconstructed by starting from Hn,m and working backwards.

© 2008 by Taylor & Francis Group, LLC


SEQUENCE ANALYSIS 215
This algorithm was used to compute the global pairwise alignment shown in
Figure 7.1B. The algorithm is efficient, requiring only O(mn) space and time.
The Smith-Waterman algorithm solves the local alignment problem similarly.
Let Hi,j denote the optimal global alignment of any suffixes of the strings
x1 . . . xi and y1 . . . yj , allowing for the empty suffixes. That is, Hi,j is the
score of a global alignment of xi′ . . . xi and yj ′ . . . yj for some 1 ≤ i′ ≤ i + 1
and 1 ≤ j ′ ≤ j + 1. The cases i′ = i + 1 or j ′ = j + 1 are interpreted as all
of x1 . . . xi or all of y1 . . . yj being discarded. An optimal local alignment of
x and y is found as an optimal global alignment of suffixes of x1 . . . xi and
y1 . . . yj , for some i and j. The Hi,j are initialized as
H0,0 = Hi,0 = H0,j = 0 .
The recurrence for computing the Hi,j is slightly modified from the Needleman-
Wunsch algorithm, to allow for the fact that the best alignment of suffixes of
x1 . . . xi with y1 . . . yj may be simply empty sequences, which have score zero.
Hi,j = max(Hi−1,j−1 + S(xi , yj ), Hi−1,j + c, Hi,j−1 + c, 0) .
By keeping track of which of the four branches resulted in the maximum value
for each Hi,j we can reconstruct the optimal local alignment. However, we do
not start at Hn,m . Rather, we find the i and j for which Hi,j is maximal
and work backwards from there. Intuitively, then, the dynamic programming
determines the best prefixes of x and y to discard, and beginning reconstruc-
tion at the maximal Hi,j determines the best suffixes of x and y to discard.
The time and space complexity of the algorithm is O(mn), just as for global
pairwise sequence alignment.

7.1.2 Multiple sequence alignment

In the global multiple sequence alignment problem, we are given m ≥ 3


sequences to align: x1 = x11 x12 . . . x1n1 , x2 = x21 x22 . . . x2n2 , . . . , xm =
xm1 xm2 . . . xmnm . The alignment is a set of sequences x′1 , x′2 , . . . x′n′ all of the
same length n′ , comprising the sequences x1 , x2 , . . . xm with zero or more gap
characters inserted between each character and at the start and end of each
sequence, as shown in Figure 7.1D. A local multiple sequence alignment of the
same sequences is a global alignment of substrings of each sequence—that is,
a global alignment after a prefix and suffix of each sequence is discarded (see
Figure 7.1E). Alignments are usually scored by the sum-of-pairs scheme, in
which the score of a multiple alignment is simply the sum of the scores of all
pairwise alignments implied by the multiple alignment.
The Needleman-Wunsch and Smith-Waterman dynamic programming algo-
rithms can be generalized to compute optimal multiple sequence alignments.
For the case of global alignments, we use an m-dimensional table, with Hi1 i2 ...im
denoting the score of the best global alignment of the prefixes x11 . . . x1i1 ,

© 2008 by Taylor & Francis Group, LLC


216 CONNECTIONS
x21 . . . x2i2 , . . . , xm1 . . . xmim . Initialization is similar to the pairwise case.
The recurrence for computing Hi1 i2 ...im is a maximum over all O(2m ) possi-
bilities for the inclusion or noninclusion of the final character of each suffix
in the final column of the alignment (the alternative being a gap character
and the necessity of including the last character in some previous column).
We omit spelling out the recurrence. The algorithm takes O(Πm i=1 ni ) space
and O(2m Πm i=1 ni ) time, as does the similar, generalized Smith-Waterman al-
gorithm for local multiple alignment. These methods were used to compute
the alignments shown in Figure 7.1D,E. However, the computations become
prohibitive when there are too many sequences to align or when they are
too long. Indeed, solving the multiple sequence alignment problem optimally
has been shown NP-compete [59], and so heuristic solutions are employed in
practice.
Currently, the most common heuristic approach is embodied by the CLUSTAL
family of algorithms, [26, 17]. In the CLUSTAL approach, pairwise alignments
are first used to create a distance matrix between the sequences, from which a
phylogenetic tree is estimated. The multiple alignment is then built from the
bottom up by a series of pairwise alignments, according to the structure of
the tree. In essence, at each internal node of the (binary) phylogenetic tree, an
alignment is made between the sequences on the left branch and the sequences
on the right branch. The sequences on each branch, however, are represented
compactly by a consensus sequence or a profile, so that the alignment can be
done in an efficient pairwise manner. There are different methods for aligning
consensus sequences or profiles, and recent versions of CLUSTAL improve the
quality of the alignments by attending to a number of biologically relevant
details such as the lengths of branches in the tree, position-dependent gap
penalties and weights that specify the importance of each input sequence [57].

7.1.3 Identification of transcription factor binding sites

Recall that transcriptional regulation is a primary means by which gene ex-


pression is regulated. A transcription factor affects transcription when it binds
the DNA at a transcription factor binding site (TFBS), a stretch of DNA usu-
ally between 6 and 20 nucleotides long. Each transcription factor binds to dif-
ferent TFBSs, and different TFBSs for the same transcription factor generally
do not have identical nucleotide sequences. Finding these TFBSs in the DNA
is a major challenge both experimentally and computationally, and is a key
step in understanding the functioning of transcriptional regulatory networks.
Computational methods for representing and identifying the characteristic
patterns of bases to which a given transcription factor binds began to be
developed in the 1970’s. (For reviews see [54, 13].) There are two main variants
of the problem. In one, we are given a set of nucleotide sequences of known
binding sites for a given transcription factor and are asked to create a model

© 2008 by Taylor & Francis Group, LLC


SEQUENCE ANALYSIS 217
which can then be used to predict, or identify, other binding sites for the factor.
In the second variant, we are given a set of nucleotide sequences which contain,
or are believed to contain, binding sites for a given transcription factor, but we
are not told exactly where those binding sites are. In the latter case, we may
also be given examples sequences that are believed to not contain any binding
sites for the transcription factor. Here we focus on the first variant, deferring
discussion of the second variant and other extensions to Section 7.3.2.

Once a set of TFBSs for a particular transcription factor is experimentally


determined, the pattern of nucleotides to which the factor binds can be statis-
tically characterized. This is usually done by a position weight matrix (PWM),
also known as a position-specific scoring matrix (PSSM). A PWM has 4 rows,
corresponding to the nucleotides A, C, G, T and as many columns as the
length of the experimentally determined TFBSs. In the simplest approach,
each entry Mi,j is set to the empirical frequency of nucleotide i in position j
among the experimentally determined TFBSs. This models the distribution
of the experimental TFBSs under the assumption that the positions are sta-
tistically independent, and employs the maximum likelihood estimate for the
probabilities of different nucleotides within each position. This model can be
viewed as a trivial HMM in which the hidden state deterministically transi-
tions through a series of states s1 , s2 , . . . , sn , where n is the number of columns
of the matrix and Mi,j is the probability of observing nucleotide i when the
state of the chain is j. The probability that the transcription factor would bind
to any particular stretch of DNA s1 s2 . . . sn ∈ {A, C, G, T }, or more properly,
the probability that the TFBS model would generate such a sequence, can be
computed as Πnj=1 Msj ,j . In a variant of the PWM idea, the matrix entries

are the logarithms of the empirical probabilities, Mi,j = log Mi,j , so that the
log
Pn probability of a transcription factor binding to a stretch of the DNA is
′ ′′
j=1 M sj ,j . Another variant considers M i,j = log(M i,j /p i ) = log Mi,j −log pi ,
where pi denotes the probability
Pn of nucleotide i under some background model.
Then the summation j=1 Ms′′j ,j can be interpreted as a log-odds ratio that
the DNA sequence is generated from the TFBS model versus the background
model. (Alternatively, the pi may be interpreted as relating to binding ener-
gies. See Stormo [54] for a more detailed discussion of these and related mod-
els.) Any of these models can be used to score candidate length-n stretches of
DNA in an effort to identify previously unknown TFBSs for the transcription
factor.

One potential problem is that when there are relatively few experimentally
determined TFBSs, some entries of the matrix M may be zero. (M ′ or M ′′
would have −∞ entries.) If Mi,j = 0, then the model predicts that the tran-
scription factor would never bind to a DNA sequence with nucleotide i in
position j. While this may be correct in some cases, the general observation
is that transcription factor binding is not so strict, and zeros in the PWM
can result in serious false negatives. One solution to this problem is to replace
the maximum likelihood parameter estimates with Bayesian parameter esti-

© 2008 by Taylor & Francis Group, LLC


218 CONNECTIONS
mates, one approach being to assume Dirichlet priors over the Mi,j , resulting
in a nonnegative estimated probability for binding any DNA sequence. Other
methods of introducing smoothing or pseudocounts to the Mi,j based more on
biological principles, such as nucleotide mutation rates, have a similar effect
and possibly better accuracy. (See Henikoff & Henikoff [25] for one example
and for further discussion.) It appears that the assumption that the positions j
are statistically independent is not a significant limitation. Attempts at fitting
models that allow for dependencies between positions, such as digram models
[55] or artificial neural networks [27], resulted in little or no improvement in
prediction performance.
On a genome scale, the identification of TFBSs based solely on PWM scores,
whether smoothed (e.g., by pseudocounts) or not, suffers from too high a
false positive rate. If one scores every length-n segment of the DNA of an
organism and selects only those segments with score higher than the score
of the lowest-scoring experimentally determined TFBS, many thousands or
millions of candidate TFBSs can easily result [54]. Most of these sites are
not actually bound by the factor, probably for reasons related to cofactors or
chromatin that are not readily apparent from the DNA sequence itself.
Any of several observations can dramatically reduce the false positive rate
for TFBS identification. First, functional TFBSs tend to be near a gene, in
particular, near to the transcription initiation site. Second, TFBSs tend to
occur in modules—stretches of DNA that include multiple binding sites for
the same or a variety of transcription factors [19, 7]. Thus, our confidence in a
particular identification can be increased if other candidate TFBSs are nearby.
Third, comparative genomics approaches, which look for sequence fragments
conserved in the promoter regions of orthologous genes across species, can help
to identify functional TFBSs [9]. Various schemes based on these observations
have been proposed, ranging from simple filtering criterion to more sophis-
ticated statistical models. While PWMs for representing the distribution of
nucleotides at binding sites remain the state of the art, the best methods for
combining PWM scores with other types of evidence—and exactly what those
other types of evidence should be—remain a topic of active research.

7.2 Analysis of High-Throughput Gene Expression Data

Problems related to sequence analysis and their solutions grew slowly in com-
plexity and sophistication over the course of several decades, as more sequence
data became available and as our scientific understanding of that data grew.
By contrast, the production of quantitative gene expression data was revo-
lutionized in the mid-1990s by the invention of high-throughput expression
assays, especially RNA expression microarrays and SAGE. These technolo-
gies offer great promise for understanding system-wide phenomena as well
as hunting down genes associated with different cellular response or diseases.

© 2008 by Taylor & Francis Group, LLC


ANALYSIS OF HIGH-THROUGHPUT GENE EXPRESSION DATA 219
However, the invention of these technologies also created an urgent demand for
techniques for handling the many machine learning and statistical challenges
posed by the data. First, there is significant “noise” in the data, interpreted
broadly to include natural variation in mRNA levels and unintentional vari-
ations in equipment, collection and measurement protocols and execution. A
second challenge is the large number of variables measured (mRNA expression
values for thousands or tens of thousands of genes) compared to the number
of samples (typically in the tens or low hundreds). Statistical significance is a
major and recurring concern in many analyses of gene expression data. Third,
when constructing models or predictions based on so many different vari-
ables, it can be difficult to extract human-useful knowledge or understanding.
Fourth, though the number of variables measured by these technologies is truly
astounding, they do not come close to measuring the abundances of all biolog-
ically relevant quantities, such as proteins, metabolites, etc. Finally, samples
average expression levels over populations of cells, let alone different com-
partments of cells, potentially obscuring much important information. While
there are technological solutions to some of these problems (e.g., microfluidic
approaches for measuring cell-specific expression), a wide variety of machine
learning methods have been successfully employed to address the challenges
in analyzing this data. Indeed, the area remains one of the most actively re-
searched, with hundreds, if not thousands, of papers published each year. We
begin our discussion with techniques for handling noise in one-color microar-
rays specifically, as they are the most commonly used of the high-throughput
expression measurement technologies. We then proceed to methods suitable
for addressing the other problems mentioned above, regardless of the partic-
ular technology generating the data.

7.2.1 Gene expression normalization

There are numerous sources of variability in one-color microarray data (and


in all other high-throughput technologies as well). Variability in chip man-
ufacture, in sample collection, in sample processing, in scanning and in the
technicians and machines carrying out the analysis all contribute noise to the
data. The true variations in mRNA concentrations between samples, which are
the signals of interest, must be estimated while accounting for this noise. The
initial stages of microarray data extraction and cleaning have become stan-
dardized in recent years. First, low-level image processes techniques are used
to extract probe-level intensities for each probe on each chip [53]. (Recall that
microarray chips contain a large number of spots, the probes, where RNAs
bind and are quantitated by fluorescent imaging.) Next, a series of normal-
ization steps synthesizes these readings to produce an estimated expression
level for each gene on each chip. Most normalization methods are based on
the supposition that most genes do not have different expression levels in dif-
ferent samples. Thus, the simplest normalization techniques rescale the probe

© 2008 by Taylor & Francis Group, LLC


220 CONNECTIONS
intensities extracted from each chip to have the same mean or the same mean
and variance (see [10] for several variants). The most popular normalization
routine is RMA [29], an acronym for Robust Multichip Average. RMA has
three steps: background “subtraction” and quantile normalization (both ap-
plied at the probe-level) and a method to integrate probe values to produce
single expression values for each gene. Background subtraction accounts for ef-
fects such as nonspecific binding or systematic bias in readings between chips.
Naive background subtraction methods literally subtract an estimated back-
ground signal level from the probe intensities, but this can lead to negative
adjusted probe intensities, which is especially problematic if one later intends
to transform expression values to a logarithmic scale. Instead, RMA assumes
the measured intensity of probe j for gene n on chip i is Pijn = sijn + bijn ,
where sijn is the true biological signal and bijn is confounding noise. Assum-
ing that for each array the sijn are distributed exponentially and the bijn
are distributed normally, the background-adjusted intensities are computed
as the expectation B(Pijn ) = E(sijn |Pijn ). Background subtraction adjusts
the probe intensities for each chip separately. The second step, quantile nor-
malization, operates on all chips simultaneously. In quantile normalization,
the ith largest probe intensity on each chip is set equal to the mean of the ith
largest probe intensities across chips. After this step, the adjusted probe inten-
sities on each chip have the exact same empirical distribution. Finally, RMA
takes the logarithm of the background-adjusted quantile-normalized probe in-
tensities, which we denote by Yijn and obtains a log expression score µin for
each gene n on each chip i using the model
Yijn = µin + αjn + ǫijn ,
where αjn is a probe-specific effect and ǫijn is a mean zero noise term. If
there are I arrays, J probes per gene and N genes, there are I × J × N such
equations. A straightforward least squares approach could be used to solve
for the (I + J) × N unknowns (the µin and αjn ), though RMA uses the more
robust median polish technique to avoid problems with outlier probes.

7.2.2 Gene expression analysis

Once the expression data matrix is obtained (we assume rows correspond to
genes and columns correspond to samples), subsequent analysis depends on
the questions the researcher wants to answer. A common starting point is to
plot or visualize the data. Clustering and dimensionality-reduction techniques
are useful in this regard—and may be useful as preprocessing for further anal-
ysis. It has become almost obligatory for publications involving microarray
data to include a heat map of the data matrix with the rows of the matrix or-
ganized according to a hierarchical clustering, typically constructed by single-
or average-linkage agglomerative clustering. (For an example based on the
yeast cell cycle data of Spellman et al. [53], see Figure 7.2A.) A dendrogram

© 2008 by Taylor & Francis Group, LLC


ANALYSIS OF HIGH-THROUGHPUT GENE EXPRESSION DATA 221

(A) (B)

Figure 7.2 (A) Heatmap and dendrogram for hiearchical clustering of microarray
data [53]. Rows correspond to 800 genes estimated to be cell-cycle regulated. Columns
correspond to 73 experimental conditions, corresponding to four time series in which
the yeast cells progressed through the cell cycle. The clustering is an average-link
agglomerative clustering based on Euclidean distance between expression profiles of
genes (rows of the data matrix). (B) Plots of each time series projected on to the first
two principal components (computed based on all the data). Dots represent samples
and lines connect the time series. A large dot marks the start of each time series and
an ‘X’ marks the end of each time series. The title of each plot refers to the means
used to synchronize the cells at the same stage of the cell cycle.

alongside the matrix indicates the structure of the hierarchical clustering, and
the branch heights indicate the dissimilarity of the clusters joined. If the sam-
ples are not naturally ordered—for example, they correspond to independent
samples and not a time series—then the columns are often clustered as well.
Dimensionality reduction can be used to reduce either the number of rows or
the number of columns in the data matrix. In the former case, which is the
more common of the two, we construct a new coordinate basis for representing
different samples. When the basis has two or three dimensions, the samples
can be plotted in that space, giving a visual sense of similarity between the
samples and the distribution of the data. For example, when the time series
comprising the Spellman et al. data [53] are plotted in two dimensions, the
series’ samples trace out one or two cycles around the origin. More medically
relevant applications include, for example, using principal components anal-
ysis to visualize similarities between different kinds of stem cells [39], and
using self-organizing maps to classify cancerous tumors [19]. Dimensionality
reduction and clustering, especially partitional clustering, can also be use-
ful preprocessing steps for solving prediction or network inference problems.
By reducing the number of independent variables, one reduces the chance of

© 2008 by Taylor & Francis Group, LLC


222 CONNECTIONS

(A) Differentially (B) Differentially


expressed? expressed?
yes no yes no

yes 36 622 yes 8 155


Cell cycle M-phase
associated? no 164 5178 associated? no 192 5645

=> p-value < 0.001 => p-value > 0.1

Figure 7.3 A hypothetical example of testing for gene enrichment. In a yeast


( Saccharomyces cerevisiae) microarray experiment, 200 genes are found to be dif-
ferentially expressed between two experimental conditions, out of 6000 genes total.
The experimenter believes that cell cycle effects may explain a statistically significant
fraction of the differential expressed genes. (A) Shows a 2-by-2 contingency table in
which each gene falls into exactly one category, depending on whether or not it was
differentially expressed and whether or not it is known to be associated with the yeast
cell cycle (according, for example, to the Gene Ontology[18]). The null hypothesis of
no association is rejected with a p-value of less than 0.001 according to Fisher’s exact
test or a Chi-square test, confirming the experimenter’s suspicion. The experimenter
further believes that the differentially expressed genes may be associated with the M
phase of the cell cycle. (B) This hypothesis is not supported, however, as there is
insufficient evidence to reject a null hypothesis of no association to known M phase
associated genes (B).

overfitting and can avoid situations in which the learning problem is under-
constrained.
Another approach to understanding microarray data is to test for the differen-
tial expression of genes between two or more conditions. If there are multiple
replicates from each of a pair of conditions, then simple t-tests, applied to
each gene, can determine which genes show a statistically significantly differ-
ent mean expression level. A slightly more sophisticated approach that has
been widely adopted is Significance Analysis of Microarrays (SAM) [58]. It
modifies the t-statistic slightly by including a correction to the sample stan-
dard deviation that accounts for greater variability in measurements of genes
expression at a low level. Permutation tests can be used to estimate the false
discovery rate. Other elaborations are aimed at the situation of very few repli-
cates (e.g., [5, 12]). The ANOVA can be used to detect significant changes in
differential expression among three or more conditions [31]. These approaches
generate lists of genes which appear to be differentially expressed, providing
a starting point for further biological investigation.
When lists of differentially expressed genes are very large—say, hundreds of
genes—extracting useful information is challenging. One approach is gene en-

© 2008 by Taylor & Francis Group, LLC


NETWORK INFERENCE 223
richment, where the goal is to identify known classes of genes that appear
over-represented in the differentially-expressed list. (See Figure 7.3 for an ex-
ample.) Often, the classes of genes are taken from an ontology, such as the
Gene Ontology (GO) database [18], which defines groups of genes from the
very general (e.g., genes involved in development) to the specific (e.g., proteins
found on the presynaptic membranes of neurons). The microarray data are
analyzed to produce a list of genes that are differentially expressed among the
conditions. For any particular gene class, a two-by-two contingency table can
be constructed, where each gene either is or is not in the class and each gene
is or is not on the differentially expressed list. From the contingency table, the
statistical significance of an association between the differentially expressed
list and the genes in the class can be determined, for example by Fisher’s exact
test or a chi-square test. When the number of gene classes tested is large, one
must be wary of the multiple comparison problem. Further, the tests for each
gene class are not independent. The classes in GO, for example, are organized
into a hierarchy. If a gene class is disproportionately represented, enriched, in
the differentially expressed list, then it is more likely that either parents or
children of that gene class are also enriched. One way to address these prob-
lems is to employ a False Discovery Rate framework, or similar approach to
multiple testing, in conjunction with permutation tests to account for corre-
lations in the statistics for different gene classes [62]. See Khatri and Draghici
[32] for a recent comparison of different techniques.

7.3 Network Inference

One of the ultimate aims of molecular biology is to identify all the chemi-
cal entities involved in life and how they relate or interact. In particular, the
problem of genetic network inference is to identify regulatory relationships be-
tween genes, often mediated by transcription factors, that control so much of
cellular function. Techniques in sequence analysis, especially for the discovery
of transcription factor binding sites, are one avenue for solving this problem.
In this section, we describe a variety of further techniques. First, we con-
sider techniques based on expression data alone. Then we describe techniques
that integrate different types of data (e.g., sequence and expression data) to
estimate regulatory relationships, as well as mentioning a few approaches for
inferring other types of networks, such as protein-protein interaction networks.

7.3.1 Inference from expression data

One of the dreams inspired by microarray data and other high-throughput


technologies is that, simply by observing the state of a biological system un-
der different conditions or over time, it should be possible to infer the existence
and nature of the interactions between components of the system (e.g., genes

© 2008 by Taylor & Francis Group, LLC


224 CONNECTIONS
or proteins). The structure of such a network specifies which genes directly
transcriptionally regulate which genes, and can be represented simply by lists,
or an interaction matrix, or by a directed graph.The problem of inferring this
structure from expression data, or more detailed knowledge of interactions,
is also called reverse engineering the network or solving the inverse prob-
lem. Indeed, the goals are similar to ideas of reverse engineering or system
identification in the engineering community, though the tools used are more
commonly drawn from statistics, machine learning and dynamical modeling.
There are several major caveats to the enterprise, however, which must be
kept in mind. First, no technology allows us to observe the full unadulterated
state of the system. For example, often mRNA expression is measured but
not protein expression, or vice versa. Spatial information, at the subcellular,
cellular or tissue levels, is often lost. Further, numerous sources of noise con-
found the measurements. Second, the chemistry of regulation is so complex
that any model we formulate glosses over many details and would never be
able to exactly capture the behavior of the system. Often, the approximations
made in modeling are gross, and the mismatch between the model formulation
and biological reality can lead to erroneous conclusions about both the struc-
ture and details of the real system. Finally, it turns out that many genes have
strongly correlated expression patterns, which makes it difficult to discrimi-
nate among different candidate regulators – an instance of the classic caveat
about confusing correlation with causation.
When the data for network inference is a matrix of expression values for a set of
genes over a set of conditions, the problem of network inference can be treated
as a general problem of testing for association between variables and modeling
relationships between them. We discuss four categories of approaches: (1)
pairwise tests of assocation, (2) modeling one gene’s expression as a function of
multiple other genes, (3) joint, or simultaneous, modeling of all the genes with
a probabilistic network model and (4) dynamical modeling. These techniques
may be applied directly when the number of genes measured is not too large
compared to the number of samples. However, most of these approaches make
little sense when applied to microarray data or the like, as the problem is vastly
underconstrained and the results would not be significant. For such data, it is
common to cluster genes and try to model (aggregate) regulatory relationships
between clusters of genes, based on prototypical expression patterns for the
clusters.
Pairwise tests of assocation: One heuristic for detecting regulatory rela-
tionships between genes is to look for genes whose expression is correlated—
the reasoning being that one of the genes may be directly activating the other
(e.g., [37, 6]). There are a number of problems with this reasoning, and the co-
expression networks that result are not always viewed as causal explanations
of the data. For the moment, however, let us pursue this heuristic. There are
many standard tests for a significant association between variables based on a
set of observations. For real-valued data, the linear correlation coefficient can

© 2008 by Taylor & Francis Group, LLC


NETWORK INFERENCE 225

(A) Colonies
COLL
ALP
OPN
BSP
OCN
FGFR1
PDGFRα
PTH1R
PTHrP

(B) (C)
OPN PDGFRα PTHrP COLL ALP

FGFR1 COLL ALP BSP

PTH-R OCN BSP OCN

Figure 7.4 (A) A binary gene expression matrix concerning nine genes (rows) in
a set of independent cultures of osteoblasts (patterned after Figure 2 of Madras et
al. [34]). Shaded boxes indicate genes that were expressed in each colonies; white
boxes indicate genes that were not expressed. (B) Fisher’s exact test, a pairwise
test of association, with a stringent p-value suggests pairs of genes whose expression
is correlated more than would be expected by chance [34]. Several genes have no
associations. OPN, for example, becomes expressed before the other genes and is
turned on in every colony, so there is no statistical basis for associating it to the
other genes. (C) A Bayesian network analysis of four of the genes with the strongest
pairwise associations, COLL, ALP, BSP and OCN, suggests a different and more
specific relationship among them, with COLL and ALP regulating BSP and BSP
regulating OCN [37]. There is insufficient evidence for regulation between COLL
and ALP, as suggested by the pairwise tests. More importantly, the COLL-OCN
and ALP-OCN correlations in the pairwise model are attributed to indirect effects,
through BSP, in the Bayesian network model.

be used to quantify degree of association, and p-values for the observed degree
of association under the null hypothesis of no assocation can be derived in a
number of ways. For discretized expression data, tests such as the chi-square,
Fisher’s exact test or a test based on mutual information are all possibilities.
(See Figure 7.4 for an example, and Nagarajan et al. [37] for more detailed
analyses.) The first two tests directly produce a p-value for the hypothesis of no
association between the variables. The mutual information between two ran-
dom variables, estimated based on the observed samples, measures strength
of association but not significance. Typically, a permutation test is used to
assess significance of the mutual information score.

The advantages of pairwise tests are their simplicity and computational effi-
ciency. They can be applied to microarray data, for example, to test for asso-
ciations between every pair of genes in an organism, even though the number
of pairs can easily be in the tens of millions. Only the mutual information test,

© 2008 by Taylor & Francis Group, LLC


226 CONNECTIONS
with its extra burden of the permutations to determine significance, is difficult
to apply on such a large scale at this time. Of course, testing many pairs of
genes leads to a multiple testing problem, and when applied to microarray
data, the results should not be seriously interpreted as reflecting biological re-
ality. Even with very strict p-value thresholds, many false positives are likely
to result. However, broad statistical patterns may be of interest (e.g., [39]).
One of the drawbacks to the pairwise association approach is that, at least
for the tests mentioned above, it does not discriminate which gene regulates
which. The tests are symmetric, so if gene pair (x, y) scores highly, so does
the pair (y, x). While there are pairs of genes that in reality directly regulate
each other, it is far from being the common case. The fact that many genes
have highly correlated expression patterns creates several problems for the
pairwise association approach. For one thing, if we have a set of highly corre-
lated genes, the pairwise tests would suggest that every pair in the set has a
regulatory relationship—a biologically implausible scenario. Further, even if
there is a true regulator x of gene y among the set, it would be difficult to
identify the correct gene x from among the set of correlated ones. Finally, if
there are two genes x and y which together regulate z, but neither x or y are
individually strongly correlated with z, the pairwise approach will not find
the true regulators. This seems to be a fairly common situation, as regula-
tors may be active only under specific conditions or in certain combinations.
The individual correlations are therefore not strong. Indeed, a more common
explanation for two genes having correlated expression patterns, called being
coexpressed, is that the gene share some common regulators—that is, they
are coregulated. This has motivated another approach to network inference in
which genes are first tested for coexpression, and then the promoter regions
of coexpressed genes are examined for signatures of common regulators. We
discuss this approach in Section 7.3.2.
Predicting each gene’s expression based on the expression of other
genes: A more general approach than testing for pairwise associations is to
solve the network inference problem as a set of regression problems (e.g.,
[33, 20]). For each gene i, we ask that its expression – column i in the gene
expression matrix – be predicted based on the expression of the other genes.
This produces a set of N univariate regression problems, each with N − 1
input attributes. The regression problem may be solved by any technique one
wishes, but often something simple such as linear regression or logistic re-
gression, or naive Bayes. The regulators of gene i are taken to be those genes
whose expression values are used by the predictor for gene i’s expression. Thus,
it is important that the predictor be regularized or somehow sparse, in the
sense that it selects a subset of all possible attributes to make its predictions.
Otherwise, if we employ a nonsparse predictor and the regression problem is
not degenerate, we could easily end up concluding that every gene regulates
every other gene. Conversely, if we employ no regularization and the data
matrix comes from a microarray experiment or something similar, there are
so many combinations of genes that could perfectly predict any given column

© 2008 by Taylor & Francis Group, LLC


NETWORK INFERENCE 227
in the matrix that we would obtain a arbitrary, meaningless set of regula-
tors for each gene. The prediction approach in principle improves upon the
pairwise approach in that it allows us to discover combinations of regulators
that explain well the behavior of a gene even if each individual factor does not.
The prediction approach can be computationally more involved than the pair-
wise approach, depending on the exact method, but is generally considered
tractable.

The prediction formulation of the problem has also been popular for theoret-
ical analysis, where one of the main questions has been how much data are
needed to infer network structure and/or parameters. Often, many simplifying
assumptions on the form of the data and the inference procedure are made for
the sake of the analysis. For example, Liang et al. [33] proposed the REVEAL
algorithm for the case that the expression matrix is binary and noiseless, in
which, for every gene i, the smallest set of other genes is sought such that
the entropy of i’s expression conditioned on the entropy of the other genes’
expression is zero. The expected number of samples needed to successfully
infer the network structure has been studied under a variety of assumptions
on the form of the data, including randomly sampled data [2, 40, 30], time
series data [41, 40] and knock-out or overexpression data [1, 28]. However,
these algorithms assume noiseless data and have not been applied directly in
practice.

Joint modeling of the gene expression distribution: Given the oft-cited


noisiness of gene expression data and the emphasis on inferring the structure
of the network, rather than just parameters, graphical probabilistic models
such as Bayeisan networks are a natural formalism for attempting network in-
ference (e.g., [22, 37]). Applying standard Bayesian network structure learning
methods to the gene expression matrix results in a candidate network struc-
ture. (See Figure 7.4 for an example.) Learned Bayesian networks are a more
complete description of the data distribution than obtained by the predic-
tion approach described above. Further, Bayesian network inference methods
(meaning computation of probabilities conditioned on observations, in con-
trast to inference of the network structure) allow principled estimation of
unobserved variables and prediction of network state in response to perturba-
tions such as gene knock outs or overexpression. A drawback is that Bayesian
network structure learning is a computationally difficult problem, so that for
all but the smallest networks, heuristics must be employed to search the space
of allowed structures (namely, all acyclic graphs with vertices corresponding to
variables). However, variations on the standard structure learning approaches,
specifically designed for inferring biological networks, have resulted in both
more efficient learning and more accurate learned models (e.g., [50, 43]). A
drawback to the Bayesian network formalism is that it requires the structure
of the network to be acyclic. This is a poor match for biological networks, in
which feedback loops abound. One solution is to focus on dynamical Bayesian
networks, which allow feedback loops while maintaining acyclicity, by encod-

© 2008 by Taylor & Francis Group, LLC


228 CONNECTIONS
ing them as influences from variables at previous time steps on variables at
subsequent time steps. We discuss this option further below.

Dynamical modeling of gene expression: Techniques for modeling dy-


namical systems apply when the expression data comprises one or more time
series. Time series analysis methods from statistics, specifically autoregres-
sive modeling, are the easiest to apply. In the form of discrete-time model, an
autoregressive-1 model, the expression of all genes at every time point is used
to predict the expression of all genes at the next time point. The problem is
thus one of multiple regression (or N univariate regression problems), which
can be solved in the same manner as described above in the prediction ap-
proach; the only difference is in the definition of the inputs and outputs for
the predictors. This approach is computationally efficient, like the prediction
approach. Because the model can be simulated, it can also be used to make
predictions, like the probabilistic modeling approach. However, there is no am-
biguity about the direction of regulatory inference (as in a Markov network)
and there is no problem with feedback loops (as in a Bayesian network), as
the latter can be represented, for example, by allowing the expression of genes
x and y at time t to influence the predictions of the expression of genes y and
x respectively at the next time point. Of course, far more sophisticated time
series models are possible, such as autoregressive or moving-average models
with longer histories (so that the prediction for the next time point depends
on expression values in the last several time points), or dynamical Bayes net-
works [36]. One should keep in mind, however, that expression time series are
often quite short, 10 time points or fewer and samples may not be spaced
evenly in time, whereas many time series modeling techniques are designed
for longer series and assume temporally-uniform sampling.

The major alternative to discrete-time models is what are called differential


equation models [35, 16]. These models have traditionally been preferred over
discrete-time models by the mathematical and computational biology com-
munities, due to their greater realism—expression levels and concentrations
in real biological systems change continuously in time, and are not discretely
clocked—though the preference is also partly due to influence from physics
and chemistry, in which many early mathematical and computational biolo-
gists were trained. In a typical ordinary differential equation model, the time
derivatives of the expression of all genes at time t, x(t), are given by some
parameterized function ẋ(t) = f (x(t), θ). Given an initial condition, x(0), the
differential equation can be solved either analytically or numerically, and the
parameters θ can be optimized to minimize some notion of error between the
model trajectory(-ies) and the observed expression series. Like the time-series
models and probabilistic models, differential equation models can be used to
make predictions about the effects of perturbations to the system. It is also
easy to accommodate temporally-nonuniform time series. A disadvantage is
that fitting differential equation models in this way is computationally diffi-
cult. The relationships between the error function and model parameters is

© 2008 by Taylor & Francis Group, LLC


NETWORK INFERENCE 229
often highly nonlinear, with many plateaus and local optima. Sophisticated
optimization algorithms with long running times, such as simulated annealing,
are the norm. However, advances in functional data analysis [45] offer much
more computationally tractable means for fitting the parameters of differential
equation models. The core idea is to create a smooth or interpolation of the
data, y(t) over the whole range of time for which data is observed, and fit the
differential equation to minimize the mismatch between ẏ(t) and f (y(t), θ).
This is more or less a regression problem, and so can be solved comparatively
efficiently—easily hundreds of times faster than the traditional formulation of
the fitting problem (see [42] for an application employing similar ideas).

7.3.2 Integrative modeling

There are limitations to what can be deduced from expression data alone, due
to factors such as: unobserved variables, noise, inaccuracy in the formulation
of the model and even inherent nonidentifiability. Conversely, there are many
other sources of information that are useful modeling networks, especially
in deducing network structure. Possibilities include: the genome sequence of
the organism and related organisms, especially the sequences of promoter
regions where transcription factors bind; localization data, such as from chip-
chip experiments; chromatin modification data; and, of course, the wealth of
knowledge already published in the biological literature. From this situation
arose the philosophy of integrative biology—the search for methods that can
somehow combine evidence about network structure or function from two or
more qualitatively different types of data.
One body of work that exemplifies this idea is the search for evidence of
co-regulation among genes that are empirically co-expressed. Recent large-
scale studies lend support to the idea that co-expressed genes tend to share
regulators (e.g., [3]). However, algorithms for finding potential regulatory el-
ements common to the promoter sequences of a given set of genes stretch
back decades. (See [54] for a recent review.) When the set of genes is based
on high-throughput expression data, a common approach is to begin by find-
ing a partitional clustering of the genes. Each gene in a cluster thus shares
similarities in expression pattern, which may be due to shared regulators.
The promoter regions of the genes in the cluster are analyzed for signatures of
shared regulation. These nucleotide signatures may be as simple as a consensus
sequence [60], a consensus sequence with wildcard or “don’t care” characters
[46, 11], or position weight matrices (perhaps representing a TFBS) [4, 47, 56].
In one formulation of the problem, we seek maximally specific patterns that
are common to all or a specified fraction of the promoters in the gene clus-
ter. Maximally specific may refer to the length of a consensus pattern, for
example, or the entropy of a position weight matrix (which should be low).
In another formulation of the problem, we seek patterns that are common to
the promoters in the gene cluster but absent, mostly absent or unlikely in a

© 2008 by Taylor & Francis Group, LLC


230 CONNECTIONS
set of promoter sequences from genes not in the cluster or in a background
sequence model.
Several studies have proposed methods for network inference that incorporate
other types of data. No standard algorithm or model has yet emerged, in part
because each study aims at integrating different types of data. As such, we
simply describe several representative studies. In one trend-setting paper, Se-
gal et al. [49] developed a probabilistic relational model (PRM), which can be
viewed as a compact representation of a Bayesian network, that combined ev-
idence from promoter sequences, localization data and microarray expression
data. Learning the parameters of the PRM implicitly determined transcrip-
tional regulatory relationships between genes. In another paper, Segal et al.
[51] combined expression data with binary protein-protein interaction data us-
ing a Markov network, to identify “pathways.” Bernard and Hartemink [8] used
dynamic Bayesian networks to model expression time series data in conjunc-
tion with localization data. The network modeled the distribution of the time
series data, while the localization data was incorporated through the learn-
ing scheme, via prior probabilities over structure space. While these studies
share their use of probabilistic modeling formalisms to combine different data
sources, theirs is not the only approach. Qi et al. [44], for example, approach
the problem of estimating protein-protein interaction networks by formulating
it as a classification problem. For each pair of proteins, the desired output is
binary—whether or not the proteins interact. A classier system (in their case,
a combination of random forests and k-nearest neighbor) is trained based on
known interactions, and can take any number of different types of evidence as
input, including direct experimental evidence and indirect evidence based on
expression data, shared functional annotations, sequence data, etc.

7.4 Exercises

1. The Needleman-Wunsch algorithm for global pairwise alignment requires


space O(mn) where m and n are the lengths of the strings to be aligned.
Suppose we were interested only in the score of the optimal alignment, and
not the alignment itself. Describe how to modify the algorithm to use only
O(min(m, n)) space.

2. Generalize our description of the Needleman-Wunsch algorithm to allow


for an affine gap penalty function.

3. Suppose that a set of binding sites for a transcription factor has been exper-
imental determined, having the sequences: GGATTT, GGATTA, GCATTA,
CGAATA, GCAATA, GGTTTA and GCACTA. (a) Determine a consensus
sequence for these binding sites by identifying the most commonly occurring
nucleotide in each position. (b) Assume a null hypothesis in which a genome

© 2008 by Taylor & Francis Group, LLC


REFERENCES 231
of length 109 nucleotides is generated randomly with each character i.i.d. and
equally likely. What is the expected number of occurrences of the consensus
sequence? (c) Calculate a position weight matrix in which the entries are the
log probabilities of each nucleotide (A,C, G or T) occurring in each position.

4. Obtain the Spellman et al. [53] yeast cell cycle data. Compute the princi-
pal components of the whole data set, not just those based on the 800 genes
estimated to be cell cycle regulated. Plot each time series along the first two
principal components. How do your plots compare to those in Figure 7.2B?

5. Generate a random binary data matrix of n rows and 6 columns as fol-


lows. Let Xi1 through Xi6 represent the entries of row i. Let Xi1 be 1 with
probability p and 0 otherwise. Let Xi2 = Xi1 with probability p and the op-
posite otherwise. Let Xi3 = Xi1 OR Xi2 . Let Xi4 = Xi1 AND NOT Xi2 . Let
Xi5 = Xi1 XOR Xi2 . Let Xi6 be 0 or 1 with equal probability, independent
of the other variables. The correct dependencies among the random variable
is given by the influence diagram below.

X3
X1
X4 X6

X2
X5

(a) Use a pairwise dependency test, such as Fisher’s exact test or a mutual
information-based test, to detect statistically significant associations between
the variables. Which dependencies are correctly identified, which are missed
and which are falsely asserted? How do the answers to these questions depend
on n and p?

(b) Use a Bayesian network structure learning procedure to learn the re-
lationships between the variables. Again, which dependencies are correctly
identified, which are missed and which are falsely asserted, and how do the
answers to these questions depend on n and p?

References

[1] T. Akutsu, S. Kuhara, O. Maruyama, and S. Miyano. Identification of gene


regulatory networks by strategic gene disruptions and gene overexpressions. In

© 2008 by Taylor & Francis Group, LLC


232 CONNECTIONS
Proceedings of the Ninth ACM-SIAM Symposium on Discrete Algorithms, pages
695–702, 1998.
[2] T. Akutsu, S. Miyano, and S. Kuhara. Identification of genetic networks from a
small number of gene expression patterns under the boolean network model. In
Proceedings of the Pacific Symposium on Biocomputing, pages 17–28, 1999.
[3] D. J. Allocco, I. S. Kohane, and A. J. Butte. Quantifying the relationship between
co-expression, co-regulation and gene function. BMC Bioinformatics, 5:18, 2007.
[4] T. L. Bailey and C. Elkan. Unsupervised learning of multiple motifs in biopoly-
mers using expectation maximization. Machine Learning, 21:51–80, 1995.
[5] P. Baldi and A. D. Long. A bayesian framework for the analysis of microarray
expression data: regularized t-test and statistical inferences of gene changes.
Bioinformatics, 17(6):509–519, 2001.
[6] K. Basso, A.A. Margolin, G. Stolovitzky, U. Klein, R. Dalla-Favera, and A. Cal-
ifano. Reverse engineering of regulatory networks in human B cells. Nature
Genetics, 37(4):382–390, 2005.
[7] B. P. Berman, Y. Nibu, B. D. Pfeiffer, P. Tomancak, S. E. Celniker, M. Levine,
G. M. Rubin, and M. B. Eisen. Exploiting transcription factor binding site
clustering to identify cis-regulatory modules involved in pattern formation in the
Drosophila genome. Proceedings of the National Academy of Sciences, 99(2):757–
762, 2002.
[8] A. Bernard and A. J. Hartemink. Informative structure priors: Joint learning of
dynamic regulatory networks from multiple types of data. In Pacific Symposium
on Biocomputing 10, pages 459–470, 2005.
[9] M. Blanchette and M. Tompa. Discovery of regulatory elements by a computa-
tional method for phylogenetic footprinting. Genome Research, 12(5):739–748,
2002.
[10] B. M. Bolstad, R. A. Irizarry, M. Astrand, and T. P. Speed. A comparison
of normalization methods for high density oligonucleotide array data based on
variance and bias. Bioinformatics, 19(2):185–193, 2003.
[11] A. Brazma, I. Jonassen, J. Vilo, and E. Ukkonen. Predicting gene regulatory
elements in silico on a genomic scale. Genome Research, 8:1202–1215, 1998.
[12] R. Breitling, P. Armengaud, A. Amtmann, and P. Herzyk. Rank products:
a simple, yet powerful, new method to detect differentially regulated genes in
replicated microarray experiments. FEBS Letters, 573(1–3):83–92, 2004.
[13] M. L. Bulyk. Computational prediction of transcription factor binding site
locations. Genome Biology, 5, 2003.
[14] C. Burge and S. Karlin. Prediction of complete gene structures in human ge-
nomic dna. Journal of Molecular Biology, 268:78–94, 1997.
[15] C. B. Burge and S. Karlin. Finding the genes in genomic dna. Current Opinion
in Structural Biology, 8:346–354, 1998.
[16] T. Chen, H. L. He, and G. M. Church. Modeling gene expression with differential
equations. In Proceedings of the Pacific Symposium on Biocomputing, pages 29–
40, 1999.
[17] R. Chenna, H. Sugawara, T. Koike, R. Lopez, T. J. Gibson, D. G. Higgins,
and J. D. Thompson. Multiple sequence alignment with the clustal series of
programs. Nucleic Acids Research, 31:3497–3500, 2003.
[18] The Gene Ontology Consortium. Gene ontology: tool for the unification of
biology. Nature Genetics, 25:25–29, 2000.
[19] E. M. Crowley, K. Roeder, and M. Bina. A statistical model for locating regu-

© 2008 by Taylor & Francis Group, LLC


REFERENCES 233
latory regions in genomic dna. Journal of Molecular Biology, 268(1):8–14, 1997.
[20] P. D’Haeseleer, X. Wen, S. Fuhrman, and R. Somogyi. Linear modeling of
mRNA expression levels during CNS development and injury. In Proceedings of
the Pacific Symposium on Biocomputing, pages 41–52, 1999.
[21] R. Durbin, S. Eddy, A. Krogh, and G. Mitchison. Biological sequence analysis.
Cambridge University Press, 1998.
[22] N. Friedman, M. Linial, I. Nachman, and D. Pe’er. Using Bayesian Networks
to Analyze Expression Data. Journal of Computational Biology, 7(3-4):601–620,
2000.
[23] T. R. Golub, D. K. Slonim, P. Tamayo, C. Huard, M. Gaasenbeek, J. P. Mesirov,
H. Coller, M. L. Loh, J. R. Downing, M. A. Caligiuri, C. D. Bloomfield, and E. S.
Lander. Molecular classification of cancer: Class discovery and class prediction
by gene expression monitoring. Science, 286:531–537, 1999.
[24] X. Gu and W.-H. Li. Estimation of evolutionary distances under stationary
and nonstationary models of nucleotide substitution. Proceedings of the National
Academy of Sciences, 95(11):5899–5905, 1998.
[25] J. G. Henikoff and S. Henikoff. Using substitution probabilities to improve
position-specific scoring matrices. CABIOS, 12(2):135–143, 1996.
[26] D. G. Higgins and P. M. Sharp. Clustal: a package for performing multiple
sequence alignment on a microcomputer. Gene, 73:237–244, 1988.
[27] P. B. Horton and M. Kanehisa. An assessment of neural network and statistical
approaches for prediction of E. coli promoter sites. Nucleic Acids Research,
20:4331–4338, 1992.
[28] T. E. Ideker, V. Thorsson, and R. M. Karp. Discovery of regulatory interactions
through perturbation: inference and experimental design. In Proceedings of the
Pacific Symposium on Biocomputing, pages 302–313, 2000.
[29] R. A. Irizarry, B. Hobbs, F. Collin, Y. D. Beazer-Barclay, K. J. Antonellis,
U. Scherf, and T. P. Speed. Exploration, normalization, and summaries of high
density oligonucleotide array probe level data. Biostatistics, 4(2):249–264, 2003.
[30] W. Just. Reverse engineering discrete dynamical systems from data sets with
random input vectors. Journal of Computational Biology, 13(8):1435–1456, 2006.
[31] M. K. Kerr, M. Martin, and G. A. Churchill. Analysis of variance for gene
expression microarray data. Journal of Computational Biology, 7(6):819–837,
2001.
[32] P. Khatri and S. Draghici. Ontological analysis of gene expression data: current
tools, limitations and open problems. Bioinformatics, 21(18):3587–3595, 2005.
[33] S. Liang, S. Fuhrman, and R. Somogyi. REVEAL, a general reverse-engineering
algorithm for inference of genetic network architectures. In Proceedings of the
Pacific Symposium on Biocomputing, pages 18–29, 1998.
[34] N. Madras, A. L. Gibbs, Y. Zhou, P. W. Zandstra, and J. E. Aubin. Modeling
stem cell development by retrospective analysis of gene expression profiles in
single progenitor-derived colonies. Stem Cells, 20:230–240, 2002.
[35] E. Mjolsness, D. H. Sharp, and J. Reinitz. A connectionist model of develop-
ment. Journal of Theoretical Biology, 152:429–453, 1991.
[36] K. Murphy and S. Mian. Modelling gene expression data using dynamic bayesian
networks. 1999.
[37] R. Nagarajan, J. E. Aubin, and C. A. Peterson. Modeling genetic networks
from clonal analysis. Journal of Theoretical Biology, 230(3):359–373, 2004.
[38] S. Needleman and C. Wunsch. A general method applicable to the search for

© 2008 by Taylor & Francis Group, LLC


234 CONNECTIONS
similarities in the amino acid sequence of two proteins. Journal of Molecular
Biology, 48(3):443–53, 1970.
[39] C. Perez-Iratxeta, G. Palidwor, C. J. Porter, N. A. Sanche, M. R. Huska, B. P.
Suomela, E. M. Muro, P. M. Krzyzanowski, E. Hughes, P. A. Campbell, M. A.
Rudnicki, and M. A. Andrade. Study of stem cell function using microarray
experiments. FEBS Letters, 579:1795–1801, 2005.
[40] T. J. Perkins, M. Hallett, and L. Glass. Dynamical properties of model gene
networks and implications for the inverse problem. BioSystems, 84(2):115–123,
2006.
[41] T. J. Perkins, M. T. Hallett, and L. Glass. Inferring models of gene expression
dynamics. Journal of Theoretical Biology, 230:289–299, 2004.
[42] Theodore J. Perkins, Johannes Jaeger, John Reinitz, and Leon Glass. Reverse
engineering the gap gene network of Drosophila melanogaster. PLoS Computa-
tional Biology, 2(5):e51, 2006.
[43] D. Peer, A. Tanay, and A. Regev. MinReg: A scalable algorithm for learning
parsimonious regulatory networks in yeast and mammals. Journal of Machine
Learning Research, 7:167–189, 2006.
[44] Y. Qi, J. Klein-Seetharaman, and Z. Bar-Joseph. Random forest similarity for
protein-protein interaction prediction from multiple sources. In Pacific Sympo-
sium on Biocomputing 10, pages 531–542, 2005.
[45] J. O. Ramsay and B. W. Silverman. Functional Data Analysis. Springer-Verlag,
2005.
[46] I. RIgoutsos and A. Floratos. Combinatorial pattern discovery in biological
sequences: the teiresias algorithm. Bioinformatics, 14(1):55–67, 1998.
[47] F. P. Roth, J. D. Hughes, P. W. Estep, and G. M. Church. Finding dna regu-
latory motifs within unaligned noncoding sequences clustered by whole-genome
mrna quantitation. Nature Biotechnology, 16:939–945, 1998.
[48] A. A. Salamov and V. V. Solovyev. Ab initio gene finding in Drosophila genomic
dna. Genome Research, 10:516–522, 2000.
[49] E. Segal, Y. Barash, I. Simon, N. Friedman, and D. Koller. From promoter se-
quence to expression: A probabilistic framework. In Proceedings of the Sixth An-
nual International Conference on Computational Molecular Biology (RECOMB),
2002.
[50] E. Segal, M. Shapira, A. Regev, D. Peer, D. Botstein, D. Koller, and N. Fried-
man. Module networks: identifying regulatory modules and their condition-
specific regulators from gene expression data. Nature Genetics, 34(2):166–76,
2003.
[51] E. Segal, H. Wang, and D. Koller. Discovering molecular pathways from protein
interaction and gene expression data. Bioinformatics, 19(1):i264–i272, 2003.
[52] T. F. Smith and M. S. Waterman. Identification of common molecular subse-
quences. Journal of Molecular Biology, 147:195–197, 1981.
[53] P. T. Spellman, G. Sherlock, M. Q. Zhang, V. R. Iyer, K. Anders, M. B. Eisen,
P. O Brown, D. Botstein, and B. Futcher. Comprehensive identification of cell
cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hy-
bridization. Molecular Biology of the Cell, 9:3273–3297, 1998.
[54] G. D. Stormo. Dna binding sites: representation and discovery. Bioinformatics,
16(1):16–23, 2000.
[55] G. D. Stormo, T. D. Schneider, and L. Gold. Quantitative analysis of the
relationship between nucleotide sequence and functional activity. Nucleic acids

© 2008 by Taylor & Francis Group, LLC


REFERENCES 235
research, 14:6661–6679, 1986.
[56] S. Tavazoie, J. D. Hughes, M. J. Campbell, R. J. Cho, and G. M. Church. Sys-
tematic determination of genetic network architecture. Nature Genetics, 22:281–
285, 1999.
[57] J. D. Thompson, D. G. Higgins, and T. J. Gibson. Clustal w: Improving the sen-
sitivity of progressive multiple sequence alignment through sequence weighting,
position-specific gap penalties and weight matrix choice. Nucleic Acids Research,
22:4673–4680, 1994.
[58] V. G. Tusher, R. Tibshirani, and G. Chu. Significance analysis of microarrays
applied to the ionizing radiation response. Proceedings of the National Academy
of Sciences, 98:5116–5121, 2001.
[59] L. Wang and T. Jiang. On the complexity of multiple sequence alignment.
Journal of Computational Biology, 1:337–348, 1994.
[60] T. G. Wolfsberg, A. E. Gabrielian, M. J. Campbell, R. J. Cho, J. L. Spouge, and
D. Landsman. Candidate regulatory sequence elements for cell cycle-dependent
transcription in Saccharomyces cerevisia. Genome research, 9(8):775–792, 1999.
[61] Y. H. Yang, M. J. Buckley, S. Dudoit, and T. P. Speed. Comparison of methods
for imagine analysis on cdna microarray data. Journal of Computational and
Graphical Statistics, 11(1):108–136, 2002.
[62] S. Zhong, L. Tian, C. Li, K.-F. Storch, and W. H. Wong. Comparative analysis
of gene sets in the gene ontology space under the multiple hypothesis testing
framework. In Proceedings of the 2004 IEEE Computational Systems Bioinfor-
matics Conference (CSB’04), pages 425–435, 2004.

© 2008 by Taylor & Francis Group, LLC


CHAPTER 8

Machine Learning in Structural


Biology: Interpreting 3D Protein
Images

Frank DiMaio, Ameet Soni and Jude Shavlik


University of Wisconsin – Madison

8.1 Introduction

This chapter discusses an important problem that arises in structural biol-


ogy: given an electron density map – a three-dimensional “image” of a pro-
tein produced from crystallography – identify the chain of protein atoms con-
tained within the image. Traditionally, a human performs this interpretation,
perhaps aided by a graphics terminal. However, over the past 15 years, a
number of research groups have used machine learning to automate density
map interpretation. Early methods had much success, saving thousands of
crystallographer-hours, but required extremely high-quality density maps to
work. Newer methods aim to automatically interpret poorer and poorer quality
maps, using state-of-the-art machine learning and computer vision algorithms.
This chapter begins with a brief introduction to structural biology and x-ray
crystallography. This introduction describes in detail the problem of density
map interpretation, a background on the algorithms used in automatic in-
terpretation and a high-level overview of automated map interpretation. The
chapter also describes four methods in detail, presenting them in chronolog-
ical order of development. We apply each algorithm to an example density
map, illustrating each algorithm’s intermediate steps and the resultant in-
terpretation. Each algorithm’s section presents pseudocode and program flow
diagrams. The chapter concludes with a discussion of the advantages and
shortcomings of each method, as well as future research directions.

8.2 Background

Knowledge of a protein’s folding – that is, the sequence-determined three-


dimensional structure – is valuable to biologists. A protein’s structure provides

237

© 2008 by Taylor & Francis Group, LLC


238 MACHINE LEARNING IN STRUCTURAL BIOLOGY
great insight into the mechanisms by which a protein acts, and knowing these
mechanisms helps increase our basic understanding of the underlying biology.
Structural knowledge is increasingly important in disease treatment, and has
led to the creation of catalysts with industrial uses. No existing computer
algorithm can accurately map sequence to 3D structure; however, several ex-
perimental “wet lab” techniques exist for determining macromolecular struc-
ture. The most commonly used method, employed for about 80% of structures
currently known, is x-ray crystallography. This time-consuming and resource-
intensive process uses the diffraction pattern of x-rays off a crystallized matrix
of protein molecules to produce an electron density map. This electron density
map is a three-dimensional “picture” of the electron clouds surrounding each
protein atom. Producing a protein structure is then a matter of identifying
the location of each of the protein’s atoms in this 3D picture.
Density map interpretation – traditionally performed by a crystallographer –
is time-consuming and, in noisy or poor-quality maps, often error-prone. Re-
cently, a number of research groups have looked into automatically interpret-
ing electron density maps, using ideas from machine learning and computer
vision. These methods have played a significant role in high-throughput struc-
ture determination, allowing novel protein structures to quickly be elucidated.

8.2.1 Protein structure

Proteins (also called polypeptides) are constructed from a set of building blocks
called amino acids. Each of the twenty naturally-occurring amino acids con-
sists of an amino group and a carboxylic acid group on one end, and a variable
chain on the other. When forming a protein, adjacent amino groups and car-
boxylic acid groups condense to form a repeating backbone (or mainchain),
while the variable regions become dangling sidechains. The atom at the inter-
face between the sidechain and the backbone is known as the alpha carbon,
or Cα for short (see Figure 8.1). The linear list of amino acids composing a
protein is often referred to as the protein’s primary structure (see Figure 8.2a).
A protein’s secondary structure (see Figure 8.2b) refers to commonly occur-
ring three-dimensional structural motifs taken by continuous segments in the
protein. There are two such motifs: α-helices, in which the peptide chain folds
in a corkscrew, and β-strands, where the chain stretches out linearly. In most
proteins, several β-strands run parallel or antiparallel to one another. These
regular structural motifs are connected by less-regular structures, called loops
(or turns). A protein’s secondary structure can be predicted somewhat accu-
rately from its amino-acid sequence [1].
Finally, a protein’s three-dimensional conformation – also called its tertiary
structure (see Figure 8.2c) – is uniquely determined from its amino acid se-
quence (with some exceptions). No existing computer algorithm can accurately

© 2008 by Taylor & Francis Group, LLC


BACKGROUND 239
Amino acid residue

OH H3C CH3 SH
Sidechains CH2 CH CH2

H H H
Backbone H N C C N C C N C C OH
H O H O H O
Amino end Alpha Peptide Carboxyl end
(N-terminus) carbon bond (C-terminus)

Figure 8.1 Proteins are constructed by joining chains of amino acids in peptide
bonds. A chain of three amino acid residues is illustrated.

(a) MET−SER−SER−SER−SER−SER−VAL−PRO−ALA−TYR−LEU−GLY−ALA−
LEU−GLY−TYR−MET−ALA−MET−VAL−PHE−ALA−CYS−...
(c)

(b) MET−SER−SER−SER−SER−SER−VAL−PRO−ALA−TYR−LEU−GLY−ALA−

LEU−GLY−TYR−MET−ALA−MET−VAL−PHE−ALA−CYS−...

Figure 8.2 An illustration of: (a) a protein’s primary structure, the linear amino-
acid sequence of the protein, (b) a protein’s secondary structure, which describes local
structural motifs such as alpha helices and beta sheets, and (c) a protein’s tertiary
structure, the global three-dimensional conformation of the protein.

map sequence to tertiary structure; instead, we must rely on experimental


techniques, primarily x-ray crystallography, to determine tertiary structure.

8.2.2 X-ray crystallography

An overview of protein crystallography appears in Figure 8.3. Given a suitable


target for structure determination, a crystallographer must produce and purify
this protein in significant quantities. Then, for this particular protein, one
must find a very specific setting of conditions (i.e., pH, solvent type, solvent
concentration) under which protein crystals will form. Once a satisfactory
crystal forms, it is placed in front of an x-ray source. Here, this crystal diffracts
a beam of x-rays, producing a pattern of spots on a collector. These spots – also
known as reflections or structure factors – represent the Fourier-transformed

© 2008 by Taylor & Francis Group, LLC


240 MACHINE LEARNING IN STRUCTURAL BIOLOGY

Figure 8.3 An overview of the crystallographic process.

electron density map. Unfortunately, the experiment can only measure the
intensities of these (complex-valued) structure factors; the phases are lost.
Determining these missing phases is known as the phase problem in crystallog-
raphy, and can be solved to a reasonable approximation using computational
or experimental techniques [2]. Only after estimating the phases can one com-
pute the electron-density map (which we will refer to as a “density map” or
simply “map” for short).
The electron density map is defined on a 3D lattice of points covering the
unit cell, the basic repeating unit in the protein crystal. The crystal’s unit cell
may contain multiple copies of the protein related by crystallographic sym-
metry, one of the 65 regular ways a protein can pack into the unit cell. Rota-
tion/translation operators relate one region in the unit cell (the asymmetric
unit) to all other symmetric copies. Furthermore, the protein may form a mul-
timeric complex (e.g., a dimer, tetramer, etc.) within the asymmetric unit. In
all these cases it is up to the crystallographer to isolate and interpret a single
copy of the protein.
Figure 8.4 shows a sample fragment from an electron density map, and the
corresponding interpretation of that fragment. The amino-acid (primary) se-
quence of the protein is typically known by the crystallographer before inter-
preting the map. In a high-quality map, every single (nonhydrogen) atom in
the protein can be placed in the map (Figure 8.4b). In a poor-quality map
it may only be possible to determine the general locations of each residue.
This is known as a Cα trace (Figure 8.4c). This information - though not as
comprehensive as an all-atom model - is still valuable to biologists.
The quality of experimental maps as well as the sheer number of atoms in
a protein makes interpretation difficult. Certain protein crystals produce a
very narrow diffraction pattern, resulting in a poor-quality, “smoothed” den-
sity map. This is quantified as the resolution of a density map, a numeric
value which refers to the minimum distance at which two peaks in the density

© 2008 by Taylor & Francis Group, LLC


BACKGROUND 241

(a) (b) (c)

Figure 8.4 An overview of electron density map interpretation. Given the amino-
acid sequence of the protein and a density map (a), the crystallographer’s goal is to
find the positions of all the protein’s atoms (b). Alternatively, a backbone trace (c),
represents each residue by its Cα location.

Figure 8.5 Electron density map quality at various resolutions. The “sticks” show
the position of the atoms generating the map.

map can be resolved. Figure 8.5 shows a simple density map at a variety of
resolutions.
Experimentally determined phases are often very inaccurate, and make inter-
pretation difficult as well. As the model is built, these phases are iteratively
improved [3], producing a better quality map, which may require resolving
large portions of the map. Figure 8.6 illustrates the effect poor phasing has on
density-map quality. In addition, noise in diffraction-pattern data collection
also introduces errors into the resulting density map.
Finally, the density map produced from x-ray crystallography is not an “im-
age” of a single molecule, but rather an average over an ensemble of all the
molecules contained within a single crystal. Flexible regions in the protein are
not visible at all, as they are averaged out.
For most proteins, this interpretation is done by an experienced crystallogra-
pher, who can, with high-quality data, fit about 100 residues per day. How-

© 2008 by Taylor & Francis Group, LLC


242 MACHINE LEARNING IN STRUCTURAL BIOLOGY

Figure 8.6 Electron density map quality as noise is added to the computed phases.
The “sticks” show the position of the atoms generating the map.

ever, for poor-quality structures or structures with poor phasing, interpreta-


tion can be an order of magnitude slower. Consequently, map interpretation
is the second-most time-consuming step in the crystallographic process (after
crystal preparation).
A key question for computational methods for interpreting density maps is the
following: how are candidate 3D models scored? Crystallographers typically
use a model’s R-factor (for residual index ) to evaluate the quality of an inter-
pretation. Formally, the R-factor is defined, given experimentally determined
structure factors Fobs and model-determined structure factors Fobs , as:
P
||Fobs | − |Fcalc ||
R= P . (8.1)
|Fobs |

The R-factor measures how well the proposed 3D structure explains the ob-
served electron-density data. Crystallographers usually strive to get R-factors
under 0.2 (or lower, depending on map resolution), while also building a
physically-feasible (i.e., valid bond distances, torsion angles, etc.) protein
model without adding too many water molecules. One can always reduce the
R-factor by placing extra water molecules in the density map; these reductions
are a result of overfitting the model to the data, and don’t correspond to a
physically feasible interpretation.
Another commonly used measure is free R-factor, or Rf ree . Here, 5-10% of
reflections are randomly held out as a test set before refinement. Rf ree is the
R-factor for these held-aside reflections. Using Rf ree tends to avoid overfitting
the protein’s atoms to the reflection data.

8.2.3 Algorithmic background

Algorithms for automatically interpreting electron density maps draw heavily


from the machine learning and statistics communities. These communities

© 2008 by Taylor & Francis Group, LLC


BACKGROUND 243
have developed powerful frameworks for modeling uncertainty, reasoning from
prior examples and statistically modeling data, all of which have been used
by researchers in crystallography. This section briefly describes the statistical
and machine learning methods used by the interpretation methods presented
in this paper. This section is intended as a basic introduction to these topics.
Interested readers should consult Russell and Norvig’s text [4] or Mitchell’s
text [5] for a thorough overview.

Probabilistic models

A model here refers to a system that simulates a real-world event or process.


Probabilistic models simulate uncertainty by producing different outcomes
with different probabilities. In such models, the probabilities associated with
certain events are generally not known, and instead have to be estimated from
a training set, a set of previously solved problem instances. Using maximum
likelihood estimation, the probability of a particular outcome is estimated as
the frequency at which that outcome occurs in the training set.
The unconditional or prior probability of some outcome A is denoted P (A).
Assigning some value to this probability, say P (A) = 0.3, means that in
the absence of any other information, the best assignment of probability of
outcome A is 0.3. As an example, when flipping a (fair) coin, P (“heads”) =
0.5. In this section, we use “outcome” to mean the setting of some random
variable; P (X = xi ) is the probability that variable X takes value xi . We will
use the shorthand P (xi ) to refer to this same value.
The conditional or posterior probability is used when other, previously un-
known, information becomes available. If other information, B, relevant to
event A is known, then the best assignment of probability to event A is given
by the conditional P (A|B). This reads “the probability of A, given B.” If more
evidence, C, is uncovered, then the best probability assignment is P (A|B, C)
(where “,” denotes “and”).
The joint probability of two or more events is the probability of both events
occurring, and – for two events A and B – is denoted P (A, B) and is read
“the probability of A and B.” Conditional and joint probabilities are related
using the expression:
P (A, B) = P (A|B)P (B) = P (B|A)P (A). (8.2)
This relation holds for any events A and B. Two events are independent if their
joint probability is the same as the product of their unconditional probabilities,
P (A, B) = P (A)P (B). If A and B are independent we also have P (A|B) =
P (A), that is, knowing B tells us nothing about A.
One computes the marginal probability by taking the joint probability and
summing out one or more variables. That is, given the joint distribution

© 2008 by Taylor & Francis Group, LLC


244 MACHINE LEARNING IN STRUCTURAL BIOLOGY
P (A, B, C), one computes the marginal distribution of A as:
XX
P (A) = P (A, B, C). (8.3)
B C

Above, the sums are over all possible outcomes of events B and C. The
marginal distribution is important because it provides information about the
distribution of some variables (A above) in the full joint distribution, with-
out requiring one to explicitly compute the (possibly intractable) full joint
distribution.
Finally, Bayes’ rule allows one to reverse the direction of a conditional:
P (B|A)P (A)
P (A|B) = . (8.4)
P (B)
Bayes’ rule is useful for computing a conditional P (A|B) when direct esti-
mation (using frequencies from a training set) is difficult, but when P (B|A)
can be estimated accurately. Often, one drops the denominator, and instead
computes the relative likelihood of two outcomes, for example, P (A = a1 |B)
versus P (A = a2 |B). If a1 and a2 are the only possible outcomes for A, then
exact probabilities can be determined by normalization; there is no need to
compute the prior P (B).

Case-based reasoning

Broadly defined, case-based reasoning (CBR) attempts to solve a new problem


by using solutions to similar past problems. Algorithms for case-based reason-
ing require a database of previously solved problem instances, and some dis-
tance function to calculate how “different” two problem instances are. There
are two key aspects of CBR systems. First, learning in such systems is lazy:
the models only generalize to unseen instances when presented with such a
new instance. Second, they only use instances “close” to the unseen instance
when categorizing it.
The most common CBR algorithm is k-nearest neighbor (kNN). In kNN,
problem instances are feature vectors, that is, points in some n-dimensional
space. The learning algorithm, when queried with a new problem instance
X = hxi , . . . , xn i for classification or regression, finds the k previously solved
problem instances closest to the query in Euclidean space. That is, one chooses
the examples minimizing the distance:
v
u n
uX
d(X||Y ) = t (xi − yi )2 . (8.5)
i=1

Then, the k neighbors “vote” on the query instance’s label: usually the ma-
jority class label (for classification) or average label (for regression) of the k
neighbors is used. One variant of kNN weights each neighbor’s vote by its

© 2008 by Taylor & Francis Group, LLC


BACKGROUND 245

! !

Figure 8.7 A multilayer, feed-forward neural network. The network consists of an


input layer fully connected to a hidden layer of sigmoid units, fully connected to an
output layer.

similarity to the query. Another variant learns weights for each dimension, to
be used when computing the distance between two instances.

Neural networks

An artificial neural network (ANN) is a nonlinear function estimator used


to approximate real or discrete target functions. Inspired by neurons in the
brain, ANNs consist of a number of units connected in a network. Each unit
is connected with multiple inputs and a single output. A given unit’s output
is some function of the weighted sum of the inputs. This function is known as
the unit’s activation function. For a perceptron – a simple, one-layer network
– this function is usually a step function.

More commonly, the network structure has multiple, feed-forward layers, as


shown in Figure 8.7. This network consists of a hidden layer which fully con-
nects the input and outputs. Learning the weights in the network requires a
differentiable activation function; often one uses a sigmoidal function:
1
σ(y) =. (8.6)
1 + e−y

Above, y is the weighted sum of inputs, y = N


P
i=0 wi xi .

The backpropagation algorithm learns the weights for a multilayer network,


given a network structure. Backpropagation uses gradient descent over the
network weight space to minimize the squared error between computed out-
put values and desired output values over some training set. The goal of
backpropagation is to find some point in weight space – that is, some set-
ting of all the weights in the network – that (locally) minimizes this squared
error.

© 2008 by Taylor & Francis Group, LLC


246 MACHINE LEARNING IN STRUCTURAL BIOLOGY
8.2.4 Approaches to automatic density map interpretation

A number of research groups have investigated automating the interpretation


of electron-density maps. This section presents a high-level overview of some
of these methods, while the remainder of this chapter takes an in-depth look at
four of these methods, describing algorithmically how they have approached
this problem.
By far the most commonly used method is arp/warp [6, 7, 8]. This atom-
based method heuristically places atoms in the map, connects them and re-
fines their positions. To handle poor phasing, arp/warp uses an iterative
algorithm, consisting of alternating phases in which (a) a model is built from
a density map, and (b) the density map’s phases are improved using the
constructed model. This algorithm is widely used, but has one drawback:
fairly high resolution data, about 2.3A or better, is needed. Given this high-
resolution data, the method is extremely accurate; however, many protein
crystals fail to diffract to this extent.
Several approaches represent the density map in an alternate form, in the
process making the map more easily interpretable for both manual and au-
tomated approaches. One of the earliest such methods, skeletonization, was
proposed for use in protein crystallography by Greer’s bones algorithm [9].
Skeletonization, similar to the medial-axis transformation in computer vision,
gradually thins the density map until it is a narrow ribbon approximately
tracing the protein’s backbone and sidechains. More recent work by Leherte
et al. [10] represents the density map as an acyclic graph: a minimum spanning
tree connecting all the critical points (points where the gradient of the density
is 0) in the electron density map. This representation accurately approximates
the backbone with 3A or better data, and separates protein from solvent up
to 5A resolution.
Cowtan’s fffear efficiently locates rigid templates in the density map [11].
It uses fast Fourier transforms (FFTs) to quickly match a learned template
over all locations in a density map. Cowtan provides evidence showing it lo-
cates alpha helices in poorly-phased 8A maps. Unfortunately, the technique is
limited in that it can only locate large rigid templates (e.g., those correspond-
ing to secondary-structure elements). One must trace loops and map the fit
to the sequence manually. However, a number of methods use fffear as a
template-matching subroutine in a larger interpretation algorithm.
X-autofit, part of the quanta [12] package, uses a gradient refinement
algorithm to place and refine the protein’s backbone. Their refinement takes
into account the density map as well as bond geometry constraints. They
report successful application of the method at resolutions ranging from 0.8 to
3.0A.
Terwilliger’s resolve contains an automated model-building routine [13, 14]
that uses a hierarchical procedure in which helices and strands are located and

© 2008 by Taylor & Francis Group, LLC


ARP/WARP 247
fitted, then are extended in an iterative fashion, using a library of tripeptides.
Finally, resolve applies a greedy fragment-merging routine to overlapping
extended fragments. The approach was able to place approximately 50% of
the protein chain in a 3.5A resolution density map.
Levitt’s maid [15] approaches map interpretation “as a human would,” by first
finding the major secondary structures, alpha helices and beta sheets, connect-
ing the secondary-structure elements, and mapping this fit to the provided
sequence. Maid reports success on density maps at around 2.8A resolution.
Ioerger’s textal [16, 17, 18] attempts to interpret poor-resolution (2.2 to
3.0A) density maps using ideas from pattern recognition. Ioerger constructs
a set of 15 rotation-invariant density features. Using these features at several
radii, a subroutine, capra, trains a neural network to identify Cα atoms.
Textal then identifies sidechains by looking at the electron density around
each putative alpha carbon, efficiently finding the most similar region in a
database, and laying down the corresponding sidechain.
Finally, acmi takes a probabilistic approach to density map interpretation
[19]. Residues of the protein are modeled as nodes in a graph, while edges
model pairwise structural interactions arising from chemistry. An efficient in-
ference algorithm determines the most probable backbone trace conditioned
on these interactions. Acmi finds accurate backbone traces in well-phased 3.0
to 4.0A density maps.
The rest of this chapter further describes four of these methods – arp/warp,
resolve, textal and acmi – in detail. Each section presents a method, de-
scribing strengths and weaknesses. High-level pseudocode clarifies important
subroutines. Throughout the chapter, a small running example is employed to
illustrate intermediate steps of the various algorithms. The example uses the
density map of protein 1xmt, a 95-amino-acid protein with two symmetric
copies in the unit cell.
The running example is not meant as a test of the algorithms (although a
comparison appears in [19]), but rather as a real-world illustrative example.
The example map is natively at 1.15A resolution. Full native resolution is used
for arp/warp; the map is downsampled to 2.5A resolution for resolve, and
3.5A resolution for textal and acmi. Maps are downsampled by smoothly
diminishing the intensities of higher-resolution reflections. The resolution val-
ues chosen are – for this particular map – the worst-quality maps for which
the respective algorithms produce an accurate trace. The 3.5A density map
and its crystallographer-determined solution appears in Figure 8.8.

8.3 arp/warp

The arp/warp (automated refinement procedure) software suite is a crystal-


lographic tool for the interpretation and refinement of electron density maps.

© 2008 by Taylor & Francis Group, LLC


248 MACHINE LEARNING IN STRUCTURAL BIOLOGY

Figure 8.8 A 3.5A resolution electron density map – containing two copies of a
95-amino-acid protein – and its crystallographer-determined solution. This map, at
various resolutions, will be used as a running example throughout the section.

Arp/warp’s warpntrace procedure was the first automatic interpretation


tool successfully used for protein models. Today, it remains one of the most
used tools in the crystallographic community for 3D protein-image interpre-
tation. Arp/warp concentrates on the best placement of individual atoms in
the map: no attempt is made to identify higher-order constructs like residues,
helices or strands. Arp/warp’s “atom-level” method requires high-quality
data, however. In general, arp/warp requires maps at a resolution of 2.3A
or higher to produce an accurate trace.
Figure 8.9 illustrates an overview of warpntrace. Warpntrace begins by
creating a free atom model – a model containing only unconnected atoms
– to fill in the density map of the protein. It then connects some of these
atoms using a heuristic, creating a hybrid model. This hybrid model consists
of a partially-connected backbone, together with a set of unconstrained atoms.
This hybrid model is refined, producing a map with improved phase estimates.
The process iterates using this improved map. At each iteration, warpntrace
removes every connection, restarting with a free-atom model.

8.3.1 Free-atom placement

Arp/warp contains a atom placement method based on arp, an interpreta-


tion method for general molecular models. Arp randomly places unconnected
atoms into the density map, producing a free atom model, illustrated in Fig-
ure 8.10a. To initialize the model, arp begins with a small set of atoms in the
density map. It slowly expands this model by looking for areas above a den-
sity threshold, at a bonding distance away from existing atoms. The density
threshold is slowly lowered until arp places the desired number of free atoms.

© 2008 by Taylor & Francis Group, LLC


ARP/WARP 249

!"!#$%&' (!')*$+ ,-.

/"-#! 0%!! -$&,) *'$& ,-.


0%!! -$&,) ,&(!"
2+:%*(
1&*' #2-*') &0 0%!! -$&,) 3!"#$#%!&'4 ,&(!"
2+:%*( ,&(!"
5!0*'! ,&(!" 6)*'7 #&''!#$*8*$+ #&')$%-*'$)
#&,."!$! :-#;:&'! ,&(!"
9%-#! )*(!#2-*')

#&,."!$! -""<-$&, ,&(!"

Figure 8.9 A flowchart of warpntrace.

For small molecules, arp’s next step is refining the free-atom model; that is,
iteratively moving atoms to better explain the density map. Free-atom refine-
ment ignores stereochemical information, and moves each atom independently
to produce a complete structure. Arp’s free-atom refinement, in addition to
moving atoms, considers adding or removing atoms from the model. Multiple
randomized initial structures are used to improve robustness. Further details
are available from Perrakis et al. [7].
However, with molecules as large as proteins, free-atom refinement alone is
insufficient to produce an accurate model. Performing free-atom refinement
with tens of thousands of atoms leads to overfitting, producing a model that is
not physically feasible. For determining protein structures, arp/warp makes
use of connectivity information in its refinement, using free-atom placement as
a starting point. The procedure warpntrace adds connectivity information
to the free atom model.

8.3.2 Main-chain tracing

Given a free-atom model of a protein, one can form a crude backbone trace
by looking for pairs of free atoms the proper distance apart. Warpntrace
formalizes this procedure, called autotracing, using a heuristic method. The
method is outlined in Algorithm 8.1. Warpntrace assigns a score – based
on density values – to each free atom. The highest scoring atom pairs 3.8 ±
0.5A apart become candidate Cα ’s. The algorithm verifies candidate pairs by
overlaying them with a peptide template. If the template matches the map,
warpntrace saves the candidate pair.
After computing a list of Cα pairs, warpntrace constructs the backbone
using a database of known backbone conformations (taken from solved protein
structures). Given a chain of candidate Cα pairs, warpntrace considers all

© 2008 by Taylor & Francis Group, LLC


250 MACHINE LEARNING IN STRUCTURAL BIOLOGY

!$#

!"#

!%#

Figure 8.10 Intermediate steps in arp/warp’s structure determination: (a) the free
atom model, where waters are placed in the map, (b) the hybrid model, after some
connections are determined and (c) the final determined structure.

backbone conformations in the database with matching Cα positions, ordered


by length. The longest candidate backbone is then added to the model. The
algorithm connects the corresponding free atoms, and removes these atoms
from the free-atom pool. The process repeats as long as there remain candidate
Cα chains at least 5 residues in length.
Autotracing produces a hybrid model, shown in Figure 8.10b. A hybrid model
contains a set of connected chains together with a set of free atoms. Auto-
tracing identifies some atom types and connectivity, which enables the use
of some stereochemical information in refinement. Added restraints increase
the number of observations available, and increase the probability of produc-
ing a good model. The tracing is initially very conservative, with many free
atoms remaining in the model. Adding too many restraints too early leads to
overfitting the model.
Finally, a modified version of arp refines this hybrid model. Arp uses the re-
fined structure to improve the experimentally determined phases, making the
map clearer to interpret. At each iteration of this “autotrace–refine–recompute
phases” cycle, warpntrace returns to a free-atom model, by removing pre-

© 2008 by Taylor & Francis Group, LLC


ARP/WARP 251

Algorithm 8.1: Warpntrace’s model-building algorithm


Given: electron density map M, free-atom model F, sequence seq
Find: all-atom model
for i = 1 to nIterations do
H←F // initialize hybrid model
CA pairs ← highest-scoring atom pairs 3.8 ± 0.5A apart
foreach ci ∈ CA pairs do
if (ci does not match backbone template) then
delete ci from CA pairs
end
end
while a Cα chain of length ≥ 5 remains in CA pairs do
bestChain ← longest fragment in DB overlapping CA pairs
remove bestChain’s atoms from CA pairs, H
add bestChain to H
end
H′ ← ref ine(H)
F ← remove connections from hybrid model H′
end
model ← sidechainTrace(H′)

vious traces. Since the map is better-phased, autotracing produces a more


complete model. This, in turn, provides a better refinement, improving the
phases further.

This cycle continues for a fixed number of iterations, or until a complete


trace is available. Finally, warpntrace adds on side-chains by identifying
patterns of free atoms around Cα ’s. It aligns these free-atom patterns to the
sequence to produce a complete model. Figure 8.10c illustrates the complete
arp/warp-determined trace on the running example.

8.3.3 Discussion

Arp/warp is the preferred method for automatically interpreting electron


density maps, assuming sufficiently high-resolution data are available. Its
placement of individual atoms, followed by atom-level refinement, produces
an extremely accurate trace with no user action required in 2.3A or better
density maps. It is widely used by crystallographers to rapidly construct a
protein model. Unfortunately, many protein crystals fail to produce maps of
sufficient quality, and one must consider alternate methods.

© 2008 by Taylor & Francis Group, LLC


252 MACHINE LEARNING IN STRUCTURAL BIOLOGY

!"!#$%&' (!')*$+ ,-.

/(!'$*0+ 1!"*23)$%-'( $!,."-$! ,-$#1!)


1!"*23)$%-'( "*)$
42$!'( ,-$#1!) *$!%-$*5!"+
.-%$*-"
.%&$!*' 0%-8,!'$ "*)$ ,&(!"
6))!,7"! #1-*' 0%&, 0%-8,!'$)
7-#:7&'! ,&(!"
9%-#! )*(!#1-*')

#&,."!$! -"";-$&, ,&(!"

Figure 8.11 A flowchart of Resolve.

8.4 resolve

While arp/warp is extremely accurate with high-resolution data, many pro-


tein crystals fail to diffract to a sufficient level for accurate interpretation. In
general, arp/warp requires individual atoms to be visible in the density map,
which happens at about 2.3A resolution or better. The next three methods
– resolve, textal and acmi – all aim to solve maps with > 2.3A resolu-
tion. All three methods take different approaches to the problem; however, all
three – in contrast to arp/warp – consider higher-level constructs than atoms
when building a protein model. This allows accurate interpretation even when
individual atoms are not visible.
Resolve is a method developed by Terwilliger for automated model-building
in poor-quality (around 3A) electron density maps [13, 14]. Figure 8.11 out-
lines the complete hierarchical approach. Resolve’s method hinges upon the
construction of two model secondary structure fragments – a short α-helix and
β-strand – for the initial matching. Resolve first searches over all of rotation
and translation space for these fragments; after placing a small set of over-
lapping model fragments into the map, the algorithm considers a much larger
template set as potential extensions. Resolve joins overlapping fragments
and, finally, identifies sidechains corresponding to each Cα – conditioned on
the input sequence – and places individual atoms into the model.

8.4.1 Secondary structure search

Given an electron density map, resolve begins its interpretation by searching


all translations and rotations in the map for a model 6-residue α-helix and
a model 4-residue β-strand. Resolve constructs these fragments by aligning
a collection of helices (or strands) from solved structures; it computes the

© 2008 by Taylor & Francis Group, LLC


RESOLVE 253

Figure 8.12 The averaged helix (left) and strand (right) fragment used in resolve’s
initial matching step.

electron density for each at 3A resolution, and averages the density across
all examples. The “average” models used by resolve are illustrated in Fig-
ure 8.12.
Given these model fragments, resolve considers placing them at each position
in the map. At each position it considers all possible rotations (at a 30◦ or 40◦
discretization) of the fragment, and computes a standardized squared-density
difference between the fragment’s electron density and the map:
X  1  
t(~x) = ǫf (~y ) ρ′f (~y ) − ρ(~y − ~x) − ρ̄(~x) . (8.7)
σf (~x)
y
~

Above, ρ(~x) is the map in which we are searching, ρ′f (~x) is the standardized
fragment electron density, ǫf (~x) is a masking function that is nonzero only
for points near the fragment and ρ̄(~x) and σf (~x) standardize the map in the
masked region ǫf centered at ~x:
P
y )ρ(~y − ~x)
y ǫf (~
~
ρ̄(~x) = P
y ǫf (~
~ y)
P  2
2 ~ y ) ρ(~y − ~x) − ρ̄(~x)
y ǫf (~
σf (~x) = P . (8.8)
y ǫf (~
~ y)
Resolve computes the matching function t(~x) quickly over the entire unit
cell using fffear’s FFT-based convolution [11].
After matching the two model fragments using a coarse rotational step-size,
the method generates a list of best-matching translations and orientations of
each fragment (shown in Figure 8.13a). Processing these matches in order,
Resolve refines each fragment’s position and rotation to maximize the real-
space correlation coefficient (RSCC) between template and map:
hρf · ρi − hρf ihρi
RSCC(ρf , ρ) = q p . (8.9)
2
hρf i − hρf i2 hρ2 i − hρi2

Here, hρi indicates the map mean over a fragment mask. Resolve only con-
siders refined matches with an RSCC above some threshold.

© 2008 by Taylor & Francis Group, LLC


254 MACHINE LEARNING IN STRUCTURAL BIOLOGY

!"#

!%#

!$#

Figure 8.13 Intermediate steps in resolve’s structure determination: (a) locations


in the map that match short helical/strand fragments (b) the same fragments after
refinement and extension and (c) the final determined structure.

8.4.2 Iterative fragment extension

At this point, resolve has a set of putative helix and strand locations in
the density map. The next phase of the algorithm extends these using a much
larger library of fragments, producing a model like that in Figure 8.13b. Specif-
ically, resolve makes use of four such libraries for fragment extension:

(a) 17 α-helices between 6 and 24 amino acids in length


(b) 17 β-strands between 4 and 9 amino acids in length
(c) 9,232 tripeptides containing backbone atoms only for N-terminus exten-
sion
(d) 4,869 tripeptides containing a partial backbone (the chain Cα − C − O
with no terminal N) plus two full residues for C-terminus extension

Resolve learns these fragment libraries from a set of previously solved protein
structures. It constructs the two tripeptide libraries by clustering a larger
dataset of tripeptides.

© 2008 by Taylor & Francis Group, LLC


RESOLVE 255
α-helix/β-strand extension

For each potential model’s placement in the map, resolve considers extend-
ing it using each fragment in either set (a), if the model fragment is a helix, or
set (b), if the model fragment is a strand. For each fragment, resolve chooses
the longest segment of the fragment such that every atom in the fragment has
a density value above some threshold.
To facilitate comparison between these 17 segments of varying length (one
for each√fragment in the library), each matching segment is given a score
Q = hρi N , with hρi the mean atom density, and N the number of atoms.
The algorithm computes a Z-score:
Q − hQi
Z= . (8.10)
σ(Q)
Resolve only considers segments with Z > 0.5. Notice there may be a large
number of overlapping segments in the model at this point.

Loop extension using tripeptide libraries

For each segment in the model, resolve attempts to extend the segment
in both the N-terminal and C-terminal direction using the tripeptide library.
Resolve tests each tripeptide in the library by superimposing the first residue
of the tripeptide on the last residue of the current model segment. It then tests
the top scoring “first-level” fragments for overlap (steric clashes) with the
current model segment. For those with no overlap, a lookahead step considers
this first-level extension as a starting point for a second extension. The score
for each first-level extension is:
scorefirst-level = hρfirst-level i + max hρsecond-leveli. (8.11)
second-level

Above, hρfirst-level i denotes the average map density at the atoms of the first-
level extension.
Resolve accepts the best first-level extension – taking the lookahead term
into account – only if the average density is above some threshold density
value. If the density is too low, and the algorithm rejects the best fragment,
several “backup procedures” consider additional first-level fragments, or step-
ping back one step in the model segment. If these backup procedures fail,
resolve rejects further extensions.

8.4.3 Chain assembly

Given this set of candidate model segments, resolve’s next step is assem-
bling a continuous chain. To do so, it uses an iterative method, illustrated in
Algorithm 8.2. The outermost loop repeats until no more candidate segments

© 2008 by Taylor & Francis Group, LLC


256 MACHINE LEARNING IN STRUCTURAL BIOLOGY

Algorithm 8.2: Resolve’s chain-assembly algorithm


Given: electron density map M, set of high scoring fragments F
Find: putative backbone trace X = {~xi } including Cβ positions
repeat
f ragbest ← top scoring unused segment
for each f ragi ∈ {F\f ragbest } do
if f ragi and f ragbest overlap at ≥ 2 Cα positions
and extension does not cause steric clashes then
extend f ragbest by f ragi
end
end
until no candidates remain

remain. At each iteration, the algorithm chooses the top-scoring candidate


segment not overlapping any others. It considers all other segments in the
model as extensions: if at least two Cα ’s between the candidate and extension
overlap, then resolve accepts the extension. Finally, the extension becomes
the current candidate chain.

8.4.4 Sidechain trace

Resolve’s final step is, given a set of Cα positions in some density map, to
identify the corresponding residue type, and to trace all the sidechain atoms
[14]. This sidechain tracing is the first time that resolve makes use of the
analyzed protein’s sequence. Resolve’s sidechain tracing uses a probabilistic
method, finding the most likely layout conditioned on the input sequence.
Resolve’s sidechain tracing procedure is outlined in Algorithm 8.3.
Resolve’s sidechain tracing relies on a rotamer library. This library consists
of a set of low-energy conformations – or rotamers – that characterizes each
amino-acid type. Resolve builds a rotamer library from the sidechains in 574
protein structures. Clustering produces 503 different low-energy side-chain
conformations. For each cluster member, the algorithm computes a density
map; each cluster’s representative map is the average of its members.
For each Cα , resolve computes a probability distribution of the correspond-
ing residue type. Probability computation begins by first finding the corre-
lation coefficient (see Equation 8.9) between the map and each rotamer. For
each rotamer j, the correlation coefficient at the kth Cα is given by ccjk . A
Z-score is computed, based on rotamer j’s correlation at every other Cα :
rot ccjk − hccj i
Zjk = . (8.12)
σj
The algorithm only keeps a single best-matching rotamer of each residue type.

© 2008 by Taylor & Francis Group, LLC


RESOLVE 257

Algorithm 8.3: Resolve’s sidechain-placement algorithm


Given: map M, backbone trace X = {~xi } (including Cβ ’s),
sidechain library F, sequence seq
Find: all-atom protein model
for each sidechain fj ∈ F do
for each Cα ~xk ∈ X do
ccjk ← RSCC(M(~xk ), fj )) // see Equation 8.9
Zjk ← (ccjk − hccj i)/σj
end
end
// Estimate probabilities Pik that residue type i is at position k
for each residue type i do
Pi0 ← a priori distribution of residue type i
Zik ← max Zjk
fragment j of type i
for each alpha carbon ~xk ∈ X do
2
exp(Zik /2)
Pik ← Pi0 · P P ·exp(Z 2 /2)
l0 lk
l
end
end
// Align trace to sequence, place individual atoms
align seq to chains maximizing product of Pik ’s
if (good alignment exists) then
place best-fit sidechain of alignment-determined type at each position
end

That is, for residue type i:


res rot
Zik = max Zjk (8.13)
fragment j is of type i

Resolve uses a Bayesian approach to compute probability from the Z-score.


Amino-acid distributions in the input sequence provide the a priori proba-
bility P0j of residue type j. Given a set of correlation coefficients at some
position, resolve computes the probability that the residue type is i by tak-
ing the product of probabilities that all other correlation coefficients were
generated by chance. It estimates this probability using the Z-score:
P (ccik ) ∝ exp(−(Z r esik )2 /2). (8.14)
Substituting and simplifying, the probability of residue type i at position k is:
res 2

exp (Zik ) /2
Pik ← Pi0 · P res 2
. (8.15)
l Pl0 · exp (Zlk ) /2

Finally, given these probabilities, resolve finds the alignment of sequence to

© 2008 by Taylor & Francis Group, LLC


258 MACHINE LEARNING IN STRUCTURAL BIOLOGY
structure that maximizes the product of probabilities. The final step is, given
an alignment-determined residue type at each position, placing the rotamer of
the correct type with the highest correlation coefficient Z-score. Resolve’s fi-
nal computed structure on the running example, both backbone and sidechain,
is illustrated in Figure 8.13c.

8.4.5 Discussion

Unlike arp/warp, resolve uses higher-order constructs than individual atoms


in tracing a protein’s chain. Searching for helices and strands in the map lets
resolve produce accurate traces in poor-quality maps, in which individual
atoms are not visible. This method is also widely used by crystallographers.
Resolve has been successfully used to provide a full or partial interpretation
at maps with as poor as 3.5A resolution. Because the method is based on
heuristics, when map quality gets worse, the heuristics fail and the interpre-
tation is poor. Typically, the tripeptide extension is the first heuristic to fail,
resulting in resolve traces consisting of disconnected secondary structure el-
ements. In poor maps, as well, resolve is often unable to identify sidechain
types. However, resolve is able to successfully use background knowledge
from structural biology in order to improve interpretation in poor-quality
maps.

8.5 textal

Textal – another method for density map interpretation – was developed


by Ioerger et al. Much like resolve, textal seeks to expand the limit of
interpretable density maps to those with medium to low resolution (2 to 3A).
The heart of textal lies in its use of computer vision and machine learning
techniques to match patterns of density in an unsolved map against a database
of known residue patterns. Matching two regions of density, however, is a
costly six-dimensional problem. To deal with this, textal uses of a set of
rotationally invariant numerical features to describe regions of density. The
electron density around each point in the map is converted to a vector of
19 features sampled at several radii that remain constant under rotations of
the sphere. The vector consists of descriptors of density, moments of inertia,
statistical variation and geometry. Using rotationally invariant features allows
for efficiency in determination – reducing the problem from 6D to 3D – and
better generalization of patterns of residues.
Textal’s algorithm – outlined in Figure 8.14 – attempts to replicate the
process by which crystallographers identify protein structures. The first step
is to identify the backbone – the location of each Cα – of the protein. Tracing
the backbone is done by capra (C-Alpha Pattern Recognition Algorithm),
which uses a neural network to estimate each subregion’s distance to the

© 2008 by Taylor & Francis Group, LLC


TEXTAL 259

!"!#$%&' (!')*$+ ,-.

/0!"!$&'*1! (!')*$+ ,-.


.)!7(&4-$&, "*)$
23$%-#$ %&$-$*&'4*'5-%*-'$ 6!-$7%!)
6!-$7%! 5!#$&% "*)$
8(!'$*6+ 9!"#$%#&'($)$*+)&',-$',%+).$',*/0+1
.%!(*#$!( (*)$-'#!) $& 9!
=7*"(> .-$#;> -'( )$*$#; #;-*')
<-#0<&'! ,&(!"
:%-#! )*(!#;-*')

#&,."!$! -""4-$&, ,&(!"

Figure 8.14 A flowchart of textal.

closest Cα given the rotationally invariant features discussed above. Capra’s


putative Cα locations are then sent into the second part of the algorithm,
lookup, which identifies the sidechains corresponding to each Cα ’s. Lookup
uses these same rotationally invariant features, but instead uses a nearest
neighbor approach to find a small subset of the database that best matches
the region of unknown density. Lookup rotationally aligns the best match
to the unknown residue, and places the corresponding atoms into the map.
Finally, textal cleans up its trace using a set of post-processing routines.

8.5.1 Feature extraction

The most important component of textal is its extraction of a set of numer-


ical features from a region of density. These numerical features allow rapid
identification of similar regions from different (solved) maps. A key aspect of
textal’s feature set is invariance to arbitrary rotations of the region’s density.
This eliminates the need for an expensive rotational search for each fragment;
additionally, a discrete rotational search is likely to underestimate some match
scores if the true rotation falls between rotational samples.
Textal uses 76 such numerical features to describe a region of density in
a map. These features include 19 rotationally invariant features, sampled at
four different radii: 3,4,5 and 6A. The use of multiple radii is critical for
differentiation between side-chains: large residues often look similar at smaller
radii but greatly differ at 6A, while small amino acids may have no density
in the outer radii and thus are only differentiated at small radii.
The 19 rotation-invariant features fall into four basic classes, shown in Ta-
ble 8.1. The first class describes statistical properties of these neighborhoods of

© 2008 by Taylor & Francis Group, LLC


260 MACHINE LEARNING IN STRUCTURAL BIOLOGY

Table 8.1 The rotation invariant features used by textal


Class Description Quantity

Statistical Features of Density 4


average, standard deviation, skewness, kurtosis
Center of Mass 1
distance from center of sphere to center of mass
Moments of Inertia 6
magnitude of primary, secondary, tertiary moments;
ratios between these moments
Spokes/Geometry of Density 8
angles between three “spokes of maximal density”
sum of angles, radial densities of each spoke,
area of triangle formed by spokes

density, treating density values in the neighborhood as a probability distribu-


tion. These features include mean, standard deviation, skewness and kurtosis,
the last two of which provide descriptions of the lopsidedness and peakedness
of the distribution of density values. The second class of features is really just
a single feature: the distance from the center of mass to the center of the
neighborhood.
A third class of descriptors includes moments of inertia (MOI), which provides
six features describing how elliptical is the density distribution. Moments of
inertia are calculated as the Eigenvectors of the inertia matrix I:
 2 
X yi + zi2 −xi yi −xi zi
ρi −xi yi x2i + zi2 −yi zi .

I=
i −xi zi −yi zi x2 + y 2
i i

Above, ρi is the density at point hxi , yi , zi i. As a rotation-invariant description,


textal only considers the moments and the ratios between moments, not the
axes themselves (the Eigenvectors of the inertia matrix).
The final class of features represent higher-level geometrical descriptors of the
region. Three “spokes of maximal density” are extended from the center of
the region, spaced > 75◦ apart. These aim to approximate the direction of the
backbone N-terminus, the backbone C-terminus and the sidechain. Rotation-
invariant features derived from these spokes include the min, mid, max and
sum of the angles, the density sum along each spoke and the area of the
triangle formed by connecting the end points of the spokes.

8.5.2 Backbone tracing

Capra, a subroutine of textal, produces the initial Cα trace. Capra con-

© 2008 by Taylor & Francis Group, LLC


TEXTAL 261

Algorithm 8.4: Textal’s capra subroutine for calculating the initial back-
bone trace
Given: electron density map M
Find: putative backbone trace X = {~xi }
M′ ← normalize(M)
pseudoAtoms ← skeletonize(M′)
for pi ∈ pseudoAtoms do
F ← rotation invariant-features in a neighborhood around pi
distance-to-Cα ← neuralN etwork(F)
end
X ← construct chain using predicted distances-to-Cα

structs a backbone chain using a feed-forward neural network. An overview of


the process is illustrated in Algorithm 8.4.
In order to accurately compare maps, capra begins by first normalizing den-
sity values in the map, ensuring feature values from different maps are com-
parable. Next, capra skeletonizes the map, creating a trace of pseudo-atoms
that identifies the medial axis of some density map contour. Figure 8.15a il-
lustrates this skeletonization. This trace is a very crude approximation of the
backbone, and may traverse the side-chains or form multiple distinct chains.
A feed-forward neural network – a nonlinear function approximator used for
both classification and regression – is trained to learn which pseudo-atoms
correspond to actual Cα ’s. Specifically, the network is trained on a set of
previously solved maps to predict the distance of each pseudo-atom to the
nearest Cα . The rotation invariant features are inputs to the network; a single
output node estimates the distance to the closest Cα . A hidden layer of 20
sigmoidal units fully connects input and output layers.
Given a predicted distance-to-Cα for each pseudo-atom, capra uses a greedy
trace to find a linear chain linking Cα ’s together. Further post-modifications
have been added to improve performance of capra, such as refining chains
and patching missing links. The output for capra, on the sample map at
3.5A resolution, is illustrated in Figure 8.15b.

8.5.3 Sidechain placement

After capra returns its predicted backbone trace, textal must next identify
the residue type associated with each Cα . This identification is performed by a
subroutine lookup. Algorithm 8.5 shows a pseudocode overview of lookup.
Essentially, the subroutine compares the density around each Cα to a database
of solved maps to identify the residue type. Lookup uses textal’s rotation
invariant features, and builds a database of feature vectors corresponding to
Cα ’s in solved maps. To determine the residue type of an unknown region of

© 2008 by Taylor & Francis Group, LLC


262 MACHINE LEARNING IN STRUCTURAL BIOLOGY

!$#

!"#

!%#

Figure 8.15 Textal’s intermediate steps: (a) the skeletonized density map, which
crudely approximates the protein backbone, (b) a backbone trace, which textal builds
by determining Cα ’s from the skeleton points, and (c) the final determined structure.

density, lookup finds the nearest neighbors in the database, using weighted
Euclidian distance:
hX 2 i1/2
D(ρ1 ||ρ2 ) = λi · Fi (ρ1 ) − Fi (ρ2 ) . (8.16)
i

Above, Fi refers to the ith feature in the vector, while ρ1 and ρ2 are two
regions of density. Feature weights λi are optimized to maximize similarity
between matching regions and minimize between nonmatching regions, where
ground truth is the optimally-aligned RSCC (Equation 8.9). Textal sets
weights using the slider algorithm [20] which considers features pairwise to
determine a good set of weights.
Since information is lost when representing a region as a rotation invariant fea-
ture vector, the nearest neighbor in the database does not always correspond to
the best-matching region. Therefore, lookup keeps the top k regions – those
with the lowest Euclidean distance – and considers these for a more time-
consuming RSCC computation (see Equation 8.9). Ideally, lookup wants
to find the rotation and translation of each of the k regions to maximize

© 2008 by Taylor & Francis Group, LLC


TEXTAL 263

Algorithm 8.5: Textal’s lookup subroutine for placing sidechains.


Given: electron density map M, backbone trace X = {xi }
Find: all-atom protein model
for ~xi ∈ X do
F ← rotation-invariant features in a neighborhood around xi
N ← k examples in DB minimizing weighted Euclidean distance
for ~ni ∈ N do
~n′i ← optimal superposition of ~ni into map at ~xi
scorei ← RSCC(ni , M(~xi )) // see Equation 8.9
end
Choose n′i maximizing scorei
Add individual atoms of n′i to model
end

this correlation coefficient. It quickly approximates this optimal rotation and


translation by aligning the moments of inertia between the template den-
sity region ρ1 and target density region ρ2 . Lookup computes the real-space
correlation at each alignment, and selects the highest-correlated candidate.
Finally, lookup retrieves the translated and rotated coordinated atoms of
the top-scoring candidate and places them in the model.

8.5.4 Post-processing routines

Since each residue’s atoms are copied from previous examples and glued to-
gether in the density map, the model produced by lookup may contain some
physically infeasible bond lengths, bond angles or φ − ψ torsion angles. Tex-
tal’s final step is improving the model using a few simple post-processing
heuristics. First, lookup often reverses the backbone direction of a residue;
textal’s post-processing makes sure that all chains are oriented in a consis-
tent direction. Refinement, like that of arp/warp, corrects improper bond
lengths and bond angles, iteratively moving individual atoms to fit the density
map better. Finally, textal takes into account the target protein’s sequence
to fix mismatched residues.

Textal makes use of a provided sequence by aligning the map-determined


model sequence to the provided input sequence, using a Smith-Waterman
dynamic-programming alignment. If there is agreement between the sequences
above some threshold, then a second lookup pass corrects residues where the
alignment disagrees. In this second pass, lookup is restricted to only con-
sider residues of the type indicated by the sequence alignment. Like resolve,
textal’s end result is a complete all-atom protein model, illustrated for our
example map in Figure 8.15c.

© 2008 by Taylor & Francis Group, LLC


264 MACHINE LEARNING IN STRUCTURAL BIOLOGY
8.5.5 Discussion

Textal – like resolve – uses higher-order constructs than atoms in order to


successfully solve low-quality maps. In practice, textal works well on maps
at around 3A resolution. Textal’s key contribution is the use of rotation-
invariant features to recognize patterns in the map. This feature representation
allows accurate Cα identification using a neural network; it also does well at
classification of amino-acid type. Textal tends to do better than resolve at
sidechain identification due to this feature set. One key shortcoming, however,
is limiting the initial backbone trace to skeleton points in the density map. In
very poor maps, skeletonization is inaccurate; this is in part responsible for
textal’s failure in maps worse than 3A. However, textal has successfully
employed previously solved structures and domain knowledge from structural
biology to produce an accurate map interpretation.

8.6 acmi

Acmi (automatic crystallographic map interpreter) is a recent method de-


veloped by DiMaio et al. for tracing protein backbones in poor-quality (3 to
4A resolution) density maps [19]. Acmi takes a probabilistic approach to elec-
tron density map interpretation, finding the most likely layout of the backbone
under some likelihood function. This likelihood function takes into account lo-
cal matches to the density map as well as the global pairwise configuration of
residues. The key difference between acmi and the preceding methods is that
acmi represents each residue not as a single location, but rather as a com-
plete probability distribution over the full electron density map. This property
– not forcing each residue to a single location – is advantageous as it naturally
handles noise in the map, errors in the input sequence and disordered regions
in the protein.
Figure 8.16 shows a high-level overview of acmi. The algorithm is comprised
of two main components: a local matching component that probabilistically
matches individual amino acids to the density map, and a global constraint
component where the backbone chain is probabilistically refined from the local
matches. Global refinement is based on physical laws governing the structure
of proteins. Acmi’s key is an efficient inference algorithm that determines the
most probable physically feasible backbone trace in an electron density map.

8.6.1 Local matching

The local matching component of acmi is provided the density map and the
protein’s amino acid sequence. It computes, for each residue in the protein,
a probability distribution Pi (w
~ i ) over all locations w
~ i in the unit cell. This

© 2008 by Taylor & Francis Group, LLC


ACMI 265

!"!#$%&' (!')*$+ ,-.

/&')$%0#$ -'( ,-$#1 23,!% $!,."-$!)


! "#$%#$ .%&9-9*"*$+ $1-$ ::* *) -$ "&#-$*&' 7
4'5!% "&#-$*&') #&'(*$*&'!( &' )!60!'#!
,-%8*'-" .%&9-9*"*$+ $1-$ ::* *) -$ "&#-$*&' 7
/1&&)! ,-7*,0,3,-%8*'-" "&#-$*&')

/!"#$%&' ,&(!"

Figure 8.16 A flowchart of acmi.

Algorithm 8.6: Acmi’s local-matching algorithm


Given: sequence seq, electron density map M
Find: probability distribution Pi (w~ i ) of each residue over map
for each residue seqi ∈ seq do
N ← instances of 5-mer hseqi−2 . . . seqi+2 i from PDB
C ← cluster N, extract centroids
λi ← cluster weights
for each cluster centroid cj ∈ C do
~ i ) ← Perform 6D search for cj over density map
t(w
Use a tuning set to convert t(w
~ i ) to probabilities Pij (w
~ i)
end
X
~i) ←
Pi (w λi Pij (w
~ i)
clusters j
end

probability distribution reflects the probability that residue i is at position


and orientation w~ i in the unit cell.
Acmi’s local match – shown in Algorithm 8.6 – is based upon a 5-mer (that
is, a polypeptide sequence five amino-acids in length) search. Using a set of
previously solved structures, acmi first constructs a basis set of structures de-
scribing the conformational space of each 5-mer in the protein. Acmi searches
for each of these fragments in the map over all translations and rotations. This
local search produces – for each residue i – an estimated probability distribu-
tion of that residue i’s location and orientation in the unit cell, Pi (w
~ i ).

Constructing a sequence-specific 5-mer basis set

Given some 5-amino-acid sequence, acmi uses the Protein Data Bank (PDB),
a repository of solved protein structures, to find all the instances of this se-
quence. If there are fewer than fifty such instances, acmi considers “near-

© 2008 by Taylor & Francis Group, LLC


266 MACHINE LEARNING IN STRUCTURAL BIOLOGY

Figure 8.17 An overview of the 5-mer template matching process. Given a cluster
of 5-mers for residue i, acmi performs a 6D search for the fragment in the density
map. Acmi also matches the fragment to a tuning set of known structures, using
Bayes’ rule to determine a probability distribution from the match scores t(w).
~

neighbors” (using the PAM-120 score, a measure of amino-acid similarity)


until at least fifty distinct conformations are available. It uses these struc-
tures to represent the conformational space of the given 5-mer.
Searching for all these conformations in the electron density map is wasteful,
because many are redundant, so acmi clusters the structures into a smaller
number of distinct conformations, representing each cluster with a single “cen-
tral” instance (or centroid ) of that cluster and a numeric weight. Acmi stores
noncentroid instances from each cluster as well for tuning. Clustering uses the
all-atom root mean squared deviation (RMSd) as a distance metric. Acmi can
perform this clustering process in advance for all 3.2 × 106 possible 5-mers.

Searching for 5-mer centroid fragments

Given a protein sequence, acmi considers the 5-mer sequence centered at


each amino-acid. It extracts the fragments which represent the conforma-
tional space of that sequence, which it learns from the clustering process,
and searches the density map for these fragments. Figure 8.17 illustrates this
process graphically. Given these fragments and a resolution limit, acmi builds
an expected density map for each fragment. Then, at each map location, acmi
computes the standardized mean squared electron density difference t(~x) be-
tween the map and the fragment. Notice that this t(~x) is the same density
map similarity function employed by resolve, shown in Equation 8.7.
Acmi’s fragment search is a 6D search: it considers every rotation of a fragment
at every location in the map. Using fffear’s FFT-based convolution, one can

© 2008 by Taylor & Francis Group, LLC


ACMI 267
compute this function very efficiently [11]. Acmi then stores – at each position
– the best-matching 5-mer fragment and corresponding rotation.
The electron density difference function t(~x) is a good measure of similarity
between regions of density; however, it doesn’t allow comparison of scores from
different templates. Acmi uses each cluster’s tuning set in order to convert
squared density differences into a probability distribution over the unit cell.
To compute probabilities, Bayes’ rule is used:
P (t(~xi )|res. i is at ~xi ) · P (res. i at ~xi )
P (res. i at ~xi |t(~xi )) = . (8.17)
P (t(~xi ))
Acmi computes terms on the right-hand side: the denominator, Pi (t(~xi )), is
the distribution of match scores over the (unsolved) map. The prior proba-
bility, Pi (res. i at ~xi ), is simply a normalization term. Acmi drops this term
and simply ensures that probabilities over the map are normalized to sum to
the number of copies of the 5-mer in the map. However, the first term in the
numerator - the distribution of scores when the 5-mer matches the map - is
trickier to compute. Acmi estimates this term using a tuning set saved from
an earlier step. This tuning set contains instances of a particular 5-mer con-
formation other than the centroid. Matching the centroid 5-mer structure’s
density to each tuneset structure’s density gives an accurate estimate to this
term. As shorthand, we will refer to this probability distribution simply as
Pi (~xi ) for the remainder of this section. Figure 8.18a plots this probability
distribution for two residues in the example protein.

8.6.2 Global constraints

Given each residue’s independent probability distribution over the unit cell,
Pi (~xi ), acmi accounts for global constraints (enforced by physical feasibility)
of a conformation by modeling the protein using a pairwise Markov field. A
pairwise Markov field defines the joint probability distribution over a set of
variables as a product of potential functions defined over vertices and edges
in an undirected graph (see Figure 8.19).

Markov field model

Formally, the graph G = (V, E) consists of a set of nodes i ∈ V connected by


edges (i, j) ∈ E. Each node in the graph is associated with a (hidden) random
variable w~ i ∈ W, and the graph is conditioned on a set of observation variables
M. Each vertex has a corresponding observation potential ψi (w ~ i , M), and each
edge is associated with an edge potential ψij (w ~ i, w
~ j ). Then, the probability of
a complete trace W is:
Y Y
P (W|M) ∝ ψij (w ~j) ×
~ i, w ψi (w
~ i , M). (8.18)
(i,j)∈E i∈V

© 2008 by Taylor & Francis Group, LLC


268 MACHINE LEARNING IN STRUCTURAL BIOLOGY

!"#

!%#

&'()* +'+,*

!$#

&'()* +'+,*

Figure 8.18 Intermediate steps in acmi’s structure determination: (a) the matching
probability distributions Pi (~
xi ) on two residues, GLU20 and ALA60 , contoured at
p = 10−4 , (b) the marginal probability distributions over the same two residues and
(c) the final (backbone-only) model, each residue shaded by likelihood (darker is more
likely).

Probabilistic inference finds the labels W = {w


~ i } maximizing this probability,
given some M.

To encode a protein in a Markov field model, acmi constructs an undirected


graph where each node i corresponds to an amino-acid residue in the protein.
The label w~ i = h~xi , ~
qi i for each amino-acid consists of seven terms: the 3D
Cartesian coordinates ~xi of the residue’s alpha Carbon (Cα ), and four “orien-
tation” parameters ~qi (three rotational parameters plus a “bend” angle). The
observation potential ψi (wi , M) associated with each residue is the previously
computed probability distribution Pi (~xi ), with – at each position – all the
probability mass stored in the orientation of the best match.

Edges in the graph enforce global constraints in a pairwise manner. The


graph is fully connected (that is, every pair of residues is connected by an
edge); DiMaio breaks the potential functions ψij associated with each edge
into two types. Adjacency potentials ψadj associated with edges between ad-
jacent residues ensure that these neighboring Cα ’s maintain the proper 3.8
spacing, and Cα triples maintain the proper bend angle. Occupancy potentials
ψocc on all other edges prevent two residues from occupying the same region
in three-dimensional space. Thus, the full joint probability of a trace, given a

© 2008 by Taylor & Francis Group, LLC


ACMI 269

Figure 8.19 Acmi’s protein backbone model. The joint probability of a conformation
of residues is the product of an observation potential psii at each node, (b) an ad-
jacency potential between adjacent residues and (c) an occupancy potential between
all pairs of nonadjacent residues.

map, is:
Y
P (W|M) ∝ ψadj (w
~ i, w
~j )
(w
~ i ,w
~ j )∈W,|i−j|=1
Y
× ψocc (w
~ i, w
~j )
(w
~ i ,w
~ j )∈W,|i−j|>1
Y
× ψi (w
~ i , M). (8.19)
w
~ i ∈W

Adjacency potentials

Adjacency potentials, which connect every neighboring pair of residues, are


the product of two constraining functions, a distance constraint function and
a rotational constraint function:
ψadj (w ~ j ) = px (||~xi − ~xj ||) · pθ (w
~ i, w ~ i, w
~ j ). (8.20)

In proteins, the Cα - Cα distance is a nearly invariant 3.8A. Thus, the potential


px takes the form of a tight Gaussian (σ = 0.03A) around this ideal value,
softened a bit for grid effects. Acmi defines the potential pθ using an alternate
parameterization of the angular parameters ~qi .
Specifically, acmi represents these four degrees of freedom as two pairs of θ −φ
spherical coordinates: the most likely direction of the forward (i + 1) residue
and the backward (i−1) residue. When matching the 5-mer templates into the
density map, at each location xi , acmi stores four values – θb , φb , θf and φf
– indicating the direction of both adjacent Cα in the rotated, best-matching
5-mer.

© 2008 by Taylor & Francis Group, LLC


270 MACHINE LEARNING IN STRUCTURAL BIOLOGY
The angular constraint function pθ is then – in each direction – a fixed-
width Gaussian on a sphere, centered on this preferred orientation, (θb , φb )
or (θf , φf ).

Occupancy potentials

Occupancy potentials ensure that two residues do not occupy the same loca-
tion in space. They are defined independently of orientation, and are merely
a step function that constrains two (nonadjacent) Cα ’s be at least 3A apart.
It is in this structural potential function that acmi deals with crystallo-
graphic symmetry, by ensuring that all crystallographic copies are at least
3A apart:
  
min
1 symmetric ||xi − K(xj )|| ≥ 3.0A

ψocc (w
~i, w
~j) = transf orms K . (8.21)
0 otherwise.

Multiple chains in the asymmetric unit are also handled by acmi: edges en-
forcing occupancy constraints fully connect separate chains.

Tracing the backbone

Acmi’s backbone trace – shown in Algorithm 8.7 – is equivalent to finding the


labels W = {w ~ i } that maximize the probability of Equation 8.18. Since the
graph over which the joint probability is defined contains loops, finding an
exact solution is infeasible (dynamic programming can solve this in quadratic
time for graphs with no loops). Acmi uses belief propagation (BP) to compute
an approximation to the marginal probability for each residue i (that is, the
full joint probability with all but one variable summed out). Acmi chooses
the label for each residue that maximizes this marginal as the final trace.

Belief propagation is an inference algorithm - based on Pearl’s polytree algo-


rithm for [21] Bayesian networks - that computes marginal probabilities using
a series of local messages. At each iteration, an amino acid computes an esti-
mate of its marginal distribution (i.e., an estimate of the residue’s location in
the unit cell) as the product of that node’s local evidence ψi and all incoming
messages:
Y
b̂ni (w
~ i ) ∝ ψi (w
~ i , M) × mnj→i (w
~ i ). (8.22)
j∈Γ(i)

Above, the belief b̂ni at iteration n is the best estimate of residue i’s marginal
distribution,
X X X X
b̂ni (w
~i) ≈ ... ... P (W, M). (8.23)
w
~0 w
~ i−1 w
~ i+1 w
~N

© 2008 by Taylor & Francis Group, LLC


ACMI 271

Algorithm 8.7: Acmi’s global-constraint algorithm


Given: individual residue probability distributions Pi (w ~ i)
Find: approximate marginal probabilities b̂i (w ~ i)
∀i initialize belief b̂0i (w~ i ) to Pi (w
~ i)
repeat
for each residue i do
~ i ) ← Pi (w
b̂i (w ~ i)
for each residue j 6= i do
// compute incoming message
if |i − j| = 1 then
b̂j
mnj→i (w
R
~ i ) ← w~ j ψadj (w ~ j ) × mn−1
~ i, w (w
~ j )dw~j
i→j

else
mnj→i (w
R
~ i ) ← w~ j ψocc (w ~ j ) × b̂j (w
~ i, w ~ j )dw
~j
end
// aggregate messages
b̂i (w ~ i ) × mnj→i (w
~ i ) ← b̂i (w ~i)
end
end
until (b̂i ’s converge)

Message update rules determine each message:


Z
n
mj→i (w~ i) ∝ ψij (w ~ j ) × ψj (w
~ i, w ~ j , M)
w
~j
Y
× mn−1
k→j (xj ) dw
~j . (8.24)
k∈Γ(j)\i

Computing the message from j to i uses all the messages going into node j
except the message from node i. When using BP in graphs with loops, such as
acmi’s protein model, there are no guarantees of convergence or correctness;
however, empirical results show that loopy BP often produces a good approx-
imation to the true marginal [22]. On the example protein, acmi computes
the marginal distributions shown in Figure 8.18b.
To represent belief and messages, acmi uses a Fourier-series probability den-
sity estimate. That is, in the Cartesian coordinates ~xi , marginal distributions
are represented as a set of 3-dimensional Fourier coefficients fk , where, given
an upper-frequency limit, (H, K, L):
H,K,L
X
bni (~xi ) = fhkl × e−2πi(~xi hh,k,li) . (8.25)
h,k,l=0

In rotational parameters, acmi divides the unit cell into sections, and in each

© 2008 by Taylor & Francis Group, LLC


272 MACHINE LEARNING IN STRUCTURAL BIOLOGY
section stores a single orientation ~qi . These orientations correspond to the best-
matching 5-mer orientation. More importantly, these stored orientations are
not updated by belief propagation: messages are independent of the rotational
parameters ~ qi .
To make this method tractable, acmi approximates all the outgoing occupancy
messages at a single node:
bnj (w
~ j )dw
~j
Z
mnj→i (w
~ i) ∝ ψocc (w ~ j ) × n−1
~ i, w . (8.26)
w
~j mi→j (w ~j )
The approximation drops the denominator above:
Z
n
mj→∗ (w~i) ∝ ψocc (w ~ j ) × bnj (w
~i, w ~ j )dw
~j . (8.27)
w
~j

That is, acmi computes occupancy messages using all incoming messages to
node j including the message from node i. All outgoing occupancy messages
from node j, then, use
Q the same estimate. Acmi caches the product of all
occupancy messages i mi→∗ . This reduces the running time of each iteration
in a protein with n amino acids from O(n2 ) to O(n).
Additionally, acmi quickly computes all occupancy messages using FFTs:
h Y i
F mnj→i (w mn−1
   
~ i ) = F ψocc (w ~j ) × F
~ i, w j→i (w
~ i) . (8.28)

This is possible only because the occupancy potential is a function of the


difference of the labels on the connected nodes, ψocc (w ~ j ) = f (||~xi − ~xj ||).
~ i, w
Finally, although acmi computes the complete marginal distribution at each
residue, a crystallographer is only interested in a single trace. The backbone
trace consists of the locations for each residue that maximize the marginal
probability:
~ i∗ = arg max b̂i (w
w ~ i)
w
~i
Y
~ i , M) ×
= arg max ψi (w mnj→i (w
~ i ). (8.29)
w
~i
j∈Γ(i)

Acmi’s backbone trace on the example map is illustrated in Figure 8.18c.


The backbone trace is shaded by confidence: since acmi computes a complete
probability distribution, it can return not only a putative trace, but also a
likelihood associated with each amino acid. This likelihood provides the crys-
tallographer with information about what areas in the trace are likely flawed;
acmi can also produce a high-likelihood partial trace suitable for phase im-
provement.

8.6.3 Discussion

Acmi’s unique approach to density map interpretation allows for an accurate

© 2008 by Taylor & Francis Group, LLC


CONCLUSION 273
trace in extremely poor maps, including those in the 3 to 4A resolution range.
Unlike the other residue-based methods, acmi is model-based. That is, it con-
structs a model based on the protein’s sequence, then searches the map for
that particular sequence. Acmi then returns the most likely interpretation of
the map, given the model. This is in contrast to textal and resolve which
search for “some backbone” in the map, then align the sequence to this trace
after the fact. This makes acmi especially good at sidechain identification;
even in extremely bad maps, acmi correctly identifies a significant portion of
residues. Unfortunately, acmi also has several shortcomings. Requiring com-
plete probability distributions for the location of each residue is especially
time consuming; this has limited the applicability of the method so far. Ad-
ditionally, in poor maps, belief propagation fails to converge to a solution,
although in these cases a partial trace is usually obtained. By incorporating
probabilistic reasoning with structural biology domain knowledge, acmi has
pushed the limit of interpretable maps even further.

8.7 Conclusion

A key step in determining protein structures is interpreting electron density


maps. In this area, bioinformatics has played a key role. This chapter describes
how four different algorithms have approached the problem of electron density
map interpretation:

• The warpntrace procedure in arp/warp was the first method devel-


oped for automatic density map interpretation. Today, it is still the most
widely used method by crystallographers. Arp/warp uses an “atom-level”
technique in which free atoms are first placed into the density map, free
atoms are next linked into chains introducing constraints and, finally, the
combined model is refined to better explain the map. The method iterates
through these three phases, at each iteration using the partial model to im-
prove the map. Because it works at the level of individual atoms, it requires
2.3A or better map resolution.
• Resolve is a method that searches for higher-level constructs – amino acids
and secondary structure elements – than arp/warp’s atom-level method.
Consequently, it produces accurate traces in poor-quality (around 3A) elec-
tron density maps, unsolvable by arp/warp. It, too, is widely used by
crystallographers. Resolve begins by matching short secondary-structure
fragments to the maps, then uses a large fragment library to extend these
matches. Finally, overlapping matches are merged in a greedy fashion, and
sidechains are traced. Incorporating structural domain knowledge is key to
this method’s success.
• Textal also accurately interprets medium to low resolution (2 to 3A),
using residue-level matching. It represents regions of density as a vector
of rotation-invariant features. This alternate representation serves several

© 2008 by Taylor & Francis Group, LLC


274 MACHINE LEARNING IN STRUCTURAL BIOLOGY
purposes. It is used to learn a classifier to identify Cα ’s, and it is also
used to recognize the residue type of each putative Cα through a database
comparison. The classifier is also very well suited to identifying the residue
type in a given region, making it more accurate than resolve in this
respect. Additionally, textal’s rotation-invariant representation enables
fast matching of regions of density. This allows textal to easily make use
of previously solved structures in its map interpretation, providing accurate
traces even in poor-quality maps.
• Acmi uses a probabilistic model to trace protein backbones in poor-quality
(3 to 4A resolution) density maps. It finds the most likely layout of the
backbone under a likelihood function which takes into account local matches
to the density map as well as the global pairwise configuration of residues.
Unlike other methods, acmi represents each residue not as a single location
but as a probability distribution over the entire density map. Also unlike
other approaches, it constructs a model based on the protein’s sequence,
and finds the most likely trace of that particular sequence in the density
map. Acmi’s probabilistic, model-based approach results in accurate trac-
ing and sidechain identification at poor resolutions.
As each of these methods extended the limit of what resolution maps are
automatically interpreted, they brought with them two things: first, a higher-
level “basic construct” at which the algorithm searches, and second, better
incorporation of structural domain knowledge. These two key aspects are what
enables interpretation in maps where individual atoms are not distinguishable,
and in the future, what will extend the threshold of interpretation further.
As fewer and fewer fine details are visible in poor-resolution maps, algorithms
must use a higher and higher level basic construct – that is, the template for
which they search – in order to be robust against blurred details. Arp/warp
has had success when most atoms are visible in the map. If individual atoms
are blurred out, the atom-level method will fail. However, a residue-based
method like textal – which will locate amino acids assuming entire residues
are not blurred – is robust enough to handle interpretation when atom details
are unclear. Similarly, using secondary-structure elements allows even better
interpretation. Probabilistic methods like acmi take this still further: its in-
terpretation considers a single flexible protein-sized element, and is robust
enough to handle maps where entire residues are indistinguishable.
Another important feature of these methods is the increasing use of structural
domain knowledge. In a way, this makes sense: the crystallographers task is
inherently no different than that of the ab initio protein folding algorithm. A
crystallographer simply has the assistance of a “picture” of the protein (the
density map). All four methods use structural domain knowledge, by employ-
ing previous solved structures in model building. Primarily, these structures
are used in the construction of a set of “representative fragments;” however,
acmi and textal also use previously solved structures to learn model param-
eters. Future methods will increasingly rely on such domain knowledge.

© 2008 by Taylor & Francis Group, LLC


ACKNOWLEDGMENTS 275
In the future, with the rising popularity of high-throughput structure deter-
mination, automated map interpretation methods will play a significant role.
Improvements in laboratory techniques are producing density maps at a faster
rate. In addition, experimental techniques such as cryo-electron microscopy are
producing density maps that approach 5-6A resolution, and are continually
improving. Automatically determining structure from maps of this quality
will be increasingly important. To further extend the limit of what maps are
interpretable, automated interpretation techniques will need to use more do-
main knowledge, and consider searching not for a single residue or a single
tripeptide, but rather entire proteins, probabilistically. Providing automated
systems with increasing amounts of a crystallographer’s “expertise” is key to
future improvements in these methods.

8.8 Acknowledgments

This work supported by NLM grant 1R01 LM008796-01 and NLM Grant 1T15
LM007359-01. The authors would also like to thank George Phillips and Tom
Ioerger for assistance in writing this chapter.

References

[1] B. Rost and C. Sander (1993). Prediction of protein secondary structure at better
than 70% accuracy. J Mol Biol.
[2] G. Rhodes (2000). Crystallography Made Crystal Clear. Academic Press.
[3] J. Abrahams and R. De Graaff (1998). New developments in phase refinement.
Curr Opin Struct Biol.
[4] S. Russell and P. Norvig (1995). Artificial Intelligence: A Modern Approach.
Prentice Hall.
[5] T. Mitchell (1997). Machine Learning. McGraw-Hill.
[6] V. Lamzin and K. Wilson (1993). Automated refinement of protein models. Acta
Cryst.
[7] A. Perrakis, T. Sixma, K. Wilson, and V. Lamzin (1997). wARP: Improvement
and extension of crystallographic phases by weighted averaging of multiple re-
fined dummy atomic models. Acta Cryst.
[8] R. Morris, A. Perrakis, and V. Lamzin (2002). ARP/wARP’s model-building
algorithms: the main chain. Acta Cryst.
[9] J. Greer (1974). Three-dimensional pattern recognition. J Mol Biol.
[10] L. Leherte, J. Glasgow, K. Baxter, E. Steeg, and S. Fortier (1997). Analysis of
three-dimensional protein images. JAIR.
[11] K. Cowtan (2001). Fast Fourier feature recognition. Acta Cryst.
[12] T. Oldfield (2001). A number of real-space torsion-angle refinement techniques
for proteins, nucleic acids, ligands and solvent. Acta Cryst.
[13] T. Terwilliger (2002). Automated main-chain model-building by template-
matching and iterative fragment extension. Acta Cryst.
[14] T. Terwilliger (2002). Automated side-chain model-building and sequence as-
signment by template-matching. Acta Cryst.

© 2008 by Taylor & Francis Group, LLC


276 MACHINE LEARNING IN STRUCTURAL BIOLOGY
[15] D. Levitt (2001). A new software routine that automates the fitting of protein
X-ray crystallographic electron density maps. Acta Cryst.
[16] T. Ioerger, T. Holton, J. Christopher, and J. Sacchettini (1999). TEXTAL: A
pattern recognition system for interpreting electron density maps. Proc ISMB.
[17] T. Ioerger and J. Sacchettini (2002). Automatic modeling of protein backbones
in electron density maps via prediction of C-alpha coordinates. Acta Cryst.
[18] K. Gopal, T. Romo, E. Mckee, K. Childs, L. Kanbi, R. Pai, J. Smith, J. Sac-
chettini, and T. Ioerger (2005). TEXTAL: Automated crystallographic protein
structure determination. Proc. IAAI.
[19] F. DiMaio, J. Shavlik, and G. Phillips (2006). A probabilistic approach to pro-
tein backbone tracing in electron density maps. Proc ISMB.
[20] K. Gopal, T. Romo, J. Sacchettini, and T. Ioerger (2004). Weighting features to
recognize 3D patterns of electron density in X-ray protein crystallography. Proc
CSB.
[21] J. Pearl (1988). Probabilistic Reasoning in Intelligent Systems. Morgan Kauf-
mann, San Mateo.
[22] K. Murphy, Y. Weiss, and M. Jordan (1999). Loopy belief propagation for ap-
proximate inference: An empirical study. Proc. UAI.

© 2008 by Taylor & Francis Group, LLC


CHAPTER 9

Soft Computing in Biclustering

Haider Banka and Sushmita Mitra


Indian Statistical Institute, Kolkata, India

9.1 Introduction

Microarray experiments produce gene expression patterns that offer dynamic


information about cell function. This is useful while investigating complex in-
teractions within the cell [1, 2]. Microarrays are used in the medical domain
to produce molecular profiles of diseased and normal tissues of patients. Such
profiles are useful for understanding various diseases, and aid in more accu-
rate diagnosis, prognosis, treatment planning, as well as drug discovery. Gene
expression data being typically high-dimensional, it requires appropriate data
mining strategies like clustering and biclustering for further analysis [3].
A cluster is a collection of data objects which are similar to one another within
the same cluster but dissimilar to the objects in other clusters [4, 5]. The
problem is to group N patterns into nc possible clusters with high intra-class
similarity and low inter-class similarity by optimizing an objective function.
Here the genes are typically partitioned into disjoint or overlapped groups
according to the similarity of their expression patterns over all conditions.
It is often observed that a subset of genes is coregulated and coexpressed
under a subset of conditions, but behave almost independently under other
conditions. Here the term “conditions” can imply environmental conditions,
as well as time points in a gene expression profile. Biclustering refers to the
simultaneous clustering of both genes and conditions in the process of knowl-
edge discovery about local patterns from microarray data [6]. Since typical
biological processes begin and end over a continuous period of time, the genes
often need to be identified in the form of biclusters over continuous columns
[7, 8].
There exist analogous terminologies for biclustering in the literature [9] like
bidimensional clustering, subspace clustering, projected clustering, cocluster-
ing, simultaneous clustering, direct clustering, block clustering, two-way clus-
tering, two-mode clustering and two-sided clustering. In fact, the term sub-
space clustering was first proposed in the general data mining domain [10]

277

© 2008 by Taylor & Francis Group, LLC


278 SOFT COMPUTING IN BICLUSTERING
to find subsets of objects such that they appear as a cluster in a subspace
formed by subsets of the features. Hence the subsets of features for various
subspace clusters can be different. Two subspace clusters can share some com-
mon objects and features, and some objects may not belong to any subspace
clusters.

Simultaneous clustering along both dimensions may also be viewed as cluster-


ing preceded by dimensionality reduction along columns. But the simultane-
ity of the process endows it with statistical regularization, thereby generating
more interpretable compact clusters with reduced computational complexity.
Biclustering can be overlapped or partitional. The two key components in
formulating a bicluster are (i) minimizing the discrepancy between the orig-
inal and the compressed representation [6], measured in terms of the sum
of element-wise squared deviation, and (ii) the information-theoretic method
[11, 12] which preserves a different set of summary statistics.

The optimization task of finding one or more biclusters by maintaining the


two competing constraints, viz., homogeneity and size, is reported to be NP-
complete [13]. The high complexity of this problem has motivated researchers
to apply various approximation techniques to find near optimal solutions.
Some approaches reported in literature include [6, 14, 15] that basically dif-
fer in their ways of formulating these conflicting objectives. Soft computing
[16], involving fuzzy sets and evolutionary computing, has been successfully
explored for faster discovery of biologically relevant overlapped biclusters.

The rest of the chapter is organized as follows. Section 9.2 introduces the basic
concepts of the biclustering problem with a state-of-the-art review. The use
of multi-objective GA (MOGA) and fuzzy possibilistic sets are investigated
in the soft computing framework. These are presented in Sections 9.3 and
9.4. The experimental results and their comparative study, along with some
biological validation in terms of gene ontology, are provided in Section 9.5.
Finally, Section 9.6 concludes the chapter.

9.2 Biclustering

A bicluster is defined as a pair (g, c), where g ⊆ {1, . . . , m} is a subset of genes


and c ⊆ {1, . . . , n} is a subset of conditions/time points. The optimization task
[6] is to find the largest bicluster that does not exceed a certain homogeneity
constraint. The size (or volume) f (g, c) of a bicluster is defined as the number
of cells in the gene expression matrix E (with values eij ) that are covered by
it. The homogeneity G(g, c) is expressed as a mean squared residue score; it
represents the variance of the selected genes and conditions. We maximize

f (g, c) = |g| × |c|, (9.1)

© 2008 by Taylor & Francis Group, LLC


BICLUSTERING 279
subject to a low G(g, c) ≤ δ for (g, c) ∈ X, with X = 2{1,...,m} × 2{1,...,n} being
the set of all biclusters, where
1 X
G(g, c) = (eij − eic − egj + egc )2 . (9.2)
|g| × |c| i∈g,j∈c

Here
1 X
eic = eij , (9.3)
|c| j∈c
1 X
egj = eij (9.4)
|g| i∈g
are the mean row and column expression values for (g, c) and
1 X
egc = eij (9.5)
|g| × |c| i∈g,j∈c

is the mean expression value over all cells contained in the bicluster (g, c).
A user-defined threshold δ represents the maximum allowable dissimilarity
within the bicluster. In other words, the residue quantifies the difference be-
tween the actual value of an element eij and its expected value as predicted
from the corresponding row mean, column mean and bicluster mean. A set of
genes whose expression levels change in accordance to each other over a set
of conditions can thus form a perfect bicluster even if the actual values lie far
apart. For a good bicluster, we have G(g, c) < δ for some δ ≥ 0.

9.2.1 Heuristic and probabilistic approaches

A good survey on biclustering is available in literature [9], with a categoriza-


tion of the different heuristic approaches made as follows.

• Iterative row and column clustering combination [17]: Apply clustering al-
gorithms to the rows and columns of the data matrix, separately, and then
combine the results using some iterative procedure.
• Divide and conquer [18]: Break the problem into smaller sub-problems,
solve them recursively, and combine the solutions to solve the original prob-
lem.
• Greedy iterative search [6, 19]: Make a locally optimal choice, in the hope
that this will lead to a globally good solution.
• Exhaustive biclustering enumeration [20]: The best biclusters are identified,
using an exhaustive enumeration of all possible biclusters existent in the
data, in exponential time.
• Distribution parameter identification [21]: Identify best-fitting parameters,
by minimizing a criterion through an iterative approach.

© 2008 by Taylor & Francis Group, LLC


280 SOFT COMPUTING IN BICLUSTERING
The pioneering work by Cheng and Church [6] employs a set of heuristic al-
gorithms to find one or more biclusters, based on a uniformity criteria. One
bicluster is identified at a time, iteratively. There are iterations of masking
null values and discovered biclusters (replacing relevant cells with random
numbers), coarse and fine node deletion, node addition and the inclusion of
inverted data. The computational complexity for discovering k biclusters is of
the order of O(mn × (m + n) × k), where m and n are the number of genes
and conditions respectively. Here similarity is computed as a measure of the
coherence of the genes and conditions in the bicluster. Although the greedy
local search methods are by themselves fast, they often yield suboptimal so-
lutions. An improvement over the result in Ref. [6] is visible [22], by slight
modification of the node addition algorithm while incorporating a parameter
to reduce the blind search space.
Sometimes the masking procedure may result in a phenomenon of random in-
terference, thereby adversely affecting the subsequent discovery of high quality
biclusters. In order to circumvent this problem, a two-phase probabilistic al-
gorithm (FLOC) [19] is designed to simultaneously discover a set of possibly
overlapping biclusters all at the same time. Initial biclusters (or seeds) are
chosen randomly from the original data matrix. Iterative gene and/or con-
dition additions and/or deletions are performed with a goal of achieving the
best potential residue reduction. The time complexity of FLOC is lower for p
iterations (p ≪ n + m); i.e., O((n + m)2 × k × p).
The Plaid model [21] tries to capture the approximate uniformity in a subma-
trix of the gene expression data, while discovering one bicluster at a time in an
iterative process with the Expectation-Maximization (EM) algorithm. Gene
expression data is considered as a sum of multiple “layers,” where each layer
may represent the presence of a particular biological process in the bicluster.
The input matrix is described as a linear function of variables corresponding to
its biclusters, and an iterative maximization process is pursued for estimating
the function. It searches for patterns where the genes differ in their expression
levels by a constant factor. An extension of the Plaid model is described in
Ref. [23].
Another probabilistic model is explored in Ref. [24], using gene regulation for
the task of identifying overlapped biological processes and their regulatory
mechanism. A key feature is that it allows genes to participate in multiple
processes, thus providing a biologically plausible model for the process of gene
regulation. Moreover, known genes are grouped to function together while
recovering existing regulatory relationships. Novel hypotheses are developed
for determining the regulatory role of previously uncharacterized proteins.
Statistical Subspace Clustering (SSC), for both continuous as well as dis-
crete attributes, is described in Ref. [25], using EM algorithm for analyzing
high dimensional data. It generates a set of rules, defined over fewer relevant
dimensions, while also reducing the number of user supplied input param-

© 2008 by Taylor & Francis Group, LLC


BICLUSTERING 281
eters. The algorithm is robust both in terms of classification accuracy and
interpretability.
Bipartite graphs are employed in Refs. [20] and [26], with a bicluster being
defined as a subset of genes that jointly respond across a subset of conditions.
The objective is to identify the maximum-weighted subgraph. Here [20] a gene
is considered to be responding under a condition if its expression level changes
significantly, over the connecting edge, with respect to its normal level. This
involves an exhaustive enumeration, with a restriction on the number of genes
that can appear in the bicluster. A simultaneous discovery of all biclusters is
made, including overlapped ones.
A partition based co-clustering (also called checkerboard biclustering and
spectral biclustering [27]) is used to partition rows and columns in a disjoint
manner into separate clusters. A coupled two-way method [17] has been de-
vised to iteratively generate a set of biclusters, at a time, in cancer datasets. It
repeatedly performs one-way hierarchical clustering on the rows and columns
of the data matrix, while using stable clusters of rows as attributes for col-
umn clustering and vice versa. The Euclidean distance is used as the similarity
measure, after normalization of the data. However, the clustering results are
sensitive to initial setting, and are sometimes difficult to interpret.
Gene ontology information, involving hierarchical functional relationships like
“part of” or “overlapping,” has been incorporated into the clustering process
called Smart Hierarchical Tendency Preserving Algorithm (SHTP) [28]. A fast
approximate pattern matching technique has been employed [29] to determine
maximum-sized biclusters, with the number of conditions being greater than
a specified minimum. The worst case complexity of the procedure is claimed
to be O(m2 n). Rich probabilistic models have been used [30] for discovering
relations between expressions, regulatory motifs and gene annotations. The
outcome is a collection of disjoint biclusters, generated in a supervised manner.
Efficient frequent pattern mining algorithms have been successfully integrated
in DBF [31] to deterministically generate a set of good quality biclusters. Here
the changing tendency between two conditions is modeled as an item, with the
genes corresponding to transactions. A frequent itemset with the supporting
genes forms a bicluster. In the second phase, these are iteratively refined by
adding more genes and/or conditions.

9.2.2 Information-theoretic approach

Attribute clustering algorithm (ACA) [32] finds optimal meaningful clusters,


by maximizing intra-group attribute interdependence. A new interdependence
information measure is introduced to capture the interrelationship among at-
tributes. The performance of gene classification, obtained from a pool of top
significant genes, is used to evaluate the clusters.

© 2008 by Taylor & Francis Group, LLC


282 SOFT COMPUTING IN BICLUSTERING
A unified framework for partitional co-clustering, based on matrix approxi-
mation, has been developed [11, 12]. Here the approximation error is mea-
sured using a large class of loss functions called Bregman divergences, that
include squared Euclidean distance and KL-divergence as special cases. Multi-
ple structurally different co-clustering schemes are modeled in terms of a new
minimum Bregman information principle that generalizes both the maximum
entropy and standard least squares. It leads to a generalization for an entire
class of the algorithms based on particular choices of the Bregman divergence
and the set of summary statistics to be preserved.

9.2.3 Handling time domain

There exist a number of investigations dealing with time-series data [33, 34].
A polynomial-time algorithm based on the Monte-Carlo method for finding
coclusters is described in Ref. [35]. Basic linear algebra and arithmetic tools
are used in the time domain [36] to search biclusters having constant values
on rows and columns, as well as those with coherent expressions.
A linear time continuous columns algorithm has been designed [37]. This re-
ports all relevant biclusters, extracted in linear time corresponding to the size
of the data matrix. The complexity is reduced after discretizing the expression
values into up, down and no change symbols, followed by the generation of a
suffix tree along with string processing. The performance is demonstrated on
synthetic and real world data.
To overcome some of the existing limitations, an attempt has been made [8] to
identify time lagged gene clusters based on the changing tendency of genes over
time. The slope of the discretized expression matrix is converted into symbols
0, -1, 1. Finally identification of time lagged subgroups of genes with similar
patterns is possible over consecutive time points. A binary reference model
Bimax [38] provides an interesting comparative evaluation of biclustering.

9.2.4 Incorporating soft computing

Soft computing tools like fuzzy sets and evolutionary algorithms have also
been used for biclustering. A possibilistic fuzzy approach has been investigated
[39] to find one bicluster at a time by assigning membership to each gene
and condition of the bicluster while minimizing the mean squared residue
and maximizing the size. After convergence, the membership is defuzzified.
However this methodology is found to be over sensitive to parameter tuning.
Section 9.4 presents the algorithm in greater detail.
GAs have been employed incorporating local search strategy for identifying
biclusters in gene expression data [14, 15]. Sequential evolutionary bicluster-
ing (SEBI) [40] detects high quality overlapped biclusters by introducing the

© 2008 by Taylor & Francis Group, LLC


MULTI-OBJECTIVE BICLUSTERING 283
concept of penalty into the fitness functions, in addition to some constrained
weightage among the parameters.
An order preserving sub matrix (OPSM) has been developed in Refs. [7, 41,
42, 43], using greedy search heuristic and evolutionary strategies. However,
there exist problems related to local optima, consumption of excessive com-
putational resources or imposition of too strict constraints on the clustering
criterion.
Simulated annealing (SA) based biclustering [44] is found to provide improved
performance over that of Ref. [6], and is also able to escape from local minima.
Unlike the optimization techniques like GA, that appreciate only improve-
ments in the chosen fitness functions, SA also allows a probabilistic acceptance
of temporary disimprovement in fitness scores. However, the results are often
dependent on the temperature schedule.
When there are two or more conflicting characteristics to be optimized, one
requires an appropriate formulation of the fitness function in terms of an
aggregation of the different criteria involved. In such situations multi-objective
evolutionary algorithm (MOEA) [45] provide an alternative, more efficient,
approach to searching for optimal solutions. It has found successful application
in biclustering of microarray gene expression patterns [15]. This is described
in greater detail in Section 9.3.

9.3 Multi-Objective Biclustering

Multi-objective evolutionary algorithm is a global search heuristic, primarily


used for optimization tasks. In this section we present the general framework
and implementation details of multi-objective evolutionary algorithm for bi-
clustering [15]. The aim is to find sub-matrices, where the genes exhibit highly
correlated activities over a range of conditions. Since these two objectives are
mutually conflicting, they become suitable candidates for multi-objective mod-
eling. A new quantitative measure to evaluate the goodness of the bicluster is
also introduced. Local search heuristics are employed, to speed up convergence
by refining the chromosomes.

9.3.1 Representation

Each bicluster is represented by a fixed sized binary string called chromosome


or individual, with a bit string for genes appended by another bit string for
conditions. The chromosome corresponds to a solution for this optimal biclus-
ter generation problem. A bit is set to one if the corresponding gene and/or
condition is present in the bicluster, and reset to zero otherwise. Fig. 9.1
depicts such an encoding of genes and conditions in a chromosome.
The initial population is generated randomly. Uniform single-point crossover,

© 2008 by Taylor & Francis Group, LLC


284 SOFT COMPUTING IN BICLUSTERING
0 0 1 1 1 0 1 ...................... 1 0 0 1 1 1 ......... 1 0 0 1 0 0 1 0

Genes Condition

Figure 9.1 An encoded chromosome representing a bicluster.

single-bit mutation and crowded tournament selection are employed in the


multi-objective framework. Both parent and offspring population, in each gen-
eration, are combined to select the best members as the new parent population.
Diversity is maintained within the biclusters by using the crowding distance
operator.

9.3.2 Multi-objective framework

We observe here that one needs to concentrate on generating maximal sets of


genes and conditions while maintaining the “homogeneity” of the biclusters.
These two characteristics of biclusters, being conflicting to each other, are well
suited for multi-objective modeling. In order to optimize this pair of conflicting
requirements, the fitness function f1 is always maximized while function f2 is
maximized as long as the residue does not exceed the threshold δ. They are
formulated as
g×c
f1 = , (9.6)
|G| × |C|
(
G(g,c)
δ if G(g, c) ≤ δ
f2 =
0 otherwise,
where g and c are the number of ones in the genes and conditions within the
bicluster, G(g, c) is its mean squared residue score as defined by eqns. (9.2)-
(9.5), δ is the user-defined threshold for the maximum acceptable dissimilarity
or mean squared residue score of the bicluster and G and C are the total
number of genes and conditions of the original gene expression array.
Note that f1 is maximum for g = G and c = C, i.e., when the submatrix
(g, c) is equal to the whole input dataset. Now as the size of the bicluster
increases, so does the mean squared residue. Thereby f2 is allowed to increase
as long as it does not exceed the homogeneity constraint δ. Beyond this we
assign a lower fitness value of zero to f2 , which is ultimately removed during
nondominated front selection of MOEA.

9.3.3 Local search

Since the initial biclusters are generated randomly, it may happen that some
irrelevant genes and/or conditions get included in spite of their expression val-
ues lying far apart in the feature space. An analogous situation may also arise

© 2008 by Taylor & Francis Group, LLC


MULTI-OBJECTIVE BICLUSTERING 285
during crossover and mutation in each generation. These genes and conditions,
with dissimilar values, need to be eliminated deterministically. Furthermore,
for good biclustering, some genes and/or conditions having similar expression
values need to be incorporated as well. In such situations, local search strate-
gies [6] can be employed to add or remove multiple genes and/or conditions. It
was observed that, in the absence of local search, stand-alone single-objective
or multi-objective EAs could not generate satisfactory solutions [14, 15]. The
algorithm starts with a given bicluster and an initial gene expression array
(G, C). The irrelevant genes or conditions having mean squared residue above
(or below) a certain threshold are now selectively eliminated (or added) using
the following conditions. A “node” refers to a gene or a condition in the sequel.

1. Multiple nodes deletion.

(a) Compute eic , egj , egc and G(g, c) of the bicluster by eqns. (9.2)-(9.5).
(b) Remove all genes i ∈ g satisfying
1 X
(eij − eic − egj + egc )2 > α × G(g, c). (9.7)
|c| i∈g

(c) Recompute eic , egj , egc and G(g, c).


(d) Remove all conditions j ∈ c satisfying
1 X
(eij − eic − egj + egc )2 > α × G(g, c). (9.8)
|g| j∈c

2. Single node deletion, corresponding to a refinement of Step 1.

(a) Recompute eic , egj , egc and G(g, c) of the modified bicluster by Step 1.
(b) Remove the node with largest mean squared residue (done for both gene
and condition), one at a time, until the mean squared residue drops
below δ.

3. Multiple nodes addition.

(a) Recompute eic , egj , egc and G(g, c) of the modified bicluster of Step 2.
(b) Add all genes i ∈
/ g satisfying
1 X
(eij − eic − egj + egc )2 ≤ G(g, c). (9.9)
|c| i∈g

(c) Recompute eic , egj , egc and G(g, c).


(d) Add all conditions j ∈
/ c satisfying
1 X
(eij − eic − egj + egc )2 ≤ G(g, c). (9.10)
|g| j∈c

© 2008 by Taylor & Francis Group, LLC


286 SOFT COMPUTING IN BICLUSTERING
It is proven that node deletion decreases the mean squared residue score of
the bicluster [6]. Here the parameter α determines the rate of node deletion.
Usually a higher value of α implies a decrease in multiple node deletion, such
that the resulting bicluster size increases. This leads to an increase in execution
time, during fine tuning in Step 2 of the algorithm.

9.3.4 Algorithm

The Nondominated Sorting Genetic Algorithm (NSGA II) in combination


with the local search procedure of Section 9.3.3 is used for generating the
set of biclusters. The main steps of the proposed algorithm, repeated over a
specified number of generations, are outlined as follows.

1. Generate a random population of size P .


2. Delete or add multiple nodes (genes and conditions) from each individual
of the population, as discussed in Section 9.3.3.
3. Calculate the multi-objective fitness functions f1 and f2 , using eqns. (9.6)-
(9.7).
4. Rank the population using the dominance criteria of MOEA.
5. Calculate crowding distance.
6. Perform selection using crowding tournament selection.
7. Perform crossover and mutation (as in conventional GA) to generate off-
spring population of size P .
8. Combine parent and offspring population.
9. Rank the mixed population using dominance criteria and crowding dis-
tance, as above.
10. Replace the parent population by the best |P | members of the combined
population.

9.3.5 Quantitative evaluation

The bicluster should satisfy two requirements simultaneously. On one hand,


the expression levels of each gene within the bicluster should be similar over
the range of conditions, i.e., it should have a low mean squared residue score.
On the other hand, the bicluster should simultaneously be larger in size. Note
that the mean squared residue represents the variance of the selected genes
and conditions with respect to the coherence (homogeneity) of the bicluster.
In order to quantify how well the biclusters satisfy these two requirements,
we introduce Coherence Index CI as a measure of evaluating their goodness.
Here CI is defined as the ratio of mean squared residue score to the size of
the formed bicluster. Let there be P biclusters of size |gk | × |ck |, ∀k ∈ P in

© 2008 by Taylor & Francis Group, LLC


FUZZY POSSIBILISTIC BICLUSTERING 287
eqn. (9.1), with mean squared residue score Gk (gk , ck ) from eqns. (9.2)-(9.5).
We define
1 X
Gk (gk , ck ) = (eij − eick − egk j + egk ck )2 , (9.11)
|gk | × |ck | i∈g ,j∈c
k k

fk (gk , ck ) = |gk | × |ck |, (9.12)


resulting in
Gk (gk , ck )
CI = min . (9.13)
k∈P fk (gk , ck )
The kth bicluster for k ∈ P is considered to be good, if it has minimum CIk
among all j ∈ P and j 6= k. A small mean square residue indicates that the
corresponding gene set has consistent value over the samples. Note that an
increase in bicluster size also leads to a decrease in the value of CI.

9.4 Fuzzy Possibilistic Biclustering

Often centralized clustering algorithms impose a probabilistic constraint, ac-


cording to which the sum of the membership values of a point in all the
clusters must be equal to one. Although this competitive constraint allows
the unsupervised learning algorithms to find the barycenter (center of mass)
of fuzzy clusters, the obtained evaluations of membership to clusters are not
interpretable as a degree of typicality. Moreover isolated outliers can some-
times hold high membership values to some clusters, thereby distorting the
position of the centroids. The possibilistic approach to clustering [46, 47] as-
sumes that the membership function of a data point in a fuzzy set (or cluster)
is absolute, i.e., it is an evaluation of a degree of typicality not depending
on the membership values of the same point in other clusters. In this section
we first describe the basics of possibilistic clustering, before embarking on the
fuzzy possibilistic biclustering approach.

9.4.1 Possibilistic clustering

Let X = {x1 , . . . , xr } be a set of unlabeled data points, Y = {y1 , . . . , ys }


a set of cluster centers (or prototypes) and U = [upq ] the fuzzy membership
matrix. In the Possibilistic c-means (PCM) algorithm the constraints on the
elements of U are relaxed to [46]
upq ∈ [0, 1] ∀p, q; (9.14)
r
X
0< upq < r ∀p; (9.15)
q=1
_
upq > 0 ∀q. (9.16)
p

© 2008 by Taylor & Francis Group, LLC


288 SOFT COMPUTING IN BICLUSTERING
Roughly speaking, these requirements simply imply that a cluster cannot be
empty and each pattern must be assigned to at least one cluster. This turns
a standard fuzzy clustering procedure into a mode seeking algorithm.

In Ref. [47] the objective function consists of two terms, the first being the
objective function of conventional c-means [48] while the second is a penalty
(regularization) term considering the entropy of clusters as well as their overall
membership values. It is defined as
s X
r s r
X X 1 X
Jm (U, Y ) = upq Epq + (upq log upq − upq ), (9.17)
p=1 q=1
β
p=1 p q=1

2
where Epq = kxq − yp k is the squared Euclidean distance, and the parameter
βp (scale) depends on the average size of the p-th cluster that must be assigned
before the clustering procedure. Thanks to the regularizing term, points with
a high degree of typicality have high upq values while those points not very
representative have low upq values in all the clusters. Note that if we take
βp → ∞ ∀p (i.e., the second term of Jm (U, Y ) is omitted), we obtain a
trivial solution of the minimization of the remaining cost function (i.e., upq =
0 ∀p, q), as no probabilistic constraint is assumed.

The pair (U, Y ) minimizes Jm , under the constraints (9.14)–(9.16), only if [47]
upq = e−Epq /βp ∀p, q, (9.18)
and
Pr
q=1 xq upq
yp = Pr ∀p. (9.19)
q=1 upq
These two equations may be interpreted as formulae for recalculating the mem-
bership functions and the cluster centers [49] following the Picard iteration
technique.

A good initialization of centroids needs to be performed before applying PCM


(say) by using fuzzy c-means [46, 47]. The PCM works as a refinement al-
gorithm, allowing us to interpret the membership as the cluster typicality
degree. Moreover, PCM displays high outlier rejection capability by making
their membership very low.

Note that the lack of probabilistic constraints makes the PCM approach equiv-
alent to a set of s independent estimation problems [50]
" r r
#
^ X 1 X
(upq , y) = arg upq Epq + (upq log upq − upq ) ∀p, (9.20)
u ,y q=1
βp q=1
pq

that can be solved independently one at a time through a Picard iteration of


eqns. (9.18)–(9.19).

© 2008 by Taylor & Francis Group, LLC


FUZZY POSSIBILISTIC BICLUSTERING 289
9.4.2 Possibilistic biclustering

Here we generalize the concept of biclustering in a fuzzy set theoretical ap-


proach. For each bicluster we assign two vectors of membership, one for the
rows and one other for the columns, denoting them respectively by a and b.
In a crisp set framework row i and column j can either belong to the bicluster
(ai = 1 and bj = 1) or not (ai = 0 or bj = 0). An element xij of X belongs
to the bicluster if both ai = 1 and bj = 1, i.e., its membership uij to the
bicluster may be defined as [39]
uij = and(ai , bj ), (9.21)
with the cardinality of the bicluster expressed as
XX
n= uij . (9.22)
i j

A fuzzy formulation of the problem can help to better model the bicluster
and also to improve the optimization process. Now we allow membership uij ,
ai and bj to lie in the interval [0, 1]. The membership uij of a point to the
bicluster is obtained by the average of row and column membership as [39]

ai + b j
uij = . (9.23)
2
The fuzzy cardinality of the bicluster is again defined as the sum of the mem-
berships uij for all i and j from eqn. (9.22). In the gene expression framework
we can now generalize eqns. (9.2)–(9.5)
XX
G= uij d2ij (9.24)
i j

where
2
(eij + egc − eic − egj )
d2ij = (9.25)
n
P
j ij eij
u
eic = P (9.26)
j uij
P
i uij eij
egj = P (9.27)
i uij
P P
i j uij eij
egc = P P . (9.28)
i j uij

The objective is to maximize the bicluster cardinality n while minimizing the


residual G in the fuzzy possibilistic paradigm. Towards this aim we treat one
bicluster at a time, with the fuzzy memberships ai and bj being interpreted
as typicality degrees of gene i and condition j with respect to the bicluster.
These requirements are fulfilled by minimizing the functional JB as

© 2008 by Taylor & Francis Group, LLC


290 SOFT COMPUTING IN BICLUSTERING

X X  ai + b j  X X
JB = d2ij +λ (ai ln(ai )−ai )+µ (bj ln(bj )−bj ). (9.29)
i j
2 i j

The parameters λ and µ control the size of the bicluster by penalizing the
small values of the memberships. Their values can be estimated by simple
statistics over the training set, and then hand-tuned to incorporate possible
a priori knowledge while obtaining desired results.
Setting the derivatives of JB with respect to the memberships ai and bj to
zero, we have
∂J X d2ij
= + λ ln(ai ) = 0, (9.30)
∂ai j
2

∂J X d2ij
= + µ ln(bj ) = 0. (9.31)
∂bj i
2
These lead to the solutions
!
d2ij
P
j
ai = exp − , (9.32)

!
d2ij
P
bj = exp − i . (9.33)

As in the case of standard PCM, the necessary conditions for the minimization
of JB together with the definition of d2ij [eqn. (9.25)] can be used by the
Possibilistic Biclustering (PBC) algorithm to find a numerical solution for the
optimization problem (Picard iteration).
PBC Algorithm

1. Initialize the memberships a and b


2. Compute d2ij ∀i, j using eqn. (9.25)
3. Update ai ∀i using eqn. (9.32)
4. Update bj ∀j using eqn. (9.33)
5. If ka′ − ak < ε and kb′ − bk < ε then stop
else jump to Step 2

The parameter ε is a threshold controlling the convergence of the algorithm.


The memberships’ initialization can be made randomly or by using some a
priori information about relevant genes and conditions. Moreover the PBC
algorithm can also be used as a refinement step for other existing algorithms,
using their results for initialization. After convergence the memberships a
and b can be defuzzified with respect to a threshold (say, 0.5) for subsequent
comparative analysis.

© 2008 by Taylor & Francis Group, LLC


EXPERIMENTAL RESULTS 291
9.5 Experimental Results

The two soft computing based biclustering algorithms described in Section 9.3
and 9.4.2 were implemented on the benchmark gene expression Yeast data. As
the problem suggests, the size of an extracted bicluster should be as large as
possible while satisfying a homogeneity criterion. The threshold δ was selected
as 300 for Yeast data in Refs. [6, 51, 31, 19, 14, 29]. There being no definite
guidelines available in literature for the choice of δ, and with a view to pro-
viding a fair comparison with existing methods, we have often used the same
parameter settings for δ and α; viz., δ = 300 with α = 1.2. We have also made
a detailed study on the variation of these parameters. The crossover and mu-
tation probabilities of 0.75 and 0.03 were selected after several experiments
with random seeds. However it was noticed that the crossover and mutation
parameters had insignificant effect on the results, as compared to that of δ and
α. Due to memory constraints, we restricted the population size to 50. Addi-
tionally, we investigated the effect of lower δ values in order to demonstrate
the biological relevance of the extracted smaller biclusters.
The Yeast cell cycle data∗ is a collection of 2884 genes (attributes) under 17
conditions (time points), having 34 null entries with −1 indicating the missing
values. All entries are integers lying in the range of 0 to 600. The missing values
are replaced by random number between 0 to 800, as in [6].

9.5.1 Multi-objective evolutionary

Table 9.1 Best biclusters for Yeast data after 50 generations with δ = 300

α Bicluster No. of No. of Mean squared CI


size genes conditions residue
1.1 6447 921 7 206.77 0.032
1.2 8832 1104 8 249.61 0.028
1.3 9846 1094 9 263.48 0.027
1.4 11754 1306 9 298.54 0.025
1.5 12483 1387 9 299.88 0.024
1.6 12870 1287 10 299.85 0.023
1.7 12970 1297 10 299.87 0.023
1.8 14828 1348 11 286.27 0.019
1.9 13783 1253 11 299.95 0.022

Table 9.1 summarizes the best biclusters for Yeast data after 50 generations,
∗ http://arep.med.harvard.edu/biclustering

© 2008 by Taylor & Francis Group, LLC


292 SOFT COMPUTING IN BICLUSTERING
CI

0.032
0.03
0.028
0.026
0.024
0.022
0.02
0.018

1.9
1.8
1.7
1.6
260 1.5
280 1.4 Alpha
300 1.3
320 1.2
Delta 340 1.1

Figure 9.2 Plot of CI for different choices of α and δ on Yeast data.

Bicluster Size

18000
16000
14000
12000
10000
8000
6000

1.9
1.8
1.7
1.6
260 1.5
280 1.4 Alpha
300 1.3
320 1.2
Delta 340 1.1

Figure 9.3 Plot of bicluster size for different choices of α and δ on Yeast data.

with δ = 300, for different values of α. The population size is chosen to be 50.
The largest sized bicluster is found at α = 1.8 for each δ, with coherence index
CI being minimal and indicating the goodness of the discovered partitions. The
minimum value of CI is 0.019 when δ = 300 and α = 1.8, with a corresponding
bicluster size of 14,828 being the best in the table. As explained earlier, a low
mean squared residue indicates a high coherence of the discovered biclusters.
It may also include some trivial biclusters containing insignificant fluctuations
in their expression values, and are not of interest to our study. Hence δ is used
as an upper limit on the allowable dissimilarity among genes and conditions.
However, a higher δ is indicative of diminishing homogeneity.
Figs. 9.2 and 9.3 depict the 3D plots of CI and bicluster size, against the
variations of parameters δ and α. It is observed that with increasing α and δ,
the bicluster size also increases while CI proportionately decreases.

© 2008 by Taylor & Francis Group, LLC


EXPERIMENTAL RESULTS 293
Biological validation
The biological relevance of smaller biclusters for the Yeast cell-cycle data, with
δ=20, was investigated in terms of the statistically significant Gene Ontology
(GO) annotation database† . Here genes are assigned to three structured, con-
trolled vocabularies (ontologies) that describe gene products in terms of asso-
ciated biological processes, components and molecular functions in a species-
independent manner.
We have measured the degree of enrichment i.e., p-values‡ using a cumulative
hypergeometric distribution, that involves the probability of observing the
number of genes from a particular GO category (viz., function, process, com-
ponent) within each bicluster. The probability p for finding at least k genes,
from a particular category within a cluster of size n, is expressed as
X fi g−f
k−1
 
n−i
p=1− g
 , (9.34)
i=0 n

where f is the total number of genes within a category and g is the total
number of genes within the genome [52]. The p-values are calculated for each
functional category in each cluster. Statistical significance is evaluated for
the genes in each bicluster by computing p-values, that signify how well they
match with the different GO categories. Note that a smaller p-value, closer to
zero, is indicative of a better match.
Table 9.2 shows the significant shared GO terms (or parent of GO terms) used
to describe the set of genes (12 and 18) in each small bicluster (generated by
tuning λ and µ ), for the process, function and component ontologies. Only
the three significant common terms with increasing order of p-value (i.e.,
decreasing order of significance) are displayed. For the first cluster, the genes
(TRM82, TRM112) are particularly involved in the process of tRNA and
RNA methaylation, tRNA modification; while genes (GBP2, AGE1, TOM20,
VPS21, PRS4, SSK22, NHP10, SOK1, etc.) are employed in cellular process,
intracellular transport, etc. The values within parentheses after each GO term
in columns 2–4 of the table, such as (2, 0.00024) in the first row, indicate that
out of twelve genes in the first cluster two belong to this process and their
statistical significance is provided by a p-value of 0.00024. Note that the genes
in the cluster share other GO terms also, but with a lower significance (i.e.,
have higher p-value).
From the table we notice that each extracted bicluster is distinct along each
category. For example, the most significant processes in the second cluster
are cell organization and biogenesis (genes LSM2, RRP7, NHP10, TOM20,
ECM9, EMG1, SEC65), rRNA processing (genes LSM2, RRP7, EMG1) and
† http://db.yeastgenome.org/cgi-bin/GO/goTermFinder
‡ The p-value of a statistical significance test represents the probability of obtaining values
of the test statistic that are equal to or greater in magnitude than the observed test
statistic

© 2008 by Taylor & Francis Group, LLC


294 SOFT COMPUTING IN BICLUSTERING

Table 9.2 Significant Shared GO Terms (Process, Function, Component) of the se-
lected 12, 18 genes for Yeast data

No. of Process Function Component


Genes
tRNA methayla- tRNA (guanine) cytosolic small
tion
(2, 0.00024), RNA methyltransferase ribosomal subunit
methaylation activity (6.07e-05), (sensu Eukaryota)
(2, 0.00027), tRNA methyl- (2, 0.0046), Eu-
biopolymer karyotic
methaylation (2, transferase activity 48S initiation com-
0.0014), plex
12 tRNA modification (2, 0.00027), RNA (2, 0.004), Eukary-
otic
(2, 0.0015), cellular methyl transferase 43S preinitiation
process (12, activity (2, 0.0006), complex (2,
0.0052), 0.0062),
intracellular trans- methyltransferase small ribosomal
port
(4, 0.006), estab- activity (2, 0.007) subunit (2, 0.010)
lishment
of cellular localiza-
tion
(4, 0.0072)
cell organization protein transporter nucleus (4, 0.0053),
and
biogenesis (9, activity (2, 0.0067) small nucleolar
0.0048),
18 rRNA processing ribonucleo protein
(3, 0.008), primary complex (2, 0.0089)
transcript process-
ing
(2, 0.0120), mem-
brane
lipid biosynthesis
(2, 0.0130)

© 2008 by Taylor & Francis Group, LLC


EXPERIMENTAL RESULTS 295

15000

10000
n

5000

0
105
100
0.36
mu 95 0.34
0.32
90 0.30
0.28 a
0.26 lambd

Figure 9.4 Size of the biclusters vs. parameters λ and µ.

membrane lipid biosynthesis (genes VRA7, FEN1). Looking at the function


category of each cluster, we discover that the most significant terms for the
first cluster are tRNA (guanine) methyltransferase activity (genes TRM82,
TRM112), and for the second cluster it is protein transporter activity (genes
TOM20, PSE1). Finally, the extracted biclusters also differ in terms of their
cellular component. The genes (RPS22A, RPS16A) of the first bicluster belong
to a small ribosomal subunit, those of the second bicluster (LSM2, RRP7,
EMG1, RPC19) to the nucleus, and genes (NCL1, PRS5, NTC20, SHM1,
GBP2, IES3, PSE1) of the third bicluster to the cell. This indicates that the
methodology is capable of finding potentially biologically significant biclusters.

9.5.2 Possibilistic fuzzy

The parameters λ and µ of eqn. (9.29) were varied, considering a threshold


of 0.5 for the memberships a and b [eqns. (9.32) and (9.33)] of 0.5 for the
defuzzification. The effect of these parameters on the size of the bicluster,
in case of possibilistic fuzzy method, is demonstrated in Fig. 9.4. Results
correspond to an average over 20 runs. It is observed that an increase in these
parameters leads to a larger bicluster. Thus PBC is observed to be slightly
sensitive to initialization of memberships, while being strongly sensitive to
variations in parameters λ and µ. The parameter ε depends on the desired
precision on the final memberships. Here it was set at 10−2 .

Table 9.3 provides a set of biclusters along with the homogeneity G of eqn.

© 2008 by Taylor & Francis Group, LLC


296 SOFT COMPUTING IN BICLUSTERING
(9.24). We are able to generate biclusters of a desired size by tuning the
parameters λ and µ.

Table 9.3 Best biclusters for Yeast data, with respect to the parameters λ and µ.

λ µ No. of No. of Bicluster Mean squared


genes conditions size residue
0.25 115 448 10 4480 56.07
0.19 200 457 16 7312 67.80
0.30 100 654 8 5232 82.20
0.32 100 840 9 7560 111.63
0.26 150 806 15 12090 130.79
0.31 120 989 13 12857 146.89
0.34 120 1177 13 15301 181.57
0.37 110 1309 13 17017 207.20
0.39 110 1422 13 18486 230.28
0.42 100 1500 13 19500 245.50
0.45 95 1622 12 19464 260.25
0.45 95 1629 13 21177 272.43
0.46 95 1681 13 21853 285.00
0.47 95 1737 13 22581 297.40
0.48 95 1797 13 23361 310.72

9.5.3 Comparative study

Table 9.4 is a comparative study on biclusters obtained using some of the


existing methods in the literature [6, 19, 31, 40], using thresholds of δ = 300,
along with the MOEA and PBC algorithms of Sections 9.3 and 9.4.2 ([15, 39]).
Yang et al. [19] identified 100 biclusters with an average of 195 genes and 12.8
conditions. For the Yeast data, DBF [31] discovered 100 biclusters, with most
of them having sizes in the range of 2000 to 3000 and the largest one being
of size 4500. Although FLOC [19] generates larger biclusters than DBF, the
latter has a lower mean squared residue that is indicative of a higher similarity
among genes in the discovered biclusters. Both these methods are regarded

© 2008 by Taylor & Francis Group, LLC


CONCLUSIONS AND DISCUSSION 297
as an improvement over the pioneering algorithm of Ref. [6], with respect
to mean squared residue and bicluster size. The largest size of a bicluster in
Ref. [6] is found to be 4485.

Table 9.4 Comparative study on Yeast data.

Method Average Average Average Average Largest


residue bicluster no. of no. of bicluster
size genes conditions size
FLOC [19] 187.54 1825.78 195 12.8 2000
DBF [31] 114.7 1627.2 188 11 4500
Cheng-Church [6] 204.29 1576.98 167 12 4485
GA [15] 52.87 570.86 191.12 5.13 1408
SEBI [40] 205.18 209.92 13.61 15.25 –
MOEA[15] 234.87 10301.71 1095.43 9.29 14,828
PBC [39] 297.40 22581 1737 13 –

The biclusters discovered in Ref. [51] from Yeast data are of sizes (124 × 8),
(124 × 9), (19 × 8), (19 × 9), (63 × 9), (23 × 9), (20 × 8) and (20 × 9), with
the two entries within the parentheses corresponding to the numbers of genes
and conditions, respectively.
GA has also been used with local search [14], to generate overlapped biclusters.
An initial deterministic selection of biclusters, having similar size, is made for
a uniform distribution of chromosomes in the population. Thereafter GA is
used with minimization of a fitness function, defined as
( 1
f (g,c) if G(g, c) ≤ δ
F (g, c) = G(g,c)
(9.35)
δ otherwise.
The best bicluster generated from Yeast data is reported as 12,350, with an
average size of 8,600.
The simulated annealing based algorithm [44] is able to find significant biclus-
ters of size 18,460 with δ = 300, but it suffers from the “random interference”
problem. The results are also data dependent.

9.6 Conclusions and Discussion

A gene expression data set typically contains thousands of genes. However,


biologists often have different requirements on cluster granularity for different
subsets of genes. For some purpose, biologists may be particularly interested
in some specific subsets of genes and prefer small and tight clusters. While

© 2008 by Taylor & Francis Group, LLC


298 SOFT COMPUTING IN BICLUSTERING
for other genes, people may only need a coarse overview of the data struc-
ture. However, most of the existing clustering algorithms only provide a crisp
set of clusters and may not be flexible to different requirements for cluster
granularity on a single data set. For gene expression data, it would be more
appropriate to avoid the direct partition of the data set and instead provide a
scalable graphical representation of the data structure, leaving the partition
problem to the users.
Biclustering is typically employed in situations involving (say) the (i) partici-
pation of a small set of genes in a cellular process of interest, (ii) study of an
interesting cellular process that is active only over a subset of conditions, (iii)
participation of a single gene in multiple pathways, that may or may not be
coactive under all conditions. Robustness of the algorithms is also desirable,
due to the complexity of the gene regulation processes as well as to intelli-
gently handle the level of noise inherent in the actual experiments. Again, if
a biclustering algorithm could integrate partial knowledge as some clustering
constraints, we can expect the partitions to be biologically more meaningful.
Uncovering genetic pathways (or chains of genetic interactions) is equivalent to
generating clusters of genes with expression levels that evolve coherently under
subsets of conditions, i.e., discovering biclusters where a subset of genes are
coexpressed under a subset of conditions. Such pathways can provide clues on
(say) genes that contribute towards a disease. This emphasizes the possibilities
and challenges posed by biclustering.
However there also exist other application domains, including information re-
trieval, text mining, collaborative filtering, target marketing, market research,
database research and data mining. The tuning and validation of bicluster-
ing methods, in comparison to known biological data, is certainly one of the
important open issues for future research.

References

[1] “Special Issue on Bioinformatics,” Pattern Recognition, vol. 39, 2006.


[2] G. P. Shapiro and P. Tamayo, “Microarray data mining: facing the challenges,”
ACM SIGKDD Explorations Newsletter, vol. 5, pp. 1–5, 2003.
[3] S. Mitra and T. Acharya, Data Mining: Multimedia, Soft Computing, and Bioin-
formatics. New York: John Wiley, 2003.
[4] J. T. Tou and R. C. Gonzalez, Pattern Recognition Principles. London: Addison-
Wesley, 1974.
[5] S. Mitra, H. Banka, and W. Pedrycz, “Rough fuzzy collaborative clustering,”
IEEE Transactions on Systems, Man and Cybernetics: Part B, vol. 36, pp. 795–
805, 2006.
[6] Y. Cheng and G. M. Church, “Biclustering of gene expression data,” in Proceed-
ings of the 8th International Conference on Intelligent Systems for Molecular
Biology (ISMB), pp. 93–103, 2000.
[7] Y. Zhang, H. Zha, and C. H. Chu, “A time-series biclustering algorithm for

© 2008 by Taylor & Francis Group, LLC


REFERENCES 299
revealing co-regulated genes,” in Proceedings of the International Conference on
Information Technology: Coding and Computing (ITCC’05), 2005.
[8] L. Ji and K. L. Tan, “Identifying time-lagged gene clusters using gene expression
data,” Bioinformatics, vol. 21, pp. 509–516, 2005.
[9] S. C. Madeira and A. L. Oliveira, “Biclustering algorithms for biological data
analysis: A survey,” IEEE Transactions on Computational Biology and Bioinfor-
matics, vol. 1, pp. 24–45, 2004.
[10] R. Agarwal, J. Gehrke, D. Gunopulos, and P. Raghavan, “Automatic subspace
clustering of high dimensional data for data mining applications,” in Proceedings
of ACM SIGMOD International Conference on Management of Data, pp. 94–105,
1998.
[11] I. Dhilon, S. Mallela, and D. Modha, “Information-theoretic co-clustering,” in
Proceedings of the 9th International Conference on Knowledge Discovery and
Data Mining (KDD), pp. 89–98, 2003.
[12] A. Banerjee, I. Dhillon, J. Ghosh, S. Merugu, and D. S. Modha, “A generalized
maximum entropy approach to Bregman co-clustering and matrix approxima-
tion,” in Proceedings of the Tenth ACM SIGKDD International Conference on
Knowledge Discovery and Data Mining, pp. 509–514, ACM Press NY, USA, 2004.
[13] R. Peeters, “The maximum edge biclique problem is NP-Complete,” Discrete
Applied Mathematics, vol. 131, pp. 651–654, 2003.
[14] S. Bleuler, A. Prelić, and E. Zitzler, “An EA framework for biclustering of
gene expression data,” in Proceedings of Congress on Evolutionary Computation,
pp. 166–173, 2004.
[15] S. Mitra and H. Banka, “Multi-objective evolutionary biclustering in gene ex-
pression data,” Pattern Recognition, 2006, vol. 39, pp. 2464–2477, 2006.
[16] S. K. Pal and S. Mitra, Neuro-fuzzy Pattern Recognition: Methods in Soft Com-
puting Paradigm. John Wiley, 1999.
[17] G. Getz, H. Gal, I. Kela, D. A. Notterman, and E. Domany, “Coupled two-
way clustering analysis of breast cancer and colon cancer gene expression data,”
Bioinformatics, vol. 19, pp. 1079–1089, 2003.
[18] J. A. Hartigan, “Direct clustering of a data matrix,” Journal of American Sta-
tistical Association (JASA), vol. 67, pp. 123–129, 1972.
[19] J. Yang, H. Wang, W. Wang, and P. Yu, “Enhanced biclustering on expres-
sion data,” in Proceedings of the Third IEEE Symposium on BioInformatics and
Bioengineering (BIBE’03), 2003.
[20] A. Tanay, R. Sharan, and R. Shamir, “Discovering statistically significant bi-
clusters in gene expression data,” Bioinformatics, vol. 18, pp. S136–S144, 2002.
[21] L. Lazzeroni and A. Owen, “Plaid models for gene expression data,” Statistica
Sinica, vol. 12, pp. 61–86, 2002.
[22] H. Qu, L.-P. Wang, Y.-C. Liang, et al., “An improved biclustering algorithm
and its application to gene expression spectrum analysis,” Genomics, Proteomics
and Bioinformatics, vol. 3, pp. 189–193, 2005.
[23] H. L. Turner, T. C. Bailey, W. J. Krzanowski, and C. A. Hemingway, “Bi-
clustering models for structured microarray data,” IEEE/ACM Transactions on
Computational Biology and Bioinformatics, vol. 2, pp. 316–329, 2005.
[24] A. Battle, E. Segal, and D. Koller, “Probabilistic discovery of overlapping cellu-
lar processes and their regulation,” in Proceedings of the Eighth Annual Interna-
tional Conference on Research in Computational Molecular Biology, pp. 167–176,
ACM Press NY, USA, 2004.

© 2008 by Taylor & Francis Group, LLC


300 SOFT COMPUTING IN BICLUSTERING
[25] L. Candillier, I. Tellier, F. Torre, and O. Bousquet, “SSC: Statistical subspace
clustering,” in 4th International Conference on Machine Learning and Data Min-
ing in Pattern Recognition (P. Perner and A. Imiya, eds.), vol. LNAI 3587,
pp. 100–109, 2005.
[26] G. Park and W. Szpankowski, “Analysis of biclusters with applications to
gene expression data,” in International Conference on Analysis of Algorithms
(C. Martnez, ed.), Theoretical Computer Science Proceedings AD, pp. 267–274,
2005.
[27] Y. Kluger, R. Basri, J. T. Chang, and M. Gerstein, “Spectral biclustering of
microarray data: Coclustering genes and conditions,” Genome Reaserch, vol. 13,
pp. 703–716, 2003.
[28] J. Liu, W. Wang, and J. Yang, “A framework for ontology-driven subspace
clustering,” in Proceedings of the Tenth ACM SIGKDD International Conference
on Knowledge Discovery and Data Mining (KDD ’04), pp. 623–628, ACM Press,
2004.
[29] A. H. Tewfik and A. B. Tchagang, “Biclustering of DNA microarray data with
early pruning,” in Proceedings of ICASSP 2005, pp. V773–V776, 2005.
[30] E. Segal, B. Taskar, A. Gasch, N. Friedman, and D. Koller, “Rich probabilistic
models for gene expression,” Bioinformatics, vol. 17, pp. S243–S252, 2001.
[31] Z. Zhang, A. Teo, B. C. Ooi, and K. L. Tan, “Mining deterministic biclus-
ters in gene expression data,” in Proceedings of the Fourth IEEE Symposium on
Bioinformatics and Bioengineering (BIBE’04), 2004.
[32] W. H. Au, K. C. C. Chan, A. K. C. Wong, and Y. Wang, “Attribute clustering
for grouping, selection, and classification of gene expression data,” IEEE/ACM
Transactions on Computational Biology and Bioinformatics, vol. 2, pp. 83–101,
2005.
[33] J. Liu, J. Yang, and W. Wang, “Biclustering in gene expression data by ten-
dency,” in Proceedings of the 2004 Computational Systems Bioinformatics Con-
ference (CSB 2004), 2004.
[34] Z. B. Joseph, “Analysing time series gene expression data,” Bioinformatics,
vol. 20, pp. 2493–2503, 2004.
[35] A. A. Melkman and E. Shaham, “Sleeved coclustering,” in Proceedings of the
Tenth ACM SIGKDD International Conference on Knowledge Discovery and
Data Mining (KDD ’04), pp. 635–640, ACM Press, 2004.
[36] A. B. Tchagang and A. H. Tewfik, “DNA microarray data analysis: A
novel biclustering algorithm approach,” Journal on Applied Signal Processing
(EURASIP), vol. Article ID 59809, pp. 1–12, 2006.
[37] S. C. Madeira and A. L. Oliveira, “A linear time biclustering algorithm for
time series gene expression data,” in WABI 2005, LNBI 3692 (R. Casadio and
G. Myers, eds.), pp. 39–52, Berlin: Springer-Verlag, 2005.
[38] A. Prelic, S. Bleuler, P. Zimmermann, A. Wille, P. Buhlman, W. Gruissem,
L. Hennig, L. Thiele, and E. Zitzler, “A systematic comparison and evaluation of
biclustering methods for gene expression data,” Bioinformatics, vol. 22, pp. 1122–
1129, 2006.
[39] M. Filippone, F. Masulli, S. Rovetta, S. Mitra, and H. Banka, “Possibilistic ap-
proach to biclustering: An application to oligonucleotide microarray data analy-
sis,” in Proceedings of the International Conference on Computational Methods
in Systems Biology, LNCS, pp. 312–322, Springer, 2006.
[40] F. Divina and J. S. Aguilar-Ruiz, “Biclustering of expression data with evolu-

© 2008 by Taylor & Francis Group, LLC


REFERENCES 301
tionary computation,” IEEE Transactions on Knowledge and Data Engineering,
vol. 18, pp. 590–602, 2006.
[41] A. Ben-Dor, B. Chor, R. Karp, and Z. Yakini, “Discovering local structure in
gene expression data: The order preserving submatrix problem,” in 6th Interna-
tional Conference on Computational Biology (NY, USA), pp. 49–57, ACM Press,
2002.
[42] B. J. Gao, O. L. Griffith, M. Ester, and S. J. M. Jones, “Discovering significant
OPSM subspace clusters in massive gene expression data,” in Proceedings of the
12th ACM SIGKDD International Conference on Knowledge Discovery and Data
Mining, pp. 922–928, ACM Press, 2006.
[43] S. Bleuler and E. Zitzler, “Order preserving clustering over multiple time course
experiments,” in EvoWorkshops 2005, LNCS 3449 (F. Rothlauf et al., ed.),
pp. 33–43, Berlin: Springer-Verlag, 2005.
[44] K. Bryan, P. Cunningham, and N. Bolshakova, “Biclustering of expression data
using simulated annealing,” in 18th IEEE Symposium on Computer-Based Med-
ical Systems (CSMB 2005), pp. 93–103, 2000.
[45] K. Deb, Multi-Objective Optimization using Evolutionary Algorithms. London:
John Wiley, 2001.
[46] R. Krishnapuram and J. M. Keller, “A possibilistic approach to clustering,”
IEEE Transactions on Fuzzy Systems, vol. 1, pp. 98–110, 1993.
[47] R. Krishnapuram and J. M. Keller, “The possibilistic c-means algorithm: in-
sights and recommendations,” IEEE Transactions on Fuzzy Systems, vol. 4,
pp. 385–393, 1996.
[48] R. O. Duda and P. E. Hart, Pattern Classification and Scene Analysis. Wiley,
1973.
[49] F. Masulli and A. Schenone, “A fuzzy clustering based segmentation system
as support to diagnosis in medical imaging,” Artificial Intelligence in Medicine,
vol. 16, pp. 129–147, 1999.
[50] O. Nasraoui and R. Krishnapuram, “Crisp interpretations of fuzzy and possi-
bilistic clustering algorithms,” EUFIT 95: 3rd European Congress on Intelligent
Techniques and Soft Computing, vol. 3, pp. 1312–1318, 1995.
[51] H. Cho, I. S. Dhilon, Y. Guan, and S. Sra, “Minimum sum-squared residue
co-clustering of gene expression data,” in Proceedings of 4th SIAM International
Conference on Data Mining, 2004.
[52] S. Tavazoie, J. D. Hughes, M. J. Campbell, R. J. Cho, and G. M. Church, “Sys-
tematic determination of genetic network architecture,” Nature Genet., vol. 22,
pp. 281–285, 1999.

© 2008 by Taylor & Francis Group, LLC


CHAPTER 10

Bayesian Machine-Learning Methods


for Tumor Classification Using Gene
Expression Data

Bani K. Mallick
Texas A & M University

Debashis Ghosh
University of Michigan

Malay Ghosh
University of Florida

10.1 Introduction

Precise classification of tumors is crucial for cancer diagnosis and treatment.


The ability to target specific therapies to pathogenetically distinct tumor types
is very important for cancer treatment because it maximizes efficacy and min-
imizes toxicity [19]. Diagnostic pathology has traditionally relied on macro-
and microscopic histology and tumor morphology as the basis for tumor clas-
sification. The downside of it, however, is the inability to discriminate among
tumors with similar histopathologic features, as these features vary in clin-
ical course and in response to treatment. This justifies the growing interest
in changing the basis of tumor classification from morphologic to molecular,
using microarrays which provide expression measurements for thousands of
genes simultaneously [35, 10]. The idea is to carry out classification on the
basis of different expression patterns. Several studies using microarrays to
profile colon, breast and other tumors have demonstrated the potential power
of this idea [2, 21]. Gene expression profiles may offer more information than,
and provide an alternative to, morphology-based tumor classification systems.
The introduction of microarray technology has raised a variety of statistical is-
sues, ranging from low-level issues such as preprocessing and normalization of
the data [44, 53] to differential expression of genes in experimental conditions

303

© 2008 by Taylor & Francis Group, LLC


304 BAYESIAN METHODS FOR TUMOR CLASSIFICATION
[12, 24]. In this chapter, we will be focusing on the problem of classification
based on microarray data.
In such analyses, there exists a set of observations that contains vectors of
gene expression data as well as the labels of the corresponding tissues. These
observations are utilized to fit a classification model which can be applied to
predict the tissue types for new samples. Golub et al. [19] employed supervised
learning methods and derived discriminant decision rules using the magnitude
and the threshold of prediction strength. However, they did not provide the
procedure for selecting a cutoff value, which is an essential ingredient for their
approach. Heuristic rules for selecting the threshold could be one option, but
this would undoubtedly be subjective. Moler et al. [31] proposed a naive Bayes
model and Xiong et al. [52] conducted linear discriminant analysis for tumor
classification. Brown et al. [7] used a support vector machine to classify genes
rather than samples. Dudoit et al. [11] compared several discriminant methods
for classification of tumors.
A major problem with microarray data analysis is that the sample size n is
small compared to the number of genes p. This is usually called the “large p,
small n” problem [50]. Faced with this problem, we need a dimension reduction
method to reduce the high-dimensional gene space. Most existing approaches
perform a preliminary selection of genes based on some ‘filtering’ criterion
and use only 5 − 10% of the genes for classification. In the approach described
here, we can utilize all the genes rather than eliminating most of them based
on a crude criterion.
Several authors have proposed such methods for the analysis of gene expres-
sion data. Efron et al. [12] have used a nonparametric empirical Bayes ap-
proach for gene profiling whereas Ibrahim et al. [24] suggested a parametric
mixture model and used a gene selection algorithm along with the L mea-
sure statistic for evaluating models. Both groups were mainly interested in
the issue of differential expression. West et al. [49] considered a classification
approach based on probit regression. Lee et al. [26] used a variable selection
approach with mixture priors in a similar setup. In this article we construct
Bayesian binary classification models for prediction based on a reproducing
kernel Hilbert space (RKHS) [3, 33] approach. The methods are quite general
and, in particular, can be used for tumor classification.
Usually RKHS has been used in a decision theoretic framework with no explicit
underlying probabilistic model. As a result, it is not possible to assess the
uncertainty either of the classifier itself or of the predictions based on it.
Our goal here is to present a full probabilistic model-based approach to RKHS-
based classification. First we consider the logistic classifier in this framework,
and then extend it to support vector machine (SVM) classifiers [8, 39]. As with
other regularization methods, there are smoothing or regularization param-
eter(s) which need to be tuned appropriately for efficient classification. One
popular approach is to use generalized approximate cross validation (GACV)

© 2008 by Taylor & Francis Group, LLC


INTRODUCTION 305
[48] to tune the smoothing parameters. In this chapter we take a different ap-
proach, namely, developing a hierarchical model where the unknown smooth-
ing parameter will be interpreted as a shrinkage parameter [9]. We will put a
prior distribution on it and obtain its posterior distribution via the Bayesian
paradigm. The prediction results from this model turn out to be quite compet-
itive to those from classical RKHS results. In this way, we obtain not only the
point predictors but also the associated measures of uncertainty. Furthermore,
we can extend the model to incorporate multiple smoothing parameters, which
will lead to significant improvements in prediction for the examples consid-
ered. These models will be compared with respect to their classification errors.
One numerical issue here is that the posterior distributions are not available
in an explicit form. Hence a Markov chain Monte Carlo (MCMC) based com-
putation approach [18, 15] will be used to generate samples from the posterior.
Our models are applied to three publicly available microarray datasets: the
leukemia dataset of Golub et al. [19], the hereditary breast cancer data from
Hedenfalk et al. [21] and the colon tumor study of Alon et al. [2].

Before proceeding further, we briefly review the current literature on Bayesian


learning, and compare our proposal with some existing methods. Tipping [42,
43] and Bishop and Tipping [6] introduced relevance vector machines (RVM’s)
in place of SVM’s. Their objective, like ours, was to obtain entire predictive
distributions for future observations rather than just point predictors. In the
classification context, they began with a likelihood based on binary data with
a logit link function, as in Section 11.4.1 of this chapter. The logits were
assumed to have a regression structure with a fairly general basis function
including the one considered here. Then a Gaussian distribution was assigned
to the vector of regression coefficients (which they call “weights”). Finally
the Bayesian procedure amounted to finding the posterior modes of these
regression coefficients, or some approximations thereof. Figueiredo [13] took
a similar approach, but used the probit instead of the logit link. He also used
Jeffreys’ prior instead of the usual Gaussian prior for regression coefficients.
Zhu and Hastie [54] proposed a frequentist approach using only a subset of the
regression vectors. They referred to the resulting procedure as Import Vector
Machine (IVM) and used iteratively reweighted least squares (IRLS) as the
fitting method.

The present approach, though similar in spirit, is operationally quite different


from the above. First, the logits or the probits are not deterministic functions
of the basis vectors, but include in addition, a random error to account for any
unexplained sources of variation. For classification models with binary data it
is well known that conjugate priors do not exist for the regression coefficients
and hence the computation becomes much harder. In this chapter, we exploit
the idea of this random residual component within the model which enables
us to calculate the marginal probabilities for a particular model structure
analytically, and we also develop an algorithm based on that. As a result
of adopting a Gaussian residual effect, many of the conditional distributions

© 2008 by Taylor & Francis Group, LLC


306 BAYESIAN METHODS FOR TUMOR CLASSIFICATION
for the model parameters are of the standard form, which greatly aids the
computations. Also, rather than estimating the hyperparameters, we assign
distributions to them, thus accounting for uncertainty due to estimation of
hyperparameters. Finally, a key feature of our method is the treatment of
model uncertainty through a prior distribution over the kernel parameter.
RVM introduces sparseness in the model by considering heavy-tailed priors
such as double exponential for the regression coefficients [6, 13]. This oppor-
tunity exists also for the SVM as considered in this chapter, even though the
binary probabilities are then modeled differently. In fact, in our examples,
with a Bayesian hierarchical setup the SVM shows more sparseness than the
logistic model. Several authors exploited this sparseness property to select sig-
nificant genes [37, 26]. To do this, we would need to consider a linear structure.
Our main emphasis, however, is to obtain predictive distributions for future
observations to be used for classification rather than direct estimation of the
parameters. So we use a nonlinear model with unknown kernel parameter.
The idea of multiple smoothing parameters used in this chapter has also been
addressed elsewhere. In the machine learning literature, this is known as auto-
matic relevance determination (ARD) [29, 32]. An advantage of using multiple
parameters is that it enables one to detect the varying influence of different
regression coefficients for prediction or classification.
Section 10.2 introduces the RKHS-based classification method. The hierarchi-
cal classification model is introduced in Section 10.3. Section 10.4 provides the
different likelihoods for the logistic and the support vector machine classifica-
tion models. Implementation of the Bayesian method is discussed in Section
10.5. Section 10.6 discusses prediction and model choice. Section 10.7 con-
tains the examples. Section 10.8 presents some simulation results. Finally,
some concluding remarks are made in Section 10.9.
One may wonder about the possibility of using neural networks as an al-
ternative to the RKHS-based classification. But unlike the RKHS, the neural
networks cannot project the prediction problem into the data space and, thus,
are not particularly suitable for the analysis of microarray data (where the
number of regressors p vastly exceeds n, the sample size). So, once again,
preliminary gene selection is needed to use neural networks.

10.2 Classification Using RKHS

For a binary classification problem, we have a training set {yi , xi }, i = 1, . . . , n,


where yi is the response variable indicating the class to which the ith observa-
tion belongs, and xi is the vector of covariates of size p. Our goal is to predict
the posterior probability of belonging to one of the classes given a set of new
covariates, based on the training data. Usually the response is coded as yi = 1
for class 1 and yi = 0 (or −1) for the other class. We utilize the training data

© 2008 by Taylor & Francis Group, LLC


CLASSIFICATION USING RKHS 307
y = (y1 , · · · , yn )T and X T = (x1 , · · · , xn ) to fit a model p(y|x) and use it to
obtain P (y∗ = 1|y, x∗ ) for a future observation y∗ with covariate x∗ .

For our problem, we have binary responses as yi = 1 indicates that the tumor
sample i is from class 1 and yi = 0 (or −1) indicates that it belongs to class
2, for i = 1, . . . , n. Gene expression data on p genes for n tumor samples
are summarized in the form of an n × p matrix; its (i, j)th entry xij is the
measurement of the expression level of the jth gene for the ith sample (i =
1, . . . , n; j = 1, . . . , p). It is assumed that the expression levels xij represent
rigorously processed data that have undergone image processing as well as
within- and between-slide normalization.

To develop a general model for classification, we need to specify a probability


model for p(y|x) where x is high-dimensional. To simplify the structure, we
introduce the latent variables z = (z1 , . . . , zn ) and assume that p(y|z) =
Q n
i=1 p(yi |zi ), i.e., the yi are conditionally independent given the zi . In the
next stage, the latent variables zi are modeled as zi = f (xi ) + ǫi , i = 1, . . . , n,
where f is not necessarily a linear function, and ǫi ’s, the random residual
effects, are independent and identically distributed N (0, σ 2 ). The use of a
residual component is consistent with the belief that there may be unexplained
sources of variation in the data. To develop the complete model, we need to
specify p(y|z) and f .

In the machine learning literature, most of the binary classification procedures


emerged from a loss function based approach. In the same spirit, we model
p(y|z) on the basis of a loss function l(y, z), which measures the loss for re-
porting z when the truth is y. Mathematically, minimizing this loss function
is equivalent to maximizing −l(y, z), where exp[−l(y, z)] is proportional to
the likelihood function. This duality between “likelihood” and “loss,” particu-
larly viewing the loss as the negative of the log-likelihood, is referred to in the
Bayesian literature as a “logarithmic scoring rule” (see for example, Bernardo,
p. 688 [4]). Specific choices of the loss functions and the corresponding likeli-
hood functions are discussed in Section 10.4.

To model the high-dimensional function f (x), we will employ a rich function-


space setting. Specifically, we will assume that f belongs to an RKHS which
has the advantage of assuring that point evaluation is well defined while, at
the same time, providing a natural choice for basis function approximation. A
Hilbert space H is a collection of functions on a set T with an associated inner
product < g1 , g2 > and norm ||g1 || =< g1 , g1 >1/2 for g1 , g2 ∈ H. A RKHS H
with reproducing kernel K (usually denoted as HK ) is a Hilbert space having
an associated function K on T ×T with the properties: (i) K(·, x) ∈ H, and (ii)
< K(·, x), g(·) >= g(x) for all x ∈ T and for every g in H. Here K(·, x) and
g(·) are functions defined on T with values at x∗ ∈ T equal to K(x∗ , x) and
g(x∗ ) respectively. The reproducing kernel function provides the fundamental
building blocks of H as a result of the following lemma from Parzen [33].

© 2008 by Taylor & Francis Group, LLC


308 BAYESIAN METHODS FOR TUMOR CLASSIFICATION
Lemma 1: If K is a reproducing kernel for the Hilbert space H, then {K(·, x)}
span H.
To prove the lemma it suffices to prove that the only function g in H orthogo-
nal to K(·, x) is the zero function; but this is obvious, since by the reproducing
property < g(·), K(·, x) >= 0 for every x ∈ T implies g(x) = 0 for all x.
PN
A consequence of Lemma 1 is that functions of the form gN (·) = j=1
βj K(·, xj ), where xj ∈ T for each j = 1, · · · , N , are dense in H. More pre-
cisely, for any g ∈ HK , there are choices of N and β1 , · · · , βN such that a gN
can be constructed to approximate g to any desired level of accuracy. Thus,
the reproducing kernel functions are the natural choice for basis expansion
modeling in an RKHS setting.
In the present problem, x1 , . . . , xn are the observed covariate values, z the
latent responses, and we take the unknown function f ∈ HK wherePchoice of
K is discussed below. To find optimal f based on z, x, we minimize ni=1 (zi −
f (xi ))2 + ||f ||2 with respect to f . Arguing as in chapter 1 of Wahba [46], this
minimizer must admit the representation
n
X
f (·) = β0 + βj K(·, xj ). (10.1)
j=1

This reduces the optimization problem to a finite dimension n which is not


large for gene expression data. Also, inference about f boils down to inference

about β = (β0 , β1 , · · · , βn ) .
With the present Bayesian formulation we need a prior for β. We will provide
a flexible and computationally convenient hierarchical prior for β in the next
section. In addition we will allow the kernel functions to depend on some un-
known parameters to enrich the class of kernels and express them as K(·, ·|θ).
Hence, K becomes a function of an unknown parameter θ, but this dependence
will be implicit through the remainder of the paper for notational simplicity.
Different choices of the reproducing kernel K generate different function spaces.
Two common choices are the Gaussian kernel K(xi , xj ) = exp{−||xi − xj ||2 /θ}
θ
and the polynomial kernel K(xi , xj ) = (xi · xj + 1) . Here a · b denotes the
inner product of two vectors a and b. Both these kernels contain a single
parameter θ.

10.3 Hierarchical Classification Model

We can construct a hierarchical model for classification as


p(yi |zi ) ∝ exp{−l(yi , zi )}, i = 1, . . . , n, (10.2)
where the y1 , y2 , · · · , yn are conditionally independent given z1 , z2 , · · · , zn and
l is any specific choice of the loss function as explained in the previous section.

© 2008 by Taylor & Francis Group, LLC


HIERARCHICAL CLASSIFICATION MODEL 309
We relate zi to f (xi ) by zi = f (xi ) + ǫi , where the ǫi are residual random
effects. This formulation is analogous to a generalized mixed linear model, but
is slightly more general than the latter in that the likelihood is not necessarily
restricted to the one-parameter exponential family.
As explained in the previous section, we express f as
n
X
f (xi ) = β0 + βj K(xi , xj |θ) (10.3)
j=1

where K is a positive definite function of the covariates (inputs) x and we


allow some unknown parameters θ to enrich the class of kernels.
The random latent variable zi is thus modeled as
n
X
z i = β0 + βj K(xi , xj |θ) + ǫi = K′i β + ǫi , (10.4)
j=1

where the ǫi are independent and identically distributed N (0, σ 2 ) variables,


and
K′i = (1, K(xi , x1 |θ), . . . , K(xi , xn |θ)), i = 1, . . . , n.

To complete the hierarchical model, we need to assign priors to the unknown


parameters β, θ and σ 2 . We assign to β the Gaussian prior with mean 0 and
variance σ 2 D−1
∗ , where D∗ ≡ Diag(λ1 , λ, · · · , λ) is a (n + 1) × (n + 1) diagonal
matrix, λ1 being fixed at a small value, but λ is unknown. This amounts to a
large variance for the intercept term. We will assign a proper uniform prior to
θ, an inverse Gamma prior to σ 2 and a Gamma prior to λ. A Gamma(α, ξ)
distribution for a random variable, say U , has probability density function
proportional to exp(−ξu)uα−1 , while the reciprocal of U will then be said to
have a IG(α, ξ) distribution. Our model is thus given by
p(yi |zi ) ∝ exp{−l(yi , zi )};
ind
zi |β, θ, σ 2 ∼ N1 (zi |K′i β, σ 2 ); (10.5)
β, σ 2 ∼ Nn+1 (β|0, σ 2 D−1 2
∗ )IG(σ |γ1 , γ2 ), (10.6)
θ ∼ Πpq=1 U (aq1 , aq2 )
λ ∼ Gamma(m, c), (10.7)
where U (aq1 , aq2 ) is the uniform probability density function over (aq1 , aq2 ).
This Bayesian model is similar to the RKHS model as the precision param-
eter or the ridge parameter λ is similar to the smoothing parameter and the
exponent of the Gaussian prior for β is essentially equivalent to the quadratic
penalty function in RKHS context.
We can extend this model using multiple smoothing parameters so that the
prior for (β, σ 2 ) is
β, σ 2 ∼ Nn+1 (β|0, σ 2 D−1 )IG(σ 2 |γ1 , γ2 ), (10.8)

© 2008 by Taylor & Francis Group, LLC


310 BAYESIAN METHODS FOR TUMOR CLASSIFICATION
where D is a diagonal matrix with diagonal elements λ1 , . . . , λn+1 . Once again
λ1 is fixed at a small value, but all other λ’s are unknown. We assign inde-
pendent Gamma(m, c) priors to them. Let λ = (λ1 , . . . , λn+1 )′ .
To avoid the problem of specifying the hyperparameters m and c of λ, we can
use Jeffreys’ independence prior p(λ) ∝ Πn+1 −1
i=1 λi . This is a limiting form of
the gamma prior when both m and c go to 0. Figueiredo [13] observed that
this type of prior promoted sparseness, thus reducing the effective number
of parameters in the posterior. Sparse models are preferable as they predict
accurately using fewer parameters.

10.4 Likelihoods of RKHS Models

We now consider several possible expressions for l(yi , zi ) in (2).

10.4.1 Logistic classification model

If we code the responses yi as 0 or 1 according to the classes, then the probabil-


ity function is p(yi |zi ) = pyi i (zi ){1 −Ppi (zi )}1−yiP
, where pi (zi ) = exp(zi )/{1 +
n n
exp(zi )}. Then the log-likelihood is i=1 yi zi − i=1 log{1 + exp(zi )}. We can
use this log-likelihood function and the Bayesian model given in (10.5)-(10.7)
or (10.5), (10.7) and (10.8) for prediction purposes. In the probit classification
model, the setup is similar, except that pi (zi ) = Φ(zi ), where Φ denotes the
standard normal distribution function.

10.4.2 The support vector machine model

Here we describe the support vector machine (SVM) classification method.


For further details, the reader is referred to Cristiani and Shawe-Taylor [8],
Schölkopf and Smola [39] and Herbrich [22]. We code the class labels as yi = 1
or yi = −1. The idea behind support vector machines is to find a linear
hyperplane that separates the observations with y = 1 from those with y = −1
that has the largest minimal distance from any of the training examples.
This largest minimal distance is known as the margin. In some cases, we can
construct such a hyperplane using the original data space. However, this will
not work in most cases, so that we map the inputs x to vectors φ(x) into
some higher-dimensional space, where the two groups are likely Pto be linearly
n
separable. When linear separability holds, writing f (xi ) = j=1 βj φj (xi ),
among all hyperplanes, f (xi ) + β0 = 0 which separate the training examples,
i.e., satisfy yi (f (xi ) + β0 ) > 0 for all i, the SVM has the largest margin.
Equivalently one can fix the margin as 1, and minimize ||β||2 subject to the
constraint yi (f (xi ) + β0 ) ≥ 1 for all i. If the problem is not linearly separable
we need to introduce the slack variables ξi > 0. Then SVMs minimize kβk2

© 2008 by Taylor & Francis Group, LLC


LIKELIHOODS OF RKHS MODELS 311
among all hyperplanes with margin 1, subject to the constraint yi (f (xi ) +
β0 ) > 1 − ξi for all i = 1, . . . , n. In other words, we are trying to find the
separating hyperplane that maximizes the margin among all classifiers that
satisfy the slack variable conditions. As shown by Wahba [47] or Pontil et al.
1 2
Pnthis optimization problem amounts to finding β which minimizes 2 kβk +
[34],
C i=1 {1 − yi f (xi )}+ , where [a]+ = a if a > 0 and is 0 otherwise, C ≥ 0 is a
penalty term and f is defined in (3). The problem can be solved using nonlinear
programming methods. Fast algorithms for computing SVM classifiers can be
found in Chapter 7 of Cristiani and Shawe-Taylor [8].
In a Bayesian formulation, this optimization problem is equivalent P to finding
the posterior mode of β, where the likelihood is given by exp[− ni=1 {1 −
yi f (xi )}+ ], while β has the N (0, CI n+1 ) prior. However, in our formulation
with latent variables z, we begin instead with the density
( n )
X
p(y|z) ∝ exp − [1 − yi zi ]+ , (10.9)
i=1
2
and assume independent N (f (xi ), σ ) priors for the zi . The rest of the prior
is the same as that given in (10.6) and (10.7) or (10.7) and (10.8).
If we use the density in (10.9), the normalizing constant may involve z. Follow-
ing Sollich [40], one may bypass this problem by assuming a distribution for
z such that the normalizing constant cancels out. If the normalized likelihood
is ( n )
X
p(y|z) = exp − [1 − yi zi ]+ /c(z),
i=1
where c(·) is the normalizing constant, then choosing p(z) ∝ Q(z)c(z), the
joint distribution turns out to be
( n )
X
p(y, z) ∝ exp − [1 − yi zi ]+ Q(z), (10.10)
i=1

as the c(·) cancels from the expression. We will take Q(z) as the product of
independent normal pdf’s with means f (xi ) and common variance σ 2 . This
method will be referred to as the Bayesian support vector machine (BSVM)
classification.
The above procedure, analogous to that in Sollich [40], makes the Bayesian
analysis somewhat similar to the usual SVM analysis, but the prior on z seems
rather artificial, intended mainly to cancel out a normalizing constant. The
other option is to use a Bayesian approach to this problem by evaluating
the normalizing constant properly and using it in the likelihood. Then the
probability model (cf. Sollich [40]) is
(
{1 + exp(−2yi zi )}−1 for |zi | ≤ 1,
p(yi |zi ) = (10.11)
[1 + exp{−yi (zi + sgn(zi ))}]−1 otherwise,

© 2008 by Taylor & Francis Group, LLC


312 BAYESIAN METHODS FOR TUMOR CLASSIFICATION
where sgn(u) = 1, 0 or −1 according as u is greater than, equal or less than 0.
The probability density function given in (10.11) will also be used to perform
a Bayesian analysis. The resulting approach will be referred to as complete
SVM (CSVM) classification and will be compared with BSVM.

10.5 The Bayesian Analysis

For classification problems with binary data and logistic likelihood, conjugate
priors do not exist for the regression coefficients. Hence, without the tailored
proposal densities needed for the implementation of the Metropolis−Hastings
accept-reject algorithm, mixing in the MCMC sampler can be poor as updates
are rarely accepted. The construction of good proposals depends on both the
model and the data. Introducing latent variables zi simplifies computation
[23], as we will now show.
From the Bayes Theorem,
p(β, θ, z, σ 2 , λ|y) ∝ p(y|z, β, θ, σ 2 , λ)p(β, z, θ, λ, σ 2 ). (10.12)
This distribution is complex, and implementation of the Bayesian procedure
requires MCMC sampling techniques, and in particular, Gibbs sampling [15]
and Metropolis−Hastings algorithms [30]. The Gibbs sampler generates pos-
terior samples using conditional densities of the model parameters which we
describe below.
First, we note again that conditional on z, all other parameters are inde-
pendent of y and furthermore the distributions follow from standard results
for the Bayesian linear model. This allows us to adopt conjugate priors for
(β, σ 2 ) and hence perform simulations as well as marginalize over some of the
parameter space.

10.5.1 Conditional distributions

The prior distributions given in (6) and (7) of Section 2 are conjugate for β and
σ 2 , whose posterior density conditional on z, θ, λ is Normal-Inverse-Gamma,
p(β, σ 2 |z, θ, λ) = Nn+1 (β|m̃, σ 2 Ṽ)IG(σ 2 |γ˜1 , γ˜2 ), (10.13)
′ −1 ′ ′ −1
where m̃ = (K0 K0 + D) (K0 z), Ṽ = (K0 K0 + D) , γ˜1 = γ1 + n/2 and
γ˜2 = γ2 + 21 (z′ z − m̃′ Ṽm̃). Here K0 ′ = (K1 , · · · , Kn ), where we recall that
Ki = [K(xi , x1 ), . . . , K(xi , xn )]′ .
The conditional distribution for the precision parameter λi given the coeffi-
cient βi is Gamma and given by
 
1 1
p(λi |βi ) = Gamma m + , c + 2 βi 2 , i = 2, . . . , n + 1. (10.14)
2 2σ

© 2008 by Taylor & Francis Group, LLC


THE BAYESIAN ANALYSIS 313
Finally, the full conditional density for zi is
 
n
1 X
p(zi |z−i , β, σ 2 , θ, λ) ∝ exp −l(yi , zi ) − 2 {zi − βj K(xi , xj )}2  .
2σ j=1

Similarly, the full conditionals are found when λ2 = · · · = λn+1 = λ from


(10.7) and (10.8).

10.5.2 Posterior sampling of the parameters

We make use of the distributions given in Sections 10.4 and 10.5 through
a Gibbs sampler that iterates through the following steps: (i) update z; (ii)
update K, β, σ 2 ; (iii) update λ.
For the update to z, we propose to update each zi in turn conditional on the
rest. That is, we update zi |z−i , y, K, σ 2 , β (i = 1, . . . , n), where z−i indicates
the z vector with the ith element removed.
The conditional distribution of zi does not have an explicit form; we thus
resort to the Metropolis−Hastings procedure with a proposal density T (zi∗ |zi )
that generates moves from the current state zi to a new state zi∗ . The proposed
updates are then accepted with probabilities
p(yi |zi∗ )p(zi∗ |z−i , K)T (zi |zi∗ )
 
α = min 1, ; (10.15)
p(yi |zi )p(zi |z−i , K)T (zi∗ |zi )
otherwise the current state is retained.
We obtain p(yi |zi ) from (10.9) and
p(zi |z−i , K) ∝ exp{−(zi − K i β)2 /(2σ 2 )}.
It is convenient to take the proposal distribution T (zi∗ |zi ) to be a symmet-
ric distribution (say Gaussian) with mean equal to the old value zi and a
prespecified standard deviation.
An update of K is equivalent to that of θ and we need a Metropolis−Hastings
algorithm to perform it. Now we need the marginal distribution of θ condi-
tional on z. We can write
p(θ|z) ∝ p(z|θ)p(θ).

Let θ ∗ denote the proposed change to the parameter. Then we accept this
change with acceptance probability
p(z|θ∗ )
 
α = min 1, . (10.16)
p(z|θ)
The ratio of the marginal likelihoods is given by
 γ˜
p(z | θ∗ ) |Ṽ∗ |1/2 γ̃2 1
= , (10.17)
p(z | θ) |Ṽ|1/2 γ̃2∗

© 2008 by Taylor & Francis Group, LLC


314 BAYESIAN METHODS FOR TUMOR CLASSIFICATION
where Ṽ∗ and γ̃2∗ are similar to Ṽ and γ̃2 with θ ∗ replacing θ. Updating β, σ 2
and λ is straightforward as they are generated from standard distributions.

10.6 Prediction and Model Choice

For a new sample with gene expression xnew , the posterior predictive proba-
bility that its tissue type, denoted by ynew , is cancerous is
Z
p(ynew |xnew , y) = p(ynew = 1|xnew , φ, y)p(φ|y)dφ, (10.18)

where φ is the vector of all the model parameters. Assuming conditional in-
dependence of the responses, this integral reduces to
Z
p(ynew = 1|xnew , φ)p(φ|y)dφ. (10.19)

The associated measure of uncertainty is p(ynew = 1|xnew , y)[1 − p(ynew =


1|xnew , y)]. The integral in (10.19) can be approximated by the Monte Carlo
estimate
XM
p(ynew = 1|xnew , φ(i) )/M, (10.20)
i=1
where φ(i) (i = 1 . . . , M ) are the MCMC posterior samples of the parameter
φ.
To select from the different models, we will generally use misclassification
error. When a test set is provided, we first obtain the posterior distributions
of the parameters (training the model) based on the training data and use
them to classify the test samples. For a new observation from the test set,
say yi,tst , we will obtain the probability p(yi,tst = 1|ytrn , xtst ) by using an
equation similar to (10.19), and approximate it by its Monte Carlo estimate
as in equation (10.20). When this estimated probability exceeds .5, the new
observation is classified as 1. Otherwise, it is classified as 0 or −1, depending
on whether we use the logistic or the SVM likelihood. Rather than using a
fixed classification rule, we can classify ytst conditional on this probability.
If there is no test set available, we use a hold-one-out cross-validation ap-
proach. We will exploit the technique described in Gelfand [16] to simplify
our computation. For the cross-validation predictive density, in general, writ-
ing y−i as the vector of yj ’s minus yi ,
Z −1
p(y)
p(yi |y−i ) = = {p(yi |y−i , φ)}−1 p(φ|y)dφ . (10.21)
p(y−i )
Monte-Carlo integration yields
M h
X i−1
p̂(yi |y−i ) = M/ p(yi |y−i , φ(j) ) ,
j=1

© 2008 by Taylor & Francis Group, LLC


SOME EXAMPLES 315
where φ(j) , j = 1, . . . , M are the MCMC posterior samples of the parameter
vector φ. This simple expression is due to the fact that yi ’s are conditionally
independent given φi ’s. If we wish to make draws from p(yi |y−i,trn ), then we
need to use importance sampling [16].

10.7 Some Examples

We now illustrate the methodology by means of several examples. For all ex-
amples, six models were fit: (i) logistic regression with a single penalty param-
eter; (ii) logistic regression with multiple penalty parameters; (iii) Bayesian
support vector (BSVM) classification with a single penalty parameter; (iv)
Bayesian support vector (BSVM) classification with multiple penalty param-
eters; (v) complete likelihood Bayesian support vector (CSVM) classification
with a single penalty parameter; and (vi) complete likelihood support vec-
tor (CSVM) classification with multiple penalty parameters. We have used
the SVM matlab toolbox to obtain the classical SVM (SVM*) results (see
http://eewww.eng.ohio-state.edu/∼maj/osu svm/). The tuning parameters are
chosen using an iterative solving method for the quadratic programming for-
mulation of the support vector machines known as the Sequential Minimiza-
tion Optimization (SMO). We obtained the RVM [42] matlab code from
http://research.microsoft.com/mlp/RVM/relevance.htm.
Throughout the examples, we selected γ1 and γ2 to give a tight inverse gamma
prior for σ 2 with mean 0.1. For λ we chose m and c so that the mean of the
gamma distribution is small, say 10−3 , but with a large variance; aq1 and aq2 ,
the prior parameters of θ, are chosen using the x in such a way that computa-
tion of the kernel function does not over- or underflow. We performed the data
analysis with both the Gaussian and polynomial kernels K as introduced in
Section 10.3, and the results showed very little difference. The results reported
here are based on Gaussian kernels.
In all the examples we used a burn-in of 5,000 samples, after which every 100th
sample was retained in the next 50,000 samples. The convergence and mixing
of the chain were checked using two independent chains and the methods
described in Gelman [17].

10.7.1 Benchmark comparisons

We utilize artificially-generated data in two dimensions in order to compare


our models with other popular models. In this artificial data both class 1 and
2 were generated from mixtures of two Gaussians by Ripley [35], with the
classes overlapping to the extent that the Bayes error is around 8%.
In addition, we analyzed also three well-known benchmark data sets, compared
results with several state-of-the art techniques, and present the results in Table

© 2008 by Taylor & Francis Group, LLC


316 BAYESIAN METHODS FOR TUMOR CLASSIFICATION

Table 10.1 Modal classification error rates and 95% credible intervals for bench-
mark datasets. Logistic: Logistic regression; BSVM: Bayesian support vector ma-
chine; CSVM: Complete likelihood Bayesian support vector machine; RVM: Rele-
vance vector machine; VRVM: Variational relevance vector machine; Jeff: Analysis
with Jeffreys prior; SVM∗ : Classical support vector machine.

Method Ripley’s Pima Crabs


Logistic (single) 13.0(11,17) 21.4 (20.1,24.3) 5(4,6)
Logistic (multiple) 9.2 (9,12) 19.4 (18.9,21.4) 2(1,3)
BSVM (single) 12.4(11.1,16.8) 21 (20,23.9) 4(2,5)
BSVM (multiple) 8.8(8.4,11.6) 18.9 (18.3,20.6) 1(0,4)
CSVM (single) 12.7(10.8,16.7) 21.3 (19.9,24.1) 4(2,5)
CSVM (multiple) 9.1(8.9,12) 19.2 (18.9,21.6) 2(1,4)
RVM 9.3 19.6 2
VRVM 9.2 19.6 N/A
Jeff(Figrd) 9.6 18.5 0
Neural Networks N/A 22.5 3.0
SVM* 13.2 21.2 4

1. The first two data sets are Pima Indians diabetes and Leptograpsus crabs
[35]. The third one is Wisconsin breast cancer data which contains ten basic
features to classify two types of cancers, malignant and benign. We split the
data randomly into training/testing partitions of sizes 300 and 269, and report
average results over ten partitions.
In addition to the methods listed at the beginning of Section 10.7, we have
performed analyses with variational relevance vector machines (VRVM) [6],
Bayesian neural networks [51] and the analysis using Jeffreys’ prior as de-
scribed in Figueiredo [13]. The results are given in Table 10.1. All our multiple
shrinkage models perform nearly as well as the best available alternatives.

10.7.2 Leukemia data

The leukemia dataset was described in Golub et al. [19]. Bone marrow or pe-
ripheral blood samples are taken from 72 patients with either myeloid leukemia
(AML) or acute lymphoblastic leukemia (ALL). Following the experimental
setup of the original paper, the data are split into training and test sets.
The former consists of 38 samples, of which 27 are ALL and 11 are AML;
the latter consists of 34 samples, 20 ALL and 14 AML. The dataset contains
expression levels for 7129 human genes produced by Affymetrix high-density
oligonucleotide microarrays.

© 2008 by Taylor & Francis Group, LLC


SOME EXAMPLES 317

Table 10.2 Modal classification error rates and 95% credible intervals for Leukemia
data. Logistic: Logistic regression; BSVM: Bayesian support vector machine; CSVM:
Complete likelihood Bayesian support vector machine; RVM: Relevance vector ma-
chine; SVM∗ : Classical support vector machine.

Model modal misclassification error error bound


Logistic (single) 4 (2,6)
Logistic (multiple) 2 (1,4)
BSVM (single) 4 (3,7)
BSVM (multiple) 1 (0,3)
CSVM (single) 5 (3,8)
CSVM (multiple) 2 (1,6)
SVM* 4
RVM 2

Golub et al. [19] constructed a predictor using their weighted voting scheme
on the training samples, and classify correctly on all samples for which a pre-
diction is made, 29 of the 34, declining to predict for the other five. We have
provided our results in Table 10.2 with the modal or most frequent num-
ber of misclassification errors (the modal values) as well as the error bounds
(maximum and minimum number of misclassifications).

Table 10.2 shows that the results produced by the multiple shrinkage models
are superior to the single precision models as well as the classical SVM models.
Though all the multiple shrinkage models performed well, the best performer
among these appears to be the Bayesian support vector machine model.

The use of RKHS leads to a reduction in the dimension of the model, but the
dimension can still be as high as the sample size. In the Bayesian hierarchical
modeling framework, due to shrinkage priors, we obtain sparsity automatically
[42]. The effective number of parameters is the degrees of freedom (DF) of the
′ −1 ′
model, which can be calculated as the trace of K(K K + D−1 ) K ([20], p.
52). Due to the presence of the unknown parameter θ in the expression of K,
this θ induces a posterior distribution for DF (rather than a fixed value). The
posterior distributions of DF for all the three multiple shrinkage models were
very similar. There is a complaint against classical support vector machines
due to lack of sparsity in the classifier but Bayesian version of it can obtain
similar sparse classifier through the shrinkage priors.

© 2008 by Taylor & Francis Group, LLC


318 BAYESIAN METHODS FOR TUMOR CLASSIFICATION

Table 10.3 Modal classification error rates and 95% credible intervals for breast can-
cer data.

Model Modal cross-validation error* Error bound

Logistic (single) 5 (4,8)


Logistic (multiple) 2 (2,4)
BSVM (single) 4 (3,7)
BSVM (multiple) 0 (0,3)
CSVM (single) 5 (3,8)
CSVM (multiple) 2 (1,4)
Feed-forward neural networks 2
Probabilistic Neural networks (r=0.01) 3
kNN(k=1) 4
SVM 4
Perceptron 5

∗: Number of Misclassified Samples

10.7.3 Hereditary breast cancer data

Hedenfalk et al. [21] studied gene expression in hereditary and sporadic breast
cancers. Studying such cancers will allow physicians to understand the differ-
ence between the cancers from mutations in the BRCA1 and the BRCA2
breast cancer genes. In the study, Hedenfalk et al. examined 22 breast tumor
samples from 21 breast cancer patients, and all the patients except one were
women and fifteen of women had hereditary breast cancer, 7 tumors with
BRCA1, 8 tumors with BRCA2. In the analysis of cDNA microarray, 3226
genes were used for each breast tumor sample. We use our methods to clas-
sify BRCA1 versus the other (BRCA2 and sporadic). As a test data set is
not available, we have used full hold-one-out cross-validation test and use the
number of misclassifications to compare different approaches. We present our
results in Table 10.3.
We have compared our cross-validation results with other popular classifica-
tion algorithms including feedforward neural networks [51], k-nearest neigh-
bors (kNN) [14], classical support vector machines (SVM) [45], perceptrons
[36] and probabilistic neural networks [41] in Table 10.2. All these methods
have used expression values of only 51 genes as used in the paper of Hedenfalk
et al. [21]. All the multiple shrinkage models have performed better than any
other methods, with SVM performing the best. The average DF for the multi-
ple shrinkage models are: logistic (10), support vector (12), complete support
vector (13).

10.7.4 Colon tumor dataset

Using Affymetrix oligonucleotide arrays, expression levels for 40 tumor and


22 normal colon tissues are measured from 6500 human genes. Of these genes,

© 2008 by Taylor & Francis Group, LLC


SOME EXAMPLES 319

Table 10.4 Colon Tumor data

Model Modal misclassification error Error bound


Logistic (single) 6 (5,7)
Logistic (multiple) 4 (3,6)
BSVM (single) 6 (4,7)
BSVM (multiple) 3 (3,6)
CSVM (single) 6 (4,8)
CSVM (multiple) 4 (4,6)
RVM 5
Classical SVM 7

the 2000 with the highest minimal intensity across the tissues are selected
for classification purposes and these scores are publicly available. Each score
represents a gene intensity derived in a process described in Alon et al. [2].
We randomly split the data into two parts: 42 data points are used to train
the model and other 20 data points are used as test set. We have provided the
misclassification error results of the test set in Table 4.
Again from the results our conclusions remained the same: the multiple shrink-
age models perform better than single shrinkage models and classical SVM in
terms of misclassification error. The Bayesian SVM performs slightly better
than the other two. The posterior mean DF for support vector and complete
support vector are 14.45 and 12.26, respectively, which is lower than 21.74 for
the logistic model.
The points misclassified by these methods usually lie at the classification
boundary, and are thus difficult to identify properly. An advantage of the
Bayesian approach is that one of its outputs is the quantification of uncer-
tainty of the misclassified predictions. For demonstration purposes, we plotted
the histogram of the posterior misclassification probability of a misclassified
test sample using the logistic model. We observed that the majority of the
mass of the posterior distribution is concentrated on [0.5,0.6]. This suggests
that the sample is hard to classify.

10.7.5 Simulation study

In order to simulate a realistic dataset for comparing the successful multi-


ple shrinkage Bayesian logistic, support vector and complete support vector
models, we used the Leukemia data as a prototype. As realistic values of the
parameters θ and β we used the posterior means from the original analysis
of the data. Then we followed the structure of our models and performed two

© 2008 by Taylor & Francis Group, LLC


320 BAYESIAN METHODS FOR TUMOR CLASSIFICATION

Table 10.5 Simulated data: The average number of misclassifications in the test data
of size 34.

Generation Model
Model Logistic CSVM
Logistic 2.5 3.8
BSVM 2.7 2.2
CSVM 3.2 2.1

sets of simulations to generate the responses Y , one using the logistic model
and the other using the complete support vector model. We replicate each of
the simulations 25 times, generating 25 different data sets. Then we analyze
these training data sets using logistic, BSVM and CSVM models and obtain
the average misclassifications in the test data for the three models. The aver-
age misclassifications should be lowest if we use the true model, but we want
to see how the other models perform in this situation.
When the data are actually generated from a logistic model, the average num-
ber of misclassifications in the test data by using the logistic, BSVM and
CSVM models are respectively 2.5, 2.7, 3.2. Similarly, when the data are
actually generated from a logistic CSVM model, the average number of mis-
classifications in the test data by using the logistic, BSVM and CSVM models
are respectively 3.8, 2.2, 2.1. Though none of the data is originally generated
from the BSVM model (as it has no normalized distribution), in both cases,
it is very near the correct (best) model in terms of average misclassification
error.
The results are given in Table 10.5.

10.7.6 Analysis with Jeffreys’ prior

As discussed in Section 10.3, sparseness can be promoted using Jeffreys’ prior


[13]. We reanalyzed the two datasets using the multiple shrinkage models and
Jeffreys’ prior. The modal number of misclassification and average DF (within
parentheses) results are presented in Table 10.6. In terms of misclassification,
Jeffreys’ prior, in general, is doing worse than the Gaussian prior models but
it has smaller DF.
In the analysis of leukemia data, for the logistic model, we obtained the poste-
rior summary of the DF for the Gaussian prior and Jeffreys’ prior, and clearly
observed the improvement of the latter over the former. Similar improvement
has been observed in support vector and complete support vector models.

© 2008 by Taylor & Francis Group, LLC


CONCLUDING REMARKS 321

Table 10.6 Analysis with Jeffreys’ prior: Average number of misclassifications and
DF (within parentheses) is reported.

Data sets
Model Leukemia Breast cancer
Logistic 2 (6.1) 3 (7.2)
BSVM 2 (5.2) 2 (5.9)
CSVM 3 (5.6) 3 (6.4)

10.8 Concluding Remarks

We have proposed a RKHS-based classification method for microarray data.


It is shown that these models in a Bayesian hierarchical setup with priors
over the shrinkage (smoothing) parameters performed better than other pop-
ular classification methods. Also, multiple shrinkage models always appear
to be superior to single parameter shrinkage models. With multiple shrink-
age parameters, the regular Bayesian SVM model emerges as the winner in
all the examples with the complete SVM finishing a close second all the
time. However, the complete SVM provides a more formal probabilistic mo-
tivation for the use of SVM’s, and are more satisfactory from a Bayesian
angle.
We may point out also that although SVM’s have been very popular in the
machine learning community, one problem with their use in practice in a non-
Bayesian framework is the inability to quantify prediction error. By using
the Bayesian framework, we are able to calculate the uncertainty associated
with the predictions. While Sollich [40] also viewed SVMs from a Bayesian
perspective, his approach did not include priors for the hyperparameters, and
did not also accommodate any potential error in the model specification.
The advantage of the logistic model is that it can be extended easily to multi-
categorical responses with a multinomial model. For support vector machines,
on the other hand, this extension is not that simple. Usually the multicate-
gory problem is reduced to a series of binary problems by constructing pairwise
classifiers or one-versus-rest classifiers. One notable exception is the work of
Lee et al. [26], where a formal Bayes rule is constructed for multicategory
support vector machines.
One of the advantages of SVM is that its performance does not deteriorate
with high input dimension. When the number of parameters exceeds the num-
ber of observations, in contrast to other machine learning methods, SVM’s do
not require an additional projection to the sample space, and then application
of a classification algorithm; the dimension reduction is built automatically

© 2008 by Taylor & Francis Group, LLC


322 BAYESIAN METHODS FOR TUMOR CLASSIFICATION
into SVM methodology. Preliminary selection of highly informative genes can
reduce the noise in the data and thus improve the predictive misclassification
rate, with tighter bounds.
Use of the probit model with introduction of latent variables [1] rather than
a logistic model accelerates the computation significantly. We tried all the
examples with the probit model and the results are almost identical to the
logistic results.
West [49], in a recent article, has addressed the general regression analysis
problem for large p and small n. He achieves dimension reduction through
singular value decomposition (SVD) which expresses the n-dimensional linear
transform of the original p-dimensional regression vector. This linear trans-
form is a function of the SVD factor matrix and the nonnegative singular
values. He used a generalized singular g-prior for the vector of transformed
regression coefficients. West suggested also the possibility of extending his re-
sults by using a Gaussian process prior. The present RKHS formulation is
indeed equivalent to consideration of such priors. However, unlike West, we
do not need the SVD in carrying out the Bayesian analysis. Our method also
allows for modeling an arbitrary (not necessarily linear) function of the mean.
In addition, the likelihood need not necessarily belong to the one-parameter
exponential family.

10.9 Acknowledgments

The first author’s research was partially supported by the National Science
Foundation grant DMS-0203215, National Cancer Institute Grant CA-57030.
The second author’s research was partially supported by MUNN Idea Grant,
Prostate SPORE Seed Grant from the University of Michigan and a Grant
from the National Science Foundation and National Institute of General Medi-
cal Sciences, 1R01GM72007-01. The third author’s research was partially sup-
ported by NIH Grant R01-85414. The authors are indebted to Randy Eubank
for many constructive suggestions that led to a much improved exposition.
The authors are grateful to Emanuel Parzen and Raymond Carroll for helpful
conversations.

References

[1] Albert, J. and Chib, S. (1993) Bayesian analysis of binary and polychotomous
response data. J. Am. Statist. Ass., 88, 669−679.
[2] Alon, U., Barkai, N., Notterman, D.A., Gish, K., Ybarra, S., Mack, D., and
Levine, A.J. (1999) Broad patterns of gene expression revealed by clustering
analysis of tumor and normal colon tissues probed by oligonucleotide arrays.
Proc. Nat. Acad. Sci., 96, 6745−6750.

© 2008 by Taylor & Francis Group, LLC


REFERENCES 323
[3] Aronszajn, N. (1950) Theory of reproducing kernels. Trans. Am. Math. Soc., 68,
337−404.
[4] Bernardo, J.M. (1979) Expected information as expected utility. Ann. Statist, 7,
686−690.
[5] Bishop, C. (1995) Neural Networks for Pattern Recognition. Oxford: Clarendon
Press.
[6] Bishop, C. and Tipping, M. (2000) Variational relevance vector machines. In
Proceedings of the 16th Conference in Uncertainty and Artificial Intelligence (eds
C. Boutilier and M. Goldszmidt), pp 46−53. San Francisco: Morgan Kaufmann.
[7] Brown, M.P.S., Grundy, W.N., Lin, D., Cristianini, N., Sugnet, C.W., Furey, T.S.
and Haussler, D. (2000) Knowledge-based analysis of microarray gene expression
data by using support vector machines. Proc. Nat. Acad. Sci., 97, 262−267.
[8] Cristiani, N. and Shawe-Taylor, J. (2000) An Introduction to Support Vector
Machines. Cambridge: Cambridge University Press.
[9] Denison, D., Holmes, C., Mallick, B., and Smith, A.F.M. (2002) Bayesian Meth-
ods for Nonlinear Classification and Regression. London: Wiley.
[10] DeRisi, J.L., Iyer, V.R., and Brown, P.O. (1997) Exploring the metabolic and
genetic control of gene expression on a genomic scale. Science, 278, 680−685.
[11] Dudoit, S., Fridlyand, J., and Speed, T.P. (2002) Comparison of discrimina-
tion methods for the classification of tumors using gene expression data. J. Am.
Statist. Ass., 97, 77−87.
[12] Efron, B., Tibshirani, R, Storey, J.D. and Tusher, V. (2001) Empirical Bayes
Analysis of a Microarray Experiment. J. Am. Statist. Ass., 96(456), 1151–1161.
[13] Figueiredo, M. (2002) Adaptive sparseness using Jeffreys prior. In Neural Infor-
mation Processing Systems 14 (eds T. Dietterich, S. Becker, and Z. Ghahramani),
pp. 697 – 704. Cambridge, MA: MIT Press.
[14] Fix, E. and Hodges, J.L. (1951) Discriminatory analysis-nonparametric dis-
crimination: consistency properties. USAF School of Aviation Medicine, Randolf
Field, Texas.
[15] Gelfand, A. and Smith, A. F. M. (1990) Sampling-based approaches to calcu-
lating marginal densities. J. Am. Statist. Ass., 85, 398−409.
[16] Gelfand, A. (1996) Model determination using sampling-based methods. In
Markov Chain Monte Carlo in Practice (eds W. Gilks, S. Richardson, and D.
J. Spiegelhalter), pp. 145–158. London: Chapman and Hall.
[17] Gelman, A. (1996) Inference and monitoring convergence. In Markov Chain
Monte Carlo in Practice (eds W. Gilks, S. Richardson, and D. J. Spiegelhalter),
pp. 131–140. London: Chapman and Hall.
[18] Gilks, W.R., Richardson, S. and Spiegelhalter, D.J. (1996) Markov Chain Monte
Carlo in Practice, London: Chapman and Hall.
[19] Golub, T.R., Slonim, D., Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov, J.,
Coller, H., Loh, M., Downing, J., Caligiuri, M., Bloomfield, C., and Lander, E.
(1999) Molecular classification of cancer: class discovery and class prediction by
gene expression monitoring. Science, 286, 531–537.
[20] Hastie, T.J. and Tibshirani, R.J. (1990) Generalized Additive Models. London:
Chapman and Hall.
[21] Hedenfalk, I., Duggan, D., Chen, Y., Radmacher, M., Bittner, M., Simon, R.,
Meltzer, P., Gusterson, B., Esteller, M., Kallioniemi, O. P., Wilfond, B., Borg,
A., and Trent, J. (2001). Gene expression profiles in hereditary breast cancer.
New England Journal of Medicine, 344, 539−548.

© 2008 by Taylor & Francis Group, LLC


324 BAYESIAN METHODS FOR TUMOR CLASSIFICATION
[22] Herbrich, R. (2002) Learning Kernel Classifiers. Cambridge: MIT Press.
[23] Holmes, C. and Held, L. (2003) Bayesian auxiliary variable models for binary
and polychotomous regression. Technical Report, Imperial College.
[24] Ibrahim, J.G., Chen, M.H. and Gray, R.J. (2002) Bayesian Models for Gene
Expression with DNA Microarray Data. J. Am. Statist. Ass., 97(457), 88–100.
[25] Kimeldorf, G. and Wahba, G. (1971) Some results on Tchebycheffian spline
functions. J. Math. Anal. Applic., 33, 82-95.
[26] Lee, K.E., Sha, N., Dougherty, E., Vannucci, M., and Mallick, B. (2003) Gene
selection: a Bayesian variable selection approach. Bioinformatics, 19, 90−97.
[27] Lin, X., Wahba, G., Xiang, D., Gao, F., Klein, R., and Klein, B. (2000) Smooth-
ing spline ANOVA models for large data sets with Bernoulli observations and
the randomized GACV. Ann. Statist., 28, 1570−1600.
[28] Lin, Y. (2002) Support vector machines and the Bayes rule in classification.
Data Mining and Knowledge Discovery, 6, 259−275.
[29] MacKay, D. (1996) Bayesian non-linear modelling for the 1993 energy prediction
competition. In Maximum Entropy and Bayesian Methods (ed G. Heidbreder),
pp. 221−234. Dordrecht: Kluwer Academic Press.
[30] Metropolis, N., Rosenbluth, A.W., Rosenbluth, M.N., Teller, A.H. and Teller, E.
(1953) Equations of State Calculations by Fast Computing Machines. J. Chem.
Phys. 21(6), 1087–1092.
[31] Moler, E. J., Chow, M. L., and Mian, I. S. (2000) Analysis of molecular pro-
file data using generative and discriminative methods. Physiological Genetics, 4,
109−126.
[32] Neal, R. (1996) Bayesian Learning for Neural Networks. New York: Springer-
Verlag.
[33] Parzen, E. (1970) Statistical inference on time series by rkhs methods. In
Proc. 12th Biennial seminar (ed. R. Pyke), pp. 1−37. Canadian Mathematical
Congress: Montreal.
[34] Pontil, M., Evgeniou, T., and Poggio, T. (2000). Regularization networks and
support vector machines. Advances in Computational Mathematics, 13, 1−50.
[35] Ripley, B.D. (1996) Pattern Recognition and Neural Networks. Cambridge: Cam-
bridge University Press.
[36] Rosenblatt F. (1962) Principles of Neurodynamics. New York: Spartan Books.
[37] Roth, V. (2002) The generalized LASSO: a wrapper approach to gene selection
for microarray data. Department of Computer Science, University of Bonn.
[38] Schena, M., Shalon, D., Davis, R., and Brown, P. (1995) Quantitative monitor-
ing of gene expression patterns with a complementary DNA microarray. Science,
270, 467−470.
[39] Schölkopf, B. and Smola, A. (2002) Learning with Kernels. Cambridge, MA:
MIT Press.
[40] Sollich, P. (2001) Bayesian methods for support vector machines: evidence and
predictive class probabilities. Machine Learning, 46, 21−52.
[41] Specht, D. F. (1990) Probabilistic neural networks. Neural Networks, 3,
109−118.
[42] Tipping, M. (2000) The relevance vector machine. In Neural Information Pro-
cessing Systems 12 (eds S. Solla, T. Leen, and K. Muller), pp. 652−658. Cam-
bridge, MA: MIT Press.
[43] Tipping, M. (2001) Sparse Bayesian learning and the relevance vector machine.
J. Mach. Learn. Res., 1, 211−244.

© 2008 by Taylor & Francis Group, LLC


REFERENCES 325
[44] Tseng, G.C., Oh, M.K., Rohlin, L., Liao, J.C., and Wong, W.H. (2001) Issues
in cDNA microarray analysis: quality filtering, channel normalization, models of
variations and assessment of gene effects. Nucleic Acids Res., 29, 2549–2557.
[45] Vapnik, V.N. (2000) The Nature of Statistical Learning Theory, 2nd edn. New
York: Springer.
[46] Wahba, G. (1990) Spline Models for Observational Data. Philadelphia: SIAM.
[47] Wahba, G. (1999) Support vector machines, reproducing kernel hilbert spaces
and the randomized GACV. In Advances in Kernel Methods (eds B. Schölkopf,
C. Burges, and A. Smola), pp. 69−88. Cambridge, MA: MIT Press.
[48] Wahba, G., Lin, Y., Lee, Y., and Zhang, H. (2002) Optimal properties and
adaptive tuning of standard and nonstandard support vector machines. In Non-
linear Estimation and Classification (eds D. Denison, M. Hansen, C. Holmes, B.
Mallick, and B. Yu), pp. 125 – 143. New York: Springer.
[49] West, M., Blanchette, C., Dressman, H., Huang, E., Ishida, S., Spang, R., Zuzan,
H., Olson Jr, J.A., Marks, J.R. and Nevins, J.R. (2001) Predicting the clinical
status of human breast cancer by using gene expression profiles. Proc. Nat. Acad.
Sci., 98(20), 11462–11467.
[50] West, M. (2003) Bayesian factor regression models in the “large p, small n”
paradigm. Technical Report, Institute for Statistics and Decision Sciences, Duke
University.
[51] Williams, C. and Barber, D. (1998) Bayesian classification with Gaussian priors.
IEEE Trans. Patt. Anal. Mach. Intell., 20, 1342−1351.
[52] Xiong, M.M., Jin, L., Li, W. and Boerwinkle, E. (2000) Tumor classification
using gene expression profiles. Biotechiques, 29, 1264–1270.
[53] Yang, Y.H., Dudoit, S., Luu, P., Lin, D.M., Peng, V., Ngai, J. and Speed, T.P.
(2002) Normalization for cDNA microarray data: a robust composite method
addressing single and multiple slide systematic variation. Nucleic Acids Res.
30(4), e15.
[54] Zhu, J. and Hastie, T. (2002) Kernel logistic regression and the import vector
machine. In Neural Information Processing Systems 14 (eds T. Dietterich, S.
Becker, and Z. Ghahramani), pp. 1081−1088. Cambridge, MA: MIT Press.

© 2008 by Taylor & Francis Group, LLC


CHAPTER 11

Modeling and Analysis of Quantitative


Proteomics Data Obtained from
iTRAQ Experiments

George Michailidis and Philip Andrews


University of Michigan, Ann Arbor

11.1 Introduction

The advent of high throughput technologies over the last two decades (e.g.,
DNA sequencing, gene microarrays, etc) have led to fundamental insights
into the workings of various biological processes. In addition they have pro-
vided inferences about protein interactions and regulation. However, they have
limitations compared to the direct observations of protein expression levels.
High throughput technologies that facilitate this task would enable researchers
to build more accurate and comprehensive protein pathways. However, until
recently most methods used for inferring protein expression levels, such as
Western blots, 2D gel electrophoresis and more recently antibody protein mi-
croarrays, are inherently low-throughput.
The recent development of mass spectrometry based techniques for assessing
the relative abundances of proteins in samples has provided a high-throughput
alternative to these traditional techniques. For example, isotope-coded affin-
ity tags (iCAT) relies on mass-difference labeling, but is limited to ‘duplex
experiments’ (two samples/experimental conditions), and so is the case with
stable isotope labeling of amino acids in culture (SILAC) [11, 15, 20]. In both
technologies, protein quantification is achieved by comparing the mass spec-
trum intensity of the peptides (protein fragments) derived from two samples.
On the other hand, the recent development of the isobaric tagging reagent
(iTRAQ) [27] allows one to compare up to four samples, thus expanding the
range of potentially interesting experiments. Further, a new iTRAQ reagent
that allows the simultaneous processing of up to eight samples would further
expand its range of applications.
In this paper, we present statistical methodology for analyzing quantitative
data obtained from iTRAQ experiments in order to infer differential expression

327

© 2008 by Taylor & Francis Group, LLC


328 MODELING AND ANALYSIS OF iTRAQ DATA
of proteins. Specifically, we develop a model that takes accounts for the various
sources of variability present in the data and also allows for formal testing
of the hypothesis of differential expression of proteins. Some other technical
issues pertinent to the processing of the data, such as normalization and outlier
elimination, are briefly discussed. The remainder of the paper is organized as
follows: a brief overview of the iTRAQ technology is provided next. Section 2
presents the statistical modeling framework and briefly discusses estimation
and inference issues. In Section 3, the methodology is illustrated on a small
data set, while an overview of the range of studies that the technology has
been used for is briefly reviewed in Section 4.

11.1.1 Overview of the iTRAQ technology

We provide next a brief overview of the iTRAQ technology (available from


Applied Biosystems, Inc. CA) that sets the stage for the statistical model
discussed in the next section. A detailed explanation of the technology and its
underlying chemistry is provided in [27]. The iTRAQ reagent consists of four
isobaric tags for labeling peptides, which are indistinguishable with respect
to mass spectrometry (MS), but which yield signature peaks at m/z 114.1,
115.1, 116.1 and 117.1 in MS/MS spectra (see Figure 2, page 1157 in [27]).
These peak areas can be used in turn for relative quantification of proteins.
The availability of four tags allows one to compare up to four samples (e.g.,
normal vs different treatments) in a single experiment. More specifically, the
four distinct iTRAQ tags can be used with four different complex protein
samples, resulting in four labeled peptide pools. The peptide pools are then
mixed together and subjected to 2-dimensional liquid chromatography and
processed by tandem MS, resulting in a set of MS/MS spectra. The MS/MS
spectra observations are then searched against a protein sequence database,
using a database search program, such as Mascot [19], X-tandem [35], Paragon
[24] or Sequest [31] to identify peptides and proteins in the sample. In addition,
the peak areas for the 114.1, 115.1, 116.1 and 117.1 signature iTRAQ masses
are extracted.

11.2 Statistical Modeling of iTRAQ Data

As outlined above, every MS/MS spectrum provides up to four measurements


of peak areas, together with peptide and protein identification information,
as well as a confidence score regarding the quality of the identification. The
important thing to note is that the measurements for the different conditions
(tags) are paired. Furthermore, due to the nature of mass spectrometry tech-
nology, the data have an inherent hierarchical structure; namely, there are
multiple observations (spectra) of a particular peptide, and each full-length
protein is associated with a number of peptides from which it was derived. In

© 2008 by Taylor & Francis Group, LLC


STATISTICAL MODELING OF iTRAQ DATA 329
order to assess whether a particular protein is differentially expressed across
two different experiment conditions, this hierarchical nature of the data struc-
ture needs to be considered to account for the different sources of variability.
The following model introduced in [14] achieves the objective. Let yijkℓ denote
the peak area measurement of the k-th spectrum of the j-th peptide, corre-
sponding to the i-th protein, under condition (tag) ℓ, where i = 1, · · · , I, j =
1, · · · , J(i), k = 1, · · · , K(j) and ℓ = 114, 115, 116 and 117, the four possible
tags available in an iTRAQ experiment. The notation captures the hierarchi-
cal nature of the data; suppose protein i has been identified with J(i) = 3
peptides, which in turn are associated with K(1) = 2, K(2) = 3 and K(3) = 5
spectra, respectively. For ease of notation we drop from the subsequent dis-
cussion index i, since the proposed model is used for each protein separately.
Then, the ratios of two different conditions ℓ and ℓ′ in the log-scale (in order
to overcome the fact that the ratio scale is bounded from below by zero) can
be modeled as follows:
yjkℓ
log( ) = r + pj + ǫjk , (11.1)
yjkℓ′
where r represents the average relative quantification of the protein in the two
experimental conditions, pj is the specific effect of peptide j on the observed
ratio and ǫjk is a MS/MS spectrum specific effect, which is assumed to be
normally distributed with mean zero and constant variance σ 2 . Due to the
fact that the protein fragmentation process into peptides and the peptide
identification process are subject to random variability, it is further assumed
that the peptide specific effects pj are normally distributed with mean zero
and constant variance τ 2 .
The postulated model is known in the literature [18] as a random effects one-
way analysis of variance and the unknown parameters σ 2 and τ 2 as random
components. The proposed model takes into consideration the variability of
the observed ratios both at the MS/MS spectrum level and at the peptide
level, or in other words it says that every observed relative peak area ratio
can be accounted for, by the overall protein ratio r, by a peptide specific
value and by an MS/MS spectrum specific value. Finally, notice that in case a
protein is identified by a single peptide the above model reduces to calculating
r by simple averaging of the observed peak area ratios.

11.2.1 Estimation and inference

The parameters of the model can be estimated using a restricted maximum


likelihood procedure [18], which ensures that the variance components are
nonnegative.
The above model offers two advantages over the current treatment of iTRAQ
data in the literature (see for example [1,12,15]), where a relative quantifica-
tion ratio is calculated as a simple average of the observed values yjkℓ /yjkℓ′ .

© 2008 by Taylor & Francis Group, LLC


330 MODELING AND ANALYSIS OF iTRAQ DATA
Firstly, it takes into consideration the underlying data structure and accounts
for different sources of variability (peptide level, MS/MS spectrum level). As
previously noted [1], there are cases in which the relative expression levels
(observed ratios) exhibit a fairly high degree of variability amongst multiple
measurements of the same peptide for a specific protein and even more im-
portantly across peptides for the same protein. Therefore, a simple averaging
of those ratios ignores (or bypasses) this issue, unlike the proposed model.
Secondly and more importantly, it allows one to formally test for differential
expression of proteins as follows:
the null hypothesis of no change between the two conditions ℓ and ℓ′ is given
by H0 : r = 0, whereas the alternative hypothesis of up/down-regulation of the
protein by HA : r 6= 0. The variance of the estimate r̂ for a protein associated
with J peptides and K MS/MS spectra is given by
τ2 σ2
Var(r̂) = + .
J N
Then, the test statistic Varr̂ (r̂) ∼ tK−1 follows a t-distribution with K − 1
degrees of freedom, which can be used for calculating p-values or the rejection
region of the above hypothesis.
However, in many situations investigators are only interested in statistically
significant changes of a certain magnitude, since they believe that small mag-
nitude ones do not represent genuine biological activity. This is easily incor-
porated in the proposed framework by modifying the null and alternative
hypotheses as follows: H0 : θ1 ≤ r ≤ θ2 vsHA : r ≤ θ1 or r ≥ θ2 , for some
thresholds θ1 and θ2 . For example, θ1 = −.23 and θ2 = .20 correspond to a
15% change in the original scale relative expression levels. Carrying out such a
composite test poses some technical challenges, but the basic technical details
can be found in [12].

11.3 Data Illustration

We illustrate the proposed methodology on two small experiments that were


designed to test the reproducibility of the technology. In both cases, the sample
consisted of 23 purified proteins that were mixed together and tagged with the
iTRAQ reagent. In the first experiment, two equal proportions of the sample
were aliquotted; hence, the expected relative ratios between the ratios of each
identified protein should be one. In the second experiment, three samples were
processed in a 4:2:1 ratio.
For the first experiment, the obtained MS/MS spectra were searched with
the Mascot search engine and 286 produced high confidence identifications
about the peptides and their corresponding proteins. Eighteen out of the
twenty-three proteins in the mixture were identified from 64 unique peptides.
A quantile-quantile plot of the data in log2 scale is shown in Figure 11.1,

© 2008 by Taylor & Francis Group, LLC


DATA ILLUSTRATION 331
which exhibits a very good agreement between the empirical distributions of
the peak areas of the two samples. However, in many cases because of pipeting
errors or other experimental factors, not such good agreement is obtained. In
such a case, normalization of the samples is required (see [32] for a discussion
of the relevant issues in gene microarrays). Our experience has shown that a
quantile based normalization [14] proves adequate. In some instances, prior
biological knowledge dictates that only spectra corresponding to a particular
subset of proteins should be used for normalization purposes. Further, in some
experiments one can include in the sample a number of proteins that act as
internal standards and could be used for such purposes. However, it may hap-
pen that some of these proteins may not be identified by the search engine
and hence one may have to resort to a data driven normalization process.
The mean ratio of the proteins in the two samples together with error bars
Peak areas of the labeled samples (in log-scale)

Peak areas of the labeled samples (in log-scale)

Figure 11.1 Quantile-quantile plot of peak areas of the two tagged samples.

corresponding to two standard errors are shown in Figure 11.2. All the ratios
are very close to their expected level of one. The different lengths of the error
bars reflect the inherent variability in the quantification of the relative protein
expression in the two samples, which is due to two factors: the number of pep-
tides associated with each protein and the number of spectra associated with

© 2008 by Taylor & Francis Group, LLC


332 MODELING AND ANALYSIS OF iTRAQ DATA
each peptide. As noted above, the proposed model accounts for both sources
of variability appropriately.

Figure 11.2 Protein ratios with error bars.

In the second experiment, much more material was loaded in order to achieve
the desired ratios between the samples. This led to obtain 673 spectra that
produced identifications. In total, 17 proteins were identified from 63 unique
peptides. However, one protein was identified from a single spectrum and was
removed from any further analysis. The protein ratios together with error bars
are shown in Figure 11.3. It can be seen that to a large extent the protein
ratios are close to their expected levels, which illustrates the potential of the
iTRAQ technology.

11.4 Discussion and Concluding Remarks

The so-called shotgun proteomic methods [2], coupled with isobaric tagging,
enable high throughput proteomic analysis. The iTRAQ technology has been
applied to date to a number of diverse areas. For example, a number of studies
have looked at cancer biomarkers [16, 8, 6, 14, 26]. Scaling up the technology
to deal with large clinical studies remains an issue, although the recent devel-
opment of an iTRAQ reagent comprised of 8 tags (the four original together

© 2008 by Taylor & Francis Group, LLC


DISCUSSION AND CONCLUDING REMARKS 333

Figure 11.3 Protein ratios with error bars. Top panel, corresponding to the samples
in a 4:1 ratio; bottom panel, samples with a 2:1 ratio.

© 2008 by Taylor & Francis Group, LLC


334 MODELING AND ANALYSIS OF iTRAQ DATA
with the 113, 118, 119 and 121 m/z peaks of MS/MS spectra) [5] will allow
researchers to conduct larger scale studies. The 8-plex iTRAQ reagent is ex-
periencing fast adoption as a number of recent publications attests (see for
example [22, 23]).
Another important area of applications is cell biology and the identification
of biological processes (see for example, [4, 13, 21, 17, 7, 30, 25]). Emerg-
ing areas include neuroscience [33, 1], toxicology [10], organelle profiling [36],
sphosphoproteomics [9, 28], identification of signaling pathways [39] and stem
cell research [34, 29, 37, 38].
To conclude, we presented a statistical model for processing high throughput
protein expression data obtained from a novel isobaric tagging technology.
The main advantages of the proposed modeling framework, based on a one-
way random effects analysis of variance model, are: (i) that it takes into con-
sideration the underlying structure of the data and accounts for the various
sources of variability and (ii) that it allows one to set up a rigorous hypothesis
testing procedure regarding differential expression of proteins.
The availability of only up to eight tags per iTRAQ experiment acts as a
limiting factor in setting up experiments with multiple conditions. In that
case one needs to appropriately combine the data from several experiments,
which introduces an additional source of variability that needs to be taken into
consideration by the model. Ideas from experimental design can be employed
to resolve this issue and this constitutes a topic of current work.

11.5 Acknowledgments

This work is supported in part by NIH grant P41-18627.

References

[1] Abdi, F., Quinn, J.F., Jankovic, J., McIntosh, M., Leverenz, J.B., Peskind, E.,
Nixon, R., Nutt, J., Chung, K., Zabetian, C., Samii, A., Lin, M., Hattan, S., Pan,
C., Wang, Y., Jin, J., Zhu, D., Li, G.J., Liu, Y., Waichunas, D., Montine, T.J. and
Zhang, J. (2006) Detection of biomarkers with a multiplex quantitative proteomic
platform in cerebrospinal fluid of patients with neurodegenerative disorders. J.
Alzheimers Dis., 9, 293–348.
[2] Aebersold, R. and Mann, M. (2003) Mass spectrometry based proteomics. Nature,
422, 198–207.
[3] Aggarwal, K., Choe, L.H., and Lee, K.H. (2006) Shotgun proteomics using the
iTRAQ isobaric tags. Proteomics, 5, 2297.
[4] Bantscheff, M., Eberhard, D., Abraham, Y., Bastuck, S., Boesche, M., Hobson,
S., Mathieson, T., Perrin, J., Raida, M., Rau, C., Reader, V., Sweetman, G.,
Bauer, A., Bouwmeester, T., Hopf, C., Kruse, U., Neubauer, G., Ramsden, N.,
Rick, J., Kuster, B. and Drewes, G. (2007) Quantitative chemical proteomics

© 2008 by Taylor & Francis Group, LLC


REFERENCES 335
reveals mechanisms of action of clinical ABL kinase inhibitors. Nat. Biotechnol.,
25, 1035–1044.
[5] Choe, L., D’Ascenzo, M., Relkin, N.R., Pappin, D., Ross, P., Williamson, B.,
Guertin, S., Pribil, P. and Lee, K.H. (2007) 8-Plex quantitation of changes in
cerebrospinal fluid protein expression in subjects undergoing intravenous im-
munoglobulin treatment for Alzheimer’s disease. Proteomics, 7, 3651–3660.
[6] Comuzzi, B. and Sadar, M.D. (2006) Proteomic analyses to identify novel thera-
peutic targets for the treatment of advanced prostate cancer. Cell Sci, 3, 61–81.
[7] Dean, R.A. and Overall, C.M. (2007) Proteomics discovery of metalloproteinase
substrates in the cellular context by iTRAQ labeling reveals a diverse MMP-2
substrate degradome. Mol. Cell. Prot. 6, 611–623.
[8] Desouza, L.V., Grigull, J., Ghanny, S., Dube, V., Romaschin, A.D., Colgan, T.J.
and Siu, K.W. (2007) Endometrial carcinoma biomarker discovery and verifi-
cation using differentially tagged clinical samples with multidimensional liquid
chromatography and tandem mass spectrometry. Mol. Cell. Prot., 6, 1170.
[9] Gafken, P.R. and Lampe, P.D. (2006) Methodologies for characterizing phospho-
proteins by mass spectrometry. Cell Commun. Adhes. 13, 249–262.
[10] Gluckmann, M., Fella, K., Waidelich, D., Merkel, D., Kruft, V., Kramer, P.J.,
Walter, Y., Hellmann, J., Karas, M. and Kroger, M. (2007) Prevalidation of po-
tential protein biomarkers in toxicology using iTRAQ reagent technology. Pro-
teomics, 7, 1564–1574.
[11] Gygi, S.P., Rist, B., Gerber, S.A., Turecek, F., Gelb, M.H. and Aebersold, R.
(1999) Quantitative analysis of complex protein mixtures using isotope-coded
affinity tags. Nat. Biotechnol., 17, 994–999.
[12] Hodges, J.L. and Lehmann, E.L. (1954) Testing the approximate validity of
statistical hypotheses. J. Roy. Stat. Soc. B, 16, 261–268.
[13] Jagtap, P., Michailidis, G., Zielke, R., Walker, A.K., Patel, N., Strahler, J.R.,
Driks, A., Andrews, P.C. and Maddock, J.R. (2006) Early events of Bacillus
anthracis germination identified by time-course quantitative proteomics. Pro-
teomics, 6, 5199–5211.
[14] Keshamouni, V.G., Michailidis, G., Grasso, C.S., Anthwal, S., Strahler, J.R.,
Walker, A., Arenberg, D.A., Reddy, R.C., Akulapalli, S., Thannickal, V.J., Stan-
diford, T.J., Andrews, P.C. and Omenn, G.S. (2006) Differential protein expres-
sion profiling by iTRAQ-2DLC-MS/MS of lung cancer cells undergoing epithelial-
mesenchymal transition reveals a migratory/invasive phenotype. J. Proteome
Res., 5, 1143–1154.
[15] Krijgsveld, J., Ketting, R.F., Mahmoudi, T., Johansen, J., Artal-Sanz, M., Ver-
rijzer, C.P., Plasterk, R.H.A. and Heck, A.J.R. (2003) Metabolic labeling of C.
elegans and D. melanogaster for quantitative proteomics. Nat Biotechnol., 21,
927–931.
[16] Kristiansson, M.H., Bhat, V.B., Babu, I.R., Wishnok, J.S. and Tannenbaum,
S.R. (2007) Comparative time-dependent analysis of potential inflammation
biomarkers in lymphoma-bearing SJL mice. J. Proteome Res., 4, 1735–1744.
[17] Lund, T.C., Anderson, L.B., McCullar, V., Higgins, L., Yun, G.H., Grzywacz,
B., Verneris, M.R. and Miller, J.S. (2007) iTRAQ is a useful method to screen
for membrane-bound proteins differentially expressed in human natural killer cell
types. J. Proteome Res., 6, 644–653.
[18] McCulloch, C.E. and Searle, S.R. Generalized, Linear and Mixed Models, Wiley
(2001).

© 2008 by Taylor & Francis Group, LLC


336 MODELING AND ANALYSIS OF iTRAQ DATA
[19] Mascot, Matrix Science.
[20] Ong, S.E., Blagoev, B., Kratchmarova, I., Kristensen, D.B., Steen, H., Pandey,
A. and Mann, M. (2002) Stable isotope labeling by amino acids in cell culture,
SILAC, as a simple and accurate approach to expression proteomics. Mol. Cell.
Prot., 1, 376–386.
[21] Ono, Y., Hayashi, C., Doi, N., Kitamura, F., Shindo, M., Kudo, K., Tsubata,
T., Yanagida, M. and Sorimachi, H. (2007) Comprehensive survey of p94/calpain
3 substrates by comparative proteomics - Possible regulation of protein synthesis
by p94. Biotechnol J., 2, 565–576.
[22] Ow, S.Y., Cardona, T., Taton, A., Magnuson, A., Lindblad, P., Stensjo, K. and
Wright, P.C. (2008) Quantitative shotgun proteomics of enriched heterocysts
from Nostoc sp. PCC 7120 using 8-Plex isobaric peptide tags. J. Proteome Res.,
7, 1615–1628.
[23] Pierce, A., Unwin, R.D., Evans, C.A., Griffiths, S., Carney, L., Zhang, L., Ja-
worska, E., Lee, C.F., Blinco, D., Okoniewski, M.J., Miller, C.J., Bitton, D.A.,
Spooncer, E. and Whetton, A.D. (2007) Eight-channel iTRAQ enables compar-
ison of the activity of 6 leukaemogenic tyrosine kinases. To appear in Mol. Cell.
Prot.
[24] ProteinPilot Software, Applied Biosystems.
[25] Radosevich, T.J., Reinhardt, T.A., Lippolis, J.D., Bannantine, J.P. and Stabel,
J.R. (2007) Proteome and differential expression analysis of membrane and cy-
tosolic proteins from Mycobacterium avium subsp. paratuberculosis strains K-10
and 187. J. Bacteriol., 189, 1109–1117.
[26] Ralhan, R., Desouza, L.V., Matta, A., Chandra Tripathi, S., Ghanny, S., Datta
Gupta, S., Bahadur, S. and Siu, K.W. (2008) Discovery and verification of
head-and-neck cancer biomarkers by differential protein expression analysis using
iTRAQ-labeling and multidimensional liquid chromatography and tandem mass
spectrometry. To appear in Mol. Cell. Prot.
[27] Ross, P.L., Huang, Y.L.N., Marchese, J.N., Williamson, B., Parker, K., Hattan,
S., Khainovski, N., Pillai, S., Dey, S., Daniels, S., Purkayastha, S., Juhasz, P.,
Martin, S., Bartlet-Jones, M., He, F., Jacobson, A. and Pappin, D.J. (2004) Mul-
tiplexed protein quantitation in Saccharomyces cerevisiae using amine-reactive
isobaric tagging reagents. Mol. Cell. Prot., 3, 1154–1169.
[28] Sachon, E., Mohammed, S., Bache, N. and Jensen, O.N. (2006) Phosphopep-
tide quantitation using amine-reactive isobaric tagging reagents and tandem mass
spectrometry: application to proteins isolated by gel electrophoresis. Rapid Com-
mun. Mass Sp., 20, 1127–1134.
[29] Salim, K., Kehoe, L., Minkoff, M.S., Bilsland, J.G., Munoz-Sanjuan, I. and
Guest, P.C. (2006) Identification of differentiating neural progenitor cell markers
using shotgun isobaric tagging mass spectrometry. Stem Cells Dev., 15, 461–470.
[30] Schilling, O. and Overall, C.M. (2007) Proteomic discovery of protease sub-
strates. Curr. Opin. Chem. Biol., 11, 36–45.
[31] Sequest Sorcerer, Thermo Scientific.
[32] Speed, T. (ed.) Statistical Analysis of Gene Expression Microarray Data, Chap-
man & Hall (2003).
[33] Tannu, N.S. and Hemby, S.E. (2006) Methods for proteomics in neuroscience.
Prog. Brain Res., 158, 41–82.
[34] Unwin, R.D., Smith, D.L., Blinco, D., Wilson, C.L., Miller, C.J., Evans, C.A.,
Jaworska, E., Baldwin, S.A., Barnes, K., Pierce, A., Spooncer, E. and Whet-

© 2008 by Taylor & Francis Group, LLC


REFERENCES 337
ton, A. (2006) Quantitative proteomics reveals post-translational control as a
regulatory factor in primary hematopoietic stem cells. Blood, 107, 4687–4694.
[35] X−tandem search algorithm, The Global Proteome Machine Organization.
[36] Yan, W., Hwang, D. and Aebersold, R. Quantitative proteomic analysis to profile
dynamic changes in the spatial distribution of cellular proteins. Humana Press
(2008).
[37] Yocum, A.K., Gratsch, T.E., Leff, N., Strahler, J.R., Hunter, C.L., Walker, A.K.,
Michailidis, G., Omenn, G.S., OShea, S.K. and Andrews, P.C. (2008) Coupled
global and targeted proteomics of human embryonic stem cells during induced
differentiation. Mol. Cell. Prot., 7, 750–767.
[38] Zhang, J., Sui, J., Ching, C.B. and Chen, W.N. (2008) Protein profile in
neuroblastoma cells incubated with S- and R-enantiomers of ibuprofen by
iTRAQ-coupled 2-D LC-MS/MS analysis: Possible action of induced proteins
on Alzheimer’s disease. To appear in Proteomics.
[39] Zhang, Y., Wolf-Yadlin, A., Ross, P.L., Pappin, D.J., Rush, J., Lauffenburger,
D.A. and White, F.M. (2005) Time-resolved mass spectrometry of tyrosine phos-
phorylation sites in the epidermal growth factor receptor signaling network re-
veals dynamic modules. Mol. Cell. Prot., 4, 1240–1250.

© 2008 by Taylor & Francis Group, LLC


CHAPTER 12

Statistical Methods for Classifying


Mass Spectrometry Database Search
Results

Zhaohui S. Qin, Peter J. Ulintz, Ji Zhu and Philip Andrews


University of Michigan, Ann Arbor

12.1 Introduction

Proteomics, the large scale analysis of proteins, holds great promise to enhance
our understanding of cellular biological process in normal and disease tissue
[32]. The proteome is defined as the complete set of proteins expressed by a
cell, tissue or organism. Transcript level analysis, as typically measured by
DNA microarray technologies [35, 26], does not provide complete information
on the proteome in that the DNA transcriptional template of an organism is
static, whereas the proteome is constantly changing in response to environ-
mental signals and stress. Recent studies have been unable to establish a con-
sistent relationship between the transcriptome and proteome [3, 30]. The main
reason is that transcript profiles do not provide any information on posttrans-
lational modifications of proteins (such as phosphorylation and glycosylation)
that are crucial for protein transport, localization and function. Studies have
shown that the correlation between mRNA levels and protein abundance was
poor for low expression proteins [17]. Posttranslational modifications such as
glycosylation, phosphorylation, ubiquitination and proteolysis produce further
modifications, which lead to changes in protein abundance.
The ultimate goal of proteomics is to identify and characterize all proteins ex-
pressed in cells collected from a variety of conditions to facilitate comparisons
[30, 1]. Although transcriptome data such as those from microarray stud-
ies reflect the genome’s objectives for protein synthesis, they do not provide
information about the final results of such objectives. Proteomics analysis
provides a more accurate view of biological porcesses, thus offering a better
understanding of the physiologic and pathologic states of an organism, and
serving as an important step in the development and validation of diagnostic
and therapeutics.

339

© 2008 by Taylor & Francis Group, LLC


340 MASS SPECTROMETRY CLASSIFICATION
In the fast-advancing proteomics field, increasingly high-throughput assays for
the identification and characterization of proteins are being developed. Mass
spectrometry is the primary experimental method for protein identification;
tandem mass spectrometry (MS/MS) in particular is now the de facto stan-
dard identification technology, providing the ability to rapidly characterize
thousands of peptides in a complex mixture. In such assays, proteins are first
digested into smaller peptides, and subjected to reverse-phase chromatogra-
phy. Pepetides are then ionized and fragmented to produce signature MS/MS
spectra that are used for identification. More details about this technique can
be found in Link et al. [25] and Washburn et al. [41].

Instrument development continues to improve the sensitivity, accuracy and


throughput of analysis. Current instruments are capable of routinely gener-
ating several thousand spectra per day, detecting sub-femtomolar levels of
protein at better than 10 ppm mass accuracy. Such an increase in instru-
ment performance is limited, however, without effective tools for automated
data analysis. In fact, the primary bottleneck in high-throughput proteomics
production “pipelines” is in many cases the quality analysis and interpreta-
tion of the results to generate confident protein assignments. This bottleneck
is primarily due to the fact that it is often difficult to distinguish true hits
from false positives in the results generated by automated mass spectrometry
database search algorithms. In most cases, peptide identifications are made
by searching MS/MS spectra against a sequence database to find the best
matching database peptide [21]. All MS database search approaches produce
scores describing how well a peptide sequence matches experimental data, yet
classifying hits as “correct” or “incorrect” based on a simple score threshold
frequently produces unacceptable false positive/false negative rates. Conse-
quently, manual validation is often required to be truly confident in the as-
signment of a database protein to a spectrum. Design and implementation
of an efficient algorithm to automate the peptide identification process is of
great interest and presents a grand challenge for the statistician and bioinfor-
matician in the post-genomics era.

An array of strategies for automated and accurate spectral identification rang-


ing from heuristics to probabilistic models has been proposed [11, 33, 8, 4, 19,
9, 16]. Discrimination of correct and incorrect hits is thus an ongoing effort
in the proteomics community [28, 27, 43, 23, 34, 13, 2, 12, 37, 39], with the
ultimate goal being completely automated MS data interpretation. In this
chapter, we intend to provide a concise and up to date review of automated
techniques for classification of database search results, with more details on
a probabilistic approach and a recent machine learning-based approach. The
remaining part of this chapter is organized as follows. In Section 12.2, we
provide a concise overview of the current proteomics technologies. In Section
12.3, we summarize all the methods proposed for classifying database search
results. In Section 12.4, we describe a dataset and the detailed procedure of

© 2008 by Taylor & Francis Group, LLC


BACKGROUND ON PROTEOMICS 341

Figure 12.1 Schematic Diagram of a typical proteomics experiment. Proteins are


extracted from a biological sample, digested and fractionated (separated) prior to
introduction into the mass spectrometer. Spectra generated by the mass spectrometer
are interpreted using algorithms which compare them to amino acid sequences from
a database, returning a list of database peptides which best match each spectrum.
Peptide predictions are validated and combined to produce a list of proteins predicted
to be present in the biological sample.

analyzing it. In Sections 12.5 and 12.6, we close with concluding remarks and
discussions.

12.2 Background on Proteomics

A typical proteomics experiment involves analyzing a biological sample to


identify the proteins present. Generating a list of protein identifications follows
a somewhat standard set of steps that are now briefly outlined in Figure 12.1
(please see Steen and Mann [36] for a general review).
An experiment begins by extracting proteins from a biological sample. This
complex mixture of proteins is reduced to disrupt the tertiary structure of
the individual proteins, the cysteines are blocked to prevent their refolding
and the proteins are digested with a proteolytic enzyme– typically trypsin–
into shorter peptide sequences to render the mixture more amenable to mass
spectrometry. This complex mixture of peptides must be fractionated into
simpler mixtures for introduction into the mass spectrometer. There is a vari-
ety of methods for resolving complex peptide mixtures, all exploiting different
physical properties of individual peptides, e.g., size, charge, hydrophobicity,
or isoelectric point (pI). Two-dimensional separation of peptide mixtures via
liquid chromatography (2D-LC) is now standard. In such an experiment, the
multiple simplified fractionated mixtures are analyzed individually in the mass
spectrometer and the results combined to produce a final dataset of evidence
for the presence of all proteins in the mixture.
Once a peptide mixture from 2D-LC is introduced, the mass spectrometer

© 2008 by Taylor & Francis Group, LLC


342 MASS SPECTROMETRY CLASSIFICATION
measures the masses of the individual peptides. A measurement of the intact
mass of an individual peptide is rarely sufficient to identify it unambiguously,
therefore tandem mass spectrometry (MS/MS) is typically employed. Tandem
mass spectrometry involves two sequential measurements. In the first stage,
the masses of all peptides in the mixture are measured as described above.
From this measurement, very narrow mass ranges corresponding to these in-
dividual “precursor” masses may be selected for further analysis. These se-
lections, ideally consisting of a homogeneous mixture of identical peptides,
undergo further fragmentation. The fragmentation is induced by adding en-
ergy to the isolated peptides, typically by collision with an inert gas in a
process known as collision-induced dissociation (CID). The additional energy
causes these peptides to fragment in a predictable manner. The masses of these
fragments are detected, producing the tandem mass spectrum. This spectrum
may be interpreted to infer the amino acid sequence of the peptide from which
it was produced. A raw tandem mass spectrum may be interpreted manually,
but this process is time-consuming; a typical mass spectrum requires 15-45
minutes to interpret by a trained expert. Consequently, the aforementioned
algorithms such as Sequest [11] and Mascot [33] are typically used to interpret
the spectra automatically. These algorithms make use of a sequence database,
a list of protein amino acid sequences, although it must be noted that a num-
ber of algorithms exist which attempt to infer the peptide sequence directly
from spectra “de novo” without the use of a sequence database (see Johnson
et al. [21] for a general review of both standard “uninterpreted” and “de novo”
methods). The primary goal of the database search algorithms is to return the
peptide sequence in the database which best explains the experimental spec-
trum. A significant amount of attention has been paid over the past fourteen
years to algorithms and heuristics for ranking and scoring sequence/spectrum
matches, but most follow the same underlying principle: for each peptide in
the database, the algorithms generate a theoretical tandem mass spectrum
and match this theoretical spectrum to the experimental spectrum, produc-
ing a score for the match. The result of performing this matching process is
a ranked list of amino acid sequences which best explain the experimental
spectrum (see Figure 12.2). Each experimental spectrum generated by the
instrument will have this associated list of search results. If successful, the
top-scoring result or ‘hit’ will be the correct one. However, the top-scoring
hit is frequently incorrect. Therefore, the fundamental problem becomes one
of identifying which hits are correct given the data returned by the search
algorithm for each experimental mass spectrum.

12.3 Classification Methods

The most straightforward approach to automated analysis of the results of


mass spectrometry database search result is to define specific score-based
filtering thresholds as discriminators of correctness, e.g., accepting Sequest
scores of doubly-charged fully tryptic peptides with XCorr greater than 2.2

© 2008 by Taylor & Francis Group, LLC


CLASSIFICATION METHODS 343

Figure 12.2 Example of Sequest search result (*.out file): A Sequest report resulting
from the search of an MS/MS peaklist against a sequence database. In addition to
search parameter information and some background statistics of the search (the top
portion of the report), a ranked list of matching peptides is provided. Each row in this
list is a potential identification of a peptide that explains the mass spectrum, the top
match being the peptide that the algorithm believes is the best match. Various scores
or attributes are provided for each potential “hit”: Sp, XCorr, deltCn, etc. These
attributes, or additional attributes calculated based on the information provided for
each hit, are the primary data being used in this work.

and delta Cn values at least 0.1 [41]; these thresholds are typically published
as the criteria for which correctness is defined. Other efforts have focused on
establishing statistical methods for inferring the likelihood that a given hit is a
random event. A well known example of this is the significance threshold cal-
culated by the Mascot search algorithm, which by default displays a threshold
indicating the predicted probability of an assignment being greater than 5%
likely to be a false positive based on the size of the database. Use of a reverse
database search to provide a measure of false positive rate is another method
frequently used [28, 31]. More formally, Sadygov and Yates [34] model the fre-
quency of fragment ion matches from a peptide sequence database matching
a spectrum as a hypergeometric distribution, a model also incorporated into
the openly available X!Tandem algorithm [9, 13]; while Geer et al. model this
distribution as a Poisson distribution [16].
Several of these approaches have been implemented directly in the scoring
calculation of new search algorithms [9, 16, 12]. Alternatively, external algo-
rithms may be developed that process the output of the more standard search
platforms such as Mascot or Sequest, classifying results as either correct or
incorrect with an associated probability. Examples of the latter type include

© 2008 by Taylor & Francis Group, LLC


344 MASS SPECTROMETRY CLASSIFICATION
PeptideProphet [23] and QScore [28]. These tools have the advantage of being
able to accommodate results from these existing, well-established search en-
gines that may already be in place in a production lab; conversely, approaches
in which the quality measures are built into the search algorithm scoring are
arguably more user-friendly in that they eliminate the extra post-search pro-
cessing step of having to run a second algorithm.
Keller et al. were among the first to implement a generic tool for classifying
the results of common search algorithms as either correct or incorrect [23].
Their PeptideProphet tool represents arguably the most widely used openly-
available package implementing a probabilistic approach to assess the validity
of peptide assignments generated by MS database search algorithms. Their
approach contains elements of both supervised and unsupervised learning,
achieves a much higher sensitivity than conventional methods based on simple
scoring thresholds. One concern with PeptideProphet, however, is the degree
to which the supervised component of the model can be generalized to new
types of data and the ease with which new potentially useful information can
be added to the algorithm.
Ulintz et al. attempt to address these difficulties by applying a set of standard
“over the counter” methods to the challenging peptide identification problem
[39]. Anderson et al. demonstrated that support vector machines could per-
form well on ion-trap spectra searches using the Sequest algorithm [2]. Our
approaches, based on the latest machine learning techniques, extend this idea,
providing further support for the flexibility and generality of using machine
learning tools with these data. We focus on establishing the effectiveness of two
statistical pattern classification approaches—boosting and random forests—
at improving peptide identification, even in cases in which individual pieces of
information obtained from a particular search result are not completely inde-
pendent or strongly discriminatory (but are easily obtained). Such work will
hopefully result in development of software tools that are easily installed in
a production laboratory setting that would allow convenient filtering of false
identifications with an acceptably high accuracy, either as new tools or as a
complement to currently existing software. The problem of classification of
mass spectrometry-based peptide identification, a binary classification prob-
lem, seems well suited to these algorithms and could lead to more readily-
usable software for automated analysis of the results of mass spectrometry
experiments.

12.3.1 Mixture model approach in peptide prophet

Among all the methods that have been proposed in the literature for the pep-
tide identification problem, the mixture model approach implemented in the
PeptideProphet algorithm [23] is perhaps the best known. In this method, a
discriminant score function F (x1 , x2 , . . . , xS ) = c0 +c1 x1 +· · ·+cS xS is defined

© 2008 by Taylor & Francis Group, LLC


CLASSIFICATION METHODS 345
to combine database search scores x1 , x2 , ..., xS where ci’s are weights. Based
on a training dataset, a Gaussian distribution is chosen to model the discrim-
inant scores corresponding to correct peptide assignments, and a Gamma dis-
tribution is selected to model the asymmetric discriminant scores correspond-
ing to incorrect peptide assignments. All the scores are therefore represented
by a mixture model
p(x) = rf1 (x) + (1 − r)f2 (x),
where f1 (x) and f2 (x) represent the density functions of the two types of
discriminant scores, and r is the proportion of correct peptide identification.
For each new test dataset, the EM algorithm [10] is used to estimate the
probability that the peptide identified is correct. A decision can be made
by comparing the probability to a pre-specified threshold. When compared to
conventional means of filtering data based on Sequest scores and other criteria,
the mixture model approach achieves much higher sensitivity.
A crucial part of the above approach is the choice of discriminant score func-
tion F . In Keller et al. (2002a), the ci ’s are derived in order to maximize
the between- versus within-class variation under the multivariate normal as-
sumption using training data with peptides assignments of known validity. To
make this method work, one has to assume that the training data and the
test data are generated from the same source. In other words, when a new
set of discriminant scores is generated requiring classification, one has to re-
train the weight parameters ci’s using a new corresponding training set; the
discriminant function F is data dependent. In an area such as proteomics in
which there is a good amount of heterogeneity in instrumentation, protocol,
database and database searching software, it is fairly common to come across
data which display significant differences. Its unclear to what degree the results
of a classification algorithm are sensitive to these differences, hence it is desir-
able to automate the discriminant function training step. Another potential
issue is the normal and Gamma distributions used to model the two types of
discriminant scores. There is no theoretical explanation why the discriminant
scores should follow these two distributions; in fact, a Gamma distribution
rather than a normal distribution may be appropriate for both positive and
negative scores when using the Mascot algorithm [33]. It is likely that for a
new set of data generated by different mass spectrometers and/or different
search algorithms, the two distributions may not fit the discriminant scores
well. If they are generically applied, significant higher classification errors may
be produced.

12.3.2 Machine learning techniques

Distinguishing correct from incorrect peptide assignments can be regarded as


a classification problem, or supervised learning, a major topic in the statistical
learning field. Many powerful methods have been developed such as CART,

© 2008 by Taylor & Francis Group, LLC


346 MASS SPECTROMETRY CLASSIFICATION
SVM, random forest, boosting and bagging [18]. Each of these approaches has
some unique features that enable them to perform well in certain scenarios;
SVMs, for example, are an ideal tool for small sample size, large feature space
situations. On the other hand, all approaches are quite flexible and have been
applied to an array of biomedical problems, from classifying tissue types using
microarray data [7] to predicting functions of single nucleotide polymorphisms
[5]. In this chapter, we apply state-of-the-art machine learning approaches to
the peptide assignment problem.

Boosting
The boosting idea, first introduced by Freund and Schapire with their Ad-
aBoost algorithm [14], is one of the most powerful learning techniques intro-
duced during the past decade. It is a procedure that combines many “weak”
classifiers to achieve a final powerful classifier. Here we give a concise descrip-
tion of boosting in the two-class classification setting. Suppose we have a set of
training samples, where xi is a vector of input variables (in this case, various
scores and features of an individual MS database search result produced from
an algorithm such as Sequest—see Figure 12.2) and yi is the output variable
coded as −1 or 1, indicating whether the sample is an incorrect or correct as-
signment of a database peptide to a spectrum. Assume we have an algorithm
that can build a classifier T (x) using weighted training samples so that, when
given a new input x, T (x) produces a prediction taking one of the two values
−1, 1. Then boosting proceeds as follows: start with equal weighted training
samples and build a classifier T1 (x); if a training sample is misclassified, i.e.,
an incorrect peptide is assigned to the spectrum, the weight of that sample
is increased (boosted). A second classifier T2 (x) is then built with the train-
ing samples, but using the new weights, no longer equal. Again, misclassified
samples have their weights boosted and the procedure is repeated M times.
Typically, one may build hundreds or thousands of classifiers this way. A final
score is then assigned to any input x, defined to be a linear (weighted) com-
bination of the classifiers, where w indicates the relative importance of each
classifier. A high score indicates that the sample is most likely a correctly
assigned protein with a low score indicating that it is most likely an incorrect
hit. By choosing a particular value of the score as a threshold, one can select
a desired specificity or a desired ratio of correct to incorrect assignments. In
this work, we use decision trees with 40 leaves for the ‘weak’ classifier, and fix
M equal to 1000.

Random Forests
Similar to boosting, the random forest [6] is also an ensemble method that
combines many decision trees. However, there are three primary differences
in how the trees are grown: 1. Instead of assigning different weights to the
training samples, the method randomly selects, with replacement, n samples
from the original training data; 2. Instead of considering all input variables
at each split of the decision tree, a small group of input variables on which
to split are randomly selected; 3. Each tree is grown to the largest extent

© 2008 by Taylor & Francis Group, LLC


DATA AND IMPLEMENTATION 347
possible. To classify a new sample from an input, one runs the input down
each of the trees in the forest. Each tree gives a classification (vote). The forest
chooses the classification having the most votes over all the trees in the forest.
The random forest enjoys several nice features: it is robust with respect to
noise and overfitting, and it gives estimates of what variables are important
in the classification. A discussion of the relative importance of the different
parameters used in our analysis of MS search results is given in the results
section. The performance of the random forest depends on the strength of
the individual tree classifiers in the forest and the correlation between them.
Reducing the number of randomly selected input variables at each split reduces
both the strength and the correlation; increasing it increases both. Somewhere
in between is an optimal range–usually quite wide.
Support vector machines
The support vector machine (SVM) is another successful learning technique
introduced in the past decade (Vapnik 1999). It typically produces a non-
linear classification boundary in the original input space by constructing a
linear boundary in a transformed version of the original input space. The
dimension of the transformed space can be very large, even infinite in some
cases. This seemingly prohibitive computation is achieved through a positive
definite reproducing kernel, which gives the inner product in the transformed
space. The SVM also has a nice geometrical interpretation in the finding of a
hyperplane in the transformed space that separates two classes by the biggest
margin in the training samples, although this is usually only an approximate
statement due to a cost parameter. The SVM has been successfully applied
to diverse scientific and engineering problems, including bioinformatics [20,
7, 15]. Anderson et al. [2] introduced the SVM to MS/MS spectra analysis,
classifying Sequest results as correct and incorrect peptide assignments. Their
result indicates that the SVM yields less false positives and false negatives
compared to other cutoff approaches.
However, one weakness of the SVM is that it only estimates the category of
the classification, while the probability p(x) is often of interest itself, where
p(x) = P (Y = 1|X = x) is the conditional probability of a sample being in
class 1 (i.e., correctly identified peptide) given the input x. Another problem
with the SVM is that it is not trivial to select the best tuning parameters
for the kernel and the cost. Often a grid search scheme has to be employed,
which can be time consuming. In comparison, boosting and the random forest
are very robust, and the amount of tuning needed is rather modest compared
with the SVM.

12.4 Data and Implementation


12.4.1 Reference datasets

In the remainder of this chapter, we present performance comparison results


from the aforementioned algorithms on a published dataset of Keller et al.

© 2008 by Taylor & Francis Group, LLC


348 MASS SPECTROMETRY CLASSIFICATION

Table 12.1 Number of spectra examples for the ESI-SEQUEST dataset.


Training Testing
Correct 1930 827
Incorrect 24001 10286

(2002b) where the protein content is known. In particular, we intend to bench-


mark the performance of boosting and random forest methods in comparison
with other approaches using a “gold-standard” dataset. The assay used to
generate this dataset represents one of the two most common protein MS
ionization approaches: electrospray ionization (ESI) (the other being Matrix-
Assisted Laser Desorption ionization (MALDI)). The results are selected and
summarized from our previous publication [39]. This dataset is referred to as
the ESI-Sequest dataset from here on.
The electrospray dataset was kindly provided by Andy Keller, as described in
Keller et al. [23, 24]. These data are combined MS/MS spectra generated from
22 different LC/MS/MS runs on a control sample of 18 known (nonhuman)
proteins mixed in varying concentrations. A ThermoFinnigan ion trap mass
spectrometer was used to generate the dataset. In total, the data consists of
37,044 spectra of three parent ion charge states: [M + H]+ , [M + 2H]2+ and
[M + 3H]3+ . Each spectrum was searched by Sequest against a human protein
database with the known protein sequences appended. The top-scoring pep-
tide hit was retained for each spectrum; top hits against the known eighteen
proteins were labeled as “correct,” and manually verified by Keller et al. All
peptide assignments corresponding to proteins other than the eighteen in the
standard sample mixture and common contaminants were labeled as “incor-
rect.” In all, 2698 (7.28%) peptide assignments were determined to be correct.
The distribution of hits is summarized in Table 12.1.

12.4.2 Dataset parameters

The attributes extracted from SEQUEST assignments are listed in Table 12.2.
Attributes include typical scores generated by the SEQUEST algorithm (pre-
liminary score (Sp), Sp rank, deltaCn, XCorr), as well as other statistics in-
cluded in a SEQUEST report (total intensity, number of matching peaks,
fragment ions ratio). Number of tryptic termini (NTT) is a useful measure
for search results obtained by specifying no proteolytic enzyme, and is used
extensively in Keller et al. [23]. Other parameters include features readily ob-
tainable from the candidate peptide sequence: C-term residue (K=‘1’, R=‘2’,
others=‘0’), number of prolines and number of arginines. A new statistic, the
Mobile Proton Factor (MPF), is calculated, which attempts to provide a sim-
ple measure of the mobility of protons in a peptide; it is a theoretical measure
of the ease of which a peptide may be fragmented in the gas phase [42, 22, 38].

© 2008 by Taylor & Francis Group, LLC


DATA AND IMPLEMENTATION 349

Table 12.2 SEQUEST attribute descriptions. Attribute names in bold are treated as
discrete categorical variables.
Attribute Group Attribute Name SEQUEST Name Description
PeptideProphet (I)
Delta MH+ (M+H)+ Parent ion mass error between observed and
theoretical
Sp Rank Rank/Sp Initial peptide rank based on preliminary score
Delta Cn deltCn 1 - Cn: difference in normalized correlation scores
between next-best and best hits
XCorr XCorr Cross-correlation score between experimental and
theoretical spectra
Length Inferred from Peptide Length of the peptide sequence
NTT (II)
NTT Inferred from Peptide Measures whether the peptide is fully tryptic (2),
partially tryptic (1), or non-tryptic (0)
Additional (III)
Parent Charge (+1), (+2), (+3) Charge of the parent ion
Total Intensity total inten Normalized summed intensity of peaks
DB peptides within # matched peptides Number of database peptides matching the parent
mass window peak mass within the specified mass tolerance
Sp Sp Preliminary score for a peptide match
Ion Ratio Ions Fraction of theoretical peaks matched in the
preliminary score
C-term Residue Inferred from Peptide Amino acid residue at the C-term of the peptide
(1 = R, 2 = ‘K’, 0 = ‘other’)
Number of Prolines Inferred from Peptide Number of prolines in the peptide
Number of Arginines Inferred from Peptide Number of arginines in the peptide
Calculated (IV)
Proton Mobility Factor calculated A measure of the ratio of basic amino acids to free
protons for a peptide

We include MPF and the other derived parameters to demonstrate the ease of
accommodation of additional information into the classification algorithms.

12.4.3 Implementation

For each of the ESI-Sequest datasets, we construct one balanced training


and testing dataset by random selection. To be specific, correct-labeled and
incorrect-labeled spectra were sampled separately so that both the training
and the testing datasets contain the same proportion of correctly identified
spectra. For all results, evaluation was performed on a test set that does not
overlap the training set. Two-thirds of all data were used for training and
one-third was used for testing.
The PeptideProphet application used in this analysis was downloaded from
peptideprophet.sourceforge.net. The *.out search result files from Sequest were
parsed; only the top hit for each spectrum was kept. PeptideProphet was run
by executing the runPeptideProphet script using default parameters.

© 2008 by Taylor & Francis Group, LLC


350 MASS SPECTROMETRY CLASSIFICATION
For the boosting and random forest approaches, we used contributed packages
for the R programming language (http://www.r-project.org). In general,
we did not fine-tune the parameters (i.e., tree size, number of trees, etc.) of
the random forest and boosting for two reasons: classification performances
of both the random forest and boosting are fairly robust to these parameters,
and also because our ultimate goal is to provide a portable software tool that
can be easily used in a production laboratory setting. Therefore, we wanted
to demonstrate the superior performances of these methods in a user-friendly
way.
For the AdaBoost [14] analysis, we used decision tree with 40 leaves for the
weak classifier and fixed the number of boosting iterations to 1000. For random
forest, the default number of attributes for each tree (one-third of total number
of attributes) was used except for the five-variable case in which the number of
attributes was fixed at two. The default number of trees in the forest was 500,
and each tree in the forest was grown until the leaf was either pure or had only
fives samples. We didn’t use cross-validation to fine tune the random forest (as
we do below for the SVM). All settings reflect the defaults of the randomForest
v4.5-8 package available in the R statistical programming language.
With the support vector machine, we chose a radial kernel to classify the
spectra as implemented in the libSVM package (version 2.7)∗ . The radial ker-
nel is flexible and performed well in preliminary studies. In order to select
the optimal set of tuning parameters for radial kernel, a grid search scheme
was adopted using a modified version of the grid.py python script distributed
with the libSVM package. The training set was randomly decomposed into
two subsets, and we use cross-validation to find the best combination of tun-
ing parameters. The optimal parameters for these data found via course grid
search were γ = 3.052e − 05 and cost = 32768.0.

12.5 Results and Discussion

12.5.1 Classification performance on the ESI-SEQUEST dataset

Each mass spectrometry database search result can be sorted based on the
resulting scoring statistics, from most confident to least confident. For Peptide-
Prophet, the samples are ordered highest to lowest on the basis of a posterior
probability as described in Keller et al. [23]. In the case of the machine learn-
ing algorithms discussed here, in addition to a correct or incorrect label, the
algorithms also return an additional “fitness” term. For random forest, the
fitness term can be interpreted as a probability of the identification being cor-
rect. A probability score can be generated from the boosting fitness measure
as well using a simple transformation. The SVM returns a classification and a
measure of the distance to a distinguishing hyperplane in attribute space that
∗ http://www.csie.ntu.tw/∼cjin/libsvm/

© 2008 by Taylor & Francis Group, LLC


RESULTS AND DISCUSSION 351
can be considered a confidence measure. When samples are ordered in this
way, results of such classification and scoring can be represented as a Receiver
Operating Characteristic (ROC) plot, which provides a way of displaying the
ratio of true positive classifications (sensitivity) to the fraction of false posi-
tives (1 specificity) as a function of a variable test threshold, chosen on the
ranked ordering of results produced by the classifier. Decision problems such
as this are always a tradeoff between being able to select the true positives
without selecting too many false positives. If we set our scoring threshold very
high, we can minimize or eliminate the number of false positives, but at the
expense of missing a number of true positives; conversely, as we lower the
scoring threshold, we select more true positives but more false positives will
be selected as well. The slopes of the ROC plot are a measure of the rate at
which one group is included at the expense of the other.

The ESI-Sequest dataset allows us to compare all four classification approaches:


boosting, random forests, PeptideProphet and the SVM. ROC plots showing
the results of classifying correct vs incorrect peptide assignments of the ESI-
Sequest dataset using these methods are shown in Figure 12.3. All methods
perform well on the data. As can be seen, the boosting and random forest
methods provide a slight performance improvement over PeptideProphet and
the SVM classification using the same six attributes. At a false positive rate
of roughly 0.05%, the boosting and random forest achieves a sensitivity of
99% while PeptideProphet and SVM provide a 97-98% sensitivity. We note
that, although a systematic difference of 1-2% can be seen in these results,
this corresponds to a relatively small number of total spectra. Also indicated
in Figure 12.3 are points corresponding to well-known thresholds from sev-
eral literature citations. Each point shows the sensitivity and specificity that
would be obtained on the test dataset by applying these published thresholds
to the Sequest attributes Charge, Xcorr, Delta Cn and NTT.

Panels 1B and 1C compare the performance of the boosting and random for-
est methods using different sets of input attributes, as shown in Table 12.2.
The panels contain the results of these algorithms using three combinations
of features: 1) attribute groups I and II: the six attributes used by the Pep-
tideProphet algorithm (SEQUEST XCorr, Delta Cn, SpRank, Delta Parent
Mass, Length and NTT); 2) attribute groups I, III and IV (all attributes ex-
cept NTT); and 3) attribute group I-IV (all fifteen variables shown in Table
12.2). Overall, it can be seen that both machine learning approaches provide
improvement over the scoring thresholds described in the literature. The best
performance was obtained by including all fifteen variables, indicating that
accommodation of additional information is beneficial. The random forest ap-
pears to be slightly more sensitive to the presence of the NTT variable than
boosting. Of note is the fact that effective classification is attained by the
boosting and random forest tools even in the explicit absence of the NTT
variable, as demonstrated by feature combination 2), despite the fact that the
ESI dataset was generated using the no enzyme feature of Sequest. No enzyme

© 2008 by Taylor & Francis Group, LLC


352 MASS SPECTROMETRY CLASSIFICATION

Figure 12.3 Performance of boosting and random forest methods on the ESI-
SEQUEST dataset. A. The top two plots are ROC plots of classification of the test set
by PeptideProphet, SVM boosting, and random forest methods using attribute groups
I and II. The plot on the right is a blowup of the upper left region of the figure on
the left. Also displayed are points corresponding to several sets of SEQUEST scoring
statistics used as linear threshold values in published studies. The following criteria
were applied for choosing correct hits, the +1, +2, +3 numbers indicating peptide
charge: a) +1: XCorr ≥ 1.5, N T T = 2; +2, +3: XCorr ≥ 2.0, N T T = 2; b)
∆Cn > 0.1, +1: XCorr ≥ 1.9, N T T = 2; +2: XCorr ≥ 3 OR 2.2 ≤ XCorr ≤ 3.0,
N T T ≥ 1; +3: XCorr ≥ 3.75, N T T ≥ 1; c) ∆Cn ≥ 0.08, +1: XCorr ≥ 1.8; +2:
XCorr ≥ 2.5; +3: XCorr ≥ 3.5; d) ∆Cn ≥ 0.1, +1: XCorr ≥ 1.9, N T T = 2;
+2: XCorr ≥ 2.2, N T T ≥ 1; +3: XCorr ≥ 3.75, N T T ≥ 1; e) ∆Cn ≥ 0.1, Sp
Rank ≤ 50, N T T ≥ 1, +1: not included; +2: XCorr ≥ 2.0; +3: XCorr ≥ 2.5. It
can be seen that all machine learning approaches provide a significant improvement
over linear scoring thresholds. B. The middle two plots show results of the random
forest method using various sets of attributes. The black line represents the result
of the random forest using six attributes defined in Table 12.2 as groups I and II:
the SEQUEST XCorr, Sp Rank, ∆Cn, Delta Parent Mass, Length and Number of
Tryptic Termini (NTT). The lighter gray line is the result using fourteen attributes,
groups I, III, and IV (no NTT). The darker gray line represents the result using all
attribute groups I-IV, all fifteen variables. C. The bottom two plots are ROC plots
of the boosting method using attribute groups I and II (black); I, III, and IV (lighter
gray); and I-IV (darker gray).

© 2008 by Taylor & Francis Group, LLC


RESULTS AND DISCUSSION 353

Figure 12.4 Relative importance of data attributes used for classification by boosting
and random forest methods. The top figure shows SEQUEST attribute importance
from boosting and random forest classification using attribute groups I and II. The
middle figure shows SEQUEST attribute importance using attribute groups I, III and
IV. The bottom figure shows SEQUEST attribute importance using all attributes in
random forest and boosting methods.

© 2008 by Taylor & Francis Group, LLC


354 MASS SPECTROMETRY CLASSIFICATION
specificity in the database search is often time-prohibitive in routine produc-
tion work; it is much more common to restrict searches to tryptic peptides (or
any other proteolytic enzyme used to digest the protein sample). Restricting
to trypsin restricts results to having an NTT=2, rendering the attribute non-
discriminatory. It must be noted, however, that in this analysis the C-term
Residue attribute is not completely independent of NTT in that it contains
residue information on one of the termini.
Figure 12.3 contains the results of these algorithms using three combinations
of features: 1) the five features used by the PeptideProphet algorithm-Sequest
XCorr, Delta Cn, SpRank, Delta parent mass and NTT; 2) all fourteen vari-
ables discussed above except NTT; and 3) all eleven variables discussed above
including NTT. Overall, it can be seen that all machine learning approaches
provide improvement over linear scoring thresholds. A modest performance
improvement is achieved by these approaches over PeptideProphet using the
same five variables. The best performance was obtained by including all four-
teen variables, indicating that accommodation of additional information is
beneficial. It is interesting that effective classification is attained by the boost-
ing and random forest tools even in the absence of the NTT variable, as demon-
strated by feature combination 2), despite the fact that the ESI dataset was
generated using the ‘no enzyme’ feature of Sequest. This type of search is often
time-prohibitive in routine production work; it is much more common to re-
strict searching to typtic peptides (or whatever other proteolytic enzyme used
to digest the protein sample). SVM classification performed well but showed
the most error of all methods; this performance could likely be improved by
more precise parameter tuning.

12.5.2 The impact of individual attributes on the final prediction accuracy

It is interesting to examine the relative usefulness of the various parameters


used by the machine learning algorithms to classify search results. One can
gain a feeling for the relative importance of each variable by randomly scram-
bling the values of any one variable amongst all search results and re-running
each search result (with the ‘noised up’ variable) through the classifier. The in-
crease in misclassification that results is a measure of the relative importance
of the randomized variable. This is valuable information in that the develop-
ment of new scoring measures is an active area of investigation in proteomics
research.
Figure 12.4 displays the relative importance each of the features for the SE-
QUEST approaches using the various variables. Results for classification of
the ESI-SEQUEST dataset incorporating the five features used by Peptide-
Prophet for the ESI-SEQUEST dataset are shown in A. All five features show a
contribution to the discrimination, with the most important contribution from
the Number of Tryptic Terminii (NTT) categorical variable. PeptideProphet

© 2008 by Taylor & Francis Group, LLC


RESULTS AND DISCUSSION 355
incorporates only the first four variables in the calculation of the discriminant
function, introducing NTT distributions using a separate joint probability cal-
culation. The coefficients for their discriminant score weight XCorr highest,
followed by Delta Cn, with much lower contributions due to Delta M+H and
Sp Rank. Our results indicate a larger contribution from Delta Cn, followed
by XCorr, with moderate contributions from Sp Rank and Delta M+H. These
results agree with those from Anderson et al., with the exception of Delta
M+H which showed very little contribution using their SVM approach. The
five features display a high importance when used in conjunction with the
other six variables, as indicated in Figure 12.4. Of these additional six, Sp
score shows a surprising contribution, as this scoring measure is rarely used
for discrimination in popular usage. Also significant is the Ions Ratio measure.
These results are in agreement with the Fisher Scores calculated by Anderson
et al. The number of arginine and proline measures, as well as parent charge,
appear to provide very little discrimative value.
The NTT variable provides by far the most important contribution, particu-
larly for the boosting approach, but is only obtainable in nonenzyme-specific
searches. The results above indicate, however, that the machine learning ap-
proaches perform quite well even in the absence of this variable. The relative
importances of the other measures in the absence of this variable are shown
in Figure 12.4. In this scenario, the Delta Cn measure provides the most im-
portance contribution.

12.5.3 Unsupervised learning and generalization/comparison to


PeptideProphet

In general, there are two primary classes of algorithms for addressing the
pattern recognition problem, the rule-based approach and the model-based
approach. Algorithms such as boosting and RFs are rule-based (see Vapnik
[40] for a general description). Rule-based approaches are characterized by
choosing one particular classification rule out of a set of rules that minimizes
the number of mistakes on the training data. Model-based approaches are
based on estimation of distributions for each of the classes being modeled,
and use these distributions to calculate the probability that a data point be-
longs to each class. PeptideProphet is an example of this latter type, modeling
correct identifications as a Gaussian distribution and incorrect identifications
as a Gamma distribution. If the distributions describing the different classes
in the problem accurately reflect the physical processes by which the data
are generated, the modeling approach works well even for a small amount of
training data. On the other hand, if the data diverge from the modeled dis-
tributions in a significant way, classification errors proportional to the degree
of divergence result. Rule-based approaches are a less risky option if there is
little knowledge of the distributions of classes of the data, and become increas-
ingly safe, approaching optimality, as data size increases. Keller et al. [23] and

© 2008 by Taylor & Francis Group, LLC


356 MASS SPECTROMETRY CLASSIFICATION
Nesvizhskii et al. [29] demonstrate that, for their data, the distributions de-
scribed in their approach model the data well. Whether these distributions are
appropriate for all types of instruments and MS search engines, and whether
they are optimal, are two research questions. Given the large amount of mass
spectrometry data available, rule-based approaches may generalize well to all
types of data.
We note that both PeptideProphet and the boosting/Random Forest meth-
ods are supervised approaches, relying on training data for their functionality.
PeptideProphet uses training data to learn coefficients in the calculation of
the discriminate score; it subsequently uses these scores to establish the basic
shape of the probability distributions modeling correct and incorrect search
hits as a function of parent peptide charge. For each unique dataset, the distri-
bution parameters are refined using an EM algorithm. Our approach provides
a framework for performing the supervised aspect of the problem in a more
general way, using established out-of-the-box functionality. This approach can
be coupled with an unsupervised component to provide the same functional-
ity, assuming appropriate training datasets are available that match the input
data. The degree to which an individual training dataset provides adequate pa-
rameterization for a particular test set is an open question. Certainly, training
sets will need to be search algorithm specific, but whether instrument-specific
datasets are necessary is an area of investigation.

12.6 Conclusions

A serious challenge faced by researchers in a proteomics lab is curating large


lists of protein identifications based on various confidence statistics generated
by the search engines. The common methodology for selecting true hits from
false positives is based on linear thresholding. These approaches can lead to
a large number of false positives (using a more promiscuous threshold), or a
large number of false negatives (using a relatively stringent threshold). Ma-
chine learning approaches such as boosting and random forest provide a more
accurate method for classification of the results of MS/MS search engines as
either correct or incorrect. Additionally, algorithmic development continues
to improve the ability of automated tools to better discriminate true search
results, and can complement the standard scoring measures generated by pop-
ular search engines. Flexible methods that allow for accommodation of these
new scoring measures are necessary to allow them to be easily incorporated
into production use. Tools such as PeptideProphet require significant work to
accommodate any new features, and are based on statistical models which may
not generalize well to all situations. Modern machine learning approaches can
perform equally well, if not better, out-of-the box with very little tuning. Im-
proved results could very likely be obtained by tuning these tools to particular
data sets, i.e., by making use of class prior probabilities to accommodate the
imbalanced sizes of the correct and incorrect datasets. These approaches can

© 2008 by Taylor & Francis Group, LLC


REFERENCES 357
additionally be used to generate measures of relative importance of scoring
variables, and may be useful in the development of new scoring approaches.
Peptide identification is not the ultimate goal in proteomics; accurately iden-
tifying the presence of proteins will allow the comparison between different
samples and is the end result of biological analysis.

12.7 Acknowledgments

We thank Dr. Philip Andrews and colleagues in National Resources for Pro-
teomics and Pathways for fruitful discussion on proteomics research and Ms.
Rhiannon Popa for editorial assistance.

References

[1] Aebersold, R. and Goodlett, D. R. (2001) Mass spectrometry in proteomics.


Chem. Rev. 101, 269-95.
[2] Anderson, D. C., Li, W., Payan, D. G. and Noble, W. S. (2003) A new algo-
rithm for the evaluation of shotgun peptide sequencing in proteomics: support
vector machine classification of peptide MS/MS spectra and SEQUEST scores.
J. Proteome Res. 2, 137-46.
[3] Anderson, L. and Seilhamer, J. (1997) A comparison of selected mRNA and
protein abundances in human liver. Electrophoresis 18, 533-7.
[4] Bafna, V. and Edwards, N. (2001) SCOPE: a probabilistic model for scoring
tandem mass spectra against a peptide database. Bioinformatics 17, Suppl. 1,
S13-21.
[5] Bao, L. and Cui, Y. (2005) Prediction of the phenotypic effects of non-
synonymous single nucleotide polymorphisms using structural and evolutionary
information. Bioinformatics 21, 2185-90.
[6] Breiman, L. (2001) Random Forests. Machine Learning 45, 5-32.
[7] Brown M. P., Grundy, W. N., Lin, D., Cristianini, N., Sugnet, C. W., Furey, T.
S., Ares, M. Jr. and Haussler, D. (2000) Knowledge-based analysis of microarray
gene expression data by using support vector machines. Proc. Natl. Acad. Sci.
U. S. A. 97, 262-7.
[8] Clauser, K. R., Baker, P. and Burlingame A. L. (1999) Role of accurate mass
measurement (+/- 10 ppm) in protein identification strategies employing MS or
MS/MS and database searching. Anal. Chem. 71, 2871-82.
[9] Craig, R. and Beavis, R. C. (2004), TANDEM: matching proteins with tandem
mass spectra. Bioinformatics 20, 1466-7.
[10] Dempster, A. P., Laird, N. M. and Rubin, D. B. (1977) Maximum likelihood
from incomplete data via EM algorithm. J Roy Stat Soc Series B /bf 39, 1-38.
[11] Eng, J., McCormack, A. and Yates, J. (1994) An approach to correlate tandem
mass spectral data of peptides with amino acid sequences in a protein database.
J. Am. Soc. Mass Spec. 5, 976-989.
[12] Eriksson, J. and Fenyo, D. (2004) Probity: a protein identification algorithm
with accurate assignment of the statistical significance of the results. J Proteome
Res. 3, 32-6.

© 2008 by Taylor & Francis Group, LLC


358 MASS SPECTROMETRY CLASSIFICATION
[13] Fenyo, D. and Beavis, R. C. (2003) A method for assessing the statistical signif-
icance of mass spectrometry-based protein identifications using general scoring
schemes. Anal Chem. 75, 768-74.
[14] Freund, Y. and Schapire, R. (1995) A decision theoretic generalization of on-
line learning and an application to boosting. Proceedings of the 2nd European
Conference on Computational Learning Theory. 23-37, Springer, New York.
[15] Furey, T. S., Cristianini, N., Duffy, N., Bednarski, D. W., Schummer, M. and
Haussler, D. (2000) Support vector machine classification and validation of cancer
tissue samples using microarray expression data. Bioinformatics 16, 906-914.
[16] Geer, L. Y. , Markey, S. P., Kowalak, J. A., Wagner, L., Xu, M., Maynard, D.
M., Yang, X., Shi, W. and Bryant, S. H. (2004) Open mass spectrometry search
algorithm. J Proteome Res. 3, 958-64.
[17] Gygi, S. P., Rochon. Y., Franza, B.R. and Aebersold, R. (1999) Correlation
between protein and mRNA abundance in yeast. Mol. Cell Biol. 19, 1720-30.
[18] Hastie, T., Tibshirani, R. and Friedman, J. H. (2001) Elements of Statistical
Learning. Springer, New York.
[19] Havilio, M., Haddad, Y. and Smilansky, Z. (2003) Intensity-based statistical
scorer for tandem mass spectrometry. Anal. Chem. 75, 435-44.
[20] Jaakkola, T., Diekhans, M. and Haussler, D. (1999) Using the Fisher kernel
method to detect remote protein homologies. Proc. Int. Conf. Intell. Syst. Mol.
Bio., 149-158. AAAI Press, Menlo Park, CA.
[21] Johnson, R. S., Davis, M. T., Taylor, J. A. and Patterson, S. D. (2005) Infor-
matics for protein identification by mass spectrometry. Methods. 35, 223-236.
[22] Kapp, E. A., Schutz, F., Reid, G. E., Eddes, J. S., Moritz, R. L, O’Hair, R.
A., Speed, T. P. and Simpson, R. J. (2003) Mining a tandem mass spectrometry
database to determine the trends and global factors influencing peptide fragmen-
tation. Anal. Chem. 75, 6251-64.
[23] Keller, A., Nesvizhskii, A. I., Kolker, E. and Aebersold, R. (2002) Empirical
statistical model to estimate the accuracy of peptide identifications made by
MS/MS and database search. Anal. Chem. 74, 5383-5392.
[24] Keller, A., Purvine, S., Nesvizhskii, A. I., Stolyar, S., Goodlett, D. R. and
Kolker, E. (2002) Experimental protein mixture for validating tandem mass spec-
tral analysis. OMICS. 6, 207- 12.
[25] Link, A. J., Eng, J., Schieltz, D. M., Carmack, E., Mize, G. J., Morris, D. R.,
Garvik, B. M. and Yates, J. R. III (1999) Direct analysis of protein complexes
using mass spectrometry. Nat. Biotechnol. 17, 676- 682.
[26] Lockhart, D. J., Dong, H., Byrne, M. C., Follettie, M. T., Gallo, M. V., Chee, M.
S., Mittmann, M., Wang, C., Kobayashi, M., Horton, H. et al. (1996) Expression
monitoring by hybridization to high-density oligonucleotide arrays. Nat. Biotech-
nol. 14 1675-1680.
[27] MacCoss, M. J., Wu, C. C. and Yates, J. R. 3rd. (2002) Probability-based
validation of protein identifications using a modified SEQUEST algorithm. Anal.
Chem. 74, 5593-9.
[28] Moore, R. E., Young, M. K. and Lee, T. D. (2002) Qscore: an algorithm for
evaluating SEQUEST database search results. J. Am. Soc. Mass Spectrom. 13,
378-86.
[29] Nesvizhskii, A. I., Keller, A., Kolker, E. and Aebersold, R. (2003) A statistical
model for identifying proteins by tandem mass spectrometry. Anal. Chem. 75,
4646-58.

© 2008 by Taylor & Francis Group, LLC


REFERENCES 359
[30] Pandey, A. and Mann, M. (2000) Proteomics to study genes and genomes.
Nature 405, 837-46.
[31] Peng, J., Elias, J. E., Thoreen, C. C., Licklider, L. J. and Gygi, S. P. (2003)
Evaluation of multidimensional chromatography coupled with tandem mass spec-
trometry (LC/LC-MS/MS) for large-scale protein analysis: the yeast proteome.
J. Proteome Res. 2, 43-50.
[32] Pennington, K., Cotter, D. and Dunn, M. J. (2005) The role of proteomics in
investigating psychiatric disorders. Br. J. Psychiatry 187, 4-6.
[33] Perkins, D., Pappin, D., Creasy, D. and Cottrell, J. (1999) Probability-based
protein identification by searching sequence databases using mass-spectromety
data. Electorphoresis 20, 3551-3567.
[34] Sadygov, R. G. and Yates, J. R. 3rd. (2003) A hypergeometric probability model
for protein identification and validation using tandem mass spectral data and
protein sequence databases. Anal. Chem. 75, 3792-8. 30
[35] Schena, M., Shalon, D., Davis, R. W. and Brown, P. O. (1995) Quantitative
monitoring of gene expression patterns with a complementary DNA microarray.
Science 270, 467-470.
[36] Steen, H. and Mann, M. (2004) The ABC’s (and XYZ’s) of peptide sequencing.
Nat. Rev. Mol. Cell Biol. 5, 699-711.
[37] Sun, W., Li, F., Wang, J., Zheng, D. and Gao, Y. (2004) AMASS: software
for automatically validating the quality of MS/MS spectrum from SEQUEST
results. Mol. Cell Proteomics. 3, 1194-9.
[38] Tabb, D. L., Huang, Y., Wysocki, V. H. and Yates, J. R. 3rd. (2004) Influence
of basic residue content on fragment ion peak intensities in low-energy collision-
induced dissociation spectra of peptides. Anal. Chem. 76, 1243-8.
[39] Ulintz, P. J., Zhu J., Qin, Z. S. and Andrews P. C. (2006) Improved classifica-
tion of mass spectrometry database search results using newer machine learning
approaches. Mol. Cell Proteomics 5, 497-509.
[40] Vapnik, V. N. (1999) The Nature of Statistical Learning Theory. 30, 138-167.
Springer, New York.
[41] Washburn, M. P., Wolters, D. and Yates, J. R. 3rd. (2001) Large-scale analysis
of the yeast proteome by multidimensional protein identification technology. Nat.
Biotechnol. 19, 242-7.
[42] Wysocki, V. H., Tsaprailis, G., Smith, L. L. and Breci, L.A. (2000) Mobile and
localized protons: a framework for understanding peptide dissociation. J. Mass
Spectrom. 35, 1399-406.
[43] Zhang, N., Aebersold, R. and Schwikowski, B. (2002) ProbID: a probabilistic
algorithm to identify peptides through sequence database searching using tandem
mass spectral data. Proteomics 2, 1406-12.

© 2008 by Taylor & Francis Group, LLC


Index

α-helix, 13 base pair, 8


β-sheet, 13 complementary, 8
β-strand, 13 Baum-Welch algorithm, 65
0/1 loss function, 105 Bayes factor, 92
1-D PAGE, 20 Bayes posterior risk, 91
2-D PAGE, 20 Bayes principle, 90
Bayes risk, 90, 105
Bayes rule, 90, 105
ACA, 281 Bayes theorem, 37
ACMI, 247, 264, 274 Bayesian network, 230
AdaBoost, 122, 346 dynamic, 230
adenine, 8 Bayesian paradigm, 2
alternative splicing, 11, 12 Bernoulli random variable, 46
amino acid, 7, 10, 12 Beta distribution, 49
residue, 13 bias, 26, 68
analysis of covariance, 69 bicluster, 149
analysis of variance, 69 biclustering, 148, 277
angiogenesis, 18 Binomial random variable, 46
ANN, 161, 245 biplot, 135
LMS error, 164 BLOSUM, 214
LVQ, 146 bones, 246
MLP, 163 boosting, 122, 346
perceptron, 163 bootstrap, 26
RBF, 165 breast cancer, 305
ANOVA, 1 Bregman divergence, 282
antibody, 14
as a probe, 21
apoptosis, 18 cancer, 18
ARP/WARP, 246, 247, 273 Carolas Linnaeus, 1
Artificial neural networks, 161 case-based reasoning, 244
attribute, 103 catalysis, 14
Attribute clustering algorithm, 281 Cauchy-Schwarz inequality, 50
automatic relevance determination, 306 cell
average linkage, 147 division, 9
proliferation, 9, 17
cells, 5
Backpropagation, 164 central limit theorem, 48
backpropagation, 245 channel, 14
backward algorithm, 63 Charles Darwin, 1
bacteria, 5 Chebyshev’s inequality, 56
bagging, 120 chi-square distribution, 49

© 2008 by Taylor & Francis Group, LLC


362 INDEX
ChIP-chip, 23 decision rule, 103
chromatin immunoprecipitation, 23 deletion, 212
chromosome, 9 differential equation, 228
class, 103 differentiation, 6
class conditional density, 104 dimensionality reduction, 129
classification, 3, 101 manifold learning, 140
bagging, 120 MDS, 136
boosting, 122 PCA, 129
ensemble methods, 120 Dirichlet prior, 218
logistic, 110 discriminant analysis, 108
nearest neighbor, 112 linear, 108
nonparametric, 112 quadratic, 108
parametric, 108 dispersion matrix, 50
support vector machine, 117 DNA, 7, 8
tree, 113 3-D structure, 8
CLUSTAL, 216 base, 8
cluster, 141 damaga, 19
clustering, 3, 129, 141, 277 polymerase, 9
hierarchical, 142, 146 probe, 21
k-means, 142 replication, 9
model based, 143 sequencing, 19
partitional, 141 sequential structure, 8
SOM, 144 strand, 8
co-immunoprecipitation, 23 double helix, 2
coding region, 10
codon, 10
coexpression, 226, 277 electron density map, 237
coherence index, 286 EM, 280, 345
colon cancer, 305 empirical Bayes, 94
competitive learning, 146 endoplasmic reticulum, 6, 7
complete linkage, 147 endosymbiosis, 6
complex, 13 ensemble methods, 120
conditional probability, 35 entropy, 56
conjugate distribution, 91 enzyme, 13
conjugate priors, 305 equilibrium, 16
coregulation, 226, 229, 277 Escherichia coli, 5, 9, 12, 14
correlation, 50, 69 eukaryote, 6
correlation matrix, 51 events, 29
covariance, 50 independent, 34
credible region, 92 mutually exclusive, 30
highest posterior density, 92 evolution, 1
cross entropy, 115 exon, 11
cross validation, 107, 304, 314 expectation-maximization, 27, 86, 144,
cytoplasm, 6 280, 345
cytosine, 8 expected value, 41
cytoskeleton, 14 exponential distribution, 48

DBF, 281, 296 false negative, 36


decision boundary, 106 false positive, 36

© 2008 by Taylor & Francis Group, LLC


INDEX 363
feature, 103 hidden Markov models, 62
FFFEAR, 246 hierarchical clustering
final precision, 90 average linkage, 147
Fisher information matrix, 57 complete linkage, 147
FLOC, 280, 296 single linkage, 147
forward algorithm, 63 histone, 9
functional data analysis, 229 HMM, 211
Fuzzy logic, 158 hormone, 7
Fuzzy sets, 157 hydrophilic, 7
basic operations, 160 hydrophobic, 7
membership, 157 hypergeometric distribution, 47
membership function, 159 hyperparameters, 94, 306
hyperpriors, 94
hypothesis testing, 26
GA, 167, 282
Gamma distribution, 48
immunostaining, 22
gap, 213 improper prior, 94
Gaussian distribution, 48 in situ hybridization, 22
gel electrophoresis, 20 information theory, 56
gene, 8 initial precision, 90
coding region, 10 insertion, 212
promoter, 10 intron, 11
regulatory network, 11 isoelectric point, 20
regulatory region, 10 Isomap, 140
transcription, 10 iTRAQ, 327
translation, 10, 11
gene expression
Jeffreys’ prior, 94, 305
analysis, 218
Jensen’s inequality, 96
clustering, 220
joint distribution, 49
differential, 222
dimensionality reduction, 221
dynamics, 228 k-means, 142
gene enrichment, 222 k-nearest neighbor, 244
gene finding, 211 kernel, 112
gene ontology, 222, 281, 293 kernel trick, 119
gene regulatory network, 11 knowledge-based networks, 162
inference, 223 Kullback-Leibler divergence, 57
generalized linear model, 69
Genetic algorithms, 167 labeled probe, 21
genetic network inference, 223 Laplacian Eigenmaps, 140
geometric distribution, 46 latent variables, 307
Gibbs sampler, 90, 96, 97, 312 learning vector quantization, 146
Gibbs sampling, 27 least squares, 68
Gini index, 115 leukemia, 305
Golgi apparatus, 6, 7 likelihood, 37
growth factor, 18 likelihood function, 26, 66
growth inhibition factor, 18 linear discriminant analysis, 108
guanine, 8 linear separability, 310

© 2008 by Taylor & Francis Group, LLC


364 INDEX
link function, 69 mitochondria, 6
lipid, 7 MLP, 163
LLE, 140 module, 218
local linear embedding, 140 MOEA, 283, 296
logistic classifier, 304 moment generating function, 42
logistic discrimination, 110, 124 moments, 42
logistic regression, 110 central, 42
logit, 305 multidimensional scaling, 136
loss function, 104, 307 multilayer perceptron, 162–163
LVQ, 146 multinomial distribution, 52
lysosome, 6 mutagen, 19

machine learning, 3 naive Bayes classifier, 112


Mahalanobis distance, 105 nearest neighbor classification, 112
MAID, 247 Needleman-Wunsch algorithm, 214
manifold learning, 140 negative binomial distribution, 47
MANOVA, 142 negative selection, 213
margin, 310 neural networks, 161
marginal distribution, 49 neuro-fuzzy computing, 174
marker, 22 neuro-fuzzy hybridization, 174
Markov chain Monte Carlo, 2, 27, 90, neurotransmitter, 14
305 neutral drift, 213
Markov chains, 58 nonparametric classification, 112
ergodic, 62 normal distribution, 48
regular, 60 bivariate, 53
steady state, 60 multivariate, 53
Markov network, 230 Northern blot, 20
Mascot, 342 NSGA, 286
mass spectrometry, 22, 124, 327, 339 nucleotide, 7
maximum likelihood, 67 nucleus, 6
maximum likelihood estimation, 26
MDS, 136
odds ratio
membrane protein, 7
posterior, 92
metabolic pathway, 15
prior, 92
metabolism, 15
oncogene, 19
metastatis, 18
organ, 6
method of moments, 66
organelle, 6
Metropolis-Hastings algorithm, 27, 90,
overfitting, 107
96, 312
microarray, 21, 124, 129, 277, 304
clustering, 220 p.d.f., 44
data analysis, 218 p.m.f., 41
differential expression, 222 PAGE, 20
dimensionality reduction, 221 PAM, 214
gene enrichment, 222 parameter estimation, 66
normalization, 219 parametric classification, 108
microtubule, 14 PBC, 296
Minkowski inequality, 56 PCA, 129, 139
misclassification error rate, 106 kernel, 140

© 2008 by Taylor & Francis Group, LLC


INDEX 365
local, 139 pseudopod, 14
PCM, 287
peptide, 13
QScore, 344
peptide mass fingerprint, 22
quadratic discriminant analysis, 108
PeptideProphet, 344
plasmid, 9
plastid, 6 Radial basis function network, 165
point mutation, 212 random forest, 346
Poisson distribution, 47 random variables, 40
polymer, 7 central moment, 42
position weight matrix, 217 continuous vs. discrete, 43
position-specific scoring matrix, 217 correlation, 50
positive selection, 213 covariance, 50
possibilistic c-means, 287 expected value or mean, 41
posterior distribution, 26 joint distribution, 49
posterior probability, 37 moments, 42
precision matrix, 51 skewness, 42
principal components analysis, 129 standard deviation, 42
prior distribution, 26 variance, 42
probabilistic model, 243 RBF, 165
probabilistic modeling, 25 recurrent state, 61
probability density curve, 44 regression, 53, 69
probability density function, 44 linear, 1
probability distribution, 40 regularization, 108
probability mass function, 41 regulatory module, 218
probability theory, 25 regulatory region, 10
probe, 21 relative entropy, 57
probit, 305 relevance vector machines, 305
prokaryote, 5 reproducing kernel Hilbert space, 304,
promoter, 10 306
proposal density, 95, 96 residue, 13
protein, 7, 10, 12 RESOLVE, 246, 252, 273
3-D structure, 13, 17 REVEAL, 227
channel, 14 reverse engineering, 224
complex, 13, 23 ribosome, 6, 7
folding, 13, 237 risk function, 104
identification, 124 RMA, 220
interaction, 13, 23 RNA, 7, 8
primary structure, 13 3-D structure, 10
quantification, 327 messenger, 10
quaternary structure, 13 polymerase, 10
secondary structure, 13, 238 probe, 21
sequential structure, 238 sequential structure, 10
strand, 10
structural, 14
transcript, 10
structure prediction, 211, 237
tertiary structure, 13, 238
transmembrane, 14 SAGE, 21
proteomics, 339 data analysis, 218
pseudocount, 218 SAM, 222

© 2008 by Taylor & Francis Group, LLC


366 INDEX
Sammon mapping, 138 t-test, 1
sampling, 95 testing data, 106
importance, 95 TEXTAL, 247, 258, 273
rejection, 95 thymine, 8
SEBI, 282 total risk, 104
self organizing map, 144 training data, 106
sequence alignment, 211 transcript, 10
global, 212 transcription, 10
local, 212 regulation, 11
multiple, 215 transcription factor, 11
pairwise, global, 213 transcription factor binding site, 11
pairwise, local, 213 identification, 216, 229
sequential evolutionary biclustering, 282 transient state, 61
Sequest, 342 transition matrix, 58
translation, 10, 11
serial analysis of gene expression, 21
regulation, 12
signal transduction, 7
trinomial distribution, 52
signaling, 14
tumor, 18
simulated annealing, 229, 283
tumor classification, 303
single linkage, 147
tumor suppressor gene, 19
single nucleotide polymorphism, 19
Single-layer perceptron, 163
singular value decomposition, 134 uniform density, 44
skeletonization, 246 universal set, 29
skewness, 42 unsupervised learning, 3, 129
Smith-Waterman algorithm, 215 uracil, 10
SNP, 19
soft computing, 3, 277 vacuole, 6
SOM, 144 variable selection, 123
Southern blot, 20 variance, 42
splice variant, 11 variance-covariance matrix, 50
splicing, 11, 12 vesicle, 8
regulation, 12
SSC, 280 Ward’s method, 147
standard deviation, 42 Western blot, 20
state space, 58
Statistical Subspace Clustering, 280
stem cell, 6 X-autofit, 246
stochastic processes, 58 x-ray crystallography, 239
stress function, 138
strong law of large numbers, 95 yeast cell cycle, 220, 291
substitution matrix, 213, 214 yeast two-hybrid, 23
sugar, 7
supervised learning, 3, 101
z-score, 48
support vector machine, 117, 347
kernel trick, 119
support vector machines, 304
Bayesian, 311
SVM, 117, 347

© 2008 by Taylor & Francis Group, LLC

You might also like